AURKAIP1 - aurora kinase A interacting protein 1 - 1p36.33

Snps	Gene	Statistic	Pvalue	Beta	Carriers	Beta_se	Linear	Tissue
chr1_1341803_C_T_b38	AURKAIP1	-3.992	7.51e-05	-0.065411	7	0.016385	yes	ADPSBQ
chr1_1373582_C_T_b38	AURKAIP1	-3.992	7.51e-05	-0.065411	7	0.016385	yes	ADPSBQ
chr1_1355212_CGGGAGCTG_C_b38	AURKAIP1	-3.968	8.29e-05	-0.074695	4	0.018825	yes	ADPSBQ
chr1_1374801_A_G_b38	AURKAIP1	-3.917	0.000102	-0.043498	9	0.011105	yes	ADPSBQ
chr1_1335515_G_A_b38	AURKAIP1	-3.837	0.00014	-0.06942	5	0.01809	yes	ADPSBQ
chr1_1296403_A_G_b38	AURKAIP1	-3.833	0.000142	-0.069141	5	0.018039	yes	ADPSBQ
chr1_1248597_A_C_b38	AURKAIP1	3.633	0.000308	0.02716	18	0.007475	yes	ADPSBQ
chr1_840409_T_TAAA_b38	AURKAIP1	-3.541	0.000435	-0.032974	10	0.009312	yes	ADPSBQ
chr1_1302799_C_A_b38	AURKAIP1	-3.514	0.00048	-0.064356	4	0.018312	yes	ADPSBQ
chr1_1339884_A_ACAGCCGCATGTCCCCCAGCAGCCCCCACAGACCCACCCGCAGCCGCATGTCCCCCAGCAGCCCCCACAGACCCACCCG_b38	AURKAIP1	-3.478	0.000548	-0.053403	5	0.015354	yes	ADPSBQ
chr1_1987886_G_A_b38	AURKAIP1	3.464	0.000577	0.055849	6	0.016123	yes	ADPSBQ
chr1_1323853_G_GA_b38	AURKAIP1	-3.439	0.000631	-0.061082	5	0.01776	yes	ADPSBQ
chr1_1909235_G_T_b38	AURKAIP1	-3.413	0.000693	-0.063828	4	0.018701	yes	ADPSBQ
chr1_1973328_G_A_b38	AURKAIP1	3.303	0.00102	0.053805	6	0.016291	yes	ADPSBQ
chr1_1329353_C_G_b38	AURKAIP1	-3.291	0.00107	-0.048344	5	0.01469	yes	ADPSBQ
chr1_1991913_G_A_b38	AURKAIP1	3.277	0.00112	0.062451	3	0.019058	yes	ADPSBQ
chr1_758443_G_C_b38	AURKAIP1	-3.197	0.00147	-0.025845	14	0.008084	yes	ADPSBQ
chr1_1985343_C_A_b38	AURKAIP1	3.165	0.00164	0.051838	6	0.016378	yes	ADPSBQ
chr1_1985367_C_T_b38	AURKAIP1	3.165	0.00164	0.051838	6	0.016378	yes	ADPSBQ
chr1_1986857_C_T_b38	AURKAIP1	3.165	0.00164	0.051838	6	0.016378	yes	ADPSBQ
chr1_1002415_C_CATTTT_b38	AURKAIP1	3.156	0.00169	0.017761	88	0.005627	yes	ADPSBQ
chr1_816108_G_GA_b38	AURKAIP1	-3.144	0.00176	-0.029241	10	0.0093	yes	ADPSBQ
chr1_1251285_G_A_b38	AURKAIP1	3.141	0.00178	0.023714	21	0.00755	yes	ADPSBQ
chr1_1296794_GC_G_b38	AURKAIP1	3.13	0.00185	0.05747	3	0.018358	yes	ADPSBQ
chr1_1306341_GAGA_G_b38	AURKAIP1	3.098	0.00206	0.060631	3	0.019574	yes	ADPSBQ
chr1_1297194_CGT_C_b38	AURKAIP1	3.096	0.00207	0.068666	3	0.022176	yes	ADPSBQ
chr1_1332271_G_A_b38	AURKAIP1	-3.091	0.00211	-0.04547	5	0.014712	yes	ADPSBQ
chr1_1582992_C_CT_b38	AURKAIP1	-3.068	0.00227	-0.018219	68	0.005939	yes	ADPSBQ
chr1_2287068_C_T_b38	AURKAIP1	-3.025	0.00261	-0.025739	11	0.008508	yes	ADPSBQ
chr1_2286661_C_T_b38	AURKAIP1	-3.015	0.0027	-0.025358	11	0.00841	yes	ADPSBQ
chr1_1428999_C_CA_b38	AURKAIP1	2.915	0.00371	0.019367	34	0.006644	yes	ADPSBQ
chr1_2093068_T_C_b38	AURKAIP1	2.889	0.00402	0.029058	6	0.010057	yes	ADPSBQ
chr1_1936077_C_T_b38	AURKAIP1	2.843	0.00465	0.016425	115	0.005777	yes	ADPSBQ
chr1_697250_A_G_b38	AURKAIP1	-2.806	0.00521	-0.031271	8	0.011146	yes	ADPSBQ
chr1_1690309_T_A_b38	AURKAIP1	-2.795	0.00538	-0.042631	4	0.01525	yes	ADPSBQ
chr1_715769_C_T_b38	AURKAIP1	2.795	0.00538	0.030177	21	0.010796	yes	ADPSBQ
chr1_1063121_G_C_b38	AURKAIP1	-2.785	0.00555	-0.019651	20	0.007056	yes	ADPSBQ
chr1_1814797_C_CA_b38	AURKAIP1	2.764	0.00592	0.023032	23	0.008333	yes	ADPSBQ
chr1_1991116_A_G_b38	AURKAIP1	2.758	0.00603	0.042425	9	0.015385	yes	ADPSBQ
chr1_857828_C_G_b38	AURKAIP1	2.735	0.00645	0.018544	72	0.006779	yes	ADPSBQ
chr1_1068824_G_GGCCACGCGGGCTGTGCAGATGCAGGTGCGGCGGGGCGGGGCCACGCGGGCTGTGAAGGTGCAGGTGCGGCGGGGCAGA_b38	AURKAIP1	-2.719	0.00678	-0.012087	78	0.004446	yes	ADPSBQ
chr1_1938771_G_A_b38	AURKAIP1	2.706	0.00703	0.021156	10	0.007817	yes	ADPSBQ
chr1_986925_G_GC_b38	AURKAIP1	-2.694	0.00728	-0.031256	5	0.0116	yes	ADPSBQ
chr1_1971170_C_A_b38	AURKAIP1	2.672	0.00778	0.041132	9	0.015393	yes	ADPSBQ
chr1_993198_G_A_b38	AURKAIP1	-2.663	0.00798	-0.030844	6	0.011581	yes	ADPSBQ
chr1_1369821_C_T_b38	AURKAIP1	2.659	0.00808	0.02133	15	0.008021	yes	ADPSBQ
chr1_1943142_A_G_b38	AURKAIP1	2.647	0.00837	0.020734	10	0.007833	yes	ADPSBQ
chr1_1773676_TTGTG_T_b38	AURKAIP1	-2.638	0.0086	-0.029886	4	0.011329	yes	ADPSBQ
chr1_1971331_C_A_b38	AURKAIP1	2.616	0.00917	0.034188	12	0.013071	yes	ADPSBQ
chr1_1727469_C_G_b38	AURKAIP1	2.61	0.00931	0.042663	4	0.016343	yes	ADPSBQ
chr1_1793064_C_CA_b38	AURKAIP1	2.608	0.00938	0.017017	40	0.006526	yes	ADPSBQ
chr1_1394752_G_GA_b38	AURKAIP1	-2.598	0.00964	-0.02491	12	0.009587	yes	ADPSBQ
chr1_1379091_T_G_b38	AURKAIP1	-4.343	1.7e-05	-0.034112	20	0.007854	no	ADPSBQ
chr1_1366299_AGT_A_b38	AURKAIP1	-4.325	1.83e-05	-0.073951	6	0.017097	no	ADPSBQ
chr1_1971109_GCA_G_b38	AURKAIP1	4.25	2.54e-05	0.072892	5	0.017151	no	ADPSBQ
chr1_1374505_A_G_b38	AURKAIP1	4.096	4.88e-05	0.033797	16	0.008251	no	ADPSBQ
chr1_1312175_C_T_b38	AURKAIP1	-4.02	6.7e-05	-0.072119	5	0.017941	no	ADPSBQ
chr1_1371538_C_T_b38	AURKAIP1	-3.982	7.83e-05	-0.062271	8	0.015639	no	ADPSBQ
chr1_1363584_G_A_b38	AURKAIP1	-3.952	8.84e-05	-0.063425	8	0.016049	no	ADPSBQ
chr1_1403127_C_CAAAAAA_b38	AURKAIP1	-3.882	0.000117	-0.066349	7	0.017092	no	ADPSBQ
chr1_1296364_G_T_b38	AURKAIP1	-3.877	0.000119	-0.069229	5	0.017855	no	ADPSBQ
chr1_1299211_G_A_b38	AURKAIP1	-3.877	0.000119	-0.069229	5	0.017855	no	ADPSBQ
chr1_1305900_C_T_b38	AURKAIP1	-3.877	0.000119	-0.069229	5	0.017855	no	ADPSBQ
chr1_1320870_C_A_b38	AURKAIP1	-3.877	0.000119	-0.069229	5	0.017855	no	ADPSBQ
chr1_1330068_G_A_b38	AURKAIP1	-3.877	0.000119	-0.069229	5	0.017855	no	ADPSBQ
chr1_1334108_G_A_b38	AURKAIP1	-3.877	0.000119	-0.069229	5	0.017855	no	ADPSBQ
chr1_1342873_C_T_b38	AURKAIP1	-3.877	0.000119	-0.069229	5	0.017855	no	ADPSBQ
chr1_1343373_C_T_b38	AURKAIP1	-3.877	0.000119	-0.069229	5	0.017855	no	ADPSBQ
chr1_1352103_A_C_b38	AURKAIP1	-3.877	0.000119	-0.069229	5	0.017855	no	ADPSBQ
chr1_1353044_C_T_b38	AURKAIP1	-3.877	0.000119	-0.069229	5	0.017855	no	ADPSBQ
chr1_1356127_G_C_b38	AURKAIP1	-3.877	0.000119	-0.069229	5	0.017855	no	ADPSBQ
chr1_1359713_GACCCCACCCC_G_b38	AURKAIP1	-3.877	0.000119	-0.069229	5	0.017855	no	ADPSBQ
chr1_1395686_G_A_b38	AURKAIP1	-3.877	0.000119	-0.069229	5	0.017855	no	ADPSBQ
chr1_1373007_G_A_b38	AURKAIP1	3.852	0.000132	0.032998	12	0.008566	no	ADPSBQ
chr1_1345423_G_A_b38	AURKAIP1	-3.831	0.000143	-0.06764	5	0.017655	no	ADPSBQ
chr1_1375642_C_T_b38	AURKAIP1	3.809	0.000157	0.031463	16	0.008261	no	ADPSBQ
chr1_1906734_T_C_b38	AURKAIP1	-3.792	0.000168	-0.073532	3	0.019393	no	ADPSBQ
chr1_1908446_A_C_b38	AURKAIP1	-3.792	0.000168	-0.073532	3	0.019393	no	ADPSBQ
chr1_891943_C_T_b38	AURKAIP1	3.785	0.000172	0.069162	3	0.018273	no	ADPSBQ
chr1_1372909_G_A_b38	AURKAIP1	3.722	0.000219	0.031338	14	0.008419	no	ADPSBQ
chr1_1340811_GCACACACCTGCA_G_b38	AURKAIP1	-3.665	0.000274	-0.05544	4	0.015129	no	ADPSBQ
chr1_1252613_C_G_b38	AURKAIP1	3.661	0.000277	0.033058	8	0.009029	no	ADPSBQ
chr1_722408_G_C_b38	AURKAIP1	3.625	0.000318	0.028069	41	0.007744	no	ADPSBQ
chr1_1356328_G_A_b38	AURKAIP1	-3.585	0.00037	-0.057574	8	0.01606	no	ADPSBQ
chr1_1240580_G_GC_b38	AURKAIP1	3.579	0.000378	0.03078	6	0.008601	no	ADPSBQ
chr1_1373006_G_A_b38	AURKAIP1	3.574	0.000385	0.030973	10	0.008666	no	ADPSBQ
chr1_1373079_A_G_b38	AURKAIP1	-3.542	0.000433	-0.057269	7	0.016168	no	ADPSBQ
chr1_1375923_C_T_b38	AURKAIP1	-3.542	0.000433	-0.057269	7	0.016168	no	ADPSBQ
chr1_1376025_T_C_b38	AURKAIP1	-3.542	0.000433	-0.057269	7	0.016168	no	ADPSBQ
chr1_1378550_G_A_b38	AURKAIP1	-3.542	0.000433	-0.057269	7	0.016168	no	ADPSBQ
chr1_1378591_C_T_b38	AURKAIP1	-3.542	0.000433	-0.057269	7	0.016168	no	ADPSBQ
chr1_758351_A_G_b38	AURKAIP1	-3.538	0.000441	-0.028533	14	0.008066	no	ADPSBQ
chr1_1423775_C_CT_b38	AURKAIP1	3.437	0.000635	0.029957	18	0.008715	no	ADPSBQ
chr1_826893_G_A_b38	AURKAIP1	3.422	0.000671	0.028032	21	0.008191	no	ADPSBQ
chr1_1382893_G_A_b38	AURKAIP1	3.413	0.000693	0.028941	15	0.008479	no	ADPSBQ
chr1_1318689_A_C_b38	AURKAIP1	-3.413	0.000693	-0.059678	5	0.017485	no	ADPSBQ
chr1_1362515_C_G_b38	AURKAIP1	-3.41	7e-04	-0.054937	8	0.016109	no	ADPSBQ
chr1_1378109_C_T_b38	AURKAIP1	-3.385	0.000767	-0.05945	5	0.017563	no	ADPSBQ
chr1_852305_G_T_b38	AURKAIP1	3.348	0.000873	0.025957	44	0.007752	no	ADPSBQ
chr1_1382829_CAACAATCCAGT_C_b38	AURKAIP1	-3.34	0.000898	-0.055777	6	0.016698	no	ADPSBQ
chr1_1252261_C_T_b38	AURKAIP1	3.329	0.000934	0.031602	5	0.009492	no	ADPSBQ
chr1_1380867_A_G_b38	AURKAIP1	3.298	0.00104	0.028434	14	0.008621	no	ADPSBQ
chr1_1363986_C_T_b38	AURKAIP1	-3.272	0.00114	-0.024683	21	0.007544	no	ADPSBQ
chr1_1366271_AGT_A_b38	AURKAIP1	-3.27	0.00115	-0.057715	5	0.01765	no	ADPSBQ
chr1_828389_AT_A_b38	AURKAIP1	-3.26	0.00119	-0.026196	18	0.008036	no	ADPSBQ
chr1_1363898_C_T_b38	AURKAIP1	-3.245	0.00125	-0.024534	21	0.00756	no	ADPSBQ
chr1_1366529_TTAG_T_b38	AURKAIP1	-3.245	0.00125	-0.024534	21	0.00756	no	ADPSBQ
chr1_827105_C_A_b38	AURKAIP1	-3.23	0.00132	-0.027196	10	0.008421	no	ADPSBQ
chr1_1367292_A_AGT_b38	AURKAIP1	-3.217	0.00138	-0.024231	21	0.007532	no	ADPSBQ
chr1_727717_G_C_b38	AURKAIP1	3.216	0.00138	0.025433	41	0.007909	no	ADPSBQ
chr1_814758_G_A_b38	AURKAIP1	-3.202	0.00145	-0.026262	12	0.008202	no	ADPSBQ
chr1_1306183_A_G_b38	AURKAIP1	-3.179	0.00157	-0.05133	7	0.016149	no	ADPSBQ
chr1_1320653_C_T_b38	AURKAIP1	-3.179	0.00157	-0.05133	7	0.016149	no	ADPSBQ
chr1_1398218_C_A_b38	AURKAIP1	3.173	0.0016	0.027163	15	0.008561	no	ADPSBQ
chr1_1400756_GGA_G_b38	AURKAIP1	3.173	0.0016	0.027163	15	0.008561	no	ADPSBQ
chr1_1401954_G_T_b38	AURKAIP1	3.173	0.0016	0.027163	15	0.008561	no	ADPSBQ
chr1_1355028_A_G_b38	AURKAIP1	-3.167	0.00163	-0.052527	7	0.016587	no	ADPSBQ
chr1_1355201_G_A_b38	AURKAIP1	-3.166	0.00164	-0.052515	7	0.01659	no	ADPSBQ
chr1_1383743_T_C_b38	AURKAIP1	3.153	0.00171	0.026809	15	0.008503	no	ADPSBQ
chr1_1403593_A_G_b38	AURKAIP1	3.144	0.00177	0.026899	15	0.008557	no	ADPSBQ
chr1_660769_C_T_b38	AURKAIP1	-3.134	0.00182	-0.025795	15	0.008231	no	ADPSBQ
chr1_1190431_A_AT_b38	AURKAIP1	-3.131	0.00184	-0.028794	4	0.009198	no	ADPSBQ
chr1_832736_AGTTTT_A_b38	AURKAIP1	-3.122	0.0019	-0.024923	15	0.007984	no	ADPSBQ
chr1_824457_T_A_b38	AURKAIP1	3.111	0.00197	0.025424	20	0.008174	no	ADPSBQ
chr1_1909229_TG_T_b38	AURKAIP1	-3.108	0.00199	-0.029741	9	0.00957	no	ADPSBQ
chr1_1973692_T_C_b38	AURKAIP1	3.103	0.00202	0.052055	5	0.016775	no	ADPSBQ
chr1_816376_T_C_b38	AURKAIP1	-3.1	0.00204	-0.025373	18	0.008184	no	ADPSBQ
chr1_818045_T_C_b38	AURKAIP1	3.098	0.00206	0.025481	20	0.008225	no	ADPSBQ
chr1_814962_C_T_b38	AURKAIP1	3.089	0.00212	0.019148	82	0.006199	no	ADPSBQ
chr1_1380206_G_A_b38	AURKAIP1	-3.082	0.00217	-0.050068	7	0.016247	no	ADPSBQ
chr1_1395579_C_T_b38	AURKAIP1	-3.082	0.00217	-0.050068	7	0.016247	no	ADPSBQ
chr1_1406131_A_G_b38	AURKAIP1	-3.082	0.00217	-0.050068	7	0.016247	no	ADPSBQ
chr1_1251618_G_A_b38	AURKAIP1	3.076	0.00221	0.02352	19	0.007647	no	ADPSBQ
chr1_827212_C_G_b38	AURKAIP1	3.063	0.00231	0.024898	20	0.008128	no	ADPSBQ
chr1_827221_T_C_b38	AURKAIP1	3.058	0.00235	0.024973	20	0.008167	no	ADPSBQ
chr1_1407232_G_C_b38	AURKAIP1	3.043	0.00247	0.020961	33	0.006889	no	ADPSBQ
chr1_1251368_T_C_b38	AURKAIP1	3.039	0.0025	0.023063	20	0.00759	no	ADPSBQ
chr1_1379093_TG_T_b38	AURKAIP1	3.036	0.00252	0.027057	10	0.008911	no	ADPSBQ
chr1_1384546_C_T_b38	AURKAIP1	3.034	0.00254	0.026574	14	0.00876	no	ADPSBQ
chr1_1916682_G_C_b38	AURKAIP1	3.031	0.00256	0.054171	3	0.017874	no	ADPSBQ
chr1_1426175_T_C_b38	AURKAIP1	3.023	0.00262	0.028634	20	0.009471	no	ADPSBQ
chr1_827209_G_C_b38	AURKAIP1	3.019	0.00266	0.024573	20	0.00814	no	ADPSBQ
chr1_1226936_G_T_b38	AURKAIP1	3.017	0.00268	0.027214	6	0.00902	no	ADPSBQ
chr1_1803982_T_TA_b38	AURKAIP1	3.008	0.00276	0.048351	7	0.016075	no	ADPSBQ
chr1_1290968_C_G_b38	AURKAIP1	3.002	0.00281	0.023448	49	0.007811	no	ADPSBQ
chr1_822354_C_T_b38	AURKAIP1	2.999	0.00284	0.024161	24	0.008056	no	ADPSBQ
chr1_1223568_A_G_b38	AURKAIP1	2.992	0.0029	0.025561	8	0.008542	no	ADPSBQ
chr1_1407565_C_A_b38	AURKAIP1	2.992	0.00291	0.026428	14	0.008834	no	ADPSBQ
chr1_727477_G_A_b38	AURKAIP1	2.987	0.00295	0.02342	41	0.00784	no	ADPSBQ
chr1_1394041_G_A_b38	AURKAIP1	2.987	0.00296	0.027165	8	0.009095	no	ADPSBQ
chr1_821224_A_G_b38	AURKAIP1	2.983	0.00299	0.023822	23	0.007985	no	ADPSBQ
chr1_1288338_T_C_b38	AURKAIP1	2.983	0.003	0.060827	3	0.020395	no	ADPSBQ
chr1_1222580_T_C_b38	AURKAIP1	2.964	0.00318	0.025551	7	0.00862	no	ADPSBQ
chr1_1222594_A_G_b38	AURKAIP1	2.964	0.00318	0.025551	7	0.00862	no	ADPSBQ
chr1_1223644_C_T_b38	AURKAIP1	2.964	0.00318	0.025551	7	0.00862	no	ADPSBQ
chr1_1226261_G_A_b38	AURKAIP1	2.964	0.00318	0.025971	6	0.008763	no	ADPSBQ
chr1_1226334_AC_A_b38	AURKAIP1	2.964	0.00318	0.025971	6	0.008763	no	ADPSBQ
chr1_1226338_TGTACGGTCAGGAGGAAACATGGCACCTCCCCTCTGGGGGCTCTTTCCAGAAACCCTCAACCC_T_b38	AURKAIP1	2.964	0.00318	0.025971	6	0.008763	no	ADPSBQ
chr1_1367462_T_C_b38	AURKAIP1	2.961	0.00321	0.023789	15	0.008035	no	ADPSBQ
chr1_853333_T_C_b38	AURKAIP1	2.958	0.00324	0.023341	45	0.007892	no	ADPSBQ
chr1_1900809_G_T_b38	AURKAIP1	-2.95	0.00332	-0.059749	3	0.020251	no	ADPSBQ
chr1_1367268_TGA_T_b38	AURKAIP1	2.942	0.00341	0.023519	15	0.007995	no	ADPSBQ
chr1_1749605_C_CGTCCATGCATATTTTTCTGTGTGATGTGTCTGTGTGTGTGTCTCAGTGGT_b38	AURKAIP1	2.938	0.00346	0.015135	71	0.005152	no	ADPSBQ
chr1_815963_T_A_b38	AURKAIP1	-2.934	0.0035	-0.02422	14	0.008256	no	ADPSBQ
chr1_1422828_G_T_b38	AURKAIP1	2.932	0.00351	0.032192	5	0.010978	no	ADPSBQ
chr1_818025_C_A_b38	AURKAIP1	2.928	0.00357	0.024038	20	0.008211	no	ADPSBQ
chr1_1368991_C_T_b38	AURKAIP1	2.917	0.00369	0.023498	15	0.008055	no	ADPSBQ
chr1_1370113_A_G_b38	AURKAIP1	-2.917	0.00369	-0.019294	63	0.006614	no	ADPSBQ
chr1_1369803_C_CT_b38	AURKAIP1	2.909	0.00379	0.021874	14	0.00752	no	ADPSBQ
chr1_839801_A_G_b38	AURKAIP1	-2.904	0.00384	-0.023299	17	0.008023	no	ADPSBQ
chr1_1365566_G_A_b38	AURKAIP1	-2.901	0.00388	-0.021852	21	0.007533	no	ADPSBQ
chr1_821099_C_A_b38	AURKAIP1	-2.899	0.0039	-0.027443	5	0.009465	no	ADPSBQ
chr1_1367511_ATGAG_A_b38	AURKAIP1	2.896	0.00395	0.023462	14	0.008103	no	ADPSBQ
chr1_827092_C_T_b38	AURKAIP1	-2.893	0.00397	-0.024488	9	0.008464	no	ADPSBQ
chr1_1431450_A_G_b38	AURKAIP1	2.892	0.00399	0.019369	79	0.006697	no	ADPSBQ
chr1_851639_C_T_b38	AURKAIP1	2.891	0.004	0.023346	19	0.008074	no	ADPSBQ
chr1_1297051_CCA_C_b38	AURKAIP1	-2.888	0.00404	-0.04682	7	0.016211	no	ADPSBQ
chr1_791100_G_GGGA_b38	AURKAIP1	-2.886	0.00407	-0.024428	18	0.008464	no	ADPSBQ
chr1_827252_T_A_b38	AURKAIP1	2.884	0.0041	0.023481	20	0.008143	no	ADPSBQ
chr1_1364253_C_G_b38	AURKAIP1	2.878	0.00417	0.023504	15	0.008167	no	ADPSBQ
chr1_851615_G_A_b38	AURKAIP1	-2.872	0.00425	-0.023482	14	0.008177	no	ADPSBQ
chr1_2345829_C_CCACACACACA_b38	AURKAIP1	-2.871	0.00426	-0.038775	5	0.013504	no	ADPSBQ
chr1_1369012_C_CG_b38	AURKAIP1	2.871	0.00427	0.0232	15	0.008082	no	ADPSBQ
chr1_1367280_T_A_b38	AURKAIP1	2.869	0.00429	0.023032	15	0.008029	no	ADPSBQ
chr1_973862_A_G_b38	AURKAIP1	2.868	0.0043	0.037746	9	0.013159	no	ADPSBQ
chr1_1428969_T_C_b38	AURKAIP1	2.859	0.00443	0.019192	79	0.006713	no	ADPSBQ
chr1_851882_C_G_b38	AURKAIP1	2.859	0.00443	0.022804	23	0.007977	no	ADPSBQ
chr1_833758_CAT_C_b38	AURKAIP1	-2.856	0.00447	-0.022743	21	0.007964	no	ADPSBQ
chr1_1901223_A_G_b38	AURKAIP1	-2.853	0.00451	-0.057897	3	0.020294	no	ADPSBQ
chr1_791101_T_G_b38	AURKAIP1	2.853	0.00451	0.024146	18	0.008464	no	ADPSBQ
chr1_1431537_G_C_b38	AURKAIP1	2.852	0.00452	0.019116	79	0.006703	no	ADPSBQ
chr1_1368177_G_C_b38	AURKAIP1	2.85	0.00455	0.023064	17	0.008093	no	ADPSBQ
chr1_1370532_C_T_b38	AURKAIP1	2.847	0.00459	0.022699	17	0.007972	no	ADPSBQ
chr1_891887_C_T_b38	AURKAIP1	2.838	0.00472	0.053049	3	0.01869	no	ADPSBQ
chr1_1369009_T_C_b38	AURKAIP1	2.837	0.00474	0.022942	15	0.008088	no	ADPSBQ
chr1_1428015_G_A_b38	AURKAIP1	2.832	0.00481	0.040122	3	0.014169	no	ADPSBQ
chr1_1430908_A_G_b38	AURKAIP1	2.832	0.00481	0.018944	79	0.00669	no	ADPSBQ
chr1_1222245_C_T_b38	AURKAIP1	2.828	0.00487	0.024684	6	0.008728	no	ADPSBQ
chr1_1288085_GC_G_b38	AURKAIP1	2.828	0.00487	0.024083	12	0.008517	no	ADPSBQ
chr1_1221960_A_G_b38	AURKAIP1	2.826	0.0049	0.024661	6	0.008726	no	ADPSBQ
chr1_1221992_G_A_b38	AURKAIP1	2.826	0.0049	0.024661	6	0.008726	no	ADPSBQ
chr1_1222167_T_C_b38	AURKAIP1	2.826	0.0049	0.024661	6	0.008726	no	ADPSBQ
chr1_1222184_G_A_b38	AURKAIP1	2.826	0.0049	0.024661	6	0.008726	no	ADPSBQ
chr1_1222251_G_A_b38	AURKAIP1	2.826	0.0049	0.024661	6	0.008726	no	ADPSBQ
chr1_1222304_C_T_b38	AURKAIP1	2.826	0.0049	0.024661	6	0.008726	no	ADPSBQ
chr1_1222325_C_G_b38	AURKAIP1	2.826	0.0049	0.024661	6	0.008726	no	ADPSBQ
chr1_1222454_C_T_b38	AURKAIP1	2.826	0.0049	0.024661	6	0.008726	no	ADPSBQ
chr1_1222482_C_T_b38	AURKAIP1	2.826	0.0049	0.024661	6	0.008726	no	ADPSBQ
chr1_1222579_C_T_b38	AURKAIP1	2.826	0.0049	0.024661	6	0.008726	no	ADPSBQ
chr1_1222611_G_A_b38	AURKAIP1	2.826	0.0049	0.024661	6	0.008726	no	ADPSBQ
chr1_1222640_A_C_b38	AURKAIP1	2.826	0.0049	0.024661	6	0.008726	no	ADPSBQ
chr1_1222897_G_A_b38	AURKAIP1	2.826	0.0049	0.024661	6	0.008726	no	ADPSBQ
chr1_1222946_G_A_b38	AURKAIP1	2.826	0.0049	0.024661	6	0.008726	no	ADPSBQ
chr1_1222977_A_G_b38	AURKAIP1	2.826	0.0049	0.024661	6	0.008726	no	ADPSBQ
chr1_1223154_G_GAC_b38	AURKAIP1	2.826	0.0049	0.024661	6	0.008726	no	ADPSBQ
chr1_1223182_AAC_A_b38	AURKAIP1	2.826	0.0049	0.024661	6	0.008726	no	ADPSBQ
chr1_1223593_A_T_b38	AURKAIP1	2.826	0.0049	0.024661	6	0.008726	no	ADPSBQ
chr1_1223595_A_C_b38	AURKAIP1	2.826	0.0049	0.024661	6	0.008726	no	ADPSBQ
chr1_1223640_A_G_b38	AURKAIP1	2.826	0.0049	0.024661	6	0.008726	no	ADPSBQ
chr1_1223682_T_C_b38	AURKAIP1	2.826	0.0049	0.024661	6	0.008726	no	ADPSBQ
chr1_1223727_G_A_b38	AURKAIP1	2.826	0.0049	0.024661	6	0.008726	no	ADPSBQ
chr1_1224105_C_T_b38	AURKAIP1	2.826	0.0049	0.024661	6	0.008726	no	ADPSBQ
chr1_1224349_T_G_b38	AURKAIP1	2.826	0.0049	0.024661	6	0.008726	no	ADPSBQ
chr1_1224844_C_T_b38	AURKAIP1	2.826	0.0049	0.024661	6	0.008726	no	ADPSBQ
chr1_1224846_A_G_b38	AURKAIP1	2.826	0.0049	0.024661	6	0.008726	no	ADPSBQ
chr1_1225429_T_C_b38	AURKAIP1	2.826	0.0049	0.024661	6	0.008726	no	ADPSBQ
chr1_1225720_CGCCACAGACACGGGCCACACACTCCACAT_C_b38	AURKAIP1	2.826	0.0049	0.024661	6	0.008726	no	ADPSBQ
chr1_1225982_A_G_b38	AURKAIP1	2.826	0.0049	0.024661	6	0.008726	no	ADPSBQ
chr1_1227161_G_C_b38	AURKAIP1	2.826	0.0049	0.024661	6	0.008726	no	ADPSBQ
chr1_1227792_T_C_b38	AURKAIP1	2.826	0.0049	0.024661	6	0.008726	no	ADPSBQ
chr1_1227975_T_C_b38	AURKAIP1	2.826	0.0049	0.024661	6	0.008726	no	ADPSBQ
chr1_1229160_G_T_b38	AURKAIP1	2.826	0.0049	0.024661	6	0.008726	no	ADPSBQ
chr1_1229307_G_C_b38	AURKAIP1	2.826	0.0049	0.024661	6	0.008726	no	ADPSBQ
chr1_1229900_GCA_G_b38	AURKAIP1	2.826	0.0049	0.024661	6	0.008726	no	ADPSBQ
chr1_1229940_CAT_C_b38	AURKAIP1	2.826	0.0049	0.024661	6	0.008726	no	ADPSBQ
chr1_1229981_A_G_b38	AURKAIP1	2.826	0.0049	0.024661	6	0.008726	no	ADPSBQ
chr1_1230091_T_C_b38	AURKAIP1	2.826	0.0049	0.024661	6	0.008726	no	ADPSBQ
chr1_1230345_A_G_b38	AURKAIP1	2.826	0.0049	0.024661	6	0.008726	no	ADPSBQ
chr1_1230441_T_C_b38	AURKAIP1	2.826	0.0049	0.024661	6	0.008726	no	ADPSBQ
chr1_1230695_G_A_b38	AURKAIP1	2.826	0.0049	0.024661	6	0.008726	no	ADPSBQ
chr1_1230797_G_C_b38	AURKAIP1	2.826	0.0049	0.024661	6	0.008726	no	ADPSBQ
chr1_1230825_C_T_b38	AURKAIP1	2.826	0.0049	0.024661	6	0.008726	no	ADPSBQ
chr1_1226892_C_T_b38	AURKAIP1	2.826	0.0049	0.024913	6	0.008817	no	ADPSBQ
chr1_1252487_C_A_b38	AURKAIP1	2.823	0.00495	0.028311	4	0.01003	no	ADPSBQ
chr1_1367388_T_TTGG_b38	AURKAIP1	2.822	0.00496	0.022685	15	0.008038	no	ADPSBQ
chr1_1341550_GCA_G_b38	AURKAIP1	2.821	0.00497	0.023282	16	0.008252	no	ADPSBQ
chr1_1242538_CT_C_b38	AURKAIP1	2.82	0.00499	0.029682	3	0.010525	no	ADPSBQ
chr1_1088408_C_T_b38	AURKAIP1	-2.814	0.00508	-0.020548	18	0.007301	no	ADPSBQ
chr1_1258206_AT_A_b38	AURKAIP1	2.813	0.00509	0.019483	68	0.006925	no	ADPSBQ
chr1_1227055_C_A_b38	AURKAIP1	2.794	0.0054	0.024302	6	0.008697	no	ADPSBQ
chr1_1411847_T_TCCAGGTC_b38	AURKAIP1	-2.786	0.00553	-0.047121	6	0.016913	no	ADPSBQ
chr1_1364282_T_G_b38	AURKAIP1	2.785	0.00555	0.022326	15	0.008016	no	ADPSBQ
chr1_1364694_T_C_b38	AURKAIP1	2.785	0.00555	0.022326	15	0.008016	no	ADPSBQ
chr1_1364721_C_T_b38	AURKAIP1	2.785	0.00555	0.022326	15	0.008016	no	ADPSBQ
chr1_1365160_A_G_b38	AURKAIP1	2.785	0.00555	0.022326	15	0.008016	no	ADPSBQ
chr1_1365198_C_T_b38	AURKAIP1	2.785	0.00555	0.022326	15	0.008016	no	ADPSBQ
chr1_1366008_A_G_b38	AURKAIP1	2.785	0.00555	0.022326	15	0.008016	no	ADPSBQ
chr1_1366062_T_C_b38	AURKAIP1	2.785	0.00555	0.022326	15	0.008016	no	ADPSBQ
chr1_1366145_TGTGAA_T_b38	AURKAIP1	2.785	0.00555	0.022326	15	0.008016	no	ADPSBQ
chr1_1366321_TGTGTGTAAATGG_T_b38	AURKAIP1	2.785	0.00555	0.022326	15	0.008016	no	ADPSBQ
chr1_1366453_G_T_b38	AURKAIP1	2.785	0.00555	0.022326	15	0.008016	no	ADPSBQ
chr1_1366726_T_G_b38	AURKAIP1	2.785	0.00555	0.022326	15	0.008016	no	ADPSBQ
chr1_1367258_T_A_b38	AURKAIP1	2.785	0.00555	0.022326	15	0.008016	no	ADPSBQ
chr1_1367297_GAA_G_b38	AURKAIP1	2.785	0.00555	0.022326	15	0.008016	no	ADPSBQ
chr1_1367329_A_AGT_b38	AURKAIP1	2.785	0.00555	0.022326	15	0.008016	no	ADPSBQ
chr1_1367373_T_TGTG_b38	AURKAIP1	2.785	0.00555	0.022326	15	0.008016	no	ADPSBQ
chr1_1367593_G_A_b38	AURKAIP1	2.785	0.00555	0.022326	15	0.008016	no	ADPSBQ
chr1_1367602_GT_G_b38	AURKAIP1	2.785	0.00555	0.022326	15	0.008016	no	ADPSBQ
chr1_1367605_GAGTGAGTGTA_G_b38	AURKAIP1	2.785	0.00555	0.022326	15	0.008016	no	ADPSBQ
chr1_1367670_GGTGA_G_b38	AURKAIP1	2.785	0.00555	0.022326	15	0.008016	no	ADPSBQ
chr1_1367722_TTTTA_T_b38	AURKAIP1	2.785	0.00555	0.022326	15	0.008016	no	ADPSBQ
chr1_1367874_A_T_b38	AURKAIP1	2.785	0.00555	0.022326	15	0.008016	no	ADPSBQ
chr1_1367919_C_T_b38	AURKAIP1	2.785	0.00555	0.022326	15	0.008016	no	ADPSBQ
chr1_1367951_C_T_b38	AURKAIP1	2.785	0.00555	0.022326	15	0.008016	no	ADPSBQ
chr1_1367965_A_G_b38	AURKAIP1	2.785	0.00555	0.022326	15	0.008016	no	ADPSBQ
chr1_1367970_T_G_b38	AURKAIP1	2.785	0.00555	0.022326	15	0.008016	no	ADPSBQ
chr1_1367994_C_A_b38	AURKAIP1	2.785	0.00555	0.022326	15	0.008016	no	ADPSBQ
chr1_1368297_C_T_b38	AURKAIP1	2.785	0.00555	0.022326	15	0.008016	no	ADPSBQ
chr1_1071842_G_T_b38	AURKAIP1	-2.778	0.00567	-0.021538	15	0.007753	no	ADPSBQ
chr1_849670_G_A_b38	AURKAIP1	2.772	0.00577	0.022232	44	0.00802	no	ADPSBQ
chr1_850609_T_C_b38	AURKAIP1	2.772	0.00577	0.022232	44	0.00802	no	ADPSBQ
chr1_836587_G_A_b38	AURKAIP1	-2.767	0.00585	-0.022056	18	0.00797	no	ADPSBQ
chr1_1248017_C_T_b38	AURKAIP1	2.764	0.00591	0.029331	3	0.010611	no	ADPSBQ
chr1_1364357_A_C_b38	AURKAIP1	2.759	0.00601	0.022101	15	0.008012	no	ADPSBQ
chr1_1368514_C_G_b38	AURKAIP1	2.759	0.00601	0.022101	15	0.008012	no	ADPSBQ
chr1_1898894_G_C_b38	AURKAIP1	-2.758	0.00603	-0.056687	3	0.020555	no	ADPSBQ
chr1_1430190_A_C_b38	AURKAIP1	2.757	0.00604	0.018514	79	0.006715	no	ADPSBQ
chr1_1726162_T_C_b38	AURKAIP1	2.756	0.00606	0.016191	126	0.005874	no	ADPSBQ
chr1_1370429_C_G_b38	AURKAIP1	-2.753	0.00612	-0.042238	9	0.015344	no	ADPSBQ
chr1_1912140_T_G_b38	AURKAIP1	-2.752	0.00613	-0.020392	19	0.00741	no	ADPSBQ
chr1_828811_T_G_b38	AURKAIP1	-2.745	0.00626	-0.021733	19	0.007916	no	ADPSBQ
chr1_727034_C_T_b38	AURKAIP1	-2.741	0.00633	-0.021064	21	0.007684	no	ADPSBQ
chr1_826352_C_T_b38	AURKAIP1	2.74	0.00636	0.020132	56	0.007348	no	ADPSBQ
chr1_796652_A_C_b38	AURKAIP1	-2.739	0.00638	-0.022447	12	0.008195	no	ADPSBQ
chr1_1235997_A_G_b38	AURKAIP1	2.721	0.00673	0.022788	14	0.008375	no	ADPSBQ
chr1_998750_G_C_b38	AURKAIP1	-2.719	0.00676	-0.020035	13	0.007367	no	ADPSBQ
chr1_1489578_C_CTA_b38	AURKAIP1	2.719	0.00676	0.043719	3	0.016077	no	ADPSBQ
chr1_1984300_C_CT_b38	AURKAIP1	2.71	0.00696	0.031452	3	0.011607	no	ADPSBQ
chr1_850867_G_A_b38	AURKAIP1	2.709	0.00698	0.021511	23	0.007942	no	ADPSBQ
chr1_1226620_G_GC_b38	AURKAIP1	2.705	0.00705	0.023741	6	0.008776	no	ADPSBQ
chr1_1366187_A_AGT_b38	AURKAIP1	2.705	0.00706	0.021695	15	0.00802	no	ADPSBQ
chr1_726821_G_A_b38	AURKAIP1	2.703	0.00711	0.019506	42	0.007217	no	ADPSBQ
chr1_851741_T_A_b38	AURKAIP1	-2.698	0.00721	-0.023075	10	0.008553	no	ADPSBQ
chr1_843942_A_G_b38	AURKAIP1	-2.698	0.00721	-0.021538	19	0.007984	no	ADPSBQ
chr1_854133_GA_G_b38	AURKAIP1	-2.698	0.00721	-0.021538	19	0.007984	no	ADPSBQ
chr1_1364566_T_C_b38	AURKAIP1	2.694	0.00729	0.021679	15	0.008047	no	ADPSBQ
chr1_1344048_G_A_b38	AURKAIP1	2.689	0.0074	0.02248	14	0.00836	no	ADPSBQ
chr1_1940540_G_A_b38	AURKAIP1	2.688	0.00742	0.015485	114	0.005761	no	ADPSBQ
chr1_1451550_C_T_b38	AURKAIP1	-2.687	0.00744	-0.055846	3	0.020783	no	ADPSBQ
chr1_826372_C_T_b38	AURKAIP1	2.686	0.00746	0.018542	45	0.006903	no	ADPSBQ
chr1_820510_A_T_b38	AURKAIP1	2.686	0.00748	0.022228	19	0.008277	no	ADPSBQ
chr1_855378_GTA_G_b38	AURKAIP1	2.685	0.00749	0.021409	44	0.007973	no	ADPSBQ
chr1_845405_T_A_b38	AURKAIP1	2.679	0.00762	0.021422	30	0.007996	no	ADPSBQ
chr1_1248149_G_C_b38	AURKAIP1	2.674	0.00773	0.048848	5	0.018266	no	ADPSBQ
chr1_1225285_G_A_b38	AURKAIP1	2.673	0.00777	0.023178	7	0.008672	no	ADPSBQ
chr1_1366292_G_T_b38	AURKAIP1	2.671	0.0078	0.021512	15	0.008053	no	ADPSBQ
chr1_1938332_A_ACT_b38	AURKAIP1	2.67	0.00783	0.015215	118	0.005699	no	ADPSBQ
chr1_1019790_G_A_b38	AURKAIP1	-2.664	0.00796	-0.030368	3	0.011397	no	ADPSBQ
chr1_683083_G_A_b38	AURKAIP1	-2.662	0.00802	-0.024604	9	0.009244	no	ADPSBQ
chr1_727242_G_A_b38	AURKAIP1	-2.659	0.00808	-0.021265	16	0.007996	no	ADPSBQ
chr1_837375_A_C_b38	AURKAIP1	2.659	0.0081	0.02128	25	0.008004	no	ADPSBQ
chr1_840279_A_G_b38	AURKAIP1	2.659	0.0081	0.02128	25	0.008004	no	ADPSBQ
chr1_989223_T_C_b38	AURKAIP1	-2.658	0.00812	-0.029836	6	0.011227	no	ADPSBQ
chr1_820905_ATCCACCCTGTCTACACTACCTGCTTGTCCAGCAGG_A_b38	AURKAIP1	-2.657	0.00813	-0.021924	12	0.008251	no	ADPSBQ
chr1_914948_CA_C_b38	AURKAIP1	2.655	0.00819	0.019544	24	0.007362	no	ADPSBQ
chr1_852019_G_T_b38	AURKAIP1	2.653	0.00822	0.02081	38	0.007843	no	ADPSBQ
chr1_2280205_T_A_b38	AURKAIP1	2.653	0.00823	0.020573	12	0.007755	no	ADPSBQ
chr1_1363880_A_G_b38	AURKAIP1	2.647	0.00838	0.021152	15	0.007993	no	ADPSBQ
chr1_1940973_C_T_b38	AURKAIP1	2.646	0.0084	0.015145	116	0.005724	no	ADPSBQ
chr1_1242865_C_T_b38	AURKAIP1	2.644	0.00844	0.020576	19	0.007781	no	ADPSBQ
chr1_1426810_C_G_b38	AURKAIP1	2.643	0.00846	0.017607	80	0.006661	no	ADPSBQ
chr1_1243102_A_G_b38	AURKAIP1	2.642	0.00849	0.020615	20	0.007802	no	ADPSBQ
chr1_1306584_G_A_b38	AURKAIP1	-2.642	0.00849	-0.037317	9	0.014124	no	ADPSBQ
chr1_1942260_G_C_b38	AURKAIP1	2.642	0.00849	0.015173	115	0.005743	no	ADPSBQ
chr1_1369282_G_A_b38	AURKAIP1	2.64	0.00854	0.02116	15	0.008014	no	ADPSBQ
chr1_1369320_GT_G_b38	AURKAIP1	2.64	0.00854	0.02116	15	0.008014	no	ADPSBQ
chr1_1369476_CTT_C_b38	AURKAIP1	2.64	0.00854	0.02116	15	0.008014	no	ADPSBQ
chr1_1369556_C_G_b38	AURKAIP1	2.64	0.00854	0.02116	15	0.008014	no	ADPSBQ
chr1_1369627_T_C_b38	AURKAIP1	2.64	0.00854	0.02116	15	0.008014	no	ADPSBQ
chr1_1369686_T_C_b38	AURKAIP1	2.64	0.00854	0.02116	15	0.008014	no	ADPSBQ
chr1_1369716_G_C_b38	AURKAIP1	2.64	0.00854	0.02116	15	0.008014	no	ADPSBQ
chr1_1369741_C_T_b38	AURKAIP1	2.64	0.00854	0.02116	15	0.008014	no	ADPSBQ
chr1_1370181_C_T_b38	AURKAIP1	2.64	0.00854	0.02116	15	0.008014	no	ADPSBQ
chr1_1370317_G_C_b38	AURKAIP1	2.64	0.00854	0.02116	15	0.008014	no	ADPSBQ
chr1_1370320_A_G_b38	AURKAIP1	2.64	0.00854	0.02116	15	0.008014	no	ADPSBQ
chr1_852226_G_T_b38	AURKAIP1	-2.639	0.00856	-0.021197	18	0.008032	no	ADPSBQ
chr1_713812_A_T_b38	AURKAIP1	-2.639	0.00857	-0.021777	12	0.008252	no	ADPSBQ
chr1_2361630_A_G_b38	AURKAIP1	2.637	0.00861	0.048345	4	0.018332	no	ADPSBQ
chr1_2362285_A_C_b38	AURKAIP1	2.637	0.00861	0.048345	4	0.018332	no	ADPSBQ
chr1_1938054_ACT_A_b38	AURKAIP1	2.636	0.00865	0.0152	114	0.005767	no	ADPSBQ
chr1_851771_G_A_b38	AURKAIP1	-2.633	0.00872	-0.022624	11	0.008593	no	ADPSBQ
chr1_1367300_T_TGA_b38	AURKAIP1	2.633	0.00873	0.021315	14	0.008097	no	ADPSBQ
chr1_1357246_C_T_b38	AURKAIP1	-2.631	0.00878	-0.041339	12	0.015715	no	ADPSBQ
chr1_1217251_C_A_b38	AURKAIP1	2.618	0.0091	0.021986	12	0.008397	no	ADPSBQ
chr1_1191757_A_C_b38	AURKAIP1	2.617	0.00912	0.023046	7	0.008805	no	ADPSBQ
chr1_1000291_C_G_b38	AURKAIP1	-2.616	0.00915	-0.019271	13	0.007366	no	ADPSBQ
chr1_1874605_TA_T_b38	AURKAIP1	2.613	0.00924	0.028372	11	0.010859	no	ADPSBQ
chr1_846465_A_G_b38	AURKAIP1	-2.613	0.00925	-0.026053	5	0.009971	no	ADPSBQ
chr1_830627_A_C_b38	AURKAIP1	-2.613	0.00925	-0.025771	5	0.009864	no	ADPSBQ
chr1_1226901_G_A_b38	AURKAIP1	2.612	0.00927	0.022981	6	0.008799	no	ADPSBQ
chr1_1228069_T_C_b38	AURKAIP1	2.61	0.00933	0.023351	4	0.008948	no	ADPSBQ
chr1_855811_G_A_b38	AURKAIP1	-2.608	0.00937	-0.020872	19	0.008003	no	ADPSBQ
chr1_1244603_G_A_b38	AURKAIP1	2.607	0.00939	0.020348	18	0.007804	no	ADPSBQ
chr1_1370430_T_C_b38	AURKAIP1	2.606	0.00942	0.021085	16	0.00809	no	ADPSBQ
chr1_1370584_G_C_b38	AURKAIP1	2.606	0.00942	0.021085	16	0.00809	no	ADPSBQ
chr1_1910289_C_T_b38	AURKAIP1	-2.605	0.00946	-0.01952	15	0.007493	no	ADPSBQ
chr1_1910369_G_A_b38	AURKAIP1	-2.605	0.00946	-0.01952	15	0.007493	no	ADPSBQ
chr1_1910480_G_A_b38	AURKAIP1	-2.605	0.00946	-0.01952	15	0.007493	no	ADPSBQ
chr1_830725_T_A_b38	AURKAIP1	2.602	0.00954	0.019737	45	0.007586	no	ADPSBQ
