ATAD3C - ATPase family AAA domain containing 3C - 1p36.33

Snps	Gene	Statistic	Pvalue	Beta	Carriers	Beta_se	Linear	Tissue
chr1_1440430_C_G_b38	ATAD3C	-9.83	5.34e-21	-0.165596	49	0.016846	yes	ADPSBQ
chr1_1443457_T_C_b38	ATAD3C	-9.8	6.85e-21	-0.16395	78	0.016729	yes	ADPSBQ
chr1_1440834_C_G_b38	ATAD3C	-9.798	6.97e-21	-0.163301	75	0.016667	yes	ADPSBQ
chr1_1441187_A_G_b38	ATAD3C	-9.364	2.46e-19	-0.162463	54	0.01735	yes	ADPSBQ
chr1_1439454_A_G_b38	ATAD3C	-9.126	1.65e-18	-0.149885	70	0.016424	yes	ADPSBQ
chr1_1445187_T_G_b38	ATAD3C	-9.122	1.71e-18	-0.154168	72	0.016901	yes	ADPSBQ
chr1_1445240_A_G_b38	ATAD3C	-8.915	8.68e-18	-0.150997	77	0.016937	yes	ADPSBQ
chr1_1442793_G_A_b38	ATAD3C	-8.612	8.98e-17	-0.169568	20	0.019689	yes	ADPSBQ
chr1_1436388_CA_C_b38	ATAD3C	-8.332	7.39e-16	-0.14511	54	0.017415	yes	ADPSBQ
chr1_1448915_G_A_b38	ATAD3C	-8.217	1.73e-15	-0.14393	53	0.017516	yes	ADPSBQ
chr1_1432355_G_A_b38	ATAD3C	-7.911	1.59e-14	-0.150194	26	0.018984	yes	ADPSBQ
chr1_1434687_C_G_b38	ATAD3C	-7.903	1.69e-14	-0.160257	18	0.020277	yes	ADPSBQ
chr1_1439805_G_C_b38	ATAD3C	-7.861	2.28e-14	-0.150868	27	0.019192	yes	ADPSBQ
chr1_1435945_C_CCGGGCGGGGGCG_b38	ATAD3C	-7.787	3.87e-14	-0.156312	20	0.020074	yes	ADPSBQ
chr1_1431656_G_A_b38	ATAD3C	-7.728	5.87e-14	-0.160713	16	0.020797	yes	ADPSBQ
chr1_1438102_G_C_b38	ATAD3C	-7.704	6.91e-14	-0.143077	29	0.018571	yes	ADPSBQ
chr1_1436079_A_G_b38	ATAD3C	-7.622	1.23e-13	-0.12751	84	0.01673	yes	ADPSBQ
chr1_1428969_T_C_b38	ATAD3C	-7.245	1.61e-12	-0.125191	79	0.01728	yes	ADPSBQ
chr1_1433374_T_C_b38	ATAD3C	-7.211	2.02e-12	-0.120302	87	0.016684	yes	ADPSBQ
chr1_1426253_G_A_b38	ATAD3C	-7.14	3.23e-12	-0.146737	16	0.020551	yes	ADPSBQ
chr1_1454770_T_C_b38	ATAD3C	-7.129	3.48e-12	-0.131103	70	0.01839	yes	ADPSBQ
chr1_1455617_T_G_b38	ATAD3C	-7.097	4.29e-12	-0.130004	69	0.018318	yes	ADPSBQ
chr1_1431813_G_T_b38	ATAD3C	-7.074	4.98e-12	-0.138251	23	0.019543	yes	ADPSBQ
chr1_1449831_A_G_b38	ATAD3C	-7.074	4.99e-12	-0.133814	68	0.018916	yes	ADPSBQ
chr1_1431537_G_C_b38	ATAD3C	-7.065	5.29e-12	-0.122172	79	0.017292	yes	ADPSBQ
chr1_1431450_A_G_b38	ATAD3C	-7.001	8.06e-12	-0.121084	79	0.017296	yes	ADPSBQ
chr1_1430190_A_C_b38	ATAD3C	-6.985	8.91e-12	-0.121066	79	0.017331	yes	ADPSBQ
chr1_1454315_C_T_b38	ATAD3C	-6.954	1.1e-11	-0.12689	64	0.018248	yes	ADPSBQ
chr1_1452511_A_G_b38	ATAD3C	-6.926	1.31e-11	-0.127202	68	0.018365	yes	ADPSBQ
chr1_1452888_C_A_b38	ATAD3C	-6.926	1.31e-11	-0.127202	68	0.018365	yes	ADPSBQ
chr1_1452909_A_C_b38	ATAD3C	-6.926	1.31e-11	-0.127202	68	0.018365	yes	ADPSBQ
chr1_1449009_A_T_b38	ATAD3C	-6.894	1.61e-11	-0.134443	48	0.019503	yes	ADPSBQ
chr1_1454092_A_G_b38	ATAD3C	-6.89	1.65e-11	-0.126456	68	0.018353	yes	ADPSBQ
chr1_1453703_A_G_b38	ATAD3C	-6.825	2.51e-11	-0.125721	68	0.018422	yes	ADPSBQ
chr1_1451787_A_C_b38	ATAD3C	-6.775	3.44e-11	-0.119674	57	0.017664	yes	ADPSBQ
chr1_1430908_A_G_b38	ATAD3C	-6.721	4.85e-11	-0.116474	79	0.017331	yes	ADPSBQ
chr1_1426810_C_G_b38	ATAD3C	-6.686	6.03e-11	-0.115305	80	0.017245	yes	ADPSBQ
chr1_1426261_C_T_b38	ATAD3C	-6.686	6.03e-11	-0.115771	79	0.017315	yes	ADPSBQ
chr1_1452825_AAAG_A_b38	ATAD3C	-6.68	6.26e-11	-0.121829	34	0.018237	yes	ADPSBQ
chr1_1447108_A_ATT_b38	ATAD3C	-6.617	9.31e-11	-0.120741	33	0.018248	yes	ADPSBQ
chr1_1431014_G_A_b38	ATAD3C	-6.547	1.44e-10	-0.113909	42	0.0174	yes	ADPSBQ
chr1_1456079_T_C_b38	ATAD3C	-6.519	1.7e-10	-0.119679	33	0.018359	yes	ADPSBQ
chr1_1454848_T_C_b38	ATAD3C	-6.505	1.86e-10	-0.118344	34	0.018194	yes	ADPSBQ
chr1_1453552_G_A_b38	ATAD3C	-6.483	2.12e-10	-0.118566	34	0.018288	yes	ADPSBQ
chr1_1455134_T_G_b38	ATAD3C	-6.483	2.12e-10	-0.118566	34	0.018288	yes	ADPSBQ
chr1_1455337_A_G_b38	ATAD3C	-6.483	2.12e-10	-0.118566	34	0.018288	yes	ADPSBQ
chr1_1455495_C_T_b38	ATAD3C	-6.483	2.12e-10	-0.118566	34	0.018288	yes	ADPSBQ
chr1_1457033_A_C_b38	ATAD3C	-6.447	2.65e-10	-0.116897	36	0.018132	yes	ADPSBQ
chr1_1437993_G_A_b38	ATAD3C	-6.383	3.91e-10	-0.115924	32	0.018162	yes	ADPSBQ
chr1_1456154_G_A_b38	ATAD3C	-6.333	5.29e-10	-0.116597	33	0.018411	yes	ADPSBQ
chr1_1456051_C_T_b38	ATAD3C	-6.322	5.63e-10	-0.116053	33	0.018356	yes	ADPSBQ
chr1_1453961_C_T_b38	ATAD3C	-6.301	6.41e-10	-0.138433	9	0.021971	yes	ADPSBQ
chr1_1455924_T_C_b38	ATAD3C	-6.247	8.81e-10	-0.115037	33	0.018414	yes	ADPSBQ
chr1_1452540_G_A_b38	ATAD3C	-6.16	1.48e-09	-0.11189	31	0.018164	yes	ADPSBQ
chr1_1471992_T_C_b38	ATAD3C	-6.128	1.78e-09	-0.110031	81	0.017955	yes	ADPSBQ
chr1_1450636_A_G_b38	ATAD3C	-6.089	2.23e-09	-0.127907	12	0.021005	yes	ADPSBQ
chr1_1431026_CCACCCCCT_C_b38	ATAD3C	-6.086	2.28e-09	-0.113642	38	0.018674	yes	ADPSBQ
chr1_1453870_A_C_b38	ATAD3C	-6.082	2.32e-09	-0.128502	11	0.021127	yes	ADPSBQ
chr1_1344048_G_A_b38	ATAD3C	-6.005	3.64e-09	-0.131025	14	0.021819	yes	ADPSBQ
chr1_1452797_CAA_C_b38	ATAD3C	-6.005	3.64e-09	-0.115701	28	0.019268	yes	ADPSBQ
chr1_1452384_G_A_b38	ATAD3C	-5.992	3.93e-09	-0.122505	14	0.020446	yes	ADPSBQ
chr1_1400410_A_G_b38	ATAD3C	-5.972	4.4e-09	-0.111119	60	0.018607	yes	ADPSBQ
chr1_1451968_C_T_b38	ATAD3C	-5.943	5.19e-09	-0.109811	32	0.018478	yes	ADPSBQ
chr1_1457071_C_T_b38	ATAD3C	-5.923	5.82e-09	-0.107221	41	0.018103	yes	ADPSBQ
chr1_1376162_G_C_b38	ATAD3C	5.918	5.97e-09	0.110299	61	0.018637	yes	ADPSBQ
chr1_1377431_C_T_b38	ATAD3C	5.918	5.97e-09	0.110299	61	0.018637	yes	ADPSBQ
chr1_1452346_A_G_b38	ATAD3C	-5.912	6.19e-09	-0.118598	16	0.02006	yes	ADPSBQ
chr1_1456217_T_C_b38	ATAD3C	-5.848	8.88e-09	-0.112153	59	0.019177	yes	ADPSBQ
chr1_1456182_G_A_b38	ATAD3C	-5.846	9e-09	-0.1056	37	0.018064	yes	ADPSBQ
chr1_1366561_AGT_A_b38	ATAD3C	5.825	1.01e-08	0.108929	78	0.018701	yes	ADPSBQ
chr1_1329973_GCGTGTGCCATGCA_G_b38	ATAD3C	-5.818	1.05e-08	-0.127949	14	0.021993	yes	ADPSBQ
chr1_1384749_C_G_b38	ATAD3C	5.8	1.17e-08	0.108199	61	0.018656	yes	ADPSBQ
chr1_1387763_CCT_C_b38	ATAD3C	5.8	1.17e-08	0.108199	61	0.018656	yes	ADPSBQ
chr1_1388944_G_A_b38	ATAD3C	5.8	1.17e-08	0.108199	61	0.018656	yes	ADPSBQ
chr1_1402457_A_G_b38	ATAD3C	-5.792	1.22e-08	-0.11032	76	0.019046	yes	ADPSBQ
chr1_1380867_A_G_b38	ATAD3C	-5.781	1.29e-08	-0.130853	14	0.022635	yes	ADPSBQ
chr1_1341550_GCA_G_b38	ATAD3C	-5.764	1.43e-08	-0.124552	16	0.02161	yes	ADPSBQ
chr1_1312114_T_C_b38	ATAD3C	5.762	1.44e-08	0.105063	79	0.018233	yes	ADPSBQ
chr1_1378204_G_C_b38	ATAD3C	5.758	1.47e-08	0.105804	61	0.018375	yes	ADPSBQ
chr1_1453643_A_ATT_b38	ATAD3C	-5.721	1.8e-08	-0.106597	41	0.018631	yes	ADPSBQ
chr1_1411323_A_C_b38	ATAD3C	-5.718	1.83e-08	-0.108968	77	0.019056	yes	ADPSBQ
chr1_1372909_G_A_b38	ATAD3C	-5.703	1.99e-08	-0.126538	14	0.022187	yes	ADPSBQ
chr1_1330125_G_A_b38	ATAD3C	5.682	2.24e-08	0.106835	79	0.018801	yes	ADPSBQ
chr1_1395346_A_G_b38	ATAD3C	-5.677	2.31e-08	-0.107795	75	0.01899	yes	ADPSBQ
chr1_1497605_G_C_b38	ATAD3C	-5.671	2.37e-08	-0.092452	72	0.016301	yes	ADPSBQ
chr1_1387698_A_G_b38	ATAD3C	5.665	2.47e-08	0.107892	76	0.019047	yes	ADPSBQ
chr1_1389827_C_T_b38	ATAD3C	5.665	2.47e-08	0.107892	76	0.019047	yes	ADPSBQ
chr1_1366427_AGTGTGATTGAATGAGT_A_b38	ATAD3C	5.665	2.47e-08	0.104154	60	0.018387	yes	ADPSBQ
chr1_1541864_T_C_b38	ATAD3C	-5.65	2.67e-08	-0.092839	93	0.016431	yes	ADPSBQ
chr1_1456829_G_C_b38	ATAD3C	-5.648	2.7e-08	-0.113994	43	0.020182	yes	ADPSBQ
chr1_1308516_C_T_b38	ATAD3C	5.641	2.81e-08	0.101336	84	0.017966	yes	ADPSBQ
chr1_1370430_T_C_b38	ATAD3C	-5.622	3.11e-08	-0.119156	16	0.021193	yes	ADPSBQ
chr1_1370584_G_C_b38	ATAD3C	-5.622	3.11e-08	-0.119156	16	0.021193	yes	ADPSBQ
chr1_1394423_A_G_b38	ATAD3C	-5.611	3.3e-08	-0.106871	76	0.019045	yes	ADPSBQ
chr1_1407565_C_A_b38	ATAD3C	-5.599	3.52e-08	-0.129875	14	0.023195	yes	ADPSBQ
chr1_1370532_C_T_b38	ATAD3C	-5.585	3.8e-08	-0.116838	17	0.020919	yes	ADPSBQ
chr1_1316929_A_T_b38	ATAD3C	-5.574	4.04e-08	-0.117468	17	0.021075	yes	ADPSBQ
chr1_1364253_C_G_b38	ATAD3C	-5.573	4.05e-08	-0.119476	15	0.021437	yes	ADPSBQ
chr1_1366511_GGTGA_G_b38	ATAD3C	-5.572	4.09e-08	-0.116789	15	0.020961	yes	ADPSBQ
chr1_1451028_T_A_b38	ATAD3C	-5.562	4.31e-08	-0.114581	14	0.0206	yes	ADPSBQ
chr1_1364566_T_C_b38	ATAD3C	-5.558	4.41e-08	-0.117286	15	0.021103	yes	ADPSBQ
chr1_1363688_C_T_b38	ATAD3C	-5.556	4.45e-08	-0.116894	15	0.021039	yes	ADPSBQ
chr1_1364099_CCA_C_b38	ATAD3C	-5.556	4.45e-08	-0.116894	15	0.021039	yes	ADPSBQ
chr1_1364102_TGTTG_T_b38	ATAD3C	-5.556	4.45e-08	-0.116894	15	0.021039	yes	ADPSBQ
chr1_1368763_G_A_b38	ATAD3C	-5.556	4.45e-08	-0.116894	15	0.021039	yes	ADPSBQ
chr1_1358384_G_C_b38	ATAD3C	5.543	4.79e-08	0.104247	78	0.018808	yes	ADPSBQ
chr1_1542773_T_C_b38	ATAD3C	-5.542	4.8e-08	-0.090063	91	0.01625	yes	ADPSBQ
chr1_1373007_G_A_b38	ATAD3C	-5.542	4.81e-08	-0.125423	12	0.022633	yes	ADPSBQ
chr1_1309988_G_A_b38	ATAD3C	5.541	4.82e-08	0.101465	84	0.01831	yes	ADPSBQ
chr1_1313807_G_A_b38	ATAD3C	5.541	4.82e-08	0.101465	84	0.01831	yes	ADPSBQ
chr1_1558726_C_CA_b38	ATAD3C	-5.533	5.04e-08	-0.090232	94	0.016308	yes	ADPSBQ
chr1_1561821_A_C_b38	ATAD3C	-5.533	5.04e-08	-0.090232	94	0.016308	yes	ADPSBQ
chr1_1369009_T_C_b38	ATAD3C	-5.533	5.05e-08	-0.117474	15	0.021233	yes	ADPSBQ
chr1_1363456_CAG_C_b38	ATAD3C	5.53	5.11e-08	0.101143	33	0.018289	yes	ADPSBQ
chr1_1368991_C_T_b38	ATAD3C	-5.53	5.12e-08	-0.116986	15	0.021155	yes	ADPSBQ
chr1_1456891_T_C_b38	ATAD3C	-5.526	5.22e-08	-0.091877	54	0.016625	yes	ADPSBQ
chr1_1367292_A_AGT_b38	ATAD3C	5.525	5.27e-08	0.109496	21	0.019819	yes	ADPSBQ
chr1_1369012_C_CG_b38	ATAD3C	-5.517	5.5e-08	-0.117083	15	0.021224	yes	ADPSBQ
chr1_1369821_C_T_b38	ATAD3C	-5.516	5.53e-08	-0.116049	15	0.02104	yes	ADPSBQ
chr1_1363898_C_T_b38	ATAD3C	5.516	5.53e-08	0.109753	21	0.019899	yes	ADPSBQ
chr1_1366529_TTAG_T_b38	ATAD3C	5.516	5.53e-08	0.109753	21	0.019899	yes	ADPSBQ
chr1_1303800_G_A_b38	ATAD3C	-5.511	5.66e-08	-0.124934	11	0.022668	yes	ADPSBQ
chr1_1364357_A_C_b38	ATAD3C	-5.505	5.85e-08	-0.115776	15	0.02103	yes	ADPSBQ
chr1_1368514_C_G_b38	ATAD3C	-5.505	5.85e-08	-0.115776	15	0.02103	yes	ADPSBQ
chr1_1369282_G_A_b38	ATAD3C	-5.496	6.15e-08	-0.115554	15	0.021026	yes	ADPSBQ
chr1_1369320_GT_G_b38	ATAD3C	-5.496	6.15e-08	-0.115554	15	0.021026	yes	ADPSBQ
chr1_1369476_CTT_C_b38	ATAD3C	-5.496	6.15e-08	-0.115554	15	0.021026	yes	ADPSBQ
chr1_1369556_C_G_b38	ATAD3C	-5.496	6.15e-08	-0.115554	15	0.021026	yes	ADPSBQ
chr1_1369627_T_C_b38	ATAD3C	-5.496	6.15e-08	-0.115554	15	0.021026	yes	ADPSBQ
chr1_1369686_T_C_b38	ATAD3C	-5.496	6.15e-08	-0.115554	15	0.021026	yes	ADPSBQ
chr1_1369716_G_C_b38	ATAD3C	-5.496	6.15e-08	-0.115554	15	0.021026	yes	ADPSBQ
chr1_1369741_C_T_b38	ATAD3C	-5.496	6.15e-08	-0.115554	15	0.021026	yes	ADPSBQ
chr1_1370181_C_T_b38	ATAD3C	-5.496	6.15e-08	-0.115554	15	0.021026	yes	ADPSBQ
chr1_1370317_G_C_b38	ATAD3C	-5.496	6.15e-08	-0.115554	15	0.021026	yes	ADPSBQ
chr1_1370320_A_G_b38	ATAD3C	-5.496	6.15e-08	-0.115554	15	0.021026	yes	ADPSBQ
chr1_1542793_C_G_b38	ATAD3C	-5.483	6.59e-08	-0.089029	90	0.016238	yes	ADPSBQ
chr1_1542800_T_C_b38	ATAD3C	-5.483	6.59e-08	-0.089029	90	0.016238	yes	ADPSBQ
chr1_1370113_A_G_b38	ATAD3C	5.466	7.21e-08	0.09502	63	0.017383	yes	ADPSBQ
chr1_1373006_G_A_b38	ATAD3C	-5.465	7.25e-08	-0.124978	10	0.022869	yes	ADPSBQ
chr1_1366292_G_T_b38	ATAD3C	-5.461	7.4e-08	-0.115436	15	0.021137	yes	ADPSBQ
chr1_1363880_A_G_b38	ATAD3C	-5.455	7.65e-08	-0.114432	15	0.020978	yes	ADPSBQ
chr1_1364282_T_G_b38	ATAD3C	-5.455	7.65e-08	-0.114848	15	0.021054	yes	ADPSBQ
chr1_1364694_T_C_b38	ATAD3C	-5.455	7.65e-08	-0.114848	15	0.021054	yes	ADPSBQ
chr1_1364721_C_T_b38	ATAD3C	-5.455	7.65e-08	-0.114848	15	0.021054	yes	ADPSBQ
chr1_1365160_A_G_b38	ATAD3C	-5.455	7.65e-08	-0.114848	15	0.021054	yes	ADPSBQ
chr1_1365198_C_T_b38	ATAD3C	-5.455	7.65e-08	-0.114848	15	0.021054	yes	ADPSBQ
chr1_1366008_A_G_b38	ATAD3C	-5.455	7.65e-08	-0.114848	15	0.021054	yes	ADPSBQ
chr1_1366062_T_C_b38	ATAD3C	-5.455	7.65e-08	-0.114848	15	0.021054	yes	ADPSBQ
chr1_1366145_TGTGAA_T_b38	ATAD3C	-5.455	7.65e-08	-0.114848	15	0.021054	yes	ADPSBQ
chr1_1366321_TGTGTGTAAATGG_T_b38	ATAD3C	-5.455	7.65e-08	-0.114848	15	0.021054	yes	ADPSBQ
chr1_1366453_G_T_b38	ATAD3C	-5.455	7.65e-08	-0.114848	15	0.021054	yes	ADPSBQ
chr1_1366726_T_G_b38	ATAD3C	-5.455	7.65e-08	-0.114848	15	0.021054	yes	ADPSBQ
chr1_1367258_T_A_b38	ATAD3C	-5.455	7.65e-08	-0.114848	15	0.021054	yes	ADPSBQ
chr1_1367297_GAA_G_b38	ATAD3C	-5.455	7.65e-08	-0.114848	15	0.021054	yes	ADPSBQ
chr1_1367329_A_AGT_b38	ATAD3C	-5.455	7.65e-08	-0.114848	15	0.021054	yes	ADPSBQ
chr1_1367373_T_TGTG_b38	ATAD3C	-5.455	7.65e-08	-0.114848	15	0.021054	yes	ADPSBQ
chr1_1367593_G_A_b38	ATAD3C	-5.455	7.65e-08	-0.114848	15	0.021054	yes	ADPSBQ
chr1_1367602_GT_G_b38	ATAD3C	-5.455	7.65e-08	-0.114848	15	0.021054	yes	ADPSBQ
chr1_1367605_GAGTGAGTGTA_G_b38	ATAD3C	-5.455	7.65e-08	-0.114848	15	0.021054	yes	ADPSBQ
chr1_1367670_GGTGA_G_b38	ATAD3C	-5.455	7.65e-08	-0.114848	15	0.021054	yes	ADPSBQ
chr1_1367722_TTTTA_T_b38	ATAD3C	-5.455	7.65e-08	-0.114848	15	0.021054	yes	ADPSBQ
chr1_1367874_A_T_b38	ATAD3C	-5.455	7.65e-08	-0.114848	15	0.021054	yes	ADPSBQ
chr1_1367919_C_T_b38	ATAD3C	-5.455	7.65e-08	-0.114848	15	0.021054	yes	ADPSBQ
chr1_1367951_C_T_b38	ATAD3C	-5.455	7.65e-08	-0.114848	15	0.021054	yes	ADPSBQ
chr1_1367965_A_G_b38	ATAD3C	-5.455	7.65e-08	-0.114848	15	0.021054	yes	ADPSBQ
chr1_1367970_T_G_b38	ATAD3C	-5.455	7.65e-08	-0.114848	15	0.021054	yes	ADPSBQ
chr1_1367994_C_A_b38	ATAD3C	-5.455	7.65e-08	-0.114848	15	0.021054	yes	ADPSBQ
chr1_1368297_C_T_b38	ATAD3C	-5.455	7.65e-08	-0.114848	15	0.021054	yes	ADPSBQ
chr1_1367300_T_TGA_b38	ATAD3C	-5.452	7.77e-08	-0.115855	14	0.02125	yes	ADPSBQ
chr1_1367462_T_C_b38	ATAD3C	-5.452	7.79e-08	-0.115163	15	0.021125	yes	ADPSBQ
chr1_1543953_A_G_b38	ATAD3C	-5.449	7.88e-08	-0.088643	91	0.016267	yes	ADPSBQ
chr1_1366187_A_AGT_b38	ATAD3C	-5.445	8.07e-08	-0.114659	15	0.021058	yes	ADPSBQ
chr1_1382893_G_A_b38	ATAD3C	-5.44	8.28e-08	-0.121628	15	0.022358	yes	ADPSBQ
chr1_1543500_T_G_b38	ATAD3C	-5.439	8.32e-08	-0.08823	89	0.016221	yes	ADPSBQ
chr1_1375642_C_T_b38	ATAD3C	-5.433	8.58e-08	-0.118686	16	0.021844	yes	ADPSBQ
chr1_1367280_T_A_b38	ATAD3C	-5.429	8.78e-08	-0.114572	15	0.021103	yes	ADPSBQ
chr1_1384546_C_T_b38	ATAD3C	-5.426	8.92e-08	-0.12505	14	0.023046	yes	ADPSBQ
chr1_1369407_G_A_b38	ATAD3C	-5.423	9.06e-08	-0.113985	14	0.021018	yes	ADPSBQ
chr1_1367388_T_TTGG_b38	ATAD3C	-5.419	9.26e-08	-0.114474	15	0.021125	yes	ADPSBQ
chr1_1550064_GC_G_b38	ATAD3C	-5.414	9.52e-08	-0.088007	90	0.016256	yes	ADPSBQ
chr1_1550068_C_A_b38	ATAD3C	-5.414	9.52e-08	-0.088007	90	0.016256	yes	ADPSBQ
chr1_1379093_TG_T_b38	ATAD3C	-5.411	9.63e-08	-0.126892	10	0.023449	yes	ADPSBQ
chr1_1367268_TGA_T_b38	ATAD3C	-5.405	9.96e-08	-0.113662	15	0.021029	yes	ADPSBQ
chr1_1303112_G_A_b38	ATAD3C	-5.398	1.04e-07	-0.118969	11	0.022041	yes	ADPSBQ
chr1_1363986_C_T_b38	ATAD3C	5.396	1.05e-07	0.107284	21	0.019882	yes	ADPSBQ
chr1_1367954_A_C_b38	ATAD3C	-5.372	1.18e-07	-0.169532	3	0.031556	yes	ADPSBQ
chr1_1372220_C_T_b38	ATAD3C	-5.372	1.18e-07	-0.169532	3	0.031556	yes	ADPSBQ
chr1_1551557_A_AG_b38	ATAD3C	-5.367	1.22e-07	-0.087803	92	0.01636	yes	ADPSBQ
chr1_1551559_A_T_b38	ATAD3C	-5.367	1.22e-07	-0.087803	92	0.01636	yes	ADPSBQ
chr1_1379083_AT_A_b38	ATAD3C	5.361	1.26e-07	0.096113	38	0.017928	yes	ADPSBQ
chr1_1325753_G_T_b38	ATAD3C	-5.352	1.32e-07	-0.125159	9	0.023385	yes	ADPSBQ
chr1_1367511_ATGAG_A_b38	ATAD3C	-5.324	1.52e-07	-0.11353	14	0.021323	yes	ADPSBQ
chr1_1374505_A_G_b38	ATAD3C	-5.323	1.53e-07	-0.116506	16	0.021888	yes	ADPSBQ
chr1_1365566_G_A_b38	ATAD3C	5.32	1.56e-07	0.105459	21	0.019824	yes	ADPSBQ
chr1_1479719_T_C_b38	ATAD3C	-5.307	1.67e-07	-0.096518	87	0.018187	yes	ADPSBQ
chr1_1545795_C_A_b38	ATAD3C	-5.303	1.7e-07	-0.085443	80	0.016112	yes	ADPSBQ
chr1_1574445_A_G_b38	ATAD3C	-5.267	2.05e-07	-0.08538	99	0.01621	yes	ADPSBQ
chr1_1403593_A_G_b38	ATAD3C	-5.251	2.23e-07	-0.118489	15	0.022567	yes	ADPSBQ
chr1_1398218_C_A_b38	ATAD3C	-5.197	2.94e-07	-0.117422	15	0.022595	yes	ADPSBQ
chr1_1400756_GGA_G_b38	ATAD3C	-5.197	2.94e-07	-0.117422	15	0.022595	yes	ADPSBQ
chr1_1401954_G_T_b38	ATAD3C	-5.197	2.94e-07	-0.117422	15	0.022595	yes	ADPSBQ
chr1_1379091_T_G_b38	ATAD3C	5.192	3.01e-07	0.108534	20	0.020904	yes	ADPSBQ
chr1_1304555_A_C_b38	ATAD3C	-5.146	3.81e-07	-0.114556	11	0.022263	yes	ADPSBQ
chr1_1573654_T_C_b38	ATAD3C	-5.128	4.17e-07	-0.082795	99	0.016146	yes	ADPSBQ
chr1_1366681_T_TGA_b38	ATAD3C	-5.127	4.19e-07	-0.110323	15	0.021519	yes	ADPSBQ
chr1_1575724_G_C_b38	ATAD3C	-5.123	4.28e-07	-0.081988	97	0.016005	yes	ADPSBQ
chr1_1560765_T_C_b38	ATAD3C	-5.098	4.84e-07	-0.083964	81	0.01647	yes	ADPSBQ
chr1_1562261_TTTTC_T_b38	ATAD3C	-5.098	4.84e-07	-0.083964	81	0.01647	yes	ADPSBQ
chr1_1361679_G_A_b38	ATAD3C	5.087	5.11e-07	0.100721	42	0.019798	yes	ADPSBQ
chr1_1369803_C_CT_b38	ATAD3C	-5.082	5.25e-07	-0.100809	14	0.019837	yes	ADPSBQ
chr1_1383743_T_C_b38	ATAD3C	-5.078	5.34e-07	-0.114082	15	0.022464	yes	ADPSBQ
chr1_1366776_G_GAATT_b38	ATAD3C	-5.016	7.29e-07	-0.10861	15	0.021652	yes	ADPSBQ
chr1_1361685_C_T_b38	ATAD3C	-5.001	7.88e-07	-0.101574	33	0.020313	yes	ADPSBQ
chr1_1365036_T_TAA_b38	ATAD3C	-4.995	8.08e-07	-0.112401	9	0.022502	yes	ADPSBQ
chr1_1370553_CAAA_C_b38	ATAD3C	-4.991	8.24e-07	-0.112518	10	0.022542	yes	ADPSBQ
chr1_1565105_CAAGGCAGGCGGATCATG_C_b38	ATAD3C	-4.99	8.31e-07	-0.079508	105	0.015934	yes	ADPSBQ
chr1_1557495_CAT_C_b38	ATAD3C	-4.979	8.75e-07	-0.081912	94	0.016451	yes	ADPSBQ
chr1_1577491_A_AC_b38	ATAD3C	-4.977	8.87e-07	-0.080562	101	0.016188	yes	ADPSBQ
chr1_1575421_C_T_b38	ATAD3C	-4.974	8.97e-07	-0.078974	99	0.015877	yes	ADPSBQ
chr1_1566086_G_A_b38	ATAD3C	-4.967	9.29e-07	-0.07915	105	0.015935	yes	ADPSBQ
chr1_1547630_G_A_b38	ATAD3C	-4.948	1.02e-06	-0.075961	94	0.015351	yes	ADPSBQ
chr1_1538787_A_G_b38	ATAD3C	-4.921	1.16e-06	-0.078478	103	0.015946	yes	ADPSBQ
chr1_1569661_T_C_b38	ATAD3C	-4.92	1.17e-06	-0.076501	97	0.015548	yes	ADPSBQ
chr1_1572532_A_C_b38	ATAD3C	-4.916	1.19e-06	-0.078029	105	0.015872	yes	ADPSBQ
chr1_1394041_G_A_b38	ATAD3C	-4.902	1.28e-06	-0.117855	8	0.024044	yes	ADPSBQ
chr1_1573079_A_G_b38	ATAD3C	-4.901	1.28e-06	-0.077837	104	0.015882	yes	ADPSBQ
chr1_1437955_C_G_b38	ATAD3C	-4.874	1.46e-06	-0.079013	56	0.016211	yes	ADPSBQ
chr1_1549967_C_G_b38	ATAD3C	-4.868	1.51e-06	-0.081477	48	0.016739	yes	ADPSBQ
chr1_1554694_A_G_b38	ATAD3C	-4.853	1.62e-06	-0.07649	102	0.015762	yes	ADPSBQ
chr1_1554781_A_G_b38	ATAD3C	-4.838	1.74e-06	-0.076221	102	0.015754	yes	ADPSBQ
chr1_1553692_A_G_b38	ATAD3C	-4.837	1.75e-06	-0.07621	103	0.015755	yes	ADPSBQ
chr1_1555247_T_A_b38	ATAD3C	-4.837	1.75e-06	-0.07621	103	0.015755	yes	ADPSBQ
chr1_1519934_T_G_b38	ATAD3C	-4.835	1.76e-06	-0.080917	101	0.016736	yes	ADPSBQ
chr1_1519938_T_C_b38	ATAD3C	-4.835	1.76e-06	-0.080917	101	0.016736	yes	ADPSBQ
chr1_1559750_C_CAG_b38	ATAD3C	-4.832	1.79e-06	-0.076666	105	0.015867	yes	ADPSBQ
chr1_1561628_T_C_b38	ATAD3C	-4.832	1.79e-06	-0.076666	105	0.015867	yes	ADPSBQ
chr1_1563918_A_G_b38	ATAD3C	-4.832	1.79e-06	-0.076666	105	0.015867	yes	ADPSBQ
chr1_1565561_A_G_b38	ATAD3C	-4.832	1.79e-06	-0.076666	105	0.015867	yes	ADPSBQ
chr1_1567715_G_A_b38	ATAD3C	-4.832	1.79e-06	-0.076666	105	0.015867	yes	ADPSBQ
chr1_1567719_A_C_b38	ATAD3C	-4.832	1.79e-06	-0.076666	105	0.015867	yes	ADPSBQ
chr1_1569875_C_T_b38	ATAD3C	-4.832	1.79e-06	-0.076666	105	0.015867	yes	ADPSBQ
chr1_1337898_A_G_b38	ATAD3C	4.82	1.9e-06	0.087831	28	0.018222	yes	ADPSBQ
chr1_1554852_T_C_b38	ATAD3C	-4.816	1.93e-06	-0.075939	103	0.015766	yes	ADPSBQ
chr1_1571794_A_AT_b38	ATAD3C	-4.813	1.96e-06	-0.078333	90	0.016275	yes	ADPSBQ
chr1_1549590_C_G_b38	ATAD3C	-4.802	2.06e-06	-0.075834	102	0.015791	yes	ADPSBQ
chr1_1368177_G_C_b38	ATAD3C	-4.797	2.11e-06	-0.102657	17	0.021398	yes	ADPSBQ
chr1_1517993_A_G_b38	ATAD3C	-4.786	2.23e-06	-0.080075	101	0.016731	yes	ADPSBQ
chr1_1566854_CA_C_b38	ATAD3C	-4.689	3.53e-06	-0.082783	65	0.017654	yes	ADPSBQ
chr1_1574655_GGC_G_b38	ATAD3C	-4.68	3.68e-06	-0.075845	86	0.016206	yes	ADPSBQ
chr1_1570294_CA_C_b38	ATAD3C	-4.663	3.98e-06	-0.075573	94	0.016206	yes	ADPSBQ
chr1_1290968_C_G_b38	ATAD3C	-4.658	4.08e-06	-0.096396	49	0.020696	yes	ADPSBQ
chr1_1480224_A_G_b38	ATAD3C	-4.602	5.29e-06	-0.175208	5	0.038074	yes	ADPSBQ
chr1_1565680_A_AG_b38	ATAD3C	-4.577	5.94e-06	-0.073178	100	0.015989	yes	ADPSBQ
chr1_1558347_G_A_b38	ATAD3C	-4.572	6.06e-06	-0.077163	58	0.016876	yes	ADPSBQ
chr1_1575864_G_A_b38	ATAD3C	-4.566	6.23e-06	-0.07562	89	0.016561	yes	ADPSBQ
chr1_1308178_GGGGCGCGGGGA_G_b38	ATAD3C	-4.495	8.61e-06	-0.087646	24	0.019498	yes	ADPSBQ
chr1_1569180_T_A_b38	ATAD3C	-4.471	9.61e-06	-0.072028	101	0.016111	yes	ADPSBQ
chr1_1568548_G_A_b38	ATAD3C	-4.433	1.14e-05	-0.070518	92	0.015906	yes	ADPSBQ
chr1_1575935_T_C_b38	ATAD3C	-4.408	1.27e-05	-0.071723	94	0.016271	yes	ADPSBQ
chr1_1532798_T_C_b38	ATAD3C	-4.401	1.31e-05	-0.066955	159	0.015212	yes	ADPSBQ
chr1_1559703_G_C_b38	ATAD3C	-4.394	1.36e-05	-0.070016	92	0.015936	yes	ADPSBQ
chr1_1570587_C_T_b38	ATAD3C	-4.394	1.36e-05	-0.070016	92	0.015936	yes	ADPSBQ
chr1_1537493_T_A_b38	ATAD3C	-4.35	1.65e-05	-0.069973	84	0.016087	yes	ADPSBQ
chr1_1497606_C_G_b38	ATAD3C	-4.317	1.9e-05	-0.084795	19	0.019643	yes	ADPSBQ
chr1_1539491_G_C_b38	ATAD3C	-4.266	2.38e-05	-0.069039	97	0.016185	yes	ADPSBQ
chr1_1551454_C_A_b38	ATAD3C	-4.262	2.41e-05	-0.063627	166	0.014928	yes	ADPSBQ
chr1_1366828_A_G_b38	ATAD3C	-4.237	2.69e-05	-0.102261	9	0.024137	yes	ADPSBQ
chr1_1447650_A_G_b38	ATAD3C	-4.155	3.81e-05	-0.183008	3	0.044045	yes	ADPSBQ
chr1_1574032_AAAG_A_b38	ATAD3C	-4.143	4e-05	-0.076137	55	0.018375	yes	ADPSBQ
chr1_1571986_G_A_b38	ATAD3C	-4.085	5.12e-05	-0.06404	79	0.015678	yes	ADPSBQ
chr1_1366830_G_A_b38	ATAD3C	-4.03	6.42e-05	-0.097603	9	0.024218	yes	ADPSBQ
chr1_1366883_G_GGTGTGAATTGGTGTAGTGTGAATGAGT_b38	ATAD3C	-4.027	6.5e-05	-0.109691	6	0.027236	yes	ADPSBQ
chr1_1366835_G_GGTGA_b38	ATAD3C	-3.97	8.21e-05	-0.095836	9	0.024139	yes	ADPSBQ
chr1_1555179_A_G_b38	ATAD3C	-3.933	9.54e-05	-0.064228	71	0.01633	yes	ADPSBQ
chr1_1533883_G_T_b38	ATAD3C	-3.925	9.87e-05	-0.106854	18	0.027226	yes	ADPSBQ
chr1_1551523_T_C_b38	ATAD3C	-3.914	0.000103	-0.068786	30	0.017575	yes	ADPSBQ
chr1_1217251_C_A_b38	ATAD3C	-3.903	0.000108	-0.087188	12	0.022338	yes	ADPSBQ
chr1_1580890_C_T_b38	ATAD3C	-3.813	0.000154	-0.06681	33	0.017521	yes	ADPSBQ
chr1_1555871_T_C_b38	ATAD3C	-3.806	0.000158	-0.06248	77	0.016414	yes	ADPSBQ
chr1_1554548_T_C_b38	ATAD3C	-3.778	0.000177	-0.062195	70	0.016461	yes	ADPSBQ
chr1_1518621_A_AC_b38	ATAD3C	-3.762	0.000188	-0.077391	20	0.020571	yes	ADPSBQ
chr1_1573776_A_G_b38	ATAD3C	-3.758	0.000191	-0.065517	34	0.017434	yes	ADPSBQ
chr1_2160238_C_CGT_b38	ATAD3C	-3.756	0.000193	-0.104394	3	0.027796	yes	ADPSBQ
chr1_1217733_G_A_b38	ATAD3C	-3.74	0.000205	-0.082839	10	0.022151	yes	ADPSBQ
chr1_1571434_C_CA_b38	ATAD3C	-3.734	0.00021	-0.066125	52	0.017709	yes	ADPSBQ
chr1_1579717_T_A_b38	ATAD3C	-3.725	0.000217	-0.063851	37	0.01714	yes	ADPSBQ
chr1_1554290_C_T_b38	ATAD3C	-3.717	0.000224	-0.060876	68	0.016377	yes	ADPSBQ
chr1_1417051_CA_C_b38	ATAD3C	-3.695	0.000243	-0.091981	8	0.02489	yes	ADPSBQ
chr1_1367028_A_G_b38	ATAD3C	3.687	0.000251	0.087687	14	0.023784	yes	ADPSBQ
chr1_1537160_T_G_b38	ATAD3C	-3.674	0.000264	-0.057675	117	0.015699	yes	ADPSBQ
chr1_1573429_CAAAAAAAAAAAAAAAAAA_C_b38	ATAD3C	-3.662	0.000277	-0.058987	91	0.01611	yes	ADPSBQ
chr1_1290841_A_G_b38	ATAD3C	-3.652	0.000288	-0.075418	41	0.020654	yes	ADPSBQ
chr1_1366951_A_AGT_b38	ATAD3C	3.643	0.000297	0.089378	12	0.024534	yes	ADPSBQ
chr1_1366941_T_TGTGTGCA_b38	ATAD3C	3.64	0.000301	0.088467	12	0.024307	yes	ADPSBQ
chr1_1259424_T_C_b38	ATAD3C	-3.623	0.00032	-0.068831	78	0.018998	yes	ADPSBQ
chr1_2224423_G_A_b38	ATAD3C	-3.527	0.000458	-0.091661	7	0.025986	yes	ADPSBQ
chr1_1258206_AT_A_b38	ATAD3C	-3.523	0.000465	-0.065149	68	0.018492	yes	ADPSBQ
chr1_1428999_C_CA_b38	ATAD3C	-3.496	0.000514	-0.062062	34	0.017754	yes	ADPSBQ
chr1_1252613_C_G_b38	ATAD3C	-3.495	0.000515	-0.084725	8	0.024241	yes	ADPSBQ
chr1_1450193_C_T_b38	ATAD3C	-3.489	0.000527	-0.097913	13	0.028063	yes	ADPSBQ
chr1_1482316_C_G_b38	ATAD3C	-3.486	0.000533	-0.055617	61	0.015955	yes	ADPSBQ
chr1_1375678_TA_T_b38	ATAD3C	3.483	0.000539	0.068415	32	0.019644	yes	ADPSBQ
chr1_1522693_A_G_b38	ATAD3C	3.473	0.000559	0.062149	32	0.017896	yes	ADPSBQ
chr1_1538924_C_A_b38	ATAD3C	-3.463	0.000578	-0.05604	63	0.016181	yes	ADPSBQ
chr1_1363438_C_CTT_b38	ATAD3C	3.449	0.000608	0.062018	47	0.017979	yes	ADPSBQ
chr1_2271335_C_T_b38	ATAD3C	-3.446	0.000616	-0.065296	24	0.018948	yes	ADPSBQ
chr1_1221049_C_G_b38	ATAD3C	-3.409	0.000703	-0.058999	78	0.017307	yes	ADPSBQ
chr1_1367046_G_C_b38	ATAD3C	-3.328	0.000937	-0.122153	6	0.036703	yes	ADPSBQ
chr1_1290261_C_A_b38	ATAD3C	-3.327	0.000942	-0.070534	39	0.021202	yes	ADPSBQ
chr1_1252487_C_A_b38	ATAD3C	-3.309	0.001	-0.088752	4	0.026822	yes	ADPSBQ
chr1_1367055_T_TGA_b38	ATAD3C	-3.302	0.00103	-0.122505	6	0.037105	yes	ADPSBQ
chr1_1694167_G_A_b38	ATAD3C	-3.301	0.00103	-0.048952	100	0.014828	yes	ADPSBQ
chr1_1955317_G_GCTGGTGCGCGT_b38	ATAD3C	3.3	0.00103	0.085798	7	0.025996	yes	ADPSBQ
chr1_1375678_TAA_T_b38	ATAD3C	-3.297	0.00104	-0.066588	20	0.020195	yes	ADPSBQ
chr1_1568428_C_G_b38	ATAD3C	-3.292	0.00106	-0.055018	41	0.016714	yes	ADPSBQ
chr1_1528513_G_C_b38	ATAD3C	-3.282	0.0011	-0.1304	3	0.039737	yes	ADPSBQ
chr1_1192776_CAGTGTAGACACTCCAGTTGGTATG_C_b38	ATAD3C	3.272	0.00114	0.091378	4	0.027927	yes	ADPSBQ
chr1_1570568_AC_A_b38	ATAD3C	-3.27	0.00115	-0.057208	36	0.017496	yes	ADPSBQ
chr1_1545968_T_C_b38	ATAD3C	-3.255	0.00121	-0.055188	38	0.016956	yes	ADPSBQ
chr1_1695459_A_G_b38	ATAD3C	-3.249	0.00123	-0.058037	98	0.017863	yes	ADPSBQ
chr1_1248017_C_T_b38	ATAD3C	-3.248	0.00124	-0.092177	3	0.028378	yes	ADPSBQ
chr1_1553619_CAAAAAAA_C_b38	ATAD3C	-3.23	0.00132	-0.058283	33	0.018044	yes	ADPSBQ
chr1_1242538_CT_C_b38	ATAD3C	-3.208	0.00142	-0.09035	3	0.028163	yes	ADPSBQ
chr1_1250178_T_C_b38	ATAD3C	-3.203	0.00145	-0.087591	4	0.02735	yes	ADPSBQ
chr1_1367122_G_A_b38	ATAD3C	-3.171	0.00161	-0.170714	3	0.053828	yes	ADPSBQ
chr1_1689465_A_G_b38	ATAD3C	3.15	0.00173	0.046972	98	0.014912	yes	ADPSBQ
chr1_1548572_A_AC_b38	ATAD3C	-3.137	0.00181	-0.107671	7	0.034323	yes	ADPSBQ
chr1_1216593_G_C_b38	ATAD3C	-3.112	0.00196	-0.060254	17	0.019362	yes	ADPSBQ
chr1_1443673_CTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT_C_b38	ATAD3C	-3.109	0.00198	-0.120348	4	0.038714	yes	ADPSBQ
chr1_1250144_T_C_b38	ATAD3C	-3.108	0.00199	-0.086496	3	0.027829	yes	ADPSBQ
chr1_1252261_C_T_b38	ATAD3C	-3.088	0.00213	-0.078721	5	0.025494	yes	ADPSBQ
chr1_1558204_T_TAAAAAA_b38	ATAD3C	-3.077	0.0022	-0.053802	46	0.017482	yes	ADPSBQ
chr1_1553018_CA_C_b38	ATAD3C	-3.069	0.00226	-0.056425	24	0.018385	yes	ADPSBQ
chr1_1181009_A_AGCCCCTGCCCCTGCCCCTGAACCC_b38	ATAD3C	-3.035	0.00253	-0.088908	4	0.029294	yes	ADPSBQ
chr1_1288085_GC_G_b38	ATAD3C	-3.033	0.00254	-0.069207	12	0.022815	yes	ADPSBQ
chr1_1682902_C_T_b38	ATAD3C	3.023	0.00263	0.0887	3	0.029342	yes	ADPSBQ
chr1_1499586_C_CT_b38	ATAD3C	-3.022	0.00263	-0.066259	25	0.021922	yes	ADPSBQ
chr1_1694109_A_ACG_b38	ATAD3C	-3.019	0.00266	-0.044719	108	0.014811	yes	ADPSBQ
chr1_1553791_CA_C_b38	ATAD3C	-3.005	0.00279	-0.053691	32	0.017869	yes	ADPSBQ
chr1_1215852_T_C_b38	ATAD3C	-3.003	0.00281	-0.05669	21	0.018879	yes	ADPSBQ
chr1_1845824_TAC_T_b38	ATAD3C	2.995	0.00287	0.065529	9	0.021877	yes	ADPSBQ
chr1_1500745_A_C_b38	ATAD3C	-2.989	0.00294	-0.077517	52	0.025938	yes	ADPSBQ
chr1_1367036_GTGAATTGGT_G_b38	ATAD3C	-2.979	0.00303	-0.11531	5	0.038712	yes	ADPSBQ
chr1_1240580_G_GC_b38	ATAD3C	-2.958	0.00324	-0.068486	6	0.023156	yes	ADPSBQ
chr1_1210101_CAA_C_b38	ATAD3C	-2.948	0.00335	-0.072578	5	0.02462	yes	ADPSBQ
chr1_1696366_A_C_b38	ATAD3C	-2.944	0.00339	-0.043792	98	0.014874	yes	ADPSBQ
chr1_1280044_T_C_b38	ATAD3C	-2.942	0.00341	-0.051731	90	0.017582	yes	ADPSBQ
chr1_1366987_GTGTGTAGTGGATGAGTGTGGA_G_b38	ATAD3C	-2.942	0.00341	-0.108716	6	0.036954	yes	ADPSBQ
chr1_1367013_TG_T_b38	ATAD3C	-2.924	0.00361	-0.107114	6	0.036628	yes	ADPSBQ
chr1_1715745_G_A_b38	ATAD3C	2.923	0.00362	0.045663	81	0.015622	yes	ADPSBQ
chr1_1366976_GTTGAA_G_b38	ATAD3C	-2.921	0.00364	-0.105819	6	0.036225	yes	ADPSBQ
chr1_1874605_T_TAA_b38	ATAD3C	-2.918	0.00367	-0.109233	9	0.037428	yes	ADPSBQ
chr1_1696117_G_A_b38	ATAD3C	-2.908	0.00379	-0.043153	100	0.014838	yes	ADPSBQ
chr1_1384256_T_G_b38	ATAD3C	2.904	0.00384	0.067253	4	0.023159	yes	ADPSBQ
chr1_1256490_C_T_b38	ATAD3C	-2.902	0.00387	-0.085836	3	0.029581	yes	ADPSBQ
chr1_641813_G_A_b38	ATAD3C	2.901	0.00388	0.061905	6	0.02134	yes	ADPSBQ
chr1_1918484_C_A_b38	ATAD3C	2.899	0.00391	0.076691	7	0.026458	yes	ADPSBQ
chr1_1235602_C_A_b38	ATAD3C	-2.895	0.00396	-0.064669	10	0.022341	yes	ADPSBQ
chr1_591638_G_A_b38	ATAD3C	2.89	0.00402	0.066516	11	0.023018	yes	ADPSBQ
chr1_1573265_C_CAAAA_b38	ATAD3C	-2.88	0.00415	-0.061958	21	0.021516	yes	ADPSBQ
chr1_1778195_G_A_b38	ATAD3C	2.871	0.00426	0.081746	4	0.028473	yes	ADPSBQ
chr1_1288341_C_T_b38	ATAD3C	-2.844	0.00464	-0.07673	15	0.026984	yes	ADPSBQ
chr1_2222256_T_C_b38	ATAD3C	-2.841	0.00467	-0.055806	22	0.01964	yes	ADPSBQ
chr1_2222257_G_C_b38	ATAD3C	-2.841	0.00467	-0.055806	22	0.01964	yes	ADPSBQ
chr1_2222258_T_C_b38	ATAD3C	-2.841	0.00467	-0.055806	22	0.01964	yes	ADPSBQ
chr1_1366907_G_A_b38	ATAD3C	-2.833	0.0048	-0.101849	6	0.035954	yes	ADPSBQ
chr1_1366911_A_T_b38	ATAD3C	-2.833	0.0048	-0.101849	6	0.035954	yes	ADPSBQ
chr1_924310_C_G_b38	ATAD3C	2.818	0.00502	0.090369	25	0.032071	yes	ADPSBQ
chr1_630555_C_T_b38	ATAD3C	-2.816	0.00505	-0.09761	6	0.034664	yes	ADPSBQ
chr1_1769192_C_T_b38	ATAD3C	2.812	0.00512	0.080988	4	0.028803	yes	ADPSBQ
chr1_1780639_C_T_b38	ATAD3C	2.812	0.00512	0.080988	4	0.028803	yes	ADPSBQ
chr1_1787203_C_A_b38	ATAD3C	2.812	0.00512	0.080988	4	0.028803	yes	ADPSBQ
chr1_1367021_GGCGAGTATGGA_G_b38	ATAD3C	-2.809	0.00516	-0.105387	6	0.037519	yes	ADPSBQ
chr1_1689421_G_A_b38	ATAD3C	2.809	0.00517	0.043805	81	0.015597	yes	ADPSBQ
chr1_2215527_T_C_b38	ATAD3C	-2.802	0.00526	-0.053582	24	0.01912	yes	ADPSBQ
chr1_1902068_C_T_b38	ATAD3C	2.795	0.00538	0.079256	5	0.028353	yes	ADPSBQ
chr1_1691377_C_T_b38	ATAD3C	-2.795	0.00539	-0.046153	62	0.016515	yes	ADPSBQ
chr1_1689446_T_C_b38	ATAD3C	2.769	0.00583	0.043184	82	0.015596	yes	ADPSBQ
chr1_1219159_G_A_b38	ATAD3C	-2.724	0.00667	-0.071207	4	0.026142	yes	ADPSBQ
chr1_1844896_C_T_b38	ATAD3C	2.72	0.00675	0.078475	4	0.028851	yes	ADPSBQ
chr1_1705816_A_G_b38	ATAD3C	-2.715	0.00686	-0.038821	119	0.0143	yes	ADPSBQ
chr1_1301426_A_AT_b38	ATAD3C	-2.707	0.00701	-0.058915	22	0.021761	yes	ADPSBQ
chr1_1251122_A_T_b38	ATAD3C	-2.698	0.00721	-0.051769	32	0.01919	yes	ADPSBQ
chr1_1889256_CTTAA_C_b38	ATAD3C	2.697	0.00722	0.077064	4	0.028569	yes	ADPSBQ
chr1_1572877_TG_T_b38	ATAD3C	-2.682	0.00757	-0.049804	23	0.018573	yes	ADPSBQ
chr1_1461687_CTGGAGGGAGAGGCTCCTCATGAGACCCCCATGTAGGGAT_C_b38	ATAD3C	-2.675	0.00771	-0.115465	4	0.043161	yes	ADPSBQ
chr1_1534226_C_T_b38	ATAD3C	-2.662	0.00801	-0.043794	68	0.016452	yes	ADPSBQ
chr1_1363601_A_AT_b38	ATAD3C	2.657	0.00814	0.038931	152	0.014654	yes	ADPSBQ
chr1_1811239_C_T_b38	ATAD3C	2.651	0.00827	0.07616	4	0.028726	yes	ADPSBQ
chr1_1860776_C_T_b38	ATAD3C	2.651	0.00827	0.07616	4	0.028726	yes	ADPSBQ
chr1_1697467_G_A_b38	ATAD3C	-2.651	0.00828	-0.04135	86	0.0156	yes	ADPSBQ
chr1_1366923_AGTTG_A_b38	ATAD3C	-2.65	0.00831	-0.092079	6	0.034752	yes	ADPSBQ
chr1_1230159_G_A_b38	ATAD3C	-2.644	0.00845	-0.048618	42	0.018389	yes	ADPSBQ
chr1_1708362_T_C_b38	ATAD3C	-2.641	0.00853	-0.04356	68	0.016496	yes	ADPSBQ
chr1_607379_G_A_b38	ATAD3C	-2.619	0.00908	-0.091312	7	0.034867	yes	ADPSBQ
chr1_1697272_G_A_b38	ATAD3C	-2.604	0.00948	-0.063633	34	0.024434	yes	ADPSBQ
chr1_2226499_CG_C_b38	ATAD3C	-2.603	0.0095	-0.04998	23	0.019198	yes	ADPSBQ
chr1_1216708_CT_C_b38	ATAD3C	-2.602	0.00954	-0.064488	4	0.024785	yes	ADPSBQ
chr1_1236037_C_T_b38	ATAD3C	-2.596	0.00972	-0.04038	107	0.015557	yes	ADPSBQ
chr1_1251285_G_A_b38	ATAD3C	-2.592	0.0098	-0.052653	21	0.02031	yes	ADPSBQ
chr1_1293731_A_ACGCCCCTGCCCTGGAGGCCC_b38	ATAD3C	2.587	0.00995	0.039437	90	0.015242	yes	ADPSBQ
chr1_868727_T_C_b38	ATAD3C	2.586	0.01	0.079365	4	0.030694	yes	ADPSBQ
chr1_1562444_C_T_b38	ATAD3C	-5.115	4.45e-07	-0.128156	7	0.025056	no	ADPSBQ
chr1_1292284_TTGAG_T_b38	ATAD3C	-4.796	2.12e-06	-0.10134	32	0.021129	no	ADPSBQ
chr1_1302795_T_TC_b38	ATAD3C	4.589	5.61e-06	0.083628	89	0.018223	no	ADPSBQ
chr1_1979552_C_T_b38	ATAD3C	3.705	0.000235	0.159108	4	0.042947	no	ADPSBQ
chr1_633846_C_A_b38	ATAD3C	3.015	0.0027	0.105699	16	0.035063	no	ADPSBQ
chr1_1724489_G_C_b38	ATAD3C	-2.73	0.00655	-0.041984	153	0.015379	no	ADPSBQ
chr1_1716489_A_G_b38	ATAD3C	2.679	0.00763	0.042269	80	0.01578	no	ADPSBQ
chr1_1324055_GCTGAGGGA_G_b38	ATAD3C	2.651	0.00828	0.117305	4	0.044256	no	ADPSBQ
chr1_1704835_C_T_b38	ATAD3C	-2.634	0.0087	-0.040349	161	0.01532	no	ADPSBQ
chr1_1720192_T_G_b38	ATAD3C	-2.602	0.00953	-0.039762	158	0.01528	no	ADPSBQ
chr1_1440430_C_G_b38	ATAD3C	-5.595	4.12e-08	-0.125449	32	0.022423	yes	ADPVSC
chr1_1432355_G_A_b38	ATAD3C	-5.548	5.28e-08	-0.131967	16	0.023787	yes	ADPVSC
chr1_1428969_T_C_b38	ATAD3C	-5.515	6.27e-08	-0.118738	52	0.021528	yes	ADPVSC
chr1_1442793_G_A_b38	ATAD3C	-5.298	1.94e-07	-0.135581	11	0.02559	yes	ADPVSC
chr1_1430190_A_C_b38	ATAD3C	-5.198	3.22e-07	-0.112553	52	0.021652	yes	ADPVSC
chr1_1430908_A_G_b38	ATAD3C	-5.185	3.45e-07	-0.111557	53	0.021517	yes	ADPVSC
chr1_1431014_G_A_b38	ATAD3C	-5.161	3.89e-07	-0.111069	30	0.021521	yes	ADPVSC
chr1_1436079_A_G_b38	ATAD3C	-5.152	4.07e-07	-0.108815	54	0.021123	yes	ADPVSC
chr1_1443457_T_C_b38	ATAD3C	-5.12	4.77e-07	-0.114165	50	0.022298	yes	ADPVSC
chr1_1439805_G_C_b38	ATAD3C	-5.039	7.12e-07	-0.119672	19	0.023749	yes	ADPVSC
chr1_1431537_G_C_b38	ATAD3C	-5.034	7.28e-07	-0.109062	52	0.021664	yes	ADPVSC
chr1_1435945_C_CCGGGCGGGGGCG_b38	ATAD3C	-5.019	7.85e-07	-0.129114	11	0.025726	yes	ADPVSC
chr1_1440834_C_G_b38	ATAD3C	-5.018	7.89e-07	-0.11149	48	0.022219	yes	ADPVSC
chr1_1433374_T_C_b38	ATAD3C	-5.017	7.94e-07	-0.104299	57	0.020791	yes	ADPVSC
chr1_1431450_A_G_b38	ATAD3C	-5.001	8.58e-07	-0.108349	52	0.021667	yes	ADPVSC
chr1_1426253_G_A_b38	ATAD3C	-4.978	9.58e-07	-0.130503	10	0.026215	yes	ADPVSC
chr1_1426261_C_T_b38	ATAD3C	-4.923	1.25e-06	-0.107146	50	0.021764	yes	ADPVSC
chr1_1426810_C_G_b38	ATAD3C	-4.883	1.51e-06	-0.105983	51	0.021703	yes	ADPVSC
chr1_1436388_CA_C_b38	ATAD3C	-4.795	2.3e-06	-0.11101	29	0.023152	yes	ADPVSC
chr1_1431026_CCACCCCCT_C_b38	ATAD3C	-4.566	6.64e-06	-0.104932	25	0.022982	yes	ADPVSC
chr1_1441187_A_G_b38	ATAD3C	-4.551	7.12e-06	-0.105347	31	0.02315	yes	ADPVSC
chr1_1431656_G_A_b38	ATAD3C	-4.438	1.18e-05	-0.116194	11	0.026184	yes	ADPVSC
chr1_1445187_T_G_b38	ATAD3C	-4.398	1.4e-05	-0.099807	44	0.022693	yes	ADPVSC
chr1_1379091_T_G_b38	ATAD3C	4.326	1.92e-05	0.11216	14	0.025927	yes	ADPVSC
chr1_1434687_C_G_b38	ATAD3C	-4.288	2.27e-05	-0.111155	11	0.025925	yes	ADPVSC
chr1_1438102_G_C_b38	ATAD3C	-4.233	2.86e-05	-0.101062	19	0.023873	yes	ADPVSC
chr1_1439454_A_G_b38	ATAD3C	-4.225	2.97e-05	-0.092302	45	0.021849	yes	ADPVSC
chr1_1447108_A_ATT_b38	ATAD3C	-4.207	3.21e-05	-0.101783	22	0.024196	yes	ADPVSC
chr1_1448915_G_A_b38	ATAD3C	-4.054	6.07e-05	-0.094875	27	0.023406	yes	ADPVSC
chr1_1453961_C_T_b38	ATAD3C	-4.032	6.63e-05	-0.11054	8	0.027417	yes	ADPVSC
chr1_1363601_A_AT_b38	ATAD3C	3.969	8.56e-05	0.069505	140	0.017512	yes	ADPVSC
chr1_1445240_A_G_b38	ATAD3C	-3.936	9.77e-05	-0.090005	49	0.022866	yes	ADPVSC
chr1_1288085_GC_G_b38	ATAD3C	-3.876	0.000124	-0.106587	9	0.027503	yes	ADPVSC
chr1_1431813_G_T_b38	ATAD3C	-3.721	0.000227	-0.092642	14	0.024898	yes	ADPVSC
chr1_1217251_C_A_b38	ATAD3C	-3.656	0.00029	-0.103029	9	0.028177	yes	ADPVSC
chr1_1373006_G_A_b38	ATAD3C	-3.641	0.000308	-0.108782	6	0.029878	yes	ADPVSC
chr1_1453870_A_C_b38	ATAD3C	-3.536	0.000454	-0.096423	8	0.02727	yes	ADPVSC
chr1_1379093_TG_T_b38	ATAD3C	-3.493	0.000531	-0.107776	7	0.030855	yes	ADPVSC
chr1_1375642_C_T_b38	ATAD3C	-3.427	0.000674	-0.097186	10	0.028358	yes	ADPVSC
chr1_1380867_A_G_b38	ATAD3C	-3.418	0.000696	-0.10132	9	0.029643	yes	ADPVSC
chr1_1373007_G_A_b38	ATAD3C	-3.399	0.000745	-0.099977	8	0.029414	yes	ADPVSC
chr1_1382893_G_A_b38	ATAD3C	-3.385	0.000782	-0.097857	10	0.028908	yes	ADPVSC
chr1_1367292_A_AGT_b38	ATAD3C	3.385	0.000784	0.085091	16	0.025141	yes	ADPVSC
chr1_1487487_C_CA_b38	ATAD3C	3.384	0.000785	0.118203	5	0.034929	yes	ADPVSC
chr1_1363898_C_T_b38	ATAD3C	3.378	0.000801	0.084898	16	0.025129	yes	ADPVSC
chr1_1366529_TTAG_T_b38	ATAD3C	3.378	0.000801	0.084898	16	0.025129	yes	ADPVSC
chr1_1428999_C_CA_b38	ATAD3C	-3.369	0.000827	-0.075711	24	0.02247	yes	ADPVSC
chr1_1403593_A_G_b38	ATAD3C	-3.357	0.000865	-0.097621	10	0.029082	yes	ADPVSC
chr1_1363986_C_T_b38	ATAD3C	3.355	0.00087	0.084505	16	0.025188	yes	ADPVSC
chr1_1366828_A_G_b38	ATAD3C	-3.318	0.00099	-0.10361	7	0.031227	yes	ADPVSC
chr1_1566854_CA_C_b38	ATAD3C	-3.292	0.00108	-0.070976	44	0.021561	yes	ADPVSC
chr1_1497105_T_G_b38	ATAD3C	3.283	0.00112	0.109157	5	0.033251	yes	ADPVSC
chr1_1407565_C_A_b38	ATAD3C	-3.276	0.00115	-0.098989	9	0.030217	yes	ADPVSC
chr1_1374505_A_G_b38	ATAD3C	-3.27	0.00117	-0.092631	10	0.028328	yes	ADPVSC
chr1_1473089_T_C_b38	ATAD3C	3.251	0.00125	0.095146	27	0.029264	yes	ADPVSC
chr1_1383743_T_C_b38	ATAD3C	-3.248	0.00126	-0.094187	10	0.028996	yes	ADPVSC
chr1_1366830_G_A_b38	ATAD3C	-3.245	0.00127	-0.101381	7	0.031243	yes	ADPVSC
chr1_1398218_C_A_b38	ATAD3C	-3.243	0.00128	-0.0944	10	0.029108	yes	ADPVSC
chr1_1400756_GGA_G_b38	ATAD3C	-3.243	0.00128	-0.0944	10	0.029108	yes	ADPVSC
chr1_1401954_G_T_b38	ATAD3C	-3.243	0.00128	-0.0944	10	0.029108	yes	ADPVSC
chr1_1372909_G_A_b38	ATAD3C	-3.221	0.00138	-0.093223	9	0.028941	yes	ADPVSC
chr1_1370553_CAAA_C_b38	ATAD3C	-3.169	0.00165	-0.09239	7	0.029154	yes	ADPVSC
chr1_1379083_AT_A_b38	ATAD3C	3.166	0.00166	0.075509	19	0.023848	yes	ADPVSC
chr1_1369803_C_CT_b38	ATAD3C	-3.163	0.00168	-0.083064	10	0.02626	yes	ADPVSC
chr1_1456217_T_C_b38	ATAD3C	-3.162	0.00169	-0.073935	46	0.023383	yes	ADPVSC
chr1_1365566_G_A_b38	ATAD3C	3.16	0.0017	0.078483	16	0.024833	yes	ADPVSC
chr1_1384546_C_T_b38	ATAD3C	-3.154	0.00173	-0.09499	9	0.030115	yes	ADPVSC
chr1_1366835_G_GGTGA_b38	ATAD3C	-3.146	0.00178	-0.098023	7	0.031158	yes	ADPVSC
chr1_1364253_C_G_b38	ATAD3C	-3.146	0.00178	-0.087072	11	0.027679	yes	ADPVSC
chr1_1329973_GCGTGTGCCATGCA_G_b38	ATAD3C	-3.144	0.00179	-0.090654	10	0.02883	yes	ADPVSC
chr1_1367511_ATGAG_A_b38	ATAD3C	-3.126	0.0019	-0.086721	10	0.027746	yes	ADPVSC
chr1_1454770_T_C_b38	ATAD3C	-3.116	0.00197	-0.073181	48	0.023486	yes	ADPVSC
chr1_1450636_A_G_b38	ATAD3C	-3.115	0.00197	-0.084702	8	0.027192	yes	ADPVSC
chr1_1574445_A_G_b38	ATAD3C	-3.108	0.00202	-0.062843	64	0.02022	yes	ADPVSC
chr1_1369407_G_A_b38	ATAD3C	-3.107	0.00202	-0.085193	10	0.027418	yes	ADPVSC
chr1_1437993_G_A_b38	ATAD3C	-3.09	0.00214	-0.072254	19	0.023386	yes	ADPVSC
chr1_1575421_C_T_b38	ATAD3C	-3.089	0.00215	-0.060913	65	0.019717	yes	ADPVSC
chr1_1481959_C_T_b38	ATAD3C	3.072	0.00227	0.089607	23	0.029167	yes	ADPVSC
chr1_1363880_A_G_b38	ATAD3C	-3.063	0.00234	-0.083343	11	0.027207	yes	ADPVSC
chr1_1490320_T_C_b38	ATAD3C	3.046	0.00247	0.091434	28	0.030016	yes	ADPVSC
chr1_1368991_C_T_b38	ATAD3C	-3.043	0.0025	-0.083806	11	0.027542	yes	ADPVSC
chr1_1565105_CAAGGCAGGCGGATCATG_C_b38	ATAD3C	-3.043	0.0025	-0.060138	72	0.019766	yes	ADPVSC
chr1_1366511_GGTGA_G_b38	ATAD3C	-3.04	0.00252	-0.082973	11	0.027295	yes	ADPVSC
chr1_1364357_A_C_b38	ATAD3C	-3.037	0.00255	-0.08335	11	0.027449	yes	ADPVSC
chr1_1368514_C_G_b38	ATAD3C	-3.037	0.00255	-0.08335	11	0.027449	yes	ADPVSC
chr1_1344048_G_A_b38	ATAD3C	-3.036	0.00256	-0.087135	10	0.028701	yes	ADPVSC
chr1_1341550_GCA_G_b38	ATAD3C	-3.031	0.0026	-0.084434	11	0.027855	yes	ADPVSC
chr1_1370532_C_T_b38	ATAD3C	-3.031	0.0026	-0.082926	11	0.027358	yes	ADPVSC
chr1_591658_C_T_b38	ATAD3C	-3.025	0.00264	-0.175678	3	0.058069	yes	ADPVSC
chr1_1366883_G_GGTGTGAATTGGTGTAGTGTGAATGAGT_b38	ATAD3C	-3.022	0.00267	-0.10744	4	0.035549	yes	ADPVSC
chr1_666028_G_A_b38	ATAD3C	-3.011	0.00277	-0.086227	7	0.028638	yes	ADPVSC
chr1_1573654_T_C_b38	ATAD3C	-2.999	0.00288	-0.060176	64	0.020066	yes	ADPVSC
chr1_1492619_A_AC_b38	ATAD3C	2.998	0.00289	0.088821	29	0.029625	yes	ADPVSC
chr1_1487887_A_G_b38	ATAD3C	2.989	0.00298	0.090061	28	0.030136	yes	ADPVSC
chr1_1510082_T_TA_b38	ATAD3C	2.98	0.00306	0.099242	5	0.033299	yes	ADPVSC
chr1_1575724_G_C_b38	ATAD3C	-2.979	0.00307	-0.059358	63	0.019924	yes	ADPVSC
chr1_1364566_T_C_b38	ATAD3C	-2.97	0.00316	-0.08165	11	0.02749	yes	ADPVSC
chr1_1363688_C_T_b38	ATAD3C	-2.97	0.00316	-0.08162	11	0.027484	yes	ADPVSC
chr1_1364099_CCA_C_b38	ATAD3C	-2.97	0.00316	-0.08162	11	0.027484	yes	ADPVSC
chr1_1364102_TGTTG_T_b38	ATAD3C	-2.97	0.00316	-0.08162	11	0.027484	yes	ADPVSC
chr1_1368763_G_A_b38	ATAD3C	-2.97	0.00316	-0.08162	11	0.027484	yes	ADPVSC
chr1_1488652_A_G_b38	ATAD3C	2.969	0.00317	0.08916	29	0.030028	yes	ADPVSC
chr1_1492292_C_G_b38	ATAD3C	2.969	0.00317	0.08916	29	0.030028	yes	ADPVSC
chr1_1492850_G_A_b38	ATAD3C	2.969	0.00317	0.08916	29	0.030028	yes	ADPVSC
chr1_1367280_T_A_b38	ATAD3C	-2.962	0.00324	-0.081387	11	0.027475	yes	ADPVSC
chr1_1367919_C_T_b38	ATAD3C	-2.962	0.00324	-0.081495	11	0.027515	yes	ADPVSC
chr1_1476515_AT_A_b38	ATAD3C	2.96	0.00326	0.088576	3	0.029926	yes	ADPVSC
chr1_1366681_T_TGA_b38	ATAD3C	-2.958	0.00328	-0.08225	11	0.027808	yes	ADPVSC
chr1_1538787_A_G_b38	ATAD3C	-2.957	0.0033	-0.058934	69	0.019933	yes	ADPVSC
chr1_1541864_T_C_b38	ATAD3C	-2.954	0.00332	-0.061278	63	0.020744	yes	ADPVSC
chr1_1551557_A_AG_b38	ATAD3C	-2.954	0.00332	-0.061278	63	0.020744	yes	ADPVSC
chr1_1551559_A_T_b38	ATAD3C	-2.954	0.00332	-0.061278	63	0.020744	yes	ADPVSC
chr1_1367300_T_TGA_b38	ATAD3C	-2.954	0.00333	-0.082202	10	0.027831	yes	ADPVSC
chr1_1369009_T_C_b38	ATAD3C	-2.94	0.00347	-0.081002	11	0.027551	yes	ADPVSC
chr1_1456829_G_C_b38	ATAD3C	-2.94	0.00347	-0.071632	31	0.024365	yes	ADPVSC
chr1_1367462_T_C_b38	ATAD3C	-2.939	0.00348	-0.080996	11	0.027557	yes	ADPVSC
chr1_1367268_TGA_T_b38	ATAD3C	-2.932	0.00356	-0.080341	11	0.0274	yes	ADPVSC
chr1_1369012_C_CG_b38	ATAD3C	-2.931	0.00357	-0.08075	11	0.027548	yes	ADPVSC
chr1_1364282_T_G_b38	ATAD3C	-2.928	0.00361	-0.080337	11	0.027442	yes	ADPVSC
chr1_1364694_T_C_b38	ATAD3C	-2.928	0.00361	-0.080337	11	0.027442	yes	ADPVSC
chr1_1364721_C_T_b38	ATAD3C	-2.928	0.00361	-0.080337	11	0.027442	yes	ADPVSC
chr1_1365160_A_G_b38	ATAD3C	-2.928	0.00361	-0.080337	11	0.027442	yes	ADPVSC
chr1_1365198_C_T_b38	ATAD3C	-2.928	0.00361	-0.080337	11	0.027442	yes	ADPVSC
chr1_1366008_A_G_b38	ATAD3C	-2.928	0.00361	-0.080337	11	0.027442	yes	ADPVSC
chr1_1366062_T_C_b38	ATAD3C	-2.928	0.00361	-0.080337	11	0.027442	yes	ADPVSC
chr1_1366145_TGTGAA_T_b38	ATAD3C	-2.928	0.00361	-0.080337	11	0.027442	yes	ADPVSC
chr1_1366187_A_AGT_b38	ATAD3C	-2.928	0.00361	-0.080337	11	0.027442	yes	ADPVSC
chr1_1366321_TGTGTGTAAATGG_T_b38	ATAD3C	-2.928	0.00361	-0.080337	11	0.027442	yes	ADPVSC
chr1_1366453_G_T_b38	ATAD3C	-2.928	0.00361	-0.080337	11	0.027442	yes	ADPVSC
chr1_1366726_T_G_b38	ATAD3C	-2.928	0.00361	-0.080337	11	0.027442	yes	ADPVSC
chr1_1367258_T_A_b38	ATAD3C	-2.928	0.00361	-0.080337	11	0.027442	yes	ADPVSC
chr1_1367297_GAA_G_b38	ATAD3C	-2.928	0.00361	-0.080337	11	0.027442	yes	ADPVSC
chr1_1367329_A_AGT_b38	ATAD3C	-2.928	0.00361	-0.080337	11	0.027442	yes	ADPVSC
chr1_1367373_T_TGTG_b38	ATAD3C	-2.928	0.00361	-0.080337	11	0.027442	yes	ADPVSC
chr1_1367388_T_TTGG_b38	ATAD3C	-2.928	0.00361	-0.080337	11	0.027442	yes	ADPVSC
chr1_1367593_G_A_b38	ATAD3C	-2.928	0.00361	-0.080337	11	0.027442	yes	ADPVSC
chr1_1367602_GT_G_b38	ATAD3C	-2.928	0.00361	-0.080337	11	0.027442	yes	ADPVSC
chr1_1367605_GAGTGAGTGTA_G_b38	ATAD3C	-2.928	0.00361	-0.080337	11	0.027442	yes	ADPVSC
chr1_1367670_GGTGA_G_b38	ATAD3C	-2.928	0.00361	-0.080337	11	0.027442	yes	ADPVSC
chr1_1367722_TTTTA_T_b38	ATAD3C	-2.928	0.00361	-0.080337	11	0.027442	yes	ADPVSC
chr1_1367874_A_T_b38	ATAD3C	-2.928	0.00361	-0.080337	11	0.027442	yes	ADPVSC
chr1_1367951_C_T_b38	ATAD3C	-2.928	0.00361	-0.080337	11	0.027442	yes	ADPVSC
chr1_1367965_A_G_b38	ATAD3C	-2.928	0.00361	-0.080337	11	0.027442	yes	ADPVSC
chr1_1367970_T_G_b38	ATAD3C	-2.928	0.00361	-0.080337	11	0.027442	yes	ADPVSC
chr1_1367994_C_A_b38	ATAD3C	-2.928	0.00361	-0.080337	11	0.027442	yes	ADPVSC
chr1_1368297_C_T_b38	ATAD3C	-2.928	0.00361	-0.080337	11	0.027442	yes	ADPVSC
chr1_1369282_G_A_b38	ATAD3C	-2.928	0.00361	-0.080337	11	0.027442	yes	ADPVSC
chr1_1369320_GT_G_b38	ATAD3C	-2.928	0.00361	-0.080337	11	0.027442	yes	ADPVSC
chr1_1369476_CTT_C_b38	ATAD3C	-2.928	0.00361	-0.080337	11	0.027442	yes	ADPVSC
chr1_1369556_C_G_b38	ATAD3C	-2.928	0.00361	-0.080337	11	0.027442	yes	ADPVSC
chr1_1369627_T_C_b38	ATAD3C	-2.928	0.00361	-0.080337	11	0.027442	yes	ADPVSC
chr1_1369686_T_C_b38	ATAD3C	-2.928	0.00361	-0.080337	11	0.027442	yes	ADPVSC
chr1_1369716_G_C_b38	ATAD3C	-2.928	0.00361	-0.080337	11	0.027442	yes	ADPVSC
chr1_1369741_C_T_b38	ATAD3C	-2.928	0.00361	-0.080337	11	0.027442	yes	ADPVSC
chr1_1370181_C_T_b38	ATAD3C	-2.928	0.00361	-0.080337	11	0.027442	yes	ADPVSC
chr1_1370317_G_C_b38	ATAD3C	-2.928	0.00361	-0.080337	11	0.027442	yes	ADPVSC
chr1_1370320_A_G_b38	ATAD3C	-2.928	0.00361	-0.080337	11	0.027442	yes	ADPVSC
chr1_1370430_T_C_b38	ATAD3C	-2.928	0.00361	-0.080337	11	0.027442	yes	ADPVSC
chr1_1370584_G_C_b38	ATAD3C	-2.928	0.00361	-0.080337	11	0.027442	yes	ADPVSC
chr1_1454315_C_T_b38	ATAD3C	-2.925	0.00364	-0.068586	43	0.02345	yes	ADPVSC
chr1_1402457_A_G_b38	ATAD3C	-2.913	0.00378	-0.07202	47	0.024723	yes	ADPVSC
chr1_1452384_G_A_b38	ATAD3C	-2.912	0.0038	-0.077022	10	0.026454	yes	ADPVSC
chr1_1550064_GC_G_b38	ATAD3C	-2.895	0.00401	-0.059486	61	0.020551	yes	ADPVSC
chr1_1550068_C_A_b38	ATAD3C	-2.895	0.00401	-0.059486	61	0.020551	yes	ADPVSC
chr1_1369821_C_T_b38	ATAD3C	-2.884	0.00414	-0.079295	11	0.027496	yes	ADPVSC
chr1_1376162_G_C_b38	ATAD3C	2.875	0.00426	0.069813	35	0.024284	yes	ADPVSC
chr1_1377431_C_T_b38	ATAD3C	2.875	0.00426	0.069813	35	0.024284	yes	ADPVSC
chr1_1455617_T_G_b38	ATAD3C	-2.867	0.00436	-0.067623	47	0.023585	yes	ADPVSC
chr1_1612867_C_CT_b38	ATAD3C	2.867	0.00436	0.127686	3	0.044533	yes	ADPVSC
chr1_1363456_CAG_C_b38	ATAD3C	2.861	0.00445	0.064652	28	0.022599	yes	ADPVSC
chr1_1452346_A_G_b38	ATAD3C	-2.854	0.00454	-0.075731	10	0.026536	yes	ADPVSC
chr1_1366292_G_T_b38	ATAD3C	-2.854	0.00455	-0.078439	11	0.027487	yes	ADPVSC
chr1_1476079_T_C_b38	ATAD3C	2.853	0.00455	0.083715	29	0.02934	yes	ADPVSC
chr1_1370113_A_G_b38	ATAD3C	2.839	0.00475	0.063526	36	0.022374	yes	ADPVSC
chr1_1558726_C_CA_b38	ATAD3C	-2.838	0.00478	-0.058095	64	0.020474	yes	ADPVSC
chr1_1561821_A_C_b38	ATAD3C	-2.838	0.00478	-0.058095	64	0.020474	yes	ADPVSC
chr1_1542773_T_C_b38	ATAD3C	-2.832	0.00485	-0.057891	62	0.020438	yes	ADPVSC
chr1_1542793_C_G_b38	ATAD3C	-2.832	0.00485	-0.057891	62	0.020438	yes	ADPVSC
chr1_1542800_T_C_b38	ATAD3C	-2.832	0.00485	-0.057891	62	0.020438	yes	ADPVSC
chr1_1543953_A_G_b38	ATAD3C	-2.826	0.00495	-0.057764	62	0.020439	yes	ADPVSC
chr1_1378204_G_C_b38	ATAD3C	2.819	0.00506	0.067248	37	0.023857	yes	ADPVSC
chr1_1574032_AAAG_A_b38	ATAD3C	-2.815	0.00511	-0.063724	31	0.022634	yes	ADPVSC
chr1_1839692_C_CA_b38	ATAD3C	-2.812	0.00516	-0.084999	4	0.030224	yes	ADPVSC
chr1_1566086_G_A_b38	ATAD3C	-2.806	0.00526	-0.055801	71	0.019887	yes	ADPVSC
chr1_1387698_A_G_b38	ATAD3C	2.782	0.00567	0.068534	47	0.024638	yes	ADPVSC
chr1_1366561_AGT_A_b38	ATAD3C	2.78	0.00569	0.066003	48	0.023742	yes	ADPVSC
chr1_1452511_A_G_b38	ATAD3C	-2.768	0.00591	-0.065251	46	0.023574	yes	ADPVSC
chr1_1452888_C_A_b38	ATAD3C	-2.768	0.00591	-0.065251	46	0.023574	yes	ADPVSC
chr1_1452909_A_C_b38	ATAD3C	-2.768	0.00591	-0.065251	46	0.023574	yes	ADPVSC
chr1_1454092_A_G_b38	ATAD3C	-2.768	0.00591	-0.065251	46	0.023574	yes	ADPVSC
chr1_1389827_C_T_b38	ATAD3C	2.761	0.00603	0.067699	46	0.024521	yes	ADPVSC
chr1_1325753_G_T_b38	ATAD3C	-2.758	0.00608	-0.082288	7	0.029831	yes	ADPVSC
chr1_1453703_A_G_b38	ATAD3C	-2.757	0.0061	-0.065006	46	0.023578	yes	ADPVSC
chr1_1252487_C_A_b38	ATAD3C	-2.742	0.00639	-0.09139	4	0.033334	yes	ADPVSC
chr1_1400410_A_G_b38	ATAD3C	-2.741	0.00641	-0.066886	36	0.024404	yes	ADPVSC
chr1_1395346_A_G_b38	ATAD3C	-2.73	0.00661	-0.067136	45	0.024592	yes	ADPVSC
chr1_1411323_A_C_b38	ATAD3C	-2.726	0.0067	-0.067348	48	0.024709	yes	ADPVSC
chr1_1532798_T_C_b38	ATAD3C	-2.723	0.00676	-0.051163	122	0.018792	yes	ADPVSC
chr1_1365036_T_TAA_b38	ATAD3C	-2.715	0.00691	-0.079947	6	0.029443	yes	ADPVSC
chr1_1384749_C_G_b38	ATAD3C	2.713	0.00696	0.066066	35	0.024352	yes	ADPVSC
chr1_1387763_CCT_C_b38	ATAD3C	2.713	0.00696	0.066066	35	0.024352	yes	ADPVSC
chr1_1388944_G_A_b38	ATAD3C	2.713	0.00696	0.066066	35	0.024352	yes	ADPVSC
chr1_1215852_T_C_b38	ATAD3C	-2.711	0.007	-0.064173	15	0.023672	yes	ADPVSC
chr1_1451028_T_A_b38	ATAD3C	-2.709	0.00705	-0.071902	9	0.026545	yes	ADPVSC
chr1_1451787_A_C_b38	ATAD3C	-2.705	0.00711	-0.061408	40	0.022698	yes	ADPVSC
chr1_2369355_G_GAAAA_b38	ATAD3C	-2.704	0.00714	-0.124349	6	0.045981	yes	ADPVSC
chr1_1533883_G_T_b38	ATAD3C	-2.703	0.00717	-0.092087	11	0.034069	yes	ADPVSC
chr1_1559750_C_CAG_b38	ATAD3C	-2.702	0.00719	-0.053324	71	0.019736	yes	ADPVSC
chr1_1561628_T_C_b38	ATAD3C	-2.702	0.00719	-0.053324	71	0.019736	yes	ADPVSC
chr1_1563918_A_G_b38	ATAD3C	-2.702	0.00719	-0.053324	71	0.019736	yes	ADPVSC
chr1_1565561_A_G_b38	ATAD3C	-2.702	0.00719	-0.053324	71	0.019736	yes	ADPVSC
chr1_1567715_G_A_b38	ATAD3C	-2.702	0.00719	-0.053324	71	0.019736	yes	ADPVSC
chr1_1567719_A_C_b38	ATAD3C	-2.702	0.00719	-0.053324	71	0.019736	yes	ADPVSC
chr1_1569875_C_T_b38	ATAD3C	-2.702	0.00719	-0.053324	71	0.019736	yes	ADPVSC
chr1_1572532_A_C_b38	ATAD3C	-2.702	0.00719	-0.053324	71	0.019736	yes	ADPVSC
chr1_1394423_A_G_b38	ATAD3C	-2.698	0.00727	-0.06618	46	0.024528	yes	ADPVSC
chr1_1366776_G_GAATT_b38	ATAD3C	-2.693	0.00738	-0.074784	11	0.027768	yes	ADPVSC
chr1_1366427_AGTGTGATTGAATGAGT_A_b38	ATAD3C	2.689	0.00747	0.063847	34	0.023746	yes	ADPVSC
chr1_1553692_A_G_b38	ATAD3C	-2.685	0.00755	-0.052636	70	0.019601	yes	ADPVSC
chr1_1554852_T_C_b38	ATAD3C	-2.685	0.00755	-0.052636	70	0.019601	yes	ADPVSC
chr1_1555247_T_A_b38	ATAD3C	-2.685	0.00755	-0.052636	70	0.019601	yes	ADPVSC
chr1_1549590_C_G_b38	ATAD3C	-2.684	0.00758	-0.05275	69	0.019654	yes	ADPVSC
chr1_1454848_T_C_b38	ATAD3C	-2.679	0.00769	-0.064478	25	0.024066	yes	ADPVSC
chr1_1316929_A_T_b38	ATAD3C	-2.675	0.00778	-0.074571	12	0.027878	yes	ADPVSC
chr1_1554694_A_G_b38	ATAD3C	-2.661	0.00811	-0.051907	69	0.019507	yes	ADPVSC
chr1_1557495_CAT_C_b38	ATAD3C	-2.66	0.00812	-0.054838	64	0.020614	yes	ADPVSC
chr1_1367047_AGTGTGAAT_A_b38	ATAD3C	-2.641	0.00859	-0.123909	4	0.046918	yes	ADPVSC
chr1_1583688_A_C_b38	ATAD3C	-2.641	0.00859	-0.050616	48	0.019166	yes	ADPVSC
chr1_2401381_C_CTCCTCCCTCCT_b38	ATAD3C	-2.639	0.00865	-0.152664	3	0.057859	yes	ADPVSC
chr1_1469088_T_C_b38	ATAD3C	2.638	0.00868	0.085099	24	0.032263	yes	ADPVSC
chr1_1368177_G_C_b38	ATAD3C	-2.635	0.00873	-0.072148	14	0.027376	yes	ADPVSC
chr1_1573079_A_G_b38	ATAD3C	-2.633	0.0088	-0.051694	70	0.019636	yes	ADPVSC
chr1_1457033_A_C_b38	ATAD3C	-2.632	0.00883	-0.063325	23	0.024063	yes	ADPVSC
chr1_1577491_A_AC_b38	ATAD3C	-2.63	0.00888	-0.052728	67	0.020051	yes	ADPVSC
chr1_1292284_TTGAG_T_b38	ATAD3C	-2.614	0.00929	-0.070459	20	0.026953	yes	ADPVSC
chr1_1417051_CA_C_b38	ATAD3C	-2.61	0.0094	-0.081856	6	0.031363	yes	ADPVSC
chr1_1570294_CA_C_b38	ATAD3C	-2.599	0.0097	-0.053042	65	0.02041	yes	ADPVSC
chr1_1490046_G_A_b38	ATAD3C	3.776	0.000183	0.120276	7	0.03185	no	ADPVSC
chr1_1490047_A_G_b38	ATAD3C	3.776	0.000183	0.120276	7	0.03185	no	ADPVSC
chr1_1213936_C_G_b38	ATAD3C	-3.757	0.000198	-0.16582	3	0.044142	no	ADPVSC
chr1_1489916_C_T_b38	ATAD3C	3.607	0.000349	0.103968	17	0.028823	no	ADPVSC
chr1_1495204_T_C_b38	ATAD3C	3.526	0.000472	0.104666	20	0.029688	no	ADPVSC
chr1_1483898_G_A_b38	ATAD3C	3.292	0.00109	0.100726	28	0.030601	no	ADPVSC
chr1_1486151_C_A_b38	ATAD3C	3.292	0.00109	0.100726	28	0.030601	no	ADPVSC
chr1_1486611_G_A_b38	ATAD3C	3.247	0.00127	0.095059	21	0.029277	no	ADPVSC
chr1_1394041_G_A_b38	ATAD3C	-3.22	0.00139	-0.099791	6	0.030989	no	ADPVSC
chr1_1490027_A_G_b38	ATAD3C	3.199	0.00149	0.095606	23	0.029887	no	ADPVSC
chr1_1490032_A_G_b38	ATAD3C	3.199	0.00149	0.095606	23	0.029887	no	ADPVSC
chr1_1482624_T_C_b38	ATAD3C	3.189	0.00154	0.093344	29	0.029268	no	ADPVSC
chr1_1476266_T_C_b38	ATAD3C	3.163	0.00168	0.093068	29	0.029425	no	ADPVSC
chr1_1650405_G_A_b38	ATAD3C	3.114	0.00198	0.114193	10	0.036669	no	ADPVSC
chr1_1361836_A_G_b38	ATAD3C	3.055	0.0024	0.103952	4	0.034028	no	ADPVSC
chr1_1217733_G_A_b38	ATAD3C	-3.04	0.00252	-0.085595	8	0.028154	no	ADPVSC
chr1_2436424_TCCTTTCTCCCTCCTCCCTTCCTCCCTTCCTCCCTCCACCTTTCCTCCTTCCTCCCTCCTCCCCTCCTCCCTCCTCCTCCTTTCCTCCTTCCTCCCTCCTCCTTTCCTCCTTCCTCCCTCCTC_T_b38	ATAD3C	-3.005	0.00283	-0.153405	5	0.051053	no	ADPVSC
chr1_1403127_C_CAAAAAAA_b38	ATAD3C	2.88	0.00419	0.136685	4	0.047452	no	ADPVSC
chr1_1468592_C_CG_b38	ATAD3C	2.867	0.00437	0.092485	15	0.032262	no	ADPVSC
chr1_1771973_A_AT_b38	ATAD3C	2.821	0.00503	0.072903	44	0.025845	no	ADPVSC
chr1_1468856_C_T_b38	ATAD3C	2.804	0.0053	0.090159	14	0.032158	no	ADPVSC
chr1_1684789_C_CA_b38	ATAD3C	2.731	0.0066	0.099378	12	0.036393	no	ADPVSC
chr1_665761_C_T_b38	ATAD3C	-2.728	0.00665	-0.075828	7	0.027794	no	ADPVSC
chr1_1468094_G_C_b38	ATAD3C	2.695	0.00733	0.091091	11	0.033795	no	ADPVSC
chr1_2200395_C_CA_b38	ATAD3C	-2.685	0.00755	-0.0661	18	0.024616	no	ADPVSC
chr1_1548572_A_AC_b38	ATAD3C	-2.684	0.00758	-0.128116	4	0.047738	no	ADPVSC
chr1_1474201_CT_C_b38	ATAD3C	2.657	0.0082	0.072853	26	0.027417	no	ADPVSC
chr1_2436280_C_T_b38	ATAD3C	-2.657	0.00821	-0.085833	10	0.032307	no	ADPVSC
chr1_1457071_C_T_b38	ATAD3C	-2.634	0.00878	-0.062823	24	0.023855	no	ADPVSC
chr1_1400410_A_G_b38	ATAD3C	-3.889	0.000139	-0.081929	22	0.021067	yes	ADRNLG
chr1_1384749_C_G_b38	ATAD3C	3.824	0.000177	0.080234	22	0.02098	yes	ADRNLG
chr1_1387763_CCT_C_b38	ATAD3C	3.824	0.000177	0.080234	22	0.02098	yes	ADRNLG
chr1_1388944_G_A_b38	ATAD3C	3.824	0.000177	0.080234	22	0.02098	yes	ADRNLG
chr1_1376162_G_C_b38	ATAD3C	3.766	0.00022	0.078689	22	0.020892	yes	ADRNLG
chr1_1377431_C_T_b38	ATAD3C	3.766	0.00022	0.078689	22	0.020892	yes	ADRNLG
chr1_1378204_G_C_b38	ATAD3C	3.766	0.00022	0.078689	22	0.020892	yes	ADRNLG
chr1_1394423_A_G_b38	ATAD3C	-3.528	0.000523	-0.075222	27	0.021319	yes	ADRNLG
chr1_1395346_A_G_b38	ATAD3C	-3.528	0.000523	-0.075222	27	0.021319	yes	ADRNLG
chr1_1402457_A_G_b38	ATAD3C	-3.528	0.000523	-0.075222	27	0.021319	yes	ADRNLG
chr1_1387698_A_G_b38	ATAD3C	3.471	0.00064	0.073774	27	0.021252	yes	ADRNLG
chr1_1389827_C_T_b38	ATAD3C	3.471	0.00064	0.073774	27	0.021252	yes	ADRNLG
chr1_1411323_A_C_b38	ATAD3C	-3.436	0.000725	-0.073112	27	0.021281	yes	ADRNLG
chr1_1366427_AGTGTGATTGAATGAGT_A_b38	ATAD3C	3.398	0.000825	0.067953	23	0.019998	yes	ADRNLG
chr1_1440430_C_G_b38	ATAD3C	-3.261	0.00131	-0.065076	15	0.019953	yes	ADRNLG
chr1_1989523_T_C_b38	ATAD3C	-3.117	0.0021	-0.051404	41	0.016489	yes	ADRNLG
chr1_1379083_AT_A_b38	ATAD3C	3.072	0.00244	0.063161	13	0.02056	yes	ADRNLG
chr1_1366561_AGT_A_b38	ATAD3C	3.068	0.00247	0.061856	29	0.020161	yes	ADRNLG
chr1_1358384_G_C_b38	ATAD3C	3.063	0.00251	0.061873	29	0.020201	yes	ADRNLG
chr1_1991761_T_C_b38	ATAD3C	-3.051	0.00261	-0.050812	33	0.016657	yes	ADRNLG
chr1_1496973_G_A_b38	ATAD3C	-3.033	0.00275	-0.086652	6	0.028567	yes	ADRNLG
chr1_1363456_CAG_C_b38	ATAD3C	3.019	0.00288	0.058518	16	0.019381	yes	ADRNLG
chr1_1312114_T_C_b38	ATAD3C	2.999	0.00306	0.060236	28	0.020083	yes	ADRNLG
chr1_1848356_GC_G_b38	ATAD3C	-2.993	0.00312	-0.062823	7	0.020989	yes	ADRNLG
chr1_1309988_G_A_b38	ATAD3C	2.971	0.00335	0.059477	30	0.020021	yes	ADRNLG
chr1_1330125_G_A_b38	ATAD3C	2.941	0.00368	0.05909	29	0.020095	yes	ADRNLG
chr1_1367292_A_AGT_b38	ATAD3C	2.91	0.00404	0.06351	10	0.021825	yes	ADRNLG
chr1_1374694_C_G_b38	ATAD3C	2.884	0.00438	0.085364	4	0.029603	yes	ADRNLG
chr1_914991_G_T_b38	ATAD3C	-2.863	0.00467	-0.046194	45	0.016136	yes	ADRNLG
chr1_1431014_G_A_b38	ATAD3C	-2.863	0.00467	-0.056311	15	0.019671	yes	ADRNLG
chr1_1369803_C_CT_b38	ATAD3C	-2.857	0.00474	-0.06619	4	0.023165	yes	ADRNLG
chr1_2436406_TCC_T_b38	ATAD3C	-2.823	0.00526	-0.075169	8	0.02663	yes	ADRNLG
chr1_1992226_A_G_b38	ATAD3C	-2.818	0.00533	-0.047091	44	0.016709	yes	ADRNLG
chr1_897018_T_C_b38	ATAD3C	-2.816	0.00538	-0.05169	15	0.018359	yes	ADRNLG
chr1_1308516_C_T_b38	ATAD3C	2.785	0.00588	0.055465	31	0.019914	yes	ADRNLG
chr1_921096_A_G_b38	ATAD3C	2.77	0.00616	0.046078	40	0.016638	yes	ADRNLG
chr1_1948515_C_T_b38	ATAD3C	2.764	0.00626	0.047132	53	0.017051	yes	ADRNLG
chr1_1948519_T_C_b38	ATAD3C	2.764	0.00626	0.047132	53	0.017051	yes	ADRNLG
chr1_1534218_C_G_b38	ATAD3C	-2.757	0.00639	-0.047113	51	0.017087	yes	ADRNLG
chr1_1534219_G_C_b38	ATAD3C	-2.757	0.00639	-0.047113	51	0.017087	yes	ADRNLG
chr1_2436409_TCCCTCCACCTTTCCTCCTTTCTCCCTCCTCCCTTCCTCCCTTCCTCCCTCCACCTTTCCTCCTTCCTCCCTCCTCCCCTCCTCCCTCCTCCTCCTTTCCTCCTTCCTCCCTCCTCCTTTCCTCCTTCCTCCCTCCTCCCTTC_T_b38	ATAD3C	-2.753	0.00647	-0.075934	7	0.027581	yes	ADRNLG
chr1_1519934_T_G_b38	ATAD3C	-2.746	0.0066	-0.053308	31	0.01941	yes	ADRNLG
chr1_1519938_T_C_b38	ATAD3C	-2.746	0.0066	-0.053308	31	0.01941	yes	ADRNLG
chr1_1363898_C_T_b38	ATAD3C	2.736	0.00681	0.060423	10	0.022086	yes	ADRNLG
chr1_1363986_C_T_b38	ATAD3C	2.736	0.00681	0.060423	10	0.022086	yes	ADRNLG
chr1_919397_A_G_b38	ATAD3C	-2.73	0.00692	-0.043789	38	0.016039	yes	ADRNLG
chr1_1971864_C_T_b38	ATAD3C	-2.724	0.00704	-0.042664	45	0.01566	yes	ADRNLG
chr1_919695_C_G_b38	ATAD3C	-2.717	0.0072	-0.043625	38	0.016059	yes	ADRNLG
chr1_915400_C_T_b38	ATAD3C	-2.715	0.00723	-0.044861	45	0.016521	yes	ADRNLG
chr1_1385553_G_A_b38	ATAD3C	2.709	0.00735	0.064745	12	0.023897	yes	ADRNLG
chr1_1361679_G_A_b38	ATAD3C	2.703	0.00749	0.056686	17	0.020973	yes	ADRNLG
chr1_917495_C_T_b38	ATAD3C	-2.692	0.00773	-0.0443	46	0.016456	yes	ADRNLG
chr1_918574_C_A_b38	ATAD3C	-2.692	0.00773	-0.0443	46	0.016456	yes	ADRNLG
chr1_1313807_G_A_b38	ATAD3C	2.683	0.00794	0.05388	30	0.020085	yes	ADRNLG
chr1_1380790_G_A_b38	ATAD3C	2.672	0.00819	0.073206	7	0.027397	yes	ADRNLG
chr1_1459632_T_C_b38	ATAD3C	-2.658	0.00852	-0.080924	12	0.030445	yes	ADRNLG
chr1_1993851_G_A_b38	ATAD3C	2.644	0.00886	0.064308	4	0.024318	yes	ADRNLG
chr1_1367280_T_A_b38	ATAD3C	-2.643	0.00889	-0.066857	5	0.025293	yes	ADRNLG
chr1_1363880_A_G_b38	ATAD3C	-2.639	0.009	-0.066308	5	0.025127	yes	ADRNLG
chr1_1364566_T_C_b38	ATAD3C	-2.636	0.00908	-0.067632	5	0.025658	yes	ADRNLG
chr1_1370113_A_G_b38	ATAD3C	2.631	0.0092	0.052029	21	0.019774	yes	ADRNLG
chr1_1366529_TTAG_T_b38	ATAD3C	2.631	0.0092	0.058065	10	0.022069	yes	ADRNLG
chr1_1366511_GGTGA_G_b38	ATAD3C	-2.623	0.00941	-0.066342	5	0.025292	yes	ADRNLG
chr1_919598_A_C_b38	ATAD3C	-2.616	0.0096	-0.043392	47	0.016587	yes	ADRNLG
chr1_2338570_C_T_b38	ATAD3C	2.615	0.00963	0.042357	32	0.016197	yes	ADRNLG
chr1_2326288_C_T_b38	ATAD3C	2.61	0.00976	0.045745	29	0.017526	yes	ADRNLG
chr1_2326884_C_T_b38	ATAD3C	2.61	0.00976	0.045745	29	0.017526	yes	ADRNLG
chr1_2338460_T_C_b38	ATAD3C	2.607	0.00984	0.042529	32	0.016311	yes	ADRNLG
chr1_1375288_A_C_b38	ATAD3C	2.605	0.00991	0.070835	7	0.027193	yes	ADRNLG
chr1_1375595_C_T_b38	ATAD3C	2.605	0.00991	0.070835	7	0.027193	yes	ADRNLG
chr1_1376092_G_A_b38	ATAD3C	2.605	0.00991	0.070835	7	0.027193	yes	ADRNLG
chr1_1376336_G_A_b38	ATAD3C	2.605	0.00991	0.070835	7	0.027193	yes	ADRNLG
chr1_1379664_G_A_b38	ATAD3C	2.605	0.00991	0.070835	7	0.027193	yes	ADRNLG
chr1_1381268_C_T_b38	ATAD3C	2.605	0.00991	0.070364	7	0.027014	yes	ADRNLG
chr1_1381294_C_T_b38	ATAD3C	2.605	0.00991	0.070364	7	0.027014	yes	ADRNLG
chr1_1990864_C_T_b38	ATAD3C	-3.727	0.000254	-0.05966	45	0.016006	no	ADRNLG
chr1_2338659_A_G_b38	ATAD3C	3.427	0.000747	0.053027	44	0.015474	no	ADRNLG
chr1_2401263_TCCACCCTC_T_b38	ATAD3C	3.276	0.00125	0.121443	6	0.037074	no	ADRNLG
chr1_2327151_A_AACAC_b38	ATAD3C	3.171	0.00177	0.051241	48	0.016158	no	ADRNLG
chr1_2337352_A_G_b38	ATAD3C	3.021	0.00286	0.050177	31	0.016609	no	ADRNLG
chr1_1986752_A_G_b38	ATAD3C	-2.962	0.00345	-0.047212	52	0.015942	no	ADRNLG
chr1_1991835_C_T_b38	ATAD3C	-2.94	0.00369	-0.049649	39	0.01689	no	ADRNLG
chr1_853415_T_TCTGATCAACATGAGATGACCGCCGTGTGGTAAACTGATGAACCCCGACG_b38	ATAD3C	-2.929	0.00381	-0.045321	4	0.015473	no	ADRNLG
chr1_1991213_T_C_b38	ATAD3C	-2.917	0.00395	-0.049068	39	0.01682	no	ADRNLG
chr1_1992242_A_G_b38	ATAD3C	-2.913	0.004	-0.049923	34	0.017136	no	ADRNLG
chr1_1589491_A_G_b38	ATAD3C	2.852	0.00483	0.051331	23	0.018001	no	ADRNLG
chr1_2337239_T_C_b38	ATAD3C	2.837	0.00504	0.052313	18	0.018438	no	ADRNLG
chr1_1987547_C_CT_b38	ATAD3C	-2.828	0.00518	-0.046666	54	0.016502	no	ADRNLG
chr1_1375678_TA_T_b38	ATAD3C	2.774	0.00609	0.056673	13	0.020433	no	ADRNLG
chr1_2324806_A_T_b38	ATAD3C	2.735	0.00683	0.048081	28	0.017582	no	ADRNLG
chr1_1993704_A_AGGGCACAGTGGCTCATGCCTGTAATCCCAGCAACATGGGAGCCTGAGGTGGGAGGCTCTCTTGAGGCCAGGAGTTTGAGACCAGCCTGGGCAACATAGTGAGACCCCCCACCCCCCGCCATTTCTAGGAAAAAAAAAAAAAGTGGCC_b38	ATAD3C	-2.722	0.00708	-0.103158	4	0.037893	no	ADRNLG
chr1_1848358_A_T_b38	ATAD3C	-2.715	0.00723	-0.058251	7	0.021456	no	ADRNLG
chr1_1836856_CT_C_b38	ATAD3C	-2.689	0.00779	-0.060624	9	0.022542	no	ADRNLG
chr1_2337299_A_G_b38	ATAD3C	2.67	0.00823	0.044895	30	0.016813	no	ADRNLG
chr1_1963538_T_C_b38	ATAD3C	-2.642	0.00892	-0.043272	36	0.016377	no	ADRNLG
chr1_822668_A_G_b38	ATAD3C	-2.636	0.00908	-0.066809	3	0.025345	no	ADRNLG
chr1_1533855_G_A_b38	ATAD3C	-2.617	0.00958	-0.062081	3	0.023725	no	ADRNLG
chr1_1963533_C_CA_b38	ATAD3C	-2.613	0.00967	-0.04225	38	0.016166	no	ADRNLG
chr1_1235720_T_G_b38	ATAD3C	3.942	9.95e-05	0.149937	14	0.038036	yes	ARTAORT
chr1_1379091_T_G_b38	ATAD3C	3.921	0.000108	0.108549	14	0.027688	yes	ARTAORT
chr1_1292284_TTGAG_T_b38	ATAD3C	-3.9	0.000118	-0.109359	18	0.028043	yes	ARTAORT
chr1_1440430_C_G_b38	ATAD3C	-3.724	0.000232	-0.095112	22	0.025539	yes	ARTAORT
chr1_1367292_A_AGT_b38	ATAD3C	3.707	0.000248	0.100341	13	0.02707	yes	ARTAORT
chr1_1375678_TA_T_b38	ATAD3C	3.683	0.000272	0.096878	16	0.026307	yes	ARTAORT
chr1_1454612_A_G_b38	ATAD3C	3.643	0.000314	0.193228	4	0.053036	yes	ARTAORT
chr1_1366529_TTAG_T_b38	ATAD3C	3.6	0.000369	0.097778	13	0.027158	yes	ARTAORT
chr1_1454579_T_C_b38	ATAD3C	3.549	0.000446	0.191124	4	0.053856	yes	ARTAORT
chr1_1363898_C_T_b38	ATAD3C	3.544	0.000454	0.096426	13	0.027211	yes	ARTAORT
chr1_1363986_C_T_b38	ATAD3C	3.544	0.000454	0.096426	13	0.027211	yes	ARTAORT
chr1_807641_T_C_b38	ATAD3C	3.516	0.000503	0.08339	18	0.023719	yes	ARTAORT
chr1_1365566_G_A_b38	ATAD3C	3.332	0.000964	0.089972	13	0.027	yes	ARTAORT
chr1_1363456_CAG_C_b38	ATAD3C	3.312	0.00103	0.085186	20	0.02572	yes	ARTAORT
chr1_1383743_T_C_b38	ATAD3C	-3.31	0.00104	-0.101259	9	0.030592	yes	ARTAORT
chr1_1647600_C_G_b38	ATAD3C	3.259	0.00124	0.095377	39	0.029265	yes	ARTAORT
chr1_1375642_C_T_b38	ATAD3C	-3.258	0.00124	-0.099298	9	0.030475	yes	ARTAORT
chr1_1398218_C_A_b38	ATAD3C	-3.254	0.00126	-0.100782	9	0.030976	yes	ARTAORT
chr1_1382893_G_A_b38	ATAD3C	-3.252	0.00127	-0.100415	9	0.030878	yes	ARTAORT
chr1_1316929_A_T_b38	ATAD3C	-3.194	0.00154	-0.097232	7	0.03044	yes	ARTAORT
chr1_1403593_A_G_b38	ATAD3C	-3.194	0.00154	-0.098124	9	0.03072	yes	ARTAORT
chr1_1208816_T_C_b38	ATAD3C	3.174	0.00165	0.127099	3	0.040042	yes	ARTAORT
chr1_1400756_GGA_G_b38	ATAD3C	-3.173	0.00165	-0.097876	9	0.030842	yes	ARTAORT
chr1_1401954_G_T_b38	ATAD3C	-3.173	0.00165	-0.097876	9	0.030842	yes	ARTAORT
chr1_1372258_T_C_b38	ATAD3C	3.165	0.0017	0.127151	3	0.040177	yes	ARTAORT
chr1_1369803_C_CT_b38	ATAD3C	-3.146	0.00181	-0.087626	7	0.02785	yes	ARTAORT
chr1_903551_A_C_b38	ATAD3C	3.14	0.00185	0.091687	5	0.029201	yes	ARTAORT
chr1_1376162_G_C_b38	ATAD3C	3.099	0.00211	0.077358	32	0.024959	yes	ARTAORT
chr1_1377431_C_T_b38	ATAD3C	3.099	0.00211	0.077358	32	0.024959	yes	ARTAORT
chr1_1378204_G_C_b38	ATAD3C	3.089	0.00219	0.076357	31	0.024719	yes	ARTAORT
chr1_1375678_TAA_T_b38	ATAD3C	-3.054	0.00245	-0.082966	10	0.027163	yes	ARTAORT
chr1_1384749_C_G_b38	ATAD3C	3.048	0.0025	0.076385	32	0.025058	yes	ARTAORT
chr1_1387763_CCT_C_b38	ATAD3C	3.048	0.0025	0.076385	32	0.025058	yes	ARTAORT
chr1_1388944_G_A_b38	ATAD3C	3.048	0.0025	0.076385	32	0.025058	yes	ARTAORT
chr1_1469469_G_C_b38	ATAD3C	3.039	0.00257	0.157733	5	0.051906	yes	ARTAORT
chr1_1374505_A_G_b38	ATAD3C	-3.024	0.0027	-0.091878	9	0.030379	yes	ARTAORT
chr1_1468062_A_T_b38	ATAD3C	3.004	0.00288	0.154397	6	0.051404	yes	ARTAORT
chr1_1394041_G_A_b38	ATAD3C	-2.997	0.00294	-0.097037	5	0.032376	yes	ARTAORT
chr1_1379093_TG_T_b38	ATAD3C	-2.985	0.00305	-0.099007	4	0.033163	yes	ARTAORT
chr1_1673968_GA_G_b38	ATAD3C	-2.972	0.00319	-0.070192	33	0.02362	yes	ARTAORT
chr1_1134748_T_G_b38	ATAD3C	-2.947	0.00345	-0.095274	8	0.032327	yes	ARTAORT
chr1_1461283_A_G_b38	ATAD3C	2.944	0.00348	0.154678	6	0.052536	yes	ARTAORT
chr1_1461362_AT_A_b38	ATAD3C	2.944	0.00348	0.154678	6	0.052536	yes	ARTAORT
chr1_1495221_G_A_b38	ATAD3C	2.89	0.00412	0.136616	8	0.047274	yes	ARTAORT
chr1_1495222_T_G_b38	ATAD3C	2.89	0.00412	0.136616	8	0.047274	yes	ARTAORT
chr1_1065530_C_T_b38	ATAD3C	2.881	0.00423	0.098576	3	0.034211	yes	ARTAORT
chr1_860034_T_A_b38	ATAD3C	2.876	0.0043	0.205625	3	0.071494	yes	ARTAORT
chr1_1400410_A_G_b38	ATAD3C	-2.841	0.00479	-0.071423	33	0.025139	yes	ARTAORT
chr1_1304555_A_C_b38	ATAD3C	-2.84	0.00481	-0.08754	5	0.030825	yes	ARTAORT
chr1_1384546_C_T_b38	ATAD3C	-2.814	0.0052	-0.092712	7	0.032944	yes	ARTAORT
chr1_1372909_G_A_b38	ATAD3C	-2.812	0.00523	-0.086794	8	0.030863	yes	ARTAORT
chr1_1468254_T_A_b38	ATAD3C	2.811	0.00524	0.143259	5	0.050959	yes	ARTAORT
chr1_1341550_GCA_G_b38	ATAD3C	-2.808	0.00529	-0.086403	9	0.030767	yes	ARTAORT
chr1_1361679_G_A_b38	ATAD3C	2.807	0.00532	0.075923	23	0.027052	yes	ARTAORT
chr1_1373007_G_A_b38	ATAD3C	-2.8	0.00543	-0.087891	7	0.031392	yes	ARTAORT
chr1_1677720_T_G_b38	ATAD3C	-2.793	0.00554	-0.052136	91	0.018667	yes	ARTAORT
chr1_1677726_A_T_b38	ATAD3C	-2.793	0.00555	-0.052276	91	0.018719	yes	ARTAORT
chr1_1303112_G_A_b38	ATAD3C	-2.788	0.00563	-0.085349	5	0.030618	yes	ARTAORT
chr1_1380867_A_G_b38	ATAD3C	-2.774	0.00586	-0.090301	7	0.03255	yes	ARTAORT
chr1_1676790_C_T_b38	ATAD3C	-2.772	0.00591	-0.050917	92	0.01837	yes	ARTAORT
chr1_1363688_C_T_b38	ATAD3C	-2.764	0.00604	-0.082294	9	0.029771	yes	ARTAORT
chr1_1364099_CCA_C_b38	ATAD3C	-2.764	0.00604	-0.082294	9	0.029771	yes	ARTAORT
chr1_1364102_TGTTG_T_b38	ATAD3C	-2.764	0.00604	-0.082294	9	0.029771	yes	ARTAORT
chr1_1368763_G_A_b38	ATAD3C	-2.764	0.00604	-0.082294	9	0.029771	yes	ARTAORT
chr1_1460858_G_T_b38	ATAD3C	2.752	0.00626	0.152125	4	0.055275	yes	ARTAORT
chr1_1460958_G_A_b38	ATAD3C	2.752	0.00626	0.152125	4	0.055275	yes	ARTAORT
chr1_1364253_C_G_b38	ATAD3C	-2.747	0.00636	-0.08326	9	0.030311	yes	ARTAORT
chr1_1366830_G_A_b38	ATAD3C	-2.745	0.00639	-0.088662	6	0.032295	yes	ARTAORT
chr1_870176_T_A_b38	ATAD3C	-2.744	0.00641	-0.099888	3	0.036397	yes	ARTAORT
chr1_1366511_GGTGA_G_b38	ATAD3C	-2.74	0.00649	-0.081663	9	0.029804	yes	ARTAORT
chr1_1366427_AGTGTGATTGAATGAGT_A_b38	ATAD3C	2.735	0.00659	0.069479	31	0.025406	yes	ARTAORT
chr1_1671097_G_C_b38	ATAD3C	-2.732	0.00664	-0.05833	39	0.021347	yes	ARTAORT
chr1_1664757_T_C_b38	ATAD3C	2.731	0.00666	0.056022	35	0.020511	yes	ARTAORT
chr1_1366828_A_G_b38	ATAD3C	-2.729	0.00671	-0.088121	6	0.032292	yes	ARTAORT
chr1_1650195_A_G_b38	ATAD3C	2.727	0.00674	0.058929	36	0.021608	yes	ARTAORT
chr1_1673818_A_C_b38	ATAD3C	-2.72	0.00689	-0.05165	90	0.018989	yes	ARTAORT
chr1_1671995_G_T_b38	ATAD3C	-2.716	0.00696	-0.05107	89	0.018801	yes	ARTAORT
chr1_2448062_C_G_b38	ATAD3C	-2.715	0.00699	-0.063429	19	0.023361	yes	ARTAORT
chr1_1370553_CAAA_C_b38	ATAD3C	-2.711	0.00708	-0.085277	6	0.031461	yes	ARTAORT
chr1_2327229_GACACAGAAAC_G_b38	ATAD3C	2.7	0.0073	0.056248	34	0.020831	yes	ARTAORT
chr1_1373006_G_A_b38	ATAD3C	-2.696	0.0074	-0.08592	5	0.031875	yes	ARTAORT
chr1_1407565_C_A_b38	ATAD3C	-2.694	0.00745	-0.089234	7	0.033129	yes	ARTAORT
chr1_1366835_G_GGTGA_b38	ATAD3C	-2.689	0.00755	-0.086882	6	0.032314	yes	ARTAORT
chr1_1431014_G_A_b38	ATAD3C	-2.684	0.00767	-0.067503	21	0.025154	yes	ARTAORT
chr1_1591703_T_C_b38	ATAD3C	-2.666	0.00808	-0.050741	73	0.019034	yes	ARTAORT
chr1_1671148_C_T_b38	ATAD3C	-2.655	0.00833	-0.056459	38	0.021266	yes	ARTAORT
chr1_1370532_C_T_b38	ATAD3C	-2.655	0.00834	-0.077719	10	0.029274	yes	ARTAORT
chr1_1461760_C_A_b38	ATAD3C	2.653	0.00838	0.123914	9	0.046707	yes	ARTAORT
chr1_1674868_G_A_b38	ATAD3C	-2.646	0.00855	-0.049948	89	0.018875	yes	ARTAORT
chr1_1443457_T_C_b38	ATAD3C	-2.646	0.00856	-0.06745	41	0.025495	yes	ARTAORT
chr1_1369407_G_A_b38	ATAD3C	-2.617	0.00931	-0.077319	8	0.02955	yes	ARTAORT
chr1_1367280_T_A_b38	ATAD3C	-2.61	0.0095	-0.07712	9	0.029553	yes	ARTAORT
chr1_1747690_A_G_b38	ATAD3C	2.598	0.00981	0.135332	5	0.052088	yes	ARTAORT
chr1_1641819_C_T_b38	ATAD3C	2.593	0.00995	0.070453	13	0.02717	yes	ARTAORT
chr1_1948594_G_GT_b38	ATAD3C	3.886	0.000124	0.239134	3	0.061536	no	ARTAORT
chr1_1458730_G_GTT_b38	ATAD3C	3.61	0.000356	0.195626	4	0.054197	no	ARTAORT
chr1_1055307_G_A_b38	ATAD3C	3.122	0.00196	0.224253	3	0.07182	no	ARTAORT
chr1_1454581_T_C_b38	ATAD3C	3.045	0.00252	0.163078	4	0.05355	no	ARTAORT
chr1_1454582_A_C_b38	ATAD3C	3.045	0.00252	0.163078	4	0.05355	no	ARTAORT
chr1_1454587_T_C_b38	ATAD3C	3.045	0.00252	0.163078	4	0.05355	no	ARTAORT
chr1_1355705_C_T_b38	ATAD3C	3.012	0.00281	0.150212	3	0.049877	no	ARTAORT
chr1_1461767_A_G_b38	ATAD3C	2.968	0.00322	0.146277	9	0.049277	no	ARTAORT
chr1_1374694_C_G_b38	ATAD3C	2.946	0.00346	0.113158	5	0.038414	no	ARTAORT
chr1_857828_C_G_b38	ATAD3C	-2.922	0.00372	-0.0701	47	0.023987	no	ARTAORT
chr1_1454676_T_A_b38	ATAD3C	2.9	0.00399	0.161447	3	0.055666	no	ARTAORT
chr1_1455134_T_A_b38	ATAD3C	2.9	0.00399	0.161447	3	0.055666	no	ARTAORT
chr1_1457922_T_C_b38	ATAD3C	2.898	0.00401	0.136938	9	0.047247	no	ARTAORT
chr1_1232800_G_C_b38	ATAD3C	2.881	0.00423	0.112098	9	0.038903	no	ARTAORT
chr1_1102614_TAAAAAAAAA_T_b38	ATAD3C	2.834	0.00489	0.145125	6	0.051204	no	ARTAORT
chr1_1217733_G_A_b38	ATAD3C	-2.832	0.00493	-0.084297	7	0.029768	no	ARTAORT
chr1_1527957_C_T_b38	ATAD3C	-2.798	0.00545	-0.141783	6	0.050665	no	ARTAORT
chr1_2056929_C_G_b38	ATAD3C	2.792	0.00555	0.175731	6	0.06293	no	ARTAORT
chr1_1335073_C_T_b38	ATAD3C	2.792	0.00557	0.120435	4	0.043143	no	ARTAORT
chr1_1340336_T_A_b38	ATAD3C	2.792	0.00557	0.120435	4	0.043143	no	ARTAORT
chr1_1340746_G_GCA_b38	ATAD3C	2.792	0.00557	0.120435	4	0.043143	no	ARTAORT
chr1_1340983_T_C_b38	ATAD3C	2.792	0.00557	0.120435	4	0.043143	no	ARTAORT
chr1_1342269_G_T_b38	ATAD3C	2.792	0.00557	0.120435	4	0.043143	no	ARTAORT
chr1_1357006_CA_C_b38	ATAD3C	2.762	0.00609	0.120576	4	0.043661	no	ARTAORT
chr1_2055016_C_T_b38	ATAD3C	2.695	0.00741	0.163602	6	0.060705	no	ARTAORT
chr1_1458448_C_CT_b38	ATAD3C	2.687	0.00758	0.119344	5	0.044409	no	ARTAORT
chr1_1168578_T_G_b38	ATAD3C	-2.665	0.0081	-0.094326	4	0.035399	no	ARTAORT
chr1_1360901_TAC_T_b38	ATAD3C	2.647	0.00854	0.115149	4	0.043507	no	ARTAORT
chr1_1343267_C_A_b38	ATAD3C	2.64	0.00871	0.112925	4	0.04278	no	ARTAORT
chr1_1164837_C_T_b38	ATAD3C	-2.626	0.00906	-0.09537	5	0.036316	no	ARTAORT
chr1_1459273_T_C_b38	ATAD3C	2.62	0.00921	0.136094	6	0.051937	no	ARTAORT
chr1_1459283_AC_A_b38	ATAD3C	2.62	0.00921	0.136094	6	0.051937	no	ARTAORT
chr1_1402944_C_T_b38	ATAD3C	2.62	0.00922	0.113806	6	0.043438	no	ARTAORT
chr1_1165623_C_T_b38	ATAD3C	-2.615	0.00936	-0.092673	5	0.035442	no	ARTAORT
chr1_1992764_A_G_b38	ATAD3C	2.613	0.0094	0.180008	4	0.068889	no	ARTAORT
chr1_1056491_G_C_b38	ATAD3C	2.596	0.00987	0.182751	3	0.070391	no	ARTAORT
chr1_1428969_T_C_b38	ATAD3C	-4.547	1.02e-05	-0.186834	26	0.041088	yes	ARTCRN
chr1_1438102_G_C_b38	ATAD3C	-4.373	2.12e-05	-0.189149	9	0.043255	yes	ARTCRN
chr1_1445187_T_G_b38	ATAD3C	-4.308	2.76e-05	-0.175412	21	0.040716	yes	ARTCRN
chr1_1440430_C_G_b38	ATAD3C	-4.273	3.18e-05	-0.177213	11	0.04147	yes	ARTCRN
chr1_1443457_T_C_b38	ATAD3C	-4.013	8.92e-05	-0.168575	25	0.042003	yes	ARTCRN
chr1_1430908_A_G_b38	ATAD3C	-3.952	0.000113	-0.164327	26	0.041575	yes	ARTCRN
chr1_1440834_C_G_b38	ATAD3C	-3.935	0.000121	-0.163797	24	0.041629	yes	ARTCRN
chr1_1430190_A_C_b38	ATAD3C	-3.883	0.000147	-0.161625	26	0.041624	yes	ARTCRN
chr1_1426261_C_T_b38	ATAD3C	-3.866	0.000157	-0.160104	25	0.041418	yes	ARTCRN
chr1_1426810_C_G_b38	ATAD3C	-3.866	0.000157	-0.160104	25	0.041418	yes	ARTCRN
chr1_1431026_CCACCCCCT_C_b38	ATAD3C	-3.857	0.000162	-0.164044	15	0.042531	yes	ARTCRN
chr1_1433374_T_C_b38	ATAD3C	-3.85	0.000166	-0.162821	26	0.04229	yes	ARTCRN
chr1_1448915_G_A_b38	ATAD3C	-3.822	0.000185	-0.15692	14	0.041059	yes	ARTCRN
chr1_1431450_A_G_b38	ATAD3C	-3.794	0.000205	-0.15868	26	0.041827	yes	ARTCRN
chr1_1431537_G_C_b38	ATAD3C	-3.794	0.000205	-0.15868	26	0.041827	yes	ARTCRN
chr1_1432355_G_A_b38	ATAD3C	-3.737	0.000253	-0.15507	10	0.041494	yes	ARTCRN
chr1_1442793_G_A_b38	ATAD3C	-3.712	0.000277	-0.177973	5	0.04794	yes	ARTCRN
chr1_1445240_A_G_b38	ATAD3C	-3.676	0.000316	-0.155614	24	0.04233	yes	ARTCRN
chr1_1434687_C_G_b38	ATAD3C	-3.607	0.000406	-0.1807	5	0.0501	yes	ARTCRN
chr1_1439454_A_G_b38	ATAD3C	-3.605	0.000409	-0.142534	24	0.039539	yes	ARTCRN
chr1_1435945_C_CCGGGCGGGGGCG_b38	ATAD3C	-3.509	0.000574	-0.17597	5	0.050146	yes	ARTCRN
chr1_1241053_A_G_b38	ATAD3C	-3.492	0.000609	-0.16704	6	0.04783	yes	ARTCRN
chr1_1431813_G_T_b38	ATAD3C	-3.464	0.000671	-0.152542	7	0.044033	yes	ARTCRN
chr1_1436079_A_G_b38	ATAD3C	-3.459	0.000685	-0.146203	25	0.042273	yes	ARTCRN
chr1_1426253_G_A_b38	ATAD3C	-3.432	0.000752	-0.162812	5	0.047446	yes	ARTCRN
chr1_1241639_T_C_b38	ATAD3C	-3.296	0.00119	-0.160106	6	0.048578	yes	ARTCRN
chr1_1242094_A_G_b38	ATAD3C	-3.296	0.00119	-0.160106	6	0.048578	yes	ARTCRN
chr1_1242250_A_G_b38	ATAD3C	-3.296	0.00119	-0.160106	6	0.048578	yes	ARTCRN
chr1_1201373_T_C_b38	ATAD3C	-3.213	0.00157	-0.135004	13	0.042021	yes	ARTCRN
chr1_1337898_A_G_b38	ATAD3C	3.153	0.00191	0.121657	10	0.038588	yes	ARTCRN
chr1_1441187_A_G_b38	ATAD3C	-3.142	0.00198	-0.139069	13	0.044266	yes	ARTCRN
chr1_1431656_G_A_b38	ATAD3C	-3.118	0.00213	-0.155007	5	0.049711	yes	ARTCRN
chr1_1242865_C_T_b38	ATAD3C	-3.097	0.00228	-0.149145	7	0.048161	yes	ARTCRN
chr1_1288341_C_T_b38	ATAD3C	-3.036	0.00277	-0.197639	3	0.065106	yes	ARTCRN
chr1_1251618_G_A_b38	ATAD3C	-2.962	0.00349	-0.138844	6	0.046878	yes	ARTCRN
chr1_1388565_GTC_G_b38	ATAD3C	2.957	0.00354	0.115047	13	0.038906	yes	ARTCRN
chr1_1192301_G_A_b38	ATAD3C	2.902	0.0042	0.15282	3	0.052668	yes	ARTCRN
chr1_1199253_C_T_b38	ATAD3C	2.882	0.00445	0.143015	4	0.049621	yes	ARTCRN
chr1_1217251_C_A_b38	ATAD3C	-2.878	0.00451	-0.141753	6	0.049257	yes	ARTCRN
chr1_1436388_CA_C_b38	ATAD3C	-2.807	0.00558	-0.122586	13	0.043675	yes	ARTCRN
chr1_1734812_G_A_b38	ATAD3C	2.788	0.00591	0.116044	19	0.04163	yes	ARTCRN
chr1_1229369_G_GC_b38	ATAD3C	-2.778	0.00608	-0.115609	12	0.041621	yes	ARTCRN
chr1_1244603_G_A_b38	ATAD3C	-2.769	0.00624	-0.13765	5	0.049713	yes	ARTCRN
chr1_1197405_C_T_b38	ATAD3C	2.75	0.00659	0.143471	3	0.052167	yes	ARTCRN
chr1_1197586_C_A_b38	ATAD3C	2.75	0.00659	0.143471	3	0.052167	yes	ARTCRN
chr1_1835922_G_GA_b38	ATAD3C	-2.741	0.00677	-0.134143	10	0.04894	yes	ARTCRN
chr1_1197874_G_A_b38	ATAD3C	2.73	0.007	0.143991	3	0.052749	yes	ARTCRN
chr1_1199327_G_A_b38	ATAD3C	2.716	0.00728	0.142636	3	0.052517	yes	ARTCRN
chr1_1243102_A_G_b38	ATAD3C	-2.703	0.00757	-0.131153	8	0.048529	yes	ARTCRN
chr1_1306523_C_G_b38	ATAD3C	2.692	0.00781	0.133206	11	0.049483	yes	ARTCRN
chr1_1241217_T_C_b38	ATAD3C	-2.679	0.0081	-0.127897	8	0.04774	yes	ARTCRN
chr1_1215852_T_C_b38	ATAD3C	-2.651	0.00877	-0.108483	10	0.040918	yes	ARTCRN
chr1_1196061_C_T_b38	ATAD3C	2.65	0.00879	0.14001	3	0.052828	yes	ARTCRN
chr1_1439805_G_C_b38	ATAD3C	-2.647	0.00888	-0.124601	6	0.047078	yes	ARTCRN
chr1_2120839_CT_C_b38	ATAD3C	2.635	0.00919	0.112101	17	0.042551	yes	ARTCRN
chr1_1186644_T_C_b38	ATAD3C	2.618	0.00965	0.136626	3	0.052196	yes	ARTCRN
chr1_1186816_A_G_b38	ATAD3C	2.618	0.00965	0.136626	3	0.052196	yes	ARTCRN
chr1_1186939_C_T_b38	ATAD3C	2.618	0.00965	0.136626	3	0.052196	yes	ARTCRN
chr1_1187136_G_A_b38	ATAD3C	2.618	0.00965	0.136626	3	0.052196	yes	ARTCRN
chr1_1187726_G_A_b38	ATAD3C	2.618	0.00965	0.136626	3	0.052196	yes	ARTCRN
chr1_1188877_A_G_b38	ATAD3C	2.618	0.00965	0.136626	3	0.052196	yes	ARTCRN
chr1_1189019_C_G_b38	ATAD3C	2.618	0.00965	0.136626	3	0.052196	yes	ARTCRN
chr1_1189511_G_A_b38	ATAD3C	2.618	0.00965	0.136626	3	0.052196	yes	ARTCRN
chr1_1189968_T_C_b38	ATAD3C	2.618	0.00965	0.136626	3	0.052196	yes	ARTCRN
chr1_1190856_G_A_b38	ATAD3C	2.618	0.00965	0.136626	3	0.052196	yes	ARTCRN
chr1_1190875_G_C_b38	ATAD3C	2.618	0.00965	0.136626	3	0.052196	yes	ARTCRN
chr1_1191614_G_A_b38	ATAD3C	2.618	0.00965	0.136626	3	0.052196	yes	ARTCRN
chr1_1191942_G_A_b38	ATAD3C	2.618	0.00965	0.136626	3	0.052196	yes	ARTCRN
chr1_1192000_G_A_b38	ATAD3C	2.618	0.00965	0.136626	3	0.052196	yes	ARTCRN
chr1_1192127_G_A_b38	ATAD3C	2.618	0.00965	0.136626	3	0.052196	yes	ARTCRN
chr1_1192143_C_T_b38	ATAD3C	2.618	0.00965	0.136626	3	0.052196	yes	ARTCRN
chr1_1192951_G_T_b38	ATAD3C	2.618	0.00965	0.136626	3	0.052196	yes	ARTCRN
chr1_1193049_G_A_b38	ATAD3C	2.618	0.00965	0.136626	3	0.052196	yes	ARTCRN
chr1_1194292_G_T_b38	ATAD3C	2.618	0.00965	0.136626	3	0.052196	yes	ARTCRN
chr1_1194327_A_G_b38	ATAD3C	2.618	0.00965	0.136626	3	0.052196	yes	ARTCRN
chr1_1194713_C_T_b38	ATAD3C	2.618	0.00965	0.136626	3	0.052196	yes	ARTCRN
chr1_1379091_T_G_b38	ATAD3C	4.439	1.61e-05	0.216478	6	0.048766	no	ARTCRN
chr1_1383743_T_C_b38	ATAD3C	-4.27	3.23e-05	-0.233779	4	0.054749	no	ARTCRN
chr1_1398218_C_A_b38	ATAD3C	-4.197	4.32e-05	-0.231177	4	0.055078	no	ARTCRN
chr1_1400756_GGA_G_b38	ATAD3C	-4.197	4.32e-05	-0.231177	4	0.055078	no	ARTCRN
chr1_1401954_G_T_b38	ATAD3C	-4.197	4.32e-05	-0.231177	4	0.055078	no	ARTCRN
chr1_1403593_A_G_b38	ATAD3C	-4.197	4.32e-05	-0.231177	4	0.055078	no	ARTCRN
chr1_1387698_A_G_b38	ATAD3C	4.106	6.22e-05	0.179564	27	0.043734	no	ARTCRN
chr1_1389827_C_T_b38	ATAD3C	4.106	6.22e-05	0.179564	27	0.043734	no	ARTCRN
chr1_1372909_G_A_b38	ATAD3C	-3.977	0.000103	-0.222288	4	0.055889	no	ARTCRN
chr1_1378204_G_C_b38	ATAD3C	3.918	0.000129	0.166106	18	0.042394	no	ARTCRN
chr1_1384546_C_T_b38	ATAD3C	-3.879	0.000149	-0.224576	4	0.057902	no	ARTCRN
chr1_1375642_C_T_b38	ATAD3C	-3.867	0.000156	-0.204653	5	0.052921	no	ARTCRN
chr1_1384749_C_G_b38	ATAD3C	3.854	0.000164	0.160643	20	0.041684	no	ARTCRN
chr1_1387763_CCT_C_b38	ATAD3C	3.854	0.000164	0.160643	20	0.041684	no	ARTCRN
chr1_1388944_G_A_b38	ATAD3C	3.854	0.000164	0.160643	20	0.041684	no	ARTCRN
chr1_1374505_A_G_b38	ATAD3C	-3.842	0.000171	-0.203424	5	0.052945	no	ARTCRN
chr1_1394423_A_G_b38	ATAD3C	-3.802	0.000199	-0.169868	27	0.044675	no	ARTCRN
chr1_1407565_C_A_b38	ATAD3C	-3.794	0.000205	-0.220658	4	0.058156	no	ARTCRN
chr1_1370113_A_G_b38	ATAD3C	3.763	0.00023	0.150693	24	0.040047	no	ARTCRN
chr1_1382893_G_A_b38	ATAD3C	-3.756	0.000236	-0.207296	4	0.055185	no	ARTCRN
chr1_1376162_G_C_b38	ATAD3C	3.715	0.000275	0.155845	20	0.041952	no	ARTCRN
chr1_1377431_C_T_b38	ATAD3C	3.715	0.000275	0.155845	20	0.041952	no	ARTCRN
chr1_1411323_A_C_b38	ATAD3C	-3.707	0.000283	-0.165242	28	0.044579	no	ARTCRN
chr1_1395346_A_G_b38	ATAD3C	-3.693	0.000298	-0.163837	27	0.044367	no	ARTCRN
chr1_1402457_A_G_b38	ATAD3C	-3.693	0.000298	-0.163837	27	0.044367	no	ARTCRN
chr1_1380867_A_G_b38	ATAD3C	-3.666	0.000328	-0.209474	4	0.057143	no	ARTCRN
chr1_1373006_G_A_b38	ATAD3C	-3.661	0.000335	-0.20637	4	0.056377	no	ARTCRN
chr1_1373007_G_A_b38	ATAD3C	-3.661	0.000335	-0.20637	4	0.056377	no	ARTCRN
chr1_1366561_AGT_A_b38	ATAD3C	3.657	0.000339	0.156315	28	0.042744	no	ARTCRN
chr1_1292284_TTGAG_T_b38	ATAD3C	-3.645	0.000354	-0.168401	10	0.046204	no	ARTCRN
chr1_1341550_GCA_G_b38	ATAD3C	-3.623	0.000384	-0.187497	5	0.051757	no	ARTCRN
chr1_1358384_G_C_b38	ATAD3C	3.611	4e-04	0.153843	28	0.042602	no	ARTCRN
chr1_1379083_AT_A_b38	ATAD3C	3.608	0.000405	0.147487	12	0.040883	no	ARTCRN
chr1_1379093_TG_T_b38	ATAD3C	-3.592	0.000428	-0.208505	3	0.058048	no	ARTCRN
chr1_1308516_C_T_b38	ATAD3C	3.513	0.000566	0.153207	29	0.043608	no	ARTCRN
chr1_1400410_A_G_b38	ATAD3C	-3.47	0.000658	-0.145937	19	0.042055	no	ARTCRN
chr1_1312114_T_C_b38	ATAD3C	3.332	0.00106	0.143876	26	0.04318	no	ARTCRN
chr1_1364253_C_G_b38	ATAD3C	-3.323	0.00109	-0.172404	4	0.051888	no	ARTCRN
chr1_1330125_G_A_b38	ATAD3C	3.27	0.0013	0.13968	28	0.042716	no	ARTCRN
chr1_1367292_A_AGT_b38	ATAD3C	3.268	0.00131	0.150465	7	0.046037	no	ARTCRN
chr1_1313807_G_A_b38	ATAD3C	3.266	0.00132	0.135677	29	0.041541	no	ARTCRN
chr1_1309988_G_A_b38	ATAD3C	3.237	0.00145	0.134971	29	0.041697	no	ARTCRN
chr1_1366427_AGTGTGATTGAATGAGT_A_b38	ATAD3C	3.211	0.00158	0.132095	20	0.041133	no	ARTCRN
chr1_1407232_G_C_b38	ATAD3C	-3.195	0.00166	-0.15371	7	0.048109	no	ARTCRN
chr1_1363898_C_T_b38	ATAD3C	3.181	0.00174	0.148479	7	0.046673	no	ARTCRN
chr1_1363986_C_T_b38	ATAD3C	3.181	0.00174	0.148479	7	0.046673	no	ARTCRN
chr1_1366529_TTAG_T_b38	ATAD3C	3.181	0.00174	0.148479	7	0.046673	no	ARTCRN
chr1_1365566_G_A_b38	ATAD3C	3.166	0.00183	0.145426	7	0.045929	no	ARTCRN
chr1_1836387_CTT_C_b38	ATAD3C	3.138	0.002	0.126375	16	0.04027	no	ARTCRN
chr1_1225476_T_C_b38	ATAD3C	-3.133	0.00203	-0.161888	3	0.051664	no	ARTCRN
chr1_1226013_C_T_b38	ATAD3C	-3.133	0.00203	-0.161888	3	0.051664	no	ARTCRN
chr1_1366941_T_TGTGTGCA_b38	ATAD3C	3.035	0.00278	0.157829	6	0.052002	no	ARTCRN
chr1_1366951_A_AGT_b38	ATAD3C	3.035	0.00278	0.157829	6	0.052002	no	ARTCRN
chr1_1248597_A_C_b38	ATAD3C	-3	0.0031	-0.134764	5	0.044927	no	ARTCRN
chr1_1316929_A_T_b38	ATAD3C	-2.978	0.00332	-0.156219	4	0.052458	no	ARTCRN
chr1_1344048_G_A_b38	ATAD3C	-2.968	0.00342	-0.162585	4	0.054777	no	ARTCRN
chr1_1361679_G_A_b38	ATAD3C	2.931	0.00384	0.136806	14	0.046681	no	ARTCRN
chr1_1235602_C_A_b38	ATAD3C	-2.908	0.00412	-0.144655	3	0.049751	no	ARTCRN
chr1_1290968_C_G_b38	ATAD3C	-2.907	0.00413	-0.132751	18	0.045661	no	ARTCRN
chr1_1573429_C_CA_b38	ATAD3C	2.871	0.00461	0.205391	4	0.071545	no	ARTCRN
chr1_1370430_T_C_b38	ATAD3C	-2.862	0.00473	-0.142595	6	0.04982	no	ARTCRN
chr1_1370584_G_C_b38	ATAD3C	-2.862	0.00473	-0.142595	6	0.04982	no	ARTCRN
chr1_1226486_C_T_b38	ATAD3C	-2.808	0.00556	-0.125837	6	0.044811	no	ARTCRN
chr1_1945842_A_AAAAGAAC_b38	ATAD3C	-2.808	0.00557	-0.102458	39	0.036493	no	ARTCRN
chr1_1991116_A_G_b38	ATAD3C	-2.805	0.00561	-0.247984	3	0.088402	no	ARTCRN
chr1_1366187_A_AGT_b38	ATAD3C	-2.798	0.00572	-0.138866	5	0.049627	no	ARTCRN
chr1_2369355_G_GA_b38	ATAD3C	2.789	0.00589	0.105329	15	0.037768	no	ARTCRN
chr1_1670423_AT_A_b38	ATAD3C	-2.787	0.00593	-0.105064	23	0.037704	no	ARTCRN
chr1_1231710_CCCCCGGGAA_C_b38	ATAD3C	-2.782	0.006	-0.123951	8	0.04455	no	ARTCRN
chr1_1367028_A_G_b38	ATAD3C	2.782	0.006	0.144244	6	0.051844	no	ARTCRN
chr1_1329973_GCGTGTGCCATGCA_G_b38	ATAD3C	-2.782	0.00601	-0.153781	4	0.055277	no	ARTCRN
chr1_1363456_CAG_C_b38	ATAD3C	2.765	0.00631	0.114035	13	0.04124	no	ARTCRN
chr1_1606099_G_C_b38	ATAD3C	-2.706	0.0075	-0.131672	6	0.048662	no	ARTCRN
chr1_1364566_T_C_b38	ATAD3C	-2.698	0.00767	-0.136461	4	0.050579	no	ARTCRN
chr1_1185961_C_T_b38	ATAD3C	2.69	0.00785	0.131332	4	0.048819	no	ARTCRN
chr1_1186245_C_G_b38	ATAD3C	2.69	0.00785	0.131332	4	0.048819	no	ARTCRN
chr1_1368177_G_C_b38	ATAD3C	-2.682	0.00803	-0.136124	6	0.050756	no	ARTCRN
chr1_1186414_G_A_b38	ATAD3C	2.679	0.00811	0.130976	4	0.048898	no	ARTCRN
chr1_1370532_C_T_b38	ATAD3C	-2.673	0.00823	-0.129103	7	0.048291	no	ARTCRN
chr1_2142322_CAGCAGCCGAAGCGCCTCCTTTCAATCCAGGGTCCACACATCCAGCAGCCGAAGCGCCCTCCTTTCAATCCAGGGTCCAGGCATCT_C_b38	ATAD3C	-2.671	0.00828	-0.189881	3	0.071077	no	ARTCRN
chr1_1571986_G_A_b38	ATAD3C	-2.665	0.00842	-0.098144	24	0.036822	no	ARTCRN
chr1_1367280_T_A_b38	ATAD3C	-2.652	0.00874	-0.132988	5	0.050137	no	ARTCRN
chr1_1363880_A_G_b38	ATAD3C	-2.65	0.00879	-0.131751	5	0.049709	no	ARTCRN
chr1_1363688_C_T_b38	ATAD3C	-2.646	0.0089	-0.132783	5	0.05018	no	ARTCRN
chr1_1364099_CCA_C_b38	ATAD3C	-2.646	0.0089	-0.132783	5	0.05018	no	ARTCRN
chr1_1364102_TGTTG_T_b38	ATAD3C	-2.646	0.0089	-0.132783	5	0.05018	no	ARTCRN
chr1_1366511_GGTGA_G_b38	ATAD3C	-2.646	0.0089	-0.132783	5	0.05018	no	ARTCRN
chr1_1368763_G_A_b38	ATAD3C	-2.646	0.0089	-0.132783	5	0.05018	no	ARTCRN
chr1_1560765_T_C_b38	ATAD3C	-2.641	0.00903	-0.100769	27	0.038158	no	ARTCRN
chr1_1562261_TTTTC_T_b38	ATAD3C	-2.641	0.00903	-0.100769	27	0.038158	no	ARTCRN
chr1_1364282_T_G_b38	ATAD3C	-2.619	0.00959	-0.131241	5	0.050102	no	ARTCRN
chr1_1364357_A_C_b38	ATAD3C	-2.619	0.00959	-0.131241	5	0.050102	no	ARTCRN
chr1_1364694_T_C_b38	ATAD3C	-2.619	0.00959	-0.131241	5	0.050102	no	ARTCRN
chr1_1364721_C_T_b38	ATAD3C	-2.619	0.00959	-0.131241	5	0.050102	no	ARTCRN
chr1_1365160_A_G_b38	ATAD3C	-2.619	0.00959	-0.131241	5	0.050102	no	ARTCRN
chr1_1365198_C_T_b38	ATAD3C	-2.619	0.00959	-0.131241	5	0.050102	no	ARTCRN
chr1_1366008_A_G_b38	ATAD3C	-2.619	0.00959	-0.131241	5	0.050102	no	ARTCRN
chr1_1366062_T_C_b38	ATAD3C	-2.619	0.00959	-0.131241	5	0.050102	no	ARTCRN
chr1_1366145_TGTGAA_T_b38	ATAD3C	-2.619	0.00959	-0.131241	5	0.050102	no	ARTCRN
chr1_1366453_G_T_b38	ATAD3C	-2.619	0.00959	-0.131241	5	0.050102	no	ARTCRN
chr1_1366726_T_G_b38	ATAD3C	-2.619	0.00959	-0.131241	5	0.050102	no	ARTCRN
chr1_1367258_T_A_b38	ATAD3C	-2.619	0.00959	-0.131241	5	0.050102	no	ARTCRN
chr1_1367297_GAA_G_b38	ATAD3C	-2.619	0.00959	-0.131241	5	0.050102	no	ARTCRN
chr1_1367300_T_TGA_b38	ATAD3C	-2.619	0.00959	-0.131241	5	0.050102	no	ARTCRN
chr1_1367329_A_AGT_b38	ATAD3C	-2.619	0.00959	-0.131241	5	0.050102	no	ARTCRN
chr1_1367373_T_TGTG_b38	ATAD3C	-2.619	0.00959	-0.131241	5	0.050102	no	ARTCRN
chr1_1367388_T_TTGG_b38	ATAD3C	-2.619	0.00959	-0.131241	5	0.050102	no	ARTCRN
chr1_1367511_ATGAG_A_b38	ATAD3C	-2.619	0.00959	-0.131241	5	0.050102	no	ARTCRN
chr1_1367593_G_A_b38	ATAD3C	-2.619	0.00959	-0.131241	5	0.050102	no	ARTCRN
chr1_1367602_GT_G_b38	ATAD3C	-2.619	0.00959	-0.131241	5	0.050102	no	ARTCRN
chr1_1367605_GAGTGAGTGTA_G_b38	ATAD3C	-2.619	0.00959	-0.131241	5	0.050102	no	ARTCRN
chr1_1367670_GGTGA_G_b38	ATAD3C	-2.619	0.00959	-0.131241	5	0.050102	no	ARTCRN
chr1_1367722_TTTTA_T_b38	ATAD3C	-2.619	0.00959	-0.131241	5	0.050102	no	ARTCRN
chr1_1367874_A_T_b38	ATAD3C	-2.619	0.00959	-0.131241	5	0.050102	no	ARTCRN
chr1_1367919_C_T_b38	ATAD3C	-2.619	0.00959	-0.131241	5	0.050102	no	ARTCRN
chr1_1367951_C_T_b38	ATAD3C	-2.619	0.00959	-0.131241	5	0.050102	no	ARTCRN
chr1_1367965_A_G_b38	ATAD3C	-2.619	0.00959	-0.131241	5	0.050102	no	ARTCRN
chr1_1367970_T_G_b38	ATAD3C	-2.619	0.00959	-0.131241	5	0.050102	no	ARTCRN
chr1_1367994_C_A_b38	ATAD3C	-2.619	0.00959	-0.131241	5	0.050102	no	ARTCRN
chr1_1368297_C_T_b38	ATAD3C	-2.619	0.00959	-0.131241	5	0.050102	no	ARTCRN
chr1_1368514_C_G_b38	ATAD3C	-2.619	0.00959	-0.131241	5	0.050102	no	ARTCRN
chr1_1369282_G_A_b38	ATAD3C	-2.619	0.00959	-0.131241	5	0.050102	no	ARTCRN
chr1_1369320_GT_G_b38	ATAD3C	-2.619	0.00959	-0.131241	5	0.050102	no	ARTCRN
chr1_1369407_G_A_b38	ATAD3C	-2.619	0.00959	-0.131241	5	0.050102	no	ARTCRN
chr1_1369476_CTT_C_b38	ATAD3C	-2.619	0.00959	-0.131241	5	0.050102	no	ARTCRN
chr1_1369556_C_G_b38	ATAD3C	-2.619	0.00959	-0.131241	5	0.050102	no	ARTCRN
chr1_1369627_T_C_b38	ATAD3C	-2.619	0.00959	-0.131241	5	0.050102	no	ARTCRN
chr1_1369686_T_C_b38	ATAD3C	-2.619	0.00959	-0.131241	5	0.050102	no	ARTCRN
chr1_1369716_G_C_b38	ATAD3C	-2.619	0.00959	-0.131241	5	0.050102	no	ARTCRN
chr1_1369741_C_T_b38	ATAD3C	-2.619	0.00959	-0.131241	5	0.050102	no	ARTCRN
chr1_1370181_C_T_b38	ATAD3C	-2.619	0.00959	-0.131241	5	0.050102	no	ARTCRN
chr1_1370317_G_C_b38	ATAD3C	-2.619	0.00959	-0.131241	5	0.050102	no	ARTCRN
chr1_1370320_A_G_b38	ATAD3C	-2.619	0.00959	-0.131241	5	0.050102	no	ARTCRN
chr1_1195100_G_A_b38	ATAD3C	2.605	0.00999	0.129228	4	0.049609	no	ARTCRN
chr1_1440430_C_G_b38	ATAD3C	-6.278	7.33e-10	-0.090332	50	0.014389	yes	ARTTBL
chr1_1443457_T_C_b38	ATAD3C	-5.942	5.19e-09	-0.08672	77	0.014593	yes	ARTTBL
chr1_1440834_C_G_b38	ATAD3C	-5.84	9.28e-09	-0.085177	74	0.014585	yes	ARTTBL
chr1_1439454_A_G_b38	ATAD3C	-5.691	2.12e-08	-0.081065	69	0.014244	yes	ARTTBL
chr1_1445187_T_G_b38	ATAD3C	-5.457	7.57e-08	-0.079072	71	0.014491	yes	ARTTBL
chr1_1445240_A_G_b38	ATAD3C	-5.28	1.91e-07	-0.077131	76	0.014609	yes	ARTTBL
chr1_1442793_G_A_b38	ATAD3C	-5.206	2.8e-07	-0.084338	21	0.0162	yes	ARTTBL
chr1_1438102_G_C_b38	ATAD3C	-5.199	2.9e-07	-0.081465	27	0.015671	yes	ARTTBL
chr1_1441187_A_G_b38	ATAD3C	-5.121	4.31e-07	-0.075817	57	0.014805	yes	ARTTBL
chr1_1448915_G_A_b38	ATAD3C	-4.901	1.28e-06	-0.071392	56	0.014566	yes	ARTTBL
chr1_1433374_T_C_b38	ATAD3C	-4.834	1.77e-06	-0.067882	82	0.014044	yes	ARTTBL
chr1_1428969_T_C_b38	ATAD3C	-4.814	1.95e-06	-0.070097	75	0.01456	yes	ARTTBL
chr1_1435945_C_CCGGGCGGGGGCG_b38	ATAD3C	-4.802	2.07e-06	-0.077598	22	0.01616	yes	ARTTBL
chr1_1436388_CA_C_b38	ATAD3C	-4.756	2.56e-06	-0.069828	54	0.014681	yes	ARTTBL
chr1_1434687_C_G_b38	ATAD3C	-4.672	3.81e-06	-0.075771	22	0.016218	yes	ARTTBL
chr1_1431450_A_G_b38	ATAD3C	-4.667	3.9e-06	-0.067769	75	0.014521	yes	ARTTBL
chr1_1431537_G_C_b38	ATAD3C	-4.658	4.08e-06	-0.067559	75	0.014504	yes	ARTTBL
chr1_1436079_A_G_b38	ATAD3C	-4.641	4.41e-06	-0.06561	79	0.014138	yes	ARTTBL
chr1_1430190_A_C_b38	ATAD3C	-4.628	4.69e-06	-0.067351	75	0.014554	yes	ARTTBL
chr1_1426810_C_G_b38	ATAD3C	-4.607	5.16e-06	-0.067546	73	0.014662	yes	ARTTBL
chr1_1426261_C_T_b38	ATAD3C	-4.591	5.55e-06	-0.06762	72	0.014729	yes	ARTTBL
chr1_1449831_A_G_b38	ATAD3C	-4.49	8.81e-06	-0.072942	68	0.016246	yes	ARTTBL
chr1_1430908_A_G_b38	ATAD3C	-4.46	1.01e-05	-0.064609	75	0.014485	yes	ARTTBL
chr1_1395346_A_G_b38	ATAD3C	-4.449	1.06e-05	-0.072392	80	0.016271	yes	ARTTBL
chr1_1447108_A_ATT_b38	ATAD3C	-4.402	1.31e-05	-0.066761	33	0.015166	yes	ARTTBL
chr1_1400410_A_G_b38	ATAD3C	-4.392	1.36e-05	-0.069343	63	0.015788	yes	ARTTBL
chr1_1402457_A_G_b38	ATAD3C	-4.382	1.43e-05	-0.071507	81	0.016319	yes	ARTTBL
chr1_1411323_A_C_b38	ATAD3C	-4.37	1.51e-05	-0.071289	81	0.016314	yes	ARTTBL
chr1_1431026_CCACCCCCT_C_b38	ATAD3C	-4.343	1.7e-05	-0.06801	38	0.01566	yes	ARTTBL
chr1_1432355_G_A_b38	ATAD3C	-4.299	2.05e-05	-0.065559	32	0.01525	yes	ARTTBL
chr1_1431656_G_A_b38	ATAD3C	-4.236	2.69e-05	-0.071923	18	0.016978	yes	ARTTBL
chr1_1454315_C_T_b38	ATAD3C	-4.186	3.34e-05	-0.064855	66	0.015494	yes	ARTTBL
chr1_1431014_G_A_b38	ATAD3C	-4.168	3.6e-05	-0.060456	39	0.014504	yes	ARTTBL
chr1_1456079_T_C_b38	ATAD3C	-4.107	4.66e-05	-0.063211	36	0.01539	yes	ARTTBL
chr1_1426253_G_A_b38	ATAD3C	-4.083	5.15e-05	-0.070861	15	0.017355	yes	ARTTBL
chr1_1455617_T_G_b38	ATAD3C	-4.079	5.25e-05	-0.063415	72	0.015548	yes	ARTTBL
chr1_1439805_G_C_b38	ATAD3C	-4.038	6.22e-05	-0.063843	30	0.015812	yes	ARTTBL
chr1_1384749_C_G_b38	ATAD3C	4.021	6.66e-05	0.063262	64	0.015733	yes	ARTTBL
chr1_1387763_CCT_C_b38	ATAD3C	4.021	6.66e-05	0.063262	64	0.015733	yes	ARTTBL
chr1_1388944_G_A_b38	ATAD3C	4.021	6.66e-05	0.063262	64	0.015733	yes	ARTTBL
chr1_1394423_A_G_b38	ATAD3C	-3.998	7.31e-05	-0.064923	80	0.016237	yes	ARTTBL
chr1_1389827_C_T_b38	ATAD3C	3.995	7.41e-05	0.064715	80	0.016198	yes	ARTTBL
chr1_1452825_AAAG_A_b38	ATAD3C	-3.981	7.87e-05	-0.060915	37	0.015303	yes	ARTTBL
chr1_1451787_A_C_b38	ATAD3C	-3.98	7.9e-05	-0.059844	58	0.015038	yes	ARTTBL
chr1_1387698_A_G_b38	ATAD3C	3.968	8.29e-05	0.064485	81	0.016253	yes	ARTTBL
chr1_1453552_G_A_b38	ATAD3C	-3.966	8.33e-05	-0.060829	37	0.015336	yes	ARTTBL
chr1_1455134_T_G_b38	ATAD3C	-3.966	8.33e-05	-0.060829	37	0.015336	yes	ARTTBL
chr1_1455337_A_G_b38	ATAD3C	-3.966	8.33e-05	-0.060829	37	0.015336	yes	ARTTBL
chr1_1455495_C_T_b38	ATAD3C	-3.966	8.33e-05	-0.060829	37	0.015336	yes	ARTTBL
chr1_1454770_T_C_b38	ATAD3C	-3.958	8.64e-05	-0.06164	72	0.015575	yes	ARTTBL
chr1_1407565_C_A_b38	ATAD3C	-3.939	9.31e-05	-0.078405	13	0.019904	yes	ARTTBL
chr1_1454848_T_C_b38	ATAD3C	-3.934	9.51e-05	-0.060044	39	0.015264	yes	ARTTBL
chr1_1453703_A_G_b38	ATAD3C	-3.899	0.000109	-0.060818	72	0.015597	yes	ARTTBL
chr1_1456154_G_A_b38	ATAD3C	-3.889	0.000114	-0.060017	36	0.015432	yes	ARTTBL
chr1_1456051_C_T_b38	ATAD3C	-3.878	0.000119	-0.059601	36	0.015368	yes	ARTTBL
chr1_1452511_A_G_b38	ATAD3C	-3.865	0.000125	-0.060256	72	0.015591	yes	ARTTBL
chr1_1452888_C_A_b38	ATAD3C	-3.865	0.000125	-0.060256	72	0.015591	yes	ARTTBL
chr1_1452909_A_C_b38	ATAD3C	-3.865	0.000125	-0.060256	72	0.015591	yes	ARTTBL
chr1_1382893_G_A_b38	ATAD3C	-3.852	0.000132	-0.072253	15	0.018756	yes	ARTTBL
chr1_1452540_G_A_b38	ATAD3C	-3.844	0.000136	-0.058587	33	0.015241	yes	ARTTBL
chr1_1455924_T_C_b38	ATAD3C	-3.834	0.000142	-0.059113	36	0.015417	yes	ARTTBL
chr1_1376162_G_C_b38	ATAD3C	3.828	0.000145	0.060135	64	0.015711	yes	ARTTBL
chr1_1377431_C_T_b38	ATAD3C	3.828	0.000145	0.060135	64	0.015711	yes	ARTTBL
chr1_1456891_T_C_b38	ATAD3C	-3.818	0.000151	-0.053003	54	0.013881	yes	ARTTBL
chr1_1454092_A_G_b38	ATAD3C	-3.806	0.000158	-0.059312	72	0.015585	yes	ARTTBL
chr1_1365566_G_A_b38	ATAD3C	3.788	0.00017	0.063469	19	0.016756	yes	ARTTBL
chr1_1366561_AGT_A_b38	ATAD3C	3.772	0.000181	0.061	80	0.016172	yes	ARTTBL
chr1_1378204_G_C_b38	ATAD3C	3.768	0.000184	0.058035	65	0.015402	yes	ARTTBL
chr1_1366681_T_TGA_b38	ATAD3C	-3.768	0.000184	-0.068755	14	0.018249	yes	ARTTBL
chr1_1398218_C_A_b38	ATAD3C	-3.762	0.000188	-0.071579	15	0.019025	yes	ARTTBL
chr1_1363898_C_T_b38	ATAD3C	3.756	0.000192	0.063602	19	0.016933	yes	ARTTBL
chr1_1366529_TTAG_T_b38	ATAD3C	3.756	0.000192	0.063602	19	0.016933	yes	ARTTBL
chr1_1367292_A_AGT_b38	ATAD3C	3.756	0.000192	0.063602	19	0.016933	yes	ARTTBL
chr1_1312114_T_C_b38	ATAD3C	3.738	0.000206	0.059648	80	0.015957	yes	ARTTBL
chr1_1547630_G_A_b38	ATAD3C	-3.73	0.000213	-0.048767	97	0.013074	yes	ARTTBL
chr1_1400756_GGA_G_b38	ATAD3C	-3.713	0.000227	-0.070483	15	0.018982	yes	ARTTBL
chr1_1401954_G_T_b38	ATAD3C	-3.713	0.000227	-0.070483	15	0.018982	yes	ARTTBL
chr1_1366427_AGTGTGATTGAATGAGT_A_b38	ATAD3C	3.708	0.000232	0.058708	60	0.015835	yes	ARTTBL
chr1_1363986_C_T_b38	ATAD3C	3.699	0.00024	0.062553	19	0.01691	yes	ARTTBL
chr1_1403593_A_G_b38	ATAD3C	-3.698	0.00024	-0.069985	15	0.018924	yes	ARTTBL
chr1_1379091_T_G_b38	ATAD3C	3.689	0.000249	0.064551	19	0.017497	yes	ARTTBL
chr1_1449009_A_T_b38	ATAD3C	-3.688	0.00025	-0.060115	49	0.0163	yes	ARTTBL
chr1_1453643_A_ATT_b38	ATAD3C	-3.688	0.00025	-0.058654	41	0.015905	yes	ARTTBL
chr1_1541864_T_C_b38	ATAD3C	-3.679	0.000259	-0.051215	96	0.013922	yes	ARTTBL
chr1_1457071_C_T_b38	ATAD3C	-3.678	0.00026	-0.055946	39	0.01521	yes	ARTTBL
chr1_1367511_ATGAG_A_b38	ATAD3C	-3.642	0.000298	-0.066277	13	0.018199	yes	ARTTBL
chr1_1367388_T_TTGG_b38	ATAD3C	-3.624	0.000318	-0.065515	14	0.018076	yes	ARTTBL
chr1_1452797_CAA_C_b38	ATAD3C	-3.62	0.000323	-0.060099	27	0.0166	yes	ARTTBL
chr1_1451968_C_T_b38	ATAD3C	-3.609	0.000338	-0.055434	34	0.015361	yes	ARTTBL
chr1_1457033_A_C_b38	ATAD3C	-3.606	0.000341	-0.054762	37	0.015185	yes	ARTTBL
chr1_1558726_C_CA_b38	ATAD3C	-3.596	0.000354	-0.0496	98	0.013793	yes	ARTTBL
chr1_1561821_A_C_b38	ATAD3C	-3.596	0.000354	-0.0496	98	0.013793	yes	ARTTBL
chr1_1358384_G_C_b38	ATAD3C	3.592	0.00036	0.058229	81	0.016211	yes	ARTTBL
chr1_1538787_A_G_b38	ATAD3C	-3.586	0.000368	-0.048519	104	0.01353	yes	ARTTBL
chr1_1542773_T_C_b38	ATAD3C	-3.575	0.000384	-0.049391	93	0.013817	yes	ARTTBL
chr1_1542793_C_G_b38	ATAD3C	-3.575	0.000384	-0.049391	93	0.013817	yes	ARTTBL
chr1_1542800_T_C_b38	ATAD3C	-3.575	0.000384	-0.049391	93	0.013817	yes	ARTTBL
chr1_1543953_A_G_b38	ATAD3C	-3.575	0.000384	-0.049391	93	0.013817	yes	ARTTBL
chr1_1471992_T_C_b38	ATAD3C	-3.573	0.000387	-0.053975	87	0.015108	yes	ARTTBL
chr1_1450322_CAA_C_b38	ATAD3C	-3.571	0.000389	-0.078334	11	0.021934	yes	ARTTBL
chr1_1456182_G_A_b38	ATAD3C	-3.568	0.000393	-0.053847	40	0.015091	yes	ARTTBL
chr1_1550064_GC_G_b38	ATAD3C	-3.562	0.000402	-0.049062	94	0.013774	yes	ARTTBL
chr1_1550068_C_A_b38	ATAD3C	-3.562	0.000402	-0.049062	94	0.013774	yes	ARTTBL
chr1_1555871_T_C_b38	ATAD3C	-3.562	0.000403	-0.047854	77	0.013436	yes	ARTTBL
chr1_1330125_G_A_b38	ATAD3C	3.543	0.000432	0.057624	81	0.016265	yes	ARTTBL
chr1_1543500_T_G_b38	ATAD3C	-3.535	0.000445	-0.048607	91	0.013752	yes	ARTTBL
chr1_1366321_TGTGTGTAAATGG_T_b38	ATAD3C	-3.502	0.000502	-0.063371	14	0.018094	yes	ARTTBL
chr1_1431813_G_T_b38	ATAD3C	-3.496	0.000514	-0.055542	24	0.015888	yes	ARTTBL
chr1_1551557_A_AG_b38	ATAD3C	-3.495	0.000515	-0.048303	97	0.013821	yes	ARTTBL
chr1_1551559_A_T_b38	ATAD3C	-3.495	0.000515	-0.048303	97	0.013821	yes	ARTTBL
chr1_1367462_T_C_b38	ATAD3C	-3.486	0.000532	-0.063194	14	0.018128	yes	ARTTBL
chr1_1375642_C_T_b38	ATAD3C	-3.48	0.000544	-0.063464	16	0.018235	yes	ARTTBL
chr1_1369009_T_C_b38	ATAD3C	-3.48	0.000544	-0.063635	14	0.018286	yes	ARTTBL
chr1_1380867_A_G_b38	ATAD3C	-3.472	0.000559	-0.067126	13	0.019331	yes	ARTTBL
chr1_1369012_C_CG_b38	ATAD3C	-3.462	0.00058	-0.063299	14	0.018282	yes	ARTTBL
chr1_1572532_A_C_b38	ATAD3C	-3.447	0.000614	-0.046313	107	0.013436	yes	ARTTBL
chr1_1361679_G_A_b38	ATAD3C	3.445	0.000617	0.057327	49	0.016639	yes	ARTTBL
chr1_1384546_C_T_b38	ATAD3C	-3.442	0.000626	-0.068264	13	0.019835	yes	ARTTBL
chr1_1309988_G_A_b38	ATAD3C	3.437	0.000635	0.055242	84	0.016071	yes	ARTTBL
chr1_1366511_GGTGA_G_b38	ATAD3C	-3.431	0.000649	-0.062069	14	0.018089	yes	ARTTBL
chr1_1374505_A_G_b38	ATAD3C	-3.43	0.000652	-0.062509	16	0.018224	yes	ARTTBL
chr1_1372909_G_A_b38	ATAD3C	-3.426	0.000662	-0.064006	14	0.018682	yes	ARTTBL
chr1_1562444_C_T_b38	ATAD3C	-3.425	0.000663	-0.066903	10	0.019531	yes	ARTTBL
chr1_1557495_CAT_C_b38	ATAD3C	-3.42	0.000676	-0.04719	98	0.013798	yes	ARTTBL
chr1_1566854_CA_C_b38	ATAD3C	-3.397	0.000733	-0.050963	67	0.015001	yes	ARTTBL
chr1_1573079_A_G_b38	ATAD3C	-3.391	0.000749	-0.045543	107	0.013429	yes	ARTTBL
chr1_1565105_CAAGGCAGGCGGATCATG_C_b38	ATAD3C	-3.371	0.000806	-0.045175	108	0.013403	yes	ARTTBL
chr1_1370113_A_G_b38	ATAD3C	3.37	0.000809	0.050324	57	0.014935	yes	ARTTBL
chr1_1363438_C_CTT_b38	ATAD3C	3.369	0.000811	0.049439	48	0.014675	yes	ARTTBL
chr1_1313807_G_A_b38	ATAD3C	3.367	0.000818	0.054043	84	0.016052	yes	ARTTBL
chr1_1363688_C_T_b38	ATAD3C	-3.366	0.000819	-0.060953	14	0.018106	yes	ARTTBL
chr1_1364099_CCA_C_b38	ATAD3C	-3.366	0.000819	-0.060953	14	0.018106	yes	ARTTBL
chr1_1364102_TGTTG_T_b38	ATAD3C	-3.366	0.000819	-0.060953	14	0.018106	yes	ARTTBL
chr1_1368763_G_A_b38	ATAD3C	-3.366	0.000819	-0.060953	14	0.018106	yes	ARTTBL
chr1_1558347_G_A_b38	ATAD3C	-3.365	0.000824	-0.046211	63	0.013734	yes	ARTTBL
chr1_1539491_G_C_b38	ATAD3C	-3.364	0.000826	-0.045681	97	0.01358	yes	ARTTBL
chr1_1363456_CAG_C_b38	ATAD3C	3.352	0.00086	0.05214	32	0.015552	yes	ARTTBL
chr1_1367268_TGA_T_b38	ATAD3C	-3.35	0.000867	-0.060415	14	0.018033	yes	ARTTBL
chr1_1368177_G_C_b38	ATAD3C	-3.347	0.000876	-0.060288	17	0.01801	yes	ARTTBL
chr1_1369407_G_A_b38	ATAD3C	-3.344	0.000887	-0.060479	13	0.018088	yes	ARTTBL
chr1_1364566_T_C_b38	ATAD3C	-3.342	0.000892	-0.060426	14	0.01808	yes	ARTTBL
chr1_1559750_C_CAG_b38	ATAD3C	-3.341	0.000896	-0.044937	107	0.013451	yes	ARTTBL
chr1_1561628_T_C_b38	ATAD3C	-3.341	0.000896	-0.044937	107	0.013451	yes	ARTTBL
chr1_1563918_A_G_b38	ATAD3C	-3.341	0.000896	-0.044937	107	0.013451	yes	ARTTBL
chr1_1565561_A_G_b38	ATAD3C	-3.341	0.000896	-0.044937	107	0.013451	yes	ARTTBL
chr1_1566086_G_A_b38	ATAD3C	-3.341	0.000896	-0.044937	107	0.013451	yes	ARTTBL
chr1_1567715_G_A_b38	ATAD3C	-3.341	0.000896	-0.044937	107	0.013451	yes	ARTTBL
chr1_1567719_A_C_b38	ATAD3C	-3.341	0.000896	-0.044937	107	0.013451	yes	ARTTBL
chr1_1569875_C_T_b38	ATAD3C	-3.341	0.000896	-0.044937	107	0.013451	yes	ARTTBL
chr1_1575935_T_C_b38	ATAD3C	-3.338	0.000906	-0.04533	96	0.013581	yes	ARTTBL
chr1_1367280_T_A_b38	ATAD3C	-3.336	0.00091	-0.06035	14	0.018088	yes	ARTTBL
chr1_1373006_G_A_b38	ATAD3C	-3.328	0.000937	-0.063658	10	0.019128	yes	ARTTBL
chr1_1367300_T_TGA_b38	ATAD3C	-3.327	0.000941	-0.060636	13	0.018226	yes	ARTTBL
chr1_1370430_T_C_b38	ATAD3C	-3.318	0.000973	-0.060553	15	0.018253	yes	ARTTBL
chr1_1370584_G_C_b38	ATAD3C	-3.318	0.000973	-0.060553	15	0.018253	yes	ARTTBL
chr1_1545795_C_A_b38	ATAD3C	-3.311	0.000994	-0.045539	85	0.013752	yes	ARTTBL
chr1_1369821_C_T_b38	ATAD3C	-3.311	0.000994	-0.059884	14	0.018084	yes	ARTTBL
chr1_1364282_T_G_b38	ATAD3C	-3.31	0.000999	-0.059819	14	0.018073	yes	ARTTBL
chr1_1364694_T_C_b38	ATAD3C	-3.31	0.000999	-0.059819	14	0.018073	yes	ARTTBL
chr1_1364721_C_T_b38	ATAD3C	-3.31	0.000999	-0.059819	14	0.018073	yes	ARTTBL
chr1_1365160_A_G_b38	ATAD3C	-3.31	0.000999	-0.059819	14	0.018073	yes	ARTTBL
chr1_1365198_C_T_b38	ATAD3C	-3.31	0.000999	-0.059819	14	0.018073	yes	ARTTBL
chr1_1366008_A_G_b38	ATAD3C	-3.31	0.000999	-0.059819	14	0.018073	yes	ARTTBL
chr1_1366062_T_C_b38	ATAD3C	-3.31	0.000999	-0.059819	14	0.018073	yes	ARTTBL
chr1_1366145_TGTGAA_T_b38	ATAD3C	-3.31	0.000999	-0.059819	14	0.018073	yes	ARTTBL
chr1_1366453_G_T_b38	ATAD3C	-3.31	0.000999	-0.059819	14	0.018073	yes	ARTTBL
chr1_1366726_T_G_b38	ATAD3C	-3.31	0.000999	-0.059819	14	0.018073	yes	ARTTBL
chr1_1367258_T_A_b38	ATAD3C	-3.31	0.000999	-0.059819	14	0.018073	yes	ARTTBL
chr1_1367297_GAA_G_b38	ATAD3C	-3.31	0.000999	-0.059819	14	0.018073	yes	ARTTBL
chr1_1367329_A_AGT_b38	ATAD3C	-3.31	0.000999	-0.059819	14	0.018073	yes	ARTTBL
chr1_1367373_T_TGTG_b38	ATAD3C	-3.31	0.000999	-0.059819	14	0.018073	yes	ARTTBL
chr1_1367593_G_A_b38	ATAD3C	-3.31	0.000999	-0.059819	14	0.018073	yes	ARTTBL
chr1_1367602_GT_G_b38	ATAD3C	-3.31	0.000999	-0.059819	14	0.018073	yes	ARTTBL
chr1_1367605_GAGTGAGTGTA_G_b38	ATAD3C	-3.31	0.000999	-0.059819	14	0.018073	yes	ARTTBL
chr1_1367670_GGTGA_G_b38	ATAD3C	-3.31	0.000999	-0.059819	14	0.018073	yes	ARTTBL
chr1_1367722_TTTTA_T_b38	ATAD3C	-3.31	0.000999	-0.059819	14	0.018073	yes	ARTTBL
chr1_1367874_A_T_b38	ATAD3C	-3.31	0.000999	-0.059819	14	0.018073	yes	ARTTBL
chr1_1367951_C_T_b38	ATAD3C	-3.31	0.000999	-0.059819	14	0.018073	yes	ARTTBL
chr1_1367965_A_G_b38	ATAD3C	-3.31	0.000999	-0.059819	14	0.018073	yes	ARTTBL
chr1_1367970_T_G_b38	ATAD3C	-3.31	0.000999	-0.059819	14	0.018073	yes	ARTTBL
chr1_1367994_C_A_b38	ATAD3C	-3.31	0.000999	-0.059819	14	0.018073	yes	ARTTBL
chr1_1368297_C_T_b38	ATAD3C	-3.31	0.000999	-0.059819	14	0.018073	yes	ARTTBL
chr1_1369282_G_A_b38	ATAD3C	-3.31	0.000999	-0.059819	14	0.018073	yes	ARTTBL
chr1_1369320_GT_G_b38	ATAD3C	-3.31	0.000999	-0.059819	14	0.018073	yes	ARTTBL
chr1_1369476_CTT_C_b38	ATAD3C	-3.31	0.000999	-0.059819	14	0.018073	yes	ARTTBL
chr1_1369556_C_G_b38	ATAD3C	-3.31	0.000999	-0.059819	14	0.018073	yes	ARTTBL
chr1_1369627_T_C_b38	ATAD3C	-3.31	0.000999	-0.059819	14	0.018073	yes	ARTTBL
chr1_1369686_T_C_b38	ATAD3C	-3.31	0.000999	-0.059819	14	0.018073	yes	ARTTBL
chr1_1369716_G_C_b38	ATAD3C	-3.31	0.000999	-0.059819	14	0.018073	yes	ARTTBL
chr1_1369741_C_T_b38	ATAD3C	-3.31	0.000999	-0.059819	14	0.018073	yes	ARTTBL
chr1_1370181_C_T_b38	ATAD3C	-3.31	0.000999	-0.059819	14	0.018073	yes	ARTTBL
chr1_1370317_G_C_b38	ATAD3C	-3.31	0.000999	-0.059819	14	0.018073	yes	ARTTBL
chr1_1370320_A_G_b38	ATAD3C	-3.31	0.000999	-0.059819	14	0.018073	yes	ARTTBL
chr1_1366292_G_T_b38	ATAD3C	-3.31	0.000999	-0.060112	14	0.018162	yes	ARTTBL
chr1_1370532_C_T_b38	ATAD3C	-3.305	0.00102	-0.06004	15	0.018169	yes	ARTTBL
chr1_1549590_C_G_b38	ATAD3C	-3.305	0.00102	-0.044335	103	0.013417	yes	ARTTBL
chr1_1364357_A_C_b38	ATAD3C	-3.298	0.00104	-0.059444	14	0.018025	yes	ARTTBL
chr1_1368514_C_G_b38	ATAD3C	-3.298	0.00104	-0.059444	14	0.018025	yes	ARTTBL
chr1_1560765_T_C_b38	ATAD3C	-3.297	0.00105	-0.045376	86	0.013765	yes	ARTTBL
chr1_1562261_TTTTC_T_b38	ATAD3C	-3.297	0.00105	-0.045376	86	0.013765	yes	ARTTBL
chr1_1373007_G_A_b38	ATAD3C	-3.273	0.00113	-0.061986	12	0.018936	yes	ARTTBL
chr1_1577491_A_AC_b38	ATAD3C	-3.27	0.00115	-0.045184	100	0.013816	yes	ARTTBL
chr1_1368991_C_T_b38	ATAD3C	-3.264	0.00117	-0.059347	14	0.018182	yes	ARTTBL
chr1_1553692_A_G_b38	ATAD3C	-3.246	0.00125	-0.043364	104	0.01336	yes	ARTTBL
chr1_1554694_A_G_b38	ATAD3C	-3.246	0.00125	-0.043364	104	0.01336	yes	ARTTBL
chr1_1555247_T_A_b38	ATAD3C	-3.246	0.00125	-0.043364	104	0.01336	yes	ARTTBL
chr1_1379093_TG_T_b38	ATAD3C	-3.237	0.00128	-0.065993	9	0.020385	yes	ARTTBL
chr1_1537493_T_A_b38	ATAD3C	-3.233	0.00131	-0.043706	81	0.013521	yes	ARTTBL
chr1_1337898_A_G_b38	ATAD3C	3.23	0.00132	0.049908	24	0.015452	yes	ARTTBL
chr1_1554781_A_G_b38	ATAD3C	-3.216	0.00138	-0.042982	104	0.013364	yes	ARTTBL
chr1_1366187_A_AGT_b38	ATAD3C	-3.215	0.00139	-0.058036	14	0.018053	yes	ARTTBL
chr1_1569180_T_A_b38	ATAD3C	-3.207	0.00143	-0.043092	102	0.013438	yes	ARTTBL
chr1_1364253_C_G_b38	ATAD3C	-3.204	0.00144	-0.058794	14	0.01835	yes	ARTTBL
chr1_1573654_T_C_b38	ATAD3C	-3.203	0.00145	-0.044107	100	0.013771	yes	ARTTBL
chr1_1574445_A_G_b38	ATAD3C	-3.203	0.00145	-0.044107	100	0.013771	yes	ARTTBL
chr1_1341550_GCA_G_b38	ATAD3C	-3.199	0.00146	-0.059131	15	0.018485	yes	ARTTBL
chr1_1555179_A_G_b38	ATAD3C	-3.187	0.00152	-0.042901	73	0.013461	yes	ARTTBL
chr1_1383743_T_C_b38	ATAD3C	-3.176	0.00159	-0.059762	15	0.01882	yes	ARTTBL
chr1_1570294_CA_C_b38	ATAD3C	-3.175	0.00159	-0.043594	97	0.01373	yes	ARTTBL
chr1_1308516_C_T_b38	ATAD3C	3.168	0.00163	0.050217	84	0.015853	yes	ARTTBL
chr1_1575864_G_A_b38	ATAD3C	-3.163	0.00166	-0.044092	90	0.013942	yes	ARTTBL
chr1_1554852_T_C_b38	ATAD3C	-3.159	0.00168	-0.042202	104	0.013359	yes	ARTTBL
chr1_690136_A_G_b38	ATAD3C	3.137	0.0018	0.107431	4	0.034242	yes	ARTTBL
chr1_1379083_AT_A_b38	ATAD3C	3.12	0.00191	0.048034	33	0.015395	yes	ARTTBL
chr1_1575724_G_C_b38	ATAD3C	-3.11	0.00197	-0.042582	97	0.01369	yes	ARTTBL
chr1_1456217_T_C_b38	ATAD3C	-3.084	0.00215	-0.050651	61	0.016425	yes	ARTTBL
chr1_1366776_G_GAATT_b38	ATAD3C	-3.078	0.0022	-0.057038	14	0.018533	yes	ARTTBL
chr1_1551523_T_C_b38	ATAD3C	-3.076	0.00221	-0.043194	35	0.014043	yes	ARTTBL
chr1_1367919_C_T_b38	ATAD3C	-3.071	0.00225	-0.055566	14	0.018094	yes	ARTTBL
chr1_1570568_AC_A_b38	ATAD3C	-3.068	0.00227	-0.043513	38	0.014182	yes	ARTTBL
chr1_1363880_A_G_b38	ATAD3C	-3.059	0.00234	-0.054809	14	0.017918	yes	ARTTBL
chr1_1366828_A_G_b38	ATAD3C	-3.056	0.00236	-0.062829	9	0.020561	yes	ARTTBL
chr1_1569661_T_C_b38	ATAD3C	-3.052	0.00239	-0.040314	100	0.013207	yes	ARTTBL
chr1_1554548_T_C_b38	ATAD3C	-3.051	0.0024	-0.041215	72	0.013509	yes	ARTTBL
chr1_1570587_C_T_b38	ATAD3C	-3.041	0.00248	-0.040597	95	0.013349	yes	ARTTBL
chr1_1559703_G_C_b38	ATAD3C	-3.037	0.00251	-0.04058	95	0.01336	yes	ARTTBL
chr1_1571986_G_A_b38	ATAD3C	-3.03	0.00256	-0.03949	83	0.013031	yes	ARTTBL
chr1_1361685_C_T_b38	ATAD3C	-3.013	0.00272	-0.052233	40	0.017337	yes	ARTTBL
chr1_1497605_G_C_b38	ATAD3C	-2.994	0.00289	-0.040279	79	0.013455	yes	ARTTBL
chr1_1365036_T_TAA_b38	ATAD3C	-2.963	0.00318	-0.058047	8	0.019588	yes	ARTTBL
chr1_1580890_C_T_b38	ATAD3C	-2.948	0.00335	-0.041811	34	0.014184	yes	ARTTBL
chr1_1573776_A_G_b38	ATAD3C	-2.942	0.00341	-0.04163	34	0.014152	yes	ARTTBL
chr1_1575421_C_T_b38	ATAD3C	-2.941	0.00342	-0.040165	97	0.013655	yes	ARTTBL
chr1_1568548_G_A_b38	ATAD3C	-2.938	0.00346	-0.039301	95	0.013379	yes	ARTTBL
chr1_1565680_A_AG_b38	ATAD3C	-2.932	0.00352	-0.039214	103	0.013376	yes	ARTTBL
chr1_1549967_C_G_b38	ATAD3C	-2.913	0.00373	-0.040047	54	0.013746	yes	ARTTBL
chr1_1369803_C_CT_b38	ATAD3C	-2.91	0.00377	-0.049574	13	0.017034	yes	ARTTBL
chr1_1574655_GGC_G_b38	ATAD3C	-2.905	0.00383	-0.039864	88	0.013724	yes	ARTTBL
chr1_1428999_C_CA_b38	ATAD3C	-2.879	0.00416	-0.042683	33	0.014828	yes	ARTTBL
chr1_1437993_G_A_b38	ATAD3C	-2.873	0.00423	-0.044152	31	0.015366	yes	ARTTBL
chr1_1366941_T_TGTGTGCA_b38	ATAD3C	2.844	0.00464	0.057426	11	0.020195	yes	ARTTBL
chr1_1573429_CAAAAAAAAAAAAAAAAAA_C_b38	ATAD3C	-2.843	0.00465	-0.03794	92	0.013347	yes	ARTTBL
chr1_1370553_CAAA_C_b38	ATAD3C	-2.84	0.00468	-0.054953	10	0.019347	yes	ARTTBL
chr1_1456829_G_C_b38	ATAD3C	-2.818	0.00502	-0.046339	51	0.016443	yes	ARTTBL
chr1_1545968_T_C_b38	ATAD3C	-2.816	0.00505	-0.038393	40	0.013633	yes	ARTTBL
chr1_1292284_TTGAG_T_b38	ATAD3C	-2.81	0.00514	-0.04943	32	0.01759	yes	ARTTBL
chr1_1568428_C_G_b38	ATAD3C	-2.809	0.00516	-0.037588	44	0.013382	yes	ARTTBL
chr1_599294_T_G_b38	ATAD3C	2.786	0.00554	0.088664	5	0.031826	yes	ARTTBL
chr1_1554290_C_T_b38	ATAD3C	-2.776	0.00571	-0.037191	71	0.013399	yes	ARTTBL
chr1_1771973_A_AT_b38	ATAD3C	2.741	0.00634	0.046536	64	0.016977	yes	ARTTBL
chr1_1588701_C_T_b38	ATAD3C	2.733	0.0065	0.108739	3	0.039791	yes	ARTTBL
chr1_1571794_A_AT_b38	ATAD3C	-2.729	0.00658	-0.037768	89	0.013841	yes	ARTTBL
chr1_1366951_A_AGT_b38	ATAD3C	2.728	0.00658	0.055369	11	0.020294	yes	ARTTBL
chr1_1100425_G_A_b38	ATAD3C	-2.719	0.00676	-0.034552	74	0.012706	yes	ARTTBL
chr1_1254681_A_G_b38	ATAD3C	-2.695	0.00727	-0.056625	15	0.021012	yes	ARTTBL
chr1_969785_A_G_b38	ATAD3C	2.657	0.00812	0.067109	29	0.025254	yes	ARTTBL
chr1_1553619_CAAAAAAA_C_b38	ATAD3C	-2.63	0.0088	-0.038764	37	0.01474	yes	ARTTBL
chr1_1991856_A_G_b38	ATAD3C	2.628	0.00885	0.095094	3	0.036188	yes	ARTTBL
chr1_1984300_CT_C_b38	ATAD3C	2.621	0.00902	0.045957	6	0.017533	yes	ARTTBL
chr1_1532798_T_C_b38	ATAD3C	-2.607	0.0094	-0.033565	156	0.012874	yes	ARTTBL
chr1_591638_G_A_b38	ATAD3C	2.595	0.00974	0.047534	11	0.01832	yes	ARTTBL
chr1_1579717_T_A_b38	ATAD3C	-2.589	0.0099	-0.035979	38	0.013897	yes	ARTTBL
chr1_1497606_C_G_b38	ATAD3C	-2.587	0.00997	-0.042002	20	0.016239	yes	ARTTBL
chr1_1366830_G_A_b38	ATAD3C	-2.586	0.00999	-0.053773	9	0.020796	yes	ARTTBL
chr1_1510082_T_TA_b38	ATAD3C	4.275	2.28e-05	0.099834	7	0.023352	no	ARTTBL
chr1_1394041_G_A_b38	ATAD3C	-3.768	0.000184	-0.077632	7	0.020605	no	ARTTBL
chr1_1068824_G_A_b38	ATAD3C	3.379	0.000782	0.068765	6	0.020348	no	ARTTBL
chr1_1344048_G_A_b38	ATAD3C	-3.355	0.000851	-0.06381	12	0.019018	no	ARTTBL
chr1_1450636_A_G_b38	ATAD3C	-3.274	0.00113	-0.055769	15	0.017035	no	ARTTBL
chr1_632160_A_G_b38	ATAD3C	3.267	0.00116	0.174496	3	0.053417	no	ARTTBL
chr1_1453961_C_T_b38	ATAD3C	-3.24	0.00127	-0.05657	14	0.017461	no	ARTTBL
chr1_1453870_A_C_b38	ATAD3C	-3.114	0.00195	-0.053047	15	0.017037	no	ARTTBL
chr1_1375678_TA_T_b38	ATAD3C	3.086	0.00214	0.049526	38	0.016047	no	ARTTBL
chr1_1316929_A_T_b38	ATAD3C	-3.086	0.00214	-0.05727	13	0.018558	no	ARTTBL
chr1_1329973_GCGTGTGCCATGCA_G_b38	ATAD3C	-3.085	0.00215	-0.059151	12	0.019177	no	ARTTBL
chr1_1303112_G_A_b38	ATAD3C	-3.019	0.00266	-0.058582	8	0.019402	no	ARTTBL
chr1_1572877_TG_T_b38	ATAD3C	-2.96	0.00322	-0.043777	28	0.014791	no	ARTTBL
chr1_1451028_T_A_b38	ATAD3C	-2.934	0.0035	-0.049175	17	0.016762	no	ARTTBL
chr1_1452384_G_A_b38	ATAD3C	-2.897	0.00393	-0.048508	16	0.016745	no	ARTTBL
chr1_1325753_G_T_b38	ATAD3C	-2.851	0.00453	-0.058377	7	0.020474	no	ARTTBL
chr1_1452346_A_G_b38	ATAD3C	-2.844	0.00463	-0.046893	18	0.016489	no	ARTTBL
chr1_1303800_G_A_b38	ATAD3C	-2.792	0.00544	-0.056307	8	0.020168	no	ARTTBL
chr1_2189011_G_GAA_b38	ATAD3C	2.757	0.00604	0.088075	3	0.031944	no	ARTTBL
chr1_1375678_TAA_T_b38	ATAD3C	-2.693	0.00731	-0.044537	27	0.016536	no	ARTTBL
chr1_2245578_C_T_b38	ATAD3C	2.647	0.00837	0.049835	15	0.018828	no	ARTTBL
chr1_1611248_ATC_A_b38	ATAD3C	-2.634	0.00868	-0.038246	29	0.014517	no	ARTTBL
chr1_885945_ACAGT_A_b38	ATAD3C	2.592	0.00981	0.036014	54	0.013894	no	ARTTBL
chr1_1443457_T_C_b38	ATAD3C	-5.175	1.13e-06	-0.223902	18	0.043266	yes	BRNAMY
chr1_1440430_C_G_b38	ATAD3C	-5.131	1.36e-06	-0.221521	10	0.04317	yes	BRNAMY
chr1_1440834_C_G_b38	ATAD3C	-5.057	1.86e-06	-0.213751	17	0.042271	yes	BRNAMY
chr1_1433374_T_C_b38	ATAD3C	-5.006	2.31e-06	-0.20584	18	0.041122	yes	BRNAMY
chr1_1431014_G_A_b38	ATAD3C	-4.912	3.41e-06	-0.209554	7	0.042665	yes	BRNAMY
chr1_1436079_A_G_b38	ATAD3C	-4.836	4.65e-06	-0.204379	17	0.04226	yes	BRNAMY
chr1_1430908_A_G_b38	ATAD3C	-4.807	5.24e-06	-0.201734	17	0.041968	yes	BRNAMY
chr1_1431450_A_G_b38	ATAD3C	-4.807	5.24e-06	-0.201734	17	0.041968	yes	BRNAMY
chr1_1431537_G_C_b38	ATAD3C	-4.807	5.24e-06	-0.201734	17	0.041968	yes	BRNAMY
chr1_1430190_A_C_b38	ATAD3C	-4.77	6.1e-06	-0.20124	17	0.042192	yes	BRNAMY
chr1_1428969_T_C_b38	ATAD3C	-4.715	7.62e-06	-0.198885	17	0.042183	yes	BRNAMY
chr1_1445187_T_G_b38	ATAD3C	-4.531	1.59e-05	-0.20275	17	0.04475	yes	BRNAMY
chr1_1445240_A_G_b38	ATAD3C	-4.531	1.59e-05	-0.20275	17	0.04475	yes	BRNAMY
chr1_1436388_CA_C_b38	ATAD3C	-4.426	2.39e-05	-0.194762	12	0.044005	yes	BRNAMY
chr1_1441187_A_G_b38	ATAD3C	-4.426	2.39e-05	-0.194762	12	0.044005	yes	BRNAMY
chr1_1438102_G_C_b38	ATAD3C	-4.335	3.4e-05	-0.202112	6	0.046626	yes	BRNAMY
chr1_1431026_CCACCCCCT_C_b38	ATAD3C	-4.322	3.57e-05	-0.190602	10	0.044099	yes	BRNAMY
chr1_1439454_A_G_b38	ATAD3C	-4.197	5.75e-05	-0.172669	17	0.041141	yes	BRNAMY
chr1_1448915_G_A_b38	ATAD3C	-4.057	9.68e-05	-0.188992	13	0.046581	yes	BRNAMY
chr1_1426261_C_T_b38	ATAD3C	-3.966	0.000135	-0.17168	17	0.043284	yes	BRNAMY
chr1_1426810_C_G_b38	ATAD3C	-3.966	0.000135	-0.17168	17	0.043284	yes	BRNAMY
chr1_1442793_G_A_b38	ATAD3C	-3.752	0.00029	-0.188218	4	0.050162	yes	BRNAMY
chr1_1431656_G_A_b38	ATAD3C	-3.698	0.000351	-0.194867	3	0.052701	yes	BRNAMY
chr1_1432355_G_A_b38	ATAD3C	-3.511	0.000664	-0.164345	7	0.04681	yes	BRNAMY
chr1_1434687_C_G_b38	ATAD3C	-3.45	0.000813	-0.175428	4	0.050846	yes	BRNAMY
chr1_1449009_A_T_b38	ATAD3C	-3.37	0.00106	-0.188006	9	0.055783	yes	BRNAMY
chr1_1437993_G_A_b38	ATAD3C	-3.356	0.00111	-0.160429	6	0.047802	yes	BRNAMY
chr1_1447108_A_ATT_b38	ATAD3C	-3.344	0.00115	-0.16025	7	0.047917	yes	BRNAMY
chr1_1435945_C_CCGGGCGGGGGCG_b38	ATAD3C	-3.342	0.00116	-0.16261	5	0.048652	yes	BRNAMY
chr1_1375678_TA_T_b38	ATAD3C	3.315	0.00126	0.191772	5	0.057843	yes	BRNAMY
chr1_1337898_A_G_b38	ATAD3C	3.311	0.00128	0.137171	10	0.041429	yes	BRNAMY
chr1_1400410_A_G_b38	ATAD3C	-3.274	0.00144	-0.148027	9	0.045209	yes	BRNAMY
chr1_1376162_G_C_b38	ATAD3C	3.274	0.00144	0.148027	9	0.045209	yes	BRNAMY
chr1_1377431_C_T_b38	ATAD3C	3.274	0.00144	0.148027	9	0.045209	yes	BRNAMY
chr1_1378204_G_C_b38	ATAD3C	3.274	0.00144	0.148027	9	0.045209	yes	BRNAMY
chr1_1384749_C_G_b38	ATAD3C	3.274	0.00144	0.148027	9	0.045209	yes	BRNAMY
chr1_1387763_CCT_C_b38	ATAD3C	3.274	0.00144	0.148027	9	0.045209	yes	BRNAMY
chr1_1388944_G_A_b38	ATAD3C	3.274	0.00144	0.148027	9	0.045209	yes	BRNAMY
chr1_1387698_A_G_b38	ATAD3C	3.256	0.00153	0.146949	13	0.045134	yes	BRNAMY
chr1_1402457_A_G_b38	ATAD3C	-3.256	0.00153	-0.146949	13	0.045134	yes	BRNAMY
chr1_1411323_A_C_b38	ATAD3C	-3.238	0.00162	-0.146895	14	0.045373	yes	BRNAMY
chr1_1379083_AT_A_b38	ATAD3C	3.164	0.00205	0.135454	9	0.042813	yes	BRNAMY
chr1_1431813_G_T_b38	ATAD3C	-3.137	0.00223	-0.151135	5	0.048182	yes	BRNAMY
chr1_1389827_C_T_b38	ATAD3C	3.128	0.00229	0.14049	12	0.044917	yes	BRNAMY
chr1_1394423_A_G_b38	ATAD3C	-3.128	0.00229	-0.14049	12	0.044917	yes	BRNAMY
chr1_1395346_A_G_b38	ATAD3C	-3.128	0.00229	-0.14049	12	0.044917	yes	BRNAMY
chr1_1366427_AGTGTGATTGAATGAGT_A_b38	ATAD3C	3.121	0.00234	0.13786	10	0.044172	yes	BRNAMY
chr1_1449831_A_G_b38	ATAD3C	-3.104	0.00246	-0.174315	13	0.056153	yes	BRNAMY
chr1_1363456_CAG_C_b38	ATAD3C	3.104	0.00247	0.136317	9	0.043917	yes	BRNAMY
chr1_1358384_G_C_b38	ATAD3C	3.07	0.00274	0.13609	14	0.04433	yes	BRNAMY
chr1_1288341_C_T_b38	ATAD3C	-3.065	0.00278	-0.217376	3	0.070933	yes	BRNAMY
chr1_1437955_C_G_b38	ATAD3C	-3.041	0.00299	-0.140032	9	0.046049	yes	BRNAMY
chr1_1184277_G_C_b38	ATAD3C	-3.021	0.00318	-0.119531	25	0.039565	yes	BRNAMY
chr1_1379091_T_G_b38	ATAD3C	3.002	0.00337	0.150067	4	0.049989	yes	BRNAMY
chr1_638970_A_C_b38	ATAD3C	2.991	0.00348	0.229859	3	0.076854	yes	BRNAMY
chr1_1366561_AGT_A_b38	ATAD3C	2.98	0.0036	0.13068	13	0.043857	yes	BRNAMY
chr1_1361679_G_A_b38	ATAD3C	2.965	0.00376	0.139286	8	0.046979	yes	BRNAMY
chr1_1309988_G_A_b38	ATAD3C	2.941	0.00404	0.131095	15	0.044576	yes	BRNAMY
chr1_1313807_G_A_b38	ATAD3C	2.941	0.00404	0.131095	15	0.044576	yes	BRNAMY
chr1_1439805_G_C_b38	ATAD3C	-2.918	0.00432	-0.141771	6	0.048582	yes	BRNAMY
chr1_1363898_C_T_b38	ATAD3C	2.899	0.00457	0.146224	4	0.050434	yes	BRNAMY
chr1_1363986_C_T_b38	ATAD3C	2.899	0.00457	0.146224	4	0.050434	yes	BRNAMY
chr1_1365566_G_A_b38	ATAD3C	2.899	0.00457	0.146224	4	0.050434	yes	BRNAMY
chr1_1366529_TTAG_T_b38	ATAD3C	2.899	0.00457	0.146224	4	0.050434	yes	BRNAMY
chr1_1367292_A_AGT_b38	ATAD3C	2.899	0.00457	0.146224	4	0.050434	yes	BRNAMY
chr1_1453643_A_ATT_b38	ATAD3C	-2.875	0.00491	-0.149257	5	0.051912	yes	BRNAMY
chr1_1308516_C_T_b38	ATAD3C	2.874	0.00493	0.12995	15	0.045219	yes	BRNAMY
chr1_1312114_T_C_b38	ATAD3C	2.874	0.00493	0.12995	15	0.045219	yes	BRNAMY
chr1_1330125_G_A_b38	ATAD3C	2.874	0.00493	0.12995	15	0.045219	yes	BRNAMY
chr1_1288085_GC_G_b38	ATAD3C	-2.868	0.00501	-0.153393	3	0.053484	yes	BRNAMY
chr1_1452540_G_A_b38	ATAD3C	-2.843	0.00539	-0.156736	6	0.055128	yes	BRNAMY
chr1_1188054_T_A_b38	ATAD3C	-2.812	0.00589	-0.142566	5	0.05069	yes	BRNAMY
chr1_1426253_G_A_b38	ATAD3C	-2.807	0.00599	-0.147558	3	0.052574	yes	BRNAMY
chr1_1129155_G_C_b38	ATAD3C	-2.793	0.00622	-0.12669	6	0.045356	yes	BRNAMY
chr1_1456182_G_A_b38	ATAD3C	-2.748	0.00709	-0.150004	8	0.054594	yes	BRNAMY
chr1_822556_C_A_b38	ATAD3C	2.697	0.00818	0.163604	3	0.060663	yes	BRNAMY
chr1_1874605_T_TA_b38	ATAD3C	2.697	0.00818	0.162058	7	0.060096	yes	BRNAMY
chr1_1370113_A_G_b38	ATAD3C	2.663	0.009	0.115643	13	0.043431	yes	BRNAMY
chr1_1473089_T_C_b38	ATAD3C	2.931	0.00416	0.183599	8	0.062644	no	BRNAMY
chr1_531693_C_T_b38	ATAD3C	-2.919	0.00431	-0.113046	24	0.038724	no	BRNAMY
chr1_1468048_A_G_b38	ATAD3C	2.816	0.00583	0.206442	5	0.073307	no	BRNAMY
chr1_1398056_C_A_b38	ATAD3C	-2.735	0.00735	-0.111597	16	0.040807	no	BRNAMY
chr1_1476079_T_C_b38	ATAD3C	2.723	0.00759	0.181607	9	0.066689	no	BRNAMY
chr1_531472_G_C_b38	ATAD3C	-2.713	0.00783	-0.109889	21	0.040511	no	BRNAMY
chr1_505074_C_T_b38	ATAD3C	-2.641	0.00954	-0.142665	5	0.05401	no	BRNAMY
chr1_1440430_C_G_b38	ATAD3C	-6.442	2.5e-09	-0.184745	15	0.028678	yes	BRNACC
chr1_1440834_C_G_b38	ATAD3C	-6.353	3.88e-09	-0.179032	20	0.028183	yes	BRNACC
chr1_1443457_T_C_b38	ATAD3C	-6.253	6.28e-09	-0.178078	21	0.028478	yes	BRNACC
chr1_1433374_T_C_b38	ATAD3C	-6.214	7.57e-09	-0.175132	22	0.028182	yes	BRNACC
chr1_1441187_A_G_b38	ATAD3C	-6.133	1.12e-08	-0.179156	16	0.029214	yes	BRNACC
chr1_1436079_A_G_b38	ATAD3C	-5.996	2.16e-08	-0.168644	21	0.028128	yes	BRNACC
chr1_1436388_CA_C_b38	ATAD3C	-5.989	2.22e-08	-0.172464	16	0.028796	yes	BRNACC
chr1_1439454_A_G_b38	ATAD3C	-5.985	2.27e-08	-0.164403	20	0.02747	yes	BRNACC
chr1_1452797_CAA_C_b38	ATAD3C	-5.978	2.35e-08	-0.205515	7	0.03438	yes	BRNACC
chr1_1456079_T_C_b38	ATAD3C	-5.666	1.01e-07	-0.18984	12	0.033504	yes	BRNACC
chr1_1452825_AAAG_A_b38	ATAD3C	-5.542	1.78e-07	-0.187567	12	0.033842	yes	BRNACC
chr1_1453552_G_A_b38	ATAD3C	-5.542	1.78e-07	-0.187567	12	0.033842	yes	BRNACC
chr1_1454848_T_C_b38	ATAD3C	-5.542	1.78e-07	-0.187567	12	0.033842	yes	BRNACC
chr1_1455134_T_G_b38	ATAD3C	-5.542	1.78e-07	-0.187567	12	0.033842	yes	BRNACC
chr1_1455337_A_G_b38	ATAD3C	-5.542	1.78e-07	-0.187567	12	0.033842	yes	BRNACC
chr1_1455495_C_T_b38	ATAD3C	-5.542	1.78e-07	-0.187567	12	0.033842	yes	BRNACC
chr1_1455924_T_C_b38	ATAD3C	-5.542	1.78e-07	-0.187567	12	0.033842	yes	BRNACC
chr1_1456051_C_T_b38	ATAD3C	-5.542	1.78e-07	-0.187567	12	0.033842	yes	BRNACC
chr1_1456182_G_A_b38	ATAD3C	-5.498	2.17e-07	-0.181215	13	0.032961	yes	BRNACC
chr1_1445187_T_G_b38	ATAD3C	-5.433	2.92e-07	-0.156543	20	0.028814	yes	BRNACC
chr1_1445240_A_G_b38	ATAD3C	-5.433	2.92e-07	-0.156543	20	0.028814	yes	BRNACC
chr1_1456154_G_A_b38	ATAD3C	-5.431	2.94e-07	-0.185228	12	0.034105	yes	BRNACC
chr1_1449831_A_G_b38	ATAD3C	-5.39	3.53e-07	-0.181222	15	0.033621	yes	BRNACC
chr1_1457071_C_T_b38	ATAD3C	-5.313	4.99e-07	-0.170809	13	0.032151	yes	BRNACC
chr1_1457033_A_C_b38	ATAD3C	-5.242	6.82e-07	-0.180427	10	0.034417	yes	BRNACC
chr1_1426261_C_T_b38	ATAD3C	-5.238	6.94e-07	-0.165835	17	0.031658	yes	BRNACC
chr1_1426810_C_G_b38	ATAD3C	-5.238	6.94e-07	-0.165835	17	0.031658	yes	BRNACC
chr1_1451968_C_T_b38	ATAD3C	-5.214	7.73e-07	-0.173159	10	0.033211	yes	BRNACC
chr1_1454315_C_T_b38	ATAD3C	-5.149	1.03e-06	-0.171968	15	0.033396	yes	BRNACC
chr1_1452540_G_A_b38	ATAD3C	-5.138	1.08e-06	-0.170562	11	0.033196	yes	BRNACC
chr1_1428969_T_C_b38	ATAD3C	-5.117	1.18e-06	-0.159802	18	0.031228	yes	BRNACC
chr1_1449009_A_T_b38	ATAD3C	-5.107	1.23e-06	-0.177427	11	0.034743	yes	BRNACC
chr1_1430908_A_G_b38	ATAD3C	-5.099	1.28e-06	-0.16059	18	0.031494	yes	BRNACC
chr1_1430190_A_C_b38	ATAD3C	-5.092	1.32e-06	-0.159693	18	0.031364	yes	BRNACC
chr1_1431450_A_G_b38	ATAD3C	-5.092	1.32e-06	-0.159693	18	0.031364	yes	BRNACC
chr1_1431537_G_C_b38	ATAD3C	-5.092	1.32e-06	-0.159693	18	0.031364	yes	BRNACC
chr1_1432355_G_A_b38	ATAD3C	-5.09	1.33e-06	-0.161524	9	0.031732	yes	BRNACC
chr1_1471992_T_C_b38	ATAD3C	-5.065	1.48e-06	-0.171952	16	0.033949	yes	BRNACC
chr1_1456829_G_C_b38	ATAD3C	-5.032	1.71e-06	-0.169285	13	0.033641	yes	BRNACC
chr1_1431014_G_A_b38	ATAD3C	-5.002	1.94e-06	-0.156656	10	0.031317	yes	BRNACC
chr1_1452511_A_G_b38	ATAD3C	-4.996	2e-06	-0.168208	16	0.03367	yes	BRNACC
chr1_1452888_C_A_b38	ATAD3C	-4.996	2e-06	-0.168208	16	0.03367	yes	BRNACC
chr1_1452909_A_C_b38	ATAD3C	-4.996	2e-06	-0.168208	16	0.03367	yes	BRNACC
chr1_1454092_A_G_b38	ATAD3C	-4.996	2e-06	-0.168208	16	0.03367	yes	BRNACC
chr1_1455617_T_G_b38	ATAD3C	-4.996	2e-06	-0.168208	16	0.03367	yes	BRNACC
chr1_1448915_G_A_b38	ATAD3C	-4.989	2.05e-06	-0.150447	17	0.030155	yes	BRNACC
chr1_1452346_A_G_b38	ATAD3C	-4.969	2.24e-06	-0.169733	7	0.034157	yes	BRNACC
chr1_1454770_T_C_b38	ATAD3C	-4.921	2.75e-06	-0.165256	16	0.033582	yes	BRNACC
chr1_1447108_A_ATT_b38	ATAD3C	-4.897	3.05e-06	-0.160592	10	0.032796	yes	BRNACC
chr1_1451787_A_C_b38	ATAD3C	-4.866	3.47e-06	-0.16303	14	0.033506	yes	BRNACC
chr1_1453703_A_G_b38	ATAD3C	-4.839	3.89e-06	-0.165365	16	0.034173	yes	BRNACC
chr1_1452384_G_A_b38	ATAD3C	-4.733	6.05e-06	-0.163386	7	0.034519	yes	BRNACC
chr1_1456891_T_C_b38	ATAD3C	-4.584	1.12e-05	-0.150608	14	0.032856	yes	BRNACC
chr1_1435945_C_CCGGGCGGGGGCG_b38	ATAD3C	-4.54	1.34e-05	-0.156888	7	0.034559	yes	BRNACC
chr1_1517993_A_G_b38	ATAD3C	-4.47	1.77e-05	-0.144903	20	0.032415	yes	BRNACC
chr1_1519934_T_G_b38	ATAD3C	-4.47	1.77e-05	-0.144903	20	0.032415	yes	BRNACC
chr1_1519938_T_C_b38	ATAD3C	-4.47	1.77e-05	-0.144903	20	0.032415	yes	BRNACC
chr1_1434687_C_G_b38	ATAD3C	-4.44	2e-05	-0.152348	7	0.034313	yes	BRNACC
chr1_1438102_G_C_b38	ATAD3C	-4.386	2.48e-05	-0.142755	10	0.032548	yes	BRNACC
chr1_1453643_A_ATT_b38	ATAD3C	-4.378	2.56e-05	-0.142623	12	0.032576	yes	BRNACC
chr1_1451028_T_A_b38	ATAD3C	-4.378	2.56e-05	-0.157851	6	0.036058	yes	BRNACC
chr1_1456217_T_C_b38	ATAD3C	-4.353	2.82e-05	-0.156733	15	0.036002	yes	BRNACC
chr1_1479719_T_C_b38	ATAD3C	-4.314	3.29e-05	-0.144015	17	0.033382	yes	BRNACC
chr1_1442793_G_A_b38	ATAD3C	-4.284	3.7e-05	-0.147293	8	0.034381	yes	BRNACC
chr1_1431656_G_A_b38	ATAD3C	-4.264	4e-05	-0.156439	5	0.036686	yes	BRNACC
chr1_1437955_C_G_b38	ATAD3C	-4.172	5.72e-05	-0.123237	17	0.029542	yes	BRNACC
chr1_1411323_A_C_b38	ATAD3C	-4.171	5.74e-05	-0.14055	16	0.033699	yes	BRNACC
chr1_1358384_G_C_b38	ATAD3C	4.161	5.95e-05	0.142595	15	0.034268	yes	BRNACC
chr1_1431026_CCACCCCCT_C_b38	ATAD3C	-4.13	6.72e-05	-0.143658	10	0.034787	yes	BRNACC
chr1_1387698_A_G_b38	ATAD3C	4.109	7.27e-05	0.138377	16	0.033678	yes	BRNACC
chr1_1500729_G_A_b38	ATAD3C	-4.062	8.68e-05	-0.242291	7	0.059648	yes	BRNACC
chr1_1431813_G_T_b38	ATAD3C	-4.052	9.01e-05	-0.142406	7	0.035146	yes	BRNACC
chr1_1366561_AGT_A_b38	ATAD3C	4.03	9.79e-05	0.13766	14	0.034159	yes	BRNACC
chr1_1439805_G_C_b38	ATAD3C	-4.028	9.86e-05	-0.13789	9	0.034232	yes	BRNACC
chr1_1308516_C_T_b38	ATAD3C	3.991	0.000113	0.137226	15	0.03438	yes	BRNACC
chr1_1309988_G_A_b38	ATAD3C	3.991	0.000113	0.137226	15	0.03438	yes	BRNACC
chr1_1312114_T_C_b38	ATAD3C	3.991	0.000113	0.137226	15	0.03438	yes	BRNACC
chr1_1313807_G_A_b38	ATAD3C	3.991	0.000113	0.137226	15	0.03438	yes	BRNACC
chr1_1330125_G_A_b38	ATAD3C	3.991	0.000113	0.137226	15	0.03438	yes	BRNACC
chr1_1394423_A_G_b38	ATAD3C	-3.98	0.000118	-0.133606	15	0.033567	yes	BRNACC
chr1_1395346_A_G_b38	ATAD3C	-3.98	0.000118	-0.133606	15	0.033567	yes	BRNACC
chr1_1389827_C_T_b38	ATAD3C	3.98	0.000118	0.133606	15	0.033567	yes	BRNACC
chr1_1265603_T_TTGTG_b38	ATAD3C	3.974	0.00012	0.153627	3	0.038653	yes	BRNACC
chr1_1366427_AGTGTGATTGAATGAGT_A_b38	ATAD3C	3.922	0.000146	0.134392	12	0.034264	yes	BRNACC
chr1_1402457_A_G_b38	ATAD3C	-3.922	0.000146	-0.133356	16	0.034002	yes	BRNACC
chr1_1384749_C_G_b38	ATAD3C	3.892	0.000163	0.131448	13	0.033778	yes	BRNACC
chr1_1387763_CCT_C_b38	ATAD3C	3.892	0.000163	0.131448	13	0.033778	yes	BRNACC
chr1_1388944_G_A_b38	ATAD3C	3.892	0.000163	0.131448	13	0.033778	yes	BRNACC
chr1_1376162_G_C_b38	ATAD3C	3.89	0.000164	0.131954	13	0.033919	yes	BRNACC
chr1_1377431_C_T_b38	ATAD3C	3.89	0.000164	0.131954	13	0.033919	yes	BRNACC
chr1_1378204_G_C_b38	ATAD3C	3.89	0.000164	0.131954	13	0.033919	yes	BRNACC
chr1_1428999_C_CA_b38	ATAD3C	-3.827	0.000207	-0.135117	7	0.035311	yes	BRNACC
chr1_1369803_C_CT_b38	ATAD3C	-3.799	0.000229	-0.142253	4	0.037442	yes	BRNACC
chr1_1515567_A_C_b38	ATAD3C	-3.763	0.000261	-0.247092	5	0.065668	yes	BRNACC
chr1_1520875_A_G_b38	ATAD3C	-3.735	0.000288	-0.245152	6	0.065643	yes	BRNACC
chr1_1522905_A_G_b38	ATAD3C	-3.735	0.000288	-0.245152	6	0.065643	yes	BRNACC
chr1_1524202_G_A_b38	ATAD3C	-3.735	0.000288	-0.245152	6	0.065643	yes	BRNACC
chr1_1533018_T_C_b38	ATAD3C	-3.735	0.000288	-0.245152	6	0.065643	yes	BRNACC
chr1_1337898_A_G_b38	ATAD3C	3.734	0.000289	0.124046	8	0.033223	yes	BRNACC
chr1_1400410_A_G_b38	ATAD3C	-3.704	0.000321	-0.126181	13	0.034064	yes	BRNACC
chr1_1523187_A_G_b38	ATAD3C	-3.694	0.000333	-0.213223	6	0.057722	yes	BRNACC
chr1_1521518_G_A_b38	ATAD3C	-3.671	0.000361	-0.249733	6	0.068025	yes	BRNACC
chr1_1302795_T_TC_b38	ATAD3C	3.641	0.000401	0.131414	17	0.036092	yes	BRNACC
chr1_1370113_A_G_b38	ATAD3C	3.641	0.000401	0.12007	13	0.032977	yes	BRNACC
chr1_1437993_G_A_b38	ATAD3C	-3.578	0.000499	-0.11531	10	0.032229	yes	BRNACC
chr1_1530002_A_G_b38	ATAD3C	-3.552	0.000545	-0.234178	5	0.065923	yes	BRNACC
chr1_1290261_C_A_b38	ATAD3C	-3.541	0.000567	-0.163067	9	0.046052	yes	BRNACC
chr1_1361685_C_T_b38	ATAD3C	-3.483	0.00069	-0.142652	5	0.040953	yes	BRNACC
chr1_1361679_G_A_b38	ATAD3C	3.455	0.000759	0.129313	8	0.037427	yes	BRNACC
chr1_1215852_T_C_b38	ATAD3C	-3.45	0.000772	-0.127136	6	0.03685	yes	BRNACC
chr1_1541864_T_C_b38	ATAD3C	-3.434	0.000814	-0.112637	20	0.032798	yes	BRNACC
chr1_1532798_T_C_b38	ATAD3C	-3.429	0.000828	-0.106323	39	0.031005	yes	BRNACC
chr1_1545795_C_A_b38	ATAD3C	-3.428	0.000832	-0.110721	16	0.0323	yes	BRNACC
chr1_1379083_AT_A_b38	ATAD3C	3.425	0.00084	0.109051	12	0.031839	yes	BRNACC
chr1_1571794_A_AT_b38	ATAD3C	-3.421	0.000852	-0.119083	17	0.03481	yes	BRNACC
chr1_1526169_C_T_b38	ATAD3C	-3.418	0.000859	-0.212765	5	0.062244	yes	BRNACC
chr1_1368763_G_A_b38	ATAD3C	-3.371	0.00101	-0.133744	3	0.039675	yes	BRNACC
chr1_1368177_G_C_b38	ATAD3C	-3.368	0.00102	-0.136217	3	0.040445	yes	BRNACC
chr1_1542793_C_G_b38	ATAD3C	-3.355	0.00106	-0.109002	18	0.032489	yes	BRNACC
chr1_1542800_T_C_b38	ATAD3C	-3.355	0.00106	-0.109002	18	0.032489	yes	BRNACC
chr1_1482316_C_G_b38	ATAD3C	-3.353	0.00107	-0.113391	10	0.033822	yes	BRNACC
chr1_1542773_T_C_b38	ATAD3C	-3.342	0.00111	-0.109705	19	0.032829	yes	BRNACC
chr1_1543953_A_G_b38	ATAD3C	-3.342	0.00111	-0.109705	19	0.032829	yes	BRNACC
chr1_1550064_GC_G_b38	ATAD3C	-3.342	0.00111	-0.109705	19	0.032829	yes	BRNACC
chr1_1550068_C_A_b38	ATAD3C	-3.342	0.00111	-0.109705	19	0.032829	yes	BRNACC
chr1_1558726_C_CA_b38	ATAD3C	-3.34	0.00111	-0.110738	20	0.033153	yes	BRNACC
chr1_1561821_A_C_b38	ATAD3C	-3.34	0.00111	-0.110738	20	0.033153	yes	BRNACC
chr1_1216593_G_C_b38	ATAD3C	-3.34	0.00112	-0.123354	6	0.036936	yes	BRNACC
chr1_1316929_A_T_b38	ATAD3C	-3.292	0.0013	-0.126902	4	0.03855	yes	BRNACC
chr1_1363456_CAG_C_b38	ATAD3C	3.266	0.00142	0.105516	11	0.032304	yes	BRNACC
chr1_1231507_T_C_b38	ATAD3C	-3.261	0.00144	-0.124031	4	0.038029	yes	BRNACC
chr1_1367919_C_T_b38	ATAD3C	-3.241	0.00154	-0.130043	3	0.04013	yes	BRNACC
chr1_1367951_C_T_b38	ATAD3C	-3.241	0.00154	-0.130043	3	0.04013	yes	BRNACC
chr1_1367965_A_G_b38	ATAD3C	-3.241	0.00154	-0.130043	3	0.04013	yes	BRNACC
chr1_1367970_T_G_b38	ATAD3C	-3.241	0.00154	-0.130043	3	0.04013	yes	BRNACC
chr1_1367994_C_A_b38	ATAD3C	-3.241	0.00154	-0.130043	3	0.04013	yes	BRNACC
chr1_1368297_C_T_b38	ATAD3C	-3.241	0.00154	-0.130043	3	0.04013	yes	BRNACC
chr1_1368514_C_G_b38	ATAD3C	-3.241	0.00154	-0.130043	3	0.04013	yes	BRNACC
chr1_1368991_C_T_b38	ATAD3C	-3.241	0.00154	-0.130043	3	0.04013	yes	BRNACC
chr1_1369009_T_C_b38	ATAD3C	-3.241	0.00154	-0.130043	3	0.04013	yes	BRNACC
chr1_1369012_C_CG_b38	ATAD3C	-3.241	0.00154	-0.130043	3	0.04013	yes	BRNACC
chr1_1369282_G_A_b38	ATAD3C	-3.237	0.00156	-0.129935	3	0.040144	yes	BRNACC
chr1_1369320_GT_G_b38	ATAD3C	-3.237	0.00156	-0.129935	3	0.040144	yes	BRNACC
chr1_1369407_G_A_b38	ATAD3C	-3.237	0.00156	-0.129935	3	0.040144	yes	BRNACC
chr1_1369476_CTT_C_b38	ATAD3C	-3.237	0.00156	-0.129935	3	0.040144	yes	BRNACC
chr1_1369556_C_G_b38	ATAD3C	-3.237	0.00156	-0.129935	3	0.040144	yes	BRNACC
chr1_1369627_T_C_b38	ATAD3C	-3.237	0.00156	-0.129935	3	0.040144	yes	BRNACC
chr1_1369686_T_C_b38	ATAD3C	-3.237	0.00156	-0.129935	3	0.040144	yes	BRNACC
chr1_1369716_G_C_b38	ATAD3C	-3.237	0.00156	-0.129935	3	0.040144	yes	BRNACC
chr1_1369741_C_T_b38	ATAD3C	-3.237	0.00156	-0.129935	3	0.040144	yes	BRNACC
chr1_1369821_C_T_b38	ATAD3C	-3.237	0.00156	-0.129935	3	0.040144	yes	BRNACC
chr1_1388565_GTC_G_b38	ATAD3C	3.225	0.00162	0.110955	10	0.03441	yes	BRNACC
chr1_1538787_A_G_b38	ATAD3C	-3.216	0.00167	-0.106719	21	0.033181	yes	BRNACC
chr1_1557495_CAT_C_b38	ATAD3C	-3.21	0.0017	-0.106443	20	0.03316	yes	BRNACC
chr1_1567912_C_CAAAAAAAA_b38	ATAD3C	-3.207	0.00172	-0.160862	4	0.050165	yes	BRNACC
chr1_1547630_G_A_b38	ATAD3C	-3.206	0.00172	-0.103144	18	0.032177	yes	BRNACC
chr1_1383743_T_C_b38	ATAD3C	-3.198	0.00177	-0.126844	3	0.039667	yes	BRNACC
chr1_1543500_T_G_b38	ATAD3C	-3.182	0.00186	-0.103775	20	0.032612	yes	BRNACC
chr1_1375642_C_T_b38	ATAD3C	-3.18	0.00187	-0.126043	3	0.039635	yes	BRNACC
chr1_1569661_T_C_b38	ATAD3C	-3.147	0.00208	-0.104422	18	0.03318	yes	BRNACC
chr1_1559750_C_CAG_b38	ATAD3C	-3.128	0.0022	-0.105114	21	0.033601	yes	BRNACC
chr1_1561628_T_C_b38	ATAD3C	-3.128	0.0022	-0.105114	21	0.033601	yes	BRNACC
chr1_1563918_A_G_b38	ATAD3C	-3.128	0.0022	-0.105114	21	0.033601	yes	BRNACC
chr1_1565561_A_G_b38	ATAD3C	-3.128	0.0022	-0.105114	21	0.033601	yes	BRNACC
chr1_1566086_G_A_b38	ATAD3C	-3.128	0.0022	-0.105114	21	0.033601	yes	BRNACC
chr1_1567715_G_A_b38	ATAD3C	-3.128	0.0022	-0.105114	21	0.033601	yes	BRNACC
chr1_1567719_A_C_b38	ATAD3C	-3.128	0.0022	-0.105114	21	0.033601	yes	BRNACC
chr1_1569875_C_T_b38	ATAD3C	-3.128	0.0022	-0.105114	21	0.033601	yes	BRNACC
chr1_1549590_C_G_b38	ATAD3C	-3.126	0.00222	-0.103829	20	0.033215	yes	BRNACC
chr1_1363898_C_T_b38	ATAD3C	3.109	0.00234	0.119598	4	0.038466	yes	BRNACC
chr1_1363986_C_T_b38	ATAD3C	3.109	0.00234	0.119598	4	0.038466	yes	BRNACC
chr1_1365566_G_A_b38	ATAD3C	3.109	0.00234	0.119598	4	0.038466	yes	BRNACC
chr1_1366529_TTAG_T_b38	ATAD3C	3.109	0.00234	0.119598	4	0.038466	yes	BRNACC
chr1_1367292_A_AGT_b38	ATAD3C	3.109	0.00234	0.119598	4	0.038466	yes	BRNACC
chr1_1217733_G_A_b38	ATAD3C	-3.108	0.00235	-0.117719	5	0.037879	yes	BRNACC
chr1_1492939_C_CA_b38	ATAD3C	-3.1	0.00241	-0.178616	3	0.057623	yes	BRNACC
chr1_1379093_TG_T_b38	ATAD3C	-3.097	0.00243	-0.123256	3	0.039794	yes	BRNACC
chr1_1380867_A_G_b38	ATAD3C	-3.097	0.00243	-0.123256	3	0.039794	yes	BRNACC
chr1_1382893_G_A_b38	ATAD3C	-3.097	0.00243	-0.123256	3	0.039794	yes	BRNACC
chr1_1384546_C_T_b38	ATAD3C	-3.097	0.00243	-0.123256	3	0.039794	yes	BRNACC
chr1_1398218_C_A_b38	ATAD3C	-3.097	0.00243	-0.123256	3	0.039794	yes	BRNACC
chr1_1308178_GGGGCGCGGGGA_G_b38	ATAD3C	-3.083	0.00254	-0.115327	5	0.03741	yes	BRNACC
chr1_1570294_CA_C_b38	ATAD3C	-3.076	0.00259	-0.101504	19	0.032997	yes	BRNACC
chr1_1569180_T_A_b38	ATAD3C	-3.071	0.00264	-0.104242	20	0.033945	yes	BRNACC
chr1_1374505_A_G_b38	ATAD3C	-3.051	0.00281	-0.122443	3	0.040137	yes	BRNACC
chr1_1235602_C_A_b38	ATAD3C	-3.042	0.00288	-0.118842	4	0.039066	yes	BRNACC
chr1_1553692_A_G_b38	ATAD3C	-3.039	0.00291	-0.102237	20	0.033643	yes	BRNACC
chr1_1554694_A_G_b38	ATAD3C	-3.039	0.00291	-0.102237	20	0.033643	yes	BRNACC
chr1_1555247_T_A_b38	ATAD3C	-3.039	0.00291	-0.102237	20	0.033643	yes	BRNACC
chr1_1572532_A_C_b38	ATAD3C	-3.038	0.00292	-0.101879	21	0.033534	yes	BRNACC
chr1_1573079_A_G_b38	ATAD3C	-3.038	0.00292	-0.101879	21	0.033534	yes	BRNACC
chr1_1379091_T_G_b38	ATAD3C	3.035	0.00295	0.112951	5	0.037222	yes	BRNACC
chr1_1565680_A_AG_b38	ATAD3C	-3.031	0.00298	-0.100932	21	0.033295	yes	BRNACC
chr1_1527386_C_T_b38	ATAD3C	-2.983	0.00345	-0.189325	5	0.063468	yes	BRNACC
chr1_1554781_A_G_b38	ATAD3C	-2.979	0.00349	-0.099919	20	0.033537	yes	BRNACC
chr1_1236303_A_G_b38	ATAD3C	-2.969	0.0036	-0.11388	5	0.038353	yes	BRNACC
chr1_1560765_T_C_b38	ATAD3C	-2.966	0.00364	-0.102799	14	0.034663	yes	BRNACC
chr1_1562261_TTTTC_T_b38	ATAD3C	-2.966	0.00364	-0.102799	14	0.034663	yes	BRNACC
chr1_1443673_CTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT_C_b38	ATAD3C	-2.96	0.0037	-0.187	3	0.063176	yes	BRNACC
chr1_1534226_C_T_b38	ATAD3C	-2.957	0.00373	-0.103726	13	0.035076	yes	BRNACC
chr1_1450322_CA_C_b38	ATAD3C	-2.947	0.00385	-0.133888	3	0.045429	yes	BRNACC
chr1_1201373_T_C_b38	ATAD3C	-2.944	0.00389	-0.105797	13	0.035939	yes	BRNACC
chr1_1249880_A_G_b38	ATAD3C	-2.905	0.00437	-0.11211	8	0.038593	yes	BRNACC
chr1_1290841_A_G_b38	ATAD3C	-2.891	0.00456	-0.121372	8	0.041988	yes	BRNACC
chr1_1400756_GGA_G_b38	ATAD3C	-2.883	0.00466	-0.115414	3	0.040032	yes	BRNACC
chr1_1401954_G_T_b38	ATAD3C	-2.883	0.00466	-0.115414	3	0.040032	yes	BRNACC
chr1_1403593_A_G_b38	ATAD3C	-2.883	0.00466	-0.115414	3	0.040032	yes	BRNACC
chr1_1407565_C_A_b38	ATAD3C	-2.883	0.00466	-0.115414	3	0.040032	yes	BRNACC
