MORN1 - MORN repeat containing 1 - 1p36.32

Snps	Gene	Statistic	Pvalue	Beta	Carriers	Beta_se	Linear	Tissue
chr1_2364339_A_C_b38	MORN1	-11.365	7.79e-27	-0.069389	72	0.006106	yes	ADPSBQ
chr1_2366816_A_G_b38	MORN1	-11.147	5.64e-26	-0.068694	70	0.006162	yes	ADPSBQ
chr1_2367872_A_G_b38	MORN1	-10.92	4.34e-25	-0.066474	78	0.006088	yes	ADPSBQ
chr1_2368188_T_C_b38	MORN1	-10.92	4.34e-25	-0.066474	78	0.006088	yes	ADPSBQ
chr1_2352756_T_C_b38	MORN1	-10.624	5.97e-24	-0.066517	69	0.006261	yes	ADPSBQ
chr1_2366555_G_C_b38	MORN1	-10.59	8.01e-24	-0.066104	69	0.006242	yes	ADPSBQ
chr1_2367799_C_T_b38	MORN1	-10.544	1.2e-23	-0.066308	68	0.006289	yes	ADPSBQ
chr1_2368473_T_C_b38	MORN1	-10.53	1.35e-23	-0.065019	81	0.006174	yes	ADPSBQ
chr1_2366496_A_T_b38	MORN1	-10.514	1.56e-23	-0.066043	68	0.006282	yes	ADPSBQ
chr1_2366243_C_T_b38	MORN1	-10.462	2.44e-23	-0.065975	67	0.006306	yes	ADPSBQ
chr1_2367197_G_A_b38	MORN1	-10.415	3.67e-23	-0.065759	67	0.006314	yes	ADPSBQ
chr1_2368939_G_C_b38	MORN1	-10.39	4.59e-23	-0.065483	68	0.006303	yes	ADPSBQ
chr1_2365333_G_A_b38	MORN1	-10.184	2.69e-22	-0.063754	67	0.00626	yes	ADPSBQ
chr1_2367456_C_CAA_b38	MORN1	-10.098	5.59e-22	-0.066785	52	0.006614	yes	ADPSBQ
chr1_2366956_CAAAATACATAGA_C_b38	MORN1	-10.081	6.47e-22	-0.062629	75	0.006213	yes	ADPSBQ
chr1_2351241_C_T_b38	MORN1	-10.07	7.1e-22	-0.065039	66	0.006459	yes	ADPSBQ
chr1_2365236_C_T_b38	MORN1	-9.958	1.83e-21	-0.062608	68	0.006287	yes	ADPSBQ
chr1_2368718_C_A_b38	MORN1	-9.867	3.93e-21	-0.06236	67	0.00632	yes	ADPSBQ
chr1_2363829_A_T_b38	MORN1	-9.822	5.72e-21	-0.061198	70	0.006231	yes	ADPSBQ
chr1_2348700_C_T_b38	MORN1	-9.564	4.83e-20	-0.062945	57	0.006582	yes	ADPSBQ
chr1_2343517_G_A_b38	MORN1	-9.446	1.27e-19	-0.062297	61	0.006595	yes	ADPSBQ
chr1_2343699_C_T_b38	MORN1	-9.231	7.14e-19	-0.061089	61	0.006618	yes	ADPSBQ
chr1_2369210_C_T_b38	MORN1	-8.844	1.51e-17	-0.055741	86	0.006302	yes	ADPSBQ
chr1_2366021_T_C_b38	MORN1	-8.236	1.51e-15	-0.051982	126	0.006312	yes	ADPSBQ
chr1_2350750_AGGGGTGGCACG_A_b38	MORN1	-8.229	1.59e-15	-0.06237	24	0.007579	yes	ADPSBQ
chr1_2364657_A_T_b38	MORN1	-8.173	2.39e-15	-0.051438	128	0.006293	yes	ADPSBQ
chr1_2364658_A_T_b38	MORN1	-8.173	2.39e-15	-0.051438	128	0.006293	yes	ADPSBQ
chr1_2348393_G_A_b38	MORN1	-8.143	2.98e-15	-0.063461	20	0.007793	yes	ADPSBQ
chr1_2362863_C_CA_b38	MORN1	-7.769	4.38e-14	-0.065112	13	0.008381	yes	ADPSBQ
chr1_2354688_G_C_b38	MORN1	-7.755	4.83e-14	-0.06394	16	0.008245	yes	ADPSBQ
chr1_2351678_C_T_b38	MORN1	-7.613	1.3e-13	-0.062441	17	0.008202	yes	ADPSBQ
chr1_2351215_T_G_b38	MORN1	-7.601	1.42e-13	-0.062242	17	0.008189	yes	ADPSBQ
chr1_2362229_A_G_b38	MORN1	-7.58	1.64e-13	-0.062093	17	0.008192	yes	ADPSBQ
chr1_2354645_C_T_b38	MORN1	-7.51	2.67e-13	-0.061841	16	0.008235	yes	ADPSBQ
chr1_2340787_C_T_b38	MORN1	-7.337	8.65e-13	-0.050457	45	0.006877	yes	ADPSBQ
chr1_2350539_T_G_b38	MORN1	-7.334	8.81e-13	-0.046726	129	0.006371	yes	ADPSBQ
chr1_2353459_T_G_b38	MORN1	7.27	1.36e-12	0.045902	127	0.006314	yes	ADPSBQ
chr1_2356177_T_C_b38	MORN1	7.27	1.36e-12	0.045902	127	0.006314	yes	ADPSBQ
chr1_2346801_C_T_b38	MORN1	-7.201	2.16e-12	-0.046673	135	0.006482	yes	ADPSBQ
chr1_2349222_G_A_b38	MORN1	-7.186	2.39e-12	-0.046463	136	0.006466	yes	ADPSBQ
chr1_2343937_T_G_b38	MORN1	-7.177	2.52e-12	-0.047104	85	0.006563	yes	ADPSBQ
chr1_2352403_G_T_b38	MORN1	7.158	2.86e-12	0.04555	127	0.006363	yes	ADPSBQ
chr1_2347212_C_T_b38	MORN1	-7.075	4.97e-12	-0.056811	18	0.00803	yes	ADPSBQ
chr1_2358849_T_C_b38	MORN1	7.055	5.64e-12	0.044944	130	0.00637	yes	ADPSBQ
chr1_2360716_T_C_b38	MORN1	7.039	6.27e-12	0.045012	129	0.006394	yes	ADPSBQ
chr1_2360970_T_C_b38	MORN1	7.039	6.27e-12	0.045012	129	0.006394	yes	ADPSBQ
chr1_2361332_A_AG_b38	MORN1	7.039	6.27e-12	0.045012	129	0.006394	yes	ADPSBQ
chr1_2361548_A_ACT_b38	MORN1	7.039	6.27e-12	0.045012	129	0.006394	yes	ADPSBQ
chr1_2352457_A_G_b38	MORN1	7.017	7.27e-12	0.044691	130	0.006369	yes	ADPSBQ
chr1_2342133_C_G_b38	MORN1	-6.897	1.58e-11	-0.058897	14	0.00854	yes	ADPSBQ
chr1_2342137_G_A_b38	MORN1	-6.897	1.58e-11	-0.058897	14	0.00854	yes	ADPSBQ
chr1_2357308_T_C_b38	MORN1	6.549	1.41e-10	0.042454	135	0.006482	yes	ADPSBQ
chr1_2363405_C_T_b38	MORN1	6.44	2.76e-10	0.046272	55	0.007185	yes	ADPSBQ
chr1_2347542_C_T_b38	MORN1	-6.303	6.34e-10	-0.040416	114	0.006413	yes	ADPSBQ
chr1_2362718_G_A_b38	MORN1	6.298	6.53e-10	0.045634	42	0.007246	yes	ADPSBQ
chr1_2364499_A_G_b38	MORN1	6.133	1.73e-09	0.043237	49	0.007049	yes	ADPSBQ
chr1_2350696_G_A_b38	MORN1	6.047	2.86e-09	0.044295	41	0.007325	yes	ADPSBQ
chr1_2348378_C_T_b38	MORN1	6	3.74e-09	0.044074	40	0.007345	yes	ADPSBQ
chr1_2342734_T_C_b38	MORN1	-5.925	5.76e-09	-0.044231	28	0.007466	yes	ADPSBQ
chr1_2353743_A_T_b38	MORN1	5.712	1.9e-08	0.041319	63	0.007234	yes	ADPSBQ
chr1_2346111_G_C_b38	MORN1	-5.68	2.27e-08	-0.036495	113	0.006425	yes	ADPSBQ
chr1_2338659_A_G_b38	MORN1	5.653	2.63e-08	0.035544	112	0.006288	yes	ADPSBQ
chr1_2356409_G_C_b38	MORN1	5.544	4.75e-08	0.040144	50	0.007241	yes	ADPSBQ
chr1_2341705_A_G_b38	MORN1	5.051	6.12e-07	0.032911	121	0.006515	yes	ADPSBQ
chr1_2345727_G_A_b38	MORN1	4.904	1.27e-06	0.038686	25	0.007889	yes	ADPSBQ
chr1_2344634_T_C_b38	MORN1	4.895	1.32e-06	0.038352	26	0.007835	yes	ADPSBQ
chr1_2344757_C_A_b38	MORN1	4.878	1.44e-06	0.038232	26	0.007838	yes	ADPSBQ
chr1_2344761_T_A_b38	MORN1	4.878	1.44e-06	0.038232	26	0.007838	yes	ADPSBQ
chr1_2351551_C_T_b38	MORN1	4.864	1.54e-06	0.038629	25	0.007942	yes	ADPSBQ
chr1_2350934_C_T_b38	MORN1	4.837	1.75e-06	0.037871	26	0.00783	yes	ADPSBQ
chr1_2345774_T_C_b38	MORN1	4.694	3.44e-06	0.036149	27	0.007701	yes	ADPSBQ
chr1_2344980_A_G_b38	MORN1	4.674	3.79e-06	0.035792	28	0.007658	yes	ADPSBQ
chr1_2345849_ACACACAG_A_b38	MORN1	4.627	4.72e-06	0.037828	19	0.008176	yes	ADPSBQ
chr1_2345829_C_CCACACA_b38	MORN1	-4.555	6.57e-06	-0.046247	10	0.010154	yes	ADPSBQ
chr1_2342999_A_G_b38	MORN1	-4.469	9.69e-06	-0.032222	36	0.00721	yes	ADPSBQ
chr1_2344256_A_T_b38	MORN1	4.432	1.14e-05	0.033538	30	0.007567	yes	ADPSBQ
chr1_2344932_C_T_b38	MORN1	4.417	1.22e-05	0.036093	20	0.008172	yes	ADPSBQ
chr1_2369355_G_GA_b38	MORN1	-4.188	3.32e-05	-0.030103	51	0.007188	yes	ADPSBQ
chr1_2333737_T_C_b38	MORN1	4.083	5.15e-05	0.028828	61	0.00706	yes	ADPSBQ
chr1_2360913_G_A_b38	MORN1	4.005	7.13e-05	0.031709	35	0.007918	yes	ADPSBQ
chr1_2344583_G_A_b38	MORN1	3.861	0.000128	0.029595	31	0.007666	yes	ADPSBQ
chr1_2337352_A_G_b38	MORN1	3.853	0.000132	0.025683	83	0.006666	yes	ADPSBQ
chr1_2337299_A_G_b38	MORN1	3.805	0.000159	0.025227	78	0.006629	yes	ADPSBQ
chr1_2343445_C_T_b38	MORN1	3.718	0.000223	0.027432	36	0.007377	yes	ADPSBQ
chr1_2327034_G_A_b38	MORN1	3.624	0.00032	0.024534	76	0.006771	yes	ADPSBQ
chr1_2980520_A_G_b38	MORN1	3.384	0.00077	0.029917	22	0.008841	yes	ADPSBQ
chr1_2324977_G_GGCT_b38	MORN1	3.211	0.00141	0.022151	73	0.006898	yes	ADPSBQ
chr1_2296236_A_C_b38	MORN1	-3.207	0.00143	-0.038672	5	0.012059	yes	ADPSBQ
chr1_2345953_G_A_b38	MORN1	3.17	0.00162	0.057666	3	0.018192	yes	ADPSBQ
chr1_2308944_C_T_b38	MORN1	3.16	0.00167	0.03367	5	0.010654	yes	ADPSBQ
chr1_2324806_A_T_b38	MORN1	3.134	0.00182	0.021549	74	0.006875	yes	ADPSBQ
chr1_2361214_A_C_b38	MORN1	-3.109	0.00198	-0.040361	6	0.012982	yes	ADPSBQ
chr1_2335368_C_T_b38	MORN1	2.996	0.00286	0.028866	12	0.009633	yes	ADPSBQ
chr1_2326288_C_T_b38	MORN1	2.985	0.00297	0.019992	77	0.006698	yes	ADPSBQ
chr1_2326884_C_T_b38	MORN1	2.985	0.00297	0.019992	77	0.006698	yes	ADPSBQ
chr1_2345442_G_A_b38	MORN1	2.984	0.00298	0.054461	3	0.01825	yes	ADPSBQ
chr1_2359219_C_T_b38	MORN1	2.976	0.00306	0.05082	5	0.017076	yes	ADPSBQ
chr1_2235045_A_AT_b38	MORN1	2.919	0.00367	0.021202	47	0.007263	yes	ADPSBQ
chr1_2364876_C_T_b38	MORN1	2.912	0.00375	0.049063	5	0.016849	yes	ADPSBQ
chr1_2357096_C_G_b38	MORN1	2.864	0.00436	0.025441	17	0.008883	yes	ADPSBQ
chr1_2106796_TGACTCTTCAGCAGGCCCCTCTGGTGGGCGAGGACCTCCACACGTGTCACCAGGCCAGGC_T_b38	MORN1	2.84	0.00469	0.031299	9	0.01102	yes	ADPSBQ
chr1_2326424_C_T_b38	MORN1	2.819	0.005	0.019054	76	0.006759	yes	ADPSBQ
chr1_2971838_G_A_b38	MORN1	2.808	0.00517	0.027192	12	0.009683	yes	ADPSBQ
chr1_2972541_G_A_b38	MORN1	2.808	0.00517	0.027192	12	0.009683	yes	ADPSBQ
chr1_2351277_T_TA_b38	MORN1	2.799	0.00532	0.028285	9	0.010105	yes	ADPSBQ
chr1_2971950_A_G_b38	MORN1	2.751	0.00616	0.022378	22	0.008135	yes	ADPSBQ
chr1_2340235_T_C_b38	MORN1	2.745	0.00627	0.01978	43	0.007206	yes	ADPSBQ
chr1_3309069_T_A_b38	MORN1	-2.728	0.00658	-0.058715	4	0.02152	yes	ADPSBQ
chr1_3309148_C_T_b38	MORN1	-2.728	0.00658	-0.058715	4	0.02152	yes	ADPSBQ
chr1_3309573_A_T_b38	MORN1	-2.728	0.00658	-0.058715	4	0.02152	yes	ADPSBQ
chr1_3309631_G_A_b38	MORN1	-2.728	0.00658	-0.058715	4	0.02152	yes	ADPSBQ
chr1_3309733_A_G_b38	MORN1	-2.728	0.00658	-0.058715	4	0.02152	yes	ADPSBQ
chr1_2370032_C_G_b38	MORN1	2.721	0.00672	0.023762	16	0.008732	yes	ADPSBQ
chr1_3335602_A_AACACACACAC_b38	MORN1	-2.718	0.0068	-0.033599	6	0.012363	yes	ADPSBQ
chr1_2355481_C_T_b38	MORN1	2.659	0.00809	0.043473	5	0.016351	yes	ADPSBQ
chr1_2364608_C_A_b38	MORN1	2.659	0.00809	0.043473	5	0.016351	yes	ADPSBQ
chr1_2344761_T_C_b38	MORN1	2.635	0.00866	0.020624	37	0.007826	yes	ADPSBQ
chr1_1679041_C_G_b38	MORN1	-2.616	0.00915	-0.031608	3	0.012081	yes	ADPSBQ
chr1_2290738_G_A_b38	MORN1	2.606	0.00942	0.022264	18	0.008543	yes	ADPSBQ
chr1_1425822_C_G_b38	MORN1	2.605	0.00946	0.031855	6	0.012229	yes	ADPSBQ
chr1_2344510_C_G_b38	MORN1	-2.593	0.00979	-0.022335	19	0.008613	yes	ADPSBQ
chr1_2359472_G_A_b38	MORN1	6.581	1.16e-10	0.042486	85	0.006455	no	ADPSBQ
chr1_2369118_G_A_b38	MORN1	-5.623	3.09e-08	-0.044263	25	0.007871	no	ADPSBQ
chr1_2389263_T_C_b38	MORN1	-5.013	7.4e-07	-0.03683	35	0.007346	no	ADPSBQ
chr1_2359882_C_CAA_b38	MORN1	4.918	1.18e-06	0.040207	26	0.008175	no	ADPSBQ
chr1_2367055_C_A_b38	MORN1	4.911	1.22e-06	0.037428	30	0.007621	no	ADPSBQ
chr1_2356095_C_T_b38	MORN1	4.862	1.55e-06	0.038634	26	0.007946	no	ADPSBQ
chr1_2357882_G_A_b38	MORN1	4.798	2.11e-06	0.037943	27	0.007909	no	ADPSBQ
chr1_2367644_G_A_b38	MORN1	-4.791	2.17e-06	-0.032268	78	0.006735	no	ADPSBQ
chr1_2359882_C_CA_b38	MORN1	-4.77	2.41e-06	-0.037188	25	0.007796	no	ADPSBQ
chr1_2309937_C_CT_b38	MORN1	-4.601	5.3e-06	-0.028445	148	0.006182	no	ADPSBQ
chr1_2338570_C_T_b38	MORN1	4.51	8.06e-06	0.029942	75	0.00664	no	ADPSBQ
chr1_2309937_C_CTT_b38	MORN1	4.489	8.86e-06	0.030599	63	0.006817	no	ADPSBQ
chr1_2363805_C_CAAACAA_b38	MORN1	4.387	1.4e-05	0.033414	41	0.007617	no	ADPSBQ
chr1_2369336_A_G_b38	MORN1	-4.36	1.57e-05	-0.036953	20	0.008475	no	ADPSBQ
chr1_2392569_C_T_b38	MORN1	-4.333	1.77e-05	-0.033327	29	0.007692	no	ADPSBQ
chr1_2337211_C_G_b38	MORN1	4.305	2e-05	0.028863	81	0.006704	no	ADPSBQ
chr1_2338460_T_C_b38	MORN1	4.228	2.79e-05	0.027916	81	0.006603	no	ADPSBQ
chr1_2379954_A_G_b38	MORN1	-4.207	3.06e-05	-0.028962	44	0.006885	no	ADPSBQ
chr1_2380956_C_T_b38	MORN1	-4.135	4.16e-05	-0.033124	26	0.008011	no	ADPSBQ
chr1_2382101_A_G_b38	MORN1	-4.135	4.16e-05	-0.033124	26	0.008011	no	ADPSBQ
chr1_2353047_C_T_b38	MORN1	-4.117	4.48e-05	-0.035139	16	0.008536	no	ADPSBQ
chr1_2334530_T_G_b38	MORN1	4.071	5.44e-05	0.028821	60	0.00708	no	ADPSBQ
chr1_2346676_G_C_b38	MORN1	-4.068	5.5e-05	-0.034503	16	0.008482	no	ADPSBQ
chr1_2357811_C_G_b38	MORN1	-4.037	6.25e-05	-0.034693	16	0.008594	no	ADPSBQ
chr1_2357812_T_C_b38	MORN1	-4.037	6.25e-05	-0.034693	16	0.008594	no	ADPSBQ
chr1_2359828_A_G_b38	MORN1	-4.037	6.25e-05	-0.034693	16	0.008594	no	ADPSBQ
chr1_2363591_T_G_b38	MORN1	-4.037	6.25e-05	-0.034693	16	0.008594	no	ADPSBQ
chr1_2391602_T_C_b38	MORN1	-4.028	6.49e-05	-0.02755	46	0.00684	no	ADPSBQ
chr1_2344932_C_A_b38	MORN1	-4.015	6.82e-05	-0.034346	16	0.008554	no	ADPSBQ
chr1_2380105_C_T_b38	MORN1	-4.002	7.23e-05	-0.025594	76	0.006396	no	ADPSBQ
chr1_2367871_C_T_b38	MORN1	-3.944	9.13e-05	-0.033927	16	0.008602	no	ADPSBQ
chr1_2350287_A_C_b38	MORN1	-3.902	0.000108	-0.03325	16	0.00852	no	ADPSBQ
chr1_2409621_C_T_b38	MORN1	-3.892	0.000113	-0.028797	35	0.0074	no	ADPSBQ
chr1_2380209_G_A_b38	MORN1	-3.875	0.00012	-0.024804	75	0.006401	no	ADPSBQ
chr1_1630225_CGCAGCTCCCTGCTCCCCG_C_b38	MORN1	3.864	0.000126	0.071319	8	0.018456	no	ADPSBQ
chr1_2337239_T_C_b38	MORN1	3.792	0.000167	0.027676	46	0.007298	no	ADPSBQ
chr1_2660743_AC_A_b38	MORN1	-3.747	0.000199	-0.08863	4	0.023654	no	ADPSBQ
chr1_2340807_G_A_b38	MORN1	3.585	0.000369	0.026467	36	0.007383	no	ADPSBQ
chr1_2341451_G_A_b38	MORN1	3.552	0.000418	0.026197	36	0.007375	no	ADPSBQ
chr1_2345148_G_A_b38	MORN1	-3.55	0.000421	-0.036084	7	0.010164	no	ADPSBQ
chr1_2340425_C_T_b38	MORN1	-3.538	0.00044	-0.023143	114	0.006541	no	ADPSBQ
chr1_2365220_A_G_b38	MORN1	-3.523	0.000464	-0.031099	15	0.008826	no	ADPSBQ
chr1_2369713_ATAAT_A_b38	MORN1	-3.515	0.000479	-0.029749	19	0.008464	no	ADPSBQ
chr1_2298478_C_T_b38	MORN1	-3.513	0.000482	-0.030052	16	0.008554	no	ADPSBQ
chr1_2297717_C_T_b38	MORN1	-3.513	0.000483	-0.030203	16	0.008598	no	ADPSBQ
chr1_2420841_G_A_b38	MORN1	-3.409	0.000704	-0.023587	51	0.006919	no	ADPSBQ
chr1_2970905_A_G_b38	MORN1	3.381	0.000777	0.026182	48	0.007743	no	ADPSBQ
chr1_2340625_G_A_b38	MORN1	3.347	0.000878	0.024466	38	0.00731	no	ADPSBQ
chr1_2973013_C_T_b38	MORN1	3.311	0.000996	0.025486	37	0.007698	no	ADPSBQ
chr1_2364484_C_T_b38	MORN1	-3.274	0.00113	-0.02841	18	0.008677	no	ADPSBQ
chr1_2327151_A_AACAC_b38	MORN1	3.253	0.00122	0.020412	131	0.006274	no	ADPSBQ
chr1_2368212_T_C_b38	MORN1	-3.152	0.00172	-0.025488	25	0.008087	no	ADPSBQ
chr1_2377078_C_G_b38	MORN1	-3.088	0.00213	-0.034532	6	0.011183	no	ADPSBQ
chr1_2419005_C_T_b38	MORN1	-3.058	0.00234	-0.021849	46	0.007145	no	ADPSBQ
chr1_2245788_C_CTTTT_b38	MORN1	3.026	0.0026	0.042332	11	0.013988	no	ADPSBQ
chr1_2364506_G_A_b38	MORN1	-3.003	0.0028	-0.022223	36	0.007399	no	ADPSBQ
chr1_2971897_T_C_b38	MORN1	2.986	0.00296	0.023804	23	0.007972	no	ADPSBQ
chr1_2337141_G_A_b38	MORN1	2.983	0.003	0.020822	61	0.006981	no	ADPSBQ
chr1_2660711_C_CGT_b38	MORN1	-2.975	0.00307	-0.056086	5	0.018854	no	ADPSBQ
chr1_2660714_C_A_b38	MORN1	-2.975	0.00307	-0.056086	5	0.018854	no	ADPSBQ
chr1_2382880_T_C_b38	MORN1	-2.973	0.00309	-0.032535	7	0.010943	no	ADPSBQ
chr1_2660701_GTGCC_G_b38	MORN1	-2.965	0.00317	-0.055939	5	0.018866	no	ADPSBQ
chr1_2931691_G_A_b38	MORN1	2.954	0.00328	0.029731	7	0.010065	no	ADPSBQ
chr1_2352405_G_A_b38	MORN1	2.953	0.0033	0.059216	3	0.020055	no	ADPSBQ
chr1_2422217_C_T_b38	MORN1	-2.934	0.00349	-0.020838	48	0.007102	no	ADPSBQ
chr1_2422225_C_T_b38	MORN1	-2.934	0.00349	-0.020838	48	0.007102	no	ADPSBQ
chr1_2300128_G_T_b38	MORN1	-2.92	0.00365	-0.018688	127	0.0064	no	ADPSBQ
chr1_1605850_G_T_b38	MORN1	2.914	0.00372	0.067896	3	0.023299	no	ADPSBQ
chr1_2370252_G_A_b38	MORN1	2.9	0.0039	0.023793	16	0.008206	no	ADPSBQ
chr1_2359451_C_T_b38	MORN1	-2.893	0.00398	-0.023606	25	0.008161	no	ADPSBQ
chr1_2360241_T_C_b38	MORN1	-2.893	0.00398	-0.023606	25	0.008161	no	ADPSBQ
chr1_2361727_G_A_b38	MORN1	-2.893	0.00398	-0.023606	25	0.008161	no	ADPSBQ
chr1_2416137_G_T_b38	MORN1	2.887	0.00405	0.022355	28	0.007743	no	ADPSBQ
chr1_2359221_T_C_b38	MORN1	-2.885	0.00408	-0.023477	26	0.008139	no	ADPSBQ
chr1_2420707_C_T_b38	MORN1	2.881	0.00413	0.022291	28	0.007737	no	ADPSBQ
chr1_2211288_C_G_b38	MORN1	2.875	0.00421	0.017531	108	0.006099	no	ADPSBQ
chr1_2418469_C_T_b38	MORN1	-2.87	0.00427	-0.020492	47	0.007139	no	ADPSBQ
chr1_2346388_G_A_b38	MORN1	-2.864	0.00435	-0.023343	25	0.00815	no	ADPSBQ
chr1_2348984_A_C_b38	MORN1	-2.864	0.00435	-0.023343	25	0.00815	no	ADPSBQ
chr1_2351337_G_C_b38	MORN1	-2.864	0.00435	-0.023343	25	0.00815	no	ADPSBQ
chr1_2356078_T_C_b38	MORN1	-2.864	0.00435	-0.023343	25	0.00815	no	ADPSBQ
chr1_2416027_C_T_b38	MORN1	2.862	0.00438	0.021772	31	0.007606	no	ADPSBQ
chr1_2211900_C_CTTTT_b38	MORN1	2.853	0.00451	0.033326	7	0.01168	no	ADPSBQ
chr1_2419962_TC_T_b38	MORN1	2.838	0.00472	0.023479	17	0.008274	no	ADPSBQ
chr1_2357413_G_A_b38	MORN1	2.836	0.00475	0.025634	15	0.009038	no	ADPSBQ
chr1_3308915_C_G_b38	MORN1	-2.836	0.00475	-0.057974	5	0.020445	no	ADPSBQ
chr1_2354969_C_T_b38	MORN1	2.812	0.00511	0.025333	15	0.009008	no	ADPSBQ
chr1_2355671_C_T_b38	MORN1	2.812	0.00511	0.025333	15	0.009008	no	ADPSBQ
chr1_2356158_C_T_b38	MORN1	2.812	0.00511	0.025333	15	0.009008	no	ADPSBQ
chr1_2353975_G_A_b38	MORN1	-2.81	0.00514	-0.022971	25	0.008175	no	ADPSBQ
chr1_2355508_A_G_b38	MORN1	-2.81	0.00514	-0.022971	25	0.008175	no	ADPSBQ
chr1_2660731_T_A_b38	MORN1	-2.81	0.00515	-0.054079	5	0.019247	no	ADPSBQ
chr1_2417420_T_TTCCCAGCC_b38	MORN1	2.803	0.00526	0.021822	27	0.007786	no	ADPSBQ
chr1_2323471_T_C_b38	MORN1	-2.79	0.00547	-0.021473	28	0.007696	no	ADPSBQ
chr1_2361249_C_G_b38	MORN1	2.786	0.00553	0.025109	15	0.009011	no	ADPSBQ
chr1_2364485_A_G_b38	MORN1	-2.786	0.00554	-0.021285	37	0.007641	no	ADPSBQ
chr1_2079294_C_T_b38	MORN1	-2.785	0.00555	-0.019213	91	0.006899	no	ADPSBQ
chr1_2436424_TCCTTTCTCCCTCCTCCCTTCCTC_T_b38	MORN1	2.781	0.00562	0.040162	8	0.014442	no	ADPSBQ
chr1_2365383_T_C_b38	MORN1	-2.779	0.00566	-0.020465	44	0.007365	no	ADPSBQ
chr1_2422265_C_T_b38	MORN1	-2.766	0.00589	-0.019675	48	0.007114	no	ADPSBQ
chr1_2660707_A_ACC_b38	MORN1	-2.763	0.00593	-0.051532	5	0.018648	no	ADPSBQ
chr1_2358817_G_A_b38	MORN1	2.76	0.00598	0.024924	15	0.00903	no	ADPSBQ
chr1_2358041_A_G_b38	MORN1	2.749	0.0062	0.024648	15	0.008968	no	ADPSBQ
chr1_2340764_G_T_b38	MORN1	2.748	0.00621	0.020037	40	0.007291	no	ADPSBQ
chr1_1606041_G_A_b38	MORN1	2.731	0.00653	0.069681	3	0.025512	no	ADPSBQ
chr1_2348949_CCT_C_b38	MORN1	2.727	0.00662	0.024351	16	0.00893	no	ADPSBQ
chr1_2420440_C_T_b38	MORN1	2.726	0.00663	0.02083	31	0.007641	no	ADPSBQ
chr1_2352564_T_C_b38	MORN1	-2.723	0.00669	-0.022212	25	0.008158	no	ADPSBQ
chr1_2303464_C_T_b38	MORN1	2.721	0.00673	0.022975	16	0.008443	no	ADPSBQ
chr1_1567912_C_CAAAAAAAA_b38	MORN1	-2.717	0.0068	-0.030929	18	0.011382	no	ADPSBQ
chr1_2337229_A_G_b38	MORN1	2.705	0.00705	0.018306	117	0.006767	no	ADPSBQ
chr1_2417413_G_GCCCAGCTT_b38	MORN1	-2.701	0.00715	-0.0193	47	0.007147	no	ADPSBQ
chr1_3157422_T_TAAAA_b38	MORN1	2.696	0.00725	0.027896	12	0.010347	no	ADPSBQ
chr1_2366312_C_T_b38	MORN1	2.696	0.00726	0.023781	17	0.008822	no	ADPSBQ
chr1_2340564_G_A_b38	MORN1	2.661	0.00804	0.019733	36	0.007416	no	ADPSBQ
chr1_2084002_C_T_b38	MORN1	-2.658	0.00812	-0.018122	69	0.006819	no	ADPSBQ
chr1_2350943_C_T_b38	MORN1	2.641	0.00851	0.023495	16	0.008896	no	ADPSBQ
chr1_2347995_C_T_b38	MORN1	2.63	0.00879	0.023409	16	0.0089	no	ADPSBQ
chr1_2972584_G_A_b38	MORN1	2.629	0.00883	0.021296	22	0.008102	no	ADPSBQ
chr1_2332063_T_C_b38	MORN1	2.627	0.00887	0.026071	17	0.009925	no	ADPSBQ
chr1_2301087_G_T_b38	MORN1	2.593	0.00978	0.032322	4	0.012465	no	ADPSBQ
chr1_2351874_C_G_b38	MORN1	2.588	0.00993	0.022884	16	0.008843	no	ADPSBQ
chr1_3200403_T_C_b38	MORN1	-2.587	0.00996	-0.044528	3	0.017213	no	ADPSBQ
chr1_2364657_A_T_b38	MORN1	-6.508	2.29e-10	-0.050297	109	0.007728	yes	ADPVSC
chr1_2364658_A_T_b38	MORN1	-6.508	2.29e-10	-0.050297	109	0.007728	yes	ADPVSC
chr1_2366021_T_C_b38	MORN1	-6.375	5.07e-10	-0.05	106	0.007843	yes	ADPVSC
chr1_2350539_T_G_b38	MORN1	-6.15	1.88e-09	-0.048451	105	0.007878	yes	ADPVSC
chr1_2364499_A_G_b38	MORN1	5.914	7.18e-09	0.050103	42	0.008471	yes	ADPVSC
chr1_2349222_G_A_b38	MORN1	-5.803	1.33e-08	-0.046243	115	0.007969	yes	ADPVSC
chr1_2362718_G_A_b38	MORN1	5.649	3.08e-08	0.048657	39	0.008614	yes	ADPVSC
chr1_2348378_C_T_b38	MORN1	5.614	3.71e-08	0.049135	36	0.008752	yes	ADPVSC
chr1_2350696_G_A_b38	MORN1	5.614	3.71e-08	0.049135	36	0.008752	yes	ADPVSC
chr1_2346801_C_T_b38	MORN1	-5.61	3.8e-08	-0.04494	114	0.008011	yes	ADPVSC
chr1_2363405_C_T_b38	MORN1	5.469	8.01e-08	0.046859	46	0.008568	yes	ADPVSC
chr1_2356409_G_C_b38	MORN1	5.355	1.45e-07	0.046494	42	0.008683	yes	ADPVSC
chr1_2357882_G_A_b38	MORN1	4.91	1.33e-06	0.046767	21	0.009524	yes	ADPVSC
chr1_2356095_C_T_b38	MORN1	4.808	2.16e-06	0.045894	21	0.009545	yes	ADPVSC
chr1_2338659_A_G_b38	MORN1	4.761	2.71e-06	0.037325	93	0.007841	yes	ADPVSC
chr1_2344256_A_T_b38	MORN1	4.759	2.73e-06	0.044295	24	0.009308	yes	ADPVSC
chr1_2341705_A_G_b38	MORN1	4.685	3.85e-06	0.037555	101	0.008016	yes	ADPVSC
chr1_2342734_T_C_b38	MORN1	-4.667	4.18e-06	-0.041911	26	0.00898	yes	ADPVSC
chr1_2346111_G_C_b38	MORN1	-4.469	1.03e-05	-0.036341	88	0.008133	yes	ADPVSC
chr1_2359882_C_CAA_b38	MORN1	4.304	2.12e-05	0.043584	17	0.010127	yes	ADPVSC
chr1_2340425_C_T_b38	MORN1	-4.26	2.56e-05	-0.033568	89	0.00788	yes	ADPVSC
chr1_2343445_C_T_b38	MORN1	4.145	4.16e-05	0.038374	25	0.009258	yes	ADPVSC
chr1_2367306_CAA_C_b38	MORN1	3.964	8.72e-05	0.033791	64	0.008524	yes	ADPVSC
chr1_2340564_G_A_b38	MORN1	3.932	9.92e-05	0.035088	30	0.008923	yes	ADPVSC
chr1_2309937_C_CT_b38	MORN1	-3.867	0.000129	-0.029575	121	0.007648	yes	ADPVSC
chr1_1487487_C_CA_b38	MORN1	3.471	0.000575	0.052992	5	0.015267	yes	ADPVSC
chr1_2327151_A_AACAC_b38	MORN1	3.355	0.00087	0.026287	99	0.007835	yes	ADPVSC
chr1_2409621_C_T_b38	MORN1	-3.349	0.00089	-0.029624	31	0.008847	yes	ADPVSC
chr1_2369187_T_TA_b38	MORN1	3.315	0.001	0.059242	9	0.01787	yes	ADPVSC
chr1_2692846_G_T_b38	MORN1	3.311	0.00101	0.037887	8	0.011442	yes	ADPVSC
chr1_2327507_C_CA_b38	MORN1	3.235	0.00132	0.037175	15	0.011492	yes	ADPVSC
chr1_2369713_ATAAT_A_b38	MORN1	-3.213	0.00142	-0.032778	15	0.010201	yes	ADPVSC
chr1_1924207_T_C_b38	MORN1	3.213	0.00142	0.028436	46	0.008849	yes	ADPVSC
chr1_2303464_C_T_b38	MORN1	3.142	0.00181	0.033361	9	0.010619	yes	ADPVSC
chr1_2325494_G_A_b38	MORN1	3.133	0.00186	0.036221	20	0.011561	yes	ADPVSC
chr1_2325768_C_A_b38	MORN1	3.133	0.00186	0.036221	20	0.011561	yes	ADPVSC
chr1_2326256_G_A_b38	MORN1	3.133	0.00186	0.036221	20	0.011561	yes	ADPVSC
chr1_2927689_A_T_b38	MORN1	-3.054	0.00241	-0.027997	47	0.009166	yes	ADPVSC
chr1_2922141_T_G_b38	MORN1	-3.042	0.00251	-0.028241	32	0.009285	yes	ADPVSC
chr1_2922233_G_C_b38	MORN1	-3.04	0.00252	-0.02794	46	0.009192	yes	ADPVSC
chr1_2332063_T_C_b38	MORN1	3.031	0.0026	0.036925	16	0.012182	yes	ADPVSC
chr1_2360913_G_A_b38	MORN1	3.018	0.00271	0.029684	28	0.009837	yes	ADPVSC
chr1_2355481_C_T_b38	MORN1	2.956	0.0033	0.054164	9	0.018324	yes	ADPVSC
chr1_2364608_C_A_b38	MORN1	2.956	0.0033	0.054164	9	0.018324	yes	ADPVSC
chr1_1502507_A_C_b38	MORN1	-2.943	0.00344	-0.057791	6	0.019637	yes	ADPVSC
chr1_2044256_TAC_T_b38	MORN1	-2.929	0.0036	-0.029907	10	0.010212	yes	ADPVSC
chr1_3180860_G_A_b38	MORN1	-2.837	0.00478	-0.031885	12	0.011238	yes	ADPVSC
chr1_2363805_C_CAAACAA_b38	MORN1	2.823	0.005	0.025981	35	0.009204	yes	ADPVSC
chr1_2921206_C_T_b38	MORN1	-2.822	0.00501	-0.02803	21	0.009933	yes	ADPVSC
chr1_2333737_T_C_b38	MORN1	2.812	0.00517	0.024486	50	0.008708	yes	ADPVSC
chr1_2334530_T_G_b38	MORN1	2.812	0.00517	0.024486	50	0.008708	yes	ADPVSC
chr1_2329738_C_T_b38	MORN1	2.809	0.00522	0.032989	23	0.011745	yes	ADPVSC
chr1_1452346_A_G_b38	MORN1	-2.796	0.00543	-0.032464	10	0.011611	yes	ADPVSC
chr1_2364876_C_T_b38	MORN1	2.776	0.00576	0.05272	9	0.01899	yes	ADPVSC
chr1_2380956_C_T_b38	MORN1	-2.763	0.006	-0.028521	18	0.010324	yes	ADPVSC
chr1_2382101_A_G_b38	MORN1	-2.763	0.006	-0.028521	18	0.010324	yes	ADPVSC
chr1_2359219_C_T_b38	MORN1	2.758	0.00609	0.052125	9	0.0189	yes	ADPVSC
chr1_2921235_G_A_b38	MORN1	-2.756	0.00613	-0.025905	32	0.0094	yes	ADPVSC
chr1_2698995_G_C_b38	MORN1	2.756	0.00613	0.042016	8	0.015247	yes	ADPVSC
chr1_2921065_T_C_b38	MORN1	-2.723	0.00676	-0.025424	33	0.009337	yes	ADPVSC
chr1_2921159_A_G_b38	MORN1	-2.723	0.00676	-0.025424	33	0.009337	yes	ADPVSC
chr1_2923260_G_A_b38	MORN1	-2.718	0.00685	-0.02596	28	0.00955	yes	ADPVSC
chr1_2923787_A_G_b38	MORN1	-2.718	0.00685	-0.02596	28	0.00955	yes	ADPVSC
chr1_2923800_T_C_b38	MORN1	-2.718	0.00685	-0.02596	28	0.00955	yes	ADPVSC
chr1_2924045_A_T_b38	MORN1	-2.718	0.00685	-0.02596	28	0.00955	yes	ADPVSC
chr1_2331844_G_C_b38	MORN1	2.715	0.00691	0.033746	10	0.012427	yes	ADPVSC
chr1_2921009_T_C_b38	MORN1	-2.706	0.00711	-0.026869	21	0.009931	yes	ADPVSC
chr1_2921013_G_C_b38	MORN1	-2.706	0.00711	-0.026869	21	0.009931	yes	ADPVSC
chr1_2921063_A_G_b38	MORN1	-2.706	0.00711	-0.026869	21	0.009931	yes	ADPVSC
chr1_2921146_T_C_b38	MORN1	-2.706	0.00711	-0.026869	21	0.009931	yes	ADPVSC
chr1_2927792_G_A_b38	MORN1	-2.702	0.00719	-0.025289	32	0.00936	yes	ADPVSC
chr1_2922443_A_G_b38	MORN1	-2.688	0.00749	-0.025371	31	0.009438	yes	ADPVSC
chr1_2922940_TA_T_b38	MORN1	-2.68	0.00768	-0.024601	45	0.009181	yes	ADPVSC
chr1_2923192_A_C_b38	MORN1	-2.68	0.00768	-0.024601	45	0.009181	yes	ADPVSC
chr1_2923196_T_C_b38	MORN1	-2.68	0.00768	-0.024601	45	0.009181	yes	ADPVSC
chr1_2924626_T_C_b38	MORN1	-2.68	0.00768	-0.024601	45	0.009181	yes	ADPVSC
chr1_2924766_T_C_b38	MORN1	-2.68	0.00768	-0.024601	45	0.009181	yes	ADPVSC
chr1_2925430_G_A_b38	MORN1	-2.68	0.00768	-0.024601	45	0.009181	yes	ADPVSC
chr1_2926182_A_C_b38	MORN1	-2.68	0.00768	-0.024601	45	0.009181	yes	ADPVSC
chr1_2926499_T_C_b38	MORN1	-2.68	0.00768	-0.024601	45	0.009181	yes	ADPVSC
chr1_2927285_G_A_b38	MORN1	-2.68	0.00768	-0.024601	45	0.009181	yes	ADPVSC
chr1_2927502_A_G_b38	MORN1	-2.68	0.00768	-0.024601	45	0.009181	yes	ADPVSC
chr1_2927809_T_G_b38	MORN1	-2.68	0.00768	-0.024601	45	0.009181	yes	ADPVSC
chr1_2925315_A_G_b38	MORN1	-2.672	0.00784	-0.024502	45	0.009169	yes	ADPVSC
chr1_2925918_C_T_b38	MORN1	-2.672	0.00784	-0.024502	45	0.009169	yes	ADPVSC
chr1_3179914_T_C_b38	MORN1	-2.672	0.00786	-0.030078	12	0.011259	yes	ADPVSC
chr1_2363825_TAA_T_b38	MORN1	-2.626	0.00898	-0.019039	91	0.007251	yes	ADPVSC
chr1_3169833_T_C_b38	MORN1	2.625	0.009	0.029249	13	0.011142	yes	ADPVSC
chr1_2342840_A_ATATTTTATTTTATTT_b38	MORN1	2.62	0.00913	0.039346	12	0.015017	yes	ADPVSC
chr1_2324194_G_A_b38	MORN1	2.615	0.00927	0.040621	8	0.015535	yes	ADPVSC
chr1_2045412_G_T_b38	MORN1	-2.591	0.00991	-0.029326	8	0.011317	yes	ADPVSC
chr1_2368473_T_C_b38	MORN1	-8.202	3.3e-15	-0.062376	61	0.007605	no	ADPVSC
chr1_2368188_T_C_b38	MORN1	-8.147	4.86e-15	-0.062005	58	0.00761	no	ADPVSC
chr1_2367872_A_G_b38	MORN1	-8.121	5.84e-15	-0.06198	58	0.007632	no	ADPVSC
chr1_2364339_A_C_b38	MORN1	-7.98	1.58e-14	-0.06103	57	0.007648	no	ADPVSC
chr1_2366816_A_G_b38	MORN1	-7.844	4.05e-14	-0.060273	57	0.007684	no	ADPVSC
chr1_2352756_T_C_b38	MORN1	-7.812	5.07e-14	-0.060472	55	0.007741	no	ADPVSC
chr1_2366243_C_T_b38	MORN1	-7.711	1.01e-13	-0.060235	54	0.007812	no	ADPVSC
chr1_2366555_G_C_b38	MORN1	-7.706	1.04e-13	-0.060062	54	0.007794	no	ADPVSC
chr1_2367799_C_T_b38	MORN1	-7.638	1.66e-13	-0.059797	54	0.007829	no	ADPVSC
chr1_2365236_C_T_b38	MORN1	-7.63	1.75e-13	-0.059538	54	0.007803	no	ADPVSC
chr1_2348700_C_T_b38	MORN1	-7.624	1.83e-13	-0.061794	47	0.008106	no	ADPVSC
chr1_2366956_CAAAATACATAGA_C_b38	MORN1	-7.617	1.91e-13	-0.058525	56	0.007684	no	ADPVSC
chr1_2368718_C_A_b38	MORN1	-7.611	1.99e-13	-0.059467	54	0.007813	no	ADPVSC
chr1_2366496_A_T_b38	MORN1	-7.552	2.96e-13	-0.059016	54	0.007814	no	ADPVSC
chr1_2368939_G_C_b38	MORN1	-7.546	3.07e-13	-0.059062	54	0.007826	no	ADPVSC
chr1_2351241_C_T_b38	MORN1	-7.521	3.64e-13	-0.05935	53	0.007891	no	ADPVSC
chr1_2367197_G_A_b38	MORN1	-7.513	3.84e-13	-0.058826	54	0.007829	no	ADPVSC
chr1_2365333_G_A_b38	MORN1	-7.492	4.42e-13	-0.058517	54	0.00781	no	ADPVSC
chr1_2363829_A_T_b38	MORN1	-7.281	1.78e-12	-0.055073	56	0.007564	no	ADPVSC
chr1_2369210_C_T_b38	MORN1	-7.144	4.34e-12	-0.055307	65	0.007742	no	ADPVSC
chr1_2343699_C_T_b38	MORN1	-6.884	2.27e-11	-0.055529	50	0.008066	no	ADPVSC
chr1_2350750_AGGGGTGGCACG_A_b38	MORN1	-6.833	3.13e-11	-0.063267	21	0.009259	no	ADPVSC
chr1_2343517_G_A_b38	MORN1	-6.733	5.84e-11	-0.054664	50	0.008119	no	ADPVSC
chr1_2367456_C_CAA_b38	MORN1	-6.368	5.29e-10	-0.053523	41	0.008405	no	ADPVSC
chr1_2347212_C_T_b38	MORN1	-6.35	5.86e-10	-0.060338	19	0.009501	no	ADPVSC
chr1_2354645_C_T_b38	MORN1	-6.35	5.88e-10	-0.062069	17	0.009774	no	ADPVSC
chr1_2362229_A_G_b38	MORN1	-6.315	7.25e-10	-0.061261	18	0.009702	no	ADPVSC
chr1_2348393_G_A_b38	MORN1	-6.305	7.65e-10	-0.060157	19	0.009541	no	ADPVSC
chr1_2351215_T_G_b38	MORN1	-6.242	1.11e-09	-0.060776	18	0.009737	no	ADPVSC
chr1_2362863_C_CA_b38	MORN1	-6.229	1.2e-09	-0.062777	14	0.010078	no	ADPVSC
chr1_2354688_G_C_b38	MORN1	-6.213	1.31e-09	-0.06107	17	0.009829	no	ADPVSC
chr1_2353459_T_G_b38	MORN1	5.854	1e-08	0.044073	106	0.007529	no	ADPVSC
chr1_2356177_T_C_b38	MORN1	5.854	1e-08	0.044073	106	0.007529	no	ADPVSC
chr1_2342133_C_G_b38	MORN1	-5.829	1.15e-08	-0.057569	17	0.009876	no	ADPVSC
chr1_2342137_G_A_b38	MORN1	-5.829	1.15e-08	-0.057569	17	0.009876	no	ADPVSC
chr1_2358849_T_C_b38	MORN1	5.826	1.17e-08	0.044171	106	0.007582	no	ADPVSC
chr1_2352457_A_G_b38	MORN1	5.816	1.24e-08	0.044143	106	0.00759	no	ADPVSC
chr1_2360716_T_C_b38	MORN1	5.816	1.24e-08	0.044143	106	0.00759	no	ADPVSC
chr1_2360970_T_C_b38	MORN1	5.816	1.24e-08	0.044143	106	0.00759	no	ADPVSC
chr1_2361332_A_AG_b38	MORN1	5.816	1.24e-08	0.044143	106	0.00759	no	ADPVSC
chr1_2361548_A_ACT_b38	MORN1	5.816	1.24e-08	0.044143	106	0.00759	no	ADPVSC
chr1_2351678_C_T_b38	MORN1	-5.788	1.45e-08	-0.057057	17	0.009858	no	ADPVSC
chr1_2352403_G_T_b38	MORN1	5.786	1.46e-08	0.04374	105	0.00756	no	ADPVSC
chr1_2357308_T_C_b38	MORN1	5.782	1.49e-08	0.044081	110	0.007624	no	ADPVSC
chr1_2340787_C_T_b38	MORN1	-5.658	2.94e-08	-0.046352	41	0.008193	no	ADPVSC
chr1_2359472_G_A_b38	MORN1	5.071	6.07e-07	0.038754	77	0.007642	no	ADPVSC
chr1_2353743_A_T_b38	MORN1	5.044	6.94e-07	0.043702	49	0.008664	no	ADPVSC
chr1_2343937_T_G_b38	MORN1	-4.941	1.15e-06	-0.040533	72	0.008204	no	ADPVSC
chr1_2337211_C_G_b38	MORN1	4.927	1.23e-06	0.0389	73	0.007896	no	ADPVSC
chr1_2341451_G_A_b38	MORN1	4.717	3.33e-06	0.042707	28	0.009055	no	ADPVSC
chr1_2344757_C_A_b38	MORN1	4.697	3.63e-06	0.044228	22	0.009415	no	ADPVSC
chr1_2344761_T_A_b38	MORN1	4.697	3.63e-06	0.044228	22	0.009415	no	ADPVSC
chr1_2345727_G_A_b38	MORN1	4.697	3.63e-06	0.044228	22	0.009415	no	ADPVSC
chr1_2350934_C_T_b38	MORN1	4.697	3.63e-06	0.044228	22	0.009415	no	ADPVSC
chr1_2369355_G_GA_b38	MORN1	-4.697	3.65e-06	-0.040072	45	0.008532	no	ADPVSC
chr1_2351551_C_T_b38	MORN1	4.691	3.74e-06	0.044544	21	0.009495	no	ADPVSC
chr1_2369118_G_A_b38	MORN1	-4.653	4.46e-06	-0.044792	21	0.009626	no	ADPVSC
chr1_2340807_G_A_b38	MORN1	4.649	4.54e-06	0.041886	29	0.009009	no	ADPVSC
chr1_2345849_ACACACAG_A_b38	MORN1	4.636	4.83e-06	0.045015	18	0.009711	no	ADPVSC
chr1_2297717_C_T_b38	MORN1	-4.605	5.56e-06	-0.045515	20	0.009884	no	ADPVSC
chr1_2344634_T_C_b38	MORN1	4.585	6.1e-06	0.043228	22	0.009429	no	ADPVSC
chr1_2367055_C_A_b38	MORN1	4.57	6.52e-06	0.042174	25	0.009229	no	ADPVSC
chr1_2379954_A_G_b38	MORN1	-4.547	7.23e-06	-0.039559	32	0.0087	no	ADPVSC
chr1_2391602_T_C_b38	MORN1	-4.477	9.92e-06	-0.038632	33	0.00863	no	ADPVSC
chr1_2338460_T_C_b38	MORN1	4.438	1.18e-05	0.03475	74	0.007831	no	ADPVSC
chr1_2340625_G_A_b38	MORN1	4.406	1.36e-05	0.03965	29	0.008999	no	ADPVSC
chr1_2347542_C_T_b38	MORN1	-4.405	1.36e-05	-0.035775	90	0.00812	no	ADPVSC
chr1_2337352_A_G_b38	MORN1	4.292	2.23e-05	0.034683	72	0.008082	no	ADPVSC
chr1_2298478_C_T_b38	MORN1	-4.267	2.47e-05	-0.042208	20	0.009891	no	ADPVSC
chr1_2338570_C_T_b38	MORN1	4.226	2.95e-05	0.033463	70	0.007918	no	ADPVSC
chr1_2337299_A_G_b38	MORN1	4.225	2.97e-05	0.034157	67	0.008085	no	ADPVSC
chr1_2337239_T_C_b38	MORN1	4.196	3.35e-05	0.036159	44	0.008617	no	ADPVSC
chr1_2340235_T_C_b38	MORN1	4.194	3.38e-05	0.037249	30	0.008882	no	ADPVSC
chr1_2337229_A_G_b38	MORN1	4.167	3.79e-05	0.03309	97	0.007941	no	ADPVSC
chr1_2344583_G_A_b38	MORN1	4.059	5.94e-05	0.038291	22	0.009434	no	ADPVSC
chr1_2340764_G_T_b38	MORN1	4.054	6.07e-05	0.036057	30	0.008895	no	ADPVSC
chr1_2337141_G_A_b38	MORN1	4.048	6.21e-05	0.033585	53	0.008297	no	ADPVSC
chr1_2344980_A_G_b38	MORN1	4.037	6.5e-05	0.037562	23	0.009305	no	ADPVSC
chr1_2345774_T_C_b38	MORN1	4.037	6.5e-05	0.037562	23	0.009305	no	ADPVSC
chr1_2344932_C_T_b38	MORN1	4.008	7.32e-05	0.040081	16	0.010001	no	ADPVSC
chr1_2380105_C_T_b38	MORN1	-3.929	0.000101	-0.031435	61	0.008001	no	ADPVSC
chr1_2389263_T_C_b38	MORN1	-3.87	0.000127	-0.035909	27	0.00928	no	ADPVSC
chr1_2380209_G_A_b38	MORN1	-3.842	0.000142	-0.030755	60	0.008006	no	ADPVSC
chr1_3156991_T_C_b38	MORN1	3.712	0.000235	0.030422	107	0.008195	no	ADPVSC
chr1_3179791_G_A_b38	MORN1	-3.62	0.000333	-0.030217	107	0.008347	no	ADPVSC
chr1_3180900_A_G_b38	MORN1	-3.585	0.00038	-0.030054	105	0.008384	no	ADPVSC
chr1_2337131_A_G_b38	MORN1	3.557	0.00042	0.028448	73	0.007997	no	ADPVSC
chr1_3173412_G_A_b38	MORN1	-3.556	0.000421	-0.029791	107	0.008377	no	ADPVSC
chr1_2345829_C_CCACACA_b38	MORN1	-3.489	0.000538	-0.043645	9	0.012508	no	ADPVSC
chr1_2369336_A_G_b38	MORN1	-3.487	0.000542	-0.035336	17	0.010133	no	ADPVSC
chr1_2849308_C_A_b38	MORN1	-3.484	0.000548	-0.032789	26	0.00941	no	ADPVSC
chr1_2662497_C_A_b38	MORN1	-3.436	0.000652	-0.095594	3	0.027819	no	ADPVSC
chr1_3164745_T_C_b38	MORN1	3.419	0.000694	0.028359	107	0.008295	no	ADPVSC
chr1_3182321_C_T_b38	MORN1	-3.376	0.000807	-0.027274	89	0.008078	no	ADPVSC
chr1_3162773_C_T_b38	MORN1	3.373	0.000815	0.027686	109	0.008207	no	ADPVSC
chr1_2326424_C_T_b38	MORN1	3.373	0.000818	0.028046	63	0.008316	no	ADPVSC
chr1_3170809_A_T_b38	MORN1	-3.364	0.000842	-0.027775	109	0.008256	no	ADPVSC
chr1_2327034_G_A_b38	MORN1	3.289	0.00109	0.027644	64	0.008404	no	ADPVSC
chr1_2326288_C_T_b38	MORN1	3.279	0.00114	0.02721	64	0.008299	no	ADPVSC
chr1_2326884_C_T_b38	MORN1	3.279	0.00114	0.02721	64	0.008299	no	ADPVSC
chr1_3160293_T_G_b38	MORN1	3.252	0.00124	0.026673	107	0.008201	no	ADPVSC
chr1_2920488_C_T_b38	MORN1	-3.236	0.00131	-0.030708	28	0.009489	no	ADPVSC
chr1_1499339_T_C_b38	MORN1	-3.227	0.00135	-0.06127	3	0.018987	no	ADPVSC
chr1_2361214_A_C_b38	MORN1	-3.219	0.00139	-0.048318	6	0.01501	no	ADPVSC
chr1_3164376_C_G_b38	MORN1	3.185	0.00156	0.025607	104	0.00804	no	ADPVSC
chr1_3154070_C_G_b38	MORN1	3.168	0.00165	0.026022	100	0.008213	no	ADPVSC
chr1_3157319_A_T_b38	MORN1	3.164	0.00167	0.028921	35	0.009139	no	ADPVSC
chr1_2314194_C_T_b38	MORN1	-3.141	0.00181	-0.027936	46	0.008895	no	ADPVSC
chr1_2662482_C_CCA_b38	MORN1	-3.127	0.0019	-0.094104	3	0.030098	no	ADPVSC
chr1_2300128_G_T_b38	MORN1	-3.121	0.00193	-0.024332	108	0.007795	no	ADPVSC
chr1_2314000_T_C_b38	MORN1	-3.117	0.00196	-0.027389	44	0.008786	no	ADPVSC
chr1_2315074_A_G_b38	MORN1	-3.066	0.00232	-0.026797	44	0.008741	no	ADPVSC
chr1_3156128_T_C_b38	MORN1	3.027	0.00263	0.027786	34	0.009178	no	ADPVSC
chr1_3170057_AT_A_b38	MORN1	3.004	0.00283	0.025535	80	0.0085	no	ADPVSC
chr1_2342881_ATTTTAT_A_b38	MORN1	3	0.00287	0.077852	4	0.025947	no	ADPVSC
chr1_2370252_G_A_b38	MORN1	2.981	0.00305	0.030435	12	0.010211	no	ADPVSC
chr1_2316943_G_GC_b38	MORN1	-2.963	0.00323	-0.026742	36	0.009027	no	ADPVSC
chr1_2316944_G_T_b38	MORN1	-2.963	0.00323	-0.026742	36	0.009027	no	ADPVSC
chr1_2302601_CAGG_C_b38	MORN1	-2.948	0.00338	-0.030966	16	0.010503	no	ADPVSC
chr1_2303193_G_A_b38	MORN1	-2.948	0.00338	-0.030966	16	0.010503	no	ADPVSC
chr1_3167148_T_C_b38	MORN1	2.937	0.0035	0.024146	90	0.00822	no	ADPVSC
chr1_2436424_TCCTTTCTCCCTCCTCCCTTCCTCCCTTCCTCCCTCCACCTTTCCTCCTTCCTCCCTCCTCCCCTCCTCCCTCCTCCTCCTTTCCTCCTTCCTCCCTCCTCCTTTCCTCCTTCCTCCCTCCTC_T_b38	MORN1	-2.928	0.00361	-0.065416	5	0.022342	no	ADPVSC
chr1_2342882_T_TTTTA_b38	MORN1	2.919	0.00371	0.077146	4	0.026432	no	ADPVSC
chr1_2320961_AG_A_b38	MORN1	2.915	0.00375	0.02675	32	0.009176	no	ADPVSC
chr1_2922151_C_CT_b38	MORN1	-2.913	0.00378	-0.026632	48	0.009141	no	ADPVSC
chr1_2924136_A_G_b38	MORN1	-2.913	0.00378	-0.026632	48	0.009141	no	ADPVSC
chr1_2325032_T_A_b38	MORN1	2.881	0.00417	0.044809	12	0.015551	no	ADPVSC
chr1_2324977_G_GGCT_b38	MORN1	2.867	0.00436	0.024576	60	0.008571	no	ADPVSC
chr1_2921485_CTGTCCATCTGTCCATCCAGCTCTGCAGGAGGGCGGCTGCCTGTGTCCGTCTGTCCATCCAGCTCTGCAGGAGGGCGGCTGCCTGTGTCCATCTGTCCATCCAGCTCTGCAGGAGGGCGGCTGCCTG_C_b38	MORN1	-2.866	0.00438	-0.068556	3	0.023921	no	ADPVSC
chr1_2324806_A_T_b38	MORN1	2.852	0.00457	0.024409	59	0.008557	no	ADPVSC
chr1_2314848_G_C_b38	MORN1	-2.836	0.0048	-0.025002	49	0.008816	no	ADPVSC
chr1_2300527_G_C_b38	MORN1	-2.828	0.00492	-0.029033	17	0.010267	no	ADPVSC
chr1_1498115_C_T_b38	MORN1	-2.823	0.005	-0.073393	3	0.026	no	ADPVSC
chr1_3158055_T_C_b38	MORN1	2.821	0.00502	0.026962	23	0.009557	no	ADPVSC
chr1_3176738_A_G_b38	MORN1	2.812	0.00516	0.023469	76	0.008346	no	ADPVSC
chr1_2675467_TAACAGCACCCACACTCCCAGGTGAGC_T_b38	MORN1	2.808	0.00523	0.061122	4	0.021766	no	ADPVSC
chr1_2342885_TA_T_b38	MORN1	2.797	0.00542	0.076114	4	0.027217	no	ADPVSC
chr1_2359882_C_CA_b38	MORN1	-2.796	0.00543	-0.026202	27	0.009371	no	ADPVSC
chr1_2675497_TGACAGCCTGCAACAGCACCCTGCACCC_T_b38	MORN1	2.794	0.00546	0.055373	6	0.019819	no	ADPVSC
chr1_3181540_GGTCTTACACACGCA_G_b38	MORN1	2.792	0.00548	0.062086	3	0.022233	no	ADPVSC
chr1_2698996_G_A_b38	MORN1	2.783	0.00565	0.04456	8	0.016013	no	ADPVSC
chr1_3182630_A_G_b38	MORN1	-2.762	0.00602	-0.02288	80	0.008285	no	ADPVSC
chr1_2926789_T_C_b38	MORN1	-2.759	0.00607	-0.026544	31	0.009622	no	ADPVSC
chr1_2302522_G_A_b38	MORN1	-2.732	0.00657	-0.028179	17	0.010313	no	ADPVSC
chr1_2342999_A_G_b38	MORN1	-2.729	0.00663	-0.02444	35	0.008954	no	ADPVSC
chr1_2346676_G_C_b38	MORN1	-2.714	0.00694	-0.028132	14	0.010365	no	ADPVSC
chr1_2312125_G_A_b38	MORN1	-2.695	0.00733	-0.021104	129	0.00783	no	ADPVSC
chr1_2357811_C_G_b38	MORN1	-2.674	0.00782	-0.027691	14	0.010357	no	ADPVSC
chr1_2357812_T_C_b38	MORN1	-2.674	0.00782	-0.027691	14	0.010357	no	ADPVSC
chr1_2359828_A_G_b38	MORN1	-2.674	0.00782	-0.027691	14	0.010357	no	ADPVSC
chr1_2363591_T_G_b38	MORN1	-2.674	0.00782	-0.027691	14	0.010357	no	ADPVSC
chr1_2921186_C_T_b38	MORN1	-2.661	0.0081	-0.026531	21	0.009969	no	ADPVSC
chr1_2921227_C_G_b38	MORN1	-2.661	0.0081	-0.026531	21	0.009969	no	ADPVSC
chr1_2197362_G_C_b38	MORN1	2.644	0.00851	0.034313	7	0.012976	no	ADPVSC
chr1_1573429_C_CA_b38	MORN1	-2.641	0.00859	-0.066213	4	0.025069	no	ADPVSC
chr1_2353047_C_T_b38	MORN1	-2.639	0.00863	-0.027318	14	0.01035	no	ADPVSC
chr1_2138661_C_T_b38	MORN1	2.634	0.00876	0.033163	7	0.012589	no	ADPVSC
chr1_2140299_C_T_b38	MORN1	2.634	0.00876	0.033163	7	0.012589	no	ADPVSC
chr1_2316048_A_G_b38	MORN1	-2.63	0.00887	-0.023718	36	0.009018	no	ADPVSC
chr1_2063845_CT_C_b38	MORN1	-2.626	0.00897	-0.031426	6	0.011966	no	ADPVSC
chr1_2927025_G_A_b38	MORN1	-2.608	0.00945	-0.024295	39	0.009315	no	ADPVSC
chr1_2921277_C_T_b38	MORN1	-2.604	0.00956	-0.025733	22	0.009882	no	ADPVSC
chr1_2350287_A_C_b38	MORN1	-2.603	0.00959	-0.026941	14	0.010351	no	ADPVSC
chr1_2319680_A_G_b38	MORN1	2.602	0.00962	0.023863	32	0.009172	no	ADPVSC
chr1_2304900_T_C_b38	MORN1	-2.599	0.00969	-0.026353	18	0.010139	no	ADPVSC
chr1_1606094_G_GAGGGGTC_b38	MORN1	2.595	0.00981	0.024569	35	0.009468	no	ADPVSC
chr1_1521518_G_A_b38	MORN1	-2.59	0.00995	-0.041398	17	0.015983	no	ADPVSC
chr1_2375533_G_A_b38	MORN1	-5.507	1.16e-07	-0.062286	24	0.01131	yes	ADRNLG
chr1_2383824_C_G_b38	MORN1	-5.319	2.89e-07	-0.058055	33	0.010915	yes	ADRNLG
chr1_2377643_T_G_b38	MORN1	-5.31	3.02e-07	-0.057103	53	0.010755	yes	ADRNLG
chr1_2383024_G_T_b38	MORN1	-5.176	5.69e-07	-0.059393	25	0.011475	yes	ADRNLG
chr1_2383716_CA_C_b38	MORN1	-5.176	5.69e-07	-0.059393	25	0.011475	yes	ADRNLG
chr1_2385630_A_C_b38	MORN1	-5.143	6.64e-07	-0.060402	22	0.011744	yes	ADRNLG
chr1_2372759_GACC_G_b38	MORN1	-5.05	1.02e-06	-0.057683	25	0.011423	yes	ADRNLG
chr1_2372762_C_CTG_b38	MORN1	-5.05	1.02e-06	-0.057683	25	0.011423	yes	ADRNLG
chr1_2375256_C_T_b38	MORN1	-4.769	3.66e-06	-0.052724	33	0.011057	yes	ADRNLG
chr1_2380956_C_T_b38	MORN1	-4.746	4.04e-06	-0.065808	8	0.013865	yes	ADRNLG
chr1_2382101_A_G_b38	MORN1	-4.746	4.04e-06	-0.065808	8	0.013865	yes	ADRNLG
chr1_2384876_A_G_b38	MORN1	-4.736	4.23e-06	-0.049103	55	0.010368	yes	ADRNLG
chr1_2384241_A_G_b38	MORN1	-4.656	6.02e-06	-0.048211	56	0.010356	yes	ADRNLG
chr1_2374713_C_T_b38	MORN1	-4.621	6.99e-06	-0.05097	34	0.01103	yes	ADRNLG
chr1_2377078_C_G_b38	MORN1	-4.555	9.29e-06	-0.081893	3	0.017978	yes	ADRNLG
chr1_2392569_C_T_b38	MORN1	-4.488	1.24e-05	-0.061617	9	0.013729	yes	ADRNLG
chr1_2371077_T_C_b38	MORN1	-4.407	1.74e-05	-0.047562	58	0.010792	yes	ADRNLG
chr1_2371472_G_A_b38	MORN1	-4.334	2.36e-05	-0.055266	12	0.012751	yes	ADRNLG
chr1_2376477_A_C_b38	MORN1	-4.327	2.43e-05	-0.044302	59	0.010239	yes	ADRNLG
chr1_2371226_C_CACAACCACA_b38	MORN1	-4.271	3.06e-05	-0.046085	50	0.010791	yes	ADRNLG
chr1_2387989_A_G_b38	MORN1	-4.266	3.13e-05	-0.045644	51	0.010701	yes	ADRNLG
chr1_2382880_T_C_b38	MORN1	-4.249	3.34e-05	-0.074636	4	0.017564	yes	ADRNLG
chr1_2392897_T_C_b38	MORN1	-4.219	3.77e-05	-0.049943	24	0.011836	yes	ADRNLG
chr1_2392128_T_C_b38	MORN1	-4.074	6.75e-05	-0.043489	50	0.010674	yes	ADRNLG
chr1_2371032_C_T_b38	MORN1	-3.987	9.52e-05	-0.043257	45	0.010851	yes	ADRNLG
chr1_2384278_A_G_b38	MORN1	-3.983	9.66e-05	-0.041327	45	0.010377	yes	ADRNLG
chr1_2389131_A_AAAG_b38	MORN1	-3.968	0.000102	-0.039309	56	0.009906	yes	ADRNLG
chr1_2370674_CTT_C_b38	MORN1	-3.687	0.000296	-0.04165	48	0.011298	yes	ADRNLG
chr1_2383975_C_T_b38	MORN1	-3.54	0.000502	-0.047152	12	0.01332	yes	ADRNLG
chr1_2972054_G_T_b38	MORN1	-3.534	0.000513	-0.041282	44	0.011682	yes	ADRNLG
chr1_2036515_C_T_b38	MORN1	-3.51	0.000559	-0.041282	21	0.011762	yes	ADRNLG
chr1_2037520_G_A_b38	MORN1	-3.4	0.000819	-0.040295	20	0.011851	yes	ADRNLG
chr1_2035575_G_A_b38	MORN1	-3.335	0.00102	-0.039768	20	0.011925	yes	ADRNLG
chr1_2395636_C_T_b38	MORN1	-3.311	0.00111	-0.044702	12	0.013502	yes	ADRNLG
chr1_2409065_C_T_b38	MORN1	-3.307	0.00113	-0.043921	14	0.013283	yes	ADRNLG
chr1_3180860_G_A_b38	MORN1	-3.084	0.00235	-0.04265	9	0.013832	yes	ADRNLG
chr1_2395479_G_A_b38	MORN1	-3.015	0.00292	-0.040658	12	0.013487	yes	ADRNLG
chr1_2389113_C_CA_b38	MORN1	-2.928	0.00382	-0.032662	38	0.011153	yes	ADRNLG
chr1_3169833_T_C_b38	MORN1	2.907	0.00408	0.040299	9	0.013863	yes	ADRNLG
chr1_2405593_C_T_b38	MORN1	-2.87	0.00457	-0.038149	15	0.013293	yes	ADRNLG
chr1_1747241_C_CA_b38	MORN1	-2.827	0.00519	-0.035428	35	0.012531	yes	ADRNLG
chr1_3132178_A_G_b38	MORN1	-2.821	0.00528	-0.044414	5	0.015742	yes	ADRNLG
chr1_2388775_CAAAA_C_b38	MORN1	-2.818	0.00534	-0.045796	9	0.016252	yes	ADRNLG
chr1_2069153_C_A_b38	MORN1	2.785	0.00589	0.037285	20	0.013388	yes	ADRNLG
chr1_2369210_C_T_b38	MORN1	-2.772	0.00611	-0.032063	30	0.011565	yes	ADRNLG
chr1_2353743_A_T_b38	MORN1	2.757	0.00639	0.034615	23	0.012554	yes	ADRNLG
chr1_2356409_G_C_b38	MORN1	2.733	0.00686	0.034374	21	0.012577	yes	ADRNLG
chr1_3158055_T_C_b38	MORN1	2.726	0.007	0.035472	12	0.01301	yes	ADRNLG
chr1_3177186_T_C_b38	MORN1	-2.723	0.00707	-0.0367	12	0.01348	yes	ADRNLG
chr1_3011857_C_T_b38	MORN1	2.719	0.00714	0.039291	8	0.014448	yes	ADRNLG
chr1_3172496_G_C_b38	MORN1	-2.708	0.00739	-0.036561	12	0.013503	yes	ADRNLG
chr1_3176764_C_T_b38	MORN1	2.702	0.0075	0.037919	8	0.014032	yes	ADRNLG
chr1_3179914_T_C_b38	MORN1	-2.687	0.00783	-0.03779	8	0.014062	yes	ADRNLG
chr1_3156128_T_C_b38	MORN1	2.686	0.00787	0.032505	21	0.012102	yes	ADRNLG
chr1_3172178_C_T_b38	MORN1	-2.675	0.00813	-0.036091	12	0.013494	yes	ADRNLG
chr1_2284929_T_G_b38	MORN1	2.674	0.00814	0.02975	42	0.011126	yes	ADRNLG
chr1_3094885_TCTTC_T_b38	MORN1	2.665	0.00835	0.035502	11	0.013321	yes	ADRNLG
chr1_2404771_C_T_b38	MORN1	-2.662	0.00843	-0.036283	13	0.013631	yes	ADRNLG
chr1_2363405_C_T_b38	MORN1	2.606	0.00989	0.032399	20	0.012433	yes	ADRNLG
chr1_1835922_G_GA_b38	MORN1	3.101	0.00222	0.049242	12	0.01588	no	ADRNLG
chr1_2043528_G_A_b38	MORN1	3.004	0.00302	0.054234	5	0.018052	no	ADRNLG
chr1_2041023_T_C_b38	MORN1	2.942	0.00366	0.052916	4	0.017984	no	ADRNLG
chr1_1734812_G_A_b38	MORN1	-2.926	0.00385	-0.04426	21	0.015125	no	ADRNLG
chr1_1993851_G_A_b38	MORN1	2.877	0.00447	0.048388	4	0.016818	no	ADRNLG
chr1_3346939_C_T_b38	MORN1	-2.845	0.00493	-0.038535	10	0.013546	no	ADRNLG
chr1_2064022_T_G_b38	MORN1	2.768	0.00619	0.085268	5	0.030805	no	ADRNLG
chr1_3345759_TCGGG_T_b38	MORN1	-2.766	0.00623	-0.036588	12	0.013229	no	ADRNLG
chr1_3345764_TCCTCCCGTGCTGCCCCCTCTGTGGTCCAGGCCACCCCTTGGTTCCTCCTGTGCTGCCCTCTC_T_b38	MORN1	-2.766	0.00623	-0.036588	12	0.013229	no	ADRNLG
chr1_2059723_G_A_b38	MORN1	2.759	0.00636	0.039217	16	0.014214	no	ADRNLG
chr1_2367799_C_T_b38	MORN1	-2.699	0.00758	-0.031088	27	0.011519	no	ADRNLG
chr1_1703583_A_G_b38	MORN1	2.649	0.00875	0.053253	14	0.020105	no	ADRNLG
chr1_2056821_T_C_b38	MORN1	2.619	0.00952	0.037023	17	0.014136	no	ADRNLG
chr1_2368473_T_C_b38	MORN1	-11.868	4.07e-27	-0.086031	62	0.007249	yes	ARTAORT
chr1_2364339_A_C_b38	MORN1	-11.718	1.4e-26	-0.084815	57	0.007238	yes	ARTAORT
chr1_2368188_T_C_b38	MORN1	-11.652	2.41e-26	-0.084141	58	0.007221	yes	ARTAORT
chr1_2366816_A_G_b38	MORN1	-11.557	5.28e-26	-0.08421	56	0.007287	yes	ARTAORT
chr1_2367872_A_G_b38	MORN1	-11.472	1.06e-25	-0.083367	58	0.007267	yes	ARTAORT
chr1_2352756_T_C_b38	MORN1	-11.182	1.11e-24	-0.082551	55	0.007383	yes	ARTAORT
chr1_2351241_C_T_b38	MORN1	-11.176	1.17e-24	-0.084012	51	0.007517	yes	ARTAORT
chr1_2367799_C_T_b38	MORN1	-11.11	1.99e-24	-0.08267	54	0.007441	yes	ARTAORT
chr1_2366496_A_T_b38	MORN1	-11.07	2.74e-24	-0.08234	54	0.007438	yes	ARTAORT
chr1_2366555_G_C_b38	MORN1	-10.975	5.89e-24	-0.081318	55	0.00741	yes	ARTAORT
chr1_2366243_C_T_b38	MORN1	-10.961	6.55e-24	-0.081721	53	0.007455	yes	ARTAORT
chr1_2368939_G_C_b38	MORN1	-10.937	7.98e-24	-0.081364	54	0.00744	yes	ARTAORT
chr1_2365333_G_A_b38	MORN1	-10.898	1.09e-23	-0.079679	53	0.007311	yes	ARTAORT
chr1_2343517_G_A_b38	MORN1	-10.801	2.35e-23	-0.082405	48	0.007629	yes	ARTAORT
chr1_2367197_G_A_b38	MORN1	-10.759	3.3e-23	-0.080499	53	0.007482	yes	ARTAORT
chr1_2366956_CAAAATACATAGA_C_b38	MORN1	-10.67	6.64e-23	-0.079722	55	0.007471	yes	ARTAORT
chr1_2348700_C_T_b38	MORN1	-10.629	9.22e-23	-0.083423	44	0.007849	yes	ARTAORT
chr1_2343699_C_T_b38	MORN1	-10.555	1.65e-22	-0.081051	48	0.007679	yes	ARTAORT
chr1_2365236_C_T_b38	MORN1	-10.501	2.52e-22	-0.078923	54	0.007516	yes	ARTAORT
chr1_2368718_C_A_b38	MORN1	-10.469	3.24e-22	-0.078515	53	0.0075	yes	ARTAORT
chr1_2369210_C_T_b38	MORN1	-10.138	4.26e-21	-0.074617	64	0.00736	yes	ARTAORT
chr1_2363829_A_T_b38	MORN1	-9.574	3.13e-19	-0.069892	56	0.0073	yes	ARTAORT
chr1_2367456_C_CAA_b38	MORN1	-9.317	2.12e-18	-0.076037	40	0.008161	yes	ARTAORT
chr1_2364657_A_T_b38	MORN1	-8.515	6.85e-16	-0.065306	93	0.007669	yes	ARTAORT
chr1_2364658_A_T_b38	MORN1	-8.515	6.85e-16	-0.065306	93	0.007669	yes	ARTAORT
chr1_2340787_C_T_b38	MORN1	-8.317	2.72e-15	-0.068727	40	0.008263	yes	ARTAORT
chr1_2366021_T_C_b38	MORN1	-8.262	3.99e-15	-0.06565	87	0.007946	yes	ARTAORT
chr1_2346801_C_T_b38	MORN1	-8.199	6.16e-15	-0.064688	94	0.00789	yes	ARTAORT
chr1_2350539_T_G_b38	MORN1	-8.175	7.27e-15	-0.064602	86	0.007903	yes	ARTAORT
chr1_2349222_G_A_b38	MORN1	-8.163	7.87e-15	-0.064112	95	0.007854	yes	ARTAORT
chr1_2343937_T_G_b38	MORN1	-7.694	1.84e-13	-0.06247	62	0.00812	yes	ARTAORT
chr1_2353459_T_G_b38	MORN1	7.222	3.84e-12	0.054712	79	0.007575	yes	ARTAORT
chr1_2356177_T_C_b38	MORN1	7.222	3.84e-12	0.054712	79	0.007575	yes	ARTAORT
chr1_2358849_T_C_b38	MORN1	7.096	8.51e-12	0.054029	81	0.007614	yes	ARTAORT
chr1_2350750_AGGGGTGGCACG_A_b38	MORN1	-7.012	1.43e-11	-0.071201	15	0.010154	yes	ARTAORT
chr1_2362229_A_G_b38	MORN1	-6.895	2.94e-11	-0.072746	13	0.010551	yes	ARTAORT
chr1_2357308_T_C_b38	MORN1	6.835	4.22e-11	0.053424	84	0.007816	yes	ARTAORT
chr1_2347212_C_T_b38	MORN1	-6.827	4.45e-11	-0.071089	12	0.010413	yes	ARTAORT
chr1_2364499_A_G_b38	MORN1	6.789	5.6e-11	0.058042	36	0.00855	yes	ARTAORT
chr1_2362863_C_CA_b38	MORN1	-6.752	6.99e-11	-0.072171	11	0.010689	yes	ARTAORT
chr1_2348393_G_A_b38	MORN1	-6.713	8.84e-11	-0.069643	14	0.010374	yes	ARTAORT
chr1_2351215_T_G_b38	MORN1	-6.653	1.27e-10	-0.070443	12	0.010589	yes	ARTAORT
chr1_2354645_C_T_b38	MORN1	-6.605	1.68e-10	-0.070385	12	0.010656	yes	ARTAORT
chr1_2354688_G_C_b38	MORN1	-6.605	1.68e-10	-0.070385	12	0.010656	yes	ARTAORT
chr1_2363405_C_T_b38	MORN1	6.414	5.17e-10	0.056821	34	0.008859	yes	ARTAORT
chr1_2351678_C_T_b38	MORN1	-6.346	7.66e-10	-0.068318	11	0.010766	yes	ARTAORT
chr1_2347542_C_T_b38	MORN1	-6.346	7.67e-10	-0.051967	81	0.008189	yes	ARTAORT
chr1_2362718_G_A_b38	MORN1	6.32	8.9e-10	0.056648	29	0.008963	yes	ARTAORT
chr1_2346111_G_C_b38	MORN1	-6.29	1.06e-09	-0.051569	79	0.008199	yes	ARTAORT
chr1_2348378_C_T_b38	MORN1	6.174	2.05e-09	0.056043	26	0.009078	yes	ARTAORT
chr1_2350696_G_A_b38	MORN1	6.131	2.61e-09	0.055505	27	0.009054	yes	ARTAORT
chr1_2356409_G_C_b38	MORN1	5.96	6.75e-09	0.053415	32	0.008963	yes	ARTAORT
chr1_2353047_C_T_b38	MORN1	-5.952	7.04e-09	-0.061915	12	0.010403	yes	ARTAORT
chr1_2346676_G_C_b38	MORN1	-5.941	7.48e-09	-0.061502	12	0.010352	yes	ARTAORT
chr1_2350287_A_C_b38	MORN1	-5.941	7.48e-09	-0.061502	12	0.010352	yes	ARTAORT
chr1_2342133_C_G_b38	MORN1	-5.928	8.01e-09	-0.065945	11	0.011124	yes	ARTAORT
chr1_2342137_G_A_b38	MORN1	-5.928	8.01e-09	-0.065945	11	0.011124	yes	ARTAORT
chr1_2344932_C_A_b38	MORN1	-5.794	1.66e-08	-0.060682	12	0.010473	yes	ARTAORT
chr1_2353743_A_T_b38	MORN1	5.753	2.07e-08	0.051387	37	0.008933	yes	ARTAORT
chr1_2369118_G_A_b38	MORN1	-5.736	2.27e-08	-0.059554	14	0.010382	yes	ARTAORT
chr1_2367871_C_T_b38	MORN1	-5.675	3.13e-08	-0.059915	12	0.010557	yes	ARTAORT
chr1_2359472_G_A_b38	MORN1	5.664	3.32e-08	0.044335	60	0.007827	yes	ARTAORT
chr1_2357811_C_G_b38	MORN1	-5.653	3.53e-08	-0.059545	12	0.010534	yes	ARTAORT
chr1_2357812_T_C_b38	MORN1	-5.653	3.53e-08	-0.059545	12	0.010534	yes	ARTAORT
chr1_2359828_A_G_b38	MORN1	-5.653	3.53e-08	-0.059545	12	0.010534	yes	ARTAORT
chr1_2363591_T_G_b38	MORN1	-5.653	3.53e-08	-0.059545	12	0.010534	yes	ARTAORT
chr1_2365220_A_G_b38	MORN1	-5.491	8.23e-08	-0.058742	12	0.010698	yes	ARTAORT
chr1_2369713_ATAAT_A_b38	MORN1	-5.46	9.63e-08	-0.05582	17	0.010223	yes	ARTAORT
chr1_2364484_C_T_b38	MORN1	-5.377	1.47e-07	-0.056619	15	0.010529	yes	ARTAORT
chr1_2357882_G_A_b38	MORN1	5.101	5.83e-07	0.049443	21	0.009693	yes	ARTAORT
chr1_2356095_C_T_b38	MORN1	4.961	1.15e-06	0.048383	21	0.009752	yes	ARTAORT
chr1_2344256_A_T_b38	MORN1	4.811	2.33e-06	0.0442	27	0.009188	yes	ARTAORT
chr1_2345829_C_CCACACA_b38	MORN1	-4.693	4.02e-06	-0.062735	7	0.013368	yes	ARTAORT
chr1_2360913_G_A_b38	MORN1	4.675	4.36e-06	0.0492	18	0.010524	yes	ARTAORT
chr1_2337299_A_G_b38	MORN1	4.557	7.42e-06	0.039762	50	0.008725	yes	ARTAORT
chr1_2345148_G_A_b38	MORN1	-4.547	7.75e-06	-0.058432	5	0.01285	yes	ARTAORT
chr1_2367055_C_A_b38	MORN1	4.507	9.26e-06	0.041881	25	0.009292	yes	ARTAORT
chr1_2359882_C_CAA_b38	MORN1	4.46	1.14e-05	0.046416	15	0.010408	yes	ARTAORT
chr1_2343445_C_T_b38	MORN1	4.441	1.24e-05	0.040621	28	0.009148	yes	ARTAORT
chr1_2367644_G_A_b38	MORN1	-4.332	1.98e-05	-0.037488	50	0.008653	yes	ARTAORT
chr1_2340425_C_T_b38	MORN1	-4.205	3.41e-05	-0.034495	81	0.008204	yes	ARTAORT
chr1_2342734_T_C_b38	MORN1	-4.023	7.21e-05	-0.040258	19	0.010008	yes	ARTAORT
chr1_2391602_T_C_b38	MORN1	-3.994	8.08e-05	-0.036225	32	0.00907	yes	ARTAORT
chr1_2340625_G_A_b38	MORN1	3.936	0.000102	0.035207	34	0.008946	yes	ARTAORT
chr1_2344932_C_T_b38	MORN1	3.932	0.000104	0.039567	18	0.010063	yes	ARTAORT
chr1_2340807_G_A_b38	MORN1	3.827	0.000156	0.034382	33	0.008983	yes	ARTAORT
chr1_2340235_T_C_b38	MORN1	3.792	0.000179	0.033665	35	0.008877	yes	ARTAORT
chr1_2341451_G_A_b38	MORN1	3.767	0.000197	0.033907	33	0.009001	yes	ARTAORT
chr1_2340564_G_A_b38	MORN1	3.682	0.000272	0.032921	34	0.00894	yes	ARTAORT
chr1_2175616_T_C_b38	MORN1	3.601	0.000367	0.046404	7	0.012885	yes	ARTAORT
chr1_2340764_G_T_b38	MORN1	3.595	0.000377	0.032171	34	0.00895	yes	ARTAORT
chr1_2379954_A_G_b38	MORN1	-3.59	0.000383	-0.032706	32	0.00911	yes	ARTAORT
chr1_2169620_C_G_b38	MORN1	3.479	0.000575	0.044105	8	0.012679	yes	ARTAORT
chr1_2337229_A_G_b38	MORN1	3.448	0.000642	0.029542	76	0.008569	yes	ARTAORT
chr1_3112648_C_T_b38	MORN1	3.379	0.00082	0.051896	3	0.01536	yes	ARTAORT
chr1_2344761_T_C_b38	MORN1	3.378	0.000822	0.036009	17	0.010661	yes	ARTAORT
chr1_2351722_A_G_b38	MORN1	3.213	0.00145	0.035603	24	0.011082	yes	ARTAORT
chr1_2341464_A_G_b38	MORN1	-3.195	0.00154	-0.039676	7	0.012419	yes	ARTAORT
chr1_2160844_C_T_b38	MORN1	3.157	0.00175	0.040149	8	0.012716	yes	ARTAORT
chr1_2325032_T_A_b38	MORN1	3.155	0.00176	0.059147	6	0.018748	yes	ARTAORT
chr1_2335494_C_T_b38	MORN1	3.142	0.00184	0.031979	20	0.010177	yes	ARTAORT
chr1_2112545_C_T_b38	MORN1	-3.072	0.00231	-0.041254	5	0.013428	yes	ARTAORT
chr1_1791172_A_AT_b38	MORN1	-3.068	0.00234	-0.034432	17	0.011223	yes	ARTAORT
chr1_3218419_C_T_b38	MORN1	3.017	0.00276	0.032102	32	0.010639	yes	ARTAORT
chr1_2341847_T_C_b38	MORN1	-3.014	0.00279	-0.038391	6	0.012738	yes	ARTAORT
chr1_1637577_T_C_b38	MORN1	-2.996	0.00295	-0.029087	26	0.009709	yes	ARTAORT
chr1_3105927_ATCCTTAGTGTGCCCCGGGGTCCACCTGTGC_A_b38	MORN1	2.984	0.00307	0.040881	9	0.0137	yes	ARTAORT
chr1_1461195_T_TC_b38	MORN1	2.982	0.00309	0.064732	8	0.021709	yes	ARTAORT
chr1_2363805_C_CAAACAA_b38	MORN1	2.964	0.00326	0.027945	32	0.009427	yes	ARTAORT
chr1_2331225_G_A_b38	MORN1	2.959	0.00332	0.046069	3	0.015567	yes	ARTAORT
chr1_2342999_A_G_b38	MORN1	-2.904	0.00395	-0.028437	23	0.009794	yes	ARTAORT
chr1_2351827_T_C_b38	MORN1	2.896	0.00405	0.030562	22	0.010555	yes	ARTAORT
chr1_2337141_G_A_b38	MORN1	2.893	0.00408	0.027181	37	0.009396	yes	ARTAORT
chr1_2436424_TCCTTTCTCCCTCCTCCCTTCCTCCCTTCCTCCCTCCACCTTTCCTCCTTCCTCCCTCCTCCCCTCCTCCCTCCTCCTCCTTTCCTCCTTCCTCCCTCCTCCTTTCCTCCTTCCTCCCTCCTC_T_b38	MORN1	-2.891	0.00411	-0.068702	4	0.023765	yes	ARTAORT
chr1_2329738_C_T_b38	MORN1	2.879	0.00426	0.038811	14	0.013482	yes	ARTAORT
chr1_2346388_G_A_b38	MORN1	-2.834	0.00489	-0.028887	19	0.010191	yes	ARTAORT
chr1_2342466_T_C_b38	MORN1	-2.832	0.00492	-0.024752	60	0.00874	yes	ARTAORT
chr1_2187285_C_CT_b38	MORN1	2.829	0.00496	0.037082	8	0.013106	yes	ARTAORT
chr1_2617426_C_CA_b38	MORN1	2.813	0.00522	0.052182	4	0.018553	yes	ARTAORT
chr1_2366312_C_T_b38	MORN1	2.78	0.00576	0.032523	9	0.011698	yes	ARTAORT
chr1_2351337_G_C_b38	MORN1	-2.768	0.00597	-0.028036	20	0.010127	yes	ARTAORT
chr1_2359221_T_C_b38	MORN1	-2.758	0.00615	-0.028087	20	0.010183	yes	ARTAORT
chr1_2360241_T_C_b38	MORN1	-2.758	0.00615	-0.028087	20	0.010183	yes	ARTAORT
chr1_3201737_G_T_b38	MORN1	2.756	0.00619	0.05857	4	0.021253	yes	ARTAORT
chr1_2364485_A_G_b38	MORN1	-2.751	0.00628	-0.025909	31	0.009418	yes	ARTAORT
chr1_2334530_T_G_b38	MORN1	2.75	0.0063	0.025684	37	0.00934	yes	ARTAORT
chr1_2747565_A_G_b38	MORN1	2.731	0.00667	0.033345	9	0.012211	yes	ARTAORT
chr1_2436407_C_T_b38	MORN1	-2.725	0.0068	-0.054166	5	0.01988	yes	ARTAORT
chr1_2333737_T_C_b38	MORN1	2.723	0.00682	0.025414	38	0.009332	yes	ARTAORT
chr1_2215707_T_C_b38	MORN1	2.71	0.0071	0.023942	48	0.008836	yes	ARTAORT
chr1_2334355_G_A_b38	MORN1	2.701	0.00728	0.032681	12	0.012099	yes	ARTAORT
chr1_2364506_G_A_b38	MORN1	-2.693	0.00747	-0.025816	26	0.009588	yes	ARTAORT
chr1_2347995_C_T_b38	MORN1	2.683	0.00769	0.031963	8	0.011915	yes	ARTAORT
chr1_2348949_CCT_C_b38	MORN1	2.682	0.0077	0.031808	8	0.01186	yes	ARTAORT
chr1_2350943_C_T_b38	MORN1	2.682	0.0077	0.031808	8	0.01186	yes	ARTAORT
chr1_1650688_T_A_b38	MORN1	-2.67	0.00797	-0.026366	27	0.009874	yes	ARTAORT
chr1_2357096_C_G_b38	MORN1	2.669	0.008	0.031808	8	0.011917	yes	ARTAORT
chr1_2348720_G_GGCACGCACACACAC_b38	MORN1	-2.664	0.00811	-0.022765	49	0.008544	yes	ARTAORT
chr1_1732892_CT_C_b38	MORN1	-2.656	0.0083	-0.031748	8	0.011952	yes	ARTAORT
chr1_2325494_G_A_b38	MORN1	2.645	0.00857	0.034141	13	0.012906	yes	ARTAORT
chr1_2325768_C_A_b38	MORN1	2.645	0.00857	0.034141	13	0.012906	yes	ARTAORT
chr1_2326256_G_A_b38	MORN1	2.645	0.00857	0.034141	13	0.012906	yes	ARTAORT
chr1_2419005_C_T_b38	MORN1	-2.643	0.00862	-0.023989	35	0.009075	yes	ARTAORT
chr1_2348984_A_C_b38	MORN1	-2.63	0.00897	-0.026783	20	0.010185	yes	ARTAORT
chr1_2353975_G_A_b38	MORN1	-2.63	0.00897	-0.026783	20	0.010185	yes	ARTAORT
chr1_2355508_A_G_b38	MORN1	-2.63	0.00897	-0.026783	20	0.010185	yes	ARTAORT
chr1_2356078_T_C_b38	MORN1	-2.63	0.00897	-0.026783	20	0.010185	yes	ARTAORT
chr1_2359451_C_T_b38	MORN1	-2.619	0.00925	-0.026829	20	0.010244	yes	ARTAORT
chr1_2361727_G_A_b38	MORN1	-2.619	0.00925	-0.026829	20	0.010244	yes	ARTAORT
chr1_1460858_G_T_b38	MORN1	2.618	0.00927	0.063771	4	0.024358	yes	ARTAORT
chr1_1460958_G_A_b38	MORN1	2.618	0.00927	0.063771	4	0.024358	yes	ARTAORT
chr1_1803982_T_TA_b38	MORN1	2.608	0.00955	0.064554	4	0.024757	yes	ARTAORT
chr1_2368212_T_C_b38	MORN1	-2.606	0.00961	-0.026681	20	0.01024	yes	ARTAORT
chr1_2360716_T_C_b38	MORN1	7.048	1.15e-11	0.053797	81	0.007633	no	ARTAORT
chr1_2360970_T_C_b38	MORN1	7.048	1.15e-11	0.053797	81	0.007633	no	ARTAORT
chr1_2361332_A_AG_b38	MORN1	7.048	1.15e-11	0.053797	81	0.007633	no	ARTAORT
chr1_2361548_A_ACT_b38	MORN1	7.048	1.15e-11	0.053797	81	0.007633	no	ARTAORT
chr1_2352403_G_T_b38	MORN1	6.892	2.99e-11	0.052221	81	0.007577	no	ARTAORT
chr1_2352457_A_G_b38	MORN1	6.858	3.68e-11	0.052121	82	0.0076	no	ARTAORT
chr1_2341705_A_G_b38	MORN1	6.531	2.61e-10	0.053372	86	0.008172	no	ARTAORT
chr1_2338659_A_G_b38	MORN1	5.574	5.34e-08	0.046183	76	0.008285	no	ARTAORT
chr1_2369336_A_G_b38	MORN1	-5.555	5.9e-08	-0.055762	19	0.010038	no	ARTAORT
chr1_2337211_C_G_b38	MORN1	5.13	5.06e-07	0.043079	55	0.008397	no	ARTAORT
chr1_2337352_A_G_b38	MORN1	5.02	8.64e-07	0.043224	58	0.00861	no	ARTAORT
chr1_2369187_T_TA_b38	MORN1	4.924	1.37e-06	0.108678	3	0.022072	no	ARTAORT
chr1_2351551_C_T_b38	MORN1	4.887	1.63e-06	0.047293	21	0.009678	no	ARTAORT
chr1_2355481_C_T_b38	MORN1	4.882	1.67e-06	0.107215	3	0.02196	no	ARTAORT
chr1_2364608_C_A_b38	MORN1	4.882	1.67e-06	0.107215	3	0.02196	no	ARTAORT
chr1_2369355_G_GA_b38	MORN1	-4.863	1.83e-06	-0.047747	34	0.009819	no	ARTAORT
chr1_2345849_ACACACAG_A_b38	MORN1	4.846	1.98e-06	0.049075	16	0.010126	no	ARTAORT
chr1_2344757_C_A_b38	MORN1	4.817	2.27e-06	0.046025	22	0.009555	no	ARTAORT
chr1_2344761_T_A_b38	MORN1	4.817	2.27e-06	0.046025	22	0.009555	no	ARTAORT
chr1_2350934_C_T_b38	MORN1	4.817	2.27e-06	0.046025	22	0.009555	no	ARTAORT
chr1_2345727_G_A_b38	MORN1	4.798	2.48e-06	0.0463	21	0.009651	no	ARTAORT
chr1_2344634_T_C_b38	MORN1	4.706	3.78e-06	0.045105	22	0.009584	no	ARTAORT
chr1_2344980_A_G_b38	MORN1	4.605	5.98e-06	0.043998	22	0.009554	no	ARTAORT
chr1_2345774_T_C_b38	MORN1	4.578	6.76e-06	0.044122	21	0.009638	no	ARTAORT
chr1_2338460_T_C_b38	MORN1	4.482	1.04e-05	0.037388	55	0.008343	no	ARTAORT
chr1_2338570_C_T_b38	MORN1	4.402	1.47e-05	0.036966	52	0.008397	no	ARTAORT
chr1_2359219_C_T_b38	MORN1	4.357	1.79e-05	0.101975	3	0.023405	no	ARTAORT
chr1_2344583_G_A_b38	MORN1	4.356	1.79e-05	0.0409	24	0.00939	no	ARTAORT
chr1_2196630_A_G_b38	MORN1	4.314	2.14e-05	0.050344	14	0.011669	no	ARTAORT
chr1_2389263_T_C_b38	MORN1	-4.278	2.5e-05	-0.040511	28	0.00947	no	ARTAORT
chr1_2204887_GCCCTCAAGCCCCGC_G_b38	MORN1	4.142	4.43e-05	0.050141	15	0.012106	no	ARTAORT
chr1_2193733_G_A_b38	MORN1	4.058	6.25e-05	0.048303	15	0.011904	no	ARTAORT
chr1_2210401_C_A_b38	MORN1	4.018	7.33e-05	0.047792	16	0.011893	no	ARTAORT
chr1_2364876_C_T_b38	MORN1	4.001	7.87e-05	0.092028	3	0.023003	no	ARTAORT
chr1_2204652_A_G_b38	MORN1	3.899	0.000118	0.046274	17	0.011869	no	ARTAORT
chr1_2370252_G_A_b38	MORN1	3.623	0.00034	0.038166	13	0.010536	no	ARTAORT
chr1_2138661_C_T_b38	MORN1	3.576	0.000403	0.045912	7	0.012838	no	ARTAORT
chr1_2140299_C_T_b38	MORN1	3.576	0.000403	0.045912	7	0.012838	no	ARTAORT
chr1_2205698_G_A_b38	MORN1	3.488	0.000555	0.04227	15	0.012118	no	ARTAORT
chr1_2325768_C_T_b38	MORN1	-3.36	0.000874	-0.049576	3	0.014754	no	ARTAORT
chr1_2108657_T_C_b38	MORN1	-3.342	0.000931	-0.041154	16	0.012314	no	ARTAORT
chr1_1836387_CT_C_b38	MORN1	-3.342	0.000933	-0.040326	19	0.012068	no	ARTAORT
chr1_2150203_C_A_b38	MORN1	3.325	0.000989	0.04048	12	0.012175	no	ARTAORT
chr1_2175551_ACTCCAACCCCTACACCCCCAACCC_A_b38	MORN1	3.321	0.001	0.04437	7	0.013361	no	ARTAORT
chr1_2361214_A_C_b38	MORN1	-3.285	0.00113	-0.060588	3	0.018442	no	ARTAORT
chr1_3114191_A_G_b38	MORN1	3.234	0.00135	0.04263	5	0.013182	no	ARTAORT
chr1_2142665_G_T_b38	MORN1	3.23	0.00137	0.041083	8	0.012721	no	ARTAORT
chr1_2145827_G_A_b38	MORN1	3.23	0.00137	0.041083	8	0.012721	no	ARTAORT
chr1_2155277_GTGA_G_b38	MORN1	3.23	0.00137	0.041083	8	0.012721	no	ARTAORT
chr1_2144375_C_T_b38	MORN1	3.229	0.00137	0.04163	7	0.012891	no	ARTAORT
chr1_2151066_C_T_b38	MORN1	3.229	0.00137	0.04163	7	0.012891	no	ARTAORT
chr1_2156118_T_C_b38	MORN1	3.229	0.00137	0.04163	7	0.012891	no	ARTAORT
chr1_2157493_C_T_b38	MORN1	3.229	0.00137	0.04163	7	0.012891	no	ARTAORT