chr1_828389_A_AT_b38	AURKAIP1	2.598	0.00965	0.017509	68	0.00674	no	ADPSBQ
chr1_836030_C_T_b38	AURKAIP1	2.596	0.0097	0.020088	44	0.007737	no	ADPSBQ
chr1_1366776_G_GAATT_b38	AURKAIP1	2.593	0.0098	0.021303	15	0.008217	no	ADPSBQ
chr1_1942258_G_A_b38	AURKAIP1	2.588	0.00992	0.01487	114	0.005745	no	ADPSBQ
chr1_749482_G_A_b38	AURKAIP1	3.58	0.000386	0.068962	12	0.019263	yes	ADPVSC
chr1_1502507_A_C_b38	AURKAIP1	-3.485	0.000547	-0.07284	6	0.020901	yes	ADPVSC
chr1_2106797_G_GACTCTTCAGCAGGCCCCTCTGGTGGGCGAGGACCTCCACACGTGTCACCAGGCCAGGTA_b38	AURKAIP1	3.206	0.00145	0.043064	17	0.01343	yes	ADPVSC
chr1_1990027_C_CT_b38	AURKAIP1	-3.087	0.00216	-0.06316	6	0.020459	yes	ADPVSC
chr1_1046551_A_G_b38	AURKAIP1	2.951	0.00336	0.03716	18	0.012592	yes	ADPVSC
chr1_2169401_C_T_b38	AURKAIP1	-2.865	0.00439	-0.085478	3	0.029835	yes	ADPVSC
chr1_2177928_G_A_b38	AURKAIP1	-2.865	0.00439	-0.085478	3	0.029835	yes	ADPVSC
chr1_2181741_C_G_b38	AURKAIP1	-2.865	0.00439	-0.085478	3	0.029835	yes	ADPVSC
chr1_1447108_A_AT_b38	AURKAIP1	2.742	0.00638	0.045239	5	0.016497	yes	ADPVSC
chr1_770501_C_T_b38	AURKAIP1	-2.703	0.00717	-0.092857	3	0.034357	yes	ADPVSC
chr1_2054960_T_A_b38	AURKAIP1	-2.685	0.00755	-0.065954	12	0.024562	yes	ADPVSC
chr1_2055132_C_T_b38	AURKAIP1	-2.685	0.00755	-0.065954	12	0.024562	yes	ADPVSC
chr1_511562_C_T_b38	AURKAIP1	2.681	0.00765	0.028848	26	0.010761	yes	ADPVSC
chr1_1283472_G_T_b38	AURKAIP1	-2.674	0.00781	-0.045863	7	0.017154	yes	ADPVSC
chr1_1283510_G_C_b38	AURKAIP1	-2.674	0.00781	-0.045863	7	0.017154	yes	ADPVSC
chr1_1306183_A_G_b38	AURKAIP1	-2.606	0.0095	-0.066395	5	0.025477	yes	ADPVSC
chr1_1320653_C_T_b38	AURKAIP1	-2.606	0.0095	-0.066395	5	0.025477	yes	ADPVSC
chr1_1134083_C_CA_b38	AURKAIP1	-2.596	0.00979	-0.070585	3	0.027194	yes	ADPVSC
chr1_1979596_G_C_b38	AURKAIP1	-3.483	0.00055	-0.066988	6	0.01923	no	ADPVSC
chr1_1979597_G_A_b38	AURKAIP1	-3.483	0.00055	-0.066988	6	0.01923	no	ADPVSC
chr1_1979599_A_G_b38	AURKAIP1	-3.48	0.000556	-0.06695	6	0.019236	no	ADPVSC
chr1_1154789_GAA_G_b38	AURKAIP1	-3.307	0.00103	-0.061684	5	0.01865	no	ADPVSC
chr1_1361163_AACAC_A_b38	AURKAIP1	-3.291	0.00109	-0.078731	9	0.023923	no	ADPVSC
chr1_1487487_C_CA_b38	AURKAIP1	3.23	0.00134	0.052809	5	0.016351	no	ADPVSC
chr1_1151436_C_CCCCCAGCCAGAGCCTCAGGGTGAGCTCAAGGCACCAAACCCAGAACGG_b38	AURKAIP1	-3.079	0.00222	-0.091639	4	0.029762	no	ADPVSC
chr1_1979572_C_G_b38	AURKAIP1	-2.998	0.00289	-0.050573	7	0.01687	no	ADPVSC
chr1_715769_C_T_b38	AURKAIP1	2.942	0.00345	0.048937	15	0.016634	no	ADPVSC
chr1_969562_A_G_b38	AURKAIP1	-2.878	0.00422	-0.070159	9	0.024377	no	ADPVSC
chr1_1979589_T_C_b38	AURKAIP1	-2.838	0.00477	-0.043446	6	0.015306	no	ADPVSC
chr1_1220305_T_C_b38	AURKAIP1	-2.788	0.00555	-0.083541	3	0.029959	no	ADPVSC
chr1_1979523_G_A_b38	AURKAIP1	-2.778	0.00572	-0.038842	10	0.013981	no	ADPVSC
chr1_1153485_T_C_b38	AURKAIP1	-2.766	0.00594	-0.055468	5	0.020053	no	ADPVSC
chr1_1153768_T_C_b38	AURKAIP1	-2.766	0.00594	-0.055468	5	0.020053	no	ADPVSC
chr1_1155177_A_C_b38	AURKAIP1	-2.766	0.00594	-0.055468	5	0.020053	no	ADPVSC
chr1_1155933_A_G_b38	AURKAIP1	-2.766	0.00594	-0.055468	5	0.020053	no	ADPVSC
chr1_1156125_C_T_b38	AURKAIP1	-2.766	0.00594	-0.055468	5	0.020053	no	ADPVSC
chr1_1156322_A_G_b38	AURKAIP1	-2.766	0.00594	-0.055468	5	0.020053	no	ADPVSC
chr1_1156447_C_T_b38	AURKAIP1	-2.766	0.00594	-0.055468	5	0.020053	no	ADPVSC
chr1_1156691_C_A_b38	AURKAIP1	-2.766	0.00594	-0.055468	5	0.020053	no	ADPVSC
chr1_1156907_A_G_b38	AURKAIP1	-2.766	0.00594	-0.055468	5	0.020053	no	ADPVSC
chr1_1157020_G_C_b38	AURKAIP1	-2.766	0.00594	-0.055468	5	0.020053	no	ADPVSC
chr1_1157044_A_G_b38	AURKAIP1	-2.766	0.00594	-0.055468	5	0.020053	no	ADPVSC
chr1_1948121_T_G_b38	AURKAIP1	-2.763	0.00599	-0.027311	29	0.009883	no	ADPVSC
chr1_917887_G_T_b38	AURKAIP1	-2.759	0.00606	-0.072665	5	0.026337	no	ADPVSC
chr1_683167_G_A_b38	AURKAIP1	2.677	0.00774	0.037575	6	0.014036	no	ADPVSC
chr1_1979531_C_T_b38	AURKAIP1	-2.662	0.00808	-0.039078	9	0.01468	no	ADPVSC
chr1_1573429_C_CA_b38	AURKAIP1	-2.659	0.00816	-0.071234	4	0.026794	no	ADPVSC
chr1_1151393_A_G_b38	AURKAIP1	-2.656	0.00821	-0.052202	6	0.019651	no	ADPVSC
chr1_1726162_T_C_b38	AURKAIP1	2.626	0.00897	0.022567	101	0.008594	no	ADPVSC
chr1_969637_T_C_b38	AURKAIP1	-2.619	0.00916	-0.063459	9	0.024232	no	ADPVSC
chr1_1606099_G_C_b38	AURKAIP1	-3.649	0.00034	-0.089546	5	0.024542	yes	ADRNLG
chr1_1855158_CA_C_b38	AURKAIP1	-3.159	0.00184	-0.058684	9	0.018574	yes	ADRNLG
chr1_2028539_C_T_b38	AURKAIP1	-3.024	0.00284	-0.045482	41	0.015041	yes	ADRNLG
chr1_2037520_G_A_b38	AURKAIP1	-2.995	0.00311	-0.048894	20	0.016327	yes	ADRNLG
chr1_2031736_A_G_b38	AURKAIP1	-2.969	0.00337	-0.044395	40	0.014953	yes	ADRNLG
chr1_2035575_G_A_b38	AURKAIP1	-2.947	0.00361	-0.048399	20	0.016423	yes	ADRNLG
chr1_921096_A_G_b38	AURKAIP1	2.855	0.00477	0.045069	40	0.015783	yes	ADRNLG
chr1_919397_A_G_b38	AURKAIP1	-2.828	0.00517	-0.043029	38	0.015213	yes	ADRNLG
chr1_2022997_G_A_b38	AURKAIP1	-2.81	0.00547	-0.048765	16	0.017355	yes	ADRNLG
chr1_919695_C_G_b38	AURKAIP1	-2.79	0.0058	-0.042512	38	0.015237	yes	ADRNLG
chr1_1877316_A_AATATAT_b38	AURKAIP1	-2.768	0.00619	-0.088008	4	0.031795	yes	ADRNLG
chr1_2036515_C_T_b38	AURKAIP1	-2.737	0.00678	-0.044604	21	0.016295	yes	ADRNLG
chr1_2342999_A_G_b38	AURKAIP1	-2.708	0.00737	-0.049548	11	0.018294	yes	ADRNLG
chr1_2189011_G_GA_b38	AURKAIP1	2.678	0.00804	0.042893	24	0.016014	yes	ADRNLG
chr1_2019182_G_A_b38	AURKAIP1	-2.666	0.00833	-0.046029	16	0.017265	yes	ADRNLG
chr1_915400_C_T_b38	AURKAIP1	-2.649	0.00875	-0.041599	45	0.015706	yes	ADRNLG
chr1_920719_T_G_b38	AURKAIP1	2.644	0.00886	0.040278	38	0.015231	yes	ADRNLG
chr1_920728_A_G_b38	AURKAIP1	2.644	0.00886	0.040278	38	0.015231	yes	ADRNLG
chr1_914991_G_T_b38	AURKAIP1	-2.636	0.00908	-0.040524	45	0.015374	yes	ADRNLG
chr1_908962_G_GGTCGGGGTC_b38	AURKAIP1	-2.62	0.00951	-0.09993	3	0.038147	yes	ADRNLG
chr1_2025598_T_C_b38	AURKAIP1	-2.617	0.00959	-0.038292	35	0.014635	yes	ADRNLG
chr1_917495_C_T_b38	AURKAIP1	-2.613	0.00969	-0.04088	46	0.015646	yes	ADRNLG
chr1_918574_C_A_b38	AURKAIP1	-2.613	0.00969	-0.04088	46	0.015646	yes	ADRNLG
chr1_2012279_C_CAAAATAAAAT_b38	AURKAIP1	-3.16	0.00183	-0.046766	33	0.014798	no	ADRNLG
chr1_1321228_G_A_b38	AURKAIP1	-3.064	0.0025	-0.065166	6	0.021267	no	ADRNLG
chr1_1685108_CA_C_b38	AURKAIP1	-3.059	0.00254	-0.058031	20	0.018968	no	ADRNLG
chr1_2012662_C_G_b38	AURKAIP1	-2.818	0.00534	-0.049901	14	0.017708	no	ADRNLG
chr1_2015152_G_A_b38	AURKAIP1	-2.818	0.00534	-0.049901	14	0.017708	no	ADRNLG
chr1_2015370_C_T_b38	AURKAIP1	-2.818	0.00534	-0.049901	14	0.017708	no	ADRNLG
chr1_2016316_C_A_b38	AURKAIP1	-2.818	0.00534	-0.049901	14	0.017708	no	ADRNLG
chr1_2017366_T_C_b38	AURKAIP1	-2.818	0.00534	-0.049901	14	0.017708	no	ADRNLG
chr1_2018105_G_T_b38	AURKAIP1	-2.818	0.00534	-0.049901	14	0.017708	no	ADRNLG
chr1_2024923_G_A_b38	AURKAIP1	-2.739	0.00674	-0.049487	12	0.018068	no	ADRNLG
chr1_1750589_G_A_b38	AURKAIP1	2.727	0.00698	0.086165	4	0.031594	no	ADRNLG
chr1_2020388_A_G_b38	AURKAIP1	-2.687	0.00784	-0.049136	12	0.018285	no	ADRNLG
chr1_2021171_T_C_b38	AURKAIP1	-2.687	0.00784	-0.049136	12	0.018285	no	ADRNLG
chr1_2289078_A_C_b38	AURKAIP1	-2.633	0.00916	-0.041007	43	0.015576	no	ADRNLG
chr1_2021166_T_C_b38	AURKAIP1	-2.631	0.0092	-0.046954	14	0.017846	no	ADRNLG
chr1_969785_A_G_b38	AURKAIP1	3.118	0.00199	0.03537	14	0.011344	yes	ARTAORT
chr1_1153726_G_A_b38	AURKAIP1	-3.103	0.00209	-0.018835	26	0.006069	yes	ARTAORT
chr1_1164057_G_A_b38	AURKAIP1	-3.085	0.00221	-0.018819	26	0.006099	yes	ARTAORT
chr1_1156987_C_T_b38	AURKAIP1	-3.028	0.00266	-0.01832	26	0.006049	yes	ARTAORT
chr1_966426_G_C_b38	AURKAIP1	-2.934	0.00359	-0.032919	14	0.011218	yes	ARTAORT
chr1_1153291_C_T_b38	AURKAIP1	-2.91	0.00387	-0.017386	27	0.005974	yes	ARTAORT
chr1_1161911_C_A_b38	AURKAIP1	-2.905	0.00393	-0.017835	24	0.006139	yes	ARTAORT
chr1_1159750_T_C_b38	AURKAIP1	-2.864	0.00446	-0.017426	25	0.006084	yes	ARTAORT
chr1_1154789_GA_G_b38	AURKAIP1	-2.779	0.00578	-0.018218	18	0.006556	yes	ARTAORT
chr1_1137871_C_A_b38	AURKAIP1	-2.777	0.00581	-0.019042	12	0.006856	yes	ARTAORT
chr1_1425750_T_C_b38	AURKAIP1	-2.763	0.00606	-0.02729	5	0.009877	yes	ARTAORT
chr1_1133966_C_T_b38	AURKAIP1	-2.734	0.00661	-0.01872	16	0.006847	yes	ARTAORT
chr1_1425936_G_A_b38	AURKAIP1	-2.721	0.00686	-0.027225	4	0.010004	yes	ARTAORT
chr1_1158683_T_C_b38	AURKAIP1	-2.667	0.00805	-0.015828	32	0.005935	yes	ARTAORT
chr1_1133503_G_A_b38	AURKAIP1	-2.65	0.00846	-0.018378	17	0.006936	yes	ARTAORT
chr1_1681101_C_T_b38	AURKAIP1	-2.643	0.00862	-0.022745	4	0.008604	yes	ARTAORT
chr1_1425822_C_G_b38	AURKAIP1	-2.636	0.0088	-0.02632	4	0.009985	yes	ARTAORT
chr1_1426771_G_C_b38	AURKAIP1	-2.632	0.00889	-0.026176	4	0.009944	yes	ARTAORT
chr1_2213543_G_T_b38	AURKAIP1	2.629	0.00899	0.015268	37	0.005808	yes	ARTAORT
chr1_1660408_T_C_b38	AURKAIP1	2.595	0.00989	0.018268	10	0.007039	yes	ARTAORT
chr1_1176929_T_C_b38	AURKAIP1	-3.351	0.000903	-0.020596	25	0.006146	no	ARTAORT
chr1_2285267_C_G_b38	AURKAIP1	3.216	0.00143	0.027303	6	0.00849	no	ARTAORT
chr1_1143811_T_C_b38	AURKAIP1	-3.201	0.00151	-0.020505	23	0.006406	no	ARTAORT
chr1_1143818_T_C_b38	AURKAIP1	-3.141	0.00184	-0.020286	24	0.006458	no	ARTAORT
chr1_2348590_C_T_b38	AURKAIP1	-3.134	0.00188	-0.046647	4	0.014883	no	ARTAORT
chr1_1144486_C_G_b38	AURKAIP1	-3.116	0.002	-0.020086	23	0.006447	no	ARTAORT
chr1_1138876_T_C_b38	AURKAIP1	-3.007	0.00285	-0.018774	19	0.006242	no	ARTAORT
chr1_1901223_A_G_b38	AURKAIP1	-2.927	0.00368	-0.056793	3	0.019406	no	ARTAORT
chr1_1900809_G_T_b38	AURKAIP1	-2.917	0.00378	-0.057425	3	0.019684	no	ARTAORT
chr1_1085543_A_AG_b38	AURKAIP1	2.886	0.00416	0.016138	42	0.005591	no	ARTAORT
chr1_1396190_G_GA_b38	AURKAIP1	2.774	0.00587	0.028401	5	0.01024	no	ARTAORT
chr1_1083795_C_G_b38	AURKAIP1	2.753	0.00625	0.015402	44	0.005595	no	ARTAORT
chr1_2285572_G_GTT_b38	AURKAIP1	2.712	0.00704	0.022528	6	0.008305	no	ARTAORT
chr1_1086315_A_G_b38	AURKAIP1	2.702	0.00726	0.015238	37	0.005639	no	ARTAORT
chr1_1150799_T_C_b38	AURKAIP1	-2.702	0.00728	-0.016793	25	0.006216	no	ARTAORT
chr1_2207868_C_T_b38	AURKAIP1	2.663	0.00813	0.016097	29	0.006044	no	ARTAORT
chr1_1085026_T_C_b38	AURKAIP1	2.663	0.00814	0.015127	40	0.005681	no	ARTAORT
chr1_1306584_G_A_b38	AURKAIP1	-2.662	0.00817	-0.038093	5	0.01431	no	ARTAORT
chr1_1906734_T_C_b38	AURKAIP1	-2.644	0.00861	-0.051183	3	0.019361	no	ARTAORT
chr1_1908446_A_C_b38	AURKAIP1	-2.644	0.00861	-0.051183	3	0.019361	no	ARTAORT
chr1_1874605_T_TA_b38	AURKAIP1	2.633	0.00888	0.020284	26	0.007704	no	ARTAORT
chr1_1159358_A_G_b38	AURKAIP1	2.603	0.00969	0.014093	56	0.005415	no	ARTAORT
chr1_976215_A_G_b38	AURKAIP1	3.504	0.000584	0.042977	19	0.012265	yes	ARTCRN
chr1_1070426_C_T_b38	AURKAIP1	-3.355	0.000977	-0.044218	8	0.01318	yes	ARTCRN
chr1_870176_T_A_b38	AURKAIP1	-3.31	0.00114	-0.060216	3	0.018193	yes	ARTCRN
chr1_2275005_A_G_b38	AURKAIP1	3.158	0.00188	0.040153	9	0.012715	yes	ARTCRN
chr1_2319680_A_G_b38	AURKAIP1	3.125	0.00209	0.035193	18	0.011261	yes	ARTCRN
chr1_2287526_C_T_b38	AURKAIP1	-3.098	0.00228	-0.034194	24	0.011039	yes	ARTCRN
chr1_2287529_G_A_b38	AURKAIP1	-3.098	0.00228	-0.034194	24	0.011039	yes	ARTCRN
chr1_1087765_G_A_b38	AURKAIP1	-3.092	0.00232	-0.044223	4	0.014305	yes	ARTCRN
chr1_2316048_A_G_b38	AURKAIP1	-3.085	0.00237	-0.035017	18	0.01135	yes	ARTCRN
chr1_2317797_G_A_b38	AURKAIP1	-3.081	0.0024	-0.034911	19	0.011331	yes	ARTCRN
chr1_2315960_T_C_b38	AURKAIP1	-3.071	0.00248	-0.035136	17	0.01144	yes	ARTCRN
chr1_2319721_T_C_b38	AURKAIP1	3.044	0.0027	0.034451	18	0.011317	yes	ARTCRN
chr1_981935_G_A_b38	AURKAIP1	-3.033	0.0028	-0.039223	8	0.012934	yes	ARTCRN
chr1_1366187_A_AGT_b38	AURKAIP1	-3.022	0.0029	-0.048115	5	0.015924	yes	ARTCRN
chr1_2316546_T_C_b38	AURKAIP1	-2.998	0.00312	-0.033464	20	0.011161	yes	ARTCRN
chr1_1970506_T_A_b38	AURKAIP1	2.954	0.00358	0.03158	42	0.01069	yes	ARTCRN
chr1_2319909_G_A_b38	AURKAIP1	2.948	0.00365	0.032966	19	0.011183	yes	ARTCRN
chr1_1471663_A_C_b38	AURKAIP1	-2.917	0.004	-0.077277	3	0.02649	yes	ARTCRN
chr1_1366776_G_GAATT_b38	AURKAIP1	-2.907	0.00413	-0.048672	5	0.016742	yes	ARTCRN
chr1_1073854_T_C_b38	AURKAIP1	2.885	0.00441	0.029452	45	0.010207	yes	ARTCRN
chr1_2316943_G_GC_b38	AURKAIP1	-2.883	0.00445	-0.031987	20	0.011096	yes	ARTCRN
chr1_2316944_G_T_b38	AURKAIP1	-2.883	0.00445	-0.031987	20	0.011096	yes	ARTCRN
chr1_2315074_A_G_b38	AURKAIP1	-2.865	0.00469	-0.031674	21	0.011057	yes	ARTCRN
chr1_1088200_A_AC_b38	AURKAIP1	-2.754	0.00652	-0.042537	4	0.015445	yes	ARTCRN
chr1_1366906_T_G_b38	AURKAIP1	-2.742	0.00675	-0.061967	4	0.022597	yes	ARTCRN
chr1_1083800_T_C_b38	AURKAIP1	2.737	0.00686	0.028143	42	0.010284	yes	ARTCRN
chr1_1367036_GTGAATTGGT_G_b38	AURKAIP1	-2.731	0.00698	-0.065319	3	0.023921	yes	ARTCRN
chr1_1367046_G_C_b38	AURKAIP1	-2.731	0.00698	-0.065319	3	0.023921	yes	ARTCRN
chr1_1367055_T_TGA_b38	AURKAIP1	-2.72	0.00719	-0.06507	3	0.023919	yes	ARTCRN
chr1_1585589_A_G_b38	AURKAIP1	2.709	0.00742	0.051135	3	0.018873	yes	ARTCRN
chr1_1585900_C_T_b38	AURKAIP1	2.709	0.00742	0.051135	3	0.018873	yes	ARTCRN
chr1_1459004_T_C_b38	AURKAIP1	-2.703	0.00757	-0.058701	10	0.021721	yes	ARTCRN
chr1_982112_C_T_b38	AURKAIP1	-2.702	0.00757	-0.036939	8	0.013669	yes	ARTCRN
chr1_982890_C_T_b38	AURKAIP1	-2.702	0.00757	-0.036939	8	0.013669	yes	ARTCRN
chr1_983237_G_A_b38	AURKAIP1	-2.702	0.00757	-0.036939	8	0.013669	yes	ARTCRN
chr1_1992226_A_G_b38	AURKAIP1	-2.698	0.00768	-0.029048	43	0.010768	yes	ARTCRN
chr1_1069577_G_A_b38	AURKAIP1	2.682	0.00804	0.027476	51	0.010247	yes	ARTCRN
chr1_1069600_G_A_b38	AURKAIP1	2.682	0.00804	0.027476	51	0.010247	yes	ARTCRN
chr1_889018_A_C_b38	AURKAIP1	2.679	0.0081	0.037956	6	0.014168	yes	ARTCRN
chr1_2045119_T_C_b38	AURKAIP1	-2.676	0.00817	-0.041563	5	0.015533	yes	ARTCRN
chr1_2045103_G_GCCGC_b38	AURKAIP1	2.676	0.00817	0.041563	5	0.015533	yes	ARTCRN
chr1_1070843_G_A_b38	AURKAIP1	2.663	0.00848	0.027303	52	0.010252	yes	ARTCRN
chr1_1586956_T_C_b38	AURKAIP1	2.633	0.00924	0.030858	31	0.011721	yes	ARTCRN
chr1_1363688_C_T_b38	AURKAIP1	-2.622	0.00953	-0.042383	5	0.016165	yes	ARTCRN
chr1_1364099_CCA_C_b38	AURKAIP1	-2.622	0.00953	-0.042383	5	0.016165	yes	ARTCRN
chr1_1364102_TGTTG_T_b38	AURKAIP1	-2.622	0.00953	-0.042383	5	0.016165	yes	ARTCRN
chr1_1366511_GGTGA_G_b38	AURKAIP1	-2.622	0.00953	-0.042383	5	0.016165	yes	ARTCRN
chr1_1368763_G_A_b38	AURKAIP1	-2.622	0.00953	-0.042383	5	0.016165	yes	ARTCRN
chr1_2287389_G_T_b38	AURKAIP1	-2.622	0.00954	-0.026163	52	0.00998	yes	ARTCRN
chr1_1968793_T_C_b38	AURKAIP1	-2.621	0.00955	-0.028491	28	0.01087	yes	ARTCRN
chr1_1071842_G_T_b38	AURKAIP1	-3.379	0.000901	-0.047618	5	0.014094	no	ARTCRN
chr1_1082207_C_T_b38	AURKAIP1	-3.359	0.000965	-0.045841	5	0.013649	no	ARTCRN
chr1_932613_GTTTC_G_b38	AURKAIP1	3.321	0.0011	0.089194	9	0.026857	no	ARTCRN
chr1_865003_C_T_b38	AURKAIP1	3.279	0.00126	0.058341	3	0.017794	no	ARTCRN
chr1_1074443_G_A_b38	AURKAIP1	-3.238	0.00145	-0.042245	7	0.013047	no	ARTCRN
chr1_1063121_G_C_b38	AURKAIP1	-3.183	0.00173	-0.042241	6	0.01327	no	ARTCRN
chr1_2314194_C_T_b38	AURKAIP1	-3.118	0.00213	-0.03488	23	0.011185	no	ARTCRN
chr1_1904424_A_AAAATAAATAAAT_b38	AURKAIP1	-3.117	0.00214	-0.031936	28	0.010246	no	ARTCRN
chr1_1060868_C_T_b38	AURKAIP1	-3.064	0.00254	-0.046063	4	0.015035	no	ARTCRN
chr1_1271974_C_CA_b38	AURKAIP1	-3.061	0.00256	-0.075889	3	0.024795	no	ARTCRN
chr1_985123_G_A_b38	AURKAIP1	-2.967	0.00344	-0.043653	4	0.014714	no	ARTCRN
chr1_1067007_A_G_b38	AURKAIP1	-2.964	0.00347	-0.035529	12	0.011987	no	ARTCRN
chr1_2314848_G_C_b38	AURKAIP1	-2.901	0.00421	-0.031479	25	0.010853	no	ARTCRN
chr1_1080336_G_A_b38	AURKAIP1	-2.875	0.00455	-0.038455	9	0.013374	no	ARTCRN
chr1_2314000_T_C_b38	AURKAIP1	-2.833	0.00516	-0.031734	21	0.011202	no	ARTCRN
chr1_2312079_C_T_b38	AURKAIP1	-2.831	0.00519	-0.033795	13	0.011937	no	ARTCRN
chr1_1968747_T_C_b38	AURKAIP1	-2.819	0.00538	-0.041814	4	0.014833	no	ARTCRN
chr1_1324185_T_TGG_b38	AURKAIP1	2.815	0.00544	0.065491	3	0.023262	no	ARTCRN
chr1_1192636_G_GACACTCCAGTTGGTATGAGTGTAGACACTCCAGTTCGTATCAGTGTAA_b38	AURKAIP1	-2.807	0.00557	-0.07294	3	0.025982	no	ARTCRN
chr1_2288000_T_G_b38	AURKAIP1	-2.728	0.00703	-0.03525	10	0.01292	no	ARTCRN
chr1_1027340_C_T_b38	AURKAIP1	-2.67	0.00832	-0.040072	4	0.015011	no	ARTCRN
chr1_1086203_A_C_b38	AURKAIP1	-2.663	0.00847	-0.035524	7	0.013338	no	ARTCRN
chr1_2301873_A_G_b38	AURKAIP1	-2.631	0.0093	-0.036486	7	0.01387	no	ARTCRN
chr1_1459391_A_G_b38	AURKAIP1	-2.631	0.0093	-0.073323	5	0.027873	no	ARTCRN
chr1_1398056_C_A_b38	AURKAIP1	3.932	9.59e-05	0.018434	74	0.004688	yes	ARTTBL
chr1_1394041_G_A_b38	AURKAIP1	3.597	0.000354	0.025912	7	0.007204	yes	ARTTBL
chr1_2102314_GTT_G_b38	AURKAIP1	3.449	0.00061	0.043335	6	0.012566	yes	ARTTBL
chr1_2060213_C_T_b38	AURKAIP1	3.435	0.000641	0.045884	5	0.013359	yes	ARTTBL
chr1_2103363_G_A_b38	AURKAIP1	3.415	0.00069	0.039123	11	0.011458	yes	ARTTBL
chr1_1303800_G_A_b38	AURKAIP1	3.389	0.000756	0.023784	8	0.007018	yes	ARTTBL
chr1_1304555_A_C_b38	AURKAIP1	3.361	0.000835	0.022943	8	0.006827	yes	ARTTBL
chr1_796578_C_T_b38	AURKAIP1	3.359	0.000839	0.046381	4	0.013807	yes	ARTTBL
chr1_1407232_G_C_b38	AURKAIP1	3.358	0.000843	0.018151	29	0.005405	yes	ARTTBL
chr1_1635226_T_C_b38	AURKAIP1	3.315	0.000983	0.01968	14	0.005938	yes	ARTTBL
chr1_1364253_C_G_b38	AURKAIP1	3.293	0.00106	0.021091	14	0.006405	yes	ARTTBL
chr1_1379093_TG_T_b38	AURKAIP1	3.292	0.00106	0.023431	9	0.007117	yes	ARTTBL
chr1_1384546_C_T_b38	AURKAIP1	3.287	0.00108	0.022789	13	0.006934	yes	ARTTBL
chr1_1301426_A_AT_b38	AURKAIP1	3.251	0.00122	0.020674	21	0.006359	yes	ARTTBL
chr1_1407565_C_A_b38	AURKAIP1	3.24	0.00127	0.022629	13	0.006984	yes	ARTTBL
chr1_1303112_G_A_b38	AURKAIP1	3.223	0.00135	0.02181	8	0.006767	yes	ARTTBL
chr1_1325753_G_T_b38	AURKAIP1	3.208	0.00142	0.022887	7	0.007135	yes	ARTTBL
chr1_1498616_T_C_b38	AURKAIP1	-3.147	0.00174	-0.040128	5	0.01275	yes	ARTTBL
chr1_1366776_G_GAATT_b38	AURKAIP1	3.133	0.00183	0.020271	14	0.00647	yes	ARTTBL
chr1_1186903_T_G_b38	AURKAIP1	3.123	0.00189	0.021975	5	0.007037	yes	ARTTBL
chr1_2103488_A_G_b38	AURKAIP1	3.119	0.00192	0.034103	15	0.010934	yes	ARTTBL
chr1_1373007_G_A_b38	AURKAIP1	3.118	0.00192	0.02064	12	0.006619	yes	ARTTBL
chr1_1366511_GGTGA_G_b38	AURKAIP1	3.108	0.00199	0.019676	14	0.00633	yes	ARTTBL
chr1_1248206_A_G_b38	AURKAIP1	3.095	0.00207	0.032691	6	0.010562	yes	ARTTBL
chr1_1363688_C_T_b38	AURKAIP1	3.059	0.00233	0.019381	14	0.006335	yes	ARTTBL
chr1_1364099_CCA_C_b38	AURKAIP1	3.059	0.00233	0.019381	14	0.006335	yes	ARTTBL
chr1_1364102_TGTTG_T_b38	AURKAIP1	3.059	0.00233	0.019381	14	0.006335	yes	ARTTBL
chr1_1368763_G_A_b38	AURKAIP1	3.059	0.00233	0.019381	14	0.006335	yes	ARTTBL
chr1_2064022_T_G_b38	AURKAIP1	3.043	0.00246	0.031117	23	0.010226	yes	ARTTBL
chr1_1364566_T_C_b38	AURKAIP1	2.988	0.00295	0.018904	14	0.006328	yes	ARTTBL
chr1_1394423_A_G_b38	AURKAIP1	2.984	0.00298	0.017038	80	0.005709	yes	ARTTBL
chr1_1370553_CAAA_C_b38	AURKAIP1	2.971	0.00311	0.020056	10	0.006752	yes	ARTTBL
chr1_1367388_T_TTGG_b38	AURKAIP1	2.966	0.00316	0.018798	14	0.006339	yes	ARTTBL
chr1_1395346_A_G_b38	AURKAIP1	2.947	0.00335	0.016925	80	0.005743	yes	ARTTBL
chr1_1369821_C_T_b38	AURKAIP1	2.933	0.00351	0.018566	14	0.00633	yes	ARTTBL
chr1_2075464_G_A_b38	AURKAIP1	2.93	0.00354	0.035047	8	0.01196	yes	ARTTBL
chr1_2075502_A_G_b38	AURKAIP1	2.93	0.00354	0.035047	8	0.01196	yes	ARTTBL
chr1_1364282_T_G_b38	AURKAIP1	2.912	0.00374	0.018426	14	0.006326	yes	ARTTBL
chr1_1364694_T_C_b38	AURKAIP1	2.912	0.00374	0.018426	14	0.006326	yes	ARTTBL
chr1_1364721_C_T_b38	AURKAIP1	2.912	0.00374	0.018426	14	0.006326	yes	ARTTBL
chr1_1365160_A_G_b38	AURKAIP1	2.912	0.00374	0.018426	14	0.006326	yes	ARTTBL
chr1_1365198_C_T_b38	AURKAIP1	2.912	0.00374	0.018426	14	0.006326	yes	ARTTBL
chr1_1366008_A_G_b38	AURKAIP1	2.912	0.00374	0.018426	14	0.006326	yes	ARTTBL
chr1_1366062_T_C_b38	AURKAIP1	2.912	0.00374	0.018426	14	0.006326	yes	ARTTBL
chr1_1366145_TGTGAA_T_b38	AURKAIP1	2.912	0.00374	0.018426	14	0.006326	yes	ARTTBL
chr1_1366453_G_T_b38	AURKAIP1	2.912	0.00374	0.018426	14	0.006326	yes	ARTTBL
chr1_1366726_T_G_b38	AURKAIP1	2.912	0.00374	0.018426	14	0.006326	yes	ARTTBL
chr1_1367258_T_A_b38	AURKAIP1	2.912	0.00374	0.018426	14	0.006326	yes	ARTTBL
chr1_1367297_GAA_G_b38	AURKAIP1	2.912	0.00374	0.018426	14	0.006326	yes	ARTTBL
chr1_1367329_A_AGT_b38	AURKAIP1	2.912	0.00374	0.018426	14	0.006326	yes	ARTTBL
chr1_1367373_T_TGTG_b38	AURKAIP1	2.912	0.00374	0.018426	14	0.006326	yes	ARTTBL
chr1_1367593_G_A_b38	AURKAIP1	2.912	0.00374	0.018426	14	0.006326	yes	ARTTBL
chr1_1367602_GT_G_b38	AURKAIP1	2.912	0.00374	0.018426	14	0.006326	yes	ARTTBL
chr1_1367605_GAGTGAGTGTA_G_b38	AURKAIP1	2.912	0.00374	0.018426	14	0.006326	yes	ARTTBL
chr1_1367670_GGTGA_G_b38	AURKAIP1	2.912	0.00374	0.018426	14	0.006326	yes	ARTTBL
chr1_1367722_TTTTA_T_b38	AURKAIP1	2.912	0.00374	0.018426	14	0.006326	yes	ARTTBL
chr1_1367874_A_T_b38	AURKAIP1	2.912	0.00374	0.018426	14	0.006326	yes	ARTTBL
chr1_1367951_C_T_b38	AURKAIP1	2.912	0.00374	0.018426	14	0.006326	yes	ARTTBL
chr1_1367965_A_G_b38	AURKAIP1	2.912	0.00374	0.018426	14	0.006326	yes	ARTTBL
chr1_1367970_T_G_b38	AURKAIP1	2.912	0.00374	0.018426	14	0.006326	yes	ARTTBL
chr1_1367994_C_A_b38	AURKAIP1	2.912	0.00374	0.018426	14	0.006326	yes	ARTTBL
chr1_1368297_C_T_b38	AURKAIP1	2.912	0.00374	0.018426	14	0.006326	yes	ARTTBL
chr1_1369282_G_A_b38	AURKAIP1	2.912	0.00374	0.018426	14	0.006326	yes	ARTTBL
chr1_1369320_GT_G_b38	AURKAIP1	2.912	0.00374	0.018426	14	0.006326	yes	ARTTBL
chr1_1369476_CTT_C_b38	AURKAIP1	2.912	0.00374	0.018426	14	0.006326	yes	ARTTBL
chr1_1369556_C_G_b38	AURKAIP1	2.912	0.00374	0.018426	14	0.006326	yes	ARTTBL
chr1_1369627_T_C_b38	AURKAIP1	2.912	0.00374	0.018426	14	0.006326	yes	ARTTBL
chr1_1369686_T_C_b38	AURKAIP1	2.912	0.00374	0.018426	14	0.006326	yes	ARTTBL
chr1_1369716_G_C_b38	AURKAIP1	2.912	0.00374	0.018426	14	0.006326	yes	ARTTBL
chr1_1369741_C_T_b38	AURKAIP1	2.912	0.00374	0.018426	14	0.006326	yes	ARTTBL
chr1_1370181_C_T_b38	AURKAIP1	2.912	0.00374	0.018426	14	0.006326	yes	ARTTBL
chr1_1370317_G_C_b38	AURKAIP1	2.912	0.00374	0.018426	14	0.006326	yes	ARTTBL
chr1_1370320_A_G_b38	AURKAIP1	2.912	0.00374	0.018426	14	0.006326	yes	ARTTBL
chr1_2059376_C_T_b38	AURKAIP1	2.909	0.00378	0.033327	14	0.011455	yes	ARTTBL
chr1_2064837_C_T_b38	AURKAIP1	2.909	0.00378	0.033327	14	0.011455	yes	ARTTBL
chr1_1367511_ATGAG_A_b38	AURKAIP1	2.908	0.00379	0.018568	13	0.006385	yes	ARTTBL
chr1_1367280_T_A_b38	AURKAIP1	2.907	0.00381	0.018408	14	0.006333	yes	ARTTBL
chr1_2331225_G_A_b38	AURKAIP1	2.891	0.00401	0.023854	3	0.008252	yes	ARTTBL
chr1_1366187_A_AGT_b38	AURKAIP1	2.886	0.00406	0.018231	14	0.006317	yes	ARTTBL
chr1_1364357_A_C_b38	AURKAIP1	2.866	0.00433	0.018087	14	0.006311	yes	ARTTBL
chr1_1368514_C_G_b38	AURKAIP1	2.866	0.00433	0.018087	14	0.006311	yes	ARTTBL
chr1_1361685_C_T_b38	AURKAIP1	2.865	0.00434	0.017363	40	0.00606	yes	ARTTBL
chr1_1366292_G_T_b38	AURKAIP1	2.857	0.00445	0.018171	14	0.00636	yes	ARTTBL
chr1_1366321_TGTGTGTAAATGG_T_b38	AURKAIP1	2.857	0.00445	0.018124	14	0.006344	yes	ARTTBL
chr1_1294390_T_C_b38	AURKAIP1	2.848	0.00458	0.042226	3	0.014827	yes	ARTTBL
chr1_1300412_C_T_b38	AURKAIP1	2.848	0.00458	0.042226	3	0.014827	yes	ARTTBL
chr1_1306341_GAGA_G_b38	AURKAIP1	2.848	0.00458	0.042226	3	0.014827	yes	ARTTBL
chr1_1367919_C_T_b38	AURKAIP1	2.845	0.00462	0.018001	14	0.006327	yes	ARTTBL
chr1_1195672_C_T_b38	AURKAIP1	2.841	0.00468	0.020436	3	0.007194	yes	ARTTBL
chr1_1363880_A_G_b38	AURKAIP1	2.837	0.00473	0.017775	14	0.006265	yes	ARTTBL
chr1_840409_TAA_T_b38	AURKAIP1	-2.831	0.00482	-0.018986	7	0.006706	yes	ARTTBL
chr1_1369803_C_CT_b38	AURKAIP1	2.826	0.0049	0.016819	13	0.005952	yes	ARTTBL
chr1_1265603_T_TTGTGTGTG_b38	AURKAIP1	2.819	0.00501	0.022687	5	0.008049	yes	ARTTBL
chr1_2055016_C_T_b38	AURKAIP1	2.797	0.00536	0.032561	13	0.011643	yes	ARTTBL
chr1_1368991_C_T_b38	AURKAIP1	2.79	0.00546	0.017767	14	0.006367	yes	ARTTBL
chr1_1369009_T_C_b38	AURKAIP1	2.787	0.00552	0.017871	14	0.006413	yes	ARTTBL
chr1_1369012_C_CG_b38	AURKAIP1	2.782	0.00559	0.017837	14	0.006411	yes	ARTTBL
chr1_2056929_C_G_b38	AURKAIP1	2.752	0.00613	0.032304	14	0.011738	yes	ARTTBL
chr1_1366681_T_TGA_b38	AURKAIP1	2.744	0.00628	0.0176	14	0.006414	yes	ARTTBL
chr1_1449009_A_T_b38	AURKAIP1	2.74	0.00636	0.015686	49	0.005726	yes	ARTTBL
chr1_967369_C_G_b38	AURKAIP1	2.734	0.00647	0.023588	3	0.008627	yes	ARTTBL
chr1_1672015_G_C_b38	AURKAIP1	2.723	0.0067	0.032356	9	0.011884	yes	ARTTBL
chr1_841852_C_T_b38	AURKAIP1	-2.684	0.0075	-0.021534	4	0.008022	yes	ARTTBL
chr1_806470_C_T_b38	AURKAIP1	2.683	0.00754	0.034828	5	0.012982	yes	ARTTBL
chr1_1191757_A_C_b38	AURKAIP1	2.682	0.00755	0.018572	6	0.006925	yes	ARTTBL
chr1_1379091_T_G_b38	AURKAIP1	-2.68	0.00759	-0.016478	19	0.006148	yes	ARTTBL
chr1_1363456_CAG_C_b38	AURKAIP1	-2.672	0.00778	-0.01457	32	0.005453	yes	ARTTBL
chr1_1500745_A_C_b38	AURKAIP1	2.672	0.00778	0.019715	59	0.007378	yes	ARTTBL
chr1_1252261_C_T_b38	AURKAIP1	2.668	0.00786	0.020608	5	0.007723	yes	ARTTBL
chr1_856473_G_A_b38	AURKAIP1	-2.668	0.00788	-0.020533	4	0.007697	yes	ARTTBL
chr1_663453_T_C_b38	AURKAIP1	2.663	0.00799	0.028341	5	0.010643	yes	ARTTBL
chr1_1389827_C_T_b38	AURKAIP1	-2.654	0.00821	-0.015139	80	0.005705	yes	ARTTBL
chr1_2056778_G_T_b38	AURKAIP1	2.642	0.00848	0.030811	14	0.01166	yes	ARTTBL
chr1_905705_C_G_b38	AURKAIP1	2.628	0.00884	0.013103	35	0.004985	yes	ARTTBL
chr1_1441187_A_G_b38	AURKAIP1	2.628	0.00885	0.013838	57	0.005266	yes	ARTTBL
chr1_1592964_C_T_b38	AURKAIP1	-2.623	0.00897	-0.021148	4	0.008062	yes	ARTTBL
chr1_1286532_T_C_b38	AURKAIP1	2.611	0.00929	0.035658	4	0.013657	yes	ARTTBL
chr1_1368177_G_C_b38	AURKAIP1	2.59	0.00987	0.016361	17	0.006317	yes	ARTTBL
chr1_1340697_G_A_b38	AURKAIP1	-3.891	0.000113	-0.020452	30	0.005256	no	ARTTBL
chr1_1398218_C_A_b38	AURKAIP1	3.688	0.00025	0.024519	15	0.006648	no	ARTTBL
chr1_1400756_GGA_G_b38	AURKAIP1	3.675	0.000262	0.02437	15	0.006631	no	ARTTBL
chr1_1401954_G_T_b38	AURKAIP1	3.675	0.000262	0.02437	15	0.006631	no	ARTTBL
chr1_1383743_T_C_b38	AURKAIP1	3.66	0.000278	0.023982	15	0.006552	no	ARTTBL
chr1_1403593_A_G_b38	AURKAIP1	3.623	0.000321	0.023953	15	0.006612	no	ARTTBL
chr1_1382893_G_A_b38	AURKAIP1	3.554	0.000414	0.023328	15	0.006564	no	ARTTBL
chr1_1375642_C_T_b38	AURKAIP1	3.407	0.00071	0.021704	16	0.006371	no	ARTTBL
chr1_1374505_A_G_b38	AURKAIP1	3.3	0.00103	0.02102	16	0.00637	no	ARTTBL
chr1_2131655_G_A_b38	AURKAIP1	3.288	0.00108	0.04163	6	0.012662	no	ARTTBL
chr1_2112579_C_G_b38	AURKAIP1	3.272	0.00114	0.042837	5	0.013091	no	ARTTBL
chr1_2115032_G_A_b38	AURKAIP1	3.272	0.00114	0.042837	5	0.013091	no	ARTTBL
chr1_1454315_C_T_b38	AURKAIP1	3.254	0.00121	0.017721	66	0.005447	no	ARTTBL
chr1_1417051_CA_C_b38	AURKAIP1	3.239	0.00128	0.023191	11	0.007161	no	ARTTBL
chr1_1453703_A_G_b38	AURKAIP1	3.223	0.00135	0.017638	72	0.005472	no	ARTTBL
chr1_1454092_A_G_b38	AURKAIP1	3.211	0.0014	0.017547	72	0.005464	no	ARTTBL
chr1_1457071_C_T_b38	AURKAIP1	3.206	0.00143	0.017085	39	0.005328	no	ARTTBL
chr1_2305809_A_G_b38	AURKAIP1	3.201	0.00145	0.016882	23	0.005273	no	ARTTBL
chr1_1454770_T_C_b38	AURKAIP1	3.184	0.00154	0.01741	72	0.005468	no	ARTTBL
chr1_2111657_G_A_b38	AURKAIP1	3.183	0.00155	0.037412	9	0.011753	no	ARTTBL
chr1_1452511_A_G_b38	AURKAIP1	3.174	0.00159	0.017362	72	0.00547	no	ARTTBL
chr1_1452888_C_A_b38	AURKAIP1	3.174	0.00159	0.017362	72	0.00547	no	ARTTBL
chr1_1452909_A_C_b38	AURKAIP1	3.174	0.00159	0.017362	72	0.00547	no	ARTTBL
chr1_1341550_GCA_G_b38	AURKAIP1	3.161	0.00166	0.020413	15	0.006457	no	ARTTBL
chr1_1372909_G_A_b38	AURKAIP1	3.16	0.00167	0.020653	14	0.006535	no	ARTTBL
chr1_1725339_C_A_b38	AURKAIP1	-3.128	0.00186	-0.012781	113	0.004086	no	ARTTBL
chr1_1455617_T_G_b38	AURKAIP1	3.082	0.00216	0.01685	72	0.005467	no	ARTTBL
chr1_1619986_T_C_b38	AURKAIP1	-3.076	0.00221	-0.014721	54	0.004785	no	ARTTBL
chr1_1186335_C_T_b38	AURKAIP1	3.027	0.00259	0.021404	4	0.007071	no	ARTTBL
chr1_1186850_G_GT_b38	AURKAIP1	3.026	0.0026	0.020382	6	0.006735	no	ARTTBL
chr1_1451787_A_C_b38	AURKAIP1	3.024	0.00262	0.015983	58	0.005285	no	ARTTBL
chr1_1456217_T_C_b38	AURKAIP1	3.023	0.00263	0.017344	61	0.005738	no	ARTTBL
chr1_1453643_A_ATT_b38	AURKAIP1	3.01	0.00274	0.016794	41	0.005579	no	ARTTBL
chr1_1230462_A_ATTT_b38	AURKAIP1	3.008	0.00276	0.022775	5	0.007571	no	ARTTBL
chr1_1367268_TGA_T_b38	AURKAIP1	2.993	0.00289	0.01889	14	0.006311	no	ARTTBL
chr1_1380867_A_G_b38	AURKAIP1	2.976	0.00305	0.020156	13	0.006772	no	ARTTBL
chr1_1373006_G_A_b38	AURKAIP1	2.955	0.00327	0.019783	10	0.006695	no	ARTTBL
chr1_2306798_A_T_b38	AURKAIP1	-2.955	0.00328	-0.019501	10	0.0066	no	ARTTBL
chr1_1186100_T_C_b38	AURKAIP1	2.944	0.00338	0.019969	7	0.006782	no	ARTTBL
chr1_1440834_C_G_b38	AURKAIP1	2.934	0.00349	0.015308	74	0.005217	no	ARTTBL
chr1_2099918_A_T_b38	AURKAIP1	2.928	0.00357	0.037393	6	0.012772	no	ARTTBL
chr1_1439454_A_G_b38	AURKAIP1	2.926	0.00358	0.014886	69	0.005087	no	ARTTBL
chr1_1402457_A_G_b38	AURKAIP1	2.921	0.00365	0.016815	81	0.005757	no	ARTTBL