chr1_1188054_T_A_b38	ATAD3C	-2.863	0.00494	-0.103527	7	0.036156	yes	BRNACC
chr1_1238231_G_A_b38	ATAD3C	-2.843	0.00524	-0.105487	8	0.037102	yes	BRNACC
chr1_1565105_CAAGGCAGGCGGATCATG_C_b38	ATAD3C	-2.828	0.00549	-0.092815	23	0.032821	yes	BRNACC
chr1_1226486_C_T_b38	ATAD3C	-2.824	0.00555	-0.110545	4	0.039143	yes	BRNACC
chr1_1231710_CCCCCGGGAA_C_b38	ATAD3C	-2.814	0.00572	-0.111181	4	0.039516	yes	BRNACC
chr1_1243650_G_A_b38	ATAD3C	-2.812	0.00574	-0.123177	3	0.043797	yes	BRNACC
chr1_1228424_C_T_b38	ATAD3C	-2.807	0.00583	-0.105899	4	0.03773	yes	BRNACC
chr1_1522693_A_G_b38	ATAD3C	2.807	0.00584	0.106796	5	0.038053	yes	BRNACC
chr1_1554852_T_C_b38	ATAD3C	-2.799	0.00597	-0.093487	20	0.0334	yes	BRNACC
chr1_1217251_C_A_b38	ATAD3C	-2.776	0.00637	-0.114708	4	0.041317	yes	BRNACC
chr1_1548572_A_AC_b38	ATAD3C	-2.741	0.00705	-0.143058	4	0.052184	yes	BRNACC
chr1_1251122_A_T_b38	ATAD3C	-2.738	0.00711	-0.102228	9	0.037331	yes	BRNACC
chr1_1559703_G_C_b38	ATAD3C	-2.733	0.00721	-0.095534	15	0.034953	yes	BRNACC
chr1_1568548_G_A_b38	ATAD3C	-2.733	0.00721	-0.095534	15	0.034953	yes	BRNACC
chr1_1539491_G_C_b38	ATAD3C	-2.705	0.00782	-0.094438	17	0.034913	yes	BRNACC
chr1_1537493_T_A_b38	ATAD3C	-2.704	0.00784	-0.094006	16	0.034766	yes	BRNACC
chr1_1500745_A_C_b38	ATAD3C	-2.697	0.00799	-0.142926	9	0.052992	yes	BRNACC
chr1_1244603_G_A_b38	ATAD3C	-2.695	0.00805	-0.120575	3	0.044748	yes	BRNACC
chr1_1501260_A_AT_b38	ATAD3C	-2.651	0.0091	-0.112769	3	0.042542	yes	BRNACC
chr1_2401201_T_C_b38	ATAD3C	2.643	0.00931	0.125696	5	0.047561	yes	BRNACC
chr1_1574655_GGC_G_b38	ATAD3C	-2.641	0.00935	-0.091087	15	0.034487	yes	BRNACC
chr1_1246371_T_C_b38	ATAD3C	-2.625	0.00979	-0.114011	6	0.043434	yes	BRNACC
chr1_1426253_G_A_b38	ATAD3C	-4.476	1.73e-05	-0.166114	4	0.037111	no	BRNACC
chr1_1450636_A_G_b38	ATAD3C	-4.338	3e-05	-0.164531	4	0.037929	no	BRNACC
chr1_1453961_C_T_b38	ATAD3C	-4.319	3.23e-05	-0.160384	5	0.037137	no	BRNACC
chr1_1453870_A_C_b38	ATAD3C	-4.072	8.35e-05	-0.152775	5	0.037516	no	BRNACC
chr1_1551557_A_AG_b38	ATAD3C	-3.466	0.000732	-0.112252	19	0.032389	no	BRNACC
chr1_1551559_A_T_b38	ATAD3C	-3.466	0.000732	-0.112252	19	0.032389	no	BRNACC
chr1_1497605_G_C_b38	ATAD3C	-3.093	0.00246	-0.109008	11	0.035246	no	BRNACC
chr1_1573654_T_C_b38	ATAD3C	-3.025	0.00304	-0.100197	21	0.033125	no	BRNACC
chr1_1574445_A_G_b38	ATAD3C	-3.025	0.00304	-0.100197	21	0.033125	no	BRNACC
chr1_1265603_T_TTG_b38	ATAD3C	-2.999	0.00329	-0.112999	5	0.037675	no	BRNACC
chr1_1577491_A_AC_b38	ATAD3C	-2.939	0.00394	-0.097708	22	0.033243	no	BRNACC
chr1_1575724_G_C_b38	ATAD3C	-2.936	0.00398	-0.097317	20	0.033148	no	BRNACC
chr1_1324173_G_GGGCTCGGGGGCTGGGGGGCTGCTGGGCTGAGA_b38	ATAD3C	2.888	0.00459	0.069827	13	0.024177	no	BRNACC
chr1_1575421_C_T_b38	ATAD3C	-2.81	0.00578	-0.09291	19	0.033065	no	BRNACC
chr1_1771973_A_AT_b38	ATAD3C	2.768	0.00652	0.122203	14	0.044143	no	BRNACC
chr1_2060286_A_G_b38	ATAD3C	2.652	0.00908	0.092343	10	0.034821	no	BRNACC
chr1_1440834_C_G_b38	ATAD3C	-8.065	1.97e-13	-0.216853	30	0.026887	yes	BRNCDT
chr1_1443457_T_C_b38	ATAD3C	-7.901	5.05e-13	-0.213183	30	0.026983	yes	BRNCDT
chr1_1440430_C_G_b38	ATAD3C	-7.696	1.61e-12	-0.209396	21	0.027208	yes	BRNCDT
chr1_1433374_T_C_b38	ATAD3C	-7.621	2.46e-12	-0.206787	32	0.027133	yes	BRNCDT
chr1_1439454_A_G_b38	ATAD3C	-7.581	3.08e-12	-0.201273	30	0.02655	yes	BRNCDT
chr1_1441187_A_G_b38	ATAD3C	-7.384	9.23e-12	-0.21284	23	0.028825	yes	BRNCDT
chr1_1436388_CA_C_b38	ATAD3C	-7.082	4.85e-11	-0.202539	21	0.028601	yes	BRNCDT
chr1_1430190_A_C_b38	ATAD3C	-7.063	5.37e-11	-0.201406	29	0.028517	yes	BRNCDT
chr1_1430908_A_G_b38	ATAD3C	-7.063	5.37e-11	-0.201406	29	0.028517	yes	BRNCDT
chr1_1431450_A_G_b38	ATAD3C	-7.063	5.37e-11	-0.201406	29	0.028517	yes	BRNCDT
chr1_1431537_G_C_b38	ATAD3C	-7.063	5.37e-11	-0.201406	29	0.028517	yes	BRNCDT
chr1_1436079_A_G_b38	ATAD3C	-7.053	5.67e-11	-0.190783	30	0.027051	yes	BRNCDT
chr1_1445187_T_G_b38	ATAD3C	-7.014	6.98e-11	-0.191312	27	0.027274	yes	BRNCDT
chr1_1445240_A_G_b38	ATAD3C	-6.881	1.43e-10	-0.189958	28	0.027607	yes	BRNCDT
chr1_1432355_G_A_b38	ATAD3C	-6.845	1.74e-10	-0.210115	12	0.030698	yes	BRNCDT
chr1_1428969_T_C_b38	ATAD3C	-6.525	9.41e-10	-0.191025	29	0.029276	yes	BRNCDT
chr1_1448915_G_A_b38	ATAD3C	-6.514	9.96e-10	-0.183465	21	0.028164	yes	BRNCDT
chr1_1426261_C_T_b38	ATAD3C	-6.33	2.58e-09	-0.190751	28	0.030132	yes	BRNCDT
chr1_1426810_C_G_b38	ATAD3C	-6.33	2.58e-09	-0.190751	28	0.030132	yes	BRNCDT
chr1_1437955_C_G_b38	ATAD3C	-5.836	3.09e-08	-0.153062	22	0.026228	yes	BRNCDT
chr1_1438102_G_C_b38	ATAD3C	-5.792	3.83e-08	-0.173553	13	0.029963	yes	BRNCDT
chr1_1431014_G_A_b38	ATAD3C	-5.766	4.34e-08	-0.162057	17	0.028104	yes	BRNCDT
chr1_1449831_A_G_b38	ATAD3C	-5.739	4.95e-08	-0.187586	24	0.032684	yes	BRNCDT
chr1_1442793_G_A_b38	ATAD3C	-5.514	1.46e-07	-0.185037	9	0.03356	yes	BRNCDT
chr1_1551454_C_A_b38	ATAD3C	-5.45	1.98e-07	-0.148228	56	0.027199	yes	BRNCDT
chr1_1431656_G_A_b38	ATAD3C	-5.438	2.09e-07	-0.187719	7	0.03452	yes	BRNCDT
chr1_1454315_C_T_b38	ATAD3C	-5.431	2.16e-07	-0.172248	21	0.031716	yes	BRNCDT
chr1_1435945_C_CCGGGCGGGGGCG_b38	ATAD3C	-5.419	2.28e-07	-0.18218	9	0.033616	yes	BRNCDT
chr1_1434687_C_G_b38	ATAD3C	-5.361	3e-07	-0.181884	8	0.03393	yes	BRNCDT
chr1_1431026_CCACCCCCT_C_b38	ATAD3C	-5.328	3.49e-07	-0.167151	15	0.031373	yes	BRNCDT
chr1_1454848_T_C_b38	ATAD3C	-5.296	4.06e-07	-0.169414	14	0.031992	yes	BRNCDT
chr1_1456079_T_C_b38	ATAD3C	-5.286	4.25e-07	-0.171411	14	0.032429	yes	BRNCDT
chr1_1455617_T_G_b38	ATAD3C	-5.283	4.3e-07	-0.170745	25	0.032321	yes	BRNCDT
chr1_1452825_AAAG_A_b38	ATAD3C	-5.247	5.07e-07	-0.170251	14	0.032446	yes	BRNCDT
chr1_1453552_G_A_b38	ATAD3C	-5.247	5.07e-07	-0.170251	14	0.032446	yes	BRNCDT
chr1_1455134_T_G_b38	ATAD3C	-5.247	5.07e-07	-0.170251	14	0.032446	yes	BRNCDT
chr1_1455337_A_G_b38	ATAD3C	-5.247	5.07e-07	-0.170251	14	0.032446	yes	BRNCDT
chr1_1455495_C_T_b38	ATAD3C	-5.247	5.07e-07	-0.170251	14	0.032446	yes	BRNCDT
chr1_1455924_T_C_b38	ATAD3C	-5.247	5.07e-07	-0.170251	14	0.032446	yes	BRNCDT
chr1_1456051_C_T_b38	ATAD3C	-5.247	5.07e-07	-0.170251	14	0.032446	yes	BRNCDT
chr1_1456154_G_A_b38	ATAD3C	-5.247	5.07e-07	-0.170251	14	0.032446	yes	BRNCDT
chr1_1452511_A_G_b38	ATAD3C	-5.242	5.18e-07	-0.168169	24	0.032079	yes	BRNCDT
chr1_1452888_C_A_b38	ATAD3C	-5.242	5.18e-07	-0.168169	24	0.032079	yes	BRNCDT
chr1_1452909_A_C_b38	ATAD3C	-5.242	5.18e-07	-0.168169	24	0.032079	yes	BRNCDT
chr1_1454092_A_G_b38	ATAD3C	-5.242	5.18e-07	-0.168169	24	0.032079	yes	BRNCDT
chr1_1449009_A_T_b38	ATAD3C	-5.223	5.67e-07	-0.175755	16	0.033651	yes	BRNCDT
chr1_1454770_T_C_b38	ATAD3C	-5.216	5.84e-07	-0.167312	25	0.032075	yes	BRNCDT
chr1_1431813_G_T_b38	ATAD3C	-5.199	6.33e-07	-0.172374	9	0.033157	yes	BRNCDT
chr1_1453703_A_G_b38	ATAD3C	-5.016	1.45e-06	-0.162111	24	0.032321	yes	BRNCDT
chr1_1452540_G_A_b38	ATAD3C	-4.963	1.83e-06	-0.160143	12	0.03227	yes	BRNCDT
chr1_1451968_C_T_b38	ATAD3C	-4.93	2.12e-06	-0.158832	12	0.032219	yes	BRNCDT
chr1_1387698_A_G_b38	ATAD3C	4.847	3.05e-06	0.149071	25	0.030758	yes	BRNCDT
chr1_1389827_C_T_b38	ATAD3C	4.847	3.05e-06	0.149071	25	0.030758	yes	BRNCDT
chr1_1394423_A_G_b38	ATAD3C	-4.847	3.05e-06	-0.149071	25	0.030758	yes	BRNCDT
chr1_1395346_A_G_b38	ATAD3C	-4.847	3.05e-06	-0.149071	25	0.030758	yes	BRNCDT
chr1_1402457_A_G_b38	ATAD3C	-4.847	3.05e-06	-0.149071	25	0.030758	yes	BRNCDT
chr1_1439805_G_C_b38	ATAD3C	-4.835	3.22e-06	-0.161677	12	0.03344	yes	BRNCDT
chr1_1451787_A_C_b38	ATAD3C	-4.816	3.49e-06	-0.15391	20	0.031958	yes	BRNCDT
chr1_1532798_T_C_b38	ATAD3C	-4.794	3.85e-06	-0.133259	53	0.0278	yes	BRNCDT
chr1_1457071_C_T_b38	ATAD3C	-4.791	3.9e-06	-0.147346	17	0.030757	yes	BRNCDT
chr1_1411323_A_C_b38	ATAD3C	-4.78	4.07e-06	-0.149536	27	0.03128	yes	BRNCDT
chr1_1426253_G_A_b38	ATAD3C	-4.734	4.98e-06	-0.172182	6	0.036372	yes	BRNCDT
chr1_1309988_G_A_b38	ATAD3C	4.704	5.65e-06	0.141422	27	0.030063	yes	BRNCDT
chr1_1313807_G_A_b38	ATAD3C	4.704	5.65e-06	0.141422	27	0.030063	yes	BRNCDT
chr1_1398056_C_A_b38	ATAD3C	-4.677	6.35e-06	-0.130044	20	0.027804	yes	BRNCDT
chr1_1437993_G_A_b38	ATAD3C	-4.646	7.25e-06	-0.149403	12	0.032158	yes	BRNCDT
chr1_1312114_T_C_b38	ATAD3C	4.607	8.56e-06	0.13918	27	0.030213	yes	BRNCDT
chr1_1457033_A_C_b38	ATAD3C	-4.606	8.57e-06	-0.147865	14	0.0321	yes	BRNCDT
chr1_1384749_C_G_b38	ATAD3C	4.596	8.95e-06	0.13841	23	0.030114	yes	BRNCDT
chr1_1387763_CCT_C_b38	ATAD3C	4.596	8.95e-06	0.13841	23	0.030114	yes	BRNCDT
chr1_1388944_G_A_b38	ATAD3C	4.596	8.95e-06	0.13841	23	0.030114	yes	BRNCDT
chr1_1308516_C_T_b38	ATAD3C	4.586	9.35e-06	0.138835	27	0.030275	yes	BRNCDT
chr1_1330125_G_A_b38	ATAD3C	4.521	1.22e-05	0.139531	26	0.030862	yes	BRNCDT
chr1_1541864_T_C_b38	ATAD3C	-4.505	1.31e-05	-0.130548	32	0.028976	yes	BRNCDT
chr1_1456182_G_A_b38	ATAD3C	-4.501	1.33e-05	-0.146466	15	0.032539	yes	BRNCDT
chr1_1456891_T_C_b38	ATAD3C	-4.5	1.34e-05	-0.135343	17	0.030079	yes	BRNCDT
chr1_1471992_T_C_b38	ATAD3C	-4.498	1.35e-05	-0.141132	28	0.031376	yes	BRNCDT
chr1_1376162_G_C_b38	ATAD3C	4.495	1.36e-05	0.135234	23	0.030082	yes	BRNCDT
chr1_1377431_C_T_b38	ATAD3C	4.495	1.36e-05	0.135234	23	0.030082	yes	BRNCDT
chr1_1378204_G_C_b38	ATAD3C	4.495	1.36e-05	0.135234	23	0.030082	yes	BRNCDT
chr1_1400410_A_G_b38	ATAD3C	-4.491	1.39e-05	-0.134848	22	0.030028	yes	BRNCDT
chr1_1551557_A_AG_b38	ATAD3C	-4.471	1.51e-05	-0.129207	30	0.028899	yes	BRNCDT
chr1_1551559_A_T_b38	ATAD3C	-4.471	1.51e-05	-0.129207	30	0.028899	yes	BRNCDT
chr1_1358384_G_C_b38	ATAD3C	4.459	1.58e-05	0.137139	25	0.030754	yes	BRNCDT
chr1_1366561_AGT_A_b38	ATAD3C	4.459	1.58e-05	0.137139	25	0.030754	yes	BRNCDT
chr1_1574445_A_G_b38	ATAD3C	-4.439	1.72e-05	-0.129845	33	0.029254	yes	BRNCDT
chr1_1545795_C_A_b38	ATAD3C	-4.438	1.73e-05	-0.124533	28	0.02806	yes	BRNCDT
chr1_1542773_T_C_b38	ATAD3C	-4.428	1.8e-05	-0.126316	32	0.028528	yes	BRNCDT
chr1_1558726_C_CA_b38	ATAD3C	-4.428	1.8e-05	-0.126316	32	0.028528	yes	BRNCDT
chr1_1561821_A_C_b38	ATAD3C	-4.428	1.8e-05	-0.126316	32	0.028528	yes	BRNCDT
chr1_1543953_A_G_b38	ATAD3C	-4.421	1.85e-05	-0.126233	32	0.028553	yes	BRNCDT
chr1_1452797_CAA_C_b38	ATAD3C	-4.389	2.11e-05	-0.15689	9	0.035748	yes	BRNCDT
chr1_1542793_C_G_b38	ATAD3C	-4.384	2.15e-05	-0.124839	31	0.028474	yes	BRNCDT
chr1_1542800_T_C_b38	ATAD3C	-4.384	2.15e-05	-0.124839	31	0.028474	yes	BRNCDT
chr1_1565105_CAAGGCAGGCGGATCATG_C_b38	ATAD3C	-4.384	2.16e-05	-0.124588	35	0.028422	yes	BRNCDT
chr1_1573654_T_C_b38	ATAD3C	-4.366	2.32e-05	-0.12583	33	0.028819	yes	BRNCDT
chr1_1575724_G_C_b38	ATAD3C	-4.366	2.32e-05	-0.12583	33	0.028819	yes	BRNCDT
chr1_1570294_CA_C_b38	ATAD3C	-4.365	2.33e-05	-0.123503	32	0.028292	yes	BRNCDT
chr1_1550064_GC_G_b38	ATAD3C	-4.329	2.7e-05	-0.12561	31	0.029016	yes	BRNCDT
chr1_1550068_C_A_b38	ATAD3C	-4.329	2.7e-05	-0.12561	31	0.029016	yes	BRNCDT
chr1_1575421_C_T_b38	ATAD3C	-4.32	2.79e-05	-0.12523	32	0.028988	yes	BRNCDT
chr1_1456217_T_C_b38	ATAD3C	-4.279	3.3e-05	-0.145816	24	0.034079	yes	BRNCDT
chr1_1569661_T_C_b38	ATAD3C	-4.272	3.39e-05	-0.120825	32	0.028281	yes	BRNCDT
chr1_1554852_T_C_b38	ATAD3C	-4.228	4.05e-05	-0.119478	34	0.02826	yes	BRNCDT
chr1_1447108_A_ATT_b38	ATAD3C	-4.226	4.08e-05	-0.136244	12	0.032243	yes	BRNCDT
chr1_1543500_T_G_b38	ATAD3C	-4.221	4.15e-05	-0.121505	32	0.028784	yes	BRNCDT
chr1_1557495_CAT_C_b38	ATAD3C	-4.207	4.39e-05	-0.120585	32	0.028662	yes	BRNCDT
chr1_1538787_A_G_b38	ATAD3C	-4.203	4.46e-05	-0.121406	34	0.028885	yes	BRNCDT
chr1_1566086_G_A_b38	ATAD3C	-4.203	4.46e-05	-0.121406	34	0.028885	yes	BRNCDT
chr1_1370113_A_G_b38	ATAD3C	4.196	4.59e-05	0.124958	21	0.02978	yes	BRNCDT
chr1_1537160_T_G_b38	ATAD3C	-4.168	5.12e-05	-0.119817	39	0.028747	yes	BRNCDT
chr1_1572532_A_C_b38	ATAD3C	-4.167	5.14e-05	-0.11807	34	0.028333	yes	BRNCDT
chr1_1573079_A_G_b38	ATAD3C	-4.167	5.14e-05	-0.11807	34	0.028333	yes	BRNCDT
chr1_1366427_AGTGTGATTGAATGAGT_A_b38	ATAD3C	4.154	5.41e-05	0.125411	21	0.030189	yes	BRNCDT
chr1_1549590_C_G_b38	ATAD3C	-4.136	5.81e-05	-0.11767	34	0.028451	yes	BRNCDT
chr1_1553692_A_G_b38	ATAD3C	-4.136	5.81e-05	-0.11767	34	0.028451	yes	BRNCDT
chr1_1554694_A_G_b38	ATAD3C	-4.136	5.81e-05	-0.11767	34	0.028451	yes	BRNCDT
chr1_1555247_T_A_b38	ATAD3C	-4.136	5.81e-05	-0.11767	34	0.028451	yes	BRNCDT
chr1_1559750_C_CAG_b38	ATAD3C	-4.136	5.81e-05	-0.11767	34	0.028451	yes	BRNCDT
chr1_1561628_T_C_b38	ATAD3C	-4.136	5.81e-05	-0.11767	34	0.028451	yes	BRNCDT
chr1_1563918_A_G_b38	ATAD3C	-4.136	5.81e-05	-0.11767	34	0.028451	yes	BRNCDT
chr1_1565561_A_G_b38	ATAD3C	-4.136	5.81e-05	-0.11767	34	0.028451	yes	BRNCDT
chr1_1567715_G_A_b38	ATAD3C	-4.136	5.81e-05	-0.11767	34	0.028451	yes	BRNCDT
chr1_1567719_A_C_b38	ATAD3C	-4.136	5.81e-05	-0.11767	34	0.028451	yes	BRNCDT
chr1_1569875_C_T_b38	ATAD3C	-4.136	5.81e-05	-0.11767	34	0.028451	yes	BRNCDT
chr1_1452346_A_G_b38	ATAD3C	-4.135	5.84e-05	-0.141719	8	0.034277	yes	BRNCDT
chr1_1577491_A_AC_b38	ATAD3C	-4.067	7.59e-05	-0.118818	34	0.029214	yes	BRNCDT
chr1_2101945_G_C_b38	ATAD3C	4.024	8.95e-05	0.112027	27	0.027837	yes	BRNCDT
chr1_1554781_A_G_b38	ATAD3C	-4.022	9.03e-05	-0.114649	34	0.028504	yes	BRNCDT
chr1_1379091_T_G_b38	ATAD3C	4.021	9.06e-05	0.134983	7	0.033566	yes	BRNCDT
chr1_1573429_CAAAAAAAAAAAAAAAAAA_C_b38	ATAD3C	-4.008	9.52e-05	-0.114269	29	0.028507	yes	BRNCDT
chr1_1560765_T_C_b38	ATAD3C	-3.987	0.000103	-0.119894	26	0.030073	yes	BRNCDT
chr1_1562261_TTTTC_T_b38	ATAD3C	-3.987	0.000103	-0.119894	26	0.030073	yes	BRNCDT
chr1_1452384_G_A_b38	ATAD3C	-3.984	0.000105	-0.137508	8	0.034516	yes	BRNCDT
chr1_2101670_C_T_b38	ATAD3C	3.972	0.000109	0.114824	18	0.028907	yes	BRNCDT
chr1_1380867_A_G_b38	ATAD3C	-3.961	0.000114	-0.143158	6	0.036138	yes	BRNCDT
chr1_1450636_A_G_b38	ATAD3C	-3.961	0.000114	-0.138614	7	0.034996	yes	BRNCDT
chr1_1370553_CAAA_C_b38	ATAD3C	-3.955	0.000117	-0.15481	4	0.039141	yes	BRNCDT
chr1_1456829_G_C_b38	ATAD3C	-3.95	0.000119	-0.134829	19	0.034136	yes	BRNCDT
chr1_2101817_G_A_b38	ATAD3C	3.935	0.000126	0.111442	20	0.02832	yes	BRNCDT
chr1_1379083_AT_A_b38	ATAD3C	3.932	0.000127	0.113313	17	0.028817	yes	BRNCDT
chr1_1574655_GGC_G_b38	ATAD3C	-3.909	0.000139	-0.118494	27	0.030315	yes	BRNCDT
chr1_1375642_C_T_b38	ATAD3C	-3.894	0.000147	-0.140837	6	0.036171	yes	BRNCDT
chr1_1374505_A_G_b38	ATAD3C	-3.884	0.000153	-0.141285	6	0.036379	yes	BRNCDT
chr1_1547630_G_A_b38	ATAD3C	-3.857	0.000169	-0.106132	31	0.027515	yes	BRNCDT
chr1_1517993_A_G_b38	ATAD3C	-3.834	0.000184	-0.118332	32	0.030866	yes	BRNCDT
chr1_1519934_T_G_b38	ATAD3C	-3.834	0.000184	-0.118332	32	0.030866	yes	BRNCDT
chr1_1519938_T_C_b38	ATAD3C	-3.834	0.000184	-0.118332	32	0.030866	yes	BRNCDT
chr1_1453643_A_ATT_b38	ATAD3C	-3.831	0.000186	-0.132289	13	0.034528	yes	BRNCDT
chr1_1537493_T_A_b38	ATAD3C	-3.826	0.00019	-0.115338	27	0.030148	yes	BRNCDT
chr1_1341550_GCA_G_b38	ATAD3C	-3.823	0.000192	-0.143073	5	0.037426	yes	BRNCDT
chr1_1382893_G_A_b38	ATAD3C	-3.821	0.000193	-0.138806	6	0.036326	yes	BRNCDT
chr1_1383743_T_C_b38	ATAD3C	-3.821	0.000193	-0.138742	6	0.036311	yes	BRNCDT
chr1_1384546_C_T_b38	ATAD3C	-3.821	0.000193	-0.138742	6	0.036311	yes	BRNCDT
chr1_1398218_C_A_b38	ATAD3C	-3.821	0.000193	-0.138742	6	0.036311	yes	BRNCDT
chr1_1400756_GGA_G_b38	ATAD3C	-3.821	0.000193	-0.138742	6	0.036311	yes	BRNCDT
chr1_1401954_G_T_b38	ATAD3C	-3.821	0.000193	-0.138742	6	0.036311	yes	BRNCDT
chr1_1403593_A_G_b38	ATAD3C	-3.821	0.000193	-0.138742	6	0.036311	yes	BRNCDT
chr1_1407565_C_A_b38	ATAD3C	-3.821	0.000193	-0.138742	6	0.036311	yes	BRNCDT
chr1_1453961_C_T_b38	ATAD3C	-3.794	0.000213	-0.137601	6	0.036264	yes	BRNCDT
chr1_1361679_G_A_b38	ATAD3C	3.783	0.000222	0.126547	12	0.033452	yes	BRNCDT
chr1_1329973_GCGTGTGCCATGCA_G_b38	ATAD3C	-3.782	0.000222	-0.142031	4	0.03755	yes	BRNCDT
chr1_1344048_G_A_b38	ATAD3C	-3.782	0.000222	-0.142031	4	0.03755	yes	BRNCDT
chr1_1364253_C_G_b38	ATAD3C	-3.782	0.000222	-0.142031	4	0.03755	yes	BRNCDT
chr1_1570587_C_T_b38	ATAD3C	-3.775	0.000228	-0.111601	28	0.029561	yes	BRNCDT
chr1_1368763_G_A_b38	ATAD3C	-3.755	0.000246	-0.137391	5	0.036586	yes	BRNCDT
chr1_1571794_A_AT_b38	ATAD3C	-3.75	0.00025	-0.111226	28	0.029658	yes	BRNCDT
chr1_1370430_T_C_b38	ATAD3C	-3.737	0.000263	-0.140628	5	0.037632	yes	BRNCDT
chr1_1370532_C_T_b38	ATAD3C	-3.737	0.000263	-0.140628	5	0.037632	yes	BRNCDT
chr1_1370584_G_C_b38	ATAD3C	-3.737	0.000263	-0.140628	5	0.037632	yes	BRNCDT
chr1_1372909_G_A_b38	ATAD3C	-3.737	0.000263	-0.140628	5	0.037632	yes	BRNCDT
chr1_1369282_G_A_b38	ATAD3C	-3.732	0.000267	-0.136961	5	0.036697	yes	BRNCDT
chr1_1369320_GT_G_b38	ATAD3C	-3.732	0.000267	-0.136961	5	0.036697	yes	BRNCDT
chr1_1369407_G_A_b38	ATAD3C	-3.732	0.000267	-0.136961	5	0.036697	yes	BRNCDT
chr1_1369476_CTT_C_b38	ATAD3C	-3.732	0.000267	-0.136961	5	0.036697	yes	BRNCDT
chr1_1369556_C_G_b38	ATAD3C	-3.732	0.000267	-0.136961	5	0.036697	yes	BRNCDT
chr1_1369627_T_C_b38	ATAD3C	-3.732	0.000267	-0.136961	5	0.036697	yes	BRNCDT
chr1_1369686_T_C_b38	ATAD3C	-3.732	0.000267	-0.136961	5	0.036697	yes	BRNCDT
chr1_1369716_G_C_b38	ATAD3C	-3.732	0.000267	-0.136961	5	0.036697	yes	BRNCDT
chr1_1369741_C_T_b38	ATAD3C	-3.732	0.000267	-0.136961	5	0.036697	yes	BRNCDT
chr1_1366951_A_AGT_b38	ATAD3C	3.728	0.000271	0.151908	4	0.040744	yes	BRNCDT
chr1_1523187_A_G_b38	ATAD3C	-3.722	0.000277	-0.201773	11	0.054214	yes	BRNCDT
chr1_1363688_C_T_b38	ATAD3C	-3.719	0.00028	-0.139926	4	0.037627	yes	BRNCDT
chr1_1364099_CCA_C_b38	ATAD3C	-3.719	0.00028	-0.139926	4	0.037627	yes	BRNCDT
chr1_1364102_TGTTG_T_b38	ATAD3C	-3.719	0.00028	-0.139926	4	0.037627	yes	BRNCDT
chr1_1501260_A_AT_b38	ATAD3C	-3.718	0.000282	-0.148101	7	0.039838	yes	BRNCDT
chr1_1575864_G_A_b38	ATAD3C	-3.705	0.000294	-0.112262	28	0.030297	yes	BRNCDT
chr1_1565680_A_AG_b38	ATAD3C	-3.704	0.000295	-0.103533	34	0.027949	yes	BRNCDT
chr1_1453870_A_C_b38	ATAD3C	-3.697	0.000303	-0.13464	6	0.036418	yes	BRNCDT
chr1_1370181_C_T_b38	ATAD3C	-3.697	0.000304	-0.139588	4	0.03776	yes	BRNCDT
chr1_1370317_G_C_b38	ATAD3C	-3.697	0.000304	-0.139588	4	0.03776	yes	BRNCDT
chr1_1370320_A_G_b38	ATAD3C	-3.697	0.000304	-0.139588	4	0.03776	yes	BRNCDT
chr1_1533841_T_C_b38	ATAD3C	-3.697	0.000304	-0.13076	17	0.035373	yes	BRNCDT
chr1_1569180_T_A_b38	ATAD3C	-3.692	0.000309	-0.107927	33	0.02923	yes	BRNCDT
chr1_1337898_A_G_b38	ATAD3C	3.685	0.000316	0.110463	13	0.029974	yes	BRNCDT
chr1_1379093_TG_T_b38	ATAD3C	-3.685	0.000317	-0.139015	5	0.037725	yes	BRNCDT
chr1_1571986_G_A_b38	ATAD3C	-3.683	0.000319	-0.108158	23	0.029369	yes	BRNCDT
chr1_1538924_C_A_b38	ATAD3C	-3.68	0.000323	-0.109274	20	0.029697	yes	BRNCDT
chr1_1559703_G_C_b38	ATAD3C	-3.669	0.000335	-0.109253	28	0.029776	yes	BRNCDT
chr1_1568548_G_A_b38	ATAD3C	-3.669	0.000335	-0.109253	28	0.029776	yes	BRNCDT
chr1_1290841_A_G_b38	ATAD3C	-3.642	0.000369	-0.126691	16	0.034784	yes	BRNCDT
chr1_1302795_T_TC_b38	ATAD3C	3.632	0.000383	0.112848	27	0.03107	yes	BRNCDT
chr1_1363898_C_T_b38	ATAD3C	3.622	0.000398	0.1248	6	0.034459	yes	BRNCDT
chr1_1363986_C_T_b38	ATAD3C	3.622	0.000398	0.1248	6	0.034459	yes	BRNCDT
chr1_1365566_G_A_b38	ATAD3C	3.622	0.000398	0.1248	6	0.034459	yes	BRNCDT
chr1_1366529_TTAG_T_b38	ATAD3C	3.622	0.000398	0.1248	6	0.034459	yes	BRNCDT
chr1_1367292_A_AGT_b38	ATAD3C	3.622	0.000398	0.1248	6	0.034459	yes	BRNCDT
chr1_2099538_G_A_b38	ATAD3C	3.602	0.000426	0.101938	21	0.028298	yes	BRNCDT
chr1_1877316_A_T_b38	ATAD3C	3.601	0.000428	0.098828	29	0.027447	yes	BRNCDT
chr1_1500745_A_C_b38	ATAD3C	-3.583	0.000455	-0.183479	17	0.051204	yes	BRNCDT
chr1_1366941_T_TGTGTGCA_b38	ATAD3C	3.576	0.000468	0.146276	4	0.040906	yes	BRNCDT
chr1_2098568_CCT_C_b38	ATAD3C	3.553	0.000507	0.097983	30	0.02758	yes	BRNCDT
chr1_1388565_GTC_G_b38	ATAD3C	3.551	0.00051	0.115379	11	0.032488	yes	BRNCDT
chr1_1368177_G_C_b38	ATAD3C	-3.543	0.000525	-0.13395	5	0.037807	yes	BRNCDT
chr1_1259424_T_C_b38	ATAD3C	-3.539	0.000533	-0.114783	25	0.032435	yes	BRNCDT
chr1_1514366_A_G_b38	ATAD3C	-3.538	0.000533	-0.224593	3	0.063474	yes	BRNCDT
chr1_1363456_CAG_C_b38	ATAD3C	3.537	0.000536	0.103057	15	0.029137	yes	BRNCDT
chr1_1539491_G_C_b38	ATAD3C	-3.528	0.000553	-0.105549	30	0.029919	yes	BRNCDT
chr1_1316929_A_T_b38	ATAD3C	-3.528	0.000554	-0.122564	7	0.034744	yes	BRNCDT
chr1_1575935_T_C_b38	ATAD3C	-3.517	0.000574	-0.104442	29	0.029693	yes	BRNCDT
chr1_1428999_C_CA_b38	ATAD3C	-3.513	0.000582	-0.115064	11	0.032752	yes	BRNCDT
chr1_1361685_C_T_b38	ATAD3C	-3.504	0.000601	-0.12569	9	0.035867	yes	BRNCDT
chr1_1369821_C_T_b38	ATAD3C	-3.502	0.000606	-0.128575	5	0.036719	yes	BRNCDT
chr1_1366511_GGTGA_G_b38	ATAD3C	-3.484	0.000644	-0.131664	4	0.037791	yes	BRNCDT
chr1_1364566_T_C_b38	ATAD3C	-3.473	0.000669	-0.131347	4	0.037816	yes	BRNCDT
chr1_1367919_C_T_b38	ATAD3C	-3.465	0.000688	-0.127965	5	0.03693	yes	BRNCDT
chr1_1367951_C_T_b38	ATAD3C	-3.465	0.000688	-0.127965	5	0.03693	yes	BRNCDT
chr1_1367965_A_G_b38	ATAD3C	-3.465	0.000688	-0.127965	5	0.03693	yes	BRNCDT
chr1_1367970_T_G_b38	ATAD3C	-3.465	0.000688	-0.127965	5	0.03693	yes	BRNCDT
chr1_1367994_C_A_b38	ATAD3C	-3.465	0.000688	-0.127965	5	0.03693	yes	BRNCDT
chr1_1368297_C_T_b38	ATAD3C	-3.465	0.000688	-0.127965	5	0.03693	yes	BRNCDT
chr1_1368514_C_G_b38	ATAD3C	-3.465	0.000688	-0.127965	5	0.03693	yes	BRNCDT
chr1_1368991_C_T_b38	ATAD3C	-3.465	0.000688	-0.127965	5	0.03693	yes	BRNCDT
chr1_1369009_T_C_b38	ATAD3C	-3.465	0.000688	-0.127965	5	0.03693	yes	BRNCDT
chr1_1369012_C_CG_b38	ATAD3C	-3.465	0.000688	-0.127965	5	0.03693	yes	BRNCDT
chr1_1451028_T_A_b38	ATAD3C	-3.429	0.000779	-0.118459	8	0.034546	yes	BRNCDT
chr1_1364282_T_G_b38	ATAD3C	-3.422	0.000798	-0.130013	4	0.037995	yes	BRNCDT
chr1_1364357_A_C_b38	ATAD3C	-3.422	0.000798	-0.130013	4	0.037995	yes	BRNCDT
chr1_1364694_T_C_b38	ATAD3C	-3.422	0.000798	-0.130013	4	0.037995	yes	BRNCDT
chr1_1364721_C_T_b38	ATAD3C	-3.422	0.000798	-0.130013	4	0.037995	yes	BRNCDT
chr1_1365160_A_G_b38	ATAD3C	-3.422	0.000798	-0.130013	4	0.037995	yes	BRNCDT
chr1_1365198_C_T_b38	ATAD3C	-3.422	0.000798	-0.130013	4	0.037995	yes	BRNCDT
chr1_1366008_A_G_b38	ATAD3C	-3.422	0.000798	-0.130013	4	0.037995	yes	BRNCDT
chr1_1366062_T_C_b38	ATAD3C	-3.422	0.000798	-0.130013	4	0.037995	yes	BRNCDT
chr1_1366145_TGTGAA_T_b38	ATAD3C	-3.422	0.000798	-0.130013	4	0.037995	yes	BRNCDT
chr1_1366187_A_AGT_b38	ATAD3C	-3.422	0.000798	-0.130013	4	0.037995	yes	BRNCDT
chr1_1366321_TGTGTGTAAATGG_T_b38	ATAD3C	-3.422	0.000798	-0.130013	4	0.037995	yes	BRNCDT
chr1_1366453_G_T_b38	ATAD3C	-3.422	0.000798	-0.130013	4	0.037995	yes	BRNCDT
chr1_1366726_T_G_b38	ATAD3C	-3.422	0.000798	-0.130013	4	0.037995	yes	BRNCDT
chr1_1367258_T_A_b38	ATAD3C	-3.422	0.000798	-0.130013	4	0.037995	yes	BRNCDT
chr1_1367280_T_A_b38	ATAD3C	-3.422	0.000798	-0.130013	4	0.037995	yes	BRNCDT
chr1_1367297_GAA_G_b38	ATAD3C	-3.422	0.000798	-0.130013	4	0.037995	yes	BRNCDT
chr1_1367300_T_TGA_b38	ATAD3C	-3.422	0.000798	-0.130013	4	0.037995	yes	BRNCDT
chr1_1367329_A_AGT_b38	ATAD3C	-3.422	0.000798	-0.130013	4	0.037995	yes	BRNCDT
chr1_1367373_T_TGTG_b38	ATAD3C	-3.422	0.000798	-0.130013	4	0.037995	yes	BRNCDT
chr1_1367462_T_C_b38	ATAD3C	-3.422	0.000798	-0.130013	4	0.037995	yes	BRNCDT
chr1_1367593_G_A_b38	ATAD3C	-3.422	0.000798	-0.130013	4	0.037995	yes	BRNCDT
chr1_1367602_GT_G_b38	ATAD3C	-3.422	0.000798	-0.130013	4	0.037995	yes	BRNCDT
chr1_1367605_GAGTGAGTGTA_G_b38	ATAD3C	-3.422	0.000798	-0.130013	4	0.037995	yes	BRNCDT
chr1_1367670_GGTGA_G_b38	ATAD3C	-3.422	0.000798	-0.130013	4	0.037995	yes	BRNCDT
chr1_1367722_TTTTA_T_b38	ATAD3C	-3.422	0.000798	-0.130013	4	0.037995	yes	BRNCDT
chr1_1367874_A_T_b38	ATAD3C	-3.422	0.000798	-0.130013	4	0.037995	yes	BRNCDT
chr1_1394041_G_A_b38	ATAD3C	-3.419	0.000804	-0.13343	4	0.03902	yes	BRNCDT
chr1_1369803_C_CT_b38	ATAD3C	-3.416	0.000814	-0.117977	6	0.034538	yes	BRNCDT
chr1_1363880_A_G_b38	ATAD3C	-3.412	0.000826	-0.129525	4	0.037965	yes	BRNCDT
chr1_1366292_G_T_b38	ATAD3C	-3.406	0.000843	-0.129705	4	0.038085	yes	BRNCDT
chr1_1514211_A_G_b38	ATAD3C	-3.395	0.000874	-0.215448	3	0.063457	yes	BRNCDT
chr1_1549967_C_G_b38	ATAD3C	-3.348	0.00102	-0.099964	18	0.029858	yes	BRNCDT
chr1_1367954_A_C_b38	ATAD3C	-3.322	0.00112	-0.160156	3	0.048205	yes	BRNCDT
chr1_1497605_G_C_b38	ATAD3C	-3.311	0.00116	-0.108818	21	0.032867	yes	BRNCDT
chr1_1367268_TGA_T_b38	ATAD3C	-3.302	0.0012	-0.125292	4	0.037949	yes	BRNCDT
chr1_1479719_T_C_b38	ATAD3C	-3.257	0.00139	-0.106079	27	0.032566	yes	BRNCDT
chr1_1280044_T_C_b38	ATAD3C	-3.252	0.00141	-0.102949	27	0.03166	yes	BRNCDT
chr1_1325753_G_T_b38	ATAD3C	-3.235	0.00149	-0.132804	3	0.04105	yes	BRNCDT
chr1_1258206_AT_A_b38	ATAD3C	-3.235	0.00149	-0.102017	24	0.031536	yes	BRNCDT
chr1_1290968_C_G_b38	ATAD3C	-3.205	0.00164	-0.119466	16	0.037275	yes	BRNCDT
chr1_1574032_AAAG_A_b38	ATAD3C	-3.204	0.00165	-0.106338	18	0.033191	yes	BRNCDT
chr1_1184277_G_C_b38	ATAD3C	-3.203	0.00165	-0.095894	37	0.029939	yes	BRNCDT
chr1_1367388_T_TTGG_b38	ATAD3C	-3.147	0.00198	-0.121278	4	0.03854	yes	BRNCDT
chr1_1308178_GGGGCGCGGGGA_G_b38	ATAD3C	-3.138	0.00204	-0.110424	8	0.035187	yes	BRNCDT
chr1_1292284_TTGAG_T_b38	ATAD3C	-3.137	0.00205	-0.115719	11	0.036886	yes	BRNCDT
chr1_1500729_G_A_b38	ATAD3C	-3.116	0.00219	-0.167688	12	0.05381	yes	BRNCDT
chr1_1555179_A_G_b38	ATAD3C	-3.114	0.00221	-0.09741	23	0.031285	yes	BRNCDT
chr1_1188054_T_A_b38	ATAD3C	-3.114	0.00221	-0.10887	9	0.034966	yes	BRNCDT
chr1_1558347_G_A_b38	ATAD3C	-3.103	0.00228	-0.097884	22	0.031541	yes	BRNCDT
chr1_1533883_G_T_b38	ATAD3C	-3.099	0.00231	-0.151994	6	0.049053	yes	BRNCDT
chr1_1367511_ATGAG_A_b38	ATAD3C	-3.075	0.00249	-0.122015	3	0.039676	yes	BRNCDT
chr1_1522905_A_G_b38	ATAD3C	-3.031	0.00286	-0.16362	9	0.053984	yes	BRNCDT
chr1_2011271_G_GT_b38	ATAD3C	-3.028	0.00289	-0.083786	39	0.027669	yes	BRNCDT
chr1_1548572_A_C_b38	ATAD3C	-3.023	0.00294	-0.086762	32	0.028705	yes	BRNCDT
chr1_1306420_A_G_b38	ATAD3C	3.005	0.00311	0.153725	14	0.051163	yes	BRNCDT
chr1_1307327_A_G_b38	ATAD3C	3.005	0.00311	0.153725	14	0.051163	yes	BRNCDT
chr1_1303800_G_A_b38	ATAD3C	-3.002	0.00314	-0.120868	4	0.040265	yes	BRNCDT
chr1_1304555_A_C_b38	ATAD3C	-3.002	0.00314	-0.120868	4	0.040265	yes	BRNCDT
chr1_1558204_T_TAAAAAA_b38	ATAD3C	-2.997	0.00318	-0.092081	16	0.030727	yes	BRNCDT
chr1_1566854_CA_C_b38	ATAD3C	-2.967	0.00349	-0.094738	23	0.03193	yes	BRNCDT
chr1_1763636_G_A_b38	ATAD3C	2.956	0.00361	0.107887	10	0.036498	yes	BRNCDT
chr1_2172996_C_T_b38	ATAD3C	2.944	0.00374	0.087168	15	0.029605	yes	BRNCDT
chr1_1363438_C_CTT_b38	ATAD3C	2.918	0.00406	0.087032	19	0.02983	yes	BRNCDT
chr1_2173542_A_G_b38	ATAD3C	2.905	0.00422	0.086662	14	0.029835	yes	BRNCDT
chr1_1295039_T_C_b38	ATAD3C	-2.893	0.00437	-0.151204	13	0.052257	yes	BRNCDT
chr1_1298561_T_C_b38	ATAD3C	-2.893	0.00437	-0.151204	13	0.052257	yes	BRNCDT
chr1_2060607_C_T_b38	ATAD3C	-2.893	0.00437	-0.105313	5	0.036405	yes	BRNCDT
chr1_1515567_A_C_b38	ATAD3C	-2.883	0.00451	-0.169594	7	0.058833	yes	BRNCDT
chr1_1551523_T_C_b38	ATAD3C	-2.882	0.00453	-0.095189	10	0.033034	yes	BRNCDT
chr1_1307603_G_A_b38	ATAD3C	2.861	0.00481	0.141503	14	0.049454	yes	BRNCDT
chr1_1482316_C_G_b38	ATAD3C	-2.822	0.0054	-0.087122	15	0.030869	yes	BRNCDT
chr1_1555871_T_C_b38	ATAD3C	-2.821	0.00542	-0.089773	23	0.031825	yes	BRNCDT
chr1_1366681_T_TGA_b38	ATAD3C	-2.814	0.00553	-0.109911	4	0.039054	yes	BRNCDT
chr1_1407232_G_C_b38	ATAD3C	-2.814	0.00554	-0.095681	8	0.034001	yes	BRNCDT
chr1_1290579_C_G_b38	ATAD3C	-2.797	0.00582	-0.094787	14	0.033887	yes	BRNCDT
chr1_1201373_T_C_b38	ATAD3C	-2.796	0.00583	-0.094688	16	0.033862	yes	BRNCDT
chr1_1501403_T_C_b38	ATAD3C	-2.791	0.00592	-0.110829	14	0.039707	yes	BRNCDT
chr1_1340697_G_A_b38	ATAD3C	2.783	0.00606	0.089044	10	0.031994	yes	BRNCDT
chr1_1300330_T_A_b38	ATAD3C	-2.753	0.00661	-0.139011	13	0.050487	yes	BRNCDT
chr1_1301656_T_C_b38	ATAD3C	-2.753	0.00661	-0.139011	13	0.050487	yes	BRNCDT
chr1_1282558_C_CCA_b38	ATAD3C	-2.737	0.00693	-0.10571	13	0.038618	yes	BRNCDT
chr1_1520875_A_G_b38	ATAD3C	-2.735	0.00697	-0.153405	9	0.056089	yes	BRNCDT
chr1_1524202_G_A_b38	ATAD3C	-2.735	0.00697	-0.153405	9	0.056089	yes	BRNCDT
chr1_1530002_A_G_b38	ATAD3C	-2.735	0.00697	-0.153405	9	0.056089	yes	BRNCDT
chr1_1533018_T_C_b38	ATAD3C	-2.735	0.00697	-0.153405	9	0.056089	yes	BRNCDT
chr1_1934821_C_G_b38	ATAD3C	-2.731	0.00705	-0.071459	20	0.026164	yes	BRNCDT
chr1_2216435_A_G_b38	ATAD3C	-2.727	0.00714	-0.110242	5	0.040429	yes	BRNCDT
chr1_1530331_T_C_b38	ATAD3C	-2.726	0.00716	-0.108898	16	0.039949	yes	BRNCDT
chr1_1573776_A_G_b38	ATAD3C	-2.723	0.00722	-0.093669	9	0.034401	yes	BRNCDT
chr1_1877314_A_T_b38	ATAD3C	2.722	0.00725	0.092679	12	0.034054	yes	BRNCDT
chr1_1579717_T_A_b38	ATAD3C	-2.72	0.00729	-0.091048	10	0.03348	yes	BRNCDT
chr1_1545968_T_C_b38	ATAD3C	-2.692	0.00789	-0.087878	11	0.032643	yes	BRNCDT
chr1_1527386_C_T_b38	ATAD3C	-2.692	0.0079	-0.158799	10	0.058995	yes	BRNCDT
chr1_1375678_TA_T_b38	ATAD3C	2.679	0.00819	0.092903	13	0.034677	yes	BRNCDT
chr1_1290261_C_A_b38	ATAD3C	-2.667	0.00847	-0.106676	14	0.039991	yes	BRNCDT
chr1_940296_GC_G_b38	ATAD3C	2.663	0.00858	0.128159	3	0.048133	yes	BRNCDT
chr1_1512376_G_C_b38	ATAD3C	-2.658	0.0087	-0.106313	15	0.039997	yes	BRNCDT
chr1_1303112_G_A_b38	ATAD3C	-2.655	0.00876	-0.106329	4	0.040044	yes	BRNCDT
chr1_2111641_T_G_b38	ATAD3C	2.648	0.00893	0.082236	14	0.031051	yes	BRNCDT
chr1_1758323_T_C_b38	ATAD3C	2.633	0.00933	0.068313	39	0.025944	yes	BRNCDT
chr1_1567912_C_CAAAAAAAA_b38	ATAD3C	-2.626	0.0095	-0.128587	6	0.048957	yes	BRNCDT
chr1_1522693_A_G_b38	ATAD3C	2.611	0.00992	0.089755	8	0.034374	yes	BRNCDT
chr1_1195280_C_T_b38	ATAD3C	-2.61	0.00994	-0.138312	4	0.052983	yes	BRNCDT
chr1_2065711_G_A_b38	ATAD3C	4.853	2.97e-06	0.158077	16	0.032572	no	BRNCDT
chr1_2058057_C_T_b38	ATAD3C	4.43	1.79e-05	0.16015	5	0.036154	no	BRNCDT
chr1_2060286_A_G_b38	ATAD3C	4.304	2.98e-05	0.145646	11	0.033839	no	BRNCDT
chr1_2059575_A_G_b38	ATAD3C	4.218	4.2e-05	0.148731	6	0.035259	no	BRNCDT
chr1_2059802_C_G_b38	ATAD3C	4.218	4.2e-05	0.148731	6	0.035259	no	BRNCDT
chr1_2059863_G_A_b38	ATAD3C	4.218	4.2e-05	0.148731	6	0.035259	no	BRNCDT
chr1_2060951_G_A_b38	ATAD3C	4.218	4.2e-05	0.148731	6	0.035259	no	BRNCDT
chr1_2063734_T_G_b38	ATAD3C	4.218	4.2e-05	0.148731	6	0.035259	no	BRNCDT
chr1_2065748_A_G_b38	ATAD3C	4.218	4.2e-05	0.148731	6	0.035259	no	BRNCDT
chr1_2058514_T_A_b38	ATAD3C	4.216	4.24e-05	0.151892	5	0.03603	no	BRNCDT
chr1_2059684_G_A_b38	ATAD3C	4.216	4.24e-05	0.151892	5	0.03603	no	BRNCDT
chr1_2061309_C_T_b38	ATAD3C	4.216	4.24e-05	0.151892	5	0.03603	no	BRNCDT
chr1_2063382_G_A_b38	ATAD3C	4.216	4.24e-05	0.151892	5	0.03603	no	BRNCDT
chr1_2055097_C_T_b38	ATAD3C	4.183	4.83e-05	0.152085	5	0.03636	no	BRNCDT
chr1_2060449_TGAGAAGTGGGGCTGAATAGAGGTTTGGCAGTGCTTAGCATAGGGGGCGAGAGTCTCGGCTTCCAGC_T_b38	ATAD3C	4.066	7.62e-05	0.143677	6	0.035333	no	BRNCDT
chr1_2056364_G_A_b38	ATAD3C	3.962	0.000114	0.138498	19	0.034959	no	BRNCDT
chr1_2075942_A_G_b38	ATAD3C	3.891	0.000148	0.142614	5	0.036648	no	BRNCDT
chr1_2077249_T_C_b38	ATAD3C	3.85	0.000173	0.145628	4	0.037822	no	BRNCDT
chr1_2079109_C_T_b38	ATAD3C	3.85	0.000173	0.145628	4	0.037822	no	BRNCDT
chr1_2085363_T_C_b38	ATAD3C	3.85	0.000173	0.145628	4	0.037822	no	BRNCDT
chr1_2085406_G_A_b38	ATAD3C	3.85	0.000173	0.145628	4	0.037822	no	BRNCDT
chr1_2086202_C_T_b38	ATAD3C	3.85	0.000173	0.145628	4	0.037822	no	BRNCDT
chr1_2087436_G_A_b38	ATAD3C	3.85	0.000173	0.145628	4	0.037822	no	BRNCDT
chr1_2096462_G_A_b38	ATAD3C	3.822	0.000192	0.110484	18	0.028905	no	BRNCDT
chr1_2071051_C_CACCTGGGCGTGTG_b38	ATAD3C	3.821	0.000193	0.140675	5	0.036821	no	BRNCDT
chr1_2081714_C_T_b38	ATAD3C	3.767	0.000235	0.135694	16	0.036017	no	BRNCDT
chr1_2093604_C_T_b38	ATAD3C	3.736	0.000263	0.104441	25	0.027954	no	BRNCDT
chr1_2090943_G_A_b38	ATAD3C	3.596	0.000435	0.136201	4	0.037872	no	BRNCDT
chr1_2079131_T_C_b38	ATAD3C	3.596	0.000436	0.13562	4	0.037717	no	BRNCDT
chr1_2090659_G_A_b38	ATAD3C	3.477	0.00066	0.131984	4	0.037957	no	BRNCDT
chr1_2091118_G_A_b38	ATAD3C	3.477	0.00066	0.131984	4	0.037957	no	BRNCDT
chr1_2091238_C_T_b38	ATAD3C	3.477	0.00066	0.131984	4	0.037957	no	BRNCDT
chr1_2092625_C_T_b38	ATAD3C	3.477	0.00066	0.131984	4	0.037957	no	BRNCDT
chr1_2079677_C_G_b38	ATAD3C	3.46	7e-04	0.127972	5	0.036986	no	BRNCDT
chr1_2079137_C_T_b38	ATAD3C	3.452	0.00072	0.12945	6	0.037499	no	BRNCDT
chr1_2072659_G_A_b38	ATAD3C	3.415	0.000817	0.126745	5	0.037116	no	BRNCDT
chr1_2074688_G_A_b38	ATAD3C	3.415	0.000817	0.126745	5	0.037116	no	BRNCDT
chr1_2089758_A_G_b38	ATAD3C	3.385	0.000905	0.119608	11	0.035336	no	BRNCDT
chr1_2098662_CGTTTTGTTTT_C_b38	ATAD3C	3.173	0.00182	0.091097	21	0.02871	no	BRNCDT
chr1_1572877_T_TG_b38	ATAD3C	3.162	0.00189	0.107369	10	0.033952	no	BRNCDT
chr1_2107293_C_T_b38	ATAD3C	3.042	0.00277	0.090363	15	0.029708	no	BRNCDT
chr1_2110474_G_GGGT_b38	ATAD3C	3.042	0.00277	0.090363	15	0.029708	no	BRNCDT
chr1_2112353_G_A_b38	ATAD3C	3.042	0.00277	0.090363	15	0.029708	no	BRNCDT
chr1_2114437_G_A_b38	ATAD3C	3.042	0.00277	0.090363	15	0.029708	no	BRNCDT
chr1_2114447_G_T_b38	ATAD3C	3.042	0.00277	0.090363	15	0.029708	no	BRNCDT
chr1_2121074_A_G_b38	ATAD3C	3.042	0.00277	0.090363	15	0.029708	no	BRNCDT
chr1_2127141_G_C_b38	ATAD3C	3.042	0.00277	0.090363	15	0.029708	no	BRNCDT
chr1_2127704_G_A_b38	ATAD3C	3.042	0.00277	0.090363	15	0.029708	no	BRNCDT
chr1_2131710_C_T_b38	ATAD3C	3.042	0.00277	0.090363	15	0.029708	no	BRNCDT
chr1_2102314_G_GT_b38	ATAD3C	3.035	0.00283	0.092702	12	0.030546	no	BRNCDT
chr1_2074854_G_GT_b38	ATAD3C	3.008	0.00307	0.117841	4	0.039173	no	BRNCDT
chr1_1606094_G_GAGGGGTC_b38	ATAD3C	3.007	0.00309	0.105953	10	0.035238	no	BRNCDT
chr1_940296_GCC_G_b38	ATAD3C	-2.997	0.00318	-0.078631	31	0.026233	no	BRNCDT
chr1_2112691_GTT_G_b38	ATAD3C	2.933	0.00388	0.086551	16	0.029512	no	BRNCDT
chr1_2112696_T_G_b38	ATAD3C	2.933	0.00388	0.086551	16	0.029512	no	BRNCDT
chr1_2076742_GA_G_b38	ATAD3C	2.874	0.00464	0.104999	4	0.03654	no	BRNCDT
chr1_1606089_GGC_G_b38	ATAD3C	2.836	0.00519	0.110444	7	0.038943	no	BRNCDT
chr1_2138882_T_C_b38	ATAD3C	-2.825	0.00537	-0.083663	15	0.02962	no	BRNCDT
chr1_2140117_A_G_b38	ATAD3C	-2.825	0.00537	-0.083663	15	0.02962	no	BRNCDT
chr1_2141561_A_G_b38	ATAD3C	-2.825	0.00537	-0.083663	15	0.02962	no	BRNCDT
chr1_2134510_C_T_b38	ATAD3C	2.825	0.00537	0.083663	15	0.02962	no	BRNCDT
chr1_2134519_C_T_b38	ATAD3C	2.825	0.00537	0.083663	15	0.02962	no	BRNCDT
chr1_2137733_C_T_b38	ATAD3C	2.825	0.00537	0.083663	15	0.02962	no	BRNCDT
chr1_2144121_T_G_b38	ATAD3C	2.825	0.00537	0.083663	15	0.02962	no	BRNCDT
chr1_2145821_C_T_b38	ATAD3C	2.825	0.00537	0.083663	15	0.02962	no	BRNCDT
chr1_2145970_A_G_b38	ATAD3C	2.825	0.00537	0.083663	15	0.02962	no	BRNCDT
chr1_2146946_C_T_b38	ATAD3C	2.825	0.00537	0.083663	15	0.02962	no	BRNCDT
chr1_2147005_T_G_b38	ATAD3C	2.825	0.00537	0.083663	15	0.02962	no	BRNCDT
chr1_2147043_T_A_b38	ATAD3C	2.825	0.00537	0.083663	15	0.02962	no	BRNCDT
chr1_2147118_T_A_b38	ATAD3C	2.825	0.00537	0.083663	15	0.02962	no	BRNCDT
chr1_2149374_G_T_b38	ATAD3C	2.825	0.00537	0.083663	15	0.02962	no	BRNCDT
chr1_2151019_C_T_b38	ATAD3C	2.825	0.00537	0.083663	15	0.02962	no	BRNCDT
chr1_2151283_T_C_b38	ATAD3C	2.825	0.00537	0.083663	15	0.02962	no	BRNCDT
chr1_2151734_A_G_b38	ATAD3C	2.825	0.00537	0.083663	15	0.02962	no	BRNCDT
chr1_2155206_T_C_b38	ATAD3C	2.825	0.00537	0.083663	15	0.02962	no	BRNCDT
chr1_2155318_A_G_b38	ATAD3C	2.825	0.00537	0.083663	15	0.02962	no	BRNCDT
chr1_2155442_GTGA_G_b38	ATAD3C	2.825	0.00537	0.083663	15	0.02962	no	BRNCDT
chr1_2155596_GTGA_G_b38	ATAD3C	2.825	0.00537	0.083663	15	0.02962	no	BRNCDT
chr1_2156665_A_G_b38	ATAD3C	2.825	0.00537	0.083663	15	0.02962	no	BRNCDT
chr1_2157138_G_A_b38	ATAD3C	2.825	0.00537	0.083663	15	0.02962	no	BRNCDT
chr1_2157315_A_C_b38	ATAD3C	2.825	0.00537	0.083663	15	0.02962	no	BRNCDT
chr1_2158078_C_CT_b38	ATAD3C	2.825	0.00537	0.083663	15	0.02962	no	BRNCDT
chr1_2159377_T_C_b38	ATAD3C	2.825	0.00537	0.083663	15	0.02962	no	BRNCDT
chr1_2159958_A_G_b38	ATAD3C	2.825	0.00537	0.083663	15	0.02962	no	BRNCDT
chr1_2162295_C_T_b38	ATAD3C	2.825	0.00537	0.083663	15	0.02962	no	BRNCDT
chr1_2162307_G_T_b38	ATAD3C	2.825	0.00537	0.083663	15	0.02962	no	BRNCDT
chr1_2164260_C_T_b38	ATAD3C	2.825	0.00537	0.083663	15	0.02962	no	BRNCDT
chr1_2167643_G_A_b38	ATAD3C	2.825	0.00537	0.083663	15	0.02962	no	BRNCDT
chr1_2175622_G_T_b38	ATAD3C	2.825	0.00537	0.083663	15	0.02962	no	BRNCDT
chr1_2178821_G_A_b38	ATAD3C	2.825	0.00537	0.083663	15	0.02962	no	BRNCDT
chr1_2182126_T_G_b38	ATAD3C	2.825	0.00537	0.083663	15	0.02962	no	BRNCDT
chr1_2110911_G_A_b38	ATAD3C	2.795	0.00585	0.090015	10	0.032205	no	BRNCDT
chr1_2185716_G_A_b38	ATAD3C	2.787	0.006	0.08234	15	0.029545	no	BRNCDT
chr1_2148243_A_G_b38	ATAD3C	2.766	0.00637	0.089281	8	0.032276	no	BRNCDT
chr1_1606099_G_GGTCAGGCGAGGGGTC_b38	ATAD3C	2.757	0.00654	0.094502	11	0.034278	no	BRNCDT
chr1_1288341_C_T_b38	ATAD3C	-2.756	0.00657	-0.133504	4	0.048447	no	BRNCDT
chr1_2150078_C_A_b38	ATAD3C	2.745	0.00677	0.081279	15	0.029606	no	BRNCDT
chr1_2170248_G_A_b38	ATAD3C	2.702	0.00767	0.079652	16	0.029481	no	BRNCDT
chr1_965666_ACC_A_b38	ATAD3C	2.662	0.00859	0.08807	10	0.033082	no	BRNCDT
chr1_2207909_CGTGTGTGTGTGTGTGTGTGT_C_b38	ATAD3C	2.642	0.00909	0.075879	18	0.028717	no	BRNCDT
chr1_2210427_C_T_b38	ATAD3C	2.642	0.0091	0.078151	16	0.029579	no	BRNCDT
chr1_2211079_A_C_b38	ATAD3C	2.642	0.0091	0.078151	16	0.029579	no	BRNCDT
chr1_965125_G_C_b38	ATAD3C	2.631	0.00939	0.088081	11	0.033481	no	BRNCDT
chr1_2342886_AT_A_b38	ATAD3C	2.626	0.00953	0.115781	6	0.044098	no	BRNCDT
chr1_1440430_C_G_b38	ATAD3C	-6.395	2.47e-09	-0.166894	17	0.026097	yes	BRNCHB
chr1_1432355_G_A_b38	ATAD3C	-6.005	1.7e-08	-0.170875	10	0.028456	yes	BRNCHB
chr1_1431656_G_A_b38	ATAD3C	-5.827	4e-08	-0.175604	6	0.030138	yes	BRNCHB
chr1_1431813_G_T_b38	ATAD3C	-5.267	5.39e-07	-0.156068	8	0.029634	yes	BRNCHB
chr1_1426253_G_A_b38	ATAD3C	-5.23	6.36e-07	-0.163497	6	0.031262	yes	BRNCHB
chr1_1442793_G_A_b38	ATAD3C	-5.109	1.09e-06	-0.154453	7	0.030231	yes	BRNCHB
chr1_1435945_C_CCGGGCGGGGGCG_b38	ATAD3C	-5.099	1.14e-06	-0.152888	8	0.029983	yes	BRNCHB
chr1_1434687_C_G_b38	ATAD3C	-5.001	1.75e-06	-0.152761	7	0.030545	yes	BRNCHB
chr1_1437955_C_G_b38	ATAD3C	-4.888	2.86e-06	-0.128982	18	0.026385	yes	BRNCHB
chr1_1366427_AGTGTGATTGAATGAGT_A_b38	ATAD3C	4.881	2.96e-06	0.136253	13	0.027917	yes	BRNCHB
chr1_1456182_G_A_b38	ATAD3C	-4.156	5.75e-05	-0.130332	12	0.031362	yes	BRNCHB
chr1_1308178_GGGGCGCGGGGA_G_b38	ATAD3C	-4.149	5.9e-05	-0.127792	8	0.030803	yes	BRNCHB
chr1_1541864_T_C_b38	ATAD3C	-4.034	9.16e-05	-0.115772	25	0.028698	yes	BRNCHB
chr1_1375642_C_T_b38	ATAD3C	-3.996	0.000106	-0.131527	5	0.032911	yes	BRNCHB
chr1_1451787_A_C_b38	ATAD3C	-3.889	0.000158	-0.122073	13	0.031389	yes	BRNCHB
chr1_1382893_G_A_b38	ATAD3C	-3.882	0.000162	-0.128516	5	0.033102	yes	BRNCHB
chr1_1370553_CAAA_C_b38	ATAD3C	-3.83	0.000196	-0.138536	4	0.036169	yes	BRNCHB
chr1_1551557_A_AG_b38	ATAD3C	-3.827	0.000198	-0.109112	25	0.028508	yes	BRNCHB
chr1_1551559_A_T_b38	ATAD3C	-3.827	0.000198	-0.109112	25	0.028508	yes	BRNCHB
chr1_1557495_CAT_C_b38	ATAD3C	-3.781	0.000234	-0.107241	26	0.02836	yes	BRNCHB
chr1_1374505_A_G_b38	ATAD3C	-3.775	0.000239	-0.124325	5	0.03293	yes	BRNCHB
chr1_1341550_GCA_G_b38	ATAD3C	-3.756	0.000257	-0.12367	5	0.032926	yes	BRNCHB
chr1_1532798_T_C_b38	ATAD3C	-3.714	0.000298	-0.095693	48	0.025766	yes	BRNCHB
chr1_1558726_C_CA_b38	ATAD3C	-3.656	0.000367	-0.104005	26	0.028447	yes	BRNCHB
chr1_1561821_A_C_b38	ATAD3C	-3.656	0.000367	-0.104005	26	0.028447	yes	BRNCHB
chr1_1364282_T_G_b38	ATAD3C	-3.649	0.000376	-0.120249	4	0.032951	yes	BRNCHB
chr1_1364357_A_C_b38	ATAD3C	-3.649	0.000376	-0.120249	4	0.032951	yes	BRNCHB
chr1_1364566_T_C_b38	ATAD3C	-3.649	0.000376	-0.120249	4	0.032951	yes	BRNCHB
chr1_1364694_T_C_b38	ATAD3C	-3.649	0.000376	-0.120249	4	0.032951	yes	BRNCHB
chr1_1364721_C_T_b38	ATAD3C	-3.649	0.000376	-0.120249	4	0.032951	yes	BRNCHB
chr1_1365160_A_G_b38	ATAD3C	-3.649	0.000376	-0.120249	4	0.032951	yes	BRNCHB
chr1_1365198_C_T_b38	ATAD3C	-3.649	0.000376	-0.120249	4	0.032951	yes	BRNCHB
chr1_1366008_A_G_b38	ATAD3C	-3.649	0.000376	-0.120249	4	0.032951	yes	BRNCHB
chr1_1366062_T_C_b38	ATAD3C	-3.649	0.000376	-0.120249	4	0.032951	yes	BRNCHB
chr1_1366145_TGTGAA_T_b38	ATAD3C	-3.649	0.000376	-0.120249	4	0.032951	yes	BRNCHB
chr1_1366187_A_AGT_b38	ATAD3C	-3.649	0.000376	-0.120249	4	0.032951	yes	BRNCHB
chr1_1366292_G_T_b38	ATAD3C	-3.649	0.000376	-0.120249	4	0.032951	yes	BRNCHB
chr1_1366321_TGTGTGTAAATGG_T_b38	ATAD3C	-3.649	0.000376	-0.120249	4	0.032951	yes	BRNCHB
chr1_1366453_G_T_b38	ATAD3C	-3.649	0.000376	-0.120249	4	0.032951	yes	BRNCHB
chr1_1366726_T_G_b38	ATAD3C	-3.649	0.000376	-0.120249	4	0.032951	yes	BRNCHB
chr1_1367258_T_A_b38	ATAD3C	-3.649	0.000376	-0.120249	4	0.032951	yes	BRNCHB
chr1_1367280_T_A_b38	ATAD3C	-3.649	0.000376	-0.120249	4	0.032951	yes	BRNCHB
chr1_1367297_GAA_G_b38	ATAD3C	-3.649	0.000376	-0.120249	4	0.032951	yes	BRNCHB
chr1_1367300_T_TGA_b38	ATAD3C	-3.649	0.000376	-0.120249	4	0.032951	yes	BRNCHB
chr1_1367329_A_AGT_b38	ATAD3C	-3.649	0.000376	-0.120249	4	0.032951	yes	BRNCHB
chr1_1367373_T_TGTG_b38	ATAD3C	-3.649	0.000376	-0.120249	4	0.032951	yes	BRNCHB
chr1_1367388_T_TTGG_b38	ATAD3C	-3.649	0.000376	-0.120249	4	0.032951	yes	BRNCHB
chr1_1367462_T_C_b38	ATAD3C	-3.649	0.000376	-0.120249	4	0.032951	yes	BRNCHB
chr1_1367593_G_A_b38	ATAD3C	-3.649	0.000376	-0.120249	4	0.032951	yes	BRNCHB
chr1_1367602_GT_G_b38	ATAD3C	-3.649	0.000376	-0.120249	4	0.032951	yes	BRNCHB
chr1_1367605_GAGTGAGTGTA_G_b38	ATAD3C	-3.649	0.000376	-0.120249	4	0.032951	yes	BRNCHB
chr1_1367670_GGTGA_G_b38	ATAD3C	-3.649	0.000376	-0.120249	4	0.032951	yes	BRNCHB
chr1_1367722_TTTTA_T_b38	ATAD3C	-3.649	0.000376	-0.120249	4	0.032951	yes	BRNCHB
chr1_1367874_A_T_b38	ATAD3C	-3.649	0.000376	-0.120249	4	0.032951	yes	BRNCHB
chr1_1367919_C_T_b38	ATAD3C	-3.649	0.000376	-0.120249	4	0.032951	yes	BRNCHB
chr1_1367951_C_T_b38	ATAD3C	-3.649	0.000376	-0.120249	4	0.032951	yes	BRNCHB
chr1_1367965_A_G_b38	ATAD3C	-3.649	0.000376	-0.120249	4	0.032951	yes	BRNCHB
chr1_1367970_T_G_b38	ATAD3C	-3.649	0.000376	-0.120249	4	0.032951	yes	BRNCHB
chr1_1367994_C_A_b38	ATAD3C	-3.649	0.000376	-0.120249	4	0.032951	yes	BRNCHB
chr1_1368297_C_T_b38	ATAD3C	-3.649	0.000376	-0.120249	4	0.032951	yes	BRNCHB
chr1_1368514_C_G_b38	ATAD3C	-3.649	0.000376	-0.120249	4	0.032951	yes	BRNCHB
chr1_1368991_C_T_b38	ATAD3C	-3.649	0.000376	-0.120249	4	0.032951	yes	BRNCHB
chr1_1369009_T_C_b38	ATAD3C	-3.649	0.000376	-0.120249	4	0.032951	yes	BRNCHB
chr1_1369012_C_CG_b38	ATAD3C	-3.649	0.000376	-0.120249	4	0.032951	yes	BRNCHB
chr1_1369282_G_A_b38	ATAD3C	-3.649	0.000376	-0.120249	4	0.032951	yes	BRNCHB
chr1_1369320_GT_G_b38	ATAD3C	-3.649	0.000376	-0.120249	4	0.032951	yes	BRNCHB
chr1_1369407_G_A_b38	ATAD3C	-3.649	0.000376	-0.120249	4	0.032951	yes	BRNCHB
chr1_1369476_CTT_C_b38	ATAD3C	-3.649	0.000376	-0.120249	4	0.032951	yes	BRNCHB
chr1_1369556_C_G_b38	ATAD3C	-3.649	0.000376	-0.120249	4	0.032951	yes	BRNCHB
chr1_1369627_T_C_b38	ATAD3C	-3.649	0.000376	-0.120249	4	0.032951	yes	BRNCHB
chr1_1369686_T_C_b38	ATAD3C	-3.649	0.000376	-0.120249	4	0.032951	yes	BRNCHB
chr1_1369716_G_C_b38	ATAD3C	-3.649	0.000376	-0.120249	4	0.032951	yes	BRNCHB
chr1_1369741_C_T_b38	ATAD3C	-3.649	0.000376	-0.120249	4	0.032951	yes	BRNCHB
chr1_1370181_C_T_b38	ATAD3C	-3.649	0.000376	-0.120249	4	0.032951	yes	BRNCHB
chr1_1370317_G_C_b38	ATAD3C	-3.649	0.000376	-0.120249	4	0.032951	yes	BRNCHB
chr1_1370320_A_G_b38	ATAD3C	-3.649	0.000376	-0.120249	4	0.032951	yes	BRNCHB
chr1_1363880_A_G_b38	ATAD3C	-3.643	0.000385	-0.119644	4	0.032846	yes	BRNCHB
chr1_1370430_T_C_b38	ATAD3C	-3.637	0.000393	-0.119565	5	0.032879	yes	BRNCHB
chr1_1370532_C_T_b38	ATAD3C	-3.637	0.000393	-0.119565	5	0.032879	yes	BRNCHB
chr1_1370584_G_C_b38	ATAD3C	-3.637	0.000393	-0.119565	5	0.032879	yes	BRNCHB
chr1_1372909_G_A_b38	ATAD3C	-3.637	0.000393	-0.119565	5	0.032879	yes	BRNCHB
chr1_1543953_A_G_b38	ATAD3C	-3.603	0.000443	-0.10413	24	0.028905	yes	BRNCHB
chr1_1545795_C_A_b38	ATAD3C	-3.602	0.000444	-0.104064	21	0.028891	yes	BRNCHB
chr1_1577491_A_AC_b38	ATAD3C	-3.583	0.000473	-0.099796	28	0.027849	yes	BRNCHB
chr1_1551454_C_A_b38	ATAD3C	-3.569	0.000498	-0.092278	49	0.025857	yes	BRNCHB
chr1_1369821_C_T_b38	ATAD3C	-3.545	0.000541	-0.116454	4	0.032848	yes	BRNCHB
chr1_1367511_ATGAG_A_b38	ATAD3C	-3.52	0.00059	-0.119418	3	0.033924	yes	BRNCHB
chr1_1366681_T_TGA_b38	ATAD3C	-3.518	0.000595	-0.11824	4	0.033613	yes	BRNCHB
chr1_1379093_TG_T_b38	ATAD3C	-3.504	0.000623	-0.122908	4	0.035075	yes	BRNCHB
chr1_1428999_C_CA_b38	ATAD3C	-3.494	0.000645	-0.110388	8	0.031591	yes	BRNCHB
chr1_1538787_A_G_b38	ATAD3C	-3.493	0.000647	-0.09888	28	0.028306	yes	BRNCHB
chr1_1398056_C_A_b38	ATAD3C	-3.492	0.000649	-0.09086	21	0.026017	yes	BRNCHB
chr1_937396_GCC_G_b38	ATAD3C	3.444	0.000764	0.088352	35	0.02565	yes	BRNCHB
chr1_1901149_A_AAAGAAAGG_b38	ATAD3C	3.409	0.000862	0.089402	28	0.026227	yes	BRNCHB
chr1_1228424_C_T_b38	ATAD3C	-3.36	0.00101	-0.115716	3	0.034437	yes	BRNCHB
chr1_1574445_A_G_b38	ATAD3C	-3.335	0.0011	-0.094314	27	0.028279	yes	BRNCHB
chr1_1566086_G_A_b38	ATAD3C	-3.304	0.00122	-0.09285	29	0.028101	yes	BRNCHB
chr1_1369803_C_CT_b38	ATAD3C	-3.286	0.0013	-0.105441	5	0.032085	yes	BRNCHB
chr1_1340697_G_A_b38	ATAD3C	3.262	0.0014	0.09371	11	0.028727	yes	BRNCHB
chr1_1565105_CAAGGCAGGCGGATCATG_C_b38	ATAD3C	-3.25	0.00146	-0.089034	31	0.027397	yes	BRNCHB
chr1_914483_G_GACTGCCCAGCTC_b38	ATAD3C	3.247	0.00147	0.108405	7	0.033386	yes	BRNCHB
chr1_1231507_T_C_b38	ATAD3C	-3.223	0.00159	-0.111131	3	0.034477	yes	BRNCHB
chr1_1572532_A_C_b38	ATAD3C	-3.214	0.00164	-0.090173	29	0.028053	yes	BRNCHB
chr1_1573079_A_G_b38	ATAD3C	-3.214	0.00164	-0.090173	29	0.028053	yes	BRNCHB
chr1_1569661_T_C_b38	ATAD3C	-3.2	0.00172	-0.089944	27	0.028111	yes	BRNCHB
chr1_899548_A_G_b38	ATAD3C	3.184	0.00181	0.109465	4	0.034378	yes	BRNCHB
chr1_899619_G_A_b38	ATAD3C	3.184	0.00181	0.109465	4	0.034378	yes	BRNCHB
chr1_1570294_CA_C_b38	ATAD3C	-3.183	0.00181	-0.09065	28	0.028476	yes	BRNCHB
chr1_899452_G_C_b38	ATAD3C	3.175	0.00186	0.103107	6	0.03247	yes	BRNCHB
chr1_1573654_T_C_b38	ATAD3C	-3.171	0.00188	-0.089238	27	0.028144	yes	BRNCHB
chr1_1559750_C_CAG_b38	ATAD3C	-3.152	0.002	-0.088395	29	0.028046	yes	BRNCHB
chr1_1561628_T_C_b38	ATAD3C	-3.152	0.002	-0.088395	29	0.028046	yes	BRNCHB
chr1_1563918_A_G_b38	ATAD3C	-3.152	0.002	-0.088395	29	0.028046	yes	BRNCHB
chr1_1565561_A_G_b38	ATAD3C	-3.152	0.002	-0.088395	29	0.028046	yes	BRNCHB
chr1_1567715_G_A_b38	ATAD3C	-3.152	0.002	-0.088395	29	0.028046	yes	BRNCHB
chr1_1567719_A_C_b38	ATAD3C	-3.152	0.002	-0.088395	29	0.028046	yes	BRNCHB
chr1_1569875_C_T_b38	ATAD3C	-3.152	0.002	-0.088395	29	0.028046	yes	BRNCHB
chr1_1575724_G_C_b38	ATAD3C	-3.11	0.00229	-0.087489	26	0.028135	yes	BRNCHB
chr1_1763636_G_A_b38	ATAD3C	3.1	0.00236	0.098255	10	0.031692	yes	BRNCHB
chr1_1877316_A_T_b38	ATAD3C	3.1	0.00236	0.078288	26	0.025254	yes	BRNCHB
chr1_1517993_A_G_b38	ATAD3C	-3.096	0.00239	-0.091622	28	0.029592	yes	BRNCHB
chr1_1519934_T_G_b38	ATAD3C	-3.096	0.00239	-0.091622	28	0.029592	yes	BRNCHB
chr1_1519938_T_C_b38	ATAD3C	-3.096	0.00239	-0.091622	28	0.029592	yes	BRNCHB
chr1_1549590_C_G_b38	ATAD3C	-3.089	0.00245	-0.086535	28	0.028018	yes	BRNCHB
chr1_1553692_A_G_b38	ATAD3C	-3.089	0.00245	-0.086535	28	0.028018	yes	BRNCHB
chr1_1554694_A_G_b38	ATAD3C	-3.089	0.00245	-0.086535	28	0.028018	yes	BRNCHB
chr1_1554781_A_G_b38	ATAD3C	-3.089	0.00245	-0.086535	28	0.028018	yes	BRNCHB
chr1_1555247_T_A_b38	ATAD3C	-3.089	0.00245	-0.086535	28	0.028018	yes	BRNCHB
chr1_897843_C_T_b38	ATAD3C	3.018	0.00305	0.096	7	0.031811	yes	BRNCHB
chr1_897922_C_T_b38	ATAD3C	3.018	0.00305	0.096	7	0.031811	yes	BRNCHB
chr1_898261_T_C_b38	ATAD3C	3.018	0.00305	0.096	7	0.031811	yes	BRNCHB
chr1_898279_T_A_b38	ATAD3C	3.018	0.00305	0.096	7	0.031811	yes	BRNCHB
chr1_898283_A_G_b38	ATAD3C	3.018	0.00305	0.096	7	0.031811	yes	BRNCHB
chr1_898444_T_C_b38	ATAD3C	3.018	0.00305	0.096	7	0.031811	yes	BRNCHB
chr1_1538924_C_A_b38	ATAD3C	-3.015	0.00308	-0.087934	18	0.029169	yes	BRNCHB
chr1_911848_C_T_b38	ATAD3C	3.008	0.00314	0.097481	7	0.032404	yes	BRNCHB
chr1_896680_G_A_b38	ATAD3C	-2.994	0.00328	-0.093293	10	0.031159	yes	BRNCHB
chr1_896686_G_C_b38	ATAD3C	-2.994	0.00328	-0.093293	10	0.031159	yes	BRNCHB
chr1_896732_T_C_b38	ATAD3C	-2.994	0.00328	-0.093293	10	0.031159	yes	BRNCHB
chr1_896798_A_G_b38	ATAD3C	-2.994	0.00328	-0.093293	10	0.031159	yes	BRNCHB
chr1_896917_CTG_C_b38	ATAD3C	-2.994	0.00328	-0.093293	10	0.031159	yes	BRNCHB
chr1_896938_C_A_b38	ATAD3C	-2.994	0.00328	-0.093293	10	0.031159	yes	BRNCHB
chr1_897792_T_TCGAA_b38	ATAD3C	2.994	0.00328	0.093293	10	0.031159	yes	BRNCHB
chr1_917378_G_C_b38	ATAD3C	2.993	0.00329	0.098233	6	0.032825	yes	BRNCHB
chr1_1533841_T_C_b38	ATAD3C	-2.969	0.00354	-0.099215	16	0.033415	yes	BRNCHB
chr1_1897682_CA_C_b38	ATAD3C	2.93	0.00399	0.092647	6	0.031621	yes	BRNCHB
chr1_912111_G_A_b38	ATAD3C	2.912	0.00421	0.092154	8	0.031645	yes	BRNCHB
chr1_913065_G_A_b38	ATAD3C	2.912	0.00421	0.092154	8	0.031645	yes	BRNCHB
chr1_913076_A_G_b38	ATAD3C	2.912	0.00421	0.092154	8	0.031645	yes	BRNCHB
chr1_1901149_A_AAAGAAAGGAAGAAAGG_b38	ATAD3C	-2.911	0.00423	-0.079334	34	0.027257	yes	BRNCHB
chr1_910255_C_T_b38	ATAD3C	2.902	0.00434	0.09523	7	0.032819	yes	BRNCHB
chr1_1471992_T_C_b38	ATAD3C	-2.895	0.00443	-0.097592	22	0.033712	yes	BRNCHB
chr1_1554852_T_C_b38	ATAD3C	-2.893	0.00445	-0.081025	28	0.028004	yes	BRNCHB
chr1_1560765_T_C_b38	ATAD3C	-2.881	0.00461	-0.085392	22	0.029637	yes	BRNCHB
chr1_1562261_TTTTC_T_b38	ATAD3C	-2.881	0.00461	-0.085392	22	0.029637	yes	BRNCHB
chr1_914682_A_T_b38	ATAD3C	2.876	0.00468	0.093085	7	0.032362	yes	BRNCHB
chr1_1407232_G_C_b38	ATAD3C	-2.865	0.00485	-0.084465	10	0.029486	yes	BRNCHB
chr1_1575421_C_T_b38	ATAD3C	-2.864	0.00485	-0.080898	26	0.028242	yes	BRNCHB
chr1_1572877_TG_T_b38	ATAD3C	-2.856	0.00497	-0.089707	8	0.03141	yes	BRNCHB
chr1_910698_C_T_b38	ATAD3C	2.856	0.00498	0.093749	7	0.032828	yes	BRNCHB
chr1_917859_A_G_b38	ATAD3C	2.854	0.00501	0.094714	6	0.033189	yes	BRNCHB
chr1_900119_A_G_b38	ATAD3C	2.851	0.00505	0.090028	8	0.031581	yes	BRNCHB
chr1_918870_A_G_b38	ATAD3C	2.833	0.00533	0.089711	7	0.031668	yes	BRNCHB
chr1_2367306_CAA_C_b38	ATAD3C	2.831	0.00535	0.082844	26	0.029261	yes	BRNCHB
chr1_917284_C_T_b38	ATAD3C	2.83	0.00537	0.092303	6	0.032612	yes	BRNCHB
chr1_897538_T_C_b38	ATAD3C	2.816	0.0056	0.086535	11	0.030732	yes	BRNCHB
chr1_1565680_A_AG_b38	ATAD3C	-2.81	0.00569	-0.078125	29	0.027799	yes	BRNCHB
chr1_976536_C_T_b38	ATAD3C	2.809	0.00572	0.100999	3	0.035958	yes	BRNCHB
chr1_978230_G_A_b38	ATAD3C	2.809	0.00572	0.100999	3	0.035958	yes	BRNCHB
chr1_1497605_G_C_b38	ATAD3C	-2.802	0.00583	-0.087217	18	0.031129	yes	BRNCHB
chr1_915810_G_A_b38	ATAD3C	2.786	0.00612	0.090686	7	0.032555	yes	BRNCHB
chr1_913274_TG_T_b38	ATAD3C	2.782	0.00619	0.091556	6	0.032915	yes	BRNCHB
chr1_1302795_T_TC_b38	ATAD3C	2.769	0.00642	0.08917	23	0.032205	yes	BRNCHB
chr1_912710_G_A_b38	ATAD3C	2.757	0.00665	0.089084	6	0.032315	yes	BRNCHB
chr1_913358_C_T_b38	ATAD3C	2.757	0.00665	0.089084	6	0.032315	yes	BRNCHB
chr1_914743_C_T_b38	ATAD3C	2.757	0.00665	0.089084	6	0.032315	yes	BRNCHB
chr1_915824_G_C_b38	ATAD3C	2.755	0.00669	0.08704	8	0.031594	yes	BRNCHB
chr1_896529_C_T_b38	ATAD3C	-2.725	0.0073	-0.083241	12	0.030552	yes	BRNCHB
chr1_981282_A_C_b38	ATAD3C	2.72	0.0074	0.097769	3	0.035947	yes	BRNCHB
chr1_975555_G_A_b38	ATAD3C	2.714	0.00751	0.093711	4	0.034524	yes	BRNCHB
chr1_1292284_TTGAG_T_b38	ATAD3C	-2.711	0.0076	-0.099556	9	0.036729	yes	BRNCHB
chr1_1229369_G_GC_b38	ATAD3C	-2.709	0.00764	-0.093614	5	0.034563	yes	BRNCHB
chr1_1238902_T_C_b38	ATAD3C	-2.692	0.008	-0.076747	22	0.028504	yes	BRNCHB
chr1_2133900_A_G_b38	ATAD3C	-2.651	0.009	-0.072482	24	0.027344	yes	BRNCHB
chr1_2133904_G_C_b38	ATAD3C	-2.651	0.009	-0.072482	24	0.027344	yes	BRNCHB
chr1_897376_T_G_b38	ATAD3C	2.634	0.00944	0.084911	9	0.032241	yes	BRNCHB
chr1_932255_C_T_b38	ATAD3C	2.632	0.00948	0.089985	4	0.034184	yes	BRNCHB
chr1_2139901_C_A_b38	ATAD3C	-2.614	0.00999	-0.07122	24	0.02725	yes	BRNCHB
chr1_2140326_A_G_b38	ATAD3C	-2.614	0.00999	-0.07122	24	0.02725	yes	BRNCHB
chr1_1431450_A_G_b38	ATAD3C	-7.092	6.88e-11	-0.182246	25	0.025697	no	BRNCHB
chr1_1431537_G_C_b38	ATAD3C	-7.092	6.88e-11	-0.182246	25	0.025697	no	BRNCHB
chr1_1436079_A_G_b38	ATAD3C	-7.081	7.3e-11	-0.177293	25	0.025038	no	BRNCHB
chr1_1443457_T_C_b38	ATAD3C	-7.029	9.58e-11	-0.18111	26	0.025766	no	BRNCHB
chr1_1431014_G_A_b38	ATAD3C	-6.905	1.83e-10	-0.173926	14	0.025189	no	BRNCHB
chr1_1430908_A_G_b38	ATAD3C	-6.876	2.12e-10	-0.179896	25	0.026162	no	BRNCHB
chr1_1430190_A_C_b38	ATAD3C	-6.808	3.03e-10	-0.178505	25	0.026221	no	BRNCHB
chr1_1428969_T_C_b38	ATAD3C	-6.738	4.34e-10	-0.177102	25	0.026285	no	BRNCHB
chr1_1440834_C_G_b38	ATAD3C	-6.647	6.91e-10	-0.170192	25	0.025604	no	BRNCHB
chr1_1426261_C_T_b38	ATAD3C	-6.643	7.06e-10	-0.176568	25	0.02658	no	BRNCHB
chr1_1426810_C_G_b38	ATAD3C	-6.643	7.06e-10	-0.176568	25	0.02658	no	BRNCHB
chr1_1433374_T_C_b38	ATAD3C	-6.58	9.7e-10	-0.169817	26	0.025807	no	BRNCHB
chr1_1445187_T_G_b38	ATAD3C	-6.386	2.59e-09	-0.167031	23	0.026157	no	BRNCHB
chr1_1431026_CCACCCCCT_C_b38	ATAD3C	-6.305	3.88e-09	-0.17425	13	0.027639	no	BRNCHB
chr1_1445240_A_G_b38	ATAD3C	-6.272	4.58e-09	-0.165556	24	0.026398	no	BRNCHB
chr1_1436388_CA_C_b38	ATAD3C	-5.852	3.55e-08	-0.15866	16	0.027114	no	BRNCHB
chr1_1438102_G_C_b38	ATAD3C	-5.84	3.75e-08	-0.157578	11	0.026981	no	BRNCHB
chr1_1439454_A_G_b38	ATAD3C	-5.835	3.85e-08	-0.145635	25	0.024959	no	BRNCHB
chr1_1441187_A_G_b38	ATAD3C	-5.739	6.06e-08	-0.155937	18	0.02717	no	BRNCHB
chr1_1330125_G_A_b38	ATAD3C	5.165	8.52e-07	0.146474	20	0.028361	no	BRNCHB
chr1_1308516_C_T_b38	ATAD3C	5.154	8.92e-07	0.143946	21	0.027928	no	BRNCHB
chr1_1312114_T_C_b38	ATAD3C	5.125	1.02e-06	0.143227	21	0.027949	no	BRNCHB
chr1_1376162_G_C_b38	ATAD3C	5.057	1.37e-06	0.144044	14	0.028486	no	BRNCHB
chr1_1377431_C_T_b38	ATAD3C	5.057	1.37e-06	0.144044	14	0.028486	no	BRNCHB
chr1_1400410_A_G_b38	ATAD3C	-5.049	1.42e-06	-0.145379	13	0.028793	no	BRNCHB
chr1_1378204_G_C_b38	ATAD3C	5.049	1.42e-06	0.140756	15	0.027878	no	BRNCHB
chr1_1309988_G_A_b38	ATAD3C	5.025	1.58e-06	0.14062	21	0.027986	no	BRNCHB
chr1_1313807_G_A_b38	ATAD3C	5.025	1.58e-06	0.14062	21	0.027986	no	BRNCHB
chr1_1448915_G_A_b38	ATAD3C	-4.935	2.34e-06	-0.136709	17	0.027703	no	BRNCHB
chr1_1402457_A_G_b38	ATAD3C	-4.934	2.35e-06	-0.145093	18	0.029409	no	BRNCHB
chr1_1411323_A_C_b38	ATAD3C	-4.872	3.07e-06	-0.144309	20	0.029621	no	BRNCHB
chr1_1387698_A_G_b38	ATAD3C	4.848	3.4e-06	0.14265	18	0.029424	no	BRNCHB
chr1_1384749_C_G_b38	ATAD3C	4.847	3.41e-06	0.139307	14	0.02874	no	BRNCHB
chr1_1387763_CCT_C_b38	ATAD3C	4.847	3.41e-06	0.139307	14	0.02874	no	BRNCHB
chr1_1388944_G_A_b38	ATAD3C	4.847	3.41e-06	0.139307	14	0.02874	no	BRNCHB
chr1_1439805_G_C_b38	ATAD3C	-4.76	4.95e-06	-0.139162	10	0.029237	no	BRNCHB
chr1_1358384_G_C_b38	ATAD3C	4.752	5.12e-06	0.135933	19	0.028605	no	BRNCHB
chr1_1389827_C_T_b38	ATAD3C	4.743	5.31e-06	0.139138	17	0.029332	no	BRNCHB
chr1_1394423_A_G_b38	ATAD3C	-4.743	5.31e-06	-0.139138	17	0.029332	no	BRNCHB
chr1_1395346_A_G_b38	ATAD3C	-4.743	5.31e-06	-0.139138	17	0.029332	no	BRNCHB
chr1_1366561_AGT_A_b38	ATAD3C	4.687	6.73e-06	0.133783	18	0.028543	no	BRNCHB
chr1_1337898_A_G_b38	ATAD3C	4.641	8.17e-06	0.127785	10	0.027536	no	BRNCHB
chr1_1370113_A_G_b38	ATAD3C	4.454	1.76e-05	0.123863	17	0.027807	no	BRNCHB
chr1_1363898_C_T_b38	ATAD3C	4.395	2.24e-05	0.133951	5	0.030479	no	BRNCHB
chr1_1363986_C_T_b38	ATAD3C	4.395	2.24e-05	0.133951	5	0.030479	no	BRNCHB
chr1_1365566_G_A_b38	ATAD3C	4.395	2.24e-05	0.133951	5	0.030479	no	BRNCHB
chr1_1366529_TTAG_T_b38	ATAD3C	4.395	2.24e-05	0.133951	5	0.030479	no	BRNCHB
chr1_1367292_A_AGT_b38	ATAD3C	4.395	2.24e-05	0.133951	5	0.030479	no	BRNCHB
chr1_1379083_AT_A_b38	ATAD3C	4.377	2.4e-05	0.122571	11	0.028002	no	BRNCHB
chr1_1394041_G_A_b38	ATAD3C	-4.308	3.17e-05	-0.148115	3	0.034384	no	BRNCHB
chr1_1379091_T_G_b38	ATAD3C	4.236	4.2e-05	0.131723	5	0.031096	no	BRNCHB
chr1_1303800_G_A_b38	ATAD3C	-4.195	4.93e-05	-0.14214	4	0.03388	no	BRNCHB
chr1_1304555_A_C_b38	ATAD3C	-4.195	4.93e-05	-0.14214	4	0.03388	no	BRNCHB
chr1_1454848_T_C_b38	ATAD3C	-4.162	5.6e-05	-0.133889	10	0.032168	no	BRNCHB
chr1_1325753_G_T_b38	ATAD3C	-4.134	6.24e-05	-0.14396	3	0.034821	no	BRNCHB
chr1_1361679_G_A_b38	ATAD3C	4.128	6.39e-05	0.123998	11	0.030037	no	BRNCHB
chr1_1457071_C_T_b38	ATAD3C	-4.084	7.58e-05	-0.12389	11	0.030337	no	BRNCHB
chr1_1363456_CAG_C_b38	ATAD3C	4.039	8.97e-05	0.111164	11	0.027519	no	BRNCHB
chr1_1303112_G_A_b38	ATAD3C	-3.982	0.000112	-0.136137	4	0.034191	no	BRNCHB
chr1_1549967_C_G_b38	ATAD3C	-3.928	0.000137	-0.112783	17	0.028714	no	BRNCHB
chr1_1380867_A_G_b38	ATAD3C	-3.928	0.000137	-0.129552	5	0.032983	no	BRNCHB
chr1_1366511_GGTGA_G_b38	ATAD3C	-3.896	0.000154	-0.128637	4	0.033021	no	BRNCHB
chr1_1452540_G_A_b38	ATAD3C	-3.891	0.000156	-0.123391	8	0.03171	no	BRNCHB
chr1_1400756_GGA_G_b38	ATAD3C	-3.885	0.00016	-0.129156	5	0.033247	no	BRNCHB
chr1_1401954_G_T_b38	ATAD3C	-3.885	0.00016	-0.129156	5	0.033247	no	BRNCHB
chr1_1403593_A_G_b38	ATAD3C	-3.885	0.00016	-0.129156	5	0.033247	no	BRNCHB
chr1_1407565_C_A_b38	ATAD3C	-3.885	0.00016	-0.129156	5	0.033247	no	BRNCHB
chr1_1188054_T_A_b38	ATAD3C	-3.881	0.000163	-0.123533	6	0.031834	no	BRNCHB
chr1_1449831_A_G_b38	ATAD3C	-3.878	0.000164	-0.133762	19	0.034489	no	BRNCHB
chr1_1383743_T_C_b38	ATAD3C	-3.875	0.000166	-0.128699	5	0.033209	no	BRNCHB
chr1_1363688_C_T_b38	ATAD3C	-3.871	0.000169	-0.127595	4	0.032964	no	BRNCHB
chr1_1364099_CCA_C_b38	ATAD3C	-3.871	0.000169	-0.127595	4	0.032964	no	BRNCHB
chr1_1364102_TGTTG_T_b38	ATAD3C	-3.871	0.000169	-0.127595	4	0.032964	no	BRNCHB
chr1_1368763_G_A_b38	ATAD3C	-3.871	0.000169	-0.127595	4	0.032964	no	BRNCHB
chr1_1450636_A_G_b38	ATAD3C	-3.855	0.000179	-0.132733	3	0.034434	no	BRNCHB
chr1_1452825_AAAG_A_b38	ATAD3C	-3.848	0.000184	-0.127082	10	0.033026	no	BRNCHB
chr1_1453552_G_A_b38	ATAD3C	-3.848	0.000184	-0.127082	10	0.033026	no	BRNCHB
chr1_1455134_T_G_b38	ATAD3C	-3.848	0.000184	-0.127082	10	0.033026	no	BRNCHB
chr1_1455337_A_G_b38	ATAD3C	-3.848	0.000184	-0.127082	10	0.033026	no	BRNCHB
chr1_1455495_C_T_b38	ATAD3C	-3.848	0.000184	-0.127082	10	0.033026	no	BRNCHB
chr1_1455924_T_C_b38	ATAD3C	-3.848	0.000184	-0.127082	10	0.033026	no	BRNCHB
chr1_1456051_C_T_b38	ATAD3C	-3.848	0.000184	-0.127082	10	0.033026	no	BRNCHB
chr1_1456079_T_C_b38	ATAD3C	-3.848	0.000184	-0.127082	10	0.033026	no	BRNCHB
chr1_1456154_G_A_b38	ATAD3C	-3.848	0.000184	-0.127082	10	0.033026	no	BRNCHB
chr1_1384546_C_T_b38	ATAD3C	-3.815	0.000207	-0.127185	5	0.033338	no	BRNCHB
chr1_1398218_C_A_b38	ATAD3C	-3.815	0.000207	-0.127185	5	0.033338	no	BRNCHB
chr1_1543500_T_G_b38	ATAD3C	-3.812	0.000209	-0.109722	24	0.02878	no	BRNCHB
chr1_1364253_C_G_b38	ATAD3C	-3.802	0.000217	-0.125606	4	0.033033	no	BRNCHB
chr1_1329973_GCGTGTGCCATGCA_G_b38	ATAD3C	-3.792	0.000225	-0.126385	4	0.033331	no	BRNCHB
chr1_1454315_C_T_b38	ATAD3C	-3.789	0.000228	-0.123268	15	0.032534	no	BRNCHB
chr1_1367268_TGA_T_b38	ATAD3C	-3.785	0.000231	-0.123194	4	0.032544	no	BRNCHB
chr1_1548572_A_AC_b38	ATAD3C	-3.781	0.000234	-0.18088	4	0.04784	no	BRNCHB
chr1_1542773_T_C_b38	ATAD3C	-3.778	0.000237	-0.107929	24	0.028565	no	BRNCHB
chr1_1542793_C_G_b38	ATAD3C	-3.778	0.000237	-0.107929	24	0.028565	no	BRNCHB
chr1_1542800_T_C_b38	ATAD3C	-3.778	0.000237	-0.107929	24	0.028565	no	BRNCHB
chr1_1344048_G_A_b38	ATAD3C	-3.768	0.000246	-0.124293	4	0.032988	no	BRNCHB
chr1_1316929_A_T_b38	ATAD3C	-3.763	0.00025	-0.11956	6	0.031771	no	BRNCHB
chr1_1451968_C_T_b38	ATAD3C	-3.719	0.000293	-0.12236	8	0.032902	no	BRNCHB
chr1_1451028_T_A_b38	ATAD3C	-3.685	0.000331	-0.126756	3	0.034399	no	BRNCHB
chr1_1217733_G_A_b38	ATAD3C	-3.681	0.000335	-0.13014	3	0.035352	no	BRNCHB
chr1_1455617_T_G_b38	ATAD3C	-3.668	0.000352	-0.121151	19	0.033033	no	BRNCHB
chr1_1457033_A_C_b38	ATAD3C	-3.625	0.000409	-0.119822	9	0.03305	no	BRNCHB
chr1_1259424_T_C_b38	ATAD3C	-3.625	0.000409	-0.110389	18	0.030452	no	BRNCHB
chr1_1453870_A_C_b38	ATAD3C	-3.62	0.000416	-0.124813	3	0.034478	no	BRNCHB
chr1_1454770_T_C_b38	ATAD3C	-3.616	0.000422	-0.118816	19	0.032859	no	BRNCHB
chr1_1453703_A_G_b38	ATAD3C	-3.576	0.000486	-0.118315	18	0.033086	no	BRNCHB
chr1_1550064_GC_G_b38	ATAD3C	-3.576	0.000486	-0.103228	24	0.028867	no	BRNCHB
chr1_1550068_C_A_b38	ATAD3C	-3.576	0.000486	-0.103228	24	0.028867	no	BRNCHB
chr1_1569180_T_A_b38	ATAD3C	-3.543	0.000546	-0.100364	27	0.028331	no	BRNCHB
chr1_1173872_A_G_b38	ATAD3C	-3.531	0.000569	-0.091276	20	0.025851	no	BRNCHB
chr1_1368177_G_C_b38	ATAD3C	-3.516	0.000598	-0.118284	4	0.033642	no	BRNCHB
chr1_1437993_G_A_b38	ATAD3C	-3.512	0.000607	-0.10182	11	0.028992	no	BRNCHB
chr1_1452511_A_G_b38	ATAD3C	-3.491	0.000653	-0.115378	18	0.033054	no	BRNCHB
chr1_1452888_C_A_b38	ATAD3C	-3.491	0.000653	-0.115378	18	0.033054	no	BRNCHB
chr1_1452909_A_C_b38	ATAD3C	-3.491	0.000653	-0.115378	18	0.033054	no	BRNCHB
chr1_1454092_A_G_b38	ATAD3C	-3.491	0.000653	-0.115378	18	0.033054	no	BRNCHB
chr1_1453961_C_T_b38	ATAD3C	-3.488	0.000658	-0.122176	3	0.035025	no	BRNCHB
chr1_1361685_C_T_b38	ATAD3C	-3.459	0.000728	-0.108946	10	0.0315	no	BRNCHB
chr1_1452346_A_G_b38	ATAD3C	-3.388	0.000924	-0.114586	4	0.033818	no	BRNCHB
chr1_1537160_T_G_b38	ATAD3C	-3.382	0.000943	-0.087971	35	0.026011	no	BRNCHB
chr1_1290841_A_G_b38	ATAD3C	-3.379	0.000952	-0.113469	12	0.033576	no	BRNCHB
chr1_1184277_G_C_b38	ATAD3C	-3.33	0.00112	-0.091496	31	0.027473	no	BRNCHB
chr1_1449009_A_T_b38	ATAD3C	-3.301	0.00123	-0.112635	12	0.034118	no	BRNCHB
chr1_1452384_G_A_b38	ATAD3C	-3.3	0.00124	-0.111919	4	0.033915	no	BRNCHB
chr1_1547630_G_A_b38	ATAD3C	-3.279	0.00133	-0.09156	24	0.027927	no	BRNCHB
chr1_1456217_T_C_b38	ATAD3C	-3.272	0.00136	-0.115433	18	0.035275	no	BRNCHB
chr1_1452797_CAA_C_b38	ATAD3C	-3.229	0.00156	-0.112002	6	0.034691	no	BRNCHB
chr1_1456891_T_C_b38	ATAD3C	-3.212	0.00165	-0.100613	13	0.031326	no	BRNCHB
chr1_1258206_AT_A_b38	ATAD3C	-3.18	0.00183	-0.093251	18	0.029326	no	BRNCHB
chr1_1217251_C_A_b38	ATAD3C	-3.16	0.00195	-0.111181	4	0.035182	no	BRNCHB
chr1_1290968_C_G_b38	ATAD3C	-3.15	0.00201	-0.112258	14	0.035638	no	BRNCHB
chr1_1447108_A_ATT_b38	ATAD3C	-3.141	0.00207	-0.099799	11	0.031775	no	BRNCHB
chr1_931558_G_A_b38	ATAD3C	3.139	0.00209	0.100142	5	0.031906	no	BRNCHB
chr1_1216593_G_C_b38	ATAD3C	-3.126	0.00218	-0.107587	4	0.034421	no	BRNCHB
chr1_941767_G_A_b38	ATAD3C	3.1	0.00236	0.10411	7	0.033579	no	BRNCHB
chr1_906982_C_T_b38	ATAD3C	3.087	0.00246	0.09748	6	0.031577	no	BRNCHB
chr1_1537493_T_A_b38	ATAD3C	-3.061	0.00266	-0.088455	23	0.028896	no	BRNCHB
chr1_1215852_T_C_b38	ATAD3C	-3.044	0.00281	-0.103171	5	0.033891	no	BRNCHB
chr1_1566854_CA_C_b38	ATAD3C	-3.039	0.00285	-0.091929	20	0.030245	no	BRNCHB
chr1_1366776_G_GAATT_b38	ATAD3C	-3.027	0.00296	-0.103393	4	0.034155	no	BRNCHB
chr1_965125_G_C_b38	ATAD3C	3.019	0.00304	0.100184	8	0.033186	no	BRNCHB
chr1_1456829_G_C_b38	ATAD3C	-3.013	0.00309	-0.100816	13	0.033459	no	BRNCHB
chr1_903007_T_C_b38	ATAD3C	2.985	0.00337	0.103858	4	0.034795	no	BRNCHB
chr1_1182018_A_G_b38	ATAD3C	-2.978	0.00345	-0.084139	27	0.028257	no	BRNCHB
chr1_1251122_A_T_b38	ATAD3C	-2.962	0.00362	-0.098906	8	0.03339	no	BRNCHB
chr1_935954_G_T_b38	ATAD3C	-2.931	0.00397	-0.081941	21	0.027957	no	BRNCHB
chr1_1231710_CCCCCGGGAA_C_b38	ATAD3C	-2.921	0.00409	-0.106769	3	0.036547	no	BRNCHB
chr1_929558_G_A_b38	ATAD3C	-2.914	0.00418	-0.084597	14	0.029031	no	BRNCHB
chr1_901149_C_G_b38	ATAD3C	2.899	0.00438	0.101851	4	0.035139	no	BRNCHB
chr1_901544_G_A_b38	ATAD3C	2.899	0.00438	0.101851	4	0.035139	no	BRNCHB
chr1_1367028_A_G_b38	ATAD3C	2.886	0.00455	0.112636	3	0.039033	no	BRNCHB
chr1_906633_T_G_b38	ATAD3C	2.842	0.00518	0.099007	4	0.034837	no	BRNCHB
chr1_924305_G_A_b38	ATAD3C	2.84	0.00521	0.086903	10	0.030599	no	BRNCHB
chr1_1571794_A_AT_b38	ATAD3C	-2.837	0.00526	-0.082638	24	0.029129	no	BRNCHB
chr1_1573265_C_CAAAA_b38	ATAD3C	-2.834	0.00531	-0.104659	9	0.036932	no	BRNCHB
chr1_938178_G_T_b38	ATAD3C	-2.808	0.00573	-0.081903	19	0.029165	no	BRNCHB
chr1_928622_G_C_b38	ATAD3C	2.803	0.00581	0.097743	3	0.034867	no	BRNCHB
chr1_965666_ACC_A_b38	ATAD3C	2.793	0.00598	0.093221	7	0.033374	no	BRNCHB
chr1_954724_G_A_b38	ATAD3C	2.785	0.00612	0.09336	7	0.033517	no	BRNCHB
chr1_929839_G_A_b38	ATAD3C	2.784	0.00614	0.09482	4	0.034057	no	BRNCHB
chr1_922660_C_A_b38	ATAD3C	2.775	0.00631	0.096652	3	0.034831	no	BRNCHB
chr1_922671_C_T_b38	ATAD3C	2.775	0.00631	0.096652	3	0.034831	no	BRNCHB
chr1_1201373_T_C_b38	ATAD3C	-2.772	0.00637	-0.090791	11	0.032755	no	BRNCHB
chr1_935265_T_C_b38	ATAD3C	2.772	0.00637	0.091521	13	0.033021	no	BRNCHB
chr1_968046_C_T_b38	ATAD3C	2.77	0.00639	0.087958	11	0.031749	no	BRNCHB
chr1_1558347_G_A_b38	ATAD3C	-2.751	0.00676	-0.086517	19	0.031446	no	BRNCHB
chr1_2181226_G_A_b38	ATAD3C	2.746	0.00687	0.072717	24	0.026483	no	BRNCHB
chr1_1221049_C_G_b38	ATAD3C	-2.745	0.00687	-0.083992	18	0.030594	no	BRNCHB
chr1_902949_G_GC_b38	ATAD3C	2.739	0.00699	0.096656	4	0.035283	no	BRNCHB
chr1_2333631_T_C_b38	ATAD3C	2.733	0.00713	0.090284	5	0.033039	no	BRNCHB
chr1_1238231_G_A_b38	ATAD3C	-2.731	0.00715	-0.090291	8	0.033056	no	BRNCHB
chr1_945259_TC_T_b38	ATAD3C	2.719	0.00741	0.091052	7	0.033485	no	BRNCHB
chr1_936972_G_C_b38	ATAD3C	2.718	0.00743	0.079632	13	0.029293	no	BRNCHB
chr1_1522693_A_G_b38	ATAD3C	2.716	0.00747	0.091057	6	0.033521	no	BRNCHB
chr1_1553018_CA_C_b38	ATAD3C	-2.714	0.00753	-0.092647	5	0.034141	no	BRNCHB
chr1_2194503_C_G_b38	ATAD3C	2.709	0.00764	0.06776	29	0.025016	no	BRNCHB
chr1_1482316_C_G_b38	ATAD3C	-2.705	0.00772	-0.075251	14	0.027818	no	BRNCHB
chr1_1249880_A_G_b38	ATAD3C	-2.7	0.00783	-0.090863	8	0.033652	no	BRNCHB
chr1_904947_G_A_b38	ATAD3C	2.685	0.00818	0.090992	5	0.033893	no	BRNCHB
chr1_1180931_A_G_b38	ATAD3C	-2.676	0.00837	-0.074406	29	0.027801	no	BRNCHB
chr1_1545968_T_C_b38	ATAD3C	-2.651	0.00899	-0.082823	11	0.031243	no	BRNCHB
chr1_925036_G_A_b38	ATAD3C	-2.65	0.00903	-0.080777	11	0.030487	no	BRNCHB
chr1_926250_G_A_b38	ATAD3C	-2.65	0.00903	-0.080777	11	0.030487	no	BRNCHB
chr1_898547_T_C_b38	ATAD3C	2.647	0.00909	0.089585	5	0.033844	no	BRNCHB
chr1_1551523_T_C_b38	ATAD3C	-2.634	0.00943	-0.083705	10	0.031777	no	BRNCHB
chr1_896109_C_T_b38	ATAD3C	-2.627	0.00963	-0.082335	12	0.031346	no	BRNCHB
chr1_1440430_C_G_b38	ATAD3C	-5.815	2.98e-08	-0.129483	20	0.022266	yes	BRNCHA
chr1_1443457_T_C_b38	ATAD3C	-5.767	3.79e-08	-0.128979	28	0.022366	yes	BRNCHA
chr1_1440834_C_G_b38	ATAD3C	-5.488	1.47e-07	-0.122551	27	0.02233	yes	BRNCHA
chr1_1430908_A_G_b38	ATAD3C	-5.362	2.69e-07	-0.126079	25	0.023515	yes	BRNCHA
chr1_1430190_A_C_b38	ATAD3C	-5.352	2.82e-07	-0.125341	25	0.02342	yes	BRNCHA
chr1_1431450_A_G_b38	ATAD3C	-5.352	2.82e-07	-0.125341	25	0.02342	yes	BRNCHA
chr1_1431537_G_C_b38	ATAD3C	-5.352	2.82e-07	-0.125341	25	0.02342	yes	BRNCHA
chr1_1436079_A_G_b38	ATAD3C	-5.352	2.82e-07	-0.117982	27	0.022046	yes	BRNCHA
chr1_1431026_CCACCCCCT_C_b38	ATAD3C	-5.329	3.13e-07	-0.1341	11	0.025162	yes	BRNCHA
chr1_1428969_T_C_b38	ATAD3C	-5.318	3.3e-07	-0.124022	25	0.02332	yes	BRNCHA
chr1_1433374_T_C_b38	ATAD3C	-5.286	3.84e-07	-0.116901	30	0.022115	yes	BRNCHA
chr1_1431014_G_A_b38	ATAD3C	-5.284	3.88e-07	-0.121333	16	0.022961	yes	BRNCHA
chr1_1436388_CA_C_b38	ATAD3C	-5.104	8.91e-07	-0.119418	18	0.023395	yes	BRNCHA
chr1_1426261_C_T_b38	ATAD3C	-5.093	9.38e-07	-0.120126	25	0.023586	yes	BRNCHA
chr1_1426810_C_G_b38	ATAD3C	-5.093	9.38e-07	-0.120126	25	0.023586	yes	BRNCHA
chr1_1442793_G_A_b38	ATAD3C	-4.988	1.51e-06	-0.127392	8	0.025538	yes	BRNCHA
chr1_1439454_A_G_b38	ATAD3C	-4.961	1.71e-06	-0.110262	26	0.022227	yes	BRNCHA
chr1_1431656_G_A_b38	ATAD3C	-4.939	1.88e-06	-0.127722	7	0.025858	yes	BRNCHA
chr1_1308178_GGGGCGCGGGGA_G_b38	ATAD3C	-4.871	2.55e-06	-0.119996	8	0.024634	yes	BRNCHA
chr1_1441187_A_G_b38	ATAD3C	-4.821	3.18e-06	-0.114263	20	0.023701	yes	BRNCHA
chr1_1426253_G_A_b38	ATAD3C	-4.813	3.29e-06	-0.127342	7	0.026458	yes	BRNCHA
chr1_1438102_G_C_b38	ATAD3C	-4.734	4.66e-06	-0.11248	12	0.023761	yes	BRNCHA
chr1_1370113_A_G_b38	ATAD3C	4.707	5.24e-06	0.112568	17	0.023917	yes	BRNCHA
chr1_1445187_T_G_b38	ATAD3C	-4.68	5.89e-06	-0.104956	25	0.022429	yes	BRNCHA
chr1_1363456_CAG_C_b38	ATAD3C	4.672	6.09e-06	0.10679	13	0.022858	yes	BRNCHA
chr1_1363898_C_T_b38	ATAD3C	4.621	7.56e-06	0.120223	5	0.026014	yes	BRNCHA
chr1_1363986_C_T_b38	ATAD3C	4.621	7.56e-06	0.120223	5	0.026014	yes	BRNCHA
chr1_1365566_G_A_b38	ATAD3C	4.621	7.56e-06	0.120223	5	0.026014	yes	BRNCHA
chr1_1366529_TTAG_T_b38	ATAD3C	4.621	7.56e-06	0.120223	5	0.026014	yes	BRNCHA
chr1_1367292_A_AGT_b38	ATAD3C	4.621	7.56e-06	0.120223	5	0.026014	yes	BRNCHA
chr1_1330125_G_A_b38	ATAD3C	4.53	1.12e-05	0.1133	22	0.025012	yes	BRNCHA
chr1_1366941_T_TGTGTGCA_b38	ATAD3C	4.519	1.17e-05	0.136118	4	0.030118	yes	BRNCHA
chr1_1445240_A_G_b38	ATAD3C	-4.518	1.17e-05	-0.101864	26	0.022547	yes	BRNCHA
chr1_1379083_AT_A_b38	ATAD3C	4.509	1.22e-05	0.10634	13	0.023583	yes	BRNCHA
chr1_1363438_C_CTT_b38	ATAD3C	4.501	1.26e-05	0.106779	17	0.023723	yes	BRNCHA
chr1_1312114_T_C_b38	ATAD3C	4.499	1.27e-05	0.110877	23	0.024642	yes	BRNCHA
chr1_1437955_C_G_b38	ATAD3C	-4.499	1.27e-05	-0.095064	25	0.02113	yes	BRNCHA
chr1_1370553_CAAA_C_b38	ATAD3C	-4.499	1.27e-05	-0.131642	4	0.029263	yes	BRNCHA
chr1_1366427_AGTGTGATTGAATGAGT_A_b38	ATAD3C	4.469	1.44e-05	0.109307	15	0.024459	yes	BRNCHA
chr1_1435945_C_CCGGGCGGGGGCG_b38	ATAD3C	-4.452	1.55e-05	-0.1145	9	0.025719	yes	BRNCHA
chr1_1308516_C_T_b38	ATAD3C	4.45	1.56e-05	0.110087	23	0.024738	yes	BRNCHA
chr1_1309988_G_A_b38	ATAD3C	4.422	1.75e-05	0.108187	23	0.024464	yes	BRNCHA
chr1_1341550_GCA_G_b38	ATAD3C	-4.408	1.86e-05	-0.124247	4	0.028187	yes	BRNCHA
chr1_1434687_C_G_b38	ATAD3C	-4.383	2.06e-05	-0.114735	8	0.026179	yes	BRNCHA
chr1_1431813_G_T_b38	ATAD3C	-4.351	2.35e-05	-0.111378	8	0.0256	yes	BRNCHA
chr1_1366561_AGT_A_b38	ATAD3C	4.337	2.48e-05	0.108372	20	0.024987	yes	BRNCHA
chr1_1358384_G_C_b38	ATAD3C	4.285	3.06e-05	0.107501	21	0.025085	yes	BRNCHA
chr1_1366951_A_AGT_b38	ATAD3C	4.278	3.15e-05	0.130115	4	0.030412	yes	BRNCHA
chr1_1379091_T_G_b38	ATAD3C	4.243	3.64e-05	0.111574	6	0.026297	yes	BRNCHA
chr1_1480224_A_G_b38	ATAD3C	-4.229	3.85e-05	-0.187982	3	0.044453	yes	BRNCHA
chr1_1402457_A_G_b38	ATAD3C	-4.212	4.12e-05	-0.104085	22	0.024712	yes	BRNCHA
chr1_1400410_A_G_b38	ATAD3C	-4.207	4.2e-05	-0.102202	17	0.024293	yes	BRNCHA
chr1_1448915_G_A_b38	ATAD3C	-4.204	4.26e-05	-0.097803	19	0.023265	yes	BRNCHA
chr1_1428999_C_CA_b38	ATAD3C	-4.184	4.6e-05	-0.104017	11	0.02486	yes	BRNCHA
chr1_1313807_G_A_b38	ATAD3C	4.174	4.8e-05	0.10289	23	0.024651	yes	BRNCHA
chr1_1387698_A_G_b38	ATAD3C	4.164	4.99e-05	0.103654	22	0.024894	yes	BRNCHA
chr1_1337898_A_G_b38	ATAD3C	4.155	5.17e-05	0.101395	10	0.024403	yes	BRNCHA
chr1_1389827_C_T_b38	ATAD3C	4.116	6.02e-05	0.102443	21	0.024888	yes	BRNCHA
chr1_1394423_A_G_b38	ATAD3C	-4.116	6.02e-05	-0.102443	21	0.024888	yes	BRNCHA
chr1_1395346_A_G_b38	ATAD3C	-4.116	6.02e-05	-0.102443	21	0.024888	yes	BRNCHA
chr1_1370430_T_C_b38	ATAD3C	-4.048	7.87e-05	-0.114058	4	0.028177	yes	BRNCHA
chr1_1370532_C_T_b38	ATAD3C	-4.048	7.87e-05	-0.114058	4	0.028177	yes	BRNCHA
chr1_1370584_G_C_b38	ATAD3C	-4.048	7.87e-05	-0.114058	4	0.028177	yes	BRNCHA
chr1_1372909_G_A_b38	ATAD3C	-4.048	7.87e-05	-0.114058	4	0.028177	yes	BRNCHA
chr1_1378204_G_C_b38	ATAD3C	4.02	8.78e-05	0.097696	19	0.024304	yes	BRNCHA
chr1_1376162_G_C_b38	ATAD3C	3.984	0.000101	0.098207	18	0.024647	yes	BRNCHA
chr1_1377431_C_T_b38	ATAD3C	3.984	0.000101	0.098207	18	0.024647	yes	BRNCHA
chr1_1411323_A_C_b38	ATAD3C	-3.98	0.000102	-0.099596	24	0.025026	yes	BRNCHA
chr1_1384749_C_G_b38	ATAD3C	3.968	0.000107	0.097639	18	0.024604	yes	BRNCHA
chr1_1387763_CCT_C_b38	ATAD3C	3.968	0.000107	0.097639	18	0.024604	yes	BRNCHA
chr1_1388944_G_A_b38	ATAD3C	3.968	0.000107	0.097639	18	0.024604	yes	BRNCHA
chr1_2416601_T_C_b38	ATAD3C	3.96	0.00011	0.086068	25	0.021733	yes	BRNCHA
chr1_1325753_G_T_b38	ATAD3C	-3.808	0.000196	-0.114566	3	0.030083	yes	BRNCHA
chr1_1361679_G_A_b38	ATAD3C	3.721	0.00027	0.095446	13	0.025651	yes	BRNCHA
chr1_1303800_G_A_b38	ATAD3C	-3.658	0.00034	-0.10785	4	0.029486	yes	BRNCHA
chr1_1304555_A_C_b38	ATAD3C	-3.658	0.00034	-0.10785	4	0.029486	yes	BRNCHA
chr1_1367028_A_G_b38	ATAD3C	3.617	0.000394	0.114542	3	0.031666	yes	BRNCHA
chr1_2421646_A_G_b38	ATAD3C	3.54	0.000517	0.077122	26	0.021783	yes	BRNCHA
chr1_1292284_TTGAG_T_b38	ATAD3C	-3.532	0.000532	-0.104804	10	0.029671	yes	BRNCHA
chr1_1379093_TG_T_b38	ATAD3C	-3.516	0.000563	-0.103679	4	0.029488	yes	BRNCHA
chr1_2422271_A_AAAAC_b38	ATAD3C	3.485	0.000628	0.077615	23	0.022271	yes	BRNCHA
chr1_1303112_G_A_b38	ATAD3C	-3.479	0.00064	-0.102372	4	0.029422	yes	BRNCHA
chr1_1259424_T_C_b38	ATAD3C	-3.477	0.000645	-0.093317	18	0.026836	yes	BRNCHA
chr1_2418330_G_A_b38	ATAD3C	-3.467	0.000668	-0.076848	24	0.022164	yes	BRNCHA
chr1_1258206_AT_A_b38	ATAD3C	-3.448	0.000714	-0.089906	17	0.026075	yes	BRNCHA
chr1_1290968_C_G_b38	ATAD3C	-3.405	0.000829	-0.098411	17	0.028905	yes	BRNCHA
chr1_1369803_C_CT_b38	ATAD3C	-3.394	0.000859	-0.091919	4	0.027083	yes	BRNCHA
chr1_1340697_G_A_b38	ATAD3C	3.359	0.000967	0.081697	13	0.02432	yes	BRNCHA
chr1_1361685_C_T_b38	ATAD3C	-3.354	0.000985	-0.090189	10	0.02689	yes	BRNCHA
chr1_2419473_G_A_b38	ATAD3C	3.344	0.00102	0.07412	24	0.022165	yes	BRNCHA
chr1_2420136_G_A_b38	ATAD3C	3.344	0.00102	0.07412	24	0.022165	yes	BRNCHA
chr1_2421856_C_T_b38	ATAD3C	3.344	0.00102	0.07412	24	0.022165	yes	BRNCHA
chr1_1398056_C_A_b38	ATAD3C	-3.239	0.00145	-0.073692	24	0.022752	yes	BRNCHA
chr1_1537160_T_G_b38	ATAD3C	-3.206	0.00161	-0.071484	38	0.022296	yes	BRNCHA
chr1_2416293_G_A_b38	ATAD3C	3.193	0.00168	0.071711	23	0.022456	yes	BRNCHA
chr1_2419657_A_G_b38	ATAD3C	3.193	0.00168	0.071711	23	0.022456	yes	BRNCHA
chr1_1541864_T_C_b38	ATAD3C	-3.168	0.00183	-0.075262	29	0.02376	yes	BRNCHA
chr1_1437993_G_A_b38	ATAD3C	-3.149	0.00194	-0.074541	15	0.023668	yes	BRNCHA
chr1_1452797_CAA_C_b38	ATAD3C	-3.077	0.00244	-0.081498	10	0.026482	yes	BRNCHA
chr1_1188054_T_A_b38	ATAD3C	-3.056	0.00261	-0.080365	8	0.026297	yes	BRNCHA
chr1_2420260_T_C_b38	ATAD3C	3.016	0.00296	0.066835	24	0.02216	yes	BRNCHA
chr1_2421981_G_GAAGAA_b38	ATAD3C	3.016	0.00296	0.066835	24	0.02216	yes	BRNCHA
chr1_2422430_G_T_b38	ATAD3C	3.016	0.00296	0.066835	24	0.02216	yes	BRNCHA
chr1_1302795_T_TC_b38	ATAD3C	2.98	0.00331	0.074866	32	0.02512	yes	BRNCHA
chr1_2426653_T_G_b38	ATAD3C	-2.976	0.00335	-0.072699	14	0.024428	yes	BRNCHA
chr1_1451787_A_C_b38	ATAD3C	-2.971	0.0034	-0.075563	18	0.025431	yes	BRNCHA
chr1_975555_G_A_b38	ATAD3C	2.953	0.0036	0.077819	8	0.026352	yes	BRNCHA
chr1_1542773_T_C_b38	ATAD3C	-2.939	0.00375	-0.068542	28	0.023318	yes	BRNCHA
chr1_1542793_C_G_b38	ATAD3C	-2.939	0.00375	-0.068542	28	0.023318	yes	BRNCHA
chr1_1542800_T_C_b38	ATAD3C	-2.939	0.00375	-0.068542	28	0.023318	yes	BRNCHA
chr1_1551557_A_AG_b38	ATAD3C	-2.888	0.00438	-0.068272	29	0.023637	yes	BRNCHA
chr1_1551559_A_T_b38	ATAD3C	-2.888	0.00438	-0.068272	29	0.023637	yes	BRNCHA
chr1_1543500_T_G_b38	ATAD3C	-2.887	0.0044	-0.067663	28	0.023437	yes	BRNCHA
chr1_2426634_C_T_b38	ATAD3C	-2.876	0.00455	-0.061104	51	0.021248	yes	BRNCHA
chr1_1543953_A_G_b38	ATAD3C	-2.871	0.00462	-0.067023	28	0.023348	yes	BRNCHA
chr1_1251356_AT_A_b38	ATAD3C	-2.868	0.00466	-0.085846	4	0.029931	yes	BRNCHA
chr1_1454315_C_T_b38	ATAD3C	-2.835	0.00514	-0.073504	19	0.025925	yes	BRNCHA
chr1_965125_G_C_b38	ATAD3C	2.787	0.00593	0.070268	11	0.02521	yes	BRNCHA
chr1_2142322_CAGCAGCCGAAGCGCCTCCTTTCAATCCAGGGTCCACACATCCAGCAGCCGAAGCGCCCTCCTTTCAATCCAGGGTCCAGGCATCT_C_b38	ATAD3C	-2.776	0.00612	-0.116445	4	0.041941	yes	BRNCHA
chr1_1534226_C_T_b38	ATAD3C	-2.776	0.00613	-0.068791	19	0.024781	yes	BRNCHA
chr1_1230159_G_A_b38	ATAD3C	-2.752	0.00658	-0.068779	13	0.024994	yes	BRNCHA
chr1_969663_CAT_C_b38	ATAD3C	2.723	0.00715	0.070085	11	0.025739	yes	BRNCHA
chr1_1231710_CCCCCGGGAA_C_b38	ATAD3C	-2.721	0.0072	-0.081124	4	0.029817	yes	BRNCHA
chr1_1497606_C_G_b38	ATAD3C	-2.705	0.00753	-0.075205	8	0.027801	yes	BRNCHA
chr1_1533883_G_T_b38	ATAD3C	-2.694	0.00778	-0.096067	5	0.03566	yes	BRNCHA
chr1_2211900_C_CTTTT_b38	ATAD3C	2.687	0.00794	0.102743	4	0.038241	yes	BRNCHA
chr1_1216593_G_C_b38	ATAD3C	-2.674	0.00823	-0.075248	5	0.02814	yes	BRNCHA
chr1_1215852_T_C_b38	ATAD3C	-2.672	0.00827	-0.074606	6	0.027917	yes	BRNCHA
chr1_1223644_C_T_b38	ATAD3C	-2.664	0.00847	-0.082607	3	0.031004	yes	BRNCHA
chr1_1221049_C_G_b38	ATAD3C	-2.663	0.0085	-0.065402	20	0.024562	yes	BRNCHA
chr1_1550064_GC_G_b38	ATAD3C	-2.661	0.00854	-0.062532	28	0.023497	yes	BRNCHA
chr1_1550068_C_A_b38	ATAD3C	-2.661	0.00854	-0.062532	28	0.023497	yes	BRNCHA
chr1_1558726_C_CA_b38	ATAD3C	-2.65	0.00882	-0.061616	30	0.023254	yes	BRNCHA
chr1_1561821_A_C_b38	ATAD3C	-2.65	0.00882	-0.061616	30	0.023254	yes	BRNCHA
chr1_1482316_C_G_b38	ATAD3C	-2.645	0.00895	-0.062735	17	0.02372	yes	BRNCHA
chr1_976536_C_T_b38	ATAD3C	2.643	0.00899	0.079323	4	0.030012	yes	BRNCHA
chr1_978230_G_A_b38	ATAD3C	2.643	0.00899	0.079323	4	0.030012	yes	BRNCHA
chr1_1522693_A_G_b38	ATAD3C	2.64	0.00908	0.070183	7	0.026588	yes	BRNCHA
chr1_1538787_A_G_b38	ATAD3C	-2.636	0.00918	-0.06133	32	0.023269	yes	BRNCHA
chr1_945259_TC_T_b38	ATAD3C	2.634	0.00923	0.065543	10	0.024885	yes	BRNCHA
chr1_1657902_T_TA_b38	ATAD3C	2.633	0.00925	0.107015	3	0.040639	yes	BRNCHA
chr1_1557495_CAT_C_b38	ATAD3C	-2.632	0.00927	-0.060907	30	0.023137	yes	BRNCHA
chr1_861387_G_A_b38	ATAD3C	-2.619	0.00963	-0.075799	19	0.028945	yes	BRNCHA
chr1_1432355_G_A_b38	ATAD3C	-4.909	2.15e-06	-0.120634	11	0.024572	no	BRNCHA
chr1_1439805_G_C_b38	ATAD3C	-4.675	6e-06	-0.112729	13	0.024112	no	BRNCHA
chr1_1366511_GGTGA_G_b38	ATAD3C	-4.534	1.1e-05	-0.126421	3	0.027886	no	BRNCHA
chr1_1366681_T_TGA_b38	ATAD3C	-4.46	1.49e-05	-0.125956	3	0.028241	no	BRNCHA
chr1_1344048_G_A_b38	ATAD3C	-4.446	1.58e-05	-0.125725	3	0.028278	no	BRNCHA
chr1_1364253_C_G_b38	ATAD3C	-4.446	1.58e-05	-0.125725	3	0.028278	no	BRNCHA
chr1_1363688_C_T_b38	ATAD3C	-4.437	1.65e-05	-0.124256	3	0.028005	no	BRNCHA
chr1_1364099_CCA_C_b38	ATAD3C	-4.437	1.65e-05	-0.124256	3	0.028005	no	BRNCHA
chr1_1364102_TGTTG_T_b38	ATAD3C	-4.437	1.65e-05	-0.124256	3	0.028005	no	BRNCHA
chr1_1368763_G_A_b38	ATAD3C	-4.437	1.65e-05	-0.124256	3	0.028005	no	BRNCHA
chr1_1367268_TGA_T_b38	ATAD3C	-4.426	1.72e-05	-0.124421	3	0.02811	no	BRNCHA
chr1_1329973_GCGTGTGCCATGCA_G_b38	ATAD3C	-4.335	2.51e-05	-0.12397	3	0.028598	no	BRNCHA
chr1_1368177_G_C_b38	ATAD3C	-4.294	2.96e-05	-0.120689	4	0.028105	no	BRNCHA
chr1_1363880_A_G_b38	ATAD3C	-4.285	3.07e-05	-0.120473	3	0.028117	no	BRNCHA
chr1_1366292_G_T_b38	ATAD3C	-4.254	3.48e-05	-0.120498	3	0.028327	no	BRNCHA
chr1_1364566_T_C_b38	ATAD3C	-4.245	3.61e-05	-0.119853	3	0.028233	no	BRNCHA
chr1_1364282_T_G_b38	ATAD3C	-4.235	3.76e-05	-0.119525	3	0.028225	no	BRNCHA
chr1_1364357_A_C_b38	ATAD3C	-4.235	3.76e-05	-0.119525	3	0.028225	no	BRNCHA
chr1_1364694_T_C_b38	ATAD3C	-4.235	3.76e-05	-0.119525	3	0.028225	no	BRNCHA
chr1_1364721_C_T_b38	ATAD3C	-4.235	3.76e-05	-0.119525	3	0.028225	no	BRNCHA
chr1_1365160_A_G_b38	ATAD3C	-4.235	3.76e-05	-0.119525	3	0.028225	no	BRNCHA
chr1_1365198_C_T_b38	ATAD3C	-4.235	3.76e-05	-0.119525	3	0.028225	no	BRNCHA
chr1_1366008_A_G_b38	ATAD3C	-4.235	3.76e-05	-0.119525	3	0.028225	no	BRNCHA
chr1_1366062_T_C_b38	ATAD3C	-4.235	3.76e-05	-0.119525	3	0.028225	no	BRNCHA
chr1_1366145_TGTGAA_T_b38	ATAD3C	-4.235	3.76e-05	-0.119525	3	0.028225	no	BRNCHA
chr1_1366187_A_AGT_b38	ATAD3C	-4.235	3.76e-05	-0.119525	3	0.028225	no	BRNCHA
chr1_1366321_TGTGTGTAAATGG_T_b38	ATAD3C	-4.235	3.76e-05	-0.119525	3	0.028225	no	BRNCHA
chr1_1366453_G_T_b38	ATAD3C	-4.235	3.76e-05	-0.119525	3	0.028225	no	BRNCHA
chr1_1366726_T_G_b38	ATAD3C	-4.235	3.76e-05	-0.119525	3	0.028225	no	BRNCHA
chr1_1367258_T_A_b38	ATAD3C	-4.235	3.76e-05	-0.119525	3	0.028225	no	BRNCHA
chr1_1367297_GAA_G_b38	ATAD3C	-4.235	3.76e-05	-0.119525	3	0.028225	no	BRNCHA
chr1_1367300_T_TGA_b38	ATAD3C	-4.235	3.76e-05	-0.119525	3	0.028225	no	BRNCHA
chr1_1367329_A_AGT_b38	ATAD3C	-4.235	3.76e-05	-0.119525	3	0.028225	no	BRNCHA
chr1_1367373_T_TGTG_b38	ATAD3C	-4.235	3.76e-05	-0.119525	3	0.028225	no	BRNCHA
chr1_1367388_T_TTGG_b38	ATAD3C	-4.235	3.76e-05	-0.119525	3	0.028225	no	BRNCHA
chr1_1367462_T_C_b38	ATAD3C	-4.235	3.76e-05	-0.119525	3	0.028225	no	BRNCHA
chr1_1367593_G_A_b38	ATAD3C	-4.235	3.76e-05	-0.119525	3	0.028225	no	BRNCHA
chr1_1367602_GT_G_b38	ATAD3C	-4.235	3.76e-05	-0.119525	3	0.028225	no	BRNCHA
chr1_1367605_GAGTGAGTGTA_G_b38	ATAD3C	-4.235	3.76e-05	-0.119525	3	0.028225	no	BRNCHA
chr1_1367670_GGTGA_G_b38	ATAD3C	-4.235	3.76e-05	-0.119525	3	0.028225	no	BRNCHA
chr1_1367722_TTTTA_T_b38	ATAD3C	-4.235	3.76e-05	-0.119525	3	0.028225	no	BRNCHA
chr1_1367874_A_T_b38	ATAD3C	-4.235	3.76e-05	-0.119525	3	0.028225	no	BRNCHA
chr1_1367919_C_T_b38	ATAD3C	-4.235	3.76e-05	-0.119525	3	0.028225	no	BRNCHA
chr1_1367951_C_T_b38	ATAD3C	-4.235	3.76e-05	-0.119525	3	0.028225	no	BRNCHA
chr1_1367965_A_G_b38	ATAD3C	-4.235	3.76e-05	-0.119525	3	0.028225	no	BRNCHA
chr1_1367970_T_G_b38	ATAD3C	-4.235	3.76e-05	-0.119525	3	0.028225	no	BRNCHA
chr1_1367994_C_A_b38	ATAD3C	-4.235	3.76e-05	-0.119525	3	0.028225	no	BRNCHA
chr1_1368297_C_T_b38	ATAD3C	-4.235	3.76e-05	-0.119525	3	0.028225	no	BRNCHA
chr1_1368514_C_G_b38	ATAD3C	-4.235	3.76e-05	-0.119525	3	0.028225	no	BRNCHA
chr1_1368991_C_T_b38	ATAD3C	-4.235	3.76e-05	-0.119525	3	0.028225	no	BRNCHA
chr1_1369009_T_C_b38	ATAD3C	-4.235	3.76e-05	-0.119525	3	0.028225	no	BRNCHA
chr1_1369012_C_CG_b38	ATAD3C	-4.235	3.76e-05	-0.119525	3	0.028225	no	BRNCHA
chr1_1367280_T_A_b38	ATAD3C	-4.191	4.48e-05	-0.118462	3	0.028267	no	BRNCHA
chr1_1380867_A_G_b38	ATAD3C	-4.104	6.31e-05	-0.113796	5	0.027726	no	BRNCHA
chr1_1400756_GGA_G_b38	ATAD3C	-4.103	6.33e-05	-0.113204	5	0.027587	no	BRNCHA
chr1_1401954_G_T_b38	ATAD3C	-4.103	6.33e-05	-0.113204	5	0.027587	no	BRNCHA
chr1_1403593_A_G_b38	ATAD3C	-4.103	6.33e-05	-0.113204	5	0.027587	no	BRNCHA
chr1_1407565_C_A_b38	ATAD3C	-4.103	6.33e-05	-0.113204	5	0.027587	no	BRNCHA
chr1_1375642_C_T_b38	ATAD3C	-4.094	6.57e-05	-0.112342	5	0.027438	no	BRNCHA
chr1_1369282_G_A_b38	ATAD3C	-4.084	6.85e-05	-0.115444	3	0.028271	no	BRNCHA
chr1_1369320_GT_G_b38	ATAD3C	-4.084	6.85e-05	-0.115444	3	0.028271	no	BRNCHA
chr1_1369407_G_A_b38	ATAD3C	-4.084	6.85e-05	-0.115444	3	0.028271	no	BRNCHA
chr1_1369476_CTT_C_b38	ATAD3C	-4.084	6.85e-05	-0.115444	3	0.028271	no	BRNCHA
chr1_1369556_C_G_b38	ATAD3C	-4.084	6.85e-05	-0.115444	3	0.028271	no	BRNCHA
chr1_1369627_T_C_b38	ATAD3C	-4.084	6.85e-05	-0.115444	3	0.028271	no	BRNCHA
chr1_1369686_T_C_b38	ATAD3C	-4.084	6.85e-05	-0.115444	3	0.028271	no	BRNCHA
chr1_1369716_G_C_b38	ATAD3C	-4.084	6.85e-05	-0.115444	3	0.028271	no	BRNCHA
chr1_1369741_C_T_b38	ATAD3C	-4.084	6.85e-05	-0.115444	3	0.028271	no	BRNCHA
chr1_1370181_C_T_b38	ATAD3C	-4.084	6.85e-05	-0.115444	3	0.028271	no	BRNCHA
chr1_1370317_G_C_b38	ATAD3C	-4.084	6.85e-05	-0.115444	3	0.028271	no	BRNCHA
chr1_1370320_A_G_b38	ATAD3C	-4.084	6.85e-05	-0.115444	3	0.028271	no	BRNCHA
chr1_1383743_T_C_b38	ATAD3C	-4.068	7.28e-05	-0.112415	5	0.027634	no	BRNCHA
chr1_1316929_A_T_b38	ATAD3C	-4.066	7.34e-05	-0.109263	6	0.026874	no	BRNCHA
chr1_1384546_C_T_b38	ATAD3C	-4.062	7.45e-05	-0.11327	5	0.027885	no	BRNCHA
chr1_1398218_C_A_b38	ATAD3C	-4.062	7.45e-05	-0.11327	5	0.027885	no	BRNCHA
chr1_1366776_G_GAATT_b38	ATAD3C	-4.043	8.01e-05	-0.115126	3	0.028473	no	BRNCHA
chr1_1382893_G_A_b38	ATAD3C	-3.975	0.000104	-0.110799	5	0.027871	no	BRNCHA
chr1_1369821_C_T_b38	ATAD3C	-3.861	0.000161	-0.109276	3	0.028303	no	BRNCHA
chr1_1374505_A_G_b38	ATAD3C	-3.759	0.000235	-0.104038	5	0.027679	no	BRNCHA
chr1_1217733_G_A_b38	ATAD3C	-3.671	0.000324	-0.107477	4	0.029279	no	BRNCHA
chr1_1394041_G_A_b38	ATAD3C	-3.596	0.000424	-0.104416	4	0.029033	no	BRNCHA
chr1_1226486_C_T_b38	ATAD3C	-3.53	0.000537	-0.1039	3	0.029436	no	BRNCHA
chr1_2422265_C_T_b38	ATAD3C	-3.496	0.000604	-0.076565	25	0.0219	no	BRNCHA
chr1_2422217_C_T_b38	ATAD3C	-3.478	0.000643	-0.076044	25	0.021865	no	BRNCHA
chr1_2422225_C_T_b38	ATAD3C	-3.478	0.000643	-0.076044	25	0.021865	no	BRNCHA
chr1_2418469_C_T_b38	ATAD3C	-3.45	0.00071	-0.076161	24	0.022078	no	BRNCHA
chr1_2419005_C_T_b38	ATAD3C	-3.433	0.000752	-0.075691	24	0.022049	no	BRNCHA
chr1_1449831_A_G_b38	ATAD3C	-3.401	0.00084	-0.089811	22	0.026409	no	BRNCHA
chr1_1378484_AT_A_b38	ATAD3C	3.389	0.000874	0.084928	32	0.025059	no	BRNCHA
chr1_2420954_C_CTT_b38	ATAD3C	3.336	0.00105	0.083678	15	0.025086	no	BRNCHA
chr1_2417413_G_GCCCAGCTT_b38	ATAD3C	-3.334	0.00105	-0.073895	24	0.022165	no	BRNCHA
chr1_1235602_C_A_b38	ATAD3C	-3.26	0.00135	-0.098755	3	0.030291	no	BRNCHA
chr1_2433069_A_G_b38	ATAD3C	-3.229	0.00149	-0.070659	26	0.02188	no	BRNCHA
chr1_2420841_G_A_b38	ATAD3C	-3.216	0.00156	-0.070074	27	0.021792	no	BRNCHA
chr1_1449009_A_T_b38	ATAD3C	-3.18	0.00175	-0.08675	14	0.02728	no	BRNCHA
chr1_1217251_C_A_b38	ATAD3C	-3.158	0.00188	-0.096006	4	0.030403	no	BRNCHA
chr1_2423169_TTTTG_T_b38	ATAD3C	-3.089	0.00235	-0.066632	27	0.021574	no	BRNCHA
chr1_2422931_T_C_b38	ATAD3C	2.991	0.0032	0.068316	22	0.022839	no	BRNCHA
chr1_968046_C_T_b38	ATAD3C	2.989	0.00322	0.075593	13	0.025289	no	BRNCHA
chr1_1514366_A_G_b38	ATAD3C	-2.944	0.0037	-0.148001	3	0.050273	no	BRNCHA
chr1_1306523_C_G_b38	ATAD3C	2.924	0.00393	0.106954	7	0.036577	no	BRNCHA
chr1_2211226_CTT_C_b38	ATAD3C	2.857	0.00482	0.133931	3	0.046885	no	BRNCHA
chr1_1515567_A_C_b38	ATAD3C	-2.834	0.00516	-0.133875	7	0.04724	no	BRNCHA
chr1_1454848_T_C_b38	ATAD3C	-2.815	0.00546	-0.072294	13	0.025683	no	BRNCHA
chr1_965666_ACC_A_b38	ATAD3C	2.811	0.00552	0.070485	10	0.02507	no	BRNCHA
chr1_1456154_G_A_b38	ATAD3C	-2.787	0.00593	-0.07255	13	0.026033	no	BRNCHA
chr1_1548572_A_AC_b38	ATAD3C	-2.783	0.00601	-0.133459	3	0.04796	no	BRNCHA
chr1_1450636_A_G_b38	ATAD3C	-2.749	0.00664	-0.081129	5	0.029515	no	BRNCHA
chr1_1456079_T_C_b38	ATAD3C	-2.706	0.00751	-0.070568	13	0.026076	no	BRNCHA
chr1_1452825_AAAG_A_b38	ATAD3C	-2.694	0.00777	-0.070051	13	0.025999	no	BRNCHA
chr1_1453552_G_A_b38	ATAD3C	-2.694	0.00777	-0.070051	13	0.025999	no	BRNCHA
chr1_1455134_T_G_b38	ATAD3C	-2.694	0.00777	-0.070051	13	0.025999	no	BRNCHA
chr1_1455337_A_G_b38	ATAD3C	-2.694	0.00777	-0.070051	13	0.025999	no	BRNCHA
chr1_1455495_C_T_b38	ATAD3C	-2.694	0.00777	-0.070051	13	0.025999	no	BRNCHA
chr1_1455924_T_C_b38	ATAD3C	-2.694	0.00777	-0.070051	13	0.025999	no	BRNCHA
chr1_1456051_C_T_b38	ATAD3C	-2.694	0.00777	-0.070051	13	0.025999	no	BRNCHA
chr1_2119789_C_CT_b38	ATAD3C	2.662	0.00853	0.065298	12	0.024533	no	BRNCHA
chr1_1934619_TTGTAGGTACACACGTGTGTACGTGGGTGTTAGGC_T_b38	ATAD3C	2.652	0.00876	0.089179	4	0.033623	no	BRNCHA
chr1_1533841_T_C_b38	ATAD3C	-2.651	0.0088	-0.06933	17	0.026157	no	BRNCHA
chr1_1452346_A_G_b38	ATAD3C	-2.65	0.00881	-0.071683	8	0.027048	no	BRNCHA
chr1_1265603_T_TTGTG_b38	ATAD3C	2.648	0.00887	0.073715	5	0.027839	no	BRNCHA
chr1_1407232_G_C_b38	ATAD3C	-2.646	0.00891	-0.064805	11	0.024487	no	BRNCHA
chr1_1451028_T_A_b38	ATAD3C	-2.621	0.00958	-0.075525	6	0.028818	no	BRNCHA
chr1_1454848_T_C_b38	ATAD3C	-11.004	1.93e-21	-0.308548	15	0.028039	yes	BRNCTXA
chr1_1452825_AAAG_A_b38	ATAD3C	-10.987	2.15e-21	-0.309996	15	0.028215	yes	BRNCTXA
chr1_1453552_G_A_b38	ATAD3C	-10.987	2.15e-21	-0.309996	15	0.028215	yes	BRNCTXA
chr1_1455134_T_G_b38	ATAD3C	-10.987	2.15e-21	-0.309996	15	0.028215	yes	BRNCTXA
chr1_1455337_A_G_b38	ATAD3C	-10.987	2.15e-21	-0.309996	15	0.028215	yes	BRNCTXA
chr1_1455495_C_T_b38	ATAD3C	-10.987	2.15e-21	-0.309996	15	0.028215	yes	BRNCTXA
chr1_1455924_T_C_b38	ATAD3C	-10.987	2.15e-21	-0.309996	15	0.028215	yes	BRNCTXA
chr1_1456051_C_T_b38	ATAD3C	-10.987	2.15e-21	-0.309996	15	0.028215	yes	BRNCTXA
chr1_1456154_G_A_b38	ATAD3C	-10.987	2.15e-21	-0.309996	15	0.028215	yes	BRNCTXA
chr1_1456182_G_A_b38	ATAD3C	-10.677	1.54e-20	-0.295304	17	0.027657	yes	BRNCTXA
chr1_1456079_T_C_b38	ATAD3C	-10.668	1.64e-20	-0.305047	15	0.028596	yes	BRNCTXA
chr1_1451968_C_T_b38	ATAD3C	-10.424	7.7e-20	-0.305476	12	0.029306	yes	BRNCTXA
chr1_1452540_G_A_b38	ATAD3C	-10.414	8.21e-20	-0.298499	13	0.028664	yes	BRNCTXA
chr1_1457033_A_C_b38	ATAD3C	-9.906	2.01e-18	-0.282249	16	0.028494	yes	BRNCTXA
chr1_1452346_A_G_b38	ATAD3C	-9.765	4.84e-18	-0.310859	7	0.031834	yes	BRNCTXA
chr1_1457071_C_T_b38	ATAD3C	-9.706	6.97e-18	-0.270009	19	0.027817	yes	BRNCTXA
chr1_1440834_C_G_b38	ATAD3C	-9.673	8.57e-18	-0.26057	30	0.026937	yes	BRNCTXA
chr1_1443457_T_C_b38	ATAD3C	-9.652	9.79e-18	-0.26009	30	0.026947	yes	BRNCTXA
chr1_1453961_C_T_b38	ATAD3C	-9.63	1.12e-17	-0.324262	5	0.033671	yes	BRNCTXA
chr1_1452384_G_A_b38	ATAD3C	-9.602	1.33e-17	-0.310804	7	0.032368	yes	BRNCTXA
chr1_1453870_A_C_b38	ATAD3C	-9.602	1.33e-17	-0.323442	5	0.033684	yes	BRNCTXA
chr1_1452797_CAA_C_b38	ATAD3C	-9.527	2.12e-17	-0.291648	12	0.030613	yes	BRNCTXA
chr1_1455617_T_G_b38	ATAD3C	-9.509	2.38e-17	-0.280264	25	0.029475	yes	BRNCTXA
chr1_1454770_T_C_b38	ATAD3C	-9.496	2.58e-17	-0.277419	25	0.029214	yes	BRNCTXA
chr1_1452511_A_G_b38	ATAD3C	-9.44	3.65e-17	-0.278602	24	0.029514	yes	BRNCTXA
chr1_1452888_C_A_b38	ATAD3C	-9.44	3.65e-17	-0.278602	24	0.029514	yes	BRNCTXA
chr1_1452909_A_C_b38	ATAD3C	-9.44	3.65e-17	-0.278602	24	0.029514	yes	BRNCTXA
chr1_1454092_A_G_b38	ATAD3C	-9.44	3.65e-17	-0.278602	24	0.029514	yes	BRNCTXA
chr1_1453703_A_G_b38	ATAD3C	-9.354	6.18e-17	-0.278674	24	0.029791	yes	BRNCTXA
chr1_1450636_A_G_b38	ATAD3C	-9.25	1.17e-16	-0.299796	6	0.032409	yes	BRNCTXA
chr1_1440430_C_G_b38	ATAD3C	-9.206	1.54e-16	-0.249714	23	0.027126	yes	BRNCTXA
chr1_1439454_A_G_b38	ATAD3C	-9.122	2.58e-16	-0.248349	30	0.027225	yes	BRNCTXA
chr1_1454315_C_T_b38	ATAD3C	-9.11	2.77e-16	-0.269083	22	0.029536	yes	BRNCTXA
chr1_1449831_A_G_b38	ATAD3C	-9.102	2.91e-16	-0.275767	24	0.030297	yes	BRNCTXA
chr1_1441187_A_G_b38	ATAD3C	-9.007	5.21e-16	-0.260206	20	0.02889	yes	BRNCTXA
chr1_1451028_T_A_b38	ATAD3C	-8.912	9.28e-16	-0.286526	7	0.032151	yes	BRNCTXA
chr1_1456829_G_C_b38	ATAD3C	-8.827	1.55e-15	-0.284293	17	0.032207	yes	BRNCTXA
chr1_1451787_A_C_b38	ATAD3C	-8.772	2.16e-15	-0.259577	19	0.02959	yes	BRNCTXA
chr1_1445187_T_G_b38	ATAD3C	-8.604	5.97e-15	-0.236207	28	0.027454	yes	BRNCTXA
chr1_1445240_A_G_b38	ATAD3C	-8.604	5.97e-15	-0.236207	28	0.027454	yes	BRNCTXA
chr1_1433374_T_C_b38	ATAD3C	-8.598	6.18e-15	-0.232952	33	0.027094	yes	BRNCTXA
chr1_1436388_CA_C_b38	ATAD3C	-8.454	1.46e-14	-0.245766	18	0.029071	yes	BRNCTXA
chr1_1449009_A_T_b38	ATAD3C	-8.43	1.69e-14	-0.271995	14	0.032264	yes	BRNCTXA
chr1_1438102_G_C_b38	ATAD3C	-8.164	8.19e-14	-0.244281	12	0.029923	yes	BRNCTXA
chr1_1436079_A_G_b38	ATAD3C	-8.141	9.36e-14	-0.222796	31	0.027368	yes	BRNCTXA
chr1_1431450_A_G_b38	ATAD3C	-8.068	1.44e-13	-0.235122	28	0.029144	yes	BRNCTXA
chr1_1431537_G_C_b38	ATAD3C	-8.068	1.44e-13	-0.235122	28	0.029144	yes	BRNCTXA
chr1_1428969_T_C_b38	ATAD3C	-7.958	2.74e-13	-0.232689	28	0.029241	yes	BRNCTXA
chr1_1430190_A_C_b38	ATAD3C	-7.928	3.24e-13	-0.231669	28	0.02922	yes	BRNCTXA
chr1_1430908_A_G_b38	ATAD3C	-7.86	4.82e-13	-0.232463	28	0.029575	yes	BRNCTXA
chr1_1442793_G_A_b38	ATAD3C	-7.827	5.83e-13	-0.255212	7	0.032605	yes	BRNCTXA
chr1_1448915_G_A_b38	ATAD3C	-7.806	6.59e-13	-0.231261	18	0.029626	yes	BRNCTXA
chr1_1434687_C_G_b38	ATAD3C	-7.655	1.57e-12	-0.253758	7	0.033149	yes	BRNCTXA
chr1_1456891_T_C_b38	ATAD3C	-7.617	1.96e-12	-0.232282	18	0.030496	yes	BRNCTXA
chr1_1432355_G_A_b38	ATAD3C	-7.527	3.28e-12	-0.23679	11	0.031461	yes	BRNCTXA
chr1_1437955_C_G_b38	ATAD3C	-7.518	3.43e-12	-0.196158	26	0.026091	yes	BRNCTXA
chr1_1456217_T_C_b38	ATAD3C	-7.445	5.21e-12	-0.247092	24	0.033189	yes	BRNCTXA
chr1_1426261_C_T_b38	ATAD3C	-7.443	5.27e-12	-0.221347	27	0.02974	yes	BRNCTXA
chr1_1426810_C_G_b38	ATAD3C	-7.443	5.27e-12	-0.221347	27	0.02974	yes	BRNCTXA
chr1_1431014_G_A_b38	ATAD3C	-7.268	1.41e-11	-0.21492	18	0.02957	yes	BRNCTXA
chr1_1437993_G_A_b38	ATAD3C	-7.061	4.45e-11	-0.219774	11	0.031125	yes	BRNCTXA
chr1_1431026_CCACCCCCT_C_b38	ATAD3C	-6.988	6.66e-11	-0.222806	13	0.031884	yes	BRNCTXA
chr1_1431656_G_A_b38	ATAD3C	-6.962	7.66e-11	-0.241565	6	0.034695	yes	BRNCTXA
chr1_1411323_A_C_b38	ATAD3C	-6.927	9.29e-11	-0.215121	25	0.031055	yes	BRNCTXA
chr1_1435945_C_CCGGGCGGGGGCG_b38	ATAD3C	-6.807	1.78e-10	-0.229142	8	0.033662	yes	BRNCTXA
chr1_1394423_A_G_b38	ATAD3C	-6.757	2.34e-10	-0.209949	24	0.03107	yes	BRNCTXA
chr1_1395346_A_G_b38	ATAD3C	-6.757	2.34e-10	-0.209949	24	0.03107	yes	BRNCTXA
chr1_1387698_A_G_b38	ATAD3C	6.757	2.34e-10	0.209949	24	0.03107	yes	BRNCTXA
chr1_1389827_C_T_b38	ATAD3C	6.757	2.34e-10	0.209949	24	0.03107	yes	BRNCTXA
chr1_1374505_A_G_b38	ATAD3C	-6.683	3.48e-10	-0.246001	4	0.036808	yes	BRNCTXA
chr1_1453643_A_ATT_b38	ATAD3C	-6.683	3.49e-10	-0.222955	15	0.033362	yes	BRNCTXA
chr1_1439805_G_C_b38	ATAD3C	-6.661	3.92e-10	-0.21876	12	0.032841	yes	BRNCTXA
chr1_1431813_G_T_b38	ATAD3C	-6.621	4.85e-10	-0.225207	7	0.034013	yes	BRNCTXA
chr1_1426253_G_A_b38	ATAD3C	-6.615	5.02e-10	-0.234772	5	0.035492	yes	BRNCTXA
chr1_1402457_A_G_b38	ATAD3C	-6.606	5.27e-10	-0.206005	24	0.031187	yes	BRNCTXA
chr1_1394041_G_A_b38	ATAD3C	-6.563	6.63e-10	-0.250656	3	0.038195	yes	BRNCTXA
chr1_1375642_C_T_b38	ATAD3C	-6.54	7.47e-10	-0.241848	4	0.03698	yes	BRNCTXA
chr1_1370430_T_C_b38	ATAD3C	-6.501	9.17e-10	-0.245979	3	0.037836	yes	BRNCTXA
chr1_1370532_C_T_b38	ATAD3C	-6.501	9.17e-10	-0.245979	3	0.037836	yes	BRNCTXA
chr1_1370584_G_C_b38	ATAD3C	-6.501	9.17e-10	-0.245979	3	0.037836	yes	BRNCTXA
chr1_1380867_A_G_b38	ATAD3C	-6.424	1.38e-09	-0.237879	4	0.037029	yes	BRNCTXA
chr1_1384749_C_G_b38	ATAD3C	6.419	1.42e-09	0.201454	21	0.031384	yes	BRNCTXA
chr1_1387763_CCT_C_b38	ATAD3C	6.419	1.42e-09	0.201454	21	0.031384	yes	BRNCTXA
chr1_1388944_G_A_b38	ATAD3C	6.419	1.42e-09	0.201454	21	0.031384	yes	BRNCTXA
chr1_1383743_T_C_b38	ATAD3C	-6.37	1.83e-09	-0.236231	4	0.037084	yes	BRNCTXA
chr1_1384546_C_T_b38	ATAD3C	-6.37	1.83e-09	-0.236231	4	0.037084	yes	BRNCTXA
chr1_1398218_C_A_b38	ATAD3C	-6.37	1.83e-09	-0.236231	4	0.037084	yes	BRNCTXA
chr1_1382893_G_A_b38	ATAD3C	-6.355	1.98e-09	-0.237325	4	0.037347	yes	BRNCTXA
chr1_1363898_C_T_b38	ATAD3C	6.312	2.47e-09	0.2178	6	0.034506	yes	BRNCTXA
chr1_1363986_C_T_b38	ATAD3C	6.312	2.47e-09	0.2178	6	0.034506	yes	BRNCTXA
chr1_1365566_G_A_b38	ATAD3C	6.312	2.47e-09	0.2178	6	0.034506	yes	BRNCTXA
chr1_1366529_TTAG_T_b38	ATAD3C	6.312	2.47e-09	0.2178	6	0.034506	yes	BRNCTXA
chr1_1367292_A_AGT_b38	ATAD3C	6.312	2.47e-09	0.2178	6	0.034506	yes	BRNCTXA
chr1_1471992_T_C_b38	ATAD3C	-6.289	2.79e-09	-0.198787	31	0.031611	yes	BRNCTXA
chr1_1376162_G_C_b38	ATAD3C	6.277	2.96e-09	0.19784	21	0.031517	yes	BRNCTXA
chr1_1377431_C_T_b38	ATAD3C	6.277	2.96e-09	0.19784	21	0.031517	yes	BRNCTXA
chr1_1366561_AGT_A_b38	ATAD3C	6.255	3.32e-09	0.196521	24	0.031416	yes	BRNCTXA
chr1_1309988_G_A_b38	ATAD3C	6.252	3.38e-09	0.195197	26	0.031223	yes	BRNCTXA
chr1_1313807_G_A_b38	ATAD3C	6.252	3.38e-09	0.195197	26	0.031223	yes	BRNCTXA
chr1_1400410_A_G_b38	ATAD3C	-6.228	3.83e-09	-0.195418	20	0.031379	yes	BRNCTXA
chr1_1330125_G_A_b38	ATAD3C	6.203	4.35e-09	0.196895	25	0.031742	yes	BRNCTXA
chr1_1400756_GGA_G_b38	ATAD3C	-6.188	4.7e-09	-0.230145	4	0.037193	yes	BRNCTXA
chr1_1401954_G_T_b38	ATAD3C	-6.188	4.7e-09	-0.230145	4	0.037193	yes	BRNCTXA
chr1_1403593_A_G_b38	ATAD3C	-6.188	4.7e-09	-0.230145	4	0.037193	yes	BRNCTXA
chr1_1407565_C_A_b38	ATAD3C	-6.188	4.7e-09	-0.230145	4	0.037193	yes	BRNCTXA
chr1_1358384_G_C_b38	ATAD3C	6.157	5.5e-09	0.193864	24	0.031486	yes	BRNCTXA
chr1_1378204_G_C_b38	ATAD3C	6.143	5.92e-09	0.191937	22	0.031246	yes	BRNCTXA
chr1_1370113_A_G_b38	ATAD3C	6.141	5.97e-09	0.184688	20	0.030073	yes	BRNCTXA
chr1_1312114_T_C_b38	ATAD3C	6.092	7.67e-09	0.191408	26	0.031419	yes	BRNCTXA
chr1_1361679_G_A_b38	ATAD3C	6.088	7.85e-09	0.20214	13	0.033205	yes	BRNCTXA
chr1_1447108_A_ATT_b38	ATAD3C	-6.084	7.99e-09	-0.197949	15	0.032535	yes	BRNCTXA
chr1_1366427_AGTGTGATTGAATGAGT_A_b38	ATAD3C	6.069	8.63e-09	0.191991	19	0.031635	yes	BRNCTXA
chr1_1368177_G_C_b38	ATAD3C	-6.045	9.73e-09	-0.227333	4	0.037604	yes	BRNCTXA
chr1_1379093_TG_T_b38	ATAD3C	-5.987	1.31e-08	-0.236917	3	0.039571	yes	BRNCTXA
chr1_1479719_T_C_b38	ATAD3C	-5.97	1.42e-08	-0.18581	32	0.031124	yes	BRNCTXA
chr1_1308516_C_T_b38	ATAD3C	5.899	2.04e-08	0.186932	26	0.031691	yes	BRNCTXA
chr1_1361685_C_T_b38	ATAD3C	-5.887	2.16e-08	-0.211678	8	0.035955	yes	BRNCTXA
chr1_1363456_CAG_C_b38	ATAD3C	5.823	2.97e-08	0.179615	14	0.030845	yes	BRNCTXA
chr1_1369803_C_CT_b38	ATAD3C	-5.807	3.2e-08	-0.210897	4	0.036315	yes	BRNCTXA
chr1_1379091_T_G_b38	ATAD3C	5.805	3.24e-08	0.200914	7	0.03461	yes	BRNCTXA
chr1_1517993_A_G_b38	ATAD3C	-5.783	3.61e-08	-0.173416	38	0.029985	yes	BRNCTXA
chr1_1519934_T_G_b38	ATAD3C	-5.783	3.61e-08	-0.173416	38	0.029985	yes	BRNCTXA
chr1_1519938_T_C_b38	ATAD3C	-5.783	3.61e-08	-0.173416	38	0.029985	yes	BRNCTXA
chr1_1379083_AT_A_b38	ATAD3C	5.772	3.83e-08	0.1843	14	0.031932	yes	BRNCTXA
chr1_1428999_C_CA_b38	ATAD3C	-5.627	7.78e-08	-0.189441	12	0.033668	yes	BRNCTXA
chr1_1532798_T_C_b38	ATAD3C	-5.508	1.38e-07	-0.166388	49	0.030206	yes	BRNCTXA
chr1_1337898_A_G_b38	ATAD3C	5.436	1.94e-07	0.171449	13	0.031538	yes	BRNCTXA
chr1_1497605_G_C_b38	ATAD3C	-5.192	6.09e-07	-0.169595	25	0.032663	yes	BRNCTXA
chr1_1366941_T_TGTGTGCA_b38	ATAD3C	5.108	8.94e-07	0.209388	4	0.040989	yes	BRNCTXA
chr1_1407232_G_C_b38	ATAD3C	-5.004	1.44e-06	-0.17106	8	0.034185	yes	BRNCTXA
chr1_1398056_C_A_b38	ATAD3C	-5.002	1.45e-06	-0.153129	24	0.030612	yes	BRNCTXA
chr1_1363438_C_CTT_b38	ATAD3C	4.828	3.14e-06	0.155418	19	0.032193	yes	BRNCTXA
chr1_1366951_A_AGT_b38	ATAD3C	4.723	4.97e-06	0.196892	4	0.041689	yes	BRNCTXA
chr1_1375678_TA_T_b38	ATAD3C	4.712	5.21e-06	0.174366	13	0.037006	yes	BRNCTXA
chr1_1522693_A_G_b38	ATAD3C	4.601	8.37e-06	0.172056	6	0.037394	yes	BRNCTXA
chr1_1302795_T_TC_b38	ATAD3C	4.568	9.62e-06	0.146174	33	0.031998	yes	BRNCTXA
chr1_1226486_C_T_b38	ATAD3C	-4.52	1.18e-05	-0.182877	3	0.040458	yes	BRNCTXA
chr1_1292284_TTGAG_T_b38	ATAD3C	-4.465	1.48e-05	-0.180646	8	0.040459	yes	BRNCTXA
chr1_1340697_G_A_b38	ATAD3C	4.388	2.04e-05	0.140526	13	0.032024	yes	BRNCTXA
chr1_1235602_C_A_b38	ATAD3C	-4.186	4.63e-05	-0.17243	3	0.041196	yes	BRNCTXA
chr1_1217733_G_A_b38	ATAD3C	-4.177	4.79e-05	-0.168241	4	0.04028	yes	BRNCTXA
chr1_1259424_T_C_b38	ATAD3C	-4.163	5.06e-05	-0.141366	23	0.033956	yes	BRNCTXA
chr1_1258206_AT_A_b38	ATAD3C	-4.121	5.98e-05	-0.136249	21	0.033065	yes	BRNCTXA
chr1_1290968_C_G_b38	ATAD3C	-4.015	9.03e-05	-0.163958	14	0.040837	yes	BRNCTXA
chr1_1231710_CCCCCGGGAA_C_b38	ATAD3C	-4.003	9.44e-05	-0.159815	4	0.03992	yes	BRNCTXA
chr1_1217251_C_A_b38	ATAD3C	-3.978	0.000104	-0.161021	5	0.04048	yes	BRNCTXA
chr1_1482316_C_G_b38	ATAD3C	-3.912	0.000134	-0.12675	17	0.0324	yes	BRNCTXA
chr1_1367028_A_G_b38	ATAD3C	3.893	0.000144	0.15718	5	0.040372	yes	BRNCTXA
chr1_1221049_C_G_b38	ATAD3C	-3.858	0.000164	-0.124308	22	0.03222	yes	BRNCTXA
chr1_1551454_C_A_b38	ATAD3C	-3.827	0.000184	-0.111941	49	0.029251	yes	BRNCTXA
chr1_1574445_A_G_b38	ATAD3C	-3.781	0.000219	-0.121083	35	0.032027	yes	BRNCTXA
chr1_1577491_A_AC_b38	ATAD3C	-3.757	0.000239	-0.119973	36	0.031935	yes	BRNCTXA
chr1_1238231_G_A_b38	ATAD3C	-3.747	0.000248	-0.131019	10	0.034966	yes	BRNCTXA
chr1_1236303_A_G_b38	ATAD3C	-3.745	0.000249	-0.150348	4	0.040145	yes	BRNCTXA
chr1_1216593_G_C_b38	ATAD3C	-3.745	0.000249	-0.13961	6	0.03728	yes	BRNCTXA
chr1_1370553_CA_C_b38	ATAD3C	3.726	0.000267	0.115888	48	0.031102	yes	BRNCTXA
chr1_1573654_T_C_b38	ATAD3C	-3.674	0.000323	-0.115641	35	0.031473	yes	BRNCTXA
chr1_1575724_G_C_b38	ATAD3C	-3.674	0.000323	-0.115641	35	0.031473	yes	BRNCTXA
chr1_1541864_T_C_b38	ATAD3C	-3.654	0.000347	-0.118206	34	0.032351	yes	BRNCTXA
chr1_1543500_T_G_b38	ATAD3C	-3.65	0.000352	-0.117057	34	0.032071	yes	BRNCTXA
chr1_1551557_A_AG_b38	ATAD3C	-3.641	0.000364	-0.116412	34	0.031974	yes	BRNCTXA
chr1_1551559_A_T_b38	ATAD3C	-3.641	0.000364	-0.116412	34	0.031974	yes	BRNCTXA
chr1_1280044_T_C_b38	ATAD3C	-3.638	0.000367	-0.120529	25	0.033126	yes	BRNCTXA
chr1_1229369_G_GC_b38	ATAD3C	-3.616	0.000397	-0.130946	8	0.036208	yes	BRNCTXA
chr1_1542773_T_C_b38	ATAD3C	-3.556	0.000492	-0.113191	34	0.03183	yes	BRNCTXA
chr1_1542793_C_G_b38	ATAD3C	-3.556	0.000492	-0.113191	34	0.03183	yes	BRNCTXA
chr1_1542800_T_C_b38	ATAD3C	-3.556	0.000492	-0.113191	34	0.03183	yes	BRNCTXA
chr1_1575421_C_T_b38	ATAD3C	-3.529	0.000542	-0.112448	34	0.031867	yes	BRNCTXA
chr1_1543953_A_G_b38	ATAD3C	-3.514	0.000571	-0.112771	34	0.032094	yes	BRNCTXA
chr1_1188054_T_A_b38	ATAD3C	-3.499	0.000601	-0.129796	9	0.037091	yes	BRNCTXA
chr1_1500745_A_C_b38	ATAD3C	-3.474	0.000656	-0.17793	17	0.05122	yes	BRNCTXA
chr1_1550064_GC_G_b38	ATAD3C	-3.456	0.000698	-0.109335	35	0.031636	yes	BRNCTXA
chr1_1550068_C_A_b38	ATAD3C	-3.456	0.000698	-0.109335	35	0.031636	yes	BRNCTXA
chr1_1558726_C_CA_b38	ATAD3C	-3.456	0.000698	-0.109335	35	0.031636	yes	BRNCTXA
chr1_1561821_A_C_b38	ATAD3C	-3.456	0.000698	-0.109335	35	0.031636	yes	BRNCTXA
chr1_1545795_C_A_b38	ATAD3C	-3.409	0.00082	-0.11021	29	0.032327	yes	BRNCTXA
chr1_1574032_AAAG_A_b38	ATAD3C	-3.37	0.000938	-0.117968	20	0.035009	yes	BRNCTXA
chr1_1238902_T_C_b38	ATAD3C	-3.353	0.000992	-0.104593	27	0.031191	yes	BRNCTXA
chr1_1538787_A_G_b38	ATAD3C	-3.336	0.00105	-0.106498	37	0.031924	yes	BRNCTXA
chr1_1557495_CAT_C_b38	ATAD3C	-3.335	0.00106	-0.105861	35	0.031743	yes	BRNCTXA
chr1_1201373_T_C_b38	ATAD3C	-3.328	0.00108	-0.12141	13	0.036476	yes	BRNCTXA
chr1_1575864_G_A_b38	ATAD3C	-3.298	0.00119	-0.108114	31	0.032783	yes	BRNCTXA
chr1_1230159_G_A_b38	ATAD3C	-3.283	0.00126	-0.113628	13	0.034611	yes	BRNCTXA
chr1_1574655_GGC_G_b38	ATAD3C	-3.265	0.00133	-0.106543	29	0.032631	yes	BRNCTXA
chr1_2222104_C_CT_b38	ATAD3C	3.256	0.00137	0.152482	7	0.046836	yes	BRNCTXA
chr1_1497606_C_G_b38	ATAD3C	-3.246	0.00142	-0.11751	11	0.036199	yes	BRNCTXA
chr1_1566086_G_A_b38	ATAD3C	-3.241	0.00144	-0.102898	38	0.031746	yes	BRNCTXA
chr1_1562444_C_T_b38	ATAD3C	-3.237	0.00146	-0.146844	4	0.045368	yes	BRNCTXA
chr1_1388565_GTC_G_b38	ATAD3C	3.233	0.00148	0.110427	13	0.034159	yes	BRNCTXA
chr1_1534226_C_T_b38	ATAD3C	-3.228	0.00151	-0.108641	23	0.033659	yes	BRNCTXA
chr1_1572532_A_C_b38	ATAD3C	-3.214	0.00158	-0.099855	38	0.03107	yes	BRNCTXA
chr1_1573079_A_G_b38	ATAD3C	-3.214	0.00158	-0.099855	38	0.03107	yes	BRNCTXA
chr1_1065530_C_T_b38	ATAD3C	3.214	0.00158	0.140386	4	0.043684	yes	BRNCTXA
chr1_1569180_T_A_b38	ATAD3C	-3.173	0.0018	-0.102584	35	0.032326	yes	BRNCTXA
chr1_1549590_C_G_b38	ATAD3C	-3.156	0.0019	-0.098591	38	0.03124	yes	BRNCTXA
chr1_1553692_A_G_b38	ATAD3C	-3.156	0.0019	-0.098591	38	0.03124	yes	BRNCTXA
chr1_1554694_A_G_b38	ATAD3C	-3.156	0.0019	-0.098591	38	0.03124	yes	BRNCTXA
chr1_1555247_T_A_b38	ATAD3C	-3.156	0.0019	-0.098591	38	0.03124	yes	BRNCTXA
chr1_1559750_C_CAG_b38	ATAD3C	-3.156	0.0019	-0.098591	38	0.03124	yes	BRNCTXA
chr1_1561628_T_C_b38	ATAD3C	-3.156	0.0019	-0.098591	38	0.03124	yes	BRNCTXA
chr1_1563918_A_G_b38	ATAD3C	-3.156	0.0019	-0.098591	38	0.03124	yes	BRNCTXA
chr1_1565561_A_G_b38	ATAD3C	-3.156	0.0019	-0.098591	38	0.03124	yes	BRNCTXA
chr1_1567715_G_A_b38	ATAD3C	-3.156	0.0019	-0.098591	38	0.03124	yes	BRNCTXA
chr1_1567719_A_C_b38	ATAD3C	-3.156	0.0019	-0.098591	38	0.03124	yes	BRNCTXA
chr1_1569875_C_T_b38	ATAD3C	-3.156	0.0019	-0.098591	38	0.03124	yes	BRNCTXA
chr1_1570294_CA_C_b38	ATAD3C	-3.155	0.00191	-0.099855	36	0.031649	yes	BRNCTXA
chr1_1537493_T_A_b38	ATAD3C	-3.134	0.00204	-0.103134	30	0.03291	yes	BRNCTXA
chr1_1569661_T_C_b38	ATAD3C	-3.13	0.00207	-0.097474	36	0.031141	yes	BRNCTXA
chr1_1028320_GC_G_b38	ATAD3C	-3.107	0.00223	-0.141466	7	0.045531	yes	BRNCTXA
chr1_1028320_GCC_G_b38	ATAD3C	3.089	0.00236	0.105371	44	0.034113	yes	BRNCTXA
chr1_1560765_T_C_b38	ATAD3C	-3.082	0.00241	-0.102155	29	0.033142	yes	BRNCTXA
chr1_1562261_TTTTC_T_b38	ATAD3C	-3.082	0.00241	-0.102155	29	0.033142	yes	BRNCTXA
chr1_1582556_T_C_b38	ATAD3C	-3.077	0.00245	-0.13526	4	0.043958	yes	BRNCTXA
chr1_1537160_T_G_b38	ATAD3C	-3.047	0.00269	-0.095643	43	0.031384	yes	BRNCTXA
chr1_1288085_GC_G_b38	ATAD3C	-3.034	0.00281	-0.128592	3	0.042383	yes	BRNCTXA
chr1_2107797_G_T_b38	ATAD3C	2.981	0.00331	0.132063	7	0.044296	yes	BRNCTXA
chr1_2109324_G_A_b38	ATAD3C	2.981	0.00331	0.132063	7	0.044296	yes	BRNCTXA
chr1_2109338_C_T_b38	ATAD3C	2.981	0.00331	0.132063	7	0.044296	yes	BRNCTXA
chr1_1518621_A_AC_b38	ATAD3C	-2.977	0.00335	-0.1192	10	0.040039	yes	BRNCTXA
chr1_1050070_G_A_b38	ATAD3C	-2.966	0.00347	-0.091034	44	0.030698	yes	BRNCTXA
chr1_1554781_A_G_b38	ATAD3C	-2.957	0.00356	-0.092284	38	0.031207	yes	BRNCTXA
chr1_1547630_G_A_b38	ATAD3C	-2.938	0.00378	-0.090854	34	0.030927	yes	BRNCTXA
chr1_2108949_G_A_b38	ATAD3C	2.938	0.00378	0.132114	7	0.044973	yes	BRNCTXA
chr1_1565105_CAAGGCAGGCGGATCATG_C_b38	ATAD3C	-2.921	0.00399	-0.091901	39	0.031466	yes	BRNCTXA
chr1_1571794_A_AT_b38	ATAD3C	-2.916	0.00404	-0.095743	31	0.032835	yes	BRNCTXA
chr1_1539491_G_C_b38	ATAD3C	-2.882	0.00448	-0.094565	33	0.03281	yes	BRNCTXA
chr1_1554852_T_C_b38	ATAD3C	-2.872	0.00461	-0.089828	38	0.031274	yes	BRNCTXA
chr1_1050063_AG_A_b38	ATAD3C	-2.864	0.00473	-0.089213	44	0.031149	yes	BRNCTXA
chr1_1575935_T_C_b38	ATAD3C	-2.842	0.00505	-0.091889	34	0.03233	yes	BRNCTXA
chr1_2333631_T_C_b38	ATAD3C	2.841	0.00507	0.104535	8	0.036795	yes	BRNCTXA
chr1_1219858_G_A_b38	ATAD3C	-2.832	0.00521	-0.110202	7	0.038919	yes	BRNCTXA
chr1_2108657_T_C_b38	ATAD3C	2.823	0.00535	0.126692	6	0.044882	yes	BRNCTXA
chr1_1184277_G_C_b38	ATAD3C	-2.801	0.0057	-0.088025	36	0.031422	yes	BRNCTXA
chr1_1568548_G_A_b38	ATAD3C	-2.784	0.006	-0.089792	32	0.032255	yes	BRNCTXA
chr1_1570587_C_T_b38	ATAD3C	-2.771	0.00624	-0.090353	32	0.032608	yes	BRNCTXA
chr1_1559703_G_C_b38	ATAD3C	-2.762	0.0064	-0.089649	32	0.032455	yes	BRNCTXA
chr1_599751_T_G_b38	ATAD3C	2.752	0.0066	0.140185	6	0.050947	yes	BRNCTXA
chr1_2325579_T_G_b38	ATAD3C	2.742	0.00678	0.104382	8	0.038063	yes	BRNCTXA
chr1_2326447_G_C_b38	ATAD3C	2.742	0.00678	0.104382	8	0.038063	yes	BRNCTXA
chr1_2330544_C_A_b38	ATAD3C	2.742	0.00678	0.104382	8	0.038063	yes	BRNCTXA
chr1_2332227_G_A_b38	ATAD3C	2.742	0.00678	0.104382	8	0.038063	yes	BRNCTXA
chr1_2332449_C_T_b38	ATAD3C	2.742	0.00678	0.104382	8	0.038063	yes	BRNCTXA
chr1_2333258_C_T_b38	ATAD3C	2.742	0.00678	0.104382	8	0.038063	yes	BRNCTXA
chr1_1573429_CAAAAAAAAAAAAAAAAAA_C_b38	ATAD3C	-2.728	0.00706	-0.084984	34	0.03115	yes	BRNCTXA
chr1_1548572_A_AC_b38	ATAD3C	-2.707	0.00751	-0.170164	4	0.06286	yes	BRNCTXA
chr1_1306523_C_G_b38	ATAD3C	2.703	0.00759	0.13687	7	0.050628	yes	BRNCTXA
chr1_1572877_T_TG_b38	ATAD3C	2.651	0.00882	0.11152	8	0.042072	yes	BRNCTXA
chr1_1533754_T_C_b38	ATAD3C	-2.65	0.00883	-0.09202	20	0.034723	yes	BRNCTXA
chr1_1182018_A_G_b38	ATAD3C	-2.643	0.00902	-0.086792	32	0.032842	yes	BRNCTXA
chr1_1180614_G_A_b38	ATAD3C	-2.639	0.00911	-0.107037	4	0.040558	yes	BRNCTXA
chr1_1565680_A_AG_b38	ATAD3C	-2.628	0.00941	-0.082473	38	0.031384	yes	BRNCTXA
chr1_1370553_CAAA_C_b38	ATAD3C	-6.879	1.21e-10	-0.2659	3	0.038652	no	BRNCTXA
chr1_1372909_G_A_b38	ATAD3C	-6.756	2.35e-10	-0.253579	3	0.037533	no	BRNCTXA
chr1_1369282_G_A_b38	ATAD3C	-6.61	5.16e-10	-0.243893	3	0.036899	no	BRNCTXA
chr1_1369320_GT_G_b38	ATAD3C	-6.61	5.16e-10	-0.243893	3	0.036899	no	BRNCTXA
chr1_1369407_G_A_b38	ATAD3C	-6.61	5.16e-10	-0.243893	3	0.036899	no	BRNCTXA
chr1_1369476_CTT_C_b38	ATAD3C	-6.61	5.16e-10	-0.243893	3	0.036899	no	BRNCTXA
chr1_1369556_C_G_b38	ATAD3C	-6.61	5.16e-10	-0.243893	3	0.036899	no	BRNCTXA
chr1_1369627_T_C_b38	ATAD3C	-6.61	5.16e-10	-0.243893	3	0.036899	no	BRNCTXA
chr1_1369686_T_C_b38	ATAD3C	-6.61	5.16e-10	-0.243893	3	0.036899	no	BRNCTXA
chr1_1369716_G_C_b38	ATAD3C	-6.61	5.16e-10	-0.243893	3	0.036899	no	BRNCTXA
chr1_1369741_C_T_b38	ATAD3C	-6.61	5.16e-10	-0.243893	3	0.036899	no	BRNCTXA
chr1_1369821_C_T_b38	ATAD3C	-6.471	1.07e-09	-0.241192	3	0.037271	no	BRNCTXA
chr1_1341550_GCA_G_b38	ATAD3C	-6.414	1.46e-09	-0.24582	3	0.038328	no	BRNCTXA
chr1_1367919_C_T_b38	ATAD3C	-6.334	2.2e-09	-0.236972	3	0.037411	no	BRNCTXA
chr1_1367951_C_T_b38	ATAD3C	-6.334	2.2e-09	-0.236972	3	0.037411	no	BRNCTXA
chr1_1367965_A_G_b38	ATAD3C	-6.334	2.2e-09	-0.236972	3	0.037411	no	BRNCTXA
chr1_1367970_T_G_b38	ATAD3C	-6.334	2.2e-09	-0.236972	3	0.037411	no	BRNCTXA
chr1_1367994_C_A_b38	ATAD3C	-6.334	2.2e-09	-0.236972	3	0.037411	no	BRNCTXA
chr1_1368297_C_T_b38	ATAD3C	-6.334	2.2e-09	-0.236972	3	0.037411	no	BRNCTXA
chr1_1368514_C_G_b38	ATAD3C	-6.334	2.2e-09	-0.236972	3	0.037411	no	BRNCTXA
chr1_1368991_C_T_b38	ATAD3C	-6.334	2.2e-09	-0.236972	3	0.037411	no	BRNCTXA
chr1_1369009_T_C_b38	ATAD3C	-6.334	2.2e-09	-0.236972	3	0.037411	no	BRNCTXA
chr1_1369012_C_CG_b38	ATAD3C	-6.334	2.2e-09	-0.236972	3	0.037411	no	BRNCTXA
chr1_1368763_G_A_b38	ATAD3C	-6.211	4.18e-09	-0.232319	3	0.037407	no	BRNCTXA
chr1_1316929_A_T_b38	ATAD3C	-5.941	1.65e-08	-0.22202	4	0.03737	no	BRNCTXA
chr1_1308178_GGGGCGCGGGGA_G_b38	ATAD3C	-5.795	3.41e-08	-0.210411	6	0.03631	no	BRNCTXA
chr1_1290841_A_G_b38	ATAD3C	-4.965	1.71e-06	-0.188466	12	0.03796	no	BRNCTXA
chr1_1480224_A_G_b38	ATAD3C	-4.901	2.28e-06	-0.282082	4	0.057561	no	BRNCTXA
chr1_1375678_TAA_T_b38	ATAD3C	-3.903	0.000138	-0.153599	6	0.039355	no	BRNCTXA
chr1_1231507_T_C_b38	ATAD3C	-3.841	0.000175	-0.144998	5	0.037747	no	BRNCTXA
chr1_1228424_C_T_b38	ATAD3C	-3.841	0.000175	-0.145613	5	0.037913	no	BRNCTXA
chr1_1251122_A_T_b38	ATAD3C	-3.839	0.000176	-0.138767	10	0.036144	no	BRNCTXA
chr1_1251285_G_A_b38	ATAD3C	-3.781	0.000218	-0.147534	6	0.03902	no	BRNCTXA
chr1_1251368_T_C_b38	ATAD3C	-3.781	0.000218	-0.147534	6	0.03902	no	BRNCTXA
chr1_1251618_G_A_b38	ATAD3C	-3.665	0.000334	-0.145618	5	0.039732	no	BRNCTXA
chr1_1215852_T_C_b38	ATAD3C	-3.63	0.000378	-0.133662	7	0.036822	no	BRNCTXA
chr1_1246371_T_C_b38	ATAD3C	-3.59	0.000436	-0.139646	7	0.038898	no	BRNCTXA
chr1_1363601_A_AT_b38	ATAD3C	3.564	0.000478	0.101218	54	0.028399	no	BRNCTXA
chr1_1249880_A_G_b38	ATAD3C	-3.557	0.00049	-0.12981	10	0.036491	no	BRNCTXA
chr1_1308549_G_T_b38	ATAD3C	3.496	0.000607	0.087526	50	0.025035	no	BRNCTXA
chr1_1243102_A_G_b38	ATAD3C	-3.388	0.000882	-0.136074	5	0.040163	no	BRNCTXA
chr1_1241053_A_G_b38	ATAD3C	-3.368	0.000943	-0.137005	4	0.040675	no	BRNCTXA
chr1_1242094_A_G_b38	ATAD3C	-3.345	0.00102	-0.136814	4	0.040904	no	BRNCTXA
chr1_1242250_A_G_b38	ATAD3C	-3.345	0.00102	-0.136814	4	0.040904	no	BRNCTXA
chr1_1244603_G_A_b38	ATAD3C	-3.341	0.00103	-0.137506	4	0.04116	no	BRNCTXA
chr1_1235642_G_C_b38	ATAD3C	-3.338	0.00105	-0.135548	3	0.040612	no	BRNCTXA
chr1_1241639_T_C_b38	ATAD3C	-3.316	0.00113	-0.138782	3	0.041857	no	BRNCTXA
chr1_791544_TGAATG_T_b38	ATAD3C	3.281	0.00126	0.131467	6	0.040066	no	BRNCTXA
chr1_1243545_G_A_b38	ATAD3C	-3.27	0.00131	-0.13849	3	0.042355	no	BRNCTXA
chr1_1243929_G_A_b38	ATAD3C	-3.27	0.00131	-0.13849	3	0.042355	no	BRNCTXA
chr1_1548572_A_C_b38	ATAD3C	-3.149	0.00195	-0.091795	39	0.029149	no	BRNCTXA
chr1_1243650_G_A_b38	ATAD3C	-3.148	0.00195	-0.130396	4	0.041424	no	BRNCTXA
chr1_1241217_T_C_b38	ATAD3C	-3.093	0.00233	-0.126747	4	0.04098	no	BRNCTXA
chr1_1242865_C_T_b38	ATAD3C	-3.069	0.00252	-0.123918	5	0.04038	no	BRNCTXA
chr1_2109346_A_G_b38	ATAD3C	3.044	0.00272	0.136783	6	0.04493	no	BRNCTXA
chr1_2109497_T_C_b38	ATAD3C	3.044	0.00272	0.136783	6	0.04493	no	BRNCTXA
chr1_1290261_C_A_b38	ATAD3C	-2.943	0.00372	-0.130838	13	0.044458	no	BRNCTXA
chr1_1182106_A_G_b38	ATAD3C	-2.869	0.00466	-0.120473	5	0.041988	no	BRNCTXA
chr1_814773_T_C_b38	ATAD3C	2.863	0.00474	0.113569	3	0.039667	no	BRNCTXA
chr1_1295039_T_C_b38	ATAD3C	-2.807	0.0056	-0.155035	13	0.055222	no	BRNCTXA
chr1_1298561_T_C_b38	ATAD3C	-2.807	0.0056	-0.155035	13	0.055222	no	BRNCTXA
chr1_1306420_A_G_b38	ATAD3C	2.807	0.0056	0.155035	13	0.055222	no	BRNCTXA
chr1_1307327_A_G_b38	ATAD3C	2.807	0.0056	0.155035	13	0.055222	no	BRNCTXA
chr1_1248062_A_G_b38	ATAD3C	-2.789	0.00592	-0.133291	3	0.047795	no	BRNCTXA
chr1_1248063_T_C_b38	ATAD3C	-2.789	0.00592	-0.133291	3	0.047795	no	BRNCTXA
chr1_1248068_A_C_b38	ATAD3C	-2.789	0.00592	-0.133291	3	0.047795	no	BRNCTXA
chr1_1248069_A_C_b38	ATAD3C	-2.789	0.00592	-0.133291	3	0.047795	no	BRNCTXA
chr1_1248075_A_C_b38	ATAD3C	-2.789	0.00592	-0.133291	3	0.047795	no	BRNCTXA
chr1_1248091_G_A_b38	ATAD3C	-2.789	0.00592	-0.133291	3	0.047795	no	BRNCTXA
chr1_1248092_T_C_b38	ATAD3C	-2.789	0.00592	-0.133291	3	0.047795	no	BRNCTXA
chr1_958081_TC_T_b38	ATAD3C	-2.781	0.00604	-0.201276	3	0.072363	no	BRNCTXA
chr1_1523187_A_G_b38	ATAD3C	-2.727	0.00709	-0.15314	12	0.056159	no	BRNCTXA
chr1_1007746_CTTTTTTTTTTTTTTT_C_b38	ATAD3C	2.704	0.00758	0.113992	7	0.042158	no	BRNCTXA
chr1_1290579_C_G_b38	ATAD3C	-2.659	0.00862	-0.096551	15	0.036315	no	BRNCTXA
chr1_1248686_A_G_b38	ATAD3C	-2.63	0.00934	-0.124325	3	0.047266	no	BRNCTXA
chr1_1441187_A_G_b38	ATAD3C	-7.629	3.93e-12	-0.254757	18	0.033393	yes	BRNCTXB
chr1_1443457_T_C_b38	ATAD3C	-7.626	3.98e-12	-0.242653	27	0.031818	yes	BRNCTXB
chr1_1440430_C_G_b38	ATAD3C	-7.49	8.3e-12	-0.236051	17	0.031515	yes	BRNCTXB
chr1_1436388_CA_C_b38	ATAD3C	-7.46	9.78e-12	-0.248918	16	0.033368	yes	BRNCTXB
chr1_1440834_C_G_b38	ATAD3C	-7.292	2.39e-11	-0.233751	26	0.032055	yes	BRNCTXB
chr1_1433374_T_C_b38	ATAD3C	-6.957	1.4e-10	-0.224131	28	0.032217	yes	BRNCTXB
chr1_1430908_A_G_b38	ATAD3C	-6.844	2.51e-10	-0.237419	24	0.034693	yes	BRNCTXB
chr1_1431450_A_G_b38	ATAD3C	-6.792	3.28e-10	-0.234308	24	0.034498	yes	BRNCTXB
chr1_1431537_G_C_b38	ATAD3C	-6.792	3.28e-10	-0.234308	24	0.034498	yes	BRNCTXB
chr1_1436079_A_G_b38	ATAD3C	-6.781	3.48e-10	-0.219773	26	0.032412	yes	BRNCTXB
chr1_1430190_A_C_b38	ATAD3C	-6.648	6.86e-10	-0.229921	24	0.034583	yes	BRNCTXB
chr1_1432355_G_A_b38	ATAD3C	-6.585	9.47e-10	-0.241309	6	0.036645	yes	BRNCTXB
chr1_1456182_G_A_b38	ATAD3C	-6.56	1.07e-09	-0.225443	17	0.034365	yes	BRNCTXB
chr1_1428969_T_C_b38	ATAD3C	-6.425	2.13e-09	-0.224494	24	0.034942	yes	BRNCTXB
chr1_1439454_A_G_b38	ATAD3C	-6.389	2.55e-09	-0.200741	25	0.031421	yes	BRNCTXB
chr1_1454848_T_C_b38	ATAD3C	-6.326	3.48e-09	-0.218919	15	0.034604	yes	BRNCTXB
chr1_1431014_G_A_b38	ATAD3C	-6.314	3.71e-09	-0.21215	12	0.033602	yes	BRNCTXB
chr1_1452825_AAAG_A_b38	ATAD3C	-6.301	3.96e-09	-0.22313	15	0.035413	yes	BRNCTXB
chr1_1453552_G_A_b38	ATAD3C	-6.301	3.96e-09	-0.22313	15	0.035413	yes	BRNCTXB
chr1_1455134_T_G_b38	ATAD3C	-6.301	3.96e-09	-0.22313	15	0.035413	yes	BRNCTXB
chr1_1455337_A_G_b38	ATAD3C	-6.301	3.96e-09	-0.22313	15	0.035413	yes	BRNCTXB
chr1_1455495_C_T_b38	ATAD3C	-6.301	3.96e-09	-0.22313	15	0.035413	yes	BRNCTXB
chr1_1455924_T_C_b38	ATAD3C	-6.301	3.96e-09	-0.22313	15	0.035413	yes	BRNCTXB
chr1_1456051_C_T_b38	ATAD3C	-6.301	3.96e-09	-0.22313	15	0.035413	yes	BRNCTXB
chr1_1456154_G_A_b38	ATAD3C	-6.301	3.96e-09	-0.22313	15	0.035413	yes	BRNCTXB
chr1_1426261_C_T_b38	ATAD3C	-6.261	4.81e-09	-0.21907	24	0.034988	yes	BRNCTXB
chr1_1426810_C_G_b38	ATAD3C	-6.261	4.81e-09	-0.21907	24	0.034988	yes	BRNCTXB
chr1_1445187_T_G_b38	ATAD3C	-6.255	4.96e-09	-0.206496	24	0.033012	yes	BRNCTXB
chr1_1452540_G_A_b38	ATAD3C	-6.223	5.81e-09	-0.214057	13	0.034397	yes	BRNCTXB
chr1_1445240_A_G_b38	ATAD3C	-6.112	1.01e-08	-0.20221	25	0.033086	yes	BRNCTXB
chr1_1456079_T_C_b38	ATAD3C	-6.105	1.04e-08	-0.217107	15	0.035561	yes	BRNCTXB
chr1_1451968_C_T_b38	ATAD3C	-6.054	1.34e-08	-0.215097	13	0.035531	yes	BRNCTXB
chr1_1452346_A_G_b38	ATAD3C	-5.922	2.53e-08	-0.215201	7	0.03634	yes	BRNCTXB
chr1_1449009_A_T_b38	ATAD3C	-5.778	5.03e-08	-0.220394	14	0.038141	yes	BRNCTXB
chr1_1448915_G_A_b38	ATAD3C	-5.699	7.33e-08	-0.196943	17	0.034557	yes	BRNCTXB
chr1_1452384_G_A_b38	ATAD3C	-5.697	7.41e-08	-0.209205	7	0.036723	yes	BRNCTXB
chr1_1431026_CCACCCCCT_C_b38	ATAD3C	-5.683	7.9e-08	-0.213534	14	0.037573	yes	BRNCTXB
chr1_1454315_C_T_b38	ATAD3C	-5.611	1.11e-07	-0.203899	20	0.036342	yes	BRNCTXB
chr1_1431813_G_T_b38	ATAD3C	-5.546	1.5e-07	-0.218205	4	0.039348	yes	BRNCTXB
chr1_1431656_G_A_b38	ATAD3C	-5.529	1.62e-07	-0.225441	3	0.040772	yes	BRNCTXB
chr1_1452797_CAA_C_b38	ATAD3C	-5.5	1.86e-07	-0.215427	9	0.039167	yes	BRNCTXB
chr1_1449831_A_G_b38	ATAD3C	-5.45	2.34e-07	-0.208548	22	0.038264	yes	BRNCTXB
chr1_1450636_A_G_b38	ATAD3C	-5.414	2.76e-07	-0.206349	6	0.038115	yes	BRNCTXB
chr1_1438102_G_C_b38	ATAD3C	-5.361	3.51e-07	-0.189111	9	0.035272	yes	BRNCTXB
chr1_1455617_T_G_b38	ATAD3C	-5.257	5.64e-07	-0.195868	23	0.037261	yes	BRNCTXB
chr1_1452511_A_G_b38	ATAD3C	-5.254	5.72e-07	-0.193051	22	0.036745	yes	BRNCTXB
chr1_1452888_C_A_b38	ATAD3C	-5.254	5.72e-07	-0.193051	22	0.036745	yes	BRNCTXB
chr1_1452909_A_C_b38	ATAD3C	-5.254	5.72e-07	-0.193051	22	0.036745	yes	BRNCTXB
chr1_1454092_A_G_b38	ATAD3C	-5.254	5.72e-07	-0.193051	22	0.036745	yes	BRNCTXB
chr1_1457071_C_T_b38	ATAD3C	-5.206	7.08e-07	-0.179541	16	0.034487	yes	BRNCTXB
chr1_1442793_G_A_b38	ATAD3C	-5.187	7.7e-07	-0.205678	4	0.039651	yes	BRNCTXB
chr1_1453870_A_C_b38	ATAD3C	-5.144	9.35e-07	-0.20325	5	0.039514	yes	BRNCTXB
chr1_1453961_C_T_b38	ATAD3C	-5.144	9.35e-07	-0.20325	5	0.039514	yes	BRNCTXB
chr1_1454770_T_C_b38	ATAD3C	-5.139	9.55e-07	-0.191068	23	0.03718	yes	BRNCTXB
chr1_1434687_C_G_b38	ATAD3C	-5.134	9.78e-07	-0.207533	4	0.040426	yes	BRNCTXB
chr1_1453703_A_G_b38	ATAD3C	-5.127	1.01e-06	-0.188788	22	0.036823	yes	BRNCTXB
chr1_1302795_T_TC_b38	ATAD3C	5.102	1.12e-06	0.201963	17	0.039582	yes	BRNCTXB
chr1_1456217_T_C_b38	ATAD3C	-5.019	1.62e-06	-0.192274	22	0.038311	yes	BRNCTXB
chr1_1451028_T_A_b38	ATAD3C	-5.018	1.63e-06	-0.189166	7	0.037699	yes	BRNCTXB
chr1_1451787_A_C_b38	ATAD3C	-5.015	1.65e-06	-0.182023	17	0.036294	yes	BRNCTXB
chr1_1313807_G_A_b38	ATAD3C	4.992	1.82e-06	0.179789	22	0.036014	yes	BRNCTXB
chr1_1457033_A_C_b38	ATAD3C	-4.969	2.02e-06	-0.180879	14	0.036404	yes	BRNCTXB
chr1_1426253_G_A_b38	ATAD3C	-4.922	2.48e-06	-0.203446	3	0.041336	yes	BRNCTXB
chr1_1456829_G_C_b38	ATAD3C	-4.887	2.88e-06	-0.185627	17	0.037985	yes	BRNCTXB
chr1_1309988_G_A_b38	ATAD3C	4.86	3.23e-06	0.175664	22	0.036142	yes	BRNCTXB
chr1_1312114_T_C_b38	ATAD3C	4.86	3.23e-06	0.175664	22	0.036142	yes	BRNCTXB
chr1_1308516_C_T_b38	ATAD3C	4.831	3.66e-06	0.174903	22	0.036206	yes	BRNCTXB
chr1_1437993_G_A_b38	ATAD3C	-4.73	5.61e-06	-0.16753	9	0.035417	yes	BRNCTXB
chr1_1330125_G_A_b38	ATAD3C	4.707	6.19e-06	0.177167	20	0.03764	yes	BRNCTXB
chr1_1384749_C_G_b38	ATAD3C	4.615	9.1e-06	0.171438	14	0.03715	yes	BRNCTXB
chr1_1387763_CCT_C_b38	ATAD3C	4.615	9.1e-06	0.171438	14	0.03715	yes	BRNCTXB
chr1_1388944_G_A_b38	ATAD3C	4.615	9.1e-06	0.171438	14	0.03715	yes	BRNCTXB
chr1_1400410_A_G_b38	ATAD3C	-4.615	9.1e-06	-0.171438	14	0.03715	yes	BRNCTXB
chr1_1435945_C_CCGGGCGGGGGCG_b38	ATAD3C	-4.523	1.33e-05	-0.182691	5	0.040388	yes	BRNCTXB
chr1_1376162_G_C_b38	ATAD3C	4.522	1.33e-05	0.167253	14	0.036984	yes	BRNCTXB
chr1_1377431_C_T_b38	ATAD3C	4.522	1.33e-05	0.167253	14	0.036984	yes	BRNCTXB
chr1_1378204_G_C_b38	ATAD3C	4.522	1.33e-05	0.167253	14	0.036984	yes	BRNCTXB
chr1_1337898_A_G_b38	ATAD3C	4.518	1.36e-05	0.163544	9	0.036197	yes	BRNCTXB
chr1_1366427_AGTGTGATTGAATGAGT_A_b38	ATAD3C	4.507	1.42e-05	0.166344	12	0.036907	yes	BRNCTXB
chr1_1358384_G_C_b38	ATAD3C	4.449	1.79e-05	0.166227	19	0.037359	yes	BRNCTXB
chr1_1456891_T_C_b38	ATAD3C	-4.412	2.08e-05	-0.154035	19	0.03491	yes	BRNCTXB
chr1_1517993_A_G_b38	ATAD3C	-4.408	2.12e-05	-0.150411	30	0.034126	yes	BRNCTXB
chr1_1519934_T_G_b38	ATAD3C	-4.408	2.12e-05	-0.150411	30	0.034126	yes	BRNCTXB
chr1_1519938_T_C_b38	ATAD3C	-4.408	2.12e-05	-0.150411	30	0.034126	yes	BRNCTXB
chr1_1402457_A_G_b38	ATAD3C	-4.384	2.34e-05	-0.164597	19	0.037549	yes	BRNCTXB
chr1_1387698_A_G_b38	ATAD3C	4.384	2.34e-05	0.164597	19	0.037549	yes	BRNCTXB
chr1_1439805_G_C_b38	ATAD3C	-4.372	2.45e-05	-0.171133	7	0.039142	yes	BRNCTXB
chr1_1453643_A_ATT_b38	ATAD3C	-4.367	2.5e-05	-0.172958	11	0.03961	yes	BRNCTXB
chr1_1411323_A_C_b38	ATAD3C	-4.268	3.71e-05	-0.163598	21	0.038333	yes	BRNCTXB
chr1_1471992_T_C_b38	ATAD3C	-4.261	3.81e-05	-0.157418	24	0.036944	yes	BRNCTXB
chr1_1394423_A_G_b38	ATAD3C	-4.253	3.92e-05	-0.160618	18	0.037761	yes	BRNCTXB
chr1_1395346_A_G_b38	ATAD3C	-4.253	3.92e-05	-0.160618	18	0.037761	yes	BRNCTXB
chr1_1389827_C_T_b38	ATAD3C	4.253	3.92e-05	0.160618	18	0.037761	yes	BRNCTXB
chr1_1366561_AGT_A_b38	ATAD3C	4.226	4.37e-05	0.158507	18	0.037508	yes	BRNCTXB
chr1_1437955_C_G_b38	ATAD3C	-4.18	5.24e-05	-0.133991	19	0.032058	yes	BRNCTXB
chr1_1303112_G_A_b38	ATAD3C	-3.975	0.000115	-0.175223	4	0.044082	yes	BRNCTXB
chr1_1303800_G_A_b38	ATAD3C	-3.975	0.000115	-0.175223	4	0.044082	yes	BRNCTXB
chr1_1304555_A_C_b38	ATAD3C	-3.975	0.000115	-0.175223	4	0.044082	yes	BRNCTXB
chr1_1532798_T_C_b38	ATAD3C	-3.918	0.000142	-0.131478	47	0.033555	yes	BRNCTXB
chr1_1379083_AT_A_b38	ATAD3C	3.858	0.000177	0.137841	11	0.035727	yes	BRNCTXB
chr1_1370113_A_G_b38	ATAD3C	3.855	0.000179	0.14128	16	0.036644	yes	BRNCTXB
chr1_1447108_A_ATT_b38	ATAD3C	-3.819	0.000204	-0.147281	11	0.038567	yes	BRNCTXB
chr1_1325753_G_T_b38	ATAD3C	-3.763	0.00025	-0.173922	3	0.046218	yes	BRNCTXB
chr1_1379091_T_G_b38	ATAD3C	3.643	0.000384	0.149032	5	0.040911	yes	BRNCTXB
chr1_1394041_G_A_b38	ATAD3C	-3.616	0.000423	-0.166411	3	0.046026	yes	BRNCTXB
chr1_1290261_C_A_b38	ATAD3C	-3.582	0.000475	-0.169031	11	0.047184	yes	BRNCTXB
chr1_1383743_T_C_b38	ATAD3C	-3.571	0.000494	-0.154255	4	0.043192	yes	BRNCTXB
chr1_1370553_CAAA_C_b38	ATAD3C	-3.562	0.000509	-0.163238	3	0.045822	yes	BRNCTXB
chr1_1361679_G_A_b38	ATAD3C	3.55	0.000532	0.1379	13	0.038843	yes	BRNCTXB
chr1_1375642_C_T_b38	ATAD3C	-3.544	0.000543	-0.1535	4	0.043308	yes	BRNCTXB
chr1_1363898_C_T_b38	ATAD3C	3.49	0.000653	0.137687	6	0.039448	yes	BRNCTXB
chr1_1363986_C_T_b38	ATAD3C	3.49	0.000653	0.137687	6	0.039448	yes	BRNCTXB
chr1_1365566_G_A_b38	ATAD3C	3.49	0.000653	0.137687	6	0.039448	yes	BRNCTXB
chr1_1366529_TTAG_T_b38	ATAD3C	3.49	0.000653	0.137687	6	0.039448	yes	BRNCTXB
chr1_1367292_A_AGT_b38	ATAD3C	3.49	0.000653	0.137687	6	0.039448	yes	BRNCTXB
chr1_1384546_C_T_b38	ATAD3C	-3.463	0.000718	-0.151504	4	0.043754	yes	BRNCTXB
chr1_1398218_C_A_b38	ATAD3C	-3.463	0.000718	-0.151504	4	0.043754	yes	BRNCTXB
chr1_1400756_GGA_G_b38	ATAD3C	-3.463	0.000718	-0.151504	4	0.043754	yes	BRNCTXB
chr1_1401954_G_T_b38	ATAD3C	-3.463	0.000718	-0.151504	4	0.043754	yes	BRNCTXB
chr1_1403593_A_G_b38	ATAD3C	-3.463	0.000718	-0.151504	4	0.043754	yes	BRNCTXB
chr1_1407565_C_A_b38	ATAD3C	-3.463	0.000718	-0.151504	4	0.043754	yes	BRNCTXB
chr1_1308178_GGGGCGCGGGGA_G_b38	ATAD3C	-3.462	0.000719	-0.139823	8	0.040383	yes	BRNCTXB
chr1_1380867_A_G_b38	ATAD3C	-3.427	0.000812	-0.150006	4	0.043778	yes	BRNCTXB
chr1_2341692_GA_G_b38	ATAD3C	3.392	0.000912	0.114885	21	0.033869	yes	BRNCTXB
chr1_1482316_C_G_b38	ATAD3C	-3.375	0.000964	-0.12181	14	0.036087	yes	BRNCTXB
chr1_1316929_A_T_b38	ATAD3C	-3.367	0.000992	-0.133852	7	0.039753	yes	BRNCTXB
chr1_1369803_C_CT_b38	ATAD3C	-3.355	0.00103	-0.134884	6	0.040198	yes	BRNCTXB
chr1_1379093_TG_T_b38	ATAD3C	-3.331	0.00112	-0.152779	3	0.04587	yes	BRNCTXB
chr1_1374505_A_G_b38	ATAD3C	-3.32	0.00116	-0.144286	4	0.043465	yes	BRNCTXB
chr1_1382893_G_A_b38	ATAD3C	-3.318	0.00117	-0.145453	4	0.043838	yes	BRNCTXB
chr1_1497605_G_C_b38	ATAD3C	-3.318	0.00117	-0.125497	18	0.037827	yes	BRNCTXB
chr1_1398056_C_A_b38	ATAD3C	-3.31	0.0012	-0.108549	27	0.032793	yes	BRNCTXB
chr1_1363688_C_T_b38	ATAD3C	-3.283	0.00131	-0.141941	4	0.043241	yes	BRNCTXB
chr1_1364099_CCA_C_b38	ATAD3C	-3.283	0.00131	-0.141941	4	0.043241	yes	BRNCTXB
chr1_1364102_TGTTG_T_b38	ATAD3C	-3.283	0.00131	-0.141941	4	0.043241	yes	BRNCTXB
chr1_1329973_GCGTGTGCCATGCA_G_b38	ATAD3C	-3.238	0.00152	-0.141184	4	0.043596	yes	BRNCTXB
chr1_1341550_GCA_G_b38	ATAD3C	-3.238	0.00152	-0.141184	4	0.043596	yes	BRNCTXB
chr1_1344048_G_A_b38	ATAD3C	-3.238	0.00152	-0.141184	4	0.043596	yes	BRNCTXB
chr1_1522693_A_G_b38	ATAD3C	3.224	0.00159	0.126732	9	0.03931	yes	BRNCTXB
chr1_1479719_T_C_b38	ATAD3C	-3.222	0.0016	-0.119086	25	0.036959	yes	BRNCTXB
chr1_1368763_G_A_b38	ATAD3C	-3.221	0.0016	-0.135438	5	0.042047	yes	BRNCTXB
chr1_1557495_CAT_C_b38	ATAD3C	-3.215	0.00164	-0.116154	25	0.036133	yes	BRNCTXB
chr1_1570294_CA_C_b38	ATAD3C	-3.208	0.00167	-0.117272	24	0.036555	yes	BRNCTXB
chr1_1364253_C_G_b38	ATAD3C	-3.168	0.0019	-0.138482	4	0.043719	yes	BRNCTXB
chr1_1366511_GGTGA_G_b38	ATAD3C	-3.155	0.00198	-0.137243	4	0.043504	yes	BRNCTXB
chr1_1551557_A_AG_b38	ATAD3C	-3.151	0.002	-0.116768	25	0.037053	yes	BRNCTXB
chr1_1551559_A_T_b38	ATAD3C	-3.151	0.002	-0.116768	25	0.037053	yes	BRNCTXB
chr1_1543500_T_G_b38	ATAD3C	-3.146	0.00204	-0.114497	23	0.036398	yes	BRNCTXB
chr1_1541864_T_C_b38	ATAD3C	-3.105	0.00232	-0.114592	25	0.036906	yes	BRNCTXB
chr1_1574445_A_G_b38	ATAD3C	-3.101	0.00235	-0.111744	26	0.036037	yes	BRNCTXB
chr1_1558726_C_CA_b38	ATAD3C	-3.09	0.00243	-0.111314	25	0.03602	yes	BRNCTXB
chr1_1561821_A_C_b38	ATAD3C	-3.09	0.00243	-0.111314	25	0.03602	yes	BRNCTXB
chr1_1188054_T_A_b38	ATAD3C	-3.084	0.00248	-0.132958	6	0.043115	yes	BRNCTXB
chr1_1573654_T_C_b38	ATAD3C	-3.082	0.0025	-0.108308	26	0.035144	yes	BRNCTXB
chr1_1565680_A_AG_b38	ATAD3C	-3.078	0.00252	-0.10863	26	0.035287	yes	BRNCTXB
chr1_1370181_C_T_b38	ATAD3C	-3.064	0.00264	-0.132905	4	0.043377	yes	BRNCTXB
chr1_1370317_G_C_b38	ATAD3C	-3.064	0.00264	-0.132905	4	0.043377	yes	BRNCTXB
chr1_1370320_A_G_b38	ATAD3C	-3.064	0.00264	-0.132905	4	0.043377	yes	BRNCTXB
chr1_1370430_T_C_b38	ATAD3C	-3.064	0.00264	-0.132905	4	0.043377	yes	BRNCTXB
chr1_1370532_C_T_b38	ATAD3C	-3.064	0.00264	-0.132905	4	0.043377	yes	BRNCTXB
chr1_1370584_G_C_b38	ATAD3C	-3.064	0.00264	-0.132905	4	0.043377	yes	BRNCTXB
chr1_1372909_G_A_b38	ATAD3C	-3.064	0.00264	-0.132905	4	0.043377	yes	BRNCTXB
chr1_1569661_T_C_b38	ATAD3C	-3.02	0.00303	-0.106987	25	0.035431	yes	BRNCTXB
chr1_1369282_G_A_b38	ATAD3C	-3.011	0.00311	-0.127017	5	0.042186	yes	BRNCTXB
chr1_1369320_GT_G_b38	ATAD3C	-3.011	0.00311	-0.127017	5	0.042186	yes	BRNCTXB
chr1_1369407_G_A_b38	ATAD3C	-3.011	0.00311	-0.127017	5	0.042186	yes	BRNCTXB
chr1_1369476_CTT_C_b38	ATAD3C	-3.011	0.00311	-0.127017	5	0.042186	yes	BRNCTXB
chr1_1369556_C_G_b38	ATAD3C	-3.011	0.00311	-0.127017	5	0.042186	yes	BRNCTXB
chr1_1369627_T_C_b38	ATAD3C	-3.011	0.00311	-0.127017	5	0.042186	yes	BRNCTXB
chr1_1369686_T_C_b38	ATAD3C	-3.011	0.00311	-0.127017	5	0.042186	yes	BRNCTXB
chr1_1369716_G_C_b38	ATAD3C	-3.011	0.00311	-0.127017	5	0.042186	yes	BRNCTXB
chr1_1369741_C_T_b38	ATAD3C	-3.011	0.00311	-0.127017	5	0.042186	yes	BRNCTXB
chr1_1361685_C_T_b38	ATAD3C	-3.006	0.00316	-0.123844	11	0.041198	yes	BRNCTXB
chr1_1366681_T_TGA_b38	ATAD3C	-2.993	0.0033	-0.131341	4	0.04389	yes	BRNCTXB
chr1_1259424_T_C_b38	ATAD3C	-2.991	0.00331	-0.118409	20	0.039582	yes	BRNCTXB
chr1_1538787_A_G_b38	ATAD3C	-2.989	0.00333	-0.109042	27	0.036484	yes	BRNCTXB
chr1_1566086_G_A_b38	ATAD3C	-2.989	0.00333	-0.109042	27	0.036484	yes	BRNCTXB
chr1_1559750_C_CAG_b38	ATAD3C	-2.977	0.00346	-0.105997	27	0.03561	yes	BRNCTXB
chr1_1561628_T_C_b38	ATAD3C	-2.977	0.00346	-0.105997	27	0.03561	yes	BRNCTXB
chr1_1563918_A_G_b38	ATAD3C	-2.977	0.00346	-0.105997	27	0.03561	yes	BRNCTXB
chr1_1565561_A_G_b38	ATAD3C	-2.977	0.00346	-0.105997	27	0.03561	yes	BRNCTXB
chr1_1567715_G_A_b38	ATAD3C	-2.977	0.00346	-0.105997	27	0.03561	yes	BRNCTXB
chr1_1567719_A_C_b38	ATAD3C	-2.977	0.00346	-0.105997	27	0.03561	yes	BRNCTXB
chr1_1569875_C_T_b38	ATAD3C	-2.977	0.00346	-0.105997	27	0.03561	yes	BRNCTXB
chr1_1575421_C_T_b38	ATAD3C	-2.962	0.00362	-0.104193	25	0.035177	yes	BRNCTXB
chr1_1575724_G_C_b38	ATAD3C	-2.962	0.00362	-0.104193	25	0.035177	yes	BRNCTXB
chr1_1542773_T_C_b38	ATAD3C	-2.961	0.00362	-0.106587	24	0.035991	yes	BRNCTXB
chr1_1542793_C_G_b38	ATAD3C	-2.961	0.00362	-0.106587	24	0.035991	yes	BRNCTXB
chr1_1542800_T_C_b38	ATAD3C	-2.961	0.00362	-0.106587	24	0.035991	yes	BRNCTXB
chr1_1543953_A_G_b38	ATAD3C	-2.961	0.00362	-0.106587	24	0.035991	yes	BRNCTXB
chr1_1364282_T_G_b38	ATAD3C	-2.95	0.00375	-0.128245	4	0.043474	yes	BRNCTXB
chr1_1364357_A_C_b38	ATAD3C	-2.95	0.00375	-0.128245	4	0.043474	yes	BRNCTXB
chr1_1364566_T_C_b38	ATAD3C	-2.95	0.00375	-0.128245	4	0.043474	yes	BRNCTXB
chr1_1364694_T_C_b38	ATAD3C	-2.95	0.00375	-0.128245	4	0.043474	yes	BRNCTXB
chr1_1364721_C_T_b38	ATAD3C	-2.95	0.00375	-0.128245	4	0.043474	yes	BRNCTXB
chr1_1365160_A_G_b38	ATAD3C	-2.95	0.00375	-0.128245	4	0.043474	yes	BRNCTXB
chr1_1365198_C_T_b38	ATAD3C	-2.95	0.00375	-0.128245	4	0.043474	yes	BRNCTXB
chr1_1366008_A_G_b38	ATAD3C	-2.95	0.00375	-0.128245	4	0.043474	yes	BRNCTXB
chr1_1366062_T_C_b38	ATAD3C	-2.95	0.00375	-0.128245	4	0.043474	yes	BRNCTXB
chr1_1366145_TGTGAA_T_b38	ATAD3C	-2.95	0.00375	-0.128245	4	0.043474	yes	BRNCTXB
chr1_1366292_G_T_b38	ATAD3C	-2.95	0.00375	-0.128245	4	0.043474	yes	BRNCTXB
chr1_1366321_TGTGTGTAAATGG_T_b38	ATAD3C	-2.95	0.00375	-0.128245	4	0.043474	yes	BRNCTXB
chr1_1366453_G_T_b38	ATAD3C	-2.95	0.00375	-0.128245	4	0.043474	yes	BRNCTXB
chr1_1366726_T_G_b38	ATAD3C	-2.95	0.00375	-0.128245	4	0.043474	yes	BRNCTXB
chr1_1367258_T_A_b38	ATAD3C	-2.95	0.00375	-0.128245	4	0.043474	yes	BRNCTXB
chr1_1367268_TGA_T_b38	ATAD3C	-2.95	0.00375	-0.128245	4	0.043474	yes	BRNCTXB
chr1_1367280_T_A_b38	ATAD3C	-2.95	0.00375	-0.128245	4	0.043474	yes	BRNCTXB
chr1_1367297_GAA_G_b38	ATAD3C	-2.95	0.00375	-0.128245	4	0.043474	yes	BRNCTXB
chr1_1367300_T_TGA_b38	ATAD3C	-2.95	0.00375	-0.128245	4	0.043474	yes	BRNCTXB
chr1_1367329_A_AGT_b38	ATAD3C	-2.95	0.00375	-0.128245	4	0.043474	yes	BRNCTXB
chr1_1367373_T_TGTG_b38	ATAD3C	-2.95	0.00375	-0.128245	4	0.043474	yes	BRNCTXB
chr1_1367462_T_C_b38	ATAD3C	-2.95	0.00375	-0.128245	4	0.043474	yes	BRNCTXB
chr1_1367593_G_A_b38	ATAD3C	-2.95	0.00375	-0.128245	4	0.043474	yes	BRNCTXB
chr1_1367602_GT_G_b38	ATAD3C	-2.95	0.00375	-0.128245	4	0.043474	yes	BRNCTXB
chr1_1367605_GAGTGAGTGTA_G_b38	ATAD3C	-2.95	0.00375	-0.128245	4	0.043474	yes	BRNCTXB
chr1_1367670_GGTGA_G_b38	ATAD3C	-2.95	0.00375	-0.128245	4	0.043474	yes	BRNCTXB
chr1_1367722_TTTTA_T_b38	ATAD3C	-2.95	0.00375	-0.128245	4	0.043474	yes	BRNCTXB
chr1_1367874_A_T_b38	ATAD3C	-2.95	0.00375	-0.128245	4	0.043474	yes	BRNCTXB
chr1_1367028_A_G_b38	ATAD3C	2.941	0.00385	0.143316	4	0.048722	yes	BRNCTXB
chr1_1545795_C_A_b38	ATAD3C	-2.933	0.00395	-0.105482	20	0.035969	yes	BRNCTXB
chr1_1571794_A_AT_b38	ATAD3C	-2.919	0.00412	-0.106536	24	0.036494	yes	BRNCTXB
chr1_1572532_A_C_b38	ATAD3C	-2.916	0.00416	-0.103644	27	0.035544	yes	BRNCTXB
chr1_1573079_A_G_b38	ATAD3C	-2.916	0.00416	-0.103644	27	0.035544	yes	BRNCTXB
chr1_1366187_A_AGT_b38	ATAD3C	-2.916	0.00416	-0.126079	4	0.04324	yes	BRNCTXB
chr1_1501260_A_AT_b38	ATAD3C	-2.912	0.00421	-0.136	7	0.046705	yes	BRNCTXB
chr1_1363880_A_G_b38	ATAD3C	-2.9	0.00437	-0.125945	4	0.043432	yes	BRNCTXB
chr1_1367919_C_T_b38	ATAD3C	-2.9	0.00437	-0.122554	5	0.042265	yes	BRNCTXB
chr1_1367951_C_T_b38	ATAD3C	-2.9	0.00437	-0.122554	5	0.042265	yes	BRNCTXB
chr1_1367965_A_G_b38	ATAD3C	-2.9	0.00437	-0.122554	5	0.042265	yes	BRNCTXB
chr1_1367970_T_G_b38	ATAD3C	-2.9	0.00437	-0.122554	5	0.042265	yes	BRNCTXB
chr1_1367994_C_A_b38	ATAD3C	-2.9	0.00437	-0.122554	5	0.042265	yes	BRNCTXB
chr1_1368297_C_T_b38	ATAD3C	-2.9	0.00437	-0.122554	5	0.042265	yes	BRNCTXB
chr1_1368514_C_G_b38	ATAD3C	-2.9	0.00437	-0.122554	5	0.042265	yes	BRNCTXB
chr1_1368991_C_T_b38	ATAD3C	-2.9	0.00437	-0.122554	5	0.042265	yes	BRNCTXB
chr1_1369009_T_C_b38	ATAD3C	-2.9	0.00437	-0.122554	5	0.042265	yes	BRNCTXB
chr1_1369012_C_CG_b38	ATAD3C	-2.9	0.00437	-0.122554	5	0.042265	yes	BRNCTXB
chr1_1367388_T_TTGG_b38	ATAD3C	-2.899	0.00437	-0.126737	4	0.043715	yes	BRNCTXB
chr1_1369821_C_T_b38	ATAD3C	-2.852	0.00503	-0.119914	5	0.042042	yes	BRNCTXB
chr1_1549590_C_G_b38	ATAD3C	-2.85	0.00506	-0.101386	26	0.035572	yes	BRNCTXB
chr1_1553692_A_G_b38	ATAD3C	-2.85	0.00506	-0.101386	26	0.035572	yes	BRNCTXB
chr1_1554694_A_G_b38	ATAD3C	-2.85	0.00506	-0.101386	26	0.035572	yes	BRNCTXB
chr1_1554781_A_G_b38	ATAD3C	-2.85	0.00506	-0.101386	26	0.035572	yes	BRNCTXB
chr1_1555247_T_A_b38	ATAD3C	-2.85	0.00506	-0.101386	26	0.035572	yes	BRNCTXB
chr1_1569180_T_A_b38	ATAD3C	-2.821	0.00551	-0.104098	26	0.0369	yes	BRNCTXB
chr1_1547630_G_A_b38	ATAD3C	-2.821	0.00552	-0.097444	23	0.034545	yes	BRNCTXB
chr1_1551454_C_A_b38	ATAD3C	-2.806	0.00577	-0.09421	47	0.033579	yes	BRNCTXB
chr1_1565105_CAAGGCAGGCGGATCATG_C_b38	ATAD3C	-2.796	0.00594	-0.101105	28	0.036163	yes	BRNCTXB
chr1_1367511_ATGAG_A_b38	ATAD3C	-2.776	0.00629	-0.125161	3	0.045085	yes	BRNCTXB
chr1_1577491_A_AC_b38	ATAD3C	-2.746	0.00687	-0.099182	27	0.036124	yes	BRNCTXB
chr1_1290841_A_G_b38	ATAD3C	-2.726	0.00726	-0.111717	11	0.040976	yes	BRNCTXB
chr1_1567912_C_CAAAAAAAA_b38	ATAD3C	-2.71	0.00761	-0.159832	3	0.05898	yes	BRNCTXB
chr1_1550064_GC_G_b38	ATAD3C	-2.687	0.00812	-0.098593	23	0.036689	yes	BRNCTXB
chr1_1550068_C_A_b38	ATAD3C	-2.687	0.00812	-0.098593	23	0.036689	yes	BRNCTXB
chr1_2337131_A_G_b38	ATAD3C	2.683	0.00821	0.093578	21	0.034872	yes	BRNCTXB
chr1_1363438_C_CTT_b38	ATAD3C	2.66	0.00877	0.091896	18	0.034549	yes	BRNCTXB
chr1_1201373_T_C_b38	ATAD3C	-2.657	0.00883	-0.117473	11	0.044205	yes	BRNCTXB
chr1_2120839_CT_C_b38	ATAD3C	2.649	0.00904	0.105724	9	0.039906	yes	BRNCTXB
chr1_1301426_A_AT_b38	ATAD3C	-2.646	0.00913	-0.12001	7	0.045359	yes	BRNCTXB
chr1_1184277_G_C_b38	ATAD3C	-2.637	0.00935	-0.090657	30	0.034377	yes	BRNCTXB
chr1_1368177_G_C_b38	ATAD3C	-2.635	0.00941	-0.113878	5	0.043218	yes	BRNCTXB
chr1_1554852_T_C_b38	ATAD3C	-2.634	0.00943	-0.093458	26	0.035479	yes	BRNCTXB
chr1_2148243_A_G_b38	ATAD3C	2.633	0.00945	0.10543	6	0.040036	yes	BRNCTXB
chr1_1518621_A_AC_b38	ATAD3C	-2.63	0.00953	-0.123694	6	0.04703	yes	BRNCTXB
chr1_2106796_TGACTCTTCAGCAGGCCCCTCTGGTGGGCGAGGACCTCCACACGTGTCACCAGGCCAGGC_T_b38	ATAD3C	3.501	0.00063	0.151777	6	0.043355	no	BRNCTXB
chr1_1499339_T_C_b38	ATAD3C	-3.15	0.00202	-0.215338	3	0.068369	no	BRNCTXB