chr1_2211288_C_G_b38	MORN1	3.219	0.00142	0.026103	70	0.008109	no	ARTAORT
chr1_2164982_T_C_b38	MORN1	3.218	0.00142	0.041436	7	0.012876	no	ARTAORT
chr1_2126311_A_C_b38	MORN1	-3.217	0.00143	-0.043142	5	0.013411	no	ARTAORT
chr1_2126584_A_G_b38	MORN1	-3.217	0.00143	-0.043142	5	0.013411	no	ARTAORT
chr1_2129937_T_C_b38	MORN1	-3.217	0.00143	-0.043142	5	0.013411	no	ARTAORT
chr1_2108949_G_A_b38	MORN1	-3.211	0.00146	-0.039694	17	0.012364	no	ARTAORT
chr1_2107797_G_T_b38	MORN1	-3.208	0.00147	-0.039777	17	0.012399	no	ARTAORT
chr1_2109324_G_A_b38	MORN1	-3.208	0.00147	-0.039777	17	0.012399	no	ARTAORT
chr1_2109338_C_T_b38	MORN1	-3.208	0.00147	-0.039777	17	0.012399	no	ARTAORT
chr1_2197209_G_A_b38	MORN1	3.199	0.00152	0.042325	7	0.01323	no	ARTAORT
chr1_2197378_G_GA_b38	MORN1	3.199	0.00152	0.042325	7	0.01323	no	ARTAORT
chr1_2197391_G_A_b38	MORN1	3.199	0.00152	0.042325	7	0.01323	no	ARTAORT
chr1_2164801_G_C_b38	MORN1	3.188	0.00157	0.041435	7	0.012996	no	ARTAORT
chr1_2165199_C_T_b38	MORN1	3.188	0.00157	0.041435	7	0.012996	no	ARTAORT
chr1_2166938_G_C_b38	MORN1	3.188	0.00157	0.041435	7	0.012996	no	ARTAORT
chr1_2167392_G_C_b38	MORN1	3.188	0.00157	0.041435	7	0.012996	no	ARTAORT
chr1_2166847_C_T_b38	MORN1	3.187	0.00158	0.040847	8	0.012816	no	ARTAORT
chr1_2328587_C_T_b38	MORN1	-3.182	0.00161	-0.046588	3	0.014642	no	ARTAORT
chr1_2116145_T_C_b38	MORN1	-3.156	0.00175	-0.042511	5	0.013468	no	ARTAORT
chr1_2068161_A_T_b38	MORN1	3.155	0.00176	0.090781	4	0.028771	no	ARTAORT
chr1_2197362_G_C_b38	MORN1	3.146	0.00181	0.0419	7	0.013317	no	ARTAORT
chr1_2186119_C_T_b38	MORN1	3.109	0.00205	0.039194	9	0.012606	no	ARTAORT
chr1_2151390_G_A_b38	MORN1	3.046	0.00252	0.040924	7	0.013436	no	ARTAORT
chr1_2207111_G_C_b38	MORN1	3.04	0.00257	0.040973	7	0.01348	no	ARTAORT
chr1_2103488_A_G_b38	MORN1	3.035	0.0026	0.079676	8	0.026252	no	ARTAORT
chr1_2137467_G_T_b38	MORN1	-3.014	0.00279	-0.039147	8	0.012988	no	ARTAORT
chr1_2108280_G_A_b38	MORN1	-2.995	0.00296	-0.03734	10	0.012468	no	ARTAORT
chr1_3109282_T_A_b38	MORN1	2.99	0.00301	0.044702	4	0.014952	no	ARTAORT
chr1_2164950_A_C_b38	MORN1	2.976	0.00315	0.039474	7	0.013264	no	ARTAORT
chr1_2174439_G_A_b38	MORN1	2.976	0.00315	0.039474	7	0.013264	no	ARTAORT
chr1_3109536_C_T_b38	MORN1	2.963	0.00328	0.044492	4	0.015017	no	ARTAORT
chr1_3201752_G_A_b38	MORN1	2.946	0.00346	0.063093	4	0.021418	no	ARTAORT
chr1_3214468_G_A_b38	MORN1	2.914	0.00383	0.047228	3	0.01621	no	ARTAORT
chr1_3225159_GA_G_b38	MORN1	2.91	0.00387	0.030161	21	0.010363	no	ARTAORT
chr1_2774631_T_G_b38	MORN1	2.905	0.00393	0.071808	4	0.024721	no	ARTAORT
chr1_1597462_C_T_b38	MORN1	-2.899	0.004	-0.030306	27	0.010453	no	ARTAORT
chr1_3217624_C_T_b38	MORN1	2.874	0.00433	0.030713	33	0.010686	no	ARTAORT
chr1_2348590_C_T_b38	MORN1	2.869	0.00439	0.068455	4	0.023858	no	ARTAORT
chr1_2056854_G_C_b38	MORN1	2.836	0.00486	0.079664	5	0.028085	no	ARTAORT
chr1_2056874_G_C_b38	MORN1	2.836	0.00486	0.079664	5	0.028085	no	ARTAORT
chr1_1486354_G_C_b38	MORN1	2.836	0.00486	0.071037	4	0.025046	no	ARTAORT
chr1_2380956_C_T_b38	MORN1	-2.836	0.00486	-0.032047	13	0.0113	no	ARTAORT
chr1_2382101_A_G_b38	MORN1	-2.836	0.00486	-0.032047	13	0.0113	no	ARTAORT
chr1_3111356_C_T_b38	MORN1	2.809	0.00528	0.041006	5	0.014598	no	ARTAORT
chr1_2131655_G_A_b38	MORN1	2.783	0.00571	0.084613	3	0.030403	no	ARTAORT
chr1_3110182_A_C_b38	MORN1	2.776	0.00583	0.041037	5	0.014783	no	ARTAORT
chr1_2141345_CTTTTTT_C_b38	MORN1	2.757	0.00617	0.038391	5	0.013925	no	ARTAORT
chr1_2337239_T_C_b38	MORN1	2.754	0.00622	0.027096	28	0.009837	no	ARTAORT
chr1_1595306_CAG_C_b38	MORN1	-2.734	0.00661	-0.025992	73	0.009506	no	ARTAORT
chr1_3107141_A_C_b38	MORN1	2.718	0.00694	0.039954	5	0.014701	no	ARTAORT
chr1_1553619_CAAAAAAA_C_b38	MORN1	2.701	0.00728	0.027073	25	0.010022	no	ARTAORT
chr1_3112355_C_T_b38	MORN1	2.695	0.00742	0.03961	5	0.014698	no	ARTAORT
chr1_3113093_G_A_b38	MORN1	2.695	0.00742	0.03961	5	0.014698	no	ARTAORT
chr1_3113418_G_A_b38	MORN1	2.695	0.00742	0.03961	5	0.014698	no	ARTAORT
chr1_2056778_G_T_b38	MORN1	2.68	0.00775	0.072928	6	0.027214	no	ARTAORT
chr1_1461283_A_G_b38	MORN1	2.676	0.00784	0.062022	6	0.023179	no	ARTAORT
chr1_1461362_AT_A_b38	MORN1	2.676	0.00784	0.062022	6	0.023179	no	ARTAORT
chr1_2210546_C_A_b38	MORN1	2.649	0.00848	0.022071	73	0.008332	no	ARTAORT
chr1_3114203_G_GCA_b38	MORN1	2.643	0.00862	0.039627	4	0.014992	no	ARTAORT
chr1_2143025_C_CT_b38	MORN1	2.637	0.00878	0.029048	19	0.011016	no	ARTAORT
chr1_2359882_C_CA_b38	MORN1	-2.628	0.009	-0.027329	20	0.010398	no	ARTAORT
chr1_2056929_C_G_b38	MORN1	2.627	0.00903	0.072876	6	0.027739	no	ARTAORT
chr1_2537418_G_A_b38	MORN1	2.627	0.00903	0.086426	3	0.032899	no	ARTAORT
chr1_2591486_T_C_b38	MORN1	2.627	0.00903	0.086426	3	0.032899	no	ARTAORT
chr1_2210506_C_T_b38	MORN1	2.619	0.00925	0.021615	74	0.008253	no	ARTAORT
chr1_2380209_G_A_b38	MORN1	-2.607	0.00956	-0.021874	56	0.008389	no	ARTAORT
chr1_2380105_C_T_b38	MORN1	-2.598	0.00981	-0.021693	57	0.008349	no	ARTAORT
chr1_2368473_T_C_b38	MORN1	-5.851	2.41e-08	-0.072933	33	0.012465	yes	ARTCRN
chr1_2367872_A_G_b38	MORN1	-5.761	3.78e-08	-0.07017	32	0.012181	yes	ARTCRN
chr1_2368188_T_C_b38	MORN1	-5.761	3.78e-08	-0.07017	32	0.012181	yes	ARTCRN
chr1_2366956_CAAAATACATAGA_C_b38	MORN1	-5.713	4.79e-08	-0.068667	31	0.01202	yes	ARTCRN
chr1_2364339_A_C_b38	MORN1	-5.66	6.22e-08	-0.069644	30	0.012305	yes	ARTCRN
chr1_2366816_A_G_b38	MORN1	-5.56	1.02e-07	-0.069314	29	0.012467	yes	ARTCRN
chr1_2343517_G_A_b38	MORN1	-4.809	3.3e-06	-0.062601	26	0.013018	yes	ARTCRN
chr1_2366555_G_C_b38	MORN1	-4.736	4.54e-06	-0.060231	29	0.012718	yes	ARTCRN
chr1_2352756_T_C_b38	MORN1	-4.718	4.91e-06	-0.060517	28	0.012827	yes	ARTCRN
chr1_2366243_C_T_b38	MORN1	-4.663	6.23e-06	-0.059821	28	0.012829	yes	ARTCRN
chr1_2366496_A_T_b38	MORN1	-4.64	6.89e-06	-0.05985	28	0.0129	yes	ARTCRN
chr1_2367197_G_A_b38	MORN1	-4.64	6.89e-06	-0.05985	28	0.0129	yes	ARTCRN
chr1_2367799_C_T_b38	MORN1	-4.64	6.89e-06	-0.05985	28	0.0129	yes	ARTCRN
chr1_2368939_G_C_b38	MORN1	-4.588	8.58e-06	-0.059037	28	0.012867	yes	ARTCRN
chr1_2343699_C_T_b38	MORN1	-4.58	8.88e-06	-0.059425	26	0.012974	yes	ARTCRN
chr1_2363829_A_T_b38	MORN1	-4.5	1.25e-05	-0.056599	28	0.012578	yes	ARTCRN
chr1_2369210_C_T_b38	MORN1	-4.497	1.27e-05	-0.058827	29	0.013083	yes	ARTCRN
chr1_2351241_C_T_b38	MORN1	-4.47	1.42e-05	-0.058063	27	0.01299	yes	ARTCRN
chr1_2368718_C_A_b38	MORN1	-4.364	2.2e-05	-0.05736	26	0.013144	yes	ARTCRN
chr1_2105801_T_C_b38	MORN1	4.306	2.78e-05	0.126956	7	0.029481	yes	ARTCRN
chr1_2325032_T_A_b38	MORN1	4.281	3.09e-05	0.103626	5	0.024206	yes	ARTCRN
chr1_2365333_G_A_b38	MORN1	-4.255	3.43e-05	-0.055638	27	0.013077	yes	ARTCRN
chr1_2125296_T_C_b38	MORN1	4.147	5.28e-05	0.133136	6	0.032105	yes	ARTCRN
chr1_2364657_A_T_b38	MORN1	-3.982	0.000101	-0.048431	54	0.012164	yes	ARTCRN
chr1_2364658_A_T_b38	MORN1	-3.982	0.000101	-0.048431	54	0.012164	yes	ARTCRN
chr1_1949036_C_CTCCT_b38	MORN1	3.971	0.000105	0.105756	3	0.026631	yes	ARTCRN
chr1_2348700_C_T_b38	MORN1	-3.962	0.000109	-0.054119	21	0.013659	yes	ARTCRN
chr1_2367456_C_CAA_b38	MORN1	-3.943	0.000117	-0.05421	21	0.013749	yes	ARTCRN
chr1_2332063_T_C_b38	MORN1	3.831	0.000179	0.082043	6	0.021416	yes	ARTCRN
chr1_2121503_A_G_b38	MORN1	3.813	0.000191	0.125758	5	0.032981	yes	ARTCRN
chr1_2366021_T_C_b38	MORN1	-3.8	2e-04	-0.046896	53	0.012341	yes	ARTCRN
chr1_2111657_G_A_b38	MORN1	3.783	0.000214	0.117528	6	0.031067	yes	ARTCRN
chr1_2132032_C_G_b38	MORN1	3.783	0.000214	0.117528	6	0.031067	yes	ARTCRN
chr1_2131655_G_A_b38	MORN1	3.77	0.000224	0.138905	3	0.036846	yes	ARTCRN
chr1_2350750_AGGGGTGGCACG_A_b38	MORN1	-3.643	0.000357	-0.057621	10	0.015817	yes	ARTCRN
chr1_2319680_A_G_b38	MORN1	3.603	0.000412	0.05014	18	0.013917	yes	ARTCRN
chr1_3240056_AAGAGG_A_b38	MORN1	3.57	0.000464	0.044625	47	0.012501	yes	ARTCRN
chr1_2340787_C_T_b38	MORN1	-3.56	0.00048	-0.051389	19	0.014435	yes	ARTCRN
chr1_2103363_G_A_b38	MORN1	3.519	0.000555	0.113539	6	0.032267	yes	ARTCRN
chr1_2348393_G_A_b38	MORN1	-3.471	0.000655	-0.056349	8	0.016233	yes	ARTCRN
chr1_2342133_C_G_b38	MORN1	-3.432	0.000751	-0.061765	5	0.017999	yes	ARTCRN
chr1_2342137_G_A_b38	MORN1	-3.432	0.000751	-0.061765	5	0.017999	yes	ARTCRN
chr1_2109797_G_A_b38	MORN1	3.373	0.000919	0.116082	4	0.034418	yes	ARTCRN
chr1_2112343_C_T_b38	MORN1	3.373	0.000919	0.116082	4	0.034418	yes	ARTCRN
chr1_2316943_G_GC_b38	MORN1	-3.37	0.000928	-0.046231	20	0.013718	yes	ARTCRN
chr1_2316944_G_T_b38	MORN1	-3.37	0.000928	-0.046231	20	0.013718	yes	ARTCRN
chr1_2325494_G_A_b38	MORN1	3.275	0.00128	0.065024	8	0.019857	yes	ARTCRN
chr1_2325768_C_A_b38	MORN1	3.275	0.00128	0.065024	8	0.019857	yes	ARTCRN
chr1_2326256_G_A_b38	MORN1	3.275	0.00128	0.065024	8	0.019857	yes	ARTCRN
chr1_2347212_C_T_b38	MORN1	-3.234	0.00146	-0.054849	7	0.01696	yes	ARTCRN
chr1_2362229_A_G_b38	MORN1	-3.18	0.00174	-0.054282	7	0.017067	yes	ARTCRN
chr1_2329738_C_T_b38	MORN1	3.154	0.0019	0.064473	8	0.020444	yes	ARTCRN
chr1_2295727_A_G_b38	MORN1	-3.133	0.00204	-0.039997	38	0.012767	yes	ARTCRN
chr1_3195105_G_A_b38	MORN1	-3.13	0.00205	-0.050767	29	0.01622	yes	ARTCRN
chr1_2351215_T_G_b38	MORN1	-3.106	0.00222	-0.053091	7	0.017095	yes	ARTCRN
chr1_2350539_T_G_b38	MORN1	-3.059	0.00258	-0.039796	53	0.01301	yes	ARTCRN
chr1_3195184_C_T_b38	MORN1	-3.057	0.00259	-0.047908	17	0.01567	yes	ARTCRN
chr1_2324194_G_A_b38	MORN1	3.052	0.00264	0.086885	3	0.028472	yes	ARTCRN
chr1_1458967_T_C_b38	MORN1	-3.047	0.00268	-0.098212	5	0.032233	yes	ARTCRN
chr1_3229627_A_T_b38	MORN1	3.037	0.00276	0.058782	8	0.019357	yes	ARTCRN
chr1_3229933_T_C_b38	MORN1	3.037	0.00276	0.058782	8	0.019357	yes	ARTCRN
chr1_2351678_C_T_b38	MORN1	-3.034	0.00279	-0.051511	7	0.016979	yes	ARTCRN
chr1_2354645_C_T_b38	MORN1	-3.034	0.00279	-0.051511	7	0.016979	yes	ARTCRN
chr1_2354688_G_C_b38	MORN1	-3.034	0.00279	-0.051511	7	0.016979	yes	ARTCRN
chr1_2304223_G_A_b38	MORN1	3.014	0.00296	0.058448	4	0.019389	yes	ARTCRN
chr1_1955424_T_C_b38	MORN1	2.972	0.00338	0.084245	6	0.028348	yes	ARTCRN
chr1_2334355_G_A_b38	MORN1	2.967	0.00344	0.0547	9	0.018436	yes	ARTCRN
chr1_1690741_T_A_b38	MORN1	2.928	0.00387	0.038394	22	0.013113	yes	ARTCRN
chr1_2346801_C_T_b38	MORN1	-2.868	0.00465	-0.036689	54	0.012795	yes	ARTCRN
chr1_3197254_C_T_b38	MORN1	-2.849	0.00492	-0.043379	16	0.015224	yes	ARTCRN
chr1_1459357_C_A_b38	MORN1	-2.834	0.00514	-0.095846	5	0.033818	yes	ARTCRN
chr1_1460370_T_C_b38	MORN1	-2.834	0.00514	-0.095846	5	0.033818	yes	ARTCRN
chr1_1836856_CT_C_b38	MORN1	-2.825	0.00529	-0.046817	8	0.016573	yes	ARTCRN
chr1_3196584_A_G_b38	MORN1	-2.798	0.00572	-0.042236	17	0.015093	yes	ARTCRN
chr1_1758323_T_C_b38	MORN1	-2.792	0.00583	-0.037458	32	0.013415	yes	ARTCRN
chr1_1742119_CA_C_b38	MORN1	2.774	0.00615	0.044913	15	0.016191	yes	ARTCRN
chr1_2103488_A_G_b38	MORN1	2.753	0.00654	0.088359	7	0.032097	yes	ARTCRN
chr1_3213009_T_A_b38	MORN1	2.752	0.00656	0.044481	10	0.016164	yes	ARTCRN
chr1_2349222_G_A_b38	MORN1	-2.747	0.00666	-0.035159	54	0.012801	yes	ARTCRN
chr1_2320961_AG_A_b38	MORN1	2.733	0.00694	0.039498	16	0.014454	yes	ARTCRN
chr1_3208882_T_C_b38	MORN1	2.722	0.00717	0.044474	17	0.016342	yes	ARTCRN
chr1_2313466_C_T_b38	MORN1	-2.718	0.00725	-0.03464	49	0.012746	yes	ARTCRN
chr1_2342734_T_C_b38	MORN1	-2.71	0.00741	-0.043381	11	0.016009	yes	ARTCRN
chr1_2316305_G_C_b38	MORN1	-2.708	0.00746	-0.034018	43	0.012564	yes	ARTCRN
chr1_3194647_C_T_b38	MORN1	-2.631	0.0093	-0.04464	9	0.01697	yes	ARTCRN
chr1_3211967_A_G_b38	MORN1	2.627	0.00939	0.048364	6	0.018411	yes	ARTCRN
chr1_1634406_C_CG_b38	MORN1	2.622	0.00953	0.060401	4	0.023037	yes	ARTCRN
chr1_2365236_C_T_b38	MORN1	-5.058	1.08e-06	-0.065383	27	0.012927	no	ARTCRN
chr1_1954676_C_G_b38	MORN1	4.065	7.29e-05	0.09955	4	0.024488	no	ARTCRN
chr1_2314848_G_C_b38	MORN1	-3.681	0.000311	-0.049104	25	0.013341	no	ARTCRN
chr1_2319909_G_A_b38	MORN1	3.604	0.00041	0.049664	19	0.013779	no	ARTCRN
chr1_2314194_C_T_b38	MORN1	-3.601	0.000415	-0.049768	23	0.013822	no	ARTCRN
chr1_2309937_C_CT_b38	MORN1	-3.593	0.000426	-0.044842	49	0.012479	no	ARTCRN
chr1_1949489_AT_A_b38	MORN1	3.544	0.000507	0.088769	4	0.025046	no	ARTCRN
chr1_1949580_T_G_b38	MORN1	3.544	0.000507	0.088769	4	0.025046	no	ARTCRN
chr1_1949631_G_A_b38	MORN1	3.544	0.000507	0.088769	4	0.025046	no	ARTCRN
chr1_1949646_A_G_b38	MORN1	3.544	0.000507	0.088769	4	0.025046	no	ARTCRN
chr1_1953441_G_A_b38	MORN1	3.544	0.000507	0.088769	4	0.025046	no	ARTCRN
chr1_1954330_G_A_b38	MORN1	3.544	0.000507	0.088769	4	0.025046	no	ARTCRN
chr1_2319721_T_C_b38	MORN1	3.543	0.000509	0.049541	18	0.013983	no	ARTCRN
chr1_1953296_CTT_C_b38	MORN1	3.429	0.000759	0.08255	3	0.024076	no	ARTCRN
chr1_2315074_A_G_b38	MORN1	-3.413	0.000802	-0.046598	21	0.013654	no	ARTCRN
chr1_2316048_A_G_b38	MORN1	-3.389	0.00087	-0.047695	18	0.014073	no	ARTCRN
chr1_2317797_G_A_b38	MORN1	-3.379	9e-04	-0.047481	19	0.014052	no	ARTCRN
chr1_2369118_G_A_b38	MORN1	-3.361	0.000957	-0.058897	7	0.017524	no	ARTCRN
chr1_2315960_T_C_b38	MORN1	-3.354	0.000981	-0.047592	17	0.014191	no	ARTCRN
chr1_2316546_T_C_b38	MORN1	-3.35	0.000992	-0.04633	20	0.013829	no	ARTCRN
chr1_2473606_T_C_b38	MORN1	-3.326	0.00108	-0.116519	11	0.035029	no	ARTCRN
chr1_2299360_T_C_b38	MORN1	-3.297	0.00119	-0.04073	37	0.012353	no	ARTCRN
chr1_1957243_T_C_b38	MORN1	3.186	0.00171	0.076063	6	0.023871	no	ARTCRN
chr1_1957760_T_C_b38	MORN1	3.186	0.00171	0.076063	6	0.023871	no	ARTCRN
chr1_2314131_C_G_b38	MORN1	-3.172	0.00179	-0.043339	25	0.013662	no	ARTCRN
chr1_2962689_G_GC_b38	MORN1	-3.136	0.00202	-0.095879	6	0.030577	no	ARTCRN
chr1_2314000_T_C_b38	MORN1	-3.08	0.00241	-0.042842	21	0.013908	no	ARTCRN
chr1_3201737_G_T_b38	MORN1	3.054	0.00261	0.08429	3	0.027597	no	ARTCRN
chr1_2064022_T_G_b38	MORN1	3.05	0.00265	0.091672	8	0.03006	no	ARTCRN
chr1_1750632_G_A_b38	MORN1	-2.992	0.00317	-0.047701	16	0.015941	no	ARTCRN
chr1_2103523_C_T_b38	MORN1	2.987	0.00323	0.091262	7	0.030551	no	ARTCRN
chr1_1737789_T_C_b38	MORN1	-2.962	0.00349	-0.06261	4	0.021141	no	ARTCRN
chr1_2313782_C_T_b38	MORN1	-2.94	0.00373	-0.041044	25	0.01396	no	ARTCRN
chr1_2362863_C_CA_b38	MORN1	-2.931	0.00384	-0.05153	5	0.017583	no	ARTCRN
chr1_2367644_G_A_b38	MORN1	-2.922	0.00394	-0.038307	28	0.01311	no	ARTCRN
chr1_3297280_ATT_A_b38	MORN1	-2.919	0.00399	-0.043392	17	0.014867	no	ARTCRN
chr1_2344761_T_C_b38	MORN1	2.852	0.00488	0.043146	13	0.015129	no	ARTCRN
chr1_1688102_G_A_b38	MORN1	-2.842	0.00503	-0.044443	14	0.015638	no	ARTCRN
chr1_2327507_C_CA_b38	MORN1	2.824	0.0053	0.055858	6	0.019778	no	ARTCRN
chr1_2355481_C_T_b38	MORN1	2.813	0.00547	0.079403	4	0.028224	no	ARTCRN
chr1_2364608_C_A_b38	MORN1	2.813	0.00547	0.079403	4	0.028224	no	ARTCRN
chr1_1471992_T_C_b38	MORN1	-2.794	0.0058	-0.047094	29	0.016858	no	ARTCRN
chr1_1924011_A_G_b38	MORN1	2.781	0.00603	0.054059	3	0.019442	no	ARTCRN
chr1_3273976_T_TA_b38	MORN1	2.768	0.00626	0.056108	7	0.020272	no	ARTCRN
chr1_2353459_T_G_b38	MORN1	2.762	0.00636	0.034763	48	0.012585	no	ARTCRN
chr1_2356177_T_C_b38	MORN1	2.762	0.00636	0.034763	48	0.012585	no	ARTCRN
chr1_1750650_C_G_b38	MORN1	-2.757	0.00646	-0.043513	15	0.015781	no	ARTCRN
chr1_2308567_T_C_b38	MORN1	-2.757	0.00647	-0.044446	9	0.016122	no	ARTCRN
chr1_1688409_C_G_b38	MORN1	-2.737	0.00684	-0.038022	34	0.01389	no	ARTCRN
chr1_2319918_C_A_b38	MORN1	2.734	0.00692	0.037549	23	0.013735	no	ARTCRN
chr1_2056778_G_T_b38	MORN1	2.733	0.00693	0.095607	5	0.034982	no	ARTCRN
chr1_2360913_G_A_b38	MORN1	2.732	0.00696	0.043382	11	0.015881	no	ARTCRN
chr1_2359219_C_T_b38	MORN1	2.719	0.00722	0.078375	4	0.028828	no	ARTCRN
chr1_2320752_A_G_b38	MORN1	2.709	0.00743	0.040247	13	0.014857	no	ARTCRN
chr1_1681370_T_G_b38	MORN1	-2.707	0.00747	-0.051079	6	0.018868	no	ARTCRN
chr1_2352403_G_T_b38	MORN1	2.689	0.00788	0.033974	49	0.012636	no	ARTCRN
chr1_2352457_A_G_b38	MORN1	2.689	0.00788	0.033974	49	0.012636	no	ARTCRN
chr1_2360716_T_C_b38	MORN1	2.689	0.00788	0.033974	49	0.012636	no	ARTCRN
chr1_2360970_T_C_b38	MORN1	2.689	0.00788	0.033974	49	0.012636	no	ARTCRN
chr1_2361332_A_AG_b38	MORN1	2.689	0.00788	0.033974	49	0.012636	no	ARTCRN
chr1_2361548_A_ACT_b38	MORN1	2.689	0.00788	0.033974	49	0.012636	no	ARTCRN
chr1_2335494_C_T_b38	MORN1	2.679	0.0081	0.039568	14	0.01477	no	ARTCRN
chr1_2073469_G_A_b38	MORN1	2.673	0.00823	0.110757	3	0.041431	no	ARTCRN
chr1_2074426_T_TTGTGGGTC_b38	MORN1	2.673	0.00823	0.110757	3	0.041431	no	ARTCRN
chr1_2075852_C_T_b38	MORN1	2.673	0.00823	0.110757	3	0.041431	no	ARTCRN
chr1_2077119_C_T_b38	MORN1	2.673	0.00823	0.110757	3	0.041431	no	ARTCRN
chr1_2078078_T_C_b38	MORN1	2.673	0.00823	0.110757	3	0.041431	no	ARTCRN
chr1_2079357_A_G_b38	MORN1	2.673	0.00823	0.110757	3	0.041431	no	ARTCRN
chr1_1741091_CT_C_b38	MORN1	-2.659	0.00858	-0.043822	8	0.016481	no	ARTCRN
chr1_1471663_A_C_b38	MORN1	-2.658	0.00861	-0.088126	3	0.033157	no	ARTCRN
chr1_2358849_T_C_b38	MORN1	2.657	0.00862	0.033505	50	0.012608	no	ARTCRN
chr1_2056854_G_C_b38	MORN1	2.647	0.00887	0.097293	4	0.036753	no	ARTCRN
chr1_2056874_G_C_b38	MORN1	2.647	0.00887	0.097293	4	0.036753	no	ARTCRN
chr1_2068161_A_T_b38	MORN1	2.647	0.00887	0.097293	4	0.036753	no	ARTCRN
chr1_3216875_C_T_b38	MORN1	2.641	0.00902	0.050421	6	0.019089	no	ARTCRN
chr1_1741473_C_T_b38	MORN1	2.617	0.00965	0.034499	35	0.01318	no	ARTCRN
chr1_1928648_C_T_b38	MORN1	2.61	0.00985	0.035608	40	0.013642	no	ARTCRN
chr1_2367872_A_G_b38	MORN1	-8.824	1.73e-17	-0.054009	83	0.00612	yes	ARTTBL
chr1_2364339_A_C_b38	MORN1	-8.803	2.04e-17	-0.054188	79	0.006156	yes	ARTTBL
chr1_2368188_T_C_b38	MORN1	-8.753	3e-17	-0.053516	83	0.006114	yes	ARTTBL
chr1_2366816_A_G_b38	MORN1	-8.674	5.54e-17	-0.053605	78	0.00618	yes	ARTTBL
chr1_2366956_CAAAATACATAGA_C_b38	MORN1	-8.469	2.62e-16	-0.052078	79	0.006149	yes	ARTTBL
chr1_2363829_A_T_b38	MORN1	-8.417	3.88e-16	-0.051011	76	0.006061	yes	ARTTBL
chr1_2368473_T_C_b38	MORN1	-8.332	7.3e-16	-0.051433	86	0.006173	yes	ARTTBL
chr1_2350750_AGGGGTGGCACG_A_b38	MORN1	-8.331	7.35e-16	-0.061984	27	0.00744	yes	ARTTBL
chr1_2366555_G_C_b38	MORN1	-8.205	1.88e-15	-0.051417	75	0.006267	yes	ARTTBL
chr1_2367799_C_T_b38	MORN1	-7.997	8.55e-15	-0.050306	75	0.006291	yes	ARTTBL
chr1_2348393_G_A_b38	MORN1	-7.994	8.7e-15	-0.061328	24	0.007672	yes	ARTTBL
chr1_2366496_A_T_b38	MORN1	-7.975	9.98e-15	-0.050151	75	0.006289	yes	ARTTBL
chr1_2368939_G_C_b38	MORN1	-7.942	1.27e-14	-0.049958	75	0.006291	yes	ARTTBL
chr1_2367197_G_A_b38	MORN1	-7.897	1.74e-14	-0.049886	74	0.006317	yes	ARTTBL
chr1_2366243_C_T_b38	MORN1	-7.891	1.82e-14	-0.049782	73	0.006309	yes	ARTTBL
chr1_2368718_C_A_b38	MORN1	-7.865	2.2e-14	-0.049583	74	0.006304	yes	ARTTBL
chr1_2367456_C_CAA_b38	MORN1	-7.861	2.26e-14	-0.052455	56	0.006673	yes	ARTTBL
chr1_2352756_T_C_b38	MORN1	-7.817	3.09e-14	-0.049003	77	0.006269	yes	ARTTBL
chr1_2366021_T_C_b38	MORN1	-7.757	4.73e-14	-0.047001	133	0.006059	yes	ARTTBL
chr1_2365236_C_T_b38	MORN1	-7.63	1.15e-13	-0.047901	76	0.006278	yes	ARTTBL
chr1_2365333_G_A_b38	MORN1	-7.546	2.06e-13	-0.047294	74	0.006267	yes	ARTTBL
chr1_2343517_G_A_b38	MORN1	-7.508	2.67e-13	-0.049022	67	0.006529	yes	ARTTBL
chr1_2351241_C_T_b38	MORN1	-7.43	4.58e-13	-0.047609	74	0.006408	yes	ARTTBL
chr1_2364657_A_T_b38	MORN1	-7.362	7.27e-13	-0.044488	136	0.006043	yes	ARTTBL
chr1_2364658_A_T_b38	MORN1	-7.362	7.27e-13	-0.044488	136	0.006043	yes	ARTTBL
chr1_2343699_C_T_b38	MORN1	-7.305	1.07e-12	-0.047689	67	0.006529	yes	ARTTBL
chr1_2342133_C_G_b38	MORN1	-7.209	2.04e-12	-0.06016	18	0.008346	yes	ARTTBL
chr1_2342137_G_A_b38	MORN1	-7.209	2.04e-12	-0.06016	18	0.008346	yes	ARTTBL
chr1_2348700_C_T_b38	MORN1	-7.156	2.89e-12	-0.047743	61	0.006672	yes	ARTTBL
chr1_2350539_T_G_b38	MORN1	-7.099	4.22e-12	-0.043147	138	0.006078	yes	ARTTBL
chr1_2347212_C_T_b38	MORN1	-7.056	5.56e-12	-0.055629	22	0.007883	yes	ARTTBL
chr1_2362863_C_CA_b38	MORN1	-6.892	1.62e-11	-0.058641	16	0.008509	yes	ARTTBL
chr1_2346801_C_T_b38	MORN1	-6.476	2.21e-10	-0.040329	148	0.006227	yes	ARTTBL
chr1_2369210_C_T_b38	MORN1	-6.469	2.3e-10	-0.040781	91	0.006304	yes	ARTTBL
chr1_2349222_G_A_b38	MORN1	-6.46	2.44e-10	-0.040084	149	0.006205	yes	ARTTBL
chr1_2350696_G_A_b38	MORN1	6.32	5.68e-10	0.043779	51	0.006927	yes	ARTTBL
chr1_2348378_C_T_b38	MORN1	6.313	5.92e-10	0.043884	50	0.006951	yes	ARTTBL
chr1_2362718_G_A_b38	MORN1	6.293	6.68e-10	0.043579	52	0.006925	yes	ARTTBL
chr1_2338659_A_G_b38	MORN1	6.114	1.92e-09	0.037286	124	0.006098	yes	ARTTBL
chr1_2347542_C_T_b38	MORN1	-6.038	3e-09	-0.036888	121	0.006109	yes	ARTTBL
chr1_2364499_A_G_b38	MORN1	5.804	1.14e-08	0.039525	59	0.00681	yes	ARTTBL
chr1_2359472_G_A_b38	MORN1	5.615	3.22e-08	0.035089	98	0.006249	yes	ARTTBL
chr1_2337211_C_G_b38	MORN1	5.601	3.48e-08	0.035668	94	0.006368	yes	ARTTBL
chr1_2358849_T_C_b38	MORN1	5.549	4.61e-08	0.035159	144	0.006336	yes	ARTTBL
chr1_2353459_T_G_b38	MORN1	5.465	7.24e-08	0.03461	142	0.006333	yes	ARTTBL
chr1_2356177_T_C_b38	MORN1	5.465	7.24e-08	0.03461	142	0.006333	yes	ARTTBL
chr1_2341705_A_G_b38	MORN1	5.459	7.46e-08	0.034135	132	0.006253	yes	ARTTBL
chr1_2360970_T_C_b38	MORN1	5.435	8.5e-08	0.034628	143	0.006372	yes	ARTTBL
chr1_2352403_G_T_b38	MORN1	5.404	1e-07	0.034203	142	0.006329	yes	ARTTBL
chr1_2352457_A_G_b38	MORN1	5.349	1.34e-07	0.033979	145	0.006353	yes	ARTTBL
chr1_2360716_T_C_b38	MORN1	5.346	1.36e-07	0.034038	143	0.006367	yes	ARTTBL
chr1_2361332_A_AG_b38	MORN1	5.346	1.36e-07	0.034038	143	0.006367	yes	ARTTBL
chr1_2361548_A_ACT_b38	MORN1	5.346	1.36e-07	0.034038	143	0.006367	yes	ARTTBL
chr1_2342734_T_C_b38	MORN1	-5.218	2.63e-07	-0.038573	33	0.007392	yes	ARTTBL
chr1_2351551_C_T_b38	MORN1	5.213	2.71e-07	0.038384	32	0.007364	yes	ARTTBL
chr1_2344634_T_C_b38	MORN1	5.171	3.35e-07	0.037594	34	0.007271	yes	ARTTBL
chr1_2344757_C_A_b38	MORN1	5.157	3.59e-07	0.037515	34	0.007274	yes	ARTTBL
chr1_2344761_T_A_b38	MORN1	5.157	3.59e-07	0.037515	34	0.007274	yes	ARTTBL
chr1_2350934_C_T_b38	MORN1	5.157	3.59e-07	0.037515	34	0.007274	yes	ARTTBL
chr1_2346111_G_C_b38	MORN1	-5.155	3.62e-07	-0.031835	121	0.006175	yes	ARTTBL
chr1_2345727_G_A_b38	MORN1	5.15	3.72e-07	0.037684	33	0.007318	yes	ARTTBL
chr1_2344980_A_G_b38	MORN1	4.973	9.01e-07	0.035602	36	0.007159	yes	ARTTBL
chr1_2356095_C_T_b38	MORN1	4.965	9.37e-07	0.037027	33	0.007458	yes	ARTTBL
chr1_2345774_T_C_b38	MORN1	4.957	9.73e-07	0.035651	35	0.007192	yes	ARTTBL
chr1_2357308_T_C_b38	MORN1	4.928	1.12e-06	0.031618	150	0.006416	yes	ARTTBL
chr1_2337352_A_G_b38	MORN1	4.9	1.29e-06	0.031791	92	0.006488	yes	ARTTBL
chr1_2357882_G_A_b38	MORN1	4.859	1.57e-06	0.036208	33	0.007451	yes	ARTTBL
chr1_2343937_T_G_b38	MORN1	-4.851	1.63e-06	-0.031326	94	0.006458	yes	ARTTBL
chr1_2370170_G_T_b38	MORN1	-4.728	2.93e-06	-0.033393	45	0.007062	yes	ARTTBL
chr1_2337299_A_G_b38	MORN1	4.66	4.03e-06	0.030182	84	0.006477	yes	ARTTBL
chr1_2333737_T_C_b38	MORN1	4.553	6.62e-06	0.030744	65	0.006753	yes	ARTTBL
chr1_2334530_T_G_b38	MORN1	4.513	7.93e-06	0.030565	64	0.006772	yes	ARTTBL
chr1_2324977_G_GGCT_b38	MORN1	4.438	1.11e-05	0.029566	76	0.006661	yes	ARTTBL
chr1_2327034_G_A_b38	MORN1	4.307	1.98e-05	0.028293	81	0.006569	yes	ARTTBL
chr1_2324806_A_T_b38	MORN1	4.274	2.29e-05	0.028228	76	0.006605	yes	ARTTBL
chr1_2369355_G_GA_b38	MORN1	-4.257	2.46e-05	-0.03013	55	0.007077	yes	ARTTBL
chr1_2342999_A_G_b38	MORN1	-4.1	4.81e-05	-0.030089	41	0.007339	yes	ARTTBL
chr1_3321262_ATATT_A_b38	MORN1	-3.931	9.64e-05	-0.077603	3	0.019744	yes	ARTTBL
chr1_1577737_T_C_b38	MORN1	-3.792	0.000167	-0.068152	3	0.017971	yes	ARTTBL
chr1_1578715_A_G_b38	MORN1	-3.792	0.000167	-0.068152	3	0.017971	yes	ARTTBL
chr1_1578718_C_G_b38	MORN1	-3.792	0.000167	-0.068152	3	0.017971	yes	ARTTBL
chr1_3229990_G_T_b38	MORN1	3.658	0.00028	0.032378	48	0.008851	yes	ARTTBL
chr1_3229994_G_A_b38	MORN1	3.658	0.00028	0.032378	48	0.008851	yes	ARTTBL
chr1_3230035_G_C_b38	MORN1	3.658	0.00028	0.032378	48	0.008851	yes	ARTTBL
chr1_3230198_T_C_b38	MORN1	3.658	0.00028	0.032378	48	0.008851	yes	ARTTBL
chr1_2359882_C_CAA_b38	MORN1	3.655	0.000283	0.029171	27	0.00798	yes	ARTTBL
chr1_2370252_G_A_b38	MORN1	3.581	0.000374	0.029325	18	0.008188	yes	ARTTBL
chr1_2340425_C_T_b38	MORN1	-3.504	0.000498	-0.022495	116	0.00642	yes	ARTTBL
chr1_3224426_C_T_b38	MORN1	3.439	0.000631	0.032265	13	0.009382	yes	ARTTBL
chr1_3220788_C_T_b38	MORN1	3.429	0.000654	0.032419	12	0.009454	yes	ARTTBL
chr1_2345829_C_CCACACA_b38	MORN1	-3.421	0.000673	-0.033874	11	0.009901	yes	ARTTBL
chr1_3224467_A_C_b38	MORN1	3.397	0.000735	0.031837	13	0.009373	yes	ARTTBL
chr1_2391602_T_C_b38	MORN1	-3.335	0.000915	-0.024042	41	0.007209	yes	ARTTBL
chr1_3309069_T_A_b38	MORN1	-3.313	0.000987	-0.075004	3	0.022638	yes	ARTTBL
chr1_3309148_C_T_b38	MORN1	-3.313	0.000987	-0.075004	3	0.022638	yes	ARTTBL
chr1_3309573_A_T_b38	MORN1	-3.313	0.000987	-0.075004	3	0.022638	yes	ARTTBL
chr1_3309631_G_A_b38	MORN1	-3.313	0.000987	-0.075004	3	0.022638	yes	ARTTBL
chr1_3309733_A_G_b38	MORN1	-3.313	0.000987	-0.075004	3	0.022638	yes	ARTTBL
chr1_2296236_A_C_b38	MORN1	-3.244	0.00126	-0.039544	5	0.012191	yes	ARTTBL
chr1_1686882_T_C_b38	MORN1	-3.227	0.00133	-0.021112	112	0.006542	yes	ARTTBL
chr1_3229627_A_T_b38	MORN1	3.211	0.00141	0.032171	12	0.01002	yes	ARTTBL
chr1_2758226_C_G_b38	MORN1	-3.203	0.00144	-0.064616	4	0.020172	yes	ARTTBL
chr1_3308915_C_G_b38	MORN1	-3.192	0.0015	-0.064281	5	0.020136	yes	ARTTBL
chr1_2137467_G_T_b38	MORN1	-3.183	0.00154	-0.030968	11	0.009728	yes	ARTTBL
chr1_3230726_C_T_b38	MORN1	3.156	0.00169	0.027677	43	0.008768	yes	ARTTBL
chr1_2315074_A_G_b38	MORN1	-3.078	0.0022	-0.022758	51	0.007395	yes	ARTTBL
chr1_2579270_AT_A_b38	MORN1	-3.042	0.00247	-0.026361	15	0.008665	yes	ARTTBL
chr1_2314000_T_C_b38	MORN1	-2.921	0.00364	-0.021523	54	0.007367	yes	ARTTBL
chr1_2313782_C_T_b38	MORN1	-2.894	0.00396	-0.021484	66	0.007422	yes	ARTTBL
chr1_3216875_C_T_b38	MORN1	2.89	0.00401	0.027093	13	0.009374	yes	ARTTBL
chr1_1680556_A_G_b38	MORN1	-2.881	0.00413	-0.019577	95	0.006794	yes	ARTTBL
chr1_2754964_G_C_b38	MORN1	2.862	0.00438	0.025179	32	0.008798	yes	ARTTBL
chr1_3208527_G_A_b38	MORN1	2.861	0.0044	0.026657	11	0.009318	yes	ARTTBL
chr1_2369355_G_GAA_b38	MORN1	-2.86	0.00441	-0.054794	6	0.019158	yes	ARTTBL
chr1_2311682_G_C_b38	MORN1	-2.834	0.00478	-0.032611	4	0.011508	yes	ARTTBL
chr1_2319918_C_A_b38	MORN1	2.832	0.00481	0.020556	57	0.007258	yes	ARTTBL
chr1_3389960_C_A_b38	MORN1	-2.817	0.00504	-0.022233	97	0.007893	yes	ARTTBL
chr1_2314194_C_T_b38	MORN1	-2.807	0.00519	-0.020649	57	0.007356	yes	ARTTBL
chr1_2364412_G_GTTGT_b38	MORN1	-2.802	0.00528	-0.020707	38	0.007391	yes	ARTTBL
chr1_2630730_C_T_b38	MORN1	2.799	0.00532	0.018996	90	0.006787	yes	ARTTBL
chr1_2237640_C_T_b38	MORN1	-2.798	0.00533	-0.025666	20	0.009172	yes	ARTTBL
chr1_2238621_G_A_b38	MORN1	-2.798	0.00533	-0.025666	20	0.009172	yes	ARTTBL
chr1_2240544_C_T_b38	MORN1	-2.798	0.00533	-0.025666	20	0.009172	yes	ARTTBL
chr1_3307945_G_A_b38	MORN1	-2.789	0.00548	-0.055933	5	0.020052	yes	ARTTBL
chr1_2369336_A_G_b38	MORN1	-2.775	0.00572	-0.023319	20	0.008403	yes	ARTTBL
chr1_1689421_G_A_b38	MORN1	-2.764	0.00591	-0.018877	78	0.006828	yes	ARTTBL
chr1_1694167_G_A_b38	MORN1	2.747	0.00623	0.017962	95	0.00654	yes	ARTTBL
chr1_1680214_T_C_b38	MORN1	-2.739	0.00638	-0.018462	95	0.00674	yes	ARTTBL
chr1_2777688_T_TGG_b38	MORN1	-2.726	0.00662	-0.02239	25	0.008212	yes	ARTTBL
chr1_2213790_GCCCGAGCGGGGGGGTGACTGTC_G_b38	MORN1	-2.726	0.00664	-0.029782	7	0.010927	yes	ARTTBL
chr1_2776575_A_T_b38	MORN1	-2.722	0.00671	-0.018314	70	0.006729	yes	ARTTBL
chr1_1948124_G_C_b38	MORN1	2.7	0.00716	0.027874	5	0.010323	yes	ARTTBL
chr1_2361630_A_G_b38	MORN1	-2.685	0.00748	-0.057601	3	0.02145	yes	ARTTBL
chr1_2362285_A_C_b38	MORN1	-2.685	0.00748	-0.057601	3	0.02145	yes	ARTTBL
chr1_1686017_A_AT_b38	MORN1	-2.682	0.00756	-0.018016	94	0.006719	yes	ARTTBL
chr1_1687061_C_T_b38	MORN1	-2.682	0.00756	-0.018016	94	0.006719	yes	ARTTBL
chr1_2315960_T_C_b38	MORN1	-2.679	0.00761	-0.020208	39	0.007542	yes	ARTTBL
chr1_2359716_T_C_b38	MORN1	-2.674	0.00774	-0.05768	3	0.021571	yes	ARTTBL
chr1_3308489_G_A_b38	MORN1	-2.669	0.00785	-0.053478	5	0.020038	yes	ARTTBL
chr1_2364485_A_G_b38	MORN1	-2.662	0.008	-0.020035	37	0.007525	yes	ARTTBL
chr1_1684308_G_C_b38	MORN1	-2.652	0.00826	-0.01809	90	0.006822	yes	ARTTBL
chr1_1684619_G_A_b38	MORN1	-2.652	0.00826	-0.01809	90	0.006822	yes	ARTTBL
chr1_1687643_G_A_b38	MORN1	-2.65	0.00829	-0.017872	94	0.006743	yes	ARTTBL
chr1_2334355_G_A_b38	MORN1	2.636	0.00865	0.023904	21	0.009069	yes	ARTTBL
chr1_1724661_CGATG_C_b38	MORN1	-2.626	0.0089	-0.018059	71	0.006877	yes	ARTTBL
chr1_2211864_C_T_b38	MORN1	2.62	0.00906	0.039343	3	0.015017	yes	ARTTBL
chr1_3230608_A_G_b38	MORN1	2.614	0.00921	0.021459	55	0.008209	yes	ARTTBL
chr1_1687159_G_T_b38	MORN1	-2.608	0.00937	-0.017683	91	0.00678	yes	ARTTBL
chr1_2384241_A_G_b38	MORN1	2.606	0.00944	0.016576	147	0.006362	yes	ARTTBL
chr1_2240198_G_C_b38	MORN1	-2.599	0.00961	-0.023943	20	0.009211	yes	ARTTBL
chr1_1689465_A_G_b38	MORN1	-2.598	0.00963	-0.017035	94	0.006556	yes	ARTTBL
chr1_2222491_T_C_b38	MORN1	-2.592	0.00983	-0.029876	7	0.011528	yes	ARTTBL
chr1_2222496_T_C_b38	MORN1	-2.592	0.00983	-0.029876	7	0.011528	yes	ARTTBL
chr1_2351215_T_G_b38	MORN1	-7.381	6.39e-13	-0.060003	21	0.00813	no	ARTTBL
chr1_2351678_C_T_b38	MORN1	-7.364	7.15e-13	-0.059803	20	0.008121	no	ARTTBL
chr1_2340787_C_T_b38	MORN1	-7.36	7.35e-13	-0.048955	51	0.006651	no	ARTTBL
chr1_2354688_G_C_b38	MORN1	-7.318	9.8e-13	-0.060104	20	0.008214	no	ARTTBL
chr1_2362229_A_G_b38	MORN1	-7.283	1.23e-12	-0.059413	21	0.008157	no	ARTTBL
chr1_2354645_C_T_b38	MORN1	-7.237	1.68e-12	-0.05938	20	0.008205	no	ARTTBL
chr1_2363405_C_T_b38	MORN1	6.281	7.19e-10	0.043064	66	0.006856	no	ARTTBL
chr1_2367055_C_A_b38	MORN1	5.629	2.98e-08	0.03979	39	0.007068	no	ARTTBL
chr1_2353743_A_T_b38	MORN1	5.357	1.28e-07	0.037299	74	0.006963	no	ARTTBL
chr1_2356409_G_C_b38	MORN1	5.317	1.58e-07	0.037058	60	0.00697	no	ARTTBL
chr1_2338460_T_C_b38	MORN1	5.304	1.69e-07	0.033181	96	0.006256	no	ARTTBL
chr1_2369118_G_A_b38	MORN1	-5.191	3.01e-07	-0.042351	25	0.008158	no	ARTTBL
chr1_2338570_C_T_b38	MORN1	5.004	7.74e-07	0.03131	93	0.006257	no	ARTTBL
chr1_2345849_ACACACAG_A_b38	MORN1	4.907	1.24e-06	0.037908	24	0.007725	no	ARTTBL
chr1_2309937_C_CT_b38	MORN1	-4.761	2.51e-06	-0.028985	155	0.006088	no	ARTTBL
chr1_2344256_A_T_b38	MORN1	4.653	4.17e-06	0.033671	37	0.007236	no	ARTTBL
chr1_2341451_G_A_b38	MORN1	4.643	4.37e-06	0.032703	45	0.007044	no	ARTTBL
chr1_2340807_G_A_b38	MORN1	4.632	4.59e-06	0.032549	45	0.007027	no	ARTTBL
chr1_2344932_C_T_b38	MORN1	4.374	1.48e-05	0.03325	27	0.007601	no	ARTTBL
chr1_2340625_G_A_b38	MORN1	4.341	1.71e-05	0.030401	46	0.007004	no	ARTTBL
chr1_2337239_T_C_b38	MORN1	4.151	3.88e-05	0.029269	50	0.007052	no	ARTTBL
chr1_2298478_C_T_b38	MORN1	-4.005	7.13e-05	-0.033013	24	0.008244	no	ARTTBL
chr1_2337141_G_A_b38	MORN1	3.932	9.6e-05	0.026754	70	0.006805	no	ARTTBL
chr1_2297717_C_T_b38	MORN1	-3.898	0.00011	-0.032183	24	0.008255	no	ARTTBL
chr1_2361214_A_C_b38	MORN1	-3.877	0.00012	-0.051701	5	0.013337	no	ARTTBL
chr1_2326288_C_T_b38	MORN1	3.857	0.000129	0.025033	80	0.00649	no	ARTTBL
chr1_2326884_C_T_b38	MORN1	3.857	0.000129	0.025033	80	0.00649	no	ARTTBL
chr1_2337229_A_G_b38	MORN1	3.817	0.000152	0.025064	130	0.006567	no	ARTTBL
chr1_2326424_C_T_b38	MORN1	3.735	0.000209	0.024307	79	0.006508	no	ARTTBL
chr1_2344583_G_A_b38	MORN1	3.691	0.000247	0.026289	39	0.007123	no	ARTTBL
chr1_2327151_A_AACAC_b38	MORN1	3.647	0.000292	0.022497	132	0.006168	no	ARTTBL
chr1_2340235_T_C_b38	MORN1	3.525	0.000461	0.024488	50	0.006947	no	ARTTBL
chr1_2196630_A_G_b38	MORN1	3.503	0.000501	0.030759	25	0.008781	no	ARTTBL
chr1_2389263_T_C_b38	MORN1	-3.451	0.000604	-0.027038	33	0.007835	no	ARTTBL
chr1_2086055_CT_C_b38	MORN1	-3.396	0.000738	-0.02662	31	0.007839	no	ARTTBL
chr1_2197209_G_A_b38	MORN1	3.362	0.000831	0.034265	9	0.010191	no	ARTTBL
chr1_2197378_G_GA_b38	MORN1	3.362	0.000831	0.034265	9	0.010191	no	ARTTBL
chr1_2340764_G_T_b38	MORN1	3.36	0.000838	0.023238	50	0.006916	no	ARTTBL
chr1_2197362_G_C_b38	MORN1	3.311	0.000995	0.034069	9	0.01029	no	ARTTBL
chr1_2660743_AC_A_b38	MORN1	-3.31	0.001	-0.073024	5	0.022064	no	ARTTBL
chr1_2300128_G_T_b38	MORN1	-3.304	0.00102	-0.021029	131	0.006364	no	ARTTBL
chr1_2343445_C_T_b38	MORN1	3.304	0.00102	0.023424	43	0.00709	no	ARTTBL
chr1_2359882_C_CA_b38	MORN1	-3.304	0.00102	-0.026219	26	0.007936	no	ARTTBL
chr1_2151390_G_A_b38	MORN1	3.302	0.00103	0.03377	9	0.010226	no	ARTTBL
chr1_2333631_T_C_b38	MORN1	3.288	0.00108	0.0237	38	0.007207	no	ARTTBL
chr1_3225159_GA_G_b38	MORN1	3.248	0.00124	0.025179	39	0.007752	no	ARTTBL
chr1_2340564_G_A_b38	MORN1	3.245	0.00125	0.02304	44	0.007101	no	ARTTBL
chr1_2193733_G_A_b38	MORN1	3.218	0.00137	0.028366	26	0.008816	no	ARTTBL
chr1_2319680_A_G_b38	MORN1	3.216	0.00138	0.023744	40	0.007382	no	ARTTBL
chr1_2175551_ACTCCAACCCCTACACCCCCAACCC_A_b38	MORN1	3.186	0.00153	0.032731	9	0.010274	no	ARTTBL
chr1_3229933_T_C_b38	MORN1	3.136	0.00181	0.031287	12	0.009978	no	ARTTBL
chr1_2207111_G_C_b38	MORN1	3.124	0.00189	0.03274	9	0.010482	no	ARTTBL
chr1_2197391_G_A_b38	MORN1	3.123	0.00189	0.031447	10	0.010071	no	ARTTBL
chr1_3205896_C_G_b38	MORN1	3.105	0.00201	0.028881	12	0.009303	no	ARTTBL
chr1_2204887_GCCCTCAAGCCCCGC_G_b38	MORN1	3.085	0.00214	0.028162	22	0.009128	no	ARTTBL
chr1_2319721_T_C_b38	MORN1	3.085	0.00215	0.022609	43	0.007329	no	ARTTBL
chr1_2166847_C_T_b38	MORN1	3.082	0.00216	0.029287	12	0.009501	no	ARTTBL
chr1_2345442_G_A_b38	MORN1	3.065	0.00229	0.053124	7	0.017334	no	ARTTBL
chr1_3204068_C_A_b38	MORN1	3.041	0.00248	0.028398	12	0.009338	no	ARTTBL
chr1_2210401_C_A_b38	MORN1	3.035	0.00253	0.02676	27	0.008817	no	ARTTBL
chr1_2319909_G_A_b38	MORN1	3.024	0.00262	0.022051	44	0.007292	no	ARTTBL
chr1_2007256_C_G_b38	MORN1	-3.021	0.00265	-0.063221	4	0.02093	no	ARTTBL
chr1_2164801_G_C_b38	MORN1	3.013	0.00272	0.029287	10	0.009721	no	ARTTBL
chr1_2165199_C_T_b38	MORN1	3.013	0.00272	0.029287	10	0.009721	no	ARTTBL
chr1_2166938_G_C_b38	MORN1	3.013	0.00272	0.029287	10	0.009721	no	ARTTBL
chr1_2167392_G_C_b38	MORN1	3.013	0.00272	0.029287	10	0.009721	no	ARTTBL
chr1_2379954_A_G_b38	MORN1	-3.011	0.00273	-0.021863	40	0.007262	no	ARTTBL
chr1_2325101_C_T_b38	MORN1	-3.008	0.00276	-0.038429	6	0.012777	no	ARTTBL
chr1_2204652_A_G_b38	MORN1	3.007	0.00277	0.026585	28	0.008841	no	ARTTBL
chr1_2314848_G_C_b38	MORN1	-3.003	0.0028	-0.022329	63	0.007435	no	ARTTBL
chr1_2164982_T_C_b38	MORN1	3.001	0.00282	0.029089	10	0.009692	no	ARTTBL
chr1_2320766_C_T_b38	MORN1	2.987	0.00295	0.026833	17	0.008982	no	ARTTBL
chr1_2164950_A_C_b38	MORN1	2.986	0.00296	0.029806	10	0.009982	no	ARTTBL
chr1_2303580_T_C_b38	MORN1	-2.948	0.00335	-0.021468	41	0.007283	no	ARTTBL
chr1_2320961_AG_A_b38	MORN1	2.946	0.00337	0.021564	46	0.00732	no	ARTTBL
chr1_2174439_G_A_b38	MORN1	2.937	0.00347	0.029481	10	0.010039	no	ARTTBL
chr1_2333899_TGCTGGAAAGAACA_T_b38	MORN1	2.934	0.0035	0.021857	36	0.007449	no	ARTTBL
chr1_3202554_G_A_b38	MORN1	2.928	0.00356	0.027404	12	0.009359	no	ARTTBL
chr1_2309937_C_CTT_b38	MORN1	2.916	0.0037	0.019643	67	0.006736	no	ARTTBL
chr1_2140299_C_T_b38	MORN1	2.91	0.00377	0.028571	10	0.009818	no	ARTTBL
chr1_2175616_T_C_b38	MORN1	2.883	0.0041	0.028786	9	0.009984	no	ARTTBL
chr1_2332227_G_A_b38	MORN1	2.877	0.00418	0.021156	37	0.007353	no	ARTTBL
chr1_2332449_C_T_b38	MORN1	2.877	0.00419	0.02127	36	0.007394	no	ARTTBL
chr1_2326447_G_C_b38	MORN1	2.868	0.0043	0.021306	36	0.00743	no	ARTTBL
chr1_2142665_G_T_b38	MORN1	2.85	0.00454	0.02704	12	0.009486	no	ARTTBL
chr1_2145827_G_A_b38	MORN1	2.85	0.00454	0.02704	12	0.009486	no	ARTTBL
chr1_3221994_G_A_b38	MORN1	2.835	0.00476	0.02602	19	0.009178	no	ARTTBL
chr1_2768235_G_A_b38	MORN1	-2.823	0.00495	-0.023941	16	0.008482	no	ARTTBL
chr1_1583688_A_C_b38	MORN1	2.822	0.00495	0.018969	61	0.006721	no	ARTTBL
chr1_2683198_C_T_b38	MORN1	2.817	0.00503	0.045547	6	0.016167	no	ARTTBL
chr1_2683199_G_T_b38	MORN1	2.817	0.00503	0.045547	6	0.016167	no	ARTTBL
chr1_2325579_T_G_b38	MORN1	2.815	0.00507	0.020713	37	0.007359	no	ARTTBL
chr1_2367644_G_A_b38	MORN1	-2.813	0.00509	-0.019145	70	0.006805	no	ARTTBL
chr1_2138661_C_T_b38	MORN1	2.813	0.0051	0.027716	10	0.009853	no	ARTTBL
chr1_2320752_A_G_b38	MORN1	2.813	0.0051	0.02122	36	0.007545	no	ARTTBL
chr1_2205698_G_A_b38	MORN1	2.804	0.00524	0.025097	26	0.008951	no	ARTTBL
chr1_2341692_GA_G_b38	MORN1	2.799	0.00531	0.018705	79	0.006682	no	ARTTBL
chr1_2316305_G_C_b38	MORN1	-2.797	0.00535	-0.018024	102	0.006444	no	ARTTBL
chr1_2337131_A_G_b38	MORN1	2.796	0.00536	0.018483	88	0.00661	no	ARTTBL
chr1_2330544_C_A_b38	MORN1	2.793	0.00542	0.020575	37	0.007367	no	ARTTBL
chr1_2141345_CTTTTTT_C_b38	MORN1	2.791	0.00544	0.029794	7	0.010674	no	ARTTBL
chr1_2155277_GTGA_G_b38	MORN1	2.79	0.00547	0.02677	11	0.009596	no	ARTTBL
chr1_2320543_C_T_b38	MORN1	2.781	0.00561	0.020992	37	0.007547	no	ARTTBL
chr1_2144375_C_T_b38	MORN1	2.772	0.00577	0.026869	10	0.009692	no	ARTTBL
chr1_2151066_C_T_b38	MORN1	2.772	0.00577	0.026869	10	0.009692	no	ARTTBL
chr1_2156118_T_C_b38	MORN1	2.772	0.00577	0.026869	10	0.009692	no	ARTTBL
chr1_2157493_C_T_b38	MORN1	2.772	0.00577	0.026869	10	0.009692	no	ARTTBL
chr1_2327187_CAG_C_b38	MORN1	2.772	0.00577	0.021883	30	0.007894	no	ARTTBL
chr1_2055016_C_T_b38	MORN1	2.77	0.00581	0.048593	13	0.017543	no	ARTTBL
chr1_2333258_C_T_b38	MORN1	2.757	0.00603	0.020502	36	0.007435	no	ARTTBL
chr1_2064022_T_G_b38	MORN1	2.737	0.00641	0.042247	23	0.015433	no	ARTTBL
chr1_2150203_C_A_b38	MORN1	2.737	0.00642	0.024864	16	0.009085	no	ARTTBL
chr1_2345953_G_A_b38	MORN1	2.732	0.00651	0.047189	7	0.017273	no	ARTTBL
chr1_2169620_C_G_b38	MORN1	2.728	0.00658	0.025784	12	0.009451	no	ARTTBL
chr1_3202925_C_T_b38	MORN1	2.724	0.00668	0.023789	20	0.008734	no	ARTTBL
chr1_2160844_C_T_b38	MORN1	2.723	0.0067	0.02615	11	0.009605	no	ARTTBL
chr1_2363805_C_CAAACAA_b38	MORN1	2.72	0.00674	0.019773	47	0.007269	no	ARTTBL
chr1_1681370_T_G_b38	MORN1	-2.719	0.00677	-0.025333	13	0.009317	no	ARTTBL
chr1_2211226_CTT_C_b38	MORN1	2.713	0.00689	0.035808	9	0.013198	no	ARTTBL
chr1_2004501_CA_C_b38	MORN1	-2.71	0.00695	-0.037792	3	0.013943	no	ARTTBL
chr1_2160238_C_CGTGTGTGT_b38	MORN1	2.695	0.00726	0.026447	14	0.009812	no	ARTTBL
chr1_3207634_C_T_b38	MORN1	2.695	0.00728	0.023252	24	0.008629	no	ARTTBL
chr1_2304217_G_A_b38	MORN1	-2.69	0.00737	-0.027082	9	0.010067	no	ARTTBL
chr1_2059376_C_T_b38	MORN1	2.676	0.00768	0.046249	14	0.01728	no	ARTTBL
chr1_2064837_C_T_b38	MORN1	2.676	0.00768	0.046249	14	0.01728	no	ARTTBL
chr1_2302601_CAGG_C_b38	MORN1	-2.675	0.0077	-0.024474	15	0.009148	no	ARTTBL
chr1_2303193_G_A_b38	MORN1	-2.675	0.0077	-0.024474	15	0.009148	no	ARTTBL
chr1_2886982_G_A_b38	MORN1	-2.674	0.00774	-0.054993	5	0.020567	no	ARTTBL
chr1_2380209_G_A_b38	MORN1	-2.671	0.0078	-0.017585	76	0.006583	no	ARTTBL
chr1_1688409_C_G_b38	MORN1	-2.667	0.00788	-0.018629	83	0.006984	no	ARTTBL
chr1_2316048_A_G_b38	MORN1	-2.656	0.00814	-0.019904	40	0.007493	no	ARTTBL
chr1_2629296_A_G_b38	MORN1	2.654	0.00821	0.01773	81	0.006681	no	ARTTBL
chr1_2380105_C_T_b38	MORN1	-2.653	0.00822	-0.017493	76	0.006593	no	ARTTBL
chr1_3269813_A_G_b38	MORN1	-2.644	0.00845	-0.025494	24	0.009643	no	ARTTBL
chr1_2981440_C_CT_b38	MORN1	-2.642	0.0085	-0.023161	22	0.008767	no	ARTTBL
chr1_1442722_A_G_b38	MORN1	2.636	0.00864	0.040594	3	0.0154	no	ARTTBL
chr1_2627301_C_T_b38	MORN1	2.631	0.00878	0.017529	82	0.006664	no	ARTTBL
chr1_2628150_T_G_b38	MORN1	2.631	0.00878	0.017529	82	0.006664	no	ARTTBL
chr1_2629820_GCCC_G_b38	MORN1	2.631	0.00878	0.017529	82	0.006664	no	ARTTBL
chr1_2624201_T_A_b38	MORN1	-2.617	0.00913	-0.017429	87	0.006659	no	ARTTBL
chr1_2625752_C_T_b38	MORN1	2.609	0.00935	0.01733	84	0.006643	no	ARTTBL
chr1_2626092_C_T_b38	MORN1	2.609	0.00935	0.01733	84	0.006643	no	ARTTBL
chr1_2626869_A_C_b38	MORN1	2.609	0.00935	0.01733	84	0.006643	no	ARTTBL
chr1_2625109_C_T_b38	MORN1	-2.609	0.00935	-0.01733	84	0.006643	no	ARTTBL
chr1_2625270_G_A_b38	MORN1	-2.609	0.00935	-0.01733	84	0.006643	no	ARTTBL
chr1_3358585_C_T_b38	MORN1	2.608	0.00937	0.022587	19	0.00866	no	ARTTBL
chr1_2624686_C_T_b38	MORN1	-2.603	0.0095	-0.017385	81	0.006678	no	ARTTBL
chr1_3359810_G_A_b38	MORN1	2.597	0.00968	0.016994	83	0.006545	no	ARTTBL
chr1_2631811_G_T_b38	MORN1	2.59	0.00987	0.01736	100	0.006703	no	ARTTBL
chr1_2385549_C_CG_b38	MORN1	-2.586	0.00999	-0.026324	11	0.01018	no	ARTTBL
chr1_2436551_C_CCTCCCTCCACCTTTCCTCCTTT_b38	MORN1	3.447	0.000821	0.090506	3	0.026255	yes	BRNAMY
chr1_1450193_C_T_b38	MORN1	3.276	0.00144	0.09421	3	0.028762	yes	BRNAMY
chr1_2698920_T_C_b38	MORN1	-3.049	0.00292	-0.046776	11	0.015341	yes	BRNAMY
chr1_1459004_T_C_b38	MORN1	3.032	0.00307	0.087365	4	0.028815	yes	BRNAMY
chr1_1459662_C_T_b38	MORN1	3.032	0.00307	0.087365	4	0.028815	yes	BRNAMY
chr1_2698922_T_C_b38	MORN1	-2.976	0.00364	-0.045862	11	0.015413	yes	BRNAMY
chr1_3074430_C_T_b38	MORN1	-2.942	0.00403	-0.046027	11	0.015646	yes	BRNAMY
chr1_1460021_C_CTG_b38	MORN1	2.853	0.00524	0.077039	4	0.027003	yes	BRNAMY
chr1_1460022_CAG_C_b38	MORN1	2.853	0.00524	0.077039	4	0.027003	yes	BRNAMY
chr1_3149004_C_T_b38	MORN1	-2.838	0.00547	-0.050258	3	0.017708	yes	BRNAMY
chr1_3150197_A_T_b38	MORN1	-2.838	0.00547	-0.050258	3	0.017708	yes	BRNAMY
chr1_3155918_T_A_b38	MORN1	-2.838	0.00547	-0.050258	3	0.017708	yes	BRNAMY
chr1_3159033_A_G_b38	MORN1	-2.838	0.00547	-0.050258	3	0.017708	yes	BRNAMY
chr1_2698917_T_C_b38	MORN1	-2.753	0.00699	-0.043416	11	0.015772	yes	BRNAMY
chr1_3175983_G_GCAGC_b38	MORN1	-2.703	0.00804	-0.048301	3	0.017869	yes	BRNAMY
chr1_3297280_ATT_A_b38	MORN1	-2.682	0.00853	-0.044353	9	0.016538	yes	BRNAMY
chr1_1459632_T_C_b38	MORN1	2.633	0.00976	0.071764	4	0.027254	yes	BRNAMY
chr1_1490027_A_G_b38	MORN1	3.212	0.00176	0.075484	6	0.023501	no	BRNAMY
chr1_1490032_A_G_b38	MORN1	3.212	0.00176	0.075484	6	0.023501	no	BRNAMY
chr1_2689769_A_C_b38	MORN1	-3.027	0.00312	-0.084877	3	0.028041	no	BRNAMY
chr1_2288174_A_T_b38	MORN1	2.919	0.00432	0.055487	3	0.019012	no	BRNAMY
chr1_3233225_G_A_b38	MORN1	2.846	0.00535	0.062836	6	0.02208	no	BRNAMY
chr1_2297862_C_T_b38	MORN1	-2.74	0.00724	-0.04113	11	0.01501	no	BRNAMY
chr1_2698924_C_G_b38	MORN1	-2.722	0.00763	-0.045991	6	0.016898	no	BRNAMY
chr1_3067523_C_A_b38	MORN1	-2.699	0.00813	-0.042238	11	0.01565	no	BRNAMY
chr1_1496953_T_C_b38	MORN1	2.681	0.00856	0.05801	10	0.021641	no	BRNAMY
chr1_2299360_T_C_b38	MORN1	-2.663	0.00899	-0.033782	25	0.012687	no	BRNAMY
chr1_1488652_A_G_b38	MORN1	2.662	0.00901	0.064034	9	0.024054	no	BRNAMY
chr1_1490320_T_C_b38	MORN1	2.662	0.00901	0.064034	9	0.024054	no	BRNAMY
chr1_1492292_C_G_b38	MORN1	2.662	0.00901	0.064034	9	0.024054	no	BRNAMY
chr1_1492850_G_A_b38	MORN1	2.662	0.00901	0.064034	9	0.024054	no	BRNAMY
chr1_2852326_T_G_b38	MORN1	3.212	0.00169	0.03872	37	0.012055	yes	BRNACC
chr1_2863327_T_C_b38	MORN1	-3.16	0.00199	-0.043043	18	0.013621	yes	BRNACC
chr1_1516109_T_C_b38	MORN1	-3.015	0.00313	-0.097626	5	0.032379	yes	BRNACC
chr1_1715553_G_A_b38	MORN1	-2.831	0.00543	-0.067419	4	0.023814	yes	BRNACC
chr1_2695068_A_C_b38	MORN1	2.729	0.00729	0.054644	3	0.02002	yes	BRNACC
chr1_2695069_C_A_b38	MORN1	2.717	0.00756	0.05624	3	0.020701	yes	BRNACC
chr1_3195853_T_C_b38	MORN1	-2.641	0.00935	-0.046521	10	0.017612	yes	BRNACC
chr1_1530546_A_ATT_b38	MORN1	-3.673	0.000359	-0.112595	4	0.030657	no	BRNACC
chr1_1530568_G_T_b38	MORN1	-3.651	0.000387	-0.112853	4	0.030908	no	BRNACC
chr1_1530549_G_GA_b38	MORN1	-3.633	0.000412	-0.112335	4	0.03092	no	BRNACC
chr1_1530550_C_A_b38	MORN1	-3.633	0.000412	-0.112335	4	0.03092	no	BRNACC
chr1_1530553_G_A_b38	MORN1	-3.633	0.000412	-0.112335	4	0.03092	no	BRNACC
chr1_1530555_C_T_b38	MORN1	-3.465	0.000734	-0.105082	4	0.030326	no	BRNACC
chr1_2343937_T_G_b38	MORN1	-3.447	0.00078	-0.047595	27	0.013808	no	BRNACC
chr1_2343699_C_T_b38	MORN1	-3.331	0.00115	-0.045312	22	0.013602	no	BRNACC
chr1_2343517_G_A_b38	MORN1	-3.322	0.00118	-0.044639	23	0.013436	no	BRNACC
chr1_2396376_C_T_b38	MORN1	-3.32	0.00119	-0.044775	21	0.013488	no	BRNACC
chr1_2351241_C_T_b38	MORN1	-3.274	0.00138	-0.043133	25	0.013174	no	BRNACC
chr1_2427505_A_C_b38	MORN1	-3.239	0.00155	-0.045663	14	0.014096	no	BRNACC
chr1_1708737_G_C_b38	MORN1	3.149	0.00206	0.081995	3	0.026036	no	BRNACC
chr1_2368473_T_C_b38	MORN1	-3.092	0.00246	-0.039239	30	0.012689	no	BRNACC
chr1_2367872_A_G_b38	MORN1	-3.009	0.00319	-0.037196	30	0.012362	no	BRNACC
chr1_2368188_T_C_b38	MORN1	-3.009	0.00319	-0.037196	30	0.012362	no	BRNACC
chr1_2364339_A_C_b38	MORN1	-2.996	0.00332	-0.037951	27	0.012667	no	BRNACC
chr1_2366816_A_G_b38	MORN1	-2.979	0.0035	-0.038059	26	0.012777	no	BRNACC
chr1_2428423_C_A_b38	MORN1	-2.978	0.00351	-0.041963	11	0.014093	no	BRNACC
chr1_1756753_A_G_b38	MORN1	-2.954	0.00376	-0.075989	5	0.02572	no	BRNACC
chr1_2429381_C_G_b38	MORN1	-2.932	0.00403	-0.041049	12	0.014001	no	BRNACC
chr1_2427316_G_C_b38	MORN1	-2.885	0.00463	-0.040531	12	0.014048	no	BRNACC
chr1_2352756_T_C_b38	MORN1	-2.821	0.00559	-0.036641	25	0.012987	no	BRNACC
chr1_2366956_CAAAATACATAGA_C_b38	MORN1	-2.815	0.0057	-0.036201	27	0.01286	no	BRNACC
chr1_2404530_C_G_b38	MORN1	2.784	0.00623	0.039079	14	0.014037	no	BRNACC
chr1_2405593_C_T_b38	MORN1	2.784	0.00623	0.039079	14	0.014037	no	BRNACC
chr1_2395479_G_A_b38	MORN1	2.75	0.00688	0.039583	12	0.014396	no	BRNACC
chr1_2365236_C_T_b38	MORN1	-2.744	0.00699	-0.035917	25	0.013088	no	BRNACC
chr1_2348700_C_T_b38	MORN1	-2.734	0.0072	-0.036688	22	0.013419	no	BRNACC
chr1_2404771_C_T_b38	MORN1	2.724	0.00741	0.040007	11	0.014688	no	BRNACC
chr1_1518621_A_AC_b38	MORN1	2.713	0.00763	0.050424	6	0.018584	no	BRNACC
chr1_2367456_C_CAA_b38	MORN1	-2.707	0.00777	-0.036642	21	0.013536	no	BRNACC
chr1_1993899_G_C_b38	MORN1	2.68	0.00838	0.112707	3	0.042052	no	BRNACC
chr1_2409065_C_T_b38	MORN1	2.674	0.00853	0.037437	14	0.014	no	BRNACC
chr1_3261127_G_GA_b38	MORN1	-2.649	0.00915	-0.037321	19	0.014088	no	BRNACC
chr1_1715546_C_T_b38	MORN1	-2.637	0.00946	-0.063027	3	0.023899	no	BRNACC
chr1_2365333_G_A_b38	MORN1	-3.671	0.000333	-0.045079	25	0.01228	yes	BRNCDT
chr1_2352403_G_T_b38	MORN1	3.633	0.000382	0.040453	44	0.011136	yes	BRNCDT
chr1_2364339_A_C_b38	MORN1	-3.631	0.000385	-0.04356	26	0.011998	yes	BRNCDT
chr1_2359882_C_CAA_b38	MORN1	3.599	0.000431	0.058901	6	0.016367	yes	BRNCDT
chr1_2369713_ATAAT_A_b38	MORN1	-3.589	0.000446	-0.058379	5	0.016265	yes	BRNCDT
chr1_2367872_A_G_b38	MORN1	-3.575	0.00047	-0.041291	31	0.011551	yes	BRNCDT
chr1_2368188_T_C_b38	MORN1	-3.575	0.00047	-0.041291	31	0.011551	yes	BRNCDT
chr1_2366555_G_C_b38	MORN1	-3.549	0.000513	-0.042636	26	0.012012	yes	BRNCDT
chr1_2352756_T_C_b38	MORN1	-3.548	0.000516	-0.043022	26	0.012127	yes	BRNCDT
chr1_2366816_A_G_b38	MORN1	-3.519	0.000571	-0.0429	25	0.012191	yes	BRNCDT
chr1_2357308_T_C_b38	MORN1	3.477	0.00066	0.039472	45	0.011352	yes	BRNCDT
chr1_2366243_C_T_b38	MORN1	-3.446	0.000736	-0.042139	25	0.01223	yes	BRNCDT
chr1_2366496_A_T_b38	MORN1	-3.446	0.000736	-0.042139	25	0.01223	yes	BRNCDT
chr1_2367197_G_A_b38	MORN1	-3.446	0.000736	-0.042139	25	0.01223	yes	BRNCDT
chr1_2367799_C_T_b38	MORN1	-3.446	0.000736	-0.042139	25	0.01223	yes	BRNCDT
chr1_2368939_G_C_b38	MORN1	-3.446	0.000736	-0.042139	25	0.01223	yes	BRNCDT
chr1_2351241_C_T_b38	MORN1	-3.44	0.000751	-0.041998	26	0.01221	yes	BRNCDT
chr1_2365220_A_G_b38	MORN1	-3.37	0.000952	-0.055808	5	0.016561	yes	BRNCDT
chr1_2367871_C_T_b38	MORN1	-3.37	0.000952	-0.055808	5	0.016561	yes	BRNCDT
chr1_2357811_C_G_b38	MORN1	-3.355	0.001	-0.054917	6	0.016369	yes	BRNCDT
chr1_2357812_T_C_b38	MORN1	-3.355	0.001	-0.054917	6	0.016369	yes	BRNCDT
chr1_2359828_A_G_b38	MORN1	-3.355	0.001	-0.054917	6	0.016369	yes	BRNCDT
chr1_2363591_T_G_b38	MORN1	-3.355	0.001	-0.054917	6	0.016369	yes	BRNCDT
chr1_2368718_C_A_b38	MORN1	-3.341	0.00105	-0.041346	24	0.012374	yes	BRNCDT
chr1_2365236_C_T_b38	MORN1	-3.327	0.0011	-0.041153	24	0.01237	yes	BRNCDT
chr1_2343517_G_A_b38	MORN1	-3.303	0.00119	-0.041769	23	0.012645	yes	BRNCDT
chr1_2368473_T_C_b38	MORN1	-3.296	0.00122	-0.038687	33	0.011739	yes	BRNCDT
chr1_2344932_C_A_b38	MORN1	-3.287	0.00126	-0.054689	5	0.016638	yes	BRNCDT
chr1_2346676_G_C_b38	MORN1	-3.273	0.00132	-0.053817	6	0.016442	yes	BRNCDT
chr1_2350287_A_C_b38	MORN1	-3.273	0.00132	-0.053817	6	0.016442	yes	BRNCDT
chr1_2353047_C_T_b38	MORN1	-3.273	0.00132	-0.053817	6	0.016442	yes	BRNCDT
chr1_2369336_A_G_b38	MORN1	-3.24	0.00146	-0.049571	9	0.015298	yes	BRNCDT
chr1_2343699_C_T_b38	MORN1	-3.237	0.00148	-0.041243	22	0.012741	yes	BRNCDT
chr1_1688531_T_C_b38	MORN1	-3.164	0.00188	-0.050583	9	0.015987	yes	BRNCDT
chr1_2220368_G_C_b38	MORN1	-3.021	0.00296	-0.049689	5	0.01645	yes	BRNCDT
chr1_2348700_C_T_b38	MORN1	-3.017	0.00299	-0.038956	21	0.012913	yes	BRNCDT
chr1_2356095_C_T_b38	MORN1	3.007	0.00308	0.043396	11	0.014429	yes	BRNCDT
chr1_1688457_G_A_b38	MORN1	-2.99	0.00325	-0.045947	13	0.015367	yes	BRNCDT
chr1_2345849_ACACACAG_A_b38	MORN1	2.977	0.00339	0.044451	8	0.014934	yes	BRNCDT
chr1_2344634_T_C_b38	MORN1	2.966	0.0035	0.042771	10	0.014419	yes	BRNCDT
chr1_2344761_T_A_b38	MORN1	2.966	0.0035	0.042771	10	0.014419	yes	BRNCDT
chr1_2350934_C_T_b38	MORN1	2.966	0.0035	0.042771	10	0.014419	yes	BRNCDT
chr1_1889659_T_TA_b38	MORN1	-2.898	0.0043	-0.043284	12	0.014935	yes	BRNCDT
chr1_1688586_C_T_b38	MORN1	-2.879	0.00457	-0.04518	11	0.015695	yes	BRNCDT
chr1_2357882_G_A_b38	MORN1	2.863	0.00479	0.041312	11	0.01443	yes	BRNCDT
chr1_3088448_A_ATTATTATTTAT_b38	MORN1	2.804	0.0057	0.038817	20	0.013842	yes	BRNCDT
chr1_2364484_C_T_b38	MORN1	-2.733	0.00702	-0.049725	5	0.018196	yes	BRNCDT
chr1_2579270_A_AT_b38	MORN1	-2.645	0.00902	-0.053907	3	0.020381	yes	BRNCDT
chr1_1688619_AAAC_A_b38	MORN1	-2.634	0.0093	-0.040663	12	0.015437	yes	BRNCDT
chr1_2359472_G_A_b38	MORN1	3.937	0.000125	0.044544	33	0.011314	no	BRNCDT
chr1_2360970_T_C_b38	MORN1	3.693	0.000308	0.041745	43	0.011303	no	BRNCDT
chr1_2353459_T_G_b38	MORN1	3.69	0.000311	0.041602	41	0.011273	no	BRNCDT
chr1_2356177_T_C_b38	MORN1	3.69	0.000311	0.041602	41	0.011273	no	BRNCDT
chr1_2352457_A_G_b38	MORN1	3.683	0.000319	0.041328	43	0.011221	no	BRNCDT
chr1_2360716_T_C_b38	MORN1	3.683	0.000319	0.041328	43	0.011221	no	BRNCDT
chr1_2361332_A_AG_b38	MORN1	3.683	0.000319	0.041328	43	0.011221	no	BRNCDT
chr1_2361548_A_ACT_b38	MORN1	3.683	0.000319	0.041328	43	0.011221	no	BRNCDT
chr1_2358849_T_C_b38	MORN1	3.612	0.000412	0.04075	44	0.011282	no	BRNCDT
chr1_2362718_G_A_b38	MORN1	3.514	0.00058	0.045535	16	0.012957	no	BRNCDT
chr1_2363405_C_T_b38	MORN1	3.499	0.000611	0.046475	17	0.013281	no	BRNCDT
chr1_2348378_C_T_b38	MORN1	3.439	0.000753	0.045646	14	0.013274	no	BRNCDT
chr1_2350696_G_A_b38	MORN1	3.439	0.000753	0.045646	14	0.013274	no	BRNCDT
chr1_2364499_A_G_b38	MORN1	3.383	0.000909	0.042617	19	0.012596	no	BRNCDT
chr1_2367055_C_A_b38	MORN1	3.299	0.00121	0.046021	11	0.013951	no	BRNCDT
chr1_2351551_C_T_b38	MORN1	3.169	0.00185	0.045723	10	0.014429	no	BRNCDT
chr1_2677419_A_T_b38	MORN1	3.145	0.002	0.056392	3	0.01793	no	BRNCDT
chr1_2237640_C_T_b38	MORN1	-3.12	0.00216	-0.050323	7	0.016128	no	BRNCDT
chr1_2238621_G_A_b38	MORN1	-3.12	0.00216	-0.050323	7	0.016128	no	BRNCDT
chr1_2240544_C_T_b38	MORN1	-3.12	0.00216	-0.050323	7	0.016128	no	BRNCDT
chr1_2353743_A_T_b38	MORN1	3.107	0.00225	0.04176	18	0.013441	no	BRNCDT
chr1_2367456_C_CAA_b38	MORN1	-3.102	0.00229	-0.039554	19	0.012751	no	BRNCDT
chr1_2344932_C_T_b38	MORN1	3.063	0.00259	0.045434	8	0.014833	no	BRNCDT
chr1_2343937_T_G_b38	MORN1	-3.02	0.00296	-0.039587	31	0.013109	no	BRNCDT
chr1_2356409_G_C_b38	MORN1	2.966	0.0035	0.039164	16	0.013205	no	BRNCDT
chr1_2344757_C_A_b38	MORN1	2.93	0.0039	0.042058	10	0.014352	no	BRNCDT
chr1_2345727_G_A_b38	MORN1	2.93	0.0039	0.042058	10	0.014352	no	BRNCDT
chr1_2344256_A_T_b38	MORN1	2.93	0.0039	0.0426	11	0.014537	no	BRNCDT
chr1_2240198_G_C_b38	MORN1	-2.882	0.00452	-0.046904	7	0.016276	no	BRNCDT
chr1_3141669_T_C_b38	MORN1	2.737	0.00694	0.034485	40	0.0126	no	BRNCDT
chr1_1688570_A_T_b38	MORN1	-2.732	0.00704	-0.045124	8	0.016518	no	BRNCDT
chr1_1861110_C_CA_b38	MORN1	-2.709	0.00752	-0.03581	27	0.013218	no	BRNCDT
chr1_2366956_CAAAATACATAGA_C_b38	MORN1	-2.701	0.00769	-0.0321	27	0.011883	no	BRNCDT
chr1_2344980_A_G_b38	MORN1	2.697	0.00777	0.037658	11	0.013961	no	BRNCDT
chr1_2345774_T_C_b38	MORN1	2.697	0.00777	0.037658	11	0.013961	no	BRNCDT
chr1_3086752_G_A_b38	MORN1	-2.681	0.00814	-0.039137	15	0.014597	no	BRNCDT
chr1_2067277_C_T_b38	MORN1	-2.664	0.00855	-0.10121	3	0.037991	no	BRNCDT
chr1_1688442_T_C_b38	MORN1	-2.625	0.00955	-0.040679	12	0.015498	no	BRNCDT
chr1_2677412_C_A_b38	MORN1	2.613	0.00986	0.047084	3	0.018017	no	BRNCDT
chr1_2364484_C_T_b38	MORN1	-4.486	1.55e-05	-0.106781	5	0.023805	yes	BRNCHB
chr1_2344932_C_A_b38	MORN1	-3.959	0.000122	-0.094928	4	0.02398	yes	BRNCHB
chr1_2346676_G_C_b38	MORN1	-3.959	0.000122	-0.094928	4	0.02398	yes	BRNCHB
chr1_2350287_A_C_b38	MORN1	-3.959	0.000122	-0.094928	4	0.02398	yes	BRNCHB
chr1_2353047_C_T_b38	MORN1	-3.959	0.000122	-0.094928	4	0.02398	yes	BRNCHB
chr1_2348378_C_T_b38	MORN1	3.837	0.000191	0.075614	12	0.019709	yes	BRNCHB
chr1_2350696_G_A_b38	MORN1	3.837	0.000191	0.075614	12	0.019709	yes	BRNCHB
chr1_2364339_A_C_b38	MORN1	-3.837	0.000191	-0.066243	27	0.017266	yes	BRNCHB
chr1_2359472_G_A_b38	MORN1	3.762	0.000251	0.062473	32	0.016604	yes	BRNCHB
chr1_2367872_A_G_b38	MORN1	-3.749	0.000263	-0.063705	31	0.016992	yes	BRNCHB
chr1_2368188_T_C_b38	MORN1	-3.749	0.000263	-0.063705	31	0.016992	yes	BRNCHB
chr1_1993898_C_T_b38	MORN1	-3.677	0.00034	-0.070805	22	0.019255	yes	BRNCHB
chr1_2345849_ACACACAG_A_b38	MORN1	3.577	0.000485	0.07817	7	0.021854	yes	BRNCHB
chr1_2363405_C_T_b38	MORN1	3.516	0.000598	0.0677	16	0.019253	yes	BRNCHB
chr1_2365236_C_T_b38	MORN1	-3.5	0.000633	-0.06269	24	0.017913	yes	BRNCHB
chr1_2365220_A_G_b38	MORN1	-3.464	0.000716	-0.084473	4	0.024389	yes	BRNCHB
chr1_2367871_C_T_b38	MORN1	-3.464	0.000716	-0.084473	4	0.024389	yes	BRNCHB
chr1_2343517_G_A_b38	MORN1	-3.442	0.000771	-0.062335	24	0.018112	yes	BRNCHB
chr1_2363829_A_T_b38	MORN1	-3.435	0.000789	-0.056715	28	0.01651	yes	BRNCHB
chr1_2353459_T_G_b38	MORN1	3.343	0.00107	0.055857	39	0.016708	yes	BRNCHB
chr1_2356177_T_C_b38	MORN1	3.343	0.00107	0.055857	39	0.016708	yes	BRNCHB
chr1_2366243_C_T_b38	MORN1	-3.288	0.00129	-0.058584	25	0.017817	yes	BRNCHB
chr1_2366496_A_T_b38	MORN1	-3.288	0.00129	-0.058584	25	0.017817	yes	BRNCHB
chr1_2367197_G_A_b38	MORN1	-3.288	0.00129	-0.058584	25	0.017817	yes	BRNCHB
chr1_2367799_C_T_b38	MORN1	-3.288	0.00129	-0.058584	25	0.017817	yes	BRNCHB
chr1_2368939_G_C_b38	MORN1	-3.288	0.00129	-0.058584	25	0.017817	yes	BRNCHB
chr1_2352756_T_C_b38	MORN1	-3.262	0.0014	-0.057855	25	0.017736	yes	BRNCHB
chr1_2366555_G_C_b38	MORN1	-3.229	0.00156	-0.057181	26	0.017709	yes	BRNCHB
chr1_2365333_G_A_b38	MORN1	-3.227	0.00157	-0.057538	25	0.017831	yes	BRNCHB
chr1_2353743_A_T_b38	MORN1	3.214	0.00164	0.062798	17	0.019536	yes	BRNCHB
chr1_2358849_T_C_b38	MORN1	3.204	0.00169	0.053346	40	0.016648	yes	BRNCHB
chr1_1994663_G_C_b38	MORN1	3.191	0.00176	0.0585	42	0.018331	yes	BRNCHB
chr1_2456474_A_G_b38	MORN1	-3.176	0.00185	-0.080392	5	0.025309	yes	BRNCHB
chr1_2352403_G_T_b38	MORN1	3.166	0.00191	0.052852	41	0.016695	yes	BRNCHB
chr1_2344932_C_T_b38	MORN1	3.128	0.00216	0.069052	8	0.022072	yes	BRNCHB
chr1_2367456_C_CAA_b38	MORN1	-3.096	0.00239	-0.06027	17	0.019465	yes	BRNCHB
chr1_2055297_GA_G_b38	MORN1	-3.095	0.0024	-0.077827	5	0.025146	yes	BRNCHB
chr1_2459276_C_G_b38	MORN1	-3.068	0.00261	-0.053917	38	0.017576	yes	BRNCHB
chr1_2089675_C_T_b38	MORN1	-3.061	0.00266	-0.080743	6	0.026375	yes	BRNCHB
chr1_2461871_C_CA_b38	MORN1	-3.035	0.00289	-0.05282	39	0.017403	yes	BRNCHB
chr1_2462635_T_C_b38	MORN1	-3.035	0.00289	-0.05282	39	0.017403	yes	BRNCHB
chr1_3119198_A_G_b38	MORN1	-3.03	0.00293	-0.075869	6	0.025037	yes	BRNCHB
chr1_2448062_C_G_b38	MORN1	-3.024	0.00299	-0.066001	8	0.021826	yes	BRNCHB
chr1_2460122_C_G_b38	MORN1	-3.016	0.00306	-0.075425	4	0.025007	yes	BRNCHB
chr1_2460900_C_T_b38	MORN1	-3.016	0.00306	-0.075425	4	0.025007	yes	BRNCHB
chr1_2463385_G_A_b38	MORN1	-3.016	0.00306	-0.075425	4	0.025007	yes	BRNCHB
chr1_2350539_T_G_b38	MORN1	-2.986	0.00336	-0.051515	42	0.01725	yes	BRNCHB
chr1_2384876_A_G_b38	MORN1	-2.968	0.00355	-0.048986	43	0.016502	yes	BRNCHB
chr1_2458263_T_C_b38	MORN1	-2.932	0.00396	-0.073943	4	0.025222	yes	BRNCHB
chr1_2458406_G_C_b38	MORN1	-2.932	0.00396	-0.073943	4	0.025222	yes	BRNCHB
chr1_2458682_TG_T_b38	MORN1	-2.932	0.00396	-0.073943	4	0.025222	yes	BRNCHB
chr1_1995500_GA_G_b38	MORN1	2.865	0.00485	0.053689	32	0.018742	yes	BRNCHB
chr1_2459149_T_C_b38	MORN1	-2.806	0.00577	-0.048961	37	0.017452	yes	BRNCHB
chr1_2389131_A_AAAG_b38	MORN1	-2.793	0.00598	-0.046312	35	0.016579	yes	BRNCHB
chr1_2054074_C_G_b38	MORN1	-2.779	0.00624	-0.070804	10	0.025482	yes	BRNCHB
chr1_2054570_T_A_b38	MORN1	-2.778	0.00625	-0.083108	3	0.029916	yes	BRNCHB
chr1_2457384_G_A_b38	MORN1	-2.714	0.00751	-0.06829	5	0.025157	yes	BRNCHB
chr1_3356191_G_A_b38	MORN1	-2.701	0.00781	-0.066219	5	0.024518	yes	BRNCHB
chr1_2297701_C_T_b38	MORN1	-2.698	0.00787	-0.075583	3	0.028012	yes	BRNCHB
chr1_2292928_G_T_b38	MORN1	-2.672	0.00846	-0.07544	3	0.028228	yes	BRNCHB
chr1_2435454_TGGCTGGA_T_b38	MORN1	-2.669	0.00854	-0.052846	24	0.019799	yes	BRNCHB
chr1_2462084_C_A_b38	MORN1	-2.662	0.00872	-0.068932	3	0.025897	yes	BRNCHB
chr1_2467680_A_G_b38	MORN1	-2.649	0.00905	-0.046974	35	0.017733	yes	BRNCHB
chr1_1663949_A_G_b38	MORN1	2.631	0.00951	0.065992	5	0.025083	yes	BRNCHB
chr1_2309937_C_CTT_b38	MORN1	4.422	2e-05	0.084479	21	0.019103	no	BRNCHB
chr1_2359882_C_CAA_b38	MORN1	3.952	0.000125	0.087623	7	0.022174	no	BRNCHB
chr1_2459587_GGTGGTCTTCCTTTCCGGTGGTCCTCCTTGCCTGTGGTCCTCCTTGCCT_G_b38	MORN1	-3.896	0.000154	-0.085137	13	0.021853	no	BRNCHB
chr1_2345148_G_A_b38	MORN1	-3.887	0.000159	-0.107487	3	0.027652	no	BRNCHB
chr1_2356095_C_T_b38	MORN1	3.865	0.000172	0.078813	11	0.020392	no	BRNCHB
chr1_2357882_G_A_b38	MORN1	3.818	0.000205	0.078237	11	0.020491	no	BRNCHB
chr1_2357811_C_G_b38	MORN1	-3.769	0.000245	-0.090902	4	0.024121	no	BRNCHB
chr1_2357812_T_C_b38	MORN1	-3.769	0.000245	-0.090902	4	0.024121	no	BRNCHB
chr1_2359828_A_G_b38	MORN1	-3.769	0.000245	-0.090902	4	0.024121	no	BRNCHB
chr1_2363591_T_G_b38	MORN1	-3.769	0.000245	-0.090902	4	0.024121	no	BRNCHB
chr1_2344634_T_C_b38	MORN1	3.765	0.000248	0.077914	10	0.020694	no	BRNCHB
chr1_2344761_T_A_b38	MORN1	3.765	0.000248	0.077914	10	0.020694	no	BRNCHB
chr1_2350934_C_T_b38	MORN1	3.765	0.000248	0.077914	10	0.020694	no	BRNCHB
chr1_2368473_T_C_b38	MORN1	-3.756	0.000257	-0.063968	32	0.017032	no	BRNCHB
chr1_2362718_G_A_b38	MORN1	3.753	0.00026	0.071145	14	0.018959	no	BRNCHB
chr1_2351551_C_T_b38	MORN1	3.748	0.000264	0.07803	10	0.02082	no	BRNCHB
chr1_2344757_C_A_b38	MORN1	3.685	0.000331	0.076412	10	0.020738	no	BRNCHB
chr1_2345727_G_A_b38	MORN1	3.685	0.000331	0.076412	10	0.020738	no	BRNCHB
chr1_2366816_A_G_b38	MORN1	-3.649	0.000376	-0.063454	26	0.017389	no	BRNCHB
chr1_2366956_CAAAATACATAGA_C_b38	MORN1	-3.645	0.000381	-0.063762	27	0.017491	no	BRNCHB
chr1_2383824_C_G_b38	MORN1	-3.593	0.000459	-0.062107	26	0.017287	no	BRNCHB
chr1_2384278_A_G_b38	MORN1	-3.582	0.000476	-0.057752	47	0.016124	no	BRNCHB
chr1_1479205_A_C_b38	MORN1	-3.498	0.000637	-0.100166	6	0.028639	no	BRNCHB
chr1_2367055_C_A_b38	MORN1	3.452	0.000744	0.069327	11	0.020081	no	BRNCHB
chr1_2364499_A_G_b38	MORN1	3.441	0.000774	0.064888	15	0.018859	no	BRNCHB
chr1_2344980_A_G_b38	MORN1	3.396	9e-04	0.070355	11	0.020717	no	BRNCHB
chr1_2345774_T_C_b38	MORN1	3.396	9e-04	0.070355	11	0.020717	no	BRNCHB
chr1_2392897_T_C_b38	MORN1	-3.361	0.00101	-0.060481	22	0.017994	no	BRNCHB
chr1_2366021_T_C_b38	MORN1	-3.341	0.00108	-0.057252	46	0.017138	no	BRNCHB
chr1_2368718_C_A_b38	MORN1	-3.324	0.00114	-0.060033	24	0.01806	no	BRNCHB
chr1_1534915_T_C_b38	MORN1	-3.323	0.00115	-0.153624	7	0.04623	no	BRNCHB
chr1_2068401_C_T_b38	MORN1	-3.322	0.00115	-0.09116	3	0.02744	no	BRNCHB
chr1_2356409_G_C_b38	MORN1	3.297	0.00125	0.063254	14	0.019186	no	BRNCHB
chr1_2344256_A_T_b38	MORN1	3.293	0.00127	0.067144	10	0.020391	no	BRNCHB
chr1_2352457_A_G_b38	MORN1	3.228	0.00157	0.053815	40	0.016673	no	BRNCHB
chr1_2360716_T_C_b38	MORN1	3.228	0.00157	0.053815	40	0.016673	no	BRNCHB
chr1_2360970_T_C_b38	MORN1	3.228	0.00157	0.053815	40	0.016673	no	BRNCHB