chr1_1411323_A_C_b38	AURKAIP1	2.918	0.00368	0.016792	81	0.005755	no	ARTTBL
chr1_1195475_T_C_b38	AURKAIP1	2.905	0.00383	0.02065	4	0.007109	no	ARTTBL
chr1_1367300_T_TGA_b38	AURKAIP1	2.897	0.00393	0.018487	13	0.006381	no	ARTTBL
chr1_1443457_T_C_b38	AURKAIP1	2.885	0.00408	0.015076	77	0.005227	no	ARTTBL
chr1_2103523_C_T_b38	AURKAIP1	2.882	0.00412	0.032048	14	0.011122	no	ARTTBL
chr1_2105801_T_C_b38	AURKAIP1	2.874	0.00422	0.032562	12	0.01133	no	ARTTBL
chr1_1193742_G_C_b38	AURKAIP1	2.858	0.00444	0.020352	4	0.007122	no	ARTTBL
chr1_1194409_G_C_b38	AURKAIP1	2.858	0.00444	0.020352	4	0.007122	no	ARTTBL
chr1_1194540_G_A_b38	AURKAIP1	2.858	0.00444	0.020352	4	0.007122	no	ARTTBL
chr1_1195347_A_C_b38	AURKAIP1	2.858	0.00444	0.020352	4	0.007122	no	ARTTBL
chr1_982890_C_T_b38	AURKAIP1	-2.857	0.00445	-0.015589	21	0.005456	no	ARTTBL
chr1_983237_G_A_b38	AURKAIP1	-2.857	0.00445	-0.015589	21	0.005456	no	ARTTBL
chr1_1370532_C_T_b38	AURKAIP1	2.83	0.00484	0.018005	15	0.006363	no	ARTTBL
chr1_1370430_T_C_b38	AURKAIP1	2.827	0.00488	0.018074	15	0.006393	no	ARTTBL
chr1_1370584_G_C_b38	AURKAIP1	2.827	0.00488	0.018074	15	0.006393	no	ARTTBL
chr1_982112_C_T_b38	AURKAIP1	-2.826	0.0049	-0.015398	21	0.005449	no	ARTTBL
chr1_1451028_T_A_b38	AURKAIP1	2.811	0.00513	0.016464	17	0.005858	no	ARTTBL
chr1_1020847_C_CG_b38	AURKAIP1	-2.806	0.0052	-0.024354	8	0.008678	no	ARTTBL
chr1_1195500_C_CTTTTTTTTTTT_b38	AURKAIP1	-2.798	0.00533	-0.03569	3	0.012754	no	ARTTBL
chr1_981935_G_A_b38	AURKAIP1	-2.793	0.00542	-0.01484	23	0.005314	no	ARTTBL
chr1_1445240_A_G_b38	AURKAIP1	2.789	0.00548	0.014502	76	0.005199	no	ARTTBL
chr1_1344048_G_A_b38	AURKAIP1	2.788	0.0055	0.018579	12	0.006664	no	ARTTBL
chr1_1369407_G_A_b38	AURKAIP1	2.771	0.0058	0.017561	13	0.006338	no	ARTTBL
chr1_1452346_A_G_b38	AURKAIP1	2.77	0.00582	0.015955	18	0.005761	no	ARTTBL
chr1_1366987_GTGTGTAGTGGATGAGTGTGGA_G_b38	AURKAIP1	2.762	0.00596	0.029961	5	0.010849	no	ARTTBL
chr1_1445187_T_G_b38	AURKAIP1	2.759	0.00601	0.014255	71	0.005167	no	ARTTBL
chr1_1367462_T_C_b38	AURKAIP1	2.756	0.00606	0.017523	14	0.006358	no	ARTTBL
chr1_1456829_G_C_b38	AURKAIP1	2.735	0.00646	0.015712	51	0.005745	no	ARTTBL
chr1_2109797_G_A_b38	AURKAIP1	2.728	0.0066	0.03261	8	0.011955	no	ARTTBL
chr1_2112343_C_T_b38	AURKAIP1	2.728	0.0066	0.03261	8	0.011955	no	ARTTBL
chr1_1202905_C_G_b38	AURKAIP1	2.721	0.00672	0.018968	5	0.00697	no	ARTTBL
chr1_1316929_A_T_b38	AURKAIP1	2.715	0.00686	0.017629	13	0.006494	no	ARTTBL
chr1_1187159_A_G_b38	AURKAIP1	2.711	0.00694	0.019361	4	0.007143	no	ARTTBL
chr1_1189439_C_T_b38	AURKAIP1	2.711	0.00694	0.019361	4	0.007143	no	ARTTBL
chr1_1189840_C_T_b38	AURKAIP1	2.711	0.00694	0.019361	4	0.007143	no	ARTTBL
chr1_1191721_C_A_b38	AURKAIP1	2.711	0.00694	0.019361	4	0.007143	no	ARTTBL
chr1_1192228_G_GT_b38	AURKAIP1	2.711	0.00694	0.019361	4	0.007143	no	ARTTBL
chr1_2037780_C_CA_b38	AURKAIP1	-2.696	0.00726	-0.02133	4	0.007913	no	ARTTBL
chr1_1329973_GCGTGTGCCATGCA_G_b38	AURKAIP1	2.692	0.00735	0.018064	12	0.006712	no	ARTTBL
chr1_2132032_C_G_b38	AURKAIP1	2.685	0.00748	0.030188	10	0.011241	no	ARTTBL
chr1_1695747_C_T_b38	AURKAIP1	-2.683	0.00754	-0.013912	93	0.005186	no	ARTTBL
chr1_1456891_T_C_b38	AURKAIP1	2.682	0.00756	0.013093	54	0.004882	no	ARTTBL
chr1_976536_C_T_b38	AURKAIP1	-2.682	0.00756	-0.014658	20	0.005466	no	ARTTBL
chr1_1456079_T_C_b38	AURKAIP1	2.679	0.00762	0.014534	36	0.005424	no	ARTTBL
chr1_668125_A_C_b38	AURKAIP1	2.677	0.00766	0.038293	3	0.014302	no	ARTTBL
chr1_2092603_A_G_b38	AURKAIP1	2.675	0.00772	0.034106	6	0.012752	no	ARTTBL
chr1_973443_G_A_b38	AURKAIP1	-2.672	0.00777	-0.014188	24	0.005309	no	ARTTBL
chr1_1471992_T_C_b38	AURKAIP1	2.669	0.00785	0.014157	87	0.005305	no	ARTTBL
chr1_1387698_A_G_b38	AURKAIP1	-2.666	0.00792	-0.015257	81	0.005723	no	ARTTBL
chr1_1479309_C_T_b38	AURKAIP1	2.662	0.00802	0.028493	3	0.010705	no	ARTTBL
chr1_1456051_C_T_b38	AURKAIP1	2.661	0.00803	0.014391	36	0.005408	no	ARTTBL
chr1_1450636_A_G_b38	AURKAIP1	2.645	0.00843	0.01579	15	0.00597	no	ARTTBL
chr1_791554_G_GGAATC_b38	AURKAIP1	-2.639	0.00858	-0.014437	19	0.005471	no	ARTTBL
chr1_2304900_T_C_b38	AURKAIP1	2.635	0.00866	0.015057	17	0.005713	no	ARTTBL
chr1_1452825_AAAG_A_b38	AURKAIP1	2.634	0.00869	0.014198	37	0.00539	no	ARTTBL
chr1_981282_A_C_b38	AURKAIP1	-2.63	0.0088	-0.014086	23	0.005356	no	ARTTBL
chr1_1456154_G_A_b38	AURKAIP1	2.604	0.00948	0.014145	36	0.005432	no	ARTTBL
chr1_1454848_T_C_b38	AURKAIP1	2.599	0.00961	0.013971	39	0.005375	no	ARTTBL
chr1_1453552_G_A_b38	AURKAIP1	2.598	0.00963	0.014036	37	0.005402	no	ARTTBL
chr1_1455134_T_G_b38	AURKAIP1	2.598	0.00963	0.014036	37	0.005402	no	ARTTBL
chr1_1455337_A_G_b38	AURKAIP1	2.598	0.00963	0.014036	37	0.005402	no	ARTTBL
chr1_1455495_C_T_b38	AURKAIP1	2.598	0.00963	0.014036	37	0.005402	no	ARTTBL
chr1_2276041_C_G_b38	AURKAIP1	-2.751	0.00703	-0.066964	15	0.024345	yes	BRNAMY
chr1_2282992_C_T_b38	AURKAIP1	-2.694	0.00825	-0.064609	14	0.023986	yes	BRNAMY
chr1_1496953_T_C_b38	AURKAIP1	2.663	0.00899	0.096621	10	0.036284	yes	BRNAMY
chr1_1518285_T_C_b38	AURKAIP1	2.646	0.00942	0.090431	12	0.034174	yes	BRNAMY
chr1_630211_C_T_b38	AURKAIP1	3.706	0.000341	0.114756	3	0.030964	no	BRNAMY
chr1_633365_C_CCA_b38	AURKAIP1	3.072	0.00272	0.084824	7	0.027616	no	BRNAMY
chr1_727034_C_T_b38	AURKAIP1	-3.051	0.0029	-0.094948	4	0.031115	no	BRNAMY
chr1_925036_G_A_b38	AURKAIP1	-2.961	0.0038	-0.084718	7	0.028608	no	BRNAMY
chr1_926250_G_A_b38	AURKAIP1	-2.961	0.0038	-0.084718	7	0.028608	no	BRNAMY
chr1_927486_C_T_b38	AURKAIP1	-2.961	0.0038	-0.084718	7	0.028608	no	BRNAMY
chr1_1315752_GAGCGAGGGAGGTGGGGGCGGGGAGGGAGGGAGGGAGGCGGGC_G_b38	AURKAIP1	2.938	0.00407	0.085416	3	0.029071	no	BRNAMY
chr1_929558_G_A_b38	AURKAIP1	-2.923	0.00426	-0.079107	9	0.02706	no	BRNAMY
chr1_925308_G_A_b38	AURKAIP1	-2.889	0.00472	-0.080413	8	0.027837	no	BRNAMY
chr1_814962_C_T_b38	AURKAIP1	2.822	0.00573	0.069239	18	0.024536	no	BRNAMY
chr1_1235720_T_G_b38	AURKAIP1	-2.785	0.00637	-0.119763	5	0.042998	no	BRNAMY
chr1_1375678_TA_T_b38	AURKAIP1	2.779	0.00649	0.093804	5	0.03376	no	BRNAMY
chr1_635258_T_C_b38	AURKAIP1	2.753	0.00698	0.096784	3	0.035153	no	BRNAMY
chr1_807641_T_C_b38	AURKAIP1	-2.753	0.00699	-0.072952	7	0.026502	no	BRNAMY
chr1_923311_TG_T_b38	AURKAIP1	-2.749	0.00705	-0.080803	7	0.029389	no	BRNAMY
chr1_727242_G_A_b38	AURKAIP1	-2.745	0.00715	-0.089323	4	0.032544	no	BRNAMY
chr1_1243102_A_G_b38	AURKAIP1	-2.673	0.00875	-0.084369	4	0.031567	no	BRNAMY
chr1_1251618_G_A_b38	AURKAIP1	-2.673	0.00875	-0.084369	4	0.031567	no	BRNAMY
chr1_1242865_C_T_b38	AURKAIP1	-2.661	0.00903	-0.082584	4	0.031033	no	BRNAMY
chr1_1232800_G_C_b38	AURKAIP1	-2.658	0.00912	-0.108316	5	0.040755	no	BRNAMY
chr1_851615_G_A_b38	AURKAIP1	-2.651	0.00929	-0.087715	3	0.033085	no	BRNAMY
chr1_727477_G_A_b38	AURKAIP1	2.634	0.00975	0.084507	6	0.032087	no	BRNAMY
chr1_455065_G_T_b38	AURKAIP1	3.16	0.00199	0.065893	5	0.020849	no	BRNACC
chr1_1381268_C_T_b38	AURKAIP1	2.941	0.00392	0.089834	3	0.030544	no	BRNACC
chr1_1381294_C_T_b38	AURKAIP1	2.941	0.00392	0.089834	3	0.030544	no	BRNACC
chr1_1380513_C_T_b38	AURKAIP1	2.83	0.00545	0.082111	3	0.029013	no	BRNACC
chr1_1381290_C_G_b38	AURKAIP1	2.83	0.00545	0.082111	3	0.029013	no	BRNACC
chr1_1385384_G_A_b38	AURKAIP1	2.83	0.00545	0.082111	3	0.029013	no	BRNACC
chr1_1395050_G_A_b38	AURKAIP1	-2.83	0.00545	-0.082111	3	0.029013	no	BRNACC
chr1_1399922_C_T_b38	AURKAIP1	-2.83	0.00545	-0.082111	3	0.029013	no	BRNACC
chr1_1402900_A_G_b38	AURKAIP1	-2.83	0.00545	-0.082111	3	0.029013	no	BRNACC
chr1_1403240_CCTTT_C_b38	AURKAIP1	-2.83	0.00545	-0.082111	3	0.029013	no	BRNACC
chr1_1405316_T_C_b38	AURKAIP1	-2.83	0.00545	-0.082111	3	0.029013	no	BRNACC
chr1_1380790_G_A_b38	AURKAIP1	2.8	0.00595	0.083585	3	0.029852	no	BRNACC
chr1_1254681_A_G_b38	AURKAIP1	-2.778	0.00635	-0.083868	4	0.030194	no	BRNACC
chr1_1258333_C_G_b38	AURKAIP1	-2.778	0.00635	-0.083868	4	0.030194	no	BRNACC
chr1_1258343_A_C_b38	AURKAIP1	-2.778	0.00635	-0.083868	4	0.030194	no	BRNACC
chr1_1530546_A_ATT_b38	AURKAIP1	-2.636	0.00948	-0.101801	4	0.038613	no	BRNACC
chr1_1353091_C_T_b38	AURKAIP1	2.632	0.00959	0.079014	3	0.03002	no	BRNACC
chr1_1353203_C_G_b38	AURKAIP1	2.628	0.0097	0.075686	3	0.028799	no	BRNACC
chr1_1530568_G_T_b38	AURKAIP1	-2.618	0.00998	-0.10189	4	0.038921	no	BRNACC
chr1_1477677_TTTTTA_T_b38	AURKAIP1	-4.022	9.05e-05	-0.133165	4	0.033111	yes	BRNCDT
chr1_1457919_C_A_b38	AURKAIP1	-3.449	0.000727	-0.117519	3	0.034074	yes	BRNCDT
chr1_1457922_T_C_b38	AURKAIP1	-3.449	0.000727	-0.117519	3	0.034074	yes	BRNCDT
chr1_1936906_C_CA_b38	AURKAIP1	2.869	0.00469	0.049259	17	0.017167	yes	BRNCDT
chr1_2051721_C_A_b38	AURKAIP1	2.817	0.00549	0.045065	13	0.015999	yes	BRNCDT
chr1_1461719_G_A_b38	AURKAIP1	-2.763	0.00644	-0.096889	3	0.035073	yes	BRNCDT
chr1_596697_ACATTCATGCTCACTCATACACACCCAGATCATATATACACTCGTGCACACATTCACACTCATACACACCCAAATCATACTCACATTCATGCACACATGTT_A_b38	AURKAIP1	-2.679	0.0082	-0.092533	3	0.034546	yes	BRNCDT
chr1_1331945_G_GC_b38	AURKAIP1	-2.664	0.00855	-0.072153	6	0.027085	yes	BRNCDT
chr1_866675_C_T_b38	AURKAIP1	-2.624	0.00958	-0.094972	3	0.036199	yes	BRNCDT
chr1_1254681_A_G_b38	AURKAIP1	-3.211	0.00161	-0.083675	5	0.02606	no	BRNCDT
chr1_1258333_C_G_b38	AURKAIP1	-3.183	0.00177	-0.081277	6	0.025536	no	BRNCDT
chr1_1258343_A_C_b38	AURKAIP1	-3.183	0.00177	-0.081277	6	0.025536	no	BRNCDT
chr1_2305809_A_G_b38	AURKAIP1	3.147	0.00198	0.052941	9	0.016821	no	BRNCDT
chr1_1232800_G_C_b38	AURKAIP1	-3.099	0.00231	-0.086433	5	0.027887	no	BRNCDT
chr1_1421814_G_A_b38	AURKAIP1	-3.035	0.00283	-0.098979	3	0.032615	no	BRNCDT
chr1_1324134_G_GGCTGGGGGGCTGGGAGGCTGAGAGGCTGGGGAGCTGGGGA_b38	AURKAIP1	-3.018	0.00298	-0.085761	4	0.028413	no	BRNCDT
chr1_2303580_T_C_b38	AURKAIP1	2.939	0.0038	0.044267	16	0.015061	no	BRNCDT
chr1_1235720_T_G_b38	AURKAIP1	-2.92	0.00403	-0.085226	6	0.02919	no	BRNCDT
chr1_1415792_A_T_b38	AURKAIP1	-2.912	0.00412	-0.093629	3	0.032149	no	BRNCDT
chr1_2050574_C_T_b38	AURKAIP1	-2.91	0.00416	-0.101415	3	0.034854	no	BRNCDT
chr1_1277269_T_C_b38	AURKAIP1	-2.905	0.00422	-0.063675	12	0.02192	no	BRNCDT
chr1_1278407_T_TA_b38	AURKAIP1	-2.905	0.00422	-0.063675	12	0.02192	no	BRNCDT
chr1_1282706_C_T_b38	AURKAIP1	-2.842	0.0051	-0.061821	13	0.021753	no	BRNCDT
chr1_1595226_C_G_b38	AURKAIP1	2.804	0.00571	0.050933	7	0.018167	no	BRNCDT
chr1_629218_A_G_b38	AURKAIP1	-2.796	0.00584	-0.10798	3	0.038617	no	BRNCDT
chr1_1486354_G_C_b38	AURKAIP1	-2.708	0.00754	-0.08771	4	0.03239	no	BRNCDT
chr1_1277844_T_A_b38	AURKAIP1	-2.701	0.00768	-0.059711	11	0.022104	no	BRNCDT
chr1_1203533_T_C_b38	AURKAIP1	-2.701	0.0077	-0.069909	7	0.025886	no	BRNCDT
chr1_1203822_T_C_b38	AURKAIP1	-2.701	0.0077	-0.069909	7	0.025886	no	BRNCDT
chr1_1206343_A_G_b38	AURKAIP1	-2.676	0.00826	-0.0731	3	0.027316	no	BRNCDT
chr1_1206770_G_A_b38	AURKAIP1	-2.676	0.00826	-0.0731	3	0.027316	no	BRNCDT
chr1_1274972_A_G_b38	AURKAIP1	-2.676	0.00826	-0.059934	12	0.022398	no	BRNCDT
chr1_2304217_G_A_b38	AURKAIP1	2.674	0.00831	0.053927	4	0.020167	no	BRNCDT
chr1_2364412_G_GTTGT_b38	AURKAIP1	2.66	0.00864	0.04369	13	0.016423	no	BRNCDT
chr1_1428763_A_G_b38	AURKAIP1	2.648	0.00895	0.073316	6	0.027688	no	BRNCDT
chr1_1494105_G_A_b38	AURKAIP1	-2.624	0.00957	-0.084189	4	0.032084	no	BRNCDT
chr1_1495205_G_A_b38	AURKAIP1	-2.624	0.00957	-0.084189	4	0.032084	no	BRNCDT
chr1_1495221_G_A_b38	AURKAIP1	-2.624	0.00957	-0.084189	4	0.032084	no	BRNCDT
chr1_1495222_T_G_b38	AURKAIP1	-2.624	0.00957	-0.084189	4	0.032084	no	BRNCDT
chr1_1495236_T_C_b38	AURKAIP1	-2.624	0.00957	-0.084189	4	0.032084	no	BRNCDT
chr1_1495327_C_T_b38	AURKAIP1	-2.624	0.00957	-0.084189	4	0.032084	no	BRNCDT
chr1_1206176_G_C_b38	AURKAIP1	-2.615	0.00981	-0.0703	3	0.02688	no	BRNCDT
chr1_1882426_C_CA_b38	AURKAIP1	2.854	0.005	0.088348	3	0.030951	yes	BRNCHB
chr1_1231507_T_C_b38	AURKAIP1	-2.827	0.00542	-0.049488	3	0.017506	yes	BRNCHB
chr1_1027869_C_T_b38	AURKAIP1	-2.738	0.00703	-0.05333	6	0.019481	yes	BRNCHB
chr1_1050080_T_C_b38	AURKAIP1	-2.733	0.00712	-0.074422	4	0.027227	yes	BRNCHB
chr1_2364484_C_T_b38	AURKAIP1	-2.73	0.00719	-0.048563	5	0.01779	yes	BRNCHB
chr1_1022587_T_TTGTAGTCTGACCTGTGGTCTGAC_b38	AURKAIP1	-3.367	0.000992	-0.112687	4	0.033467	no	BRNCHB
chr1_1456182_G_A_b38	AURKAIP1	-2.936	0.00392	-0.047742	12	0.016264	no	BRNCHB
chr1_1236303_A_G_b38	AURKAIP1	-2.91	0.00424	-0.04955	4	0.017028	no	BRNCHB
chr1_1456829_G_C_b38	AURKAIP1	-2.837	0.00526	-0.047974	13	0.016908	no	BRNCHB
chr1_1454770_T_C_b38	AURKAIP1	-2.837	0.00526	-0.047761	19	0.016835	no	BRNCHB
chr1_1452511_A_G_b38	AURKAIP1	-2.708	0.00766	-0.045834	18	0.016927	no	BRNCHB
chr1_1452888_C_A_b38	AURKAIP1	-2.708	0.00766	-0.045834	18	0.016927	no	BRNCHB
chr1_1452909_A_C_b38	AURKAIP1	-2.708	0.00766	-0.045834	18	0.016927	no	BRNCHB
chr1_1454092_A_G_b38	AURKAIP1	-2.708	0.00766	-0.045834	18	0.016927	no	BRNCHB
chr1_1265603_T_TTGTG_b38	AURKAIP1	2.689	0.00807	0.047651	3	0.017718	no	BRNCHB
chr1_1453703_A_G_b38	AURKAIP1	-2.671	0.00851	-0.045374	18	0.01699	no	BRNCHB
chr1_1454848_T_C_b38	AURKAIP1	-2.628	0.00958	-0.044115	10	0.016785	no	BRNCHB
chr1_1454315_C_T_b38	AURKAIP1	-2.621	0.00977	-0.044066	15	0.016811	no	BRNCHB
chr1_1120062_A_G_b38	AURKAIP1	-2.62	0.00982	-0.074052	4	0.028267	no	BRNCHB
chr1_530938_C_T_b38	AURKAIP1	-3.096	0.0023	-0.049317	3	0.015929	yes	BRNCHA
chr1_2367644_G_A_b38	AURKAIP1	-2.916	0.00403	-0.035258	26	0.012091	yes	BRNCHA
chr1_903175_C_A_b38	AURKAIP1	2.87	0.00463	0.04058	9	0.014139	yes	BRNCHA
chr1_1663038_T_C_b38	AURKAIP1	-2.867	0.00468	-0.035276	37	0.012306	yes	BRNCHA
chr1_1679100_A_G_b38	AURKAIP1	2.762	0.00638	0.031593	40	0.011438	yes	BRNCHA
chr1_905705_C_G_b38	AURKAIP1	2.611	0.00984	0.037451	9	0.014344	yes	BRNCHA
chr1_1732892_CT_C_b38	AURKAIP1	2.607	0.00996	0.038967	6	0.014948	yes	BRNCHA
chr1_2068241_G_A_b38	AURKAIP1	3.482	0.000635	0.048339	8	0.013883	no	BRNCHA
chr1_1279441_C_T_b38	AURKAIP1	3.058	0.00259	0.063966	3	0.020914	no	BRNCHA
chr1_2351874_C_G_b38	AURKAIP1	2.988	0.00323	0.047903	4	0.01603	no	BRNCHA
chr1_2028422_G_GC_b38	AURKAIP1	2.93	0.00387	0.040941	11	0.013975	no	BRNCHA
chr1_2118713_C_CTGTG_b38	AURKAIP1	2.876	0.00455	0.046407	3	0.016138	no	BRNCHA
chr1_2347995_C_T_b38	AURKAIP1	2.738	0.00686	0.044408	4	0.016222	no	BRNCHA
chr1_2348949_CCT_C_b38	AURKAIP1	2.738	0.00686	0.044408	4	0.016222	no	BRNCHA
chr1_2350943_C_T_b38	AURKAIP1	2.738	0.00686	0.044408	4	0.016222	no	BRNCHA
chr1_2354291_A_G_b38	AURKAIP1	2.738	0.00686	0.044408	4	0.016222	no	BRNCHA
chr1_1674633_C_CA_b38	AURKAIP1	-2.726	0.0071	-0.032993	25	0.012104	no	BRNCHA
chr1_2366312_C_T_b38	AURKAIP1	2.723	0.00714	0.044566	4	0.016364	no	BRNCHA
chr1_2357096_C_G_b38	AURKAIP1	2.694	0.00777	0.043976	4	0.016323	no	BRNCHA
chr1_2357413_G_A_b38	AURKAIP1	2.694	0.00777	0.043976	4	0.016323	no	BRNCHA
chr1_2354969_C_T_b38	AURKAIP1	2.684	0.00801	0.044256	4	0.01649	no	BRNCHA
chr1_2355671_C_T_b38	AURKAIP1	2.684	0.00801	0.044256	4	0.01649	no	BRNCHA
chr1_2356158_C_T_b38	AURKAIP1	2.684	0.00801	0.044256	4	0.01649	no	BRNCHA
chr1_2361249_C_G_b38	AURKAIP1	2.684	0.00801	0.044256	4	0.01649	no	BRNCHA
chr1_897018_T_C_b38	AURKAIP1	-2.683	0.00802	-0.036486	10	0.013597	no	BRNCHA
chr1_1898648_CACACACATAAGTTGGATAT_C_b38	AURKAIP1	-2.628	0.00937	-0.035106	11	0.013356	no	BRNCHA
chr1_1805416_A_G_b38	AURKAIP1	3.284	0.00125	0.080345	3	0.024468	yes	BRNCTXA
chr1_921056_TG_T_b38	AURKAIP1	3.177	0.00178	0.066514	3	0.020934	yes	BRNCTXA
chr1_2309937_C_CT_b38	AURKAIP1	-2.991	0.00321	-0.044719	47	0.014953	yes	BRNCTXA
chr1_1819705_AT_A_b38	AURKAIP1	2.839	0.00509	0.061583	3	0.021689	yes	BRNCTXA
chr1_1810535_CA_C_b38	AURKAIP1	2.767	0.0063	0.050678	26	0.018313	yes	BRNCTXA
chr1_1822300_CT_C_b38	AURKAIP1	2.612	0.00982	0.041772	43	0.015989	yes	BRNCTXA
chr1_1736801_CA_C_b38	AURKAIP1	3.629	0.00038	0.059613	27	0.016428	no	BRNCTXA
chr1_1743566_T_A_b38	AURKAIP1	-3.327	0.00108	-0.090694	4	0.027258	no	BRNCTXA
chr1_1744121_A_C_b38	AURKAIP1	3.004	0.00308	0.057459	21	0.019125	no	BRNCTXA
chr1_1855158_CA_C_b38	AURKAIP1	2.95	0.00364	0.056543	5	0.019167	no	BRNCTXA
chr1_915824_G_C_b38	AURKAIP1	2.799	0.00575	0.051732	9	0.018486	no	BRNCTXA
chr1_1367175_C_T_b38	AURKAIP1	-2.61	0.00989	-0.077525	4	0.029701	no	BRNCTXA
chr1_1982325_C_T_b38	AURKAIP1	-2.97	0.00353	-0.065459	4	0.022041	yes	BRNCTXB
chr1_1510082_T_TA_b38	AURKAIP1	-2.692	0.00801	-0.071507	5	0.026565	yes	BRNCTXB
chr1_1173774_G_A_b38	AURKAIP1	2.66	0.00876	0.054298	7	0.020409	yes	BRNCTXB
chr1_1679085_T_C_b38	AURKAIP1	3.037	0.00287	0.047628	39	0.015682	no	BRNCTXB
chr1_1661562_G_C_b38	AURKAIP1	-3.034	0.0029	-0.045762	36	0.015083	no	BRNCTXB
chr1_1049114_GC_G_b38	AURKAIP1	-3.03	0.00294	-0.04837	40	0.015965	no	BRNCTXB
chr1_1361836_A_G_b38	AURKAIP1	-2.988	0.00334	-0.082331	3	0.027557	no	BRNCTXB
chr1_1651653_C_T_b38	AURKAIP1	-2.924	0.00406	-0.050883	35	0.017404	no	BRNCTXB
chr1_1668373_C_T_b38	AURKAIP1	-2.905	0.00429	-0.056205	20	0.019346	no	BRNCTXB
chr1_2120839_CT_C_b38	AURKAIP1	2.804	0.00579	0.056692	9	0.020217	no	BRNCTXB
chr1_2304233_C_T_b38	AURKAIP1	2.767	0.00645	0.060668	8	0.021922	no	BRNCTXB
chr1_2303464_C_T_b38	AURKAIP1	2.765	0.0065	0.060045	4	0.021719	no	BRNCTXB
chr1_2061538_G_T_b38	AURKAIP1	-2.688	0.00811	-0.058638	4	0.021817	no	BRNCTXB
chr1_599165_G_A_b38	AURKAIP1	-2.635	0.0094	-0.059559	6	0.022601	no	BRNCTXB
chr1_1424819_C_T_b38	AURKAIP1	-4.275	3.78e-05	-0.211861	3	0.049563	yes	BRNHPP
chr1_1020847_C_CGGG_b38	AURKAIP1	-3.785	0.000238	-0.092226	22	0.024365	yes	BRNHPP
chr1_1485282_A_G_b38	AURKAIP1	-3.349	0.00107	-0.19531	3	0.058312	yes	BRNHPP
chr1_660993_T_C_b38	AURKAIP1	-3.265	0.00141	-0.17551	3	0.053751	yes	BRNHPP
chr1_1477677_TTTTTA_T_b38	AURKAIP1	-3.084	0.00252	-0.184703	4	0.059898	yes	BRNHPP
chr1_1477850_C_G_b38	AURKAIP1	-2.979	0.00348	-0.16278	3	0.05465	yes	BRNHPP
chr1_1477855_G_C_b38	AURKAIP1	-2.979	0.00348	-0.16278	3	0.05465	yes	BRNHPP
chr1_1501260_A_AT_b38	AURKAIP1	-2.953	0.00377	-0.089617	7	0.03035	yes	BRNHPP
chr1_1810535_CA_C_b38	AURKAIP1	-2.937	0.00396	-0.089896	10	0.030612	yes	BRNHPP
chr1_993602_G_GC_b38	AURKAIP1	2.916	0.00421	0.137515	3	0.047157	yes	BRNHPP
chr1_960891_C_T_b38	AURKAIP1	-2.734	0.00717	-0.064661	31	0.023648	yes	BRNHPP
chr1_1419135_C_G_b38	AURKAIP1	-2.695	0.00802	-0.109138	10	0.040502	yes	BRNHPP
chr1_1067552_C_G_b38	AURKAIP1	-2.682	0.00831	-0.064634	13	0.024097	yes	BRNHPP
chr1_978953_C_G_b38	AURKAIP1	-2.673	0.00854	-0.06057	29	0.022664	yes	BRNHPP
chr1_1486354_G_C_b38	AURKAIP1	-2.64	0.00936	-0.148498	3	0.056254	yes	BRNHPP
chr1_1203533_T_C_b38	AURKAIP1	-2.632	0.00958	-0.109014	7	0.041424	yes	BRNHPP
chr1_1203822_T_C_b38	AURKAIP1	-2.632	0.00958	-0.109014	7	0.041424	yes	BRNHPP
chr1_981454_G_A_b38	AURKAIP1	-2.625	0.00977	-0.061186	30	0.023313	yes	BRNHPP
chr1_983193_A_G_b38	AURKAIP1	-2.625	0.00977	-0.061186	30	0.023313	yes	BRNHPP
chr1_1479334_A_G_b38	AURKAIP1	-2.623	0.00981	-0.114886	10	0.043797	yes	BRNHPP
chr1_945259_TC_T_b38	AURKAIP1	2.619	0.00993	0.068053	8	0.025989	yes	BRNHPP
chr1_1500729_G_A_b38	AURKAIP1	-4.243	4.27e-05	-0.176764	10	0.041656	no	BRNHPP
chr1_1527386_C_T_b38	AURKAIP1	-4.016	0.000102	-0.174285	7	0.043397	no	BRNHPP
chr1_1523187_A_G_b38	AURKAIP1	-3.644	0.000393	-0.158672	9	0.043541	no	BRNHPP
chr1_1020681_A_AG_b38	AURKAIP1	3.528	0.000589	0.087008	14	0.024665	no	BRNHPP
chr1_1020697_C_T_b38	AURKAIP1	3.528	0.000589	0.087008	14	0.024665	no	BRNHPP
chr1_1022518_G_T_b38	AURKAIP1	3.482	0.000687	0.082302	18	0.023634	no	BRNHPP
chr1_1020217_G_T_b38	AURKAIP1	3.444	0.000782	0.083504	16	0.024246	no	BRNHPP
chr1_1936217_C_CA_b38	AURKAIP1	-3.397	0.000915	-0.153799	6	0.045272	no	BRNHPP
chr1_1018652_C_G_b38	AURKAIP1	3.356	0.00105	0.081559	16	0.024305	no	BRNHPP
chr1_1018754_G_A_b38	AURKAIP1	3.356	0.00105	0.081559	16	0.024305	no	BRNHPP
chr1_1461760_C_A_b38	AURKAIP1	-3.335	0.00112	-0.171607	4	0.051452	no	BRNHPP
chr1_1461767_A_G_b38	AURKAIP1	-3.335	0.00112	-0.171607	4	0.051452	no	BRNHPP
chr1_1021740_G_C_b38	AURKAIP1	3.285	0.00133	0.079514	16	0.024208	no	BRNHPP
chr1_1008307_G_C_b38	AURKAIP1	3.226	0.0016	0.076767	21	0.023795	no	BRNHPP
chr1_1009184_T_C_b38	AURKAIP1	3.226	0.0016	0.076767	21	0.023795	no	BRNHPP
chr1_1017114_A_AT_b38	AURKAIP1	3.218	0.00165	0.07759	18	0.024115	no	BRNHPP
chr1_1359138_C_T_b38	AURKAIP1	3.186	0.00183	0.129836	8	0.040752	no	BRNHPP
chr1_1357046_C_G_b38	AURKAIP1	3.182	0.00185	0.13168	7	0.041378	no	BRNHPP
chr1_1357369_C_T_b38	AURKAIP1	3.182	0.00185	0.13168	7	0.041378	no	BRNHPP
chr1_1359943_G_A_b38	AURKAIP1	3.182	0.00185	0.13168	7	0.041378	no	BRNHPP
chr1_1360023_T_C_b38	AURKAIP1	3.182	0.00185	0.13168	7	0.041378	no	BRNHPP
chr1_1016623_G_A_b38	AURKAIP1	3.145	0.00208	0.074515	20	0.023696	no	BRNHPP
chr1_1016184_A_G_b38	AURKAIP1	3.139	0.00212	0.072328	22	0.023041	no	BRNHPP
chr1_1019479_TG_T_b38	AURKAIP1	-3.128	0.00219	-0.068248	35	0.021819	no	BRNHPP
chr1_1015925_A_ATT_b38	AURKAIP1	3.043	0.00286	0.073916	17	0.024293	no	BRNHPP
chr1_1127258_C_A_b38	AURKAIP1	-3.037	0.00291	-0.06941	28	0.022854	no	BRNHPP
chr1_1534915_T_C_b38	AURKAIP1	-2.978	0.00349	-0.165062	8	0.055419	no	BRNHPP
chr1_1014228_G_A_b38	AURKAIP1	2.968	0.0036	0.06962	23	0.023456	no	BRNHPP
chr1_1079456_A_G_b38	AURKAIP1	-2.957	0.00372	-0.061739	45	0.020879	no	BRNHPP
chr1_1022868_A_G_b38	AURKAIP1	2.952	0.00377	0.069229	20	0.023449	no	BRNHPP
chr1_978509_G_A_b38	AURKAIP1	-2.935	0.00398	-0.065997	32	0.022488	no	BRNHPP
chr1_1526169_C_T_b38	AURKAIP1	-2.919	0.00417	-0.122073	7	0.041817	no	BRNHPP
chr1_1021472_C_T_b38	AURKAIP1	-2.907	0.00433	-0.065249	34	0.022447	no	BRNHPP
chr1_1005429_C_CA_b38	AURKAIP1	2.887	0.00459	0.067764	21	0.023472	no	BRNHPP
chr1_1005904_C_T_b38	AURKAIP1	2.887	0.00459	0.067764	21	0.023472	no	BRNHPP
chr1_1005954_G_A_b38	AURKAIP1	2.887	0.00459	0.067764	21	0.023472	no	BRNHPP
chr1_1023525_A_G_b38	AURKAIP1	2.854	0.00506	0.06922	18	0.024251	no	BRNHPP
chr1_1358907_C_A_b38	AURKAIP1	2.837	0.00532	0.118257	7	0.041681	no	BRNHPP
chr1_2263866_C_CA_b38	AURKAIP1	-2.818	0.00563	-0.083819	5	0.029744	no	BRNHPP
chr1_1015915_C_T_b38	AURKAIP1	-2.818	0.00563	-0.065729	33	0.023328	no	BRNHPP
chr1_1014863_A_C_b38	AURKAIP1	2.808	0.0058	0.066854	20	0.02381	no	BRNHPP
chr1_1027226_G_A_b38	AURKAIP1	-2.795	0.00602	-0.063071	38	0.022568	no	BRNHPP
chr1_1023789_G_C_b38	AURKAIP1	-2.795	0.00602	-0.063421	36	0.022694	no	BRNHPP
chr1_1023573_A_G_b38	AURKAIP1	2.777	0.00634	0.067113	19	0.02417	no	BRNHPP
chr1_1415976_G_A_b38	AURKAIP1	-2.77	0.00648	-0.110045	7	0.039734	no	BRNHPP
chr1_1494105_G_A_b38	AURKAIP1	-2.765	0.00656	-0.149394	3	0.054032	no	BRNHPP
chr1_1495205_G_A_b38	AURKAIP1	-2.765	0.00656	-0.149394	3	0.054032	no	BRNHPP
chr1_1495221_G_A_b38	AURKAIP1	-2.765	0.00656	-0.149394	3	0.054032	no	BRNHPP
chr1_1495222_T_G_b38	AURKAIP1	-2.765	0.00656	-0.149394	3	0.054032	no	BRNHPP
chr1_1495236_T_C_b38	AURKAIP1	-2.765	0.00656	-0.149394	3	0.054032	no	BRNHPP
chr1_1495327_C_T_b38	AURKAIP1	-2.765	0.00656	-0.149394	3	0.054032	no	BRNHPP
chr1_979472_G_C_b38	AURKAIP1	-2.756	0.00674	-0.06254	33	0.022693	no	BRNHPP
chr1_1023775_G_A_b38	AURKAIP1	-2.74	0.00705	-0.061346	42	0.02239	no	BRNHPP
chr1_1410877_A_G_b38	AURKAIP1	-2.734	0.00716	-0.109331	8	0.039982	no	BRNHPP
chr1_791544_TGAATG_T_b38	AURKAIP1	-2.732	0.00721	-0.080845	5	0.029588	no	BRNHPP
chr1_983004_G_T_b38	AURKAIP1	-2.732	0.00722	-0.063757	34	0.02334	no	BRNHPP
chr1_1079484_T_A_b38	AURKAIP1	-2.726	0.00733	-0.0583	36	0.021384	no	BRNHPP
chr1_1023351_A_G_b38	AURKAIP1	2.72	0.00747	0.064885	19	0.023855	no	BRNHPP
chr1_1027511_C_T_b38	AURKAIP1	-2.717	0.00752	-0.062018	36	0.022823	no	BRNHPP
chr1_996254_A_AGGGAGGGCAG_b38	AURKAIP1	2.714	0.0076	0.079813	5	0.029409	no	BRNHPP
chr1_1015297_T_C_b38	AURKAIP1	-2.713	0.00762	-0.063655	32	0.023465	no	BRNHPP
chr1_1318756_G_A_b38	AURKAIP1	2.703	0.00783	0.112839	7	0.041743	no	BRNHPP
chr1_1319063_G_A_b38	AURKAIP1	2.703	0.00783	0.112839	7	0.041743	no	BRNHPP
chr1_1319461_C_G_b38	AURKAIP1	2.703	0.00783	0.112839	7	0.041743	no	BRNHPP
chr1_1320023_TG_T_b38	AURKAIP1	2.703	0.00783	0.112839	7	0.041743	no	BRNHPP
chr1_1322866_A_C_b38	AURKAIP1	2.703	0.00783	0.112839	7	0.041743	no	BRNHPP
chr1_1327211_C_T_b38	AURKAIP1	2.703	0.00783	0.112839	7	0.041743	no	BRNHPP
chr1_1330080_T_C_b38	AURKAIP1	2.703	0.00783	0.112839	7	0.041743	no	BRNHPP
chr1_1410616_G_T_b38	AURKAIP1	-2.687	0.0082	-0.103894	7	0.038663	no	BRNHPP
chr1_1412488_C_CAG_b38	AURKAIP1	-2.687	0.0082	-0.103894	7	0.038663	no	BRNHPP
chr1_979560_T_C_b38	AURKAIP1	-2.68	0.00836	-0.062893	33	0.023465	no	BRNHPP
chr1_1014733_GAAGT_G_b38	AURKAIP1	-2.667	0.00866	-0.063148	32	0.023673	no	BRNHPP
chr1_1083800_T_C_b38	AURKAIP1	-2.662	0.00879	-0.056945	32	0.02139	no	BRNHPP
chr1_2022166_C_T_b38	AURKAIP1	2.661	0.00882	0.194121	3	0.07295	no	BRNHPP
chr1_1411929_G_C_b38	AURKAIP1	-2.641	0.00933	-0.098838	7	0.037423	no	BRNHPP
chr1_1327982_G_A_b38	AURKAIP1	2.637	0.00944	0.110571	8	0.041936	no	BRNHPP
chr1_1004625_A_G_b38	AURKAIP1	2.628	0.00968	0.062685	23	0.023856	no	BRNHPP
chr1_1296939_G_A_b38	AURKAIP1	-2.626	0.00972	-0.114533	6	0.04361	no	BRNHPP
chr1_1063661_ATG_A_b38	AURKAIP1	-2.623	0.0098	-0.057135	36	0.02178	no	BRNHPP
chr1_988731_T_A_b38	AURKAIP1	2.622	0.00983	0.07141	8	0.027232	no	BRNHPP
chr1_1675132_A_G_b38	AURKAIP1	-3.42	0.000838	-0.081015	22	0.023686	yes	BRNHPT
chr1_1675228_C_CG_b38	AURKAIP1	-2.964	0.00362	-0.068535	27	0.023125	yes	BRNHPT
chr1_1677707_C_T_b38	AURKAIP1	2.956	0.0037	0.085758	4	0.029009	yes	BRNHPT
chr1_1672155_G_A_b38	AURKAIP1	2.94	0.00389	0.070481	17	0.023975	yes	BRNHPT
chr1_1661169_C_A_b38	AURKAIP1	-2.867	0.00484	-0.069686	12	0.024303	yes	BRNHPT
chr1_1653319_A_G_b38	AURKAIP1	-2.85	0.00509	-0.069186	12	0.024276	yes	BRNHPT
chr1_1960886_T_C_b38	AURKAIP1	-2.694	0.00799	-0.074363	4	0.027599	yes	BRNHPT
chr1_1169858_T_C_b38	AURKAIP1	3.112	0.00229	0.065864	22	0.021165	no	BRNHPT
chr1_1671724_C_T_b38	AURKAIP1	3.033	0.00293	0.072353	14	0.023858	no	BRNHPT
chr1_971790_AG_A_b38	AURKAIP1	-2.933	0.00397	-0.061457	23	0.020952	no	BRNHPT
chr1_981282_A_C_b38	AURKAIP1	-2.759	0.00665	-0.080429	4	0.029155	no	BRNHPT
chr1_976536_C_T_b38	AURKAIP1	-2.706	0.00772	-0.078827	4	0.029126	no	BRNHPT
chr1_978230_G_A_b38	AURKAIP1	-2.706	0.00772	-0.078827	4	0.029126	no	BRNHPT
chr1_1574032_AAAG_A_b38	AURKAIP1	3.144	0.00198	0.059396	15	0.018891	yes	BRNNCC
chr1_1481085_C_G_b38	AURKAIP1	3.033	0.00282	0.100686	4	0.033198	yes	BRNNCC
chr1_1567912_C_CAAAAAAA_b38	AURKAIP1	2.781	0.00607	0.06583	6	0.023673	yes	BRNNCC
chr1_921056_TG_T_b38	AURKAIP1	2.698	0.00773	0.057403	4	0.021279	yes	BRNNCC
chr1_1955424_T_C_b38	AURKAIP1	-2.687	0.00797	-0.129158	4	0.048072	yes	BRNNCC
chr1_1373006_G_A_b38	AURKAIP1	2.611	0.00989	0.056565	3	0.021667	yes	BRNNCC
chr1_1373007_G_A_b38	AURKAIP1	2.611	0.00989	0.056565	3	0.021667	yes	BRNNCC
chr1_1571434_C_CA_b38	AURKAIP1	3.564	0.000481	0.063068	16	0.017697	no	BRNNCC
chr1_1679100_A_G_b38	AURKAIP1	3.268	0.00133	0.049345	40	0.0151	no	BRNNCC
chr1_1573776_A_G_b38	AURKAIP1	3.187	0.00173	0.0569	11	0.017854	no	BRNNCC
chr1_1577491_A_AC_b38	AURKAIP1	3.078	0.00245	0.050516	33	0.016412	no	BRNNCC
chr1_1579717_T_A_b38	AURKAIP1	3.065	0.00255	0.052362	13	0.017085	no	BRNNCC
chr1_1580890_C_T_b38	AURKAIP1	2.948	0.00368	0.052844	11	0.017927	no	BRNNCC
chr1_907538_T_TA_b38	AURKAIP1	2.883	0.00448	0.051176	12	0.017753	no	BRNNCC
chr1_1574445_A_G_b38	AURKAIP1	2.805	0.00566	0.046414	32	0.016549	no	BRNNCC
chr1_1573654_T_C_b38	AURKAIP1	2.772	0.00623	0.045326	32	0.016351	no	BRNNCC
chr1_1570568_AC_A_b38	AURKAIP1	2.67	0.00835	0.047254	13	0.017695	no	BRNNCC
chr1_1575724_G_C_b38	AURKAIP1	2.652	0.0088	0.043217	31	0.016295	no	BRNNCC
chr1_906982_C_T_b38	AURKAIP1	3.933	0.000136	0.070207	7	0.017849	yes	BRNPTM
chr1_925308_G_A_b38	AURKAIP1	-3.59	0.000469	-0.065944	10	0.018371	yes	BRNPTM
chr1_923421_A_G_b38	AURKAIP1	-3.52	0.000596	-0.066857	8	0.018992	yes	BRNPTM
chr1_923311_TG_T_b38	AURKAIP1	-3.384	0.000947	-0.064969	8	0.0192	yes	BRNPTM
chr1_925036_G_A_b38	AURKAIP1	-3.384	0.000947	-0.064969	8	0.0192	yes	BRNPTM
chr1_926250_G_A_b38	AURKAIP1	-3.384	0.000947	-0.064969	8	0.0192	yes	BRNPTM
chr1_927486_C_T_b38	AURKAIP1	-3.248	0.00148	-0.062623	8	0.019279	yes	BRNPTM
chr1_907236_TA_T_b38	AURKAIP1	3.183	0.00183	0.058541	7	0.01839	yes	BRNPTM
chr1_922660_C_A_b38	AURKAIP1	3.141	0.00209	0.064913	3	0.020667	yes	BRNPTM
chr1_922671_C_T_b38	AURKAIP1	3.141	0.00209	0.064913	3	0.020667	yes	BRNPTM
chr1_928622_G_C_b38	AURKAIP1	3.08	0.00253	0.061512	4	0.019971	yes	BRNPTM
chr1_907835_C_CCTGCCCGGTCCTTCTGACCAGCCGAGAGAGTA_b38	AURKAIP1	3.069	0.00262	0.048234	19	0.015716	yes	BRNPTM
chr1_914483_G_GACTGCCCAGCTC_b38	AURKAIP1	3.028	0.00297	0.060544	6	0.019993	yes	BRNPTM
chr1_890030_G_A_b38	AURKAIP1	-2.864	0.00488	-0.047821	16	0.016695	yes	BRNPTM
chr1_1020847_C_CGG_b38	AURKAIP1	2.829	0.00541	0.046055	28	0.016277	yes	BRNPTM
chr1_918870_A_G_b38	AURKAIP1	2.812	0.00569	0.053898	6	0.019167	yes	BRNPTM
chr1_932255_C_T_b38	AURKAIP1	2.801	0.00588	0.055524	5	0.019822	yes	BRNPTM
chr1_931558_G_A_b38	AURKAIP1	2.795	0.00599	0.054426	5	0.019476	yes	BRNPTM