chr1_1363456_CAG_C_b38	ATAD3C	3.104	0.00233	0.10331	15	0.033286	no	BRNCTXB
chr1_2312125_G_A_b38	ATAD3C	-3.04	0.00284	-0.095042	40	0.031262	no	BRNCTXB
chr1_1814815_A_AAAAAAG_b38	ATAD3C	-3.008	0.00314	-0.137799	8	0.045815	no	BRNCTXB
chr1_1773711_T_TGAGA_b38	ATAD3C	2.994	0.00328	0.161012	3	0.053774	no	BRNCTXB
chr1_1514211_A_G_b38	ATAD3C	-2.966	0.00357	-0.225266	3	0.075938	no	BRNCTXB
chr1_1421170_A_G_b38	ATAD3C	-2.884	0.00457	-0.16951	9	0.058767	no	BRNCTXB
chr1_1362790_A_ATT_b38	ATAD3C	2.878	0.00466	0.131265	3	0.045613	no	BRNCTXB
chr1_1889659_T_TA_b38	ATAD3C	2.859	0.00493	0.108401	11	0.037914	no	BRNCTXB
chr1_1515567_A_C_b38	ATAD3C	-2.81	0.0057	-0.197578	8	0.070321	no	BRNCTXB
chr1_1522905_A_G_b38	ATAD3C	-2.785	0.00614	-0.180969	9	0.064989	no	BRNCTXB
chr1_1190043_C_T_b38	ATAD3C	-2.759	0.00661	-0.173153	4	0.062763	no	BRNCTXB
chr1_1362780_CAAA_C_b38	ATAD3C	2.723	0.00734	0.125665	3	0.046156	no	BRNCTXB
chr1_2098568_CCT_C_b38	ATAD3C	2.712	0.00756	0.096589	25	0.035613	no	BRNCTXB
chr1_1428999_C_CA_b38	ATAD3C	-2.712	0.00757	-0.108668	9	0.040072	no	BRNCTXB
chr1_1520875_A_G_b38	ATAD3C	-2.704	0.00775	-0.18068	9	0.066826	no	BRNCTXB
chr1_1521518_G_A_b38	ATAD3C	-2.704	0.00775	-0.18068	9	0.066826	no	BRNCTXB
chr1_1524202_G_A_b38	ATAD3C	-2.704	0.00775	-0.18068	9	0.066826	no	BRNCTXB
chr1_1533018_T_C_b38	ATAD3C	-2.704	0.00775	-0.18068	9	0.066826	no	BRNCTXB
chr1_2093604_C_T_b38	ATAD3C	2.676	0.00837	0.092318	21	0.034492	no	BRNCTXB
chr1_1195280_C_T_b38	ATAD3C	-2.633	0.00947	-0.171727	4	0.065229	no	BRNCTXB
chr1_1171093_G_A_b38	ATAD3C	-2.63	0.00954	-0.107479	13	0.040867	no	BRNCTXB
chr1_1523187_A_G_b38	ATAD3C	-2.614	0.00998	-0.167015	11	0.063897	no	BRNCTXB
chr1_2101945_G_C_b38	ATAD3C	2.613	0.00999	0.092301	24	0.035319	no	BRNCTXB
chr1_1443457_T_C_b38	ATAD3C	-9.611	1.11e-16	-0.356848	23	0.037129	yes	BRNHPP
chr1_1440834_C_G_b38	ATAD3C	-9.138	1.53e-15	-0.343285	22	0.037567	yes	BRNHPP
chr1_1433374_T_C_b38	ATAD3C	-8.773	1.14e-14	-0.328019	24	0.037392	yes	BRNHPP
chr1_1436388_CA_C_b38	ATAD3C	-8.471	5.91e-14	-0.333589	16	0.039379	yes	BRNHPP
chr1_1440430_C_G_b38	ATAD3C	-8.439	7.02e-14	-0.320368	16	0.037961	yes	BRNHPP
chr1_1436079_A_G_b38	ATAD3C	-8.337	1.22e-13	-0.32265	22	0.038699	yes	BRNHPP
chr1_1428969_T_C_b38	ATAD3C	-8.101	4.37e-13	-0.340659	19	0.04205	yes	BRNHPP
chr1_1441187_A_G_b38	ATAD3C	-7.854	1.64e-12	-0.317609	18	0.040438	yes	BRNHPP
chr1_1430908_A_G_b38	ATAD3C	-7.752	2.83e-12	-0.337586	19	0.043551	yes	BRNHPP
chr1_1430190_A_C_b38	ATAD3C	-7.681	4.12e-12	-0.330575	19	0.043041	yes	BRNHPP
chr1_1445187_T_G_b38	ATAD3C	-7.647	4.92e-12	-0.310153	21	0.040559	yes	BRNHPP
chr1_1445240_A_G_b38	ATAD3C	-7.647	4.92e-12	-0.310153	21	0.040559	yes	BRNHPP
chr1_1431450_A_G_b38	ATAD3C	-7.586	6.79e-12	-0.32709	19	0.043118	yes	BRNHPP
chr1_1431537_G_C_b38	ATAD3C	-7.586	6.79e-12	-0.32709	19	0.043118	yes	BRNHPP
chr1_1439454_A_G_b38	ATAD3C	-7.509	1.02e-11	-0.286955	23	0.038214	yes	BRNHPP
chr1_1448915_G_A_b38	ATAD3C	-7.31	2.88e-11	-0.3082	17	0.042161	yes	BRNHPP
chr1_1432355_G_A_b38	ATAD3C	-7.267	3.6e-11	-0.320636	8	0.044123	yes	BRNHPP
chr1_1431014_G_A_b38	ATAD3C	-7.216	4.67e-11	-0.304064	10	0.042135	yes	BRNHPP
chr1_1426261_C_T_b38	ATAD3C	-7.019	1.29e-10	-0.317517	18	0.045234	yes	BRNHPP
chr1_1426810_C_G_b38	ATAD3C	-7.019	1.29e-10	-0.317517	18	0.045234	yes	BRNHPP
chr1_1438102_G_C_b38	ATAD3C	-6.661	7.93e-10	-0.291208	9	0.04372	yes	BRNHPP
chr1_1431026_CCACCCCCT_C_b38	ATAD3C	-6.647	8.51e-10	-0.302508	10	0.045512	yes	BRNHPP
chr1_1442793_G_A_b38	ATAD3C	-6.551	1.37e-09	-0.298383	7	0.045545	yes	BRNHPP
chr1_1449831_A_G_b38	ATAD3C	-6.426	2.55e-09	-0.297445	20	0.046289	yes	BRNHPP
chr1_1451787_A_C_b38	ATAD3C	-6.341	3.87e-09	-0.272987	15	0.043052	yes	BRNHPP
chr1_1454315_C_T_b38	ATAD3C	-6.313	4.44e-09	-0.279919	18	0.044341	yes	BRNHPP
chr1_1435945_C_CCGGGCGGGGGCG_b38	ATAD3C	-6.238	6.39e-09	-0.290591	6	0.046583	yes	BRNHPP
chr1_1452511_A_G_b38	ATAD3C	-6.159	9.39e-09	-0.276625	20	0.044916	yes	BRNHPP
chr1_1452888_C_A_b38	ATAD3C	-6.159	9.39e-09	-0.276625	20	0.044916	yes	BRNHPP
chr1_1452909_A_C_b38	ATAD3C	-6.159	9.39e-09	-0.276625	20	0.044916	yes	BRNHPP
chr1_1454092_A_G_b38	ATAD3C	-6.159	9.39e-09	-0.276625	20	0.044916	yes	BRNHPP
chr1_1455617_T_G_b38	ATAD3C	-6.159	9.39e-09	-0.276625	20	0.044916	yes	BRNHPP
chr1_1453703_A_G_b38	ATAD3C	-6.158	9.42e-09	-0.27733	20	0.045035	yes	BRNHPP
chr1_1434687_C_G_b38	ATAD3C	-6.154	9.63e-09	-0.288011	6	0.046804	yes	BRNHPP
chr1_1449009_A_T_b38	ATAD3C	-6.138	1.04e-08	-0.309984	12	0.0505	yes	BRNHPP
chr1_1439805_G_C_b38	ATAD3C	-6.104	1.22e-08	-0.279323	8	0.045757	yes	BRNHPP
chr1_1452825_AAAG_A_b38	ATAD3C	-6.035	1.71e-08	-0.27533	14	0.045624	yes	BRNHPP
chr1_1453552_G_A_b38	ATAD3C	-6.035	1.71e-08	-0.27533	14	0.045624	yes	BRNHPP
chr1_1455134_T_G_b38	ATAD3C	-6.035	1.71e-08	-0.27533	14	0.045624	yes	BRNHPP
chr1_1455337_A_G_b38	ATAD3C	-6.035	1.71e-08	-0.27533	14	0.045624	yes	BRNHPP
chr1_1455495_C_T_b38	ATAD3C	-6.035	1.71e-08	-0.27533	14	0.045624	yes	BRNHPP
chr1_1455924_T_C_b38	ATAD3C	-6.035	1.71e-08	-0.27533	14	0.045624	yes	BRNHPP
chr1_1456051_C_T_b38	ATAD3C	-6.035	1.71e-08	-0.27533	14	0.045624	yes	BRNHPP
chr1_1456154_G_A_b38	ATAD3C	-5.95	2.55e-08	-0.273573	14	0.045976	yes	BRNHPP
chr1_1456079_T_C_b38	ATAD3C	-5.925	2.87e-08	-0.272205	14	0.04594	yes	BRNHPP
chr1_1454848_T_C_b38	ATAD3C	-5.903	3.2e-08	-0.266635	14	0.045172	yes	BRNHPP
chr1_1454770_T_C_b38	ATAD3C	-5.881	3.54e-08	-0.266155	20	0.045256	yes	BRNHPP
chr1_1456217_T_C_b38	ATAD3C	-5.862	3.87e-08	-0.268617	19	0.045823	yes	BRNHPP
chr1_1431656_G_A_b38	ATAD3C	-5.77	5.98e-08	-0.289157	4	0.050118	yes	BRNHPP
chr1_1431813_G_T_b38	ATAD3C	-5.638	1.1e-07	-0.271887	6	0.048226	yes	BRNHPP
chr1_1375642_C_T_b38	ATAD3C	-5.59	1.37e-07	-0.288921	4	0.051684	yes	BRNHPP
chr1_1383743_T_C_b38	ATAD3C	-5.59	1.37e-07	-0.288921	4	0.051684	yes	BRNHPP
chr1_1452540_G_A_b38	ATAD3C	-5.586	1.4e-07	-0.249358	12	0.044641	yes	BRNHPP
chr1_1316929_A_T_b38	ATAD3C	-5.481	2.26e-07	-0.262354	7	0.047862	yes	BRNHPP
chr1_1308178_GGGGCGCGGGGA_G_b38	ATAD3C	-5.475	2.33e-07	-0.259324	7	0.047366	yes	BRNHPP
chr1_1456182_G_A_b38	ATAD3C	-5.46	2.49e-07	-0.250566	15	0.04589	yes	BRNHPP
chr1_1457033_A_C_b38	ATAD3C	-5.445	2.66e-07	-0.248668	12	0.045666	yes	BRNHPP
chr1_1394041_G_A_b38	ATAD3C	-5.43	2.85e-07	-0.299875	3	0.055224	yes	BRNHPP
chr1_1451968_C_T_b38	ATAD3C	-5.404	3.21e-07	-0.248845	11	0.046047	yes	BRNHPP
chr1_1402457_A_G_b38	ATAD3C	-5.359	3.92e-07	-0.254309	19	0.047451	yes	BRNHPP
chr1_1387698_A_G_b38	ATAD3C	5.359	3.92e-07	0.254309	19	0.047451	yes	BRNHPP
chr1_1309988_G_A_b38	ATAD3C	5.341	4.27e-07	0.24562	21	0.045992	yes	BRNHPP
chr1_1312114_T_C_b38	ATAD3C	5.341	4.27e-07	0.24562	21	0.045992	yes	BRNHPP
chr1_1313807_G_A_b38	ATAD3C	5.341	4.27e-07	0.24562	21	0.045992	yes	BRNHPP
chr1_1374505_A_G_b38	ATAD3C	-5.321	4.65e-07	-0.275599	4	0.051791	yes	BRNHPP
chr1_1325753_G_T_b38	ATAD3C	-5.307	4.96e-07	-0.298769	3	0.056299	yes	BRNHPP
chr1_1358384_G_C_b38	ATAD3C	5.306	4.98e-07	0.251607	19	0.04742	yes	BRNHPP
chr1_1380867_A_G_b38	ATAD3C	-5.303	5.04e-07	-0.274886	4	0.051833	yes	BRNHPP
chr1_1384546_C_T_b38	ATAD3C	-5.303	5.04e-07	-0.274886	4	0.051833	yes	BRNHPP
chr1_1398218_C_A_b38	ATAD3C	-5.303	5.04e-07	-0.274886	4	0.051833	yes	BRNHPP
chr1_1400756_GGA_G_b38	ATAD3C	-5.303	5.04e-07	-0.274886	4	0.051833	yes	BRNHPP
chr1_1401954_G_T_b38	ATAD3C	-5.303	5.04e-07	-0.274886	4	0.051833	yes	BRNHPP
chr1_1403593_A_G_b38	ATAD3C	-5.303	5.04e-07	-0.274886	4	0.051833	yes	BRNHPP
chr1_1407565_C_A_b38	ATAD3C	-5.303	5.04e-07	-0.274886	4	0.051833	yes	BRNHPP
chr1_1308516_C_T_b38	ATAD3C	5.299	5.14e-07	0.244456	21	0.046135	yes	BRNHPP
chr1_1370113_A_G_b38	ATAD3C	5.282	5.54e-07	0.234899	16	0.044469	yes	BRNHPP
chr1_1426253_G_A_b38	ATAD3C	-5.259	6.14e-07	-0.278146	3	0.052891	yes	BRNHPP
chr1_1456829_G_C_b38	ATAD3C	-5.252	6.34e-07	-0.241501	16	0.045985	yes	BRNHPP
chr1_1452797_CAA_C_b38	ATAD3C	-5.246	6.52e-07	-0.259833	9	0.049533	yes	BRNHPP
chr1_1303112_G_A_b38	ATAD3C	-5.246	6.52e-07	-0.284655	4	0.054265	yes	BRNHPP
chr1_1303800_G_A_b38	ATAD3C	-5.246	6.52e-07	-0.284655	4	0.054265	yes	BRNHPP
chr1_1304555_A_C_b38	ATAD3C	-5.246	6.52e-07	-0.284655	4	0.054265	yes	BRNHPP
chr1_1451028_T_A_b38	ATAD3C	-5.226	7.11e-07	-0.257148	6	0.049206	yes	BRNHPP
chr1_1382893_G_A_b38	ATAD3C	-5.225	7.15e-07	-0.273447	4	0.052336	yes	BRNHPP
chr1_1453870_A_C_b38	ATAD3C	-5.172	9.01e-07	-0.260893	5	0.05044	yes	BRNHPP
chr1_1453961_C_T_b38	ATAD3C	-5.172	9.01e-07	-0.260893	5	0.05044	yes	BRNHPP
chr1_1452346_A_G_b38	ATAD3C	-5.166	9.27e-07	-0.244042	7	0.047241	yes	BRNHPP
chr1_1411323_A_C_b38	ATAD3C	-5.114	1.16e-06	-0.245151	19	0.047936	yes	BRNHPP
chr1_1372909_G_A_b38	ATAD3C	-5.09	1.29e-06	-0.266547	4	0.052372	yes	BRNHPP
chr1_1379093_TG_T_b38	ATAD3C	-5.078	1.36e-06	-0.279559	3	0.055053	yes	BRNHPP
chr1_1329973_GCGTGTGCCATGCA_G_b38	ATAD3C	-5.07	1.41e-06	-0.265686	4	0.052401	yes	BRNHPP
chr1_1341550_GCA_G_b38	ATAD3C	-5.07	1.41e-06	-0.265686	4	0.052401	yes	BRNHPP
chr1_1344048_G_A_b38	ATAD3C	-5.07	1.41e-06	-0.265686	4	0.052401	yes	BRNHPP
chr1_1364253_C_G_b38	ATAD3C	-5.07	1.41e-06	-0.265686	4	0.052401	yes	BRNHPP
chr1_1337898_A_G_b38	ATAD3C	5.07	1.41e-06	0.228791	10	0.04513	yes	BRNHPP
chr1_1394423_A_G_b38	ATAD3C	-5.048	1.55e-06	-0.238244	18	0.0472	yes	BRNHPP
chr1_1395346_A_G_b38	ATAD3C	-5.048	1.55e-06	-0.238244	18	0.0472	yes	BRNHPP
chr1_1389827_C_T_b38	ATAD3C	5.048	1.55e-06	0.238244	18	0.0472	yes	BRNHPP
chr1_1450636_A_G_b38	ATAD3C	-5.022	1.73e-06	-0.253832	5	0.050541	yes	BRNHPP
chr1_1456891_T_C_b38	ATAD3C	-5.009	1.83e-06	-0.234647	17	0.046842	yes	BRNHPP
chr1_1366561_AGT_A_b38	ATAD3C	4.996	1.95e-06	0.235542	18	0.047151	yes	BRNHPP
chr1_1366427_AGTGTGATTGAATGAGT_A_b38	ATAD3C	4.986	2.03e-06	0.235281	14	0.047186	yes	BRNHPP
chr1_1452384_G_A_b38	ATAD3C	-4.986	2.03e-06	-0.236023	7	0.047339	yes	BRNHPP
chr1_1330125_G_A_b38	ATAD3C	4.974	2.13e-06	0.240992	19	0.048449	yes	BRNHPP
chr1_1363898_C_T_b38	ATAD3C	4.959	2.28e-06	0.249386	5	0.050294	yes	BRNHPP
chr1_1363986_C_T_b38	ATAD3C	4.959	2.28e-06	0.249386	5	0.050294	yes	BRNHPP
chr1_1365566_G_A_b38	ATAD3C	4.959	2.28e-06	0.249386	5	0.050294	yes	BRNHPP
chr1_1366529_TTAG_T_b38	ATAD3C	4.959	2.28e-06	0.249386	5	0.050294	yes	BRNHPP
chr1_1367292_A_AGT_b38	ATAD3C	4.959	2.28e-06	0.249386	5	0.050294	yes	BRNHPP
chr1_1407232_G_C_b38	ATAD3C	-4.948	2.39e-06	-0.240312	7	0.048571	yes	BRNHPP
chr1_1370553_CAAA_C_b38	ATAD3C	-4.88	3.2e-06	-0.280103	3	0.057403	yes	BRNHPP
chr1_1379083_AT_A_b38	ATAD3C	4.839	3.79e-06	0.218661	12	0.045185	yes	BRNHPP
chr1_1379091_T_G_b38	ATAD3C	4.809	4.32e-06	0.247656	4	0.051503	yes	BRNHPP
chr1_1457071_C_T_b38	ATAD3C	-4.786	4.74e-06	-0.219073	16	0.04577	yes	BRNHPP
chr1_1363688_C_T_b38	ATAD3C	-4.715	6.4e-06	-0.25226	4	0.053503	yes	BRNHPP
chr1_1364099_CCA_C_b38	ATAD3C	-4.715	6.4e-06	-0.25226	4	0.053503	yes	BRNHPP
chr1_1364102_TGTTG_T_b38	ATAD3C	-4.715	6.4e-06	-0.25226	4	0.053503	yes	BRNHPP
chr1_1366511_GGTGA_G_b38	ATAD3C	-4.689	7.12e-06	-0.250914	4	0.053511	yes	BRNHPP
chr1_1376162_G_C_b38	ATAD3C	4.681	7.36e-06	0.222639	16	0.047564	yes	BRNHPP
chr1_1377431_C_T_b38	ATAD3C	4.681	7.36e-06	0.222639	16	0.047564	yes	BRNHPP
chr1_1400410_A_G_b38	ATAD3C	-4.66	8.03e-06	-0.22147	15	0.047525	yes	BRNHPP
chr1_1368763_G_A_b38	ATAD3C	-4.629	9.11e-06	-0.241668	5	0.052204	yes	BRNHPP
chr1_1471992_T_C_b38	ATAD3C	-4.614	9.71e-06	-0.217817	21	0.047209	yes	BRNHPP
chr1_1384749_C_G_b38	ATAD3C	4.581	1.11e-05	0.218922	16	0.047791	yes	BRNHPP
chr1_1387763_CCT_C_b38	ATAD3C	4.581	1.11e-05	0.218922	16	0.047791	yes	BRNHPP
chr1_1388944_G_A_b38	ATAD3C	4.581	1.11e-05	0.218922	16	0.047791	yes	BRNHPP
chr1_1367280_T_A_b38	ATAD3C	-4.563	1.2e-05	-0.242684	4	0.053189	yes	BRNHPP
chr1_1367028_A_G_b38	ATAD3C	4.545	1.29e-05	0.285005	3	0.062709	yes	BRNHPP
chr1_1361679_G_A_b38	ATAD3C	4.522	1.41e-05	0.228942	10	0.050629	yes	BRNHPP
chr1_1437955_C_G_b38	ATAD3C	-4.503	1.53e-05	-0.181776	20	0.040368	yes	BRNHPP
chr1_1302795_T_TC_b38	ATAD3C	4.488	1.62e-05	0.245708	21	0.054744	yes	BRNHPP
chr1_1364282_T_G_b38	ATAD3C	-4.471	1.74e-05	-0.239136	4	0.053488	yes	BRNHPP
chr1_1364357_A_C_b38	ATAD3C	-4.471	1.74e-05	-0.239136	4	0.053488	yes	BRNHPP
chr1_1364566_T_C_b38	ATAD3C	-4.471	1.74e-05	-0.239136	4	0.053488	yes	BRNHPP
chr1_1364694_T_C_b38	ATAD3C	-4.471	1.74e-05	-0.239136	4	0.053488	yes	BRNHPP
chr1_1364721_C_T_b38	ATAD3C	-4.471	1.74e-05	-0.239136	4	0.053488	yes	BRNHPP
chr1_1365160_A_G_b38	ATAD3C	-4.471	1.74e-05	-0.239136	4	0.053488	yes	BRNHPP
chr1_1365198_C_T_b38	ATAD3C	-4.471	1.74e-05	-0.239136	4	0.053488	yes	BRNHPP
chr1_1366008_A_G_b38	ATAD3C	-4.471	1.74e-05	-0.239136	4	0.053488	yes	BRNHPP
chr1_1366062_T_C_b38	ATAD3C	-4.471	1.74e-05	-0.239136	4	0.053488	yes	BRNHPP
chr1_1366145_TGTGAA_T_b38	ATAD3C	-4.471	1.74e-05	-0.239136	4	0.053488	yes	BRNHPP
chr1_1366187_A_AGT_b38	ATAD3C	-4.471	1.74e-05	-0.239136	4	0.053488	yes	BRNHPP
chr1_1366292_G_T_b38	ATAD3C	-4.471	1.74e-05	-0.239136	4	0.053488	yes	BRNHPP
chr1_1366321_TGTGTGTAAATGG_T_b38	ATAD3C	-4.471	1.74e-05	-0.239136	4	0.053488	yes	BRNHPP
chr1_1366453_G_T_b38	ATAD3C	-4.471	1.74e-05	-0.239136	4	0.053488	yes	BRNHPP
chr1_1366726_T_G_b38	ATAD3C	-4.471	1.74e-05	-0.239136	4	0.053488	yes	BRNHPP
chr1_1367258_T_A_b38	ATAD3C	-4.471	1.74e-05	-0.239136	4	0.053488	yes	BRNHPP
chr1_1367268_TGA_T_b38	ATAD3C	-4.471	1.74e-05	-0.239136	4	0.053488	yes	BRNHPP
chr1_1367297_GAA_G_b38	ATAD3C	-4.471	1.74e-05	-0.239136	4	0.053488	yes	BRNHPP
chr1_1367300_T_TGA_b38	ATAD3C	-4.471	1.74e-05	-0.239136	4	0.053488	yes	BRNHPP
chr1_1367329_A_AGT_b38	ATAD3C	-4.471	1.74e-05	-0.239136	4	0.053488	yes	BRNHPP
chr1_1367373_T_TGTG_b38	ATAD3C	-4.471	1.74e-05	-0.239136	4	0.053488	yes	BRNHPP
chr1_1367388_T_TTGG_b38	ATAD3C	-4.471	1.74e-05	-0.239136	4	0.053488	yes	BRNHPP
chr1_1367462_T_C_b38	ATAD3C	-4.471	1.74e-05	-0.239136	4	0.053488	yes	BRNHPP
chr1_1367593_G_A_b38	ATAD3C	-4.471	1.74e-05	-0.239136	4	0.053488	yes	BRNHPP
chr1_1367602_GT_G_b38	ATAD3C	-4.471	1.74e-05	-0.239136	4	0.053488	yes	BRNHPP
chr1_1367605_GAGTGAGTGTA_G_b38	ATAD3C	-4.471	1.74e-05	-0.239136	4	0.053488	yes	BRNHPP
chr1_1367670_GGTGA_G_b38	ATAD3C	-4.471	1.74e-05	-0.239136	4	0.053488	yes	BRNHPP
chr1_1367722_TTTTA_T_b38	ATAD3C	-4.471	1.74e-05	-0.239136	4	0.053488	yes	BRNHPP
chr1_1367874_A_T_b38	ATAD3C	-4.471	1.74e-05	-0.239136	4	0.053488	yes	BRNHPP
chr1_1370181_C_T_b38	ATAD3C	-4.471	1.74e-05	-0.239136	4	0.053488	yes	BRNHPP
chr1_1370317_G_C_b38	ATAD3C	-4.471	1.74e-05	-0.239136	4	0.053488	yes	BRNHPP
chr1_1370320_A_G_b38	ATAD3C	-4.471	1.74e-05	-0.239136	4	0.053488	yes	BRNHPP
chr1_1370430_T_C_b38	ATAD3C	-4.471	1.74e-05	-0.239136	4	0.053488	yes	BRNHPP
chr1_1370532_C_T_b38	ATAD3C	-4.471	1.74e-05	-0.239136	4	0.053488	yes	BRNHPP
chr1_1370584_G_C_b38	ATAD3C	-4.471	1.74e-05	-0.239136	4	0.053488	yes	BRNHPP
chr1_1378204_G_C_b38	ATAD3C	4.467	1.76e-05	0.209379	17	0.046872	yes	BRNHPP
chr1_1447108_A_ATT_b38	ATAD3C	-4.464	1.79e-05	-0.224684	10	0.050337	yes	BRNHPP
chr1_1453643_A_ATT_b38	ATAD3C	-4.461	1.81e-05	-0.216948	11	0.048635	yes	BRNHPP
chr1_1369803_C_CT_b38	ATAD3C	-4.427	2.07e-05	-0.220603	6	0.049828	yes	BRNHPP
chr1_1363880_A_G_b38	ATAD3C	-4.412	2.2e-05	-0.235698	4	0.053422	yes	BRNHPP
chr1_1367919_C_T_b38	ATAD3C	-4.399	2.32e-05	-0.229703	5	0.05222	yes	BRNHPP
chr1_1367951_C_T_b38	ATAD3C	-4.399	2.32e-05	-0.229703	5	0.05222	yes	BRNHPP
chr1_1367965_A_G_b38	ATAD3C	-4.399	2.32e-05	-0.229703	5	0.05222	yes	BRNHPP
chr1_1367970_T_G_b38	ATAD3C	-4.399	2.32e-05	-0.229703	5	0.05222	yes	BRNHPP
chr1_1367994_C_A_b38	ATAD3C	-4.399	2.32e-05	-0.229703	5	0.05222	yes	BRNHPP
chr1_1368297_C_T_b38	ATAD3C	-4.399	2.32e-05	-0.229703	5	0.05222	yes	BRNHPP
chr1_1368514_C_G_b38	ATAD3C	-4.399	2.32e-05	-0.229703	5	0.05222	yes	BRNHPP
chr1_1368991_C_T_b38	ATAD3C	-4.399	2.32e-05	-0.229703	5	0.05222	yes	BRNHPP
chr1_1369009_T_C_b38	ATAD3C	-4.399	2.32e-05	-0.229703	5	0.05222	yes	BRNHPP
chr1_1369012_C_CG_b38	ATAD3C	-4.399	2.32e-05	-0.229703	5	0.05222	yes	BRNHPP
chr1_1369282_G_A_b38	ATAD3C	-4.399	2.32e-05	-0.229703	5	0.05222	yes	BRNHPP
chr1_1369320_GT_G_b38	ATAD3C	-4.399	2.32e-05	-0.229703	5	0.05222	yes	BRNHPP
chr1_1369407_G_A_b38	ATAD3C	-4.399	2.32e-05	-0.229703	5	0.05222	yes	BRNHPP
chr1_1369476_CTT_C_b38	ATAD3C	-4.399	2.32e-05	-0.229703	5	0.05222	yes	BRNHPP
chr1_1369556_C_G_b38	ATAD3C	-4.399	2.32e-05	-0.229703	5	0.05222	yes	BRNHPP
chr1_1369627_T_C_b38	ATAD3C	-4.399	2.32e-05	-0.229703	5	0.05222	yes	BRNHPP
chr1_1369686_T_C_b38	ATAD3C	-4.399	2.32e-05	-0.229703	5	0.05222	yes	BRNHPP
chr1_1369716_G_C_b38	ATAD3C	-4.399	2.32e-05	-0.229703	5	0.05222	yes	BRNHPP
chr1_1369741_C_T_b38	ATAD3C	-4.399	2.32e-05	-0.229703	5	0.05222	yes	BRNHPP
chr1_1398056_C_A_b38	ATAD3C	-4.282	3.67e-05	-0.182558	20	0.042629	yes	BRNHPP
chr1_1369821_C_T_b38	ATAD3C	-4.243	4.28e-05	-0.222651	5	0.052473	yes	BRNHPP
chr1_1533883_G_T_b38	ATAD3C	-4.242	4.3e-05	-0.338065	5	0.079695	yes	BRNHPP
chr1_1437993_G_A_b38	ATAD3C	-4.225	4.58e-05	-0.197604	9	0.046766	yes	BRNHPP
chr1_1367511_ATGAG_A_b38	ATAD3C	-4.167	5.75e-05	-0.230528	3	0.055326	yes	BRNHPP
chr1_1573654_T_C_b38	ATAD3C	-4.084	7.89e-05	-0.184388	27	0.045153	yes	BRNHPP
chr1_1574445_A_G_b38	ATAD3C	-4.084	7.89e-05	-0.184388	27	0.045153	yes	BRNHPP
chr1_1363438_C_CTT_b38	ATAD3C	4.009	0.000105	0.177772	16	0.044349	yes	BRNHPP
chr1_1366681_T_TGA_b38	ATAD3C	-3.999	0.000109	-0.218099	4	0.054545	yes	BRNHPP
chr1_1575421_C_T_b38	ATAD3C	-3.958	0.000126	-0.178032	26	0.044979	yes	BRNHPP
chr1_1558726_C_CA_b38	ATAD3C	-3.926	0.000142	-0.181847	26	0.046315	yes	BRNHPP
chr1_1561821_A_C_b38	ATAD3C	-3.926	0.000142	-0.181847	26	0.046315	yes	BRNHPP
chr1_1551557_A_AG_b38	ATAD3C	-3.902	0.000156	-0.180922	25	0.046367	yes	BRNHPP
chr1_1551559_A_T_b38	ATAD3C	-3.902	0.000156	-0.180922	25	0.046367	yes	BRNHPP
chr1_1541864_T_C_b38	ATAD3C	-3.872	0.000174	-0.182233	25	0.047063	yes	BRNHPP
chr1_1517993_A_G_b38	ATAD3C	-3.87	0.000175	-0.173709	25	0.044886	yes	BRNHPP
chr1_1575724_G_C_b38	ATAD3C	-3.869	0.000176	-0.174044	26	0.044989	yes	BRNHPP
chr1_1361685_C_T_b38	ATAD3C	-3.867	0.000177	-0.209608	9	0.054206	yes	BRNHPP
chr1_1557495_CAT_C_b38	ATAD3C	-3.853	0.000186	-0.179119	26	0.04649	yes	BRNHPP
chr1_1251122_A_T_b38	ATAD3C	-3.852	0.000187	-0.227931	9	0.059173	yes	BRNHPP
chr1_1217251_C_A_b38	ATAD3C	-3.839	0.000196	-0.228132	5	0.05942	yes	BRNHPP
chr1_1366776_G_GAATT_b38	ATAD3C	-3.813	0.000215	-0.212783	4	0.055798	yes	BRNHPP
chr1_1368177_G_C_b38	ATAD3C	-3.805	0.000222	-0.204038	5	0.053625	yes	BRNHPP
chr1_1577491_A_AC_b38	ATAD3C	-3.803	0.000223	-0.175855	28	0.046245	yes	BRNHPP
chr1_1532798_T_C_b38	ATAD3C	-3.755	0.000265	-0.165399	42	0.044048	yes	BRNHPP
chr1_1519934_T_G_b38	ATAD3C	-3.749	0.000271	-0.169077	25	0.045104	yes	BRNHPP
chr1_1519938_T_C_b38	ATAD3C	-3.749	0.000271	-0.169077	25	0.045104	yes	BRNHPP
chr1_1301426_A_AT_b38	ATAD3C	-3.745	0.000275	-0.201479	10	0.053804	yes	BRNHPP
chr1_1543953_A_G_b38	ATAD3C	-3.744	0.000276	-0.175345	24	0.04684	yes	BRNHPP
chr1_1217733_G_A_b38	ATAD3C	-3.709	0.000312	-0.218924	4	0.059019	yes	BRNHPP
chr1_1259424_T_C_b38	ATAD3C	-3.701	0.000322	-0.201165	17	0.054361	yes	BRNHPP
chr1_1428999_C_CA_b38	ATAD3C	-3.699	0.000324	-0.19005	7	0.051378	yes	BRNHPP
chr1_1542773_T_C_b38	ATAD3C	-3.652	0.000382	-0.171046	24	0.046833	yes	BRNHPP
chr1_1188054_T_A_b38	ATAD3C	-3.638	0.000402	-0.190953	7	0.052489	yes	BRNHPP
chr1_1543500_T_G_b38	ATAD3C	-3.617	0.000432	-0.168319	24	0.046535	yes	BRNHPP
chr1_1249880_A_G_b38	ATAD3C	-3.602	0.000455	-0.214983	9	0.05968	yes	BRNHPP
chr1_1479719_T_C_b38	ATAD3C	-3.594	0.000469	-0.171708	20	0.047782	yes	BRNHPP
chr1_1324185_T_TGG_b38	ATAD3C	-3.59	0.000475	-0.244023	6	0.067981	yes	BRNHPP
chr1_1201373_T_C_b38	ATAD3C	-3.579	0.000492	-0.1871	14	0.05227	yes	BRNHPP
chr1_1877316_A_T_b38	ATAD3C	3.575	5e-04	0.151641	24	0.042416	yes	BRNHPP
chr1_1542793_C_G_b38	ATAD3C	-3.574	0.000502	-0.166594	23	0.046615	yes	BRNHPP
chr1_1542800_T_C_b38	ATAD3C	-3.574	0.000502	-0.166594	23	0.046615	yes	BRNHPP
chr1_1515567_A_C_b38	ATAD3C	-3.569	0.000511	-0.301276	7	0.084416	yes	BRNHPP
chr1_1497605_G_C_b38	ATAD3C	-3.563	0.000521	-0.16965	15	0.047609	yes	BRNHPP
chr1_1559750_C_CAG_b38	ATAD3C	-3.552	0.000542	-0.163045	28	0.045905	yes	BRNHPP
chr1_1561628_T_C_b38	ATAD3C	-3.552	0.000542	-0.163045	28	0.045905	yes	BRNHPP
chr1_1563918_A_G_b38	ATAD3C	-3.552	0.000542	-0.163045	28	0.045905	yes	BRNHPP
chr1_1565561_A_G_b38	ATAD3C	-3.552	0.000542	-0.163045	28	0.045905	yes	BRNHPP
chr1_1566086_G_A_b38	ATAD3C	-3.552	0.000542	-0.163045	28	0.045905	yes	BRNHPP
chr1_1567715_G_A_b38	ATAD3C	-3.552	0.000542	-0.163045	28	0.045905	yes	BRNHPP
chr1_1567719_A_C_b38	ATAD3C	-3.552	0.000542	-0.163045	28	0.045905	yes	BRNHPP
chr1_1569875_C_T_b38	ATAD3C	-3.552	0.000542	-0.163045	28	0.045905	yes	BRNHPP
chr1_1215852_T_C_b38	ATAD3C	-3.529	0.000587	-0.194404	6	0.055092	yes	BRNHPP
chr1_1292284_TTGAG_T_b38	ATAD3C	-3.514	0.000617	-0.198501	9	0.056487	yes	BRNHPP
chr1_1545795_C_A_b38	ATAD3C	-3.502	0.000642	-0.166149	21	0.047438	yes	BRNHPP
chr1_1538787_A_G_b38	ATAD3C	-3.502	0.000643	-0.163548	27	0.046705	yes	BRNHPP
chr1_1226486_C_T_b38	ATAD3C	-3.495	0.000657	-0.207525	3	0.059371	yes	BRNHPP
chr1_1574655_GGC_G_b38	ATAD3C	-3.474	0.000708	-0.162659	23	0.046826	yes	BRNHPP
chr1_1550064_GC_G_b38	ATAD3C	-3.469	0.00072	-0.163451	24	0.047124	yes	BRNHPP
chr1_1550068_C_A_b38	ATAD3C	-3.469	0.00072	-0.163451	24	0.047124	yes	BRNHPP
chr1_1565105_CAAGGCAGGCGGATCATG_C_b38	ATAD3C	-3.465	0.000728	-0.159405	28	0.045999	yes	BRNHPP
chr1_1572532_A_C_b38	ATAD3C	-3.462	0.000736	-0.159607	28	0.0461	yes	BRNHPP
chr1_1573079_A_G_b38	ATAD3C	-3.462	0.000736	-0.159607	28	0.0461	yes	BRNHPP
chr1_1522693_A_G_b38	ATAD3C	3.462	0.000737	0.191767	6	0.055395	yes	BRNHPP
chr1_1569661_T_C_b38	ATAD3C	-3.439	0.000797	-0.15755	26	0.045817	yes	BRNHPP
chr1_1340697_G_A_b38	ATAD3C	3.43	0.000821	0.17209	7	0.050179	yes	BRNHPP
chr1_1569180_T_A_b38	ATAD3C	-3.422	0.000841	-0.159917	26	0.046725	yes	BRNHPP
chr1_1570294_CA_C_b38	ATAD3C	-3.415	0.000862	-0.156824	26	0.045917	yes	BRNHPP
chr1_1565680_A_AG_b38	ATAD3C	-3.407	0.000887	-0.156432	27	0.045917	yes	BRNHPP
chr1_1251285_G_A_b38	ATAD3C	-3.399	0.00091	-0.217059	4	0.063859	yes	BRNHPP
chr1_1251368_T_C_b38	ATAD3C	-3.399	0.00091	-0.217059	4	0.063859	yes	BRNHPP
chr1_1533841_T_C_b38	ATAD3C	-3.359	0.00104	-0.181394	15	0.053995	yes	BRNHPP
chr1_1549590_C_G_b38	ATAD3C	-3.345	0.00109	-0.152641	27	0.045632	yes	BRNHPP
chr1_1553692_A_G_b38	ATAD3C	-3.345	0.00109	-0.152641	27	0.045632	yes	BRNHPP
chr1_1554694_A_G_b38	ATAD3C	-3.345	0.00109	-0.152641	27	0.045632	yes	BRNHPP
chr1_1555247_T_A_b38	ATAD3C	-3.345	0.00109	-0.152641	27	0.045632	yes	BRNHPP
chr1_1388565_GTC_G_b38	ATAD3C	3.339	0.00111	0.163857	13	0.049069	yes	BRNHPP
chr1_1573429_CAAAAAAAAAAAAAAAAAA_C_b38	ATAD3C	-3.337	0.00112	-0.156537	24	0.04691	yes	BRNHPP
chr1_1216593_G_C_b38	ATAD3C	-3.316	0.0012	-0.184616	5	0.055678	yes	BRNHPP
chr1_1575864_G_A_b38	ATAD3C	-3.308	0.00123	-0.153699	23	0.046463	yes	BRNHPP
chr1_1558204_T_TAAAAAA_b38	ATAD3C	-3.299	0.00127	-0.164387	12	0.049832	yes	BRNHPP
chr1_1560765_T_C_b38	ATAD3C	-3.296	0.00128	-0.157854	22	0.047889	yes	BRNHPP
chr1_1562261_TTTTC_T_b38	ATAD3C	-3.296	0.00128	-0.157854	22	0.047889	yes	BRNHPP
chr1_1251356_AT_A_b38	ATAD3C	-3.296	0.00128	-0.191322	3	0.058048	yes	BRNHPP
chr1_1877316_A_AATAT_b38	ATAD3C	-3.295	0.00128	-0.245976	3	0.07465	yes	BRNHPP
chr1_1235602_C_A_b38	ATAD3C	-3.285	0.00133	-0.20216	3	0.061539	yes	BRNHPP
chr1_1251618_G_A_b38	ATAD3C	-3.268	0.0014	-0.211772	3	0.064798	yes	BRNHPP
chr1_1375678_TA_T_b38	ATAD3C	3.256	0.00146	0.181087	8	0.055623	yes	BRNHPP
chr1_2447809_G_A_b38	ATAD3C	3.226	0.00161	0.161294	9	0.049999	yes	BRNHPP
chr1_1258206_AT_A_b38	ATAD3C	-3.214	0.00167	-0.166212	17	0.051715	yes	BRNHPP
chr1_1547630_G_A_b38	ATAD3C	-3.189	0.00181	-0.148907	23	0.0467	yes	BRNHPP
chr1_1554852_T_C_b38	ATAD3C	-3.187	0.00182	-0.145273	27	0.045587	yes	BRNHPP
chr1_1537493_T_A_b38	ATAD3C	-3.185	0.00183	-0.147849	22	0.046425	yes	BRNHPP
chr1_1570587_C_T_b38	ATAD3C	-3.151	0.00204	-0.147838	24	0.046921	yes	BRNHPP
chr1_1231710_CCCCCGGGAA_C_b38	ATAD3C	-3.134	0.00216	-0.187675	4	0.059891	yes	BRNHPP
chr1_1554781_A_G_b38	ATAD3C	-3.071	0.00263	-0.140746	27	0.045838	yes	BRNHPP
chr1_1500745_A_C_b38	ATAD3C	-3.039	0.00289	-0.215197	13	0.070808	yes	BRNHPP
chr1_1280044_T_C_b38	ATAD3C	-3.024	0.00304	-0.163899	18	0.054205	yes	BRNHPP
chr1_1566854_CA_C_b38	ATAD3C	-3.011	0.00316	-0.150824	18	0.050099	yes	BRNHPP
chr1_1231507_T_C_b38	ATAD3C	-2.985	0.00342	-0.178638	3	0.059845	yes	BRNHPP
chr1_1195280_C_T_b38	ATAD3C	-2.948	0.00383	-0.233281	3	0.079137	yes	BRNHPP
chr1_1559703_G_C_b38	ATAD3C	-2.936	0.00397	-0.138649	24	0.047231	yes	BRNHPP
chr1_1568548_G_A_b38	ATAD3C	-2.936	0.00397	-0.138649	24	0.047231	yes	BRNHPP
chr1_1236303_A_G_b38	ATAD3C	-2.899	0.00443	-0.164222	5	0.056652	yes	BRNHPP
chr1_1571794_A_AT_b38	ATAD3C	-2.895	0.00448	-0.13996	24	0.048346	yes	BRNHPP
chr1_1574032_AAAG_A_b38	ATAD3C	-2.867	0.00488	-0.142228	14	0.049616	yes	BRNHPP
chr1_1190043_C_T_b38	ATAD3C	-2.863	0.00493	-0.218457	3	0.076298	yes	BRNHPP
chr1_1238231_G_A_b38	ATAD3C	-2.857	0.00502	-0.162996	8	0.057061	yes	BRNHPP
chr1_1538924_C_A_b38	ATAD3C	-2.844	0.00522	-0.136814	15	0.048112	yes	BRNHPP
chr1_1522905_A_G_b38	ATAD3C	-2.824	0.00553	-0.236423	8	0.083719	yes	BRNHPP
chr1_1184277_G_C_b38	ATAD3C	-2.816	0.00566	-0.139578	28	0.049562	yes	BRNHPP
chr1_1290841_A_G_b38	ATAD3C	-2.797	0.00599	-0.152005	13	0.054354	yes	BRNHPP
chr1_1223568_A_G_b38	ATAD3C	-2.787	0.00616	-0.178273	3	0.063967	yes	BRNHPP
chr1_1246371_T_C_b38	ATAD3C	-2.777	0.00634	-0.182589	6	0.065747	yes	BRNHPP
chr1_1539491_G_C_b38	ATAD3C	-2.777	0.00634	-0.132395	24	0.047678	yes	BRNHPP
chr1_1571986_G_A_b38	ATAD3C	-2.746	0.00693	-0.128247	20	0.046703	yes	BRNHPP
chr1_1537160_T_G_b38	ATAD3C	-2.705	0.00779	-0.119783	35	0.04428	yes	BRNHPP
chr1_2442681_C_T_b38	ATAD3C	2.703	0.00783	0.138093	9	0.051085	yes	BRNHPP
chr1_2444536_G_GT_b38	ATAD3C	2.703	0.00783	0.138093	9	0.051085	yes	BRNHPP
chr1_1575935_T_C_b38	ATAD3C	-2.69	0.00812	-0.126208	24	0.046912	yes	BRNHPP
chr1_1482316_C_G_b38	ATAD3C	-2.68	0.00837	-0.138123	11	0.051543	yes	BRNHPP
chr1_1525526_C_T_b38	ATAD3C	-2.671	0.00858	-0.268854	5	0.100659	yes	BRNHPP
chr1_2436409_TCCCTCCACCTTTCCTCCTTTCTCCCTCCTCCCTTCCTCCCTTCCTCCCTCCACCTTTCCTCCTTCCTCCCTCCTCCCCTCCTCCCTCCTCCTCCTTTCCTCCTTCCTCCCTCCTCCTTTCCTCCTTCCTCCCTCCTCCCTTC_T_b38	ATAD3C	2.647	0.00917	0.168766	8	0.06375	yes	BRNHPP
chr1_1366941_T_TGTGTGCA_b38	ATAD3C	5.008	1.85e-06	0.293196	3	0.058548	no	BRNHPP
chr1_1366951_A_AGT_b38	ATAD3C	4.835	3.86e-06	0.287127	3	0.059381	no	BRNHPP
chr1_1363456_CAG_C_b38	ATAD3C	4.737	5.82e-06	0.207847	12	0.043874	no	BRNHPP
chr1_1367954_A_C_b38	ATAD3C	-4.325	3.11e-05	-0.295032	3	0.068218	no	BRNHPP
chr1_511982_G_A_b38	ATAD3C	-3.186	0.00183	-0.137723	23	0.043231	no	BRNHPP
chr1_531693_C_T_b38	ATAD3C	-3.045	0.00284	-0.12828	27	0.042128	no	BRNHPP
chr1_1551454_C_A_b38	ATAD3C	-2.922	0.00413	-0.129011	40	0.044148	no	BRNHPP
chr1_1070689_G_A_b38	ATAD3C	-2.9	0.00442	-0.190118	3	0.065557	no	BRNHPP
chr1_1523187_A_G_b38	ATAD3C	-2.859	0.00499	-0.24303	9	0.085008	no	BRNHPP
chr1_1572877_T_TG_b38	ATAD3C	2.821	0.00557	0.158941	5	0.056333	no	BRNHPP
chr1_531472_G_C_b38	ATAD3C	-2.781	0.00627	-0.126165	25	0.045374	no	BRNHPP
chr1_1514211_A_G_b38	ATAD3C	-2.76	0.00665	-0.251008	3	0.090939	no	BRNHPP
chr1_509848_C_T_b38	ATAD3C	-2.746	0.00694	-0.155055	5	0.056471	no	BRNHPP
chr1_2109324_G_A_b38	ATAD3C	2.688	0.00817	0.172849	6	0.064293	no	BRNHPP
chr1_2109338_C_T_b38	ATAD3C	2.688	0.00817	0.172849	6	0.064293	no	BRNHPP
chr1_1520875_A_G_b38	ATAD3C	-2.687	0.0082	-0.231056	8	0.085992	no	BRNHPP
chr1_1524202_G_A_b38	ATAD3C	-2.687	0.0082	-0.231056	8	0.085992	no	BRNHPP
chr1_1533018_T_C_b38	ATAD3C	-2.687	0.0082	-0.231056	8	0.085992	no	BRNHPP
chr1_1440430_C_G_b38	ATAD3C	-8.29	1.28e-13	-0.261966	15	0.031601	yes	BRNHPT
chr1_1443457_T_C_b38	ATAD3C	-8.231	1.77e-13	-0.266123	23	0.032333	yes	BRNHPT
chr1_1436079_A_G_b38	ATAD3C	-8.189	2.22e-13	-0.265339	22	0.032402	yes	BRNHPT
chr1_1440834_C_G_b38	ATAD3C	-8.181	2.32e-13	-0.263304	22	0.032186	yes	BRNHPT
chr1_1436388_CA_C_b38	ATAD3C	-8.021	5.54e-13	-0.269262	15	0.033568	yes	BRNHPT
chr1_1441187_A_G_b38	ATAD3C	-8.009	5.91e-13	-0.267588	16	0.03341	yes	BRNHPT
chr1_1433374_T_C_b38	ATAD3C	-7.792	1.91e-12	-0.259219	24	0.033267	yes	BRNHPT
chr1_1431450_A_G_b38	ATAD3C	-7.784	1.99e-12	-0.2652	22	0.034068	yes	BRNHPT
chr1_1431537_G_C_b38	ATAD3C	-7.784	1.99e-12	-0.2652	22	0.034068	yes	BRNHPT
chr1_1434687_C_G_b38	ATAD3C	-7.754	2.35e-12	-0.283365	6	0.036545	yes	BRNHPT
chr1_1431014_G_A_b38	ATAD3C	-7.68	3.49e-12	-0.253625	13	0.033023	yes	BRNHPT
chr1_1445187_T_G_b38	ATAD3C	-7.673	3.62e-12	-0.256728	20	0.033459	yes	BRNHPT
chr1_1445240_A_G_b38	ATAD3C	-7.611	5.05e-12	-0.257723	21	0.033863	yes	BRNHPT
chr1_1432355_G_A_b38	ATAD3C	-7.594	5.54e-12	-0.273567	8	0.036026	yes	BRNHPT
chr1_1430190_A_C_b38	ATAD3C	-7.546	7.14e-12	-0.258388	22	0.034242	yes	BRNHPT
chr1_1430908_A_G_b38	ATAD3C	-7.515	8.4e-12	-0.261739	22	0.034827	yes	BRNHPT
chr1_1435945_C_CCGGGCGGGGGCG_b38	ATAD3C	-7.382	1.7e-11	-0.271495	7	0.036777	yes	BRNHPT
chr1_1428969_T_C_b38	ATAD3C	-7.294	2.71e-11	-0.250502	22	0.034344	yes	BRNHPT
chr1_1438102_G_C_b38	ATAD3C	-7.203	4.36e-11	-0.252029	10	0.034988	yes	BRNHPT
chr1_1442793_G_A_b38	ATAD3C	-7.156	5.57e-11	-0.264396	6	0.036946	yes	BRNHPT
chr1_1439454_A_G_b38	ATAD3C	-7.103	7.36e-11	-0.221927	22	0.031245	yes	BRNHPT
chr1_1431656_G_A_b38	ATAD3C	-6.978	1.4e-10	-0.272156	5	0.039001	yes	BRNHPT
chr1_1431813_G_T_b38	ATAD3C	-6.743	4.7e-10	-0.266515	6	0.039526	yes	BRNHPT
chr1_1448915_G_A_b38	ATAD3C	-6.507	1.55e-09	-0.227105	16	0.034902	yes	BRNHPT
chr1_1431026_CCACCCCCT_C_b38	ATAD3C	-6.451	2.04e-09	-0.242023	12	0.037516	yes	BRNHPT
chr1_1426261_C_T_b38	ATAD3C	-6.361	3.2e-09	-0.226184	21	0.035558	yes	BRNHPT
chr1_1426810_C_G_b38	ATAD3C	-6.361	3.2e-09	-0.226184	21	0.035558	yes	BRNHPT
chr1_1437955_C_G_b38	ATAD3C	-6.271	4.98e-09	-0.194543	21	0.031021	yes	BRNHPT
chr1_1439805_G_C_b38	ATAD3C	-6.138	9.57e-09	-0.22508	9	0.036671	yes	BRNHPT
chr1_1449009_A_T_b38	ATAD3C	-5.622	1.11e-07	-0.233322	12	0.041499	yes	BRNHPT
chr1_1449831_A_G_b38	ATAD3C	-5.616	1.15e-07	-0.228433	17	0.040674	yes	BRNHPT
chr1_1437993_G_A_b38	ATAD3C	-5.489	2.06e-07	-0.199842	10	0.036408	yes	BRNHPT
chr1_1426253_G_A_b38	ATAD3C	-5.395	3.17e-07	-0.224472	4	0.041608	yes	BRNHPT
chr1_1453703_A_G_b38	ATAD3C	-5.32	4.45e-07	-0.205133	18	0.038559	yes	BRNHPT
chr1_1454315_C_T_b38	ATAD3C	-5.151	9.47e-07	-0.196147	16	0.038083	yes	BRNHPT
chr1_1366427_AGTGTGATTGAATGAGT_A_b38	ATAD3C	5.107	1.15e-06	0.189402	12	0.037084	yes	BRNHPT
chr1_1376162_G_C_b38	ATAD3C	5.089	1.24e-06	0.187896	13	0.036921	yes	BRNHPT
chr1_1377431_C_T_b38	ATAD3C	5.089	1.24e-06	0.187896	13	0.036921	yes	BRNHPT
chr1_1452511_A_G_b38	ATAD3C	-5.072	1.34e-06	-0.196119	18	0.03867	yes	BRNHPT
chr1_1452888_C_A_b38	ATAD3C	-5.072	1.34e-06	-0.196119	18	0.03867	yes	BRNHPT
chr1_1452909_A_C_b38	ATAD3C	-5.072	1.34e-06	-0.196119	18	0.03867	yes	BRNHPT
chr1_1454092_A_G_b38	ATAD3C	-5.072	1.34e-06	-0.196119	18	0.03867	yes	BRNHPT
chr1_1455617_T_G_b38	ATAD3C	-5.072	1.34e-06	-0.196119	18	0.03867	yes	BRNHPT
chr1_1454770_T_C_b38	ATAD3C	-5.016	1.71e-06	-0.194013	18	0.038682	yes	BRNHPT
chr1_1313807_G_A_b38	ATAD3C	4.99	1.91e-06	0.185629	17	0.037198	yes	BRNHPT
chr1_1400410_A_G_b38	ATAD3C	-4.979	2.01e-06	-0.187279	13	0.037613	yes	BRNHPT
chr1_1384749_C_G_b38	ATAD3C	4.979	2.01e-06	0.187279	13	0.037613	yes	BRNHPT
chr1_1387763_CCT_C_b38	ATAD3C	4.979	2.01e-06	0.187279	13	0.037613	yes	BRNHPT
chr1_1388944_G_A_b38	ATAD3C	4.979	2.01e-06	0.187279	13	0.037613	yes	BRNHPT
chr1_1337898_A_G_b38	ATAD3C	4.952	2.25e-06	0.180388	9	0.036425	yes	BRNHPT
chr1_1378204_G_C_b38	ATAD3C	4.951	2.27e-06	0.18077	14	0.036515	yes	BRNHPT
chr1_1366561_AGT_A_b38	ATAD3C	4.902	2.79e-06	0.18333	15	0.037396	yes	BRNHPT
chr1_1309988_G_A_b38	ATAD3C	4.869	3.23e-06	0.183044	17	0.037597	yes	BRNHPT
chr1_1312114_T_C_b38	ATAD3C	4.869	3.23e-06	0.183044	17	0.037597	yes	BRNHPT
chr1_1308516_C_T_b38	ATAD3C	4.842	3.61e-06	0.182805	17	0.03775	yes	BRNHPT
chr1_1330125_G_A_b38	ATAD3C	4.84	3.65e-06	0.182652	17	0.037742	yes	BRNHPT
chr1_1411323_A_C_b38	ATAD3C	-4.827	3.85e-06	-0.182717	18	0.03785	yes	BRNHPT
chr1_1358384_G_C_b38	ATAD3C	4.814	4.07e-06	0.181193	16	0.037639	yes	BRNHPT
chr1_1389827_C_T_b38	ATAD3C	4.761	5.1e-06	0.18134	15	0.038091	yes	BRNHPT
chr1_1394423_A_G_b38	ATAD3C	-4.761	5.1e-06	-0.18134	15	0.038091	yes	BRNHPT
chr1_1395346_A_G_b38	ATAD3C	-4.761	5.1e-06	-0.18134	15	0.038091	yes	BRNHPT
chr1_1452797_CAA_C_b38	ATAD3C	-4.742	5.51e-06	-0.203009	6	0.04281	yes	BRNHPT
chr1_1451787_A_C_b38	ATAD3C	-4.674	7.33e-06	-0.181353	14	0.0388	yes	BRNHPT
chr1_1402457_A_G_b38	ATAD3C	-4.674	7.33e-06	-0.179253	16	0.038352	yes	BRNHPT
chr1_1387698_A_G_b38	ATAD3C	4.674	7.33e-06	0.179253	16	0.038352	yes	BRNHPT
chr1_1379083_AT_A_b38	ATAD3C	4.622	9.08e-06	0.168072	11	0.03636	yes	BRNHPT
chr1_1370113_A_G_b38	ATAD3C	4.62	9.16e-06	0.167261	14	0.036202	yes	BRNHPT
chr1_1532798_T_C_b38	ATAD3C	-4.49	1.56e-05	-0.153737	45	0.034236	yes	BRNHPT
chr1_1398056_C_A_b38	ATAD3C	-4.469	1.7e-05	-0.143271	25	0.032056	yes	BRNHPT
chr1_1451968_C_T_b38	ATAD3C	-4.421	2.06e-05	-0.177535	10	0.040153	yes	BRNHPT
chr1_1452825_AAAG_A_b38	ATAD3C	-4.334	2.92e-05	-0.176109	12	0.040635	yes	BRNHPT
chr1_1453552_G_A_b38	ATAD3C	-4.334	2.92e-05	-0.176109	12	0.040635	yes	BRNHPT
chr1_1455134_T_G_b38	ATAD3C	-4.334	2.92e-05	-0.176109	12	0.040635	yes	BRNHPT
chr1_1455337_A_G_b38	ATAD3C	-4.334	2.92e-05	-0.176109	12	0.040635	yes	BRNHPT
chr1_1455495_C_T_b38	ATAD3C	-4.334	2.92e-05	-0.176109	12	0.040635	yes	BRNHPT
chr1_1455924_T_C_b38	ATAD3C	-4.334	2.92e-05	-0.176109	12	0.040635	yes	BRNHPT
chr1_1456051_C_T_b38	ATAD3C	-4.334	2.92e-05	-0.176109	12	0.040635	yes	BRNHPT
chr1_1456154_G_A_b38	ATAD3C	-4.334	2.92e-05	-0.176109	12	0.040635	yes	BRNHPT
chr1_1453870_A_C_b38	ATAD3C	-4.326	3.01e-05	-0.179451	5	0.041478	yes	BRNHPT
chr1_1453961_C_T_b38	ATAD3C	-4.326	3.01e-05	-0.179451	5	0.041478	yes	BRNHPT
chr1_1456079_T_C_b38	ATAD3C	-4.316	3.14e-05	-0.176184	12	0.040823	yes	BRNHPT
chr1_1457071_C_T_b38	ATAD3C	-4.299	3.35e-05	-0.165472	12	0.038488	yes	BRNHPT
chr1_1452540_G_A_b38	ATAD3C	-4.295	3.41e-05	-0.172819	10	0.040237	yes	BRNHPT
chr1_1497605_G_C_b38	ATAD3C	-4.278	3.64e-05	-0.155688	17	0.036393	yes	BRNHPT
chr1_1519934_T_G_b38	ATAD3C	-4.271	3.75e-05	-0.148713	25	0.034823	yes	BRNHPT
chr1_1519938_T_C_b38	ATAD3C	-4.271	3.75e-05	-0.148713	25	0.034823	yes	BRNHPT
chr1_1517993_A_G_b38	ATAD3C	-4.266	3.81e-05	-0.148844	25	0.034888	yes	BRNHPT
chr1_1452384_G_A_b38	ATAD3C	-4.233	4.35e-05	-0.171723	6	0.040572	yes	BRNHPT
chr1_1452346_A_G_b38	ATAD3C	-4.215	4.66e-05	-0.170579	6	0.04047	yes	BRNHPT
chr1_1450636_A_G_b38	ATAD3C	-4.171	5.53e-05	-0.16839	6	0.040374	yes	BRNHPT
chr1_1340697_G_A_b38	ATAD3C	4.125	6.59e-05	0.153998	12	0.037329	yes	BRNHPT
chr1_1454848_T_C_b38	ATAD3C	-4.122	6.69e-05	-0.164934	12	0.040016	yes	BRNHPT
chr1_1471992_T_C_b38	ATAD3C	-4.093	7.45e-05	-0.156402	18	0.03821	yes	BRNHPT
chr1_1259424_T_C_b38	ATAD3C	-4.06	8.46e-05	-0.157013	17	0.038675	yes	BRNHPT
chr1_1451028_T_A_b38	ATAD3C	-4.051	8.75e-05	-0.164186	6	0.04053	yes	BRNHPT
chr1_1456217_T_C_b38	ATAD3C	-4.037	9.23e-05	-0.175389	17	0.043445	yes	BRNHPT
chr1_1290841_A_G_b38	ATAD3C	-4.011	0.000102	-0.170327	9	0.04247	yes	BRNHPT
chr1_1456182_G_A_b38	ATAD3C	-4.01	0.000102	-0.158046	14	0.039408	yes	BRNHPT
chr1_1479719_T_C_b38	ATAD3C	-4.008	0.000103	-0.146812	21	0.036625	yes	BRNHPT
chr1_2055097_C_T_b38	ATAD3C	3.969	0.000119	0.176539	4	0.044481	yes	BRNHPT
chr1_1453643_A_ATT_b38	ATAD3C	-3.963	0.000122	-0.155866	10	0.039335	yes	BRNHPT
chr1_2060449_TGAGAAGTGGGGCTGAATAGAGGTTTGGCAGTGCTTAGCATAGGGGGCGAGAGTCTCGGCTTCCAGC_T_b38	ATAD3C	3.955	0.000125	0.174976	4	0.044239	yes	BRNHPT
chr1_1447108_A_ATT_b38	ATAD3C	-3.95	0.000128	-0.165474	8	0.041894	yes	BRNHPT
chr1_2058057_C_T_b38	ATAD3C	3.935	0.000135	0.173299	4	0.044037	yes	BRNHPT
chr1_1547630_G_A_b38	ATAD3C	-3.889	0.00016	-0.136425	21	0.035082	yes	BRNHPT
chr1_2058514_T_A_b38	ATAD3C	3.868	0.000173	0.170707	4	0.044131	yes	BRNHPT
chr1_2059575_A_G_b38	ATAD3C	3.868	0.000173	0.170707	4	0.044131	yes	BRNHPT
chr1_2059684_G_A_b38	ATAD3C	3.868	0.000173	0.170707	4	0.044131	yes	BRNHPT
chr1_2059802_C_G_b38	ATAD3C	3.868	0.000173	0.170707	4	0.044131	yes	BRNHPT
chr1_2059863_G_A_b38	ATAD3C	3.868	0.000173	0.170707	4	0.044131	yes	BRNHPT
chr1_2060951_G_A_b38	ATAD3C	3.868	0.000173	0.170707	4	0.044131	yes	BRNHPT
chr1_2061309_C_T_b38	ATAD3C	3.868	0.000173	0.170707	4	0.044131	yes	BRNHPT
chr1_2063382_G_A_b38	ATAD3C	3.868	0.000173	0.170707	4	0.044131	yes	BRNHPT
chr1_2063734_T_G_b38	ATAD3C	3.868	0.000173	0.170707	4	0.044131	yes	BRNHPT
chr1_2065748_A_G_b38	ATAD3C	3.868	0.000173	0.170707	4	0.044131	yes	BRNHPT
chr1_1575421_C_T_b38	ATAD3C	-3.863	0.000176	-0.136411	23	0.035311	yes	BRNHPT
chr1_1543953_A_G_b38	ATAD3C	-3.862	0.000177	-0.140906	22	0.036484	yes	BRNHPT
chr1_1545795_C_A_b38	ATAD3C	-3.858	0.00018	-0.140403	19	0.036394	yes	BRNHPT
chr1_1388565_GTC_G_b38	ATAD3C	3.855	0.000182	0.155065	9	0.040224	yes	BRNHPT
chr1_1456829_G_C_b38	ATAD3C	-3.845	0.000189	-0.156827	14	0.040788	yes	BRNHPT
chr1_1575724_G_C_b38	ATAD3C	-3.843	0.00019	-0.135942	23	0.035374	yes	BRNHPT
chr1_1566854_CA_C_b38	ATAD3C	-3.829	2e-04	-0.145901	19	0.038101	yes	BRNHPT
chr1_1542773_T_C_b38	ATAD3C	-3.828	2e-04	-0.139554	22	0.036453	yes	BRNHPT
chr1_1542793_C_G_b38	ATAD3C	-3.828	2e-04	-0.139554	22	0.036453	yes	BRNHPT
chr1_1542800_T_C_b38	ATAD3C	-3.828	2e-04	-0.139554	22	0.036453	yes	BRNHPT
chr1_1184277_G_C_b38	ATAD3C	-3.821	0.000206	-0.130725	29	0.034217	yes	BRNHPT
chr1_1258206_AT_A_b38	ATAD3C	-3.82	0.000206	-0.140305	17	0.036727	yes	BRNHPT
chr1_1538787_A_G_b38	ATAD3C	-3.82	0.000207	-0.136535	25	0.035744	yes	BRNHPT
chr1_1577491_A_AC_b38	ATAD3C	-3.819	0.000207	-0.135265	25	0.035417	yes	BRNHPT
chr1_1182018_A_G_b38	ATAD3C	-3.791	0.000229	-0.129969	28	0.034284	yes	BRNHPT
chr1_1569661_T_C_b38	ATAD3C	-3.773	0.000245	-0.133779	24	0.035456	yes	BRNHPT
chr1_1573654_T_C_b38	ATAD3C	-3.758	0.000259	-0.133414	24	0.035505	yes	BRNHPT
chr1_1574445_A_G_b38	ATAD3C	-3.758	0.000259	-0.133414	24	0.035505	yes	BRNHPT
chr1_1549590_C_G_b38	ATAD3C	-3.755	0.000262	-0.133256	25	0.035492	yes	BRNHPT
chr1_1553692_A_G_b38	ATAD3C	-3.755	0.000262	-0.133256	25	0.035492	yes	BRNHPT
chr1_1554694_A_G_b38	ATAD3C	-3.755	0.000262	-0.133256	25	0.035492	yes	BRNHPT
chr1_1554781_A_G_b38	ATAD3C	-3.755	0.000262	-0.133256	25	0.035492	yes	BRNHPT
chr1_1555247_T_A_b38	ATAD3C	-3.755	0.000262	-0.133256	25	0.035492	yes	BRNHPT
chr1_1537160_T_G_b38	ATAD3C	-3.752	0.000264	-0.131315	32	0.034998	yes	BRNHPT
chr1_1570294_CA_C_b38	ATAD3C	-3.748	0.000268	-0.135655	24	0.036192	yes	BRNHPT
chr1_1541864_T_C_b38	ATAD3C	-3.748	0.000268	-0.137334	23	0.036646	yes	BRNHPT
chr1_1363898_C_T_b38	ATAD3C	3.721	0.000295	0.150654	6	0.04049	yes	BRNHPT
chr1_1363986_C_T_b38	ATAD3C	3.721	0.000295	0.150654	6	0.04049	yes	BRNHPT
chr1_1365566_G_A_b38	ATAD3C	3.721	0.000295	0.150654	6	0.04049	yes	BRNHPT
chr1_1366529_TTAG_T_b38	ATAD3C	3.721	0.000295	0.150654	6	0.04049	yes	BRNHPT
chr1_1367292_A_AGT_b38	ATAD3C	3.721	0.000295	0.150654	6	0.04049	yes	BRNHPT
chr1_1550064_GC_G_b38	ATAD3C	-3.681	0.00034	-0.133879	23	0.036372	yes	BRNHPT
chr1_1550068_C_A_b38	ATAD3C	-3.681	0.00034	-0.133879	23	0.036372	yes	BRNHPT
chr1_1559750_C_CAG_b38	ATAD3C	-3.673	0.00035	-0.130949	26	0.03565	yes	BRNHPT
chr1_1561628_T_C_b38	ATAD3C	-3.673	0.00035	-0.130949	26	0.03565	yes	BRNHPT
chr1_1563918_A_G_b38	ATAD3C	-3.673	0.00035	-0.130949	26	0.03565	yes	BRNHPT
chr1_1565561_A_G_b38	ATAD3C	-3.673	0.00035	-0.130949	26	0.03565	yes	BRNHPT
chr1_1566086_G_A_b38	ATAD3C	-3.673	0.00035	-0.130949	26	0.03565	yes	BRNHPT
chr1_1567715_G_A_b38	ATAD3C	-3.673	0.00035	-0.130949	26	0.03565	yes	BRNHPT
chr1_1567719_A_C_b38	ATAD3C	-3.673	0.00035	-0.130949	26	0.03565	yes	BRNHPT
chr1_1569875_C_T_b38	ATAD3C	-3.673	0.00035	-0.130949	26	0.03565	yes	BRNHPT
chr1_1557495_CAT_C_b38	ATAD3C	-3.67	0.000354	-0.133329	24	0.036333	yes	BRNHPT
chr1_1370553_CAAA_C_b38	ATAD3C	-3.664	0.000361	-0.180637	4	0.049295	yes	BRNHPT
chr1_1572532_A_C_b38	ATAD3C	-3.652	0.000377	-0.129886	26	0.035566	yes	BRNHPT
chr1_1573079_A_G_b38	ATAD3C	-3.652	0.000377	-0.129886	26	0.035566	yes	BRNHPT
chr1_1379091_T_G_b38	ATAD3C	3.643	0.000389	0.152883	6	0.041963	yes	BRNHPT
chr1_1569180_T_A_b38	ATAD3C	-3.642	0.00039	-0.129328	24	0.035508	yes	BRNHPT
chr1_1549967_C_G_b38	ATAD3C	-3.628	0.00041	-0.135107	14	0.037238	yes	BRNHPT
chr1_1565680_A_AG_b38	ATAD3C	-3.625	0.000414	-0.132905	25	0.03666	yes	BRNHPT
chr1_1554852_T_C_b38	ATAD3C	-3.601	0.00045	-0.127849	25	0.035502	yes	BRNHPT
chr1_1558726_C_CA_b38	ATAD3C	-3.597	0.000456	-0.131421	24	0.036531	yes	BRNHPT
chr1_1561821_A_C_b38	ATAD3C	-3.597	0.000456	-0.131421	24	0.036531	yes	BRNHPT
chr1_1551557_A_AG_b38	ATAD3C	-3.59	0.000468	-0.131188	23	0.036541	yes	BRNHPT
chr1_1551559_A_T_b38	ATAD3C	-3.59	0.000468	-0.131188	23	0.036541	yes	BRNHPT
chr1_1302795_T_TC_b38	ATAD3C	3.575	0.000494	0.148268	21	0.041477	yes	BRNHPT
chr1_1543500_T_G_b38	ATAD3C	-3.55	0.000539	-0.129787	22	0.036564	yes	BRNHPT
chr1_1205055_G_T_b38	ATAD3C	-3.547	0.000544	-0.131653	22	0.037119	yes	BRNHPT
chr1_2079677_C_G_b38	ATAD3C	3.547	0.000544	0.158332	5	0.044642	yes	BRNHPT
chr1_1180931_A_G_b38	ATAD3C	-3.498	0.000644	-0.119751	27	0.034236	yes	BRNHPT
chr1_2074366_C_G_b38	ATAD3C	3.467	0.000715	0.171885	3	0.049572	yes	BRNHPT
chr1_1221049_C_G_b38	ATAD3C	-3.464	0.000722	-0.127981	17	0.036942	yes	BRNHPT
chr1_1574655_GGC_G_b38	ATAD3C	-3.456	0.000742	-0.128757	20	0.037251	yes	BRNHPT
chr1_1361679_G_A_b38	ATAD3C	3.451	0.000755	0.140057	10	0.040584	yes	BRNHPT
chr1_1539491_G_C_b38	ATAD3C	-3.449	0.000761	-0.128019	22	0.037121	yes	BRNHPT
chr1_1565105_CAAGGCAGGCGGATCATG_C_b38	ATAD3C	-3.44	0.000785	-0.122812	26	0.035703	yes	BRNHPT
chr1_1571794_A_AT_b38	ATAD3C	-3.438	0.000788	-0.128887	21	0.037485	yes	BRNHPT
chr1_1575864_G_A_b38	ATAD3C	-3.437	0.000792	-0.128151	21	0.037285	yes	BRNHPT
chr1_1568548_G_A_b38	ATAD3C	-3.435	0.000798	-0.127179	22	0.037028	yes	BRNHPT
chr1_1380867_A_G_b38	ATAD3C	-3.394	0.000914	-0.15332	5	0.045169	yes	BRNHPT
chr1_1307603_G_A_b38	ATAD3C	3.392	0.000922	0.215011	7	0.063388	yes	BRNHPT
chr1_1382893_G_A_b38	ATAD3C	-3.385	0.000942	-0.153651	5	0.045387	yes	BRNHPT
chr1_1573429_CAAAAAAAAAAAAAAAAAA_C_b38	ATAD3C	-3.382	0.000954	-0.123006	22	0.036376	yes	BRNHPT
chr1_1428999_C_CA_b38	ATAD3C	-3.371	0.000988	-0.138877	8	0.041197	yes	BRNHPT
chr1_2072659_G_A_b38	ATAD3C	3.37	0.000991	0.15307	5	0.045419	yes	BRNHPT
chr1_2074688_G_A_b38	ATAD3C	3.37	0.000991	0.15307	5	0.045419	yes	BRNHPT
chr1_1175206_T_C_b38	ATAD3C	-3.368	0.000997	-0.113819	28	0.03379	yes	BRNHPT
chr1_1533841_T_C_b38	ATAD3C	-3.366	0.00101	-0.148549	11	0.044136	yes	BRNHPT
chr1_1292284_TTGAG_T_b38	ATAD3C	-3.359	0.00103	-0.163189	6	0.048587	yes	BRNHPT
chr1_1570587_C_T_b38	ATAD3C	-3.349	0.00106	-0.124271	22	0.037103	yes	BRNHPT
chr1_1300330_T_A_b38	ATAD3C	-3.347	0.00107	-0.218611	6	0.065312	yes	BRNHPT
chr1_1301656_T_C_b38	ATAD3C	-3.347	0.00107	-0.218611	6	0.065312	yes	BRNHPT
chr1_1538924_C_A_b38	ATAD3C	-3.347	0.00107	-0.12257	15	0.036623	yes	BRNHPT
chr1_1537493_T_A_b38	ATAD3C	-3.341	0.00109	-0.123782	21	0.037055	yes	BRNHPT
chr1_1559703_G_C_b38	ATAD3C	-3.327	0.00114	-0.12309	22	0.036999	yes	BRNHPT
chr1_1238902_T_C_b38	ATAD3C	-3.318	0.00118	-0.112908	22	0.034028	yes	BRNHPT
chr1_1575935_T_C_b38	ATAD3C	-3.292	0.00128	-0.121733	23	0.036982	yes	BRNHPT
chr1_1560765_T_C_b38	ATAD3C	-3.28	0.00134	-0.12564	20	0.038307	yes	BRNHPT
chr1_1562261_TTTTC_T_b38	ATAD3C	-3.28	0.00134	-0.12564	20	0.038307	yes	BRNHPT
chr1_1375642_C_T_b38	ATAD3C	-3.278	0.00134	-0.148279	5	0.045232	yes	BRNHPT
chr1_1500745_A_C_b38	ATAD3C	-3.276	0.00135	-0.20452	9	0.062435	yes	BRNHPT
chr1_1522693_A_G_b38	ATAD3C	3.274	0.00136	0.135537	8	0.041392	yes	BRNHPT
chr1_1571986_G_A_b38	ATAD3C	-3.272	0.00137	-0.117916	18	0.036039	yes	BRNHPT
chr1_1394041_G_A_b38	ATAD3C	-3.251	0.00147	-0.155644	3	0.047871	yes	BRNHPT
chr1_1290968_C_G_b38	ATAD3C	-3.246	0.00149	-0.149813	10	0.046151	yes	BRNHPT
chr1_1558204_T_TAAAAAA_b38	ATAD3C	-3.243	0.00151	-0.127644	10	0.039364	yes	BRNHPT
chr1_1374505_A_G_b38	ATAD3C	-3.235	0.00154	-0.145734	5	0.045048	yes	BRNHPT
chr1_1369803_C_CT_b38	ATAD3C	-3.232	0.00156	-0.131458	6	0.040676	yes	BRNHPT
chr1_1456891_T_C_b38	ATAD3C	-3.229	0.00158	-0.127977	14	0.039639	yes	BRNHPT
chr1_1282558_C_CCA_b38	ATAD3C	-3.225	0.0016	-0.164191	5	0.05091	yes	BRNHPT
chr1_1193398_C_CTTA_b38	ATAD3C	-3.221	0.00162	-0.122641	19	0.038079	yes	BRNHPT
chr1_1384546_C_T_b38	ATAD3C	-3.216	0.00164	-0.146163	5	0.045453	yes	BRNHPT
chr1_1398218_C_A_b38	ATAD3C	-3.216	0.00164	-0.146163	5	0.045453	yes	BRNHPT
chr1_1400756_GGA_G_b38	ATAD3C	-3.216	0.00164	-0.146163	5	0.045453	yes	BRNHPT
chr1_1401954_G_T_b38	ATAD3C	-3.216	0.00164	-0.146163	5	0.045453	yes	BRNHPT
chr1_1403593_A_G_b38	ATAD3C	-3.216	0.00164	-0.146163	5	0.045453	yes	BRNHPT
chr1_1407565_C_A_b38	ATAD3C	-3.216	0.00164	-0.146163	5	0.045453	yes	BRNHPT
chr1_1173872_A_G_b38	ATAD3C	-3.209	0.00168	-0.111562	19	0.03476	yes	BRNHPT
chr1_1341550_GCA_G_b38	ATAD3C	-3.191	0.00178	-0.144111	5	0.045169	yes	BRNHPT
chr1_1230159_G_A_b38	ATAD3C	-3.118	0.00224	-0.106464	15	0.034142	yes	BRNHPT
chr1_1236037_C_T_b38	ATAD3C	-3.104	0.00235	-0.095736	30	0.030844	yes	BRNHPT
chr1_1555179_A_G_b38	ATAD3C	-3.097	0.0024	-0.120164	20	0.0388	yes	BRNHPT
chr1_1555871_T_C_b38	ATAD3C	-3.097	0.0024	-0.120164	20	0.0388	yes	BRNHPT
chr1_1554548_T_C_b38	ATAD3C	-3.094	0.00242	-0.119524	18	0.038634	yes	BRNHPT
chr1_1383743_T_C_b38	ATAD3C	-3.091	0.00244	-0.140305	5	0.045386	yes	BRNHPT
chr1_1341030_C_A_b38	ATAD3C	3.083	0.00251	0.175953	5	0.057078	yes	BRNHPT
chr1_1325753_G_T_b38	ATAD3C	-3.078	0.00255	-0.149916	3	0.04871	yes	BRNHPT
chr1_1497606_C_G_b38	ATAD3C	-3.058	0.00271	-0.129568	6	0.042368	yes	BRNHPT
chr1_1558347_G_A_b38	ATAD3C	-3.047	0.00281	-0.12281	18	0.040308	yes	BRNHPT
chr1_1370430_T_C_b38	ATAD3C	-3.029	0.00297	-0.136121	5	0.044946	yes	BRNHPT
chr1_1370532_C_T_b38	ATAD3C	-3.029	0.00297	-0.136121	5	0.044946	yes	BRNHPT
chr1_1370584_G_C_b38	ATAD3C	-3.029	0.00297	-0.136121	5	0.044946	yes	BRNHPT
chr1_1372909_G_A_b38	ATAD3C	-3.029	0.00297	-0.136121	5	0.044946	yes	BRNHPT
chr1_1379093_TG_T_b38	ATAD3C	-3.006	0.00318	-0.144507	4	0.048071	yes	BRNHPT
chr1_1554290_C_T_b38	ATAD3C	-2.995	0.00329	-0.118005	17	0.0394	yes	BRNHPT
chr1_1375678_TA_T_b38	ATAD3C	2.977	0.00348	0.134493	9	0.045182	yes	BRNHPT
chr1_1511945_G_A_b38	ATAD3C	-2.975	0.00349	-0.158452	8	0.053253	yes	BRNHPT
chr1_1573776_A_G_b38	ATAD3C	-2.968	0.00358	-0.120987	10	0.040767	yes	BRNHPT
chr1_1173774_G_A_b38	ATAD3C	-2.959	0.00368	-0.126747	6	0.042841	yes	BRNHPT
chr1_1752908_C_CCCT_b38	ATAD3C	-2.956	0.00371	-0.110513	22	0.037387	yes	BRNHPT
chr1_1220751_T_C_b38	ATAD3C	-2.906	0.0043	-0.123394	6	0.042456	yes	BRNHPT
chr1_1327982_G_A_b38	ATAD3C	2.88	0.00466	0.176696	5	0.06136	yes	BRNHPT
chr1_1361685_C_T_b38	ATAD3C	-2.851	0.00508	-0.127527	8	0.044732	yes	BRNHPT
chr1_1496953_T_C_b38	ATAD3C	-2.824	0.0055	-0.168496	9	0.059669	yes	BRNHPT
chr1_1385919_A_AG_b38	ATAD3C	2.816	0.00562	0.168875	4	0.059966	yes	BRNHPT
chr1_1351517_G_C_b38	ATAD3C	2.81	0.00573	0.15738	6	0.056017	yes	BRNHPT
chr1_2054074_C_G_b38	ATAD3C	-2.788	0.0061	-0.124493	10	0.044649	yes	BRNHPT
chr1_2054114_T_C_b38	ATAD3C	-2.788	0.0061	-0.124493	10	0.044649	yes	BRNHPT
chr1_1568428_C_G_b38	ATAD3C	-2.781	0.00622	-0.109028	12	0.039199	yes	BRNHPT
chr1_1359138_C_T_b38	ATAD3C	2.751	0.00679	0.165816	5	0.060264	yes	BRNHPT
chr1_1174096_C_A_b38	ATAD3C	-2.747	0.00687	-0.127154	3	0.046288	yes	BRNHPT
chr1_1579717_T_A_b38	ATAD3C	-2.736	0.0071	-0.111294	10	0.040679	yes	BRNHPT
chr1_1172897_G_A_b38	ATAD3C	-2.734	0.00713	-0.126691	3	0.046331	yes	BRNHPT
chr1_2055297_GA_G_b38	ATAD3C	-2.732	0.00718	-0.126463	6	0.046296	yes	BRNHPT
chr1_1501403_T_C_b38	ATAD3C	-2.727	0.00728	-0.143211	8	0.052514	yes	BRNHPT
chr1_1551523_T_C_b38	ATAD3C	-2.722	0.00738	-0.110961	10	0.04076	yes	BRNHPT
chr1_2005948_A_C_b38	ATAD3C	2.719	0.00744	0.123478	4	0.045408	yes	BRNHPT
chr1_1512376_G_C_b38	ATAD3C	-2.693	0.00802	-0.143696	8	0.053357	yes	BRNHPT
chr1_1174402_G_A_b38	ATAD3C	-2.68	0.00832	-0.126046	3	0.047029	yes	BRNHPT
chr1_1579410_AT_A_b38	ATAD3C	-2.668	0.00861	-0.11116	9	0.041667	yes	BRNHPT
chr1_1530331_T_C_b38	ATAD3C	-2.662	0.00876	-0.132465	9	0.049764	yes	BRNHPT
chr1_1367028_A_G_b38	ATAD3C	2.659	0.00883	0.133117	4	0.050064	yes	BRNHPT
chr1_1303112_G_A_b38	ATAD3C	-2.645	0.00919	-0.130045	3	0.049171	yes	BRNHPT
chr1_1303800_G_A_b38	ATAD3C	-2.645	0.00919	-0.130045	3	0.049171	yes	BRNHPT
chr1_1304555_A_C_b38	ATAD3C	-2.645	0.00919	-0.130045	3	0.049171	yes	BRNHPT
chr1_1553018_CA_C_b38	ATAD3C	-2.617	0.00992	-0.117224	4	0.044787	yes	BRNHPT
chr1_2056364_G_A_b38	ATAD3C	4.724	5.94e-06	0.198541	11	0.042024	no	BRNHPT
chr1_2065711_G_A_b38	ATAD3C	4.562	1.16e-05	0.184187	9	0.040371	no	BRNHPT
chr1_1457033_A_C_b38	ATAD3C	-4.264	3.85e-05	-0.178158	11	0.041784	no	BRNHPT
chr1_2060286_A_G_b38	ATAD3C	4.011	0.000102	0.164678	8	0.04106	no	BRNHPT
chr1_1551454_C_A_b38	ATAD3C	-3.971	0.000118	-0.136298	45	0.03432	no	BRNHPT
chr1_2081714_C_T_b38	ATAD3C	3.904	0.000152	0.161198	12	0.041294	no	BRNHPT
chr1_2075942_A_G_b38	ATAD3C	3.716	3e-04	0.161273	5	0.043395	no	BRNHPT
chr1_2077249_T_C_b38	ATAD3C	3.645	0.000386	0.165426	4	0.045381	no	BRNHPT
chr1_2079109_C_T_b38	ATAD3C	3.645	0.000386	0.165426	4	0.045381	no	BRNHPT
chr1_2085363_T_C_b38	ATAD3C	3.645	0.000386	0.165426	4	0.045381	no	BRNHPT
chr1_2085406_G_A_b38	ATAD3C	3.645	0.000386	0.165426	4	0.045381	no	BRNHPT
chr1_2086202_C_T_b38	ATAD3C	3.645	0.000386	0.165426	4	0.045381	no	BRNHPT
chr1_2087436_G_A_b38	ATAD3C	3.645	0.000386	0.165426	4	0.045381	no	BRNHPT
chr1_1363456_CAG_C_b38	ATAD3C	3.607	0.000441	0.135499	9	0.03756	no	BRNHPT
chr1_2076742_GA_G_b38	ATAD3C	3.583	0.00048	0.167181	3	0.046661	no	BRNHPT
chr1_2071051_C_CACCTGGGCGTGTG_b38	ATAD3C	3.569	0.000503	0.159087	5	0.04457	no	BRNHPT
chr1_2079137_C_T_b38	ATAD3C	3.535	0.000566	0.155419	6	0.043961	no	BRNHPT
chr1_2074854_G_GT_b38	ATAD3C	3.497	0.000645	0.159119	4	0.045498	no	BRNHPT
chr1_2090659_G_A_b38	ATAD3C	3.482	0.000679	0.150116	5	0.043107	no	BRNHPT
chr1_2091118_G_A_b38	ATAD3C	3.482	0.000679	0.150116	5	0.043107	no	BRNHPT
chr1_2091238_C_T_b38	ATAD3C	3.482	0.000679	0.150116	5	0.043107	no	BRNHPT
chr1_2092625_C_T_b38	ATAD3C	3.482	0.000679	0.150116	5	0.043107	no	BRNHPT
chr1_1367954_A_C_b38	ATAD3C	-3.463	0.000725	-0.204987	3	0.059188	no	BRNHPT
chr1_1375998_T_A_b38	ATAD3C	3.461	0.000731	0.204625	3	0.059127	no	BRNHPT
chr1_1361833_G_C_b38	ATAD3C	3.446	0.000769	0.15005	7	0.043545	no	BRNHPT
chr1_2090943_G_A_b38	ATAD3C	3.432	0.000807	0.155173	4	0.04522	no	BRNHPT
chr1_1329774_T_C_b38	ATAD3C	3.359	0.00103	0.199445	3	0.059374	no	BRNHPT
chr1_1337736_A_G_b38	ATAD3C	3.359	0.00103	0.199445	3	0.059374	no	BRNHPT
chr1_1368047_ACT_A_b38	ATAD3C	3.348	0.00107	0.196543	3	0.058707	no	BRNHPT
chr1_1308549_G_T_b38	ATAD3C	3.331	0.00113	0.097795	41	0.029361	no	BRNHPT
chr1_1370553_CA_C_b38	ATAD3C	3.317	0.00118	0.110838	40	0.033412	no	BRNHPT
chr1_2079131_T_C_b38	ATAD3C	3.311	0.00121	0.150371	4	0.045418	no	BRNHPT
chr1_2093604_C_T_b38	ATAD3C	3.283	0.00132	0.12124	20	0.036932	no	BRNHPT
chr1_2089758_A_G_b38	ATAD3C	3.266	0.0014	0.138225	8	0.042318	no	BRNHPT
chr1_1359943_G_A_b38	ATAD3C	3.261	0.00142	0.201731	4	0.061864	no	BRNHPT
chr1_1353091_C_T_b38	ATAD3C	3.26	0.00143	0.191171	3	0.058649	no	BRNHPT
chr1_1353443_A_G_b38	ATAD3C	3.26	0.00143	0.191171	3	0.058649	no	BRNHPT
chr1_1327586_C_T_b38	ATAD3C	3.225	0.0016	0.192552	3	0.059706	no	BRNHPT
chr1_2056323_C_T_b38	ATAD3C	-3.212	0.00167	-0.145537	5	0.045317	no	BRNHPT
chr1_2061187_A_G_b38	ATAD3C	-3.212	0.00167	-0.145537	5	0.045317	no	BRNHPT
chr1_2061762_C_A_b38	ATAD3C	-3.212	0.00167	-0.145537	5	0.045317	no	BRNHPT
chr1_2065120_G_A_b38	ATAD3C	-3.212	0.00167	-0.145537	5	0.045317	no	BRNHPT
chr1_2096462_G_A_b38	ATAD3C	3.204	0.00171	0.124847	14	0.038968	no	BRNHPT
chr1_1344048_G_A_b38	ATAD3C	-3.196	0.00175	-0.144965	4	0.045356	no	BRNHPT
chr1_1364253_C_G_b38	ATAD3C	-3.196	0.00175	-0.144965	4	0.045356	no	BRNHPT
chr1_1482316_C_G_b38	ATAD3C	-3.192	0.00177	-0.119464	14	0.037425	no	BRNHPT
chr1_2057679_A_C_b38	ATAD3C	-3.183	0.00182	-0.1396	6	0.043853	no	BRNHPT
chr1_2060607_C_T_b38	ATAD3C	-3.182	0.00183	-0.138333	6	0.043473	no	BRNHPT
chr1_2101817_G_A_b38	ATAD3C	3.162	0.00195	0.118159	17	0.037371	no	BRNHPT
chr1_1318756_G_A_b38	ATAD3C	3.103	0.00236	0.190376	4	0.061361	no	BRNHPT
chr1_1319063_G_A_b38	ATAD3C	3.103	0.00236	0.190376	4	0.061361	no	BRNHPT
chr1_1319461_C_G_b38	ATAD3C	3.103	0.00236	0.190376	4	0.061361	no	BRNHPT
chr1_1320023_TG_T_b38	ATAD3C	3.103	0.00236	0.190376	4	0.061361	no	BRNHPT
chr1_1322866_A_C_b38	ATAD3C	3.103	0.00236	0.190376	4	0.061361	no	BRNHPT
chr1_1375288_A_C_b38	ATAD3C	3.099	0.00238	0.18481	3	0.059633	no	BRNHPT
chr1_1375595_C_T_b38	ATAD3C	3.099	0.00238	0.18481	3	0.059633	no	BRNHPT
chr1_1376092_G_A_b38	ATAD3C	3.099	0.00238	0.18481	3	0.059633	no	BRNHPT
chr1_1376336_G_A_b38	ATAD3C	3.099	0.00238	0.18481	3	0.059633	no	BRNHPT
chr1_1379664_G_A_b38	ATAD3C	3.099	0.00238	0.18481	3	0.059633	no	BRNHPT
chr1_507505_G_A_b38	ATAD3C	3.084	0.0025	0.180925	3	0.058664	no	BRNHPT
chr1_1363688_C_T_b38	ATAD3C	-3.077	0.00255	-0.139546	4	0.04535	no	BRNHPT
chr1_1364099_CCA_C_b38	ATAD3C	-3.077	0.00255	-0.139546	4	0.04535	no	BRNHPT
chr1_1364102_TGTTG_T_b38	ATAD3C	-3.077	0.00255	-0.139546	4	0.04535	no	BRNHPT
chr1_1366511_GGTGA_G_b38	ATAD3C	-3.077	0.00255	-0.139546	4	0.04535	no	BRNHPT
chr1_1308178_GGGGCGCGGGGA_G_b38	ATAD3C	-3.076	0.00257	-0.131649	6	0.042805	no	BRNHPT
chr1_1368763_G_A_b38	ATAD3C	-3.069	0.00262	-0.13436	5	0.043782	no	BRNHPT
chr1_2101670_C_T_b38	ATAD3C	3.06	0.00269	0.114093	16	0.037281	no	BRNHPT
chr1_1327211_C_T_b38	ATAD3C	3.046	0.00281	0.187485	4	0.061542	no	BRNHPT
chr1_1330080_T_C_b38	ATAD3C	3.046	0.00281	0.187485	4	0.061542	no	BRNHPT
chr1_2101945_G_C_b38	ATAD3C	3.043	0.00284	0.10992	22	0.036126	no	BRNHPT
chr1_1367388_T_TTGG_b38	ATAD3C	-3.035	0.00291	-0.138588	4	0.04566	no	BRNHPT
chr1_1364282_T_G_b38	ATAD3C	-3.035	0.00291	-0.137004	4	0.045147	no	BRNHPT
chr1_1364357_A_C_b38	ATAD3C	-3.035	0.00291	-0.137004	4	0.045147	no	BRNHPT
chr1_1364566_T_C_b38	ATAD3C	-3.035	0.00291	-0.137004	4	0.045147	no	BRNHPT
chr1_1364694_T_C_b38	ATAD3C	-3.035	0.00291	-0.137004	4	0.045147	no	BRNHPT
chr1_1364721_C_T_b38	ATAD3C	-3.035	0.00291	-0.137004	4	0.045147	no	BRNHPT
chr1_1365160_A_G_b38	ATAD3C	-3.035	0.00291	-0.137004	4	0.045147	no	BRNHPT
chr1_1365198_C_T_b38	ATAD3C	-3.035	0.00291	-0.137004	4	0.045147	no	BRNHPT
chr1_1366008_A_G_b38	ATAD3C	-3.035	0.00291	-0.137004	4	0.045147	no	BRNHPT
chr1_1366062_T_C_b38	ATAD3C	-3.035	0.00291	-0.137004	4	0.045147	no	BRNHPT
chr1_1366145_TGTGAA_T_b38	ATAD3C	-3.035	0.00291	-0.137004	4	0.045147	no	BRNHPT
chr1_1366187_A_AGT_b38	ATAD3C	-3.035	0.00291	-0.137004	4	0.045147	no	BRNHPT
chr1_1366292_G_T_b38	ATAD3C	-3.035	0.00291	-0.137004	4	0.045147	no	BRNHPT
chr1_1366321_TGTGTGTAAATGG_T_b38	ATAD3C	-3.035	0.00291	-0.137004	4	0.045147	no	BRNHPT
chr1_1366453_G_T_b38	ATAD3C	-3.035	0.00291	-0.137004	4	0.045147	no	BRNHPT
chr1_1366726_T_G_b38	ATAD3C	-3.035	0.00291	-0.137004	4	0.045147	no	BRNHPT
chr1_1367258_T_A_b38	ATAD3C	-3.035	0.00291	-0.137004	4	0.045147	no	BRNHPT
chr1_1367268_TGA_T_b38	ATAD3C	-3.035	0.00291	-0.137004	4	0.045147	no	BRNHPT
chr1_1367280_T_A_b38	ATAD3C	-3.035	0.00291	-0.137004	4	0.045147	no	BRNHPT
chr1_1367297_GAA_G_b38	ATAD3C	-3.035	0.00291	-0.137004	4	0.045147	no	BRNHPT
chr1_1367300_T_TGA_b38	ATAD3C	-3.035	0.00291	-0.137004	4	0.045147	no	BRNHPT
chr1_1367329_A_AGT_b38	ATAD3C	-3.035	0.00291	-0.137004	4	0.045147	no	BRNHPT
chr1_1367373_T_TGTG_b38	ATAD3C	-3.035	0.00291	-0.137004	4	0.045147	no	BRNHPT
chr1_1367462_T_C_b38	ATAD3C	-3.035	0.00291	-0.137004	4	0.045147	no	BRNHPT
chr1_1367593_G_A_b38	ATAD3C	-3.035	0.00291	-0.137004	4	0.045147	no	BRNHPT
chr1_1367602_GT_G_b38	ATAD3C	-3.035	0.00291	-0.137004	4	0.045147	no	BRNHPT
chr1_1367605_GAGTGAGTGTA_G_b38	ATAD3C	-3.035	0.00291	-0.137004	4	0.045147	no	BRNHPT
chr1_1367670_GGTGA_G_b38	ATAD3C	-3.035	0.00291	-0.137004	4	0.045147	no	BRNHPT
chr1_1367722_TTTTA_T_b38	ATAD3C	-3.035	0.00291	-0.137004	4	0.045147	no	BRNHPT
chr1_1367874_A_T_b38	ATAD3C	-3.035	0.00291	-0.137004	4	0.045147	no	BRNHPT
chr1_1370181_C_T_b38	ATAD3C	-3.035	0.00291	-0.137004	4	0.045147	no	BRNHPT
chr1_1370317_G_C_b38	ATAD3C	-3.035	0.00291	-0.137004	4	0.045147	no	BRNHPT
chr1_1370320_A_G_b38	ATAD3C	-3.035	0.00291	-0.137004	4	0.045147	no	BRNHPT
chr1_1306420_A_G_b38	ATAD3C	3.034	0.00292	0.205267	7	0.06765	no	BRNHPT
chr1_2062283_C_T_b38	ATAD3C	-3.034	0.00292	-0.1455	4	0.047957	no	BRNHPT
chr1_1367919_C_T_b38	ATAD3C	-3.027	0.00298	-0.131954	5	0.043586	no	BRNHPT
chr1_1367951_C_T_b38	ATAD3C	-3.027	0.00298	-0.131954	5	0.043586	no	BRNHPT
chr1_1367965_A_G_b38	ATAD3C	-3.027	0.00298	-0.131954	5	0.043586	no	BRNHPT
chr1_1367970_T_G_b38	ATAD3C	-3.027	0.00298	-0.131954	5	0.043586	no	BRNHPT
chr1_1367994_C_A_b38	ATAD3C	-3.027	0.00298	-0.131954	5	0.043586	no	BRNHPT
chr1_1368297_C_T_b38	ATAD3C	-3.027	0.00298	-0.131954	5	0.043586	no	BRNHPT
chr1_1368514_C_G_b38	ATAD3C	-3.027	0.00298	-0.131954	5	0.043586	no	BRNHPT
chr1_1368991_C_T_b38	ATAD3C	-3.027	0.00298	-0.131954	5	0.043586	no	BRNHPT
chr1_1369009_T_C_b38	ATAD3C	-3.027	0.00298	-0.131954	5	0.043586	no	BRNHPT
chr1_1369012_C_CG_b38	ATAD3C	-3.027	0.00298	-0.131954	5	0.043586	no	BRNHPT
chr1_1369282_G_A_b38	ATAD3C	-3.027	0.00298	-0.131954	5	0.043586	no	BRNHPT
chr1_1369320_GT_G_b38	ATAD3C	-3.027	0.00298	-0.131954	5	0.043586	no	BRNHPT
chr1_1369407_G_A_b38	ATAD3C	-3.027	0.00298	-0.131954	5	0.043586	no	BRNHPT
chr1_1369476_CTT_C_b38	ATAD3C	-3.027	0.00298	-0.131954	5	0.043586	no	BRNHPT
chr1_1369556_C_G_b38	ATAD3C	-3.027	0.00298	-0.131954	5	0.043586	no	BRNHPT
chr1_1369627_T_C_b38	ATAD3C	-3.027	0.00298	-0.131954	5	0.043586	no	BRNHPT
chr1_1369686_T_C_b38	ATAD3C	-3.027	0.00298	-0.131954	5	0.043586	no	BRNHPT
chr1_1369716_G_C_b38	ATAD3C	-3.027	0.00298	-0.131954	5	0.043586	no	BRNHPT
chr1_1369741_C_T_b38	ATAD3C	-3.027	0.00298	-0.131954	5	0.043586	no	BRNHPT
chr1_1368177_G_C_b38	ATAD3C	-3.027	0.00298	-0.132576	5	0.043792	no	BRNHPT
chr1_1363880_A_G_b38	ATAD3C	-3.025	0.003	-0.13599	4	0.044961	no	BRNHPT
chr1_1280044_T_C_b38	ATAD3C	-3.024	0.00301	-0.116869	18	0.038652	no	BRNHPT
chr1_1659940_A_C_b38	ATAD3C	-3.008	0.00316	-0.127242	5	0.042297	no	BRNHPT
chr1_1548572_A_C_b38	ATAD3C	-3	0.00324	-0.10136	26	0.033784	no	BRNHPT
chr1_1773711_T_TGAGA_b38	ATAD3C	2.999	0.00326	0.170228	3	0.056771	no	BRNHPT
chr1_1307327_A_G_b38	ATAD3C	2.998	0.00326	0.199364	7	0.0665	no	BRNHPT
chr1_1381268_C_T_b38	ATAD3C	2.994	0.0033	0.189901	3	0.06343	no	BRNHPT
chr1_1381294_C_T_b38	ATAD3C	2.994	0.0033	0.189901	3	0.06343	no	BRNHPT
chr1_1380790_G_A_b38	ATAD3C	2.991	0.00333	0.187536	3	0.0627	no	BRNHPT
chr1_1369821_C_T_b38	ATAD3C	-2.988	0.00336	-0.130099	5	0.043544	no	BRNHPT
chr1_1329973_GCGTGTGCCATGCA_G_b38	ATAD3C	-2.982	0.00343	-0.136466	4	0.045771	no	BRNHPT
chr1_1363153_T_G_b38	ATAD3C	2.958	0.00369	0.181125	3	0.061239	no	BRNHPT
chr1_1295039_T_C_b38	ATAD3C	-2.948	0.00379	-0.202728	6	0.068762	no	BRNHPT
chr1_1298561_T_C_b38	ATAD3C	-2.948	0.00379	-0.202728	6	0.068762	no	BRNHPT
chr1_2098568_CCT_C_b38	ATAD3C	2.911	0.00424	0.109589	23	0.037645	no	BRNHPT
chr1_1357046_C_G_b38	ATAD3C	2.909	0.00427	0.175666	4	0.060385	no	BRNHPT
chr1_1357369_C_T_b38	ATAD3C	2.909	0.00427	0.175666	4	0.060385	no	BRNHPT
chr1_1360023_T_C_b38	ATAD3C	2.909	0.00427	0.175666	4	0.060385	no	BRNHPT
chr1_2011271_G_GT_b38	ATAD3C	-2.9	0.00439	-0.096889	37	0.03341	no	BRNHPT
chr1_2011271_G_GTT_b38	ATAD3C	2.877	0.0047	0.106871	12	0.037146	no	BRNHPT
chr1_1316929_A_T_b38	ATAD3C	-2.86	0.00494	-0.123507	6	0.043185	no	BRNHPT
chr1_1367511_ATGAG_A_b38	ATAD3C	-2.855	0.00501	-0.136319	3	0.047744	no	BRNHPT
chr1_1500729_G_A_b38	ATAD3C	-2.845	0.00517	-0.223125	8	0.078434	no	BRNHPT
chr1_1545968_T_C_b38	ATAD3C	-2.836	0.00531	-0.112001	11	0.039498	no	BRNHPT
chr1_1366681_T_TGA_b38	ATAD3C	-2.83	0.0054	-0.130873	4	0.046248	no	BRNHPT
chr1_1522905_A_G_b38	ATAD3C	-2.828	0.00542	-0.208796	6	0.073819	no	BRNHPT
chr1_2056605_G_C_b38	ATAD3C	-2.791	0.00605	-0.129647	5	0.046445	no	BRNHPT
chr1_1665061_C_T_b38	ATAD3C	-2.779	0.00627	-0.10703	12	0.038517	no	BRNHPT
chr1_2099538_G_A_b38	ATAD3C	2.763	0.00657	0.106062	16	0.038389	no	BRNHPT
chr1_2071051_C_CACCTGGGCGTGTGACCTGGGCGTGTG_b38	ATAD3C	-2.747	0.00688	-0.120789	6	0.043972	no	BRNHPT
chr1_2075002_G_A_b38	ATAD3C	-2.746	0.00689	-0.128644	5	0.046848	no	BRNHPT
chr1_1303959_T_G_b38	ATAD3C	2.74	0.00702	0.178291	4	0.065076	no	BRNHPT
chr1_2055769_T_C_b38	ATAD3C	-2.722	0.00738	-0.117408	7	0.043129	no	BRNHPT
chr1_1668721_C_T_b38	ATAD3C	-2.717	0.0075	-0.098562	15	0.03628	no	BRNHPT
chr1_1526169_C_T_b38	ATAD3C	-2.7	0.00787	-0.20661	5	0.076534	no	BRNHPT
chr1_1530002_A_G_b38	ATAD3C	-2.7	0.00787	-0.20661	5	0.076534	no	BRNHPT
chr1_1179833_G_T_b38	ATAD3C	-2.699	0.00788	-0.1325	3	0.049087	no	BRNHPT
chr1_1181173_C_G_b38	ATAD3C	-2.699	0.00788	-0.1325	3	0.049087	no	BRNHPT
chr1_2238792_C_T_b38	ATAD3C	2.692	0.00804	0.088858	35	0.033003	no	BRNHPT
chr1_1296939_G_A_b38	ATAD3C	-2.687	0.00816	-0.179518	3	0.066806	no	BRNHPT
chr1_1659060_G_A_b38	ATAD3C	-2.686	0.00819	-0.100043	14	0.037248	no	BRNHPT
chr1_2070129_T_C_b38	ATAD3C	-2.676	0.00841	-0.122806	5	0.045886	no	BRNHPT
chr1_1664757_T_C_b38	ATAD3C	-2.665	0.00869	-0.094694	18	0.035538	no	BRNHPT
chr1_2087423_G_T_b38	ATAD3C	-2.664	0.0087	-0.126468	5	0.047468	no	BRNHPT
chr1_2092415_G_A_b38	ATAD3C	-2.664	0.0087	-0.126468	5	0.047468	no	BRNHPT
chr1_2093894_C_T_b38	ATAD3C	-2.664	0.0087	-0.126468	5	0.047468	no	BRNHPT
chr1_2095729_C_T_b38	ATAD3C	-2.664	0.0087	-0.126468	5	0.047468	no	BRNHPT
chr1_1668108_C_T_b38	ATAD3C	2.654	0.00895	0.093701	20	0.035301	no	BRNHPT
chr1_1358907_C_A_b38	ATAD3C	2.648	0.00911	0.161198	4	0.060879	no	BRNHPT
chr1_2089466_C_T_b38	ATAD3C	-2.624	0.00975	-0.121449	6	0.046292	no	BRNHPT
chr1_1660683_C_T_b38	ATAD3C	-2.618	0.00989	-0.102805	11	0.039261	no	BRNHPT
chr1_1440430_C_G_b38	ATAD3C	-8.036	1.87e-13	-0.211796	21	0.026357	yes	BRNNCC
chr1_1440834_C_G_b38	ATAD3C	-7.629	1.95e-12	-0.205641	30	0.026956	yes	BRNNCC
chr1_1433374_T_C_b38	ATAD3C	-7.625	2e-12	-0.204884	32	0.026871	yes	BRNNCC
chr1_1443457_T_C_b38	ATAD3C	-7.579	2.59e-12	-0.207013	31	0.027313	yes	BRNNCC
chr1_1441187_A_G_b38	ATAD3C	-7.408	6.8e-12	-0.208391	23	0.028129	yes	BRNNCC
chr1_1436388_CA_C_b38	ATAD3C	-7.195	2.23e-11	-0.203527	21	0.028285	yes	BRNNCC
chr1_1445187_T_G_b38	ATAD3C	-6.91	1.07e-10	-0.191415	28	0.027701	yes	BRNNCC
chr1_1436079_A_G_b38	ATAD3C	-6.886	1.22e-10	-0.187913	30	0.02729	yes	BRNNCC
chr1_1442793_G_A_b38	ATAD3C	-6.769	2.3e-10	-0.213353	8	0.03152	yes	BRNNCC
chr1_1448915_G_A_b38	ATAD3C	-6.769	2.3e-10	-0.195293	22	0.028853	yes	BRNNCC
chr1_1445240_A_G_b38	ATAD3C	-6.731	2.81e-10	-0.188341	29	0.027981	yes	BRNNCC
chr1_1431450_A_G_b38	ATAD3C	-6.7	3.32e-10	-0.190091	30	0.028371	yes	BRNNCC
chr1_1431537_G_C_b38	ATAD3C	-6.7	3.32e-10	-0.190091	30	0.028371	yes	BRNNCC
chr1_1430190_A_C_b38	ATAD3C	-6.66	4.12e-10	-0.189733	30	0.028489	yes	BRNNCC
chr1_1426261_C_T_b38	ATAD3C	-6.526	8.38e-10	-0.190661	29	0.029216	yes	BRNNCC
chr1_1426810_C_G_b38	ATAD3C	-6.526	8.38e-10	-0.190661	29	0.029216	yes	BRNNCC
chr1_1430908_A_G_b38	ATAD3C	-6.52	8.63e-10	-0.187892	30	0.028817	yes	BRNNCC
chr1_1428969_T_C_b38	ATAD3C	-6.426	1.41e-09	-0.185239	30	0.028825	yes	BRNNCC
chr1_1431014_G_A_b38	ATAD3C	-6.229	3.93e-09	-0.173282	19	0.027819	yes	BRNNCC
chr1_1432355_G_A_b38	ATAD3C	-6.112	7.14e-09	-0.184202	13	0.030136	yes	BRNNCC
chr1_1449009_A_T_b38	ATAD3C	-6.092	7.94e-09	-0.209797	17	0.034441	yes	BRNNCC
chr1_1438102_G_C_b38	ATAD3C	-6.001	1.25e-08	-0.178692	12	0.029776	yes	BRNNCC
chr1_1435945_C_CCGGGCGGGGGCG_b38	ATAD3C	-5.986	1.35e-08	-0.190414	9	0.031808	yes	BRNNCC
chr1_1434687_C_G_b38	ATAD3C	-5.966	1.5e-08	-0.19138	8	0.03208	yes	BRNNCC
chr1_1439454_A_G_b38	ATAD3C	-5.942	1.69e-08	-0.159655	30	0.026868	yes	BRNNCC
chr1_1439805_G_C_b38	ATAD3C	-5.867	2.45e-08	-0.180029	12	0.030683	yes	BRNNCC
chr1_1431656_G_A_b38	ATAD3C	-5.826	3e-08	-0.191506	7	0.03287	yes	BRNNCC
chr1_1449831_A_G_b38	ATAD3C	-5.672	6.39e-08	-0.190466	24	0.03358	yes	BRNNCC
chr1_1431026_CCACCCCCT_C_b38	ATAD3C	-5.319	3.44e-07	-0.166044	16	0.031217	yes	BRNNCC
chr1_1426253_G_A_b38	ATAD3C	-5.21	5.7e-07	-0.183796	6	0.035276	yes	BRNNCC
chr1_1431813_G_T_b38	ATAD3C	-5.116	8.79e-07	-0.166891	9	0.032623	yes	BRNNCC
chr1_1454315_C_T_b38	ATAD3C	-5.006	1.45e-06	-0.164594	22	0.032881	yes	BRNNCC
chr1_1437955_C_G_b38	ATAD3C	-4.937	1.96e-06	-0.140734	21	0.028504	yes	BRNNCC
chr1_1455617_T_G_b38	ATAD3C	-4.87	2.65e-06	-0.161706	26	0.033204	yes	BRNNCC
chr1_1398056_C_A_b38	ATAD3C	-4.815	3.37e-06	-0.129203	27	0.026833	yes	BRNNCC
chr1_1453643_A_ATT_b38	ATAD3C	-4.808	3.48e-06	-0.159988	15	0.033276	yes	BRNNCC
chr1_1454770_T_C_b38	ATAD3C	-4.783	3.87e-06	-0.157804	26	0.032991	yes	BRNNCC
chr1_1451787_A_C_b38	ATAD3C	-4.666	6.41e-06	-0.151443	21	0.032453	yes	BRNNCC
chr1_1437993_G_A_b38	ATAD3C	-4.637	7.26e-06	-0.143157	12	0.03087	yes	BRNNCC
chr1_1452511_A_G_b38	ATAD3C	-4.635	7.33e-06	-0.154072	25	0.033241	yes	BRNNCC
chr1_1452888_C_A_b38	ATAD3C	-4.635	7.33e-06	-0.154072	25	0.033241	yes	BRNNCC
chr1_1452909_A_C_b38	ATAD3C	-4.635	7.33e-06	-0.154072	25	0.033241	yes	BRNNCC
chr1_1454092_A_G_b38	ATAD3C	-4.635	7.33e-06	-0.154072	25	0.033241	yes	BRNNCC
chr1_1447108_A_ATT_b38	ATAD3C	-4.629	7.52e-06	-0.145188	14	0.031363	yes	BRNNCC
chr1_1453703_A_G_b38	ATAD3C	-4.617	7.92e-06	-0.154299	25	0.03342	yes	BRNNCC
chr1_1337898_A_G_b38	ATAD3C	4.525	1.17e-05	0.137311	13	0.030343	yes	BRNNCC
chr1_1394423_A_G_b38	ATAD3C	-4.403	1.93e-05	-0.135806	23	0.030841	yes	BRNNCC
chr1_1395346_A_G_b38	ATAD3C	-4.403	1.93e-05	-0.135806	23	0.030841	yes	BRNNCC
chr1_1389827_C_T_b38	ATAD3C	4.403	1.93e-05	0.135806	23	0.030841	yes	BRNNCC
chr1_1411323_A_C_b38	ATAD3C	-4.392	2.03e-05	-0.137053	26	0.031208	yes	BRNNCC
chr1_1402457_A_G_b38	ATAD3C	-4.385	2.09e-05	-0.136014	24	0.031017	yes	BRNNCC
chr1_1387698_A_G_b38	ATAD3C	4.385	2.09e-05	0.136014	24	0.031017	yes	BRNNCC
chr1_1384749_C_G_b38	ATAD3C	4.346	2.45e-05	0.13298	21	0.030602	yes	BRNNCC
chr1_1387763_CCT_C_b38	ATAD3C	4.346	2.45e-05	0.13298	21	0.030602	yes	BRNNCC
chr1_1388944_G_A_b38	ATAD3C	4.346	2.45e-05	0.13298	21	0.030602	yes	BRNNCC
chr1_1400410_A_G_b38	ATAD3C	-4.343	2.48e-05	-0.133098	20	0.03065	yes	BRNNCC
chr1_1376162_G_C_b38	ATAD3C	4.324	2.68e-05	0.132053	21	0.030541	yes	BRNNCC
chr1_1377431_C_T_b38	ATAD3C	4.324	2.68e-05	0.132053	21	0.030541	yes	BRNNCC
chr1_1456829_G_C_b38	ATAD3C	-4.301	2.94e-05	-0.148232	21	0.034465	yes	BRNNCC
chr1_1454848_T_C_b38	ATAD3C	-4.223	4.01e-05	-0.139226	16	0.032965	yes	BRNNCC
chr1_1451968_C_T_b38	ATAD3C	-4.205	4.32e-05	-0.140574	14	0.033429	yes	BRNNCC
chr1_1379091_T_G_b38	ATAD3C	4.195	4.49e-05	0.140459	8	0.033482	yes	BRNNCC
chr1_1456154_G_A_b38	ATAD3C	-4.185	4.68e-05	-0.13936	16	0.033299	yes	BRNNCC
chr1_1456217_T_C_b38	ATAD3C	-4.183	4.71e-05	-0.143616	25	0.03433	yes	BRNNCC
chr1_1452384_G_A_b38	ATAD3C	-4.174	4.88e-05	-0.146436	9	0.035081	yes	BRNNCC
chr1_1452540_G_A_b38	ATAD3C	-4.169	4.99e-05	-0.139026	14	0.033348	yes	BRNNCC
chr1_1452825_AAAG_A_b38	ATAD3C	-4.169	4.99e-05	-0.139841	16	0.033544	yes	BRNNCC
chr1_1453552_G_A_b38	ATAD3C	-4.169	4.99e-05	-0.139841	16	0.033544	yes	BRNNCC
chr1_1455134_T_G_b38	ATAD3C	-4.169	4.99e-05	-0.139841	16	0.033544	yes	BRNNCC
chr1_1455337_A_G_b38	ATAD3C	-4.169	4.99e-05	-0.139841	16	0.033544	yes	BRNNCC
chr1_1455495_C_T_b38	ATAD3C	-4.169	4.99e-05	-0.139841	16	0.033544	yes	BRNNCC
chr1_1455924_T_C_b38	ATAD3C	-4.169	4.99e-05	-0.139841	16	0.033544	yes	BRNNCC
chr1_1456051_C_T_b38	ATAD3C	-4.169	4.99e-05	-0.139841	16	0.033544	yes	BRNNCC
chr1_1340697_G_A_b38	ATAD3C	4.16	5.16e-05	0.130704	13	0.031418	yes	BRNNCC
chr1_1452797_CAA_C_b38	ATAD3C	-4.151	5.35e-05	-0.146887	9	0.035387	yes	BRNNCC
chr1_1378204_G_C_b38	ATAD3C	4.134	5.73e-05	0.125171	22	0.03028	yes	BRNNCC
chr1_1522693_A_G_b38	ATAD3C	4.123	5.97e-05	0.14658	6	0.035549	yes	BRNNCC
chr1_1456079_T_C_b38	ATAD3C	-4.12	6.04e-05	-0.139384	16	0.033828	yes	BRNNCC
chr1_1452346_A_G_b38	ATAD3C	-4.119	6.08e-05	-0.143685	9	0.034887	yes	BRNNCC
chr1_1428999_C_CA_b38	ATAD3C	-4.112	6.24e-05	-0.136097	11	0.033097	yes	BRNNCC
chr1_1453870_A_C_b38	ATAD3C	-4.065	7.48e-05	-0.147684	8	0.036328	yes	BRNNCC
chr1_1453961_C_T_b38	ATAD3C	-4.065	7.48e-05	-0.147684	8	0.036328	yes	BRNNCC
chr1_1330125_G_A_b38	ATAD3C	4.043	8.15e-05	0.125883	25	0.031132	yes	BRNNCC
chr1_1450636_A_G_b38	ATAD3C	-4.035	8.41e-05	-0.142997	9	0.035437	yes	BRNNCC
chr1_1457071_C_T_b38	ATAD3C	-3.984	0.000103	-0.128249	17	0.032195	yes	BRNNCC
chr1_1309988_G_A_b38	ATAD3C	3.945	0.000119	0.122695	25	0.031103	yes	BRNNCC
chr1_1312114_T_C_b38	ATAD3C	3.945	0.000119	0.122695	25	0.031103	yes	BRNNCC
chr1_1358384_G_C_b38	ATAD3C	3.934	0.000124	0.122698	24	0.031186	yes	BRNNCC
chr1_1313807_G_A_b38	ATAD3C	3.887	0.000148	0.121135	25	0.031164	yes	BRNNCC
chr1_1308516_C_T_b38	ATAD3C	3.874	0.000155	0.121355	25	0.031323	yes	BRNNCC
chr1_1370553_CA_C_b38	ATAD3C	3.834	0.000181	0.105251	53	0.027454	yes	BRNNCC
chr1_1366561_AGT_A_b38	ATAD3C	3.828	0.000185	0.119022	23	0.031092	yes	BRNNCC
chr1_1532798_T_C_b38	ATAD3C	-3.823	0.000188	-0.1059	50	0.0277	yes	BRNNCC
chr1_1379083_AT_A_b38	ATAD3C	3.817	0.000192	0.1174	15	0.030755	yes	BRNNCC
chr1_1574445_A_G_b38	ATAD3C	-3.814	0.000195	-0.112783	32	0.029573	yes	BRNNCC
chr1_1451028_T_A_b38	ATAD3C	-3.81	0.000197	-0.134868	9	0.035396	yes	BRNNCC
chr1_1456891_T_C_b38	ATAD3C	-3.792	0.000211	-0.118394	19	0.031221	yes	BRNNCC
chr1_1482316_C_G_b38	ATAD3C	-3.777	0.000223	-0.116309	13	0.030794	yes	BRNNCC
chr1_1457033_A_C_b38	ATAD3C	-3.766	0.000232	-0.124013	16	0.032932	yes	BRNNCC
chr1_1575421_C_T_b38	ATAD3C	-3.754	0.000242	-0.110711	31	0.029488	yes	BRNNCC
chr1_1456182_G_A_b38	ATAD3C	-3.752	0.000245	-0.123014	18	0.032789	yes	BRNNCC
chr1_1366427_AGTGTGATTGAATGAGT_A_b38	ATAD3C	3.739	0.000256	0.115718	19	0.030945	yes	BRNNCC
chr1_1184277_G_C_b38	ATAD3C	-3.667	0.000333	-0.108975	36	0.029721	yes	BRNNCC
chr1_1577491_A_AC_b38	ATAD3C	-3.666	0.000334	-0.108373	33	0.029561	yes	BRNNCC
chr1_1575724_G_C_b38	ATAD3C	-3.614	0.000403	-0.105418	31	0.029171	yes	BRNNCC
chr1_1573654_T_C_b38	ATAD3C	-3.596	0.000429	-0.105501	32	0.029338	yes	BRNNCC
chr1_1537160_T_G_b38	ATAD3C	-3.561	0.000487	-0.105221	39	0.029552	yes	BRNNCC
chr1_1366941_T_TGTGTGCA_b38	ATAD3C	3.541	0.000522	0.148866	4	0.042041	yes	BRNNCC
chr1_1370113_A_G_b38	ATAD3C	3.513	0.000575	0.106016	20	0.030177	yes	BRNNCC
chr1_1380867_A_G_b38	ATAD3C	-3.505	0.000592	-0.125001	7	0.035666	yes	BRNNCC
chr1_1570294_CA_C_b38	ATAD3C	-3.501	0.000599	-0.104141	32	0.029743	yes	BRNNCC
chr1_1567912_C_CAAAAAAAA_b38	ATAD3C	-3.464	0.000683	-0.161745	6	0.0467	yes	BRNNCC
chr1_1375642_C_T_b38	ATAD3C	-3.46	0.000691	-0.123588	7	0.035718	yes	BRNNCC
chr1_1551557_A_AG_b38	ATAD3C	-3.445	0.000729	-0.105537	30	0.030636	yes	BRNNCC
chr1_1551559_A_T_b38	ATAD3C	-3.445	0.000729	-0.105537	30	0.030636	yes	BRNNCC
chr1_1384546_C_T_b38	ATAD3C	-3.411	0.000818	-0.122639	7	0.035952	yes	BRNNCC
chr1_1398218_C_A_b38	ATAD3C	-3.411	0.000818	-0.122639	7	0.035952	yes	BRNNCC
chr1_1400756_GGA_G_b38	ATAD3C	-3.411	0.000818	-0.122639	7	0.035952	yes	BRNNCC
chr1_1401954_G_T_b38	ATAD3C	-3.411	0.000818	-0.122639	7	0.035952	yes	BRNNCC
chr1_1403593_A_G_b38	ATAD3C	-3.411	0.000818	-0.122639	7	0.035952	yes	BRNNCC
chr1_1407565_C_A_b38	ATAD3C	-3.411	0.000818	-0.122639	7	0.035952	yes	BRNNCC
chr1_1569180_T_A_b38	ATAD3C	-3.403	0.000841	-0.10063	33	0.029571	yes	BRNNCC
chr1_1541864_T_C_b38	ATAD3C	-3.402	0.000843	-0.105569	30	0.031028	yes	BRNNCC
chr1_976536_C_T_b38	ATAD3C	3.394	0.000867	0.14037	3	0.041357	yes	BRNNCC
chr1_978230_G_A_b38	ATAD3C	3.394	0.000867	0.14037	3	0.041357	yes	BRNNCC
chr1_1366951_A_AGT_b38	ATAD3C	3.393	0.000871	0.143627	4	0.042333	yes	BRNNCC
chr1_940296_GC_G_b38	ATAD3C	3.391	0.000875	0.167264	3	0.049321	yes	BRNNCC
chr1_1382893_G_A_b38	ATAD3C	-3.379	0.000914	-0.121148	7	0.035858	yes	BRNNCC
chr1_1383743_T_C_b38	ATAD3C	-3.36	0.000972	-0.120798	7	0.035948	yes	BRNNCC
chr1_1361679_G_A_b38	ATAD3C	3.322	0.00111	0.111025	13	0.033422	yes	BRNNCC
chr1_1182018_A_G_b38	ATAD3C	-3.291	0.00123	-0.09829	35	0.029864	yes	BRNNCC
chr1_1374505_A_G_b38	ATAD3C	-3.257	0.00137	-0.115557	7	0.03548	yes	BRNNCC
chr1_1566086_G_A_b38	ATAD3C	-3.254	0.00139	-0.096621	34	0.029694	yes	BRNNCC
chr1_1543953_A_G_b38	ATAD3C	-3.249	0.00141	-0.099215	29	0.030537	yes	BRNNCC
chr1_1538787_A_G_b38	ATAD3C	-3.245	0.00143	-0.097275	33	0.029975	yes	BRNNCC
chr1_981935_G_A_b38	ATAD3C	3.215	0.00157	0.129794	4	0.040366	yes	BRNNCC
chr1_1550064_GC_G_b38	ATAD3C	-3.208	0.00161	-0.096896	30	0.030206	yes	BRNNCC
chr1_1550068_C_A_b38	ATAD3C	-3.208	0.00161	-0.096896	30	0.030206	yes	BRNNCC
chr1_1569661_T_C_b38	ATAD3C	-3.203	0.00164	-0.093245	32	0.02911	yes	BRNNCC
chr1_1566854_CA_C_b38	ATAD3C	-3.202	0.00164	-0.10053	25	0.031392	yes	BRNNCC
chr1_1558726_C_CA_b38	ATAD3C	-3.197	0.00167	-0.097363	31	0.030459	yes	BRNNCC
chr1_1561821_A_C_b38	ATAD3C	-3.197	0.00167	-0.097363	31	0.030459	yes	BRNNCC
chr1_1542773_T_C_b38	ATAD3C	-3.196	0.00168	-0.097377	29	0.030472	yes	BRNNCC
chr1_1542793_C_G_b38	ATAD3C	-3.196	0.00168	-0.097377	29	0.030472	yes	BRNNCC
chr1_1542800_T_C_b38	ATAD3C	-3.196	0.00168	-0.097377	29	0.030472	yes	BRNNCC
chr1_1557495_CAT_C_b38	ATAD3C	-3.192	0.0017	-0.097376	31	0.030505	yes	BRNNCC
chr1_1188054_T_A_b38	ATAD3C	-3.184	0.00174	-0.111351	8	0.034973	yes	BRNNCC
chr1_1180931_A_G_b38	ATAD3C	-3.181	0.00176	-0.092812	38	0.029177	yes	BRNNCC
chr1_981282_A_C_b38	ATAD3C	3.169	0.00183	0.131901	3	0.041616	yes	BRNNCC
chr1_1363456_CAG_C_b38	ATAD3C	3.155	0.00192	0.093574	17	0.029662	yes	BRNNCC
chr1_1565105_CAAGGCAGGCGGATCATG_C_b38	ATAD3C	-3.139	0.00202	-0.092388	35	0.029434	yes	BRNNCC
chr1_1565680_A_AG_b38	ATAD3C	-3.127	0.0021	-0.091542	33	0.029274	yes	BRNNCC
chr1_1500745_A_C_b38	ATAD3C	-3.125	0.00211	-0.154973	15	0.049588	yes	BRNNCC
chr1_1574032_AAAG_A_b38	ATAD3C	-3.124	0.00212	-0.107548	15	0.034432	yes	BRNNCC
chr1_1545795_C_A_b38	ATAD3C	-3.106	0.00224	-0.094496	26	0.030422	yes	BRNNCC
chr1_1543500_T_G_b38	ATAD3C	-3.072	0.0025	-0.094253	29	0.030681	yes	BRNNCC
chr1_1551454_C_A_b38	ATAD3C	-3.067	0.00254	-0.085722	51	0.02795	yes	BRNNCC
chr1_1363898_C_T_b38	ATAD3C	3.066	0.00255	0.105216	7	0.034322	yes	BRNNCC
chr1_1363986_C_T_b38	ATAD3C	3.066	0.00255	0.105216	7	0.034322	yes	BRNNCC
chr1_1365566_G_A_b38	ATAD3C	3.066	0.00255	0.105216	7	0.034322	yes	BRNNCC
chr1_1366529_TTAG_T_b38	ATAD3C	3.066	0.00255	0.105216	7	0.034322	yes	BRNNCC
chr1_1367292_A_AGT_b38	ATAD3C	3.066	0.00255	0.105216	7	0.034322	yes	BRNNCC
chr1_1549590_C_G_b38	ATAD3C	-3.065	0.00255	-0.089531	33	0.029212	yes	BRNNCC
chr1_1553692_A_G_b38	ATAD3C	-3.065	0.00255	-0.089531	33	0.029212	yes	BRNNCC
chr1_1554694_A_G_b38	ATAD3C	-3.065	0.00255	-0.089531	33	0.029212	yes	BRNNCC
chr1_1555247_T_A_b38	ATAD3C	-3.065	0.00255	-0.089531	33	0.029212	yes	BRNNCC
chr1_982112_C_T_b38	ATAD3C	3.063	0.00257	0.131085	3	0.042793	yes	BRNNCC
chr1_982890_C_T_b38	ATAD3C	3.063	0.00257	0.131085	3	0.042793	yes	BRNNCC
chr1_983237_G_A_b38	ATAD3C	3.063	0.00257	0.131085	3	0.042793	yes	BRNNCC
chr1_1259424_T_C_b38	ATAD3C	-3.061	0.00259	-0.098505	24	0.032183	yes	BRNNCC
chr1_1559750_C_CAG_b38	ATAD3C	-3.052	0.00266	-0.08986	34	0.029441	yes	BRNNCC
chr1_1561628_T_C_b38	ATAD3C	-3.052	0.00266	-0.08986	34	0.029441	yes	BRNNCC
chr1_1563918_A_G_b38	ATAD3C	-3.052	0.00266	-0.08986	34	0.029441	yes	BRNNCC
chr1_1565561_A_G_b38	ATAD3C	-3.052	0.00266	-0.08986	34	0.029441	yes	BRNNCC
chr1_1567715_G_A_b38	ATAD3C	-3.052	0.00266	-0.08986	34	0.029441	yes	BRNNCC
chr1_1567719_A_C_b38	ATAD3C	-3.052	0.00266	-0.08986	34	0.029441	yes	BRNNCC
chr1_1569875_C_T_b38	ATAD3C	-3.052	0.00266	-0.08986	34	0.029441	yes	BRNNCC
chr1_1549967_C_G_b38	ATAD3C	-3.05	0.00268	-0.093514	17	0.030662	yes	BRNNCC
chr1_1572532_A_C_b38	ATAD3C	-3.047	0.0027	-0.089532	34	0.029381	yes	BRNNCC
chr1_1573079_A_G_b38	ATAD3C	-3.047	0.0027	-0.089532	34	0.029381	yes	BRNNCC
chr1_1407232_G_C_b38	ATAD3C	-3.018	0.00295	-0.096407	11	0.031939	yes	BRNNCC
chr1_1379093_TG_T_b38	ATAD3C	-3.015	0.00298	-0.112585	6	0.037338	yes	BRNNCC
chr1_1471992_T_C_b38	ATAD3C	-3.003	0.0031	-0.098089	28	0.032665	yes	BRNNCC
chr1_1290841_A_G_b38	ATAD3C	-2.974	0.00339	-0.105697	12	0.035538	yes	BRNNCC
chr1_1173872_A_G_b38	ATAD3C	-2.953	0.00361	-0.084209	24	0.028512	yes	BRNNCC
chr1_1554781_A_G_b38	ATAD3C	-2.936	0.00381	-0.085611	33	0.029158	yes	BRNNCC
chr1_1554852_T_C_b38	ATAD3C	-2.936	0.00381	-0.085404	33	0.029091	yes	BRNNCC
chr1_1221049_C_G_b38	ATAD3C	-2.918	0.00403	-0.090748	22	0.031101	yes	BRNNCC
chr1_1877314_A_T_b38	ATAD3C	2.909	0.00414	0.09943	12	0.034185	yes	BRNNCC
chr1_1479719_T_C_b38	ATAD3C	-2.906	0.00418	-0.094803	28	0.032627	yes	BRNNCC
chr1_1252613_C_G_b38	ATAD3C	-2.9	0.00425	-0.124235	3	0.042836	yes	BRNNCC
chr1_1571794_A_AT_b38	ATAD3C	-2.9	0.00425	-0.089302	28	0.030795	yes	BRNNCC
chr1_1375678_TA_T_b38	ATAD3C	2.898	0.00428	0.110819	13	0.03824	yes	BRNNCC
chr1_1591703_T_C_b38	ATAD3C	-2.897	0.00429	-0.078519	34	0.027103	yes	BRNNCC
chr1_1497605_G_C_b38	ATAD3C	-2.889	0.00439	-0.088126	25	0.030502	yes	BRNNCC
chr1_1515567_A_C_b38	ATAD3C	-2.875	0.00458	-0.18691	7	0.065002	yes	BRNNCC
chr1_1547630_G_A_b38	ATAD3C	-2.851	0.00493	-0.082692	29	0.029007	yes	BRNNCC
chr1_1501260_A_AT_b38	ATAD3C	-2.836	0.00515	-0.110842	6	0.039081	yes	BRNNCC
chr1_1388565_GTC_G_b38	ATAD3C	2.8	0.00574	0.093348	11	0.033341	yes	BRNNCC
chr1_1548572_A_AC_b38	ATAD3C	-2.8	0.00574	-0.161748	3	0.057772	yes	BRNNCC
chr1_1517993_A_G_b38	ATAD3C	-2.764	0.00638	-0.082384	34	0.029811	yes	BRNNCC
chr1_1519934_T_G_b38	ATAD3C	-2.764	0.00638	-0.082384	34	0.029811	yes	BRNNCC
chr1_1519938_T_C_b38	ATAD3C	-2.764	0.00638	-0.082384	34	0.029811	yes	BRNNCC
chr1_1533841_T_C_b38	ATAD3C	-2.753	0.00658	-0.095322	17	0.034621	yes	BRNNCC
chr1_1258206_AT_A_b38	ATAD3C	-2.697	0.00773	-0.083839	23	0.031082	yes	BRNNCC
chr1_914618_A_G_b38	ATAD3C	2.672	0.00831	0.104336	3	0.039044	yes	BRNNCC
chr1_1693427_G_A_b38	ATAD3C	-2.667	0.00843	-0.091851	29	0.03444	yes	BRNNCC
chr1_916753_C_T_b38	ATAD3C	2.662	0.00856	0.103533	4	0.038897	yes	BRNNCC
chr1_1584235_A_AT_b38	ATAD3C	2.657	0.00868	0.078626	31	0.029594	yes	BRNNCC
chr1_1367954_A_C_b38	ATAD3C	-2.651	0.00882	-0.124451	3	0.046942	yes	BRNNCC
chr1_1301426_A_AT_b38	ATAD3C	-2.624	0.00953	-0.088665	13	0.03379	yes	BRNNCC
chr1_1236037_C_T_b38	ATAD3C	-2.614	0.00979	-0.073074	34	0.02795	yes	BRNNCC
chr1_1394041_G_A_b38	ATAD3C	-3.641	0.000366	-0.136018	5	0.037357	no	BRNNCC
chr1_1514211_A_G_b38	ATAD3C	-3.479	0.000647	-0.238976	3	0.068685	no	BRNNCC
chr1_1325753_G_T_b38	ATAD3C	-3.263	0.00134	-0.127231	4	0.038989	no	BRNNCC
chr1_1303112_G_A_b38	ATAD3C	-3.229	0.00151	-0.125989	4	0.039021	no	BRNNCC
chr1_1303800_G_A_b38	ATAD3C	-3.229	0.00151	-0.125989	4	0.039021	no	BRNNCC
chr1_1304555_A_C_b38	ATAD3C	-3.229	0.00151	-0.125989	4	0.039021	no	BRNNCC
chr1_1235602_C_A_b38	ATAD3C	-3.193	0.00169	-0.119315	4	0.037364	no	BRNNCC
chr1_507505_G_A_b38	ATAD3C	3.111	0.00221	0.149567	3	0.048081	no	BRNNCC
chr1_1370553_CAAA_C_b38	ATAD3C	-3.087	0.00238	-0.124599	5	0.040363	no	BRNNCC
chr1_1231507_T_C_b38	ATAD3C	-3.08	0.00244	-0.11041	5	0.035849	no	BRNNCC
chr1_1523187_A_G_b38	ATAD3C	-3.054	0.00264	-0.175535	10	0.05747	no	BRNNCC
chr1_975555_G_A_b38	ATAD3C	2.992	0.00321	0.110687	6	0.036995	no	BRNNCC
chr1_1228424_C_T_b38	ATAD3C	-2.966	0.00347	-0.106474	5	0.035893	no	BRNNCC
chr1_1308178_GGGGCGCGGGGA_G_b38	ATAD3C	-2.943	0.00373	-0.105261	8	0.035765	no	BRNNCC
chr1_1302795_T_TC_b38	ATAD3C	2.934	0.00384	0.093263	27	0.031787	no	BRNNCC
chr1_1226486_C_T_b38	ATAD3C	-2.895	0.00432	-0.108377	4	0.037438	no	BRNNCC
chr1_1363601_A_AT_b38	ATAD3C	2.882	0.00449	0.079948	48	0.027737	no	BRNNCC
chr1_1526169_C_T_b38	ATAD3C	-2.861	0.00479	-0.175768	7	0.061445	no	BRNNCC
chr1_1530002_A_G_b38	ATAD3C	-2.861	0.00479	-0.175768	7	0.061445	no	BRNNCC
chr1_1231710_CCCCCGGGAA_C_b38	ATAD3C	-2.845	0.00502	-0.10462	5	0.03677	no	BRNNCC
chr1_1215852_T_C_b38	ATAD3C	-2.834	0.00518	-0.099856	7	0.035231	no	BRNNCC
chr1_1368047_ACT_A_b38	ATAD3C	2.818	0.00544	0.139663	6	0.049565	no	BRNNCC
chr1_1361833_G_C_b38	ATAD3C	2.816	0.00547	0.113945	7	0.040465	no	BRNNCC
chr1_1520875_A_G_b38	ATAD3C	-2.794	0.00583	-0.172514	8	0.061736	no	BRNNCC
chr1_1524202_G_A_b38	ATAD3C	-2.794	0.00583	-0.172514	8	0.061736	no	BRNNCC
chr1_1533018_T_C_b38	ATAD3C	-2.794	0.00583	-0.172514	8	0.061736	no	BRNNCC
chr1_1363153_T_G_b38	ATAD3C	2.775	0.00616	0.137409	6	0.049508	no	BRNNCC
chr1_1522905_A_G_b38	ATAD3C	-2.745	0.00675	-0.16587	8	0.060437	no	BRNNCC
chr1_1359943_G_A_b38	ATAD3C	2.688	0.00794	0.138052	8	0.051356	no	BRNNCC
chr1_1201373_T_C_b38	ATAD3C	-2.684	0.00802	-0.093392	15	0.03479	no	BRNNCC
chr1_1353443_A_G_b38	ATAD3C	2.675	0.00823	0.126668	5	0.047345	no	BRNNCC
chr1_1324173_G_GGGCTCGGGGGCTGGGGGGCTGCTGGGCTGAGA_b38	ATAD3C	2.664	0.00851	0.064226	15	0.024112	no	BRNNCC
chr1_1329973_GCGTGTGCCATGCA_G_b38	ATAD3C	-2.658	0.00866	-0.098137	5	0.036927	no	BRNNCC
chr1_1344048_G_A_b38	ATAD3C	-2.658	0.00866	-0.098137	5	0.036927	no	BRNNCC
chr1_1524911_C_T_b38	ATAD3C	-2.637	0.00919	-0.167078	4	0.063369	no	BRNNCC
chr1_1341550_GCA_G_b38	ATAD3C	-2.63	0.00938	-0.097056	6	0.03691	no	BRNNCC
chr1_1229369_G_GC_b38	ATAD3C	-2.623	0.00956	-0.093537	7	0.035663	no	BRNNCC
chr1_1440834_C_G_b38	ATAD3C	-8.962	3.08e-15	-0.241111	24	0.026902	yes	BRNPTM
chr1_1440430_C_G_b38	ATAD3C	-8.717	1.21e-14	-0.234874	16	0.026943	yes	BRNPTM
chr1_1443457_T_C_b38	ATAD3C	-8.716	1.22e-14	-0.239393	24	0.027467	yes	BRNPTM
chr1_1439454_A_G_b38	ATAD3C	-8.34	9.72e-14	-0.216836	25	0.026	yes	BRNPTM
chr1_1433374_T_C_b38	ATAD3C	-8.101	3.59e-13	-0.228667	26	0.028227	yes	BRNPTM
chr1_1441187_A_G_b38	ATAD3C	-7.981	6.88e-13	-0.224156	18	0.028085	yes	BRNPTM
chr1_1436388_CA_C_b38	ATAD3C	-7.971	7.26e-13	-0.224395	16	0.02815	yes	BRNPTM
chr1_1436079_A_G_b38	ATAD3C	-7.97	7.32e-13	-0.22261	24	0.027931	yes	BRNPTM
chr1_1445187_T_G_b38	ATAD3C	-7.195	4.54e-11	-0.20341	21	0.02827	yes	BRNPTM
chr1_1430908_A_G_b38	ATAD3C	-7.091	7.83e-11	-0.210953	24	0.02975	yes	BRNPTM
chr1_1431450_A_G_b38	ATAD3C	-7.091	7.83e-11	-0.210953	24	0.02975	yes	BRNPTM
chr1_1431537_G_C_b38	ATAD3C	-7.091	7.83e-11	-0.210953	24	0.02975	yes	BRNPTM
chr1_1430190_A_C_b38	ATAD3C	-6.959	1.55e-10	-0.207892	24	0.029874	yes	BRNPTM
chr1_1445240_A_G_b38	ATAD3C	-6.917	1.93e-10	-0.198993	22	0.028769	yes	BRNPTM
chr1_1428969_T_C_b38	ATAD3C	-6.605	9.43e-10	-0.199167	24	0.030153	yes	BRNPTM
chr1_1432355_G_A_b38	ATAD3C	-6.191	7.39e-09	-0.191226	9	0.030889	yes	BRNPTM
chr1_1448915_G_A_b38	ATAD3C	-6.188	7.5e-09	-0.180018	16	0.029093	yes	BRNPTM
chr1_1426261_C_T_b38	ATAD3C	-6.083	1.25e-08	-0.191077	23	0.031413	yes	BRNPTM
chr1_1426810_C_G_b38	ATAD3C	-6.083	1.25e-08	-0.191077	23	0.031413	yes	BRNPTM
chr1_1431014_G_A_b38	ATAD3C	-6.006	1.81e-08	-0.172776	15	0.028767	yes	BRNPTM
chr1_1434687_C_G_b38	ATAD3C	-5.896	3.07e-08	-0.195725	6	0.033196	yes	BRNPTM
chr1_1431026_CCACCCCCT_C_b38	ATAD3C	-5.893	3.11e-08	-0.189194	13	0.032103	yes	BRNPTM
chr1_1438102_G_C_b38	ATAD3C	-5.882	3.29e-08	-0.183809	10	0.031252	yes	BRNPTM
chr1_1387698_A_G_b38	ATAD3C	5.516	1.82e-07	0.165325	22	0.02997	yes	BRNPTM
chr1_1389827_C_T_b38	ATAD3C	5.516	1.82e-07	0.165325	22	0.02997	yes	BRNPTM
chr1_1394423_A_G_b38	ATAD3C	-5.516	1.82e-07	-0.165325	22	0.02997	yes	BRNPTM
chr1_1395346_A_G_b38	ATAD3C	-5.516	1.82e-07	-0.165325	22	0.02997	yes	BRNPTM
chr1_1402457_A_G_b38	ATAD3C	-5.516	1.82e-07	-0.165325	22	0.02997	yes	BRNPTM
chr1_1452797_CAA_C_b38	ATAD3C	-5.503	1.93e-07	-0.188503	8	0.034254	yes	BRNPTM
chr1_1378204_G_C_b38	ATAD3C	5.47	2.25e-07	0.157525	21	0.028796	yes	BRNPTM
chr1_1442793_G_A_b38	ATAD3C	-5.422	2.8e-07	-0.183156	6	0.033778	yes	BRNPTM
chr1_1400410_A_G_b38	ATAD3C	-5.418	2.85e-07	-0.159591	19	0.029455	yes	BRNPTM
chr1_1376162_G_C_b38	ATAD3C	5.406	3.01e-07	0.159538	20	0.029511	yes	BRNPTM
chr1_1377431_C_T_b38	ATAD3C	5.406	3.01e-07	0.159538	20	0.029511	yes	BRNPTM
chr1_1384749_C_G_b38	ATAD3C	5.405	3.03e-07	0.159281	20	0.029469	yes	BRNPTM
chr1_1387763_CCT_C_b38	ATAD3C	5.405	3.03e-07	0.159281	20	0.029469	yes	BRNPTM
chr1_1388944_G_A_b38	ATAD3C	5.405	3.03e-07	0.159281	20	0.029469	yes	BRNPTM
chr1_1435945_C_CCGGGCGGGGGCG_b38	ATAD3C	-5.373	3.5e-07	-0.184885	6	0.034412	yes	BRNPTM
chr1_1449831_A_G_b38	ATAD3C	-5.357	3.76e-07	-0.185082	19	0.034547	yes	BRNPTM
chr1_1370113_A_G_b38	ATAD3C	5.303	4.8e-07	0.156273	18	0.02947	yes	BRNPTM
chr1_1439805_G_C_b38	ATAD3C	-5.264	5.71e-07	-0.176136	8	0.033459	yes	BRNPTM
chr1_1337898_A_G_b38	ATAD3C	5.206	7.42e-07	0.160927	10	0.030914	yes	BRNPTM
chr1_1398056_C_A_b38	ATAD3C	-5.198	7.67e-07	-0.142037	20	0.027326	yes	BRNPTM
chr1_1379083_AT_A_b38	ATAD3C	5.157	9.22e-07	0.154199	14	0.029903	yes	BRNPTM
chr1_1411323_A_C_b38	ATAD3C	-5.083	1.28e-06	-0.154869	23	0.030469	yes	BRNPTM
chr1_1366941_T_TGTGTGCA_b38	ATAD3C	5.081	1.29e-06	0.201573	3	0.039671	yes	BRNPTM
chr1_1358384_G_C_b38	ATAD3C	5.054	1.45e-06	0.156427	21	0.03095	yes	BRNPTM
chr1_1366561_AGT_A_b38	ATAD3C	5.054	1.45e-06	0.156427	21	0.03095	yes	BRNPTM
chr1_1366951_A_AGT_b38	ATAD3C	5.049	1.48e-06	0.20104	3	0.039816	yes	BRNPTM
chr1_1366427_AGTGTGATTGAATGAGT_A_b38	ATAD3C	4.898	2.85e-06	0.148276	17	0.030276	yes	BRNPTM
chr1_1309988_G_A_b38	ATAD3C	4.893	2.91e-06	0.151689	21	0.031003	yes	BRNPTM
chr1_1312114_T_C_b38	ATAD3C	4.893	2.91e-06	0.151689	21	0.031003	yes	BRNPTM
chr1_1313807_G_A_b38	ATAD3C	4.893	2.91e-06	0.151689	21	0.031003	yes	BRNPTM
chr1_1330125_G_A_b38	ATAD3C	4.893	2.91e-06	0.151689	21	0.031003	yes	BRNPTM
chr1_921056_TG_T_b38	ATAD3C	4.861	3.34e-06	0.172548	4	0.035498	yes	BRNPTM
chr1_1308516_C_T_b38	ATAD3C	4.848	3.53e-06	0.151064	21	0.031162	yes	BRNPTM
chr1_1455617_T_G_b38	ATAD3C	-4.83	3.81e-06	-0.166798	21	0.034536	yes	BRNPTM
chr1_1449009_A_T_b38	ATAD3C	-4.829	3.82e-06	-0.170064	13	0.035217	yes	BRNPTM
chr1_1541864_T_C_b38	ATAD3C	-4.781	4.69e-06	-0.140843	24	0.029461	yes	BRNPTM
chr1_1574445_A_G_b38	ATAD3C	-4.713	6.24e-06	-0.134483	26	0.028536	yes	BRNPTM
chr1_1551557_A_AG_b38	ATAD3C	-4.652	8.03e-06	-0.138098	23	0.029686	yes	BRNPTM
chr1_1551559_A_T_b38	ATAD3C	-4.652	8.03e-06	-0.138098	23	0.029686	yes	BRNPTM
chr1_1456154_G_A_b38	ATAD3C	-4.635	8.62e-06	-0.157051	12	0.033884	yes	BRNPTM
chr1_1452825_AAAG_A_b38	ATAD3C	-4.635	8.62e-06	-0.158182	12	0.034129	yes	BRNPTM
chr1_1453552_G_A_b38	ATAD3C	-4.635	8.62e-06	-0.158182	12	0.034129	yes	BRNPTM
chr1_1455134_T_G_b38	ATAD3C	-4.635	8.62e-06	-0.158182	12	0.034129	yes	BRNPTM
chr1_1455337_A_G_b38	ATAD3C	-4.635	8.62e-06	-0.158182	12	0.034129	yes	BRNPTM
chr1_1455495_C_T_b38	ATAD3C	-4.635	8.62e-06	-0.158182	12	0.034129	yes	BRNPTM
chr1_1455924_T_C_b38	ATAD3C	-4.635	8.62e-06	-0.158182	12	0.034129	yes	BRNPTM
chr1_1456051_C_T_b38	ATAD3C	-4.635	8.62e-06	-0.158182	12	0.034129	yes	BRNPTM
chr1_1456079_T_C_b38	ATAD3C	-4.635	8.62e-06	-0.158182	12	0.034129	yes	BRNPTM
chr1_1454770_T_C_b38	ATAD3C	-4.634	8.66e-06	-0.159597	21	0.03444	yes	BRNPTM
chr1_1453703_A_G_b38	ATAD3C	-4.62	9.17e-06	-0.160344	20	0.034705	yes	BRNPTM
chr1_1457033_A_C_b38	ATAD3C	-4.596	1.01e-05	-0.154249	12	0.03356	yes	BRNPTM
chr1_1454315_C_T_b38	ATAD3C	-4.565	1.15e-05	-0.15503	17	0.03396	yes	BRNPTM
chr1_912710_G_A_b38	ATAD3C	4.562	1.17e-05	0.156584	5	0.034325	yes	BRNPTM
chr1_913358_C_T_b38	ATAD3C	4.562	1.17e-05	0.156584	5	0.034325	yes	BRNPTM
chr1_914743_C_T_b38	ATAD3C	4.562	1.17e-05	0.156584	5	0.034325	yes	BRNPTM
chr1_917284_C_T_b38	ATAD3C	4.562	1.17e-05	0.156584	5	0.034325	yes	BRNPTM
chr1_917378_G_C_b38	ATAD3C	4.562	1.17e-05	0.156584	5	0.034325	yes	BRNPTM
chr1_1543500_T_G_b38	ATAD3C	-4.54	1.28e-05	-0.132148	24	0.029109	yes	BRNPTM
chr1_913274_TG_T_b38	ATAD3C	4.516	1.41e-05	0.155764	5	0.034493	yes	BRNPTM
chr1_917859_A_G_b38	ATAD3C	4.516	1.41e-05	0.155764	5	0.034493	yes	BRNPTM
chr1_1451787_A_C_b38	ATAD3C	-4.499	1.5e-05	-0.153876	17	0.034199	yes	BRNPTM
chr1_1452346_A_G_b38	ATAD3C	-4.492	1.55e-05	-0.156441	8	0.034824	yes	BRNPTM
chr1_1452511_A_G_b38	ATAD3C	-4.476	1.66e-05	-0.155082	20	0.034651	yes	BRNPTM
chr1_1452888_C_A_b38	ATAD3C	-4.476	1.66e-05	-0.155082	20	0.034651	yes	BRNPTM
chr1_1452909_A_C_b38	ATAD3C	-4.476	1.66e-05	-0.155082	20	0.034651	yes	BRNPTM
chr1_1454092_A_G_b38	ATAD3C	-4.476	1.66e-05	-0.155082	20	0.034651	yes	BRNPTM
chr1_1431656_G_A_b38	ATAD3C	-4.459	1.77e-05	-0.160155	5	0.03592	yes	BRNPTM
chr1_1454848_T_C_b38	ATAD3C	-4.456	1.79e-05	-0.150217	12	0.033712	yes	BRNPTM
chr1_1542773_T_C_b38	ATAD3C	-4.403	2.22e-05	-0.128415	24	0.029168	yes	BRNPTM
chr1_1542793_C_G_b38	ATAD3C	-4.403	2.22e-05	-0.128415	24	0.029168	yes	BRNPTM
chr1_1542800_T_C_b38	ATAD3C	-4.403	2.22e-05	-0.128415	24	0.029168	yes	BRNPTM
chr1_1550064_GC_G_b38	ATAD3C	-4.403	2.22e-05	-0.128415	24	0.029168	yes	BRNPTM
chr1_1550068_C_A_b38	ATAD3C	-4.403	2.22e-05	-0.128415	24	0.029168	yes	BRNPTM
chr1_1437993_G_A_b38	ATAD3C	-4.401	2.24e-05	-0.142568	9	0.032394	yes	BRNPTM
chr1_1456829_G_C_b38	ATAD3C	-4.396	2.28e-05	-0.150434	17	0.034218	yes	BRNPTM
chr1_1538787_A_G_b38	ATAD3C	-4.387	2.36e-05	-0.12522	27	0.028542	yes	BRNPTM
chr1_1558726_C_CA_b38	ATAD3C	-4.366	2.57e-05	-0.12769	24	0.029245	yes	BRNPTM
chr1_1561821_A_C_b38	ATAD3C	-4.366	2.57e-05	-0.12769	24	0.029245	yes	BRNPTM
chr1_1566086_G_A_b38	ATAD3C	-4.351	2.73e-05	-0.124502	27	0.028613	yes	BRNPTM
chr1_1452384_G_A_b38	ATAD3C	-4.35	2.75e-05	-0.152004	8	0.034947	yes	BRNPTM
chr1_1573654_T_C_b38	ATAD3C	-4.346	2.78e-05	-0.122716	26	0.028235	yes	BRNPTM
chr1_1575724_G_C_b38	ATAD3C	-4.346	2.78e-05	-0.122716	26	0.028235	yes	BRNPTM
chr1_1565105_CAAGGCAGGCGGATCATG_C_b38	ATAD3C	-4.343	2.82e-05	-0.12261	28	0.028231	yes	BRNPTM
chr1_1577491_A_AC_b38	ATAD3C	-4.337	2.88e-05	-0.123707	27	0.02852	yes	BRNPTM
chr1_1557495_CAT_C_b38	ATAD3C	-4.324	3.04e-05	-0.125718	24	0.029076	yes	BRNPTM
chr1_1451968_C_T_b38	ATAD3C	-4.323	3.05e-05	-0.152647	9	0.035308	yes	BRNPTM
chr1_1437955_C_G_b38	ATAD3C	-4.307	3.25e-05	-0.122106	18	0.028349	yes	BRNPTM
chr1_933548_A_AG_b38	ATAD3C	-4.277	3.66e-05	-0.123546	23	0.028889	yes	BRNPTM
chr1_1431813_G_T_b38	ATAD3C	-4.261	3.89e-05	-0.147906	6	0.034708	yes	BRNPTM
chr1_1543953_A_G_b38	ATAD3C	-4.248	4.11e-05	-0.124953	24	0.029418	yes	BRNPTM
chr1_1456182_G_A_b38	ATAD3C	-4.242	4.2e-05	-0.141476	13	0.033351	yes	BRNPTM
chr1_1456891_T_C_b38	ATAD3C	-4.233	4.35e-05	-0.133636	14	0.031571	yes	BRNPTM
chr1_1363456_CAG_C_b38	ATAD3C	4.223	4.52e-05	0.121779	16	0.028837	yes	BRNPTM
chr1_1452540_G_A_b38	ATAD3C	-4.144	6.13e-05	-0.14107	10	0.03404	yes	BRNPTM
chr1_1447108_A_ATT_b38	ATAD3C	-4.143	6.16e-05	-0.13856	8	0.033444	yes	BRNPTM
chr1_1363438_C_CTT_b38	ATAD3C	4.13	6.47e-05	0.12165	20	0.029454	yes	BRNPTM
chr1_1340697_G_A_b38	ATAD3C	4.118	6.78e-05	0.133579	10	0.032439	yes	BRNPTM
chr1_910255_C_T_b38	ATAD3C	4.085	7.68e-05	0.14562	5	0.035644	yes	BRNPTM
chr1_1545795_C_A_b38	ATAD3C	-4.08	7.83e-05	-0.118444	20	0.029029	yes	BRNPTM
chr1_1569180_T_A_b38	ATAD3C	-4.056	8.59e-05	-0.116764	27	0.028788	yes	BRNPTM
chr1_918870_A_G_b38	ATAD3C	4.053	8.7e-05	0.137668	6	0.033971	yes	BRNPTM
chr1_1456217_T_C_b38	ATAD3C	-4.05	8.79e-05	-0.140688	20	0.034738	yes	BRNPTM
chr1_1549590_C_G_b38	ATAD3C	-4.047	8.89e-05	-0.114324	27	0.028249	yes	BRNPTM
chr1_910698_C_T_b38	ATAD3C	4.027	9.58e-05	0.144823	5	0.035962	yes	BRNPTM
chr1_1575421_C_T_b38	ATAD3C	-4.025	9.67e-05	-0.115952	26	0.02881	yes	BRNPTM
chr1_1572532_A_C_b38	ATAD3C	-4.021	9.79e-05	-0.114479	27	0.028468	yes	BRNPTM
chr1_1573079_A_G_b38	ATAD3C	-4.021	9.79e-05	-0.114479	27	0.028468	yes	BRNPTM
chr1_1363898_C_T_b38	ATAD3C	4.02	9.84e-05	0.134671	6	0.033501	yes	BRNPTM
chr1_1363986_C_T_b38	ATAD3C	4.02	9.84e-05	0.134671	6	0.033501	yes	BRNPTM
chr1_1365566_G_A_b38	ATAD3C	4.02	9.84e-05	0.134671	6	0.033501	yes	BRNPTM
chr1_1366529_TTAG_T_b38	ATAD3C	4.02	9.84e-05	0.134671	6	0.033501	yes	BRNPTM
chr1_1367292_A_AGT_b38	ATAD3C	4.02	9.84e-05	0.134671	6	0.033501	yes	BRNPTM
chr1_1553692_A_G_b38	ATAD3C	-4.012	0.000102	-0.113581	27	0.028312	yes	BRNPTM
chr1_1554694_A_G_b38	ATAD3C	-4.012	0.000102	-0.113581	27	0.028312	yes	BRNPTM
chr1_1555247_T_A_b38	ATAD3C	-4.012	0.000102	-0.113581	27	0.028312	yes	BRNPTM
chr1_1559750_C_CAG_b38	ATAD3C	-4.012	0.000102	-0.113581	27	0.028312	yes	BRNPTM
chr1_1561628_T_C_b38	ATAD3C	-4.012	0.000102	-0.113581	27	0.028312	yes	BRNPTM
chr1_1563918_A_G_b38	ATAD3C	-4.012	0.000102	-0.113581	27	0.028312	yes	BRNPTM
chr1_1565561_A_G_b38	ATAD3C	-4.012	0.000102	-0.113581	27	0.028312	yes	BRNPTM
chr1_1567715_G_A_b38	ATAD3C	-4.012	0.000102	-0.113581	27	0.028312	yes	BRNPTM
chr1_1567719_A_C_b38	ATAD3C	-4.012	0.000102	-0.113581	27	0.028312	yes	BRNPTM
chr1_1569875_C_T_b38	ATAD3C	-4.012	0.000102	-0.113581	27	0.028312	yes	BRNPTM
chr1_1471992_T_C_b38	ATAD3C	-3.973	0.000118	-0.132624	23	0.033384	yes	BRNPTM
chr1_1554852_T_C_b38	ATAD3C	-3.957	0.000125	-0.111601	27	0.028202	yes	BRNPTM
chr1_931558_G_A_b38	ATAD3C	3.955	0.000126	0.136827	5	0.034598	yes	BRNPTM
chr1_903007_T_C_b38	ATAD3C	3.953	0.000127	0.14107	4	0.035689	yes	BRNPTM
chr1_1565680_A_AG_b38	ATAD3C	-3.935	0.000135	-0.109915	27	0.027935	yes	BRNPTM
chr1_935265_T_C_b38	ATAD3C	3.925	0.000141	0.123103	15	0.031366	yes	BRNPTM
chr1_911484_G_C_b38	ATAD3C	3.91	0.000148	0.135644	8	0.034692	yes	BRNPTM
chr1_1554781_A_G_b38	ATAD3C	-3.907	0.00015	-0.110844	27	0.028369	yes	BRNPTM
chr1_1570294_CA_C_b38	ATAD3C	-3.903	0.000152	-0.112969	25	0.028947	yes	BRNPTM
chr1_1569661_T_C_b38	ATAD3C	-3.902	0.000153	-0.110378	26	0.02829	yes	BRNPTM
chr1_910558_G_A_b38	ATAD3C	3.87	0.000172	0.133723	9	0.034551	yes	BRNPTM
chr1_932255_C_T_b38	ATAD3C	3.87	0.000172	0.136594	5	0.035299	yes	BRNPTM
chr1_901149_C_G_b38	ATAD3C	3.862	0.000177	0.13832	4	0.035815	yes	BRNPTM
chr1_901544_G_A_b38	ATAD3C	3.862	0.000177	0.13832	4	0.035815	yes	BRNPTM
chr1_915810_G_A_b38	ATAD3C	3.839	0.000193	0.131416	6	0.034234	yes	BRNPTM
chr1_899548_A_G_b38	ATAD3C	3.814	0.000211	0.135916	4	0.035637	yes	BRNPTM
chr1_899619_G_A_b38	ATAD3C	3.814	0.000211	0.135916	4	0.035637	yes	BRNPTM
chr1_1379091_T_G_b38	ATAD3C	3.81	0.000214	0.127866	7	0.033562	yes	BRNPTM
chr1_1360507_T_TGGGGGGC_b38	ATAD3C	3.807	0.000217	0.162956	4	0.042809	yes	BRNPTM
chr1_914682_A_T_b38	ATAD3C	3.756	0.00026	0.129729	6	0.034541	yes	BRNPTM
chr1_897538_T_C_b38	ATAD3C	3.749	0.000267	0.117704	13	0.031398	yes	BRNPTM
chr1_897792_T_TCGAA_b38	ATAD3C	3.749	0.000267	0.117704	13	0.031398	yes	BRNPTM
chr1_896529_C_T_b38	ATAD3C	-3.749	0.000267	-0.117704	13	0.031398	yes	BRNPTM
chr1_896680_G_A_b38	ATAD3C	-3.749	0.000267	-0.117704	13	0.031398	yes	BRNPTM
chr1_896686_G_C_b38	ATAD3C	-3.749	0.000267	-0.117704	13	0.031398	yes	BRNPTM
chr1_896732_T_C_b38	ATAD3C	-3.749	0.000267	-0.117704	13	0.031398	yes	BRNPTM
chr1_896798_A_G_b38	ATAD3C	-3.749	0.000267	-0.117704	13	0.031398	yes	BRNPTM
chr1_896917_CTG_C_b38	ATAD3C	-3.749	0.000267	-0.117704	13	0.031398	yes	BRNPTM
chr1_896938_C_A_b38	ATAD3C	-3.749	0.000267	-0.117704	13	0.031398	yes	BRNPTM
chr1_1532798_T_C_b38	ATAD3C	-3.747	0.000269	-0.106964	45	0.02855	yes	BRNPTM
chr1_1374505_A_G_b38	ATAD3C	-3.745	0.000271	-0.132523	6	0.035387	yes	BRNPTM
chr1_1453643_A_ATT_b38	ATAD3C	-3.739	0.000276	-0.13711	11	0.036666	yes	BRNPTM
chr1_906633_T_G_b38	ATAD3C	3.725	0.000291	0.13244	4	0.035557	yes	BRNPTM
chr1_1394041_G_A_b38	ATAD3C	-3.713	0.000304	-0.140399	4	0.037812	yes	BRNPTM
chr1_929839_G_A_b38	ATAD3C	3.708	0.000309	0.130936	5	0.03531	yes	BRNPTM
chr1_1375642_C_T_b38	ATAD3C	-3.705	0.000312	-0.133211	6	0.035955	yes	BRNPTM
chr1_1380867_A_G_b38	ATAD3C	-3.705	0.000312	-0.133211	6	0.035955	yes	BRNPTM
chr1_1383743_T_C_b38	ATAD3C	-3.705	0.000312	-0.133211	6	0.035955	yes	BRNPTM
chr1_1384546_C_T_b38	ATAD3C	-3.705	0.000312	-0.133211	6	0.035955	yes	BRNPTM
chr1_1398218_C_A_b38	ATAD3C	-3.705	0.000312	-0.133211	6	0.035955	yes	BRNPTM
chr1_1400756_GGA_G_b38	ATAD3C	-3.705	0.000312	-0.133211	6	0.035955	yes	BRNPTM
chr1_1401954_G_T_b38	ATAD3C	-3.705	0.000312	-0.133211	6	0.035955	yes	BRNPTM
chr1_1403593_A_G_b38	ATAD3C	-3.705	0.000312	-0.133211	6	0.035955	yes	BRNPTM
chr1_1407565_C_A_b38	ATAD3C	-3.705	0.000312	-0.133211	6	0.035955	yes	BRNPTM
chr1_1537160_T_G_b38	ATAD3C	-3.687	0.000333	-0.10397	31	0.028197	yes	BRNPTM
chr1_1382893_G_A_b38	ATAD3C	-3.68	0.000342	-0.133416	6	0.036258	yes	BRNPTM
chr1_1360502_G_GGGGGCGGGC_b38	ATAD3C	3.677	0.000345	0.160358	4	0.043607	yes	BRNPTM
chr1_928622_G_C_b38	ATAD3C	3.661	0.000365	0.131717	4	0.035974	yes	BRNPTM
chr1_1370553_CAAA_C_b38	ATAD3C	-3.66	0.000366	-0.141099	4	0.038551	yes	BRNPTM
chr1_907236_TA_T_b38	ATAD3C	3.653	0.000376	0.121304	7	0.033211	yes	BRNPTM
chr1_906982_C_T_b38	ATAD3C	3.642	0.00039	0.119669	7	0.032855	yes	BRNPTM
chr1_1367028_A_G_b38	ATAD3C	3.595	0.00046	0.148247	4	0.041235	yes	BRNPTM
chr1_904947_G_A_b38	ATAD3C	3.581	0.000483	0.129135	4	0.03606	yes	BRNPTM
chr1_941767_G_A_b38	ATAD3C	3.579	0.000487	0.117116	9	0.032725	yes	BRNPTM
chr1_1547630_G_A_b38	ATAD3C	-3.565	0.00051	-0.098903	24	0.02774	yes	BRNPTM
chr1_911428_C_T_b38	ATAD3C	3.555	0.000529	0.123535	9	0.034748	yes	BRNPTM
chr1_1341079_C_A_b38	ATAD3C	3.552	0.000535	0.163873	3	0.046138	yes	BRNPTM
chr1_1341098_T_G_b38	ATAD3C	3.552	0.000535	0.163873	3	0.046138	yes	BRNPTM
chr1_1522905_A_G_b38	ATAD3C	-3.546	0.000546	-0.191349	8	0.053964	yes	BRNPTM
chr1_902949_G_GC_b38	ATAD3C	3.544	0.00055	0.127106	4	0.035869	yes	BRNPTM
chr1_1352542_G_A_b38	ATAD3C	3.52	0.000597	0.164971	4	0.046864	yes	BRNPTM
chr1_1368177_G_C_b38	ATAD3C	-3.512	0.000614	-0.126667	5	0.036068	yes	BRNPTM
chr1_1258206_AT_A_b38	ATAD3C	-3.511	0.000617	-0.113244	19	0.032258	yes	BRNPTM
chr1_2142322_CAGCAGCCGAAGCGCCTCCTTTCAATCCAGGGTCCACACATCCAGCAGCCGAAGCGCCCTCCTTTCAATCCAGGGTCCAGGCATCT_C_b38	ATAD3C	-3.499	0.000641	-0.198772	4	0.056802	yes	BRNPTM
chr1_2213349_A_G_b38	ATAD3C	-3.499	0.000642	-0.103977	24	0.029718	yes	BRNPTM
chr1_1367919_C_T_b38	ATAD3C	-3.487	0.000668	-0.126472	5	0.036269	yes	BRNPTM
chr1_1367951_C_T_b38	ATAD3C	-3.487	0.000668	-0.126472	5	0.036269	yes	BRNPTM
chr1_1367965_A_G_b38	ATAD3C	-3.487	0.000668	-0.126472	5	0.036269	yes	BRNPTM
chr1_1367970_T_G_b38	ATAD3C	-3.487	0.000668	-0.126472	5	0.036269	yes	BRNPTM
chr1_1367994_C_A_b38	ATAD3C	-3.487	0.000668	-0.126472	5	0.036269	yes	BRNPTM
chr1_1368297_C_T_b38	ATAD3C	-3.487	0.000668	-0.126472	5	0.036269	yes	BRNPTM
chr1_1368514_C_G_b38	ATAD3C	-3.487	0.000668	-0.126472	5	0.036269	yes	BRNPTM
chr1_1368991_C_T_b38	ATAD3C	-3.487	0.000668	-0.126472	5	0.036269	yes	BRNPTM
chr1_1369009_T_C_b38	ATAD3C	-3.487	0.000668	-0.126472	5	0.036269	yes	BRNPTM
chr1_1369012_C_CG_b38	ATAD3C	-3.487	0.000668	-0.126472	5	0.036269	yes	BRNPTM
chr1_1520875_A_G_b38	ATAD3C	-3.485	0.000674	-0.191229	8	0.054877	yes	BRNPTM
chr1_1521518_G_A_b38	ATAD3C	-3.485	0.000674	-0.191229	8	0.054877	yes	BRNPTM
chr1_1524202_G_A_b38	ATAD3C	-3.485	0.000674	-0.191229	8	0.054877	yes	BRNPTM
chr1_1526169_C_T_b38	ATAD3C	-3.485	0.000674	-0.191229	8	0.054877	yes	BRNPTM
chr1_1530002_A_G_b38	ATAD3C	-3.485	0.000674	-0.191229	8	0.054877	yes	BRNPTM
chr1_1533018_T_C_b38	ATAD3C	-3.485	0.000674	-0.191229	8	0.054877	yes	BRNPTM
chr1_901516_T_C_b38	ATAD3C	3.483	0.000677	0.117072	9	0.033609	yes	BRNPTM
chr1_2363827_A_T_b38	ATAD3C	-3.483	0.000677	-0.163312	6	0.046887	yes	BRNPTM
chr1_1417031_A_G_b38	ATAD3C	-3.479	0.000687	-0.158879	5	0.04567	yes	BRNPTM
chr1_954724_G_A_b38	ATAD3C	3.472	0.000703	0.114762	8	0.033051	yes	BRNPTM
chr1_1428999_C_CA_b38	ATAD3C	-3.472	0.000703	-0.118772	10	0.034209	yes	BRNPTM
chr1_1366511_GGTGA_G_b38	ATAD3C	-3.47	0.000709	-0.129768	4	0.037401	yes	BRNPTM
chr1_1361679_G_A_b38	ATAD3C	3.468	0.000713	0.115669	11	0.033352	yes	BRNPTM
chr1_1523187_A_G_b38	ATAD3C	-3.465	0.000719	-0.183995	9	0.053093	yes	BRNPTM
chr1_965666_ACC_A_b38	ATAD3C	3.464	0.000723	0.111865	9	0.032293	yes	BRNPTM
chr1_1553018_CA_C_b38	ATAD3C	-3.44	0.000784	-0.122443	4	0.035592	yes	BRNPTM
chr1_2214805_CTG_C_b38	ATAD3C	-3.439	0.000786	-0.110927	17	0.032253	yes	BRNPTM
chr1_911018_G_A_b38	ATAD3C	3.434	0.000801	0.124602	6	0.03629	yes	BRNPTM
chr1_1364282_T_G_b38	ATAD3C	-3.428	0.000816	-0.126993	4	0.037043	yes	BRNPTM
chr1_1364357_A_C_b38	ATAD3C	-3.428	0.000816	-0.126993	4	0.037043	yes	BRNPTM
chr1_1364566_T_C_b38	ATAD3C	-3.428	0.000816	-0.126993	4	0.037043	yes	BRNPTM
chr1_1364694_T_C_b38	ATAD3C	-3.428	0.000816	-0.126993	4	0.037043	yes	BRNPTM
chr1_1364721_C_T_b38	ATAD3C	-3.428	0.000816	-0.126993	4	0.037043	yes	BRNPTM
chr1_1365160_A_G_b38	ATAD3C	-3.428	0.000816	-0.126993	4	0.037043	yes	BRNPTM
chr1_1365198_C_T_b38	ATAD3C	-3.428	0.000816	-0.126993	4	0.037043	yes	BRNPTM
chr1_1366008_A_G_b38	ATAD3C	-3.428	0.000816	-0.126993	4	0.037043	yes	BRNPTM
chr1_1366062_T_C_b38	ATAD3C	-3.428	0.000816	-0.126993	4	0.037043	yes	BRNPTM
chr1_1366145_TGTGAA_T_b38	ATAD3C	-3.428	0.000816	-0.126993	4	0.037043	yes	BRNPTM
chr1_1366187_A_AGT_b38	ATAD3C	-3.428	0.000816	-0.126993	4	0.037043	yes	BRNPTM
chr1_1366321_TGTGTGTAAATGG_T_b38	ATAD3C	-3.428	0.000816	-0.126993	4	0.037043	yes	BRNPTM
chr1_1366453_G_T_b38	ATAD3C	-3.428	0.000816	-0.126993	4	0.037043	yes	BRNPTM
chr1_1366726_T_G_b38	ATAD3C	-3.428	0.000816	-0.126993	4	0.037043	yes	BRNPTM
chr1_1367258_T_A_b38	ATAD3C	-3.428	0.000816	-0.126993	4	0.037043	yes	BRNPTM
chr1_1367280_T_A_b38	ATAD3C	-3.428	0.000816	-0.126993	4	0.037043	yes	BRNPTM
chr1_1367297_GAA_G_b38	ATAD3C	-3.428	0.000816	-0.126993	4	0.037043	yes	BRNPTM
chr1_1367300_T_TGA_b38	ATAD3C	-3.428	0.000816	-0.126993	4	0.037043	yes	BRNPTM
chr1_1367329_A_AGT_b38	ATAD3C	-3.428	0.000816	-0.126993	4	0.037043	yes	BRNPTM
chr1_1367373_T_TGTG_b38	ATAD3C	-3.428	0.000816	-0.126993	4	0.037043	yes	BRNPTM
chr1_1367388_T_TTGG_b38	ATAD3C	-3.428	0.000816	-0.126993	4	0.037043	yes	BRNPTM
chr1_1367462_T_C_b38	ATAD3C	-3.428	0.000816	-0.126993	4	0.037043	yes	BRNPTM
chr1_1367593_G_A_b38	ATAD3C	-3.428	0.000816	-0.126993	4	0.037043	yes	BRNPTM
chr1_1367602_GT_G_b38	ATAD3C	-3.428	0.000816	-0.126993	4	0.037043	yes	BRNPTM
chr1_1367605_GAGTGAGTGTA_G_b38	ATAD3C	-3.428	0.000816	-0.126993	4	0.037043	yes	BRNPTM
chr1_1367670_GGTGA_G_b38	ATAD3C	-3.428	0.000816	-0.126993	4	0.037043	yes	BRNPTM
chr1_1367722_TTTTA_T_b38	ATAD3C	-3.428	0.000816	-0.126993	4	0.037043	yes	BRNPTM
chr1_1367874_A_T_b38	ATAD3C	-3.428	0.000816	-0.126993	4	0.037043	yes	BRNPTM
chr1_1353987_CTG_C_b38	ATAD3C	3.417	0.000846	0.157465	4	0.046076	yes	BRNPTM
chr1_1354531_G_A_b38	ATAD3C	3.417	0.000846	0.157465	4	0.046076	yes	BRNPTM
chr1_1366292_G_T_b38	ATAD3C	-3.406	0.000878	-0.126563	4	0.037154	yes	BRNPTM
chr1_1290841_A_G_b38	ATAD3C	-3.406	0.000881	-0.121247	13	0.035603	yes	BRNPTM
chr1_1353203_C_G_b38	ATAD3C	3.387	0.000936	0.154251	4	0.045535	yes	BRNPTM
chr1_1379093_TG_T_b38	ATAD3C	-3.382	0.000952	-0.130501	5	0.038582	yes	BRNPTM
chr1_903723_A_G_b38	ATAD3C	3.379	0.000961	0.115028	8	0.034038	yes	BRNPTM
chr1_1515567_A_C_b38	ATAD3C	-3.375	0.000975	-0.196805	7	0.058312	yes	BRNPTM
chr1_2274142_C_A_b38	ATAD3C	3.37	0.000992	0.093113	32	0.02763	yes	BRNPTM
chr1_1571794_A_AT_b38	ATAD3C	-3.368	0.000999	-0.101566	21	0.030158	yes	BRNPTM
chr1_1422081_C_T_b38	ATAD3C	-3.361	0.00102	-0.171545	13	0.051042	yes	BRNPTM
chr1_1369282_G_A_b38	ATAD3C	-3.361	0.00102	-0.121497	5	0.036152	yes	BRNPTM
chr1_1369320_GT_G_b38	ATAD3C	-3.361	0.00102	-0.121497	5	0.036152	yes	BRNPTM
chr1_1369407_G_A_b38	ATAD3C	-3.361	0.00102	-0.121497	5	0.036152	yes	BRNPTM
chr1_1369476_CTT_C_b38	ATAD3C	-3.361	0.00102	-0.121497	5	0.036152	yes	BRNPTM
chr1_1369556_C_G_b38	ATAD3C	-3.361	0.00102	-0.121497	5	0.036152	yes	BRNPTM
chr1_1369627_T_C_b38	ATAD3C	-3.361	0.00102	-0.121497	5	0.036152	yes	BRNPTM
chr1_1369686_T_C_b38	ATAD3C	-3.361	0.00102	-0.121497	5	0.036152	yes	BRNPTM
chr1_1369716_G_C_b38	ATAD3C	-3.361	0.00102	-0.121497	5	0.036152	yes	BRNPTM
chr1_1369741_C_T_b38	ATAD3C	-3.361	0.00102	-0.121497	5	0.036152	yes	BRNPTM
chr1_1363880_A_G_b38	ATAD3C	-3.36	0.00103	-0.124235	4	0.036976	yes	BRNPTM
chr1_1415221_G_T_b38	ATAD3C	-3.359	0.00103	-0.149077	6	0.044379	yes	BRNPTM
chr1_935954_G_T_b38	ATAD3C	-3.352	0.00105	-0.099079	19	0.029562	yes	BRNPTM
chr1_1380513_C_T_b38	ATAD3C	3.344	0.00108	0.158319	4	0.047344	yes	BRNPTM
chr1_1381290_C_G_b38	ATAD3C	3.344	0.00108	0.158319	4	0.047344	yes	BRNPTM
chr1_1383798_AG_A_b38	ATAD3C	3.344	0.00108	0.158319	4	0.047344	yes	BRNPTM
chr1_1385384_G_A_b38	ATAD3C	3.344	0.00108	0.158319	4	0.047344	yes	BRNPTM
chr1_1395050_G_A_b38	ATAD3C	-3.344	0.00108	-0.158319	4	0.047344	yes	BRNPTM
chr1_1316929_A_T_b38	ATAD3C	-3.338	0.0011	-0.122514	5	0.036704	yes	BRNPTM
chr1_1399922_C_T_b38	ATAD3C	-3.322	0.00116	-0.155666	4	0.046862	yes	BRNPTM
chr1_1402900_A_G_b38	ATAD3C	-3.322	0.00116	-0.155666	4	0.046862	yes	BRNPTM
chr1_1403240_CCTTT_C_b38	ATAD3C	-3.322	0.00116	-0.155666	4	0.046862	yes	BRNPTM
chr1_1405316_T_C_b38	ATAD3C	-3.322	0.00116	-0.155666	4	0.046862	yes	BRNPTM
chr1_914483_G_GACTGCCCAGCTC_b38	ATAD3C	3.32	0.00117	0.12045	6	0.036277	yes	BRNPTM
chr1_1370430_T_C_b38	ATAD3C	-3.319	0.00117	-0.122277	5	0.036837	yes	BRNPTM
chr1_1370532_C_T_b38	ATAD3C	-3.319	0.00117	-0.122277	5	0.036837	yes	BRNPTM
chr1_1370584_G_C_b38	ATAD3C	-3.319	0.00117	-0.122277	5	0.036837	yes	BRNPTM
chr1_1372909_G_A_b38	ATAD3C	-3.319	0.00117	-0.122277	5	0.036837	yes	BRNPTM
chr1_1368763_G_A_b38	ATAD3C	-3.318	0.00118	-0.121982	5	0.036763	yes	BRNPTM
chr1_1259424_T_C_b38	ATAD3C	-3.31	0.00121	-0.109886	20	0.033196	yes	BRNPTM
chr1_1370181_C_T_b38	ATAD3C	-3.302	0.00124	-0.121965	4	0.036936	yes	BRNPTM
chr1_1370317_G_C_b38	ATAD3C	-3.302	0.00124	-0.121965	4	0.036936	yes	BRNPTM
chr1_1370320_A_G_b38	ATAD3C	-3.302	0.00124	-0.121965	4	0.036936	yes	BRNPTM
chr1_1417046_C_T_b38	ATAD3C	-3.297	0.00126	-0.152263	4	0.046175	yes	BRNPTM
chr1_1369821_C_T_b38	ATAD3C	-3.297	0.00126	-0.119996	5	0.036391	yes	BRNPTM
chr1_1527386_C_T_b38	ATAD3C	-3.296	0.00127	-0.203213	8	0.06165	yes	BRNPTM
chr1_899452_G_C_b38	ATAD3C	3.289	0.0013	0.113094	7	0.034384	yes	BRNPTM
chr1_945259_TC_T_b38	ATAD3C	3.281	0.00133	0.105566	9	0.032171	yes	BRNPTM
chr1_1367511_ATGAG_A_b38	ATAD3C	-3.28	0.00133	-0.125917	3	0.038386	yes	BRNPTM
chr1_1341550_GCA_G_b38	ATAD3C	-3.277	0.00135	-0.12285	5	0.037487	yes	BRNPTM
chr1_1423062_C_T_b38	ATAD3C	-3.272	0.00137	-0.162799	3	0.049758	yes	BRNPTM
chr1_1514211_A_G_b38	ATAD3C	-3.267	0.00139	-0.209028	3	0.06398	yes	BRNPTM
chr1_1367268_TGA_T_b38	ATAD3C	-3.263	0.00141	-0.120471	4	0.036925	yes	BRNPTM
chr1_1326444_G_C_b38	ATAD3C	3.261	0.00142	0.156025	3	0.047853	yes	BRNPTM
chr1_1329973_GCGTGTGCCATGCA_G_b38	ATAD3C	-3.258	0.00144	-0.122403	4	0.037572	yes	BRNPTM
chr1_1344048_G_A_b38	ATAD3C	-3.258	0.00144	-0.122403	4	0.037572	yes	BRNPTM
chr1_1363688_C_T_b38	ATAD3C	-3.258	0.00144	-0.122403	4	0.037572	yes	BRNPTM
chr1_1364099_CCA_C_b38	ATAD3C	-3.258	0.00144	-0.122403	4	0.037572	yes	BRNPTM
chr1_1364102_TGTTG_T_b38	ATAD3C	-3.258	0.00144	-0.122403	4	0.037572	yes	BRNPTM
chr1_1364253_C_G_b38	ATAD3C	-3.258	0.00144	-0.122403	4	0.037572	yes	BRNPTM
chr1_1500745_A_C_b38	ATAD3C	-3.243	0.0015	-0.161418	13	0.049771	yes	BRNPTM
chr1_1375698_G_T_b38	ATAD3C	3.232	0.00156	0.149081	4	0.046133	yes	BRNPTM
chr1_1376153_G_C_b38	ATAD3C	3.232	0.00156	0.149081	4	0.046133	yes	BRNPTM
chr1_1376752_T_C_b38	ATAD3C	3.232	0.00156	0.149081	4	0.046133	yes	BRNPTM
chr1_1378635_C_T_b38	ATAD3C	3.232	0.00156	0.149081	4	0.046133	yes	BRNPTM
chr1_1378792_C_T_b38	ATAD3C	3.232	0.00156	0.149081	4	0.046133	yes	BRNPTM
chr1_1378865_C_T_b38	ATAD3C	3.232	0.00156	0.149081	4	0.046133	yes	BRNPTM
chr1_1379334_A_G_b38	ATAD3C	3.232	0.00156	0.149081	4	0.046133	yes	BRNPTM
chr1_1421170_A_G_b38	ATAD3C	-3.229	0.00158	-0.160724	9	0.049777	yes	BRNPTM
chr1_1426253_G_A_b38	ATAD3C	-3.21	0.00167	-0.122646	4	0.038205	yes	BRNPTM
chr1_933038_C_T_b38	ATAD3C	3.205	0.0017	0.101555	11	0.031683	yes	BRNPTM
chr1_892786_A_G_b38	ATAD3C	3.198	0.00174	0.101847	11	0.031845	yes	BRNPTM
chr1_2429870_C_A_b38	ATAD3C	-3.191	0.00178	-0.093453	31	0.029283	yes	BRNPTM
chr1_897843_C_T_b38	ATAD3C	3.19	0.00179	0.108211	8	0.033926	yes	BRNPTM
chr1_897922_C_T_b38	ATAD3C	3.19	0.00179	0.108211	8	0.033926	yes	BRNPTM
chr1_898444_T_C_b38	ATAD3C	3.19	0.00179	0.108211	8	0.033926	yes	BRNPTM
chr1_2231505_C_T_b38	ATAD3C	3.177	0.00186	0.098556	21	0.031019	yes	BRNPTM
chr1_1327764_G_A_b38	ATAD3C	3.164	0.00194	0.148069	3	0.046801	yes	BRNPTM
chr1_2109324_G_A_b38	ATAD3C	3.159	0.00197	0.134895	6	0.042705	yes	BRNPTM
chr1_2109338_C_T_b38	ATAD3C	3.159	0.00197	0.134895	6	0.042705	yes	BRNPTM
chr1_936972_G_C_b38	ATAD3C	3.138	0.00211	0.093768	15	0.029883	yes	BRNPTM
chr1_919695_C_G_b38	ATAD3C	-3.134	0.00213	-0.090284	24	0.028806	yes	BRNPTM
chr1_2107797_G_T_b38	ATAD3C	3.133	0.00214	0.136691	5	0.043631	yes	BRNPTM
chr1_1574032_AAAG_A_b38	ATAD3C	-3.129	0.00217	-0.104766	12	0.033479	yes	BRNPTM
chr1_1366776_G_GAATT_b38	ATAD3C	-3.114	0.00227	-0.118004	4	0.037896	yes	BRNPTM
chr1_1419214_A_G_b38	ATAD3C	-3.111	0.00229	-0.14602	5	0.046932	yes	BRNPTM
chr1_1877314_A_T_b38	ATAD3C	3.106	0.00233	0.108424	9	0.034907	yes	BRNPTM
chr1_1290261_C_A_b38	ATAD3C	-3.106	0.00233	-0.128861	10	0.041488	yes	BRNPTM
chr1_1534915_T_C_b38	ATAD3C	-3.103	0.00235	-0.201906	9	0.065068	yes	BRNPTM
chr1_1176929_T_C_b38	ATAD3C	-3.095	0.00241	-0.100499	9	0.032467	yes	BRNPTM
chr1_2238353_C_T_b38	ATAD3C	3.088	0.00247	0.095962	21	0.031073	yes	BRNPTM
chr1_896109_C_T_b38	ATAD3C	-3.082	0.00252	-0.103542	13	0.033598	yes	BRNPTM
chr1_2217853_C_T_b38	ATAD3C	3.082	0.00252	0.095617	21	0.031028	yes	BRNPTM
chr1_1407232_G_C_b38	ATAD3C	-3.078	0.00255	-0.102742	9	0.033383	yes	BRNPTM
chr1_911848_C_T_b38	ATAD3C	3.072	0.00259	0.109418	6	0.035616	yes	BRNPTM
chr1_920719_T_G_b38	ATAD3C	3.055	0.00273	0.090655	22	0.029672	yes	BRNPTM
chr1_920728_A_G_b38	ATAD3C	3.055	0.00273	0.090655	22	0.029672	yes	BRNPTM
chr1_1551454_C_A_b38	ATAD3C	-3.043	0.00284	-0.086016	47	0.028264	yes	BRNPTM
chr1_1415385_T_C_b38	ATAD3C	-3.037	0.00289	-0.140273	6	0.046188	yes	BRNPTM
chr1_1415659_G_C_b38	ATAD3C	-3.037	0.00289	-0.140273	6	0.046188	yes	BRNPTM
chr1_1417561_A_G_b38	ATAD3C	-3.037	0.00289	-0.140273	6	0.046188	yes	BRNPTM
chr1_1418000_T_C_b38	ATAD3C	-3.037	0.00289	-0.140273	6	0.046188	yes	BRNPTM
chr1_1418223_A_G_b38	ATAD3C	-3.037	0.00289	-0.140273	6	0.046188	yes	BRNPTM
chr1_1418252_A_G_b38	ATAD3C	-3.037	0.00289	-0.140273	6	0.046188	yes	BRNPTM
chr1_1500729_G_A_b38	ATAD3C	-3.032	0.00293	-0.172763	10	0.056972	yes	BRNPTM
chr1_2237640_C_T_b38	ATAD3C	-3.032	0.00294	-0.115324	5	0.038041	yes	BRNPTM
chr1_2238621_G_A_b38	ATAD3C	-3.032	0.00294	-0.115324	5	0.038041	yes	BRNPTM
chr1_2240198_G_C_b38	ATAD3C	-3.032	0.00294	-0.115324	5	0.038041	yes	BRNPTM
chr1_2240544_C_T_b38	ATAD3C	-3.032	0.00294	-0.115324	5	0.038041	yes	BRNPTM
chr1_1549967_C_G_b38	ATAD3C	-3.029	0.00296	-0.095352	13	0.031478	yes	BRNPTM
chr1_2107293_C_T_b38	ATAD3C	3.029	0.00296	0.098289	9	0.032449	yes	BRNPTM
chr1_2241478_T_C_b38	ATAD3C	3.023	0.00302	0.092067	21	0.030457	yes	BRNPTM
chr1_2241480_T_C_b38	ATAD3C	3.023	0.00302	0.092067	21	0.030457	yes	BRNPTM
chr1_2242065_T_C_b38	ATAD3C	3.023	0.00302	0.092067	21	0.030457	yes	BRNPTM
chr1_1419135_C_G_b38	ATAD3C	-3.022	0.00303	-0.152048	12	0.050314	yes	BRNPTM
chr1_2237776_G_A_b38	ATAD3C	3.018	0.00307	0.091806	21	0.030424	yes	BRNPTM
chr1_1415976_G_A_b38	ATAD3C	-3.011	0.00313	-0.149424	9	0.04962	yes	BRNPTM
chr1_1388565_GTC_G_b38	ATAD3C	3.005	0.00319	0.100143	11	0.033321	yes	BRNPTM
chr1_1366681_T_TGA_b38	ATAD3C	-3.005	0.00319	-0.11269	4	0.037496	yes	BRNPTM
chr1_1290968_C_G_b38	ATAD3C	-2.989	0.00335	-0.122043	12	0.040828	yes	BRNPTM
chr1_965125_G_C_b38	ATAD3C	2.98	0.00344	0.096507	10	0.032384	yes	BRNPTM
chr1_2108949_G_A_b38	ATAD3C	2.967	0.00359	0.133087	5	0.044861	yes	BRNPTM
chr1_951437_C_CATTTT_b38	ATAD3C	-2.963	0.00363	-0.176457	3	0.059559	yes	BRNPTM
chr1_1408286_G_A_b38	ATAD3C	-2.958	0.00369	-0.135041	4	0.045654	yes	BRNPTM
chr1_1409306_A_G_b38	ATAD3C	-2.958	0.00369	-0.135041	4	0.045654	yes	BRNPTM
chr1_1281631_A_C_b38	ATAD3C	-2.931	0.004	-0.136492	5	0.046568	yes	BRNPTM
chr1_1306523_C_G_b38	ATAD3C	2.922	0.0041	0.135327	7	0.046309	yes	BRNPTM
chr1_1415754_CCGCT_C_b38	ATAD3C	-2.914	0.00421	-0.134937	5	0.046305	yes	BRNPTM
chr1_1415762_ATCCGCT_A_b38	ATAD3C	-2.914	0.00421	-0.134937	5	0.046305	yes	BRNPTM
chr1_1417000_C_T_b38	ATAD3C	-2.914	0.00421	-0.134937	5	0.046305	yes	BRNPTM
chr1_1418181_A_G_b38	ATAD3C	-2.914	0.00421	-0.134937	5	0.046305	yes	BRNPTM
chr1_1217251_C_A_b38	ATAD3C	-2.912	0.00424	-0.105055	6	0.036082	yes	BRNPTM
chr1_1575864_G_A_b38	ATAD3C	-2.887	0.00456	-0.086598	23	0.029992	yes	BRNPTM
chr1_1533883_G_T_b38	ATAD3C	-2.885	0.00459	-0.15042	5	0.052134	yes	BRNPTM
chr1_1537493_T_A_b38	ATAD3C	-2.874	0.00474	-0.08682	22	0.030205	yes	BRNPTM
chr1_2271133_C_T_b38	ATAD3C	2.866	0.00485	0.087648	24	0.030581	yes	BRNPTM
chr1_2272051_C_T_b38	ATAD3C	2.866	0.00485	0.087648	24	0.030581	yes	BRNPTM
chr1_919397_A_G_b38	ATAD3C	-2.852	0.00506	-0.083249	24	0.029189	yes	BRNPTM
chr1_2102314_G_GT_b38	ATAD3C	2.851	0.00507	0.098935	6	0.034696	yes	BRNPTM
chr1_946653_G_A_b38	ATAD3C	2.848	0.00512	0.095014	7	0.033359	yes	BRNPTM
chr1_1351517_G_C_b38	ATAD3C	2.848	0.00512	0.127106	7	0.044629	yes	BRNPTM
chr1_1416747_CT_C_b38	ATAD3C	-2.847	0.00514	-0.124946	5	0.043889	yes	BRNPTM
chr1_1307603_G_A_b38	ATAD3C	2.838	0.00528	0.140969	12	0.04968	yes	BRNPTM
chr1_1566854_CA_C_b38	ATAD3C	-2.83	0.00539	-0.092199	19	0.032575	yes	BRNPTM
chr1_1384256_T_G_b38	ATAD3C	2.83	0.0054	0.12062	3	0.04262	yes	BRNPTM
chr1_1369803_C_CT_b38	ATAD3C	-2.828	0.00544	-0.102147	6	0.036123	yes	BRNPTM
chr1_2054570_T_A_b38	ATAD3C	-2.822	0.00553	-0.110557	3	0.03918	yes	BRNPTM
chr1_1415011_A_G_b38	ATAD3C	-2.822	0.00553	-0.128506	6	0.045543	yes	BRNPTM
chr1_1302795_T_TC_b38	ATAD3C	2.82	0.00556	0.091663	23	0.032504	yes	BRNPTM
chr1_2250903_T_C_b38	ATAD3C	2.818	0.00559	0.086663	21	0.030751	yes	BRNPTM
chr1_2252841_T_C_b38	ATAD3C	2.818	0.00559	0.086663	21	0.030751	yes	BRNPTM
chr1_1409623_T_C_b38	ATAD3C	-2.811	0.00572	-0.124828	5	0.044414	yes	BRNPTM
chr1_2241949_C_CTG_b38	ATAD3C	2.803	0.00584	0.088696	18	0.031638	yes	BRNPTM
chr1_922660_C_A_b38	ATAD3C	2.799	0.00591	0.10645	3	0.03803	yes	BRNPTM
chr1_922671_C_T_b38	ATAD3C	2.799	0.00591	0.10645	3	0.03803	yes	BRNPTM
chr1_890030_G_A_b38	ATAD3C	-2.797	0.00596	-0.085399	16	0.030537	yes	BRNPTM
chr1_1479719_T_C_b38	ATAD3C	-2.793	0.00603	-0.100756	23	0.03608	yes	BRNPTM
chr1_2252315_C_G_b38	ATAD3C	2.791	0.00605	0.085233	24	0.030538	yes	BRNPTM
chr1_1574655_GGC_G_b38	ATAD3C	-2.788	0.00611	-0.08347	22	0.029943	yes	BRNPTM
chr1_1280044_T_C_b38	ATAD3C	-2.772	0.00639	-0.091816	21	0.033119	yes	BRNPTM
chr1_1300330_T_A_b38	ATAD3C	-2.77	0.00643	-0.139765	11	0.050449	yes	BRNPTM
chr1_1301656_T_C_b38	ATAD3C	-2.77	0.00643	-0.139765	11	0.050449	yes	BRNPTM
chr1_1425013_C_T_b38	ATAD3C	-2.761	0.0066	-0.158478	13	0.0574	yes	BRNPTM
chr1_2220368_G_C_b38	ATAD3C	-2.759	0.00664	-0.109269	3	0.039603	yes	BRNPTM
chr1_1560765_T_C_b38	ATAD3C	-2.758	0.00665	-0.085933	20	0.031152	yes	BRNPTM
chr1_1562261_TTTTC_T_b38	ATAD3C	-2.758	0.00665	-0.085933	20	0.031152	yes	BRNPTM
chr1_1324788_C_A_b38	ATAD3C	2.758	0.00665	0.127754	9	0.046314	yes	BRNPTM
chr1_968046_C_T_b38	ATAD3C	2.755	0.00672	0.088108	11	0.031979	yes	BRNPTM
chr1_2220140_C_A_b38	ATAD3C	-2.746	0.0069	-0.093194	14	0.03394	yes	BRNPTM
chr1_2056821_T_C_b38	ATAD3C	-2.732	0.00718	-0.100199	12	0.036676	yes	BRNPTM
chr1_1517993_A_G_b38	ATAD3C	-2.72	0.00743	-0.090606	27	0.033313	yes	BRNPTM
chr1_1519934_T_G_b38	ATAD3C	-2.72	0.00743	-0.090606	27	0.033313	yes	BRNPTM
chr1_1519938_T_C_b38	ATAD3C	-2.72	0.00743	-0.090606	27	0.033313	yes	BRNPTM
chr1_1411525_T_A_b38	ATAD3C	-2.718	0.00748	-0.126264	8	0.04646	yes	BRNPTM
chr1_1410590_A_G_b38	ATAD3C	-2.711	0.00762	-0.124112	5	0.045776	yes	BRNPTM
chr1_1413898_T_C_b38	ATAD3C	-2.711	0.00762	-0.124112	5	0.045776	yes	BRNPTM
chr1_1848358_A_T_b38	ATAD3C	2.703	0.00779	0.110476	3	0.040865	yes	BRNPTM
chr1_1573429_CAAAAAAAAAAAAAAAAAA_C_b38	ATAD3C	-2.696	0.00795	-0.078699	25	0.029187	yes	BRNPTM
chr1_898261_T_C_b38	ATAD3C	2.686	0.00819	0.091873	8	0.034207	yes	BRNPTM
chr1_898279_T_A_b38	ATAD3C	2.686	0.00819	0.091873	8	0.034207	yes	BRNPTM
chr1_898283_A_G_b38	ATAD3C	2.686	0.00819	0.091873	8	0.034207	yes	BRNPTM
chr1_2219851_AAAAAC_A_b38	ATAD3C	-2.685	0.00821	-0.091235	15	0.03398	yes	BRNPTM
chr1_2101817_G_A_b38	ATAD3C	2.683	0.00825	0.08638	13	0.032194	yes	BRNPTM
chr1_2268965_C_T_b38	ATAD3C	2.682	0.00827	0.082225	24	0.030656	yes	BRNPTM
chr1_937396_GCC_G_b38	ATAD3C	2.679	0.00834	0.078383	30	0.029254	yes	BRNPTM
chr1_915400_C_T_b38	ATAD3C	-2.67	0.00857	-0.077356	31	0.028977	yes	BRNPTM
chr1_2054074_C_G_b38	ATAD3C	-2.661	0.00878	-0.09847	8	0.037005	yes	BRNPTM
chr1_1288085_GC_G_b38	ATAD3C	-2.64	0.00932	-0.102846	4	0.038963	yes	BRNPTM
chr1_2056605_G_C_b38	ATAD3C	-2.627	0.00965	-0.103973	3	0.039575	yes	BRNPTM
chr1_2233260_C_T_b38	ATAD3C	2.617	0.00993	0.079927	22	0.03054	yes	BRNPTM
chr1_1453961_C_T_b38	ATAD3C	-4.313	3.18e-05	-0.156444	7	0.036274	no	BRNPTM
chr1_1522693_A_G_b38	ATAD3C	4.265	3.84e-05	0.150364	6	0.035257	no	BRNPTM
chr1_903175_C_A_b38	ATAD3C	4.143	6.17e-05	0.144544	6	0.034893	no	BRNPTM
chr1_1453870_A_C_b38	ATAD3C	-4.14	6.24e-05	-0.150194	7	0.036282	no	BRNPTM
chr1_897018_T_C_b38	ATAD3C	-4.138	6.28e-05	-0.130232	10	0.031473	no	BRNPTM
chr1_909894_G_T_b38	ATAD3C	4.036	9.25e-05	0.143717	8	0.035606	no	BRNPTM
chr1_905705_C_G_b38	ATAD3C	3.938	0.000134	0.133967	7	0.03402	no	BRNPTM
chr1_1457071_C_T_b38	ATAD3C	-3.929	0.000138	-0.125529	14	0.031951	no	BRNPTM
chr1_924305_G_A_b38	ATAD3C	3.894	0.000157	0.124344	12	0.031931	no	BRNPTM
chr1_900119_A_G_b38	ATAD3C	3.861	0.000177	0.128753	8	0.033343	no	BRNPTM
chr1_1450636_A_G_b38	ATAD3C	-3.851	0.000184	-0.136316	8	0.035395	no	BRNPTM
chr1_898547_T_C_b38	ATAD3C	3.815	0.000211	0.134889	5	0.035362	no	BRNPTM
chr1_906677_A_AAACTCAGCTGCCTCTCCCCTTC_b38	ATAD3C	3.736	0.00028	0.123979	10	0.033185	no	BRNPTM
chr1_898818_T_C_b38	ATAD3C	3.726	0.00029	0.132791	5	0.035639	no	BRNPTM
chr1_1499339_T_C_b38	ATAD3C	-3.672	0.000352	-0.212308	3	0.057825	no	BRNPTM
chr1_1451028_T_A_b38	ATAD3C	-3.626	0.000413	-0.127283	9	0.035105	no	BRNPTM
chr1_915824_G_C_b38	ATAD3C	3.596	0.000459	0.122107	8	0.033958	no	BRNPTM
chr1_912111_G_A_b38	ATAD3C	3.593	0.000464	0.12301	7	0.034237	no	BRNPTM
chr1_913065_G_A_b38	ATAD3C	3.593	0.000464	0.12301	7	0.034237	no	BRNPTM
chr1_913076_A_G_b38	ATAD3C	3.593	0.000464	0.12301	7	0.034237	no	BRNPTM
chr1_929558_G_A_b38	ATAD3C	-3.537	0.000562	-0.113901	12	0.0322	no	BRNPTM
chr1_1482316_C_G_b38	ATAD3C	-3.523	0.000591	-0.106551	14	0.030245	no	BRNPTM
chr1_923421_A_G_b38	ATAD3C	-3.476	0.000694	-0.120718	8	0.03473	no	BRNPTM
chr1_1338970_A_G_b38	ATAD3C	3.471	0.000706	0.166561	3	0.04799	no	BRNPTM
chr1_1344634_A_G_b38	ATAD3C	3.471	0.000706	0.166561	3	0.04799	no	BRNPTM
chr1_1345965_C_T_b38	ATAD3C	3.471	0.000706	0.166561	3	0.04799	no	BRNPTM
chr1_1351747_G_A_b38	ATAD3C	3.471	0.000706	0.166561	3	0.04799	no	BRNPTM
chr1_1325753_G_T_b38	ATAD3C	-3.45	0.000758	-0.13734	3	0.039807	no	BRNPTM
chr1_938178_G_T_b38	ATAD3C	-3.402	0.000891	-0.104778	18	0.030798	no	BRNPTM
chr1_1360302_A_G_b38	ATAD3C	3.381	0.000955	0.160021	3	0.047327	no	BRNPTM
chr1_1360989_GAC_G_b38	ATAD3C	3.381	0.000955	0.160021	3	0.047327	no	BRNPTM
chr1_923311_TG_T_b38	ATAD3C	-3.376	0.000973	-0.118417	8	0.035079	no	BRNPTM
chr1_925036_G_A_b38	ATAD3C	-3.376	0.000973	-0.118417	8	0.035079	no	BRNPTM
chr1_926250_G_A_b38	ATAD3C	-3.376	0.000973	-0.118417	8	0.035079	no	BRNPTM
chr1_927486_C_T_b38	ATAD3C	-3.339	0.0011	-0.11734	8	0.035141	no	BRNPTM
chr1_1362042_C_T_b38	ATAD3C	3.225	0.00159	0.152791	3	0.047371	no	BRNPTM
chr1_1363031_C_T_b38	ATAD3C	3.225	0.00159	0.152791	3	0.047371	no	BRNPTM
chr1_897376_T_G_b38	ATAD3C	3.136	0.00212	0.102602	12	0.03272	no	BRNPTM
chr1_1368047_ACT_A_b38	ATAD3C	3.067	0.00263	0.15381	6	0.050149	no	BRNPTM
chr1_1363157_C_T_b38	ATAD3C	3.067	0.00264	0.144591	3	0.047148	no	BRNPTM
chr1_1303112_G_A_b38	ATAD3C	-3.055	0.00274	-0.120984	4	0.039605	no	BRNPTM
chr1_1303800_G_A_b38	ATAD3C	-3.055	0.00274	-0.120984	4	0.039605	no	BRNPTM
chr1_1304555_A_C_b38	ATAD3C	-3.055	0.00274	-0.120984	4	0.039605	no	BRNPTM
chr1_2108657_T_C_b38	ATAD3C	3.047	0.00281	0.135899	4	0.044607	no	BRNPTM
chr1_919598_A_C_b38	ATAD3C	-3.009	0.00315	-0.084561	35	0.028101	no	BRNPTM
chr1_1361685_C_T_b38	ATAD3C	-2.996	0.00328	-0.105514	9	0.035216	no	BRNPTM
chr1_1357046_C_G_b38	ATAD3C	2.993	0.00331	0.149102	9	0.04981	no	BRNPTM
chr1_1357369_C_T_b38	ATAD3C	2.993	0.00331	0.149102	9	0.04981	no	BRNPTM
chr1_1358907_C_A_b38	ATAD3C	2.993	0.00331	0.149102	9	0.04981	no	BRNPTM
chr1_1359138_C_T_b38	ATAD3C	2.993	0.00331	0.149102	9	0.04981	no	BRNPTM
chr1_1359943_G_A_b38	ATAD3C	2.993	0.00331	0.149102	9	0.04981	no	BRNPTM
chr1_1360023_T_C_b38	ATAD3C	2.993	0.00331	0.149102	9	0.04981	no	BRNPTM
chr1_2370170_G_T_b38	ATAD3C	-2.98	0.00344	-0.093423	12	0.031346	no	BRNPTM
chr1_914838_T_A_b38	ATAD3C	-2.968	0.00357	-0.087636	37	0.029525	no	BRNPTM
chr1_2215723_T_C_b38	ATAD3C	-2.961	0.00365	-0.098616	16	0.033307	no	BRNPTM
chr1_933741_T_TG_b38	ATAD3C	-2.954	0.00373	-0.08962	16	0.030335	no	BRNPTM
chr1_2072659_G_A_b38	ATAD3C	2.919	0.00415	0.108324	5	0.037116	no	BRNPTM
chr1_2074688_G_A_b38	ATAD3C	2.919	0.00415	0.108324	5	0.037116	no	BRNPTM
chr1_2079677_C_G_b38	ATAD3C	2.918	0.00416	0.107524	5	0.036848	no	BRNPTM
chr1_1381268_C_T_b38	ATAD3C	2.898	0.00441	0.139796	8	0.048236	no	BRNPTM
chr1_1381294_C_T_b38	ATAD3C	2.898	0.00441	0.139796	8	0.048236	no	BRNPTM
chr1_1308178_GGGGCGCGGGGA_G_b38	ATAD3C	-2.84	0.00524	-0.102945	6	0.036246	no	BRNPTM
chr1_1341030_C_A_b38	ATAD3C	2.839	0.00526	0.130387	9	0.045925	no	BRNPTM
chr1_914991_G_T_b38	ATAD3C	-2.817	0.00561	-0.080648	33	0.028629	no	BRNPTM
chr1_1410877_A_G_b38	ATAD3C	-2.816	0.00562	-0.140789	11	0.049987	no	BRNPTM
chr1_1318756_G_A_b38	ATAD3C	2.786	0.00614	0.138183	9	0.049592	no	BRNPTM
chr1_1319063_G_A_b38	ATAD3C	2.786	0.00614	0.138183	9	0.049592	no	BRNPTM
chr1_1319461_C_G_b38	ATAD3C	2.786	0.00614	0.138183	9	0.049592	no	BRNPTM
chr1_1320023_TG_T_b38	ATAD3C	2.786	0.00614	0.138183	9	0.049592	no	BRNPTM
chr1_1322866_A_C_b38	ATAD3C	2.786	0.00614	0.138183	9	0.049592	no	BRNPTM
chr1_1327211_C_T_b38	ATAD3C	2.786	0.00614	0.138183	9	0.049592	no	BRNPTM
chr1_1327982_G_A_b38	ATAD3C	2.786	0.00614	0.138183	9	0.049592	no	BRNPTM
chr1_1330080_T_C_b38	ATAD3C	2.786	0.00614	0.138183	9	0.049592	no	BRNPTM
chr1_1353091_C_T_b38	ATAD3C	2.773	0.00637	0.128265	6	0.04625	no	BRNPTM
chr1_1353443_A_G_b38	ATAD3C	2.773	0.00637	0.128265	6	0.04625	no	BRNPTM
chr1_1337736_A_G_b38	ATAD3C	2.763	0.00656	0.131731	6	0.047674	no	BRNPTM
chr1_921096_A_G_b38	ATAD3C	2.758	0.00666	0.079196	29	0.028713	no	BRNPTM
chr1_1363153_T_G_b38	ATAD3C	2.723	0.00737	0.136171	7	0.050008	no	BRNPTM
chr1_1385919_A_AG_b38	ATAD3C	2.72	0.00744	0.12245	9	0.045026	no	BRNPTM
chr1_2075942_A_G_b38	ATAD3C	2.713	0.00759	0.100857	5	0.037182	no	BRNPTM
chr1_917495_C_T_b38	ATAD3C	-2.708	0.00768	-0.077656	32	0.028671	no	BRNPTM
chr1_918574_C_A_b38	ATAD3C	-2.708	0.00768	-0.077656	32	0.028671	no	BRNPTM
chr1_1380790_G_A_b38	ATAD3C	2.708	0.00768	0.12832	7	0.047378	no	BRNPTM
chr1_925308_G_A_b38	ATAD3C	-2.69	0.00809	-0.092123	10	0.034246	no	BRNPTM
chr1_2089758_A_G_b38	ATAD3C	2.685	0.00821	0.094026	10	0.03502	no	BRNPTM
chr1_1334606_G_A_b38	ATAD3C	-2.682	0.00829	-0.15364	3	0.057296	no	BRNPTM
chr1_1340576_C_T_b38	ATAD3C	-2.682	0.00829	-0.15364	3	0.057296	no	BRNPTM
chr1_1341362_GAC_G_b38	ATAD3C	-2.682	0.00829	-0.15364	3	0.057296	no	BRNPTM
chr1_1345112_C_T_b38	ATAD3C	-2.682	0.00829	-0.15364	3	0.057296	no	BRNPTM
chr1_1346453_C_T_b38	ATAD3C	-2.682	0.00829	-0.15364	3	0.057296	no	BRNPTM
chr1_916657_G_A_b38	ATAD3C	-2.681	0.0083	-0.079564	36	0.029676	no	BRNPTM
chr1_916683_G_A_b38	ATAD3C	-2.681	0.0083	-0.079564	36	0.029676	no	BRNPTM
chr1_2079137_C_T_b38	ATAD3C	2.669	0.00858	0.101769	6	0.038129	no	BRNPTM
chr1_1408687_T_C_b38	ATAD3C	-2.654	0.00896	-0.128228	7	0.048315	no	BRNPTM
chr1_2071051_C_CACCTGGGCGTGTG_b38	ATAD3C	2.627	0.00967	0.097654	5	0.037178	no	BRNPTM
chr1_1375288_A_C_b38	ATAD3C	2.623	0.00977	0.121167	7	0.046198	no	BRNPTM
chr1_1375595_C_T_b38	ATAD3C	2.623	0.00977	0.121167	7	0.046198	no	BRNPTM
chr1_1376092_G_A_b38	ATAD3C	2.623	0.00977	0.121167	7	0.046198	no	BRNPTM
chr1_1376336_G_A_b38	ATAD3C	2.623	0.00977	0.121167	7	0.046198	no	BRNPTM
chr1_1379664_G_A_b38	ATAD3C	2.623	0.00977	0.121167	7	0.046198	no	BRNPTM
chr1_1433374_T_C_b38	ATAD3C	-10.795	1.8e-18	-0.516422	16	0.047837	yes	BRNSPC
chr1_1443457_T_C_b38	ATAD3C	-10.452	1.01e-17	-0.510173	15	0.04881	yes	BRNSPC
chr1_1440834_C_G_b38	ATAD3C	-10.292	2.27e-17	-0.507085	15	0.049272	yes	BRNSPC
chr1_1431450_A_G_b38	ATAD3C	-9.556	9.32e-16	-0.513252	14	0.05371	yes	BRNSPC
chr1_1431537_G_C_b38	ATAD3C	-9.556	9.32e-16	-0.513252	14	0.05371	yes	BRNSPC
chr1_1436079_A_G_b38	ATAD3C	-9.487	1.32e-15	-0.484421	15	0.051064	yes	BRNSPC
chr1_1426261_C_T_b38	ATAD3C	-9.264	4.07e-15	-0.531123	12	0.057335	yes	BRNSPC
chr1_1430908_A_G_b38	ATAD3C	-9.259	4.18e-15	-0.511281	14	0.055222	yes	BRNSPC
chr1_1440430_C_G_b38	ATAD3C	-9.236	4.68e-15	-0.47723	11	0.051672	yes	BRNSPC
chr1_1430190_A_C_b38	ATAD3C	-9.046	1.22e-14	-0.500222	14	0.055298	yes	BRNSPC
chr1_1445187_T_G_b38	ATAD3C	-8.974	1.75e-14	-0.476754	13	0.053128	yes	BRNSPC
chr1_1445240_A_G_b38	ATAD3C	-8.974	1.75e-14	-0.476754	13	0.053128	yes	BRNSPC
chr1_1439454_A_G_b38	ATAD3C	-8.963	1.85e-14	-0.460189	14	0.051344	yes	BRNSPC
chr1_1426810_C_G_b38	ATAD3C	-8.839	3.45e-14	-0.507884	13	0.057461	yes	BRNSPC
chr1_1428969_T_C_b38	ATAD3C	-8.806	4.08e-14	-0.493235	14	0.056013	yes	BRNSPC
chr1_1449831_A_G_b38	ATAD3C	-8.134	1.17e-12	-0.480965	13	0.059129	yes	BRNSPC
chr1_1431014_G_A_b38	ATAD3C	-7.985	2.45e-12	-0.451959	8	0.056599	yes	BRNSPC
chr1_1436388_CA_C_b38	ATAD3C	-7.615	1.52e-11	-0.466151	9	0.061217	yes	BRNSPC
chr1_1438102_G_C_b38	ATAD3C	-7.472	3.05e-11	-0.473365	5	0.063352	yes	BRNSPC
chr1_1431026_CCACCCCCT_C_b38	ATAD3C	-7.365	5.14e-11	-0.465266	7	0.063177	yes	BRNSPC
chr1_1441187_A_G_b38	ATAD3C	-7.247	9.1e-11	-0.443993	11	0.061269	yes	BRNSPC
chr1_1442793_G_A_b38	ATAD3C	-7.246	9.13e-11	-0.515548	3	0.071149	yes	BRNSPC
chr1_1432355_G_A_b38	ATAD3C	-6.764	9.17e-10	-0.469391	5	0.069393	yes	BRNSPC
chr1_1435945_C_CCGGGCGGGGGCG_b38	ATAD3C	-6.548	2.54e-09	-0.479208	4	0.073185	yes	BRNSPC
chr1_1449009_A_T_b38	ATAD3C	-6.5	3.19e-09	-0.447942	8	0.068919	yes	BRNSPC
chr1_1439805_G_C_b38	ATAD3C	-6.459	3.84e-09	-0.430528	7	0.066651	yes	BRNSPC
chr1_1434687_C_G_b38	ATAD3C	-6.207	1.24e-08	-0.472545	3	0.076135	yes	BRNSPC
chr1_1451787_A_C_b38	ATAD3C	-6.103	1.99e-08	-0.373665	11	0.061225	yes	BRNSPC
chr1_1447108_A_ATT_b38	ATAD3C	-6.041	2.63e-08	-0.418344	6	0.069248	yes	BRNSPC
chr1_1411323_A_C_b38	ATAD3C	-6.001	3.16e-08	-0.397631	11	0.066264	yes	BRNSPC
chr1_1452511_A_G_b38	ATAD3C	-5.922	4.51e-08	-0.36695	15	0.061966	yes	BRNSPC
chr1_1452888_C_A_b38	ATAD3C	-5.922	4.51e-08	-0.36695	15	0.061966	yes	BRNSPC
chr1_1452909_A_C_b38	ATAD3C	-5.922	4.51e-08	-0.36695	15	0.061966	yes	BRNSPC
chr1_1453703_A_G_b38	ATAD3C	-5.922	4.51e-08	-0.36695	15	0.061966	yes	BRNSPC
chr1_1454092_A_G_b38	ATAD3C	-5.922	4.51e-08	-0.36695	15	0.061966	yes	BRNSPC
chr1_1455617_T_G_b38	ATAD3C	-5.922	4.51e-08	-0.36695	15	0.061966	yes	BRNSPC
chr1_1431656_G_A_b38	ATAD3C	-5.916	4.63e-08	-0.451951	3	0.076393	yes	BRNSPC
chr1_1394423_A_G_b38	ATAD3C	-5.911	4.74e-08	-0.394844	10	0.066799	yes	BRNSPC
chr1_1395346_A_G_b38	ATAD3C	-5.911	4.74e-08	-0.394844	10	0.066799	yes	BRNSPC
chr1_1402457_A_G_b38	ATAD3C	-5.911	4.74e-08	-0.394844	10	0.066799	yes	BRNSPC
chr1_1387698_A_G_b38	ATAD3C	5.911	4.74e-08	0.394844	10	0.066799	yes	BRNSPC
chr1_1389827_C_T_b38	ATAD3C	5.911	4.74e-08	0.394844	10	0.066799	yes	BRNSPC
chr1_1448915_G_A_b38	ATAD3C	-5.904	4.89e-08	-0.392463	9	0.066475	yes	BRNSPC
chr1_1454315_C_T_b38	ATAD3C	-5.884	5.35e-08	-0.362245	14	0.061563	yes	BRNSPC
chr1_1400410_A_G_b38	ATAD3C	-5.859	5.99e-08	-0.398574	7	0.06803	yes	BRNSPC
chr1_1384749_C_G_b38	ATAD3C	5.859	5.99e-08	0.398574	7	0.06803	yes	BRNSPC
chr1_1387763_CCT_C_b38	ATAD3C	5.859	5.99e-08	0.398574	7	0.06803	yes	BRNSPC
chr1_1388944_G_A_b38	ATAD3C	5.859	5.99e-08	0.398574	7	0.06803	yes	BRNSPC
chr1_1452797_CAA_C_b38	ATAD3C	-5.815	7.27e-08	-0.382735	7	0.065813	yes	BRNSPC
chr1_1376162_G_C_b38	ATAD3C	5.783	8.4e-08	0.393252	7	0.067999	yes	BRNSPC
chr1_1377431_C_T_b38	ATAD3C	5.783	8.4e-08	0.393252	7	0.067999	yes	BRNSPC
chr1_1378204_G_C_b38	ATAD3C	5.783	8.4e-08	0.393252	7	0.067999	yes	BRNSPC
chr1_1366427_AGTGTGATTGAATGAGT_A_b38	ATAD3C	5.72	1.11e-07	0.412327	4	0.072088	yes	BRNSPC
chr1_1330125_G_A_b38	ATAD3C	5.687	1.29e-07	0.389017	10	0.068407	yes	BRNSPC
chr1_1309988_G_A_b38	ATAD3C	5.66	1.45e-07	0.378359	11	0.066848	yes	BRNSPC
chr1_1312114_T_C_b38	ATAD3C	5.66	1.45e-07	0.378359	11	0.066848	yes	BRNSPC
chr1_1313807_G_A_b38	ATAD3C	5.66	1.45e-07	0.378359	11	0.066848	yes	BRNSPC
chr1_1431813_G_T_b38	ATAD3C	-5.65	1.52e-07	-0.406366	5	0.071928	yes	BRNSPC
chr1_1379083_AT_A_b38	ATAD3C	5.637	1.61e-07	0.381114	5	0.06761	yes	BRNSPC
chr1_1457033_A_C_b38	ATAD3C	-5.634	1.63e-07	-0.35585	9	0.063166	yes	BRNSPC
chr1_1308516_C_T_b38	ATAD3C	5.596	1.92e-07	0.37379	11	0.066794	yes	BRNSPC
chr1_1370113_A_G_b38	ATAD3C	5.462	3.45e-07	0.364414	8	0.066718	yes	BRNSPC
chr1_1456217_T_C_b38	ATAD3C	-5.419	4.15e-07	-0.354159	14	0.065353	yes	BRNSPC
chr1_1454770_T_C_b38	ATAD3C	-5.41	4.32e-07	-0.343792	15	0.063549	yes	BRNSPC
chr1_1358384_G_C_b38	ATAD3C	5.371	5.11e-07	0.376976	9	0.070189	yes	BRNSPC
chr1_1366561_AGT_A_b38	ATAD3C	5.371	5.11e-07	0.376976	9	0.070189	yes	BRNSPC
chr1_1452825_AAAG_A_b38	ATAD3C	-5.256	8.35e-07	-0.336701	10	0.064057	yes	BRNSPC
chr1_1453552_G_A_b38	ATAD3C	-5.256	8.35e-07	-0.336701	10	0.064057	yes	BRNSPC
chr1_1454848_T_C_b38	ATAD3C	-5.256	8.35e-07	-0.336701	10	0.064057	yes	BRNSPC
chr1_1455134_T_G_b38	ATAD3C	-5.256	8.35e-07	-0.336701	10	0.064057	yes	BRNSPC
chr1_1455337_A_G_b38	ATAD3C	-5.256	8.35e-07	-0.336701	10	0.064057	yes	BRNSPC
chr1_1455495_C_T_b38	ATAD3C	-5.256	8.35e-07	-0.336701	10	0.064057	yes	BRNSPC
chr1_1455924_T_C_b38	ATAD3C	-5.256	8.35e-07	-0.336701	10	0.064057	yes	BRNSPC
chr1_1456051_C_T_b38	ATAD3C	-5.256	8.35e-07	-0.336701	10	0.064057	yes	BRNSPC
chr1_1451968_C_T_b38	ATAD3C	-5.168	1.21e-06	-0.332969	9	0.064429	yes	BRNSPC
chr1_1428999_C_CA_b38	ATAD3C	-5.154	1.29e-06	-0.393602	3	0.076367	yes	BRNSPC
chr1_1456154_G_A_b38	ATAD3C	-5.145	1.34e-06	-0.332404	10	0.064606	yes	BRNSPC
chr1_1337898_A_G_b38	ATAD3C	5.066	1.87e-06	0.36221	3	0.071505	yes	BRNSPC
chr1_1456079_T_C_b38	ATAD3C	-4.965	2.84e-06	-0.323705	10	0.065204	yes	BRNSPC
chr1_1453643_A_ATT_b38	ATAD3C	-4.86	4.37e-06	-0.32098	11	0.066051	yes	BRNSPC
chr1_1456891_T_C_b38	ATAD3C	-4.8	5.56e-06	-0.314635	11	0.065544	yes	BRNSPC
chr1_1379091_T_G_b38	ATAD3C	4.78	6.04e-06	0.355999	3	0.074481	yes	BRNSPC
chr1_1452540_G_A_b38	ATAD3C	-4.638	1.07e-05	-0.307213	9	0.066233	yes	BRNSPC
chr1_1573654_T_C_b38	ATAD3C	-4.565	1.43e-05	-0.310844	15	0.068098	yes	BRNSPC
chr1_1574445_A_G_b38	ATAD3C	-4.565	1.43e-05	-0.310844	15	0.068098	yes	BRNSPC
chr1_1575724_G_C_b38	ATAD3C	-4.565	1.43e-05	-0.310844	15	0.068098	yes	BRNSPC
chr1_1456829_G_C_b38	ATAD3C	-4.539	1.58e-05	-0.311688	12	0.068664	yes	BRNSPC
chr1_1456182_G_A_b38	ATAD3C	-4.5	1.84e-05	-0.280909	12	0.062424	yes	BRNSPC
chr1_1457071_C_T_b38	ATAD3C	-4.412	2.59e-05	-0.278574	13	0.063145	yes	BRNSPC
chr1_1523187_A_G_b38	ATAD3C	-4.39	2.81e-05	-0.508683	7	0.115863	yes	BRNSPC
chr1_1452346_A_G_b38	ATAD3C	-4.313	3.79e-05	-0.312778	5	0.072526	yes	BRNSPC
chr1_1452384_G_A_b38	ATAD3C	-4.313	3.79e-05	-0.312778	5	0.072526	yes	BRNSPC
chr1_1575421_C_T_b38	ATAD3C	-4.299	3.99e-05	-0.294611	15	0.068528	yes	BRNSPC
chr1_1577491_A_AC_b38	ATAD3C	-4.217	5.45e-05	-0.290945	16	0.069001	yes	BRNSPC
chr1_1575864_G_A_b38	ATAD3C	-4.084	8.94e-05	-0.297538	14	0.072861	yes	BRNSPC
chr1_1363456_CAG_C_b38	ATAD3C	4.072	9.34e-05	0.28122	6	0.069066	yes	BRNSPC
chr1_1450636_A_G_b38	ATAD3C	-4.072	9.35e-05	-0.312772	4	0.076817	yes	BRNSPC
chr1_1451028_T_A_b38	ATAD3C	-4.072	9.35e-05	-0.312772	4	0.076817	yes	BRNSPC
chr1_1453870_A_C_b38	ATAD3C	-4.068	9.48e-05	-0.313936	4	0.077177	yes	BRNSPC
chr1_1361679_G_A_b38	ATAD3C	4.049	0.000102	0.305571	6	0.075475	yes	BRNSPC
chr1_1574655_GGC_G_b38	ATAD3C	-4.048	0.000102	-0.291593	13	0.072038	yes	BRNSPC
chr1_1383743_T_C_b38	ATAD3C	-4.027	0.00011	-0.336538	3	0.083569	yes	BRNSPC
chr1_1384546_C_T_b38	ATAD3C	-4.027	0.00011	-0.336538	3	0.083569	yes	BRNSPC
chr1_1398218_C_A_b38	ATAD3C	-4.027	0.00011	-0.336538	3	0.083569	yes	BRNSPC
chr1_1400756_GGA_G_b38	ATAD3C	-4.027	0.00011	-0.336538	3	0.083569	yes	BRNSPC
chr1_1401954_G_T_b38	ATAD3C	-4.027	0.00011	-0.336538	3	0.083569	yes	BRNSPC
chr1_1403593_A_G_b38	ATAD3C	-4.027	0.00011	-0.336538	3	0.083569	yes	BRNSPC
chr1_1407565_C_A_b38	ATAD3C	-4.027	0.00011	-0.336538	3	0.083569	yes	BRNSPC
chr1_1437993_G_A_b38	ATAD3C	-4.012	0.000116	-0.299809	5	0.074725	yes	BRNSPC
chr1_1363438_C_CTT_b38	ATAD3C	4	0.000121	0.275335	9	0.068832	yes	BRNSPC
chr1_1374505_A_G_b38	ATAD3C	-3.982	0.00013	-0.328041	3	0.082384	yes	BRNSPC
chr1_1573265_C_CAAAA_b38	ATAD3C	-3.972	0.000135	-0.38308	5	0.096455	yes	BRNSPC
chr1_1375642_C_T_b38	ATAD3C	-3.971	0.000135	-0.324547	3	0.081738	yes	BRNSPC
chr1_1380867_A_G_b38	ATAD3C	-3.971	0.000135	-0.324547	3	0.081738	yes	BRNSPC
chr1_1569180_T_A_b38	ATAD3C	-3.961	0.00014	-0.278854	15	0.070407	yes	BRNSPC
chr1_1453961_C_T_b38	ATAD3C	-3.96	0.000141	-0.307994	4	0.077782	yes	BRNSPC
chr1_1572532_A_C_b38	ATAD3C	-3.95	0.000146	-0.275302	16	0.069696	yes	BRNSPC
chr1_1573079_A_G_b38	ATAD3C	-3.95	0.000146	-0.275302	16	0.069696	yes	BRNSPC