chr1_2361332_A_AG_b38	MORN1	3.228	0.00157	0.053815	40	0.016673	no	BRNCHB
chr1_2361548_A_ACT_b38	MORN1	3.228	0.00157	0.053815	40	0.016673	no	BRNCHB
chr1_2357308_T_C_b38	MORN1	3.197	0.00173	0.053451	41	0.01672	no	BRNCHB
chr1_2371472_G_A_b38	MORN1	-3.185	0.0018	-0.069235	8	0.021739	no	BRNCHB
chr1_2075002_G_A_b38	MORN1	-3.183	0.00181	-0.086108	3	0.027051	no	BRNCHB
chr1_2344583_G_A_b38	MORN1	3.172	0.00188	0.064696	10	0.020398	no	BRNCHB
chr1_2364657_A_T_b38	MORN1	-3.151	0.00201	-0.054731	47	0.017371	no	BRNCHB
chr1_2364658_A_T_b38	MORN1	-3.151	0.00201	-0.054731	47	0.017371	no	BRNCHB
chr1_2351241_C_T_b38	MORN1	-3.115	0.00225	-0.055594	25	0.017848	no	BRNCHB
chr1_2453797_T_C_b38	MORN1	-3.089	0.00244	-0.057354	35	0.018565	no	BRNCHB
chr1_2459813_A_C_b38	MORN1	-3.03	0.00294	-0.05376	37	0.017742	no	BRNCHB
chr1_2363805_C_CAAACAA_b38	MORN1	3.027	0.00297	0.061744	13	0.0204	no	BRNCHB
chr1_2358373_A_T_b38	MORN1	-3.022	0.00301	-0.072625	5	0.024034	no	BRNCHB
chr1_2383024_G_T_b38	MORN1	-3.008	0.00314	-0.054763	23	0.018205	no	BRNCHB
chr1_2383716_CA_C_b38	MORN1	-3.008	0.00314	-0.054763	23	0.018205	no	BRNCHB
chr1_2056821_T_C_b38	MORN1	-2.998	0.00324	-0.073726	14	0.024594	no	BRNCHB
chr1_2369336_A_G_b38	MORN1	-2.958	0.00367	-0.0679	6	0.022957	no	BRNCHB
chr1_2343699_C_T_b38	MORN1	-2.945	0.00381	-0.054115	23	0.018374	no	BRNCHB
chr1_2456389_C_T_b38	MORN1	-2.943	0.00383	-0.074055	4	0.025163	no	BRNCHB
chr1_1994648_T_C_b38	MORN1	2.939	0.00388	0.054052	41	0.018392	no	BRNCHB
chr1_2374713_C_T_b38	MORN1	-2.906	0.00429	-0.050921	27	0.017524	no	BRNCHB
chr1_2375256_C_T_b38	MORN1	-2.906	0.00429	-0.050921	27	0.017524	no	BRNCHB
chr1_2348700_C_T_b38	MORN1	-2.886	0.00455	-0.051454	22	0.017828	no	BRNCHB
chr1_2078844_C_CT_b38	MORN1	-2.885	0.00456	-0.106218	3	0.036815	no	BRNCHB
chr1_2056605_G_C_b38	MORN1	-2.87	0.00478	-0.078826	3	0.027469	no	BRNCHB
chr1_2451600_A_G_b38	MORN1	-2.863	0.00488	-0.054416	34	0.019009	no	BRNCHB
chr1_2090485_G_GC_b38	MORN1	-2.863	0.00488	-0.079083	3	0.027626	no	BRNCHB
chr1_2461209_G_C_b38	MORN1	-2.846	0.00513	-0.052369	36	0.018404	no	BRNCHB
chr1_2282479_GGTGGTGGAGATCTTCAGAGAGAGGACGCCTGAGAAGACAGGCA_G_b38	MORN1	2.77	0.00641	0.08541	4	0.030838	no	BRNCHB
chr1_2343445_C_T_b38	MORN1	2.762	0.00655	0.055743	10	0.02018	no	BRNCHB
chr1_1500729_G_A_b38	MORN1	-2.746	0.00685	-0.104994	10	0.03823	no	BRNCHB
chr1_2464013_C_T_b38	MORN1	-2.739	0.007	-0.076021	3	0.027755	no	BRNCHB
chr1_2464836_G_T_b38	MORN1	-2.739	0.007	-0.076021	3	0.027755	no	BRNCHB
chr1_2466310_G_A_b38	MORN1	-2.739	0.007	-0.076021	3	0.027755	no	BRNCHB
chr1_2466611_G_A_b38	MORN1	-2.739	0.007	-0.076021	3	0.027755	no	BRNCHB
chr1_2467963_C_G_b38	MORN1	-2.739	0.007	-0.076021	3	0.027755	no	BRNCHB
chr1_2464099_G_C_b38	MORN1	-2.731	0.00716	-0.049724	37	0.018207	no	BRNCHB
chr1_2452669_T_C_b38	MORN1	-2.701	0.00781	-0.05131	34	0.018997	no	BRNCHB
chr1_1998655_G_A_b38	MORN1	2.677	0.00836	0.050462	43	0.01885	no	BRNCHB
chr1_2001596_G_A_b38	MORN1	2.677	0.00836	0.050462	43	0.01885	no	BRNCHB
chr1_2003208_C_G_b38	MORN1	2.677	0.00836	0.050462	43	0.01885	no	BRNCHB
chr1_2385630_A_C_b38	MORN1	-2.671	0.00851	-0.049959	21	0.018706	no	BRNCHB
chr1_2070129_T_C_b38	MORN1	-2.668	0.00857	-0.072487	3	0.027167	no	BRNCHB
chr1_3386167_C_G_b38	MORN1	-2.653	0.00894	-0.111662	3	0.04209	no	BRNCHB
chr1_2383975_C_T_b38	MORN1	-2.652	0.00897	-0.055512	14	0.020934	no	BRNCHB
chr1_2455662_C_T_b38	MORN1	-2.648	0.00907	-0.048482	44	0.01831	no	BRNCHB
chr1_2056323_C_T_b38	MORN1	-2.636	0.00939	-0.072012	3	0.027323	no	BRNCHB
chr1_2061187_A_G_b38	MORN1	-2.636	0.00939	-0.072012	3	0.027323	no	BRNCHB
chr1_2065120_G_A_b38	MORN1	-2.636	0.00939	-0.072012	3	0.027323	no	BRNCHB
chr1_1452797_CAA_C_b38	MORN1	-2.632	0.00949	-0.065004	6	0.024699	no	BRNCHB
chr1_2375533_G_A_b38	MORN1	-2.631	0.0095	-0.048105	22	0.018282	no	BRNCHB
chr1_1456829_G_C_b38	MORN1	-2.627	0.00962	-0.062295	13	0.023713	no	BRNCHB
chr1_2367456_C_CAA_b38	MORN1	-4.681	5.86e-06	-0.076251	25	0.01629	yes	BRNCHA
chr1_2367871_C_T_b38	MORN1	-4.364	2.23e-05	-0.093565	4	0.021442	yes	BRNCHA
chr1_2365220_A_G_b38	MORN1	-4.274	3.21e-05	-0.091739	4	0.021465	yes	BRNCHA
chr1_2357811_C_G_b38	MORN1	-4.212	4.12e-05	-0.090447	4	0.021474	yes	BRNCHA
chr1_2357812_T_C_b38	MORN1	-4.212	4.12e-05	-0.090447	4	0.021474	yes	BRNCHA
chr1_2359828_A_G_b38	MORN1	-4.212	4.12e-05	-0.090447	4	0.021474	yes	BRNCHA
chr1_2363591_T_G_b38	MORN1	-4.212	4.12e-05	-0.090447	4	0.021474	yes	BRNCHA
chr1_2366956_CAAAATACATAGA_C_b38	MORN1	-4.167	4.93e-05	-0.064208	34	0.015408	yes	BRNCHA
chr1_2367872_A_G_b38	MORN1	-4.047	7.9e-05	-0.061558	37	0.015211	yes	BRNCHA
chr1_2368188_T_C_b38	MORN1	-4.047	7.9e-05	-0.061558	37	0.015211	yes	BRNCHA
chr1_2344932_C_A_b38	MORN1	-3.993	9.73e-05	-0.085254	4	0.02135	yes	BRNCHA
chr1_2346676_G_C_b38	MORN1	-3.993	9.73e-05	-0.085254	4	0.02135	yes	BRNCHA
chr1_2350287_A_C_b38	MORN1	-3.993	9.73e-05	-0.085254	4	0.02135	yes	BRNCHA
chr1_2353047_C_T_b38	MORN1	-3.993	9.73e-05	-0.085254	4	0.02135	yes	BRNCHA
chr1_2366816_A_G_b38	MORN1	-3.78	0.000218	-0.05889	32	0.01558	yes	BRNCHA
chr1_2365236_C_T_b38	MORN1	-3.744	0.000248	-0.059838	30	0.015982	yes	BRNCHA
chr1_2364339_A_C_b38	MORN1	-3.723	0.000269	-0.057918	33	0.015558	yes	BRNCHA
chr1_2366021_T_C_b38	MORN1	-3.719	0.000273	-0.060045	43	0.016148	yes	BRNCHA
chr1_2366555_G_C_b38	MORN1	-3.692	0.000301	-0.057766	32	0.015648	yes	BRNCHA
chr1_2366496_A_T_b38	MORN1	-3.674	0.000321	-0.058002	31	0.015788	yes	BRNCHA
chr1_2367197_G_A_b38	MORN1	-3.674	0.000321	-0.058002	31	0.015788	yes	BRNCHA
chr1_2367799_C_T_b38	MORN1	-3.674	0.000321	-0.058002	31	0.015788	yes	BRNCHA
chr1_2368939_G_C_b38	MORN1	-3.674	0.000321	-0.058002	31	0.015788	yes	BRNCHA
chr1_2369713_ATAAT_A_b38	MORN1	-3.66	0.000337	-0.075467	6	0.020617	yes	BRNCHA
chr1_2369336_A_G_b38	MORN1	-3.649	0.000352	-0.073839	8	0.020237	yes	BRNCHA
chr1_2343517_G_A_b38	MORN1	-3.647	0.000353	-0.059887	28	0.01642	yes	BRNCHA
chr1_2350539_T_G_b38	MORN1	-3.611	0.000403	-0.058223	41	0.016126	yes	BRNCHA
chr1_2343699_C_T_b38	MORN1	-3.604	0.000413	-0.059262	28	0.016446	yes	BRNCHA
chr1_2351241_C_T_b38	MORN1	-3.603	0.000415	-0.057543	31	0.015972	yes	BRNCHA
chr1_2364484_C_T_b38	MORN1	-3.531	0.000535	-0.078412	5	0.022209	yes	BRNCHA
chr1_2352756_T_C_b38	MORN1	-3.467	0.000668	-0.055183	31	0.015916	yes	BRNCHA
chr1_1594614_G_C_b38	MORN1	-3.45	0.000709	-0.058407	29	0.016929	yes	BRNCHA
chr1_2364657_A_T_b38	MORN1	-3.435	0.000747	-0.055467	46	0.016148	yes	BRNCHA
chr1_2364658_A_T_b38	MORN1	-3.435	0.000747	-0.055467	46	0.016148	yes	BRNCHA
chr1_1602507_C_A_b38	MORN1	-3.408	0.000819	-0.060091	23	0.017633	yes	BRNCHA
chr1_1602666_G_A_b38	MORN1	-3.408	0.000819	-0.060091	23	0.017633	yes	BRNCHA
chr1_1622510_C_T_b38	MORN1	-3.401	0.00084	-0.058089	29	0.017082	yes	BRNCHA
chr1_1596144_GAGAC_G_b38	MORN1	-3.357	0.000973	-0.057553	28	0.017142	yes	BRNCHA
chr1_1618118_G_A_b38	MORN1	-3.344	0.00102	-0.056618	30	0.01693	yes	BRNCHA
chr1_1616048_C_T_b38	MORN1	-3.337	0.00104	-0.056698	30	0.01699	yes	BRNCHA
chr1_2365333_G_A_b38	MORN1	-3.332	0.00106	-0.053154	31	0.015951	yes	BRNCHA
chr1_1613090_A_G_b38	MORN1	-3.297	0.00119	-0.055796	30	0.016921	yes	BRNCHA
chr1_2346801_C_T_b38	MORN1	-3.278	0.00127	-0.055145	45	0.016824	yes	BRNCHA
chr1_1629572_TG_T_b38	MORN1	-3.274	0.00129	-0.053922	33	0.01647	yes	BRNCHA
chr1_1698022_G_A_b38	MORN1	-3.273	0.00129	-0.186273	5	0.056905	yes	BRNCHA
chr1_2349222_G_A_b38	MORN1	-3.27	0.00131	-0.05442	46	0.016644	yes	BRNCHA
chr1_1597128_C_CCCTCAGCTGGACT_b38	MORN1	-3.22	0.00154	-0.052071	30	0.016171	yes	BRNCHA
chr1_2347542_C_T_b38	MORN1	-3.204	0.00162	-0.053576	38	0.01672	yes	BRNCHA
chr1_2333631_T_C_b38	MORN1	3.118	0.00214	0.064313	7	0.020625	yes	BRNCHA
chr1_1595306_CAG_C_b38	MORN1	-3.084	0.00239	-0.055592	39	0.018025	yes	BRNCHA
chr1_1624720_G_A_b38	MORN1	-3.077	0.00244	-0.051468	32	0.016726	yes	BRNCHA
chr1_1628409_C_A_b38	MORN1	-3.066	0.00253	-0.051033	32	0.016643	yes	BRNCHA
chr1_1628814_C_T_b38	MORN1	-3.066	0.00253	-0.051033	32	0.016643	yes	BRNCHA
chr1_2352403_G_T_b38	MORN1	3.05	0.00266	0.047593	47	0.015605	yes	BRNCHA
chr1_2352457_A_G_b38	MORN1	3.05	0.00266	0.047593	47	0.015605	yes	BRNCHA
chr1_2360716_T_C_b38	MORN1	3.05	0.00266	0.047593	47	0.015605	yes	BRNCHA
chr1_2360970_T_C_b38	MORN1	3.05	0.00266	0.047593	47	0.015605	yes	BRNCHA
chr1_2361332_A_AG_b38	MORN1	3.05	0.00266	0.047593	47	0.015605	yes	BRNCHA
chr1_2361548_A_ACT_b38	MORN1	3.05	0.00266	0.047593	47	0.015605	yes	BRNCHA
chr1_1629332_G_T_b38	MORN1	3.041	0.00273	0.056263	19	0.0185	yes	BRNCHA
chr1_1594890_G_GAC_b38	MORN1	-3.038	0.00276	-0.050503	36	0.016625	yes	BRNCHA
chr1_1625805_G_A_b38	MORN1	-3.029	0.00284	-0.050664	32	0.016724	yes	BRNCHA
chr1_1593732_G_C_b38	MORN1	-3.021	0.00291	-0.04945	38	0.016369	yes	BRNCHA
chr1_1592572_T_C_b38	MORN1	-3.017	0.00295	-0.051613	28	0.017105	yes	BRNCHA
chr1_2359472_G_A_b38	MORN1	3.015	0.00297	0.04649	38	0.015419	yes	BRNCHA
chr1_1584321_T_C_b38	MORN1	-3	0.00311	-0.053933	27	0.017976	yes	BRNCHA
chr1_2353459_T_G_b38	MORN1	2.99	0.00321	0.04693	45	0.015694	yes	BRNCHA
chr1_2356177_T_C_b38	MORN1	2.99	0.00321	0.04693	45	0.015694	yes	BRNCHA
chr1_2344932_C_T_b38	MORN1	2.963	0.00349	0.062169	9	0.020985	yes	BRNCHA
chr1_2333899_TGCTGGAAAGAACA_T_b38	MORN1	2.946	0.00367	0.063234	7	0.021463	yes	BRNCHA
chr1_1593274_CA_C_b38	MORN1	-2.929	0.00388	-0.068081	3	0.023245	yes	BRNCHA
chr1_1606384_A_G_b38	MORN1	2.852	0.00489	0.050595	21	0.01774	yes	BRNCHA
chr1_1589618_A_T_b38	MORN1	-2.846	0.00497	-0.048826	28	0.017154	yes	BRNCHA
chr1_2358849_T_C_b38	MORN1	2.827	0.00526	0.044032	48	0.015573	yes	BRNCHA
chr1_1662933_T_A_b38	MORN1	-2.804	0.00564	-0.047051	26	0.016778	yes	BRNCHA
chr1_2325579_T_G_b38	MORN1	2.797	0.00575	0.060095	7	0.021483	yes	BRNCHA
chr1_2326447_G_C_b38	MORN1	2.797	0.00575	0.060095	7	0.021483	yes	BRNCHA
chr1_2330544_C_A_b38	MORN1	2.797	0.00575	0.060095	7	0.021483	yes	BRNCHA
chr1_2332227_G_A_b38	MORN1	2.797	0.00575	0.060095	7	0.021483	yes	BRNCHA
chr1_2332449_C_T_b38	MORN1	2.797	0.00575	0.060095	7	0.021483	yes	BRNCHA
chr1_2333258_C_T_b38	MORN1	2.797	0.00575	0.060095	7	0.021483	yes	BRNCHA
chr1_1630798_C_T_b38	MORN1	2.754	0.00654	0.051235	18	0.018605	yes	BRNCHA
chr1_2666102_C_A_b38	MORN1	-2.747	0.00668	-0.069853	8	0.025433	yes	BRNCHA
chr1_1624323_AT_A_b38	MORN1	2.739	0.00683	0.045691	37	0.016684	yes	BRNCHA
chr1_1625951_G_A_b38	MORN1	-2.731	0.00698	-0.044383	37	0.01625	yes	BRNCHA
chr1_1606536_GCT_G_b38	MORN1	-2.713	0.00736	-0.048536	21	0.017891	yes	BRNCHA
chr1_1606539_G_GCC_b38	MORN1	-2.713	0.00736	-0.048536	21	0.017891	yes	BRNCHA
chr1_1613769_C_T_b38	MORN1	2.71	0.00743	0.050097	19	0.018487	yes	BRNCHA
chr1_1587547_C_T_b38	MORN1	-2.709	0.00745	-0.045408	36	0.016762	yes	BRNCHA
chr1_1624086_G_A_b38	MORN1	-2.704	0.00755	-0.043817	38	0.016203	yes	BRNCHA
chr1_1589151_C_T_b38	MORN1	-2.669	0.00834	-0.044196	33	0.016556	yes	BRNCHA
chr1_1587397_A_AT_b38	MORN1	-2.665	0.00846	-0.043747	39	0.016418	yes	BRNCHA
chr1_1621352_G_A_b38	MORN1	2.638	0.00913	0.046068	21	0.017464	yes	BRNCHA
chr1_2348378_C_T_b38	MORN1	3.839	0.000175	0.072231	14	0.018816	no	BRNCHA
chr1_2350696_G_A_b38	MORN1	3.839	0.000175	0.072231	14	0.018816	no	BRNCHA
chr1_2368473_T_C_b38	MORN1	-3.761	0.000234	-0.058255	39	0.01549	no	BRNCHA
chr1_2359882_C_CAA_b38	MORN1	3.694	0.000298	0.076239	10	0.020636	no	BRNCHA
chr1_2362718_G_A_b38	MORN1	3.625	0.000383	0.066377	16	0.018312	no	BRNCHA
chr1_2366243_C_T_b38	MORN1	-3.563	0.000477	-0.056473	30	0.015848	no	BRNCHA
chr1_2368718_C_A_b38	MORN1	-3.483	0.000632	-0.056128	30	0.016114	no	BRNCHA
chr1_2356409_G_C_b38	MORN1	3.466	0.000672	0.065086	16	0.018781	no	BRNCHA
chr1_2367055_C_A_b38	MORN1	3.374	0.000921	0.064047	13	0.018984	no	BRNCHA
chr1_1606532_G_A_b38	MORN1	-3.368	0.00094	-0.061317	20	0.018207	no	BRNCHA
chr1_2364499_A_G_b38	MORN1	3.321	0.0011	0.060382	18	0.018184	no	BRNCHA
chr1_1608603_C_A_b38	MORN1	-3.301	0.00118	-0.055989	30	0.016962	no	BRNCHA
chr1_1609070_G_A_b38	MORN1	-3.301	0.00118	-0.055989	30	0.016962	no	BRNCHA
chr1_2348700_C_T_b38	MORN1	-3.28	0.00126	-0.053239	27	0.016231	no	BRNCHA
chr1_2363405_C_T_b38	MORN1	3.275	0.00129	0.060516	18	0.018481	no	BRNCHA
chr1_1597462_C_T_b38	MORN1	-3.26	0.00135	-0.057726	19	0.017709	no	BRNCHA
chr1_2351551_C_T_b38	MORN1	3.253	0.00138	0.066119	11	0.020324	no	BRNCHA
chr1_2344634_T_C_b38	MORN1	3.175	0.00178	0.064357	11	0.020272	no	BRNCHA
chr1_2344757_C_A_b38	MORN1	3.175	0.00178	0.064357	11	0.020272	no	BRNCHA
chr1_2344761_T_A_b38	MORN1	3.175	0.00178	0.064357	11	0.020272	no	BRNCHA
chr1_2345727_G_A_b38	MORN1	3.175	0.00178	0.064357	11	0.020272	no	BRNCHA
chr1_2350934_C_T_b38	MORN1	3.175	0.00178	0.064357	11	0.020272	no	BRNCHA
chr1_1610924_C_T_b38	MORN1	-3.167	0.00183	-0.053909	30	0.017021	no	BRNCHA
chr1_2345849_ACACACAG_A_b38	MORN1	3.081	0.00241	0.064971	8	0.021085	no	BRNCHA
chr1_2353743_A_T_b38	MORN1	3.05	0.00266	0.057633	19	0.018899	no	BRNCHA
chr1_2357308_T_C_b38	MORN1	3.044	0.00271	0.047992	48	0.015766	no	BRNCHA
chr1_2357882_G_A_b38	MORN1	3.003	0.00308	0.060144	12	0.020027	no	BRNCHA
chr1_1605347_C_T_b38	MORN1	-2.998	0.00313	-0.051694	29	0.017243	no	BRNCHA
chr1_2356095_C_T_b38	MORN1	2.99	0.00321	0.059916	12	0.020036	no	BRNCHA
chr1_2338460_T_C_b38	MORN1	2.988	0.00323	0.050769	25	0.016991	no	BRNCHA
chr1_3355977_G_A_b38	MORN1	2.919	0.00399	0.048557	45	0.016634	no	BRNCHA
chr1_2369210_C_T_b38	MORN1	-2.853	0.00488	-0.046222	36	0.016204	no	BRNCHA
chr1_3349979_T_TGGAGGA_b38	MORN1	-2.788	0.00592	-0.059601	8	0.021379	no	BRNCHA
chr1_2338570_C_T_b38	MORN1	2.747	0.00666	0.047019	24	0.017114	no	BRNCHA
chr1_2459410_TGGTGGTCCTCCTTGCC_T_b38	MORN1	2.744	0.00673	0.046786	23	0.017052	no	BRNCHA
chr1_2344980_A_G_b38	MORN1	2.726	0.0071	0.053834	12	0.019751	no	BRNCHA
chr1_2345774_T_C_b38	MORN1	2.726	0.0071	0.053834	12	0.019751	no	BRNCHA
chr1_3356191_G_A_b38	MORN1	-2.723	0.00716	-0.062885	3	0.023098	no	BRNCHA
chr1_1606559_C_G_b38	MORN1	-2.698	0.0077	-0.048383	23	0.017936	no	BRNCHA
chr1_2414660_C_G_b38	MORN1	2.688	0.0079	0.049394	15	0.018373	no	BRNCHA
chr1_2344583_G_A_b38	MORN1	2.685	0.00797	0.053939	11	0.020085	no	BRNCHA
chr1_2342466_T_C_b38	MORN1	-2.671	0.00832	-0.041148	40	0.015408	no	BRNCHA
chr1_1606552_A_G_b38	MORN1	-2.647	0.00888	-0.045446	24	0.017166	no	BRNCHA
chr1_1497741_CTG_C_b38	MORN1	2.638	0.00913	0.109479	7	0.041505	no	BRNCHA
chr1_2363829_A_T_b38	MORN1	-2.636	0.00917	-0.039533	34	0.014996	no	BRNCHA
chr1_2357811_C_G_b38	MORN1	-5.863	2.43e-08	-0.097518	3	0.016632	yes	BRNCTXA
chr1_2357812_T_C_b38	MORN1	-5.863	2.43e-08	-0.097518	3	0.016632	yes	BRNCTXA
chr1_2359828_A_G_b38	MORN1	-5.863	2.43e-08	-0.097518	3	0.016632	yes	BRNCTXA
chr1_2363591_T_G_b38	MORN1	-5.863	2.43e-08	-0.097518	3	0.016632	yes	BRNCTXA
chr1_2367871_C_T_b38	MORN1	-5.845	2.66e-08	-0.097799	3	0.016733	yes	BRNCTXA
chr1_2344932_C_A_b38	MORN1	-5.777	3.73e-08	-0.095195	3	0.016478	yes	BRNCTXA
chr1_2346676_G_C_b38	MORN1	-5.777	3.73e-08	-0.095195	3	0.016478	yes	BRNCTXA
chr1_2350287_A_C_b38	MORN1	-5.777	3.73e-08	-0.095195	3	0.016478	yes	BRNCTXA
chr1_2353047_C_T_b38	MORN1	-5.777	3.73e-08	-0.095195	3	0.016478	yes	BRNCTXA
chr1_2365220_A_G_b38	MORN1	-5.733	4.62e-08	-0.096561	3	0.016842	yes	BRNCTXA
chr1_2364484_C_T_b38	MORN1	-5.482	1.56e-07	-0.096042	4	0.01752	yes	BRNCTXA
chr1_2369713_ATAAT_A_b38	MORN1	-5.355	2.85e-07	-0.083464	5	0.015586	yes	BRNCTXA
chr1_2369336_A_G_b38	MORN1	-5.203	5.8e-07	-0.079772	7	0.015333	yes	BRNCTXA
chr1_2356409_G_C_b38	MORN1	4.22	4.04e-05	0.057275	16	0.013573	yes	BRNCTXA
chr1_2350539_T_G_b38	MORN1	-4.02	8.87e-05	-0.04687	42	0.01166	yes	BRNCTXA
chr1_2353743_A_T_b38	MORN1	3.889	0.000146	0.053364	19	0.013722	yes	BRNCTXA
chr1_2346801_C_T_b38	MORN1	-3.682	0.000314	-0.0447	47	0.012141	yes	BRNCTXA
chr1_1663949_A_G_b38	MORN1	3.44	0.000738	0.061901	4	0.017996	yes	BRNCTXA
chr1_2358373_A_T_b38	MORN1	-3.344	0.00102	-0.059169	4	0.017695	yes	BRNCTXA
chr1_2959341_G_T_b38	MORN1	-3.07	0.00251	-0.042851	16	0.01396	yes	BRNCTXA
chr1_2383975_C_T_b38	MORN1	-2.96	0.00353	-0.040621	14	0.013722	yes	BRNCTXA
chr1_1698022_G_A_b38	MORN1	-2.954	0.00359	-0.126432	5	0.042794	yes	BRNCTXA
chr1_3309230_A_G_b38	MORN1	2.875	0.00458	0.038547	17	0.013409	yes	BRNCTXA
chr1_3320610_C_T_b38	MORN1	-2.859	0.0048	-0.034686	28	0.012131	yes	BRNCTXA
chr1_2371472_G_A_b38	MORN1	-2.826	0.00529	-0.044177	9	0.015631	yes	BRNCTXA
chr1_2384876_A_G_b38	MORN1	-2.747	0.00669	-0.032692	47	0.011902	yes	BRNCTXA
chr1_3320346_A_G_b38	MORN1	-2.727	0.00708	-0.031268	41	0.011464	yes	BRNCTXA
chr1_2385630_A_C_b38	MORN1	-2.688	0.00793	-0.034599	22	0.012872	yes	BRNCTXA
chr1_2360913_G_A_b38	MORN1	2.648	0.00888	0.042169	7	0.015923	yes	BRNCTXA
chr1_2945317_T_C_b38	MORN1	-2.642	0.00904	-0.033631	29	0.01273	yes	BRNCTXA
chr1_2344256_A_T_b38	MORN1	2.633	0.00926	0.038562	11	0.014644	yes	BRNCTXA
chr1_2383824_C_G_b38	MORN1	-2.615	0.00977	-0.033031	25	0.012634	yes	BRNCTXA
chr1_2367872_A_G_b38	MORN1	-6.097	7.48e-09	-0.067543	35	0.011078	no	BRNCTXA
chr1_2368188_T_C_b38	MORN1	-6.097	7.48e-09	-0.067543	35	0.011078	no	BRNCTXA
chr1_2364339_A_C_b38	MORN1	-5.911	1.91e-08	-0.06732	30	0.011389	no	BRNCTXA
chr1_2368473_T_C_b38	MORN1	-5.89	2.12e-08	-0.065905	37	0.011189	no	BRNCTXA
chr1_2366956_CAAAATACATAGA_C_b38	MORN1	-5.858	2.5e-08	-0.066036	32	0.011273	no	BRNCTXA
chr1_2366816_A_G_b38	MORN1	-5.767	3.91e-08	-0.066746	29	0.011573	no	BRNCTXA
chr1_2352756_T_C_b38	MORN1	-5.676	6.11e-08	-0.065939	29	0.011617	no	BRNCTXA
chr1_2366555_G_C_b38	MORN1	-5.566	1.05e-07	-0.063505	30	0.01141	no	BRNCTXA
chr1_2366496_A_T_b38	MORN1	-5.482	1.56e-07	-0.063648	29	0.01161	no	BRNCTXA
chr1_2367197_G_A_b38	MORN1	-5.482	1.56e-07	-0.063648	29	0.01161	no	BRNCTXA
chr1_2367799_C_T_b38	MORN1	-5.482	1.56e-07	-0.063648	29	0.01161	no	BRNCTXA
chr1_2368939_G_C_b38	MORN1	-5.482	1.56e-07	-0.063648	29	0.01161	no	BRNCTXA
chr1_2365333_G_A_b38	MORN1	-5.434	1.96e-07	-0.062738	29	0.011545	no	BRNCTXA
chr1_2366243_C_T_b38	MORN1	-5.362	2.76e-07	-0.0634	27	0.011824	no	BRNCTXA
chr1_2351241_C_T_b38	MORN1	-5.218	5.41e-07	-0.061552	29	0.011797	no	BRNCTXA
chr1_2368718_C_A_b38	MORN1	-5.183	6.35e-07	-0.061373	28	0.011841	no	BRNCTXA
chr1_2365236_C_T_b38	MORN1	-5.073	1.05e-06	-0.059284	29	0.011685	no	BRNCTXA
chr1_2348700_C_T_b38	MORN1	-5.005	1.43e-06	-0.060664	24	0.012121	no	BRNCTXA
chr1_2367456_C_CAA_b38	MORN1	-4.983	1.57e-06	-0.063795	20	0.012801	no	BRNCTXA
chr1_2343699_C_T_b38	MORN1	-4.937	1.94e-06	-0.060082	26	0.01217	no	BRNCTXA
chr1_2343517_G_A_b38	MORN1	-4.835	3.05e-06	-0.059115	26	0.012227	no	BRNCTXA
chr1_2363829_A_T_b38	MORN1	-4.646	6.9e-06	-0.053546	32	0.011524	no	BRNCTXA
chr1_2353459_T_G_b38	MORN1	4.644	6.97e-06	0.054992	42	0.011841	no	BRNCTXA
chr1_2356177_T_C_b38	MORN1	4.644	6.97e-06	0.054992	42	0.011841	no	BRNCTXA
chr1_2352403_G_T_b38	MORN1	4.64	7.09e-06	0.054887	44	0.011829	no	BRNCTXA
chr1_2352457_A_G_b38	MORN1	4.64	7.09e-06	0.054887	44	0.011829	no	BRNCTXA
chr1_2360716_T_C_b38	MORN1	4.64	7.09e-06	0.054887	44	0.011829	no	BRNCTXA
chr1_2360970_T_C_b38	MORN1	4.64	7.09e-06	0.054887	44	0.011829	no	BRNCTXA
chr1_2361332_A_AG_b38	MORN1	4.64	7.09e-06	0.054887	44	0.011829	no	BRNCTXA
chr1_2361548_A_ACT_b38	MORN1	4.64	7.09e-06	0.054887	44	0.011829	no	BRNCTXA
chr1_2358849_T_C_b38	MORN1	4.636	7.23e-06	0.05463	45	0.011785	no	BRNCTXA
chr1_2369210_C_T_b38	MORN1	-4.625	7.56e-06	-0.055295	34	0.011956	no	BRNCTXA
chr1_2364657_A_T_b38	MORN1	-4.564	9.79e-06	-0.051733	49	0.011335	no	BRNCTXA
chr1_2364658_A_T_b38	MORN1	-4.564	9.79e-06	-0.051733	49	0.011335	no	BRNCTXA
chr1_2362718_G_A_b38	MORN1	4.544	1.07e-05	0.060717	16	0.013363	no	BRNCTXA
chr1_2357308_T_C_b38	MORN1	4.467	1.47e-05	0.053196	47	0.011909	no	BRNCTXA
chr1_2364499_A_G_b38	MORN1	4.378	2.13e-05	0.057904	18	0.013226	no	BRNCTXA
chr1_2366021_T_C_b38	MORN1	-4.339	2.49e-05	-0.049139	46	0.011324	no	BRNCTXA
chr1_2363405_C_T_b38	MORN1	4.306	2.85e-05	0.058256	18	0.013528	no	BRNCTXA
chr1_2348378_C_T_b38	MORN1	4.043	8.12e-05	0.056499	13	0.013976	no	BRNCTXA
chr1_2350696_G_A_b38	MORN1	4.043	8.12e-05	0.056499	13	0.013976	no	BRNCTXA
chr1_2359472_G_A_b38	MORN1	4.029	8.55e-05	0.048126	33	0.011945	no	BRNCTXA
chr1_2349222_G_A_b38	MORN1	-3.779	0.00022	-0.045308	48	0.011989	no	BRNCTXA
chr1_2369355_G_GA_b38	MORN1	-3.471	0.000664	-0.044569	23	0.012842	no	BRNCTXA
chr1_2341705_A_G_b38	MORN1	3.43	0.000763	0.04016	45	0.011708	no	BRNCTXA
chr1_2343937_T_G_b38	MORN1	-3.332	0.00106	-0.041445	37	0.012438	no	BRNCTXA
chr1_2357882_G_A_b38	MORN1	3.228	0.00151	0.048163	11	0.014922	no	BRNCTXA
chr1_2345849_ACACACAG_A_b38	MORN1	3.189	0.00171	0.050345	7	0.015789	no	BRNCTXA
chr1_2367055_C_A_b38	MORN1	3.171	0.00181	0.045784	12	0.014437	no	BRNCTXA
chr1_2356095_C_T_b38	MORN1	3.102	0.00226	0.046336	11	0.014938	no	BRNCTXA
chr1_2351551_C_T_b38	MORN1	3.046	0.0027	0.047056	9	0.015447	no	BRNCTXA
chr1_2347542_C_T_b38	MORN1	-2.994	0.00318	-0.037387	37	0.012488	no	BRNCTXA
chr1_2309937_C_CT_b38	MORN1	-2.989	0.00323	-0.038142	47	0.012759	no	BRNCTXA
chr1_2340787_C_T_b38	MORN1	-2.929	0.00388	-0.036219	22	0.012365	no	BRNCTXA
chr1_1755523_C_T_b38	MORN1	-2.893	0.00434	-0.035281	48	0.012197	no	BRNCTXA
chr1_2926746_A_AGCTGGGCGGTGCTGG_b38	MORN1	-2.847	0.00498	-0.040296	13	0.014156	no	BRNCTXA
chr1_3180748_GA_G_b38	MORN1	-2.843	0.00503	-0.055696	5	0.019588	no	BRNCTXA
chr1_2338460_T_C_b38	MORN1	2.837	0.00512	0.035463	23	0.012499	no	BRNCTXA
chr1_2344634_T_C_b38	MORN1	2.83	0.00523	0.043536	9	0.015381	no	BRNCTXA
chr1_2344757_C_A_b38	MORN1	2.83	0.00523	0.043536	9	0.015381	no	BRNCTXA
chr1_2344761_T_A_b38	MORN1	2.83	0.00523	0.043536	9	0.015381	no	BRNCTXA
chr1_2345727_G_A_b38	MORN1	2.83	0.00523	0.043536	9	0.015381	no	BRNCTXA
chr1_2350934_C_T_b38	MORN1	2.83	0.00523	0.043536	9	0.015381	no	BRNCTXA
chr1_1739883_C_T_b38	MORN1	2.811	0.00554	0.032585	32	0.011592	no	BRNCTXA
chr1_2344932_C_T_b38	MORN1	2.811	0.00555	0.045172	7	0.016072	no	BRNCTXA
chr1_2926816_G_T_b38	MORN1	-2.756	0.00651	-0.039372	13	0.014285	no	BRNCTXA
chr1_1657902_T_TA_b38	MORN1	-2.703	0.00759	-0.063173	3	0.023367	no	BRNCTXA
chr1_2937640_C_A_b38	MORN1	-2.694	0.00779	-0.035174	21	0.013056	no	BRNCTXA
chr1_2370170_G_T_b38	MORN1	-2.671	0.00834	-0.038529	13	0.014428	no	BRNCTXA
chr1_3180895_C_T_b38	MORN1	-2.668	0.00839	-0.051431	5	0.019275	no	BRNCTXA
chr1_2364484_C_T_b38	MORN1	-5.57	1.34e-07	-0.09299	5	0.016696	yes	BRNCTXB
chr1_2369336_A_G_b38	MORN1	-5.47	2.14e-07	-0.083432	9	0.015253	yes	BRNCTXB
chr1_2365220_A_G_b38	MORN1	-5.444	2.4e-07	-0.090177	5	0.016563	yes	BRNCTXB
chr1_2367871_C_T_b38	MORN1	-5.438	2.47e-07	-0.090214	5	0.016588	yes	BRNCTXB
chr1_2367456_C_CAA_b38	MORN1	-5.25	5.81e-07	-0.066268	23	0.012623	yes	BRNCTXB
chr1_2357811_C_G_b38	MORN1	-5.206	7.07e-07	-0.086513	5	0.016617	yes	BRNCTXB
chr1_2357812_T_C_b38	MORN1	-5.206	7.07e-07	-0.086513	5	0.016617	yes	BRNCTXB
chr1_2359828_A_G_b38	MORN1	-5.206	7.07e-07	-0.086513	5	0.016617	yes	BRNCTXB
chr1_2363591_T_G_b38	MORN1	-5.206	7.07e-07	-0.086513	5	0.016617	yes	BRNCTXB
chr1_2344932_C_A_b38	MORN1	-5.11	1.09e-06	-0.084096	5	0.016458	yes	BRNCTXB
chr1_2346676_G_C_b38	MORN1	-5.11	1.09e-06	-0.084096	5	0.016458	yes	BRNCTXB
chr1_2350287_A_C_b38	MORN1	-5.11	1.09e-06	-0.084096	5	0.016458	yes	BRNCTXB
chr1_2353047_C_T_b38	MORN1	-5.11	1.09e-06	-0.084096	5	0.016458	yes	BRNCTXB
chr1_2369713_ATAAT_A_b38	MORN1	-5.102	1.12e-06	-0.08385	5	0.016434	yes	BRNCTXB
chr1_2363405_C_T_b38	MORN1	5.061	1.35e-06	0.07309	13	0.014442	yes	BRNCTXB
chr1_2348378_C_T_b38	MORN1	5.053	1.4e-06	0.074281	9	0.014701	yes	BRNCTXB
chr1_2350696_G_A_b38	MORN1	5.053	1.4e-06	0.074281	9	0.014701	yes	BRNCTXB
chr1_2344634_T_C_b38	MORN1	5.013	1.66e-06	0.078469	7	0.015653	yes	BRNCTXB
chr1_2344761_T_A_b38	MORN1	5.013	1.66e-06	0.078469	7	0.015653	yes	BRNCTXB
chr1_2350934_C_T_b38	MORN1	5.013	1.66e-06	0.078469	7	0.015653	yes	BRNCTXB
chr1_2351551_C_T_b38	MORN1	5.013	1.66e-06	0.078469	7	0.015653	yes	BRNCTXB
chr1_2357882_G_A_b38	MORN1	4.998	1.78e-06	0.077806	8	0.015567	yes	BRNCTXB
chr1_2344757_C_A_b38	MORN1	4.885	2.9e-06	0.076068	7	0.015572	yes	BRNCTXB
chr1_2345727_G_A_b38	MORN1	4.885	2.9e-06	0.076068	7	0.015572	yes	BRNCTXB
chr1_2362718_G_A_b38	MORN1	4.866	3.14e-06	0.069418	12	0.014265	yes	BRNCTXB
chr1_2356095_C_T_b38	MORN1	4.841	3.5e-06	0.075684	8	0.015634	yes	BRNCTXB
chr1_2344980_A_G_b38	MORN1	4.796	4.25e-06	0.073457	7	0.015317	yes	BRNCTXB
chr1_2345774_T_C_b38	MORN1	4.796	4.25e-06	0.073457	7	0.015317	yes	BRNCTXB
chr1_2364499_A_G_b38	MORN1	4.785	4.45e-06	0.069396	11	0.014504	yes	BRNCTXB
chr1_2356409_G_C_b38	MORN1	4.474	1.62e-05	0.065165	12	0.014565	yes	BRNCTXB
chr1_2345148_G_A_b38	MORN1	-4.423	2e-05	-0.083823	3	0.018952	yes	BRNCTXB
chr1_2344932_C_T_b38	MORN1	4.364	2.54e-05	0.072301	5	0.016569	yes	BRNCTXB
chr1_2344583_G_A_b38	MORN1	4.215	4.56e-05	0.065448	7	0.015527	yes	BRNCTXB
chr1_2359882_C_CAA_b38	MORN1	4.187	5.09e-05	0.076554	4	0.018283	yes	BRNCTXB
chr1_2340787_C_T_b38	MORN1	-4.149	5.89e-05	-0.054778	24	0.013201	yes	BRNCTXB
chr1_2337141_G_A_b38	MORN1	3.813	0.000208	0.057633	12	0.015113	yes	BRNCTXB
chr1_2371472_G_A_b38	MORN1	-3.724	0.000288	-0.060775	8	0.016322	yes	BRNCTXB
chr1_2340807_G_A_b38	MORN1	3.667	0.000353	0.058639	10	0.015991	yes	BRNCTXB
chr1_2392128_T_C_b38	MORN1	-3.63	0.000402	-0.045346	44	0.012491	yes	BRNCTXB
chr1_2340625_G_A_b38	MORN1	3.576	0.000486	0.056937	10	0.015923	yes	BRNCTXB
chr1_2341451_G_A_b38	MORN1	3.576	0.000486	0.056937	10	0.015923	yes	BRNCTXB
chr1_2387989_A_G_b38	MORN1	-3.573	0.000491	-0.045681	45	0.012784	yes	BRNCTXB
chr1_1671995_G_T_b38	MORN1	-3.498	0.000637	-0.044019	43	0.012585	yes	BRNCTXB
chr1_2358373_A_T_b38	MORN1	-3.497	0.00064	-0.059145	6	0.016915	yes	BRNCTXB
chr1_2371226_C_CACAACCACA_b38	MORN1	-3.424	0.00082	-0.043422	44	0.012683	yes	BRNCTXB
chr1_2384876_A_G_b38	MORN1	-3.41	0.00086	-0.043022	49	0.012618	yes	BRNCTXB
chr1_2364657_A_T_b38	MORN1	-3.379	0.000954	-0.042467	48	0.012569	yes	BRNCTXB
chr1_2364658_A_T_b38	MORN1	-3.379	0.000954	-0.042467	48	0.012569	yes	BRNCTXB
chr1_1673818_A_C_b38	MORN1	-3.336	0.0011	-0.042088	43	0.012617	yes	BRNCTXB
chr1_1677707_C_T_b38	MORN1	3.3	0.00124	0.057435	6	0.017403	yes	BRNCTXB
chr1_1677720_T_G_b38	MORN1	-3.275	0.00135	-0.041356	42	0.01263	yes	BRNCTXB
chr1_1677726_A_T_b38	MORN1	-3.275	0.00135	-0.041356	42	0.01263	yes	BRNCTXB
chr1_2371077_T_C_b38	MORN1	-3.271	0.00136	-0.041561	45	0.012705	yes	BRNCTXB
chr1_1750658_T_C_b38	MORN1	-3.258	0.00142	-0.047238	19	0.014498	yes	BRNCTXB
chr1_2377643_T_G_b38	MORN1	-3.256	0.00143	-0.041951	38	0.012885	yes	BRNCTXB
chr1_1674720_TGC_T_b38	MORN1	-3.194	0.00175	-0.040001	41	0.012522	yes	BRNCTXB
chr1_1674868_G_A_b38	MORN1	-3.194	0.00175	-0.040001	41	0.012522	yes	BRNCTXB
chr1_2384241_A_G_b38	MORN1	-3.182	0.00182	-0.04055	49	0.012745	yes	BRNCTXB
chr1_1676790_C_T_b38	MORN1	-3.178	0.00184	-0.04004	41	0.012599	yes	BRNCTXB
chr1_2389131_A_AAAG_b38	MORN1	-3.152	0.002	-0.03905	39	0.012391	yes	BRNCTXB
chr1_2376477_A_C_b38	MORN1	-3.118	0.00223	-0.039296	47	0.012604	yes	BRNCTXB
chr1_2338659_A_G_b38	MORN1	3.107	0.00231	0.040767	43	0.01312	yes	BRNCTXB
chr1_1688647_G_A_b38	MORN1	-3.088	0.00245	-0.04862	13	0.015747	yes	BRNCTXB
chr1_1671724_C_T_b38	MORN1	3.034	0.0029	0.043527	17	0.014348	yes	BRNCTXB
chr1_2340764_G_T_b38	MORN1	2.962	0.00361	0.047146	10	0.015915	yes	BRNCTXB
chr1_2687568_G_C_b38	MORN1	-2.933	0.00395	-0.051091	13	0.017419	yes	BRNCTXB
chr1_2384278_A_G_b38	MORN1	-2.872	0.00475	-0.037001	40	0.012885	yes	BRNCTXB
chr1_2340235_T_C_b38	MORN1	2.869	0.00479	0.046164	10	0.016092	yes	BRNCTXB
chr1_3255979_G_C_b38	MORN1	-2.849	0.00507	-0.05672	3	0.019907	yes	BRNCTXB
chr1_1673968_GA_G_b38	MORN1	-2.785	0.00612	-0.044284	13	0.015899	yes	BRNCTXB
chr1_3253002_G_A_b38	MORN1	-2.777	0.00628	-0.054255	3	0.019541	yes	BRNCTXB
chr1_1750632_G_A_b38	MORN1	-2.773	0.00635	-0.044809	17	0.016161	yes	BRNCTXB
chr1_1688457_G_A_b38	MORN1	-2.766	0.00648	-0.045246	10	0.016359	yes	BRNCTXB
chr1_3251181_A_T_b38	MORN1	-2.751	0.00676	-0.056582	3	0.020567	yes	BRNCTXB
chr1_3252045_G_A_b38	MORN1	-2.751	0.00676	-0.056582	3	0.020567	yes	BRNCTXB
chr1_3252461_CAT_C_b38	MORN1	-2.751	0.00676	-0.056582	3	0.020567	yes	BRNCTXB
chr1_3253009_C_T_b38	MORN1	-2.751	0.00676	-0.056582	3	0.020567	yes	BRNCTXB
chr1_3253027_G_T_b38	MORN1	-2.751	0.00676	-0.056582	3	0.020567	yes	BRNCTXB
chr1_3273438_ATGTG_A_b38	MORN1	-2.701	0.00781	-0.046399	14	0.017178	yes	BRNCTXB
chr1_3275345_G_A_b38	MORN1	-2.701	0.00781	-0.046399	14	0.017178	yes	BRNCTXB
chr1_3276539_C_T_b38	MORN1	-2.701	0.00781	-0.046399	14	0.017178	yes	BRNCTXB
chr1_3277381_G_A_b38	MORN1	-2.701	0.00781	-0.046399	14	0.017178	yes	BRNCTXB
chr1_3253351_TC_T_b38	MORN1	2.69	0.00806	0.040701	13	0.015133	yes	BRNCTXB
chr1_1585372_T_A_b38	MORN1	2.665	0.00865	0.048811	5	0.018317	yes	BRNCTXB
chr1_1658422_T_C_b38	MORN1	-2.652	0.00898	-0.049428	6	0.018641	yes	BRNCTXB
chr1_1991841_T_C_b38	MORN1	-2.649	0.00905	-0.054505	5	0.020577	yes	BRNCTXB
chr1_2368473_T_C_b38	MORN1	-5.68	8.01e-08	-0.06667	36	0.011737	no	BRNCTXB
chr1_2366816_A_G_b38	MORN1	-5.662	8.71e-08	-0.067055	31	0.011842	no	BRNCTXB
chr1_2364339_A_C_b38	MORN1	-5.568	1.36e-07	-0.066623	31	0.011966	no	BRNCTXB
chr1_2367872_A_G_b38	MORN1	-5.528	1.63e-07	-0.064656	35	0.011696	no	BRNCTXB
chr1_2368188_T_C_b38	MORN1	-5.528	1.63e-07	-0.064656	35	0.011696	no	BRNCTXB
chr1_2353459_T_G_b38	MORN1	5.454	2.29e-07	0.065946	32	0.01209	no	BRNCTXB
chr1_2356177_T_C_b38	MORN1	5.454	2.29e-07	0.065946	32	0.01209	no	BRNCTXB
chr1_2368718_C_A_b38	MORN1	-5.435	2.5e-07	-0.066757	29	0.012282	no	BRNCTXB
chr1_2360716_T_C_b38	MORN1	5.387	3.12e-07	0.065243	34	0.012111	no	BRNCTXB
chr1_2360970_T_C_b38	MORN1	5.387	3.12e-07	0.065243	34	0.012111	no	BRNCTXB
chr1_2361332_A_AG_b38	MORN1	5.387	3.12e-07	0.065243	34	0.012111	no	BRNCTXB
chr1_2361548_A_ACT_b38	MORN1	5.387	3.12e-07	0.065243	34	0.012111	no	BRNCTXB
chr1_2352457_A_G_b38	MORN1	5.346	3.76e-07	0.064869	34	0.012133	no	BRNCTXB
chr1_2366243_C_T_b38	MORN1	-5.346	3.76e-07	-0.06534	29	0.012222	no	BRNCTXB
chr1_2366956_CAAAATACATAGA_C_b38	MORN1	-5.333	3.99e-07	-0.063866	31	0.011976	no	BRNCTXB
chr1_2365236_C_T_b38	MORN1	-5.317	4.29e-07	-0.065248	29	0.01227	no	BRNCTXB
chr1_2358849_T_C_b38	MORN1	5.3	4.64e-07	0.064677	34	0.012204	no	BRNCTXB
chr1_2359472_G_A_b38	MORN1	5.294	4.76e-07	0.062654	26	0.011834	no	BRNCTXB
chr1_2366496_A_T_b38	MORN1	-5.282	5.03e-07	-0.064232	30	0.012161	no	BRNCTXB
chr1_2366555_G_C_b38	MORN1	-5.282	5.03e-07	-0.064232	30	0.012161	no	BRNCTXB
chr1_2367799_C_T_b38	MORN1	-5.282	5.03e-07	-0.064232	30	0.012161	no	BRNCTXB
chr1_2368939_G_C_b38	MORN1	-5.282	5.03e-07	-0.064232	30	0.012161	no	BRNCTXB
chr1_2352403_G_T_b38	MORN1	5.252	5.75e-07	0.063593	35	0.012107	no	BRNCTXB
chr1_2357308_T_C_b38	MORN1	5.236	6.18e-07	0.064004	35	0.012223	no	BRNCTXB
chr1_2352756_T_C_b38	MORN1	-5.189	7.65e-07	-0.064121	30	0.012358	no	BRNCTXB
chr1_2345849_ACACACAG_A_b38	MORN1	5.128	1e-06	0.081489	6	0.015891	no	BRNCTXB
chr1_2343517_G_A_b38	MORN1	-5.075	1.27e-06	-0.063299	30	0.012472	no	BRNCTXB
chr1_2367197_G_A_b38	MORN1	-5.046	1.44e-06	-0.062251	29	0.012337	no	BRNCTXB
chr1_2351241_C_T_b38	MORN1	-5.032	1.53e-06	-0.063073	30	0.012535	no	BRNCTXB
chr1_2392897_T_C_b38	MORN1	-4.942	2.26e-06	-0.059696	27	0.012078	no	BRNCTXB
chr1_2365333_G_A_b38	MORN1	-4.938	2.31e-06	-0.060641	30	0.012282	no	BRNCTXB
chr1_2343699_C_T_b38	MORN1	-4.781	4.53e-06	-0.061241	29	0.012809	no	BRNCTXB
chr1_2353743_A_T_b38	MORN1	4.75	5.17e-06	0.069555	14	0.014644	no	BRNCTXB
chr1_2348700_C_T_b38	MORN1	-4.718	5.92e-06	-0.062409	25	0.013229	no	BRNCTXB
chr1_2367055_C_A_b38	MORN1	4.678	6.99e-06	0.06987	9	0.014936	no	BRNCTXB
chr1_2383824_C_G_b38	MORN1	-4.466	1.68e-05	-0.054524	29	0.01221	no	BRNCTXB
chr1_2383024_G_T_b38	MORN1	-4.431	1.93e-05	-0.054709	26	0.012346	no	BRNCTXB
chr1_2383716_CA_C_b38	MORN1	-4.431	1.93e-05	-0.054709	26	0.012346	no	BRNCTXB
chr1_2375533_G_A_b38	MORN1	-4.417	2.04e-05	-0.055854	24	0.012644	no	BRNCTXB
chr1_2343937_T_G_b38	MORN1	-4.224	4.41e-05	-0.054088	36	0.012805	no	BRNCTXB
chr1_2372759_GACC_G_b38	MORN1	-4.185	5.12e-05	-0.053861	24	0.012869	no	BRNCTXB
chr1_2372762_C_CTG_b38	MORN1	-4.185	5.12e-05	-0.053861	24	0.012869	no	BRNCTXB
chr1_2366021_T_C_b38	MORN1	-4.154	5.79e-05	-0.052305	44	0.012592	no	BRNCTXB
chr1_2385630_A_C_b38	MORN1	-4.142	6.06e-05	-0.051862	23	0.012521	no	BRNCTXB
chr1_2383975_C_T_b38	MORN1	-3.965	0.000119	-0.054062	15	0.013636	no	BRNCTXB
chr1_2337211_C_G_b38	MORN1	3.959	0.000121	0.056427	18	0.014251	no	BRNCTXB
chr1_1661562_G_C_b38	MORN1	-3.911	0.000145	-0.046924	36	0.011997	no	BRNCTXB
chr1_2374713_C_T_b38	MORN1	-3.861	0.000175	-0.048659	27	0.012604	no	BRNCTXB
chr1_2375256_C_T_b38	MORN1	-3.861	0.000175	-0.048659	27	0.012604	no	BRNCTXB
chr1_2350539_T_G_b38	MORN1	-3.809	0.000212	-0.049861	38	0.01309	no	BRNCTXB
chr1_2369210_C_T_b38	MORN1	-3.799	0.00022	-0.049509	35	0.013032	no	BRNCTXB
chr1_1651653_C_T_b38	MORN1	-3.784	0.000232	-0.052437	35	0.013857	no	BRNCTXB
chr1_1654662_CT_C_b38	MORN1	-3.745	0.000267	-0.059613	24	0.015917	no	BRNCTXB
chr1_3242280_T_C_b38	MORN1	-3.68	0.000337	-0.070136	5	0.019061	no	BRNCTXB
chr1_1750650_C_G_b38	MORN1	-3.643	0.000384	-0.055375	15	0.015199	no	BRNCTXB
chr1_2338570_C_T_b38	MORN1	3.532	0.000566	0.049067	20	0.013892	no	BRNCTXB
chr1_1673060_G_A_b38	MORN1	-3.522	0.000586	-0.044008	43	0.012496	no	BRNCTXB
chr1_2338460_T_C_b38	MORN1	3.492	0.000649	0.048697	20	0.013944	no	BRNCTXB
chr1_1671797_G_A_b38	MORN1	-3.474	0.000692	-0.04431	42	0.012757	no	BRNCTXB
chr1_1649976_G_A_b38	MORN1	-3.434	0.000793	-0.047975	23	0.013972	no	BRNCTXB
chr1_3241278_A_G_b38	MORN1	-3.421	0.000827	-0.064206	6	0.018767	no	BRNCTXB
chr1_2341705_A_G_b38	MORN1	3.411	0.000855	0.045248	42	0.013264	no	BRNCTXB
chr1_2346801_C_T_b38	MORN1	-3.387	0.000928	-0.044654	46	0.013184	no	BRNCTXB
chr1_2349222_G_A_b38	MORN1	-3.387	0.000928	-0.044654	46	0.013184	no	BRNCTXB
chr1_2389113_C_CA_b38	MORN1	-3.385	0.000933	-0.043367	29	0.01281	no	BRNCTXB
chr1_1648736_G_A_b38	MORN1	-3.377	0.00096	-0.048383	29	0.014328	no	BRNCTXB
chr1_1650000_G_A_b38	MORN1	-3.371	0.000978	-0.048662	16	0.014435	no	BRNCTXB
chr1_2347542_C_T_b38	MORN1	-3.368	0.000988	-0.044866	39	0.01332	no	BRNCTXB
chr1_2344256_A_T_b38	MORN1	3.361	0.00101	0.053914	9	0.01604	no	BRNCTXB
chr1_2346111_G_C_b38	MORN1	-3.35	0.00105	-0.045006	38	0.013435	no	BRNCTXB
chr1_2363829_A_T_b38	MORN1	-3.328	0.00113	-0.043039	30	0.012931	no	BRNCTXB
chr1_2340564_G_A_b38	MORN1	3.228	0.00157	0.05008	12	0.015512	no	BRNCTXB
chr1_1609890_C_T_b38	MORN1	3.227	0.00157	0.060361	6	0.018707	no	BRNCTXB
chr1_1674633_C_CA_b38	MORN1	-3.205	0.00169	-0.043074	23	0.013441	no	BRNCTXB
chr1_1649932_C_T_b38	MORN1	-3.203	0.0017	-0.043613	33	0.013615	no	BRNCTXB
chr1_1497606_C_G_b38	MORN1	3.168	0.0019	0.05297	7	0.016722	no	BRNCTXB
chr1_3245735_A_AT_b38	MORN1	-3.152	0.002	-0.061076	4	0.019375	no	BRNCTXB
chr1_1437955_C_G_b38	MORN1	3.13	0.00215	0.042499	19	0.013578	no	BRNCTXB
chr1_3243510_C_T_b38	MORN1	-3.079	0.00252	-0.059599	7	0.019355	no	BRNCTXB
chr1_1627156_G_A_b38	MORN1	3.03	0.00294	0.059985	4	0.0198	no	BRNCTXB
chr1_3247452_T_C_b38	MORN1	-3.024	0.00299	-0.058077	7	0.019205	no	BRNCTXB
chr1_2300128_G_T_b38	MORN1	-2.952	0.00373	-0.041268	40	0.01398	no	BRNCTXB
chr1_1636278_G_T_b38	MORN1	-2.941	0.00385	-0.04243	26	0.014426	no	BRNCTXB
chr1_2699020_A_T_b38	MORN1	2.935	0.00393	0.076723	4	0.026144	no	BRNCTXB
chr1_1672155_G_A_b38	MORN1	2.899	0.00437	0.041629	20	0.014358	no	BRNCTXB
chr1_1688586_C_T_b38	MORN1	-2.892	0.00446	-0.047029	11	0.016259	no	BRNCTXB
chr1_1675228_C_CG_b38	MORN1	-2.889	0.00451	-0.041322	29	0.014305	no	BRNCTXB
chr1_3245645_A_G_b38	MORN1	-2.881	0.00462	-0.054577	10	0.018946	no	BRNCTXB
chr1_1715745_G_A_b38	MORN1	-2.876	0.00468	-0.03987	30	0.013861	no	BRNCTXB
chr1_3145797_A_G_b38	MORN1	2.869	0.00478	0.045046	8	0.015701	no	BRNCTXB
chr1_1708362_T_C_b38	MORN1	2.855	0.00498	0.040253	26	0.014097	no	BRNCTXB
chr1_2363805_C_CAAACAA_b38	MORN1	2.828	0.0054	0.049315	8	0.017438	no	BRNCTXB
chr1_1768171_CA_C_b38	MORN1	-2.812	0.00566	-0.044895	10	0.015964	no	BRNCTXB
chr1_1696117_G_A_b38	MORN1	2.786	0.00611	0.036463	35	0.013088	no	BRNCTXB
chr1_2343445_C_T_b38	MORN1	2.774	0.00633	0.04352	10	0.015689	no	BRNCTXB
chr1_2327239_C_CACACAGAAACACACAGAAACACAGAAACAAACACAGAG_b38	MORN1	2.711	0.00758	0.040457	10	0.014922	no	BRNCTXB
chr1_3269030_G_A_b38	MORN1	-2.71	0.00761	-0.046624	13	0.017204	no	BRNCTXB
chr1_3260916_A_G_b38	MORN1	-2.703	0.00775	-0.046218	12	0.017097	no	BRNCTXB
chr1_1661169_C_A_b38	MORN1	-2.698	0.00788	-0.040293	16	0.014936	no	BRNCTXB
chr1_1696366_A_C_b38	MORN1	2.694	0.00796	0.035765	34	0.013274	no	BRNCTXB
chr1_1676287_C_T_b38	MORN1	2.694	0.00796	0.04891	5	0.018155	no	BRNCTXB
chr1_2309937_C_CT_b38	MORN1	-2.688	0.00809	-0.035241	43	0.013109	no	BRNCTXB
chr1_1653319_A_G_b38	MORN1	-2.685	0.00816	-0.03983	16	0.014833	no	BRNCTXB
chr1_1688531_T_C_b38	MORN1	-2.662	0.00871	-0.043812	10	0.016458	no	BRNCTXB
chr1_1585173_C_T_b38	MORN1	2.661	0.00875	0.051538	4	0.01937	no	BRNCTXB
chr1_2699005_C_CCT_b38	MORN1	2.661	0.00875	0.071725	4	0.026958	no	BRNCTXB
chr1_3269600_GACAGTCCCAGAGGAGC_G_b38	MORN1	-2.656	0.00886	-0.045776	14	0.017233	no	BRNCTXB
chr1_2699010_CCA_C_b38	MORN1	2.63	0.00954	0.070866	4	0.026945	no	BRNCTXB
chr1_2340425_C_T_b38	MORN1	-2.619	0.00983	-0.035029	40	0.013374	no	BRNCTXB
chr1_3240407_C_CA_b38	MORN1	3.402	0.000902	0.063034	3	0.018531	yes	BRNHPP
chr1_2978989_C_T_b38	MORN1	-3.307	0.00123	-0.045824	22	0.013855	yes	BRNHPP
chr1_1631827_G_A_b38	MORN1	-3.216	0.00166	-0.058514	3	0.018194	yes	BRNHPP
chr1_1631710_T_C_b38	MORN1	-3.162	0.00197	-0.063699	3	0.020148	yes	BRNHPP
chr1_1679100_A_G_b38	MORN1	2.923	0.00412	0.038261	32	0.013087	yes	BRNHPP
chr1_3163340_G_GGTCT_b38	MORN1	-2.842	0.00525	-0.073382	3	0.025823	yes	BRNHPP
chr1_1591703_T_C_b38	MORN1	-2.786	0.00618	-0.034796	31	0.012491	yes	BRNHPP
chr1_2682047_T_C_b38	MORN1	-2.775	0.00637	-0.06841	3	0.024649	yes	BRNHPP
chr1_1994839_A_T_b38	MORN1	-2.772	0.00643	-0.038391	19	0.01385	yes	BRNHPP
chr1_2969901_C_T_b38	MORN1	2.759	0.00668	0.048131	6	0.017445	yes	BRNHPP
chr1_2472868_C_T_b38	MORN1	-2.679	0.00838	-0.043252	8	0.016142	yes	BRNHPP
chr1_2051982_T_C_b38	MORN1	2.652	0.00906	0.0346	25	0.013049	yes	BRNHPP
chr1_2462787_T_G_b38	MORN1	2.623	0.00981	0.039798	9	0.015172	yes	BRNHPP
chr1_2466668_C_T_b38	MORN1	2.623	0.00981	0.039798	9	0.015172	yes	BRNHPP
chr1_2758202_TGAGCAACTGACACCCTGGAACAGCACACACACCCCCAGGC_T_b38	MORN1	4.879	3.21e-06	0.125086	3	0.025639	no	BRNHPP
chr1_2758265_G_C_b38	MORN1	4.378	2.52e-05	0.108905	3	0.024874	no	BRNHPP
chr1_2758300_G_C_b38	MORN1	3.866	0.000178	0.098713	3	0.025534	no	BRNHPP
chr1_2235045_A_AT_b38	MORN1	3.553	0.000539	0.05024	12	0.014138	no	BRNHPP
chr1_2964779_A_ACCAT_b38	MORN1	3.377	0.000981	0.069776	3	0.020665	no	BRNHPP
chr1_2697925_C_T_b38	MORN1	3.362	0.00103	0.085029	3	0.02529	no	BRNHPP
chr1_1662738_CT_C_b38	MORN1	3.237	0.00155	0.077591	7	0.02397	no	BRNHPP
chr1_1662855_T_C_b38	MORN1	3.237	0.00155	0.077591	7	0.02397	no	BRNHPP
chr1_2350750_AGGGGTGGCACG_A_b38	MORN1	-3.197	0.00176	-0.043639	15	0.013652	no	BRNHPP
chr1_3287565_CGGGCATCCAGGATTGCATTTACCGGGGCTGGAGCTGCCCCTGCCATGCGGGCATCGAGGATTGCATTTACCGGGGCTGGAGCCGCCCCCTGCCACGT_C_b38	MORN1	3.169	0.00192	0.040707	6	0.012844	no	BRNHPP
chr1_2293437_A_C_b38	MORN1	3.149	0.00205	0.048966	8	0.015548	no	BRNHPP
chr1_1584235_A_AT_b38	MORN1	3.076	0.00258	0.048215	19	0.015675	no	BRNHPP
chr1_1613160_C_CTT_b38	MORN1	2.988	0.00339	0.078976	4	0.026435	no	BRNHPP
chr1_3350578_A_G_b38	MORN1	-2.985	0.00342	-0.098076	7	0.032855	no	BRNHPP
chr1_2367872_A_G_b38	MORN1	-2.883	0.00464	-0.034401	31	0.011931	no	BRNHPP
chr1_2368188_T_C_b38	MORN1	-2.883	0.00464	-0.034401	31	0.011931	no	BRNHPP
chr1_2459928_G_A_b38	MORN1	2.819	0.00561	0.044377	7	0.015742	no	BRNHPP
chr1_2415084_G_C_b38	MORN1	-2.799	0.00594	-0.042489	10	0.015179	no	BRNHPP
chr1_2415085_T_C_b38	MORN1	-2.799	0.00594	-0.042489	10	0.015179	no	BRNHPP
chr1_2368473_T_C_b38	MORN1	-2.79	0.00611	-0.03329	32	0.011934	no	BRNHPP
chr1_1816644_CT_C_b38	MORN1	2.745	0.00696	0.04348	22	0.015841	no	BRNHPP
chr1_1586987_G_A_b38	MORN1	2.722	0.00742	0.040588	17	0.01491	no	BRNHPP
chr1_1650452_G_A_b38	MORN1	2.719	0.00749	0.076877	3	0.028276	no	BRNHPP
chr1_1461760_C_A_b38	MORN1	-2.714	0.0076	-0.080763	4	0.029759	no	BRNHPP
chr1_1461767_A_G_b38	MORN1	-2.714	0.0076	-0.080763	4	0.029759	no	BRNHPP
chr1_2758225_G_C_b38	MORN1	-2.71	0.00769	-0.052408	5	0.01934	no	BRNHPP
chr1_2480854_C_T_b38	MORN1	-2.706	0.00777	-0.052377	4	0.019355	no	BRNHPP
chr1_2487186_C_T_b38	MORN1	-2.706	0.00777	-0.052377	4	0.019355	no	BRNHPP
chr1_2488659_A_T_b38	MORN1	-2.706	0.00777	-0.052377	4	0.019355	no	BRNHPP
chr1_2053372_G_T_b38	MORN1	-2.694	0.00805	-0.039042	11	0.014494	no	BRNHPP
chr1_2347212_C_T_b38	MORN1	-2.668	0.00866	-0.038322	12	0.014365	no	BRNHPP
chr1_2249085_G_A_b38	MORN1	3.454	0.000748	0.047808	39	0.013841	yes	BRNHPT
chr1_2244722_C_T_b38	MORN1	3.405	0.000883	0.046771	35	0.013737	yes	BRNHPT
chr1_2244599_C_T_b38	MORN1	3.349	0.00106	0.04601	35	0.013738	yes	BRNHPT
chr1_2268951_C_A_b38	MORN1	3.336	0.00111	0.045969	40	0.013778	yes	BRNHPT
chr1_2435454_TGGCTGGA_T_b38	MORN1	-3.321	0.00117	-0.052394	23	0.015777	yes	BRNHPT
chr1_2233260_C_T_b38	MORN1	3.125	0.0022	0.045762	26	0.014643	yes	BRNHPT
chr1_2163734_CA_C_b38	MORN1	3.106	0.00233	0.055736	10	0.017945	yes	BRNHPT
chr1_2360716_T_C_b38	MORN1	3.104	0.00235	0.043157	34	0.013905	yes	BRNHPT
chr1_2360970_T_C_b38	MORN1	3.104	0.00235	0.043157	34	0.013905	yes	BRNHPT
chr1_2361332_A_AG_b38	MORN1	3.104	0.00235	0.043157	34	0.013905	yes	BRNHPT
chr1_2361548_A_ACT_b38	MORN1	3.104	0.00235	0.043157	34	0.013905	yes	BRNHPT
chr1_2357308_T_C_b38	MORN1	3.089	0.00246	0.0441	35	0.014276	yes	BRNHPT
chr1_2365236_C_T_b38	MORN1	-3.072	0.00259	-0.04302	24	0.014002	yes	BRNHPT
chr1_2231505_C_T_b38	MORN1	3.022	0.00303	0.044768	26	0.014812	yes	BRNHPT
chr1_2366816_A_G_b38	MORN1	-3.011	0.00314	-0.041709	26	0.013854	yes	BRNHPT
chr1_2367872_A_G_b38	MORN1	-3.01	0.00314	-0.040825	29	0.013561	yes	BRNHPT
chr1_2368188_T_C_b38	MORN1	-3.01	0.00314	-0.040825	29	0.013561	yes	BRNHPT
chr1_2274142_C_A_b38	MORN1	2.994	0.0033	0.042218	34	0.014102	yes	BRNHPT
chr1_2358849_T_C_b38	MORN1	2.987	0.00337	0.041705	35	0.013962	yes	BRNHPT
chr1_2366243_C_T_b38	MORN1	-2.942	0.00387	-0.040902	25	0.013902	yes	BRNHPT
chr1_2366496_A_T_b38	MORN1	-2.942	0.00387	-0.040902	25	0.013902	yes	BRNHPT
chr1_2366555_G_C_b38	MORN1	-2.942	0.00387	-0.040902	25	0.013902	yes	BRNHPT
chr1_2367197_G_A_b38	MORN1	-2.942	0.00387	-0.040902	25	0.013902	yes	BRNHPT
chr1_2367799_C_T_b38	MORN1	-2.942	0.00387	-0.040902	25	0.013902	yes	BRNHPT
chr1_2368939_G_C_b38	MORN1	-2.942	0.00387	-0.040902	25	0.013902	yes	BRNHPT
chr1_2359472_G_A_b38	MORN1	2.923	0.00409	0.040278	29	0.013778	yes	BRNHPT
chr1_2217853_C_T_b38	MORN1	2.897	0.00443	0.043224	26	0.014923	yes	BRNHPT
chr1_2238353_C_T_b38	MORN1	2.897	0.00443	0.043224	26	0.014923	yes	BRNHPT
chr1_2364339_A_C_b38	MORN1	-2.871	0.00479	-0.039865	26	0.013887	yes	BRNHPT
chr1_2237776_G_A_b38	MORN1	2.858	0.00496	0.041606	26	0.014555	yes	BRNHPT
chr1_2241478_T_C_b38	MORN1	2.858	0.00496	0.041606	26	0.014555	yes	BRNHPT
chr1_2241480_T_C_b38	MORN1	2.858	0.00496	0.041606	26	0.014555	yes	BRNHPT
chr1_2242065_T_C_b38	MORN1	2.858	0.00496	0.041606	26	0.014555	yes	BRNHPT
chr1_2262484_G_A_b38	MORN1	2.802	0.00586	0.04158	28	0.014839	yes	BRNHPT
chr1_2352756_T_C_b38	MORN1	-2.794	0.006	-0.039145	25	0.014011	yes	BRNHPT
chr1_2368718_C_A_b38	MORN1	-2.722	0.00738	-0.038433	24	0.014118	yes	BRNHPT
chr1_2246288_T_C_b38	MORN1	2.718	0.00748	0.040119	29	0.014762	yes	BRNHPT
chr1_2247560_C_T_b38	MORN1	2.718	0.00748	0.040119	29	0.014762	yes	BRNHPT
chr1_2252315_C_G_b38	MORN1	2.718	0.00748	0.040119	29	0.014762	yes	BRNHPT
chr1_2255646_T_G_b38	MORN1	2.718	0.00748	0.040119	29	0.014762	yes	BRNHPT
chr1_2257757_A_T_b38	MORN1	2.718	0.00748	0.040119	29	0.014762	yes	BRNHPT
chr1_2261509_T_C_b38	MORN1	2.718	0.00748	0.040119	29	0.014762	yes	BRNHPT
chr1_2268965_C_T_b38	MORN1	2.701	0.00783	0.04021	29	0.014885	yes	BRNHPT
chr1_2271133_C_T_b38	MORN1	2.701	0.00783	0.04021	29	0.014885	yes	BRNHPT
chr1_2272051_C_T_b38	MORN1	2.701	0.00783	0.04021	29	0.014885	yes	BRNHPT
chr1_2352457_A_G_b38	MORN1	2.686	0.00817	0.037296	34	0.013883	yes	BRNHPT
chr1_2246853_T_TG_b38	MORN1	2.683	0.00826	0.040131	28	0.014959	yes	BRNHPT
chr1_2263678_C_T_b38	MORN1	2.68	0.00833	0.03904	30	0.014569	yes	BRNHPT
chr1_2340807_G_A_b38	MORN1	2.679	0.00834	0.045766	11	0.017081	yes	BRNHPT
chr1_2250903_T_C_b38	MORN1	2.668	0.00861	0.03939	26	0.014763	yes	BRNHPT
chr1_2252841_T_C_b38	MORN1	2.668	0.00861	0.03939	26	0.014763	yes	BRNHPT
chr1_2341451_G_A_b38	MORN1	2.667	0.00862	0.04529	11	0.016979	yes	BRNHPT
chr1_2353459_T_G_b38	MORN1	2.667	0.00862	0.037109	33	0.013912	yes	BRNHPT
chr1_2356177_T_C_b38	MORN1	2.667	0.00862	0.037109	33	0.013912	yes	BRNHPT
chr1_2365333_G_A_b38	MORN1	-2.667	0.00864	-0.037184	25	0.013943	yes	BRNHPT
chr1_2352403_G_T_b38	MORN1	2.666	0.00865	0.036706	35	0.013767	yes	BRNHPT
chr1_2258038_T_C_b38	MORN1	2.665	0.00867	0.039816	28	0.014938	yes	BRNHPT
chr1_2751407_A_G_b38	MORN1	2.65	0.00905	0.061012	4	0.023022	yes	BRNHPT
chr1_2351241_C_T_b38	MORN1	-2.645	0.00919	-0.037877	24	0.014321	yes	BRNHPT
chr1_2241949_C_CTG_b38	MORN1	2.638	0.00936	0.043043	19	0.016316	yes	BRNHPT
chr1_2340787_C_T_b38	MORN1	-2.633	0.0095	-0.041158	17	0.015633	yes	BRNHPT
chr1_2213543_G_T_b38	MORN1	4.458	1.78e-05	0.065793	16	0.014757	no	BRNHPT
chr1_2364484_C_T_b38	MORN1	-3.761	0.000256	-0.069893	5	0.018585	no	BRNHPT
chr1_2215707_T_C_b38	MORN1	3.694	0.000325	0.051346	23	0.013902	no	BRNHPT
chr1_2238792_C_T_b38	MORN1	3.65	0.00038	0.050517	35	0.013841	no	BRNHPT
chr1_2224923_A_G_b38	MORN1	3.644	0.000388	0.050732	23	0.013922	no	BRNHPT
chr1_2225560_G_C_b38	MORN1	3.644	0.000388	0.050732	23	0.013922	no	BRNHPT
chr1_2234971_T_C_b38	MORN1	3.508	0.000621	0.04986	24	0.014212	no	BRNHPT
chr1_3352496_C_T_b38	MORN1	-3.365	0.00101	-0.062635	6	0.018616	no	BRNHPT
chr1_2366956_CAAAATACATAGA_C_b38	MORN1	-3.254	0.00145	-0.045188	26	0.013886	no	BRNHPT
chr1_2205929_T_C_b38	MORN1	3.245	0.00149	0.046025	31	0.014182	no	BRNHPT
chr1_2369713_ATAAT_A_b38	MORN1	-3.243	0.00151	-0.057056	6	0.017594	no	BRNHPT
chr1_2207240_A_G_b38	MORN1	3.143	0.00208	0.044022	31	0.014007	no	BRNHPT
chr1_2233496_G_T_b38	MORN1	3.138	0.00211	0.044993	40	0.014337	no	BRNHPT
chr1_2241549_T_C_b38	MORN1	3.103	0.00235	0.045205	38	0.014568	no	BRNHPT
chr1_2425690_G_GT_b38	MORN1	-3.069	0.00262	-0.056559	7	0.018431	no	BRNHPT
chr1_2367871_C_T_b38	MORN1	-3.063	0.00267	-0.056983	4	0.018605	no	BRNHPT
chr1_2365220_A_G_b38	MORN1	-3.06	0.00269	-0.056696	4	0.018528	no	BRNHPT
chr1_2274109_A_C_b38	MORN1	3.039	0.00288	0.044291	30	0.014576	no	BRNHPT
chr1_2450690_G_A_b38	MORN1	3.028	0.00297	0.073524	3	0.024279	no	BRNHPT
chr1_2235168_G_GT_b38	MORN1	3.021	0.00303	0.043706	39	0.014465	no	BRNHPT
chr1_1716919_CTT_C_b38	MORN1	-3.006	0.00318	-0.048003	17	0.015968	no	BRNHPT
chr1_2206812_A_G_b38	MORN1	2.985	0.00339	0.041399	30	0.013869	no	BRNHPT
chr1_2201613_G_T_b38	MORN1	2.962	0.00365	0.042197	29	0.014248	no	BRNHPT
chr1_2368473_T_C_b38	MORN1	-2.959	0.00368	-0.040433	30	0.013666	no	BRNHPT
chr1_2749479_C_G_b38	MORN1	2.951	0.00377	0.097414	3	0.033014	no	BRNHPT
chr1_2210546_C_A_b38	MORN1	2.9	0.00438	0.041215	28	0.01421	no	BRNHPT
chr1_2210506_C_T_b38	MORN1	2.88	0.00466	0.040809	27	0.014172	no	BRNHPT
chr1_2357811_C_G_b38	MORN1	-2.87	0.00481	-0.053485	4	0.018639	no	BRNHPT
chr1_2357812_T_C_b38	MORN1	-2.87	0.00481	-0.053485	4	0.018639	no	BRNHPT
chr1_2359828_A_G_b38	MORN1	-2.87	0.00481	-0.053485	4	0.018639	no	BRNHPT
chr1_2363591_T_G_b38	MORN1	-2.87	0.00481	-0.053485	4	0.018639	no	BRNHPT
chr1_2211288_C_G_b38	MORN1	2.859	0.00496	0.037023	34	0.01295	no	BRNHPT
chr1_2344932_C_A_b38	MORN1	-2.84	0.00525	-0.053242	4	0.018749	no	BRNHPT
chr1_2346676_G_C_b38	MORN1	-2.84	0.00525	-0.053242	4	0.018749	no	BRNHPT
chr1_2353047_C_T_b38	MORN1	-2.84	0.00525	-0.053242	4	0.018749	no	BRNHPT
chr1_2350287_A_C_b38	MORN1	-2.835	0.00533	-0.052315	4	0.018455	no	BRNHPT
chr1_2369336_A_G_b38	MORN1	-2.834	0.00534	-0.047608	8	0.0168	no	BRNHPT
chr1_1835922_G_GAA_b38	MORN1	2.826	0.00546	0.063271	10	0.022386	no	BRNHPT
chr1_2179591_T_C_b38	MORN1	2.822	0.00552	0.040853	29	0.014475	no	BRNHPT
chr1_2183219_A_AGTCTCC_b38	MORN1	2.805	0.00582	0.040789	28	0.014544	no	BRNHPT
chr1_2262576_C_A_b38	MORN1	2.788	0.0061	0.04155	37	0.014902	no	BRNHPT
chr1_2656361_GAACAGCACCCACACCCACAGGTGAGCATCTGACAGCATGTAACAGCACCCACACCCCCAGGTGAGCATCTGACAGCCTGC_G_b38	MORN1	2.785	0.00615	0.069031	6	0.024784	no	BRNHPT
chr1_2251031_G_A_b38	MORN1	2.782	0.00622	0.04108	37	0.014769	no	BRNHPT
chr1_2252606_GC_G_b38	MORN1	2.782	0.00622	0.04108	37	0.014769	no	BRNHPT
chr1_2252962_T_G_b38	MORN1	2.782	0.00622	0.04108	37	0.014769	no	BRNHPT
chr1_2253720_G_A_b38	MORN1	2.782	0.00622	0.04108	37	0.014769	no	BRNHPT
chr1_2255546_G_A_b38	MORN1	2.782	0.00622	0.04108	37	0.014769	no	BRNHPT
chr1_2261200_G_C_b38	MORN1	2.782	0.00622	0.04108	37	0.014769	no	BRNHPT
chr1_2271528_T_C_b38	MORN1	2.78	0.00625	0.039682	41	0.014275	no	BRNHPT
chr1_2195995_C_A_b38	MORN1	2.761	0.0066	0.039941	29	0.014465	no	BRNHPT
chr1_1812407_T_TAC_b38	MORN1	-2.754	0.00674	-0.052773	4	0.019164	no	BRNHPT
chr1_2181138_C_A_b38	MORN1	2.748	0.00685	0.040697	20	0.014809	no	BRNHPT
chr1_2179937_A_G_b38	MORN1	2.711	0.00763	0.038923	28	0.014359	no	BRNHPT
chr1_2145302_A_G_b38	MORN1	2.648	0.00911	0.038626	28	0.014588	no	BRNHPT
chr1_2147483_C_T_b38	MORN1	2.648	0.00911	0.038626	28	0.014588	no	BRNHPT
chr1_2151127_T_C_b38	MORN1	2.648	0.00911	0.038626	28	0.014588	no	BRNHPT
chr1_2154873_A_G_b38	MORN1	2.648	0.00911	0.038626	28	0.014588	no	BRNHPT
chr1_2757974_C_G_b38	MORN1	2.643	0.00922	0.058636	4	0.022182	no	BRNHPT
chr1_2186900_A_G_b38	MORN1	2.62	0.00984	0.037759	23	0.014411	no	BRNHPT
chr1_2186920_A_G_b38	MORN1	2.62	0.00984	0.037759	23	0.014411	no	BRNHPT
chr1_1521298_C_CAA_b38	MORN1	-4.228	3.94e-05	-0.122109	3	0.028879	yes	BRNNCC
chr1_2368473_T_C_b38	MORN1	-4.212	4.21e-05	-0.047671	36	0.011319	yes	BRNNCC
chr1_2365236_C_T_b38	MORN1	-4.089	6.83e-05	-0.048543	27	0.011873	yes	BRNNCC
chr1_2367872_A_G_b38	MORN1	-4.087	6.87e-05	-0.046748	34	0.011437	yes	BRNNCC
chr1_2368188_T_C_b38	MORN1	-4.087	6.87e-05	-0.046748	34	0.011437	yes	BRNNCC
chr1_2366816_A_G_b38	MORN1	-3.984	0.000102	-0.046287	29	0.011618	yes	BRNNCC
chr1_2365333_G_A_b38	MORN1	-3.899	0.000141	-0.04584	28	0.011756	yes	BRNNCC
chr1_2364339_A_C_b38	MORN1	-3.888	0.000148	-0.045317	30	0.011656	yes	BRNNCC
chr1_2366243_C_T_b38	MORN1	-3.853	0.000168	-0.045511	28	0.011812	yes	BRNNCC
chr1_2366496_A_T_b38	MORN1	-3.853	0.000168	-0.045511	28	0.011812	yes	BRNNCC
chr1_2367197_G_A_b38	MORN1	-3.853	0.000168	-0.045511	28	0.011812	yes	BRNNCC
chr1_2367799_C_T_b38	MORN1	-3.853	0.000168	-0.045511	28	0.011812	yes	BRNNCC
chr1_2368939_G_C_b38	MORN1	-3.853	0.000168	-0.045511	28	0.011812	yes	BRNNCC
chr1_2368718_C_A_b38	MORN1	-3.845	0.000173	-0.045998	27	0.011963	yes	BRNNCC
chr1_2366956_CAAAATACATAGA_C_b38	MORN1	-3.801	0.000204	-0.044684	31	0.011756	yes	BRNNCC
chr1_2352756_T_C_b38	MORN1	-3.768	0.000231	-0.044662	29	0.011854	yes	BRNNCC
chr1_2366021_T_C_b38	MORN1	-3.767	0.000232	-0.043638	49	0.011586	yes	BRNNCC
chr1_2366555_G_C_b38	MORN1	-3.756	0.000241	-0.044506	29	0.01185	yes	BRNNCC
chr1_2343517_G_A_b38	MORN1	-3.727	0.000268	-0.04537	26	0.012173	yes	BRNNCC
chr1_2343699_C_T_b38	MORN1	-3.573	0.000465	-0.043828	26	0.012265	yes	BRNNCC
chr1_2363829_A_T_b38	MORN1	-3.54	0.000524	-0.040805	29	0.011527	yes	BRNNCC
chr1_2338659_A_G_b38	MORN1	3.515	0.000572	0.04156	46	0.011825	yes	BRNNCC
chr1_2364657_A_T_b38	MORN1	-3.483	0.000638	-0.041113	52	0.011804	yes	BRNNCC
chr1_2364658_A_T_b38	MORN1	-3.483	0.000638	-0.041113	52	0.011804	yes	BRNNCC
chr1_2351241_C_T_b38	MORN1	-3.416	0.000803	-0.041058	29	0.012018	yes	BRNNCC
chr1_2343937_T_G_b38	MORN1	-3.379	0.000911	-0.040201	34	0.011896	yes	BRNNCC
chr1_2885492_G_A_b38	MORN1	3.357	0.000984	0.043222	36	0.012877	yes	BRNNCC
chr1_2347542_C_T_b38	MORN1	-3.338	0.00105	-0.040471	44	0.012123	yes	BRNNCC
chr1_2350539_T_G_b38	MORN1	-3.326	0.00109	-0.039894	45	0.011995	yes	BRNNCC
chr1_2367456_C_CAA_b38	MORN1	-3.287	0.00124	-0.041669	20	0.012675	yes	BRNNCC
chr1_2346111_G_C_b38	MORN1	-3.287	0.00124	-0.039812	44	0.012111	yes	BRNNCC
chr1_2341705_A_G_b38	MORN1	3.275	0.00129	0.040105	49	0.012247	yes	BRNNCC
chr1_2885487_C_T_b38	MORN1	3.211	0.00159	0.042097	33	0.013108	yes	BRNNCC
chr1_2345849_ACACACAG_A_b38	MORN1	3.176	0.00179	0.046959	8	0.014784	yes	BRNNCC
chr1_2344634_T_C_b38	MORN1	3.138	0.00202	0.044459	11	0.014169	yes	BRNNCC
chr1_2344761_T_A_b38	MORN1	3.138	0.00202	0.044459	11	0.014169	yes	BRNNCC
chr1_2350934_C_T_b38	MORN1	3.138	0.00202	0.044459	11	0.014169	yes	BRNNCC
chr1_2752210_C_A_b38	MORN1	3.095	0.00232	0.076012	3	0.02456	yes	BRNNCC
chr1_2344757_C_A_b38	MORN1	3.085	0.0024	0.043664	11	0.014153	yes	BRNNCC
chr1_2345727_G_A_b38	MORN1	3.085	0.0024	0.043664	11	0.014153	yes	BRNNCC
chr1_2346801_C_T_b38	MORN1	-3.037	0.00279	-0.037464	48	0.012335	yes	BRNNCC
chr1_2351551_C_T_b38	MORN1	3.032	0.00283	0.043163	11	0.014237	yes	BRNNCC
chr1_2349222_G_A_b38	MORN1	-3.02	0.00294	-0.037167	49	0.012309	yes	BRNNCC
chr1_2340807_G_A_b38	MORN1	2.984	0.00329	0.042199	11	0.014142	yes	BRNNCC
chr1_2340625_G_A_b38	MORN1	2.983	0.0033	0.041606	12	0.013948	yes	BRNNCC
chr1_2887713_C_G_b38	MORN1	-2.973	0.00341	-0.035756	46	0.012029	yes	BRNNCC
chr1_2369210_C_T_b38	MORN1	-2.94	0.00376	-0.034967	34	0.011891	yes	BRNNCC
chr1_2344932_C_T_b38	MORN1	2.937	0.0038	0.04362	8	0.014851	yes	BRNNCC
chr1_2341451_G_A_b38	MORN1	2.934	0.00384	0.041463	11	0.014132	yes	BRNNCC
chr1_2937896_C_T_b38	MORN1	2.901	0.00424	0.045401	7	0.015648	yes	BRNNCC
chr1_2883789_G_T_b38	MORN1	-2.9	0.00425	-0.036229	43	0.012492	yes	BRNNCC
chr1_2881892_G_A_b38	MORN1	-2.897	0.0043	-0.036088	42	0.012459	yes	BRNNCC
chr1_2348378_C_T_b38	MORN1	2.862	0.00477	0.039266	14	0.013718	yes	BRNNCC
chr1_2350696_G_A_b38	MORN1	2.862	0.00477	0.039266	14	0.013718	yes	BRNNCC
chr1_2881291_C_T_b38	MORN1	-2.852	0.00491	-0.035722	42	0.012523	yes	BRNNCC
chr1_2881640_G_C_b38	MORN1	-2.852	0.00491	-0.035722	42	0.012523	yes	BRNNCC
chr1_2881711_G_A_b38	MORN1	-2.852	0.00491	-0.035722	42	0.012523	yes	BRNNCC
chr1_2881770_T_G_b38	MORN1	-2.852	0.00491	-0.035722	42	0.012523	yes	BRNNCC
chr1_2882482_A_G_b38	MORN1	-2.852	0.00491	-0.035722	42	0.012523	yes	BRNNCC
chr1_2344256_A_T_b38	MORN1	2.847	0.00499	0.040271	10	0.014144	yes	BRNNCC
chr1_2359472_G_A_b38	MORN1	2.838	0.00512	0.032659	35	0.011507	yes	BRNNCC
chr1_2344583_G_A_b38	MORN1	2.74	0.00684	0.03792	11	0.013839	yes	BRNNCC
chr1_2348700_C_T_b38	MORN1	-2.737	0.00689	-0.03433	24	0.012541	yes	BRNNCC
chr1_2367055_C_A_b38	MORN1	2.732	0.00699	0.037451	13	0.013706	yes	BRNNCC
chr1_2124349_ACGGCGGTGGTTAGGGTCACGGCGGCGGTTAGGGTCACGGCGGTGGTTAGGGTCACGGTGGTGGTTAGG_A_b38	MORN1	-2.723	0.00719	-0.074559	3	0.027383	yes	BRNNCC
chr1_2882147_T_C_b38	MORN1	-2.656	0.00871	-0.033926	39	0.012775	yes	BRNNCC
chr1_2364484_C_T_b38	MORN1	-4.038	8.31e-05	-0.067336	4	0.016674	no	BRNNCC
chr1_2357811_C_G_b38	MORN1	-3.627	0.000385	-0.058895	4	0.016238	no	BRNNCC
chr1_2357812_T_C_b38	MORN1	-3.627	0.000385	-0.058895	4	0.016238	no	BRNNCC
chr1_2359828_A_G_b38	MORN1	-3.627	0.000385	-0.058895	4	0.016238	no	BRNNCC
chr1_2363591_T_G_b38	MORN1	-3.627	0.000385	-0.058895	4	0.016238	no	BRNNCC
chr1_2346676_G_C_b38	MORN1	-3.587	0.000443	-0.057716	4	0.01609	no	BRNNCC
chr1_2353047_C_T_b38	MORN1	-3.587	0.000443	-0.057716	4	0.01609	no	BRNNCC
chr1_2365220_A_G_b38	MORN1	-3.564	0.000481	-0.058547	3	0.016428	no	BRNNCC
chr1_2367871_C_T_b38	MORN1	-3.564	0.000481	-0.058547	3	0.016428	no	BRNNCC
chr1_2344932_C_A_b38	MORN1	-3.523	0.000555	-0.057325	3	0.016271	no	BRNNCC
chr1_2350287_A_C_b38	MORN1	-3.517	0.000567	-0.056029	4	0.01593	no	BRNNCC
chr1_3390834_G_GT_b38	MORN1	3.343	0.00103	0.04955	13	0.01482	no	BRNNCC
chr1_1662738_CT_C_b38	MORN1	3.225	0.00153	0.066585	9	0.020648	no	BRNNCC
chr1_1662855_T_C_b38	MORN1	3.225	0.00153	0.066585	9	0.020648	no	BRNNCC
chr1_2356095_C_T_b38	MORN1	3.208	0.00161	0.045297	12	0.01412	no	BRNNCC
chr1_2325642_ATTT_A_b38	MORN1	3.199	0.00166	0.049289	10	0.015406	no	BRNNCC
chr1_2885783_A_G_b38	MORN1	3.176	0.00179	0.041007	36	0.012911	no	BRNNCC
chr1_2357882_G_A_b38	MORN1	3.064	0.00256	0.043256	12	0.01412	no	BRNNCC
chr1_2757353_C_A_b38	MORN1	3.029	0.00286	0.08043	3	0.026551	no	BRNNCC
chr1_2362718_G_A_b38	MORN1	3.002	0.00311	0.040232	16	0.013401	no	BRNNCC
chr1_2369336_A_G_b38	MORN1	-2.997	0.00316	-0.045636	7	0.015229	no	BRNNCC
chr1_2751878_C_T_b38	MORN1	2.924	0.00396	0.074175	3	0.025371	no	BRNNCC
chr1_2882915_C_T_b38	MORN1	2.923	0.00397	0.038664	33	0.013227	no	BRNNCC
chr1_2369713_ATAAT_A_b38	MORN1	-2.922	0.00397	-0.045595	5	0.015602	no	BRNNCC
chr1_2675320_A_G_b38	MORN1	-2.826	0.00532	-0.052661	5	0.018637	no	BRNNCC
chr1_1650452_G_A_b38	MORN1	2.798	0.00578	0.071041	3	0.025393	no	BRNNCC
chr1_2356409_G_C_b38	MORN1	2.746	0.00671	0.037131	16	0.013521	no	BRNNCC
chr1_2363405_C_T_b38	MORN1	2.728	0.00708	0.036796	17	0.013488	no	BRNNCC
chr1_2344980_A_G_b38	MORN1	2.698	0.00773	0.037098	12	0.013752	no	BRNNCC
chr1_2345774_T_C_b38	MORN1	2.698	0.00773	0.037098	12	0.013752	no	BRNNCC
chr1_1567912_C_CAAAAAAA_b38	MORN1	2.688	0.00794	0.051058	6	0.018993	no	BRNNCC
chr1_2338460_T_C_b38	MORN1	2.679	0.00815	0.034055	22	0.012711	no	BRNNCC
chr1_2691659_G_C_b38	MORN1	2.656	0.00871	0.06033	5	0.022717	no	BRNNCC
chr1_2364499_A_G_b38	MORN1	2.621	0.0096	0.033485	19	0.012774	no	BRNNCC
chr1_2368473_T_C_b38	MORN1	-5.696	7.91e-08	-0.05671	28	0.009957	yes	BRNPTM
chr1_2364657_A_T_b38	MORN1	-5.322	4.4e-07	-0.058911	39	0.011069	yes	BRNPTM
chr1_2364658_A_T_b38	MORN1	-5.322	4.4e-07	-0.058911	39	0.011069	yes	BRNPTM
chr1_2367456_C_CAA_b38	MORN1	-4.914	2.66e-06	-0.054851	16	0.011163	yes	BRNPTM
chr1_2343699_C_T_b38	MORN1	-4.904	2.78e-06	-0.053401	19	0.01089	yes	BRNPTM
chr1_2348700_C_T_b38	MORN1	-4.647	8.2e-06	-0.050574	18	0.010883	yes	BRNPTM
chr1_2343937_T_G_b38	MORN1	-4.531	1.32e-05	-0.048185	25	0.010635	yes	BRNPTM
chr1_2347542_C_T_b38	MORN1	-4.226	4.47e-05	-0.047676	32	0.011283	yes	BRNPTM
chr1_2344980_A_G_b38	MORN1	3.849	0.000186	0.054471	8	0.014151	yes	BRNPTM
chr1_2345774_T_C_b38	MORN1	3.849	0.000186	0.054471	8	0.014151	yes	BRNPTM
chr1_2369210_C_T_b38	MORN1	-3.838	0.000193	-0.041076	28	0.010702	yes	BRNPTM
chr1_2345849_ACACACAG_A_b38	MORN1	3.795	0.000226	0.058561	5	0.015432	yes	BRNPTM
chr1_2358373_A_T_b38	MORN1	-3.662	0.000364	-0.05186	5	0.014163	yes	BRNPTM
chr1_2357308_T_C_b38	MORN1	3.52	0.000597	0.03692	39	0.010489	yes	BRNPTM
chr1_2051721_C_A_b38	MORN1	3.186	0.00181	0.042948	8	0.01348	yes	BRNPTM
chr1_1991761_T_C_b38	MORN1	-3.056	0.00273	-0.036869	21	0.012064	yes	BRNPTM
chr1_1897682_CA_C_b38	MORN1	-2.997	0.00327	-0.04314	6	0.014392	yes	BRNPTM
chr1_2459410_TGGTGGTCCTCCTTGCC_T_b38	MORN1	2.898	0.00441	0.034998	20	0.012075	yes	BRNPTM
chr1_2151127_T_C_b38	MORN1	2.882	0.00463	0.034975	26	0.012135	yes	BRNPTM
chr1_2334355_G_A_b38	MORN1	2.843	0.0052	0.048294	3	0.016989	yes	BRNPTM
chr1_2179937_A_G_b38	MORN1	2.801	0.00589	0.033377	24	0.011917	yes	BRNPTM
chr1_2337141_G_A_b38	MORN1	2.733	0.00715	0.038664	10	0.014145	yes	BRNPTM
chr1_2145302_A_G_b38	MORN1	2.729	0.00725	0.033137	24	0.012144	yes	BRNPTM
chr1_2147483_C_T_b38	MORN1	2.729	0.00725	0.033137	24	0.012144	yes	BRNPTM
chr1_2154873_A_G_b38	MORN1	2.729	0.00725	0.033137	24	0.012144	yes	BRNPTM
chr1_2101019_TA_T_b38	MORN1	2.697	0.00792	0.039018	5	0.014465	yes	BRNPTM
chr1_2155655_A_AATG_b38	MORN1	2.696	0.00797	0.032474	20	0.012047	yes	BRNPTM
chr1_2164301_G_GACCCCTGGGCCA_b38	MORN1	2.696	0.00797	0.032474	20	0.012047	yes	BRNPTM
chr1_2181226_G_A_b38	MORN1	2.694	0.00799	0.032876	19	0.012202	yes	BRNPTM
chr1_2870129_T_C_b38	MORN1	2.675	0.00844	0.028461	32	0.010639	yes	BRNPTM
chr1_2327507_C_CA_b38	MORN1	2.67	0.00856	0.049461	3	0.018525	yes	BRNPTM
chr1_2870528_C_T_b38	MORN1	-2.661	0.00877	-0.028791	30	0.010817	yes	BRNPTM
chr1_2873528_C_T_b38	MORN1	-2.661	0.00877	-0.028791	30	0.010817	yes	BRNPTM
chr1_2186506_G_C_b38	MORN1	2.65	0.00906	0.031836	19	0.012014	yes	BRNPTM
chr1_2365236_C_T_b38	MORN1	-5.887	3.2e-08	-0.060672	21	0.010305	no	BRNPTM