chr1_1818305_T_TA_b38	AURKAIP1	2.779	0.00626	0.048447	17	0.017431	yes	BRNPTM
chr1_1212042_C_T_b38	AURKAIP1	-2.748	0.00686	-0.054514	5	0.019841	yes	BRNPTM
chr1_1462302_A_G_b38	AURKAIP1	-2.731	0.0072	-0.070414	4	0.025785	yes	BRNPTM
chr1_911484_G_C_b38	AURKAIP1	2.725	0.00733	0.053218	8	0.019532	yes	BRNPTM
chr1_929839_G_A_b38	AURKAIP1	2.698	0.00791	0.053378	5	0.019784	yes	BRNPTM
chr1_915824_G_C_b38	AURKAIP1	2.68	0.00831	0.05087	8	0.018979	yes	BRNPTM
chr1_921056_TG_T_b38	AURKAIP1	2.679	0.00834	0.055123	4	0.020574	yes	BRNPTM
chr1_910255_C_T_b38	AURKAIP1	2.65	0.00905	0.053519	5	0.020195	yes	BRNPTM
chr1_910698_C_T_b38	AURKAIP1	2.641	0.0093	0.053724	5	0.020346	yes	BRNPTM
chr1_900119_A_G_b38	AURKAIP1	2.622	0.00979	0.049261	8	0.018786	yes	BRNPTM
chr1_913274_TG_T_b38	AURKAIP1	2.618	0.0099	0.05184	5	0.019802	yes	BRNPTM
chr1_917859_A_G_b38	AURKAIP1	2.618	0.0099	0.05184	5	0.019802	yes	BRNPTM
chr1_905705_C_G_b38	AURKAIP1	3.692	0.000327	0.069221	7	0.018746	no	BRNPTM
chr1_906633_T_G_b38	AURKAIP1	3.611	0.000435	0.070505	4	0.019523	no	BRNPTM
chr1_903007_T_C_b38	AURKAIP1	3.593	0.000463	0.070872	4	0.019724	no	BRNPTM
chr1_903175_C_A_b38	AURKAIP1	3.561	0.000518	0.069091	6	0.019402	no	BRNPTM
chr1_899548_A_G_b38	AURKAIP1	3.416	0.000851	0.067319	4	0.019708	no	BRNPTM
chr1_899619_G_A_b38	AURKAIP1	3.416	0.000851	0.067319	4	0.019708	no	BRNPTM
chr1_901149_C_G_b38	AURKAIP1	3.409	0.000869	0.067627	4	0.019835	no	BRNPTM
chr1_901544_G_A_b38	AURKAIP1	3.409	0.000869	0.067627	4	0.019835	no	BRNPTM
chr1_902949_G_GC_b38	AURKAIP1	3.368	0.001	0.066415	4	0.019722	no	BRNPTM
chr1_904947_G_A_b38	AURKAIP1	3.254	0.00145	0.064744	4	0.019899	no	BRNPTM
chr1_903723_A_G_b38	AURKAIP1	3.155	0.002	0.059096	8	0.018733	no	BRNPTM
chr1_907538_T_TA_b38	AURKAIP1	3.145	0.00206	0.055828	11	0.017752	no	BRNPTM
chr1_2340564_G_A_b38	AURKAIP1	3.145	0.00206	0.054958	10	0.017477	no	BRNPTM
chr1_898818_T_C_b38	AURKAIP1	3.123	0.00221	0.061837	5	0.019799	no	BRNPTM
chr1_906677_A_AAACTCAGCTGCCTCTCCCCTTC_b38	AURKAIP1	3.116	0.00226	0.057463	10	0.018444	no	BRNPTM
chr1_899452_G_C_b38	AURKAIP1	3.09	0.00245	0.058439	7	0.01891	no	BRNPTM
chr1_901516_T_C_b38	AURKAIP1	3.036	0.0029	0.056455	9	0.018592	no	BRNPTM
chr1_898261_T_C_b38	AURKAIP1	2.995	0.0033	0.055723	8	0.018608	no	BRNPTM
chr1_898279_T_A_b38	AURKAIP1	2.995	0.0033	0.055723	8	0.018608	no	BRNPTM
chr1_898283_A_G_b38	AURKAIP1	2.995	0.0033	0.055723	8	0.018608	no	BRNPTM
chr1_898547_T_C_b38	AURKAIP1	2.987	0.00338	0.058989	5	0.01975	no	BRNPTM
chr1_2340807_G_A_b38	AURKAIP1	2.908	0.00429	0.052918	9	0.018199	no	BRNPTM
chr1_892786_A_G_b38	AURKAIP1	2.832	0.00537	0.049771	11	0.017574	no	BRNPTM
chr1_911848_C_T_b38	AURKAIP1	2.796	0.00597	0.05483	6	0.019614	no	BRNPTM
chr1_899024_C_CT_b38	AURKAIP1	2.778	0.00628	0.053755	8	0.019347	no	BRNPTM
chr1_897843_C_T_b38	AURKAIP1	2.751	0.00679	0.051586	8	0.018749	no	BRNPTM
chr1_897922_C_T_b38	AURKAIP1	2.751	0.00679	0.051586	8	0.018749	no	BRNPTM
chr1_898444_T_C_b38	AURKAIP1	2.751	0.00679	0.051586	8	0.018749	no	BRNPTM
chr1_1809189_AT_A_b38	AURKAIP1	2.699	0.00788	0.057187	22	0.021186	no	BRNPTM
chr1_912111_G_A_b38	AURKAIP1	2.684	0.00823	0.051352	7	0.019132	no	BRNPTM
chr1_913065_G_A_b38	AURKAIP1	2.684	0.00823	0.051352	7	0.019132	no	BRNPTM
chr1_913076_A_G_b38	AURKAIP1	2.684	0.00823	0.051352	7	0.019132	no	BRNPTM
chr1_914948_CA_C_b38	AURKAIP1	2.64	0.00932	0.059196	4	0.022425	no	BRNPTM
chr1_2371032_C_T_b38	AURKAIP1	2.634	0.00948	0.038265	41	0.014529	no	BRNPTM
chr1_909903_G_T_b38	AURKAIP1	2.62	0.00985	0.057277	3	0.021864	no	BRNPTM
chr1_911220_CT_C_b38	AURKAIP1	2.62	0.00985	0.057277	3	0.021864	no	BRNPTM
chr1_517599_A_AAC_b38	AURKAIP1	-2.916	0.00437	-0.103862	8	0.035616	yes	BRNSPC
chr1_2372127_A_G_b38	AURKAIP1	-2.802	0.0061	-0.118098	3	0.042149	yes	BRNSPC
chr1_1171093_G_A_b38	AURKAIP1	-2.697	0.0082	-0.095989	14	0.035585	yes	BRNSPC
chr1_414673_C_A_b38	AURKAIP1	-2.689	0.00839	-0.105553	5	0.039247	yes	BRNSPC
chr1_2189294_T_TG_b38	AURKAIP1	-3.433	0.000869	-0.113231	11	0.032982	no	BRNSPC
chr1_2137585_GCCT_G_b38	AURKAIP1	-3.202	0.00183	-0.095158	15	0.029719	no	BRNSPC
chr1_414665_C_T_b38	AURKAIP1	-3.152	0.00214	-0.126411	5	0.040108	no	BRNSPC
chr1_2173095_TCCAC_T_b38	AURKAIP1	-3.075	0.00271	-0.095537	14	0.031068	no	BRNSPC
chr1_2179409_T_G_b38	AURKAIP1	-3.075	0.00271	-0.095537	14	0.031068	no	BRNSPC
chr1_2134596_A_AAT_b38	AURKAIP1	-2.795	0.00622	-0.086766	14	0.031042	no	BRNSPC
chr1_2128619_C_T_b38	AURKAIP1	-2.72	0.00771	-0.085198	14	0.031328	no	BRNSPC
chr1_2132033_G_C_b38	AURKAIP1	-2.717	0.00777	-0.086325	13	0.031773	no	BRNSPC
chr1_2119789_C_CT_b38	AURKAIP1	2.662	0.00906	0.097239	8	0.036531	no	BRNSPC
chr1_2350287_A_C_b38	AURKAIP1	-3.071	0.00284	-0.088568	5	0.028838	yes	BRNSNG
chr1_2345148_G_A_b38	AURKAIP1	-2.87	0.00515	-0.09205	4	0.032078	yes	BRNSNG
chr1_2363826_A_AT_b38	AURKAIP1	-2.866	0.0052	-0.10547	4	0.0368	yes	BRNSNG
chr1_1370553_CAAA_C_b38	AURKAIP1	2.762	0.00699	0.090227	4	0.032666	yes	BRNSNG
chr1_1882426_CAAAAA_C_b38	AURKAIP1	2.661	0.00926	0.087031	5	0.032707	yes	BRNSNG
chr1_1477677_TTTTTA_T_b38	AURKAIP1	-2.66	0.00929	-0.159821	3	0.060086	yes	BRNSNG
chr1_1816644_CT_C_b38	AURKAIP1	3.673	0.000411	0.099682	17	0.027139	no	BRNSNG
chr1_2363827_A_T_b38	AURKAIP1	-3.302	0.00139	-0.109265	6	0.033089	no	BRNSNG
chr1_1041776_CCGGCCAGTGCCAGGGTCGAGGTGGGCGGCTCCCCCGGGGGAGGGCTG_C_b38	AURKAIP1	3.064	0.0029	0.060059	10	0.019599	no	BRNSNG
chr1_1897190_CT_C_b38	AURKAIP1	3.017	0.00333	0.089158	3	0.029548	no	BRNSNG
chr1_1567912_C_CAAAAAAAA_b38	AURKAIP1	-2.947	0.00411	-0.108835	4	0.036937	no	BRNSNG
chr1_2011271_G_GTT_b38	AURKAIP1	2.838	0.00564	0.076164	7	0.026841	no	BRNSNG
chr1_1329973_GCGTGTGCCATGCA_G_b38	AURKAIP1	2.694	0.00846	0.080736	4	0.029972	no	BRNSNG
chr1_1303112_G_A_b38	AURKAIP1	2.676	0.00889	0.08233	4	0.030769	no	BRNSNG
chr1_1303800_G_A_b38	AURKAIP1	2.676	0.00889	0.08233	4	0.030769	no	BRNSNG
chr1_1304555_A_C_b38	AURKAIP1	2.676	0.00889	0.08233	4	0.030769	no	BRNSNG
chr1_1325753_G_T_b38	AURKAIP1	2.653	0.00946	0.085146	3	0.032093	no	BRNSNG
chr1_1839692_C_CA_b38	AURKAIP1	-3.973	8.75e-05	-0.05471	3	0.013771	yes	BREAST
chr1_1644361_C_T_b38	AURKAIP1	-3.433	0.000675	-0.038118	3	0.011104	yes	BREAST
chr1_1993969_A_G_b38	AURKAIP1	-3.421	0.000704	-0.042912	5	0.012545	yes	BREAST
chr1_1681370_T_G_b38	AURKAIP1	-3.368	0.000847	-0.038324	11	0.011378	yes	BREAST
chr1_1663038_T_C_b38	AURKAIP1	-3.265	0.00121	-0.027822	64	0.008522	yes	BREAST
chr1_1681928_C_A_b38	AURKAIP1	-3.264	0.00121	-0.028404	61	0.008701	yes	BREAST
chr1_1687236_T_G_b38	AURKAIP1	-3.136	0.00187	-0.026954	62	0.008595	yes	BREAST
chr1_1901149_A_AAAGAAAGG_b38	AURKAIP1	-3.102	0.00209	-0.0263	56	0.008477	yes	BREAST
chr1_1686147_T_G_b38	AURKAIP1	-3.099	0.00211	-0.026882	62	0.008674	yes	BREAST
chr1_1684817_G_C_b38	AURKAIP1	-3.081	0.00224	-0.02711	58	0.008799	yes	BREAST
chr1_1689421_G_A_b38	AURKAIP1	-3.062	0.00238	-0.02582	62	0.008433	yes	BREAST
chr1_1664417_G_A_b38	AURKAIP1	3.021	0.00272	0.028336	27	0.009381	yes	BREAST
chr1_1897682_C_CA_b38	AURKAIP1	-2.99	0.00301	-0.038985	4	0.01304	yes	BREAST
chr1_506851_G_T_b38	AURKAIP1	-2.913	0.00383	-0.03906	7	0.013408	yes	BREAST
chr1_1729373_A_G_b38	AURKAIP1	-2.883	0.0042	-0.026723	36	0.00927	yes	BREAST
chr1_866675_C_T_b38	AURKAIP1	2.805	0.00533	0.044479	9	0.015854	yes	BREAST
chr1_1689465_A_G_b38	AURKAIP1	-2.805	0.00533	-0.022561	75	0.008043	yes	BREAST
chr1_1687734_CAA_C_b38	AURKAIP1	-2.719	0.0069	-0.0247	47	0.009085	yes	BREAST
chr1_1728948_T_C_b38	AURKAIP1	-2.707	0.00715	-0.024783	37	0.009155	yes	BREAST
chr1_1602507_C_A_b38	AURKAIP1	-2.687	0.00758	-0.024731	32	0.009204	yes	BREAST
chr1_1602666_G_A_b38	AURKAIP1	-2.687	0.00758	-0.024731	32	0.009204	yes	BREAST
chr1_2363805_C_CAAACAA_b38	AURKAIP1	-2.662	0.00815	-0.024934	28	0.009366	yes	BREAST
chr1_1738309_A_G_b38	AURKAIP1	-2.659	0.00823	-0.02204	66	0.008289	yes	BREAST
chr1_1587082_G_A_b38	AURKAIP1	-2.657	0.00827	-0.033438	6	0.012585	yes	BREAST
chr1_1737703_A_C_b38	AURKAIP1	-2.642	0.00864	-0.021659	67	0.008198	yes	BREAST
chr1_1691377_C_T_b38	AURKAIP1	2.631	0.00891	0.023735	47	0.00902	yes	BREAST
chr1_1717376_CTAACACCCG_C_b38	AURKAIP1	-2.626	0.00904	-0.021978	65	0.008368	yes	BREAST
chr1_1729539_C_A_b38	AURKAIP1	-2.609	0.00951	-0.024341	37	0.009331	yes	BREAST
chr1_1694167_G_A_b38	AURKAIP1	2.606	0.00957	0.021045	76	0.008075	yes	BREAST
chr1_1760401_G_A_b38	AURKAIP1	-4.329	2e-05	-0.058013	4	0.013402	no	BREAST
chr1_1761550_G_A_b38	AURKAIP1	-4.245	2.86e-05	-0.059146	3	0.013934	no	BREAST
chr1_1780989_A_C_b38	AURKAIP1	-4.222	3.15e-05	-0.058354	3	0.013822	no	BREAST
chr1_1806456_G_A_b38	AURKAIP1	-4.222	3.15e-05	-0.058354	3	0.013822	no	BREAST
chr1_1806461_C_T_b38	AURKAIP1	-4.222	3.15e-05	-0.058354	3	0.013822	no	BREAST
chr1_1847293_A_ACAACAAAATCCCTTTTT_b38	AURKAIP1	-4.222	3.15e-05	-0.058354	3	0.013822	no	BREAST
chr1_1856365_C_G_b38	AURKAIP1	-4.222	3.15e-05	-0.058354	3	0.013822	no	BREAST
chr1_1891375_G_A_b38	AURKAIP1	-4.222	3.15e-05	-0.058354	3	0.013822	no	BREAST
chr1_1662933_T_A_b38	AURKAIP1	-3.478	0.000574	-0.030435	36	0.00875	no	BREAST
chr1_1687153_A_G_b38	AURKAIP1	-3.215	0.00144	-0.026848	72	0.008351	no	BREAST
chr1_1687643_G_A_b38	AURKAIP1	-3.208	0.00147	-0.026758	70	0.008341	no	BREAST
chr1_1687061_C_T_b38	AURKAIP1	-3.17	0.00167	-0.026323	68	0.008304	no	BREAST
chr1_1743565_ATAT_A_b38	AURKAIP1	-3.167	0.00169	-0.025163	61	0.007946	no	BREAST
chr1_1684308_G_C_b38	AURKAIP1	-3.165	0.0017	-0.02651	67	0.008377	no	BREAST
chr1_1684619_G_A_b38	AURKAIP1	-3.165	0.0017	-0.02651	67	0.008377	no	BREAST
chr1_1686017_A_AT_b38	AURKAIP1	-3.157	0.00174	-0.02615	69	0.008282	no	BREAST
chr1_1684266_T_C_b38	AURKAIP1	-3.138	0.00185	-0.026047	69	0.0083	no	BREAST
chr1_1687159_G_T_b38	AURKAIP1	-3.093	0.00216	-0.025699	69	0.00831	no	BREAST
chr1_1681164_G_A_b38	AURKAIP1	-3.087	0.0022	-0.025512	70	0.008266	no	BREAST
chr1_1683909_A_C_b38	AURKAIP1	-3.05	0.00248	-0.025557	74	0.00838	no	BREAST
chr1_1689446_T_C_b38	AURKAIP1	-3.027	0.00267	-0.025605	62	0.008459	no	BREAST
chr1_1002192_A_AT_b38	AURKAIP1	2.997	0.00293	0.040664	4	0.013567	no	BREAST
chr1_866664_G_A_b38	AURKAIP1	2.964	0.00326	0.039016	16	0.013164	no	BREAST
chr1_1680214_T_C_b38	AURKAIP1	-2.955	0.00335	-0.02431	71	0.008226	no	BREAST
chr1_1664099_T_C_b38	AURKAIP1	-2.951	0.0034	-0.030732	17	0.010414	no	BREAST
chr1_1728965_A_G_b38	AURKAIP1	-2.912	0.00384	-0.026346	37	0.009047	no	BREAST
chr1_1679993_A_G_b38	AURKAIP1	-2.89	0.00412	-0.023336	88	0.008076	no	BREAST
chr1_1734812_G_A_b38	AURKAIP1	-2.846	0.0047	-0.029295	44	0.010292	no	BREAST
chr1_1901149_A_AAAGAAAGGAAGAAAGG_b38	AURKAIP1	2.787	0.00564	0.024538	85	0.008805	no	BREAST
chr1_1735008_G_GGTTT_b38	AURKAIP1	-2.76	0.0061	-0.023106	64	0.008371	no	BREAST
chr1_1680556_A_G_b38	AURKAIP1	-2.755	0.0062	-0.0229	71	0.008313	no	BREAST
chr1_1993851_G_A_b38	AURKAIP1	-2.741	0.00646	-0.037349	4	0.013625	no	BREAST
chr1_937404_C_A_b38	AURKAIP1	-2.74	0.00648	-0.051098	3	0.018647	no	BREAST
chr1_1690741_T_A_b38	AURKAIP1	2.737	0.00653	0.021754	53	0.007947	no	BREAST
chr1_1039411_T_TGGG_b38	AURKAIP1	2.735	0.00659	0.027121	24	0.009918	no	BREAST
chr1_1734263_T_C_b38	AURKAIP1	-2.665	0.00808	-0.022091	68	0.008289	no	BREAST
chr1_1009470_A_T_b38	AURKAIP1	2.662	0.00815	0.051193	3	0.019229	no	BREAST
chr1_1691417_T_C_b38	AURKAIP1	2.653	0.00838	0.023126	78	0.008718	no	BREAST
chr1_1688570_A_T_b38	AURKAIP1	-2.608	0.00953	-0.028884	17	0.011075	no	BREAST
chr1_1704180_T_C_b38	AURKAIP1	2.599	0.00978	0.021786	67	0.008383	no	BREAST
chr1_1374801_A_G_b38	AURKAIP1	-9.363	5.09e-19	-0.056717	9	0.006057	yes	CULTFB
chr1_1374694_C_G_b38	AURKAIP1	6.613	1.17e-10	0.042302	11	0.006397	yes	CULTFB
chr1_1375998_T_A_b38	AURKAIP1	6.273	8.97e-10	0.034518	19	0.005503	yes	CULTFB
chr1_1375288_A_C_b38	AURKAIP1	6.184	1.51e-09	0.034524	19	0.005583	yes	CULTFB
chr1_1375595_C_T_b38	AURKAIP1	6.184	1.51e-09	0.034524	19	0.005583	yes	CULTFB
chr1_1376092_G_A_b38	AURKAIP1	6.184	1.51e-09	0.034524	19	0.005583	yes	CULTFB
chr1_1376336_G_A_b38	AURKAIP1	6.184	1.51e-09	0.034524	19	0.005583	yes	CULTFB
chr1_1380790_G_A_b38	AURKAIP1	6.149	1.85e-09	0.035003	19	0.005693	yes	CULTFB
chr1_1381268_C_T_b38	AURKAIP1	6.059	3.09e-09	0.034299	19	0.005661	yes	CULTFB
chr1_1381294_C_T_b38	AURKAIP1	6.059	3.09e-09	0.034299	19	0.005661	yes	CULTFB
chr1_1379664_G_A_b38	AURKAIP1	6.05	3.26e-09	0.033879	19	0.0056	yes	CULTFB
chr1_1320653_C_T_b38	AURKAIP1	-6.024	3.77e-09	-0.059229	7	0.009832	yes	CULTFB
chr1_1306183_A_G_b38	AURKAIP1	-5.853	9.87e-09	-0.057429	7	0.009812	yes	CULTFB
chr1_1297051_CCA_C_b38	AURKAIP1	-5.613	3.65e-08	-0.055527	7	0.009892	yes	CULTFB
chr1_1345423_G_A_b38	AURKAIP1	-5.57	4.59e-08	-0.056689	6	0.010177	yes	CULTFB
chr1_1306584_G_A_b38	AURKAIP1	-5.482	7.33e-08	-0.046474	10	0.008477	yes	CULTFB
chr1_1366299_AGT_A_b38	AURKAIP1	-5.482	7.35e-08	-0.054895	7	0.010014	yes	CULTFB
chr1_1371538_C_T_b38	AURKAIP1	-5.474	7.66e-08	-0.052078	8	0.009514	yes	CULTFB
chr1_1323853_G_GA_b38	AURKAIP1	-5.455	8.48e-08	-0.059119	5	0.010838	yes	CULTFB
chr1_1302799_C_A_b38	AURKAIP1	-5.403	1.11e-07	-0.061642	4	0.011409	yes	CULTFB
chr1_1378109_C_T_b38	AURKAIP1	-5.34	1.54e-07	-0.054302	6	0.010169	yes	CULTFB
chr1_1312175_C_T_b38	AURKAIP1	-5.264	2.28e-07	-0.054802	6	0.010412	yes	CULTFB
chr1_1359138_C_T_b38	AURKAIP1	5.205	3.07e-07	0.030321	27	0.005825	yes	CULTFB
chr1_1296364_G_T_b38	AURKAIP1	-5.197	3.19e-07	-0.054164	6	0.010422	yes	CULTFB
chr1_1299211_G_A_b38	AURKAIP1	-5.197	3.19e-07	-0.054164	6	0.010422	yes	CULTFB
chr1_1305900_C_T_b38	AURKAIP1	-5.197	3.19e-07	-0.054164	6	0.010422	yes	CULTFB
chr1_1318689_A_C_b38	AURKAIP1	-5.197	3.19e-07	-0.054164	6	0.010422	yes	CULTFB
chr1_1320870_C_A_b38	AURKAIP1	-5.197	3.19e-07	-0.054164	6	0.010422	yes	CULTFB
chr1_1330068_G_A_b38	AURKAIP1	-5.197	3.19e-07	-0.054164	6	0.010422	yes	CULTFB
chr1_1334108_G_A_b38	AURKAIP1	-5.197	3.19e-07	-0.054164	6	0.010422	yes	CULTFB
chr1_1335515_G_A_b38	AURKAIP1	-5.197	3.19e-07	-0.054164	6	0.010422	yes	CULTFB
chr1_1342873_C_T_b38	AURKAIP1	-5.197	3.19e-07	-0.054164	6	0.010422	yes	CULTFB
chr1_1343373_C_T_b38	AURKAIP1	-5.197	3.19e-07	-0.054164	6	0.010422	yes	CULTFB
chr1_1352103_A_C_b38	AURKAIP1	-5.197	3.19e-07	-0.054164	6	0.010422	yes	CULTFB
chr1_1353044_C_T_b38	AURKAIP1	-5.197	3.19e-07	-0.054164	6	0.010422	yes	CULTFB
chr1_1356127_G_C_b38	AURKAIP1	-5.197	3.19e-07	-0.054164	6	0.010422	yes	CULTFB
chr1_1359713_GACCCCACCCC_G_b38	AURKAIP1	-5.197	3.19e-07	-0.054164	6	0.010422	yes	CULTFB
chr1_1395686_G_A_b38	AURKAIP1	-5.197	3.19e-07	-0.054164	6	0.010422	yes	CULTFB
chr1_1355212_CGGGAGCTG_C_b38	AURKAIP1	-5.146	4.12e-07	-0.056108	5	0.010902	yes	CULTFB
chr1_1341803_C_T_b38	AURKAIP1	-5.05	6.65e-07	-0.050986	7	0.010096	yes	CULTFB
chr1_1373582_C_T_b38	AURKAIP1	-5.05	6.65e-07	-0.050986	7	0.010096	yes	CULTFB
chr1_1356328_G_A_b38	AURKAIP1	-5	8.51e-07	-0.048889	8	0.009779	yes	CULTFB
chr1_1362515_C_G_b38	AURKAIP1	-5	8.51e-07	-0.048889	8	0.009779	yes	CULTFB
chr1_1296403_A_G_b38	AURKAIP1	-4.933	1.18e-06	-0.052248	6	0.010592	yes	CULTFB
chr1_1363584_G_A_b38	AURKAIP1	-4.927	1.21e-06	-0.047845	8	0.00971	yes	CULTFB
chr1_1366271_AGT_A_b38	AURKAIP1	-4.887	1.47e-06	-0.050028	6	0.010237	yes	CULTFB
chr1_1319750_G_A_b38	AURKAIP1	-4.838	1.86e-06	-0.045415	9	0.009388	yes	CULTFB
chr1_1370429_C_G_b38	AURKAIP1	-4.764	2.64e-06	-0.046159	8	0.009689	yes	CULTFB
chr1_1355028_A_G_b38	AURKAIP1	-4.693	3.67e-06	-0.047538	7	0.010129	yes	CULTFB
chr1_1355201_G_A_b38	AURKAIP1	-4.675	4e-06	-0.047357	7	0.010131	yes	CULTFB
chr1_1417340_A_G_b38	AURKAIP1	-4.59	5.88e-06	-0.057073	3	0.012433	yes	CULTFB
chr1_1410877_A_G_b38	AURKAIP1	-4.555	6.92e-06	-0.025927	33	0.005693	yes	CULTFB
chr1_1422081_C_T_b38	AURKAIP1	-4.263	2.5e-05	-0.024879	39	0.005836	yes	CULTFB
chr1_1419135_C_G_b38	AURKAIP1	-4.235	2.82e-05	-0.024653	37	0.005821	yes	CULTFB
chr1_1331945_G_GC_b38	AURKAIP1	-4.146	4.11e-05	-0.024236	14	0.005846	yes	CULTFB
chr1_1337736_A_G_b38	AURKAIP1	3.969	8.5e-05	0.022387	15	0.00564	yes	CULTFB
chr1_1329774_T_C_b38	AURKAIP1	3.945	9.38e-05	0.022542	15	0.005714	yes	CULTFB
chr1_1353091_C_T_b38	AURKAIP1	3.834	0.000146	0.022071	14	0.005757	yes	CULTFB
chr1_1353443_A_G_b38	AURKAIP1	3.764	0.000191	0.02175	14	0.005778	yes	CULTFB
chr1_1295039_T_C_b38	AURKAIP1	-3.678	0.000266	-0.022743	33	0.006183	yes	CULTFB
chr1_1298561_T_C_b38	AURKAIP1	-3.678	0.000266	-0.022743	33	0.006183	yes	CULTFB
chr1_1327586_C_T_b38	AURKAIP1	3.656	0.000289	0.020448	16	0.005593	yes	CULTFB
chr1_1219203_A_AC_b38	AURKAIP1	-3.651	0.000295	-0.025532	3	0.006993	yes	CULTFB
chr1_1340811_GCACACACCTGCA_G_b38	AURKAIP1	-3.597	0.000362	-0.032099	5	0.008925	yes	CULTFB
chr1_1374505_A_G_b38	AURKAIP1	3.578	0.000387	0.018699	8	0.005225	yes	CULTFB
chr1_1375642_C_T_b38	AURKAIP1	3.555	0.000422	0.018638	8	0.005243	yes	CULTFB
chr1_1327211_C_T_b38	AURKAIP1	3.521	0.000477	0.020878	23	0.005929	yes	CULTFB
chr1_1363153_T_G_b38	AURKAIP1	3.513	0.000492	0.020852	24	0.005936	yes	CULTFB
chr1_1368047_ACT_A_b38	AURKAIP1	3.5	0.000516	0.020587	23	0.005882	yes	CULTFB
chr1_1330080_T_C_b38	AURKAIP1	3.493	0.00053	0.020718	23	0.005932	yes	CULTFB
chr1_1411525_T_A_b38	AURKAIP1	-3.437	0.000647	-0.019254	23	0.005601	yes	CULTFB
chr1_1379091_T_G_b38	AURKAIP1	-3.426	0.000674	-0.017232	10	0.00503	yes	CULTFB
chr1_1490027_A_G_b38	AURKAIP1	-3.414	0.000704	-0.018457	35	0.005406	yes	CULTFB
chr1_1490032_A_G_b38	AURKAIP1	-3.414	0.000704	-0.018457	35	0.005406	yes	CULTFB
chr1_1307603_G_A_b38	AURKAIP1	3.352	0.000875	0.0198	35	0.005906	yes	CULTFB
chr1_1296939_G_A_b38	AURKAIP1	-3.308	0.00102	-0.020197	22	0.006105	yes	CULTFB
chr1_1358907_C_A_b38	AURKAIP1	3.308	0.00102	0.019847	24	0.006	yes	CULTFB
chr1_1307327_A_G_b38	AURKAIP1	3.294	0.00107	0.019913	35	0.006045	yes	CULTFB
chr1_1380513_C_T_b38	AURKAIP1	3.289	0.00109	0.020412	8	0.006206	yes	CULTFB
chr1_1381290_C_G_b38	AURKAIP1	3.289	0.00109	0.020412	8	0.006206	yes	CULTFB
chr1_1364253_C_G_b38	AURKAIP1	3.283	0.00111	0.017012	8	0.005182	yes	CULTFB
chr1_1482624_T_C_b38	AURKAIP1	-3.248	0.00126	-0.017489	39	0.005384	yes	CULTFB
chr1_1375698_G_T_b38	AURKAIP1	3.236	0.00131	0.019667	8	0.006077	yes	CULTFB
chr1_1376153_G_C_b38	AURKAIP1	3.236	0.00131	0.019667	8	0.006077	yes	CULTFB
chr1_1376752_T_C_b38	AURKAIP1	3.236	0.00131	0.019667	8	0.006077	yes	CULTFB
chr1_1378635_C_T_b38	AURKAIP1	3.236	0.00131	0.019667	8	0.006077	yes	CULTFB
chr1_1378792_C_T_b38	AURKAIP1	3.236	0.00131	0.019667	8	0.006077	yes	CULTFB
chr1_1378865_C_T_b38	AURKAIP1	3.236	0.00131	0.019667	8	0.006077	yes	CULTFB
chr1_1379334_A_G_b38	AURKAIP1	3.236	0.00131	0.019667	8	0.006077	yes	CULTFB
chr1_1524911_C_T_b38	AURKAIP1	-3.231	0.00133	-0.025938	11	0.008027	yes	CULTFB
chr1_1372909_G_A_b38	AURKAIP1	3.231	0.00133	0.016892	8	0.005228	yes	CULTFB
chr1_1341550_GCA_G_b38	AURKAIP1	3.211	0.00143	0.016744	9	0.005215	yes	CULTFB
chr1_660993_T_C_b38	AURKAIP1	-3.181	0.00158	-0.027818	8	0.008745	yes	CULTFB
chr1_1473089_T_C_b38	AURKAIP1	-3.164	0.00167	-0.016966	38	0.005362	yes	CULTFB
chr1_1488652_A_G_b38	AURKAIP1	-3.126	0.00189	-0.017037	39	0.005449	yes	CULTFB
chr1_1492292_C_G_b38	AURKAIP1	-3.126	0.00189	-0.017037	39	0.005449	yes	CULTFB
chr1_1492850_G_A_b38	AURKAIP1	-3.126	0.00189	-0.017037	39	0.005449	yes	CULTFB
chr1_1474201_CT_C_b38	AURKAIP1	-3.123	0.00192	-0.015807	34	0.005062	yes	CULTFB
chr1_1306420_A_G_b38	AURKAIP1	3.119	0.00194	0.019602	35	0.006284	yes	CULTFB
chr1_1521518_G_A_b38	AURKAIP1	-3.111	0.00199	-0.02125	23	0.006831	yes	CULTFB
chr1_2302812_A_G_b38	AURKAIP1	-3.093	0.00211	-0.015277	9	0.004939	yes	CULTFB
chr1_1318756_G_A_b38	AURKAIP1	3.063	0.00233	0.018267	24	0.005963	yes	CULTFB
chr1_2189011_G_GA_b38	AURKAIP1	3.02	0.00268	0.011469	45	0.003797	yes	CULTFB
chr1_1425013_C_T_b38	AURKAIP1	-3.02	0.00269	-0.018804	36	0.006227	yes	CULTFB
chr1_1373007_G_A_b38	AURKAIP1	2.997	0.00289	0.016157	6	0.00539	yes	CULTFB
chr1_1490320_T_C_b38	AURKAIP1	-2.974	0.00311	-0.01616	38	0.005433	yes	CULTFB
chr1_1492619_A_AC_b38	AURKAIP1	-2.974	0.00311	-0.01616	38	0.005433	yes	CULTFB
chr1_1691121_A_G_b38	AURKAIP1	-2.974	0.00311	-0.014121	18	0.004748	yes	CULTFB
chr1_1319063_G_A_b38	AURKAIP1	2.971	0.00314	0.017811	25	0.005994	yes	CULTFB
chr1_1319461_C_G_b38	AURKAIP1	2.971	0.00314	0.017811	25	0.005994	yes	CULTFB
chr1_1320023_TG_T_b38	AURKAIP1	2.971	0.00314	0.017811	25	0.005994	yes	CULTFB
chr1_1377480_C_CA_b38	AURKAIP1	-2.96	0.00325	-0.021095	3	0.007126	yes	CULTFB
chr1_1487887_A_G_b38	AURKAIP1	-2.951	0.00335	-0.01601	39	0.005425	yes	CULTFB
chr1_1525526_C_T_b38	AURKAIP1	-2.948	0.00339	-0.024033	5	0.008153	yes	CULTFB
chr1_1483898_G_A_b38	AURKAIP1	-2.941	0.00346	-0.015979	38	0.005434	yes	CULTFB
chr1_1734308_T_C_b38	AURKAIP1	2.93	0.00358	0.016115	19	0.0055	yes	CULTFB
chr1_1495204_T_C_b38	AURKAIP1	-2.898	0.00396	-0.015538	28	0.005362	yes	CULTFB
chr1_1339884_A_ACAGCCGCATGTCCCCCAGCAGCCCCCACAGACCCACCCG_b38	AURKAIP1	2.86	0.00445	0.012449	27	0.004353	yes	CULTFB
chr1_1303959_T_G_b38	AURKAIP1	2.848	0.00462	0.017582	25	0.006173	yes	CULTFB
chr1_1476266_T_C_b38	AURKAIP1	-2.836	0.00479	-0.015549	39	0.005482	yes	CULTFB
chr1_1385384_G_A_b38	AURKAIP1	2.836	0.00479	0.01704	10	0.006009	yes	CULTFB
chr1_1403127_C_CAAAAAAA_b38	AURKAIP1	-2.831	0.00487	-0.023405	5	0.008267	yes	CULTFB
chr1_1329973_GCGTGTGCCATGCA_G_b38	AURKAIP1	2.795	0.00544	0.014952	7	0.00535	yes	CULTFB
chr1_1773729_T_A_b38	AURKAIP1	2.786	0.00559	0.01058	54	0.003798	yes	CULTFB
chr1_878714_A_G_b38	AURKAIP1	2.784	0.00561	0.014952	3	0.00537	yes	CULTFB
chr1_1324788_C_A_b38	AURKAIP1	2.78	0.00568	0.015861	25	0.005704	yes	CULTFB
chr1_1203822_T_C_b38	AURKAIP1	-2.774	0.00579	-0.016614	12	0.00599	yes	CULTFB
chr1_1203533_T_C_b38	AURKAIP1	-2.771	0.00585	-0.016675	12	0.006018	yes	CULTFB
chr1_1486151_C_A_b38	AURKAIP1	-2.758	0.00608	-0.014947	38	0.00542	yes	CULTFB
chr1_588022_A_G_b38	AURKAIP1	2.757	0.00608	0.01248	23	0.004526	yes	CULTFB
chr1_1476079_T_C_b38	AURKAIP1	-2.745	0.00631	-0.014594	36	0.005316	yes	CULTFB
chr1_1773725_T_A_b38	AURKAIP1	2.734	0.00654	0.009609	76	0.003515	yes	CULTFB
chr1_1344048_G_A_b38	AURKAIP1	2.722	0.00677	0.014496	7	0.005326	yes	CULTFB
chr1_1459662_C_T_b38	AURKAIP1	-2.714	0.00692	-0.017827	28	0.006568	yes	CULTFB
chr1_1173931_G_A_b38	AURKAIP1	-2.705	0.00711	-0.014309	9	0.005289	yes	CULTFB
chr1_1173935_C_G_b38	AURKAIP1	-2.705	0.00711	-0.014309	9	0.005289	yes	CULTFB
chr1_1764994_G_A_b38	AURKAIP1	2.689	0.00745	0.023671	9	0.008802	yes	CULTFB
chr1_1496953_T_C_b38	AURKAIP1	-2.65	0.00836	-0.013872	39	0.005235	yes	CULTFB
chr1_1197935_AAC_A_b38	AURKAIP1	-2.6	0.00964	-0.017618	4	0.006775	yes	CULTFB
chr1_1325753_G_T_b38	AURKAIP1	2.593	0.00984	0.015293	4	0.005897	yes	CULTFB
chr1_1385919_A_AG_b38	AURKAIP1	5.531	5.67e-08	0.031552	22	0.005705	no	CULTFB
chr1_1373079_A_G_b38	AURKAIP1	-5.193	3.26e-07	-0.05122	7	0.009863	no	CULTFB
chr1_1375923_C_T_b38	AURKAIP1	-5.193	3.26e-07	-0.05122	7	0.009863	no	CULTFB
chr1_1376025_T_C_b38	AURKAIP1	-5.193	3.26e-07	-0.05122	7	0.009863	no	CULTFB
chr1_1385553_G_A_b38	AURKAIP1	5.117	4.77e-07	0.027069	25	0.00529	no	CULTFB
chr1_1378550_G_A_b38	AURKAIP1	-4.921	1.25e-06	-0.048378	7	0.009831	no	CULTFB
chr1_1378591_C_T_b38	AURKAIP1	-4.921	1.25e-06	-0.048378	7	0.009831	no	CULTFB
chr1_1380206_G_A_b38	AURKAIP1	-4.921	1.25e-06	-0.048378	7	0.009831	no	CULTFB
chr1_1382829_CAACAATCCAGT_C_b38	AURKAIP1	-4.921	1.25e-06	-0.048378	7	0.009831	no	CULTFB
chr1_1395579_C_T_b38	AURKAIP1	-4.921	1.25e-06	-0.048378	7	0.009831	no	CULTFB
chr1_1406131_A_G_b38	AURKAIP1	-4.921	1.25e-06	-0.048378	7	0.009831	no	CULTFB
chr1_1413611_CT_C_b38	AURKAIP1	-4.763	2.64e-06	-0.057443	3	0.012059	no	CULTFB
chr1_1408687_T_C_b38	AURKAIP1	-4.733	3.05e-06	-0.025979	24	0.005489	no	CULTFB
chr1_1411929_G_C_b38	AURKAIP1	-4.643	4.62e-06	-0.025716	27	0.005538	no	CULTFB
chr1_1415976_G_A_b38	AURKAIP1	-4.509	8.51e-06	-0.024946	27	0.005533	no	CULTFB
chr1_1410616_G_T_b38	AURKAIP1	-4.448	1.12e-05	-0.024552	28	0.00552	no	CULTFB
chr1_1412488_C_CAG_b38	AURKAIP1	-4.448	1.12e-05	-0.024552	28	0.00552	no	CULTFB
chr1_1403127_C_CAAAAAA_b38	AURKAIP1	-4.372	1.56e-05	-0.048812	5	0.011165	no	CULTFB
chr1_1363081_C_CA_b38	AURKAIP1	-4.346	1.75e-05	-0.036693	5	0.008442	no	CULTFB
chr1_1329353_C_G_b38	AURKAIP1	-4.33	1.88e-05	-0.03786	6	0.008744	no	CULTFB
chr1_1372258_T_C_b38	AURKAIP1	4.292	2.21e-05	0.029966	9	0.006981	no	CULTFB
chr1_1411847_T_TCCAGGTC_b38	AURKAIP1	-4.283	2.29e-05	-0.043694	6	0.010201	no	CULTFB
chr1_1332271_G_A_b38	AURKAIP1	-4.273	2.4e-05	-0.037475	6	0.008771	no	CULTFB
chr1_1390113_C_CA_b38	AURKAIP1	-4.167	3.76e-05	-0.029619	4	0.007108	no	CULTFB
chr1_1411196_A_G_b38	AURKAIP1	-4.097	5.05e-05	-0.040763	6	0.009951	no	CULTFB
chr1_1412179_C_T_b38	AURKAIP1	-4.097	5.05e-05	-0.040763	6	0.009951	no	CULTFB
chr1_1419780_C_A_b38	AURKAIP1	-4.039	6.4e-05	-0.042365	5	0.010488	no	CULTFB
chr1_1361163_AACAC_A_b38	AURKAIP1	-3.935	9.76e-05	-0.038494	11	0.009782	no	CULTFB
chr1_1357246_C_T_b38	AURKAIP1	-3.923	0.000102	-0.039256	10	0.010005	no	CULTFB
chr1_1300330_T_A_b38	AURKAIP1	-3.714	0.000233	-0.022328	33	0.006013	no	CULTFB
chr1_1301656_T_C_b38	AURKAIP1	-3.714	0.000233	-0.022328	33	0.006013	no	CULTFB
chr1_1339884_A_ACAGCCGCATGTCCCCCAGCAGCCCCCACAGACCCACCCGCAGCCGCATGTCCCCCAGCAGCCCCCACAGACCCACCCG_b38	AURKAIP1	-3.581	0.000383	-0.034758	6	0.009705	no	CULTFB
chr1_1357046_C_G_b38	AURKAIP1	3.452	0.000614	0.020943	24	0.006066	no	CULTFB
chr1_1357369_C_T_b38	AURKAIP1	3.452	0.000614	0.020943	24	0.006066	no	CULTFB
chr1_1359943_G_A_b38	AURKAIP1	3.452	0.000614	0.020943	24	0.006066	no	CULTFB
chr1_1360023_T_C_b38	AURKAIP1	3.452	0.000614	0.020943	24	0.006066	no	CULTFB
chr1_1422379_G_A_b38	AURKAIP1	-3.43	0.000664	-0.033369	8	0.009727	no	CULTFB
chr1_1469429_A_G_b38	AURKAIP1	-3.339	0.000918	-0.020664	35	0.006189	no	CULTFB
chr1_1470034_T_C_b38	AURKAIP1	-3.339	0.000918	-0.020664	35	0.006189	no	CULTFB
chr1_1471144_G_C_b38	AURKAIP1	-3.339	0.000918	-0.020664	35	0.006189	no	CULTFB
chr1_1383743_T_C_b38	AURKAIP1	3.333	0.000935	0.018064	7	0.005419	no	CULTFB
chr1_1327982_G_A_b38	AURKAIP1	3.331	0.000942	0.019716	24	0.005918	no	CULTFB
chr1_1514211_A_G_b38	AURKAIP1	-3.29	0.00109	-0.024779	12	0.007532	no	CULTFB
chr1_1322866_A_C_b38	AURKAIP1	3.281	0.00112	0.01956	22	0.005962	no	CULTFB
chr1_1382893_G_A_b38	AURKAIP1	3.271	0.00116	0.017625	7	0.005388	no	CULTFB
chr1_1422280_A_G_b38	AURKAIP1	-3.226	0.00136	-0.030508	9	0.009457	no	CULTFB
chr1_2239033_T_C_b38	AURKAIP1	3.202	0.00147	0.022679	6	0.007083	no	CULTFB
chr1_2241740_A_G_b38	AURKAIP1	3.202	0.00147	0.022679	6	0.007083	no	CULTFB
chr1_1737789_T_C_b38	AURKAIP1	3.198	0.00149	0.018374	10	0.005746	no	CULTFB
chr1_1774721_A_G_b38	AURKAIP1	3.169	0.00165	0.012511	43	0.003948	no	CULTFB
chr1_1531601_A_G_b38	AURKAIP1	-3.163	0.00167	-0.023771	23	0.007514	no	CULTFB
chr1_1520875_A_G_b38	AURKAIP1	-3.156	0.00172	-0.021333	23	0.00676	no	CULTFB
chr1_1398218_C_A_b38	AURKAIP1	3.139	0.00182	0.017225	7	0.005488	no	CULTFB
chr1_1400756_GGA_G_b38	AURKAIP1	3.139	0.00182	0.017225	7	0.005488	no	CULTFB
chr1_1401954_G_T_b38	AURKAIP1	3.139	0.00182	0.017225	7	0.005488	no	CULTFB
chr1_1403593_A_G_b38	AURKAIP1	3.139	0.00182	0.017225	7	0.005488	no	CULTFB
chr1_1412042_ATCTAGGTCCCAGGTCCCAGGTCCGTCTAGGTCCCAGGTCCG_A_b38	AURKAIP1	-3.117	0.00196	-0.020592	9	0.006607	no	CULTFB
chr1_1514366_A_G_b38	AURKAIP1	-3.094	0.00211	-0.02499	6	0.008077	no	CULTFB
chr1_1531448_C_T_b38	AURKAIP1	-3.032	0.00258	-0.022823	20	0.007527	no	CULTFB
chr1_1533018_T_C_b38	AURKAIP1	-2.995	0.00291	-0.020399	24	0.006811	no	CULTFB
chr1_1380867_A_G_b38	AURKAIP1	2.988	0.00298	0.016382	6	0.005483	no	CULTFB
chr1_1468313_A_G_b38	AURKAIP1	-2.987	0.00298	-0.034961	3	0.011703	no	CULTFB
chr1_2246853_TGG_T_b38	AURKAIP1	2.985	0.00301	0.02136	4	0.007157	no	CULTFB
chr1_2258141_C_T_b38	AURKAIP1	2.985	0.00301	0.02136	4	0.007157	no	CULTFB
chr1_1492939_C_CA_b38	AURKAIP1	-2.973	0.00313	-0.019561	12	0.006581	no	CULTFB
chr1_1533178_A_G_b38	AURKAIP1	-2.949	0.00336	-0.022427	18	0.007604	no	CULTFB
chr1_1383798_AG_A_b38	AURKAIP1	2.942	0.00345	0.017874	10	0.006076	no	CULTFB
chr1_1341030_C_A_b38	AURKAIP1	2.925	0.00364	0.01688	25	0.005772	no	CULTFB
chr1_1290722_G_A_b38	AURKAIP1	-2.915	0.00375	-0.023701	3	0.008129	no	CULTFB
chr1_1384546_C_T_b38	AURKAIP1	2.914	0.00376	0.016408	6	0.00563	no	CULTFB
chr1_1458967_T_C_b38	AURKAIP1	-2.913	0.00378	-0.024181	10	0.008302	no	CULTFB
chr1_2308567_T_C_b38	AURKAIP1	-2.912	0.00378	-0.014157	9	0.004861	no	CULTFB
chr1_1373006_G_A_b38	AURKAIP1	2.912	0.00379	0.015877	5	0.005453	no	CULTFB
chr1_1532105_T_C_b38	AURKAIP1	-2.904	0.00388	-0.02208	20	0.007604	no	CULTFB
chr1_1533253_C_T_b38	AURKAIP1	-2.904	0.00388	-0.02208	20	0.007604	no	CULTFB
chr1_1365036_T_TA_b38	AURKAIP1	-2.898	0.00396	-0.024524	7	0.008462	no	CULTFB
chr1_1459658_G_A_b38	AURKAIP1	-2.875	0.00425	-0.019169	34	0.006668	no	CULTFB
chr1_1773356_TC_T_b38	AURKAIP1	2.872	0.00428	0.011256	49	0.003919	no	CULTFB
chr1_1421170_A_G_b38	AURKAIP1	-2.86	0.00445	-0.017245	31	0.006029	no	CULTFB
chr1_1778596_C_T_b38	AURKAIP1	2.841	0.00472	0.010857	56	0.003821	no	CULTFB