chr1_1398056_C_A_b38	ATAD3C	-3.9	0.000174	-0.217463	20	0.05576	yes	BRNSPC
chr1_1553692_A_G_b38	ATAD3C	-3.885	0.000184	-0.267591	16	0.068876	yes	BRNSPC
chr1_1554694_A_G_b38	ATAD3C	-3.885	0.000184	-0.267591	16	0.068876	yes	BRNSPC
chr1_1554781_A_G_b38	ATAD3C	-3.885	0.000184	-0.267591	16	0.068876	yes	BRNSPC
chr1_1555247_T_A_b38	ATAD3C	-3.885	0.000184	-0.267591	16	0.068876	yes	BRNSPC
chr1_1559750_C_CAG_b38	ATAD3C	-3.885	0.000184	-0.267591	16	0.068876	yes	BRNSPC
chr1_1561628_T_C_b38	ATAD3C	-3.885	0.000184	-0.267591	16	0.068876	yes	BRNSPC
chr1_1563918_A_G_b38	ATAD3C	-3.885	0.000184	-0.267591	16	0.068876	yes	BRNSPC
chr1_1565105_CAAGGCAGGCGGATCATG_C_b38	ATAD3C	-3.885	0.000184	-0.267591	16	0.068876	yes	BRNSPC
chr1_1565561_A_G_b38	ATAD3C	-3.885	0.000184	-0.267591	16	0.068876	yes	BRNSPC
chr1_1566086_G_A_b38	ATAD3C	-3.885	0.000184	-0.267591	16	0.068876	yes	BRNSPC
chr1_1567715_G_A_b38	ATAD3C	-3.885	0.000184	-0.267591	16	0.068876	yes	BRNSPC
chr1_1567719_A_C_b38	ATAD3C	-3.885	0.000184	-0.267591	16	0.068876	yes	BRNSPC
chr1_1569875_C_T_b38	ATAD3C	-3.885	0.000184	-0.267591	16	0.068876	yes	BRNSPC
chr1_1569661_T_C_b38	ATAD3C	-3.881	0.000187	-0.265785	15	0.068484	yes	BRNSPC
chr1_1538787_A_G_b38	ATAD3C	-3.841	0.000216	-0.268995	15	0.07004	yes	BRNSPC
chr1_1259424_T_C_b38	ATAD3C	-3.831	0.000223	-0.289345	10	0.075534	yes	BRNSPC
chr1_1549590_C_G_b38	ATAD3C	-3.768	0.000278	-0.258117	16	0.0685	yes	BRNSPC
chr1_1565680_A_AG_b38	ATAD3C	-3.752	0.000294	-0.26062	16	0.069455	yes	BRNSPC
chr1_1515567_A_C_b38	ATAD3C	-3.745	0.000301	-0.505604	4	0.134992	yes	BRNSPC
chr1_1537493_T_A_b38	ATAD3C	-3.745	0.000301	-0.269461	13	0.071946	yes	BRNSPC
chr1_1382893_G_A_b38	ATAD3C	-3.713	0.000337	-0.306903	3	0.082652	yes	BRNSPC
chr1_1557495_CAT_C_b38	ATAD3C	-3.708	0.000343	-0.255724	15	0.068965	yes	BRNSPC
chr1_1558726_C_CA_b38	ATAD3C	-3.701	0.000352	-0.258107	15	0.069748	yes	BRNSPC
chr1_1561821_A_C_b38	ATAD3C	-3.701	0.000352	-0.258107	15	0.069748	yes	BRNSPC
chr1_1570294_CA_C_b38	ATAD3C	-3.686	0.00037	-0.254256	15	0.06897	yes	BRNSPC
chr1_1554852_T_C_b38	ATAD3C	-3.682	0.000376	-0.255988	16	0.069531	yes	BRNSPC
chr1_1302795_T_TC_b38	ATAD3C	3.659	0.000407	0.244126	19	0.066727	yes	BRNSPC
chr1_1541864_T_C_b38	ATAD3C	-3.653	0.000415	-0.25905	14	0.07092	yes	BRNSPC
chr1_1542773_T_C_b38	ATAD3C	-3.653	0.000415	-0.25905	14	0.07092	yes	BRNSPC
chr1_1542793_C_G_b38	ATAD3C	-3.653	0.000415	-0.25905	14	0.07092	yes	BRNSPC
chr1_1542800_T_C_b38	ATAD3C	-3.653	0.000415	-0.25905	14	0.07092	yes	BRNSPC
chr1_1543953_A_G_b38	ATAD3C	-3.653	0.000415	-0.25905	14	0.07092	yes	BRNSPC
chr1_1306523_C_G_b38	ATAD3C	3.602	0.000493	0.343323	5	0.095305	yes	BRNSPC
chr1_1550064_GC_G_b38	ATAD3C	-3.585	0.000523	-0.248544	15	0.069325	yes	BRNSPC
chr1_1550068_C_A_b38	ATAD3C	-3.585	0.000523	-0.248544	15	0.069325	yes	BRNSPC
chr1_1551557_A_AG_b38	ATAD3C	-3.58	0.000533	-0.243057	15	0.067901	yes	BRNSPC
chr1_1551559_A_T_b38	ATAD3C	-3.58	0.000533	-0.243057	15	0.067901	yes	BRNSPC
chr1_1437955_C_G_b38	ATAD3C	-3.564	0.000562	-0.225349	11	0.063234	yes	BRNSPC
chr1_1543500_T_G_b38	ATAD3C	-3.562	0.000565	-0.248895	15	0.069865	yes	BRNSPC
chr1_1527386_C_T_b38	ATAD3C	-3.55	0.000588	-0.482885	7	0.136007	yes	BRNSPC
chr1_1422081_C_T_b38	ATAD3C	-3.538	0.000614	-0.37717	5	0.106611	yes	BRNSPC
chr1_1497605_G_C_b38	ATAD3C	-3.49	0.00072	-0.234292	13	0.067131	yes	BRNSPC
chr1_1471992_T_C_b38	ATAD3C	-3.477	0.000752	-0.227124	18	0.065321	yes	BRNSPC
chr1_1547630_G_A_b38	ATAD3C	-3.446	0.000834	-0.235494	13	0.068342	yes	BRNSPC
chr1_1388565_GTC_G_b38	ATAD3C	3.444	0.00084	0.259746	5	0.07543	yes	BRNSPC
chr1_1532798_T_C_b38	ATAD3C	-3.443	0.00084	-0.221464	29	0.064315	yes	BRNSPC
chr1_1571986_G_A_b38	ATAD3C	-3.438	0.000856	-0.242964	12	0.070672	yes	BRNSPC
chr1_1410877_A_G_b38	ATAD3C	-3.413	0.000928	-0.371996	5	0.108983	yes	BRNSPC
chr1_1419135_C_G_b38	ATAD3C	-3.413	0.000928	-0.371996	5	0.108983	yes	BRNSPC
chr1_1575935_T_C_b38	ATAD3C	-3.41	0.000939	-0.250406	15	0.073443	yes	BRNSPC
chr1_1306420_A_G_b38	ATAD3C	3.397	0.000978	0.359705	7	0.105877	yes	BRNSPC
chr1_1307327_A_G_b38	ATAD3C	3.397	0.000978	0.359705	7	0.105877	yes	BRNSPC
chr1_1295039_T_C_b38	ATAD3C	-3.397	0.000978	-0.359705	7	0.105877	yes	BRNSPC
chr1_1298561_T_C_b38	ATAD3C	-3.397	0.000978	-0.359705	7	0.105877	yes	BRNSPC
chr1_1258206_AT_A_b38	ATAD3C	-3.378	0.00104	-0.243142	10	0.071973	yes	BRNSPC
chr1_2263866_C_CA_b38	ATAD3C	-3.377	0.00105	-0.257965	4	0.076395	yes	BRNSPC
chr1_1559703_G_C_b38	ATAD3C	-3.346	0.00116	-0.240797	14	0.071962	yes	BRNSPC
chr1_1570587_C_T_b38	ATAD3C	-3.346	0.00116	-0.240797	14	0.071962	yes	BRNSPC
chr1_1538924_C_A_b38	ATAD3C	-3.328	0.00123	-0.239583	9	0.072001	yes	BRNSPC
chr1_1341030_C_A_b38	ATAD3C	3.308	0.00131	0.343288	3	0.103773	yes	BRNSPC
chr1_1568548_G_A_b38	ATAD3C	-3.302	0.00133	-0.237942	14	0.072061	yes	BRNSPC
chr1_1539491_G_C_b38	ATAD3C	-3.295	0.00136	-0.242761	14	0.073668	yes	BRNSPC
chr1_1300330_T_A_b38	ATAD3C	-3.292	0.00138	-0.342683	7	0.104108	yes	BRNSPC
chr1_1301656_T_C_b38	ATAD3C	-3.292	0.00138	-0.342683	7	0.104108	yes	BRNSPC
chr1_1307603_G_A_b38	ATAD3C	3.292	0.00138	0.342683	7	0.104108	yes	BRNSPC
chr1_1410616_G_T_b38	ATAD3C	-3.292	0.00138	-0.348279	3	0.105809	yes	BRNSPC
chr1_1412488_C_CAG_b38	ATAD3C	-3.292	0.00138	-0.348279	3	0.105809	yes	BRNSPC
chr1_1415976_G_A_b38	ATAD3C	-3.292	0.00138	-0.348279	3	0.105809	yes	BRNSPC
chr1_1407232_G_C_b38	ATAD3C	-3.283	0.00142	-0.228797	7	0.069694	yes	BRNSPC
chr1_1425013_C_T_b38	ATAD3C	-3.233	0.00166	-0.300579	7	0.092965	yes	BRNSPC
chr1_1545795_C_A_b38	ATAD3C	-3.21	0.00179	-0.227674	12	0.070932	yes	BRNSPC
chr1_1411929_G_C_b38	ATAD3C	-3.207	0.0018	-0.329381	3	0.102712	yes	BRNSPC
chr1_1378484_AT_A_b38	ATAD3C	3.187	0.00192	0.224382	20	0.070408	yes	BRNSPC
chr1_1361833_G_C_b38	ATAD3C	3.174	0.002	0.253867	4	0.079988	yes	BRNSPC
chr1_1560765_T_C_b38	ATAD3C	-3.156	0.00211	-0.2295	13	0.072715	yes	BRNSPC
chr1_1562261_TTTTC_T_b38	ATAD3C	-3.156	0.00211	-0.2295	13	0.072715	yes	BRNSPC
chr1_1571794_A_AT_b38	ATAD3C	-3.152	0.00214	-0.231899	12	0.07357	yes	BRNSPC
chr1_1500729_G_A_b38	ATAD3C	-3.14	0.00222	-0.448249	6	0.142743	yes	BRNSPC
chr1_1351517_G_C_b38	ATAD3C	3.1	0.00252	0.29109	5	0.09391	yes	BRNSPC
chr1_1555179_A_G_b38	ATAD3C	-3.094	0.00256	-0.227894	12	0.073653	yes	BRNSPC
chr1_1411525_T_A_b38	ATAD3C	-3.087	0.00262	-0.323549	3	0.104825	yes	BRNSPC
chr1_1359943_G_A_b38	ATAD3C	3.067	0.00278	0.339192	3	0.110585	yes	BRNSPC
chr1_1537160_T_G_b38	ATAD3C	-3.043	0.003	-0.211205	19	0.069417	yes	BRNSPC
chr1_1566854_CA_C_b38	ATAD3C	-3.036	0.00305	-0.231939	15	0.076391	yes	BRNSPC
chr1_1549967_C_G_b38	ATAD3C	-2.972	0.00371	-0.222204	8	0.074769	yes	BRNSPC
chr1_1428763_A_G_b38	ATAD3C	-2.968	0.00375	-0.328193	5	0.110578	yes	BRNSPC
chr1_1479719_T_C_b38	ATAD3C	-2.963	0.00381	-0.202408	17	0.06831	yes	BRNSPC
chr1_1555871_T_C_b38	ATAD3C	-2.935	0.00414	-0.2225	11	0.07581	yes	BRNSPC
chr1_1340697_G_A_b38	ATAD3C	2.932	0.00417	0.191847	10	0.065428	yes	BRNSPC
chr1_1530555_C_T_b38	ATAD3C	-2.93	0.0042	-0.434968	3	0.148435	yes	BRNSPC
chr1_1280044_T_C_b38	ATAD3C	-2.924	0.00428	-0.222998	10	0.076276	yes	BRNSPC
chr1_1579717_T_A_b38	ATAD3C	-2.903	0.00455	-0.231943	4	0.079893	yes	BRNSPC
chr1_1520875_A_G_b38	ATAD3C	-2.89	0.00472	-0.405137	5	0.140178	yes	BRNSPC
chr1_1524202_G_A_b38	ATAD3C	-2.89	0.00472	-0.405137	5	0.140178	yes	BRNSPC
chr1_1530002_A_G_b38	ATAD3C	-2.89	0.00472	-0.405137	5	0.140178	yes	BRNSPC
chr1_1533018_T_C_b38	ATAD3C	-2.89	0.00472	-0.405137	5	0.140178	yes	BRNSPC
chr1_1296939_G_A_b38	ATAD3C	-2.887	0.00477	-0.312741	3	0.108337	yes	BRNSPC
chr1_1303959_T_G_b38	ATAD3C	2.887	0.00477	0.312741	3	0.108337	yes	BRNSPC
chr1_1482316_C_G_b38	ATAD3C	-2.882	0.00484	-0.197917	8	0.06868	yes	BRNSPC
chr1_1251122_A_T_b38	ATAD3C	-2.852	0.00529	-0.21831	4	0.076557	yes	BRNSPC
chr1_1324788_C_A_b38	ATAD3C	2.844	0.0054	0.279785	3	0.098364	yes	BRNSPC
chr1_1517993_A_G_b38	ATAD3C	-2.815	0.00587	-0.173053	21	0.061469	yes	BRNSPC
chr1_1519934_T_G_b38	ATAD3C	-2.815	0.00587	-0.173053	21	0.061469	yes	BRNSPC
chr1_1519938_T_C_b38	ATAD3C	-2.815	0.00587	-0.173053	21	0.061469	yes	BRNSPC
chr1_1318756_G_A_b38	ATAD3C	2.793	0.00626	0.297098	3	0.106376	yes	BRNSPC
chr1_1319063_G_A_b38	ATAD3C	2.793	0.00626	0.297098	3	0.106376	yes	BRNSPC
chr1_1319461_C_G_b38	ATAD3C	2.793	0.00626	0.297098	3	0.106376	yes	BRNSPC
chr1_1320023_TG_T_b38	ATAD3C	2.793	0.00626	0.297098	3	0.106376	yes	BRNSPC
chr1_1322866_A_C_b38	ATAD3C	2.793	0.00626	0.297098	3	0.106376	yes	BRNSPC
chr1_1327211_C_T_b38	ATAD3C	2.793	0.00626	0.297098	3	0.106376	yes	BRNSPC
chr1_1327982_G_A_b38	ATAD3C	2.793	0.00626	0.297098	3	0.106376	yes	BRNSPC
chr1_1330080_T_C_b38	ATAD3C	2.793	0.00626	0.297098	3	0.106376	yes	BRNSPC
chr1_1554548_T_C_b38	ATAD3C	-2.783	0.00645	-0.205931	11	0.074008	yes	BRNSPC
chr1_1991761_T_C_b38	ATAD3C	-2.776	0.00658	-0.186411	20	0.067158	yes	BRNSPC
chr1_1567912_C_CAAAAAAAA_b38	ATAD3C	-2.773	0.00662	-0.29606	3	0.106759	yes	BRNSPC
chr1_1574032_AAAG_A_b38	ATAD3C	-2.772	0.00665	-0.216782	10	0.078214	yes	BRNSPC
chr1_2271335_C_T_b38	ATAD3C	-2.771	0.00666	-0.222799	5	0.080404	yes	BRNSPC
chr1_2270709_G_A_b38	ATAD3C	-2.756	0.00695	-0.215193	5	0.078082	yes	BRNSPC
chr1_2119789_C_CT_b38	ATAD3C	2.756	0.00696	0.201749	8	0.073209	yes	BRNSPC
chr1_1573429_CAAAAAAAAAAAAAAAAAA_C_b38	ATAD3C	-2.747	0.00712	-0.194232	14	0.070695	yes	BRNSPC
chr1_1558347_G_A_b38	ATAD3C	-2.747	0.00713	-0.210716	11	0.076706	yes	BRNSPC
chr1_1361685_C_T_b38	ATAD3C	-2.743	0.00721	-0.229748	6	0.083746	yes	BRNSPC
chr1_1551454_C_A_b38	ATAD3C	-2.732	0.00744	-0.16652	32	0.06095	yes	BRNSPC
chr1_1290261_C_A_b38	ATAD3C	-2.716	0.0078	-0.264998	5	0.097585	yes	BRNSPC
chr1_1357046_C_G_b38	ATAD3C	2.712	0.00788	0.296003	3	0.109161	yes	BRNSPC
chr1_1357369_C_T_b38	ATAD3C	2.712	0.00788	0.296003	3	0.109161	yes	BRNSPC
chr1_1358907_C_A_b38	ATAD3C	2.712	0.00788	0.296003	3	0.109161	yes	BRNSPC
chr1_1359138_C_T_b38	ATAD3C	2.712	0.00788	0.296003	3	0.109161	yes	BRNSPC
chr1_1360023_T_C_b38	ATAD3C	2.712	0.00788	0.296003	3	0.109161	yes	BRNSPC
chr1_1573776_A_G_b38	ATAD3C	-2.7	0.00814	-0.221875	3	0.082175	yes	BRNSPC
chr1_1251368_T_C_b38	ATAD3C	-2.687	0.00845	-0.223026	3	0.083015	yes	BRNSPC
chr1_1530549_G_GA_b38	ATAD3C	-2.665	0.00897	-0.415617	3	0.155935	yes	BRNSPC
chr1_1530550_C_A_b38	ATAD3C	-2.665	0.00897	-0.415617	3	0.155935	yes	BRNSPC
chr1_1530553_G_A_b38	ATAD3C	-2.665	0.00897	-0.415617	3	0.155935	yes	BRNSPC
chr1_1530546_A_ATT_b38	ATAD3C	-2.662	0.00906	-0.415369	3	0.156043	yes	BRNSPC
chr1_1530568_G_T_b38	ATAD3C	-2.662	0.00906	-0.415369	3	0.156043	yes	BRNSPC
chr1_1726053_G_C_b38	ATAD3C	2.646	0.00947	0.27628	6	0.104424	yes	BRNSPC
chr1_1580890_C_T_b38	ATAD3C	-2.638	0.00967	-0.219963	3	0.083378	yes	BRNSPC
chr1_1421170_A_G_b38	ATAD3C	-3.336	0.0012	-0.373398	4	0.111942	no	BRNSPC
chr1_1522905_A_G_b38	ATAD3C	-3.3	0.00134	-0.445777	5	0.135092	no	BRNSPC
chr1_1497606_C_G_b38	ATAD3C	-2.988	0.00353	-0.249614	3	0.083534	no	BRNSPC
chr1_1650000_G_A_b38	ATAD3C	2.919	0.00434	0.177554	15	0.060822	no	BRNSPC
chr1_2416398_G_GGGACA_b38	ATAD3C	-2.78	0.0065	-0.181225	11	0.065193	no	BRNSPC
chr1_1521518_G_A_b38	ATAD3C	-2.772	0.00665	-0.40651	5	0.146671	no	BRNSPC
chr1_1522693_A_G_b38	ATAD3C	2.758	0.00691	0.214663	4	0.077823	no	BRNSPC
chr1_1443457_T_C_b38	ATAD3C	-8.218	1.66e-12	-0.352273	19	0.042867	yes	BRNSNG
chr1_1428969_T_C_b38	ATAD3C	-7.995	4.75e-12	-0.343094	19	0.042915	yes	BRNSNG
chr1_1440834_C_G_b38	ATAD3C	-7.783	1.28e-11	-0.335412	18	0.043094	yes	BRNSNG
chr1_1430190_A_C_b38	ATAD3C	-7.556	3.71e-11	-0.332788	19	0.044044	yes	BRNSNG
chr1_1430908_A_G_b38	ATAD3C	-7.556	3.71e-11	-0.332788	19	0.044044	yes	BRNSNG
chr1_1431450_A_G_b38	ATAD3C	-7.556	3.71e-11	-0.332788	19	0.044044	yes	BRNSNG
chr1_1431537_G_C_b38	ATAD3C	-7.556	3.71e-11	-0.332788	19	0.044044	yes	BRNSNG
chr1_1440430_C_G_b38	ATAD3C	-7.343	9.98e-11	-0.321437	14	0.043776	yes	BRNSNG
chr1_1433374_T_C_b38	ATAD3C	-7.308	1.17e-10	-0.317924	20	0.043503	yes	BRNSNG
chr1_1431014_G_A_b38	ATAD3C	-7.086	3.27e-10	-0.314319	9	0.04436	yes	BRNSNG
chr1_1436079_A_G_b38	ATAD3C	-7.074	3.46e-10	-0.314697	18	0.044489	yes	BRNSNG
chr1_1441187_A_G_b38	ATAD3C	-6.732	1.64e-09	-0.316873	13	0.047067	yes	BRNSNG
chr1_1431026_CCACCCCCT_C_b38	ATAD3C	-6.676	2.11e-09	-0.321092	8	0.048094	yes	BRNSNG
chr1_1436388_CA_C_b38	ATAD3C	-6.602	2.96e-09	-0.311972	12	0.047256	yes	BRNSNG
chr1_1445187_T_G_b38	ATAD3C	-6.502	4.64e-09	-0.301087	17	0.046308	yes	BRNSNG
chr1_1445240_A_G_b38	ATAD3C	-6.502	4.64e-09	-0.301087	17	0.046308	yes	BRNSNG
chr1_1426261_C_T_b38	ATAD3C	-6.433	6.34e-09	-0.300737	19	0.046753	yes	BRNSNG
chr1_1426810_C_G_b38	ATAD3C	-6.433	6.34e-09	-0.300737	19	0.046753	yes	BRNSNG
chr1_1439454_A_G_b38	ATAD3C	-6.212	1.69e-08	-0.270915	17	0.043611	yes	BRNSNG
chr1_1438102_G_C_b38	ATAD3C	-6.06	3.3e-08	-0.288408	7	0.047592	yes	BRNSNG
chr1_1448915_G_A_b38	ATAD3C	-5.919	6.1e-08	-0.294823	13	0.049806	yes	BRNSNG
chr1_1432355_G_A_b38	ATAD3C	-5.765	1.19e-07	-0.281943	7	0.048905	yes	BRNSNG
chr1_1434687_C_G_b38	ATAD3C	-5.704	1.54e-07	-0.305289	4	0.05352	yes	BRNSNG
chr1_1442793_G_A_b38	ATAD3C	-5.262	9.96e-07	-0.287616	5	0.054664	yes	BRNSNG
chr1_1435945_C_CCGGGCGGGGGCG_b38	ATAD3C	-5.251	1.04e-06	-0.289299	5	0.055092	yes	BRNSNG
chr1_1411323_A_C_b38	ATAD3C	-5.236	1.11e-06	-0.262562	16	0.050146	yes	BRNSNG
chr1_1387698_A_G_b38	ATAD3C	5.223	1.17e-06	0.260091	15	0.049799	yes	BRNSNG
chr1_1402457_A_G_b38	ATAD3C	-5.223	1.17e-06	-0.260091	15	0.049799	yes	BRNSNG
chr1_1308516_C_T_b38	ATAD3C	5.207	1.25e-06	0.266592	16	0.0512	yes	BRNSNG
chr1_1337898_A_G_b38	ATAD3C	5.119	1.79e-06	0.250605	7	0.048955	yes	BRNSNG
chr1_1431656_G_A_b38	ATAD3C	-5.047	2.4e-06	-0.292894	3	0.058038	yes	BRNSNG
chr1_1309988_G_A_b38	ATAD3C	5.015	2.73e-06	0.257468	16	0.051341	yes	BRNSNG
chr1_1312114_T_C_b38	ATAD3C	5.015	2.73e-06	0.257468	16	0.051341	yes	BRNSNG
chr1_1313807_G_A_b38	ATAD3C	5.015	2.73e-06	0.257468	16	0.051341	yes	BRNSNG
chr1_1330125_G_A_b38	ATAD3C	5.015	2.73e-06	0.257468	16	0.051341	yes	BRNSNG
chr1_1394423_A_G_b38	ATAD3C	-5.006	2.83e-06	-0.249788	14	0.049898	yes	BRNSNG
chr1_1395346_A_G_b38	ATAD3C	-5.006	2.83e-06	-0.249788	14	0.049898	yes	BRNSNG
chr1_1389827_C_T_b38	ATAD3C	5.006	2.83e-06	0.249788	14	0.049898	yes	BRNSNG
chr1_1358384_G_C_b38	ATAD3C	4.943	3.64e-06	0.25278	15	0.051135	yes	BRNSNG
chr1_1376162_G_C_b38	ATAD3C	4.915	4.08e-06	0.245918	12	0.050034	yes	BRNSNG
chr1_1377431_C_T_b38	ATAD3C	4.915	4.08e-06	0.245918	12	0.050034	yes	BRNSNG
chr1_1378204_G_C_b38	ATAD3C	4.915	4.08e-06	0.245918	12	0.050034	yes	BRNSNG
chr1_1384749_C_G_b38	ATAD3C	4.915	4.08e-06	0.245918	12	0.050034	yes	BRNSNG
chr1_1387763_CCT_C_b38	ATAD3C	4.915	4.08e-06	0.245918	12	0.050034	yes	BRNSNG
chr1_1388944_G_A_b38	ATAD3C	4.915	4.08e-06	0.245918	12	0.050034	yes	BRNSNG
chr1_1400410_A_G_b38	ATAD3C	-4.915	4.08e-06	-0.245918	12	0.050034	yes	BRNSNG
chr1_1366561_AGT_A_b38	ATAD3C	4.737	8.26e-06	0.242649	14	0.051223	yes	BRNSNG
chr1_1370113_A_G_b38	ATAD3C	4.604	1.39e-05	0.226071	14	0.049105	yes	BRNSNG
chr1_1431813_G_T_b38	ATAD3C	-4.552	1.7e-05	-0.25145	5	0.055243	yes	BRNSNG
chr1_1366427_AGTGTGATTGAATGAGT_A_b38	ATAD3C	4.551	1.7e-05	0.233855	11	0.051383	yes	BRNSNG
chr1_1482316_C_G_b38	ATAD3C	-4.42	2.81e-05	-0.230546	8	0.052162	yes	BRNSNG
chr1_1259424_T_C_b38	ATAD3C	-4.361	3.5e-05	-0.235206	15	0.053929	yes	BRNSNG
chr1_1375678_TA_T_b38	ATAD3C	4.315	4.16e-05	0.242997	9	0.056313	yes	BRNSNG
chr1_1439805_G_C_b38	ATAD3C	-4.291	4.55e-05	-0.242577	7	0.056533	yes	BRNSNG
chr1_1437993_G_A_b38	ATAD3C	-4.181	6.82e-05	-0.214567	7	0.051314	yes	BRNSNG
chr1_1426253_G_A_b38	ATAD3C	-4.098	9.24e-05	-0.245301	3	0.059854	yes	BRNSNG
chr1_1394041_G_A_b38	ATAD3C	-4.011	0.000127	-0.246773	3	0.06153	yes	BRNSNG
chr1_1551557_A_AG_b38	ATAD3C	-3.981	0.000141	-0.223646	12	0.056184	yes	BRNSNG
chr1_1551559_A_T_b38	ATAD3C	-3.981	0.000141	-0.223646	12	0.056184	yes	BRNSNG
chr1_1541864_T_C_b38	ATAD3C	-3.972	0.000145	-0.225936	14	0.056881	yes	BRNSNG
chr1_1447108_A_ATT_b38	ATAD3C	-3.92	0.000175	-0.225345	6	0.057493	yes	BRNSNG
chr1_1258206_AT_A_b38	ATAD3C	-3.89	0.000194	-0.202383	15	0.052024	yes	BRNSNG
chr1_1379083_AT_A_b38	ATAD3C	3.873	0.000206	0.194226	10	0.050143	yes	BRNSNG
chr1_1557495_CAT_C_b38	ATAD3C	-3.872	0.000207	-0.212803	14	0.054953	yes	BRNSNG
chr1_1374505_A_G_b38	ATAD3C	-3.858	0.000218	-0.223352	5	0.057898	yes	BRNSNG
chr1_1325753_G_T_b38	ATAD3C	-3.855	0.00022	-0.24797	3	0.064329	yes	BRNSNG
chr1_1375642_C_T_b38	ATAD3C	-3.849	0.000224	-0.222517	5	0.057808	yes	BRNSNG
chr1_1379093_TG_T_b38	ATAD3C	-3.847	0.000226	-0.236691	4	0.061523	yes	BRNSNG
chr1_1558726_C_CA_b38	ATAD3C	-3.846	0.000227	-0.213787	14	0.055592	yes	BRNSNG
chr1_1561821_A_C_b38	ATAD3C	-3.846	0.000227	-0.213787	14	0.055592	yes	BRNSNG
chr1_1383743_T_C_b38	ATAD3C	-3.836	0.000235	-0.220255	5	0.057415	yes	BRNSNG
chr1_1361679_G_A_b38	ATAD3C	3.811	0.000256	0.206382	10	0.05416	yes	BRNSNG
chr1_1217251_C_A_b38	ATAD3C	-3.719	0.000351	-0.232202	4	0.062429	yes	BRNSNG
chr1_1384546_C_T_b38	ATAD3C	-3.707	0.000366	-0.215036	5	0.058011	yes	BRNSNG
chr1_1398218_C_A_b38	ATAD3C	-3.707	0.000366	-0.215036	5	0.058011	yes	BRNSNG
chr1_1400756_GGA_G_b38	ATAD3C	-3.707	0.000366	-0.215036	5	0.058011	yes	BRNSNG
chr1_1401954_G_T_b38	ATAD3C	-3.707	0.000366	-0.215036	5	0.058011	yes	BRNSNG
chr1_1403593_A_G_b38	ATAD3C	-3.707	0.000366	-0.215036	5	0.058011	yes	BRNSNG
chr1_1407565_C_A_b38	ATAD3C	-3.707	0.000366	-0.215036	5	0.058011	yes	BRNSNG
chr1_1363898_C_T_b38	ATAD3C	3.704	0.00037	0.203593	6	0.054969	yes	BRNSNG
chr1_1363986_C_T_b38	ATAD3C	3.704	0.00037	0.203593	6	0.054969	yes	BRNSNG
chr1_1365566_G_A_b38	ATAD3C	3.704	0.00037	0.203593	6	0.054969	yes	BRNSNG
chr1_1366529_TTAG_T_b38	ATAD3C	3.704	0.00037	0.203593	6	0.054969	yes	BRNSNG
chr1_1367292_A_AGT_b38	ATAD3C	3.704	0.00037	0.203593	6	0.054969	yes	BRNSNG
chr1_1380867_A_G_b38	ATAD3C	-3.697	0.000379	-0.215048	5	0.058165	yes	BRNSNG
chr1_1545795_C_A_b38	ATAD3C	-3.686	0.000393	-0.207144	10	0.056197	yes	BRNSNG
chr1_1532798_T_C_b38	ATAD3C	-3.685	0.000395	-0.192604	24	0.052269	yes	BRNSNG
chr1_1382893_G_A_b38	ATAD3C	-3.668	0.000419	-0.214534	5	0.058496	yes	BRNSNG
chr1_1379091_T_G_b38	ATAD3C	3.654	0.000438	0.203058	6	0.055573	yes	BRNSNG
chr1_1542793_C_G_b38	ATAD3C	-3.646	0.00045	-0.199527	12	0.054719	yes	BRNSNG
chr1_1542800_T_C_b38	ATAD3C	-3.646	0.00045	-0.199527	12	0.054719	yes	BRNSNG
chr1_1249880_A_G_b38	ATAD3C	-3.644	0.000454	-0.212121	8	0.058217	yes	BRNSNG
chr1_1372909_G_A_b38	ATAD3C	-3.641	0.000458	-0.2191	5	0.06017	yes	BRNSNG
chr1_1384256_T_G_b38	ATAD3C	3.601	0.000524	0.236584	3	0.065702	yes	BRNSNG
chr1_1542773_T_C_b38	ATAD3C	-3.582	0.000559	-0.197508	13	0.055145	yes	BRNSNG
chr1_1543953_A_G_b38	ATAD3C	-3.582	0.000559	-0.197508	13	0.055145	yes	BRNSNG
chr1_1550064_GC_G_b38	ATAD3C	-3.582	0.000559	-0.197508	13	0.055145	yes	BRNSNG
chr1_1550068_C_A_b38	ATAD3C	-3.582	0.000559	-0.197508	13	0.055145	yes	BRNSNG
chr1_1363456_CAG_C_b38	ATAD3C	3.579	0.000564	0.184073	9	0.051435	yes	BRNSNG
chr1_1251122_A_T_b38	ATAD3C	-3.542	0.000638	-0.199826	9	0.056417	yes	BRNSNG
chr1_1398056_C_A_b38	ATAD3C	-3.542	0.000638	-0.183485	11	0.051806	yes	BRNSNG
chr1_1329973_GCGTGTGCCATGCA_G_b38	ATAD3C	-3.529	0.000666	-0.214772	4	0.060861	yes	BRNSNG
chr1_1574445_A_G_b38	ATAD3C	-3.526	0.000673	-0.189893	16	0.053859	yes	BRNSNG
chr1_1370553_CAAA_C_b38	ATAD3C	-3.525	0.000674	-0.234324	4	0.06647	yes	BRNSNG
chr1_1303112_G_A_b38	ATAD3C	-3.512	0.000704	-0.219461	4	0.062484	yes	BRNSNG
chr1_1303800_G_A_b38	ATAD3C	-3.512	0.000704	-0.219461	4	0.062484	yes	BRNSNG
chr1_1304555_A_C_b38	ATAD3C	-3.512	0.000704	-0.219461	4	0.062484	yes	BRNSNG
chr1_1566854_CA_C_b38	ATAD3C	-3.489	0.000759	-0.20745	11	0.059453	yes	BRNSNG
chr1_1341550_GCA_G_b38	ATAD3C	-3.489	0.000759	-0.211274	5	0.060552	yes	BRNSNG
chr1_1543500_T_G_b38	ATAD3C	-3.485	0.00077	-0.18915	14	0.05428	yes	BRNSNG
chr1_1388565_GTC_G_b38	ATAD3C	3.483	0.000774	0.204953	7	0.058842	yes	BRNSNG
chr1_1316929_A_T_b38	ATAD3C	-3.467	0.000816	-0.203575	5	0.058718	yes	BRNSNG
chr1_1344048_G_A_b38	ATAD3C	-3.463	0.000827	-0.21009	4	0.060666	yes	BRNSNG
chr1_1364253_C_G_b38	ATAD3C	-3.463	0.000827	-0.21009	4	0.060666	yes	BRNSNG
chr1_1566086_G_A_b38	ATAD3C	-3.462	0.000831	-0.191931	16	0.055447	yes	BRNSNG
chr1_1570294_CA_C_b38	ATAD3C	-3.443	0.000883	-0.189598	15	0.055071	yes	BRNSNG
chr1_1569180_T_A_b38	ATAD3C	-3.435	0.000906	-0.188014	16	0.054735	yes	BRNSNG
chr1_1280044_T_C_b38	ATAD3C	-3.423	0.000941	-0.185152	16	0.054087	yes	BRNSNG
chr1_1538787_A_G_b38	ATAD3C	-3.411	0.000979	-0.18897	16	0.055399	yes	BRNSNG
chr1_1290968_C_G_b38	ATAD3C	-3.403	0.001	-0.232092	10	0.068197	yes	BRNSNG
chr1_1522693_A_G_b38	ATAD3C	3.39	0.00105	0.196869	5	0.058068	yes	BRNSNG
chr1_1573654_T_C_b38	ATAD3C	-3.386	0.00106	-0.178594	16	0.052741	yes	BRNSNG
chr1_1549967_C_G_b38	ATAD3C	-3.347	0.0012	-0.194117	7	0.058001	yes	BRNSNG
chr1_1251356_AT_A_b38	ATAD3C	-3.342	0.00122	-0.221983	3	0.06643	yes	BRNSNG
chr1_1252261_C_T_b38	ATAD3C	-3.341	0.00123	-0.224079	3	0.067072	yes	BRNSNG
chr1_1559750_C_CAG_b38	ATAD3C	-3.31	0.00135	-0.179142	16	0.054119	yes	BRNSNG
chr1_1561628_T_C_b38	ATAD3C	-3.31	0.00135	-0.179142	16	0.054119	yes	BRNSNG
chr1_1563918_A_G_b38	ATAD3C	-3.31	0.00135	-0.179142	16	0.054119	yes	BRNSNG
chr1_1565561_A_G_b38	ATAD3C	-3.31	0.00135	-0.179142	16	0.054119	yes	BRNSNG
chr1_1567715_G_A_b38	ATAD3C	-3.31	0.00135	-0.179142	16	0.054119	yes	BRNSNG
chr1_1567719_A_C_b38	ATAD3C	-3.31	0.00135	-0.179142	16	0.054119	yes	BRNSNG
chr1_1569875_C_T_b38	ATAD3C	-3.31	0.00135	-0.179142	16	0.054119	yes	BRNSNG
chr1_1449009_A_T_b38	ATAD3C	-3.305	0.00137	-0.202716	11	0.061335	yes	BRNSNG
chr1_1575421_C_T_b38	ATAD3C	-3.294	0.00142	-0.17218	15	0.052272	yes	BRNSNG
chr1_1572532_A_C_b38	ATAD3C	-3.287	0.00145	-0.177247	16	0.053916	yes	BRNSNG
chr1_1573079_A_G_b38	ATAD3C	-3.287	0.00145	-0.177247	16	0.053916	yes	BRNSNG
chr1_2108657_T_C_b38	ATAD3C	3.281	0.00148	0.22544	5	0.068713	yes	BRNSNG
chr1_1577491_A_AC_b38	ATAD3C	-3.268	0.00155	-0.173692	17	0.053148	yes	BRNSNG
chr1_1252613_C_G_b38	ATAD3C	-3.224	0.00178	-0.20683	4	0.064159	yes	BRNSNG
chr1_1421170_A_G_b38	ATAD3C	-3.211	0.00185	-0.291083	5	0.090642	yes	BRNSNG
chr1_1575724_G_C_b38	ATAD3C	-3.201	0.00191	-0.167395	15	0.052293	yes	BRNSNG
chr1_1236037_C_T_b38	ATAD3C	-3.193	0.00195	-0.163052	19	0.051063	yes	BRNSNG
chr1_1449831_A_G_b38	ATAD3C	-3.186	0.002	-0.198024	16	0.062163	yes	BRNSNG
chr1_1569661_T_C_b38	ATAD3C	-3.181	0.00203	-0.173127	14	0.054425	yes	BRNSNG
chr1_2109346_A_G_b38	ATAD3C	3.178	0.00205	0.215735	5	0.06789	yes	BRNSNG
chr1_2109497_T_C_b38	ATAD3C	3.178	0.00205	0.215735	5	0.06789	yes	BRNSNG
chr1_1290841_A_G_b38	ATAD3C	-3.176	0.00206	-0.192772	8	0.060691	yes	BRNSNG
chr1_1411525_T_A_b38	ATAD3C	-3.158	0.00218	-0.269961	3	0.08549	yes	BRNSNG
chr1_1547630_G_A_b38	ATAD3C	-3.156	0.00219	-0.171782	12	0.054434	yes	BRNSNG
chr1_1370430_T_C_b38	ATAD3C	-3.148	0.00225	-0.191361	5	0.060793	yes	BRNSNG
chr1_1370532_C_T_b38	ATAD3C	-3.148	0.00225	-0.191361	5	0.060793	yes	BRNSNG
chr1_1370584_G_C_b38	ATAD3C	-3.148	0.00225	-0.191361	5	0.060793	yes	BRNSNG
chr1_1244603_G_A_b38	ATAD3C	-3.132	0.00236	-0.210556	3	0.067235	yes	BRNSNG
chr1_2107797_G_T_b38	ATAD3C	3.127	0.00239	0.212435	6	0.06793	yes	BRNSNG
chr1_2108949_G_A_b38	ATAD3C	3.127	0.00239	0.212435	6	0.06793	yes	BRNSNG
chr1_2109324_G_A_b38	ATAD3C	3.127	0.00239	0.212435	6	0.06793	yes	BRNSNG
chr1_2109338_C_T_b38	ATAD3C	3.127	0.00239	0.212435	6	0.06793	yes	BRNSNG
chr1_1553692_A_G_b38	ATAD3C	-3.126	0.0024	-0.167798	15	0.053676	yes	BRNSNG
chr1_1554694_A_G_b38	ATAD3C	-3.126	0.0024	-0.167798	15	0.053676	yes	BRNSNG
chr1_1554781_A_G_b38	ATAD3C	-3.126	0.0024	-0.167798	15	0.053676	yes	BRNSNG
chr1_1555247_T_A_b38	ATAD3C	-3.126	0.0024	-0.167798	15	0.053676	yes	BRNSNG
chr1_1363880_A_G_b38	ATAD3C	-3.126	0.0024	-0.190512	4	0.060944	yes	BRNSNG
chr1_1364282_T_G_b38	ATAD3C	-3.123	0.00242	-0.190228	4	0.060911	yes	BRNSNG
chr1_1364357_A_C_b38	ATAD3C	-3.123	0.00242	-0.190228	4	0.060911	yes	BRNSNG
chr1_1364566_T_C_b38	ATAD3C	-3.123	0.00242	-0.190228	4	0.060911	yes	BRNSNG
chr1_1364694_T_C_b38	ATAD3C	-3.123	0.00242	-0.190228	4	0.060911	yes	BRNSNG
chr1_1364721_C_T_b38	ATAD3C	-3.123	0.00242	-0.190228	4	0.060911	yes	BRNSNG
chr1_1365160_A_G_b38	ATAD3C	-3.123	0.00242	-0.190228	4	0.060911	yes	BRNSNG
chr1_1365198_C_T_b38	ATAD3C	-3.123	0.00242	-0.190228	4	0.060911	yes	BRNSNG
chr1_1366008_A_G_b38	ATAD3C	-3.123	0.00242	-0.190228	4	0.060911	yes	BRNSNG
chr1_1366062_T_C_b38	ATAD3C	-3.123	0.00242	-0.190228	4	0.060911	yes	BRNSNG
chr1_1366145_TGTGAA_T_b38	ATAD3C	-3.123	0.00242	-0.190228	4	0.060911	yes	BRNSNG
chr1_1366187_A_AGT_b38	ATAD3C	-3.123	0.00242	-0.190228	4	0.060911	yes	BRNSNG
chr1_1366292_G_T_b38	ATAD3C	-3.123	0.00242	-0.190228	4	0.060911	yes	BRNSNG
chr1_1366321_TGTGTGTAAATGG_T_b38	ATAD3C	-3.123	0.00242	-0.190228	4	0.060911	yes	BRNSNG
chr1_1366453_G_T_b38	ATAD3C	-3.123	0.00242	-0.190228	4	0.060911	yes	BRNSNG
chr1_1366726_T_G_b38	ATAD3C	-3.123	0.00242	-0.190228	4	0.060911	yes	BRNSNG
chr1_1367258_T_A_b38	ATAD3C	-3.123	0.00242	-0.190228	4	0.060911	yes	BRNSNG
chr1_1367268_TGA_T_b38	ATAD3C	-3.123	0.00242	-0.190228	4	0.060911	yes	BRNSNG
chr1_1367280_T_A_b38	ATAD3C	-3.123	0.00242	-0.190228	4	0.060911	yes	BRNSNG
chr1_1367297_GAA_G_b38	ATAD3C	-3.123	0.00242	-0.190228	4	0.060911	yes	BRNSNG
chr1_1367300_T_TGA_b38	ATAD3C	-3.123	0.00242	-0.190228	4	0.060911	yes	BRNSNG
chr1_1367329_A_AGT_b38	ATAD3C	-3.123	0.00242	-0.190228	4	0.060911	yes	BRNSNG
chr1_1367373_T_TGTG_b38	ATAD3C	-3.123	0.00242	-0.190228	4	0.060911	yes	BRNSNG
chr1_1367388_T_TTGG_b38	ATAD3C	-3.123	0.00242	-0.190228	4	0.060911	yes	BRNSNG
chr1_1367462_T_C_b38	ATAD3C	-3.123	0.00242	-0.190228	4	0.060911	yes	BRNSNG
chr1_1367593_G_A_b38	ATAD3C	-3.123	0.00242	-0.190228	4	0.060911	yes	BRNSNG
chr1_1367602_GT_G_b38	ATAD3C	-3.123	0.00242	-0.190228	4	0.060911	yes	BRNSNG
chr1_1367605_GAGTGAGTGTA_G_b38	ATAD3C	-3.123	0.00242	-0.190228	4	0.060911	yes	BRNSNG
chr1_1367670_GGTGA_G_b38	ATAD3C	-3.123	0.00242	-0.190228	4	0.060911	yes	BRNSNG
chr1_1367722_TTTTA_T_b38	ATAD3C	-3.123	0.00242	-0.190228	4	0.060911	yes	BRNSNG
chr1_1367874_A_T_b38	ATAD3C	-3.123	0.00242	-0.190228	4	0.060911	yes	BRNSNG
chr1_1367919_C_T_b38	ATAD3C	-3.123	0.00242	-0.190228	4	0.060911	yes	BRNSNG
chr1_1367951_C_T_b38	ATAD3C	-3.123	0.00242	-0.190228	4	0.060911	yes	BRNSNG
chr1_1367965_A_G_b38	ATAD3C	-3.123	0.00242	-0.190228	4	0.060911	yes	BRNSNG
chr1_1367970_T_G_b38	ATAD3C	-3.123	0.00242	-0.190228	4	0.060911	yes	BRNSNG
chr1_1367994_C_A_b38	ATAD3C	-3.123	0.00242	-0.190228	4	0.060911	yes	BRNSNG
chr1_1368297_C_T_b38	ATAD3C	-3.123	0.00242	-0.190228	4	0.060911	yes	BRNSNG
chr1_1368514_C_G_b38	ATAD3C	-3.123	0.00242	-0.190228	4	0.060911	yes	BRNSNG
chr1_1368991_C_T_b38	ATAD3C	-3.123	0.00242	-0.190228	4	0.060911	yes	BRNSNG
chr1_1369009_T_C_b38	ATAD3C	-3.123	0.00242	-0.190228	4	0.060911	yes	BRNSNG
chr1_1369012_C_CG_b38	ATAD3C	-3.123	0.00242	-0.190228	4	0.060911	yes	BRNSNG
chr1_1369282_G_A_b38	ATAD3C	-3.123	0.00242	-0.190228	4	0.060911	yes	BRNSNG
chr1_1369320_GT_G_b38	ATAD3C	-3.123	0.00242	-0.190228	4	0.060911	yes	BRNSNG
chr1_1369407_G_A_b38	ATAD3C	-3.123	0.00242	-0.190228	4	0.060911	yes	BRNSNG
chr1_1369476_CTT_C_b38	ATAD3C	-3.123	0.00242	-0.190228	4	0.060911	yes	BRNSNG
chr1_1369556_C_G_b38	ATAD3C	-3.123	0.00242	-0.190228	4	0.060911	yes	BRNSNG
chr1_1369627_T_C_b38	ATAD3C	-3.123	0.00242	-0.190228	4	0.060911	yes	BRNSNG
chr1_1369686_T_C_b38	ATAD3C	-3.123	0.00242	-0.190228	4	0.060911	yes	BRNSNG
chr1_1369716_G_C_b38	ATAD3C	-3.123	0.00242	-0.190228	4	0.060911	yes	BRNSNG
chr1_1369741_C_T_b38	ATAD3C	-3.123	0.00242	-0.190228	4	0.060911	yes	BRNSNG
chr1_1370181_C_T_b38	ATAD3C	-3.123	0.00242	-0.190228	4	0.060911	yes	BRNSNG
chr1_1370317_G_C_b38	ATAD3C	-3.123	0.00242	-0.190228	4	0.060911	yes	BRNSNG
chr1_1370320_A_G_b38	ATAD3C	-3.123	0.00242	-0.190228	4	0.060911	yes	BRNSNG
chr1_1363688_C_T_b38	ATAD3C	-3.121	0.00244	-0.190018	4	0.060881	yes	BRNSNG
chr1_1364099_CCA_C_b38	ATAD3C	-3.121	0.00244	-0.190018	4	0.060881	yes	BRNSNG
chr1_1364102_TGTTG_T_b38	ATAD3C	-3.121	0.00244	-0.190018	4	0.060881	yes	BRNSNG
chr1_1366511_GGTGA_G_b38	ATAD3C	-3.121	0.00244	-0.190018	4	0.060881	yes	BRNSNG
chr1_1368763_G_A_b38	ATAD3C	-3.121	0.00244	-0.190018	4	0.060881	yes	BRNSNG
chr1_1554852_T_C_b38	ATAD3C	-3.093	0.00266	-0.164598	15	0.053219	yes	BRNSNG
chr1_1549590_C_G_b38	ATAD3C	-3.082	0.00275	-0.165301	15	0.05364	yes	BRNSNG
chr1_1231507_T_C_b38	ATAD3C	-3.073	0.00282	-0.198434	3	0.064563	yes	BRNSNG
chr1_1236303_A_G_b38	ATAD3C	-3.059	0.00294	-0.183613	4	0.060023	yes	BRNSNG
chr1_1221049_C_G_b38	ATAD3C	-3.056	0.00297	-0.15889	17	0.051997	yes	BRNSNG
chr1_1565105_CAAGGCAGGCGGATCATG_C_b38	ATAD3C	-3.051	0.00302	-0.172221	16	0.056449	yes	BRNSNG
chr1_2108280_G_A_b38	ATAD3C	3.037	0.00314	0.219004	3	0.072109	yes	BRNSNG
chr1_1369821_C_T_b38	ATAD3C	-3.029	0.00322	-0.183957	4	0.060724	yes	BRNSNG
chr1_1407232_G_C_b38	ATAD3C	-3.027	0.00324	-0.164317	8	0.054286	yes	BRNSNG
chr1_1361685_C_T_b38	ATAD3C	-3.02	0.00331	-0.179163	8	0.059321	yes	BRNSNG
chr1_1551454_C_A_b38	ATAD3C	-3.015	0.00335	-0.161921	23	0.053699	yes	BRNSNG
chr1_1182018_A_G_b38	ATAD3C	-3.009	0.00342	-0.159497	24	0.053006	yes	BRNSNG
chr1_1471992_T_C_b38	ATAD3C	-3.008	0.00343	-0.169749	17	0.05643	yes	BRNSNG
chr1_1359943_G_A_b38	ATAD3C	2.997	0.00354	0.278644	3	0.092965	yes	BRNSNG
chr1_1231710_CCCCCGGGAA_C_b38	ATAD3C	-2.986	0.00366	-0.19014	4	0.063669	yes	BRNSNG
chr1_1560765_T_C_b38	ATAD3C	-2.985	0.00367	-0.17596	10	0.058943	yes	BRNSNG
chr1_1562261_TTTTC_T_b38	ATAD3C	-2.985	0.00367	-0.17596	10	0.058943	yes	BRNSNG
chr1_1308178_GGGGCGCGGGGA_G_b38	ATAD3C	-2.984	0.00368	-0.170318	8	0.057075	yes	BRNSNG
chr1_1360507_T_TGGGGGGC_b38	ATAD3C	2.971	0.00383	0.232836	3	0.078373	yes	BRNSNG
chr1_1367511_ATGAG_A_b38	ATAD3C	-2.958	0.00398	-0.187428	3	0.063372	yes	BRNSNG
chr1_1251618_G_A_b38	ATAD3C	-2.956	0.004	-0.187106	5	0.063306	yes	BRNSNG
chr1_1215852_T_C_b38	ATAD3C	-2.952	0.00404	-0.186732	5	0.063248	yes	BRNSNG
chr1_2370032_C_G_b38	ATAD3C	-2.928	0.00435	-0.175306	6	0.05988	yes	BRNSNG
chr1_1533883_G_T_b38	ATAD3C	-2.911	0.00456	-0.280597	4	0.096375	yes	BRNSNG
chr1_1246371_T_C_b38	ATAD3C	-2.91	0.00457	-0.186621	7	0.064126	yes	BRNSNG
chr1_1571794_A_AT_b38	ATAD3C	-2.905	0.00464	-0.165909	12	0.057111	yes	BRNSNG
chr1_1296939_G_A_b38	ATAD3C	-2.904	0.00466	-0.260751	3	0.089803	yes	BRNSNG
chr1_1303959_T_G_b38	ATAD3C	2.904	0.00466	0.260751	3	0.089803	yes	BRNSNG
chr1_1318756_G_A_b38	ATAD3C	2.904	0.00466	0.260751	3	0.089803	yes	BRNSNG
chr1_1319063_G_A_b38	ATAD3C	2.904	0.00466	0.260751	3	0.089803	yes	BRNSNG
chr1_1319461_C_G_b38	ATAD3C	2.904	0.00466	0.260751	3	0.089803	yes	BRNSNG
chr1_1320023_TG_T_b38	ATAD3C	2.904	0.00466	0.260751	3	0.089803	yes	BRNSNG
chr1_1322866_A_C_b38	ATAD3C	2.904	0.00466	0.260751	3	0.089803	yes	BRNSNG
chr1_1327211_C_T_b38	ATAD3C	2.904	0.00466	0.260751	3	0.089803	yes	BRNSNG
chr1_1330080_T_C_b38	ATAD3C	2.904	0.00466	0.260751	3	0.089803	yes	BRNSNG
chr1_1357046_C_G_b38	ATAD3C	2.904	0.00466	0.260751	3	0.089803	yes	BRNSNG
chr1_1357369_C_T_b38	ATAD3C	2.904	0.00466	0.260751	3	0.089803	yes	BRNSNG
chr1_1358907_C_A_b38	ATAD3C	2.904	0.00466	0.260751	3	0.089803	yes	BRNSNG
chr1_1360023_T_C_b38	ATAD3C	2.904	0.00466	0.260751	3	0.089803	yes	BRNSNG
chr1_1238231_G_A_b38	ATAD3C	-2.901	0.00469	-0.171167	7	0.058998	yes	BRNSNG
chr1_1537160_T_G_b38	ATAD3C	-2.896	0.00477	-0.159647	21	0.055131	yes	BRNSNG
chr1_1453870_A_C_b38	ATAD3C	-2.891	0.00483	-0.176977	4	0.061207	yes	BRNSNG
chr1_1453961_C_T_b38	ATAD3C	-2.891	0.00483	-0.176977	4	0.061207	yes	BRNSNG
chr1_1571986_G_A_b38	ATAD3C	-2.89	0.00485	-0.156352	10	0.054101	yes	BRNSNG
chr1_1517993_A_G_b38	ATAD3C	-2.882	0.00496	-0.154356	21	0.053552	yes	BRNSNG
chr1_1519934_T_G_b38	ATAD3C	-2.882	0.00496	-0.154356	21	0.053552	yes	BRNSNG
chr1_1519938_T_C_b38	ATAD3C	-2.882	0.00496	-0.154356	21	0.053552	yes	BRNSNG
chr1_1368177_G_C_b38	ATAD3C	-2.882	0.00496	-0.176692	4	0.061301	yes	BRNSNG
chr1_1450636_A_G_b38	ATAD3C	-2.867	0.00519	-0.178839	4	0.062382	yes	BRNSNG
chr1_1451028_T_A_b38	ATAD3C	-2.867	0.00519	-0.178839	4	0.062382	yes	BRNSNG
chr1_1251285_G_A_b38	ATAD3C	-2.863	0.00524	-0.181327	6	0.063328	yes	BRNSNG
chr1_1251368_T_C_b38	ATAD3C	-2.863	0.00524	-0.181327	6	0.063328	yes	BRNSNG
chr1_1370553_CA_C_b38	ATAD3C	2.862	0.00527	0.144835	27	0.050613	yes	BRNSNG
chr1_1453703_A_G_b38	ATAD3C	-2.857	0.00533	-0.170814	16	0.059782	yes	BRNSNG
chr1_1565680_A_AG_b38	ATAD3C	-2.856	0.00536	-0.156948	16	0.054963	yes	BRNSNG
chr1_1497605_G_C_b38	ATAD3C	-2.847	0.00549	-0.159295	16	0.055952	yes	BRNSNG
chr1_2302601_CAGG_C_b38	ATAD3C	2.847	0.00549	0.178693	5	0.062766	yes	BRNSNG
chr1_2303193_G_A_b38	ATAD3C	2.847	0.00549	0.178693	5	0.062766	yes	BRNSNG
chr1_455065_G_T_b38	ATAD3C	-2.818	0.00596	-0.153734	7	0.054549	yes	BRNSNG
chr1_1290579_C_G_b38	ATAD3C	-2.813	0.00605	-0.152293	11	0.054139	yes	BRNSNG
chr1_1341030_C_A_b38	ATAD3C	2.793	0.0064	0.226371	4	0.081035	yes	BRNSNG
chr1_1238902_T_C_b38	ATAD3C	-2.786	0.00653	-0.150603	17	0.054056	yes	BRNSNG
chr1_1229369_G_GC_b38	ATAD3C	-2.777	0.0067	-0.17482	5	0.062946	yes	BRNSNG
chr1_1422081_C_T_b38	ATAD3C	-2.771	0.00682	-0.249208	7	0.089935	yes	BRNSNG
chr1_1228424_C_T_b38	ATAD3C	-2.764	0.00696	-0.182466	3	0.066018	yes	BRNSNG
chr1_1226486_C_T_b38	ATAD3C	-2.755	0.00713	-0.176868	3	0.064202	yes	BRNSNG
chr1_2302522_G_A_b38	ATAD3C	2.748	0.00728	0.169713	5	0.06176	yes	BRNSNG
chr1_1419135_C_G_b38	ATAD3C	-2.729	0.00767	-0.247152	6	0.090563	yes	BRNSNG
chr1_1415976_G_A_b38	ATAD3C	-2.726	0.00774	-0.254476	3	0.093362	yes	BRNSNG
chr1_1437955_C_G_b38	ATAD3C	-2.723	0.00779	-0.136104	15	0.049975	yes	BRNSNG
chr1_1217733_G_A_b38	ATAD3C	-2.721	0.00785	-0.17619	4	0.064763	yes	BRNSNG
chr1_1410616_G_T_b38	ATAD3C	-2.72	0.00787	-0.243381	3	0.089491	yes	BRNSNG
chr1_1412488_C_CAG_b38	ATAD3C	-2.72	0.00787	-0.243381	3	0.089491	yes	BRNSNG
chr1_1201373_T_C_b38	ATAD3C	-2.716	0.00795	-0.15696	13	0.057785	yes	BRNSNG
chr1_1367028_A_G_b38	ATAD3C	2.709	0.00812	0.181677	4	0.067075	yes	BRNSNG
chr1_1248709_A_G_b38	ATAD3C	-2.7	0.00831	-0.19345	4	0.071644	yes	BRNSNG
chr1_1455617_T_G_b38	ATAD3C	-2.699	0.00834	-0.16327	17	0.06049	yes	BRNSNG
chr1_1452797_CAA_C_b38	ATAD3C	-2.691	0.00851	-0.171553	6	0.06374	yes	BRNSNG
chr1_1411929_G_C_b38	ATAD3C	-2.672	0.00898	-0.235572	3	0.088162	yes	BRNSNG
chr1_1732892_C_CT_b38	ATAD3C	-2.665	0.00917	-0.234527	3	0.088018	yes	BRNSNG
chr1_1575864_G_A_b38	ATAD3C	-2.662	0.00923	-0.146492	12	0.055027	yes	BRNSNG
chr1_1216593_G_C_b38	ATAD3C	-2.659	0.0093	-0.166277	5	0.062526	yes	BRNSNG
chr1_2298478_C_T_b38	ATAD3C	2.641	0.00977	0.145229	9	0.054981	yes	BRNSNG
chr1_1292284_TTGAG_T_b38	ATAD3C	-3.764	0.000301	-0.237542	7	0.063108	no	BRNSNG
chr1_871922_A_ATT_b38	ATAD3C	3.694	0.000383	0.225371	3	0.061016	no	BRNSNG
chr1_1243102_A_G_b38	ATAD3C	-3.182	0.00202	-0.211779	4	0.066546	no	BRNSNG
chr1_1242865_C_T_b38	ATAD3C	-3.163	0.00215	-0.204114	4	0.064542	no	BRNSNG
chr1_1290261_C_A_b38	ATAD3C	-3.127	0.00239	-0.223147	9	0.071352	no	BRNSNG
chr1_1243650_G_A_b38	ATAD3C	-3.114	0.00249	-0.208367	3	0.066923	no	BRNSNG
chr1_1327982_G_A_b38	ATAD3C	3.077	0.00279	0.271524	4	0.088249	no	BRNSNG
chr1_1235602_C_A_b38	ATAD3C	-3.054	0.00299	-0.198325	3	0.064943	no	BRNSNG
chr1_1306420_A_G_b38	ATAD3C	3.042	0.0031	0.288367	7	0.094801	no	BRNSNG
chr1_1307327_A_G_b38	ATAD3C	3.042	0.0031	0.288367	7	0.094801	no	BRNSNG
chr1_1307603_G_A_b38	ATAD3C	3.042	0.0031	0.288367	7	0.094801	no	BRNSNG
chr1_1295039_T_C_b38	ATAD3C	-3.042	0.0031	-0.288367	7	0.094801	no	BRNSNG
chr1_1298561_T_C_b38	ATAD3C	-3.042	0.0031	-0.288367	7	0.094801	no	BRNSNG
chr1_1300330_T_A_b38	ATAD3C	-3.042	0.0031	-0.288367	7	0.094801	no	BRNSNG
chr1_1301656_T_C_b38	ATAD3C	-3.042	0.0031	-0.288367	7	0.094801	no	BRNSNG
chr1_1274256_A_G_b38	ATAD3C	-2.876	0.00505	-0.21764	4	0.075678	no	BRNSNG
chr1_1274980_C_T_b38	ATAD3C	-2.876	0.00505	-0.21764	4	0.075678	no	BRNSNG
chr1_1275912_C_T_b38	ATAD3C	-2.876	0.00505	-0.21764	4	0.075678	no	BRNSNG
chr1_1279694_A_G_b38	ATAD3C	-2.876	0.00505	-0.21764	4	0.075678	no	BRNSNG
chr1_1279698_A_G_b38	ATAD3C	-2.876	0.00505	-0.21764	4	0.075678	no	BRNSNG
chr1_1279728_TG_T_b38	ATAD3C	-2.876	0.00505	-0.21764	4	0.075678	no	BRNSNG
chr1_1241053_A_G_b38	ATAD3C	-2.84	0.00561	-0.189679	3	0.066799	no	BRNSNG
chr1_1242094_A_G_b38	ATAD3C	-2.84	0.00561	-0.189679	3	0.066799	no	BRNSNG
chr1_1242250_A_G_b38	ATAD3C	-2.84	0.00561	-0.189679	3	0.066799	no	BRNSNG
chr1_1306523_C_G_b38	ATAD3C	2.787	0.00651	0.238558	6	0.085594	no	BRNSNG
chr1_2107223_G_A_b38	ATAD3C	2.69	0.00855	0.131932	18	0.049048	no	BRNSNG
chr1_1443457_T_C_b38	ATAD3C	-6.625	1.44e-10	-0.171362	55	0.025867	yes	BREAST
chr1_1440834_C_G_b38	ATAD3C	-6.598	1.69e-10	-0.170488	52	0.025838	yes	BREAST
chr1_1433374_T_C_b38	ATAD3C	-6.197	1.74e-09	-0.153947	58	0.024842	yes	BREAST
chr1_1441187_A_G_b38	ATAD3C	-6.163	2.12e-09	-0.159633	38	0.025904	yes	BREAST
chr1_1428969_T_C_b38	ATAD3C	-6.068	3.6e-09	-0.15166	55	0.024993	yes	BREAST
chr1_1436079_A_G_b38	ATAD3C	-5.995	5.41e-09	-0.148416	56	0.024756	yes	BREAST
chr1_1341550_GCA_G_b38	ATAD3C	-5.889	9.71e-09	-0.194046	9	0.032952	yes	BREAST
chr1_1430190_A_C_b38	ATAD3C	-5.786	1.7e-08	-0.14531	55	0.025116	yes	BREAST
chr1_1426261_C_T_b38	ATAD3C	-5.713	2.51e-08	-0.145298	53	0.025434	yes	BREAST
chr1_1431450_A_G_b38	ATAD3C	-5.65	3.51e-08	-0.14188	55	0.025111	yes	BREAST
chr1_1431537_G_C_b38	ATAD3C	-5.65	3.51e-08	-0.14188	55	0.025111	yes	BREAST
chr1_1426810_C_G_b38	ATAD3C	-5.632	3.86e-08	-0.142378	54	0.02528	yes	BREAST
chr1_1430908_A_G_b38	ATAD3C	-5.624	4.02e-08	-0.139776	56	0.024853	yes	BREAST
chr1_1316929_A_T_b38	ATAD3C	-5.414	1.2e-07	-0.183791	7	0.033949	yes	BREAST
chr1_1380867_A_G_b38	ATAD3C	-5.335	1.79e-07	-0.181202	9	0.033962	yes	BREAST
chr1_1344048_G_A_b38	ATAD3C	-5.326	1.88e-07	-0.180649	7	0.033919	yes	BREAST
chr1_1384546_C_T_b38	ATAD3C	-5.261	2.61e-07	-0.182868	9	0.034762	yes	BREAST
chr1_1329973_GCGTGTGCCATGCA_G_b38	ATAD3C	-5.246	2.81e-07	-0.178526	7	0.03403	yes	BREAST
chr1_1435945_C_CCGGGCGGGGGCG_b38	ATAD3C	-4.885	1.63e-06	-0.138281	15	0.028307	yes	BREAST
chr1_1370553_CAAA_C_b38	ATAD3C	-4.843	1.99e-06	-0.166069	7	0.034293	yes	BREAST
chr1_1428999_C_CA_b38	ATAD3C	-4.805	2.36e-06	-0.125135	20	0.026041	yes	BREAST
chr1_1308178_GGGGCGCGGGGA_G_b38	ATAD3C	-4.437	1.25e-05	-0.135646	13	0.030569	yes	BREAST
chr1_2189011_G_GAA_b38	ATAD3C	4.378	1.62e-05	0.235834	3	0.053866	yes	BREAST
chr1_1303800_G_A_b38	ATAD3C	-4.269	2.58e-05	-0.150905	5	0.035349	yes	BREAST
chr1_1439805_G_C_b38	ATAD3C	-3.979	8.55e-05	-0.108295	23	0.02722	yes	BREAST
chr1_1437993_G_A_b38	ATAD3C	-3.968	8.93e-05	-0.105277	22	0.026533	yes	BREAST
chr1_1541864_T_C_b38	ATAD3C	-3.963	9.11e-05	-0.097681	61	0.024649	yes	BREAST
chr1_1407232_G_C_b38	ATAD3C	-3.955	9.41e-05	-0.105436	22	0.026662	yes	BREAST
chr1_1575724_G_C_b38	ATAD3C	-3.92	0.000108	-0.09729	58	0.024816	yes	BREAST
chr1_1551557_A_AG_b38	ATAD3C	-3.887	0.000123	-0.095365	61	0.024532	yes	BREAST
chr1_1551559_A_T_b38	ATAD3C	-3.887	0.000123	-0.095365	61	0.024532	yes	BREAST
chr1_1558726_C_CA_b38	ATAD3C	-3.797	0.000175	-0.092396	63	0.024335	yes	BREAST
chr1_1561821_A_C_b38	ATAD3C	-3.797	0.000175	-0.092396	63	0.024335	yes	BREAST
chr1_1543953_A_G_b38	ATAD3C	-3.73	0.000226	-0.090904	58	0.024372	yes	BREAST
chr1_1575421_C_T_b38	ATAD3C	-3.728	0.000228	-0.092508	58	0.024815	yes	BREAST
chr1_1543500_T_G_b38	ATAD3C	-3.701	0.000252	-0.089697	57	0.024237	yes	BREAST
chr1_1545795_C_A_b38	ATAD3C	-3.695	0.000258	-0.091001	51	0.024627	yes	BREAST
chr1_1547630_G_A_b38	ATAD3C	-3.691	0.000261	-0.087683	58	0.023753	yes	BREAST
chr1_1532798_T_C_b38	ATAD3C	-3.686	0.000267	-0.083025	104	0.022523	yes	BREAST
chr1_1542773_T_C_b38	ATAD3C	-3.666	0.000287	-0.089408	58	0.024387	yes	BREAST
chr1_1542793_C_G_b38	ATAD3C	-3.666	0.000287	-0.089408	58	0.024387	yes	BREAST
chr1_1542800_T_C_b38	ATAD3C	-3.666	0.000287	-0.089408	58	0.024387	yes	BREAST
chr1_1550064_GC_G_b38	ATAD3C	-3.644	0.000312	-0.088627	59	0.024321	yes	BREAST
chr1_1550068_C_A_b38	ATAD3C	-3.644	0.000312	-0.088627	59	0.024321	yes	BREAST
chr1_861347_G_T_b38	ATAD3C	-3.611	0.000353	-0.107128	7	0.029669	yes	BREAST
chr1_1302795_T_TC_b38	ATAD3C	3.609	0.000356	0.094357	69	0.026145	yes	BREAST
chr1_1437955_C_G_b38	ATAD3C	-3.604	0.000362	-0.087568	42	0.024296	yes	BREAST
chr1_1559750_C_CAG_b38	ATAD3C	-3.59	0.000382	-0.086076	68	0.023978	yes	BREAST
chr1_1561628_T_C_b38	ATAD3C	-3.59	0.000382	-0.086076	68	0.023978	yes	BREAST
chr1_1563918_A_G_b38	ATAD3C	-3.59	0.000382	-0.086076	68	0.023978	yes	BREAST
chr1_1565561_A_G_b38	ATAD3C	-3.59	0.000382	-0.086076	68	0.023978	yes	BREAST
chr1_1567715_G_A_b38	ATAD3C	-3.59	0.000382	-0.086076	68	0.023978	yes	BREAST
chr1_1567719_A_C_b38	ATAD3C	-3.59	0.000382	-0.086076	68	0.023978	yes	BREAST
chr1_1569875_C_T_b38	ATAD3C	-3.59	0.000382	-0.086076	68	0.023978	yes	BREAST
chr1_1456217_T_C_b38	ATAD3C	-3.567	0.000416	-0.098627	47	0.027651	yes	BREAST
chr1_1553692_A_G_b38	ATAD3C	-3.507	0.000517	-0.083816	65	0.023898	yes	BREAST
chr1_1555247_T_A_b38	ATAD3C	-3.507	0.000517	-0.083816	65	0.023898	yes	BREAST
chr1_1366883_G_GGTGTGAATTGGTGTAGTGTGAATGAGT_b38	ATAD3C	-3.5	0.00053	-0.140116	5	0.040031	yes	BREAST
chr1_1575864_G_A_b38	ATAD3C	-3.493	0.000543	-0.087464	55	0.025037	yes	BREAST
chr1_1574655_GGC_G_b38	ATAD3C	-3.474	0.000582	-0.087245	52	0.025114	yes	BREAST
chr1_1554852_T_C_b38	ATAD3C	-3.467	0.000598	-0.082488	65	0.023794	yes	BREAST
chr1_1549590_C_G_b38	ATAD3C	-3.439	0.00066	-0.082368	64	0.02395	yes	BREAST
chr1_1557495_CAT_C_b38	ATAD3C	-3.405	0.000743	-0.083177	63	0.024424	yes	BREAST
chr1_1569661_T_C_b38	ATAD3C	-3.381	0.000809	-0.08077	60	0.023887	yes	BREAST
chr1_1192776_CAGTGTAGACACTCCAGTTGGTATG_C_b38	ATAD3C	3.377	0.000822	0.144319	3	0.042736	yes	BREAST
chr1_1554694_A_G_b38	ATAD3C	-3.375	0.000828	-0.0808	64	0.023941	yes	BREAST
chr1_1388565_GTC_G_b38	ATAD3C	3.374	0.00083	0.088944	21	0.026359	yes	BREAST
chr1_1554781_A_G_b38	ATAD3C	-3.367	0.000852	-0.080622	65	0.023947	yes	BREAST
chr1_904947_G_A_b38	ATAD3C	-3.264	0.00122	-0.093362	11	0.028606	yes	BREAST
chr1_1449009_A_T_b38	ATAD3C	-3.207	0.00147	-0.095103	33	0.029654	yes	BREAST
chr1_911848_C_T_b38	ATAD3C	-3.202	0.0015	-0.088072	16	0.027505	yes	BREAST
chr1_1571794_A_AT_b38	ATAD3C	-3.159	0.00173	-0.078147	54	0.02474	yes	BREAST
chr1_1258206_AT_A_b38	ATAD3C	-3.158	0.00173	-0.090227	45	0.028567	yes	BREAST
chr1_1288341_C_T_b38	ATAD3C	-3.153	0.00176	-0.11942	12	0.037871	yes	BREAST
chr1_1216593_G_C_b38	ATAD3C	-3.14	0.00184	-0.091925	11	0.029272	yes	BREAST
chr1_1560765_T_C_b38	ATAD3C	-3.101	0.0021	-0.076103	54	0.024542	yes	BREAST
chr1_1562261_TTTTC_T_b38	ATAD3C	-3.101	0.0021	-0.076103	54	0.024542	yes	BREAST
chr1_906633_T_G_b38	ATAD3C	-3.101	0.0021	-0.085166	11	0.027465	yes	BREAST
chr1_1575935_T_C_b38	ATAD3C	-3.076	0.00228	-0.074036	62	0.024069	yes	BREAST
chr1_1598099_C_G_b38	ATAD3C	-3.058	0.00241	-0.206919	4	0.067665	yes	BREAST
chr1_1571986_G_A_b38	ATAD3C	-3.055	0.00244	-0.071299	52	0.023342	yes	BREAST
chr1_1537493_T_A_b38	ATAD3C	-3.039	0.00257	-0.073637	55	0.024233	yes	BREAST
chr1_1692900_G_GTT_b38	ATAD3C	-3.028	0.00266	-0.099888	10	0.032988	yes	BREAST
chr1_923421_A_G_b38	ATAD3C	3.013	0.00279	0.07983	40	0.026497	yes	BREAST
chr1_923311_TG_T_b38	ATAD3C	3.011	0.00281	0.079942	40	0.026551	yes	BREAST
chr1_1710588_C_T_b38	ATAD3C	-3.001	0.0029	-0.114258	11	0.038072	yes	BREAST
chr1_1539491_G_C_b38	ATAD3C	-2.971	0.00319	-0.071899	62	0.024197	yes	BREAST
chr1_1568548_G_A_b38	ATAD3C	-2.963	0.00327	-0.071203	59	0.024027	yes	BREAST
chr1_897018_T_C_b38	ATAD3C	2.951	0.0034	0.078234	18	0.02651	yes	BREAST
chr1_1081587_G_A_b38	ATAD3C	2.949	0.00342	0.219056	3	0.074275	yes	BREAST
chr1_1976855_C_CTT_b38	ATAD3C	-2.906	0.00392	-0.077374	19	0.02663	yes	BREAST
chr1_1559703_G_C_b38	ATAD3C	-2.895	0.00405	-0.06962	59	0.024052	yes	BREAST
chr1_1570587_C_T_b38	ATAD3C	-2.895	0.00405	-0.06962	59	0.024052	yes	BREAST
chr1_915400_C_T_b38	ATAD3C	2.883	0.0042	0.065757	64	0.022809	yes	BREAST
chr1_1934821_C_CGTTGTAGGTACGTGTGTACGTGGGTGTTAGGTTGTAGGTACACACGTGTATATGTGGGTGTTAG_b38	ATAD3C	2.841	0.00478	0.066696	41	0.023477	yes	BREAST
chr1_915824_G_C_b38	ATAD3C	-2.84	0.0048	-0.076722	20	0.027019	yes	BREAST
chr1_1188054_T_A_b38	ATAD3C	-2.825	0.00502	-0.079419	15	0.02811	yes	BREAST
chr1_2342840_A_ATATTTTATTTTATTT_b38	ATAD3C	2.815	0.00518	0.128447	9	0.04563	yes	BREAST
chr1_903007_T_C_b38	ATAD3C	-2.804	0.00535	-0.075817	12	0.02704	yes	BREAST
chr1_1252613_C_G_b38	ATAD3C	-2.804	0.00535	-0.101439	6	0.03618	yes	BREAST
chr1_1921849_G_T_b38	ATAD3C	-2.8	0.00542	-0.069392	33	0.024784	yes	BREAST
chr1_902949_G_GC_b38	ATAD3C	-2.8	0.00542	-0.077047	12	0.02752	yes	BREAST
chr1_1573429_CAAAAAAAAAAAAAAAAAA_C_b38	ATAD3C	-2.789	0.00561	-0.068459	59	0.02455	yes	BREAST
chr1_913274_TG_T_b38	ATAD3C	-2.786	0.00565	-0.08234	10	0.029555	yes	BREAST
chr1_1378484_AT_A_b38	ATAD3C	2.726	0.00677	0.071638	76	0.026284	yes	BREAST
chr1_898818_T_C_b38	ATAD3C	-2.719	0.0069	-0.075866	12	0.027901	yes	BREAST
chr1_917378_G_C_b38	ATAD3C	-2.717	0.00693	-0.080414	10	0.029593	yes	BREAST
chr1_917859_A_G_b38	ATAD3C	-2.711	0.00707	-0.079738	11	0.029418	yes	BREAST
chr1_914838_T_A_b38	ATAD3C	2.699	0.00733	0.063054	91	0.023365	yes	BREAST
chr1_927486_C_T_b38	ATAD3C	2.694	0.00743	0.072706	45	0.02699	yes	BREAST
chr1_1533841_T_C_b38	ATAD3C	-2.684	0.00764	-0.076934	33	0.028661	yes	BREAST
chr1_919598_A_C_b38	ATAD3C	2.682	0.00768	0.060642	68	0.022607	yes	BREAST
chr1_851430_G_A_b38	ATAD3C	-2.676	0.00784	-0.141446	7	0.052865	yes	BREAST
chr1_914991_G_T_b38	ATAD3C	2.663	0.00814	0.060709	60	0.022801	yes	BREAST
chr1_925036_G_A_b38	ATAD3C	2.659	0.00822	0.071345	43	0.026831	yes	BREAST
chr1_2424477_C_T_b38	ATAD3C	-2.649	0.00847	-0.057341	80	0.021648	yes	BREAST
chr1_1551454_C_A_b38	ATAD3C	-2.637	0.00877	-0.061723	103	0.023406	yes	BREAST
chr1_1981144_T_G_b38	ATAD3C	-2.627	0.00903	-0.067355	24	0.025642	yes	BREAST
chr1_1497605_G_C_b38	ATAD3C	-2.615	0.00935	-0.063371	55	0.024237	yes	BREAST
chr1_901149_C_G_b38	ATAD3C	-2.609	0.00949	-0.072377	12	0.027738	yes	BREAST
chr1_901544_G_A_b38	ATAD3C	-2.609	0.00949	-0.072377	12	0.027738	yes	BREAST
chr1_1220305_T_C_b38	ATAD3C	2.6	0.00975	0.200885	3	0.077267	yes	BREAST
chr1_917495_C_T_b38	ATAD3C	2.596	0.00986	0.059351	66	0.022861	yes	BREAST
chr1_918574_C_A_b38	ATAD3C	2.596	0.00986	0.059351	66	0.022861	yes	BREAST
chr1_1427080_C_T_b38	ATAD3C	-2.594	0.00992	-0.110174	5	0.042472	yes	BREAST
chr1_1440430_C_G_b38	ATAD3C	-7.165	5.25e-12	-0.179504	35	0.025054	no	BREAST
chr1_1439454_A_G_b38	ATAD3C	-6.625	1.44e-10	-0.165581	48	0.024994	no	BREAST
chr1_1445187_T_G_b38	ATAD3C	-6.306	9.36e-10	-0.163209	52	0.025883	no	BREAST
chr1_1400410_A_G_b38	ATAD3C	-6.04	4.21e-09	-0.166574	43	0.027579	no	BREAST
chr1_1384749_C_G_b38	ATAD3C	5.981	5.85e-09	0.166033	43	0.02776	no	BREAST
chr1_1387763_CCT_C_b38	ATAD3C	5.981	5.85e-09	0.166033	43	0.02776	no	BREAST
chr1_1388944_G_A_b38	ATAD3C	5.981	5.85e-09	0.166033	43	0.02776	no	BREAST
chr1_1378204_G_C_b38	ATAD3C	5.955	6.74e-09	0.164132	42	0.027561	no	BREAST
chr1_1403593_A_G_b38	ATAD3C	-5.928	7.85e-09	-0.194915	10	0.032883	no	BREAST
chr1_1432355_G_A_b38	ATAD3C	-5.911	8.57e-09	-0.160462	20	0.027144	no	BREAST
chr1_1442793_G_A_b38	ATAD3C	-5.886	9.86e-09	-0.164718	13	0.027985	no	BREAST
chr1_1373007_G_A_b38	ATAD3C	-5.871	1.07e-08	-0.193186	9	0.032902	no	BREAST
chr1_1363986_C_T_b38	ATAD3C	5.871	1.07e-08	0.173502	15	0.029554	no	BREAST
chr1_1376162_G_C_b38	ATAD3C	5.87	1.08e-08	0.162043	43	0.027605	no	BREAST
chr1_1377431_C_T_b38	ATAD3C	5.87	1.08e-08	0.162043	43	0.027605	no	BREAST
chr1_1383743_T_C_b38	ATAD3C	-5.853	1.18e-08	-0.193858	10	0.033122	no	BREAST
chr1_1366529_TTAG_T_b38	ATAD3C	5.848	1.21e-08	0.171759	15	0.029372	no	BREAST
chr1_1373006_G_A_b38	ATAD3C	-5.839	1.27e-08	-0.194731	7	0.03335	no	BREAST
chr1_1365566_G_A_b38	ATAD3C	5.816	1.45e-08	0.1711	15	0.029421	no	BREAST
chr1_1363898_C_T_b38	ATAD3C	5.803	1.55e-08	0.171386	15	0.029535	no	BREAST
chr1_1368991_C_T_b38	ATAD3C	-5.8	1.57e-08	-0.185536	9	0.031986	no	BREAST
chr1_1367292_A_AGT_b38	ATAD3C	5.8	1.57e-08	0.170701	15	0.029432	no	BREAST
chr1_1370532_C_T_b38	ATAD3C	-5.799	1.58e-08	-0.183378	11	0.031624	no	BREAST
chr1_1372909_G_A_b38	ATAD3C	-5.794	1.62e-08	-0.188459	10	0.032524	no	BREAST
chr1_1400756_GGA_G_b38	ATAD3C	-5.771	1.84e-08	-0.191392	10	0.033167	no	BREAST
chr1_1401954_G_T_b38	ATAD3C	-5.771	1.84e-08	-0.191392	10	0.033167	no	BREAST
chr1_1366427_AGTGTGATTGAATGAGT_A_b38	ATAD3C	5.756	1.99e-08	0.160168	39	0.027827	no	BREAST
chr1_1375642_C_T_b38	ATAD3C	-5.718	2.44e-08	-0.182186	12	0.031862	no	BREAST
chr1_1364357_A_C_b38	ATAD3C	-5.713	2.51e-08	-0.184756	9	0.032338	no	BREAST
chr1_1368514_C_G_b38	ATAD3C	-5.713	2.51e-08	-0.184756	9	0.032338	no	BREAST
chr1_1398218_C_A_b38	ATAD3C	-5.709	2.56e-08	-0.190631	10	0.033391	no	BREAST
chr1_1370430_T_C_b38	ATAD3C	-5.699	2.7e-08	-0.18479	10	0.032424	no	BREAST
chr1_1370584_G_C_b38	ATAD3C	-5.699	2.7e-08	-0.18479	10	0.032424	no	BREAST
chr1_1382893_G_A_b38	ATAD3C	-5.647	3.56e-08	-0.186759	10	0.03307	no	BREAST
chr1_1364253_C_G_b38	ATAD3C	-5.632	3.87e-08	-0.187923	8	0.033369	no	BREAST
chr1_1379091_T_G_b38	ATAD3C	5.618	4.15e-08	0.169867	16	0.030235	no	BREAST
chr1_1369407_G_A_b38	ATAD3C	-5.618	4.15e-08	-0.181096	8	0.032234	no	BREAST
chr1_1379093_TG_T_b38	ATAD3C	-5.606	4.43e-08	-0.197738	7	0.035275	no	BREAST
chr1_1369282_G_A_b38	ATAD3C	-5.605	4.45e-08	-0.180987	9	0.032291	no	BREAST
chr1_1369320_GT_G_b38	ATAD3C	-5.605	4.45e-08	-0.180987	9	0.032291	no	BREAST
chr1_1369476_CTT_C_b38	ATAD3C	-5.605	4.45e-08	-0.180987	9	0.032291	no	BREAST
chr1_1369556_C_G_b38	ATAD3C	-5.605	4.45e-08	-0.180987	9	0.032291	no	BREAST
chr1_1369627_T_C_b38	ATAD3C	-5.605	4.45e-08	-0.180987	9	0.032291	no	BREAST
chr1_1369686_T_C_b38	ATAD3C	-5.605	4.45e-08	-0.180987	9	0.032291	no	BREAST
chr1_1369716_G_C_b38	ATAD3C	-5.605	4.45e-08	-0.180987	9	0.032291	no	BREAST
chr1_1369741_C_T_b38	ATAD3C	-5.605	4.45e-08	-0.180987	9	0.032291	no	BREAST
chr1_1369821_C_T_b38	ATAD3C	-5.605	4.45e-08	-0.180987	9	0.032291	no	BREAST
chr1_1370181_C_T_b38	ATAD3C	-5.605	4.45e-08	-0.180987	9	0.032291	no	BREAST
chr1_1370317_G_C_b38	ATAD3C	-5.605	4.45e-08	-0.180987	9	0.032291	no	BREAST
chr1_1370320_A_G_b38	ATAD3C	-5.605	4.45e-08	-0.180987	9	0.032291	no	BREAST
chr1_1445240_A_G_b38	ATAD3C	-5.603	4.49e-08	-0.146716	55	0.026183	no	BREAST
chr1_1365036_T_TAA_b38	ATAD3C	-5.594	4.7e-08	-0.193714	5	0.034626	no	BREAST
chr1_1369009_T_C_b38	ATAD3C	-5.594	4.71e-08	-0.181867	9	0.032511	no	BREAST
chr1_1369012_C_CG_b38	ATAD3C	-5.594	4.71e-08	-0.181867	9	0.032511	no	BREAST
chr1_1374505_A_G_b38	ATAD3C	-5.586	4.91e-08	-0.177853	12	0.031839	no	BREAST
chr1_1366321_TGTGTGTAAATGG_T_b38	ATAD3C	-5.583	5e-08	-0.182206	9	0.032638	no	BREAST
chr1_1363880_A_G_b38	ATAD3C	-5.574	5.23e-08	-0.180889	9	0.032451	no	BREAST
chr1_1366681_T_TGA_b38	ATAD3C	-5.569	5.37e-08	-0.182794	9	0.032823	no	BREAST
chr1_1364566_T_C_b38	ATAD3C	-5.567	5.43e-08	-0.184437	8	0.03313	no	BREAST
chr1_1364282_T_G_b38	ATAD3C	-5.564	5.5e-08	-0.181583	9	0.032633	no	BREAST
chr1_1364694_T_C_b38	ATAD3C	-5.564	5.5e-08	-0.181583	9	0.032633	no	BREAST
chr1_1364721_C_T_b38	ATAD3C	-5.564	5.5e-08	-0.181583	9	0.032633	no	BREAST
chr1_1365160_A_G_b38	ATAD3C	-5.564	5.5e-08	-0.181583	9	0.032633	no	BREAST
chr1_1365198_C_T_b38	ATAD3C	-5.564	5.5e-08	-0.181583	9	0.032633	no	BREAST
chr1_1366008_A_G_b38	ATAD3C	-5.564	5.5e-08	-0.181583	9	0.032633	no	BREAST
chr1_1366062_T_C_b38	ATAD3C	-5.564	5.5e-08	-0.181583	9	0.032633	no	BREAST
chr1_1366145_TGTGAA_T_b38	ATAD3C	-5.564	5.5e-08	-0.181583	9	0.032633	no	BREAST
chr1_1366187_A_AGT_b38	ATAD3C	-5.564	5.5e-08	-0.181583	9	0.032633	no	BREAST
chr1_1366453_G_T_b38	ATAD3C	-5.564	5.5e-08	-0.181583	9	0.032633	no	BREAST
chr1_1366726_T_G_b38	ATAD3C	-5.564	5.5e-08	-0.181583	9	0.032633	no	BREAST
chr1_1367258_T_A_b38	ATAD3C	-5.564	5.5e-08	-0.181583	9	0.032633	no	BREAST
chr1_1367297_GAA_G_b38	ATAD3C	-5.564	5.5e-08	-0.181583	9	0.032633	no	BREAST
chr1_1367329_A_AGT_b38	ATAD3C	-5.564	5.5e-08	-0.181583	9	0.032633	no	BREAST
chr1_1367373_T_TGTG_b38	ATAD3C	-5.564	5.5e-08	-0.181583	9	0.032633	no	BREAST
chr1_1367388_T_TTGG_b38	ATAD3C	-5.564	5.5e-08	-0.181583	9	0.032633	no	BREAST
chr1_1367511_ATGAG_A_b38	ATAD3C	-5.564	5.5e-08	-0.181583	9	0.032633	no	BREAST
chr1_1367593_G_A_b38	ATAD3C	-5.564	5.5e-08	-0.181583	9	0.032633	no	BREAST
chr1_1367602_GT_G_b38	ATAD3C	-5.564	5.5e-08	-0.181583	9	0.032633	no	BREAST
chr1_1367605_GAGTGAGTGTA_G_b38	ATAD3C	-5.564	5.5e-08	-0.181583	9	0.032633	no	BREAST
chr1_1367670_GGTGA_G_b38	ATAD3C	-5.564	5.5e-08	-0.181583	9	0.032633	no	BREAST
chr1_1367722_TTTTA_T_b38	ATAD3C	-5.564	5.5e-08	-0.181583	9	0.032633	no	BREAST
chr1_1367874_A_T_b38	ATAD3C	-5.564	5.5e-08	-0.181583	9	0.032633	no	BREAST
chr1_1367951_C_T_b38	ATAD3C	-5.564	5.5e-08	-0.181583	9	0.032633	no	BREAST
chr1_1367965_A_G_b38	ATAD3C	-5.564	5.5e-08	-0.181583	9	0.032633	no	BREAST
chr1_1367970_T_G_b38	ATAD3C	-5.564	5.5e-08	-0.181583	9	0.032633	no	BREAST
chr1_1367994_C_A_b38	ATAD3C	-5.564	5.5e-08	-0.181583	9	0.032633	no	BREAST
chr1_1368297_C_T_b38	ATAD3C	-5.564	5.5e-08	-0.181583	9	0.032633	no	BREAST
chr1_1367280_T_A_b38	ATAD3C	-5.562	5.57e-08	-0.181715	9	0.03267	no	BREAST
chr1_1366511_GGTGA_G_b38	ATAD3C	-5.546	6.07e-08	-0.182346	9	0.03288	no	BREAST
chr1_1363688_C_T_b38	ATAD3C	-5.545	6.11e-08	-0.181581	9	0.03275	no	BREAST
chr1_1364099_CCA_C_b38	ATAD3C	-5.545	6.11e-08	-0.181581	9	0.03275	no	BREAST
chr1_1364102_TGTTG_T_b38	ATAD3C	-5.545	6.11e-08	-0.181581	9	0.03275	no	BREAST
chr1_1368763_G_A_b38	ATAD3C	-5.545	6.11e-08	-0.181581	9	0.03275	no	BREAST
chr1_1411323_A_C_b38	ATAD3C	-5.541	6.22e-08	-0.157352	54	0.028397	no	BREAST
chr1_1407565_C_A_b38	ATAD3C	-5.534	6.44e-08	-0.19183	9	0.034662	no	BREAST
chr1_1438102_G_C_b38	ATAD3C	-5.526	6.74e-08	-0.149437	21	0.027044	no	BREAST
chr1_1366292_G_T_b38	ATAD3C	-5.525	6.76e-08	-0.181218	9	0.0328	no	BREAST
chr1_1367300_T_TGA_b38	ATAD3C	-5.508	7.39e-08	-0.182302	8	0.033098	no	BREAST
chr1_1367919_C_T_b38	ATAD3C	-5.46	9.47e-08	-0.177979	9	0.032597	no	BREAST
chr1_1402457_A_G_b38	ATAD3C	-5.373	1.48e-07	-0.153309	53	0.028534	no	BREAST
chr1_1367268_TGA_T_b38	ATAD3C	-5.369	1.51e-07	-0.174772	9	0.032552	no	BREAST
chr1_1436388_CA_C_b38	ATAD3C	-5.365	1.54e-07	-0.136838	37	0.025508	no	BREAST
chr1_1367462_T_C_b38	ATAD3C	-5.362	1.57e-07	-0.177815	8	0.033163	no	BREAST
chr1_1363456_CAG_C_b38	ATAD3C	5.351	1.65e-07	0.140117	26	0.026183	no	BREAST
chr1_1387698_A_G_b38	ATAD3C	5.306	2.07e-07	0.15232	53	0.028705	no	BREAST
chr1_1389827_C_T_b38	ATAD3C	5.306	2.07e-07	0.15232	53	0.028705	no	BREAST
chr1_1395346_A_G_b38	ATAD3C	-5.216	3.27e-07	-0.149827	52	0.028727	no	BREAST
chr1_1368177_G_C_b38	ATAD3C	-5.174	4.02e-07	-0.170214	11	0.032899	no	BREAST
chr1_1434687_C_G_b38	ATAD3C	-5.156	4.39e-07	-0.149553	13	0.029006	no	BREAST
chr1_1394423_A_G_b38	ATAD3C	-5.153	4.46e-07	-0.148547	53	0.028827	no	BREAST
chr1_1426253_G_A_b38	ATAD3C	-5.131	4.96e-07	-0.153843	11	0.029982	no	BREAST
chr1_1448915_G_A_b38	ATAD3C	-5.101	5.77e-07	-0.133183	38	0.026112	no	BREAST
chr1_1431656_G_A_b38	ATAD3C	-5.064	6.88e-07	-0.153954	11	0.0304	no	BREAST
chr1_1379083_AT_A_b38	ATAD3C	5.058	7.11e-07	0.133367	26	0.026369	no	BREAST
chr1_1366561_AGT_A_b38	ATAD3C	5.005	9.17e-07	0.142686	52	0.028509	no	BREAST
chr1_1369803_C_CT_b38	ATAD3C	-4.994	9.69e-07	-0.154895	8	0.031019	no	BREAST
chr1_1330125_G_A_b38	ATAD3C	4.875	1.71e-06	0.139308	53	0.028576	no	BREAST
chr1_1431014_G_A_b38	ATAD3C	-4.865	1.79e-06	-0.124244	28	0.02554	no	BREAST
chr1_1358384_G_C_b38	ATAD3C	4.851	1.91e-06	0.138873	52	0.028626	no	BREAST
chr1_1312114_T_C_b38	ATAD3C	4.847	1.95e-06	0.136239	53	0.02811	no	BREAST
chr1_1366776_G_GAATT_b38	ATAD3C	-4.704	3.77e-06	-0.15956	9	0.033918	no	BREAST
chr1_1370113_A_G_b38	ATAD3C	4.684	4.14e-06	0.122364	40	0.026123	no	BREAST
chr1_1431813_G_T_b38	ATAD3C	-4.672	4.37e-06	-0.131365	16	0.028117	no	BREAST
chr1_1431026_CCACCCCCT_C_b38	ATAD3C	-4.646	4.93e-06	-0.12753	22	0.02745	no	BREAST
chr1_1309988_G_A_b38	ATAD3C	4.635	5.19e-06	0.129337	55	0.027907	no	BREAST
chr1_1303112_G_A_b38	ATAD3C	-4.631	5.28e-06	-0.159675	5	0.034483	no	BREAST
chr1_1366828_A_G_b38	ATAD3C	-4.615	5.66e-06	-0.177259	5	0.038409	no	BREAST
chr1_1313807_G_A_b38	ATAD3C	4.6	6.08e-06	0.128033	55	0.027836	no	BREAST
chr1_1308516_C_T_b38	ATAD3C	4.594	6.23e-06	0.128624	56	0.027999	no	BREAST
chr1_1304555_A_C_b38	ATAD3C	-4.592	6.28e-06	-0.158745	5	0.034568	no	BREAST
chr1_1447108_A_ATT_b38	ATAD3C	-4.576	6.75e-06	-0.122432	22	0.026755	no	BREAST
chr1_1366830_G_A_b38	ATAD3C	-4.546	7.72e-06	-0.175315	5	0.038564	no	BREAST
chr1_1394041_G_A_b38	ATAD3C	-4.499	9.51e-06	-0.160577	5	0.03569	no	BREAST
chr1_1447650_A_G_b38	ATAD3C	-4.489	9.97e-06	-0.263918	3	0.058798	no	BREAST
chr1_1325753_G_T_b38	ATAD3C	-4.457	1.15e-05	-0.159246	4	0.035729	no	BREAST
chr1_1366835_G_GGTGA_b38	ATAD3C	-4.433	1.27e-05	-0.170629	5	0.038488	no	BREAST
chr1_1361679_G_A_b38	ATAD3C	4.325	2.03e-05	0.131041	30	0.030301	no	BREAST
chr1_1337898_A_G_b38	ATAD3C	4.297	2.29e-05	0.116286	19	0.027064	no	BREAST
chr1_1574445_A_G_b38	ATAD3C	-4.226	3.1e-05	-0.105899	61	0.02506	no	BREAST
chr1_1577491_A_AC_b38	ATAD3C	-4.03	6.94e-05	-0.09939	63	0.02466	no	BREAST
chr1_1573654_T_C_b38	ATAD3C	-4.009	7.57e-05	-0.099799	61	0.024895	no	BREAST
chr1_1367122_G_A_b38	ATAD3C	-3.985	8.34e-05	-0.283103	3	0.071042	no	BREAST
chr1_1456182_G_A_b38	ATAD3C	-3.947	9.72e-05	-0.102897	30	0.026072	no	BREAST
chr1_1457071_C_T_b38	ATAD3C	-3.916	0.00011	-0.107332	26	0.027407	no	BREAST
chr1_1457033_A_C_b38	ATAD3C	-3.916	0.00011	-0.104798	27	0.02676	no	BREAST
chr1_1533883_G_T_b38	ATAD3C	-3.908	0.000113	-0.152733	8	0.039077	no	BREAST
chr1_1454848_T_C_b38	ATAD3C	-3.904	0.000115	-0.104571	29	0.026787	no	BREAST
chr1_1449831_A_G_b38	ATAD3C	-3.895	0.000119	-0.114645	47	0.029432	no	BREAST
chr1_1456051_C_T_b38	ATAD3C	-3.876	0.000128	-0.10506	26	0.027105	no	BREAST
chr1_1366951_A_AGT_b38	ATAD3C	3.852	0.000141	0.134928	8	0.035031	no	BREAST
chr1_1361685_C_T_b38	ATAD3C	-3.85	0.000142	-0.123436	20	0.032065	no	BREAST
chr1_1453552_G_A_b38	ATAD3C	-3.845	0.000145	-0.103862	27	0.027013	no	BREAST
chr1_1455134_T_G_b38	ATAD3C	-3.845	0.000145	-0.103862	27	0.027013	no	BREAST
chr1_1455337_A_G_b38	ATAD3C	-3.845	0.000145	-0.103862	27	0.027013	no	BREAST
chr1_1455495_C_T_b38	ATAD3C	-3.845	0.000145	-0.103862	27	0.027013	no	BREAST
chr1_1366941_T_TGTGTGCA_b38	ATAD3C	3.843	0.000146	0.133404	8	0.034713	no	BREAST
chr1_1565105_CAAGGCAGGCGGATCATG_C_b38	ATAD3C	-3.832	0.000152	-0.091941	69	0.023992	no	BREAST
chr1_1455924_T_C_b38	ATAD3C	-3.832	0.000153	-0.103372	27	0.026978	no	BREAST
chr1_1452797_CAA_C_b38	ATAD3C	-3.814	0.000164	-0.110471	18	0.028966	no	BREAST
chr1_1456154_G_A_b38	ATAD3C	-3.813	0.000164	-0.103043	27	0.027025	no	BREAST
chr1_1566086_G_A_b38	ATAD3C	-3.792	0.000178	-0.091569	68	0.024146	no	BREAST
chr1_1363438_C_CTT_b38	ATAD3C	3.777	0.000189	0.095958	37	0.025408	no	BREAST
chr1_1456079_T_C_b38	ATAD3C	-3.737	0.00022	-0.101437	27	0.027144	no	BREAST
chr1_1217733_G_A_b38	ATAD3C	-3.727	0.000228	-0.128519	6	0.034479	no	BREAST
chr1_1452825_AAAG_A_b38	ATAD3C	-3.727	0.000228	-0.100255	27	0.026898	no	BREAST
chr1_1471992_T_C_b38	ATAD3C	-3.724	0.000231	-0.09867	58	0.026496	no	BREAST
chr1_1569180_T_A_b38	ATAD3C	-3.724	0.000231	-0.090214	64	0.024226	no	BREAST
chr1_1451787_A_C_b38	ATAD3C	-3.685	0.000268	-0.100588	46	0.027299	no	BREAST
chr1_1538787_A_G_b38	ATAD3C	-3.641	0.000316	-0.088627	65	0.02434	no	BREAST
chr1_1455617_T_G_b38	ATAD3C	-3.591	0.00038	-0.10091	52	0.028097	no	BREAST
chr1_1570294_CA_C_b38	ATAD3C	-3.587	0.000386	-0.088735	64	0.024736	no	BREAST
chr1_631998_T_C_b38	ATAD3C	3.582	0.000393	0.234877	3	0.065575	no	BREAST
chr1_1572532_A_C_b38	ATAD3C	-3.579	0.000398	-0.086071	68	0.024051	no	BREAST
chr1_1252487_C_A_b38	ATAD3C	-3.571	0.00041	-0.141564	3	0.039645	no	BREAST
chr1_1456891_T_C_b38	ATAD3C	-3.546	0.000448	-0.088718	38	0.025016	no	BREAST
chr1_1292284_TTGAG_T_b38	ATAD3C	-3.525	0.000484	-0.107419	25	0.03047	no	BREAST
chr1_915810_G_A_b38	ATAD3C	-3.522	0.00049	-0.095462	17	0.027108	no	BREAST
chr1_1248864_T_C_b38	ATAD3C	-3.508	0.000515	-0.115253	9	0.032855	no	BREAST
chr1_1452346_A_G_b38	ATAD3C	-3.479	0.000573	-0.101722	12	0.029242	no	BREAST
chr1_1573079_A_G_b38	ATAD3C	-3.455	0.000624	-0.083297	67	0.024112	no	BREAST
chr1_1454770_T_C_b38	ATAD3C	-3.45	0.000634	-0.097249	53	0.028186	no	BREAST
chr1_1453961_C_T_b38	ATAD3C	-3.433	0.000674	-0.104125	10	0.030332	no	BREAST
chr1_1454315_C_T_b38	ATAD3C	-3.4	0.000758	-0.093459	49	0.027489	no	BREAST
chr1_913076_A_G_b38	ATAD3C	-3.38	0.000814	-0.092363	17	0.027328	no	BREAST
chr1_788757_T_TAATGGAATGG_b38	ATAD3C	3.354	0.000889	0.080419	30	0.023974	no	BREAST
chr1_1452384_G_A_b38	ATAD3C	-3.353	0.000894	-0.099399	11	0.029644	no	BREAST
chr1_1452540_G_A_b38	ATAD3C	-3.348	0.00091	-0.089354	25	0.02669	no	BREAST
chr1_1367028_A_G_b38	ATAD3C	3.343	0.000924	0.110471	11	0.033041	no	BREAST
chr1_1453870_A_C_b38	ATAD3C	-3.325	0.000986	-0.100284	10	0.030163	no	BREAST
chr1_1452511_A_G_b38	ATAD3C	-3.32	0.001	-0.092579	51	0.027881	no	BREAST
chr1_1452888_C_A_b38	ATAD3C	-3.32	0.001	-0.092579	51	0.027881	no	BREAST
chr1_1452909_A_C_b38	ATAD3C	-3.32	0.001	-0.092579	51	0.027881	no	BREAST
chr1_1454092_A_G_b38	ATAD3C	-3.32	0.001	-0.092579	51	0.027881	no	BREAST
chr1_1453703_A_G_b38	ATAD3C	-3.272	0.00118	-0.091428	51	0.027942	no	BREAST
chr1_914682_A_T_b38	ATAD3C	-3.263	0.00122	-0.088754	17	0.027197	no	BREAST
chr1_913065_G_A_b38	ATAD3C	-3.252	0.00127	-0.088552	17	0.02723	no	BREAST
chr1_1573776_A_G_b38	ATAD3C	-3.249	0.00128	-0.081935	24	0.025218	no	BREAST
chr1_1553791_CA_C_b38	ATAD3C	-3.235	0.00134	-0.080059	27	0.02475	no	BREAST
chr1_1580890_C_T_b38	ATAD3C	-3.233	0.00135	-0.08122	24	0.02512	no	BREAST
chr1_1528513_G_C_b38	ATAD3C	-3.222	0.0014	-0.169973	3	0.052755	no	BREAST
chr1_1461687_CTGGAGGGAGAGGCTCCTCATGAGACCCCCATGTAGGGAT_C_b38	ATAD3C	-3.219	0.00141	-0.198228	3	0.061574	no	BREAST
chr1_912111_G_A_b38	ATAD3C	-3.207	0.00147	-0.087461	17	0.02727	no	BREAST
chr1_1259424_T_C_b38	ATAD3C	-3.191	0.00156	-0.095539	51	0.029939	no	BREAST
chr1_1713611_C_T_b38	ATAD3C	-3.177	0.00163	-0.094416	43	0.029719	no	BREAST
chr1_1450636_A_G_b38	ATAD3C	-3.157	0.00174	-0.09437	11	0.029893	no	BREAST
chr1_922660_C_A_b38	ATAD3C	-3.151	0.00178	-0.09379	8	0.029767	no	BREAST
chr1_1480224_A_G_b38	ATAD3C	-3.132	0.00189	-0.155072	4	0.049511	no	BREAST
chr1_1243545_G_A_b38	ATAD3C	-3.122	0.00196	-0.106685	5	0.03417	no	BREAST
chr1_1243929_G_A_b38	ATAD3C	-3.122	0.00196	-0.106685	5	0.03417	no	BREAST
chr1_922671_C_T_b38	ATAD3C	-3.115	0.002	-0.092498	8	0.029697	no	BREAST
chr1_1969235_A_G_b38	ATAD3C	-3.084	0.00222	-0.082684	18	0.026809	no	BREAST
chr1_1252845_G_T_b38	ATAD3C	-3.084	0.00222	-0.129924	3	0.042134	no	BREAST
chr1_1574032_AAAG_A_b38	ATAD3C	-3.076	0.00228	-0.085963	33	0.027946	no	BREAST
chr1_1215852_T_C_b38	ATAD3C	-3.073	0.0023	-0.089258	12	0.029046	no	BREAST
chr1_1549967_C_G_b38	ATAD3C	-3.051	0.00247	-0.072988	36	0.023926	no	BREAST
chr1_1235602_C_A_b38	ATAD3C	-3.027	0.00266	-0.101111	6	0.033398	no	BREAST
chr1_1375678_TA_T_b38	ATAD3C	3.017	0.00276	0.091422	24	0.030307	no	BREAST
chr1_1969249_A_AGCCCT_b38	ATAD3C	-3.004	0.00287	-0.08006	18	0.026652	no	BREAST
chr1_1566854_CA_C_b38	ATAD3C	-2.973	0.00317	-0.078602	41	0.026438	no	BREAST
chr1_633846_C_A_b38	ATAD3C	2.969	0.00321	0.154042	12	0.051886	no	BREAST
chr1_1722599_G_A_b38	ATAD3C	-2.956	0.00335	-0.079471	48	0.026887	no	BREAST
chr1_1579717_T_A_b38	ATAD3C	-2.946	0.00345	-0.073333	26	0.024894	no	BREAST
chr1_1453643_A_ATT_b38	ATAD3C	-2.939	0.00353	-0.083082	34	0.02827	no	BREAST
chr1_1969238_C_T_b38	ATAD3C	-2.928	0.00366	-0.078291	18	0.026742	no	BREAST
chr1_1565680_A_AG_b38	ATAD3C	-2.919	0.00375	-0.070142	64	0.024026	no	BREAST
chr1_629218_A_G_b38	ATAD3C	2.906	0.00391	0.173598	7	0.059733	no	BREAST
chr1_1375678_TAA_T_b38	ATAD3C	-2.9	0.00399	-0.090292	15	0.031139	no	BREAST
chr1_917887_G_T_b38	ATAD3C	-2.886	0.00417	-0.188381	4	0.065281	no	BREAST
chr1_1214831_G_A_b38	ATAD3C	-2.873	0.00433	-0.115151	3	0.040081	no	BREAST
chr1_1499586_C_CTTT_b38	ATAD3C	-2.868	0.00441	-0.175379	4	0.061159	no	BREAST
chr1_1969229_T_A_b38	ATAD3C	-2.861	0.00449	-0.076577	18	0.026762	no	BREAST
chr1_1235869_T_C_b38	ATAD3C	-2.86	0.00451	-0.109489	3	0.038287	no	BREAST
chr1_1257407_C_G_b38	ATAD3C	-2.859	0.00452	-0.151287	5	0.052915	no	BREAST
chr1_1537160_T_G_b38	ATAD3C	-2.856	0.00456	-0.068001	77	0.023806	no	BREAST
chr1_1252261_C_T_b38	ATAD3C	-2.85	0.00464	-0.108492	4	0.038061	no	BREAST
chr1_1135738_G_C_b38	ATAD3C	-2.841	0.00478	-0.063431	79	0.022326	no	BREAST
chr1_1721197_CA_C_b38	ATAD3C	-2.82	0.0051	-0.102766	13	0.036442	no	BREAST
chr1_1931743_CA_C_b38	ATAD3C	2.818	0.00513	0.075495	33	0.026789	no	BREAST
chr1_1241831_G_C_b38	ATAD3C	-2.811	0.00523	-0.098216	3	0.034936	no	BREAST
chr1_1290968_C_G_b38	ATAD3C	-2.804	0.00536	-0.08545	36	0.030479	no	BREAST
chr1_1719638_C_CTCGCTCTGTCACCCAGGCT_b38	ATAD3C	-2.793	0.00553	-0.09463	19	0.033883	no	BREAST
chr1_1451968_C_T_b38	ATAD3C	-2.792	0.00556	-0.076136	26	0.027274	no	BREAST
chr1_1217251_C_A_b38	ATAD3C	-2.789	0.00559	-0.099545	6	0.035688	no	BREAST
chr1_1288085_GC_G_b38	ATAD3C	-2.784	0.00568	-0.093916	8	0.033732	no	BREAST
chr1_1243650_G_A_b38	ATAD3C	-2.766	0.006	-0.093781	5	0.033909	no	BREAST
chr1_1174747_C_T_b38	ATAD3C	-2.76	0.00611	-0.104254	6	0.037776	no	BREAST
chr1_914483_G_GACTGCCCAGCTC_b38	ATAD3C	-2.754	0.00621	-0.076116	16	0.027634	no	BREAST
chr1_2391287_G_A_b38	ATAD3C	-2.723	0.00681	-0.102974	5	0.037813	no	BREAST
chr1_1219941_C_T_b38	ATAD3C	-2.718	0.00692	-0.109299	3	0.040214	no	BREAST
chr1_632160_A_G_b38	ATAD3C	2.711	0.00707	0.231429	3	0.08537	no	BREAST
chr1_1773676_TTGTG_T_b38	ATAD3C	-2.701	0.00726	-0.122	3	0.04516	no	BREAST
chr1_1737789_T_C_b38	ATAD3C	-2.68	0.00775	-0.092454	7	0.034504	no	BREAST
chr1_1514366_A_G_b38	ATAD3C	-2.669	0.008	-0.130629	5	0.04895	no	BREAST
chr1_932255_C_T_b38	ATAD3C	-2.663	0.00814	-0.079705	9	0.029933	no	BREAST
chr1_1226486_C_T_b38	ATAD3C	-2.654	0.00834	-0.087772	7	0.033067	no	BREAST
chr1_1174573_G_A_b38	ATAD3C	-2.646	0.00853	-0.104945	5	0.039655	no	BREAST
chr1_929839_G_A_b38	ATAD3C	-2.644	0.00859	-0.079083	9	0.029909	no	BREAST
chr1_1551523_T_C_b38	ATAD3C	-2.64	0.0087	-0.065023	27	0.024633	no	BREAST
chr1_2051107_G_A_b38	ATAD3C	2.634	0.00883	0.099101	5	0.037617	no	BREAST
chr1_1081152_A_AG_b38	ATAD3C	2.634	0.00884	0.191215	3	0.072589	no	BREAST
chr1_1177430_G_T_b38	ATAD3C	-2.624	0.0091	-0.099364	6	0.037869	no	BREAST
chr1_1179288_G_A_b38	ATAD3C	-2.624	0.0091	-0.099364	6	0.037869	no	BREAST
chr1_914743_C_T_b38	ATAD3C	-2.623	0.00913	-0.075851	12	0.02892	no	BREAST
chr1_1175832_G_GAGAGGCTGCCGCTGTGCCGGTGGAGAGGCTGCCGCCGTGCAGGTGGAA_b38	ATAD3C	-2.592	0.00999	-0.106572	4	0.041123	no	BREAST
chr1_1476266_T_C_b38	ATAD3C	6.545	1.77e-10	0.112179	39	0.017139	yes	CULTFB
chr1_1483898_G_A_b38	ATAD3C	6.507	2.23e-10	0.110679	38	0.01701	yes	CULTFB
chr1_1487887_A_G_b38	ATAD3C	6.465	2.87e-10	0.109872	39	0.016994	yes	CULTFB
chr1_1473089_T_C_b38	ATAD3C	6.446	3.22e-10	0.108469	38	0.016828	yes	CULTFB
chr1_1486151_C_A_b38	ATAD3C	6.432	3.49e-10	0.109109	38	0.016963	yes	CULTFB
chr1_1488652_A_G_b38	ATAD3C	6.429	3.55e-10	0.109947	39	0.0171	yes	CULTFB
chr1_1492292_C_G_b38	ATAD3C	6.429	3.55e-10	0.109947	39	0.0171	yes	CULTFB
chr1_1492850_G_A_b38	ATAD3C	6.429	3.55e-10	0.109947	39	0.0171	yes	CULTFB
chr1_1482624_T_C_b38	ATAD3C	6.411	3.96e-10	0.10844	39	0.016914	yes	CULTFB
chr1_1490320_T_C_b38	ATAD3C	6.37	5.07e-10	0.108569	38	0.017045	yes	CULTFB
chr1_1492619_A_AC_b38	ATAD3C	6.37	5.07e-10	0.108569	38	0.017045	yes	CULTFB
chr1_1523022_A_G_b38	ATAD3C	6.183	1.52e-09	0.108546	24	0.017557	yes	CULTFB
chr1_1474201_CT_C_b38	ATAD3C	6.118	2.21e-09	0.097592	34	0.015953	yes	CULTFB
chr1_1489916_C_T_b38	ATAD3C	6.07	2.91e-09	0.102682	19	0.016917	yes	CULTFB
chr1_1476079_T_C_b38	ATAD3C	6.019	3.89e-09	0.100707	36	0.016732	yes	CULTFB
chr1_1496953_T_C_b38	ATAD3C	5.812	1.24e-08	0.095969	39	0.016513	yes	CULTFB
chr1_1490027_A_G_b38	ATAD3C	5.639	3.19e-08	0.096901	35	0.017185	yes	CULTFB
chr1_1490032_A_G_b38	ATAD3C	5.639	3.19e-08	0.096901	35	0.017185	yes	CULTFB
chr1_1496973_G_A_b38	ATAD3C	5.474	7.64e-08	0.095461	27	0.017438	yes	CULTFB
chr1_1517958_C_T_b38	ATAD3C	5.336	1.57e-07	0.098933	7	0.01854	yes	CULTFB
chr1_1479334_A_G_b38	ATAD3C	5.206	3.05e-07	0.109275	35	0.020988	yes	CULTFB
chr1_1486611_G_A_b38	ATAD3C	5.195	3.23e-07	0.093371	23	0.017974	yes	CULTFB
chr1_1512376_G_C_b38	ATAD3C	5.136	4.33e-07	0.077501	41	0.015089	yes	CULTFB
chr1_1481959_C_T_b38	ATAD3C	5.01	8.11e-07	0.088685	27	0.017703	yes	CULTFB
chr1_1511945_G_A_b38	ATAD3C	4.963	1.02e-06	0.07656	41	0.015427	yes	CULTFB
chr1_1501403_T_C_b38	ATAD3C	4.806	2.16e-06	0.073158	41	0.015223	yes	CULTFB
chr1_1518541_T_C_b38	ATAD3C	4.799	2.23e-06	0.069627	38	0.014508	yes	CULTFB
chr1_1747690_A_G_b38	ATAD3C	4.633	4.84e-06	0.141841	6	0.030615	yes	CULTFB
chr1_1515567_A_C_b38	ATAD3C	4.567	6.55e-06	0.099214	16	0.021725	yes	CULTFB
chr1_1513923_G_C_b38	ATAD3C	4.553	6.98e-06	0.066568	45	0.014621	yes	CULTFB
chr1_1521518_G_A_b38	ATAD3C	4.507	8.59e-06	0.098918	23	0.021948	yes	CULTFB
chr1_1533018_T_C_b38	ATAD3C	4.476	9.84e-06	0.097909	24	0.021872	yes	CULTFB
chr1_1520875_A_G_b38	ATAD3C	4.475	9.89e-06	0.097274	23	0.021736	yes	CULTFB
chr1_1501260_A_AT_b38	ATAD3C	4.411	1.31e-05	0.069618	20	0.015782	yes	CULTFB
chr1_1530331_T_C_b38	ATAD3C	4.358	1.66e-05	0.065016	46	0.01492	yes	CULTFB
chr1_1516000_T_C_b38	ATAD3C	4.355	1.68e-05	0.065011	45	0.014928	yes	CULTFB
chr1_1482402_A_G_b38	ATAD3C	4.31	2.04e-05	0.07054	53	0.016365	yes	CULTFB
chr1_1510082_T_TA_b38	ATAD3C	4.294	2.19e-05	0.082966	10	0.019323	yes	CULTFB
chr1_1530002_A_G_b38	ATAD3C	4.272	2.41e-05	0.093134	21	0.021801	yes	CULTFB
chr1_1526169_C_T_b38	ATAD3C	4.259	2.55e-05	0.091132	21	0.021399	yes	CULTFB
chr1_1469429_A_G_b38	ATAD3C	4.25	2.65e-05	0.084875	35	0.019972	yes	CULTFB
chr1_1470034_T_C_b38	ATAD3C	4.25	2.65e-05	0.084875	35	0.019972	yes	CULTFB
chr1_1471144_G_C_b38	ATAD3C	4.25	2.65e-05	0.084875	35	0.019972	yes	CULTFB
chr1_1468048_A_G_b38	ATAD3C	4.217	3.04e-05	0.083471	24	0.019792	yes	CULTFB
chr1_1469088_T_C_b38	ATAD3C	4.197	3.32e-05	0.081614	31	0.019446	yes	CULTFB
chr1_1500729_G_A_b38	ATAD3C	4.165	3.79e-05	0.092165	27	0.022126	yes	CULTFB
chr1_1514211_A_G_b38	ATAD3C	4.142	4.18e-05	0.100738	12	0.024322	yes	CULTFB
chr1_1522905_A_G_b38	ATAD3C	4.119	4.6e-05	0.088501	23	0.021485	yes	CULTFB
chr1_1726649_G_A_b38	ATAD3C	4.08	5.41e-05	0.133671	4	0.032764	yes	CULTFB
chr1_1524202_G_A_b38	ATAD3C	4.047	6.19e-05	0.093449	22	0.023089	yes	CULTFB
chr1_1518285_T_C_b38	ATAD3C	4.024	6.81e-05	0.06135	58	0.015246	yes	CULTFB
chr1_1020947_C_T_b38	ATAD3C	3.947	9.31e-05	0.09101	3	0.023059	yes	CULTFB
chr1_1517976_T_C_b38	ATAD3C	3.936	9.73e-05	0.102569	3	0.026061	yes	CULTFB
chr1_1523187_A_G_b38	ATAD3C	3.907	0.000109	0.082467	29	0.021106	yes	CULTFB
chr1_1468094_G_C_b38	ATAD3C	3.901	0.000112	0.076275	16	0.019554	yes	CULTFB
chr1_1533909_G_C_b38	ATAD3C	3.794	0.00017	0.048826	62	0.012868	yes	CULTFB
chr1_1468856_C_T_b38	ATAD3C	3.789	0.000174	0.073386	17	0.019368	yes	CULTFB
chr1_1534226_C_T_b38	ATAD3C	3.782	0.000179	0.048891	49	0.012929	yes	CULTFB
chr1_1514366_A_G_b38	ATAD3C	3.764	0.000191	0.098382	6	0.026136	yes	CULTFB
chr1_1479205_A_C_b38	ATAD3C	3.75	0.000202	0.0619	27	0.016508	yes	CULTFB
chr1_1527386_C_T_b38	ATAD3C	3.698	0.000246	0.081549	24	0.022049	yes	CULTFB
chr1_1739115_T_C_b38	ATAD3C	3.68	0.000264	0.117124	5	0.031828	yes	CULTFB
chr1_586069_T_A_b38	ATAD3C	3.634	0.000315	0.083565	6	0.022998	yes	CULTFB
chr1_1743602_T_C_b38	ATAD3C	3.616	0.000336	0.118731	3	0.032832	yes	CULTFB
chr1_1479683_T_G_b38	ATAD3C	3.559	0.000415	0.083625	34	0.023495	yes	CULTFB
chr1_1480096_G_C_b38	ATAD3C	3.559	0.000415	0.083625	34	0.023495	yes	CULTFB
chr1_2342840_A_ATATTTTATTTTATTT_b38	ATAD3C	3.539	0.000448	0.066685	18	0.018845	yes	CULTFB
chr1_908025_A_G_b38	ATAD3C	3.536	0.000452	0.042492	56	0.012016	yes	CULTFB
chr1_1471663_A_C_b38	ATAD3C	3.531	0.000461	0.096406	9	0.027305	yes	CULTFB
chr1_1531601_A_G_b38	ATAD3C	3.48	0.000556	0.084853	23	0.024386	yes	CULTFB
chr1_1485622_T_G_b38	ATAD3C	3.463	0.00059	0.109012	3	0.031479	yes	CULTFB
chr1_1476515_AT_A_b38	ATAD3C	3.453	0.000613	0.059971	5	0.01737	yes	CULTFB
chr1_1533095_G_A_b38	ATAD3C	3.45	0.000619	0.086341	18	0.025027	yes	CULTFB
chr1_1532105_T_C_b38	ATAD3C	3.443	0.000634	0.084832	20	0.024637	yes	CULTFB
chr1_1533253_C_T_b38	ATAD3C	3.443	0.000634	0.084832	20	0.024637	yes	CULTFB
chr1_1002192_A_AT_b38	ATAD3C	3.403	0.000733	0.06041	4	0.017754	yes	CULTFB
chr1_1533178_A_G_b38	ATAD3C	3.353	0.000872	0.082703	18	0.024663	yes	CULTFB
chr1_1531448_C_T_b38	ATAD3C	3.325	0.000963	0.081253	20	0.024435	yes	CULTFB
chr1_1480778_T_C_b38	ATAD3C	3.32	0.00098	0.10509	3	0.031653	yes	CULTFB
chr1_2189011_G_GAA_b38	ATAD3C	3.307	0.00103	0.086847	5	0.026264	yes	CULTFB
chr1_1764994_G_A_b38	ATAD3C	3.299	0.00105	0.094062	9	0.028511	yes	CULTFB
chr1_633678_C_T_b38	ATAD3C	3.25	0.00125	0.06159	6	0.018952	yes	CULTFB
chr1_1516109_T_C_b38	ATAD3C	3.249	0.00125	0.07901	12	0.024315	yes	CULTFB
chr1_1531133_G_A_b38	ATAD3C	3.202	0.00147	0.080187	12	0.025044	yes	CULTFB
chr1_1533841_T_C_b38	ATAD3C	3.196	0.0015	0.044724	43	0.013992	yes	CULTFB
chr1_2331983_C_CCTGCGCCTCTCCCGCCG_b38	ATAD3C	3.17	0.00164	0.097682	4	0.030818	yes	CULTFB
chr1_1524911_C_T_b38	ATAD3C	3.149	0.00176	0.082277	11	0.02613	yes	CULTFB
chr1_1135061_C_T_b38	ATAD3C	-3.102	0.00206	-0.048701	10	0.015702	yes	CULTFB
chr1_1516110_G_A_b38	ATAD3C	3.089	0.00214	0.075875	12	0.024561	yes	CULTFB
chr1_1425013_C_T_b38	ATAD3C	3.028	0.00261	0.06135	36	0.020259	yes	CULTFB
chr1_1461195_T_TC_b38	ATAD3C	2.966	0.00319	0.072751	11	0.024527	yes	CULTFB
chr1_868739_A_T_b38	ATAD3C	2.922	0.00367	0.0664	3	0.022723	yes	CULTFB
chr1_1534218_C_G_b38	ATAD3C	2.88	0.00418	0.033631	130	0.011677	yes	CULTFB
chr1_1534219_G_C_b38	ATAD3C	2.88	0.00418	0.033631	130	0.011677	yes	CULTFB
chr1_1411847_TCCAGGTC_T_b38	ATAD3C	2.88	0.00419	0.062399	9	0.021668	yes	CULTFB
chr1_1130902_A_G_b38	ATAD3C	-2.876	0.00424	-0.037872	30	0.013169	yes	CULTFB
chr1_2437459_CA_C_b38	ATAD3C	2.86	0.00445	0.044781	17	0.015655	yes	CULTFB
chr1_1442722_A_G_b38	ATAD3C	2.86	0.00446	0.079749	3	0.027887	yes	CULTFB
chr1_1422946_C_T_b38	ATAD3C	2.857	0.00449	0.076562	5	0.026794	yes	CULTFB
chr1_1424725_G_A_b38	ATAD3C	2.843	0.00469	0.078599	4	0.027643	yes	CULTFB
chr1_868729_C_A_b38	ATAD3C	2.838	0.00476	0.064579	3	0.022752	yes	CULTFB
chr1_1530595_C_T_b38	ATAD3C	2.824	0.00498	0.122288	3	0.043311	yes	CULTFB
chr1_633636_C_T_b38	ATAD3C	2.781	0.00566	0.044997	12	0.016177	yes	CULTFB
chr1_633329_A_G_b38	ATAD3C	2.772	0.00583	0.043445	13	0.015675	yes	CULTFB
chr1_862646_C_T_b38	ATAD3C	-2.76	0.00604	-0.050673	7	0.018362	yes	CULTFB
chr1_967384_C_G_b38	ATAD3C	-2.75	0.00622	-0.034119	98	0.012407	yes	CULTFB
chr1_1130879_G_C_b38	ATAD3C	-2.729	0.00662	-0.043928	11	0.016096	yes	CULTFB
chr1_958081_TC_T_b38	ATAD3C	2.712	0.00697	0.07127	9	0.026281	yes	CULTFB
chr1_1517993_A_G_b38	ATAD3C	2.684	0.00757	0.035794	80	0.013338	yes	CULTFB
chr1_1383798_AG_A_b38	ATAD3C	-2.653	0.00829	-0.052542	10	0.019805	yes	CULTFB
chr1_1409623_T_C_b38	ATAD3C	2.63	0.00887	0.04548	19	0.017295	yes	CULTFB
chr1_1423062_C_T_b38	ATAD3C	2.628	0.00892	0.052365	9	0.019928	yes	CULTFB
chr1_1418181_A_G_b38	ATAD3C	2.603	0.00959	0.046268	17	0.017778	yes	CULTFB
chr1_1418000_T_C_b38	ATAD3C	2.59	0.00994	0.045883	17	0.017715	yes	CULTFB
chr1_1418252_A_G_b38	ATAD3C	2.59	0.00994	0.045883	17	0.017715	yes	CULTFB
chr1_1490046_G_A_b38	ATAD3C	5.869	9.03e-09	0.109401	7	0.018641	no	CULTFB
chr1_1490047_A_G_b38	ATAD3C	5.869	9.03e-09	0.109401	7	0.018641	no	CULTFB
chr1_1497105_T_G_b38	ATAD3C	5.783	1.45e-08	0.111591	5	0.019296	no	CULTFB
chr1_1495204_T_C_b38	ATAD3C	5.733	1.91e-08	0.097216	28	0.016958	no	CULTFB
chr1_599294_T_G_b38	ATAD3C	4.715	3.31e-06	0.144172	3	0.030578	no	CULTFB
chr1_1487487_C_CA_b38	ATAD3C	4.535	7.57e-06	0.10312	4	0.02274	no	CULTFB
chr1_940296_G_GCCCCCCC_b38	ATAD3C	3.986	7.94e-05	0.107103	7	0.026869	no	CULTFB
chr1_1473170_C_T_b38	ATAD3C	3.873	0.000125	0.08938	3	0.023075	no	CULTFB
chr1_1494616_G_A_b38	ATAD3C	3.861	0.000131	0.087553	3	0.022675	no	CULTFB
chr1_1485510_G_A_b38	ATAD3C	3.848	0.000138	0.091836	3	0.023867	no	CULTFB
chr1_1468592_C_CG_b38	ATAD3C	3.798	0.000168	0.073712	17	0.019408	no	CULTFB
chr1_1497857_T_TAAAAA_b38	ATAD3C	3.685	0.000259	0.131362	4	0.035643	no	CULTFB
chr1_1009470_A_T_b38	ATAD3C	3.608	0.000347	0.081717	4	0.02265	no	CULTFB
chr1_660192_G_A_b38	ATAD3C	3.486	0.000544	0.062484	7	0.017926	no	CULTFB
chr1_1742119_C_CA_b38	ATAD3C	3.212	0.00142	0.106614	3	0.033193	no	CULTFB
chr1_1474819_G_C_b38	ATAD3C	3.059	0.00236	0.078021	10	0.025503	no	CULTFB
chr1_1028979_GCCACGCCACCCTCTCCCAAGGAACCGAGCCCCAGCCCCTCGTGGGCCAAGGGCGCCCACAC_G_b38	ATAD3C	3.026	0.00263	0.057386	11	0.018965	no	CULTFB
chr1_1135812_T_C_b38	ATAD3C	-2.966	0.0032	-0.061105	3	0.020604	no	CULTFB
chr1_2075289_T_C_b38	ATAD3C	-2.931	0.00357	-0.034462	69	0.01176	no	CULTFB
chr1_2369355_G_GA_b38	ATAD3C	2.904	0.00389	0.037416	44	0.012886	no	CULTFB
chr1_1568428_C_G_b38	ATAD3C	-2.874	0.00426	-0.03773	30	0.013128	no	CULTFB
chr1_868727_T_C_b38	ATAD3C	2.869	0.00433	0.066147	3	0.023054	no	CULTFB
chr1_2436516_TCCCTCCTCCTTTCCTCCTTCCTCCCTCCTCCCTTC_T_b38	ATAD3C	2.859	0.00446	0.085821	5	0.030015	no	CULTFB
chr1_1551523_T_C_b38	ATAD3C	-2.85	0.00459	-0.038297	27	0.013436	no	CULTFB
chr1_2245578_C_T_b38	ATAD3C	2.841	0.00472	0.047286	12	0.016645	no	CULTFB
chr1_1065530_C_T_b38	ATAD3C	2.841	0.00472	0.057286	4	0.020165	no	CULTFB
chr1_868755_A_G_b38	ATAD3C	2.831	0.00487	0.060873	3	0.021501	no	CULTFB
chr1_1545968_T_C_b38	ATAD3C	-2.828	0.00491	-0.037086	30	0.013113	no	CULTFB
chr1_2436513_TCC_T_b38	ATAD3C	2.815	0.00512	0.084568	5	0.030046	no	CULTFB
chr1_868710_C_T_b38	ATAD3C	2.811	0.00517	0.063489	3	0.022584	no	CULTFB
chr1_1115600_CCCCTCCCCAGGGACCCCCCT_C_b38	ATAD3C	2.764	0.00596	0.065032	5	0.023527	no	CULTFB
chr1_996254_A_AGGGAGGGCAG_b38	ATAD3C	2.74	0.0064	0.040307	18	0.014708	no	CULTFB
chr1_984608_C_CTTCTTTAT_b38	ATAD3C	2.733	0.00654	0.043435	20	0.015891	no	CULTFB
chr1_1579717_T_A_b38	ATAD3C	-2.722	0.00676	-0.037134	24	0.013641	no	CULTFB
chr1_868416_G_A_b38	ATAD3C	2.667	0.00796	0.061437	3	0.023038	no	CULTFB
chr1_1144906_G_A_b38	ATAD3C	-2.641	0.00857	-0.056113	3	0.021245	no	CULTFB
chr1_632644_A_G_b38	ATAD3C	2.641	0.00858	0.045234	5	0.017129	no	CULTFB
chr1_1000335_C_T_b38	ATAD3C	2.64	0.00861	0.03823	21	0.014481	no	CULTFB
chr1_1035169_TGG_T_b38	ATAD3C	2.637	0.00869	0.038945	15	0.014771	no	CULTFB
chr1_1948412_A_AATAT_b38	ATAD3C	-2.624	0.00901	-0.02715	124	0.010347	no	CULTFB
chr1_868772_T_G_b38	ATAD3C	2.614	0.00928	0.054473	3	0.020839	no	CULTFB
chr1_997077_G_A_b38	ATAD3C	2.61	0.00937	0.037772	21	0.01447	no	CULTFB
chr1_1573776_A_G_b38	ATAD3C	-2.593	0.00986	-0.0359	23	0.013847	no	CULTFB
chr1_868635_A_G_b38	ATAD3C	2.589	0.00997	0.055795	3	0.021553	no	CULTFB
chr1_1028979_GCCACGCCACCCTCTCCCAAGGAACCGAGCCCCAGCCCCTCGTGGGCCAAGGGCGCCCACAC_G_b38	ATAD3C	4.235	4.48e-05	0.246353	6	0.058171	yes	EBVTLC
chr1_633678_C_T_b38	ATAD3C	3.685	0.000344	0.219137	4	0.05947	yes	EBVTLC
chr1_861347_G_T_b38	ATAD3C	-3.598	0.000466	-0.196897	6	0.054723	yes	EBVTLC
chr1_591638_G_A_b38	ATAD3C	3.525	0.000598	0.232567	3	0.06597	yes	EBVTLC
chr1_1180614_G_A_b38	ATAD3C	-3.349	0.00108	-0.172536	10	0.051516	yes	EBVTLC
chr1_865003_C_T_b38	ATAD3C	-3.322	0.00118	-0.219294	3	0.066011	yes	EBVTLC
chr1_2344583_G_A_b38	ATAD3C	3.306	0.00125	0.179342	6	0.05425	yes	EBVTLC
chr1_1002192_A_AT_b38	ATAD3C	3.11	0.00233	0.185557	3	0.059656	yes	EBVTLC
chr1_862646_C_T_b38	ATAD3C	-3.11	0.00234	-0.202568	3	0.065144	yes	EBVTLC
chr1_601811_C_G_b38	ATAD3C	3.086	0.00252	0.164034	4	0.053156	yes	EBVTLC
chr1_2353743_A_T_b38	ATAD3C	2.861	0.00498	0.147263	20	0.051472	yes	EBVTLC
chr1_790933_CGAATGGAATG_C_b38	ATAD3C	-2.852	0.00512	-0.13861	14	0.048609	yes	EBVTLC
chr1_591650_C_T_b38	ATAD3C	2.851	0.00512	0.183511	4	0.064357	yes	EBVTLC
chr1_982260_G_A_b38	ATAD3C	2.813	0.00573	0.148937	7	0.052941	yes	EBVTLC
chr1_982858_C_G_b38	ATAD3C	2.813	0.00573	0.148937	7	0.052941	yes	EBVTLC
chr1_2356095_C_T_b38	ATAD3C	2.727	0.00735	0.162021	3	0.05942	yes	EBVTLC
chr1_996254_A_AGGGAGGGCAG_b38	ATAD3C	2.711	0.00769	0.153913	4	0.056778	yes	EBVTLC
chr1_998741_G_A_b38	ATAD3C	2.71	0.0077	0.140497	8	0.051839	yes	EBVTLC
chr1_2344634_T_C_b38	ATAD3C	2.699	0.00794	0.154127	4	0.057097	yes	EBVTLC
chr1_986280_C_T_b38	ATAD3C	2.693	0.00808	0.148501	5	0.055138	yes	EBVTLC
chr1_2293812_C_T_b38	ATAD3C	2.684	0.00829	0.122847	17	0.045765	yes	EBVTLC
chr1_2356409_G_C_b38	ATAD3C	2.684	0.00829	0.142124	14	0.052947	yes	EBVTLC
chr1_633887_G_A_b38	ATAD3C	2.673	0.00855	0.156632	11	0.058594	yes	EBVTLC
chr1_2367644_G_A_b38	ATAD3C	2.668	0.00867	0.131164	19	0.049156	yes	EBVTLC
chr1_1177602_C_T_b38	ATAD3C	-2.936	0.00398	-0.15835	9	0.05394	no	EBVTLC
chr1_1240648_T_TCATTCACCCCGGCCGTGGTCCCTGCCCCAGCCCCCGCCGCCCC_b38	ATAD3C	2.906	0.00436	0.098215	15	0.033799	no	EBVTLC
chr1_2213543_G_T_b38	ATAD3C	-2.736	0.00715	-0.135233	12	0.049423	no	EBVTLC
chr1_984608_C_CTTCTTTAT_b38	ATAD3C	2.657	0.00895	0.15456	6	0.058176	no	EBVTLC
chr1_1443457_T_C_b38	ATAD3C	-9.11	2.19e-17	-0.27171	32	0.029824	yes	CLNSGM
chr1_1440834_C_G_b38	ATAD3C	-9.029	3.86e-17	-0.269515	31	0.02985	yes	CLNSGM
chr1_1445187_T_G_b38	ATAD3C	-8.587	8.06e-16	-0.257206	32	0.029952	yes	CLNSGM
chr1_1440430_C_G_b38	ATAD3C	-8.576	8.69e-16	-0.260846	19	0.030415	yes	CLNSGM
chr1_1445240_A_G_b38	ATAD3C	-8.493	1.52e-15	-0.255136	32	0.03004	yes	CLNSGM
chr1_1439454_A_G_b38	ATAD3C	-8.451	2.02e-15	-0.256983	29	0.030408	yes	CLNSGM
chr1_1428969_T_C_b38	ATAD3C	-7.736	2.23e-13	-0.235111	35	0.030394	yes	CLNSGM
chr1_1430908_A_G_b38	ATAD3C	-7.616	4.77e-13	-0.232983	35	0.030592	yes	CLNSGM
chr1_1436079_A_G_b38	ATAD3C	-7.58	5.99e-13	-0.225238	36	0.029715	yes	CLNSGM
chr1_1441187_A_G_b38	ATAD3C	-7.351	2.51e-12	-0.24425	18	0.033226	yes	CLNSGM
chr1_1430190_A_C_b38	ATAD3C	-7.344	2.63e-12	-0.225031	35	0.030643	yes	CLNSGM
chr1_1436388_CA_C_b38	ATAD3C	-7.293	3.59e-12	-0.241149	19	0.033065	yes	CLNSGM
chr1_1433374_T_C_b38	ATAD3C	-7.245	4.85e-12	-0.217683	37	0.030048	yes	CLNSGM
chr1_1431450_A_G_b38	ATAD3C	-7.221	5.62e-12	-0.221354	35	0.030656	yes	CLNSGM
chr1_1431537_G_C_b38	ATAD3C	-7.221	5.62e-12	-0.221354	35	0.030656	yes	CLNSGM
chr1_1449831_A_G_b38	ATAD3C	-7.046	1.63e-11	-0.23605	30	0.033502	yes	CLNSGM
chr1_1455617_T_G_b38	ATAD3C	-6.948	2.93e-11	-0.229268	29	0.032998	yes	CLNSGM
chr1_1457033_A_C_b38	ATAD3C	-6.934	3.19e-11	-0.227225	14	0.032772	yes	CLNSGM
chr1_1426810_C_G_b38	ATAD3C	-6.917	3.53e-11	-0.210492	35	0.030432	yes	CLNSGM
chr1_1454770_T_C_b38	ATAD3C	-6.902	3.86e-11	-0.228351	29	0.033085	yes	CLNSGM
chr1_1426261_C_T_b38	ATAD3C	-6.752	9.33e-11	-0.207189	34	0.030684	yes	CLNSGM
chr1_1454315_C_T_b38	ATAD3C	-6.747	9.64e-11	-0.22073	27	0.032716	yes	CLNSGM
chr1_1448915_G_A_b38	ATAD3C	-6.729	1.07e-10	-0.220915	21	0.032833	yes	CLNSGM
chr1_1452511_A_G_b38	ATAD3C	-6.616	2.07e-10	-0.218964	28	0.033099	yes	CLNSGM
chr1_1452888_C_A_b38	ATAD3C	-6.616	2.07e-10	-0.218964	28	0.033099	yes	CLNSGM
chr1_1452909_A_C_b38	ATAD3C	-6.616	2.07e-10	-0.218964	28	0.033099	yes	CLNSGM
chr1_1453703_A_G_b38	ATAD3C	-6.616	2.07e-10	-0.218964	28	0.033099	yes	CLNSGM
chr1_1454092_A_G_b38	ATAD3C	-6.616	2.07e-10	-0.218964	28	0.033099	yes	CLNSGM
chr1_1451787_A_C_b38	ATAD3C	-6.477	4.59e-10	-0.212685	26	0.032835	yes	CLNSGM
chr1_1456154_G_A_b38	ATAD3C	-6.317	1.14e-09	-0.208986	13	0.033083	yes	CLNSGM
chr1_1452825_AAAG_A_b38	ATAD3C	-6.225	1.9e-09	-0.206179	13	0.033122	yes	CLNSGM
chr1_1453552_G_A_b38	ATAD3C	-6.225	1.9e-09	-0.206179	13	0.033122	yes	CLNSGM
chr1_1455134_T_G_b38	ATAD3C	-6.225	1.9e-09	-0.206179	13	0.033122	yes	CLNSGM
chr1_1455337_A_G_b38	ATAD3C	-6.225	1.9e-09	-0.206179	13	0.033122	yes	CLNSGM
chr1_1455495_C_T_b38	ATAD3C	-6.225	1.9e-09	-0.206179	13	0.033122	yes	CLNSGM
chr1_1456079_T_C_b38	ATAD3C	-6.196	2.24e-09	-0.206245	13	0.033289	yes	CLNSGM
chr1_1438102_G_C_b38	ATAD3C	-6.169	2.6e-09	-0.209322	12	0.033934	yes	CLNSGM
chr1_1455924_T_C_b38	ATAD3C	-6.162	2.7e-09	-0.203735	13	0.033066	yes	CLNSGM
chr1_1456051_C_T_b38	ATAD3C	-6.152	2.84e-09	-0.203862	13	0.033136	yes	CLNSGM
chr1_1454848_T_C_b38	ATAD3C	-6.065	4.59e-09	-0.200759	14	0.033102	yes	CLNSGM
chr1_1497605_G_C_b38	ATAD3C	-5.938	9.13e-09	-0.17187	36	0.028944	yes	CLNSGM
chr1_1432355_G_A_b38	ATAD3C	-5.912	1.05e-08	-0.19758	15	0.03342	yes	CLNSGM
chr1_1452797_CAA_C_b38	ATAD3C	-5.856	1.41e-08	-0.203644	11	0.034775	yes	CLNSGM
chr1_1431014_G_A_b38	ATAD3C	-5.789	2.02e-08	-0.180377	18	0.031159	yes	CLNSGM
chr1_1457071_C_T_b38	ATAD3C	-5.739	2.63e-08	-0.191989	13	0.033456	yes	CLNSGM
chr1_1456217_T_C_b38	ATAD3C	-5.729	2.77e-08	-0.198347	29	0.034623	yes	CLNSGM
chr1_1452540_G_A_b38	ATAD3C	-5.659	3.98e-08	-0.188115	11	0.033241	yes	CLNSGM
chr1_1451968_C_T_b38	ATAD3C	-5.635	4.52e-08	-0.186715	12	0.033136	yes	CLNSGM
chr1_1431026_CCACCCCCT_C_b38	ATAD3C	-5.565	6.46e-08	-0.192425	13	0.034575	yes	CLNSGM
chr1_1449009_A_T_b38	ATAD3C	-5.539	7.4e-08	-0.204429	18	0.036907	yes	CLNSGM
chr1_1456182_G_A_b38	ATAD3C	-5.465	1.08e-07	-0.17972	14	0.032886	yes	CLNSGM
chr1_1442793_G_A_b38	ATAD3C	-5.44	1.22e-07	-0.203931	5	0.037488	yes	CLNSGM
chr1_1370113_A_G_b38	ATAD3C	5.365	1.78e-07	0.178361	22	0.033243	yes	CLNSGM
chr1_1435945_C_CCGGGCGGGGGCG_b38	ATAD3C	-5.311	2.33e-07	-0.195688	7	0.036844	yes	CLNSGM
chr1_1394423_A_G_b38	ATAD3C	-5.188	4.26e-07	-0.191227	29	0.036858	yes	CLNSGM
chr1_1395346_A_G_b38	ATAD3C	-5.188	4.26e-07	-0.191227	29	0.036858	yes	CLNSGM
chr1_1402457_A_G_b38	ATAD3C	-5.188	4.26e-07	-0.191227	29	0.036858	yes	CLNSGM
chr1_1387698_A_G_b38	ATAD3C	5.188	4.26e-07	0.191227	29	0.036858	yes	CLNSGM
chr1_1389827_C_T_b38	ATAD3C	5.188	4.26e-07	0.191227	29	0.036858	yes	CLNSGM
chr1_1312114_T_C_b38	ATAD3C	5.184	4.34e-07	0.179238	33	0.034573	yes	CLNSGM
chr1_1330125_G_A_b38	ATAD3C	5.18	4.44e-07	0.183899	31	0.035504	yes	CLNSGM
chr1_1437993_G_A_b38	ATAD3C	-5.173	4.58e-07	-0.183982	8	0.035564	yes	CLNSGM
chr1_1366561_AGT_A_b38	ATAD3C	5.158	4.93e-07	0.18286	31	0.035453	yes	CLNSGM
chr1_1471992_T_C_b38	ATAD3C	-5.14	5.38e-07	-0.171773	34	0.033418	yes	CLNSGM
chr1_1431813_G_T_b38	ATAD3C	-5.071	7.48e-07	-0.178602	11	0.035217	yes	CLNSGM
chr1_1456891_T_C_b38	ATAD3C	-5.064	7.73e-07	-0.155104	18	0.030626	yes	CLNSGM
chr1_1309988_G_A_b38	ATAD3C	5.054	8.12e-07	0.171975	35	0.034026	yes	CLNSGM
chr1_1313807_G_A_b38	ATAD3C	5.054	8.12e-07	0.171975	35	0.034026	yes	CLNSGM
chr1_1358384_G_C_b38	ATAD3C	5.039	8.73e-07	0.179941	31	0.03571	yes	CLNSGM
chr1_1411323_A_C_b38	ATAD3C	-4.939	1.4e-06	-0.181666	29	0.036781	yes	CLNSGM
chr1_1434687_C_G_b38	ATAD3C	-4.899	1.69e-06	-0.187224	6	0.038215	yes	CLNSGM
chr1_1308516_C_T_b38	ATAD3C	4.888	1.78e-06	0.165018	35	0.033758	yes	CLNSGM
chr1_1453643_A_ATT_b38	ATAD3C	-4.817	2.47e-06	-0.168807	18	0.035048	yes	CLNSGM
chr1_1439805_G_C_b38	ATAD3C	-4.693	4.35e-06	-0.166404	10	0.035461	yes	CLNSGM
chr1_1500745_A_C_b38	ATAD3C	-4.672	4.78e-06	-0.226706	22	0.048526	yes	CLNSGM
chr1_1431656_G_A_b38	ATAD3C	-4.665	4.92e-06	-0.179703	6	0.03852	yes	CLNSGM
chr1_1426253_G_A_b38	ATAD3C	-4.6	6.59e-06	-0.173883	5	0.037801	yes	CLNSGM
chr1_1517993_A_G_b38	ATAD3C	-4.592	6.83e-06	-0.142075	43	0.030941	yes	CLNSGM
chr1_1519934_T_G_b38	ATAD3C	-4.592	6.83e-06	-0.142075	43	0.030941	yes	CLNSGM
chr1_1519938_T_C_b38	ATAD3C	-4.592	6.83e-06	-0.142075	43	0.030941	yes	CLNSGM
chr1_1366941_T_TGTGTGCA_b38	ATAD3C	4.559	7.9e-06	0.183189	6	0.040183	yes	CLNSGM
chr1_1366951_A_AGT_b38	ATAD3C	4.559	7.9e-06	0.183189	6	0.040183	yes	CLNSGM
chr1_1379083_AT_A_b38	ATAD3C	4.538	8.67e-06	0.153281	13	0.033779	yes	CLNSGM
chr1_1456829_G_C_b38	ATAD3C	-4.518	9.44e-06	-0.171353	18	0.037924	yes	CLNSGM
chr1_1447108_A_ATT_b38	ATAD3C	-4.497	1.04e-05	-0.159787	9	0.03553	yes	CLNSGM
chr1_1400410_A_G_b38	ATAD3C	-4.474	1.14e-05	-0.158667	23	0.035461	yes	CLNSGM
chr1_1384749_C_G_b38	ATAD3C	4.474	1.14e-05	0.158667	23	0.035461	yes	CLNSGM
chr1_1387763_CCT_C_b38	ATAD3C	4.474	1.14e-05	0.158667	23	0.035461	yes	CLNSGM
chr1_1388944_G_A_b38	ATAD3C	4.474	1.14e-05	0.158667	23	0.035461	yes	CLNSGM
chr1_1376162_G_C_b38	ATAD3C	4.433	1.37e-05	0.156271	23	0.035254	yes	CLNSGM
chr1_1377431_C_T_b38	ATAD3C	4.433	1.37e-05	0.156271	23	0.035254	yes	CLNSGM
chr1_1378204_G_C_b38	ATAD3C	4.428	1.4e-05	0.15224	25	0.034381	yes	CLNSGM
chr1_1533841_T_C_b38	ATAD3C	-4.419	1.46e-05	-0.156089	18	0.035326	yes	CLNSGM
chr1_1366427_AGTGTGATTGAATGAGT_A_b38	ATAD3C	4.367	1.81e-05	0.150478	24	0.034455	yes	CLNSGM
chr1_1379091_T_G_b38	ATAD3C	4.307	2.34e-05	0.166367	7	0.038629	yes	CLNSGM
chr1_1501260_A_AT_b38	ATAD3C	-4.288	2.53e-05	-0.158911	11	0.037058	yes	CLNSGM
chr1_1452346_A_G_b38	ATAD3C	-4.28	2.62e-05	-0.16268	5	0.038006	yes	CLNSGM
chr1_1363456_CAG_C_b38	ATAD3C	4.046	6.87e-05	0.131022	18	0.032386	yes	CLNSGM
chr1_1337898_A_G_b38	ATAD3C	4.038	7.09e-05	0.138062	12	0.034193	yes	CLNSGM
chr1_1452384_G_A_b38	ATAD3C	-3.998	8.3e-05	-0.154798	4	0.038717	yes	CLNSGM
chr1_1453870_A_C_b38	ATAD3C	-3.958	9.74e-05	-0.155725	4	0.039345	yes	CLNSGM
chr1_1178191_A_G_b38	ATAD3C	-3.918	0.000114	-0.161981	6	0.041339	yes	CLNSGM
chr1_1472158_C_G_b38	ATAD3C	-3.901	0.000122	-0.189818	8	0.048662	yes	CLNSGM
chr1_1460021_C_CTG_b38	ATAD3C	-3.886	0.000129	-0.180677	9	0.04649	yes	CLNSGM
chr1_1460022_CAG_C_b38	ATAD3C	-3.886	0.000129	-0.180677	9	0.04649	yes	CLNSGM
chr1_1363986_C_T_b38	ATAD3C	3.873	0.000136	0.140138	9	0.036184	yes	CLNSGM
chr1_1367292_A_AGT_b38	ATAD3C	3.865	0.00014	0.138831	9	0.035917	yes	CLNSGM
chr1_1363898_C_T_b38	ATAD3C	3.861	0.000142	0.13949	9	0.036127	yes	CLNSGM
chr1_1366529_TTAG_T_b38	ATAD3C	3.861	0.000142	0.13949	9	0.036127	yes	CLNSGM
chr1_1450636_A_G_b38	ATAD3C	-3.852	0.000147	-0.150188	5	0.038985	yes	CLNSGM
chr1_1451028_T_A_b38	ATAD3C	-3.852	0.000147	-0.150188	5	0.038985	yes	CLNSGM
chr1_1316929_A_T_b38	ATAD3C	-3.827	0.000162	-0.160169	4	0.041848	yes	CLNSGM
chr1_1324149_G_A_b38	ATAD3C	3.827	0.000162	0.082939	67	0.021672	yes	CLNSGM
chr1_1534226_C_T_b38	ATAD3C	-3.786	0.00019	-0.116915	35	0.030884	yes	CLNSGM
chr1_1365566_G_A_b38	ATAD3C	3.763	0.000208	0.135478	9	0.036007	yes	CLNSGM
chr1_1461621_T_TCTCCTCATGAGACCCCCATGTCGGAATTCGAAGGAGAGG_b38	ATAD3C	-3.755	0.000213	-0.192117	8	0.051161	yes	CLNSGM
chr1_1518285_T_C_b38	ATAD3C	-3.743	0.000224	-0.145782	28	0.038951	yes	CLNSGM
chr1_1422081_C_T_b38	ATAD3C	-3.742	0.000225	-0.18327	18	0.048983	yes	CLNSGM
chr1_1450193_C_T_b38	ATAD3C	-3.711	0.000252	-0.178766	9	0.048173	yes	CLNSGM
chr1_1468048_A_G_b38	ATAD3C	-3.706	0.000257	-0.170114	11	0.045902	yes	CLNSGM
chr1_1428999_C_CA_b38	ATAD3C	-3.692	0.000271	-0.116152	17	0.03146	yes	CLNSGM
chr1_1459004_T_C_b38	ATAD3C	-3.691	0.000272	-0.197923	8	0.053627	yes	CLNSGM
chr1_1251122_A_T_b38	ATAD3C	-3.682	0.000282	-0.133843	12	0.036356	yes	CLNSGM
chr1_1453961_C_T_b38	ATAD3C	-3.65	0.000317	-0.144696	4	0.039647	yes	CLNSGM
chr1_1421170_A_G_b38	ATAD3C	-3.648	0.000319	-0.181176	13	0.04967	yes	CLNSGM
chr1_1479719_T_C_b38	ATAD3C	-3.622	0.000351	-0.125924	39	0.034769	yes	CLNSGM
chr1_1501403_T_C_b38	ATAD3C	-3.613	0.000363	-0.14124	17	0.039092	yes	CLNSGM
chr1_1254283_G_A_b38	ATAD3C	-3.607	0.000371	-0.188788	3	0.052338	yes	CLNSGM
chr1_1255533_CT_C_b38	ATAD3C	-3.607	0.000371	-0.188788	3	0.052338	yes	CLNSGM
chr1_1257135_A_G_b38	ATAD3C	-3.607	0.000371	-0.188788	3	0.052338	yes	CLNSGM
chr1_1260440_T_C_b38	ATAD3C	-3.607	0.000371	-0.188788	3	0.052338	yes	CLNSGM
chr1_1264812_C_G_b38	ATAD3C	-3.607	0.000371	-0.188788	3	0.052338	yes	CLNSGM
chr1_1266260_T_C_b38	ATAD3C	-3.607	0.000371	-0.188788	3	0.052338	yes	CLNSGM
chr1_1270963_C_A_b38	ATAD3C	-3.607	0.000371	-0.188788	3	0.052338	yes	CLNSGM
chr1_1388565_GTC_G_b38	ATAD3C	3.581	0.000408	0.117542	15	0.032824	yes	CLNSGM
chr1_1419214_A_G_b38	ATAD3C	-3.569	0.000426	-0.169005	6	0.047354	yes	CLNSGM
chr1_1375678_TA_T_b38	ATAD3C	3.565	0.000432	0.127056	13	0.035638	yes	CLNSGM
chr1_1361679_G_A_b38	ATAD3C	3.552	0.000453	0.128035	19	0.036044	yes	CLNSGM
chr1_1295039_T_C_b38	ATAD3C	-3.506	0.000536	-0.160649	20	0.045826	yes	CLNSGM
chr1_1298561_T_C_b38	ATAD3C	-3.506	0.000536	-0.160649	20	0.045826	yes	CLNSGM
chr1_1300330_T_A_b38	ATAD3C	-3.506	0.000536	-0.160649	20	0.045826	yes	CLNSGM
chr1_1301656_T_C_b38	ATAD3C	-3.506	0.000536	-0.160649	20	0.045826	yes	CLNSGM
chr1_1351517_G_C_b38	ATAD3C	3.504	0.000539	0.145211	11	0.041446	yes	CLNSGM
chr1_1329973_GCGTGTGCCATGCA_G_b38	ATAD3C	-3.489	0.000568	-0.146426	4	0.041966	yes	CLNSGM
chr1_1344048_G_A_b38	ATAD3C	-3.486	0.000575	-0.146899	4	0.042143	yes	CLNSGM
chr1_1459658_G_A_b38	ATAD3C	-3.476	0.000596	-0.180699	14	0.051988	yes	CLNSGM
chr1_1271835_A_G_b38	ATAD3C	-3.475	0.000598	-0.182585	3	0.052542	yes	CLNSGM
chr1_1364253_C_G_b38	ATAD3C	-3.451	0.000652	-0.139789	5	0.040512	yes	CLNSGM
chr1_1303112_G_A_b38	ATAD3C	-3.446	0.000662	-0.140714	5	0.040833	yes	CLNSGM
chr1_1249880_A_G_b38	ATAD3C	-3.435	0.000688	-0.129092	11	0.037579	yes	CLNSGM
chr1_1530331_T_C_b38	ATAD3C	-3.434	0.00069	-0.13099	19	0.038142	yes	CLNSGM
chr1_1341550_GCA_G_b38	ATAD3C	-3.395	0.000793	-0.139336	5	0.041041	yes	CLNSGM
chr1_1417046_C_T_b38	ATAD3C	-3.394	0.000794	-0.158068	3	0.046566	yes	CLNSGM
chr1_1254681_A_G_b38	ATAD3C	-3.394	0.000797	-0.164845	6	0.048576	yes	CLNSGM
chr1_1258333_C_G_b38	ATAD3C	-3.394	0.000797	-0.164845	6	0.048576	yes	CLNSGM
chr1_1258343_A_C_b38	ATAD3C	-3.394	0.000797	-0.164845	6	0.048576	yes	CLNSGM
chr1_1382893_G_A_b38	ATAD3C	-3.391	0.000804	-0.146976	3	0.043342	yes	CLNSGM
chr1_1302795_T_TC_b38	ATAD3C	3.385	0.000822	0.10961	48	0.032384	yes	CLNSGM
chr1_1308549_G_T_b38	ATAD3C	3.383	0.000826	0.083844	89	0.024781	yes	CLNSGM
chr1_1368047_ACT_A_b38	ATAD3C	3.376	0.000846	0.161491	11	0.04783	yes	CLNSGM
chr1_1306420_A_G_b38	ATAD3C	3.376	0.000848	0.158114	20	0.046841	yes	CLNSGM
chr1_1423062_C_T_b38	ATAD3C	-3.373	0.000856	-0.162837	3	0.048275	yes	CLNSGM
chr1_1515567_A_C_b38	ATAD3C	-3.362	0.000888	-0.204974	6	0.060962	yes	CLNSGM
chr1_1303800_G_A_b38	ATAD3C	-3.356	0.000907	-0.141431	5	0.042138	yes	CLNSGM
chr1_1279425_C_T_b38	ATAD3C	-3.343	0.00095	-0.177026	3	0.052957	yes	CLNSGM
chr1_1395050_G_A_b38	ATAD3C	-3.338	0.000965	-0.160895	3	0.048197	yes	CLNSGM
chr1_1399922_C_T_b38	ATAD3C	-3.338	0.000965	-0.160895	3	0.048197	yes	CLNSGM
chr1_1402900_A_G_b38	ATAD3C	-3.338	0.000965	-0.160895	3	0.048197	yes	CLNSGM
chr1_1405316_T_C_b38	ATAD3C	-3.338	0.000965	-0.160895	3	0.048197	yes	CLNSGM
chr1_1482402_A_G_b38	ATAD3C	-3.335	0.000978	-0.14533	26	0.043584	yes	CLNSGM
chr1_1566854_CA_C_b38	ATAD3C	-3.334	0.000978	-0.109991	26	0.032986	yes	CLNSGM
chr1_1512376_G_C_b38	ATAD3C	-3.328	0.001	-0.132643	16	0.039855	yes	CLNSGM
chr1_1417031_A_G_b38	ATAD3C	-3.316	0.00104	-0.154352	3	0.046541	yes	CLNSGM
chr1_1375642_C_T_b38	ATAD3C	-3.307	0.00108	-0.143373	3	0.043361	yes	CLNSGM
chr1_1304555_A_C_b38	ATAD3C	-3.305	0.00108	-0.136813	5	0.041394	yes	CLNSGM
chr1_1513923_G_C_b38	ATAD3C	-3.292	0.00113	-0.125728	19	0.038189	yes	CLNSGM
chr1_1419135_C_G_b38	ATAD3C	-3.279	0.00118	-0.161568	17	0.049274	yes	CLNSGM
chr1_1403240_CCTTT_C_b38	ATAD3C	-3.278	0.00119	-0.157312	3	0.047988	yes	CLNSGM
chr1_1306523_C_G_b38	ATAD3C	3.267	0.00123	0.140678	11	0.043066	yes	CLNSGM
chr1_1511945_G_A_b38	ATAD3C	-3.264	0.00124	-0.132903	16	0.040715	yes	CLNSGM
chr1_1524664_A_G_b38	ATAD3C	-3.256	0.00128	-0.125264	24	0.038477	yes	CLNSGM
chr1_1385384_G_A_b38	ATAD3C	3.249	0.00131	0.157505	3	0.048478	yes	CLNSGM
chr1_1324788_C_A_b38	ATAD3C	3.244	0.00133	0.153923	11	0.047442	yes	CLNSGM
chr1_1551454_C_A_b38	ATAD3C	-3.231	0.00139	-0.090485	73	0.028005	yes	CLNSGM
chr1_1532798_T_C_b38	ATAD3C	-3.226	0.00141	-0.087591	77	0.02715	yes	CLNSGM
chr1_1418181_A_G_b38	ATAD3C	-3.219	0.00145	-0.146913	4	0.045636	yes	CLNSGM
chr1_1415221_G_T_b38	ATAD3C	-3.209	0.0015	-0.144833	4	0.045137	yes	CLNSGM
chr1_1416747_CT_C_b38	ATAD3C	-3.202	0.00153	-0.143777	4	0.044901	yes	CLNSGM
chr1_1372909_G_A_b38	ATAD3C	-3.2	0.00154	-0.138509	3	0.043281	yes	CLNSGM
chr1_1374505_A_G_b38	ATAD3C	-3.2	0.00154	-0.138509	3	0.043281	yes	CLNSGM
chr1_2005903_A_ACTCT_b38	ATAD3C	-3.171	0.0017	-0.125874	4	0.039692	yes	CLNSGM
chr1_1489916_C_T_b38	ATAD3C	-3.162	0.00175	-0.138636	9	0.04385	yes	CLNSGM
chr1_1367268_TGA_T_b38	ATAD3C	-3.16	0.00176	-0.127563	5	0.040372	yes	CLNSGM
chr1_1588141_CA_C_b38	ATAD3C	3.146	0.00185	0.106088	16	0.033722	yes	CLNSGM
chr1_1258206_AT_A_b38	ATAD3C	-3.144	0.00186	-0.113336	24	0.036051	yes	CLNSGM
chr1_1533883_G_T_b38	ATAD3C	-3.14	0.00189	-0.191363	4	0.060952	yes	CLNSGM
chr1_1383798_AG_A_b38	ATAD3C	3.139	0.00189	0.151532	3	0.048271	yes	CLNSGM
chr1_1366681_T_TGA_b38	ATAD3C	-3.127	0.00197	-0.127109	5	0.040649	yes	CLNSGM
chr1_1496973_G_A_b38	ATAD3C	-3.125	0.00198	-0.136038	12	0.04353	yes	CLNSGM
chr1_1290968_C_G_b38	ATAD3C	-3.125	0.00198	-0.123347	24	0.039474	yes	CLNSGM
chr1_1217251_C_A_b38	ATAD3C	-3.123	0.00199	-0.130936	4	0.041924	yes	CLNSGM
chr1_1418223_A_G_b38	ATAD3C	-3.123	0.00199	-0.143717	4	0.046024	yes	CLNSGM
chr1_1468592_C_CG_b38	ATAD3C	-3.123	0.00199	-0.150385	9	0.048162	yes	CLNSGM
chr1_1468856_C_T_b38	ATAD3C	-3.122	0.00199	-0.150933	8	0.048338	yes	CLNSGM
chr1_1366511_GGTGA_G_b38	ATAD3C	-3.12	0.00201	-0.126558	5	0.040558	yes	CLNSGM
chr1_1415385_T_C_b38	ATAD3C	-3.119	0.00202	-0.142532	4	0.045695	yes	CLNSGM
chr1_1415659_G_C_b38	ATAD3C	-3.119	0.00202	-0.142532	4	0.045695	yes	CLNSGM
chr1_1417561_A_G_b38	ATAD3C	-3.119	0.00202	-0.142532	4	0.045695	yes	CLNSGM
chr1_1418000_T_C_b38	ATAD3C	-3.119	0.00202	-0.142532	4	0.045695	yes	CLNSGM
chr1_1418252_A_G_b38	ATAD3C	-3.119	0.00202	-0.142532	4	0.045695	yes	CLNSGM
chr1_1569180_T_A_b38	ATAD3C	-3.115	0.00204	-0.093261	42	0.029936	yes	CLNSGM
chr1_1292284_TTGAG_T_b38	ATAD3C	-3.107	0.0021	-0.120645	15	0.038828	yes	CLNSGM
chr1_1516000_T_C_b38	ATAD3C	-3.107	0.0021	-0.120353	19	0.038739	yes	CLNSGM
chr1_1417000_C_T_b38	ATAD3C	-3.104	0.00212	-0.141489	4	0.045584	yes	CLNSGM
chr1_1175611_G_C_b38	ATAD3C	-3.103	0.00212	-0.131122	5	0.042254	yes	CLNSGM
chr1_1533754_T_C_b38	ATAD3C	-3.096	0.00217	-0.110923	22	0.035823	yes	CLNSGM
chr1_1363688_C_T_b38	ATAD3C	-3.095	0.00218	-0.125569	5	0.040566	yes	CLNSGM
chr1_1364099_CCA_C_b38	ATAD3C	-3.095	0.00218	-0.125569	5	0.040566	yes	CLNSGM
chr1_1364102_TGTTG_T_b38	ATAD3C	-3.095	0.00218	-0.125569	5	0.040566	yes	CLNSGM
chr1_1368763_G_A_b38	ATAD3C	-3.095	0.00218	-0.125569	5	0.040566	yes	CLNSGM
chr1_1459632_T_C_b38	ATAD3C	-3.092	0.0022	-0.163203	11	0.052779	yes	CLNSGM
chr1_1307327_A_G_b38	ATAD3C	3.09	0.00222	0.143728	20	0.046512	yes	CLNSGM
chr1_1307603_G_A_b38	ATAD3C	3.09	0.00222	0.143728	20	0.046512	yes	CLNSGM
chr1_1183348_C_G_b38	ATAD3C	-3.09	0.00222	-0.148542	3	0.048072	yes	CLNSGM
chr1_1280332_C_T_b38	ATAD3C	-3.08	0.00229	-0.160933	3	0.052252	yes	CLNSGM
chr1_1259424_T_C_b38	ATAD3C	-3.08	0.00229	-0.113766	29	0.036941	yes	CLNSGM
chr1_1364566_T_C_b38	ATAD3C	-3.079	0.0023	-0.124757	5	0.040523	yes	CLNSGM
chr1_1177741_G_A_b38	ATAD3C	-3.079	0.0023	-0.130598	5	0.04242	yes	CLNSGM
chr1_1368177_G_C_b38	ATAD3C	-3.078	0.00231	-0.124719	6	0.040526	yes	CLNSGM
chr1_1415754_CCGCT_C_b38	ATAD3C	-3.068	0.00238	-0.141623	3	0.046156	yes	CLNSGM
chr1_1415762_ATCCGCT_A_b38	ATAD3C	-3.068	0.00238	-0.141623	3	0.046156	yes	CLNSGM
chr1_1496953_T_C_b38	ATAD3C	-3.058	0.00246	-0.131865	15	0.043116	yes	CLNSGM
chr1_1459662_C_T_b38	ATAD3C	-3.055	0.00248	-0.161332	11	0.052809	yes	CLNSGM
chr1_1370553_CAAA_C_b38	ATAD3C	-3.047	0.00255	-0.129158	4	0.04239	yes	CLNSGM
chr1_1383743_T_C_b38	ATAD3C	-3.042	0.00259	-0.134526	3	0.044226	yes	CLNSGM
chr1_1398218_C_A_b38	ATAD3C	-3.042	0.00259	-0.134526	3	0.044226	yes	CLNSGM
chr1_1400756_GGA_G_b38	ATAD3C	-3.042	0.00259	-0.134526	3	0.044226	yes	CLNSGM
chr1_1401954_G_T_b38	ATAD3C	-3.042	0.00259	-0.134526	3	0.044226	yes	CLNSGM
chr1_1403593_A_G_b38	ATAD3C	-3.042	0.00259	-0.134526	3	0.044226	yes	CLNSGM
chr1_1277844_T_A_b38	ATAD3C	-3.041	0.0026	-0.131324	15	0.043185	yes	CLNSGM
chr1_1384256_T_G_b38	ATAD3C	3.04	0.00261	0.125045	3	0.041139	yes	CLNSGM
chr1_1173138_T_C_b38	ATAD3C	-3.036	0.00264	-0.129328	5	0.042595	yes	CLNSGM
chr1_1370532_C_T_b38	ATAD3C	-3.036	0.00264	-0.123056	5	0.040538	yes	CLNSGM
chr1_1363153_T_G_b38	ATAD3C	3.032	0.00267	0.148128	11	0.048857	yes	CLNSGM
chr1_1541864_T_C_b38	ATAD3C	-3.03	0.00269	-0.097538	36	0.032186	yes	CLNSGM
chr1_1551557_A_AG_b38	ATAD3C	-3.03	0.00269	-0.097538	36	0.032186	yes	CLNSGM
chr1_1551559_A_T_b38	ATAD3C	-3.03	0.00269	-0.097538	36	0.032186	yes	CLNSGM
chr1_1570294_CA_C_b38	ATAD3C	-3.03	0.00269	-0.091203	42	0.030103	yes	CLNSGM
chr1_1518541_T_C_b38	ATAD3C	-3.025	0.00273	-0.114197	17	0.037745	yes	CLNSGM
chr1_2007034_T_G_b38	ATAD3C	-3.02	0.00278	-0.124525	3	0.041234	yes	CLNSGM
chr1_1367462_T_C_b38	ATAD3C	-3.005	0.00291	-0.122445	5	0.040747	yes	CLNSGM
chr1_1175607_T_TC_b38	ATAD3C	-3.003	0.00293	-0.126831	5	0.042233	yes	CLNSGM
chr1_1174273_G_A_b38	ATAD3C	-3.002	0.00294	-0.129244	4	0.043056	yes	CLNSGM
chr1_1364282_T_G_b38	ATAD3C	-2.999	0.00297	-0.121501	5	0.040512	yes	CLNSGM
chr1_1364357_A_C_b38	ATAD3C	-2.999	0.00297	-0.121501	5	0.040512	yes	CLNSGM
chr1_1364694_T_C_b38	ATAD3C	-2.999	0.00297	-0.121501	5	0.040512	yes	CLNSGM
chr1_1364721_C_T_b38	ATAD3C	-2.999	0.00297	-0.121501	5	0.040512	yes	CLNSGM
chr1_1365160_A_G_b38	ATAD3C	-2.999	0.00297	-0.121501	5	0.040512	yes	CLNSGM
chr1_1365198_C_T_b38	ATAD3C	-2.999	0.00297	-0.121501	5	0.040512	yes	CLNSGM
chr1_1366008_A_G_b38	ATAD3C	-2.999	0.00297	-0.121501	5	0.040512	yes	CLNSGM
chr1_1366062_T_C_b38	ATAD3C	-2.999	0.00297	-0.121501	5	0.040512	yes	CLNSGM
chr1_1366145_TGTGAA_T_b38	ATAD3C	-2.999	0.00297	-0.121501	5	0.040512	yes	CLNSGM
chr1_1366187_A_AGT_b38	ATAD3C	-2.999	0.00297	-0.121501	5	0.040512	yes	CLNSGM
chr1_1366321_TGTGTGTAAATGG_T_b38	ATAD3C	-2.999	0.00297	-0.121501	5	0.040512	yes	CLNSGM
chr1_1366453_G_T_b38	ATAD3C	-2.999	0.00297	-0.121501	5	0.040512	yes	CLNSGM
chr1_1366726_T_G_b38	ATAD3C	-2.999	0.00297	-0.121501	5	0.040512	yes	CLNSGM
chr1_1367258_T_A_b38	ATAD3C	-2.999	0.00297	-0.121501	5	0.040512	yes	CLNSGM
chr1_1367297_GAA_G_b38	ATAD3C	-2.999	0.00297	-0.121501	5	0.040512	yes	CLNSGM
chr1_1367329_A_AGT_b38	ATAD3C	-2.999	0.00297	-0.121501	5	0.040512	yes	CLNSGM
chr1_1367373_T_TGTG_b38	ATAD3C	-2.999	0.00297	-0.121501	5	0.040512	yes	CLNSGM
chr1_1367388_T_TTGG_b38	ATAD3C	-2.999	0.00297	-0.121501	5	0.040512	yes	CLNSGM
chr1_1367593_G_A_b38	ATAD3C	-2.999	0.00297	-0.121501	5	0.040512	yes	CLNSGM
chr1_1367602_GT_G_b38	ATAD3C	-2.999	0.00297	-0.121501	5	0.040512	yes	CLNSGM
chr1_1367605_GAGTGAGTGTA_G_b38	ATAD3C	-2.999	0.00297	-0.121501	5	0.040512	yes	CLNSGM
chr1_1367670_GGTGA_G_b38	ATAD3C	-2.999	0.00297	-0.121501	5	0.040512	yes	CLNSGM
chr1_1367722_TTTTA_T_b38	ATAD3C	-2.999	0.00297	-0.121501	5	0.040512	yes	CLNSGM
chr1_1367874_A_T_b38	ATAD3C	-2.999	0.00297	-0.121501	5	0.040512	yes	CLNSGM
chr1_1367919_C_T_b38	ATAD3C	-2.999	0.00297	-0.121501	5	0.040512	yes	CLNSGM
chr1_1367951_C_T_b38	ATAD3C	-2.999	0.00297	-0.121501	5	0.040512	yes	CLNSGM
chr1_1367965_A_G_b38	ATAD3C	-2.999	0.00297	-0.121501	5	0.040512	yes	CLNSGM
chr1_1367970_T_G_b38	ATAD3C	-2.999	0.00297	-0.121501	5	0.040512	yes	CLNSGM
chr1_1367994_C_A_b38	ATAD3C	-2.999	0.00297	-0.121501	5	0.040512	yes	CLNSGM
chr1_1368297_C_T_b38	ATAD3C	-2.999	0.00297	-0.121501	5	0.040512	yes	CLNSGM
chr1_1368514_C_G_b38	ATAD3C	-2.999	0.00297	-0.121501	5	0.040512	yes	CLNSGM
chr1_1369282_G_A_b38	ATAD3C	-2.999	0.00297	-0.121501	5	0.040512	yes	CLNSGM
chr1_1369320_GT_G_b38	ATAD3C	-2.999	0.00297	-0.121501	5	0.040512	yes	CLNSGM
chr1_1369407_G_A_b38	ATAD3C	-2.999	0.00297	-0.121501	5	0.040512	yes	CLNSGM
chr1_1369476_CTT_C_b38	ATAD3C	-2.999	0.00297	-0.121501	5	0.040512	yes	CLNSGM
chr1_1369556_C_G_b38	ATAD3C	-2.999	0.00297	-0.121501	5	0.040512	yes	CLNSGM
chr1_1369627_T_C_b38	ATAD3C	-2.999	0.00297	-0.121501	5	0.040512	yes	CLNSGM
chr1_1369686_T_C_b38	ATAD3C	-2.999	0.00297	-0.121501	5	0.040512	yes	CLNSGM
chr1_1369716_G_C_b38	ATAD3C	-2.999	0.00297	-0.121501	5	0.040512	yes	CLNSGM
chr1_1369741_C_T_b38	ATAD3C	-2.999	0.00297	-0.121501	5	0.040512	yes	CLNSGM
chr1_1369821_C_T_b38	ATAD3C	-2.999	0.00297	-0.121501	5	0.040512	yes	CLNSGM
chr1_1370181_C_T_b38	ATAD3C	-2.999	0.00297	-0.121501	5	0.040512	yes	CLNSGM
chr1_1370317_G_C_b38	ATAD3C	-2.999	0.00297	-0.121501	5	0.040512	yes	CLNSGM
chr1_1370320_A_G_b38	ATAD3C	-2.999	0.00297	-0.121501	5	0.040512	yes	CLNSGM
chr1_1318756_G_A_b38	ATAD3C	2.997	0.00299	0.147704	14	0.049279	yes	CLNSGM
chr1_1319063_G_A_b38	ATAD3C	2.997	0.00299	0.147704	14	0.049279	yes	CLNSGM
chr1_1319461_C_G_b38	ATAD3C	2.997	0.00299	0.147704	14	0.049279	yes	CLNSGM
chr1_1320023_TG_T_b38	ATAD3C	2.997	0.00299	0.147704	14	0.049279	yes	CLNSGM
chr1_1410877_A_G_b38	ATAD3C	-2.994	0.00302	-0.146878	14	0.049062	yes	CLNSGM
chr1_1363438_C_CTT_b38	ATAD3C	2.993	0.00303	0.095028	21	0.031754	yes	CLNSGM
chr1_1366292_G_T_b38	ATAD3C	-2.987	0.00308	-0.121159	5	0.040559	yes	CLNSGM
chr1_1367280_T_A_b38	ATAD3C	-2.982	0.00313	-0.121192	5	0.040643	yes	CLNSGM
chr1_1118005_C_T_b38	ATAD3C	2.98	0.00315	0.082013	67	0.027519	yes	CLNSGM
chr1_1527386_C_T_b38	ATAD3C	-2.977	0.00318	-0.196747	7	0.066086	yes	CLNSGM
chr1_1367300_T_TGA_b38	ATAD3C	-2.971	0.00324	-0.123217	4	0.041472	yes	CLNSGM
chr1_1575421_C_T_b38	ATAD3C	-2.967	0.00329	-0.086638	42	0.029201	yes	CLNSGM
chr1_1549967_C_G_b38	ATAD3C	-2.962	0.00333	-0.088758	25	0.029962	yes	CLNSGM
chr1_1574445_A_G_b38	ATAD3C	-2.96	0.00336	-0.089861	41	0.030356	yes	CLNSGM
chr1_1410590_A_G_b38	ATAD3C	-2.958	0.00338	-0.135056	4	0.045658	yes	CLNSGM
chr1_1413898_T_C_b38	ATAD3C	-2.958	0.00338	-0.135056	4	0.045658	yes	CLNSGM
chr1_1251285_G_A_b38	ATAD3C	-2.956	0.0034	-0.118411	7	0.040061	yes	CLNSGM
chr1_1369009_T_C_b38	ATAD3C	-2.947	0.0035	-0.121216	5	0.041132	yes	CLNSGM
chr1_1369012_C_CG_b38	ATAD3C	-2.942	0.00355	-0.12109	5	0.041153	yes	CLNSGM
chr1_1370430_T_C_b38	ATAD3C	-2.942	0.00355	-0.120157	5	0.040839	yes	CLNSGM
chr1_1370584_G_C_b38	ATAD3C	-2.942	0.00355	-0.120157	5	0.040839	yes	CLNSGM
chr1_1327764_G_A_b38	ATAD3C	2.941	0.00357	0.13973	3	0.047516	yes	CLNSGM
chr1_1577491_A_AC_b38	ATAD3C	-2.939	0.00359	-0.088975	42	0.030278	yes	CLNSGM
chr1_1367511_ATGAG_A_b38	ATAD3C	-2.938	0.0036	-0.12155	4	0.04137	yes	CLNSGM
chr1_1174639_A_G_b38	ATAD3C	-2.925	0.00375	-0.121507	6	0.041543	yes	CLNSGM
chr1_1124795_T_C_b38	ATAD3C	2.92	0.00381	0.081301	74	0.027844	yes	CLNSGM
chr1_1368991_C_T_b38	ATAD3C	-2.917	0.00384	-0.119816	5	0.041072	yes	CLNSGM
chr1_1369803_C_CT_b38	ATAD3C	-2.915	0.00386	-0.110664	5	0.037959	yes	CLNSGM
chr1_1408286_G_A_b38	ATAD3C	-2.902	0.00402	-0.134861	3	0.046465	yes	CLNSGM
chr1_1565105_CAAGGCAGGCGGATCATG_C_b38	ATAD3C	-2.898	0.00407	-0.086918	45	0.029992	yes	CLNSGM
chr1_1367028_A_G_b38	ATAD3C	2.896	0.0041	0.115497	8	0.039886	yes	CLNSGM
chr1_1327211_C_T_b38	ATAD3C	2.894	0.00412	0.140181	12	0.048436	yes	CLNSGM
chr1_1327982_G_A_b38	ATAD3C	2.894	0.00412	0.140181	12	0.048436	yes	CLNSGM
chr1_1330080_T_C_b38	ATAD3C	2.894	0.00412	0.140181	12	0.048436	yes	CLNSGM
chr1_1363880_A_G_b38	ATAD3C	-2.894	0.00413	-0.115848	5	0.040037	yes	CLNSGM
chr1_1357046_C_G_b38	ATAD3C	2.882	0.00428	0.141973	12	0.049259	yes	CLNSGM
chr1_1357369_C_T_b38	ATAD3C	2.882	0.00428	0.141973	12	0.049259	yes	CLNSGM
chr1_1358907_C_A_b38	ATAD3C	2.882	0.00428	0.141973	12	0.049259	yes	CLNSGM
chr1_1359943_G_A_b38	ATAD3C	2.882	0.00428	0.141973	12	0.049259	yes	CLNSGM
chr1_1360023_T_C_b38	ATAD3C	2.882	0.00428	0.141973	12	0.049259	yes	CLNSGM
chr1_1409306_A_G_b38	ATAD3C	-2.881	0.0043	-0.132725	3	0.046077	yes	CLNSGM
chr1_1530002_A_G_b38	ATAD3C	-2.879	0.00432	-0.187211	9	0.065032	yes	CLNSGM
chr1_1533018_T_C_b38	ATAD3C	-2.879	0.00432	-0.187211	9	0.065032	yes	CLNSGM
chr1_1274972_A_G_b38	ATAD3C	-2.863	0.00454	-0.123043	16	0.042981	yes	CLNSGM
chr1_1275091_T_C_b38	ATAD3C	-2.863	0.00454	-0.123043	16	0.042981	yes	CLNSGM
chr1_1277269_T_C_b38	ATAD3C	-2.863	0.00454	-0.123043	16	0.042981	yes	CLNSGM
chr1_1282706_C_T_b38	ATAD3C	-2.863	0.00454	-0.123043	16	0.042981	yes	CLNSGM
chr1_1415011_A_G_b38	ATAD3C	-2.857	0.00462	-0.130513	4	0.045683	yes	CLNSGM
chr1_2401220_TCC_T_b38	ATAD3C	-2.842	0.00484	-0.079576	49	0.028001	yes	CLNSGM
chr1_1173996_G_A_b38	ATAD3C	-2.834	0.00495	-0.128177	5	0.045226	yes	CLNSGM
chr1_1557495_CAT_C_b38	ATAD3C	-2.831	0.00501	-0.088999	37	0.031443	yes	CLNSGM
chr1_1558726_C_CA_b38	ATAD3C	-2.822	0.00514	-0.08907	37	0.031562	yes	CLNSGM
chr1_1561821_A_C_b38	ATAD3C	-2.822	0.00514	-0.08907	37	0.031562	yes	CLNSGM
chr1_1548572_A_AC_b38	ATAD3C	-2.821	0.00515	-0.183332	4	0.064981	yes	CLNSGM
chr1_1566086_G_A_b38	ATAD3C	-2.814	0.00526	-0.084317	45	0.029962	yes	CLNSGM
chr1_1322866_A_C_b38	ATAD3C	2.814	0.00527	0.135321	12	0.048095	yes	CLNSGM
chr1_2008008_CA_C_b38	ATAD3C	-2.812	0.00529	-0.109892	3	0.039076	yes	CLNSGM
chr1_1283472_G_T_b38	ATAD3C	-2.812	0.00529	-0.159694	3	0.056786	yes	CLNSGM
chr1_1283510_G_C_b38	ATAD3C	-2.812	0.00529	-0.159694	3	0.056786	yes	CLNSGM
chr1_1409623_T_C_b38	ATAD3C	-2.807	0.00538	-0.12755	4	0.045442	yes	CLNSGM
chr1_1240648_T_TCATTCACCCCGGCCGTGGTCCCTGCCCCAGCCCCCGCCGCCCC_b38	ATAD3C	2.805	0.00541	0.062354	50	0.022229	yes	CLNSGM
chr1_1278407_T_TA_b38	ATAD3C	-2.801	0.00548	-0.120102	16	0.042883	yes	CLNSGM
chr1_1585973_T_TAATAATAATAATAATAATAATAAA_b38	ATAD3C	2.8	0.00549	0.107988	13	0.038566	yes	CLNSGM
chr1_1251368_T_C_b38	ATAD3C	-2.799	0.00551	-0.114134	6	0.040776	yes	CLNSGM
chr1_1296939_G_A_b38	ATAD3C	-2.795	0.00557	-0.128934	15	0.046124	yes	CLNSGM
chr1_1543953_A_G_b38	ATAD3C	-2.792	0.00563	-0.087954	36	0.031504	yes	CLNSGM
chr1_1550064_GC_G_b38	ATAD3C	-2.785	0.00574	-0.087385	36	0.031373	yes	CLNSGM
chr1_1550068_C_A_b38	ATAD3C	-2.785	0.00574	-0.087385	36	0.031373	yes	CLNSGM
chr1_2394570_G_A_b38	ATAD3C	-2.769	0.00603	-0.074049	59	0.026743	yes	CLNSGM
chr1_1537160_T_G_b38	ATAD3C	-2.766	0.00608	-0.078989	52	0.028558	yes	CLNSGM
chr1_1281631_A_C_b38	ATAD3C	-2.761	0.00617	-0.124871	6	0.045224	yes	CLNSGM
chr1_1246371_T_C_b38	ATAD3C	-2.759	0.00621	-0.119221	6	0.043216	yes	CLNSGM
chr1_1538787_A_G_b38	ATAD3C	-2.758	0.00622	-0.083291	44	0.030194	yes	CLNSGM
chr1_1290261_C_A_b38	ATAD3C	-2.748	0.00642	-0.107726	16	0.039203	yes	CLNSGM
chr1_1542773_T_C_b38	ATAD3C	-2.747	0.00642	-0.086939	36	0.031643	yes	CLNSGM
chr1_1542793_C_G_b38	ATAD3C	-2.747	0.00642	-0.086939	36	0.031643	yes	CLNSGM
chr1_1542800_T_C_b38	ATAD3C	-2.747	0.00642	-0.086939	36	0.031643	yes	CLNSGM
chr1_1481959_C_T_b38	ATAD3C	-2.746	0.00645	-0.11669	13	0.042498	yes	CLNSGM
chr1_1324134_G_GGCTGGGGGGCTGGGAGGCTGAGAGGCTGGGGAGCTGGGGA_b38	ATAD3C	2.742	0.00652	0.191878	4	0.06997	yes	CLNSGM
chr1_2010191_G_C_b38	ATAD3C	-2.73	0.00675	-0.111566	3	0.040861	yes	CLNSGM
chr1_2398751_T_G_b38	ATAD3C	-2.723	0.00691	-0.072156	59	0.026502	yes	CLNSGM
chr1_1589618_A_T_b38	ATAD3C	2.722	0.00692	0.084325	28	0.030975	yes	CLNSGM
chr1_1573654_T_C_b38	ATAD3C	-2.715	0.00708	-0.081601	41	0.030061	yes	CLNSGM
chr1_1279694_A_G_b38	ATAD3C	-2.713	0.00711	-0.117445	10	0.043294	yes	CLNSGM
chr1_1279698_A_G_b38	ATAD3C	-2.713	0.00711	-0.117445	10	0.043294	yes	CLNSGM
chr1_1279728_TG_T_b38	ATAD3C	-2.713	0.00711	-0.117445	10	0.043294	yes	CLNSGM
chr1_1575724_G_C_b38	ATAD3C	-2.707	0.00723	-0.080848	41	0.029863	yes	CLNSGM
chr1_2401227_C_CCCT_b38	ATAD3C	-2.701	0.00735	-0.076008	48	0.028136	yes	CLNSGM
chr1_1303959_T_G_b38	ATAD3C	2.696	0.00746	0.12617	15	0.046791	yes	CLNSGM
chr1_2008632_C_T_b38	ATAD3C	-2.696	0.00747	-0.106663	3	0.039563	yes	CLNSGM
chr1_2008948_G_C_b38	ATAD3C	-2.696	0.00747	-0.106663	3	0.039563	yes	CLNSGM
chr1_814617_A_G_b38	ATAD3C	-2.693	0.00753	-0.078227	33	0.029043	yes	CLNSGM
chr1_1174578_A_G_b38	ATAD3C	-2.692	0.00757	-0.116111	4	0.043137	yes	CLNSGM
chr1_2296236_A_C_b38	ATAD3C	2.684	0.00774	0.137464	3	0.051218	yes	CLNSGM
chr1_1174523_C_T_b38	ATAD3C	-2.684	0.00774	-0.121499	5	0.04527	yes	CLNSGM
chr1_1365036_T_TAA_b38	ATAD3C	-2.666	0.00816	-0.115632	3	0.04338	yes	CLNSGM
chr1_1415976_G_A_b38	ATAD3C	-2.663	0.00823	-0.126094	10	0.047358	yes	CLNSGM
chr1_1251618_G_A_b38	ATAD3C	-2.662	0.00824	-0.107621	6	0.040426	yes	CLNSGM
chr1_2395373_A_G_b38	ATAD3C	-2.656	0.00839	-0.070471	60	0.026531	yes	CLNSGM
chr1_2008387_C_T_b38	ATAD3C	-2.637	0.00886	-0.103735	3	0.039336	yes	CLNSGM
chr1_1174747_C_T_b38	ATAD3C	-2.636	0.00889	-0.119735	5	0.045425	yes	CLNSGM
chr1_1177430_G_T_b38	ATAD3C	-2.636	0.00889	-0.119735	5	0.045425	yes	CLNSGM
chr1_1178014_C_T_b38	ATAD3C	-2.636	0.00889	-0.119735	5	0.045425	yes	CLNSGM
chr1_1179288_G_A_b38	ATAD3C	-2.636	0.00889	-0.119735	5	0.045425	yes	CLNSGM
chr1_1523187_A_G_b38	ATAD3C	-2.635	0.00892	-0.165928	10	0.062976	yes	CLNSGM
chr1_1470034_T_C_b38	ATAD3C	-2.631	0.00901	-0.12558	14	0.047724	yes	CLNSGM
chr1_1471144_G_C_b38	ATAD3C	-2.631	0.00901	-0.12558	14	0.047724	yes	CLNSGM
chr1_1281640_G_C_b38	ATAD3C	-2.628	0.00909	-0.120853	3	0.045981	yes	CLNSGM
chr1_1281878_G_C_b38	ATAD3C	-2.628	0.00909	-0.120853	3	0.045981	yes	CLNSGM
chr1_1612560_G_GT_b38	ATAD3C	2.622	0.00926	0.075662	37	0.028861	yes	CLNSGM
chr1_1385919_A_AG_b38	ATAD3C	2.618	0.00937	0.122737	9	0.046888	yes	CLNSGM
chr1_2224423_G_A_b38	ATAD3C	-2.606	0.00968	-0.120559	3	0.046261	yes	CLNSGM
chr1_1569661_T_C_b38	ATAD3C	-2.602	0.00981	-0.075731	43	0.029109	yes	CLNSGM
chr1_1573079_A_G_b38	ATAD3C	-2.599	0.00988	-0.07704	45	0.029644	yes	CLNSGM
chr1_1497606_C_G_b38	ATAD3C	-3.887	0.000129	-0.133296	12	0.034292	no	CLNSGM
chr1_1468094_G_C_b38	ATAD3C	-3.531	0.000489	-0.171349	7	0.048527	no	CLNSGM
chr1_1362780_CAAA_C_b38	ATAD3C	3.311	0.00106	0.14311	3	0.043217	no	CLNSGM
chr1_814583_T_TAA_b38	ATAD3C	-3.18	0.00165	-0.10839	14	0.034081	no	CLNSGM
chr1_1324173_G_GGGCTCGGGGGCTGGGGGGCTGCTGGGCTGAGA_b38	ATAD3C	3.137	0.0019	0.071704	26	0.022861	no	CLNSGM
chr1_1437955_C_G_b38	ATAD3C	-3.085	0.00226	-0.092076	22	0.02985	no	CLNSGM
chr1_1326444_G_C_b38	ATAD3C	3.058	0.00246	0.144303	3	0.047189	no	CLNSGM
chr1_1351747_G_A_b38	ATAD3C	3.05	0.00252	0.146372	3	0.047988	no	CLNSGM
chr1_1363031_C_T_b38	ATAD3C	3.01	0.00286	0.146174	3	0.048558	no	CLNSGM
chr1_1308178_GGGGCGCGGGGA_G_b38	ATAD3C	-3.005	0.00292	-0.10982	9	0.036549	no	CLNSGM
chr1_1363157_C_T_b38	ATAD3C	2.971	0.00325	0.143799	3	0.048405	no	CLNSGM
chr1_1325753_G_T_b38	ATAD3C	-2.964	0.00331	-0.1312	4	0.044257	no	CLNSGM
chr1_1362042_C_T_b38	ATAD3C	2.962	0.00334	0.143377	3	0.048407	no	CLNSGM
chr1_1362790_A_ATT_b38	ATAD3C	2.961	0.00334	0.127652	3	0.043107	no	CLNSGM
chr1_1361833_G_C_b38	ATAD3C	2.915	0.00386	0.114138	8	0.039149	no	CLNSGM
chr1_2005768_G_A_b38	ATAD3C	-2.912	0.0039	-0.11408	4	0.039174	no	CLNSGM
chr1_2006475_G_A_b38	ATAD3C	-2.912	0.0039	-0.11408	4	0.039174	no	CLNSGM
chr1_1352542_G_A_b38	ATAD3C	2.906	0.00398	0.140243	3	0.048266	no	CLNSGM
chr1_1360302_A_G_b38	ATAD3C	2.887	0.00421	0.139584	3	0.048345	no	CLNSGM
chr1_1360989_GAC_G_b38	ATAD3C	2.887	0.00421	0.139584	3	0.048345	no	CLNSGM
chr1_1999114_T_C_b38	ATAD3C	-2.887	0.00421	-0.114719	5	0.039736	no	CLNSGM
chr1_1338970_A_G_b38	ATAD3C	2.879	0.00431	0.13678	3	0.047505	no	CLNSGM
chr1_1344634_A_G_b38	ATAD3C	2.879	0.00431	0.13678	3	0.047505	no	CLNSGM
chr1_1345965_C_T_b38	ATAD3C	2.879	0.00431	0.13678	3	0.047505	no	CLNSGM
chr1_2401252_T_TCC_b38	ATAD3C	-2.87	0.00443	-0.078365	54	0.027301	no	CLNSGM
chr1_2003927_G_C_b38	ATAD3C	-2.804	0.00542	-0.103322	7	0.036845	no	CLNSGM
chr1_1480224_A_G_b38	ATAD3C	-2.765	0.0061	-0.155137	5	0.056111	no	CLNSGM
chr1_813885_G_A_b38	ATAD3C	-2.764	0.00611	-0.076651	68	0.027727	no	CLNSGM
chr1_598934_CG_C_b38	ATAD3C	2.755	0.00628	0.114121	4	0.041425	no	CLNSGM
chr1_1353987_CTG_C_b38	ATAD3C	2.741	0.00654	0.133274	3	0.048615	no	CLNSGM
chr1_1354531_G_A_b38	ATAD3C	2.741	0.00654	0.133274	3	0.048615	no	CLNSGM
chr1_1999860_A_T_b38	ATAD3C	-2.739	0.00659	-0.106786	5	0.038992	no	CLNSGM
chr1_1533855_G_A_b38	ATAD3C	-2.734	0.00668	-0.116655	3	0.042668	no	CLNSGM
chr1_1341098_T_G_b38	ATAD3C	2.716	0.00704	0.127157	3	0.046815	no	CLNSGM
chr1_2000742_G_C_b38	ATAD3C	-2.699	0.00741	-0.104687	5	0.038792	no	CLNSGM
chr1_1353203_C_G_b38	ATAD3C	2.632	0.009	0.12674	3	0.048161	no	CLNSGM
chr1_2003636_G_C_b38	ATAD3C	-2.625	0.00917	-0.102196	5	0.03893	no	CLNSGM
chr1_1241639_T_C_b38	ATAD3C	-2.623	0.00922	-0.115608	4	0.044071	no	CLNSGM
chr1_2004049_G_C_b38	ATAD3C	-2.596	0.00995	-0.095843	7	0.036915	no	CLNSGM
chr1_2004070_T_C_b38	ATAD3C	-2.596	0.00995	-0.095843	7	0.036915	no	CLNSGM
chr1_1440834_C_G_b38	ATAD3C	-7.457	9.76e-13	-0.157647	46	0.02114	yes	CLNTRN
chr1_1440430_C_G_b38	ATAD3C	-7.432	1.15e-12	-0.160595	28	0.02161	yes	CLNTRN
chr1_1445187_T_G_b38	ATAD3C	-7.265	3.31e-12	-0.152703	43	0.02102	yes	CLNTRN
chr1_1443457_T_C_b38	ATAD3C	-7.259	3.42e-12	-0.153875	48	0.021197	yes	CLNTRN
chr1_1441187_A_G_b38	ATAD3C	-7.136	7.39e-12	-0.158115	31	0.022157	yes	CLNTRN
chr1_1445240_A_G_b38	ATAD3C	-6.76	7.31e-11	-0.144558	48	0.021384	yes	CLNTRN
chr1_1439454_A_G_b38	ATAD3C	-6.501	3.37e-10	-0.13871	45	0.021336	yes	CLNTRN
chr1_1436079_A_G_b38	ATAD3C	-5.923	8.72e-09	-0.123363	51	0.020827	yes	CLNTRN
chr1_1378204_G_C_b38	ATAD3C	5.916	9.07e-09	0.142319	33	0.024057	yes	CLNTRN
chr1_1433374_T_C_b38	ATAD3C	-5.669	3.4e-08	-0.119096	53	0.021009	yes	CLNTRN
chr1_1436388_CA_C_b38	ATAD3C	-5.658	3.61e-08	-0.125357	31	0.022157	yes	CLNTRN
chr1_1376162_G_C_b38	ATAD3C	5.643	3.89e-08	0.139216	34	0.024669	yes	CLNTRN
chr1_1377431_C_T_b38	ATAD3C	5.643	3.89e-08	0.139216	34	0.024669	yes	CLNTRN
chr1_1384749_C_G_b38	ATAD3C	5.631	4.15e-08	0.139302	34	0.024739	yes	CLNTRN
chr1_1387763_CCT_C_b38	ATAD3C	5.631	4.15e-08	0.139302	34	0.024739	yes	CLNTRN
chr1_1388944_G_A_b38	ATAD3C	5.631	4.15e-08	0.139302	34	0.024739	yes	CLNTRN
chr1_1394423_A_G_b38	ATAD3C	-5.465	9.82e-08	-0.138645	46	0.025371	yes	CLNTRN
chr1_1387698_A_G_b38	ATAD3C	5.453	1.05e-07	0.138614	46	0.025421	yes	CLNTRN
chr1_1389827_C_T_b38	ATAD3C	5.453	1.05e-07	0.138614	46	0.025421	yes	CLNTRN
chr1_1449009_A_T_b38	ATAD3C	-5.365	1.63e-07	-0.127208	30	0.023712	yes	CLNTRN
chr1_1395346_A_G_b38	ATAD3C	-5.363	1.65e-07	-0.136859	46	0.025518	yes	CLNTRN
chr1_1402457_A_G_b38	ATAD3C	-5.363	1.65e-07	-0.136859	46	0.025518	yes	CLNTRN
chr1_1400410_A_G_b38	ATAD3C	-5.342	1.83e-07	-0.133319	34	0.024958	yes	CLNTRN
chr1_1430908_A_G_b38	ATAD3C	-5.306	2.2e-07	-0.114075	49	0.021501	yes	CLNTRN
chr1_1442793_G_A_b38	ATAD3C	-5.271	2.62e-07	-0.135521	10	0.025712	yes	CLNTRN
chr1_1428969_T_C_b38	ATAD3C	-5.216	3.43e-07	-0.112647	49	0.021596	yes	CLNTRN
chr1_1430190_A_C_b38	ATAD3C	-5.216	3.43e-07	-0.112647	49	0.021596	yes	CLNTRN
chr1_1358384_G_C_b38	ATAD3C	5.189	3.93e-07	0.130422	46	0.025135	yes	CLNTRN
chr1_1330125_G_A_b38	ATAD3C	5.188	3.95e-07	0.130081	46	0.025075	yes	CLNTRN
chr1_1431537_G_C_b38	ATAD3C	-5.173	4.25e-07	-0.111978	49	0.021647	yes	CLNTRN
chr1_1366561_AGT_A_b38	ATAD3C	5.168	4.35e-07	0.129727	46	0.025102	yes	CLNTRN
chr1_1426261_C_T_b38	ATAD3C	-5.131	5.21e-07	-0.110419	48	0.021519	yes	CLNTRN
chr1_1426810_C_G_b38	ATAD3C	-5.131	5.21e-07	-0.110419	48	0.021519	yes	CLNTRN
chr1_1452511_A_G_b38	ATAD3C	-5.131	5.22e-07	-0.117188	43	0.02284	yes	CLNTRN
chr1_1452888_C_A_b38	ATAD3C	-5.131	5.22e-07	-0.117188	43	0.02284	yes	CLNTRN
chr1_1452909_A_C_b38	ATAD3C	-5.131	5.22e-07	-0.117188	43	0.02284	yes	CLNTRN
chr1_1431450_A_G_b38	ATAD3C	-5.117	5.57e-07	-0.110647	49	0.021621	yes	CLNTRN
chr1_1432355_G_A_b38	ATAD3C	-5.108	5.83e-07	-0.125804	15	0.024628	yes	CLNTRN
chr1_1453703_A_G_b38	ATAD3C	-5.094	6.25e-07	-0.116453	43	0.022862	yes	CLNTRN
chr1_1454092_A_G_b38	ATAD3C	-5.094	6.25e-07	-0.116453	43	0.022862	yes	CLNTRN
chr1_1454770_T_C_b38	ATAD3C	-5.074	6.87e-07	-0.115815	43	0.022824	yes	CLNTRN
chr1_1455617_T_G_b38	ATAD3C	-5.074	6.87e-07	-0.115815	43	0.022824	yes	CLNTRN
chr1_1411323_A_C_b38	ATAD3C	-5.061	7.33e-07	-0.129009	46	0.025492	yes	CLNTRN
chr1_1471992_T_C_b38	ATAD3C	-5.022	8.84e-07	-0.114568	49	0.022814	yes	CLNTRN
chr1_1361679_G_A_b38	ATAD3C	4.937	1.32e-06	0.122942	29	0.024902	yes	CLNTRN
chr1_1366427_AGTGTGATTGAATGAGT_A_b38	ATAD3C	4.85	2e-06	0.122385	31	0.025237	yes	CLNTRN
chr1_1308516_C_T_b38	ATAD3C	4.826	2.23e-06	0.116701	52	0.02418	yes	CLNTRN
chr1_1454315_C_T_b38	ATAD3C	-4.695	4.08e-06	-0.108021	39	0.023007	yes	CLNTRN
chr1_1451787_A_C_b38	ATAD3C	-4.681	4.35e-06	-0.105455	34	0.02253	yes	CLNTRN
chr1_1290261_C_A_b38	ATAD3C	-4.626	5.56e-06	-0.125126	26	0.027046	yes	CLNTRN
chr1_1439805_G_C_b38	ATAD3C	-4.565	7.31e-06	-0.110489	17	0.024202	yes	CLNTRN
chr1_1367292_A_AGT_b38	ATAD3C	4.494	1e-05	0.116911	12	0.026015	yes	CLNTRN
chr1_1370113_A_G_b38	ATAD3C	4.493	1.01e-05	0.106908	32	0.023793	yes	CLNTRN
chr1_1363898_C_T_b38	ATAD3C	4.425	1.36e-05	0.115723	12	0.026152	yes	CLNTRN
chr1_1366529_TTAG_T_b38	ATAD3C	4.425	1.36e-05	0.115723	12	0.026152	yes	CLNTRN
chr1_1379091_T_G_b38	ATAD3C	4.405	1.48e-05	0.118547	13	0.026909	yes	CLNTRN
chr1_1453552_G_A_b38	ATAD3C	-4.353	1.85e-05	-0.102938	18	0.023646	yes	CLNTRN
chr1_1455134_T_G_b38	ATAD3C	-4.353	1.85e-05	-0.102938	18	0.023646	yes	CLNTRN
chr1_1455337_A_G_b38	ATAD3C	-4.353	1.85e-05	-0.102938	18	0.023646	yes	CLNTRN
chr1_1455495_C_T_b38	ATAD3C	-4.353	1.85e-05	-0.102938	18	0.023646	yes	CLNTRN
chr1_1365566_G_A_b38	ATAD3C	4.321	2.12e-05	0.112564	12	0.026048	yes	CLNTRN
chr1_1431014_G_A_b38	ATAD3C	-4.282	2.5e-05	-0.094351	28	0.022034	yes	CLNTRN
chr1_1454848_T_C_b38	ATAD3C	-4.281	2.52e-05	-0.100402	20	0.023455	yes	CLNTRN
chr1_1479719_T_C_b38	ATAD3C	-4.264	2.7e-05	-0.09863	54	0.023131	yes	CLNTRN
chr1_1259424_T_C_b38	ATAD3C	-4.22	3.25e-05	-0.102973	48	0.024401	yes	CLNTRN
chr1_1457033_A_C_b38	ATAD3C	-4.201	3.53e-05	-0.099046	18	0.023579	yes	CLNTRN
chr1_1374505_A_G_b38	ATAD3C	-4.151	4.34e-05	-0.121953	8	0.029382	yes	CLNTRN
chr1_1375642_C_T_b38	ATAD3C	-4.131	4.71e-05	-0.121793	8	0.029485	yes	CLNTRN
chr1_1431026_CCACCCCCT_C_b38	ATAD3C	-4.076	5.88e-05	-0.095989	25	0.023548	yes	CLNTRN
chr1_1337898_A_G_b38	ATAD3C	4.014	7.57e-05	0.101038	9	0.025173	yes	CLNTRN
chr1_1379083_AT_A_b38	ATAD3C	4.001	7.98e-05	0.10319	13	0.025793	yes	CLNTRN
chr1_1431813_G_T_b38	ATAD3C	-3.978	8.74e-05	-0.104208	10	0.026197	yes	CLNTRN
chr1_1221049_C_G_b38	ATAD3C	-3.958	9.47e-05	-0.087735	51	0.022168	yes	CLNTRN
chr1_1456182_G_A_b38	ATAD3C	-3.943	0.000101	-0.095862	17	0.024313	yes	CLNTRN
chr1_1379093_TG_T_b38	ATAD3C	-3.94	0.000102	-0.132215	3	0.033559	yes	CLNTRN
chr1_1453643_A_ATT_b38	ATAD3C	-3.925	0.000108	-0.093303	27	0.023768	yes	CLNTRN
chr1_1388565_GTC_G_b38	ATAD3C	3.914	0.000113	0.09218	19	0.023553	yes	CLNTRN
chr1_1456829_G_C_b38	ATAD3C	-3.901	0.000119	-0.099202	27	0.025431	yes	CLNTRN
chr1_1457071_C_T_b38	ATAD3C	-3.857	0.000141	-0.091321	19	0.023679	yes	CLNTRN
chr1_1426253_G_A_b38	ATAD3C	-3.848	0.000146	-0.108759	7	0.028266	yes	CLNTRN
chr1_689819_C_T_b38	ATAD3C	3.833	0.000154	0.133668	3	0.034871	yes	CLNTRN
chr1_1380867_A_G_b38	ATAD3C	-3.78	0.000189	-0.122806	5	0.032487	yes	CLNTRN
chr1_1382893_G_A_b38	ATAD3C	-3.754	0.00021	-0.116221	7	0.030961	yes	CLNTRN
chr1_1519934_T_G_b38	ATAD3C	-3.675	0.000283	-0.07985	61	0.02173	yes	CLNTRN
chr1_1519938_T_C_b38	ATAD3C	-3.675	0.000283	-0.07985	61	0.02173	yes	CLNTRN
chr1_1394041_G_A_b38	ATAD3C	-3.665	0.000292	-0.125915	3	0.034352	yes	CLNTRN
chr1_1383743_T_C_b38	ATAD3C	-3.653	0.000306	-0.113003	7	0.030933	yes	CLNTRN
chr1_1369803_C_CT_b38	ATAD3C	-3.625	0.000339	-0.097807	6	0.026979	yes	CLNTRN
chr1_1238902_T_C_b38	ATAD3C	-3.602	0.00037	-0.080298	53	0.022291	yes	CLNTRN
chr1_1517993_A_G_b38	ATAD3C	-3.573	0.000412	-0.077648	61	0.021735	yes	CLNTRN
chr1_1398218_C_A_b38	ATAD3C	-3.545	0.000456	-0.110678	7	0.031224	yes	CLNTRN
chr1_1400756_GGA_G_b38	ATAD3C	-3.545	0.000456	-0.110678	7	0.031224	yes	CLNTRN
chr1_1401954_G_T_b38	ATAD3C	-3.545	0.000456	-0.110678	7	0.031224	yes	CLNTRN
chr1_1403593_A_G_b38	ATAD3C	-3.545	0.000456	-0.110678	7	0.031224	yes	CLNTRN
chr1_1292284_TTGAG_T_b38	ATAD3C	-3.498	0.000541	-0.105203	16	0.030075	yes	CLNTRN
chr1_1325753_G_T_b38	ATAD3C	-3.497	0.000542	-0.114255	3	0.032672	yes	CLNTRN
chr1_1497605_G_C_b38	ATAD3C	-3.463	0.000613	-0.072915	42	0.021055	yes	CLNTRN
chr1_1384546_C_T_b38	ATAD3C	-3.461	0.000616	-0.114084	5	0.032959	yes	CLNTRN
chr1_1366941_T_TGTGTGCA_b38	ATAD3C	3.387	0.000801	0.112432	3	0.033192	yes	CLNTRN
chr1_1366951_A_AGT_b38	ATAD3C	3.387	0.000801	0.112432	3	0.033192	yes	CLNTRN
chr1_1541864_T_C_b38	ATAD3C	-3.372	0.000846	-0.072588	57	0.021528	yes	CLNTRN
chr1_1551557_A_AG_b38	ATAD3C	-3.372	0.000846	-0.072588	57	0.021528	yes	CLNTRN
chr1_1551559_A_T_b38	ATAD3C	-3.372	0.000846	-0.072588	57	0.021528	yes	CLNTRN
chr1_1303800_G_A_b38	ATAD3C	-3.347	0.000921	-0.109481	3	0.032706	yes	CLNTRN
chr1_1558726_C_CA_b38	ATAD3C	-3.323	0.001	-0.071113	58	0.021401	yes	CLNTRN
chr1_1561821_A_C_b38	ATAD3C	-3.323	0.001	-0.071113	58	0.021401	yes	CLNTRN
chr1_1280044_T_C_b38	ATAD3C	-3.254	0.00127	-0.072957	59	0.022424	yes	CLNTRN
chr1_1443673_CTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT_C_b38	ATAD3C	-3.238	0.00134	-0.154811	3	0.047803	yes	CLNTRN
chr1_1187904_CA_C_b38	ATAD3C	3.227	0.00139	0.081119	10	0.025135	yes	CLNTRN
chr1_1550064_GC_G_b38	ATAD3C	-3.214	0.00146	-0.068123	55	0.021198	yes	CLNTRN
chr1_1550068_C_A_b38	ATAD3C	-3.214	0.00146	-0.068123	55	0.021198	yes	CLNTRN
chr1_1543953_A_G_b38	ATAD3C	-3.198	0.00154	-0.068143	55	0.021311	yes	CLNTRN
chr1_1557495_CAT_C_b38	ATAD3C	-3.188	0.00159	-0.068321	58	0.021433	yes	CLNTRN
chr1_1542773_T_C_b38	ATAD3C	-3.186	0.0016	-0.067835	55	0.021295	yes	CLNTRN
chr1_1542793_C_G_b38	ATAD3C	-3.186	0.0016	-0.067835	55	0.021295	yes	CLNTRN
chr1_1542800_T_C_b38	ATAD3C	-3.186	0.0016	-0.067835	55	0.021295	yes	CLNTRN
chr1_1407565_C_A_b38	ATAD3C	-3.181	0.00162	-0.10706	5	0.033654	yes	CLNTRN
chr1_1566854_CA_C_b38	ATAD3C	-3.169	0.00169	-0.075459	36	0.023814	yes	CLNTRN
chr1_1543500_T_G_b38	ATAD3C	-3.162	0.00173	-0.066578	55	0.021058	yes	CLNTRN
chr1_1193652_A_G_b38	ATAD3C	-3.065	0.00238	-0.107309	3	0.035009	yes	CLNTRN
chr1_1570294_CA_C_b38	ATAD3C	-3.032	0.00264	-0.06451	59	0.021277	yes	CLNTRN
chr1_1574032_AAAG_A_b38	ATAD3C	-3.03	0.00266	-0.069536	34	0.022951	yes	CLNTRN
chr1_1573654_T_C_b38	ATAD3C	-2.979	0.00313	-0.064115	57	0.021525	yes	CLNTRN
chr1_1574445_A_G_b38	ATAD3C	-2.979	0.00313	-0.064115	57	0.021525	yes	CLNTRN
chr1_1545795_C_A_b38	ATAD3C	-2.911	0.00388	-0.061318	47	0.021065	yes	CLNTRN
chr1_1575421_C_T_b38	ATAD3C	-2.891	0.00413	-0.060711	56	0.021002	yes	CLNTRN
chr1_1589418_T_TA_b38	ATAD3C	-2.88	0.00426	-0.058312	53	0.020245	yes	CLNTRN
chr1_1558204_T_TAAAAAA_b38	ATAD3C	-2.872	0.00437	-0.064287	29	0.022383	yes	CLNTRN
chr1_1367028_A_G_b38	ATAD3C	2.834	0.00492	0.084232	9	0.029726	yes	CLNTRN
chr1_1565105_CAAGGCAGGCGGATCATG_C_b38	ATAD3C	-2.819	0.00514	-0.058122	65	0.020617	yes	CLNTRN
chr1_1230159_G_A_b38	ATAD3C	-2.816	0.00519	-0.067108	27	0.023834	yes	CLNTRN
chr1_1474819_G_C_b38	ATAD3C	-2.815	0.0052	-0.115582	5	0.041059	yes	CLNTRN
chr1_1575724_G_C_b38	ATAD3C	-2.811	0.00526	-0.059882	55	0.0213	yes	CLNTRN
chr1_1208071_A_G_b38	ATAD3C	-2.802	0.00541	-0.095664	3	0.034142	yes	CLNTRN
chr1_1388583_CTA_C_b38	ATAD3C	-2.778	0.00582	-0.090573	4	0.032603	yes	CLNTRN
chr1_1236037_C_T_b38	ATAD3C	-2.734	0.00664	-0.054963	62	0.020105	yes	CLNTRN
chr1_1538787_A_G_b38	ATAD3C	-2.712	0.00707	-0.057207	62	0.021091	yes	CLNTRN
chr1_1559750_C_CAG_b38	ATAD3C	-2.671	0.00799	-0.055682	63	0.020851	yes	CLNTRN
chr1_1561628_T_C_b38	ATAD3C	-2.671	0.00799	-0.055682	63	0.020851	yes	CLNTRN
chr1_1563918_A_G_b38	ATAD3C	-2.671	0.00799	-0.055682	63	0.020851	yes	CLNTRN
chr1_1565561_A_G_b38	ATAD3C	-2.671	0.00799	-0.055682	63	0.020851	yes	CLNTRN
chr1_1566086_G_A_b38	ATAD3C	-2.671	0.00799	-0.055682	63	0.020851	yes	CLNTRN
chr1_1567715_G_A_b38	ATAD3C	-2.671	0.00799	-0.055682	63	0.020851	yes	CLNTRN
chr1_1567719_A_C_b38	ATAD3C	-2.671	0.00799	-0.055682	63	0.020851	yes	CLNTRN
chr1_1569875_C_T_b38	ATAD3C	-2.671	0.00799	-0.055682	63	0.020851	yes	CLNTRN
chr1_1572532_A_C_b38	ATAD3C	-2.671	0.00799	-0.055682	63	0.020851	yes	CLNTRN
chr1_1532798_T_C_b38	ATAD3C	-2.667	0.00807	-0.053655	95	0.020119	yes	CLNTRN
chr1_1569180_T_A_b38	ATAD3C	-2.663	0.00816	-0.055358	61	0.020785	yes	CLNTRN
chr1_1560765_T_C_b38	ATAD3C	-2.663	0.00816	-0.056324	50	0.021149	yes	CLNTRN
chr1_1562261_TTTTC_T_b38	ATAD3C	-2.663	0.00816	-0.056324	50	0.021149	yes	CLNTRN
chr1_1524664_A_G_b38	ATAD3C	-2.627	0.00905	-0.064963	43	0.024726	yes	CLNTRN
chr1_1565680_A_AG_b38	ATAD3C	-2.598	0.00983	-0.053655	60	0.020649	yes	CLNTRN
chr1_1573079_A_G_b38	ATAD3C	-2.593	0.00998	-0.053996	62	0.020822	yes	CLNTRN
chr1_1448915_G_A_b38	ATAD3C	-6.179	2.12e-09	-0.136454	29	0.022084	no	CLNTRN
chr1_1449831_A_G_b38	ATAD3C	-5.568	5.77e-08	-0.127036	46	0.022815	no	CLNTRN
chr1_1447108_A_ATT_b38	ATAD3C	-5.226	3.27e-07	-0.122538	19	0.023449	no	CLNTRN
chr1_1312114_T_C_b38	ATAD3C	5.088	6.44e-07	0.12389	46	0.024351	no	CLNTRN
chr1_1435945_C_CCGGGCGGGGGCG_b38	ATAD3C	-5.054	7.58e-07	-0.13116	11	0.025953	no	CLNTRN
chr1_1309988_G_A_b38	ATAD3C	4.994	1.01e-06	0.123193	49	0.024668	no	CLNTRN
chr1_1313807_G_A_b38	ATAD3C	4.994	1.01e-06	0.123193	49	0.024668	no	CLNTRN
chr1_1438102_G_C_b38	ATAD3C	-4.591	6.51e-06	-0.112863	16	0.024581	no	CLNTRN
chr1_1456217_T_C_b38	ATAD3C	-4.508	9.42e-06	-0.109998	37	0.0244	no	CLNTRN
chr1_1434687_C_G_b38	ATAD3C	-4.482	1.06e-05	-0.119124	10	0.026579	no	CLNTRN
chr1_1363986_C_T_b38	ATAD3C	4.476	1.08e-05	0.116963	12	0.02613	no	CLNTRN
chr1_1452825_AAAG_A_b38	ATAD3C	-4.391	1.57e-05	-0.103809	18	0.023644	no	CLNTRN
chr1_1456079_T_C_b38	ATAD3C	-4.325	2.08e-05	-0.102686	17	0.023742	no	CLNTRN
chr1_1452384_G_A_b38	ATAD3C	-4.322	2.11e-05	-0.116331	4	0.026914	no	CLNTRN
chr1_1455924_T_C_b38	ATAD3C	-4.319	2.14e-05	-0.10187	18	0.023586	no	CLNTRN
chr1_1258206_AT_A_b38	ATAD3C	-4.3	2.32e-05	-0.101506	42	0.023609	no	CLNTRN
chr1_1361685_C_T_b38	ATAD3C	-4.268	2.66e-05	-0.115139	20	0.026978	no	CLNTRN
chr1_1456154_G_A_b38	ATAD3C	-4.259	2.76e-05	-0.101785	17	0.0239	no	CLNTRN
chr1_1452346_A_G_b38	ATAD3C	-4.237	3.03e-05	-0.113239	5	0.026726	no	CLNTRN
chr1_1375678_TA_T_b38	ATAD3C	4.219	3.27e-05	0.107459	24	0.025472	no	CLNTRN
chr1_1456051_C_T_b38	ATAD3C	-4.157	4.21e-05	-0.098919	17	0.023793	no	CLNTRN
chr1_1452540_G_A_b38	ATAD3C	-4.154	4.28e-05	-0.098475	14	0.023708	no	CLNTRN
chr1_1368177_G_C_b38	ATAD3C	-4.137	4.58e-05	-0.118661	8	0.028682	no	CLNTRN
chr1_1364566_T_C_b38	ATAD3C	-4.108	5.16e-05	-0.118904	7	0.028941	no	CLNTRN
chr1_1451968_C_T_b38	ATAD3C	-4.092	5.52e-05	-0.098179	15	0.023994	no	CLNTRN
chr1_1370532_C_T_b38	ATAD3C	-4.055	6.4e-05	-0.116349	8	0.028691	no	CLNTRN
chr1_1363880_A_G_b38	ATAD3C	-4.043	6.73e-05	-0.11551	7	0.028571	no	CLNTRN
chr1_1366883_G_GGTGTGAATTGGTGTAGTGTGAATGAGT_b38	ATAD3C	-4.024	7.27e-05	-0.145815	3	0.036236	no	CLNTRN
chr1_1431656_G_A_b38	ATAD3C	-4.023	7.28e-05	-0.113537	8	0.028219	no	CLNTRN
chr1_1437993_G_A_b38	ATAD3C	-4.004	7.89e-05	-0.101309	14	0.025304	no	CLNTRN
chr1_1369282_G_A_b38	ATAD3C	-3.998	8.07e-05	-0.115204	7	0.028816	no	CLNTRN
chr1_1369320_GT_G_b38	ATAD3C	-3.998	8.07e-05	-0.115204	7	0.028816	no	CLNTRN
chr1_1369407_G_A_b38	ATAD3C	-3.998	8.07e-05	-0.115204	7	0.028816	no	CLNTRN
chr1_1369476_CTT_C_b38	ATAD3C	-3.998	8.07e-05	-0.115204	7	0.028816	no	CLNTRN
chr1_1369556_C_G_b38	ATAD3C	-3.998	8.07e-05	-0.115204	7	0.028816	no	CLNTRN
chr1_1369627_T_C_b38	ATAD3C	-3.998	8.07e-05	-0.115204	7	0.028816	no	CLNTRN
chr1_1369686_T_C_b38	ATAD3C	-3.998	8.07e-05	-0.115204	7	0.028816	no	CLNTRN
chr1_1369716_G_C_b38	ATAD3C	-3.998	8.07e-05	-0.115204	7	0.028816	no	CLNTRN
chr1_1369741_C_T_b38	ATAD3C	-3.998	8.07e-05	-0.115204	7	0.028816	no	CLNTRN
chr1_1369821_C_T_b38	ATAD3C	-3.998	8.07e-05	-0.115204	7	0.028816	no	CLNTRN
chr1_1370181_C_T_b38	ATAD3C	-3.998	8.07e-05	-0.115204	7	0.028816	no	CLNTRN
chr1_1370317_G_C_b38	ATAD3C	-3.998	8.07e-05	-0.115204	7	0.028816	no	CLNTRN
chr1_1370320_A_G_b38	ATAD3C	-3.998	8.07e-05	-0.115204	7	0.028816	no	CLNTRN
chr1_1369012_C_CG_b38	ATAD3C	-3.983	8.56e-05	-0.117221	7	0.029429	no	CLNTRN
chr1_1366828_A_G_b38	ATAD3C	-3.983	8.57e-05	-0.12602	5	0.031641	no	CLNTRN
chr1_1370430_T_C_b38	ATAD3C	-3.975	8.84e-05	-0.116329	7	0.029265	no	CLNTRN
chr1_1370584_G_C_b38	ATAD3C	-3.975	8.84e-05	-0.116329	7	0.029265	no	CLNTRN
chr1_1369009_T_C_b38	ATAD3C	-3.964	9.25e-05	-0.116669	7	0.029435	no	CLNTRN
chr1_1367280_T_A_b38	ATAD3C	-3.947	9.88e-05	-0.113952	7	0.02887	no	CLNTRN
chr1_1366830_G_A_b38	ATAD3C	-3.91	0.000114	-0.124787	5	0.031912	no	CLNTRN
chr1_1367388_T_TTGG_b38	ATAD3C	-3.91	0.000114	-0.112374	7	0.02874	no	CLNTRN
chr1_1367511_ATGAG_A_b38	ATAD3C	-3.91	0.000114	-0.112374	7	0.02874	no	CLNTRN
chr1_1367268_TGA_T_b38	ATAD3C	-3.91	0.000115	-0.11217	7	0.028691	no	CLNTRN
chr1_1364282_T_G_b38	ATAD3C	-3.909	0.000115	-0.112616	7	0.028809	no	CLNTRN
chr1_1364357_A_C_b38	ATAD3C	-3.909	0.000115	-0.112616	7	0.028809	no	CLNTRN
chr1_1364694_T_C_b38	ATAD3C	-3.909	0.000115	-0.112616	7	0.028809	no	CLNTRN
chr1_1364721_C_T_b38	ATAD3C	-3.909	0.000115	-0.112616	7	0.028809	no	CLNTRN
chr1_1365160_A_G_b38	ATAD3C	-3.909	0.000115	-0.112616	7	0.028809	no	CLNTRN
chr1_1365198_C_T_b38	ATAD3C	-3.909	0.000115	-0.112616	7	0.028809	no	CLNTRN
chr1_1366008_A_G_b38	ATAD3C	-3.909	0.000115	-0.112616	7	0.028809	no	CLNTRN
chr1_1366062_T_C_b38	ATAD3C	-3.909	0.000115	-0.112616	7	0.028809	no	CLNTRN
chr1_1366145_TGTGAA_T_b38	ATAD3C	-3.909	0.000115	-0.112616	7	0.028809	no	CLNTRN
chr1_1366187_A_AGT_b38	ATAD3C	-3.909	0.000115	-0.112616	7	0.028809	no	CLNTRN
chr1_1366321_TGTGTGTAAATGG_T_b38	ATAD3C	-3.909	0.000115	-0.112616	7	0.028809	no	CLNTRN
chr1_1366453_G_T_b38	ATAD3C	-3.909	0.000115	-0.112616	7	0.028809	no	CLNTRN
chr1_1366726_T_G_b38	ATAD3C	-3.909	0.000115	-0.112616	7	0.028809	no	CLNTRN