chr1_2368718_C_A_b38	MORN1	-5.777	5.4e-08	-0.059845	21	0.01036	no	BRNPTM
chr1_2364339_A_C_b38	MORN1	-5.661	9.3e-08	-0.057663	23	0.010186	no	BRNPTM
chr1_2366555_G_C_b38	MORN1	-5.596	1.26e-07	-0.057058	23	0.010195	no	BRNPTM
chr1_2367872_A_G_b38	MORN1	-5.581	1.35e-07	-0.056138	26	0.010059	no	BRNPTM
chr1_2368188_T_C_b38	MORN1	-5.581	1.35e-07	-0.056138	26	0.010059	no	BRNPTM
chr1_2365333_G_A_b38	MORN1	-5.538	1.64e-07	-0.057234	22	0.010334	no	BRNPTM
chr1_2366816_A_G_b38	MORN1	-5.537	1.66e-07	-0.057074	22	0.010309	no	BRNPTM
chr1_2366243_C_T_b38	MORN1	-5.497	1.99e-07	-0.056869	22	0.010346	no	BRNPTM
chr1_2366496_A_T_b38	MORN1	-5.497	1.99e-07	-0.056869	22	0.010346	no	BRNPTM
chr1_2367197_G_A_b38	MORN1	-5.497	1.99e-07	-0.056869	22	0.010346	no	BRNPTM
chr1_2367799_C_T_b38	MORN1	-5.497	1.99e-07	-0.056869	22	0.010346	no	BRNPTM
chr1_2368939_G_C_b38	MORN1	-5.497	1.99e-07	-0.056869	22	0.010346	no	BRNPTM
chr1_2366021_T_C_b38	MORN1	-5.446	2.51e-07	-0.058966	36	0.010828	no	BRNPTM
chr1_2352756_T_C_b38	MORN1	-5.445	2.52e-07	-0.056777	22	0.010428	no	BRNPTM
chr1_2366956_CAAAATACATAGA_C_b38	MORN1	-5.419	2.84e-07	-0.05648	22	0.010422	no	BRNPTM
chr1_2343517_G_A_b38	MORN1	-5.064	1.39e-06	-0.054223	20	0.010709	no	BRNPTM
chr1_2351241_C_T_b38	MORN1	-5.047	1.49e-06	-0.053079	22	0.010516	no	BRNPTM
chr1_2359882_C_CAA_b38	MORN1	4.837	3.69e-06	0.075878	4	0.015687	no	BRNPTM
chr1_2364484_C_T_b38	MORN1	-4.812	4.1e-06	-0.068968	5	0.014332	no	BRNPTM
chr1_2363405_C_T_b38	MORN1	4.716	6.16e-06	0.063107	12	0.013382	no	BRNPTM
chr1_2357811_C_G_b38	MORN1	-4.711	6.29e-06	-0.066048	4	0.01402	no	BRNPTM
chr1_2357812_T_C_b38	MORN1	-4.711	6.29e-06	-0.066048	4	0.01402	no	BRNPTM
chr1_2359828_A_G_b38	MORN1	-4.711	6.29e-06	-0.066048	4	0.01402	no	BRNPTM
chr1_2363591_T_G_b38	MORN1	-4.711	6.29e-06	-0.066048	4	0.01402	no	BRNPTM
chr1_2365220_A_G_b38	MORN1	-4.711	6.29e-06	-0.066048	4	0.01402	no	BRNPTM
chr1_2367871_C_T_b38	MORN1	-4.711	6.29e-06	-0.066048	4	0.01402	no	BRNPTM
chr1_2338659_A_G_b38	MORN1	4.697	6.65e-06	0.051927	39	0.011055	no	BRNPTM
chr1_2350539_T_G_b38	MORN1	-4.681	7.13e-06	-0.052761	32	0.011272	no	BRNPTM
chr1_2351551_C_T_b38	MORN1	4.68	7.16e-06	0.067858	7	0.014501	no	BRNPTM
chr1_2349222_G_A_b38	MORN1	-4.651	8.05e-06	-0.052886	38	0.01137	no	BRNPTM
chr1_2356095_C_T_b38	MORN1	4.647	8.19e-06	0.066788	8	0.014371	no	BRNPTM
chr1_2362718_G_A_b38	MORN1	4.646	8.25e-06	0.061161	11	0.013165	no	BRNPTM
chr1_2344932_C_A_b38	MORN1	-4.616	9.34e-06	-0.064854	4	0.014051	no	BRNPTM
chr1_2346676_G_C_b38	MORN1	-4.616	9.34e-06	-0.064854	4	0.014051	no	BRNPTM
chr1_2350287_A_C_b38	MORN1	-4.616	9.34e-06	-0.064854	4	0.014051	no	BRNPTM
chr1_2353047_C_T_b38	MORN1	-4.616	9.34e-06	-0.064854	4	0.014051	no	BRNPTM
chr1_2357882_G_A_b38	MORN1	4.514	1.41e-05	0.065559	8	0.014522	no	BRNPTM
chr1_2346801_C_T_b38	MORN1	-4.478	1.64e-05	-0.051212	38	0.011435	no	BRNPTM
chr1_2341705_A_G_b38	MORN1	4.468	1.71e-05	0.049949	37	0.011179	no	BRNPTM
chr1_2353743_A_T_b38	MORN1	4.452	1.82e-05	0.06089	13	0.013677	no	BRNPTM
chr1_2344634_T_C_b38	MORN1	4.424	2.04e-05	0.064204	7	0.014513	no	BRNPTM
chr1_2344761_T_A_b38	MORN1	4.424	2.04e-05	0.064204	7	0.014513	no	BRNPTM
chr1_2350934_C_T_b38	MORN1	4.424	2.04e-05	0.064204	7	0.014513	no	BRNPTM
chr1_2344256_A_T_b38	MORN1	4.386	2.38e-05	0.057435	8	0.013096	no	BRNPTM
chr1_2363829_A_T_b38	MORN1	-4.384	2.39e-05	-0.045515	24	0.010382	no	BRNPTM
chr1_2356409_G_C_b38	MORN1	4.364	2.59e-05	0.059031	11	0.013527	no	BRNPTM
chr1_2340807_G_A_b38	MORN1	4.337	2.89e-05	0.056051	9	0.012924	no	BRNPTM
chr1_2346111_G_C_b38	MORN1	-4.323	3.05e-05	-0.04877	31	0.011281	no	BRNPTM
chr1_2348378_C_T_b38	MORN1	4.303	3.3e-05	0.059618	9	0.013854	no	BRNPTM
chr1_2350696_G_A_b38	MORN1	4.303	3.3e-05	0.059618	9	0.013854	no	BRNPTM
chr1_2344757_C_A_b38	MORN1	4.247	4.12e-05	0.061542	7	0.014491	no	BRNPTM
chr1_2345727_G_A_b38	MORN1	4.247	4.12e-05	0.061542	7	0.014491	no	BRNPTM
chr1_2345148_G_A_b38	MORN1	-4.241	4.21e-05	-0.067487	3	0.015913	no	BRNPTM
chr1_2369336_A_G_b38	MORN1	-4.227	4.44e-05	-0.057147	7	0.013519	no	BRNPTM
chr1_2367055_C_A_b38	MORN1	4.21	4.76e-05	0.05768	9	0.013702	no	BRNPTM
chr1_2341451_G_A_b38	MORN1	4.207	4.82e-05	0.054536	9	0.012965	no	BRNPTM
chr1_2340564_G_A_b38	MORN1	4.19	5.14e-05	0.052492	10	0.012529	no	BRNPTM
chr1_2364499_A_G_b38	MORN1	4.13	6.47e-05	0.052375	14	0.01268	no	BRNPTM
chr1_2344583_G_A_b38	MORN1	4.102	7.22e-05	0.057722	7	0.014073	no	BRNPTM
chr1_2369713_ATAAT_A_b38	MORN1	-4.065	8.3e-05	-0.058358	4	0.014357	no	BRNPTM
chr1_2344932_C_T_b38	MORN1	4.059	8.49e-05	0.059596	6	0.014683	no	BRNPTM
chr1_2343445_C_T_b38	MORN1	4.035	9.28e-05	0.052239	9	0.012945	no	BRNPTM
chr1_2340625_G_A_b38	MORN1	3.928	0.000139	0.050278	10	0.012799	no	BRNPTM
chr1_2340235_T_C_b38	MORN1	3.889	0.00016	0.049622	9	0.012758	no	BRNPTM
chr1_2337211_C_G_b38	MORN1	3.831	0.000198	0.049612	14	0.012949	no	BRNPTM
chr1_2353459_T_G_b38	MORN1	3.827	0.000201	0.039876	36	0.010419	no	BRNPTM
chr1_2356177_T_C_b38	MORN1	3.827	0.000201	0.039876	36	0.010419	no	BRNPTM
chr1_2340764_G_T_b38	MORN1	3.819	0.000207	0.048931	9	0.012813	no	BRNPTM
chr1_2352457_A_G_b38	MORN1	3.741	0.000275	0.038833	38	0.010382	no	BRNPTM
chr1_2360716_T_C_b38	MORN1	3.741	0.000275	0.038833	38	0.010382	no	BRNPTM
chr1_2360970_T_C_b38	MORN1	3.741	0.000275	0.038833	38	0.010382	no	BRNPTM
chr1_2361332_A_AG_b38	MORN1	3.741	0.000275	0.038833	38	0.010382	no	BRNPTM
chr1_2361548_A_ACT_b38	MORN1	3.741	0.000275	0.038833	38	0.010382	no	BRNPTM
chr1_2359472_G_A_b38	MORN1	3.704	0.000313	0.038635	30	0.010431	no	BRNPTM
chr1_2358849_T_C_b38	MORN1	3.641	0.000392	0.037748	39	0.010368	no	BRNPTM
chr1_2352403_G_T_b38	MORN1	3.638	0.000396	0.037803	39	0.010392	no	BRNPTM
chr1_2338460_T_C_b38	MORN1	3.564	0.000512	0.044719	15	0.012547	no	BRNPTM
chr1_2338570_C_T_b38	MORN1	3.564	0.000512	0.044719	15	0.012547	no	BRNPTM
chr1_2363805_C_CAAACAA_b38	MORN1	3.542	0.000554	0.051086	9	0.014424	no	BRNPTM
chr1_1657902_T_TA_b38	MORN1	-3.431	0.00081	-0.071041	4	0.020708	no	BRNPTM
chr1_2179591_T_C_b38	MORN1	3.196	0.00175	0.038453	25	0.012031	no	BRNPTM
chr1_2340787_C_T_b38	MORN1	-3.049	0.00279	-0.035979	16	0.0118	no	BRNPTM
chr1_2181022_T_C_b38	MORN1	3.037	0.00289	0.0357	37	0.011756	no	BRNPTM
chr1_2471060_G_A_b38	MORN1	-3.02	0.00305	-0.033148	44	0.010976	no	BRNPTM
chr1_2369355_G_GA_b38	MORN1	-2.874	0.00474	-0.03398	20	0.011822	no	BRNPTM
chr1_2332063_T_C_b38	MORN1	2.862	0.00491	0.052573	4	0.018369	no	BRNPTM
chr1_2325494_G_A_b38	MORN1	2.842	0.00521	0.050354	4	0.017718	no	BRNPTM
chr1_2325768_C_A_b38	MORN1	2.842	0.00521	0.050354	4	0.017718	no	BRNPTM
chr1_2326256_G_A_b38	MORN1	2.842	0.00521	0.050354	4	0.017718	no	BRNPTM
chr1_2810257_G_C_b38	MORN1	2.811	0.00571	0.054434	3	0.019366	no	BRNPTM
chr1_2467710_A_G_b38	MORN1	-2.81	0.00572	-0.031796	41	0.011314	no	BRNPTM
chr1_2183219_A_AGTCTCC_b38	MORN1	2.782	0.00621	0.033759	24	0.012134	no	BRNPTM
chr1_2675482_T_C_b38	MORN1	2.777	0.0063	0.03581	29	0.012895	no	BRNPTM
chr1_2455662_C_T_b38	MORN1	-2.768	0.00646	-0.031491	42	0.011375	no	BRNPTM
chr1_1818305_T_TA_b38	MORN1	2.742	0.00698	0.03522	17	0.012846	no	BRNPTM
chr1_2329738_C_T_b38	MORN1	2.735	0.00712	0.047892	5	0.017512	no	BRNPTM
chr1_2314131_C_G_b38	MORN1	-2.735	0.00712	-0.035639	14	0.013032	no	BRNPTM
chr1_2326288_C_T_b38	MORN1	2.72	0.00742	0.031382	26	0.011535	no	BRNPTM
chr1_2326884_C_T_b38	MORN1	2.72	0.00742	0.031382	26	0.011535	no	BRNPTM
chr1_2314194_C_T_b38	MORN1	-2.697	0.00793	-0.035274	12	0.013078	no	BRNPTM
chr1_2333737_T_C_b38	MORN1	2.686	0.00817	0.032104	24	0.01195	no	BRNPTM
chr1_2313782_C_T_b38	MORN1	-2.682	0.00828	-0.035472	13	0.013227	no	BRNPTM
chr1_2327034_G_A_b38	MORN1	2.661	0.00878	0.031539	25	0.011853	no	BRNPTM
chr1_2314848_G_C_b38	MORN1	-2.654	0.00896	-0.035007	13	0.013191	no	BRNPTM
chr1_2334530_T_G_b38	MORN1	2.649	0.00907	0.03176	23	0.011988	no	BRNPTM
chr1_2326424_C_T_b38	MORN1	2.62	0.00985	0.030316	26	0.011571	no	BRNPTM
chr1_2694607_GAAACC_G_b38	MORN1	-3.3	0.00134	-0.069284	9	0.020993	yes	BRNSPC
chr1_2220171_C_CA_b38	MORN1	3.279	0.00143	0.078105	5	0.023816	yes	BRNSPC
chr1_3144719_C_A_b38	MORN1	2.977	0.00365	0.052658	23	0.017688	yes	BRNSPC
chr1_1586956_T_C_b38	MORN1	-2.951	0.00395	-0.060254	10	0.020421	yes	BRNSPC
chr1_1877316_A_AATATAT_b38	MORN1	-2.939	0.00409	-0.093495	3	0.031817	yes	BRNSPC
chr1_1489916_C_T_b38	MORN1	2.875	0.00493	0.081471	5	0.028334	yes	BRNSPC
chr1_1919773_C_T_b38	MORN1	2.807	0.006	0.07925	5	0.028229	yes	BRNSPC
chr1_1916092_C_T_b38	MORN1	2.8	0.00614	0.079754	4	0.028488	yes	BRNSPC
chr1_1916540_T_C_b38	MORN1	2.8	0.00614	0.079754	4	0.028488	yes	BRNSPC
chr1_1916721_A_G_b38	MORN1	2.8	0.00614	0.079754	4	0.028488	yes	BRNSPC
chr1_1917393_A_AAC_b38	MORN1	2.8	0.00614	0.079754	4	0.028488	yes	BRNSPC
chr1_1918091_T_C_b38	MORN1	2.8	0.00614	0.079754	4	0.028488	yes	BRNSPC
chr1_1918305_G_A_b38	MORN1	2.8	0.00614	0.079754	4	0.028488	yes	BRNSPC
chr1_1919475_A_G_b38	MORN1	2.8	0.00614	0.079754	4	0.028488	yes	BRNSPC
chr1_1921945_G_A_b38	MORN1	2.8	0.00614	0.079754	4	0.028488	yes	BRNSPC
chr1_1921955_T_C_b38	MORN1	2.8	0.00614	0.079754	4	0.028488	yes	BRNSPC
chr1_1922149_C_T_b38	MORN1	2.8	0.00614	0.079754	4	0.028488	yes	BRNSPC
chr1_1924931_G_A_b38	MORN1	2.8	0.00614	0.079754	4	0.028488	yes	BRNSPC
chr1_1929558_G_A_b38	MORN1	2.8	0.00614	0.079754	4	0.028488	yes	BRNSPC
chr1_1930002_T_C_b38	MORN1	2.8	0.00614	0.079754	4	0.028488	yes	BRNSPC
chr1_1939898_G_A_b38	MORN1	2.8	0.00614	0.079754	4	0.028488	yes	BRNSPC
chr1_1943993_C_A_b38	MORN1	2.8	0.00614	0.079754	4	0.028488	yes	BRNSPC
chr1_1933640_C_T_b38	MORN1	2.793	0.00625	0.078116	4	0.027964	yes	BRNSPC
chr1_2838732_C_G_b38	MORN1	2.762	0.00684	0.043827	31	0.015868	yes	BRNSPC
chr1_2838415_T_G_b38	MORN1	2.698	0.0082	0.042485	35	0.01575	yes	BRNSPC
chr1_1939322_T_G_b38	MORN1	2.674	0.00875	0.0741	4	0.027709	yes	BRNSPC
chr1_1587352_A_G_b38	MORN1	-2.662	0.00905	-0.051136	18	0.019208	yes	BRNSPC
chr1_1586425_A_G_b38	MORN1	-2.642	0.00956	-0.051462	18	0.019477	yes	BRNSPC
chr1_1918697_C_T_b38	MORN1	-3.084	0.00264	-0.060814	7	0.019721	no	BRNSPC
chr1_1915022_C_T_b38	MORN1	-2.963	0.00381	-0.059297	6	0.020013	no	BRNSPC
chr1_1929306_C_T_b38	MORN1	-2.822	0.00575	-0.060546	4	0.021453	no	BRNSPC
chr1_2043528_G_A_b38	MORN1	-2.719	0.00772	-0.083833	3	0.03083	no	BRNSPC
chr1_1928119_T_C_b38	MORN1	-2.709	0.00795	-0.058126	4	0.021459	no	BRNSPC
chr1_1924659_C_T_b38	MORN1	-2.67	0.00885	-0.054748	6	0.020504	no	BRNSPC
chr1_2343699_C_T_b38	MORN1	-3.443	0.000882	-0.054774	19	0.015908	yes	BRNSNG
chr1_2350287_A_C_b38	MORN1	-3.298	0.0014	-0.063679	5	0.019307	yes	BRNSNG
chr1_2351241_C_T_b38	MORN1	-3.276	0.00151	-0.053167	19	0.016231	yes	BRNSNG
chr1_2343517_G_A_b38	MORN1	-3.26	0.00158	-0.052538	19	0.016114	yes	BRNSNG
chr1_1638879_C_T_b38	MORN1	-3.257	0.0016	-0.066708	3	0.02048	yes	BRNSNG
chr1_1606532_G_A_b38	MORN1	-3.217	0.00181	-0.054297	12	0.016878	yes	BRNSNG
chr1_2368473_T_C_b38	MORN1	-3.171	0.00209	-0.048031	25	0.015148	yes	BRNSNG
chr1_2345148_G_A_b38	MORN1	-3.16	0.00216	-0.067753	4	0.02144	yes	BRNSNG
chr1_1606536_GCT_G_b38	MORN1	-3.152	0.00222	-0.052123	13	0.016537	yes	BRNSNG
chr1_1606539_G_GCC_b38	MORN1	-3.152	0.00222	-0.052123	13	0.016537	yes	BRNSNG
chr1_2367872_A_G_b38	MORN1	-3.147	0.00225	-0.047647	24	0.015138	yes	BRNSNG
chr1_2368188_T_C_b38	MORN1	-3.147	0.00225	-0.047647	24	0.015138	yes	BRNSNG
chr1_1639685_G_A_b38	MORN1	-3.124	0.00242	-0.064861	3	0.020762	yes	BRNSNG
chr1_1661177_A_G_b38	MORN1	-3.121	0.00244	-0.064299	4	0.020604	yes	BRNSNG
chr1_2344932_C_A_b38	MORN1	-3.111	0.00251	-0.060642	5	0.019493	yes	BRNSNG
chr1_2346676_G_C_b38	MORN1	-3.111	0.00251	-0.060642	5	0.019493	yes	BRNSNG
chr1_2353047_C_T_b38	MORN1	-3.111	0.00251	-0.060642	5	0.019493	yes	BRNSNG
chr1_2366816_A_G_b38	MORN1	-3.1	0.0026	-0.049042	20	0.015821	yes	BRNSNG
chr1_1667948_A_G_b38	MORN1	-3.094	0.00264	-0.064732	4	0.020919	yes	BRNSNG
chr1_2364339_A_C_b38	MORN1	-3.069	0.00286	-0.048106	21	0.015676	yes	BRNSNG
chr1_2364484_C_T_b38	MORN1	-3.019	0.00332	-0.063082	5	0.020898	yes	BRNSNG
chr1_2352756_T_C_b38	MORN1	-3.015	0.00336	-0.048334	19	0.01603	yes	BRNSNG
chr1_2348700_C_T_b38	MORN1	-3.012	0.00339	-0.050971	15	0.016923	yes	BRNSNG
chr1_2357811_C_G_b38	MORN1	-2.951	0.00405	-0.058359	5	0.019773	yes	BRNSNG
chr1_2357812_T_C_b38	MORN1	-2.951	0.00405	-0.058359	5	0.019773	yes	BRNSNG
chr1_2359828_A_G_b38	MORN1	-2.951	0.00405	-0.058359	5	0.019773	yes	BRNSNG
chr1_2363591_T_G_b38	MORN1	-2.951	0.00405	-0.058359	5	0.019773	yes	BRNSNG
chr1_2437267_T_C_b38	MORN1	2.885	0.00492	0.050887	12	0.017639	yes	BRNSNG
chr1_3146121_G_C_b38	MORN1	-2.879	0.00501	-0.050372	9	0.017499	yes	BRNSNG
chr1_1668717_C_G_b38	MORN1	-2.871	0.00513	-0.0612	4	0.021317	yes	BRNSNG
chr1_1669576_G_A_b38	MORN1	-2.871	0.00513	-0.0612	4	0.021317	yes	BRNSNG
chr1_1669613_G_A_b38	MORN1	-2.871	0.00513	-0.0612	4	0.021317	yes	BRNSNG
chr1_1665061_C_T_b38	MORN1	-2.862	0.00526	-0.060504	4	0.021143	yes	BRNSNG
chr1_2366956_CAAAATACATAGA_C_b38	MORN1	-2.861	0.00528	-0.044741	22	0.01564	yes	BRNSNG
chr1_3201114_G_C_b38	MORN1	-2.857	0.00534	-0.058841	12	0.020598	yes	BRNSNG
chr1_2365220_A_G_b38	MORN1	-2.856	0.00536	-0.055794	5	0.019539	yes	BRNSNG
chr1_2367871_C_T_b38	MORN1	-2.856	0.00536	-0.055794	5	0.019539	yes	BRNSNG
chr1_1606559_C_G_b38	MORN1	-2.834	0.0057	-0.044619	15	0.015745	yes	BRNSNG
chr1_1665581_C_G_b38	MORN1	-2.828	0.00579	-0.057093	5	0.020185	yes	BRNSNG
chr1_1668542_C_T_b38	MORN1	-2.785	0.00655	-0.060861	3	0.021853	yes	BRNSNG
chr1_1658830_C_G_b38	MORN1	-2.767	0.0069	-0.055741	5	0.020146	yes	BRNSNG
chr1_1716919_CTT_C_b38	MORN1	-2.762	0.00699	-0.055642	8	0.020145	yes	BRNSNG
chr1_2471060_G_A_b38	MORN1	2.742	0.0074	0.0422	30	0.015392	yes	BRNSNG
chr1_1594614_G_C_b38	MORN1	-2.73	0.00764	-0.045092	17	0.016515	yes	BRNSNG
chr1_1605347_C_T_b38	MORN1	-2.73	0.00764	-0.045092	17	0.016515	yes	BRNSNG
chr1_2342466_T_C_b38	MORN1	-2.721	0.00785	-0.045278	19	0.016642	yes	BRNSNG
chr1_2365333_G_A_b38	MORN1	-2.72	0.00787	-0.044223	19	0.016259	yes	BRNSNG
chr1_2469925_T_G_b38	MORN1	2.694	0.00846	0.044762	16	0.016616	yes	BRNSNG
chr1_3283435_T_C_b38	MORN1	2.687	0.00862	0.059945	10	0.022309	yes	BRNSNG
chr1_2389131_A_AAAG_b38	MORN1	-2.66	0.00927	-0.038994	25	0.014657	yes	BRNSNG
chr1_1597462_C_T_b38	MORN1	-2.655	0.00941	-0.048122	10	0.018124	yes	BRNSNG
chr1_2366243_C_T_b38	MORN1	-2.644	0.0097	-0.042545	19	0.01609	yes	BRNSNG
chr1_2366496_A_T_b38	MORN1	-2.644	0.0097	-0.042545	19	0.01609	yes	BRNSNG
chr1_2367799_C_T_b38	MORN1	-2.644	0.0097	-0.042545	19	0.01609	yes	BRNSNG
chr1_2368939_G_C_b38	MORN1	-2.644	0.0097	-0.042545	19	0.01609	yes	BRNSNG
chr1_2466668_C_T_b38	MORN1	2.642	0.00976	0.046256	8	0.017509	yes	BRNSNG
chr1_3200876_A_G_b38	MORN1	-3.917	0.000177	-0.097438	4	0.024877	no	BRNSNG
chr1_1606552_A_G_b38	MORN1	-3.488	0.000763	-0.05538	15	0.015879	no	BRNSNG
chr1_1816644_CT_C_b38	MORN1	3.485	0.00077	0.064209	17	0.018426	no	BRNSNG
chr1_2416027_C_T_b38	MORN1	3.364	0.00114	0.067259	4	0.019996	no	BRNSNG
chr1_2417420_T_TTCCCAGCC_b38	MORN1	3.364	0.00114	0.067259	4	0.019996	no	BRNSNG
chr1_2420440_C_T_b38	MORN1	3.364	0.00114	0.067259	4	0.019996	no	BRNSNG
chr1_2420707_C_T_b38	MORN1	3.364	0.00114	0.067259	4	0.019996	no	BRNSNG
chr1_3373407_C_T_b38	MORN1	-3.234	0.00172	-0.048393	23	0.014965	no	BRNSNG
chr1_3374575_A_C_b38	MORN1	-3.208	0.00187	-0.046544	28	0.01451	no	BRNSNG
chr1_2040323_A_G_b38	MORN1	-3.095	0.00264	-0.079285	3	0.025621	no	BRNSNG
chr1_2416137_G_T_b38	MORN1	3.072	0.00283	0.063845	3	0.020785	no	BRNSNG
chr1_3390834_GT_G_b38	MORN1	3.037	0.00314	0.060068	4	0.019776	no	BRNSNG
chr1_2419962_TC_T_b38	MORN1	3.036	0.00315	0.06352	3	0.020919	no	BRNSNG
chr1_2043528_G_A_b38	MORN1	-3.015	0.00335	-0.082123	3	0.027235	no	BRNSNG
chr1_1616048_C_T_b38	MORN1	-2.931	0.00431	-0.046452	19	0.01585	no	BRNSNG
chr1_1628409_C_A_b38	MORN1	-2.796	0.00635	-0.045146	18	0.016146	no	BRNSNG
chr1_1628814_C_T_b38	MORN1	-2.796	0.00635	-0.045146	18	0.016146	no	BRNSNG
chr1_1608603_C_A_b38	MORN1	-2.691	0.00853	-0.043687	18	0.016237	no	BRNSNG
chr1_1609070_G_A_b38	MORN1	-2.691	0.00853	-0.043687	18	0.016237	no	BRNSNG
chr1_1610924_C_T_b38	MORN1	-2.691	0.00853	-0.043687	18	0.016237	no	BRNSNG
chr1_1609196_CA_C_b38	MORN1	2.689	0.00856	0.050449	8	0.018758	no	BRNSNG
chr1_1622510_C_T_b38	MORN1	-2.689	0.00858	-0.044699	17	0.016626	no	BRNSNG
chr1_2011271_G_GT_b38	MORN1	-2.678	0.00883	-0.046303	21	0.017289	no	BRNSNG
chr1_1613090_A_G_b38	MORN1	-2.663	0.00921	-0.04331	18	0.016264	no	BRNSNG
chr1_1624720_G_A_b38	MORN1	-2.639	0.00983	-0.042928	18	0.016266	no	BRNSNG
chr1_2369210_C_T_b38	MORN1	-7.113	7.3e-12	-0.06808	49	0.009572	yes	BREAST
chr1_2363829_A_T_b38	MORN1	-6.806	4.84e-11	-0.064637	39	0.009497	yes	BREAST
chr1_2350750_AGGGGTGGCACG_A_b38	MORN1	-6.333	8e-10	-0.073286	13	0.011572	yes	BREAST
chr1_2367456_C_CAA_b38	MORN1	-6.29	1.02e-09	-0.065627	28	0.010434	yes	BREAST
chr1_2351678_C_T_b38	MORN1	-5.788	1.68e-08	-0.073031	10	0.012618	yes	BREAST
chr1_2348393_G_A_b38	MORN1	-5.738	2.19e-08	-0.069303	11	0.012077	yes	BREAST
chr1_2351215_T_G_b38	MORN1	-5.446	1.02e-07	-0.06901	10	0.012671	yes	BREAST
chr1_2362229_A_G_b38	MORN1	-5.327	1.87e-07	-0.068476	9	0.012854	yes	BREAST
chr1_2354645_C_T_b38	MORN1	-5.325	1.89e-07	-0.068233	9	0.012814	yes	BREAST
chr1_2362863_C_CA_b38	MORN1	-5.323	1.9e-07	-0.069635	8	0.013081	yes	BREAST
chr1_2347212_C_T_b38	MORN1	-5.322	1.92e-07	-0.067018	9	0.012594	yes	BREAST
chr1_2380956_C_T_b38	MORN1	-5.031	8.1e-07	-0.055517	22	0.011036	yes	BREAST
chr1_2382101_A_G_b38	MORN1	-5.031	8.1e-07	-0.055517	22	0.011036	yes	BREAST
chr1_2352403_G_T_b38	MORN1	4.937	1.27e-06	0.044246	96	0.008962	yes	BREAST
chr1_2352457_A_G_b38	MORN1	4.916	1.4e-06	0.044192	97	0.00899	yes	BREAST
chr1_2353459_T_G_b38	MORN1	4.903	1.49e-06	0.044271	96	0.009029	yes	BREAST
chr1_2356177_T_C_b38	MORN1	4.903	1.49e-06	0.044271	96	0.009029	yes	BREAST
chr1_2392569_C_T_b38	MORN1	-4.885	1.62e-06	-0.053288	21	0.010908	yes	BREAST
chr1_2360716_T_C_b38	MORN1	4.716	3.58e-06	0.042448	96	0.009001	yes	BREAST
chr1_2360970_T_C_b38	MORN1	4.716	3.58e-06	0.042448	96	0.009001	yes	BREAST
chr1_2361332_A_AG_b38	MORN1	4.716	3.58e-06	0.042448	96	0.009001	yes	BREAST
chr1_2361548_A_ACT_b38	MORN1	4.716	3.58e-06	0.042448	96	0.009001	yes	BREAST
chr1_2358849_T_C_b38	MORN1	4.535	8.11e-06	0.040844	97	0.009006	yes	BREAST
chr1_2357308_T_C_b38	MORN1	4.378	1.62e-05	0.039615	102	0.00905	yes	BREAST
chr1_2349222_G_A_b38	MORN1	-4.371	1.67e-05	-0.041775	92	0.009558	yes	BREAST
chr1_2346801_C_T_b38	MORN1	-4.366	1.7e-05	-0.042035	92	0.009628	yes	BREAST
chr1_2367644_G_A_b38	MORN1	-3.887	0.000123	-0.038625	55	0.009936	yes	BREAST
chr1_2362718_G_A_b38	MORN1	3.878	0.000128	0.039238	34	0.010118	yes	BREAST
chr1_2369355_G_GA_b38	MORN1	-3.845	0.000145	-0.042854	30	0.011144	yes	BREAST
chr1_2343937_T_G_b38	MORN1	-3.821	0.000159	-0.037492	58	0.009813	yes	BREAST
chr1_2164801_G_C_b38	MORN1	3.803	0.000171	0.055354	5	0.014556	yes	BREAST
chr1_2164982_T_C_b38	MORN1	3.803	0.000171	0.055354	5	0.014556	yes	BREAST
chr1_2165199_C_T_b38	MORN1	3.803	0.000171	0.055354	5	0.014556	yes	BREAST
chr1_2166938_G_C_b38	MORN1	3.803	0.000171	0.055354	5	0.014556	yes	BREAST
chr1_2167392_G_C_b38	MORN1	3.803	0.000171	0.055354	5	0.014556	yes	BREAST
chr1_2348378_C_T_b38	MORN1	3.801	0.000172	0.039446	32	0.010378	yes	BREAST
chr1_2350696_G_A_b38	MORN1	3.801	0.000172	0.039446	32	0.010378	yes	BREAST
chr1_2364499_A_G_b38	MORN1	3.762	2e-04	0.037298	41	0.009914	yes	BREAST
chr1_2144375_C_T_b38	MORN1	3.674	0.00028	0.053297	5	0.014508	yes	BREAST
chr1_2151066_C_T_b38	MORN1	3.674	0.00028	0.053297	5	0.014508	yes	BREAST
chr1_2156118_T_C_b38	MORN1	3.674	0.00028	0.053297	5	0.014508	yes	BREAST
chr1_2157493_C_T_b38	MORN1	3.674	0.00028	0.053297	5	0.014508	yes	BREAST
chr1_2155277_GTGA_G_b38	MORN1	3.595	0.000375	0.05139	6	0.014295	yes	BREAST
chr1_2363405_C_T_b38	MORN1	3.565	0.000418	0.035989	41	0.010094	yes	BREAST
chr1_2166847_C_T_b38	MORN1	3.565	0.000418	0.050944	6	0.014288	yes	BREAST
chr1_2160844_C_T_b38	MORN1	3.552	0.00044	0.051172	6	0.014408	yes	BREAST
chr1_2150203_C_A_b38	MORN1	3.54	0.000459	0.048142	7	0.0136	yes	BREAST
chr1_2356409_G_C_b38	MORN1	3.524	0.000486	0.036654	38	0.010401	yes	BREAST
chr1_2138661_C_T_b38	MORN1	3.498	0.000534	0.051125	5	0.014615	yes	BREAST
chr1_2419962_TC_T_b38	MORN1	3.474	0.000583	0.042955	12	0.012366	yes	BREAST
chr1_2186119_C_T_b38	MORN1	3.45	0.000635	0.048656	5	0.014105	yes	BREAST
chr1_2151390_G_A_b38	MORN1	3.448	0.000639	0.051928	5	0.015061	yes	BREAST
chr1_2142665_G_T_b38	MORN1	3.441	0.000655	0.049007	6	0.014241	yes	BREAST
chr1_2145827_G_A_b38	MORN1	3.441	0.000655	0.049007	6	0.014241	yes	BREAST
chr1_2140299_C_T_b38	MORN1	3.439	0.00066	0.050141	5	0.014581	yes	BREAST
chr1_2164950_A_C_b38	MORN1	3.408	0.000736	0.050975	5	0.014957	yes	BREAST
chr1_2174439_G_A_b38	MORN1	3.408	0.000736	0.050975	5	0.014957	yes	BREAST
chr1_2137467_G_T_b38	MORN1	-3.404	0.000746	-0.049499	6	0.014539	yes	BREAST
chr1_2416398_G_GCGACA_b38	MORN1	3.402	0.000753	0.037836	24	0.011122	yes	BREAST
chr1_2175551_ACTCCAACCCCTACACCCCCAACCC_A_b38	MORN1	3.354	0.00089	0.050681	5	0.01511	yes	BREAST
chr1_2169620_C_G_b38	MORN1	3.331	0.000965	0.047095	6	0.014138	yes	BREAST
chr1_2197209_G_A_b38	MORN1	3.33	0.000967	0.05026	5	0.015091	yes	BREAST
chr1_2197362_G_C_b38	MORN1	3.33	0.000967	0.05026	5	0.015091	yes	BREAST
chr1_2197378_G_GA_b38	MORN1	3.33	0.000967	0.05026	5	0.015091	yes	BREAST
chr1_2197391_G_A_b38	MORN1	3.33	0.000967	0.05026	5	0.015091	yes	BREAST
chr1_2207111_G_C_b38	MORN1	3.251	0.00127	0.050029	5	0.015389	yes	BREAST
chr1_2353743_A_T_b38	MORN1	3.188	0.00157	0.033057	45	0.010368	yes	BREAST
chr1_2359882_C_CAA_b38	MORN1	3.176	0.00164	0.037404	18	0.011778	yes	BREAST
chr1_3303808_G_A_b38	MORN1	-3.135	0.00188	-0.084028	6	0.026804	yes	BREAST
chr1_2175616_T_C_b38	MORN1	3.121	0.00197	0.046135	5	0.014783	yes	BREAST
chr1_2340267_T_C_b38	MORN1	3.013	0.00279	0.037607	14	0.012482	yes	BREAST
chr1_2398369_A_G_b38	MORN1	-3.01	0.00281	-0.055835	3	0.018547	yes	BREAST
chr1_1948121_T_G_b38	MORN1	-2.869	0.00439	-0.032442	25	0.011309	yes	BREAST
chr1_2617426_C_CA_b38	MORN1	2.841	0.00478	0.058778	5	0.020686	yes	BREAST
chr1_2350943_C_T_b38	MORN1	2.841	0.00478	0.035828	13	0.012609	yes	BREAST
chr1_2345829_C_CCACACA_b38	MORN1	-2.839	0.00481	-0.043595	4	0.015356	yes	BREAST
chr1_1428763_A_G_b38	MORN1	2.837	0.00484	0.048796	11	0.017199	yes	BREAST
chr1_2357882_G_A_b38	MORN1	2.828	0.00498	0.032387	18	0.011453	yes	BREAST
chr1_2514580_G_GGGGCAGGGTGGGGGCTGGCCGTTGGGGGCTGCCCA_b38	MORN1	-2.776	0.00581	-0.064406	13	0.023197	yes	BREAST
chr1_2351874_C_G_b38	MORN1	2.768	0.00597	0.034929	13	0.01262	yes	BREAST
chr1_2354291_A_G_b38	MORN1	2.768	0.00597	0.034929	13	0.01262	yes	BREAST
chr1_2348949_CCT_C_b38	MORN1	2.768	0.00597	0.03503	13	0.012657	yes	BREAST
chr1_2347995_C_T_b38	MORN1	2.72	0.00688	0.034439	13	0.012662	yes	BREAST
chr1_3175767_A_G_b38	MORN1	2.681	0.0077	0.049598	3	0.018497	yes	BREAST
chr1_3067399_G_A_b38	MORN1	2.659	0.00823	0.027567	36	0.010369	yes	BREAST
chr1_2967367_T_C_b38	MORN1	2.612	0.00943	0.029827	29	0.011421	yes	BREAST
chr1_2348703_A_G_b38	MORN1	2.611	0.00945	0.033346	13	0.012772	yes	BREAST
chr1_2367872_A_G_b38	MORN1	-7.935	3.45e-14	-0.072911	44	0.009189	no	BREAST
chr1_2368188_T_C_b38	MORN1	-7.844	6.33e-14	-0.072205	44	0.009205	no	BREAST
chr1_2364339_A_C_b38	MORN1	-7.799	8.56e-14	-0.072535	42	0.009301	no	BREAST
chr1_2366956_CAAAATACATAGA_C_b38	MORN1	-7.764	1.08e-13	-0.071818	42	0.00925	no	BREAST
chr1_2366816_A_G_b38	MORN1	-7.742	1.25e-13	-0.072168	41	0.009322	no	BREAST
chr1_2366555_G_C_b38	MORN1	-7.487	6.7e-13	-0.071381	39	0.009535	no	BREAST
chr1_2368939_G_C_b38	MORN1	-7.428	9.8e-13	-0.070821	39	0.009535	no	BREAST
chr1_2368473_T_C_b38	MORN1	-7.428	9.82e-13	-0.069387	47	0.009342	no	BREAST
chr1_2365333_G_A_b38	MORN1	-7.381	1.33e-12	-0.070179	39	0.009509	no	BREAST
chr1_2367799_C_T_b38	MORN1	-7.376	1.37e-12	-0.070587	39	0.00957	no	BREAST
chr1_2365236_C_T_b38	MORN1	-7.359	1.53e-12	-0.069402	40	0.009431	no	BREAST
chr1_2366496_A_T_b38	MORN1	-7.348	1.64e-12	-0.070149	39	0.009547	no	BREAST
chr1_2366243_C_T_b38	MORN1	-7.34	1.72e-12	-0.070408	38	0.009592	no	BREAST
chr1_2367197_G_A_b38	MORN1	-7.292	2.34e-12	-0.069645	38	0.009551	no	BREAST
chr1_2352756_T_C_b38	MORN1	-7.184	4.64e-12	-0.06917	39	0.009628	no	BREAST
chr1_2368718_C_A_b38	MORN1	-7.069	9.61e-12	-0.067513	39	0.009551	no	BREAST
chr1_2351241_C_T_b38	MORN1	-6.942	2.11e-11	-0.067758	40	0.009761	no	BREAST
chr1_2343517_G_A_b38	MORN1	-6.751	6.77e-11	-0.067422	37	0.009987	no	BREAST
chr1_2343699_C_T_b38	MORN1	-6.593	1.74e-10	-0.065854	37	0.009988	no	BREAST
chr1_2348700_C_T_b38	MORN1	-6.52	2.68e-10	-0.065127	37	0.009988	no	BREAST
chr1_2340787_C_T_b38	MORN1	-5.762	1.93e-08	-0.05684	32	0.009865	no	BREAST
chr1_2354688_G_C_b38	MORN1	-5.514	7.17e-08	-0.070786	9	0.012838	no	BREAST
chr1_2364657_A_T_b38	MORN1	-5.4	1.29e-07	-0.04982	87	0.009227	no	BREAST
chr1_2364658_A_T_b38	MORN1	-5.4	1.29e-07	-0.04982	87	0.009227	no	BREAST
chr1_2366021_T_C_b38	MORN1	-5.38	1.43e-07	-0.050264	84	0.009343	no	BREAST
chr1_2369118_G_A_b38	MORN1	-4.991	9.82e-07	-0.063231	11	0.01267	no	BREAST
chr1_2350539_T_G_b38	MORN1	-4.697	3.9e-06	-0.043711	90	0.009306	no	BREAST
chr1_2359472_G_A_b38	MORN1	4.306	2.2e-05	0.038968	68	0.00905	no	BREAST
chr1_2342133_C_G_b38	MORN1	-4.225	3.11e-05	-0.054347	10	0.012864	no	BREAST
chr1_2342137_G_A_b38	MORN1	-4.225	3.11e-05	-0.054347	10	0.012864	no	BREAST
chr1_2338659_A_G_b38	MORN1	4.119	4.84e-05	0.037138	82	0.009017	no	BREAST
chr1_2341705_A_G_b38	MORN1	4.068	5.95e-05	0.036953	90	0.009083	no	BREAST
chr1_2377078_C_G_b38	MORN1	-4.005	7.68e-05	-0.063463	4	0.015845	no	BREAST
chr1_2382880_T_C_b38	MORN1	-3.83	0.000154	-0.059742	4	0.015599	no	BREAST
chr1_2342734_T_C_b38	MORN1	-3.649	0.000306	-0.04189	17	0.01148	no	BREAST
chr1_2347542_C_T_b38	MORN1	-3.61	0.000354	-0.034957	69	0.009683	no	BREAST
chr1_2416027_C_T_b38	MORN1	3.572	0.000408	0.040538	23	0.011349	no	BREAST
chr1_2337352_A_G_b38	MORN1	3.518	0.000497	0.032773	64	0.009316	no	BREAST
chr1_2416137_G_T_b38	MORN1	3.416	0.000716	0.03985	21	0.011666	no	BREAST
chr1_2420707_C_T_b38	MORN1	3.393	0.000777	0.039548	20	0.011656	no	BREAST
chr1_2417420_T_TTCCCAGCC_b38	MORN1	3.365	0.000858	0.038857	21	0.011548	no	BREAST
chr1_2344761_T_C_b38	MORN1	3.303	0.00106	0.036985	30	0.011198	no	BREAST
chr1_2389263_T_C_b38	MORN1	-3.293	0.0011	-0.03802	23	0.011545	no	BREAST
chr1_2369336_A_G_b38	MORN1	-3.188	0.00157	-0.038474	13	0.012069	no	BREAST
chr1_2391602_T_C_b38	MORN1	-3.164	0.0017	-0.034192	27	0.010807	no	BREAST
chr1_2345442_G_A_b38	MORN1	3.125	0.00194	0.073853	7	0.02363	no	BREAST
chr1_2345953_G_A_b38	MORN1	3.125	0.00194	0.073853	7	0.02363	no	BREAST
chr1_2367055_C_A_b38	MORN1	3.068	0.00234	0.034069	19	0.011105	no	BREAST
chr1_2357811_C_G_b38	MORN1	-3.052	0.00246	-0.039261	7	0.012862	no	BREAST
chr1_2357812_T_C_b38	MORN1	-3.052	0.00246	-0.039261	7	0.012862	no	BREAST
chr1_2359828_A_G_b38	MORN1	-3.052	0.00246	-0.039261	7	0.012862	no	BREAST
chr1_2363591_T_G_b38	MORN1	-3.052	0.00246	-0.039261	7	0.012862	no	BREAST
chr1_2341692_GAAA_G_b38	MORN1	3.039	0.00257	0.038611	13	0.012707	no	BREAST
chr1_2337299_A_G_b38	MORN1	3.034	0.0026	0.028303	57	0.009327	no	BREAST
chr1_2367871_C_T_b38	MORN1	-3.032	0.00263	-0.039092	7	0.012894	no	BREAST
chr1_2420440_C_T_b38	MORN1	3.026	0.00267	0.034485	23	0.011395	no	BREAST
chr1_2346676_G_C_b38	MORN1	-3.006	0.00285	-0.039013	7	0.012977	no	BREAST
chr1_2350287_A_C_b38	MORN1	-3.006	0.00285	-0.039013	7	0.012977	no	BREAST
chr1_2353047_C_T_b38	MORN1	-3.006	0.00285	-0.039013	7	0.012977	no	BREAST
chr1_2141345_CTTTTTT_C_b38	MORN1	2.996	0.00294	0.046544	4	0.015534	no	BREAST
chr1_2341042_C_T_b38	MORN1	2.994	0.00297	0.038433	12	0.012838	no	BREAST
chr1_2344932_C_A_b38	MORN1	-2.989	0.00301	-0.038981	7	0.01304	no	BREAST
chr1_2369713_ATAAT_A_b38	MORN1	-2.977	0.00313	-0.036052	11	0.012111	no	BREAST
chr1_2415084_G_C_b38	MORN1	2.976	0.00314	0.033317	23	0.011195	no	BREAST
chr1_2415085_T_C_b38	MORN1	2.976	0.00314	0.033317	23	0.011195	no	BREAST
chr1_3147001_T_C_b38	MORN1	-2.966	0.00324	-0.058472	19	0.019715	no	BREAST
chr1_2356095_C_T_b38	MORN1	2.949	0.00342	0.034002	17	0.01153	no	BREAST
chr1_2359882_C_CA_b38	MORN1	-2.934	0.00359	-0.034252	17	0.011675	no	BREAST
chr1_2360913_G_A_b38	MORN1	2.934	0.00359	0.033626	27	0.011462	no	BREAST
chr1_2309937_C_CT_b38	MORN1	-2.932	0.00361	-0.026154	107	0.008921	no	BREAST
chr1_2758260_G_C_b38	MORN1	-2.916	0.00379	-0.076173	4	0.02612	no	BREAST
chr1_2472817_C_T_b38	MORN1	2.896	0.00403	0.028268	50	0.00976	no	BREAST
chr1_2297717_C_T_b38	MORN1	-2.886	0.00416	-0.034965	13	0.012114	no	BREAST
chr1_2205151_C_A_b38	MORN1	2.864	0.00446	0.045394	9	0.01585	no	BREAST
chr1_1425095_A_G_b38	MORN1	2.831	0.00493	0.064679	5	0.022849	no	BREAST
chr1_2370252_G_A_b38	MORN1	2.822	0.00506	0.034632	11	0.012271	no	BREAST
chr1_3345361_G_A_b38	MORN1	2.819	0.00512	0.048736	3	0.017291	no	BREAST
chr1_2351551_C_T_b38	MORN1	2.806	0.00532	0.032272	16	0.011502	no	BREAST
chr1_2346111_G_C_b38	MORN1	-2.754	0.00622	-0.026174	71	0.009504	no	BREAST
chr1_2344634_T_C_b38	MORN1	2.729	0.00671	0.031424	16	0.011517	no	BREAST
chr1_2275005_A_G_b38	MORN1	2.727	0.00674	0.02986	26	0.010949	no	BREAST
chr1_2808134_G_A_b38	MORN1	-2.68	0.00774	-0.059959	4	0.022373	no	BREAST
chr1_2422961_C_T_b38	MORN1	2.678	0.00779	0.040843	4	0.015253	no	BREAST
chr1_2379954_A_G_b38	MORN1	-2.669	0.00799	-0.029043	27	0.010882	no	BREAST
chr1_2298478_C_T_b38	MORN1	-2.641	0.00867	-0.031945	13	0.012096	no	BREAST
chr1_2423124_C_T_b38	MORN1	2.622	0.00914	0.040064	4	0.015278	no	BREAST
chr1_2383024_G_T_b38	MORN1	-8.465	4.53e-16	-0.048425	57	0.00572	yes	CULTFB
chr1_2383716_CA_C_b38	MORN1	-8.465	4.53e-16	-0.048425	57	0.00572	yes	CULTFB
chr1_2375533_G_A_b38	MORN1	-7.874	3.07e-14	-0.04598	54	0.005839	yes	CULTFB
chr1_2383824_C_G_b38	MORN1	-7.843	3.8e-14	-0.042951	71	0.005476	yes	CULTFB
chr1_2392897_T_C_b38	MORN1	-7.822	4.41e-14	-0.043807	59	0.0056	yes	CULTFB
chr1_2371472_G_A_b38	MORN1	-7.502	3.9e-13	-0.047943	27	0.00639	yes	CULTFB
chr1_2385630_A_C_b38	MORN1	-7.407	7.38e-13	-0.044192	50	0.005966	yes	CULTFB
chr1_2372759_GACC_G_b38	MORN1	-7.309	1.41e-12	-0.043466	55	0.005947	yes	CULTFB
chr1_2372762_C_CTG_b38	MORN1	-7.309	1.41e-12	-0.043466	55	0.005947	yes	CULTFB
chr1_2357811_C_G_b38	MORN1	-7.192	3.04e-12	-0.051945	14	0.007223	yes	CULTFB
chr1_2357812_T_C_b38	MORN1	-7.192	3.04e-12	-0.051945	14	0.007223	yes	CULTFB
chr1_2359828_A_G_b38	MORN1	-7.192	3.04e-12	-0.051945	14	0.007223	yes	CULTFB
chr1_2363591_T_G_b38	MORN1	-7.192	3.04e-12	-0.051945	14	0.007223	yes	CULTFB
chr1_2344932_C_A_b38	MORN1	-7.15	3.99e-12	-0.05209	13	0.007286	yes	CULTFB
chr1_2375256_C_T_b38	MORN1	-7.04	8.1e-12	-0.038785	75	0.005509	yes	CULTFB
chr1_2365220_A_G_b38	MORN1	-7.037	8.26e-12	-0.051762	13	0.007356	yes	CULTFB
chr1_2367871_C_T_b38	MORN1	-7.035	8.35e-12	-0.051368	13	0.007302	yes	CULTFB
chr1_2374713_C_T_b38	MORN1	-7.034	8.41e-12	-0.038576	76	0.005484	yes	CULTFB
chr1_2353047_C_T_b38	MORN1	-7.029	8.66e-12	-0.05094	14	0.007247	yes	CULTFB
chr1_2350287_A_C_b38	MORN1	-6.834	2.98e-11	-0.049556	14	0.007251	yes	CULTFB
chr1_2346676_G_C_b38	MORN1	-6.734	5.56e-11	-0.048721	14	0.007235	yes	CULTFB
chr1_2364484_C_T_b38	MORN1	-6.612	1.17e-10	-0.048055	17	0.007267	yes	CULTFB
chr1_2369336_A_G_b38	MORN1	-6.409	4e-10	-0.044609	19	0.00696	yes	CULTFB
chr1_2364339_A_C_b38	MORN1	-6.304	7.46e-10	-0.036368	63	0.005769	yes	CULTFB
chr1_2366816_A_G_b38	MORN1	-6.267	9.29e-10	-0.036085	62	0.005758	yes	CULTFB
chr1_2351241_C_T_b38	MORN1	-6.206	1.33e-09	-0.03652	59	0.005885	yes	CULTFB
chr1_2348700_C_T_b38	MORN1	-6.074	2.84e-09	-0.037008	48	0.006093	yes	CULTFB
chr1_2369713_ATAAT_A_b38	MORN1	-6.016	3.95e-09	-0.043261	16	0.007191	yes	CULTFB
chr1_2352756_T_C_b38	MORN1	-5.978	4.91e-09	-0.034734	60	0.005811	yes	CULTFB
chr1_2367799_C_T_b38	MORN1	-5.911	7.13e-09	-0.034414	60	0.005822	yes	CULTFB
chr1_2367197_G_A_b38	MORN1	-5.911	7.16e-09	-0.034829	58	0.005893	yes	CULTFB
chr1_2366496_A_T_b38	MORN1	-5.839	1.06e-08	-0.034198	59	0.005857	yes	CULTFB
chr1_2343517_G_A_b38	MORN1	-5.826	1.15e-08	-0.035065	55	0.006019	yes	CULTFB
chr1_2368718_C_A_b38	MORN1	-5.818	1.2e-08	-0.034265	57	0.00589	yes	CULTFB
chr1_2343699_C_T_b38	MORN1	-5.801	1.32e-08	-0.034983	54	0.006031	yes	CULTFB
chr1_2367456_C_CAA_b38	MORN1	-5.797	1.35e-08	-0.036697	38	0.006331	yes	CULTFB
chr1_2366555_G_C_b38	MORN1	-5.796	1.35e-08	-0.034012	60	0.005868	yes	CULTFB
chr1_2369210_C_T_b38	MORN1	-5.745	1.79e-08	-0.033388	71	0.005812	yes	CULTFB
chr1_2366243_C_T_b38	MORN1	-5.745	1.79e-08	-0.033872	58	0.005896	yes	CULTFB
chr1_2368939_G_C_b38	MORN1	-5.713	2.13e-08	-0.033508	59	0.005866	yes	CULTFB
chr1_2367872_A_G_b38	MORN1	-5.659	2.86e-08	-0.033176	64	0.005863	yes	CULTFB
chr1_2368188_T_C_b38	MORN1	-5.659	2.86e-08	-0.033176	64	0.005863	yes	CULTFB
chr1_2365333_G_A_b38	MORN1	-5.573	4.53e-08	-0.03242	58	0.005817	yes	CULTFB
chr1_2384278_A_G_b38	MORN1	-5.533	5.62e-08	-0.029774	95	0.005381	yes	CULTFB
chr1_2376477_A_C_b38	MORN1	-5.528	5.76e-08	-0.029733	124	0.005379	yes	CULTFB
chr1_2368473_T_C_b38	MORN1	-5.514	6.2e-08	-0.032801	65	0.005949	yes	CULTFB
chr1_2345148_G_A_b38	MORN1	-5.485	7.22e-08	-0.047699	5	0.008696	yes	CULTFB
chr1_2392128_T_C_b38	MORN1	-5.458	8.32e-08	-0.030031	107	0.005502	yes	CULTFB
chr1_2384876_A_G_b38	MORN1	-5.357	1.41e-07	-0.029215	122	0.005454	yes	CULTFB
chr1_2343937_T_G_b38	MORN1	-5.354	1.44e-07	-0.031678	72	0.005917	yes	CULTFB
chr1_2363829_A_T_b38	MORN1	-5.349	1.47e-07	-0.030228	60	0.005651	yes	CULTFB
chr1_2365236_C_T_b38	MORN1	-5.349	1.47e-07	-0.031491	58	0.005887	yes	CULTFB
chr1_2380956_C_T_b38	MORN1	-5.281	2.09e-07	-0.036928	17	0.006993	yes	CULTFB
chr1_2382101_A_G_b38	MORN1	-5.281	2.09e-07	-0.036928	17	0.006993	yes	CULTFB
chr1_2392569_C_T_b38	MORN1	-5.202	3.12e-07	-0.035546	18	0.006833	yes	CULTFB
chr1_2387989_A_G_b38	MORN1	-5.172	3.62e-07	-0.028624	111	0.005534	yes	CULTFB
chr1_2384241_A_G_b38	MORN1	-5.124	4.61e-07	-0.028091	126	0.005482	yes	CULTFB
chr1_2377643_T_G_b38	MORN1	-5.051	6.6e-07	-0.02849	103	0.00564	yes	CULTFB
chr1_2376590_G_A_b38	MORN1	-4.998	8.57e-07	-0.048811	3	0.009766	yes	CULTFB
chr1_2371226_C_CACAACCACA_b38	MORN1	-4.859	1.68e-06	-0.02706	110	0.005569	yes	CULTFB
chr1_2366956_CAAAATACATAGA_C_b38	MORN1	-4.846	1.79e-06	-0.028803	61	0.005943	yes	CULTFB
chr1_2383975_C_T_b38	MORN1	-4.821	2.01e-06	-0.032106	30	0.00666	yes	CULTFB
chr1_2389131_A_AAAG_b38	MORN1	-4.76	2.69e-06	-0.025146	104	0.005283	yes	CULTFB
chr1_2392882_G_T_b38	MORN1	-4.612	5.32e-06	-0.040582	6	0.008798	yes	CULTFB
chr1_2358373_A_T_b38	MORN1	-4.533	7.64e-06	-0.035596	9	0.007853	yes	CULTFB
chr1_2357308_T_C_b38	MORN1	4.53	7.74e-06	0.025827	104	0.005702	yes	CULTFB
chr1_2371032_C_T_b38	MORN1	-4.483	9.55e-06	-0.024649	101	0.005498	yes	CULTFB
chr1_2360970_T_C_b38	MORN1	4.474	9.95e-06	0.025346	102	0.005665	yes	CULTFB
chr1_2352403_G_T_b38	MORN1	4.432	1.2e-05	0.024971	103	0.005634	yes	CULTFB
chr1_2360716_T_C_b38	MORN1	4.416	1.28e-05	0.024957	102	0.005651	yes	CULTFB
chr1_2361332_A_AG_b38	MORN1	4.416	1.28e-05	0.024957	102	0.005651	yes	CULTFB
chr1_2361548_A_ACT_b38	MORN1	4.416	1.28e-05	0.024957	102	0.005651	yes	CULTFB
chr1_2353459_T_G_b38	MORN1	4.376	1.53e-05	0.024745	101	0.005654	yes	CULTFB
chr1_2356177_T_C_b38	MORN1	4.376	1.53e-05	0.024745	101	0.005654	yes	CULTFB
chr1_2352457_A_G_b38	MORN1	4.346	1.75e-05	0.024411	104	0.005617	yes	CULTFB
chr1_2358849_T_C_b38	MORN1	4.3	2.13e-05	0.024323	103	0.005657	yes	CULTFB
chr1_2371077_T_C_b38	MORN1	-4.28	2.33e-05	-0.02367	119	0.00553	yes	CULTFB
chr1_2409065_C_T_b38	MORN1	-4.126	4.47e-05	-0.025789	46	0.00625	yes	CULTFB
chr1_2389113_C_CA_b38	MORN1	-4.079	5.42e-05	-0.022907	78	0.005615	yes	CULTFB
chr1_2350539_T_G_b38	MORN1	-4.019	6.96e-05	-0.022643	112	0.005634	yes	CULTFB
chr1_2359472_G_A_b38	MORN1	3.897	0.000114	0.02207	71	0.005663	yes	CULTFB
chr1_2364657_A_T_b38	MORN1	-3.787	0.000175	-0.02134	113	0.005636	yes	CULTFB
chr1_2364658_A_T_b38	MORN1	-3.787	0.000175	-0.02134	113	0.005636	yes	CULTFB
chr1_2382880_T_C_b38	MORN1	-3.704	0.000241	-0.034414	7	0.009291	yes	CULTFB
chr1_2341705_A_G_b38	MORN1	3.682	0.000262	0.021513	103	0.005843	yes	CULTFB
chr1_2405593_C_T_b38	MORN1	-3.65	0.000296	-0.022744	47	0.006231	yes	CULTFB
chr1_2388775_CAAAA_C_b38	MORN1	-3.608	0.000347	-0.030658	19	0.008498	yes	CULTFB
chr1_2347542_C_T_b38	MORN1	-3.607	0.000348	-0.020531	100	0.005692	yes	CULTFB
chr1_2366021_T_C_b38	MORN1	-3.594	0.000365	-0.020576	110	0.005725	yes	CULTFB
chr1_2370674_CTT_C_b38	MORN1	-3.546	0.000435	-0.021083	93	0.005945	yes	CULTFB
chr1_2377078_C_G_b38	MORN1	-3.534	0.000456	-0.033794	6	0.009563	yes	CULTFB
chr1_2395636_C_T_b38	MORN1	-3.445	0.00063	-0.021858	43	0.006345	yes	CULTFB
chr1_2124676_A_G_b38	MORN1	-3.413	0.000706	-0.025778	16	0.007553	yes	CULTFB
chr1_2395479_G_A_b38	MORN1	-3.242	0.00128	-0.020473	44	0.006316	yes	CULTFB
chr1_2363405_C_T_b38	MORN1	3.218	0.00139	0.020077	46	0.006239	yes	CULTFB
chr1_2404771_C_T_b38	MORN1	-3.193	0.00152	-0.020181	45	0.006321	yes	CULTFB
chr1_2359882_C_CAA_b38	MORN1	3.109	0.00201	0.022921	19	0.007373	yes	CULTFB
chr1_2364499_A_G_b38	MORN1	3.085	0.00217	0.019283	40	0.00625	yes	CULTFB
chr1_2404530_C_G_b38	MORN1	-3.07	0.00228	-0.018899	51	0.006156	yes	CULTFB
chr1_2350696_G_A_b38	MORN1	3.009	0.00278	0.019325	35	0.006422	yes	CULTFB
chr1_2699855_C_G_b38	MORN1	3.006	0.00281	0.033348	13	0.011093	yes	CULTFB
chr1_2351722_A_G_b38	MORN1	3.003	0.00284	0.022768	39	0.007582	yes	CULTFB
chr1_2353743_A_T_b38	MORN1	2.946	0.0034	0.018824	52	0.00639	yes	CULTFB
chr1_2751651_C_A_b38	MORN1	2.91	0.00381	0.043083	7	0.014806	yes	CULTFB
chr1_2479350_C_T_b38	MORN1	-2.907	0.00384	-0.016601	80	0.00571	yes	CULTFB
chr1_2348378_C_T_b38	MORN1	2.89	0.00406	0.018653	34	0.006454	yes	CULTFB
chr1_2344980_A_G_b38	MORN1	2.875	0.00425	0.019282	25	0.006706	yes	CULTFB
chr1_2367644_G_A_b38	MORN1	-2.873	0.00427	-0.017682	57	0.006154	yes	CULTFB
chr1_2188394_A_G_b38	MORN1	2.87	0.00431	0.01877	36	0.00654	yes	CULTFB
chr1_2398369_A_G_b38	MORN1	-2.838	0.00476	-0.030017	3	0.010576	yes	CULTFB
chr1_2921432_G_A_b38	MORN1	2.836	0.0048	0.02118	19	0.007469	yes	CULTFB
chr1_2152298_T_C_b38	MORN1	2.828	0.00492	0.018434	37	0.006519	yes	CULTFB
chr1_2367055_C_A_b38	MORN1	2.821	0.00502	0.018481	28	0.006551	yes	CULTFB
chr1_2401201_T_C_b38	MORN1	-2.817	0.00508	-0.021075	32	0.007481	yes	CULTFB
chr1_2362718_G_A_b38	MORN1	2.808	0.00522	0.018042	35	0.006425	yes	CULTFB
chr1_2143812_A_G_b38	MORN1	2.8	0.00535	0.018209	37	0.006503	yes	CULTFB
chr1_2344757_C_A_b38	MORN1	2.792	0.00548	0.018847	25	0.00675	yes	CULTFB
chr1_2753670_T_C_b38	MORN1	2.782	0.00566	0.05747	3	0.020661	yes	CULTFB
chr1_2972584_G_A_b38	MORN1	2.764	0.00596	0.020364	15	0.007367	yes	CULTFB
chr1_2751662_T_C_b38	MORN1	2.763	0.00598	0.041276	7	0.014938	yes	CULTFB
chr1_1673060_G_A_b38	MORN1	-2.758	0.00608	-0.015465	107	0.005608	yes	CULTFB
chr1_2658731_A_G_b38	MORN1	-2.757	0.0061	-0.02214	41	0.008032	yes	CULTFB
chr1_2345774_T_C_b38	MORN1	2.749	0.00623	0.018533	24	0.006741	yes	CULTFB
chr1_2207868_C_T_b38	MORN1	2.744	0.00633	0.017929	37	0.006533	yes	CULTFB
chr1_2411230_C_CT_b38	MORN1	-2.742	0.00637	-0.026273	15	0.009582	yes	CULTFB
chr1_2344761_T_A_b38	MORN1	2.741	0.00639	0.018521	25	0.006757	yes	CULTFB
chr1_2356409_G_C_b38	MORN1	2.7	0.00721	0.017468	42	0.006469	yes	CULTFB
chr1_2187100_T_C_b38	MORN1	2.676	0.00775	0.017421	36	0.00651	yes	CULTFB
chr1_2345727_G_A_b38	MORN1	2.665	0.008	0.018081	24	0.006784	yes	CULTFB
chr1_2345829_CCA_C_b38	MORN1	-2.661	0.0081	-0.031951	3	0.012007	yes	CULTFB
chr1_1993851_G_A_b38	MORN1	-2.65	0.00835	-0.023939	7	0.009033	yes	CULTFB
chr1_2921359_G_T_b38	MORN1	2.646	0.00845	0.019859	19	0.007505	yes	CULTFB
chr1_2921360_C_G_b38	MORN1	2.646	0.00845	0.019859	19	0.007505	yes	CULTFB
chr1_2921397_G_C_b38	MORN1	2.638	0.00866	0.019874	19	0.007534	yes	CULTFB
chr1_2350934_C_T_b38	MORN1	2.628	0.0089	0.017773	25	0.006762	yes	CULTFB
chr1_2344761_T_C_b38	MORN1	2.623	0.00904	0.018662	29	0.007114	yes	CULTFB
chr1_2411755_T_C_b38	MORN1	-2.623	0.00905	-0.028969	3	0.011045	yes	CULTFB
chr1_2751653_G_A_b38	MORN1	2.607	0.00948	0.039079	7	0.014992	yes	CULTFB
chr1_2434976_AG_A_b38	MORN1	2.6	0.00967	0.020339	13	0.007824	yes	CULTFB
chr1_2434982_G_T_b38	MORN1	2.6	0.00967	0.020339	13	0.007824	yes	CULTFB
chr1_2344634_T_C_b38	MORN1	2.598	0.00972	0.017679	25	0.006806	yes	CULTFB
chr1_2401252_T_TTCCTCCCTCCTCC_b38	MORN1	-2.593	0.00984	-0.016239	46	0.006262	yes	CULTFB
chr1_2349222_G_A_b38	MORN1	-4.251	2.63e-05	-0.023851	121	0.00561	no	CULTFB
chr1_2346801_C_T_b38	MORN1	-3.998	7.58e-05	-0.022676	120	0.005672	no	CULTFB
chr1_2346111_G_C_b38	MORN1	-3.433	0.000657	-0.019686	99	0.005734	no	CULTFB
chr1_2340787_C_T_b38	MORN1	-3.05	0.00243	-0.019231	38	0.006305	no	CULTFB
chr1_2082757_G_A_b38	MORN1	-3.034	0.00257	-0.019167	41	0.006318	no	CULTFB
chr1_2061538_G_T_b38	MORN1	-2.9	0.00393	-0.020851	20	0.007189	no	CULTFB
chr1_2342466_T_C_b38	MORN1	-2.879	0.0042	-0.017191	79	0.005972	no	CULTFB
chr1_2383999_G_A_b38	MORN1	2.869	0.00433	0.025263	7	0.008805	no	CULTFB
chr1_1991468_T_C_b38	MORN1	2.813	0.00515	0.051734	7	0.018392	no	CULTFB
chr1_2921611_G_C_b38	MORN1	2.761	0.00602	0.034086	5	0.012345	no	CULTFB
chr1_3123440_G_C_b38	MORN1	2.703	0.00715	0.021999	10	0.008137	no	CULTFB
chr1_2344932_C_T_b38	MORN1	2.694	0.00734	0.019405	18	0.007203	no	CULTFB
chr1_3125087_C_T_b38	MORN1	2.658	0.00815	0.021693	10	0.00816	no	CULTFB
chr1_2933547_G_A_b38	MORN1	2.608	0.00945	0.017284	34	0.006628	no	CULTFB
chr1_3131759_C_T_b38	MORN1	2.591	0.00991	0.020981	11	0.008097	no	CULTFB
chr1_2329738_C_T_b38	MORN1	-4.236	4.45e-05	-0.131893	13	0.031133	yes	EBVTLC
chr1_2325494_G_A_b38	MORN1	-3.736	0.000286	-0.119632	12	0.032018	yes	EBVTLC
chr1_2325768_C_A_b38	MORN1	-3.736	0.000286	-0.119632	12	0.032018	yes	EBVTLC
chr1_2326256_G_A_b38	MORN1	-3.736	0.000286	-0.119632	12	0.032018	yes	EBVTLC
chr1_2332063_T_C_b38	MORN1	-3.625	0.000424	-0.11498	8	0.031721	yes	EBVTLC
chr1_3141674_A_C_b38	MORN1	-3.546	0.000557	-0.087242	21	0.024603	yes	EBVTLC
chr1_2334355_G_A_b38	MORN1	-3.392	0.000939	-0.102697	9	0.03028	yes	EBVTLC
chr1_1657902_T_TA_b38	MORN1	-3.366	0.00102	-0.131797	3	0.039154	yes	EBVTLC
chr1_3094139_G_T_b38	MORN1	3.339	0.00112	0.090007	8	0.026954	yes	EBVTLC
chr1_3094405_A_C_b38	MORN1	3.339	0.00112	0.090007	8	0.026954	yes	EBVTLC
chr1_3141685_A_G_b38	MORN1	-3.332	0.00115	-0.081337	21	0.024413	yes	EBVTLC
chr1_2327507_C_CA_b38	MORN1	-3.282	0.00135	-0.103741	10	0.031609	yes	EBVTLC
chr1_3093405_G_A_b38	MORN1	3.225	0.00162	0.086376	13	0.026782	yes	EBVTLC
chr1_3093763_G_A_b38	MORN1	3.225	0.00162	0.086376	13	0.026782	yes	EBVTLC
chr1_3094289_G_A_b38	MORN1	3.225	0.00162	0.086376	13	0.026782	yes	EBVTLC
chr1_3094985_G_A_b38	MORN1	2.982	0.00347	0.081209	8	0.027237	yes	EBVTLC
chr1_2323471_T_C_b38	MORN1	-2.972	0.00357	-0.087447	5	0.029425	yes	EBVTLC
chr1_1710588_C_T_b38	MORN1	2.875	0.00477	0.095821	9	0.033325	yes	EBVTLC
chr1_3141669_T_C_b38	MORN1	-2.854	0.00508	-0.064646	32	0.022648	yes	EBVTLC
chr1_3093753_A_T_b38	MORN1	2.843	0.00525	0.075069	32	0.026406	yes	EBVTLC
chr1_3094765_T_C_b38	MORN1	2.843	0.00525	0.075069	32	0.026406	yes	EBVTLC
chr1_1705856_G_A_b38	MORN1	2.812	0.00575	0.06309	35	0.022436	yes	EBVTLC
chr1_1722619_C_T_b38	MORN1	2.712	0.00766	0.078813	18	0.02906	yes	EBVTLC
chr1_1722360_C_T_b38	MORN1	2.709	0.00772	0.105096	4	0.038789	yes	EBVTLC
chr1_2458892_G_A_b38	MORN1	2.682	0.00834	0.072951	9	0.027198	yes	EBVTLC
chr1_3095810_C_G_b38	MORN1	2.675	0.0085	0.070878	13	0.026492	yes	EBVTLC
chr1_3135937_C_T_b38	MORN1	2.672	0.00857	0.068524	39	0.025642	yes	EBVTLC
chr1_3106831_T_C_b38	MORN1	2.655	0.00901	0.069368	22	0.02613	yes	EBVTLC
chr1_2465697_C_T_b38	MORN1	2.632	0.00959	0.076334	7	0.029001	yes	EBVTLC
chr1_2441650_G_T_b38	MORN1	2.621	0.0099	0.066263	13	0.025284	yes	EBVTLC
chr1_2450183_A_G_b38	MORN1	2.619	0.00995	0.062508	23	0.023869	yes	EBVTLC
chr1_3233225_G_A_b38	MORN1	-3.372	0.001	-0.098696	18	0.02927	no	EBVTLC
chr1_2341464_A_G_b38	MORN1	-3.025	0.00304	-0.099568	3	0.03292	no	EBVTLC
chr1_3015969_G_A_b38	MORN1	-2.87	0.00484	-0.119898	9	0.041769	no	EBVTLC
chr1_3016055_A_G_b38	MORN1	-2.87	0.00484	-0.119898	9	0.041769	no	EBVTLC
chr1_3016811_C_G_b38	MORN1	-2.87	0.00484	-0.119898	9	0.041769	no	EBVTLC
chr1_2334639_T_C_b38	MORN1	-2.736	0.00716	-0.06289	39	0.02299	no	EBVTLC
chr1_2440123_T_C_b38	MORN1	-2.719	0.00751	-0.143086	4	0.052624	no	EBVTLC
chr1_1705799_A_G_b38	MORN1	2.69	0.00815	0.063793	35	0.023711	no	EBVTLC
chr1_3015935_C_T_b38	MORN1	-2.651	0.00911	-0.114073	9	0.043037	no	EBVTLC
chr1_3135057_A_G_b38	MORN1	2.634	0.00953	0.067233	21	0.02552	no	EBVTLC
chr1_1641819_C_T_b38	MORN1	2.626	0.00976	0.093579	3	0.03564	no	EBVTLC
chr1_3139183_G_C_b38	MORN1	2.617	0.01	0.078643	5	0.030049	no	EBVTLC
chr1_2364339_A_C_b38	MORN1	-7.038	1.71e-11	-0.07092	45	0.010077	yes	CLNSGM
chr1_2367872_A_G_b38	MORN1	-7	2.14e-11	-0.069762	46	0.009966	yes	CLNSGM
chr1_2368188_T_C_b38	MORN1	-7	2.14e-11	-0.069762	46	0.009966	yes	CLNSGM
chr1_2366555_G_C_b38	MORN1	-6.923	3.39e-11	-0.070104	43	0.010126	yes	CLNSGM
chr1_2368473_T_C_b38	MORN1	-6.772	8.31e-11	-0.068749	46	0.010151	yes	CLNSGM
chr1_2366816_A_G_b38	MORN1	-6.737	1.02e-10	-0.068743	44	0.010204	yes	CLNSGM
chr1_2366496_A_T_b38	MORN1	-6.65	1.7e-10	-0.068441	42	0.010293	yes	CLNSGM
chr1_2367799_C_T_b38	MORN1	-6.65	1.7e-10	-0.068441	42	0.010293	yes	CLNSGM
chr1_2368939_G_C_b38	MORN1	-6.606	2.2e-10	-0.06761	42	0.010235	yes	CLNSGM
chr1_2367197_G_A_b38	MORN1	-6.593	2.37e-10	-0.068221	41	0.010348	yes	CLNSGM
chr1_2366243_C_T_b38	MORN1	-6.579	2.56e-10	-0.068727	40	0.010446	yes	CLNSGM
chr1_2352756_T_C_b38	MORN1	-6.564	2.8e-10	-0.067374	43	0.010264	yes	CLNSGM
chr1_2365236_C_T_b38	MORN1	-6.54	3.21e-10	-0.067301	42	0.010291	yes	CLNSGM
chr1_2343517_G_A_b38	MORN1	-6.471	4.77e-10	-0.069785	39	0.010784	yes	CLNSGM
chr1_2368718_C_A_b38	MORN1	-6.446	5.49e-10	-0.067093	41	0.010409	yes	CLNSGM
chr1_2364657_A_T_b38	MORN1	-6.437	5.79e-10	-0.062138	76	0.009654	yes	CLNSGM
chr1_2364658_A_T_b38	MORN1	-6.437	5.79e-10	-0.062138	76	0.009654	yes	CLNSGM
chr1_2365333_G_A_b38	MORN1	-6.407	6.85e-10	-0.066462	41	0.010373	yes	CLNSGM
chr1_2366956_CAAAATACATAGA_C_b38	MORN1	-6.37	8.45e-10	-0.064207	46	0.01008	yes	CLNSGM
chr1_2343699_C_T_b38	MORN1	-6.333	1.04e-09	-0.06834	39	0.010792	yes	CLNSGM
chr1_2367456_C_CAA_b38	MORN1	-6.292	1.31e-09	-0.069168	32	0.010993	yes	CLNSGM
chr1_2351241_C_T_b38	MORN1	-6.287	1.35e-09	-0.066708	41	0.010611	yes	CLNSGM
chr1_2366021_T_C_b38	MORN1	-5.975	7.47e-09	-0.059442	73	0.009948	yes	CLNSGM
chr1_2348700_C_T_b38	MORN1	-5.916	1.03e-08	-0.063475	38	0.01073	yes	CLNSGM
chr1_2369210_C_T_b38	MORN1	-5.864	1.36e-08	-0.060724	51	0.010355	yes	CLNSGM
chr1_2340787_C_T_b38	MORN1	-5.791	2e-08	-0.063689	30	0.010998	yes	CLNSGM
chr1_2363829_A_T_b38	MORN1	-5.587	5.79e-08	-0.056558	45	0.010123	yes	CLNSGM
chr1_2350539_T_G_b38	MORN1	-5.52	8.16e-08	-0.055637	73	0.01008	yes	CLNSGM
chr1_2362718_G_A_b38	MORN1	5.479	1.01e-07	0.063124	25	0.011522	yes	CLNSGM
chr1_2346801_C_T_b38	MORN1	-5.462	1.09e-07	-0.05553	81	0.010166	yes	CLNSGM
chr1_2349222_G_A_b38	MORN1	-5.458	1.12e-07	-0.05499	83	0.010075	yes	CLNSGM
chr1_2363405_C_T_b38	MORN1	5.423	1.33e-07	0.062521	28	0.011529	yes	CLNSGM
chr1_2364499_A_G_b38	MORN1	5.368	1.75e-07	0.060423	29	0.011255	yes	CLNSGM
chr1_2348378_C_T_b38	MORN1	5.265	2.93e-07	0.062008	23	0.011778	yes	CLNSGM
chr1_2350696_G_A_b38	MORN1	5.265	2.93e-07	0.062008	23	0.011778	yes	CLNSGM
chr1_2356409_G_C_b38	MORN1	5.264	2.93e-07	0.061518	27	0.011686	yes	CLNSGM
chr1_2338659_A_G_b38	MORN1	5.253	3.1e-07	0.052729	75	0.010038	yes	CLNSGM
chr1_2353743_A_T_b38	MORN1	5.056	8.06e-07	0.059229	30	0.011715	yes	CLNSGM
chr1_2360716_T_C_b38	MORN1	5.023	9.42e-07	0.053832	66	0.010717	yes	CLNSGM
chr1_2360970_T_C_b38	MORN1	5.023	9.42e-07	0.053832	66	0.010717	yes	CLNSGM
chr1_2361332_A_AG_b38	MORN1	5.023	9.42e-07	0.053832	66	0.010717	yes	CLNSGM
chr1_2361548_A_ACT_b38	MORN1	5.023	9.42e-07	0.053832	66	0.010717	yes	CLNSGM
chr1_2352457_A_G_b38	MORN1	5.013	9.89e-07	0.053763	67	0.010725	yes	CLNSGM
chr1_2353459_T_G_b38	MORN1	4.972	1.2e-06	0.052871	66	0.010635	yes	CLNSGM
chr1_2356177_T_C_b38	MORN1	4.972	1.2e-06	0.052871	66	0.010635	yes	CLNSGM
chr1_2352403_G_T_b38	MORN1	4.932	1.45e-06	0.052664	65	0.010679	yes	CLNSGM
chr1_2358849_T_C_b38	MORN1	4.848	2.14e-06	0.051919	66	0.01071	yes	CLNSGM
chr1_2367055_C_A_b38	MORN1	4.547	8.31e-06	0.056136	16	0.012345	yes	CLNSGM
chr1_2341705_A_G_b38	MORN1	4.547	8.34e-06	0.046393	77	0.010204	yes	CLNSGM
chr1_2337352_A_G_b38	MORN1	4.467	1.18e-05	0.046134	55	0.010327	yes	CLNSGM
chr1_2350750_AGGGGTGGCACG_A_b38	MORN1	-4.137	4.74e-05	-0.051654	16	0.012485	yes	CLNSGM
chr1_2064022_T_G_b38	MORN1	4.066	6.32e-05	0.101768	12	0.025026	yes	CLNSGM
chr1_2348393_G_A_b38	MORN1	-4.042	6.97e-05	-0.051812	15	0.012818	yes	CLNSGM
chr1_2347542_C_T_b38	MORN1	-4.041	7e-05	-0.041824	61	0.01035	yes	CLNSGM
chr1_2359472_G_A_b38	MORN1	4.017	7.69e-05	0.043657	48	0.010867	yes	CLNSGM
chr1_2351551_C_T_b38	MORN1	4.008	7.97e-05	0.052939	12	0.013207	yes	CLNSGM
chr1_2346111_G_C_b38	MORN1	-3.994	8.44e-05	-0.042132	58	0.010549	yes	CLNSGM
chr1_2356095_C_T_b38	MORN1	3.972	9.22e-05	0.052826	12	0.0133	yes	CLNSGM
chr1_2357882_G_A_b38	MORN1	3.925	0.000111	0.051731	13	0.013179	yes	CLNSGM
chr1_2354688_G_C_b38	MORN1	-3.915	0.000115	-0.053214	12	0.013592	yes	CLNSGM
chr1_2338460_T_C_b38	MORN1	3.88	0.000132	0.043078	40	0.011103	yes	CLNSGM
chr1_2354645_C_T_b38	MORN1	-3.816	0.000169	-0.051861	12	0.013591	yes	CLNSGM
chr1_2345849_ACACACAG_A_b38	MORN1	3.807	0.000175	0.050302	12	0.013214	yes	CLNSGM
chr1_2344757_C_A_b38	MORN1	3.806	0.000176	0.049516	13	0.01301	yes	CLNSGM
chr1_2344761_T_A_b38	MORN1	3.806	0.000176	0.049516	13	0.01301	yes	CLNSGM
chr1_2345727_G_A_b38	MORN1	3.806	0.000176	0.049516	13	0.01301	yes	CLNSGM
chr1_2350934_C_T_b38	MORN1	3.806	0.000176	0.049516	13	0.01301	yes	CLNSGM
chr1_2344980_A_G_b38	MORN1	3.717	0.000247	0.047817	14	0.012865	yes	CLNSGM
chr1_2345774_T_C_b38	MORN1	3.717	0.000247	0.047817	14	0.012865	yes	CLNSGM
chr1_2342133_C_G_b38	MORN1	-3.674	0.000289	-0.050666	12	0.01379	yes	CLNSGM
chr1_2342137_G_A_b38	MORN1	-3.674	0.000289	-0.050666	12	0.01379	yes	CLNSGM
chr1_2351215_T_G_b38	MORN1	-3.668	0.000296	-0.049502	13	0.013497	yes	CLNSGM
chr1_2872980_T_TTTTCTTTC_b38	MORN1	-3.652	0.000315	-0.100005	3	0.027386	yes	CLNSGM
chr1_2344634_T_C_b38	MORN1	3.644	0.000324	0.047807	13	0.01312	yes	CLNSGM
chr1_2359882_C_CAA_b38	MORN1	3.61	0.000366	0.050728	11	0.014051	yes	CLNSGM
chr1_2692584_C_A_b38	MORN1	-3.592	0.000392	-0.045023	23	0.012535	yes	CLNSGM
chr1_2351678_C_T_b38	MORN1	-3.591	0.000393	-0.047476	13	0.013221	yes	CLNSGM
chr1_2362229_A_G_b38	MORN1	-3.518	0.000513	-0.047267	13	0.013437	yes	CLNSGM
chr1_2344932_C_T_b38	MORN1	3.439	0.000678	0.04633	10	0.01347	yes	CLNSGM
chr1_2338570_C_T_b38	MORN1	3.399	0.000782	0.037974	39	0.011172	yes	CLNSGM
chr1_2681679_T_C_b38	MORN1	3.372	0.000859	0.079638	5	0.023616	yes	CLNSGM
chr1_2362863_C_CA_b38	MORN1	-3.301	0.0011	-0.047422	8	0.014368	yes	CLNSGM
chr1_2347212_C_T_b38	MORN1	-3.261	0.00126	-0.043573	13	0.013363	yes	CLNSGM
chr1_2344256_A_T_b38	MORN1	3.23	0.0014	0.040217	16	0.012453	yes	CLNSGM
chr1_2337211_C_G_b38	MORN1	3.229	0.0014	0.036211	43	0.011214	yes	CLNSGM
chr1_2056929_C_G_b38	MORN1	3.159	0.00177	0.098858	7	0.031299	yes	CLNSGM
chr1_3273817_AGTGT_A_b38	MORN1	-2.937	0.00361	-0.045475	4	0.015482	yes	CLNSGM
chr1_2355481_C_T_b38	MORN1	2.893	0.00414	0.072167	5	0.024949	yes	CLNSGM
chr1_2364608_C_A_b38	MORN1	2.893	0.00414	0.072167	5	0.024949	yes	CLNSGM
chr1_2754964_G_C_b38	MORN1	2.889	0.00419	0.038058	24	0.013173	yes	CLNSGM
chr1_1685108_CA_C_b38	MORN1	-2.886	0.00423	-0.040341	23	0.01398	yes	CLNSGM
chr1_2337229_A_G_b38	MORN1	2.883	0.00427	0.031588	59	0.010956	yes	CLNSGM
chr1_2341451_G_A_b38	MORN1	2.837	0.00491	0.035143	18	0.012388	yes	CLNSGM
chr1_2344583_G_A_b38	MORN1	2.801	0.00547	0.036604	15	0.013066	yes	CLNSGM
chr1_2907850_TGGTGAGCGAGGTTAGGGTGGGCCCTCC_T_b38	MORN1	2.795	0.00557	0.04219	8	0.015094	yes	CLNSGM
chr1_2142322_CAGCAGCCGAAGCGCCTCCTTTCAATCCAGGGTCCACACATCCAGCAGCCGAAGCGCCCTCCTTTCAATCCAGGGTCCAGGCATCT_C_b38	MORN1	2.772	0.00596	0.062032	4	0.022375	yes	CLNSGM
chr1_2068161_A_T_b38	MORN1	2.759	0.0062	0.083928	7	0.030417	yes	CLNSGM
chr1_2340807_G_A_b38	MORN1	2.73	0.00676	0.033505	19	0.012272	yes	CLNSGM
chr1_2359219_C_T_b38	MORN1	2.719	0.00698	0.07057	5	0.025954	yes	CLNSGM
chr1_2340235_T_C_b38	MORN1	2.698	0.00742	0.032725	21	0.012128	yes	CLNSGM
chr1_3079069_C_T_b38	MORN1	-2.667	0.00812	-0.040242	10	0.015087	yes	CLNSGM
chr1_2691530_A_G_b38	MORN1	-2.665	0.00818	-0.084596	3	0.031747	yes	CLNSGM
chr1_3105927_ATCCTTAGTGTGCCCCGGGGTCCACCTGTGC_A_b38	MORN1	2.639	0.00882	0.043765	7	0.016586	yes	CLNSGM
chr1_3202554_G_A_b38	MORN1	2.637	0.00886	0.043271	7	0.016409	yes	CLNSGM
chr1_3110182_A_C_b38	MORN1	2.621	0.00927	0.047718	5	0.018205	yes	CLNSGM
chr1_2692582_C_A_b38	MORN1	-2.61	0.00957	-0.059255	4	0.022701	yes	CLNSGM
chr1_2369187_T_TA_b38	MORN1	2.597	0.00995	0.06568	5	0.025294	yes	CLNSGM
chr1_2357308_T_C_b38	MORN1	4.567	7.61e-06	0.049527	70	0.010844	no	CLNSGM
chr1_2369713_ATAAT_A_b38	MORN1	-4.403	1.56e-05	-0.059516	12	0.013518	no	CLNSGM
chr1_2369336_A_G_b38	MORN1	-3.877	0.000134	-0.053332	11	0.013756	no	CLNSGM
chr1_2365220_A_G_b38	MORN1	-3.843	0.000153	-0.054456	9	0.014171	no	CLNSGM
chr1_2367871_C_T_b38	MORN1	-3.825	0.000164	-0.052963	10	0.013847	no	CLNSGM
chr1_2343937_T_G_b38	MORN1	-3.816	0.000169	-0.041819	54	0.010959	no	CLNSGM
chr1_2357811_C_G_b38	MORN1	-3.808	0.000175	-0.052638	10	0.013824	no	CLNSGM
chr1_2357812_T_C_b38	MORN1	-3.808	0.000175	-0.052638	10	0.013824	no	CLNSGM
chr1_2359828_A_G_b38	MORN1	-3.808	0.000175	-0.052638	10	0.013824	no	CLNSGM
chr1_2363591_T_G_b38	MORN1	-3.808	0.000175	-0.052638	10	0.013824	no	CLNSGM
chr1_2337299_A_G_b38	MORN1	3.793	0.000185	0.040094	50	0.010571	no	CLNSGM
chr1_2344932_C_A_b38	MORN1	-3.733	0.000232	-0.051875	10	0.013895	no	CLNSGM
chr1_2346676_G_C_b38	MORN1	-3.723	0.000241	-0.051339	10	0.013791	no	CLNSGM
chr1_2350287_A_C_b38	MORN1	-3.723	0.000241	-0.051339	10	0.013791	no	CLNSGM
chr1_2353047_C_T_b38	MORN1	-3.723	0.000241	-0.051339	10	0.013791	no	CLNSGM
chr1_2086055_CTT_C_b38	MORN1	3.538	0.000476	0.079869	4	0.022573	no	CLNSGM
chr1_2364484_C_T_b38	MORN1	-3.514	0.00052	-0.05069	10	0.014425	no	CLNSGM
chr1_2345442_G_A_b38	MORN1	3.472	0.000604	0.091634	4	0.026391	no	CLNSGM
chr1_2345953_G_A_b38	MORN1	3.472	0.000604	0.091634	4	0.026391	no	CLNSGM
chr1_2056778_G_T_b38	MORN1	3.367	0.000875	0.102368	7	0.030406	no	CLNSGM
chr1_2059376_C_T_b38	MORN1	3.249	0.00131	0.097686	7	0.030071	no	CLNSGM
chr1_2064837_C_T_b38	MORN1	3.249	0.00131	0.097686	7	0.030071	no	CLNSGM
chr1_2369355_G_GA_b38	MORN1	-3.222	0.00144	-0.037936	35	0.011775	no	CLNSGM
chr1_2758226_C_G_b38	MORN1	-3.216	0.00146	-0.095998	3	0.02985	no	CLNSGM
chr1_2056854_G_C_b38	MORN1	3.162	0.00175	0.099856	6	0.031582	no	CLNSGM
chr1_2056874_G_C_b38	MORN1	3.162	0.00175	0.099856	6	0.031582	no	CLNSGM
chr1_1836387_CTT_C_b38	MORN1	-3.068	0.00238	-0.046693	14	0.015218	no	CLNSGM
chr1_2609034_TACAC_T_b38	MORN1	-3.02	0.00277	-0.042508	9	0.014074	no	CLNSGM
chr1_3300347_CGATCCCAGTCGTGGTGACTCTGCCCTGGTTGAAGATGCTATGCTGTGGCTGTGATGTTTCA_C_b38	MORN1	-2.985	0.0031	-0.09232	3	0.030929	no	CLNSGM
chr1_3252045_G_A_b38	MORN1	-2.95	0.00346	-0.043454	6	0.014729	no	CLNSGM
chr1_2691474_C_G_b38	MORN1	-2.934	0.00365	-0.077475	5	0.026408	no	CLNSGM
chr1_3269600_GACAGTCCCAGAGGAGC_G_b38	MORN1	-2.932	0.00367	-0.042084	20	0.014354	no	CLNSGM
chr1_1424727_C_A_b38	MORN1	2.899	0.00406	0.076855	3	0.026513	no	CLNSGM
chr1_2960085_C_G_b38	MORN1	2.841	0.00484	0.090986	4	0.032022	no	CLNSGM
chr1_2960096_C_T_b38	MORN1	2.838	0.00489	0.090816	4	0.031997	no	CLNSGM
chr1_2369118_G_A_b38	MORN1	-2.834	0.00496	-0.038602	12	0.013623	no	CLNSGM
chr1_2055016_C_T_b38	MORN1	2.827	0.00507	0.085097	7	0.030105	no	CLNSGM
chr1_1587082_G_A_b38	MORN1	-2.756	0.00626	-0.0416	7	0.015093	no	CLNSGM
chr1_3251181_A_T_b38	MORN1	-2.726	0.00685	-0.04147	6	0.015214	no	CLNSGM
chr1_3253009_C_T_b38	MORN1	-2.726	0.00685	-0.04147	6	0.015214	no	CLNSGM
chr1_3253027_G_T_b38	MORN1	-2.726	0.00685	-0.04147	6	0.015214	no	CLNSGM
chr1_3233225_G_A_b38	MORN1	2.672	0.00801	0.038829	21	0.014532	no	CLNSGM
chr1_2419956_G_A_b38	MORN1	2.647	0.00862	0.043813	4	0.016554	no	CLNSGM
chr1_3255979_G_C_b38	MORN1	-2.633	0.00897	-0.039409	6	0.014967	no	CLNSGM
chr1_1424725_G_A_b38	MORN1	-2.614	0.00947	-0.077255	3	0.029557	no	CLNSGM
chr1_2364339_A_C_b38	MORN1	-6.635	1.53e-10	-0.05085	48	0.007664	yes	CLNTRN
chr1_2366816_A_G_b38	MORN1	-6.571	2.24e-10	-0.05068	47	0.007713	yes	CLNTRN
chr1_2367872_A_G_b38	MORN1	-6.563	2.35e-10	-0.050918	49	0.007758	yes	CLNTRN
chr1_2368188_T_C_b38	MORN1	-6.484	3.73e-10	-0.050197	49	0.007742	yes	CLNTRN
chr1_2366956_CAAAATACATAGA_C_b38	MORN1	-6.352	7.94e-10	-0.049274	49	0.007757	yes	CLNTRN
chr1_2368473_T_C_b38	MORN1	-6.344	8.33e-10	-0.049359	51	0.00778	yes	CLNTRN
chr1_2368718_C_A_b38	MORN1	-6.293	1.12e-09	-0.049345	45	0.007841	yes	CLNTRN
chr1_2366555_G_C_b38	MORN1	-6.292	1.12e-09	-0.049278	46	0.007832	yes	CLNTRN
chr1_2368939_G_C_b38	MORN1	-6.223	1.66e-09	-0.048856	46	0.007851	yes	CLNTRN
chr1_2367799_C_T_b38	MORN1	-6.188	2.01e-09	-0.048308	47	0.007806	yes	CLNTRN
chr1_2365236_C_T_b38	MORN1	-6.186	2.04e-09	-0.04827	47	0.007803	yes	CLNTRN
chr1_2366496_A_T_b38	MORN1	-6.14	2.64e-09	-0.048245	46	0.007857	yes	CLNTRN
chr1_2352756_T_C_b38	MORN1	-6.087	3.55e-09	-0.047478	47	0.0078	yes	CLNTRN
chr1_2364499_A_G_b38	MORN1	6.067	3.96e-09	0.051907	34	0.008555	yes	CLNTRN
chr1_2362718_G_A_b38	MORN1	6.047	4.43e-09	0.053227	29	0.008802	yes	CLNTRN
chr1_2363405_C_T_b38	MORN1	6.019	5.16e-09	0.051507	41	0.008557	yes	CLNTRN
chr1_2367197_G_A_b38	MORN1	-5.985	6.21e-09	-0.046969	45	0.007847	yes	CLNTRN
chr1_2366243_C_T_b38	MORN1	-5.948	7.62e-09	-0.047101	45	0.007919	yes	CLNTRN
chr1_2351241_C_T_b38	MORN1	-5.922	8.8e-09	-0.046981	45	0.007934	yes	CLNTRN
chr1_2352403_G_T_b38	MORN1	5.885	1.07e-08	0.044801	85	0.007613	yes	CLNTRN
chr1_2352457_A_G_b38	MORN1	5.869	1.17e-08	0.044915	85	0.007653	yes	CLNTRN
chr1_2358849_T_C_b38	MORN1	5.869	1.17e-08	0.044915	85	0.007653	yes	CLNTRN
chr1_2360716_T_C_b38	MORN1	5.869	1.17e-08	0.044915	85	0.007653	yes	CLNTRN
chr1_2360970_T_C_b38	MORN1	5.869	1.17e-08	0.044915	85	0.007653	yes	CLNTRN
chr1_2361332_A_AG_b38	MORN1	5.869	1.17e-08	0.044915	85	0.007653	yes	CLNTRN
chr1_2361548_A_ACT_b38	MORN1	5.869	1.17e-08	0.044915	85	0.007653	yes	CLNTRN
chr1_2353459_T_G_b38	MORN1	5.832	1.43e-08	0.044387	84	0.007612	yes	CLNTRN
chr1_2356177_T_C_b38	MORN1	5.832	1.43e-08	0.044387	84	0.007612	yes	CLNTRN
chr1_2357308_T_C_b38	MORN1	5.778	1.91e-08	0.044757	87	0.007746	yes	CLNTRN
chr1_2365333_G_A_b38	MORN1	-5.738	2.36e-08	-0.044887	45	0.007823	yes	CLNTRN
chr1_2369210_C_T_b38	MORN1	-5.641	3.94e-08	-0.044589	53	0.007905	yes	CLNTRN
chr1_2367456_C_CAA_b38	MORN1	-5.599	4.9e-08	-0.047594	32	0.0085	yes	CLNTRN
chr1_2353743_A_T_b38	MORN1	5.488	8.73e-08	0.047815	45	0.008713	yes	CLNTRN
chr1_2348700_C_T_b38	MORN1	-5.369	1.6e-07	-0.043942	40	0.008184	yes	CLNTRN
chr1_2343517_G_A_b38	MORN1	-5.36	1.67e-07	-0.044038	41	0.008215	yes	CLNTRN
chr1_2343699_C_T_b38	MORN1	-5.26	2.76e-07	-0.043309	41	0.008234	yes	CLNTRN
chr1_2349222_G_A_b38	MORN1	-5.224	3.3e-07	-0.042052	90	0.008049	yes	CLNTRN
chr1_2346801_C_T_b38	MORN1	-5.106	5.88e-07	-0.041291	90	0.008086	yes	CLNTRN
chr1_2094608_G_A_b38	MORN1	-4.571	7.12e-06	-0.110799	3	0.024238	yes	CLNTRN
chr1_2363829_A_T_b38	MORN1	-4.554	7.68e-06	-0.036302	45	0.007971	yes	CLNTRN
chr1_2359472_G_A_b38	MORN1	4.339	1.97e-05	0.034501	53	0.007952	yes	CLNTRN
chr1_2355481_C_T_b38	MORN1	4.263	2.72e-05	0.079938	5	0.018753	yes	CLNTRN
chr1_2364608_C_A_b38	MORN1	4.263	2.72e-05	0.079938	5	0.018753	yes	CLNTRN
chr1_2340787_C_T_b38	MORN1	-4.127	4.79e-05	-0.035539	34	0.008612	yes	CLNTRN
chr1_2369187_T_TA_b38	MORN1	4.076	5.89e-05	0.074275	5	0.018224	yes	CLNTRN
chr1_2359219_C_T_b38	MORN1	4.013	7.6e-05	0.078085	5	0.019458	yes	CLNTRN