chr1_1524202_G_A_b38	AURKAIP1	-2.82	0.00503	-0.020216	22	0.007168	no	CULTFB
chr1_1530002_A_G_b38	AURKAIP1	-2.8	0.00534	-0.018997	21	0.006783	no	CULTFB
chr1_1500729_G_A_b38	AURKAIP1	-2.8	0.00535	-0.019259	27	0.006878	no	CULTFB
chr1_1424819_C_T_b38	AURKAIP1	-2.798	0.00539	-0.022632	9	0.008089	no	CULTFB
chr1_1910289_C_T_b38	AURKAIP1	-2.795	0.00543	-0.012425	16	0.004446	no	CULTFB
chr1_1910369_G_A_b38	AURKAIP1	-2.795	0.00543	-0.012425	16	0.004446	no	CULTFB
chr1_1910480_G_A_b38	AURKAIP1	-2.795	0.00543	-0.012425	16	0.004446	no	CULTFB
chr1_1035169_TGG_T_b38	AURKAIP1	-2.787	0.00556	-0.012643	15	0.004536	no	CULTFB
chr1_2270301_T_C_b38	AURKAIP1	2.779	0.00571	0.019889	4	0.007157	no	CULTFB
chr1_1526169_C_T_b38	AURKAIP1	-2.764	0.00597	-0.018405	21	0.006659	no	CULTFB
chr1_1912140_T_G_b38	AURKAIP1	-2.759	0.00605	-0.011964	20	0.004336	no	CULTFB
chr1_1195500_C_CTTTTTTTTTTT_b38	AURKAIP1	-2.757	0.00609	-0.03372	3	0.012231	no	CULTFB
chr1_1734301_T_C_b38	AURKAIP1	2.753	0.00616	0.016394	16	0.005954	no	CULTFB
chr1_1900809_G_T_b38	AURKAIP1	-2.742	0.00636	-0.032268	3	0.011766	no	CULTFB
chr1_2253253_G_C_b38	AURKAIP1	2.737	0.00647	0.019187	5	0.00701	no	CULTFB
chr1_1379093_TG_T_b38	AURKAIP1	2.727	0.00666	0.015927	3	0.00584	no	CULTFB
chr1_993602_G_GC_b38	AURKAIP1	-2.697	0.00729	-0.018494	7	0.006858	no	CULTFB
chr1_2244139_G_A_b38	AURKAIP1	2.696	0.0073	0.021592	5	0.008007	no	CULTFB
chr1_697250_A_G_b38	AURKAIP1	-2.681	0.00764	-0.018262	5	0.006812	no	CULTFB
chr1_1523022_A_G_b38	AURKAIP1	-2.66	0.00813	-0.014877	24	0.005593	no	CULTFB
chr1_2260994_A_G_b38	AURKAIP1	2.658	0.00816	0.018696	5	0.007033	no	CULTFB
chr1_1500553_CA_C_b38	AURKAIP1	-2.65	0.00835	-0.017529	3	0.006614	no	CULTFB
chr1_2348590_C_T_b38	AURKAIP1	-2.638	0.00867	-0.027752	5	0.010522	no	CULTFB
chr1_1523187_A_G_b38	AURKAIP1	-2.637	0.00869	-0.017274	29	0.006551	no	CULTFB
chr1_1845840_C_G_b38	AURKAIP1	-2.634	0.00876	-0.012711	8	0.004826	no	CULTFB
chr1_791549_G_GGAATGGAATC_b38	AURKAIP1	2.625	0.00898	0.010738	28	0.00409	no	CULTFB
chr1_1533095_G_A_b38	AURKAIP1	-2.624	0.009	-0.020309	18	0.007739	no	CULTFB
chr1_1367046_G_C_b38	AURKAIP1	2.611	0.00936	0.020867	4	0.007993	no	CULTFB
chr1_2207633_G_A_b38	AURKAIP1	-2.606	0.00949	-0.031592	3	0.012122	no	CULTFB
chr1_2208044_C_T_b38	AURKAIP1	-2.606	0.00949	-0.031592	3	0.012122	no	CULTFB
chr1_1527386_C_T_b38	AURKAIP1	-2.596	0.00977	-0.017738	24	0.006833	no	CULTFB
chr1_1522905_A_G_b38	AURKAIP1	-2.593	0.00985	-0.017334	23	0.006684	no	CULTFB
chr1_1447108_A_ATT_b38	AURKAIP1	3.314	0.00122	0.040481	7	0.012217	yes	EBVTLC
chr1_1102071_C_CA_b38	AURKAIP1	-2.921	0.00416	-0.040451	6	0.013847	yes	EBVTLC
chr1_1498616_T_C_b38	AURKAIP1	2.869	0.00487	0.059657	4	0.020797	yes	EBVTLC
chr1_1379091_T_G_b38	AURKAIP1	-2.839	0.00531	-0.039136	3	0.013787	yes	EBVTLC
chr1_1436079_A_G_b38	AURKAIP1	2.828	0.00548	0.034915	22	0.012345	yes	EBVTLC
chr1_1454315_C_T_b38	AURKAIP1	2.818	0.00564	0.039172	16	0.013899	yes	EBVTLC
chr1_1452511_A_G_b38	AURKAIP1	2.811	0.00576	0.038869	16	0.013827	yes	EBVTLC
chr1_1452888_C_A_b38	AURKAIP1	2.811	0.00576	0.038869	16	0.013827	yes	EBVTLC
chr1_1452909_A_C_b38	AURKAIP1	2.811	0.00576	0.038869	16	0.013827	yes	EBVTLC
chr1_1453703_A_G_b38	AURKAIP1	2.811	0.00576	0.038869	16	0.013827	yes	EBVTLC
chr1_1454092_A_G_b38	AURKAIP1	2.811	0.00576	0.038869	16	0.013827	yes	EBVTLC
chr1_1819705_AT_A_b38	AURKAIP1	-2.786	0.0062	-0.037819	4	0.013577	yes	EBVTLC
chr1_1993198_CA_C_b38	AURKAIP1	-2.772	0.00646	-0.031609	6	0.011405	yes	EBVTLC
chr1_1443457_T_C_b38	AURKAIP1	2.75	0.00688	0.035219	19	0.012808	yes	EBVTLC
chr1_1433374_T_C_b38	AURKAIP1	2.749	0.0069	0.034055	22	0.012389	yes	EBVTLC
chr1_1439805_G_C_b38	AURKAIP1	2.683	0.00833	0.034739	6	0.01295	yes	EBVTLC
chr1_1453552_G_A_b38	AURKAIP1	2.627	0.00973	0.03386	6	0.01289	yes	EBVTLC
chr1_1454848_T_C_b38	AURKAIP1	2.627	0.00973	0.03386	6	0.01289	yes	EBVTLC
chr1_1455134_T_G_b38	AURKAIP1	2.627	0.00973	0.03386	6	0.01289	yes	EBVTLC
chr1_1455337_A_G_b38	AURKAIP1	2.627	0.00973	0.03386	6	0.01289	yes	EBVTLC
chr1_1455495_C_T_b38	AURKAIP1	2.627	0.00973	0.03386	6	0.01289	yes	EBVTLC
chr1_1455924_T_C_b38	AURKAIP1	2.627	0.00973	0.03386	6	0.01289	yes	EBVTLC
chr1_1454770_T_C_b38	AURKAIP1	2.625	0.00979	0.036657	17	0.013966	yes	EBVTLC
chr1_1456051_C_T_b38	AURKAIP1	2.618	0.00997	0.033804	5	0.012912	yes	EBVTLC
chr1_2049200_G_A_b38	AURKAIP1	-3.868	0.000178	-0.046918	3	0.01213	no	EBVTLC
chr1_2048285_C_A_b38	AURKAIP1	-3.696	0.000331	-0.044397	3	0.012013	no	EBVTLC
chr1_1898648_CACACACATAAGTTGGATAT_C_b38	AURKAIP1	-3.368	0.00102	-0.030597	19	0.009085	no	EBVTLC
chr1_1431537_G_C_b38	AURKAIP1	3.195	0.00179	0.039999	21	0.012521	no	EBVTLC
chr1_1991468_T_C_b38	AURKAIP1	3.189	0.00182	0.06391	5	0.020039	no	EBVTLC
chr1_1431026_CCACCCCCT_C_b38	AURKAIP1	3.064	0.0027	0.043268	3	0.014124	no	EBVTLC
chr1_1050069_G_A_b38	AURKAIP1	-3.002	0.00326	-0.031625	30	0.010536	no	EBVTLC
chr1_1450193_C_T_b38	AURKAIP1	2.96	0.00371	0.042143	7	0.014239	no	EBVTLC
chr1_1288085_GC_G_b38	AURKAIP1	2.951	0.00381	0.042543	3	0.014417	no	EBVTLC
chr1_1428969_T_C_b38	AURKAIP1	2.934	0.00401	0.037168	21	0.012668	no	EBVTLC
chr1_1430190_A_C_b38	AURKAIP1	2.934	0.00401	0.037168	21	0.012668	no	EBVTLC
chr1_1430908_A_G_b38	AURKAIP1	2.934	0.00401	0.037168	21	0.012668	no	EBVTLC
chr1_1431450_A_G_b38	AURKAIP1	2.934	0.00401	0.037168	21	0.012668	no	EBVTLC
chr1_2108949_G_A_b38	AURKAIP1	-2.934	0.00401	-0.037459	9	0.012768	no	EBVTLC
chr1_1450322_CAA_C_b38	AURKAIP1	2.909	0.00431	0.046849	3	0.016103	no	EBVTLC
chr1_1810077_T_A_b38	AURKAIP1	-2.843	0.00525	-0.029376	21	0.010332	no	EBVTLC
chr1_2286661_C_T_b38	AURKAIP1	-2.791	0.0061	-0.035786	4	0.01282	no	EBVTLC
chr1_1588220_CT_C_b38	AURKAIP1	2.711	0.00768	0.028353	12	0.010458	no	EBVTLC
chr1_1774506_T_C_b38	AURKAIP1	-2.71	0.00771	-0.028793	26	0.010626	no	EBVTLC
chr1_1256888_G_GA_b38	AURKAIP1	-2.701	0.0079	-0.035889	7	0.013286	no	EBVTLC
chr1_726821_G_A_b38	AURKAIP1	-2.698	0.00798	-0.030955	14	0.011474	no	EBVTLC
chr1_2108657_T_C_b38	AURKAIP1	-2.672	0.00859	-0.035904	6	0.013439	no	EBVTLC
chr1_1897985_C_G_b38	AURKAIP1	-2.671	0.00861	-0.02855	10	0.01069	no	EBVTLC
chr1_1426261_C_T_b38	AURKAIP1	2.664	0.00877	0.033604	21	0.012613	no	EBVTLC
chr1_1426810_C_G_b38	AURKAIP1	2.664	0.00877	0.033604	21	0.012613	no	EBVTLC
chr1_1324139_GGGGGCTGGGGGGCTGAGGGGCTGGGGGGCTGA_G_b38	AURKAIP1	-3.859	0.000143	-0.058989	15	0.015284	yes	CLNSGM
chr1_1743565_AT_A_b38	AURKAIP1	3.253	0.00129	0.030389	83	0.009341	yes	CLNSGM
chr1_2005948_A_C_b38	AURKAIP1	-3.196	0.00157	-0.046277	6	0.014481	yes	CLNSGM
chr1_810809_A_G_b38	AURKAIP1	-3.157	0.00178	-0.099038	4	0.031375	yes	CLNSGM
chr1_1834667_C_CT_b38	AURKAIP1	-2.684	0.00773	-0.027529	50	0.010255	yes	CLNSGM
chr1_1138387_T_A_b38	AURKAIP1	-2.683	0.00777	-0.053715	4	0.020023	yes	CLNSGM
chr1_1425464_CA_C_b38	AURKAIP1	-2.643	0.0087	-0.043528	3	0.016467	yes	CLNSGM
chr1_624505_A_G_b38	AURKAIP1	-3.374	0.000854	-0.048125	4	0.014266	no	CLNSGM
chr1_1288372_TCC_T_b38	AURKAIP1	-3.357	0.000905	-0.103694	4	0.03089	no	CLNSGM
chr1_1810535_C_CA_b38	AURKAIP1	-3.322	0.00102	-0.082593	3	0.024864	no	CLNSGM
chr1_2212668_A_G_b38	AURKAIP1	3.319	0.00103	0.053705	4	0.016182	no	CLNSGM
chr1_2053372_G_T_b38	AURKAIP1	-2.984	0.00311	-0.036991	20	0.012395	no	CLNSGM
chr1_1874605_T_TA_b38	AURKAIP1	2.687	0.00767	0.038182	26	0.01421	no	CLNSGM
chr1_1861110_C_CA_b38	AURKAIP1	-2.658	0.00835	-0.026792	54	0.010081	no	CLNSGM
chr1_2224430_C_T_b38	AURKAIP1	2.627	0.00912	0.04416	5	0.016811	no	CLNSGM
chr1_2194537_C_A_b38	AURKAIP1	-2.601	0.00981	-0.032421	18	0.012463	no	CLNSGM
chr1_2245631_A_G_b38	AURKAIP1	-3.757	0.000207	-0.057268	3	0.015243	yes	CLNTRN
chr1_1713469_C_A_b38	AURKAIP1	-3.419	0.000715	-0.09091	3	0.026586	yes	CLNTRN
chr1_1501260_A_AT_b38	AURKAIP1	3.418	0.000719	0.03789	20	0.011086	yes	CLNTRN
chr1_1501403_T_C_b38	AURKAIP1	3.389	0.000796	0.038244	31	0.011285	yes	CLNTRN
chr1_1639685_G_A_b38	AURKAIP1	-3.261	0.00124	-0.031797	19	0.00975	yes	CLNTRN
chr1_1050066_G_T_b38	AURKAIP1	-3.219	0.00143	-0.028427	48	0.00883	yes	CLNTRN
chr1_1039411_T_TGG_b38	AURKAIP1	-3.148	0.00181	-0.026659	69	0.008468	yes	CLNTRN
chr1_1102614_T_TA_b38	AURKAIP1	3.029	0.00267	0.043033	11	0.014208	yes	CLNTRN
chr1_1734812_G_A_b38	AURKAIP1	-2.925	0.00371	-0.029134	46	0.009959	yes	CLNTRN
chr1_1511945_G_A_b38	AURKAIP1	2.899	0.00402	0.033015	31	0.011389	yes	CLNTRN
chr1_1692900_G_GT_b38	AURKAIP1	2.895	0.00407	0.041388	3	0.014297	yes	CLNTRN
chr1_1650664_CTTTTT_C_b38	AURKAIP1	-2.882	0.00424	-0.028298	19	0.009818	yes	CLNTRN
chr1_1494105_G_A_b38	AURKAIP1	2.882	0.00424	0.056679	4	0.019666	yes	CLNTRN
chr1_1002415_C_CATTT_b38	AURKAIP1	2.88	0.00427	0.03014	20	0.010467	yes	CLNTRN
chr1_1512376_G_C_b38	AURKAIP1	2.87	0.0044	0.032039	30	0.011164	yes	CLNTRN
chr1_1477677_TTTTTA_T_b38	AURKAIP1	2.844	0.00476	0.055769	4	0.019609	yes	CLNTRN
chr1_993036_G_A_b38	AURKAIP1	2.829	0.00499	0.027121	18	0.009588	yes	CLNTRN
chr1_1074910_TCACA_T_b38	AURKAIP1	2.775	0.00588	0.034564	6	0.012457	yes	CLNTRN
chr1_1725745_C_G_b38	AURKAIP1	-2.772	0.00593	-0.028263	20	0.010197	yes	CLNTRN
chr1_2181022_T_C_b38	AURKAIP1	2.769	0.00597	0.023421	88	0.008457	yes	CLNTRN
chr1_1521298_C_CAAA_b38	AURKAIP1	2.739	0.00653	0.062763	4	0.022913	yes	CLNTRN
chr1_1026447_G_A_b38	AURKAIP1	-2.737	0.00658	-0.032775	16	0.011976	yes	CLNTRN
chr1_683167_G_A_b38	AURKAIP1	2.705	0.00722	0.034404	5	0.012719	yes	CLNTRN
chr1_1495236_T_C_b38	AURKAIP1	2.697	0.00739	0.0535	4	0.019835	yes	CLNTRN
chr1_669882_G_A_b38	AURKAIP1	2.692	0.00752	0.034006	6	0.012635	yes	CLNTRN
chr1_1050069_G_A_b38	AURKAIP1	-2.666	0.00809	-0.023022	74	0.008635	yes	CLNTRN
chr1_1740869_C_T_b38	AURKAIP1	2.654	0.00839	0.055	4	0.020727	yes	CLNTRN
chr1_1741174_TTCA_T_b38	AURKAIP1	2.654	0.00839	0.055	4	0.020727	yes	CLNTRN
chr1_1741497_G_A_b38	AURKAIP1	2.654	0.00839	0.055	4	0.020727	yes	CLNTRN
chr1_790733_C_CAATGG_b38	AURKAIP1	-2.644	0.00864	-0.031643	3	0.01197	yes	CLNTRN
chr1_1518689_A_ACC_b38	AURKAIP1	2.639	0.00875	0.036677	3	0.013897	yes	CLNTRN
chr1_1485282_A_G_b38	AURKAIP1	2.635	0.00886	0.047114	7	0.017881	yes	CLNTRN
chr1_1739996_G_T_b38	AURKAIP1	2.627	0.00906	0.058646	3	0.022323	yes	CLNTRN
chr1_1034835_G_C_b38	AURKAIP1	-2.627	0.00907	-0.021741	80	0.008277	yes	CLNTRN
chr1_1086657_C_T_b38	AURKAIP1	-2.626	0.00908	-0.02055	79	0.007825	yes	CLNTRN
chr1_613200_TG_T_b38	AURKAIP1	2.6	0.00979	0.049473	4	0.019029	yes	CLNTRN
chr1_1486354_G_C_b38	AURKAIP1	2.596	0.00989	0.05269	4	0.020293	yes	CLNTRN
chr1_1664757_T_C_b38	AURKAIP1	-3.72	0.000238	-0.032737	32	0.008801	no	CLNTRN
chr1_1664865_A_G_b38	AURKAIP1	-3.451	0.00064	-0.030461	33	0.008827	no	CLNTRN
chr1_1312208_G_T_b38	AURKAIP1	-3.403	0.000758	-0.077802	3	0.022862	no	CLNTRN
chr1_1665061_C_T_b38	AURKAIP1	-3.305	0.00107	-0.032894	19	0.009954	no	CLNTRN
chr1_994321_C_CA_b38	AURKAIP1	-3.287	0.00114	-0.033137	29	0.010083	no	CLNTRN
chr1_1624323_AT_A_b38	AURKAIP1	3.27	0.0012	0.027387	55	0.008375	no	CLNTRN
chr1_1641261_C_T_b38	AURKAIP1	-3.267	0.00121	-0.032776	18	0.010033	no	CLNTRN
chr1_1657093_C_A_b38	AURKAIP1	-3.247	0.0013	-0.032081	28	0.009879	no	CLNTRN
chr1_2237274_C_T_b38	AURKAIP1	-3.244	0.00131	-0.040431	6	0.012461	no	CLNTRN
chr1_1658830_C_G_b38	AURKAIP1	-3.243	0.00132	-0.030753	22	0.009483	no	CLNTRN
chr1_1661177_A_G_b38	AURKAIP1	-3.226	0.0014	-0.031729	20	0.009836	no	CLNTRN
chr1_1658866_G_A_b38	AURKAIP1	-3.199	0.00153	-0.027917	36	0.008727	no	CLNTRN
chr1_1659114_A_G_b38	AURKAIP1	-3.199	0.00153	-0.027917	36	0.008727	no	CLNTRN
chr1_1659220_A_G_b38	AURKAIP1	-3.199	0.00153	-0.027917	36	0.008727	no	CLNTRN
chr1_1661420_C_A_b38	AURKAIP1	-3.197	0.00154	-0.027874	36	0.008718	no	CLNTRN
chr1_1651574_G_A_b38	AURKAIP1	-3.195	0.00155	-0.028382	32	0.008885	no	CLNTRN
chr1_2247315_CGCCCTCA_C_b38	AURKAIP1	-3.185	0.0016	-0.039327	7	0.012348	no	CLNTRN
chr1_2250524_C_T_b38	AURKAIP1	-3.185	0.0016	-0.039327	7	0.012348	no	CLNTRN
chr1_1641819_C_T_b38	AURKAIP1	-3.161	0.00173	-0.036992	9	0.011702	no	CLNTRN
chr1_2221609_A_G_b38	AURKAIP1	-3.156	0.00176	-0.039784	5	0.012605	no	CLNTRN
chr1_1481959_C_T_b38	AURKAIP1	3.153	0.00178	0.041589	18	0.01319	no	CLNTRN
chr1_1496973_G_A_b38	AURKAIP1	3.145	0.00183	0.041741	15	0.01327	no	CLNTRN
chr1_1651926_T_C_b38	AURKAIP1	-3.142	0.00184	-0.027972	32	0.008901	no	CLNTRN
chr1_1445055_G_A_b38	AURKAIP1	3.141	0.00185	0.04777	3	0.015209	no	CLNTRN
chr1_1651137_C_T_b38	AURKAIP1	-3.121	0.00198	-0.027703	32	0.008875	no	CLNTRN
chr1_1651267_T_C_b38	AURKAIP1	-3.121	0.00198	-0.027703	32	0.008875	no	CLNTRN
chr1_1651421_GTAGCCCCTCTGAACGGTCTGTGACACACGCATGCTTTCAGCTAGAGTACTCTA_G_b38	AURKAIP1	-3.121	0.00198	-0.027703	32	0.008875	no	CLNTRN
chr1_1651785_C_A_b38	AURKAIP1	-3.121	0.00198	-0.027703	32	0.008875	no	CLNTRN
chr1_1652135_C_G_b38	AURKAIP1	-3.121	0.00198	-0.027703	32	0.008875	no	CLNTRN
chr1_1652191_C_T_b38	AURKAIP1	-3.121	0.00198	-0.027703	32	0.008875	no	CLNTRN
chr1_1652592_A_G_b38	AURKAIP1	-3.121	0.00198	-0.027703	32	0.008875	no	CLNTRN
chr1_1652779_A_G_b38	AURKAIP1	-3.121	0.00198	-0.027703	32	0.008875	no	CLNTRN
chr1_1653147_A_C_b38	AURKAIP1	-3.121	0.00198	-0.027703	32	0.008875	no	CLNTRN
chr1_1653396_T_C_b38	AURKAIP1	-3.121	0.00198	-0.027703	32	0.008875	no	CLNTRN
chr1_1653472_T_C_b38	AURKAIP1	-3.121	0.00198	-0.027703	32	0.008875	no	CLNTRN
chr1_1653811_G_A_b38	AURKAIP1	-3.121	0.00198	-0.027703	32	0.008875	no	CLNTRN
chr1_1653893_C_T_b38	AURKAIP1	-3.121	0.00198	-0.027703	32	0.008875	no	CLNTRN
chr1_1654143_G_A_b38	AURKAIP1	-3.121	0.00198	-0.027703	32	0.008875	no	CLNTRN
chr1_1653934_G_A_b38	AURKAIP1	-3.083	0.00224	-0.027367	32	0.008877	no	CLNTRN
chr1_1657085_C_CTAA_b38	AURKAIP1	-3.075	0.0023	-0.030972	27	0.010073	no	CLNTRN
chr1_1989803_A_G_b38	AURKAIP1	3.067	0.00236	0.026434	52	0.00862	no	CLNTRN
chr1_1641723_TTCCTCCTCC_T_b38	AURKAIP1	-3.039	0.00258	-0.033866	7	0.011142	no	CLNTRN
chr1_1668108_C_T_b38	AURKAIP1	3.036	0.00261	0.026978	33	0.008886	no	CLNTRN
chr1_1518541_T_C_b38	AURKAIP1	3.035	0.00262	0.031121	30	0.010254	no	CLNTRN
chr1_2253549_A_G_b38	AURKAIP1	-3.028	0.00268	-0.037557	7	0.012403	no	CLNTRN
chr1_2233384_G_T_b38	AURKAIP1	-3	0.00293	-0.037711	5	0.012571	no	CLNTRN
chr1_1652061_T_C_b38	AURKAIP1	-2.997	0.00295	-0.026466	33	0.00883	no	CLNTRN
chr1_1654188_T_G_b38	AURKAIP1	-2.997	0.00295	-0.026466	33	0.00883	no	CLNTRN
chr1_2160238_C_CGT_b38	AURKAIP1	-2.996	0.00297	-0.042944	5	0.014335	no	CLNTRN
chr1_1657081_C_T_b38	AURKAIP1	-2.988	0.00304	-0.02973	27	0.009951	no	CLNTRN
chr1_1665581_C_G_b38	AURKAIP1	-2.966	0.00327	-0.028445	23	0.009592	no	CLNTRN
chr1_1650777_G_A_b38	AURKAIP1	-2.964	0.00328	-0.026322	32	0.008881	no	CLNTRN
chr1_1660683_C_T_b38	AURKAIP1	-2.952	0.0034	-0.027874	24	0.009441	no	CLNTRN
chr1_1516000_T_C_b38	AURKAIP1	2.945	0.00348	0.031442	35	0.010675	no	CLNTRN
chr1_1641275_A_G_b38	AURKAIP1	-2.939	0.00355	-0.026036	39	0.008859	no	CLNTRN
chr1_1513923_G_C_b38	AURKAIP1	2.935	0.0036	0.030565	35	0.010414	no	CLNTRN
chr1_1459658_G_A_b38	AURKAIP1	2.914	0.00384	0.043337	25	0.014873	no	CLNTRN
chr1_1450193_C_T_b38	AURKAIP1	2.907	0.00393	0.043427	7	0.01494	no	CLNTRN
chr1_1530331_T_C_b38	AURKAIP1	2.906	0.00394	0.030845	35	0.010614	no	CLNTRN
chr1_1605347_C_T_b38	AURKAIP1	-2.882	0.00424	-0.026147	42	0.009074	no	CLNTRN
chr1_1486611_G_A_b38	AURKAIP1	2.876	0.00431	0.038957	13	0.013544	no	CLNTRN
chr1_1639348_G_T_b38	AURKAIP1	-2.873	0.00436	-0.024338	41	0.008471	no	CLNTRN
chr1_2231034_C_T_b38	AURKAIP1	-2.863	0.00449	-0.035212	7	0.012298	no	CLNTRN
chr1_1629572_TG_T_b38	AURKAIP1	-2.839	0.00484	-0.02542	43	0.008954	no	CLNTRN
chr1_1650195_A_G_b38	AURKAIP1	-2.83	0.00497	-0.025534	33	0.009022	no	CLNTRN
chr1_1038078_C_T_b38	AURKAIP1	-2.825	0.00505	-0.03534	7	0.012512	no	CLNTRN
chr1_1041950_T_C_b38	AURKAIP1	-2.825	0.00505	-0.03534	7	0.012512	no	CLNTRN
chr1_886546_C_G_b38	AURKAIP1	-2.824	0.00506	-0.039577	5	0.014014	no	CLNTRN
chr1_1038288_A_G_b38	AURKAIP1	-2.804	0.00538	-0.036538	6	0.013031	no	CLNTRN
chr1_981210_G_A_b38	AURKAIP1	2.799	0.00546	0.031502	8	0.011255	no	CLNTRN
chr1_1459632_T_C_b38	AURKAIP1	2.77	0.00596	0.040072	21	0.014468	no	CLNTRN
chr1_1027226_G_A_b38	AURKAIP1	-2.769	0.00597	-0.022706	82	0.008199	no	CLNTRN
chr1_1608603_C_A_b38	AURKAIP1	-2.76	0.00614	-0.025037	40	0.009071	no	CLNTRN
chr1_1609070_G_A_b38	AURKAIP1	-2.76	0.00614	-0.025037	40	0.009071	no	CLNTRN
chr1_1489916_C_T_b38	AURKAIP1	2.757	0.00619	0.034533	15	0.012525	no	CLNTRN
chr1_1460021_C_CTG_b38	AURKAIP1	2.752	0.00629	0.036722	17	0.013344	no	CLNTRN
chr1_1460022_CAG_C_b38	AURKAIP1	2.752	0.00629	0.036722	17	0.013344	no	CLNTRN
chr1_1659060_G_A_b38	AURKAIP1	-2.739	0.00653	-0.024685	32	0.009012	no	CLNTRN
chr1_1625805_G_A_b38	AURKAIP1	-2.723	0.00685	-0.024575	42	0.009024	no	CLNTRN
chr1_1590813_CA_C_b38	AURKAIP1	2.719	0.00694	0.03161	5	0.011628	no	CLNTRN
chr1_1628409_C_A_b38	AURKAIP1	-2.717	0.00697	-0.024375	41	0.00897	no	CLNTRN
chr1_1613090_A_G_b38	AURKAIP1	-2.717	0.00698	-0.024834	40	0.009141	no	CLNTRN
chr1_1743544_CA_C_b38	AURKAIP1	-2.708	0.00716	-0.022234	69	0.00821	no	CLNTRN
chr1_1468048_A_G_b38	AURKAIP1	2.705	0.00723	0.037885	19	0.014006	no	CLNTRN
chr1_1648826_A_G_b38	AURKAIP1	-2.682	0.00774	-0.023753	39	0.008858	no	CLNTRN
chr1_1023775_G_A_b38	AURKAIP1	-2.671	0.00798	-0.022103	83	0.008275	no	CLNTRN
chr1_1660408_T_C_b38	AURKAIP1	-2.67	0.008	-0.02842	7	0.010643	no	CLNTRN
chr1_1472158_C_G_b38	AURKAIP1	2.666	0.0081	0.038002	13	0.014255	no	CLNTRN
chr1_1624720_G_A_b38	AURKAIP1	-2.66	0.00824	-0.02405	41	0.009042	no	CLNTRN
chr1_1667948_A_G_b38	AURKAIP1	-2.648	0.00854	-0.026166	20	0.009883	no	CLNTRN
chr1_1037956_A_G_b38	AURKAIP1	-2.644	0.00863	-0.03406	5	0.012883	no	CLNTRN
chr1_1037997_G_A_b38	AURKAIP1	-2.644	0.00863	-0.03406	5	0.012883	no	CLNTRN
chr1_1038800_G_T_b38	AURKAIP1	-2.644	0.00863	-0.03406	5	0.012883	no	CLNTRN
chr1_1038819_C_T_b38	AURKAIP1	-2.644	0.00863	-0.03406	5	0.012883	no	CLNTRN
chr1_1038845_A_G_b38	AURKAIP1	-2.644	0.00863	-0.03406	5	0.012883	no	CLNTRN
chr1_1038916_A_G_b38	AURKAIP1	-2.644	0.00863	-0.03406	5	0.012883	no	CLNTRN
chr1_1038975_G_A_b38	AURKAIP1	-2.644	0.00863	-0.03406	5	0.012883	no	CLNTRN
chr1_1038976_T_C_b38	AURKAIP1	-2.644	0.00863	-0.03406	5	0.012883	no	CLNTRN
chr1_1039114_G_T_b38	AURKAIP1	-2.644	0.00863	-0.03406	5	0.012883	no	CLNTRN
chr1_1039190_T_G_b38	AURKAIP1	-2.644	0.00863	-0.03406	5	0.012883	no	CLNTRN
chr1_1039753_T_A_b38	AURKAIP1	-2.644	0.00863	-0.03406	5	0.012883	no	CLNTRN
chr1_1040322_A_G_b38	AURKAIP1	-2.644	0.00863	-0.03406	5	0.012883	no	CLNTRN
chr1_1610924_C_T_b38	AURKAIP1	-2.638	0.00878	-0.024074	40	0.009127	no	CLNTRN
chr1_1618118_G_A_b38	AURKAIP1	-2.638	0.00878	-0.024074	40	0.009127	no	CLNTRN
chr1_998762_A_AGGGGAGG_b38	AURKAIP1	-2.624	0.00914	-0.020072	65	0.00765	no	CLNTRN
chr1_1628814_C_T_b38	AURKAIP1	-2.618	0.00929	-0.023593	41	0.009011	no	CLNTRN
chr1_1668717_C_G_b38	AURKAIP1	-2.618	0.0093	-0.025932	20	0.009906	no	CLNTRN
chr1_1669613_G_A_b38	AURKAIP1	-2.618	0.0093	-0.025932	20	0.009906	no	CLNTRN
chr1_2137041_C_T_b38	AURKAIP1	-2.615	0.00938	-0.022754	40	0.008701	no	CLNTRN
chr1_1032278_C_T_b38	AURKAIP1	-2.61	0.00951	-0.021814	91	0.008358	no	CLNTRN
chr1_1999114_T_C_b38	AURKAIP1	-3.662	3e-04	-0.043696	7	0.011931	yes	ESPGSJ
chr1_2003927_G_C_b38	AURKAIP1	-3.597	0.000381	-0.040037	9	0.01113	yes	ESPGSJ
chr1_2005768_G_A_b38	AURKAIP1	-3.56	0.000437	-0.040849	8	0.011474	yes	ESPGSJ
chr1_2006475_G_A_b38	AURKAIP1	-3.56	0.000437	-0.040849	8	0.011474	yes	ESPGSJ
chr1_2000742_G_C_b38	AURKAIP1	-3.506	0.000531	-0.041189	7	0.011748	yes	ESPGSJ
chr1_2004049_G_C_b38	AURKAIP1	-3.436	0.000683	-0.038328	9	0.011156	yes	ESPGSJ
chr1_1999860_A_T_b38	AURKAIP1	-3.343	0.000946	-0.039336	7	0.011768	yes	ESPGSJ
chr1_2003636_G_C_b38	AURKAIP1	-3.343	0.000946	-0.039336	7	0.011768	yes	ESPGSJ
chr1_683083_G_A_b38	AURKAIP1	3.291	0.00113	0.046234	6	0.014051	yes	ESPGSJ
chr1_2011271_G_GTT_b38	AURKAIP1	-3.284	0.00116	-0.032036	17	0.009755	yes	ESPGSJ
chr1_2004070_T_C_b38	AURKAIP1	-3.282	0.00116	-0.036712	9	0.011185	yes	ESPGSJ
chr1_2007034_T_G_b38	AURKAIP1	-3.276	0.00119	-0.039185	7	0.011961	yes	ESPGSJ
chr1_2017202_C_T_b38	AURKAIP1	-3.211	0.00148	-0.040419	4	0.012589	yes	ESPGSJ
chr1_2029235_C_T_b38	AURKAIP1	-3.191	0.00158	-0.040609	4	0.012726	yes	ESPGSJ
chr1_2029969_C_T_b38	AURKAIP1	-3.191	0.00158	-0.040609	4	0.012726	yes	ESPGSJ
chr1_2031629_GTGTCTGGGGCGCTAC_G_b38	AURKAIP1	-3.191	0.00158	-0.040609	4	0.012726	yes	ESPGSJ
chr1_2031648_CCTCTG_C_b38	AURKAIP1	-3.191	0.00158	-0.040609	4	0.012726	yes	ESPGSJ
chr1_2031655_AGGACCCAGGCATCTG_A_b38	AURKAIP1	-3.191	0.00158	-0.040609	4	0.012726	yes	ESPGSJ
chr1_2031719_C_T_b38	AURKAIP1	-3.191	0.00158	-0.040609	4	0.012726	yes	ESPGSJ
chr1_2031852_C_G_b38	AURKAIP1	-3.191	0.00158	-0.040609	4	0.012726	yes	ESPGSJ
chr1_2033336_T_C_b38	AURKAIP1	-3.191	0.00158	-0.040609	4	0.012726	yes	ESPGSJ
chr1_2033373_T_G_b38	AURKAIP1	-3.191	0.00158	-0.040609	4	0.012726	yes	ESPGSJ
chr1_2032636_T_C_b38	AURKAIP1	-3.187	0.00161	-0.036712	7	0.011521	yes	ESPGSJ
chr1_2005928_T_TTC_b38	AURKAIP1	-3.173	0.00168	-0.044109	4	0.013902	yes	ESPGSJ
chr1_2031380_T_A_b38	AURKAIP1	-3.085	0.00224	-0.038998	5	0.012641	yes	ESPGSJ
chr1_2010975_T_C_b38	AURKAIP1	-3.067	0.00238	-0.037602	5	0.012262	yes	ESPGSJ
chr1_1014274_A_G_b38	AURKAIP1	-3.065	0.00239	-0.053782	4	0.017546	yes	ESPGSJ
chr1_903723_A_G_b38	AURKAIP1	3.053	0.00249	0.02823	27	0.009247	yes	ESPGSJ
chr1_2008008_CA_C_b38	AURKAIP1	-3.04	0.0026	-0.034902	6	0.011481	yes	ESPGSJ
chr1_1605794_G_C_b38	AURKAIP1	-3.031	0.00267	-0.058201	3	0.019199	yes	ESPGSJ
chr1_2010406_G_A_b38	AURKAIP1	-3.019	0.00278	-0.034951	6	0.011579	yes	ESPGSJ
chr1_2008632_C_T_b38	AURKAIP1	-3.011	0.00284	-0.035465	6	0.011777	yes	ESPGSJ
chr1_2008948_G_C_b38	AURKAIP1	-3.011	0.00284	-0.035465	6	0.011777	yes	ESPGSJ
chr1_2010191_G_C_b38	AURKAIP1	-2.956	0.00339	-0.035371	6	0.011968	yes	ESPGSJ
chr1_2008387_C_T_b38	AURKAIP1	-2.926	0.00373	-0.034079	6	0.011649	yes	ESPGSJ
chr1_2033988_G_A_b38	AURKAIP1	-2.9	0.00403	-0.036936	4	0.012735	yes	ESPGSJ
chr1_2057679_A_C_b38	AURKAIP1	2.898	0.00406	0.034317	8	0.011843	yes	ESPGSJ
chr1_2031194_A_G_b38	AURKAIP1	-2.879	0.00431	-0.034486	6	0.011979	yes	ESPGSJ
chr1_2023934_C_T_b38	AURKAIP1	-2.856	0.00462	-0.03382	5	0.011842	yes	ESPGSJ
chr1_2009834_C_T_b38	AURKAIP1	-2.805	0.0054	-0.032672	6	0.01165	yes	ESPGSJ
chr1_2089466_C_T_b38	AURKAIP1	2.766	0.00606	0.031914	11	0.011538	yes	ESPGSJ
chr1_1230462_A_ATTT_b38	AURKAIP1	-2.73	0.00675	-0.04193	3	0.015361	yes	ESPGSJ
chr1_1584235_A_AT_b38	AURKAIP1	2.628	0.00908	0.023588	47	0.008977	yes	ESPGSJ
chr1_911018_G_A_b38	AURKAIP1	2.606	0.00966	0.028502	14	0.010936	yes	ESPGSJ
chr1_860178_C_CTTTT_b38	AURKAIP1	-2.6	0.00982	-0.053041	3	0.020399	yes	ESPGSJ
chr1_2005903_A_ACTCT_b38	AURKAIP1	-3.456	0.000636	-0.04151	5	0.012012	no	ESPGSJ
chr1_1157306_CCCGCCCCCAGCCCACCCATCCCATCCCCGCCCACCCATCCCATCCCCG_C_b38	AURKAIP1	-3.172	0.00169	-0.059755	4	0.018839	no	ESPGSJ
chr1_1692900_G_GT_b38	AURKAIP1	-3.086	0.00223	-0.047542	3	0.015405	no	ESPGSJ
chr1_903175_C_A_b38	AURKAIP1	2.969	0.00326	0.029708	17	0.010008	no	ESPGSJ
chr1_1996920_C_CA_b38	AURKAIP1	-2.867	0.00447	-0.050897	4	0.017753	no	ESPGSJ
chr1_1909229_TG_T_b38	AURKAIP1	-3.578	0.000386	-0.034105	7	0.009532	yes	ESPMCS
chr1_1892483_A_G_b38	AURKAIP1	3.522	0.000474	0.036007	9	0.010223	yes	ESPMCS
chr1_1768171_CA_C_b38	AURKAIP1	3.512	0.000492	0.023819	17	0.006782	yes	ESPMCS
chr1_1872863_C_T_b38	AURKAIP1	3.441	0.000636	0.034279	11	0.009962	yes	ESPMCS
chr1_1847597_T_C_b38	AURKAIP1	3.419	0.000688	0.035236	9	0.010305	yes	ESPMCS
chr1_1840233_GA_G_b38	AURKAIP1	3.406	0.000723	0.022988	18	0.00675	yes	ESPMCS
chr1_1764895_A_C_b38	AURKAIP1	3.394	0.000753	0.03357	11	0.00989	yes	ESPMCS
chr1_1814797_C_CA_b38	AURKAIP1	3.383	0.000785	0.029095	19	0.008601	yes	ESPMCS
chr1_1862347_A_C_b38	AURKAIP1	3.367	0.00083	0.034325	10	0.010195	yes	ESPMCS
chr1_1864048_A_C_b38	AURKAIP1	3.367	0.00083	0.034325	10	0.010195	yes	ESPMCS
chr1_1870733_A_G_b38	AURKAIP1	3.367	0.00083	0.034325	10	0.010195	yes	ESPMCS
chr1_1874867_A_G_b38	AURKAIP1	3.367	0.00083	0.034325	10	0.010195	yes	ESPMCS
chr1_1880926_CA_C_b38	AURKAIP1	3.367	0.00083	0.034325	10	0.010195	yes	ESPMCS
chr1_1881389_G_A_b38	AURKAIP1	3.367	0.00083	0.034325	10	0.010195	yes	ESPMCS
chr1_1885731_G_A_b38	AURKAIP1	3.367	0.00083	0.034325	10	0.010195	yes	ESPMCS
chr1_1887939_T_C_b38	AURKAIP1	3.367	0.00083	0.034325	10	0.010195	yes	ESPMCS
chr1_1841296_T_C_b38	AURKAIP1	3.365	0.000835	0.034374	10	0.010216	yes	ESPMCS
chr1_1849439_T_C_b38	AURKAIP1	3.365	0.000835	0.034374	10	0.010216	yes	ESPMCS
chr1_1861564_A_G_b38	AURKAIP1	3.365	0.000835	0.034374	10	0.010216	yes	ESPMCS
chr1_1861632_A_G_b38	AURKAIP1	3.365	0.000835	0.034374	10	0.010216	yes	ESPMCS
chr1_1861672_A_G_b38	AURKAIP1	3.365	0.000835	0.034374	10	0.010216	yes	ESPMCS
chr1_1764135_G_T_b38	AURKAIP1	3.298	0.00106	0.032708	10	0.009919	yes	ESPMCS
chr1_1764392_C_T_b38	AURKAIP1	3.298	0.00106	0.032708	10	0.009919	yes	ESPMCS
chr1_1765220_A_G_b38	AURKAIP1	3.298	0.00106	0.032708	10	0.009919	yes	ESPMCS
chr1_1767368_C_G_b38	AURKAIP1	3.298	0.00106	0.032708	10	0.009919	yes	ESPMCS
chr1_1766668_C_T_b38	AURKAIP1	3.22	0.00138	0.031324	11	0.009728	yes	ESPMCS
chr1_1774334_A_G_b38	AURKAIP1	3.216	0.0014	0.032605	9	0.010137	yes	ESPMCS
chr1_1773676_TTGTG_T_b38	AURKAIP1	-3.2	0.00148	-0.038273	3	0.01196	yes	ESPMCS
chr1_1830575_T_C_b38	AURKAIP1	3.173	0.00162	0.033704	7	0.010622	yes	ESPMCS
chr1_1902056_G_A_b38	AURKAIP1	3.168	0.00164	0.01987	31	0.006272	yes	ESPMCS
chr1_1848356_GC_G_b38	AURKAIP1	3.159	0.0017	0.023592	15	0.007469	yes	ESPMCS
chr1_1762664_A_G_b38	AURKAIP1	3.136	0.00183	0.031802	10	0.01014	yes	ESPMCS
chr1_1757030_C_G_b38	AURKAIP1	3.099	0.00207	0.029663	10	0.009571	yes	ESPMCS
chr1_1821516_C_T_b38	AURKAIP1	3.091	0.00212	0.030672	10	0.009922	yes	ESPMCS
chr1_1753774_C_G_b38	AURKAIP1	3.079	0.00221	0.029601	10	0.009614	yes	ESPMCS
chr1_1837221_C_G_b38	AURKAIP1	3.074	0.00225	0.030819	10	0.010025	yes	ESPMCS
chr1_1774697_T_C_b38	AURKAIP1	3.049	0.00244	0.031354	9	0.010284	yes	ESPMCS
chr1_1900918_G_A_b38	AURKAIP1	3.028	0.00261	0.019364	27	0.006395	yes	ESPMCS
chr1_1812038_G_C_b38	AURKAIP1	3.021	0.00267	0.029999	10	0.009929	yes	ESPMCS
chr1_1805416_A_G_b38	AURKAIP1	3.018	0.0027	0.029969	9	0.009931	yes	ESPMCS
chr1_1814717_A_G_b38	AURKAIP1	3.01	0.00277	0.030554	9	0.010152	yes	ESPMCS
chr1_1773215_C_A_b38	AURKAIP1	3.004	0.00282	0.019358	28	0.006445	yes	ESPMCS
chr1_1795751_T_TCAAAAAAA_b38	AURKAIP1	3.001	0.00285	0.030224	9	0.01007	yes	ESPMCS
chr1_1767762_C_A_b38	AURKAIP1	2.978	0.00306	0.019232	28	0.006457	yes	ESPMCS
chr1_1774308_G_A_b38	AURKAIP1	2.978	0.00306	0.019232	28	0.006457	yes	ESPMCS
chr1_1827587_T_C_b38	AURKAIP1	2.961	0.00324	0.030798	9	0.0104	yes	ESPMCS
chr1_1829550_A_C_b38	AURKAIP1	2.961	0.00324	0.030798	9	0.0104	yes	ESPMCS
chr1_1829897_A_C_b38	AURKAIP1	2.961	0.00324	0.030798	9	0.0104	yes	ESPMCS
chr1_1834144_T_C_b38	AURKAIP1	2.961	0.00324	0.030798	9	0.0104	yes	ESPMCS
chr1_1834920_A_G_b38	AURKAIP1	2.961	0.00324	0.030798	9	0.0104	yes	ESPMCS
chr1_1838619_T_C_b38	AURKAIP1	2.961	0.00324	0.030798	9	0.0104	yes	ESPMCS
chr1_1931743_CA_C_b38	AURKAIP1	-2.959	0.00326	-0.02009	38	0.006789	yes	ESPMCS
chr1_1907199_A_G_b38	AURKAIP1	2.945	0.00341	0.018733	28	0.006362	yes	ESPMCS
chr1_1866635_T_TA_b38	AURKAIP1	2.91	0.0038	0.017898	61	0.00615	yes	ESPMCS
chr1_1881428_C_T_b38	AURKAIP1	2.909	0.00382	0.018972	26	0.006523	yes	ESPMCS
chr1_1837455_C_T_b38	AURKAIP1	2.88	0.00418	0.01885	25	0.006546	yes	ESPMCS
chr1_1851762_G_A_b38	AURKAIP1	2.88	0.00418	0.01885	25	0.006546	yes	ESPMCS
chr1_1839349_C_G_b38	AURKAIP1	2.872	0.00429	0.018712	28	0.006516	yes	ESPMCS
chr1_1839350_T_A_b38	AURKAIP1	2.872	0.00429	0.018712	28	0.006516	yes	ESPMCS
chr1_1851181_C_T_b38	AURKAIP1	2.872	0.00429	0.018712	28	0.006516	yes	ESPMCS
chr1_1906439_C_T_b38	AURKAIP1	2.863	0.00441	0.017823	32	0.006226	yes	ESPMCS
chr1_1773725_T_A_b38	AURKAIP1	2.862	0.00442	0.016646	62	0.005816	yes	ESPMCS
chr1_1773727_T_A_b38	AURKAIP1	2.853	0.00454	0.016803	58	0.005889	yes	ESPMCS
chr1_2051689_A_T_b38	AURKAIP1	2.838	0.00475	0.01611	74	0.005676	yes	ESPMCS
chr1_1456891_T_C_b38	AURKAIP1	2.832	0.00485	0.017911	38	0.006326	yes	ESPMCS
chr1_1774165_A_G_b38	AURKAIP1	2.821	0.00502	0.018481	25	0.006552	yes	ESPMCS
chr1_2051769_C_T_b38	AURKAIP1	2.816	0.00509	0.015982	83	0.005675	yes	ESPMCS
chr1_1827615_G_A_b38	AURKAIP1	2.811	0.00516	0.018333	25	0.006522	yes	ESPMCS
chr1_1909237_G_T_b38	AURKAIP1	2.805	0.00527	0.01761	32	0.006278	yes	ESPMCS
chr1_1842226_T_C_b38	AURKAIP1	2.796	0.00541	0.017978	30	0.00643	yes	ESPMCS
chr1_1897682_CA_C_b38	AURKAIP1	2.792	0.00547	0.01944	15	0.006963	yes	ESPMCS
chr1_1152615_A_ACATGACCCAGCTCTATCATCCCATCAGGGATCCAGG_b38	AURKAIP1	-2.785	0.00559	-0.039972	4	0.014354	yes	ESPMCS
chr1_1729196_T_G_b38	AURKAIP1	2.78	0.00568	0.025416	13	0.009143	yes	ESPMCS
chr1_1805214_T_G_b38	AURKAIP1	2.78	0.00568	0.018004	26	0.006477	yes	ESPMCS
chr1_1834655_A_C_b38	AURKAIP1	2.78	0.00568	0.018004	26	0.006477	yes	ESPMCS