chr1_1367258_T_A_b38	ATAD3C	-3.909	0.000115	-0.112616	7	0.028809	no	CLNTRN
chr1_1367297_GAA_G_b38	ATAD3C	-3.909	0.000115	-0.112616	7	0.028809	no	CLNTRN
chr1_1367329_A_AGT_b38	ATAD3C	-3.909	0.000115	-0.112616	7	0.028809	no	CLNTRN
chr1_1367373_T_TGTG_b38	ATAD3C	-3.909	0.000115	-0.112616	7	0.028809	no	CLNTRN
chr1_1367593_G_A_b38	ATAD3C	-3.909	0.000115	-0.112616	7	0.028809	no	CLNTRN
chr1_1367602_GT_G_b38	ATAD3C	-3.909	0.000115	-0.112616	7	0.028809	no	CLNTRN
chr1_1367605_GAGTGAGTGTA_G_b38	ATAD3C	-3.909	0.000115	-0.112616	7	0.028809	no	CLNTRN
chr1_1367670_GGTGA_G_b38	ATAD3C	-3.909	0.000115	-0.112616	7	0.028809	no	CLNTRN
chr1_1367722_TTTTA_T_b38	ATAD3C	-3.909	0.000115	-0.112616	7	0.028809	no	CLNTRN
chr1_1367874_A_T_b38	ATAD3C	-3.909	0.000115	-0.112616	7	0.028809	no	CLNTRN
chr1_1367919_C_T_b38	ATAD3C	-3.909	0.000115	-0.112616	7	0.028809	no	CLNTRN
chr1_1367951_C_T_b38	ATAD3C	-3.909	0.000115	-0.112616	7	0.028809	no	CLNTRN
chr1_1367965_A_G_b38	ATAD3C	-3.909	0.000115	-0.112616	7	0.028809	no	CLNTRN
chr1_1367970_T_G_b38	ATAD3C	-3.909	0.000115	-0.112616	7	0.028809	no	CLNTRN
chr1_1367994_C_A_b38	ATAD3C	-3.909	0.000115	-0.112616	7	0.028809	no	CLNTRN
chr1_1368297_C_T_b38	ATAD3C	-3.909	0.000115	-0.112616	7	0.028809	no	CLNTRN
chr1_1368514_C_G_b38	ATAD3C	-3.909	0.000115	-0.112616	7	0.028809	no	CLNTRN
chr1_1368991_C_T_b38	ATAD3C	-3.896	0.000121	-0.114423	7	0.029366	no	CLNTRN
chr1_1363688_C_T_b38	ATAD3C	-3.896	0.000121	-0.112769	7	0.028941	no	CLNTRN
chr1_1364099_CCA_C_b38	ATAD3C	-3.896	0.000121	-0.112769	7	0.028941	no	CLNTRN
chr1_1364102_TGTTG_T_b38	ATAD3C	-3.896	0.000121	-0.112769	7	0.028941	no	CLNTRN
chr1_1368763_G_A_b38	ATAD3C	-3.896	0.000121	-0.112769	7	0.028941	no	CLNTRN
chr1_1366292_G_T_b38	ATAD3C	-3.894	0.000122	-0.112371	7	0.028857	no	CLNTRN
chr1_1366511_GGTGA_G_b38	ATAD3C	-3.885	0.000126	-0.112205	7	0.028881	no	CLNTRN
chr1_1367462_T_C_b38	ATAD3C	-3.884	0.000127	-0.112363	7	0.028931	no	CLNTRN
chr1_1366681_T_TGA_b38	ATAD3C	-3.878	0.00013	-0.112519	7	0.029018	no	CLNTRN
chr1_1453870_A_C_b38	ATAD3C	-3.866	0.000136	-0.10676	4	0.027613	no	CLNTRN
chr1_1367300_T_TGA_b38	ATAD3C	-3.852	0.000144	-0.11226	6	0.029145	no	CLNTRN
chr1_1282558_C_CCA_b38	ATAD3C	-3.834	0.000154	-0.093328	28	0.024343	no	CLNTRN
chr1_1373007_G_A_b38	ATAD3C	-3.805	0.000172	-0.113749	7	0.029895	no	CLNTRN
chr1_1372909_G_A_b38	ATAD3C	-3.8	0.000176	-0.116329	6	0.030617	no	CLNTRN
chr1_1366835_G_GGTGA_b38	ATAD3C	-3.783	0.000188	-0.120473	5	0.031849	no	CLNTRN
chr1_1373006_G_A_b38	ATAD3C	-3.744	0.000217	-0.113273	6	0.030253	no	CLNTRN
chr1_1456891_T_C_b38	ATAD3C	-3.685	0.000272	-0.081556	28	0.022133	no	CLNTRN
chr1_1450636_A_G_b38	ATAD3C	-3.672	0.000285	-0.102316	5	0.027864	no	CLNTRN
chr1_1366776_G_GAATT_b38	ATAD3C	-3.654	0.000305	-0.106293	7	0.029087	no	CLNTRN
chr1_1341550_GCA_G_b38	ATAD3C	-3.636	0.000327	-0.108655	7	0.029886	no	CLNTRN
chr1_1370553_CAAA_C_b38	ATAD3C	-3.623	0.000342	-0.113006	5	0.031188	no	CLNTRN
chr1_1364253_C_G_b38	ATAD3C	-3.586	0.000392	-0.105489	7	0.029414	no	CLNTRN
chr1_1290968_C_G_b38	ATAD3C	-3.508	0.000521	-0.095973	32	0.027357	no	CLNTRN
chr1_1453961_C_T_b38	ATAD3C	-3.49	0.000556	-0.102359	3	0.029327	no	CLNTRN
chr1_1329973_GCGTGTGCCATGCA_G_b38	ATAD3C	-3.467	0.000605	-0.107861	5	0.031115	no	CLNTRN
chr1_1344048_G_A_b38	ATAD3C	-3.467	0.000605	-0.107861	5	0.031115	no	CLNTRN
chr1_2103488_A_G_b38	ATAD3C	-3.466	0.000607	-0.167427	13	0.048308	no	CLNTRN
chr1_1316929_A_T_b38	ATAD3C	-3.429	0.00069	-0.103847	5	0.030281	no	CLNTRN
chr1_1452797_CAA_C_b38	ATAD3C	-3.424	0.000705	-0.085211	16	0.024889	no	CLNTRN
chr1_1227685_G_A_b38	ATAD3C	-3.323	0.001	-0.111688	5	0.033615	no	CLNTRN
chr1_1365036_T_TAA_b38	ATAD3C	-3.321	0.00101	-0.099646	5	0.030004	no	CLNTRN
chr1_1303112_G_A_b38	ATAD3C	-3.302	0.00108	-0.10187	3	0.030849	no	CLNTRN
chr1_1319750_G_A_b38	ATAD3C	-3.301	0.00108	-0.174497	6	0.052856	no	CLNTRN
chr1_1428999_C_CA_b38	ATAD3C	-3.271	0.0012	-0.073226	20	0.022383	no	CLNTRN
chr1_1363456_CAG_C_b38	ATAD3C	3.27	0.0012	0.079643	22	0.024354	no	CLNTRN
chr1_1275091_T_C_b38	ATAD3C	-3.269	0.00121	-0.087942	29	0.026902	no	CLNTRN
chr1_1282706_C_T_b38	ATAD3C	-3.269	0.00121	-0.087942	29	0.026902	no	CLNTRN
chr1_1451028_T_A_b38	ATAD3C	-3.254	0.00127	-0.088602	6	0.027226	no	CLNTRN
chr1_1278407_T_TA_b38	ATAD3C	-3.228	0.00138	-0.086631	28	0.026835	no	CLNTRN
chr1_1746452_A_AC_b38	ATAD3C	-3.205	0.0015	-0.211498	3	0.065999	no	CLNTRN
chr1_1274972_A_G_b38	ATAD3C	-3.166	0.0017	-0.085619	28	0.02704	no	CLNTRN
chr1_1277844_T_A_b38	ATAD3C	-3.166	0.0017	-0.085619	28	0.02704	no	CLNTRN
chr1_1979684_G_A_b38	ATAD3C	-3.161	0.00173	-0.14031	5	0.044386	no	CLNTRN
chr1_1220751_T_C_b38	ATAD3C	-3.146	0.00182	-0.077202	24	0.024542	no	CLNTRN
chr1_1208038_T_C_b38	ATAD3C	-3.14	0.00186	-0.105027	10	0.033446	no	CLNTRN
chr1_1304555_A_C_b38	ATAD3C	-3.125	0.00195	-0.098369	3	0.031476	no	CLNTRN
chr1_1291816_A_G_b38	ATAD3C	-3.009	0.00284	-0.16395	3	0.054484	no	CLNTRN
chr1_1411525_T_A_b38	ATAD3C	-2.971	0.00321	-0.090461	17	0.03045	no	CLNTRN
chr1_1471663_A_C_b38	ATAD3C	-2.962	0.0033	-0.129897	6	0.043853	no	CLNTRN
chr1_1375678_TAA_T_b38	ATAD3C	-2.958	0.00334	-0.082249	16	0.027803	no	CLNTRN
chr1_1450193_C_T_b38	ATAD3C	-2.953	0.0034	-0.104313	7	0.035321	no	CLNTRN
chr1_1385919_A_AG_b38	ATAD3C	2.932	0.00362	0.091283	15	0.031128	no	CLNTRN
chr1_1277269_T_C_b38	ATAD3C	-2.876	0.00431	-0.078125	27	0.02716	no	CLNTRN
chr1_1415976_G_A_b38	ATAD3C	-2.869	0.00441	-0.088923	19	0.030996	no	CLNTRN
chr1_1553018_CA_C_b38	ATAD3C	-2.864	0.00448	-0.066353	18	0.023167	no	CLNTRN
chr1_1551454_C_A_b38	ATAD3C	-2.855	0.00461	-0.056817	96	0.019902	no	CLNTRN
chr1_1419135_C_G_b38	ATAD3C	-2.851	0.00466	-0.092286	30	0.032367	no	CLNTRN
chr1_1411929_G_C_b38	ATAD3C	-2.833	0.00492	-0.086327	19	0.03047	no	CLNTRN
chr1_1277415_C_A_b38	ATAD3C	-2.8	0.00544	-0.093766	11	0.033485	no	CLNTRN
chr1_1278556_G_A_b38	ATAD3C	-2.8	0.00544	-0.093766	11	0.033485	no	CLNTRN
chr1_1422081_C_T_b38	ATAD3C	-2.799	0.00546	-0.090272	31	0.032253	no	CLNTRN
chr1_1275583_T_C_b38	ATAD3C	-2.794	0.00555	-0.092614	12	0.033148	no	CLNTRN
chr1_1182895_C_T_b38	ATAD3C	-2.793	0.00557	-0.102573	4	0.036731	no	CLNTRN
chr1_1524202_G_A_b38	ATAD3C	-2.783	0.00573	-0.104038	18	0.037386	no	CLNTRN
chr1_1274256_A_G_b38	ATAD3C	-2.777	0.00583	-0.078596	20	0.028298	no	CLNTRN
chr1_1533883_G_T_b38	ATAD3C	-2.776	0.00586	-0.094753	11	0.034135	no	CLNTRN
chr1_1523187_A_G_b38	ATAD3C	-2.775	0.00588	-0.099686	23	0.035928	no	CLNTRN
chr1_1425013_C_T_b38	ATAD3C	-2.769	0.00598	-0.085114	33	0.030742	no	CLNTRN
chr1_1297051_CCA_C_b38	ATAD3C	-2.764	0.00607	-0.15001	4	0.054273	no	CLNTRN
chr1_1410616_G_T_b38	ATAD3C	-2.757	0.0062	-0.084187	19	0.030541	no	CLNTRN
chr1_1412488_C_CAG_b38	ATAD3C	-2.757	0.0062	-0.084187	19	0.030541	no	CLNTRN
chr1_1500745_A_C_b38	ATAD3C	-2.751	0.00631	-0.089282	36	0.032455	no	CLNTRN
chr1_1374694_C_G_b38	ATAD3C	2.742	0.00648	0.093115	8	0.033962	no	CLNTRN
chr1_1624723_C_T_b38	ATAD3C	-2.742	0.00648	-0.068996	11	0.025166	no	CLNTRN
chr1_1306183_A_G_b38	ATAD3C	-2.734	0.00664	-0.148866	4	0.054458	no	CLNTRN
chr1_1320653_C_T_b38	ATAD3C	-2.734	0.00664	-0.148866	4	0.054458	no	CLNTRN
chr1_1274980_C_T_b38	ATAD3C	-2.679	0.0078	-0.076443	19	0.028538	no	CLNTRN
chr1_1275912_C_T_b38	ATAD3C	-2.679	0.0078	-0.076443	19	0.028538	no	CLNTRN
chr1_1279728_TG_T_b38	ATAD3C	-2.679	0.0078	-0.076443	19	0.028538	no	CLNTRN
chr1_2103523_C_T_b38	ATAD3C	-2.661	0.00821	-0.13066	10	0.0491	no	CLNTRN
chr1_1363601_A_AT_b38	ATAD3C	2.636	0.00883	0.047805	101	0.018136	no	CLNTRN
chr1_1739996_G_T_b38	ATAD3C	2.619	0.00926	0.138304	3	0.052803	no	CLNTRN
chr1_1499339_T_C_b38	ATAD3C	-2.61	0.00952	-0.104716	4	0.040126	no	CLNTRN
chr1_1445187_T_G_b38	ATAD3C	-9.391	2.4e-18	-0.25222	30	0.026856	yes	ESPGSJ
chr1_1440430_C_G_b38	ATAD3C	-9.386	2.5e-18	-0.257928	21	0.02748	yes	ESPGSJ
chr1_1443457_T_C_b38	ATAD3C	-9.071	2.35e-17	-0.247001	36	0.02723	yes	ESPGSJ
chr1_1440834_C_G_b38	ATAD3C	-8.968	4.86e-17	-0.244245	35	0.027236	yes	ESPGSJ
chr1_1433374_T_C_b38	ATAD3C	-8.836	1.22e-16	-0.232426	40	0.026304	yes	ESPGSJ
chr1_1439454_A_G_b38	ATAD3C	-8.462	1.6e-15	-0.231368	32	0.027341	yes	ESPGSJ
chr1_1445240_A_G_b38	ATAD3C	-8.341	3.64e-15	-0.232975	35	0.027932	yes	ESPGSJ
chr1_1448915_G_A_b38	ATAD3C	-8.295	4.97e-15	-0.234913	21	0.028321	yes	ESPGSJ
chr1_1436079_A_G_b38	ATAD3C	-8.248	6.78e-15	-0.223776	37	0.02713	yes	ESPGSJ
chr1_1441187_A_G_b38	ATAD3C	-7.768	1.6e-13	-0.224359	23	0.028882	yes	ESPGSJ
chr1_1431450_A_G_b38	ATAD3C	-7.702	2.46e-13	-0.210282	38	0.027304	yes	ESPGSJ
chr1_1430908_A_G_b38	ATAD3C	-7.671	2.99e-13	-0.206772	39	0.026955	yes	ESPGSJ
chr1_1431537_G_C_b38	ATAD3C	-7.655	3.33e-13	-0.208683	38	0.027262	yes	ESPGSJ
chr1_1430190_A_C_b38	ATAD3C	-7.639	3.68e-13	-0.208323	38	0.02727	yes	ESPGSJ
chr1_1428969_T_C_b38	ATAD3C	-7.552	6.43e-13	-0.206706	38	0.027373	yes	ESPGSJ
chr1_1432355_G_A_b38	ATAD3C	-7.496	9.12e-13	-0.224658	15	0.029969	yes	ESPGSJ
chr1_1436388_CA_C_b38	ATAD3C	-7.435	1.35e-12	-0.220092	22	0.029603	yes	ESPGSJ
chr1_1426810_C_G_b38	ATAD3C	-7.366	2.07e-12	-0.202235	37	0.027454	yes	ESPGSJ
chr1_1426261_C_T_b38	ATAD3C	-7.289	3.35e-12	-0.201881	36	0.027697	yes	ESPGSJ
chr1_1449831_A_G_b38	ATAD3C	-7.077	1.23e-11	-0.210529	34	0.029746	yes	ESPGSJ
chr1_1435945_C_CCGGGCGGGGGCG_b38	ATAD3C	-6.67	1.41e-10	-0.218279	11	0.032728	yes	ESPGSJ
chr1_1442793_G_A_b38	ATAD3C	-6.667	1.43e-10	-0.219706	10	0.032955	yes	ESPGSJ
chr1_1431813_G_T_b38	ATAD3C	-6.543	2.94e-10	-0.20823	12	0.031822	yes	ESPGSJ
chr1_1454315_C_T_b38	ATAD3C	-6.523	3.31e-10	-0.190114	32	0.029144	yes	ESPGSJ
chr1_1431026_CCACCCCCT_C_b38	ATAD3C	-6.464	4.64e-10	-0.191544	18	0.029631	yes	ESPGSJ
chr1_1449009_A_T_b38	ATAD3C	-6.274	1.37e-09	-0.199572	21	0.031812	yes	ESPGSJ
chr1_1434687_C_G_b38	ATAD3C	-6.273	1.37e-09	-0.208883	10	0.033298	yes	ESPGSJ
chr1_1438102_G_C_b38	ATAD3C	-6.251	1.56e-09	-0.197403	13	0.031581	yes	ESPGSJ
chr1_1384749_C_G_b38	ATAD3C	6.228	1.77e-09	0.191109	25	0.030683	yes	ESPGSJ
chr1_1387763_CCT_C_b38	ATAD3C	6.228	1.77e-09	0.191109	25	0.030683	yes	ESPGSJ
chr1_1388944_G_A_b38	ATAD3C	6.228	1.77e-09	0.191109	25	0.030683	yes	ESPGSJ
chr1_1454770_T_C_b38	ATAD3C	-6.209	1.97e-09	-0.182544	34	0.029401	yes	ESPGSJ
chr1_1400410_A_G_b38	ATAD3C	-6.151	2.72e-09	-0.189667	26	0.030837	yes	ESPGSJ
chr1_1376162_G_C_b38	ATAD3C	6.141	2.87e-09	0.187844	25	0.030589	yes	ESPGSJ
chr1_1377431_C_T_b38	ATAD3C	6.141	2.87e-09	0.187844	25	0.030589	yes	ESPGSJ
chr1_1452511_A_G_b38	ATAD3C	-6.124	3.15e-09	-0.180218	34	0.029427	yes	ESPGSJ
chr1_1452888_C_A_b38	ATAD3C	-6.124	3.15e-09	-0.180218	34	0.029427	yes	ESPGSJ
chr1_1452909_A_C_b38	ATAD3C	-6.124	3.15e-09	-0.180218	34	0.029427	yes	ESPGSJ
chr1_1453703_A_G_b38	ATAD3C	-6.124	3.15e-09	-0.180218	34	0.029427	yes	ESPGSJ
chr1_1454092_A_G_b38	ATAD3C	-6.124	3.15e-09	-0.180218	34	0.029427	yes	ESPGSJ
chr1_1402457_A_G_b38	ATAD3C	-6.083	3.95e-09	-0.192522	34	0.031647	yes	ESPGSJ
chr1_1378204_G_C_b38	ATAD3C	6.072	4.2e-09	0.183632	26	0.030242	yes	ESPGSJ
chr1_1455617_T_G_b38	ATAD3C	-6.015	5.72e-09	-0.17728	34	0.029471	yes	ESPGSJ
chr1_1431656_G_A_b38	ATAD3C	-6.006	6.04e-09	-0.208057	9	0.034644	yes	ESPGSJ
chr1_1387698_A_G_b38	ATAD3C	5.991	6.53e-09	0.188197	34	0.031413	yes	ESPGSJ
chr1_1389827_C_T_b38	ATAD3C	5.991	6.53e-09	0.188197	34	0.031413	yes	ESPGSJ
chr1_1439805_G_C_b38	ATAD3C	-5.921	9.53e-09	-0.187757	14	0.031708	yes	ESPGSJ
chr1_1456217_T_C_b38	ATAD3C	-5.829	1.56e-08	-0.176797	30	0.030328	yes	ESPGSJ
chr1_1395346_A_G_b38	ATAD3C	-5.747	2.42e-08	-0.183261	34	0.03189	yes	ESPGSJ
chr1_1426253_G_A_b38	ATAD3C	-5.69	3.26e-08	-0.196557	8	0.034545	yes	ESPGSJ
chr1_1575724_G_C_b38	ATAD3C	-5.684	3.36e-08	-0.142198	51	0.025015	yes	ESPGSJ
chr1_1471992_T_C_b38	ATAD3C	-5.641	4.21e-08	-0.166423	42	0.029503	yes	ESPGSJ
chr1_1573654_T_C_b38	ATAD3C	-5.619	4.71e-08	-0.141713	51	0.025219	yes	ESPGSJ
chr1_1574445_A_G_b38	ATAD3C	-5.619	4.71e-08	-0.141713	51	0.025219	yes	ESPGSJ
chr1_1394423_A_G_b38	ATAD3C	-5.615	4.83e-08	-0.178448	34	0.031782	yes	ESPGSJ
chr1_1411323_A_C_b38	ATAD3C	-5.613	4.86e-08	-0.179454	35	0.03197	yes	ESPGSJ
chr1_1454848_T_C_b38	ATAD3C	-5.584	5.65e-08	-0.16474	19	0.029501	yes	ESPGSJ
chr1_1575421_C_T_b38	ATAD3C	-5.542	7.03e-08	-0.13639	53	0.024612	yes	ESPGSJ
chr1_1453643_A_ATT_b38	ATAD3C	-5.487	9.29e-08	-0.160843	24	0.029311	yes	ESPGSJ
chr1_1447108_A_ATT_b38	ATAD3C	-5.484	9.43e-08	-0.171368	19	0.031247	yes	ESPGSJ
chr1_1457071_C_T_b38	ATAD3C	-5.475	9.89e-08	-0.161023	19	0.029411	yes	ESPGSJ
chr1_1451787_A_C_b38	ATAD3C	-5.464	1.05e-07	-0.15979	28	0.029243	yes	ESPGSJ
chr1_1455924_T_C_b38	ATAD3C	-5.416	1.33e-07	-0.162282	18	0.029961	yes	ESPGSJ
chr1_1453552_G_A_b38	ATAD3C	-5.386	1.55e-07	-0.16172	18	0.030026	yes	ESPGSJ
chr1_1455134_T_G_b38	ATAD3C	-5.386	1.55e-07	-0.16172	18	0.030026	yes	ESPGSJ
chr1_1455337_A_G_b38	ATAD3C	-5.386	1.55e-07	-0.16172	18	0.030026	yes	ESPGSJ
chr1_1455495_C_T_b38	ATAD3C	-5.386	1.55e-07	-0.16172	18	0.030026	yes	ESPGSJ
chr1_1431014_G_A_b38	ATAD3C	-5.38	1.6e-07	-0.155061	22	0.028822	yes	ESPGSJ
chr1_1456154_G_A_b38	ATAD3C	-5.364	1.73e-07	-0.161735	18	0.030149	yes	ESPGSJ
chr1_1452825_AAAG_A_b38	ATAD3C	-5.325	2.11e-07	-0.159248	18	0.029906	yes	ESPGSJ
chr1_1542773_T_C_b38	ATAD3C	-5.317	2.2e-07	-0.137954	49	0.025948	yes	ESPGSJ
chr1_1542793_C_G_b38	ATAD3C	-5.317	2.2e-07	-0.137954	49	0.025948	yes	ESPGSJ
chr1_1542800_T_C_b38	ATAD3C	-5.317	2.2e-07	-0.137954	49	0.025948	yes	ESPGSJ
chr1_1550064_GC_G_b38	ATAD3C	-5.313	2.23e-07	-0.1375	50	0.025879	yes	ESPGSJ
chr1_1550068_C_A_b38	ATAD3C	-5.313	2.23e-07	-0.1375	50	0.025879	yes	ESPGSJ
chr1_1456051_C_T_b38	ATAD3C	-5.313	2.24e-07	-0.16042	17	0.030196	yes	ESPGSJ
chr1_1543953_A_G_b38	ATAD3C	-5.309	2.28e-07	-0.138148	49	0.02602	yes	ESPGSJ
chr1_1575864_G_A_b38	ATAD3C	-5.27	2.77e-07	-0.136928	46	0.025983	yes	ESPGSJ
chr1_1547630_G_A_b38	ATAD3C	-5.264	2.85e-07	-0.129553	50	0.02461	yes	ESPGSJ
chr1_1541864_T_C_b38	ATAD3C	-5.237	3.26e-07	-0.137323	49	0.026221	yes	ESPGSJ
chr1_1577491_A_AC_b38	ATAD3C	-5.227	3.43e-07	-0.132249	52	0.025303	yes	ESPGSJ
chr1_1574032_AAAG_A_b38	ATAD3C	-5.203	3.85e-07	-0.144876	26	0.027844	yes	ESPGSJ
chr1_1375642_C_T_b38	ATAD3C	-5.191	4.08e-07	-0.191169	8	0.036825	yes	ESPGSJ
chr1_1457033_A_C_b38	ATAD3C	-5.191	4.08e-07	-0.155629	17	0.02998	yes	ESPGSJ
chr1_1330125_G_A_b38	ATAD3C	5.187	4.17e-07	0.16055	35	0.030954	yes	ESPGSJ
chr1_1517993_A_G_b38	ATAD3C	-5.175	4.41e-07	-0.14367	50	0.027763	yes	ESPGSJ
chr1_1519934_T_G_b38	ATAD3C	-5.175	4.41e-07	-0.14367	50	0.027763	yes	ESPGSJ
chr1_1519938_T_C_b38	ATAD3C	-5.175	4.41e-07	-0.14367	50	0.027763	yes	ESPGSJ
chr1_1551557_A_AG_b38	ATAD3C	-5.174	4.43e-07	-0.134252	51	0.025946	yes	ESPGSJ
chr1_1551559_A_T_b38	ATAD3C	-5.174	4.43e-07	-0.134252	51	0.025946	yes	ESPGSJ
chr1_1309988_G_A_b38	ATAD3C	5.163	4.67e-07	0.157886	37	0.030578	yes	ESPGSJ
chr1_1313807_G_A_b38	ATAD3C	5.163	4.67e-07	0.157886	37	0.030578	yes	ESPGSJ
chr1_1543500_T_G_b38	ATAD3C	-5.146	5.09e-07	-0.134172	49	0.026075	yes	ESPGSJ
chr1_1549590_C_G_b38	ATAD3C	-5.099	6.37e-07	-0.127392	55	0.024983	yes	ESPGSJ
chr1_1308516_C_T_b38	ATAD3C	5.067	7.45e-07	0.151594	40	0.02992	yes	ESPGSJ
chr1_1545795_C_A_b38	ATAD3C	-5.031	8.83e-07	-0.131548	46	0.026146	yes	ESPGSJ
chr1_1538787_A_G_b38	ATAD3C	-5.023	9.19e-07	-0.127051	54	0.025295	yes	ESPGSJ
chr1_1558726_C_CA_b38	ATAD3C	-5.022	9.22e-07	-0.130796	51	0.026044	yes	ESPGSJ
chr1_1561821_A_C_b38	ATAD3C	-5.022	9.22e-07	-0.130796	51	0.026044	yes	ESPGSJ
chr1_1574655_GGC_G_b38	ATAD3C	-5.014	9.61e-07	-0.128939	46	0.025718	yes	ESPGSJ
chr1_1312114_T_C_b38	ATAD3C	4.952	1.29e-06	0.151094	36	0.030514	yes	ESPGSJ
chr1_1456182_G_A_b38	ATAD3C	-4.935	1.39e-06	-0.146029	20	0.02959	yes	ESPGSJ
chr1_1456079_T_C_b38	ATAD3C	-4.895	1.68e-06	-0.14765	18	0.030164	yes	ESPGSJ
chr1_1565105_CAAGGCAGGCGGATCATG_C_b38	ATAD3C	-4.895	1.68e-06	-0.121858	57	0.024895	yes	ESPGSJ
chr1_1553692_A_G_b38	ATAD3C	-4.894	1.69e-06	-0.122144	56	0.024958	yes	ESPGSJ
chr1_1554694_A_G_b38	ATAD3C	-4.894	1.69e-06	-0.122144	56	0.024958	yes	ESPGSJ
chr1_1554781_A_G_b38	ATAD3C	-4.894	1.69e-06	-0.122144	56	0.024958	yes	ESPGSJ
chr1_1554852_T_C_b38	ATAD3C	-4.894	1.69e-06	-0.122144	56	0.024958	yes	ESPGSJ
chr1_1555247_T_A_b38	ATAD3C	-4.894	1.69e-06	-0.122144	56	0.024958	yes	ESPGSJ
chr1_1366561_AGT_A_b38	ATAD3C	4.878	1.82e-06	0.153101	35	0.031387	yes	ESPGSJ
chr1_1569661_T_C_b38	ATAD3C	-4.849	2.08e-06	-0.120621	54	0.024875	yes	ESPGSJ
chr1_1557495_CAT_C_b38	ATAD3C	-4.836	2.21e-06	-0.128095	51	0.026489	yes	ESPGSJ
chr1_1559750_C_CAG_b38	ATAD3C	-4.826	2.31e-06	-0.121385	56	0.025151	yes	ESPGSJ
chr1_1561628_T_C_b38	ATAD3C	-4.826	2.31e-06	-0.121385	56	0.025151	yes	ESPGSJ
chr1_1563918_A_G_b38	ATAD3C	-4.826	2.31e-06	-0.121385	56	0.025151	yes	ESPGSJ
chr1_1565561_A_G_b38	ATAD3C	-4.826	2.31e-06	-0.121385	56	0.025151	yes	ESPGSJ
chr1_1566086_G_A_b38	ATAD3C	-4.826	2.31e-06	-0.121385	56	0.025151	yes	ESPGSJ
chr1_1567715_G_A_b38	ATAD3C	-4.826	2.31e-06	-0.121385	56	0.025151	yes	ESPGSJ
chr1_1567719_A_C_b38	ATAD3C	-4.826	2.31e-06	-0.121385	56	0.025151	yes	ESPGSJ
chr1_1569875_C_T_b38	ATAD3C	-4.826	2.31e-06	-0.121385	56	0.025151	yes	ESPGSJ
chr1_1572532_A_C_b38	ATAD3C	-4.826	2.31e-06	-0.121385	56	0.025151	yes	ESPGSJ
chr1_1373006_G_A_b38	ATAD3C	-4.802	2.59e-06	-0.178848	7	0.037247	yes	ESPGSJ
chr1_1373007_G_A_b38	ATAD3C	-4.802	2.59e-06	-0.178848	7	0.037247	yes	ESPGSJ
chr1_1379091_T_G_b38	ATAD3C	4.794	2.69e-06	0.166187	10	0.034669	yes	ESPGSJ
chr1_1437955_C_G_b38	ATAD3C	-4.793	2.7e-06	-0.130649	23	0.027258	yes	ESPGSJ
chr1_1358384_G_C_b38	ATAD3C	4.771	2.99e-06	0.149916	35	0.031425	yes	ESPGSJ
chr1_1452540_G_A_b38	ATAD3C	-4.77	2.99e-06	-0.145457	15	0.030492	yes	ESPGSJ
chr1_1452346_A_G_b38	ATAD3C	-4.738	3.48e-06	-0.153585	8	0.032418	yes	ESPGSJ
chr1_1451968_C_T_b38	ATAD3C	-4.698	4.17e-06	-0.144629	14	0.030788	yes	ESPGSJ
chr1_1573079_A_G_b38	ATAD3C	-4.694	4.25e-06	-0.118268	56	0.025198	yes	ESPGSJ
chr1_1374505_A_G_b38	ATAD3C	-4.689	4.33e-06	-0.173121	8	0.036918	yes	ESPGSJ
chr1_1479719_T_C_b38	ATAD3C	-4.683	4.46e-06	-0.13913	41	0.02971	yes	ESPGSJ
chr1_1497605_G_C_b38	ATAD3C	-4.662	4.89e-06	-0.125001	38	0.026812	yes	ESPGSJ
chr1_1379083_AT_A_b38	ATAD3C	4.625	5.77e-06	0.147222	14	0.031828	yes	ESPGSJ
chr1_1366427_AGTGTGATTGAATGAGT_A_b38	ATAD3C	4.613	6.1e-06	0.144693	25	0.031366	yes	ESPGSJ
chr1_1403593_A_G_b38	ATAD3C	-4.605	6.33e-06	-0.181229	7	0.039358	yes	ESPGSJ
chr1_1452797_CAA_C_b38	ATAD3C	-4.593	6.66e-06	-0.149919	13	0.032639	yes	ESPGSJ
chr1_1566854_CA_C_b38	ATAD3C	-4.564	7.59e-06	-0.127737	36	0.027989	yes	ESPGSJ
chr1_1292284_TTGAG_T_b38	ATAD3C	-4.553	7.96e-06	-0.162457	13	0.035681	yes	ESPGSJ
chr1_1437993_G_A_b38	ATAD3C	-4.539	8.48e-06	-0.146969	14	0.032382	yes	ESPGSJ
chr1_1382893_G_A_b38	ATAD3C	-4.531	8.79e-06	-0.176721	7	0.039007	yes	ESPGSJ
chr1_1452384_G_A_b38	ATAD3C	-4.527	8.94e-06	-0.147722	8	0.032632	yes	ESPGSJ
chr1_1571794_A_AT_b38	ATAD3C	-4.519	9.27e-06	-0.117602	47	0.026027	yes	ESPGSJ
chr1_1361679_G_A_b38	ATAD3C	4.515	9.41e-06	0.144427	20	0.031987	yes	ESPGSJ
chr1_1539491_G_C_b38	ATAD3C	-4.515	9.43e-06	-0.116139	51	0.025725	yes	ESPGSJ
chr1_1532798_T_C_b38	ATAD3C	-4.483	1.08e-05	-0.111408	85	0.024851	yes	ESPGSJ
chr1_1569180_T_A_b38	ATAD3C	-4.481	1.09e-05	-0.115789	51	0.02584	yes	ESPGSJ
chr1_1560765_T_C_b38	ATAD3C	-4.467	1.16e-05	-0.118238	46	0.02647	yes	ESPGSJ
chr1_1562261_TTTTC_T_b38	ATAD3C	-4.467	1.16e-05	-0.118238	46	0.02647	yes	ESPGSJ
chr1_1383743_T_C_b38	ATAD3C	-4.463	1.18e-05	-0.1748	7	0.03917	yes	ESPGSJ
chr1_1370113_A_G_b38	ATAD3C	4.452	1.24e-05	0.136032	28	0.030556	yes	ESPGSJ
chr1_1380867_A_G_b38	ATAD3C	-4.427	1.38e-05	-0.177118	6	0.040009	yes	ESPGSJ
chr1_1428999_C_CA_b38	ATAD3C	-4.401	1.54e-05	-0.133157	16	0.030254	yes	ESPGSJ
chr1_1537493_T_A_b38	ATAD3C	-4.397	1.58e-05	-0.111899	44	0.025452	yes	ESPGSJ
chr1_1570294_CA_C_b38	ATAD3C	-4.384	1.66e-05	-0.115473	47	0.026342	yes	ESPGSJ
chr1_1372909_G_A_b38	ATAD3C	-4.346	1.95e-05	-0.166674	6	0.038349	yes	ESPGSJ
chr1_1570587_C_T_b38	ATAD3C	-4.337	2.03e-05	-0.110493	51	0.025475	yes	ESPGSJ
chr1_1341550_GCA_G_b38	ATAD3C	-4.297	2.41e-05	-0.161463	8	0.037576	yes	ESPGSJ
chr1_1559703_G_C_b38	ATAD3C	-4.281	2.58e-05	-0.109005	51	0.025463	yes	ESPGSJ
chr1_1568548_G_A_b38	ATAD3C	-4.281	2.58e-05	-0.109005	51	0.025463	yes	ESPGSJ
chr1_1398218_C_A_b38	ATAD3C	-4.225	3.25e-05	-0.167504	7	0.039645	yes	ESPGSJ
chr1_1400756_GGA_G_b38	ATAD3C	-4.225	3.25e-05	-0.167504	7	0.039645	yes	ESPGSJ
chr1_1401954_G_T_b38	ATAD3C	-4.225	3.25e-05	-0.167504	7	0.039645	yes	ESPGSJ
chr1_1549967_C_G_b38	ATAD3C	-4.22	3.32e-05	-0.115588	27	0.027389	yes	ESPGSJ
chr1_1367292_A_AGT_b38	ATAD3C	4.215	3.39e-05	0.141312	10	0.033526	yes	ESPGSJ
chr1_1524202_G_A_b38	ATAD3C	-4.197	3.66e-05	-0.210062	12	0.050049	yes	ESPGSJ
chr1_1363898_C_T_b38	ATAD3C	4.156	4.33e-05	0.139611	10	0.033591	yes	ESPGSJ
chr1_1363986_C_T_b38	ATAD3C	4.156	4.33e-05	0.139611	10	0.033591	yes	ESPGSJ
chr1_1366529_TTAG_T_b38	ATAD3C	4.156	4.33e-05	0.139611	10	0.033591	yes	ESPGSJ
chr1_1456829_G_C_b38	ATAD3C	-4.146	4.52e-05	-0.134242	20	0.03238	yes	ESPGSJ
chr1_1456891_T_C_b38	ATAD3C	-4.093	5.61e-05	-0.108216	30	0.026441	yes	ESPGSJ
chr1_1533883_G_T_b38	ATAD3C	-4.081	5.89e-05	-0.190134	6	0.046591	yes	ESPGSJ
chr1_1551454_C_A_b38	ATAD3C	-4.066	6.26e-05	-0.098013	89	0.024106	yes	ESPGSJ
chr1_1361685_C_T_b38	ATAD3C	-4.061	6.38e-05	-0.135808	16	0.033442	yes	ESPGSJ
chr1_1368991_C_T_b38	ATAD3C	-4.054	6.56e-05	-0.147321	8	0.036336	yes	ESPGSJ
chr1_1522905_A_G_b38	ATAD3C	-4.02	7.52e-05	-0.185237	13	0.046075	yes	ESPGSJ
chr1_1537160_T_G_b38	ATAD3C	-4.015	7.68e-05	-0.102838	60	0.025613	yes	ESPGSJ
chr1_1364357_A_C_b38	ATAD3C	-3.98	8.82e-05	-0.143916	8	0.036158	yes	ESPGSJ
chr1_1368514_C_G_b38	ATAD3C	-3.98	8.82e-05	-0.143916	8	0.036158	yes	ESPGSJ
chr1_1217251_C_A_b38	ATAD3C	-3.975	9e-05	-0.148584	6	0.037378	yes	ESPGSJ
chr1_1548572_A_AC_b38	ATAD3C	-3.957	9.67e-05	-0.230302	4	0.058201	yes	ESPGSJ
chr1_1370430_T_C_b38	ATAD3C	-3.952	9.85e-05	-0.14524	8	0.036747	yes	ESPGSJ
chr1_1370584_G_C_b38	ATAD3C	-3.952	9.85e-05	-0.14524	8	0.036747	yes	ESPGSJ
chr1_1290968_C_G_b38	ATAD3C	-3.949	9.97e-05	-0.140002	25	0.03545	yes	ESPGSJ
chr1_1370532_C_T_b38	ATAD3C	-3.932	0.000107	-0.142669	8	0.036285	yes	ESPGSJ
chr1_1573429_CAAAAAAAAAAAAAAAAAA_C_b38	ATAD3C	-3.906	0.000118	-0.102224	50	0.026174	yes	ESPGSJ
chr1_1530002_A_G_b38	ATAD3C	-3.898	0.000122	-0.191083	13	0.049015	yes	ESPGSJ
chr1_1533018_T_C_b38	ATAD3C	-3.898	0.000122	-0.191083	13	0.049015	yes	ESPGSJ
chr1_1365566_G_A_b38	ATAD3C	3.888	0.000127	0.130124	10	0.033467	yes	ESPGSJ
chr1_1514366_A_G_b38	ATAD3C	-3.87	0.000136	-0.230007	3	0.05943	yes	ESPGSJ
chr1_1407565_C_A_b38	ATAD3C	-3.864	0.000139	-0.161214	6	0.041723	yes	ESPGSJ
chr1_1520875_A_G_b38	ATAD3C	-3.846	0.00015	-0.186136	13	0.048402	yes	ESPGSJ
chr1_1521518_G_A_b38	ATAD3C	-3.846	0.00015	-0.186136	13	0.048402	yes	ESPGSJ
chr1_1523187_A_G_b38	ATAD3C	-3.816	0.000168	-0.180772	15	0.047369	yes	ESPGSJ
chr1_1369009_T_C_b38	ATAD3C	-3.812	0.00017	-0.140525	8	0.036865	yes	ESPGSJ
chr1_1553018_CA_C_b38	ATAD3C	-3.806	0.000174	-0.110387	14	0.029002	yes	ESPGSJ
chr1_1369012_C_CG_b38	ATAD3C	-3.802	0.000177	-0.139989	8	0.036825	yes	ESPGSJ
chr1_1329973_GCGTGTGCCATGCA_G_b38	ATAD3C	-3.8	0.000178	-0.146166	7	0.038461	yes	ESPGSJ
chr1_1344048_G_A_b38	ATAD3C	-3.8	0.000178	-0.146166	7	0.038461	yes	ESPGSJ
chr1_1363880_A_G_b38	ATAD3C	-3.797	0.000181	-0.136527	8	0.035959	yes	ESPGSJ
chr1_1384546_C_T_b38	ATAD3C	-3.794	0.000183	-0.15647	6	0.041243	yes	ESPGSJ
chr1_1364253_C_G_b38	ATAD3C	-3.788	0.000187	-0.140966	8	0.037218	yes	ESPGSJ
chr1_1366511_GGTGA_G_b38	ATAD3C	-3.773	0.000197	-0.13803	8	0.03658	yes	ESPGSJ
chr1_1369282_G_A_b38	ATAD3C	-3.772	0.000198	-0.136979	8	0.036311	yes	ESPGSJ
chr1_1369320_GT_G_b38	ATAD3C	-3.772	0.000198	-0.136979	8	0.036311	yes	ESPGSJ
chr1_1369407_G_A_b38	ATAD3C	-3.772	0.000198	-0.136979	8	0.036311	yes	ESPGSJ
chr1_1369476_CTT_C_b38	ATAD3C	-3.772	0.000198	-0.136979	8	0.036311	yes	ESPGSJ
chr1_1369556_C_G_b38	ATAD3C	-3.772	0.000198	-0.136979	8	0.036311	yes	ESPGSJ
chr1_1369627_T_C_b38	ATAD3C	-3.772	0.000198	-0.136979	8	0.036311	yes	ESPGSJ
chr1_1369686_T_C_b38	ATAD3C	-3.772	0.000198	-0.136979	8	0.036311	yes	ESPGSJ
chr1_1369716_G_C_b38	ATAD3C	-3.772	0.000198	-0.136979	8	0.036311	yes	ESPGSJ
chr1_1369741_C_T_b38	ATAD3C	-3.772	0.000198	-0.136979	8	0.036311	yes	ESPGSJ
chr1_1369821_C_T_b38	ATAD3C	-3.772	0.000198	-0.136979	8	0.036311	yes	ESPGSJ
chr1_1370181_C_T_b38	ATAD3C	-3.772	0.000198	-0.136979	8	0.036311	yes	ESPGSJ
chr1_1370317_G_C_b38	ATAD3C	-3.772	0.000198	-0.136979	8	0.036311	yes	ESPGSJ
chr1_1370320_A_G_b38	ATAD3C	-3.772	0.000198	-0.136979	8	0.036311	yes	ESPGSJ
chr1_1379093_TG_T_b38	ATAD3C	-3.768	0.000201	-0.158914	5	0.042172	yes	ESPGSJ
chr1_1555871_T_C_b38	ATAD3C	-3.766	0.000203	-0.097642	41	0.025927	yes	ESPGSJ
chr1_1217733_G_A_b38	ATAD3C	-3.763	0.000205	-0.143544	6	0.038143	yes	ESPGSJ
chr1_1363688_C_T_b38	ATAD3C	-3.758	0.00021	-0.137359	8	0.036556	yes	ESPGSJ
chr1_1364099_CCA_C_b38	ATAD3C	-3.758	0.00021	-0.137359	8	0.036556	yes	ESPGSJ
chr1_1364102_TGTTG_T_b38	ATAD3C	-3.758	0.00021	-0.137359	8	0.036556	yes	ESPGSJ
chr1_1368763_G_A_b38	ATAD3C	-3.758	0.00021	-0.137359	8	0.036556	yes	ESPGSJ
chr1_1367462_T_C_b38	ATAD3C	-3.751	0.000215	-0.13643	8	0.036374	yes	ESPGSJ
chr1_1555179_A_G_b38	ATAD3C	-3.75	0.000216	-0.097087	40	0.025893	yes	ESPGSJ
chr1_1558347_G_A_b38	ATAD3C	-3.715	0.000247	-0.099696	35	0.026839	yes	ESPGSJ
chr1_1290261_C_A_b38	ATAD3C	-3.684	0.000277	-0.125693	18	0.03412	yes	ESPGSJ
chr1_1364282_T_G_b38	ATAD3C	-3.643	0.000322	-0.132519	8	0.036375	yes	ESPGSJ
chr1_1364694_T_C_b38	ATAD3C	-3.643	0.000322	-0.132519	8	0.036375	yes	ESPGSJ
chr1_1364721_C_T_b38	ATAD3C	-3.643	0.000322	-0.132519	8	0.036375	yes	ESPGSJ
chr1_1365160_A_G_b38	ATAD3C	-3.643	0.000322	-0.132519	8	0.036375	yes	ESPGSJ
chr1_1365198_C_T_b38	ATAD3C	-3.643	0.000322	-0.132519	8	0.036375	yes	ESPGSJ
chr1_1366008_A_G_b38	ATAD3C	-3.643	0.000322	-0.132519	8	0.036375	yes	ESPGSJ
chr1_1366062_T_C_b38	ATAD3C	-3.643	0.000322	-0.132519	8	0.036375	yes	ESPGSJ
chr1_1366145_TGTGAA_T_b38	ATAD3C	-3.643	0.000322	-0.132519	8	0.036375	yes	ESPGSJ
chr1_1366187_A_AGT_b38	ATAD3C	-3.643	0.000322	-0.132519	8	0.036375	yes	ESPGSJ
chr1_1366292_G_T_b38	ATAD3C	-3.643	0.000322	-0.132519	8	0.036375	yes	ESPGSJ
chr1_1366321_TGTGTGTAAATGG_T_b38	ATAD3C	-3.643	0.000322	-0.132519	8	0.036375	yes	ESPGSJ
chr1_1366453_G_T_b38	ATAD3C	-3.643	0.000322	-0.132519	8	0.036375	yes	ESPGSJ
chr1_1366726_T_G_b38	ATAD3C	-3.643	0.000322	-0.132519	8	0.036375	yes	ESPGSJ
chr1_1367258_T_A_b38	ATAD3C	-3.643	0.000322	-0.132519	8	0.036375	yes	ESPGSJ
chr1_1367297_GAA_G_b38	ATAD3C	-3.643	0.000322	-0.132519	8	0.036375	yes	ESPGSJ
chr1_1367300_T_TGA_b38	ATAD3C	-3.643	0.000322	-0.132519	8	0.036375	yes	ESPGSJ
chr1_1367329_A_AGT_b38	ATAD3C	-3.643	0.000322	-0.132519	8	0.036375	yes	ESPGSJ
chr1_1367373_T_TGTG_b38	ATAD3C	-3.643	0.000322	-0.132519	8	0.036375	yes	ESPGSJ
chr1_1367388_T_TTGG_b38	ATAD3C	-3.643	0.000322	-0.132519	8	0.036375	yes	ESPGSJ
chr1_1367511_ATGAG_A_b38	ATAD3C	-3.643	0.000322	-0.132519	8	0.036375	yes	ESPGSJ
chr1_1367593_G_A_b38	ATAD3C	-3.643	0.000322	-0.132519	8	0.036375	yes	ESPGSJ
chr1_1367602_GT_G_b38	ATAD3C	-3.643	0.000322	-0.132519	8	0.036375	yes	ESPGSJ
chr1_1367605_GAGTGAGTGTA_G_b38	ATAD3C	-3.643	0.000322	-0.132519	8	0.036375	yes	ESPGSJ
chr1_1367670_GGTGA_G_b38	ATAD3C	-3.643	0.000322	-0.132519	8	0.036375	yes	ESPGSJ
chr1_1367722_TTTTA_T_b38	ATAD3C	-3.643	0.000322	-0.132519	8	0.036375	yes	ESPGSJ
chr1_1367874_A_T_b38	ATAD3C	-3.643	0.000322	-0.132519	8	0.036375	yes	ESPGSJ
chr1_1367919_C_T_b38	ATAD3C	-3.643	0.000322	-0.132519	8	0.036375	yes	ESPGSJ
chr1_1367951_C_T_b38	ATAD3C	-3.643	0.000322	-0.132519	8	0.036375	yes	ESPGSJ
chr1_1367965_A_G_b38	ATAD3C	-3.643	0.000322	-0.132519	8	0.036375	yes	ESPGSJ
chr1_1367970_T_G_b38	ATAD3C	-3.643	0.000322	-0.132519	8	0.036375	yes	ESPGSJ
chr1_1367994_C_A_b38	ATAD3C	-3.643	0.000322	-0.132519	8	0.036375	yes	ESPGSJ
chr1_1368297_C_T_b38	ATAD3C	-3.643	0.000322	-0.132519	8	0.036375	yes	ESPGSJ
chr1_1367280_T_A_b38	ATAD3C	-3.642	0.000323	-0.132368	8	0.036343	yes	ESPGSJ
chr1_1364566_T_C_b38	ATAD3C	-3.628	0.00034	-0.132638	8	0.036556	yes	ESPGSJ
chr1_1316929_A_T_b38	ATAD3C	-3.606	0.00037	-0.13623	7	0.037783	yes	ESPGSJ
chr1_1553619_CAAAAAAA_C_b38	ATAD3C	-3.596	0.000384	-0.103787	19	0.028864	yes	ESPGSJ
chr1_1337898_A_G_b38	ATAD3C	3.574	0.000416	0.11538	9	0.032286	yes	ESPGSJ
chr1_1500745_A_C_b38	ATAD3C	-3.569	0.000422	-0.146951	25	0.041171	yes	ESPGSJ
chr1_1538924_C_A_b38	ATAD3C	-3.561	0.000436	-0.096018	29	0.026966	yes	ESPGSJ
chr1_1514211_A_G_b38	ATAD3C	-3.541	0.000468	-0.205253	5	0.057966	yes	ESPGSJ
chr1_1524911_C_T_b38	ATAD3C	-3.536	0.000477	-0.203957	7	0.057685	yes	ESPGSJ
chr1_1553791_CA_C_b38	ATAD3C	-3.534	0.00048	-0.103487	15	0.029283	yes	ESPGSJ
chr1_1367268_TGA_T_b38	ATAD3C	-3.525	0.000496	-0.127493	8	0.036165	yes	ESPGSJ
chr1_1533841_T_C_b38	ATAD3C	-3.498	0.000546	-0.107732	23	0.030794	yes	ESPGSJ
chr1_1497606_C_G_b38	ATAD3C	-3.486	0.000571	-0.122144	6	0.035038	yes	ESPGSJ
chr1_1306420_A_G_b38	ATAD3C	3.48	0.000583	0.138562	23	0.039814	yes	ESPGSJ
chr1_1366776_G_GAATT_b38	ATAD3C	-3.462	0.000623	-0.127692	8	0.036888	yes	ESPGSJ
chr1_1295039_T_C_b38	ATAD3C	-3.449	0.000651	-0.133761	23	0.038782	yes	ESPGSJ
chr1_1298561_T_C_b38	ATAD3C	-3.449	0.000651	-0.133761	23	0.038782	yes	ESPGSJ
chr1_1534226_C_T_b38	ATAD3C	-3.447	0.000656	-0.096486	36	0.027991	yes	ESPGSJ
chr1_1394041_G_A_b38	ATAD3C	-3.442	0.000668	-0.145324	4	0.042222	yes	ESPGSJ
chr1_1369803_C_CT_b38	ATAD3C	-3.419	0.000724	-0.119458	8	0.034941	yes	ESPGSJ
chr1_1300330_T_A_b38	ATAD3C	-3.41	0.000747	-0.131208	23	0.038474	yes	ESPGSJ
chr1_1301656_T_C_b38	ATAD3C	-3.41	0.000747	-0.131208	23	0.038474	yes	ESPGSJ
chr1_1366681_T_TGA_b38	ATAD3C	-3.407	0.000754	-0.124219	8	0.036455	yes	ESPGSJ
chr1_1525526_C_T_b38	ATAD3C	-3.405	0.00076	-0.191395	4	0.056207	yes	ESPGSJ
chr1_1518621_A_AC_b38	ATAD3C	-3.404	0.000763	-0.10744	13	0.031562	yes	ESPGSJ
chr1_1515567_A_C_b38	ATAD3C	-3.403	0.000765	-0.156911	11	0.046106	yes	ESPGSJ
chr1_1302795_T_TC_b38	ATAD3C	3.385	0.000816	0.094541	62	0.027931	yes	ESPGSJ
chr1_1366828_A_G_b38	ATAD3C	-3.382	0.000824	-0.133962	6	0.039607	yes	ESPGSJ
chr1_1527938_C_A_b38	ATAD3C	-3.366	0.000873	-0.193422	5	0.05747	yes	ESPGSJ
chr1_2369210_C_T_b38	ATAD3C	3.351	0.000917	0.079454	53	0.023708	yes	ESPGSJ
chr1_1450193_C_T_b38	ATAD3C	-3.339	0.000958	-0.158164	6	0.047371	yes	ESPGSJ
chr1_1375678_TA_T_b38	ATAD3C	3.338	0.00096	0.114292	14	0.034239	yes	ESPGSJ
chr1_1417051_CA_C_b38	ATAD3C	-3.332	0.00098	-0.127569	7	0.038282	yes	ESPGSJ
chr1_2351827_T_C_b38	ATAD3C	-3.325	0.001	-0.101434	21	0.030502	yes	ESPGSJ
chr1_1370553_CAAA_C_b38	ATAD3C	-3.318	0.00103	-0.12646	6	0.038114	yes	ESPGSJ
chr1_1280044_T_C_b38	ATAD3C	-3.314	0.00104	-0.092793	46	0.028	yes	ESPGSJ
chr1_1307327_A_G_b38	ATAD3C	3.305	0.00108	0.128884	23	0.038996	yes	ESPGSJ
chr1_1695005_CAA_C_b38	ATAD3C	3.285	0.00115	0.094837	30	0.028873	yes	ESPGSJ
chr1_1307603_G_A_b38	ATAD3C	3.268	0.00122	0.126419	23	0.038686	yes	ESPGSJ
chr1_1518285_T_C_b38	ATAD3C	-3.247	0.00131	-0.104305	34	0.032126	yes	ESPGSJ
chr1_1526169_C_T_b38	ATAD3C	-3.243	0.00133	-0.15866	13	0.048922	yes	ESPGSJ
chr1_1366941_T_TGTGTGCA_b38	ATAD3C	3.239	0.00135	0.140906	3	0.043509	yes	ESPGSJ
chr1_2369355_G_GA_b38	ATAD3C	3.226	0.00141	0.084555	33	0.02621	yes	ESPGSJ
chr1_2376477_A_C_b38	ATAD3C	3.216	0.00146	0.075192	86	0.02338	yes	ESPGSJ
chr1_2343699_C_T_b38	ATAD3C	3.212	0.00147	0.078807	45	0.024532	yes	ESPGSJ
chr1_2078844_C_CT_b38	ATAD3C	3.186	0.00161	0.14805	3	0.046463	yes	ESPGSJ
chr1_1585345_C_T_b38	ATAD3C	3.18	0.00164	0.088054	32	0.027688	yes	ESPGSJ
chr1_1587547_C_T_b38	ATAD3C	3.176	0.00166	0.089737	31	0.028256	yes	ESPGSJ
chr1_1533754_T_C_b38	ATAD3C	-3.171	0.00169	-0.095594	26	0.030146	yes	ESPGSJ
chr1_2343517_G_A_b38	ATAD3C	3.15	0.00181	0.077065	45	0.024466	yes	ESPGSJ
chr1_1388565_GTC_G_b38	ATAD3C	3.11	0.00207	0.105394	10	0.033892	yes	ESPGSJ
chr1_1558204_T_TAAAAAA_b38	ATAD3C	-3.09	0.00221	-0.085117	25	0.027544	yes	ESPGSJ
chr1_1259424_T_C_b38	ATAD3C	-3.085	0.00224	-0.0952	36	0.030856	yes	ESPGSJ
chr1_1185051_G_A_b38	ATAD3C	-3.071	0.00235	-0.13908	4	0.045294	yes	ESPGSJ
chr1_1084906_A_C_b38	ATAD3C	-3.065	0.00239	-0.229464	5	0.074856	yes	ESPGSJ
chr1_1523022_A_G_b38	ATAD3C	-3.045	0.00256	-0.126811	12	0.041649	yes	ESPGSJ
chr1_1120024_C_CA_b38	ATAD3C	-3.04	0.0026	-0.159683	4	0.052533	yes	ESPGSJ
chr1_1516110_G_A_b38	ATAD3C	-3.032	0.00266	-0.158293	7	0.052203	yes	ESPGSJ
chr1_1385919_A_AG_b38	ATAD3C	3.029	0.00269	0.12859	9	0.042449	yes	ESPGSJ
chr1_1471663_A_C_b38	ATAD3C	-3.013	0.00283	-0.179346	4	0.05953	yes	ESPGSJ
chr1_1587397_A_AT_b38	ATAD3C	3.006	0.00289	0.082649	34	0.02749	yes	ESPGSJ
chr1_1579410_AT_A_b38	ATAD3C	-3	0.00294	-0.088899	23	0.029629	yes	ESPGSJ
chr1_1527386_C_T_b38	ATAD3C	-2.991	0.00303	-0.146482	14	0.048966	yes	ESPGSJ
chr1_1370553_CA_C_b38	ATAD3C	2.973	0.00322	0.083138	87	0.027968	yes	ESPGSJ
chr1_1419135_C_G_b38	ATAD3C	-2.97	0.00324	-0.122911	21	0.041382	yes	ESPGSJ
chr1_1120889_C_T_b38	ATAD3C	2.963	0.00331	0.119476	3	0.040323	yes	ESPGSJ
chr1_2348700_C_T_b38	ATAD3C	2.951	0.00344	0.074866	42	0.025369	yes	ESPGSJ
chr1_2360913_G_A_b38	ATAD3C	-2.947	0.00348	-0.090626	17	0.030751	yes	ESPGSJ
chr1_2409065_C_T_b38	ATAD3C	2.938	0.00359	0.077341	31	0.026327	yes	ESPGSJ
chr1_2070779_G_A_b38	ATAD3C	-2.927	0.00371	-0.200254	6	0.068413	yes	ESPGSJ
chr1_1216593_G_C_b38	ATAD3C	-2.898	0.00406	-0.090978	14	0.031398	yes	ESPGSJ
chr1_2351241_C_T_b38	ATAD3C	2.895	0.0041	0.071096	48	0.024562	yes	ESPGSJ
chr1_2395636_C_T_b38	ATAD3C	2.887	0.0042	0.076992	29	0.026666	yes	ESPGSJ
chr1_1325753_G_T_b38	ATAD3C	-2.88	0.00429	-0.115965	5	0.04026	yes	ESPGSJ
chr1_1518541_T_C_b38	ATAD3C	-2.87	0.00442	-0.089429	23	0.031157	yes	ESPGSJ
chr1_1278491_C_CT_b38	ATAD3C	-2.858	0.0046	-0.112542	8	0.039383	yes	ESPGSJ
chr1_1050080_T_C_b38	ATAD3C	-2.841	0.00483	-0.13657	9	0.048071	yes	ESPGSJ
chr1_1215852_T_C_b38	ATAD3C	-2.833	0.00495	-0.088693	14	0.031304	yes	ESPGSJ
chr1_1501260_A_AT_b38	ATAD3C	-2.833	0.00496	-0.095362	13	0.033663	yes	ESPGSJ
chr1_1533653_C_T_b38	ATAD3C	-2.83	0.005	-0.154156	5	0.054472	yes	ESPGSJ
chr1_1120417_A_G_b38	ATAD3C	2.821	0.00514	0.113436	3	0.040213	yes	ESPGSJ
chr1_1122042_G_C_b38	ATAD3C	2.821	0.00514	0.113436	3	0.040213	yes	ESPGSJ
chr1_1619986_T_C_b38	ATAD3C	2.818	0.00519	0.07985	28	0.028338	yes	ESPGSJ
chr1_1170732_A_G_b38	ATAD3C	-2.804	0.00541	-0.226574	20	0.080806	yes	ESPGSJ
chr1_1122128_C_G_b38	ATAD3C	2.802	0.00544	0.112469	3	0.040138	yes	ESPGSJ
chr1_1122144_C_T_b38	ATAD3C	2.802	0.00544	0.112469	3	0.040138	yes	ESPGSJ
chr1_1422081_C_T_b38	ATAD3C	-2.8	0.00547	-0.117081	21	0.041815	yes	ESPGSJ
chr1_2404771_C_T_b38	ATAD3C	2.8	0.00547	0.073532	32	0.026262	yes	ESPGSJ
chr1_1587413_C_T_b38	ATAD3C	2.798	0.0055	0.075603	38	0.027018	yes	ESPGSJ
chr1_1367028_A_G_b38	ATAD3C	2.793	0.0056	0.108978	6	0.039023	yes	ESPGSJ
chr1_1120273_C_G_b38	ATAD3C	2.789	0.00566	0.111584	3	0.040013	yes	ESPGSJ
chr1_1120521_C_A_b38	ATAD3C	2.789	0.00566	0.111584	3	0.040013	yes	ESPGSJ
chr1_1121559_T_A_b38	ATAD3C	2.789	0.00566	0.111584	3	0.040013	yes	ESPGSJ
chr1_1122649_A_G_b38	ATAD3C	2.789	0.00566	0.111584	3	0.040013	yes	ESPGSJ
chr1_2344761_T_C_b38	ATAD3C	-2.781	0.0058	-0.084575	19	0.030412	yes	ESPGSJ
chr1_2395479_G_A_b38	ATAD3C	2.776	0.00589	0.073197	30	0.026371	yes	ESPGSJ
chr1_1499586_C_CT_b38	ATAD3C	-2.773	0.00594	-0.100654	11	0.036303	yes	ESPGSJ
chr1_1230159_G_A_b38	ATAD3C	-2.772	0.00595	-0.084171	21	0.03036	yes	ESPGSJ
chr1_1425013_C_T_b38	ATAD3C	-2.753	0.00629	-0.106104	22	0.038535	yes	ESPGSJ
chr1_1533178_A_G_b38	ATAD3C	-2.751	0.00634	-0.148706	11	0.054056	yes	ESPGSJ
chr1_1117566_G_T_b38	ATAD3C	2.745	0.00645	0.10961	3	0.039929	yes	ESPGSJ
chr1_1118447_T_TG_b38	ATAD3C	2.745	0.00645	0.10961	3	0.039929	yes	ESPGSJ
chr1_1586626_C_T_b38	ATAD3C	2.744	0.00647	0.073771	39	0.026884	yes	ESPGSJ
chr1_2405593_C_T_b38	ATAD3C	2.726	0.00682	0.071206	34	0.026121	yes	ESPGSJ
chr1_1383798_AG_A_b38	ATAD3C	2.7	0.00736	0.115087	5	0.04262	yes	ESPGSJ
chr1_1586425_A_G_b38	ATAD3C	2.69	0.00759	0.07205	40	0.026789	yes	ESPGSJ
chr1_1734812_G_A_b38	ATAD3C	2.688	0.00763	0.086143	25	0.032046	yes	ESPGSJ
chr1_2404530_C_G_b38	ATAD3C	2.684	0.00773	0.067943	39	0.025319	yes	ESPGSJ
chr1_2369118_G_A_b38	ATAD3C	2.676	0.0079	0.083647	13	0.031258	yes	ESPGSJ
chr1_1571434_C_CA_b38	ATAD3C	-2.675	0.00791	-0.075594	30	0.028256	yes	ESPGSJ
chr1_1586679_C_T_b38	ATAD3C	2.663	0.00821	0.0716	39	0.02689	yes	ESPGSJ
chr1_1421170_A_G_b38	ATAD3C	-2.652	0.00847	-0.110258	16	0.041577	yes	ESPGSJ
chr1_1531133_G_A_b38	ATAD3C	-2.641	0.00873	-0.136564	9	0.051704	yes	ESPGSJ
chr1_1363601_A_AT_b38	ATAD3C	2.635	0.00889	0.06089	84	0.023108	yes	ESPGSJ
chr1_633553_A_G_b38	ATAD3C	2.627	0.00911	0.088945	7	0.033862	yes	ESPGSJ
chr1_1531448_C_T_b38	ATAD3C	-2.623	0.0092	-0.140188	12	0.05344	yes	ESPGSJ
chr1_1531601_A_G_b38	ATAD3C	-2.623	0.0092	-0.140188	12	0.05344	yes	ESPGSJ
chr1_1532105_T_C_b38	ATAD3C	-2.623	0.0092	-0.140188	12	0.05344	yes	ESPGSJ
chr1_1533095_G_A_b38	ATAD3C	-2.623	0.0092	-0.140188	12	0.05344	yes	ESPGSJ
chr1_1533253_C_T_b38	ATAD3C	-2.623	0.0092	-0.140188	12	0.05344	yes	ESPGSJ
chr1_1303800_G_A_b38	ATAD3C	-2.603	0.00974	-0.105348	5	0.04047	yes	ESPGSJ
chr1_633678_C_T_b38	ATAD3C	2.6	0.00981	0.109996	4	0.042298	yes	ESPGSJ
chr1_1512376_G_C_b38	ATAD3C	-2.599	0.00986	-0.089695	23	0.034514	yes	ESPGSJ
chr1_1585290_TTTTG_T_b38	ATAD3C	2.598	0.00989	0.068859	40	0.026505	yes	ESPGSJ
chr1_1450636_A_G_b38	ATAD3C	-4.811	2.49e-06	-0.161248	7	0.03352	no	ESPGSJ
chr1_1453870_A_C_b38	ATAD3C	-4.553	7.97e-06	-0.149152	8	0.032761	no	ESPGSJ
chr1_1575935_T_C_b38	ATAD3C	-4.494	1.03e-05	-0.116785	50	0.025988	no	ESPGSJ
chr1_1366883_G_GGTGTGAATTGGTGTAGTGTGAATGAGT_b38	ATAD3C	-4.381	1.69e-05	-0.204121	3	0.046597	no	ESPGSJ
chr1_1565680_A_AG_b38	ATAD3C	-4.321	2.17e-05	-0.109745	53	0.025396	no	ESPGSJ
chr1_1453961_C_T_b38	ATAD3C	-4.302	2.35e-05	-0.149465	6	0.03474	no	ESPGSJ
chr1_1571986_G_A_b38	ATAD3C	-4.169	4.11e-05	-0.104808	44	0.02514	no	ESPGSJ
chr1_1363456_CAG_C_b38	ATAD3C	3.949	9.97e-05	0.119306	19	0.030208	no	ESPGSJ
chr1_1580890_C_T_b38	ATAD3C	-3.811	0.000171	-0.107121	18	0.02811	no	ESPGSJ
chr1_1368177_G_C_b38	ATAD3C	-3.806	0.000174	-0.140011	9	0.036788	no	ESPGSJ
chr1_2357096_C_G_b38	ATAD3C	-3.699	0.000261	-0.125583	8	0.033947	no	ESPGSJ
chr1_1451028_T_A_b38	ATAD3C	-3.683	0.000277	-0.123245	8	0.03346	no	ESPGSJ
chr1_1573776_A_G_b38	ATAD3C	-3.645	0.00032	-0.101143	19	0.027748	no	ESPGSJ
chr1_1366835_G_GGTGA_b38	ATAD3C	-3.566	0.000427	-0.142541	6	0.039968	no	ESPGSJ
chr1_1554548_T_C_b38	ATAD3C	-3.55	0.000454	-0.092568	39	0.026078	no	ESPGSJ
chr1_1612560_G_GT_b38	ATAD3C	3.543	0.000465	0.093095	36	0.026277	no	ESPGSJ
chr1_1366830_G_A_b38	ATAD3C	-3.523	5e-04	-0.14146	6	0.040157	no	ESPGSJ
chr1_2366312_C_T_b38	ATAD3C	-3.501	0.000541	-0.118989	8	0.033987	no	ESPGSJ
chr1_2358041_A_G_b38	ATAD3C	-3.493	0.000556	-0.119843	7	0.034306	no	ESPGSJ
chr1_1366951_A_AGT_b38	ATAD3C	3.433	0.000689	0.149809	3	0.043636	no	ESPGSJ
chr1_2343937_T_G_b38	ATAD3C	3.432	0.000691	0.083538	60	0.024339	no	ESPGSJ
chr1_1365036_T_TAA_b38	ATAD3C	-3.429	0.000698	-0.132123	6	0.038527	no	ESPGSJ
chr1_1579717_T_A_b38	ATAD3C	-3.412	0.000742	-0.094059	20	0.027568	no	ESPGSJ
chr1_2350540_T_C_b38	ATAD3C	-3.399	0.000778	-0.112945	9	0.033233	no	ESPGSJ
chr1_2361249_C_G_b38	ATAD3C	-3.381	0.000826	-0.116934	7	0.034582	no	ESPGSJ
chr1_2357413_G_A_b38	ATAD3C	-3.321	0.00102	-0.115368	7	0.034738	no	ESPGSJ
chr1_2358817_G_A_b38	ATAD3C	-3.321	0.00102	-0.115368	7	0.034738	no	ESPGSJ
chr1_1554241_T_C_b38	ATAD3C	-3.28	0.00117	-0.092571	23	0.028222	no	ESPGSJ
chr1_1554290_C_T_b38	ATAD3C	-3.27	0.00121	-0.086128	39	0.026338	no	ESPGSJ
chr1_2345557_C_T_b38	ATAD3C	-3.257	0.00127	-0.107649	9	0.033048	no	ESPGSJ
chr1_1189019_C_G_b38	ATAD3C	3.253	0.00128	0.131277	4	0.040355	no	ESPGSJ
chr1_2351874_C_G_b38	ATAD3C	-3.226	0.00141	-0.110364	8	0.034216	no	ESPGSJ
chr1_2354291_A_G_b38	ATAD3C	-3.226	0.00141	-0.110364	8	0.034216	no	ESPGSJ
chr1_1191942_G_A_b38	ATAD3C	3.22	0.00144	0.130712	4	0.040598	no	ESPGSJ
chr1_1187013_A_AT_b38	ATAD3C	3.206	0.0015	0.129653	4	0.040438	no	ESPGSJ
chr1_1185961_C_T_b38	ATAD3C	3.185	0.00161	0.120304	6	0.037766	no	ESPGSJ
chr1_1186245_C_G_b38	ATAD3C	3.185	0.00161	0.120304	6	0.037766	no	ESPGSJ
chr1_2350943_C_T_b38	ATAD3C	-3.17	0.0017	-0.108094	8	0.034098	no	ESPGSJ
chr1_1195100_G_A_b38	ATAD3C	3.149	0.00182	0.120041	6	0.038116	no	ESPGSJ
chr1_1189968_T_C_b38	ATAD3C	3.145	0.00184	0.124361	5	0.039545	no	ESPGSJ
chr1_1190856_G_A_b38	ATAD3C	3.145	0.00184	0.124361	5	0.039545	no	ESPGSJ
chr1_1186816_A_G_b38	ATAD3C	3.138	0.00188	0.121742	6	0.038792	no	ESPGSJ
chr1_1186644_T_C_b38	ATAD3C	3.112	0.00206	0.123801	5	0.039783	no	ESPGSJ
chr1_1186939_C_T_b38	ATAD3C	3.112	0.00206	0.123801	5	0.039783	no	ESPGSJ
chr1_1187136_G_A_b38	ATAD3C	3.112	0.00206	0.123801	5	0.039783	no	ESPGSJ
chr1_1187726_G_A_b38	ATAD3C	3.112	0.00206	0.123801	5	0.039783	no	ESPGSJ
chr1_1188877_A_G_b38	ATAD3C	3.112	0.00206	0.123801	5	0.039783	no	ESPGSJ
chr1_1189511_G_A_b38	ATAD3C	3.112	0.00206	0.123801	5	0.039783	no	ESPGSJ
chr1_1190875_G_C_b38	ATAD3C	3.112	0.00206	0.123801	5	0.039783	no	ESPGSJ
chr1_1192000_G_A_b38	ATAD3C	3.112	0.00206	0.123801	5	0.039783	no	ESPGSJ
chr1_1192127_G_A_b38	ATAD3C	3.112	0.00206	0.123801	5	0.039783	no	ESPGSJ
chr1_1192143_C_T_b38	ATAD3C	3.112	0.00206	0.123801	5	0.039783	no	ESPGSJ
chr1_1192301_G_A_b38	ATAD3C	3.112	0.00206	0.123801	5	0.039783	no	ESPGSJ
chr1_1192951_G_T_b38	ATAD3C	3.112	0.00206	0.123801	5	0.039783	no	ESPGSJ
chr1_1193049_G_A_b38	ATAD3C	3.112	0.00206	0.123801	5	0.039783	no	ESPGSJ
chr1_1194292_G_T_b38	ATAD3C	3.112	0.00206	0.123801	5	0.039783	no	ESPGSJ
chr1_1194327_A_G_b38	ATAD3C	3.112	0.00206	0.123801	5	0.039783	no	ESPGSJ
chr1_1194713_C_T_b38	ATAD3C	3.112	0.00206	0.123801	5	0.039783	no	ESPGSJ
chr1_2348949_CCT_C_b38	ATAD3C	-3.109	0.00208	-0.10642	8	0.034232	no	ESPGSJ
chr1_1554246_C_T_b38	ATAD3C	-3.108	0.00208	-0.089417	24	0.028767	no	ESPGSJ
chr1_2354969_C_T_b38	ATAD3C	-3.104	0.00211	-0.108119	7	0.034833	no	ESPGSJ
chr1_2355671_C_T_b38	ATAD3C	-3.104	0.00211	-0.108119	7	0.034833	no	ESPGSJ
chr1_2356158_C_T_b38	ATAD3C	-3.104	0.00211	-0.108119	7	0.034833	no	ESPGSJ
chr1_2347995_C_T_b38	ATAD3C	-3.096	0.00216	-0.105901	8	0.034202	no	ESPGSJ
chr1_1993854_C_T_b38	ATAD3C	3.087	0.00223	0.107721	9	0.034897	no	ESPGSJ
chr1_1187008_G_A_b38	ATAD3C	3.079	0.00229	0.124565	4	0.040457	no	ESPGSJ
chr1_1546845_A_AAAC_b38	ATAD3C	-3.063	0.00241	-0.128603	6	0.041992	no	ESPGSJ
chr1_1191614_G_A_b38	ATAD3C	3.018	0.00279	0.119883	5	0.039725	no	ESPGSJ
chr1_1186414_G_A_b38	ATAD3C	2.984	0.0031	0.115196	6	0.038605	no	ESPGSJ
chr1_2367644_G_A_b38	ATAD3C	2.966	0.00328	0.07705	45	0.025977	no	ESPGSJ
chr1_1187016_C_T_b38	ATAD3C	2.931	0.00366	0.118292	4	0.040357	no	ESPGSJ
chr1_2389113_C_CA_b38	ATAD3C	2.906	0.00396	0.069794	62	0.02402	no	ESPGSJ
chr1_2348703_A_G_b38	ATAD3C	-2.89	0.00417	-0.100714	8	0.034855	no	ESPGSJ
chr1_1199253_C_T_b38	ATAD3C	2.88	0.00429	0.110214	6	0.038268	no	ESPGSJ
chr1_818464_CCT_C_b38	ATAD3C	-2.875	0.00435	-0.089356	19	0.031076	no	ESPGSJ
chr1_818469_G_T_b38	ATAD3C	-2.875	0.00435	-0.089356	19	0.031076	no	ESPGSJ
chr1_1378484_AT_A_b38	ATAD3C	2.853	0.00467	0.084855	62	0.029746	no	ESPGSJ
chr1_1589618_A_T_b38	ATAD3C	2.82	0.00515	0.080225	25	0.028447	no	ESPGSJ
chr1_1199327_G_A_b38	ATAD3C	2.816	0.00522	0.110831	6	0.039359	no	ESPGSJ
chr1_1584235_A_AT_b38	ATAD3C	2.805	0.0054	0.072525	47	0.025858	no	ESPGSJ
chr1_632403_T_C_b38	ATAD3C	2.799	0.00548	0.132373	10	0.047286	no	ESPGSJ
chr1_1135061_C_T_b38	ATAD3C	-2.796	0.00554	-0.0908	9	0.032475	no	ESPGSJ
chr1_1279400_C_CTTT_b38	ATAD3C	-2.793	0.0056	-0.148396	6	0.053138	no	ESPGSJ
chr1_1188054_T_A_b38	ATAD3C	-2.785	0.00573	-0.084885	13	0.030484	no	ESPGSJ
chr1_1210101_CAA_C_b38	ATAD3C	-2.767	0.00604	-0.116089	3	0.041955	no	ESPGSJ
chr1_877371_T_C_b38	ATAD3C	2.76	0.00617	0.213634	4	0.07741	no	ESPGSJ
chr1_1197405_C_T_b38	ATAD3C	2.75	0.00635	0.107425	6	0.039062	no	ESPGSJ
chr1_1197586_C_A_b38	ATAD3C	2.75	0.00635	0.107425	6	0.039062	no	ESPGSJ
chr1_2363826_A_AT_b38	ATAD3C	2.738	0.00658	0.128424	5	0.046896	no	ESPGSJ
chr1_1167770_G_A_b38	ATAD3C	-2.715	0.00705	-0.073352	24	0.027017	no	ESPGSJ
chr1_1562444_C_T_b38	ATAD3C	-2.712	0.00712	-0.109889	4	0.040527	no	ESPGSJ
chr1_2388775_CAAAA_C_b38	ATAD3C	2.711	0.00713	0.085015	24	0.031361	no	ESPGSJ
chr1_1551523_T_C_b38	ATAD3C	-2.683	0.00775	-0.076357	19	0.028462	no	ESPGSJ
chr1_1625951_G_A_b38	ATAD3C	2.683	0.00775	0.07181	35	0.026769	no	ESPGSJ
chr1_1303959_T_G_b38	ATAD3C	2.679	0.00783	0.111265	16	0.04153	no	ESPGSJ
chr1_1197874_G_A_b38	ATAD3C	2.675	0.00791	0.107237	5	0.040084	no	ESPGSJ
chr1_1363438_C_CTT_b38	ATAD3C	2.675	0.00792	0.076721	28	0.028682	no	ESPGSJ
chr1_1296939_G_A_b38	ATAD3C	-2.667	0.0081	-0.109266	15	0.040967	no	ESPGSJ
chr1_1570568_AC_A_b38	ATAD3C	-2.647	0.00859	-0.074539	22	0.028159	no	ESPGSJ
chr1_1388583_CTA_C_b38	ATAD3C	-2.64	0.00877	-0.116753	3	0.044229	no	ESPGSJ
chr1_1568428_C_G_b38	ATAD3C	-2.598	0.00988	-0.070094	24	0.02698	no	ESPGSJ
chr1_1443457_T_C_b38	ATAD3C	-9.129	2.79e-18	-0.151632	60	0.016609	yes	ESPMCS
chr1_1440834_C_G_b38	ATAD3C	-8.98	8.77e-18	-0.14894	57	0.016585	yes	ESPMCS
chr1_1445187_T_G_b38	ATAD3C	-8.866	2.09e-17	-0.147032	54	0.016583	yes	ESPMCS
chr1_1440430_C_G_b38	ATAD3C	-8.692	7.73e-17	-0.144814	33	0.01666	yes	ESPMCS
chr1_1445240_A_G_b38	ATAD3C	-8.252	1.96e-15	-0.139969	59	0.016961	yes	ESPMCS
chr1_1441187_A_G_b38	ATAD3C	-7.894	2.5e-14	-0.137514	41	0.01742	yes	ESPMCS
chr1_1439454_A_G_b38	ATAD3C	-7.804	4.67e-14	-0.130584	54	0.016732	yes	ESPMCS
chr1_1436388_CA_C_b38	ATAD3C	-7.689	1.04e-13	-0.133481	41	0.017361	yes	ESPMCS
chr1_1436079_A_G_b38	ATAD3C	-7.648	1.37e-13	-0.126283	62	0.016512	yes	ESPMCS
chr1_1433374_T_C_b38	ATAD3C	-7.587	2.08e-13	-0.124455	64	0.016404	yes	ESPMCS
chr1_1448915_G_A_b38	ATAD3C	-7.376	8.59e-13	-0.128785	40	0.01746	yes	ESPMCS
chr1_1577491_A_AC_b38	ATAD3C	-7.204	2.68e-12	-0.109887	79	0.015254	yes	ESPMCS
chr1_1453552_G_A_b38	ATAD3C	-7.172	3.3e-12	-0.12953	24	0.018061	yes	ESPMCS
chr1_1455134_T_G_b38	ATAD3C	-7.172	3.3e-12	-0.12953	24	0.018061	yes	ESPMCS
chr1_1455337_A_G_b38	ATAD3C	-7.172	3.3e-12	-0.12953	24	0.018061	yes	ESPMCS
chr1_1455495_C_T_b38	ATAD3C	-7.172	3.3e-12	-0.12953	24	0.018061	yes	ESPMCS
chr1_1455924_T_C_b38	ATAD3C	-7.162	3.52e-12	-0.12891	24	0.018	yes	ESPMCS
chr1_1453703_A_G_b38	ATAD3C	-7.16	3.56e-12	-0.129588	54	0.018098	yes	ESPMCS
chr1_1454092_A_G_b38	ATAD3C	-7.16	3.56e-12	-0.129588	54	0.018098	yes	ESPMCS
chr1_1455617_T_G_b38	ATAD3C	-7.096	5.41e-12	-0.128176	54	0.018064	yes	ESPMCS
chr1_1454770_T_C_b38	ATAD3C	-7.052	7.16e-12	-0.127896	54	0.018136	yes	ESPMCS
chr1_1452825_AAAG_A_b38	ATAD3C	-7.041	7.68e-12	-0.127534	24	0.018112	yes	ESPMCS
chr1_1573654_T_C_b38	ATAD3C	-7.03	8.25e-12	-0.109092	77	0.015518	yes	ESPMCS
chr1_1574445_A_G_b38	ATAD3C	-7.03	8.25e-12	-0.109092	77	0.015518	yes	ESPMCS
chr1_1471992_T_C_b38	ATAD3C	-7.022	8.7e-12	-0.118589	68	0.016889	yes	ESPMCS
chr1_1449831_A_G_b38	ATAD3C	-7.008	9.52e-12	-0.129649	54	0.018501	yes	ESPMCS
chr1_1452511_A_G_b38	ATAD3C	-6.97	1.21e-11	-0.12676	54	0.018186	yes	ESPMCS
chr1_1452888_C_A_b38	ATAD3C	-6.97	1.21e-11	-0.12676	54	0.018186	yes	ESPMCS
chr1_1452909_A_C_b38	ATAD3C	-6.97	1.21e-11	-0.12676	54	0.018186	yes	ESPMCS
chr1_1454315_C_T_b38	ATAD3C	-6.963	1.27e-11	-0.126764	46	0.018205	yes	ESPMCS
chr1_1575724_G_C_b38	ATAD3C	-6.952	1.36e-11	-0.107435	75	0.015454	yes	ESPMCS
chr1_1426261_C_T_b38	ATAD3C	-6.909	1.79e-11	-0.119305	57	0.017269	yes	ESPMCS
chr1_1426810_C_G_b38	ATAD3C	-6.909	1.79e-11	-0.119305	57	0.017269	yes	ESPMCS
chr1_1456891_T_C_b38	ATAD3C	-6.877	2.18e-11	-0.110237	38	0.016029	yes	ESPMCS
chr1_1575421_C_T_b38	ATAD3C	-6.83	2.95e-11	-0.105207	76	0.015404	yes	ESPMCS
chr1_1457033_A_C_b38	ATAD3C	-6.817	3.2e-11	-0.122342	25	0.017948	yes	ESPMCS
chr1_1428969_T_C_b38	ATAD3C	-6.623	1.06e-10	-0.114909	58	0.017349	yes	ESPMCS
chr1_1430190_A_C_b38	ATAD3C	-6.601	1.21e-10	-0.114795	58	0.01739	yes	ESPMCS
chr1_1431450_A_G_b38	ATAD3C	-6.601	1.21e-10	-0.114795	58	0.01739	yes	ESPMCS
chr1_1431537_G_C_b38	ATAD3C	-6.54	1.77e-10	-0.11372	58	0.017389	yes	ESPMCS
chr1_1557495_CAT_C_b38	ATAD3C	-6.387	4.45e-10	-0.101601	76	0.015909	yes	ESPMCS
chr1_1543500_T_G_b38	ATAD3C	-6.381	4.59e-10	-0.100888	72	0.01581	yes	ESPMCS
chr1_1541864_T_C_b38	ATAD3C	-6.358	5.25e-10	-0.101334	75	0.015937	yes	ESPMCS
chr1_1558726_C_CA_b38	ATAD3C	-6.339	5.88e-10	-0.100899	76	0.015916	yes	ESPMCS
chr1_1561821_A_C_b38	ATAD3C	-6.339	5.88e-10	-0.100899	76	0.015916	yes	ESPMCS
chr1_1551557_A_AG_b38	ATAD3C	-6.336	6.02e-10	-0.100864	75	0.01592	yes	ESPMCS
chr1_1551559_A_T_b38	ATAD3C	-6.336	6.02e-10	-0.100864	75	0.01592	yes	ESPMCS
chr1_1550064_GC_G_b38	ATAD3C	-6.292	7.78e-10	-0.099297	73	0.015781	yes	ESPMCS
chr1_1550068_C_A_b38	ATAD3C	-6.292	7.78e-10	-0.099297	73	0.015781	yes	ESPMCS
chr1_1430908_A_G_b38	ATAD3C	-6.287	8.01e-10	-0.109124	58	0.017356	yes	ESPMCS
chr1_1559750_C_CAG_b38	ATAD3C	-6.264	9.2e-10	-0.096989	83	0.015484	yes	ESPMCS
chr1_1561628_T_C_b38	ATAD3C	-6.264	9.2e-10	-0.096989	83	0.015484	yes	ESPMCS
chr1_1563918_A_G_b38	ATAD3C	-6.264	9.2e-10	-0.096989	83	0.015484	yes	ESPMCS
chr1_1565561_A_G_b38	ATAD3C	-6.264	9.2e-10	-0.096989	83	0.015484	yes	ESPMCS
chr1_1566086_G_A_b38	ATAD3C	-6.264	9.2e-10	-0.096989	83	0.015484	yes	ESPMCS
chr1_1567715_G_A_b38	ATAD3C	-6.264	9.2e-10	-0.096989	83	0.015484	yes	ESPMCS
chr1_1567719_A_C_b38	ATAD3C	-6.264	9.2e-10	-0.096989	83	0.015484	yes	ESPMCS
chr1_1569875_C_T_b38	ATAD3C	-6.264	9.2e-10	-0.096989	83	0.015484	yes	ESPMCS
chr1_1565105_CAAGGCAGGCGGATCATG_C_b38	ATAD3C	-6.263	9.26e-10	-0.096998	83	0.015488	yes	ESPMCS
chr1_1538787_A_G_b38	ATAD3C	-6.25	1e-09	-0.097121	82	0.015541	yes	ESPMCS
chr1_1573079_A_G_b38	ATAD3C	-6.236	1.08e-09	-0.096564	82	0.015484	yes	ESPMCS
chr1_1547630_G_A_b38	ATAD3C	-6.233	1.1e-09	-0.095022	73	0.015244	yes	ESPMCS
chr1_1451787_A_C_b38	ATAD3C	-6.225	1.15e-09	-0.112291	45	0.018038	yes	ESPMCS
chr1_1549590_C_G_b38	ATAD3C	-6.207	1.28e-09	-0.095777	80	0.01543	yes	ESPMCS
chr1_1542773_T_C_b38	ATAD3C	-6.204	1.3e-09	-0.098653	73	0.015901	yes	ESPMCS
chr1_1542793_C_G_b38	ATAD3C	-6.204	1.3e-09	-0.098653	73	0.015901	yes	ESPMCS
chr1_1542800_T_C_b38	ATAD3C	-6.204	1.3e-09	-0.098653	73	0.015901	yes	ESPMCS
chr1_1554694_A_G_b38	ATAD3C	-6.201	1.32e-09	-0.095562	80	0.01541	yes	ESPMCS
chr1_1553692_A_G_b38	ATAD3C	-6.191	1.41e-09	-0.09543	81	0.015415	yes	ESPMCS
chr1_1554781_A_G_b38	ATAD3C	-6.191	1.41e-09	-0.09543	81	0.015415	yes	ESPMCS
chr1_1554852_T_C_b38	ATAD3C	-6.191	1.41e-09	-0.09543	81	0.015415	yes	ESPMCS
chr1_1555247_T_A_b38	ATAD3C	-6.191	1.41e-09	-0.09543	81	0.015415	yes	ESPMCS
chr1_1572532_A_C_b38	ATAD3C	-6.189	1.43e-09	-0.095954	83	0.015505	yes	ESPMCS
chr1_1543953_A_G_b38	ATAD3C	-6.188	1.43e-09	-0.098401	73	0.015902	yes	ESPMCS
chr1_1452797_CAA_C_b38	ATAD3C	-6.147	1.81e-09	-0.119943	18	0.019511	yes	ESPMCS
chr1_1571794_A_AT_b38	ATAD3C	-6.119	2.14e-09	-0.097189	70	0.015883	yes	ESPMCS
chr1_1569180_T_A_b38	ATAD3C	-6.106	2.3e-09	-0.093602	81	0.015329	yes	ESPMCS
chr1_1570294_CA_C_b38	ATAD3C	-6.086	2.58e-09	-0.097034	74	0.015944	yes	ESPMCS
chr1_1565680_A_AG_b38	ATAD3C	-6.068	2.87e-09	-0.093156	79	0.015353	yes	ESPMCS
chr1_1453643_A_ATT_b38	ATAD3C	-6.063	2.95e-09	-0.112187	31	0.018504	yes	ESPMCS
chr1_1569661_T_C_b38	ATAD3C	-6.036	3.45e-09	-0.092753	75	0.015368	yes	ESPMCS
chr1_1545795_C_A_b38	ATAD3C	-5.945	5.75e-09	-0.094181	64	0.015841	yes	ESPMCS
chr1_1456829_G_C_b38	ATAD3C	-5.854	9.57e-09	-0.116277	36	0.019861	yes	ESPMCS
chr1_1575864_G_A_b38	ATAD3C	-5.827	1.12e-08	-0.092989	71	0.015959	yes	ESPMCS
chr1_1431026_CCACCCCCT_C_b38	ATAD3C	-5.785	1.41e-08	-0.107438	26	0.018573	yes	ESPMCS
chr1_1449009_A_T_b38	ATAD3C	-5.716	2.06e-08	-0.110693	37	0.019366	yes	ESPMCS
chr1_1431014_G_A_b38	ATAD3C	-5.623	3.4e-08	-0.096285	29	0.017123	yes	ESPMCS
chr1_1574655_GGC_G_b38	ATAD3C	-5.619	3.47e-08	-0.089043	67	0.015847	yes	ESPMCS
chr1_1574032_AAAG_A_b38	ATAD3C	-5.386	1.19e-07	-0.094909	43	0.017621	yes	ESPMCS
chr1_1566854_CA_C_b38	ATAD3C	-5.269	2.18e-07	-0.090517	47	0.017178	yes	ESPMCS
chr1_1378204_G_C_b38	ATAD3C	5.229	2.67e-07	0.099674	40	0.01906	yes	ESPMCS
chr1_1532798_T_C_b38	ATAD3C	-5.214	2.89e-07	-0.078366	131	0.015031	yes	ESPMCS
chr1_1447108_A_ATT_b38	ATAD3C	-5.176	3.5e-07	-0.097259	24	0.018791	yes	ESPMCS
chr1_1479719_T_C_b38	ATAD3C	-5.149	4.01e-07	-0.089921	69	0.017465	yes	ESPMCS
chr1_1575935_T_C_b38	ATAD3C	-5.145	4.1e-07	-0.082044	76	0.015948	yes	ESPMCS
chr1_1384749_C_G_b38	ATAD3C	5.143	4.12e-07	0.099128	40	0.019273	yes	ESPMCS
chr1_1387763_CCT_C_b38	ATAD3C	5.143	4.12e-07	0.099128	40	0.019273	yes	ESPMCS
chr1_1388944_G_A_b38	ATAD3C	5.143	4.12e-07	0.099128	40	0.019273	yes	ESPMCS
chr1_1400410_A_G_b38	ATAD3C	-5.14	4.2e-07	-0.099294	40	0.019319	yes	ESPMCS
chr1_1519934_T_G_b38	ATAD3C	-5.132	4.37e-07	-0.085797	77	0.016718	yes	ESPMCS
chr1_1519938_T_C_b38	ATAD3C	-5.132	4.37e-07	-0.085797	77	0.016718	yes	ESPMCS
chr1_1539491_G_C_b38	ATAD3C	-5.105	5e-07	-0.080481	78	0.015765	yes	ESPMCS
chr1_1437993_G_A_b38	ATAD3C	-5.09	5.38e-07	-0.09418	21	0.018503	yes	ESPMCS
chr1_1411323_A_C_b38	ATAD3C	-5.083	5.57e-07	-0.101311	55	0.01993	yes	ESPMCS
chr1_1376162_G_C_b38	ATAD3C	5.077	5.73e-07	0.097808	40	0.019263	yes	ESPMCS
chr1_1377431_C_T_b38	ATAD3C	5.077	5.73e-07	0.097808	40	0.019263	yes	ESPMCS
chr1_1395346_A_G_b38	ATAD3C	-5.035	7.05e-07	-0.100072	53	0.019874	yes	ESPMCS
chr1_1402457_A_G_b38	ATAD3C	-5.035	7.05e-07	-0.100072	53	0.019874	yes	ESPMCS
chr1_1560765_T_C_b38	ATAD3C	-5.016	7.77e-07	-0.081465	66	0.016242	yes	ESPMCS
chr1_1562261_TTTTC_T_b38	ATAD3C	-5.016	7.77e-07	-0.081465	66	0.016242	yes	ESPMCS
chr1_1549967_C_G_b38	ATAD3C	-5.011	7.94e-07	-0.081932	41	0.016349	yes	ESPMCS
chr1_1517993_A_G_b38	ATAD3C	-5	8.4e-07	-0.083655	77	0.016731	yes	ESPMCS
chr1_1456217_T_C_b38	ATAD3C	-4.991	8.76e-07	-0.099272	46	0.019889	yes	ESPMCS
chr1_1394423_A_G_b38	ATAD3C	-4.979	9.3e-07	-0.09889	53	0.019862	yes	ESPMCS
chr1_1559703_G_C_b38	ATAD3C	-4.951	1.07e-06	-0.077766	73	0.015707	yes	ESPMCS
chr1_1568548_G_A_b38	ATAD3C	-4.951	1.07e-06	-0.077766	73	0.015707	yes	ESPMCS
chr1_1570587_C_T_b38	ATAD3C	-4.951	1.07e-06	-0.077766	73	0.015707	yes	ESPMCS
chr1_1537493_T_A_b38	ATAD3C	-4.945	1.1e-06	-0.077502	69	0.015673	yes	ESPMCS
chr1_1573776_A_G_b38	ATAD3C	-4.932	1.17e-06	-0.082702	29	0.016767	yes	ESPMCS
chr1_1387698_A_G_b38	ATAD3C	4.874	1.55e-06	0.096583	53	0.019816	yes	ESPMCS
chr1_1389827_C_T_b38	ATAD3C	4.874	1.55e-06	0.096583	53	0.019816	yes	ESPMCS
chr1_1537160_T_G_b38	ATAD3C	-4.869	1.58e-06	-0.076969	89	0.015806	yes	ESPMCS
chr1_1580890_C_T_b38	ATAD3C	-4.786	2.34e-06	-0.080443	29	0.016806	yes	ESPMCS
chr1_1555871_T_C_b38	ATAD3C	-4.766	2.58e-06	-0.077388	63	0.016237	yes	ESPMCS
chr1_1551454_C_A_b38	ATAD3C	-4.74	2.92e-06	-0.070742	130	0.014925	yes	ESPMCS
chr1_1312114_T_C_b38	ATAD3C	4.717	3.25e-06	0.088799	56	0.018824	yes	ESPMCS
chr1_1366561_AGT_A_b38	ATAD3C	4.628	4.92e-06	0.089023	56	0.019237	yes	ESPMCS
chr1_1308516_C_T_b38	ATAD3C	4.597	5.65e-06	0.085711	62	0.018644	yes	ESPMCS
chr1_1571986_G_A_b38	ATAD3C	-4.521	7.99e-06	-0.069941	63	0.015471	yes	ESPMCS
chr1_1497605_G_C_b38	ATAD3C	-4.5	8.78e-06	-0.072201	63	0.016045	yes	ESPMCS
chr1_1358384_G_C_b38	ATAD3C	4.478	9.67e-06	0.086275	56	0.019265	yes	ESPMCS
chr1_1555179_A_G_b38	ATAD3C	-4.472	9.97e-06	-0.071934	59	0.016087	yes	ESPMCS
chr1_1579717_T_A_b38	ATAD3C	-4.467	1.02e-05	-0.073381	32	0.016429	yes	ESPMCS
chr1_1309988_G_A_b38	ATAD3C	4.395	1.4e-05	0.083159	59	0.018922	yes	ESPMCS
chr1_1313807_G_A_b38	ATAD3C	4.395	1.4e-05	0.083159	59	0.018922	yes	ESPMCS
chr1_1428999_C_CA_b38	ATAD3C	-4.348	1.72e-05	-0.078361	23	0.018023	yes	ESPMCS
chr1_1366427_AGTGTGATTGAATGAGT_A_b38	ATAD3C	4.342	1.77e-05	0.082033	41	0.018892	yes	ESPMCS
chr1_1366529_TTAG_T_b38	ATAD3C	4.338	1.8e-05	0.089475	14	0.020626	yes	ESPMCS
chr1_1558347_G_A_b38	ATAD3C	-4.32	1.95e-05	-0.071137	50	0.016468	yes	ESPMCS
chr1_1554548_T_C_b38	ATAD3C	-4.317	1.97e-05	-0.069707	57	0.016146	yes	ESPMCS
chr1_1439805_G_C_b38	ATAD3C	-4.313	2e-05	-0.083383	21	0.019333	yes	ESPMCS
chr1_1369803_C_CT_b38	ATAD3C	-4.261	2.51e-05	-0.089701	9	0.021053	yes	ESPMCS
chr1_1379083_AT_A_b38	ATAD3C	4.255	2.57e-05	0.081434	20	0.019138	yes	ESPMCS
chr1_1330125_G_A_b38	ATAD3C	4.245	2.68e-05	0.081696	57	0.019245	yes	ESPMCS
chr1_1367919_C_T_b38	ATAD3C	-4.244	2.69e-05	-0.09466	11	0.022303	yes	ESPMCS
chr1_1363898_C_T_b38	ATAD3C	4.204	3.19e-05	0.0871	14	0.020717	yes	ESPMCS
chr1_1363986_C_T_b38	ATAD3C	4.204	3.19e-05	0.0871	14	0.020717	yes	ESPMCS
chr1_1365566_G_A_b38	ATAD3C	4.204	3.2e-05	0.086428	14	0.02056	yes	ESPMCS
chr1_1370113_A_G_b38	ATAD3C	4.178	3.57e-05	0.076875	42	0.018401	yes	ESPMCS
chr1_1500745_A_C_b38	ATAD3C	-4.177	3.58e-05	-0.10226	44	0.024482	yes	ESPMCS
chr1_1554290_C_T_b38	ATAD3C	-4.144	4.12e-05	-0.067112	56	0.016196	yes	ESPMCS
chr1_1366681_T_TGA_b38	ATAD3C	-4.127	4.42e-05	-0.093328	11	0.022613	yes	ESPMCS
chr1_1367292_A_AGT_b38	ATAD3C	4.112	4.7e-05	0.084953	14	0.020658	yes	ESPMCS
chr1_1573429_CAAAAAAAAAAAAAAAAAA_C_b38	ATAD3C	-4.096	5.04e-05	-0.066913	67	0.016337	yes	ESPMCS
chr1_1369282_G_A_b38	ATAD3C	-4.074	5.51e-05	-0.090794	11	0.022287	yes	ESPMCS
chr1_1369320_GT_G_b38	ATAD3C	-4.074	5.51e-05	-0.090794	11	0.022287	yes	ESPMCS
chr1_1369407_G_A_b38	ATAD3C	-4.074	5.51e-05	-0.090794	11	0.022287	yes	ESPMCS
chr1_1369476_CTT_C_b38	ATAD3C	-4.074	5.51e-05	-0.090794	11	0.022287	yes	ESPMCS
chr1_1369556_C_G_b38	ATAD3C	-4.074	5.51e-05	-0.090794	11	0.022287	yes	ESPMCS
chr1_1369627_T_C_b38	ATAD3C	-4.074	5.51e-05	-0.090794	11	0.022287	yes	ESPMCS
chr1_1369686_T_C_b38	ATAD3C	-4.074	5.51e-05	-0.090794	11	0.022287	yes	ESPMCS
chr1_1369716_G_C_b38	ATAD3C	-4.074	5.51e-05	-0.090794	11	0.022287	yes	ESPMCS
chr1_1369741_C_T_b38	ATAD3C	-4.074	5.51e-05	-0.090794	11	0.022287	yes	ESPMCS
chr1_1369821_C_T_b38	ATAD3C	-4.074	5.51e-05	-0.090794	11	0.022287	yes	ESPMCS
chr1_1370181_C_T_b38	ATAD3C	-4.074	5.51e-05	-0.090794	11	0.022287	yes	ESPMCS
chr1_1370317_G_C_b38	ATAD3C	-4.074	5.51e-05	-0.090794	11	0.022287	yes	ESPMCS
chr1_1370320_A_G_b38	ATAD3C	-4.074	5.51e-05	-0.090794	11	0.022287	yes	ESPMCS
chr1_1524911_C_T_b38	ATAD3C	-4.073	5.53e-05	-0.130019	13	0.031921	yes	ESPMCS
chr1_1367388_T_TTGG_b38	ATAD3C	-4.051	6.05e-05	-0.090541	11	0.022348	yes	ESPMCS
chr1_1367280_T_A_b38	ATAD3C	-4.047	6.15e-05	-0.090349	11	0.022323	yes	ESPMCS
chr1_1364282_T_G_b38	ATAD3C	-4.042	6.28e-05	-0.090291	11	0.022336	yes	ESPMCS
chr1_1364357_A_C_b38	ATAD3C	-4.042	6.28e-05	-0.090291	11	0.022336	yes	ESPMCS
chr1_1364694_T_C_b38	ATAD3C	-4.042	6.28e-05	-0.090291	11	0.022336	yes	ESPMCS
chr1_1364721_C_T_b38	ATAD3C	-4.042	6.28e-05	-0.090291	11	0.022336	yes	ESPMCS
chr1_1365160_A_G_b38	ATAD3C	-4.042	6.28e-05	-0.090291	11	0.022336	yes	ESPMCS
chr1_1365198_C_T_b38	ATAD3C	-4.042	6.28e-05	-0.090291	11	0.022336	yes	ESPMCS
chr1_1366008_A_G_b38	ATAD3C	-4.042	6.28e-05	-0.090291	11	0.022336	yes	ESPMCS
chr1_1366062_T_C_b38	ATAD3C	-4.042	6.28e-05	-0.090291	11	0.022336	yes	ESPMCS
chr1_1366145_TGTGAA_T_b38	ATAD3C	-4.042	6.28e-05	-0.090291	11	0.022336	yes	ESPMCS
chr1_1366187_A_AGT_b38	ATAD3C	-4.042	6.28e-05	-0.090291	11	0.022336	yes	ESPMCS
chr1_1366321_TGTGTGTAAATGG_T_b38	ATAD3C	-4.042	6.28e-05	-0.090291	11	0.022336	yes	ESPMCS
chr1_1366453_G_T_b38	ATAD3C	-4.042	6.28e-05	-0.090291	11	0.022336	yes	ESPMCS
chr1_1366726_T_G_b38	ATAD3C	-4.042	6.28e-05	-0.090291	11	0.022336	yes	ESPMCS
chr1_1367258_T_A_b38	ATAD3C	-4.042	6.28e-05	-0.090291	11	0.022336	yes	ESPMCS
chr1_1367297_GAA_G_b38	ATAD3C	-4.042	6.28e-05	-0.090291	11	0.022336	yes	ESPMCS
chr1_1367329_A_AGT_b38	ATAD3C	-4.042	6.28e-05	-0.090291	11	0.022336	yes	ESPMCS
chr1_1367373_T_TGTG_b38	ATAD3C	-4.042	6.28e-05	-0.090291	11	0.022336	yes	ESPMCS
chr1_1367593_G_A_b38	ATAD3C	-4.042	6.28e-05	-0.090291	11	0.022336	yes	ESPMCS
chr1_1367602_GT_G_b38	ATAD3C	-4.042	6.28e-05	-0.090291	11	0.022336	yes	ESPMCS
chr1_1367605_GAGTGAGTGTA_G_b38	ATAD3C	-4.042	6.28e-05	-0.090291	11	0.022336	yes	ESPMCS
chr1_1367670_GGTGA_G_b38	ATAD3C	-4.042	6.28e-05	-0.090291	11	0.022336	yes	ESPMCS
chr1_1367722_TTTTA_T_b38	ATAD3C	-4.042	6.28e-05	-0.090291	11	0.022336	yes	ESPMCS
chr1_1367874_A_T_b38	ATAD3C	-4.042	6.28e-05	-0.090291	11	0.022336	yes	ESPMCS
chr1_1367951_C_T_b38	ATAD3C	-4.042	6.28e-05	-0.090291	11	0.022336	yes	ESPMCS
chr1_1367965_A_G_b38	ATAD3C	-4.042	6.28e-05	-0.090291	11	0.022336	yes	ESPMCS
chr1_1367970_T_G_b38	ATAD3C	-4.042	6.28e-05	-0.090291	11	0.022336	yes	ESPMCS
chr1_1367994_C_A_b38	ATAD3C	-4.042	6.28e-05	-0.090291	11	0.022336	yes	ESPMCS
chr1_1368297_C_T_b38	ATAD3C	-4.042	6.28e-05	-0.090291	11	0.022336	yes	ESPMCS
chr1_1368514_C_G_b38	ATAD3C	-4.042	6.28e-05	-0.090291	11	0.022336	yes	ESPMCS
chr1_1363688_C_T_b38	ATAD3C	-4.039	6.37e-05	-0.090462	11	0.022399	yes	ESPMCS
chr1_1364099_CCA_C_b38	ATAD3C	-4.039	6.37e-05	-0.090462	11	0.022399	yes	ESPMCS
chr1_1364102_TGTTG_T_b38	ATAD3C	-4.039	6.37e-05	-0.090462	11	0.022399	yes	ESPMCS
chr1_1368763_G_A_b38	ATAD3C	-4.039	6.37e-05	-0.090462	11	0.022399	yes	ESPMCS
chr1_1366292_G_T_b38	ATAD3C	-4.036	6.44e-05	-0.090416	11	0.022401	yes	ESPMCS
chr1_1373006_G_A_b38	ATAD3C	-4.03	6.6e-05	-0.096238	9	0.023878	yes	ESPMCS
chr1_1361679_G_A_b38	ATAD3C	4.024	6.77e-05	0.081631	31	0.020286	yes	ESPMCS
chr1_1373007_G_A_b38	ATAD3C	-4.023	6.79e-05	-0.094825	10	0.023569	yes	ESPMCS
chr1_1368991_C_T_b38	ATAD3C	-4.019	6.9e-05	-0.089873	11	0.02236	yes	ESPMCS
chr1_1553018_CA_C_b38	ATAD3C	-4.019	6.92e-05	-0.069852	22	0.017381	yes	ESPMCS
chr1_1364566_T_C_b38	ATAD3C	-4.018	6.95e-05	-0.090268	10	0.022467	yes	ESPMCS
chr1_1533018_T_C_b38	ATAD3C	-3.989	7.81e-05	-0.110415	22	0.02768	yes	ESPMCS
chr1_1367511_ATGAG_A_b38	ATAD3C	-3.986	7.89e-05	-0.090142	10	0.022612	yes	ESPMCS
chr1_1538924_C_A_b38	ATAD3C	-3.971	8.4e-05	-0.06303	50	0.015872	yes	ESPMCS
chr1_1530002_A_G_b38	ATAD3C	-3.965	8.62e-05	-0.110827	20	0.027953	yes	ESPMCS
chr1_1369009_T_C_b38	ATAD3C	-3.948	9.21e-05	-0.088492	11	0.022413	yes	ESPMCS
chr1_1363880_A_G_b38	ATAD3C	-3.943	9.4e-05	-0.087372	11	0.022158	yes	ESPMCS
chr1_1369012_C_CG_b38	ATAD3C	-3.923	0.000102	-0.087912	11	0.022408	yes	ESPMCS
chr1_1375642_C_T_b38	ATAD3C	-3.918	0.000104	-0.091556	11	0.023368	yes	ESPMCS
chr1_1367268_TGA_T_b38	ATAD3C	-3.912	0.000106	-0.087008	11	0.022239	yes	ESPMCS
chr1_1366511_GGTGA_G_b38	ATAD3C	-3.904	0.00011	-0.087151	11	0.022324	yes	ESPMCS
chr1_1521518_G_A_b38	ATAD3C	-3.897	0.000113	-0.107671	22	0.027627	yes	ESPMCS
chr1_1562444_C_T_b38	ATAD3C	-3.892	0.000115	-0.096639	4	0.024829	yes	ESPMCS
chr1_1523187_A_G_b38	ATAD3C	-3.888	0.000117	-0.108024	29	0.027786	yes	ESPMCS
chr1_1374505_A_G_b38	ATAD3C	-3.876	0.000123	-0.090357	11	0.023313	yes	ESPMCS
chr1_1551679_G_A_b38	ATAD3C	-3.866	0.000128	-0.141816	5	0.036683	yes	ESPMCS
chr1_1570568_AC_A_b38	ATAD3C	-3.845	0.000139	-0.065683	32	0.017083	yes	ESPMCS
chr1_1520875_A_G_b38	ATAD3C	-3.833	0.000146	-0.105035	22	0.027406	yes	ESPMCS
chr1_1568428_C_G_b38	ATAD3C	-3.803	0.000164	-0.061879	36	0.016272	yes	ESPMCS
chr1_1514211_A_G_b38	ATAD3C	-3.8	0.000166	-0.116958	11	0.030775	yes	ESPMCS
chr1_1548572_A_AC_b38	ATAD3C	-3.781	0.000178	-0.137059	5	0.036245	yes	ESPMCS
chr1_1533883_G_T_b38	ATAD3C	-3.781	0.000179	-0.10387	11	0.027475	yes	ESPMCS
chr1_1551523_T_C_b38	ATAD3C	-3.749	0.000202	-0.06337	29	0.016905	yes	ESPMCS
chr1_1480224_A_G_b38	ATAD3C	-3.746	0.000204	-0.151704	3	0.040498	yes	ESPMCS
chr1_1545968_T_C_b38	ATAD3C	-3.736	0.000212	-0.061129	34	0.016362	yes	ESPMCS
chr1_1379091_T_G_b38	ATAD3C	3.726	0.000221	0.082984	11	0.02227	yes	ESPMCS
chr1_1407565_C_A_b38	ATAD3C	-3.721	0.000225	-0.098126	7	0.026371	yes	ESPMCS
chr1_1384546_C_T_b38	ATAD3C	-3.71	0.000235	-0.096707	7	0.026068	yes	ESPMCS
chr1_1370553_CAAA_C_b38	ATAD3C	-3.686	0.000257	-0.084664	9	0.022966	yes	ESPMCS
chr1_1382893_G_A_b38	ATAD3C	-3.674	0.00027	-0.089052	9	0.024241	yes	ESPMCS
chr1_1437955_C_G_b38	ATAD3C	-3.636	0.000311	-0.06116	39	0.01682	yes	ESPMCS
chr1_1361685_C_T_b38	ATAD3C	-3.636	0.000311	-0.078148	24	0.021495	yes	ESPMCS
chr1_1553619_CAAAAAAA_C_b38	ATAD3C	-3.609	0.000344	-0.061764	30	0.017113	yes	ESPMCS
chr1_1367462_T_C_b38	ATAD3C	-3.606	0.000348	-0.081262	10	0.022535	yes	ESPMCS
chr1_1526169_C_T_b38	ATAD3C	-3.599	0.000356	-0.099899	20	0.027754	yes	ESPMCS
chr1_1522905_A_G_b38	ATAD3C	-3.572	0.000395	-0.095452	22	0.026723	yes	ESPMCS
chr1_1515567_A_C_b38	ATAD3C	-3.554	0.000422	-0.09835	14	0.027672	yes	ESPMCS
chr1_1365036_T_TAA_b38	ATAD3C	-3.457	0.000601	-0.080441	8	0.023267	yes	ESPMCS
chr1_1450193_C_T_b38	ATAD3C	-3.445	0.000627	-0.092161	11	0.026749	yes	ESPMCS
chr1_1341550_GCA_G_b38	ATAD3C	-3.431	0.000661	-0.079422	11	0.023151	yes	ESPMCS
chr1_1290841_A_G_b38	ATAD3C	-3.411	0.00071	-0.072673	31	0.021307	yes	ESPMCS
chr1_1364253_C_G_b38	ATAD3C	-3.399	0.000741	-0.078252	10	0.023025	yes	ESPMCS
chr1_1793064_C_CA_b38	ATAD3C	3.384	0.000781	0.059486	27	0.01758	yes	ESPMCS
chr1_1417051_CA_C_b38	ATAD3C	-3.379	0.000794	-0.08527	8	0.025234	yes	ESPMCS
chr1_1366776_G_GAATT_b38	ATAD3C	-3.326	0.000956	-0.075554	11	0.022714	yes	ESPMCS
chr1_1474819_G_C_b38	ATAD3C	-3.311	0.00101	-0.107494	7	0.032463	yes	ESPMCS
chr1_1769737_GA_G_b38	ATAD3C	3.295	0.00107	0.059065	20	0.017926	yes	ESPMCS
chr1_1292284_TTGAG_T_b38	ATAD3C	-3.276	0.00114	-0.073248	21	0.022357	yes	ESPMCS
chr1_1558204_T_TAAAAAA_b38	ATAD3C	-3.263	0.00119	-0.059224	35	0.01815	yes	ESPMCS
chr1_1527386_C_T_b38	ATAD3C	-3.234	0.00131	-0.092699	22	0.028661	yes	ESPMCS
chr1_1366883_G_GGTGTGAATTGGTGTAGTGTGAATGAGT_b38	ATAD3C	-3.232	0.00132	-0.094184	4	0.029139	yes	ESPMCS
chr1_1573265_C_CAAAA_b38	ATAD3C	-3.214	0.00141	-0.063307	23	0.019695	yes	ESPMCS
chr1_1522693_A_G_b38	ATAD3C	3.142	0.0018	0.052006	35	0.016553	yes	ESPMCS
chr1_1374694_C_G_b38	ATAD3C	3.13	0.00187	0.094867	6	0.030309	yes	ESPMCS
chr1_1363456_CAG_C_b38	ATAD3C	3.12	0.00193	0.060451	22	0.019373	yes	ESPMCS
chr1_1303800_G_A_b38	ATAD3C	-3.105	0.00203	-0.076707	6	0.024705	yes	ESPMCS
chr1_1337898_A_G_b38	ATAD3C	3.104	0.00204	0.058563	15	0.01887	yes	ESPMCS
chr1_1579410_AT_A_b38	ATAD3C	-3.063	0.00233	-0.054961	34	0.017943	yes	ESPMCS
chr1_1774165_A_G_b38	ATAD3C	3.041	0.0025	0.052649	25	0.017313	yes	ESPMCS
chr1_1385553_G_A_b38	ATAD3C	3.006	0.00281	0.069361	21	0.023076	yes	ESPMCS
chr1_1057460_ATT_A_b38	ATAD3C	-2.98	0.00304	-0.059669	14	0.020021	yes	ESPMCS
chr1_1375678_TA_T_b38	ATAD3C	2.98	0.00305	0.059032	24	0.019811	yes	ESPMCS
chr1_1504928_TTG_T_b38	ATAD3C	-2.944	0.00342	-0.067707	6	0.023	yes	ESPMCS
chr1_1776301_T_G_b38	ATAD3C	2.933	0.00354	0.049906	28	0.017016	yes	ESPMCS
chr1_1960047_A_G_b38	ATAD3C	2.921	0.00368	0.127681	6	0.043715	yes	ESPMCS
chr1_1055393_C_T_b38	ATAD3C	-2.904	0.00387	-0.058327	14	0.020083	yes	ESPMCS
chr1_1055426_G_A_b38	ATAD3C	-2.904	0.00387	-0.058327	14	0.020083	yes	ESPMCS
chr1_1049113_GGC_G_b38	ATAD3C	-2.894	0.004	-0.056836	21	0.019642	yes	ESPMCS
chr1_1217251_C_A_b38	ATAD3C	-2.884	0.00412	-0.070524	7	0.02445	yes	ESPMCS
chr1_1842221_C_G_b38	ATAD3C	2.867	0.00435	0.048988	31	0.017088	yes	ESPMCS
chr1_1767762_C_A_b38	ATAD3C	2.863	0.0044	0.048964	28	0.017101	yes	ESPMCS
chr1_1774308_G_A_b38	ATAD3C	2.863	0.0044	0.048964	28	0.017101	yes	ESPMCS
chr1_1028979_GCCACGCCACCCTCTCCCAAGGAACCGAGCCCCAGCCCCTCGTGGGCCAAGGGCGCCCACAC_G_b38	ATAD3C	2.86	0.00445	0.067869	13	0.023733	yes	ESPMCS
chr1_1879682_G_A_b38	ATAD3C	2.859	0.00446	0.048567	30	0.016988	yes	ESPMCS
chr1_971643_G_A_b38	ATAD3C	2.845	0.00466	0.128117	4	0.045032	yes	ESPMCS
chr1_1881428_C_T_b38	ATAD3C	2.843	0.00469	0.049091	26	0.017269	yes	ESPMCS
chr1_1842237_T_C_b38	ATAD3C	2.842	0.0047	0.047725	32	0.016794	yes	ESPMCS
chr1_1578879_A_T_b38	ATAD3C	-2.834	0.00482	-0.089283	4	0.031507	yes	ESPMCS
chr1_1842213_A_G_b38	ATAD3C	2.832	0.00485	0.048594	30	0.01716	yes	ESPMCS
chr1_1554241_T_C_b38	ATAD3C	-2.82	0.00502	-0.048079	39	0.017048	yes	ESPMCS
chr1_638970_A_C_b38	ATAD3C	-2.818	0.00506	-0.081437	15	0.028903	yes	ESPMCS
chr1_1991856_A_G_b38	ATAD3C	2.797	0.00539	0.12102	3	0.043269	yes	ESPMCS
chr1_1534218_C_G_b38	ATAD3C	-2.795	0.00543	-0.042653	137	0.015262	yes	ESPMCS
chr1_1534219_G_C_b38	ATAD3C	-2.795	0.00543	-0.042653	137	0.015262	yes	ESPMCS
chr1_1524664_A_G_b38	ATAD3C	-2.791	0.00549	-0.054013	51	0.019353	yes	ESPMCS
chr1_1873952_G_A_b38	ATAD3C	2.78	0.00567	0.047217	30	0.016982	yes	ESPMCS
chr1_1878651_C_T_b38	ATAD3C	2.78	0.00567	0.047217	30	0.016982	yes	ESPMCS
chr1_1773215_C_A_b38	ATAD3C	2.78	0.00567	0.047484	28	0.017079	yes	ESPMCS
chr1_1554246_C_T_b38	ATAD3C	-2.762	0.00599	-0.047361	42	0.017146	yes	ESPMCS
chr1_1518285_T_C_b38	ATAD3C	-2.752	0.00618	-0.055216	54	0.020066	yes	ESPMCS
chr1_1533841_T_C_b38	ATAD3C	-2.749	0.00624	-0.051341	37	0.018678	yes	ESPMCS
chr1_1842226_T_C_b38	ATAD3C	2.739	0.00641	0.046627	30	0.017021	yes	ESPMCS
chr1_1366987_GTGTGTAGTGGATGAGTGTGGA_G_b38	ATAD3C	-2.736	0.00647	-0.099788	6	0.036467	yes	ESPMCS
chr1_1213936_C_G_b38	ATAD3C	-2.724	0.00672	-0.096336	4	0.035368	yes	ESPMCS
chr1_1878070_C_T_b38	ATAD3C	2.712	0.00696	0.046223	27	0.017044	yes	ESPMCS
chr1_1881006_GGA_G_b38	ATAD3C	2.712	0.00696	0.046223	27	0.017044	yes	ESPMCS
chr1_1780791_C_T_b38	ATAD3C	2.709	0.00702	0.046333	27	0.017104	yes	ESPMCS
chr1_1782430_T_G_b38	ATAD3C	2.705	0.0071	0.046138	27	0.017056	yes	ESPMCS
chr1_1746439_GA_G_b38	ATAD3C	2.696	0.00729	0.044718	79	0.016584	yes	ESPMCS
chr1_1053552_G_C_b38	ATAD3C	-2.696	0.00729	-0.054341	29	0.020154	yes	ESPMCS
chr1_1842333_G_A_b38	ATAD3C	2.683	0.00759	0.045704	30	0.017038	yes	ESPMCS
chr1_689819_C_T_b38	ATAD3C	2.674	0.00778	0.0776	4	0.029019	yes	ESPMCS
chr1_1056425_GCGGGTA_G_b38	ATAD3C	-2.671	0.00785	-0.057008	8	0.021343	yes	ESPMCS
chr1_1890186_G_A_b38	ATAD3C	2.663	0.00803	0.045313	30	0.017013	yes	ESPMCS
chr1_1838449_C_CT_b38	ATAD3C	2.656	0.00821	0.046842	21	0.017638	yes	ESPMCS
chr1_589657_G_T_b38	ATAD3C	-2.651	0.00831	-0.09559	3	0.036052	yes	ESPMCS
chr1_1500729_G_A_b38	ATAD3C	-2.65	0.00834	-0.078867	27	0.029758	yes	ESPMCS
chr1_1848358_A_T_b38	ATAD3C	2.646	0.00844	0.052607	15	0.01988	yes	ESPMCS
chr1_1192776_CAGTGTAGACACTCCAGTTGGTATG_C_b38	ATAD3C	2.646	0.00845	0.070526	4	0.026654	yes	ESPMCS
chr1_1803531_C_T_b38	ATAD3C	2.642	0.00854	0.045252	29	0.017126	yes	ESPMCS
chr1_1830566_A_T_b38	ATAD3C	2.642	0.00854	0.045252	29	0.017126	yes	ESPMCS
chr1_1650664_C_CT_b38	ATAD3C	2.637	0.00867	0.091551	6	0.034717	yes	ESPMCS
chr1_1558204_T_TAAAAA_b38	ATAD3C	-2.636	0.0087	-0.089161	6	0.033828	yes	ESPMCS
chr1_1888667_A_C_b38	ATAD3C	2.622	0.00906	0.044722	27	0.017057	yes	ESPMCS
chr1_1366830_G_A_b38	ATAD3C	-2.608	0.00943	-0.068116	6	0.02612	yes	ESPMCS
chr1_1432355_G_A_b38	ATAD3C	-7.689	1.04e-13	-0.141691	22	0.018428	no	ESPMCS
chr1_1454848_T_C_b38	ATAD3C	-7.231	2.24e-12	-0.129832	25	0.017955	no	ESPMCS
chr1_1457071_C_T_b38	ATAD3C	-7.073	6.26e-12	-0.124558	26	0.01761	no	ESPMCS
chr1_1456079_T_C_b38	ATAD3C	-7.016	9.01e-12	-0.127728	23	0.018204	no	ESPMCS
chr1_1456154_G_A_b38	ATAD3C	-6.955	1.33e-11	-0.126287	23	0.018157	no	ESPMCS
chr1_1456051_C_T_b38	ATAD3C	-6.789	3.8e-11	-0.123529	23	0.018195	no	ESPMCS
chr1_1451968_C_T_b38	ATAD3C	-6.659	8.54e-11	-0.120978	23	0.018168	no	ESPMCS
chr1_1452540_G_A_b38	ATAD3C	-6.631	1.02e-10	-0.119308	21	0.017994	no	ESPMCS
chr1_1426253_G_A_b38	ATAD3C	-6.558	1.58e-10	-0.136666	11	0.020838	no	ESPMCS
chr1_1438102_G_C_b38	ATAD3C	-6.24	1.06e-09	-0.116581	17	0.018683	no	ESPMCS
chr1_1456182_G_A_b38	ATAD3C	-6.22	1.19e-09	-0.112905	25	0.018151	no	ESPMCS
chr1_1442793_G_A_b38	ATAD3C	-6.141	1.88e-09	-0.122591	12	0.019963	no	ESPMCS
chr1_1434687_C_G_b38	ATAD3C	-5.779	1.45e-08	-0.116404	13	0.020141	no	ESPMCS
chr1_1435945_C_CCGGGCGGGGGCG_b38	ATAD3C	-5.775	1.48e-08	-0.115621	15	0.02002	no	ESPMCS
chr1_1452346_A_G_b38	ATAD3C	-5.761	1.6e-08	-0.111899	12	0.019423	no	ESPMCS
chr1_1431656_G_A_b38	ATAD3C	-5.729	1.91e-08	-0.119823	12	0.020915	no	ESPMCS
chr1_1452384_G_A_b38	ATAD3C	-5.633	3.23e-08	-0.112071	10	0.019897	no	ESPMCS
chr1_1431813_G_T_b38	ATAD3C	-5.344	1.49e-07	-0.103959	17	0.019454	no	ESPMCS
chr1_1453870_A_C_b38	ATAD3C	-5.289	1.97e-07	-0.107229	9	0.020275	no	ESPMCS
chr1_1453961_C_T_b38	ATAD3C	-5.277	2.1e-07	-0.111738	7	0.021175	no	ESPMCS
chr1_1450636_A_G_b38	ATAD3C	-5.268	2.19e-07	-0.107361	10	0.020378	no	ESPMCS
chr1_1524202_G_A_b38	ATAD3C	-4.492	9.09e-06	-0.126944	20	0.028258	no	ESPMCS
chr1_1451028_T_A_b38	ATAD3C	-4.477	9.75e-06	-0.090459	11	0.020207	no	ESPMCS
chr1_1370532_C_T_b38	ATAD3C	-4.209	3.13e-05	-0.093815	12	0.022289	no	ESPMCS
chr1_1316929_A_T_b38	ATAD3C	-4.206	3.17e-05	-0.096813	9	0.023017	no	ESPMCS
chr1_1514366_A_G_b38	ATAD3C	-4.2	3.25e-05	-0.138578	5	0.032992	no	ESPMCS
chr1_1370430_T_C_b38	ATAD3C	-4.109	4.77e-05	-0.092029	12	0.022399	no	ESPMCS
chr1_1370584_G_C_b38	ATAD3C	-4.109	4.77e-05	-0.092029	12	0.022399	no	ESPMCS
chr1_1367300_T_TGA_b38	ATAD3C	-4.039	6.36e-05	-0.091137	10	0.022563	no	ESPMCS
chr1_1380867_A_G_b38	ATAD3C	-3.949	9.19e-05	-0.100227	7	0.025381	no	ESPMCS
chr1_1303112_G_A_b38	ATAD3C	-3.84	0.000142	-0.091704	6	0.023879	no	ESPMCS
chr1_1372909_G_A_b38	ATAD3C	-3.77	0.000186	-0.089078	10	0.02363	no	ESPMCS
chr1_1329973_GCGTGTGCCATGCA_G_b38	ATAD3C	-3.724	0.000222	-0.089997	8	0.024165	no	ESPMCS
chr1_1344048_G_A_b38	ATAD3C	-3.724	0.000222	-0.089997	8	0.024165	no	ESPMCS
chr1_1290261_C_A_b38	ATAD3C	-3.685	0.000258	-0.076462	33	0.020747	no	ESPMCS
chr1_1368177_G_C_b38	ATAD3C	-3.675	0.000268	-0.08109	13	0.022067	no	ESPMCS
chr1_1308178_GGGGCGCGGGGA_G_b38	ATAD3C	-3.669	0.000274	-0.075909	14	0.020688	no	ESPMCS
chr1_1572877_TG_T_b38	ATAD3C	-3.66	0.000284	-0.063888	26	0.017454	no	ESPMCS
chr1_1366951_A_AGT_b38	ATAD3C	3.631	0.000316	0.087338	9	0.024051	no	ESPMCS
chr1_1379093_TG_T_b38	ATAD3C	-3.502	0.000511	-0.093022	5	0.026565	no	ESPMCS
chr1_1499339_T_C_b38	ATAD3C	-3.465	0.000584	-0.110894	5	0.032006	no	ESPMCS
chr1_1471663_A_C_b38	ATAD3C	-3.449	0.000619	-0.119886	8	0.034762	no	ESPMCS
chr1_1304555_A_C_b38	ATAD3C	-3.447	0.000623	-0.083253	6	0.02415	no	ESPMCS
chr1_1398218_C_A_b38	ATAD3C	-3.394	0.000754	-0.083341	9	0.024558	no	ESPMCS
chr1_1400756_GGA_G_b38	ATAD3C	-3.394	0.000754	-0.083341	9	0.024558	no	ESPMCS
chr1_1401954_G_T_b38	ATAD3C	-3.394	0.000754	-0.083341	9	0.024558	no	ESPMCS
chr1_1403593_A_G_b38	ATAD3C	-3.394	0.000754	-0.083341	9	0.024558	no	ESPMCS
chr1_1398056_C_A_b38	ATAD3C	-3.39	0.000763	-0.055644	63	0.016413	no	ESPMCS
chr1_1366941_T_TGTGTGCA_b38	ATAD3C	3.385	0.000777	0.080855	9	0.023883	no	ESPMCS
chr1_1383743_T_C_b38	ATAD3C	-3.325	0.000962	-0.081424	9	0.024492	no	ESPMCS
chr1_1394041_G_A_b38	ATAD3C	-3.321	0.000973	-0.087753	3	0.02642	no	ESPMCS
chr1_1948594_G_GT_b38	ATAD3C	3.223	0.00137	0.15367	3	0.04768	no	ESPMCS
chr1_1290968_C_G_b38	ATAD3C	-3.182	0.00157	-0.070228	40	0.022071	no	ESPMCS
chr1_1223251_A_G_b38	ATAD3C	-3.169	0.00164	-0.07243	10	0.022857	no	ESPMCS
chr1_1363601_A_AT_b38	ATAD3C	3.065	0.00232	0.043803	134	0.014293	no	ESPMCS
chr1_1325753_G_T_b38	ATAD3C	-3.03	0.00259	-0.076472	5	0.025239	no	ESPMCS
chr1_1385919_A_AG_b38	ATAD3C	2.978	0.00307	0.074141	17	0.024898	no	ESPMCS
chr1_690136_A_G_b38	ATAD3C	2.936	0.0035	0.126881	3	0.043213	no	ESPMCS
chr1_1383798_AG_A_b38	ATAD3C	2.935	0.00351	0.073406	7	0.025008	no	ESPMCS
chr1_1756389_C_T_b38	ATAD3C	2.913	0.00377	0.13201	3	0.045325	no	ESPMCS
chr1_1056704_T_C_b38	ATAD3C	-2.897	0.00397	-0.05318	24	0.01836	no	ESPMCS
chr1_1399922_C_T_b38	ATAD3C	-2.855	0.00451	-0.070888	8	0.024829	no	ESPMCS
chr1_607379_G_A_b38	ATAD3C	-2.855	0.00452	-0.093039	8	0.032589	no	ESPMCS
chr1_1340697_G_A_b38	ATAD3C	2.843	0.00469	0.05001	28	0.017592	no	ESPMCS
chr1_1080437_G_A_b38	ATAD3C	-2.776	0.00575	-0.044353	45	0.01598	no	ESPMCS
chr1_1403240_CCTTT_C_b38	ATAD3C	-2.736	0.00648	-0.06798	8	0.024847	no	ESPMCS
chr1_2435454_TGGCTGGA_T_b38	ATAD3C	-2.734	0.00651	-0.043434	57	0.015885	no	ESPMCS
chr1_1366976_GTTGAA_G_b38	ATAD3C	-2.712	0.00696	-0.094837	6	0.034972	no	ESPMCS
chr1_1388565_GTC_G_b38	ATAD3C	2.695	0.00732	0.050553	28	0.018758	no	ESPMCS
chr1_1747690_A_G_b38	ATAD3C	2.693	0.00735	0.105915	8	0.039323	no	ESPMCS
chr1_1395050_G_A_b38	ATAD3C	-2.686	0.00751	-0.068026	7	0.025326	no	ESPMCS
chr1_1497606_C_G_b38	ATAD3C	-2.681	0.00764	-0.052344	13	0.019527	no	ESPMCS
chr1_1366923_AGTTG_A_b38	ATAD3C	-2.67	0.00789	-0.090067	6	0.033739	no	ESPMCS
chr1_1129155_G_C_b38	ATAD3C	-2.663	0.00805	-0.043807	35	0.016452	no	ESPMCS
chr1_1081152_A_AG_b38	ATAD3C	2.648	0.00841	0.126157	4	0.047649	no	ESPMCS
chr1_1718311_A_T_b38	ATAD3C	-2.643	0.00853	-0.050776	17	0.019213	no	ESPMCS
chr1_1071101_C_A_b38	ATAD3C	2.614	0.00927	0.1287	4	0.049236	no	ESPMCS
chr1_1739115_T_C_b38	ATAD3C	2.611	0.00936	0.104081	8	0.039869	no	ESPMCS
chr1_1442722_A_G_b38	ATAD3C	-2.61	0.00938	-0.094974	3	0.036393	no	ESPMCS
chr1_1081587_G_A_b38	ATAD3C	2.608	0.00944	0.126741	4	0.048605	no	ESPMCS
chr1_1375678_TAA_T_b38	ATAD3C	-2.608	0.00944	-0.052764	17	0.020235	no	ESPMCS
chr1_1440430_C_G_b38	ATAD3C	-11.073	5.42e-25	-0.235068	30	0.02123	yes	ESPMSL
chr1_1445187_T_G_b38	ATAD3C	-10.862	3.22e-24	-0.22915	49	0.021096	yes	ESPMSL
chr1_1443457_T_C_b38	ATAD3C	-10.752	8.15e-24	-0.230832	54	0.02147	yes	ESPMSL
chr1_1440834_C_G_b38	ATAD3C	-10.472	8.35e-23	-0.22559	52	0.021542	yes	ESPMSL
chr1_1428969_T_C_b38	ATAD3C	-10.217	6.81e-22	-0.213372	56	0.020885	yes	ESPMSL
chr1_1430190_A_C_b38	ATAD3C	-10.075	2.15e-21	-0.211342	56	0.020977	yes	ESPMSL
chr1_1439454_A_G_b38	ATAD3C	-10.016	3.46e-21	-0.213022	49	0.021268	yes	ESPMSL
chr1_1431537_G_C_b38	ATAD3C	-9.98	4.62e-21	-0.208224	56	0.020864	yes	ESPMSL
chr1_1431450_A_G_b38	ATAD3C	-9.965	5.23e-21	-0.208337	56	0.020908	yes	ESPMSL
chr1_1426810_C_G_b38	ATAD3C	-9.939	6.41e-21	-0.209186	56	0.021046	yes	ESPMSL
chr1_1426261_C_T_b38	ATAD3C	-9.869	1.13e-20	-0.208667	55	0.021144	yes	ESPMSL
chr1_1445240_A_G_b38	ATAD3C	-9.752	2.86e-20	-0.212009	53	0.02174	yes	ESPMSL
chr1_1433374_T_C_b38	ATAD3C	-9.751	2.89e-20	-0.20439	58	0.020961	yes	ESPMSL
chr1_1430908_A_G_b38	ATAD3C	-9.749	2.94e-20	-0.202552	57	0.020777	yes	ESPMSL
chr1_1436079_A_G_b38	ATAD3C	-9.649	6.45e-20	-0.202457	57	0.020982	yes	ESPMSL
chr1_1448915_G_A_b38	ATAD3C	-9.45	3.06e-19	-0.208013	38	0.022011	yes	ESPMSL
chr1_1432355_G_A_b38	ATAD3C	-9.112	4.14e-18	-0.207751	22	0.022799	yes	ESPMSL
chr1_1431014_G_A_b38	ATAD3C	-8.985	1.09e-17	-0.191035	29	0.021262	yes	ESPMSL
chr1_1441187_A_G_b38	ATAD3C	-8.847	3.07e-17	-0.203746	39	0.02303	yes	ESPMSL
chr1_1376162_G_C_b38	ATAD3C	8.837	3.3e-17	0.201695	44	0.022824	yes	ESPMSL
chr1_1377431_C_T_b38	ATAD3C	8.837	3.3e-17	0.201695	44	0.022824	yes	ESPMSL
chr1_1436388_CA_C_b38	ATAD3C	-8.722	7.75e-17	-0.197994	38	0.0227	yes	ESPMSL
chr1_1384749_C_G_b38	ATAD3C	8.622	1.63e-16	0.197826	44	0.022945	yes	ESPMSL
chr1_1387763_CCT_C_b38	ATAD3C	8.622	1.63e-16	0.197826	44	0.022945	yes	ESPMSL
chr1_1388944_G_A_b38	ATAD3C	8.622	1.63e-16	0.197826	44	0.022945	yes	ESPMSL
chr1_1378204_G_C_b38	ATAD3C	8.621	1.64e-16	0.195507	44	0.022679	yes	ESPMSL
chr1_1411323_A_C_b38	ATAD3C	-8.541	2.95e-16	-0.203215	55	0.023794	yes	ESPMSL
chr1_1402457_A_G_b38	ATAD3C	-8.465	5.12e-16	-0.201072	53	0.023754	yes	ESPMSL
chr1_1387698_A_G_b38	ATAD3C	8.435	6.33e-16	0.200687	53	0.023791	yes	ESPMSL
chr1_1389827_C_T_b38	ATAD3C	8.435	6.33e-16	0.200687	53	0.023791	yes	ESPMSL
chr1_1400410_A_G_b38	ATAD3C	-8.363	1.07e-15	-0.191968	44	0.022954	yes	ESPMSL
chr1_1395346_A_G_b38	ATAD3C	-8.236	2.65e-15	-0.197017	53	0.023921	yes	ESPMSL
chr1_1449831_A_G_b38	ATAD3C	-8.217	3.04e-15	-0.195311	50	0.023769	yes	ESPMSL
chr1_1394423_A_G_b38	ATAD3C	-8.207	3.26e-15	-0.196627	53	0.023958	yes	ESPMSL
chr1_1308516_C_T_b38	ATAD3C	8.194	3.57e-15	0.185348	61	0.02262	yes	ESPMSL
chr1_1330125_G_A_b38	ATAD3C	8.193	3.6e-15	0.19261	55	0.023508	yes	ESPMSL
chr1_1431026_CCACCCCCT_C_b38	ATAD3C	-8.18	3.96e-15	-0.191691	28	0.023435	yes	ESPMSL
chr1_1435945_C_CCGGGCGGGGGCG_b38	ATAD3C	-8.105	6.71e-15	-0.199264	16	0.024585	yes	ESPMSL
chr1_1309988_G_A_b38	ATAD3C	8.078	8.12e-15	0.187248	57	0.02318	yes	ESPMSL
chr1_1313807_G_A_b38	ATAD3C	8.078	8.12e-15	0.187248	57	0.02318	yes	ESPMSL
chr1_1426253_G_A_b38	ATAD3C	-7.978	1.64e-14	-0.211916	10	0.026564	yes	ESPMSL
chr1_1442793_G_A_b38	ATAD3C	-7.952	1.96e-14	-0.201777	12	0.025375	yes	ESPMSL
chr1_1312114_T_C_b38	ATAD3C	7.886	3.09e-14	0.184356	54	0.023376	yes	ESPMSL
chr1_1431656_G_A_b38	ATAD3C	-7.823	4.78e-14	-0.202876	12	0.025933	yes	ESPMSL
chr1_1438102_G_C_b38	ATAD3C	-7.751	7.82e-14	-0.182619	19	0.02356	yes	ESPMSL
chr1_1431813_G_T_b38	ATAD3C	-7.715	1e-13	-0.182309	19	0.023629	yes	ESPMSL
chr1_1366561_AGT_A_b38	ATAD3C	7.706	1.07e-13	0.182509	54	0.023684	yes	ESPMSL
chr1_1380867_A_G_b38	ATAD3C	-7.628	1.81e-13	-0.229822	8	0.030129	yes	ESPMSL
chr1_1358384_G_C_b38	ATAD3C	7.539	3.28e-13	0.180115	54	0.02389	yes	ESPMSL
chr1_1375642_C_T_b38	ATAD3C	-7.525	3.62e-13	-0.21185	11	0.028154	yes	ESPMSL
chr1_1434687_C_G_b38	ATAD3C	-7.496	4.37e-13	-0.187407	14	0.025	yes	ESPMSL
chr1_1379091_T_G_b38	ATAD3C	7.461	5.55e-13	0.199668	15	0.026763	yes	ESPMSL
chr1_1370113_A_G_b38	ATAD3C	7.42	7.26e-13	0.171124	42	0.023062	yes	ESPMSL
chr1_1374505_A_G_b38	ATAD3C	-7.411	7.72e-13	-0.20981	11	0.028311	yes	ESPMSL
chr1_1366427_AGTGTGATTGAATGAGT_A_b38	ATAD3C	7.391	8.79e-13	0.171054	43	0.023143	yes	ESPMSL
chr1_1449009_A_T_b38	ATAD3C	-7.214	2.8e-12	-0.180048	36	0.024957	yes	ESPMSL
chr1_1454770_T_C_b38	ATAD3C	-7.192	3.23e-12	-0.169525	48	0.02357	yes	ESPMSL
chr1_1382893_G_A_b38	ATAD3C	-7.163	3.9e-12	-0.207302	10	0.028939	yes	ESPMSL
chr1_1439805_G_C_b38	ATAD3C	-7.151	4.23e-12	-0.169647	22	0.023724	yes	ESPMSL
chr1_1373006_G_A_b38	ATAD3C	-7.135	4.67e-12	-0.214188	7	0.030018	yes	ESPMSL
chr1_1453703_A_G_b38	ATAD3C	-7.107	5.62e-12	-0.167603	48	0.023584	yes	ESPMSL
chr1_1454092_A_G_b38	ATAD3C	-7.107	5.62e-12	-0.167603	48	0.023584	yes	ESPMSL
chr1_1471992_T_C_b38	ATAD3C	-7.082	6.56e-12	-0.163515	60	0.023088	yes	ESPMSL
chr1_1455617_T_G_b38	ATAD3C	-7.025	9.43e-12	-0.166702	48	0.023728	yes	ESPMSL
chr1_1384546_C_T_b38	ATAD3C	-7.002	1.09e-11	-0.219523	8	0.031351	yes	ESPMSL
chr1_1407565_C_A_b38	ATAD3C	-6.985	1.22e-11	-0.219983	8	0.031494	yes	ESPMSL
chr1_1403593_A_G_b38	ATAD3C	-6.976	1.29e-11	-0.204498	10	0.029313	yes	ESPMSL
chr1_1452511_A_G_b38	ATAD3C	-6.953	1.49e-11	-0.16533	48	0.023777	yes	ESPMSL
chr1_1452888_C_A_b38	ATAD3C	-6.953	1.49e-11	-0.16533	48	0.023777	yes	ESPMSL
chr1_1452909_A_C_b38	ATAD3C	-6.953	1.49e-11	-0.16533	48	0.023777	yes	ESPMSL
chr1_1373007_G_A_b38	ATAD3C	-6.947	1.55e-11	-0.205912	8	0.029639	yes	ESPMSL
chr1_1383743_T_C_b38	ATAD3C	-6.932	1.71e-11	-0.203323	10	0.029332	yes	ESPMSL
chr1_1454315_C_T_b38	ATAD3C	-6.887	2.26e-11	-0.162581	42	0.023608	yes	ESPMSL
chr1_1372909_G_A_b38	ATAD3C	-6.866	2.58e-11	-0.201304	9	0.029318	yes	ESPMSL
chr1_1361679_G_A_b38	ATAD3C	6.818	3.49e-11	0.170763	30	0.025047	yes	ESPMSL
chr1_1367292_A_AGT_b38	ATAD3C	6.729	6.04e-11	0.172498	16	0.025635	yes	ESPMSL
chr1_1398218_C_A_b38	ATAD3C	-6.729	6.05e-11	-0.199031	10	0.029579	yes	ESPMSL
chr1_1400756_GGA_G_b38	ATAD3C	-6.729	6.05e-11	-0.199031	10	0.029579	yes	ESPMSL
chr1_1401954_G_T_b38	ATAD3C	-6.729	6.05e-11	-0.199031	10	0.029579	yes	ESPMSL
chr1_1363986_C_T_b38	ATAD3C	6.724	6.22e-11	0.173844	16	0.025853	yes	ESPMSL
chr1_1379083_AT_A_b38	ATAD3C	6.706	6.98e-11	0.15812	26	0.02358	yes	ESPMSL
chr1_1379093_TG_T_b38	ATAD3C	-6.7	7.23e-11	-0.219105	6	0.032703	yes	ESPMSL
chr1_1363898_C_T_b38	ATAD3C	6.688	7.79e-11	0.172533	16	0.025799	yes	ESPMSL
chr1_1366529_TTAG_T_b38	ATAD3C	6.676	8.36e-11	0.171514	16	0.025691	yes	ESPMSL
chr1_1329973_GCGTGTGCCATGCA_G_b38	ATAD3C	-6.643	1.02e-10	-0.196034	8	0.029508	yes	ESPMSL
chr1_1344048_G_A_b38	ATAD3C	-6.643	1.02e-10	-0.196034	8	0.029508	yes	ESPMSL
chr1_1341550_GCA_G_b38	ATAD3C	-6.562	1.67e-10	-0.185198	11	0.028221	yes	ESPMSL
chr1_1451787_A_C_b38	ATAD3C	-6.558	1.72e-10	-0.152282	43	0.023222	yes	ESPMSL
chr1_1316929_A_T_b38	ATAD3C	-6.414	4.07e-10	-0.184648	8	0.028789	yes	ESPMSL
chr1_1394041_G_A_b38	ATAD3C	-6.361	5.58e-10	-0.214426	5	0.033712	yes	ESPMSL
chr1_1292284_TTGAG_T_b38	ATAD3C	-6.319	7.13e-10	-0.173114	23	0.027397	yes	ESPMSL
chr1_1457071_C_T_b38	ATAD3C	-6.259	1.01e-09	-0.147651	24	0.023589	yes	ESPMSL
chr1_1290968_C_G_b38	ATAD3C	-6.225	1.23e-09	-0.171348	35	0.027524	yes	ESPMSL
chr1_1364253_C_G_b38	ATAD3C	-6.218	1.28e-09	-0.175789	10	0.02827	yes	ESPMSL
chr1_1497605_G_C_b38	ATAD3C	-6.216	1.3e-09	-0.126089	60	0.020285	yes	ESPMSL
chr1_1368991_C_T_b38	ATAD3C	-6.172	1.68e-09	-0.173983	10	0.028189	yes	ESPMSL
chr1_1455924_T_C_b38	ATAD3C	-6.098	2.57e-09	-0.149132	21	0.024456	yes	ESPMSL
chr1_1364357_A_C_b38	ATAD3C	-6.09	2.69e-09	-0.170408	10	0.027984	yes	ESPMSL
chr1_1368514_C_G_b38	ATAD3C	-6.09	2.69e-09	-0.170408	10	0.027984	yes	ESPMSL
chr1_1365566_G_A_b38	ATAD3C	6.089	2.7e-09	0.156401	16	0.025686	yes	ESPMSL
chr1_1361685_C_T_b38	ATAD3C	-6.088	2.71e-09	-0.162558	22	0.026701	yes	ESPMSL
chr1_1454848_T_C_b38	ATAD3C	-6.054	3.3e-09	-0.146812	22	0.024252	yes	ESPMSL
chr1_1217251_C_A_b38	ATAD3C	-6.041	3.54e-09	-0.185206	7	0.030656	yes	ESPMSL
chr1_1369009_T_C_b38	ATAD3C	-6.032	3.74e-09	-0.172077	10	0.028529	yes	ESPMSL
chr1_1370430_T_C_b38	ATAD3C	-6.029	3.79e-09	-0.171817	11	0.028496	yes	ESPMSL
chr1_1370584_G_C_b38	ATAD3C	-6.029	3.79e-09	-0.171817	11	0.028496	yes	ESPMSL
chr1_1367300_T_TGA_b38	ATAD3C	-6.012	4.18e-09	-0.171725	9	0.028563	yes	ESPMSL
chr1_1453552_G_A_b38	ATAD3C	-6.001	4.44e-09	-0.147068	21	0.024505	yes	ESPMSL
chr1_1455134_T_G_b38	ATAD3C	-6.001	4.44e-09	-0.147068	21	0.024505	yes	ESPMSL
chr1_1455337_A_G_b38	ATAD3C	-6.001	4.44e-09	-0.147068	21	0.024505	yes	ESPMSL
chr1_1455495_C_T_b38	ATAD3C	-6.001	4.44e-09	-0.147068	21	0.024505	yes	ESPMSL
chr1_1369012_C_CG_b38	ATAD3C	-5.992	4.68e-09	-0.171029	10	0.028542	yes	ESPMSL
chr1_1363880_A_G_b38	ATAD3C	-5.971	5.28e-09	-0.167806	10	0.028105	yes	ESPMSL
chr1_1370532_C_T_b38	ATAD3C	-5.964	5.48e-09	-0.166646	12	0.027943	yes	ESPMSL
chr1_1367280_T_A_b38	ATAD3C	-5.948	5.98e-09	-0.167727	10	0.028197	yes	ESPMSL
chr1_1364566_T_C_b38	ATAD3C	-5.948	6.01e-09	-0.167227	10	0.028117	yes	ESPMSL
chr1_1453643_A_ATT_b38	ATAD3C	-5.921	6.96e-09	-0.14134	27	0.02387	yes	ESPMSL
chr1_1375678_TA_T_b38	ATAD3C	5.909	7.44e-09	0.148404	28	0.025113	yes	ESPMSL
chr1_1457033_A_C_b38	ATAD3C	-5.907	7.54e-09	-0.141375	24	0.023934	yes	ESPMSL
chr1_1366292_G_T_b38	ATAD3C	-5.905	7.61e-09	-0.166915	10	0.028265	yes	ESPMSL
chr1_1437993_G_A_b38	ATAD3C	-5.898	7.94e-09	-0.146885	18	0.024906	yes	ESPMSL
chr1_1456217_T_C_b38	ATAD3C	-5.878	8.85e-09	-0.144342	42	0.024556	yes	ESPMSL
chr1_1369282_G_A_b38	ATAD3C	-5.875	9.02e-09	-0.166326	10	0.028313	yes	ESPMSL
chr1_1369320_GT_G_b38	ATAD3C	-5.875	9.02e-09	-0.166326	10	0.028313	yes	ESPMSL
chr1_1369407_G_A_b38	ATAD3C	-5.875	9.02e-09	-0.166326	10	0.028313	yes	ESPMSL
chr1_1369476_CTT_C_b38	ATAD3C	-5.875	9.02e-09	-0.166326	10	0.028313	yes	ESPMSL
chr1_1369556_C_G_b38	ATAD3C	-5.875	9.02e-09	-0.166326	10	0.028313	yes	ESPMSL
chr1_1369627_T_C_b38	ATAD3C	-5.875	9.02e-09	-0.166326	10	0.028313	yes	ESPMSL
chr1_1369686_T_C_b38	ATAD3C	-5.875	9.02e-09	-0.166326	10	0.028313	yes	ESPMSL
chr1_1369716_G_C_b38	ATAD3C	-5.875	9.02e-09	-0.166326	10	0.028313	yes	ESPMSL
chr1_1369741_C_T_b38	ATAD3C	-5.875	9.02e-09	-0.166326	10	0.028313	yes	ESPMSL
chr1_1370181_C_T_b38	ATAD3C	-5.875	9.02e-09	-0.166326	10	0.028313	yes	ESPMSL
chr1_1370317_G_C_b38	ATAD3C	-5.875	9.02e-09	-0.166326	10	0.028313	yes	ESPMSL
chr1_1370320_A_G_b38	ATAD3C	-5.875	9.02e-09	-0.166326	10	0.028313	yes	ESPMSL
chr1_1364282_T_G_b38	ATAD3C	-5.869	9.33e-09	-0.165723	10	0.028239	yes	ESPMSL
chr1_1364694_T_C_b38	ATAD3C	-5.869	9.33e-09	-0.165723	10	0.028239	yes	ESPMSL
chr1_1364721_C_T_b38	ATAD3C	-5.869	9.33e-09	-0.165723	10	0.028239	yes	ESPMSL
chr1_1365160_A_G_b38	ATAD3C	-5.869	9.33e-09	-0.165723	10	0.028239	yes	ESPMSL
chr1_1365198_C_T_b38	ATAD3C	-5.869	9.33e-09	-0.165723	10	0.028239	yes	ESPMSL
chr1_1366008_A_G_b38	ATAD3C	-5.869	9.33e-09	-0.165723	10	0.028239	yes	ESPMSL
chr1_1366062_T_C_b38	ATAD3C	-5.869	9.33e-09	-0.165723	10	0.028239	yes	ESPMSL
chr1_1366145_TGTGAA_T_b38	ATAD3C	-5.869	9.33e-09	-0.165723	10	0.028239	yes	ESPMSL
chr1_1366187_A_AGT_b38	ATAD3C	-5.869	9.33e-09	-0.165723	10	0.028239	yes	ESPMSL
chr1_1366321_TGTGTGTAAATGG_T_b38	ATAD3C	-5.869	9.33e-09	-0.165723	10	0.028239	yes	ESPMSL
chr1_1366453_G_T_b38	ATAD3C	-5.869	9.33e-09	-0.165723	10	0.028239	yes	ESPMSL
chr1_1366726_T_G_b38	ATAD3C	-5.869	9.33e-09	-0.165723	10	0.028239	yes	ESPMSL
chr1_1367258_T_A_b38	ATAD3C	-5.869	9.33e-09	-0.165723	10	0.028239	yes	ESPMSL
chr1_1367297_GAA_G_b38	ATAD3C	-5.869	9.33e-09	-0.165723	10	0.028239	yes	ESPMSL
chr1_1367329_A_AGT_b38	ATAD3C	-5.869	9.33e-09	-0.165723	10	0.028239	yes	ESPMSL
chr1_1367373_T_TGTG_b38	ATAD3C	-5.869	9.33e-09	-0.165723	10	0.028239	yes	ESPMSL
chr1_1367388_T_TTGG_b38	ATAD3C	-5.869	9.33e-09	-0.165723	10	0.028239	yes	ESPMSL
chr1_1367593_G_A_b38	ATAD3C	-5.869	9.33e-09	-0.165723	10	0.028239	yes	ESPMSL
chr1_1367602_GT_G_b38	ATAD3C	-5.869	9.33e-09	-0.165723	10	0.028239	yes	ESPMSL
chr1_1367605_GAGTGAGTGTA_G_b38	ATAD3C	-5.869	9.33e-09	-0.165723	10	0.028239	yes	ESPMSL
chr1_1367670_GGTGA_G_b38	ATAD3C	-5.869	9.33e-09	-0.165723	10	0.028239	yes	ESPMSL
chr1_1367722_TTTTA_T_b38	ATAD3C	-5.869	9.33e-09	-0.165723	10	0.028239	yes	ESPMSL
chr1_1367874_A_T_b38	ATAD3C	-5.869	9.33e-09	-0.165723	10	0.028239	yes	ESPMSL
chr1_1367951_C_T_b38	ATAD3C	-5.869	9.33e-09	-0.165723	10	0.028239	yes	ESPMSL
chr1_1367965_A_G_b38	ATAD3C	-5.869	9.33e-09	-0.165723	10	0.028239	yes	ESPMSL
chr1_1367970_T_G_b38	ATAD3C	-5.869	9.33e-09	-0.165723	10	0.028239	yes	ESPMSL
chr1_1367994_C_A_b38	ATAD3C	-5.869	9.33e-09	-0.165723	10	0.028239	yes	ESPMSL
chr1_1368297_C_T_b38	ATAD3C	-5.869	9.33e-09	-0.165723	10	0.028239	yes	ESPMSL
chr1_1369821_C_T_b38	ATAD3C	-5.866	9.44e-09	-0.166118	10	0.028317	yes	ESPMSL
chr1_1363456_CAG_C_b38	ATAD3C	5.853	1.02e-08	0.139959	27	0.023912	yes	ESPMSL
chr1_1303112_G_A_b38	ATAD3C	-5.821	1.22e-08	-0.179063	6	0.030763	yes	ESPMSL
chr1_1367268_TGA_T_b38	ATAD3C	-5.789	1.44e-08	-0.162776	10	0.028117	yes	ESPMSL
chr1_1367919_C_T_b38	ATAD3C	-5.785	1.48e-08	-0.163452	10	0.028254	yes	ESPMSL
chr1_1452825_AAAG_A_b38	ATAD3C	-5.779	1.52e-08	-0.142761	21	0.024701	yes	ESPMSL
chr1_1367511_ATGAG_A_b38	ATAD3C	-5.776	1.56e-08	-0.165501	9	0.028655	yes	ESPMSL
chr1_1447108_A_ATT_b38	ATAD3C	-5.775	1.56e-08	-0.135921	24	0.023536	yes	ESPMSL
chr1_1456079_T_C_b38	ATAD3C	-5.767	1.64e-08	-0.142654	20	0.024738	yes	ESPMSL
chr1_1479719_T_C_b38	ATAD3C	-5.756	1.73e-08	-0.133366	62	0.023169	yes	ESPMSL
chr1_1363688_C_T_b38	ATAD3C	-5.742	1.88e-08	-0.162717	10	0.02834	yes	ESPMSL
chr1_1364099_CCA_C_b38	ATAD3C	-5.742	1.88e-08	-0.162717	10	0.02834	yes	ESPMSL
chr1_1364102_TGTTG_T_b38	ATAD3C	-5.742	1.88e-08	-0.162717	10	0.02834	yes	ESPMSL
chr1_1368763_G_A_b38	ATAD3C	-5.742	1.88e-08	-0.162717	10	0.02834	yes	ESPMSL
chr1_1517993_A_G_b38	ATAD3C	-5.739	1.9e-08	-0.125445	71	0.021859	yes	ESPMSL
chr1_1519934_T_G_b38	ATAD3C	-5.739	1.9e-08	-0.125445	71	0.021859	yes	ESPMSL
chr1_1519938_T_C_b38	ATAD3C	-5.739	1.9e-08	-0.125445	71	0.021859	yes	ESPMSL
chr1_1456051_C_T_b38	ATAD3C	-5.73	2e-08	-0.140971	20	0.024604	yes	ESPMSL
chr1_1428999_C_CA_b38	ATAD3C	-5.727	2.03e-08	-0.131112	23	0.022895	yes	ESPMSL
chr1_1366511_GGTGA_G_b38	ATAD3C	-5.707	2.27e-08	-0.161324	10	0.028269	yes	ESPMSL
chr1_1368177_G_C_b38	ATAD3C	-5.687	2.53e-08	-0.160661	13	0.028253	yes	ESPMSL
chr1_1337898_A_G_b38	ATAD3C	5.685	2.55e-08	0.13475	19	0.023704	yes	ESPMSL
chr1_1573654_T_C_b38	ATAD3C	-5.681	2.61e-08	-0.119562	69	0.021046	yes	ESPMSL
chr1_1574445_A_G_b38	ATAD3C	-5.681	2.61e-08	-0.119562	69	0.021046	yes	ESPMSL
chr1_1575421_C_T_b38	ATAD3C	-5.673	2.73e-08	-0.118327	68	0.020859	yes	ESPMSL
chr1_1575724_G_C_b38	ATAD3C	-5.649	3.1e-08	-0.118016	68	0.020891	yes	ESPMSL
chr1_1304555_A_C_b38	ATAD3C	-5.6	4.03e-08	-0.17449	6	0.03116	yes	ESPMSL
chr1_1366681_T_TGA_b38	ATAD3C	-5.599	4.05e-08	-0.160638	10	0.028691	yes	ESPMSL
chr1_1367462_T_C_b38	ATAD3C	-5.581	4.47e-08	-0.159523	10	0.028586	yes	ESPMSL
chr1_1451968_C_T_b38	ATAD3C	-5.577	4.56e-08	-0.139291	19	0.024978	yes	ESPMSL
chr1_1574032_AAAG_A_b38	ATAD3C	-5.55	5.24e-08	-0.128714	37	0.02319	yes	ESPMSL
chr1_1259424_T_C_b38	ATAD3C	-5.542	5.48e-08	-0.137311	52	0.024775	yes	ESPMSL
chr1_1456154_G_A_b38	ATAD3C	-5.538	5.6e-08	-0.137401	20	0.024811	yes	ESPMSL
chr1_1325753_G_T_b38	ATAD3C	-5.53	5.83e-08	-0.179821	6	0.032516	yes	ESPMSL
chr1_1453961_C_T_b38	ATAD3C	-5.526	5.97e-08	-0.154632	7	0.027983	yes	ESPMSL
chr1_1452797_CAA_C_b38	ATAD3C	-5.5	6.84e-08	-0.140607	19	0.025564	yes	ESPMSL
chr1_1303800_G_A_b38	ATAD3C	-5.499	6.87e-08	-0.177459	6	0.03227	yes	ESPMSL
chr1_1577491_A_AC_b38	ATAD3C	-5.424	1.02e-07	-0.114292	70	0.021071	yes	ESPMSL
chr1_1565680_A_AG_b38	ATAD3C	-5.405	1.12e-07	-0.112911	72	0.020889	yes	ESPMSL
chr1_1453870_A_C_b38	ATAD3C	-5.404	1.13e-07	-0.146872	8	0.027178	yes	ESPMSL
chr1_1570294_CA_C_b38	ATAD3C	-5.399	1.16e-07	-0.115078	66	0.021314	yes	ESPMSL
chr1_1366776_G_GAATT_b38	ATAD3C	-5.357	1.44e-07	-0.154784	10	0.028894	yes	ESPMSL
chr1_1366951_A_AGT_b38	ATAD3C	5.353	1.47e-07	0.177799	8	0.033213	yes	ESPMSL
chr1_1551557_A_AG_b38	ATAD3C	-5.352	1.48e-07	-0.115204	66	0.021527	yes	ESPMSL
chr1_1551559_A_T_b38	ATAD3C	-5.352	1.48e-07	-0.115204	66	0.021527	yes	ESPMSL
chr1_1569661_T_C_b38	ATAD3C	-5.339	1.59e-07	-0.108151	70	0.020259	yes	ESPMSL
chr1_1565105_CAAGGCAGGCGGATCATG_C_b38	ATAD3C	-5.328	1.67e-07	-0.110351	76	0.02071	yes	ESPMSL
chr1_1366941_T_TGTGTGCA_b38	ATAD3C	5.32	1.75e-07	0.176533	8	0.033185	yes	ESPMSL
chr1_1559750_C_CAG_b38	ATAD3C	-5.307	1.87e-07	-0.110616	75	0.020844	yes	ESPMSL
chr1_1561628_T_C_b38	ATAD3C	-5.307	1.87e-07	-0.110616	75	0.020844	yes	ESPMSL
chr1_1563918_A_G_b38	ATAD3C	-5.307	1.87e-07	-0.110616	75	0.020844	yes	ESPMSL
chr1_1565561_A_G_b38	ATAD3C	-5.307	1.87e-07	-0.110616	75	0.020844	yes	ESPMSL
chr1_1566086_G_A_b38	ATAD3C	-5.307	1.87e-07	-0.110616	75	0.020844	yes	ESPMSL
chr1_1567715_G_A_b38	ATAD3C	-5.307	1.87e-07	-0.110616	75	0.020844	yes	ESPMSL
chr1_1567719_A_C_b38	ATAD3C	-5.307	1.87e-07	-0.110616	75	0.020844	yes	ESPMSL
chr1_1569875_C_T_b38	ATAD3C	-5.307	1.87e-07	-0.110616	75	0.020844	yes	ESPMSL
chr1_1569180_T_A_b38	ATAD3C	-5.287	2.07e-07	-0.109587	71	0.020729	yes	ESPMSL
chr1_1554852_T_C_b38	ATAD3C	-5.277	2.18e-07	-0.108836	74	0.020626	yes	ESPMSL
chr1_1538787_A_G_b38	ATAD3C	-5.275	2.19e-07	-0.109985	75	0.020849	yes	ESPMSL
chr1_1549590_C_G_b38	ATAD3C	-5.273	2.22e-07	-0.108998	74	0.020672	yes	ESPMSL
chr1_1553692_A_G_b38	ATAD3C	-5.273	2.22e-07	-0.108998	74	0.020672	yes	ESPMSL
chr1_1555247_T_A_b38	ATAD3C	-5.273	2.22e-07	-0.108998	74	0.020672	yes	ESPMSL
chr1_1572532_A_C_b38	ATAD3C	-5.268	2.27e-07	-0.110038	75	0.020887	yes	ESPMSL
chr1_1554694_A_G_b38	ATAD3C	-5.266	2.29e-07	-0.108549	73	0.020611	yes	ESPMSL
chr1_1456829_G_C_b38	ATAD3C	-5.244	2.57e-07	-0.139761	32	0.026651	yes	ESPMSL
chr1_1573079_A_G_b38	ATAD3C	-5.232	2.73e-07	-0.108959	74	0.020826	yes	ESPMSL
chr1_1443673_CTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT_C_b38	ATAD3C	-5.214	3e-07	-0.272202	3	0.05221	yes	ESPMSL
chr1_1541864_T_C_b38	ATAD3C	-5.204	3.15e-07	-0.11212	67	0.021546	yes	ESPMSL
chr1_1558726_C_CA_b38	ATAD3C	-5.204	3.15e-07	-0.11212	67	0.021546	yes	ESPMSL
chr1_1561821_A_C_b38	ATAD3C	-5.204	3.15e-07	-0.11212	67	0.021546	yes	ESPMSL
chr1_1550064_GC_G_b38	ATAD3C	-5.204	3.15e-07	-0.110476	66	0.021231	yes	ESPMSL
chr1_1550068_C_A_b38	ATAD3C	-5.204	3.15e-07	-0.110476	66	0.021231	yes	ESPMSL
chr1_1456182_G_A_b38	ATAD3C	-5.196	3.28e-07	-0.126476	22	0.024341	yes	ESPMSL
chr1_1554781_A_G_b38	ATAD3C	-5.196	3.28e-07	-0.107405	74	0.020671	yes	ESPMSL
chr1_1542773_T_C_b38	ATAD3C	-5.176	3.63e-07	-0.110673	66	0.021384	yes	ESPMSL
chr1_1542793_C_G_b38	ATAD3C	-5.176	3.63e-07	-0.110673	66	0.021384	yes	ESPMSL
chr1_1542800_T_C_b38	ATAD3C	-5.176	3.63e-07	-0.110673	66	0.021384	yes	ESPMSL
chr1_1543953_A_G_b38	ATAD3C	-5.176	3.63e-07	-0.110673	66	0.021384	yes	ESPMSL
chr1_1369803_C_CT_b38	ATAD3C	-5.152	4.08e-07	-0.138523	10	0.026886	yes	ESPMSL
chr1_1366828_A_G_b38	ATAD3C	-5.146	4.2e-07	-0.160578	7	0.031202	yes	ESPMSL
chr1_1450636_A_G_b38	ATAD3C	-5.139	4.35e-07	-0.144056	8	0.02803	yes	ESPMSL
chr1_1452540_G_A_b38	ATAD3C	-5.13	4.56e-07	-0.126901	19	0.024739	yes	ESPMSL
chr1_1365036_T_TAA_b38	ATAD3C	-5.127	4.62e-07	-0.153695	7	0.029975	yes	ESPMSL
chr1_1532798_T_C_b38	ATAD3C	-5.11	5.03e-07	-0.101314	122	0.019826	yes	ESPMSL
chr1_1290841_A_G_b38	ATAD3C	-5.11	5.04e-07	-0.138107	27	0.027028	yes	ESPMSL
chr1_1375678_TAA_T_b38	ATAD3C	-5.08	5.85e-07	-0.133019	16	0.026186	yes	ESPMSL
chr1_1547630_G_A_b38	ATAD3C	-5.073	6.03e-07	-0.102393	69	0.020183	yes	ESPMSL
chr1_1543500_T_G_b38	ATAD3C	-5.062	6.39e-07	-0.107666	66	0.021271	yes	ESPMSL
chr1_1366835_G_GGTGA_b38	ATAD3C	-5.055	6.62e-07	-0.158729	7	0.031403	yes	ESPMSL
chr1_1571794_A_AT_b38	ATAD3C	-5.048	6.82e-07	-0.108598	64	0.021512	yes	ESPMSL
chr1_1366830_G_A_b38	ATAD3C	-5.047	6.88e-07	-0.159403	7	0.031586	yes	ESPMSL
chr1_1370553_CAAA_C_b38	ATAD3C	-5.04	7.11e-07	-0.149498	9	0.029663	yes	ESPMSL
chr1_1574655_GGC_G_b38	ATAD3C	-5.037	7.21e-07	-0.104523	63	0.02075	yes	ESPMSL
chr1_1217733_G_A_b38	ATAD3C	-4.986	9.24e-07	-0.142935	8	0.028665	yes	ESPMSL
chr1_1258206_AT_A_b38	ATAD3C	-4.965	1.03e-06	-0.12083	46	0.024337	yes	ESPMSL
chr1_1557495_CAT_C_b38	ATAD3C	-4.952	1.09e-06	-0.1076	67	0.021729	yes	ESPMSL
chr1_1452384_G_A_b38	ATAD3C	-4.938	1.17e-06	-0.135346	8	0.027409	yes	ESPMSL
chr1_1545795_C_A_b38	ATAD3C	-4.937	1.17e-06	-0.105057	59	0.02128	yes	ESPMSL
chr1_1452346_A_G_b38	ATAD3C	-4.93	1.22e-06	-0.133943	9	0.02717	yes	ESPMSL
chr1_1367028_A_G_b38	ATAD3C	4.846	1.82e-06	0.145323	12	0.02999	yes	ESPMSL
chr1_1456891_T_C_b38	ATAD3C	-4.792	2.35e-06	-0.10423	36	0.021753	yes	ESPMSL
chr1_1417051_CA_C_b38	ATAD3C	-4.735	3.06e-06	-0.150252	6	0.031732	yes	ESPMSL
chr1_1575864_G_A_b38	ATAD3C	-4.715	3.36e-06	-0.10063	65	0.021343	yes	ESPMSL
chr1_1559703_G_C_b38	ATAD3C	-4.649	4.57e-06	-0.095175	69	0.020474	yes	ESPMSL
chr1_1568548_G_A_b38	ATAD3C	-4.649	4.57e-06	-0.095175	69	0.020474	yes	ESPMSL
chr1_1363438_C_CTT_b38	ATAD3C	4.63	4.97e-06	0.102268	40	0.022087	yes	ESPMSL
chr1_1551454_C_A_b38	ATAD3C	-4.609	5.46e-06	-0.091179	124	0.019781	yes	ESPMSL
chr1_1290261_C_A_b38	ATAD3C	-4.605	5.58e-06	-0.130542	26	0.028349	yes	ESPMSL
chr1_1539491_G_C_b38	ATAD3C	-4.566	6.64e-06	-0.095317	73	0.020874	yes	ESPMSL
chr1_1560765_T_C_b38	ATAD3C	-4.563	6.76e-06	-0.097106	61	0.021283	yes	ESPMSL
chr1_1562261_TTTTC_T_b38	ATAD3C	-4.563	6.76e-06	-0.097106	61	0.021283	yes	ESPMSL
chr1_1570587_C_T_b38	ATAD3C	-4.558	6.91e-06	-0.093471	69	0.020509	yes	ESPMSL
chr1_1407232_G_C_b38	ATAD3C	-4.553	7.07e-06	-0.112868	20	0.024792	yes	ESPMSL
chr1_1548572_A_AC_b38	ATAD3C	-4.532	7.75e-06	-0.206511	5	0.045565	yes	ESPMSL
chr1_1555179_A_G_b38	ATAD3C	-4.439	1.17e-05	-0.091161	58	0.020535	yes	ESPMSL
chr1_1280044_T_C_b38	ATAD3C	-4.394	1.43e-05	-0.099998	63	0.022757	yes	ESPMSL
chr1_1523187_A_G_b38	ATAD3C	-4.389	1.46e-05	-0.161052	26	0.036691	yes	ESPMSL
chr1_1537493_T_A_b38	ATAD3C	-4.376	1.55e-05	-0.090702	63	0.020726	yes	ESPMSL
chr1_1555871_T_C_b38	ATAD3C	-4.356	1.69e-05	-0.091292	61	0.02096	yes	ESPMSL
chr1_1554548_T_C_b38	ATAD3C	-4.353	1.72e-05	-0.089965	56	0.02067	yes	ESPMSL
chr1_1300330_T_A_b38	ATAD3C	-4.306	2.1e-05	-0.13799	32	0.032044	yes	ESPMSL
chr1_1301656_T_C_b38	ATAD3C	-4.306	2.1e-05	-0.13799	32	0.032044	yes	ESPMSL
chr1_1423062_C_T_b38	ATAD3C	-4.299	2.16e-05	-0.142345	8	0.033107	yes	ESPMSL
chr1_1575935_T_C_b38	ATAD3C	-4.295	2.21e-05	-0.091165	70	0.021228	yes	ESPMSL
chr1_1366883_G_GGTGTGAATTGGTGTAGTGTGAATGAGT_b38	ATAD3C	-4.225	2.97e-05	-0.145929	5	0.034538	yes	ESPMSL
chr1_1497606_C_G_b38	ATAD3C	-4.206	3.21e-05	-0.104762	17	0.024905	yes	ESPMSL
chr1_1451028_T_A_b38	ATAD3C	-4.193	3.4e-05	-0.11699	9	0.0279	yes	ESPMSL
chr1_1553018_CA_C_b38	ATAD3C	-4.163	3.86e-05	-0.094119	21	0.022609	yes	ESPMSL
chr1_1295039_T_C_b38	ATAD3C	-4.152	4.04e-05	-0.136519	32	0.03288	yes	ESPMSL
chr1_1298561_T_C_b38	ATAD3C	-4.152	4.04e-05	-0.136519	32	0.03288	yes	ESPMSL
chr1_1421170_A_G_b38	ATAD3C	-4.123	4.57e-05	-0.140829	20	0.03416	yes	ESPMSL
chr1_1571986_G_A_b38	ATAD3C	-4.115	4.72e-05	-0.082302	60	0.020002	yes	ESPMSL
chr1_1537160_T_G_b38	ATAD3C	-4.11	4.81e-05	-0.08425	86	0.020497	yes	ESPMSL
chr1_1518621_A_AC_b38	ATAD3C	-4.094	5.16e-05	-0.107844	14	0.026345	yes	ESPMSL
chr1_1549967_C_G_b38	ATAD3C	-4.085	5.33e-05	-0.08646	39	0.021163	yes	ESPMSL
chr1_1307603_G_A_b38	ATAD3C	4.083	5.39e-05	0.130895	33	0.032061	yes	ESPMSL
chr1_1554290_C_T_b38	ATAD3C	-4.081	5.43e-05	-0.085363	55	0.020918	yes	ESPMSL
chr1_1558347_G_A_b38	ATAD3C	-4.069	5.7e-05	-0.087237	48	0.021439	yes	ESPMSL
chr1_1306420_A_G_b38	ATAD3C	4.055	6.04e-05	0.133689	33	0.032966	yes	ESPMSL
chr1_1308178_GGGGCGCGGGGA_G_b38	ATAD3C	-4.052	6.13e-05	-0.10454	14	0.025802	yes	ESPMSL
chr1_1566854_CA_C_b38	ATAD3C	-4.002	7.5e-05	-0.095439	39	0.023847	yes	ESPMSL
chr1_1282558_C_CCA_b38	ATAD3C	-3.958	8.97e-05	-0.10577	30	0.026724	yes	ESPMSL
chr1_1307327_A_G_b38	ATAD3C	3.92	0.000104	0.128836	33	0.032864	yes	ESPMSL
chr1_1249880_A_G_b38	ATAD3C	-3.911	0.000108	-0.103703	19	0.026512	yes	ESPMSL
chr1_1302795_T_TC_b38	ATAD3C	3.897	0.000114	0.092761	61	0.023801	yes	ESPMSL
chr1_1423368_G_A_b38	ATAD3C	-3.883	0.000121	-0.121984	8	0.031412	yes	ESPMSL
chr1_1424078_G_A_b38	ATAD3C	-3.88	0.000122	-0.119922	9	0.030907	yes	ESPMSL
chr1_1424220_A_G_b38	ATAD3C	-3.88	0.000122	-0.119922	9	0.030907	yes	ESPMSL
chr1_1251122_A_T_b38	ATAD3C	-3.841	0.000143	-0.099968	20	0.026027	yes	ESPMSL
chr1_1425013_C_T_b38	ATAD3C	-3.829	0.00015	-0.123435	33	0.032238	yes	ESPMSL
chr1_1423191_T_A_b38	ATAD3C	-3.817	0.000157	-0.119025	9	0.031182	yes	ESPMSL
chr1_1423343_G_T_b38	ATAD3C	-3.796	0.00017	-0.118114	9	0.031112	yes	ESPMSL
chr1_1423478_C_T_b38	ATAD3C	-3.796	0.00017	-0.118114	9	0.031112	yes	ESPMSL
chr1_1424102_G_T_b38	ATAD3C	-3.788	0.000175	-0.116209	10	0.030674	yes	ESPMSL
chr1_1524911_C_T_b38	ATAD3C	-3.776	0.000184	-0.155728	12	0.041246	yes	ESPMSL
chr1_1580890_C_T_b38	ATAD3C	-3.723	0.000226	-0.081454	29	0.02188	yes	ESPMSL
chr1_1215852_T_C_b38	ATAD3C	-3.706	0.000241	-0.089375	17	0.024117	yes	ESPMSL
chr1_1534226_C_T_b38	ATAD3C	-3.704	0.000243	-0.076855	55	0.020749	yes	ESPMSL
chr1_1562444_C_T_b38	ATAD3C	-3.671	0.000275	-0.117298	6	0.031953	yes	ESPMSL
chr1_1235602_C_A_b38	ATAD3C	-3.665	0.000281	-0.105035	9	0.02866	yes	ESPMSL
chr1_1187904_CA_C_b38	ATAD3C	3.659	0.000288	0.08828	13	0.024129	yes	ESPMSL
chr1_1450193_C_T_b38	ATAD3C	-3.647	0.000301	-0.12991	10	0.035619	yes	ESPMSL
chr1_1573776_A_G_b38	ATAD3C	-3.627	0.000324	-0.078951	30	0.021766	yes	ESPMSL
chr1_1231710_CCCCCGGGAA_C_b38	ATAD3C	-3.613	0.000342	-0.101962	9	0.02822	yes	ESPMSL
chr1_1385553_G_A_b38	ATAD3C	3.593	0.000369	0.112597	20	0.031341	yes	ESPMSL
chr1_1385919_A_AG_b38	ATAD3C	3.526	0.000471	0.115635	18	0.032792	yes	ESPMSL
chr1_1216593_G_C_b38	ATAD3C	-3.508	0.000503	-0.086354	15	0.024615	yes	ESPMSL
chr1_1579717_T_A_b38	ATAD3C	-3.489	0.00054	-0.073718	33	0.021131	yes	ESPMSL
chr1_1422081_C_T_b38	ATAD3C	-3.44	0.000643	-0.113993	33	0.033133	yes	ESPMSL
chr1_1306584_G_A_b38	ATAD3C	-3.392	0.000765	-0.172848	6	0.050965	yes	ESPMSL
chr1_1538924_C_A_b38	ATAD3C	-3.385	0.000782	-0.069841	48	0.020631	yes	ESPMSL
chr1_1226486_C_T_b38	ATAD3C	-3.374	0.000815	-0.096365	8	0.028564	yes	ESPMSL
chr1_1419135_C_G_b38	ATAD3C	-3.367	0.000833	-0.111155	32	0.033008	yes	ESPMSL
chr1_1241639_T_C_b38	ATAD3C	-3.358	0.000861	-0.099648	9	0.029674	yes	ESPMSL
chr1_1372258_T_C_b38	ATAD3C	3.342	0.000912	0.137397	5	0.041116	yes	ESPMSL
chr1_1415976_G_A_b38	ATAD3C	-3.34	0.000919	-0.106887	22	0.032006	yes	ESPMSL
chr1_1573429_CAAAAAAAAAAAAAAAAAA_C_b38	ATAD3C	-3.328	0.000956	-0.070265	65	0.021111	yes	ESPMSL
chr1_1499586_C_CTTT_b38	ATAD3C	-3.307	0.00103	-0.16997	5	0.05139	yes	ESPMSL
chr1_1242094_A_G_b38	ATAD3C	-3.3	0.00106	-0.097057	10	0.029416	yes	ESPMSL
chr1_1242250_A_G_b38	ATAD3C	-3.3	0.00106	-0.097057	10	0.029416	yes	ESPMSL
chr1_1341098_T_G_b38	ATAD3C	3.296	0.00107	0.11249	5	0.03413	yes	ESPMSL
chr1_1424727_C_A_b38	ATAD3C	-3.279	0.00113	-0.159679	5	0.048698	yes	ESPMSL
chr1_1243545_G_A_b38	ATAD3C	-3.277	0.00114	-0.101745	5	0.031049	yes	ESPMSL
chr1_1243929_G_A_b38	ATAD3C	-3.277	0.00114	-0.101745	5	0.031049	yes	ESPMSL
chr1_1500745_A_C_b38	ATAD3C	-3.263	0.0012	-0.110539	38	0.033873	yes	ESPMSL
chr1_1545968_T_C_b38	ATAD3C	-3.254	0.00123	-0.06856	35	0.021066	yes	ESPMSL
chr1_1424819_C_T_b38	ATAD3C	-3.249	0.00126	-0.174289	3	0.05364	yes	ESPMSL
chr1_1450322_CAA_C_b38	ATAD3C	-3.249	0.00126	-0.11223	7	0.034548	yes	ESPMSL
chr1_1383798_AG_A_b38	ATAD3C	3.239	0.0013	0.108686	8	0.033558	yes	ESPMSL
chr1_1361833_G_C_b38	ATAD3C	3.232	0.00133	0.090492	11	0.028001	yes	ESPMSL
chr1_1241053_A_G_b38	ATAD3C	-3.227	0.00135	-0.094773	10	0.029364	yes	ESPMSL
chr1_1518285_T_C_b38	ATAD3C	-3.214	0.00142	-0.087721	46	0.027291	yes	ESPMSL
chr1_1570568_AC_A_b38	ATAD3C	-3.207	0.00145	-0.071012	32	0.022146	yes	ESPMSL
chr1_1568428_C_G_b38	ATAD3C	-3.202	0.00147	-0.066959	37	0.020909	yes	ESPMSL
chr1_1375998_T_A_b38	ATAD3C	3.179	0.0016	0.106375	15	0.033465	yes	ESPMSL
chr1_1533883_G_T_b38	ATAD3C	-3.172	0.00163	-0.122424	9	0.03859	yes	ESPMSL
chr1_1170732_A_G_b38	ATAD3C	-3.164	0.00168	-0.192434	30	0.060828	yes	ESPMSL
chr1_1554241_T_C_b38	ATAD3C	-3.161	0.00169	-0.068351	40	0.021622	yes	ESPMSL
chr1_1527386_C_T_b38	ATAD3C	-3.15	0.00176	-0.124478	20	0.039514	yes	ESPMSL
chr1_1231507_T_C_b38	ATAD3C	-3.091	0.00214	-0.079405	14	0.025688	yes	ESPMSL
chr1_1522905_A_G_b38	ATAD3C	-3.086	0.00217	-0.113718	19	0.036852	yes	ESPMSL
chr1_1228424_C_T_b38	ATAD3C	-3.083	0.00219	-0.078617	13	0.025499	yes	ESPMSL
chr1_1551523_T_C_b38	ATAD3C	-3.074	0.00226	-0.066924	30	0.021773	yes	ESPMSL
chr1_1306523_C_G_b38	ATAD3C	3.057	0.00238	0.096193	17	0.031462	yes	ESPMSL
chr1_1408687_T_C_b38	ATAD3C	-3.051	0.00244	-0.099535	17	0.032626	yes	ESPMSL
chr1_1229369_G_GC_b38	ATAD3C	-3.048	0.00246	-0.076091	18	0.024963	yes	ESPMSL
chr1_1241831_G_C_b38	ATAD3C	-3.046	0.00247	-0.096488	3	0.031673	yes	ESPMSL
chr1_1002415_C_CATTTTT_b38	ATAD3C	-3.029	0.00261	-0.063771	46	0.021052	yes	ESPMSL
chr1_1366923_AGTTG_A_b38	ATAD3C	-3.004	0.00283	-0.145226	4	0.048344	yes	ESPMSL
chr1_1411929_G_C_b38	ATAD3C	-2.985	0.00301	-0.094479	22	0.031648	yes	ESPMSL
chr1_1474819_G_C_b38	ATAD3C	-2.982	0.00304	-0.128261	6	0.043006	yes	ESPMSL
chr1_1374694_C_G_b38	ATAD3C	2.979	0.00307	0.116938	7	0.039252	yes	ESPMSL
chr1_1279400_C_CTTT_b38	ATAD3C	-2.961	0.00326	-0.143677	5	0.048528	yes	ESPMSL
chr1_1554246_C_T_b38	ATAD3C	-2.96	0.00326	-0.065215	41	0.022033	yes	ESPMSL
chr1_1388565_GTC_G_b38	ATAD3C	2.953	0.00333	0.072653	26	0.024602	yes	ESPMSL
chr1_1410877_A_G_b38	ATAD3C	-2.95	0.00337	-0.095611	27	0.032412	yes	ESPMSL
chr1_1375288_A_C_b38	ATAD3C	2.94	0.00347	0.098812	15	0.033605	yes	ESPMSL
chr1_1375595_C_T_b38	ATAD3C	2.94	0.00347	0.098812	15	0.033605	yes	ESPMSL
chr1_1376092_G_A_b38	ATAD3C	2.94	0.00347	0.098812	15	0.033605	yes	ESPMSL
chr1_1376336_G_A_b38	ATAD3C	2.94	0.00347	0.098812	15	0.033605	yes	ESPMSL
chr1_1379664_G_A_b38	ATAD3C	2.94	0.00347	0.098812	15	0.033605	yes	ESPMSL
chr1_1263831_T_TA_b38	ATAD3C	-2.928	0.00361	-0.107102	4	0.036574	yes	ESPMSL
chr1_1976834_T_C_b38	ATAD3C	-2.928	0.00361	-0.148343	13	0.05067	yes	ESPMSL
chr1_1367040_ATTGG_A_b38	ATAD3C	-2.908	0.00385	-0.138901	3	0.04777	yes	ESPMSL
chr1_1521518_G_A_b38	ATAD3C	-2.907	0.00386	-0.108089	19	0.037188	yes	ESPMSL
chr1_1410616_G_T_b38	ATAD3C	-2.905	0.00388	-0.09211	23	0.031712	yes	ESPMSL
chr1_1412488_C_CAG_b38	ATAD3C	-2.905	0.00388	-0.09211	23	0.031712	yes	ESPMSL
chr1_1251285_G_A_b38	ATAD3C	-2.904	0.00389	-0.082341	11	0.028354	yes	ESPMSL
chr1_1579410_AT_A_b38	ATAD3C	-2.897	0.00398	-0.068504	29	0.023649	yes	ESPMSL
chr1_1672015_G_C_b38	ATAD3C	-2.894	0.00402	-0.159079	7	0.054972	yes	ESPMSL
chr1_1244603_G_A_b38	ATAD3C	-2.891	0.00405	-0.084773	10	0.029321	yes	ESPMSL
chr1_1688457_G_A_b38	ATAD3C	-2.885	0.00413	-0.067423	42	0.023369	yes	ESPMSL
chr1_1363601_A_AT_b38	ATAD3C	2.879	0.00421	0.055281	127	0.019204	yes	ESPMSL
chr1_1230159_G_A_b38	ATAD3C	-2.865	0.00439	-0.070585	28	0.024636	yes	ESPMSL
chr1_1399922_C_T_b38	ATAD3C	-2.864	0.00441	-0.094616	9	0.033039	yes	ESPMSL
chr1_1836387_CTT_C_b38	ATAD3C	2.855	0.00453	0.072691	24	0.025459	yes	ESPMSL
chr1_1308549_G_T_b38	ATAD3C	2.852	0.00457	0.049937	119	0.017508	yes	ESPMSL
chr1_1411525_T_A_b38	ATAD3C	-2.85	0.0046	-0.090695	21	0.031825	yes	ESPMSL
chr1_1512376_G_C_b38	ATAD3C	-2.849	0.00462	-0.081808	31	0.028718	yes	ESPMSL
chr1_1246371_T_C_b38	ATAD3C	-2.847	0.00465	-0.08337	13	0.029284	yes	ESPMSL
chr1_1514211_A_G_b38	ATAD3C	-2.844	0.00468	-0.114364	10	0.040207	yes	ESPMSL
chr1_1353987_CTG_C_b38	ATAD3C	2.839	0.00476	0.096912	6	0.034136	yes	ESPMSL
chr1_1251368_T_C_b38	ATAD3C	-2.831	0.00487	-0.081052	10	0.028628	yes	ESPMSL
chr1_1324185_T_TGG_b38	ATAD3C	-2.82	0.00505	-0.126081	6	0.044711	yes	ESPMSL
chr1_799082_G_A_b38	ATAD3C	2.812	0.00517	0.08004	12	0.028462	yes	ESPMSL
chr1_1327764_G_A_b38	ATAD3C	2.806	0.00526	0.096753	5	0.03448	yes	ESPMSL
chr1_1236303_A_G_b38	ATAD3C	-2.797	0.0054	-0.076209	11	0.027242	yes	ESPMSL
chr1_1533018_T_C_b38	ATAD3C	-2.785	0.00561	-0.103849	19	0.037291	yes	ESPMSL
chr1_1530002_A_G_b38	ATAD3C	-2.775	0.00578	-0.103962	18	0.03746	yes	ESPMSL
chr1_1331945_G_GC_b38	ATAD3C	-2.771	0.00585	-0.102667	10	0.03705	yes	ESPMSL
chr1_1705856_G_A_b38	ATAD3C	2.769	0.0059	0.049608	135	0.017919	yes	ESPMSL
chr1_1251618_G_A_b38	ATAD3C	-2.764	0.00597	-0.079737	9	0.028845	yes	ESPMSL
chr1_1238231_G_A_b38	ATAD3C	-2.754	0.00616	-0.069044	22	0.025069	yes	ESPMSL
chr1_1520875_A_G_b38	ATAD3C	-2.753	0.00619	-0.102082	19	0.037086	yes	ESPMSL
chr1_1385384_G_A_b38	ATAD3C	2.751	0.00621	0.093189	8	0.033868	yes	ESPMSL
chr1_1646352_A_C_b38	ATAD3C	2.747	0.0063	0.076225	11	0.027752	yes	ESPMSL
chr1_1242865_C_T_b38	ATAD3C	-2.745	0.00633	-0.08006	10	0.029169	yes	ESPMSL
chr1_1361836_A_G_b38	ATAD3C	2.741	0.00641	0.102322	4	0.037333	yes	ESPMSL
chr1_1417031_A_G_b38	ATAD3C	-2.73	0.00663	-0.086292	13	0.031614	yes	ESPMSL
chr1_591590_T_C_b38	ATAD3C	-2.725	0.00672	-0.075733	11	0.027795	yes	ESPMSL
chr1_1210101_CAA_C_b38	ATAD3C	-2.722	0.00677	-0.087537	4	0.032153	yes	ESPMSL
chr1_2233384_G_T_b38	ATAD3C	-2.719	0.00685	-0.080682	8	0.029678	yes	ESPMSL
chr1_2325101_C_T_b38	ATAD3C	-2.708	0.00707	-0.105873	4	0.039099	yes	ESPMSL
chr1_1415221_G_T_b38	ATAD3C	-2.706	0.00711	-0.08258	14	0.030518	yes	ESPMSL
chr1_1395050_G_A_b38	ATAD3C	-2.692	0.00741	-0.090834	8	0.033747	yes	ESPMSL
chr1_1418223_A_G_b38	ATAD3C	-2.692	0.00741	-0.083406	15	0.030988	yes	ESPMSL
chr1_2052788_C_T_b38	ATAD3C	2.686	0.00754	0.064582	20	0.024047	yes	ESPMSL
chr1_1277830_C_CA_b38	ATAD3C	-2.682	0.00763	-0.085043	10	0.031713	yes	ESPMSL
chr1_928463_C_T_b38	ATAD3C	-2.679	0.00769	-0.131103	7	0.048939	yes	ESPMSL
chr1_2237274_C_T_b38	ATAD3C	-2.676	0.00776	-0.079792	8	0.029815	yes	ESPMSL
chr1_1469429_A_G_b38	ATAD3C	-2.676	0.00777	-0.091851	30	0.034328	yes	ESPMSL
chr1_1367047_AGTGTGAAT_A_b38	ATAD3C	-2.672	0.00786	-0.130649	3	0.048901	yes	ESPMSL
chr1_1524202_G_A_b38	ATAD3C	-2.65	0.00836	-0.104817	16	0.039548	yes	ESPMSL
chr1_1971331_C_A_b38	ATAD3C	-2.641	0.0086	-0.127614	8	0.048321	yes	ESPMSL
chr1_2119789_C_CT_b38	ATAD3C	2.634	0.00876	0.057505	38	0.021828	yes	ESPMSL
chr1_1423775_C_T_b38	ATAD3C	-2.634	0.00878	-0.103761	4	0.0394	yes	ESPMSL
chr1_1185051_G_A_b38	ATAD3C	-2.623	0.00905	-0.095985	8	0.036593	yes	ESPMSL
chr1_1418000_T_C_b38	ATAD3C	-2.623	0.00906	-0.080885	15	0.03084	yes	ESPMSL
chr1_1418252_A_G_b38	ATAD3C	-2.623	0.00906	-0.080885	15	0.03084	yes	ESPMSL
chr1_2247315_CGCCCTCA_C_b38	ATAD3C	-2.616	0.00925	-0.077317	9	0.029561	yes	ESPMSL
chr1_2250524_C_T_b38	ATAD3C	-2.616	0.00925	-0.077317	9	0.029561	yes	ESPMSL
chr1_1241217_T_C_b38	ATAD3C	-2.61	0.0094	-0.076242	10	0.029211	yes	ESPMSL
chr1_2253549_A_G_b38	ATAD3C	-2.602	0.00961	-0.077121	9	0.029638	yes	ESPMSL
chr1_1419214_A_G_b38	ATAD3C	-2.59	0.00994	-0.083258	17	0.032141	yes	ESPMSL
chr1_1470034_T_C_b38	ATAD3C	-2.59	0.00995	-0.089579	30	0.034586	yes	ESPMSL
chr1_1471144_G_C_b38	ATAD3C	-2.59	0.00995	-0.089579	30	0.034586	yes	ESPMSL
chr1_1437955_C_G_b38	ATAD3C	-4.517	8.3e-06	-0.095704	39	0.021187	no	ESPMSL
chr1_1430020_G_C_b38	ATAD3C	4.385	1.49e-05	0.157018	3	0.03581	no	ESPMSL
chr1_1480224_A_G_b38	ATAD3C	-4.296	2.19e-05	-0.189682	6	0.044148	no	ESPMSL
chr1_1221049_C_G_b38	ATAD3C	-3.84	0.000143	-0.087732	56	0.022848	no	ESPMSL
chr1_1329774_T_C_b38	ATAD3C	3.811	0.00016	0.128558	11	0.033729	no	ESPMSL
chr1_1240580_G_GC_b38	ATAD3C	-3.75	0.000203	-0.116277	4	0.031006	no	ESPMSL
chr1_1326444_G_C_b38	ATAD3C	3.604	0.000354	0.123491	5	0.034268	no	ESPMSL
chr1_1324788_C_A_b38	ATAD3C	3.587	0.000376	0.115881	19	0.032302	no	ESPMSL
chr1_1485324_C_T_b38	ATAD3C	3.572	0.000398	0.121599	3	0.034039	no	ESPMSL
chr1_1252613_C_G_b38	ATAD3C	-3.569	0.000403	-0.121467	3	0.034036	no	ESPMSL
chr1_1288085_GC_G_b38	ATAD3C	-3.556	0.000422	-0.11632	6	0.032707	no	ESPMSL
chr1_1213936_C_G_b38	ATAD3C	-3.526	0.000472	-0.166711	3	0.047283	no	ESPMSL
chr1_1359943_G_A_b38	ATAD3C	3.503	0.000513	0.118104	20	0.033717	no	ESPMSL
chr1_1327586_C_T_b38	ATAD3C	3.49	0.000537	0.114635	12	0.032843	no	ESPMSL
chr1_1341079_C_A_b38	ATAD3C	3.427	0.000674	0.114015	6	0.033267	no	ESPMSL
chr1_975093_G_A_b38	ATAD3C	3.361	0.000851	0.091016	8	0.027077	no	ESPMSL
chr1_1338970_A_G_b38	ATAD3C	3.36	0.000854	0.115777	5	0.034454	no	ESPMSL
chr1_1315752_GAGCGAGGGAGGTGGGGGCGGGGAGGGAGGGAGGGAGGCGGGC_G_b38	ATAD3C	3.356	0.000867	0.080132	20	0.023875	no	ESPMSL
chr1_1479704_G_A_b38	ATAD3C	3.325	0.000966	0.100943	11	0.030355	no	ESPMSL
chr1_1327982_G_A_b38	ATAD3C	3.311	0.00102	0.109412	19	0.033048	no	ESPMSL
chr1_1185961_C_T_b38	ATAD3C	3.304	0.00104	0.102892	5	0.031138	no	ESPMSL
chr1_1186245_C_G_b38	ATAD3C	3.304	0.00104	0.102892	5	0.031138	no	ESPMSL
chr1_1318756_G_A_b38	ATAD3C	3.269	0.00118	0.109274	22	0.033431	no	ESPMSL
chr1_1495136_G_A_b38	ATAD3C	3.248	0.00126	0.10972	4	0.033783	no	ESPMSL
chr1_1515828_G_A_b38	ATAD3C	3.245	0.00127	0.112347	3	0.034619	no	ESPMSL
chr1_1358907_C_A_b38	ATAD3C	3.244	0.00128	0.107809	20	0.033233	no	ESPMSL
chr1_1533841_T_C_b38	ATAD3C	-3.235	0.00132	-0.083369	28	0.025772	no	ESPMSL
chr1_1301426_A_AT_b38	ATAD3C	-3.234	0.00132	-0.095628	14	0.029571	no	ESPMSL
chr1_1238902_T_C_b38	ATAD3C	-3.233	0.00133	-0.073865	57	0.022848	no	ESPMSL
chr1_1322866_A_C_b38	ATAD3C	3.227	0.00136	0.107197	19	0.033218	no	ESPMSL
chr1_1327211_C_T_b38	ATAD3C	3.227	0.00136	0.107197	19	0.033218	no	ESPMSL
chr1_1572877_TG_T_b38	ATAD3C	-3.226	0.00136	-0.074443	22	0.023078	no	ESPMSL
chr1_1319063_G_A_b38	ATAD3C	3.204	0.00147	0.106867	23	0.033353	no	ESPMSL
chr1_1319461_C_G_b38	ATAD3C	3.204	0.00147	0.106867	23	0.033353	no	ESPMSL
chr1_1320023_TG_T_b38	ATAD3C	3.204	0.00147	0.106867	23	0.033353	no	ESPMSL
chr1_1368047_ACT_A_b38	ATAD3C	3.202	0.00147	0.10681	17	0.033353	no	ESPMSL
chr1_1357046_C_G_b38	ATAD3C	3.189	0.00154	0.106793	20	0.033487	no	ESPMSL
chr1_1357369_C_T_b38	ATAD3C	3.189	0.00154	0.106793	20	0.033487	no	ESPMSL
chr1_1360023_T_C_b38	ATAD3C	3.189	0.00154	0.106793	20	0.033487	no	ESPMSL
chr1_1195100_G_A_b38	ATAD3C	3.169	0.00165	0.101248	5	0.031946	no	ESPMSL
chr1_1337736_A_G_b38	ATAD3C	3.124	0.00191	0.104224	11	0.033359	no	ESPMSL
chr1_1186644_T_C_b38	ATAD3C	3.099	0.00208	0.102609	4	0.033109	no	ESPMSL
chr1_1187136_G_A_b38	ATAD3C	3.099	0.00208	0.102609	4	0.033109	no	ESPMSL
chr1_1187726_G_A_b38	ATAD3C	3.099	0.00208	0.102609	4	0.033109	no	ESPMSL
chr1_1188877_A_G_b38	ATAD3C	3.099	0.00208	0.102609	4	0.033109	no	ESPMSL
chr1_1189511_G_A_b38	ATAD3C	3.099	0.00208	0.102609	4	0.033109	no	ESPMSL
chr1_1190875_G_C_b38	ATAD3C	3.099	0.00208	0.102609	4	0.033109	no	ESPMSL
chr1_1191614_G_A_b38	ATAD3C	3.099	0.00208	0.102609	4	0.033109	no	ESPMSL
chr1_1191942_G_A_b38	ATAD3C	3.099	0.00208	0.102609	4	0.033109	no	ESPMSL
chr1_1192000_G_A_b38	ATAD3C	3.099	0.00208	0.102609	4	0.033109	no	ESPMSL
chr1_1192127_G_A_b38	ATAD3C	3.099	0.00208	0.102609	4	0.033109	no	ESPMSL
chr1_1192143_C_T_b38	ATAD3C	3.099	0.00208	0.102609	4	0.033109	no	ESPMSL
chr1_1192951_G_T_b38	ATAD3C	3.099	0.00208	0.102609	4	0.033109	no	ESPMSL
chr1_1193049_G_A_b38	ATAD3C	3.099	0.00208	0.102609	4	0.033109	no	ESPMSL
chr1_1194292_G_T_b38	ATAD3C	3.099	0.00208	0.102609	4	0.033109	no	ESPMSL
chr1_1194327_A_G_b38	ATAD3C	3.099	0.00208	0.102609	4	0.033109	no	ESPMSL
chr1_1194713_C_T_b38	ATAD3C	3.099	0.00208	0.102609	4	0.033109	no	ESPMSL
chr1_1186939_C_T_b38	ATAD3C	3.097	0.0021	0.102662	4	0.033152	no	ESPMSL
chr1_1353443_A_G_b38	ATAD3C	3.095	0.00211	0.105372	11	0.034046	no	ESPMSL
chr1_1330080_T_C_b38	ATAD3C	3.047	0.00247	0.102093	18	0.033505	no	ESPMSL
chr1_1192301_G_A_b38	ATAD3C	3.044	0.00249	0.101633	4	0.03339	no	ESPMSL
chr1_1186414_G_A_b38	ATAD3C	3.03	0.00261	0.096427	5	0.031823	no	ESPMSL
chr1_1352542_G_A_b38	ATAD3C	3.019	0.00271	0.105333	5	0.034895	no	ESPMSL
chr1_1705198_C_G_b38	ATAD3C	-3.012	0.00276	-0.125418	7	0.041641	no	ESPMSL
chr1_1351747_G_A_b38	ATAD3C	2.994	0.00293	0.104454	5	0.034893	no	ESPMSL
chr1_1353091_C_T_b38	ATAD3C	2.99	0.00297	0.101827	11	0.03406	no	ESPMSL
chr1_1248864_T_C_b38	ATAD3C	-2.981	0.00305	-0.088904	9	0.029826	no	ESPMSL
chr1_1186816_A_G_b38	ATAD3C	2.98	0.00306	0.096501	5	0.032382	no	ESPMSL
chr1_1360989_GAC_G_b38	ATAD3C	2.962	0.00324	0.103051	5	0.034785	no	ESPMSL
chr1_1296939_G_A_b38	ATAD3C	-2.957	0.0033	-0.096912	22	0.032778	no	ESPMSL
chr1_1243102_A_G_b38	ATAD3C	-2.954	0.00333	-0.086008	11	0.029117	no	ESPMSL
chr1_1189019_C_G_b38	ATAD3C	2.94	0.00347	0.096723	4	0.032895	no	ESPMSL
chr1_1189968_T_C_b38	ATAD3C	2.94	0.00347	0.096723	4	0.032895	no	ESPMSL
chr1_1190856_G_A_b38	ATAD3C	2.94	0.00347	0.096723	4	0.032895	no	ESPMSL
chr1_1187013_A_AT_b38	ATAD3C	2.931	0.00358	0.09788	4	0.033399	no	ESPMSL
chr1_1187016_C_T_b38	ATAD3C	2.931	0.00358	0.09788	4	0.033399	no	ESPMSL
chr1_591413_A_G_b38	ATAD3C	-2.923	0.00367	-0.098129	9	0.033573	no	ESPMSL
chr1_1185634_G_A_b38	ATAD3C	2.923	0.00367	0.095046	5	0.032521	no	ESPMSL
chr1_1228069_T_C_b38	ATAD3C	-2.922	0.00368	-0.093796	3	0.032102	no	ESPMSL
chr1_1243650_G_A_b38	ATAD3C	-2.91	0.00382	-0.089302	5	0.030687	no	ESPMSL
chr1_1239126_C_CT_b38	ATAD3C	-2.902	0.00391	-0.09112	5	0.031397	no	ESPMSL
chr1_1239127_A_ACATGCATCC_b38	ATAD3C	-2.902	0.00391	-0.09112	5	0.031397	no	ESPMSL
chr1_1239574_T_C_b38	ATAD3C	-2.902	0.00391	-0.09112	5	0.031397	no	ESPMSL
chr1_1189730_T_C_b38	ATAD3C	2.889	0.00408	0.098003	4	0.033926	no	ESPMSL
chr1_981935_G_A_b38	ATAD3C	2.883	0.00415	0.068341	19	0.023701	no	ESPMSL
chr1_1650000_G_A_b38	ATAD3C	2.88	0.00419	0.057179	69	0.019851	no	ESPMSL
chr1_1341030_C_A_b38	ATAD3C	2.875	0.00426	0.090963	20	0.031637	no	ESPMSL
chr1_1362042_C_T_b38	ATAD3C	2.869	0.00433	0.100383	5	0.034983	no	ESPMSL
chr1_877371_T_C_b38	ATAD3C	2.856	0.00452	0.180262	4	0.063125	no	ESPMSL
chr1_1344634_A_G_b38	ATAD3C	2.852	0.00458	0.099165	5	0.034775	no	ESPMSL
chr1_1345965_C_T_b38	ATAD3C	2.852	0.00458	0.099165	5	0.034775	no	ESPMSL
chr1_1303959_T_G_b38	ATAD3C	2.841	0.00472	0.093161	24	0.032787	no	ESPMSL
chr1_1363031_C_T_b38	ATAD3C	2.833	0.00485	0.100474	4	0.035467	no	ESPMSL
chr1_1353203_C_G_b38	ATAD3C	2.809	0.00522	0.100591	5	0.035815	no	ESPMSL
chr1_1409623_T_C_b38	ATAD3C	-2.797	0.00542	-0.084035	15	0.030048	no	ESPMSL
chr1_1533754_T_C_b38	ATAD3C	-2.791	0.00551	-0.07027	31	0.025175	no	ESPMSL
chr1_1354531_G_A_b38	ATAD3C	2.79	0.00554	0.097014	5	0.034778	no	ESPMSL
chr1_1225476_T_C_b38	ATAD3C	-2.783	0.00565	-0.088103	4	0.031663	no	ESPMSL
chr1_1226013_C_T_b38	ATAD3C	-2.783	0.00565	-0.088103	4	0.031663	no	ESPMSL
chr1_1360302_A_G_b38	ATAD3C	2.766	0.00595	0.096217	5	0.034788	no	ESPMSL
chr1_1199327_G_A_b38	ATAD3C	2.76	0.00605	0.090767	5	0.032888	no	ESPMSL
chr1_1223640_A_G_b38	ATAD3C	-2.756	0.00612	-0.088229	3	0.032011	no	ESPMSL
chr1_1223644_C_T_b38	ATAD3C	-2.756	0.00612	-0.088229	3	0.032011	no	ESPMSL
chr1_1050080_T_C_b38	ATAD3C	-2.744	0.00635	-0.093721	18	0.034158	no	ESPMSL
chr1_1216708_CT_C_b38	ATAD3C	-2.741	0.00641	-0.091744	3	0.033474	no	ESPMSL
chr1_1363157_C_T_b38	ATAD3C	2.731	0.0066	0.096036	4	0.035168	no	ESPMSL
chr1_1221355_T_C_b38	ATAD3C	-2.699	0.00726	-0.086622	3	0.032099	no	ESPMSL
chr1_1187008_G_A_b38	ATAD3C	2.696	0.00731	0.090441	4	0.033542	no	ESPMSL
chr1_1224281_GTTTTA_G_b38	ATAD3C	-2.696	0.00732	-0.091535	3	0.033952	no	ESPMSL
chr1_1227886_G_A_b38	ATAD3C	-2.696	0.00732	-0.091535	3	0.033952	no	ESPMSL
chr1_1230250_G_A_b38	ATAD3C	-2.696	0.00732	-0.091535	3	0.033952	no	ESPMSL
chr1_1197874_G_A_b38	ATAD3C	2.694	0.00735	0.089731	4	0.033304	no	ESPMSL
chr1_1197586_C_A_b38	ATAD3C	2.693	0.00739	0.088272	5	0.032782	no	ESPMSL
chr1_978230_G_A_b38	ATAD3C	2.684	0.00759	0.063648	19	0.023716	no	ESPMSL
chr1_1360507_T_TGGGGGGC_b38	ATAD3C	2.681	0.00765	0.082709	6	0.030852	no	ESPMSL
chr1_1514366_A_G_b38	ATAD3C	-2.672	0.00785	-0.113758	5	0.042573	no	ESPMSL
chr1_1571434_C_CA_b38	ATAD3C	-2.659	0.00815	-0.061095	36	0.022973	no	ESPMSL
chr1_1223568_A_G_b38	ATAD3C	-2.655	0.00826	-0.083906	4	0.031606	no	ESPMSL
chr1_1240367_A_G_b38	ATAD3C	-2.651	0.00835	-0.083552	5	0.031518	no	ESPMSL
chr1_631998_T_C_b38	ATAD3C	2.632	0.00883	0.201713	3	0.07665	no	ESPMSL
chr1_1238883_G_A_b38	ATAD3C	-2.628	0.00891	-0.088755	3	0.033767	no	ESPMSL
chr1_1197405_C_T_b38	ATAD3C	2.619	0.00917	0.08662	5	0.033079	no	ESPMSL
chr1_788757_T_TAATGGAATGG_b38	ATAD3C	2.618	0.00918	0.057117	30	0.021815	no	ESPMSL
chr1_1558204_T_TAAAAAA_b38	ATAD3C	-2.616	0.00923	-0.06078	31	0.023233	no	ESPMSL
chr1_1363153_T_G_b38	ATAD3C	2.616	0.00925	0.089121	17	0.034072	no	ESPMSL
chr1_1186850_GT_G_b38	ATAD3C	2.615	0.00928	0.080487	7	0.030784	no	ESPMSL
chr1_1725745_C_G_b38	ATAD3C	2.61	0.0094	0.061951	27	0.023735	no	ESPMSL
chr1_1359138_C_T_b38	ATAD3C	2.598	0.00974	0.085442	25	0.032891	no	ESPMSL
chr1_982112_C_T_b38	ATAD3C	2.595	0.00981	0.062024	18	0.0239	no	ESPMSL
chr1_1445187_T_G_b38	ATAD3C	-7.24	3.76e-12	-0.149157	36	0.020601	yes	HRTAA
chr1_1440430_C_G_b38	ATAD3C	-7.211	4.53e-12	-0.151764	24	0.021047	yes	HRTAA
chr1_1440834_C_G_b38	ATAD3C	-7.098	9.12e-12	-0.149328	42	0.021038	yes	HRTAA
chr1_1443457_T_C_b38	ATAD3C	-7.002	1.65e-11	-0.147345	43	0.021043	yes	HRTAA
chr1_1433374_T_C_b38	ATAD3C	-6.621	1.64e-10	-0.133747	47	0.020202	yes	HRTAA
chr1_1445240_A_G_b38	ATAD3C	-6.451	4.44e-10	-0.137032	41	0.021244	yes	HRTAA
chr1_1432355_G_A_b38	ATAD3C	-6.419	5.34e-10	-0.14754	12	0.022986	yes	HRTAA
chr1_1439454_A_G_b38	ATAD3C	-6.331	8.81e-10	-0.132165	40	0.020874	yes	HRTAA
chr1_1442793_G_A_b38	ATAD3C	-6.204	1.81e-09	-0.147443	7	0.023764	yes	HRTAA
chr1_1448915_G_A_b38	ATAD3C	-6.079	3.65e-09	-0.132076	24	0.021725	yes	HRTAA
chr1_1435945_C_CCGGGCGGGGGCG_b38	ATAD3C	-6.059	4.09e-09	-0.146793	7	0.024228	yes	HRTAA
chr1_1438102_G_C_b38	ATAD3C	-6.003	5.56e-09	-0.137581	13	0.022918	yes	HRTAA
chr1_1441187_A_G_b38	ATAD3C	-5.927	8.43e-09	-0.129983	27	0.02193	yes	HRTAA
chr1_1436079_A_G_b38	ATAD3C	-5.9	9.79e-09	-0.122373	44	0.020742	yes	HRTAA
chr1_1428969_T_C_b38	ATAD3C	-5.891	1.03e-08	-0.126177	44	0.021419	yes	HRTAA
chr1_1436388_CA_C_b38	ATAD3C	-5.859	1.22e-08	-0.128667	24	0.021959	yes	HRTAA
chr1_1434687_C_G_b38	ATAD3C	-5.84	1.36e-08	-0.143013	6	0.02449	yes	HRTAA
chr1_1430908_A_G_b38	ATAD3C	-5.784	1.83e-08	-0.124283	44	0.021488	yes	HRTAA
chr1_1431450_A_G_b38	ATAD3C	-5.693	2.97e-08	-0.122254	44	0.021476	yes	HRTAA
chr1_1431537_G_C_b38	ATAD3C	-5.693	2.97e-08	-0.122254	44	0.021476	yes	HRTAA
chr1_1430190_A_C_b38	ATAD3C	-5.678	3.21e-08	-0.122332	44	0.021545	yes	HRTAA
chr1_1454770_T_C_b38	ATAD3C	-5.621	4.33e-08	-0.118298	46	0.021045	yes	HRTAA
chr1_1454315_C_T_b38	ATAD3C	-5.569	5.67e-08	-0.117166	42	0.021038	yes	HRTAA
chr1_1431014_G_A_b38	ATAD3C	-5.549	6.29e-08	-0.120813	22	0.021771	yes	HRTAA
chr1_1426253_G_A_b38	ATAD3C	-5.493	8.42e-08	-0.137771	5	0.025081	yes	HRTAA
chr1_1426810_C_G_b38	ATAD3C	-5.478	9.08e-08	-0.117819	43	0.021506	yes	HRTAA
chr1_1426261_C_T_b38	ATAD3C	-5.461	9.92e-08	-0.118103	42	0.021626	yes	HRTAA
chr1_1431656_G_A_b38	ATAD3C	-5.449	1.06e-07	-0.140092	5	0.02571	yes	HRTAA
chr1_1452511_A_G_b38	ATAD3C	-5.408	1.3e-07	-0.114601	45	0.021193	yes	HRTAA
chr1_1452888_C_A_b38	ATAD3C	-5.408	1.3e-07	-0.114601	45	0.021193	yes	HRTAA
chr1_1452909_A_C_b38	ATAD3C	-5.408	1.3e-07	-0.114601	45	0.021193	yes	HRTAA
chr1_1454092_A_G_b38	ATAD3C	-5.408	1.3e-07	-0.114601	45	0.021193	yes	HRTAA
chr1_1439805_G_C_b38	ATAD3C	-5.378	1.51e-07	-0.123628	13	0.022986	yes	HRTAA
chr1_1455617_T_G_b38	ATAD3C	-5.334	1.89e-07	-0.113043	45	0.021193	yes	HRTAA
chr1_1453703_A_G_b38	ATAD3C	-5.29	2.36e-07	-0.112359	45	0.02124	yes	HRTAA
chr1_1457071_C_T_b38	ATAD3C	-5.235	3.1e-07	-0.106397	27	0.020324	yes	HRTAA
chr1_1452825_AAAG_A_b38	ATAD3C	-5.164	4.41e-07	-0.105854	25	0.020499	yes	HRTAA
chr1_1453552_G_A_b38	ATAD3C	-5.14	4.96e-07	-0.105686	25	0.020563	yes	HRTAA
chr1_1455134_T_G_b38	ATAD3C	-5.14	4.96e-07	-0.105686	25	0.020563	yes	HRTAA
chr1_1455337_A_G_b38	ATAD3C	-5.14	4.96e-07	-0.105686	25	0.020563	yes	HRTAA
chr1_1455495_C_T_b38	ATAD3C	-5.14	4.96e-07	-0.105686	25	0.020563	yes	HRTAA
chr1_1455924_T_C_b38	ATAD3C	-5.14	4.96e-07	-0.105686	25	0.020563	yes	HRTAA
chr1_1471992_T_C_b38	ATAD3C	-5.12	5.45e-07	-0.109361	53	0.021358	yes	HRTAA
chr1_1457033_A_C_b38	ATAD3C	-5.117	5.53e-07	-0.105296	25	0.020576	yes	HRTAA
chr1_1449831_A_G_b38	ATAD3C	-5.112	5.67e-07	-0.117639	39	0.023012	yes	HRTAA
chr1_1454848_T_C_b38	ATAD3C	-5.093	6.24e-07	-0.102992	26	0.020223	yes	HRTAA
chr1_1431026_CCACCCCCT_C_b38	ATAD3C	-5.07	6.97e-07	-0.115125	23	0.022708	yes	HRTAA
chr1_1456051_C_T_b38	ATAD3C	-5.061	7.28e-07	-0.104573	24	0.020664	yes	HRTAA
chr1_1451787_A_C_b38	ATAD3C	-5.057	7.43e-07	-0.104818	38	0.020729	yes	HRTAA
chr1_1431813_G_T_b38	ATAD3C	-5.033	8.32e-07	-0.119547	8	0.023753	yes	HRTAA
chr1_1452346_A_G_b38	ATAD3C	-5.007	9.43e-07	-0.112604	12	0.02249	yes	HRTAA
chr1_1453643_A_ATT_b38	ATAD3C	-4.973	1.11e-06	-0.107809	26	0.021681	yes	HRTAA
chr1_1452540_G_A_b38	ATAD3C	-4.97	1.13e-06	-0.10289	21	0.020702	yes	HRTAA
chr1_1456079_T_C_b38	ATAD3C	-4.881	1.71e-06	-0.100933	25	0.020677	yes	HRTAA
chr1_1456154_G_A_b38	ATAD3C	-4.828	2.2e-06	-0.099831	25	0.020678	yes	HRTAA
chr1_1452384_G_A_b38	ATAD3C	-4.768	2.9e-06	-0.108538	11	0.022764	yes	HRTAA
chr1_1551454_C_A_b38	ATAD3C	-4.761	3e-06	-0.08226	106	0.017279	yes	HRTAA
chr1_1449009_A_T_b38	ATAD3C	-4.685	4.24e-06	-0.113019	24	0.024124	yes	HRTAA
chr1_1450636_A_G_b38	ATAD3C	-4.664	4.67e-06	-0.108901	11	0.023349	yes	HRTAA
chr1_1407565_C_A_b38	ATAD3C	-4.654	4.89e-06	-0.132908	5	0.028558	yes	HRTAA
chr1_1453870_A_C_b38	ATAD3C	-4.649	5e-06	-0.108336	10	0.023304	yes	HRTAA
chr1_1451968_C_T_b38	ATAD3C	-4.642	5.16e-06	-0.097777	21	0.021064	yes	HRTAA
chr1_1456182_G_A_b38	ATAD3C	-4.621	5.68e-06	-0.095182	26	0.020598	yes	HRTAA
chr1_1380867_A_G_b38	ATAD3C	-4.583	6.72e-06	-0.128615	5	0.028062	yes	HRTAA
chr1_1379091_T_G_b38	ATAD3C	4.557	7.57e-06	0.107035	12	0.02349	yes	HRTAA
chr1_1453961_C_T_b38	ATAD3C	-4.542	8.07e-06	-0.108876	9	0.02397	yes	HRTAA
chr1_1447108_A_ATT_b38	ATAD3C	-4.529	8.54e-06	-0.100758	20	0.022246	yes	HRTAA
chr1_1384546_C_T_b38	ATAD3C	-4.493	1e-05	-0.127442	5	0.028365	yes	HRTAA
chr1_1398218_C_A_b38	ATAD3C	-4.392	1.56e-05	-0.117416	7	0.026737	yes	HRTAA
chr1_1382893_G_A_b38	ATAD3C	-4.369	1.72e-05	-0.116811	7	0.026739	yes	HRTAA
chr1_1400756_GGA_G_b38	ATAD3C	-4.325	2.08e-05	-0.115528	7	0.026713	yes	HRTAA
chr1_1401954_G_T_b38	ATAD3C	-4.325	2.08e-05	-0.115528	7	0.026713	yes	HRTAA
chr1_1403593_A_G_b38	ATAD3C	-4.325	2.08e-05	-0.115528	7	0.026713	yes	HRTAA
chr1_1402457_A_G_b38	ATAD3C	-4.296	2.35e-05	-0.099368	43	0.023129	yes	HRTAA
chr1_1479719_T_C_b38	ATAD3C	-4.294	2.37e-05	-0.091413	54	0.021289	yes	HRTAA
chr1_1395346_A_G_b38	ATAD3C	-4.289	2.42e-05	-0.098683	42	0.023008	yes	HRTAA
chr1_1400410_A_G_b38	ATAD3C	-4.272	2.6e-05	-0.095489	32	0.022351	yes	HRTAA
chr1_1456891_T_C_b38	ATAD3C	-4.232	3.08e-05	-0.079138	37	0.018701	yes	HRTAA
chr1_1437993_G_A_b38	ATAD3C	-4.22	3.24e-05	-0.096795	12	0.02294	yes	HRTAA
chr1_1517993_A_G_b38	ATAD3C	-4.203	3.47e-05	-0.082851	63	0.019711	yes	HRTAA
chr1_1519934_T_G_b38	ATAD3C	-4.203	3.47e-05	-0.082851	63	0.019711	yes	HRTAA
chr1_1519938_T_C_b38	ATAD3C	-4.203	3.47e-05	-0.082851	63	0.019711	yes	HRTAA
chr1_1394423_A_G_b38	ATAD3C	-4.196	3.59e-05	-0.097008	43	0.023121	yes	HRTAA
chr1_1383743_T_C_b38	ATAD3C	-4.186	3.73e-05	-0.111249	7	0.026576	yes	HRTAA
chr1_1456829_G_C_b38	ATAD3C	-4.182	3.8e-05	-0.092808	31	0.022194	yes	HRTAA
chr1_1384749_C_G_b38	ATAD3C	4.167	4.04e-05	0.092685	32	0.022244	yes	HRTAA
chr1_1387763_CCT_C_b38	ATAD3C	4.167	4.04e-05	0.092685	32	0.022244	yes	HRTAA
chr1_1388944_G_A_b38	ATAD3C	4.167	4.04e-05	0.092685	32	0.022244	yes	HRTAA
chr1_1452797_CAA_C_b38	ATAD3C	-4.166	4.06e-05	-0.092977	17	0.02232	yes	HRTAA
chr1_1361679_G_A_b38	ATAD3C	4.153	4.28e-05	0.096075	25	0.023133	yes	HRTAA
chr1_1376162_G_C_b38	ATAD3C	4.128	4.74e-05	0.091449	32	0.022153	yes	HRTAA
chr1_1377431_C_T_b38	ATAD3C	4.128	4.74e-05	0.091449	32	0.022153	yes	HRTAA
chr1_1365566_G_A_b38	ATAD3C	4.127	4.75e-05	0.095062	14	0.023032	yes	HRTAA
chr1_1329973_GCGTGTGCCATGCA_G_b38	ATAD3C	-4.105	5.22e-05	-0.113552	6	0.027663	yes	HRTAA
chr1_1378204_G_C_b38	ATAD3C	4.099	5.33e-05	0.088303	35	0.021541	yes	HRTAA
chr1_1387698_A_G_b38	ATAD3C	4.093	5.47e-05	0.094455	43	0.023077	yes	HRTAA
chr1_1389827_C_T_b38	ATAD3C	4.093	5.47e-05	0.094455	43	0.023077	yes	HRTAA
chr1_1456217_T_C_b38	ATAD3C	-4.085	5.67e-05	-0.087958	41	0.021534	yes	HRTAA
chr1_1411323_A_C_b38	ATAD3C	-4.065	6.13e-05	-0.094793	45	0.023317	yes	HRTAA
chr1_1330125_G_A_b38	ATAD3C	4.058	6.3e-05	0.090856	45	0.022387	yes	HRTAA
chr1_1313807_G_A_b38	ATAD3C	4.003	7.87e-05	0.089199	46	0.022282	yes	HRTAA
chr1_1344048_G_A_b38	ATAD3C	-4.002	7.91e-05	-0.111285	6	0.027805	yes	HRTAA
chr1_1375642_C_T_b38	ATAD3C	-3.992	8.24e-05	-0.105093	7	0.026327	yes	HRTAA
chr1_1316929_A_T_b38	ATAD3C	-3.982	8.58e-05	-0.105906	7	0.026598	yes	HRTAA
chr1_1379093_TG_T_b38	ATAD3C	-3.98	8.65e-05	-0.114737	4	0.028829	yes	HRTAA
chr1_1312114_T_C_b38	ATAD3C	3.974	8.87e-05	0.088604	46	0.022298	yes	HRTAA
chr1_1394041_G_A_b38	ATAD3C	-3.973	8.89e-05	-0.116422	4	0.029304	yes	HRTAA
chr1_1309988_G_A_b38	ATAD3C	3.95	9.73e-05	0.088002	46	0.022278	yes	HRTAA
chr1_1363898_C_T_b38	ATAD3C	3.947	9.87e-05	0.090966	14	0.023049	yes	HRTAA
chr1_1363986_C_T_b38	ATAD3C	3.947	9.87e-05	0.090966	14	0.023049	yes	HRTAA
chr1_1366529_TTAG_T_b38	ATAD3C	3.947	9.87e-05	0.090966	14	0.023049	yes	HRTAA
chr1_1308516_C_T_b38	ATAD3C	3.944	9.99e-05	0.086259	49	0.021873	yes	HRTAA
chr1_1374505_A_G_b38	ATAD3C	-3.907	0.000116	-0.102577	7	0.026258	yes	HRTAA
chr1_1428999_C_CA_b38	ATAD3C	-3.905	0.000116	-0.085566	17	0.021911	yes	HRTAA
chr1_1367292_A_AGT_b38	ATAD3C	3.903	0.000117	0.090077	14	0.023077	yes	HRTAA
chr1_1358384_G_C_b38	ATAD3C	3.881	0.000128	0.087946	44	0.022661	yes	HRTAA
chr1_1366561_AGT_A_b38	ATAD3C	3.881	0.000128	0.087946	44	0.022661	yes	HRTAA
chr1_1451028_T_A_b38	ATAD3C	-3.877	0.00013	-0.089503	12	0.023088	yes	HRTAA
chr1_1252487_C_A_b38	ATAD3C	-3.808	0.00017	-0.118947	3	0.031234	yes	HRTAA
chr1_1192301_G_A_b38	ATAD3C	3.799	0.000176	0.104872	6	0.027608	yes	HRTAA
chr1_1364253_C_G_b38	ATAD3C	-3.782	0.000188	-0.098374	8	0.02601	yes	HRTAA
chr1_1341550_GCA_G_b38	ATAD3C	-3.762	0.000203	-0.098615	8	0.026213	yes	HRTAA
chr1_1558726_C_CA_b38	ATAD3C	-3.746	0.000215	-0.072611	59	0.019384	yes	HRTAA
chr1_1561821_A_C_b38	ATAD3C	-3.746	0.000215	-0.072611	59	0.019384	yes	HRTAA
chr1_1372909_G_A_b38	ATAD3C	-3.723	0.000235	-0.101596	6	0.027288	yes	HRTAA
chr1_1303800_G_A_b38	ATAD3C	-3.709	0.000248	-0.104164	6	0.028083	yes	HRTAA
chr1_1252261_C_T_b38	ATAD3C	-3.693	0.000263	-0.109561	4	0.029666	yes	HRTAA
chr1_1366427_AGTGTGATTGAATGAGT_A_b38	ATAD3C	3.673	0.000284	0.080617	31	0.021949	yes	HRTAA
chr1_1575724_G_C_b38	ATAD3C	-3.666	0.000292	-0.070796	58	0.019314	yes	HRTAA
chr1_1573654_T_C_b38	ATAD3C	-3.641	0.00032	-0.070201	59	0.019282	yes	HRTAA
chr1_1574445_A_G_b38	ATAD3C	-3.641	0.00032	-0.070201	59	0.019282	yes	HRTAA
chr1_1550064_GC_G_b38	ATAD3C	-3.632	0.000331	-0.070236	58	0.019339	yes	HRTAA
chr1_1550068_C_A_b38	ATAD3C	-3.632	0.000331	-0.070236	58	0.019339	yes	HRTAA
chr1_1304555_A_C_b38	ATAD3C	-3.617	0.000349	-0.100568	6	0.027804	yes	HRTAA
chr1_1367919_C_T_b38	ATAD3C	-3.615	0.000352	-0.093296	8	0.025809	yes	HRTAA
chr1_1292284_TTGAG_T_b38	ATAD3C	-3.611	0.000357	-0.09176	18	0.025412	yes	HRTAA
chr1_1575421_C_T_b38	ATAD3C	-3.604	0.000366	-0.070007	58	0.019424	yes	HRTAA
chr1_1543953_A_G_b38	ATAD3C	-3.602	0.000369	-0.070126	58	0.019469	yes	HRTAA
chr1_1542773_T_C_b38	ATAD3C	-3.601	0.00037	-0.069933	58	0.019419	yes	HRTAA
chr1_1542793_C_G_b38	ATAD3C	-3.601	0.00037	-0.069933	58	0.019419	yes	HRTAA
chr1_1542800_T_C_b38	ATAD3C	-3.601	0.00037	-0.069933	58	0.019419	yes	HRTAA
chr1_1373006_G_A_b38	ATAD3C	-3.593	0.000381	-0.100266	4	0.027904	yes	HRTAA
chr1_1541864_T_C_b38	ATAD3C	-3.579	0.000402	-0.069416	59	0.019397	yes	HRTAA
chr1_1366511_GGTGA_G_b38	ATAD3C	-3.566	0.000421	-0.092192	8	0.025852	yes	HRTAA
chr1_1366321_TGTGTGTAAATGG_T_b38	ATAD3C	-3.55	0.000446	-0.092035	8	0.025922	yes	HRTAA
chr1_1369009_T_C_b38	ATAD3C	-3.55	0.000446	-0.092035	8	0.025922	yes	HRTAA
chr1_1369012_C_CG_b38	ATAD3C	-3.55	0.000446	-0.092035	8	0.025922	yes	HRTAA
chr1_1325753_G_T_b38	ATAD3C	-3.549	0.000448	-0.102353	5	0.028839	yes	HRTAA
chr1_1370113_A_G_b38	ATAD3C	3.54	0.000463	0.075093	37	0.021212	yes	HRTAA
chr1_1373007_G_A_b38	ATAD3C	-3.533	0.000475	-0.097067	6	0.027472	yes	HRTAA