chr1_2345442_G_A_b38	MORN1	3.995	8.15e-05	0.081084	4	0.020294	yes	CLNTRN
chr1_2320961_AG_A_b38	MORN1	3.921	0.000109	0.035376	28	0.009021	yes	CLNTRN
chr1_2345953_G_A_b38	MORN1	3.881	0.000128	0.078155	4	0.020138	yes	CLNTRN
chr1_2354645_C_T_b38	MORN1	-3.834	0.000154	-0.040783	14	0.010638	yes	CLNTRN
chr1_2354688_G_C_b38	MORN1	-3.834	0.000154	-0.040783	14	0.010638	yes	CLNTRN
chr1_2362229_A_G_b38	MORN1	-3.834	0.000154	-0.040783	14	0.010638	yes	CLNTRN
chr1_2350287_A_C_b38	MORN1	-3.812	0.000168	-0.040544	11	0.010636	yes	CLNTRN
chr1_2351722_A_G_b38	MORN1	3.805	0.000172	0.038684	31	0.010166	yes	CLNTRN
chr1_2357811_C_G_b38	MORN1	-3.795	0.000179	-0.040556	11	0.010685	yes	CLNTRN
chr1_2357812_T_C_b38	MORN1	-3.795	0.000179	-0.040556	11	0.010685	yes	CLNTRN
chr1_2359828_A_G_b38	MORN1	-3.795	0.000179	-0.040556	11	0.010685	yes	CLNTRN
chr1_2363591_T_G_b38	MORN1	-3.795	0.000179	-0.040556	11	0.010685	yes	CLNTRN
chr1_2367871_C_T_b38	MORN1	-3.795	0.000179	-0.040556	11	0.010685	yes	CLNTRN
chr1_2353047_C_T_b38	MORN1	-3.779	0.000191	-0.040176	11	0.010632	yes	CLNTRN
chr1_2348590_C_T_b38	MORN1	3.76	0.000204	0.071862	7	0.019111	yes	CLNTRN
chr1_2364876_C_T_b38	MORN1	3.724	0.000235	0.071994	5	0.019333	yes	CLNTRN
chr1_2346676_G_C_b38	MORN1	-3.684	0.000273	-0.039198	11	0.01064	yes	CLNTRN
chr1_2315074_A_G_b38	MORN1	-3.681	0.000276	-0.032762	31	0.0089	yes	CLNTRN
chr1_2362863_C_CA_b38	MORN1	-3.679	0.000278	-0.041063	10	0.011163	yes	CLNTRN
chr1_2337211_C_G_b38	MORN1	3.678	0.000279	0.030569	48	0.008312	yes	CLNTRN
chr1_2338460_T_C_b38	MORN1	3.67	0.000287	0.029694	56	0.008091	yes	CLNTRN
chr1_2345148_G_A_b38	MORN1	-3.638	0.000324	-0.046354	5	0.012742	yes	CLNTRN
chr1_2319680_A_G_b38	MORN1	3.638	0.000324	0.033029	24	0.009079	yes	CLNTRN
chr1_2338659_A_G_b38	MORN1	3.626	0.000339	0.029054	74	0.008013	yes	CLNTRN
chr1_2344932_C_A_b38	MORN1	-3.603	0.000369	-0.038484	11	0.010681	yes	CLNTRN
chr1_2351215_T_G_b38	MORN1	-3.6	0.000373	-0.037798	15	0.0105	yes	CLNTRN
chr1_2319909_G_A_b38	MORN1	3.594	0.000381	0.032439	26	0.009025	yes	CLNTRN
chr1_2369336_A_G_b38	MORN1	-3.583	0.000397	-0.037567	12	0.010485	yes	CLNTRN
chr1_2320766_C_T_b38	MORN1	3.524	0.000491	0.039872	9	0.011313	yes	CLNTRN
chr1_2320752_A_G_b38	MORN1	3.524	0.000492	0.033037	21	0.009375	yes	CLNTRN
chr1_2320543_C_T_b38	MORN1	3.492	0.000553	0.032508	21	0.00931	yes	CLNTRN
chr1_2150203_C_A_b38	MORN1	3.477	0.000583	0.04366	8	0.012557	yes	CLNTRN
chr1_2196630_A_G_b38	MORN1	3.469	6e-04	0.038882	19	0.011209	yes	CLNTRN
chr1_2193733_G_A_b38	MORN1	3.468	0.000601	0.039938	19	0.011515	yes	CLNTRN
chr1_2186119_C_T_b38	MORN1	3.461	0.000618	0.044091	6	0.012741	yes	CLNTRN
chr1_2319721_T_C_b38	MORN1	3.459	0.000621	0.031398	25	0.009077	yes	CLNTRN
chr1_2314194_C_T_b38	MORN1	-3.447	0.000648	-0.030972	33	0.008984	yes	CLNTRN
chr1_2365220_A_G_b38	MORN1	-3.419	0.000715	-0.038074	10	0.011135	yes	CLNTRN
chr1_2369713_ATAAT_A_b38	MORN1	-3.413	0.000731	-0.035518	11	0.010406	yes	CLNTRN
chr1_2348393_G_A_b38	MORN1	-3.395	0.000781	-0.034473	15	0.010155	yes	CLNTRN
chr1_2210401_C_A_b38	MORN1	3.37	0.00085	0.038896	20	0.011541	yes	CLNTRN
chr1_2380956_C_T_b38	MORN1	-3.35	0.000912	-0.035965	12	0.010736	yes	CLNTRN
chr1_2382101_A_G_b38	MORN1	-3.35	0.000912	-0.035965	12	0.010736	yes	CLNTRN
chr1_2360913_G_A_b38	MORN1	3.348	0.00092	0.032771	24	0.009789	yes	CLNTRN
chr1_2204887_GCCCTCAAGCCCCGC_G_b38	MORN1	3.338	0.000952	0.039719	16	0.011899	yes	CLNTRN
chr1_2314000_T_C_b38	MORN1	-3.335	0.000963	-0.030091	32	0.009024	yes	CLNTRN
chr1_2300128_G_T_b38	MORN1	-3.325	0.000994	-0.02683	90	0.008068	yes	CLNTRN
chr1_2316943_G_GC_b38	MORN1	-3.304	0.00107	-0.030278	26	0.009165	yes	CLNTRN
chr1_2316944_G_T_b38	MORN1	-3.304	0.00107	-0.030278	26	0.009165	yes	CLNTRN
chr1_1504291_C_G_b38	MORN1	3.303	0.00107	0.068295	4	0.020678	yes	CLNTRN
chr1_1504666_AAGAG_A_b38	MORN1	3.303	0.00107	0.068295	4	0.020678	yes	CLNTRN
chr1_2313782_C_T_b38	MORN1	-3.288	0.00113	-0.029686	38	0.00903	yes	CLNTRN
chr1_2359882_C_CAA_b38	MORN1	3.286	0.00114	0.033367	16	0.010153	yes	CLNTRN
chr1_2337229_A_G_b38	MORN1	3.272	0.00119	0.027675	71	0.008458	yes	CLNTRN
chr1_2204652_A_G_b38	MORN1	3.263	0.00123	0.037629	21	0.011531	yes	CLNTRN
chr1_2314848_G_C_b38	MORN1	-3.201	0.00152	-0.028747	37	0.00898	yes	CLNTRN
chr1_2138661_C_T_b38	MORN1	3.185	0.0016	0.042743	4	0.013418	yes	CLNTRN
chr1_2337352_A_G_b38	MORN1	3.179	0.00163	0.026775	54	0.008423	yes	CLNTRN
chr1_2392569_C_T_b38	MORN1	-3.161	0.00174	-0.033569	12	0.01062	yes	CLNTRN
chr1_2308567_T_C_b38	MORN1	-3.157	0.00176	-0.034377	9	0.01089	yes	CLNTRN
chr1_2207925_T_C_b38	MORN1	3.155	0.00177	0.037687	4	0.011946	yes	CLNTRN
chr1_2304233_C_T_b38	MORN1	3.11	0.00205	0.035421	19	0.01139	yes	CLNTRN
chr1_2337141_G_A_b38	MORN1	3.098	0.00214	0.026526	36	0.008563	yes	CLNTRN
chr1_2972054_G_T_b38	MORN1	-3.064	0.00238	-0.027022	75	0.008818	yes	CLNTRN
chr1_2321320_A_G_b38	MORN1	3.063	0.00239	0.02621	51	0.008557	yes	CLNTRN
chr1_2319918_C_A_b38	MORN1	3.061	0.00241	0.027528	33	0.008993	yes	CLNTRN
chr1_2205698_G_A_b38	MORN1	3.006	0.00287	0.035592	19	0.01184	yes	CLNTRN
chr1_2140299_C_T_b38	MORN1	2.991	0.00301	0.039999	4	0.013373	yes	CLNTRN
chr1_2194503_C_G_b38	MORN1	2.946	0.00347	0.025504	58	0.008656	yes	CLNTRN
chr1_2296236_A_C_b38	MORN1	-2.908	0.00392	-0.042704	3	0.014687	yes	CLNTRN
chr1_2383824_C_G_b38	MORN1	-2.87	0.0044	-0.023758	56	0.008278	yes	CLNTRN
chr1_2341692_GA_G_b38	MORN1	2.866	0.00446	0.023877	46	0.008333	yes	CLNTRN
chr1_2312079_C_T_b38	MORN1	-2.863	0.0045	-0.02851	16	0.009958	yes	CLNTRN
chr1_2142665_G_T_b38	MORN1	2.846	0.00473	0.036909	6	0.012967	yes	CLNTRN
chr1_2145827_G_A_b38	MORN1	2.846	0.00473	0.036909	6	0.012967	yes	CLNTRN
chr1_2245578_C_T_b38	MORN1	-2.816	0.00519	-0.031662	15	0.011245	yes	CLNTRN
chr1_2352405_G_A_b38	MORN1	2.814	0.00523	0.063219	3	0.022469	yes	CLNTRN
chr1_1425750_T_C_b38	MORN1	2.803	0.0054	0.040498	5	0.014449	yes	CLNTRN
chr1_2291705_TG_T_b38	MORN1	-2.795	0.00553	-0.033356	5	0.011935	yes	CLNTRN
chr1_2317797_G_A_b38	MORN1	-2.773	0.0059	-0.025599	26	0.00923	yes	CLNTRN
chr1_2382880_T_C_b38	MORN1	-2.759	0.00616	-0.038766	4	0.014052	yes	CLNTRN
chr1_2197362_G_C_b38	MORN1	2.755	0.00624	0.038999	4	0.014158	yes	CLNTRN
chr1_2275005_A_G_b38	MORN1	2.737	0.00657	0.028406	13	0.010379	yes	CLNTRN
chr1_2974565_G_A_b38	MORN1	2.728	0.00676	0.043027	12	0.015774	yes	CLNTRN
chr1_2106518_A_G_b38	MORN1	-2.715	0.00701	-0.060273	3	0.0222	yes	CLNTRN
chr1_2750800_C_A_b38	MORN1	-2.71	0.00711	-0.075018	3	0.027677	yes	CLNTRN
chr1_2364484_C_T_b38	MORN1	-2.707	0.00718	-0.030419	11	0.011237	yes	CLNTRN
chr1_2384876_A_G_b38	MORN1	-2.699	0.00735	-0.021981	81	0.008144	yes	CLNTRN
chr1_2169620_C_G_b38	MORN1	2.699	0.00735	0.034806	6	0.012896	yes	CLNTRN
chr1_2155277_GTGA_G_b38	MORN1	2.683	0.0077	0.035532	5	0.013243	yes	CLNTRN
chr1_2369355_G_GA_b38	MORN1	-2.674	0.00791	-0.025371	31	0.009488	yes	CLNTRN
chr1_2063845_CT_C_b38	MORN1	-2.658	0.00829	-0.034148	4	0.012848	yes	CLNTRN
chr1_2144375_C_T_b38	MORN1	2.639	0.00876	0.035291	4	0.013374	yes	CLNTRN
chr1_2151066_C_T_b38	MORN1	2.639	0.00876	0.035291	4	0.013374	yes	CLNTRN
chr1_2156118_T_C_b38	MORN1	2.639	0.00876	0.035291	4	0.013374	yes	CLNTRN
chr1_2157493_C_T_b38	MORN1	2.639	0.00876	0.035291	4	0.013374	yes	CLNTRN
chr1_2189294_T_TG_b38	MORN1	-2.635	0.00886	-0.026245	13	0.009961	yes	CLNTRN
chr1_2106511_C_CT_b38	MORN1	-2.635	0.00887	-0.054813	3	0.020806	yes	CLNTRN
chr1_2384241_A_G_b38	MORN1	-2.62	0.00926	-0.021282	84	0.008124	yes	CLNTRN
chr1_2160844_C_T_b38	MORN1	2.618	0.0093	0.034684	5	0.013248	yes	CLNTRN
chr1_2302812_A_G_b38	MORN1	-2.605	0.00964	-0.031602	4	0.01213	yes	CLNTRN
chr1_2971111_G_C_b38	MORN1	-2.596	0.00989	-0.023135	67	0.008911	yes	CLNTRN
chr1_2973781_G_A_b38	MORN1	-2.596	0.00989	-0.023135	67	0.008911	yes	CLNTRN
chr1_2974150_C_T_b38	MORN1	-2.596	0.00989	-0.023135	67	0.008911	yes	CLNTRN
chr1_2970854_T_A_b38	MORN1	-2.596	0.00991	-0.023133	65	0.008912	yes	CLNTRN
chr1_2970997_G_GC_b38	MORN1	-2.596	0.00991	-0.023133	65	0.008912	yes	CLNTRN
chr1_2348378_C_T_b38	MORN1	5.734	2.42e-08	0.051203	27	0.00893	no	CLNTRN
chr1_2350696_G_A_b38	MORN1	5.668	3.42e-08	0.050384	28	0.008889	no	CLNTRN
chr1_2356409_G_C_b38	MORN1	5.619	4.43e-08	0.04984	34	0.008871	no	CLNTRN
chr1_2364657_A_T_b38	MORN1	-5.34	1.85e-07	-0.042021	86	0.00787	no	CLNTRN
chr1_2364658_A_T_b38	MORN1	-5.34	1.85e-07	-0.042021	86	0.00787	no	CLNTRN
chr1_2366021_T_C_b38	MORN1	-5.3	2.26e-07	-0.043136	81	0.008138	no	CLNTRN
chr1_2350539_T_G_b38	MORN1	-5.231	3.19e-07	-0.042019	83	0.008033	no	CLNTRN
chr1_2367055_C_A_b38	MORN1	4.194	3.62e-05	0.038662	20	0.009218	no	CLNTRN
chr1_2357882_G_A_b38	MORN1	3.916	0.000112	0.037486	17	0.009573	no	CLNTRN
chr1_2356095_C_T_b38	MORN1	3.864	0.000137	0.037458	16	0.009695	no	CLNTRN
chr1_2351551_C_T_b38	MORN1	3.801	0.000175	0.037365	15	0.009831	no	CLNTRN
chr1_2344757_C_A_b38	MORN1	3.791	0.000182	0.036523	16	0.009634	no	CLNTRN
chr1_2344761_T_A_b38	MORN1	3.791	0.000182	0.036523	16	0.009634	no	CLNTRN
chr1_2345727_G_A_b38	MORN1	3.791	0.000182	0.036523	16	0.009634	no	CLNTRN
chr1_2350934_C_T_b38	MORN1	3.791	0.000182	0.036523	16	0.009634	no	CLNTRN
chr1_2344980_A_G_b38	MORN1	3.769	0.000198	0.03532	18	0.009372	no	CLNTRN
chr1_2345774_T_C_b38	MORN1	3.769	0.000198	0.03532	18	0.009372	no	CLNTRN
chr1_2345849_ACACACAG_A_b38	MORN1	3.745	0.000217	0.036454	14	0.009735	no	CLNTRN
chr1_2344634_T_C_b38	MORN1	3.662	0.000296	0.035093	16	0.009583	no	CLNTRN
chr1_2350750_AGGGGTGGCACG_A_b38	MORN1	-3.655	0.000304	-0.035558	17	0.009728	no	CLNTRN
chr1_1523574_C_T_b38	MORN1	3.638	0.000324	0.08002	3	0.021997	no	CLNTRN
chr1_2338570_C_T_b38	MORN1	3.544	0.000457	0.029092	51	0.008209	no	CLNTRN
chr1_2351678_C_T_b38	MORN1	-3.518	0.000502	-0.036843	14	0.010472	no	CLNTRN
chr1_2340235_T_C_b38	MORN1	3.478	0.00058	0.030744	27	0.008839	no	CLNTRN
chr1_2344256_A_T_b38	MORN1	3.472	0.000593	0.032702	18	0.009418	no	CLNTRN
chr1_2750742_T_C_b38	MORN1	-3.362	0.000876	-0.054009	4	0.016066	no	CLNTRN
chr1_2346111_G_C_b38	MORN1	-3.354	0.000901	-0.02721	72	0.008113	no	CLNTRN
chr1_1763635_AG_A_b38	MORN1	3.336	0.000957	0.057727	5	0.017303	no	CLNTRN
chr1_2189331_C_CA_b38	MORN1	3.325	0.000996	0.043939	3	0.013215	no	CLNTRN
chr1_2344583_G_A_b38	MORN1	3.302	0.00108	0.030712	19	0.009303	no	CLNTRN
chr1_2291684_T_C_b38	MORN1	-3.293	0.00111	-0.039552	4	0.012013	no	CLNTRN
chr1_2297717_C_T_b38	MORN1	-3.278	0.00117	-0.034616	16	0.010561	no	CLNTRN
chr1_2316048_A_G_b38	MORN1	-3.257	0.00126	-0.030001	24	0.009211	no	CLNTRN
chr1_2340425_C_T_b38	MORN1	-3.256	0.00126	-0.026439	73	0.00812	no	CLNTRN
chr1_2347542_C_T_b38	MORN1	-3.229	0.00138	-0.026034	75	0.008064	no	CLNTRN
chr1_2344932_C_T_b38	MORN1	3.177	0.00164	0.031904	13	0.010041	no	CLNTRN
chr1_2347212_C_T_b38	MORN1	-3.169	0.00169	-0.032732	14	0.01033	no	CLNTRN
chr1_2315960_T_C_b38	MORN1	-3.159	0.00174	-0.029376	23	0.009298	no	CLNTRN
chr1_2342133_C_G_b38	MORN1	-3.127	0.00194	-0.034367	12	0.010989	no	CLNTRN
chr1_2342137_G_A_b38	MORN1	-3.127	0.00194	-0.034367	12	0.010989	no	CLNTRN
chr1_2340807_G_A_b38	MORN1	3.081	0.00226	0.028115	23	0.009125	no	CLNTRN
chr1_2316546_T_C_b38	MORN1	-3.072	0.00233	-0.028033	27	0.009126	no	CLNTRN
chr1_2341451_G_A_b38	MORN1	3.05	0.00249	0.027869	23	0.009137	no	CLNTRN
chr1_3000609_T_TA_b38	MORN1	3.044	0.00254	0.030658	46	0.01007	no	CLNTRN
chr1_2343445_C_T_b38	MORN1	3.032	0.00264	0.02738	23	0.009031	no	CLNTRN
chr1_2291121_A_G_b38	MORN1	-3.001	0.00292	-0.036488	4	0.012157	no	CLNTRN
chr1_2291144_T_C_b38	MORN1	-3.001	0.00292	-0.036488	4	0.012157	no	CLNTRN
chr1_2291819_T_C_b38	MORN1	-3.001	0.00292	-0.036488	4	0.012157	no	CLNTRN
chr1_2292843_A_G_b38	MORN1	-3.001	0.00292	-0.036488	4	0.012157	no	CLNTRN
chr1_2207111_G_C_b38	MORN1	2.994	0.00299	0.043025	4	0.014372	no	CLNTRN
chr1_2949213_T_C_b38	MORN1	2.957	0.00336	0.069959	3	0.023659	no	CLNTRN
chr1_2340625_G_A_b38	MORN1	2.955	0.00337	0.026668	24	0.009023	no	CLNTRN
chr1_2341705_A_G_b38	MORN1	2.932	0.00364	0.024108	81	0.008224	no	CLNTRN
chr1_2343937_T_G_b38	MORN1	-2.906	0.00393	-0.023862	59	0.008211	no	CLNTRN
chr1_2369118_G_A_b38	MORN1	-2.872	0.00438	-0.030137	14	0.010495	no	CLNTRN
chr1_2293206_A_G_b38	MORN1	-2.841	0.0048	-0.034519	4	0.012149	no	CLNTRN
chr1_2298478_C_T_b38	MORN1	-2.832	0.00495	-0.029848	16	0.010541	no	CLNTRN
chr1_2340764_G_T_b38	MORN1	2.821	0.00511	0.025235	25	0.008946	no	CLNTRN
chr1_2340564_G_A_b38	MORN1	2.816	0.00519	0.026135	20	0.00928	no	CLNTRN
chr1_2293170_T_G_b38	MORN1	-2.778	0.00582	-0.033967	4	0.012228	no	CLNTRN
chr1_2137467_G_T_b38	MORN1	-2.775	0.00587	-0.035839	5	0.012916	no	CLNTRN
chr1_2151390_G_A_b38	MORN1	2.752	0.00628	0.038691	4	0.014058	no	CLNTRN
chr1_2305258_A_G_b38	MORN1	-2.735	0.0066	-0.033911	4	0.012397	no	CLNTRN
chr1_2298008_A_G_b38	MORN1	-2.733	0.00665	-0.033076	4	0.012102	no	CLNTRN
chr1_2298114_C_T_b38	MORN1	-2.733	0.00665	-0.033076	4	0.012102	no	CLNTRN
chr1_2164982_T_C_b38	MORN1	2.73	0.0067	0.036327	4	0.013304	no	CLNTRN
chr1_2166847_C_T_b38	MORN1	2.729	0.00673	0.035587	6	0.013039	no	CLNTRN
chr1_1716710_G_T_b38	MORN1	2.718	0.00695	0.072389	3	0.02663	no	CLNTRN
chr1_2370252_G_A_b38	MORN1	2.717	0.00697	0.028105	12	0.010344	no	CLNTRN
chr1_1732892_C_CT_b38	MORN1	2.705	0.00724	0.05205	3	0.019246	no	CLNTRN
chr1_2197209_G_A_b38	MORN1	2.701	0.00732	0.038074	4	0.014099	no	CLNTRN
chr1_2197378_G_GA_b38	MORN1	2.701	0.00732	0.038074	4	0.014099	no	CLNTRN
chr1_2197391_G_A_b38	MORN1	2.701	0.00732	0.038074	4	0.014099	no	CLNTRN
chr1_2294894_T_A_b38	MORN1	-2.67	0.008	-0.032526	4	0.012181	no	CLNTRN
chr1_2364339_A_C_b38	MORN1	-8.552	8.66e-16	-0.073736	50	0.008622	yes	ESPGSJ
chr1_2367872_A_G_b38	MORN1	-8.547	8.99e-16	-0.073986	52	0.008656	yes	ESPGSJ
chr1_2368188_T_C_b38	MORN1	-8.547	8.99e-16	-0.073986	52	0.008656	yes	ESPGSJ
chr1_2368473_T_C_b38	MORN1	-8.494	1.29e-15	-0.073769	54	0.008685	yes	ESPGSJ
chr1_2366816_A_G_b38	MORN1	-8.37	2.99e-15	-0.073126	49	0.008737	yes	ESPGSJ
chr1_2366956_CAAAATACATAGA_C_b38	MORN1	-8.022	3.04e-14	-0.071033	49	0.008854	yes	ESPGSJ
chr1_2365333_G_A_b38	MORN1	-7.97	4.29e-14	-0.070103	47	0.008795	yes	ESPGSJ
chr1_2343517_G_A_b38	MORN1	-7.947	4.99e-14	-0.070332	45	0.00885	yes	ESPGSJ
chr1_2366555_G_C_b38	MORN1	-7.802	1.28e-13	-0.068158	49	0.008735	yes	ESPGSJ
chr1_2352756_T_C_b38	MORN1	-7.764	1.65e-13	-0.068402	48	0.008811	yes	ESPGSJ
chr1_2351241_C_T_b38	MORN1	-7.74	1.92e-13	-0.068915	48	0.008903	yes	ESPGSJ
chr1_2343699_C_T_b38	MORN1	-7.679	2.85e-13	-0.068616	45	0.008936	yes	ESPGSJ
chr1_2366496_A_T_b38	MORN1	-7.638	3.71e-13	-0.06766	48	0.008859	yes	ESPGSJ
chr1_2367799_C_T_b38	MORN1	-7.63	3.9e-13	-0.067393	49	0.008833	yes	ESPGSJ
chr1_2367197_G_A_b38	MORN1	-7.63	3.91e-13	-0.067375	48	0.008831	yes	ESPGSJ
chr1_2365236_C_T_b38	MORN1	-7.627	3.98e-13	-0.067786	47	0.008888	yes	ESPGSJ
chr1_2366243_C_T_b38	MORN1	-7.614	4.33e-13	-0.06762	47	0.008882	yes	ESPGSJ
chr1_2368718_C_A_b38	MORN1	-7.597	4.8e-13	-0.067703	47	0.008911	yes	ESPGSJ
chr1_2348700_C_T_b38	MORN1	-7.509	8.41e-13	-0.069461	42	0.00925	yes	ESPGSJ
chr1_2368939_G_C_b38	MORN1	-7.486	9.74e-13	-0.066577	48	0.008894	yes	ESPGSJ
chr1_2369210_C_T_b38	MORN1	-7.411	1.57e-12	-0.064489	53	0.008702	yes	ESPGSJ
chr1_2367456_C_CAA_b38	MORN1	-6.724	1.03e-10	-0.064446	33	0.009585	yes	ESPGSJ
chr1_2343937_T_G_b38	MORN1	-6.532	3.15e-10	-0.059529	60	0.009114	yes	ESPGSJ
chr1_2363829_A_T_b38	MORN1	-6.511	3.56e-10	-0.057393	46	0.008815	yes	ESPGSJ
chr1_2369336_A_G_b38	MORN1	-5.534	7.3e-08	-0.062056	15	0.011213	yes	ESPGSJ
chr1_2365220_A_G_b38	MORN1	-5.471	1.01e-07	-0.064067	12	0.011711	yes	ESPGSJ
chr1_2350287_A_C_b38	MORN1	-5.369	1.69e-07	-0.061165	14	0.011392	yes	ESPGSJ
chr1_2353047_C_T_b38	MORN1	-5.369	1.69e-07	-0.061165	14	0.011392	yes	ESPGSJ
chr1_2346676_G_C_b38	MORN1	-5.344	1.91e-07	-0.061066	14	0.011427	yes	ESPGSJ
chr1_2340787_C_T_b38	MORN1	-5.288	2.53e-07	-0.052109	30	0.009854	yes	ESPGSJ
chr1_2364499_A_G_b38	MORN1	5.288	2.53e-07	0.055205	27	0.010439	yes	ESPGSJ
chr1_2344932_C_A_b38	MORN1	-5.281	2.62e-07	-0.06024	14	0.011406	yes	ESPGSJ
chr1_2357811_C_G_b38	MORN1	-5.277	2.68e-07	-0.059823	14	0.011337	yes	ESPGSJ
chr1_2357812_T_C_b38	MORN1	-5.277	2.68e-07	-0.059823	14	0.011337	yes	ESPGSJ
chr1_2359828_A_G_b38	MORN1	-5.277	2.68e-07	-0.059823	14	0.011337	yes	ESPGSJ
chr1_2363591_T_G_b38	MORN1	-5.277	2.68e-07	-0.059823	14	0.011337	yes	ESPGSJ
chr1_2367871_C_T_b38	MORN1	-5.277	2.68e-07	-0.059823	14	0.011337	yes	ESPGSJ
chr1_2362718_G_A_b38	MORN1	5.271	2.75e-07	0.056146	24	0.010651	yes	ESPGSJ
chr1_2363405_C_T_b38	MORN1	5.053	7.96e-07	0.053463	30	0.01058	yes	ESPGSJ
chr1_2357308_T_C_b38	MORN1	5.003	1.01e-06	0.04466	77	0.008926	yes	ESPGSJ
chr1_2369713_ATAAT_A_b38	MORN1	-4.892	1.71e-06	-0.054354	15	0.011112	yes	ESPGSJ
chr1_2364484_C_T_b38	MORN1	-4.867	1.91e-06	-0.056453	16	0.011599	yes	ESPGSJ
chr1_2359472_G_A_b38	MORN1	4.739	3.46e-06	0.042348	56	0.008937	yes	ESPGSJ
chr1_2352403_G_T_b38	MORN1	4.733	3.56e-06	0.042128	74	0.008902	yes	ESPGSJ
chr1_2352457_A_G_b38	MORN1	4.711	3.93e-06	0.041919	75	0.008899	yes	ESPGSJ
chr1_2353459_T_G_b38	MORN1	4.711	3.93e-06	0.041919	75	0.008899	yes	ESPGSJ
chr1_2356177_T_C_b38	MORN1	4.711	3.93e-06	0.041919	75	0.008899	yes	ESPGSJ
chr1_2360716_T_C_b38	MORN1	4.705	4.02e-06	0.041793	74	0.008882	yes	ESPGSJ
chr1_2360970_T_C_b38	MORN1	4.705	4.02e-06	0.041793	74	0.008882	yes	ESPGSJ
chr1_2361332_A_AG_b38	MORN1	4.705	4.02e-06	0.041793	74	0.008882	yes	ESPGSJ
chr1_2361548_A_ACT_b38	MORN1	4.705	4.02e-06	0.041793	74	0.008882	yes	ESPGSJ
chr1_2356409_G_C_b38	MORN1	4.659	4.96e-06	0.050329	27	0.010802	yes	ESPGSJ
chr1_2358849_T_C_b38	MORN1	4.636	5.51e-06	0.041233	74	0.008895	yes	ESPGSJ
chr1_2353743_A_T_b38	MORN1	4.584	6.94e-06	0.049197	34	0.010732	yes	ESPGSJ
chr1_2369355_G_GA_b38	MORN1	-4.558	7.78e-06	-0.046257	33	0.010148	yes	ESPGSJ
chr1_2345148_G_A_b38	MORN1	-4.215	3.39e-05	-0.058637	6	0.01391	yes	ESPGSJ
chr1_2350750_AGGGGTGGCACG_A_b38	MORN1	-4.16	4.26e-05	-0.050595	14	0.012162	yes	ESPGSJ
chr1_2354645_C_T_b38	MORN1	-4.092	5.63e-05	-0.051798	11	0.012658	yes	ESPGSJ
chr1_2354688_G_C_b38	MORN1	-4.092	5.63e-05	-0.051798	11	0.012658	yes	ESPGSJ
chr1_2342133_C_G_b38	MORN1	-3.952	9.89e-05	-0.052414	9	0.013264	yes	ESPGSJ
chr1_2342137_G_A_b38	MORN1	-3.952	9.89e-05	-0.052414	9	0.013264	yes	ESPGSJ
chr1_2347212_C_T_b38	MORN1	-3.934	0.000106	-0.049122	11	0.012487	yes	ESPGSJ
chr1_2362229_A_G_b38	MORN1	-3.931	0.000107	-0.049991	11	0.012717	yes	ESPGSJ
chr1_1791172_A_AT_b38	MORN1	-3.916	0.000114	-0.050827	12	0.012981	yes	ESPGSJ
chr1_2351215_T_G_b38	MORN1	-3.804	0.000175	-0.047911	12	0.012594	yes	ESPGSJ
chr1_2351678_C_T_b38	MORN1	-3.774	0.000197	-0.047111	12	0.012483	yes	ESPGSJ
chr1_2362863_C_CA_b38	MORN1	-3.652	0.000311	-0.048704	8	0.013336	yes	ESPGSJ
chr1_2166847_C_T_b38	MORN1	3.645	0.00032	0.054202	5	0.01487	yes	ESPGSJ
chr1_2359882_C_CAA_b38	MORN1	3.642	0.000323	0.045095	12	0.012382	yes	ESPGSJ
chr1_2348393_G_A_b38	MORN1	-3.568	0.000425	-0.044376	12	0.012438	yes	ESPGSJ
chr1_2367644_G_A_b38	MORN1	-3.435	0.000684	-0.034987	45	0.010186	yes	ESPGSJ
chr1_2358373_A_T_b38	MORN1	-3.432	0.000693	-0.043328	10	0.012626	yes	ESPGSJ
chr1_2293437_A_C_b38	MORN1	3.377	0.000838	0.037758	18	0.011179	yes	ESPGSJ
chr1_2142665_G_T_b38	MORN1	3.281	0.00117	0.048612	5	0.014817	yes	ESPGSJ
chr1_2145827_G_A_b38	MORN1	3.281	0.00117	0.048612	5	0.014817	yes	ESPGSJ
chr1_3270678_A_AGAGGAGGACAGTCGGGGAGGACAGTCCCG_b38	MORN1	-3.218	0.00145	-0.039412	34	0.012247	yes	ESPGSJ
chr1_2089466_C_T_b38	MORN1	3.186	0.00161	0.041626	11	0.013066	yes	ESPGSJ
chr1_2210401_C_A_b38	MORN1	3.134	0.00191	0.042425	12	0.013538	yes	ESPGSJ
chr1_3269815_T_G_b38	MORN1	-3.096	0.00216	-0.045827	13	0.0148	yes	ESPGSJ
chr1_3269817_A_AAAGTCC_b38	MORN1	-3.085	0.00225	-0.046018	13	0.014918	yes	ESPGSJ
chr1_3269846_A_AGGGAGGAGGAC_b38	MORN1	-3.037	0.00262	-0.045927	12	0.015123	yes	ESPGSJ
chr1_2204887_GCCCTCAAGCCCCGC_G_b38	MORN1	3.03	0.00268	0.042442	9	0.014009	yes	ESPGSJ
chr1_3181676_G_GTGCAGTCTTACACACGGTCTTACATATGGTCTTACACA_b38	MORN1	-3.023	0.00274	-0.041293	13	0.013658	yes	ESPGSJ
chr1_3278995_G_A_b38	MORN1	-3.023	0.00274	-0.037201	22	0.012307	yes	ESPGSJ
chr1_3273823_T_A_b38	MORN1	-2.97	0.00324	-0.042184	3	0.014203	yes	ESPGSJ
chr1_2169620_C_G_b38	MORN1	2.964	0.00331	0.043926	5	0.014821	yes	ESPGSJ
chr1_2340425_C_T_b38	MORN1	-2.954	0.00341	-0.029085	66	0.009845	yes	ESPGSJ
chr1_2196630_A_G_b38	MORN1	2.931	0.00366	0.039516	12	0.013481	yes	ESPGSJ
chr1_2186119_C_T_b38	MORN1	2.911	0.00389	0.041488	5	0.01425	yes	ESPGSJ
chr1_3268291_G_T_b38	MORN1	-2.896	0.00408	-0.033314	35	0.011503	yes	ESPGSJ
chr1_2346388_G_A_b38	MORN1	-2.859	0.00458	-0.033457	17	0.011704	yes	ESPGSJ
chr1_2348984_A_C_b38	MORN1	-2.859	0.00458	-0.033457	17	0.011704	yes	ESPGSJ
chr1_2351337_G_C_b38	MORN1	-2.859	0.00458	-0.033457	17	0.011704	yes	ESPGSJ
chr1_2353975_G_A_b38	MORN1	-2.859	0.00458	-0.033457	17	0.011704	yes	ESPGSJ
chr1_2355508_A_G_b38	MORN1	-2.859	0.00458	-0.033457	17	0.011704	yes	ESPGSJ
chr1_2356078_T_C_b38	MORN1	-2.859	0.00458	-0.033457	17	0.011704	yes	ESPGSJ
chr1_3269793_A_AGGAGGAGCATAATCCTG_b38	MORN1	-2.855	0.00464	-0.039456	15	0.013822	yes	ESPGSJ
chr1_2189011_G_GA_b38	MORN1	2.845	0.00477	0.029235	38	0.010276	yes	ESPGSJ
chr1_3269813_A_G_b38	MORN1	-2.837	0.00489	-0.0411	14	0.014486	yes	ESPGSJ
chr1_3263322_G_C_b38	MORN1	-2.827	0.00505	-0.032057	20	0.011341	yes	ESPGSJ
chr1_2204652_A_G_b38	MORN1	2.824	0.0051	0.038362	12	0.013586	yes	ESPGSJ
chr1_2391602_T_C_b38	MORN1	-2.814	0.00526	-0.030557	22	0.010861	yes	ESPGSJ
chr1_2369355_G_GAAAA_b38	MORN1	-2.813	0.00527	-0.068132	3	0.024222	yes	ESPGSJ
chr1_3260916_A_G_b38	MORN1	-2.801	0.00545	-0.031073	22	0.011092	yes	ESPGSJ
chr1_3270621_T_G_b38	MORN1	-2.79	0.00564	-0.032014	39	0.011474	yes	ESPGSJ
chr1_3273976_T_TA_b38	MORN1	-2.774	0.00592	-0.046362	8	0.016713	yes	ESPGSJ
chr1_2309937_C_CTT_b38	MORN1	2.7	0.00736	0.027259	36	0.010095	yes	ESPGSJ
chr1_2193733_G_A_b38	MORN1	2.694	0.00749	0.036154	12	0.01342	yes	ESPGSJ
chr1_3271515_A_G_b38	MORN1	-2.694	0.0075	-0.030803	40	0.011434	yes	ESPGSJ
chr1_3272574_A_G_b38	MORN1	-2.694	0.0075	-0.030803	40	0.011434	yes	ESPGSJ
chr1_3273150_A_G_b38	MORN1	-2.694	0.0075	-0.030803	40	0.011434	yes	ESPGSJ
chr1_3276395_A_G_b38	MORN1	-2.694	0.0075	-0.030803	40	0.011434	yes	ESPGSJ
chr1_3273817_AGTGT_A_b38	MORN1	-2.687	0.00764	-0.035507	5	0.013213	yes	ESPGSJ
chr1_2309937_C_CT_b38	MORN1	-2.68	0.00781	-0.024074	90	0.008984	yes	ESPGSJ
chr1_2087423_G_T_b38	MORN1	2.674	0.00795	0.036788	8	0.013758	yes	ESPGSJ
chr1_2092415_G_A_b38	MORN1	2.674	0.00795	0.036788	8	0.013758	yes	ESPGSJ
chr1_2093894_C_T_b38	MORN1	2.674	0.00795	0.036788	8	0.013758	yes	ESPGSJ
chr1_2342466_T_C_b38	MORN1	-2.659	0.0083	-0.027034	53	0.010168	yes	ESPGSJ
chr1_3269600_GACAGTCCCAGAGGAGC_G_b38	MORN1	-2.657	0.00834	-0.033857	24	0.012742	yes	ESPGSJ
chr1_3269030_G_A_b38	MORN1	-2.654	0.00843	-0.033597	25	0.012661	yes	ESPGSJ
chr1_3049439_T_G_b38	MORN1	2.653	0.00843	0.062151	3	0.023423	yes	ESPGSJ
chr1_2379954_A_G_b38	MORN1	-2.651	0.0085	-0.028863	22	0.010889	yes	ESPGSJ
chr1_2359451_C_T_b38	MORN1	-2.651	0.0085	-0.03104	17	0.011711	yes	ESPGSJ
chr1_2360241_T_C_b38	MORN1	-2.651	0.0085	-0.03104	17	0.011711	yes	ESPGSJ
chr1_2361727_G_A_b38	MORN1	-2.651	0.0085	-0.03104	17	0.011711	yes	ESPGSJ
chr1_2325032_T_A_b38	MORN1	2.643	0.00868	0.052768	7	0.019963	yes	ESPGSJ
chr1_2011271_G_GTT_b38	MORN1	-2.638	0.0088	-0.029475	17	0.011171	yes	ESPGSJ
chr1_3253002_G_A_b38	MORN1	-2.614	0.00945	-0.034647	7	0.013255	yes	ESPGSJ
chr1_2364657_A_T_b38	MORN1	-7.45	1.22e-12	-0.066897	71	0.008979	no	ESPGSJ
chr1_2364658_A_T_b38	MORN1	-7.45	1.22e-12	-0.066897	71	0.008979	no	ESPGSJ
chr1_2350539_T_G_b38	MORN1	-7.419	1.49e-12	-0.068469	71	0.009229	no	ESPGSJ
chr1_2349222_G_A_b38	MORN1	-6.925	3.1e-11	-0.064049	81	0.009249	no	ESPGSJ
chr1_2346801_C_T_b38	MORN1	-6.869	4.35e-11	-0.063999	80	0.009318	no	ESPGSJ
chr1_2366021_T_C_b38	MORN1	-6.851	4.84e-11	-0.063686	69	0.009296	no	ESPGSJ
chr1_2346111_G_C_b38	MORN1	-5.861	1.32e-08	-0.055966	62	0.00955	no	ESPGSJ
chr1_2347542_C_T_b38	MORN1	-5.647	4.08e-08	-0.053183	63	0.009418	no	ESPGSJ
chr1_2348378_C_T_b38	MORN1	5.048	8.15e-07	0.055586	23	0.011011	no	ESPGSJ
chr1_2350696_G_A_b38	MORN1	5.048	8.15e-07	0.055586	23	0.011011	no	ESPGSJ
chr1_2357882_G_A_b38	MORN1	4.743	3.4e-06	0.054455	16	0.011482	no	ESPGSJ
chr1_2367055_C_A_b38	MORN1	4.733	3.56e-06	0.051894	20	0.010965	no	ESPGSJ
chr1_2341705_A_G_b38	MORN1	4.69	4.32e-06	0.045159	69	0.00963	no	ESPGSJ
chr1_2356095_C_T_b38	MORN1	4.669	4.74e-06	0.05419	15	0.011606	no	ESPGSJ
chr1_2345849_ACACACAG_A_b38	MORN1	4.433	1.35e-05	0.053716	11	0.012118	no	ESPGSJ
chr1_2338659_A_G_b38	MORN1	4.419	1.43e-05	0.042188	59	0.009547	no	ESPGSJ
chr1_2344757_C_A_b38	MORN1	4.397	1.57e-05	0.051649	15	0.011747	no	ESPGSJ
chr1_2344761_T_A_b38	MORN1	4.397	1.57e-05	0.051649	15	0.011747	no	ESPGSJ
chr1_2345727_G_A_b38	MORN1	4.397	1.57e-05	0.051649	15	0.011747	no	ESPGSJ
chr1_2350934_C_T_b38	MORN1	4.397	1.57e-05	0.051649	15	0.011747	no	ESPGSJ
chr1_2344980_A_G_b38	MORN1	4.366	1.79e-05	0.050455	16	0.011555	no	ESPGSJ
chr1_2345774_T_C_b38	MORN1	4.366	1.79e-05	0.050455	16	0.011555	no	ESPGSJ
chr1_2351551_C_T_b38	MORN1	4.287	2.51e-05	0.051169	14	0.011935	no	ESPGSJ
chr1_2344932_C_T_b38	MORN1	4.257	2.85e-05	0.053055	11	0.012464	no	ESPGSJ
chr1_2344634_T_C_b38	MORN1	4.124	4.93e-05	0.048849	15	0.011844	no	ESPGSJ
chr1_2344256_A_T_b38	MORN1	3.871	0.000136	0.044624	17	0.011528	no	ESPGSJ
chr1_2337352_A_G_b38	MORN1	3.65	0.000314	0.03664	41	0.010039	no	ESPGSJ
chr1_2344583_G_A_b38	MORN1	3.536	0.000477	0.042153	15	0.011921	no	ESPGSJ
chr1_2197362_G_C_b38	MORN1	3.513	0.000518	0.054438	4	0.015496	no	ESPGSJ
chr1_2197378_G_GA_b38	MORN1	3.513	0.000518	0.054438	4	0.015496	no	ESPGSJ
chr1_2197391_G_A_b38	MORN1	3.513	0.000518	0.054438	4	0.015496	no	ESPGSJ
chr1_2343445_C_T_b38	MORN1	3.502	0.000538	0.039712	18	0.011338	no	ESPGSJ
chr1_2197209_G_A_b38	MORN1	3.44	0.000673	0.053981	4	0.015693	no	ESPGSJ
chr1_2175551_ACTCCAACCCCTACACCCCCAACCC_A_b38	MORN1	3.425	0.000708	0.053385	4	0.015585	no	ESPGSJ
chr1_2151390_G_A_b38	MORN1	3.423	0.000714	0.053197	4	0.015541	no	ESPGSJ
chr1_2164801_G_C_b38	MORN1	3.381	0.000827	0.051182	4	0.015138	no	ESPGSJ
chr1_2164982_T_C_b38	MORN1	3.381	0.000827	0.051182	4	0.015138	no	ESPGSJ
chr1_2165199_C_T_b38	MORN1	3.381	0.000827	0.051182	4	0.015138	no	ESPGSJ
chr1_2166938_G_C_b38	MORN1	3.381	0.000827	0.051182	4	0.015138	no	ESPGSJ
chr1_2167392_G_C_b38	MORN1	3.381	0.000827	0.051182	4	0.015138	no	ESPGSJ
chr1_2137467_G_T_b38	MORN1	-3.357	0.000898	-0.049635	4	0.014784	no	ESPGSJ
chr1_2338570_C_T_b38	MORN1	3.337	0.000965	0.032738	45	0.009811	no	ESPGSJ
chr1_2207111_G_C_b38	MORN1	3.318	0.00103	0.052657	4	0.015869	no	ESPGSJ
chr1_1684789_C_CAAAAA_b38	MORN1	-3.294	0.00112	-0.071342	6	0.021659	no	ESPGSJ
chr1_2337299_A_G_b38	MORN1	3.261	0.00125	0.033096	38	0.01015	no	ESPGSJ
chr1_2164950_A_C_b38	MORN1	3.253	0.00129	0.050371	4	0.015485	no	ESPGSJ
chr1_2174439_G_A_b38	MORN1	3.253	0.00129	0.050371	4	0.015485	no	ESPGSJ
chr1_2341451_G_A_b38	MORN1	3.241	0.00134	0.036515	19	0.011266	no	ESPGSJ
chr1_2369118_G_A_b38	MORN1	-3.188	0.0016	-0.039072	13	0.012256	no	ESPGSJ
chr1_2138661_C_T_b38	MORN1	3.181	0.00164	0.048617	4	0.015284	no	ESPGSJ
chr1_2140299_C_T_b38	MORN1	3.181	0.00164	0.048617	4	0.015284	no	ESPGSJ
chr1_2338460_T_C_b38	MORN1	3.171	0.00169	0.031234	48	0.00985	no	ESPGSJ
chr1_2126311_A_C_b38	MORN1	-3.138	0.00189	-0.046874	4	0.014938	no	ESPGSJ
chr1_2126584_A_G_b38	MORN1	-3.138	0.00189	-0.046874	4	0.014938	no	ESPGSJ
chr1_2129937_T_C_b38	MORN1	-3.138	0.00189	-0.046874	4	0.014938	no	ESPGSJ
chr1_3269819_AGG_A_b38	MORN1	-3.099	0.00215	-0.046558	12	0.015026	no	ESPGSJ
chr1_3269841_G_A_b38	MORN1	-3.078	0.0023	-0.046313	12	0.015048	no	ESPGSJ
chr1_3269845_A_AC_b38	MORN1	-3.078	0.0023	-0.046313	12	0.015048	no	ESPGSJ
chr1_3278976_G_A_b38	MORN1	-3.058	0.00245	-0.037836	15	0.012374	no	ESPGSJ
chr1_3269790_C_CCCGGAGGAGGACAGTTGGGAGGACAG_b38	MORN1	-3.054	0.00248	-0.044772	12	0.01466	no	ESPGSJ
chr1_3181692_G_GGTCTTACACATGCAGTCTTACACACGGTCTTACACACGGTCTTACACAGTCTTACACGCGCA_b38	MORN1	-3.051	0.0025	-0.051921	3	0.017018	no	ESPGSJ
chr1_2340807_G_A_b38	MORN1	3.046	0.00254	0.03406	20	0.011181	no	ESPGSJ
chr1_2116145_T_C_b38	MORN1	-3.044	0.00256	-0.045875	4	0.015071	no	ESPGSJ
chr1_3265843_G_C_b38	MORN1	-3.039	0.0026	-0.036827	16	0.012117	no	ESPGSJ
chr1_3266782_T_A_b38	MORN1	-3.039	0.0026	-0.036827	16	0.012117	no	ESPGSJ
chr1_1587082_G_A_b38	MORN1	-3.019	0.00278	-0.044242	5	0.014655	no	ESPGSJ
chr1_2144375_C_T_b38	MORN1	3.018	0.00278	0.045518	4	0.015082	no	ESPGSJ
chr1_2151066_C_T_b38	MORN1	3.018	0.00278	0.045518	4	0.015082	no	ESPGSJ
chr1_2155277_GTGA_G_b38	MORN1	3.018	0.00278	0.045518	4	0.015082	no	ESPGSJ
chr1_2156118_T_C_b38	MORN1	3.018	0.00278	0.045518	4	0.015082	no	ESPGSJ
chr1_2157493_C_T_b38	MORN1	3.018	0.00278	0.045518	4	0.015082	no	ESPGSJ
chr1_3263283_C_T_b38	MORN1	-3.005	0.0029	-0.036293	16	0.012077	no	ESPGSJ
chr1_3263807_A_G_b38	MORN1	-3.005	0.0029	-0.036293	16	0.012077	no	ESPGSJ
chr1_3261547_C_A_b38	MORN1	-2.977	0.00317	-0.035565	17	0.011947	no	ESPGSJ
chr1_2121058_T_C_b38	MORN1	-2.976	0.00318	-0.045293	4	0.015221	no	ESPGSJ
chr1_3258807_T_G_b38	MORN1	-2.958	0.00336	-0.031927	34	0.010793	no	ESPGSJ
chr1_2337211_C_G_b38	MORN1	2.953	0.00342	0.030108	47	0.010195	no	ESPGSJ
chr1_3268507_C_T_b38	MORN1	-2.95	0.00345	-0.036341	15	0.012318	no	ESPGSJ
chr1_3269275_G_A_b38	MORN1	-2.95	0.00345	-0.036341	15	0.012318	no	ESPGSJ
chr1_2907850_TGGTGAGCGAGGTTAGGGTGGGCCCTCC_T_b38	MORN1	2.927	0.00371	0.040841	6	0.013953	no	ESPGSJ
chr1_2187285_C_CT_b38	MORN1	2.925	0.00373	0.044227	5	0.015118	no	ESPGSJ
chr1_2160844_C_T_b38	MORN1	2.918	0.00381	0.044339	4	0.015193	no	ESPGSJ
chr1_2340625_G_A_b38	MORN1	2.913	0.00387	0.032562	21	0.011177	no	ESPGSJ
chr1_3261852_A_G_b38	MORN1	-2.879	0.0043	-0.034747	17	0.012067	no	ESPGSJ
chr1_3262896_T_G_b38	MORN1	-2.879	0.0043	-0.034747	17	0.012067	no	ESPGSJ
chr1_3262909_C_T_b38	MORN1	-2.878	0.00431	-0.035068	16	0.012184	no	ESPGSJ
chr1_3271941_C_T_b38	MORN1	-2.876	0.00435	-0.035379	15	0.012303	no	ESPGSJ
chr1_3275174_A_G_b38	MORN1	-2.876	0.00435	-0.035379	15	0.012303	no	ESPGSJ
chr1_2352564_T_C_b38	MORN1	-2.861	0.00454	-0.033513	17	0.011713	no	ESPGSJ
chr1_3262286_A_G_b38	MORN1	-2.857	0.00461	-0.034407	17	0.012044	no	ESPGSJ
chr1_3265668_C_A_b38	MORN1	-2.855	0.00463	-0.034727	16	0.012162	no	ESPGSJ
chr1_3265674_G_T_b38	MORN1	-2.855	0.00463	-0.034727	16	0.012162	no	ESPGSJ
chr1_3265691_T_A_b38	MORN1	-2.855	0.00463	-0.034727	16	0.012162	no	ESPGSJ
chr1_2364412_G_GTTGT_b38	MORN1	-2.848	0.00473	-0.031551	24	0.011078	no	ESPGSJ
chr1_2085014_GA_G_b38	MORN1	2.793	0.00559	0.037374	6	0.013381	no	ESPGSJ
chr1_2344510_C_G_b38	MORN1	-2.788	0.00567	-0.03694	10	0.013248	no	ESPGSJ
chr1_3259164_A_G_b38	MORN1	-2.776	0.00589	-0.030818	43	0.011103	no	ESPGSJ
chr1_3264069_A_G_b38	MORN1	-2.77	0.006	-0.03098	42	0.011186	no	ESPGSJ
chr1_3265358_A_G_b38	MORN1	-2.77	0.006	-0.03098	42	0.011186	no	ESPGSJ
chr1_2207909_CGTGTGTGT_C_b38	MORN1	2.739	0.00656	0.036053	11	0.013161	no	ESPGSJ
chr1_2175616_T_C_b38	MORN1	2.709	0.00717	0.04128	4	0.015236	no	ESPGSJ
chr1_3265967_A_C_b38	MORN1	-2.703	0.00731	-0.029483	25	0.010909	no	ESPGSJ
chr1_3277784_T_TGCACACACAA_b38	MORN1	-2.674	0.00794	-0.033153	14	0.012398	no	ESPGSJ
chr1_3277786_T_C_b38	MORN1	-2.674	0.00794	-0.033153	14	0.012398	no	ESPGSJ
chr1_2160238_C_CGTGTGTGT_b38	MORN1	2.674	0.00795	0.043647	3	0.016324	no	ESPGSJ
chr1_2976360_A_G_b38	MORN1	2.644	0.00867	0.028453	43	0.010762	no	ESPGSJ
chr1_2966572_G_T_b38	MORN1	2.639	0.00879	0.025898	77	0.009813	no	ESPGSJ
chr1_1764895_A_C_b38	MORN1	-2.637	0.00884	-0.044643	6	0.016929	no	ESPGSJ
chr1_1762664_A_G_b38	MORN1	-2.636	0.00886	-0.046579	4	0.017667	no	ESPGSJ
chr1_1868514_T_C_b38	MORN1	-2.636	0.00886	-0.050724	3	0.01924	no	ESPGSJ
chr1_2096688_G_T_b38	MORN1	2.631	0.00898	0.036184	8	0.01375	no	ESPGSJ
chr1_2340764_G_T_b38	MORN1	2.621	0.00927	0.029078	21	0.011096	no	ESPGSJ
chr1_2118342_G_GT_b38	MORN1	-2.615	0.00942	-0.02517	66	0.009625	no	ESPGSJ
chr1_3264851_G_A_b38	MORN1	-2.608	0.00961	-0.031925	14	0.012242	no	ESPGSJ
chr1_2112545_C_T_b38	MORN1	-2.602	0.00976	-0.038013	5	0.014607	no	ESPGSJ
chr1_3275345_G_A_b38	MORN1	-2.6	0.00983	-0.032922	26	0.012663	no	ESPGSJ
chr1_3277381_G_A_b38	MORN1	-2.6	0.00983	-0.032922	26	0.012663	no	ESPGSJ
chr1_2366021_T_C_b38	MORN1	-6.15	1.78e-09	-0.042581	107	0.006923	yes	ESPMCS
chr1_2364657_A_T_b38	MORN1	-5.978	4.77e-09	-0.04106	111	0.006868	yes	ESPMCS
chr1_2364658_A_T_b38	MORN1	-5.978	4.77e-09	-0.04106	111	0.006868	yes	ESPMCS
chr1_2350539_T_G_b38	MORN1	-5.886	8.01e-09	-0.040502	112	0.006881	yes	ESPMCS
chr1_2346801_C_T_b38	MORN1	-5.402	1.1e-07	-0.038165	125	0.007065	yes	ESPMCS
chr1_2349222_G_A_b38	MORN1	-5.356	1.39e-07	-0.037555	126	0.007011	yes	ESPMCS
chr1_2364499_A_G_b38	MORN1	5.126	4.51e-07	0.039021	43	0.007613	yes	ESPMCS
chr1_2350696_G_A_b38	MORN1	5.1	5.12e-07	0.039284	41	0.007703	yes	ESPMCS
chr1_2362718_G_A_b38	MORN1	5.067	6.02e-07	0.038943	41	0.007685	yes	ESPMCS
chr1_2348378_C_T_b38	MORN1	5.015	7.81e-07	0.038711	40	0.00772	yes	ESPMCS
chr1_2359472_G_A_b38	MORN1	4.962	1.01e-06	0.035642	73	0.007183	yes	ESPMCS
chr1_2357308_T_C_b38	MORN1	4.858	1.67e-06	0.035488	112	0.007304	yes	ESPMCS
chr1_2367055_C_A_b38	MORN1	4.539	7.36e-06	0.036722	28	0.00809	yes	ESPMCS
chr1_2353743_A_T_b38	MORN1	4.385	1.46e-05	0.034128	57	0.007783	yes	ESPMCS
chr1_2356409_G_C_b38	MORN1	4.371	1.55e-05	0.034034	46	0.007786	yes	ESPMCS
chr1_2346111_G_C_b38	MORN1	-4.364	1.6e-05	-0.030884	99	0.007077	yes	ESPMCS
chr1_2345849_ACACACAG_A_b38	MORN1	4.271	2.4e-05	0.036512	21	0.008548	yes	ESPMCS
chr1_2356095_C_T_b38	MORN1	4.221	2.98e-05	0.035694	24	0.008457	yes	ESPMCS
chr1_2345727_G_A_b38	MORN1	4.214	3.07e-05	0.034789	26	0.008256	yes	ESPMCS
chr1_2350934_C_T_b38	MORN1	4.214	3.07e-05	0.034789	26	0.008256	yes	ESPMCS
chr1_2351551_C_T_b38	MORN1	4.201	3.23e-05	0.035162	24	0.008369	yes	ESPMCS
chr1_2344757_C_A_b38	MORN1	4.132	4.32e-05	0.034165	26	0.008267	yes	ESPMCS
chr1_2344761_T_A_b38	MORN1	4.132	4.32e-05	0.034165	26	0.008267	yes	ESPMCS
chr1_2345774_T_C_b38	MORN1	4.132	4.33e-05	0.033505	28	0.008109	yes	ESPMCS
chr1_2344980_A_G_b38	MORN1	4.05	6.09e-05	0.032868	28	0.008116	yes	ESPMCS
chr1_2344634_T_C_b38	MORN1	4.011	7.15e-05	0.03314	26	0.008263	yes	ESPMCS
chr1_2341705_A_G_b38	MORN1	3.951	9.11e-05	0.028346	108	0.007175	yes	ESPMCS
chr1_2344256_A_T_b38	MORN1	3.908	0.000108	0.032002	30	0.008189	yes	ESPMCS
chr1_2344932_C_T_b38	MORN1	3.746	0.000205	0.032352	22	0.008637	yes	ESPMCS
chr1_2753268_T_C_b38	MORN1	-3.677	0.000266	-0.062795	3	0.017079	yes	ESPMCS
chr1_2338460_T_C_b38	MORN1	3.596	0.000361	0.025437	74	0.007074	yes	ESPMCS
chr1_2375533_G_A_b38	MORN1	-3.508	0.000499	-0.02644	60	0.007537	yes	ESPMCS
chr1_2341451_G_A_b38	MORN1	3.472	0.00057	0.027454	36	0.007908	yes	ESPMCS
chr1_2338570_C_T_b38	MORN1	3.45	0.000617	0.024613	68	0.007135	yes	ESPMCS
chr1_2337211_C_G_b38	MORN1	3.437	0.000646	0.02491	72	0.007247	yes	ESPMCS
chr1_2337229_A_G_b38	MORN1	3.374	0.000808	0.024306	102	0.007204	yes	ESPMCS
chr1_2383824_C_G_b38	MORN1	-3.327	0.000954	-0.023616	79	0.007098	yes	ESPMCS
chr1_3356261_C_A_b38	MORN1	-3.2	0.00147	-0.036093	7	0.011278	yes	ESPMCS
chr1_1992764_A_G_b38	MORN1	-3.107	0.00201	-0.062869	9	0.020233	yes	ESPMCS
chr1_2385630_A_C_b38	MORN1	-3.069	0.00229	-0.023363	55	0.007613	yes	ESPMCS
chr1_3082504_T_G_b38	MORN1	-3.005	0.00282	-0.021489	78	0.007152	yes	ESPMCS
chr1_2343445_C_T_b38	MORN1	2.957	0.00328	0.023486	36	0.007943	yes	ESPMCS
chr1_2340807_G_A_b38	MORN1	2.939	0.00347	0.023026	37	0.007834	yes	ESPMCS
chr1_1708501_C_T_b38	MORN1	-2.937	0.00349	-0.073227	4	0.02493	yes	ESPMCS
chr1_2344583_G_A_b38	MORN1	2.906	0.00385	0.023554	31	0.008104	yes	ESPMCS
chr1_1521298_C_CA_b38	MORN1	2.903	0.00389	0.040337	10	0.013894	yes	ESPMCS
chr1_2340564_G_A_b38	MORN1	2.891	0.00404	0.022815	35	0.007893	yes	ESPMCS
chr1_2455297_G_A_b38	MORN1	2.853	0.00455	0.032257	5	0.011308	yes	ESPMCS
chr1_3005456_A_G_b38	MORN1	-2.833	0.00482	-0.055475	5	0.019578	yes	ESPMCS
chr1_2340235_T_C_b38	MORN1	2.815	0.00511	0.021478	44	0.00763	yes	ESPMCS
chr1_3082434_C_G_b38	MORN1	-2.793	0.00546	-0.019999	89	0.007161	yes	ESPMCS
chr1_2340625_G_A_b38	MORN1	2.756	0.0061	0.021404	39	0.007766	yes	ESPMCS
chr1_3003473_G_A_b38	MORN1	-2.735	0.00649	-0.053239	8	0.019465	yes	ESPMCS
chr1_3326233_A_G_b38	MORN1	2.713	0.00693	0.02533	15	0.009335	yes	ESPMCS
chr1_2340425_C_T_b38	MORN1	-2.69	0.00743	-0.019222	98	0.007147	yes	ESPMCS
chr1_1635226_T_C_b38	MORN1	2.67	0.00788	0.027069	11	0.010139	yes	ESPMCS
chr1_2472817_C_T_b38	MORN1	2.654	0.00825	0.019456	67	0.007331	yes	ESPMCS
chr1_2749606_C_T_b38	MORN1	-2.614	0.00927	-0.047151	5	0.018039	yes	ESPMCS
chr1_2364339_A_C_b38	MORN1	-7.435	5.78e-13	-0.052185	74	0.007018	no	ESPMCS
chr1_2367872_A_G_b38	MORN1	-7.429	6.04e-13	-0.051557	79	0.00694	no	ESPMCS
chr1_2368188_T_C_b38	MORN1	-7.429	6.04e-13	-0.051557	79	0.00694	no	ESPMCS
chr1_2366816_A_G_b38	MORN1	-7.373	8.77e-13	-0.051882	72	0.007037	no	ESPMCS
chr1_2368473_T_C_b38	MORN1	-7.102	5.2e-12	-0.049645	82	0.006991	no	ESPMCS
chr1_2366956_CAAAATACATAGA_C_b38	MORN1	-6.91	1.77e-11	-0.047704	77	0.006903	no	ESPMCS
chr1_2366555_G_C_b38	MORN1	-6.821	3.11e-11	-0.048879	71	0.007166	no	ESPMCS
chr1_2352756_T_C_b38	MORN1	-6.746	4.97e-11	-0.048565	71	0.007199	no	ESPMCS
chr1_2351241_C_T_b38	MORN1	-6.734	5.35e-11	-0.049231	69	0.007311	no	ESPMCS
chr1_2366496_A_T_b38	MORN1	-6.679	7.55e-11	-0.048129	70	0.007207	no	ESPMCS
chr1_2368718_C_A_b38	MORN1	-6.656	8.7e-11	-0.047711	69	0.007168	no	ESPMCS
chr1_2367799_C_T_b38	MORN1	-6.63	1.02e-10	-0.047611	71	0.007182	no	ESPMCS
chr1_2343517_G_A_b38	MORN1	-6.579	1.39e-10	-0.048629	62	0.007391	no	ESPMCS
chr1_2368939_G_C_b38	MORN1	-6.526	1.92e-10	-0.046951	70	0.007195	no	ESPMCS
chr1_2365236_C_T_b38	MORN1	-6.523	1.96e-10	-0.046834	69	0.00718	no	ESPMCS
chr1_2367197_G_A_b38	MORN1	-6.509	2.12e-10	-0.047111	69	0.007237	no	ESPMCS
chr1_2366243_C_T_b38	MORN1	-6.496	2.31e-10	-0.04696	69	0.007229	no	ESPMCS
chr1_2343699_C_T_b38	MORN1	-6.479	2.56e-10	-0.047858	62	0.007387	no	ESPMCS
chr1_2365333_G_A_b38	MORN1	-6.416	3.74e-10	-0.046137	69	0.007191	no	ESPMCS
chr1_2348700_C_T_b38	MORN1	-6.13	2.01e-09	-0.046371	60	0.007565	no	ESPMCS
chr1_2367456_C_CAA_b38	MORN1	-5.862	9.2e-09	-0.04521	50	0.007713	no	ESPMCS
chr1_2369210_C_T_b38	MORN1	-5.61	3.64e-08	-0.041039	82	0.007315	no	ESPMCS
chr1_2363829_A_T_b38	MORN1	-5.456	8.26e-08	-0.037529	73	0.006878	no	ESPMCS
chr1_2369336_A_G_b38	MORN1	-5.382	1.22e-07	-0.048158	18	0.008948	no	ESPMCS
chr1_2344932_C_A_b38	MORN1	-5.219	2.82e-07	-0.046617	16	0.008933	no	ESPMCS
chr1_2369713_ATAAT_A_b38	MORN1	-5.179	3.44e-07	-0.046129	19	0.008906	no	ESPMCS
chr1_2353047_C_T_b38	MORN1	-5.159	3.81e-07	-0.046074	16	0.008931	no	ESPMCS
chr1_2340787_C_T_b38	MORN1	-5.091	5.36e-07	-0.039594	45	0.007778	no	ESPMCS
chr1_2367871_C_T_b38	MORN1	-5.075	5.8e-07	-0.045466	16	0.008959	no	ESPMCS
chr1_2350287_A_C_b38	MORN1	-5.038	6.98e-07	-0.044928	16	0.008919	no	ESPMCS
chr1_2363405_C_T_b38	MORN1	5.028	7.32e-07	0.038325	52	0.007623	no	ESPMCS
chr1_2346676_G_C_b38	MORN1	-5.027	7.35e-07	-0.044891	16	0.00893	no	ESPMCS
chr1_2357811_C_G_b38	MORN1	-5.009	8.03e-07	-0.044965	16	0.008977	no	ESPMCS
chr1_2357812_T_C_b38	MORN1	-5.009	8.03e-07	-0.044965	16	0.008977	no	ESPMCS
chr1_2359828_A_G_b38	MORN1	-5.009	8.03e-07	-0.044965	16	0.008977	no	ESPMCS
chr1_2363591_T_G_b38	MORN1	-5.009	8.03e-07	-0.044965	16	0.008977	no	ESPMCS
chr1_2359882_C_CAA_b38	MORN1	4.934	1.16e-06	0.044072	20	0.008933	no	ESPMCS
chr1_2353459_T_G_b38	MORN1	4.891	1.42e-06	0.034931	107	0.007141	no	ESPMCS
chr1_2356177_T_C_b38	MORN1	4.891	1.42e-06	0.034931	107	0.007141	no	ESPMCS
chr1_2365220_A_G_b38	MORN1	-4.858	1.67e-06	-0.044341	15	0.009128	no	ESPMCS
chr1_2343937_T_G_b38	MORN1	-4.826	1.94e-06	-0.035232	88	0.0073	no	ESPMCS
chr1_2352403_G_T_b38	MORN1	4.757	2.69e-06	0.034127	108	0.007173	no	ESPMCS
chr1_2360716_T_C_b38	MORN1	4.755	2.72e-06	0.034112	108	0.007174	no	ESPMCS
chr1_2360970_T_C_b38	MORN1	4.755	2.72e-06	0.034112	108	0.007174	no	ESPMCS
chr1_2361332_A_AG_b38	MORN1	4.755	2.72e-06	0.034112	108	0.007174	no	ESPMCS
chr1_2361548_A_ACT_b38	MORN1	4.755	2.72e-06	0.034112	108	0.007174	no	ESPMCS
chr1_2358849_T_C_b38	MORN1	4.731	3.05e-06	0.033911	108	0.007168	no	ESPMCS
chr1_2352457_A_G_b38	MORN1	4.723	3.16e-06	0.033787	109	0.007154	no	ESPMCS
chr1_2347542_C_T_b38	MORN1	-4.665	4.13e-06	-0.032945	99	0.007062	no	ESPMCS
chr1_2357882_G_A_b38	MORN1	4.384	1.47e-05	0.036727	25	0.008377	no	ESPMCS
chr1_2364484_C_T_b38	MORN1	-4.199	3.26e-05	-0.038605	17	0.009193	no	ESPMCS
chr1_2345148_G_A_b38	MORN1	-3.997	7.56e-05	-0.042335	8	0.010592	no	ESPMCS
chr1_2338659_A_G_b38	MORN1	3.455	0.000606	0.024458	98	0.007079	no	ESPMCS
chr1_2337352_A_G_b38	MORN1	3.366	0.000833	0.024587	74	0.007305	no	ESPMCS
chr1_2380956_C_T_b38	MORN1	-3.323	0.000967	-0.031315	15	0.009423	no	ESPMCS
chr1_2382101_A_G_b38	MORN1	-3.323	0.000967	-0.031315	15	0.009423	no	ESPMCS
chr1_2350750_AGGGGTGGCACG_A_b38	MORN1	-3.236	0.00131	-0.027125	28	0.008384	no	ESPMCS
chr1_2458894_G_T_b38	MORN1	-3.093	0.00211	-0.07636	3	0.024687	no	ESPMCS
chr1_2753279_G_A_b38	MORN1	-3.026	0.00263	-0.051038	3	0.016865	no	ESPMCS
chr1_2392569_C_T_b38	MORN1	-3.002	0.00284	-0.027601	17	0.009193	no	ESPMCS
chr1_2383024_G_T_b38	MORN1	-2.957	0.00328	-0.022311	62	0.007545	no	ESPMCS
chr1_2383716_CA_C_b38	MORN1	-2.957	0.00328	-0.022311	62	0.007545	no	ESPMCS
chr1_2372759_GACC_G_b38	MORN1	-2.925	0.00363	-0.021988	61	0.007518	no	ESPMCS
chr1_2372762_C_CTG_b38	MORN1	-2.925	0.00363	-0.021988	61	0.007518	no	ESPMCS
chr1_2323263_T_C_b38	MORN1	2.882	0.00415	0.03457	5	0.011994	no	ESPMCS
chr1_2362863_C_CA_b38	MORN1	-2.87	0.00431	-0.027024	15	0.009415	no	ESPMCS
chr1_2358373_A_T_b38	MORN1	-2.819	0.00504	-0.026522	17	0.009407	no	ESPMCS
chr1_1686004_G_T_b38	MORN1	-2.819	0.00504	-0.061229	4	0.021718	no	ESPMCS
chr1_2374713_C_T_b38	MORN1	-2.816	0.00509	-0.019516	85	0.00693	no	ESPMCS
chr1_2375256_C_T_b38	MORN1	-2.804	0.00528	-0.019614	82	0.006994	no	ESPMCS
chr1_2348393_G_A_b38	MORN1	-2.759	0.00605	-0.02416	23	0.008757	no	ESPMCS
chr1_2328587_C_T_b38	MORN1	-2.731	0.00658	-0.035037	3	0.012831	no	ESPMCS
chr1_2383975_C_T_b38	MORN1	-2.709	0.00703	-0.021987	37	0.008118	no	ESPMCS
chr1_2351215_T_G_b38	MORN1	-2.656	0.0082	-0.024028	21	0.009046	no	ESPMCS
chr1_2354645_C_T_b38	MORN1	-2.656	0.0082	-0.024028	21	0.009046	no	ESPMCS
chr1_2354688_G_C_b38	MORN1	-2.656	0.0082	-0.024028	21	0.009046	no	ESPMCS
chr1_2458710_G_A_b38	MORN1	-2.656	0.00822	-0.062427	4	0.023508	no	ESPMCS
chr1_2362229_A_G_b38	MORN1	-2.644	0.0085	-0.023978	21	0.009069	no	ESPMCS
chr1_2392897_T_C_b38	MORN1	-2.621	0.00908	-0.019074	67	0.007277	no	ESPMCS
chr1_2367872_A_G_b38	MORN1	-10.023	3.27e-21	-0.074766	70	0.007459	yes	ESPMSL
chr1_2368188_T_C_b38	MORN1	-10.023	3.27e-21	-0.074766	70	0.007459	yes	ESPMSL
chr1_2366956_CAAAATACATAGA_C_b38	MORN1	-9.873	1.09e-20	-0.0738	67	0.007475	yes	ESPMSL
chr1_2364339_A_C_b38	MORN1	-9.855	1.26e-20	-0.073892	66	0.007498	yes	ESPMSL
chr1_2366816_A_G_b38	MORN1	-9.571	1.2e-19	-0.072747	64	0.007601	yes	ESPMSL
chr1_2368473_T_C_b38	MORN1	-9.411	4.15e-19	-0.07129	73	0.007575	yes	ESPMSL
chr1_2366555_G_C_b38	MORN1	-8.939	1.54e-17	-0.069005	63	0.007719	yes	ESPMSL
chr1_2352756_T_C_b38	MORN1	-8.89	2.22e-17	-0.068442	63	0.007699	yes	ESPMSL
chr1_2367799_C_T_b38	MORN1	-8.663	1.2e-16	-0.067789	62	0.007825	yes	ESPMSL
chr1_2363829_A_T_b38	MORN1	-8.638	1.44e-16	-0.065533	64	0.007587	yes	ESPMSL
chr1_2366496_A_T_b38	MORN1	-8.633	1.5e-16	-0.067395	62	0.007807	yes	ESPMSL
chr1_2365236_C_T_b38	MORN1	-8.566	2.44e-16	-0.066419	61	0.007753	yes	ESPMSL
chr1_2365333_G_A_b38	MORN1	-8.561	2.55e-16	-0.066073	61	0.007718	yes	ESPMSL
chr1_2367197_G_A_b38	MORN1	-8.495	4.11e-16	-0.066553	61	0.007834	yes	ESPMSL
chr1_2340787_C_T_b38	MORN1	-8.46	5.3e-16	-0.072576	37	0.008579	yes	ESPMSL
chr1_2351241_C_T_b38	MORN1	-8.357	1.11e-15	-0.065925	61	0.007888	yes	ESPMSL
chr1_2366243_C_T_b38	MORN1	-8.329	1.36e-15	-0.065607	60	0.007876	yes	ESPMSL
chr1_2368939_G_C_b38	MORN1	-8.305	1.61e-15	-0.065054	62	0.007833	yes	ESPMSL
chr1_2368718_C_A_b38	MORN1	-8.259	2.25e-15	-0.064529	61	0.007813	yes	ESPMSL
chr1_2369210_C_T_b38	MORN1	-8.02	1.22e-14	-0.0635	71	0.007918	yes	ESPMSL
chr1_2343517_G_A_b38	MORN1	-8.012	1.29e-14	-0.065396	53	0.008162	yes	ESPMSL
chr1_2364657_A_T_b38	MORN1	-7.999	1.41e-14	-0.059988	105	0.0075	yes	ESPMSL
chr1_2364658_A_T_b38	MORN1	-7.999	1.41e-14	-0.059988	105	0.0075	yes	ESPMSL
chr1_2367456_C_CAA_b38	MORN1	-7.919	2.46e-14	-0.065883	45	0.008319	yes	ESPMSL
chr1_2362718_G_A_b38	MORN1	7.847	4.05e-14	0.066514	38	0.008476	yes	ESPMSL
chr1_2343699_C_T_b38	MORN1	-7.837	4.35e-14	-0.06421	53	0.008193	yes	ESPMSL
chr1_2366021_T_C_b38	MORN1	-7.709	1.04e-13	-0.058547	102	0.007594	yes	ESPMSL
chr1_2363405_C_T_b38	MORN1	7.655	1.51e-13	0.064321	47	0.008403	yes	ESPMSL
chr1_2364499_A_G_b38	MORN1	7.556	2.93e-13	0.062668	44	0.008294	yes	ESPMSL
chr1_2350696_G_A_b38	MORN1	7.474	5.07e-13	0.064441	38	0.008622	yes	ESPMSL
chr1_2348700_C_T_b38	MORN1	-7.469	5.24e-13	-0.062298	51	0.00834	yes	ESPMSL
chr1_2348378_C_T_b38	MORN1	7.321	1.39e-12	0.063316	37	0.008648	yes	ESPMSL
chr1_2353459_T_G_b38	MORN1	7.297	1.64e-12	0.055828	102	0.007651	yes	ESPMSL
chr1_2356177_T_C_b38	MORN1	7.297	1.64e-12	0.055828	102	0.007651	yes	ESPMSL
chr1_2352457_A_G_b38	MORN1	7.209	2.9e-12	0.055399	104	0.007685	yes	ESPMSL
chr1_2352403_G_T_b38	MORN1	7.15	4.24e-12	0.055188	102	0.007718	yes	ESPMSL
chr1_2360716_T_C_b38	MORN1	7.105	5.67e-12	0.05482	103	0.007716	yes	ESPMSL
chr1_2360970_T_C_b38	MORN1	7.105	5.67e-12	0.05482	103	0.007716	yes	ESPMSL
chr1_2361332_A_AG_b38	MORN1	7.105	5.67e-12	0.05482	103	0.007716	yes	ESPMSL
chr1_2361548_A_ACT_b38	MORN1	7.105	5.67e-12	0.05482	103	0.007716	yes	ESPMSL
chr1_2359472_G_A_b38	MORN1	7.067	7.24e-12	0.05534	73	0.007831	yes	ESPMSL
chr1_2358849_T_C_b38	MORN1	6.963	1.4e-11	0.053569	104	0.007694	yes	ESPMSL
chr1_2356409_G_C_b38	MORN1	6.958	1.45e-11	0.060378	43	0.008678	yes	ESPMSL
chr1_2350539_T_G_b38	MORN1	-6.935	1.68e-11	-0.053286	108	0.007684	yes	ESPMSL
chr1_2350750_AGGGGTGGCACG_A_b38	MORN1	-6.925	1.78e-11	-0.067337	21	0.009723	yes	ESPMSL
chr1_2353743_A_T_b38	MORN1	6.549	1.81e-10	0.056671	52	0.008653	yes	ESPMSL
chr1_2357308_T_C_b38	MORN1	6.512	2.26e-10	0.051304	107	0.007878	yes	ESPMSL
chr1_2348393_G_A_b38	MORN1	-6.405	4.3e-10	-0.064002	18	0.009993	yes	ESPMSL
chr1_2346801_C_T_b38	MORN1	-6.39	4.7e-10	-0.050093	115	0.00784	yes	ESPMSL
chr1_2349222_G_A_b38	MORN1	-6.311	7.45e-10	-0.049187	116	0.007793	yes	ESPMSL
chr1_2367055_C_A_b38	MORN1	6.295	8.22e-10	0.056295	30	0.008943	yes	ESPMSL
chr1_2341705_A_G_b38	MORN1	6.25	1.07e-09	0.049758	102	0.007962	yes	ESPMSL
chr1_2347212_C_T_b38	MORN1	-6.183	1.58e-09	-0.063447	14	0.010262	yes	ESPMSL
chr1_2351551_C_T_b38	MORN1	6.055	3.28e-09	0.057058	23	0.009424	yes	ESPMSL
chr1_2356095_C_T_b38	MORN1	6.02	3.99e-09	0.056728	24	0.009423	yes	ESPMSL
chr1_2357882_G_A_b38	MORN1	6.008	4.28e-09	0.056363	25	0.009381	yes	ESPMSL
chr1_2354645_C_T_b38	MORN1	-5.967	5.4e-09	-0.061984	16	0.010388	yes	ESPMSL
chr1_2354688_G_C_b38	MORN1	-5.967	5.4e-09	-0.061984	16	0.010388	yes	ESPMSL
chr1_2344757_C_A_b38	MORN1	5.936	6.4e-09	0.055322	25	0.009319	yes	ESPMSL
chr1_2344761_T_A_b38	MORN1	5.936	6.4e-09	0.055322	25	0.009319	yes	ESPMSL
chr1_2351215_T_G_b38	MORN1	-5.893	8.17e-09	-0.061351	16	0.010412	yes	ESPMSL
chr1_2345727_G_A_b38	MORN1	5.881	8.72e-09	0.055229	24	0.009392	yes	ESPMSL
chr1_2350934_C_T_b38	MORN1	5.865	9.54e-09	0.054769	25	0.009339	yes	ESPMSL
chr1_2362229_A_G_b38	MORN1	-5.798	1.38e-08	-0.060344	16	0.010407	yes	ESPMSL
chr1_2351678_C_T_b38	MORN1	-5.726	2.04e-08	-0.060408	15	0.010549	yes	ESPMSL
chr1_2345849_ACACACAG_A_b38	MORN1	5.721	2.1e-08	0.05553	20	0.009706	yes	ESPMSL
chr1_2338659_A_G_b38	MORN1	5.667	2.82e-08	0.045186	89	0.007974	yes	ESPMSL
chr1_2344932_C_T_b38	MORN1	5.656	2.98e-08	0.055096	20	0.009741	yes	ESPMSL
chr1_2344634_T_C_b38	MORN1	5.606	3.91e-08	0.05256	25	0.009377	yes	ESPMSL
chr1_2342133_C_G_b38	MORN1	-5.592	4.2e-08	-0.063897	9	0.011426	yes	ESPMSL
chr1_2342137_G_A_b38	MORN1	-5.592	4.2e-08	-0.063897	9	0.011426	yes	ESPMSL
chr1_2343937_T_G_b38	MORN1	-5.576	4.57e-08	-0.046616	75	0.00836	yes	ESPMSL
chr1_2338460_T_C_b38	MORN1	5.556	5.09e-08	0.044493	74	0.008008	yes	ESPMSL
chr1_2338570_C_T_b38	MORN1	5.496	7e-08	0.044285	68	0.008058	yes	ESPMSL
chr1_2344256_A_T_b38	MORN1	5.466	8.18e-08	0.05078	28	0.00929	yes	ESPMSL
chr1_2347542_C_T_b38	MORN1	-5.412	1.08e-07	-0.041953	96	0.007751	yes	ESPMSL
chr1_2309937_C_CT_b38	MORN1	-5.317	1.77e-07	-0.039986	125	0.00752	yes	ESPMSL
chr1_2344980_A_G_b38	MORN1	5.312	1.82e-07	0.048964	27	0.009218	yes	ESPMSL
chr1_2345774_T_C_b38	MORN1	5.244	2.57e-07	0.048612	26	0.009271	yes	ESPMSL
chr1_2337211_C_G_b38	MORN1	5.127	4.62e-07	0.042984	70	0.008383	yes	ESPMSL
chr1_2362863_C_CA_b38	MORN1	-5.123	4.72e-07	-0.055591	12	0.010852	yes	ESPMSL
chr1_2363805_C_CAAACAA_b38	MORN1	5.104	5.18e-07	0.047872	35	0.009379	yes	ESPMSL
chr1_2359882_C_CAA_b38	MORN1	4.983	9.38e-07	0.050898	22	0.010214	yes	ESPMSL
chr1_2341451_G_A_b38	MORN1	4.82	2.05e-06	0.043764	35	0.00908	yes	ESPMSL
chr1_2340807_G_A_b38	MORN1	4.706	3.51e-06	0.042502	35	0.009032	yes	ESPMSL
chr1_2340625_G_A_b38	MORN1	4.632	4.92e-06	0.0416	37	0.00898	yes	ESPMSL
chr1_2342734_T_C_b38	MORN1	-4.601	5.68e-06	-0.04412	24	0.00959	yes	ESPMSL
chr1_2346111_G_C_b38	MORN1	-4.565	6.69e-06	-0.036187	95	0.007927	yes	ESPMSL
chr1_2369118_G_A_b38	MORN1	-4.521	8.15e-06	-0.047128	17	0.010424	yes	ESPMSL
chr1_2369336_A_G_b38	MORN1	-4.507	8.68e-06	-0.045652	19	0.010129	yes	ESPMSL
chr1_2369713_ATAAT_A_b38	MORN1	-4.459	1.07e-05	-0.046081	17	0.010334	yes	ESPMSL
chr1_2343445_C_T_b38	MORN1	4.404	1.37e-05	0.040118	33	0.009109	yes	ESPMSL
chr1_2337229_A_G_b38	MORN1	4.372	1.58e-05	0.036576	102	0.008367	yes	ESPMSL
chr1_2344583_G_A_b38	MORN1	4.305	2.11e-05	0.039828	29	0.009252	yes	ESPMSL
chr1_2369355_G_GA_b38	MORN1	-4.217	3.08e-05	-0.038926	41	0.009231	yes	ESPMSL
chr1_2344932_C_A_b38	MORN1	-4.211	3.15e-05	-0.044676	13	0.01061	yes	ESPMSL
chr1_2353047_C_T_b38	MORN1	-4.211	3.15e-05	-0.044676	13	0.01061	yes	ESPMSL
chr1_2359716_T_C_b38	MORN1	-4.082	5.4e-05	-0.11207	3	0.027453	yes	ESPMSL
chr1_2357811_C_G_b38	MORN1	-4.048	6.22e-05	-0.043287	13	0.010693	yes	ESPMSL
chr1_2357812_T_C_b38	MORN1	-4.048	6.22e-05	-0.043287	13	0.010693	yes	ESPMSL
chr1_2359828_A_G_b38	MORN1	-4.048	6.22e-05	-0.043287	13	0.010693	yes	ESPMSL
chr1_2363591_T_G_b38	MORN1	-4.048	6.22e-05	-0.043287	13	0.010693	yes	ESPMSL
chr1_2367871_C_T_b38	MORN1	-4.048	6.22e-05	-0.043287	13	0.010693	yes	ESPMSL
chr1_2365220_A_G_b38	MORN1	-4.043	6.34e-05	-0.043869	12	0.010849	yes	ESPMSL
chr1_2350287_A_C_b38	MORN1	-4.03	6.69e-05	-0.042659	13	0.010584	yes	ESPMSL
chr1_2340235_T_C_b38	MORN1	4.027	6.77e-05	0.035517	43	0.008819	yes	ESPMSL
chr1_2346676_G_C_b38	MORN1	-4.019	6.99e-05	-0.042693	13	0.010622	yes	ESPMSL
chr1_2333631_T_C_b38	MORN1	3.999	7.59e-05	0.035247	35	0.008813	yes	ESPMSL
chr1_2340425_C_T_b38	MORN1	-3.908	0.00011	-0.032352	96	0.008279	yes	ESPMSL
chr1_3204068_C_A_b38	MORN1	3.741	0.00021	0.044113	9	0.011791	yes	ESPMSL
chr1_2326447_G_C_b38	MORN1	3.695	0.000251	0.033491	33	0.009065	yes	ESPMSL
chr1_2309937_C_CTT_b38	MORN1	3.65	0.000298	0.030838	50	0.00845	yes	ESPMSL
chr1_2332449_C_T_b38	MORN1	3.635	0.000315	0.032763	33	0.009014	yes	ESPMSL
chr1_2333899_TGCTGGAAAGAACA_T_b38	MORN1	3.63	0.000321	0.033093	33	0.009118	yes	ESPMSL
chr1_2333258_C_T_b38	MORN1	3.625	0.000327	0.032853	33	0.009063	yes	ESPMSL
chr1_2340764_G_T_b38	MORN1	3.617	0.000337	0.032212	40	0.008907	yes	ESPMSL
chr1_3202554_G_A_b38	MORN1	3.544	0.000442	0.04208	9	0.011874	yes	ESPMSL
chr1_2332227_G_A_b38	MORN1	3.527	0.000469	0.031668	34	0.008978	yes	ESPMSL
chr1_2345442_G_A_b38	MORN1	3.509	0.000501	0.071249	6	0.020302	yes	ESPMSL
chr1_3205896_C_G_b38	MORN1	3.507	0.000506	0.041058	9	0.011709	yes	ESPMSL
chr1_2337239_T_C_b38	MORN1	3.467	0.000583	0.032673	33	0.009423	yes	ESPMSL
chr1_2293812_C_T_b38	MORN1	-3.398	0.000747	-0.031224	51	0.009188	yes	ESPMSL
chr1_3310290_T_A_b38	MORN1	-3.378	0.000804	-0.045024	4	0.01333	yes	ESPMSL
chr1_1546962_G_A_b38	MORN1	3.359	0.000859	0.067341	11	0.020049	yes	ESPMSL
chr1_2325579_T_G_b38	MORN1	3.352	0.000879	0.030137	34	0.00899	yes	ESPMSL
chr1_2359219_C_T_b38	MORN1	3.351	0.000882	0.070477	5	0.021029	yes	ESPMSL
chr1_2340564_G_A_b38	MORN1	3.349	0.000888	0.030449	35	0.009091	yes	ESPMSL
chr1_2330544_C_A_b38	MORN1	3.342	0.000911	0.030095	34	0.009005	yes	ESPMSL
chr1_2345953_G_A_b38	MORN1	3.34	0.000916	0.067654	6	0.020253	yes	ESPMSL
chr1_2682331_C_T_b38	MORN1	-3.338	0.000923	-0.033672	86	0.010086	yes	ESPMSL
chr1_2355481_C_T_b38	MORN1	3.284	0.00111	0.064217	6	0.019552	yes	ESPMSL
chr1_2300128_G_T_b38	MORN1	-3.277	0.00114	-0.027011	105	0.008242	yes	ESPMSL
chr1_2364876_C_T_b38	MORN1	3.268	0.00118	0.067652	5	0.020704	yes	ESPMSL
chr1_2112545_C_T_b38	MORN1	-3.256	0.00123	-0.04297	5	0.013196	yes	ESPMSL
chr1_2196630_A_G_b38	MORN1	3.256	0.00123	0.038158	17	0.011721	yes	ESPMSL
chr1_1460021_C_CTG_b38	MORN1	-3.237	0.00131	-0.041988	19	0.012972	yes	ESPMSL
chr1_1460022_CAG_C_b38	MORN1	-3.237	0.00131	-0.041988	19	0.012972	yes	ESPMSL
chr1_2342840_A_ATATTTTATTT_b38	MORN1	3.225	0.00137	0.046574	13	0.014442	yes	ESPMSL
chr1_2364608_C_A_b38	MORN1	3.224	0.00137	0.064877	5	0.020123	yes	ESPMSL
chr1_3061198_C_T_b38	MORN1	3.194	0.00152	0.081912	3	0.025649	yes	ESPMSL
chr1_2335858_C_T_b38	MORN1	3.177	0.0016	0.030767	22	0.009684	yes	ESPMSL
chr1_2324849_C_A_b38	MORN1	3.169	0.00165	0.030562	25	0.009644	yes	ESPMSL
chr1_3310922_A_G_b38	MORN1	-3.16	0.0017	-0.043135	3	0.01365	yes	ESPMSL
chr1_3310983_G_A_b38	MORN1	-3.16	0.0017	-0.043135	3	0.01365	yes	ESPMSL
chr1_2369187_T_TA_b38	MORN1	3.153	0.00174	0.061156	5	0.019399	yes	ESPMSL
chr1_3211832_C_T_b38	MORN1	3.137	0.00183	0.030071	34	0.009586	yes	ESPMSL
chr1_3311588_T_G_b38	MORN1	-3.124	0.00192	-0.042673	3	0.013659	yes	ESPMSL
chr1_3311597_C_T_b38	MORN1	-3.124	0.00192	-0.042673	3	0.013659	yes	ESPMSL
chr1_3312219_G_T_b38	MORN1	-3.124	0.00192	-0.042673	3	0.013659	yes	ESPMSL
chr1_3312621_G_A_b38	MORN1	-3.124	0.00192	-0.042673	3	0.013659	yes	ESPMSL
chr1_3312694_A_G_b38	MORN1	-3.124	0.00192	-0.042673	3	0.013659	yes	ESPMSL
chr1_3313956_T_C_b38	MORN1	-3.124	0.00192	-0.042673	3	0.013659	yes	ESPMSL
chr1_2126311_A_C_b38	MORN1	-3.107	0.00202	-0.041963	4	0.013504	yes	ESPMSL
chr1_2126584_A_G_b38	MORN1	-3.107	0.00202	-0.041963	4	0.013504	yes	ESPMSL
chr1_2129937_T_C_b38	MORN1	-3.107	0.00202	-0.041963	4	0.013504	yes	ESPMSL
chr1_2315074_A_G_b38	MORN1	-3.101	0.00207	-0.027985	38	0.009024	yes	ESPMSL
chr1_3229990_G_T_b38	MORN1	3.101	0.00207	0.035616	32	0.011486	yes	ESPMSL
chr1_3229994_G_A_b38	MORN1	3.101	0.00207	0.035616	32	0.011486	yes	ESPMSL
chr1_3230035_G_C_b38	MORN1	3.101	0.00207	0.035616	32	0.011486	yes	ESPMSL
chr1_3230198_T_C_b38	MORN1	3.101	0.00207	0.035616	32	0.011486	yes	ESPMSL
chr1_3217624_C_T_b38	MORN1	3.1	0.00207	0.02994	46	0.009658	yes	ESPMSL
chr1_2108280_G_A_b38	MORN1	-3.099	0.00208	-0.037432	12	0.012077	yes	ESPMSL
chr1_2131655_G_A_b38	MORN1	3.095	0.00211	0.077063	5	0.024901	yes	ESPMSL
chr1_3208527_G_A_b38	MORN1	3.082	0.0022	0.03589	9	0.011645	yes	ESPMSL
chr1_3206560_T_C_b38	MORN1	3.072	0.00227	0.028483	50	0.009271	yes	ESPMSL
chr1_2118342_G_GT_b38	MORN1	-3.07	0.00229	-0.025234	89	0.008219	yes	ESPMSL
chr1_2327187_CAG_C_b38	MORN1	3.051	0.00243	0.02921	27	0.009574	yes	ESPMSL
chr1_3310606_A_C_b38	MORN1	-3.048	0.00246	-0.04154	3	0.013628	yes	ESPMSL
chr1_2116145_T_C_b38	MORN1	-3.042	0.0025	-0.041431	4	0.013618	yes	ESPMSL
chr1_3211856_T_C_b38	MORN1	3.024	0.00266	0.029015	36	0.009595	yes	ESPMSL
chr1_2297717_C_T_b38	MORN1	-2.933	0.00355	-0.031472	13	0.01073	yes	ESPMSL
chr1_3211967_A_G_b38	MORN1	2.914	0.00377	0.033362	11	0.011449	yes	ESPMSL
chr1_2108657_T_C_b38	MORN1	-2.913	0.00378	-0.034036	20	0.011682	yes	ESPMSL
chr1_2112579_C_G_b38	MORN1	2.909	0.00383	0.072992	5	0.02509	yes	ESPMSL
chr1_2115032_G_A_b38	MORN1	2.909	0.00383	0.072992	5	0.02509	yes	ESPMSL
chr1_3314073_G_GGGGGT_b38	MORN1	-2.895	0.004	-0.036052	10	0.012453	yes	ESPMSL
chr1_2109324_G_A_b38	MORN1	-2.887	0.00411	-0.033717	20	0.01168	yes	ESPMSL
chr1_2109338_C_T_b38	MORN1	-2.887	0.00411	-0.033717	20	0.01168	yes	ESPMSL
chr1_2304900_T_C_b38	MORN1	-2.882	0.00416	-0.03239	10	0.011237	yes	ESPMSL
chr1_3208882_T_C_b38	MORN1	2.88	0.00419	0.027698	35	0.009618	yes	ESPMSL
chr1_2383999_G_A_b38	MORN1	2.854	0.00454	0.036343	4	0.012734	yes	ESPMSL
chr1_3230608_A_G_b38	MORN1	2.848	0.00463	0.028277	42	0.009928	yes	ESPMSL
chr1_2372127_A_G_b38	MORN1	2.846	0.00465	0.036488	3	0.012819	yes	ESPMSL
chr1_2107797_G_T_b38	MORN1	-2.842	0.00472	-0.033015	21	0.011619	yes	ESPMSL
chr1_1948121_T_G_b38	MORN1	-2.834	0.00483	-0.027041	31	0.00954	yes	ESPMSL
chr1_2337141_G_A_b38	MORN1	2.824	0.00498	0.024622	54	0.008717	yes	ESPMSL
chr1_2298478_C_T_b38	MORN1	-2.82	0.00504	-0.030221	13	0.010716	yes	ESPMSL
chr1_2314848_G_C_b38	MORN1	-2.814	0.00514	-0.024839	47	0.008827	yes	ESPMSL
chr1_2692697_C_T_b38	MORN1	-2.806	0.00526	-0.039789	3	0.014179	yes	ESPMSL
chr1_2869106_C_T_b38	MORN1	-2.795	0.00544	-0.049044	4	0.017547	yes	ESPMSL
chr1_2385630_A_C_b38	MORN1	-2.788	0.00556	-0.025313	47	0.009078	yes	ESPMSL
chr1_2870985_A_G_b38	MORN1	-2.775	0.00579	-0.047024	5	0.016948	yes	ESPMSL
chr1_3355587_A_G_b38	MORN1	2.771	0.00586	0.059361	7	0.021423	yes	ESPMSL
chr1_3231335_G_A_b38	MORN1	2.748	0.00627	0.029536	18	0.010748	yes	ESPMSL
chr1_3313405_G_A_b38	MORN1	-2.736	0.0065	-0.037481	3	0.0137	yes	ESPMSL
chr1_2422271_A_AAAAC_b38	MORN1	2.728	0.00665	0.02336	48	0.008562	yes	ESPMSL
chr1_2345829_C_CCACACA_b38	MORN1	-2.727	0.00668	-0.034547	9	0.012669	yes	ESPMSL
chr1_2314194_C_T_b38	MORN1	-2.727	0.00668	-0.024425	45	0.008958	yes	ESPMSL
chr1_2361214_A_C_b38	MORN1	-2.72	0.00681	-0.045125	5	0.016587	yes	ESPMSL
chr1_2383824_C_G_b38	MORN1	-2.715	0.00693	-0.023262	71	0.008569	yes	ESPMSL
chr1_2197362_G_C_b38	MORN1	2.714	0.00695	0.036981	6	0.013628	yes	ESPMSL
chr1_3218419_C_T_b38	MORN1	2.703	0.00718	0.025998	44	0.00962	yes	ESPMSL
chr1_2872143_C_T_b38	MORN1	-2.701	0.00721	-0.047331	4	0.017523	yes	ESPMSL
chr1_2873808_A_C_b38	MORN1	-2.701	0.00721	-0.047331	4	0.017523	yes	ESPMSL
chr1_2207111_G_C_b38	MORN1	2.689	0.00747	0.037051	6	0.013778	yes	ESPMSL
chr1_3230726_C_T_b38	MORN1	2.688	0.00749	0.030922	29	0.011503	yes	ESPMSL
chr1_3211361_A_G_b38	MORN1	2.674	0.00781	0.030441	12	0.011384	yes	ESPMSL
chr1_2325159_CCCTTCCTTCCTTT_C_b38	MORN1	2.67	0.00789	0.039305	5	0.014719	yes	ESPMSL
chr1_2108949_G_A_b38	MORN1	-2.658	0.00818	-0.031007	21	0.011665	yes	ESPMSL
chr1_2121058_T_C_b38	MORN1	-2.653	0.0083	-0.037247	4	0.01404	yes	ESPMSL
chr1_2324806_A_T_b38	MORN1	2.638	0.00866	0.022732	57	0.008616	yes	ESPMSL
chr1_2422931_T_C_b38	MORN1	2.635	0.00875	0.023125	41	0.008777	yes	ESPMSL
chr1_1547458_A_G_b38	MORN1	2.633	0.00879	0.058038	6	0.022041	yes	ESPMSL
chr1_3225159_GA_G_b38	MORN1	2.602	0.00961	0.024172	34	0.009289	yes	ESPMSL
chr1_2337352_A_G_b38	MORN1	4.813	2.12e-06	0.041234	62	0.008568	no	ESPMSL
chr1_2337299_A_G_b38	MORN1	4.073	5.62e-05	0.035239	58	0.008652	no	ESPMSL
chr1_2361630_A_G_b38	MORN1	-3.994	7.77e-05	-0.108896	3	0.027268	no	ESPMSL
chr1_2362285_A_C_b38	MORN1	-3.994	7.77e-05	-0.108896	3	0.027268	no	ESPMSL
chr1_2380105_C_T_b38	MORN1	-3.952	9.18e-05	-0.032853	60	0.008313	no	ESPMSL
chr1_2380956_C_T_b38	MORN1	-3.79	0.000174	-0.039571	16	0.010441	no	ESPMSL
chr1_2382101_A_G_b38	MORN1	-3.79	0.000174	-0.039571	16	0.010441	no	ESPMSL
chr1_2391602_T_C_b38	MORN1	-3.761	0.000195	-0.033915	32	0.009018	no	ESPMSL
chr1_2392569_C_T_b38	MORN1	-3.757	0.000198	-0.038059	18	0.01013	no	ESPMSL
chr1_2389263_T_C_b38	MORN1	-3.583	0.000382	-0.035374	25	0.009873	no	ESPMSL
chr1_2380209_G_A_b38	MORN1	-3.581	0.000385	-0.029839	60	0.008332	no	ESPMSL
chr1_2364484_C_T_b38	MORN1	-3.519	0.000484	-0.037527	16	0.010664	no	ESPMSL
chr1_2414976_CTT_C_b38	MORN1	-3.495	0.000527	-0.032533	83	0.009308	no	ESPMSL
chr1_2319680_A_G_b38	MORN1	3.318	0.000992	0.030733	31	0.009263	no	ESPMSL