chr1_1903603_G_A_b38	AURKAIP1	2.778	0.00571	0.018048	25	0.006496	yes	ESPMCS
chr1_1903617_C_T_b38	AURKAIP1	2.778	0.00571	0.018048	25	0.006496	yes	ESPMCS
chr1_1773729_T_A_b38	AURKAIP1	2.778	0.00571	0.016894	47	0.006081	yes	ESPMCS
chr1_928210_G_A_b38	AURKAIP1	2.777	0.00573	0.024425	4	0.008796	yes	ESPMCS
chr1_1903309_A_G_b38	AURKAIP1	2.775	0.00577	0.017742	54	0.006394	yes	ESPMCS
chr1_1842221_C_G_b38	AURKAIP1	2.773	0.00581	0.017915	31	0.006462	yes	ESPMCS
chr1_731666_G_A_b38	AURKAIP1	2.77	0.00586	0.027125	3	0.009794	yes	ESPMCS
chr1_2051982_T_C_b38	AURKAIP1	2.764	0.00596	0.015751	77	0.005699	yes	ESPMCS
chr1_1794321_C_T_b38	AURKAIP1	2.758	0.00606	0.017918	26	0.006496	yes	ESPMCS
chr1_1803531_C_T_b38	AURKAIP1	2.751	0.0062	0.017791	29	0.006467	yes	ESPMCS
chr1_1830566_A_T_b38	AURKAIP1	2.751	0.0062	0.017791	29	0.006467	yes	ESPMCS
chr1_1152614_G_GGCTCTCC_b38	AURKAIP1	-2.731	0.00657	-0.039072	4	0.014305	yes	ESPMCS
chr1_1842237_T_C_b38	AURKAIP1	2.726	0.00668	0.017311	32	0.006351	yes	ESPMCS
chr1_1773723_T_A_b38	AURKAIP1	2.718	0.00684	0.015864	61	0.005837	yes	ESPMCS
chr1_1739915_G_A_b38	AURKAIP1	2.707	0.00705	0.022583	20	0.008341	yes	ESPMCS
chr1_928622_G_C_b38	AURKAIP1	2.707	0.00706	0.018316	21	0.006766	yes	ESPMCS
chr1_2302601_CAGG_C_b38	AURKAIP1	-2.702	0.00716	-0.021549	9	0.007975	yes	ESPMCS
chr1_2303193_G_A_b38	AURKAIP1	-2.702	0.00716	-0.021549	9	0.007975	yes	ESPMCS
chr1_1842333_G_A_b38	AURKAIP1	2.685	0.00754	0.017285	30	0.006438	yes	ESPMCS
chr1_1873952_G_A_b38	AURKAIP1	2.671	0.00784	0.017156	30	0.006422	yes	ESPMCS
chr1_1878651_C_T_b38	AURKAIP1	2.671	0.00784	0.017156	30	0.006422	yes	ESPMCS
chr1_1907077_C_A_b38	AURKAIP1	2.671	0.00785	0.017985	24	0.006733	yes	ESPMCS
chr1_1888667_A_C_b38	AURKAIP1	2.666	0.00798	0.017177	27	0.006444	yes	ESPMCS
chr1_1890186_G_A_b38	AURKAIP1	2.654	0.00826	0.017062	30	0.00643	yes	ESPMCS
chr1_1885444_TTAGA_T_b38	AURKAIP1	2.644	0.00848	0.016983	28	0.006422	yes	ESPMCS
chr1_1740427_A_T_b38	AURKAIP1	2.638	0.00865	0.024187	14	0.009169	yes	ESPMCS
chr1_1762759_AAATG_A_b38	AURKAIP1	2.633	0.00878	0.0147	99	0.005584	yes	ESPMCS
chr1_928223_T_A_b38	AURKAIP1	2.629	0.00888	0.024368	3	0.009269	yes	ESPMCS
chr1_1572877_TG_T_b38	AURKAIP1	2.618	0.00916	0.017399	26	0.006646	yes	ESPMCS
chr1_789680_A_AGGAATGGAATGGAAT_b38	AURKAIP1	2.611	0.00934	0.015684	45	0.006007	yes	ESPMCS
chr1_1532798_T_C_b38	AURKAIP1	2.605	0.00951	0.015142	131	0.005812	yes	ESPMCS
chr1_1452540_G_A_b38	AURKAIP1	2.603	0.00956	0.018445	21	0.007086	yes	ESPMCS
chr1_1905247_C_G_b38	AURKAIP1	2.588	0.00999	0.028499	3	0.011013	yes	ESPMCS
chr1_1428999_C_CA_b38	AURKAIP1	3.764	0.000191	0.025771	23	0.006847	no	ESPMCS
chr1_1825782_G_A_b38	AURKAIP1	-3.354	0.000869	-0.038357	5	0.011437	no	ESPMCS
chr1_1890770_C_T_b38	AURKAIP1	3.24	0.00129	0.020359	35	0.006284	no	ESPMCS
chr1_1809189_AT_A_b38	AURKAIP1	3.237	0.0013	0.023694	80	0.00732	no	ESPMCS
chr1_1749605_C_CGTCCATGCATATTTTTCTGTGTGATGTGTCTGTGTGTGTGTCTCAGTGGT_b38	AURKAIP1	3.236	0.00131	0.016192	51	0.005003	no	ESPMCS
chr1_1802763_T_TAA_b38	AURKAIP1	3.206	0.00145	0.022517	17	0.007024	no	ESPMCS
chr1_1769737_GA_G_b38	AURKAIP1	3.204	0.00146	0.021717	20	0.006779	no	ESPMCS
chr1_1308549_G_T_b38	AURKAIP1	-3.139	0.00181	-0.016161	135	0.005149	no	ESPMCS
chr1_1848358_A_T_b38	AURKAIP1	3.072	0.00226	0.023015	15	0.007491	no	ESPMCS
chr1_1793064_C_CA_b38	AURKAIP1	3	0.00286	0.019986	27	0.006662	no	ESPMCS
chr1_935431_G_A_b38	AURKAIP1	2.965	0.0032	0.049617	4	0.016737	no	ESPMCS
chr1_1776301_T_G_b38	AURKAIP1	2.946	0.00339	0.018944	28	0.00643	no	ESPMCS
chr1_1949125_T_TTCCC_b38	AURKAIP1	2.935	0.00352	0.023061	13	0.007858	no	ESPMCS
chr1_1758687_A_AAC_b38	AURKAIP1	2.921	0.00367	0.027733	13	0.009493	no	ESPMCS
chr1_1864350_C_T_b38	AURKAIP1	2.921	0.00368	0.018457	31	0.00632	no	ESPMCS
chr1_1852145_G_A_b38	AURKAIP1	2.902	0.0039	0.018865	26	0.006501	no	ESPMCS
chr1_2304217_G_A_b38	AURKAIP1	-2.898	0.00395	-0.026019	3	0.008978	no	ESPMCS
chr1_861131_C_G_b38	AURKAIP1	-2.88	0.00418	-0.028159	5	0.009778	no	ESPMCS
chr1_1783572_C_A_b38	AURKAIP1	2.869	0.00432	0.018682	26	0.006511	no	ESPMCS
chr1_1868514_T_C_b38	AURKAIP1	2.853	0.00455	0.031501	5	0.011043	no	ESPMCS
chr1_1808642_TTTTG_T_b38	AURKAIP1	2.833	0.00483	0.018303	29	0.006461	no	ESPMCS
chr1_1925075_G_A_b38	AURKAIP1	-2.82	0.00503	-0.03117	8	0.011053	no	ESPMCS
chr1_1897325_G_A_b38	AURKAIP1	2.818	0.00506	0.019106	19	0.00678	no	ESPMCS
chr1_1836856_CT_C_b38	AURKAIP1	2.812	0.00515	0.020321	24	0.007227	no	ESPMCS
chr1_1869595_G_A_b38	AURKAIP1	2.801	0.00533	0.018219	26	0.006505	no	ESPMCS
chr1_868710_C_T_b38	AURKAIP1	-2.783	0.00562	-0.034128	3	0.012261	no	ESPMCS
chr1_1782430_T_G_b38	AURKAIP1	2.77	0.00584	0.017849	27	0.006443	no	ESPMCS
chr1_1936906_CA_C_b38	AURKAIP1	2.752	0.00617	0.019164	14	0.006963	no	ESPMCS
chr1_1891450_G_A_b38	AURKAIP1	2.751	0.00619	0.017562	31	0.006383	no	ESPMCS
chr1_1780791_C_T_b38	AURKAIP1	2.748	0.00624	0.01776	27	0.006462	no	ESPMCS
chr1_1923880_C_T_b38	AURKAIP1	-2.733	0.00653	-0.029962	8	0.010962	no	ESPMCS
chr1_1865951_T_A_b38	AURKAIP1	2.716	0.00688	0.017869	25	0.00658	no	ESPMCS
chr1_1157295_AGCCCACCCATCCCGCCCCCAGCCCACCCATCCCATCCCC_A_b38	AURKAIP1	2.703	0.00716	0.012073	76	0.004467	no	ESPMCS
chr1_1842213_A_G_b38	AURKAIP1	2.697	0.00728	0.017502	30	0.00649	no	ESPMCS
chr1_1878070_C_T_b38	AURKAIP1	2.675	0.00777	0.017231	27	0.006442	no	ESPMCS
chr1_1881006_GGA_G_b38	AURKAIP1	2.675	0.00777	0.017231	27	0.006442	no	ESPMCS
chr1_907538_T_TAA_b38	AURKAIP1	-2.665	0.008	-0.036822	4	0.013819	no	ESPMCS
chr1_1912983_T_C_b38	AURKAIP1	2.651	0.00832	0.016398	35	0.006185	no	ESPMCS
chr1_1879682_G_A_b38	AURKAIP1	2.647	0.00842	0.017017	30	0.006428	no	ESPMCS
chr1_1737789_T_C_b38	AURKAIP1	2.636	0.0087	0.024152	9	0.009163	no	ESPMCS
chr1_1923278_C_T_b38	AURKAIP1	-2.615	0.00924	-0.02866	8	0.01096	no	ESPMCS
chr1_509894_T_G_b38	AURKAIP1	2.61	0.00936	0.019451	11	0.007451	no	ESPMCS
chr1_1923107_C_T_b38	AURKAIP1	-2.598	0.00969	-0.028695	8	0.011044	no	ESPMCS
chr1_1925663_A_G_b38	AURKAIP1	-2.598	0.00969	-0.028695	8	0.011044	no	ESPMCS
chr1_1926722_C_T_b38	AURKAIP1	-2.598	0.00969	-0.028695	8	0.011044	no	ESPMCS
chr1_1928702_C_T_b38	AURKAIP1	-2.598	0.00969	-0.028695	8	0.011044	no	ESPMCS
chr1_2040323_A_G_b38	AURKAIP1	3.296	0.00107	0.033239	7	0.010085	yes	ESPMSL
chr1_2040432_T_A_b38	AURKAIP1	3.24	0.0013	0.033879	5	0.010456	yes	ESPMSL
chr1_2124387_G_A_b38	AURKAIP1	2.926	0.00364	0.04291	8	0.014667	yes	ESPMSL
chr1_1500745_A_C_b38	AURKAIP1	2.752	0.0062	0.031228	38	0.011349	yes	ESPMSL
chr1_1530585_T_G_b38	AURKAIP1	2.646	0.00847	0.048389	5	0.018287	yes	ESPMSL
chr1_1285574_G_A_b38	AURKAIP1	2.637	0.00869	0.033695	26	0.012777	yes	ESPMSL
chr1_1284756_A_G_b38	AURKAIP1	2.619	0.00916	0.032346	29	0.012351	yes	ESPMSL
chr1_2043456_T_C_b38	AURKAIP1	2.592	0.00991	0.029025	3	0.011199	yes	ESPMSL
chr1_1349974_T_C_b38	AURKAIP1	3.884	0.000121	0.09215	3	0.023727	no	ESPMSL
chr1_1039411_T_TGG_b38	AURKAIP1	-2.79	0.00553	-0.018895	81	0.006772	no	ESPMSL
chr1_893791_AAAAAAAAAAAATATATATATATATATATATATATAT_A_b38	AURKAIP1	2.746	0.00631	0.042057	3	0.015316	no	ESPMSL
chr1_2370032_C_G_b38	AURKAIP1	2.667	0.00797	0.023243	13	0.008715	no	ESPMSL
chr1_1691417_T_C_b38	AURKAIP1	3.321	0.00101	0.047754	68	0.014379	yes	HRTAA
chr1_621475_C_T_b38	AURKAIP1	3.303	0.00107	0.119021	4	0.03603	yes	HRTAA
chr1_1689446_T_C_b38	AURKAIP1	-3.209	0.00147	-0.045309	52	0.014117	yes	HRTAA
chr1_1688570_A_T_b38	AURKAIP1	-3.193	0.00156	-0.059307	9	0.018576	yes	HRTAA
chr1_1547458_A_G_b38	AURKAIP1	3.172	0.00167	0.125618	5	0.039605	yes	HRTAA
chr1_1546862_A_AC_b38	AURKAIP1	3.138	0.00187	0.113081	3	0.036035	yes	HRTAA
chr1_1689421_G_A_b38	AURKAIP1	-3.112	0.00204	-0.044049	51	0.014156	yes	HRTAA
chr1_1691377_C_T_b38	AURKAIP1	3.057	0.00244	0.046071	36	0.01507	yes	HRTAA
chr1_1680672_C_T_b38	AURKAIP1	-3.022	0.00273	-0.044656	66	0.014777	yes	HRTAA
chr1_2304900_T_C_b38	AURKAIP1	-2.952	0.0034	-0.053458	11	0.018107	yes	HRTAA
chr1_1714932_G_T_b38	AURKAIP1	2.942	0.00352	0.039028	81	0.013267	yes	HRTAA
chr1_1689465_A_G_b38	AURKAIP1	-2.941	0.00353	-0.04004	61	0.013616	yes	HRTAA
chr1_1696366_A_C_b38	AURKAIP1	2.929	0.00366	0.039508	65	0.013489	yes	HRTAA
chr1_1697467_G_A_b38	AURKAIP1	2.92	0.00377	0.040856	57	0.013993	yes	HRTAA
chr1_1705816_A_G_b38	AURKAIP1	2.911	0.00388	0.036172	87	0.012427	yes	HRTAA
chr1_1546962_G_A_b38	AURKAIP1	2.905	0.00395	0.108658	8	0.037408	yes	HRTAA
chr1_1720192_T_G_b38	AURKAIP1	2.902	0.00398	0.04002	99	0.013792	yes	HRTAA
chr1_1696117_G_A_b38	AURKAIP1	2.899	0.00401	0.039429	64	0.013599	yes	HRTAA
chr1_2302601_CAGG_C_b38	AURKAIP1	-2.89	0.00413	-0.054771	10	0.01895	yes	HRTAA
chr1_2303193_G_A_b38	AURKAIP1	-2.89	0.00413	-0.054771	10	0.01895	yes	HRTAA
chr1_1704835_C_T_b38	AURKAIP1	2.89	0.00413	0.039546	99	0.013683	yes	HRTAA
chr1_1706067_ACT_A_b38	AURKAIP1	2.885	0.00419	0.039804	98	0.013796	yes	HRTAA
chr1_1688586_C_T_b38	AURKAIP1	-2.882	0.00423	-0.050772	20	0.017616	yes	HRTAA
chr1_1695747_C_T_b38	AURKAIP1	2.873	0.00435	0.045291	62	0.015761	yes	HRTAA
chr1_1687734_CAA_C_b38	AURKAIP1	-2.869	0.00441	-0.043441	39	0.015143	yes	HRTAA
chr1_1715838_C_T_b38	AURKAIP1	2.853	0.00464	0.039375	103	0.013803	yes	HRTAA
chr1_1705856_G_A_b38	AURKAIP1	2.825	0.00505	0.036109	118	0.012782	yes	HRTAA
chr1_1696758_A_G_b38	AURKAIP1	2.801	0.00543	0.038485	60	0.013741	yes	HRTAA
chr1_1694167_G_A_b38	AURKAIP1	2.776	0.00586	0.037568	64	0.013535	yes	HRTAA
chr1_1687236_T_G_b38	AURKAIP1	-2.757	0.00618	-0.039648	56	0.014379	yes	HRTAA
chr1_1706566_G_C_b38	AURKAIP1	2.73	0.00671	0.0392	54	0.01436	yes	HRTAA
chr1_1801780_A_G_b38	AURKAIP1	-2.72	0.0069	-0.042184	42	0.015508	yes	HRTAA
chr1_1704180_T_C_b38	AURKAIP1	2.714	0.00703	0.038871	54	0.014322	yes	HRTAA
chr1_1704605_G_A_b38	AURKAIP1	2.681	0.00774	0.03863	54	0.014407	yes	HRTAA
chr1_1705867_T_C_b38	AURKAIP1	2.675	0.00788	0.033119	95	0.012381	yes	HRTAA
chr1_1686147_T_G_b38	AURKAIP1	-2.672	0.00794	-0.038585	56	0.014438	yes	HRTAA
chr1_1703565_T_C_b38	AURKAIP1	2.668	0.00803	0.038535	53	0.014441	yes	HRTAA
chr1_1694109_A_ACG_b38	AURKAIP1	2.646	0.00857	0.035611	66	0.013459	yes	HRTAA
chr1_1743565_AT_A_b38	AURKAIP1	2.637	0.00881	0.033292	98	0.012627	yes	HRTAA
chr1_1681928_C_A_b38	AURKAIP1	-2.625	0.0091	-0.037791	57	0.014396	yes	HRTAA
chr1_1681370_T_G_b38	AURKAIP1	-2.601	0.00976	-0.050154	12	0.019285	yes	HRTAA
chr1_1374801_A_G_b38	AURKAIP1	-3.071	0.00233	-0.088605	5	0.028857	no	HRTAA
chr1_632487_A_G_b38	AURKAIP1	2.947	0.00346	0.087031	10	0.029534	no	HRTAA
chr1_1992068_C_T_b38	AURKAIP1	2.838	0.00486	0.097678	6	0.034424	no	HRTAA
chr1_2043528_G_A_b38	AURKAIP1	2.744	0.00644	0.058816	11	0.021438	no	HRTAA
chr1_2189679_C_T_b38	AURKAIP1	-2.723	0.00685	-0.039591	46	0.014541	no	HRTAA
chr1_2285267_C_G_b38	AURKAIP1	2.71	0.00712	0.066388	4	0.024501	no	HRTAA
chr1_1306183_A_G_b38	AURKAIP1	-2.663	0.00815	-0.115364	3	0.043316	no	HRTAA
chr1_1320653_C_T_b38	AURKAIP1	-2.663	0.00815	-0.115364	3	0.043316	no	HRTAA
chr1_1584235_A_AT_b38	AURKAIP1	-2.957	0.00334	-0.040797	66	0.013798	yes	HRTLV
chr1_1600320_C_G_b38	AURKAIP1	2.927	0.00368	0.041427	36	0.014155	yes	HRTLV
chr1_973693_C_T_b38	AURKAIP1	-2.89	0.00412	-0.038845	62	0.013441	yes	HRTLV
chr1_1607931_G_A_b38	AURKAIP1	2.842	0.00477	0.03981	38	0.014006	yes	HRTLV
chr1_1609058_G_A_b38	AURKAIP1	2.842	0.00478	0.039719	38	0.013977	yes	HRTLV
chr1_1312208_G_T_b38	AURKAIP1	-2.842	0.00478	-0.097163	4	0.034194	yes	HRTLV
chr1_1606559_C_G_b38	AURKAIP1	-2.782	0.00572	-0.041209	33	0.014811	yes	HRTLV
chr1_1612562_T_TC_b38	AURKAIP1	2.737	0.00655	0.038965	36	0.014236	yes	HRTLV
chr1_1265603_T_TTG_b38	AURKAIP1	-2.734	0.00661	-0.047821	9	0.01749	yes	HRTLV
chr1_1621352_G_A_b38	AURKAIP1	2.7	0.0073	0.038205	38	0.014149	yes	HRTLV
chr1_1184478_C_T_b38	AURKAIP1	-2.687	0.00758	-0.059965	21	0.022313	yes	HRTLV
chr1_1600379_C_T_b38	AURKAIP1	2.685	0.00764	0.037604	38	0.014006	yes	HRTLV
chr1_1362790_A_ATT_b38	AURKAIP1	2.678	0.00779	0.053221	8	0.019871	yes	HRTLV
chr1_1622295_G_C_b38	AURKAIP1	2.624	0.00911	0.037047	38	0.014118	yes	HRTLV
chr1_1578879_A_T_b38	AURKAIP1	-2.612	0.00943	-0.07435	4	0.028462	yes	HRTLV
chr1_1042813_G_A_b38	AURKAIP1	2.593	0.00997	0.046735	10	0.018027	yes	HRTLV
chr1_618877_G_A_b38	AURKAIP1	3.245	0.0013	0.091467	3	0.028183	no	HRTLV
chr1_1190043_C_T_b38	AURKAIP1	-3.165	0.0017	-0.073609	3	0.023254	no	HRTLV
chr1_1605792_C_G_b38	AURKAIP1	-3.1	0.00211	-0.081943	4	0.026435	no	HRTLV
chr1_1203533_T_C_b38	AURKAIP1	-3	0.00291	-0.074835	7	0.024944	no	HRTLV
chr1_1203822_T_C_b38	AURKAIP1	-3	0.00291	-0.074835	7	0.024944	no	HRTLV
chr1_1208038_T_C_b38	AURKAIP1	-2.98	0.00311	-0.074652	10	0.025053	no	HRTLV
chr1_1605794_G_C_b38	AURKAIP1	-2.975	0.00316	-0.078796	5	0.026489	no	HRTLV
chr1_1190394_C_G_b38	AURKAIP1	-2.934	0.00359	-0.068868	3	0.023475	no	HRTLV
chr1_1589491_A_G_b38	AURKAIP1	-2.719	0.0069	-0.037394	52	0.013751	no	HRTLV
chr1_1589418_T_TA_b38	AURKAIP1	2.674	0.00789	0.038422	55	0.014369	no	HRTLV
chr1_1650383_G_T_b38	AURKAIP1	-2.658	0.00826	-0.039495	31	0.014859	no	HRTLV
chr1_1041119_GGGC_G_b38	AURKAIP1	-2.595	0.00989	-0.028329	29	0.010915	no	HRTLV
chr1_1411847_TCCAGGTC_T_b38	AURKAIP1	-2.595	0.0099	-0.069717	9	0.026866	no	HRTLV
chr1_2022137_G_A_b38	AURKAIP1	3.515	0.000986	0.140405	8	0.03995	yes	KDNCTX
chr1_2004141_A_C_b38	AURKAIP1	-3.445	0.00121	-0.159473	4	0.046291	yes	KDNCTX
chr1_1744854_C_A_b38	AURKAIP1	3.287	0.00192	0.126548	8	0.038504	yes	KDNCTX
chr1_984121_G_T_b38	AURKAIP1	-3.214	0.00237	-0.129118	22	0.040176	yes	KDNCTX
chr1_1971123_A_G_b38	AURKAIP1	-3.18	0.00261	-0.169767	6	0.053382	yes	KDNCTX
chr1_1971127_G_A_b38	AURKAIP1	-3.18	0.00261	-0.169767	6	0.053382	yes	KDNCTX
chr1_1971434_C_T_b38	AURKAIP1	-3.18	0.00261	-0.169767	6	0.053382	yes	KDNCTX
chr1_2047887_T_C_b38	AURKAIP1	-3.168	0.0027	-0.132882	12	0.041951	yes	KDNCTX
chr1_2051703_C_T_b38	AURKAIP1	-3.152	0.00282	-0.138592	10	0.043973	yes	KDNCTX
chr1_1971027_A_C_b38	AURKAIP1	-3.129	0.00301	-0.169129	6	0.054057	yes	KDNCTX
chr1_1972273_C_A_b38	AURKAIP1	-3.111	0.00317	-0.16364	8	0.052601	yes	KDNCTX
chr1_2047418_A_G_b38	AURKAIP1	-3.096	0.0033	-0.129887	16	0.041954	yes	KDNCTX
chr1_1983989_A_AT_b38	AURKAIP1	-3.057	0.00368	-0.173216	5	0.056663	yes	KDNCTX
chr1_1986752_A_G_b38	AURKAIP1	-2.96	0.0048	-0.142597	14	0.048168	yes	KDNCTX
chr1_1987049_A_G_b38	AURKAIP1	-2.96	0.0048	-0.142597	14	0.048168	yes	KDNCTX
chr1_1971864_C_T_b38	AURKAIP1	-2.935	0.00514	-0.121633	15	0.041435	yes	KDNCTX
chr1_2342999_A_G_b38	AURKAIP1	2.865	0.00621	0.142443	4	0.049714	yes	KDNCTX
chr1_975555_G_A_b38	AURKAIP1	2.855	0.00639	0.133685	7	0.046825	yes	KDNCTX
chr1_1978429_G_A_b38	AURKAIP1	-2.762	0.00817	-0.14399	7	0.052133	yes	KDNCTX
chr1_1983507_C_T_b38	AURKAIP1	-2.762	0.00817	-0.14399	7	0.052133	yes	KDNCTX
chr1_1688102_G_A_b38	AURKAIP1	2.747	0.00849	0.132578	4	0.048257	yes	KDNCTX
chr1_1976473_C_T_b38	AURKAIP1	-2.74	0.00866	-0.141949	9	0.051809	yes	KDNCTX
chr1_1976573_T_C_b38	AURKAIP1	-2.74	0.00866	-0.141949	9	0.051809	yes	KDNCTX
chr1_1976600_C_T_b38	AURKAIP1	-2.74	0.00866	-0.141949	9	0.051809	yes	KDNCTX
chr1_1976646_A_G_b38	AURKAIP1	-2.74	0.00866	-0.141949	9	0.051809	yes	KDNCTX
chr1_1976661_G_T_b38	AURKAIP1	-2.74	0.00866	-0.141949	9	0.051809	yes	KDNCTX
chr1_1976946_C_T_b38	AURKAIP1	-2.74	0.00866	-0.141949	9	0.051809	yes	KDNCTX
chr1_1977264_C_G_b38	AURKAIP1	-2.74	0.00866	-0.141949	9	0.051809	yes	KDNCTX
chr1_1977765_A_G_b38	AURKAIP1	-2.74	0.00866	-0.141949	9	0.051809	yes	KDNCTX
chr1_1977879_G_A_b38	AURKAIP1	-2.74	0.00866	-0.141949	9	0.051809	yes	KDNCTX
chr1_1978006_A_G_b38	AURKAIP1	-2.74	0.00866	-0.141949	9	0.051809	yes	KDNCTX
chr1_1978055_C_T_b38	AURKAIP1	-2.74	0.00866	-0.141949	9	0.051809	yes	KDNCTX
chr1_1978114_T_A_b38	AURKAIP1	-2.74	0.00866	-0.141949	9	0.051809	yes	KDNCTX
chr1_1978404_C_T_b38	AURKAIP1	-2.74	0.00866	-0.141949	9	0.051809	yes	KDNCTX
chr1_1978415_G_A_b38	AURKAIP1	-2.74	0.00866	-0.141949	9	0.051809	yes	KDNCTX
chr1_1978647_G_T_b38	AURKAIP1	-2.74	0.00866	-0.141949	9	0.051809	yes	KDNCTX
chr1_1980953_G_A_b38	AURKAIP1	-2.74	0.00866	-0.141949	9	0.051809	yes	KDNCTX
chr1_1981319_G_C_b38	AURKAIP1	-2.74	0.00866	-0.141949	9	0.051809	yes	KDNCTX
chr1_1983166_A_T_b38	AURKAIP1	-2.74	0.00866	-0.141949	9	0.051809	yes	KDNCTX
chr1_1983956_TGG_T_b38	AURKAIP1	-2.74	0.00866	-0.141949	9	0.051809	yes	KDNCTX
chr1_1984859_C_T_b38	AURKAIP1	-2.74	0.00866	-0.141949	9	0.051809	yes	KDNCTX
chr1_1985148_G_T_b38	AURKAIP1	-2.74	0.00866	-0.141949	9	0.051809	yes	KDNCTX
chr1_1986033_G_A_b38	AURKAIP1	-2.74	0.00866	-0.141949	9	0.051809	yes	KDNCTX
chr1_1986176_A_T_b38	AURKAIP1	-2.74	0.00866	-0.141949	9	0.051809	yes	KDNCTX
chr1_1986211_T_C_b38	AURKAIP1	-2.74	0.00866	-0.141949	9	0.051809	yes	KDNCTX
chr1_1986390_T_G_b38	AURKAIP1	-2.74	0.00866	-0.141949	9	0.051809	yes	KDNCTX
chr1_1986469_A_C_b38	AURKAIP1	-2.74	0.00866	-0.141949	9	0.051809	yes	KDNCTX
chr1_1987096_A_T_b38	AURKAIP1	-2.74	0.00866	-0.141949	9	0.051809	yes	KDNCTX
chr1_1987156_G_A_b38	AURKAIP1	-2.74	0.00866	-0.141949	9	0.051809	yes	KDNCTX
chr1_1955806_G_A_b38	AURKAIP1	-3.214	0.00237	-0.184635	3	0.057451	no	KDNCTX
chr1_2142322_CAGCAGCCGAAGCGCCTCCTTTCAATCCAGGGTCCACACATCCAGCAGCCGAAGCGCCCTCCTTTCAATCCAGGGTCCAGGCATCT_C_b38	AURKAIP1	3.005	0.00425	0.193746	3	0.064483	no	KDNCTX
chr1_1897325_G_A_b38	AURKAIP1	-2.985	0.00449	-0.160957	3	0.053926	no	KDNCTX
chr1_1976566_T_C_b38	AURKAIP1	-2.928	0.00524	-0.120415	16	0.04112	no	KDNCTX
chr1_2346111_G_C_b38	AURKAIP1	2.717	0.00919	0.103244	19	0.037997	no	KDNCTX
chr1_2148243_A_G_b38	AURKAIP1	3.982	0.000102	0.086517	9	0.021727	yes	LIVER
chr1_2117367_GT_G_b38	AURKAIP1	3.687	0.000306	0.080785	9	0.02191	yes	LIVER
chr1_2111641_T_G_b38	AURKAIP1	3.626	0.000382	0.073221	15	0.020192	yes	LIVER
chr1_2112691_GTT_G_b38	AURKAIP1	3.516	0.000564	0.071916	15	0.020452	yes	LIVER
chr1_2110474_G_GGGT_b38	AURKAIP1	3.502	0.000591	0.071633	15	0.020452	yes	LIVER
chr1_2112353_G_A_b38	AURKAIP1	3.502	0.000591	0.071633	15	0.020452	yes	LIVER
chr1_2112696_T_G_b38	AURKAIP1	3.502	0.000591	0.071633	15	0.020452	yes	LIVER
chr1_2114437_G_A_b38	AURKAIP1	3.502	0.000591	0.071633	15	0.020452	yes	LIVER
chr1_2114447_G_T_b38	AURKAIP1	3.502	0.000591	0.071633	15	0.020452	yes	LIVER
chr1_2121074_A_G_b38	AURKAIP1	3.502	0.000591	0.071633	15	0.020452	yes	LIVER
chr1_2127141_G_C_b38	AURKAIP1	3.502	0.000591	0.071633	15	0.020452	yes	LIVER
chr1_2127704_G_A_b38	AURKAIP1	3.502	0.000591	0.071633	15	0.020452	yes	LIVER
chr1_2131710_C_T_b38	AURKAIP1	3.502	0.000591	0.071633	15	0.020452	yes	LIVER
chr1_2337239_T_C_b38	AURKAIP1	3.472	0.000659	0.070484	18	0.020303	yes	LIVER
chr1_2158087_G_A_b38	AURKAIP1	3.213	0.00158	0.066515	16	0.020703	yes	LIVER
chr1_2129293_C_T_b38	AURKAIP1	-3.154	0.00191	-0.059495	35	0.018866	yes	LIVER
chr1_2333737_T_C_b38	AURKAIP1	3.128	0.00208	0.059388	25	0.018988	yes	LIVER
chr1_2110022_C_T_b38	AURKAIP1	-3.123	0.00211	-0.057825	37	0.018516	yes	LIVER
chr1_2134510_C_T_b38	AURKAIP1	3.118	0.00214	0.064467	15	0.020676	yes	LIVER
chr1_2134519_C_T_b38	AURKAIP1	3.118	0.00214	0.064467	15	0.020676	yes	LIVER
chr1_2326288_C_T_b38	AURKAIP1	3.101	0.00226	0.058047	27	0.018717	yes	LIVER
chr1_2326424_C_T_b38	AURKAIP1	3.101	0.00226	0.058047	27	0.018717	yes	LIVER
chr1_2326884_C_T_b38	AURKAIP1	3.101	0.00226	0.058047	27	0.018717	yes	LIVER
chr1_2172996_C_T_b38	AURKAIP1	3.073	0.00248	0.062021	17	0.020183	yes	LIVER
chr1_2173542_A_G_b38	AURKAIP1	3.073	0.00248	0.062021	17	0.020183	yes	LIVER
chr1_2104538_G_T_b38	AURKAIP1	-3.057	0.0026	-0.057225	35	0.018718	yes	LIVER
chr1_2334530_T_G_b38	AURKAIP1	3.034	0.0028	0.058163	24	0.019172	yes	LIVER
chr1_2127343_CA_C_b38	AURKAIP1	-3.029	0.00284	-0.057403	36	0.018951	yes	LIVER
chr1_2104245_C_T_b38	AURKAIP1	-3.021	0.00292	-0.057162	33	0.018923	yes	LIVER
chr1_2104824_G_A_b38	AURKAIP1	-3.021	0.00292	-0.057162	33	0.018923	yes	LIVER
chr1_2108082_G_T_b38	AURKAIP1	-3.008	0.00304	-0.055593	36	0.018483	yes	LIVER
chr1_2109459_T_C_b38	AURKAIP1	-3.008	0.00304	-0.055593	36	0.018483	yes	LIVER
chr1_2109716_C_T_b38	AURKAIP1	-3.008	0.00304	-0.055593	36	0.018483	yes	LIVER
chr1_2113726_G_A_b38	AURKAIP1	-3.008	0.00304	-0.055593	36	0.018483	yes	LIVER
chr1_2151283_T_C_b38	AURKAIP1	3.008	0.00304	0.060826	16	0.020222	yes	LIVER
chr1_2155206_T_C_b38	AURKAIP1	3.008	0.00304	0.060826	16	0.020222	yes	LIVER
chr1_2155318_A_G_b38	AURKAIP1	3.008	0.00304	0.060826	16	0.020222	yes	LIVER
chr1_2156665_A_G_b38	AURKAIP1	3.008	0.00304	0.060826	16	0.020222	yes	LIVER
chr1_2157315_A_C_b38	AURKAIP1	3.008	0.00304	0.060826	16	0.020222	yes	LIVER
chr1_2162295_C_T_b38	AURKAIP1	3.008	0.00304	0.060826	16	0.020222	yes	LIVER
chr1_2162307_G_T_b38	AURKAIP1	3.008	0.00304	0.060826	16	0.020222	yes	LIVER
chr1_2164260_C_T_b38	AURKAIP1	3.008	0.00304	0.060826	16	0.020222	yes	LIVER
chr1_2167643_G_A_b38	AURKAIP1	3.008	0.00304	0.060826	16	0.020222	yes	LIVER
chr1_2140117_A_G_b38	AURKAIP1	-3.008	0.00304	-0.060826	16	0.020222	yes	LIVER
chr1_2329106_G_A_b38	AURKAIP1	3	0.00312	0.055388	49	0.018464	yes	LIVER
chr1_2111104_A_G_b38	AURKAIP1	-2.996	0.00316	-0.055029	36	0.01837	yes	LIVER
chr1_2137733_C_T_b38	AURKAIP1	2.963	0.00349	0.060469	16	0.020408	yes	LIVER
chr1_2138882_T_C_b38	AURKAIP1	-2.963	0.00349	-0.060469	16	0.020408	yes	LIVER
chr1_2145821_C_T_b38	AURKAIP1	2.963	0.00349	0.060469	16	0.020408	yes	LIVER
chr1_2145970_A_G_b38	AURKAIP1	2.963	0.00349	0.060469	16	0.020408	yes	LIVER
chr1_2146946_C_T_b38	AURKAIP1	2.963	0.00349	0.060469	16	0.020408	yes	LIVER
chr1_2147005_T_G_b38	AURKAIP1	2.963	0.00349	0.060469	16	0.020408	yes	LIVER
chr1_2147043_T_A_b38	AURKAIP1	2.963	0.00349	0.060469	16	0.020408	yes	LIVER
chr1_2147118_T_A_b38	AURKAIP1	2.963	0.00349	0.060469	16	0.020408	yes	LIVER
chr1_2149374_G_T_b38	AURKAIP1	2.963	0.00349	0.060469	16	0.020408	yes	LIVER
chr1_2151019_C_T_b38	AURKAIP1	2.963	0.00349	0.060469	16	0.020408	yes	LIVER
chr1_2151734_A_G_b38	AURKAIP1	2.963	0.00349	0.060469	16	0.020408	yes	LIVER
chr1_2155596_GTGA_G_b38	AURKAIP1	2.963	0.00349	0.060469	16	0.020408	yes	LIVER
chr1_2157138_G_A_b38	AURKAIP1	2.963	0.00349	0.060469	16	0.020408	yes	LIVER
chr1_2158078_C_CT_b38	AURKAIP1	2.963	0.00349	0.060469	16	0.020408	yes	LIVER
chr1_2159377_T_C_b38	AURKAIP1	2.963	0.00349	0.060469	16	0.020408	yes	LIVER
chr1_2159958_A_G_b38	AURKAIP1	2.963	0.00349	0.060469	16	0.020408	yes	LIVER
chr1_2175622_G_T_b38	AURKAIP1	2.963	0.00349	0.060469	16	0.020408	yes	LIVER
chr1_2178821_G_A_b38	AURKAIP1	2.963	0.00349	0.060469	16	0.020408	yes	LIVER
chr1_2182126_T_G_b38	AURKAIP1	2.963	0.00349	0.060469	16	0.020408	yes	LIVER
chr1_2141561_A_G_b38	AURKAIP1	-2.958	0.00354	-0.060489	16	0.020448	yes	LIVER
chr1_2144121_T_G_b38	AURKAIP1	2.958	0.00354	0.060489	16	0.020448	yes	LIVER
chr1_818469_G_T_b38	AURKAIP1	2.947	0.00367	0.068566	12	0.023264	yes	LIVER
chr1_2354645_C_T_b38	AURKAIP1	-2.944	0.00371	-0.069739	9	0.023692	yes	LIVER
chr1_2354688_G_C_b38	AURKAIP1	-2.944	0.00371	-0.069739	9	0.023692	yes	LIVER
chr1_2362229_A_G_b38	AURKAIP1	-2.944	0.00371	-0.069739	9	0.023692	yes	LIVER
chr1_839480_CACACACCTGGACAA_C_b38	AURKAIP1	2.923	0.00395	0.064707	19	0.022139	yes	LIVER
chr1_818464_CCT_C_b38	AURKAIP1	2.891	0.00435	0.066043	13	0.022847	yes	LIVER
chr1_2103940_A_G_b38	AURKAIP1	-2.854	0.00487	-0.054065	34	0.018944	yes	LIVER
chr1_2170248_G_A_b38	AURKAIP1	2.83	0.00523	0.057182	17	0.020208	yes	LIVER
chr1_851805_G_A_b38	AURKAIP1	2.828	0.00527	0.06812	11	0.024092	yes	LIVER
chr1_2324977_G_GGCT_b38	AURKAIP1	2.819	0.0054	0.053564	28	0.019002	yes	LIVER
chr1_1127258_C_A_b38	AURKAIP1	2.753	0.00657	0.050032	44	0.018176	yes	LIVER
chr1_1118005_C_T_b38	AURKAIP1	-2.749	0.00665	-0.050381	50	0.01833	yes	LIVER
chr1_2185716_G_A_b38	AURKAIP1	2.747	0.00667	0.056018	16	0.020392	yes	LIVER
chr1_2350750_AGGGGTGGCACG_A_b38	AURKAIP1	-2.742	0.00678	-0.061578	13	0.022458	yes	LIVER
chr1_917284_C_T_b38	AURKAIP1	2.738	0.00685	0.063172	8	0.02307	yes	LIVER
chr1_1499586_C_CTT_b38	AURKAIP1	2.686	0.00795	0.079905	6	0.029744	yes	LIVER
chr1_1169858_T_C_b38	AURKAIP1	-2.671	0.00831	-0.053362	18	0.019979	yes	LIVER
chr1_2112692_T_TTGG_b38	AURKAIP1	-2.651	0.00879	-0.052554	43	0.019821	yes	LIVER
chr1_2150078_C_A_b38	AURKAIP1	2.628	0.00938	0.053701	16	0.020432	yes	LIVER
chr1_2106796_TGACTCTTCAGCAGGCCCCTCTGGTGGGCGAGGACCTCCACACGTGTCACCAGGCCAGGC_T_b38	AURKAIP1	2.619	0.00964	0.077144	5	0.029458	yes	LIVER
chr1_2110911_G_A_b38	AURKAIP1	3.344	0.00102	0.074163	8	0.02218	no	LIVER
chr1_2107293_C_T_b38	AURKAIP1	3.246	0.00141	0.066697	15	0.020546	no	LIVER
chr1_830725_T_A_b38	AURKAIP1	3.195	0.00167	0.07771	13	0.024322	no	LIVER
chr1_791564_C_G_b38	AURKAIP1	3.085	0.00238	0.072145	13	0.023386	no	LIVER
chr1_1091421_T_A_b38	AURKAIP1	3.066	0.00253	0.054838	39	0.017887	no	LIVER
chr1_2107454_G_A_b38	AURKAIP1	-3.054	0.00263	-0.057487	37	0.018823	no	LIVER
chr1_2118160_T_C_b38	AURKAIP1	-3.045	0.00271	-0.057842	29	0.018997	no	LIVER
chr1_2112598_T_C_b38	AURKAIP1	-3.032	0.00282	-0.056632	30	0.01868	no	LIVER
chr1_2113933_G_C_b38	AURKAIP1	-3.024	0.00289	-0.056492	30	0.018683	no	LIVER
chr1_2113937_A_G_b38	AURKAIP1	-3.024	0.00289	-0.056492	30	0.018683	no	LIVER
chr1_2113941_C_A_b38	AURKAIP1	-3.024	0.00289	-0.056492	30	0.018683	no	LIVER
chr1_2120074_T_G_b38	AURKAIP1	-3.015	0.00297	-0.056848	29	0.018854	no	LIVER
chr1_2155442_GTGA_G_b38	AURKAIP1	3.01	0.00302	0.060882	16	0.020227	no	LIVER
chr1_2113103_T_C_b38	AURKAIP1	-3	0.00311	-0.056879	29	0.01896	no	LIVER
chr1_2114443_A_G_b38	AURKAIP1	-3	0.00311	-0.056879	29	0.01896	no	LIVER
chr1_2115347_G_A_b38	AURKAIP1	-3	0.00311	-0.056879	29	0.01896	no	LIVER
chr1_2115499_G_T_b38	AURKAIP1	-3	0.00311	-0.056879	29	0.01896	no	LIVER
chr1_2104360_G_A_b38	AURKAIP1	-2.995	0.00316	-0.057136	33	0.019078	no	LIVER
chr1_816108_G_GA_b38	AURKAIP1	-2.983	0.00328	-0.0991	3	0.033217	no	LIVER
chr1_836030_C_T_b38	AURKAIP1	2.982	0.00329	0.07489	13	0.025112	no	LIVER
chr1_2116057_C_G_b38	AURKAIP1	-2.979	0.00333	-0.056926	28	0.019111	no	LIVER
chr1_2116108_G_A_b38	AURKAIP1	-2.979	0.00333	-0.056926	28	0.019111	no	LIVER
chr1_2129085_T_C_b38	AURKAIP1	-2.979	0.00333	-0.056926	28	0.019111	no	LIVER
chr1_2129191_T_C_b38	AURKAIP1	-2.979	0.00333	-0.056926	28	0.019111	no	LIVER
chr1_2264013_TA_T_b38	AURKAIP1	2.977	0.00335	0.058739	42	0.019734	no	LIVER
chr1_2283349_AGGG_A_b38	AURKAIP1	-2.97	0.00342	-0.069088	7	0.023262	no	LIVER
chr1_2283682_C_T_b38	AURKAIP1	-2.97	0.00342	-0.068834	7	0.023178	no	LIVER
chr1_2117290_G_A_b38	AURKAIP1	-2.964	0.00348	-0.055333	30	0.018668	no	LIVER
chr1_2112615_A_C_b38	AURKAIP1	-2.961	0.00352	-0.056452	29	0.019067	no	LIVER
chr1_2107223_G_A_b38	AURKAIP1	-2.935	0.00381	-0.055423	32	0.018886	no	LIVER
chr1_2118069_G_T_b38	AURKAIP1	-2.914	0.00405	-0.054986	30	0.018867	no	LIVER
chr1_1865177_G_A_b38	AURKAIP1	2.909	0.00412	0.062518	12	0.021491	no	LIVER
chr1_2137275_G_A_b38	AURKAIP1	2.874	0.00458	0.06448	9	0.022435	no	LIVER
chr1_924305_G_A_b38	AURKAIP1	2.874	0.00459	0.070448	8	0.024516	no	LIVER
chr1_2351215_T_G_b38	AURKAIP1	-2.863	0.00473	-0.067103	10	0.023436	no	LIVER
chr1_2186496_G_GC_b38	AURKAIP1	2.814	0.00548	0.057501	18	0.020435	no	LIVER
chr1_2348393_G_A_b38	AURKAIP1	-2.805	0.00563	-0.065062	10	0.023196	no	LIVER
chr1_2342133_C_G_b38	AURKAIP1	-2.803	0.00566	-0.068177	8	0.024324	no	LIVER
chr1_2342137_G_A_b38	AURKAIP1	-2.803	0.00566	-0.068177	8	0.024324	no	LIVER
chr1_2119063_C_CT_b38	AURKAIP1	-2.776	0.00612	-0.052969	28	0.019078	no	LIVER
chr1_1098619_C_T_b38	AURKAIP1	2.768	0.00627	0.049785	47	0.017983	no	LIVER
chr1_2253095_GAA_G_b38	AURKAIP1	2.752	0.00658	0.056081	29	0.020379	no	LIVER
chr1_2241549_T_C_b38	AURKAIP1	2.74	0.00682	0.049572	50	0.018094	no	LIVER
chr1_2362863_C_CA_b38	AURKAIP1	-2.731	0.00699	-0.06673	7	0.024432	no	LIVER
chr1_2233496_G_T_b38	AURKAIP1	2.711	0.0074	0.048831	51	0.018011	no	LIVER
chr1_2235168_G_GT_b38	AURKAIP1	2.711	0.0074	0.048831	51	0.018011	no	LIVER
chr1_2271528_T_C_b38	AURKAIP1	2.701	0.00763	0.047514	53	0.017592	no	LIVER
chr1_2252962_T_G_b38	AURKAIP1	2.69	0.00786	0.049012	50	0.018218	no	LIVER
chr1_2351678_C_T_b38	AURKAIP1	-2.684	0.00801	-0.062437	10	0.023263	no	LIVER
chr1_917378_G_C_b38	AURKAIP1	2.675	0.00821	0.063763	7	0.023836	no	LIVER
chr1_917859_A_G_b38	AURKAIP1	2.675	0.00821	0.063763	7	0.023836	no	LIVER
chr1_2262576_C_A_b38	AURKAIP1	2.663	0.00851	0.048187	50	0.018097	no	LIVER
chr1_2160238_CGTGT_C_b38	AURKAIP1	2.643	0.00899	0.058816	8	0.02225	no	LIVER
chr1_931558_G_A_b38	AURKAIP1	2.629	0.00937	0.057556	10	0.021894	no	LIVER
chr1_2118756_A_T_b38	AURKAIP1	-2.628	0.0094	-0.049045	32	0.018665	no	LIVER
chr1_2241949_C_CTG_b38	AURKAIP1	2.62	0.00961	0.052357	24	0.019984	no	LIVER
chr1_2251031_G_A_b38	AURKAIP1	2.616	0.00971	0.047459	51	0.018141	no	LIVER
chr1_2252606_GC_G_b38	AURKAIP1	2.616	0.00971	0.047459	51	0.018141	no	LIVER
chr1_2253720_G_A_b38	AURKAIP1	2.616	0.00971	0.047459	51	0.018141	no	LIVER
chr1_2255546_G_A_b38	AURKAIP1	2.616	0.00971	0.047459	51	0.018141	no	LIVER
chr1_2261200_G_C_b38	AURKAIP1	2.616	0.00971	0.047459	51	0.018141	no	LIVER