chr1_1363688_C_T_b38	ATAD3C	-3.532	0.000477	-0.09128	8	0.025844	yes	HRTAA
chr1_1364099_CCA_C_b38	ATAD3C	-3.532	0.000477	-0.09128	8	0.025844	yes	HRTAA
chr1_1364102_TGTTG_T_b38	ATAD3C	-3.532	0.000477	-0.09128	8	0.025844	yes	HRTAA
chr1_1368763_G_A_b38	ATAD3C	-3.532	0.000477	-0.09128	8	0.025844	yes	HRTAA
chr1_1557495_CAT_C_b38	ATAD3C	-3.527	0.000486	-0.068539	59	0.019432	yes	HRTAA
chr1_1551557_A_AG_b38	ATAD3C	-3.524	0.000492	-0.067789	60	0.019238	yes	HRTAA
chr1_1551559_A_T_b38	ATAD3C	-3.524	0.000492	-0.067789	60	0.019238	yes	HRTAA
chr1_1500745_A_C_b38	ATAD3C	-3.508	0.000521	-0.100433	33	0.028633	yes	HRTAA
chr1_1361685_C_T_b38	ATAD3C	-3.497	0.000541	-0.088342	18	0.025261	yes	HRTAA
chr1_1532798_T_C_b38	ATAD3C	-3.497	0.000542	-0.061922	107	0.017709	yes	HRTAA
chr1_1366292_G_T_b38	ATAD3C	-3.492	0.000552	-0.090489	8	0.025914	yes	HRTAA
chr1_1369407_G_A_b38	ATAD3C	-3.488	0.00056	-0.089474	7	0.025655	yes	HRTAA
chr1_1545795_C_A_b38	ATAD3C	-3.483	0.000569	-0.066844	52	0.01919	yes	HRTAA
chr1_1364566_T_C_b38	ATAD3C	-3.475	0.000586	-0.089805	8	0.025844	yes	HRTAA
chr1_1497605_G_C_b38	ATAD3C	-3.474	0.000589	-0.068686	52	0.019773	yes	HRTAA
chr1_1367300_T_TGA_b38	ATAD3C	-3.464	0.00061	-0.091121	7	0.026305	yes	HRTAA
chr1_1379083_AT_A_b38	ATAD3C	3.464	0.00061	0.076743	18	0.022157	yes	HRTAA
chr1_1364282_T_G_b38	ATAD3C	-3.464	0.00061	-0.089555	8	0.025856	yes	HRTAA
chr1_1364357_A_C_b38	ATAD3C	-3.464	0.00061	-0.089555	8	0.025856	yes	HRTAA
chr1_1364694_T_C_b38	ATAD3C	-3.464	0.00061	-0.089555	8	0.025856	yes	HRTAA
chr1_1364721_C_T_b38	ATAD3C	-3.464	0.00061	-0.089555	8	0.025856	yes	HRTAA
chr1_1365160_A_G_b38	ATAD3C	-3.464	0.00061	-0.089555	8	0.025856	yes	HRTAA
chr1_1365198_C_T_b38	ATAD3C	-3.464	0.00061	-0.089555	8	0.025856	yes	HRTAA
chr1_1366008_A_G_b38	ATAD3C	-3.464	0.00061	-0.089555	8	0.025856	yes	HRTAA
chr1_1366062_T_C_b38	ATAD3C	-3.464	0.00061	-0.089555	8	0.025856	yes	HRTAA
chr1_1366145_TGTGAA_T_b38	ATAD3C	-3.464	0.00061	-0.089555	8	0.025856	yes	HRTAA
chr1_1366187_A_AGT_b38	ATAD3C	-3.464	0.00061	-0.089555	8	0.025856	yes	HRTAA
chr1_1366453_G_T_b38	ATAD3C	-3.464	0.00061	-0.089555	8	0.025856	yes	HRTAA
chr1_1366726_T_G_b38	ATAD3C	-3.464	0.00061	-0.089555	8	0.025856	yes	HRTAA
chr1_1367258_T_A_b38	ATAD3C	-3.464	0.00061	-0.089555	8	0.025856	yes	HRTAA
chr1_1367297_GAA_G_b38	ATAD3C	-3.464	0.00061	-0.089555	8	0.025856	yes	HRTAA
chr1_1367329_A_AGT_b38	ATAD3C	-3.464	0.00061	-0.089555	8	0.025856	yes	HRTAA
chr1_1367373_T_TGTG_b38	ATAD3C	-3.464	0.00061	-0.089555	8	0.025856	yes	HRTAA
chr1_1367388_T_TTGG_b38	ATAD3C	-3.464	0.00061	-0.089555	8	0.025856	yes	HRTAA
chr1_1367462_T_C_b38	ATAD3C	-3.464	0.00061	-0.089555	8	0.025856	yes	HRTAA
chr1_1367511_ATGAG_A_b38	ATAD3C	-3.464	0.00061	-0.089555	8	0.025856	yes	HRTAA
chr1_1367593_G_A_b38	ATAD3C	-3.464	0.00061	-0.089555	8	0.025856	yes	HRTAA
chr1_1367602_GT_G_b38	ATAD3C	-3.464	0.00061	-0.089555	8	0.025856	yes	HRTAA
chr1_1367605_GAGTGAGTGTA_G_b38	ATAD3C	-3.464	0.00061	-0.089555	8	0.025856	yes	HRTAA
chr1_1367670_GGTGA_G_b38	ATAD3C	-3.464	0.00061	-0.089555	8	0.025856	yes	HRTAA
chr1_1367722_TTTTA_T_b38	ATAD3C	-3.464	0.00061	-0.089555	8	0.025856	yes	HRTAA
chr1_1367874_A_T_b38	ATAD3C	-3.464	0.00061	-0.089555	8	0.025856	yes	HRTAA
chr1_1367951_C_T_b38	ATAD3C	-3.464	0.00061	-0.089555	8	0.025856	yes	HRTAA
chr1_1367965_A_G_b38	ATAD3C	-3.464	0.00061	-0.089555	8	0.025856	yes	HRTAA
chr1_1367970_T_G_b38	ATAD3C	-3.464	0.00061	-0.089555	8	0.025856	yes	HRTAA
chr1_1367994_C_A_b38	ATAD3C	-3.464	0.00061	-0.089555	8	0.025856	yes	HRTAA
chr1_1368297_C_T_b38	ATAD3C	-3.464	0.00061	-0.089555	8	0.025856	yes	HRTAA
chr1_1368514_C_G_b38	ATAD3C	-3.464	0.00061	-0.089555	8	0.025856	yes	HRTAA
chr1_1303112_G_A_b38	ATAD3C	-3.463	0.000612	-0.095218	6	0.027496	yes	HRTAA
chr1_1367280_T_A_b38	ATAD3C	-3.454	0.000632	-0.089229	8	0.025833	yes	HRTAA
chr1_1369282_G_A_b38	ATAD3C	-3.449	0.000643	-0.089062	8	0.025822	yes	HRTAA
chr1_1369320_GT_G_b38	ATAD3C	-3.449	0.000643	-0.089062	8	0.025822	yes	HRTAA
chr1_1369476_CTT_C_b38	ATAD3C	-3.449	0.000643	-0.089062	8	0.025822	yes	HRTAA
chr1_1369556_C_G_b38	ATAD3C	-3.449	0.000643	-0.089062	8	0.025822	yes	HRTAA
chr1_1369627_T_C_b38	ATAD3C	-3.449	0.000643	-0.089062	8	0.025822	yes	HRTAA
chr1_1369686_T_C_b38	ATAD3C	-3.449	0.000643	-0.089062	8	0.025822	yes	HRTAA
chr1_1369716_G_C_b38	ATAD3C	-3.449	0.000643	-0.089062	8	0.025822	yes	HRTAA
chr1_1369741_C_T_b38	ATAD3C	-3.449	0.000643	-0.089062	8	0.025822	yes	HRTAA
chr1_1370181_C_T_b38	ATAD3C	-3.449	0.000643	-0.089062	8	0.025822	yes	HRTAA
chr1_1370317_G_C_b38	ATAD3C	-3.449	0.000643	-0.089062	8	0.025822	yes	HRTAA
chr1_1370320_A_G_b38	ATAD3C	-3.449	0.000643	-0.089062	8	0.025822	yes	HRTAA
chr1_1370430_T_C_b38	ATAD3C	-3.449	0.000643	-0.089062	8	0.025822	yes	HRTAA
chr1_1370584_G_C_b38	ATAD3C	-3.449	0.000643	-0.089062	8	0.025822	yes	HRTAA
chr1_1368991_C_T_b38	ATAD3C	-3.442	0.000659	-0.088871	8	0.02582	yes	HRTAA
chr1_1560765_T_C_b38	ATAD3C	-3.43	0.000687	-0.067384	51	0.019644	yes	HRTAA
chr1_1562261_TTTTC_T_b38	ATAD3C	-3.43	0.000687	-0.067384	51	0.019644	yes	HRTAA
chr1_1370532_C_T_b38	ATAD3C	-3.428	0.000692	-0.088426	8	0.025793	yes	HRTAA
chr1_1337898_A_G_b38	ATAD3C	3.392	0.000786	0.073401	18	0.021639	yes	HRTAA
chr1_1543500_T_G_b38	ATAD3C	-3.377	0.000828	-0.065379	58	0.019358	yes	HRTAA
chr1_1368177_G_C_b38	ATAD3C	-3.377	0.00083	-0.087735	10	0.025982	yes	HRTAA
chr1_1565105_CAAGGCAGGCGGATCATG_C_b38	ATAD3C	-3.376	0.000833	-0.063504	66	0.018812	yes	HRTAA
chr1_1574655_GGC_G_b38	ATAD3C	-3.361	0.000877	-0.065607	51	0.01952	yes	HRTAA
chr1_1366681_T_TGA_b38	ATAD3C	-3.359	0.000882	-0.087948	8	0.026181	yes	HRTAA
chr1_1197405_C_T_b38	ATAD3C	3.356	0.000893	0.09309	6	0.02774	yes	HRTAA
chr1_1197586_C_A_b38	ATAD3C	3.356	0.000893	0.09309	6	0.02774	yes	HRTAA
chr1_1197874_G_A_b38	ATAD3C	3.356	0.000893	0.09309	6	0.02774	yes	HRTAA
chr1_1569661_T_C_b38	ATAD3C	-3.338	0.000951	-0.062355	60	0.018683	yes	HRTAA
chr1_1367268_TGA_T_b38	ATAD3C	-3.337	0.000952	-0.086338	8	0.02587	yes	HRTAA
chr1_1199327_G_A_b38	ATAD3C	3.332	0.000971	0.092902	6	0.027885	yes	HRTAA
chr1_1554694_A_G_b38	ATAD3C	-3.318	0.00102	-0.063057	62	0.019004	yes	HRTAA
chr1_1577491_A_AC_b38	ATAD3C	-3.318	0.00102	-0.064989	58	0.019586	yes	HRTAA
chr1_1480224_A_G_b38	ATAD3C	-3.315	0.00103	-0.148342	3	0.04475	yes	HRTAA
chr1_1573079_A_G_b38	ATAD3C	-3.309	0.00105	-0.062922	63	0.019016	yes	HRTAA
chr1_1565680_A_AG_b38	ATAD3C	-3.278	0.00117	-0.062715	61	0.019131	yes	HRTAA
chr1_1725582_T_C_b38	ATAD3C	3.277	0.00117	0.050733	88	0.015479	yes	HRTAA
chr1_1196061_C_T_b38	ATAD3C	3.274	0.00118	0.09287	6	0.028366	yes	HRTAA
chr1_1369821_C_T_b38	ATAD3C	-3.268	0.00121	-0.084673	8	0.025907	yes	HRTAA
chr1_1363880_A_G_b38	ATAD3C	-3.259	0.00125	-0.083525	8	0.025631	yes	HRTAA
chr1_1553692_A_G_b38	ATAD3C	-3.243	0.00131	-0.061678	63	0.019016	yes	HRTAA
chr1_1554781_A_G_b38	ATAD3C	-3.243	0.00131	-0.061678	63	0.019016	yes	HRTAA
chr1_1554852_T_C_b38	ATAD3C	-3.243	0.00131	-0.061678	63	0.019016	yes	HRTAA
chr1_1555247_T_A_b38	ATAD3C	-3.243	0.00131	-0.061678	63	0.019016	yes	HRTAA
chr1_1559750_C_CAG_b38	ATAD3C	-3.222	0.00141	-0.061185	64	0.018992	yes	HRTAA
chr1_1561628_T_C_b38	ATAD3C	-3.222	0.00141	-0.061185	64	0.018992	yes	HRTAA
chr1_1563918_A_G_b38	ATAD3C	-3.222	0.00141	-0.061185	64	0.018992	yes	HRTAA
chr1_1565561_A_G_b38	ATAD3C	-3.222	0.00141	-0.061185	64	0.018992	yes	HRTAA
chr1_1566086_G_A_b38	ATAD3C	-3.222	0.00141	-0.061185	64	0.018992	yes	HRTAA
chr1_1567715_G_A_b38	ATAD3C	-3.222	0.00141	-0.061185	64	0.018992	yes	HRTAA
chr1_1567719_A_C_b38	ATAD3C	-3.222	0.00141	-0.061185	64	0.018992	yes	HRTAA
chr1_1569875_C_T_b38	ATAD3C	-3.222	0.00141	-0.061185	64	0.018992	yes	HRTAA
chr1_1572532_A_C_b38	ATAD3C	-3.222	0.00141	-0.061185	64	0.018992	yes	HRTAA
chr1_1186644_T_C_b38	ATAD3C	3.21	0.00147	0.088872	6	0.027688	yes	HRTAA
chr1_1187136_G_A_b38	ATAD3C	3.21	0.00147	0.088872	6	0.027688	yes	HRTAA
chr1_1187726_G_A_b38	ATAD3C	3.21	0.00147	0.088872	6	0.027688	yes	HRTAA
chr1_1188877_A_G_b38	ATAD3C	3.21	0.00147	0.088872	6	0.027688	yes	HRTAA
chr1_1189511_G_A_b38	ATAD3C	3.21	0.00147	0.088872	6	0.027688	yes	HRTAA
chr1_1190875_G_C_b38	ATAD3C	3.21	0.00147	0.088872	6	0.027688	yes	HRTAA
chr1_1192000_G_A_b38	ATAD3C	3.21	0.00147	0.088872	6	0.027688	yes	HRTAA
chr1_1192127_G_A_b38	ATAD3C	3.21	0.00147	0.088872	6	0.027688	yes	HRTAA
chr1_1192143_C_T_b38	ATAD3C	3.21	0.00147	0.088872	6	0.027688	yes	HRTAA
chr1_1192951_G_T_b38	ATAD3C	3.21	0.00147	0.088872	6	0.027688	yes	HRTAA
chr1_1193049_G_A_b38	ATAD3C	3.21	0.00147	0.088872	6	0.027688	yes	HRTAA
chr1_1194292_G_T_b38	ATAD3C	3.21	0.00147	0.088872	6	0.027688	yes	HRTAA
chr1_1194327_A_G_b38	ATAD3C	3.21	0.00147	0.088872	6	0.027688	yes	HRTAA
chr1_1194713_C_T_b38	ATAD3C	3.21	0.00147	0.088872	6	0.027688	yes	HRTAA
chr1_1575864_G_A_b38	ATAD3C	-3.195	0.00155	-0.063474	53	0.019867	yes	HRTAA
chr1_1363456_CAG_C_b38	ATAD3C	3.191	0.00157	0.067794	23	0.021244	yes	HRTAA
chr1_1252613_C_G_b38	ATAD3C	-3.191	0.00157	-0.09303	4	0.029153	yes	HRTAA
chr1_1366941_T_TGTGTGCA_b38	ATAD3C	3.19	0.00158	0.091398	7	0.028655	yes	HRTAA
chr1_1366951_A_AGT_b38	ATAD3C	3.19	0.00158	0.091398	7	0.028655	yes	HRTAA
chr1_1186939_C_T_b38	ATAD3C	3.176	0.00165	0.088154	6	0.027753	yes	HRTAA
chr1_1191942_G_A_b38	ATAD3C	3.158	0.00175	0.088983	5	0.028176	yes	HRTAA
chr1_1288085_GC_G_b38	ATAD3C	-3.132	0.00191	-0.085054	6	0.027156	yes	HRTAA
chr1_1569180_T_A_b38	ATAD3C	-3.129	0.00193	-0.060131	61	0.01922	yes	HRTAA
chr1_2075289_T_C_b38	ATAD3C	-3.129	0.00193	-0.060441	47	0.019319	yes	HRTAA
chr1_1538787_A_G_b38	ATAD3C	-3.122	0.00197	-0.059229	63	0.018974	yes	HRTAA
chr1_2066876_A_G_b38	ATAD3C	-3.11	0.00205	-0.056171	77	0.018064	yes	HRTAA
chr1_1302795_T_TC_b38	ATAD3C	3.103	0.0021	0.070243	54	0.022641	yes	HRTAA
chr1_1366828_A_G_b38	ATAD3C	-3.094	0.00216	-0.089616	6	0.028967	yes	HRTAA
chr1_1549967_C_G_b38	ATAD3C	-3.088	0.0022	-0.061665	31	0.019967	yes	HRTAA
chr1_1366776_G_GAATT_b38	ATAD3C	-3.087	0.00221	-0.081532	8	0.026411	yes	HRTAA
chr1_1549590_C_G_b38	ATAD3C	-3.083	0.00224	-0.058629	63	0.019018	yes	HRTAA
chr1_1407232_G_C_b38	ATAD3C	-3.077	0.00229	-0.068492	16	0.022263	yes	HRTAA
chr1_1191614_G_A_b38	ATAD3C	3.074	0.0023	0.085424	6	0.027788	yes	HRTAA
chr1_1367028_A_G_b38	ATAD3C	3.052	0.00247	0.080762	11	0.026461	yes	HRTAA
chr1_2065495_A_G_b38	ATAD3C	-3.05	0.00249	-0.055335	78	0.018141	yes	HRTAA
chr1_1197558_G_A_b38	ATAD3C	3.045	0.00253	0.086505	6	0.028409	yes	HRTAA
chr1_1189968_T_C_b38	ATAD3C	3.042	0.00256	0.083193	6	0.027347	yes	HRTAA
chr1_1190856_G_A_b38	ATAD3C	3.042	0.00256	0.083193	6	0.027347	yes	HRTAA
chr1_1547630_G_A_b38	ATAD3C	-3.04	0.00257	-0.056093	57	0.018451	yes	HRTAA
chr1_1366835_G_GGTGA_b38	ATAD3C	-3.038	0.00259	-0.087563	6	0.028825	yes	HRTAA
chr1_1363438_C_CTT_b38	ATAD3C	3.024	0.00271	0.058543	36	0.019357	yes	HRTAA
chr1_1366830_G_A_b38	ATAD3C	-3.023	0.00272	-0.087492	6	0.028944	yes	HRTAA
chr1_1375678_TA_T_b38	ATAD3C	3.012	0.00281	0.070558	16	0.023424	yes	HRTAA
chr1_2065141_C_G_b38	ATAD3C	-2.99	0.00302	-0.053877	76	0.018021	yes	HRTAA
chr1_1189019_C_G_b38	ATAD3C	2.989	0.00303	0.083149	5	0.027821	yes	HRTAA
chr1_2079294_C_T_b38	ATAD3C	-2.971	0.00321	-0.054227	56	0.018254	yes	HRTAA
chr1_1241831_G_C_b38	ATAD3C	-2.965	0.00327	-0.081441	4	0.027471	yes	HRTAA
chr1_2070417_A_G_b38	ATAD3C	-2.956	0.00336	-0.05619	67	0.019009	yes	HRTAA
chr1_1570294_CA_C_b38	ATAD3C	-2.956	0.00337	-0.058681	55	0.019854	yes	HRTAA
chr1_2056554_T_C_b38	ATAD3C	-2.953	0.00339	-0.053559	76	0.018135	yes	HRTAA
chr1_2074669_A_G_b38	ATAD3C	-2.952	0.00341	-0.056189	67	0.019036	yes	HRTAA
chr1_2073508_T_C_b38	ATAD3C	-2.943	0.00351	-0.055929	67	0.019005	yes	HRTAA
chr1_2072553_GC_G_b38	ATAD3C	-2.938	0.00356	-0.055437	67	0.018871	yes	HRTAA
chr1_1186816_A_G_b38	ATAD3C	2.932	0.00362	0.079597	7	0.027146	yes	HRTAA
chr1_1570587_C_T_b38	ATAD3C	-2.925	0.0037	-0.056151	56	0.019196	yes	HRTAA
chr1_1559703_G_C_b38	ATAD3C	-2.908	0.00391	-0.05579	56	0.019188	yes	HRTAA
chr1_1568548_G_A_b38	ATAD3C	-2.908	0.00391	-0.05579	56	0.019188	yes	HRTAA
chr1_1186414_G_A_b38	ATAD3C	2.903	0.00397	0.078096	7	0.026906	yes	HRTAA
chr1_1189730_T_C_b38	ATAD3C	2.898	0.00403	0.082145	6	0.028346	yes	HRTAA
chr1_2059734_A_G_b38	ATAD3C	-2.894	0.00408	-0.0517	76	0.017863	yes	HRTAA
chr1_1571794_A_AT_b38	ATAD3C	-2.89	0.00413	-0.057189	53	0.019786	yes	HRTAA
chr1_1187008_G_A_b38	ATAD3C	2.879	0.00428	0.081027	5	0.028149	yes	HRTAA
chr1_1280044_T_C_b38	ATAD3C	-2.86	0.00453	-0.059462	54	0.020791	yes	HRTAA
chr1_1241639_T_C_b38	ATAD3C	-2.854	0.00461	-0.073156	10	0.025629	yes	HRTAA
chr1_1365036_T_TAA_b38	ATAD3C	-2.848	0.0047	-0.080207	4	0.028164	yes	HRTAA
chr1_1566854_CA_C_b38	ATAD3C	-2.835	0.00489	-0.058642	41	0.020682	yes	HRTAA
chr1_1533883_G_T_b38	ATAD3C	-2.828	0.005	-0.096117	10	0.033988	yes	HRTAA
chr1_2069834_A_G_b38	ATAD3C	-2.82	0.00512	-0.053717	67	0.019049	yes	HRTAA
chr1_1553791_CA_C_b38	ATAD3C	-2.819	0.00513	-0.063498	17	0.022521	yes	HRTAA
chr1_1546845_A_AAAC_b38	ATAD3C	-2.818	0.00516	-0.074513	13	0.026446	yes	HRTAA
chr1_1185961_C_T_b38	ATAD3C	2.8	0.00544	0.074065	7	0.026453	yes	HRTAA
chr1_940296_G_GCCCCC_b38	ATAD3C	2.783	0.00572	0.10993	4	0.039497	yes	HRTAA
chr1_1534166_G_A_b38	ATAD3C	-2.774	0.00589	-0.04997	47	0.018017	yes	HRTAA
chr1_1575935_T_C_b38	ATAD3C	-2.769	0.00598	-0.054431	57	0.019661	yes	HRTAA
chr1_1241053_A_G_b38	ATAD3C	-2.764	0.00606	-0.070455	11	0.025491	yes	HRTAA
chr1_1242094_A_G_b38	ATAD3C	-2.764	0.00606	-0.070455	11	0.025491	yes	HRTAA
chr1_1242250_A_G_b38	ATAD3C	-2.764	0.00606	-0.070455	11	0.025491	yes	HRTAA
chr1_2069856_A_C_b38	ATAD3C	-2.763	0.00608	-0.052388	67	0.018959	yes	HRTAA
chr1_1558347_G_A_b38	ATAD3C	-2.761	0.00611	-0.056252	40	0.020372	yes	HRTAA
chr1_1190431_A_AT_b38	ATAD3C	2.761	0.00611	0.079071	3	0.028637	yes	HRTAA
chr1_1290232_G_A_b38	ATAD3C	-2.755	0.00623	-0.07938	6	0.028815	yes	HRTAA
chr1_1518621_A_AC_b38	ATAD3C	-2.755	0.00623	-0.060412	19	0.021931	yes	HRTAA
chr1_1248068_A_C_b38	ATAD3C	-2.746	0.00639	-0.084761	7	0.030862	yes	HRTAA
chr1_1248069_A_C_b38	ATAD3C	-2.746	0.00639	-0.084761	7	0.030862	yes	HRTAA
chr1_1248062_A_G_b38	ATAD3C	-2.745	0.00641	-0.084755	7	0.030873	yes	HRTAA
chr1_1248063_T_C_b38	ATAD3C	-2.745	0.00641	-0.084755	7	0.030873	yes	HRTAA
chr1_1563537_C_CA_b38	ATAD3C	-2.744	0.00644	-0.055705	33	0.020301	yes	HRTAA
chr1_1571986_G_A_b38	ATAD3C	-2.742	0.00648	-0.050936	49	0.018577	yes	HRTAA
chr1_1248075_A_C_b38	ATAD3C	-2.737	0.00656	-0.084456	7	0.030854	yes	HRTAA
chr1_1248091_G_A_b38	ATAD3C	-2.737	0.00656	-0.084456	7	0.030854	yes	HRTAA
chr1_1248092_T_C_b38	ATAD3C	-2.737	0.00656	-0.084456	7	0.030854	yes	HRTAA
chr1_1217251_C_A_b38	ATAD3C	-2.734	0.00664	-0.076068	9	0.027828	yes	HRTAA
chr1_1369803_C_CT_b38	ATAD3C	-2.728	0.00674	-0.066022	8	0.024199	yes	HRTAA
chr1_1188405_A_ATT_b38	ATAD3C	2.725	0.00681	0.08243	4	0.030249	yes	HRTAA
chr1_2067849_T_C_b38	ATAD3C	-2.707	0.00717	-0.051235	67	0.018926	yes	HRTAA
chr1_1290841_A_G_b38	ATAD3C	-2.704	0.00724	-0.069088	20	0.025549	yes	HRTAA
chr1_1573429_CAAAAAAAAAAAAAAAAAA_C_b38	ATAD3C	-2.701	0.00731	-0.05249	57	0.019436	yes	HRTAA
chr1_1514366_A_G_b38	ATAD3C	-2.692	0.0075	-0.118449	5	0.044002	yes	HRTAA
chr1_1533754_T_C_b38	ATAD3C	-2.691	0.00753	-0.060334	32	0.022422	yes	HRTAA
chr1_2079902_A_G_b38	ATAD3C	-2.661	0.00821	-0.051184	62	0.019234	yes	HRTAA
chr1_1187013_A_AT_b38	ATAD3C	2.66	0.00823	0.075709	5	0.028459	yes	HRTAA
chr1_1187016_C_T_b38	ATAD3C	2.66	0.00823	0.075709	5	0.028459	yes	HRTAA
chr1_2084002_C_T_b38	ATAD3C	-2.658	0.00828	-0.047653	47	0.017927	yes	HRTAA
chr1_2080519_A_G_b38	ATAD3C	-2.65	0.00848	-0.050089	62	0.018903	yes	HRTAA
chr1_2080979_A_G_b38	ATAD3C	-2.65	0.00848	-0.050089	62	0.018903	yes	HRTAA
chr1_2076945_T_C_b38	ATAD3C	-2.647	0.00855	-0.050575	62	0.019107	yes	HRTAA
chr1_2077003_T_C_b38	ATAD3C	-2.647	0.00855	-0.050575	62	0.019107	yes	HRTAA
chr1_2077297_G_T_b38	ATAD3C	-2.647	0.00855	-0.050575	62	0.019107	yes	HRTAA
chr1_1308549_G_T_b38	ATAD3C	2.645	0.0086	0.042706	90	0.016145	yes	HRTAA
chr1_2121289_T_A_b38	ATAD3C	2.645	0.0086	0.062036	11	0.023454	yes	HRTAA
chr1_1243545_G_A_b38	ATAD3C	-2.639	0.00876	-0.07073	7	0.026806	yes	HRTAA
chr1_1243929_G_A_b38	ATAD3C	-2.639	0.00876	-0.07073	7	0.026806	yes	HRTAA
chr1_1202905_C_G_b38	ATAD3C	-2.63	0.00899	-0.076749	4	0.029186	yes	HRTAA
chr1_1308178_GGGGCGCGGGGA_G_b38	ATAD3C	-2.622	0.00919	-0.064387	10	0.024559	yes	HRTAA
chr1_832736_A_AGTTTT_b38	ATAD3C	2.621	0.0092	0.046057	78	0.01757	yes	HRTAA
chr1_1539491_G_C_b38	ATAD3C	-2.62	0.00924	-0.051432	59	0.019631	yes	HRTAA
chr1_1437955_C_G_b38	ATAD3C	-4.324	2.09e-05	-0.081517	34	0.018854	no	HRTAA
chr1_1855321_C_CA_b38	ATAD3C	3.816	0.000165	0.087826	15	0.023014	no	HRTAA
chr1_1583825_T_C_b38	ATAD3C	-3.567	0.00042	-0.129602	4	0.036334	no	HRTAA
chr1_1195100_G_A_b38	ATAD3C	3.193	0.00156	0.084933	7	0.026597	no	HRTAA
chr1_1186092_C_CT_b38	ATAD3C	3.144	0.00184	0.088095	4	0.028024	no	HRTAA
chr1_775930_G_A_b38	ATAD3C	-3.045	0.00253	-0.113737	4	0.037354	no	HRTAA
chr1_813885_G_A_b38	ATAD3C	-2.92	0.00377	-0.056268	79	0.019273	no	HRTAA
chr1_807610_C_T_b38	ATAD3C	-2.823	0.00508	-0.104472	3	0.037008	no	HRTAA
chr1_1186245_C_G_b38	ATAD3C	2.818	0.00516	0.074411	7	0.026408	no	HRTAA
chr1_1199253_C_T_b38	ATAD3C	2.732	0.00667	0.073247	7	0.026813	no	HRTAA
chr1_2436477_CCCTCCTCCCCTCCTCCCT_C_b38	ATAD3C	2.644	0.00862	0.092646	7	0.035036	no	HRTAA
chr1_2060449_TGAGAAGTGGGGCTGAATAGAGGTTTGGCAGTGCTTAGCATAGGGGGCGAGAGTCTCGGCTTCCAGC_T_b38	ATAD3C	-2.598	0.00985	-0.053127	22	0.020452	no	HRTAA
chr1_1426253_G_A_b38	ATAD3C	-4.374	1.66e-05	-0.065195	8	0.014904	yes	HRTLV
chr1_1192776_CAGTGTAGACACTCCAGTTGGTATG_C_b38	ATAD3C	4.368	1.71e-05	0.08417	3	0.019271	yes	HRTLV
chr1_861347_G_T_b38	ATAD3C	-4.214	3.28e-05	-0.060232	5	0.014292	yes	HRTLV
chr1_1432355_G_A_b38	ATAD3C	-4.042	6.67e-05	-0.055202	17	0.013658	yes	HRTLV
chr1_1440430_C_G_b38	ATAD3C	-4.039	6.76e-05	-0.052584	21	0.01302	yes	HRTLV
chr1_1431656_G_A_b38	ATAD3C	-3.99	8.21e-05	-0.060755	8	0.015225	yes	HRTLV
chr1_1438102_G_C_b38	ATAD3C	-3.954	9.49e-05	-0.053509	16	0.013532	yes	HRTLV
chr1_1445187_T_G_b38	ATAD3C	-3.835	0.000152	-0.04891	41	0.012754	yes	HRTLV
chr1_1442793_G_A_b38	ATAD3C	-3.696	0.000258	-0.053301	9	0.014421	yes	HRTLV
chr1_1191942_G_A_b38	ATAD3C	3.622	0.00034	0.062518	5	0.017259	yes	HRTLV
chr1_1443457_T_C_b38	ATAD3C	-3.612	0.000353	-0.04719	45	0.013063	yes	HRTLV
chr1_1440834_C_G_b38	ATAD3C	-3.59	0.000383	-0.046735	43	0.013018	yes	HRTLV
chr1_1189019_C_G_b38	ATAD3C	3.543	0.000456	0.060772	5	0.017153	yes	HRTLV
chr1_1445240_A_G_b38	ATAD3C	-3.482	0.000567	-0.045233	44	0.012989	yes	HRTLV
chr1_1479205_A_C_b38	ATAD3C	3.466	0.000603	0.058381	15	0.016846	yes	HRTLV
chr1_1434687_C_G_b38	ATAD3C	-3.461	0.000613	-0.050685	10	0.014645	yes	HRTLV
chr1_1732892_CT_C_b38	ATAD3C	3.46	0.000614	0.050302	8	0.014536	yes	HRTLV
chr1_1186644_T_C_b38	ATAD3C	3.424	7e-04	0.05788	6	0.016906	yes	HRTLV
chr1_1186939_C_T_b38	ATAD3C	3.424	7e-04	0.05788	6	0.016906	yes	HRTLV
chr1_1187136_G_A_b38	ATAD3C	3.424	7e-04	0.05788	6	0.016906	yes	HRTLV
chr1_1187726_G_A_b38	ATAD3C	3.424	7e-04	0.05788	6	0.016906	yes	HRTLV
chr1_1188877_A_G_b38	ATAD3C	3.424	7e-04	0.05788	6	0.016906	yes	HRTLV
chr1_1189511_G_A_b38	ATAD3C	3.424	7e-04	0.05788	6	0.016906	yes	HRTLV
chr1_1190875_G_C_b38	ATAD3C	3.424	7e-04	0.05788	6	0.016906	yes	HRTLV
chr1_1192000_G_A_b38	ATAD3C	3.424	7e-04	0.05788	6	0.016906	yes	HRTLV
chr1_1192127_G_A_b38	ATAD3C	3.424	7e-04	0.05788	6	0.016906	yes	HRTLV
chr1_1192143_C_T_b38	ATAD3C	3.424	7e-04	0.05788	6	0.016906	yes	HRTLV
chr1_1192951_G_T_b38	ATAD3C	3.424	7e-04	0.05788	6	0.016906	yes	HRTLV
chr1_1193049_G_A_b38	ATAD3C	3.424	7e-04	0.05788	6	0.016906	yes	HRTLV
chr1_1194292_G_T_b38	ATAD3C	3.424	7e-04	0.05788	6	0.016906	yes	HRTLV
chr1_1194327_A_G_b38	ATAD3C	3.424	7e-04	0.05788	6	0.016906	yes	HRTLV
chr1_1194713_C_T_b38	ATAD3C	3.424	7e-04	0.05788	6	0.016906	yes	HRTLV
chr1_1743565_AT_A_b38	ATAD3C	3.419	0.000712	0.03411	95	0.009977	yes	HRTLV
chr1_1191614_G_A_b38	ATAD3C	3.418	0.000715	0.057434	6	0.016805	yes	HRTLV
chr1_1192301_G_A_b38	ATAD3C	3.405	0.000746	0.058273	6	0.017112	yes	HRTLV
chr1_1439805_G_C_b38	ATAD3C	-3.402	0.000755	-0.046777	15	0.013749	yes	HRTLV
chr1_1197586_C_A_b38	ATAD3C	3.402	0.000756	0.057631	6	0.016942	yes	HRTLV
chr1_1197874_G_A_b38	ATAD3C	3.402	0.000756	0.057631	6	0.016942	yes	HRTLV
chr1_1199327_G_A_b38	ATAD3C	3.398	0.000766	0.057935	6	0.01705	yes	HRTLV
chr1_1431014_G_A_b38	ATAD3C	-3.39	0.000789	-0.042257	24	0.012467	yes	HRTLV
chr1_1189968_T_C_b38	ATAD3C	3.351	0.000903	0.056364	6	0.01682	yes	HRTLV
chr1_1190856_G_A_b38	ATAD3C	3.351	0.000903	0.056364	6	0.01682	yes	HRTLV
chr1_1435945_C_CCGGGCGGGGGCG_b38	ATAD3C	-3.325	0.000988	-0.047628	12	0.014324	yes	HRTLV
chr1_1431813_G_T_b38	ATAD3C	-3.297	0.00109	-0.046108	13	0.013985	yes	HRTLV
chr1_1428969_T_C_b38	ATAD3C	-3.295	0.0011	-0.041803	46	0.012688	yes	HRTLV
chr1_1439454_A_G_b38	ATAD3C	-3.285	0.00113	-0.041381	41	0.012596	yes	HRTLV
chr1_1186816_A_G_b38	ATAD3C	3.264	0.00122	0.054165	7	0.016594	yes	HRTLV
chr1_1292284_TTGAG_T_b38	ATAD3C	-3.168	0.00169	-0.046802	24	0.014774	yes	HRTLV
chr1_1189730_T_C_b38	ATAD3C	3.125	0.00194	0.054539	6	0.017452	yes	HRTLV
chr1_1197405_C_T_b38	ATAD3C	3.103	0.00209	0.053214	6	0.017148	yes	HRTLV
chr1_1448915_G_A_b38	ATAD3C	-3.059	0.00241	-0.040239	32	0.013154	yes	HRTLV
chr1_1130902_A_G_b38	ATAD3C	-3.045	0.00252	-0.033913	32	0.011138	yes	HRTLV
chr1_868727_T_C_b38	ATAD3C	3.035	0.00261	0.065028	4	0.021427	yes	HRTLV
chr1_1743544_CA_C_b38	ATAD3C	3.019	0.00274	0.031507	81	0.010437	yes	HRTLV
chr1_2344932_C_T_b38	ATAD3C	2.99	0.00301	0.037487	19	0.012539	yes	HRTLV
chr1_1480224_A_G_b38	ATAD3C	-2.957	0.00334	-0.082683	3	0.027962	yes	HRTLV
chr1_1692151_T_C_b38	ATAD3C	-2.942	0.00351	-0.036538	29	0.012421	yes	HRTLV
chr1_868416_G_A_b38	ATAD3C	2.939	0.00353	0.061822	4	0.021033	yes	HRTLV
chr1_1186414_G_A_b38	ATAD3C	2.915	0.00381	0.047734	7	0.016373	yes	HRTLV
chr1_1433374_T_C_b38	ATAD3C	-2.903	0.00396	-0.035985	49	0.012396	yes	HRTLV
chr1_1436079_A_G_b38	ATAD3C	-2.899	0.004	-0.036018	48	0.012423	yes	HRTLV
chr1_1308178_GGGGCGCGGGGA_G_b38	ATAD3C	-2.886	0.00417	-0.041751	13	0.014465	yes	HRTLV
chr1_1533883_G_T_b38	ATAD3C	-2.871	0.00437	-0.064066	7	0.022313	yes	HRTLV
chr1_868739_A_T_b38	ATAD3C	2.868	0.00441	0.059516	4	0.020754	yes	HRTLV
chr1_1597462_C_T_b38	ATAD3C	-2.858	0.00455	-0.035116	26	0.012288	yes	HRTLV
chr1_1108235_CA_C_b38	ATAD3C	2.841	0.00479	0.048846	4	0.017194	yes	HRTLV
chr1_1316929_A_T_b38	ATAD3C	-2.834	0.00489	-0.04364	10	0.015396	yes	HRTLV
chr1_1431450_A_G_b38	ATAD3C	-2.829	0.00497	-0.03601	46	0.01273	yes	HRTLV
chr1_1431537_G_C_b38	ATAD3C	-2.829	0.00497	-0.03601	46	0.01273	yes	HRTLV
chr1_1456217_T_C_b38	ATAD3C	-2.789	0.00561	-0.041279	36	0.014801	yes	HRTLV
chr1_1453961_C_T_b38	ATAD3C	-2.788	0.00562	-0.04349	5	0.015598	yes	HRTLV
chr1_1426810_C_G_b38	ATAD3C	-2.772	0.0059	-0.03527	45	0.012723	yes	HRTLV
chr1_868755_A_G_b38	ATAD3C	2.769	0.00596	0.054542	4	0.0197	yes	HRTLV
chr1_868729_C_A_b38	ATAD3C	2.768	0.00598	0.057898	4	0.020918	yes	HRTLV
chr1_868710_C_T_b38	ATAD3C	2.761	0.0061	0.057968	4	0.020994	yes	HRTLV
chr1_1186245_C_G_b38	ATAD3C	2.758	0.00616	0.04479	7	0.016242	yes	HRTLV
chr1_1426261_C_T_b38	ATAD3C	-2.755	0.00621	-0.035241	44	0.012792	yes	HRTLV
chr1_1744096_C_T_b38	ATAD3C	-2.746	0.00637	-0.041097	43	0.014964	yes	HRTLV
chr1_868693_G_A_b38	ATAD3C	2.738	0.00653	0.057267	4	0.020914	yes	HRTLV
chr1_1744052_GAGA_G_b38	ATAD3C	-2.722	0.00684	-0.038296	15	0.014068	yes	HRTLV
chr1_1471992_T_C_b38	ATAD3C	-2.719	0.00691	-0.036933	54	0.013584	yes	HRTLV
chr1_1450636_A_G_b38	ATAD3C	-2.717	0.00696	-0.040504	7	0.014909	yes	HRTLV
chr1_1431026_CCACCCCCT_C_b38	ATAD3C	-2.713	0.00704	-0.035793	24	0.013195	yes	HRTLV
chr1_1559703_G_C_b38	ATAD3C	-2.71	0.00709	-0.030687	62	0.011323	yes	HRTLV
chr1_1568548_G_A_b38	ATAD3C	-2.71	0.00709	-0.030687	62	0.011323	yes	HRTLV
chr1_1369803_C_CT_b38	ATAD3C	-2.705	0.00719	-0.040224	9	0.014868	yes	HRTLV
chr1_1065530_C_T_b38	ATAD3C	2.702	0.00727	0.0477	4	0.017654	yes	HRTLV
chr1_1562444_C_T_b38	ATAD3C	-2.702	0.00727	-0.046454	4	0.017193	yes	HRTLV
chr1_1570568_AC_A_b38	ATAD3C	-2.694	0.00744	-0.032338	24	0.012004	yes	HRTLV
chr1_1631827_G_A_b38	ATAD3C	-2.689	0.00754	-0.037058	13	0.013779	yes	HRTLV
chr1_868788_C_A_b38	ATAD3C	2.687	0.0076	0.051248	4	0.019076	yes	HRTLV
chr1_1329973_GCGTGTGCCATGCA_G_b38	ATAD3C	-2.687	0.0076	-0.044226	8	0.016462	yes	HRTLV
chr1_868772_T_G_b38	ATAD3C	2.676	0.00783	0.051733	4	0.01933	yes	HRTLV
chr1_1108244_T_C_b38	ATAD3C	2.674	0.00788	0.041905	8	0.01567	yes	HRTLV
chr1_1344048_G_A_b38	ATAD3C	-2.67	0.00798	-0.043894	8	0.01644	yes	HRTLV
chr1_1575935_T_C_b38	ATAD3C	-2.667	0.00804	-0.030794	63	0.011545	yes	HRTLV
chr1_1185961_C_T_b38	ATAD3C	2.666	0.00807	0.043482	7	0.016309	yes	HRTLV
chr1_937396_GCC_G_b38	ATAD3C	2.661	0.0082	0.029551	76	0.011106	yes	HRTLV
chr1_1456051_C_T_b38	ATAD3C	-2.66	0.0082	-0.035001	20	0.013156	yes	HRTLV
chr1_1430908_A_G_b38	ATAD3C	-2.66	0.00822	-0.033646	47	0.01265	yes	HRTLV
chr1_601673_G_A_b38	ATAD3C	2.647	0.00854	0.051286	3	0.019378	yes	HRTLV
chr1_1430190_A_C_b38	ATAD3C	-2.64	0.00871	-0.033738	46	0.012781	yes	HRTLV
chr1_1454315_C_T_b38	ATAD3C	-2.633	0.00888	-0.035958	40	0.013656	yes	HRTLV
chr1_1108232_CAG_C_b38	ATAD3C	2.618	0.00928	0.044524	5	0.01701	yes	HRTLV
chr1_1185634_G_A_b38	ATAD3C	2.612	0.00943	0.043989	7	0.016841	yes	HRTLV
chr1_1499586_C_CT_b38	ATAD3C	-2.61	0.0095	-0.044683	12	0.017122	yes	HRTLV
chr1_1452825_AAAG_A_b38	ATAD3C	-2.608	0.00955	-0.034159	20	0.013099	yes	HRTLV
chr1_1570587_C_T_b38	ATAD3C	-2.607	0.00958	-0.029481	62	0.01131	yes	HRTLV
chr1_1452511_A_G_b38	ATAD3C	-2.605	0.00964	-0.035521	43	0.013638	yes	HRTLV
chr1_1452888_C_A_b38	ATAD3C	-2.605	0.00964	-0.035521	43	0.013638	yes	HRTLV
chr1_1452909_A_C_b38	ATAD3C	-2.605	0.00964	-0.035521	43	0.013638	yes	HRTLV
chr1_1453703_A_G_b38	ATAD3C	-2.605	0.00964	-0.035521	43	0.013638	yes	HRTLV
chr1_1454092_A_G_b38	ATAD3C	-2.605	0.00964	-0.035521	43	0.013638	yes	HRTLV
chr1_1454770_T_C_b38	ATAD3C	-2.6	0.00975	-0.035512	43	0.013657	yes	HRTLV
chr1_2074301_T_C_b38	ATAD3C	-2.592	0.00998	-0.04153	4	0.016021	yes	HRTLV
chr1_1196061_C_T_b38	ATAD3C	3.682	0.000273	0.064927	6	0.017635	no	HRTLV
chr1_1115600_CCCCTCCCCAGGGACCCCCCT_C_b38	ATAD3C	3.504	0.000525	0.063843	6	0.018221	no	HRTLV
chr1_1187008_G_A_b38	ATAD3C	3.465	0.000604	0.06063	5	0.017499	no	HRTLV
chr1_1195100_G_A_b38	ATAD3C	3.452	0.000632	0.055709	7	0.016138	no	HRTLV
chr1_2324194_G_A_b38	ATAD3C	3.326	0.000985	0.074622	4	0.022437	no	HRTLV
chr1_1187013_A_AT_b38	ATAD3C	3.316	0.00102	0.058802	5	0.017731	no	HRTLV
chr1_1187016_C_T_b38	ATAD3C	3.316	0.00102	0.058802	5	0.017731	no	HRTLV
chr1_1130879_G_C_b38	ATAD3C	-3.276	0.00117	-0.042953	13	0.013112	no	HRTLV
chr1_1473134_C_CTT_b38	ATAD3C	-3.135	0.00188	-0.086535	4	0.0276	no	HRTLV
chr1_1132485_A_C_b38	ATAD3C	-3.124	0.00195	-0.049182	7	0.015745	no	HRTLV
chr1_611317_A_G_b38	ATAD3C	3.116	0.002	0.047188	14	0.015141	no	HRTLV
chr1_1744028_A_AC_b38	ATAD3C	-3.109	0.00205	-0.044341	13	0.014261	no	HRTLV
chr1_1197558_G_A_b38	ATAD3C	3.103	0.00209	0.054306	6	0.017498	no	HRTLV
chr1_1132216_CAG_C_b38	ATAD3C	-3.033	0.00262	-0.030688	75	0.010118	no	HRTLV
chr1_1407565_C_A_b38	ATAD3C	-2.984	0.00307	-0.052399	7	0.017562	no	HRTLV
chr1_1380867_A_G_b38	ATAD3C	-2.98	0.00311	-0.051575	7	0.017308	no	HRTLV
chr1_1743586_T_TAC_b38	ATAD3C	-2.947	0.00345	-0.033768	46	0.011457	no	HRTLV
chr1_1120273_C_G_b38	ATAD3C	2.945	0.00347	0.048411	3	0.016438	no	HRTLV
chr1_1120521_C_A_b38	ATAD3C	2.945	0.00347	0.048411	3	0.016438	no	HRTLV
chr1_1121559_T_A_b38	ATAD3C	2.945	0.00347	0.048411	3	0.016438	no	HRTLV
chr1_1122128_C_G_b38	ATAD3C	2.945	0.00347	0.048411	3	0.016438	no	HRTLV
chr1_1122144_C_T_b38	ATAD3C	2.945	0.00347	0.048411	3	0.016438	no	HRTLV
chr1_1120417_A_G_b38	ATAD3C	2.93	0.00364	0.047501	3	0.016213	no	HRTLV
chr1_1122042_G_C_b38	ATAD3C	2.93	0.00364	0.047501	3	0.016213	no	HRTLV
chr1_1122649_A_G_b38	ATAD3C	2.93	0.00364	0.047501	3	0.016213	no	HRTLV
chr1_958081_TC_T_b38	ATAD3C	2.918	0.00378	0.069727	7	0.0239	no	HRTLV
chr1_1379091_T_G_b38	ATAD3C	2.911	0.00386	0.044125	11	0.015158	no	HRTLV
chr1_1120889_C_T_b38	ATAD3C	2.871	0.00437	0.046714	3	0.016273	no	HRTLV
chr1_1132294_T_TGG_b38	ATAD3C	-2.84	0.0048	-0.028547	73	0.010051	no	HRTLV
chr1_770988_A_G_b38	ATAD3C	-2.838	0.00483	-0.030504	96	0.010747	no	HRTLV
chr1_1117566_G_T_b38	ATAD3C	2.826	0.00502	0.046327	3	0.016394	no	HRTLV
chr1_1118447_T_TG_b38	ATAD3C	2.826	0.00502	0.046327	3	0.016394	no	HRTLV
chr1_1743565_ATAT_A_b38	ATAD3C	-2.813	0.00521	-0.029633	65	0.010533	no	HRTLV
chr1_1375642_C_T_b38	ATAD3C	-2.797	0.00548	-0.045705	8	0.016343	no	HRTLV
chr1_1252487_C_A_b38	ATAD3C	-2.792	0.00556	-0.052777	3	0.018902	no	HRTLV
chr1_1131572_A_G_b38	ATAD3C	-2.775	0.00586	-0.028142	84	0.010143	no	HRTLV
chr1_1131573_T_C_b38	ATAD3C	-2.775	0.00586	-0.028142	84	0.010143	no	HRTLV
chr1_1199253_C_T_b38	ATAD3C	2.772	0.0059	0.045251	8	0.016325	no	HRTLV
chr1_1133289_GT_G_b38	ATAD3C	-2.767	0.00599	-0.027912	81	0.010086	no	HRTLV
chr1_1123509_G_A_b38	ATAD3C	2.756	0.00619	0.045654	3	0.016564	no	HRTLV
chr1_2364499_A_G_b38	ATAD3C	2.753	0.00624	0.030383	39	0.011035	no	HRTLV
chr1_865003_C_T_b38	ATAD3C	-2.72	0.00688	-0.045281	8	0.016645	no	HRTLV
chr1_1125772_T_C_b38	ATAD3C	2.702	0.00727	0.044475	3	0.01646	no	HRTLV
chr1_1126128_G_A_b38	ATAD3C	2.702	0.00727	0.044475	3	0.01646	no	HRTLV
chr1_1119172_G_A_b38	ATAD3C	2.698	0.00735	0.045153	3	0.016734	no	HRTLV
chr1_1123255_G_A_b38	ATAD3C	2.698	0.00735	0.045153	3	0.016734	no	HRTLV
chr1_1123889_C_T_b38	ATAD3C	2.698	0.00735	0.045153	3	0.016734	no	HRTLV
chr1_1124663_A_C_b38	ATAD3C	2.698	0.00735	0.045153	3	0.016734	no	HRTLV
chr1_1124768_G_T_b38	ATAD3C	2.698	0.00735	0.045153	3	0.016734	no	HRTLV
chr1_1368178_C_CTTTTT_b38	ATAD3C	-2.696	0.0074	-0.043899	3	0.016285	no	HRTLV
chr1_1131566_A_G_b38	ATAD3C	-2.688	0.00756	-0.026763	81	0.009955	no	HRTLV
chr1_1384546_C_T_b38	ATAD3C	-2.687	0.00759	-0.047216	7	0.017571	no	HRTLV
chr1_1110093_G_A_b38	ATAD3C	2.686	0.00762	0.044701	3	0.016643	no	HRTLV
chr1_791544_T_TGAATGGAATGGAATC_b38	ATAD3C	-2.663	0.00815	-0.045024	5	0.01691	no	HRTLV
chr1_1217733_G_A_b38	ATAD3C	-2.662	0.00816	-0.04263	9	0.016012	no	HRTLV
chr1_1403593_A_G_b38	ATAD3C	-2.645	0.00858	-0.043421	8	0.016416	no	HRTLV
chr1_1125735_T_C_b38	ATAD3C	2.642	0.00865	0.04276	3	0.016185	no	HRTLV
chr1_2344256_A_T_b38	ATAD3C	2.641	0.00867	0.030659	27	0.011608	no	HRTLV
chr1_1989523_T_C_b38	ATAD3C	2.633	0.00888	0.029789	56	0.011314	no	HRTLV
chr1_1125228_G_A_b38	ATAD3C	2.622	0.00918	0.043488	3	0.016588	no	HRTLV
chr1_1126571_C_T_b38	ATAD3C	2.622	0.00918	0.043488	3	0.016588	no	HRTLV
chr1_872909_A_T_b38	ATAD3C	2.61	0.00949	0.048428	6	0.018557	no	HRTLV
chr1_1125882_A_G_b38	ATAD3C	2.604	0.00966	0.042474	3	0.016314	no	HRTLV
chr1_941767_G_A_b38	ATAD3C	2.602	0.0097	0.032302	19	0.012413	no	HRTLV
chr1_1743886_C_T_b38	ATAD3C	-2.601	0.00972	-0.03291	32	0.012651	no	HRTLV
chr1_2342999_A_G_b38	ATAD3C	3.797	0.000419	0.228205	4	0.060097	yes	KDNCTX
chr1_2022137_G_A_b38	ATAD3C	3.141	0.00291	0.163449	8	0.052039	yes	KDNCTX
chr1_1680672_C_T_b38	ATAD3C	3.093	0.00333	0.193788	14	0.062647	yes	KDNCTX
chr1_2423447_G_A_b38	ATAD3C	-2.895	0.00574	-0.1545	14	0.053377	yes	KDNCTX
chr1_1686147_T_G_b38	ATAD3C	2.877	0.00602	0.168748	11	0.058655	yes	KDNCTX
chr1_1188054_T_A_b38	ATAD3C	-2.785	0.0077	-0.187156	3	0.067207	yes	KDNCTX
chr1_1684308_G_C_b38	ATAD3C	2.748	0.00847	0.159574	11	0.058066	yes	KDNCTX
chr1_1684619_G_A_b38	ATAD3C	2.748	0.00847	0.159574	11	0.058066	yes	KDNCTX
chr1_1864334_AAAG_A_b38	ATAD3C	4.022	0.000208	0.266495	3	0.066252	no	KDNCTX
chr1_2060607_C_T_b38	ATAD3C	-3.682	0.000596	-0.222023	3	0.060301	no	KDNCTX
chr1_2056323_C_T_b38	ATAD3C	-3.635	0.000688	-0.23273	3	0.064031	no	KDNCTX
chr1_2056605_G_C_b38	ATAD3C	-3.635	0.000688	-0.23273	3	0.064031	no	KDNCTX
chr1_2055769_T_C_b38	ATAD3C	-3.608	0.000745	-0.213551	3	0.05918	no	KDNCTX
chr1_2054074_C_G_b38	ATAD3C	-3.576	0.00082	-0.215841	4	0.06035	no	KDNCTX
chr1_2054114_T_C_b38	ATAD3C	-3.576	0.00082	-0.215841	4	0.06035	no	KDNCTX
chr1_2057679_A_C_b38	ATAD3C	-3.509	0.001	-0.21888	3	0.062378	no	KDNCTX
chr1_2061187_A_G_b38	ATAD3C	-3.509	0.001	-0.21888	3	0.062378	no	KDNCTX
chr1_2061762_C_A_b38	ATAD3C	-3.509	0.001	-0.21888	3	0.062378	no	KDNCTX
chr1_2062283_C_T_b38	ATAD3C	-3.509	0.001	-0.21888	3	0.062378	no	KDNCTX
chr1_2065120_G_A_b38	ATAD3C	-3.509	0.001	-0.21888	3	0.062378	no	KDNCTX
chr1_2090485_G_GC_b38	ATAD3C	-3.456	0.00117	-0.226741	3	0.065602	no	KDNCTX
chr1_2059723_G_A_b38	ATAD3C	-3.437	0.00124	-0.212999	7	0.061968	no	KDNCTX
chr1_2235045_A_AT_b38	ATAD3C	-3.349	0.00161	-0.215911	5	0.064471	no	KDNCTX
chr1_2056821_T_C_b38	ATAD3C	-3.326	0.00172	-0.201181	7	0.060495	no	KDNCTX
chr1_2232129_C_T_b38	ATAD3C	-3.297	0.00187	-0.199714	10	0.060578	no	KDNCTX
chr1_2232677_T_C_b38	ATAD3C	-3.297	0.00187	-0.199714	10	0.060578	no	KDNCTX
chr1_2235710_C_T_b38	ATAD3C	-3.297	0.00187	-0.199714	10	0.060578	no	KDNCTX
chr1_2071051_C_CACCTGGGCGTGTGACCTGGGCGTGTG_b38	ATAD3C	-3.222	0.00231	-0.216185	3	0.06709	no	KDNCTX
chr1_2226509_T_C_b38	ATAD3C	-3.139	0.00293	-0.183148	11	0.058353	no	KDNCTX
chr1_1684817_G_C_b38	ATAD3C	3.052	0.00373	0.184033	9	0.060291	no	KDNCTX
chr1_2089675_C_T_b38	ATAD3C	-3.04	0.00386	-0.203704	5	0.067005	no	KDNCTX
chr1_2053731_G_A_b38	ATAD3C	2.843	0.0066	0.176272	7	0.062011	no	KDNCTX
chr1_1679993_A_G_b38	ATAD3C	2.764	0.00812	0.159441	13	0.057679	no	KDNCTX
chr1_2327239_C_CACACAGAAACACACAGAAACACAGAAACAAACACAGAG_b38	ATAD3C	2.709	0.00938	0.18952	4	0.069957	no	KDNCTX
chr1_2094964_T_C_b38	ATAD3C	-2.707	0.00944	-0.162561	16	0.06006	no	KDNCTX
chr1_1456829_G_C_b38	ATAD3C	9.321	6.74e-17	0.547201	14	0.058707	yes	LIVER
chr1_1452346_A_G_b38	ATAD3C	8.575	6.48e-15	0.512102	5	0.059723	yes	LIVER
chr1_1452384_G_A_b38	ATAD3C	8.575	6.48e-15	0.512102	5	0.059723	yes	LIVER
chr1_1453961_C_T_b38	ATAD3C	8.533	8.35e-15	0.526332	4	0.061685	yes	LIVER
chr1_1451028_T_A_b38	ATAD3C	8.162	7.65e-14	0.521236	4	0.063864	yes	LIVER
chr1_1453870_A_C_b38	ATAD3C	8.051	1.47e-13	0.492882	5	0.061222	yes	LIVER
chr1_1450636_A_G_b38	ATAD3C	7.987	2.14e-13	0.513749	4	0.064322	yes	LIVER
chr1_1452825_AAAG_A_b38	ATAD3C	7.52	3.19e-12	0.435386	10	0.057894	yes	LIVER
chr1_1453552_G_A_b38	ATAD3C	7.442	4.99e-12	0.432726	11	0.058147	yes	LIVER
chr1_1454848_T_C_b38	ATAD3C	7.442	4.99e-12	0.432726	11	0.058147	yes	LIVER
chr1_1455134_T_G_b38	ATAD3C	7.442	4.99e-12	0.432726	11	0.058147	yes	LIVER
chr1_1455337_A_G_b38	ATAD3C	7.442	4.99e-12	0.432726	11	0.058147	yes	LIVER
chr1_1455495_C_T_b38	ATAD3C	7.442	4.99e-12	0.432726	11	0.058147	yes	LIVER
chr1_1455924_T_C_b38	ATAD3C	7.442	4.99e-12	0.432726	11	0.058147	yes	LIVER
chr1_1456051_C_T_b38	ATAD3C	7.442	4.99e-12	0.432726	11	0.058147	yes	LIVER
chr1_1452540_G_A_b38	ATAD3C	7.273	1.3e-11	0.420663	10	0.057839	yes	LIVER
chr1_1451968_C_T_b38	ATAD3C	7.271	1.31e-11	0.423745	11	0.058281	yes	LIVER
chr1_1456079_T_C_b38	ATAD3C	7.248	1.49e-11	0.425808	11	0.058749	yes	LIVER
chr1_1457033_A_C_b38	ATAD3C	7.119	3.07e-11	0.41859	12	0.058799	yes	LIVER
chr1_1453643_A_ATT_b38	ATAD3C	6.887	1.11e-10	0.422245	11	0.061312	yes	LIVER
chr1_1452511_A_G_b38	ATAD3C	6.728	2.62e-10	0.417031	19	0.061984	yes	LIVER
chr1_1452888_C_A_b38	ATAD3C	6.728	2.62e-10	0.417031	19	0.061984	yes	LIVER
chr1_1452909_A_C_b38	ATAD3C	6.728	2.62e-10	0.417031	19	0.061984	yes	LIVER
chr1_1454092_A_G_b38	ATAD3C	6.728	2.62e-10	0.417031	19	0.061984	yes	LIVER
chr1_1455617_T_G_b38	ATAD3C	6.728	2.62e-10	0.417031	19	0.061984	yes	LIVER
chr1_1456154_G_A_b38	ATAD3C	6.597	5.31e-10	0.399113	11	0.060502	yes	LIVER
chr1_1457071_C_T_b38	ATAD3C	6.436	1.25e-09	0.377171	12	0.058605	yes	LIVER
chr1_1454770_T_C_b38	ATAD3C	6.35	1.96e-09	0.395697	19	0.062318	yes	LIVER
chr1_1454315_C_T_b38	ATAD3C	6.305	2.48e-09	0.389899	18	0.061839	yes	LIVER
chr1_1449009_A_T_b38	ATAD3C	6.263	3.09e-09	0.425734	12	0.067977	yes	LIVER
chr1_1453703_A_G_b38	ATAD3C	6.25	3.29e-09	0.393623	19	0.062975	yes	LIVER
chr1_1451787_A_C_b38	ATAD3C	6.128	6.2e-09	0.371816	16	0.060676	yes	LIVER
chr1_1431813_G_T_b38	ATAD3C	6.086	7.69e-09	0.42828	3	0.070375	yes	LIVER
chr1_1434687_C_G_b38	ATAD3C	6.001	1.19e-08	0.423242	3	0.070532	yes	LIVER
chr1_1437993_G_A_b38	ATAD3C	5.759	3.98e-08	0.347306	9	0.06031	yes	LIVER
chr1_1437955_C_G_b38	ATAD3C	5.638	7.2e-08	0.304309	15	0.053976	yes	LIVER
chr1_1452797_CAA_C_b38	ATAD3C	5.509	1.34e-07	0.363642	6	0.066012	yes	LIVER
chr1_1449831_A_G_b38	ATAD3C	5.504	1.38e-07	0.376648	17	0.068437	yes	LIVER
chr1_1479719_T_C_b38	ATAD3C	5.481	1.54e-07	0.339567	23	0.061956	yes	LIVER
chr1_1436388_CA_C_b38	ATAD3C	5.383	2.45e-07	0.335975	11	0.062416	yes	LIVER
chr1_1426261_C_T_b38	ATAD3C	5.272	4.13e-07	0.321794	18	0.061037	yes	LIVER
chr1_1426810_C_G_b38	ATAD3C	5.272	4.13e-07	0.321794	18	0.061037	yes	LIVER
chr1_1428969_T_C_b38	ATAD3C	5.219	5.28e-07	0.315697	19	0.060486	yes	LIVER
chr1_1456891_T_C_b38	ATAD3C	5.128	8.03e-07	0.294071	15	0.057344	yes	LIVER
chr1_1441187_A_G_b38	ATAD3C	5.121	8.3e-07	0.323225	10	0.063117	yes	LIVER
chr1_1448915_G_A_b38	ATAD3C	5.111	8.69e-07	0.333438	12	0.065239	yes	LIVER
chr1_1430190_A_C_b38	ATAD3C	5.048	1.16e-06	0.306373	19	0.060694	yes	LIVER
chr1_1431450_A_G_b38	ATAD3C	5.048	1.16e-06	0.306373	19	0.060694	yes	LIVER
chr1_1431537_G_C_b38	ATAD3C	5.048	1.16e-06	0.306373	19	0.060694	yes	LIVER
chr1_1442793_G_A_b38	ATAD3C	5.032	1.25e-06	0.358752	3	0.0713	yes	LIVER
chr1_1379093_TG_T_b38	ATAD3C	5.004	1.41e-06	0.369797	4	0.073903	yes	LIVER
chr1_1456182_G_A_b38	ATAD3C	4.973	1.62e-06	0.303987	12	0.061127	yes	LIVER
chr1_1431026_CCACCCCCT_C_b38	ATAD3C	4.943	1.86e-06	0.304371	13	0.06158	yes	LIVER
chr1_1435945_C_CCGGGCGGGGGCG_b38	ATAD3C	4.885	2.41e-06	0.345764	4	0.070779	yes	LIVER
chr1_1384546_C_T_b38	ATAD3C	4.835	3e-06	0.354488	6	0.073312	yes	LIVER
chr1_1407565_C_A_b38	ATAD3C	4.835	3e-06	0.354488	6	0.073312	yes	LIVER
chr1_1438102_G_C_b38	ATAD3C	4.812	3.32e-06	0.317487	6	0.065974	yes	LIVER
chr1_1370532_C_T_b38	ATAD3C	4.802	3.48e-06	0.325035	7	0.067694	yes	LIVER
chr1_1373006_G_A_b38	ATAD3C	4.732	4.71e-06	0.355632	3	0.075151	yes	LIVER
chr1_1398218_C_A_b38	ATAD3C	4.714	5.1e-06	0.344009	6	0.072981	yes	LIVER
chr1_1400756_GGA_G_b38	ATAD3C	4.714	5.1e-06	0.344009	6	0.072981	yes	LIVER
chr1_1401954_G_T_b38	ATAD3C	4.714	5.1e-06	0.344009	6	0.072981	yes	LIVER
chr1_1403593_A_G_b38	ATAD3C	4.711	5.16e-06	0.340376	6	0.072249	yes	LIVER
chr1_1372909_G_A_b38	ATAD3C	4.692	5.6e-06	0.336638	6	0.071743	yes	LIVER
chr1_1368991_C_T_b38	ATAD3C	4.67	6.15e-06	0.313679	6	0.067165	yes	LIVER
chr1_1411323_A_C_b38	ATAD3C	4.664	6.32e-06	0.298177	21	0.063929	yes	LIVER
chr1_1380867_A_G_b38	ATAD3C	4.655	6.56e-06	0.334565	6	0.071866	yes	LIVER
chr1_1374505_A_G_b38	ATAD3C	4.629	7.35e-06	0.329658	6	0.071215	yes	LIVER
chr1_1400410_A_G_b38	ATAD3C	4.607	8.09e-06	0.292748	16	0.063551	yes	LIVER
chr1_1369803_C_CT_b38	ATAD3C	4.592	8.61e-06	0.304317	5	0.066275	yes	LIVER
chr1_1430908_A_G_b38	ATAD3C	4.561	9.81e-06	0.275128	20	0.060321	yes	LIVER
chr1_1383743_T_C_b38	ATAD3C	4.549	1.03e-05	0.326007	6	0.071663	yes	LIVER
chr1_1389827_C_T_b38	ATAD3C	-4.544	1.05e-05	-0.289241	19	0.063654	yes	LIVER
chr1_1373007_G_A_b38	ATAD3C	4.54	1.07e-05	0.34862	4	0.076787	yes	LIVER
chr1_1436079_A_G_b38	ATAD3C	4.538	1.08e-05	0.28087	19	0.061888	yes	LIVER
chr1_1369407_G_A_b38	ATAD3C	4.538	1.08e-05	0.305092	5	0.067226	yes	LIVER
chr1_1382893_G_A_b38	ATAD3C	4.538	1.08e-05	0.327772	6	0.072227	yes	LIVER
chr1_1394423_A_G_b38	ATAD3C	4.522	1.16e-05	0.289315	19	0.063974	yes	LIVER
chr1_1395346_A_G_b38	ATAD3C	4.522	1.16e-05	0.289315	19	0.063974	yes	LIVER
chr1_1402457_A_G_b38	ATAD3C	4.508	1.22e-05	0.290141	20	0.064355	yes	LIVER
chr1_1387698_A_G_b38	ATAD3C	-4.508	1.22e-05	-0.290141	20	0.064355	yes	LIVER
chr1_1370430_T_C_b38	ATAD3C	4.495	1.3e-05	0.307678	7	0.06845	yes	LIVER
chr1_1370584_G_C_b38	ATAD3C	4.495	1.3e-05	0.307678	7	0.06845	yes	LIVER
chr1_1384749_C_G_b38	ATAD3C	-4.491	1.32e-05	-0.286513	15	0.063799	yes	LIVER
chr1_1387763_CCT_C_b38	ATAD3C	-4.491	1.32e-05	-0.286513	15	0.063799	yes	LIVER
chr1_1388944_G_A_b38	ATAD3C	-4.491	1.32e-05	-0.286513	15	0.063799	yes	LIVER
chr1_1367280_T_A_b38	ATAD3C	4.393	1.98e-05	0.30009	6	0.068313	yes	LIVER
chr1_1375642_C_T_b38	ATAD3C	4.374	2.14e-05	0.310009	6	0.070871	yes	LIVER
chr1_1364357_A_C_b38	ATAD3C	4.367	2.2e-05	0.296357	6	0.067863	yes	LIVER
chr1_1368514_C_G_b38	ATAD3C	4.367	2.2e-05	0.296357	6	0.067863	yes	LIVER
chr1_1366292_G_T_b38	ATAD3C	4.364	2.23e-05	0.29941	6	0.068615	yes	LIVER
chr1_1364282_T_G_b38	ATAD3C	4.346	2.4e-05	0.296661	6	0.068258	yes	LIVER
chr1_1364694_T_C_b38	ATAD3C	4.346	2.4e-05	0.296661	6	0.068258	yes	LIVER
chr1_1364721_C_T_b38	ATAD3C	4.346	2.4e-05	0.296661	6	0.068258	yes	LIVER
chr1_1365160_A_G_b38	ATAD3C	4.346	2.4e-05	0.296661	6	0.068258	yes	LIVER
chr1_1365198_C_T_b38	ATAD3C	4.346	2.4e-05	0.296661	6	0.068258	yes	LIVER
chr1_1366008_A_G_b38	ATAD3C	4.346	2.4e-05	0.296661	6	0.068258	yes	LIVER
chr1_1366062_T_C_b38	ATAD3C	4.346	2.4e-05	0.296661	6	0.068258	yes	LIVER
chr1_1366145_TGTGAA_T_b38	ATAD3C	4.346	2.4e-05	0.296661	6	0.068258	yes	LIVER
chr1_1366187_A_AGT_b38	ATAD3C	4.346	2.4e-05	0.296661	6	0.068258	yes	LIVER
chr1_1366321_TGTGTGTAAATGG_T_b38	ATAD3C	4.346	2.4e-05	0.296661	6	0.068258	yes	LIVER
chr1_1366453_G_T_b38	ATAD3C	4.346	2.4e-05	0.296661	6	0.068258	yes	LIVER
chr1_1366726_T_G_b38	ATAD3C	4.346	2.4e-05	0.296661	6	0.068258	yes	LIVER
chr1_1367258_T_A_b38	ATAD3C	4.346	2.4e-05	0.296661	6	0.068258	yes	LIVER
chr1_1367297_GAA_G_b38	ATAD3C	4.346	2.4e-05	0.296661	6	0.068258	yes	LIVER
chr1_1367300_T_TGA_b38	ATAD3C	4.346	2.4e-05	0.296661	6	0.068258	yes	LIVER
chr1_1367329_A_AGT_b38	ATAD3C	4.346	2.4e-05	0.296661	6	0.068258	yes	LIVER
chr1_1367373_T_TGTG_b38	ATAD3C	4.346	2.4e-05	0.296661	6	0.068258	yes	LIVER
chr1_1367388_T_TTGG_b38	ATAD3C	4.346	2.4e-05	0.296661	6	0.068258	yes	LIVER
chr1_1367462_T_C_b38	ATAD3C	4.346	2.4e-05	0.296661	6	0.068258	yes	LIVER
chr1_1367511_ATGAG_A_b38	ATAD3C	4.346	2.4e-05	0.296661	6	0.068258	yes	LIVER
chr1_1367593_G_A_b38	ATAD3C	4.346	2.4e-05	0.296661	6	0.068258	yes	LIVER
chr1_1367602_GT_G_b38	ATAD3C	4.346	2.4e-05	0.296661	6	0.068258	yes	LIVER
chr1_1367605_GAGTGAGTGTA_G_b38	ATAD3C	4.346	2.4e-05	0.296661	6	0.068258	yes	LIVER
chr1_1367670_GGTGA_G_b38	ATAD3C	4.346	2.4e-05	0.296661	6	0.068258	yes	LIVER
chr1_1367722_TTTTA_T_b38	ATAD3C	4.346	2.4e-05	0.296661	6	0.068258	yes	LIVER
chr1_1367874_A_T_b38	ATAD3C	4.346	2.4e-05	0.296661	6	0.068258	yes	LIVER
chr1_1367919_C_T_b38	ATAD3C	4.346	2.4e-05	0.296661	6	0.068258	yes	LIVER
chr1_1367951_C_T_b38	ATAD3C	4.346	2.4e-05	0.296661	6	0.068258	yes	LIVER
chr1_1367965_A_G_b38	ATAD3C	4.346	2.4e-05	0.296661	6	0.068258	yes	LIVER
chr1_1367970_T_G_b38	ATAD3C	4.346	2.4e-05	0.296661	6	0.068258	yes	LIVER
chr1_1367994_C_A_b38	ATAD3C	4.346	2.4e-05	0.296661	6	0.068258	yes	LIVER
chr1_1368297_C_T_b38	ATAD3C	4.346	2.4e-05	0.296661	6	0.068258	yes	LIVER
chr1_1369009_T_C_b38	ATAD3C	4.346	2.4e-05	0.296661	6	0.068258	yes	LIVER
chr1_1369012_C_CG_b38	ATAD3C	4.346	2.4e-05	0.296661	6	0.068258	yes	LIVER
chr1_1369282_G_A_b38	ATAD3C	4.346	2.4e-05	0.296661	6	0.068258	yes	LIVER
chr1_1369320_GT_G_b38	ATAD3C	4.346	2.4e-05	0.296661	6	0.068258	yes	LIVER
chr1_1369476_CTT_C_b38	ATAD3C	4.346	2.4e-05	0.296661	6	0.068258	yes	LIVER
chr1_1369556_C_G_b38	ATAD3C	4.346	2.4e-05	0.296661	6	0.068258	yes	LIVER
chr1_1369627_T_C_b38	ATAD3C	4.346	2.4e-05	0.296661	6	0.068258	yes	LIVER
chr1_1369686_T_C_b38	ATAD3C	4.346	2.4e-05	0.296661	6	0.068258	yes	LIVER
chr1_1369716_G_C_b38	ATAD3C	4.346	2.4e-05	0.296661	6	0.068258	yes	LIVER
chr1_1369741_C_T_b38	ATAD3C	4.346	2.4e-05	0.296661	6	0.068258	yes	LIVER
chr1_1369821_C_T_b38	ATAD3C	4.346	2.4e-05	0.296661	6	0.068258	yes	LIVER
chr1_1370181_C_T_b38	ATAD3C	4.346	2.4e-05	0.296661	6	0.068258	yes	LIVER
chr1_1370317_G_C_b38	ATAD3C	4.346	2.4e-05	0.296661	6	0.068258	yes	LIVER
chr1_1370320_A_G_b38	ATAD3C	4.346	2.4e-05	0.296661	6	0.068258	yes	LIVER
chr1_1364566_T_C_b38	ATAD3C	4.343	2.43e-05	0.296116	6	0.06818	yes	LIVER
chr1_1341550_GCA_G_b38	ATAD3C	4.333	2.54e-05	0.303707	7	0.070099	yes	LIVER
chr1_1367268_TGA_T_b38	ATAD3C	4.311	2.77e-05	0.291124	6	0.067537	yes	LIVER
chr1_1344048_G_A_b38	ATAD3C	4.29	3.02e-05	0.301186	6	0.07021	yes	LIVER
chr1_1445240_A_G_b38	ATAD3C	4.288	3.05e-05	0.275013	17	0.064142	yes	LIVER
chr1_1363880_A_G_b38	ATAD3C	4.261	3.4e-05	0.287932	6	0.067581	yes	LIVER
chr1_1431014_G_A_b38	ATAD3C	4.234	3.79e-05	0.260337	10	0.061491	yes	LIVER
chr1_1361685_C_T_b38	ATAD3C	4.214	4.09e-05	0.274445	12	0.065122	yes	LIVER
chr1_1433374_T_C_b38	ATAD3C	4.208	4.19e-05	0.254335	21	0.060437	yes	LIVER
chr1_1303112_G_A_b38	ATAD3C	4.187	4.56e-05	0.2965	3	0.070811	yes	LIVER
chr1_1304555_A_C_b38	ATAD3C	4.187	4.56e-05	0.2965	3	0.070811	yes	LIVER
chr1_1303800_G_A_b38	ATAD3C	4.177	4.74e-05	0.300221	3	0.071867	yes	LIVER
chr1_1364253_C_G_b38	ATAD3C	4.164	4.99e-05	0.292946	6	0.070345	yes	LIVER
chr1_1325753_G_T_b38	ATAD3C	4.164	5e-05	0.308351	3	0.074048	yes	LIVER
chr1_1316929_A_T_b38	ATAD3C	4.156	5.16e-05	0.279587	6	0.067269	yes	LIVER
chr1_1445187_T_G_b38	ATAD3C	4.115	6.07e-05	0.267436	16	0.064991	yes	LIVER
chr1_1368177_G_C_b38	ATAD3C	4.092	6.63e-05	0.281994	7	0.068907	yes	LIVER
chr1_1363688_C_T_b38	ATAD3C	4.092	6.65e-05	0.279617	6	0.06834	yes	LIVER
chr1_1364099_CCA_C_b38	ATAD3C	4.092	6.65e-05	0.279617	6	0.06834	yes	LIVER
chr1_1364102_TGTTG_T_b38	ATAD3C	4.092	6.65e-05	0.279617	6	0.06834	yes	LIVER
chr1_1368763_G_A_b38	ATAD3C	4.092	6.65e-05	0.279617	6	0.06834	yes	LIVER
chr1_1471992_T_C_b38	ATAD3C	4.063	7.44e-05	0.262805	21	0.064683	yes	LIVER
chr1_1366681_T_TGA_b38	ATAD3C	4.06	7.54e-05	0.281866	6	0.069432	yes	LIVER
chr1_1366511_GGTGA_G_b38	ATAD3C	4.048	7.88e-05	0.277064	6	0.068442	yes	LIVER
chr1_1432355_G_A_b38	ATAD3C	4.026	8.6e-05	0.266072	7	0.066092	yes	LIVER
chr1_1363898_C_T_b38	ATAD3C	-4.001	9.46e-05	-0.258851	7	0.064697	yes	LIVER
chr1_1366529_TTAG_T_b38	ATAD3C	-4.001	9.46e-05	-0.258851	7	0.064697	yes	LIVER
chr1_1367292_A_AGT_b38	ATAD3C	-4.001	9.46e-05	-0.258851	7	0.064697	yes	LIVER
chr1_1329973_GCGTGTGCCATGCA_G_b38	ATAD3C	3.997	9.62e-05	0.280695	6	0.070232	yes	LIVER
chr1_1456217_T_C_b38	ATAD3C	3.988	9.95e-05	0.277459	18	0.069577	yes	LIVER
chr1_1370113_A_G_b38	ATAD3C	-3.983	0.000101	-0.249886	14	0.062737	yes	LIVER
chr1_1363986_C_T_b38	ATAD3C	-3.974	0.000105	-0.25853	7	0.065048	yes	LIVER
chr1_1366776_G_GAATT_b38	ATAD3C	3.971	0.000106	0.277519	6	0.069878	yes	LIVER
chr1_1358384_G_C_b38	ATAD3C	-3.954	0.000113	-0.253105	21	0.06401	yes	LIVER
chr1_1366561_AGT_A_b38	ATAD3C	-3.953	0.000114	-0.251426	20	0.063598	yes	LIVER
chr1_1376162_G_C_b38	ATAD3C	-3.949	0.000115	-0.254159	15	0.064357	yes	LIVER
chr1_1377431_C_T_b38	ATAD3C	-3.949	0.000115	-0.254159	15	0.064357	yes	LIVER
chr1_1439805_G_C_b38	ATAD3C	3.924	0.000127	0.268476	6	0.068413	yes	LIVER
chr1_1378204_G_C_b38	ATAD3C	-3.921	0.000129	-0.254819	14	0.064996	yes	LIVER
chr1_1365036_T_TAA_b38	ATAD3C	3.899	0.00014	0.266217	5	0.068282	yes	LIVER
chr1_1379091_T_G_b38	ATAD3C	-3.89	0.000144	-0.260153	7	0.066872	yes	LIVER
chr1_1366427_AGTGTGATTGAATGAGT_A_b38	ATAD3C	-3.885	0.000147	-0.246722	16	0.063498	yes	LIVER
chr1_1447108_A_ATT_b38	ATAD3C	3.872	0.000155	0.262159	9	0.067713	yes	LIVER
chr1_1440834_C_G_b38	ATAD3C	3.857	0.000163	0.245021	17	0.063521	yes	LIVER
chr1_1365566_G_A_b38	ATAD3C	-3.852	0.000167	-0.250252	7	0.064971	yes	LIVER
chr1_1443457_T_C_b38	ATAD3C	3.772	0.000224	0.244087	18	0.064708	yes	LIVER
chr1_1313807_G_A_b38	ATAD3C	-3.725	0.000266	-0.228981	23	0.061464	yes	LIVER
chr1_1361679_G_A_b38	ATAD3C	-3.703	0.000289	-0.232047	14	0.062665	yes	LIVER
chr1_2205125_C_A_b38	ATAD3C	3.701	0.000291	0.180801	25	0.048851	yes	LIVER
chr1_1379083_AT_A_b38	ATAD3C	-3.696	0.000296	-0.236566	9	0.063998	yes	LIVER
chr1_1337898_A_G_b38	ATAD3C	-3.663	0.000334	-0.245617	6	0.067048	yes	LIVER
chr1_1366835_G_GGTGA_b38	ATAD3C	3.607	0.000408	0.285922	4	0.07926	yes	LIVER
chr1_1439454_A_G_b38	ATAD3C	3.603	0.000414	0.222602	15	0.061776	yes	LIVER
chr1_1366830_G_A_b38	ATAD3C	3.599	0.00042	0.287899	4	0.079987	yes	LIVER
chr1_1309988_G_A_b38	ATAD3C	-3.597	0.000423	-0.222385	23	0.061823	yes	LIVER
chr1_1312114_T_C_b38	ATAD3C	-3.597	0.000423	-0.222385	23	0.061823	yes	LIVER
chr1_1330125_G_A_b38	ATAD3C	-3.559	0.000485	-0.225841	22	0.063461	yes	LIVER
chr1_1366828_A_G_b38	ATAD3C	3.542	0.000515	0.282348	4	0.079719	yes	LIVER
chr1_1375678_TA_T_b38	ATAD3C	-3.537	0.000524	-0.231826	9	0.065538	yes	LIVER
chr1_1308516_C_T_b38	ATAD3C	-3.532	0.000534	-0.213823	24	0.060542	yes	LIVER
chr1_1363456_CAG_C_b38	ATAD3C	-3.426	0.000772	-0.202594	13	0.059141	yes	LIVER
chr1_1497605_G_C_b38	ATAD3C	3.31	0.00114	0.203102	20	0.061366	yes	LIVER
chr1_1370553_CAAA_C_b38	ATAD3C	3.248	0.00141	0.237925	5	0.073261	yes	LIVER
chr1_1375678_TAA_T_b38	ATAD3C	3.236	0.00146	0.210525	5	0.065055	yes	LIVER
chr1_1440430_C_G_b38	ATAD3C	3.22	0.00154	0.211442	10	0.065661	yes	LIVER
chr1_1518621_A_AC_b38	ATAD3C	3.121	0.00212	0.226059	5	0.072431	yes	LIVER
chr1_1551454_C_A_b38	ATAD3C	3.102	0.00226	0.161103	52	0.051935	yes	LIVER
chr1_1030889_ATGTGTGTGTGTGCAGTGCATGGTGCTGTGAGATCAGCG_A_b38	ATAD3C	3.015	0.00297	0.283654	3	0.094066	yes	LIVER
chr1_1290579_C_G_b38	ATAD3C	2.961	0.00351	0.186234	19	0.062891	yes	LIVER
chr1_1690745_G_GA_b38	ATAD3C	2.833	0.00518	0.289658	3	0.102253	yes	LIVER
chr1_2414660_C_G_b38	ATAD3C	2.801	0.0057	0.167067	9	0.059655	yes	LIVER
chr1_1517993_A_G_b38	ATAD3C	2.793	0.00583	0.16925	27	0.060593	yes	LIVER
chr1_1519934_T_G_b38	ATAD3C	2.793	0.00583	0.16925	27	0.060593	yes	LIVER
chr1_1519938_T_C_b38	ATAD3C	2.793	0.00583	0.16925	27	0.060593	yes	LIVER
chr1_2101935_G_A_b38	ATAD3C	2.764	0.00636	0.141284	48	0.05112	yes	LIVER
chr1_1560765_T_C_b38	ATAD3C	2.756	0.00649	0.154089	24	0.055901	yes	LIVER
chr1_1562261_TTTTC_T_b38	ATAD3C	2.756	0.00649	0.154089	24	0.055901	yes	LIVER
chr1_1574032_AAAG_A_b38	ATAD3C	2.732	0.00697	0.170579	15	0.062434	yes	LIVER
chr1_2421646_A_G_b38	ATAD3C	2.682	0.00806	0.144004	18	0.0537	yes	LIVER
chr1_1497606_C_G_b38	ATAD3C	2.671	0.00831	0.185184	6	0.069331	yes	LIVER
chr1_2205111_GC_G_b38	ATAD3C	3.582	0.000447	0.1764	24	0.049244	no	LIVER
chr1_2160238_CGTGT_C_b38	ATAD3C	3.297	0.00119	0.191592	8	0.058106	no	LIVER
chr1_2051721_C_A_b38	ATAD3C	2.987	0.00324	0.152661	16	0.05111	no	LIVER
chr1_2137275_G_A_b38	ATAD3C	2.811	0.00553	0.166685	9	0.0593	no	LIVER
chr1_2148243_A_G_b38	ATAD3C	2.731	0.007	0.16038	9	0.058734	no	LIVER
chr1_2119213_C_CT_b38	ATAD3C	2.7	0.00764	0.159206	14	0.058961	no	LIVER
chr1_2158087_G_A_b38	ATAD3C	2.651	0.00879	0.146297	16	0.055181	no	LIVER
chr1_1468592_C_CG_b38	ATAD3C	7.59	1.9e-13	0.182882	18	0.024094	yes	LUNG
chr1_1472158_C_G_b38	ATAD3C	7.147	3.66e-12	0.181779	15	0.025434	yes	LUNG
chr1_1468048_A_G_b38	ATAD3C	7.146	3.68e-12	0.175566	21	0.024568	yes	LUNG
chr1_1468094_G_C_b38	ATAD3C	7.139	3.88e-12	0.176975	15	0.024792	yes	LUNG
chr1_1468856_C_T_b38	ATAD3C	6.987	1.03e-11	0.170724	16	0.024433	yes	LUNG
chr1_1486611_G_A_b38	ATAD3C	6.659	8.17e-11	0.151354	18	0.022729	yes	LUNG
chr1_1481959_C_T_b38	ATAD3C	6.61	1.11e-10	0.146654	22	0.022188	yes	LUNG
chr1_1485282_A_G_b38	ATAD3C	6.287	7.73e-10	0.207171	9	0.03295	yes	LUNG
chr1_1473089_T_C_b38	ATAD3C	6.229	1.09e-09	0.135375	33	0.021734	yes	LUNG
chr1_1471144_G_C_b38	ATAD3C	6.191	1.36e-09	0.15582	31	0.025168	yes	LUNG
chr1_1483898_G_A_b38	ATAD3C	6.02	3.65e-09	0.133006	34	0.022094	yes	LUNG
chr1_1486151_C_A_b38	ATAD3C	6.02	3.65e-09	0.133006	34	0.022094	yes	LUNG
chr1_1470034_T_C_b38	ATAD3C	5.934	5.97e-09	0.14858	31	0.02504	yes	LUNG
chr1_1482624_T_C_b38	ATAD3C	5.926	6.25e-09	0.129417	34	0.02184	yes	LUNG
chr1_1469429_A_G_b38	ATAD3C	5.888	7.72e-09	0.146676	31	0.024911	yes	LUNG
chr1_1490320_T_C_b38	ATAD3C	5.869	8.59e-09	0.129332	33	0.022037	yes	LUNG
chr1_1492619_A_AC_b38	ATAD3C	5.869	8.59e-09	0.129332	33	0.022037	yes	LUNG
chr1_1488652_A_G_b38	ATAD3C	5.823	1.11e-08	0.128502	34	0.022069	yes	LUNG
chr1_1492292_C_G_b38	ATAD3C	5.823	1.11e-08	0.128502	34	0.022069	yes	LUNG
chr1_1492850_G_A_b38	ATAD3C	5.823	1.11e-08	0.128502	34	0.022069	yes	LUNG
chr1_1460021_C_CTG_b38	ATAD3C	5.821	1.12e-08	0.141173	22	0.024252	yes	LUNG
chr1_1460022_CAG_C_b38	ATAD3C	5.821	1.12e-08	0.141173	22	0.024252	yes	LUNG
chr1_1476515_AT_A_b38	ATAD3C	5.785	1.37e-08	0.131096	3	0.022661	yes	LUNG
chr1_1461767_A_G_b38	ATAD3C	5.676	2.5e-08	0.1808	10	0.031855	yes	LUNG
chr1_1461719_G_A_b38	ATAD3C	5.646	2.93e-08	0.198453	6	0.035149	yes	LUNG
chr1_1490027_A_G_b38	ATAD3C	5.474	7.35e-08	0.120975	28	0.022098	yes	LUNG
chr1_1490032_A_G_b38	ATAD3C	5.474	7.35e-08	0.120975	28	0.022098	yes	LUNG
chr1_1461760_C_A_b38	ATAD3C	5.382	1.19e-07	0.167979	10	0.031211	yes	LUNG
chr1_1469088_T_C_b38	ATAD3C	5.255	2.3e-07	0.126005	27	0.023978	yes	LUNG
chr1_1459004_T_C_b38	ATAD3C	4.96	1e-06	0.140872	24	0.0284	yes	LUNG
chr1_1461621_T_TCTCCTCATGAGACCCCCATGTCGGAATTCGAAGGAGAGG_b38	ATAD3C	4.928	1.18e-06	0.136276	14	0.027654	yes	LUNG
chr1_1460858_G_T_b38	ATAD3C	4.807	2.1e-06	0.183722	4	0.038222	yes	LUNG
chr1_1460958_G_A_b38	ATAD3C	4.807	2.1e-06	0.183722	4	0.038222	yes	LUNG
chr1_1474201_CT_C_b38	ATAD3C	4.659	4.21e-06	0.096406	31	0.020694	yes	LUNG
chr1_1459799_T_G_b38	ATAD3C	4.655	4.29e-06	0.178933	4	0.038439	yes	LUNG
chr1_1459658_G_A_b38	ATAD3C	4.573	6.25e-06	0.124787	30	0.027289	yes	LUNG
chr1_1458730_G_GTT_b38	ATAD3C	4.567	6.42e-06	0.168563	5	0.036911	yes	LUNG
chr1_1459632_T_C_b38	ATAD3C	4.515	8.13e-06	0.117563	25	0.02604	yes	LUNG
chr1_1461283_A_G_b38	ATAD3C	4.502	8.6e-06	0.167024	5	0.037098	yes	LUNG
chr1_1461362_AT_A_b38	ATAD3C	4.502	8.6e-06	0.167024	5	0.037098	yes	LUNG
chr1_1476079_T_C_b38	ATAD3C	4.413	1.28e-05	0.098441	31	0.022306	yes	LUNG
chr1_1459273_T_C_b38	ATAD3C	4.357	1.64e-05	0.150498	7	0.034541	yes	LUNG
chr1_1459283_AC_A_b38	ATAD3C	4.357	1.64e-05	0.150498	7	0.034541	yes	LUNG
chr1_1459662_C_T_b38	ATAD3C	4.345	1.73e-05	0.116861	27	0.026895	yes	LUNG
chr1_1482402_A_G_b38	ATAD3C	4.316	1.96e-05	0.089746	51	0.020793	yes	LUNG
chr1_1457922_T_C_b38	ATAD3C	4.276	2.33e-05	0.141613	11	0.03312	yes	LUNG
chr1_1457919_C_A_b38	ATAD3C	4.179	3.53e-05	0.141624	10	0.033893	yes	LUNG
chr1_1217733_G_A_b38	ATAD3C	-4.153	3.94e-05	-0.09193	7	0.022137	yes	LUNG
chr1_1002192_A_AT_b38	ATAD3C	3.876	0.000122	0.087649	6	0.022613	yes	LUNG
chr1_1458448_C_CT_b38	ATAD3C	3.831	0.000146	0.122189	7	0.031893	yes	LUNG
chr1_1428763_A_G_b38	ATAD3C	3.775	0.000182	0.099248	11	0.026292	yes	LUNG
chr1_1510841_C_T_b38	ATAD3C	3.441	0.000635	0.089689	4	0.026065	yes	LUNG
chr1_1502497_C_T_b38	ATAD3C	3.417	0.000691	0.087747	5	0.025678	yes	LUNG
chr1_1502220_C_CT_b38	ATAD3C	3.409	0.00071	0.087239	3	0.025587	yes	LUNG
chr1_841166_A_G_b38	ATAD3C	-3.393	0.000753	-0.056032	34	0.016514	yes	LUNG
chr1_618877_G_A_b38	ATAD3C	3.378	0.000795	0.102974	3	0.030486	yes	LUNG
chr1_1496953_T_C_b38	ATAD3C	3.359	0.000848	0.073369	33	0.021839	yes	LUNG
chr1_1499339_T_C_b38	ATAD3C	-3.299	0.00105	-0.10703	5	0.032444	yes	LUNG
chr1_921096_A_G_b38	ATAD3C	3.196	0.00149	0.047042	86	0.014718	yes	LUNG
chr1_1756389_C_T_b38	ATAD3C	3.178	0.00159	0.130505	4	0.041066	yes	LUNG
chr1_2175324_A_G_b38	ATAD3C	3.166	0.00165	0.149497	4	0.047212	yes	LUNG
chr1_1479334_A_G_b38	ATAD3C	3.123	0.00191	0.084423	31	0.027032	yes	LUNG
chr1_2082757_G_A_b38	ATAD3C	-3.122	0.00191	-0.050915	39	0.016308	yes	LUNG
chr1_1479205_A_C_b38	ATAD3C	3.113	0.00197	0.074375	18	0.023893	yes	LUNG
chr1_1004716_C_T_b38	ATAD3C	-3.106	0.00202	-0.045021	120	0.014493	yes	LUNG
chr1_1509914_T_TAA_b38	ATAD3C	3.07	0.00227	0.092309	3	0.030067	yes	LUNG
chr1_1426175_T_C_b38	ATAD3C	3.038	0.00252	0.079314	12	0.026104	yes	LUNG
chr1_1231710_CCCCCGGGAA_C_b38	ATAD3C	-3	0.00285	-0.064215	10	0.021404	yes	LUNG
chr1_1009184_T_C_b38	ATAD3C	2.973	0.0031	0.043253	80	0.014546	yes	LUNG
chr1_982260_G_A_b38	ATAD3C	2.927	0.0036	0.052158	24	0.017819	yes	LUNG
chr1_982858_C_G_b38	ATAD3C	2.927	0.0036	0.052158	24	0.017819	yes	LUNG
chr1_1537805_T_G_b38	ATAD3C	2.921	0.00367	0.126001	5	0.043136	yes	LUNG
chr1_1005757_AGCCCCCGCAGCAGT_A_b38	ATAD3C	-2.899	0.00393	-0.041735	114	0.014395	yes	LUNG
chr1_1005429_C_CA_b38	ATAD3C	2.897	0.00396	0.042009	79	0.014502	yes	LUNG
chr1_1235602_C_A_b38	ATAD3C	-2.888	0.00406	-0.063874	7	0.022115	yes	LUNG
chr1_1005904_C_T_b38	ATAD3C	2.879	0.00418	0.041981	78	0.014582	yes	LUNG
chr1_2220368_G_C_b38	ATAD3C	2.87	0.00429	0.05857	15	0.020404	yes	LUNG
chr1_1547630_G_A_b38	ATAD3C	-2.838	0.00475	-0.043714	74	0.015406	yes	LUNG
chr1_1236303_A_G_b38	ATAD3C	-2.832	0.00484	-0.059895	10	0.021149	yes	LUNG
chr1_960891_C_T_b38	ATAD3C	-2.828	0.00489	-0.04169	117	0.014741	yes	LUNG
chr1_1014228_G_A_b38	ATAD3C	2.815	0.00509	0.040632	83	0.014433	yes	LUNG
chr1_1005954_G_A_b38	ATAD3C	2.797	0.00537	0.040831	78	0.014596	yes	LUNG
chr1_861347_G_T_b38	ATAD3C	-2.797	0.00537	-0.056578	6	0.020225	yes	LUNG
chr1_1016623_G_A_b38	ATAD3C	2.778	0.0057	0.041039	74	0.014773	yes	LUNG
chr1_2086055_CT_C_b38	ATAD3C	2.764	0.00594	0.048581	22	0.017575	yes	LUNG
chr1_917495_C_T_b38	ATAD3C	-2.761	0.00601	-0.03987	100	0.014443	yes	LUNG
chr1_918574_C_A_b38	ATAD3C	-2.761	0.00601	-0.03987	100	0.014443	yes	LUNG
chr1_1020217_G_T_b38	ATAD3C	2.758	0.00606	0.041098	56	0.014903	yes	LUNG
chr1_1016184_A_G_b38	ATAD3C	2.749	0.00621	0.040202	81	0.014622	yes	LUNG
chr1_986280_C_T_b38	ATAD3C	2.748	0.00624	0.049103	24	0.017868	yes	LUNG
chr1_1595740_G_GAGAGAGAC_b38	ATAD3C	-2.745	0.00629	-0.051419	25	0.018731	yes	LUNG
chr1_1595772_CACAGAG_C_b38	ATAD3C	-2.74	0.00639	-0.049937	25	0.018226	yes	LUNG
chr1_807641_T_C_b38	ATAD3C	2.736	0.00646	0.046496	31	0.016992	yes	LUNG
chr1_791544_TGAATG_T_b38	ATAD3C	-2.718	0.00682	-0.057605	8	0.021194	yes	LUNG
chr1_1312208_G_T_b38	ATAD3C	-2.687	0.00749	-0.094772	6	0.035276	yes	LUNG
chr1_1023525_A_G_b38	ATAD3C	2.686	0.00751	0.039162	66	0.014582	yes	LUNG
chr1_996254_A_AGGGAGGGCAG_b38	ATAD3C	2.668	0.0079	0.047875	24	0.017941	yes	LUNG
chr1_995371_C_G_b38	ATAD3C	2.657	0.00816	0.038206	79	0.014377	yes	LUNG
chr1_986629_G_A_b38	ATAD3C	2.644	0.00848	0.047508	24	0.017968	yes	LUNG
chr1_1008588_C_T_b38	ATAD3C	-2.624	0.009	-0.038675	134	0.01474	yes	LUNG
chr1_1017048_G_A_b38	ATAD3C	-2.6	0.00962	-0.038272	134	0.014717	yes	LUNG
chr1_1489916_C_T_b38	ATAD3C	6.472	2.57e-10	0.143833	17	0.022224	no	LUNG
chr1_1469469_G_C_b38	ATAD3C	5.9	7.22e-09	0.199156	5	0.033755	no	LUNG
chr1_1495204_T_C_b38	ATAD3C	5.726	1.9e-08	0.125912	26	0.02199	no	LUNG
chr1_1476266_T_C_b38	ATAD3C	5.72	1.96e-08	0.123866	35	0.021656	no	LUNG
chr1_1468254_T_A_b38	ATAD3C	5.537	5.28e-08	0.184984	5	0.033409	no	LUNG
chr1_1487887_A_G_b38	ATAD3C	5.497	6.51e-08	0.12143	34	0.022089	no	LUNG
chr1_1468062_A_T_b38	ATAD3C	5.463	7.82e-08	0.178755	7	0.032721	no	LUNG
chr1_1486354_G_C_b38	ATAD3C	4.985	8.88e-07	0.187225	5	0.037555	no	LUNG
chr1_1479683_T_G_b38	ATAD3C	4.823	1.95e-06	0.138221	31	0.028659	no	LUNG
chr1_1480096_G_C_b38	ATAD3C	4.823	1.95e-06	0.138221	31	0.028659	no	LUNG
chr1_1479324_C_G_b38	ATAD3C	4.696	3.54e-06	0.173823	6	0.037015	no	LUNG
chr1_1495236_T_C_b38	ATAD3C	4.568	6.39e-06	0.168546	5	0.036899	no	LUNG
chr1_1490046_G_A_b38	ATAD3C	4.482	9.42e-06	0.114704	5	0.025591	no	LUNG
chr1_1490047_A_G_b38	ATAD3C	4.482	9.42e-06	0.114704	5	0.025591	no	LUNG
chr1_1495327_C_T_b38	ATAD3C	4.442	1.13e-05	0.163195	5	0.03674	no	LUNG
chr1_1477850_C_G_b38	ATAD3C	4.422	1.23e-05	0.174464	4	0.039452	no	LUNG
chr1_1477855_G_C_b38	ATAD3C	4.422	1.23e-05	0.174464	4	0.039452	no	LUNG
chr1_1495205_G_A_b38	ATAD3C	4.306	2.05e-05	0.147676	6	0.034299	no	LUNG
chr1_1485510_G_A_b38	ATAD3C	4.274	2.35e-05	0.127979	3	0.029942	no	LUNG
chr1_1494105_G_A_b38	ATAD3C	4.274	2.35e-05	0.157354	5	0.03682	no	LUNG
chr1_1459357_C_A_b38	ATAD3C	4.249	2.62e-05	0.144276	9	0.033955	no	LUNG
chr1_1460370_T_C_b38	ATAD3C	4.249	2.62e-05	0.144276	9	0.033955	no	LUNG
chr1_1461195_T_TC_b38	ATAD3C	4.203	3.19e-05	0.138315	9	0.032912	no	LUNG
chr1_1459391_A_G_b38	ATAD3C	4.184	3.45e-05	0.14279	9	0.034124	no	LUNG
chr1_1477677_TTTTTA_T_b38	ATAD3C	4.153	3.93e-05	0.152398	6	0.036695	no	LUNG
chr1_1473170_C_T_b38	ATAD3C	4.141	4.14e-05	0.123399	3	0.029801	no	LUNG
chr1_1495221_G_A_b38	ATAD3C	4.105	4.82e-05	0.132614	9	0.032308	no	LUNG
chr1_1495222_T_G_b38	ATAD3C	4.105	4.82e-05	0.132614	9	0.032308	no	LUNG
chr1_1497105_T_G_b38	ATAD3C	3.951	9.03e-05	0.104609	3	0.026473	no	LUNG
chr1_1494616_G_A_b38	ATAD3C	3.938	9.56e-05	0.114969	3	0.029198	no	LUNG
chr1_1009470_A_T_b38	ATAD3C	3.624	0.000324	0.11038	4	0.03046	no	LUNG
chr1_978953_C_G_b38	ATAD3C	-3.603	0.00035	-0.049672	115	0.013785	no	LUNG
chr1_983193_A_G_b38	ATAD3C	-3.493	0.000526	-0.048638	119	0.013925	no	LUNG
chr1_1510122_G_C_b38	ATAD3C	3.443	0.000631	0.089595	4	0.026025	no	LUNG
chr1_1518689_A_ACC_b38	ATAD3C	3.414	0.000699	0.087326	3	0.02558	no	LUNG
chr1_981454_G_A_b38	ATAD3C	-3.393	0.000753	-0.047127	118	0.01389	no	LUNG
chr1_1020947_C_T_b38	ATAD3C	3.371	0.000815	0.100769	4	0.029895	no	LUNG
chr1_1531589_C_T_b38	ATAD3C	3.363	0.000837	0.077846	8	0.023146	no	LUNG
chr1_1716919_CTTT_C_b38	ATAD3C	-3.355	0.000862	-0.142819	5	0.04257	no	LUNG
chr1_1022518_G_T_b38	ATAD3C	3.301	0.00104	0.047939	64	0.014521	no	LUNG
chr1_1022868_A_G_b38	ATAD3C	3.232	0.00132	0.047356	68	0.014654	no	LUNG
chr1_978509_G_A_b38	ATAD3C	-3.23	0.00133	-0.044609	123	0.013812	no	LUNG
chr1_791564_C_CGAATG_b38	ATAD3C	-3.209	0.00143	-0.098828	3	0.030795	no	LUNG
chr1_1006159_C_T_b38	ATAD3C	3.201	0.00147	0.046248	87	0.014448	no	LUNG
chr1_1747690_A_G_b38	ATAD3C	3.15	0.00174	0.126736	6	0.040235	no	LUNG
chr1_1634405_CCGG_C_b38	ATAD3C	3.149	0.00175	0.135615	4	0.04306	no	LUNG
chr1_791564_C_G_b38	ATAD3C	3.127	0.00188	0.05528	53	0.017681	no	LUNG
chr1_1578879_A_T_b38	ATAD3C	-3.114	0.00196	-0.093316	4	0.029963	no	LUNG
chr1_1004625_A_G_b38	ATAD3C	3.106	0.00202	0.045103	85	0.014523	no	LUNG
chr1_979472_G_C_b38	ATAD3C	-3.074	0.00224	-0.042535	123	0.013836	no	LUNG
chr1_1008307_G_C_b38	ATAD3C	2.994	0.0029	0.043405	81	0.014496	no	LUNG
chr1_979560_T_C_b38	ATAD3C	-2.99	0.00295	-0.041654	130	0.013933	no	LUNG
chr1_995982_G_A_b38	ATAD3C	2.972	0.00312	0.042496	81	0.014298	no	LUNG
chr1_983004_G_T_b38	ATAD3C	-2.963	0.00321	-0.041601	138	0.014039	no	LUNG
chr1_1741174_TTCA_T_b38	ATAD3C	2.933	0.00353	0.125664	3	0.042842	no	LUNG
chr1_1741497_G_A_b38	ATAD3C	2.933	0.00353	0.125664	3	0.042842	no	LUNG
chr1_1726649_G_A_b38	ATAD3C	2.892	0.00402	0.122423	4	0.042337	no	LUNG
chr1_1865951_T_A_b38	ATAD3C	2.884	0.00412	0.050373	23	0.017469	no	LUNG
chr1_1740869_C_T_b38	ATAD3C	2.881	0.00416	0.123258	3	0.042787	no	LUNG
chr1_1034279_G_A_b38	ATAD3C	2.851	0.00456	0.045073	43	0.015809	no	LUNG
chr1_1021740_G_C_b38	ATAD3C	2.839	0.00473	0.042449	54	0.014952	no	LUNG
chr1_1018652_C_G_b38	ATAD3C	2.839	0.00474	0.042362	55	0.014924	no	LUNG
chr1_592666_T_C_b38	ATAD3C	2.832	0.00484	0.133591	3	0.047179	no	LUNG
chr1_939779_AGCCAGTGGACGCCGACCT_A_b38	ATAD3C	-2.828	0.00489	-0.040881	108	0.014455	no	LUNG
chr1_1018754_G_A_b38	ATAD3C	2.814	0.00511	0.042163	54	0.014983	no	LUNG
chr1_1480990_T_C_b38	ATAD3C	2.812	0.00515	0.061103	39	0.021731	no	LUNG
chr1_973693_C_T_b38	ATAD3C	-2.806	0.00523	-0.040842	77	0.014553	no	LUNG
chr1_981169_A_G_b38	ATAD3C	-2.767	0.00589	-0.045066	40	0.016284	no	LUNG
chr1_1235349_G_A_b38	ATAD3C	-2.722	0.00675	-0.104139	3	0.038264	no	LUNG
chr1_1029365_A_ATCTATGCAGGCAGGTGGGGGGATCAGTG_b38	ATAD3C	2.722	0.00675	0.043639	38	0.016035	no	LUNG
chr1_599349_C_T_b38	ATAD3C	-2.72	0.00679	-0.123602	3	0.045448	no	LUNG
chr1_2213790_GCCCGAGCGGGGGGGTGACTGTC_G_b38	ATAD3C	2.698	0.00724	0.064697	4	0.02398	no	LUNG
chr1_1819705_AT_A_b38	ATAD3C	2.69	0.00742	0.056922	19	0.021162	no	LUNG
chr1_1000335_C_T_b38	ATAD3C	2.689	0.00743	0.047708	25	0.01774	no	LUNG
chr1_1454676_T_A_b38	ATAD3C	2.687	0.00747	0.10023	5	0.037296	no	LUNG
chr1_1025561_G_C_b38	ATAD3C	2.674	0.00778	0.04099	52	0.01533	no	LUNG
chr1_1234105_G_A_b38	ATAD3C	-2.664	0.00801	-0.101453	3	0.03809	no	LUNG
chr1_1783572_C_A_b38	ATAD3C	2.636	0.00867	0.045885	24	0.017404	no	LUNG
chr1_1869595_G_A_b38	ATAD3C	2.613	0.00929	0.045912	24	0.017572	no	LUNG
chr1_1023351_A_G_b38	ATAD3C	2.608	0.00941	0.038081	65	0.0146	no	LUNG
chr1_1032846_C_A_b38	ATAD3C	2.606	0.00947	0.040389	51	0.015498	no	LUNG
chr1_633887_G_A_b38	ATAD3C	2.593	0.00982	0.049454	24	0.019071	no	LUNG
chr1_1433374_T_C_b38	ATAD3C	-4.249	4.32e-05	-0.159654	18	0.037577	yes	SLVRYG
chr1_1436079_A_G_b38	ATAD3C	-3.962	0.000128	-0.148793	18	0.037559	yes	SLVRYG
chr1_1438102_G_C_b38	ATAD3C	-3.886	0.000169	-0.160738	5	0.041362	yes	SLVRYG
chr1_1443457_T_C_b38	ATAD3C	-3.829	0.000208	-0.15137	19	0.039533	yes	SLVRYG
chr1_1428969_T_C_b38	ATAD3C	-3.753	0.000273	-0.144399	17	0.038476	yes	SLVRYG
chr1_1440834_C_G_b38	ATAD3C	-3.716	0.00031	-0.147416	18	0.039667	yes	SLVRYG
chr1_1431014_G_A_b38	ATAD3C	-3.692	0.000338	-0.146163	6	0.039584	yes	SLVRYG
chr1_1430190_A_C_b38	ATAD3C	-3.599	0.000468	-0.139261	17	0.038696	yes	SLVRYG
chr1_1431450_A_G_b38	ATAD3C	-3.599	0.000468	-0.139261	17	0.038696	yes	SLVRYG
chr1_1431537_G_C_b38	ATAD3C	-3.599	0.000468	-0.139261	17	0.038696	yes	SLVRYG
chr1_1407232_G_C_b38	ATAD3C	-3.581	0.000498	-0.145455	6	0.040618	yes	SLVRYG
chr1_2069153_C_A_b38	ATAD3C	-3.551	0.000552	-0.138189	20	0.038914	yes	SLVRYG
chr1_1426261_C_T_b38	ATAD3C	-3.474	0.000718	-0.135138	17	0.038901	yes	SLVRYG
chr1_1426810_C_G_b38	ATAD3C	-3.474	0.000718	-0.135138	17	0.038901	yes	SLVRYG
chr1_1440430_C_G_b38	ATAD3C	-3.452	0.000774	-0.142127	10	0.041178	yes	SLVRYG
chr1_1430908_A_G_b38	ATAD3C	-3.405	0.000906	-0.131692	17	0.038681	yes	SLVRYG
chr1_1439454_A_G_b38	ATAD3C	-3.388	0.000956	-0.133447	18	0.039384	yes	SLVRYG
chr1_1436388_CA_C_b38	ATAD3C	-3.333	0.00115	-0.134571	12	0.040376	yes	SLVRYG
chr1_1447108_A_ATT_b38	ATAD3C	-3.265	0.00143	-0.137835	7	0.04221	yes	SLVRYG
chr1_1431026_CCACCCCCT_C_b38	ATAD3C	-3.264	0.00144	-0.125316	15	0.038389	yes	SLVRYG
chr1_1448915_G_A_b38	ATAD3C	-3.229	0.00161	-0.13152	13	0.040728	yes	SLVRYG
chr1_1441187_A_G_b38	ATAD3C	-3.16	0.002	-0.132987	12	0.042079	yes	SLVRYG
chr1_1238902_T_C_b38	ATAD3C	-3.092	0.00248	-0.117773	20	0.038094	yes	SLVRYG
chr1_1967961_G_A_b38	ATAD3C	3.072	0.00264	0.123115	4	0.040071	yes	SLVRYG
chr1_2093912_T_C_b38	ATAD3C	-3.06	0.00274	-0.102725	35	0.033574	yes	SLVRYG
chr1_1837255_A_AT_b38	ATAD3C	3.04	0.00292	0.128781	4	0.042369	yes	SLVRYG
chr1_2287338_A_AT_b38	ATAD3C	3.007	0.00323	0.113738	14	0.037829	yes	SLVRYG
chr1_2094964_T_C_b38	ATAD3C	-2.999	0.00331	-0.100817	35	0.03362	yes	SLVRYG
chr1_1193652_A_G_b38	ATAD3C	-2.976	0.00354	-0.15934	3	0.053543	yes	SLVRYG
chr1_1230159_G_A_b38	ATAD3C	-2.891	0.00458	-0.122197	8	0.042274	yes	SLVRYG
chr1_1432355_G_A_b38	ATAD3C	-2.878	0.00475	-0.123135	5	0.042785	yes	SLVRYG
chr1_729703_A_G_b38	ATAD3C	2.875	0.00479	0.12646	6	0.043981	yes	SLVRYG
chr1_835506_G_A_b38	ATAD3C	2.827	0.00552	0.139261	3	0.04926	yes	SLVRYG
chr1_1130879_G_C_b38	ATAD3C	-2.823	0.00559	-0.119215	5	0.04223	yes	SLVRYG
chr1_2095310_A_G_b38	ATAD3C	-2.822	0.0056	-0.094987	35	0.033657	yes	SLVRYG
chr1_833068_G_A_b38	ATAD3C	2.81	0.0058	0.134898	3	0.048001	yes	SLVRYG
chr1_834583_G_A_b38	ATAD3C	2.81	0.0058	0.134898	3	0.048001	yes	SLVRYG
chr1_2095731_A_T_b38	ATAD3C	-2.805	0.00589	-0.096085	34	0.034255	yes	SLVRYG
chr1_1365566_G_A_b38	ATAD3C	2.774	0.00643	0.115589	5	0.041662	yes	SLVRYG
chr1_2097768_T_C_b38	ATAD3C	-2.774	0.00645	-0.092827	33	0.033468	yes	SLVRYG
chr1_907538_T_TA_b38	ATAD3C	-2.747	0.00696	-0.102459	13	0.037303	yes	SLVRYG
chr1_1439805_G_C_b38	ATAD3C	-2.744	0.00702	-0.111738	8	0.040722	yes	SLVRYG
chr1_1453870_A_C_b38	ATAD3C	-2.737	0.00715	-0.122549	5	0.044769	yes	SLVRYG
chr1_1453961_C_T_b38	ATAD3C	-2.737	0.00715	-0.122549	5	0.044769	yes	SLVRYG
chr1_1457033_A_C_b38	ATAD3C	-2.724	0.00742	-0.109791	8	0.040299	yes	SLVRYG
chr1_1363986_C_T_b38	ATAD3C	2.706	0.00781	0.112625	5	0.041613	yes	SLVRYG
chr1_2181022_T_C_b38	ATAD3C	-2.706	0.00781	-0.08499	36	0.031404	yes	SLVRYG
chr1_1216593_G_C_b38	ATAD3C	-2.703	0.00789	-0.117167	4	0.04335	yes	SLVRYG
chr1_2327151_A_AACAC_b38	ATAD3C	-2.697	0.00801	-0.084588	29	0.031358	yes	SLVRYG
chr1_1056344_C_T_b38	ATAD3C	-2.687	0.00826	-0.111238	9	0.041403	yes	SLVRYG
chr1_1367292_A_AGT_b38	ATAD3C	2.683	0.00834	0.112332	5	0.041864	yes	SLVRYG
chr1_2099903_T_C_b38	ATAD3C	-2.677	0.00848	-0.088615	33	0.033102	yes	SLVRYG
chr1_1962899_A_C_b38	ATAD3C	2.648	0.0092	0.113772	3	0.04296	yes	SLVRYG
chr1_1370113_A_G_b38	ATAD3C	3.458	0.000758	0.130517	15	0.037746	no	SLVRYG
chr1_1445187_T_G_b38	ATAD3C	-3.446	0.000789	-0.138326	16	0.040143	no	SLVRYG
chr1_1445240_A_G_b38	ATAD3C	-3.327	0.00117	-0.133787	18	0.040218	no	SLVRYG
chr1_1258206_AT_A_b38	ATAD3C	-3.247	0.00152	-0.137048	15	0.042212	no	SLVRYG
chr1_1402457_A_G_b38	ATAD3C	-3.08	0.00257	-0.133238	20	0.043258	no	SLVRYG
chr1_1411323_A_C_b38	ATAD3C	-3.074	0.00262	-0.131121	20	0.042648	no	SLVRYG
chr1_1379091_T_G_b38	ATAD3C	3.072	0.00264	0.138161	5	0.044979	no	SLVRYG
chr1_2079294_C_T_b38	ATAD3C	-3.048	0.00285	-0.108609	25	0.035638	no	SLVRYG
chr1_2245788_C_CTTT_b38	ATAD3C	3.021	0.00309	0.15698	5	0.051969	no	SLVRYG
chr1_1387698_A_G_b38	ATAD3C	3.015	0.00315	0.130189	20	0.043178	no	SLVRYG
chr1_1221049_C_G_b38	ATAD3C	-3.011	0.00318	-0.11587	20	0.038481	no	SLVRYG
chr1_899024_C_CT_b38	ATAD3C	-3.001	0.00329	-0.127207	5	0.042394	no	SLVRYG
chr1_1395346_A_G_b38	ATAD3C	-2.957	0.00375	-0.127933	19	0.043266	no	SLVRYG
chr1_1259424_T_C_b38	ATAD3C	-2.951	0.00382	-0.12826	18	0.043466	no	SLVRYG
chr1_2076945_T_C_b38	ATAD3C	-2.95	0.00384	-0.107429	28	0.036421	no	SLVRYG
chr1_2077003_T_C_b38	ATAD3C	-2.95	0.00384	-0.107429	28	0.036421	no	SLVRYG
chr1_2077297_G_T_b38	ATAD3C	-2.95	0.00384	-0.107429	28	0.036421	no	SLVRYG
chr1_2079902_A_G_b38	ATAD3C	-2.95	0.00384	-0.107429	28	0.036421	no	SLVRYG
chr1_2080519_A_G_b38	ATAD3C	-2.95	0.00384	-0.107429	28	0.036421	no	SLVRYG
chr1_2080979_A_G_b38	ATAD3C	-2.95	0.00384	-0.107429	28	0.036421	no	SLVRYG
chr1_1382893_G_A_b38	ATAD3C	-2.939	0.00397	-0.136129	3	0.046323	no	SLVRYG
chr1_1217251_C_A_b38	ATAD3C	-2.925	0.00413	-0.137956	3	0.047157	no	SLVRYG
chr1_1394423_A_G_b38	ATAD3C	-2.889	0.00459	-0.124638	19	0.043135	no	SLVRYG
chr1_1389827_C_T_b38	ATAD3C	2.889	0.00459	0.124638	19	0.043135	no	SLVRYG
chr1_2069834_A_G_b38	ATAD3C	-2.854	0.00511	-0.104684	30	0.036685	no	SLVRYG
chr1_2070417_A_G_b38	ATAD3C	-2.854	0.00511	-0.104684	30	0.036685	no	SLVRYG
chr1_2072553_GC_G_b38	ATAD3C	-2.854	0.00511	-0.104684	30	0.036685	no	SLVRYG
chr1_2073508_T_C_b38	ATAD3C	-2.854	0.00511	-0.104684	30	0.036685	no	SLVRYG
chr1_2074669_A_G_b38	ATAD3C	-2.854	0.00511	-0.104684	30	0.036685	no	SLVRYG
chr1_2092065_T_C_b38	ATAD3C	-2.834	0.0054	-0.098705	31	0.034825	no	SLVRYG
chr1_1437955_C_G_b38	ATAD3C	-2.825	0.00556	-0.100428	11	0.035553	no	SLVRYG
chr1_2067849_T_C_b38	ATAD3C	-2.803	0.00592	-0.103602	28	0.036957	no	SLVRYG
chr1_2445627_G_C_b38	ATAD3C	2.801	0.00595	0.13817	4	0.049324	no	SLVRYG
chr1_2446086_C_T_b38	ATAD3C	2.801	0.00595	0.13817	4	0.049324	no	SLVRYG
chr1_2333737_T_C_b38	ATAD3C	-2.779	0.00635	-0.094772	16	0.034103	no	SLVRYG
chr1_2334530_T_G_b38	ATAD3C	-2.779	0.00635	-0.094772	16	0.034103	no	SLVRYG
chr1_624100_C_T_b38	ATAD3C	2.759	0.00673	0.133226	5	0.048295	no	SLVRYG
chr1_1363898_C_T_b38	ATAD3C	2.723	0.00745	0.113972	5	0.041851	no	SLVRYG
chr1_1366529_TTAG_T_b38	ATAD3C	2.723	0.00745	0.113972	5	0.041851	no	SLVRYG
chr1_2089232_C_CG_b38	ATAD3C	-2.702	0.0079	-0.09948	27	0.036813	no	SLVRYG
chr1_2089946_T_C_b38	ATAD3C	-2.702	0.0079	-0.09948	27	0.036813	no	SLVRYG
chr1_2092353_T_C_b38	ATAD3C	-2.702	0.0079	-0.09948	27	0.036813	no	SLVRYG
chr1_2092357_A_G_b38	ATAD3C	-2.702	0.0079	-0.09948	27	0.036813	no	SLVRYG
chr1_2092817_A_G_b38	ATAD3C	-2.702	0.0079	-0.09948	27	0.036813	no	SLVRYG
chr1_1435945_C_CCGGGCGGGGGCG_b38	ATAD3C	-2.691	0.00816	-0.122957	4	0.045691	no	SLVRYG
chr1_2443457_G_A_b38	ATAD3C	2.681	0.0084	0.130362	7	0.048628	no	SLVRYG
chr1_1398218_C_A_b38	ATAD3C	-2.679	0.00843	-0.126725	3	0.047295	no	SLVRYG
chr1_1400756_GGA_G_b38	ATAD3C	-2.679	0.00843	-0.126725	3	0.047295	no	SLVRYG
chr1_1401954_G_T_b38	ATAD3C	-2.679	0.00843	-0.126725	3	0.047295	no	SLVRYG
chr1_1403593_A_G_b38	ATAD3C	-2.679	0.00843	-0.126725	3	0.047295	no	SLVRYG
chr1_2069856_A_C_b38	ATAD3C	-2.674	0.00856	-0.099122	31	0.03707	no	SLVRYG
chr1_1374505_A_G_b38	ATAD3C	-2.673	0.00859	-0.120344	3	0.045029	no	SLVRYG
chr1_1375642_C_T_b38	ATAD3C	-2.657	0.00898	-0.119758	3	0.045079	no	SLVRYG
chr1_1514211_A_G_b38	ATAD3C	-2.654	0.00904	-0.186705	4	0.070341	no	SLVRYG
chr1_1383743_T_C_b38	ATAD3C	-2.643	0.00933	-0.120774	3	0.045693	no	SLVRYG
chr1_2089845_T_A_b38	ATAD3C	-2.631	0.00966	-0.094619	25	0.035967	no	SLVRYG
chr1_1154630_C_A_b38	ATAD3C	-2.63	0.00968	-0.12785	4	0.048615	no	SLVRYG
chr1_1132485_A_C_b38	ATAD3C	-2.629	0.00969	-0.122746	4	0.046682	no	SLVRYG
chr1_1366561_AGT_A_b38	ATAD3C	2.619	0.00998	0.111664	19	0.042638	no	SLVRYG
chr1_1435945_C_CCGGGCGGGGGCG_b38	ATAD3C	-3.975	7.84e-05	-0.02624	22	0.006601	yes	MSCLSK
chr1_1473089_T_C_b38	ATAD3C	3.957	8.45e-05	0.028631	46	0.007235	yes	MSCLSK
chr1_1495204_T_C_b38	ATAD3C	3.892	0.00011	0.027967	38	0.007187	yes	MSCLSK
chr1_1486151_C_A_b38	ATAD3C	3.829	0.000141	0.028348	48	0.007403	yes	MSCLSK
chr1_1483898_G_A_b38	ATAD3C	3.825	0.000143	0.02839	48	0.007422	yes	MSCLSK
chr1_1476266_T_C_b38	ATAD3C	3.79	0.000165	0.027109	50	0.007152	yes	MSCLSK
chr1_1489916_C_T_b38	ATAD3C	3.79	0.000165	0.027766	25	0.007326	yes	MSCLSK
chr1_1566854_CA_C_b38	ATAD3C	-3.764	0.000183	-0.021766	71	0.005783	yes	MSCLSK
chr1_1426253_G_A_b38	ATAD3C	-3.727	0.000211	-0.025856	15	0.006937	yes	MSCLSK
chr1_1482624_T_C_b38	ATAD3C	3.721	0.000216	0.026983	49	0.007251	yes	MSCLSK
chr1_1580890_C_T_b38	ATAD3C	-3.695	0.000239	-0.02082	37	0.005635	yes	MSCLSK
chr1_1573776_A_G_b38	ATAD3C	-3.658	0.000275	-0.020476	38	0.005597	yes	MSCLSK
chr1_1488652_A_G_b38	ATAD3C	3.63	0.000307	0.026674	49	0.007349	yes	MSCLSK
chr1_1490320_T_C_b38	ATAD3C	3.63	0.000307	0.026674	49	0.007349	yes	MSCLSK
chr1_1492292_C_G_b38	ATAD3C	3.63	0.000307	0.026674	49	0.007349	yes	MSCLSK
chr1_1492850_G_A_b38	ATAD3C	3.63	0.000307	0.026674	49	0.007349	yes	MSCLSK
chr1_1571986_G_A_b38	ATAD3C	-3.621	0.000317	-0.018598	92	0.005137	yes	MSCLSK
chr1_1434687_C_G_b38	ATAD3C	-3.608	0.000333	-0.023953	21	0.006639	yes	MSCLSK
chr1_1559703_G_C_b38	ATAD3C	-3.592	0.000354	-0.01892	106	0.005268	yes	MSCLSK
chr1_1570568_AC_A_b38	ATAD3C	-3.578	0.000373	-0.019995	44	0.005588	yes	MSCLSK
chr1_1431014_G_A_b38	ATAD3C	-3.566	0.000389	-0.020387	46	0.005717	yes	MSCLSK
chr1_1545968_T_C_b38	ATAD3C	-3.562	0.000396	-0.019217	46	0.005395	yes	MSCLSK
chr1_1431656_G_A_b38	ATAD3C	-3.549	0.000415	-0.024843	17	0.006999	yes	MSCLSK
chr1_1568428_C_G_b38	ATAD3C	-3.549	0.000416	-0.018982	49	0.005349	yes	MSCLSK
chr1_1575935_T_C_b38	ATAD3C	-3.547	0.000418	-0.0189	108	0.005328	yes	MSCLSK
chr1_1568548_G_A_b38	ATAD3C	-3.542	0.000427	-0.018642	106	0.005264	yes	MSCLSK
chr1_1570587_C_T_b38	ATAD3C	-3.54	0.000429	-0.018651	106	0.005269	yes	MSCLSK
chr1_1487887_A_G_b38	ATAD3C	3.53	0.000445	0.026067	50	0.007384	yes	MSCLSK
chr1_1588701_C_T_b38	ATAD3C	3.489	0.000518	0.050406	3	0.014447	yes	MSCLSK
chr1_1551523_T_C_b38	ATAD3C	-3.477	0.000541	-0.019276	40	0.005544	yes	MSCLSK
chr1_1438102_G_C_b38	ATAD3C	-3.452	0.000594	-0.021074	34	0.006105	yes	MSCLSK
chr1_1756389_C_T_b38	ATAD3C	3.43	0.000644	0.047816	4	0.013942	yes	MSCLSK
chr1_1486611_G_A_b38	ATAD3C	3.41	0.000692	0.026215	27	0.007689	yes	MSCLSK
chr1_1560765_T_C_b38	ATAD3C	-3.407	0.000697	-0.018463	97	0.005419	yes	MSCLSK
chr1_1562261_TTTTC_T_b38	ATAD3C	-3.407	0.000697	-0.018463	97	0.005419	yes	MSCLSK
chr1_1574655_GGC_G_b38	ATAD3C	-3.401	0.000713	-0.018294	97	0.005379	yes	MSCLSK
chr1_1597451_GCTCCTC_G_b38	ATAD3C	3.383	0.000761	0.05486	3	0.016217	yes	MSCLSK
chr1_1555871_T_C_b38	ATAD3C	-3.383	0.000762	-0.018088	88	0.005347	yes	MSCLSK
chr1_1579717_T_A_b38	ATAD3C	-3.382	0.000765	-0.018616	42	0.005505	yes	MSCLSK
chr1_1432355_G_A_b38	ATAD3C	-3.368	0.000804	-0.021208	31	0.006297	yes	MSCLSK
chr1_1547630_G_A_b38	ATAD3C	-3.362	0.000819	-0.017367	107	0.005165	yes	MSCLSK
chr1_1565105_CAAGGCAGGCGGATCATG_C_b38	ATAD3C	-3.361	0.000825	-0.017628	122	0.005246	yes	MSCLSK
chr1_1474201_CT_C_b38	ATAD3C	3.352	0.000851	0.02306	46	0.006881	yes	MSCLSK
chr1_1538787_A_G_b38	ATAD3C	-3.349	0.000858	-0.017718	117	0.00529	yes	MSCLSK
chr1_1537493_T_A_b38	ATAD3C	-3.337	0.000896	-0.017575	95	0.005267	yes	MSCLSK
chr1_1565680_A_AG_b38	ATAD3C	-3.317	0.000961	-0.017264	115	0.005204	yes	MSCLSK
chr1_1569661_T_C_b38	ATAD3C	-3.309	0.000989	-0.017223	111	0.005205	yes	MSCLSK
chr1_1487487_C_CA_b38	ATAD3C	3.277	0.00111	0.031241	4	0.009533	yes	MSCLSK
chr1_1739996_G_T_b38	ATAD3C	3.272	0.00113	0.045448	4	0.013889	yes	MSCLSK
chr1_1573079_A_G_b38	ATAD3C	-3.264	0.00116	-0.01715	119	0.005254	yes	MSCLSK
chr1_1575864_G_A_b38	ATAD3C	-3.252	0.00121	-0.017652	100	0.005428	yes	MSCLSK
chr1_1440430_C_G_b38	ATAD3C	-3.238	0.00127	-0.018876	55	0.005829	yes	MSCLSK
chr1_1570294_CA_C_b38	ATAD3C	-3.208	0.00141	-0.017307	108	0.005396	yes	MSCLSK
chr1_1572532_A_C_b38	ATAD3C	-3.205	0.00142	-0.016848	120	0.005257	yes	MSCLSK
chr1_1566086_G_A_b38	ATAD3C	-3.2	0.00144	-0.016893	120	0.00528	yes	MSCLSK
chr1_1439805_G_C_b38	ATAD3C	-3.153	0.00169	-0.020005	30	0.006344	yes	MSCLSK
chr1_1549590_C_G_b38	ATAD3C	-3.15	0.00171	-0.016499	116	0.005237	yes	MSCLSK
chr1_1554781_A_G_b38	ATAD3C	-3.137	0.00178	-0.016385	116	0.005223	yes	MSCLSK
chr1_1577491_A_AC_b38	ATAD3C	-3.118	0.0019	-0.016868	111	0.00541	yes	MSCLSK
chr1_1559750_C_CAG_b38	ATAD3C	-3.108	0.00196	-0.016343	120	0.005258	yes	MSCLSK
chr1_1561628_T_C_b38	ATAD3C	-3.108	0.00196	-0.016343	120	0.005258	yes	MSCLSK
chr1_1563918_A_G_b38	ATAD3C	-3.108	0.00196	-0.016343	120	0.005258	yes	MSCLSK
chr1_1565561_A_G_b38	ATAD3C	-3.108	0.00196	-0.016343	120	0.005258	yes	MSCLSK
chr1_1567715_G_A_b38	ATAD3C	-3.108	0.00196	-0.016343	120	0.005258	yes	MSCLSK
chr1_1567719_A_C_b38	ATAD3C	-3.108	0.00196	-0.016343	120	0.005258	yes	MSCLSK
chr1_1569875_C_T_b38	ATAD3C	-3.108	0.00196	-0.016343	120	0.005258	yes	MSCLSK
chr1_1431813_G_T_b38	ATAD3C	-3.108	0.00197	-0.020072	26	0.006459	yes	MSCLSK
chr1_1554694_A_G_b38	ATAD3C	-3.106	0.00198	-0.016266	116	0.005237	yes	MSCLSK
chr1_1428969_T_C_b38	ATAD3C	-3.096	0.00205	-0.017719	86	0.005724	yes	MSCLSK
chr1_1554852_T_C_b38	ATAD3C	-3.09	0.00209	-0.01617	117	0.005232	yes	MSCLSK
chr1_1731093_G_C_b38	ATAD3C	3.087	0.00211	0.042641	4	0.013814	yes	MSCLSK
chr1_1735087_A_C_b38	ATAD3C	3.087	0.00211	0.042641	4	0.013814	yes	MSCLSK
chr1_1735286_G_A_b38	ATAD3C	3.087	0.00211	0.042641	4	0.013814	yes	MSCLSK
chr1_1553692_A_G_b38	ATAD3C	-3.081	0.00215	-0.016131	117	0.005235	yes	MSCLSK
chr1_1555247_T_A_b38	ATAD3C	-3.081	0.00215	-0.016131	117	0.005235	yes	MSCLSK
chr1_1569180_T_A_b38	ATAD3C	-3.081	0.00215	-0.016189	115	0.005255	yes	MSCLSK
chr1_2028422_G_GC_b38	ATAD3C	-3.07	0.00223	-0.017309	34	0.005637	yes	MSCLSK
chr1_1551557_A_AG_b38	ATAD3C	-3.05	0.00238	-0.016475	109	0.005402	yes	MSCLSK
chr1_1551559_A_T_b38	ATAD3C	-3.05	0.00238	-0.016475	109	0.005402	yes	MSCLSK
chr1_1445187_T_G_b38	ATAD3C	-3.036	0.00249	-0.017499	83	0.005764	yes	MSCLSK
chr1_1543953_A_G_b38	ATAD3C	-3.032	0.00253	-0.01633	106	0.005386	yes	MSCLSK
chr1_1479334_A_G_b38	ATAD3C	3.004	0.00277	0.026971	45	0.008978	yes	MSCLSK
chr1_1496953_T_C_b38	ATAD3C	3.003	0.00277	0.021799	48	0.007258	yes	MSCLSK
chr1_1740869_C_T_b38	ATAD3C	3.001	0.0028	0.042234	4	0.014074	yes	MSCLSK
chr1_1538924_C_A_b38	ATAD3C	-2.993	0.00287	-0.015821	72	0.005286	yes	MSCLSK
chr1_1574445_A_G_b38	ATAD3C	-2.984	0.00295	-0.016063	111	0.005382	yes	MSCLSK
chr1_1741174_TTCA_T_b38	ATAD3C	2.977	0.00302	0.041897	4	0.014073	yes	MSCLSK
chr1_1741497_G_A_b38	ATAD3C	2.977	0.00302	0.041897	4	0.014073	yes	MSCLSK
chr1_1575421_C_T_b38	ATAD3C	-2.967	0.00312	-0.015817	108	0.00533	yes	MSCLSK
chr1_1443457_T_C_b38	ATAD3C	-2.946	0.00334	-0.01702	89	0.005778	yes	MSCLSK
chr1_1545795_C_A_b38	ATAD3C	-2.941	0.0034	-0.015684	96	0.005334	yes	MSCLSK
chr1_1430908_A_G_b38	ATAD3C	-2.935	0.00345	-0.016791	87	0.005721	yes	MSCLSK
chr1_1542793_C_G_b38	ATAD3C	-2.925	0.00357	-0.015732	105	0.005379	yes	MSCLSK
chr1_1542800_T_C_b38	ATAD3C	-2.925	0.00357	-0.015732	105	0.005379	yes	MSCLSK
chr1_1542773_T_C_b38	ATAD3C	-2.924	0.00358	-0.015751	106	0.005387	yes	MSCLSK
chr1_1739115_T_C_b38	ATAD3C	2.923	0.00359	0.03455	14	0.01182	yes	MSCLSK
chr1_2363827_A_T_b38	ATAD3C	2.922	0.0036	0.021383	27	0.007319	yes	MSCLSK
chr1_1558726_C_CA_b38	ATAD3C	-2.904	0.00381	-0.01566	111	0.005392	yes	MSCLSK
chr1_1561821_A_C_b38	ATAD3C	-2.904	0.00381	-0.01566	111	0.005392	yes	MSCLSK
chr1_663390_T_C_b38	ATAD3C	2.901	0.00385	0.028299	3	0.009756	yes	MSCLSK
chr1_1573654_T_C_b38	ATAD3C	-2.892	0.00395	-0.0155	111	0.005359	yes	MSCLSK
chr1_1550064_GC_G_b38	ATAD3C	-2.888	0.00401	-0.015498	106	0.005367	yes	MSCLSK
chr1_1550068_C_A_b38	ATAD3C	-2.888	0.00401	-0.015498	106	0.005367	yes	MSCLSK
chr1_2026833_CA_C_b38	ATAD3C	-2.878	0.00414	-0.016315	31	0.005669	yes	MSCLSK
chr1_1575724_G_C_b38	ATAD3C	-2.864	0.00432	-0.01527	108	0.005332	yes	MSCLSK
chr1_1571794_A_AT_b38	ATAD3C	-2.839	0.00467	-0.015313	101	0.005394	yes	MSCLSK
chr1_629626_T_C_b38	ATAD3C	-2.81	0.0051	-0.027796	7	0.009891	yes	MSCLSK
chr1_1557495_CAT_C_b38	ATAD3C	-2.806	0.00518	-0.015203	111	0.005419	yes	MSCLSK
chr1_2273316_G_A_b38	ATAD3C	-2.797	0.00532	-0.014526	72	0.005193	yes	MSCLSK
chr1_1440834_C_G_b38	ATAD3C	-2.794	0.00536	-0.016075	85	0.005753	yes	MSCLSK
chr1_1433374_T_C_b38	ATAD3C	-2.789	0.00545	-0.015684	92	0.005623	yes	MSCLSK
chr1_2268730_T_C_b38	ATAD3C	-2.787	0.00548	-0.014409	73	0.00517	yes	MSCLSK
chr1_1436079_A_G_b38	ATAD3C	-2.743	0.00627	-0.015445	89	0.005631	yes	MSCLSK
chr1_789680_A_AGGAATGGAAT_b38	ATAD3C	2.73	0.00651	0.013478	86	0.004937	yes	MSCLSK
chr1_1496973_G_A_b38	ATAD3C	2.725	0.00661	0.020838	30	0.007647	yes	MSCLSK
chr1_1431026_CCACCCCCT_C_b38	ATAD3C	-2.724	0.00663	-0.016589	42	0.006091	yes	MSCLSK
chr1_599294_T_G_b38	ATAD3C	2.712	0.00687	0.035368	4	0.013042	yes	MSCLSK
chr1_690136_A_G_b38	ATAD3C	2.697	0.00719	0.035969	4	0.013338	yes	MSCLSK
chr1_1573429_C_CA_b38	ATAD3C	2.687	0.0074	0.040972	6	0.01525	yes	MSCLSK
chr1_1468856_C_T_b38	ATAD3C	2.671	0.00775	0.022043	20	0.008252	yes	MSCLSK
chr1_1523022_A_G_b38	ATAD3C	2.668	0.00782	0.020915	33	0.007838	yes	MSCLSK
chr1_1431537_G_C_b38	ATAD3C	-2.666	0.00788	-0.015285	86	0.005734	yes	MSCLSK
chr1_1513923_G_C_b38	ATAD3C	2.666	0.00788	0.016625	59	0.006237	yes	MSCLSK
chr1_1445240_A_G_b38	ATAD3C	-2.663	0.00793	-0.015415	87	0.005788	yes	MSCLSK
chr1_1431450_A_G_b38	ATAD3C	-2.647	0.00831	-0.015197	86	0.00574	yes	MSCLSK
chr1_1571434_C_CA_b38	ATAD3C	-2.629	0.00876	-0.015081	61	0.005735	yes	MSCLSK
chr1_1169204_T_C_b38	ATAD3C	2.621	0.00897	0.0302	3	0.011521	yes	MSCLSK
chr1_1394041_G_A_b38	ATAD3C	-2.621	0.00897	-0.021184	8	0.008082	yes	MSCLSK
chr1_1439454_A_G_b38	ATAD3C	-2.602	0.00948	-0.014505	80	0.005574	yes	MSCLSK
chr1_990304_T_C_b38	ATAD3C	-2.598	0.00959	-0.026079	6	0.010038	yes	MSCLSK
chr1_1492619_A_AC_b38	ATAD3C	3.649	0.000285	0.026649	50	0.007304	no	MSCLSK
chr1_1490046_G_A_b38	ATAD3C	3.649	0.000285	0.029715	6	0.008144	no	MSCLSK
chr1_1490047_A_G_b38	ATAD3C	3.649	0.000285	0.029715	6	0.008144	no	MSCLSK
chr1_1510082_T_TA_b38	ATAD3C	3.53	0.000445	0.031953	10	0.009051	no	MSCLSK
chr1_1573429_CAAAAAAAAAAAAAAAAAA_C_b38	ATAD3C	-3.518	0.000465	-0.018641	102	0.005298	no	MSCLSK
chr1_1481959_C_T_b38	ATAD3C	3.512	0.000477	0.026417	33	0.007522	no	MSCLSK
chr1_1476079_T_C_b38	ATAD3C	3.505	0.000489	0.025647	47	0.007317	no	MSCLSK
chr1_1497105_T_G_b38	ATAD3C	3.479	0.000537	0.028983	5	0.00833	no	MSCLSK
chr1_1539491_G_C_b38	ATAD3C	-3.454	0.000589	-0.018377	110	0.00532	no	MSCLSK
chr1_1554548_T_C_b38	ATAD3C	-3.448	0.000603	-0.018483	80	0.005361	no	MSCLSK
chr1_1555179_A_G_b38	ATAD3C	-3.422	0.000661	-0.018265	82	0.005337	no	MSCLSK
chr1_1442793_G_A_b38	ATAD3C	-3.42	0.000667	-0.022485	22	0.006575	no	MSCLSK
chr1_1554241_T_C_b38	ATAD3C	-3.381	0.000768	-0.018695	56	0.00553	no	MSCLSK
chr1_1490027_A_G_b38	ATAD3C	3.224	0.00133	0.023544	41	0.007304	no	MSCLSK
chr1_1490032_A_G_b38	ATAD3C	3.224	0.00133	0.023544	41	0.007304	no	MSCLSK
chr1_1497857_T_TAAAAA_b38	ATAD3C	3.215	0.00137	0.047113	5	0.014653	no	MSCLSK
chr1_1558347_G_A_b38	ATAD3C	-3.17	0.0016	-0.01731	72	0.00546	no	MSCLSK
chr1_1743602_T_C_b38	ATAD3C	3.149	0.00172	0.044599	3	0.014164	no	MSCLSK
chr1_1747690_A_G_b38	ATAD3C	3.145	0.00174	0.041046	8	0.013053	no	MSCLSK
chr1_1501403_T_C_b38	ATAD3C	3.131	0.00182	0.020287	54	0.006479	no	MSCLSK
chr1_1728274_G_C_b38	ATAD3C	3.083	0.00214	0.043841	3	0.01422	no	MSCLSK
chr1_1541864_T_C_b38	ATAD3C	-3.072	0.00222	-0.016719	109	0.005442	no	MSCLSK
chr1_1554246_C_T_b38	ATAD3C	-3.068	0.00224	-0.017017	60	0.005546	no	MSCLSK
chr1_1771973_A_AT_b38	ATAD3C	3.063	0.00228	0.019724	75	0.006439	no	MSCLSK
chr1_2325021_C_T_b38	ATAD3C	3.045	0.00242	0.03301	3	0.010841	no	MSCLSK
chr1_1554290_C_T_b38	ATAD3C	-3.044	0.00243	-0.016276	78	0.005347	no	MSCLSK
chr1_1502220_C_CT_b38	ATAD3C	3.021	0.00262	0.025347	5	0.008391	no	MSCLSK
chr1_1168009_GGGGCGGAGGGCCGAGCGGGGCCAGCAGACGGGTGA_G_b38	ATAD3C	-3.015	0.00268	-0.012548	43	0.004163	no	MSCLSK
chr1_1729403_C_T_b38	ATAD3C	3.014	0.00268	0.042868	3	0.014224	no	MSCLSK
chr1_1730099_A_G_b38	ATAD3C	3.014	0.00268	0.042868	3	0.014224	no	MSCLSK
chr1_1452797_C_CA_b38	ATAD3C	2.989	0.00291	0.038588	3	0.012911	no	MSCLSK
chr1_989249_A_G_b38	ATAD3C	-2.975	0.00304	-0.029191	7	0.009811	no	MSCLSK
chr1_1512376_G_C_b38	ATAD3C	2.94	0.0034	0.019142	54	0.006511	no	MSCLSK
chr1_1192776_CAGTGTAGACACTCCAGTTGGTATG_C_b38	ATAD3C	2.939	0.00341	0.025791	6	0.008776	no	MSCLSK
chr1_1764994_G_A_b38	ATAD3C	2.923	0.00359	0.036223	11	0.012391	no	MSCLSK
chr1_1543500_T_G_b38	ATAD3C	-2.908	0.00377	-0.01558	105	0.005358	no	MSCLSK
chr1_1511945_G_A_b38	ATAD3C	2.888	0.00401	0.018971	54	0.00657	no	MSCLSK
chr1_1482402_A_G_b38	ATAD3C	2.859	0.00438	0.019541	73	0.006834	no	MSCLSK
chr1_2334682_C_T_b38	ATAD3C	2.822	0.00493	0.029161	3	0.010335	no	MSCLSK
chr1_1612867_C_CT_b38	ATAD3C	2.819	0.00497	0.033752	3	0.011974	no	MSCLSK
chr1_1502497_C_T_b38	ATAD3C	2.798	0.00529	0.023872	5	0.008531	no	MSCLSK
chr1_1516000_T_C_b38	ATAD3C	2.773	0.00572	0.017469	59	0.0063	no	MSCLSK
chr1_1407565_C_A_b38	ATAD3C	-2.761	0.00594	-0.021594	14	0.007822	no	MSCLSK
chr1_1530331_T_C_b38	ATAD3C	2.757	0.006	0.017308	60	0.006277	no	MSCLSK
chr1_1533855_G_A_b38	ATAD3C	2.749	0.00615	0.019088	14	0.006944	no	MSCLSK
chr1_1510122_G_C_b38	ATAD3C	2.735	0.00641	0.023351	5	0.008537	no	MSCLSK
chr1_1448915_G_A_b38	ATAD3C	-2.686	0.00743	-0.015987	60	0.005953	no	MSCLSK
chr1_1349974_T_C_b38	ATAD3C	2.668	0.00783	0.051601	3	0.019342	no	MSCLSK
chr1_1380867_A_G_b38	ATAD3C	-2.668	0.00784	-0.020333	14	0.007622	no	MSCLSK
chr1_1436388_CA_C_b38	ATAD3C	-2.665	0.0079	-0.015723	59	0.0059	no	MSCLSK
chr1_1510841_C_T_b38	ATAD3C	2.659	0.00803	0.022576	5	0.00849	no	MSCLSK
chr1_1716710_G_T_b38	ATAD3C	2.642	0.00844	0.049072	3	0.018573	no	MSCLSK
chr1_989223_T_C_b38	ATAD3C	-2.641	0.00847	-0.025556	7	0.009676	no	MSCLSK
chr1_1726162_T_C_b38	ATAD3C	-2.635	0.00861	-0.012827	155	0.004867	no	MSCLSK
chr1_1623412_T_C_b38	ATAD3C	-2.59	0.00983	-0.023518	5	0.009082	no	MSCLSK
chr1_1441187_A_G_b38	ATAD3C	-2.585	0.00997	-0.015398	61	0.005957	no	MSCLSK
chr1_1443457_T_C_b38	ATAD3C	-24.435	3.34e-85	-0.520359	72	0.021295	yes	NERVET
chr1_1445187_T_G_b38	ATAD3C	-24.333	1e-84	-0.513664	67	0.02111	yes	NERVET
chr1_1440834_C_G_b38	ATAD3C	-23.426	1.63e-80	-0.506669	68	0.021629	yes	NERVET
chr1_1440430_C_G_b38	ATAD3C	-23.169	2.54e-79	-0.50144	46	0.021642	yes	NERVET
chr1_1445240_A_G_b38	ATAD3C	-23.011	1.4e-78	-0.50523	72	0.021956	yes	NERVET
chr1_1439454_A_G_b38	ATAD3C	-21.437	3.08e-71	-0.471176	64	0.021979	yes	NERVET
chr1_1436079_A_G_b38	ATAD3C	-20.664	1.26e-67	-0.46407	72	0.022458	yes	NERVET
chr1_1433374_T_C_b38	ATAD3C	-20.221	1.48e-65	-0.458578	74	0.022679	yes	NERVET
chr1_1448915_G_A_b38	ATAD3C	-19.593	1.25e-62	-0.478544	49	0.024425	yes	NERVET
chr1_1441187_A_G_b38	ATAD3C	-19.216	7.05e-61	-0.480726	49	0.025017	yes	NERVET
chr1_1436388_CA_C_b38	ATAD3C	-19.048	4.28e-60	-0.473106	46	0.024838	yes	NERVET
chr1_1449831_A_G_b38	ATAD3C	-18.394	4.57e-57	-0.485015	64	0.026368	yes	NERVET
chr1_1430908_A_G_b38	ATAD3C	-18.356	6.79e-57	-0.441473	70	0.02405	yes	NERVET
chr1_1428969_T_C_b38	ATAD3C	-18.12	8.38e-56	-0.440105	70	0.024288	yes	NERVET
chr1_1430190_A_C_b38	ATAD3C	-18.112	9.11e-56	-0.440913	70	0.024344	yes	NERVET
chr1_1431537_G_C_b38	ATAD3C	-18.106	9.68e-56	-0.439605	70	0.024279	yes	NERVET
chr1_1431450_A_G_b38	ATAD3C	-18.106	9.77e-56	-0.440412	70	0.024325	yes	NERVET
chr1_1426261_C_T_b38	ATAD3C	-17.898	8.87e-55	-0.441292	67	0.024657	yes	NERVET
chr1_1426810_C_G_b38	ATAD3C	-17.785	2.91e-54	-0.437981	68	0.024626	yes	NERVET
chr1_1438102_G_C_b38	ATAD3C	-16.986	1.32e-50	-0.45284	27	0.02666	yes	NERVET
chr1_1454770_T_C_b38	ATAD3C	-16.852	5.35e-50	-0.4521	65	0.026827	yes	NERVET
chr1_1455617_T_G_b38	ATAD3C	-16.8	9.24e-50	-0.450913	64	0.02684	yes	NERVET
chr1_1452511_A_G_b38	ATAD3C	-16.681	3.23e-49	-0.44833	63	0.026877	yes	NERVET
chr1_1452888_C_A_b38	ATAD3C	-16.681	3.23e-49	-0.44833	63	0.026877	yes	NERVET
chr1_1452909_A_C_b38	ATAD3C	-16.681	3.23e-49	-0.44833	63	0.026877	yes	NERVET
chr1_1454092_A_G_b38	ATAD3C	-16.557	1.17e-48	-0.44583	63	0.026927	yes	NERVET
chr1_1453703_A_G_b38	ATAD3C	-16.433	4.26e-48	-0.444349	63	0.02704	yes	NERVET
chr1_1454315_C_T_b38	ATAD3C	-16.382	7.24e-48	-0.443286	59	0.02706	yes	NERVET
chr1_1442793_G_A_b38	ATAD3C	-15.805	2.83e-45	-0.468908	18	0.029669	yes	NERVET
chr1_1434687_C_G_b38	ATAD3C	-15.162	2.03e-42	-0.458947	18	0.03027	yes	NERVET
chr1_1431014_G_A_b38	ATAD3C	-15.037	7.18e-42	-0.38721	40	0.02575	yes	NERVET
chr1_1449009_A_T_b38	ATAD3C	-15.021	8.47e-42	-0.444582	44	0.029597	yes	NERVET
chr1_1451787_A_C_b38	ATAD3C	-14.991	1.15e-41	-0.408507	52	0.027251	yes	NERVET
chr1_1435945_C_CCGGGCGGGGGCG_b38	ATAD3C	-14.935	2.01e-41	-0.444354	20	0.029752	yes	NERVET
chr1_1432355_G_A_b38	ATAD3C	-14.709	1.98e-40	-0.426356	25	0.028987	yes	NERVET
chr1_1431026_CCACCCCCT_C_b38	ATAD3C	-14.56	8.77e-40	-0.417357	32	0.028664	yes	NERVET
chr1_1431656_G_A_b38	ATAD3C	-14.188	3.62e-38	-0.461499	15	0.032528	yes	NERVET
chr1_1457033_A_C_b38	ATAD3C	-14.156	4.92e-38	-0.402667	30	0.028444	yes	NERVET
chr1_1426253_G_A_b38	ATAD3C	-14.123	6.85e-38	-0.461081	14	0.032647	yes	NERVET
chr1_1439805_G_C_b38	ATAD3C	-14.093	9.19e-38	-0.407089	29	0.028885	yes	NERVET
chr1_1447108_A_ATT_b38	ATAD3C	-14.087	9.75e-38	-0.402986	30	0.028606	yes	NERVET
chr1_1452825_AAAG_A_b38	ATAD3C	-14.02	1.89e-37	-0.397412	32	0.028345	yes	NERVET
chr1_1431813_G_T_b38	ATAD3C	-13.97	3.11e-37	-0.428014	20	0.030638	yes	NERVET
chr1_1453643_A_ATT_b38	ATAD3C	-13.84	1.12e-36	-0.402401	36	0.029074	yes	NERVET
chr1_1453552_G_A_b38	ATAD3C	-13.802	1.63e-36	-0.392985	32	0.028473	yes	NERVET
chr1_1455134_T_G_b38	ATAD3C	-13.802	1.63e-36	-0.392985	32	0.028473	yes	NERVET
chr1_1455337_A_G_b38	ATAD3C	-13.802	1.63e-36	-0.392985	32	0.028473	yes	NERVET
chr1_1455495_C_T_b38	ATAD3C	-13.802	1.63e-36	-0.392985	32	0.028473	yes	NERVET
chr1_1456051_C_T_b38	ATAD3C	-13.733	3.21e-36	-0.39335	31	0.028643	yes	NERVET
chr1_1455924_T_C_b38	ATAD3C	-13.699	4.48e-36	-0.392362	31	0.028643	yes	NERVET
chr1_1454848_T_C_b38	ATAD3C	-13.669	5.98e-36	-0.386914	33	0.028306	yes	NERVET
chr1_1437993_G_A_b38	ATAD3C	-13.624	9.3e-36	-0.395047	25	0.028997	yes	NERVET
chr1_1456154_G_A_b38	ATAD3C	-13.446	5.26e-35	-0.390385	31	0.029034	yes	NERVET
chr1_1471992_T_C_b38	ATAD3C	-13.381	9.85e-35	-0.370568	73	0.027693	yes	NERVET
chr1_1456079_T_C_b38	ATAD3C	-13.358	1.24e-34	-0.386504	31	0.028935	yes	NERVET
chr1_1411323_A_C_b38	ATAD3C	-13.2	5.66e-34	-0.398623	66	0.030198	yes	NERVET
chr1_1402457_A_G_b38	ATAD3C	-13.168	7.74e-34	-0.397346	64	0.030176	yes	NERVET
chr1_1400410_A_G_b38	ATAD3C	-13.139	1.02e-33	-0.388967	51	0.029604	yes	NERVET
chr1_1452797_CAA_C_b38	ATAD3C	-13.045	2.53e-33	-0.398915	24	0.030581	yes	NERVET
chr1_1457071_C_T_b38	ATAD3C	-13.044	2.54e-33	-0.373107	32	0.028603	yes	NERVET
chr1_1451968_C_T_b38	ATAD3C	-12.951	6.17e-33	-0.372704	29	0.028777	yes	NERVET
chr1_1384749_C_G_b38	ATAD3C	12.934	7.25e-33	0.380186	51	0.029393	yes	NERVET
chr1_1387763_CCT_C_b38	ATAD3C	12.934	7.25e-33	0.380186	51	0.029393	yes	NERVET
chr1_1388944_G_A_b38	ATAD3C	12.934	7.25e-33	0.380186	51	0.029393	yes	NERVET
chr1_1452540_G_A_b38	ATAD3C	-12.891	1.1e-32	-0.368388	28	0.028578	yes	NERVET
chr1_1376162_G_C_b38	ATAD3C	12.726	5.26e-32	0.373608	51	0.029358	yes	NERVET
chr1_1377431_C_T_b38	ATAD3C	12.726	5.26e-32	0.373608	51	0.029358	yes	NERVET
chr1_1456217_T_C_b38	ATAD3C	-12.698	6.84e-32	-0.379876	58	0.029915	yes	NERVET
chr1_1395346_A_G_b38	ATAD3C	-12.695	7.06e-32	-0.385644	62	0.030378	yes	NERVET
chr1_1387698_A_G_b38	ATAD3C	12.684	7.84e-32	0.38253	64	0.030159	yes	NERVET
chr1_1389827_C_T_b38	ATAD3C	12.584	2.02e-31	0.379018	63	0.03012	yes	NERVET
chr1_1456182_G_A_b38	ATAD3C	-12.472	5.77e-31	-0.360329	35	0.028891	yes	NERVET
chr1_1378204_G_C_b38	ATAD3C	12.451	7.05e-31	0.361807	53	0.029059	yes	NERVET
chr1_1394423_A_G_b38	ATAD3C	-12.243	4.92e-30	-0.372773	63	0.030449	yes	NERVET
chr1_1456829_G_C_b38	ATAD3C	-12.124	1.48e-29	-0.38593	41	0.031831	yes	NERVET
chr1_1452384_G_A_b38	ATAD3C	-11.821	2.4e-28	-0.399804	10	0.033821	yes	NERVET
chr1_1452346_A_G_b38	ATAD3C	-11.644	1.2e-27	-0.386848	12	0.033222	yes	NERVET
chr1_1366427_AGTGTGATTGAATGAGT_A_b38	ATAD3C	11.41	9.89e-27	0.343344	49	0.030091	yes	NERVET
chr1_1479719_T_C_b38	ATAD3C	-11.409	9.94e-27	-0.32617	77	0.028588	yes	NERVET
chr1_1366561_AGT_A_b38	ATAD3C	11.407	1.01e-26	0.346148	64	0.030344	yes	NERVET
chr1_1330125_G_A_b38	ATAD3C	11.387	1.22e-26	0.34664	66	0.030442	yes	NERVET
chr1_1517993_A_G_b38	ATAD3C	-11.351	1.68e-26	-0.308356	89	0.027166	yes	NERVET
chr1_1519934_T_G_b38	ATAD3C	-11.323	2.16e-26	-0.307761	89	0.027181	yes	NERVET
chr1_1519938_T_C_b38	ATAD3C	-11.323	2.16e-26	-0.307761	89	0.027181	yes	NERVET
chr1_1358384_G_C_b38	ATAD3C	11.285	3.02e-26	0.344017	65	0.030484	yes	NERVET
chr1_1379083_AT_A_b38	ATAD3C	11.285	3.02e-26	0.342571	29	0.030356	yes	NERVET
chr1_1309988_G_A_b38	ATAD3C	11.123	1.28e-25	0.333325	69	0.029969	yes	NERVET
chr1_1313807_G_A_b38	ATAD3C	11.123	1.28e-25	0.333325	69	0.029969	yes	NERVET
chr1_1370113_A_G_b38	ATAD3C	11.118	1.33e-25	0.322442	50	0.029002	yes	NERVET
chr1_1497605_G_C_b38	ATAD3C	-10.964	5.17e-25	-0.296053	66	0.027002	yes	NERVET
chr1_1312114_T_C_b38	ATAD3C	10.932	6.83e-25	0.330438	67	0.030226	yes	NERVET
chr1_1453870_A_C_b38	ATAD3C	-10.882	1.06e-24	-0.386656	8	0.035533	yes	NERVET
chr1_1456891_T_C_b38	ATAD3C	-10.868	1.2e-24	-0.30164	46	0.027755	yes	NERVET
chr1_1453961_C_T_b38	ATAD3C	-10.824	1.76e-24	-0.390583	8	0.036086	yes	NERVET
chr1_1437955_C_G_b38	ATAD3C	-10.798	2.19e-24	-0.285228	50	0.026414	yes	NERVET
chr1_1308516_C_T_b38	ATAD3C	10.682	6.03e-24	0.319702	71	0.02993	yes	NERVET
chr1_1450636_A_G_b38	ATAD3C	-10.404	6.53e-23	-0.368204	10	0.035392	yes	NERVET
chr1_1532798_T_C_b38	ATAD3C	-10.097	8.64e-22	-0.258063	145	0.025558	yes	NERVET
chr1_1428999_C_CA_b38	ATAD3C	-9.968	2.53e-21	-0.297726	30	0.029869	yes	NERVET
chr1_1363898_C_T_b38	ATAD3C	9.888	4.89e-21	0.32348	20	0.032715	yes	NERVET
chr1_1366529_TTAG_T_b38	ATAD3C	9.888	4.89e-21	0.32348	20	0.032715	yes	NERVET
chr1_1363986_C_T_b38	ATAD3C	9.842	7.13e-21	0.323025	20	0.032821	yes	NERVET
chr1_1379091_T_G_b38	ATAD3C	9.836	7.52e-21	0.333113	18	0.033868	yes	NERVET
chr1_1367292_A_AGT_b38	ATAD3C	9.817	8.77e-21	0.32104	20	0.032703	yes	NERVET
chr1_1403593_A_G_b38	ATAD3C	-9.708	2.13e-20	-0.368085	13	0.037915	yes	NERVET
chr1_1400756_GGA_G_b38	ATAD3C	-9.417	2.23e-19	-0.358281	13	0.038046	yes	NERVET
chr1_1401954_G_T_b38	ATAD3C	-9.417	2.23e-19	-0.358281	13	0.038046	yes	NERVET
chr1_1398218_C_A_b38	ATAD3C	-9.38	3e-19	-0.358287	13	0.038198	yes	NERVET
chr1_1382893_G_A_b38	ATAD3C	-9.347	3.89e-19	-0.352438	13	0.037705	yes	NERVET
chr1_1407565_C_A_b38	ATAD3C	-9.331	4.42e-19	-0.36966	12	0.039616	yes	NERVET
chr1_1375642_C_T_b38	ATAD3C	-9.256	8.02e-19	-0.336374	15	0.036341	yes	NERVET
chr1_1365566_G_A_b38	ATAD3C	9.251	8.35e-19	0.303762	20	0.032836	yes	NERVET
chr1_1383743_T_C_b38	ATAD3C	-9.212	1.14e-18	-0.348722	13	0.037857	yes	NERVET
chr1_1374505_A_G_b38	ATAD3C	-9.109	2.54e-18	-0.33054	15	0.036286	yes	NERVET
chr1_1541864_T_C_b38	ATAD3C	-9.086	3.05e-18	-0.258053	81	0.028402	yes	NERVET
chr1_1451028_T_A_b38	ATAD3C	-9.044	4.23e-18	-0.322157	11	0.035623	yes	NERVET
chr1_1372909_G_A_b38	ATAD3C	-9.026	4.84e-18	-0.335372	13	0.037155	yes	NERVET
chr1_1551454_C_A_b38	ATAD3C	-8.987	6.58e-18	-0.231309	149	0.025739	yes	NERVET
chr1_1373007_G_A_b38	ATAD3C	-8.915	1.15e-17	-0.337578	11	0.037867	yes	NERVET
chr1_1574445_A_G_b38	ATAD3C	-8.895	1.33e-17	-0.248775	83	0.027967	yes	NERVET
chr1_1373006_G_A_b38	ATAD3C	-8.86	1.74e-17	-0.339423	9	0.038308	yes	NERVET
chr1_1551557_A_AG_b38	ATAD3C	-8.859	1.77e-17	-0.251193	82	0.028356	yes	NERVET
chr1_1551559_A_T_b38	ATAD3C	-8.859	1.77e-17	-0.251193	82	0.028356	yes	NERVET
chr1_1280044_T_C_b38	ATAD3C	-8.798	2.8e-17	-0.263969	73	0.030003	yes	NERVET
chr1_1337898_A_G_b38	ATAD3C	8.787	3.06e-17	0.279617	20	0.031823	yes	NERVET
chr1_1361679_G_A_b38	ATAD3C	8.771	3.44e-17	0.285126	39	0.032507	yes	NERVET
chr1_1542773_T_C_b38	ATAD3C	-8.76	3.75e-17	-0.247206	78	0.028221	yes	NERVET
chr1_1542793_C_G_b38	ATAD3C	-8.76	3.75e-17	-0.247206	78	0.028221	yes	NERVET
chr1_1542800_T_C_b38	ATAD3C	-8.76	3.75e-17	-0.247206	78	0.028221	yes	NERVET
chr1_1380867_A_G_b38	ATAD3C	-8.756	3.86e-17	-0.338454	12	0.038653	yes	NERVET
chr1_1543953_A_G_b38	ATAD3C	-8.736	4.51e-17	-0.245752	78	0.028132	yes	NERVET
chr1_1368991_C_T_b38	ATAD3C	-8.719	5.1e-17	-0.313313	14	0.035933	yes	NERVET
chr1_1573654_T_C_b38	ATAD3C	-8.719	5.11e-17	-0.242782	83	0.027844	yes	NERVET
chr1_1364357_A_C_b38	ATAD3C	-8.716	5.24e-17	-0.313335	14	0.03595	yes	NERVET
chr1_1384546_C_T_b38	ATAD3C	-8.693	6.24e-17	-0.344091	12	0.039583	yes	NERVET
chr1_1550064_GC_G_b38	ATAD3C	-8.688	6.47e-17	-0.242959	79	0.027965	yes	NERVET
chr1_1550068_C_A_b38	ATAD3C	-8.688	6.47e-17	-0.242959	79	0.027965	yes	NERVET
chr1_1558726_C_CA_b38	ATAD3C	-8.673	7.23e-17	-0.244267	83	0.028163	yes	NERVET
chr1_1561821_A_C_b38	ATAD3C	-8.673	7.23e-17	-0.244267	83	0.028163	yes	NERVET
chr1_1545795_C_A_b38	ATAD3C	-8.658	8.14e-17	-0.247136	71	0.028545	yes	NERVET
chr1_1497606_C_G_b38	ATAD3C	-8.652	8.5e-17	-0.281918	19	0.032585	yes	NERVET
chr1_1369012_C_CG_b38	ATAD3C	-8.647	8.79e-17	-0.312691	14	0.03616	yes	NERVET
chr1_1259424_T_C_b38	ATAD3C	-8.642	9.19e-17	-0.279844	63	0.032383	yes	NERVET
chr1_1369009_T_C_b38	ATAD3C	-8.631	9.98e-17	-0.312279	14	0.036183	yes	NERVET
chr1_1543500_T_G_b38	ATAD3C	-8.614	1.13e-16	-0.243515	77	0.02827	yes	NERVET
chr1_1366187_A_AGT_b38	ATAD3C	-8.612	1.14e-16	-0.310553	14	0.036059	yes	NERVET
chr1_1538787_A_G_b38	ATAD3C	-8.61	1.17e-16	-0.238403	88	0.02769	yes	NERVET
chr1_1575724_G_C_b38	ATAD3C	-8.598	1.27e-16	-0.238965	80	0.027792	yes	NERVET
chr1_1370430_T_C_b38	ATAD3C	-8.598	1.28e-16	-0.310902	15	0.03616	yes	NERVET
chr1_1370584_G_C_b38	ATAD3C	-8.598	1.28e-16	-0.310902	15	0.03616	yes	NERVET
chr1_1368514_C_G_b38	ATAD3C	-8.581	1.45e-16	-0.310085	14	0.036136	yes	NERVET
chr1_1557495_CAT_C_b38	ATAD3C	-8.566	1.62e-16	-0.243137	83	0.028385	yes	NERVET
chr1_1366321_TGTGTGTAAATGG_T_b38	ATAD3C	-8.564	1.64e-16	-0.309256	14	0.036111	yes	NERVET
chr1_1565105_CAAGGCAGGCGGATCATG_C_b38	ATAD3C	-8.548	1.86e-16	-0.23367	93	0.027338	yes	NERVET
chr1_1363880_A_G_b38	ATAD3C	-8.544	1.91e-16	-0.307769	14	0.036022	yes	NERVET
chr1_1364566_T_C_b38	ATAD3C	-8.54	1.97e-16	-0.311295	13	0.036451	yes	NERVET
chr1_1575421_C_T_b38	ATAD3C	-8.532	2.1e-16	-0.235799	80	0.027638	yes	NERVET
chr1_1570294_CA_C_b38	ATAD3C	-8.531	2.11e-16	-0.23937	86	0.028059	yes	NERVET
chr1_1363456_CAG_C_b38	ATAD3C	8.501	2.64e-16	0.257717	33	0.030318	yes	NERVET
chr1_1366292_G_T_b38	ATAD3C	-8.494	2.77e-16	-0.307335	14	0.036181	yes	NERVET
chr1_1369821_C_T_b38	ATAD3C	-8.492	2.82e-16	-0.307053	14	0.036159	yes	NERVET
chr1_1364282_T_G_b38	ATAD3C	-8.483	3.02e-16	-0.306409	14	0.036121	yes	NERVET
chr1_1364694_T_C_b38	ATAD3C	-8.483	3.02e-16	-0.306409	14	0.036121	yes	NERVET
chr1_1364721_C_T_b38	ATAD3C	-8.483	3.02e-16	-0.306409	14	0.036121	yes	NERVET
chr1_1365160_A_G_b38	ATAD3C	-8.483	3.02e-16	-0.306409	14	0.036121	yes	NERVET
chr1_1365198_C_T_b38	ATAD3C	-8.483	3.02e-16	-0.306409	14	0.036121	yes	NERVET
chr1_1366008_A_G_b38	ATAD3C	-8.483	3.02e-16	-0.306409	14	0.036121	yes	NERVET
chr1_1366062_T_C_b38	ATAD3C	-8.483	3.02e-16	-0.306409	14	0.036121	yes	NERVET
chr1_1366145_TGTGAA_T_b38	ATAD3C	-8.483	3.02e-16	-0.306409	14	0.036121	yes	NERVET
chr1_1366453_G_T_b38	ATAD3C	-8.483	3.02e-16	-0.306409	14	0.036121	yes	NERVET
chr1_1366726_T_G_b38	ATAD3C	-8.483	3.02e-16	-0.306409	14	0.036121	yes	NERVET
chr1_1367258_T_A_b38	ATAD3C	-8.483	3.02e-16	-0.306409	14	0.036121	yes	NERVET
chr1_1367297_GAA_G_b38	ATAD3C	-8.483	3.02e-16	-0.306409	14	0.036121	yes	NERVET
chr1_1367329_A_AGT_b38	ATAD3C	-8.483	3.02e-16	-0.306409	14	0.036121	yes	NERVET
chr1_1367373_T_TGTG_b38	ATAD3C	-8.483	3.02e-16	-0.306409	14	0.036121	yes	NERVET
chr1_1367593_G_A_b38	ATAD3C	-8.483	3.02e-16	-0.306409	14	0.036121	yes	NERVET
chr1_1367602_GT_G_b38	ATAD3C	-8.483	3.02e-16	-0.306409	14	0.036121	yes	NERVET
chr1_1367605_GAGTGAGTGTA_G_b38	ATAD3C	-8.483	3.02e-16	-0.306409	14	0.036121	yes	NERVET
chr1_1367670_GGTGA_G_b38	ATAD3C	-8.483	3.02e-16	-0.306409	14	0.036121	yes	NERVET
chr1_1367722_TTTTA_T_b38	ATAD3C	-8.483	3.02e-16	-0.306409	14	0.036121	yes	NERVET
chr1_1367874_A_T_b38	ATAD3C	-8.483	3.02e-16	-0.306409	14	0.036121	yes	NERVET
chr1_1367951_C_T_b38	ATAD3C	-8.483	3.02e-16	-0.306409	14	0.036121	yes	NERVET
chr1_1367965_A_G_b38	ATAD3C	-8.483	3.02e-16	-0.306409	14	0.036121	yes	NERVET
chr1_1367970_T_G_b38	ATAD3C	-8.483	3.02e-16	-0.306409	14	0.036121	yes	NERVET
chr1_1367994_C_A_b38	ATAD3C	-8.483	3.02e-16	-0.306409	14	0.036121	yes	NERVET
chr1_1368297_C_T_b38	ATAD3C	-8.483	3.02e-16	-0.306409	14	0.036121	yes	NERVET
chr1_1369282_G_A_b38	ATAD3C	-8.476	3.17e-16	-0.30642	14	0.036151	yes	NERVET
chr1_1369320_GT_G_b38	ATAD3C	-8.476	3.17e-16	-0.30642	14	0.036151	yes	NERVET
chr1_1369476_CTT_C_b38	ATAD3C	-8.476	3.17e-16	-0.30642	14	0.036151	yes	NERVET
chr1_1369556_C_G_b38	ATAD3C	-8.476	3.17e-16	-0.30642	14	0.036151	yes	NERVET
chr1_1369627_T_C_b38	ATAD3C	-8.476	3.17e-16	-0.30642	14	0.036151	yes	NERVET
chr1_1369686_T_C_b38	ATAD3C	-8.476	3.17e-16	-0.30642	14	0.036151	yes	NERVET
chr1_1369716_G_C_b38	ATAD3C	-8.476	3.17e-16	-0.30642	14	0.036151	yes	NERVET
chr1_1369741_C_T_b38	ATAD3C	-8.476	3.17e-16	-0.30642	14	0.036151	yes	NERVET
chr1_1370181_C_T_b38	ATAD3C	-8.476	3.17e-16	-0.30642	14	0.036151	yes	NERVET
chr1_1370317_G_C_b38	ATAD3C	-8.476	3.17e-16	-0.30642	14	0.036151	yes	NERVET
chr1_1370320_A_G_b38	ATAD3C	-8.476	3.17e-16	-0.30642	14	0.036151	yes	NERVET
chr1_1370532_C_T_b38	ATAD3C	-8.471	3.29e-16	-0.305399	15	0.036051	yes	NERVET
chr1_1367280_T_A_b38	ATAD3C	-8.464	3.46e-16	-0.30587	14	0.036136	yes	NERVET
chr1_1367919_C_T_b38	ATAD3C	-8.458	3.63e-16	-0.305302	14	0.036097	yes	NERVET
chr1_1367300_T_TGA_b38	ATAD3C	-8.445	3.99e-16	-0.308265	13	0.036503	yes	NERVET
chr1_1369407_G_A_b38	ATAD3C	-8.438	4.19e-16	-0.304649	13	0.036103	yes	NERVET
chr1_1566086_G_A_b38	ATAD3C	-8.434	4.34e-16	-0.233092	91	0.027638	yes	NERVET
chr1_1367388_T_TTGG_b38	ATAD3C	-8.425	4.62e-16	-0.30606	14	0.036326	yes	NERVET
chr1_1367268_TGA_T_b38	ATAD3C	-8.406	5.33e-16	-0.302622	14	0.036001	yes	NERVET
chr1_1577491_A_AC_b38	ATAD3C	-8.377	6.59e-16	-0.235749	85	0.028142	yes	NERVET
chr1_1363688_C_T_b38	ATAD3C	-8.369	6.98e-16	-0.30416	14	0.036342	yes	NERVET
chr1_1364099_CCA_C_b38	ATAD3C	-8.369	6.98e-16	-0.30416	14	0.036342	yes	NERVET
chr1_1364102_TGTTG_T_b38	ATAD3C	-8.369	6.98e-16	-0.30416	14	0.036342	yes	NERVET
chr1_1368763_G_A_b38	ATAD3C	-8.369	6.98e-16	-0.30416	14	0.036342	yes	NERVET
chr1_1547630_G_A_b38	ATAD3C	-8.363	7.32e-16	-0.229136	80	0.027399	yes	NERVET
chr1_1379093_TG_T_b38	ATAD3C	-8.352	7.92e-16	-0.340291	8	0.040743	yes	NERVET
chr1_1341550_GCA_G_b38	ATAD3C	-8.313	1.06e-15	-0.307636	14	0.037008	yes	NERVET
chr1_1569661_T_C_b38	ATAD3C	-8.304	1.13e-15	-0.227657	83	0.027414	yes	NERVET
chr1_1569180_T_A_b38	ATAD3C	-8.281	1.33e-15	-0.230526	86	0.027836	yes	NERVET
chr1_1559750_C_CAG_b38	ATAD3C	-8.269	1.45e-15	-0.227545	91	0.027517	yes	NERVET
chr1_1561628_T_C_b38	ATAD3C	-8.269	1.45e-15	-0.227545	91	0.027517	yes	NERVET
chr1_1563918_A_G_b38	ATAD3C	-8.269	1.45e-15	-0.227545	91	0.027517	yes	NERVET
chr1_1565561_A_G_b38	ATAD3C	-8.269	1.45e-15	-0.227545	91	0.027517	yes	NERVET
chr1_1567715_G_A_b38	ATAD3C	-8.269	1.45e-15	-0.227545	91	0.027517	yes	NERVET
chr1_1567719_A_C_b38	ATAD3C	-8.269	1.45e-15	-0.227545	91	0.027517	yes	NERVET
chr1_1569875_C_T_b38	ATAD3C	-8.269	1.45e-15	-0.227545	91	0.027517	yes	NERVET
chr1_1367511_ATGAG_A_b38	ATAD3C	-8.267	1.48e-15	-0.303702	13	0.036737	yes	NERVET
chr1_1549590_C_G_b38	ATAD3C	-8.236	1.86e-15	-0.22641	87	0.027492	yes	NERVET
chr1_1366511_GGTGA_G_b38	ATAD3C	-8.231	1.93e-15	-0.298875	14	0.036312	yes	NERVET
chr1_1572532_A_C_b38	ATAD3C	-8.172	2.96e-15	-0.224837	91	0.027515	yes	NERVET
chr1_1366776_G_GAATT_b38	ATAD3C	-8.156	3.32e-15	-0.300143	14	0.036801	yes	NERVET
chr1_1553692_A_G_b38	ATAD3C	-8.144	3.61e-15	-0.223423	88	0.027434	yes	NERVET
chr1_1555247_T_A_b38	ATAD3C	-8.144	3.61e-15	-0.223423	88	0.027434	yes	NERVET
chr1_1554694_A_G_b38	ATAD3C	-8.143	3.65e-15	-0.224065	87	0.027518	yes	NERVET
chr1_1364253_C_G_b38	ATAD3C	-8.142	3.68e-15	-0.301662	13	0.037052	yes	NERVET
chr1_1370553_CAAA_C_b38	ATAD3C	-8.114	4.49e-15	-0.313242	10	0.038606	yes	NERVET
chr1_1573079_A_G_b38	ATAD3C	-8.11	4.61e-15	-0.22409	90	0.027631	yes	NERVET
chr1_1554852_T_C_b38	ATAD3C	-8.11	4.63e-15	-0.221725	88	0.027341	yes	NERVET
chr1_1367462_T_C_b38	ATAD3C	-8.087	5.46e-15	-0.29832	13	0.036891	yes	NERVET
chr1_1316929_A_T_b38	ATAD3C	-8.078	5.81e-15	-0.302301	13	0.037422	yes	NERVET
chr1_1258206_AT_A_b38	ATAD3C	-8.078	5.82e-15	-0.253782	55	0.031417	yes	NERVET
chr1_1554781_A_G_b38	ATAD3C	-8.068	6.23e-15	-0.221405	87	0.027441	yes	NERVET
chr1_1565680_A_AG_b38	ATAD3C	-7.999	1.03e-14	-0.219269	89	0.027413	yes	NERVET
chr1_1368177_G_C_b38	ATAD3C	-7.94	1.55e-14	-0.290239	17	0.036553	yes	NERVET
chr1_1537160_T_G_b38	ATAD3C	-7.924	1.74e-14	-0.212547	103	0.026824	yes	NERVET
chr1_1290968_C_G_b38	ATAD3C	-7.917	1.83e-14	-0.282239	41	0.035648	yes	NERVET
chr1_1344048_G_A_b38	ATAD3C	-7.914	1.88e-14	-0.302507	12	0.038226	yes	NERVET
chr1_1574655_GGC_G_b38	ATAD3C	-7.908	1.95e-14	-0.225231	72	0.028481	yes	NERVET
chr1_1394041_G_A_b38	ATAD3C	-7.877	2.42e-14	-0.336793	6	0.042755	yes	NERVET
chr1_1369803_C_CT_b38	ATAD3C	-7.838	3.2e-14	-0.27503	12	0.03509	yes	NERVET
chr1_1329973_GCGTGTGCCATGCA_G_b38	ATAD3C	-7.815	3.75e-14	-0.299729	12	0.038352	yes	NERVET
chr1_1560765_T_C_b38	ATAD3C	-7.809	3.93e-14	-0.225419	72	0.028868	yes	NERVET
chr1_1562261_TTTTC_T_b38	ATAD3C	-7.809	3.93e-14	-0.225419	72	0.028868	yes	NERVET
chr1_1363438_C_CTT_b38	ATAD3C	7.798	4.22e-14	0.228748	46	0.029332	yes	NERVET
chr1_1575864_G_A_b38	ATAD3C	-7.776	4.95e-14	-0.223193	74	0.028704	yes	NERVET
chr1_1292284_TTGAG_T_b38	ATAD3C	-7.742	6.24e-14	-0.282316	25	0.036464	yes	NERVET
chr1_1366681_T_TGA_b38	ATAD3C	-7.723	7.13e-14	-0.28555	14	0.036973	yes	NERVET
chr1_1571794_A_AT_b38	ATAD3C	-7.542	2.48e-13	-0.213211	81	0.028269	yes	NERVET
chr1_1366830_G_A_b38	ATAD3C	-7.519	2.91e-13	-0.309214	7	0.041126	yes	NERVET
chr1_1366835_G_GGTGA_b38	ATAD3C	-7.499	3.32e-13	-0.308154	7	0.041092	yes	NERVET
chr1_1539491_G_C_b38	ATAD3C	-7.461	4.3e-13	-0.210548	83	0.028219	yes	NERVET
chr1_1568548_G_A_b38	ATAD3C	-7.441	4.93e-13	-0.208686	80	0.028046	yes	NERVET
chr1_1366828_A_G_b38	ATAD3C	-7.43	5.32e-13	-0.306824	7	0.041296	yes	NERVET
chr1_1533841_T_C_b38	ATAD3C	-7.416	5.83e-13	-0.241596	48	0.032577	yes	NERVET
chr1_1559703_G_C_b38	ATAD3C	-7.412	5.98e-13	-0.208167	80	0.028084	yes	NERVET
chr1_1450193_C_T_b38	ATAD3C	-7.405	6.28e-13	-0.334437	16	0.045162	yes	NERVET
chr1_1500745_A_C_b38	ATAD3C	-7.399	6.55e-13	-0.327237	44	0.044228	yes	NERVET
chr1_1570587_C_T_b38	ATAD3C	-7.385	7.19e-13	-0.207437	80	0.028089	yes	NERVET
chr1_1361685_C_T_b38	ATAD3C	-7.363	8.31e-13	-0.260217	29	0.035339	yes	NERVET
chr1_1537493_T_A_b38	ATAD3C	-7.345	9.44e-13	-0.207134	74	0.028202	yes	NERVET
chr1_1523187_A_G_b38	ATAD3C	-7.29	1.36e-12	-0.340473	30	0.046706	yes	NERVET
chr1_1375678_TA_T_b38	ATAD3C	7.244	1.84e-12	0.248162	29	0.034257	yes	NERVET
chr1_1417051_CA_C_b38	ATAD3C	-7.172	2.96e-12	-0.313498	6	0.043711	yes	NERVET
chr1_1290841_A_G_b38	ATAD3C	-7.151	3.4e-12	-0.255435	32	0.03572	yes	NERVET
chr1_1575935_T_C_b38	ATAD3C	-7.133	3.84e-12	-0.202721	81	0.028421	yes	NERVET
chr1_1388565_GTC_G_b38	ATAD3C	7.093	4.97e-12	0.231649	25	0.032659	yes	NERVET
chr1_1518285_T_C_b38	ATAD3C	-7.024	7.79e-12	-0.249044	57	0.035457	yes	NERVET
chr1_1366951_A_AGT_b38	ATAD3C	6.978	1.05e-11	0.296841	10	0.042541	yes	NERVET
chr1_1533754_T_C_b38	ATAD3C	-6.904	1.68e-11	-0.218927	44	0.031709	yes	NERVET
chr1_1512376_G_C_b38	ATAD3C	-6.867	2.14e-11	-0.252424	40	0.036761	yes	NERVET
chr1_1365036_T_TAA_b38	ATAD3C	-6.865	2.16e-11	-0.266413	10	0.038808	yes	NERVET
chr1_1303112_G_A_b38	ATAD3C	-6.862	2.2e-11	-0.273011	8	0.039786	yes	NERVET
chr1_1533883_G_T_b38	ATAD3C	-6.85	2.37e-11	-0.320745	14	0.046821	yes	NERVET
chr1_1366941_T_TGTGTGCA_b38	ATAD3C	6.849	2.39e-11	0.289748	10	0.042305	yes	NERVET
chr1_1511945_G_A_b38	ATAD3C	-6.823	2.81e-11	-0.254099	41	0.03724	yes	NERVET
chr1_1574032_AAAG_A_b38	ATAD3C	-6.822	2.83e-11	-0.218449	48	0.03202	yes	NERVET
chr1_1571986_G_A_b38	ATAD3C	-6.694	6.34e-11	-0.187955	71	0.028079	yes	NERVET
chr1_1325753_G_T_b38	ATAD3C	-6.66	7.82e-11	-0.279106	7	0.041909	yes	NERVET
chr1_1367028_A_G_b38	ATAD3C	6.656	8.03e-11	0.259449	15	0.038982	yes	NERVET
chr1_1482402_A_G_b38	ATAD3C	-6.648	8.42e-11	-0.252798	54	0.038026	yes	NERVET
chr1_1221049_C_G_b38	ATAD3C	-6.636	9.04e-11	-0.199768	65	0.030102	yes	NERVET
chr1_1501403_T_C_b38	ATAD3C	-6.577	1.3e-10	-0.244867	41	0.037229	yes	NERVET
chr1_1304555_A_C_b38	ATAD3C	-6.555	1.5e-10	-0.26337	8	0.04018	yes	NERVET
chr1_1566854_CA_C_b38	ATAD3C	-6.551	1.53e-10	-0.203762	55	0.031103	yes	NERVET
chr1_1450322_CAA_C_b38	ATAD3C	-6.533	1.71e-10	-0.30612	8	0.046856	yes	NERVET
chr1_1366883_G_GGTGTGAATTGGTGTAGTGTGAATGAGT_b38	ATAD3C	-6.428	3.23e-10	-0.3096	4	0.048165	yes	NERVET
chr1_1573429_CAAAAAAAAAAAAAAAAAA_C_b38	ATAD3C	-6.397	3.9e-10	-0.18471	76	0.028874	yes	NERVET
chr1_1383798_AG_A_b38	ATAD3C	6.384	4.2e-10	0.306005	7	0.047931	yes	NERVET
chr1_1501260_A_AT_b38	ATAD3C	-6.384	4.22e-10	-0.238091	22	0.037297	yes	NERVET
chr1_1538924_C_A_b38	ATAD3C	-6.383	4.24e-10	-0.18511	60	0.029001	yes	NERVET
chr1_1517958_C_T_b38	ATAD3C	-6.336	5.61e-10	-0.280587	6	0.044283	yes	NERVET
chr1_1514366_A_G_b38	ATAD3C	-6.329	5.84e-10	-0.365121	6	0.057686	yes	NERVET
chr1_1303800_G_A_b38	ATAD3C	-6.297	7.09e-10	-0.261388	8	0.041511	yes	NERVET
chr1_1407232_G_C_b38	ATAD3C	-6.282	7.73e-10	-0.204887	25	0.032614	yes	NERVET
chr1_1385919_A_AG_b38	ATAD3C	6.231	1.05e-09	0.290298	18	0.046591	yes	NERVET
chr1_1468048_A_G_b38	ATAD3C	-6.178	1.43e-09	-0.281408	26	0.045551	yes	NERVET
chr1_1469429_A_G_b38	ATAD3C	-6.173	1.47e-09	-0.275601	37	0.044645	yes	NERVET
chr1_1445055_G_A_b38	ATAD3C	-6.139	1.79e-09	-0.29495	4	0.048042	yes	NERVET
chr1_1534226_C_T_b38	ATAD3C	-6.103	2.21e-09	-0.176742	59	0.028958	yes	NERVET
chr1_1470034_T_C_b38	ATAD3C	-6.099	2.27e-09	-0.274902	37	0.045076	yes	NERVET
chr1_1375678_TAA_T_b38	ATAD3C	-6.078	2.55e-09	-0.221263	16	0.036401	yes	NERVET
chr1_1459662_C_T_b38	ATAD3C	-6.069	2.68e-09	-0.280369	29	0.046195	yes	NERVET
chr1_1306420_A_G_b38	ATAD3C	6.069	2.69e-09	0.274064	37	0.04516	yes	NERVET
chr1_1496953_T_C_b38	ATAD3C	-6.063	2.79e-09	-0.250941	40	0.041391	yes	NERVET
chr1_1518541_T_C_b38	ATAD3C	-6.053	2.95e-09	-0.208558	39	0.034456	yes	NERVET
chr1_1282558_C_CCA_b38	ATAD3C	-6.051	2.98e-09	-0.217142	33	0.035885	yes	NERVET
chr1_1459658_G_A_b38	ATAD3C	-6.021	3.55e-09	-0.284455	37	0.047246	yes	NERVET
chr1_1295039_T_C_b38	ATAD3C	-6.01	3.77e-09	-0.263837	36	0.043898	yes	NERVET
chr1_1298561_T_C_b38	ATAD3C	-6.01	3.77e-09	-0.263837	36	0.043898	yes	NERVET
chr1_1300330_T_A_b38	ATAD3C	-6.008	3.82e-09	-0.260069	36	0.043289	yes	NERVET
chr1_1301656_T_C_b38	ATAD3C	-6.008	3.82e-09	-0.260069	36	0.043289	yes	NERVET
chr1_1471144_G_C_b38	ATAD3C	-5.993	4.15e-09	-0.271359	37	0.045278	yes	NERVET
chr1_1516000_T_C_b38	ATAD3C	-5.945	5.47e-09	-0.211773	46	0.035623	yes	NERVET
chr1_1380513_C_T_b38	ATAD3C	5.945	5.48e-09	0.296633	4	0.049899	yes	NERVET
chr1_1381290_C_G_b38	ATAD3C	5.945	5.48e-09	0.296633	4	0.049899	yes	NERVET
chr1_1238902_T_C_b38	ATAD3C	-5.919	6.34e-09	-0.174095	70	0.029414	yes	NERVET
chr1_1307603_G_A_b38	ATAD3C	5.919	6.34e-09	0.261754	36	0.044224	yes	NERVET
chr1_1530331_T_C_b38	ATAD3C	-5.919	6.35e-09	-0.211104	47	0.035668	yes	NERVET
chr1_1307327_A_G_b38	ATAD3C	5.91	6.66e-09	0.264736	36	0.044794	yes	NERVET
chr1_1385384_G_A_b38	ATAD3C	5.909	6.71e-09	0.287589	6	0.048673	yes	NERVET
chr1_1482316_C_G_b38	ATAD3C	-5.902	6.96e-09	-0.165516	54	0.028043	yes	NERVET
chr1_1513923_G_C_b38	ATAD3C	-5.901	7.02e-09	-0.206409	46	0.034981	yes	NERVET
chr1_1361833_G_C_b38	ATAD3C	5.861	8.79e-09	0.237224	10	0.040478	yes	NERVET
chr1_1399922_C_T_b38	ATAD3C	-5.813	1.15e-08	-0.278848	7	0.047971	yes	NERVET
chr1_1395050_G_A_b38	ATAD3C	-5.792	1.29e-08	-0.283489	6	0.048947	yes	NERVET
chr1_1375698_G_T_b38	ATAD3C	5.79	1.3e-08	0.28358	4	0.048975	yes	NERVET
chr1_1376153_G_C_b38	ATAD3C	5.79	1.3e-08	0.28358	4	0.048975	yes	NERVET
chr1_1376752_T_C_b38	ATAD3C	5.79	1.3e-08	0.28358	4	0.048975	yes	NERVET
chr1_1378635_C_T_b38	ATAD3C	5.79	1.3e-08	0.28358	4	0.048975	yes	NERVET
chr1_1378792_C_T_b38	ATAD3C	5.79	1.3e-08	0.28358	4	0.048975	yes	NERVET
chr1_1378865_C_T_b38	ATAD3C	5.79	1.3e-08	0.28358	4	0.048975	yes	NERVET
chr1_1379334_A_G_b38	ATAD3C	5.79	1.3e-08	0.28358	4	0.048975	yes	NERVET
chr1_1562444_C_T_b38	ATAD3C	-5.789	1.31e-08	-0.247865	8	0.042814	yes	NERVET
chr1_1341079_C_A_b38	ATAD3C	5.785	1.34e-08	0.274564	3	0.04746	yes	NERVET
chr1_1217251_C_A_b38	ATAD3C	-5.769	1.47e-08	-0.2465	8	0.042731	yes	NERVET
chr1_1518621_A_AC_b38	ATAD3C	-5.754	1.59e-08	-0.196064	24	0.034074	yes	NERVET
chr1_1555871_T_C_b38	ATAD3C	-5.7	2.14e-08	-0.165724	70	0.029075	yes	NERVET
chr1_1459632_T_C_b38	ATAD3C	-5.686	2.31e-08	-0.260397	25	0.045797	yes	NERVET
chr1_1251122_A_T_b38	ATAD3C	-5.671	2.5e-08	-0.20647	24	0.036405	yes	NERVET
chr1_1353203_C_G_b38	ATAD3C	5.669	2.53e-08	0.288651	3	0.050915	yes	NERVET
chr1_1496973_G_A_b38	ATAD3C	-5.667	2.57e-08	-0.242697	27	0.042829	yes	NERVET
chr1_1558347_G_A_b38	ATAD3C	-5.659	2.68e-08	-0.170991	56	0.030218	yes	NERVET
chr1_1522905_A_G_b38	ATAD3C	-5.653	2.77e-08	-0.268192	25	0.047446	yes	NERVET
chr1_1352542_G_A_b38	ATAD3C	5.65	2.82e-08	0.284182	3	0.0503	yes	NERVET
chr1_1549967_C_G_b38	ATAD3C	-5.638	3e-08	-0.168386	49	0.029864	yes	NERVET
chr1_1554548_T_C_b38	ATAD3C	-5.638	3e-08	-0.166554	64	0.02954	yes	NERVET
chr1_1555179_A_G_b38	ATAD3C	-5.615	3.39e-08	-0.164511	66	0.029296	yes	NERVET
chr1_1354531_G_A_b38	ATAD3C	5.603	3.64e-08	0.283956	3	0.050683	yes	NERVET
chr1_1488652_A_G_b38	ATAD3C	-5.601	3.67e-08	-0.233781	41	0.041738	yes	NERVET
chr1_1492292_C_G_b38	ATAD3C	-5.601	3.67e-08	-0.233781	41	0.041738	yes	NERVET
chr1_1492850_G_A_b38	ATAD3C	-5.601	3.67e-08	-0.233781	41	0.041738	yes	NERVET
chr1_1326444_G_C_b38	ATAD3C	5.578	4.16e-08	0.274609	3	0.049233	yes	NERVET
chr1_1514211_A_G_b38	ATAD3C	-5.569	4.35e-08	-0.296757	15	0.053283	yes	NERVET
chr1_1490320_T_C_b38	ATAD3C	-5.565	4.45e-08	-0.231475	40	0.041595	yes	NERVET
chr1_1385553_G_A_b38	ATAD3C	5.55	4.83e-08	0.234213	22	0.042203	yes	NERVET
chr1_1338970_A_G_b38	ATAD3C	5.545	4.97e-08	0.274652	3	0.049535	yes	NERVET
chr1_1490027_A_G_b38	ATAD3C	-5.53	5.37e-08	-0.227663	34	0.041168	yes	NERVET
chr1_1490032_A_G_b38	ATAD3C	-5.53	5.37e-08	-0.227663	34	0.041168	yes	NERVET
chr1_1548572_A_C_b38	ATAD3C	-5.518	5.73e-08	-0.144046	90	0.026106	yes	NERVET
chr1_1353987_CTG_C_b38	ATAD3C	5.506	6.11e-08	0.279049	3	0.050683	yes	NERVET
chr1_1363031_C_T_b38	ATAD3C	5.481	6.97e-08	0.278743	3	0.050855	yes	NERVET
chr1_1468094_G_C_b38	ATAD3C	-5.462	7.72e-08	-0.249781	17	0.045733	yes	NERVET
chr1_1492619_A_AC_b38	ATAD3C	-5.457	7.91e-08	-0.227922	40	0.041765	yes	NERVET
chr1_1476266_T_C_b38	ATAD3C	-5.454	8.03e-08	-0.222566	42	0.040804	yes	NERVET
chr1_1341098_T_G_b38	ATAD3C	5.454	8.04e-08	0.265738	3	0.048722	yes	NERVET
chr1_1459004_T_C_b38	ATAD3C	-5.438	8.74e-08	-0.267203	25	0.049134	yes	NERVET
chr1_1521518_G_A_b38	ATAD3C	-5.428	9.21e-08	-0.267574	25	0.049291	yes	NERVET
chr1_1403240_CCTTT_C_b38	ATAD3C	-5.409	1.02e-07	-0.260626	7	0.048181	yes	NERVET
chr1_1402900_A_G_b38	ATAD3C	-5.409	1.02e-07	-0.262027	7	0.048441	yes	NERVET
chr1_1405316_T_C_b38	ATAD3C	-5.409	1.02e-07	-0.262027	7	0.048441	yes	NERVET
chr1_1487887_A_G_b38	ATAD3C	-5.409	1.02e-07	-0.227177	41	0.042002	yes	NERVET
chr1_1482624_T_C_b38	ATAD3C	-5.397	1.09e-07	-0.222742	41	0.041272	yes	NERVET
chr1_1419135_C_G_b38	ATAD3C	-5.385	1.15e-07	-0.252675	36	0.046918	yes	NERVET
chr1_1351747_G_A_b38	ATAD3C	5.38	1.19e-07	0.26974	3	0.050138	yes	NERVET
chr1_1363157_C_T_b38	ATAD3C	5.373	1.23e-07	0.272876	3	0.050784	yes	NERVET
chr1_1515567_A_C_b38	ATAD3C	-5.367	1.27e-07	-0.269272	19	0.050174	yes	NERVET
chr1_1520875_A_G_b38	ATAD3C	-5.366	1.28e-07	-0.264764	25	0.049338	yes	NERVET
chr1_1558204_T_TAAAAAA_b38	ATAD3C	-5.359	1.32e-07	-0.170747	40	0.031861	yes	NERVET
chr1_1381268_C_T_b38	ATAD3C	5.344	1.43e-07	0.252639	14	0.047277	yes	NERVET
chr1_1381294_C_T_b38	ATAD3C	5.344	1.43e-07	0.252639	14	0.047277	yes	NERVET
chr1_1533018_T_C_b38	ATAD3C	-5.34	1.46e-07	-0.266508	26	0.049904	yes	NERVET
chr1_1360302_A_G_b38	ATAD3C	5.335	1.5e-07	0.269655	3	0.050545	yes	NERVET
chr1_1375998_T_A_b38	ATAD3C	5.306	1.74e-07	0.246242	13	0.046404	yes	NERVET
chr1_1249880_A_G_b38	ATAD3C	-5.305	1.75e-07	-0.195823	24	0.036911	yes	NERVET
chr1_1422081_C_T_b38	ATAD3C	-5.298	1.81e-07	-0.251393	37	0.047447	yes	NERVET
chr1_1308178_GGGGCGCGGGGA_G_b38	ATAD3C	-5.297	1.83e-07	-0.188225	20	0.035534	yes	NERVET
chr1_1362042_C_T_b38	ATAD3C	5.291	1.88e-07	0.268205	3	0.050688	yes	NERVET
chr1_1360989_GAC_G_b38	ATAD3C	5.281	1.98e-07	0.267513	3	0.050653	yes	NERVET
chr1_1554290_C_T_b38	ATAD3C	-5.275	2.05e-07	-0.15546	64	0.029472	yes	NERVET
chr1_1380790_G_A_b38	ATAD3C	5.27	2.09e-07	0.253222	13	0.048045	yes	NERVET
chr1_1495204_T_C_b38	ATAD3C	-5.262	2.19e-07	-0.216677	29	0.041181	yes	NERVET
chr1_1578879_A_T_b38	ATAD3C	-5.225	2.65e-07	-0.283754	3	0.054309	yes	NERVET
chr1_1524202_G_A_b38	ATAD3C	-5.224	2.65e-07	-0.26582	24	0.05088	yes	NERVET
chr1_1306523_C_G_b38	ATAD3C	5.206	2.92e-07	0.224503	21	0.043126	yes	NERVET
chr1_1473089_T_C_b38	ATAD3C	-5.194	3.09e-07	-0.21434	39	0.041266	yes	NERVET
chr1_1409623_T_C_b38	ATAD3C	-5.17	3.49e-07	-0.219245	15	0.042406	yes	NERVET
chr1_1408687_T_C_b38	ATAD3C	-5.168	3.52e-07	-0.246036	17	0.047605	yes	NERVET
chr1_1370553_CA_C_b38	ATAD3C	5.163	3.63e-07	0.152895	134	0.029615	yes	NERVET
chr1_1527386_C_T_b38	ATAD3C	-5.151	3.85e-07	-0.263171	24	0.051091	yes	NERVET
chr1_1530002_A_G_b38	ATAD3C	-5.149	3.88e-07	-0.255729	23	0.049663	yes	NERVET
chr1_1421170_A_G_b38	ATAD3C	-5.146	3.95e-07	-0.251823	27	0.04894	yes	NERVET
chr1_1344634_A_G_b38	ATAD3C	5.131	4.26e-07	0.256619	3	0.050016	yes	NERVET
chr1_1345965_C_T_b38	ATAD3C	5.131	4.26e-07	0.256619	3	0.050016	yes	NERVET
chr1_1375288_A_C_b38	ATAD3C	5.13	4.29e-07	0.241599	13	0.0471	yes	NERVET
chr1_1375595_C_T_b38	ATAD3C	5.13	4.29e-07	0.241599	13	0.0471	yes	NERVET
chr1_1376092_G_A_b38	ATAD3C	5.13	4.29e-07	0.241599	13	0.0471	yes	NERVET
chr1_1376336_G_A_b38	ATAD3C	5.13	4.29e-07	0.241599	13	0.0471	yes	NERVET
chr1_1379664_G_A_b38	ATAD3C	5.13	4.29e-07	0.241599	13	0.0471	yes	NERVET
chr1_1290579_C_G_b38	ATAD3C	-5.115	4.61e-07	-0.181293	39	0.035445	yes	NERVET
chr1_1468856_C_T_b38	ATAD3C	-5.1	4.96e-07	-0.229577	19	0.045012	yes	NERVET
chr1_1469088_T_C_b38	ATAD3C	-5.08	5.49e-07	-0.223198	34	0.043936	yes	NERVET
chr1_1425013_C_T_b38	ATAD3C	-5.042	6.62e-07	-0.233224	38	0.046253	yes	NERVET
chr1_1230159_G_A_b38	ATAD3C	-5.042	6.63e-07	-0.161599	37	0.03205	yes	NERVET
chr1_1398056_C_A_b38	ATAD3C	-5.017	7.51e-07	-0.141412	72	0.028187	yes	NERVET
chr1_1217733_G_A_b38	ATAD3C	-5.011	7.73e-07	-0.204855	8	0.04088	yes	NERVET
chr1_1302795_T_TC_b38	ATAD3C	4.979	9.03e-07	0.158623	82	0.031856	yes	NERVET
chr1_1419214_A_G_b38	ATAD3C	-4.965	9.71e-07	-0.222636	18	0.044844	yes	NERVET
chr1_1252613_C_G_b38	ATAD3C	-4.962	9.81e-07	-0.224901	7	0.045321	yes	NERVET
chr1_1573776_A_G_b38	ATAD3C	-4.95	1.04e-06	-0.15816	29	0.031949	yes	NERVET
chr1_1359943_G_A_b38	ATAD3C	4.945	1.07e-06	0.237621	22	0.048054	yes	NERVET
chr1_1500729_G_A_b38	ATAD3C	-4.943	1.08e-06	-0.259905	27	0.052578	yes	NERVET
chr1_1468592_C_CG_b38	ATAD3C	-4.918	1.22e-06	-0.221343	21	0.045007	yes	NERVET
chr1_1242094_A_G_b38	ATAD3C	-4.917	1.22e-06	-0.200357	10	0.040746	yes	NERVET
chr1_1242250_A_G_b38	ATAD3C	-4.917	1.22e-06	-0.200357	10	0.040746	yes	NERVET
chr1_1415976_G_A_b38	ATAD3C	-4.915	1.24e-06	-0.226062	23	0.045993	yes	NERVET
chr1_1410877_A_G_b38	ATAD3C	-4.912	1.25e-06	-0.230859	29	0.046995	yes	NERVET
chr1_1329774_T_C_b38	ATAD3C	4.869	1.55e-06	0.227809	11	0.046792	yes	NERVET
chr1_1526169_C_T_b38	ATAD3C	-4.863	1.59e-06	-0.237059	23	0.048747	yes	NERVET
chr1_1241639_T_C_b38	ATAD3C	-4.861	1.6e-06	-0.198678	10	0.040869	yes	NERVET
chr1_1443673_CTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT_C_b38	ATAD3C	-4.853	1.67e-06	-0.323277	5	0.066614	yes	NERVET
chr1_1252261_C_T_b38	ATAD3C	-4.847	1.72e-06	-0.229729	4	0.047396	yes	NERVET
chr1_1327764_G_A_b38	ATAD3C	4.843	1.75e-06	0.244734	3	0.050529	yes	NERVET
chr1_1241053_A_G_b38	ATAD3C	-4.835	1.82e-06	-0.196804	10	0.040704	yes	NERVET
chr1_1359138_C_T_b38	ATAD3C	4.829	1.87e-06	0.22714	25	0.047034	yes	NERVET
chr1_1522693_A_G_b38	ATAD3C	4.82	1.95e-06	0.150839	30	0.031296	yes	NERVET
chr1_1481959_C_T_b38	ATAD3C	-4.819	1.96e-06	-0.204987	31	0.042534	yes	NERVET
chr1_1319063_G_A_b38	ATAD3C	4.818	1.97e-06	0.223697	27	0.046429	yes	NERVET
chr1_1319461_C_G_b38	ATAD3C	4.818	1.97e-06	0.223697	27	0.046429	yes	NERVET
chr1_1320023_TG_T_b38	ATAD3C	4.818	1.97e-06	0.223697	27	0.046429	yes	NERVET
chr1_1353091_C_T_b38	ATAD3C	4.81	2.05e-06	0.234423	9	0.04874	yes	NERVET
chr1_1489916_C_T_b38	ATAD3C	-4.803	2.11e-06	-0.201698	21	0.04199	yes	NERVET
chr1_1415221_G_T_b38	ATAD3C	-4.801	2.13e-06	-0.204225	14	0.042536	yes	NERVET
chr1_1353443_A_G_b38	ATAD3C	4.8	2.14e-06	0.230491	10	0.048015	yes	NERVET
chr1_1411525_T_A_b38	ATAD3C	-4.782	2.34e-06	-0.213926	22	0.044738	yes	NERVET
chr1_1242865_C_T_b38	ATAD3C	-4.782	2.34e-06	-0.192864	11	0.040335	yes	NERVET
chr1_1357046_C_G_b38	ATAD3C	4.74	2.86e-06	0.225842	22	0.04765	yes	NERVET
chr1_1357369_C_T_b38	ATAD3C	4.74	2.86e-06	0.225842	22	0.04765	yes	NERVET
chr1_1360023_T_C_b38	ATAD3C	4.74	2.86e-06	0.225842	22	0.04765	yes	NERVET
chr1_1579717_T_A_b38	ATAD3C	-4.738	2.88e-06	-0.147478	33	0.031128	yes	NERVET
chr1_1318756_G_A_b38	ATAD3C	4.737	2.9e-06	0.220034	26	0.046454	yes	NERVET
chr1_1580890_C_T_b38	ATAD3C	-4.735	2.92e-06	-0.152914	29	0.032294	yes	NERVET
chr1_1243102_A_G_b38	ATAD3C	-4.725	3.05e-06	-0.188773	13	0.039948	yes	NERVET
chr1_1374694_C_G_b38	ATAD3C	4.724	3.07e-06	0.247906	7	0.052472	yes	NERVET
chr1_1251368_T_C_b38	ATAD3C	-4.715	3.2e-06	-0.188106	12	0.039891	yes	NERVET
chr1_1410616_G_T_b38	ATAD3C	-4.691	3.59e-06	-0.213969	24	0.045615	yes	NERVET
chr1_1412488_C_CAG_b38	ATAD3C	-4.691	3.59e-06	-0.213969	24	0.045615	yes	NERVET
chr1_1251285_G_A_b38	ATAD3C	-4.691	3.59e-06	-0.186166	13	0.039689	yes	NERVET
chr1_1324788_C_A_b38	ATAD3C	4.687	3.65e-06	0.212827	22	0.045403	yes	NERVET
chr1_1358907_C_A_b38	ATAD3C	4.685	3.68e-06	0.221504	22	0.047275	yes	NERVET
chr1_1408286_G_A_b38	ATAD3C	-4.684	3.7e-06	-0.220308	7	0.047033	yes	NERVET
chr1_1483898_G_A_b38	ATAD3C	-4.684	3.71e-06	-0.2017	40	0.043065	yes	NERVET
chr1_1486151_C_A_b38	ATAD3C	-4.684	3.71e-06	-0.2017	40	0.043065	yes	NERVET
chr1_1327982_G_A_b38	ATAD3C	4.67	3.96e-06	0.220415	24	0.047201	yes	NERVET
chr1_1486611_G_A_b38	ATAD3C	-4.668	3.98e-06	-0.203439	26	0.043577	yes	NERVET
chr1_1553018_CA_C_b38	ATAD3C	-4.666	4.03e-06	-0.153136	23	0.03282	yes	NERVET
chr1_1251618_G_A_b38	ATAD3C	-4.658	4.18e-06	-0.186068	12	0.039945	yes	NERVET
chr1_1290261_C_A_b38	ATAD3C	-4.65	4.34e-06	-0.187202	34	0.040257	yes	NERVET
chr1_1361836_A_G_b38	ATAD3C	4.648	4.38e-06	0.256527	4	0.055192	yes	NERVET
chr1_1553791_CA_C_b38	ATAD3C	-4.648	4.39e-06	-0.150558	32	0.032394	yes	NERVET
chr1_1418000_T_C_b38	ATAD3C	-4.645	4.45e-06	-0.20141	15	0.043362	yes	NERVET
chr1_1418223_A_G_b38	ATAD3C	-4.645	4.45e-06	-0.20141	15	0.043362	yes	NERVET
chr1_1418252_A_G_b38	ATAD3C	-4.645	4.45e-06	-0.20141	15	0.043362	yes	NERVET
chr1_1327211_C_T_b38	ATAD3C	4.624	4.88e-06	0.218186	23	0.047181	yes	NERVET
chr1_1479334_A_G_b38	ATAD3C	-4.624	4.89e-06	-0.225938	37	0.048859	yes	NERVET
chr1_1246371_T_C_b38	ATAD3C	-4.617	5.05e-06	-0.182721	18	0.039572	yes	NERVET
chr1_1411929_G_C_b38	ATAD3C	-4.603	5.4e-06	-0.211216	23	0.045888	yes	NERVET
chr1_1551523_T_C_b38	ATAD3C	-4.601	5.45e-06	-0.14382	31	0.03126	yes	NERVET
chr1_1409306_A_G_b38	ATAD3C	-4.599	5.48e-06	-0.215595	7	0.046875	yes	NERVET
chr1_1303959_T_G_b38	ATAD3C	4.599	5.49e-06	0.213028	27	0.04632	yes	NERVET
chr1_1417031_A_G_b38	ATAD3C	-4.596	5.58e-06	-0.205336	13	0.04468	yes	NERVET
chr1_1472158_C_G_b38	ATAD3C	-4.591	5.68e-06	-0.214318	19	0.046677	yes	NERVET
chr1_1296939_G_A_b38	ATAD3C	-4.561	6.53e-06	-0.207264	26	0.045442	yes	NERVET
chr1_1327586_C_T_b38	ATAD3C	4.56	6.55e-06	0.211065	11	0.046282	yes	NERVET
chr1_1460021_C_CTG_b38	ATAD3C	-4.56	6.56e-06	-0.209504	24	0.045943	yes	NERVET
chr1_1460022_CAG_C_b38	ATAD3C	-4.56	6.56e-06	-0.209504	24	0.045943	yes	NERVET
chr1_1418181_A_G_b38	ATAD3C	-4.557	6.64e-06	-0.200033	14	0.043892	yes	NERVET
chr1_1281631_A_C_b38	ATAD3C	-4.546	6.98e-06	-0.195591	16	0.043021	yes	NERVET
chr1_1337736_A_G_b38	ATAD3C	4.521	7.84e-06	0.209891	11	0.046427	yes	NERVET
chr1_1241831_G_C_b38	ATAD3C	-4.518	7.95e-06	-0.198772	4	0.043997	yes	NERVET
chr1_1423062_C_T_b38	ATAD3C	-4.517	7.99e-06	-0.213844	9	0.047347	yes	NERVET
chr1_1330080_T_C_b38	ATAD3C	4.511	8.22e-06	0.213549	22	0.047345	yes	NERVET
chr1_1524664_A_G_b38	ATAD3C	-4.509	8.27e-06	-0.158252	53	0.035096	yes	NERVET
chr1_1322866_A_C_b38	ATAD3C	4.473	9.72e-06	0.209891	22	0.046923	yes	NERVET
chr1_1523022_A_G_b38	ATAD3C	-4.463	1.02e-05	-0.196487	21	0.044024	yes	NERVET
chr1_1360507_T_TGGGGGGC_b38	ATAD3C	4.43	1.18e-05	0.19398	4	0.04379	yes	NERVET
chr1_1427080_C_T_b38	ATAD3C	-4.429	1.18e-05	-0.245257	4	0.055375	yes	NERVET
chr1_1415011_A_G_b38	ATAD3C	-4.398	1.36e-05	-0.192312	14	0.043732	yes	NERVET
chr1_1545968_T_C_b38	ATAD3C	-4.394	1.38e-05	-0.133893	36	0.030475	yes	NERVET
chr1_1368047_ACT_A_b38	ATAD3C	4.391	1.4e-05	0.210024	19	0.047829	yes	NERVET
chr1_1516110_G_A_b38	ATAD3C	-4.387	1.42e-05	-0.240851	14	0.054896	yes	NERVET
chr1_1415385_T_C_b38	ATAD3C	-4.387	1.43e-05	-0.192147	14	0.043803	yes	NERVET
chr1_1415659_G_C_b38	ATAD3C	-4.387	1.43e-05	-0.192147	14	0.043803	yes	NERVET
chr1_1417561_A_G_b38	ATAD3C	-4.387	1.43e-05	-0.192147	14	0.043803	yes	NERVET
chr1_1243545_G_A_b38	ATAD3C	-4.355	1.64e-05	-0.190091	7	0.043648	yes	NERVET
chr1_1243929_G_A_b38	ATAD3C	-4.355	1.64e-05	-0.190091	7	0.043648	yes	NERVET
chr1_1417046_C_T_b38	ATAD3C	-4.355	1.64e-05	-0.197831	12	0.045428	yes	NERVET
chr1_1516109_T_C_b38	ATAD3C	-4.332	1.81e-05	-0.232637	14	0.053697	yes	NERVET
chr1_1568428_C_G_b38	ATAD3C	-4.332	1.81e-05	-0.130585	39	0.030144	yes	NERVET
chr1_1415754_CCGCT_C_b38	ATAD3C	-4.331	1.82e-05	-0.193227	12	0.044617	yes	NERVET
chr1_1415762_ATCCGCT_A_b38	ATAD3C	-4.331	1.82e-05	-0.193227	12	0.044617	yes	NERVET
chr1_1428763_A_G_b38	ATAD3C	-4.326	1.86e-05	-0.212799	16	0.049191	yes	NERVET
chr1_1417000_C_T_b38	ATAD3C	-4.312	1.98e-05	-0.192665	13	0.044678	yes	NERVET
chr1_1410590_A_G_b38	ATAD3C	-4.311	1.99e-05	-0.191027	13	0.044307	yes	NERVET
chr1_1413898_T_C_b38	ATAD3C	-4.311	1.99e-05	-0.191027	13	0.044307	yes	NERVET
chr1_1351517_G_C_b38	ATAD3C	4.28	2.28e-05	0.189536	13	0.044287	yes	NERVET
chr1_1425822_C_G_b38	ATAD3C	-4.223	2.9e-05	-0.233725	4	0.055343	yes	NERVET
chr1_1425936_G_A_b38	ATAD3C	-4.221	2.93e-05	-0.234771	4	0.055617	yes	NERVET
chr1_1243650_G_A_b38	ATAD3C	-4.214	3.02e-05	-0.178772	9	0.042425	yes	NERVET
chr1_1244603_G_A_b38	ATAD3C	-4.212	3.05e-05	-0.17201	12	0.040843	yes	NERVET
chr1_1238231_G_A_b38	ATAD3C	-4.201	3.19e-05	-0.14665	25	0.034905	yes	NERVET
chr1_1282706_C_T_b38	ATAD3C	-4.192	3.31e-05	-0.163461	35	0.038993	yes	NERVET
chr1_1570568_AC_A_b38	ATAD3C	-4.187	3.38e-05	-0.132332	34	0.031603	yes	NERVET
chr1_1479205_A_C_b38	ATAD3C	-4.18	3.49e-05	-0.168809	24	0.040385	yes	NERVET
chr1_1315752_GAGCGAGGGAGGTGGGGGCGGGGAGGGAGGGAGGGAGGCGGGC_G_b38	ATAD3C	4.179	3.5e-05	0.136946	25	0.032768	yes	NERVET
chr1_1301426_A_AT_b38	ATAD3C	-4.151	3.95e-05	-0.157809	21	0.03802	yes	NERVET
chr1_1215852_T_C_b38	ATAD3C	-4.147	4.01e-05	-0.147185	17	0.035491	yes	NERVET
chr1_1426771_G_C_b38	ATAD3C	-4.146	4.03e-05	-0.234019	3	0.056443	yes	NERVET
chr1_1241217_T_C_b38	ATAD3C	-4.143	4.08e-05	-0.167663	12	0.040468	yes	NERVET
chr1_1275091_T_C_b38	ATAD3C	-4.141	4.11e-05	-0.162553	35	0.039251	yes	NERVET
chr1_1277844_T_A_b38	ATAD3C	-4.129	4.33e-05	-0.162505	34	0.039359	yes	NERVET
chr1_1534218_C_G_b38	ATAD3C	-4.128	4.34e-05	-0.114194	140	0.027663	yes	NERVET
chr1_1534219_G_C_b38	ATAD3C	-4.128	4.34e-05	-0.114194	140	0.027663	yes	NERVET
chr1_1274972_A_G_b38	ATAD3C	-4.093	5.03e-05	-0.161223	34	0.039389	yes	NERVET
chr1_1278407_T_TA_b38	ATAD3C	-4.086	5.18e-05	-0.159747	34	0.039099	yes	NERVET
chr1_1572877_TGG_T_b38	ATAD3C	-4.076	5.4e-05	-0.228517	4	0.056064	yes	NERVET
chr1_1474201_CT_C_b38	ATAD3C	-4.076	5.4e-05	-0.161754	37	0.039687	yes	NERVET
chr1_1231710_CCCCCGGGAA_C_b38	ATAD3C	-4.067	5.59e-05	-0.159149	14	0.039128	yes	NERVET
chr1_1216593_G_C_b38	ATAD3C	-4.057	5.83e-05	-0.147837	14	0.036439	yes	NERVET
chr1_1281640_G_C_b38	ATAD3C	-4.055	5.87e-05	-0.188218	9	0.046411	yes	NERVET
chr1_1281878_G_C_b38	ATAD3C	-4.055	5.87e-05	-0.188218	9	0.046411	yes	NERVET
chr1_1235602_C_A_b38	ATAD3C	-4.039	6.29e-05	-0.164461	8	0.04072	yes	NERVET
chr1_1363153_T_G_b38	ATAD3C	4.035	6.39e-05	0.193559	20	0.047971	yes	NERVET
chr1_1425750_T_C_b38	ATAD3C	-4.023	6.71e-05	-0.220396	4	0.05478	yes	NERVET
chr1_1416747_CT_C_b38	ATAD3C	-4.018	6.84e-05	-0.174786	13	0.043496	yes	NERVET
chr1_1485282_A_G_b38	ATAD3C	-4.017	6.88e-05	-0.243428	12	0.060601	yes	NERVET
chr1_1277269_T_C_b38	ATAD3C	-4.009	7.11e-05	-0.158102	33	0.039438	yes	NERVET
chr1_1533653_C_T_b38	ATAD3C	-4.004	7.25e-05	-0.225079	11	0.056209	yes	NERVET
chr1_1362790_A_ATT_b38	ATAD3C	4.002	7.3e-05	0.171616	5	0.042877	yes	NERVET
chr1_1571434_C_CA_b38	ATAD3C	-3.993	7.59e-05	-0.125419	47	0.031409	yes	NERVET
chr1_1360502_G_GGGGGCGGGC_b38	ATAD3C	3.99	7.69e-05	0.181044	4	0.045375	yes	NERVET
chr1_1288085_GC_G_b38	ATAD3C	-3.979	8.03e-05	-0.166639	9	0.041877	yes	NERVET
chr1_1424078_G_A_b38	ATAD3C	-3.979	8.05e-05	-0.179458	10	0.045104	yes	NERVET
chr1_1424220_A_G_b38	ATAD3C	-3.979	8.05e-05	-0.179458	10	0.045104	yes	NERVET
chr1_1236037_C_T_b38	ATAD3C	-3.979	8.05e-05	-0.109369	93	0.027489	yes	NERVET
chr1_1461682_A_G_b38	ATAD3C	-3.959	8.71e-05	-0.283432	4	0.071592	yes	NERVET
chr1_1476079_T_C_b38	ATAD3C	-3.946	9.19e-05	-0.165496	39	0.041941	yes	NERVET
chr1_1548572_A_AC_b38	ATAD3C	-3.941	9.37e-05	-0.24159	7	0.061301	yes	NERVET
chr1_1182832_T_C_b38	ATAD3C	-3.923	0.000101	-0.12191	66	0.031074	yes	NERVET
chr1_1424102_G_T_b38	ATAD3C	-3.906	0.000108	-0.175425	11	0.044913	yes	NERVET
chr1_1490046_G_A_b38	ATAD3C	-3.901	0.00011	-0.184016	7	0.047177	yes	NERVET
chr1_1490047_A_G_b38	ATAD3C	-3.901	0.00011	-0.184016	7	0.047177	yes	NERVET
chr1_1229369_G_GC_b38	ATAD3C	-3.898	0.000111	-0.138738	20	0.035593	yes	NERVET
chr1_1231507_T_C_b38	ATAD3C	-3.896	0.000112	-0.143057	13	0.03672	yes	NERVET
chr1_1362780_CAAA_C_b38	ATAD3C	3.893	0.000114	0.164602	6	0.042282	yes	NERVET
chr1_1263831_T_TA_b38	ATAD3C	-3.876	0.000122	-0.189016	5	0.048772	yes	NERVET
chr1_1976834_T_C_b38	ATAD3C	-3.864	0.000127	-0.270445	15	0.069989	yes	NERVET
chr1_1476515_AT_A_b38	ATAD3C	-3.858	0.000131	-0.168911	4	0.043781	yes	NERVET
chr1_1525526_C_T_b38	ATAD3C	-3.839	0.000141	-0.219339	10	0.057141	yes	NERVET
chr1_1341030_C_A_b38	ATAD3C	3.816	0.000154	0.175019	23	0.045864	yes	NERVET
chr1_1254681_A_G_b38	ATAD3C	-3.787	0.000172	-0.187472	11	0.0495	yes	NERVET
chr1_1226486_C_T_b38	ATAD3C	-3.778	0.000179	-0.154313	7	0.040843	yes	NERVET
chr1_1423191_T_A_b38	ATAD3C	-3.758	0.000193	-0.170405	10	0.045339	yes	NERVET
chr1_1423343_G_T_b38	ATAD3C	-3.758	0.000193	-0.170897	10	0.045474	yes	NERVET
chr1_1423478_C_T_b38	ATAD3C	-3.758	0.000193	-0.170897	10	0.045474	yes	NERVET
chr1_1240580_G_GC_b38	ATAD3C	-3.726	0.000219	-0.154984	8	0.041593	yes	NERVET
chr1_1425135_T_C_b38	ATAD3C	-3.714	0.000229	-0.202805	4	0.054608	yes	NERVET
chr1_1277830_C_CA_b38	ATAD3C	-3.671	0.00027	-0.160005	15	0.043589	yes	NERVET
chr1_1479683_T_G_b38	ATAD3C	-3.67	0.000271	-0.191904	36	0.052294	yes	NERVET
chr1_1480096_G_C_b38	ATAD3C	-3.67	0.000271	-0.191904	36	0.052294	yes	NERVET
chr1_1532105_T_C_b38	ATAD3C	-3.668	0.000273	-0.193336	23	0.052704	yes	NERVET
chr1_1533253_C_T_b38	ATAD3C	-3.668	0.000273	-0.193336	23	0.052704	yes	NERVET
chr1_1367175_C_T_b38	ATAD3C	3.654	0.000288	0.239626	6	0.065578	yes	NERVET