chr1_2409621_C_T_b38	MORN1	-3.314	0.001	-0.031626	27	0.009542	no	ESPMSL
chr1_2382880_T_C_b38	MORN1	-3.26	0.00121	-0.04468	6	0.013704	no	ESPMSL
chr1_2379954_A_G_b38	MORN1	-3.246	0.00127	-0.029712	31	0.009153	no	ESPMSL
chr1_2420841_G_A_b38	MORN1	-3.163	0.00168	-0.028068	42	0.008875	no	ESPMSL
chr1_2319909_G_A_b38	MORN1	3.105	0.00204	0.028307	34	0.009117	no	ESPMSL
chr1_2424400_A_G_b38	MORN1	-3.104	0.00204	-0.037628	9	0.012121	no	ESPMSL
chr1_2189331_C_CA_b38	MORN1	3.038	0.00254	0.039917	5	0.013139	no	ESPMSL
chr1_2319721_T_C_b38	MORN1	3.026	0.00264	0.027536	34	0.009099	no	ESPMSL
chr1_2414976_CT_C_b38	MORN1	3.016	0.00272	0.027443	38	0.009098	no	ESPMSL
chr1_2377078_C_G_b38	MORN1	-2.981	0.00305	-0.043057	5	0.014441	no	ESPMSL
chr1_2295727_A_G_b38	MORN1	-2.956	0.0033	-0.024938	74	0.008436	no	ESPMSL
chr1_2193733_G_A_b38	MORN1	2.908	0.00385	0.034677	16	0.011926	no	ESPMSL
chr1_3390839_T_G_b38	MORN1	-2.898	0.00397	-0.042272	6	0.014587	no	ESPMSL
chr1_2360913_G_A_b38	MORN1	2.886	0.00411	0.029685	23	0.010285	no	ESPMSL
chr1_2325101_C_T_b38	MORN1	-2.869	0.00434	-0.047225	4	0.016459	no	ESPMSL
chr1_2316048_A_G_b38	MORN1	-2.846	0.00466	-0.025975	33	0.009126	no	ESPMSL
chr1_2921485_CTGTCCATCTGTCCATCCAGCTCTGCAGGAGGGCGGCTGCCTGTGTCCGTCTGTCCATCCAGCTCTGCAGGAGGGCGGCTGCCTGTGTCCATCTGTCCATCCAGCTCTGCAGGAGGGCGGCTGCCTG_C_b38	MORN1	-2.828	0.00492	-0.068202	4	0.024116	no	ESPMSL
chr1_2683198_C_T_b38	MORN1	2.819	0.00506	0.055893	5	0.019826	no	ESPMSL
chr1_2683199_G_T_b38	MORN1	2.819	0.00506	0.055893	5	0.019826	no	ESPMSL
chr1_2418469_C_T_b38	MORN1	-2.788	0.00555	-0.025512	39	0.00915	no	ESPMSL
chr1_2422265_C_T_b38	MORN1	-2.787	0.00558	-0.025417	40	0.00912	no	ESPMSL
chr1_2319918_C_A_b38	MORN1	2.784	0.00564	0.024882	43	0.008939	no	ESPMSL
chr1_3269793_A_AGGAGGAGCATAATCCTG_b38	MORN1	-2.777	0.00576	-0.034076	19	0.012272	no	ESPMSL
chr1_2480084_G_T_b38	MORN1	2.766	0.00594	0.074142	3	0.026801	no	ESPMSL
chr1_2345148_G_A_b38	MORN1	-2.749	0.00626	-0.034843	5	0.012677	no	ESPMSL
chr1_1468048_A_G_b38	MORN1	-2.747	0.00628	-0.039079	23	0.014223	no	ESPMSL
chr1_1916682_G_C_b38	MORN1	-2.744	0.00634	-0.072655	3	0.026474	no	ESPMSL
chr1_2205698_G_A_b38	MORN1	2.737	0.00648	0.033269	16	0.012155	no	ESPMSL
chr1_2419005_C_T_b38	MORN1	-2.722	0.00678	-0.025056	39	0.009205	no	ESPMSL
chr1_2422217_C_T_b38	MORN1	-2.721	0.0068	-0.024958	40	0.009174	no	ESPMSL
chr1_2422225_C_T_b38	MORN1	-2.721	0.0068	-0.024958	40	0.009174	no	ESPMSL
chr1_2656478_C_G_b38	MORN1	-2.71	0.00702	-0.076544	3	0.028242	no	ESPMSL
chr1_1481959_C_T_b38	MORN1	-2.691	0.00742	-0.035855	23	0.013324	no	ESPMSL
chr1_2417413_G_GCCCAGCTT_b38	MORN1	-2.652	0.00833	-0.024261	39	0.009149	no	ESPMSL
chr1_2344761_T_C_b38	MORN1	2.651	0.00836	0.026763	26	0.010097	no	ESPMSL
chr1_3238112_A_G_b38	MORN1	2.637	0.00871	0.062134	5	0.023566	no	ESPMSL
chr1_2316546_T_C_b38	MORN1	-2.626	0.00899	-0.023627	37	0.008999	no	ESPMSL
chr1_2343517_G_A_b38	MORN1	-4.631	5.41e-06	-0.034713	35	0.007495	yes	HRTAA
chr1_2343699_C_T_b38	MORN1	-4.535	8.34e-06	-0.03383	35	0.00746	yes	HRTAA
chr1_2340787_C_T_b38	MORN1	-4.419	1.38e-05	-0.032176	33	0.007281	yes	HRTAA
chr1_2364339_A_C_b38	MORN1	-4.285	2.46e-05	-0.031099	44	0.007258	yes	HRTAA
chr1_2367799_C_T_b38	MORN1	-4.238	3e-05	-0.030702	43	0.007245	yes	HRTAA
chr1_2366816_A_G_b38	MORN1	-4.206	3.43e-05	-0.030772	42	0.007315	yes	HRTAA
chr1_2366555_G_C_b38	MORN1	-4.171	3.98e-05	-0.030259	43	0.007255	yes	HRTAA
chr1_2366956_CAAAATACATAGA_C_b38	MORN1	-4.145	4.42e-05	-0.029986	45	0.007234	yes	HRTAA
chr1_2367872_A_G_b38	MORN1	-4.133	4.65e-05	-0.029964	48	0.00725	yes	HRTAA
chr1_2368939_G_C_b38	MORN1	-4.087	5.61e-05	-0.029771	42	0.007285	yes	HRTAA
chr1_2368188_T_C_b38	MORN1	-4.082	5.72e-05	-0.029522	48	0.007232	yes	HRTAA
chr1_2366243_C_T_b38	MORN1	-4.064	6.17e-05	-0.029605	42	0.007285	yes	HRTAA
chr1_2368718_C_A_b38	MORN1	-4.045	6.64e-05	-0.029636	41	0.007326	yes	HRTAA
chr1_2365236_C_T_b38	MORN1	-4.039	6.83e-05	-0.029446	42	0.007291	yes	HRTAA
chr1_2367197_G_A_b38	MORN1	-4.036	6.91e-05	-0.029411	41	0.007288	yes	HRTAA
chr1_2351241_C_T_b38	MORN1	-4.025	7.22e-05	-0.029666	40	0.007371	yes	HRTAA
chr1_2366496_A_T_b38	MORN1	-3.99	8.31e-05	-0.02909	42	0.007291	yes	HRTAA
chr1_2346801_C_T_b38	MORN1	-3.969	9.04e-05	-0.029039	84	0.007317	yes	HRTAA
chr1_2352756_T_C_b38	MORN1	-3.935	0.000104	-0.028609	42	0.007271	yes	HRTAA
chr1_2337352_A_G_b38	MORN1	3.882	0.000127	0.027859	58	0.007177	yes	HRTAA
chr1_2368473_T_C_b38	MORN1	-3.818	0.000164	-0.027399	53	0.007177	yes	HRTAA
chr1_2367456_C_CAA_b38	MORN1	-3.73	0.000229	-0.028942	30	0.007759	yes	HRTAA
chr1_2348700_C_T_b38	MORN1	-3.726	0.000232	-0.028349	34	0.007608	yes	HRTAA
chr1_2342734_T_C_b38	MORN1	-3.694	0.000262	-0.029799	20	0.008067	yes	HRTAA
chr1_2365333_G_A_b38	MORN1	-3.661	0.000296	-0.02672	41	0.007298	yes	HRTAA
chr1_2349222_G_A_b38	MORN1	-3.661	0.000297	-0.026796	85	0.00732	yes	HRTAA
chr1_2364657_A_T_b38	MORN1	-3.644	0.000316	-0.026039	80	0.007146	yes	HRTAA
chr1_2364658_A_T_b38	MORN1	-3.644	0.000316	-0.026039	80	0.007146	yes	HRTAA
chr1_2350539_T_G_b38	MORN1	-3.628	0.000336	-0.026204	78	0.007223	yes	HRTAA
chr1_2338659_A_G_b38	MORN1	3.625	0.000339	0.025772	76	0.00711	yes	HRTAA
chr1_2342133_C_G_b38	MORN1	-3.585	0.000393	-0.032737	14	0.009132	yes	HRTAA
chr1_2342137_G_A_b38	MORN1	-3.585	0.000393	-0.032737	14	0.009132	yes	HRTAA
chr1_2364499_A_G_b38	MORN1	3.581	0.000399	0.028514	35	0.007963	yes	HRTAA
chr1_2366021_T_C_b38	MORN1	-3.432	0.000682	-0.02482	77	0.007231	yes	HRTAA
chr1_3341756_T_C_b38	MORN1	-3.413	0.000729	-0.023841	81	0.006985	yes	HRTAA
chr1_2347542_C_T_b38	MORN1	-3.402	0.00076	-0.024774	69	0.007282	yes	HRTAA
chr1_2363405_C_T_b38	MORN1	3.333	0.000966	0.027335	36	0.008201	yes	HRTAA
chr1_3341065_C_CT_b38	MORN1	-3.33	0.000977	-0.023507	58	0.007059	yes	HRTAA
chr1_2358849_T_C_b38	MORN1	3.328	0.000982	0.02323	81	0.006979	yes	HRTAA
chr1_2346111_G_C_b38	MORN1	-3.327	0.000985	-0.024415	66	0.007337	yes	HRTAA
chr1_2362863_C_CA_b38	MORN1	-3.309	0.00105	-0.030548	11	0.009232	yes	HRTAA
chr1_3386245_AAG_A_b38	MORN1	3.263	0.00123	0.027901	16	0.00855	yes	HRTAA
chr1_2348378_C_T_b38	MORN1	3.231	0.00137	0.026866	26	0.008316	yes	HRTAA
chr1_2350696_G_A_b38	MORN1	3.231	0.00137	0.026866	26	0.008316	yes	HRTAA
chr1_2362718_G_A_b38	MORN1	3.215	0.00145	0.026234	30	0.008161	yes	HRTAA
chr1_2348393_G_A_b38	MORN1	-3.208	0.00148	-0.02692	18	0.008392	yes	HRTAA
chr1_2357308_T_C_b38	MORN1	3.181	0.00162	0.022453	85	0.007059	yes	HRTAA
chr1_3296367_G_A_b38	MORN1	-3.174	0.00166	-0.024913	29	0.007849	yes	HRTAA
chr1_1538924_C_A_b38	MORN1	3.159	0.00175	0.024352	37	0.00771	yes	HRTAA
chr1_2351215_T_G_b38	MORN1	-3.152	0.00178	-0.027464	16	0.008712	yes	HRTAA
chr1_1537160_T_G_b38	MORN1	3.148	0.00181	0.023346	72	0.007415	yes	HRTAA
chr1_3342337_T_C_b38	MORN1	-3.146	0.00182	-0.024113	33	0.007666	yes	HRTAA
chr1_2352403_G_T_b38	MORN1	3.127	0.00194	0.021746	80	0.006955	yes	HRTAA
chr1_3334729_C_T_b38	MORN1	-3.124	0.00196	-0.022254	57	0.007124	yes	HRTAA
chr1_2344980_A_G_b38	MORN1	3.123	0.00197	0.026547	20	0.008502	yes	HRTAA
chr1_2345774_T_C_b38	MORN1	3.123	0.00197	0.026547	20	0.008502	yes	HRTAA
chr1_2353743_A_T_b38	MORN1	3.116	0.00201	0.025602	38	0.008215	yes	HRTAA
chr1_2351678_C_T_b38	MORN1	-3.074	0.0023	-0.02707	15	0.008806	yes	HRTAA
chr1_2353459_T_G_b38	MORN1	3.063	0.00239	0.021388	79	0.006983	yes	HRTAA
chr1_2356177_T_C_b38	MORN1	3.063	0.00239	0.021388	79	0.006983	yes	HRTAA
chr1_2354688_G_C_b38	MORN1	-3.061	0.0024	-0.026751	16	0.008739	yes	HRTAA
chr1_2367055_C_A_b38	MORN1	3.05	0.0025	0.026583	20	0.008717	yes	HRTAA
chr1_2360716_T_C_b38	MORN1	3.033	0.00263	0.021331	80	0.007033	yes	HRTAA
chr1_2360970_T_C_b38	MORN1	3.033	0.00263	0.021331	80	0.007033	yes	HRTAA
chr1_2361332_A_AG_b38	MORN1	3.033	0.00263	0.021331	80	0.007033	yes	HRTAA
chr1_2361548_A_ACT_b38	MORN1	3.033	0.00263	0.021331	80	0.007033	yes	HRTAA
chr1_2352457_A_G_b38	MORN1	3.019	0.00275	0.021176	80	0.007013	yes	HRTAA
chr1_3385157_C_T_b38	MORN1	3.004	0.00289	0.024936	19	0.008302	yes	HRTAA
chr1_2087271_C_T_b38	MORN1	3.002	0.0029	0.066489	3	0.022146	yes	HRTAA
chr1_3334760_G_T_b38	MORN1	-2.999	0.00294	-0.021217	58	0.007075	yes	HRTAA
chr1_3338975_G_A_b38	MORN1	-2.999	0.00294	-0.021217	58	0.007075	yes	HRTAA
chr1_3386142_T_TCGGGGTGCC_b38	MORN1	2.985	0.00307	0.023872	22	0.007997	yes	HRTAA
chr1_2354645_C_T_b38	MORN1	-2.981	0.00311	-0.026049	16	0.008738	yes	HRTAA
chr1_3343504_C_CT_b38	MORN1	-2.972	0.0032	-0.023794	25	0.008006	yes	HRTAA
chr1_3341970_T_C_b38	MORN1	-2.959	0.00333	-0.022761	32	0.007692	yes	HRTAA
chr1_3341978_T_A_b38	MORN1	-2.959	0.00333	-0.022761	32	0.007692	yes	HRTAA
chr1_3342097_C_T_b38	MORN1	-2.959	0.00333	-0.022761	32	0.007692	yes	HRTAA
chr1_3342124_G_C_b38	MORN1	-2.959	0.00333	-0.022761	32	0.007692	yes	HRTAA
chr1_3342549_G_A_b38	MORN1	-2.959	0.00333	-0.022761	32	0.007692	yes	HRTAA
chr1_3343113_C_T_b38	MORN1	-2.959	0.00333	-0.022761	32	0.007692	yes	HRTAA
chr1_3343319_ATTGT_A_b38	MORN1	-2.959	0.00333	-0.022761	32	0.007692	yes	HRTAA
chr1_3343390_T_C_b38	MORN1	-2.959	0.00333	-0.022761	32	0.007692	yes	HRTAA
chr1_3343832_A_G_b38	MORN1	-2.959	0.00333	-0.022761	32	0.007692	yes	HRTAA
chr1_3343906_G_T_b38	MORN1	-2.959	0.00333	-0.022761	32	0.007692	yes	HRTAA
chr1_2338460_T_C_b38	MORN1	2.943	0.0035	0.022471	52	0.007634	yes	HRTAA
chr1_1573429_CAAAAAAAAAAAAAAAAAA_C_b38	MORN1	2.911	0.00387	0.022499	57	0.007729	yes	HRTAA
chr1_3386181_A_G_b38	MORN1	2.898	0.00404	0.024186	19	0.008347	yes	HRTAA
chr1_3386307_G_A_b38	MORN1	2.898	0.00404	0.024186	19	0.008347	yes	HRTAA
chr1_1571986_G_A_b38	MORN1	2.895	0.00407	0.0214	49	0.007391	yes	HRTAA
chr1_3309193_T_G_b38	MORN1	-2.867	0.00443	-0.024249	20	0.008457	yes	HRTAA
chr1_3388749_C_A_b38	MORN1	2.828	0.005	0.023571	19	0.008335	yes	HRTAA
chr1_1861110_C_CAA_b38	MORN1	2.81	0.00528	0.025964	20	0.009241	yes	HRTAA
chr1_1664099_T_C_b38	MORN1	-2.805	0.00536	-0.025312	17	0.009024	yes	HRTAA
chr1_2359472_G_A_b38	MORN1	2.788	0.00565	0.019493	58	0.006993	yes	HRTAA
chr1_2080325_A_AGTGCGCGTGGACGTGGCGGTGCGCGTGGACGTGGCG_b38	MORN1	2.774	0.00589	0.061088	3	0.022025	yes	HRTAA
chr1_2343937_T_G_b38	MORN1	-2.753	0.00627	-0.020175	56	0.007329	yes	HRTAA
chr1_2351551_C_T_b38	MORN1	2.75	0.00633	0.024583	17	0.00894	yes	HRTAA
chr1_2235045_A_AT_b38	MORN1	2.747	0.00637	0.022901	30	0.008336	yes	HRTAA
chr1_1547630_G_A_b38	MORN1	2.735	0.0066	0.020165	57	0.007372	yes	HRTAA
chr1_1574655_GGC_G_b38	MORN1	2.723	0.00685	0.021308	51	0.007826	yes	HRTAA
chr1_3345759_TCGGG_T_b38	MORN1	-2.72	0.00691	-0.021176	31	0.007785	yes	HRTAA
chr1_3345764_TCCTCCCGTGCTGCCCCCTCTGTGGTCCAGGCCACCCCTTGGTTCCTCCTGTGCTGCCCTCTC_T_b38	MORN1	-2.72	0.00691	-0.021176	31	0.007785	yes	HRTAA
chr1_2677412_C_A_b38	MORN1	-2.708	0.00717	-0.028728	3	0.01061	yes	HRTAA
chr1_1570294_CA_C_b38	MORN1	2.684	0.00767	0.021287	55	0.00793	yes	HRTAA
chr1_3342805_A_G_b38	MORN1	-2.673	0.00792	-0.020931	44	0.00783	yes	HRTAA
chr1_3389174_G_A_b38	MORN1	2.64	0.00872	0.021829	21	0.008269	yes	HRTAA
chr1_3302090_TA_T_b38	MORN1	-2.632	0.00894	-0.021566	26	0.008195	yes	HRTAA
chr1_3304807_G_A_b38	MORN1	-2.632	0.00894	-0.021566	26	0.008195	yes	HRTAA
chr1_3306063_C_G_b38	MORN1	-2.632	0.00894	-0.021566	26	0.008195	yes	HRTAA
chr1_1559703_G_C_b38	MORN1	2.63	0.00897	0.020159	56	0.007664	yes	HRTAA
chr1_1568548_G_A_b38	MORN1	2.63	0.00897	0.020159	56	0.007664	yes	HRTAA
chr1_3293801_T_C_b38	MORN1	-2.621	0.00921	-0.021019	25	0.00802	yes	HRTAA
chr1_1532798_T_C_b38	MORN1	2.606	0.00962	0.018546	107	0.007118	yes	HRTAA
chr1_1664300_T_C_b38	MORN1	-2.603	0.00969	-0.022987	15	0.00883	yes	HRTAA
chr1_1570587_C_T_b38	MORN1	2.593	0.00998	0.01989	56	0.007671	yes	HRTAA
chr1_2363829_A_T_b38	MORN1	-3.592	0.000382	-0.025496	43	0.007097	no	HRTAA
chr1_2369210_C_T_b38	MORN1	-3.569	0.000416	-0.025439	54	0.007127	no	HRTAA
chr1_3333859_A_G_b38	MORN1	-3.387	8e-04	-0.023875	72	0.007049	no	HRTAA
chr1_2337299_A_G_b38	MORN1	3.38	0.000819	0.025123	49	0.007432	no	HRTAA
chr1_3330825_T_C_b38	MORN1	-3.372	0.000845	-0.023633	73	0.007009	no	HRTAA
chr1_3331534_A_G_b38	MORN1	-3.372	0.000845	-0.023633	73	0.007009	no	HRTAA
chr1_2341705_A_G_b38	MORN1	3.217	0.00143	0.022677	83	0.007048	no	HRTAA
chr1_2350750_AGGGGTGGCACG_A_b38	MORN1	-3.169	0.00169	-0.026038	22	0.008217	no	HRTAA
chr1_3331272_A_C_b38	MORN1	-3.167	0.0017	-0.022058	75	0.006965	no	HRTAA
chr1_2297717_C_T_b38	MORN1	-3.09	0.00219	-0.027519	16	0.008904	no	HRTAA
chr1_2356409_G_C_b38	MORN1	3.086	0.00221	0.025434	31	0.008241	no	HRTAA
chr1_3380387_T_C_b38	MORN1	3.078	0.00228	0.02245	50	0.007293	no	HRTAA
chr1_2362229_A_G_b38	MORN1	-3.07	0.00233	-0.026548	17	0.008647	no	HRTAA
chr1_3325967_T_C_b38	MORN1	-3.05	0.00249	-0.02133	88	0.006994	no	HRTAA
chr1_2075464_G_A_b38	MORN1	3.049	0.0025	0.064918	4	0.021295	no	HRTAA
chr1_2075502_A_G_b38	MORN1	3.049	0.0025	0.064918	4	0.021295	no	HRTAA
chr1_3329529_G_A_b38	MORN1	-3.022	0.00272	-0.021117	60	0.006987	no	HRTAA
chr1_2347212_C_T_b38	MORN1	-3.018	0.00276	-0.025755	18	0.008533	no	HRTAA
chr1_1680672_C_T_b38	MORN1	-2.989	0.00303	-0.022667	66	0.007583	no	HRTAA
chr1_3384243_C_T_b38	MORN1	2.984	0.00307	0.020974	88	0.007028	no	HRTAA
chr1_1547458_A_G_b38	MORN1	2.938	0.00356	0.059821	5	0.020363	no	HRTAA
chr1_1695747_C_T_b38	MORN1	2.913	0.00385	0.023545	62	0.008082	no	HRTAA
chr1_2325642_ATTT_A_b38	MORN1	2.895	0.00407	0.023779	28	0.008215	no	HRTAA
chr1_2338570_C_T_b38	MORN1	2.894	0.00409	0.02209	50	0.007634	no	HRTAA
chr1_2652111_A_G_b38	MORN1	-2.884	0.00422	-0.053138	4	0.018428	no	HRTAA
chr1_2337211_C_G_b38	MORN1	2.879	0.00428	0.021985	51	0.007637	no	HRTAA
chr1_2298478_C_T_b38	MORN1	-2.878	0.00429	-0.025484	16	0.008854	no	HRTAA
chr1_2335494_C_T_b38	MORN1	2.856	0.00459	0.024126	18	0.008449	no	HRTAA
chr1_3305273_C_T_b38	MORN1	-2.853	0.00463	-0.023224	27	0.00814	no	HRTAA
chr1_3346939_C_T_b38	MORN1	-2.84	0.00482	-0.022242	29	0.007832	no	HRTAA
chr1_2872984_T_TTC_b38	MORN1	2.819	0.00513	0.049198	5	0.01745	no	HRTAA
chr1_3341487_C_T_b38	MORN1	-2.818	0.00516	-0.021165	44	0.007512	no	HRTAA
chr1_2345849_ACACACAG_A_b38	MORN1	2.809	0.00529	0.025772	14	0.009173	no	HRTAA
chr1_3291759_G_A_b38	MORN1	-2.806	0.00534	-0.028792	7	0.01026	no	HRTAA
chr1_1691417_T_C_b38	MORN1	2.778	0.00582	0.020599	68	0.007416	no	HRTAA
chr1_2069762_G_C_b38	MORN1	2.774	0.00588	0.060425	4	0.021782	no	HRTAA
chr1_3265967_A_C_b38	MORN1	-2.763	0.00607	-0.024438	20	0.008844	no	HRTAA
chr1_3303712_T_A_b38	MORN1	-2.761	0.00612	-0.022452	27	0.008133	no	HRTAA
chr1_3304520_G_A_b38	MORN1	-2.761	0.00612	-0.022452	27	0.008133	no	HRTAA
chr1_3287755_T_C_b38	MORN1	-2.76	0.00613	-0.033546	5	0.012152	no	HRTAA
chr1_2079677_C_G_b38	MORN1	-2.743	0.00645	-0.024771	13	0.00903	no	HRTAA
chr1_2691587_A_C_b38	MORN1	-2.732	0.00667	-0.054893	3	0.020094	no	HRTAA
chr1_2344757_C_A_b38	MORN1	2.721	0.00688	0.024126	18	0.008865	no	HRTAA
chr1_2344761_T_A_b38	MORN1	2.721	0.00688	0.024126	18	0.008865	no	HRTAA
chr1_2345727_G_A_b38	MORN1	2.721	0.00688	0.024126	18	0.008865	no	HRTAA
chr1_2350934_C_T_b38	MORN1	2.721	0.00688	0.024126	18	0.008865	no	HRTAA
chr1_2079137_C_T_b38	MORN1	-2.718	0.00695	-0.024177	17	0.008896	no	HRTAA
chr1_3340495_G_A_b38	MORN1	-2.668	0.00803	-0.018441	61	0.006911	no	HRTAA
chr1_2356095_C_T_b38	MORN1	2.667	0.00807	0.023707	18	0.008889	no	HRTAA
chr1_3249542_C_A_b38	MORN1	-2.667	0.00807	-0.024704	9	0.009263	no	HRTAA
chr1_2337229_A_G_b38	MORN1	2.655	0.00836	0.019169	79	0.007221	no	HRTAA
chr1_2325032_T_A_b38	MORN1	2.653	0.0084	0.03786	9	0.014271	no	HRTAA
chr1_1546862_A_AC_b38	MORN1	2.647	0.00855	0.049156	3	0.01857	no	HRTAA
chr1_1539491_G_C_b38	MORN1	2.646	0.00859	0.020687	59	0.00782	no	HRTAA
chr1_3388532_G_C_b38	MORN1	-2.636	0.00883	-0.02697	8	0.010232	no	HRTAA
chr1_3303459_C_T_b38	MORN1	-2.634	0.00887	-0.02216	25	0.008412	no	HRTAA
chr1_3304965_C_G_b38	MORN1	-2.634	0.00887	-0.02216	25	0.008412	no	HRTAA
chr1_3333590_G_A_b38	MORN1	-2.627	0.00905	-0.018065	62	0.006876	no	HRTAA
chr1_3337792_C_T_b38	MORN1	-2.627	0.00905	-0.018065	62	0.006876	no	HRTAA
chr1_2072659_G_A_b38	MORN1	-2.619	0.00926	-0.023617	14	0.009017	no	HRTAA
chr1_2357882_G_A_b38	MORN1	2.613	0.00941	0.023148	18	0.008857	no	HRTAA
chr1_2102314_GTT_G_b38	MORN1	2.609	0.00954	0.057673	4	0.022109	no	HRTAA
chr1_2083306_C_T_b38	MORN1	2.607	0.00958	0.058194	4	0.022321	no	HRTAA
chr1_2327034_G_A_b38	MORN1	2.604	0.00969	0.019217	54	0.007381	no	HRTAA
chr1_2077005_T_C_b38	MORN1	-2.603	0.00969	-0.019538	40	0.007505	no	HRTAA
chr1_2304900_T_C_b38	MORN1	-2.601	0.00975	-0.024236	11	0.009318	no	HRTAA
chr1_2691644_G_T_b38	MORN1	2.593	0.00998	0.052319	5	0.020177	no	HRTAA
chr1_2363405_C_T_b38	MORN1	4.003	7.8e-05	0.022582	37	0.005641	yes	HRTLV
chr1_2341705_A_G_b38	MORN1	3.98	8.57e-05	0.021095	86	0.005301	yes	HRTLV
chr1_2362718_G_A_b38	MORN1	3.977	8.66e-05	0.022573	32	0.005676	yes	HRTLV
chr1_2368718_C_A_b38	MORN1	-3.967	9.01e-05	-0.021809	47	0.005497	yes	HRTLV
chr1_2364499_A_G_b38	MORN1	3.94	1e-04	0.021781	39	0.005528	yes	HRTLV
chr1_1609196_CA_C_b38	MORN1	3.923	0.000107	0.023338	37	0.005949	yes	HRTLV
chr1_2353743_A_T_b38	MORN1	3.827	0.000156	0.021989	41	0.005745	yes	HRTLV
chr1_2366816_A_G_b38	MORN1	-3.808	0.000169	-0.020791	49	0.00546	yes	HRTLV
chr1_2366555_G_C_b38	MORN1	-3.786	0.000184	-0.020747	49	0.00548	yes	HRTLV
chr1_2364339_A_C_b38	MORN1	-3.784	0.000185	-0.020544	51	0.00543	yes	HRTLV
chr1_2367872_A_G_b38	MORN1	-3.78	0.000187	-0.020476	55	0.005416	yes	HRTLV
chr1_2366021_T_C_b38	MORN1	-3.761	0.000202	-0.019759	82	0.005253	yes	HRTLV
chr1_2367197_G_A_b38	MORN1	-3.737	0.000221	-0.020582	47	0.005508	yes	HRTLV
chr1_2356409_G_C_b38	MORN1	3.701	0.000254	0.021343	36	0.005767	yes	HRTLV
chr1_2367799_C_T_b38	MORN1	-3.701	0.000254	-0.020397	48	0.005512	yes	HRTLV
chr1_2350696_G_A_b38	MORN1	3.683	0.000272	0.021341	31	0.005795	yes	HRTLV
chr1_2365333_G_A_b38	MORN1	-3.671	0.000284	-0.020058	47	0.005464	yes	HRTLV
chr1_2359882_C_CAA_b38	MORN1	3.659	0.000297	0.023848	17	0.006517	yes	HRTLV
chr1_2368188_T_C_b38	MORN1	-3.658	0.000298	-0.019798	55	0.005413	yes	HRTLV
chr1_2368939_G_C_b38	MORN1	-3.64	0.000319	-0.01997	48	0.005487	yes	HRTLV
chr1_2366496_A_T_b38	MORN1	-3.631	0.00033	-0.020017	48	0.005513	yes	HRTLV
chr1_2351241_C_T_b38	MORN1	-3.616	0.000348	-0.020349	46	0.005627	yes	HRTLV
chr1_2368473_T_C_b38	MORN1	-3.607	0.00036	-0.019852	58	0.005503	yes	HRTLV
chr1_2348378_C_T_b38	MORN1	3.603	0.000365	0.020974	30	0.005821	yes	HRTLV
chr1_2365236_C_T_b38	MORN1	-3.585	0.000391	-0.019555	49	0.005455	yes	HRTLV
chr1_2366956_CAAAATACATAGA_C_b38	MORN1	-3.553	0.00044	-0.019201	55	0.005405	yes	HRTLV
chr1_2363829_A_T_b38	MORN1	-3.539	0.000462	-0.018522	51	0.005234	yes	HRTLV
chr1_2343517_G_A_b38	MORN1	-3.536	0.000467	-0.020175	43	0.005705	yes	HRTLV
chr1_2352756_T_C_b38	MORN1	-3.503	0.000526	-0.019417	48	0.005543	yes	HRTLV
chr1_2343699_C_T_b38	MORN1	-3.489	0.000554	-0.019931	43	0.005713	yes	HRTLV
chr1_2338460_T_C_b38	MORN1	3.464	0.000606	0.018315	53	0.005287	yes	HRTLV
chr1_2349222_G_A_b38	MORN1	-3.447	0.000643	-0.01859	95	0.005392	yes	HRTLV
chr1_2366243_C_T_b38	MORN1	-3.44	0.000661	-0.018967	48	0.005514	yes	HRTLV
chr1_2364657_A_T_b38	MORN1	-3.439	0.000662	-0.018147	87	0.005276	yes	HRTLV
chr1_2364658_A_T_b38	MORN1	-3.439	0.000662	-0.018147	87	0.005276	yes	HRTLV
chr1_2346801_C_T_b38	MORN1	-3.438	0.000665	-0.018638	95	0.005422	yes	HRTLV
chr1_2350539_T_G_b38	MORN1	-3.411	0.000733	-0.018244	84	0.005349	yes	HRTLV
chr1_2348700_C_T_b38	MORN1	-3.382	0.00081	-0.019542	37	0.005778	yes	HRTLV
chr1_2345442_G_A_b38	MORN1	3.358	0.000881	0.045931	5	0.013677	yes	HRTLV
chr1_2345953_G_A_b38	MORN1	3.358	0.000881	0.045931	5	0.013677	yes	HRTLV
chr1_2340787_C_T_b38	MORN1	-3.252	0.00127	-0.018303	39	0.005628	yes	HRTLV
chr1_2338570_C_T_b38	MORN1	3.24	0.00132	0.01734	50	0.005351	yes	HRTLV
chr1_2367055_C_A_b38	MORN1	3.237	0.00134	0.019134	25	0.005911	yes	HRTLV
chr1_2357308_T_C_b38	MORN1	3.237	0.00134	0.016842	86	0.005203	yes	HRTLV
chr1_1773715_T_TGAGA_b38	MORN1	3.213	0.00145	0.043619	4	0.013575	yes	HRTLV
chr1_2367456_C_CAA_b38	MORN1	-3.187	0.00158	-0.018492	35	0.005802	yes	HRTLV
chr1_2337299_A_G_b38	MORN1	3.177	0.00163	0.017536	52	0.005519	yes	HRTLV
chr1_2358849_T_C_b38	MORN1	3.172	0.00166	0.016213	82	0.005112	yes	HRTLV
chr1_2338659_A_G_b38	MORN1	3.155	0.00176	0.016799	81	0.005324	yes	HRTLV
chr1_2359219_C_T_b38	MORN1	3.114	0.00201	0.040847	5	0.013116	yes	HRTLV
chr1_2360716_T_C_b38	MORN1	3.113	0.00202	0.015934	82	0.005119	yes	HRTLV
chr1_2360970_T_C_b38	MORN1	3.113	0.00202	0.015934	82	0.005119	yes	HRTLV
chr1_2361332_A_AG_b38	MORN1	3.113	0.00202	0.015934	82	0.005119	yes	HRTLV
chr1_2361548_A_ACT_b38	MORN1	3.113	0.00202	0.015934	82	0.005119	yes	HRTLV
chr1_2352403_G_T_b38	MORN1	3.112	0.00203	0.015846	83	0.005092	yes	HRTLV
chr1_2337352_A_G_b38	MORN1	3.077	0.00227	0.01698	59	0.005518	yes	HRTLV
chr1_2337141_G_A_b38	MORN1	3.075	0.00229	0.017555	37	0.005709	yes	HRTLV
chr1_2101019_TA_T_b38	MORN1	3.048	0.0025	0.019698	17	0.006462	yes	HRTLV
chr1_2337211_C_G_b38	MORN1	3.048	0.0025	0.016583	53	0.005441	yes	HRTLV
chr1_2681679_T_C_b38	MORN1	3.029	0.00266	0.035522	5	0.011728	yes	HRTLV
chr1_2353459_T_G_b38	MORN1	3.013	0.00279	0.015436	82	0.005123	yes	HRTLV
chr1_2356177_T_C_b38	MORN1	3.013	0.00279	0.015436	82	0.005123	yes	HRTLV
chr1_2352457_A_G_b38	MORN1	2.991	0.003	0.015315	83	0.00512	yes	HRTLV
chr1_2369187_T_TA_b38	MORN1	2.97	0.00321	0.035681	5	0.012015	yes	HRTLV
chr1_2337229_A_G_b38	MORN1	2.95	0.00342	0.015736	78	0.005335	yes	HRTLV
chr1_2340807_G_A_b38	MORN1	2.949	0.00343	0.017081	31	0.005792	yes	HRTLV
chr1_2340235_T_C_b38	MORN1	2.806	0.00532	0.016033	34	0.005713	yes	HRTLV
chr1_2749442_ACCCCC_A_b38	MORN1	2.792	0.00555	0.031144	5	0.011153	yes	HRTLV
chr1_2341451_G_A_b38	MORN1	2.785	0.00567	0.01604	32	0.005759	yes	HRTLV
chr1_2211288_C_G_b38	MORN1	2.784	0.00569	0.013567	75	0.004873	yes	HRTLV
chr1_3341487_C_T_b38	MORN1	-2.783	0.00571	-0.015985	44	0.005744	yes	HRTLV
chr1_2340625_G_A_b38	MORN1	2.741	0.00648	0.015736	33	0.005741	yes	HRTLV
chr1_3345361_G_A_b38	MORN1	2.714	0.00701	0.022012	6	0.00811	yes	HRTLV
chr1_2074688_G_A_b38	MORN1	-2.673	0.0079	-0.018547	14	0.006938	yes	HRTLV
chr1_1500729_G_A_b38	MORN1	-2.666	0.00807	-0.031261	22	0.011725	yes	HRTLV
chr1_2067567_G_A_b38	MORN1	-2.646	0.00856	-0.019351	7	0.007314	yes	HRTLV
chr1_3343504_C_CT_b38	MORN1	-2.642	0.00865	-0.015594	32	0.005902	yes	HRTLV
chr1_1442722_A_G_b38	MORN1	-2.641	0.00869	-0.032638	4	0.01236	yes	HRTLV
chr1_2356095_C_T_b38	MORN1	2.631	0.00892	0.01631	21	0.006198	yes	HRTLV
chr1_2364608_C_A_b38	MORN1	2.622	0.00917	0.033291	5	0.012698	yes	HRTLV
chr1_2083306_C_T_b38	MORN1	2.621	0.00918	0.04669	3	0.01781	yes	HRTLV
chr1_2749448_AGGTGAGCATCTGACGGCCTGGAACAGCACCCACAT_A_b38	MORN1	2.614	0.00937	0.029805	5	0.0114	yes	HRTLV
chr1_2357882_G_A_b38	MORN1	2.595	0.0099	0.015864	22	0.006114	yes	HRTLV
chr1_2364876_C_T_b38	MORN1	3.02	0.00273	0.038684	5	0.012807	no	HRTLV
chr1_1836387_CTT_C_b38	MORN1	-3.016	0.00277	-0.020916	18	0.006934	no	HRTLV
chr1_2327239_C_CACACAGAAACACACAGAAACACAGAAACAAACACAGAG_b38	MORN1	3.004	0.00288	0.017046	16	0.005675	no	HRTLV
chr1_1514211_A_G_b38	MORN1	-2.977	0.00314	-0.036698	9	0.012328	no	HRTLV
chr1_3345705_A_G_b38	MORN1	2.882	0.00423	0.016272	38	0.005647	no	HRTLV
chr1_2369713_ATAAT_A_b38	MORN1	-2.848	0.00468	-0.020129	11	0.007067	no	HRTLV
chr1_3163340_G_GGTCT_b38	MORN1	2.832	0.00492	0.028231	11	0.009968	no	HRTLV
chr1_2074301_T_C_b38	MORN1	-2.78	0.00577	-0.022547	4	0.008111	no	HRTLV
chr1_2286661_C_T_b38	MORN1	-2.778	0.00579	-0.023361	5	0.008408	no	HRTLV
chr1_2072659_G_A_b38	MORN1	-2.726	0.00676	-0.018896	14	0.006931	no	HRTLV
chr1_1515567_A_C_b38	MORN1	-2.705	0.00719	-0.030656	11	0.011331	no	HRTLV
chr1_2287068_C_T_b38	MORN1	-2.704	0.00722	-0.02262	5	0.008366	no	HRTLV
chr1_3344952_C_T_b38	MORN1	2.701	0.00728	0.015448	36	0.005719	no	HRTLV
chr1_1525526_C_T_b38	MORN1	-2.685	0.00764	-0.035681	6	0.013289	no	HRTLV
chr1_3080038_T_C_b38	MORN1	2.674	0.00789	0.016197	25	0.006058	no	HRTLV
chr1_2076235_A_G_b38	MORN1	-2.654	0.00836	-0.021192	4	0.007985	no	HRTLV
chr1_2757318_AGGATCGGACAGC_A_b38	MORN1	-2.637	0.00877	-0.034914	4	0.013238	no	HRTLV
chr1_2337239_T_C_b38	MORN1	2.624	0.00913	0.015554	34	0.005929	no	HRTLV
chr1_1471663_A_C_b38	MORN1	-2.619	0.00924	-0.038892	3	0.014849	no	HRTLV
chr1_1516110_G_A_b38	MORN1	-2.602	0.00971	-0.033945	7	0.013047	no	HRTLV
chr1_3341218_G_A_b38	MORN1	-2.6	0.00978	-0.014377	52	0.005531	no	HRTLV
chr1_3337805_T_C_b38	MORN1	2.597	0.00986	0.014563	41	0.005609	no	HRTLV
chr1_2338659_A_G_b38	MORN1	3.052	0.00373	0.092238	18	0.030221	yes	KDNCTX
chr1_2366816_A_G_b38	MORN1	-3.037	0.0039	-0.120498	9	0.039682	yes	KDNCTX
chr1_1605629_G_A_b38	MORN1	-3.013	0.00416	-0.148422	3	0.049259	yes	KDNCTX
chr1_2011852_C_T_b38	MORN1	3.009	0.0042	0.120115	8	0.039917	yes	KDNCTX
chr1_2016961_C_A_b38	MORN1	3.009	0.0042	0.120115	8	0.039917	yes	KDNCTX
chr1_2022373_C_T_b38	MORN1	3.009	0.0042	0.120115	8	0.039917	yes	KDNCTX
chr1_2358849_T_C_b38	MORN1	2.988	0.00446	0.119054	14	0.039846	yes	KDNCTX
chr1_2360716_T_C_b38	MORN1	2.988	0.00446	0.119054	14	0.039846	yes	KDNCTX
chr1_2360970_T_C_b38	MORN1	2.988	0.00446	0.119054	14	0.039846	yes	KDNCTX
chr1_2361332_A_AG_b38	MORN1	2.988	0.00446	0.119054	14	0.039846	yes	KDNCTX
chr1_2361548_A_ACT_b38	MORN1	2.988	0.00446	0.119054	14	0.039846	yes	KDNCTX
chr1_2423447_G_A_b38	MORN1	-2.888	0.00584	-0.108761	14	0.03766	yes	KDNCTX
chr1_2022997_G_A_b38	MORN1	2.854	0.00639	0.120747	5	0.042301	yes	KDNCTX
chr1_2024545_C_T_b38	MORN1	2.854	0.00639	0.120747	5	0.042301	yes	KDNCTX
chr1_2364499_A_G_b38	MORN1	2.829	0.00685	0.11589	6	0.040967	yes	KDNCTX
chr1_1647600_C_G_b38	MORN1	-2.829	0.00685	-0.157825	5	0.055795	yes	KDNCTX
chr1_2352403_G_T_b38	MORN1	2.82	0.00702	0.114953	14	0.040769	yes	KDNCTX
chr1_2352457_A_G_b38	MORN1	2.82	0.00702	0.114953	14	0.040769	yes	KDNCTX
chr1_2353459_T_G_b38	MORN1	2.82	0.00702	0.114953	14	0.040769	yes	KDNCTX
chr1_2356177_T_C_b38	MORN1	2.82	0.00702	0.114953	14	0.040769	yes	KDNCTX
chr1_2268730_T_C_b38	MORN1	-2.794	0.0075	-0.128073	5	0.045831	yes	KDNCTX
chr1_2348378_C_T_b38	MORN1	2.739	0.00868	0.113535	6	0.041452	yes	KDNCTX
chr1_2350696_G_A_b38	MORN1	2.739	0.00868	0.113535	6	0.041452	yes	KDNCTX
chr1_2342999_A_G_b38	MORN1	2.736	0.00874	0.123141	4	0.045002	yes	KDNCTX
chr1_2021166_T_C_b38	MORN1	2.715	0.00924	0.120335	4	0.044323	yes	KDNCTX
chr1_2338460_T_C_b38	MORN1	4.119	0.000153	0.131005	11	0.031806	no	KDNCTX
chr1_2338570_C_T_b38	MORN1	3.271	0.00201	0.117004	9	0.035772	no	KDNCTX
chr1_2367872_A_G_b38	MORN1	-3.25	0.00213	-0.118524	12	0.036466	no	KDNCTX
chr1_2368188_T_C_b38	MORN1	-3.25	0.00213	-0.118524	12	0.036466	no	KDNCTX
chr1_2022137_G_A_b38	MORN1	3.151	0.00283	0.115601	8	0.036682	no	KDNCTX
chr1_2189679_C_T_b38	MORN1	3.125	0.00305	0.136179	8	0.043581	no	KDNCTX
chr1_2364339_A_C_b38	MORN1	-3.101	0.00325	-0.118723	10	0.038283	no	KDNCTX
chr1_2359472_G_A_b38	MORN1	3.1	0.00326	0.124509	10	0.040161	no	KDNCTX
chr1_2366956_CAAAATACATAGA_C_b38	MORN1	-3.09	0.00336	-0.11741	11	0.037998	no	KDNCTX
chr1_2366555_G_C_b38	MORN1	-3.016	0.00412	-0.117956	9	0.039108	no	KDNCTX
chr1_1751888_C_T_b38	MORN1	2.988	0.00446	0.132636	4	0.044392	no	KDNCTX
chr1_1864334_AAAG_A_b38	MORN1	2.903	0.00561	0.144841	3	0.049888	no	KDNCTX
chr1_1739519_C_G_b38	MORN1	2.887	0.00585	0.117344	6	0.04064	no	KDNCTX
chr1_2367456_C_CAA_b38	MORN1	-2.867	0.00619	-0.112285	7	0.03917	no	KDNCTX
chr1_2352756_T_C_b38	MORN1	-2.864	0.00623	-0.113857	9	0.039754	no	KDNCTX
chr1_2366496_A_T_b38	MORN1	-2.864	0.00623	-0.113857	9	0.039754	no	KDNCTX
chr1_2367197_G_A_b38	MORN1	-2.864	0.00623	-0.113857	9	0.039754	no	KDNCTX
chr1_2367799_C_T_b38	MORN1	-2.864	0.00623	-0.113857	9	0.039754	no	KDNCTX
chr1_2337211_C_G_b38	MORN1	2.821	0.00699	0.108063	10	0.038303	no	KDNCTX
chr1_2366243_C_T_b38	MORN1	-2.808	0.00724	-0.108226	9	0.038542	no	KDNCTX
chr1_3195105_G_A_b38	MORN1	2.777	0.00785	0.136732	9	0.049232	no	KDNCTX
chr1_2365333_G_A_b38	MORN1	-2.775	0.00791	-0.112386	9	0.040506	no	KDNCTX
chr1_2368473_T_C_b38	MORN1	-2.763	0.00816	-0.108305	13	0.039205	no	KDNCTX
chr1_2364339_A_C_b38	MORN1	-7.052	4.46e-11	-0.072435	33	0.010272	yes	LIVER
chr1_2366816_A_G_b38	MORN1	-6.987	6.38e-11	-0.072501	32	0.010376	yes	LIVER
chr1_2351241_C_T_b38	MORN1	-6.491	9.34e-10	-0.069719	30	0.010742	yes	LIVER
chr1_2367456_C_CAA_b38	MORN1	-6.245	3.39e-09	-0.071811	21	0.011499	yes	LIVER
chr1_2343517_G_A_b38	MORN1	-6.008	1.14e-08	-0.068231	26	0.011357	yes	LIVER
chr1_2343699_C_T_b38	MORN1	-6.008	1.14e-08	-0.068231	26	0.011357	yes	LIVER
chr1_2369210_C_T_b38	MORN1	-5.953	1.51e-08	-0.062049	34	0.010424	yes	LIVER
chr1_2350539_T_G_b38	MORN1	-5.178	6.4e-07	-0.05624	36	0.010862	yes	LIVER
chr1_2366021_T_C_b38	MORN1	-5.165	6.79e-07	-0.056167	37	0.010875	yes	LIVER
chr1_2364657_A_T_b38	MORN1	-5.11	8.71e-07	-0.055167	37	0.010795	yes	LIVER
chr1_2364658_A_T_b38	MORN1	-5.11	8.71e-07	-0.055167	37	0.010795	yes	LIVER
chr1_2349222_G_A_b38	MORN1	-5.099	9.17e-07	-0.056085	42	0.010999	yes	LIVER
chr1_2346801_C_T_b38	MORN1	-4.957	1.74e-06	-0.055019	42	0.011098	yes	LIVER
chr1_2341705_A_G_b38	MORN1	4.06	7.51e-05	0.044685	47	0.011005	yes	LIVER
chr1_2347542_C_T_b38	MORN1	-4.051	7.8e-05	-0.046368	34	0.011446	yes	LIVER
chr1_1725582_T_C_b38	MORN1	4.05	7.82e-05	0.038864	49	0.009596	yes	LIVER
chr1_2357308_T_C_b38	MORN1	3.968	0.000108	0.042628	42	0.010744	yes	LIVER
chr1_2338659_A_G_b38	MORN1	3.959	0.000111	0.044272	41	0.011183	yes	LIVER
chr1_2297717_C_T_b38	MORN1	-3.938	0.00012	-0.051273	10	0.01302	yes	LIVER
chr1_2346111_G_C_b38	MORN1	-3.885	0.000147	-0.044683	33	0.011501	yes	LIVER
chr1_2298478_C_T_b38	MORN1	-3.844	0.000172	-0.049873	10	0.012975	yes	LIVER
chr1_2342734_T_C_b38	MORN1	-3.823	0.000186	-0.052871	8	0.01383	yes	LIVER
chr1_2360716_T_C_b38	MORN1	3.81	0.000195	0.041116	41	0.010793	yes	LIVER
chr1_2360970_T_C_b38	MORN1	3.81	0.000195	0.041116	41	0.010793	yes	LIVER
chr1_2361332_A_AG_b38	MORN1	3.81	0.000195	0.041116	41	0.010793	yes	LIVER
chr1_2361548_A_ACT_b38	MORN1	3.81	0.000195	0.041116	41	0.010793	yes	LIVER
chr1_2845230_A_AACAAAACAAAAC_b38	MORN1	3.797	0.000205	0.062355	3	0.016424	yes	LIVER
chr1_2358849_T_C_b38	MORN1	3.795	0.000206	0.040784	41	0.010747	yes	LIVER
chr1_2363405_C_T_b38	MORN1	3.739	0.000254	0.049624	11	0.013273	yes	LIVER
chr1_2348378_C_T_b38	MORN1	3.678	0.000317	0.050824	7	0.01382	yes	LIVER
chr1_2350696_G_A_b38	MORN1	3.678	0.000317	0.050824	7	0.01382	yes	LIVER
chr1_2362718_G_A_b38	MORN1	3.636	0.000369	0.048707	9	0.013397	yes	LIVER
chr1_2364499_A_G_b38	MORN1	3.595	0.000427	0.045838	13	0.012751	yes	LIVER
chr1_3010437_C_CT_b38	MORN1	3.591	0.000433	0.048066	11	0.013387	yes	LIVER
chr1_2338460_T_C_b38	MORN1	3.575	0.000458	0.040365	24	0.01129	yes	LIVER
chr1_2337299_A_G_b38	MORN1	3.491	0.000616	0.040342	26	0.011557	yes	LIVER
chr1_3022425_G_A_b38	MORN1	3.381	9e-04	0.047615	7	0.014083	yes	LIVER
chr1_2309937_C_CTT_b38	MORN1	3.364	0.000953	0.040175	20	0.011943	yes	LIVER
chr1_2367644_G_A_b38	MORN1	-3.347	0.00101	-0.040353	25	0.012058	yes	LIVER
chr1_2356409_G_C_b38	MORN1	3.323	0.00109	0.04568	10	0.013746	yes	LIVER
chr1_2369713_ATAAT_A_b38	MORN1	-3.287	0.00124	-0.042716	10	0.012997	yes	LIVER
chr1_2353743_A_T_b38	MORN1	3.256	0.00137	0.044906	13	0.013793	yes	LIVER
chr1_2370032_C_G_b38	MORN1	3.247	0.00141	0.048891	4	0.015056	yes	LIVER
chr1_2065678_C_CAA_b38	MORN1	-3.236	0.00146	-0.086061	3	0.026595	yes	LIVER
chr1_2338570_C_T_b38	MORN1	3.12	0.00213	0.036099	21	0.011568	yes	LIVER
chr1_2698969_C_A_b38	MORN1	3.114	0.00217	0.06277	4	0.020159	yes	LIVER
chr1_2369336_A_G_b38	MORN1	-3.076	0.00246	-0.039072	12	0.012704	yes	LIVER
chr1_2333737_T_C_b38	MORN1	3.073	0.00248	0.034679	25	0.011285	yes	LIVER
chr1_2337352_A_G_b38	MORN1	3.043	0.00272	0.035656	32	0.011717	yes	LIVER
chr1_2345849_ACACACAG_A_b38	MORN1	2.971	0.0034	0.043537	4	0.014653	yes	LIVER
chr1_1584235_A_AT_b38	MORN1	-2.933	0.00383	-0.032289	28	0.011009	yes	LIVER
chr1_2334530_T_G_b38	MORN1	2.928	0.00389	0.03339	24	0.011404	yes	LIVER
chr1_2326288_C_T_b38	MORN1	2.884	0.00445	0.032167	27	0.011154	yes	LIVER
chr1_2326424_C_T_b38	MORN1	2.884	0.00445	0.032167	27	0.011154	yes	LIVER
chr1_2326884_C_T_b38	MORN1	2.884	0.00445	0.032167	27	0.011154	yes	LIVER
chr1_2346676_G_C_b38	MORN1	-2.851	0.00492	-0.039642	7	0.013907	yes	LIVER
chr1_2350287_A_C_b38	MORN1	-2.851	0.00492	-0.039642	7	0.013907	yes	LIVER
chr1_2353047_C_T_b38	MORN1	-2.851	0.00492	-0.039642	7	0.013907	yes	LIVER
chr1_2357811_C_G_b38	MORN1	-2.851	0.00492	-0.039642	7	0.013907	yes	LIVER
chr1_2357812_T_C_b38	MORN1	-2.851	0.00492	-0.039642	7	0.013907	yes	LIVER
chr1_2359828_A_G_b38	MORN1	-2.851	0.00492	-0.039642	7	0.013907	yes	LIVER
chr1_2363591_T_G_b38	MORN1	-2.851	0.00492	-0.039642	7	0.013907	yes	LIVER
chr1_2367871_C_T_b38	MORN1	-2.851	0.00492	-0.039642	7	0.013907	yes	LIVER
chr1_2344932_C_T_b38	MORN1	2.814	0.00547	0.042373	3	0.015056	yes	LIVER
chr1_2365220_A_G_b38	MORN1	-2.807	0.0056	-0.039939	6	0.014229	yes	LIVER
chr1_2300128_G_T_b38	MORN1	-2.796	0.00578	-0.029169	52	0.010432	yes	LIVER
chr1_2324977_G_GGCT_b38	MORN1	2.771	0.00623	0.031284	28	0.011292	yes	LIVER
chr1_2327034_G_A_b38	MORN1	2.766	0.00632	0.031053	29	0.011228	yes	LIVER
chr1_2385549_C_CG_b38	MORN1	-2.704	0.00757	-0.048233	4	0.017839	yes	LIVER
chr1_3236404_A_T_b38	MORN1	-2.677	0.00816	-0.040899	12	0.015275	yes	LIVER
chr1_1690741_T_A_b38	MORN1	2.669	0.00836	0.030624	19	0.011474	yes	LIVER
chr1_2334355_G_A_b38	MORN1	2.667	0.00842	0.042544	4	0.015955	yes	LIVER
chr1_2344932_C_A_b38	MORN1	-2.645	0.00895	-0.037093	7	0.014025	yes	LIVER
chr1_2335494_C_T_b38	MORN1	2.63	0.00934	0.035959	8	0.013674	yes	LIVER
chr1_3325912_CCTTGGCCCTCCTCGGCCCT_C_b38	MORN1	2.607	0.00996	0.042635	5	0.016354	yes	LIVER
chr1_2368473_T_C_b38	MORN1	-6.999	5.99e-11	-0.072518	38	0.010362	no	LIVER
chr1_2367872_A_G_b38	MORN1	-6.934	8.54e-11	-0.071721	35	0.010343	no	LIVER
chr1_2368188_T_C_b38	MORN1	-6.934	8.54e-11	-0.071721	35	0.010343	no	LIVER
chr1_2366956_CAAAATACATAGA_C_b38	MORN1	-6.658	3.83e-10	-0.070105	33	0.01053	no	LIVER
chr1_2366555_G_C_b38	MORN1	-6.639	4.23e-10	-0.069892	31	0.010527	no	LIVER
chr1_2352756_T_C_b38	MORN1	-6.599	5.25e-10	-0.070342	30	0.01066	no	LIVER
chr1_2366496_A_T_b38	MORN1	-6.599	5.25e-10	-0.070342	30	0.01066	no	LIVER
chr1_2367799_C_T_b38	MORN1	-6.599	5.25e-10	-0.070342	30	0.01066	no	LIVER
chr1_2368939_G_C_b38	MORN1	-6.599	5.25e-10	-0.070342	30	0.01066	no	LIVER
chr1_2368718_C_A_b38	MORN1	-6.578	5.86e-10	-0.069713	30	0.010597	no	LIVER
chr1_2366243_C_T_b38	MORN1	-6.557	6.57e-10	-0.069808	29	0.010646	no	LIVER
chr1_2367197_G_A_b38	MORN1	-6.505	8.67e-10	-0.069599	29	0.0107	no	LIVER
chr1_2365333_G_A_b38	MORN1	-6.416	1.38e-09	-0.067532	30	0.010525	no	LIVER
chr1_2348700_C_T_b38	MORN1	-6.109	6.84e-09	-0.068284	26	0.011178	no	LIVER
chr1_2365236_C_T_b38	MORN1	-5.947	1.56e-08	-0.064054	30	0.010772	no	LIVER
chr1_2363829_A_T_b38	MORN1	-5.841	2.65e-08	-0.059803	33	0.010239	no	LIVER
chr1_2362863_C_CA_b38	MORN1	-4.963	1.7e-06	-0.068702	7	0.013842	no	LIVER
chr1_2340787_C_T_b38	MORN1	-4.752	4.33e-06	-0.057733	18	0.01215	no	LIVER
chr1_2343937_T_G_b38	MORN1	-4.605	8.14e-06	-0.052533	33	0.011408	no	LIVER
chr1_2350750_AGGGGTGGCACG_A_b38	MORN1	-4.522	1.16e-05	-0.058186	13	0.012867	no	LIVER
chr1_2354645_C_T_b38	MORN1	-4.463	1.48e-05	-0.060858	9	0.013637	no	LIVER
chr1_2354688_G_C_b38	MORN1	-4.463	1.48e-05	-0.060858	9	0.013637	no	LIVER
chr1_2362229_A_G_b38	MORN1	-4.463	1.48e-05	-0.060858	9	0.013637	no	LIVER
chr1_2351215_T_G_b38	MORN1	-4.314	2.74e-05	-0.058318	10	0.01352	no	LIVER
chr1_2348393_G_A_b38	MORN1	-4.313	2.75e-05	-0.057654	10	0.013369	no	LIVER
chr1_2351678_C_T_b38	MORN1	-4.3	2.9e-05	-0.057559	10	0.013386	no	LIVER
chr1_2342133_C_G_b38	MORN1	-4.293	2.98e-05	-0.060204	8	0.014025	no	LIVER
chr1_2342137_G_A_b38	MORN1	-4.293	2.98e-05	-0.060204	8	0.014025	no	LIVER
chr1_2347212_C_T_b38	MORN1	-4.053	7.72e-05	-0.055753	9	0.013755	no	LIVER
chr1_2352403_G_T_b38	MORN1	3.787	0.000213	0.04085	41	0.010788	no	LIVER
chr1_2352457_A_G_b38	MORN1	3.787	0.000213	0.04085	41	0.010788	no	LIVER
chr1_2353459_T_G_b38	MORN1	3.787	0.000213	0.04085	41	0.010788	no	LIVER
chr1_2356177_T_C_b38	MORN1	3.787	0.000213	0.04085	41	0.010788	no	LIVER
chr1_2359882_C_CAA_b38	MORN1	3.436	0.000745	0.051339	5	0.014942	no	LIVER
chr1_2344256_A_T_b38	MORN1	3.428	0.000766	0.047083	6	0.013735	no	LIVER
chr1_2369118_G_A_b38	MORN1	-3.395	0.000858	-0.045171	10	0.013306	no	LIVER
chr1_2391602_T_C_b38	MORN1	-3.383	0.000894	-0.03913	17	0.011567	no	LIVER
chr1_2962689_G_GC_b38	MORN1	-3.277	0.00128	-0.117705	3	0.035919	no	LIVER
chr1_2359472_G_A_b38	MORN1	3.273	0.00129	0.035288	32	0.010782	no	LIVER
chr1_2379954_A_G_b38	MORN1	-3.217	0.00156	-0.037333	17	0.011605	no	LIVER
chr1_1698022_G_A_b38	MORN1	3.183	0.00174	0.110512	4	0.034722	no	LIVER
chr1_2343445_C_T_b38	MORN1	3.166	0.00184	0.043182	7	0.013638	no	LIVER
chr1_3225530_CTGTG_C_b38	MORN1	3.072	0.00248	0.040172	25	0.013077	no	LIVER
chr1_2337211_C_G_b38	MORN1	3.013	0.00299	0.03616	21	0.012003	no	LIVER
chr1_2351551_C_T_b38	MORN1	2.99	0.00321	0.04269	5	0.014276	no	LIVER
chr1_2389263_T_C_b38	MORN1	-2.97	0.00341	-0.0364	16	0.012255	no	LIVER
chr1_1681370_T_G_b38	MORN1	-2.935	0.0038	-0.045839	7	0.015618	no	LIVER
chr1_1514211_A_G_b38	MORN1	-2.917	0.00402	-0.067361	3	0.023092	no	LIVER
chr1_2401200_CTGTCCTCCCT_C_b38	MORN1	-2.904	0.00418	-0.096611	3	0.033263	no	LIVER
chr1_2401212_C_G_b38	MORN1	-2.904	0.00418	-0.096611	3	0.033263	no	LIVER
chr1_2245788_C_CTTTT_b38	MORN1	2.903	0.0042	0.071011	4	0.024463	no	LIVER
chr1_2660743_AC_A_b38	MORN1	-2.902	0.0042	-0.083485	3	0.028764	no	LIVER
chr1_2392569_C_T_b38	MORN1	-2.89	0.00437	-0.03913	9	0.01354	no	LIVER
chr1_2344634_T_C_b38	MORN1	2.876	0.00455	0.041509	5	0.014431	no	LIVER
chr1_2356095_C_T_b38	MORN1	2.875	0.00457	0.040936	6	0.01424	no	LIVER
chr1_2357882_G_A_b38	MORN1	2.875	0.00457	0.040936	6	0.01424	no	LIVER
chr1_2344757_C_A_b38	MORN1	2.857	0.00482	0.040771	5	0.01427	no	LIVER
chr1_2344761_T_A_b38	MORN1	2.857	0.00482	0.040771	5	0.01427	no	LIVER
chr1_2345727_G_A_b38	MORN1	2.857	0.00482	0.040771	5	0.01427	no	LIVER
chr1_2350934_C_T_b38	MORN1	2.857	0.00482	0.040771	5	0.01427	no	LIVER
chr1_2380209_G_A_b38	MORN1	-2.844	0.00501	-0.03087	29	0.010854	no	LIVER
chr1_2340807_G_A_b38	MORN1	2.815	0.00547	0.038399	8	0.013643	no	LIVER
chr1_2341451_G_A_b38	MORN1	2.815	0.00547	0.038399	8	0.013643	no	LIVER
chr1_2380956_C_T_b38	MORN1	-2.8	0.00571	-0.039466	7	0.014093	no	LIVER
chr1_2382101_A_G_b38	MORN1	-2.8	0.00571	-0.039466	7	0.014093	no	LIVER
chr1_2367055_C_A_b38	MORN1	2.798	0.00575	0.038312	7	0.013693	no	LIVER
chr1_2380105_C_T_b38	MORN1	-2.784	0.00599	-0.030369	28	0.010909	no	LIVER
chr1_2340235_T_C_b38	MORN1	2.726	0.00708	0.037348	8	0.013698	no	LIVER
chr1_1523187_A_G_b38	MORN1	-2.71	0.00744	-0.057369	9	0.021172	no	LIVER
chr1_1680672_C_T_b38	MORN1	-2.704	0.00755	-0.03004	46	0.011108	no	LIVER
chr1_3233225_G_A_b38	MORN1	-2.697	0.00771	-0.045573	11	0.016896	no	LIVER
chr1_1521518_G_A_b38	MORN1	-2.656	0.00867	-0.057337	7	0.021587	no	LIVER
chr1_2340625_G_A_b38	MORN1	2.651	0.00879	0.035687	9	0.01346	no	LIVER
chr1_1520875_A_G_b38	MORN1	-2.61	0.00987	-0.057367	7	0.021978	no	LIVER
chr1_2366021_T_C_b38	MORN1	-6.253	9.49e-10	-0.048133	113	0.007698	yes	LUNG
chr1_2364499_A_G_b38	MORN1	6.132	1.92e-09	0.052484	45	0.00856	yes	LUNG
chr1_2348700_C_T_b38	MORN1	-6.111	2.17e-09	-0.051338	58	0.008401	yes	LUNG
chr1_2348378_C_T_b38	MORN1	6.048	3.12e-09	0.053367	39	0.008824	yes	LUNG
chr1_2350696_G_A_b38	MORN1	6.037	3.31e-09	0.05312	40	0.008799	yes	LUNG
chr1_2362718_G_A_b38	MORN1	6.018	3.7e-09	0.052731	40	0.008762	yes	LUNG
chr1_2350539_T_G_b38	MORN1	-5.92	6.47e-09	-0.046317	117	0.007824	yes	LUNG
chr1_2356409_G_C_b38	MORN1	5.859	9.08e-09	0.051698	45	0.008824	yes	LUNG
chr1_2349222_G_A_b38	MORN1	-5.783	1.38e-08	-0.046133	127	0.007977	yes	LUNG
chr1_2363405_C_T_b38	MORN1	5.772	1.47e-08	0.050266	48	0.008708	yes	LUNG
chr1_2367456_C_CAA_b38	MORN1	-5.705	2.13e-08	-0.049105	50	0.008607	yes	LUNG
chr1_2353743_A_T_b38	MORN1	5.612	3.53e-08	0.049658	53	0.008849	yes	LUNG
chr1_2358849_T_C_b38	MORN1	5.362	1.33e-07	0.041928	110	0.007819	yes	LUNG
chr1_2353459_T_G_b38	MORN1	5.312	1.71e-07	0.041579	109	0.007827	yes	LUNG
chr1_2356177_T_C_b38	MORN1	5.312	1.71e-07	0.041579	109	0.007827	yes	LUNG
chr1_2352403_G_T_b38	MORN1	5.234	2.56e-07	0.04106	110	0.007844	yes	LUNG
chr1_2352457_A_G_b38	MORN1	5.188	3.24e-07	0.040843	110	0.007873	yes	LUNG
chr1_2338659_A_G_b38	MORN1	5.172	3.51e-07	0.040876	97	0.007903	yes	LUNG
chr1_2363829_A_T_b38	MORN1	-5.149	3.94e-07	-0.039591	73	0.007689	yes	LUNG
chr1_2360716_T_C_b38	MORN1	5.147	3.97e-07	0.040577	109	0.007883	yes	LUNG
chr1_2360970_T_C_b38	MORN1	5.147	3.97e-07	0.040577	109	0.007883	yes	LUNG
chr1_2361332_A_AG_b38	MORN1	5.147	3.97e-07	0.040577	109	0.007883	yes	LUNG
chr1_2361548_A_ACT_b38	MORN1	5.147	3.97e-07	0.040577	109	0.007883	yes	LUNG
chr1_2344634_T_C_b38	MORN1	5.071	5.82e-07	0.047189	25	0.009305	yes	LUNG
chr1_2344757_C_A_b38	MORN1	5.035	6.94e-07	0.046733	25	0.009281	yes	LUNG
chr1_2344761_T_A_b38	MORN1	5.035	6.94e-07	0.046733	25	0.009281	yes	LUNG
chr1_2350934_C_T_b38	MORN1	5.022	7.41e-07	0.046732	25	0.009305	yes	LUNG
chr1_2351551_C_T_b38	MORN1	5.015	7.7e-07	0.047338	24	0.00944	yes	LUNG
chr1_2345849_ACACACAG_A_b38	MORN1	5.008	7.96e-07	0.04875	19	0.009735	yes	LUNG
chr1_2350750_AGGGGTGGCACG_A_b38	MORN1	-4.985	8.91e-07	-0.046984	27	0.009426	yes	LUNG
chr1_2357882_G_A_b38	MORN1	4.971	9.54e-07	0.046561	26	0.009367	yes	LUNG
chr1_2345727_G_A_b38	MORN1	4.928	1.17e-06	0.04624	24	0.009383	yes	LUNG
chr1_2356095_C_T_b38	MORN1	4.845	1.76e-06	0.045703	25	0.009434	yes	LUNG
chr1_2344932_C_T_b38	MORN1	4.765	2.56e-06	0.047551	17	0.009979	yes	LUNG
chr1_2347542_C_T_b38	MORN1	-4.754	2.7e-06	-0.037394	103	0.007866	yes	LUNG
chr1_2348393_G_A_b38	MORN1	-4.703	3.42e-06	-0.045457	24	0.009665	yes	LUNG
chr1_2367055_C_A_b38	MORN1	4.683	3.77e-06	0.042733	29	0.009126	yes	LUNG
chr1_2342133_C_G_b38	MORN1	-4.529	7.64e-06	-0.047173	18	0.010417	yes	LUNG
chr1_2342137_G_A_b38	MORN1	-4.529	7.64e-06	-0.047173	18	0.010417	yes	LUNG
chr1_2337211_C_G_b38	MORN1	4.484	9.33e-06	0.037255	64	0.008308	yes	LUNG
chr1_2359472_G_A_b38	MORN1	4.453	1.07e-05	0.035452	77	0.007961	yes	LUNG
chr1_2357308_T_C_b38	MORN1	4.446	1.11e-05	0.035974	115	0.008092	yes	LUNG
chr1_2346111_G_C_b38	MORN1	-4.441	1.13e-05	-0.035346	102	0.007959	yes	LUNG
chr1_2345774_T_C_b38	MORN1	4.427	1.21e-05	0.040822	26	0.009222	yes	LUNG
chr1_2362863_C_CA_b38	MORN1	-4.41	1.3e-05	-0.04661	15	0.010569	yes	LUNG
chr1_2343937_T_G_b38	MORN1	-4.409	1.31e-05	-0.036414	91	0.00826	yes	LUNG
chr1_2359882_C_CAA_b38	MORN1	4.393	1.4e-05	0.04391	21	0.009995	yes	LUNG
chr1_2344256_A_T_b38	MORN1	4.276	2.33e-05	0.040377	23	0.009442	yes	LUNG
chr1_2337352_A_G_b38	MORN1	4.261	2.49e-05	0.036185	69	0.008493	yes	LUNG
chr1_2347212_C_T_b38	MORN1	-4.179	3.53e-05	-0.040932	24	0.009795	yes	LUNG
chr1_2338460_T_C_b38	MORN1	4.141	4.13e-05	0.033665	68	0.008129	yes	LUNG
chr1_2351215_T_G_b38	MORN1	-4.135	4.24e-05	-0.041815	22	0.010112	yes	LUNG
chr1_2344583_G_A_b38	MORN1	4.058	5.85e-05	0.037495	29	0.009239	yes	LUNG
chr1_2354688_G_C_b38	MORN1	-4.043	6.22e-05	-0.041078	22	0.01016	yes	LUNG
chr1_2362229_A_G_b38	MORN1	-4.038	6.36e-05	-0.040642	23	0.010066	yes	LUNG
chr1_2354645_C_T_b38	MORN1	-4.014	7e-05	-0.040614	22	0.010118	yes	LUNG
chr1_2351678_C_T_b38	MORN1	-3.988	7.78e-05	-0.040764	21	0.010221	yes	LUNG
chr1_2340807_G_A_b38	MORN1	3.918	0.000103	0.036321	28	0.00927	yes	LUNG
chr1_2341451_G_A_b38	MORN1	3.861	0.000129	0.035622	29	0.009225	yes	LUNG
chr1_2337141_G_A_b38	MORN1	3.748	0.000202	0.032233	52	0.008601	yes	LUNG
chr1_2337299_A_G_b38	MORN1	3.739	0.000209	0.031647	63	0.008465	yes	LUNG
chr1_2340625_G_A_b38	MORN1	3.713	0.000231	0.034125	30	0.009191	yes	LUNG
chr1_2369355_G_GA_b38	MORN1	-3.612	0.000338	-0.032693	48	0.00905	yes	LUNG
chr1_2196630_A_G_b38	MORN1	3.472	0.000567	0.040261	19	0.011595	yes	LUNG
chr1_2343445_C_T_b38	MORN1	3.459	0.000594	0.032193	27	0.009306	yes	LUNG
chr1_2353047_C_T_b38	MORN1	-3.347	0.000886	-0.035679	15	0.01066	yes	LUNG
chr1_2350287_A_C_b38	MORN1	-3.327	0.000951	-0.035372	15	0.010632	yes	LUNG
chr1_2337229_A_G_b38	MORN1	3.294	0.00107	0.026812	100	0.008139	yes	LUNG
chr1_2344932_C_A_b38	MORN1	-3.261	0.00119	-0.03469	15	0.010636	yes	LUNG
chr1_2346676_G_C_b38	MORN1	-3.208	0.00143	-0.034247	15	0.010676	yes	LUNG
chr1_2357811_C_G_b38	MORN1	-3.173	0.00161	-0.033847	15	0.010666	yes	LUNG
chr1_2357812_T_C_b38	MORN1	-3.173	0.00161	-0.033847	15	0.010666	yes	LUNG
chr1_2359828_A_G_b38	MORN1	-3.173	0.00161	-0.033847	15	0.010666	yes	LUNG
chr1_2363591_T_G_b38	MORN1	-3.173	0.00161	-0.033847	15	0.010666	yes	LUNG
chr1_2355481_C_T_b38	MORN1	3.173	0.00161	0.062349	8	0.019649	yes	LUNG
chr1_2367871_C_T_b38	MORN1	-3.153	0.00173	-0.033662	15	0.010677	yes	LUNG
chr1_2365220_A_G_b38	MORN1	-3.133	0.00185	-0.033791	15	0.010786	yes	LUNG
chr1_2376590_G_A_b38	MORN1	3.13	0.00186	0.040539	4	0.012951	yes	LUNG
chr1_2337239_T_C_b38	MORN1	3.043	0.00248	0.02733	42	0.008982	yes	LUNG
chr1_2204887_GCCCTCAAGCCCCGC_G_b38	MORN1	3.006	0.0028	0.03602	19	0.011983	yes	LUNG
chr1_3141097_T_C_b38	MORN1	-2.988	0.00296	-0.025133	72	0.008411	yes	LUNG
chr1_2340235_T_C_b38	MORN1	2.951	0.00333	0.026877	33	0.009107	yes	LUNG
chr1_2193733_G_A_b38	MORN1	2.863	0.0044	0.033817	18	0.011813	yes	LUNG
chr1_2210401_C_A_b38	MORN1	2.862	0.00441	0.033999	20	0.011879	yes	LUNG
chr1_2150203_C_A_b38	MORN1	2.859	0.00445	0.035056	11	0.012263	yes	LUNG
chr1_3353146_A_C_b38	MORN1	2.847	0.00462	0.057127	9	0.020066	yes	LUNG
chr1_2340764_G_T_b38	MORN1	2.843	0.00467	0.026286	30	0.009246	yes	LUNG
chr1_3109083_A_AAATAAT_b38	MORN1	-2.835	0.00479	-0.059487	3	0.020983	yes	LUNG
chr1_2204652_A_G_b38	MORN1	2.822	0.00499	0.033473	21	0.011861	yes	LUNG
chr1_2750697_G_A_b38	MORN1	2.819	0.00504	0.029741	9	0.010551	yes	LUNG
chr1_2364484_C_T_b38	MORN1	-2.798	0.00537	-0.030271	17	0.010819	yes	LUNG
chr1_2340564_G_A_b38	MORN1	2.786	0.00557	0.025954	29	0.009316	yes	LUNG
chr1_2472817_C_T_b38	MORN1	2.729	0.0066	0.02262	64	0.008288	yes	LUNG
chr1_2186119_C_T_b38	MORN1	2.709	0.00701	0.034045	8	0.012568	yes	LUNG
chr1_1433374_T_C_b38	MORN1	-2.67	0.00786	-0.024687	65	0.009245	yes	LUNG
chr1_2609034_TACACACACACACAC_T_b38	MORN1	2.646	0.00842	0.02461	43	0.009299	yes	LUNG
chr1_2319680_A_G_b38	MORN1	2.616	0.00921	0.024239	34	0.009267	yes	LUNG
chr1_2748488_T_TGAGCATCTGACAGCATGGAACAGCACCCACACCCCCAGGA_b38	MORN1	2.609	0.00938	0.035833	3	0.013734	yes	LUNG
chr1_2345148_G_A_b38	MORN1	-2.592	0.00985	-0.032468	7	0.012525	yes	LUNG
chr1_2368473_T_C_b38	MORN1	-7.12	4.36e-12	-0.055452	84	0.007788	no	LUNG
chr1_2366956_CAAAATACATAGA_C_b38	MORN1	-7.111	4.62e-12	-0.055842	76	0.007852	no	LUNG
chr1_2367872_A_G_b38	MORN1	-7.053	6.76e-12	-0.055003	79	0.007799	no	LUNG
chr1_2368188_T_C_b38	MORN1	-7.053	6.76e-12	-0.055003	79	0.007799	no	LUNG
chr1_2366816_A_G_b38	MORN1	-7.007	9.1e-12	-0.055081	74	0.007861	no	LUNG
chr1_2364339_A_C_b38	MORN1	-6.892	1.9e-11	-0.054092	76	0.007849	no	LUNG
chr1_2352756_T_C_b38	MORN1	-6.736	5.07e-11	-0.053611	72	0.007959	no	LUNG
chr1_2367799_C_T_b38	MORN1	-6.589	1.25e-10	-0.052594	71	0.007982	no	LUNG
chr1_2366496_A_T_b38	MORN1	-6.56	1.5e-10	-0.052409	71	0.007989	no	LUNG
chr1_2368939_G_C_b38	MORN1	-6.538	1.72e-10	-0.052128	71	0.007973	no	LUNG
chr1_2366243_C_T_b38	MORN1	-6.528	1.82e-10	-0.052014	70	0.007967	no	LUNG
chr1_2368718_C_A_b38	MORN1	-6.518	1.94e-10	-0.051771	70	0.007943	no	LUNG
chr1_2366555_G_C_b38	MORN1	-6.501	2.14e-10	-0.05185	72	0.007975	no	LUNG
chr1_2367197_G_A_b38	MORN1	-6.412	3.67e-10	-0.051312	70	0.008002	no	LUNG
chr1_2340787_C_T_b38	MORN1	-6.403	3.87e-10	-0.053253	48	0.008316	no	LUNG
chr1_2365333_G_A_b38	MORN1	-6.389	4.23e-10	-0.050346	70	0.007881	no	LUNG
chr1_2365236_C_T_b38	MORN1	-6.388	4.25e-10	-0.050756	71	0.007945	no	LUNG
chr1_2364657_A_T_b38	MORN1	-6.275	8.31e-10	-0.048042	115	0.007656	no	LUNG
chr1_2364658_A_T_b38	MORN1	-6.275	8.31e-10	-0.048042	115	0.007656	no	LUNG
chr1_2351241_C_T_b38	MORN1	-6.258	9.18e-10	-0.051412	68	0.008215	no	LUNG
chr1_2343517_G_A_b38	MORN1	-6.184	1.42e-09	-0.051506	63	0.008329	no	LUNG
chr1_2343699_C_T_b38	MORN1	-5.998	4.14e-09	-0.049965	63	0.00833	no	LUNG
chr1_2346801_C_T_b38	MORN1	-5.664	2.67e-08	-0.045508	126	0.008035	no	LUNG
chr1_2341705_A_G_b38	MORN1	4.963	9.93e-07	0.039467	110	0.007953	no	LUNG
chr1_2369210_C_T_b38	MORN1	-4.937	1.12e-06	-0.040188	83	0.00814	no	LUNG
chr1_2344980_A_G_b38	MORN1	4.541	7.22e-06	0.041485	27	0.009135	no	LUNG
chr1_2338570_C_T_b38	MORN1	3.995	7.57e-05	0.032703	63	0.008186	no	LUNG
chr1_2335368_C_T_b38	MORN1	3.691	0.000251	0.046122	8	0.012497	no	LUNG
chr1_2436407_C_T_b38	MORN1	-3.65	0.000294	-0.069211	7	0.018963	no	LUNG
chr1_2369336_A_G_b38	MORN1	-3.404	0.000724	-0.03433	23	0.010085	no	LUNG
chr1_2189331_C_CA_b38	MORN1	3.225	0.00135	0.041216	5	0.012781	no	LUNG
chr1_2369713_ATAAT_A_b38	MORN1	-3.158	0.0017	-0.03245	19	0.010274	no	LUNG
chr1_2363805_C_CAAACAA_b38	MORN1	3.148	0.00175	0.028841	40	0.00916	no	LUNG
chr1_2364876_C_T_b38	MORN1	3.137	0.00182	0.064526	7	0.020569	no	LUNG
chr1_2205151_C_A_b38	MORN1	3.136	0.00183	0.051047	7	0.016279	no	LUNG
chr1_2138661_C_T_b38	MORN1	3.068	0.00229	0.040424	7	0.013176	no	LUNG
chr1_2359219_C_T_b38	MORN1	3.044	0.00248	0.062891	7	0.020662	no	LUNG
chr1_2364608_C_A_b38	MORN1	3.037	0.00253	0.060582	7	0.019948	no	LUNG
chr1_2342734_T_C_b38	MORN1	-3.018	0.00269	-0.028226	29	0.009351	no	LUNG
chr1_2369187_T_TA_b38	MORN1	3.009	0.00277	0.05663	7	0.01882	no	LUNG
chr1_2692540_C_G_b38	MORN1	3.003	0.00282	0.074682	3	0.024868	no	LUNG
chr1_2140299_C_T_b38	MORN1	2.851	0.00456	0.037493	7	0.01315	no	LUNG
chr1_1525526_C_T_b38	MORN1	-2.807	0.00521	-0.052601	7	0.018736	no	LUNG
chr1_2207111_G_C_b38	MORN1	2.739	0.0064	0.037771	7	0.013788	no	LUNG
chr1_1479205_A_C_b38	MORN1	-2.691	0.00738	-0.036246	18	0.013468	no	LUNG
chr1_2334355_G_A_b38	MORN1	2.66	0.0081	0.029582	17	0.011122	no	LUNG
chr1_3098959_G_A_b38	MORN1	2.649	0.00836	0.032045	8	0.012098	no	LUNG
chr1_1512497_C_G_b38	MORN1	-2.643	0.00851	-0.070038	3	0.026498	no	LUNG
chr1_2207909_CGTGTGTGT_C_b38	MORN1	2.639	0.00861	0.030903	16	0.01171	no	LUNG
chr1_2324194_G_A_b38	MORN1	2.638	0.00864	0.045406	4	0.017214	no	LUNG
chr1_2151390_G_A_b38	MORN1	2.624	0.009	0.035896	7	0.013682	no	LUNG
chr1_2197362_G_C_b38	MORN1	2.623	0.00902	0.035807	7	0.013652	no	LUNG
chr1_2774717_T_A_b38	MORN1	2.622	0.00903	0.062456	7	0.023817	no	LUNG
chr1_3269600_GACAGTCCCAGAGGAGC_G_b38	MORN1	-2.619	0.00912	-0.028433	32	0.010857	no	LUNG
chr1_2141345_CTTTTTT_C_b38	MORN1	2.606	0.00946	0.037103	5	0.014235	no	LUNG
chr1_2974675_GTCACACTCACCTGGGGGACGCGTCACACTCACCTGGGGAACGCC_G_b38	MORN1	-2.599	0.00967	-0.01859	138	0.007153	no	LUNG
chr1_2197209_G_A_b38	MORN1	2.597	0.00971	0.035257	7	0.013574	no	LUNG
chr1_2197378_G_GA_b38	MORN1	2.597	0.00971	0.035257	7	0.013574	no	LUNG
chr1_2197391_G_A_b38	MORN1	2.597	0.00971	0.035257	7	0.013574	no	LUNG
chr1_2315074_A_G_b38	MORN1	-2.596	0.00975	-0.02338	41	0.009007	no	LUNG
chr1_2340787_C_T_b38	MORN1	-4.289	3.69e-05	-0.071906	9	0.016766	yes	SLVRYG
chr1_2364339_A_C_b38	MORN1	-4.1	7.61e-05	-0.065255	18	0.015914	yes	SLVRYG
chr1_2366555_G_C_b38	MORN1	-4.079	8.26e-05	-0.065551	16	0.016071	yes	SLVRYG
chr1_2352756_T_C_b38	MORN1	-4.044	9.42e-05	-0.065827	16	0.016279	yes	SLVRYG
chr1_2368473_T_C_b38	MORN1	-4.037	9.68e-05	-0.06305	23	0.01562	yes	SLVRYG
chr1_2367799_C_T_b38	MORN1	-4.029	9.96e-05	-0.064816	16	0.016088	yes	SLVRYG
chr1_2366496_A_T_b38	MORN1	-3.952	0.000132	-0.063528	16	0.016073	yes	SLVRYG
chr1_2369210_C_T_b38	MORN1	-3.937	0.00014	-0.065388	18	0.016609	yes	SLVRYG
chr1_2366243_C_T_b38	MORN1	-3.91	0.000155	-0.06262	16	0.016016	yes	SLVRYG
chr1_2351241_C_T_b38	MORN1	-3.88	0.000172	-0.064317	16	0.016575	yes	SLVRYG
chr1_2366816_A_G_b38	MORN1	-3.777	0.00025	-0.05946	18	0.015742	yes	SLVRYG
chr1_2368188_T_C_b38	MORN1	-3.772	0.000255	-0.059764	20	0.015844	yes	SLVRYG
chr1_2366956_CAAAATACATAGA_C_b38	MORN1	-3.707	0.000321	-0.058391	20	0.015753	yes	SLVRYG
chr1_2367872_A_G_b38	MORN1	-3.683	0.00035	-0.058678	20	0.015934	yes	SLVRYG
chr1_2343517_G_A_b38	MORN1	-3.67	0.000365	-0.063383	14	0.017269	yes	SLVRYG
chr1_2343699_C_T_b38	MORN1	-3.67	0.000365	-0.063383	14	0.017269	yes	SLVRYG
chr1_2348700_C_T_b38	MORN1	-3.654	0.000386	-0.064977	11	0.017781	yes	SLVRYG
chr1_2368939_G_C_b38	MORN1	-3.616	0.000442	-0.058455	16	0.016167	yes	SLVRYG
chr1_2367197_G_A_b38	MORN1	-3.577	0.000505	-0.058085	15	0.016239	yes	SLVRYG
chr1_2368718_C_A_b38	MORN1	-3.567	0.000523	-0.05793	16	0.01624	yes	SLVRYG
chr1_2367456_C_CAA_b38	MORN1	-3.537	0.000579	-0.058573	13	0.01656	yes	SLVRYG
chr1_2365333_G_A_b38	MORN1	-3.435	0.000819	-0.055649	16	0.016201	yes	SLVRYG
chr1_2348393_G_A_b38	MORN1	-3.424	0.000848	-0.061655	6	0.018005	yes	SLVRYG
chr1_2365236_C_T_b38	MORN1	-3.408	0.000896	-0.053171	17	0.015603	yes	SLVRYG
chr1_2600066_C_T_b38	MORN1	-3.406	0.000901	-0.049199	33	0.014443	yes	SLVRYG
chr1_2700293_C_A_b38	MORN1	-3.368	0.00102	-0.049027	20	0.014555	yes	SLVRYG
chr1_2764527_G_C_b38	MORN1	3.289	0.00133	0.064275	3	0.019542	yes	SLVRYG
chr1_2747709_AC_A_b38	MORN1	3.235	0.00158	0.070448	6	0.021775	yes	SLVRYG
chr1_2604319_A_G_b38	MORN1	3.185	0.00185	0.04683	32	0.014701	yes	SLVRYG
chr1_2597560_G_T_b38	MORN1	-3.185	0.00185	-0.04683	32	0.014701	yes	SLVRYG
chr1_2597658_T_C_b38	MORN1	-3.185	0.00185	-0.04683	32	0.014701	yes	SLVRYG
chr1_2597921_G_A_b38	MORN1	-3.185	0.00185	-0.04683	32	0.014701	yes	SLVRYG
chr1_2597998_C_T_b38	MORN1	-3.185	0.00185	-0.04683	32	0.014701	yes	SLVRYG
chr1_1965567_C_T_b38	MORN1	3.183	0.00186	0.063015	3	0.019797	yes	SLVRYG
chr1_2747714_G_A_b38	MORN1	3.164	0.00198	0.069462	6	0.021955	yes	SLVRYG
chr1_2593018_T_C_b38	MORN1	3.154	0.00204	0.046001	33	0.014585	yes	SLVRYG
chr1_2593504_G_A_b38	MORN1	3.154	0.00204	0.046001	33	0.014585	yes	SLVRYG
chr1_2594226_T_C_b38	MORN1	3.154	0.00204	0.046001	33	0.014585	yes	SLVRYG
chr1_2595307_A_G_b38	MORN1	3.154	0.00204	0.046001	33	0.014585	yes	SLVRYG
chr1_2569783_G_T_b38	MORN1	3.133	0.00219	0.045288	30	0.014457	yes	SLVRYG
chr1_2747718_C_G_b38	MORN1	3.125	0.00224	0.076373	6	0.024438	yes	SLVRYG
chr1_2685081_C_G_b38	MORN1	-3.119	0.00228	-0.060153	4	0.019287	yes	SLVRYG
chr1_2352457_A_G_b38	MORN1	3.103	0.0024	0.048479	31	0.015624	yes	SLVRYG
chr1_2353459_T_G_b38	MORN1	3.103	0.0024	0.048479	31	0.015624	yes	SLVRYG
chr1_2356177_T_C_b38	MORN1	3.103	0.0024	0.048479	31	0.015624	yes	SLVRYG
chr1_2358849_T_C_b38	MORN1	3.103	0.0024	0.048479	31	0.015624	yes	SLVRYG
chr1_2360716_T_C_b38	MORN1	3.103	0.0024	0.048479	31	0.015624	yes	SLVRYG
chr1_2360970_T_C_b38	MORN1	3.103	0.0024	0.048479	31	0.015624	yes	SLVRYG
chr1_2361332_A_AG_b38	MORN1	3.103	0.0024	0.048479	31	0.015624	yes	SLVRYG
chr1_2361548_A_ACT_b38	MORN1	3.103	0.0024	0.048479	31	0.015624	yes	SLVRYG
chr1_2685080_C_G_b38	MORN1	-3.099	0.00243	-0.059614	4	0.019237	yes	SLVRYG
chr1_2694012_G_C_b38	MORN1	-3.096	0.00245	-0.042196	25	0.013628	yes	SLVRYG
chr1_2700276_T_A_b38	MORN1	-3.085	0.00253	-0.045244	20	0.014664	yes	SLVRYG
chr1_2363829_A_T_b38	MORN1	-3.081	0.00257	-0.046305	17	0.015029	yes	SLVRYG
chr1_2600536_GAAA_G_b38	MORN1	-3.055	0.00279	-0.045139	32	0.014777	yes	SLVRYG
chr1_2600540_A_G_b38	MORN1	-3.055	0.00279	-0.045139	32	0.014777	yes	SLVRYG
chr1_1962899_A_C_b38	MORN1	3.051	0.00282	0.06122	3	0.020069	yes	SLVRYG
chr1_2342133_C_G_b38	MORN1	-3.012	0.00318	-0.059711	4	0.019826	yes	SLVRYG
chr1_2342137_G_A_b38	MORN1	-3.012	0.00318	-0.059711	4	0.019826	yes	SLVRYG
chr1_2606025_A_G_b38	MORN1	2.995	0.00334	0.04432	31	0.014797	yes	SLVRYG
chr1_2588863_T_C_b38	MORN1	2.983	0.00347	0.043758	35	0.01467	yes	SLVRYG
chr1_2589061_G_A_b38	MORN1	2.983	0.00347	0.043758	35	0.01467	yes	SLVRYG
chr1_2589088_T_C_b38	MORN1	2.983	0.00347	0.043758	35	0.01467	yes	SLVRYG
chr1_2568459_G_A_b38	MORN1	2.959	0.00373	0.043444	29	0.01468	yes	SLVRYG
chr1_2677013_C_A_b38	MORN1	-2.952	0.00381	-0.050986	14	0.017272	yes	SLVRYG
chr1_2352403_G_T_b38	MORN1	2.945	0.00389	0.045273	31	0.015372	yes	SLVRYG
chr1_2575976_G_T_b38	MORN1	2.933	0.00404	0.042993	28	0.014661	yes	SLVRYG
chr1_2677005_AC_A_b38	MORN1	-2.922	0.00416	-0.051875	12	0.017751	yes	SLVRYG
chr1_2677010_T_C_b38	MORN1	-2.922	0.00416	-0.051875	12	0.017751	yes	SLVRYG
chr1_2350750_AGGGGTGGCACG_A_b38	MORN1	-2.899	0.00447	-0.051106	9	0.017631	yes	SLVRYG
chr1_2677018_C_G_b38	MORN1	-2.897	0.00449	-0.051397	13	0.017742	yes	SLVRYG
chr1_2552522_G_A_b38	MORN1	2.858	0.00504	0.042722	27	0.014947	yes	SLVRYG
chr1_2747701_G_T_b38	MORN1	2.85	0.00516	0.06433	6	0.022573	yes	SLVRYG
chr1_2607567_T_C_b38	MORN1	2.823	0.00558	0.04115	28	0.014574	yes	SLVRYG
chr1_2607742_C_T_b38	MORN1	2.823	0.00558	0.04115	28	0.014574	yes	SLVRYG
chr1_2608093_A_G_b38	MORN1	2.823	0.00558	0.04115	28	0.014574	yes	SLVRYG
chr1_2608116_A_G_b38	MORN1	2.823	0.00558	0.04115	28	0.014574	yes	SLVRYG
chr1_2608462_A_C_b38	MORN1	2.823	0.00558	0.04115	28	0.014574	yes	SLVRYG
chr1_2609830_A_G_b38	MORN1	2.823	0.00558	0.04115	28	0.014574	yes	SLVRYG
chr1_2357308_T_C_b38	MORN1	2.79	0.00616	0.045046	34	0.016148	yes	SLVRYG
chr1_2629443_G_A_b38	MORN1	-2.785	0.00623	-0.04157	31	0.014924	yes	SLVRYG
chr1_2631811_G_T_b38	MORN1	-2.785	0.00623	-0.04157	31	0.014924	yes	SLVRYG
chr1_2966572_G_T_b38	MORN1	-2.779	0.00635	-0.040139	38	0.014444	yes	SLVRYG
chr1_2347212_C_T_b38	MORN1	-2.698	0.008	-0.051712	4	0.019166	yes	SLVRYG
chr1_2343937_T_G_b38	MORN1	-2.674	0.00855	-0.044647	22	0.016695	yes	SLVRYG
chr1_2694919_C_G_b38	MORN1	-2.673	0.00859	-0.035096	18	0.01313	yes	SLVRYG
chr1_1924183_GC_G_b38	MORN1	-2.665	0.00878	-0.044515	15	0.016704	yes	SLVRYG
chr1_2620778_G_GA_b38	MORN1	-2.657	0.00898	-0.042626	30	0.016045	yes	SLVRYG
chr1_2346801_C_T_b38	MORN1	-2.652	0.0091	-0.043996	31	0.016589	yes	SLVRYG
chr1_2786542_T_G_b38	MORN1	2.642	0.00935	0.039517	23	0.014955	yes	SLVRYG
chr1_2800905_G_A_b38	MORN1	2.642	0.00935	0.039517	23	0.014955	yes	SLVRYG
chr1_2677028_T_C_b38	MORN1	-2.638	0.00947	-0.047414	13	0.017976	yes	SLVRYG
chr1_2349222_G_A_b38	MORN1	-2.637	0.00949	-0.042742	31	0.016208	yes	SLVRYG
chr1_2650103_A_G_b38	MORN1	-3.431	0.000828	-0.049252	24	0.014353	no	SLVRYG
chr1_2747463_G_A_b38	MORN1	-3.347	0.0011	-0.066346	3	0.019823	no	SLVRYG
chr1_2354645_C_T_b38	MORN1	-3.244	0.00154	-0.061444	5	0.018943	no	SLVRYG
chr1_2354688_G_C_b38	MORN1	-3.244	0.00154	-0.061444	5	0.018943	no	SLVRYG
chr1_1967961_G_GTGAA_b38	MORN1	-3.238	0.00156	-0.054666	8	0.016884	no	SLVRYG
chr1_1967961_G_A_b38	MORN1	3.207	0.00173	0.060379	4	0.018827	no	SLVRYG
chr1_2351215_T_G_b38	MORN1	-3.197	0.00178	-0.060765	5	0.019004	no	SLVRYG
chr1_2351678_C_T_b38	MORN1	-3.125	0.00224	-0.057926	5	0.018536	no	SLVRYG
chr1_2617413_A_C_b38	MORN1	3.039	0.00293	0.044318	30	0.014585	no	SLVRYG
chr1_2600075_C_A_b38	MORN1	-3.012	0.00318	-0.043385	29	0.014406	no	SLVRYG
chr1_2619614_T_C_b38	MORN1	2.997	0.00332	0.044376	31	0.014807	no	SLVRYG
chr1_2362229_A_G_b38	MORN1	-2.995	0.00334	-0.056885	5	0.018993	no	SLVRYG
chr1_2622103_TAGG_T_b38	MORN1	2.968	0.00364	0.043677	31	0.014718	no	SLVRYG
chr1_2608151_C_T_b38	MORN1	2.949	0.00384	0.043677	31	0.01481	no	SLVRYG
chr1_2608823_C_T_b38	MORN1	2.949	0.00384	0.043677	31	0.01481	no	SLVRYG
chr1_2608904_A_C_b38	MORN1	2.949	0.00384	0.043677	31	0.01481	no	SLVRYG
chr1_2608925_G_A_b38	MORN1	2.949	0.00384	0.043677	31	0.01481	no	SLVRYG
chr1_2620632_T_C_b38	MORN1	2.949	0.00384	0.043677	31	0.01481	no	SLVRYG
chr1_2621644_G_A_b38	MORN1	2.949	0.00384	0.043677	31	0.01481	no	SLVRYG
chr1_2622319_C_T_b38	MORN1	2.949	0.00384	0.043677	31	0.01481	no	SLVRYG
chr1_2625937_G_GGAA_b38	MORN1	-2.949	0.00384	-0.043677	31	0.01481	no	SLVRYG
chr1_2594221_G_A_b38	MORN1	2.933	0.00404	0.04321	29	0.014734	no	SLVRYG
chr1_2362863_C_CA_b38	MORN1	-2.908	0.00435	-0.05541	5	0.019055	no	SLVRYG
chr1_2596239_A_G_b38	MORN1	-2.905	0.00439	-0.043132	29	0.014849	no	SLVRYG
chr1_2596694_T_C_b38	MORN1	-2.905	0.00439	-0.043132	29	0.014849	no	SLVRYG
chr1_2597243_T_C_b38	MORN1	-2.905	0.00439	-0.043132	29	0.014849	no	SLVRYG
chr1_2607961_T_C_b38	MORN1	2.902	0.00443	0.041493	28	0.014299	no	SLVRYG