chr1_1763633_AAAG_A_b38	AURKAIP1	-2.614	0.00975	-0.090861	3	0.034753	no	LIVER
chr1_1725745_C_G_b38	AURKAIP1	-3.888	0.000117	-0.025324	34	0.006513	yes	LUNG
chr1_1814287_G_A_b38	AURKAIP1	-3.48	0.000552	-0.032531	4	0.009349	yes	LUNG
chr1_1993887_C_A_b38	AURKAIP1	-3.468	0.000576	-0.039509	5	0.011394	yes	LUNG
chr1_1775447_G_A_b38	AURKAIP1	-3.272	0.00115	-0.030067	5	0.009188	yes	LUNG
chr1_1481085_C_G_b38	AURKAIP1	-3.141	0.0018	-0.040809	8	0.012993	yes	LUNG
chr1_1650086_C_T_b38	AURKAIP1	3.111	0.00199	0.034725	3	0.011164	yes	LUNG
chr1_1813304_C_T_b38	AURKAIP1	-3.081	0.00219	-0.031333	3	0.010168	yes	LUNG
chr1_1049115_C_G_b38	AURKAIP1	3.069	0.00228	0.032276	8	0.010518	yes	LUNG
chr1_1844391_CA_C_b38	AURKAIP1	-2.939	0.00347	-0.02035	30	0.006925	yes	LUNG
chr1_814016_T_G_b38	AURKAIP1	-2.93	0.00357	-0.018186	43	0.006207	yes	LUNG
chr1_1707217_G_A_b38	AURKAIP1	-2.707	0.00705	-0.033996	3	0.012558	yes	LUNG
chr1_816108_G_GA_b38	AURKAIP1	-2.683	0.00757	-0.026253	4	0.009786	yes	LUNG
chr1_1919773_C_T_b38	AURKAIP1	2.634	0.00874	0.027224	8	0.010337	yes	LUNG
chr1_1108242_G_A_b38	AURKAIP1	-2.599	0.00965	-0.023586	8	0.009073	yes	LUNG
chr1_1108232_CAG_C_b38	AURKAIP1	-2.596	0.00975	-0.023164	9	0.008924	yes	LUNG
chr1_1991841_T_C_b38	AURKAIP1	3.761	0.000192	0.031329	13	0.008329	no	LUNG
chr1_629626_T_C_b38	AURKAIP1	-3.169	0.00163	-0.036515	3	0.011521	no	LUNG
chr1_1771802_A_AT_b38	AURKAIP1	-2.95	0.00335	-0.025539	5	0.008658	no	LUNG
chr1_1932082_AAAAAC_A_b38	AURKAIP1	-2.923	0.00365	-0.041677	6	0.01426	no	LUNG
chr1_1897190_CT_C_b38	AURKAIP1	-2.877	0.00421	-0.020743	10	0.007211	no	LUNG
chr1_2028539_C_T_b38	AURKAIP1	2.864	0.00438	0.015662	96	0.005468	no	LUNG
chr1_1958061_C_T_b38	AURKAIP1	-2.857	0.00447	-0.030627	3	0.010719	no	LUNG
chr1_1798925_C_CTT_b38	AURKAIP1	-2.842	0.00469	-0.029473	4	0.010371	no	LUNG
chr1_1919746_G_T_b38	AURKAIP1	2.802	0.0053	0.028824	9	0.010286	no	LUNG
chr1_1919749_A_G_b38	AURKAIP1	2.802	0.0053	0.028824	9	0.010286	no	LUNG
chr1_2245631_A_G_b38	AURKAIP1	2.802	0.0053	0.028363	3	0.010123	no	LUNG
chr1_1367028_A_G_b38	AURKAIP1	-2.796	0.00541	-0.023993	13	0.008583	no	LUNG
chr1_2031736_A_G_b38	AURKAIP1	2.77	0.00583	0.015016	95	0.00542	no	LUNG
chr1_2039950_G_C_b38	AURKAIP1	2.755	0.0061	0.015078	86	0.005472	no	LUNG
chr1_2025860_C_T_b38	AURKAIP1	2.666	0.00796	0.015065	115	0.005651	no	LUNG
chr1_2094608_G_A_b38	AURKAIP1	2.665	0.00798	0.048133	4	0.018061	no	LUNG
chr1_1701568_G_C_b38	AURKAIP1	2.663	0.00803	0.03026	17	0.011365	no	LUNG
chr1_885945_ACAGT_A_b38	AURKAIP1	2.968	0.00363	0.045634	12	0.015376	yes	SLVRYG
chr1_872843_G_C_b38	AURKAIP1	-2.945	0.00389	-0.046516	36	0.015793	yes	SLVRYG
chr1_729703_A_G_b38	AURKAIP1	2.83	0.00547	0.050744	6	0.01793	yes	SLVRYG
chr1_2286690_T_C_b38	AURKAIP1	-2.639	0.00943	-0.050588	3	0.019167	yes	SLVRYG
chr1_2286825_T_G_b38	AURKAIP1	-2.639	0.00943	-0.050588	3	0.019167	yes	SLVRYG
chr1_2286826_T_C_b38	AURKAIP1	-2.639	0.00943	-0.050588	3	0.019167	yes	SLVRYG
chr1_1534218_C_G_b38	AURKAIP1	2.732	0.00725	0.035021	41	0.012817	no	SLVRYG
chr1_1534219_G_C_b38	AURKAIP1	2.732	0.00725	0.035021	41	0.012817	no	SLVRYG
chr1_624100_C_T_b38	AURKAIP1	2.709	0.00775	0.053343	5	0.019689	no	SLVRYG
chr1_1374801_A_G_b38	AURKAIP1	-7.775	3.05e-14	-0.101645	10	0.013073	yes	MSCLSK
chr1_1332271_G_A_b38	AURKAIP1	-4.555	6.29e-06	-0.080968	5	0.017776	yes	MSCLSK
chr1_1329353_C_G_b38	AURKAIP1	-4.522	7.3e-06	-0.08006	5	0.017704	yes	MSCLSK
chr1_1375288_A_C_b38	AURKAIP1	4.522	7.31e-06	0.050362	24	0.011137	yes	MSCLSK
chr1_1375595_C_T_b38	AURKAIP1	4.522	7.31e-06	0.050362	24	0.011137	yes	MSCLSK
chr1_1376092_G_A_b38	AURKAIP1	4.522	7.31e-06	0.050362	24	0.011137	yes	MSCLSK
chr1_1376336_G_A_b38	AURKAIP1	4.522	7.31e-06	0.050362	24	0.011137	yes	MSCLSK
chr1_1375998_T_A_b38	AURKAIP1	4.433	1.09e-05	0.049079	24	0.011071	yes	MSCLSK
chr1_1366299_AGT_A_b38	AURKAIP1	-4.303	1.95e-05	-0.091779	6	0.021327	yes	MSCLSK
chr1_1432367_CCT_C_b38	AURKAIP1	-4.21	2.92e-05	-0.065471	3	0.015552	yes	MSCLSK
chr1_1229158_G_T_b38	AURKAIP1	-4.076	5.16e-05	-0.049641	5	0.012178	yes	MSCLSK
chr1_1229244_A_G_b38	AURKAIP1	-4.076	5.16e-05	-0.049641	5	0.012178	yes	MSCLSK
chr1_1229248_C_T_b38	AURKAIP1	-4.076	5.16e-05	-0.049641	5	0.012178	yes	MSCLSK
chr1_1229378_T_TG_b38	AURKAIP1	-4.076	5.16e-05	-0.049641	5	0.012178	yes	MSCLSK
chr1_1229930_G_A_b38	AURKAIP1	-4.076	5.16e-05	-0.049641	5	0.012178	yes	MSCLSK
chr1_1345423_G_A_b38	AURKAIP1	-4.036	6.1e-05	-0.087282	5	0.021626	yes	MSCLSK
chr1_1229060_CGCCTTCTCCAGACCACACGTGGCACT_C_b38	AURKAIP1	-4	7.08e-05	-0.049004	5	0.012251	yes	MSCLSK
chr1_1425095_A_G_b38	AURKAIP1	-3.997	7.16e-05	-0.068907	6	0.017238	yes	MSCLSK
chr1_1356127_G_C_b38	AURKAIP1	-3.949	8.71e-05	-0.087327	5	0.022111	yes	MSCLSK
chr1_1323853_G_GA_b38	AURKAIP1	-3.89	0.000111	-0.085236	5	0.021911	yes	MSCLSK
chr1_1320870_C_A_b38	AURKAIP1	-3.845	0.000133	-0.08476	5	0.022044	yes	MSCLSK
chr1_1330068_G_A_b38	AURKAIP1	-3.845	0.000133	-0.08476	5	0.022044	yes	MSCLSK
chr1_1334108_G_A_b38	AURKAIP1	-3.845	0.000133	-0.08476	5	0.022044	yes	MSCLSK
chr1_1342873_C_T_b38	AURKAIP1	-3.845	0.000133	-0.08476	5	0.022044	yes	MSCLSK
chr1_1343373_C_T_b38	AURKAIP1	-3.845	0.000133	-0.08476	5	0.022044	yes	MSCLSK
chr1_1352103_A_C_b38	AURKAIP1	-3.845	0.000133	-0.08476	5	0.022044	yes	MSCLSK
chr1_1353044_C_T_b38	AURKAIP1	-3.845	0.000133	-0.08476	5	0.022044	yes	MSCLSK
chr1_1359713_GACCCCACCCC_G_b38	AURKAIP1	-3.845	0.000133	-0.08476	5	0.022044	yes	MSCLSK
chr1_1378109_C_T_b38	AURKAIP1	-3.845	0.000133	-0.08476	5	0.022044	yes	MSCLSK
chr1_1395686_G_A_b38	AURKAIP1	-3.845	0.000133	-0.08476	5	0.022044	yes	MSCLSK
chr1_1312208_G_T_b38	AURKAIP1	-3.813	0.000151	-0.061249	8	0.016065	yes	MSCLSK
chr1_1305900_C_T_b38	AURKAIP1	-3.789	0.000166	-0.083944	5	0.022157	yes	MSCLSK
chr1_1312175_C_T_b38	AURKAIP1	-3.688	0.000246	-0.08249	5	0.022369	yes	MSCLSK
chr1_1424819_C_T_b38	AURKAIP1	-3.672	0.000261	-0.057482	11	0.015653	yes	MSCLSK
chr1_1335515_G_A_b38	AURKAIP1	-3.649	0.000284	-0.081182	5	0.022245	yes	MSCLSK
chr1_1296364_G_T_b38	AURKAIP1	-3.635	0.000301	-0.079997	5	0.022009	yes	MSCLSK
chr1_1299211_G_A_b38	AURKAIP1	-3.635	0.000301	-0.079997	5	0.022009	yes	MSCLSK
chr1_1258096_G_C_b38	AURKAIP1	-3.612	0.000328	-0.057049	4	0.015796	yes	MSCLSK
chr1_1296403_A_G_b38	AURKAIP1	-3.52	0.000462	-0.07846	5	0.022288	yes	MSCLSK
chr1_1224160_G_A_b38	AURKAIP1	-3.47	0.000556	-0.043808	4	0.012626	yes	MSCLSK
chr1_1366271_AGT_A_b38	AURKAIP1	-3.435	0.00063	-0.074807	5	0.021776	yes	MSCLSK
chr1_1432844_GA_G_b38	AURKAIP1	-3.426	0.000653	-0.065395	4	0.019089	yes	MSCLSK
chr1_1363081_C_CA_b38	AURKAIP1	-3.413	0.000683	-0.059016	5	0.01729	yes	MSCLSK
chr1_1318689_A_C_b38	AURKAIP1	-3.403	0.000708	-0.073368	5	0.021559	yes	MSCLSK
chr1_1408687_T_C_b38	AURKAIP1	-3.378	0.000775	-0.038095	26	0.011277	yes	MSCLSK
chr1_1385919_A_AG_b38	AURKAIP1	3.357	0.000835	0.037597	30	0.0112	yes	MSCLSK
chr1_1172462_G_C_b38	AURKAIP1	-3.175	0.00157	-0.035977	9	0.01133	yes	MSCLSK
chr1_1331945_G_GC_b38	AURKAIP1	-3.157	0.00167	-0.038535	17	0.012206	yes	MSCLSK
chr1_1390113_C_CA_b38	AURKAIP1	-3.142	0.00176	-0.048092	4	0.015306	yes	MSCLSK
chr1_1340811_GCACACACCTGCA_G_b38	AURKAIP1	-3.142	0.00176	-0.055951	5	0.017809	yes	MSCLSK
chr1_1174573_G_A_b38	AURKAIP1	-3.134	0.00181	-0.037459	7	0.011954	yes	MSCLSK
chr1_1948121_T_G_b38	AURKAIP1	-3.126	0.00185	-0.024965	48	0.007986	yes	MSCLSK
chr1_1477677_T_TTTTTA_b38	AURKAIP1	-3.115	0.00192	-0.064466	3	0.020695	yes	MSCLSK
chr1_1337736_A_G_b38	AURKAIP1	3.1	0.00202	0.034759	19	0.011213	yes	MSCLSK
chr1_1359138_C_T_b38	AURKAIP1	3.083	0.00214	0.034646	41	0.011237	yes	MSCLSK
chr1_1302799_C_A_b38	AURKAIP1	-3.046	0.00242	-0.068786	4	0.022583	yes	MSCLSK
chr1_1265603_T_TTGTG_b38	AURKAIP1	3.027	0.00257	0.02674	18	0.008834	yes	MSCLSK
chr1_455086_C_A_b38	AURKAIP1	-2.96	0.00319	-0.028756	11	0.009715	yes	MSCLSK
chr1_1183348_C_G_b38	AURKAIP1	-2.958	0.00322	-0.036039	6	0.012185	yes	MSCLSK
chr1_641813_G_A_b38	AURKAIP1	-2.933	0.00347	-0.027902	6	0.009512	yes	MSCLSK
chr1_1457611_AAAAC_A_b38	AURKAIP1	2.932	0.00349	0.060913	8	0.020775	yes	MSCLSK
chr1_1174988_C_T_b38	AURKAIP1	-2.929	0.00352	-0.033706	8	0.011506	yes	MSCLSK
chr1_1175040_T_C_b38	AURKAIP1	-2.929	0.00352	-0.033706	8	0.011506	yes	MSCLSK
chr1_1174845_C_T_b38	AURKAIP1	-2.911	0.00373	-0.033336	8	0.011451	yes	MSCLSK
chr1_1339884_A_ACAGCCGCATGTCCCCCAGCAGCCCCCACAGACCCACCCGCAGCCGCATGTCCCCCAGCAGCCCCCACAGACCCACCCG_b38	AURKAIP1	-2.906	0.00379	-0.053607	6	0.018446	yes	MSCLSK
chr1_1255533_CT_C_b38	AURKAIP1	-2.882	0.00408	-0.039096	6	0.013564	yes	MSCLSK
chr1_1257135_A_G_b38	AURKAIP1	-2.882	0.00408	-0.039096	6	0.013564	yes	MSCLSK
chr1_1264812_C_G_b38	AURKAIP1	-2.882	0.00408	-0.039096	6	0.013564	yes	MSCLSK
chr1_1174578_A_G_b38	AURKAIP1	-2.879	0.00413	-0.03049	9	0.010591	yes	MSCLSK
chr1_1134083_C_CA_b38	AURKAIP1	2.86	0.00438	0.064016	3	0.022384	yes	MSCLSK
chr1_1179288_G_A_b38	AURKAIP1	-2.85	0.00451	-0.03358	8	0.011782	yes	MSCLSK
chr1_1174747_C_T_b38	AURKAIP1	-2.836	0.00472	-0.032995	8	0.011636	yes	MSCLSK
chr1_1192636_G_GACACTCCAGTTGGTATGAGTGTAGACACTCCAGTTCGTATCAGTGTAA_b38	AURKAIP1	-2.813	0.00506	-0.051376	4	0.018265	yes	MSCLSK
chr1_1174523_C_T_b38	AURKAIP1	-2.812	0.00508	-0.032698	8	0.011628	yes	MSCLSK
chr1_1254283_G_A_b38	AURKAIP1	-2.791	0.00541	-0.037602	6	0.013471	yes	MSCLSK
chr1_1177430_G_T_b38	AURKAIP1	-2.781	0.00558	-0.032631	8	0.011734	yes	MSCLSK
chr1_2118713_C_CTG_b38	AURKAIP1	-2.78	0.00559	-0.027096	9	0.009745	yes	MSCLSK
chr1_1174174_G_C_b38	AURKAIP1	-2.765	0.00587	-0.031474	8	0.011385	yes	MSCLSK
chr1_1176929_T_C_b38	AURKAIP1	-2.74	0.00632	-0.021309	40	0.007777	yes	MSCLSK
chr1_1260440_T_C_b38	AURKAIP1	-2.732	0.00646	-0.036443	7	0.013338	yes	MSCLSK
chr1_1266260_T_C_b38	AURKAIP1	-2.732	0.00646	-0.036443	7	0.013338	yes	MSCLSK
chr1_633714_A_G_b38	AURKAIP1	2.729	0.00653	0.035052	19	0.012846	yes	MSCLSK
chr1_1173815_A_G_b38	AURKAIP1	-2.728	0.00654	-0.030825	7	0.011298	yes	MSCLSK
chr1_2348590_C_T_b38	AURKAIP1	-2.685	0.00743	-0.048964	10	0.018233	yes	MSCLSK
chr1_1175832_G_GAGAGGCTGCCGCTGTGCCGGTGGAGAGGCTGCCGCCGTGCAGGTGGAA_b38	AURKAIP1	-2.683	0.00748	-0.033825	5	0.012607	yes	MSCLSK
chr1_1203822_T_C_b38	AURKAIP1	-2.667	0.00784	-0.030414	16	0.011402	yes	MSCLSK
chr1_1270963_C_A_b38	AURKAIP1	-2.663	0.00794	-0.035	8	0.013143	yes	MSCLSK
chr1_1241831_G_C_b38	AURKAIP1	-2.646	0.00835	-0.02864	6	0.010824	yes	MSCLSK
chr1_1457922_T_C_b38	AURKAIP1	2.638	0.00853	0.04283	15	0.016233	yes	MSCLSK
chr1_1178014_C_T_b38	AURKAIP1	-2.634	0.00864	-0.030855	8	0.011714	yes	MSCLSK
chr1_1173724_G_T_b38	AURKAIP1	-2.598	0.00959	-0.03033	8	0.011673	yes	MSCLSK
chr1_1282756_C_CT_b38	AURKAIP1	-2.585	0.00996	-0.03217	4	0.012445	yes	MSCLSK
chr1_1374694_C_G_b38	AURKAIP1	5.049	5.81e-07	0.063571	12	0.012591	no	MSCLSK
chr1_1371538_C_T_b38	AURKAIP1	-5.017	6.82e-07	-0.099243	8	0.019781	no	MSCLSK
chr1_1341803_C_T_b38	AURKAIP1	-4.64	4.24e-06	-0.094568	7	0.020382	no	MSCLSK
chr1_1373079_A_G_b38	AURKAIP1	-4.64	4.24e-06	-0.094568	7	0.020382	no	MSCLSK
chr1_1373582_C_T_b38	AURKAIP1	-4.64	4.24e-06	-0.094568	7	0.020382	no	MSCLSK
chr1_1375923_C_T_b38	AURKAIP1	-4.64	4.24e-06	-0.094568	7	0.020382	no	MSCLSK
chr1_1376025_T_C_b38	AURKAIP1	-4.64	4.24e-06	-0.094568	7	0.020382	no	MSCLSK
chr1_1378550_G_A_b38	AURKAIP1	-4.49	8.46e-06	-0.091672	7	0.020417	no	MSCLSK
chr1_1378591_C_T_b38	AURKAIP1	-4.49	8.46e-06	-0.091672	7	0.020417	no	MSCLSK
chr1_1379664_G_A_b38	AURKAIP1	4.467	9.37e-06	0.050087	24	0.011212	no	MSCLSK
chr1_1380790_G_A_b38	AURKAIP1	4.357	1.54e-05	0.049134	24	0.011278	no	MSCLSK
chr1_1380206_G_A_b38	AURKAIP1	-4.299	1.99e-05	-0.088174	7	0.020511	no	MSCLSK
chr1_1382829_CAACAATCCAGT_C_b38	AURKAIP1	-4.299	1.99e-05	-0.088174	7	0.020511	no	MSCLSK
chr1_1395579_C_T_b38	AURKAIP1	-4.299	1.99e-05	-0.088174	7	0.020511	no	MSCLSK
chr1_1406131_A_G_b38	AURKAIP1	-4.299	1.99e-05	-0.088174	7	0.020511	no	MSCLSK
chr1_1372258_T_C_b38	AURKAIP1	4.083	5.01e-05	0.053827	10	0.013183	no	MSCLSK
chr1_1319750_G_A_b38	AURKAIP1	-4.067	5.37e-05	-0.075607	10	0.018592	no	MSCLSK
chr1_1306183_A_G_b38	AURKAIP1	-4.047	5.82e-05	-0.080787	7	0.01996	no	MSCLSK
chr1_1320653_C_T_b38	AURKAIP1	-4.047	5.82e-05	-0.080787	7	0.01996	no	MSCLSK
chr1_1411847_T_TCCAGGTC_b38	AURKAIP1	-3.989	7.41e-05	-0.087138	5	0.021844	no	MSCLSK
chr1_1363584_G_A_b38	AURKAIP1	-3.941	9.02e-05	-0.077097	9	0.019564	no	MSCLSK
chr1_1381268_C_T_b38	AURKAIP1	3.919	9.85e-05	0.044172	25	0.011271	no	MSCLSK
chr1_1381294_C_T_b38	AURKAIP1	3.919	9.85e-05	0.044172	25	0.011271	no	MSCLSK
chr1_1297051_CCA_C_b38	AURKAIP1	-3.869	0.000121	-0.077378	7	0.02	no	MSCLSK
chr1_1370429_C_G_b38	AURKAIP1	-3.76	0.000185	-0.071075	10	0.018902	no	MSCLSK
chr1_1411929_G_C_b38	AURKAIP1	-3.676	0.000257	-0.040419	34	0.010996	no	MSCLSK
chr1_1357246_C_T_b38	AURKAIP1	-3.66	0.000273	-0.066054	14	0.018046	no	MSCLSK
chr1_1355212_CGGGAGCTG_C_b38	AURKAIP1	-3.577	0.000374	-0.079612	5	0.022258	no	MSCLSK
chr1_1403127_C_CAAAAAA_b38	AURKAIP1	-3.548	0.000417	-0.074477	8	0.020991	no	MSCLSK
chr1_1080338_G_A_b38	AURKAIP1	-3.442	0.000616	-0.090933	3	0.026421	no	MSCLSK
chr1_1356328_G_A_b38	AURKAIP1	-3.437	0.000626	-0.067201	9	0.019551	no	MSCLSK
chr1_1362515_C_G_b38	AURKAIP1	-3.361	0.000822	-0.065821	9	0.019581	no	MSCLSK
chr1_1424727_C_A_b38	AURKAIP1	-3.356	0.000839	-0.052032	11	0.015506	no	MSCLSK
chr1_1288273_TCC_T_b38	AURKAIP1	-3.35	0.000857	-0.063786	4	0.019043	no	MSCLSK
chr1_1361163_AACAC_A_b38	AURKAIP1	-3.329	0.000923	-0.058978	15	0.017717	no	MSCLSK
chr1_1422379_G_A_b38	AURKAIP1	-3.315	0.000969	-0.063933	8	0.019287	no	MSCLSK
chr1_1410616_G_T_b38	AURKAIP1	-3.314	0.000974	-0.036702	34	0.011076	no	MSCLSK
chr1_1412488_C_CAG_b38	AURKAIP1	-3.314	0.000974	-0.036702	34	0.011076	no	MSCLSK
chr1_2334682_C_T_b38	AURKAIP1	-3.282	0.00109	-0.047722	3	0.01454	no	MSCLSK
chr1_1415976_G_A_b38	AURKAIP1	-3.265	0.00115	-0.036428	34	0.011156	no	MSCLSK
chr1_1055153_G_A_b38	AURKAIP1	-3.24	0.00126	-0.054582	14	0.016847	no	MSCLSK
chr1_1419780_C_A_b38	AURKAIP1	-3.217	0.00136	-0.068396	5	0.021262	no	MSCLSK
chr1_1254681_A_G_b38	AURKAIP1	-3.199	0.00145	-0.036126	17	0.011292	no	MSCLSK
chr1_1306149_A_G_b38	AURKAIP1	-3.177	0.00156	-0.044345	6	0.013957	no	MSCLSK
chr1_1411196_A_G_b38	AURKAIP1	-3.151	0.0017	-0.067695	5	0.021485	no	MSCLSK
chr1_1412179_C_T_b38	AURKAIP1	-3.108	0.00197	-0.066755	5	0.021476	no	MSCLSK
chr1_1422280_A_G_b38	AURKAIP1	-3.098	0.00203	-0.058515	9	0.018889	no	MSCLSK
chr1_1207724_C_T_b38	AURKAIP1	-3.088	0.0021	-0.040572	8	0.013137	no	MSCLSK
chr1_1258333_C_G_b38	AURKAIP1	-3.082	0.00215	-0.034466	20	0.011183	no	MSCLSK
chr1_1258343_A_C_b38	AURKAIP1	-3.082	0.00215	-0.034466	20	0.011183	no	MSCLSK
chr1_1219203_A_AC_b38	AURKAIP1	-3.055	0.00234	-0.042092	4	0.013777	no	MSCLSK
chr1_1050446_G_A_b38	AURKAIP1	-3.042	0.00245	-0.074843	3	0.024606	no	MSCLSK
chr1_1422081_C_T_b38	AURKAIP1	-3.029	0.00255	-0.03463	52	0.011433	no	MSCLSK
chr1_1207799_AG_A_b38	AURKAIP1	-2.997	0.00283	-0.040575	3	0.013537	no	MSCLSK
chr1_1198122_C_T_b38	AURKAIP1	-2.987	0.00293	-0.036502	5	0.012221	no	MSCLSK
chr1_1198550_A_G_b38	AURKAIP1	-2.987	0.00293	-0.036502	5	0.012221	no	MSCLSK
chr1_1198673_G_A_b38	AURKAIP1	-2.987	0.00293	-0.036502	5	0.012221	no	MSCLSK
chr1_1410877_A_G_b38	AURKAIP1	-2.917	0.00365	-0.032918	43	0.011283	no	MSCLSK
chr1_1181009_A_AGCCCCTGCCCCTGCCCCTGAACCC_b38	AURKAIP1	-2.905	0.00381	-0.037247	6	0.012824	no	MSCLSK
chr1_1419135_C_G_b38	AURKAIP1	-2.901	0.00385	-0.033022	50	0.011382	no	MSCLSK
chr1_1228424_C_T_b38	AURKAIP1	-2.9	0.00386	-0.026336	17	0.009082	no	MSCLSK
chr1_1319056_A_G_b38	AURKAIP1	-2.892	0.00395	-0.042051	5	0.014538	no	MSCLSK
chr1_1297187_A_G_b38	AURKAIP1	-2.882	0.00409	-0.04703	8	0.01632	no	MSCLSK
chr1_1734812_G_A_b38	AURKAIP1	2.877	0.00416	0.024591	75	0.008549	no	MSCLSK
chr1_1197935_AAC_A_b38	AURKAIP1	-2.866	0.00429	-0.038806	4	0.01354	no	MSCLSK
chr1_1194820_G_A_b38	AURKAIP1	-2.847	0.00455	-0.034764	5	0.012209	no	MSCLSK
chr1_1058479_G_A_b38	AURKAIP1	-2.846	0.00456	-0.067091	3	0.02357	no	MSCLSK
chr1_1059015_AG_A_b38	AURKAIP1	-2.846	0.00456	-0.067091	3	0.02357	no	MSCLSK
chr1_1059390_C_A_b38	AURKAIP1	-2.845	0.00459	-0.066128	3	0.023247	no	MSCLSK
chr1_1050630_T_C_b38	AURKAIP1	-2.841	0.00465	-0.071207	3	0.025068	no	MSCLSK
chr1_1194931_T_C_b38	AURKAIP1	-2.834	0.00474	-0.034536	5	0.012187	no	MSCLSK
chr1_1199727_C_T_b38	AURKAIP1	-2.831	0.00478	-0.035081	5	0.01239	no	MSCLSK
chr1_1199728_C_G_b38	AURKAIP1	-2.831	0.00478	-0.035081	5	0.01239	no	MSCLSK
chr1_1664099_T_C_b38	AURKAIP1	2.827	0.00484	0.024843	28	0.008787	no	MSCLSK
chr1_1203533_T_C_b38	AURKAIP1	-2.813	0.00505	-0.032067	16	0.011398	no	MSCLSK
chr1_1425013_C_T_b38	AURKAIP1	-2.806	0.00517	-0.031013	54	0.011052	no	MSCLSK
chr1_2325021_C_T_b38	AURKAIP1	-2.805	0.00519	-0.042923	3	0.015303	no	MSCLSK
chr1_1635226_T_C_b38	AURKAIP1	2.804	0.00521	0.025878	16	0.00923	no	MSCLSK
chr1_1059925_CT_C_b38	AURKAIP1	-2.801	0.00525	-0.065356	3	0.023333	no	MSCLSK
chr1_1374505_A_G_b38	AURKAIP1	2.768	0.00581	0.02835	16	0.010243	no	MSCLSK
chr1_1355201_G_A_b38	AURKAIP1	-2.757	0.006	-0.055258	8	0.020044	no	MSCLSK
chr1_2316206_C_T_b38	AURKAIP1	2.757	0.006	0.065293	4	0.023684	no	MSCLSK
chr1_631412_T_C_b38	AURKAIP1	2.75	0.00613	0.047267	10	0.017188	no	MSCLSK
chr1_1355028_A_G_b38	AURKAIP1	-2.741	0.0063	-0.054909	8	0.020032	no	MSCLSK
chr1_1411525_T_A_b38	AURKAIP1	-2.716	0.00679	-0.029954	30	0.011029	no	MSCLSK
chr1_1428004_G_C_b38	AURKAIP1	-2.673	0.0077	-0.059389	3	0.022216	no	MSCLSK
chr1_1054081_G_A_b38	AURKAIP1	-2.658	0.00806	-0.056603	3	0.021294	no	MSCLSK
chr1_807808_G_A_b38	AURKAIP1	-2.649	0.00826	-0.056701	5	0.021401	no	MSCLSK
chr1_1235720_T_G_b38	AURKAIP1	-2.645	0.00836	-0.034029	20	0.012863	no	MSCLSK
chr1_1291509_G_A_b38	AURKAIP1	2.624	0.00891	0.043726	3	0.016666	no	MSCLSK
chr1_1195280_C_T_b38	AURKAIP1	-2.614	0.00917	-0.03071	7	0.011749	no	MSCLSK
chr1_1203355_C_G_b38	AURKAIP1	-2.613	0.00919	-0.034382	3	0.013159	no	MSCLSK
chr1_2287068_C_T_b38	AURKAIP1	-2.607	0.00935	-0.027684	10	0.01062	no	MSCLSK
chr1_1204910_T_C_b38	AURKAIP1	-2.605	0.0094	-0.033511	3	0.012864	no	MSCLSK
chr1_1295028_A_C_b38	AURKAIP1	2.604	0.00942	0.038281	3	0.014699	no	MSCLSK
chr1_1295309_C_T_b38	AURKAIP1	2.604	0.00942	0.038281	3	0.014699	no	MSCLSK
chr1_1296127_G_A_b38	AURKAIP1	2.604	0.00942	0.038281	3	0.014699	no	MSCLSK
chr1_1299382_AG_A_b38	AURKAIP1	2.604	0.00942	0.038281	3	0.014699	no	MSCLSK
chr1_1304573_A_G_b38	AURKAIP1	-2.604	0.00942	-0.038281	3	0.014699	no	MSCLSK
chr1_1067159_G_A_b38	AURKAIP1	-2.598	0.00961	-0.019882	76	0.007654	no	MSCLSK
chr1_1103805_C_T_b38	AURKAIP1	2.594	0.00971	0.035898	5	0.01384	no	MSCLSK
chr1_1232800_G_C_b38	AURKAIP1	-2.593	0.00972	-0.033923	13	0.01308	no	MSCLSK
chr1_1374801_A_G_b38	AURKAIP1	-2.913	0.00375	-0.030016	6	0.010303	yes	NERVET
chr1_511982_G_A_b38	AURKAIP1	2.851	0.00455	0.013629	73	0.00478	yes	NERVET
chr1_1942186_G_A_b38	AURKAIP1	-2.745	0.00629	-0.015241	28	0.005552	yes	NERVET
chr1_2090485_G_GC_b38	AURKAIP1	2.736	0.00647	0.019365	7	0.007079	yes	NERVET
chr1_1947648_G_A_b38	AURKAIP1	-2.712	0.00694	-0.015155	28	0.005588	yes	NERVET
chr1_511562_C_T_b38	AURKAIP1	3.591	0.000365	0.020794	33	0.005791	no	NERVET
chr1_1297194_CGT_C_b38	AURKAIP1	3.286	0.00109	0.057191	3	0.017403	no	NERVET
chr1_1301426_A_AT_b38	AURKAIP1	3.18	0.00157	0.021411	21	0.006734	no	NERVET
chr1_1375642_C_T_b38	AURKAIP1	3.136	0.00182	0.021588	15	0.006884	no	NERVET
chr1_1374505_A_G_b38	AURKAIP1	3.106	0.00201	0.021303	15	0.006858	no	NERVET
chr1_1174096_C_A_b38	AURKAIP1	-3.093	0.0021	-0.018536	17	0.005993	no	NERVET
chr1_1174402_G_A_b38	AURKAIP1	-3.08	0.00219	-0.018532	17	0.006016	no	NERVET
chr1_1380867_A_G_b38	AURKAIP1	3.047	0.00244	0.022137	12	0.007265	no	NERVET
chr1_1534402_G_C_b38	AURKAIP1	-3.004	0.00281	-0.023361	4	0.007776	no	NERVET
chr1_1382893_G_A_b38	AURKAIP1	2.958	0.00325	0.021187	13	0.007161	no	NERVET
chr1_1384546_C_T_b38	AURKAIP1	2.921	0.00366	0.021728	12	0.007439	no	NERVET
chr1_1372909_G_A_b38	AURKAIP1	2.905	0.00385	0.020395	13	0.007021	no	NERVET
chr1_1171404_T_C_b38	AURKAIP1	-2.876	0.00421	-0.016117	30	0.005603	no	NERVET
chr1_1379093_TG_T_b38	AURKAIP1	2.871	0.00428	0.021868	8	0.007617	no	NERVET
chr1_1379091_T_G_b38	AURKAIP1	-2.857	0.00447	-0.018547	18	0.006491	no	NERVET
chr1_608256_G_A_b38	AURKAIP1	2.855	0.0045	0.044001	3	0.015412	no	NERVET
chr1_2004501_CAA_C_b38	AURKAIP1	2.84	0.00471	0.021682	7	0.007634	no	NERVET
chr1_1948121_T_G_b38	AURKAIP1	-2.836	0.00477	-0.015498	38	0.005464	no	NERVET
chr1_1398218_C_A_b38	AURKAIP1	2.822	0.00497	0.020505	13	0.007265	no	NERVET
chr1_1383743_T_C_b38	AURKAIP1	2.811	0.00514	0.020187	13	0.00718	no	NERVET
chr1_1173774_G_A_b38	AURKAIP1	-2.773	0.00578	-0.016099	23	0.005806	no	NERVET
chr1_1403593_A_G_b38	AURKAIP1	2.772	0.00579	0.020111	13	0.007255	no	NERVET
chr1_1400756_GGA_G_b38	AURKAIP1	2.772	0.0058	0.020075	13	0.007243	no	NERVET
chr1_1401954_G_T_b38	AURKAIP1	2.772	0.0058	0.020075	13	0.007243	no	NERVET
chr1_2091780_G_A_b38	AURKAIP1	2.731	0.00656	0.020128	7	0.007371	no	NERVET
chr1_2089675_C_T_b38	AURKAIP1	2.723	0.00671	0.017738	23	0.006513	no	NERVET
chr1_1373006_G_A_b38	AURKAIP1	2.715	0.00687	0.019624	9	0.007228	no	NERVET
chr1_1903513_C_CT_b38	AURKAIP1	2.703	0.00712	0.04406	3	0.016298	no	NERVET
chr1_1373007_G_A_b38	AURKAIP1	2.693	0.00734	0.019259	11	0.007152	no	NERVET
chr1_1065910_C_T_b38	AURKAIP1	2.68	0.00763	0.023859	5	0.008903	no	NERVET
chr1_1288085_GC_G_b38	AURKAIP1	2.673	0.00778	0.019862	9	0.00743	no	NERVET
chr1_1948124_G_C_b38	AURKAIP1	2.631	0.0088	0.01978	3	0.007518	no	NERVET
chr1_1394041_G_A_b38	AURKAIP1	2.628	0.00887	0.020886	6	0.007947	no	NERVET
chr1_2275005_A_G_b38	AURKAIP1	2.626	0.00892	0.015165	19	0.005775	no	NERVET
chr1_1722690_TA_T_b38	AURKAIP1	2.626	0.00894	0.019488	4	0.007422	no	NERVET
chr1_1020847_C_CG_b38	AURKAIP1	-2.612	0.0093	-0.024426	7	0.009352	no	NERVET
chr1_1407565_C_A_b38	AURKAIP1	2.605	0.0095	0.019633	12	0.007538	no	NERVET
chr1_2253253_G_C_b38	AURKAIP1	2.603	0.00955	0.025344	3	0.009738	no	NERVET
chr1_1938771_G_A_b38	AURKAIP1	-2.762	0.0066	-0.038825	4	0.014057	yes	OVARY
chr1_1938493_C_CAT_b38	AURKAIP1	-2.671	0.00855	-0.037939	4	0.014203	yes	OVARY
chr1_1939978_T_C_b38	AURKAIP1	-2.671	0.00855	-0.037939	4	0.014203	yes	OVARY
chr1_1943142_A_G_b38	AURKAIP1	-2.671	0.00855	-0.037939	4	0.014203	yes	OVARY
chr1_1943706_C_T_b38	AURKAIP1	-2.671	0.00855	-0.037939	4	0.014203	yes	OVARY
chr1_1943828_A_G_b38	AURKAIP1	-2.671	0.00855	-0.037939	4	0.014203	yes	OVARY
chr1_1945799_T_G_b38	AURKAIP1	-2.671	0.00855	-0.037939	4	0.014203	yes	OVARY
chr1_1922882_A_G_b38	AURKAIP1	-2.664	0.00873	-0.038177	4	0.014332	yes	OVARY
chr1_1925261_C_T_b38	AURKAIP1	-2.664	0.00873	-0.038177	4	0.014332	yes	OVARY
chr1_1460021_C_CTG_b38	AURKAIP1	-2.645	0.00921	-0.049251	7	0.018623	yes	OVARY
chr1_1460022_CAG_C_b38	AURKAIP1	-2.645	0.00921	-0.049251	7	0.018623	yes	OVARY
chr1_1470425_C_CTT_b38	AURKAIP1	-3.133	0.00215	-0.065811	3	0.021008	no	OVARY
chr1_1248116_G_A_b38	AURKAIP1	-3.034	0.00292	-0.05871	3	0.019348	no	OVARY
chr1_1924011_A_G_b38	AURKAIP1	-2.965	0.00362	-0.044591	3	0.01504	no	OVARY
chr1_1002192_A_AT_b38	AURKAIP1	-2.946	0.00383	-0.052482	3	0.017812	no	OVARY
chr1_1582556_T_C_b38	AURKAIP1	-3.27	0.00123	-0.040837	8	0.012488	yes	PNCREAS
chr1_601811_C_G_b38	AURKAIP1	3.214	0.00148	0.036876	7	0.011472	yes	PNCREAS
chr1_1212390_G_A_b38	AURKAIP1	-3.18	0.00166	-0.051632	3	0.016236	yes	PNCREAS
chr1_591413_A_G_b38	AURKAIP1	3.132	0.00194	0.047428	4	0.015141	yes	PNCREAS
chr1_1214801_G_C_b38	AURKAIP1	-3.104	0.00213	-0.049259	3	0.01587	yes	PNCREAS
chr1_601293_G_A_b38	AURKAIP1	3.008	0.0029	0.035064	8	0.011657	yes	PNCREAS
chr1_1215068_T_C_b38	AURKAIP1	-2.941	0.00358	-0.047394	3	0.016117	yes	PNCREAS
chr1_1210101_CAA_C_b38	AURKAIP1	-2.937	0.00362	-0.045567	3	0.015514	yes	PNCREAS
chr1_1219858_G_A_b38	AURKAIP1	-2.926	0.00375	-0.037795	10	0.012916	yes	PNCREAS
chr1_1214831_G_A_b38	AURKAIP1	-2.876	0.00437	-0.045952	3	0.015976	yes	PNCREAS
chr1_1209119_GGA_G_b38	AURKAIP1	-2.869	0.00447	-0.046025	3	0.016042	yes	PNCREAS
chr1_1209273_G_A_b38	AURKAIP1	-2.869	0.00447	-0.046025	3	0.016042	yes	PNCREAS
chr1_1209316_T_C_b38	AURKAIP1	-2.869	0.00447	-0.046025	3	0.016042	yes	PNCREAS
chr1_1533754_T_C_b38	AURKAIP1	-2.83	0.00503	-0.032928	26	0.011635	yes	PNCREAS
chr1_1210031_G_A_b38	AURKAIP1	-2.789	0.0057	-0.044199	3	0.015848	yes	PNCREAS
chr1_1210061_A_G_b38	AURKAIP1	-2.789	0.0057	-0.044199	3	0.015848	yes	PNCREAS
chr1_1210087_C_G_b38	AURKAIP1	-2.789	0.0057	-0.044199	3	0.015848	yes	PNCREAS
chr1_1210386_C_G_b38	AURKAIP1	-2.789	0.0057	-0.044199	3	0.015848	yes	PNCREAS
chr1_1211863_A_C_b38	AURKAIP1	-2.789	0.0057	-0.044199	3	0.015848	yes	PNCREAS
chr1_1211917_G_A_b38	AURKAIP1	-2.789	0.0057	-0.044199	3	0.015848	yes	PNCREAS
chr1_1567912_C_CAAAAAAA_b38	AURKAIP1	2.749	0.00642	0.040158	8	0.014609	yes	PNCREAS
chr1_2026833_CA_C_b38	AURKAIP1	-2.743	0.00653	-0.02852	14	0.010398	yes	PNCREAS
chr1_632487_A_G_b38	AURKAIP1	2.708	0.00725	0.0509	11	0.018798	yes	PNCREAS
chr1_1611571_T_C_b38	AURKAIP1	-2.678	0.0079	-0.026272	27	0.00981	yes	PNCREAS
chr1_1546860_CAA_C_b38	AURKAIP1	2.641	0.00878	0.054709	3	0.020713	yes	PNCREAS
chr1_1240367_A_G_b38	AURKAIP1	-2.632	0.00901	-0.038158	4	0.014496	yes	PNCREAS
chr1_2285870_G_GT_b38	AURKAIP1	-3.228	0.00142	-0.047753	5	0.014795	no	PNCREAS
chr1_1102071_C_CA_b38	AURKAIP1	-3.043	0.00259	-0.043942	8	0.01444	no	PNCREAS
chr1_1215852_T_C_b38	AURKAIP1	-2.933	0.00367	-0.032065	13	0.010934	no	PNCREAS
chr1_1553619_CAAAAAAA_C_b38	AURKAIP1	2.909	0.00395	0.030182	21	0.010374	no	PNCREAS
chr1_1611567_CT_C_b38	AURKAIP1	-2.874	0.00441	-0.027719	28	0.009645	no	PNCREAS
chr1_943526_CTTT_C_b38	AURKAIP1	-2.808	0.00539	-0.027152	63	0.009671	no	PNCREAS
chr1_1877316_A_AATATAT_b38	AURKAIP1	2.792	0.00565	0.055847	3	0.020004	no	PNCREAS
chr1_1866635_T_TA_b38	AURKAIP1	2.79	0.00567	0.02782	34	0.00997	no	PNCREAS
chr1_1216593_G_C_b38	AURKAIP1	-2.69	0.00763	-0.030479	10	0.011332	no	PNCREAS
chr1_1212042_C_T_b38	AURKAIP1	2.64	0.00881	0.026291	22	0.009959	no	PNCREAS
chr1_1186100_T_C_b38	AURKAIP1	-2.635	0.00895	-0.036544	5	0.01387	no	PNCREAS
chr1_1186816_A_G_b38	AURKAIP1	2.628	0.00911	0.036282	7	0.013804	no	PNCREAS
chr1_928252_C_T_b38	AURKAIP1	2.622	0.00929	0.03964	13	0.01512	no	PNCREAS
chr1_1663949_A_G_b38	AURKAIP1	-3.239	0.00141	-0.049072	5	0.01515	yes	PTTARY
chr1_2059723_G_A_b38	AURKAIP1	-3.118	0.0021	-0.040245	16	0.012909	yes	PTTARY
chr1_1324149_G_A_b38	AURKAIP1	-3.021	0.00286	-0.02462	45	0.00815	yes	PTTARY
chr1_928131_T_C_b38	AURKAIP1	-2.878	0.00444	-0.036523	8	0.012689	yes	PTTARY
chr1_2069153_C_A_b38	AURKAIP1	-2.691	0.00773	-0.035058	15	0.013026	yes	PTTARY
chr1_1240684_G_GCCGCCCCCATTCACCCCGGCCGTGGTCCCTGCCCCAGCCCCCA_b38	AURKAIP1	-3.474	0.00063	-0.072954	5	0.020998	no	PTTARY
chr1_1240648_T_TCATTCACCCCGGCCGTGGTCCCTGCCCCAGCCCCCGCCGCCCC_b38	AURKAIP1	3.025	0.00282	0.024808	37	0.0082	no	PTTARY
chr1_2071051_C_CACCTGGGCGTGTGACCTGGGCGTGTG_b38	AURKAIP1	-2.968	0.00337	-0.042548	7	0.014334	no	PTTARY
chr1_2056821_T_C_b38	AURKAIP1	-2.924	0.00387	-0.038292	15	0.013098	no	PTTARY
chr1_1750589_G_A_b38	AURKAIP1	-2.714	0.00723	-0.043203	11	0.015916	no	PTTARY
chr1_2070417_A_G_b38	AURKAIP1	-2.647	0.00877	-0.028558	33	0.010787	no	PTTARY
chr1_2072553_GC_G_b38	AURKAIP1	-2.647	0.00877	-0.028558	33	0.010787	no	PTTARY
chr1_2074669_A_G_b38	AURKAIP1	-2.647	0.00877	-0.028558	33	0.010787	no	PTTARY
chr1_2056605_G_C_b38	AURKAIP1	-2.609	0.00979	-0.037713	7	0.014457	no	PTTARY
chr1_1812407_T_TAC_b38	AURKAIP1	3.287	0.00121	0.066058	5	0.020094	yes	PRSTTE
chr1_1479205_A_C_b38	AURKAIP1	3.116	0.00213	0.072047	8	0.023123	yes	PRSTTE
chr1_903723_A_G_b38	AURKAIP1	2.888	0.00435	0.04784	17	0.016564	yes	PRSTTE
chr1_2363827_A_T_b38	AURKAIP1	-2.842	0.005	-0.066212	8	0.023297	yes	PRSTTE
chr1_897843_C_T_b38	AURKAIP1	2.83	0.00518	0.046348	20	0.016376	yes	PRSTTE
chr1_897922_C_T_b38	AURKAIP1	2.83	0.00518	0.046348	20	0.016376	yes	PRSTTE
chr1_898444_T_C_b38	AURKAIP1	2.83	0.00518	0.046348	20	0.016376	yes	PRSTTE
chr1_1701564_CG_C_b38	AURKAIP1	2.81	0.00549	0.037907	39	0.013489	yes	PRSTTE
chr1_2037520_G_A_b38	AURKAIP1	-2.757	0.00642	-0.043506	24	0.015778	yes	PRSTTE
chr1_899452_G_C_b38	AURKAIP1	2.751	0.00655	0.045266	19	0.016455	yes	PRSTTE
chr1_2005946_C_A_b38	AURKAIP1	-2.66	0.00851	-0.044769	13	0.016829	yes	PRSTTE
chr1_901516_T_C_b38	AURKAIP1	2.618	0.00959	0.044017	21	0.016812	yes	PRSTTE
chr1_586069_T_A_b38	AURKAIP1	2.875	0.00452	0.079571	5	0.027673	no	PRSTTE
chr1_1613160_C_CTT_b38	AURKAIP1	2.692	0.00777	0.070013	5	0.02601	no	PRSTTE
chr1_791564_C_G_b38	AURKAIP1	-2.687	0.00788	-0.047964	25	0.017849	no	PRSTTE
chr1_1439454_A_G_b38	AURKAIP1	2.678	0.00808	0.047596	22	0.017772	no	PRSTTE
chr1_1450322_CAA_C_b38	AURKAIP1	3.389	0.000764	0.031202	6	0.009207	yes	SKINNS
chr1_1379091_T_G_b38	AURKAIP1	-3.142	0.00179	-0.021917	15	0.006975	yes	SKINNS
chr1_1671097_G_C_b38	AURKAIP1	-3.086	0.00216	-0.015972	52	0.005176	yes	SKINNS
chr1_596700_T_C_b38	AURKAIP1	3.038	0.00252	0.02082	12	0.006852	yes	SKINNS