chr1_1351587_A_G_b38	ATAD3C	3.644	0.000299	0.295064	3	0.080966	yes	NERVET
chr1_1248864_T_C_b38	ATAD3C	-3.638	0.000306	-0.152509	11	0.041921	yes	NERVET
chr1_1175206_T_C_b38	ATAD3C	-3.636	0.000308	-0.108518	99	0.029846	yes	NERVET
chr1_1274256_A_G_b38	ATAD3C	-3.634	0.000311	-0.151113	25	0.041585	yes	NERVET
chr1_1527938_C_A_b38	ATAD3C	-3.631	0.000314	-0.226594	8	0.06241	yes	NERVET
chr1_1554241_T_C_b38	ATAD3C	-3.63	0.000315	-0.115388	46	0.031785	yes	NERVET
chr1_1228424_C_T_b38	ATAD3C	-3.627	0.000319	-0.134084	11	0.036966	yes	NERVET
chr1_1278491_C_CT_b38	ATAD3C	-3.615	0.000334	-0.156159	14	0.043202	yes	NERVET
chr1_1572877_TG_T_b38	ATAD3C	-3.597	0.000357	-0.119285	22	0.033165	yes	NERVET
chr1_1279698_A_G_b38	ATAD3C	-3.591	0.000365	-0.149846	23	0.041727	yes	NERVET
chr1_1366923_AGTTG_A_b38	ATAD3C	-3.587	0.00037	-0.21307	7	0.059395	yes	NERVET
chr1_1274980_C_T_b38	ATAD3C	-3.585	0.000373	-0.149759	24	0.041773	yes	NERVET
chr1_1275912_C_T_b38	ATAD3C	-3.585	0.000373	-0.149759	24	0.041773	yes	NERVET
chr1_1502497_C_T_b38	ATAD3C	-3.551	0.000424	-0.175837	4	0.049522	yes	NERVET
chr1_1533095_G_A_b38	ATAD3C	-3.551	0.000424	-0.188253	22	0.053019	yes	NERVET
chr1_1362470_A_T_b38	ATAD3C	3.549	0.000426	0.139011	4	0.039167	yes	NERVET
chr1_1319056_A_G_b38	ATAD3C	3.548	0.000428	0.210862	3	0.059428	yes	NERVET
chr1_1239126_C_CT_b38	ATAD3C	-3.547	0.00043	-0.151088	7	0.042599	yes	NERVET
chr1_1239127_A_ACATGCATCC_b38	ATAD3C	-3.547	0.00043	-0.151088	7	0.042599	yes	NERVET
chr1_1239574_T_C_b38	ATAD3C	-3.547	0.00043	-0.151088	7	0.042599	yes	NERVET
chr1_1279728_TG_T_b38	ATAD3C	-3.54	0.000441	-0.147378	24	0.041631	yes	NERVET
chr1_1551679_G_A_b38	ATAD3C	-3.536	0.000447	-0.251771	3	0.071202	yes	NERVET
chr1_1334606_G_A_b38	ATAD3C	-3.51	0.000493	-0.204347	3	0.058225	yes	NERVET
chr1_1340576_C_T_b38	ATAD3C	-3.51	0.000493	-0.204347	3	0.058225	yes	NERVET
chr1_1341362_GAC_G_b38	ATAD3C	-3.51	0.000493	-0.204347	3	0.058225	yes	NERVET
chr1_1258333_C_G_b38	ATAD3C	-3.504	0.000503	-0.170055	14	0.048529	yes	NERVET
chr1_1258343_A_C_b38	ATAD3C	-3.504	0.000503	-0.170055	14	0.048529	yes	NERVET
chr1_1279694_A_G_b38	ATAD3C	-3.5	0.00051	-0.146535	23	0.041862	yes	NERVET
chr1_1971277_GCA_G_b38	ATAD3C	-3.499	0.000512	-0.249099	10	0.071193	yes	NERVET
chr1_1451726_A_G_b38	ATAD3C	-3.486	0.000537	-0.234172	6	0.067175	yes	NERVET
chr1_1210101_CAA_C_b38	ATAD3C	-3.485	0.000539	-0.153367	5	0.044005	yes	NERVET
chr1_1303675_C_CCCT_b38	ATAD3C	3.48	0.00055	0.142263	6	0.040884	yes	NERVET
chr1_1423368_G_A_b38	ATAD3C	-3.475	0.000559	-0.160298	9	0.046125	yes	NERVET
chr1_931131_C_CCCCT_b38	ATAD3C	3.445	0.000623	0.135163	60	0.039232	yes	NERVET
chr1_1531601_A_G_b38	ATAD3C	-3.438	0.00064	-0.180337	26	0.05246	yes	NERVET
chr1_1975785_C_T_b38	ATAD3C	-3.431	0.000655	-0.24387	10	0.071073	yes	NERVET
chr1_1329159_G_C_b38	ATAD3C	3.422	0.000676	0.187669	3	0.054837	yes	NERVET
chr1_1725697_T_C_b38	ATAD3C	3.41	0.000706	0.114379	43	0.033541	yes	NERVET
chr1_1426175_T_C_b38	ATAD3C	-3.402	0.000727	-0.166349	14	0.048897	yes	NERVET
chr1_1546845_A_AAAC_b38	ATAD3C	-3.396	0.000744	-0.14437	15	0.042516	yes	NERVET
chr1_1510122_G_C_b38	ATAD3C	-3.394	0.000749	-0.169256	3	0.049871	yes	NERVET
chr1_1366987_GTGTGTAGTGGATGAGTGTGGA_G_b38	ATAD3C	-3.385	0.000773	-0.21272	7	0.062846	yes	NERVET
chr1_1284756_A_G_b38	ATAD3C	-3.378	0.000793	-0.151227	36	0.044774	yes	NERVET
chr1_1567912_C_CAAAAAAAA_b38	ATAD3C	-3.37	0.000814	-0.159415	14	0.047298	yes	NERVET
chr1_1531133_G_A_b38	ATAD3C	-3.369	0.000817	-0.182462	17	0.054158	yes	NERVET
chr1_1336562_C_T_b38	ATAD3C	-3.366	0.000826	-0.198557	3	0.058985	yes	NERVET
chr1_1457614_AC_A_b38	ATAD3C	-3.366	0.000827	-0.313343	3	0.093093	yes	NERVET
chr1_1367040_ATTGG_A_b38	ATAD3C	-3.358	0.00085	-0.222462	3	0.06625	yes	NERVET
chr1_1554246_C_T_b38	ATAD3C	-3.353	0.000865	-0.106464	49	0.031751	yes	NERVET
chr1_1976709_G_A_b38	ATAD3C	-3.352	0.000867	-0.239533	9	0.071452	yes	NERVET
chr1_1240367_A_G_b38	ATAD3C	-3.326	0.000951	-0.14266	6	0.042891	yes	NERVET
chr1_1363601_A_AT_b38	ATAD3C	3.314	0.000993	0.089179	150	0.026912	yes	NERVET
chr1_1225476_T_C_b38	ATAD3C	-3.311	0.001	-0.138111	10	0.041714	yes	NERVET
chr1_1226013_C_T_b38	ATAD3C	-3.311	0.001	-0.138111	10	0.041714	yes	NERVET
chr1_1524911_C_T_b38	ATAD3C	-3.306	0.00102	-0.188323	12	0.056963	yes	NERVET
chr1_1531448_C_T_b38	ATAD3C	-3.296	0.00106	-0.172791	23	0.05242	yes	NERVET
chr1_1533178_A_G_b38	ATAD3C	-3.296	0.00106	-0.172791	23	0.05242	yes	NERVET
chr1_1585973_T_TAATAATAATAATAATAATAATAAA_b38	ATAD3C	3.292	0.00107	0.118878	30	0.036108	yes	NERVET
chr1_1228069_T_C_b38	ATAD3C	-3.284	0.0011	-0.144503	4	0.044005	yes	NERVET
chr1_1424727_C_A_b38	ATAD3C	-3.28	0.00112	-0.201079	8	0.061309	yes	NERVET
chr1_1248905_G_C_b38	ATAD3C	-3.278	0.00112	-0.159181	11	0.04856	yes	NERVET
chr1_1223644_C_T_b38	ATAD3C	-3.273	0.00114	-0.140253	7	0.042848	yes	NERVET
chr1_1182018_A_G_b38	ATAD3C	-3.252	0.00123	-0.094686	108	0.029113	yes	NERVET
chr1_1230462_A_ATTT_b38	ATAD3C	-3.237	0.00129	-0.15474	4	0.047801	yes	NERVET
chr1_1306149_A_G_b38	ATAD3C	3.236	0.0013	0.189473	4	0.058542	yes	NERVET
chr1_1502507_A_T_b38	ATAD3C	-3.232	0.00132	-0.213504	5	0.066059	yes	NERVET
chr1_1285574_G_A_b38	ATAD3C	-3.232	0.00132	-0.149967	33	0.046405	yes	NERVET
chr1_1570655_G_A_b38	ATAD3C	-3.226	0.00135	-0.118925	17	0.036869	yes	NERVET
chr1_1227685_G_A_b38	ATAD3C	-3.212	0.00141	-0.160202	6	0.049874	yes	NERVET
chr1_1192776_CAGTGTAGACACTCCAGTTGGTATG_C_b38	ATAD3C	3.209	0.00143	0.154896	4	0.048272	yes	NERVET
chr1_1510841_C_T_b38	ATAD3C	-3.205	0.00145	-0.16015	3	0.049974	yes	NERVET
chr1_1223640_A_G_b38	ATAD3C	-3.187	0.00153	-0.13953	5	0.043775	yes	NERVET
chr1_1275583_T_C_b38	ATAD3C	-3.179	0.00158	-0.14991	19	0.047154	yes	NERVET
chr1_1277415_C_A_b38	ATAD3C	-3.179	0.00158	-0.14991	19	0.047154	yes	NERVET
chr1_1278556_G_A_b38	ATAD3C	-3.179	0.00158	-0.14991	19	0.047154	yes	NERVET
chr1_1255533_CT_C_b38	ATAD3C	-3.163	0.00166	-0.184336	5	0.058276	yes	NERVET
chr1_1257135_A_G_b38	ATAD3C	-3.163	0.00166	-0.184336	5	0.058276	yes	NERVET
chr1_1264812_C_G_b38	ATAD3C	-3.163	0.00166	-0.184336	5	0.058276	yes	NERVET
chr1_1579410_AT_A_b38	ATAD3C	-3.163	0.00167	-0.10596	35	0.033503	yes	NERVET
chr1_969780_C_T_b38	ATAD3C	3.162	0.00167	0.121544	32	0.03844	yes	NERVET
chr1_1367047_AGTGTGAAT_A_b38	ATAD3C	-3.157	0.0017	-0.213557	3	0.067647	yes	NERVET
chr1_1224783_G_A_b38	ATAD3C	-3.155	0.00171	-0.131867	6	0.041795	yes	NERVET
chr1_1533855_G_A_b38	ATAD3C	-3.154	0.00172	-0.122603	12	0.038871	yes	NERVET
chr1_1366976_GTTGAA_G_b38	ATAD3C	-3.154	0.00172	-0.192149	7	0.060932	yes	NERVET
chr1_1254283_G_A_b38	ATAD3C	-3.142	0.00178	-0.18183	5	0.057863	yes	NERVET
chr1_1553619_CAAAAAAA_C_b38	ATAD3C	-3.137	0.00182	-0.102427	34	0.032652	yes	NERVET
chr1_1287315_G_C_b38	ATAD3C	-3.128	0.00187	-0.155814	12	0.049807	yes	NERVET
chr1_1527957_C_T_b38	ATAD3C	-3.126	0.00188	-0.195326	8	0.062475	yes	NERVET
chr1_1236303_A_G_b38	ATAD3C	-3.12	0.00192	-0.119221	14	0.038213	yes	NERVET
chr1_1221355_T_C_b38	ATAD3C	-3.108	0.002	-0.137365	4	0.044191	yes	NERVET
chr1_1222580_T_C_b38	ATAD3C	-3.108	0.002	-0.133478	7	0.042945	yes	NERVET
chr1_1222594_A_G_b38	ATAD3C	-3.108	0.002	-0.133478	7	0.042945	yes	NERVET
chr1_1235997_A_G_b38	ATAD3C	-3.096	0.00208	-0.12656	15	0.040883	yes	NERVET
chr1_1223568_A_G_b38	ATAD3C	-3.093	0.0021	-0.131596	8	0.042553	yes	NERVET
chr1_1455134_T_A_b38	ATAD3C	-3.085	0.00216	-0.206079	5	0.066801	yes	NERVET
chr1_1499586_C_CT_b38	ATAD3C	-3.082	0.00218	-0.127287	20	0.041302	yes	NERVET
chr1_1367055_T_TGA_b38	ATAD3C	-3.078	0.00221	-0.189498	7	0.061566	yes	NERVET
chr1_1345112_C_T_b38	ATAD3C	-3.054	0.00239	-0.179886	3	0.058907	yes	NERVET
chr1_1346453_C_T_b38	ATAD3C	-3.054	0.00239	-0.179886	3	0.058907	yes	NERVET
chr1_1180931_A_G_b38	ATAD3C	-3.053	0.0024	-0.089255	105	0.029234	yes	NERVET
chr1_1205055_G_T_b38	ATAD3C	-3.052	0.0024	-0.08873	95	0.029069	yes	NERVET
chr1_1340697_G_A_b38	ATAD3C	3.047	0.00245	0.096958	31	0.031825	yes	NERVET
chr1_1258052_T_G_b38	ATAD3C	-3.044	0.00247	-0.189375	5	0.062216	yes	NERVET
chr1_1973328_G_A_b38	ATAD3C	-3.042	0.00248	-0.23577	6	0.077502	yes	NERVET
chr1_1453697_C_T_b38	ATAD3C	-3.042	0.00249	-0.201939	5	0.066393	yes	NERVET
chr1_1985343_C_A_b38	ATAD3C	-3.035	0.00254	-0.242816	5	0.080008	yes	NERVET
chr1_1985367_C_T_b38	ATAD3C	-3.035	0.00254	-0.242816	5	0.080008	yes	NERVET
chr1_1986857_C_T_b38	ATAD3C	-3.035	0.00254	-0.242816	5	0.080008	yes	NERVET
chr1_1448775_G_GT_b38	ATAD3C	-3.022	0.00265	-0.160774	3	0.0532	yes	NERVET
chr1_1172462_G_C_b38	ATAD3C	-3.02	0.00267	-0.143532	5	0.047532	yes	NERVET
chr1_1367046_G_C_b38	ATAD3C	-3.018	0.00268	-0.184259	7	0.061051	yes	NERVET
chr1_1221960_A_G_b38	ATAD3C	-3.017	0.0027	-0.132267	5	0.043844	yes	NERVET
chr1_1221992_G_A_b38	ATAD3C	-3.017	0.0027	-0.132267	5	0.043844	yes	NERVET
chr1_1222167_T_C_b38	ATAD3C	-3.017	0.0027	-0.132267	5	0.043844	yes	NERVET
chr1_1222184_G_A_b38	ATAD3C	-3.017	0.0027	-0.132267	5	0.043844	yes	NERVET
chr1_1222251_G_A_b38	ATAD3C	-3.017	0.0027	-0.132267	5	0.043844	yes	NERVET
chr1_1222304_C_T_b38	ATAD3C	-3.017	0.0027	-0.132267	5	0.043844	yes	NERVET
chr1_1222325_C_G_b38	ATAD3C	-3.017	0.0027	-0.132267	5	0.043844	yes	NERVET
chr1_1222454_C_T_b38	ATAD3C	-3.017	0.0027	-0.132267	5	0.043844	yes	NERVET
chr1_1222482_C_T_b38	ATAD3C	-3.017	0.0027	-0.132267	5	0.043844	yes	NERVET
chr1_1222579_C_T_b38	ATAD3C	-3.017	0.0027	-0.132267	5	0.043844	yes	NERVET
chr1_1222611_G_A_b38	ATAD3C	-3.017	0.0027	-0.132267	5	0.043844	yes	NERVET
chr1_1222640_A_C_b38	ATAD3C	-3.017	0.0027	-0.132267	5	0.043844	yes	NERVET
chr1_1222897_G_A_b38	ATAD3C	-3.017	0.0027	-0.132267	5	0.043844	yes	NERVET
chr1_1222946_G_A_b38	ATAD3C	-3.017	0.0027	-0.132267	5	0.043844	yes	NERVET
chr1_1222977_A_G_b38	ATAD3C	-3.017	0.0027	-0.132267	5	0.043844	yes	NERVET
chr1_1223154_G_GAC_b38	ATAD3C	-3.017	0.0027	-0.132267	5	0.043844	yes	NERVET
chr1_1223182_AAC_A_b38	ATAD3C	-3.017	0.0027	-0.132267	5	0.043844	yes	NERVET
chr1_1223593_A_T_b38	ATAD3C	-3.017	0.0027	-0.132267	5	0.043844	yes	NERVET
chr1_1223595_A_C_b38	ATAD3C	-3.017	0.0027	-0.132267	5	0.043844	yes	NERVET
chr1_1223682_T_C_b38	ATAD3C	-3.017	0.0027	-0.132267	5	0.043844	yes	NERVET
chr1_1224105_C_T_b38	ATAD3C	-3.017	0.0027	-0.132267	5	0.043844	yes	NERVET
chr1_1224349_T_G_b38	ATAD3C	-3.017	0.0027	-0.132267	5	0.043844	yes	NERVET
chr1_1224844_C_T_b38	ATAD3C	-3.017	0.0027	-0.132267	5	0.043844	yes	NERVET
chr1_1224846_A_G_b38	ATAD3C	-3.017	0.0027	-0.132267	5	0.043844	yes	NERVET
chr1_1225429_T_C_b38	ATAD3C	-3.017	0.0027	-0.132267	5	0.043844	yes	NERVET
chr1_1225720_CGCCACAGACACGGGCCACACACTCCACAT_C_b38	ATAD3C	-3.017	0.0027	-0.132267	5	0.043844	yes	NERVET
chr1_1225982_A_G_b38	ATAD3C	-3.017	0.0027	-0.132267	5	0.043844	yes	NERVET
chr1_1226261_G_A_b38	ATAD3C	-3.017	0.0027	-0.132267	5	0.043844	yes	NERVET
chr1_1226334_AC_A_b38	ATAD3C	-3.017	0.0027	-0.132267	5	0.043844	yes	NERVET
chr1_1226338_TGTACGGTCAGGAGGAAACATGGCACCTCCCCTCTGGGGGCTCTTTCCAGAAACCCTCAACCC_T_b38	ATAD3C	-3.017	0.0027	-0.132267	5	0.043844	yes	NERVET
chr1_1227161_G_C_b38	ATAD3C	-3.017	0.0027	-0.132267	5	0.043844	yes	NERVET
chr1_1227792_T_C_b38	ATAD3C	-3.017	0.0027	-0.132267	5	0.043844	yes	NERVET
chr1_1227975_T_C_b38	ATAD3C	-3.017	0.0027	-0.132267	5	0.043844	yes	NERVET
chr1_1229160_G_T_b38	ATAD3C	-3.017	0.0027	-0.132267	5	0.043844	yes	NERVET
chr1_1229307_G_C_b38	ATAD3C	-3.017	0.0027	-0.132267	5	0.043844	yes	NERVET
chr1_1229900_GCA_G_b38	ATAD3C	-3.017	0.0027	-0.132267	5	0.043844	yes	NERVET
chr1_1229940_CAT_C_b38	ATAD3C	-3.017	0.0027	-0.132267	5	0.043844	yes	NERVET
chr1_1229981_A_G_b38	ATAD3C	-3.017	0.0027	-0.132267	5	0.043844	yes	NERVET
chr1_1230091_T_C_b38	ATAD3C	-3.017	0.0027	-0.132267	5	0.043844	yes	NERVET
chr1_1230345_A_G_b38	ATAD3C	-3.017	0.0027	-0.132267	5	0.043844	yes	NERVET
chr1_1230441_T_C_b38	ATAD3C	-3.017	0.0027	-0.132267	5	0.043844	yes	NERVET
chr1_1230695_G_A_b38	ATAD3C	-3.017	0.0027	-0.132267	5	0.043844	yes	NERVET
chr1_1230797_G_C_b38	ATAD3C	-3.017	0.0027	-0.132267	5	0.043844	yes	NERVET
chr1_1230825_C_T_b38	ATAD3C	-3.017	0.0027	-0.132267	5	0.043844	yes	NERVET
chr1_1458448_C_CT_b38	ATAD3C	-3.01	0.00275	-0.169365	6	0.056266	yes	NERVET
chr1_1235869_T_C_b38	ATAD3C	-3.008	0.00278	-0.138034	5	0.045893	yes	NERVET
chr1_1248709_A_G_b38	ATAD3C	-3.007	0.00278	-0.124382	13	0.04136	yes	NERVET
chr1_1221275_G_A_b38	ATAD3C	-2.996	0.00288	-0.13327	4	0.04448	yes	NERVET
chr1_1201373_T_C_b38	ATAD3C	-2.994	0.0029	-0.103756	31	0.034656	yes	NERVET
chr1_1222245_C_T_b38	ATAD3C	-2.99	0.00294	-0.131172	5	0.043874	yes	NERVET
chr1_1288341_C_T_b38	ATAD3C	-2.988	0.00296	-0.167152	8	0.055939	yes	NERVET
chr1_1170732_A_G_b38	ATAD3C	-2.988	0.00296	-0.237065	36	0.079345	yes	NERVET
chr1_1367036_GTGAATTGGT_G_b38	ATAD3C	-2.982	0.00301	-0.192033	6	0.064388	yes	NERVET
chr1_1227055_C_A_b38	ATAD3C	-2.981	0.00302	-0.130383	5	0.043732	yes	NERVET
chr1_1223727_G_A_b38	ATAD3C	-2.98	0.00304	-0.130631	5	0.043841	yes	NERVET
chr1_1240390_G_A_b38	ATAD3C	-2.965	0.00319	-0.138579	4	0.046741	yes	NERVET
chr1_1357963_T_C_b38	ATAD3C	-2.95	0.00334	-0.179452	3	0.060827	yes	NERVET
chr1_1248068_A_C_b38	ATAD3C	-2.95	0.00334	-0.144317	7	0.048926	yes	NERVET
chr1_1248069_A_C_b38	ATAD3C	-2.95	0.00334	-0.144317	7	0.048926	yes	NERVET
chr1_1248062_A_G_b38	ATAD3C	-2.944	0.00341	-0.144055	7	0.048937	yes	NERVET
chr1_1248063_T_C_b38	ATAD3C	-2.944	0.00341	-0.144055	7	0.048937	yes	NERVET
chr1_1248075_A_C_b38	ATAD3C	-2.944	0.00341	-0.144055	7	0.048937	yes	NERVET
chr1_1248091_G_A_b38	ATAD3C	-2.944	0.00341	-0.144055	7	0.048937	yes	NERVET
chr1_1248092_T_C_b38	ATAD3C	-2.944	0.00341	-0.144055	7	0.048937	yes	NERVET
chr1_1971331_C_A_b38	ATAD3C	-2.941	0.00344	-0.193057	10	0.065646	yes	NERVET
chr1_1225285_G_A_b38	ATAD3C	-2.936	0.00349	-0.127668	6	0.043489	yes	NERVET
chr1_1612560_G_GT_b38	ATAD3C	2.932	0.00354	0.086719	49	0.029577	yes	NERVET
chr1_1224281_GTTTTA_G_b38	ATAD3C	-2.931	0.00354	-0.136072	4	0.046419	yes	NERVET
chr1_1227886_G_A_b38	ATAD3C	-2.931	0.00354	-0.136072	4	0.046419	yes	NERVET
chr1_1230250_G_A_b38	ATAD3C	-2.931	0.00354	-0.136072	4	0.046419	yes	NERVET
chr1_1598099_C_G_b38	ATAD3C	-2.924	0.00363	-0.238231	6	0.081485	yes	NERVET
chr1_1226936_G_T_b38	ATAD3C	-2.924	0.00363	-0.132281	5	0.045246	yes	NERVET
chr1_1219159_G_A_b38	ATAD3C	-2.918	0.00369	-0.14141	4	0.048455	yes	NERVET
chr1_1388583_CTA_C_b38	ATAD3C	-2.912	0.00376	-0.139724	4	0.047981	yes	NERVET
chr1_1168157_C_T_b38	ATAD3C	-2.911	0.00377	-0.251717	4	0.086459	yes	NERVET
chr1_1219858_G_A_b38	ATAD3C	-2.902	0.00389	-0.10439	21	0.035972	yes	NERVET
chr1_1971066_C_T_b38	ATAD3C	-2.9	0.00391	-0.188231	12	0.064906	yes	NERVET
chr1_1572877_T_TG_b38	ATAD3C	2.899	0.00392	0.104296	18	0.035973	yes	NERVET
chr1_1971170_C_A_b38	ATAD3C	-2.897	0.00394	-0.210112	8	0.072518	yes	NERVET
chr1_1396190_GA_G_b38	ATAD3C	-2.897	0.00395	-0.14405	3	0.049725	yes	NERVET
chr1_1238883_G_A_b38	ATAD3C	-2.896	0.00396	-0.133852	4	0.046221	yes	NERVET
chr1_1322213_A_G_b38	ATAD3C	2.895	0.00398	0.157588	3	0.054444	yes	NERVET
chr1_1573265_C_CAAAA_b38	ATAD3C	-2.89	0.00404	-0.114819	23	0.039734	yes	NERVET
chr1_1454676_T_A_b38	ATAD3C	-2.887	0.00408	-0.192155	5	0.066567	yes	NERVET
chr1_1973692_T_C_b38	ATAD3C	-2.885	0.00409	-0.2281	6	0.079058	yes	NERVET
chr1_1260440_T_C_b38	ATAD3C	-2.885	0.0041	-0.165936	6	0.057524	yes	NERVET
chr1_1266260_T_C_b38	ATAD3C	-2.885	0.0041	-0.165936	6	0.057524	yes	NERVET
chr1_1184478_C_T_b38	ATAD3C	-2.879	0.00418	-0.119862	26	0.041638	yes	NERVET
chr1_1987886_G_A_b38	ATAD3C	-2.877	0.00421	-0.227096	5	0.078947	yes	NERVET
chr1_1971109_GCA_G_b38	ATAD3C	-2.872	0.00426	-0.231469	5	0.080582	yes	NERVET
chr1_1367013_TG_T_b38	ATAD3C	-2.863	0.00439	-0.180123	7	0.062921	yes	NERVET
chr1_1292517_A_G_b38	ATAD3C	-2.856	0.00449	-0.262504	3	0.091926	yes	NERVET
chr1_928309_A_G_b38	ATAD3C	2.855	0.0045	0.18713	14	0.065549	yes	NERVET
chr1_1193652_A_G_b38	ATAD3C	-2.853	0.00452	-0.147087	4	0.051551	yes	NERVET
chr1_1226892_C_T_b38	ATAD3C	-2.845	0.00464	-0.124361	5	0.043716	yes	NERVET
chr1_1324185_T_TGG_b38	ATAD3C	-2.84	0.00472	-0.156669	11	0.055175	yes	NERVET
chr1_1184277_G_C_b38	ATAD3C	-2.833	0.00481	-0.083601	105	0.029508	yes	NERVET
chr1_1771973_A_AT_b38	ATAD3C	2.832	0.00483	0.104721	60	0.036975	yes	NERVET
chr1_1193982_A_AC_b38	ATAD3C	-2.828	0.00488	-0.145041	4	0.051282	yes	NERVET
chr1_2436424_TCCTTTCTCCCTCCTCCCTTCCTCCCTTCCTCCCTCCACCTTTCCTCCTTCCTCCCTCCTCCCCTCCTCCCTCCTCCTCCTTTCCTCCTTCCTCCCTCCTCCTTTCCTCCTTCCTCCCTCCTC_T_b38	ATAD3C	-2.808	0.00519	-0.179661	9	0.063979	yes	NERVET
chr1_1182895_C_T_b38	ATAD3C	-2.807	0.00522	-0.143535	8	0.051143	yes	NERVET
chr1_1185051_G_A_b38	ATAD3C	-2.806	0.00523	-0.13978	7	0.049815	yes	NERVET
chr1_1203533_T_C_b38	ATAD3C	-2.806	0.00523	-0.135897	12	0.048433	yes	NERVET
chr1_1486354_G_C_b38	ATAD3C	-2.794	0.00542	-0.188587	8	0.067491	yes	NERVET
chr1_1479704_G_A_b38	ATAD3C	2.784	0.00559	0.120981	10	0.043456	yes	NERVET
chr1_1487487_C_CA_b38	ATAD3C	-2.781	0.00564	-0.144692	4	0.052022	yes	NERVET
chr1_1219941_C_T_b38	ATAD3C	-2.778	0.0057	-0.134385	5	0.048382	yes	NERVET
chr1_1367021_GGCGAGTATGGA_G_b38	ATAD3C	-2.774	0.00576	-0.178215	7	0.064248	yes	NERVET
chr1_1248218_A_G_b38	ATAD3C	-2.774	0.00577	-0.144533	15	0.052107	yes	NERVET
chr1_1216708_CT_C_b38	ATAD3C	-2.766	0.00591	-0.125755	4	0.045468	yes	NERVET
chr1_2200395_C_CA_b38	ATAD3C	-2.761	0.00599	-0.098115	18	0.035532	yes	NERVET
chr1_1226620_G_GC_b38	ATAD3C	-2.754	0.00612	-0.120147	5	0.043631	yes	NERVET
chr1_1366907_G_A_b38	ATAD3C	-2.752	0.00616	-0.1691	7	0.061456	yes	NERVET
chr1_1366911_A_T_b38	ATAD3C	-2.752	0.00616	-0.1691	7	0.061456	yes	NERVET
chr1_877371_T_C_b38	ATAD3C	2.743	0.00632	0.245058	4	0.089328	yes	NERVET
chr1_1235642_G_C_b38	ATAD3C	-2.732	0.00653	-0.107873	9	0.039482	yes	NERVET
chr1_1530568_G_T_b38	ATAD3C	-2.727	0.00664	-0.164862	8	0.060459	yes	NERVET
chr1_2205151_C_A_b38	ATAD3C	2.715	0.00687	0.138858	10	0.051143	yes	NERVET
chr1_1214801_G_C_b38	ATAD3C	-2.707	0.00705	-0.127343	5	0.047048	yes	NERVET
chr1_1265603_T_TTGTG_b38	ATAD3C	2.699	0.00722	0.094903	15	0.035168	yes	NERVET
chr1_1374801_A_G_b38	ATAD3C	-2.697	0.00726	-0.158249	6	0.058686	yes	NERVET
chr1_1214831_G_A_b38	ATAD3C	-2.691	0.00738	-0.127765	5	0.047478	yes	NERVET
chr1_1226901_G_A_b38	ATAD3C	-2.685	0.00751	-0.117536	5	0.043775	yes	NERVET
chr1_1682902_C_T_b38	ATAD3C	2.677	0.0077	0.137541	4	0.051384	yes	NERVET
chr1_1183348_C_G_b38	ATAD3C	-2.659	0.00811	-0.139263	3	0.052372	yes	NERVET
chr1_1993854_C_T_b38	ATAD3C	2.649	0.00836	0.104604	10	0.039494	yes	NERVET
chr1_1991116_A_G_b38	ATAD3C	-2.634	0.00871	-0.191577	9	0.072721	yes	NERVET
chr1_1332779_C_T_b38	ATAD3C	-2.633	0.00874	-0.142959	5	0.054287	yes	NERVET
chr1_1209119_GGA_G_b38	ATAD3C	-2.63	0.00882	-0.123761	5	0.047056	yes	NERVET
chr1_1209273_G_A_b38	ATAD3C	-2.63	0.00882	-0.123761	5	0.047056	yes	NERVET
chr1_1209316_T_C_b38	ATAD3C	-2.63	0.00882	-0.123761	5	0.047056	yes	NERVET
chr1_1210031_G_A_b38	ATAD3C	-2.63	0.00882	-0.123761	5	0.047056	yes	NERVET
chr1_1210061_A_G_b38	ATAD3C	-2.63	0.00882	-0.123761	5	0.047056	yes	NERVET
chr1_1210087_C_G_b38	ATAD3C	-2.63	0.00882	-0.123761	5	0.047056	yes	NERVET
chr1_1210386_C_G_b38	ATAD3C	-2.63	0.00882	-0.123761	5	0.047056	yes	NERVET
chr1_1534166_G_A_b38	ATAD3C	-2.63	0.00883	-0.073728	60	0.028034	yes	NERVET
chr1_1203822_T_C_b38	ATAD3C	-2.623	0.00901	-0.128111	12	0.048842	yes	NERVET
chr1_1215068_T_C_b38	ATAD3C	-2.596	0.00974	-0.123061	5	0.047412	yes	NERVET
chr1_2070779_G_A_b38	ATAD3C	-2.595	0.00977	-0.17281	15	0.066606	yes	NERVET
chr1_1502507_A_C_b38	ATAD3C	-2.594	0.00979	-0.180852	5	0.069725	yes	NERVET
chr1_1239925_G_A_b38	ATAD3C	-2.593	0.00983	-0.126073	4	0.048629	yes	NERVET
chr1_1480224_A_G_b38	ATAD3C	-5.374	1.23e-07	-0.351168	5	0.065346	no	NERVET
chr1_1324173_G_GGGCTCGGGGGCTGGGGGGCTGCTGGGCTGAGA_b38	ATAD3C	4.511	8.18e-06	0.102739	35	0.022773	no	NERVET
chr1_1497105_T_G_b38	ATAD3C	-4.163	3.75e-05	-0.200776	5	0.048231	no	NERVET
chr1_1499339_T_C_b38	ATAD3C	-3.804	0.000162	-0.226327	4	0.059497	no	NERVET
chr1_1372258_T_C_b38	ATAD3C	3.757	0.000194	0.207952	5	0.055358	no	NERVET
chr1_1573265_CAA_C_b38	ATAD3C	-3.42	0.000683	-0.209937	3	0.06139	no	NERVET
chr1_1213936_C_G_b38	ATAD3C	-3.321	0.000969	-0.224817	3	0.067702	no	NERVET
chr1_2118713_C_CTGTGTG_b38	ATAD3C	3.147	0.00175	0.105537	18	0.033531	no	NERVET
chr1_1306584_G_A_b38	ATAD3C	-3.062	0.00233	-0.215977	6	0.070537	no	NERVET
chr1_2436426_CTTT_C_b38	ATAD3C	-3.008	0.00277	-0.324639	3	0.10791	no	NERVET
chr1_1293731_A_ACGCCCCTGCCCTGGAGGCCC_b38	ATAD3C	2.975	0.00309	0.082782	76	0.027828	no	NERVET
chr1_1424819_C_T_b38	ATAD3C	-2.938	0.00347	-0.188734	7	0.064243	no	NERVET
chr1_2119213_C_CT_b38	ATAD3C	-2.83	0.00486	-0.09241	34	0.032657	no	NERVET
chr1_1712515_T_A_b38	ATAD3C	-2.803	0.00528	-0.093149	38	0.033233	no	NERVET
chr1_1321228_G_A_b38	ATAD3C	2.79	0.00548	0.108903	14	0.039028	no	NERVET
chr1_1495136_G_A_b38	ATAD3C	2.758	0.00604	0.130892	4	0.047455	no	NERVET
chr1_1515828_G_A_b38	ATAD3C	2.73	0.00657	0.130687	4	0.047863	no	NERVET
chr1_1312208_G_T_b38	ATAD3C	-2.711	0.00695	-0.184723	6	0.068128	no	NERVET
chr1_1485324_C_T_b38	ATAD3C	2.684	0.00754	0.126083	4	0.046978	no	NERVET
chr1_1366906_T_G_b38	ATAD3C	-2.64	0.00858	-0.195913	4	0.074216	no	NERVET
chr1_1102094_AAAC_A_b38	ATAD3C	2.633	0.00875	0.164324	3	0.062413	no	NERVET
chr1_1127664_A_G_b38	ATAD3C	-2.607	0.00944	-0.102782	8	0.039431	no	NERVET
chr1_807641_T_C_b38	ATAD3C	3.14	0.0021	0.116214	10	0.037015	yes	OVARY
chr1_1440430_C_G_b38	ATAD3C	-3.056	0.00273	-0.109438	15	0.035807	yes	OVARY
chr1_1363601_A_AT_b38	ATAD3C	3.026	0.003	0.088713	40	0.029313	yes	OVARY
chr1_599751_T_G_b38	ATAD3C	-2.958	0.00369	-0.148704	5	0.050264	yes	OVARY
chr1_2225467_A_AT_b38	ATAD3C	2.955	0.00372	0.116724	8	0.039494	yes	OVARY
chr1_1567912_C_CAAAAAAAA_b38	ATAD3C	-2.896	0.00445	-0.153237	5	0.052913	yes	OVARY
chr1_2352457_A_G_b38	ATAD3C	-2.823	0.00552	-0.08049	36	0.02851	yes	OVARY
chr1_2353459_T_G_b38	ATAD3C	-2.823	0.00552	-0.08049	36	0.02851	yes	OVARY
chr1_2356177_T_C_b38	ATAD3C	-2.823	0.00552	-0.08049	36	0.02851	yes	OVARY
chr1_2358849_T_C_b38	ATAD3C	-2.823	0.00552	-0.08049	36	0.02851	yes	OVARY
chr1_2360716_T_C_b38	ATAD3C	-2.823	0.00552	-0.08049	36	0.02851	yes	OVARY
chr1_2360970_T_C_b38	ATAD3C	-2.823	0.00552	-0.08049	36	0.02851	yes	OVARY
chr1_2361332_A_AG_b38	ATAD3C	-2.823	0.00552	-0.08049	36	0.02851	yes	OVARY
chr1_2361548_A_ACT_b38	ATAD3C	-2.823	0.00552	-0.08049	36	0.02851	yes	OVARY
chr1_2351722_A_G_b38	ATAD3C	-2.816	0.00564	-0.114666	7	0.040723	yes	OVARY
chr1_2352403_G_T_b38	ATAD3C	-2.807	0.00578	-0.079405	36	0.028285	yes	OVARY
chr1_2186119_C_T_b38	ATAD3C	-2.805	0.00583	-0.129211	3	0.046067	yes	OVARY
chr1_2357308_T_C_b38	ATAD3C	-2.794	0.00601	-0.079909	37	0.0286	yes	OVARY
chr1_1411323_A_C_b38	ATAD3C	-2.757	0.0067	-0.114673	22	0.041597	yes	OVARY
chr1_1363986_C_T_b38	ATAD3C	2.752	0.00679	0.118156	5	0.042933	yes	OVARY
chr1_2365236_C_T_b38	ATAD3C	2.715	0.00756	0.08331	28	0.030689	yes	OVARY
chr1_1365566_G_A_b38	ATAD3C	2.706	0.00775	0.115072	5	0.042529	yes	OVARY
chr1_2342734_T_C_b38	ATAD3C	2.706	0.00776	0.094472	13	0.034918	yes	OVARY
chr1_1367292_A_AGT_b38	ATAD3C	2.703	0.00782	0.114285	5	0.042284	yes	OVARY
chr1_1431014_G_A_b38	ATAD3C	-2.689	0.00814	-0.097849	11	0.036393	yes	OVARY
chr1_2150203_C_A_b38	ATAD3C	-2.684	0.00825	-0.120094	4	0.044749	yes	OVARY
chr1_2109346_A_G_b38	ATAD3C	2.673	0.0085	0.122144	4	0.04569	yes	OVARY
chr1_2109497_T_C_b38	ATAD3C	2.673	0.0085	0.122144	4	0.04569	yes	OVARY
chr1_1309988_G_A_b38	ATAD3C	2.672	0.00854	0.109872	22	0.041125	yes	OVARY
chr1_1313807_G_A_b38	ATAD3C	2.672	0.00854	0.109872	22	0.041125	yes	OVARY
chr1_673518_C_T_b38	ATAD3C	-2.622	0.00982	-0.102493	5	0.039092	yes	OVARY
chr1_1330125_G_A_b38	ATAD3C	3.299	0.00126	0.134528	22	0.04078	no	OVARY
chr1_1417051_CA_C_b38	ATAD3C	-3.144	0.00208	-0.151414	4	0.048159	no	OVARY
chr1_1312208_G_T_b38	ATAD3C	-2.972	0.00354	-0.178342	4	0.059998	no	OVARY
chr1_1312114_T_C_b38	ATAD3C	2.956	0.00372	0.121067	21	0.040958	no	OVARY
chr1_1366427_AGTGTGATTGAATGAGT_A_b38	ATAD3C	2.939	0.00391	0.115976	16	0.039456	no	OVARY
chr1_1387763_CCT_C_b38	ATAD3C	2.903	0.00435	0.116105	17	0.03999	no	OVARY
chr1_1388944_G_A_b38	ATAD3C	2.903	0.00435	0.116105	17	0.03999	no	OVARY
chr1_1378204_G_C_b38	ATAD3C	2.899	0.00441	0.115162	16	0.039719	no	OVARY
chr1_1400410_A_G_b38	ATAD3C	-2.877	0.00471	-0.116042	17	0.040335	no	OVARY
chr1_1387698_A_G_b38	ATAD3C	2.869	0.00482	0.118737	21	0.041384	no	OVARY
chr1_1389827_C_T_b38	ATAD3C	2.869	0.00482	0.118737	21	0.041384	no	OVARY
chr1_1376162_G_C_b38	ATAD3C	2.851	0.00508	0.113641	17	0.039856	no	OVARY
chr1_1377431_C_T_b38	ATAD3C	2.851	0.00508	0.113641	17	0.039856	no	OVARY
chr1_1358384_G_C_b38	ATAD3C	2.833	0.00536	0.116863	21	0.041246	no	OVARY
chr1_1384749_C_G_b38	ATAD3C	2.83	0.00541	0.113434	17	0.040083	no	OVARY
chr1_1394423_A_G_b38	ATAD3C	-2.827	0.00547	-0.117479	21	0.041561	no	OVARY
chr1_1395346_A_G_b38	ATAD3C	-2.827	0.00547	-0.117479	21	0.041561	no	OVARY
chr1_1402457_A_G_b38	ATAD3C	-2.827	0.00547	-0.117479	21	0.041561	no	OVARY
chr1_1803982_T_TA_b38	ATAD3C	2.785	0.00617	0.213092	3	0.076512	no	OVARY
chr1_1730265_A_G_b38	ATAD3C	-2.772	0.00641	-0.112982	11	0.040759	no	OVARY
chr1_1366561_AGT_A_b38	ATAD3C	2.75	0.00683	0.111722	21	0.040629	no	OVARY
chr1_1524911_C_T_b38	ATAD3C	-2.681	0.00831	-0.165498	6	0.061725	no	OVARY
chr1_674381_A_AT_b38	ATAD3C	-2.666	0.00867	-0.104041	8	0.039022	no	OVARY
chr1_2118756_A_T_b38	ATAD3C	2.65	0.00906	0.086583	30	0.032668	no	OVARY
chr1_1514211_A_G_b38	ATAD3C	-4.603	6.65e-06	-0.204501	10	0.044431	yes	PNCREAS
chr1_1530002_A_G_b38	ATAD3C	-4.237	3.19e-05	-0.183265	15	0.043252	yes	PNCREAS
chr1_1526169_C_T_b38	ATAD3C	-4.17	4.21e-05	-0.176261	15	0.042273	yes	PNCREAS
chr1_1524202_G_A_b38	ATAD3C	-4.14	4.76e-05	-0.183363	16	0.044293	yes	PNCREAS
chr1_1533018_T_C_b38	ATAD3C	-4.113	5.3e-05	-0.177328	16	0.043109	yes	PNCREAS
chr1_1388565_GTC_G_b38	ATAD3C	4.033	7.32e-05	0.118936	17	0.029489	yes	PNCREAS
chr1_1524664_A_G_b38	ATAD3C	-3.795	0.000185	-0.113603	37	0.029932	yes	PNCREAS
chr1_1520875_A_G_b38	ATAD3C	-3.687	0.000279	-0.159109	16	0.043157	yes	PNCREAS
chr1_1521518_G_A_b38	ATAD3C	-3.68	0.000286	-0.159858	16	0.043436	yes	PNCREAS
chr1_1514366_A_G_b38	ATAD3C	-3.655	0.000313	-0.177413	5	0.048536	yes	PNCREAS
chr1_960375_A_AG_b38	ATAD3C	3.489	0.000573	0.123997	20	0.035538	yes	PNCREAS
chr1_1527386_C_T_b38	ATAD3C	-3.392	0.000807	-0.151289	16	0.044602	yes	PNCREAS
chr1_2079137_C_T_b38	ATAD3C	3.282	0.00118	0.104582	12	0.031864	yes	PNCREAS
chr1_1523187_A_G_b38	ATAD3C	-3.281	0.00118	-0.145461	20	0.044329	yes	PNCREAS
chr1_1515567_A_C_b38	ATAD3C	-3.196	0.00157	-0.142496	8	0.044581	yes	PNCREAS
chr1_2075942_A_G_b38	ATAD3C	3.163	0.00176	0.100812	9	0.031876	yes	PNCREAS
chr1_967724_C_T_b38	ATAD3C	-3.077	0.00233	-0.135799	9	0.044138	yes	PNCREAS
chr1_590378_T_C_b38	ATAD3C	-3.062	0.00244	-0.099427	19	0.032474	yes	PNCREAS
chr1_959193_G_A_b38	ATAD3C	3.054	0.0025	0.11858	20	0.038822	yes	PNCREAS
chr1_2247315_CGCCCTCA_C_b38	ATAD3C	-3.05	0.00254	-0.101907	8	0.033417	yes	PNCREAS
chr1_2250524_C_T_b38	ATAD3C	-3.05	0.00254	-0.101907	8	0.033417	yes	PNCREAS
chr1_2253549_A_G_b38	ATAD3C	-3.05	0.00254	-0.101907	8	0.033417	yes	PNCREAS
chr1_1522905_A_G_b38	ATAD3C	-3.048	0.00255	-0.128708	16	0.042231	yes	PNCREAS
chr1_607379_G_A_b38	ATAD3C	-3.027	0.00273	-0.143768	5	0.047492	yes	PNCREAS
chr1_2054960_T_A_b38	ATAD3C	-3.025	0.00275	-0.177709	7	0.058755	yes	PNCREAS
chr1_2055132_C_T_b38	ATAD3C	-3.021	0.00278	-0.179132	7	0.05929	yes	PNCREAS
chr1_1518285_T_C_b38	ATAD3C	-3.018	0.00281	-0.095764	35	0.031734	yes	PNCREAS
chr1_1705198_C_G_b38	ATAD3C	-3.011	0.00287	-0.151103	5	0.050181	yes	PNCREAS
chr1_929375_A_G_b38	ATAD3C	2.984	0.00313	0.190038	11	0.063688	yes	PNCREAS
chr1_929377_G_A_b38	ATAD3C	2.984	0.00313	0.190038	11	0.063688	yes	PNCREAS
chr1_962184_T_C_b38	ATAD3C	2.959	0.00339	0.125114	3	0.042287	yes	PNCREAS
chr1_2237274_C_T_b38	ATAD3C	-2.958	0.00339	-0.099769	7	0.033729	yes	PNCREAS
chr1_1474819_G_C_b38	ATAD3C	-2.917	0.00385	-0.125285	7	0.042947	yes	PNCREAS
chr1_2053412_G_A_b38	ATAD3C	-2.904	0.00402	-0.184868	5	0.063663	yes	PNCREAS
chr1_1728671_C_A_b38	ATAD3C	2.896	0.00412	0.08393	13	0.028982	yes	PNCREAS
chr1_630555_C_T_b38	ATAD3C	-2.891	0.00418	-0.13533	5	0.046809	yes	PNCREAS
chr1_960326_G_A_b38	ATAD3C	2.888	0.00422	0.106334	20	0.036823	yes	PNCREAS
chr1_2054570_T_A_b38	ATAD3C	-2.825	0.00511	-0.088199	10	0.031217	yes	PNCREAS
chr1_1500729_G_A_b38	ATAD3C	-2.811	0.00534	-0.128934	18	0.045871	yes	PNCREAS
chr1_1739519_C_G_b38	ATAD3C	2.791	0.00567	0.07672	21	0.027492	yes	PNCREAS
chr1_1729859_A_G_b38	ATAD3C	2.765	0.00612	0.077593	12	0.028062	yes	PNCREAS
chr1_2072659_G_A_b38	ATAD3C	2.751	0.00639	0.087917	11	0.031963	yes	PNCREAS
chr1_951408_G_A_b38	ATAD3C	2.745	0.00649	0.099229	7	0.036145	yes	PNCREAS
chr1_951437_C_T_b38	ATAD3C	2.745	0.00649	0.099229	7	0.036145	yes	PNCREAS
chr1_962358_C_T_b38	ATAD3C	-2.74	0.00659	-0.117476	3	0.042877	yes	PNCREAS
chr1_2077249_T_C_b38	ATAD3C	2.739	0.0066	0.090104	9	0.032895	yes	PNCREAS
chr1_2079109_C_T_b38	ATAD3C	2.739	0.0066	0.090104	9	0.032895	yes	PNCREAS
chr1_2079131_T_C_b38	ATAD3C	2.739	0.0066	0.090104	9	0.032895	yes	PNCREAS
chr1_2074688_G_A_b38	ATAD3C	2.738	0.00663	0.087707	11	0.032037	yes	PNCREAS
chr1_927003_C_T_b38	ATAD3C	2.734	0.00671	0.137713	16	0.050374	yes	PNCREAS
chr1_2056854_G_C_b38	ATAD3C	-2.732	0.00675	-0.19319	3	0.070719	yes	PNCREAS
chr1_2056874_G_C_b38	ATAD3C	-2.732	0.00675	-0.19319	3	0.070719	yes	PNCREAS
chr1_1530331_T_C_b38	ATAD3C	-2.718	0.00704	-0.086284	31	0.031751	yes	PNCREAS
chr1_2079677_C_G_b38	ATAD3C	2.717	0.00705	0.086701	10	0.031909	yes	PNCREAS
chr1_1500745_A_C_b38	ATAD3C	-2.7	0.0074	-0.109735	26	0.040637	yes	PNCREAS
chr1_1532105_T_C_b38	ATAD3C	-2.697	0.00747	-0.132387	14	0.049087	yes	PNCREAS
chr1_1533253_C_T_b38	ATAD3C	-2.697	0.00747	-0.132387	14	0.049087	yes	PNCREAS
chr1_633423_C_T_b38	ATAD3C	2.691	0.00761	0.139733	4	0.051926	yes	PNCREAS
chr1_1648636_G_A_b38	ATAD3C	-2.69	0.00763	-0.069305	30	0.025763	yes	PNCREAS
chr1_1518541_T_C_b38	ATAD3C	-2.681	0.00782	-0.081833	25	0.030519	yes	PNCREAS
chr1_633365_C_CCA_b38	ATAD3C	-2.671	0.00807	-0.075194	25	0.028154	yes	PNCREAS
chr1_2056778_G_T_b38	ATAD3C	-2.669	0.00811	-0.177544	4	0.066523	yes	PNCREAS
chr1_966179_G_A_b38	ATAD3C	2.648	0.00861	0.100825	17	0.038073	yes	PNCREAS
chr1_2075464_G_A_b38	ATAD3C	-2.639	0.00883	-0.175919	3	0.066649	yes	PNCREAS
chr1_2075502_A_G_b38	ATAD3C	-2.639	0.00883	-0.175919	3	0.066649	yes	PNCREAS
chr1_932613_GTTTC_G_b38	ATAD3C	2.637	0.0089	0.172523	13	0.065431	yes	PNCREAS
chr1_965350_G_A_b38	ATAD3C	2.629	0.0091	0.104232	18	0.039651	yes	PNCREAS
chr1_1479205_A_C_b38	ATAD3C	-2.627	0.00914	-0.090817	13	0.034568	yes	PNCREAS
chr1_1512376_G_C_b38	ATAD3C	-2.626	0.00916	-0.087632	26	0.033365	yes	PNCREAS
chr1_1542773_T_C_b38	ATAD3C	-2.615	0.00947	-0.066176	47	0.025308	yes	PNCREAS
chr1_1542793_C_G_b38	ATAD3C	-2.615	0.00947	-0.066176	47	0.025308	yes	PNCREAS
chr1_1542800_T_C_b38	ATAD3C	-2.615	0.00947	-0.066176	47	0.025308	yes	PNCREAS
chr1_1543953_A_G_b38	ATAD3C	-2.615	0.00947	-0.066176	47	0.025308	yes	PNCREAS
chr1_2221609_A_G_b38	ATAD3C	-2.614	0.00949	-0.089648	6	0.034295	yes	PNCREAS
chr1_2233384_G_T_b38	ATAD3C	-2.614	0.00949	-0.089648	6	0.034295	yes	PNCREAS
chr1_1648826_A_G_b38	ATAD3C	-2.61	0.00962	-0.067171	30	0.025741	yes	PNCREAS
chr1_1439454_A_G_b38	ATAD3C	-2.599	0.0099	-0.07704	25	0.02964	yes	PNCREAS
chr1_966227_C_G_b38	ATAD3C	2.598	0.00992	0.110193	7	0.042408	yes	PNCREAS
chr1_638771_A_T_b38	ATAD3C	-3.813	0.000173	-0.156455	7	0.04103	no	PNCREAS
chr1_1499339_T_C_b38	ATAD3C	-3.793	0.000187	-0.17838	3	0.047023	no	PNCREAS
chr1_1672015_G_C_b38	ATAD3C	-3.708	0.000258	-0.256564	3	0.069192	no	PNCREAS
chr1_2068161_A_T_b38	ATAD3C	-3.242	0.00135	-0.226162	3	0.069769	no	PNCREAS
chr1_631490_T_C_b38	ATAD3C	-3.066	0.00241	-0.149083	6	0.048631	no	PNCREAS
chr1_961945_G_C_b38	ATAD3C	3.048	0.00255	0.119538	5	0.039221	no	PNCREAS
chr1_1471663_A_C_b38	ATAD3C	-2.955	0.00342	-0.145979	6	0.049396	no	PNCREAS
chr1_1157295_AGCCCACCCATCCCGCCCCCAGCCCACCCATCCCATCCCC_A_b38	ATAD3C	-2.866	0.00451	-0.054736	54	0.0191	no	PNCREAS
chr1_2071051_C_CACCTGGGCGTGTG_b38	ATAD3C	2.825	0.00511	0.091717	10	0.032466	no	PNCREAS
chr1_2423961_A_G_b38	ATAD3C	2.822	0.00515	0.086948	9	0.030805	no	PNCREAS
chr1_666028_G_A_b38	ATAD3C	2.821	0.00518	0.099307	5	0.035205	no	PNCREAS
chr1_949046_A_AACAGCAAAG_b38	ATAD3C	2.817	0.00524	0.119312	3	0.042358	no	PNCREAS
chr1_1134095_AAAAAAAG_A_b38	ATAD3C	-2.795	0.0056	-0.064951	55	0.023241	no	PNCREAS
chr1_950669_ACAG_A_b38	ATAD3C	2.73	0.00679	0.111159	4	0.04072	no	PNCREAS
chr1_2067525_T_C_b38	ATAD3C	2.697	0.00748	0.250482	3	0.09288	no	PNCREAS
chr1_1649932_C_T_b38	ATAD3C	2.696	0.0075	0.061849	67	0.022941	no	PNCREAS
chr1_596697_ACATTCATGCTCACTCATACACACCCAGATCATATATACACTCGTGCACACATTCACACTCATACACACCCAAATCATACTCACATTCATGCACACATGTT_A_b38	ATAD3C	-2.692	0.00758	-0.169974	3	0.06314	no	PNCREAS
chr1_2053372_G_T_b38	ATAD3C	2.665	0.00819	0.076505	16	0.028704	no	PNCREAS
chr1_1650195_A_G_b38	ATAD3C	-2.64	0.00882	-0.067648	27	0.025628	no	PNCREAS
chr1_2327151_A_AACAC_b38	ATAD3C	2.612	0.00954	0.057494	64	0.022007	no	PNCREAS
chr1_1486611_G_A_b38	ATAD3C	5.663	5.23e-08	0.202265	9	0.035715	yes	PTTARY
chr1_1481959_C_T_b38	ATAD3C	5.56	8.76e-08	0.198506	10	0.035704	yes	PTTARY
chr1_1502497_C_T_b38	ATAD3C	4.968	1.47e-06	0.190415	3	0.038331	yes	PTTARY
chr1_1489916_C_T_b38	ATAD3C	4.774	3.52e-06	0.173806	9	0.036404	yes	PTTARY
chr1_1367122_G_A_b38	ATAD3C	-4.76	3.75e-06	-0.308066	3	0.064714	yes	PTTARY
chr1_1482402_A_G_b38	ATAD3C	4.745	4.01e-06	0.157956	15	0.033288	yes	PTTARY
chr1_1487487_C_CA_b38	ATAD3C	4.742	4.07e-06	0.181534	4	0.038286	yes	PTTARY
chr1_1483898_G_A_b38	ATAD3C	4.692	5.08e-06	0.177651	12	0.037865	yes	PTTARY
chr1_1476266_T_C_b38	ATAD3C	4.644	6.25e-06	0.166286	13	0.035804	yes	PTTARY
chr1_1476079_T_C_b38	ATAD3C	4.637	6.45e-06	0.165069	13	0.0356	yes	PTTARY
chr1_1473089_T_C_b38	ATAD3C	4.628	6.72e-06	0.16388	13	0.035413	yes	PTTARY
chr1_1482624_T_C_b38	ATAD3C	4.628	6.72e-06	0.16388	13	0.035413	yes	PTTARY
chr1_1486151_C_A_b38	ATAD3C	4.509	1.12e-05	0.170501	12	0.037816	yes	PTTARY
chr1_1474201_CT_C_b38	ATAD3C	4.335	2.33e-05	0.142613	13	0.032899	yes	PTTARY
chr1_1366941_T_TGTGTGCA_b38	ATAD3C	4.217	3.78e-05	0.141712	6	0.033604	yes	PTTARY
chr1_1366951_A_AGT_b38	ATAD3C	4.217	3.78e-05	0.141712	6	0.033604	yes	PTTARY
chr1_1548572_A_AC_b38	ATAD3C	-4.174	4.49e-05	-0.202627	5	0.048543	yes	PTTARY
chr1_1488652_A_G_b38	ATAD3C	4.168	4.61e-05	0.153319	13	0.036785	yes	PTTARY
chr1_1490320_T_C_b38	ATAD3C	4.168	4.61e-05	0.153319	13	0.036785	yes	PTTARY
chr1_1492292_C_G_b38	ATAD3C	4.168	4.61e-05	0.153319	13	0.036785	yes	PTTARY
chr1_1492619_A_AC_b38	ATAD3C	4.168	4.61e-05	0.153319	13	0.036785	yes	PTTARY
chr1_1492850_G_A_b38	ATAD3C	4.168	4.61e-05	0.153319	13	0.036785	yes	PTTARY
chr1_1490027_A_G_b38	ATAD3C	4.03	7.99e-05	0.147266	10	0.036546	yes	PTTARY
chr1_1490032_A_G_b38	ATAD3C	4.03	7.99e-05	0.147266	10	0.036546	yes	PTTARY
chr1_1495204_T_C_b38	ATAD3C	4.013	8.54e-05	0.145207	12	0.036186	yes	PTTARY
chr1_1571794_A_AT_b38	ATAD3C	-3.88	0.000143	-0.100985	34	0.02603	yes	PTTARY
chr1_1487887_A_G_b38	ATAD3C	3.863	0.000152	0.142279	13	0.036835	yes	PTTARY
chr1_1490046_G_A_b38	ATAD3C	3.847	0.000162	0.145007	5	0.037691	yes	PTTARY
chr1_1490047_A_G_b38	ATAD3C	3.847	0.000162	0.145007	5	0.037691	yes	PTTARY
chr1_1235602_C_A_b38	ATAD3C	-3.772	0.000215	-0.130959	4	0.034722	yes	PTTARY
chr1_1231710_CCCCCGGGAA_C_b38	ATAD3C	-3.74	0.000242	-0.127891	4	0.034198	yes	PTTARY
chr1_1497105_T_G_b38	ATAD3C	3.734	0.000247	0.145031	4	0.03884	yes	PTTARY
chr1_1565105_CAAGGCAGGCGGATCATG_C_b38	ATAD3C	-3.715	0.000265	-0.094676	39	0.025482	yes	PTTARY
chr1_1565680_A_AG_b38	ATAD3C	-3.708	0.000272	-0.095782	37	0.02583	yes	PTTARY
chr1_1550064_GC_G_b38	ATAD3C	-3.67	0.000313	-0.095937	33	0.026144	yes	PTTARY
chr1_1550068_C_A_b38	ATAD3C	-3.67	0.000313	-0.095937	33	0.026144	yes	PTTARY
chr1_1337898_A_G_b38	ATAD3C	3.664	0.000319	0.10587	12	0.028893	yes	PTTARY
chr1_1551557_A_AG_b38	ATAD3C	-3.654	0.000331	-0.094812	33	0.025948	yes	PTTARY
chr1_1551559_A_T_b38	ATAD3C	-3.654	0.000331	-0.094812	33	0.025948	yes	PTTARY
chr1_1572532_A_C_b38	ATAD3C	-3.636	0.000354	-0.092687	38	0.025495	yes	PTTARY
chr1_1573079_A_G_b38	ATAD3C	-3.636	0.000354	-0.092687	38	0.025495	yes	PTTARY
chr1_1553692_A_G_b38	ATAD3C	-3.596	0.000409	-0.091868	38	0.025549	yes	PTTARY
chr1_1554694_A_G_b38	ATAD3C	-3.596	0.000409	-0.091868	38	0.025549	yes	PTTARY
chr1_1554852_T_C_b38	ATAD3C	-3.596	0.000409	-0.091868	38	0.025549	yes	PTTARY
chr1_1555247_T_A_b38	ATAD3C	-3.596	0.000409	-0.091868	38	0.025549	yes	PTTARY
chr1_1559750_C_CAG_b38	ATAD3C	-3.596	0.000409	-0.091868	38	0.025549	yes	PTTARY
chr1_1561628_T_C_b38	ATAD3C	-3.596	0.000409	-0.091868	38	0.025549	yes	PTTARY
chr1_1563918_A_G_b38	ATAD3C	-3.596	0.000409	-0.091868	38	0.025549	yes	PTTARY
chr1_1565561_A_G_b38	ATAD3C	-3.596	0.000409	-0.091868	38	0.025549	yes	PTTARY
chr1_1566086_G_A_b38	ATAD3C	-3.596	0.000409	-0.091868	38	0.025549	yes	PTTARY
chr1_1567715_G_A_b38	ATAD3C	-3.596	0.000409	-0.091868	38	0.025549	yes	PTTARY
chr1_1567719_A_C_b38	ATAD3C	-3.596	0.000409	-0.091868	38	0.025549	yes	PTTARY
chr1_1569875_C_T_b38	ATAD3C	-3.596	0.000409	-0.091868	38	0.025549	yes	PTTARY
chr1_1538787_A_G_b38	ATAD3C	-3.575	0.000442	-0.091922	37	0.025715	yes	PTTARY
chr1_1549590_C_G_b38	ATAD3C	-3.541	0.000498	-0.090403	38	0.025529	yes	PTTARY
chr1_1226486_C_T_b38	ATAD3C	-3.534	0.000511	-0.121122	4	0.034278	yes	PTTARY
chr1_924310_C_G_b38	ATAD3C	3.523	0.00053	0.245086	5	0.06956	yes	PTTARY
chr1_1547630_G_A_b38	ATAD3C	-3.511	0.000554	-0.090097	36	0.02566	yes	PTTARY
chr1_1569661_T_C_b38	ATAD3C	-3.481	0.000617	-0.088905	37	0.025544	yes	PTTARY
chr1_1228424_C_T_b38	ATAD3C	-3.471	0.000637	-0.111055	6	0.031993	yes	PTTARY
chr1_1468592_C_CG_b38	ATAD3C	3.447	0.000693	0.155009	7	0.044966	yes	PTTARY
chr1_1370113_A_G_b38	ATAD3C	3.388	0.00085	0.094692	18	0.027947	yes	PTTARY
chr1_1402457_A_G_b38	ATAD3C	-3.379	0.000879	-0.09693	21	0.028689	yes	PTTARY
chr1_1468856_C_T_b38	ATAD3C	3.366	0.000918	0.149305	6	0.044357	yes	PTTARY
chr1_1569180_T_A_b38	ATAD3C	-3.357	0.000946	-0.087256	36	0.025991	yes	PTTARY
chr1_1554781_A_G_b38	ATAD3C	-3.344	0.00099	-0.085294	38	0.025508	yes	PTTARY
chr1_1570294_CA_C_b38	ATAD3C	-3.271	0.00127	-0.084757	37	0.02591	yes	PTTARY
chr1_1217251_C_A_b38	ATAD3C	-3.264	0.0013	-0.117758	5	0.036083	yes	PTTARY
chr1_1468048_A_G_b38	ATAD3C	3.25	0.00136	0.149048	7	0.045866	yes	PTTARY
chr1_1387698_A_G_b38	ATAD3C	3.239	0.00141	0.092959	21	0.028701	yes	PTTARY
chr1_1389827_C_T_b38	ATAD3C	3.239	0.00141	0.092959	21	0.028701	yes	PTTARY
chr1_1394423_A_G_b38	ATAD3C	-3.239	0.00141	-0.092959	21	0.028701	yes	PTTARY
chr1_1395346_A_G_b38	ATAD3C	-3.239	0.00141	-0.092959	21	0.028701	yes	PTTARY
chr1_1379091_T_G_b38	ATAD3C	3.237	0.00142	0.101243	8	0.031276	yes	PTTARY
chr1_1217733_G_A_b38	ATAD3C	-3.231	0.00145	-0.112579	5	0.034841	yes	PTTARY
chr1_1534402_G_C_b38	ATAD3C	3.229	0.00146	0.117155	4	0.036283	yes	PTTARY
chr1_1573654_T_C_b38	ATAD3C	-3.217	0.00152	-0.082769	36	0.025729	yes	PTTARY
chr1_1574445_A_G_b38	ATAD3C	-3.217	0.00152	-0.082769	36	0.025729	yes	PTTARY
chr1_1575724_G_C_b38	ATAD3C	-3.217	0.00152	-0.082769	36	0.025729	yes	PTTARY
chr1_1499586_C_CT_b38	ATAD3C	-3.205	0.00158	-0.115297	9	0.035973	yes	PTTARY
chr1_1358384_G_C_b38	ATAD3C	3.195	0.00163	0.09166	21	0.028691	yes	PTTARY
chr1_1366561_AGT_A_b38	ATAD3C	3.186	0.00168	0.09128	21	0.028648	yes	PTTARY
chr1_1441187_A_G_b38	ATAD3C	-3.179	0.00172	-0.091233	18	0.028699	yes	PTTARY
chr1_1577491_A_AC_b38	ATAD3C	-3.161	0.00182	-0.081565	36	0.025803	yes	PTTARY
chr1_1324139_GGGGGCTGGGGGGCTGAGGGGCTGGGGGGCTGA_G_b38	ATAD3C	3.145	0.00192	0.140491	7	0.044678	yes	PTTARY
chr1_1468094_G_C_b38	ATAD3C	3.143	0.00193	0.143337	6	0.045602	yes	PTTARY
chr1_1431014_G_A_b38	ATAD3C	-3.091	0.00229	-0.083855	19	0.027133	yes	PTTARY
chr1_1440430_C_G_b38	ATAD3C	-3.086	0.00232	-0.083674	21	0.027111	yes	PTTARY
chr1_1400410_A_G_b38	ATAD3C	-3.075	0.00241	-0.088354	17	0.028737	yes	PTTARY
chr1_1216593_G_C_b38	ATAD3C	-3.057	0.00255	-0.099302	6	0.032486	yes	PTTARY
chr1_1407232_G_C_b38	ATAD3C	-3.035	0.00273	-0.08397	14	0.027666	yes	PTTARY
chr1_1533883_G_T_b38	ATAD3C	-3.002	0.00304	-0.14055	3	0.046826	yes	PTTARY
chr1_1379083_AT_A_b38	ATAD3C	2.973	0.00332	0.085492	13	0.028757	yes	PTTARY
chr1_632403_T_C_b38	ATAD3C	-2.953	0.00353	-0.18573	4	0.062888	yes	PTTARY
chr1_1436388_CA_C_b38	ATAD3C	-2.946	0.00361	-0.084244	17	0.028598	yes	PTTARY
chr1_1575421_C_T_b38	ATAD3C	-2.925	0.00385	-0.075196	35	0.025707	yes	PTTARY
chr1_1330125_G_A_b38	ATAD3C	2.911	0.00402	0.083396	22	0.028649	yes	PTTARY
chr1_924024_C_G_b38	ATAD3C	2.909	0.00404	0.171746	7	0.059038	yes	PTTARY
chr1_1574032_AAAG_A_b38	ATAD3C	-2.908	0.00406	-0.090603	19	0.031161	yes	PTTARY
chr1_1376162_G_C_b38	ATAD3C	2.887	0.00433	0.082414	18	0.028548	yes	PTTARY
chr1_1377431_C_T_b38	ATAD3C	2.887	0.00433	0.082414	18	0.028548	yes	PTTARY
chr1_1384749_C_G_b38	ATAD3C	2.886	0.00434	0.082882	18	0.028717	yes	PTTARY
chr1_1387763_CCT_C_b38	ATAD3C	2.886	0.00434	0.082882	18	0.028717	yes	PTTARY
chr1_1388944_G_A_b38	ATAD3C	2.886	0.00434	0.082882	18	0.028717	yes	PTTARY
chr1_1378204_G_C_b38	ATAD3C	2.85	0.00483	0.080419	19	0.028212	yes	PTTARY
chr1_1668373_C_T_b38	ATAD3C	2.82	0.00529	0.080605	24	0.028583	yes	PTTARY
chr1_1365036_T_TAA_b38	ATAD3C	-2.789	0.00582	-0.099675	3	0.035745	yes	PTTARY
chr1_1201373_T_C_b38	ATAD3C	-2.776	0.00604	-0.087888	9	0.031664	yes	PTTARY
chr1_2285267_C_G_b38	ATAD3C	-2.774	0.00608	-0.108852	3	0.039246	yes	PTTARY
chr1_1439454_A_G_b38	ATAD3C	-2.719	0.00714	-0.072508	27	0.026671	yes	PTTARY
chr1_1361679_G_A_b38	ATAD3C	2.687	0.00783	0.082075	14	0.030544	yes	PTTARY
chr1_1398056_C_A_b38	ATAD3C	-2.665	0.00833	-0.067872	30	0.025464	yes	PTTARY
chr1_1301426_A_AT_b38	ATAD3C	-2.653	0.00863	-0.088893	11	0.033504	yes	PTTARY
chr1_925081_G_A_b38	ATAD3C	2.65	0.00871	0.150914	7	0.056953	yes	PTTARY
chr1_925141_C_A_b38	ATAD3C	2.65	0.00871	0.150914	7	0.056953	yes	PTTARY
chr1_926428_A_G_b38	ATAD3C	2.65	0.00871	0.150914	7	0.056953	yes	PTTARY
chr1_926713_T_C_b38	ATAD3C	2.65	0.00871	0.150914	7	0.056953	yes	PTTARY
chr1_926744_A_G_b38	ATAD3C	2.65	0.00871	0.150914	7	0.056953	yes	PTTARY
chr1_927003_C_T_b38	ATAD3C	2.65	0.00871	0.150914	7	0.056953	yes	PTTARY
chr1_927744_G_T_b38	ATAD3C	2.65	0.00871	0.150914	7	0.056953	yes	PTTARY
chr1_1575935_T_C_b38	ATAD3C	-2.646	0.0088	-0.070849	34	0.026774	yes	PTTARY
chr1_1251122_A_T_b38	ATAD3C	-2.638	0.00901	-0.085302	8	0.032338	yes	PTTARY
chr1_921797_T_C_b38	ATAD3C	-2.628	0.00928	-0.153843	5	0.058547	yes	PTTARY
chr1_1366427_AGTGTGATTGAATGAGT_A_b38	ATAD3C	2.618	0.00952	0.074451	17	0.028434	yes	PTTARY
chr1_1531589_C_T_b38	ATAD3C	4.123	5.52e-05	0.148843	3	0.036099	no	PTTARY
chr1_1373006_G_A_b38	ATAD3C	-3.809	0.000187	-0.133967	3	0.035174	no	PTTARY
chr1_1373007_G_A_b38	ATAD3C	-3.809	0.000187	-0.133967	3	0.035174	no	PTTARY
chr1_1557495_CAT_C_b38	ATAD3C	-3.723	0.000257	-0.097339	33	0.026145	no	PTTARY
chr1_1558726_C_CA_b38	ATAD3C	-3.723	0.000257	-0.097339	33	0.026145	no	PTTARY
chr1_1561821_A_C_b38	ATAD3C	-3.723	0.000257	-0.097339	33	0.026145	no	PTTARY
chr1_1541864_T_C_b38	ATAD3C	-3.71	0.00027	-0.097805	32	0.026365	no	PTTARY
chr1_1542773_T_C_b38	ATAD3C	-3.71	0.00027	-0.097805	32	0.026365	no	PTTARY
chr1_1542793_C_G_b38	ATAD3C	-3.71	0.00027	-0.097805	32	0.026365	no	PTTARY
chr1_1542800_T_C_b38	ATAD3C	-3.71	0.00027	-0.097805	32	0.026365	no	PTTARY
chr1_1543953_A_G_b38	ATAD3C	-3.71	0.00027	-0.097805	32	0.026365	no	PTTARY
chr1_1527386_C_T_b38	ATAD3C	-3.692	0.000289	-0.197813	8	0.053585	no	PTTARY
chr1_1543500_T_G_b38	ATAD3C	-3.688	0.000293	-0.098195	32	0.026627	no	PTTARY
chr1_1400756_GGA_G_b38	ATAD3C	-3.684	0.000297	-0.122114	6	0.033145	no	PTTARY
chr1_1401954_G_T_b38	ATAD3C	-3.684	0.000297	-0.122114	6	0.033145	no	PTTARY
chr1_1403593_A_G_b38	ATAD3C	-3.684	0.000297	-0.122114	6	0.033145	no	PTTARY
chr1_1407565_C_A_b38	ATAD3C	-3.684	0.000297	-0.122114	6	0.033145	no	PTTARY
chr1_1520875_A_G_b38	ATAD3C	-3.683	0.000298	-0.200635	5	0.054478	no	PTTARY
chr1_1524202_G_A_b38	ATAD3C	-3.683	0.000298	-0.200635	5	0.054478	no	PTTARY
chr1_1530002_A_G_b38	ATAD3C	-3.683	0.000298	-0.200635	5	0.054478	no	PTTARY
chr1_1533018_T_C_b38	ATAD3C	-3.683	0.000298	-0.200635	5	0.054478	no	PTTARY
chr1_1545795_C_A_b38	ATAD3C	-3.642	0.000346	-0.095797	31	0.026302	no	PTTARY
chr1_1383743_T_C_b38	ATAD3C	-3.531	0.000516	-0.117486	6	0.033271	no	PTTARY
chr1_1384546_C_T_b38	ATAD3C	-3.531	0.000516	-0.117486	6	0.033271	no	PTTARY
chr1_1398218_C_A_b38	ATAD3C	-3.531	0.000516	-0.117486	6	0.033271	no	PTTARY
chr1_1515567_A_C_b38	ATAD3C	-3.528	0.000522	-0.209958	3	0.05952	no	PTTARY
chr1_1379093_TG_T_b38	ATAD3C	-3.521	0.000535	-0.119849	5	0.034038	no	PTTARY
chr1_2436477_CCCTCCTCCCCTCCTCCCT_C_b38	ATAD3C	3.503	0.000569	0.183814	3	0.05247	no	PTTARY
chr1_1432355_G_A_b38	ATAD3C	-3.427	0.000744	-0.103413	11	0.030177	no	PTTARY
chr1_1229369_G_GC_b38	ATAD3C	-3.41	0.000789	-0.106547	7	0.031248	no	PTTARY
chr1_1372909_G_A_b38	ATAD3C	-3.409	0.000791	-0.114963	5	0.033722	no	PTTARY
chr1_1375642_C_T_b38	ATAD3C	-3.403	0.000807	-0.112463	6	0.033046	no	PTTARY
chr1_1380867_A_G_b38	ATAD3C	-3.401	0.000814	-0.112636	6	0.033119	no	PTTARY
chr1_1382893_G_A_b38	ATAD3C	-3.401	0.000814	-0.112636	6	0.033119	no	PTTARY
chr1_1236303_A_G_b38	ATAD3C	-3.399	0.000818	-0.114732	5	0.033751	no	PTTARY
chr1_1521518_G_A_b38	ATAD3C	-3.394	0.000835	-0.189255	5	0.05577	no	PTTARY
chr1_1231507_T_C_b38	ATAD3C	-3.366	0.000918	-0.110286	5	0.032766	no	PTTARY
chr1_1374505_A_G_b38	ATAD3C	-3.354	0.000955	-0.111128	6	0.033131	no	PTTARY
chr1_1522905_A_G_b38	ATAD3C	-3.342	0.000995	-0.176493	5	0.052805	no	PTTARY
chr1_1344048_G_A_b38	ATAD3C	-3.252	0.00135	-0.109337	5	0.033625	no	PTTARY
chr1_1341550_GCA_G_b38	ATAD3C	-3.234	0.00143	-0.108265	6	0.033473	no	PTTARY
chr1_1523187_A_G_b38	ATAD3C	-3.231	0.00145	-0.169331	8	0.052404	no	PTTARY
chr1_1364253_C_G_b38	ATAD3C	-3.229	0.00145	-0.108042	5	0.033455	no	PTTARY
chr1_1411323_A_C_b38	ATAD3C	-3.193	0.00164	-0.091828	23	0.028763	no	PTTARY
chr1_1215852_T_C_b38	ATAD3C	-3.162	0.00182	-0.101298	7	0.032037	no	PTTARY
chr1_1394041_G_A_b38	ATAD3C	-3.156	0.00185	-0.108073	5	0.034242	no	PTTARY
chr1_2298478_C_T_b38	ATAD3C	3.144	0.00193	0.084827	17	0.026985	no	PTTARY
chr1_1329973_GCGTGTGCCATGCA_G_b38	ATAD3C	-3.095	0.00226	-0.10429	5	0.033697	no	PTTARY
chr1_2297717_C_T_b38	ATAD3C	3.04	0.00269	0.082685	17	0.027203	no	PTTARY
chr1_1308178_GGGGCGCGGGGA_G_b38	ATAD3C	-3.036	0.00273	-0.094823	8	0.031236	no	PTTARY
chr1_1325753_G_T_b38	ATAD3C	-3.021	0.00286	-0.10682	5	0.035363	no	PTTARY
chr1_1041119_GGGC_G_b38	ATAD3C	2.965	0.0034	0.05821	19	0.019629	no	PTTARY
chr1_1238231_G_A_b38	ATAD3C	-2.95	0.00357	-0.093129	7	0.031573	no	PTTARY
chr1_1303800_G_A_b38	ATAD3C	-2.931	0.00378	-0.104469	5	0.035639	no	PTTARY
chr1_1304555_A_C_b38	ATAD3C	-2.931	0.00378	-0.104469	5	0.035639	no	PTTARY
chr1_1428969_T_C_b38	ATAD3C	-2.927	0.00383	-0.081177	25	0.027735	no	PTTARY
chr1_1316929_A_T_b38	ATAD3C	-2.924	0.00387	-0.096983	6	0.033172	no	PTTARY
chr1_1184277_G_C_b38	ATAD3C	-2.894	0.00424	-0.077495	34	0.02678	no	PTTARY
chr1_1303112_G_A_b38	ATAD3C	-2.889	0.0043	-0.102422	5	0.035449	no	PTTARY
chr1_2056605_G_C_b38	ATAD3C	-2.88	0.00442	-0.098102	7	0.034062	no	PTTARY
chr1_1573429_CAAAAAAAAAAAAAAAAAA_C_b38	ATAD3C	-2.876	0.00448	-0.075312	33	0.026188	no	PTTARY
chr1_1534915_T_C_b38	ATAD3C	-2.863	0.00465	-0.200179	6	0.069912	no	PTTARY
chr1_2369355_G_GAAAA_b38	ATAD3C	-2.856	0.00475	-0.16984	3	0.059469	no	PTTARY
chr1_1440834_C_G_b38	ATAD3C	-2.854	0.00478	-0.076718	27	0.026879	no	PTTARY
chr1_1443457_T_C_b38	ATAD3C	-2.854	0.00478	-0.076718	27	0.026879	no	PTTARY
chr1_1185978_A_C_b38	ATAD3C	-2.853	0.0048	-0.106551	3	0.037347	no	PTTARY
chr1_2296236_A_C_b38	ATAD3C	2.849	0.00485	0.115867	4	0.040662	no	PTTARY
chr1_1363438_C_CTT_b38	ATAD3C	2.846	0.0049	0.078334	19	0.027526	no	PTTARY
chr1_1549967_C_G_b38	ATAD3C	-2.845	0.00491	-0.077158	23	0.027121	no	PTTARY
chr1_1424819_C_T_b38	ATAD3C	-2.792	0.00576	-0.168672	4	0.060413	no	PTTARY
chr1_1041126_AGCGGGGGC_A_b38	ATAD3C	2.784	0.00589	0.055536	20	0.019946	no	PTTARY
chr1_1629572_TG_T_b38	ATAD3C	-2.766	0.00622	-0.067281	36	0.024324	no	PTTARY
chr1_1249880_A_G_b38	ATAD3C	-2.753	0.00646	-0.0922	7	0.033493	no	PTTARY
chr1_1553791_CA_C_b38	ATAD3C	-2.743	0.00665	-0.084915	11	0.030956	no	PTTARY
chr1_1628409_C_A_b38	ATAD3C	-2.741	0.00669	-0.068042	34	0.024824	no	PTTARY
chr1_1628814_C_T_b38	ATAD3C	-2.741	0.00669	-0.068042	34	0.024824	no	PTTARY
chr1_1424727_C_A_b38	ATAD3C	-2.734	0.00684	-0.161107	4	0.058933	no	PTTARY
chr1_1367511_ATGAG_A_b38	ATAD3C	-2.721	0.00709	-0.09331	4	0.034291	no	PTTARY
chr1_1560765_T_C_b38	ATAD3C	-2.718	0.00715	-0.075091	28	0.027625	no	PTTARY
chr1_1562261_TTTTC_T_b38	ATAD3C	-2.718	0.00715	-0.075091	28	0.027625	no	PTTARY
chr1_1312208_G_T_b38	ATAD3C	-2.716	0.0072	-0.151502	4	0.055779	no	PTTARY
chr1_1288085_GC_G_b38	ATAD3C	-2.707	0.00738	-0.097087	5	0.035862	no	PTTARY
chr1_1624720_G_A_b38	ATAD3C	-2.691	0.00773	-0.067615	34	0.025123	no	PTTARY
chr1_1625805_G_A_b38	ATAD3C	-2.691	0.00773	-0.067615	34	0.025123	no	PTTARY
chr1_1539491_G_C_b38	ATAD3C	-2.688	0.0078	-0.072578	33	0.026997	no	PTTARY
chr1_1367954_A_C_b38	ATAD3C	-2.682	0.00794	-0.114844	3	0.04282	no	PTTARY
chr1_1235997_A_G_b38	ATAD3C	-2.677	0.00805	-0.098461	3	0.036777	no	PTTARY
chr1_1202905_C_G_b38	ATAD3C	-2.668	0.00827	-0.101679	3	0.038112	no	PTTARY
chr1_1460021_C_CTG_b38	ATAD3C	2.663	0.0084	0.133599	4	0.050177	no	PTTARY
chr1_1460022_CAG_C_b38	ATAD3C	2.663	0.0084	0.133599	4	0.050177	no	PTTARY
chr1_638970_A_C_b38	ATAD3C	-2.657	0.00854	-0.174787	3	0.065791	no	PTTARY
chr1_1366511_GGTGA_G_b38	ATAD3C	-2.654	0.00861	-0.089038	5	0.033549	no	PTTARY
chr1_2068401_C_T_b38	ATAD3C	-2.629	0.00925	-0.094405	5	0.035911	no	PTTARY
chr1_2290095_A_G_b38	ATAD3C	2.619	0.0095	0.062169	61	0.023734	no	PTTARY
chr1_2290637_G_A_b38	ATAD3C	2.619	0.0095	0.062169	61	0.023734	no	PTTARY
chr1_1440430_C_G_b38	ATAD3C	-7.172	1.82e-11	-0.242194	14	0.033767	yes	PRSTTE
chr1_1440834_C_G_b38	ATAD3C	-7.145	2.12e-11	-0.241907	21	0.033855	yes	PRSTTE
chr1_1443457_T_C_b38	ATAD3C	-7.049	3.66e-11	-0.239342	22	0.033954	yes	PRSTTE
chr1_1452825_AAAG_A_b38	ATAD3C	-6.521	6.74e-10	-0.220275	15	0.033777	yes	PRSTTE
chr1_1453552_G_A_b38	ATAD3C	-6.521	6.74e-10	-0.220275	15	0.033777	yes	PRSTTE
chr1_1455134_T_G_b38	ATAD3C	-6.521	6.74e-10	-0.220275	15	0.033777	yes	PRSTTE
chr1_1455337_A_G_b38	ATAD3C	-6.521	6.74e-10	-0.220275	15	0.033777	yes	PRSTTE
chr1_1455495_C_T_b38	ATAD3C	-6.521	6.74e-10	-0.220275	15	0.033777	yes	PRSTTE
chr1_1455924_T_C_b38	ATAD3C	-6.521	6.74e-10	-0.220275	15	0.033777	yes	PRSTTE
chr1_1456051_C_T_b38	ATAD3C	-6.521	6.74e-10	-0.220275	15	0.033777	yes	PRSTTE
chr1_1452797_CAA_C_b38	ATAD3C	-6.485	8.2e-10	-0.241939	12	0.037308	yes	PRSTTE
chr1_1454848_T_C_b38	ATAD3C	-6.363	1.58e-09	-0.215085	16	0.033805	yes	PRSTTE
chr1_1439454_A_G_b38	ATAD3C	-6.359	1.61e-09	-0.213323	22	0.033549	yes	PRSTTE
chr1_1451968_C_T_b38	ATAD3C	-6.313	2.06e-09	-0.213239	14	0.033779	yes	PRSTTE
chr1_1456154_G_A_b38	ATAD3C	-6.236	3.09e-09	-0.214449	14	0.034392	yes	PRSTTE
chr1_1456079_T_C_b38	ATAD3C	-6.182	4.09e-09	-0.212573	14	0.034385	yes	PRSTTE
chr1_1519934_T_G_b38	ATAD3C	-6.101	6.24e-09	-0.193128	34	0.031654	yes	PRSTTE
chr1_1519938_T_C_b38	ATAD3C	-6.101	6.24e-09	-0.193128	34	0.031654	yes	PRSTTE
chr1_1436079_A_G_b38	ATAD3C	-6.042	8.45e-09	-0.203653	24	0.033703	yes	PRSTTE
chr1_1433374_T_C_b38	ATAD3C	-6.042	8.48e-09	-0.20746	25	0.034337	yes	PRSTTE
chr1_1457033_A_C_b38	ATAD3C	-6.018	9.58e-09	-0.203469	15	0.033809	yes	PRSTTE
chr1_1517993_A_G_b38	ATAD3C	-5.989	1.11e-08	-0.190806	34	0.031857	yes	PRSTTE
chr1_1428969_T_C_b38	ATAD3C	-5.931	1.5e-08	-0.205292	24	0.034614	yes	PRSTTE
chr1_1430190_A_C_b38	ATAD3C	-5.931	1.5e-08	-0.205292	24	0.034614	yes	PRSTTE
chr1_1431450_A_G_b38	ATAD3C	-5.897	1.78e-08	-0.203265	24	0.03447	yes	PRSTTE
chr1_1431537_G_C_b38	ATAD3C	-5.897	1.78e-08	-0.203265	24	0.03447	yes	PRSTTE
chr1_1426810_C_G_b38	ATAD3C	-5.871	2.03e-08	-0.203602	23	0.034679	yes	PRSTTE
chr1_1430908_A_G_b38	ATAD3C	-5.86	2.15e-08	-0.20063	24	0.03424	yes	PRSTTE
chr1_1445187_T_G_b38	ATAD3C	-5.854	2.21e-08	-0.204664	20	0.034959	yes	PRSTTE
chr1_1395346_A_G_b38	ATAD3C	-5.785	3.13e-08	-0.207442	26	0.035857	yes	PRSTTE
chr1_1402457_A_G_b38	ATAD3C	-5.785	3.13e-08	-0.207442	26	0.035857	yes	PRSTTE
chr1_1441187_A_G_b38	ATAD3C	-5.771	3.36e-08	-0.204189	15	0.03538	yes	PRSTTE
chr1_1454315_C_T_b38	ATAD3C	-5.748	3.77e-08	-0.202099	20	0.035159	yes	PRSTTE
chr1_1457071_C_T_b38	ATAD3C	-5.73	4.12e-08	-0.19387	15	0.033832	yes	PRSTTE
chr1_1426261_C_T_b38	ATAD3C	-5.698	4.83e-08	-0.201159	22	0.035301	yes	PRSTTE
chr1_1456829_G_C_b38	ATAD3C	-5.627	6.89e-08	-0.207353	17	0.036852	yes	PRSTTE
chr1_1431026_CCACCCCCT_C_b38	ATAD3C	-5.604	7.7e-08	-0.200376	15	0.035756	yes	PRSTTE
chr1_1308516_C_T_b38	ATAD3C	5.599	7.9e-08	0.184922	31	0.033029	yes	PRSTTE
chr1_1452511_A_G_b38	ATAD3C	-5.596	8e-08	-0.195037	23	0.034853	yes	PRSTTE
chr1_1452888_C_A_b38	ATAD3C	-5.596	8e-08	-0.195037	23	0.034853	yes	PRSTTE
chr1_1452909_A_C_b38	ATAD3C	-5.596	8e-08	-0.195037	23	0.034853	yes	PRSTTE
chr1_1453703_A_G_b38	ATAD3C	-5.596	8e-08	-0.195037	23	0.034853	yes	PRSTTE
chr1_1454092_A_G_b38	ATAD3C	-5.596	8e-08	-0.195037	23	0.034853	yes	PRSTTE
chr1_1454770_T_C_b38	ATAD3C	-5.596	8e-08	-0.195037	23	0.034853	yes	PRSTTE
chr1_1366561_AGT_A_b38	ATAD3C	5.583	8.55e-08	0.199798	26	0.03579	yes	PRSTTE
chr1_1455617_T_G_b38	ATAD3C	-5.58	8.67e-08	-0.194444	23	0.034848	yes	PRSTTE
chr1_1330125_G_A_b38	ATAD3C	5.577	8.79e-08	0.19988	26	0.035841	yes	PRSTTE
chr1_1456182_G_A_b38	ATAD3C	-5.564	9.36e-08	-0.193662	15	0.034805	yes	PRSTTE
chr1_1394423_A_G_b38	ATAD3C	-5.556	9.72e-08	-0.199914	26	0.035979	yes	PRSTTE
chr1_1387698_A_G_b38	ATAD3C	5.556	9.72e-08	0.199914	26	0.035979	yes	PRSTTE
chr1_1389827_C_T_b38	ATAD3C	5.556	9.72e-08	0.199914	26	0.035979	yes	PRSTTE
chr1_1449831_A_G_b38	ATAD3C	-5.551	9.96e-08	-0.206551	22	0.037207	yes	PRSTTE
chr1_1452540_G_A_b38	ATAD3C	-5.484	1.38e-07	-0.18986	12	0.034618	yes	PRSTTE
chr1_1445240_A_G_b38	ATAD3C	-5.44	1.71e-07	-0.191769	21	0.03525	yes	PRSTTE
chr1_1400410_A_G_b38	ATAD3C	-5.415	1.93e-07	-0.189449	22	0.034989	yes	PRSTTE
chr1_1411323_A_C_b38	ATAD3C	-5.406	2.02e-07	-0.196294	27	0.036314	yes	PRSTTE
chr1_1358384_G_C_b38	ATAD3C	5.397	2.1e-07	0.195093	26	0.036146	yes	PRSTTE
chr1_1452384_G_A_b38	ATAD3C	-5.387	2.21e-07	-0.203371	7	0.037754	yes	PRSTTE
chr1_1452346_A_G_b38	ATAD3C	-5.367	2.43e-07	-0.198741	8	0.03703	yes	PRSTTE
chr1_1471992_T_C_b38	ATAD3C	-5.31	3.19e-07	-0.175687	31	0.033087	yes	PRSTTE
chr1_1436388_CA_C_b38	ATAD3C	-5.309	3.2e-07	-0.189455	14	0.035684	yes	PRSTTE
chr1_1453870_A_C_b38	ATAD3C	-5.274	3.79e-07	-0.2016	7	0.038228	yes	PRSTTE
chr1_1453961_C_T_b38	ATAD3C	-5.229	4.67e-07	-0.200786	7	0.0384	yes	PRSTTE
chr1_1384749_C_G_b38	ATAD3C	5.207	5.19e-07	0.182842	22	0.035117	yes	PRSTTE
chr1_1387763_CCT_C_b38	ATAD3C	5.207	5.19e-07	0.182842	22	0.035117	yes	PRSTTE
chr1_1388944_G_A_b38	ATAD3C	5.207	5.19e-07	0.182842	22	0.035117	yes	PRSTTE
chr1_1431014_G_A_b38	ATAD3C	-5.202	5.31e-07	-0.17478	14	0.0336	yes	PRSTTE
chr1_1378204_G_C_b38	ATAD3C	5.198	5.4e-07	0.182369	21	0.035083	yes	PRSTTE
chr1_1309988_G_A_b38	ATAD3C	5.172	6.11e-07	0.178207	29	0.034459	yes	PRSTTE
chr1_1313807_G_A_b38	ATAD3C	5.172	6.11e-07	0.178207	29	0.034459	yes	PRSTTE
chr1_1450636_A_G_b38	ATAD3C	-5.168	6.21e-07	-0.195344	8	0.037798	yes	PRSTTE
chr1_1370113_A_G_b38	ATAD3C	5.153	6.67e-07	0.181987	16	0.035318	yes	PRSTTE
chr1_1376162_G_C_b38	ATAD3C	5.147	6.85e-07	0.180342	22	0.035037	yes	PRSTTE
chr1_1377431_C_T_b38	ATAD3C	5.147	6.85e-07	0.180342	22	0.035037	yes	PRSTTE
chr1_1312114_T_C_b38	ATAD3C	5.144	6.95e-07	0.178124	27	0.034628	yes	PRSTTE
chr1_1438102_G_C_b38	ATAD3C	-5.139	7.11e-07	-0.195007	8	0.037947	yes	PRSTTE
chr1_1432355_G_A_b38	ATAD3C	-5.032	1.16e-06	-0.179727	11	0.035717	yes	PRSTTE
chr1_1497605_G_C_b38	ATAD3C	-5.01	1.29e-06	-0.163896	24	0.032712	yes	PRSTTE
chr1_1532798_T_C_b38	ATAD3C	-4.988	1.42e-06	-0.151497	56	0.030372	yes	PRSTTE
chr1_1366427_AGTGTGATTGAATGAGT_A_b38	ATAD3C	4.988	1.42e-06	0.175991	21	0.035284	yes	PRSTTE
chr1_1449009_A_T_b38	ATAD3C	-4.925	1.89e-06	-0.188892	13	0.038354	yes	PRSTTE
chr1_1456217_T_C_b38	ATAD3C	-4.903	2.09e-06	-0.179458	23	0.036605	yes	PRSTTE
chr1_1456891_T_C_b38	ATAD3C	-4.879	2.33e-06	-0.149256	26	0.030591	yes	PRSTTE
chr1_1451028_T_A_b38	ATAD3C	-4.865	2.48e-06	-0.184457	8	0.037918	yes	PRSTTE
chr1_1448915_G_A_b38	ATAD3C	-4.848	2.68e-06	-0.168218	15	0.0347	yes	PRSTTE
chr1_1439805_G_C_b38	ATAD3C	-4.742	4.28e-06	-0.180913	8	0.038152	yes	PRSTTE
chr1_1479719_T_C_b38	ATAD3C	-4.719	4.72e-06	-0.171642	30	0.03637	yes	PRSTTE
chr1_1453643_A_ATT_b38	ATAD3C	-4.7	5.13e-06	-0.175728	16	0.037388	yes	PRSTTE
chr1_1337898_A_G_b38	ATAD3C	4.517	1.13e-05	0.170492	8	0.037743	yes	PRSTTE
chr1_1451787_A_C_b38	ATAD3C	-4.438	1.58e-05	-0.155565	19	0.035054	yes	PRSTTE
chr1_1421170_A_G_b38	ATAD3C	-4.418	1.71e-05	-0.241608	12	0.054685	yes	PRSTTE
chr1_1231507_T_C_b38	ATAD3C	-4.344	2.33e-05	-0.175932	5	0.040502	yes	PRSTTE
chr1_1379083_AT_A_b38	ATAD3C	4.309	2.69e-05	0.155563	12	0.036102	yes	PRSTTE
chr1_1442793_G_A_b38	ATAD3C	-4.289	2.92e-05	-0.170714	6	0.039805	yes	PRSTTE
chr1_1437993_G_A_b38	ATAD3C	-4.284	2.98e-05	-0.158494	10	0.036999	yes	PRSTTE
chr1_1537160_T_G_b38	ATAD3C	-4.247	3.46e-05	-0.143986	33	0.033902	yes	PRSTTE
chr1_1259424_T_C_b38	ATAD3C	-4.238	3.59e-05	-0.165671	23	0.039096	yes	PRSTTE
chr1_1303112_G_A_b38	ATAD3C	-4.185	4.44e-05	-0.181096	4	0.043269	yes	PRSTTE
chr1_1304555_A_C_b38	ATAD3C	-4.185	4.44e-05	-0.181096	4	0.043269	yes	PRSTTE
chr1_1316929_A_T_b38	ATAD3C	-4.156	4.98e-05	-0.174616	6	0.042013	yes	PRSTTE
chr1_1500745_A_C_b38	ATAD3C	-4.096	6.33e-05	-0.193595	18	0.047262	yes	PRSTTE
chr1_1570294_CA_C_b38	ATAD3C	-4.051	7.54e-05	-0.144479	26	0.035661	yes	PRSTTE
chr1_1303800_G_A_b38	ATAD3C	-4.011	8.83e-05	-0.181383	4	0.045219	yes	PRSTTE
chr1_1385919_A_AG_b38	ATAD3C	3.995	9.39e-05	0.217427	7	0.054421	yes	PRSTTE
chr1_1369803_C_CT_b38	ATAD3C	-3.987	9.69e-05	-0.159364	5	0.03997	yes	PRSTTE
chr1_1426253_G_A_b38	ATAD3C	-3.974	0.000102	-0.164385	6	0.041365	yes	PRSTTE
chr1_1428999_C_CA_b38	ATAD3C	-3.946	0.000114	-0.131149	16	0.033236	yes	PRSTTE
chr1_1569180_T_A_b38	ATAD3C	-3.943	0.000115	-0.135425	31	0.034344	yes	PRSTTE
chr1_1228424_C_T_b38	ATAD3C	-3.94	0.000116	-0.160994	4	0.040861	yes	PRSTTE
chr1_1569661_T_C_b38	ATAD3C	-3.937	0.000117	-0.132052	29	0.033539	yes	PRSTTE
chr1_1497606_C_G_b38	ATAD3C	-3.931	0.00012	-0.157722	6	0.040124	yes	PRSTTE
chr1_1431656_G_A_b38	ATAD3C	-3.915	0.000128	-0.158208	7	0.040406	yes	PRSTTE
chr1_1434687_C_G_b38	ATAD3C	-3.911	0.00013	-0.1583	7	0.040471	yes	PRSTTE
chr1_1329973_GCGTGTGCCATGCA_G_b38	ATAD3C	-3.866	0.000154	-0.172165	5	0.044528	yes	PRSTTE
chr1_1344048_G_A_b38	ATAD3C	-3.866	0.000154	-0.172165	5	0.044528	yes	PRSTTE
chr1_1290841_A_G_b38	ATAD3C	-3.826	0.000179	-0.148165	17	0.038723	yes	PRSTTE
chr1_1372909_G_A_b38	ATAD3C	-3.811	0.000189	-0.1684	4	0.044186	yes	PRSTTE
chr1_1435945_C_CCGGGCGGGGGCG_b38	ATAD3C	-3.811	0.00019	-0.156297	7	0.041014	yes	PRSTTE
chr1_1559750_C_CAG_b38	ATAD3C	-3.782	0.000211	-0.129479	32	0.034235	yes	PRSTTE
chr1_1561628_T_C_b38	ATAD3C	-3.782	0.000211	-0.129479	32	0.034235	yes	PRSTTE
chr1_1563918_A_G_b38	ATAD3C	-3.782	0.000211	-0.129479	32	0.034235	yes	PRSTTE
chr1_1565561_A_G_b38	ATAD3C	-3.782	0.000211	-0.129479	32	0.034235	yes	PRSTTE
chr1_1566086_G_A_b38	ATAD3C	-3.782	0.000211	-0.129479	32	0.034235	yes	PRSTTE
chr1_1567715_G_A_b38	ATAD3C	-3.782	0.000211	-0.129479	32	0.034235	yes	PRSTTE
chr1_1567719_A_C_b38	ATAD3C	-3.782	0.000211	-0.129479	32	0.034235	yes	PRSTTE
chr1_1569875_C_T_b38	ATAD3C	-3.782	0.000211	-0.129479	32	0.034235	yes	PRSTTE
chr1_1572532_A_C_b38	ATAD3C	-3.782	0.000211	-0.129479	32	0.034235	yes	PRSTTE
chr1_1573079_A_G_b38	ATAD3C	-3.782	0.000211	-0.129479	32	0.034235	yes	PRSTTE
chr1_1251122_A_T_b38	ATAD3C	-3.771	0.00022	-0.148633	8	0.039419	yes	PRSTTE
chr1_1238231_G_A_b38	ATAD3C	-3.77	0.000221	-0.151421	7	0.040165	yes	PRSTTE
chr1_1341550_GCA_G_b38	ATAD3C	-3.769	0.000221	-0.165511	5	0.043911	yes	PRSTTE
chr1_1364253_C_G_b38	ATAD3C	-3.769	0.000221	-0.165511	5	0.043911	yes	PRSTTE
chr1_1249880_A_G_b38	ATAD3C	-3.744	0.000243	-0.153768	7	0.041071	yes	PRSTTE
chr1_1565105_CAAGGCAGGCGGATCATG_C_b38	ATAD3C	-3.743	0.000244	-0.12614	33	0.033703	yes	PRSTTE
chr1_1538787_A_G_b38	ATAD3C	-3.739	0.000248	-0.12798	32	0.034228	yes	PRSTTE
chr1_1201373_T_C_b38	ATAD3C	-3.729	0.000257	-0.141082	8	0.037835	yes	PRSTTE
chr1_1501260_A_AT_b38	ATAD3C	-3.726	0.00026	-0.165141	7	0.044325	yes	PRSTTE
chr1_1370532_C_T_b38	ATAD3C	-3.685	0.000302	-0.150165	6	0.040755	yes	PRSTTE
chr1_1410877_A_G_b38	ATAD3C	-3.681	0.000307	-0.202238	13	0.054948	yes	PRSTTE
chr1_1431813_G_T_b38	ATAD3C	-3.679	0.000309	-0.139141	10	0.03782	yes	PRSTTE
chr1_1292284_TTGAG_T_b38	ATAD3C	-3.672	0.000317	-0.147039	11	0.040045	yes	PRSTTE
chr1_1380867_A_G_b38	ATAD3C	-3.662	0.000329	-0.163096	5	0.044542	yes	PRSTTE
chr1_1575421_C_T_b38	ATAD3C	-3.659	0.000332	-0.12461	29	0.034059	yes	PRSTTE
chr1_1258206_AT_A_b38	ATAD3C	-3.624	0.000376	-0.138987	17	0.038347	yes	PRSTTE
chr1_1215852_T_C_b38	ATAD3C	-3.602	0.000408	-0.15157	3	0.042078	yes	PRSTTE
chr1_1565680_A_AG_b38	ATAD3C	-3.601	0.00041	-0.125219	30	0.034775	yes	PRSTTE
chr1_1229369_G_GC_b38	ATAD3C	-3.596	0.000416	-0.143912	7	0.040018	yes	PRSTTE
chr1_1551454_C_A_b38	ATAD3C	-3.585	0.000434	-0.105235	60	0.029358	yes	PRSTTE
chr1_1566854_CA_C_b38	ATAD3C	-3.584	0.000436	-0.13287	21	0.037078	yes	PRSTTE
chr1_1361685_C_T_b38	ATAD3C	-3.579	0.000442	-0.141366	14	0.039495	yes	PRSTTE
chr1_1308178_GGGGCGCGGGGA_G_b38	ATAD3C	-3.574	0.000451	-0.137949	8	0.0386	yes	PRSTTE
chr1_1382893_G_A_b38	ATAD3C	-3.553	0.000485	-0.158461	5	0.044597	yes	PRSTTE
chr1_1325753_G_T_b38	ATAD3C	-3.55	0.00049	-0.169203	3	0.047656	yes	PRSTTE
chr1_1363153_T_G_b38	ATAD3C	3.549	0.000493	0.202443	8	0.057043	yes	PRSTTE
chr1_1368047_ACT_A_b38	ATAD3C	3.549	0.000493	0.202443	8	0.057043	yes	PRSTTE
chr1_1364566_T_C_b38	ATAD3C	-3.534	0.000519	-0.153184	5	0.043341	yes	PRSTTE
chr1_1331945_G_GC_b38	ATAD3C	-3.533	0.000522	-0.210086	4	0.059469	yes	PRSTTE
chr1_1518285_T_C_b38	ATAD3C	-3.515	0.000556	-0.141746	21	0.040326	yes	PRSTTE
chr1_1573654_T_C_b38	ATAD3C	-3.51	0.000565	-0.121895	30	0.034724	yes	PRSTTE
chr1_1574445_A_G_b38	ATAD3C	-3.51	0.000565	-0.121895	30	0.034724	yes	PRSTTE
chr1_1277844_T_A_b38	ATAD3C	-3.504	0.000578	-0.159338	11	0.045478	yes	PRSTTE
chr1_1367280_T_A_b38	ATAD3C	-3.486	0.000616	-0.148205	5	0.042517	yes	PRSTTE
chr1_1221049_C_G_b38	ATAD3C	-3.486	0.000616	-0.123682	20	0.035484	yes	PRSTTE
chr1_1394041_G_A_b38	ATAD3C	-3.475	0.00064	-0.166697	3	0.047977	yes	PRSTTE
chr1_1366681_T_TGA_b38	ATAD3C	-3.469	0.000653	-0.148627	5	0.042843	yes	PRSTTE
chr1_1419135_C_G_b38	ATAD3C	-3.466	0.000659	-0.188666	16	0.054431	yes	PRSTTE
chr1_1322866_A_C_b38	ATAD3C	3.456	0.000683	0.194082	9	0.056154	yes	PRSTTE
chr1_1357046_C_G_b38	ATAD3C	3.455	0.000684	0.198239	10	0.05737	yes	PRSTTE
chr1_1357369_C_T_b38	ATAD3C	3.455	0.000684	0.198239	10	0.05737	yes	PRSTTE
chr1_1359943_G_A_b38	ATAD3C	3.455	0.000684	0.198239	10	0.05737	yes	PRSTTE
chr1_1360023_T_C_b38	ATAD3C	3.455	0.000684	0.198239	10	0.05737	yes	PRSTTE
chr1_1407565_C_A_b38	ATAD3C	-3.455	0.000685	-0.158853	5	0.045977	yes	PRSTTE
chr1_1368991_C_T_b38	ATAD3C	-3.451	0.000694	-0.146303	5	0.042391	yes	PRSTTE
chr1_1437955_C_G_b38	ATAD3C	-3.445	0.000709	-0.114371	15	0.033196	yes	PRSTTE
chr1_1501403_T_C_b38	ATAD3C	-3.433	0.00074	-0.149939	14	0.043675	yes	PRSTTE
chr1_1425013_C_T_b38	ATAD3C	-3.414	0.000791	-0.173243	17	0.050752	yes	PRSTTE
chr1_1327586_C_T_b38	ATAD3C	3.412	0.000796	0.188988	4	0.055393	yes	PRSTTE
chr1_1447108_A_ATT_b38	ATAD3C	-3.412	0.000796	-0.131634	9	0.038582	yes	PRSTTE
chr1_1329774_T_C_b38	ATAD3C	3.401	0.000827	0.194226	4	0.057115	yes	PRSTTE
chr1_1374505_A_G_b38	ATAD3C	-3.393	0.00085	-0.145734	5	0.042956	yes	PRSTTE
chr1_1375642_C_T_b38	ATAD3C	-3.393	0.00085	-0.145734	5	0.042956	yes	PRSTTE
chr1_1290968_C_G_b38	ATAD3C	-3.387	0.000866	-0.129876	18	0.038344	yes	PRSTTE
chr1_1363688_C_T_b38	ATAD3C	-3.376	0.000899	-0.143716	5	0.042566	yes	PRSTTE
chr1_1363880_A_G_b38	ATAD3C	-3.376	0.000899	-0.143716	5	0.042566	yes	PRSTTE
chr1_1364099_CCA_C_b38	ATAD3C	-3.376	0.000899	-0.143716	5	0.042566	yes	PRSTTE
chr1_1364102_TGTTG_T_b38	ATAD3C	-3.376	0.000899	-0.143716	5	0.042566	yes	PRSTTE
chr1_1364282_T_G_b38	ATAD3C	-3.376	0.000899	-0.143716	5	0.042566	yes	PRSTTE
chr1_1364357_A_C_b38	ATAD3C	-3.376	0.000899	-0.143716	5	0.042566	yes	PRSTTE
chr1_1364694_T_C_b38	ATAD3C	-3.376	0.000899	-0.143716	5	0.042566	yes	PRSTTE
chr1_1364721_C_T_b38	ATAD3C	-3.376	0.000899	-0.143716	5	0.042566	yes	PRSTTE
chr1_1365160_A_G_b38	ATAD3C	-3.376	0.000899	-0.143716	5	0.042566	yes	PRSTTE
chr1_1365198_C_T_b38	ATAD3C	-3.376	0.000899	-0.143716	5	0.042566	yes	PRSTTE
chr1_1366008_A_G_b38	ATAD3C	-3.376	0.000899	-0.143716	5	0.042566	yes	PRSTTE
chr1_1366062_T_C_b38	ATAD3C	-3.376	0.000899	-0.143716	5	0.042566	yes	PRSTTE
chr1_1366145_TGTGAA_T_b38	ATAD3C	-3.376	0.000899	-0.143716	5	0.042566	yes	PRSTTE
chr1_1366187_A_AGT_b38	ATAD3C	-3.376	0.000899	-0.143716	5	0.042566	yes	PRSTTE
chr1_1366321_TGTGTGTAAATGG_T_b38	ATAD3C	-3.376	0.000899	-0.143716	5	0.042566	yes	PRSTTE
chr1_1366453_G_T_b38	ATAD3C	-3.376	0.000899	-0.143716	5	0.042566	yes	PRSTTE
chr1_1366511_GGTGA_G_b38	ATAD3C	-3.376	0.000899	-0.143716	5	0.042566	yes	PRSTTE
chr1_1366726_T_G_b38	ATAD3C	-3.376	0.000899	-0.143716	5	0.042566	yes	PRSTTE
chr1_1367258_T_A_b38	ATAD3C	-3.376	0.000899	-0.143716	5	0.042566	yes	PRSTTE
chr1_1367268_TGA_T_b38	ATAD3C	-3.376	0.000899	-0.143716	5	0.042566	yes	PRSTTE
chr1_1367297_GAA_G_b38	ATAD3C	-3.376	0.000899	-0.143716	5	0.042566	yes	PRSTTE
chr1_1367300_T_TGA_b38	ATAD3C	-3.376	0.000899	-0.143716	5	0.042566	yes	PRSTTE
chr1_1367329_A_AGT_b38	ATAD3C	-3.376	0.000899	-0.143716	5	0.042566	yes	PRSTTE
chr1_1367373_T_TGTG_b38	ATAD3C	-3.376	0.000899	-0.143716	5	0.042566	yes	PRSTTE
chr1_1367388_T_TTGG_b38	ATAD3C	-3.376	0.000899	-0.143716	5	0.042566	yes	PRSTTE
chr1_1367593_G_A_b38	ATAD3C	-3.376	0.000899	-0.143716	5	0.042566	yes	PRSTTE
chr1_1367602_GT_G_b38	ATAD3C	-3.376	0.000899	-0.143716	5	0.042566	yes	PRSTTE
chr1_1367605_GAGTGAGTGTA_G_b38	ATAD3C	-3.376	0.000899	-0.143716	5	0.042566	yes	PRSTTE
chr1_1367670_GGTGA_G_b38	ATAD3C	-3.376	0.000899	-0.143716	5	0.042566	yes	PRSTTE
chr1_1367722_TTTTA_T_b38	ATAD3C	-3.376	0.000899	-0.143716	5	0.042566	yes	PRSTTE
chr1_1367874_A_T_b38	ATAD3C	-3.376	0.000899	-0.143716	5	0.042566	yes	PRSTTE
chr1_1367919_C_T_b38	ATAD3C	-3.376	0.000899	-0.143716	5	0.042566	yes	PRSTTE
chr1_1367951_C_T_b38	ATAD3C	-3.376	0.000899	-0.143716	5	0.042566	yes	PRSTTE
chr1_1367965_A_G_b38	ATAD3C	-3.376	0.000899	-0.143716	5	0.042566	yes	PRSTTE
chr1_1367970_T_G_b38	ATAD3C	-3.376	0.000899	-0.143716	5	0.042566	yes	PRSTTE
chr1_1367994_C_A_b38	ATAD3C	-3.376	0.000899	-0.143716	5	0.042566	yes	PRSTTE
chr1_1368297_C_T_b38	ATAD3C	-3.376	0.000899	-0.143716	5	0.042566	yes	PRSTTE
chr1_1368514_C_G_b38	ATAD3C	-3.376	0.000899	-0.143716	5	0.042566	yes	PRSTTE
chr1_1368763_G_A_b38	ATAD3C	-3.376	0.000899	-0.143716	5	0.042566	yes	PRSTTE
chr1_1369282_G_A_b38	ATAD3C	-3.376	0.000899	-0.143716	5	0.042566	yes	PRSTTE
chr1_1369320_GT_G_b38	ATAD3C	-3.376	0.000899	-0.143716	5	0.042566	yes	PRSTTE
chr1_1369407_G_A_b38	ATAD3C	-3.376	0.000899	-0.143716	5	0.042566	yes	PRSTTE
chr1_1369476_CTT_C_b38	ATAD3C	-3.376	0.000899	-0.143716	5	0.042566	yes	PRSTTE
chr1_1369556_C_G_b38	ATAD3C	-3.376	0.000899	-0.143716	5	0.042566	yes	PRSTTE
chr1_1369627_T_C_b38	ATAD3C	-3.376	0.000899	-0.143716	5	0.042566	yes	PRSTTE
chr1_1369686_T_C_b38	ATAD3C	-3.376	0.000899	-0.143716	5	0.042566	yes	PRSTTE
chr1_1369716_G_C_b38	ATAD3C	-3.376	0.000899	-0.143716	5	0.042566	yes	PRSTTE
chr1_1369741_C_T_b38	ATAD3C	-3.376	0.000899	-0.143716	5	0.042566	yes	PRSTTE
chr1_1370181_C_T_b38	ATAD3C	-3.376	0.000899	-0.143716	5	0.042566	yes	PRSTTE
chr1_1370317_G_C_b38	ATAD3C	-3.376	0.000899	-0.143716	5	0.042566	yes	PRSTTE
chr1_1370320_A_G_b38	ATAD3C	-3.376	0.000899	-0.143716	5	0.042566	yes	PRSTTE
chr1_1370430_T_C_b38	ATAD3C	-3.376	0.000899	-0.143716	5	0.042566	yes	PRSTTE
chr1_1370584_G_C_b38	ATAD3C	-3.376	0.000899	-0.143716	5	0.042566	yes	PRSTTE
chr1_1368177_G_C_b38	ATAD3C	-3.367	0.000929	-0.147964	6	0.043948	yes	PRSTTE
chr1_1422081_C_T_b38	ATAD3C	-3.363	0.000941	-0.185299	16	0.0551	yes	PRSTTE
chr1_1398218_C_A_b38	ATAD3C	-3.348	0.000989	-0.151076	5	0.04512	yes	PRSTTE
chr1_1400756_GGA_G_b38	ATAD3C	-3.348	0.000989	-0.151076	5	0.04512	yes	PRSTTE
chr1_1401954_G_T_b38	ATAD3C	-3.348	0.000989	-0.151076	5	0.04512	yes	PRSTTE
chr1_1403593_A_G_b38	ATAD3C	-3.348	0.000989	-0.151076	5	0.04512	yes	PRSTTE
chr1_1577491_A_AC_b38	ATAD3C	-3.339	0.00102	-0.114633	31	0.034333	yes	PRSTTE
chr1_1369009_T_C_b38	ATAD3C	-3.336	0.00103	-0.143129	5	0.042904	yes	PRSTTE
chr1_1380790_G_A_b38	ATAD3C	3.335	0.00104	0.186361	5	0.055884	yes	PRSTTE
chr1_1381268_C_T_b38	ATAD3C	3.335	0.00104	0.186361	5	0.055884	yes	PRSTTE
chr1_1381294_C_T_b38	ATAD3C	3.335	0.00104	0.186361	5	0.055884	yes	PRSTTE
chr1_1279728_TG_T_b38	ATAD3C	-3.334	0.00104	-0.151883	10	0.045561	yes	PRSTTE
chr1_1361679_G_A_b38	ATAD3C	3.333	0.00104	0.130144	19	0.039041	yes	PRSTTE
chr1_1530331_T_C_b38	ATAD3C	-3.329	0.00106	-0.134256	15	0.040334	yes	PRSTTE
chr1_1366292_G_T_b38	ATAD3C	-3.327	0.00106	-0.141811	5	0.042621	yes	PRSTTE
chr1_1274972_A_G_b38	ATAD3C	-3.321	0.00108	-0.150767	12	0.045397	yes	PRSTTE
chr1_1275091_T_C_b38	ATAD3C	-3.321	0.00108	-0.150767	12	0.045397	yes	PRSTTE
chr1_1278407_T_TA_b38	ATAD3C	-3.321	0.00108	-0.150767	12	0.045397	yes	PRSTTE
chr1_1173996_G_A_b38	ATAD3C	-3.319	0.00109	-0.159698	4	0.04811	yes	PRSTTE
chr1_1174523_C_T_b38	ATAD3C	-3.319	0.00109	-0.159698	4	0.04811	yes	PRSTTE
chr1_1174747_C_T_b38	ATAD3C	-3.319	0.00109	-0.159698	4	0.04811	yes	PRSTTE
chr1_1302795_T_TC_b38	ATAD3C	3.318	0.0011	0.12107	37	0.036493	yes	PRSTTE
chr1_1190043_C_T_b38	ATAD3C	-3.317	0.0011	-0.17332	3	0.052245	yes	PRSTTE
chr1_1324788_C_A_b38	ATAD3C	3.315	0.00111	0.185657	8	0.056008	yes	PRSTTE
chr1_1522693_A_G_b38	ATAD3C	3.311	0.00112	0.11827	12	0.035725	yes	PRSTTE
chr1_1369012_C_CG_b38	ATAD3C	-3.31	0.00113	-0.142095	5	0.042933	yes	PRSTTE
chr1_1511945_G_A_b38	ATAD3C	-3.29	0.0012	-0.144178	14	0.04382	yes	PRSTTE
chr1_1512376_G_C_b38	ATAD3C	-3.29	0.00121	-0.14407	13	0.043796	yes	PRSTTE
chr1_1524202_G_A_b38	ATAD3C	-3.272	0.00128	-0.196842	9	0.060161	yes	PRSTTE
chr1_1184478_C_T_b38	ATAD3C	-3.269	0.00129	-0.154494	11	0.047262	yes	PRSTTE
chr1_1533018_T_C_b38	ATAD3C	-3.269	0.00129	-0.208949	7	0.063927	yes	PRSTTE
chr1_1358907_C_A_b38	ATAD3C	3.267	0.0013	0.182673	10	0.055914	yes	PRSTTE
chr1_1415976_G_A_b38	ATAD3C	-3.266	0.00131	-0.177795	8	0.054446	yes	PRSTTE
chr1_1366941_T_TGTGTGCA_b38	ATAD3C	3.261	0.00133	0.157534	5	0.048313	yes	PRSTTE
chr1_1366951_A_AGT_b38	ATAD3C	3.261	0.00133	0.157534	5	0.048313	yes	PRSTTE
chr1_1359138_C_T_b38	ATAD3C	3.251	0.00137	0.18769	10	0.057739	yes	PRSTTE
chr1_1337736_A_G_b38	ATAD3C	3.24	0.00142	0.184426	4	0.056913	yes	PRSTTE
chr1_1571794_A_AT_b38	ATAD3C	-3.229	0.00148	-0.117786	27	0.03648	yes	PRSTTE
chr1_1173724_G_T_b38	ATAD3C	-3.216	0.00154	-0.156863	4	0.048782	yes	PRSTTE
chr1_1384546_C_T_b38	ATAD3C	-3.215	0.00154	-0.147566	5	0.045897	yes	PRSTTE
chr1_1533841_T_C_b38	ATAD3C	-3.214	0.00155	-0.127562	12	0.039687	yes	PRSTTE
chr1_1274256_A_G_b38	ATAD3C	-3.211	0.00157	-0.148378	10	0.046209	yes	PRSTTE
chr1_1274980_C_T_b38	ATAD3C	-3.211	0.00157	-0.148378	10	0.046209	yes	PRSTTE
chr1_1275912_C_T_b38	ATAD3C	-3.211	0.00157	-0.148378	10	0.046209	yes	PRSTTE
chr1_1174174_G_C_b38	ATAD3C	-3.203	0.00161	-0.15409	4	0.048109	yes	PRSTTE
chr1_1363898_C_T_b38	ATAD3C	3.203	0.00161	0.132061	7	0.041237	yes	PRSTTE
chr1_1363986_C_T_b38	ATAD3C	3.203	0.00161	0.132061	7	0.041237	yes	PRSTTE
chr1_1366529_TTAG_T_b38	ATAD3C	3.203	0.00161	0.132061	7	0.041237	yes	PRSTTE
chr1_1367292_A_AGT_b38	ATAD3C	3.203	0.00161	0.132061	7	0.041237	yes	PRSTTE
chr1_1173138_T_C_b38	ATAD3C	-3.195	0.00165	-0.13923	6	0.04358	yes	PRSTTE
chr1_1238902_T_C_b38	ATAD3C	-3.188	0.00169	-0.110398	23	0.034626	yes	PRSTTE
chr1_1411525_T_A_b38	ATAD3C	-3.184	0.00171	-0.172835	7	0.054284	yes	PRSTTE
chr1_1534226_C_T_b38	ATAD3C	-3.161	0.00185	-0.104377	26	0.033024	yes	PRSTTE
chr1_1971331_C_A_b38	ATAD3C	-3.156	0.00187	-0.199603	6	0.063236	yes	PRSTTE
chr1_1385553_G_A_b38	ATAD3C	3.155	0.00188	0.166447	7	0.05276	yes	PRSTTE
chr1_1365566_G_A_b38	ATAD3C	3.149	0.00192	0.12934	7	0.041075	yes	PRSTTE
chr1_1231710_CCCCCGGGAA_C_b38	ATAD3C	-3.14	0.00198	-0.13799	3	0.043951	yes	PRSTTE
chr1_1482316_C_G_b38	ATAD3C	-3.132	0.00203	-0.09589	27	0.03062	yes	PRSTTE
chr1_1375288_A_C_b38	ATAD3C	3.125	0.00207	0.171951	5	0.055022	yes	PRSTTE
chr1_1375595_C_T_b38	ATAD3C	3.125	0.00207	0.171951	5	0.055022	yes	PRSTTE
chr1_1375998_T_A_b38	ATAD3C	3.125	0.00207	0.171951	5	0.055022	yes	PRSTTE
chr1_1376092_G_A_b38	ATAD3C	3.125	0.00207	0.171951	5	0.055022	yes	PRSTTE
chr1_1376336_G_A_b38	ATAD3C	3.125	0.00207	0.171951	5	0.055022	yes	PRSTTE
chr1_1379664_G_A_b38	ATAD3C	3.125	0.00207	0.171951	5	0.055022	yes	PRSTTE
chr1_1282706_C_T_b38	ATAD3C	-3.121	0.0021	-0.143323	12	0.045924	yes	PRSTTE
chr1_1369821_C_T_b38	ATAD3C	-3.121	0.0021	-0.13374	5	0.042858	yes	PRSTTE
chr1_1383743_T_C_b38	ATAD3C	-3.114	0.00214	-0.140234	5	0.045026	yes	PRSTTE
chr1_1178014_C_T_b38	ATAD3C	-3.104	0.00221	-0.151545	4	0.048818	yes	PRSTTE
chr1_1279694_A_G_b38	ATAD3C	-3.102	0.00223	-0.143906	9	0.046395	yes	PRSTTE
chr1_1279698_A_G_b38	ATAD3C	-3.102	0.00223	-0.143906	9	0.046395	yes	PRSTTE
chr1_1571986_G_A_b38	ATAD3C	-3.1	0.00225	-0.103426	26	0.033367	yes	PRSTTE
chr1_1277269_T_C_b38	ATAD3C	-3.09	0.00232	-0.142816	11	0.046221	yes	PRSTTE
chr1_1361833_G_C_b38	ATAD3C	3.083	0.00237	0.147764	3	0.04793	yes	PRSTTE
chr1_1367462_T_C_b38	ATAD3C	-3.066	0.0025	-0.133157	5	0.043429	yes	PRSTTE
chr1_1518541_T_C_b38	ATAD3C	-3.065	0.00251	-0.119022	11	0.038831	yes	PRSTTE
chr1_1179288_G_A_b38	ATAD3C	-3.049	0.00264	-0.147445	4	0.048355	yes	PRSTTE
chr1_1516000_T_C_b38	ATAD3C	-3.049	0.00264	-0.123726	15	0.040583	yes	PRSTTE
chr1_1370553_CAAA_C_b38	ATAD3C	-3.033	0.00278	-0.134317	4	0.044291	yes	PRSTTE
chr1_1363438_C_CTT_b38	ATAD3C	3.031	0.00279	0.108813	16	0.035895	yes	PRSTTE
chr1_1367511_ATGAG_A_b38	ATAD3C	-3.025	0.00285	-0.133066	4	0.043984	yes	PRSTTE
chr1_1177430_G_T_b38	ATAD3C	-3.024	0.00286	-0.146093	4	0.048311	yes	PRSTTE
chr1_1379091_T_G_b38	ATAD3C	3.015	0.00294	0.132882	6	0.044071	yes	PRSTTE
chr1_1341030_C_A_b38	ATAD3C	3.008	0.003	0.168026	10	0.055852	yes	PRSTTE
chr1_1188054_T_A_b38	ATAD3C	-3.006	0.00303	-0.117977	5	0.039253	yes	PRSTTE
chr1_1398056_C_A_b38	ATAD3C	-3.003	0.00305	-0.09724	27	0.032377	yes	PRSTTE
chr1_1549967_C_G_b38	ATAD3C	-2.992	0.00316	-0.110712	15	0.037004	yes	PRSTTE
chr1_1174573_G_A_b38	ATAD3C	-2.992	0.00316	-0.148671	4	0.049693	yes	PRSTTE
chr1_1216593_G_C_b38	ATAD3C	-2.984	0.00324	-0.126174	3	0.042283	yes	PRSTTE
chr1_1174578_A_G_b38	ATAD3C	-2.961	0.00347	-0.130021	6	0.043905	yes	PRSTTE
chr1_1407232_G_C_b38	ATAD3C	-2.946	0.00365	-0.11476	7	0.038959	yes	PRSTTE
chr1_1570587_C_T_b38	ATAD3C	-2.931	0.00381	-0.099025	29	0.033785	yes	PRSTTE
chr1_1379093_TG_T_b38	ATAD3C	-2.921	0.00393	-0.137976	3	0.047232	yes	PRSTTE
chr1_1411929_G_C_b38	ATAD3C	-2.92	0.00394	-0.1583	8	0.054206	yes	PRSTTE
chr1_2103488_A_G_b38	ATAD3C	-2.92	0.00395	-0.218064	7	0.07469	yes	PRSTTE
chr1_1524664_A_G_b38	ATAD3C	-2.913	0.00403	-0.116366	21	0.039945	yes	PRSTTE
chr1_1174845_C_T_b38	ATAD3C	-2.906	0.00411	-0.140242	4	0.048252	yes	PRSTTE
chr1_1174988_C_T_b38	ATAD3C	-2.906	0.00411	-0.140242	4	0.048252	yes	PRSTTE
chr1_1175040_T_C_b38	ATAD3C	-2.906	0.00411	-0.140242	4	0.048252	yes	PRSTTE
chr1_1417051_CA_C_b38	ATAD3C	-2.902	0.00417	-0.144263	3	0.049707	yes	PRSTTE
chr1_1713469_C_T_b38	ATAD3C	2.899	0.00421	0.125611	14	0.043331	yes	PRSTTE
chr1_1410616_G_T_b38	ATAD3C	-2.89	0.00432	-0.156684	9	0.054218	yes	PRSTTE
chr1_1412488_C_CAG_b38	ATAD3C	-2.89	0.00432	-0.156684	9	0.054218	yes	PRSTTE
chr1_1707555_C_T_b38	ATAD3C	-2.88	0.00446	-0.171709	16	0.05962	yes	PRSTTE
chr1_1424819_C_T_b38	ATAD3C	-2.879	0.00447	-0.1923	4	0.066802	yes	PRSTTE
chr1_1559703_G_C_b38	ATAD3C	-2.871	0.00457	-0.097246	29	0.033866	yes	PRSTTE
chr1_1568548_G_A_b38	ATAD3C	-2.871	0.00457	-0.097246	29	0.033866	yes	PRSTTE
chr1_1530002_A_G_b38	ATAD3C	-2.86	0.00474	-0.182704	7	0.06389	yes	PRSTTE
chr1_1241053_A_G_b38	ATAD3C	-2.848	0.0049	-0.136793	4	0.048027	yes	PRSTTE
chr1_928309_A_G_b38	ATAD3C	2.838	0.00506	0.228375	4	0.08048	yes	PRSTTE
chr1_1178191_A_G_b38	ATAD3C	-2.81	0.0055	-0.118258	7	0.042088	yes	PRSTTE
chr1_1419214_A_G_b38	ATAD3C	-2.801	0.00565	-0.150972	5	0.0539	yes	PRSTTE
chr1_1366776_G_GAATT_b38	ATAD3C	-2.783	0.00597	-0.123384	5	0.044342	yes	PRSTTE
chr1_1174639_A_G_b38	ATAD3C	-2.779	0.00603	-0.120917	6	0.043513	yes	PRSTTE
chr1_2121503_A_G_b38	ATAD3C	-2.776	0.00608	-0.196596	5	0.070818	yes	PRSTTE
chr1_1718663_C_T_b38	ATAD3C	2.771	0.00618	0.13055	12	0.04712	yes	PRSTTE
chr1_1388565_GTC_G_b38	ATAD3C	2.766	0.00627	0.111488	9	0.040309	yes	PRSTTE
chr1_1282558_C_CCA_b38	ATAD3C	-2.756	0.00644	-0.117706	14	0.042703	yes	PRSTTE
chr1_1236303_A_G_b38	ATAD3C	-2.753	0.0065	-0.121547	3	0.044148	yes	PRSTTE
chr1_1523187_A_G_b38	ATAD3C	-2.742	0.00671	-0.16478	11	0.060088	yes	PRSTTE
chr1_1408687_T_C_b38	ATAD3C	-2.741	0.00673	-0.154064	6	0.056202	yes	PRSTTE
chr1_1538924_C_A_b38	ATAD3C	-2.739	0.00677	-0.098744	16	0.036048	yes	PRSTTE
chr1_1513923_G_C_b38	ATAD3C	-2.735	0.00686	-0.10854	15	0.039687	yes	PRSTTE
chr1_2282479_GGTGGTGGAGATCTTCAGAGAGAGGACGCCTGAGAAGACAGGCA_G_b38	ATAD3C	2.735	0.00686	0.12865	7	0.047042	yes	PRSTTE
chr1_2359219_C_T_b38	ATAD3C	-2.731	0.00694	-0.198419	4	0.072652	yes	PRSTTE
chr1_1971277_GCA_G_b38	ATAD3C	-2.705	0.00748	-0.187301	3	0.069236	yes	PRSTTE
chr1_1975785_C_T_b38	ATAD3C	-2.705	0.00748	-0.187301	3	0.069236	yes	PRSTTE
chr1_1976709_G_A_b38	ATAD3C	-2.705	0.00748	-0.187301	3	0.069236	yes	PRSTTE
chr1_2080325_A_AGTGCGCGTGGACGTGGCGGTGCGCGTGGACGTGGCG_b38	ATAD3C	-2.696	0.00767	-0.206103	5	0.076441	yes	PRSTTE
chr1_1976834_T_C_b38	ATAD3C	-2.69	0.00782	-0.177554	7	0.066016	yes	PRSTTE
chr1_2369187_T_TA_b38	ATAD3C	-2.686	0.00791	-0.182294	4	0.067872	yes	PRSTTE
chr1_1301426_A_AT_b38	ATAD3C	-2.682	0.00799	-0.118405	7	0.044143	yes	PRSTTE
chr1_1280044_T_C_b38	ATAD3C	-2.68	0.00803	-0.099839	28	0.037249	yes	PRSTTE
chr1_1363456_CAG_C_b38	ATAD3C	2.677	0.00811	0.102017	12	0.038107	yes	PRSTTE
chr1_788757_T_TAATGGAATGG_b38	ATAD3C	2.676	0.00814	0.088534	16	0.033085	yes	PRSTTE
chr1_1812407_T_TAC_b38	ATAD3C	2.674	0.00817	0.111112	5	0.041546	yes	PRSTTE
chr1_2355481_C_T_b38	ATAD3C	-2.673	0.00821	-0.182887	4	0.068421	yes	PRSTTE
chr1_2364608_C_A_b38	ATAD3C	-2.673	0.00821	-0.182887	4	0.068421	yes	PRSTTE
chr1_1251285_G_A_b38	ATAD3C	-2.671	0.00825	-0.125233	4	0.046884	yes	PRSTTE
chr1_2364876_C_T_b38	ATAD3C	-2.667	0.00836	-0.194225	4	0.072835	yes	PRSTTE
chr1_1236037_C_T_b38	ATAD3C	-2.656	0.00861	-0.08686	28	0.032701	yes	PRSTTE
chr1_1351517_G_C_b38	ATAD3C	2.652	0.00871	0.14084	6	0.053105	yes	PRSTTE
chr1_1574655_GGC_G_b38	ATAD3C	-2.624	0.00943	-0.090423	27	0.034458	yes	PRSTTE
chr1_1293731_A_ACGCCCCTGCCCTGGAGGCCCCGCCCCTGCCCTGGAGGCCC_b38	ATAD3C	-2.614	0.0097	-0.146227	4	0.055939	yes	PRSTTE
chr1_1177741_G_A_b38	ATAD3C	-2.61	0.00982	-0.113512	6	0.043494	yes	PRSTTE
chr1_1722940_TAAG_T_b38	ATAD3C	2.604	0.00999	0.108202	18	0.041557	yes	PRSTTE
chr1_1541864_T_C_b38	ATAD3C	-4.121	5.74e-05	-0.141689	30	0.034385	no	PRSTTE
chr1_1551557_A_AG_b38	ATAD3C	-4.121	5.74e-05	-0.141689	30	0.034385	no	PRSTTE
chr1_1551559_A_T_b38	ATAD3C	-4.121	5.74e-05	-0.141689	30	0.034385	no	PRSTTE
chr1_1557495_CAT_C_b38	ATAD3C	-4.111	5.96e-05	-0.141812	30	0.034492	no	PRSTTE
chr1_1558726_C_CA_b38	ATAD3C	-4.108	6.04e-05	-0.14123	30	0.034379	no	PRSTTE
chr1_1561821_A_C_b38	ATAD3C	-4.108	6.04e-05	-0.14123	30	0.034379	no	PRSTTE
chr1_1542773_T_C_b38	ATAD3C	-4.107	6.07e-05	-0.140963	29	0.034327	no	PRSTTE
chr1_1542793_C_G_b38	ATAD3C	-4.107	6.07e-05	-0.140963	29	0.034327	no	PRSTTE
chr1_1542800_T_C_b38	ATAD3C	-4.107	6.07e-05	-0.140963	29	0.034327	no	PRSTTE
chr1_1543500_T_G_b38	ATAD3C	-4.107	6.07e-05	-0.140963	29	0.034327	no	PRSTTE
chr1_1543953_A_G_b38	ATAD3C	-4.107	6.07e-05	-0.140963	29	0.034327	no	PRSTTE
chr1_1550064_GC_G_b38	ATAD3C	-4.107	6.07e-05	-0.140963	29	0.034327	no	PRSTTE
chr1_1550068_C_A_b38	ATAD3C	-4.107	6.07e-05	-0.140963	29	0.034327	no	PRSTTE
chr1_1545795_C_A_b38	ATAD3C	-3.925	0.000123	-0.133345	27	0.033973	no	PRSTTE
chr1_1549590_C_G_b38	ATAD3C	-3.768	0.000222	-0.128428	31	0.034083	no	PRSTTE
chr1_1553692_A_G_b38	ATAD3C	-3.759	0.00023	-0.128206	31	0.034102	no	PRSTTE
chr1_1554694_A_G_b38	ATAD3C	-3.759	0.00023	-0.128206	31	0.034102	no	PRSTTE
chr1_1554852_T_C_b38	ATAD3C	-3.759	0.00023	-0.128206	31	0.034102	no	PRSTTE
chr1_1555247_T_A_b38	ATAD3C	-3.759	0.00023	-0.128206	31	0.034102	no	PRSTTE
chr1_1518621_A_AC_b38	ATAD3C	-3.594	0.00042	-0.148903	8	0.041432	no	PRSTTE
chr1_1554781_A_G_b38	ATAD3C	-3.506	0.000573	-0.119931	31	0.034203	no	PRSTTE
chr1_1327211_C_T_b38	ATAD3C	3.498	0.00059	0.200086	9	0.0572	no	PRSTTE
chr1_1327982_G_A_b38	ATAD3C	3.498	0.00059	0.200086	9	0.0572	no	PRSTTE
chr1_1330080_T_C_b38	ATAD3C	3.498	0.00059	0.200086	9	0.0572	no	PRSTTE
chr1_1575724_G_C_b38	ATAD3C	-3.485	0.000617	-0.120432	29	0.034553	no	PRSTTE
chr1_1574032_AAAG_A_b38	ATAD3C	-3.246	0.0014	-0.12349	16	0.038047	no	PRSTTE
chr1_1547630_G_A_b38	ATAD3C	-3.23	0.00147	-0.10882	29	0.033692	no	PRSTTE
chr1_1560765_T_C_b38	ATAD3C	-3.182	0.00172	-0.108919	27	0.034234	no	PRSTTE
chr1_1562261_TTTTC_T_b38	ATAD3C	-3.182	0.00172	-0.108919	27	0.034234	no	PRSTTE
chr1_1300330_T_A_b38	ATAD3C	-3.162	0.00184	-0.166732	15	0.052728	no	PRSTTE
chr1_1301656_T_C_b38	ATAD3C	-3.162	0.00184	-0.166732	15	0.052728	no	PRSTTE
chr1_1295039_T_C_b38	ATAD3C	-3.131	0.00203	-0.167275	15	0.053423	no	PRSTTE
chr1_1298561_T_C_b38	ATAD3C	-3.131	0.00203	-0.167275	15	0.053423	no	PRSTTE
chr1_1134095_AAAAAAAG_A_b38	ATAD3C	-3.053	0.00261	-0.093595	42	0.030659	no	PRSTTE
chr1_1278491_C_CT_b38	ATAD3C	-3.044	0.00268	-0.14848	7	0.048771	no	PRSTTE
chr1_1353443_A_G_b38	ATAD3C	3.041	0.0027	0.168598	5	0.055435	no	PRSTTE
chr1_1306420_A_G_b38	ATAD3C	3.03	0.0028	0.168963	15	0.055763	no	PRSTTE
chr1_1307603_G_A_b38	ATAD3C	2.946	0.00365	0.160746	15	0.054569	no	PRSTTE
chr1_1318756_G_A_b38	ATAD3C	2.916	0.004	0.162274	11	0.055659	no	PRSTTE
chr1_1319063_G_A_b38	ATAD3C	2.916	0.004	0.162274	11	0.055659	no	PRSTTE
chr1_1319461_C_G_b38	ATAD3C	2.916	0.004	0.162274	11	0.055659	no	PRSTTE
chr1_1320023_TG_T_b38	ATAD3C	2.916	0.004	0.162274	11	0.055659	no	PRSTTE
chr1_1307327_A_G_b38	ATAD3C	2.902	0.00416	0.160089	15	0.055157	no	PRSTTE
chr1_1572877_T_TG_b38	ATAD3C	2.888	0.00435	0.121319	6	0.042006	no	PRSTTE
chr1_1240648_T_TCATTCACCCCGGCCGTGGTCCCTGCCCCAGCCCCCGCCGCCCC_b38	ATAD3C	2.836	0.00508	0.07031	38	0.024788	no	PRSTTE
chr1_1537493_T_A_b38	ATAD3C	-2.768	0.00623	-0.097135	25	0.035094	no	PRSTTE
chr1_1353091_C_T_b38	ATAD3C	2.765	0.00628	0.153112	5	0.055372	no	PRSTTE
chr1_1533855_G_A_b38	ATAD3C	-2.746	0.00664	-0.121765	4	0.04434	no	PRSTTE
chr1_1769969_CAAAACA_C_b38	ATAD3C	2.74	0.00675	0.088984	32	0.032473	no	PRSTTE
chr1_1539491_G_C_b38	ATAD3C	-2.701	0.00756	-0.092933	31	0.034403	no	PRSTTE
chr1_1575935_T_C_b38	ATAD3C	-2.691	0.00778	-0.092598	31	0.034405	no	PRSTTE
chr1_1440430_C_G_b38	ATAD3C	-6.414	3.62e-10	-0.098165	36	0.015305	yes	SKINNS
chr1_1432355_G_A_b38	ATAD3C	-5.99	4.32e-09	-0.098681	19	0.016474	yes	SKINNS
chr1_1443457_T_C_b38	ATAD3C	-5.71	2.07e-08	-0.087325	63	0.015294	yes	SKINNS
chr1_1442793_G_A_b38	ATAD3C	-5.685	2.37e-08	-0.100188	12	0.017623	yes	SKINNS
chr1_1440834_C_G_b38	ATAD3C	-5.404	1.06e-07	-0.082435	60	0.015255	yes	SKINNS
chr1_1435945_C_CCGGGCGGGGGCG_b38	ATAD3C	-5.298	1.84e-07	-0.094274	13	0.017793	yes	SKINNS
chr1_1445187_T_G_b38	ATAD3C	-5.256	2.29e-07	-0.080069	57	0.015234	yes	SKINNS
chr1_1441187_A_G_b38	ATAD3C	-5.044	6.63e-07	-0.080089	41	0.015877	yes	SKINNS
chr1_1438102_G_C_b38	ATAD3C	-4.885	1.44e-06	-0.080212	21	0.016419	yes	SKINNS
chr1_1439454_A_G_b38	ATAD3C	-4.863	1.6e-06	-0.07341	55	0.015094	yes	SKINNS
chr1_1431656_G_A_b38	ATAD3C	-4.838	1.81e-06	-0.089571	11	0.018512	yes	SKINNS
chr1_1436388_CA_C_b38	ATAD3C	-4.785	2.33e-06	-0.075938	41	0.01587	yes	SKINNS
chr1_1439805_G_C_b38	ATAD3C	-4.775	2.44e-06	-0.078119	23	0.016361	yes	SKINNS
chr1_1431014_G_A_b38	ATAD3C	-4.745	2.81e-06	-0.073104	30	0.015406	yes	SKINNS
chr1_1426253_G_A_b38	ATAD3C	-4.712	3.28e-06	-0.087448	10	0.018558	yes	SKINNS
chr1_1433374_T_C_b38	ATAD3C	-4.682	3.78e-06	-0.068061	70	0.014538	yes	SKINNS
chr1_1434687_C_G_b38	ATAD3C	-4.679	3.84e-06	-0.083958	12	0.017945	yes	SKINNS
chr1_1445240_A_G_b38	ATAD3C	-4.587	5.85e-06	-0.070932	62	0.015464	yes	SKINNS
chr1_1436079_A_G_b38	ATAD3C	-4.558	6.67e-06	-0.067091	68	0.014718	yes	SKINNS
chr1_1448915_G_A_b38	ATAD3C	-4.54	7.26e-06	-0.071872	41	0.015832	yes	SKINNS
chr1_1497105_T_G_b38	ATAD3C	4.396	1.38e-05	0.094359	6	0.021463	yes	SKINNS
chr1_1483898_G_A_b38	ATAD3C	4.375	1.51e-05	0.086265	37	0.019717	yes	SKINNS
chr1_1486151_C_A_b38	ATAD3C	4.375	1.51e-05	0.086265	37	0.019717	yes	SKINNS
chr1_1428969_T_C_b38	ATAD3C	-4.33	1.84e-05	-0.066143	63	0.015276	yes	SKINNS
chr1_1476266_T_C_b38	ATAD3C	4.309	2.02e-05	0.081801	39	0.018983	yes	SKINNS
chr1_1579717_T_A_b38	ATAD3C	-4.281	2.28e-05	-0.061607	31	0.014391	yes	SKINNS
chr1_1482624_T_C_b38	ATAD3C	4.27	2.39e-05	0.081827	38	0.019164	yes	SKINNS
chr1_1473089_T_C_b38	ATAD3C	4.268	2.41e-05	0.081965	37	0.019206	yes	SKINNS
chr1_1574445_A_G_b38	ATAD3C	-4.265	2.45e-05	-0.058594	85	0.013739	yes	SKINNS
chr1_1573776_A_G_b38	ATAD3C	-4.263	2.46e-05	-0.062291	29	0.014612	yes	SKINNS
chr1_1476079_T_C_b38	ATAD3C	4.26	2.5e-05	0.080258	38	0.018841	yes	SKINNS
chr1_1577491_A_AC_b38	ATAD3C	-4.24	2.72e-05	-0.058501	85	0.013798	yes	SKINNS
chr1_1549967_C_G_b38	ATAD3C	-4.199	3.24e-05	-0.058406	46	0.013911	yes	SKINNS
chr1_1566854_CA_C_b38	ATAD3C	-4.156	3.88e-05	-0.061145	61	0.014712	yes	SKINNS
chr1_1487887_A_G_b38	ATAD3C	4.136	4.22e-05	0.080655	37	0.019501	yes	SKINNS
chr1_1547630_G_A_b38	ATAD3C	-4.115	4.61e-05	-0.054242	84	0.013181	yes	SKINNS
chr1_1490320_T_C_b38	ATAD3C	4.108	4.74e-05	0.079994	37	0.01947	yes	SKINNS
chr1_1573654_T_C_b38	ATAD3C	-4.104	4.82e-05	-0.056136	85	0.013677	yes	SKINNS
chr1_1575421_C_T_b38	ATAD3C	-4.097	4.96e-05	-0.055539	83	0.013554	yes	SKINNS
chr1_1474201_CT_C_b38	ATAD3C	4.089	5.13e-05	0.073205	35	0.017901	yes	SKINNS
chr1_1580890_C_T_b38	ATAD3C	-4.083	5.26e-05	-0.059986	28	0.014691	yes	SKINNS
chr1_1492619_A_AC_b38	ATAD3C	4.069	5.59e-05	0.078369	38	0.019262	yes	SKINNS
chr1_1488652_A_G_b38	ATAD3C	4.019	6.85e-05	0.078554	38	0.019544	yes	SKINNS
chr1_1492292_C_G_b38	ATAD3C	4.019	6.85e-05	0.078554	38	0.019544	yes	SKINNS
chr1_1492850_G_A_b38	ATAD3C	4.019	6.85e-05	0.078554	38	0.019544	yes	SKINNS
chr1_1575724_G_C_b38	ATAD3C	-4.017	6.92e-05	-0.054593	83	0.013591	yes	SKINNS
chr1_1551523_T_C_b38	ATAD3C	-4.017	6.92e-05	-0.058109	30	0.014467	yes	SKINNS
chr1_1565105_CAAGGCAGGCGGATCATG_C_b38	ATAD3C	-3.939	9.49e-05	-0.052495	97	0.013327	yes	SKINNS
chr1_1551557_A_AG_b38	ATAD3C	-3.82	0.000153	-0.052495	86	0.013744	yes	SKINNS
chr1_1551559_A_T_b38	ATAD3C	-3.82	0.000153	-0.052495	86	0.013744	yes	SKINNS
chr1_1102071_C_CAA_b38	ATAD3C	-3.819	0.000153	-0.099918	7	0.026165	yes	SKINNS
chr1_1431813_G_T_b38	ATAD3C	-3.815	0.000155	-0.066875	15	0.01753	yes	SKINNS
chr1_1545968_T_C_b38	ATAD3C	-3.813	0.000156	-0.054017	35	0.014166	yes	SKINNS
chr1_1541864_T_C_b38	ATAD3C	-3.803	0.000163	-0.052899	84	0.013912	yes	SKINNS
chr1_1490046_G_A_b38	ATAD3C	3.787	0.000173	0.077551	9	0.020479	yes	SKINNS
chr1_1490047_A_G_b38	ATAD3C	3.787	0.000173	0.077551	9	0.020479	yes	SKINNS
chr1_1481959_C_T_b38	ATAD3C	3.749	0.000201	0.073378	27	0.01957	yes	SKINNS
chr1_1431537_G_C_b38	ATAD3C	-3.726	0.00022	-0.057047	63	0.015312	yes	SKINNS
chr1_1538787_A_G_b38	ATAD3C	-3.708	0.000235	-0.050243	92	0.013551	yes	SKINNS
chr1_1568428_C_G_b38	ATAD3C	-3.687	0.000255	-0.051294	39	0.013913	yes	SKINNS
chr1_1431450_A_G_b38	ATAD3C	-3.684	0.000257	-0.056533	63	0.015344	yes	SKINNS
chr1_1486611_G_A_b38	ATAD3C	3.661	0.000281	0.072958	24	0.019927	yes	SKINNS
chr1_1490027_A_G_b38	ATAD3C	3.658	0.000285	0.071229	32	0.019473	yes	SKINNS
chr1_1490032_A_G_b38	ATAD3C	3.658	0.000285	0.071229	32	0.019473	yes	SKINNS
chr1_1550064_GC_G_b38	ATAD3C	-3.625	0.000322	-0.049593	83	0.013681	yes	SKINNS
chr1_1550068_C_A_b38	ATAD3C	-3.625	0.000322	-0.049593	83	0.013681	yes	SKINNS
chr1_1430190_A_C_b38	ATAD3C	-3.608	0.000344	-0.055529	63	0.015391	yes	SKINNS
chr1_1566086_G_A_b38	ATAD3C	-3.596	0.000359	-0.048349	95	0.013445	yes	SKINNS
chr1_1430908_A_G_b38	ATAD3C	-3.586	0.000373	-0.054787	64	0.015278	yes	SKINNS
chr1_1570568_AC_A_b38	ATAD3C	-3.585	0.000375	-0.052372	35	0.01461	yes	SKINNS
chr1_1558726_C_CA_b38	ATAD3C	-3.582	0.000378	-0.049212	86	0.013737	yes	SKINNS
chr1_1561821_A_C_b38	ATAD3C	-3.582	0.000378	-0.049212	86	0.013737	yes	SKINNS
chr1_1545795_C_A_b38	ATAD3C	-3.575	0.000388	-0.048897	73	0.013677	yes	SKINNS
chr1_1367122_G_A_b38	ATAD3C	-3.557	0.000415	-0.14063	3	0.039534	yes	SKINNS
chr1_1542773_T_C_b38	ATAD3C	-3.547	0.000431	-0.048818	82	0.013764	yes	SKINNS
chr1_1542793_C_G_b38	ATAD3C	-3.547	0.000431	-0.048818	82	0.013764	yes	SKINNS
chr1_1542800_T_C_b38	ATAD3C	-3.547	0.000431	-0.048818	82	0.013764	yes	SKINNS
chr1_1489916_C_T_b38	ATAD3C	3.537	0.000447	0.068208	20	0.019283	yes	SKINNS
chr1_1543953_A_G_b38	ATAD3C	-3.536	0.000449	-0.048594	82	0.013742	yes	SKINNS
chr1_1431026_CCACCCCCT_C_b38	ATAD3C	-3.503	0.000506	-0.055987	36	0.015982	yes	SKINNS
chr1_1549590_C_G_b38	ATAD3C	-3.49	0.000531	-0.046539	92	0.013335	yes	SKINNS
chr1_1569661_T_C_b38	ATAD3C	-3.489	0.000534	-0.045903	87	0.013158	yes	SKINNS
chr1_1426810_C_G_b38	ATAD3C	-3.479	0.000552	-0.053383	62	0.015343	yes	SKINNS
chr1_1569180_T_A_b38	ATAD3C	-3.456	0.000601	-0.047487	90	0.013742	yes	SKINNS
chr1_1559750_C_CAG_b38	ATAD3C	-3.449	0.000617	-0.046175	95	0.01339	yes	SKINNS
chr1_1561628_T_C_b38	ATAD3C	-3.449	0.000617	-0.046175	95	0.01339	yes	SKINNS
chr1_1563918_A_G_b38	ATAD3C	-3.449	0.000617	-0.046175	95	0.01339	yes	SKINNS
chr1_1565561_A_G_b38	ATAD3C	-3.449	0.000617	-0.046175	95	0.01339	yes	SKINNS
chr1_1567715_G_A_b38	ATAD3C	-3.449	0.000617	-0.046175	95	0.01339	yes	SKINNS
chr1_1567719_A_C_b38	ATAD3C	-3.449	0.000617	-0.046175	95	0.01339	yes	SKINNS
chr1_1569875_C_T_b38	ATAD3C	-3.449	0.000617	-0.046175	95	0.01339	yes	SKINNS
chr1_1572532_A_C_b38	ATAD3C	-3.449	0.000617	-0.046175	95	0.01339	yes	SKINNS
chr1_1543500_T_G_b38	ATAD3C	-3.449	0.000617	-0.047342	82	0.013728	yes	SKINNS
chr1_1574655_GGC_G_b38	ATAD3C	-3.446	0.000622	-0.047581	72	0.013806	yes	SKINNS
chr1_1573079_A_G_b38	ATAD3C	-3.435	0.000647	-0.045944	94	0.013374	yes	SKINNS
chr1_1426261_C_T_b38	ATAD3C	-3.419	0.000686	-0.052766	61	0.015433	yes	SKINNS
chr1_1570294_CA_C_b38	ATAD3C	-3.389	0.000765	-0.046727	86	0.013789	yes	SKINNS
chr1_1548572_A_AC_b38	ATAD3C	-3.376	0.000799	-0.100753	6	0.02984	yes	SKINNS
chr1_1553692_A_G_b38	ATAD3C	-3.369	0.000819	-0.04483	93	0.013305	yes	SKINNS
chr1_1554852_T_C_b38	ATAD3C	-3.369	0.000819	-0.04483	93	0.013305	yes	SKINNS
chr1_1555247_T_A_b38	ATAD3C	-3.369	0.000819	-0.04483	93	0.013305	yes	SKINNS
chr1_1554694_A_G_b38	ATAD3C	-3.364	0.000836	-0.044728	92	0.013298	yes	SKINNS
chr1_1555871_T_C_b38	ATAD3C	-3.351	0.000872	-0.046204	67	0.013786	yes	SKINNS
chr1_1366941_T_TGTGTGCA_b38	ATAD3C	3.342	0.000901	0.066014	10	0.019751	yes	SKINNS
chr1_1366951_A_AGT_b38	ATAD3C	3.342	0.000901	0.066014	10	0.019751	yes	SKINNS
chr1_1403593_A_G_b38	ATAD3C	-3.319	0.000978	-0.068145	10	0.020533	yes	SKINNS
chr1_2222104_C_CT_b38	ATAD3C	3.3	0.00104	0.078448	10	0.02377	yes	SKINNS
chr1_1382893_G_A_b38	ATAD3C	-3.285	0.0011	-0.067434	10	0.020529	yes	SKINNS
chr1_1557495_CAT_C_b38	ATAD3C	-3.279	0.00112	-0.04537	86	0.013838	yes	SKINNS
chr1_1400756_GGA_G_b38	ATAD3C	-3.272	0.00115	-0.067218	10	0.020541	yes	SKINNS
chr1_1401954_G_T_b38	ATAD3C	-3.272	0.00115	-0.067218	10	0.020541	yes	SKINNS
chr1_1555179_A_G_b38	ATAD3C	-3.247	0.00125	-0.044476	62	0.013698	yes	SKINNS
chr1_1554781_A_G_b38	ATAD3C	-3.225	0.00135	-0.042862	93	0.013289	yes	SKINNS
chr1_988598_A_G_b38	ATAD3C	3.216	0.0014	0.078414	3	0.024384	yes	SKINNS
chr1_1575864_G_A_b38	ATAD3C	-3.171	0.00162	-0.04425	77	0.013955	yes	SKINNS
chr1_1469088_T_C_b38	ATAD3C	3.129	0.00187	0.067157	32	0.021463	yes	SKINNS
chr1_1554548_T_C_b38	ATAD3C	-3.125	0.0019	-0.042911	62	0.013733	yes	SKINNS
chr1_1565680_A_AG_b38	ATAD3C	-3.11	0.00199	-0.041511	92	0.013348	yes	SKINNS
chr1_1558347_G_A_b38	ATAD3C	-3.089	0.00214	-0.043494	53	0.014082	yes	SKINNS
chr1_1398218_C_A_b38	ATAD3C	-3.076	0.00222	-0.063532	10	0.020652	yes	SKINNS
chr1_1407232_G_C_b38	ATAD3C	-3.035	0.00254	-0.050583	24	0.016664	yes	SKINNS
chr1_1571986_G_A_b38	ATAD3C	-3.03	0.00259	-0.040386	73	0.01333	yes	SKINNS
chr1_1482402_A_G_b38	ATAD3C	3.01	0.00276	0.055667	54	0.018496	yes	SKINNS
chr1_1574032_AAAG_A_b38	ATAD3C	-3.01	0.00276	-0.046059	46	0.015304	yes	SKINNS
chr1_618345_C_T_b38	ATAD3C	-3	0.00285	-0.102861	5	0.034288	yes	SKINNS
chr1_1497605_G_C_b38	ATAD3C	-3	0.00285	-0.042206	66	0.01407	yes	SKINNS
chr1_1571794_A_AT_b38	ATAD3C	-2.987	0.00297	-0.041216	81	0.013797	yes	SKINNS
chr1_1384256_T_G_b38	ATAD3C	2.977	0.00307	0.059319	5	0.019929	yes	SKINNS
chr1_1551454_C_A_b38	ATAD3C	-2.958	0.00326	-0.037984	136	0.012841	yes	SKINNS
chr1_1957772_GGC_G_b38	ATAD3C	2.92	0.00368	0.081446	5	0.027895	yes	SKINNS
chr1_1560765_T_C_b38	ATAD3C	-2.862	0.0044	-0.039721	73	0.013877	yes	SKINNS
chr1_1562261_TTTTC_T_b38	ATAD3C	-2.862	0.0044	-0.039721	73	0.013877	yes	SKINNS
chr1_1292284_TTGAG_T_b38	ATAD3C	-2.849	0.00459	-0.054705	25	0.019203	yes	SKINNS
chr1_1558204_T_TAAAAAA_b38	ATAD3C	-2.846	0.00463	-0.042001	41	0.014759	yes	SKINNS
chr1_1383743_T_C_b38	ATAD3C	-2.834	0.0048	-0.05789	10	0.020426	yes	SKINNS
chr1_1572877_TG_T_b38	ATAD3C	-2.825	0.00495	-0.043576	27	0.015427	yes	SKINNS
chr1_1941139_T_G_b38	ATAD3C	-2.812	0.00513	-0.112737	4	0.040086	yes	SKINNS
chr1_2436477_CCCTCCTCCCCTCCTCCCT_C_b38	ATAD3C	2.807	0.00522	0.07585	8	0.027022	yes	SKINNS
chr1_1953441_G_A_b38	ATAD3C	2.795	0.00542	0.07595	6	0.027175	yes	SKINNS
chr1_1954330_G_A_b38	ATAD3C	2.795	0.00542	0.07595	6	0.027175	yes	SKINNS
chr1_1423761_CCAT_C_b38	ATAD3C	2.774	0.00576	0.07708	3	0.027782	yes	SKINNS
chr1_1573265_C_CAAAA_b38	ATAD3C	-2.768	0.00587	-0.046736	26	0.016883	yes	SKINNS
chr1_663453_T_C_b38	ATAD3C	-2.761	0.00601	-0.092465	6	0.033493	yes	SKINNS
chr1_1509914_T_TAA_b38	ATAD3C	2.754	0.00614	0.070689	3	0.025672	yes	SKINNS
chr1_1217251_C_A_b38	ATAD3C	-2.742	0.00634	-0.054377	9	0.019828	yes	SKINNS
chr1_1559703_G_C_b38	ATAD3C	-2.739	0.00641	-0.036901	82	0.013474	yes	SKINNS
chr1_1570587_C_T_b38	ATAD3C	-2.739	0.00641	-0.036901	82	0.013474	yes	SKINNS
chr1_1568548_G_A_b38	ATAD3C	-2.738	0.00643	-0.036801	82	0.013442	yes	SKINNS
chr1_1290261_C_A_b38	ATAD3C	-2.735	0.00649	-0.050033	31	0.018295	yes	SKINNS
chr1_1469429_A_G_b38	ATAD3C	2.734	0.00651	0.060828	34	0.022251	yes	SKINNS
chr1_1553619_CAAAAAAA_C_b38	ATAD3C	-2.731	0.00657	-0.040381	35	0.014787	yes	SKINNS
chr1_1400410_A_G_b38	ATAD3C	-2.725	0.00668	-0.045005	44	0.016513	yes	SKINNS
chr1_624100_C_T_b38	ATAD3C	2.715	0.00688	0.058792	12	0.021654	yes	SKINNS
chr1_1443673_CTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT_C_b38	ATAD3C	-2.71	0.00698	-0.082819	5	0.030557	yes	SKINNS
chr1_1375642_C_T_b38	ATAD3C	-2.698	0.00724	-0.054564	10	0.020225	yes	SKINNS
chr1_1553791_CA_C_b38	ATAD3C	-2.688	0.00745	-0.041486	30	0.015433	yes	SKINNS
chr1_1554290_C_T_b38	ATAD3C	-2.687	0.00747	-0.037077	61	0.013796	yes	SKINNS
chr1_1573429_CAAAAAAAAAAAAAAAAAA_C_b38	ATAD3C	-2.668	0.00792	-0.036218	82	0.013576	yes	SKINNS
chr1_1539491_G_C_b38	ATAD3C	-2.662	0.00804	-0.036597	86	0.013746	yes	SKINNS
chr1_1402457_A_G_b38	ATAD3C	-2.655	0.00822	-0.04511	60	0.016992	yes	SKINNS
chr1_1532798_T_C_b38	ATAD3C	-2.653	0.00827	-0.034837	135	0.013133	yes	SKINNS
chr1_1471992_T_C_b38	ATAD3C	-2.652	0.00829	-0.040759	72	0.015369	yes	SKINNS
chr1_1562444_C_T_b38	ATAD3C	-2.631	0.00881	-0.052229	9	0.019851	yes	SKINNS
chr1_1265603_T_TTGTGTGTG_b38	ATAD3C	-2.631	0.00882	-0.066049	4	0.025107	yes	SKINNS
chr1_1510082_T_TA_b38	ATAD3C	2.615	0.00923	0.059723	9	0.022842	yes	SKINNS
chr1_1454315_C_T_b38	ATAD3C	-2.613	0.00928	-0.042027	53	0.016085	yes	SKINNS
chr1_1470034_T_C_b38	ATAD3C	2.611	0.00932	0.058451	34	0.022383	yes	SKINNS
chr1_1554241_T_C_b38	ATAD3C	-2.609	0.00939	-0.038188	41	0.014637	yes	SKINNS
chr1_928622_G_C_b38	ATAD3C	2.608	0.00942	0.043336	16	0.016619	yes	SKINNS
chr1_1876492_C_CGA_b38	ATAD3C	-2.594	0.0098	-0.048732	4	0.018787	yes	SKINNS
chr1_1495204_T_C_b38	ATAD3C	4.178	3.54e-05	0.080529	27	0.019275	no	SKINNS
chr1_1690745_G_GA_b38	ATAD3C	4.048	6.08e-05	0.126892	6	0.031344	no	SKINNS
chr1_1453961_C_T_b38	ATAD3C	-3.625	0.000322	-0.065306	11	0.018014	no	SKINNS
chr1_2436516_TCCCTCCTCCTTTCCTCCTTCCTCCCTCCTCCCTTC_T_b38	ATAD3C	3.588	0.00037	0.117112	6	0.032638	no	SKINNS
chr1_2436513_TCC_T_b38	ATAD3C	3.587	0.000371	0.117096	6	0.032641	no	SKINNS
chr1_1453870_A_C_b38	ATAD3C	-3.425	0.00067	-0.059733	13	0.017438	no	SKINNS
chr1_1407565_C_A_b38	ATAD3C	-3.297	0.00106	-0.070764	8	0.021463	no	SKINNS
chr1_1468592_C_CG_b38	ATAD3C	3.095	0.00209	0.068258	19	0.022056	no	SKINNS
chr1_1450636_A_G_b38	ATAD3C	-3.044	0.00247	-0.054253	12	0.017824	no	SKINNS
chr1_1380867_A_G_b38	ATAD3C	-2.968	0.00316	-0.062296	8	0.020991	no	SKINNS
chr1_1949489_AT_A_b38	ATAD3C	2.943	0.00343	0.077833	7	0.026451	no	SKINNS
chr1_1537805_T_G_b38	ATAD3C	2.915	0.00374	0.110411	5	0.037878	no	SKINNS
chr1_1296207_G_A_b38	ATAD3C	2.903	0.00388	0.072944	3	0.02513	no	SKINNS
chr1_1394041_G_A_b38	ATAD3C	-2.888	0.00407	-0.064694	4	0.022401	no	SKINNS
chr1_1773676_TTGTGTG_T_b38	ATAD3C	-2.87	0.0043	-0.062882	4	0.021912	no	SKINNS
chr1_1949580_T_G_b38	ATAD3C	2.825	0.00494	0.07557	7	0.026751	no	SKINNS
chr1_1949631_G_A_b38	ATAD3C	2.825	0.00494	0.07557	7	0.026751	no	SKINNS
chr1_1949646_A_G_b38	ATAD3C	2.825	0.00494	0.07557	7	0.026751	no	SKINNS
chr1_1384546_C_T_b38	ATAD3C	-2.8	0.00532	-0.059709	8	0.021321	no	SKINNS
chr1_1356751_A_G_b38	ATAD3C	2.8	0.00533	0.072145	3	0.025763	no	SKINNS
chr1_1213936_C_G_b38	ATAD3C	-2.766	0.00591	-0.080616	5	0.029145	no	SKINNS
chr1_1366183_TGA_T_b38	ATAD3C	2.749	0.00622	0.070713	3	0.025723	no	SKINNS
chr1_1319648_G_A_b38	ATAD3C	2.746	0.00627	0.070229	3	0.025573	no	SKINNS
chr1_1468856_C_T_b38	ATAD3C	2.736	0.00647	0.060806	17	0.022226	no	SKINNS
chr1_1954676_C_G_b38	ATAD3C	2.728	0.00662	0.073228	7	0.02684	no	SKINNS
chr1_1497857_T_TAAAAA_b38	ATAD3C	2.692	0.00738	0.10303	3	0.038278	no	SKINNS
chr1_1440430_C_G_b38	ATAD3C	-8.907	8.25e-18	-0.119061	53	0.013368	yes	SKNS
chr1_1432355_G_A_b38	ATAD3C	-8.715	3.68e-17	-0.126263	29	0.014489	yes	SKNS
chr1_1442793_G_A_b38	ATAD3C	-8.709	3.85e-17	-0.134223	20	0.015412	yes	SKNS
chr1_1441187_A_G_b38	ATAD3C	-8.461	2.55e-16	-0.117553	55	0.013893	yes	SKNS
chr1_1440834_C_G_b38	ATAD3C	-8.329	6.88e-16	-0.111831	79	0.013426	yes	SKNS
chr1_1443457_T_C_b38	ATAD3C	-8.313	7.77e-16	-0.112243	84	0.013502	yes	SKNS
chr1_1436388_CA_C_b38	ATAD3C	-7.868	2.02e-14	-0.108499	56	0.013791	yes	SKNS
chr1_1435945_C_CCGGGCGGGGGCG_b38	ATAD3C	-7.76	4.34e-14	-0.120787	22	0.015565	yes	SKNS
chr1_1445187_T_G_b38	ATAD3C	-7.462	3.47e-13	-0.100939	76	0.013526	yes	SKNS
chr1_1434687_C_G_b38	ATAD3C	-7.407	5.07e-13	-0.115702	21	0.01562	yes	SKNS
chr1_1448915_G_A_b38	ATAD3C	-7.402	5.24e-13	-0.102373	56	0.01383	yes	SKNS
chr1_1436079_A_G_b38	ATAD3C	-7.364	6.79e-13	-0.096144	89	0.013055	yes	SKNS
chr1_1445240_A_G_b38	ATAD3C	-7.313	9.64e-13	-0.099644	82	0.013626	yes	SKNS
chr1_1439805_G_C_b38	ATAD3C	-7.303	1.03e-12	-0.110438	27	0.015122	yes	SKNS
chr1_1433374_T_C_b38	ATAD3C	-7.28	1.2e-12	-0.094749	93	0.013015	yes	SKNS
chr1_1431014_G_A_b38	ATAD3C	-7.275	1.24e-12	-0.098378	45	0.013523	yes	SKNS
chr1_1438102_G_C_b38	ATAD3C	-7.212	1.9e-12	-0.105825	31	0.014673	yes	SKNS
chr1_1426253_G_A_b38	ATAD3C	-7.176	2.41e-12	-0.118118	14	0.01646	yes	SKNS
chr1_1428969_T_C_b38	ATAD3C	-7.175	2.43e-12	-0.097306	84	0.013562	yes	SKNS
chr1_1431656_G_A_b38	ATAD3C	-7.166	2.58e-12	-0.116964	17	0.016322	yes	SKNS
chr1_1439454_A_G_b38	ATAD3C	-7.123	3.44e-12	-0.095275	74	0.013376	yes	SKNS
chr1_1431537_G_C_b38	ATAD3C	-6.822	2.44e-11	-0.093105	84	0.013648	yes	SKNS
chr1_1430190_A_C_b38	ATAD3C	-6.815	2.56e-11	-0.092943	84	0.013639	yes	SKNS
chr1_1431450_A_G_b38	ATAD3C	-6.81	2.64e-11	-0.092975	84	0.013653	yes	SKNS
chr1_1545795_C_A_b38	ATAD3C	-6.788	3.04e-11	-0.086995	87	0.012816	yes	SKNS
chr1_1431813_G_T_b38	ATAD3C	-6.752	3.81e-11	-0.103654	24	0.015351	yes	SKNS
chr1_1430908_A_G_b38	ATAD3C	-6.712	4.92e-11	-0.091355	84	0.013611	yes	SKNS
chr1_1426810_C_G_b38	ATAD3C	-6.617	8.95e-11	-0.090849	82	0.01373	yes	SKNS
chr1_1426261_C_T_b38	ATAD3C	-6.553	1.33e-10	-0.090265	81	0.013775	yes	SKNS
chr1_1543953_A_G_b38	ATAD3C	-6.519	1.64e-10	-0.083951	98	0.012878	yes	SKNS
chr1_1542773_T_C_b38	ATAD3C	-6.441	2.66e-10	-0.082794	98	0.012855	yes	SKNS
chr1_1541864_T_C_b38	ATAD3C	-6.426	2.9e-10	-0.083251	102	0.012955	yes	SKNS
chr1_1547630_G_A_b38	ATAD3C	-6.41	3.2e-10	-0.079279	98	0.012368	yes	SKNS
chr1_1550064_GC_G_b38	ATAD3C	-6.386	3.7e-10	-0.081793	98	0.012808	yes	SKNS
chr1_1550068_C_A_b38	ATAD3C	-6.386	3.7e-10	-0.081793	98	0.012808	yes	SKNS
chr1_1542793_C_G_b38	ATAD3C	-6.365	4.22e-10	-0.081748	97	0.012844	yes	SKNS
chr1_1542800_T_C_b38	ATAD3C	-6.365	4.22e-10	-0.081748	97	0.012844	yes	SKNS
chr1_1558726_C_CA_b38	ATAD3C	-6.31	5.87e-10	-0.081271	104	0.01288	yes	SKNS
chr1_1561821_A_C_b38	ATAD3C	-6.31	5.87e-10	-0.081271	104	0.01288	yes	SKNS
chr1_1543500_T_G_b38	ATAD3C	-6.221	9.98e-10	-0.079701	97	0.012811	yes	SKNS
chr1_1447108_A_ATT_b38	ATAD3C	-6.209	1.07e-09	-0.089912	39	0.014481	yes	SKNS
chr1_1551557_A_AG_b38	ATAD3C	-6.207	1.08e-09	-0.079774	102	0.012852	yes	SKNS
chr1_1551559_A_T_b38	ATAD3C	-6.207	1.08e-09	-0.079774	102	0.012852	yes	SKNS
chr1_1400410_A_G_b38	ATAD3C	-6.001	3.62e-09	-0.088742	62	0.014787	yes	SKNS
chr1_1565105_CAAGGCAGGCGGATCATG_C_b38	ATAD3C	-5.966	4.42e-09	-0.075113	114	0.012589	yes	SKNS
chr1_1557495_CAT_C_b38	ATAD3C	-5.95	4.85e-09	-0.076962	104	0.012934	yes	SKNS
chr1_1569661_T_C_b38	ATAD3C	-5.95	4.85e-09	-0.074106	102	0.012454	yes	SKNS
chr1_1384749_C_G_b38	ATAD3C	5.921	5.72e-09	0.087058	63	0.014702	yes	SKNS
chr1_1387763_CCT_C_b38	ATAD3C	5.921	5.72e-09	0.087058	63	0.014702	yes	SKNS
chr1_1388944_G_A_b38	ATAD3C	5.921	5.72e-09	0.087058	63	0.014702	yes	SKNS
chr1_1549590_C_G_b38	ATAD3C	-5.9	6.45e-09	-0.074239	107	0.012582	yes	SKNS
chr1_1379083_AT_A_b38	ATAD3C	5.872	7.58e-09	0.084289	37	0.014355	yes	SKNS
chr1_1538787_A_G_b38	ATAD3C	-5.839	9.12e-09	-0.074334	110	0.01273	yes	SKNS
chr1_1376162_G_C_b38	ATAD3C	5.81	1.07e-08	0.085242	63	0.014672	yes	SKNS
chr1_1377431_C_T_b38	ATAD3C	5.81	1.07e-08	0.085242	63	0.014672	yes	SKNS
chr1_1572532_A_C_b38	ATAD3C	-5.801	1.13e-08	-0.073565	112	0.012681	yes	SKNS
chr1_1553692_A_G_b38	ATAD3C	-5.79	1.2e-08	-0.072729	108	0.012562	yes	SKNS
chr1_1554694_A_G_b38	ATAD3C	-5.79	1.2e-08	-0.072729	108	0.012562	yes	SKNS
chr1_1555247_T_A_b38	ATAD3C	-5.79	1.2e-08	-0.072729	108	0.012562	yes	SKNS
chr1_1559750_C_CAG_b38	ATAD3C	-5.778	1.29e-08	-0.0732	112	0.012669	yes	SKNS
chr1_1561628_T_C_b38	ATAD3C	-5.778	1.29e-08	-0.0732	112	0.012669	yes	SKNS
chr1_1563918_A_G_b38	ATAD3C	-5.778	1.29e-08	-0.0732	112	0.012669	yes	SKNS
chr1_1565561_A_G_b38	ATAD3C	-5.778	1.29e-08	-0.0732	112	0.012669	yes	SKNS
chr1_1566086_G_A_b38	ATAD3C	-5.778	1.29e-08	-0.0732	112	0.012669	yes	SKNS
chr1_1567715_G_A_b38	ATAD3C	-5.778	1.29e-08	-0.0732	112	0.012669	yes	SKNS
chr1_1567719_A_C_b38	ATAD3C	-5.778	1.29e-08	-0.0732	112	0.012669	yes	SKNS
chr1_1569875_C_T_b38	ATAD3C	-5.778	1.29e-08	-0.0732	112	0.012669	yes	SKNS
chr1_1573079_A_G_b38	ATAD3C	-5.759	1.43e-08	-0.072972	112	0.012671	yes	SKNS
chr1_1431026_CCACCCCCT_C_b38	ATAD3C	-5.756	1.46e-08	-0.083369	43	0.014485	yes	SKNS
chr1_1554852_T_C_b38	ATAD3C	-5.745	1.54e-08	-0.072129	108	0.012555	yes	SKNS
chr1_1569180_T_A_b38	ATAD3C	-5.742	1.58e-08	-0.07335	106	0.012775	yes	SKNS
chr1_1549967_C_G_b38	ATAD3C	-5.685	2.15e-08	-0.0744	57	0.013086	yes	SKNS
chr1_1575724_G_C_b38	ATAD3C	-5.683	2.17e-08	-0.073261	99	0.012891	yes	SKNS
chr1_1573654_T_C_b38	ATAD3C	-5.667	2.38e-08	-0.073657	103	0.012998	yes	SKNS
chr1_1574445_A_G_b38	ATAD3C	-5.667	2.38e-08	-0.073657	103	0.012998	yes	SKNS
chr1_1378204_G_C_b38	ATAD3C	5.641	2.74e-08	0.081878	64	0.014514	yes	SKNS
chr1_1554781_A_G_b38	ATAD3C	-5.633	2.86e-08	-0.070797	108	0.012568	yes	SKNS
chr1_1447650_A_G_b38	ATAD3C	-5.619	3.1e-08	-0.189101	3	0.033654	yes	SKNS
chr1_1402457_A_G_b38	ATAD3C	-5.611	3.23e-08	-0.085614	79	0.015258	yes	SKNS
chr1_1575421_C_T_b38	ATAD3C	-5.586	3.71e-08	-0.07166	100	0.01283	yes	SKNS
chr1_1571794_A_AT_b38	ATAD3C	-5.472	6.84e-08	-0.071965	94	0.013151	yes	SKNS
chr1_1387698_A_G_b38	ATAD3C	5.468	6.98e-08	0.082982	79	0.015175	yes	SKNS
chr1_1574032_AAAG_A_b38	ATAD3C	-5.468	7.02e-08	-0.078384	60	0.014336	yes	SKNS
chr1_1389827_C_T_b38	ATAD3C	5.46	7.29e-08	0.082566	78	0.015121	yes	SKNS
chr1_1380867_A_G_b38	ATAD3C	-5.422	8.95e-08	-0.097607	13	0.018002	yes	SKNS
chr1_1560765_T_C_b38	ATAD3C	-5.422	8.95e-08	-0.071155	88	0.013124	yes	SKNS
chr1_1562261_TTTTC_T_b38	ATAD3C	-5.422	8.95e-08	-0.071155	88	0.013124	yes	SKNS
chr1_1411323_A_C_b38	ATAD3C	-5.413	9.39e-08	-0.082587	81	0.015258	yes	SKNS
chr1_1403593_A_G_b38	ATAD3C	-5.4	1e-07	-0.098244	13	0.018193	yes	SKNS
chr1_1366427_AGTGTGATTGAATGAGT_A_b38	ATAD3C	5.349	1.31e-07	0.078936	60	0.014757	yes	SKNS
chr1_1577491_A_AC_b38	ATAD3C	-5.347	1.32e-07	-0.069561	105	0.013008	yes	SKNS
chr1_1449831_A_G_b38	ATAD3C	-5.323	1.5e-07	-0.082397	73	0.015479	yes	SKNS
chr1_1395346_A_G_b38	ATAD3C	-5.322	1.52e-07	-0.081001	77	0.015221	yes	SKNS
chr1_1407565_C_A_b38	ATAD3C	-5.316	1.56e-07	-0.098322	13	0.018497	yes	SKNS
chr1_1372220_C_T_b38	ATAD3C	-5.277	1.91e-07	-0.131719	3	0.02496	yes	SKNS
chr1_1394423_A_G_b38	ATAD3C	-5.242	2.29e-07	-0.079679	78	0.015199	yes	SKNS
chr1_1383743_T_C_b38	ATAD3C	-5.191	2.97e-07	-0.093965	13	0.0181	yes	SKNS
chr1_1570294_CA_C_b38	ATAD3C	-5.177	3.2e-07	-0.067994	102	0.013133	yes	SKNS
chr1_1400756_GGA_G_b38	ATAD3C	-5.163	3.43e-07	-0.09435	13	0.018274	yes	SKNS
chr1_1401954_G_T_b38	ATAD3C	-5.163	3.43e-07	-0.09435	13	0.018274	yes	SKNS
chr1_1437993_G_A_b38	ATAD3C	-5.134	3.99e-07	-0.076074	32	0.014819	yes	SKNS
chr1_1449009_A_T_b38	ATAD3C	-5.129	4.08e-07	-0.082356	49	0.016057	yes	SKNS
chr1_1384546_C_T_b38	ATAD3C	-5.116	4.37e-07	-0.094038	13	0.018383	yes	SKNS
chr1_1367954_A_C_b38	ATAD3C	-5.111	4.47e-07	-0.125597	4	0.024574	yes	SKNS
chr1_1398218_C_A_b38	ATAD3C	-5.106	4.58e-07	-0.093303	13	0.018272	yes	SKNS
chr1_1370113_A_G_b38	ATAD3C	5.087	5.05e-07	0.072336	63	0.01422	yes	SKNS
chr1_1565680_A_AG_b38	ATAD3C	-5.085	5.09e-07	-0.064444	108	0.012673	yes	SKNS
chr1_1394041_G_A_b38	ATAD3C	-5.041	6.34e-07	-0.096901	8	0.019222	yes	SKNS
chr1_1551523_T_C_b38	ATAD3C	-5.008	7.47e-07	-0.068381	38	0.013654	yes	SKNS
chr1_1379093_TG_T_b38	ATAD3C	-4.978	8.69e-07	-0.094345	10	0.018953	yes	SKNS
chr1_1344048_G_A_b38	ATAD3C	-4.958	9.58e-07	-0.088632	12	0.017876	yes	SKNS
chr1_1368991_C_T_b38	ATAD3C	-4.95	9.98e-07	-0.08686	14	0.017548	yes	SKNS
chr1_1574655_GGC_G_b38	ATAD3C	-4.944	1.03e-06	-0.064915	87	0.013131	yes	SKNS
chr1_1558347_G_A_b38	ATAD3C	-4.924	1.13e-06	-0.065814	67	0.013367	yes	SKNS
chr1_1341550_GCA_G_b38	ATAD3C	-4.915	1.18e-06	-0.088029	13	0.017909	yes	SKNS
chr1_1566854_CA_C_b38	ATAD3C	-4.909	1.22e-06	-0.069739	69	0.014207	yes	SKNS
chr1_1570587_C_T_b38	ATAD3C	-4.908	1.23e-06	-0.062851	96	0.012807	yes	SKNS
chr1_1373006_G_A_b38	ATAD3C	-4.882	1.39e-06	-0.089469	11	0.018327	yes	SKNS
chr1_1373007_G_A_b38	ATAD3C	-4.882	1.39e-06	-0.089469	11	0.018327	yes	SKNS
chr1_1337898_A_G_b38	ATAD3C	4.88	1.4e-06	0.071766	27	0.014706	yes	SKNS
chr1_1559703_G_C_b38	ATAD3C	-4.88	1.4e-06	-0.062481	96	0.012804	yes	SKNS
chr1_1568548_G_A_b38	ATAD3C	-4.88	1.4e-06	-0.062481	96	0.012804	yes	SKNS
chr1_1532798_T_C_b38	ATAD3C	-4.865	1.51e-06	-0.059963	158	0.012325	yes	SKNS
chr1_1537160_T_G_b38	ATAD3C	-4.859	1.55e-06	-0.061311	123	0.012618	yes	SKNS
chr1_1312114_T_C_b38	ATAD3C	4.858	1.56e-06	0.071933	82	0.014806	yes	SKNS
chr1_1368177_G_C_b38	ATAD3C	-4.857	1.57e-06	-0.08437	17	0.017371	yes	SKNS
chr1_1571986_G_A_b38	ATAD3C	-4.822	1.86e-06	-0.060634	85	0.012575	yes	SKNS
chr1_1539491_G_C_b38	ATAD3C	-4.81	1.96e-06	-0.062473	100	0.012987	yes	SKNS
chr1_1330125_G_A_b38	ATAD3C	4.786	2.21e-06	0.072545	81	0.015158	yes	SKNS
chr1_1366681_T_TGA_b38	ATAD3C	-4.733	2.84e-06	-0.084598	13	0.017873	yes	SKNS
chr1_1366561_AGT_A_b38	ATAD3C	4.728	2.91e-06	0.071524	79	0.015128	yes	SKNS
chr1_1364357_A_C_b38	ATAD3C	-4.727	2.92e-06	-0.083385	13	0.017639	yes	SKNS
chr1_1367511_ATGAG_A_b38	ATAD3C	-4.701	3.31e-06	-0.084207	12	0.017914	yes	SKNS
chr1_1367388_T_TTGG_b38	ATAD3C	-4.685	3.55e-06	-0.083107	13	0.017738	yes	SKNS
chr1_1308516_C_T_b38	ATAD3C	4.667	3.87e-06	0.06883	84	0.014749	yes	SKNS
chr1_1369012_C_CG_b38	ATAD3C	-4.664	3.93e-06	-0.082486	14	0.017686	yes	SKNS
chr1_1364253_C_G_b38	ATAD3C	-4.663	3.93e-06	-0.083284	12	0.017859	yes	SKNS
chr1_1358384_G_C_b38	ATAD3C	4.661	3.97e-06	0.070861	80	0.015201	yes	SKNS
chr1_1368514_C_G_b38	ATAD3C	-4.658	4.03e-06	-0.081518	14	0.0175	yes	SKNS
chr1_1325753_G_T_b38	ATAD3C	-4.652	4.15e-06	-0.089182	8	0.019171	yes	SKNS
chr1_1366187_A_AGT_b38	ATAD3C	-4.646	4.27e-06	-0.082151	13	0.017682	yes	SKNS
chr1_1329973_GCGTGTGCCATGCA_G_b38	ATAD3C	-4.646	4.28e-06	-0.0836	12	0.017996	yes	SKNS
chr1_1554548_T_C_b38	ATAD3C	-4.643	4.33e-06	-0.060646	75	0.013062	yes	SKNS
chr1_1369821_C_T_b38	ATAD3C	-4.641	4.36e-06	-0.081264	14	0.017508	yes	SKNS
chr1_1369009_T_C_b38	ATAD3C	-4.64	4.38e-06	-0.08215	14	0.017703	yes	SKNS
chr1_1370532_C_T_b38	ATAD3C	-4.636	4.47e-06	-0.082347	14	0.017762	yes	SKNS
chr1_1575935_T_C_b38	ATAD3C	-4.636	4.47e-06	-0.059894	98	0.012919	yes	SKNS
chr1_1555871_T_C_b38	ATAD3C	-4.62	4.81e-06	-0.060214	82	0.013032	yes	SKNS
chr1_1316929_A_T_b38	ATAD3C	-4.597	5.35e-06	-0.079501	15	0.017294	yes	SKNS
chr1_1554290_C_T_b38	ATAD3C	-4.595	5.4e-06	-0.05963	75	0.012976	yes	SKNS
chr1_1538924_C_A_b38	ATAD3C	-4.574	5.95e-06	-0.058777	69	0.012849	yes	SKNS
chr1_1537493_T_A_b38	ATAD3C	-4.569	6.08e-06	-0.058832	89	0.012875	yes	SKNS
chr1_1364566_T_C_b38	ATAD3C	-4.567	6.14e-06	-0.08143	12	0.017829	yes	SKNS
chr1_1370430_T_C_b38	ATAD3C	-4.565	6.2e-06	-0.08167	14	0.01789	yes	SKNS
chr1_1370584_G_C_b38	ATAD3C	-4.565	6.2e-06	-0.08167	14	0.01789	yes	SKNS
chr1_1367280_T_A_b38	ATAD3C	-4.563	6.26e-06	-0.080813	13	0.01771	yes	SKNS
chr1_1363880_A_G_b38	ATAD3C	-4.539	7e-06	-0.07982	13	0.017587	yes	SKNS
chr1_1453870_A_C_b38	ATAD3C	-4.538	7.03e-06	-0.076282	13	0.01681	yes	SKNS
chr1_1303112_G_A_b38	ATAD3C	-4.511	7.95e-06	-0.082463	9	0.018282	yes	SKNS
chr1_1555179_A_G_b38	ATAD3C	-4.511	7.95e-06	-0.058819	78	0.01304	yes	SKNS
chr1_1364282_T_G_b38	ATAD3C	-4.504	8.19e-06	-0.079815	13	0.01772	yes	SKNS
chr1_1364694_T_C_b38	ATAD3C	-4.504	8.19e-06	-0.079815	13	0.01772	yes	SKNS
chr1_1364721_C_T_b38	ATAD3C	-4.504	8.19e-06	-0.079815	13	0.01772	yes	SKNS
chr1_1365160_A_G_b38	ATAD3C	-4.504	8.19e-06	-0.079815	13	0.01772	yes	SKNS
chr1_1365198_C_T_b38	ATAD3C	-4.504	8.19e-06	-0.079815	13	0.01772	yes	SKNS
chr1_1366008_A_G_b38	ATAD3C	-4.504	8.19e-06	-0.079815	13	0.01772	yes	SKNS
chr1_1366062_T_C_b38	ATAD3C	-4.504	8.19e-06	-0.079815	13	0.01772	yes	SKNS
chr1_1366145_TGTGAA_T_b38	ATAD3C	-4.504	8.19e-06	-0.079815	13	0.01772	yes	SKNS
chr1_1366321_TGTGTGTAAATGG_T_b38	ATAD3C	-4.504	8.19e-06	-0.079815	13	0.01772	yes	SKNS
chr1_1366453_G_T_b38	ATAD3C	-4.504	8.19e-06	-0.079815	13	0.01772	yes	SKNS
chr1_1366726_T_G_b38	ATAD3C	-4.504	8.19e-06	-0.079815	13	0.01772	yes	SKNS
chr1_1367258_T_A_b38	ATAD3C	-4.504	8.19e-06	-0.079815	13	0.01772	yes	SKNS
chr1_1367297_GAA_G_b38	ATAD3C	-4.504	8.19e-06	-0.079815	13	0.01772	yes	SKNS
chr1_1367300_T_TGA_b38	ATAD3C	-4.504	8.19e-06	-0.079815	13	0.01772	yes	SKNS
chr1_1367329_A_AGT_b38	ATAD3C	-4.504	8.19e-06	-0.079815	13	0.01772	yes	SKNS
chr1_1367373_T_TGTG_b38	ATAD3C	-4.504	8.19e-06	-0.079815	13	0.01772	yes	SKNS
chr1_1367593_G_A_b38	ATAD3C	-4.504	8.19e-06	-0.079815	13	0.01772	yes	SKNS
chr1_1367602_GT_G_b38	ATAD3C	-4.504	8.19e-06	-0.079815	13	0.01772	yes	SKNS
chr1_1367605_GAGTGAGTGTA_G_b38	ATAD3C	-4.504	8.19e-06	-0.079815	13	0.01772	yes	SKNS
chr1_1367670_GGTGA_G_b38	ATAD3C	-4.504	8.19e-06	-0.079815	13	0.01772	yes	SKNS
chr1_1367722_TTTTA_T_b38	ATAD3C	-4.504	8.19e-06	-0.079815	13	0.01772	yes	SKNS
chr1_1367874_A_T_b38	ATAD3C	-4.504	8.19e-06	-0.079815	13	0.01772	yes	SKNS
chr1_1370181_C_T_b38	ATAD3C	-4.497	8.45e-06	-0.079763	13	0.017736	yes	SKNS
chr1_1370317_G_C_b38	ATAD3C	-4.497	8.45e-06	-0.079763	13	0.017736	yes	SKNS
chr1_1370320_A_G_b38	ATAD3C	-4.497	8.45e-06	-0.079763	13	0.017736	yes	SKNS
chr1_1366511_GGTGA_G_b38	ATAD3C	-4.497	8.48e-06	-0.079664	13	0.017717	yes	SKNS
chr1_1367919_C_T_b38	ATAD3C	-4.491	8.67e-06	-0.078843	14	0.017554	yes	SKNS
chr1_1367951_C_T_b38	ATAD3C	-4.491	8.67e-06	-0.078843	14	0.017554	yes	SKNS
chr1_1367965_A_G_b38	ATAD3C	-4.491	8.67e-06	-0.078843	14	0.017554	yes	SKNS
chr1_1367970_T_G_b38	ATAD3C	-4.491	8.67e-06	-0.078843	14	0.017554	yes	SKNS
chr1_1367994_C_A_b38	ATAD3C	-4.491	8.67e-06	-0.078843	14	0.017554	yes	SKNS
chr1_1368297_C_T_b38	ATAD3C	-4.491	8.67e-06	-0.078843	14	0.017554	yes	SKNS
chr1_1363688_C_T_b38	ATAD3C	-4.487	8.87e-06	-0.079597	13	0.017741	yes	SKNS
chr1_1364099_CCA_C_b38	ATAD3C	-4.487	8.87e-06	-0.079597	13	0.017741	yes	SKNS
chr1_1364102_TGTTG_T_b38	ATAD3C	-4.487	8.87e-06	-0.079597	13	0.017741	yes	SKNS
chr1_1369282_G_A_b38	ATAD3C	-4.484	8.96e-06	-0.078781	14	0.017568	yes	SKNS
chr1_1369320_GT_G_b38	ATAD3C	-4.484	8.96e-06	-0.078781	14	0.017568	yes	SKNS
chr1_1369407_G_A_b38	ATAD3C	-4.484	8.96e-06	-0.078781	14	0.017568	yes	SKNS
chr1_1369476_CTT_C_b38	ATAD3C	-4.484	8.96e-06	-0.078781	14	0.017568	yes	SKNS
chr1_1369556_C_G_b38	ATAD3C	-4.484	8.96e-06	-0.078781	14	0.017568	yes	SKNS
chr1_1369627_T_C_b38	ATAD3C	-4.484	8.96e-06	-0.078781	14	0.017568	yes	SKNS
chr1_1369686_T_C_b38	ATAD3C	-4.484	8.96e-06	-0.078781	14	0.017568	yes	SKNS
chr1_1369716_G_C_b38	ATAD3C	-4.484	8.96e-06	-0.078781	14	0.017568	yes	SKNS
chr1_1369741_C_T_b38	ATAD3C	-4.484	8.96e-06	-0.078781	14	0.017568	yes	SKNS
chr1_1368763_G_A_b38	ATAD3C	-4.474	9.39e-06	-0.078625	14	0.017574	yes	SKNS
chr1_1454315_C_T_b38	ATAD3C	-4.466	9.73e-06	-0.066026	68	0.014784	yes	SKNS
chr1_1575864_G_A_b38	ATAD3C	-4.436	1.11e-05	-0.058872	89	0.01327	yes	SKNS
chr1_1366292_G_T_b38	ATAD3C	-4.428	1.15e-05	-0.078699	13	0.017773	yes	SKNS
chr1_1379091_T_G_b38	ATAD3C	4.427	1.16e-05	0.074195	20	0.016761	yes	SKNS
chr1_1545968_T_C_b38	ATAD3C	-4.405	1.28e-05	-0.058215	45	0.013216	yes	SKNS
chr1_1367462_T_C_b38	ATAD3C	-4.4	1.31e-05	-0.078355	12	0.01781	yes	SKNS
chr1_1304555_A_C_b38	ATAD3C	-4.369	1.5e-05	-0.080352	9	0.018393	yes	SKNS
chr1_1367268_TGA_T_b38	ATAD3C	-4.337	1.73e-05	-0.076703	13	0.017687	yes	SKNS
chr1_1570568_AC_A_b38	ATAD3C	-4.336	1.73e-05	-0.059463	44	0.013713	yes	SKNS
chr1_1303800_G_A_b38	ATAD3C	-4.336	1.73e-05	-0.082114	9	0.018937	yes	SKNS
chr1_1369803_C_CT_b38	ATAD3C	-4.317	1.88e-05	-0.072537	13	0.016801	yes	SKNS
chr1_1174578_A_G_b38	ATAD3C	-4.299	2.04e-05	-0.079509	9	0.018493	yes	SKNS
chr1_1528513_G_C_b38	ATAD3C	-4.285	2.16e-05	-0.128086	3	0.029889	yes	SKNS
chr1_1568428_C_G_b38	ATAD3C	-4.268	2.33e-05	-0.055958	48	0.01311	yes	SKNS
chr1_1308178_GGGGCGCGGGGA_G_b38	ATAD3C	-4.262	2.4e-05	-0.068954	19	0.016179	yes	SKNS
chr1_1573429_CAAAAAAAAAAAAAAAAAA_C_b38	ATAD3C	-4.26	2.42e-05	-0.055462	92	0.01302	yes	SKNS
chr1_1366941_T_TGTGTGCA_b38	ATAD3C	4.255	2.47e-05	0.082093	12	0.019293	yes	SKNS
chr1_1573776_A_G_b38	ATAD3C	-4.243	2.6e-05	-0.058356	38	0.013754	yes	SKNS
chr1_1217733_G_A_b38	ATAD3C	-4.238	2.65e-05	-0.075334	11	0.017774	yes	SKNS
chr1_1533883_G_T_b38	ATAD3C	-4.234	2.71e-05	-0.094048	15	0.022214	yes	SKNS
chr1_1551454_C_A_b38	ATAD3C	-4.221	2.86e-05	-0.050523	170	0.011969	yes	SKNS
chr1_1366951_A_AGT_b38	ATAD3C	4.216	2.92e-05	0.081637	12	0.019363	yes	SKNS
chr1_1288085_GC_G_b38	ATAD3C	-4.215	2.93e-05	-0.076014	12	0.018033	yes	SKNS
chr1_1363898_C_T_b38	ATAD3C	4.185	3.33e-05	0.068966	21	0.01648	yes	SKNS
chr1_1367122_G_A_b38	ATAD3C	-4.176	3.47e-05	-0.164684	4	0.03944	yes	SKNS
chr1_1363986_C_T_b38	ATAD3C	4.154	3.8e-05	0.068373	21	0.016459	yes	SKNS
chr1_1302795_T_TC_b38	ATAD3C	4.136	4.11e-05	0.058388	93	0.014118	yes	SKNS
chr1_1366529_TTAG_T_b38	ATAD3C	4.135	4.13e-05	0.067945	21	0.016433	yes	SKNS
chr1_1456079_T_C_b38	ATAD3C	-4.127	4.26e-05	-0.060719	41	0.014712	yes	SKNS
chr1_1453703_A_G_b38	ATAD3C	-4.123	4.33e-05	-0.061748	75	0.014975	yes	SKNS
chr1_1456182_G_A_b38	ATAD3C	-4.115	4.48e-05	-0.059634	44	0.014491	yes	SKNS
chr1_1497605_G_C_b38	ATAD3C	-4.114	4.51e-05	-0.055446	74	0.013478	yes	SKNS
chr1_1454092_A_G_b38	ATAD3C	-4.114	4.51e-05	-0.06154	75	0.01496	yes	SKNS
chr1_1309988_G_A_b38	ATAD3C	4.112	4.55e-05	0.060832	86	0.014795	yes	SKNS
chr1_1456154_G_A_b38	ATAD3C	-4.111	4.55e-05	-0.06073	41	0.014771	yes	SKNS
chr1_1453643_A_ATT_b38	ATAD3C	-4.11	4.57e-05	-0.062077	46	0.015103	yes	SKNS
chr1_1367292_A_AGT_b38	ATAD3C	4.108	4.61e-05	0.067595	21	0.016454	yes	SKNS
chr1_1455617_T_G_b38	ATAD3C	-4.1	4.77e-05	-0.061218	75	0.01493	yes	SKNS
chr1_1452511_A_G_b38	ATAD3C	-4.084	5.1e-05	-0.061239	75	0.014993	yes	SKNS
chr1_1452888_C_A_b38	ATAD3C	-4.084	5.1e-05	-0.061239	75	0.014993	yes	SKNS
chr1_1452909_A_C_b38	ATAD3C	-4.084	5.1e-05	-0.061239	75	0.014993	yes	SKNS
chr1_1454770_T_C_b38	ATAD3C	-4.083	5.13e-05	-0.06097	76	0.014933	yes	SKNS
chr1_1313807_G_A_b38	ATAD3C	4.063	5.56e-05	0.060102	86	0.014791	yes	SKNS
chr1_1290261_C_A_b38	ATAD3C	-4.055	5.77e-05	-0.069457	43	0.017129	yes	SKNS
chr1_1363456_CAG_C_b38	ATAD3C	4.009	6.95e-05	0.059748	35	0.014902	yes	SKNS
chr1_1452797_CAA_C_b38	ATAD3C	-4.002	7.18e-05	-0.062556	32	0.015633	yes	SKNS
chr1_1366776_G_GAATT_b38	ATAD3C	-4.002	7.18e-05	-0.071928	13	0.017975	yes	SKNS
chr1_1452540_G_A_b38	ATAD3C	-3.998	7.29e-05	-0.058169	37	0.01455	yes	SKNS
chr1_1453552_G_A_b38	ATAD3C	-3.986	7.65e-05	-0.058546	42	0.014687	yes	SKNS
chr1_1455134_T_G_b38	ATAD3C	-3.986	7.65e-05	-0.058546	42	0.014687	yes	SKNS
chr1_1455337_A_G_b38	ATAD3C	-3.986	7.65e-05	-0.058546	42	0.014687	yes	SKNS
chr1_1455495_C_T_b38	ATAD3C	-3.986	7.65e-05	-0.058546	42	0.014687	yes	SKNS
chr1_1451787_A_C_b38	ATAD3C	-3.976	7.98e-05	-0.057885	60	0.014559	yes	SKNS
chr1_1235602_C_A_b38	ATAD3C	-3.958	8.57e-05	-0.069749	11	0.017622	yes	SKNS
chr1_1217251_C_A_b38	ATAD3C	-3.953	8.77e-05	-0.073065	12	0.018486	yes	SKNS
chr1_1452825_AAAG_A_b38	ATAD3C	-3.94	9.24e-05	-0.057864	42	0.014687	yes	SKNS
chr1_1553018_CA_C_b38	ATAD3C	-3.929	9.65e-05	-0.057135	29	0.014542	yes	SKNS
chr1_1428999_C_CA_b38	ATAD3C	-3.905	0.000106	-0.055066	34	0.014102	yes	SKNS
chr1_1231710_CCCCCGGGAA_C_b38	ATAD3C	-3.901	0.000108	-0.066254	17	0.016986	yes	SKNS
chr1_1579717_T_A_b38	ATAD3C	-3.897	0.00011	-0.052552	41	0.013487	yes	SKNS
chr1_1181009_A_AGCCCCTGCCCCTGCCCCTGAACCC_b38	ATAD3C	-3.87	0.000122	-0.087838	6	0.022698	yes	SKNS
chr1_1454848_T_C_b38	ATAD3C	-3.86	0.000127	-0.056259	44	0.014574	yes	SKNS
chr1_1174639_A_G_b38	ATAD3C	-3.8	0.000161	-0.068908	11	0.018134	yes	SKNS
chr1_1455924_T_C_b38	ATAD3C	-3.795	0.000164	-0.056124	41	0.014787	yes	SKNS
chr1_1558204_T_TAAAAAA_b38	ATAD3C	-3.792	0.000167	-0.054955	46	0.014493	yes	SKNS
chr1_1456051_C_T_b38	ATAD3C	-3.791	0.000167	-0.055842	41	0.014731	yes	SKNS
chr1_1183348_C_G_b38	ATAD3C	-3.785	0.000171	-0.081723	6	0.02159	yes	SKNS
chr1_1580890_C_T_b38	ATAD3C	-3.763	0.000187	-0.051813	38	0.01377	yes	SKNS
chr1_1497606_C_G_b38	ATAD3C	-3.76	0.000189	-0.061123	18	0.016255	yes	SKNS
chr1_1572877_T_TG_b38	ATAD3C	3.759	0.000189	0.059496	20	0.015827	yes	SKNS
chr1_1226486_C_T_b38	ATAD3C	-3.752	0.000195	-0.065473	11	0.01745	yes	SKNS
chr1_1173138_T_C_b38	ATAD3C	-3.75	0.000196	-0.068855	10	0.01836	yes	SKNS
chr1_1471992_T_C_b38	ATAD3C	-3.724	0.000217	-0.054399	86	0.014608	yes	SKNS
chr1_1331358_G_A_b38	ATAD3C	3.71	0.000229	0.094346	4	0.025434	yes	SKNS
chr1_1331360_T_A_b38	ATAD3C	3.71	0.000229	0.094346	4	0.025434	yes	SKNS
chr1_1177741_G_A_b38	ATAD3C	-3.709	0.00023	-0.068979	10	0.018598	yes	SKNS
chr1_1407232_G_C_b38	ATAD3C	-3.695	0.000242	-0.054818	30	0.014834	yes	SKNS
chr1_1457033_A_C_b38	ATAD3C	-3.683	0.000254	-0.053531	39	0.014535	yes	SKNS
chr1_1174273_G_A_b38	ATAD3C	-3.663	0.000274	-0.067868	9	0.018529	yes	SKNS
chr1_1554241_T_C_b38	ATAD3C	-3.659	0.000279	-0.049775	52	0.013605	yes	SKNS
chr1_1365566_G_A_b38	ATAD3C	3.64	0.000299	0.059656	21	0.016389	yes	SKNS
chr1_1457071_C_T_b38	ATAD3C	-3.637	0.000302	-0.052671	44	0.014482	yes	SKNS
chr1_1175607_T_TC_b38	ATAD3C	-3.634	0.000306	-0.066936	10	0.01842	yes	SKNS
chr1_1518621_A_ACC_b38	ATAD3C	-3.623	0.000319	-0.113388	3	0.031297	yes	SKNS
chr1_1388565_GTC_G_b38	ATAD3C	3.608	0.000338	0.053808	30	0.014914	yes	SKNS
chr1_1175611_G_C_b38	ATAD3C	-3.601	0.000346	-0.066495	10	0.018464	yes	SKNS
chr1_1178191_A_G_b38	ATAD3C	-3.576	0.00038	-0.063628	13	0.017792	yes	SKNS
chr1_1451968_C_T_b38	ATAD3C	-3.547	0.000424	-0.05276	38	0.014874	yes	SKNS
chr1_1456829_G_C_b38	ATAD3C	-3.528	0.000456	-0.056332	48	0.015969	yes	SKNS
chr1_1437955_C_G_b38	ATAD3C	-3.527	0.000456	-0.045858	59	0.013001	yes	SKNS
chr1_1365036_T_TAA_b38	ATAD3C	-3.526	0.000457	-0.065982	9	0.018711	yes	SKNS
chr1_1367028_A_G_b38	ATAD3C	3.52	0.000469	0.066338	14	0.018848	yes	SKNS
chr1_1174845_C_T_b38	ATAD3C	-3.505	0.000495	-0.071585	8	0.020424	yes	SKNS
chr1_1236303_A_G_b38	ATAD3C	-3.504	0.000497	-0.058326	17	0.016647	yes	SKNS
chr1_1173724_G_T_b38	ATAD3C	-3.496	0.000512	-0.072594	8	0.020766	yes	SKNS
chr1_960375_A_AG_b38	ATAD3C	3.493	0.000518	0.064066	38	0.018342	yes	SKNS
chr1_2304223_G_A_b38	ATAD3C	3.484	0.000534	0.061022	15	0.017514	yes	SKNS
chr1_1174988_C_T_b38	ATAD3C	-3.483	0.000536	-0.071452	8	0.020513	yes	SKNS
chr1_1175040_T_C_b38	ATAD3C	-3.483	0.000536	-0.071452	8	0.020513	yes	SKNS
chr1_1570655_G_A_b38	ATAD3C	-3.479	0.000544	-0.057007	19	0.016384	yes	SKNS
chr1_1178014_C_T_b38	ATAD3C	-3.473	0.000556	-0.071945	8	0.020714	yes	SKNS
chr1_1174573_G_A_b38	ATAD3C	-3.472	0.000559	-0.073827	7	0.021265	yes	SKNS
chr1_1453643_A_AT_b38	ATAD3C	3.465	0.000572	0.05514	18	0.015911	yes	SKNS
chr1_1174174_G_C_b38	ATAD3C	-3.454	0.000596	-0.070137	8	0.020304	yes	SKNS
chr1_1175832_G_GAGAGGCTGCCGCTGTGCCGGTGGAGAGGCTGCCGCCGTGCAGGTGGAA_b38	ATAD3C	-3.452	6e-04	-0.076794	5	0.022246	yes	SKNS
chr1_1461687_CTGGAGGGAGAGGCTCCTCATGAGACCCCCATGTAGGGAT_C_b38	ATAD3C	-3.448	0.00061	-0.122323	3	0.03548	yes	SKNS
chr1_1216593_G_C_b38	ATAD3C	-3.427	0.000657	-0.054274	18	0.015837	yes	SKNS
chr1_1534218_C_G_b38	ATAD3C	-3.423	0.000668	-0.043115	159	0.012597	yes	SKNS
chr1_1534219_G_C_b38	ATAD3C	-3.423	0.000668	-0.043115	159	0.012597	yes	SKNS
chr1_1174523_C_T_b38	ATAD3C	-3.42	0.000675	-0.070225	8	0.020536	yes	SKNS
chr1_1174747_C_T_b38	ATAD3C	-3.42	0.000675	-0.070225	8	0.020536	yes	SKNS
chr1_1566099_T_TA_b38	ATAD3C	-3.356	0.000848	-0.072258	3	0.021532	yes	SKNS
chr1_1519934_T_G_b38	ATAD3C	-3.344	0.000885	-0.045789	102	0.013695	yes	SKNS
chr1_1519938_T_C_b38	ATAD3C	-3.344	0.000885	-0.045789	102	0.013695	yes	SKNS
chr1_1179288_G_A_b38	ATAD3C	-3.337	0.000906	-0.069283	8	0.020763	yes	SKNS
chr1_1215852_T_C_b38	ATAD3C	-3.333	0.000919	-0.051186	22	0.015357	yes	SKNS
chr1_1456891_T_C_b38	ATAD3C	-3.325	0.000945	-0.044265	59	0.013313	yes	SKNS
chr1_1256490_C_T_b38	ATAD3C	-3.318	0.000968	-0.079757	3	0.024036	yes	SKNS
chr1_1177430_G_T_b38	ATAD3C	-3.288	0.00108	-0.068132	8	0.020724	yes	SKNS
chr1_1553791_CA_C_b38	ATAD3C	-3.282	0.0011	-0.04728	37	0.014405	yes	SKNS
chr1_1383798_AG_A_b38	ATAD3C	3.249	0.00123	0.066806	10	0.020563	yes	SKNS
chr1_928309_A_G_b38	ATAD3C	3.247	0.00124	0.100893	16	0.031073	yes	SKNS
chr1_1456217_T_C_b38	ATAD3C	-3.238	0.00128	-0.050413	65	0.015567	yes	SKNS
chr1_1517993_A_G_b38	ATAD3C	-3.226	0.00133	-0.044168	102	0.013692	yes	SKNS
chr1_1534226_C_T_b38	ATAD3C	-3.202	0.00145	-0.043561	66	0.013606	yes	SKNS
chr1_969785_A_G_b38	ATAD3C	3.196	0.00147	0.078268	26	0.024487	yes	SKNS
chr1_1210031_G_A_b38	ATAD3C	-3.184	0.00154	-0.065096	6	0.020444	yes	SKNS
chr1_1210061_A_G_b38	ATAD3C	-3.184	0.00154	-0.065096	6	0.020444	yes	SKNS
chr1_1210087_C_G_b38	ATAD3C	-3.184	0.00154	-0.065096	6	0.020444	yes	SKNS
chr1_1210386_C_G_b38	ATAD3C	-3.184	0.00154	-0.065096	6	0.020444	yes	SKNS
chr1_1450322_CAA_C_b38	ATAD3C	-3.18	0.00156	-0.070007	10	0.022015	yes	SKNS
chr1_1219159_G_A_b38	ATAD3C	-3.18	0.00156	-0.066495	5	0.020914	yes	SKNS
chr1_1210101_CAA_C_b38	ATAD3C	-3.178	0.00157	-0.062787	6	0.019757	yes	SKNS
chr1_1479719_T_C_b38	ATAD3C	-3.178	0.00157	-0.04668	88	0.01469	yes	SKNS
chr1_1173996_G_A_b38	ATAD3C	-3.171	0.00161	-0.064887	8	0.020464	yes	SKNS
chr1_1288341_C_T_b38	ATAD3C	-3.152	0.00171	-0.072922	10	0.023132	yes	SKNS
chr1_1399922_C_T_b38	ATAD3C	-3.147	0.00174	-0.065081	9	0.020682	yes	SKNS
chr1_1238231_G_A_b38	ATAD3C	-3.134	0.00182	-0.047351	34	0.01511	yes	SKNS
chr1_1219941_C_T_b38	ATAD3C	-3.129	0.00185	-0.065296	6	0.020867	yes	SKNS
chr1_1212390_G_A_b38	ATAD3C	-3.126	0.00187	-0.063985	6	0.020466	yes	SKNS
chr1_1385384_G_A_b38	ATAD3C	3.118	0.00192	0.064533	9	0.020698	yes	SKNS
chr1_1395050_G_A_b38	ATAD3C	-3.092	0.00209	-0.064186	9	0.02076	yes	SKNS
chr1_1211863_A_C_b38	ATAD3C	-3.091	0.0021	-0.063021	6	0.02039	yes	SKNS
chr1_1223644_C_T_b38	ATAD3C	-3.091	0.0021	-0.05777	9	0.018692	yes	SKNS
chr1_1716919_CT_C_b38	ATAD3C	3.079	0.00218	0.096408	7	0.031312	yes	SKNS
chr1_1209119_GGA_G_b38	ATAD3C	-3.078	0.00219	-0.063064	6	0.020491	yes	SKNS
chr1_1209273_G_A_b38	ATAD3C	-3.078	0.00219	-0.063064	6	0.020491	yes	SKNS
chr1_1209316_T_C_b38	ATAD3C	-3.078	0.00219	-0.063064	6	0.020491	yes	SKNS
chr1_959193_G_A_b38	ATAD3C	3.064	0.0023	0.060698	38	0.019813	yes	SKNS
chr1_1173872_A_G_b38	ATAD3C	-3.056	0.00236	-0.037754	76	0.012355	yes	SKNS
chr1_1201373_T_C_b38	ATAD3C	-3.04	0.00249	-0.046153	37	0.015184	yes	SKNS
chr1_1252613_C_G_b38	ATAD3C	-3.034	0.00253	-0.058113	10	0.019152	yes	SKNS
chr1_1292284_TTGAG_T_b38	ATAD3C	-3.029	0.00257	-0.052193	30	0.017228	yes	SKNS
chr1_1554246_C_T_b38	ATAD3C	-3.02	0.00264	-0.041295	57	0.013672	yes	SKNS
chr1_1402900_A_G_b38	ATAD3C	-3.012	0.00272	-0.062581	9	0.020778	yes	SKNS
chr1_1403240_CCTTT_C_b38	ATAD3C	-3.012	0.00272	-0.062581	9	0.020778	yes	SKNS
chr1_1405316_T_C_b38	ATAD3C	-3.012	0.00272	-0.062581	9	0.020778	yes	SKNS
chr1_1553619_CAAAAAAA_C_b38	ATAD3C	-3.008	0.00275	-0.043001	37	0.014295	yes	SKNS
chr1_960326_G_A_b38	ATAD3C	3.008	0.00275	0.056119	37	0.018655	yes	SKNS
chr1_1239925_G_A_b38	ATAD3C	-3.005	0.00278	-0.063099	5	0.021001	yes	SKNS
chr1_1238883_G_A_b38	ATAD3C	-3.003	0.0028	-0.060656	5	0.020199	yes	SKNS
chr1_1172462_G_C_b38	ATAD3C	-2.999	0.00283	-0.061218	9	0.020411	yes	SKNS
chr1_1250144_T_C_b38	ATAD3C	-2.996	0.00286	-0.067683	3	0.02259	yes	SKNS
chr1_1242538_CT_C_b38	ATAD3C	-2.992	0.0029	-0.068831	3	0.023005	yes	SKNS
chr1_1235869_T_C_b38	ATAD3C	-2.987	0.00295	-0.058976	6	0.019746	yes	SKNS
chr1_1211917_G_A_b38	ATAD3C	-2.985	0.00297	-0.061002	6	0.020437	yes	SKNS
chr1_1250178_T_C_b38	ATAD3C	-2.983	0.00299	-0.066589	4	0.022326	yes	SKNS
chr1_1571434_C_CA_b38	ATAD3C	-2.959	0.00323	-0.042244	56	0.014277	yes	SKNS
chr1_1173931_G_A_b38	ATAD3C	-2.956	0.00325	-0.056695	8	0.01918	yes	SKNS
chr1_1173935_C_G_b38	ATAD3C	-2.956	0.00325	-0.056695	8	0.01918	yes	SKNS
chr1_1214801_G_C_b38	ATAD3C	-2.948	0.00334	-0.059283	6	0.020109	yes	SKNS
chr1_1222580_T_C_b38	ATAD3C	-2.948	0.00334	-0.055147	9	0.018708	yes	SKNS
chr1_1222594_A_G_b38	ATAD3C	-2.948	0.00334	-0.055147	9	0.018708	yes	SKNS
chr1_1533841_T_C_b38	ATAD3C	-2.937	0.00346	-0.044171	48	0.01504	yes	SKNS
chr1_1224281_GTTTTA_G_b38	ATAD3C	-2.931	0.00352	-0.059582	5	0.020325	yes	SKNS
chr1_1227886_G_A_b38	ATAD3C	-2.931	0.00352	-0.059582	5	0.020325	yes	SKNS
chr1_1230250_G_A_b38	ATAD3C	-2.931	0.00352	-0.059582	5	0.020325	yes	SKNS
chr1_1175206_T_C_b38	ATAD3C	-2.93	0.00353	-0.038179	124	0.013028	yes	SKNS
chr1_1240580_G_GC_b38	ATAD3C	-2.92	0.00365	-0.053694	7	0.018391	yes	SKNS
chr1_1380513_C_T_b38	ATAD3C	2.918	0.00367	0.061603	7	0.021112	yes	SKNS
chr1_1381290_C_G_b38	ATAD3C	2.918	0.00367	0.061603	7	0.021112	yes	SKNS
chr1_1366828_A_G_b38	ATAD3C	-2.908	0.00379	-0.058777	8	0.020214	yes	SKNS
chr1_1223640_A_G_b38	ATAD3C	-2.906	0.00381	-0.055271	7	0.019021	yes	SKNS
chr1_1361679_G_A_b38	ATAD3C	2.897	0.00393	0.046795	45	0.016155	yes	SKNS
chr1_1690745_G_GA_b38	ATAD3C	2.895	0.00395	0.090522	6	0.031269	yes	SKNS
chr1_1384256_T_G_b38	ATAD3C	2.892	0.00398	0.054008	3	0.018673	yes	SKNS
chr1_1341079_C_A_b38	ATAD3C	2.883	0.0041	0.057425	6	0.019919	yes	SKNS
chr1_969780_C_T_b38	ATAD3C	2.882	0.00411	0.049734	37	0.017256	yes	SKNS
chr1_1249880_A_G_b38	ATAD3C	-2.868	0.00429	-0.046054	30	0.016058	yes	SKNS
chr1_1466535_CA_C_b38	ATAD3C	-2.865	0.00434	-0.06387	3	0.022295	yes	SKNS
chr1_1225476_T_C_b38	ATAD3C	-2.859	0.00441	-0.052776	11	0.018459	yes	SKNS
chr1_1226013_C_T_b38	ATAD3C	-2.859	0.00441	-0.052776	11	0.018459	yes	SKNS
chr1_1229369_G_GC_b38	ATAD3C	-2.857	0.00444	-0.043813	28	0.015335	yes	SKNS
chr1_1240390_G_A_b38	ATAD3C	-2.856	0.00445	-0.05835	5	0.020428	yes	SKNS
chr1_1251122_A_T_b38	ATAD3C	-2.852	0.00451	-0.044803	32	0.015709	yes	SKNS
chr1_929375_A_G_b38	ATAD3C	2.851	0.00453	0.093107	15	0.032659	yes	SKNS
chr1_929377_G_A_b38	ATAD3C	2.851	0.00453	0.093107	15	0.032659	yes	SKNS
chr1_1248017_C_T_b38	ATAD3C	-2.84	0.00468	-0.065775	3	0.023159	yes	SKNS
chr1_1375698_G_T_b38	ATAD3C	2.839	0.00469	0.058988	7	0.020776	yes	SKNS
chr1_1376153_G_C_b38	ATAD3C	2.839	0.00469	0.058988	7	0.020776	yes	SKNS
chr1_1376752_T_C_b38	ATAD3C	2.839	0.00469	0.058988	7	0.020776	yes	SKNS
chr1_1378635_C_T_b38	ATAD3C	2.839	0.00469	0.058988	7	0.020776	yes	SKNS
chr1_1378792_C_T_b38	ATAD3C	2.839	0.00469	0.058988	7	0.020776	yes	SKNS
chr1_1378865_C_T_b38	ATAD3C	2.839	0.00469	0.058988	7	0.020776	yes	SKNS
chr1_1379334_A_G_b38	ATAD3C	2.839	0.00469	0.058988	7	0.020776	yes	SKNS
chr1_1214831_G_A_b38	ATAD3C	-2.837	0.00473	-0.057024	6	0.020101	yes	SKNS
chr1_1222251_G_A_b38	ATAD3C	-2.835	0.00475	-0.053813	7	0.01898	yes	SKNS
chr1_1225285_G_A_b38	ATAD3C	-2.822	0.00495	-0.05366	8	0.019015	yes	SKNS
chr1_1222245_C_T_b38	ATAD3C	-2.82	0.00498	-0.053788	7	0.019075	yes	SKNS
chr1_1235997_A_G_b38	ATAD3C	-2.815	0.00506	-0.051342	16	0.018241	yes	SKNS
chr1_1228069_T_C_b38	ATAD3C	-2.814	0.00508	-0.054529	5	0.019381	yes	SKNS
chr1_966426_G_C_b38	ATAD3C	-2.811	0.00512	-0.068438	26	0.024344	yes	SKNS
chr1_1215068_T_C_b38	ATAD3C	-2.806	0.0052	-0.057054	6	0.020335	yes	SKNS
chr1_966179_G_A_b38	ATAD3C	2.792	0.00543	0.055167	33	0.019761	yes	SKNS
chr1_1223568_A_G_b38	ATAD3C	-2.791	0.00545	-0.051709	10	0.01853	yes	SKNS
chr1_1255533_CT_C_b38	ATAD3C	-2.786	0.00552	-0.066131	7	0.023733	yes	SKNS
chr1_1257135_A_G_b38	ATAD3C	-2.786	0.00552	-0.066131	7	0.023733	yes	SKNS
chr1_1264812_C_G_b38	ATAD3C	-2.786	0.00552	-0.066131	7	0.023733	yes	SKNS
chr1_1252487_C_A_b38	ATAD3C	-2.786	0.00552	-0.059707	4	0.021428	yes	SKNS
chr1_1230462_A_ATTT_b38	ATAD3C	-2.774	0.00573	-0.057517	6	0.020736	yes	SKNS
chr1_1182832_T_C_b38	ATAD3C	-2.772	0.00576	-0.036865	85	0.013298	yes	SKNS
chr1_1223727_G_A_b38	ATAD3C	-2.771	0.00579	-0.052644	7	0.019	yes	SKNS
chr1_1573265_C_CAAAA_b38	ATAD3C	-2.765	0.00589	-0.044514	31	0.016101	yes	SKNS
chr1_1290841_A_G_b38	ATAD3C	-2.763	0.00593	-0.047134	42	0.017062	yes	SKNS
chr1_1221960_A_G_b38	ATAD3C	-2.76	0.00597	-0.052532	7	0.019031	yes	SKNS
chr1_1221992_G_A_b38	ATAD3C	-2.76	0.00597	-0.052532	7	0.019031	yes	SKNS
chr1_1222167_T_C_b38	ATAD3C	-2.76	0.00597	-0.052532	7	0.019031	yes	SKNS
chr1_1222184_G_A_b38	ATAD3C	-2.76	0.00597	-0.052532	7	0.019031	yes	SKNS
chr1_1222304_C_T_b38	ATAD3C	-2.76	0.00597	-0.052532	7	0.019031	yes	SKNS
chr1_1222325_C_G_b38	ATAD3C	-2.76	0.00597	-0.052532	7	0.019031	yes	SKNS
chr1_1222454_C_T_b38	ATAD3C	-2.76	0.00597	-0.052532	7	0.019031	yes	SKNS
chr1_1222482_C_T_b38	ATAD3C	-2.76	0.00597	-0.052532	7	0.019031	yes	SKNS
chr1_1222579_C_T_b38	ATAD3C	-2.76	0.00597	-0.052532	7	0.019031	yes	SKNS
chr1_1222611_G_A_b38	ATAD3C	-2.76	0.00597	-0.052532	7	0.019031	yes	SKNS
chr1_1222640_A_C_b38	ATAD3C	-2.76	0.00597	-0.052532	7	0.019031	yes	SKNS
chr1_1222897_G_A_b38	ATAD3C	-2.76	0.00597	-0.052532	7	0.019031	yes	SKNS
chr1_1222946_G_A_b38	ATAD3C	-2.76	0.00597	-0.052532	7	0.019031	yes	SKNS
chr1_1222977_A_G_b38	ATAD3C	-2.76	0.00597	-0.052532	7	0.019031	yes	SKNS
chr1_1223154_G_GAC_b38	ATAD3C	-2.76	0.00597	-0.052532	7	0.019031	yes	SKNS
chr1_1223182_AAC_A_b38	ATAD3C	-2.76	0.00597	-0.052532	7	0.019031	yes	SKNS
chr1_1223593_A_T_b38	ATAD3C	-2.76	0.00597	-0.052532	7	0.019031	yes	SKNS
chr1_1223595_A_C_b38	ATAD3C	-2.76	0.00597	-0.052532	7	0.019031	yes	SKNS
chr1_1223682_T_C_b38	ATAD3C	-2.76	0.00597	-0.052532	7	0.019031	yes	SKNS
chr1_1224105_C_T_b38	ATAD3C	-2.76	0.00597	-0.052532	7	0.019031	yes	SKNS
chr1_1224349_T_G_b38	ATAD3C	-2.76	0.00597	-0.052532	7	0.019031	yes	SKNS