chr1_2681949_A_C_b38	MORN1	-2.885	0.00465	-0.03776	40	0.013088	no	SLVRYG
chr1_2591773_G_C_b38	MORN1	2.876	0.00478	0.042367	30	0.01473	no	SLVRYG
chr1_2592766_C_T_b38	MORN1	2.876	0.00478	0.042367	30	0.01473	no	SLVRYG
chr1_2593476_G_T_b38	MORN1	2.876	0.00478	0.042367	30	0.01473	no	SLVRYG
chr1_2608357_C_T_b38	MORN1	2.862	0.00498	0.042112	26	0.014715	no	SLVRYG
chr1_2696360_C_G_b38	MORN1	-2.859	0.00503	-0.043392	18	0.015179	no	SLVRYG
chr1_2686166_G_T_b38	MORN1	-2.842	0.00528	-0.05694	3	0.020032	no	SLVRYG
chr1_2605656_G_A_b38	MORN1	2.823	0.00559	0.04254	30	0.015069	no	SLVRYG
chr1_2687185_C_G_b38	MORN1	-2.82	0.00564	-0.051163	7	0.018145	no	SLVRYG
chr1_2599856_C_CAAA_b38	MORN1	-2.798	0.00602	-0.041405	31	0.014801	no	SLVRYG
chr1_2597753_A_G_b38	MORN1	-2.797	0.00602	-0.041017	28	0.014663	no	SLVRYG
chr1_2598902_A_AG_b38	MORN1	-2.797	0.00602	-0.041017	28	0.014663	no	SLVRYG
chr1_2599119_T_C_b38	MORN1	-2.797	0.00602	-0.041017	28	0.014663	no	SLVRYG
chr1_2599255_G_A_b38	MORN1	-2.797	0.00602	-0.041017	28	0.014663	no	SLVRYG
chr1_2599933_A_C_b38	MORN1	-2.797	0.00602	-0.041017	28	0.014663	no	SLVRYG
chr1_2600028_T_C_b38	MORN1	-2.797	0.00602	-0.041017	28	0.014663	no	SLVRYG
chr1_2600684_TCAAACAAACAAA_T_b38	MORN1	-2.797	0.00602	-0.041017	28	0.014663	no	SLVRYG
chr1_2600720_C_CTGT_b38	MORN1	-2.797	0.00602	-0.041017	28	0.014663	no	SLVRYG
chr1_2635498_G_C_b38	MORN1	-2.787	0.0062	-0.055028	3	0.019743	no	SLVRYG
chr1_2801925_T_C_b38	MORN1	2.781	0.00632	0.053141	5	0.019111	no	SLVRYG
chr1_2805011_A_G_b38	MORN1	2.781	0.00632	0.053141	5	0.019111	no	SLVRYG
chr1_2783104_C_A_b38	MORN1	-2.781	0.00632	-0.053141	5	0.019111	no	SLVRYG
chr1_2785251_G_C_b38	MORN1	-2.781	0.00632	-0.053141	5	0.019111	no	SLVRYG
chr1_2611214_A_G_b38	MORN1	2.781	0.00632	0.04181	32	0.015036	no	SLVRYG
chr1_2622905_T_G_b38	MORN1	2.768	0.00655	0.041247	29	0.014903	no	SLVRYG
chr1_2602648_C_T_b38	MORN1	2.762	0.00667	0.040421	27	0.014635	no	SLVRYG
chr1_2603539_G_A_b38	MORN1	2.762	0.00667	0.040421	27	0.014635	no	SLVRYG
chr1_2603653_ACT_A_b38	MORN1	2.762	0.00667	0.040421	27	0.014635	no	SLVRYG
chr1_2620346_C_T_b38	MORN1	-2.762	0.00667	-0.054992	3	0.019913	no	SLVRYG
chr1_2609034_TACACACACACACAC_T_b38	MORN1	2.755	0.00681	0.044583	13	0.016185	no	SLVRYG
chr1_2642639_T_C_b38	MORN1	-2.745	0.00699	-0.040612	26	0.014794	no	SLVRYG
chr1_2802737_T_C_b38	MORN1	2.734	0.00721	0.052319	5	0.019133	no	SLVRYG
chr1_2779144_C_T_b38	MORN1	2.729	0.00732	0.040134	25	0.014706	no	SLVRYG
chr1_2782407_G_A_b38	MORN1	2.729	0.00732	0.040134	25	0.014706	no	SLVRYG
chr1_2785298_T_TACCCCAGGAGATCCCTGC_b38	MORN1	2.729	0.00732	0.040134	25	0.014706	no	SLVRYG
chr1_2791865_G_A_b38	MORN1	2.729	0.00732	0.040134	25	0.014706	no	SLVRYG
chr1_2792599_C_A_b38	MORN1	2.729	0.00732	0.040134	25	0.014706	no	SLVRYG
chr1_2800059_C_T_b38	MORN1	2.729	0.00732	0.040134	25	0.014706	no	SLVRYG
chr1_2804584_G_A_b38	MORN1	2.729	0.00732	0.040134	25	0.014706	no	SLVRYG
chr1_2600977_T_C_b38	MORN1	-2.728	0.00734	-0.039986	27	0.014656	no	SLVRYG
chr1_2601014_C_CT_b38	MORN1	-2.728	0.00734	-0.039986	27	0.014656	no	SLVRYG
chr1_2601067_G_A_b38	MORN1	-2.728	0.00734	-0.039986	27	0.014656	no	SLVRYG
chr1_2601185_C_T_b38	MORN1	-2.728	0.00734	-0.039986	27	0.014656	no	SLVRYG
chr1_2601460_C_A_b38	MORN1	-2.728	0.00734	-0.039986	27	0.014656	no	SLVRYG
chr1_2601811_C_A_b38	MORN1	2.728	0.00734	0.039986	27	0.014656	no	SLVRYG
chr1_2602113_A_C_b38	MORN1	2.728	0.00734	0.039986	27	0.014656	no	SLVRYG
chr1_2602267_G_A_b38	MORN1	2.728	0.00734	0.039986	27	0.014656	no	SLVRYG
chr1_2603362_G_C_b38	MORN1	2.728	0.00734	0.039986	27	0.014656	no	SLVRYG
chr1_2604174_C_A_b38	MORN1	2.728	0.00734	0.039986	27	0.014656	no	SLVRYG
chr1_2604456_C_T_b38	MORN1	2.728	0.00734	0.039986	27	0.014656	no	SLVRYG
chr1_2604563_C_G_b38	MORN1	2.728	0.00734	0.039986	27	0.014656	no	SLVRYG
chr1_2593527_C_T_b38	MORN1	2.726	0.00739	0.040631	30	0.014907	no	SLVRYG
chr1_2788353_G_T_b38	MORN1	-2.708	0.00778	-0.053466	4	0.019745	no	SLVRYG
chr1_2602164_C_CAGCCTCCCTCCA_b38	MORN1	2.704	0.00787	0.040969	23	0.015154	no	SLVRYG
chr1_2622185_T_C_b38	MORN1	2.675	0.00854	0.040342	28	0.015082	no	SLVRYG
chr1_1981563_A_G_b38	MORN1	2.669	0.00867	0.053805	5	0.020155	no	SLVRYG
chr1_3231335_G_A_b38	MORN1	2.669	0.00868	0.057934	3	0.021708	no	SLVRYG
chr1_2974675_GTCACACTCACCTGGGGGACGCGTCACACTCACCTGGGGAACGCC_G_b38	MORN1	-2.666	0.00874	-0.033094	29	0.012411	no	SLVRYG
chr1_2624201_T_A_b38	MORN1	2.65	0.00916	0.040144	28	0.015151	no	SLVRYG
chr1_2620778_G_GAA_b38	MORN1	2.641	0.00938	0.038363	26	0.014526	no	SLVRYG
chr1_2683618_C_G_b38	MORN1	-2.623	0.00986	-0.050926	5	0.019415	no	SLVRYG
chr1_2368188_T_C_b38	MORN1	-5.967	4.01e-09	-0.02846	95	0.004769	yes	MSCLSK
chr1_2367872_A_G_b38	MORN1	-5.965	4.07e-09	-0.028481	95	0.004775	yes	MSCLSK
chr1_2366021_T_C_b38	MORN1	-5.923	5.18e-09	-0.027629	153	0.004665	yes	MSCLSK
chr1_2350696_G_A_b38	MORN1	5.891	6.23e-09	0.03041	57	0.005162	yes	MSCLSK
chr1_2362718_G_A_b38	MORN1	5.864	7.28e-09	0.029929	58	0.005104	yes	MSCLSK
chr1_2348378_C_T_b38	MORN1	5.782	1.16e-08	0.029944	56	0.005179	yes	MSCLSK
chr1_2368473_T_C_b38	MORN1	-5.752	1.37e-08	-0.027537	100	0.004788	yes	MSCLSK
chr1_2356409_G_C_b38	MORN1	5.728	1.57e-08	0.029188	67	0.005096	yes	MSCLSK
chr1_2366956_CAAAATACATAGA_C_b38	MORN1	-5.568	3.81e-08	-0.026807	92	0.004815	yes	MSCLSK
chr1_2364499_A_G_b38	MORN1	5.551	4.17e-08	0.02772	68	0.004993	yes	MSCLSK
chr1_2364339_A_C_b38	MORN1	-5.53	4.69e-08	-0.02665	90	0.004819	yes	MSCLSK
chr1_2364657_A_T_b38	MORN1	-5.508	5.27e-08	-0.025538	159	0.004636	yes	MSCLSK
chr1_2364658_A_T_b38	MORN1	-5.508	5.27e-08	-0.025538	159	0.004636	yes	MSCLSK
chr1_2366555_G_C_b38	MORN1	-5.507	5.31e-08	-0.026712	86	0.004851	yes	MSCLSK
chr1_2366816_A_G_b38	MORN1	-5.5	5.51e-08	-0.026623	88	0.00484	yes	MSCLSK
chr1_2352756_T_C_b38	MORN1	-5.36	1.17e-07	-0.026022	87	0.004855	yes	MSCLSK
chr1_2366496_A_T_b38	MORN1	-5.355	1.2e-07	-0.02609	85	0.004872	yes	MSCLSK
chr1_2367799_C_T_b38	MORN1	-5.352	1.22e-07	-0.026083	85	0.004873	yes	MSCLSK
chr1_2367197_G_A_b38	MORN1	-5.319	1.44e-07	-0.025963	84	0.004881	yes	MSCLSK
chr1_2363405_C_T_b38	MORN1	5.31	1.52e-07	0.027028	72	0.00509	yes	MSCLSK
chr1_2366243_C_T_b38	MORN1	-5.3	1.6e-07	-0.025926	83	0.004892	yes	MSCLSK
chr1_2368718_C_A_b38	MORN1	-5.29	1.69e-07	-0.025689	84	0.004857	yes	MSCLSK
chr1_2368939_G_C_b38	MORN1	-5.27	1.87e-07	-0.025707	85	0.004878	yes	MSCLSK
chr1_2341705_A_G_b38	MORN1	5.156	3.37e-07	0.02414	156	0.004682	yes	MSCLSK
chr1_2345727_G_A_b38	MORN1	5.132	3.82e-07	0.027997	40	0.005455	yes	MSCLSK
chr1_2350934_C_T_b38	MORN1	5.052	5.72e-07	0.02747	41	0.005437	yes	MSCLSK
chr1_2344757_C_A_b38	MORN1	5.029	6.42e-07	0.027368	41	0.005442	yes	MSCLSK
chr1_2344761_T_A_b38	MORN1	5.029	6.42e-07	0.027368	41	0.005442	yes	MSCLSK
chr1_2351551_C_T_b38	MORN1	5.002	7.35e-07	0.027526	39	0.005503	yes	MSCLSK
chr1_2365333_G_A_b38	MORN1	-4.991	7.78e-07	-0.024255	84	0.00486	yes	MSCLSK
chr1_2344634_T_C_b38	MORN1	4.982	8.14e-07	0.027153	41	0.005451	yes	MSCLSK
chr1_2353459_T_G_b38	MORN1	4.97	8.61e-07	0.023255	162	0.004679	yes	MSCLSK
chr1_2356177_T_C_b38	MORN1	4.97	8.61e-07	0.023255	162	0.004679	yes	MSCLSK
chr1_2365236_C_T_b38	MORN1	-4.944	9.78e-07	-0.024048	86	0.004864	yes	MSCLSK
chr1_2352457_A_G_b38	MORN1	4.906	1.18e-06	0.022965	166	0.004681	yes	MSCLSK
chr1_2352403_G_T_b38	MORN1	4.904	1.2e-06	0.022898	165	0.00467	yes	MSCLSK
chr1_2358849_T_C_b38	MORN1	4.88	1.35e-06	0.022878	165	0.004688	yes	MSCLSK
chr1_2360716_T_C_b38	MORN1	4.867	1.43e-06	0.022849	164	0.004695	yes	MSCLSK
chr1_2361332_A_AG_b38	MORN1	4.867	1.43e-06	0.022849	164	0.004695	yes	MSCLSK
chr1_2361548_A_ACT_b38	MORN1	4.867	1.43e-06	0.022849	164	0.004695	yes	MSCLSK
chr1_2351241_C_T_b38	MORN1	-4.815	1.84e-06	-0.023768	85	0.004936	yes	MSCLSK
chr1_2360970_T_C_b38	MORN1	4.804	1.95e-06	0.022602	164	0.004705	yes	MSCLSK
chr1_2350539_T_G_b38	MORN1	-4.732	2.74e-06	-0.022152	158	0.004681	yes	MSCLSK
chr1_2345849_ACACACAG_A_b38	MORN1	4.709	3.06e-06	0.026812	30	0.005693	yes	MSCLSK
chr1_2344932_C_T_b38	MORN1	4.707	3.09e-06	0.026983	32	0.005733	yes	MSCLSK
chr1_2340787_C_T_b38	MORN1	-4.676	3.58e-06	-0.023581	60	0.005043	yes	MSCLSK
chr1_2338659_A_G_b38	MORN1	4.59	5.34e-06	0.021268	140	0.004633	yes	MSCLSK
chr1_2359472_G_A_b38	MORN1	4.584	5.49e-06	0.021329	118	0.004653	yes	MSCLSK
chr1_2348700_C_T_b38	MORN1	-4.557	6.23e-06	-0.023178	72	0.005086	yes	MSCLSK
chr1_2341451_G_A_b38	MORN1	4.548	6.5e-06	0.024474	49	0.005382	yes	MSCLSK
chr1_2369210_C_T_b38	MORN1	-4.537	6.82e-06	-0.021833	106	0.004812	yes	MSCLSK
chr1_2345774_T_C_b38	MORN1	4.501	8.05e-06	0.024211	42	0.005379	yes	MSCLSK
chr1_2343699_C_T_b38	MORN1	-4.458	9.78e-06	-0.02244	77	0.005034	yes	MSCLSK
chr1_2350750_AGGGGTGGCACG_A_b38	MORN1	-4.446	1.03e-05	-0.025422	32	0.005718	yes	MSCLSK
chr1_2346801_C_T_b38	MORN1	-4.44	1.06e-05	-0.02106	171	0.004743	yes	MSCLSK
chr1_2357308_T_C_b38	MORN1	4.432	1.1e-05	0.020978	170	0.004734	yes	MSCLSK
chr1_2357882_G_A_b38	MORN1	4.4	1.27e-05	0.024244	39	0.00551	yes	MSCLSK
chr1_2367456_C_CAA_b38	MORN1	-4.377	1.41e-05	-0.022562	66	0.005155	yes	MSCLSK
chr1_2343517_G_A_b38	MORN1	-4.375	1.42e-05	-0.022072	77	0.005045	yes	MSCLSK
chr1_2356095_C_T_b38	MORN1	4.37	1.45e-05	0.024131	39	0.005521	yes	MSCLSK
chr1_2340807_G_A_b38	MORN1	4.288	2.08e-05	0.023064	49	0.005379	yes	MSCLSK
chr1_2340625_G_A_b38	MORN1	4.28	2.15e-05	0.022799	51	0.005326	yes	MSCLSK
chr1_2349222_G_A_b38	MORN1	-4.262	2.33e-05	-0.020179	172	0.004734	yes	MSCLSK
chr1_2337211_C_G_b38	MORN1	4.189	3.19e-05	0.020127	103	0.004804	yes	MSCLSK
chr1_2363829_A_T_b38	MORN1	-4.1	4.66e-05	-0.019442	88	0.004742	yes	MSCLSK
chr1_2344256_A_T_b38	MORN1	3.993	7.28e-05	0.02203	42	0.005517	yes	MSCLSK
chr1_2348393_G_A_b38	MORN1	-3.941	9e-05	-0.023113	28	0.005864	yes	MSCLSK
chr1_2359882_C_CAA_b38	MORN1	3.895	0.000109	0.023095	31	0.00593	yes	MSCLSK
chr1_2338460_T_C_b38	MORN1	3.797	0.00016	0.017993	107	0.004739	yes	MSCLSK
chr1_2344583_G_A_b38	MORN1	3.777	0.000174	0.020099	46	0.005322	yes	MSCLSK
chr1_2347212_C_T_b38	MORN1	-3.734	0.000205	-0.02225	26	0.005958	yes	MSCLSK
chr1_2338570_C_T_b38	MORN1	3.496	0.000506	0.016696	99	0.004776	yes	MSCLSK
chr1_2351215_T_G_b38	MORN1	-3.463	0.00057	-0.021186	25	0.006118	yes	MSCLSK
chr1_2354645_C_T_b38	MORN1	-3.436	0.000629	-0.021193	23	0.006168	yes	MSCLSK
chr1_2346111_G_C_b38	MORN1	-3.389	0.000746	-0.016089	136	0.004748	yes	MSCLSK
chr1_2337299_A_G_b38	MORN1	3.383	0.000762	0.016464	95	0.004867	yes	MSCLSK
chr1_2362863_C_CA_b38	MORN1	-3.379	0.000773	-0.021682	16	0.006417	yes	MSCLSK
chr1_2337352_A_G_b38	MORN1	3.352	0.000849	0.016209	106	0.004835	yes	MSCLSK
chr1_2354688_G_C_b38	MORN1	-3.348	0.000862	-0.020723	23	0.006189	yes	MSCLSK
chr1_2303580_T_C_b38	MORN1	-3.081	0.00215	-0.016916	40	0.005491	yes	MSCLSK
chr1_2351678_C_T_b38	MORN1	-3.076	0.00219	-0.018968	24	0.006167	yes	MSCLSK
chr1_2345148_G_A_b38	MORN1	-3.052	0.00237	-0.023181	7	0.007596	yes	MSCLSK
chr1_2363805_C_CAAACAA_b38	MORN1	3.026	0.00258	0.016127	57	0.005329	yes	MSCLSK
chr1_3145931_G_A_b38	MORN1	2.982	0.00297	0.027431	3	0.009199	yes	MSCLSK
chr1_2369713_ATAAT_A_b38	MORN1	-2.96	0.00319	-0.018302	21	0.006182	yes	MSCLSK
chr1_2337229_A_G_b38	MORN1	2.942	0.00338	0.014015	145	0.004764	yes	MSCLSK
chr1_3335602_A_AACACACACACAC_b38	MORN1	2.846	0.00457	0.023588	6	0.008289	yes	MSCLSK
chr1_2369336_A_G_b38	MORN1	-2.739	0.00633	-0.016903	24	0.006171	yes	MSCLSK
chr1_1459004_T_C_b38	MORN1	-2.721	0.00669	-0.024432	31	0.008979	yes	MSCLSK
chr1_2696630_G_T_b38	MORN1	2.716	0.00679	0.037157	3	0.013683	yes	MSCLSK
chr1_2343937_T_G_b38	MORN1	-2.694	0.00725	-0.013391	108	0.004971	yes	MSCLSK
chr1_2343445_C_T_b38	MORN1	2.683	0.00749	0.014344	48	0.005346	yes	MSCLSK
chr1_2414660_C_G_b38	MORN1	2.679	0.00757	0.015428	36	0.005759	yes	MSCLSK
chr1_1453643_A_AT_b38	MORN1	2.659	0.00803	0.017087	18	0.006426	yes	MSCLSK
chr1_2042765_C_CAA_b38	MORN1	-2.647	0.00833	-0.029684	10	0.011216	yes	MSCLSK
chr1_3144715_C_T_b38	MORN1	2.641	0.00846	0.021333	9	0.008077	yes	MSCLSK
chr1_1763635_AG_A_b38	MORN1	2.637	0.00857	0.027034	7	0.010252	yes	MSCLSK
chr1_2275005_A_G_b38	MORN1	2.623	0.00893	0.014792	35	0.00564	yes	MSCLSK
chr1_2698922_T_C_b38	MORN1	2.612	0.00922	0.014203	66	0.005438	yes	MSCLSK
chr1_2367055_C_A_b38	MORN1	5.372	1.09e-07	0.028423	45	0.005291	no	MSCLSK
chr1_2353743_A_T_b38	MORN1	5.1	4.49e-07	0.026015	81	0.005101	no	MSCLSK
chr1_2344980_A_G_b38	MORN1	4.407	1.23e-05	0.023667	43	0.00537	no	MSCLSK
chr1_2694607_GAAACC_G_b38	MORN1	4.153	3.72e-05	0.024369	43	0.005867	no	MSCLSK
chr1_2347542_C_T_b38	MORN1	-3.936	9.19e-05	-0.018634	139	0.004734	no	MSCLSK
chr1_2340235_T_C_b38	MORN1	3.816	0.000149	0.020014	57	0.005245	no	MSCLSK
chr1_2993152_A_G_b38	MORN1	-3.466	0.000563	-0.023599	34	0.006808	no	MSCLSK
chr1_2340764_G_T_b38	MORN1	3.438	0.000624	0.018168	54	0.005284	no	MSCLSK
chr1_2342133_C_G_b38	MORN1	-3.416	0.000675	-0.021719	20	0.006357	no	MSCLSK
chr1_2342137_G_A_b38	MORN1	-3.416	0.000675	-0.021719	20	0.006357	no	MSCLSK
chr1_2362229_A_G_b38	MORN1	-3.334	0.000906	-0.020474	24	0.006141	no	MSCLSK
chr1_3008162_T_C_b38	MORN1	-3.295	0.00104	-0.022723	37	0.006896	no	MSCLSK
chr1_3008858_A_G_b38	MORN1	-3.295	0.00104	-0.022723	37	0.006896	no	MSCLSK
chr1_2309937_C_CT_b38	MORN1	-3.285	0.00108	-0.014917	186	0.004541	no	MSCLSK
chr1_1486354_G_C_b38	MORN1	-3.231	0.0013	-0.041225	9	0.012758	no	MSCLSK
chr1_2993761_A_G_b38	MORN1	-3.195	0.00147	-0.022047	24	0.006899	no	MSCLSK
chr1_2990871_C_A_b38	MORN1	-3.188	0.0015	-0.02176	25	0.006825	no	MSCLSK
chr1_2311682_G_C_b38	MORN1	-3.182	0.00153	-0.026617	3	0.008365	no	MSCLSK
chr1_3017338_C_G_b38	MORN1	-3.179	0.00155	-0.021896	30	0.006888	no	MSCLSK
chr1_2998709_G_A_b38	MORN1	-3.134	0.00181	-0.021407	26	0.006831	no	MSCLSK
chr1_3008958_A_G_b38	MORN1	-3.083	0.00214	-0.020825	32	0.006756	no	MSCLSK
chr1_1477850_C_G_b38	MORN1	-3.057	0.00233	-0.039159	8	0.012812	no	MSCLSK
chr1_1477855_G_C_b38	MORN1	-3.057	0.00233	-0.039159	8	0.012812	no	MSCLSK
chr1_2996283_T_C_b38	MORN1	-3.016	0.00266	-0.020827	25	0.006905	no	MSCLSK
chr1_2995663_C_T_b38	MORN1	-3.016	0.00266	-0.02083	25	0.006906	no	MSCLSK
chr1_2998564_G_T_b38	MORN1	-3.016	0.00266	-0.02083	25	0.006906	no	MSCLSK
chr1_2996735_T_C_b38	MORN1	-3.007	0.00274	-0.020821	25	0.006924	no	MSCLSK
chr1_3014763_C_A_b38	MORN1	-3.006	0.00275	-0.020667	29	0.006875	no	MSCLSK
chr1_2993780_A_G_b38	MORN1	-3.006	0.00276	-0.020665	23	0.006876	no	MSCLSK
chr1_2998498_G_A_b38	MORN1	-2.976	0.00303	-0.020505	25	0.00689	no	MSCLSK
chr1_2462084_C_A_b38	MORN1	2.967	0.00312	0.020903	9	0.007045	no	MSCLSK
chr1_2994793_T_C_b38	MORN1	-2.951	0.00328	-0.020413	26	0.006916	no	MSCLSK
chr1_2997361_C_T_b38	MORN1	-2.951	0.00328	-0.020413	26	0.006916	no	MSCLSK
chr1_2998054_G_T_b38	MORN1	-2.951	0.00328	-0.020413	26	0.006916	no	MSCLSK
chr1_3003066_C_T_b38	MORN1	-2.922	0.00361	-0.02085	12	0.007136	no	MSCLSK
chr1_2340564_G_A_b38	MORN1	2.904	0.00381	0.015548	49	0.005354	no	MSCLSK
chr1_2337141_G_A_b38	MORN1	2.898	0.00388	0.014544	76	0.005019	no	MSCLSK
chr1_2652005_CCAGGTGAGCACCTGACATCGTGGAGCAGCAGCCCACACCCA_C_b38	MORN1	2.882	0.00409	0.048705	5	0.0169	no	MSCLSK
chr1_1686004_G_T_b38	MORN1	-2.875	0.00418	-0.040989	7	0.014257	no	MSCLSK
chr1_3002905_A_G_b38	MORN1	-2.872	0.00422	-0.019959	25	0.00695	no	MSCLSK
chr1_3000908_A_G_b38	MORN1	-2.861	0.00436	-0.020269	14	0.007084	no	MSCLSK
chr1_1594599_T_C_b38	MORN1	2.854	0.00446	0.027153	7	0.009514	no	MSCLSK
chr1_2367456_C_CA_b38	MORN1	-2.807	0.00515	-0.032379	5	0.011534	no	MSCLSK
chr1_3031456_G_A_b38	MORN1	-2.802	0.00524	-0.017105	25	0.006106	no	MSCLSK
chr1_3003867_A_G_b38	MORN1	-2.795	0.00535	-0.018847	34	0.006743	no	MSCLSK
chr1_2996438_C_A_b38	MORN1	-2.764	0.00587	-0.019815	8	0.007168	no	MSCLSK
chr1_2998998_C_T_b38	MORN1	-2.761	0.00592	-0.019778	8	0.007163	no	MSCLSK
chr1_2999596_G_A_b38	MORN1	-2.756	0.00602	-0.019158	22	0.006952	no	MSCLSK
chr1_2999781_C_T_b38	MORN1	-2.756	0.00602	-0.019158	22	0.006952	no	MSCLSK
chr1_2999792_T_C_b38	MORN1	-2.756	0.00602	-0.019158	22	0.006952	no	MSCLSK
chr1_3000106_A_G_b38	MORN1	-2.756	0.00602	-0.019158	22	0.006952	no	MSCLSK
chr1_3000117_A_G_b38	MORN1	-2.756	0.00602	-0.019158	22	0.006952	no	MSCLSK
chr1_3000572_T_C_b38	MORN1	-2.756	0.00602	-0.019158	22	0.006952	no	MSCLSK
chr1_3000896_C_G_b38	MORN1	-2.756	0.00602	-0.019158	22	0.006952	no	MSCLSK
chr1_3000899_C_T_b38	MORN1	-2.756	0.00602	-0.019158	22	0.006952	no	MSCLSK
chr1_3001457_A_G_b38	MORN1	-2.756	0.00602	-0.019158	22	0.006952	no	MSCLSK
chr1_3001621_C_T_b38	MORN1	-2.756	0.00602	-0.019158	22	0.006952	no	MSCLSK
chr1_3001631_G_A_b38	MORN1	-2.756	0.00602	-0.019158	22	0.006952	no	MSCLSK
chr1_3002220_G_A_b38	MORN1	-2.756	0.00602	-0.019158	22	0.006952	no	MSCLSK
chr1_3002226_T_C_b38	MORN1	-2.756	0.00602	-0.019158	22	0.006952	no	MSCLSK
chr1_3002247_T_C_b38	MORN1	-2.756	0.00602	-0.019158	22	0.006952	no	MSCLSK
chr1_3002267_A_G_b38	MORN1	-2.756	0.00602	-0.019158	22	0.006952	no	MSCLSK
chr1_3002374_C_T_b38	MORN1	-2.756	0.00602	-0.019158	22	0.006952	no	MSCLSK
chr1_2987013_T_C_b38	MORN1	-2.742	0.00628	-0.018917	18	0.0069	no	MSCLSK
chr1_2337239_T_C_b38	MORN1	2.738	0.00635	0.014666	55	0.005356	no	MSCLSK
chr1_2999894_G_C_b38	MORN1	-2.733	0.00645	-0.01899	22	0.006948	no	MSCLSK
chr1_2999907_T_C_b38	MORN1	-2.733	0.00645	-0.01899	22	0.006948	no	MSCLSK
chr1_2369118_G_A_b38	MORN1	-2.733	0.00646	-0.016387	29	0.005997	no	MSCLSK
chr1_2989041_T_C_b38	MORN1	-2.72	0.00672	-0.018756	18	0.006897	no	MSCLSK
chr1_2991506_A_G_b38	MORN1	-2.72	0.00672	-0.018756	18	0.006897	no	MSCLSK
chr1_1460858_G_T_b38	MORN1	-2.717	0.00676	-0.035584	6	0.013096	no	MSCLSK
chr1_2285757_G_A_b38	MORN1	-2.715	0.00682	-0.052984	3	0.019518	no	MSCLSK
chr1_2991824_C_T_b38	MORN1	-2.709	0.00693	-0.018641	18	0.006881	no	MSCLSK
chr1_3066754_T_C_b38	MORN1	-2.703	0.00706	-0.016142	25	0.005973	no	MSCLSK
chr1_3044226_C_T_b38	MORN1	-2.701	0.00709	-0.016709	24	0.006186	no	MSCLSK
chr1_3044265_CA_C_b38	MORN1	-2.701	0.00709	-0.016709	24	0.006186	no	MSCLSK
chr1_3044838_G_T_b38	MORN1	-2.701	0.00709	-0.016709	24	0.006186	no	MSCLSK
chr1_2345829_CCACA_C_b38	MORN1	-2.698	0.00716	-0.014285	51	0.005295	no	MSCLSK
chr1_2999573_T_G_b38	MORN1	-2.697	0.00718	-0.019355	8	0.007176	no	MSCLSK
chr1_3003378_G_A_b38	MORN1	-2.691	0.0073	-0.019215	10	0.007139	no	MSCLSK
chr1_3012412_C_T_b38	MORN1	-2.678	0.0076	-0.017597	17	0.006571	no	MSCLSK
chr1_1495236_T_C_b38	MORN1	-2.677	0.00762	-0.033995	8	0.012699	no	MSCLSK
chr1_2698924_C_G_b38	MORN1	2.668	0.00783	0.016262	25	0.006096	no	MSCLSK
chr1_2376590_G_A_b38	MORN1	2.663	0.00795	0.022076	3	0.008291	no	MSCLSK
chr1_3063713_T_C_b38	MORN1	-2.659	0.00802	-0.015555	41	0.005849	no	MSCLSK
chr1_1494105_G_A_b38	MORN1	-2.658	0.00805	-0.033584	8	0.012633	no	MSCLSK
chr1_2995636_C_T_b38	MORN1	-2.655	0.00812	-0.020476	6	0.007712	no	MSCLSK
chr1_3003594_C_T_b38	MORN1	-2.64	0.0085	-0.01884	10	0.007136	no	MSCLSK
chr1_3039366_A_G_b38	MORN1	-2.639	0.00853	-0.016356	24	0.006199	no	MSCLSK
chr1_3037733_T_C_b38	MORN1	-2.635	0.00862	-0.016365	24	0.006211	no	MSCLSK
chr1_2357811_C_G_b38	MORN1	-2.634	0.00864	-0.016843	18	0.006394	no	MSCLSK
chr1_2357812_T_C_b38	MORN1	-2.634	0.00864	-0.016843	18	0.006394	no	MSCLSK
chr1_2359828_A_G_b38	MORN1	-2.634	0.00864	-0.016843	18	0.006394	no	MSCLSK
chr1_2363591_T_G_b38	MORN1	-2.634	0.00864	-0.016843	18	0.006394	no	MSCLSK
chr1_3034178_G_GA_b38	MORN1	-2.631	0.00872	-0.016322	24	0.006204	no	MSCLSK
chr1_2327034_G_A_b38	MORN1	2.629	0.00878	0.013215	89	0.005027	no	MSCLSK
chr1_2315074_A_G_b38	MORN1	-2.626	0.00884	-0.014116	56	0.005375	no	MSCLSK
chr1_2367871_C_T_b38	MORN1	-2.621	0.00897	-0.016865	17	0.006434	no	MSCLSK
chr1_2997506_TA_T_b38	MORN1	-2.621	0.00898	-0.017957	22	0.006852	no	MSCLSK
chr1_3034477_C_T_b38	MORN1	-2.619	0.00904	-0.016205	24	0.006188	no	MSCLSK
chr1_2986595_A_G_b38	MORN1	-2.616	0.0091	-0.020874	5	0.007978	no	MSCLSK
chr1_2314000_T_C_b38	MORN1	-2.612	0.00923	-0.014056	58	0.005382	no	MSCLSK
chr1_3033043_G_C_b38	MORN1	-2.611	0.00925	-0.016192	24	0.006202	no	MSCLSK
chr1_3033673_G_A_b38	MORN1	-2.611	0.00925	-0.016192	24	0.006202	no	MSCLSK
chr1_3033770_G_A_b38	MORN1	-2.611	0.00925	-0.016192	24	0.006202	no	MSCLSK
chr1_3034030_T_C_b38	MORN1	-2.611	0.00925	-0.016192	24	0.006202	no	MSCLSK
chr1_3034322_A_G_b38	MORN1	-2.611	0.00925	-0.016192	24	0.006202	no	MSCLSK
chr1_3034470_A_T_b38	MORN1	-2.611	0.00925	-0.016192	24	0.006202	no	MSCLSK
chr1_3034680_T_C_b38	MORN1	-2.611	0.00925	-0.016192	24	0.006202	no	MSCLSK
chr1_3034783_G_A_b38	MORN1	-2.611	0.00925	-0.016192	24	0.006202	no	MSCLSK
chr1_3034785_T_C_b38	MORN1	-2.611	0.00925	-0.016192	24	0.006202	no	MSCLSK
chr1_3034947_C_T_b38	MORN1	-2.611	0.00925	-0.016192	24	0.006202	no	MSCLSK
chr1_3035425_C_T_b38	MORN1	-2.611	0.00925	-0.016192	24	0.006202	no	MSCLSK
chr1_3035548_T_TG_b38	MORN1	-2.611	0.00925	-0.016192	24	0.006202	no	MSCLSK
chr1_3036259_C_T_b38	MORN1	-2.611	0.00925	-0.016192	24	0.006202	no	MSCLSK
chr1_3036276_T_G_b38	MORN1	-2.611	0.00925	-0.016192	24	0.006202	no	MSCLSK
chr1_3037269_C_G_b38	MORN1	-2.611	0.00925	-0.016192	24	0.006202	no	MSCLSK
chr1_3037467_A_G_b38	MORN1	-2.611	0.00925	-0.016192	24	0.006202	no	MSCLSK
chr1_3037487_C_T_b38	MORN1	-2.611	0.00925	-0.016192	24	0.006202	no	MSCLSK
chr1_3037491_A_G_b38	MORN1	-2.611	0.00925	-0.016192	24	0.006202	no	MSCLSK
chr1_3037559_T_C_b38	MORN1	-2.611	0.00925	-0.016192	24	0.006202	no	MSCLSK
chr1_3037601_C_T_b38	MORN1	-2.611	0.00925	-0.016192	24	0.006202	no	MSCLSK
chr1_3037644_G_A_b38	MORN1	-2.611	0.00925	-0.016192	24	0.006202	no	MSCLSK
chr1_3037666_T_C_b38	MORN1	-2.611	0.00925	-0.016192	24	0.006202	no	MSCLSK
chr1_3038594_G_A_b38	MORN1	-2.611	0.00925	-0.016192	24	0.006202	no	MSCLSK
chr1_3039599_A_G_b38	MORN1	-2.611	0.00925	-0.016192	24	0.006202	no	MSCLSK
chr1_3040435_T_G_b38	MORN1	-2.611	0.00925	-0.016192	24	0.006202	no	MSCLSK
chr1_1477677_TTTTTA_T_b38	MORN1	-2.602	0.0095	-0.032462	9	0.012478	no	MSCLSK
chr1_1486396_C_G_b38	MORN1	-2.595	0.00968	-0.035556	4	0.013702	no	MSCLSK
chr1_1459799_T_G_b38	MORN1	-2.593	0.00975	-0.033666	6	0.012986	no	MSCLSK
chr1_2387989_A_G_b38	MORN1	2.587	0.0099	0.012463	152	0.004817	no	MSCLSK
chr1_2364339_A_C_b38	MORN1	-10.543	1.98e-23	-0.075926	67	0.007201	yes	NERVET
chr1_2366816_A_G_b38	MORN1	-10.3	1.57e-22	-0.074834	66	0.007266	yes	NERVET
chr1_2348393_G_A_b38	MORN1	-10.27	2.02e-22	-0.092086	19	0.008966	yes	NERVET
chr1_2367872_A_G_b38	MORN1	-10.094	8.84e-22	-0.073377	70	0.007269	yes	NERVET
chr1_2350750_AGGGGTGGCACG_A_b38	MORN1	-10.086	9.48e-22	-0.086838	24	0.00861	yes	NERVET
chr1_2368188_T_C_b38	MORN1	-10.05	1.28e-21	-0.072944	70	0.007258	yes	NERVET
chr1_2363829_A_T_b38	MORN1	-9.86	6.18e-21	-0.069384	66	0.007037	yes	NERVET
chr1_2368473_T_C_b38	MORN1	-9.836	7.5e-21	-0.071949	73	0.007315	yes	NERVET
chr1_2351215_T_G_b38	MORN1	-9.57	6.55e-20	-0.08876	17	0.009275	yes	NERVET
chr1_2366555_G_C_b38	MORN1	-9.565	6.83e-20	-0.071359	63	0.007461	yes	NERVET
chr1_2366956_CAAAATACATAGA_C_b38	MORN1	-9.512	1.04e-19	-0.071016	66	0.007466	yes	NERVET
chr1_2354645_C_T_b38	MORN1	-9.438	1.89e-19	-0.087677	17	0.00929	yes	NERVET
chr1_2352756_T_C_b38	MORN1	-9.395	2.65e-19	-0.06998	63	0.007448	yes	NERVET
chr1_2366496_A_T_b38	MORN1	-9.367	3.33e-19	-0.070473	62	0.007524	yes	NERVET
chr1_2362229_A_G_b38	MORN1	-9.363	3.43e-19	-0.086275	18	0.009214	yes	NERVET
chr1_2354688_G_C_b38	MORN1	-9.333	4.34e-19	-0.087558	17	0.009381	yes	NERVET
chr1_2367197_G_A_b38	MORN1	-9.328	4.53e-19	-0.070187	62	0.007524	yes	NERVET
chr1_2367799_C_T_b38	MORN1	-9.325	4.65e-19	-0.070323	62	0.007541	yes	NERVET
chr1_2351678_C_T_b38	MORN1	-9.228	1e-18	-0.086514	17	0.009376	yes	NERVET
chr1_2368939_G_C_b38	MORN1	-9.155	1.77e-18	-0.069073	62	0.007545	yes	NERVET
chr1_2366243_C_T_b38	MORN1	-9.007	5.63e-18	-0.068217	61	0.007574	yes	NERVET
chr1_2365333_G_A_b38	MORN1	-8.954	8.49e-18	-0.066998	61	0.007483	yes	NERVET
chr1_2362863_C_CA_b38	MORN1	-8.939	9.51e-18	-0.086039	12	0.009625	yes	NERVET
chr1_2351241_C_T_b38	MORN1	-8.92	1.1e-17	-0.067978	60	0.007621	yes	NERVET
chr1_2365236_C_T_b38	MORN1	-8.919	1.11e-17	-0.067072	62	0.00752	yes	NERVET
chr1_2368718_C_A_b38	MORN1	-8.839	2.06e-17	-0.067281	60	0.007612	yes	NERVET
chr1_2347212_C_T_b38	MORN1	-8.627	1.02e-16	-0.079595	18	0.009226	yes	NERVET
chr1_2369210_C_T_b38	MORN1	-8.532	2.1e-16	-0.064034	76	0.007506	yes	NERVET
chr1_2367456_C_CAA_b38	MORN1	-8.53	2.12e-16	-0.069589	44	0.008158	yes	NERVET
chr1_2348700_C_T_b38	MORN1	-8.452	3.78e-16	-0.06575	53	0.007779	yes	NERVET
chr1_2342133_C_G_b38	MORN1	-8.452	3.8e-16	-0.082384	14	0.009748	yes	NERVET
chr1_2342137_G_A_b38	MORN1	-8.452	3.8e-16	-0.082384	14	0.009748	yes	NERVET
chr1_2343699_C_T_b38	MORN1	-8.441	4.12e-16	-0.066029	54	0.007823	yes	NERVET
chr1_2343517_G_A_b38	MORN1	-8.322	9.87e-16	-0.065371	54	0.007855	yes	NERVET
chr1_2340787_C_T_b38	MORN1	-8.274	1.41e-15	-0.065613	44	0.00793	yes	NERVET
chr1_2364657_A_T_b38	MORN1	-8.018	8.9e-15	-0.0587	120	0.007321	yes	NERVET
chr1_2364658_A_T_b38	MORN1	-8.018	8.9e-15	-0.0587	120	0.007321	yes	NERVET
chr1_2369118_G_A_b38	MORN1	-7.684	9.38e-14	-0.071624	23	0.009322	yes	NERVET
chr1_2366021_T_C_b38	MORN1	-7.625	1.41e-13	-0.056352	115	0.007391	yes	NERVET
chr1_2389263_T_C_b38	MORN1	-7.345	9.41e-13	-0.062868	33	0.008559	yes	NERVET
chr1_2350539_T_G_b38	MORN1	-7.077	5.5e-12	-0.052979	115	0.007486	yes	NERVET
chr1_2369355_G_GA_b38	MORN1	-6.985	1e-11	-0.057615	48	0.008249	yes	NERVET
chr1_2391602_T_C_b38	MORN1	-6.965	1.14e-11	-0.056207	41	0.00807	yes	NERVET
chr1_2349222_G_A_b38	MORN1	-6.913	1.59e-11	-0.052238	126	0.007556	yes	NERVET
chr1_2346801_C_T_b38	MORN1	-6.877	2e-11	-0.052261	125	0.007599	yes	NERVET
chr1_2338659_A_G_b38	MORN1	6.757	4.26e-11	0.050096	106	0.007413	yes	NERVET
chr1_2353459_T_G_b38	MORN1	6.184	1.38e-09	0.046954	116	0.007593	yes	NERVET
chr1_2356177_T_C_b38	MORN1	6.184	1.38e-09	0.046954	116	0.007593	yes	NERVET
chr1_2337299_A_G_b38	MORN1	6.143	1.76e-09	0.04677	76	0.007614	yes	NERVET
chr1_2360716_T_C_b38	MORN1	6.084	2.47e-09	0.046516	119	0.007646	yes	NERVET
chr1_2360970_T_C_b38	MORN1	6.084	2.47e-09	0.046516	119	0.007646	yes	NERVET
chr1_2361332_A_AG_b38	MORN1	6.084	2.47e-09	0.046516	119	0.007646	yes	NERVET
chr1_2361548_A_ACT_b38	MORN1	6.084	2.47e-09	0.046516	119	0.007646	yes	NERVET
chr1_2379954_A_G_b38	MORN1	-6.078	2.55e-09	-0.050017	39	0.008229	yes	NERVET
chr1_2363405_C_T_b38	MORN1	6.077	2.56e-09	0.050998	54	0.008392	yes	NERVET
chr1_2352403_G_T_b38	MORN1	6.068	2.7e-09	0.046072	118	0.007592	yes	NERVET
chr1_2352457_A_G_b38	MORN1	6.067	2.73e-09	0.046332	119	0.007637	yes	NERVET
chr1_2341705_A_G_b38	MORN1	5.889	7.51e-09	0.044556	119	0.007566	yes	NERVET
chr1_2358849_T_C_b38	MORN1	5.885	7.67e-09	0.04492	120	0.007633	yes	NERVET
chr1_2337352_A_G_b38	MORN1	5.83	1.04e-08	0.044692	83	0.007666	yes	NERVET
chr1_2362718_G_A_b38	MORN1	5.808	1.18e-08	0.049478	44	0.008518	yes	NERVET
chr1_2350696_G_A_b38	MORN1	5.792	1.29e-08	0.049862	43	0.008608	yes	NERVET
chr1_2348378_C_T_b38	MORN1	5.707	2.06e-08	0.049285	42	0.008636	yes	NERVET
chr1_2357308_T_C_b38	MORN1	5.68	2.39e-08	0.04393	123	0.007734	yes	NERVET
chr1_2364499_A_G_b38	MORN1	5.511	5.94e-08	0.045536	53	0.008263	yes	NERVET
chr1_2342734_T_C_b38	MORN1	-5.413	9.99e-08	-0.047459	28	0.008768	yes	NERVET
chr1_2347542_C_T_b38	MORN1	-5.379	1.19e-07	-0.041371	100	0.007691	yes	NERVET
chr1_2343937_T_G_b38	MORN1	-5.318	1.64e-07	-0.042084	81	0.007914	yes	NERVET
chr1_2337239_T_C_b38	MORN1	4.981	8.97e-07	0.042531	45	0.008539	yes	NERVET
chr1_2333737_T_C_b38	MORN1	4.964	9.74e-07	0.041067	56	0.008273	yes	NERVET
chr1_2353743_A_T_b38	MORN1	4.962	9.84e-07	0.042693	58	0.008604	yes	NERVET
chr1_2409621_C_T_b38	MORN1	-4.951	1.04e-06	-0.042372	35	0.008559	yes	NERVET
chr1_2377643_T_G_b38	MORN1	4.947	1.06e-06	0.037571	112	0.007594	yes	NERVET
chr1_2334530_T_G_b38	MORN1	4.939	1.1e-06	0.040927	55	0.008287	yes	NERVET
chr1_2356409_G_C_b38	MORN1	4.828	1.88e-06	0.041634	49	0.008624	yes	NERVET
chr1_2380105_C_T_b38	MORN1	-4.813	2.02e-06	-0.036637	71	0.007612	yes	NERVET
chr1_2324806_A_T_b38	MORN1	4.801	2.14e-06	0.038783	66	0.008078	yes	NERVET
chr1_2375256_C_T_b38	MORN1	4.741	2.84e-06	0.036093	85	0.007613	yes	NERVET
chr1_2380209_G_A_b38	MORN1	-4.661	4.13e-06	-0.035395	72	0.007594	yes	NERVET
chr1_2345442_G_A_b38	MORN1	4.627	4.83e-06	0.091408	6	0.019755	yes	NERVET
chr1_2338460_T_C_b38	MORN1	4.622	4.95e-06	0.035842	81	0.007755	yes	NERVET
chr1_2392897_T_C_b38	MORN1	4.614	5.13e-06	0.03656	64	0.007924	yes	NERVET
chr1_2371077_T_C_b38	MORN1	4.594	5.61e-06	0.035062	121	0.007631	yes	NERVET
chr1_2327034_G_A_b38	MORN1	4.566	6.37e-06	0.036965	68	0.008095	yes	NERVET
chr1_2346111_G_C_b38	MORN1	-4.548	6.94e-06	-0.035236	98	0.007748	yes	NERVET
chr1_2345953_G_A_b38	MORN1	4.544	7.05e-06	0.090124	6	0.019832	yes	NERVET
chr1_2384241_A_G_b38	MORN1	4.446	1.1e-05	0.033602	132	0.007558	yes	NERVET
chr1_2367306_CAA_C_b38	MORN1	4.403	1.33e-05	0.036924	69	0.008386	yes	NERVET
chr1_2392128_T_C_b38	MORN1	4.396	1.37e-05	0.033404	108	0.007598	yes	NERVET
chr1_2338570_C_T_b38	MORN1	4.38	1.47e-05	0.034051	75	0.007774	yes	NERVET
chr1_2374713_C_T_b38	MORN1	4.336	1.78e-05	0.032987	88	0.007607	yes	NERVET
chr1_2326288_C_T_b38	MORN1	4.293	2.15e-05	0.034542	68	0.008046	yes	NERVET
chr1_2326884_C_T_b38	MORN1	4.293	2.15e-05	0.034542	68	0.008046	yes	NERVET
chr1_2337211_C_G_b38	MORN1	4.275	2.32e-05	0.034309	76	0.008025	yes	NERVET
chr1_2367055_C_A_b38	MORN1	4.267	2.41e-05	0.038387	29	0.008997	yes	NERVET
chr1_2387989_A_G_b38	MORN1	4.249	2.6e-05	0.032278	114	0.007596	yes	NERVET
chr1_2371226_C_CACAACCACA_b38	MORN1	4.248	2.62e-05	0.032772	109	0.007716	yes	NERVET
chr1_2367644_G_A_b38	MORN1	-4.221	2.93e-05	-0.033984	70	0.008051	yes	NERVET
chr1_2326424_C_T_b38	MORN1	4.204	3.15e-05	0.033808	68	0.008042	yes	NERVET
chr1_2371032_C_T_b38	MORN1	4.182	3.46e-05	0.03182	108	0.007608	yes	NERVET
chr1_2325101_C_T_b38	MORN1	-4.149	3.97e-05	-0.06137	5	0.01479	yes	NERVET
chr1_2345774_T_C_b38	MORN1	4.099	4.91e-05	0.036966	29	0.009019	yes	NERVET
chr1_2324977_G_GGCT_b38	MORN1	4.085	5.19e-05	0.033777	65	0.008268	yes	NERVET
chr1_2384876_A_G_b38	MORN1	4.074	5.45e-05	0.030842	132	0.007571	yes	NERVET
chr1_2383824_C_G_b38	MORN1	3.988	7.75e-05	0.031248	76	0.007836	yes	NERVET
chr1_2344980_A_G_b38	MORN1	3.973	8.24e-05	0.035735	30	0.008995	yes	NERVET
chr1_2372759_GACC_G_b38	MORN1	3.967	8.44e-05	0.032823	59	0.008274	yes	NERVET
chr1_2372762_C_CTG_b38	MORN1	3.967	8.44e-05	0.032823	59	0.008274	yes	NERVET
chr1_2376477_A_C_b38	MORN1	3.954	8.88e-05	0.029545	131	0.007471	yes	NERVET
chr1_2327151_A_AACAC_b38	MORN1	3.936	9.55e-05	0.0296	115	0.00752	yes	NERVET
chr1_2344256_A_T_b38	MORN1	3.872	0.000124	0.034047	32	0.008794	yes	NERVET
chr1_2341451_G_A_b38	MORN1	3.867	0.000126	0.033596	37	0.008687	yes	NERVET
chr1_2344761_T_C_b38	MORN1	3.805	0.000161	0.035203	31	0.009252	yes	NERVET
chr1_2355481_C_T_b38	MORN1	3.8	0.000164	0.071577	6	0.018834	yes	NERVET
chr1_2364608_C_A_b38	MORN1	3.8	0.000164	0.071577	6	0.018834	yes	NERVET
chr1_2384278_A_G_b38	MORN1	3.787	0.000173	0.028418	104	0.007504	yes	NERVET
chr1_2364506_G_A_b38	MORN1	-3.758	0.000193	-0.033063	33	0.008797	yes	NERVET
chr1_1708501_C_T_b38	MORN1	-3.696	0.000245	-0.101179	4	0.027373	yes	NERVET
chr1_2375533_G_A_b38	MORN1	3.647	0.000296	0.030315	58	0.008313	yes	NERVET
chr1_2974683_C_CACCTGGGGAACGCGTCACACTTACCTGGGGGAAGCGTCACACTT_b38	MORN1	3.624	0.000323	0.088864	3	0.024522	yes	NERVET
chr1_2344932_C_T_b38	MORN1	3.614	0.000334	0.034402	22	0.009519	yes	NERVET
chr1_3310290_T_A_b38	MORN1	-3.593	0.000362	-0.049153	4	0.01368	yes	NERVET
chr1_2359219_C_T_b38	MORN1	3.58	0.00038	0.070114	6	0.019586	yes	NERVET
chr1_2364876_C_T_b38	MORN1	3.543	0.000436	0.068564	6	0.019353	yes	NERVET
chr1_1708173_T_C_b38	MORN1	-3.535	0.00045	-0.086492	3	0.02447	yes	NERVET
chr1_2364485_A_G_b38	MORN1	-3.526	0.000464	-0.031347	34	0.00889	yes	NERVET
chr1_2383024_G_T_b38	MORN1	3.476	0.000558	0.028972	58	0.008336	yes	NERVET
chr1_2383716_CA_C_b38	MORN1	3.476	0.000558	0.028972	58	0.008336	yes	NERVET
chr1_2656361_GAACAGCACCCACACCCACAGGTGAGCATCTGACAGCATGTAACAGCACCCACACCCCCAGGTGAGCATCTGACAGCCTGC_G_b38	MORN1	-3.393	0.000751	-0.039032	24	0.011504	yes	NERVET
chr1_2337229_A_G_b38	MORN1	3.365	0.000828	0.026842	105	0.007976	yes	NERVET
chr1_1714987_C_T_b38	MORN1	-3.323	0.000961	-0.075376	5	0.022682	yes	NERVET
chr1_1718786_G_A_b38	MORN1	-3.318	0.000979	-0.07524	5	0.022677	yes	NERVET
chr1_1719189_G_A_b38	MORN1	-3.318	0.000979	-0.07524	5	0.022677	yes	NERVET
chr1_1720548_G_A_b38	MORN1	-3.318	0.000979	-0.07524	5	0.022677	yes	NERVET
chr1_1721336_G_A_b38	MORN1	-3.318	0.000979	-0.07524	5	0.022677	yes	NERVET
chr1_2327187_CAG_C_b38	MORN1	3.318	0.000979	0.033431	20	0.010076	yes	NERVET
chr1_1719740_C_T_b38	MORN1	-3.309	0.00101	-0.077476	4	0.023417	yes	NERVET
chr1_2363825_TAA_T_b38	MORN1	-3.303	0.00103	-0.023249	112	0.007039	yes	NERVET
chr1_3287970_T_A_b38	MORN1	-3.278	0.00112	-0.032179	35	0.009817	yes	NERVET
chr1_2335494_C_T_b38	MORN1	3.23	0.00133	0.029954	29	0.009275	yes	NERVET
chr1_2340807_G_A_b38	MORN1	3.183	0.00156	0.027545	38	0.008654	yes	NERVET
chr1_2284952_A_G_b38	MORN1	-3.157	0.0017	-0.025723	56	0.008148	yes	NERVET
chr1_2370674_CTT_C_b38	MORN1	3.152	0.00173	0.025421	114	0.008066	yes	NERVET
chr1_1714807_A_G_b38	MORN1	-3.127	0.00188	-0.073496	4	0.023503	yes	NERVET
chr1_1719896_T_C_b38	MORN1	-3.127	0.00188	-0.073496	4	0.023503	yes	NERVET
chr1_1694987_G_A_b38	MORN1	-3.124	0.00189	-0.073421	4	0.023499	yes	NERVET
chr1_3310922_A_G_b38	MORN1	-3.124	0.0019	-0.043454	3	0.013909	yes	NERVET
chr1_2385630_A_C_b38	MORN1	3.123	0.0019	0.026265	53	0.008409	yes	NERVET
chr1_2359221_T_C_b38	MORN1	-3.104	0.00203	-0.029881	22	0.009626	yes	NERVET
chr1_3313405_G_A_b38	MORN1	-3.073	0.00224	-0.042306	3	0.013766	yes	NERVET
chr1_3311588_T_G_b38	MORN1	-3.072	0.00225	-0.042496	3	0.013834	yes	NERVET
chr1_3311597_C_T_b38	MORN1	-3.072	0.00225	-0.042496	3	0.013834	yes	NERVET
chr1_3312219_G_T_b38	MORN1	-3.072	0.00225	-0.042496	3	0.013834	yes	NERVET
chr1_3312621_G_A_b38	MORN1	-3.072	0.00225	-0.042496	3	0.013834	yes	NERVET
chr1_3312694_A_G_b38	MORN1	-3.072	0.00225	-0.042496	3	0.013834	yes	NERVET
chr1_3313956_T_C_b38	MORN1	-3.072	0.00225	-0.042496	3	0.013834	yes	NERVET
chr1_2316305_G_C_b38	MORN1	-3.072	0.00225	-0.023959	90	0.0078	yes	NERVET
chr1_2302601_CAGG_C_b38	MORN1	-3.066	0.00229	-0.032791	14	0.010694	yes	NERVET
chr1_2303193_G_A_b38	MORN1	-3.066	0.00229	-0.032791	14	0.010694	yes	NERVET
chr1_2369187_T_TA_b38	MORN1	3.065	0.0023	0.054604	7	0.017813	yes	NERVET
chr1_3310983_G_A_b38	MORN1	-3.053	0.0024	-0.042409	3	0.01389	yes	NERVET
chr1_2999619_C_T_b38	MORN1	-3.053	0.0024	-0.066954	4	0.02193	yes	NERVET
chr1_1724428_C_CG_b38	MORN1	-3.017	0.00269	-0.069016	5	0.022873	yes	NERVET
chr1_3225571_T_C_b38	MORN1	-3.013	0.00273	-0.042847	5	0.014221	yes	NERVET
chr1_3310606_A_C_b38	MORN1	-3.002	0.00282	-0.041727	3	0.013898	yes	NERVET
chr1_2120054_T_C_b38	MORN1	2.996	0.00289	0.035669	6	0.011907	yes	NERVET
chr1_2202633_T_G_b38	MORN1	2.968	0.00316	0.037026	4	0.012476	yes	NERVET
chr1_2389131_A_AAAG_b38	MORN1	2.916	0.00372	0.021359	113	0.007325	yes	NERVET
chr1_2335858_C_T_b38	MORN1	2.916	0.00372	0.028575	20	0.009801	yes	NERVET
chr1_2275005_A_G_b38	MORN1	2.904	0.00386	0.027492	19	0.009466	yes	NERVET
chr1_2304900_T_C_b38	MORN1	-2.891	0.00402	-0.029335	16	0.010146	yes	NERVET
chr1_2397773_G_A_b38	MORN1	-2.866	0.00435	-0.051521	3	0.017978	yes	NERVET
chr1_1890472_C_G_b38	MORN1	-2.862	0.0044	-0.036072	10	0.012602	yes	NERVET
chr1_3281183_C_A_b38	MORN1	-2.862	0.00441	-0.03512	6	0.012272	yes	NERVET
chr1_2348590_C_T_b38	MORN1	2.852	0.00454	0.055139	9	0.019334	yes	NERVET
chr1_2224430_C_T_b38	MORN1	2.822	0.00498	0.034114	6	0.01209	yes	NERVET
chr1_2208822_G_A_b38	MORN1	2.813	0.00512	0.033306	7	0.01184	yes	NERVET
chr1_2317797_G_A_b38	MORN1	-2.804	0.00527	-0.025322	34	0.009032	yes	NERVET
chr1_2075464_G_A_b38	MORN1	2.795	0.00541	0.067246	4	0.02406	yes	NERVET
chr1_2075502_A_G_b38	MORN1	2.795	0.00541	0.067246	4	0.02406	yes	NERVET
chr1_2305809_A_G_b38	MORN1	-2.794	0.00542	-0.027147	19	0.009717	yes	NERVET
chr1_3314073_G_GGGGGT_b38	MORN1	-2.783	0.00561	-0.034622	12	0.012441	yes	NERVET
chr1_2099918_A_T_b38	MORN1	2.775	0.00574	0.070346	3	0.02535	yes	NERVET
chr1_3309975_T_A_b38	MORN1	-2.775	0.00575	-0.043437	4	0.015654	yes	NERVET
chr1_2303580_T_C_b38	MORN1	-2.772	0.00579	-0.024762	33	0.008932	yes	NERVET
chr1_2181827_G_A_b38	MORN1	2.772	0.0058	0.034974	4	0.012619	yes	NERVET
chr1_2314194_C_T_b38	MORN1	-2.768	0.00587	-0.024169	48	0.008732	yes	NERVET
chr1_2340267_T_C_b38	MORN1	2.763	0.00595	0.029622	14	0.01072	yes	NERVET
chr1_2060213_C_T_b38	MORN1	2.753	0.00615	0.07277	3	0.026437	yes	NERVET
chr1_2106507_A_G_b38	MORN1	-2.74	0.00637	-0.049649	5	0.018117	yes	NERVET
chr1_3269600_GACAGTCCCAGAGGAGC_G_b38	MORN1	-2.724	0.0067	-0.028622	27	0.010508	yes	NERVET
chr1_3033396_GC_G_b38	MORN1	-2.721	0.00675	-0.02261	89	0.008309	yes	NERVET
chr1_2313466_C_T_b38	MORN1	-2.717	0.00683	-0.021286	107	0.007833	yes	NERVET
chr1_2370032_C_G_b38	MORN1	2.69	0.00741	0.027716	14	0.010304	yes	NERVET
chr1_2314848_G_C_b38	MORN1	-2.67	0.00785	-0.02342	51	0.008771	yes	NERVET
chr1_2337141_G_A_b38	MORN1	2.664	0.00799	0.022505	56	0.008447	yes	NERVET
chr1_3283997_T_C_b38	MORN1	-2.653	0.00825	-0.032265	6	0.012161	yes	NERVET
chr1_3290083_G_T_b38	MORN1	-2.653	0.00825	-0.032265	6	0.012161	yes	NERVET
chr1_2316546_T_C_b38	MORN1	-2.653	0.00825	-0.023484	37	0.008852	yes	NERVET
chr1_2436424_TCCTTTCTCCCTCCTCCCTTCCTCCCTTCCTCCCTCCACCTTTCCTCCTTCCTCCCTCCTCCCCTCCTCCCTCCTCCTCCTTTCCTCCTTCCTCCCTCCTCCTTTCCTCCTTCCTCCCTCCTC_T_b38	MORN1	-2.648	0.00838	-0.048941	9	0.018483	yes	NERVET
chr1_2074301_T_C_b38	MORN1	-2.646	0.00842	-0.031584	7	0.011936	yes	NERVET
chr1_2930600_G_A_b38	MORN1	-2.645	0.00846	-0.067835	3	0.025651	yes	NERVET
chr1_2750896_A_T_b38	MORN1	-2.639	0.00859	-0.058538	6	0.02218	yes	NERVET
chr1_2371472_G_A_b38	MORN1	2.638	0.00862	0.024776	24	0.009391	yes	NERVET
chr1_2338509_C_T_b38	MORN1	2.624	0.00898	0.025481	21	0.009711	yes	NERVET
chr1_2754753_G_C_b38	MORN1	-2.619	0.00912	-0.035188	10	0.013437	yes	NERVET
chr1_2340425_C_T_b38	MORN1	-2.604	0.00951	-0.020334	104	0.007809	yes	NERVET
chr1_1969249_A_AGCCCT_b38	MORN1	-2.6	0.00963	-0.024001	27	0.009232	yes	NERVET
chr1_2370170_G_T_b38	MORN1	-2.588	0.00997	-0.022969	33	0.008877	yes	NERVET
chr1_2345829_C_CCACACA_b38	MORN1	-5.693	2.22e-08	-0.06511	10	0.011436	no	NERVET
chr1_2361214_A_C_b38	MORN1	-5.221	2.69e-07	-0.075287	6	0.014419	no	NERVET
chr1_2359472_G_A_b38	MORN1	5.185	3.24e-07	0.039452	83	0.007609	no	NERVET
chr1_2359882_C_CA_b38	MORN1	-5.094	5.13e-07	-0.046447	26	0.009118	no	NERVET
chr1_2385549_C_CG_b38	MORN1	-4.859	1.62e-06	-0.059888	8	0.012324	no	NERVET
chr1_2342999_A_G_b38	MORN1	-4.317	1.94e-05	-0.037553	37	0.008699	no	NERVET
chr1_1776774_A_T_b38	MORN1	-4.235	2.75e-05	-0.057883	3	0.013666	no	NERVET
chr1_2429870_C_A_b38	MORN1	-4.12	4.49e-05	-0.032108	99	0.007793	no	NERVET
chr1_2344634_T_C_b38	MORN1	4.078	5.36e-05	0.037375	28	0.009166	no	NERVET
chr1_2345727_G_A_b38	MORN1	3.933	9.68e-05	0.036235	27	0.009213	no	NERVET
chr1_2360913_G_A_b38	MORN1	3.912	0.000105	0.03712	29	0.009488	no	NERVET
chr1_2363805_C_CAAACAA_b38	MORN1	3.885	0.000117	0.033205	42	0.008548	no	NERVET
chr1_3233583_C_T_b38	MORN1	3.861	0.000129	0.056964	5	0.014755	no	NERVET
chr1_2297717_C_T_b38	MORN1	-3.812	0.000157	-0.038107	19	0.009997	no	NERVET
chr1_2344757_C_A_b38	MORN1	3.799	0.000165	0.034851	28	0.009173	no	NERVET
chr1_2344761_T_A_b38	MORN1	3.799	0.000165	0.034851	28	0.009173	no	NERVET
chr1_2350934_C_T_b38	MORN1	3.799	0.000165	0.034851	28	0.009173	no	NERVET
chr1_2357882_G_A_b38	MORN1	3.778	0.000179	0.035305	27	0.009344	no	NERVET
chr1_2345849_ACACACAG_A_b38	MORN1	3.775	0.000181	0.036941	18	0.009785	no	NERVET
chr1_2351551_C_T_b38	MORN1	3.758	0.000193	0.034927	26	0.009294	no	NERVET
chr1_2356095_C_T_b38	MORN1	3.715	0.000228	0.034914	26	0.009399	no	NERVET
chr1_2298478_C_T_b38	MORN1	-3.531	0.000456	-0.035183	19	0.009964	no	NERVET
chr1_3016811_C_G_b38	MORN1	-3.456	0.000599	-0.065342	15	0.018907	no	NERVET
chr1_3017169_G_C_b38	MORN1	-3.44	0.000634	-0.067806	7	0.019711	no	NERVET
chr1_3017189_A_G_b38	MORN1	-3.44	0.000634	-0.067806	7	0.019711	no	NERVET
chr1_2750886_C_G_b38	MORN1	-3.413	0.000698	-0.063945	7	0.018734	no	NERVET
chr1_2309937_C_CT_b38	MORN1	-3.381	0.000783	-0.024712	141	0.007309	no	NERVET
chr1_2458710_G_A_b38	MORN1	-3.367	0.000825	-0.091505	3	0.02718	no	NERVET
chr1_2750889_C_A_b38	MORN1	-3.358	0.00085	-0.062964	7	0.018751	no	NERVET
chr1_2750890_C_A_b38	MORN1	-3.348	0.000882	-0.062783	7	0.018754	no	NERVET
chr1_1696214_G_T_b38	MORN1	-3.34	0.000907	-0.077667	4	0.023257	no	NERVET
chr1_2359882_C_CAA_b38	MORN1	3.331	0.000936	0.033095	22	0.009936	no	NERVET
chr1_2750894_C_T_b38	MORN1	-3.282	0.00111	-0.061412	8	0.018711	no	NERVET
chr1_2308567_T_C_b38	MORN1	-3.276	0.00113	-0.034699	11	0.010592	no	NERVET
chr1_2424400_A_G_b38	MORN1	-3.195	0.00149	-0.037181	9	0.011637	no	NERVET
chr1_1969238_C_T_b38	MORN1	-3.162	0.00167	-0.028788	28	0.009104	no	NERVET
chr1_2333899_TGCTGGAAAGAACA_T_b38	MORN1	3.141	0.00179	0.029218	26	0.009303	no	NERVET
chr1_2348984_A_C_b38	MORN1	-3.104	0.00203	-0.030122	21	0.009704	no	NERVET
chr1_2353975_G_A_b38	MORN1	-3.104	0.00203	-0.030122	21	0.009704	no	NERVET
chr1_2355508_A_G_b38	MORN1	-3.104	0.00203	-0.030122	21	0.009704	no	NERVET
chr1_2356078_T_C_b38	MORN1	-3.104	0.00203	-0.030122	21	0.009704	no	NERVET
chr1_2359451_C_T_b38	MORN1	-3.096	0.00208	-0.030061	21	0.009709	no	NERVET
chr1_2361727_G_A_b38	MORN1	-3.096	0.00208	-0.030061	21	0.009709	no	NERVET
chr1_2427409_G_C_b38	MORN1	3.096	0.00208	0.029976	24	0.009681	no	NERVET
chr1_2346388_G_A_b38	MORN1	-3.079	0.0022	-0.029783	21	0.009674	no	NERVET
chr1_2351337_G_C_b38	MORN1	-3.079	0.0022	-0.029783	21	0.009674	no	NERVET
chr1_2360241_T_C_b38	MORN1	-3.071	0.00226	-0.029724	21	0.009679	no	NERVET
chr1_2675497_TGACAGCCTGCAACAGCACCCTGCACCC_T_b38	MORN1	3.053	0.0024	0.062769	5	0.020562	no	NERVET
chr1_3015969_G_A_b38	MORN1	-3.053	0.0024	-0.056978	15	0.018666	no	NERVET
chr1_3016055_A_G_b38	MORN1	-3.053	0.0024	-0.056978	15	0.018666	no	NERVET
chr1_2333631_T_C_b38	MORN1	3.044	0.00247	0.027434	27	0.009014	no	NERVET
chr1_2994895_G_A_b38	MORN1	-3.04	0.0025	-0.066698	4	0.021939	no	NERVET
chr1_2996017_C_T_b38	MORN1	-3.04	0.0025	-0.066698	4	0.021939	no	NERVET
chr1_2996153_T_C_b38	MORN1	-3.04	0.0025	-0.066698	4	0.021939	no	NERVET
chr1_1718605_C_T_b38	MORN1	-3.04	0.0025	-0.073479	4	0.024173	no	NERVET
chr1_1718611_C_T_b38	MORN1	-3.04	0.0025	-0.073479	4	0.024173	no	NERVET
chr1_2181138_C_A_b38	MORN1	3.019	0.00268	0.024409	62	0.008085	no	NERVET
chr1_2304217_G_A_b38	MORN1	-3.009	0.00276	-0.036536	8	0.012142	no	NERVET
chr1_2352564_T_C_b38	MORN1	-2.998	0.00287	-0.029069	21	0.009697	no	NERVET
chr1_2106511_C_CT_b38	MORN1	-2.991	0.00293	-0.071037	4	0.023753	no	NERVET
chr1_2428501_C_T_b38	MORN1	2.985	0.00299	0.028958	22	0.009702	no	NERVET
chr1_2288631_T_A_b38	MORN1	-2.973	0.0031	-0.027657	31	0.009303	no	NERVET
chr1_1874605_T_TAA_b38	MORN1	2.94	0.00344	0.055869	8	0.019001	no	NERVET
chr1_2139901_C_A_b38	MORN1	-2.93	0.00356	-0.023355	73	0.007971	no	NERVET
chr1_2140326_A_G_b38	MORN1	-2.93	0.00356	-0.023355	73	0.007971	no	NERVET
chr1_2332227_G_A_b38	MORN1	2.93	0.00356	0.027057	26	0.009236	no	NERVET
chr1_1638937_A_AT_b38	MORN1	-2.929	0.00356	-0.063251	3	0.021591	no	NERVET
chr1_2368212_T_C_b38	MORN1	-2.927	0.00359	-0.028239	21	0.009648	no	NERVET
chr1_3015935_C_T_b38	MORN1	-2.919	0.00368	-0.055171	15	0.018898	no	NERVET
chr1_2332449_C_T_b38	MORN1	2.918	0.0037	0.027144	25	0.009303	no	NERVET
chr1_2326447_G_C_b38	MORN1	2.912	0.00377	0.026968	26	0.009262	no	NERVET
chr1_1969235_A_G_b38	MORN1	-2.911	0.00377	-0.02652	28	0.009109	no	NERVET
chr1_2101019_TAAA_T_b38	MORN1	-2.911	0.00378	-0.059091	3	0.020302	no	NERVET
chr1_1992039_C_CAAAAAA_b38	MORN1	2.908	0.00381	0.073816	3	0.025381	no	NERVET
chr1_1708486_C_A_b38	MORN1	-2.893	0.00399	-0.021226	106	0.007336	no	NERVET
chr1_2314000_T_C_b38	MORN1	-2.889	0.00404	-0.025202	44	0.008722	no	NERVET
chr1_2325579_T_G_b38	MORN1	2.871	0.00428	0.026555	26	0.00925	no	NERVET
chr1_1708505_G_C_b38	MORN1	-2.864	0.00438	-0.021066	84	0.007356	no	NERVET
chr1_2340235_T_C_b38	MORN1	2.848	0.00459	0.024161	42	0.008483	no	NERVET
chr1_2338442_A_G_b38	MORN1	2.838	0.00475	0.028517	19	0.01005	no	NERVET
chr1_1450193_C_T_b38	MORN1	-2.837	0.00476	-0.038779	16	0.01367	no	NERVET
chr1_2330544_C_A_b38	MORN1	2.826	0.00492	0.026116	26	0.009243	no	NERVET
chr1_2340625_G_A_b38	MORN1	2.825	0.00493	0.024398	39	0.008636	no	NERVET
chr1_2429381_C_G_b38	MORN1	-2.825	0.00494	-0.023905	41	0.008463	no	NERVET
chr1_1969229_T_A_b38	MORN1	-2.821	0.005	-0.025683	28	0.009105	no	NERVET
chr1_2757840_G_T_b38	MORN1	-2.797	0.00537	-0.034392	7	0.012296	no	NERVET
chr1_2186506_G_C_b38	MORN1	2.787	0.00553	0.022622	69	0.008116	no	NERVET
chr1_3377858_A_G_b38	MORN1	-2.786	0.00556	-0.028276	29	0.01015	no	NERVET
chr1_2465015_G_T_b38	MORN1	-2.766	0.00591	-0.066966	4	0.024212	no	NERVET
chr1_2333258_C_T_b38	MORN1	2.761	0.00599	0.025563	26	0.009259	no	NERVET
chr1_2133900_A_G_b38	MORN1	-2.76	0.00601	-0.022443	66	0.008131	no	NERVET
chr1_2133904_G_C_b38	MORN1	-2.76	0.00601	-0.022443	66	0.008131	no	NERVET
chr1_2757684_T_C_b38	MORN1	-2.758	0.00605	-0.024802	45	0.008993	no	NERVET
chr1_2325159_CCCTTCCTTCCTTT_C_b38	MORN1	2.755	0.00611	0.038123	6	0.01384	no	NERVET
chr1_2978989_C_T_b38	MORN1	-2.748	0.00623	-0.022524	66	0.008196	no	NERVET
chr1_2145689_A_G_b38	MORN1	2.739	0.00639	0.021987	68	0.008026	no	NERVET
chr1_2106518_A_G_b38	MORN1	-2.737	0.00644	-0.065339	4	0.023874	no	NERVET
chr1_2329783_C_A_b38	MORN1	2.729	0.00661	0.028392	17	0.010406	no	NERVET
chr1_2427316_G_C_b38	MORN1	-2.717	0.00684	-0.023183	40	0.008533	no	NERVET
chr1_2377078_C_G_b38	MORN1	-2.702	0.00714	-0.036951	5	0.013674	no	NERVET
chr1_2315074_A_G_b38	MORN1	-2.693	0.00733	-0.023605	43	0.008764	no	NERVET
chr1_2970392_G_T_b38	MORN1	2.693	0.00733	0.030218	13	0.01122	no	NERVET
chr1_2194503_C_G_b38	MORN1	2.679	0.00765	0.021049	86	0.007857	no	NERVET
chr1_2380956_C_T_b38	MORN1	-2.672	0.00781	-0.026159	21	0.009791	no	NERVET
chr1_2382101_A_G_b38	MORN1	-2.672	0.00781	-0.026159	21	0.009791	no	NERVET
chr1_2329106_G_A_b38	MORN1	2.665	0.00796	0.021299	122	0.007991	no	NERVET
chr1_2428423_C_A_b38	MORN1	-2.658	0.00815	-0.022593	38	0.008501	no	NERVET
chr1_2395479_G_A_b38	MORN1	2.654	0.00823	0.022958	46	0.008651	no	NERVET
chr1_2364412_G_GTTGT_b38	MORN1	-2.653	0.00824	-0.02388	31	0.009	no	NERVET
chr1_2469095_C_T_b38	MORN1	2.645	0.00845	0.023065	41	0.00872	no	NERVET
chr1_2429693_C_T_b38	MORN1	2.63	0.00883	0.024853	25	0.009451	no	NERVET
chr1_3222964_C_T_b38	MORN1	-2.629	0.00885	-0.064939	3	0.024701	no	NERVET
chr1_3227327_C_T_b38	MORN1	-2.629	0.00885	-0.064939	3	0.024701	no	NERVET
chr1_3223103_C_CTT_b38	MORN1	2.622	0.00902	0.050415	7	0.019226	no	NERVET
chr1_1634405_CCGG_C_b38	MORN1	-2.618	0.00913	-0.062247	4	0.023773	no	NERVET
chr1_3231728_A_G_b38	MORN1	-2.607	0.00943	-0.041504	4	0.015921	no	NERVET
chr1_2243956_T_TTTTCTTTC_b38	MORN1	-2.593	0.00982	-0.036315	4	0.014006	no	NERVET
chr1_3163340_G_GGTCT_b38	MORN1	2.59	0.00991	0.038585	12	0.014899	no	NERVET
chr1_2427505_A_C_b38	MORN1	-2.588	0.00997	-0.022149	46	0.00856	no	NERVET
chr1_2345774_T_C_b38	MORN1	4.281	3.64e-05	0.097325	8	0.022736	yes	OVARY
chr1_2344980_A_G_b38	MORN1	4.269	3.81e-05	0.095668	9	0.02241	yes	OVARY
chr1_2194537_C_A_b38	MORN1	-4.182	5.35e-05	-0.100283	9	0.02398	yes	OVARY
chr1_2351551_C_T_b38	MORN1	3.997	0.000108	0.094122	8	0.023551	yes	OVARY
chr1_2344634_T_C_b38	MORN1	3.956	0.000126	0.090994	9	0.023003	yes	OVARY
chr1_2338570_C_T_b38	MORN1	3.945	0.000131	0.082612	15	0.02094	yes	OVARY
chr1_2345727_G_A_b38	MORN1	3.94	0.000134	0.091959	8	0.02334	yes	OVARY
chr1_2338460_T_C_b38	MORN1	3.934	0.000137	0.083012	17	0.0211	yes	OVARY
chr1_2344757_C_A_b38	MORN1	3.926	0.000141	0.090164	9	0.022964	yes	OVARY
chr1_2344761_T_A_b38	MORN1	3.926	0.000141	0.090164	9	0.022964	yes	OVARY
chr1_2350934_C_T_b38	MORN1	3.926	0.000141	0.090164	9	0.022964	yes	OVARY
chr1_2357882_G_A_b38	MORN1	3.873	0.000171	0.089923	8	0.023219	yes	OVARY
chr1_2344256_A_T_b38	MORN1	3.869	0.000174	0.08682	10	0.022439	yes	OVARY
chr1_2356095_C_T_b38	MORN1	3.759	0.000259	0.08996	7	0.023933	yes	OVARY
chr1_2344583_G_A_b38	MORN1	3.716	0.000302	0.084887	9	0.022842	yes	OVARY
chr1_2340807_G_A_b38	MORN1	3.686	0.000337	0.083286	10	0.022597	yes	OVARY
chr1_2341451_G_A_b38	MORN1	3.686	0.000337	0.083286	10	0.022597	yes	OVARY
chr1_2340625_G_A_b38	MORN1	3.625	0.000417	0.080011	11	0.022075	yes	OVARY
chr1_2340235_T_C_b38	MORN1	3.619	0.000426	0.078411	13	0.021669	yes	OVARY
chr1_2337211_C_G_b38	MORN1	3.583	0.000483	0.07932	16	0.022141	yes	OVARY
chr1_2353743_A_T_b38	MORN1	3.556	0.000529	0.07338	17	0.020634	yes	OVARY
chr1_2873028_C_T_b38	MORN1	-3.55	0.000541	-0.113543	6	0.031982	yes	OVARY
chr1_2344932_C_T_b38	MORN1	3.547	0.000546	0.085854	8	0.024202	yes	OVARY
chr1_2873032_C_T_b38	MORN1	-3.525	0.000589	-0.110454	6	0.031331	yes	OVARY
chr1_2343445_C_T_b38	MORN1	3.474	0.000703	0.075859	11	0.021839	yes	OVARY
chr1_2340764_G_T_b38	MORN1	3.447	0.00077	0.075634	12	0.021943	yes	OVARY
chr1_2340564_G_A_b38	MORN1	3.342	0.00109	0.076116	10	0.022774	yes	OVARY
chr1_2324849_C_A_b38	MORN1	3.224	0.00161	0.080583	7	0.024993	yes	OVARY
chr1_2346111_G_C_b38	MORN1	-3.22	0.00163	-0.06573	28	0.020413	yes	OVARY
chr1_2179409_T_G_b38	MORN1	-3.206	0.0017	-0.077489	7	0.024171	yes	OVARY
chr1_2873063_C_CT_b38	MORN1	-3.17	0.00191	-0.103943	6	0.032786	yes	OVARY
chr1_2873067_C_CT_b38	MORN1	-3.17	0.00191	-0.103943	6	0.032786	yes	OVARY
chr1_2873053_C_CT_b38	MORN1	-3.158	0.00199	-0.103591	6	0.032805	yes	OVARY
chr1_2352457_A_G_b38	MORN1	3.126	0.0022	0.05514	36	0.01764	yes	OVARY
chr1_2353459_T_G_b38	MORN1	3.126	0.0022	0.05514	36	0.01764	yes	OVARY
chr1_2356177_T_C_b38	MORN1	3.126	0.0022	0.05514	36	0.01764	yes	OVARY
chr1_2358849_T_C_b38	MORN1	3.126	0.0022	0.05514	36	0.01764	yes	OVARY
chr1_2360716_T_C_b38	MORN1	3.126	0.0022	0.05514	36	0.01764	yes	OVARY
chr1_2360970_T_C_b38	MORN1	3.126	0.0022	0.05514	36	0.01764	yes	OVARY
chr1_2361332_A_AG_b38	MORN1	3.126	0.0022	0.05514	36	0.01764	yes	OVARY
chr1_2361548_A_ACT_b38	MORN1	3.126	0.0022	0.05514	36	0.01764	yes	OVARY
chr1_1465589_T_TA_b38	MORN1	3.122	0.00223	0.102642	4	0.032882	yes	OVARY
chr1_1650370_C_CT_b38	MORN1	3.12	0.00224	0.077481	7	0.024833	yes	OVARY
chr1_2337229_A_G_b38	MORN1	3.078	0.00256	0.065228	26	0.021193	yes	OVARY
chr1_2873060_TC_T_b38	MORN1	-3.047	0.00281	-0.104724	5	0.034373	yes	OVARY
chr1_1949125_T_TTCCC_b38	MORN1	-3.042	0.00286	-0.082277	4	0.027051	yes	OVARY
chr1_2128619_C_T_b38	MORN1	-3.039	0.00288	-0.075288	6	0.024772	yes	OVARY
chr1_1514211_A_G_b38	MORN1	-2.982	0.00343	-0.106139	4	0.035589	yes	OVARY
chr1_1909229_TG_T_b38	MORN1	-2.973	0.00353	-0.101584	3	0.034174	yes	OVARY
chr1_1516109_T_C_b38	MORN1	-2.956	0.00372	-0.106557	5	0.036049	yes	OVARY
chr1_1516110_G_A_b38	MORN1	-2.956	0.00372	-0.106557	5	0.036049	yes	OVARY
chr1_1531133_G_A_b38	MORN1	-2.946	0.00383	-0.110161	5	0.037392	yes	OVARY
chr1_1515567_A_C_b38	MORN1	-2.878	0.00469	-0.091893	6	0.031928	yes	OVARY
chr1_2915023_G_T_b38	MORN1	-2.872	0.00478	-0.064716	14	0.022534	yes	OVARY
chr1_2915225_A_G_b38	MORN1	-2.872	0.00478	-0.064716	14	0.022534	yes	OVARY
chr1_2347542_C_T_b38	MORN1	-2.872	0.00479	-0.057532	31	0.020035	yes	OVARY
chr1_2349222_G_A_b38	MORN1	-2.865	0.00488	-0.056278	39	0.019642	yes	OVARY
chr1_1533653_C_T_b38	MORN1	-2.852	0.00508	-0.114784	3	0.040251	yes	OVARY
chr1_2367055_C_A_b38	MORN1	2.85	0.00511	0.063356	10	0.022234	yes	OVARY
chr1_1668373_C_T_b38	MORN1	-2.842	0.00522	-0.070271	13	0.024724	yes	OVARY
chr1_2342999_A_G_b38	MORN1	-2.834	0.00535	-0.063544	10	0.022423	yes	OVARY
chr1_2359882_C_CAA_b38	MORN1	2.83	0.00542	0.070189	9	0.024803	yes	OVARY
chr1_2346801_C_T_b38	MORN1	-2.818	0.0056	-0.055821	38	0.019806	yes	OVARY
chr1_1527938_C_A_b38	MORN1	-2.806	0.00581	-0.106609	4	0.037996	yes	OVARY
chr1_1531448_C_T_b38	MORN1	-2.785	0.00618	-0.102649	7	0.036861	yes	OVARY
chr1_1531601_A_G_b38	MORN1	-2.785	0.00618	-0.102649	7	0.036861	yes	OVARY
chr1_1532105_T_C_b38	MORN1	-2.785	0.00618	-0.102649	7	0.036861	yes	OVARY
chr1_1533178_A_G_b38	MORN1	-2.785	0.00618	-0.102649	7	0.036861	yes	OVARY
chr1_1533253_C_T_b38	MORN1	-2.785	0.00618	-0.102649	7	0.036861	yes	OVARY
chr1_2205698_G_A_b38	MORN1	2.778	0.0063	0.07555	6	0.027194	yes	OVARY
chr1_2343937_T_G_b38	MORN1	-2.759	0.00666	-0.051298	36	0.018595	yes	OVARY
chr1_1533095_G_A_b38	MORN1	-2.749	0.00685	-0.10445	6	0.037994	yes	OVARY
chr1_1520875_A_G_b38	MORN1	-2.747	0.00689	-0.09004	8	0.032778	yes	OVARY
chr1_1521518_G_A_b38	MORN1	-2.747	0.00689	-0.09004	8	0.032778	yes	OVARY
chr1_1530002_A_G_b38	MORN1	-2.747	0.00689	-0.09004	8	0.032778	yes	OVARY
chr1_1533018_T_C_b38	MORN1	-2.747	0.00689	-0.09004	8	0.032778	yes	OVARY
chr1_2363829_A_T_b38	MORN1	-2.716	0.00752	-0.048492	26	0.017852	yes	OVARY
chr1_1693256_GT_G_b38	MORN1	-2.713	0.00759	-0.115845	4	0.042697	yes	OVARY
chr1_2342133_C_G_b38	MORN1	-2.7	0.00788	-0.065951	8	0.024425	yes	OVARY
chr1_2342137_G_A_b38	MORN1	-2.7	0.00788	-0.065951	8	0.024425	yes	OVARY
chr1_2056929_C_G_b38	MORN1	2.662	0.00877	0.137406	4	0.051615	yes	OVARY
chr1_2357308_T_C_b38	MORN1	2.658	0.00887	0.047483	37	0.017863	yes	OVARY
chr1_1534913_G_GC_b38	MORN1	-2.643	0.00925	-0.126427	4	0.047831	yes	OVARY
chr1_1522905_A_G_b38	MORN1	-2.643	0.00925	-0.081774	8	0.03094	yes	OVARY
chr1_2350539_T_G_b38	MORN1	-2.627	0.00969	-0.051694	34	0.019681	yes	OVARY
chr1_2340787_C_T_b38	MORN1	-2.625	0.00974	-0.053183	18	0.020263	yes	OVARY
chr1_2963558_C_T_b38	MORN1	4.047	8.96e-05	0.109915	6	0.027161	no	OVARY
chr1_2363405_C_T_b38	MORN1	3.703	0.000316	0.075047	16	0.020264	no	OVARY
chr1_2345849_ACACACAG_A_b38	MORN1	3.517	0.000606	0.086973	5	0.024729	no	OVARY
chr1_2107385_G_A_b38	MORN1	-3.499	0.000646	-0.069804	42	0.019953	no	OVARY
chr1_2368473_T_C_b38	MORN1	-3.469	0.000713	-0.065557	31	0.018896	no	OVARY
chr1_2348378_C_T_b38	MORN1	3.398	0.000906	0.072886	13	0.021447	no	OVARY
chr1_2350696_G_A_b38	MORN1	3.398	0.000906	0.072886	13	0.021447	no	OVARY
chr1_2314848_G_C_b38	MORN1	-3.334	0.00112	-0.076225	14	0.02286	no	OVARY
chr1_2366496_A_T_b38	MORN1	-3.305	0.00124	-0.062284	27	0.018847	no	OVARY
chr1_2367799_C_T_b38	MORN1	-3.305	0.00124	-0.062284	27	0.018847	no	OVARY
chr1_2189294_T_TG_b38	MORN1	-3.293	0.00128	-0.081784	6	0.024835	no	OVARY
chr1_2366555_G_C_b38	MORN1	-3.268	0.00139	-0.060697	28	0.018571	no	OVARY
chr1_2366816_A_G_b38	MORN1	-3.264	0.00141	-0.061738	27	0.018912	no	OVARY
chr1_2365333_G_A_b38	MORN1	-3.249	0.00148	-0.062371	27	0.019196	no	OVARY
chr1_2364499_A_G_b38	MORN1	3.231	0.00157	0.065772	17	0.020354	no	OVARY
chr1_2134596_A_AAT_b38	MORN1	-3.231	0.00157	-0.078501	7	0.024299	no	OVARY
chr1_2368718_C_A_b38	MORN1	-3.223	0.00161	-0.060887	27	0.018894	no	OVARY
chr1_2364339_A_C_b38	MORN1	-3.21	0.00168	-0.060271	28	0.018777	no	OVARY
chr1_2367197_G_A_b38	MORN1	-3.209	0.00169	-0.060777	27	0.018942	no	OVARY
chr1_2368939_G_C_b38	MORN1	-3.209	0.00169	-0.060777	27	0.018942	no	OVARY
chr1_2137585_GCCT_G_b38	MORN1	-3.147	0.00205	-0.079222	6	0.025172	no	OVARY
chr1_2362718_G_A_b38	MORN1	3.144	0.00208	0.066907	13	0.021282	no	OVARY
chr1_2873054_TTTTCTTCTCTTTC_T_b38	MORN1	3.133	0.00215	0.070916	16	0.022635	no	OVARY
chr1_2352756_T_C_b38	MORN1	-3.083	0.00251	-0.059341	27	0.019247	no	OVARY
chr1_2173095_TCCAC_T_b38	MORN1	-3.048	0.0028	-0.075869	6	0.024888	no	OVARY
chr1_2343517_G_A_b38	MORN1	-3.035	0.00292	-0.058081	26	0.01914	no	OVARY
chr1_1657081_C_T_b38	MORN1	3.023	0.00303	0.070034	13	0.023168	no	OVARY
chr1_2207909_CGTGTGT_C_b38	MORN1	-3.022	0.00304	-0.078373	4	0.025933	no	OVARY
chr1_2352403_G_T_b38	MORN1	3.002	0.00323	0.052667	36	0.017544	no	OVARY
chr1_2356409_G_C_b38	MORN1	2.963	0.00364	0.064173	14	0.021662	no	OVARY
chr1_2965079_T_TACTA_b38	MORN1	2.956	0.00372	0.080598	7	0.027268	no	OVARY
chr1_2337141_G_A_b38	MORN1	2.946	0.00383	0.070453	7	0.023914	no	OVARY
chr1_2365236_C_T_b38	MORN1	-2.943	0.00387	-0.055984	28	0.019024	no	OVARY
chr1_2333899_TGCTGGAAAGAACA_T_b38	MORN1	2.921	0.00413	0.072619	8	0.024861	no	OVARY
chr1_1716919_CTTT_C_b38	MORN1	-2.913	0.00423	-0.132859	3	0.045602	no	OVARY
chr1_2343699_C_T_b38	MORN1	-2.897	0.00443	-0.055636	26	0.019202	no	OVARY
chr1_2366243_C_T_b38	MORN1	-2.89	0.00454	-0.055751	26	0.019293	no	OVARY
chr1_2351241_C_T_b38	MORN1	-2.883	0.00463	-0.055023	28	0.019085	no	OVARY
chr1_1657085_C_CTAA_b38	MORN1	2.87	0.00481	0.067295	13	0.023446	no	OVARY
chr1_3377858_A_G_b38	MORN1	-2.869	0.00482	-0.070482	10	0.024564	no	OVARY
chr1_2320961_AG_A_b38	MORN1	2.858	0.00499	0.068619	9	0.024011	no	OVARY
chr1_2293973_T_C_b38	MORN1	-2.853	0.00505	-0.078897	3	0.027649	no	OVARY
chr1_2368188_T_C_b38	MORN1	-2.851	0.00508	-0.053898	29	0.018902	no	OVARY
chr1_2320543_C_T_b38	MORN1	2.844	0.00519	0.0711	6	0.024997	no	OVARY
chr1_2313782_C_T_b38	MORN1	-2.82	0.00558	-0.063277	16	0.022442	no	OVARY
chr1_2963819_A_G_b38	MORN1	2.811	0.00573	0.075661	6	0.026919	no	OVARY
chr1_2863327_T_C_b38	MORN1	2.779	0.00628	0.054968	28	0.019779	no	OVARY
chr1_2324806_A_T_b38	MORN1	2.774	0.00637	0.059351	21	0.021394	no	OVARY
chr1_2367872_A_G_b38	MORN1	-2.774	0.00637	-0.052957	29	0.01909	no	OVARY
chr1_2325579_T_G_b38	MORN1	2.745	0.00692	0.068442	8	0.02493	no	OVARY
chr1_2326447_G_C_b38	MORN1	2.745	0.00692	0.068442	8	0.02493	no	OVARY
chr1_2330544_C_A_b38	MORN1	2.745	0.00692	0.068442	8	0.02493	no	OVARY
chr1_2332227_G_A_b38	MORN1	2.745	0.00692	0.068442	8	0.02493	no	OVARY
chr1_2332449_C_T_b38	MORN1	2.745	0.00692	0.068442	8	0.02493	no	OVARY
chr1_2333258_C_T_b38	MORN1	2.745	0.00692	0.068442	8	0.02493	no	OVARY
chr1_2319918_C_A_b38	MORN1	2.737	0.00708	0.065194	12	0.023816	no	OVARY
chr1_2656416_C_A_b38	MORN1	-2.731	0.00722	-0.098247	3	0.035981	no	OVARY
chr1_2132033_G_C_b38	MORN1	-2.722	0.0074	-0.069365	5	0.025485	no	OVARY
chr1_2338659_A_G_b38	MORN1	2.642	0.00928	0.052459	42	0.019857	no	OVARY
chr1_2300128_G_T_b38	MORN1	-2.639	0.00936	-0.052816	33	0.020014	no	OVARY
chr1_2369210_C_T_b38	MORN1	-2.632	0.00955	-0.052333	28	0.019885	no	OVARY
chr1_1657093_C_A_b38	MORN1	2.631	0.00956	0.062559	13	0.023774	no	OVARY
chr1_2967367_T_C_b38	MORN1	2.631	0.00956	0.065431	10	0.024867	no	OVARY
chr1_2364339_A_C_b38	MORN1	-8.123	2.12e-14	-0.059775	44	0.007359	yes	PNCREAS
chr1_2366956_CAAAATACATAGA_C_b38	MORN1	-7.972	5.64e-14	-0.057573	46	0.007222	yes	PNCREAS
chr1_2367872_A_G_b38	MORN1	-7.781	1.92e-13	-0.057279	46	0.007361	yes	PNCREAS
chr1_2368188_T_C_b38	MORN1	-7.781	1.92e-13	-0.057279	46	0.007361	yes	PNCREAS
chr1_2366555_G_C_b38	MORN1	-7.639	4.7e-13	-0.057785	42	0.007564	yes	PNCREAS
chr1_2366816_A_G_b38	MORN1	-7.568	7.37e-13	-0.056895	42	0.007518	yes	PNCREAS
chr1_2368473_T_C_b38	MORN1	-7.077	1.5e-11	-0.05396	49	0.007625	yes	PNCREAS
chr1_2367197_G_A_b38	MORN1	-7.076	1.5e-11	-0.054219	41	0.007662	yes	PNCREAS
chr1_2366496_A_T_b38	MORN1	-7.051	1.74e-11	-0.054251	41	0.007694	yes	PNCREAS
chr1_2367799_C_T_b38	MORN1	-7.02	2.1e-11	-0.054304	41	0.007735	yes	PNCREAS
chr1_2352756_T_C_b38	MORN1	-7.006	2.28e-11	-0.053524	42	0.00764	yes	PNCREAS
chr1_2368939_G_C_b38	MORN1	-6.98	2.66e-11	-0.053456	41	0.007658	yes	PNCREAS
chr1_2367456_C_CAA_b38	MORN1	-6.728	1.17e-10	-0.05414	32	0.008047	yes	PNCREAS
chr1_2368718_C_A_b38	MORN1	-6.652	1.82e-10	-0.051152	40	0.007689	yes	PNCREAS
chr1_2369210_C_T_b38	MORN1	-6.646	1.89e-10	-0.051291	49	0.007718	yes	PNCREAS
chr1_2366243_C_T_b38	MORN1	-6.637	1.98e-10	-0.051487	40	0.007757	yes	PNCREAS
chr1_2351241_C_T_b38	MORN1	-6.634	2.02e-10	-0.051594	40	0.007777	yes	PNCREAS
chr1_2365333_G_A_b38	MORN1	-6.526	3.75e-10	-0.049968	40	0.007657	yes	PNCREAS
chr1_2343699_C_T_b38	MORN1	-6.49	4.62e-10	-0.050883	37	0.007841	yes	PNCREAS
chr1_2365236_C_T_b38	MORN1	-6.404	7.47e-10	-0.049932	41	0.007796	yes	PNCREAS
chr1_2343517_G_A_b38	MORN1	-6.403	7.54e-10	-0.050425	37	0.007875	yes	PNCREAS
chr1_2340787_C_T_b38	MORN1	-6.401	7.6e-10	-0.051212	28	0.008	yes	PNCREAS