chr1_1671148_C_T_b38	AURKAIP1	-3.019	0.00268	-0.015683	53	0.005195	yes	SKINNS
chr1_928131_T_C_b38	AURKAIP1	-2.952	0.00332	-0.017107	27	0.005795	yes	SKINNS
chr1_1102614_TAAAAAAAAA_T_b38	AURKAIP1	2.939	0.00347	0.035886	5	0.012212	yes	SKINNS
chr1_1976834_T_C_b38	AURKAIP1	2.893	0.004	0.036643	16	0.012667	yes	SKINNS
chr1_597685_T_TA_b38	AURKAIP1	2.819	0.00503	0.025657	10	0.009102	yes	SKINNS
chr1_1070689_G_A_b38	AURKAIP1	2.809	0.00519	0.023248	4	0.008277	yes	SKINNS
chr1_1102596_G_T_b38	AURKAIP1	2.758	0.00606	0.036278	3	0.013155	yes	SKINNS
chr1_596797_T_TCA_b38	AURKAIP1	2.739	0.00641	0.02381	6	0.008693	yes	SKINNS
chr1_1422828_G_T_b38	AURKAIP1	2.716	0.00686	0.025719	3	0.009469	yes	SKINNS
chr1_1991913_G_A_b38	AURKAIP1	2.702	0.00716	0.041982	4	0.01554	yes	SKINNS
chr1_1440430_C_G_b38	AURKAIP1	2.696	0.00729	0.016116	36	0.005978	yes	SKINNS
chr1_1874605_T_TAA_b38	AURKAIP1	-2.689	0.00743	-0.028173	11	0.010475	yes	SKINNS
chr1_1690745_G_GA_b38	AURKAIP1	-2.681	0.0076	-0.031987	6	0.011929	yes	SKINNS
chr1_1818305_T_TAA_b38	AURKAIP1	2.62	0.00908	0.035816	3	0.013668	yes	SKINNS
chr1_1751981_A_T_b38	AURKAIP1	2.616	0.00919	0.016042	42	0.006132	yes	SKINNS
chr1_1750508_A_C_b38	AURKAIP1	3.087	0.00215	0.013635	118	0.004417	no	SKINNS
chr1_1750528_G_A_b38	AURKAIP1	2.945	0.0034	0.013147	115	0.004464	no	SKINNS
chr1_1509914_T_TA_b38	AURKAIP1	2.925	0.00362	0.028051	3	0.00959	no	SKINNS
chr1_1367028_A_G_b38	AURKAIP1	-2.886	0.00409	-0.020375	14	0.007059	no	SKINNS
chr1_1971066_C_T_b38	AURKAIP1	2.829	0.00488	0.033069	12	0.011689	no	SKINNS
chr1_860178_C_CTTTT_b38	AURKAIP1	-2.803	0.00528	-0.030938	5	0.011036	no	SKINNS
chr1_789481_G_A_b38	AURKAIP1	-2.759	0.00604	-0.022343	3	0.008099	no	SKINNS
chr1_1366941_T_TGTGTGCA_b38	AURKAIP1	-2.698	0.00723	-0.020167	10	0.007473	no	SKINNS
chr1_1366951_A_AGT_b38	AURKAIP1	-2.698	0.00723	-0.020167	10	0.007473	no	SKINNS
chr1_1890472_C_G_b38	AURKAIP1	-2.664	0.00801	-0.02324	5	0.008725	no	SKINNS
chr1_1186850_G_GT_b38	AURKAIP1	2.662	0.00804	0.020179	6	0.00758	no	SKINNS
chr1_1257406_C_A_b38	AURKAIP1	-2.607	0.00945	-0.030353	8	0.011644	no	SKINNS
chr1_928131_T_C_b38	AURKAIP1	-3.553	0.000415	-0.017447	30	0.004911	yes	SKNS
chr1_2085014_GA_G_b38	AURKAIP1	-3.098	0.00205	-0.018306	7	0.005908	yes	SKNS
chr1_2075002_G_A_b38	AURKAIP1	-3.059	0.00234	-0.018091	10	0.005915	yes	SKNS
chr1_2079413_A_G_b38	AURKAIP1	-3.045	0.00244	-0.018344	9	0.006023	yes	SKNS
chr1_2079933_C_A_b38	AURKAIP1	-3.045	0.00244	-0.018344	9	0.006023	yes	SKNS
chr1_1583825_T_C_b38	AURKAIP1	-2.992	0.0029	-0.026014	3	0.008693	yes	SKNS
chr1_2363813_T_A_b38	AURKAIP1	2.864	0.00435	0.018868	19	0.006588	yes	SKNS
chr1_796652_A_C_b38	AURKAIP1	-2.863	0.00436	-0.016119	15	0.00563	yes	SKNS
chr1_2081307_C_T_b38	AURKAIP1	-2.849	0.00456	-0.01722	9	0.006044	yes	SKNS
chr1_633672_C_T_b38	AURKAIP1	-2.827	0.00488	-0.035977	6	0.012727	yes	SKNS
chr1_2037780_C_CA_b38	AURKAIP1	-2.796	0.00536	-0.021614	4	0.00773	yes	SKNS
chr1_1472158_C_G_b38	AURKAIP1	2.794	0.00539	0.020871	19	0.007469	yes	SKNS
chr1_851741_T_A_b38	AURKAIP1	-2.726	0.00662	-0.016478	14	0.006044	yes	SKNS
chr1_1265603_T_TTGTG_b38	AURKAIP1	-2.705	0.00705	-0.014083	18	0.005206	yes	SKNS
chr1_1339884_A_ACAGCCGCATGTCCCCCAGCAGCCCCCACAGACCCACCCGCAGCCGCATGTCCCCCAGCAGCCCCCACAGACCCACCCG_b38	AURKAIP1	-2.699	0.00718	-0.031743	4	0.011762	yes	SKNS
chr1_938178_G_T_b38	AURKAIP1	-2.696	0.00723	-0.011891	84	0.00441	yes	SKNS
chr1_749482_G_A_b38	AURKAIP1	2.669	0.00784	0.023251	16	0.008711	yes	SKNS
chr1_954724_G_A_b38	AURKAIP1	2.665	0.00793	0.013383	25	0.005021	yes	SKNS
chr1_790136_A_AGAATG_b38	AURKAIP1	-2.642	0.00849	-0.014085	22	0.005332	yes	SKNS
chr1_2007629_CA_C_b38	AURKAIP1	2.641	0.00852	0.011999	116	0.004544	yes	SKNS
chr1_1186850_GT_G_b38	AURKAIP1	2.629	0.0088	0.016875	10	0.006418	yes	SKNS
chr1_1306149_A_G_b38	AURKAIP1	-2.622	0.00899	-0.022233	3	0.008479	yes	SKNS
chr1_2244139_G_A_b38	AURKAIP1	2.6	0.00957	0.024334	5	0.009358	yes	SKNS
chr1_816108_G_GA_b38	AURKAIP1	-3.772	0.00018	-0.023722	13	0.006289	no	SKNS
chr1_727477_G_A_b38	AURKAIP1	3.705	0.000233	0.020287	47	0.005475	no	SKNS
chr1_726821_G_A_b38	AURKAIP1	3.414	0.000689	0.01723	49	0.005047	no	SKNS
chr1_789568_TATGGA_T_b38	AURKAIP1	3.365	0.00082	0.017423	49	0.005177	no	SKNS
chr1_2058306_AT_A_b38	AURKAIP1	-3.351	0.000861	-0.025524	5	0.007616	no	SKNS
chr1_758443_G_C_b38	AURKAIP1	-3.341	0.000892	-0.018949	15	0.005671	no	SKNS
chr1_814016_T_G_b38	AURKAIP1	-3.332	0.000922	-0.01577	48	0.004733	no	SKNS
chr1_852019_G_T_b38	AURKAIP1	3.307	0.00101	0.018259	42	0.005521	no	SKNS
chr1_722408_G_C_b38	AURKAIP1	3.265	0.00116	0.017859	47	0.005469	no	SKNS
chr1_852305_G_T_b38	AURKAIP1	3.257	0.0012	0.018165	51	0.005576	no	SKNS
chr1_2245788_C_CTTT_b38	AURKAIP1	3.244	0.00125	0.024009	19	0.007401	no	SKNS
chr1_1979684_G_A_b38	AURKAIP1	3.24	0.00127	0.031507	9	0.009724	no	SKNS
chr1_630026_C_T_b38	AURKAIP1	-3.105	0.002	-0.020437	12	0.006581	no	SKNS
chr1_794299_C_G_b38	AURKAIP1	3.082	0.00216	0.016262	42	0.005276	no	SKNS
chr1_851805_G_A_b38	AURKAIP1	3.03	0.00257	0.016399	36	0.005413	no	SKNS
chr1_840409_T_TAAA_b38	AURKAIP1	-3.026	0.00259	-0.019963	12	0.006596	no	SKNS
chr1_727717_G_C_b38	AURKAIP1	3.016	0.00268	0.016779	49	0.005564	no	SKNS
chr1_851771_G_A_b38	AURKAIP1	-2.99	0.00292	-0.017946	19	0.006001	no	SKNS
chr1_847601_C_T_b38	AURKAIP1	-2.986	0.00296	-0.016695	29	0.005591	no	SKNS
chr1_2078147_C_T_b38	AURKAIP1	-2.975	0.00307	-0.017857	9	0.006003	no	SKNS
chr1_850867_G_A_b38	AURKAIP1	2.967	0.00314	0.016288	27	0.005489	no	SKNS
chr1_1521298_C_CA_b38	AURKAIP1	2.96	0.00322	0.02205	17	0.00745	no	SKNS
chr1_852226_G_T_b38	AURKAIP1	-2.96	0.00322	-0.016643	21	0.005624	no	SKNS
chr1_2036515_C_T_b38	AURKAIP1	2.956	0.00325	0.012383	66	0.004189	no	SKNS
chr1_654132_T_C_b38	AURKAIP1	-2.942	0.0034	-0.027783	4	0.009444	no	SKNS
chr1_727242_G_A_b38	AURKAIP1	-2.941	0.00342	-0.0165	18	0.005611	no	SKNS
chr1_818161_G_A_b38	AURKAIP1	-2.937	0.00345	-0.016638	29	0.005664	no	SKNS
chr1_629906_C_T_b38	AURKAIP1	-2.9	0.00388	-0.018112	12	0.006245	no	SKNS
chr1_758351_A_G_b38	AURKAIP1	-2.899	0.0039	-0.016347	16	0.005639	no	SKNS
chr1_2037520_G_A_b38	AURKAIP1	2.896	0.00393	0.012168	65	0.004201	no	SKNS
chr1_2070129_T_C_b38	AURKAIP1	-2.889	0.00403	-0.016944	10	0.005866	no	SKNS
chr1_1743586_T_TAC_b38	AURKAIP1	-2.865	0.00434	-0.012753	76	0.004452	no	SKNS
chr1_814758_G_A_b38	AURKAIP1	-2.865	0.00434	-0.016708	11	0.005833	no	SKNS
chr1_833758_CAT_C_b38	AURKAIP1	-2.857	0.00444	-0.015797	25	0.005529	no	SKNS
chr1_1097584_A_ATT_b38	AURKAIP1	2.855	0.00447	0.025002	3	0.008757	no	SKNS
chr1_633824_T_C_b38	AURKAIP1	-2.842	0.00466	-0.040677	4	0.014313	no	SKNS
chr1_727034_C_T_b38	AURKAIP1	-2.828	0.00487	-0.015152	24	0.005359	no	SKNS
chr1_2035575_G_A_b38	AURKAIP1	2.792	0.00543	0.011854	61	0.004246	no	SKNS
chr1_2079555_G_A_b38	AURKAIP1	-2.77	0.0058	-0.016722	9	0.006036	no	SKNS
chr1_822556_C_A_b38	AURKAIP1	2.764	0.0059	0.014919	29	0.005397	no	SKNS
chr1_506032_AAAC_A_b38	AURKAIP1	2.755	0.00606	0.041387	4	0.015021	no	SKNS
chr1_843942_A_G_b38	AURKAIP1	-2.75	0.00616	-0.015306	23	0.005566	no	SKNS
chr1_854133_GA_G_b38	AURKAIP1	-2.75	0.00616	-0.015306	23	0.005566	no	SKNS
chr1_2089675_C_T_b38	AURKAIP1	-2.746	0.00623	-0.015342	27	0.005587	no	SKNS
chr1_855811_G_A_b38	AURKAIP1	-2.745	0.00626	-0.015346	23	0.005591	no	SKNS
chr1_830725_T_A_b38	AURKAIP1	2.745	0.00626	0.014442	53	0.005262	no	SKNS
chr1_679602_T_C_b38	AURKAIP1	2.742	0.00632	0.040886	4	0.014914	no	SKNS
chr1_2022137_G_A_b38	AURKAIP1	2.731	0.00653	0.011522	84	0.00422	no	SKNS
chr1_845405_T_A_b38	AURKAIP1	2.727	0.0066	0.015394	36	0.005645	no	SKNS
chr1_828389_AT_A_b38	AURKAIP1	-2.716	0.00683	-0.015145	23	0.005577	no	SKNS
chr1_2090485_G_GC_b38	AURKAIP1	-2.714	0.00686	-0.016144	10	0.005948	no	SKNS
chr1_813498_G_T_b38	AURKAIP1	2.698	0.00721	0.013506	43	0.005007	no	SKNS
chr1_612402_C_T_b38	AURKAIP1	2.695	0.00727	0.023303	3	0.008647	no	SKNS
chr1_851615_G_A_b38	AURKAIP1	-2.668	0.00786	-0.015261	17	0.00572	no	SKNS
chr1_1811085_T_A_b38	AURKAIP1	2.666	0.00792	0.028046	4	0.010522	no	SKNS
chr1_841742_A_T_b38	AURKAIP1	2.665	0.00794	0.014879	29	0.005584	no	SKNS
chr1_849670_G_A_b38	AURKAIP1	2.655	0.00818	0.01505	51	0.005669	no	SKNS
chr1_850609_T_C_b38	AURKAIP1	2.655	0.00818	0.01505	51	0.005669	no	SKNS
chr1_1741733_T_C_b38	AURKAIP1	-2.653	0.00823	-0.010874	112	0.004099	no	SKNS
chr1_1739883_C_T_b38	AURKAIP1	-2.639	0.00856	-0.010989	89	0.004164	no	SKNS
chr1_843365_A_G_b38	AURKAIP1	-2.631	0.00877	-0.014662	21	0.005574	no	SKNS
chr1_818802_A_G_b38	AURKAIP1	2.627	0.00887	0.015026	33	0.00572	no	SKNS
chr1_818812_A_G_b38	AURKAIP1	2.627	0.00887	0.015026	33	0.00572	no	SKNS
chr1_818954_T_C_b38	AURKAIP1	2.627	0.00887	0.015026	33	0.00572	no	SKNS
chr1_839801_A_G_b38	AURKAIP1	-2.625	0.00891	-0.014553	22	0.005544	no	SKNS
chr1_816376_T_C_b38	AURKAIP1	-2.617	0.00913	-0.014972	20	0.005722	no	SKNS
chr1_1763636_G_A_b38	AURKAIP1	-2.615	0.00916	-0.014229	34	0.00544	no	SKNS
chr1_826893_G_A_b38	AURKAIP1	2.589	0.0099	0.014713	26	0.005684	no	SKNS
chr1_840409_TA_T_b38	AURKAIP1	-3.405	0.000875	-0.044765	23	0.013146	yes	SNTTRM
chr1_899548_A_G_b38	AURKAIP1	-3.116	0.00225	-0.044058	5	0.014139	yes	SNTTRM
chr1_899619_G_A_b38	AURKAIP1	-3.116	0.00225	-0.044058	5	0.014139	yes	SNTTRM
chr1_2211288_C_G_b38	AURKAIP1	3.111	0.00228	0.033362	30	0.010722	yes	SNTTRM
chr1_591242_C_T_b38	AURKAIP1	-3.08	0.00251	-0.059471	3	0.019308	yes	SNTTRM
chr1_889689_G_C_b38	AURKAIP1	3.011	0.00312	0.047069	12	0.015633	yes	SNTTRM
chr1_904947_G_A_b38	AURKAIP1	-2.949	0.00376	-0.045189	3	0.015321	yes	SNTTRM
chr1_903007_T_C_b38	AURKAIP1	-2.947	0.00379	-0.043408	3	0.014729	yes	SNTTRM
chr1_904478_CGCCTCCTCCGAACGCGGCCGCCTCCTCCTCCGAACGTGGCCTCCTCCGAACGCGGCCGCCTCCTCCTCCGAACGCGGCCGCCTCCTCCTCCGAACGTG_C_b38	AURKAIP1	-2.933	0.00395	-0.042105	5	0.014356	yes	SNTTRM
chr1_2139901_C_A_b38	AURKAIP1	-2.88	0.00464	-0.033182	24	0.011523	yes	SNTTRM
chr1_2140326_A_G_b38	AURKAIP1	-2.88	0.00464	-0.033182	24	0.011523	yes	SNTTRM
chr1_633375_G_A_b38	AURKAIP1	-2.801	0.00586	-0.040484	9	0.014454	yes	SNTTRM
chr1_1606552_A_G_b38	AURKAIP1	-2.796	0.00594	-0.033257	14	0.011894	yes	SNTTRM
chr1_2284470_A_C_b38	AURKAIP1	2.776	0.0063	0.03123	22	0.011251	yes	SNTTRM
chr1_2206812_A_G_b38	AURKAIP1	2.753	0.00673	0.030074	33	0.010923	yes	SNTTRM
chr1_877371_T_C_b38	AURKAIP1	2.701	0.00782	0.078177	4	0.028946	yes	SNTTRM
chr1_2186900_A_G_b38	AURKAIP1	2.676	0.00838	0.031169	24	0.011646	yes	SNTTRM
chr1_2186920_A_G_b38	AURKAIP1	2.676	0.00838	0.031169	24	0.011646	yes	SNTTRM
chr1_910698_C_T_b38	AURKAIP1	-2.655	0.00889	-0.036409	5	0.013711	yes	SNTTRM
chr1_924024_C_G_b38	AURKAIP1	-3.178	0.00185	-0.076937	7	0.024212	no	SNTTRM
chr1_591460_T_C_b38	AURKAIP1	3.133	0.00213	0.069396	4	0.022148	no	SNTTRM
chr1_779047_G_A_b38	AURKAIP1	3.098	0.00238	0.055345	6	0.017865	no	SNTTRM
chr1_809641_G_T_b38	AURKAIP1	-3.076	0.00255	-0.061278	3	0.019924	no	SNTTRM
chr1_994321_C_CA_b38	AURKAIP1	-2.982	0.00341	-0.039873	15	0.013373	no	SNTTRM
chr1_788511_G_C_b38	AURKAIP1	2.948	0.00378	0.054874	4	0.018613	no	SNTTRM
chr1_624752_C_T_b38	AURKAIP1	-2.868	0.00481	-0.044693	3	0.015585	no	SNTTRM
chr1_1948412_A_AATAT_b38	AURKAIP1	-2.795	0.00596	-0.025543	54	0.00914	no	SNTTRM
chr1_2181138_C_A_b38	AURKAIP1	2.758	0.00664	0.032125	21	0.011649	no	SNTTRM
chr1_1976834_T_C_b38	AURKAIP1	2.757	0.00666	0.073617	6	0.026704	no	SNTTRM
chr1_910255_C_T_b38	AURKAIP1	-2.698	0.00788	-0.038058	4	0.014106	no	SNTTRM
chr1_812899_A_T_b38	AURKAIP1	-2.695	0.00794	-0.055311	3	0.02052	no	SNTTRM
chr1_814476_C_T_b38	AURKAIP1	2.638	0.00932	0.041606	8	0.015769	no	SNTTRM
chr1_924305_G_A_b38	AURKAIP1	-2.613	0.01	-0.037679	5	0.014418	no	SNTTRM
chr1_908943_CGTTGCTGGT_C_b38	AURKAIP1	-3.648	0.000343	-0.041819	11	0.011465	yes	SPLEEN
chr1_2285626_G_A_b38	AURKAIP1	-3.494	0.000594	-0.034102	10	0.009759	yes	SPLEEN
chr1_2035177_A_G_b38	AURKAIP1	-3.134	0.002	-0.029957	10	0.009559	yes	SPLEEN
chr1_2037392_A_G_b38	AURKAIP1	-3.132	0.00202	-0.030012	10	0.009581	yes	SPLEEN
chr1_2287338_A_AT_b38	AURKAIP1	-3.06	0.00254	-0.025408	27	0.008303	yes	SPLEEN
chr1_1332779_C_T_b38	AURKAIP1	3.008	0.00299	0.041979	5	0.013955	yes	SPLEEN
chr1_1991852_G_A_b38	AURKAIP1	-2.965	0.00342	-0.025554	18	0.008617	yes	SPLEEN
chr1_2022373_C_T_b38	AURKAIP1	-2.807	0.00553	-0.021502	35	0.00766	yes	SPLEEN
chr1_2022997_G_A_b38	AURKAIP1	-2.798	0.00568	-0.024876	17	0.00889	yes	SPLEEN
chr1_2011852_C_T_b38	AURKAIP1	-2.701	0.00756	-0.020726	35	0.007674	yes	SPLEEN
chr1_2016961_C_A_b38	AURKAIP1	-2.701	0.00756	-0.020726	35	0.007674	yes	SPLEEN
chr1_2341464_A_G_b38	AURKAIP1	2.681	0.00801	0.029013	8	0.010823	yes	SPLEEN
chr1_2029487_T_C_b38	AURKAIP1	-2.649	0.00876	-0.024955	11	0.009419	yes	SPLEEN
chr1_2010219_C_T_b38	AURKAIP1	-2.639	0.00902	-0.020638	28	0.00782	yes	SPLEEN
chr1_1606559_C_G_b38	AURKAIP1	-3.115	0.00213	-0.029178	15	0.009368	no	SPLEEN
chr1_788418_CAG_C_b38	AURKAIP1	-2.898	0.00421	-0.036884	6	0.012729	no	SPLEEN
chr1_1331945_G_GC_b38	AURKAIP1	2.818	0.00535	0.040712	7	0.014446	no	SPLEEN
chr1_1694689_C_CA_b38	AURKAIP1	2.816	0.00539	0.061173	3	0.021727	no	SPLEEN
chr1_1606507_GTGGGC_G_b38	AURKAIP1	-2.804	0.00558	-0.022362	51	0.007974	no	SPLEEN
chr1_1341079_C_A_b38	AURKAIP1	-2.781	0.00597	-0.034895	5	0.012546	no	SPLEEN
chr1_1353091_C_T_b38	AURKAIP1	-2.746	0.00663	-0.037011	7	0.01348	no	SPLEEN
chr1_1353443_A_G_b38	AURKAIP1	-2.741	0.00673	-0.037023	8	0.013508	no	SPLEEN
chr1_800605_G_A_b38	AURKAIP1	2.689	0.00781	0.034661	5	0.012888	no	SPLEEN
chr1_1587352_A_G_b38	AURKAIP1	-2.678	0.00807	-0.025776	24	0.009625	no	SPLEEN
chr1_779047_G_A_b38	AURKAIP1	-2.677	0.00808	-0.032762	9	0.012236	no	SPLEEN
chr1_778639_A_G_b38	AURKAIP1	2.627	0.00934	0.033831	5	0.01288	no	SPLEEN
chr1_1608244_T_C_b38	AURKAIP1	-2.627	0.00934	-0.024718	12	0.00941	no	SPLEEN
chr1_788511_G_C_b38	AURKAIP1	-2.624	0.00941	-0.032626	8	0.012434	no	SPLEEN
chr1_2022137_G_A_b38	AURKAIP1	-2.615	0.00966	-0.020382	37	0.007795	no	SPLEEN
chr1_2213543_G_T_b38	AURKAIP1	3.224	0.00142	0.037149	31	0.011523	yes	STMACH
chr1_1991778_A_G_b38	AURKAIP1	3.161	0.00175	0.039235	18	0.012413	yes	STMACH
chr1_2137585_GCCT_G_b38	AURKAIP1	-3.029	0.0027	-0.039465	12	0.013031	yes	STMACH
chr1_2132033_G_C_b38	AURKAIP1	-2.881	0.00429	-0.037781	11	0.013115	yes	STMACH
chr1_2189294_T_TG_b38	AURKAIP1	-2.748	0.00641	-0.03682	11	0.013401	yes	STMACH
chr1_1991690_A_G_b38	AURKAIP1	-2.742	0.00652	-0.029401	65	0.010722	yes	STMACH
chr1_1468636_G_A_b38	AURKAIP1	2.731	0.00674	0.069183	3	0.025336	yes	STMACH
chr1_2118713_C_CTG_b38	AURKAIP1	-2.701	0.00735	-0.044406	4	0.016439	yes	STMACH
chr1_2106495_A_G_b38	AURKAIP1	-2.69	0.00759	-0.050113	6	0.018628	yes	STMACH
chr1_1523187_A_G_b38	AURKAIP1	2.643	0.00869	0.052064	18	0.019697	yes	STMACH
chr1_2173095_TCCAC_T_b38	AURKAIP1	-2.639	0.0088	-0.034789	11	0.013183	yes	STMACH
chr1_2179409_T_G_b38	AURKAIP1	-2.616	0.0094	-0.034139	12	0.013051	yes	STMACH
chr1_920719_T_G_b38	AURKAIP1	2.602	0.00979	0.028263	49	0.010863	yes	STMACH
chr1_920728_A_G_b38	AURKAIP1	2.602	0.00979	0.028263	49	0.010863	yes	STMACH
chr1_2094608_G_A_b38	AURKAIP1	-3.049	0.00252	-0.092638	3	0.030381	no	STMACH
chr1_1479334_A_G_b38	AURKAIP1	2.874	0.00437	0.057499	23	0.020004	no	STMACH
chr1_1102614_TAAAAAAAAA_T_b38	AURKAIP1	-2.828	0.00504	-0.073879	4	0.026125	no	STMACH
chr1_928141_C_G_b38	AURKAIP1	-2.794	0.00558	-0.052333	4	0.01873	no	STMACH
chr1_807281_A_C_b38	AURKAIP1	-2.741	0.00655	-0.088671	3	0.032355	no	STMACH
chr1_1516110_G_A_b38	AURKAIP1	2.667	0.00812	0.058248	5	0.021841	no	STMACH
chr1_1458448_C_CT_b38	AURKAIP1	2.662	0.00824	0.05646	5	0.02121	no	STMACH
chr1_1217733_G_A_b38	AURKAIP1	3.385	0.00082	0.039412	3	0.011645	yes	TESTIS
chr1_598862_C_T_b38	AURKAIP1	3.217	0.00146	0.030844	3	0.009588	yes	TESTIS
chr1_1607341_CTT_C_b38	AURKAIP1	3.031	0.00268	0.022632	60	0.007468	yes	TESTIS
chr1_1224137_T_C_b38	AURKAIP1	2.936	0.00362	0.040462	3	0.013783	yes	TESTIS
chr1_1232800_G_C_b38	AURKAIP1	-2.755	0.00627	-0.045025	4	0.016341	yes	TESTIS
chr1_2155122_A_G_b38	AURKAIP1	2.62	0.00931	0.029297	4	0.011184	yes	TESTIS
chr1_1982325_C_T_b38	AURKAIP1	2.598	0.00991	0.024679	7	0.009501	yes	TESTIS
chr1_2120293_G_GTT_b38	AURKAIP1	-2.595	0.00997	-0.048884	4	0.018836	yes	TESTIS
chr1_1657902_T_TA_b38	AURKAIP1	3.959	9.66e-05	0.043743	9	0.011049	no	TESTIS
chr1_597817_A_G_b38	AURKAIP1	3.057	0.00246	0.043148	5	0.014113	no	TESTIS
chr1_1067054_C_T_b38	AURKAIP1	3.001	0.00295	0.02153	60	0.007175	no	TESTIS
chr1_1949036_C_CTCCT_b38	AURKAIP1	-2.966	0.00329	-0.041172	4	0.013882	no	TESTIS
chr1_1324134_G_GGCTGGGGGGCTGGGAGGCTGAGAGGCTGGGGAGCTGGGGA_b38	AURKAIP1	2.954	0.00342	0.047913	4	0.016221	no	TESTIS
chr1_2274109_A_C_b38	AURKAIP1	2.879	0.00431	0.018937	61	0.006577	no	TESTIS
chr1_1812407_T_TAC_b38	AURKAIP1	2.82	0.00516	0.027373	9	0.009705	no	TESTIS
chr1_2241549_T_C_b38	AURKAIP1	2.817	0.00522	0.018179	86	0.006454	no	TESTIS
chr1_1029386_G_GATCAGTGTCTATGCAGGCAGGTGGGGGGGAC_b38	AURKAIP1	2.813	0.00528	0.018346	59	0.006523	no	TESTIS
chr1_2106507_A_G_b38	AURKAIP1	-2.789	0.00566	-0.038015	4	0.013629	no	TESTIS
chr1_2235168_G_GT_b38	AURKAIP1	2.714	0.00707	0.017682	85	0.006514	no	TESTIS
chr1_1063202_G_C_b38	AURKAIP1	2.704	0.0073	0.019029	85	0.007038	no	TESTIS
chr1_1844391_CA_C_b38	AURKAIP1	2.695	0.0075	0.02466	16	0.009152	no	TESTIS
chr1_2252962_T_G_b38	AURKAIP1	2.691	0.00758	0.017145	88	0.006372	no	TESTIS
chr1_1060101_T_G_b38	AURKAIP1	2.689	0.00761	0.01923	82	0.007151	no	TESTIS
chr1_2271528_T_C_b38	AURKAIP1	2.669	0.00807	0.017033	90	0.006381	no	TESTIS
chr1_1285621_A_G_b38	AURKAIP1	-2.663	0.00821	-0.059924	3	0.022499	no	TESTIS
chr1_1286671_A_G_b38	AURKAIP1	-2.663	0.00821	-0.059924	3	0.022499	no	TESTIS
chr1_679602_T_C_b38	AURKAIP1	2.661	0.00825	0.058216	3	0.021874	no	TESTIS
chr1_514446_TA_T_b38	AURKAIP1	2.66	0.00828	0.024443	6	0.009187	no	TESTIS
chr1_2233496_G_T_b38	AURKAIP1	2.658	0.00835	0.017249	85	0.006491	no	TESTIS
chr1_2262576_C_A_b38	AURKAIP1	2.651	0.0085	0.016821	87	0.006345	no	TESTIS
chr1_2313466_C_T_b38	AURKAIP1	-2.638	0.00882	-0.018747	65	0.007106	no	TESTIS
chr1_2261200_G_C_b38	AURKAIP1	2.636	0.00888	0.016735	88	0.006349	no	TESTIS
chr1_2251031_G_A_b38	AURKAIP1	2.625	0.00916	0.016723	87	0.006371	no	TESTIS
chr1_1934821_C_CGTTGTAGGTACGTGTGTACGTGGGTGTTAGGTTGTAGGTACACACGTGTATATGTGGGTGTTAG_b38	AURKAIP1	2.608	0.00963	0.017759	39	0.00681	no	TESTIS
chr1_1056602_T_TGTGGGTGCGTGTGC_b38	AURKAIP1	2.602	0.00979	0.016798	58	0.006456	no	TESTIS
chr1_633846_C_A_b38	AURKAIP1	-3.257	0.0012	-0.044317	11	0.013608	yes	THYROID
chr1_1379083_AT_A_b38	AURKAIP1	-3.245	0.00125	-0.02364	32	0.007285	yes	THYROID
chr1_2224430_C_T_b38	AURKAIP1	3.075	0.00222	0.026646	9	0.008666	yes	THYROID
chr1_2285572_G_GTT_b38	AURKAIP1	3.014	0.00271	0.027804	6	0.009225	yes	THYROID
chr1_1773676_TTGTG_T_b38	AURKAIP1	-3.006	0.00278	-0.035135	4	0.011687	yes	THYROID
chr1_1285045_A_G_b38	AURKAIP1	2.998	0.00285	0.048105	3	0.016047	yes	THYROID
chr1_1366427_AGTGTGATTGAATGAGT_A_b38	AURKAIP1	-2.984	0.00298	-0.021813	53	0.007309	yes	THYROID
chr1_2287498_A_G_b38	AURKAIP1	-2.943	0.0034	-0.028498	3	0.009684	yes	THYROID
chr1_588115_AC_A_b38	AURKAIP1	2.911	0.00376	0.026199	5	0.009	yes	THYROID
chr1_1353203_C_G_b38	AURKAIP1	-2.893	0.00398	-0.030213	5	0.010442	yes	THYROID
chr1_2050447_C_G_b38	AURKAIP1	2.872	0.00425	0.02808	6	0.009776	yes	THYROID
chr1_2287481_T_C_b38	AURKAIP1	-2.848	0.00459	-0.027854	3	0.009782	yes	THYROID
chr1_1278550_T_C_b38	AURKAIP1	2.844	0.00463	0.047216	3	0.016601	yes	THYROID
chr1_1279882_T_C_b38	AURKAIP1	2.844	0.00463	0.047216	3	0.016601	yes	THYROID
chr1_1280416_A_G_b38	AURKAIP1	2.844	0.00463	0.047216	3	0.016601	yes	THYROID
chr1_1284551_G_T_b38	AURKAIP1	2.844	0.00463	0.047216	3	0.016601	yes	THYROID
chr1_2369187_T_TA_b38	AURKAIP1	-2.816	0.00506	-0.03804	7	0.013511	yes	THYROID
chr1_1370113_A_G_b38	AURKAIP1	-2.787	0.00552	-0.020226	50	0.007257	yes	THYROID
chr1_601293_G_A_b38	AURKAIP1	-2.756	0.00607	-0.021991	12	0.007981	yes	THYROID
chr1_1365036_T_TA_b38	AURKAIP1	-2.732	0.00652	-0.037841	7	0.013852	yes	THYROID
chr1_1971434_C_T_b38	AURKAIP1	-2.725	0.00665	-0.016963	41	0.006225	yes	THYROID
chr1_1280469_A_T_b38	AURKAIP1	2.715	0.00685	0.044425	3	0.01636	yes	THYROID
chr1_1108232_CAG_C_b38	AURKAIP1	2.692	0.00734	0.024663	9	0.009161	yes	THYROID
chr1_1108235_CA_C_b38	AURKAIP1	2.662	0.00802	0.024576	8	0.009233	yes	THYROID
chr1_958061_C_CTT_b38	AURKAIP1	2.645	0.00843	0.021918	28	0.008287	yes	THYROID
chr1_1971027_A_C_b38	AURKAIP1	-2.64	0.00855	-0.016553	40	0.00627	yes	THYROID
chr1_1366681_T_TGA_b38	AURKAIP1	2.634	0.0087	0.023255	11	0.00883	yes	THYROID
chr1_1337898_A_G_b38	AURKAIP1	-2.63	0.00881	-0.019315	23	0.007345	yes	THYROID
chr1_1055307_G_A_b38	AURKAIP1	-2.628	0.00886	-0.053295	3	0.020281	yes	THYROID
chr1_1378204_G_C_b38	AURKAIP1	-2.608	0.00937	-0.018902	58	0.007247	yes	THYROID
chr1_2277312_A_C_b38	AURKAIP1	3.805	0.000159	0.031116	11	0.008177	no	THYROID
chr1_2280205_T_A_b38	AURKAIP1	3.744	0.000202	0.029548	11	0.007893	no	THYROID
chr1_2283304_C_T_b38	AURKAIP1	-3.555	0.000413	-0.020127	111	0.005661	no	THYROID
chr1_632487_A_G_b38	AURKAIP1	-3.383	0.000772	-0.043887	17	0.012971	no	THYROID
chr1_789481_G_A_b38	AURKAIP1	3.308	0.00101	0.031274	7	0.009455	no	THYROID
chr1_1969249_A_AGCCCT_b38	AURKAIP1	-3.287	0.00109	-0.022363	29	0.006804	no	THYROID
chr1_2284212_C_G_b38	AURKAIP1	3.17	0.00161	0.026257	11	0.008282	no	THYROID
chr1_2345829_C_CCACACACACA_b38	AURKAIP1	-3.135	0.00182	-0.040527	7	0.012927	no	THYROID
chr1_1269099_C_CCAT_b38	AURKAIP1	-3.027	0.0026	-0.05382	3	0.017781	no	THYROID
chr1_2217310_C_CA_b38	AURKAIP1	-3.016	0.00269	-0.028299	13	0.009382	no	THYROID
chr1_840409_T_TAAA_b38	AURKAIP1	-2.968	0.00314	-0.029004	10	0.009773	no	THYROID
chr1_632199_C_T_b38	AURKAIP1	-2.908	0.0038	-0.035157	18	0.012089	no	THYROID
chr1_1969238_C_T_b38	AURKAIP1	-2.907	0.00381	-0.019563	30	0.00673	no	THYROID
chr1_2282992_C_T_b38	AURKAIP1	-2.889	0.00403	-0.016954	77	0.005868	no	THYROID
chr1_1370429_C_G_b38	AURKAIP1	-2.869	0.00429	-0.04678	9	0.016304	no	THYROID
chr1_1969235_A_G_b38	AURKAIP1	-2.85	0.00456	-0.019305	30	0.006775	no	THYROID
chr1_2275005_A_G_b38	AURKAIP1	2.836	0.00475	0.019149	29	0.006752	no	THYROID
chr1_1261891_CTT_C_b38	AURKAIP1	-2.776	0.00571	-0.047213	3	0.017008	no	THYROID
chr1_1969229_T_A_b38	AURKAIP1	-2.774	0.00575	-0.018727	30	0.006751	no	THYROID
chr1_1362515_C_G_b38	AURKAIP1	-2.773	0.00576	-0.045701	8	0.016481	no	THYROID
chr1_2285572_G_GT_b38	AURKAIP1	-2.741	0.00635	-0.035774	14	0.013053	no	THYROID
chr1_722408_G_C_b38	AURKAIP1	2.732	0.00652	0.020853	44	0.007633	no	THYROID
chr1_1269775_A_C_b38	AURKAIP1	-2.721	0.00674	-0.045514	3	0.016728	no	THYROID
chr1_2187285_C_CT_b38	AURKAIP1	-2.71	0.00696	-0.024832	6	0.009163	no	THYROID
chr1_2204887_GCCCTCAAGCCCCGC_G_b38	AURKAIP1	-2.678	0.00764	-0.022416	18	0.00837	no	THYROID
chr1_1537805_T_G_b38	AURKAIP1	-2.655	0.00819	-0.047176	5	0.017771	no	THYROID
chr1_1361163_AACAC_A_b38	AURKAIP1	-2.653	0.00822	-0.043259	12	0.016304	no	THYROID
chr1_791100_G_GGGA_b38	AURKAIP1	-2.649	0.00832	-0.022647	20	0.008548	no	THYROID
chr1_623755_T_G_b38	AURKAIP1	-2.641	0.00853	-0.033365	9	0.012636	no	THYROID
chr1_1356328_G_A_b38	AURKAIP1	-2.639	0.00858	-0.043576	8	0.016514	no	THYROID
chr1_2150203_C_A_b38	AURKAIP1	-2.621	0.00903	-0.022169	9	0.008458	no	THYROID
chr1_2186119_C_T_b38	AURKAIP1	-2.62	0.00906	-0.022357	8	0.008534	no	THYROID
chr1_1291509_G_A_b38	AURKAIP1	2.608	0.00938	0.037242	3	0.01428	no	THYROID
chr1_1969006_C_T_b38	AURKAIP1	-2.599	0.00963	-0.016619	39	0.006395	no	THYROID
chr1_2103523_C_T_b38	AURKAIP1	-3.364	0.00108	-0.127689	3	0.037958	yes	UTERUS
chr1_1091327_C_A_b38	AURKAIP1	-3.315	0.00126	-0.049179	23	0.014837	yes	UTERUS
chr1_1102614_T_TA_b38	AURKAIP1	3.246	0.00158	0.080323	3	0.024749	yes	UTERUS
chr1_1126645_A_G_b38	AURKAIP1	3.012	0.00326	0.044656	21	0.014824	yes	UTERUS
chr1_1126414_A_G_b38	AURKAIP1	2.987	0.00352	0.045634	15	0.015278	yes	UTERUS
chr1_1126468_A_G_b38	AURKAIP1	2.987	0.00352	0.045634	15	0.015278	yes	UTERUS
chr1_2089675_C_T_b38	AURKAIP1	-2.964	0.00377	-0.06219	5	0.020983	yes	UTERUS
chr1_2107797_G_T_b38	AURKAIP1	2.947	0.00396	0.0647	4	0.021951	yes	UTERUS
chr1_2108657_T_C_b38	AURKAIP1	2.947	0.00396	0.0647	4	0.021951	yes	UTERUS
chr1_2109324_G_A_b38	AURKAIP1	2.947	0.00396	0.0647	4	0.021951	yes	UTERUS
chr1_2109338_C_T_b38	AURKAIP1	2.947	0.00396	0.0647	4	0.021951	yes	UTERUS
chr1_2109346_A_G_b38	AURKAIP1	2.907	0.00447	0.062571	3	0.021527	yes	UTERUS
chr1_2109497_T_C_b38	AURKAIP1	2.907	0.00447	0.062571	3	0.021527	yes	UTERUS
chr1_623755_T_G_b38	AURKAIP1	-2.853	0.00523	-0.07905	3	0.027712	yes	UTERUS
chr1_2103488_A_G_b38	AURKAIP1	-2.816	0.00582	-0.116875	3	0.041508	yes	UTERUS
chr1_2106796_TGACTCTTCAGCAGGCCCCTCTGGTGGGCGAGGACCTCCACACGTGTCACCAGGCCAGGC_T_b38	AURKAIP1	2.814	0.00586	0.069445	3	0.024681	yes	UTERUS
chr1_1091421_T_A_b38	AURKAIP1	-2.79	0.00627	-0.042018	24	0.01506	yes	UTERUS
chr1_1437993_G_A_b38	AURKAIP1	2.781	0.00644	0.055949	5	0.020121	yes	UTERUS
chr1_633365_C_CCA_b38	AURKAIP1	-2.749	0.00705	-0.048777	14	0.017745	yes	UTERUS
chr1_2101817_G_A_b38	AURKAIP1	2.715	0.00777	0.043831	19	0.016145	yes	UTERUS
chr1_2076742_GA_G_b38	AURKAIP1	2.713	0.0078	0.053858	4	0.01985	yes	UTERUS
chr1_626781_G_GGT_b38	AURKAIP1	3.508	0.000669	0.09776	3	0.02787	no	UTERUS
chr1_1124975_G_C_b38	AURKAIP1	3.235	0.00163	0.048129	18	0.014876	no	UTERUS
chr1_2244139_G_A_b38	AURKAIP1	3.021	0.00317	0.103183	3	0.034151	no	UTERUS
chr1_2132032_C_G_b38	AURKAIP1	-2.994	0.00344	-0.097703	4	0.032633	no	UTERUS
chr1_1098619_C_T_b38	AURKAIP1	-2.898	0.00458	-0.041143	31	0.014198	no	UTERUS
chr1_2055132_C_T_b38	AURKAIP1	-2.825	0.00567	-0.107338	4	0.037995	no	UTERUS
chr1_981210_G_A_b38	AURKAIP1	2.786	0.00634	0.052042	5	0.01868	no	UTERUS
chr1_1739519_C_G_b38	AURKAIP1	2.766	0.00671	0.054429	4	0.019675	no	UTERUS
chr1_1751888_C_T_b38	AURKAIP1	2.75	0.00702	0.071854	3	0.026125	no	UTERUS
chr1_2297862_C_T_b38	AURKAIP1	-2.717	0.00771	-0.044955	9	0.016544	no	UTERUS
chr1_2105801_T_C_b38	AURKAIP1	-2.639	0.0096	-0.100624	3	0.038133	no	UTERUS
chr1_908025_A_G_b38	AURKAIP1	2.637	0.00966	0.038582	23	0.014633	no	UTERUS
chr1_1979531_C_T_b38	AURKAIP1	3.342	0.00112	0.071403	3	0.021362	yes	VAGINA
chr1_1979502_G_A_b38	AURKAIP1	-3.02	0.00311	-0.094773	3	0.03138	yes	VAGINA
chr1_932716_T_C_b38	AURKAIP1	2.982	0.00349	0.114818	3	0.038502	yes	VAGINA
chr1_2048285_C_A_b38	AURKAIP1	-2.709	0.00777	-0.04213	6	0.015551	yes	VAGINA
chr1_2049200_G_A_b38	AURKAIP1	-2.709	0.00777	-0.04213	6	0.015551	yes	VAGINA
chr1_2050397_C_T_b38	AURKAIP1	2.646	0.00927	0.041085	7	0.015526	yes	VAGINA
chr1_633846_C_A_b38	AURKAIP1	-2.633	0.00962	-0.081934	4	0.031119	yes	VAGINA
chr1_1992764_A_G_b38	AURKAIP1	2.889	0.00461	0.113927	3	0.039432	no	VAGINA
chr1_414665_C_T_b38	AURKAIP1	2.68	0.00843	0.045286	4	0.016898	no	VAGINA
chr1_2018334_AATAAC_A_b38	AURKAIP1	2.659	0.00895	0.035627	11	0.013399	no	VAGINA
chr1_933411_C_T_b38	AURKAIP1	-3.277	0.00111	-0.06055	8	0.018475	yes	WHLBLD
chr1_680774_C_T_b38	AURKAIP1	-3.035	0.00251	-0.037742	3	0.012437	yes	WHLBLD
chr1_2287338_A_AT_b38	AURKAIP1	-2.966	0.00314	-0.02203	101	0.007427	yes	WHLBLD
chr1_2151375_C_G_b38	AURKAIP1	2.958	0.00321	0.07377	4	0.024936	yes	WHLBLD
chr1_1485282_A_G_b38	AURKAIP1	2.939	0.00342	0.050934	13	0.017331	yes	WHLBLD
chr1_713812_A_T_b38	AURKAIP1	2.887	0.00403	0.031983	9	0.011078	yes	WHLBLD
chr1_1115683_C_A_b38	AURKAIP1	2.782	0.00558	0.041625	12	0.014964	yes	WHLBLD
chr1_2325768_C_T_b38	AURKAIP1	2.739	0.00634	0.03583	3	0.013081	yes	WHLBLD
chr1_2056778_G_T_b38	AURKAIP1	2.738	0.00636	0.053758	16	0.019631	yes	WHLBLD
chr1_2148410_A_G_b38	AURKAIP1	2.69	0.00734	0.065939	4	0.024511	yes	WHLBLD
chr1_1836856_CT_C_b38	AURKAIP1	2.677	0.00763	0.024755	27	0.009247	yes	WHLBLD
chr1_1521298_C_CAAA_b38	AURKAIP1	2.674	0.0077	0.050406	8	0.01885	yes	WHLBLD
chr1_1903513_C_CT_b38	AURKAIP1	2.619	0.00904	0.061318	3	0.023412	yes	WHLBLD
chr1_632160_A_G_b38	AURKAIP1	2.916	0.00367	0.081988	3	0.028113	no	WHLBLD
chr1_1394752_G_GAA_b38	AURKAIP1	-2.884	0.00406	-0.063441	5	0.021994	no	WHLBLD
chr1_1989523_T_C_b38	AURKAIP1	2.76	0.00595	0.020532	110	0.007438	no	WHLBLD
chr1_1679100_A_G_b38	AURKAIP1	-2.752	0.00611	-0.019928	116	0.007242	no	WHLBLD
chr1_874906_G_A_b38	AURKAIP1	2.704	0.00704	0.026884	29	0.009942	no	WHLBLD
chr1_631996_G_A_b38	AURKAIP1	-2.699	0.00715	-0.083321	3	0.030871	no	WHLBLD
chr1_631998_T_C_b38	AURKAIP1	2.617	0.0091	0.068511	3	0.026182	no	WHLBLD
chr1_1479683_T_G_b38	AURKAIP1	2.617	0.00911	0.038352	45	0.014658	no	WHLBLD
chr1_1480096_G_C_b38	AURKAIP1	2.617	0.00911	0.038352	45	0.014658	no	WHLBLD

---

Filters:      p-Values >= and <=      Betas >= and <=      Statistic >= and <=      Carriers >= and <=
Positions: left right     Zoom: AURKAIP1     Other:     -      +     reset     eQTLs Region
Draw    p-Value Beta Statistic Carriers Beta/sd(t)     Scaling     Sign (red=+, blue-)     Colors: Tissue Sign