chr1_1224844_C_T_b38	ATAD3C	-2.76	0.00597	-0.052532	7	0.019031	yes	SKNS
chr1_1224846_A_G_b38	ATAD3C	-2.76	0.00597	-0.052532	7	0.019031	yes	SKNS
chr1_1225429_T_C_b38	ATAD3C	-2.76	0.00597	-0.052532	7	0.019031	yes	SKNS
chr1_1225720_CGCCACAGACACGGGCCACACACTCCACAT_C_b38	ATAD3C	-2.76	0.00597	-0.052532	7	0.019031	yes	SKNS
chr1_1225982_A_G_b38	ATAD3C	-2.76	0.00597	-0.052532	7	0.019031	yes	SKNS
chr1_1227161_G_C_b38	ATAD3C	-2.76	0.00597	-0.052532	7	0.019031	yes	SKNS
chr1_1227792_T_C_b38	ATAD3C	-2.76	0.00597	-0.052532	7	0.019031	yes	SKNS
chr1_1227975_T_C_b38	ATAD3C	-2.76	0.00597	-0.052532	7	0.019031	yes	SKNS
chr1_1229160_G_T_b38	ATAD3C	-2.76	0.00597	-0.052532	7	0.019031	yes	SKNS
chr1_1229307_G_C_b38	ATAD3C	-2.76	0.00597	-0.052532	7	0.019031	yes	SKNS
chr1_1229900_GCA_G_b38	ATAD3C	-2.76	0.00597	-0.052532	7	0.019031	yes	SKNS
chr1_1229940_CAT_C_b38	ATAD3C	-2.76	0.00597	-0.052532	7	0.019031	yes	SKNS
chr1_1229981_A_G_b38	ATAD3C	-2.76	0.00597	-0.052532	7	0.019031	yes	SKNS
chr1_1230091_T_C_b38	ATAD3C	-2.76	0.00597	-0.052532	7	0.019031	yes	SKNS
chr1_1230345_A_G_b38	ATAD3C	-2.76	0.00597	-0.052532	7	0.019031	yes	SKNS
chr1_1230441_T_C_b38	ATAD3C	-2.76	0.00597	-0.052532	7	0.019031	yes	SKNS
chr1_1230695_G_A_b38	ATAD3C	-2.76	0.00597	-0.052532	7	0.019031	yes	SKNS
chr1_1230797_G_C_b38	ATAD3C	-2.76	0.00597	-0.052532	7	0.019031	yes	SKNS
chr1_1230825_C_T_b38	ATAD3C	-2.76	0.00597	-0.052532	7	0.019031	yes	SKNS
chr1_1353203_C_G_b38	ATAD3C	2.756	0.00606	0.059998	4	0.021773	yes	SKNS
chr1_1228424_C_T_b38	ATAD3C	-2.753	0.00611	-0.043165	20	0.015679	yes	SKNS
chr1_1182018_A_G_b38	ATAD3C	-2.728	0.00659	-0.035348	127	0.01296	yes	SKNS
chr1_1184277_G_C_b38	ATAD3C	-2.716	0.00682	-0.035883	122	0.013211	yes	SKNS
chr1_1227055_C_A_b38	ATAD3C	-2.715	0.00684	-0.051281	7	0.018887	yes	SKNS
chr1_1258052_T_G_b38	ATAD3C	-2.707	0.00701	-0.072626	6	0.02683	yes	SKNS
chr1_1226261_G_A_b38	ATAD3C	-2.705	0.00704	-0.051659	7	0.019095	yes	SKNS
chr1_1226334_AC_A_b38	ATAD3C	-2.705	0.00704	-0.051659	7	0.019095	yes	SKNS
chr1_1226338_TGTACGGTCAGGAGGAAACATGGCACCTCCCCTCTGGGGGCTCTTTCCAGAAACCCTCAACCC_T_b38	ATAD3C	-2.705	0.00704	-0.051659	7	0.019095	yes	SKNS
chr1_1221355_T_C_b38	ATAD3C	-2.705	0.00705	-0.052511	5	0.019414	yes	SKNS
chr1_1260440_T_C_b38	ATAD3C	-2.699	0.00717	-0.064376	7	0.02385	yes	SKNS
chr1_1266260_T_C_b38	ATAD3C	-2.699	0.00717	-0.064376	7	0.02385	yes	SKNS
chr1_1334606_G_A_b38	ATAD3C	-2.694	0.00729	-0.064956	4	0.024115	yes	SKNS
chr1_1340576_C_T_b38	ATAD3C	-2.694	0.00729	-0.064956	4	0.024115	yes	SKNS
chr1_1336562_C_T_b38	ATAD3C	-2.69	0.00738	-0.065419	4	0.024323	yes	SKNS
chr1_1252261_C_T_b38	ATAD3C	-2.684	0.0075	-0.054571	6	0.02033	yes	SKNS
chr1_1180931_A_G_b38	ATAD3C	-2.681	0.00756	-0.034319	128	0.012799	yes	SKNS
chr1_1254283_G_A_b38	ATAD3C	-2.68	0.0076	-0.063322	7	0.023631	yes	SKNS
chr1_1226892_C_T_b38	ATAD3C	-2.667	0.00789	-0.050901	7	0.019087	yes	SKNS
chr1_967724_C_T_b38	ATAD3C	-2.654	0.00818	-0.062837	22	0.023674	yes	SKNS
chr1_1235349_G_A_b38	ATAD3C	-2.645	0.00841	-0.079644	4	0.030113	yes	SKNS
chr1_1239126_C_CT_b38	ATAD3C	-2.64	0.00852	-0.049414	9	0.018715	yes	SKNS
chr1_1239127_A_ACATGCATCC_b38	ATAD3C	-2.64	0.00852	-0.049414	9	0.018715	yes	SKNS
chr1_1239574_T_C_b38	ATAD3C	-2.64	0.00852	-0.049414	9	0.018715	yes	SKNS
chr1_1366830_G_A_b38	ATAD3C	-2.639	0.00857	-0.053218	8	0.020168	yes	SKNS
chr1_1243650_G_A_b38	ATAD3C	-2.63	0.00878	-0.04795	11	0.018231	yes	SKNS
chr1_1258206_AT_A_b38	ATAD3C	-2.621	0.00902	-0.039152	66	0.014938	yes	SKNS
chr1_1530600_C_T_b38	ATAD3C	2.619	0.00907	0.11805	3	0.045076	yes	SKNS
chr1_2436477_CCCTCCTCCCCTCCTCCCT_C_b38	ATAD3C	2.607	0.00938	0.066696	10	0.025581	yes	SKNS
chr1_1363031_C_T_b38	ATAD3C	2.607	0.0094	0.056083	4	0.021516	yes	SKNS
chr1_1363157_C_T_b38	ATAD3C	2.607	0.0094	0.056083	4	0.021516	yes	SKNS
chr1_2094168_G_A_b38	ATAD3C	2.603	0.00949	0.052915	6	0.020326	yes	SKNS
chr1_1240367_A_G_b38	ATAD3C	-2.6	0.00958	-0.048943	8	0.018824	yes	SKNS
chr1_1693191_TGGTTCCGCCCGGGC_T_b38	ATAD3C	2.597	0.00965	0.097499	3	0.037536	yes	SKNS
chr1_1224783_G_A_b38	ATAD3C	-2.588	0.00991	-0.047554	8	0.018373	yes	SKNS
chr1_1382893_G_A_b38	ATAD3C	-5.398	1.01e-07	-0.097287	13	0.018022	no	SKNS
chr1_1375642_C_T_b38	ATAD3C	-5.202	2.81e-07	-0.091286	15	0.017548	no	SKNS
chr1_1374505_A_G_b38	ATAD3C	-4.982	8.52e-07	-0.087709	15	0.017606	no	SKNS
chr1_1372909_G_A_b38	ATAD3C	-4.829	1.8e-06	-0.086863	13	0.017989	no	SKNS
chr1_1453961_C_T_b38	ATAD3C	-4.52	7.64e-06	-0.078566	11	0.017384	no	SKNS
chr1_1562444_C_T_b38	ATAD3C	-4.417	1.21e-05	-0.085512	10	0.019359	no	SKNS
chr1_1450636_A_G_b38	ATAD3C	-4.17	3.55e-05	-0.071356	13	0.017111	no	SKNS
chr1_1452384_G_A_b38	ATAD3C	-4.009	6.96e-05	-0.065703	16	0.016388	no	SKNS
chr1_1370553_CAAA_C_b38	ATAD3C	-3.79	0.000168	-0.07163	11	0.018902	no	SKNS
chr1_1312208_G_T_b38	ATAD3C	-3.769	0.000182	-0.10674	8	0.028322	no	SKNS
chr1_1452346_A_G_b38	ATAD3C	-3.716	0.000224	-0.059966	18	0.016138	no	SKNS
chr1_1451028_T_A_b38	ATAD3C	-3.664	0.000273	-0.061792	15	0.016865	no	SKNS
chr1_1480224_A_G_b38	ATAD3C	-3.649	0.000289	-0.103742	7	0.028427	no	SKNS
chr1_1366987_GTGTGTAGTGGATGAGTGTGGA_G_b38	ATAD3C	-3.614	0.00033	-0.109624	5	0.030331	no	SKNS
chr1_1366976_GTTGAA_G_b38	ATAD3C	-3.608	0.000338	-0.106004	5	0.029381	no	SKNS
chr1_1366923_AGTTG_A_b38	ATAD3C	-3.519	0.00047	-0.099667	5	0.028321	no	SKNS
chr1_2332063_T_C_b38	ATAD3C	3.464	0.000574	0.063047	22	0.018199	no	SKNS
chr1_1366907_G_A_b38	ATAD3C	-3.446	0.000614	-0.102024	5	0.029608	no	SKNS
chr1_1366911_A_T_b38	ATAD3C	-3.446	0.000614	-0.102024	5	0.029608	no	SKNS
chr1_1367013_TG_T_b38	ATAD3C	-3.44	0.000627	-0.104493	5	0.030374	no	SKNS
chr1_1366906_T_G_b38	ATAD3C	-3.44	0.000627	-0.120977	3	0.035168	no	SKNS
chr1_1367046_G_C_b38	ATAD3C	-3.361	0.000832	-0.101545	5	0.030212	no	SKNS
chr1_1548572_A_AC_b38	ATAD3C	-3.356	0.000848	-0.090247	8	0.026893	no	SKNS
chr1_1367055_T_TGA_b38	ATAD3C	-3.342	0.000891	-0.10085	5	0.030181	no	SKNS
chr1_1367036_GTGAATTGGT_G_b38	ATAD3C	-3.332	0.000924	-0.104601	4	0.031397	no	SKNS
chr1_2290929_G_A_b38	ATAD3C	-3.327	0.000938	-0.041089	97	0.01235	no	SKNS
chr1_1366896_G_GT_b38	ATAD3C	-3.324	0.000947	-0.102459	5	0.030822	no	SKNS
chr1_1367021_GGCGAGTATGGA_G_b38	ATAD3C	-3.293	0.00106	-0.1027	5	0.03119	no	SKNS
chr1_2291058_G_A_b38	ATAD3C	-3.278	0.00111	-0.040456	98	0.012342	no	SKNS
chr1_1572877_TG_T_b38	ATAD3C	-3.268	0.00115	-0.04691	31	0.014355	no	SKNS
chr1_2290536_C_CG_b38	ATAD3C	-3.249	0.00123	-0.040205	98	0.012374	no	SKNS
chr1_1252845_G_T_b38	ATAD3C	-3.179	0.00157	-0.074716	3	0.023506	no	SKNS
chr1_2293397_G_A_b38	ATAD3C	-3.127	0.00186	-0.03906	75	0.012491	no	SKNS
chr1_1231507_T_C_b38	ATAD3C	-3.084	0.00214	-0.048238	21	0.015639	no	SKNS
chr1_2331983_C_CCTGCGCCTCTCCCGCCG_b38	ATAD3C	3.064	0.0023	0.081709	11	0.026669	no	SKNS
chr1_1361685_C_T_b38	ATAD3C	-3.035	0.00252	-0.051455	33	0.016953	no	SKNS
chr1_2121549_TAGTTA_T_b38	ATAD3C	-2.989	0.00293	-0.0987	4	0.033026	no	SKNS
chr1_2292427_C_T_b38	ATAD3C	-2.96	0.00322	-0.036437	100	0.012311	no	SKNS
chr1_1585973_T_A_b38	ATAD3C	-2.85	0.00454	-0.053765	22	0.018866	no	SKNS
chr1_2436280_C_T_b38	ATAD3C	-2.842	0.00466	-0.063713	11	0.022421	no	SKNS
chr1_2304233_C_T_b38	ATAD3C	2.841	0.00467	0.045997	31	0.016192	no	SKNS
chr1_1173815_A_G_b38	ATAD3C	-2.795	0.00537	-0.055552	7	0.019874	no	SKNS
chr1_1546845_A_AAAC_b38	ATAD3C	-2.754	0.00609	-0.05256	17	0.019086	no	SKNS
chr1_1240684_G_GCCGCCCCCATTCACCCCGGCCGTGGTCCCTGCCGCAGCCCCCA_b38	ATAD3C	-2.738	0.00639	-0.06789	5	0.024795	no	SKNS
chr1_1530598_G_A_b38	ATAD3C	2.699	0.00718	0.113396	3	0.042015	no	SKNS
chr1_2121562_GGCTGTA_G_b38	ATAD3C	-2.644	0.00844	-0.08729	4	0.033018	no	SKNS
chr1_928128_G_T_b38	ATAD3C	-2.62	0.00905	-0.049243	19	0.018798	no	SKNS
chr1_2290637_G_A_b38	ATAD3C	2.616	0.00915	0.03218	138	0.012301	no	SKNS
chr1_2290195_G_C_b38	ATAD3C	2.596	0.00968	0.031684	139	0.012203	no	SKNS
chr1_2290197_A_T_b38	ATAD3C	2.596	0.00968	0.031684	139	0.012203	no	SKNS
chr1_1063661_ATGTG_A_b38	ATAD3C	2.588	0.00991	0.088524	4	0.034202	no	SKNS
chr1_1440430_C_G_b38	ATAD3C	-3.801	0.000219	-0.157377	10	0.04141	yes	SNTTRM
chr1_940296_G_GCCCCCCC_b38	ATAD3C	3.575	0.000488	0.243313	3	0.068055	yes	SNTTRM
chr1_971790_AG_A_b38	ATAD3C	3.529	0.000573	0.111228	24	0.031516	yes	SNTTRM
chr1_2106470_GTGGGCGAGGACCTCCACACGTGTCACCAGGCCAGGTAACTCTCAGCAAGCCCCTCTGGTGGGCGAGGACCTCCACACGTGTCACCAGGCCAGGTAACTCTCAGCAAGCCCCTCCA_G_b38	ATAD3C	3.308	0.00121	0.177173	3	0.053565	yes	SNTTRM
chr1_1431014_G_A_b38	ATAD3C	-3.199	0.00172	-0.124321	10	0.038864	yes	SNTTRM
chr1_1445187_T_G_b38	ATAD3C	-2.95	0.00376	-0.122173	19	0.041416	yes	SNTTRM
chr1_1725582_T_C_b38	ATAD3C	2.754	0.0067	0.074057	40	0.026887	yes	SNTTRM
chr1_1130879_G_C_b38	ATAD3C	-2.712	0.00758	-0.107722	6	0.039727	yes	SNTTRM
chr1_1020217_G_T_b38	ATAD3C	2.703	0.00778	0.086802	19	0.032118	yes	SNTTRM
chr1_1436388_CA_C_b38	ATAD3C	-2.664	0.00868	-0.112685	13	0.042303	yes	SNTTRM
chr1_822668_A_G_b38	ATAD3C	-2.643	0.00922	-0.127229	4	0.048146	yes	SNTTRM
chr1_1443457_T_C_b38	ATAD3C	-3.5	0.000633	-0.144877	21	0.041393	no	SNTTRM
chr1_1439454_A_G_b38	ATAD3C	-3.447	0.000758	-0.136996	19	0.03974	no	SNTTRM
chr1_1440834_C_G_b38	ATAD3C	-3.428	0.000809	-0.141053	20	0.041144	no	SNTTRM
chr1_1454315_C_T_b38	ATAD3C	-3.387	0.000929	-0.13983	18	0.041284	no	SNTTRM
chr1_1555179_A_G_b38	ATAD3C	-3.377	0.000962	-0.118939	21	0.035224	no	SNTTRM
chr1_1555871_T_C_b38	ATAD3C	-3.331	0.00112	-0.117167	23	0.035175	no	SNTTRM
chr1_1186850_GT_G_b38	ATAD3C	3.266	0.00139	0.149722	4	0.045842	no	SNTTRM
chr1_1451787_A_C_b38	ATAD3C	-3.265	0.00139	-0.126745	17	0.038814	no	SNTTRM
chr1_995508_ATTTTT_A_b38	ATAD3C	-3.261	0.00141	-0.106197	39	0.032566	no	SNTTRM
chr1_995187_A_G_b38	ATAD3C	3.254	0.00144	0.102138	26	0.031392	no	SNTTRM
chr1_999842_C_A_b38	ATAD3C	-3.244	0.00149	-0.10916	47	0.033654	no	SNTTRM
chr1_1441187_A_G_b38	ATAD3C	-3.224	0.00159	-0.132619	12	0.041129	no	SNTTRM
chr1_989068_GTTGA_G_b38	ATAD3C	-3.195	0.00175	-0.104485	40	0.032705	no	SNTTRM
chr1_995153_C_G_b38	ATAD3C	3.164	0.00193	0.100867	24	0.031884	no	SNTTRM
chr1_1442793_G_A_b38	ATAD3C	-3.162	0.00194	-0.148603	3	0.046996	no	SNTTRM
chr1_995371_C_G_b38	ATAD3C	3.129	0.00216	0.099067	22	0.031665	no	SNTTRM
chr1_992967_GGGAGGGTCCATGTGTCCGTCATCTGA_G_b38	ATAD3C	-3.111	0.00228	-0.104531	47	0.033599	no	SNTTRM
chr1_998410_G_A_b38	ATAD3C	-3.104	0.00233	-0.101676	41	0.032752	no	SNTTRM
chr1_1570568_AC_A_b38	ATAD3C	-3.103	0.00234	-0.116369	9	0.037498	no	SNTTRM
chr1_984121_G_T_b38	ATAD3C	-3.092	0.00242	-0.095494	49	0.030879	no	SNTTRM
chr1_995786_A_G_b38	ATAD3C	3.082	0.0025	0.096428	26	0.031286	no	SNTTRM
chr1_995512_T_C_b38	ATAD3C	3.08	0.00252	0.096871	26	0.031451	no	SNTTRM
chr1_995982_G_A_b38	ATAD3C	3.072	0.00258	0.096636	23	0.031461	no	SNTTRM
chr1_1445240_A_G_b38	ATAD3C	-3.059	0.00269	-0.126985	20	0.041511	no	SNTTRM
chr1_2304223_G_A_b38	ATAD3C	3.059	0.00269	0.150997	3	0.049361	no	SNTTRM
chr1_1554548_T_C_b38	ATAD3C	-3.043	0.00283	-0.108146	20	0.035543	no	SNTTRM
chr1_1554290_C_T_b38	ATAD3C	-3.033	0.00291	-0.106667	20	0.035171	no	SNTTRM
chr1_986336_C_A_b38	ATAD3C	-3.02	0.00304	-0.10495	42	0.034757	no	SNTTRM
chr1_1557495_CAT_C_b38	ATAD3C	-3.012	0.00311	-0.105491	29	0.035025	no	SNTTRM
chr1_1004716_C_T_b38	ATAD3C	-3.009	0.00314	-0.101895	41	0.033863	no	SNTTRM
chr1_1008588_C_T_b38	ATAD3C	-3.002	0.00321	-0.098848	45	0.032929	no	SNTTRM
chr1_1452511_A_G_b38	ATAD3C	-3	0.00323	-0.126277	20	0.042097	no	SNTTRM
chr1_1452888_C_A_b38	ATAD3C	-3	0.00323	-0.126277	20	0.042097	no	SNTTRM
chr1_1452909_A_C_b38	ATAD3C	-3	0.00323	-0.126277	20	0.042097	no	SNTTRM
chr1_1453703_A_G_b38	ATAD3C	-3	0.00323	-0.126277	20	0.042097	no	SNTTRM
chr1_1454092_A_G_b38	ATAD3C	-3	0.00323	-0.126277	20	0.042097	no	SNTTRM
chr1_1454770_T_C_b38	ATAD3C	-3	0.00323	-0.126277	20	0.042097	no	SNTTRM
chr1_1455617_T_G_b38	ATAD3C	-3	0.00323	-0.126277	20	0.042097	no	SNTTRM
chr1_1558347_G_A_b38	ATAD3C	-2.993	0.00329	-0.109346	20	0.036528	no	SNTTRM
chr1_1426261_C_T_b38	ATAD3C	-2.984	0.00339	-0.119989	23	0.040217	no	SNTTRM
chr1_1426810_C_G_b38	ATAD3C	-2.984	0.00339	-0.119989	23	0.040217	no	SNTTRM
chr1_1436079_A_G_b38	ATAD3C	-2.978	0.00345	-0.114462	25	0.038435	no	SNTTRM
chr1_1189370_T_C_b38	ATAD3C	-2.959	0.00365	-0.134924	3	0.045594	no	SNTTRM
chr1_1223251_A_G_b38	ATAD3C	-2.95	0.00375	-0.131967	4	0.044731	no	SNTTRM
chr1_1510082_T_TA_b38	ATAD3C	2.929	0.004	0.150039	3	0.051223	no	SNTTRM
chr1_1000731_C_T_b38	ATAD3C	-2.929	0.00401	-0.093138	43	0.031802	no	SNTTRM
chr1_1433374_T_C_b38	ATAD3C	-2.906	0.00429	-0.111767	25	0.038464	no	SNTTRM
chr1_1542773_T_C_b38	ATAD3C	-2.902	0.00434	-0.103921	29	0.03581	no	SNTTRM
chr1_1542793_C_G_b38	ATAD3C	-2.902	0.00434	-0.103921	29	0.03581	no	SNTTRM
chr1_1542800_T_C_b38	ATAD3C	-2.902	0.00434	-0.103921	29	0.03581	no	SNTTRM
chr1_1005429_C_CA_b38	ATAD3C	2.897	0.00441	0.092627	23	0.031973	no	SNTTRM
chr1_1005904_C_T_b38	ATAD3C	2.897	0.00441	0.092627	23	0.031973	no	SNTTRM
chr1_1005954_G_A_b38	ATAD3C	2.897	0.00441	0.092627	23	0.031973	no	SNTTRM
chr1_1430908_A_G_b38	ATAD3C	-2.895	0.00444	-0.11479	24	0.039655	no	SNTTRM
chr1_1570294_CA_C_b38	ATAD3C	-2.879	0.00465	-0.102621	25	0.035648	no	SNTTRM
chr1_2304233_C_T_b38	ATAD3C	2.871	0.00476	0.134344	9	0.046787	no	SNTTRM
chr1_1439805_G_C_b38	ATAD3C	-2.834	0.00532	-0.114221	8	0.040309	no	SNTTRM
chr1_1547630_G_A_b38	ATAD3C	-2.833	0.00533	-0.094609	27	0.033393	no	SNTTRM
chr1_1549590_C_G_b38	ATAD3C	-2.832	0.00535	-0.098428	30	0.034762	no	SNTTRM
chr1_1553692_A_G_b38	ATAD3C	-2.832	0.00535	-0.098428	30	0.034762	no	SNTTRM
chr1_1554694_A_G_b38	ATAD3C	-2.832	0.00535	-0.098428	30	0.034762	no	SNTTRM
chr1_1554781_A_G_b38	ATAD3C	-2.832	0.00535	-0.098428	30	0.034762	no	SNTTRM
chr1_1554852_T_C_b38	ATAD3C	-2.832	0.00535	-0.098428	30	0.034762	no	SNTTRM
chr1_1555247_T_A_b38	ATAD3C	-2.832	0.00535	-0.098428	30	0.034762	no	SNTTRM
chr1_1559750_C_CAG_b38	ATAD3C	-2.832	0.00535	-0.098428	30	0.034762	no	SNTTRM
chr1_1561628_T_C_b38	ATAD3C	-2.832	0.00535	-0.098428	30	0.034762	no	SNTTRM
chr1_1563918_A_G_b38	ATAD3C	-2.832	0.00535	-0.098428	30	0.034762	no	SNTTRM
chr1_1565105_CAAGGCAGGCGGATCATG_C_b38	ATAD3C	-2.832	0.00535	-0.098428	30	0.034762	no	SNTTRM
chr1_1565561_A_G_b38	ATAD3C	-2.832	0.00535	-0.098428	30	0.034762	no	SNTTRM
chr1_1566086_G_A_b38	ATAD3C	-2.832	0.00535	-0.098428	30	0.034762	no	SNTTRM
chr1_1567715_G_A_b38	ATAD3C	-2.832	0.00535	-0.098428	30	0.034762	no	SNTTRM
chr1_1567719_A_C_b38	ATAD3C	-2.832	0.00535	-0.098428	30	0.034762	no	SNTTRM
chr1_1569875_C_T_b38	ATAD3C	-2.832	0.00535	-0.098428	30	0.034762	no	SNTTRM
chr1_1572532_A_C_b38	ATAD3C	-2.832	0.00535	-0.098428	30	0.034762	no	SNTTRM
chr1_1545968_T_C_b38	ATAD3C	-2.82	0.00554	-0.103123	9	0.036567	no	SNTTRM
chr1_1541864_T_C_b38	ATAD3C	-2.815	0.00561	-0.100456	29	0.035681	no	SNTTRM
chr1_1543500_T_G_b38	ATAD3C	-2.815	0.00561	-0.100456	29	0.035681	no	SNTTRM
chr1_1543953_A_G_b38	ATAD3C	-2.815	0.00561	-0.100456	29	0.035681	no	SNTTRM
chr1_1551557_A_AG_b38	ATAD3C	-2.815	0.00561	-0.100456	29	0.035681	no	SNTTRM
chr1_1551559_A_T_b38	ATAD3C	-2.815	0.00561	-0.100456	29	0.035681	no	SNTTRM
chr1_1558726_C_CA_b38	ATAD3C	-2.815	0.00561	-0.100456	29	0.035681	no	SNTTRM
chr1_1561821_A_C_b38	ATAD3C	-2.815	0.00561	-0.100456	29	0.035681	no	SNTTRM
chr1_1568428_C_G_b38	ATAD3C	-2.811	0.00568	-0.102846	9	0.036582	no	SNTTRM
chr1_1537493_T_A_b38	ATAD3C	-2.806	0.00577	-0.096662	27	0.03445	no	SNTTRM
chr1_1022868_A_G_b38	ATAD3C	2.796	0.00593	0.092044	21	0.032915	no	SNTTRM
chr1_1551523_T_C_b38	ATAD3C	-2.795	0.00597	-0.104763	9	0.037489	no	SNTTRM
chr1_1573079_A_G_b38	ATAD3C	-2.786	0.00611	-0.09672	30	0.034712	no	SNTTRM
chr1_1550064_GC_G_b38	ATAD3C	-2.778	0.00626	-0.098948	29	0.035621	no	SNTTRM
chr1_1550068_C_A_b38	ATAD3C	-2.778	0.00626	-0.098948	29	0.035621	no	SNTTRM
chr1_1004625_A_G_b38	ATAD3C	2.775	0.00631	0.089008	27	0.03207	no	SNTTRM
chr1_1006159_C_T_b38	ATAD3C	2.775	0.00631	0.089008	27	0.03207	no	SNTTRM
chr1_1008307_G_C_b38	ATAD3C	2.771	0.0064	0.086317	24	0.031154	no	SNTTRM
chr1_1009184_T_C_b38	ATAD3C	2.771	0.0064	0.086317	24	0.031154	no	SNTTRM
chr1_1015903_C_T_b38	ATAD3C	-2.768	0.00644	-0.091682	41	0.03312	no	SNTTRM
chr1_1538787_A_G_b38	ATAD3C	-2.766	0.00648	-0.096428	30	0.034858	no	SNTTRM
chr1_1005757_AGCCCCCGCAGCAGT_A_b38	ATAD3C	-2.765	0.0065	-0.091061	39	0.032935	no	SNTTRM
chr1_1571794_A_AT_b38	ATAD3C	-2.76	0.00659	-0.099295	26	0.035972	no	SNTTRM
chr1_1573429_CAAAAAAAAAAAAAAAAAA_C_b38	ATAD3C	-2.76	0.0066	-0.093381	27	0.033834	no	SNTTRM
chr1_1019397_C_A_b38	ATAD3C	-2.752	0.00675	-0.091714	46	0.033325	no	SNTTRM
chr1_1018572_G_A_b38	ATAD3C	-2.74	0.007	-0.092786	46	0.033869	no	SNTTRM
chr1_1398056_C_A_b38	ATAD3C	-2.731	0.00717	-0.086678	32	0.031738	no	SNTTRM
chr1_1428969_T_C_b38	ATAD3C	-2.715	0.0075	-0.108683	24	0.040028	no	SNTTRM
chr1_1020681_A_AG_b38	ATAD3C	2.69	0.00806	0.086389	18	0.032115	no	SNTTRM
chr1_1565680_A_AG_b38	ATAD3C	-2.675	0.00841	-0.092893	28	0.034726	no	SNTTRM
chr1_992993_A_G_b38	ATAD3C	2.667	0.00861	0.082912	34	0.03109	no	SNTTRM
chr1_1549967_C_G_b38	ATAD3C	-2.665	0.00865	-0.095045	16	0.035664	no	SNTTRM
chr1_1539491_G_C_b38	ATAD3C	-2.663	0.0087	-0.092637	30	0.034785	no	SNTTRM
chr1_989148_C_A_b38	ATAD3C	-2.66	0.00878	-0.090239	43	0.033929	no	SNTTRM
chr1_1569661_T_C_b38	ATAD3C	-2.656	0.00889	-0.091665	28	0.034518	no	SNTTRM
chr1_1020697_C_T_b38	ATAD3C	2.655	0.0089	0.085279	18	0.032119	no	SNTTRM
chr1_1575935_T_C_b38	ATAD3C	-2.65	0.00902	-0.095599	27	0.03607	no	SNTTRM
chr1_1554246_C_T_b38	ATAD3C	-2.645	0.00914	-0.098584	15	0.037265	no	SNTTRM
chr1_1023573_A_G_b38	ATAD3C	2.636	0.00939	0.084019	22	0.031873	no	SNTTRM
chr1_1571434_C_CA_b38	ATAD3C	-2.636	0.0094	-0.097541	20	0.037009	no	SNTTRM
chr1_1572877_TG_T_b38	ATAD3C	-2.622	0.00976	-0.094831	8	0.036166	no	SNTTRM
chr1_1430190_A_C_b38	ATAD3C	-2.622	0.00976	-0.105438	24	0.040212	no	SNTTRM
chr1_1553619_CAAAAAAA_C_b38	ATAD3C	-2.614	0.00998	-0.095805	12	0.036648	no	SNTTRM
chr1_1023525_A_G_b38	ATAD3C	2.614	0.00999	0.082927	22	0.031728	no	SNTTRM
chr1_1510082_T_TA_b38	ATAD3C	6.033	8.5e-09	0.203603	6	0.033746	yes	SPLEEN
chr1_1483898_G_A_b38	ATAD3C	5.495	1.28e-07	0.183383	21	0.033374	yes	SPLEEN
chr1_1486151_C_A_b38	ATAD3C	5.495	1.28e-07	0.183383	21	0.033374	yes	SPLEEN
chr1_1487887_A_G_b38	ATAD3C	4.941	1.72e-06	0.161145	21	0.032612	yes	SPLEEN
chr1_1473089_T_C_b38	ATAD3C	4.872	2.36e-06	0.160902	22	0.033026	yes	SPLEEN
chr1_1482624_T_C_b38	ATAD3C	4.872	2.36e-06	0.160902	22	0.033026	yes	SPLEEN
chr1_1488652_A_G_b38	ATAD3C	4.872	2.36e-06	0.160902	22	0.033026	yes	SPLEEN
chr1_1490320_T_C_b38	ATAD3C	4.872	2.36e-06	0.160902	22	0.033026	yes	SPLEEN
chr1_1492292_C_G_b38	ATAD3C	4.872	2.36e-06	0.160902	22	0.033026	yes	SPLEEN
chr1_1492850_G_A_b38	ATAD3C	4.872	2.36e-06	0.160902	22	0.033026	yes	SPLEEN
chr1_1490027_A_G_b38	ATAD3C	4.839	2.73e-06	0.160977	19	0.033267	yes	SPLEEN
chr1_1490032_A_G_b38	ATAD3C	4.839	2.73e-06	0.160977	19	0.033267	yes	SPLEEN
chr1_1482402_A_G_b38	ATAD3C	4.777	3.6e-06	0.152594	30	0.031943	yes	SPLEEN
chr1_1489916_C_T_b38	ATAD3C	4.757	3.93e-06	0.153515	11	0.032272	yes	SPLEEN
chr1_1492619_A_AC_b38	ATAD3C	4.676	5.6e-06	0.151137	23	0.032319	yes	SPLEEN
chr1_1474201_CT_C_b38	ATAD3C	4.634	6.72e-06	0.144146	20	0.031103	yes	SPLEEN
chr1_1495204_T_C_b38	ATAD3C	4.573	8.76e-06	0.150564	17	0.032926	yes	SPLEEN
chr1_2342840_A_ATATTTTATTTTATTT_b38	ATAD3C	4.56	9.26e-06	0.181463	5	0.039796	yes	SPLEEN
chr1_1476266_T_C_b38	ATAD3C	4.528	1.06e-05	0.14615	23	0.032277	yes	SPLEEN
chr1_1468062_A_T_b38	ATAD3C	4.214	3.91e-05	0.175379	7	0.041621	yes	SPLEEN
chr1_1511945_G_A_b38	ATAD3C	4.135	5.36e-05	0.123736	25	0.029922	yes	SPLEEN
chr1_1512376_G_C_b38	ATAD3C	4.132	5.43e-05	0.121436	25	0.029387	yes	SPLEEN
chr1_1496953_T_C_b38	ATAD3C	4.11	5.94e-05	0.133596	20	0.032509	yes	SPLEEN
chr1_586069_T_A_b38	ATAD3C	4.05	7.51e-05	0.143549	6	0.035443	yes	SPLEEN
chr1_1495205_G_A_b38	ATAD3C	4.026	8.25e-05	0.174123	6	0.043249	yes	SPLEEN
chr1_1501403_T_C_b38	ATAD3C	4.023	8.36e-05	0.119679	27	0.029752	yes	SPLEEN
chr1_1476515_AT_A_b38	ATAD3C	4.004	8.99e-05	0.12463	4	0.031127	yes	SPLEEN
chr1_1495221_G_A_b38	ATAD3C	3.913	0.000128	0.160069	8	0.040906	yes	SPLEEN
chr1_1495222_T_G_b38	ATAD3C	3.913	0.000128	0.160069	8	0.040906	yes	SPLEEN
chr1_1479683_T_G_b38	ATAD3C	3.829	0.000176	0.150792	17	0.039381	yes	SPLEEN
chr1_1480096_G_C_b38	ATAD3C	3.829	0.000176	0.150792	17	0.039381	yes	SPLEEN
chr1_1461195_T_TC_b38	ATAD3C	3.809	0.00019	0.155442	8	0.040814	yes	SPLEEN
chr1_1469469_G_C_b38	ATAD3C	3.808	0.00019	0.166285	5	0.043665	yes	SPLEEN
chr1_1468048_A_G_b38	ATAD3C	3.777	0.000213	0.12721	15	0.033676	yes	SPLEEN
chr1_1481959_C_T_b38	ATAD3C	3.701	0.000283	0.128357	13	0.034683	yes	SPLEEN
chr1_1476079_T_C_b38	ATAD3C	3.696	0.000289	0.125264	20	0.033896	yes	SPLEEN
chr1_878665_C_T_b38	ATAD3C	3.69	0.000294	0.11972	3	0.032445	yes	SPLEEN
chr1_1468856_C_T_b38	ATAD3C	3.675	0.000311	0.125908	13	0.034264	yes	SPLEEN
chr1_833068_G_A_b38	ATAD3C	3.653	0.000337	0.117216	3	0.032086	yes	SPLEEN
chr1_1486611_G_A_b38	ATAD3C	3.582	0.000435	0.125422	12	0.035014	yes	SPLEEN
chr1_1490046_G_A_b38	ATAD3C	3.567	0.000459	0.128315	3	0.03597	yes	SPLEEN
chr1_1490047_A_G_b38	ATAD3C	3.567	0.000459	0.128315	3	0.03597	yes	SPLEEN
chr1_2389263_T_C_b38	ATAD3C	3.519	0.000545	0.095734	9	0.027208	yes	SPLEEN
chr1_1468094_G_C_b38	ATAD3C	3.498	0.000587	0.122026	11	0.034889	yes	SPLEEN
chr1_1468592_C_CG_b38	ATAD3C	3.495	0.000592	0.120676	13	0.034525	yes	SPLEEN
chr1_591638_G_A_b38	ATAD3C	3.493	0.000597	0.100317	6	0.02872	yes	SPLEEN
chr1_870176_T_A_b38	ATAD3C	3.422	0.000764	0.118783	3	0.03471	yes	SPLEEN
chr1_1523022_A_G_b38	ATAD3C	3.421	0.000766	0.114621	15	0.033503	yes	SPLEEN
chr1_2391602_T_C_b38	ATAD3C	3.395	0.000839	0.079604	14	0.023448	yes	SPLEEN
chr1_1469429_A_G_b38	ATAD3C	3.395	0.00084	0.119545	22	0.035215	yes	SPLEEN
chr1_1516000_T_C_b38	ATAD3C	3.331	0.00104	0.09529	29	0.028608	yes	SPLEEN
chr1_1530331_T_C_b38	ATAD3C	3.3	0.00116	0.093368	29	0.02829	yes	SPLEEN
chr1_1513923_G_C_b38	ATAD3C	3.289	0.0012	0.093318	29	0.028371	yes	SPLEEN
chr1_1470034_T_C_b38	ATAD3C	3.247	0.00138	0.115973	22	0.035718	yes	SPLEEN
chr1_1471144_G_C_b38	ATAD3C	3.247	0.00138	0.115973	22	0.035718	yes	SPLEEN
chr1_1533754_T_C_b38	ATAD3C	3.235	0.00144	0.08984	25	0.02777	yes	SPLEEN
chr1_1002192_A_AT_b38	ATAD3C	3.224	0.00149	0.108455	3	0.033642	yes	SPLEEN
chr1_2379954_A_G_b38	ATAD3C	3.198	0.00162	0.076184	13	0.023819	yes	SPLEEN
chr1_1480990_T_C_b38	ATAD3C	3.152	0.00189	0.100914	21	0.032012	yes	SPLEEN
chr1_1479334_A_G_b38	ATAD3C	3.145	0.00193	0.117547	20	0.037371	yes	SPLEEN
chr1_1461621_T_TCTCCTCATGAGACCCCCATGTCGGAATTCGAAGGAGAGG_b38	ATAD3C	3.124	0.00207	0.114313	9	0.036593	yes	SPLEEN
chr1_885945_ACAGT_A_b38	ATAD3C	3.083	0.00236	0.075892	22	0.024615	yes	SPLEEN
chr1_1501260_A_AT_b38	ATAD3C	3.057	0.00256	0.09338	14	0.030546	yes	SPLEEN
chr1_1469088_T_C_b38	ATAD3C	3.052	0.0026	0.102283	20	0.033509	yes	SPLEEN
chr1_1516110_G_A_b38	ATAD3C	3.052	0.0026	0.13392	5	0.043878	yes	SPLEEN
chr1_1516109_T_C_b38	ATAD3C	3.05	0.00263	0.127503	5	0.041811	yes	SPLEEN
chr1_1518285_T_C_b38	ATAD3C	2.931	0.00381	0.085461	34	0.029162	yes	SPLEEN
chr1_1518541_T_C_b38	ATAD3C	2.913	0.00402	0.080384	24	0.027595	yes	SPLEEN
chr1_1533841_T_C_b38	ATAD3C	2.902	0.00416	0.081782	19	0.028185	yes	SPLEEN
chr1_863020_A_G_b38	ATAD3C	2.879	0.00445	0.073477	20	0.025519	yes	SPLEEN
chr1_863579_G_A_b38	ATAD3C	2.879	0.00445	0.073477	20	0.025519	yes	SPLEEN
chr1_1421814_G_A_b38	ATAD3C	2.862	0.0047	0.111552	11	0.038983	yes	SPLEEN
chr1_591650_C_T_b38	ATAD3C	2.772	0.00614	0.077607	6	0.027996	yes	SPLEEN
chr1_1909237_G_T_b38	ATAD3C	2.768	0.00621	0.066555	14	0.024044	yes	SPLEEN
chr1_1861110_C_CAA_b38	ATAD3C	2.72	0.00715	0.073845	13	0.027152	yes	SPLEEN
chr1_1746439_GA_G_b38	ATAD3C	2.719	0.00717	0.070859	26	0.026063	yes	SPLEEN
chr1_1479205_A_C_b38	ATAD3C	2.704	0.00749	0.091788	10	0.033946	yes	SPLEEN
chr1_1531133_G_A_b38	ATAD3C	2.688	0.00785	0.114253	7	0.04251	yes	SPLEEN
chr1_1367498_T_C_b38	ATAD3C	2.67	0.00826	0.124712	3	0.046708	yes	SPLEEN
chr1_1331045_G_A_b38	ATAD3C	2.664	0.0084	0.125088	3	0.046955	yes	SPLEEN
chr1_1848356_GC_G_b38	ATAD3C	2.641	0.00897	0.07459	6	0.028244	yes	SPLEEN
chr1_1375788_G_C_b38	ATAD3C	2.633	0.00917	0.127088	3	0.048266	yes	SPLEEN
chr1_1381507_G_A_b38	ATAD3C	2.633	0.00917	0.127088	3	0.048266	yes	SPLEEN
chr1_1382885_A_G_b38	ATAD3C	2.633	0.00917	0.127088	3	0.048266	yes	SPLEEN
chr1_1042813_G_A_b38	ATAD3C	2.625	0.0094	0.079061	5	0.030123	yes	SPLEEN
chr1_1848358_A_T_b38	ATAD3C	2.611	0.00975	0.073764	6	0.028247	yes	SPLEEN
chr1_690136_A_G_b38	ATAD3C	5.029	1.15e-06	0.254259	3	0.050556	no	SPLEEN
chr1_1468254_T_A_b38	ATAD3C	4.057	7.3e-05	0.174813	5	0.043086	no	SPLEEN
chr1_1485282_A_G_b38	ATAD3C	3.925	0.000122	0.192329	5	0.048998	no	SPLEEN
chr1_940296_G_GCCCCCCC_b38	ATAD3C	3.82	0.000182	0.159198	4	0.04168	no	SPLEEN
chr1_1028979_GCCACGCCACCCTCTCCCAAGGAACCGAGCCCCAGCCCCTCGTGGGCCAAGGGCGCCCACAC_G_b38	ATAD3C	3.783	0.000209	0.138236	3	0.036541	no	SPLEEN
chr1_633678_C_T_b38	ATAD3C	3.741	0.000244	0.12968	3	0.034662	no	SPLEEN
chr1_872909_A_T_b38	ATAD3C	3.679	0.000306	0.125008	4	0.033978	no	SPLEEN
chr1_633553_A_G_b38	ATAD3C	3.556	0.000478	0.104458	4	0.029377	no	SPLEEN
chr1_633574_A_G_b38	ATAD3C	3.478	0.000629	0.101439	4	0.029166	no	SPLEEN
chr1_633588_T_C_b38	ATAD3C	3.478	0.000629	0.101439	4	0.029166	no	SPLEEN
chr1_633182_A_G_b38	ATAD3C	3.417	0.000777	0.094828	7	0.02775	no	SPLEEN
chr1_633420_G_A_b38	ATAD3C	3.36	0.000944	0.095477	6	0.028412	no	SPLEEN
chr1_633443_C_T_b38	ATAD3C	3.32	0.00108	0.095599	5	0.028792	no	SPLEEN
chr1_633444_C_T_b38	ATAD3C	3.32	0.00108	0.095599	5	0.028792	no	SPLEEN
chr1_865003_C_T_b38	ATAD3C	-3.271	0.00128	-0.103161	5	0.031535	no	SPLEEN
chr1_599294_T_G_b38	ATAD3C	3.237	0.00143	0.138739	4	0.042866	no	SPLEEN
chr1_633375_G_A_b38	ATAD3C	3.233	0.00145	0.089666	7	0.027734	no	SPLEEN
chr1_633209_T_C_b38	ATAD3C	3.209	0.00157	0.089794	7	0.027982	no	SPLEEN
chr1_633230_C_T_b38	ATAD3C	3.209	0.00157	0.089794	7	0.027982	no	SPLEEN
chr1_633098_C_T_b38	ATAD3C	3.206	0.00158	0.089189	7	0.027816	no	SPLEEN
chr1_633264_T_C_b38	ATAD3C	3.159	0.00185	0.088007	7	0.027855	no	SPLEEN
chr1_633290_T_C_b38	ATAD3C	3.159	0.00185	0.088007	7	0.027855	no	SPLEEN
chr1_633293_A_G_b38	ATAD3C	3.159	0.00185	0.088007	7	0.027855	no	SPLEEN
chr1_633561_A_G_b38	ATAD3C	3.152	0.00189	0.093151	4	0.029553	no	SPLEEN
chr1_633251_C_T_b38	ATAD3C	3.151	0.0019	0.087931	7	0.027907	no	SPLEEN
chr1_633032_T_C_b38	ATAD3C	3.096	0.00226	0.086359	7	0.02789	no	SPLEEN
chr1_633071_C_T_b38	ATAD3C	3.096	0.00226	0.086359	7	0.02789	no	SPLEEN
chr1_689819_C_T_b38	ATAD3C	3.085	0.00235	0.112861	3	0.036583	no	SPLEEN
chr1_632781_C_T_b38	ATAD3C	3.081	0.00237	0.090192	3	0.02927	no	SPLEEN
chr1_633636_C_T_b38	ATAD3C	2.997	0.00309	0.087255	7	0.029109	no	SPLEEN
chr1_633329_A_G_b38	ATAD3C	2.982	0.00324	0.085608	7	0.028704	no	SPLEEN
chr1_1726649_G_A_b38	ATAD3C	2.951	0.00358	0.136607	5	0.046292	no	SPLEEN
chr1_874496_A_G_b38	ATAD3C	2.885	0.00438	0.096127	3	0.033324	no	SPLEEN
chr1_1756389_C_T_b38	ATAD3C	2.857	0.00477	0.147801	3	0.051741	no	SPLEEN
chr1_632730_A_G_b38	ATAD3C	2.854	0.0048	0.08713	3	0.030525	no	SPLEEN
chr1_632535_A_G_b38	ATAD3C	2.847	0.0049	0.097306	3	0.034173	no	SPLEEN
chr1_1747690_A_G_b38	ATAD3C	2.815	0.0054	0.123458	6	0.043853	no	SPLEEN
chr1_669882_G_A_b38	ATAD3C	2.802	0.00561	0.086364	6	0.030819	no	SPLEEN
chr1_858952_G_A_b38	ATAD3C	2.801	0.00563	0.092226	3	0.032926	no	SPLEEN
chr1_1461767_A_G_b38	ATAD3C	2.789	0.00584	0.123987	6	0.044461	no	SPLEEN
chr1_2075289_T_C_b38	ATAD3C	-2.73	0.00695	-0.062229	29	0.022797	no	SPLEEN
chr1_1533653_C_T_b38	ATAD3C	2.706	0.00744	0.123458	4	0.045624	no	SPLEEN
chr1_1741174_TTCA_T_b38	ATAD3C	2.696	0.00767	0.135131	3	0.050127	no	SPLEEN
chr1_1741497_G_A_b38	ATAD3C	2.696	0.00767	0.135131	3	0.050127	no	SPLEEN
chr1_1130879_G_C_b38	ATAD3C	-2.684	0.00794	-0.078113	7	0.029105	no	SPLEEN
chr1_2325642_ATT_A_b38	ATAD3C	-2.653	0.00866	-0.075192	7	0.028341	no	SPLEEN
chr1_1731093_G_C_b38	ATAD3C	2.607	0.00987	0.128628	3	0.049336	no	SPLEEN
chr1_1735087_A_C_b38	ATAD3C	2.607	0.00987	0.128628	3	0.049336	no	SPLEEN
chr1_1735286_G_A_b38	ATAD3C	2.607	0.00987	0.128628	3	0.049336	no	SPLEEN
chr1_862646_C_T_b38	ATAD3C	-2.603	0.00998	-0.083604	5	0.032117	no	SPLEEN
chr1_1440834_C_G_b38	ATAD3C	-5.802	1.84e-08	-0.133508	35	0.023009	yes	STMACH
chr1_1440430_C_G_b38	ATAD3C	-5.578	5.95e-08	-0.129314	22	0.023184	yes	STMACH
chr1_1443457_T_C_b38	ATAD3C	-5.564	6.4e-08	-0.130228	37	0.023407	yes	STMACH
chr1_1439454_A_G_b38	ATAD3C	-5.543	7.12e-08	-0.124599	33	0.02248	yes	STMACH
chr1_1435945_C_CCGGGCGGGGGCG_b38	ATAD3C	-4.892	1.72e-06	-0.132211	8	0.027024	yes	STMACH
chr1_1445240_A_G_b38	ATAD3C	-4.89	1.74e-06	-0.114695	37	0.023455	yes	STMACH
chr1_1433374_T_C_b38	ATAD3C	-4.877	1.85e-06	-0.109701	40	0.022492	yes	STMACH
chr1_1436079_A_G_b38	ATAD3C	-4.805	2.58e-06	-0.106979	40	0.022262	yes	STMACH
chr1_1445187_T_G_b38	ATAD3C	-4.799	2.66e-06	-0.113978	36	0.023752	yes	STMACH
chr1_1449831_A_G_b38	ATAD3C	-4.754	3.26e-06	-0.117702	35	0.024761	yes	STMACH
chr1_1441187_A_G_b38	ATAD3C	-4.696	4.24e-06	-0.112304	24	0.023916	yes	STMACH
chr1_1436388_CA_C_b38	ATAD3C	-4.648	5.26e-06	-0.109676	25	0.023595	yes	STMACH
chr1_1519934_T_G_b38	ATAD3C	-4.283	2.57e-05	-0.094299	50	0.022017	yes	STMACH
chr1_1519938_T_C_b38	ATAD3C	-4.283	2.57e-05	-0.094299	50	0.022017	yes	STMACH
chr1_1448915_G_A_b38	ATAD3C	-4.228	3.24e-05	-0.101674	26	0.024048	yes	STMACH
chr1_1432355_G_A_b38	ATAD3C	-4.158	4.32e-05	-0.101753	15	0.02447	yes	STMACH
chr1_1430190_A_C_b38	ATAD3C	-4.13	4.85e-05	-0.096253	38	0.023304	yes	STMACH
chr1_2181237_A_G_b38	ATAD3C	4.087	5.77e-05	0.078303	81	0.019157	yes	STMACH
chr1_1517993_A_G_b38	ATAD3C	-4.023	7.49e-05	-0.088956	50	0.022113	yes	STMACH
chr1_1439805_G_C_b38	ATAD3C	-3.98	8.86e-05	-0.102642	13	0.025786	yes	STMACH
chr1_1431026_CCACCCCCT_C_b38	ATAD3C	-3.541	0.00047	-0.091434	16	0.025822	yes	STMACH
chr1_1426253_G_A_b38	ATAD3C	-3.451	0.00065	-0.096509	5	0.027969	yes	STMACH
chr1_1471992_T_C_b38	ATAD3C	-3.304	0.00108	-0.079378	41	0.024022	yes	STMACH
chr1_2181022_T_C_b38	ATAD3C	3.141	0.00187	0.059482	76	0.018935	yes	STMACH
chr1_1437993_G_A_b38	ATAD3C	-3.091	0.00221	-0.077239	11	0.024992	yes	STMACH
chr1_1363438_C_CTT_b38	ATAD3C	3.083	0.00227	0.068256	24	0.022142	yes	STMACH
chr1_1524664_A_G_b38	ATAD3C	-2.958	0.00338	-0.075285	35	0.025453	yes	STMACH
chr1_2112615_A_C_b38	ATAD3C	-2.923	0.00376	-0.057139	45	0.019549	yes	STMACH
chr1_1157306_CCCGCCCCCAGCCCACCCATCCCATCCCCGCCCACCCATCCCATCCCCG_C_b38	ATAD3C	2.835	0.00493	0.13519	3	0.047688	yes	STMACH
chr1_2346676_G_C_b38	ATAD3C	2.772	0.00597	0.069003	9	0.024897	yes	STMACH
chr1_588011_C_T_b38	ATAD3C	2.765	0.00609	0.066704	16	0.024125	yes	STMACH
chr1_601293_G_A_b38	ATAD3C	2.746	0.00645	0.072699	7	0.026478	yes	STMACH
chr1_2353047_C_T_b38	ATAD3C	2.737	0.00661	0.068342	9	0.024966	yes	STMACH
chr1_2137041_C_T_b38	ATAD3C	-2.731	0.00673	-0.052504	49	0.019223	yes	STMACH
chr1_2350287_A_C_b38	ATAD3C	2.73	0.00675	0.06794	9	0.024886	yes	STMACH
chr1_2047887_T_C_b38	ATAD3C	-2.722	0.00692	-0.04977	49	0.018287	yes	STMACH
chr1_2107454_G_A_b38	ATAD3C	-2.709	0.00717	-0.053277	62	0.019664	yes	STMACH
chr1_2201613_G_T_b38	ATAD3C	2.709	0.00718	0.05211	67	0.019236	yes	STMACH
chr1_2344932_C_A_b38	ATAD3C	2.705	0.00727	0.067951	9	0.02512	yes	STMACH
chr1_2133900_A_G_b38	ATAD3C	-2.696	0.00747	-0.051797	49	0.019216	yes	STMACH
chr1_2133904_G_C_b38	ATAD3C	-2.696	0.00747	-0.051797	49	0.019216	yes	STMACH
chr1_2205929_T_C_b38	ATAD3C	2.695	0.00749	0.051921	69	0.019268	yes	STMACH
chr1_2207240_A_G_b38	ATAD3C	2.695	0.00749	0.051921	69	0.019268	yes	STMACH
chr1_2369713_ATAAT_A_b38	ATAD3C	2.693	0.00753	0.064319	13	0.023884	yes	STMACH
chr1_1367462_T_C_b38	ATAD3C	-2.691	0.00757	-0.085591	5	0.031806	yes	STMACH
chr1_2179591_T_C_b38	ATAD3C	2.676	0.0079	0.051507	68	0.019246	yes	STMACH
chr1_2341705_A_G_b38	ATAD3C	-2.661	0.00825	-0.049493	72	0.018596	yes	STMACH
chr1_1363456_CAG_C_b38	ATAD3C	2.658	0.00832	0.065786	17	0.024747	yes	STMACH
chr1_1500745_A_C_b38	ATAD3C	-2.657	0.00836	-0.088257	29	0.03322	yes	STMACH
chr1_858567_A_G_b38	ATAD3C	-2.651	0.0085	-0.074637	9	0.028154	yes	STMACH
chr1_2051721_C_A_b38	ATAD3C	2.643	0.00869	0.051894	29	0.019631	yes	STMACH
chr1_2312125_G_A_b38	ATAD3C	2.643	0.00869	0.05118	80	0.019362	yes	STMACH
chr1_2181138_C_A_b38	ATAD3C	2.604	0.00973	0.050496	50	0.019393	yes	STMACH
chr1_1434687_C_G_b38	ATAD3C	-5.172	4.54e-07	-0.13865	7	0.026808	no	STMACH
chr1_1438102_G_C_b38	ATAD3C	-4.794	2.72e-06	-0.119752	13	0.024982	no	STMACH
chr1_1431014_G_A_b38	ATAD3C	-4.295	2.44e-05	-0.094702	20	0.022049	no	STMACH
chr1_1431656_G_A_b38	ATAD3C	-4.154	4.4e-05	-0.115683	5	0.027848	no	STMACH
chr1_1431537_G_C_b38	ATAD3C	-4.069	6.23e-05	-0.094252	38	0.023166	no	STMACH
chr1_1430908_A_G_b38	ATAD3C	-4.061	6.42e-05	-0.094789	38	0.023341	no	STMACH
chr1_1428969_T_C_b38	ATAD3C	-4.028	7.33e-05	-0.093728	38	0.023269	no	STMACH
chr1_1431450_A_G_b38	ATAD3C	-3.965	9.42e-05	-0.092178	38	0.023248	no	STMACH
chr1_1426261_C_T_b38	ATAD3C	-3.872	0.000136	-0.090438	38	0.023356	no	STMACH
chr1_1426810_C_G_b38	ATAD3C	-3.872	0.000136	-0.090438	38	0.023356	no	STMACH
chr1_1454770_T_C_b38	ATAD3C	-3.855	0.000145	-0.094042	33	0.024397	no	STMACH
chr1_1455617_T_G_b38	ATAD3C	-3.855	0.000145	-0.094042	33	0.024397	no	STMACH
chr1_1449009_A_T_b38	ATAD3C	-3.841	0.000153	-0.096434	26	0.025105	no	STMACH
chr1_1454315_C_T_b38	ATAD3C	-3.841	0.000153	-0.092938	31	0.024198	no	STMACH
chr1_1428999_C_CA_b38	ATAD3C	-3.79	0.000186	-0.082612	21	0.0218	no	STMACH
chr1_1452511_A_G_b38	ATAD3C	-3.779	0.000194	-0.092547	33	0.024489	no	STMACH
chr1_1452888_C_A_b38	ATAD3C	-3.779	0.000194	-0.092547	33	0.024489	no	STMACH
chr1_1452909_A_C_b38	ATAD3C	-3.779	0.000194	-0.092547	33	0.024489	no	STMACH
chr1_1453703_A_G_b38	ATAD3C	-3.738	0.000226	-0.091398	33	0.024448	no	STMACH
chr1_1454092_A_G_b38	ATAD3C	-3.738	0.000226	-0.091398	33	0.024448	no	STMACH
chr1_1442793_G_A_b38	ATAD3C	-3.713	0.000249	-0.103256	5	0.027812	no	STMACH
chr1_1451787_A_C_b38	ATAD3C	-3.634	0.000334	-0.085247	29	0.023455	no	STMACH
chr1_1400410_A_G_b38	ATAD3C	-3.544	0.000465	-0.093925	31	0.026504	no	STMACH
chr1_588022_A_G_b38	ATAD3C	3.491	0.000562	0.085896	15	0.024603	no	STMACH
chr1_1330125_G_A_b38	ATAD3C	3.479	0.000587	0.097136	37	0.027919	no	STMACH
chr1_1456217_T_C_b38	ATAD3C	-3.465	0.000618	-0.090728	28	0.026185	no	STMACH
chr1_2119063_C_CT_b38	ATAD3C	-3.416	0.000735	-0.067321	44	0.019709	no	STMACH
chr1_2116057_C_G_b38	ATAD3C	-3.415	0.000736	-0.06731	44	0.019708	no	STMACH
chr1_2116108_G_A_b38	ATAD3C	-3.415	0.000736	-0.06731	44	0.019708	no	STMACH
chr1_1497605_G_C_b38	ATAD3C	-3.401	0.000773	-0.072681	36	0.02137	no	STMACH
chr1_1366561_AGT_A_b38	ATAD3C	3.398	0.000782	0.094498	37	0.027811	no	STMACH
chr1_1309988_G_A_b38	ATAD3C	3.387	0.000813	0.092357	39	0.027269	no	STMACH
chr1_1313807_G_A_b38	ATAD3C	3.387	0.000813	0.092357	39	0.027269	no	STMACH
chr1_1431813_G_T_b38	ATAD3C	-3.382	0.000826	-0.086046	11	0.025439	no	STMACH
chr1_1384749_C_G_b38	ATAD3C	3.334	0.000977	0.087526	31	0.026253	no	STMACH
chr1_1387763_CCT_C_b38	ATAD3C	3.334	0.000977	0.087526	31	0.026253	no	STMACH
chr1_1388944_G_A_b38	ATAD3C	3.334	0.000977	0.087526	31	0.026253	no	STMACH
chr1_1411323_A_C_b38	ATAD3C	-3.315	0.00104	-0.093542	37	0.028214	no	STMACH
chr1_1447108_A_ATT_b38	ATAD3C	-3.298	0.0011	-0.08156	14	0.024728	no	STMACH
chr1_1376162_G_C_b38	ATAD3C	3.274	0.0012	0.085808	31	0.026211	no	STMACH
chr1_1377431_C_T_b38	ATAD3C	3.274	0.0012	0.085808	31	0.026211	no	STMACH
chr1_1395346_A_G_b38	ATAD3C	-3.266	0.00123	-0.092915	37	0.028447	no	STMACH
chr1_1402457_A_G_b38	ATAD3C	-3.266	0.00123	-0.092915	37	0.028447	no	STMACH
chr1_2118069_G_T_b38	ATAD3C	-3.25	0.0013	-0.062816	48	0.019329	no	STMACH
chr1_2115499_G_T_b38	ATAD3C	-3.217	0.00145	-0.062605	45	0.01946	no	STMACH
chr1_2129085_T_C_b38	ATAD3C	-3.213	0.00147	-0.063281	44	0.019693	no	STMACH
chr1_2129191_T_C_b38	ATAD3C	-3.213	0.00147	-0.063281	44	0.019693	no	STMACH
chr1_1358384_G_C_b38	ATAD3C	3.2	0.00154	0.089703	37	0.028034	no	STMACH
chr1_2113103_T_C_b38	ATAD3C	-3.19	0.00159	-0.061869	45	0.019394	no	STMACH
chr1_2114443_A_G_b38	ATAD3C	-3.19	0.00159	-0.061869	45	0.019394	no	STMACH
chr1_2115347_G_A_b38	ATAD3C	-3.19	0.00159	-0.061869	45	0.019394	no	STMACH
chr1_1366427_AGTGTGATTGAATGAGT_A_b38	ATAD3C	3.188	0.0016	0.084281	28	0.026434	no	STMACH
chr1_1378204_G_C_b38	ATAD3C	3.167	0.00172	0.083502	29	0.026364	no	STMACH
chr1_1394423_A_G_b38	ATAD3C	-3.116	0.00203	-0.088107	37	0.028279	no	STMACH
chr1_2325157_C_T_b38	ATAD3C	3.11	0.00207	0.1127	3	0.036236	no	STMACH
chr1_1361685_C_T_b38	ATAD3C	-3.082	0.00227	-0.087898	16	0.028522	no	STMACH
chr1_1387698_A_G_b38	ATAD3C	3.044	0.00257	0.085575	37	0.028116	no	STMACH
chr1_1389827_C_T_b38	ATAD3C	3.044	0.00257	0.085575	37	0.028116	no	STMACH
chr1_2118342_G_GT_b38	ATAD3C	-3.04	0.0026	-0.057723	70	0.018989	no	STMACH
chr1_1290261_C_A_b38	ATAD3C	-3.027	0.00271	-0.084955	23	0.028066	no	STMACH
chr1_2117290_G_A_b38	ATAD3C	-3	0.00296	-0.059242	45	0.019748	no	STMACH
chr1_2120074_T_G_b38	ATAD3C	-3	0.00296	-0.059242	45	0.019748	no	STMACH
chr1_1456829_G_C_b38	ATAD3C	-2.995	0.00301	-0.079837	22	0.026661	no	STMACH
chr1_1324134_G_GGCTGGGGGGCTGGGAGGCTGAGAGGCTGGGGAGCTGGGGA_b38	ATAD3C	2.992	0.00303	0.125032	7	0.041783	no	STMACH
chr1_2365220_A_G_b38	ATAD3C	2.983	0.00311	0.078001	7	0.026145	no	STMACH
chr1_2357811_C_G_b38	ATAD3C	2.975	0.00319	0.07423	9	0.024949	no	STMACH
chr1_2357812_T_C_b38	ATAD3C	2.975	0.00319	0.07423	9	0.024949	no	STMACH
chr1_2359828_A_G_b38	ATAD3C	2.975	0.00319	0.07423	9	0.024949	no	STMACH
chr1_2363591_T_G_b38	ATAD3C	2.975	0.00319	0.07423	9	0.024949	no	STMACH
chr1_2367871_C_T_b38	ATAD3C	2.975	0.00319	0.07423	9	0.024949	no	STMACH
chr1_1308516_C_T_b38	ATAD3C	2.971	0.00324	0.078396	42	0.026389	no	STMACH
chr1_2131725_G_A_b38	ATAD3C	-2.967	0.00328	-0.057135	52	0.019257	no	STMACH
chr1_1424727_C_A_b38	ATAD3C	-2.965	0.0033	-0.129586	4	0.043708	no	STMACH
chr1_1337898_A_G_b38	ATAD3C	2.964	0.00331	0.075317	10	0.025411	no	STMACH
chr1_1361679_G_A_b38	ATAD3C	2.95	0.00346	0.079485	23	0.026946	no	STMACH
chr1_2104538_G_T_b38	ATAD3C	-2.937	0.00361	-0.05698	60	0.019404	no	STMACH
chr1_2118160_T_C_b38	ATAD3C	-2.917	0.00384	-0.057459	46	0.019699	no	STMACH
chr1_1459658_G_A_b38	ATAD3C	-2.915	0.00386	-0.103604	23	0.035545	no	STMACH
chr1_1456154_G_A_b38	ATAD3C	-2.902	0.00402	-0.073709	10	0.025402	no	STMACH
chr1_2127343_CA_C_b38	ATAD3C	-2.9	0.00404	-0.057163	61	0.019711	no	STMACH
chr1_2103940_A_G_b38	ATAD3C	-2.895	0.00411	-0.056457	59	0.019503	no	STMACH
chr1_2130530_T_C_b38	ATAD3C	-2.89	0.00417	-0.055163	53	0.019087	no	STMACH
chr1_2110022_C_T_b38	ATAD3C	-2.862	0.00454	-0.055109	61	0.019255	no	STMACH
chr1_1282558_C_CCA_b38	ATAD3C	-2.853	0.00466	-0.072745	27	0.025494	no	STMACH
chr1_2104824_G_A_b38	ATAD3C	-2.853	0.00467	-0.055104	56	0.019313	no	STMACH
chr1_2111104_A_G_b38	ATAD3C	-2.852	0.00468	-0.055151	57	0.019335	no	STMACH
chr1_1453643_A_ATT_b38	ATAD3C	-2.848	0.00474	-0.071469	21	0.025094	no	STMACH
chr1_1472158_C_G_b38	ATAD3C	-2.848	0.00475	-0.096364	11	0.03384	no	STMACH
chr1_1534915_T_C_b38	ATAD3C	-2.842	0.00483	-0.112653	15	0.039643	no	STMACH
chr1_1457033_A_C_b38	ATAD3C	-2.807	0.00537	-0.068534	13	0.024415	no	STMACH
chr1_1532798_T_C_b38	ATAD3C	-2.802	0.00545	-0.057309	75	0.020452	no	STMACH
chr1_1495204_T_C_b38	ATAD3C	-2.799	0.0055	-0.086287	17	0.030827	no	STMACH
chr1_2129293_C_T_b38	ATAD3C	-2.797	0.00553	-0.05498	60	0.019657	no	STMACH
chr1_2113933_G_C_b38	ATAD3C	-2.778	0.00586	-0.053824	47	0.019375	no	STMACH
chr1_2113937_A_G_b38	ATAD3C	-2.778	0.00586	-0.053824	47	0.019375	no	STMACH
chr1_2113941_C_A_b38	ATAD3C	-2.778	0.00586	-0.053824	47	0.019375	no	STMACH
chr1_1171093_G_A_b38	ATAD3C	-2.745	0.00646	-0.071792	31	0.026156	no	STMACH
chr1_2104245_C_T_b38	ATAD3C	-2.744	0.00648	-0.053172	56	0.019376	no	STMACH
chr1_2113726_G_A_b38	ATAD3C	-2.732	0.00671	-0.053016	60	0.019403	no	STMACH
chr1_1456051_C_T_b38	ATAD3C	-2.732	0.00672	-0.068451	11	0.025058	no	STMACH
chr1_1454848_T_C_b38	ATAD3C	-2.721	0.00693	-0.068131	12	0.025037	no	STMACH
chr1_2112598_T_C_b38	ATAD3C	-2.71	0.00716	-0.052398	47	0.019334	no	STMACH
chr1_1459632_T_C_b38	ATAD3C	-2.706	0.00725	-0.09434	18	0.034863	no	STMACH
chr1_1457071_C_T_b38	ATAD3C	-2.7	0.00737	-0.066022	15	0.02445	no	STMACH
chr1_1452825_AAAG_A_b38	ATAD3C	-2.698	0.00741	-0.067678	11	0.025082	no	STMACH
chr1_1452797_CAA_C_b38	ATAD3C	-2.689	0.00761	-0.072022	9	0.026783	no	STMACH
chr1_1518285_T_C_b38	ATAD3C	-2.683	0.00775	-0.072281	37	0.026938	no	STMACH
chr1_1963619_C_A_b38	ATAD3C	-2.681	0.00779	-0.143432	4	0.053491	no	STMACH
chr1_1456182_G_A_b38	ATAD3C	-2.675	0.00794	-0.066307	12	0.024791	no	STMACH
chr1_2116145_T_C_b38	ATAD3C	-2.662	0.00825	-0.079345	3	0.029812	no	STMACH
chr1_1455924_T_C_b38	ATAD3C	-2.658	0.00833	-0.066726	11	0.025104	no	STMACH
chr1_1453552_G_A_b38	ATAD3C	-2.65	0.00852	-0.066767	11	0.025191	no	STMACH
chr1_1455134_T_G_b38	ATAD3C	-2.65	0.00852	-0.066767	11	0.025191	no	STMACH
chr1_1455337_A_G_b38	ATAD3C	-2.65	0.00852	-0.066767	11	0.025191	no	STMACH
chr1_1455495_C_T_b38	ATAD3C	-2.65	0.00852	-0.066767	11	0.025191	no	STMACH
chr1_2109716_C_T_b38	ATAD3C	-2.63	0.00904	-0.050596	60	0.019239	no	STMACH
chr1_1131430_C_CTTTTTTTTTTTTTTT_b38	ATAD3C	2.628	0.00907	0.05686	32	0.021633	no	STMACH
chr1_1479719_T_C_b38	ATAD3C	-2.627	0.00912	-0.064239	45	0.024456	no	STMACH
chr1_2111555_C_G_b38	ATAD3C	-2.626	0.00913	-0.079121	3	0.030128	no	STMACH
chr1_2108082_G_T_b38	ATAD3C	-2.62	0.00929	-0.050534	59	0.019285	no	STMACH
chr1_2109459_T_C_b38	ATAD3C	-2.62	0.00929	-0.050534	59	0.019285	no	STMACH
chr1_2144131_T_C_b38	ATAD3C	2.595	0.00997	0.049973	51	0.019256	no	STMACH
chr1_2146433_A_G_b38	ATAD3C	2.595	0.00997	0.049973	51	0.019256	no	STMACH
chr1_2151050_G_A_b38	ATAD3C	2.595	0.00997	0.049973	51	0.019256	no	STMACH
chr1_2151163_A_G_b38	ATAD3C	2.595	0.00997	0.049973	51	0.019256	no	STMACH
chr1_2152098_G_C_b38	ATAD3C	2.595	0.00997	0.049973	51	0.019256	no	STMACH
chr1_2153594_A_G_b38	ATAD3C	2.595	0.00997	0.049973	51	0.019256	no	STMACH
chr1_1440430_C_G_b38	ATAD3C	-6.556	2.85e-10	-0.143512	18	0.021891	yes	TESTIS
chr1_1443457_T_C_b38	ATAD3C	-6.469	4.68e-10	-0.145079	30	0.022426	yes	TESTIS
chr1_1428969_T_C_b38	ATAD3C	-6.455	5.07e-10	-0.143479	34	0.022227	yes	TESTIS
chr1_1440834_C_G_b38	ATAD3C	-6.43	5.86e-10	-0.143904	29	0.022381	yes	TESTIS
chr1_1431014_G_A_b38	ATAD3C	-5.99	6.75e-09	-0.126558	22	0.021127	yes	TESTIS
chr1_1439454_A_G_b38	ATAD3C	-5.9	1.1e-08	-0.12893	30	0.021851	yes	TESTIS
chr1_1432355_G_A_b38	ATAD3C	-5.886	1.18e-08	-0.143065	11	0.024305	yes	TESTIS
chr1_1438102_G_C_b38	ATAD3C	-5.87	1.29e-08	-0.136969	11	0.023333	yes	TESTIS
chr1_1436079_A_G_b38	ATAD3C	-5.835	1.56e-08	-0.127034	35	0.021772	yes	TESTIS
chr1_1433374_T_C_b38	ATAD3C	-5.808	1.8e-08	-0.124828	38	0.021494	yes	TESTIS
chr1_1430908_A_G_b38	ATAD3C	-5.595	5.46e-08	-0.125146	35	0.022367	yes	TESTIS
chr1_1430190_A_C_b38	ATAD3C	-5.52	8.01e-08	-0.125519	34	0.022738	yes	TESTIS
chr1_1431450_A_G_b38	ATAD3C	-5.52	8.01e-08	-0.125519	34	0.022738	yes	TESTIS
chr1_1431537_G_C_b38	ATAD3C	-5.52	8.01e-08	-0.125519	34	0.022738	yes	TESTIS
chr1_1426261_C_T_b38	ATAD3C	-5.492	9.25e-08	-0.123159	34	0.022425	yes	TESTIS
chr1_1426810_C_G_b38	ATAD3C	-5.492	9.25e-08	-0.123159	34	0.022425	yes	TESTIS
chr1_1445187_T_G_b38	ATAD3C	-5.32	2.19e-07	-0.12138	26	0.022814	yes	TESTIS
chr1_1441187_A_G_b38	ATAD3C	-5.2	3.97e-07	-0.125418	19	0.024118	yes	TESTIS
chr1_1445240_A_G_b38	ATAD3C	-5.124	5.73e-07	-0.119132	29	0.023248	yes	TESTIS
chr1_1431026_CCACCCCCT_C_b38	ATAD3C	-5.097	6.55e-07	-0.120358	20	0.023615	yes	TESTIS
chr1_1436388_CA_C_b38	ATAD3C	-5.071	7.41e-07	-0.123977	19	0.024448	yes	TESTIS
chr1_1434687_C_G_b38	ATAD3C	-4.996	1.06e-06	-0.132304	6	0.026483	yes	TESTIS
chr1_1442793_G_A_b38	ATAD3C	-4.735	3.56e-06	-0.125726	5	0.026552	yes	TESTIS
chr1_1456217_T_C_b38	ATAD3C	-4.698	4.22e-06	-0.11576	30	0.024642	yes	TESTIS
chr1_1453870_A_C_b38	ATAD3C	-4.686	4.44e-06	-0.121746	6	0.025981	yes	TESTIS
chr1_1453961_C_T_b38	ATAD3C	-4.656	5.09e-06	-0.121503	6	0.026096	yes	TESTIS
chr1_1431656_G_A_b38	ATAD3C	-4.621	5.96e-06	-0.126868	5	0.027457	yes	TESTIS
chr1_1450636_A_G_b38	ATAD3C	-4.617	6.06e-06	-0.120338	7	0.026064	yes	TESTIS
chr1_1428999_C_CA_b38	ATAD3C	-4.54	8.52e-06	-0.098208	19	0.021632	yes	TESTIS
chr1_1449831_A_G_b38	ATAD3C	-4.531	8.87e-06	-0.111851	29	0.024687	yes	TESTIS
chr1_1457071_C_T_b38	ATAD3C	-4.423	1.42e-05	-0.098534	21	0.022277	yes	TESTIS
chr1_1454315_C_T_b38	ATAD3C	-4.393	1.62e-05	-0.102079	28	0.023238	yes	TESTIS
chr1_1456079_T_C_b38	ATAD3C	-4.342	2e-05	-0.100862	16	0.023228	yes	TESTIS
chr1_1431813_G_T_b38	ATAD3C	-4.338	2.04e-05	-0.113069	7	0.026067	yes	TESTIS
chr1_1452825_AAAG_A_b38	ATAD3C	-4.299	2.41e-05	-0.099546	17	0.023156	yes	TESTIS
chr1_1453552_G_A_b38	ATAD3C	-4.299	2.41e-05	-0.099546	17	0.023156	yes	TESTIS
chr1_1454848_T_C_b38	ATAD3C	-4.299	2.41e-05	-0.099546	17	0.023156	yes	TESTIS
chr1_1455134_T_G_b38	ATAD3C	-4.299	2.41e-05	-0.099546	17	0.023156	yes	TESTIS
chr1_1455337_A_G_b38	ATAD3C	-4.299	2.41e-05	-0.099546	17	0.023156	yes	TESTIS
chr1_1455495_C_T_b38	ATAD3C	-4.299	2.41e-05	-0.099546	17	0.023156	yes	TESTIS
chr1_1455924_T_C_b38	ATAD3C	-4.299	2.41e-05	-0.099546	17	0.023156	yes	TESTIS
chr1_1456051_C_T_b38	ATAD3C	-4.299	2.41e-05	-0.099546	17	0.023156	yes	TESTIS
chr1_1452511_A_G_b38	ATAD3C	-4.296	2.44e-05	-0.099674	31	0.0232	yes	TESTIS
chr1_1452888_C_A_b38	ATAD3C	-4.296	2.44e-05	-0.099674	31	0.0232	yes	TESTIS
chr1_1452909_A_C_b38	ATAD3C	-4.296	2.44e-05	-0.099674	31	0.0232	yes	TESTIS
chr1_1454092_A_G_b38	ATAD3C	-4.296	2.44e-05	-0.099674	31	0.0232	yes	TESTIS
chr1_1455617_T_G_b38	ATAD3C	-4.296	2.44e-05	-0.099674	31	0.0232	yes	TESTIS
chr1_1454770_T_C_b38	ATAD3C	-4.255	2.9e-05	-0.098823	31	0.023226	yes	TESTIS
chr1_1439805_G_C_b38	ATAD3C	-4.242	3.06e-05	-0.105981	10	0.024985	yes	TESTIS
chr1_1452540_G_A_b38	ATAD3C	-4.236	3.14e-05	-0.09854	13	0.023265	yes	TESTIS
chr1_1453703_A_G_b38	ATAD3C	-4.233	3.17e-05	-0.098364	31	0.023237	yes	TESTIS
chr1_1457033_A_C_b38	ATAD3C	-4.182	3.92e-05	-0.096739	17	0.023131	yes	TESTIS
chr1_1451028_T_A_b38	ATAD3C	-4.151	4.45e-05	-0.107134	8	0.025807	yes	TESTIS
chr1_1456154_G_A_b38	ATAD3C	-4.114	5.19e-05	-0.096418	16	0.023439	yes	TESTIS
chr1_1451968_C_T_b38	ATAD3C	-4.023	7.5e-05	-0.096609	13	0.024016	yes	TESTIS
chr1_1451787_A_C_b38	ATAD3C	-3.966	9.4e-05	-0.090367	25	0.022786	yes	TESTIS
chr1_1448915_G_A_b38	ATAD3C	-3.956	9.79e-05	-0.095102	17	0.024043	yes	TESTIS
chr1_1453643_A_ATT_b38	ATAD3C	-3.871	0.000136	-0.09327	21	0.024096	yes	TESTIS
chr1_1452346_A_G_b38	ATAD3C	-3.797	0.000181	-0.098919	6	0.026053	yes	TESTIS
chr1_1447108_A_ATT_b38	ATAD3C	-3.794	0.000184	-0.091407	14	0.024094	yes	TESTIS
chr1_1452384_G_A_b38	ATAD3C	-3.746	0.00022	-0.098296	6	0.026242	yes	TESTIS
chr1_1329973_GCGTGTGCCATGCA_G_b38	ATAD3C	-3.713	0.000249	-0.108437	5	0.029202	yes	TESTIS
chr1_1344048_G_A_b38	ATAD3C	-3.713	0.000249	-0.108437	5	0.029202	yes	TESTIS
chr1_1337898_A_G_b38	ATAD3C	3.668	0.000295	0.089155	11	0.024306	yes	TESTIS
chr1_1384546_C_T_b38	ATAD3C	-3.582	0.000405	-0.110407	4	0.03082	yes	TESTIS
chr1_1456182_G_A_b38	ATAD3C	-3.567	0.000428	-0.083282	17	0.023348	yes	TESTIS
chr1_1456891_T_C_b38	ATAD3C	-3.557	0.000443	-0.072921	29	0.020498	yes	TESTIS
chr1_1456829_G_C_b38	ATAD3C	-3.498	0.000549	-0.091437	22	0.026141	yes	TESTIS
chr1_1566854_CA_C_b38	ATAD3C	-3.424	0.000714	-0.079912	28	0.023339	yes	TESTIS
chr1_1452797_CAA_C_b38	ATAD3C	-3.349	0.000929	-0.087432	13	0.02611	yes	TESTIS
chr1_1341550_GCA_G_b38	ATAD3C	-3.299	0.0011	-0.094717	6	0.028714	yes	TESTIS
chr1_1379091_T_G_b38	ATAD3C	3.296	0.00111	0.086641	10	0.026283	yes	TESTIS
chr1_1308178_GGGGCGCGGGGA_G_b38	ATAD3C	-3.278	0.00118	-0.086072	7	0.026254	yes	TESTIS
chr1_1575724_G_C_b38	ATAD3C	-3.242	0.00134	-0.069958	43	0.021581	yes	TESTIS
chr1_1251618_G_A_b38	ATAD3C	-3.225	0.00142	-0.09249	5	0.02868	yes	TESTIS
chr1_1575421_C_T_b38	ATAD3C	-3.213	0.00147	-0.068999	43	0.021473	yes	TESTIS
chr1_1364253_C_G_b38	ATAD3C	-3.212	0.00148	-0.091728	6	0.02856	yes	TESTIS
chr1_1542773_T_C_b38	ATAD3C	-3.209	0.00149	-0.068789	42	0.021433	yes	TESTIS
chr1_1542793_C_G_b38	ATAD3C	-3.209	0.00149	-0.068789	42	0.021433	yes	TESTIS
chr1_1542800_T_C_b38	ATAD3C	-3.209	0.00149	-0.068789	42	0.021433	yes	TESTIS
chr1_1543500_T_G_b38	ATAD3C	-3.208	0.0015	-0.069168	41	0.021559	yes	TESTIS
chr1_1577491_A_AC_b38	ATAD3C	-3.204	0.00152	-0.069385	44	0.021657	yes	TESTIS
chr1_1192776_CAGTGTAGACACTCCAGTTGGTATG_C_b38	ATAD3C	3.203	0.00153	0.1031	4	0.032193	yes	TESTIS
chr1_1543953_A_G_b38	ATAD3C	-3.193	0.00158	-0.068305	42	0.021392	yes	TESTIS
chr1_1550064_GC_G_b38	ATAD3C	-3.193	0.00158	-0.068305	42	0.021392	yes	TESTIS
chr1_1550068_C_A_b38	ATAD3C	-3.193	0.00158	-0.068305	42	0.021392	yes	TESTIS
chr1_1251285_G_A_b38	ATAD3C	-3.18	0.00165	-0.089931	6	0.028278	yes	TESTIS
chr1_1251368_T_C_b38	ATAD3C	-3.18	0.00165	-0.089931	6	0.028278	yes	TESTIS
chr1_1573654_T_C_b38	ATAD3C	-3.171	0.00169	-0.06907	43	0.021779	yes	TESTIS
chr1_1574445_A_G_b38	ATAD3C	-3.171	0.00169	-0.06907	43	0.021779	yes	TESTIS
chr1_1402457_A_G_b38	ATAD3C	-3.167	0.00172	-0.079033	34	0.024954	yes	TESTIS
chr1_1449009_A_T_b38	ATAD3C	-3.146	0.00184	-0.082896	18	0.026347	yes	TESTIS
chr1_1471992_T_C_b38	ATAD3C	-3.136	0.00191	-0.069864	36	0.022281	yes	TESTIS
chr1_1497605_G_C_b38	ATAD3C	-3.126	0.00197	-0.063969	35	0.020466	yes	TESTIS
chr1_1541864_T_C_b38	ATAD3C	-3.121	0.002	-0.067321	42	0.021571	yes	TESTIS
chr1_1551557_A_AG_b38	ATAD3C	-3.121	0.002	-0.067321	42	0.021571	yes	TESTIS
chr1_1551559_A_T_b38	ATAD3C	-3.121	0.002	-0.067321	42	0.021571	yes	TESTIS
chr1_1387698_A_G_b38	ATAD3C	3.081	0.00228	0.076689	34	0.024889	yes	TESTIS
chr1_1389827_C_T_b38	ATAD3C	3.081	0.00228	0.076689	34	0.024889	yes	TESTIS
chr1_2436477_CCCTCCTCCCCTCCTCCCT_C_b38	ATAD3C	3.05	0.00252	0.133337	4	0.043722	yes	TESTIS
chr1_1991778_A_G_b38	ATAD3C	3.033	0.00266	0.066516	17	0.021931	yes	TESTIS
chr1_1653825_T_TACAC_b38	ATAD3C	3.03	0.00268	0.071928	8	0.023735	yes	TESTIS
chr1_1545795_C_A_b38	ATAD3C	-3.026	0.00272	-0.063859	38	0.0211	yes	TESTIS
chr1_1549590_C_G_b38	ATAD3C	-3.026	0.00272	-0.0637	46	0.021049	yes	TESTIS
chr1_1395346_A_G_b38	ATAD3C	-3.025	0.00272	-0.075848	34	0.02507	yes	TESTIS
chr1_1558726_C_CA_b38	ATAD3C	-3.021	0.00277	-0.064499	43	0.021352	yes	TESTIS
chr1_1561821_A_C_b38	ATAD3C	-3.021	0.00277	-0.064499	43	0.021352	yes	TESTIS
chr1_1035169_TG_T_b38	ATAD3C	-3.019	0.00279	-0.068427	22	0.022669	yes	TESTIS
chr1_1407232_G_C_b38	ATAD3C	-3.009	0.00287	-0.071706	12	0.023829	yes	TESTIS
chr1_1557495_CAT_C_b38	ATAD3C	-3	0.00296	-0.063851	43	0.021287	yes	TESTIS
chr1_1571794_A_AT_b38	ATAD3C	-2.991	0.00304	-0.063887	44	0.021357	yes	TESTIS
chr1_1400410_A_G_b38	ATAD3C	-2.985	0.00309	-0.074385	26	0.024916	yes	TESTIS
chr1_1538787_A_G_b38	ATAD3C	-2.981	0.00314	-0.06304	46	0.021149	yes	TESTIS
chr1_1384749_C_G_b38	ATAD3C	2.946	0.00351	0.07352	26	0.024959	yes	TESTIS
chr1_1387763_CCT_C_b38	ATAD3C	2.946	0.00351	0.07352	26	0.024959	yes	TESTIS
chr1_1388944_G_A_b38	ATAD3C	2.946	0.00351	0.07352	26	0.024959	yes	TESTIS
chr1_1394423_A_G_b38	ATAD3C	-2.94	0.00357	-0.073504	34	0.025002	yes	TESTIS
chr1_1217251_C_A_b38	ATAD3C	-2.926	0.00373	-0.090946	5	0.031083	yes	TESTIS
chr1_1411323_A_C_b38	ATAD3C	-2.9	0.00405	-0.072922	34	0.025149	yes	TESTIS
chr1_1130879_G_C_b38	ATAD3C	-2.895	0.00411	-0.072946	7	0.025198	yes	TESTIS
chr1_1244603_G_A_b38	ATAD3C	-2.833	0.00496	-0.088183	3	0.031128	yes	TESTIS
chr1_1251122_A_T_b38	ATAD3C	-2.812	0.00529	-0.075025	12	0.026684	yes	TESTIS
chr1_1479719_T_C_b38	ATAD3C	-2.803	0.00543	-0.063434	37	0.022627	yes	TESTIS
chr1_1574032_AAAG_A_b38	ATAD3C	-2.799	0.0055	-0.06646	22	0.023746	yes	TESTIS
chr1_1196039_C_G_b38	ATAD3C	2.796	0.00555	0.064981	15	0.023239	yes	TESTIS
chr1_1570294_CA_C_b38	ATAD3C	-2.76	0.00618	-0.059629	40	0.021603	yes	TESTIS
chr1_591638_G_A_b38	ATAD3C	2.75	0.00636	0.077164	5	0.028057	yes	TESTIS
chr1_2342133_C_G_b38	ATAD3C	2.748	0.0064	0.069581	10	0.025319	yes	TESTIS
chr1_2342137_G_A_b38	ATAD3C	2.748	0.0064	0.069581	10	0.025319	yes	TESTIS
chr1_1551454_C_A_b38	ATAD3C	-2.744	0.00648	-0.051644	87	0.01882	yes	TESTIS
chr1_1641275_A_G_b38	ATAD3C	-2.743	0.0065	-0.056021	39	0.020423	yes	TESTIS
chr1_1835922_G_GAA_b38	ATAD3C	2.734	0.00668	0.068344	23	0.025001	yes	TESTIS
chr1_1312114_T_C_b38	ATAD3C	2.701	0.00736	0.065444	35	0.024233	yes	TESTIS
chr1_1330125_G_A_b38	ATAD3C	2.689	0.00762	0.065817	35	0.024479	yes	TESTIS
chr1_1361679_G_A_b38	ATAD3C	2.673	0.00797	0.067086	22	0.025095	yes	TESTIS
chr1_1553018_CA_C_b38	ATAD3C	-2.642	0.00874	-0.059274	14	0.022438	yes	TESTIS
chr1_1991690_A_G_b38	ATAD3C	-2.634	0.00892	-0.05252	56	0.019937	yes	TESTIS
chr1_2052788_C_T_b38	ATAD3C	-2.627	0.0091	-0.06371	10	0.024249	yes	TESTIS
chr1_1313807_G_A_b38	ATAD3C	2.621	0.00926	0.063262	37	0.024133	yes	TESTIS
chr1_1275091_T_C_b38	ATAD3C	-2.609	0.00959	-0.074602	16	0.028595	yes	TESTIS
chr1_2436280_C_T_b38	ATAD3C	-2.596	0.00997	-0.098105	3	0.037797	yes	TESTIS
chr1_1426253_G_A_b38	ATAD3C	-4.775	2.97e-06	-0.127295	5	0.02666	no	TESTIS
chr1_1435945_C_CCGGGCGGGGGCG_b38	ATAD3C	-4.672	4.73e-06	-0.124566	6	0.026661	no	TESTIS
chr1_1186939_C_T_b38	ATAD3C	4.17	4.12e-05	0.116179	8	0.027862	no	TESTIS
chr1_1303800_G_A_b38	ATAD3C	-4.168	4.15e-05	-0.128912	3	0.030928	no	TESTIS
chr1_1304555_A_C_b38	ATAD3C	-4.114	5.19e-05	-0.124406	3	0.030242	no	TESTIS
chr1_1191942_G_A_b38	ATAD3C	4.087	5.78e-05	0.116029	7	0.028389	no	TESTIS
chr1_1186644_T_C_b38	ATAD3C	4.077	6.02e-05	0.113556	8	0.027851	no	TESTIS
chr1_1187136_G_A_b38	ATAD3C	4.077	6.02e-05	0.113556	8	0.027851	no	TESTIS
chr1_1187726_G_A_b38	ATAD3C	4.077	6.02e-05	0.113556	8	0.027851	no	TESTIS
chr1_1188877_A_G_b38	ATAD3C	4.077	6.02e-05	0.113556	8	0.027851	no	TESTIS
chr1_1189511_G_A_b38	ATAD3C	4.077	6.02e-05	0.113556	8	0.027851	no	TESTIS
chr1_1190875_G_C_b38	ATAD3C	4.077	6.02e-05	0.113556	8	0.027851	no	TESTIS
chr1_1191614_G_A_b38	ATAD3C	4.077	6.02e-05	0.113556	8	0.027851	no	TESTIS
chr1_1192000_G_A_b38	ATAD3C	4.077	6.02e-05	0.113556	8	0.027851	no	TESTIS
chr1_1192127_G_A_b38	ATAD3C	4.077	6.02e-05	0.113556	8	0.027851	no	TESTIS
chr1_1192143_C_T_b38	ATAD3C	4.077	6.02e-05	0.113556	8	0.027851	no	TESTIS
chr1_1192951_G_T_b38	ATAD3C	4.077	6.02e-05	0.113556	8	0.027851	no	TESTIS
chr1_1193049_G_A_b38	ATAD3C	4.077	6.02e-05	0.113556	8	0.027851	no	TESTIS
chr1_1194292_G_T_b38	ATAD3C	4.077	6.02e-05	0.113556	8	0.027851	no	TESTIS
chr1_1194327_A_G_b38	ATAD3C	4.077	6.02e-05	0.113556	8	0.027851	no	TESTIS
chr1_1303112_G_A_b38	ATAD3C	-4.074	6.09e-05	-0.122226	3	0.03	no	TESTIS
chr1_1192301_G_A_b38	ATAD3C	4.064	6.34e-05	0.114045	8	0.028061	no	TESTIS
chr1_1189019_C_G_b38	ATAD3C	4.014	7.76e-05	0.113697	7	0.028324	no	TESTIS
chr1_1186816_A_G_b38	ATAD3C	4.005	8.05e-05	0.111263	8	0.027782	no	TESTIS
chr1_1189968_T_C_b38	ATAD3C	4.005	8.05e-05	0.111263	8	0.027782	no	TESTIS
chr1_1190856_G_A_b38	ATAD3C	4.005	8.05e-05	0.111263	8	0.027782	no	TESTIS
chr1_1189730_T_C_b38	ATAD3C	3.93	0.000108	0.110525	8	0.02812	no	TESTIS
chr1_1196061_C_T_b38	ATAD3C	3.921	0.000112	0.108791	8	0.027746	no	TESTIS
chr1_1186414_G_A_b38	ATAD3C	3.916	0.000114	0.10835	8	0.02767	no	TESTIS
chr1_1194713_C_T_b38	ATAD3C	3.9	0.000122	0.108086	8	0.027716	no	TESTIS
chr1_1197586_C_A_b38	ATAD3C	3.884	0.00013	0.106178	9	0.027337	no	TESTIS
chr1_1195100_G_A_b38	ATAD3C	3.883	0.00013	0.103652	9	0.026693	no	TESTIS
chr1_1185961_C_T_b38	ATAD3C	3.881	0.000131	0.106568	8	0.027456	no	TESTIS
chr1_1186245_C_G_b38	ATAD3C	3.881	0.000131	0.106568	8	0.027456	no	TESTIS
chr1_1199327_G_A_b38	ATAD3C	3.857	0.000144	0.106058	9	0.027497	no	TESTIS
chr1_1197874_G_A_b38	ATAD3C	3.842	0.000153	0.107345	8	0.027941	no	TESTIS
chr1_1187008_G_A_b38	ATAD3C	3.815	0.000169	0.110114	7	0.028866	no	TESTIS
chr1_1197405_C_T_b38	ATAD3C	3.814	0.00017	0.105155	9	0.027569	no	TESTIS
chr1_1185634_G_A_b38	ATAD3C	3.77	0.000201	0.105319	8	0.027935	no	TESTIS
chr1_1407565_C_A_b38	ATAD3C	-3.696	0.000265	-0.114336	4	0.030932	no	TESTIS
chr1_1197558_G_A_b38	ATAD3C	3.691	0.000271	0.104021	8	0.028183	no	TESTIS
chr1_1380867_A_G_b38	ATAD3C	-3.673	0.00029	-0.110607	4	0.030114	no	TESTIS
chr1_1199253_C_T_b38	ATAD3C	3.644	0.000323	0.097	10	0.026622	no	TESTIS
chr1_1316929_A_T_b38	ATAD3C	-3.596	0.000385	-0.100158	7	0.027853	no	TESTIS
chr1_1188405_A_ATT_b38	ATAD3C	3.574	0.000417	0.109746	5	0.030704	no	TESTIS
chr1_1403593_A_G_b38	ATAD3C	-3.54	0.000472	-0.104841	5	0.029619	no	TESTIS
chr1_660192_G_A_b38	ATAD3C	3.523	0.000503	0.096504	8	0.027396	no	TESTIS
chr1_1373006_G_A_b38	ATAD3C	-3.515	0.000517	-0.10585	3	0.030118	no	TESTIS
chr1_1187016_C_T_b38	ATAD3C	3.455	0.00064	0.100481	7	0.029083	no	TESTIS
chr1_1382893_G_A_b38	ATAD3C	-3.451	0.00065	-0.102162	5	0.029606	no	TESTIS
chr1_1383743_T_C_b38	ATAD3C	-3.437	0.000682	-0.101579	5	0.029554	no	TESTIS
chr1_1375642_C_T_b38	ATAD3C	-3.413	0.000743	-0.097014	6	0.028428	no	TESTIS
chr1_1187013_A_AT_b38	ATAD3C	3.408	0.000756	0.098952	7	0.029037	no	TESTIS
chr1_1373007_G_A_b38	ATAD3C	-3.396	0.000788	-0.100359	4	0.029553	no	TESTIS
chr1_1398218_C_A_b38	ATAD3C	-3.373	0.000853	-0.100585	5	0.029818	no	TESTIS
chr1_1400756_GGA_G_b38	ATAD3C	-3.373	0.000853	-0.100585	5	0.029818	no	TESTIS
chr1_1401954_G_T_b38	ATAD3C	-3.373	0.000853	-0.100585	5	0.029818	no	TESTIS
chr1_1186850_GT_G_b38	ATAD3C	3.324	0.00101	0.097084	6	0.029209	no	TESTIS
chr1_1991835_C_T_b38	ATAD3C	-3.292	0.00113	-0.068581	44	0.020831	no	TESTIS
chr1_1374505_A_G_b38	ATAD3C	-3.291	0.00113	-0.093927	6	0.028542	no	TESTIS
chr1_509574_T_C_b38	ATAD3C	3.221	0.00144	0.125368	3	0.038928	no	TESTIS
chr1_1437993_G_A_b38	ATAD3C	-3.205	0.00151	-0.082373	11	0.025698	no	TESTIS
chr1_1372909_G_A_b38	ATAD3C	-3.17	0.0017	-0.091981	5	0.029017	no	TESTIS
chr1_1641819_C_T_b38	ATAD3C	-3.16	0.00176	-0.07976	15	0.025244	no	TESTIS
chr1_1547630_G_A_b38	ATAD3C	-3.127	0.00196	-0.063663	42	0.020358	no	TESTIS
chr1_1499586_C_CT_b38	ATAD3C	-3.047	0.00254	-0.092876	10	0.030477	no	TESTIS
chr1_1553692_A_G_b38	ATAD3C	-2.93	0.00369	-0.061047	47	0.020838	no	TESTIS
chr1_1554694_A_G_b38	ATAD3C	-2.93	0.00369	-0.061047	47	0.020838	no	TESTIS
chr1_1554852_T_C_b38	ATAD3C	-2.93	0.00369	-0.061047	47	0.020838	no	TESTIS
chr1_1555247_T_A_b38	ATAD3C	-2.93	0.00369	-0.061047	47	0.020838	no	TESTIS
chr1_1487487_C_CA_b38	ATAD3C	2.928	0.00371	0.105591	3	0.036064	no	TESTIS
chr1_1565105_CAAGGCAGGCGGATCATG_C_b38	ATAD3C	-2.909	0.00393	-0.060913	47	0.02094	no	TESTIS
chr1_1510082_T_TA_b38	ATAD3C	2.882	0.00427	0.101112	4	0.035085	no	TESTIS
chr1_1130902_A_G_b38	ATAD3C	-2.863	0.00452	-0.061134	20	0.02135	no	TESTIS
chr1_1569661_T_C_b38	ATAD3C	-2.862	0.00454	-0.058809	45	0.020546	no	TESTIS
chr1_1559750_C_CAG_b38	ATAD3C	-2.859	0.00459	-0.060064	47	0.02101	no	TESTIS
chr1_1561628_T_C_b38	ATAD3C	-2.859	0.00459	-0.060064	47	0.02101	no	TESTIS
chr1_1563918_A_G_b38	ATAD3C	-2.859	0.00459	-0.060064	47	0.02101	no	TESTIS
chr1_1565561_A_G_b38	ATAD3C	-2.859	0.00459	-0.060064	47	0.02101	no	TESTIS
chr1_1566086_G_A_b38	ATAD3C	-2.859	0.00459	-0.060064	47	0.02101	no	TESTIS
chr1_1567715_G_A_b38	ATAD3C	-2.859	0.00459	-0.060064	47	0.02101	no	TESTIS
chr1_1567719_A_C_b38	ATAD3C	-2.859	0.00459	-0.060064	47	0.02101	no	TESTIS
chr1_1569875_C_T_b38	ATAD3C	-2.859	0.00459	-0.060064	47	0.02101	no	TESTIS
chr1_1572532_A_C_b38	ATAD3C	-2.859	0.00459	-0.060064	47	0.02101	no	TESTIS
chr1_1573079_A_G_b38	ATAD3C	-2.859	0.00459	-0.060064	47	0.02101	no	TESTIS
chr1_2436551_C_CCTCCCTCCACCTTTCCTCCTTT_b38	ATAD3C	-2.853	0.00467	-0.080607	15	0.02825	no	TESTIS
chr1_1308516_C_T_b38	ATAD3C	2.838	0.00488	0.065914	41	0.023222	no	TESTIS
chr1_1483898_G_A_b38	ATAD3C	2.772	0.00596	0.088524	19	0.031932	no	TESTIS
chr1_1565680_A_AG_b38	ATAD3C	-2.739	0.00658	-0.057258	47	0.020904	no	TESTIS
chr1_1575864_G_A_b38	ATAD3C	-2.737	0.00661	-0.059833	41	0.021858	no	TESTIS
chr1_1554781_A_G_b38	ATAD3C	-2.728	0.00679	-0.056891	47	0.020854	no	TESTIS
chr1_965666_ACC_A_b38	ATAD3C	2.696	0.00745	0.06152	16	0.022815	no	TESTIS
chr1_1569180_T_A_b38	ATAD3C	-2.678	0.00786	-0.056614	45	0.021137	no	TESTIS
chr1_1129916_T_C_b38	ATAD3C	-2.662	0.00823	-0.050544	42	0.018985	no	TESTIS
chr1_1274972_A_G_b38	ATAD3C	-2.639	0.00881	-0.075924	15	0.028771	no	TESTIS
chr1_1548572_A_AC_b38	ATAD3C	-2.63	0.00905	-0.116916	3	0.044462	no	TESTIS
chr1_1277269_T_C_b38	ATAD3C	-2.6	0.00985	-0.075416	15	0.02901	no	TESTIS
chr1_1278407_T_TA_b38	ATAD3C	-2.6	0.00985	-0.075416	15	0.02901	no	TESTIS
chr1_1468592_C_CG_b38	ATAD3C	10.59	8.56e-24	0.256219	23	0.024194	yes	THYROID
chr1_1472158_C_G_b38	ATAD3C	10.194	2.6e-22	0.261114	21	0.025613	yes	THYROID
chr1_1468856_C_T_b38	ATAD3C	10.109	5.36e-22	0.248409	20	0.024572	yes	THYROID
chr1_1468094_G_C_b38	ATAD3C	10.075	7.19e-22	0.251365	19	0.02495	yes	THYROID
chr1_1486611_G_A_b38	ATAD3C	9.491	9.16e-20	0.22761	26	0.023982	yes	THYROID
chr1_1489916_C_T_b38	ATAD3C	9.307	4.04e-19	0.213957	24	0.022988	yes	THYROID
chr1_1481959_C_T_b38	ATAD3C	9.242	6.8e-19	0.219753	29	0.023777	yes	THYROID
chr1_1468048_A_G_b38	ATAD3C	8.89	1.1e-17	0.226037	25	0.025427	yes	THYROID
chr1_1473089_T_C_b38	ATAD3C	8.799	2.21e-17	0.202423	36	0.023005	yes	THYROID
chr1_1482624_T_C_b38	ATAD3C	8.654	6.75e-17	0.200763	38	0.023199	yes	THYROID
chr1_1459658_G_A_b38	ATAD3C	8.64	7.51e-17	0.231246	31	0.026765	yes	THYROID
chr1_1495204_T_C_b38	ATAD3C	8.472	2.68e-16	0.197535	30	0.023316	yes	THYROID
chr1_1471144_G_C_b38	ATAD3C	8.405	4.44e-16	0.216304	34	0.025737	yes	THYROID
chr1_1470034_T_C_b38	ATAD3C	8.377	5.43e-16	0.214769	34	0.025637	yes	THYROID
chr1_1488652_A_G_b38	ATAD3C	8.375	5.52e-16	0.197583	38	0.023591	yes	THYROID
chr1_1492292_C_G_b38	ATAD3C	8.375	5.52e-16	0.197583	38	0.023591	yes	THYROID
chr1_1492850_G_A_b38	ATAD3C	8.375	5.52e-16	0.197583	38	0.023591	yes	THYROID
chr1_1459632_T_C_b38	ATAD3C	8.36	6.17e-16	0.216315	24	0.025874	yes	THYROID
chr1_1483898_G_A_b38	ATAD3C	8.345	6.92e-16	0.200989	37	0.024085	yes	THYROID
chr1_1486151_C_A_b38	ATAD3C	8.301	9.61e-16	0.199555	37	0.024041	yes	THYROID
chr1_1490320_T_C_b38	ATAD3C	8.257	1.32e-15	0.194505	37	0.023556	yes	THYROID
chr1_1487887_A_G_b38	ATAD3C	8.253	1.36e-15	0.194227	39	0.023533	yes	THYROID
chr1_1476266_T_C_b38	ATAD3C	8.244	1.46e-15	0.194064	38	0.023541	yes	THYROID
chr1_1469429_A_G_b38	ATAD3C	8.238	1.52e-15	0.209299	34	0.025405	yes	THYROID
chr1_1492619_A_AC_b38	ATAD3C	8.141	3.1e-15	0.189739	38	0.023306	yes	THYROID
chr1_1490027_A_G_b38	ATAD3C	8.115	3.75e-15	0.191316	31	0.023575	yes	THYROID
chr1_1490032_A_G_b38	ATAD3C	8.115	3.75e-15	0.191316	31	0.023575	yes	THYROID
chr1_1459662_C_T_b38	ATAD3C	7.833	2.85e-14	0.211742	24	0.027032	yes	THYROID
chr1_1469088_T_C_b38	ATAD3C	7.494	3.03e-13	0.186599	32	0.024899	yes	THYROID
chr1_1482402_A_G_b38	ATAD3C	7.096	4.39e-12	0.151557	55	0.021358	yes	THYROID
chr1_1460021_C_CTG_b38	ATAD3C	7.095	4.43e-12	0.180237	20	0.025404	yes	THYROID
chr1_1460022_CAG_C_b38	ATAD3C	7.095	4.43e-12	0.180237	20	0.025404	yes	THYROID
chr1_1476079_T_C_b38	ATAD3C	6.983	9.18e-12	0.167319	36	0.023961	yes	THYROID
chr1_1497105_T_G_b38	ATAD3C	6.877	1.82e-11	0.183495	4	0.026682	yes	THYROID
chr1_1490046_G_A_b38	ATAD3C	6.673	6.64e-11	0.173377	6	0.025983	yes	THYROID
chr1_1490047_A_G_b38	ATAD3C	6.673	6.64e-11	0.173377	6	0.025983	yes	THYROID
chr1_1367122_G_A_b38	ATAD3C	-6.652	7.58e-11	-0.339948	3	0.051108	yes	THYROID
chr1_1474201_CT_C_b38	ATAD3C	6.606	1.01e-10	0.143843	36	0.021774	yes	THYROID
chr1_1476515_AT_A_b38	ATAD3C	6.565	1.3e-10	0.154387	6	0.023518	yes	THYROID
chr1_1458448_C_CT_b38	ATAD3C	6.472	2.3e-10	0.218305	5	0.033729	yes	THYROID
chr1_1459004_T_C_b38	ATAD3C	6.462	2.44e-10	0.187809	21	0.029062	yes	THYROID
chr1_1461621_T_TCTCCTCATGAGACCCCCATGTCGGAATTCGAAGGAGAGG_b38	ATAD3C	6.261	8.2e-10	0.186374	14	0.029767	yes	THYROID
chr1_1468062_A_T_b38	ATAD3C	5.873	7.8e-09	0.207909	9	0.035403	yes	THYROID
chr1_1458730_G_GTT_b38	ATAD3C	5.666	2.47e-08	0.227436	4	0.040142	yes	THYROID
chr1_1487487_C_CA_b38	ATAD3C	5.62	3.17e-08	0.169233	3	0.030113	yes	THYROID
chr1_1469469_G_C_b38	ATAD3C	5.433	8.66e-08	0.196662	7	0.0362	yes	THYROID
chr1_1459799_T_G_b38	ATAD3C	5.428	8.88e-08	0.21958	5	0.040453	yes	THYROID
chr1_1460858_G_T_b38	ATAD3C	5.428	8.88e-08	0.21958	5	0.040453	yes	THYROID
chr1_1460958_G_A_b38	ATAD3C	5.428	8.88e-08	0.21958	5	0.040453	yes	THYROID
chr1_1461496_G_A_b38	ATAD3C	5.41	9.77e-08	0.229947	3	0.042505	yes	THYROID
chr1_1461195_T_TC_b38	ATAD3C	5.294	1.8e-07	0.186651	11	0.03526	yes	THYROID
chr1_1459273_T_C_b38	ATAD3C	5.293	1.8e-07	0.209348	6	0.039552	yes	THYROID
chr1_1459283_AC_A_b38	ATAD3C	5.293	1.8e-07	0.209348	6	0.039552	yes	THYROID
chr1_1471591_C_G_b38	ATAD3C	5.198	2.93e-07	0.22228	3	0.042762	yes	THYROID
chr1_1495327_C_T_b38	ATAD3C	5.085	5.21e-07	0.204855	8	0.040289	yes	THYROID
chr1_1461767_A_G_b38	ATAD3C	5.02	7.19e-07	0.176256	12	0.035112	yes	THYROID
chr1_1468254_T_A_b38	ATAD3C	4.985	8.56e-07	0.179254	7	0.035962	yes	THYROID
chr1_1461283_A_G_b38	ATAD3C	4.983	8.63e-07	0.19999	6	0.040135	yes	THYROID
chr1_1461362_AT_A_b38	ATAD3C	4.983	8.63e-07	0.19999	6	0.040135	yes	THYROID
chr1_1457919_C_A_b38	ATAD3C	4.9	1.29e-06	0.189857	9	0.038747	yes	THYROID
chr1_1457922_T_C_b38	ATAD3C	4.9	1.29e-06	0.189857	9	0.038747	yes	THYROID
chr1_1474259_C_G_b38	ATAD3C	4.897	1.31e-06	0.210846	3	0.043052	yes	THYROID
chr1_1484012_C_T_b38	ATAD3C	4.897	1.31e-06	0.210846	3	0.043052	yes	THYROID
chr1_1486396_C_G_b38	ATAD3C	4.874	1.47e-06	0.211341	3	0.043365	yes	THYROID
chr1_1488349_C_T_b38	ATAD3C	4.874	1.47e-06	0.211341	3	0.043365	yes	THYROID
chr1_1489767_T_C_b38	ATAD3C	4.874	1.47e-06	0.211341	3	0.043365	yes	THYROID
chr1_1479324_C_G_b38	ATAD3C	4.765	2.48e-06	0.17511	11	0.036752	yes	THYROID
chr1_1461760_C_A_b38	ATAD3C	4.751	2.64e-06	0.164647	12	0.034654	yes	THYROID
chr1_1432355_G_A_b38	ATAD3C	-4.718	3.09e-06	-0.093172	26	0.019747	yes	THYROID
chr1_1461719_G_A_b38	ATAD3C	4.651	4.22e-06	0.177864	8	0.038239	yes	THYROID
chr1_1476195_G_C_b38	ATAD3C	4.641	4.42e-06	0.20555	3	0.044286	yes	THYROID
chr1_1479683_T_G_b38	ATAD3C	4.626	4.75e-06	0.150284	34	0.032488	yes	THYROID
chr1_1480096_G_C_b38	ATAD3C	4.626	4.75e-06	0.150284	34	0.032488	yes	THYROID
chr1_1494105_G_A_b38	ATAD3C	4.598	5.41e-06	0.181686	8	0.039518	yes	THYROID
chr1_1490122_A_G_b38	ATAD3C	4.594	5.5e-06	0.177824	4	0.038707	yes	THYROID
chr1_1492939_C_CA_b38	ATAD3C	4.593	5.52e-06	0.138154	14	0.030077	yes	THYROID
chr1_1485282_A_G_b38	ATAD3C	4.577	5.94e-06	0.17189	10	0.037552	yes	THYROID
chr1_1495236_T_C_b38	ATAD3C	4.532	7.3e-06	0.181745	8	0.0401	yes	THYROID
chr1_1460370_T_C_b38	ATAD3C	4.53	7.36e-06	0.174576	8	0.038535	yes	THYROID
chr1_1472097_CGGCGG_C_b38	ATAD3C	4.508	8.16e-06	0.195096	4	0.04328	yes	THYROID
chr1_1531133_G_A_b38	ATAD3C	4.489	8.89e-06	0.146606	16	0.03266	yes	THYROID
chr1_1459357_C_A_b38	ATAD3C	4.483	9.1e-06	0.175421	8	0.039126	yes	THYROID
chr1_1495357_G_A_b38	ATAD3C	4.468	9.75e-06	0.190877	3	0.042718	yes	THYROID
chr1_1459391_A_G_b38	ATAD3C	4.447	1.07e-05	0.175984	8	0.039578	yes	THYROID
chr1_1319056_A_G_b38	ATAD3C	-4.432	1.15e-05	-0.147624	4	0.033309	yes	THYROID
chr1_1533095_G_A_b38	ATAD3C	4.407	1.28e-05	0.143519	21	0.032568	yes	THYROID
chr1_1489578_C_CTA_b38	ATAD3C	4.398	1.33e-05	0.194128	3	0.044138	yes	THYROID
chr1_1495205_G_A_b38	ATAD3C	4.336	1.75e-05	0.157335	9	0.036287	yes	THYROID
chr1_1502497_C_T_b38	ATAD3C	4.283	2.21e-05	0.118217	4	0.0276	yes	THYROID
chr1_1510841_C_T_b38	ATAD3C	4.254	2.51e-05	0.117178	4	0.027546	yes	THYROID
chr1_1466242_C_CA_b38	ATAD3C	4.225	2.84e-05	0.113497	10	0.026862	yes	THYROID
chr1_1509914_T_TAA_b38	ATAD3C	4.122	4.38e-05	0.126248	3	0.030624	yes	THYROID
chr1_1533178_A_G_b38	ATAD3C	4.116	4.51e-05	0.133792	21	0.032509	yes	THYROID
chr1_1531448_C_T_b38	ATAD3C	4.113	4.57e-05	0.132488	22	0.032214	yes	THYROID
chr1_1532105_T_C_b38	ATAD3C	4.095	4.91e-05	0.132726	22	0.032409	yes	THYROID
chr1_1533253_C_T_b38	ATAD3C	4.095	4.91e-05	0.132726	22	0.032409	yes	THYROID
chr1_1235720_T_G_b38	ATAD3C	4.027	6.52e-05	0.128257	14	0.031848	yes	THYROID
chr1_1510122_G_C_b38	ATAD3C	4.015	6.84e-05	0.112668	4	0.02806	yes	THYROID
chr1_1496953_T_C_b38	ATAD3C	4.01	7e-05	0.094993	38	0.023691	yes	THYROID
chr1_1322213_A_G_b38	ATAD3C	-3.996	7.4e-05	-0.121063	4	0.030296	yes	THYROID
chr1_1495221_G_A_b38	ATAD3C	3.992	7.51e-05	0.144201	10	0.036118	yes	THYROID
chr1_1495222_T_G_b38	ATAD3C	3.992	7.51e-05	0.144201	10	0.036118	yes	THYROID
chr1_1533653_C_T_b38	ATAD3C	3.992	7.52e-05	0.134887	12	0.033788	yes	THYROID
chr1_1411847_TCCAGGTC_T_b38	ATAD3C	3.921	1e-04	0.122518	10	0.031248	yes	THYROID
chr1_1516109_T_C_b38	ATAD3C	3.872	0.000122	0.122573	15	0.031653	yes	THYROID
chr1_1531601_A_G_b38	ATAD3C	3.772	0.000181	0.122721	24	0.032532	yes	THYROID
chr1_1486354_G_C_b38	ATAD3C	3.766	0.000185	0.155705	8	0.041344	yes	THYROID
chr1_1421814_G_A_b38	ATAD3C	3.737	0.000208	0.119551	14	0.031993	yes	THYROID
chr1_1525526_C_T_b38	ATAD3C	3.705	0.000234	0.124609	12	0.033629	yes	THYROID
chr1_1551679_G_A_b38	ATAD3C	-3.702	0.000237	-0.139544	5	0.037693	yes	THYROID
chr1_1547630_G_A_b38	ATAD3C	-3.668	0.00027	-0.061387	78	0.016736	yes	THYROID
chr1_1496973_G_A_b38	ATAD3C	3.628	0.000315	0.092109	24	0.025389	yes	THYROID
chr1_1457615_C_A_b38	ATAD3C	3.61	0.000337	0.084333	22	0.02336	yes	THYROID
chr1_1518689_A_ACC_b38	ATAD3C	3.607	0.000341	0.094341	4	0.026157	yes	THYROID
chr1_1477677_TTTTTA_T_b38	ATAD3C	3.598	0.000353	0.143696	8	0.03994	yes	THYROID
chr1_1442793_G_A_b38	ATAD3C	-3.552	0.000418	-0.076596	16	0.021563	yes	THYROID
chr1_1415792_A_T_b38	ATAD3C	3.527	0.000458	0.126173	5	0.035769	yes	THYROID
chr1_1516110_G_A_b38	ATAD3C	3.48	0.000545	0.11391	14	0.032734	yes	THYROID
chr1_1332815_G_A_b38	ATAD3C	3.479	0.000546	0.117802	5	0.033858	yes	THYROID
chr1_1374801_A_G_b38	ATAD3C	-3.475	0.000556	-0.111355	9	0.032049	yes	THYROID
chr1_1278550_T_C_b38	ATAD3C	3.466	0.000573	0.156661	3	0.045194	yes	THYROID
chr1_1279882_T_C_b38	ATAD3C	3.466	0.000573	0.156661	3	0.045194	yes	THYROID
chr1_1280416_A_G_b38	ATAD3C	3.466	0.000573	0.156661	3	0.045194	yes	THYROID
chr1_1284551_G_T_b38	ATAD3C	3.466	0.000573	0.156661	3	0.045194	yes	THYROID
chr1_1739115_T_C_b38	ATAD3C	3.414	0.000691	0.139441	9	0.040839	yes	THYROID
chr1_1280469_A_T_b38	ATAD3C	3.406	0.000712	0.15166	3	0.044525	yes	THYROID
chr1_1427029_G_A_b38	ATAD3C	3.396	0.000738	0.134325	5	0.039553	yes	THYROID
chr1_1306149_A_G_b38	ATAD3C	-3.38	0.000782	-0.109957	5	0.032536	yes	THYROID
chr1_1501403_T_C_b38	ATAD3C	3.355	0.000853	0.072981	42	0.021752	yes	THYROID
chr1_1428763_A_G_b38	ATAD3C	3.32	0.000965	0.097166	13	0.029266	yes	THYROID
chr1_1425135_T_C_b38	ATAD3C	3.315	0.000983	0.104044	4	0.031387	yes	THYROID
chr1_1575421_C_T_b38	ATAD3C	-3.294	0.00106	-0.056851	81	0.017261	yes	THYROID
chr1_1413406_G_A_b38	ATAD3C	3.283	0.0011	0.115712	6	0.03525	yes	THYROID
chr1_1335073_C_T_b38	ATAD3C	3.276	0.00113	0.116559	4	0.035584	yes	THYROID
chr1_1340336_T_A_b38	ATAD3C	3.276	0.00113	0.116559	4	0.035584	yes	THYROID
chr1_1340746_G_GCA_b38	ATAD3C	3.276	0.00113	0.116559	4	0.035584	yes	THYROID
chr1_1340983_T_C_b38	ATAD3C	3.276	0.00113	0.116559	4	0.035584	yes	THYROID
chr1_1342269_G_T_b38	ATAD3C	3.276	0.00113	0.116559	4	0.035584	yes	THYROID
chr1_1192776_CAGTGTAGACACTCCAGTTGGTATG_C_b38	ATAD3C	3.257	0.0012	0.091631	4	0.028137	yes	THYROID
chr1_1217733_G_A_b38	ATAD3C	-3.255	0.00121	-0.077292	9	0.023748	yes	THYROID
chr1_1479205_A_C_b38	ATAD3C	3.254	0.00122	0.078298	25	0.024066	yes	THYROID
chr1_1357006_CA_C_b38	ATAD3C	3.249	0.00124	0.116526	4	0.035868	yes	THYROID
chr1_1511945_G_A_b38	ATAD3C	3.246	0.00125	0.0715	41	0.022024	yes	THYROID
chr1_1423761_CCAT_C_b38	ATAD3C	3.23	0.00132	0.108139	4	0.033484	yes	THYROID
chr1_1260994_C_T_b38	ATAD3C	3.225	0.00134	0.147385	3	0.045707	yes	THYROID
chr1_1690745_G_GA_b38	ATAD3C	3.201	0.00146	0.118602	6	0.037052	yes	THYROID
chr1_1426175_T_C_b38	ATAD3C	3.187	0.00153	0.092143	12	0.02891	yes	THYROID
chr1_1195100_G_A_b38	ATAD3C	3.178	0.00158	0.077076	9	0.024254	yes	THYROID
chr1_1499279_C_CT_b38	ATAD3C	-3.17	0.00162	-0.137328	5	0.043326	yes	THYROID
chr1_1232800_G_C_b38	ATAD3C	3.158	0.00168	0.099102	9	0.031378	yes	THYROID
chr1_1186092_C_CT_b38	ATAD3C	3.152	0.00172	0.078233	4	0.024818	yes	THYROID
chr1_1331045_G_A_b38	ATAD3C	3.142	0.00178	0.113223	4	0.036035	yes	THYROID
chr1_1375788_G_C_b38	ATAD3C	3.141	0.00178	0.117138	4	0.037296	yes	THYROID
chr1_1381507_G_A_b38	ATAD3C	3.141	0.00178	0.117138	4	0.037296	yes	THYROID
chr1_1382885_A_G_b38	ATAD3C	3.141	0.00178	0.117138	4	0.037296	yes	THYROID
chr1_1367498_T_C_b38	ATAD3C	3.124	0.00189	0.112453	4	0.035995	yes	THYROID
chr1_1360901_TAC_T_b38	ATAD3C	3.115	0.00195	0.111122	4	0.035676	yes	THYROID
chr1_1364223_G_A_b38	ATAD3C	3.114	0.00195	0.113116	4	0.036326	yes	THYROID
chr1_1366030_CTGTG_C_b38	ATAD3C	3.114	0.00195	0.113116	4	0.036326	yes	THYROID
chr1_1343267_C_A_b38	ATAD3C	3.075	0.00222	0.105759	5	0.03439	yes	THYROID
chr1_1477850_C_G_b38	ATAD3C	3.075	0.00222	0.129527	7	0.042119	yes	THYROID
chr1_1477855_G_C_b38	ATAD3C	3.075	0.00222	0.129527	7	0.042119	yes	THYROID
chr1_1458967_T_C_b38	ATAD3C	3.073	0.00224	0.119033	6	0.038741	yes	THYROID
chr1_1285045_A_G_b38	ATAD3C	3.052	0.00239	0.133802	3	0.043839	yes	THYROID
chr1_1578879_A_T_b38	ATAD3C	-3.049	0.00242	-0.100336	3	0.032913	yes	THYROID
chr1_1534913_G_GC_b38	ATAD3C	3.043	0.00247	0.129099	15	0.042429	yes	THYROID
chr1_1424725_G_A_b38	ATAD3C	3.029	0.00258	0.11605	5	0.038309	yes	THYROID
chr1_1188405_A_ATT_b38	ATAD3C	3.015	0.0027	0.081237	5	0.026947	yes	THYROID
chr1_1173931_G_A_b38	ATAD3C	-2.996	0.00287	-0.074374	9	0.024821	yes	THYROID
chr1_1173935_C_G_b38	ATAD3C	-2.996	0.00287	-0.074374	9	0.024821	yes	THYROID
chr1_1281678_G_A_b38	ATAD3C	2.99	0.00292	0.118503	3	0.03963	yes	THYROID
chr1_1504666_AAGAG_A_b38	ATAD3C	2.98	0.00303	0.124786	7	0.041881	yes	THYROID
chr1_2443457_G_A_b38	ATAD3C	2.979	0.00303	0.067248	16	0.022575	yes	THYROID
chr1_973693_C_T_b38	ATAD3C	-2.974	0.00308	-0.045798	93	0.015399	yes	THYROID
chr1_1531589_C_T_b38	ATAD3C	2.97	0.00312	0.072237	9	0.024326	yes	THYROID
chr1_625820_C_T_b38	ATAD3C	-2.967	0.00315	-0.152766	5	0.051485	yes	THYROID
chr1_1533754_T_C_b38	ATAD3C	2.96	0.00322	0.056665	47	0.019142	yes	THYROID
chr1_1642233_G_A_b38	ATAD3C	2.942	0.00341	0.184209	3	0.062609	yes	THYROID
chr1_1260310_G_C_b38	ATAD3C	2.922	0.00363	0.135195	3	0.04626	yes	THYROID
chr1_1351587_A_G_b38	ATAD3C	-2.922	0.00364	-0.133289	3	0.045624	yes	THYROID
chr1_1453961_C_T_b38	ATAD3C	-2.897	0.00393	-0.064477	11	0.022257	yes	THYROID
chr1_1479334_A_G_b38	ATAD3C	2.892	0.00399	0.087488	35	0.030252	yes	THYROID
chr1_1258096_G_C_b38	ATAD3C	2.886	0.00407	0.106371	3	0.036857	yes	THYROID
chr1_1422946_C_T_b38	ATAD3C	2.885	0.00409	0.107272	6	0.037186	yes	THYROID
chr1_2125296_T_C_b38	ATAD3C	2.875	0.00421	0.125629	11	0.043695	yes	THYROID
chr1_1534402_G_C_b38	ATAD3C	2.872	0.00425	0.072582	5	0.025274	yes	THYROID
chr1_1512492_GGCGGC_G_b38	ATAD3C	2.86	0.00442	0.125919	6	0.044033	yes	THYROID
chr1_1372258_T_C_b38	ATAD3C	2.828	0.00487	0.085804	8	0.030343	yes	THYROID
chr1_1504291_C_G_b38	ATAD3C	2.823	0.00495	0.118415	7	0.041947	yes	THYROID
chr1_2446607_C_T_b38	ATAD3C	2.801	0.0053	0.067746	7	0.024189	yes	THYROID
chr1_1375642_C_T_b38	ATAD3C	-2.78	0.00563	-0.067388	12	0.024237	yes	THYROID
chr1_1746452_A_AC_b38	ATAD3C	-2.78	0.00564	-0.176646	3	0.063546	yes	THYROID
chr1_1960047_A_G_b38	ATAD3C	2.76	0.00599	0.136426	6	0.04943	yes	THYROID
chr1_1573776_A_G_b38	ATAD3C	-2.745	0.00626	-0.050291	30	0.018319	yes	THYROID
chr1_1453870_A_C_b38	ATAD3C	-2.742	0.00633	-0.059037	13	0.021534	yes	THYROID
chr1_2309937_C_CTT_b38	ATAD3C	2.722	0.00671	0.044872	60	0.016483	yes	THYROID
chr1_1524911_C_T_b38	ATAD3C	-2.722	0.00672	-0.092965	13	0.034159	yes	THYROID
chr1_1192301_G_A_b38	ATAD3C	2.717	0.00681	0.068405	8	0.025174	yes	THYROID
chr1_1530546_A_ATT_b38	ATAD3C	2.711	0.00693	0.095282	11	0.035142	yes	THYROID
chr1_1501260_A_AT_b38	ATAD3C	2.71	0.00696	0.058475	24	0.021577	yes	THYROID
chr1_1284395_C_T_b38	ATAD3C	2.697	0.00722	0.109124	4	0.040456	yes	THYROID
chr1_1580890_C_T_b38	ATAD3C	-2.695	0.00728	-0.049608	30	0.018409	yes	THYROID
chr1_1281631_A_C_b38	ATAD3C	2.669	0.00785	0.066786	16	0.025021	yes	THYROID
chr1_1510082_T_TA_b38	ATAD3C	2.664	0.00798	0.074544	8	0.027986	yes	THYROID
chr1_2111657_G_A_b38	ATAD3C	2.65	0.00831	0.11939	10	0.045058	yes	THYROID
chr1_1355705_C_T_b38	ATAD3C	2.649	0.00833	0.115532	3	0.043616	yes	THYROID
chr1_1466535_C_CA_b38	ATAD3C	2.646	0.00839	0.061539	16	0.023254	yes	THYROID
chr1_1186644_T_C_b38	ATAD3C	2.646	0.0084	0.065853	8	0.024886	yes	THYROID
chr1_1187136_G_A_b38	ATAD3C	2.646	0.0084	0.065853	8	0.024886	yes	THYROID
chr1_1187726_G_A_b38	ATAD3C	2.646	0.0084	0.065853	8	0.024886	yes	THYROID
chr1_1188877_A_G_b38	ATAD3C	2.646	0.0084	0.065853	8	0.024886	yes	THYROID
chr1_1189511_G_A_b38	ATAD3C	2.646	0.0084	0.065853	8	0.024886	yes	THYROID
chr1_1190875_G_C_b38	ATAD3C	2.646	0.0084	0.065853	8	0.024886	yes	THYROID
chr1_1191614_G_A_b38	ATAD3C	2.646	0.0084	0.065853	8	0.024886	yes	THYROID
chr1_1192000_G_A_b38	ATAD3C	2.646	0.0084	0.065853	8	0.024886	yes	THYROID
chr1_1192127_G_A_b38	ATAD3C	2.646	0.0084	0.065853	8	0.024886	yes	THYROID
chr1_1192143_C_T_b38	ATAD3C	2.646	0.0084	0.065853	8	0.024886	yes	THYROID
chr1_1192951_G_T_b38	ATAD3C	2.646	0.0084	0.065853	8	0.024886	yes	THYROID
chr1_1193049_G_A_b38	ATAD3C	2.646	0.0084	0.065853	8	0.024886	yes	THYROID
chr1_1194292_G_T_b38	ATAD3C	2.646	0.0084	0.065853	8	0.024886	yes	THYROID
chr1_1194327_A_G_b38	ATAD3C	2.646	0.0084	0.065853	8	0.024886	yes	THYROID
chr1_1426253_G_A_b38	ATAD3C	-2.646	0.00841	-0.059414	13	0.022456	yes	THYROID
chr1_1530568_G_T_b38	ATAD3C	2.644	0.00845	0.093854	11	0.035498	yes	THYROID
chr1_788814_G_A_b38	ATAD3C	2.637	0.00861	0.12081	7	0.045805	yes	THYROID
chr1_968046_C_T_b38	ATAD3C	2.617	0.00914	0.045651	55	0.017446	yes	THYROID
chr1_1530549_G_GA_b38	ATAD3C	2.615	0.0092	0.093185	11	0.035638	yes	THYROID
chr1_1530550_C_A_b38	ATAD3C	2.615	0.0092	0.093185	11	0.035638	yes	THYROID
chr1_1530553_G_A_b38	ATAD3C	2.615	0.0092	0.093185	11	0.035638	yes	THYROID
chr1_2042765_C_CA_b38	ATAD3C	-2.605	0.00947	-0.054891	30	0.021074	yes	THYROID
chr1_1537805_T_G_b38	ATAD3C	2.603	0.0095	0.126469	5	0.048578	yes	THYROID
chr1_1383743_T_C_b38	ATAD3C	-2.586	0.00999	-0.064598	11	0.02498	yes	THYROID
chr1_1425095_A_G_b38	ATAD3C	-5.878	7.59e-09	-0.23507	5	0.039995	no	THYROID
chr1_1424727_C_A_b38	ATAD3C	-5.401	1.02e-07	-0.206706	6	0.038273	no	THYROID
chr1_1549967_C_G_b38	ATAD3C	-5.146	3.83e-07	-0.088111	46	0.017124	no	THYROID
chr1_1329353_C_G_b38	ATAD3C	-5.105	4.71e-07	-0.199855	5	0.039152	no	THYROID
chr1_1332271_G_A_b38	ATAD3C	-5.105	4.71e-07	-0.199855	5	0.039152	no	THYROID
chr1_1424819_C_T_b38	ATAD3C	-4.966	9.4e-07	-0.184032	8	0.037061	no	THYROID
chr1_1302224_T_C_b38	ATAD3C	-4.365	1.54e-05	-0.142144	3	0.032565	no	THYROID
chr1_1548572_A_AC_b38	ATAD3C	-4.365	1.55e-05	-0.157058	6	0.035984	no	THYROID
chr1_1441187_A_G_b38	ATAD3C	-4.188	3.32e-05	-0.079475	49	0.018975	no	THYROID
chr1_1325353_A_C_b38	ATAD3C	-4.168	3.62e-05	-0.123392	5	0.029606	no	THYROID
chr1_1329159_G_C_b38	ATAD3C	-4.168	3.62e-05	-0.123392	5	0.029606	no	THYROID
chr1_1541864_T_C_b38	ATAD3C	-4.029	6.47e-05	-0.071548	80	0.017758	no	THYROID
chr1_1028320_GCCC_G_b38	ATAD3C	4.017	6.79e-05	0.113725	6	0.028311	no	THYROID
chr1_1558726_C_CA_b38	ATAD3C	-3.99	7.59e-05	-0.070385	82	0.017641	no	THYROID
chr1_1561821_A_C_b38	ATAD3C	-3.99	7.59e-05	-0.070385	82	0.017641	no	THYROID
chr1_1545795_C_A_b38	ATAD3C	-3.982	7.84e-05	-0.070148	69	0.017616	no	THYROID
chr1_1454612_A_G_b38	ATAD3C	3.976	8.02e-05	0.167389	4	0.042096	no	THYROID
chr1_1543500_T_G_b38	ATAD3C	-3.94	9.29e-05	-0.069173	77	0.017555	no	THYROID
chr1_1454587_T_C_b38	ATAD3C	3.9	0.000109	0.171148	3	0.043879	no	THYROID
chr1_1312208_G_T_b38	ATAD3C	-3.864	0.000126	-0.138575	8	0.03586	no	THYROID
chr1_1551557_A_AG_b38	ATAD3C	-3.85	0.000134	-0.068004	81	0.017665	no	THYROID
chr1_1551559_A_T_b38	ATAD3C	-3.85	0.000134	-0.068004	81	0.017665	no	THYROID
chr1_1454676_T_A_b38	ATAD3C	3.833	0.000143	0.159296	4	0.041559	no	THYROID
chr1_1543953_A_G_b38	ATAD3C	-3.825	0.000147	-0.067616	78	0.017677	no	THYROID
chr1_1542773_T_C_b38	ATAD3C	-3.781	0.000175	-0.066692	78	0.017638	no	THYROID
chr1_1542793_C_G_b38	ATAD3C	-3.781	0.000175	-0.066692	78	0.017638	no	THYROID
chr1_1542800_T_C_b38	ATAD3C	-3.781	0.000175	-0.066692	78	0.017638	no	THYROID
chr1_1454581_T_C_b38	ATAD3C	3.78	0.000176	0.166558	3	0.044066	no	THYROID
chr1_1454582_A_C_b38	ATAD3C	3.78	0.000176	0.166558	3	0.044066	no	THYROID
chr1_1455134_T_A_b38	ATAD3C	3.765	0.000186	0.154888	4	0.041135	no	THYROID
chr1_1454579_T_C_b38	ATAD3C	3.764	0.000187	0.165812	3	0.044049	no	THYROID
chr1_1550064_GC_G_b38	ATAD3C	-3.738	0.000207	-0.06536	79	0.017487	no	THYROID
chr1_1550068_C_A_b38	ATAD3C	-3.738	0.000207	-0.06536	79	0.017487	no	THYROID
chr1_1453697_C_T_b38	ATAD3C	3.686	0.000252	0.156106	3	0.042349	no	THYROID
chr1_1509914_T_TA_b38	ATAD3C	-3.66	0.000279	-0.111477	4	0.03046	no	THYROID
chr1_1450193_C_T_b38	ATAD3C	3.651	0.000288	0.107336	10	0.029397	no	THYROID
chr1_1573654_T_C_b38	ATAD3C	-3.617	0.000328	-0.063148	82	0.017456	no	THYROID
chr1_1574445_A_G_b38	ATAD3C	-3.617	0.000328	-0.063148	82	0.017456	no	THYROID
chr1_1235602_C_A_b38	ATAD3C	-3.498	0.00051	-0.081959	9	0.023429	no	THYROID
chr1_1557495_CAT_C_b38	ATAD3C	-3.485	0.000536	-0.061805	82	0.017736	no	THYROID
chr1_1412042_ATCTAGGTCCCAGGTCCCAGGTCCGTCTAGGTCCCAGGTCCG_A_b38	ATAD3C	3.476	0.000552	0.116991	7	0.033654	no	THYROID
chr1_1566854_CA_C_b38	ATAD3C	-3.443	0.000624	-0.065194	54	0.018936	no	THYROID
chr1_1440430_C_G_b38	ATAD3C	-3.434	0.000643	-0.065216	43	0.01899	no	THYROID
chr1_1538787_A_G_b38	ATAD3C	-3.434	0.000644	-0.059327	86	0.017276	no	THYROID
chr1_1573079_A_G_b38	ATAD3C	-3.424	0.000667	-0.058778	88	0.017165	no	THYROID
chr1_1291869_T_C_b38	ATAD3C	3.4	0.000728	0.124606	3	0.036652	no	THYROID
chr1_1565105_CAAGGCAGGCGGATCATG_C_b38	ATAD3C	-3.391	0.000752	-0.057821	91	0.017053	no	THYROID
chr1_1569661_T_C_b38	ATAD3C	-3.389	0.000757	-0.057496	82	0.016967	no	THYROID
chr1_1304573_A_G_b38	ATAD3C	-3.36	0.000838	-0.114757	3	0.034152	no	THYROID
chr1_1295028_A_C_b38	ATAD3C	3.36	0.000838	0.114757	3	0.034152	no	THYROID
chr1_1295309_C_T_b38	ATAD3C	3.36	0.000838	0.114757	3	0.034152	no	THYROID
chr1_1296127_G_A_b38	ATAD3C	3.36	0.000838	0.114757	3	0.034152	no	THYROID
chr1_1299382_AG_A_b38	ATAD3C	3.36	0.000838	0.114757	3	0.034152	no	THYROID
chr1_1575724_G_C_b38	ATAD3C	-3.351	0.000866	-0.058184	80	0.017363	no	THYROID
chr1_1559750_C_CAG_b38	ATAD3C	-3.341	0.000898	-0.05744	89	0.017194	no	THYROID
chr1_1561628_T_C_b38	ATAD3C	-3.341	0.000898	-0.05744	89	0.017194	no	THYROID
chr1_1563918_A_G_b38	ATAD3C	-3.341	0.000898	-0.05744	89	0.017194	no	THYROID
chr1_1565561_A_G_b38	ATAD3C	-3.341	0.000898	-0.05744	89	0.017194	no	THYROID
chr1_1566086_G_A_b38	ATAD3C	-3.341	0.000898	-0.05744	89	0.017194	no	THYROID
chr1_1567715_G_A_b38	ATAD3C	-3.341	0.000898	-0.05744	89	0.017194	no	THYROID
chr1_1567719_A_C_b38	ATAD3C	-3.341	0.000898	-0.05744	89	0.017194	no	THYROID
chr1_1569875_C_T_b38	ATAD3C	-3.341	0.000898	-0.05744	89	0.017194	no	THYROID
chr1_1572532_A_C_b38	ATAD3C	-3.318	0.000974	-0.057023	89	0.017189	no	THYROID
chr1_1565680_A_AG_b38	ATAD3C	-3.307	0.00101	-0.057065	86	0.017254	no	THYROID
chr1_1290261_C_A_b38	ATAD3C	-3.297	0.00105	-0.071082	41	0.02156	no	THYROID
chr1_1571794_A_AT_b38	ATAD3C	-3.279	0.00111	-0.057464	76	0.017525	no	THYROID
chr1_1570294_CA_C_b38	ATAD3C	-3.246	0.00125	-0.056818	79	0.017505	no	THYROID
chr1_1577491_A_AC_b38	ATAD3C	-3.233	0.0013	-0.056513	84	0.017478	no	THYROID
chr1_1186414_G_A_b38	ATAD3C	3.225	0.00134	0.077375	9	0.023993	no	THYROID
chr1_1185634_G_A_b38	ATAD3C	3.152	0.00172	0.076567	9	0.024291	no	THYROID
chr1_1549590_C_G_b38	ATAD3C	-3.126	0.00187	-0.053508	86	0.017116	no	THYROID
chr1_1174573_G_A_b38	ATAD3C	-3.123	0.0019	-0.085709	7	0.027448	no	THYROID
chr1_1554694_A_G_b38	ATAD3C	-3.11	0.00198	-0.053141	86	0.017087	no	THYROID
chr1_1185961_C_T_b38	ATAD3C	3.099	0.00205	0.073459	9	0.023703	no	THYROID
chr1_1436388_CA_C_b38	ATAD3C	-3.085	0.00215	-0.058641	47	0.01901	no	THYROID
chr1_1186245_C_G_b38	ATAD3C	3.082	0.00217	0.07296	9	0.023669	no	THYROID
chr1_1553692_A_G_b38	ATAD3C	-3.081	0.00218	-0.052678	87	0.017097	no	THYROID
chr1_1555247_T_A_b38	ATAD3C	-3.081	0.00218	-0.052678	87	0.017097	no	THYROID
chr1_1291509_G_A_b38	ATAD3C	3.077	0.0022	0.11977	3	0.038922	no	THYROID
chr1_1173815_A_G_b38	ATAD3C	-3.043	0.00246	-0.079408	7	0.026095	no	THYROID
chr1_1401298_G_A_b38	ATAD3C	3.038	0.0025	0.108368	5	0.035668	no	THYROID
chr1_1554852_T_C_b38	ATAD3C	-3.034	0.00253	-0.05182	87	0.017077	no	THYROID
chr1_1551523_T_C_b38	ATAD3C	-3.027	0.0026	-0.054138	32	0.017885	no	THYROID
chr1_1439805_G_C_b38	ATAD3C	-3.012	0.00272	-0.061695	24	0.020481	no	THYROID
chr1_1174578_A_G_b38	ATAD3C	-3.007	0.00277	-0.074052	8	0.024629	no	THYROID
chr1_1848357_C_T_b38	ATAD3C	2.998	0.00286	0.109359	4	0.036482	no	THYROID
chr1_1301258_C_CT_b38	ATAD3C	2.982	0.003	0.125749	4	0.042169	no	THYROID
chr1_1291377_G_A_b38	ATAD3C	2.98	0.00302	0.109608	3	0.036781	no	THYROID
chr1_1569180_T_A_b38	ATAD3C	-2.966	0.00316	-0.051077	85	0.017223	no	THYROID
chr1_1402944_C_T_b38	ATAD3C	2.96	0.00323	0.105964	5	0.035803	no	THYROID
chr1_1226486_C_T_b38	ATAD3C	-2.928	0.00356	-0.068226	8	0.023297	no	THYROID
chr1_967369_C_G_b38	ATAD3C	-2.903	0.00386	-0.088358	3	0.030438	no	THYROID
chr1_1554781_A_G_b38	ATAD3C	-2.891	0.00401	-0.049394	87	0.017088	no	THYROID
chr1_1393591_C_T_b38	ATAD3C	2.85	0.00456	0.102338	5	0.035914	no	THYROID
chr1_1396732_A_G_b38	ATAD3C	2.85	0.00456	0.102338	5	0.035914	no	THYROID
chr1_1401102_T_C_b38	ATAD3C	2.85	0.00456	0.102338	5	0.035914	no	THYROID
chr1_1401840_G_A_b38	ATAD3C	2.85	0.00456	0.102338	5	0.035914	no	THYROID
chr1_1404347_G_T_b38	ATAD3C	2.85	0.00456	0.102338	5	0.035914	no	THYROID
chr1_1409102_A_G_b38	ATAD3C	2.85	0.00456	0.102338	5	0.035914	no	THYROID
chr1_1409159_A_G_b38	ATAD3C	2.85	0.00456	0.102338	5	0.035914	no	THYROID
chr1_1174747_C_T_b38	ATAD3C	-2.835	0.00476	-0.075981	8	0.0268	no	THYROID
chr1_1174523_C_T_b38	ATAD3C	-2.798	0.00534	-0.074836	8	0.026749	no	THYROID
chr1_1433060_T_C_b38	ATAD3C	2.786	0.00554	0.171771	3	0.06166	no	THYROID
chr1_1537160_T_G_b38	ATAD3C	-2.755	0.00607	-0.046409	101	0.016843	no	THYROID
chr1_1173724_G_T_b38	ATAD3C	-2.749	0.0062	-0.074638	8	0.027155	no	THYROID
chr1_928261_G_A_b38	ATAD3C	-2.746	0.00625	-0.063081	17	0.022974	no	THYROID
chr1_666028_G_A_b38	ATAD3C	-2.703	0.00711	-0.065878	10	0.024373	no	THYROID
chr1_1191942_G_A_b38	ATAD3C	2.698	0.00721	0.067849	7	0.025146	no	THYROID
chr1_1174845_C_T_b38	ATAD3C	-2.698	0.00721	-0.071992	8	0.026686	no	THYROID
chr1_2323077_G_A_b38	ATAD3C	-2.696	0.00726	-0.043157	92	0.016009	no	THYROID
chr1_1536667_C_T_b38	ATAD3C	2.678	0.00764	0.073425	4	0.027416	no	THYROID
chr1_1173996_G_A_b38	ATAD3C	-2.656	0.00816	-0.070695	8	0.026619	no	THYROID
chr1_1174174_G_C_b38	ATAD3C	-2.637	0.00862	-0.069899	8	0.026504	no	THYROID
chr1_1366951_A_AGT_b38	ATAD3C	2.62	0.00906	0.065101	11	0.024849	no	THYROID
chr1_1173138_T_C_b38	ATAD3C	-2.616	0.00917	-0.064101	9	0.024505	no	THYROID
chr1_2440123_T_C_b38	ATAD3C	2.606	0.00944	0.151464	4	0.05813	no	THYROID
chr1_1440834_C_G_b38	ATAD3C	-5.205	9.82e-07	-0.267519	19	0.051396	yes	UTERUS
chr1_1443457_T_C_b38	ATAD3C	-5.205	9.82e-07	-0.267519	19	0.051396	yes	UTERUS
chr1_1440430_C_G_b38	ATAD3C	-5.003	2.31e-06	-0.262323	13	0.052434	yes	UTERUS
chr1_1436079_A_G_b38	ATAD3C	-4.647	9.91e-06	-0.231869	20	0.049897	yes	UTERUS
chr1_1379083_AT_A_b38	ATAD3C	4.503	1.76e-05	0.267052	8	0.059305	yes	UTERUS
chr1_1433374_T_C_b38	ATAD3C	-4.491	1.84e-05	-0.225298	20	0.050171	yes	UTERUS
chr1_1439454_A_G_b38	ATAD3C	-4.444	2.21e-05	-0.236155	15	0.053141	yes	UTERUS
chr1_1538787_A_G_b38	ATAD3C	-4.319	3.59e-05	-0.218222	22	0.050522	yes	UTERUS
chr1_1366427_AGTGTGATTGAATGAGT_A_b38	ATAD3C	4.241	4.83e-05	0.263848	12	0.06221	yes	UTERUS
chr1_1370113_A_G_b38	ATAD3C	4.21	5.43e-05	0.239902	13	0.056981	yes	UTERUS
chr1_1566854_CA_C_b38	ATAD3C	-4.2	5.66e-05	-0.235731	14	0.056131	yes	UTERUS
chr1_1445187_T_G_b38	ATAD3C	-4.194	5.77e-05	-0.225819	19	0.053841	yes	UTERUS
chr1_1445240_A_G_b38	ATAD3C	-4.194	5.77e-05	-0.225819	19	0.053841	yes	UTERUS
chr1_1337898_A_G_b38	ATAD3C	4.134	7.23e-05	0.248427	5	0.06009	yes	UTERUS
chr1_1547630_G_A_b38	ATAD3C	-4.117	7.72e-05	-0.210798	22	0.051205	yes	UTERUS
chr1_1394423_A_G_b38	ATAD3C	-4.1	8.23e-05	-0.261516	16	0.063792	yes	UTERUS
chr1_1395346_A_G_b38	ATAD3C	-4.1	8.23e-05	-0.261516	16	0.063792	yes	UTERUS
chr1_1402457_A_G_b38	ATAD3C	-4.1	8.23e-05	-0.261516	16	0.063792	yes	UTERUS
chr1_1411323_A_C_b38	ATAD3C	-4.1	8.23e-05	-0.261516	16	0.063792	yes	UTERUS
chr1_2431888_G_C_b38	ATAD3C	-4.079	8.87e-05	-0.200454	14	0.04914	yes	UTERUS
chr1_1436388_CA_C_b38	ATAD3C	-4.063	9.43e-05	-0.221275	14	0.054463	yes	UTERUS
chr1_1312114_T_C_b38	ATAD3C	4.008	0.000115	0.253231	16	0.063187	yes	UTERUS
chr1_1358384_G_C_b38	ATAD3C	4.008	0.000115	0.253231	16	0.063187	yes	UTERUS
chr1_1366561_AGT_A_b38	ATAD3C	4.008	0.000115	0.253231	16	0.063187	yes	UTERUS
chr1_1309988_G_A_b38	ATAD3C	3.996	0.000121	0.250984	16	0.062811	yes	UTERUS
chr1_1313807_G_A_b38	ATAD3C	3.996	0.000121	0.250984	16	0.062811	yes	UTERUS
chr1_1565105_CAAGGCAGGCGGATCATG_C_b38	ATAD3C	-3.993	0.000122	-0.19742	24	0.049439	yes	UTERUS
chr1_2425473_G_A_b38	ATAD3C	-3.99	0.000123	-0.193034	14	0.048384	yes	UTERUS
chr1_1575421_C_T_b38	ATAD3C	-3.986	0.000125	-0.199898	23	0.050145	yes	UTERUS
chr1_1430908_A_G_b38	ATAD3C	-3.967	0.000134	-0.202693	20	0.051089	yes	UTERUS
chr1_1523187_A_G_b38	ATAD3C	-3.959	0.000138	-0.328751	5	0.083039	yes	UTERUS
chr1_1549590_C_G_b38	ATAD3C	-3.949	0.000143	-0.199563	23	0.050539	yes	UTERUS
chr1_1553692_A_G_b38	ATAD3C	-3.949	0.000143	-0.199563	23	0.050539	yes	UTERUS
chr1_1554694_A_G_b38	ATAD3C	-3.949	0.000143	-0.199563	23	0.050539	yes	UTERUS
chr1_1554781_A_G_b38	ATAD3C	-3.949	0.000143	-0.199563	23	0.050539	yes	UTERUS
chr1_1554852_T_C_b38	ATAD3C	-3.949	0.000143	-0.199563	23	0.050539	yes	UTERUS
chr1_1555247_T_A_b38	ATAD3C	-3.949	0.000143	-0.199563	23	0.050539	yes	UTERUS
chr1_1559750_C_CAG_b38	ATAD3C	-3.949	0.000143	-0.199563	23	0.050539	yes	UTERUS
chr1_1561628_T_C_b38	ATAD3C	-3.949	0.000143	-0.199563	23	0.050539	yes	UTERUS
chr1_1563918_A_G_b38	ATAD3C	-3.949	0.000143	-0.199563	23	0.050539	yes	UTERUS
chr1_1565561_A_G_b38	ATAD3C	-3.949	0.000143	-0.199563	23	0.050539	yes	UTERUS
chr1_1566086_G_A_b38	ATAD3C	-3.949	0.000143	-0.199563	23	0.050539	yes	UTERUS
chr1_1567715_G_A_b38	ATAD3C	-3.949	0.000143	-0.199563	23	0.050539	yes	UTERUS
chr1_1567719_A_C_b38	ATAD3C	-3.949	0.000143	-0.199563	23	0.050539	yes	UTERUS
chr1_1569661_T_C_b38	ATAD3C	-3.949	0.000143	-0.199563	23	0.050539	yes	UTERUS
chr1_1569875_C_T_b38	ATAD3C	-3.949	0.000143	-0.199563	23	0.050539	yes	UTERUS
chr1_1570294_CA_C_b38	ATAD3C	-3.949	0.000143	-0.199563	23	0.050539	yes	UTERUS
chr1_1572532_A_C_b38	ATAD3C	-3.949	0.000143	-0.199563	23	0.050539	yes	UTERUS
chr1_1415754_CCGCT_C_b38	ATAD3C	-3.928	0.000154	-0.278448	4	0.070886	yes	UTERUS
chr1_1415762_ATCCGCT_A_b38	ATAD3C	-3.928	0.000154	-0.278448	4	0.070886	yes	UTERUS
chr1_1387698_A_G_b38	ATAD3C	3.919	0.000159	0.251324	16	0.064123	yes	UTERUS
chr1_1389827_C_T_b38	ATAD3C	3.919	0.000159	0.251324	16	0.064123	yes	UTERUS
chr1_1441187_A_G_b38	ATAD3C	-3.914	0.000162	-0.221416	14	0.05657	yes	UTERUS
chr1_1426261_C_T_b38	ATAD3C	-3.902	0.000169	-0.199675	20	0.05117	yes	UTERUS
chr1_1426810_C_G_b38	ATAD3C	-3.902	0.000169	-0.199675	20	0.05117	yes	UTERUS
chr1_1428969_T_C_b38	ATAD3C	-3.902	0.000169	-0.199675	20	0.05117	yes	UTERUS
chr1_1430190_A_C_b38	ATAD3C	-3.902	0.000169	-0.199675	20	0.05117	yes	UTERUS
chr1_1431450_A_G_b38	ATAD3C	-3.902	0.000169	-0.199675	20	0.05117	yes	UTERUS
chr1_1431537_G_C_b38	ATAD3C	-3.902	0.000169	-0.199675	20	0.05117	yes	UTERUS
chr1_1577491_A_AC_b38	ATAD3C	-3.899	0.000171	-0.194089	24	0.049775	yes	UTERUS
chr1_1419214_A_G_b38	ATAD3C	-3.881	0.000183	-0.269501	7	0.069434	yes	UTERUS
chr1_1573654_T_C_b38	ATAD3C	-3.881	0.000183	-0.196052	23	0.050511	yes	UTERUS
chr1_1574445_A_G_b38	ATAD3C	-3.881	0.000183	-0.196052	23	0.050511	yes	UTERUS
chr1_1575724_G_C_b38	ATAD3C	-3.881	0.000183	-0.196052	23	0.050511	yes	UTERUS
chr1_1330125_G_A_b38	ATAD3C	3.876	0.000186	0.246071	16	0.063485	yes	UTERUS
chr1_2425138_A_G_b38	ATAD3C	-3.857	0.000199	-0.184647	15	0.047874	yes	UTERUS
chr1_2427319_C_T_b38	ATAD3C	-3.857	0.000199	-0.184647	15	0.047874	yes	UTERUS
chr1_1363898_C_T_b38	ATAD3C	3.821	0.000227	0.273784	3	0.071659	yes	UTERUS
chr1_1363986_C_T_b38	ATAD3C	3.821	0.000227	0.273784	3	0.071659	yes	UTERUS
chr1_1366529_TTAG_T_b38	ATAD3C	3.821	0.000227	0.273784	3	0.071659	yes	UTERUS
chr1_1400410_A_G_b38	ATAD3C	-3.75	0.000291	-0.238544	14	0.063609	yes	UTERUS
chr1_1367292_A_AGT_b38	ATAD3C	3.745	0.000296	0.269233	3	0.071894	yes	UTERUS
chr1_1571794_A_AT_b38	ATAD3C	-3.744	0.000297	-0.187388	21	0.050047	yes	UTERUS
chr1_1545795_C_A_b38	ATAD3C	-3.735	0.000307	-0.208507	18	0.055824	yes	UTERUS
chr1_2431330_C_CGT_b38	ATAD3C	-3.704	0.000342	-0.186972	20	0.050476	yes	UTERUS
chr1_1363456_CAG_C_b38	ATAD3C	3.678	0.000374	0.25554	4	0.069474	yes	UTERUS
chr1_1527386_C_T_b38	ATAD3C	-3.677	0.000376	-0.325983	4	0.088664	yes	UTERUS
chr1_1520875_A_G_b38	ATAD3C	-3.662	0.000396	-0.295197	4	0.080618	yes	UTERUS
chr1_1530002_A_G_b38	ATAD3C	-3.662	0.000396	-0.295197	4	0.080618	yes	UTERUS
chr1_1533018_T_C_b38	ATAD3C	-3.662	0.000396	-0.295197	4	0.080618	yes	UTERUS
chr1_1541864_T_C_b38	ATAD3C	-3.66	0.000398	-0.198871	19	0.054336	yes	UTERUS
chr1_1542773_T_C_b38	ATAD3C	-3.66	0.000398	-0.198871	19	0.054336	yes	UTERUS
chr1_1542793_C_G_b38	ATAD3C	-3.66	0.000398	-0.198871	19	0.054336	yes	UTERUS
chr1_1542800_T_C_b38	ATAD3C	-3.66	0.000398	-0.198871	19	0.054336	yes	UTERUS
chr1_1543953_A_G_b38	ATAD3C	-3.66	0.000398	-0.198871	19	0.054336	yes	UTERUS
chr1_2426634_C_T_b38	ATAD3C	-3.639	0.000427	-0.180065	20	0.049476	yes	UTERUS
chr1_1409623_T_C_b38	ATAD3C	-3.637	0.00043	-0.240496	6	0.066116	yes	UTERUS
chr1_1438102_G_C_b38	ATAD3C	-3.636	0.000433	-0.216723	8	0.059609	yes	UTERUS
chr1_1521518_G_A_b38	ATAD3C	-3.631	0.00044	-0.298101	4	0.082098	yes	UTERUS
chr1_1551557_A_AG_b38	ATAD3C	-3.602	0.000486	-0.189862	19	0.05271	yes	UTERUS
chr1_1551559_A_T_b38	ATAD3C	-3.602	0.000486	-0.189862	19	0.05271	yes	UTERUS
chr1_1431014_G_A_b38	ATAD3C	-3.601	0.000488	-0.198494	10	0.055122	yes	UTERUS
chr1_1557495_CAT_C_b38	ATAD3C	-3.594	5e-04	-0.19525	20	0.054332	yes	UTERUS
chr1_1376162_G_C_b38	ATAD3C	3.575	0.000533	0.228216	14	0.063841	yes	UTERUS
chr1_1377431_C_T_b38	ATAD3C	3.575	0.000533	0.228216	14	0.063841	yes	UTERUS
chr1_1378204_G_C_b38	ATAD3C	3.575	0.000533	0.228216	14	0.063841	yes	UTERUS
chr1_1384749_C_G_b38	ATAD3C	3.575	0.000533	0.228216	14	0.063841	yes	UTERUS
chr1_1387763_CCT_C_b38	ATAD3C	3.575	0.000533	0.228216	14	0.063841	yes	UTERUS
chr1_1388944_G_A_b38	ATAD3C	3.575	0.000533	0.228216	14	0.063841	yes	UTERUS
chr1_1365566_G_A_b38	ATAD3C	3.571	0.00054	0.253827	3	0.071075	yes	UTERUS
chr1_1550064_GC_G_b38	ATAD3C	-3.514	0.000655	-0.184681	20	0.052555	yes	UTERUS
chr1_1550068_C_A_b38	ATAD3C	-3.514	0.000655	-0.184681	20	0.052555	yes	UTERUS
chr1_1432355_G_A_b38	ATAD3C	-3.493	0.000704	-0.198996	10	0.056976	yes	UTERUS
chr1_1558726_C_CA_b38	ATAD3C	-3.484	0.000725	-0.185806	20	0.053338	yes	UTERUS
chr1_1561821_A_C_b38	ATAD3C	-3.484	0.000725	-0.185806	20	0.053338	yes	UTERUS
chr1_1517993_A_G_b38	ATAD3C	-3.473	0.000751	-0.211651	16	0.060938	yes	UTERUS
chr1_1519934_T_G_b38	ATAD3C	-3.473	0.000751	-0.211651	16	0.060938	yes	UTERUS
chr1_1519938_T_C_b38	ATAD3C	-3.473	0.000751	-0.211651	16	0.060938	yes	UTERUS
chr1_1534915_T_C_b38	ATAD3C	-3.465	0.000772	-0.351589	3	0.10147	yes	UTERUS
chr1_1431026_CCACCCCCT_C_b38	ATAD3C	-3.431	0.000864	-0.203041	9	0.059179	yes	UTERUS
chr1_2430201_G_T_b38	ATAD3C	-3.425	0.000881	-0.166224	16	0.048534	yes	UTERUS
chr1_1308516_C_T_b38	ATAD3C	3.4	0.000958	0.222397	15	0.065419	yes	UTERUS
chr1_1217251_C_A_b38	ATAD3C	-3.376	0.00104	-0.233425	4	0.069142	yes	UTERUS
chr1_1375698_G_T_b38	ATAD3C	3.355	0.00111	0.247986	3	0.073906	yes	UTERUS
chr1_1376153_G_C_b38	ATAD3C	3.355	0.00111	0.247986	3	0.073906	yes	UTERUS
chr1_1376752_T_C_b38	ATAD3C	3.355	0.00111	0.247986	3	0.073906	yes	UTERUS
chr1_1378635_C_T_b38	ATAD3C	3.355	0.00111	0.247986	3	0.073906	yes	UTERUS
chr1_1378792_C_T_b38	ATAD3C	3.355	0.00111	0.247986	3	0.073906	yes	UTERUS
chr1_1378865_C_T_b38	ATAD3C	3.355	0.00111	0.247986	3	0.073906	yes	UTERUS
chr1_1379334_A_G_b38	ATAD3C	3.355	0.00111	0.247986	3	0.073906	yes	UTERUS
chr1_1380513_C_T_b38	ATAD3C	3.355	0.00111	0.247986	3	0.073906	yes	UTERUS
chr1_1381290_C_G_b38	ATAD3C	3.355	0.00111	0.247986	3	0.073906	yes	UTERUS
chr1_1235997_A_G_b38	ATAD3C	-3.236	0.00163	-0.214685	6	0.066343	yes	UTERUS
chr1_1219858_G_A_b38	ATAD3C	-3.235	0.00163	-0.196847	6	0.060849	yes	UTERUS
chr1_1500729_G_A_b38	ATAD3C	-3.215	0.00174	-0.287014	5	0.08928	yes	UTERUS
chr1_1533841_T_C_b38	ATAD3C	-3.213	0.00175	-0.202459	6	0.063005	yes	UTERUS
chr1_1281631_A_C_b38	ATAD3C	-3.213	0.00175	-0.205199	7	0.063873	yes	UTERUS
chr1_1522905_A_G_b38	ATAD3C	-3.202	0.00181	-0.255429	4	0.079764	yes	UTERUS
chr1_1524202_G_A_b38	ATAD3C	-3.189	0.00188	-0.27089	4	0.084933	yes	UTERUS
chr1_1515567_A_C_b38	ATAD3C	-3.187	0.0019	-0.248864	3	0.078093	yes	UTERUS
chr1_1281640_G_C_b38	ATAD3C	-3.169	0.00201	-0.220268	4	0.069516	yes	UTERUS
chr1_1281878_G_C_b38	ATAD3C	-3.169	0.00201	-0.220268	4	0.069516	yes	UTERUS
chr1_1526169_C_T_b38	ATAD3C	-3.124	0.00231	-0.251244	4	0.080414	yes	UTERUS
chr1_1543500_T_G_b38	ATAD3C	-3.113	0.00239	-0.168593	19	0.054152	yes	UTERUS
chr1_1501260_A_AT_b38	ATAD3C	-3.102	0.00247	-0.213643	3	0.06887	yes	UTERUS
chr1_1259424_T_C_b38	ATAD3C	-3.086	0.0026	-0.188366	17	0.061038	yes	UTERUS
chr1_1524911_C_T_b38	ATAD3C	-3.059	0.00283	-0.293792	4	0.096044	yes	UTERUS
chr1_1258206_AT_A_b38	ATAD3C	-3.054	0.00286	-0.183343	16	0.060026	yes	UTERUS
chr1_2424298_TA_T_b38	ATAD3C	-3.024	0.00315	-0.137008	27	0.045312	yes	UTERUS
chr1_2424306_T_C_b38	ATAD3C	-3.024	0.00315	-0.137008	27	0.045312	yes	UTERUS
chr1_1447108_A_ATT_b38	ATAD3C	-3.024	0.00315	-0.184579	7	0.061045	yes	UTERUS
chr1_1379091_T_G_b38	ATAD3C	3.011	0.00327	0.221652	4	0.073621	yes	UTERUS
chr1_1523022_A_G_b38	ATAD3C	-2.995	0.00343	-0.236791	4	0.07905	yes	UTERUS
chr1_1388565_GTC_G_b38	ATAD3C	2.986	0.00352	0.178018	8	0.059611	yes	UTERUS
chr1_2428478_T_C_b38	ATAD3C	-2.97	0.0037	-0.176207	5	0.059335	yes	UTERUS
chr1_609015_G_A_b38	ATAD3C	-2.945	0.00398	-0.202976	3	0.068922	yes	UTERUS
chr1_1280044_T_C_b38	ATAD3C	-2.938	0.00406	-0.16717	19	0.056891	yes	UTERUS
chr1_1553018_CA_C_b38	ATAD3C	-2.871	0.00496	-0.169554	5	0.059056	yes	UTERUS
chr1_1419135_C_G_b38	ATAD3C	-2.87	0.00497	-0.233633	10	0.081393	yes	UTERUS
chr1_1422081_C_T_b38	ATAD3C	-2.87	0.00497	-0.233633	10	0.081393	yes	UTERUS
chr1_1641642_T_C_b38	ATAD3C	2.853	0.00523	0.168164	8	0.058942	yes	UTERUS
chr1_1435945_C_CCGGGCGGGGGCG_b38	ATAD3C	-2.836	0.00549	-0.192386	5	0.067841	yes	UTERUS
chr1_1361679_G_A_b38	ATAD3C	2.816	0.00583	0.20045	6	0.071194	yes	UTERUS
chr1_1497605_G_C_b38	ATAD3C	-2.781	0.00643	-0.159337	11	0.057289	yes	UTERUS
chr1_1471992_T_C_b38	ATAD3C	-2.777	0.00651	-0.18257	13	0.065742	yes	UTERUS
chr1_1549967_C_G_b38	ATAD3C	-2.757	0.00689	-0.14699	16	0.053315	yes	UTERUS
chr1_1546845_A_AAAC_b38	ATAD3C	-2.717	0.00771	-0.218146	3	0.080286	yes	UTERUS
chr1_2004070_T_C_b38	ATAD3C	2.704	0.008	0.170395	4	0.063011	yes	UTERUS
chr1_1239126_C_CT_b38	ATAD3C	-2.692	0.00828	-0.193768	3	0.071982	yes	UTERUS
chr1_1239127_A_ACATGCATCC_b38	ATAD3C	-2.692	0.00828	-0.193768	3	0.071982	yes	UTERUS
chr1_1239574_T_C_b38	ATAD3C	-2.692	0.00828	-0.193768	3	0.071982	yes	UTERUS
chr1_1240367_A_G_b38	ATAD3C	-2.692	0.00828	-0.193768	3	0.071982	yes	UTERUS
chr1_1428999_C_CA_b38	ATAD3C	-2.685	0.00845	-0.161016	5	0.059973	yes	UTERUS
chr1_1057460_ATT_A_b38	ATAD3C	-2.681	0.00855	-0.172394	5	0.064311	yes	UTERUS
chr1_1448915_G_A_b38	ATAD3C	-2.68	0.00857	-0.157967	14	0.058947	yes	UTERUS
chr1_2424477_C_T_b38	ATAD3C	-2.668	0.00886	-0.127183	25	0.047674	yes	UTERUS
chr1_1360507_T_TGGGGGGC_b38	ATAD3C	2.658	0.00909	0.183549	3	0.069048	yes	UTERUS
chr1_1442793_G_A_b38	ATAD3C	-2.627	0.0099	-0.178033	5	0.067758	yes	UTERUS
chr1_1532798_T_C_b38	ATAD3C	-4.193	5.79e-05	-0.206186	32	0.049169	no	UTERUS
chr1_1569180_T_A_b38	ATAD3C	-4.179	6.11e-05	-0.213534	21	0.051097	no	UTERUS
chr1_1573079_A_G_b38	ATAD3C	-3.853	0.000202	-0.195389	23	0.050707	no	UTERUS
chr1_1416747_CT_C_b38	ATAD3C	-3.784	0.000258	-0.259096	5	0.068468	no	UTERUS
chr1_1565680_A_AG_b38	ATAD3C	-3.778	0.000264	-0.189704	23	0.050214	no	UTERUS
chr1_1415221_G_T_b38	ATAD3C	-3.74	0.000301	-0.255781	5	0.068385	no	UTERUS
chr1_1417031_A_G_b38	ATAD3C	-3.702	0.000345	-0.263556	4	0.071202	no	UTERUS
chr1_1417000_C_T_b38	ATAD3C	-3.657	0.000402	-0.258681	5	0.070729	no	UTERUS
chr1_1567912_C_CAAAAAAA_b38	ATAD3C	-3.616	0.000463	-0.322772	3	0.089255	no	UTERUS
chr1_1410590_A_G_b38	ATAD3C	-3.612	0.00047	-0.252208	5	0.069829	no	UTERUS
chr1_1413898_T_C_b38	ATAD3C	-3.612	0.00047	-0.252208	5	0.069829	no	UTERUS
chr1_1415011_A_G_b38	ATAD3C	-3.612	0.00047	-0.252208	5	0.069829	no	UTERUS
chr1_1415385_T_C_b38	ATAD3C	-3.612	0.00047	-0.252208	5	0.069829	no	UTERUS
chr1_1415659_G_C_b38	ATAD3C	-3.612	0.00047	-0.252208	5	0.069829	no	UTERUS
chr1_1417561_A_G_b38	ATAD3C	-3.612	0.00047	-0.252208	5	0.069829	no	UTERUS
chr1_1418000_T_C_b38	ATAD3C	-3.612	0.00047	-0.252208	5	0.069829	no	UTERUS
chr1_1418181_A_G_b38	ATAD3C	-3.612	0.00047	-0.252208	5	0.069829	no	UTERUS
chr1_1418223_A_G_b38	ATAD3C	-3.612	0.00047	-0.252208	5	0.069829	no	UTERUS
chr1_1418252_A_G_b38	ATAD3C	-3.612	0.00047	-0.252208	5	0.069829	no	UTERUS
chr1_1417046_C_T_b38	ATAD3C	-3.609	0.000475	-0.25862	4	0.071667	no	UTERUS
chr1_1537160_T_G_b38	ATAD3C	-3.522	0.000637	-0.176375	26	0.050076	no	UTERUS
chr1_1217733_G_A_b38	ATAD3C	-3.27	0.00146	-0.212166	4	0.064881	no	UTERUS
chr1_1374694_C_G_b38	ATAD3C	3.233	0.00164	0.27701	4	0.085694	no	UTERUS
chr1_1395050_G_A_b38	ATAD3C	-3.215	0.00174	-0.230844	4	0.071794	no	UTERUS
chr1_1399922_C_T_b38	ATAD3C	-3.215	0.00174	-0.230844	4	0.071794	no	UTERUS
chr1_1402900_A_G_b38	ATAD3C	-3.215	0.00174	-0.230844	4	0.071794	no	UTERUS
chr1_1403240_CCTTT_C_b38	ATAD3C	-3.215	0.00174	-0.230844	4	0.071794	no	UTERUS
chr1_1405316_T_C_b38	ATAD3C	-3.215	0.00174	-0.230844	4	0.071794	no	UTERUS
chr1_1231710_CCCCCGGGAA_C_b38	ATAD3C	-3.117	0.00236	-0.187277	7	0.060087	no	UTERUS
chr1_1408286_G_A_b38	ATAD3C	-3.11	0.00242	-0.223513	4	0.071876	no	UTERUS
chr1_1409306_A_G_b38	ATAD3C	-3.11	0.00242	-0.223513	4	0.071876	no	UTERUS
chr1_1539491_G_C_b38	ATAD3C	-3.104	0.00246	-0.166787	21	0.053733	no	UTERUS
chr1_1573429_CAAAAAAAAAAAAAAAAAA_C_b38	ATAD3C	-3.064	0.00278	-0.159337	22	0.052	no	UTERUS
chr1_2379954_A_G_b38	ATAD3C	-3.036	0.00303	-0.155093	12	0.051087	no	UTERUS
chr1_1574655_GGC_G_b38	ATAD3C	-3.023	0.00316	-0.159519	22	0.052777	no	UTERUS
chr1_1385384_G_A_b38	ATAD3C	3.017	0.00321	0.216484	4	0.071748	no	UTERUS
chr1_1383798_AG_A_b38	ATAD3C	2.976	0.00364	0.210277	4	0.070668	no	UTERUS
chr1_1559703_G_C_b38	ATAD3C	-2.956	0.00386	-0.15596	22	0.052762	no	UTERUS
chr1_1568548_G_A_b38	ATAD3C	-2.956	0.00386	-0.15596	22	0.052762	no	UTERUS
chr1_1570587_C_T_b38	ATAD3C	-2.956	0.00386	-0.15596	22	0.052762	no	UTERUS
chr1_1524664_A_G_b38	ATAD3C	-2.885	0.00476	-0.183115	11	0.063477	no	UTERUS
chr1_2391602_T_C_b38	ATAD3C	-2.874	0.00491	-0.143581	13	0.049953	no	UTERUS
chr1_1575935_T_C_b38	ATAD3C	-2.874	0.00492	-0.156913	21	0.054604	no	UTERUS
chr1_1575864_G_A_b38	ATAD3C	-2.82	0.00576	-0.148326	22	0.052607	no	UTERUS
chr1_1537493_T_A_b38	ATAD3C	-2.812	0.00589	-0.148125	20	0.052681	no	UTERUS
chr1_1555871_T_C_b38	ATAD3C	-2.808	0.00596	-0.153337	19	0.05461	no	UTERUS
chr1_1324173_G_GGGCTCGGGGGCTGGGGGGCTGCTGGGCTGAGA_b38	ATAD3C	2.709	0.00789	0.120282	10	0.044398	no	UTERUS
chr1_1226486_C_T_b38	ATAD3C	-2.688	0.00837	-0.177123	4	0.065891	no	UTERUS
chr1_1551454_C_A_b38	ATAD3C	-2.646	0.00942	-0.141927	30	0.053645	no	UTERUS
chr1_1440430_C_G_b38	ATAD3C	-4.755	5.75e-06	-0.249272	8	0.05242	yes	VAGINA
chr1_1443457_T_C_b38	ATAD3C	-4.634	9.45e-06	-0.237696	14	0.051293	yes	VAGINA
chr1_1441187_A_G_b38	ATAD3C	-4.48	1.76e-05	-0.240448	9	0.053669	yes	VAGINA
chr1_1440834_C_G_b38	ATAD3C	-4.409	2.34e-05	-0.228302	14	0.051784	yes	VAGINA
chr1_1439454_A_G_b38	ATAD3C	-4.125	7e-05	-0.20967	13	0.050827	yes	VAGINA
chr1_1448915_G_A_b38	ATAD3C	-3.876	0.000176	-0.214815	10	0.055421	yes	VAGINA
chr1_1436388_CA_C_b38	ATAD3C	-3.852	0.000193	-0.202181	9	0.052488	yes	VAGINA
chr1_1442793_G_A_b38	ATAD3C	-3.78	0.000249	-0.231679	3	0.061292	yes	VAGINA
chr1_1445187_T_G_b38	ATAD3C	-3.728	3e-04	-0.197541	14	0.052994	yes	VAGINA
chr1_1445240_A_G_b38	ATAD3C	-3.728	3e-04	-0.197541	14	0.052994	yes	VAGINA
chr1_1432355_G_A_b38	ATAD3C	-3.672	0.000366	-0.192601	7	0.052457	yes	VAGINA
chr1_1394423_A_G_b38	ATAD3C	-3.36	0.00106	-0.199176	13	0.05928	yes	VAGINA
chr1_1395346_A_G_b38	ATAD3C	-3.347	0.0011	-0.197956	13	0.059149	yes	VAGINA
chr1_1402457_A_G_b38	ATAD3C	-3.347	0.0011	-0.197956	13	0.059149	yes	VAGINA
chr1_1411323_A_C_b38	ATAD3C	-3.347	0.0011	-0.197956	13	0.059149	yes	VAGINA
chr1_1434687_C_G_b38	ATAD3C	-3.34	0.00113	-0.205594	3	0.061546	yes	VAGINA
chr1_1387698_A_G_b38	ATAD3C	3.26	0.00146	0.193355	13	0.05932	yes	VAGINA
chr1_1389827_C_T_b38	ATAD3C	3.26	0.00146	0.193355	13	0.05932	yes	VAGINA
chr1_1471992_T_C_b38	ATAD3C	-3.251	0.00151	-0.199579	11	0.061392	yes	VAGINA
chr1_1002415_CT_C_b38	ATAD3C	3.23	0.00161	0.167625	9	0.051899	yes	VAGINA
chr1_1002417_T_A_b38	ATAD3C	3.2	0.00178	0.178873	7	0.055906	yes	VAGINA
chr1_1358384_G_C_b38	ATAD3C	3.163	0.00199	0.186411	13	0.058939	yes	VAGINA
chr1_1363601_A_AT_b38	ATAD3C	3.16	0.00201	0.1283	37	0.040601	yes	VAGINA
chr1_982260_G_A_b38	ATAD3C	-3.104	0.0024	-0.160725	7	0.051788	yes	VAGINA
chr1_982858_C_G_b38	ATAD3C	-3.104	0.0024	-0.160725	7	0.051788	yes	VAGINA
chr1_1449009_A_T_b38	ATAD3C	-3.09	0.0025	-0.203814	7	0.065954	yes	VAGINA
chr1_1439805_G_C_b38	ATAD3C	-3.08	0.00259	-0.174632	6	0.056708	yes	VAGINA
chr1_1366561_AGT_A_b38	ATAD3C	3.06	0.00275	0.179685	13	0.058723	yes	VAGINA
chr1_1361679_G_A_b38	ATAD3C	3.055	0.00279	0.186456	6	0.061036	yes	VAGINA
chr1_1574032_AAAG_A_b38	ATAD3C	-3.04	0.00292	-0.159164	9	0.052353	yes	VAGINA
chr1_1312114_T_C_b38	ATAD3C	2.953	0.00381	0.174167	12	0.058972	yes	VAGINA
chr1_1426253_G_A_b38	ATAD3C	-2.929	0.00409	-0.181472	3	0.061951	yes	VAGINA
chr1_1543953_A_G_b38	ATAD3C	-2.92	0.0042	-0.146998	18	0.050337	yes	VAGINA
chr1_1400410_A_G_b38	ATAD3C	-2.908	0.00436	-0.169743	10	0.058377	yes	VAGINA
chr1_1436079_A_G_b38	ATAD3C	-2.903	0.00442	-0.152341	15	0.052471	yes	VAGINA
chr1_1577491_A_AC_b38	ATAD3C	-2.895	0.00453	-0.14203	19	0.049064	yes	VAGINA
chr1_2363829_A_T_b38	ATAD3C	-2.893	0.00456	-0.117403	22	0.040587	yes	VAGINA
chr1_1575421_C_T_b38	ATAD3C	-2.88	0.00474	-0.14234	19	0.049427	yes	VAGINA
chr1_1433374_T_C_b38	ATAD3C	-2.858	0.00505	-0.150432	15	0.052632	yes	VAGINA
chr1_1447108_A_ATT_b38	ATAD3C	-2.851	0.00516	-0.157314	6	0.055177	yes	VAGINA
chr1_1541864_T_C_b38	ATAD3C	-2.826	0.00554	-0.142548	18	0.050433	yes	VAGINA
chr1_1542773_T_C_b38	ATAD3C	-2.826	0.00554	-0.142548	18	0.050433	yes	VAGINA
chr1_1542793_C_G_b38	ATAD3C	-2.826	0.00554	-0.142548	18	0.050433	yes	VAGINA
chr1_1542800_T_C_b38	ATAD3C	-2.826	0.00554	-0.142548	18	0.050433	yes	VAGINA
chr1_1551557_A_AG_b38	ATAD3C	-2.826	0.00554	-0.142548	18	0.050433	yes	VAGINA
chr1_1551559_A_T_b38	ATAD3C	-2.826	0.00554	-0.142548	18	0.050433	yes	VAGINA
chr1_1558726_C_CA_b38	ATAD3C	-2.826	0.00554	-0.142548	18	0.050433	yes	VAGINA
chr1_1561821_A_C_b38	ATAD3C	-2.826	0.00554	-0.142548	18	0.050433	yes	VAGINA
chr1_1384749_C_G_b38	ATAD3C	2.822	0.00561	0.165031	10	0.058475	yes	VAGINA
chr1_1387763_CCT_C_b38	ATAD3C	2.822	0.00561	0.165031	10	0.058475	yes	VAGINA
chr1_1388944_G_A_b38	ATAD3C	2.822	0.00561	0.165031	10	0.058475	yes	VAGINA
chr1_1538787_A_G_b38	ATAD3C	-2.815	0.00573	-0.137105	19	0.0487	yes	VAGINA
chr1_1550064_GC_G_b38	ATAD3C	-2.805	0.0059	-0.140429	18	0.050057	yes	VAGINA
chr1_1550068_C_A_b38	ATAD3C	-2.805	0.0059	-0.140429	18	0.050057	yes	VAGINA
chr1_1330125_G_A_b38	ATAD3C	2.799	0.00601	0.166145	13	0.059362	yes	VAGINA
chr1_1573654_T_C_b38	ATAD3C	-2.785	0.00626	-0.139332	18	0.050036	yes	VAGINA
chr1_1574445_A_G_b38	ATAD3C	-2.785	0.00626	-0.139332	18	0.050036	yes	VAGINA
chr1_1575724_G_C_b38	ATAD3C	-2.785	0.00626	-0.139332	18	0.050036	yes	VAGINA
chr1_1545795_C_A_b38	ATAD3C	-2.784	0.00628	-0.145899	14	0.052413	yes	VAGINA
chr1_1547630_G_A_b38	ATAD3C	-2.781	0.00633	-0.136874	17	0.04922	yes	VAGINA
chr1_1569661_T_C_b38	ATAD3C	-2.781	0.00633	-0.136874	17	0.04922	yes	VAGINA
chr1_1571794_A_AT_b38	ATAD3C	-2.77	0.00652	-0.139032	16	0.050185	yes	VAGINA
chr1_1566854_CA_C_b38	ATAD3C	-2.764	0.00664	-0.150126	10	0.054308	yes	VAGINA
chr1_1565680_A_AG_b38	ATAD3C	-2.743	0.00705	-0.133617	18	0.048706	yes	VAGINA
chr1_1302795_T_TC_b38	ATAD3C	2.74	0.00712	0.15632	15	0.057056	yes	VAGINA
chr1_1308178_GGGGCGCGGGGA_G_b38	ATAD3C	-2.731	0.00729	-0.156058	7	0.057135	yes	VAGINA
chr1_1497605_G_C_b38	ATAD3C	-2.721	0.0075	-0.146753	10	0.053928	yes	VAGINA
chr1_981169_A_G_b38	ATAD3C	2.704	0.00789	0.130536	12	0.048281	yes	VAGINA
chr1_1549590_C_G_b38	ATAD3C	-2.691	0.00818	-0.132054	19	0.049077	yes	VAGINA
chr1_1553692_A_G_b38	ATAD3C	-2.691	0.00818	-0.132054	19	0.049077	yes	VAGINA
chr1_1554781_A_G_b38	ATAD3C	-2.691	0.00818	-0.132054	19	0.049077	yes	VAGINA
chr1_1555247_T_A_b38	ATAD3C	-2.691	0.00818	-0.132054	19	0.049077	yes	VAGINA
chr1_1559750_C_CAG_b38	ATAD3C	-2.691	0.00818	-0.132054	19	0.049077	yes	VAGINA
chr1_1561628_T_C_b38	ATAD3C	-2.691	0.00818	-0.132054	19	0.049077	yes	VAGINA
chr1_1563918_A_G_b38	ATAD3C	-2.691	0.00818	-0.132054	19	0.049077	yes	VAGINA
chr1_1565105_CAAGGCAGGCGGATCATG_C_b38	ATAD3C	-2.691	0.00818	-0.132054	19	0.049077	yes	VAGINA
chr1_1565561_A_G_b38	ATAD3C	-2.691	0.00818	-0.132054	19	0.049077	yes	VAGINA
chr1_1566086_G_A_b38	ATAD3C	-2.691	0.00818	-0.132054	19	0.049077	yes	VAGINA
chr1_1567715_G_A_b38	ATAD3C	-2.691	0.00818	-0.132054	19	0.049077	yes	VAGINA
chr1_1567719_A_C_b38	ATAD3C	-2.691	0.00818	-0.132054	19	0.049077	yes	VAGINA
chr1_1569875_C_T_b38	ATAD3C	-2.691	0.00818	-0.132054	19	0.049077	yes	VAGINA
chr1_1570294_CA_C_b38	ATAD3C	-2.691	0.00818	-0.132054	19	0.049077	yes	VAGINA
chr1_1572532_A_C_b38	ATAD3C	-2.691	0.00818	-0.132054	19	0.049077	yes	VAGINA
chr1_1431656_G_A_b38	ATAD3C	-2.669	0.0087	-0.167406	3	0.062721	yes	VAGINA
chr1_1456829_G_C_b38	ATAD3C	-2.644	0.00932	-0.171028	6	0.064676	yes	VAGINA
chr1_1361685_C_T_b38	ATAD3C	-2.622	0.0099	-0.177453	4	0.067668	yes	VAGINA
chr1_1435945_C_CCGGGCGGGGGCG_b38	ATAD3C	-3.609	0.000455	-0.214029	4	0.059306	no	VAGINA
chr1_1524911_C_T_b38	ATAD3C	-3.469	0.000735	-0.327814	3	0.09451	no	VAGINA
chr1_1309988_G_A_b38	ATAD3C	3.003	0.00327	0.174398	14	0.058066	no	VAGINA
chr1_1313807_G_A_b38	ATAD3C	3.003	0.00327	0.174398	14	0.058066	no	VAGINA
chr1_1534915_T_C_b38	ATAD3C	-2.94	0.00396	-0.283412	4	0.096402	no	VAGINA
chr1_1378204_G_C_b38	ATAD3C	2.909	0.00435	0.17054	9	0.058631	no	VAGINA
chr1_1500729_G_A_b38	ATAD3C	-2.879	0.00474	-0.253529	5	0.088047	no	VAGINA
chr1_1376162_G_C_b38	ATAD3C	2.871	0.00487	0.167671	10	0.058406	no	VAGINA
chr1_1377431_C_T_b38	ATAD3C	2.871	0.00487	0.167671	10	0.058406	no	VAGINA
chr1_1292284_TTGAG_T_b38	ATAD3C	-2.75	0.00692	-0.179728	5	0.065361	no	VAGINA
chr1_1523187_A_G_b38	ATAD3C	-2.74	0.00712	-0.222027	5	0.08104	no	VAGINA
chr1_1370113_A_G_b38	ATAD3C	2.678	0.00847	0.149855	11	0.055951	no	VAGINA
chr1_1366427_AGTGTGATTGAATGAGT_A_b38	ATAD3C	2.647	0.00924	0.152731	9	0.057694	no	VAGINA
chr1_1489916_C_T_b38	ATAD3C	5.735	1.54e-08	0.060239	25	0.010503	yes	WHLBLD
chr1_1476515_AT_A_b38	ATAD3C	5.089	4.83e-07	0.056233	5	0.01105	yes	WHLBLD
chr1_1497105_T_G_b38	ATAD3C	4.829	1.75e-06	0.057872	5	0.011985	yes	WHLBLD
chr1_1490046_G_A_b38	ATAD3C	4.805	1.96e-06	0.05605	8	0.011664	yes	WHLBLD
chr1_1490047_A_G_b38	ATAD3C	4.805	1.96e-06	0.05605	8	0.011664	yes	WHLBLD
chr1_1487487_C_CA_b38	ATAD3C	4.503	8.04e-06	0.059347	5	0.013178	yes	WHLBLD
chr1_1301258_C_CT_b38	ATAD3C	4.345	1.64e-05	0.079103	4	0.018205	yes	WHLBLD
chr1_1496953_T_C_b38	ATAD3C	4.122	4.29e-05	0.043761	48	0.010617	yes	WHLBLD
chr1_1494616_G_A_b38	ATAD3C	4.061	5.53e-05	0.057061	3	0.014051	yes	WHLBLD
chr1_1496973_G_A_b38	ATAD3C	3.8	0.000159	0.042138	33	0.011088	yes	WHLBLD
chr1_1472158_C_G_b38	ATAD3C	3.707	0.000229	0.047174	19	0.012724	yes	WHLBLD
chr1_1518541_T_C_b38	ATAD3C	3.675	0.000259	0.033287	47	0.009058	yes	WHLBLD
chr1_1418223_A_G_b38	ATAD3C	3.608	0.000334	0.039777	19	0.011024	yes	WHLBLD
chr1_1473170_C_T_b38	ATAD3C	3.574	0.00038	0.051081	3	0.014292	yes	WHLBLD
chr1_1533754_T_C_b38	ATAD3C	3.569	0.000388	0.031363	55	0.008789	yes	WHLBLD
chr1_1418000_T_C_b38	ATAD3C	3.563	0.000396	0.039162	19	0.010992	yes	WHLBLD
chr1_1418252_A_G_b38	ATAD3C	3.563	0.000396	0.039162	19	0.010992	yes	WHLBLD
chr1_1419214_A_G_b38	ATAD3C	3.546	0.000422	0.03979	23	0.011221	yes	WHLBLD
chr1_1485510_G_A_b38	ATAD3C	3.52	0.000464	0.05333	3	0.01515	yes	WHLBLD
chr1_1415221_G_T_b38	ATAD3C	3.519	0.000466	0.038082	18	0.010821	yes	WHLBLD
chr1_1412042_ATCTAGGTCCCAGGTCCCAGGTCCGTCTAGGTCCCAGGTCCG_A_b38	ATAD3C	3.515	0.000474	0.052201	8	0.014853	yes	WHLBLD
chr1_1415385_T_C_b38	ATAD3C	3.505	0.000491	0.038855	18	0.011086	yes	WHLBLD
chr1_1415659_G_C_b38	ATAD3C	3.505	0.000491	0.038855	18	0.011086	yes	WHLBLD
chr1_1418181_A_G_b38	ATAD3C	3.504	0.000493	0.038635	19	0.011027	yes	WHLBLD
chr1_1417000_C_T_b38	ATAD3C	3.494	0.000511	0.03901	18	0.011165	yes	WHLBLD
chr1_1417561_A_G_b38	ATAD3C	3.493	0.000513	0.038637	18	0.011062	yes	WHLBLD
chr1_1415754_CCGCT_C_b38	ATAD3C	3.472	0.000555	0.038773	17	0.011169	yes	WHLBLD
chr1_1415762_ATCCGCT_A_b38	ATAD3C	3.472	0.000555	0.038773	17	0.011169	yes	WHLBLD
chr1_1302224_T_C_b38	ATAD3C	-3.453	0.000594	-0.051866	3	0.015021	yes	WHLBLD
chr1_858792_G_T_b38	ATAD3C	3.424	0.00066	0.080488	4	0.02351	yes	WHLBLD
chr1_1415011_A_G_b38	ATAD3C	3.416	0.000678	0.037823	18	0.011071	yes	WHLBLD
chr1_1188405_A_ATT_b38	ATAD3C	3.367	0.000809	0.040669	6	0.012079	yes	WHLBLD
chr1_1413898_T_C_b38	ATAD3C	3.356	0.00084	0.037278	18	0.011107	yes	WHLBLD
chr1_1410590_A_G_b38	ATAD3C	3.338	0.000897	0.037032	18	0.011095	yes	WHLBLD
chr1_1409623_T_C_b38	ATAD3C	3.313	0.000977	0.035575	21	0.010736	yes	WHLBLD
chr1_1430908_A_G_b38	ATAD3C	3.305	0.00101	0.028981	75	0.008769	yes	WHLBLD
chr1_1533841_T_C_b38	ATAD3C	3.286	0.00108	0.029113	54	0.008861	yes	WHLBLD
chr1_1329159_G_C_b38	ATAD3C	-3.264	0.00116	-0.043528	5	0.013338	yes	WHLBLD
chr1_1417046_C_T_b38	ATAD3C	3.253	0.00121	0.037173	16	0.011428	yes	WHLBLD
chr1_1439454_A_G_b38	ATAD3C	3.242	0.00125	0.026792	70	0.008264	yes	WHLBLD
chr1_1430190_A_C_b38	ATAD3C	3.234	0.00129	0.028475	75	0.008804	yes	WHLBLD
chr1_1395346_A_G_b38	ATAD3C	3.213	0.00138	0.029742	76	0.009256	yes	WHLBLD
chr1_1431450_A_G_b38	ATAD3C	3.21	0.0014	0.028235	75	0.008797	yes	WHLBLD
chr1_1431537_G_C_b38	ATAD3C	3.203	0.00143	0.028101	75	0.008773	yes	WHLBLD
chr1_1443457_T_C_b38	ATAD3C	3.189	0.0015	0.027424	79	0.0086	yes	WHLBLD
chr1_1417031_A_G_b38	ATAD3C	3.183	0.00153	0.03615	16	0.011358	yes	WHLBLD
chr1_1426261_C_T_b38	ATAD3C	3.179	0.00155	0.028059	73	0.008827	yes	WHLBLD
chr1_1325353_A_C_b38	ATAD3C	-3.17	0.0016	-0.04327	4	0.013651	yes	WHLBLD
chr1_1426810_C_G_b38	ATAD3C	3.161	0.00165	0.027875	74	0.008817	yes	WHLBLD
chr1_1322213_A_G_b38	ATAD3C	-3.132	0.00182	-0.043663	3	0.01394	yes	WHLBLD
chr1_1195100_G_A_b38	ATAD3C	3.076	0.00219	0.033642	10	0.010938	yes	WHLBLD
chr1_1197586_C_A_b38	ATAD3C	3.071	0.00223	0.033893	11	0.011035	yes	WHLBLD
chr1_1199327_G_A_b38	ATAD3C	3.064	0.00228	0.033904	11	0.011066	yes	WHLBLD
chr1_1587082_G_A_b38	ATAD3C	-3.053	0.00236	-0.031832	13	0.010426	yes	WHLBLD
chr1_1360901_TAC_T_b38	ATAD3C	3.002	0.0028	0.049043	4	0.016338	yes	WHLBLD
chr1_2342840_A_ATATTTTATTTTATTT_b38	ATAD3C	3.001	0.0028	0.039632	17	0.013207	yes	WHLBLD
chr1_1510841_C_T_b38	ATAD3C	3	0.00281	0.037197	4	0.012397	yes	WHLBLD
chr1_1319056_A_G_b38	ATAD3C	-3	0.00281	-0.045652	4	0.015216	yes	WHLBLD
chr1_1497606_C_G_b38	ATAD3C	2.975	0.00305	0.026721	22	0.008983	yes	WHLBLD
chr1_1437993_G_A_b38	ATAD3C	2.969	0.0031	0.026671	27	0.008982	yes	WHLBLD
chr1_2337239_T_C_b38	ATAD3C	-2.961	0.00319	-0.022562	58	0.00762	yes	WHLBLD
chr1_1510122_G_C_b38	ATAD3C	2.96	0.0032	0.036339	5	0.012276	yes	WHLBLD
chr1_928119_T_C_b38	ATAD3C	-2.958	0.00321	-0.04557	4	0.015403	yes	WHLBLD
chr1_928121_T_C_b38	ATAD3C	-2.932	0.0035	-0.038869	4	0.013258	yes	WHLBLD
chr1_1357006_CA_C_b38	ATAD3C	2.929	0.00353	0.047482	4	0.016211	yes	WHLBLD
chr1_1436079_A_G_b38	ATAD3C	2.926	0.00356	0.024642	79	0.008421	yes	WHLBLD
chr1_1375698_G_T_b38	ATAD3C	-2.926	0.00357	-0.035504	8	0.012136	yes	WHLBLD
chr1_1376153_G_C_b38	ATAD3C	-2.926	0.00357	-0.035504	8	0.012136	yes	WHLBLD
chr1_1376752_T_C_b38	ATAD3C	-2.926	0.00357	-0.035504	8	0.012136	yes	WHLBLD
chr1_1378635_C_T_b38	ATAD3C	-2.926	0.00357	-0.035504	8	0.012136	yes	WHLBLD
chr1_1378792_C_T_b38	ATAD3C	-2.926	0.00357	-0.035504	8	0.012136	yes	WHLBLD
chr1_1378865_C_T_b38	ATAD3C	-2.926	0.00357	-0.035504	8	0.012136	yes	WHLBLD
chr1_1379334_A_G_b38	ATAD3C	-2.926	0.00357	-0.035504	8	0.012136	yes	WHLBLD
chr1_1187016_C_T_b38	ATAD3C	2.919	0.00364	0.032375	10	0.011091	yes	WHLBLD
chr1_1370113_A_G_b38	ATAD3C	-2.911	0.00374	-0.024969	58	0.008577	yes	WHLBLD
chr1_1375788_G_C_b38	ATAD3C	2.91	0.00374	0.048733	4	0.016745	yes	WHLBLD
chr1_1381507_G_A_b38	ATAD3C	2.91	0.00374	0.048733	4	0.016745	yes	WHLBLD
chr1_1382885_A_G_b38	ATAD3C	2.91	0.00374	0.048733	4	0.016745	yes	WHLBLD
chr1_1197874_G_A_b38	ATAD3C	2.906	0.00379	0.032711	10	0.011255	yes	WHLBLD
chr1_1478568_T_C_b38	ATAD3C	2.89	0.004	0.053172	3	0.018402	yes	WHLBLD
chr1_2189011_G_GA_b38	ATAD3C	2.883	0.00408	0.021809	66	0.007565	yes	WHLBLD
chr1_1367498_T_C_b38	ATAD3C	2.88	0.00412	0.047102	4	0.016356	yes	WHLBLD
chr1_1533855_G_A_b38	ATAD3C	2.879	0.00414	0.028696	16	0.009968	yes	WHLBLD
chr1_1364223_G_A_b38	ATAD3C	2.877	0.00416	0.047357	4	0.016459	yes	WHLBLD
chr1_1366030_CTGTG_C_b38	ATAD3C	2.877	0.00416	0.047357	4	0.016459	yes	WHLBLD
chr1_1186939_C_T_b38	ATAD3C	2.863	0.00435	0.032139	10	0.011227	yes	WHLBLD
chr1_1502497_C_T_b38	ATAD3C	2.862	0.00435	0.035376	5	0.012358	yes	WHLBLD
chr1_1924207_T_C_b38	ATAD3C	-2.855	0.00445	-0.021003	75	0.007356	yes	WHLBLD
chr1_2011271_G_GTT_b38	ATAD3C	-2.848	0.00454	-0.022611	45	0.007938	yes	WHLBLD
chr1_1186414_G_A_b38	ATAD3C	2.841	0.00466	0.031307	10	0.011021	yes	WHLBLD
chr1_1186644_T_C_b38	ATAD3C	2.837	0.0047	0.031781	10	0.0112	yes	WHLBLD
chr1_1187136_G_A_b38	ATAD3C	2.837	0.0047	0.031781	10	0.0112	yes	WHLBLD
chr1_1187726_G_A_b38	ATAD3C	2.837	0.0047	0.031781	10	0.0112	yes	WHLBLD
chr1_1188877_A_G_b38	ATAD3C	2.837	0.0047	0.031781	10	0.0112	yes	WHLBLD
chr1_1189511_G_A_b38	ATAD3C	2.837	0.0047	0.031781	10	0.0112	yes	WHLBLD
chr1_1190875_G_C_b38	ATAD3C	2.837	0.0047	0.031781	10	0.0112	yes	WHLBLD
chr1_1191942_G_A_b38	ATAD3C	2.837	0.0047	0.031781	10	0.0112	yes	WHLBLD
chr1_1192000_G_A_b38	ATAD3C	2.837	0.0047	0.031781	10	0.0112	yes	WHLBLD
chr1_1192127_G_A_b38	ATAD3C	2.837	0.0047	0.031781	10	0.0112	yes	WHLBLD
chr1_1192143_C_T_b38	ATAD3C	2.837	0.0047	0.031781	10	0.0112	yes	WHLBLD
chr1_1192951_G_T_b38	ATAD3C	2.837	0.0047	0.031781	10	0.0112	yes	WHLBLD
chr1_1193049_G_A_b38	ATAD3C	2.837	0.0047	0.031781	10	0.0112	yes	WHLBLD
chr1_1194292_G_T_b38	ATAD3C	2.837	0.0047	0.031781	10	0.0112	yes	WHLBLD
chr1_1194327_A_G_b38	ATAD3C	2.837	0.0047	0.031781	10	0.0112	yes	WHLBLD
chr1_1194713_C_T_b38	ATAD3C	2.837	0.0047	0.031781	10	0.0112	yes	WHLBLD
chr1_1197558_G_A_b38	ATAD3C	2.837	0.00471	0.032364	10	0.011409	yes	WHLBLD
chr1_1186092_C_CT_b38	ATAD3C	2.809	0.00513	0.031315	5	0.011147	yes	WHLBLD
chr1_1433374_T_C_b38	ATAD3C	2.804	0.00521	0.023727	82	0.008462	yes	WHLBLD
chr1_904493_C_T_b38	ATAD3C	2.796	0.00533	0.044207	3	0.015809	yes	WHLBLD
chr1_1187013_A_AT_b38	ATAD3C	2.784	0.00554	0.031083	10	0.011165	yes	WHLBLD
chr1_2049679_A_C_b38	ATAD3C	2.772	0.00574	0.032053	8	0.011563	yes	WHLBLD
chr1_1189730_T_C_b38	ATAD3C	2.767	0.00583	0.031415	10	0.011352	yes	WHLBLD
chr1_1572877_TG_T_b38	ATAD3C	-2.764	0.00589	-0.023275	31	0.008421	yes	WHLBLD
chr1_1362042_C_T_b38	ATAD3C	-2.761	0.00595	-0.034735	5	0.012582	yes	WHLBLD
chr1_1360989_GAC_G_b38	ATAD3C	-2.751	0.00612	-0.034708	5	0.012615	yes	WHLBLD
chr1_1185634_G_A_b38	ATAD3C	2.749	0.00615	0.030593	10	0.011127	yes	WHLBLD
chr1_1531589_C_T_b38	ATAD3C	2.736	0.0064	0.030618	9	0.011191	yes	WHLBLD
chr1_1354531_G_A_b38	ATAD3C	-2.736	0.00641	-0.034242	5	0.012517	yes	WHLBLD
chr1_2047973_C_G_b38	ATAD3C	2.734	0.00645	0.031553	8	0.011543	yes	WHLBLD
chr1_1191614_G_A_b38	ATAD3C	2.731	0.0065	0.030508	10	0.011172	yes	WHLBLD
chr1_1335073_C_T_b38	ATAD3C	2.73	0.00651	0.043975	4	0.016106	yes	WHLBLD
chr1_1340336_T_A_b38	ATAD3C	2.73	0.00651	0.043975	4	0.016106	yes	WHLBLD
chr1_1340746_G_GCA_b38	ATAD3C	2.73	0.00651	0.043975	4	0.016106	yes	WHLBLD
chr1_1340983_T_C_b38	ATAD3C	2.73	0.00651	0.043975	4	0.016106	yes	WHLBLD
chr1_1342269_G_T_b38	ATAD3C	2.73	0.00651	0.043975	4	0.016106	yes	WHLBLD
chr1_1379083_AT_A_b38	ATAD3C	-2.728	0.00656	-0.023862	34	0.008748	yes	WHLBLD
chr1_1197405_C_T_b38	ATAD3C	2.725	0.00662	0.030268	11	0.011108	yes	WHLBLD
chr1_2051107_G_A_b38	ATAD3C	2.716	0.0068	0.032006	7	0.011785	yes	WHLBLD
chr1_1295028_A_C_b38	ATAD3C	2.706	0.00701	0.041593	3	0.015373	yes	WHLBLD
chr1_1295309_C_T_b38	ATAD3C	2.706	0.00701	0.041593	3	0.015373	yes	WHLBLD
chr1_1296127_G_A_b38	ATAD3C	2.706	0.00701	0.041593	3	0.015373	yes	WHLBLD
chr1_1299382_AG_A_b38	ATAD3C	2.706	0.00701	0.041593	3	0.015373	yes	WHLBLD
chr1_1304573_A_G_b38	ATAD3C	-2.706	0.00701	-0.041593	3	0.015373	yes	WHLBLD
chr1_1360302_A_G_b38	ATAD3C	-2.702	0.0071	-0.033936	5	0.012561	yes	WHLBLD
chr1_1187008_G_A_b38	ATAD3C	2.694	0.00725	0.029896	10	0.011096	yes	WHLBLD
chr1_919049_G_A_b38	ATAD3C	-2.688	0.00738	-0.048594	6	0.018077	yes	WHLBLD
chr1_1179830_G_A_b38	ATAD3C	2.676	0.00765	0.027399	14	0.010239	yes	WHLBLD
chr1_2052262_G_A_b38	ATAD3C	2.672	0.00774	0.031663	7	0.011849	yes	WHLBLD
chr1_1190431_A_AT_b38	ATAD3C	2.669	0.00781	0.030691	4	0.011499	yes	WHLBLD
chr1_2194537_C_A_b38	ATAD3C	2.663	0.00796	0.022665	36	0.008512	yes	WHLBLD
chr1_1363031_C_T_b38	ATAD3C	-2.662	0.00798	-0.033499	5	0.012586	yes	WHLBLD
chr1_1363157_C_T_b38	ATAD3C	-2.662	0.00798	-0.033499	5	0.012586	yes	WHLBLD
chr1_2047814_G_A_b38	ATAD3C	2.659	0.00804	0.030738	8	0.011559	yes	WHLBLD
chr1_1189019_C_G_b38	ATAD3C	2.658	0.00808	0.029319	10	0.011031	yes	WHLBLD
chr1_1189968_T_C_b38	ATAD3C	2.658	0.00808	0.029319	10	0.011031	yes	WHLBLD
chr1_1190856_G_A_b38	ATAD3C	2.658	0.00808	0.029319	10	0.011031	yes	WHLBLD
chr1_1331045_G_A_b38	ATAD3C	2.651	0.00823	0.043053	4	0.016239	yes	WHLBLD
chr1_918425_C_T_b38	ATAD3C	-2.647	0.00834	-0.047927	6	0.018108	yes	WHLBLD
chr1_1343267_C_A_b38	ATAD3C	2.627	0.00885	0.040835	5	0.015547	yes	WHLBLD
chr1_1458730_G_GTT_b38	ATAD3C	2.626	0.00887	0.048123	6	0.018328	yes	WHLBLD
chr1_1199253_C_T_b38	ATAD3C	2.625	0.00888	0.027211	15	0.010365	yes	WHLBLD
chr1_1424102_G_T_b38	ATAD3C	2.619	0.00905	0.030035	12	0.011469	yes	WHLBLD
chr1_2089758_A_G_b38	ATAD3C	-2.614	0.00917	-0.022774	42	0.008712	yes	WHLBLD
chr1_1196061_C_T_b38	ATAD3C	2.613	0.00921	0.0301	10	0.01152	yes	WHLBLD
chr1_2098662_C_CGTTTT_b38	ATAD3C	2.598	0.00962	0.047595	4	0.018323	yes	WHLBLD
chr1_1192301_G_A_b38	ATAD3C	2.587	0.0099	0.029292	10	0.011321	yes	WHLBLD
chr1_1474201_CT_C_b38	ATAD3C	5.957	4.38e-09	0.058336	45	0.009792	no	WHLBLD
chr1_1468856_C_T_b38	ATAD3C	5.687	2.02e-08	0.066629	21	0.011716	no	WHLBLD
chr1_1468592_C_CG_b38	ATAD3C	5.303	1.6e-07	0.062701	22	0.011824	no	WHLBLD
chr1_1490027_A_G_b38	ATAD3C	5.259	2.02e-07	0.055297	42	0.010514	no	WHLBLD
chr1_1490032_A_G_b38	ATAD3C	5.259	2.02e-07	0.055297	42	0.010514	no	WHLBLD
chr1_1490320_T_C_b38	ATAD3C	5.239	2.24e-07	0.055273	49	0.010551	no	WHLBLD
chr1_1492619_A_AC_b38	ATAD3C	5.239	2.24e-07	0.055273	49	0.010551	no	WHLBLD
chr1_1495204_T_C_b38	ATAD3C	5.2	2.74e-07	0.05456	36	0.010492	no	WHLBLD
chr1_1473089_T_C_b38	ATAD3C	5.183	2.99e-07	0.054059	47	0.01043	no	WHLBLD
chr1_1468094_G_C_b38	ATAD3C	5.117	4.19e-07	0.061764	19	0.01207	no	WHLBLD
chr1_1482624_T_C_b38	ATAD3C	5.036	6.31e-07	0.052708	50	0.010467	no	WHLBLD
chr1_1488652_A_G_b38	ATAD3C	5.015	7e-07	0.052992	50	0.010567	no	WHLBLD
chr1_1492292_C_G_b38	ATAD3C	5.015	7e-07	0.052992	50	0.010567	no	WHLBLD
chr1_1492850_G_A_b38	ATAD3C	5.015	7e-07	0.052992	50	0.010567	no	WHLBLD
chr1_1486611_G_A_b38	ATAD3C	4.973	8.64e-07	0.054746	29	0.011009	no	WHLBLD
chr1_1487887_A_G_b38	ATAD3C	4.952	9.57e-07	0.052273	50	0.010556	no	WHLBLD
chr1_1476266_T_C_b38	ATAD3C	4.922	1.11e-06	0.051191	51	0.010401	no	WHLBLD
chr1_1481959_C_T_b38	ATAD3C	4.892	1.29e-06	0.052662	35	0.010766	no	WHLBLD
chr1_1483898_G_A_b38	ATAD3C	4.735	2.74e-06	0.05121	49	0.010815	no	WHLBLD
chr1_1486151_C_A_b38	ATAD3C	4.685	3.47e-06	0.050595	49	0.0108	no	WHLBLD
chr1_1482402_A_G_b38	ATAD3C	4.669	3.74e-06	0.047208	68	0.010111	no	WHLBLD
chr1_1469088_T_C_b38	ATAD3C	4.228	2.73e-05	0.049592	40	0.011729	no	WHLBLD
chr1_1468048_A_G_b38	ATAD3C	4.187	3.26e-05	0.049927	29	0.011925	no	WHLBLD
chr1_1471144_G_C_b38	ATAD3C	4.166	3.56e-05	0.049798	44	0.011954	no	WHLBLD
chr1_1470034_T_C_b38	ATAD3C	4.113	4.45e-05	0.048921	44	0.011894	no	WHLBLD
chr1_1469429_A_G_b38	ATAD3C	4.085	5.01e-05	0.048465	44	0.011864	no	WHLBLD
chr1_1476079_T_C_b38	ATAD3C	3.927	9.59e-05	0.041326	47	0.010523	no	WHLBLD
chr1_1468254_T_A_b38	ATAD3C	3.903	0.000106	0.066844	5	0.017124	no	WHLBLD
chr1_1469469_G_C_b38	ATAD3C	3.84	0.000136	0.066076	5	0.017205	no	WHLBLD
chr1_1450193_C_T_b38	ATAD3C	3.813	0.000151	0.047886	19	0.012558	no	WHLBLD
chr1_1445240_A_G_b38	ATAD3C	3.804	0.000157	0.032335	78	0.008501	no	WHLBLD
chr1_1479334_A_G_b38	ATAD3C	3.73	0.000209	0.048812	46	0.013085	no	WHLBLD
chr1_1449831_A_G_b38	ATAD3C	3.683	0.000251	0.033477	71	0.009088	no	WHLBLD
chr1_1445187_T_G_b38	ATAD3C	3.68	0.000254	0.031371	72	0.008524	no	WHLBLD
chr1_1518285_T_C_b38	ATAD3C	3.659	0.000275	0.034639	74	0.009466	no	WHLBLD
chr1_1468062_A_T_b38	ATAD3C	3.618	0.000322	0.058876	8	0.016273	no	WHLBLD
chr1_1451787_A_C_b38	ATAD3C	3.611	0.000331	0.030318	62	0.008396	no	WHLBLD
chr1_1452797_C_CA_b38	ATAD3C	3.567	0.00039	0.064693	3	0.018138	no	WHLBLD
chr1_1448775_G_GT_b38	ATAD3C	3.427	0.000652	0.0458	3	0.013365	no	WHLBLD
chr1_1459632_T_C_b38	ATAD3C	3.4	0.000718	0.043079	32	0.01267	no	WHLBLD
chr1_1512376_G_C_b38	ATAD3C	3.39	0.000746	0.032394	49	0.009557	no	WHLBLD
chr1_1501260_A_AT_b38	ATAD3C	3.364	0.000818	0.032377	28	0.009625	no	WHLBLD
chr1_1433010_ACCGCTGCCCCTCACCG_A_b38	ATAD3C	3.307	0.000998	0.062993	4	0.019046	no	WHLBLD
chr1_1452511_A_G_b38	ATAD3C	3.288	0.00107	0.028591	73	0.008696	no	WHLBLD
chr1_1452888_C_A_b38	ATAD3C	3.288	0.00107	0.028591	73	0.008696	no	WHLBLD
chr1_1452909_A_C_b38	ATAD3C	3.288	0.00107	0.028591	73	0.008696	no	WHLBLD
chr1_1454092_A_G_b38	ATAD3C	3.288	0.00107	0.028591	73	0.008696	no	WHLBLD
chr1_1513923_G_C_b38	ATAD3C	3.282	0.00109	0.029993	56	0.009139	no	WHLBLD
chr1_1453703_A_G_b38	ATAD3C	3.279	0.0011	0.028508	73	0.008694	no	WHLBLD
chr1_1791172_A_AT_b38	ATAD3C	-3.26	0.00118	-0.029187	37	0.008953	no	WHLBLD
chr1_1182832_T_C_b38	ATAD3C	3.245	0.00124	0.026189	86	0.00807	no	WHLBLD
chr1_1501403_T_C_b38	ATAD3C	3.238	0.00127	0.030869	51	0.009532	no	WHLBLD
chr1_1416747_CT_C_b38	ATAD3C	3.229	0.00131	0.035423	18	0.010972	no	WHLBLD
chr1_1459662_C_T_b38	ATAD3C	3.2	0.00144	0.040954	35	0.012796	no	WHLBLD
chr1_1455617_T_G_b38	ATAD3C	3.163	0.00164	0.027491	74	0.008693	no	WHLBLD
chr1_1459658_G_A_b38	ATAD3C	3.143	0.00175	0.040201	43	0.012789	no	WHLBLD
chr1_1511945_G_A_b38	ATAD3C	3.142	0.00176	0.030449	50	0.00969	no	WHLBLD
chr1_1002415_C_CATTTTTT_b38	ATAD3C	3.137	0.00179	0.03817	19	0.012167	no	WHLBLD
chr1_1430906_G_T_b38	ATAD3C	3.136	0.0018	0.060002	3	0.019133	no	WHLBLD
chr1_1516000_T_C_b38	ATAD3C	3.127	0.00185	0.028894	56	0.009241	no	WHLBLD
chr1_1411847_TCCAGGTC_T_b38	ATAD3C	3.126	0.00186	0.044864	10	0.01435	no	WHLBLD
chr1_1402457_A_G_b38	ATAD3C	3.121	0.00189	0.028978	78	0.009284	no	WHLBLD
chr1_1411323_A_C_b38	ATAD3C	3.113	0.00194	0.029018	80	0.009322	no	WHLBLD
chr1_1485282_A_G_b38	ATAD3C	3.099	0.00204	0.051805	13	0.016719	no	WHLBLD
chr1_1440834_C_G_b38	ATAD3C	3.097	0.00205	0.026466	75	0.008547	no	WHLBLD
chr1_1517993_A_G_b38	ATAD3C	3.088	0.00211	0.024194	110	0.007835	no	WHLBLD
chr1_2436513_TCC_T_b38	ATAD3C	3.085	0.00213	0.059043	6	0.019139	no	WHLBLD
chr1_1422081_C_T_b38	ATAD3C	3.07	0.00223	0.037083	50	0.012078	no	WHLBLD
chr1_1192776_CAGTGTAGACACTCCAGTTGGTATG_C_b38	ATAD3C	3.066	0.00226	0.038671	7	0.012611	no	WHLBLD
chr1_2436516_TCCCTCCTCCTTTCCTCCTTCCTCCCTCCTCCCTTC_T_b38	ATAD3C	3.061	0.00231	0.058562	6	0.019135	no	WHLBLD
chr1_1519934_T_G_b38	ATAD3C	3.059	0.00232	0.023967	110	0.007834	no	WHLBLD
chr1_1519938_T_C_b38	ATAD3C	3.059	0.00232	0.023967	110	0.007834	no	WHLBLD
chr1_1445055_G_A_b38	ATAD3C	3.047	0.00241	0.038214	3	0.012542	no	WHLBLD
chr1_1458448_C_CT_b38	ATAD3C	3.023	0.00261	0.046027	8	0.015225	no	WHLBLD
chr1_1419135_C_G_b38	ATAD3C	3.004	0.00277	0.036074	48	0.012007	no	WHLBLD
chr1_1425135_T_C_b38	ATAD3C	2.991	0.0029	0.040603	6	0.013577	no	WHLBLD
chr1_1442722_A_G_b38	ATAD3C	2.986	0.00294	0.051259	3	0.017165	no	WHLBLD
chr1_1360502_G_GGGGGCGGGC_b38	ATAD3C	-2.985	0.00295	-0.034263	6	0.011476	no	WHLBLD
chr1_591509_C_T_b38	ATAD3C	2.956	0.00324	0.078474	3	0.026544	no	WHLBLD
chr1_1380513_C_T_b38	ATAD3C	-2.931	0.00351	-0.036144	8	0.012332	no	WHLBLD
chr1_1381290_C_G_b38	ATAD3C	-2.931	0.00351	-0.036144	8	0.012332	no	WHLBLD
chr1_1281631_A_C_b38	ATAD3C	2.921	0.00362	0.032293	19	0.011056	no	WHLBLD
chr1_1449009_A_T_b38	ATAD3C	2.918	0.00365	0.027197	50	0.00932	no	WHLBLD
chr1_1530331_T_C_b38	ATAD3C	2.917	0.00367	0.027065	57	0.00928	no	WHLBLD
chr1_1454770_T_C_b38	ATAD3C	2.904	0.00382	0.02527	75	0.008703	no	WHLBLD
chr1_1500745_A_C_b38	ATAD3C	2.895	0.00393	0.033952	59	0.011726	no	WHLBLD
chr1_668910_A_G_b38	ATAD3C	2.892	0.00397	0.083418	3	0.028844	no	WHLBLD
chr1_1041119_GGGC_G_b38	ATAD3C	2.85	0.00453	0.016053	47	0.005633	no	WHLBLD
chr1_967724_C_T_b38	ATAD3C	-2.843	0.00462	-0.038534	22	0.013553	no	WHLBLD
chr1_1454581_T_C_b38	ATAD3C	2.834	0.00476	0.053913	6	0.019026	no	WHLBLD
chr1_1454582_A_C_b38	ATAD3C	2.834	0.00476	0.053913	6	0.019026	no	WHLBLD
chr1_1518689_A_ACC_b38	ATAD3C	2.829	0.00483	0.034679	3	0.012259	no	WHLBLD
chr1_1394423_A_G_b38	ATAD3C	2.827	0.00485	0.026023	77	0.009204	no	WHLBLD
chr1_1804000_AAAAG_A_b38	ATAD3C	2.827	0.00485	0.060012	4	0.021225	no	WHLBLD
chr1_1408286_G_A_b38	ATAD3C	2.794	0.00538	0.032026	12	0.011464	no	WHLBLD
chr1_1749605_C_CGTCCATGCATATTTTTCTGTGTGATGTGTCTGTGTGTGTGTCTCAGTGGT_b38	ATAD3C	-2.776	0.00568	-0.017412	73	0.006273	no	WHLBLD
chr1_1400410_A_G_b38	ATAD3C	2.772	0.00575	0.02492	65	0.008991	no	WHLBLD
chr1_1388565_GTC_G_b38	ATAD3C	-2.752	0.00611	-0.023972	34	0.008712	no	WHLBLD
chr1_1308551_GGGA_G_b38	ATAD3C	-2.743	0.00627	-0.048432	6	0.017657	no	WHLBLD
chr1_1448915_G_A_b38	ATAD3C	2.739	0.00635	0.023924	56	0.008735	no	WHLBLD
chr1_1176929_T_C_b38	ATAD3C	2.724	0.00664	0.022133	39	0.008126	no	WHLBLD
chr1_1454579_T_C_b38	ATAD3C	2.714	0.00684	0.051921	6	0.019129	no	WHLBLD
chr1_1240684_G_GCCGCCCCCATTCACCCCGGCCGTGGTCCCTGCCGCAGCCCCCA_b38	ATAD3C	-2.708	0.00696	-0.037599	6	0.013883	no	WHLBLD
chr1_1389827_C_T_b38	ATAD3C	-2.707	0.00698	-0.024855	77	0.009182	no	WHLBLD
chr1_1708501_C_T_b38	ATAD3C	2.704	0.00705	0.067739	5	0.025054	no	WHLBLD
chr1_1387698_A_G_b38	ATAD3C	-2.698	0.00718	-0.024837	78	0.009207	no	WHLBLD
chr1_1327764_G_A_b38	ATAD3C	-2.696	0.00721	-0.033577	6	0.012453	no	WHLBLD
chr1_1041126_AGCGGGGGC_A_b38	ATAD3C	2.692	0.00729	0.015435	56	0.005733	no	WHLBLD
chr1_1410877_A_G_b38	ATAD3C	2.692	0.0073	0.031447	41	0.01168	no	WHLBLD
chr1_1351373_ACGGGGGGAG_A_b38	ATAD3C	-2.669	0.00781	-0.029268	7	0.010966	no	WHLBLD
chr1_1383798_AG_A_b38	ATAD3C	-2.664	0.00793	-0.0321	11	0.012049	no	WHLBLD
chr1_1731375_T_C_b38	ATAD3C	-2.651	0.00823	-0.028205	30	0.010637	no	WHLBLD
chr1_1409306_A_G_b38	ATAD3C	2.646	0.00835	0.030267	12	0.011438	no	WHLBLD
chr1_1306149_A_G_b38	ATAD3C	-2.644	0.00842	-0.038509	5	0.014567	no	WHLBLD
chr1_1399922_C_T_b38	ATAD3C	2.635	0.00863	0.031685	11	0.012023	no	WHLBLD
chr1_1402900_A_G_b38	ATAD3C	2.635	0.00863	0.031685	11	0.012023	no	WHLBLD
chr1_1405316_T_C_b38	ATAD3C	2.635	0.00863	0.031685	11	0.012023	no	WHLBLD
chr1_1497857_T_TAAAAA_b38	ATAD3C	2.618	0.00908	0.051699	6	0.019751	no	WHLBLD
chr1_1395050_G_A_b38	ATAD3C	2.614	0.00919	0.0317	10	0.012129	no	WHLBLD
chr1_1359138_C_T_b38	ATAD3C	-2.609	0.00929	-0.03062	36	0.011734	no	WHLBLD
chr1_1415976_G_A_b38	ATAD3C	2.605	0.00942	0.030019	34	0.011525	no	WHLBLD
chr1_2106663_TGTGTCACCAGGCCAGGTAACTCTCAGCAAGCCCCTCCGGTGGGCGAGGACCTCCATGC_T_b38	ATAD3C	2.585	0.00998	0.042552	5	0.016462	no	WHLBLD
chr1_1309988_G_A_b38	ATAD3C	-2.584	0.01	-0.022771	86	0.008812	no	WHLBLD

---

Filters:      p-Values >= and <=      Betas >= and <=      Statistic >= and <=      Carriers >= and <=
Positions: left right     Zoom: ATAD3C     Other:     -      +     reset     eQTLs Region
Draw    p-Value Beta Statistic Carriers Beta/sd(t)     Scaling     Sign (red=+, blue-)     Colors: Tissue Sign