chr1_2348700_C_T_b38	MORN1	-6.275	1.54e-09	-0.051853	31	0.008263	yes	PNCREAS
chr1_2363829_A_T_b38	MORN1	-5.974	7.96e-09	-0.046094	40	0.007716	yes	PNCREAS
chr1_2364657_A_T_b38	MORN1	-5.738	2.77e-08	-0.043431	71	0.007569	yes	PNCREAS
chr1_2364658_A_T_b38	MORN1	-5.738	2.77e-08	-0.043431	71	0.007569	yes	PNCREAS
chr1_2366021_T_C_b38	MORN1	-5.634	4.74e-08	-0.04341	68	0.007704	yes	PNCREAS
chr1_2350750_AGGGGTGGCACG_A_b38	MORN1	-5.104	6.59e-07	-0.047758	12	0.009356	yes	PNCREAS
chr1_2350539_T_G_b38	MORN1	-4.965	1.27e-06	-0.03847	72	0.007748	yes	PNCREAS
chr1_2362863_C_CA_b38	MORN1	-4.904	1.7e-06	-0.050708	7	0.010341	yes	PNCREAS
chr1_2342133_C_G_b38	MORN1	-4.879	1.91e-06	-0.051294	7	0.010514	yes	PNCREAS
chr1_2342137_G_A_b38	MORN1	-4.879	1.91e-06	-0.051294	7	0.010514	yes	PNCREAS
chr1_2346801_C_T_b38	MORN1	-4.748	3.46e-06	-0.037477	70	0.007893	yes	PNCREAS
chr1_2349222_G_A_b38	MORN1	-4.709	4.13e-06	-0.036951	70	0.007846	yes	PNCREAS
chr1_2369355_G_GA_b38	MORN1	-4.685	4.61e-06	-0.043337	27	0.00925	yes	PNCREAS
chr1_2351215_T_G_b38	MORN1	-4.534	9e-06	-0.046198	9	0.01019	yes	PNCREAS
chr1_2354645_C_T_b38	MORN1	-4.529	9.19e-06	-0.046087	9	0.010176	yes	PNCREAS
chr1_2354688_G_C_b38	MORN1	-4.529	9.19e-06	-0.046087	9	0.010176	yes	PNCREAS
chr1_2362229_A_G_b38	MORN1	-4.529	9.19e-06	-0.046087	9	0.010176	yes	PNCREAS
chr1_2348393_G_A_b38	MORN1	-4.529	9.21e-06	-0.043575	11	0.009622	yes	PNCREAS
chr1_2351678_C_T_b38	MORN1	-4.457	1.26e-05	-0.045383	9	0.010182	yes	PNCREAS
chr1_2353459_T_G_b38	MORN1	4.443	1.33e-05	0.034906	60	0.007856	yes	PNCREAS
chr1_2356177_T_C_b38	MORN1	4.443	1.33e-05	0.034906	60	0.007856	yes	PNCREAS
chr1_2352457_A_G_b38	MORN1	4.406	1.56e-05	0.03481	61	0.0079	yes	PNCREAS
chr1_2360716_T_C_b38	MORN1	4.406	1.56e-05	0.03481	61	0.0079	yes	PNCREAS
chr1_2360970_T_C_b38	MORN1	4.406	1.56e-05	0.03481	61	0.0079	yes	PNCREAS
chr1_2361332_A_AG_b38	MORN1	4.406	1.56e-05	0.03481	61	0.0079	yes	PNCREAS
chr1_2361548_A_ACT_b38	MORN1	4.406	1.56e-05	0.03481	61	0.0079	yes	PNCREAS
chr1_2389263_T_C_b38	MORN1	-4.377	1.78e-05	-0.040371	18	0.009225	yes	PNCREAS
chr1_2358849_T_C_b38	MORN1	4.351	1.98e-05	0.034403	61	0.007908	yes	PNCREAS
chr1_2352403_G_T_b38	MORN1	4.343	2.04e-05	0.034465	60	0.007935	yes	PNCREAS
chr1_2380956_C_T_b38	MORN1	-4.304	2.42e-05	-0.043829	8	0.010184	yes	PNCREAS
chr1_2382101_A_G_b38	MORN1	-4.304	2.42e-05	-0.043829	8	0.010184	yes	PNCREAS
chr1_2357308_T_C_b38	MORN1	4.298	2.47e-05	0.03476	66	0.008087	yes	PNCREAS
chr1_2363405_C_T_b38	MORN1	4.26	2.91e-05	0.039112	25	0.009182	yes	PNCREAS
chr1_2338659_A_G_b38	MORN1	4.18	4.03e-05	0.0322	55	0.007703	yes	PNCREAS
chr1_2364499_A_G_b38	MORN1	4.136	4.84e-05	0.037757	22	0.00913	yes	PNCREAS
chr1_2392569_C_T_b38	MORN1	-4.072	6.27e-05	-0.041168	8	0.01011	yes	PNCREAS
chr1_2347212_C_T_b38	MORN1	-4.05	6.86e-05	-0.041424	8	0.010229	yes	PNCREAS
chr1_2337352_A_G_b38	MORN1	4.019	7.74e-05	0.032744	41	0.008147	yes	PNCREAS
chr1_2440123_T_C_b38	MORN1	3.975	9.23e-05	0.097999	3	0.024654	yes	PNCREAS
chr1_2341705_A_G_b38	MORN1	3.961	9.75e-05	0.0322	61	0.008129	yes	PNCREAS
chr1_2391602_T_C_b38	MORN1	-3.949	0.000102	-0.033394	24	0.008457	yes	PNCREAS
chr1_2343937_T_G_b38	MORN1	-3.949	0.000102	-0.033009	49	0.008359	yes	PNCREAS
chr1_2362718_G_A_b38	MORN1	3.936	0.000108	0.036554	19	0.009287	yes	PNCREAS
chr1_2337299_A_G_b38	MORN1	3.901	0.000123	0.031691	39	0.008123	yes	PNCREAS
chr1_2369336_A_G_b38	MORN1	-3.802	0.00018	-0.038763	12	0.010194	yes	PNCREAS
chr1_2369713_ATAAT_A_b38	MORN1	-3.786	0.000192	-0.037048	14	0.009784	yes	PNCREAS
chr1_2347542_C_T_b38	MORN1	-3.751	0.000219	-0.028843	68	0.007689	yes	PNCREAS
chr1_2344761_T_C_b38	MORN1	3.712	0.000254	0.036775	16	0.009907	yes	PNCREAS
chr1_2369118_G_A_b38	MORN1	-3.638	0.000335	-0.03514	14	0.00966	yes	PNCREAS
chr1_2380105_C_T_b38	MORN1	-3.545	0.000469	-0.029169	35	0.008228	yes	PNCREAS
chr1_2350696_G_A_b38	MORN1	3.519	0.000515	0.032573	21	0.009257	yes	PNCREAS
chr1_2348378_C_T_b38	MORN1	3.511	0.000529	0.032586	20	0.00928	yes	PNCREAS
chr1_2342734_T_C_b38	MORN1	-3.492	0.000567	-0.032872	13	0.009414	yes	PNCREAS
chr1_2380209_G_A_b38	MORN1	-3.412	0.000751	-0.027942	35	0.008188	yes	PNCREAS
chr1_3200824_C_T_b38	MORN1	3.391	0.00081	0.031937	26	0.009418	yes	PNCREAS
chr1_2353047_C_T_b38	MORN1	-3.361	0.000898	-0.034436	10	0.010245	yes	PNCREAS
chr1_2360913_G_A_b38	MORN1	3.357	0.000912	0.033466	14	0.00997	yes	PNCREAS
chr1_2304233_C_T_b38	MORN1	3.333	0.000991	0.036897	15	0.011071	yes	PNCREAS
chr1_2364484_C_T_b38	MORN1	-3.326	0.00101	-0.034638	11	0.010413	yes	PNCREAS
chr1_2365220_A_G_b38	MORN1	-3.317	0.00104	-0.034674	10	0.010452	yes	PNCREAS
chr1_2357811_C_G_b38	MORN1	-3.31	0.00107	-0.034161	10	0.01032	yes	PNCREAS
chr1_2357812_T_C_b38	MORN1	-3.31	0.00107	-0.034161	10	0.01032	yes	PNCREAS
chr1_2359828_A_G_b38	MORN1	-3.31	0.00107	-0.034161	10	0.01032	yes	PNCREAS
chr1_2363591_T_G_b38	MORN1	-3.31	0.00107	-0.034161	10	0.01032	yes	PNCREAS
chr1_2367871_C_T_b38	MORN1	-3.31	0.00107	-0.034161	10	0.01032	yes	PNCREAS
chr1_2346676_G_C_b38	MORN1	-3.31	0.00107	-0.03361	10	0.010154	yes	PNCREAS
chr1_2350287_A_C_b38	MORN1	-3.31	0.00107	-0.03361	10	0.010154	yes	PNCREAS
chr1_2344932_C_A_b38	MORN1	-3.302	0.0011	-0.033906	10	0.010267	yes	PNCREAS
chr1_2370252_G_A_b38	MORN1	3.248	0.00132	0.03348	8	0.010309	yes	PNCREAS
chr1_2379954_A_G_b38	MORN1	-3.101	0.00215	-0.026954	23	0.008692	yes	PNCREAS
chr1_2353743_A_T_b38	MORN1	3.099	0.00217	0.028964	29	0.009348	yes	PNCREAS
chr1_1486354_G_C_b38	MORN1	-3.024	0.00275	-0.061466	3	0.020323	yes	PNCREAS
chr1_2300128_G_T_b38	MORN1	-3.004	0.00293	-0.023551	70	0.007839	yes	PNCREAS
chr1_3291478_C_T_b38	MORN1	-2.979	0.00318	-0.041789	12	0.014029	yes	PNCREAS
chr1_2346111_G_C_b38	MORN1	-2.909	0.00396	-0.023213	65	0.00798	yes	PNCREAS
chr1_2337239_T_C_b38	MORN1	2.896	0.00412	0.026249	23	0.009064	yes	PNCREAS
chr1_3302508_T_TA_b38	MORN1	2.805	0.00543	0.026565	18	0.009471	yes	PNCREAS
chr1_1459004_T_C_b38	MORN1	-2.785	0.00576	-0.042719	15	0.015338	yes	PNCREAS
chr1_1982141_G_A_b38	MORN1	-2.784	0.00577	-0.05807	3	0.020856	yes	PNCREAS
chr1_3299422_G_A_b38	MORN1	-2.782	0.00582	-0.048592	4	0.017468	yes	PNCREAS
chr1_3197254_C_T_b38	MORN1	2.772	0.00599	0.027655	16	0.009977	yes	PNCREAS
chr1_3195714_G_A_b38	MORN1	2.768	0.00606	0.034018	8	0.012288	yes	PNCREAS
chr1_2370032_C_G_b38	MORN1	2.765	0.00612	0.029281	10	0.01059	yes	PNCREAS
chr1_2047973_C_G_b38	MORN1	-2.748	0.00643	-0.035107	4	0.012774	yes	PNCREAS
chr1_2049679_A_C_b38	MORN1	-2.748	0.00643	-0.035107	4	0.012774	yes	PNCREAS
chr1_1736832_GA_G_b38	MORN1	2.725	0.00688	0.059882	3	0.021973	yes	PNCREAS
chr1_3197116_T_C_b38	MORN1	2.71	0.00719	0.026279	19	0.009696	yes	PNCREAS
chr1_1461283_A_G_b38	MORN1	-2.697	0.00747	-0.053574	3	0.019861	yes	PNCREAS
chr1_1461362_AT_A_b38	MORN1	-2.697	0.00747	-0.053574	3	0.019861	yes	PNCREAS
chr1_2347995_C_T_b38	MORN1	2.656	0.00841	0.031687	5	0.011929	yes	PNCREAS
chr1_1461760_C_A_b38	MORN1	-2.655	0.00844	-0.043077	6	0.016224	yes	PNCREAS
chr1_3312351_T_C_b38	MORN1	-2.651	0.00853	-0.026706	13	0.010073	yes	PNCREAS
chr1_3313426_T_C_b38	MORN1	-2.651	0.00853	-0.026706	13	0.010073	yes	PNCREAS
chr1_3310052_G_C_b38	MORN1	-2.648	0.00862	-0.026456	14	0.009992	yes	PNCREAS
chr1_3196584_A_G_b38	MORN1	2.622	0.00928	0.026204	17	0.009994	yes	PNCREAS
chr1_2367644_G_A_b38	MORN1	-4.119	5.18e-05	-0.035807	35	0.008693	no	PNCREAS
chr1_2359472_G_A_b38	MORN1	4.075	6.18e-05	0.032348	40	0.007937	no	PNCREAS
chr1_1992764_A_G_b38	MORN1	-3.611	0.000369	-0.087814	5	0.024321	no	PNCREAS
chr1_2377078_C_G_b38	MORN1	-3.568	0.000431	-0.049037	3	0.013743	no	PNCREAS
chr1_2382880_T_C_b38	MORN1	-3.47	0.000612	-0.045988	4	0.013252	no	PNCREAS
chr1_3287931_C_G_b38	MORN1	-3.242	0.00135	-0.046026	11	0.014197	no	PNCREAS
chr1_3290616_C_T_b38	MORN1	-3.242	0.00135	-0.046026	11	0.014197	no	PNCREAS
chr1_2338460_T_C_b38	MORN1	3.162	0.00176	0.024849	42	0.007859	no	PNCREAS
chr1_1495221_G_A_b38	MORN1	-3.095	0.00219	-0.048163	7	0.015561	no	PNCREAS
chr1_1495222_T_G_b38	MORN1	-3.095	0.00219	-0.048163	7	0.015561	no	PNCREAS
chr1_2337229_A_G_b38	MORN1	3.095	0.00219	0.025097	62	0.008109	no	PNCREAS
chr1_3110182_A_C_b38	MORN1	3.077	0.00232	0.042263	4	0.013733	no	PNCREAS
chr1_1495205_G_A_b38	MORN1	-3.075	0.00234	-0.049848	5	0.016209	no	PNCREAS
chr1_2356409_G_C_b38	MORN1	3.057	0.00248	0.028345	24	0.009273	no	PNCREAS
chr1_1494105_G_A_b38	MORN1	-3.005	0.00292	-0.057386	4	0.019094	no	PNCREAS
chr1_1495236_T_C_b38	MORN1	-3.005	0.00292	-0.057386	4	0.019094	no	PNCREAS
chr1_1729998_T_TGGGA_b38	MORN1	2.978	0.00319	0.027018	30	0.009072	no	PNCREAS
chr1_2308944_C_T_b38	MORN1	2.973	0.00324	0.039319	4	0.013227	no	PNCREAS
chr1_2303464_C_T_b38	MORN1	2.942	0.00357	0.031469	7	0.010696	no	PNCREAS
chr1_2337211_C_G_b38	MORN1	2.905	0.00401	0.023919	41	0.008235	no	PNCREAS
chr1_2367055_C_A_b38	MORN1	2.897	0.0041	0.026698	16	0.009216	no	PNCREAS
chr1_3340801_T_G_b38	MORN1	2.812	0.00532	0.02214	42	0.007875	no	PNCREAS
chr1_2309937_C_CTT_b38	MORN1	2.797	0.00557	0.024741	30	0.008847	no	PNCREAS
chr1_3363689_G_A_b38	MORN1	-2.795	0.00559	-0.038622	3	0.013816	no	PNCREAS
chr1_1457919_C_A_b38	MORN1	-2.793	0.00562	-0.049674	7	0.017783	no	PNCREAS
chr1_1457922_T_C_b38	MORN1	-2.793	0.00562	-0.049674	7	0.017783	no	PNCREAS
chr1_3199797_T_G_b38	MORN1	2.773	0.00598	0.027277	39	0.009838	no	PNCREAS
chr1_3362704_T_A_b38	MORN1	-2.769	0.00604	-0.036284	6	0.013103	no	PNCREAS
chr1_1495327_C_T_b38	MORN1	-2.764	0.00615	-0.054295	4	0.019647	no	PNCREAS
chr1_2364485_A_G_b38	MORN1	-2.738	0.00663	-0.025431	24	0.009289	no	PNCREAS
chr1_1567912_C_CAAAAAAAA_b38	MORN1	-2.713	0.00713	-0.039892	9	0.014704	no	PNCREAS
chr1_2960085_C_G_b38	MORN1	2.713	0.00713	0.071756	3	0.02645	no	PNCREAS
chr1_3283435_T_C_b38	MORN1	-2.707	0.00727	-0.030323	23	0.011203	no	PNCREAS
chr1_1468254_T_A_b38	MORN1	-2.683	0.00778	-0.045379	3	0.016913	no	PNCREAS
chr1_2338570_C_T_b38	MORN1	2.68	0.00785	0.021521	39	0.00803	no	PNCREAS
chr1_2364506_G_A_b38	MORN1	-2.675	0.00798	-0.024969	20	0.009336	no	PNCREAS
chr1_1468062_A_T_b38	MORN1	-2.673	0.00801	-0.043502	5	0.016273	no	PNCREAS
chr1_3095323_AG_A_b38	MORN1	-2.634	0.00897	-0.06307	3	0.023947	no	PNCREAS
chr1_3112648_C_T_b38	MORN1	2.619	0.00936	0.036946	3	0.014108	no	PNCREAS
chr1_1740869_C_T_b38	MORN1	2.613	0.00951	0.052695	4	0.020164	no	PNCREAS
chr1_3254004_C_G_b38	MORN1	-2.599	0.00991	-0.039889	3	0.015349	no	PNCREAS
chr1_1427029_G_A_b38	MORN1	-2.597	0.00996	-0.046621	3	0.017952	no	PNCREAS
chr1_2367456_C_CAA_b38	MORN1	-6.079	6.2e-09	-0.069449	31	0.011424	yes	PTTARY
chr1_2364339_A_C_b38	MORN1	-5.711	4.12e-08	-0.063403	37	0.011102	yes	PTTARY
chr1_2365236_C_T_b38	MORN1	-5.655	5.44e-08	-0.063487	35	0.011226	yes	PTTARY
chr1_2366555_G_C_b38	MORN1	-5.635	6.03e-08	-0.062776	37	0.011141	yes	PTTARY
chr1_2367197_G_A_b38	MORN1	-5.634	6.06e-08	-0.063324	35	0.01124	yes	PTTARY
chr1_2366496_A_T_b38	MORN1	-5.593	7.44e-08	-0.062608	36	0.011194	yes	PTTARY
chr1_2366816_A_G_b38	MORN1	-5.593	7.44e-08	-0.062608	36	0.011194	yes	PTTARY
chr1_2367799_C_T_b38	MORN1	-5.593	7.44e-08	-0.062608	36	0.011194	yes	PTTARY
chr1_2368939_G_C_b38	MORN1	-5.593	7.44e-08	-0.062608	36	0.011194	yes	PTTARY
chr1_2368718_C_A_b38	MORN1	-5.538	9.77e-08	-0.062855	35	0.01135	yes	PTTARY
chr1_2352756_T_C_b38	MORN1	-5.513	1.1e-07	-0.06181	36	0.011211	yes	PTTARY
chr1_2366956_CAAAATACATAGA_C_b38	MORN1	-5.45	1.5e-07	-0.061333	38	0.011253	yes	PTTARY
chr1_2366243_C_T_b38	MORN1	-5.446	1.53e-07	-0.061286	34	0.011254	yes	PTTARY
chr1_2343517_G_A_b38	MORN1	-5.431	1.65e-07	-0.063358	31	0.011666	yes	PTTARY
chr1_2369210_C_T_b38	MORN1	-5.335	2.62e-07	-0.059872	40	0.011223	yes	PTTARY
chr1_2368473_T_C_b38	MORN1	-5.312	2.93e-07	-0.060475	41	0.011385	yes	PTTARY
chr1_2343699_C_T_b38	MORN1	-5.262	3.72e-07	-0.061604	31	0.011707	yes	PTTARY
chr1_2351241_C_T_b38	MORN1	-5.249	3.96e-07	-0.059924	35	0.011417	yes	PTTARY
chr1_2365333_G_A_b38	MORN1	-5.247	3.99e-07	-0.058504	36	0.011149	yes	PTTARY
chr1_2367872_A_G_b38	MORN1	-5.216	4.63e-07	-0.058278	40	0.011173	yes	PTTARY
chr1_2368188_T_C_b38	MORN1	-5.216	4.63e-07	-0.058278	40	0.011173	yes	PTTARY
chr1_2348700_C_T_b38	MORN1	-4.53	1.03e-05	-0.053928	30	0.011906	yes	PTTARY
chr1_2343937_T_G_b38	MORN1	-4.413	1.68e-05	-0.051369	41	0.011639	yes	PTTARY
chr1_2340787_C_T_b38	MORN1	-4.378	1.95e-05	-0.051666	30	0.011801	yes	PTTARY
chr1_2363829_A_T_b38	MORN1	-4.3	2.69e-05	-0.048623	35	0.011309	yes	PTTARY
chr1_2338659_A_G_b38	MORN1	4.194	4.15e-05	0.048619	57	0.011592	yes	PTTARY
chr1_2352403_G_T_b38	MORN1	3.788	0.000202	0.043345	51	0.011444	yes	PTTARY
chr1_2352457_A_G_b38	MORN1	3.788	0.000202	0.043345	51	0.011444	yes	PTTARY
chr1_2353459_T_G_b38	MORN1	3.788	0.000202	0.043345	51	0.011444	yes	PTTARY
chr1_2356177_T_C_b38	MORN1	3.788	0.000202	0.043345	51	0.011444	yes	PTTARY
chr1_2360716_T_C_b38	MORN1	3.786	0.000203	0.043324	51	0.011442	yes	PTTARY
chr1_2360970_T_C_b38	MORN1	3.786	0.000203	0.043324	51	0.011442	yes	PTTARY
chr1_2361332_A_AG_b38	MORN1	3.786	0.000203	0.043324	51	0.011442	yes	PTTARY
chr1_2361548_A_ACT_b38	MORN1	3.786	0.000203	0.043324	51	0.011442	yes	PTTARY
chr1_2358849_T_C_b38	MORN1	3.665	0.000319	0.041707	52	0.011381	yes	PTTARY
chr1_2369355_G_GA_b38	MORN1	-3.59	0.000418	-0.045956	25	0.012801	yes	PTTARY
chr1_2357308_T_C_b38	MORN1	3.56	0.000466	0.040948	53	0.011503	yes	PTTARY
chr1_2337211_C_G_b38	MORN1	3.503	0.000569	0.045017	28	0.01285	yes	PTTARY
chr1_2337352_A_G_b38	MORN1	3.404	0.000806	0.040082	46	0.011776	yes	PTTARY
chr1_2338570_C_T_b38	MORN1	3.319	0.00108	0.041085	29	0.012378	yes	PTTARY
chr1_2287068_C_T_b38	MORN1	-3.118	0.0021	-0.059412	4	0.019056	yes	PTTARY
chr1_2369713_ATAAT_A_b38	MORN1	-3.057	0.00255	-0.049877	5	0.016317	yes	PTTARY
chr1_2359472_G_A_b38	MORN1	3.027	0.00281	0.034629	45	0.011442	yes	PTTARY
chr1_2367644_G_A_b38	MORN1	-2.996	0.00308	-0.037477	33	0.012507	yes	PTTARY
chr1_2344932_C_A_b38	MORN1	-2.975	0.00329	-0.050608	3	0.017009	yes	PTTARY
chr1_2346676_G_C_b38	MORN1	-2.975	0.00329	-0.050608	3	0.017009	yes	PTTARY
chr1_2350287_A_C_b38	MORN1	-2.975	0.00329	-0.050608	3	0.017009	yes	PTTARY
chr1_2353047_C_T_b38	MORN1	-2.975	0.00329	-0.050608	3	0.017009	yes	PTTARY
chr1_2357811_C_G_b38	MORN1	-2.975	0.00329	-0.050608	3	0.017009	yes	PTTARY
chr1_2357812_T_C_b38	MORN1	-2.975	0.00329	-0.050608	3	0.017009	yes	PTTARY
chr1_2359828_A_G_b38	MORN1	-2.975	0.00329	-0.050608	3	0.017009	yes	PTTARY
chr1_2363591_T_G_b38	MORN1	-2.975	0.00329	-0.050608	3	0.017009	yes	PTTARY
chr1_2363405_C_T_b38	MORN1	2.96	0.00345	0.039577	21	0.01337	yes	PTTARY
chr1_2353743_A_T_b38	MORN1	2.916	0.00396	0.039281	21	0.01347	yes	PTTARY
chr1_2286661_C_T_b38	MORN1	-2.907	0.00406	-0.053811	4	0.018508	yes	PTTARY
chr1_2367871_C_T_b38	MORN1	-2.89	0.00429	-0.04955	3	0.017147	yes	PTTARY
chr1_2212052_G_A_b38	MORN1	-2.857	0.00473	-0.048151	5	0.016851	yes	PTTARY
chr1_1889659_T_TA_b38	MORN1	2.839	0.00501	0.042011	11	0.014799	yes	PTTARY
chr1_2690121_C_G_b38	MORN1	2.82	0.0053	0.051836	3	0.018384	yes	PTTARY
chr1_2297717_C_T_b38	MORN1	-2.812	0.00542	-0.038208	17	0.013587	yes	PTTARY
chr1_2293437_A_C_b38	MORN1	2.8	0.00563	0.038399	14	0.013716	yes	PTTARY
chr1_1792696_C_CA_b38	MORN1	2.745	0.00661	0.035121	29	0.012793	yes	PTTARY
chr1_2462394_G_T_b38	MORN1	-2.733	0.00685	-0.049431	3	0.018086	yes	PTTARY
chr1_2365220_A_G_b38	MORN1	-2.705	0.00743	-0.046676	3	0.017255	yes	PTTARY
chr1_2356409_G_C_b38	MORN1	2.655	0.00858	0.035404	19	0.013335	yes	PTTARY
chr1_2342734_T_C_b38	MORN1	-2.647	0.00877	-0.035136	18	0.013272	yes	PTTARY
chr1_1896396_CT_C_b38	MORN1	2.632	0.00916	0.04283	3	0.016273	yes	PTTARY
chr1_2298478_C_T_b38	MORN1	-2.626	0.00932	-0.035537	17	0.013533	yes	PTTARY
chr1_1877314_A_T_b38	MORN1	2.615	0.00962	0.039746	13	0.0152	yes	PTTARY
chr1_2344256_A_T_b38	MORN1	2.606	0.00986	0.036272	14	0.013918	yes	PTTARY
chr1_2346801_C_T_b38	MORN1	-4.025	8.14e-05	-0.047895	54	0.011899	no	PTTARY
chr1_2349222_G_A_b38	MORN1	-3.99	9.32e-05	-0.047163	55	0.011819	no	PTTARY
chr1_2348393_G_A_b38	MORN1	-3.896	0.000134	-0.053316	16	0.013685	no	PTTARY
chr1_2347542_C_T_b38	MORN1	-3.888	0.000138	-0.046583	46	0.011981	no	PTTARY
chr1_2364657_A_T_b38	MORN1	-3.847	0.000162	-0.044126	56	0.01147	no	PTTARY
chr1_2364658_A_T_b38	MORN1	-3.847	0.000162	-0.044126	56	0.01147	no	PTTARY
chr1_2366021_T_C_b38	MORN1	-3.791	0.000199	-0.043876	52	0.011573	no	PTTARY
chr1_2354688_G_C_b38	MORN1	-3.676	0.000305	-0.050269	16	0.013674	no	PTTARY
chr1_2354645_C_T_b38	MORN1	-3.488	0.000602	-0.047581	16	0.013643	no	PTTARY
chr1_2362229_A_G_b38	MORN1	-3.488	0.000602	-0.047581	16	0.013643	no	PTTARY
chr1_2351215_T_G_b38	MORN1	-3.432	0.00073	-0.047151	16	0.013737	no	PTTARY
chr1_2350539_T_G_b38	MORN1	-3.424	0.000751	-0.040117	50	0.011716	no	PTTARY
chr1_2369118_G_A_b38	MORN1	-3.398	0.000821	-0.048281	12	0.014207	no	PTTARY
chr1_2346111_G_C_b38	MORN1	-3.373	0.000897	-0.039829	47	0.011809	no	PTTARY
chr1_2350750_AGGGGTGGCACG_A_b38	MORN1	-3.341	0.000998	-0.044415	19	0.013293	no	PTTARY
chr1_2341705_A_G_b38	MORN1	3.298	0.00116	0.039165	55	0.011874	no	PTTARY
chr1_2351678_C_T_b38	MORN1	-3.241	0.0014	-0.045296	15	0.013977	no	PTTARY
chr1_2362863_C_CA_b38	MORN1	-3.228	0.00146	-0.045373	13	0.014056	no	PTTARY
chr1_2338460_T_C_b38	MORN1	3.215	0.00153	0.03996	31	0.012431	no	PTTARY
chr1_2369336_A_G_b38	MORN1	-3.036	0.00273	-0.047301	7	0.015582	no	PTTARY
chr1_2008008_CA_C_b38	MORN1	3.001	0.00304	0.048197	6	0.016059	no	PTTARY
chr1_2347212_C_T_b38	MORN1	-2.959	0.00347	-0.039897	17	0.013485	no	PTTARY
chr1_2008387_C_T_b38	MORN1	2.954	0.00352	0.047493	6	0.016078	no	PTTARY
chr1_2009834_C_T_b38	MORN1	2.954	0.00352	0.047493	6	0.016078	no	PTTARY
chr1_2031194_A_G_b38	MORN1	2.912	0.00401	0.046023	7	0.015806	no	PTTARY
chr1_2005928_T_TTC_b38	MORN1	2.885	0.00435	0.052004	3	0.018027	no	PTTARY
chr1_2010406_G_A_b38	MORN1	2.855	0.00477	0.045897	6	0.016078	no	PTTARY
chr1_2005948_A_C_b38	MORN1	2.838	0.00502	0.051773	4	0.018244	no	PTTARY
chr1_2008632_C_T_b38	MORN1	2.826	0.0052	0.045646	6	0.016153	no	PTTARY
chr1_2008948_G_C_b38	MORN1	2.826	0.0052	0.045646	6	0.016153	no	PTTARY
chr1_2010975_T_C_b38	MORN1	2.821	0.00528	0.04521	6	0.016027	no	PTTARY
chr1_2342133_C_G_b38	MORN1	-2.803	0.00557	-0.040222	14	0.014351	no	PTTARY
chr1_2342137_G_A_b38	MORN1	-2.803	0.00557	-0.040222	14	0.014351	no	PTTARY
chr1_2026833_CA_C_b38	MORN1	2.797	0.00568	0.039389	13	0.014085	no	PTTARY
chr1_1769737_GA_G_b38	MORN1	2.74	0.0067	0.042701	11	0.015582	no	PTTARY
chr1_2023934_C_T_b38	MORN1	2.722	0.00706	0.04378	6	0.016081	no	PTTARY
chr1_3180547_G_A_b38	MORN1	-2.696	0.00764	-0.04562	6	0.016923	no	PTTARY
chr1_1864337_G_A_b38	MORN1	-2.69	0.00776	-0.033015	27	0.012273	no	PTTARY
chr1_2029235_C_T_b38	MORN1	2.687	0.00783	0.044187	6	0.016445	no	PTTARY
chr1_2029969_C_T_b38	MORN1	2.687	0.00783	0.044187	6	0.016445	no	PTTARY
chr1_2031380_T_A_b38	MORN1	2.687	0.00783	0.044187	6	0.016445	no	PTTARY
chr1_2031629_GTGTCTGGGGCGCTAC_G_b38	MORN1	2.687	0.00783	0.044187	6	0.016445	no	PTTARY
chr1_2031648_CCTCTG_C_b38	MORN1	2.687	0.00783	0.044187	6	0.016445	no	PTTARY
chr1_2031655_AGGACCCAGGCATCTG_A_b38	MORN1	2.687	0.00783	0.044187	6	0.016445	no	PTTARY
chr1_2031719_C_T_b38	MORN1	2.687	0.00783	0.044187	6	0.016445	no	PTTARY
chr1_2031852_C_G_b38	MORN1	2.687	0.00783	0.044187	6	0.016445	no	PTTARY
chr1_2010191_G_C_b38	MORN1	2.65	0.0087	0.043115	6	0.016268	no	PTTARY
chr1_2033336_T_C_b38	MORN1	2.65	0.00871	0.044267	5	0.016706	no	PTTARY
chr1_2033373_T_G_b38	MORN1	2.65	0.00871	0.044267	5	0.016706	no	PTTARY
chr1_2033988_G_A_b38	MORN1	2.65	0.00871	0.044267	5	0.016706	no	PTTARY
chr1_1809189_AT_A_b38	MORN1	2.619	0.0095	0.042575	48	0.016255	no	PTTARY
chr1_1861110_C_CA_b38	MORN1	-2.604	0.00991	-0.033068	36	0.012698	no	PTTARY
chr1_2364339_A_C_b38	MORN1	-8.428	1.07e-14	-0.130424	27	0.015475	yes	PRSTTE
chr1_2366816_A_G_b38	MORN1	-8.33	1.95e-14	-0.129188	27	0.015509	yes	PRSTTE
chr1_2363829_A_T_b38	MORN1	-8.052	1.05e-13	-0.124218	25	0.015427	yes	PRSTTE
chr1_2367872_A_G_b38	MORN1	-8.029	1.21e-13	-0.1253	28	0.015607	yes	PRSTTE
chr1_2368188_T_C_b38	MORN1	-8.029	1.21e-13	-0.1253	28	0.015607	yes	PRSTTE
chr1_2352756_T_C_b38	MORN1	-8.018	1.29e-13	-0.125309	27	0.015628	yes	PRSTTE
chr1_2366956_CAAAATACATAGA_C_b38	MORN1	-7.921	2.31e-13	-0.12347	26	0.015588	yes	PRSTTE
chr1_2366555_G_C_b38	MORN1	-7.815	4.34e-13	-0.124159	26	0.015888	yes	PRSTTE
chr1_2351241_C_T_b38	MORN1	-7.733	7.04e-13	-0.124146	25	0.016053	yes	PRSTTE
chr1_2368473_T_C_b38	MORN1	-7.728	7.25e-13	-0.12254	28	0.015856	yes	PRSTTE
chr1_2366496_A_T_b38	MORN1	-7.718	7.7e-13	-0.122828	26	0.015914	yes	PRSTTE
chr1_2367799_C_T_b38	MORN1	-7.718	7.7e-13	-0.122828	26	0.015914	yes	PRSTTE
chr1_2365333_G_A_b38	MORN1	-7.716	7.8e-13	-0.122001	25	0.015812	yes	PRSTTE
chr1_2367197_G_A_b38	MORN1	-7.671	1.02e-12	-0.123142	25	0.016053	yes	PRSTTE
chr1_2368718_C_A_b38	MORN1	-7.593	1.61e-12	-0.1209	25	0.015923	yes	PRSTTE
chr1_2368939_G_C_b38	MORN1	-7.558	1.97e-12	-0.120694	26	0.015968	yes	PRSTTE
chr1_2343517_G_A_b38	MORN1	-7.547	2.1e-12	-0.121785	24	0.016137	yes	PRSTTE
chr1_2343699_C_T_b38	MORN1	-7.547	2.1e-12	-0.121785	24	0.016137	yes	PRSTTE
chr1_2366243_C_T_b38	MORN1	-7.511	2.59e-12	-0.120373	26	0.016026	yes	PRSTTE
chr1_2369210_C_T_b38	MORN1	-7.058	3.48e-11	-0.111123	33	0.015744	yes	PRSTTE
chr1_2340787_C_T_b38	MORN1	-7.034	3.98e-11	-0.115977	19	0.016487	yes	PRSTTE
chr1_2365236_C_T_b38	MORN1	-6.912	7.9e-11	-0.114034	25	0.016498	yes	PRSTTE
chr1_2367456_C_CAA_b38	MORN1	-6.858	1.06e-10	-0.11913	19	0.01737	yes	PRSTTE
chr1_2348700_C_T_b38	MORN1	-6.522	6.71e-10	-0.117046	18	0.017946	yes	PRSTTE
chr1_2343937_T_G_b38	MORN1	-6.081	6.93e-09	-0.10239	31	0.016838	yes	PRSTTE
chr1_2351215_T_G_b38	MORN1	-5.346	2.68e-07	-0.114808	7	0.021474	yes	PRSTTE
chr1_2354645_C_T_b38	MORN1	-5.346	2.68e-07	-0.114808	7	0.021474	yes	PRSTTE
chr1_2354688_G_C_b38	MORN1	-5.346	2.68e-07	-0.114808	7	0.021474	yes	PRSTTE
chr1_2362229_A_G_b38	MORN1	-5.346	2.68e-07	-0.114808	7	0.021474	yes	PRSTTE
chr1_2348393_G_A_b38	MORN1	-5.294	3.44e-07	-0.106151	9	0.020052	yes	PRSTTE
chr1_2350750_AGGGGTGGCACG_A_b38	MORN1	-5.23	4.66e-07	-0.106213	8	0.02031	yes	PRSTTE
chr1_2366021_T_C_b38	MORN1	-5.215	4.99e-07	-0.082558	53	0.015831	yes	PRSTTE
chr1_2347212_C_T_b38	MORN1	-5.046	1.09e-06	-0.106948	7	0.021197	yes	PRSTTE
chr1_2364657_A_T_b38	MORN1	-5.038	1.14e-06	-0.080761	54	0.016032	yes	PRSTTE
chr1_2364658_A_T_b38	MORN1	-5.038	1.14e-06	-0.080761	54	0.016032	yes	PRSTTE
chr1_2342133_C_G_b38	MORN1	-4.96	1.61e-06	-0.114644	4	0.023111	yes	PRSTTE
chr1_2342137_G_A_b38	MORN1	-4.96	1.61e-06	-0.114644	4	0.023111	yes	PRSTTE
chr1_2346801_C_T_b38	MORN1	-4.922	1.92e-06	-0.078564	57	0.015961	yes	PRSTTE
chr1_2369713_ATAAT_A_b38	MORN1	-4.902	2.1e-06	-0.104131	8	0.021242	yes	PRSTTE
chr1_2350539_T_G_b38	MORN1	-4.887	2.25e-06	-0.078188	58	0.015999	yes	PRSTTE
chr1_2362863_C_CA_b38	MORN1	-4.842	2.75e-06	-0.109277	5	0.022569	yes	PRSTTE
chr1_2349222_G_A_b38	MORN1	-4.787	3.51e-06	-0.076216	57	0.015921	yes	PRSTTE
chr1_2351678_C_T_b38	MORN1	-4.683	5.54e-06	-0.101782	6	0.021735	yes	PRSTTE
chr1_2346111_G_C_b38	MORN1	-4.544	1.01e-05	-0.074467	47	0.016389	yes	PRSTTE
chr1_2369336_A_G_b38	MORN1	-4.48	1.32e-05	-0.095746	7	0.021374	yes	PRSTTE
chr1_2353459_T_G_b38	MORN1	4.332	2.45e-05	0.066758	55	0.015412	yes	PRSTTE
chr1_2356177_T_C_b38	MORN1	4.332	2.45e-05	0.066758	55	0.015412	yes	PRSTTE
chr1_2298478_C_T_b38	MORN1	-4.32	2.56e-05	-0.095667	8	0.022143	yes	PRSTTE
chr1_2297717_C_T_b38	MORN1	-4.242	3.53e-05	-0.095145	8	0.02243	yes	PRSTTE
chr1_2302601_CAGG_C_b38	MORN1	-4.197	4.24e-05	-0.098071	6	0.023369	yes	PRSTTE
chr1_2303193_G_A_b38	MORN1	-4.197	4.24e-05	-0.098071	6	0.023369	yes	PRSTTE
chr1_2302522_G_A_b38	MORN1	-4.12	5.77e-05	-0.095656	6	0.02322	yes	PRSTTE
chr1_2357308_T_C_b38	MORN1	4.102	6.18e-05	0.063871	58	0.015571	yes	PRSTTE
chr1_2341705_A_G_b38	MORN1	4.09	6.49e-05	0.067674	45	0.016548	yes	PRSTTE
chr1_2367644_G_A_b38	MORN1	-3.978	0.000101	-0.070279	29	0.017668	yes	PRSTTE
chr1_2304900_T_C_b38	MORN1	-3.863	0.000156	-0.088103	6	0.022805	yes	PRSTTE
chr1_2300527_G_C_b38	MORN1	-3.719	0.000266	-0.08603	6	0.02313	yes	PRSTTE
chr1_2338659_A_G_b38	MORN1	3.604	0.000404	0.061479	42	0.017057	yes	PRSTTE
chr1_2304217_G_A_b38	MORN1	-3.545	5e-04	-0.088211	5	0.024885	yes	PRSTTE
chr1_2344932_C_A_b38	MORN1	-3.475	0.000639	-0.076982	6	0.022152	yes	PRSTTE
chr1_2353047_C_T_b38	MORN1	-3.475	0.000639	-0.076982	6	0.022152	yes	PRSTTE
chr1_2369118_G_A_b38	MORN1	-3.308	0.00113	-0.068299	11	0.020645	yes	PRSTTE
chr1_2346676_G_C_b38	MORN1	-3.307	0.00114	-0.072637	6	0.021967	yes	PRSTTE
chr1_2350287_A_C_b38	MORN1	-3.307	0.00114	-0.072637	6	0.021967	yes	PRSTTE
chr1_2362718_G_A_b38	MORN1	3.298	0.00117	0.060308	22	0.018284	yes	PRSTTE
chr1_2369355_G_GA_b38	MORN1	-3.26	0.00133	-0.068512	15	0.021016	yes	PRSTTE
chr1_2345829_C_CCACACA_b38	MORN1	-3.235	0.00145	-0.089387	3	0.027635	yes	PRSTTE
chr1_2350696_G_A_b38	MORN1	3.162	0.00184	0.057546	23	0.018202	yes	PRSTTE
chr1_2357811_C_G_b38	MORN1	-3.133	0.00202	-0.069839	6	0.022288	yes	PRSTTE
chr1_2357812_T_C_b38	MORN1	-3.133	0.00202	-0.069839	6	0.022288	yes	PRSTTE
chr1_2359828_A_G_b38	MORN1	-3.133	0.00202	-0.069839	6	0.022288	yes	PRSTTE
chr1_2363591_T_G_b38	MORN1	-3.133	0.00202	-0.069839	6	0.022288	yes	PRSTTE
chr1_2367871_C_T_b38	MORN1	-3.133	0.00202	-0.069839	6	0.022288	yes	PRSTTE
chr1_2348378_C_T_b38	MORN1	3.085	0.00236	0.056683	22	0.018375	yes	PRSTTE
chr1_2356409_G_C_b38	MORN1	2.996	0.00312	0.054173	25	0.018081	yes	PRSTTE
chr1_2126311_A_C_b38	MORN1	-2.946	0.00364	-0.073488	4	0.024943	yes	PRSTTE
chr1_2126584_A_G_b38	MORN1	-2.946	0.00364	-0.073488	4	0.024943	yes	PRSTTE
chr1_2129937_T_C_b38	MORN1	-2.946	0.00364	-0.073488	4	0.024943	yes	PRSTTE
chr1_2364499_A_G_b38	MORN1	2.923	0.0039	0.052808	25	0.018064	yes	PRSTTE
chr1_2360913_G_A_b38	MORN1	2.891	0.0043	0.056081	19	0.019396	yes	PRSTTE
chr1_2364484_C_T_b38	MORN1	-2.785	0.00593	-0.062829	6	0.022561	yes	PRSTTE
chr1_2365220_A_G_b38	MORN1	-2.76	0.00637	-0.065096	4	0.023583	yes	PRSTTE
chr1_2359882_C_CAA_b38	MORN1	2.753	0.0065	0.055988	12	0.020334	yes	PRSTTE
chr1_2121058_T_C_b38	MORN1	-2.746	0.00664	-0.07061	4	0.025713	yes	PRSTTE
chr1_2364412_G_GTTGT_b38	MORN1	-2.716	0.00726	-0.052097	18	0.019184	yes	PRSTTE
chr1_2346388_G_A_b38	MORN1	-2.704	0.0075	-0.056719	11	0.020973	yes	PRSTTE
chr1_2348984_A_C_b38	MORN1	-2.704	0.0075	-0.056719	11	0.020973	yes	PRSTTE
chr1_2351337_G_C_b38	MORN1	-2.704	0.0075	-0.056719	11	0.020973	yes	PRSTTE
chr1_2352564_T_C_b38	MORN1	-2.704	0.0075	-0.056719	11	0.020973	yes	PRSTTE
chr1_2353975_G_A_b38	MORN1	-2.704	0.0075	-0.056719	11	0.020973	yes	PRSTTE
chr1_2355508_A_G_b38	MORN1	-2.704	0.0075	-0.056719	11	0.020973	yes	PRSTTE
chr1_2356078_T_C_b38	MORN1	-2.704	0.0075	-0.056719	11	0.020973	yes	PRSTTE
chr1_2305809_A_G_b38	MORN1	-2.681	0.00802	-0.056769	7	0.021174	yes	PRSTTE
chr1_2364506_G_A_b38	MORN1	-2.68	0.00804	-0.05438	12	0.020289	yes	PRSTTE
chr1_1563537_C_CA_b38	MORN1	-2.657	0.00859	-0.061978	10	0.023326	yes	PRSTTE
chr1_2344256_A_T_b38	MORN1	2.655	0.00864	0.050989	15	0.019205	yes	PRSTTE
chr1_2380956_C_T_b38	MORN1	-2.636	0.00911	-0.056426	8	0.021405	yes	PRSTTE
chr1_2382101_A_G_b38	MORN1	-2.636	0.00911	-0.056426	8	0.021405	yes	PRSTTE
chr1_2359221_T_C_b38	MORN1	-2.635	0.00915	-0.054532	12	0.020696	yes	PRSTTE
chr1_2113103_T_C_b38	MORN1	-2.61	0.00982	-0.044202	34	0.016937	yes	PRSTTE
chr1_2114443_A_G_b38	MORN1	-2.61	0.00982	-0.044202	34	0.016937	yes	PRSTTE
chr1_2115347_G_A_b38	MORN1	-2.61	0.00982	-0.044202	34	0.016937	yes	PRSTTE
chr1_2115499_G_T_b38	MORN1	-2.61	0.00982	-0.044202	34	0.016937	yes	PRSTTE
chr1_2183219_A_AGTCTCC_b38	MORN1	2.606	0.00992	0.042773	41	0.016412	yes	PRSTTE
chr1_2347542_C_T_b38	MORN1	-5.014	1.26e-06	-0.083142	44	0.016581	no	PRSTTE
chr1_2360716_T_C_b38	MORN1	4.268	3.18e-05	0.066554	55	0.015594	no	PRSTTE
chr1_2360970_T_C_b38	MORN1	4.268	3.18e-05	0.066554	55	0.015594	no	PRSTTE
chr1_2361332_A_AG_b38	MORN1	4.268	3.18e-05	0.066554	55	0.015594	no	PRSTTE
chr1_2361548_A_ACT_b38	MORN1	4.268	3.18e-05	0.066554	55	0.015594	no	PRSTTE
chr1_2359472_G_A_b38	MORN1	4.182	4.5e-05	0.065875	38	0.015752	no	PRSTTE
chr1_2352403_G_T_b38	MORN1	4.161	4.9e-05	0.064618	54	0.015531	no	PRSTTE
chr1_2352457_A_G_b38	MORN1	4.107	6.06e-05	0.064035	55	0.015592	no	PRSTTE
chr1_2358849_T_C_b38	MORN1	4.099	6.25e-05	0.063547	56	0.015502	no	PRSTTE
chr1_2363405_C_T_b38	MORN1	3.489	0.000609	0.062672	25	0.017964	no	PRSTTE
chr1_2337352_A_G_b38	MORN1	3.482	0.000625	0.060099	30	0.017262	no	PRSTTE
chr1_2340425_C_T_b38	MORN1	-3.288	0.00121	-0.052376	46	0.015928	no	PRSTTE
chr1_2197209_G_A_b38	MORN1	3.285	0.00122	0.086207	4	0.026243	no	PRSTTE
chr1_2197362_G_C_b38	MORN1	3.285	0.00122	0.086207	4	0.026243	no	PRSTTE
chr1_2197378_G_GA_b38	MORN1	3.285	0.00122	0.086207	4	0.026243	no	PRSTTE
chr1_2197391_G_A_b38	MORN1	3.285	0.00122	0.086207	4	0.026243	no	PRSTTE
chr1_2160844_C_T_b38	MORN1	3.245	0.0014	0.079666	4	0.024551	no	PRSTTE
chr1_2353743_A_T_b38	MORN1	3.216	0.00154	0.057743	27	0.017955	no	PRSTTE
chr1_2175551_ACTCCAACCCCTACACCCCCAACCC_A_b38	MORN1	3.191	0.00167	0.08453	4	0.026492	no	PRSTTE
chr1_2138661_C_T_b38	MORN1	3.188	0.00169	0.079762	4	0.02502	no	PRSTTE
chr1_2140299_C_T_b38	MORN1	3.188	0.00169	0.079762	4	0.02502	no	PRSTTE
chr1_2207111_G_C_b38	MORN1	3.152	0.0019	0.082988	4	0.026328	no	PRSTTE
chr1_2151390_G_A_b38	MORN1	3.143	0.00195	0.082261	4	0.026171	no	PRSTTE
chr1_2164950_A_C_b38	MORN1	3.143	0.00195	0.082261	4	0.026171	no	PRSTTE
chr1_2174439_G_A_b38	MORN1	3.143	0.00195	0.082261	4	0.026171	no	PRSTTE
chr1_2116145_T_C_b38	MORN1	-3.139	0.00198	-0.078864	4	0.025124	no	PRSTTE
chr1_2166847_C_T_b38	MORN1	3.13	0.00204	0.077404	4	0.024728	no	PRSTTE
chr1_2342999_A_G_b38	MORN1	-3.112	0.00216	-0.059842	13	0.019231	no	PRSTTE
chr1_2142665_G_T_b38	MORN1	3.111	0.00216	0.07557	4	0.024288	no	PRSTTE
chr1_2145827_G_A_b38	MORN1	3.111	0.00216	0.07557	4	0.024288	no	PRSTTE
chr1_2141345_CTTTTTT_C_b38	MORN1	3.086	0.00235	0.080957	4	0.026234	no	PRSTTE
chr1_2164801_G_C_b38	MORN1	3.086	0.00235	0.076907	4	0.024924	no	PRSTTE
chr1_2164982_T_C_b38	MORN1	3.086	0.00235	0.076907	4	0.024924	no	PRSTTE
chr1_2165199_C_T_b38	MORN1	3.086	0.00235	0.076907	4	0.024924	no	PRSTTE
chr1_2166938_G_C_b38	MORN1	3.086	0.00235	0.076907	4	0.024924	no	PRSTTE
chr1_2167392_G_C_b38	MORN1	3.086	0.00235	0.076907	4	0.024924	no	PRSTTE
chr1_2144375_C_T_b38	MORN1	3.064	0.00252	0.074912	4	0.024451	no	PRSTTE
chr1_2151066_C_T_b38	MORN1	3.064	0.00252	0.074912	4	0.024451	no	PRSTTE
chr1_2155277_GTGA_G_b38	MORN1	3.064	0.00252	0.074912	4	0.024451	no	PRSTTE
chr1_2156118_T_C_b38	MORN1	3.064	0.00252	0.074912	4	0.024451	no	PRSTTE
chr1_2157493_C_T_b38	MORN1	3.064	0.00252	0.074912	4	0.024451	no	PRSTTE
chr1_2337299_A_G_b38	MORN1	3.063	0.00253	0.052081	28	0.017003	no	PRSTTE
chr1_3165572_G_C_b38	MORN1	-3.059	0.00256	-0.09716	5	0.03176	no	PRSTTE
chr1_2137041_C_T_b38	MORN1	-3.052	0.00262	-0.050588	29	0.016576	no	PRSTTE
chr1_1685108_CA_C_b38	MORN1	-3.048	0.00265	-0.060629	20	0.019892	no	PRSTTE
chr1_1588141_C_CA_b38	MORN1	-3.024	0.00285	-0.125822	3	0.041603	no	PRSTTE
chr1_2181138_C_A_b38	MORN1	3.02	0.0029	0.050226	29	0.016632	no	PRSTTE
chr1_2044256_TAC_T_b38	MORN1	-2.975	0.00333	-0.060816	10	0.020445	no	PRSTTE
chr1_2370170_G_T_b38	MORN1	-2.954	0.00356	-0.052394	20	0.017739	no	PRSTTE
chr1_2750720_C_A_b38	MORN1	2.872	0.00457	0.064425	7	0.022433	no	PRSTTE
chr1_2367055_C_A_b38	MORN1	2.871	0.00457	0.055037	15	0.019167	no	PRSTTE
chr1_2150203_C_A_b38	MORN1	2.856	0.0048	0.069758	6	0.024428	no	PRSTTE
chr1_2169620_C_G_b38	MORN1	2.85	0.00488	0.069448	4	0.024366	no	PRSTTE
chr1_2196630_A_G_b38	MORN1	2.842	0.005	0.064412	10	0.022667	no	PRSTTE
chr1_2175616_T_C_b38	MORN1	2.804	0.00559	0.071271	4	0.025414	no	PRSTTE
chr1_2106495_A_G_b38	MORN1	-2.801	0.00564	-0.078652	4	0.028076	no	PRSTTE
chr1_2344980_A_G_b38	MORN1	2.779	0.00603	0.05395	14	0.019415	no	PRSTTE
chr1_2345774_T_C_b38	MORN1	2.779	0.00603	0.05395	14	0.019415	no	PRSTTE
chr1_2210401_C_A_b38	MORN1	2.769	0.0062	0.063206	11	0.022824	no	PRSTTE
chr1_2160238_C_CGTGTGTGT_b38	MORN1	2.765	0.00627	0.068961	5	0.024937	no	PRSTTE
chr1_2186119_C_T_b38	MORN1	2.733	0.0069	0.067856	5	0.024829	no	PRSTTE
chr1_2205698_G_A_b38	MORN1	2.73	0.00697	0.063319	10	0.023197	no	PRSTTE
chr1_2205151_C_A_b38	MORN1	2.716	0.00724	0.078467	6	0.028887	no	PRSTTE
chr1_2204887_GCCCTCAAGCCCCGC_G_b38	MORN1	2.689	0.00783	0.064567	8	0.024008	no	PRSTTE
chr1_2342734_T_C_b38	MORN1	-2.686	0.0079	-0.054838	9	0.020416	no	PRSTTE
chr1_2344634_T_C_b38	MORN1	2.681	0.00803	0.052588	14	0.019618	no	PRSTTE
chr1_2344757_C_A_b38	MORN1	2.681	0.00803	0.052588	14	0.019618	no	PRSTTE
chr1_2344761_T_A_b38	MORN1	2.681	0.00803	0.052588	14	0.019618	no	PRSTTE
chr1_2345727_G_A_b38	MORN1	2.681	0.00803	0.052588	14	0.019618	no	PRSTTE
chr1_2350934_C_T_b38	MORN1	2.681	0.00803	0.052588	14	0.019618	no	PRSTTE
chr1_2105158_G_T_b38	MORN1	-2.68	0.00803	-0.067668	4	0.025245	no	PRSTTE
chr1_2111555_C_G_b38	MORN1	-2.644	0.00891	-0.06741	4	0.025496	no	PRSTTE
chr1_2351551_C_T_b38	MORN1	2.628	0.00932	0.051604	14	0.019634	no	PRSTTE
chr1_2356095_C_T_b38	MORN1	2.628	0.00932	0.051604	14	0.019634	no	PRSTTE
chr1_2357882_G_A_b38	MORN1	2.628	0.00932	0.051604	14	0.019634	no	PRSTTE
chr1_2118069_G_T_b38	MORN1	-2.619	0.00958	-0.043917	36	0.016772	no	PRSTTE
chr1_2193733_G_A_b38	MORN1	2.615	0.00969	0.060038	11	0.022963	no	PRSTTE
chr1_2364339_A_C_b38	MORN1	-8.764	3.97e-17	-0.062417	67	0.007122	yes	SKINNS
chr1_2366816_A_G_b38	MORN1	-8.646	9.69e-17	-0.06209	65	0.007182	yes	SKINNS
chr1_2366555_G_C_b38	MORN1	-8.399	6.05e-16	-0.061089	63	0.007273	yes	SKINNS
chr1_2366496_A_T_b38	MORN1	-8.37	7.47e-16	-0.06107	62	0.007296	yes	SKINNS
chr1_2366243_C_T_b38	MORN1	-8.359	8.11e-16	-0.061553	60	0.007364	yes	SKINNS
chr1_2368939_G_C_b38	MORN1	-8.313	1.14e-15	-0.060766	62	0.00731	yes	SKINNS
chr1_2363829_A_T_b38	MORN1	-8.305	1.21e-15	-0.058479	64	0.007041	yes	SKINNS
chr1_2368188_T_C_b38	MORN1	-8.299	1.26e-15	-0.058903	72	0.007098	yes	SKINNS
chr1_2367872_A_G_b38	MORN1	-8.288	1.36e-15	-0.058909	72	0.007107	yes	SKINNS
chr1_2367799_C_T_b38	MORN1	-8.273	1.52e-15	-0.060506	62	0.007314	yes	SKINNS
chr1_2367197_G_A_b38	MORN1	-8.11	4.94e-15	-0.059341	61	0.007317	yes	SKINNS
chr1_2352756_T_C_b38	MORN1	-8.035	8.48e-15	-0.059048	63	0.007349	yes	SKINNS
chr1_2368718_C_A_b38	MORN1	-7.991	1.15e-14	-0.058764	61	0.007354	yes	SKINNS
chr1_2368473_T_C_b38	MORN1	-7.97	1.34e-14	-0.057175	76	0.007174	yes	SKINNS
chr1_2365333_G_A_b38	MORN1	-7.949	1.56e-14	-0.058042	61	0.007302	yes	SKINNS
chr1_2366956_CAAAATACATAGA_C_b38	MORN1	-7.83	3.6e-14	-0.055982	69	0.00715	yes	SKINNS
chr1_2365236_C_T_b38	MORN1	-7.676	1.05e-13	-0.056228	62	0.007325	yes	SKINNS
chr1_2367456_C_CAA_b38	MORN1	-7.468	4.33e-13	-0.057914	49	0.007755	yes	SKINNS
chr1_2343517_G_A_b38	MORN1	-7.305	1.29e-12	-0.056443	53	0.007726	yes	SKINNS
chr1_2351241_C_T_b38	MORN1	-7.206	2.47e-12	-0.054486	60	0.007561	yes	SKINNS
chr1_2343699_C_T_b38	MORN1	-7.205	2.5e-12	-0.055549	53	0.00771	yes	SKINNS
chr1_2369210_C_T_b38	MORN1	-6.812	3.12e-11	-0.048953	77	0.007186	yes	SKINNS
chr1_2348700_C_T_b38	MORN1	-6.75	4.61e-11	-0.05214	54	0.007724	yes	SKINNS
chr1_2360716_T_C_b38	MORN1	6.353	5.21e-10	0.045717	114	0.007196	yes	SKINNS
chr1_2360970_T_C_b38	MORN1	6.353	5.21e-10	0.045717	114	0.007196	yes	SKINNS
chr1_2361332_A_AG_b38	MORN1	6.353	5.21e-10	0.045717	114	0.007196	yes	SKINNS
chr1_2361548_A_ACT_b38	MORN1	6.353	5.21e-10	0.045717	114	0.007196	yes	SKINNS
chr1_2358849_T_C_b38	MORN1	6.304	6.98e-10	0.045159	115	0.007164	yes	SKINNS
chr1_2352457_A_G_b38	MORN1	6.265	8.78e-10	0.04512	115	0.007202	yes	SKINNS
chr1_2353459_T_G_b38	MORN1	6.127	1.97e-09	0.044092	114	0.007197	yes	SKINNS
chr1_2356177_T_C_b38	MORN1	6.127	1.97e-09	0.044092	114	0.007197	yes	SKINNS
chr1_2352403_G_T_b38	MORN1	6.118	2.07e-09	0.043792	114	0.007157	yes	SKINNS
chr1_2340787_C_T_b38	MORN1	-5.802	1.24e-08	-0.044663	45	0.007698	yes	SKINNS
chr1_2357308_T_C_b38	MORN1	5.618	3.41e-08	0.041016	120	0.007301	yes	SKINNS
chr1_2348393_G_A_b38	MORN1	-5.268	2.15e-07	-0.045843	25	0.008703	yes	SKINNS
chr1_2359472_G_A_b38	MORN1	5.168	3.57e-07	0.037537	81	0.007263	yes	SKINNS
chr1_2366021_T_C_b38	MORN1	-5.091	5.25e-07	-0.036892	109	0.007246	yes	SKINNS
chr1_2350750_AGGGGTGGCACG_A_b38	MORN1	-4.997	8.36e-07	-0.04231	29	0.008466	yes	SKINNS
chr1_2364657_A_T_b38	MORN1	-4.995	8.45e-07	-0.035857	114	0.007178	yes	SKINNS
chr1_2364658_A_T_b38	MORN1	-4.995	8.45e-07	-0.035857	114	0.007178	yes	SKINNS
chr1_2343937_T_G_b38	MORN1	-4.945	1.08e-06	-0.037688	84	0.007621	yes	SKINNS
chr1_2369713_ATAAT_A_b38	MORN1	-4.673	3.94e-06	-0.044721	16	0.00957	yes	SKINNS
chr1_2362863_C_CA_b38	MORN1	-4.65	4.38e-06	-0.043474	20	0.009349	yes	SKINNS
chr1_2354688_G_C_b38	MORN1	-4.582	5.98e-06	-0.041738	23	0.009109	yes	SKINNS
chr1_2362229_A_G_b38	MORN1	-4.579	6.06e-06	-0.041481	24	0.009059	yes	SKINNS
chr1_2354645_C_T_b38	MORN1	-4.543	7.16e-06	-0.041344	23	0.009101	yes	SKINNS
chr1_2351215_T_G_b38	MORN1	-4.526	7.73e-06	-0.041129	23	0.009088	yes	SKINNS
chr1_2351678_C_T_b38	MORN1	-4.29	2.19e-05	-0.039095	23	0.009113	yes	SKINNS
chr1_2338659_A_G_b38	MORN1	4.109	4.74e-05	0.02941	110	0.007158	yes	SKINNS
chr1_2392569_C_T_b38	MORN1	-4.067	5.63e-05	-0.0361	21	0.008877	yes	SKINNS
chr1_2370170_G_T_b38	MORN1	-4.038	6.35e-05	-0.032719	34	0.008103	yes	SKINNS
chr1_2367644_G_A_b38	MORN1	-4.002	7.34e-05	-0.030659	67	0.00766	yes	SKINNS
chr1_2347212_C_T_b38	MORN1	-3.975	8.2e-05	-0.035798	22	0.009005	yes	SKINNS
chr1_2758226_C_G_b38	MORN1	-3.955	8.9e-05	-0.077203	4	0.019521	yes	SKINNS
chr1_2350287_A_C_b38	MORN1	-3.946	9.23e-05	-0.039021	14	0.009889	yes	SKINNS
chr1_2350539_T_G_b38	MORN1	-3.924	0.000101	-0.028816	110	0.007344	yes	SKINNS
chr1_2344932_C_A_b38	MORN1	-3.921	0.000102	-0.038763	14	0.009887	yes	SKINNS
chr1_2346676_G_C_b38	MORN1	-3.919	0.000103	-0.038877	14	0.00992	yes	SKINNS
chr1_2364499_A_G_b38	MORN1	3.896	0.000113	0.030953	49	0.007945	yes	SKINNS
chr1_2357811_C_G_b38	MORN1	-3.895	0.000113	-0.038132	14	0.00979	yes	SKINNS
chr1_2357812_T_C_b38	MORN1	-3.895	0.000113	-0.038132	14	0.00979	yes	SKINNS
chr1_2359828_A_G_b38	MORN1	-3.895	0.000113	-0.038132	14	0.00979	yes	SKINNS
chr1_2363591_T_G_b38	MORN1	-3.895	0.000113	-0.038132	14	0.00979	yes	SKINNS
chr1_2367871_C_T_b38	MORN1	-3.895	0.000113	-0.038132	14	0.00979	yes	SKINNS
chr1_2353743_A_T_b38	MORN1	3.865	0.000127	0.031873	54	0.008246	yes	SKINNS
chr1_2369187_T_TA_b38	MORN1	3.861	0.00013	0.065402	8	0.016941	yes	SKINNS
chr1_2353047_C_T_b38	MORN1	-3.86	0.00013	-0.03818	14	0.009892	yes	SKINNS
chr1_2342133_C_G_b38	MORN1	-3.761	0.000192	-0.03558	19	0.009461	yes	SKINNS
chr1_2342137_G_A_b38	MORN1	-3.761	0.000192	-0.03558	19	0.009461	yes	SKINNS
chr1_2347542_C_T_b38	MORN1	-3.699	0.000244	-0.02756	94	0.007451	yes	SKINNS
chr1_2341705_A_G_b38	MORN1	3.663	0.000279	0.026753	120	0.007304	yes	SKINNS
chr1_2356409_G_C_b38	MORN1	3.58	0.000381	0.029434	46	0.008222	yes	SKINNS
chr1_2365220_A_G_b38	MORN1	-3.399	0.000737	-0.034232	12	0.010071	yes	SKINNS
chr1_2351874_C_G_b38	MORN1	3.371	0.000815	0.032955	14	0.009777	yes	SKINNS
chr1_2354291_A_G_b38	MORN1	3.36	0.000848	0.032917	14	0.009798	yes	SKINNS
chr1_2350943_C_T_b38	MORN1	3.288	0.00109	0.032112	14	0.009766	yes	SKINNS
chr1_2350540_T_C_b38	MORN1	3.254	0.00123	0.03171	14	0.009746	yes	SKINNS
chr1_2348949_CCT_C_b38	MORN1	3.233	0.00132	0.031554	14	0.009761	yes	SKINNS
chr1_2367055_C_A_b38	MORN1	3.172	0.00162	0.027815	26	0.008768	yes	SKINNS
chr1_2345557_C_T_b38	MORN1	3.118	0.00194	0.030108	14	0.009655	yes	SKINNS
chr1_2359882_C_CAA_b38	MORN1	3.102	0.00205	0.029878	20	0.009633	yes	SKINNS
chr1_2581432_CAA_C_b38	MORN1	-3.059	0.00235	-0.041896	5	0.013694	yes	SKINNS
chr1_1707634_A_T_b38	MORN1	3.029	0.0026	0.045518	13	0.015029	yes	SKINNS
chr1_2090659_G_A_b38	MORN1	-3.024	0.00264	-0.028362	20	0.00938	yes	SKINNS
chr1_2091118_G_A_b38	MORN1	-3.024	0.00264	-0.028362	20	0.00938	yes	SKINNS
chr1_2091238_C_T_b38	MORN1	-3.024	0.00264	-0.028362	20	0.00938	yes	SKINNS
chr1_3313405_G_A_b38	MORN1	-3.01	0.00276	-0.03843	3	0.012768	yes	SKINNS
chr1_2345849_ACACACAG_A_b38	MORN1	3.001	0.00284	0.027926	18	0.009307	yes	SKINNS
chr1_2337299_A_G_b38	MORN1	2.932	0.00354	0.021578	77	0.007359	yes	SKINNS
chr1_3311588_T_G_b38	MORN1	-2.919	0.00369	-0.037386	3	0.012808	yes	SKINNS
chr1_3311597_C_T_b38	MORN1	-2.919	0.00369	-0.037386	3	0.012808	yes	SKINNS
chr1_3312219_G_T_b38	MORN1	-2.919	0.00369	-0.037386	3	0.012808	yes	SKINNS
chr1_3312621_G_A_b38	MORN1	-2.919	0.00369	-0.037386	3	0.012808	yes	SKINNS
chr1_3312694_A_G_b38	MORN1	-2.919	0.00369	-0.037386	3	0.012808	yes	SKINNS
chr1_3313956_T_C_b38	MORN1	-2.919	0.00369	-0.037386	3	0.012808	yes	SKINNS
chr1_1704961_G_A_b38	MORN1	2.899	0.00393	0.039002	11	0.013455	yes	SKINNS
chr1_3314073_G_GGGGGT_b38	MORN1	-2.893	0.004	-0.034363	10	0.011878	yes	SKINNS
chr1_2981286_GC_G_b38	MORN1	2.89	0.00404	0.058469	7	0.020232	yes	SKINNS
chr1_2364608_C_A_b38	MORN1	2.887	0.00407	0.049514	8	0.017148	yes	SKINNS
chr1_1707744_A_G_b38	MORN1	2.868	0.00432	0.039063	14	0.013619	yes	SKINNS
chr1_1708248_G_A_b38	MORN1	2.86	0.00444	0.040654	10	0.014215	yes	SKINNS
chr1_2364484_C_T_b38	MORN1	-2.836	0.00478	-0.028058	17	0.009895	yes	SKINNS
chr1_2142322_CAGCAGCCGAAGCGCCTCCTTTCAATCCAGGGTCCACACATCCAGCAGCCGAAGCGCCCTCCTTTCAATCCAGGGTCCAGGCATCT_C_b38	MORN1	2.835	0.0048	0.044248	8	0.01561	yes	SKINNS
chr1_1707714_C_G_b38	MORN1	2.826	0.00493	0.039535	12	0.01399	yes	SKINNS
chr1_1707716_T_C_b38	MORN1	2.826	0.00493	0.039535	12	0.01399	yes	SKINNS
chr1_3310922_A_G_b38	MORN1	-2.803	0.00528	-0.036035	3	0.012854	yes	SKINNS
chr1_3015583_T_C_b38	MORN1	-2.797	0.00538	-0.027841	20	0.009953	yes	SKINNS
chr1_2357882_G_A_b38	MORN1	2.795	0.00541	0.025299	24	0.00905	yes	SKINNS
chr1_1704673_G_A_b38	MORN1	2.795	0.00542	0.036728	15	0.013142	yes	SKINNS
chr1_1704916_A_G_b38	MORN1	2.783	0.00561	0.032761	16	0.01177	yes	SKINNS
chr1_1708001_A_T_b38	MORN1	2.779	0.00568	0.03929	10	0.014139	yes	SKINNS
chr1_1874605_TA_T_b38	MORN1	2.778	0.0057	0.036747	10	0.013228	yes	SKINNS
chr1_2356095_C_T_b38	MORN1	2.777	0.00572	0.025235	24	0.009087	yes	SKINNS
chr1_3017169_G_C_b38	MORN1	-2.769	0.00586	-0.052549	7	0.018977	yes	SKINNS
chr1_3017189_A_G_b38	MORN1	-2.769	0.00586	-0.052549	7	0.018977	yes	SKINNS
chr1_1708131_C_T_b38	MORN1	2.742	0.00634	0.038753	11	0.014131	yes	SKINNS
chr1_2845230_A_AACAAAACAAAAC_b38	MORN1	-2.742	0.00636	-0.032764	7	0.011951	yes	SKINNS
chr1_2337352_A_G_b38	MORN1	2.734	0.00651	0.020167	86	0.007377	yes	SKINNS
chr1_2092625_C_T_b38	MORN1	-2.71	0.00699	-0.025331	20	0.009348	yes	SKINNS
chr1_3014763_C_A_b38	MORN1	-2.706	0.00706	-0.027151	25	0.010032	yes	SKINNS
chr1_1706210_G_A_b38	MORN1	2.668	0.0079	0.035071	15	0.013144	yes	SKINNS
chr1_1706488_C_G_b38	MORN1	2.668	0.0079	0.035071	15	0.013144	yes	SKINNS
chr1_2296236_A_C_b38	MORN1	-2.656	0.00819	-0.036882	4	0.013887	yes	SKINNS
chr1_1634663_C_G_b38	MORN1	-2.65	0.00833	-0.031009	19	0.0117	yes	SKINNS
chr1_2351277_T_TA_b38	MORN1	2.648	0.00837	0.030498	8	0.011516	yes	SKINNS
chr1_3310983_G_A_b38	MORN1	-2.644	0.00849	-0.033753	3	0.012768	yes	SKINNS
chr1_1510841_C_T_b38	MORN1	2.642	0.00853	0.034127	4	0.012917	yes	SKINNS
chr1_2683370_T_C_b38	MORN1	-2.615	0.00922	-0.027525	4	0.010525	yes	SKINNS
chr1_3310606_A_C_b38	MORN1	-2.602	0.00958	-0.033437	3	0.012852	yes	SKINNS
chr1_2360913_G_A_b38	MORN1	4.893	1.39e-06	0.042746	32	0.008736	no	SKINNS
chr1_2369336_A_G_b38	MORN1	-4.771	2.49e-06	-0.045682	18	0.009575	no	SKINNS
chr1_2363405_C_T_b38	MORN1	4.605	5.4e-06	0.037323	48	0.008105	no	SKINNS
chr1_2380956_C_T_b38	MORN1	-4.352	1.68e-05	-0.039402	20	0.009055	no	SKINNS
chr1_2382101_A_G_b38	MORN1	-4.352	1.68e-05	-0.039402	20	0.009055	no	SKINNS
chr1_2369355_G_GA_b38	MORN1	-4.3	2.1e-05	-0.034715	47	0.008073	no	SKINNS
chr1_2362718_G_A_b38	MORN1	4.253	2.58e-05	0.034553	41	0.008125	no	SKINNS
chr1_2344761_T_C_b38	MORN1	4.155	3.9e-05	0.036227	36	0.008719	no	SKINNS
chr1_2349222_G_A_b38	MORN1	-4.078	5.38e-05	-0.030341	127	0.00744	no	SKINNS
chr1_2346801_C_T_b38	MORN1	-3.965	8.54e-05	-0.029628	127	0.007472	no	SKINNS
chr1_2348378_C_T_b38	MORN1	3.729	0.000217	0.031189	38	0.008365	no	SKINNS
chr1_2350696_G_A_b38	MORN1	3.729	0.000217	0.031189	38	0.008365	no	SKINNS
chr1_2366312_C_T_b38	MORN1	3.563	0.000406	0.034752	15	0.009753	no	SKINNS
chr1_2345148_G_A_b38	MORN1	-3.548	0.00043	-0.041485	6	0.011694	no	SKINNS
chr1_2347995_C_T_b38	MORN1	3.449	0.000615	0.033744	14	0.009783	no	SKINNS
chr1_2358041_A_G_b38	MORN1	3.419	0.000686	0.033858	13	0.009902	no	SKINNS
chr1_2348703_A_G_b38	MORN1	3.368	0.000823	0.033268	14	0.009878	no	SKINNS
chr1_2357096_C_G_b38	MORN1	3.348	0.000884	0.032416	15	0.009683	no	SKINNS
chr1_2358817_G_A_b38	MORN1	3.334	0.000927	0.033099	13	0.009927	no	SKINNS
chr1_2361249_C_G_b38	MORN1	3.31	0.00101	0.032939	13	0.009951	no	SKINNS
chr1_2354969_C_T_b38	MORN1	3.301	0.00104	0.032886	13	0.009963	no	SKINNS
chr1_2355671_C_T_b38	MORN1	3.301	0.00104	0.032886	13	0.009963	no	SKINNS
chr1_2356158_C_T_b38	MORN1	3.301	0.00104	0.032886	13	0.009963	no	SKINNS
chr1_2369118_G_A_b38	MORN1	-3.296	0.00106	-0.029107	27	0.00883	no	SKINNS
chr1_2357413_G_A_b38	MORN1	3.29	0.00108	0.03263	13	0.009919	no	SKINNS
chr1_2919534_C_T_b38	MORN1	3.205	0.00145	0.029647	20	0.009249	no	SKINNS
chr1_3016811_C_G_b38	MORN1	-3.2	0.00147	-0.060046	14	0.018766	no	SKINNS
chr1_2351722_A_G_b38	MORN1	3.181	0.00157	0.029507	40	0.009276	no	SKINNS
chr1_1706963_G_A_b38	MORN1	3.105	0.00203	0.043219	13	0.01392	no	SKINNS
chr1_3015969_G_A_b38	MORN1	-3.054	0.0024	-0.056575	14	0.018527	no	SKINNS
chr1_3016055_A_G_b38	MORN1	-3.054	0.0024	-0.056575	14	0.018527	no	SKINNS
chr1_1502220_C_CT_b38	MORN1	3.04	0.00251	0.039748	4	0.013076	no	SKINNS
chr1_3015935_C_T_b38	MORN1	-3.003	0.00282	-0.056392	14	0.018777	no	SKINNS
chr1_2683198_C_T_b38	MORN1	2.977	0.00307	0.057633	4	0.01936	no	SKINNS
chr1_2683199_G_T_b38	MORN1	2.977	0.00307	0.057633	4	0.01936	no	SKINNS
chr1_3030855_G_A_b38	MORN1	2.977	0.00307	0.069085	3	0.023209	no	SKINNS
chr1_1743602_T_C_b38	MORN1	2.95	0.00334	0.063894	4	0.021656	no	SKINNS
chr1_2338460_T_C_b38	MORN1	2.924	0.00363	0.021802	76	0.007455	no	SKINNS
chr1_2359219_C_T_b38	MORN1	2.891	0.00402	0.052514	8	0.018162	no	SKINNS
chr1_3008162_T_C_b38	MORN1	-2.883	0.00413	-0.029443	28	0.010212	no	SKINNS
chr1_3008858_A_G_b38	MORN1	-2.883	0.00413	-0.029443	28	0.010212	no	SKINNS
chr1_2363826_A_AT_b38	MORN1	-2.883	0.00414	-0.042619	6	0.014785	no	SKINNS
chr1_2682047_T_C_b38	MORN1	-2.868	0.00432	-0.038794	9	0.013524	no	SKINNS
chr1_1686004_G_T_b38	MORN1	-2.868	0.00433	-0.068605	3	0.023921	no	SKINNS
chr1_2683180_G_A_b38	MORN1	2.844	0.00467	0.054449	7	0.019148	no	SKINNS
chr1_2344980_A_G_b38	MORN1	2.82	0.00502	0.02501	23	0.008869	no	SKINNS
chr1_2345774_T_C_b38	MORN1	2.82	0.00502	0.02501	23	0.008869	no	SKINNS
chr1_1729287_T_C_b38	MORN1	2.819	0.00503	0.023325	45	0.008274	no	SKINNS
chr1_2440123_T_C_b38	MORN1	2.816	0.00508	0.067981	4	0.024141	no	SKINNS
chr1_1703754_T_C_b38	MORN1	2.804	0.00527	0.036792	17	0.013122	no	SKINNS
chr1_1704126_C_T_b38	MORN1	2.804	0.00527	0.036792	17	0.013122	no	SKINNS
chr1_1704504_A_C_b38	MORN1	2.803	0.00528	0.036437	17	0.012998	no	SKINNS
chr1_2338570_C_T_b38	MORN1	2.801	0.00532	0.020907	71	0.007464	no	SKINNS
chr1_3003473_G_A_b38	MORN1	-2.799	0.00536	-0.059305	8	0.021191	no	SKINNS
chr1_2351551_C_T_b38	MORN1	2.786	0.00556	0.025465	22	0.009139	no	SKINNS
chr1_1729296_T_C_b38	MORN1	2.782	0.00563	0.023163	43	0.008325	no	SKINNS
chr1_2342886_AT_A_b38	MORN1	2.779	0.00568	0.034787	11	0.012517	no	SKINNS
chr1_2346111_G_C_b38	MORN1	-2.778	0.0057	-0.020692	93	0.007449	no	SKINNS
chr1_2364876_C_T_b38	MORN1	2.774	0.00577	0.050426	8	0.01818	no	SKINNS
chr1_2363805_C_CAAACAA_b38	MORN1	2.757	0.00608	0.023724	37	0.008606	no	SKINNS
chr1_2337211_C_G_b38	MORN1	2.753	0.00615	0.021258	72	0.007723	no	SKINNS
chr1_1704540_G_C_b38	MORN1	2.747	0.00626	0.035826	17	0.013042	no	SKINNS
chr1_2344757_C_A_b38	MORN1	2.745	0.00629	0.024843	23	0.00905	no	SKINNS
chr1_2344761_T_A_b38	MORN1	2.745	0.00629	0.024843	23	0.00905	no	SKINNS
chr1_2345727_G_A_b38	MORN1	2.745	0.00629	0.024843	23	0.00905	no	SKINNS
chr1_2350934_C_T_b38	MORN1	2.745	0.00629	0.024843	23	0.00905	no	SKINNS
chr1_1707486_C_T_b38	MORN1	2.744	0.00631	0.036235	14	0.013204	no	SKINNS
chr1_1721197_CA_C_b38	MORN1	-2.703	0.00714	-0.032231	17	0.011925	no	SKINNS
chr1_2344634_T_C_b38	MORN1	2.692	0.00736	0.024367	23	0.00905	no	SKINNS
chr1_1708393_T_C_b38	MORN1	2.689	0.00743	0.037296	13	0.013868	no	SKINNS
chr1_3017338_C_G_b38	MORN1	-2.685	0.00752	-0.027367	23	0.010192	no	SKINNS
chr1_1707341_C_T_b38	MORN1	2.683	0.00756	0.035523	16	0.013238	no	SKINNS
chr1_2355481_C_T_b38	MORN1	2.677	0.0077	0.045078	9	0.016838	no	SKINNS
chr1_1510122_G_C_b38	MORN1	2.664	0.008	0.034469	4	0.012938	no	SKINNS
chr1_2345442_G_A_b38	MORN1	2.662	0.00804	0.049915	8	0.018749	no	SKINNS
chr1_1714987_C_T_b38	MORN1	-2.65	0.00833	-0.062174	3	0.023459	no	SKINNS
chr1_1718786_G_A_b38	MORN1	-2.65	0.00833	-0.062174	3	0.023459	no	SKINNS
chr1_1719189_G_A_b38	MORN1	-2.65	0.00833	-0.062174	3	0.023459	no	SKINNS
chr1_1720548_G_A_b38	MORN1	-2.65	0.00833	-0.062174	3	0.023459	no	SKINNS
chr1_1721336_G_A_b38	MORN1	-2.65	0.00833	-0.062174	3	0.023459	no	SKINNS
chr1_1501260_A_AT_b38	MORN1	2.642	0.00853	0.026953	21	0.010202	no	SKINNS
chr1_2994895_G_A_b38	MORN1	-2.639	0.0086	-0.058904	3	0.022319	no	SKINNS
chr1_2996017_C_T_b38	MORN1	-2.639	0.0086	-0.058904	3	0.022319	no	SKINNS
chr1_2996153_T_C_b38	MORN1	-2.639	0.0086	-0.058904	3	0.022319	no	SKINNS
chr1_2999619_C_T_b38	MORN1	-2.639	0.0086	-0.058904	3	0.022319	no	SKINNS
chr1_2993152_A_G_b38	MORN1	-2.637	0.00866	-0.026614	25	0.010093	no	SKINNS
chr1_3008958_A_G_b38	MORN1	-2.631	0.00881	-0.026673	23	0.010138	no	SKINNS
chr1_1703669_G_A_b38	MORN1	2.612	0.00929	0.034463	16	0.013192	no	SKINNS
chr1_2993761_A_G_b38	MORN1	-2.606	0.00946	-0.026271	20	0.01008	no	SKINNS
chr1_3002611_G_A_b38	MORN1	2.601	0.00959	0.045795	5	0.017604	no	SKINNS
chr1_2998498_G_A_b38	MORN1	-2.593	0.00984	-0.026211	20	0.01011	no	SKINNS
chr1_2364339_A_C_b38	MORN1	-9.943	1.74e-21	-0.065429	80	0.006581	yes	SKNS
chr1_2367872_A_G_b38	MORN1	-9.844	4.03e-21	-0.065055	85	0.006609	yes	SKNS
chr1_2368188_T_C_b38	MORN1	-9.803	5.65e-21	-0.064783	85	0.006608	yes	SKNS
chr1_2366816_A_G_b38	MORN1	-9.755	8.47e-21	-0.064521	78	0.006614	yes	SKNS
chr1_2366956_CAAAATACATAGA_C_b38	MORN1	-9.613	2.76e-20	-0.063763	82	0.006633	yes	SKNS
chr1_2366555_G_C_b38	MORN1	-9.431	1.24e-19	-0.063503	75	0.006733	yes	SKNS
chr1_2368473_T_C_b38	MORN1	-9.416	1.39e-19	-0.062803	87	0.00667	yes	SKNS
chr1_2352756_T_C_b38	MORN1	-9.258	5.03e-19	-0.062231	76	0.006722	yes	SKNS
chr1_2367197_G_A_b38	MORN1	-9.231	6.26e-19	-0.062473	73	0.006768	yes	SKNS
chr1_2366496_A_T_b38	MORN1	-9.21	7.43e-19	-0.062306	74	0.006765	yes	SKNS
chr1_2367799_C_T_b38	MORN1	-9.129	1.42e-18	-0.061971	74	0.006789	yes	SKNS
chr1_2368939_G_C_b38	MORN1	-9.063	2.39e-18	-0.061467	74	0.006782	yes	SKNS
chr1_2351241_C_T_b38	MORN1	-8.961	5.38e-18	-0.061704	73	0.006886	yes	SKNS
chr1_2366243_C_T_b38	MORN1	-8.861	1.18e-17	-0.060632	72	0.006843	yes	SKNS
chr1_2343517_G_A_b38	MORN1	-8.823	1.58e-17	-0.061834	66	0.007008	yes	SKNS
chr1_2365333_G_A_b38	MORN1	-8.806	1.81e-17	-0.059046	74	0.006705	yes	SKNS
chr1_2368718_C_A_b38	MORN1	-8.696	4.26e-17	-0.059131	74	0.0068	yes	SKNS
chr1_2343699_C_T_b38	MORN1	-8.571	1.11e-16	-0.06032	66	0.007038	yes	SKNS
chr1_2363829_A_T_b38	MORN1	-8.558	1.23e-16	-0.055775	79	0.006517	yes	SKNS
chr1_2348700_C_T_b38	MORN1	-8.547	1.34e-16	-0.060896	62	0.007125	yes	SKNS
chr1_2365236_C_T_b38	MORN1	-8.489	2.07e-16	-0.057875	74	0.006818	yes	SKNS
chr1_2367456_C_CAA_b38	MORN1	-8.457	2.63e-16	-0.061046	55	0.007218	yes	SKNS
chr1_2369210_C_T_b38	MORN1	-8.301	8.48e-16	-0.056295	90	0.006781	yes	SKNS
chr1_2364657_A_T_b38	MORN1	-7.52	2.33e-13	-0.049637	139	0.006601	yes	SKNS
chr1_2364658_A_T_b38	MORN1	-7.52	2.33e-13	-0.049637	139	0.006601	yes	SKNS
chr1_2366021_T_C_b38	MORN1	-7.439	4.08e-13	-0.049741	133	0.006687	yes	SKNS
chr1_2353459_T_G_b38	MORN1	7.086	4.38e-12	0.047048	136	0.00664	yes	SKNS
chr1_2356177_T_C_b38	MORN1	7.086	4.38e-12	0.047048	136	0.00664	yes	SKNS
chr1_2352403_G_T_b38	MORN1	7.062	5.12e-12	0.046981	136	0.006652	yes	SKNS
chr1_2344932_C_A_b38	MORN1	-7.057	5.33e-12	-0.063384	17	0.008982	yes	SKNS
chr1_2353047_C_T_b38	MORN1	-6.956	1.03e-11	-0.062421	18	0.008974	yes	SKNS
chr1_2352457_A_G_b38	MORN1	6.89	1.58e-11	0.045931	138	0.006667	yes	SKNS
chr1_2346676_G_C_b38	MORN1	-6.846	2.09e-11	-0.061589	18	0.008996	yes	SKNS
chr1_2367871_C_T_b38	MORN1	-6.843	2.14e-11	-0.061982	17	0.009058	yes	SKNS
chr1_2350287_A_C_b38	MORN1	-6.768	3.45e-11	-0.060826	18	0.008987	yes	SKNS
chr1_2358849_T_C_b38	MORN1	6.761	3.59e-11	0.04528	138	0.006697	yes	SKNS
chr1_2360970_T_C_b38	MORN1	6.74	4.11e-11	0.045282	137	0.006718	yes	SKNS
chr1_2340787_C_T_b38	MORN1	-6.714	4.84e-11	-0.048238	55	0.007184	yes	SKNS
chr1_2360716_T_C_b38	MORN1	6.706	5.1e-11	0.045012	137	0.006712	yes	SKNS
chr1_2361332_A_AG_b38	MORN1	6.706	5.1e-11	0.045012	137	0.006712	yes	SKNS
chr1_2361548_A_ACT_b38	MORN1	6.706	5.1e-11	0.045012	137	0.006712	yes	SKNS
chr1_2343937_T_G_b38	MORN1	-6.706	5.12e-11	-0.046579	93	0.006946	yes	SKNS
chr1_2359472_G_A_b38	MORN1	6.658	6.91e-11	0.045308	95	0.006805	yes	SKNS
chr1_2350539_T_G_b38	MORN1	-6.573	1.18e-10	-0.04366	140	0.006643	yes	SKNS
chr1_2365220_A_G_b38	MORN1	-6.571	1.19e-10	-0.060966	16	0.009278	yes	SKNS
chr1_2363405_C_T_b38	MORN1	6.466	2.28e-10	0.047325	63	0.007319	yes	SKNS
chr1_2346801_C_T_b38	MORN1	-6.446	2.57e-10	-0.043593	145	0.006763	yes	SKNS
chr1_2349222_G_A_b38	MORN1	-6.397	3.46e-10	-0.043108	146	0.006738	yes	SKNS
chr1_2362718_G_A_b38	MORN1	6.336	5e-10	0.046816	50	0.007388	yes	SKNS
chr1_2357308_T_C_b38	MORN1	6.29	6.61e-10	0.042949	144	0.006828	yes	SKNS
chr1_2364484_C_T_b38	MORN1	-6.202	1.12e-09	-0.05724	19	0.00923	yes	SKNS
chr1_2350696_G_A_b38	MORN1	6.073	2.39e-09	0.04521	51	0.007445	yes	SKNS
chr1_2364499_A_G_b38	MORN1	6.01	3.45e-09	0.043308	58	0.007206	yes	SKNS
chr1_2338659_A_G_b38	MORN1	6.001	3.62e-09	0.040805	117	0.0068	yes	SKNS
chr1_2347542_C_T_b38	MORN1	-5.995	3.75e-09	-0.040712	120	0.006791	yes	SKNS
chr1_2348378_C_T_b38	MORN1	5.958	4.63e-09	0.044457	50	0.007461	yes	SKNS
chr1_2341705_A_G_b38	MORN1	5.931	5.41e-09	0.039895	135	0.006727	yes	SKNS
chr1_2356409_G_C_b38	MORN1	5.766	1.37e-08	0.042581	59	0.007384	yes	SKNS
chr1_2353743_A_T_b38	MORN1	5.76	1.42e-08	0.042458	72	0.007372	yes	SKNS
chr1_2337211_C_G_b38	MORN1	5.652	2.59e-08	0.040033	89	0.007083	yes	SKNS
chr1_2367055_C_A_b38	MORN1	5.587	3.68e-08	0.043416	37	0.00777	yes	SKNS
chr1_2338570_C_T_b38	MORN1	5.538	4.8e-08	0.038654	85	0.00698	yes	SKNS
chr1_2338460_T_C_b38	MORN1	5.369	1.18e-07	0.037251	93	0.006938	yes	SKNS
chr1_2344256_A_T_b38	MORN1	5.362	1.23e-07	0.041427	39	0.007726	yes	SKNS
chr1_2346111_G_C_b38	MORN1	-5.273	1.96e-07	-0.035672	121	0.006766	yes	SKNS
chr1_2344757_C_A_b38	MORN1	5.256	2.13e-07	0.041634	34	0.007921	yes	SKNS
chr1_2344761_T_A_b38	MORN1	5.256	2.13e-07	0.041634	34	0.007921	yes	SKNS
chr1_2351551_C_T_b38	MORN1	5.251	2.19e-07	0.042033	33	0.008005	yes	SKNS
chr1_2344634_T_C_b38	MORN1	5.157	3.54e-07	0.040794	34	0.00791	yes	SKNS
chr1_2359882_C_CAA_b38	MORN1	5.148	3.71e-07	0.043997	27	0.008547	yes	SKNS
chr1_2350934_C_T_b38	MORN1	5.128	4.1e-07	0.040619	34	0.007921	yes	SKNS
chr1_2345727_G_A_b38	MORN1	5.114	4.41e-07	0.040737	33	0.007966	yes	SKNS
chr1_2340807_G_A_b38	MORN1	5.073	5.42e-07	0.038793	46	0.007648	yes	SKNS
chr1_2356095_C_T_b38	MORN1	5.049	6.11e-07	0.04102	32	0.008125	yes	SKNS
chr1_2328587_C_T_b38	MORN1	-5.022	6.97e-07	-0.06083	3	0.012112	yes	SKNS
chr1_2344980_A_G_b38	MORN1	5.017	7.17e-07	0.039107	36	0.007796	yes	SKNS
chr1_2357882_G_A_b38	MORN1	4.989	8.24e-07	0.040456	32	0.00811	yes	SKNS
chr1_2325768_C_T_b38	MORN1	-4.983	8.47e-07	-0.062317	3	0.012506	yes	SKNS
chr1_2341451_G_A_b38	MORN1	4.971	9e-07	0.038167	45	0.007678	yes	SKNS
chr1_2345774_T_C_b38	MORN1	4.872	1.46e-06	0.038157	35	0.007832	yes	SKNS
chr1_2345849_ACACACAG_A_b38	MORN1	4.801	2.05e-06	0.040417	23	0.008418	yes	SKNS
chr1_2337352_A_G_b38	MORN1	4.775	2.33e-06	0.03349	91	0.007014	yes	SKNS
chr1_2344932_C_T_b38	MORN1	4.733	2.84e-06	0.038916	28	0.008222	yes	SKNS
chr1_2340625_G_A_b38	MORN1	4.725	2.94e-06	0.035892	48	0.007596	yes	SKNS
chr1_2343445_C_T_b38	MORN1	4.592	5.48e-06	0.035007	43	0.007623	yes	SKNS
chr1_2337299_A_G_b38	MORN1	4.577	5.88e-06	0.031647	84	0.006915	yes	SKNS
chr1_2350750_AGGGGTGGCACG_A_b38	MORN1	-4.308	1.96e-05	-0.036175	32	0.008398	yes	SKNS
chr1_2348393_G_A_b38	MORN1	-4.266	2.36e-05	-0.037093	24	0.008695	yes	SKNS
chr1_2344583_G_A_b38	MORN1	4.082	5.15e-05	0.031801	38	0.00779	yes	SKNS
chr1_2340425_C_T_b38	MORN1	-4.038	6.19e-05	-0.028401	120	0.007034	yes	SKNS
chr1_2337229_A_G_b38	MORN1	4.037	6.21e-05	0.028928	122	0.007166	yes	SKNS
chr1_2354688_G_C_b38	MORN1	-3.971	8.14e-05	-0.035581	22	0.00896	yes	SKNS
chr1_2351678_C_T_b38	MORN1	-3.964	8.36e-05	-0.035298	22	0.008904	yes	SKNS
chr1_2354645_C_T_b38	MORN1	-3.896	0.00011	-0.034903	22	0.008958	yes	SKNS
chr1_3311799_G_T_b38	MORN1	-3.89	0.000113	-0.046343	3	0.011914	yes	SKNS
chr1_2351215_T_G_b38	MORN1	-3.85	0.000132	-0.0343	23	0.008909	yes	SKNS
chr1_2347212_C_T_b38	MORN1	-3.79	0.000168	-0.033142	24	0.008745	yes	SKNS
chr1_2362229_A_G_b38	MORN1	-3.785	0.000171	-0.033779	23	0.008925	yes	SKNS
chr1_2340564_G_A_b38	MORN1	3.784	0.000172	0.029159	44	0.007706	yes	SKNS
chr1_2327187_CAG_C_b38	MORN1	3.737	0.000207	0.032658	29	0.00874	yes	SKNS
chr1_2369118_G_A_b38	MORN1	-3.681	0.000256	-0.032133	25	0.00873	yes	SKNS
chr1_1746439_GA_G_b38	MORN1	3.646	0.000292	0.028838	99	0.007909	yes	SKNS
chr1_2337141_G_A_b38	MORN1	3.637	0.000302	0.027012	70	0.007427	yes	SKNS
chr1_2362863_C_CA_b38	MORN1	-3.586	0.000366	-0.03359	15	0.009366	yes	SKNS
chr1_2342133_C_G_b38	MORN1	-3.57	0.000389	-0.033164	18	0.009289	yes	SKNS
chr1_2342137_G_A_b38	MORN1	-3.57	0.000389	-0.033164	18	0.009289	yes	SKNS
chr1_2369355_G_GA_b38	MORN1	-3.5	0.000504	-0.027504	54	0.007858	yes	SKNS
chr1_2367644_G_A_b38	MORN1	-3.477	0.000549	-0.024882	84	0.007156	yes	SKNS
chr1_3269600_GACAGTCCCAGAGGAGC_G_b38	MORN1	-3.438	0.000632	-0.031442	37	0.009146	yes	SKNS
chr1_1874605_TA_T_b38	MORN1	3.395	0.000737	0.041496	15	0.012223	yes	SKNS
chr1_1726106_AT_A_b38	MORN1	3.157	0.00168	0.02913	29	0.009226	yes	SKNS
chr1_2325642_ATT_A_b38	MORN1	3.132	0.00183	0.028458	20	0.009085	yes	SKNS
chr1_1934807_G_A_b38	MORN1	-3.106	0.002	-0.034515	8	0.011113	yes	SKNS
chr1_3275345_G_A_b38	MORN1	-3.07	0.00225	-0.028062	37	0.009139	yes	SKNS
chr1_3277381_G_A_b38	MORN1	-3.07	0.00225	-0.028062	37	0.009139	yes	SKNS
chr1_3261852_A_G_b38	MORN1	-3.026	0.0026	-0.026505	27	0.00876	yes	SKNS
chr1_3262896_T_G_b38	MORN1	-3.026	0.0026	-0.026505	27	0.00876	yes	SKNS
chr1_2370252_G_A_b38	MORN1	3.012	0.00272	0.02705	18	0.00898	yes	SKNS
chr1_3262909_C_T_b38	MORN1	-3.004	0.00279	-0.026504	26	0.008824	yes	SKNS
chr1_2309937_C_CTT_b38	MORN1	3	0.00283	0.022592	67	0.007531	yes	SKNS
chr1_3295189_C_T_b38	MORN1	2.965	0.00316	0.020634	129	0.006958	yes	SKNS
chr1_3262286_A_G_b38	MORN1	-2.964	0.00317	-0.026209	25	0.008841	yes	SKNS
chr1_3263807_A_G_b38	MORN1	-2.946	0.00336	-0.025984	25	0.008821	yes	SKNS
chr1_2327239_C_CACACAGAAACACACAGAAACACAGAAACAAACACAGAG_b38	MORN1	2.932	0.00351	0.023134	34	0.00789	yes	SKNS
chr1_1940973_C_T_b38	MORN1	-2.931	0.00352	-0.020766	120	0.007084	yes	SKNS
chr1_1937841_ACACCAGGTCCACCTCTGGACACAGGTCCACC_A_b38	MORN1	-2.922	0.00362	-0.020792	118	0.007115	yes	SKNS
chr1_1938054_ACT_A_b38	MORN1	-2.922	0.00362	-0.020792	118	0.007115	yes	SKNS
chr1_1942258_G_A_b38	MORN1	-2.913	0.00373	-0.020718	118	0.007113	yes	SKNS
chr1_2677434_G_T_b38	MORN1	2.913	0.00373	0.031532	6	0.010826	yes	SKNS
chr1_3265668_C_A_b38	MORN1	-2.912	0.00374	-0.025913	24	0.008898	yes	SKNS
chr1_3265674_G_T_b38	MORN1	-2.912	0.00374	-0.025913	24	0.008898	yes	SKNS
chr1_3265691_T_A_b38	MORN1	-2.912	0.00374	-0.025913	24	0.008898	yes	SKNS
chr1_3271941_C_T_b38	MORN1	-2.908	0.00378	-0.026047	23	0.008956	yes	SKNS
chr1_3275174_A_G_b38	MORN1	-2.908	0.00378	-0.026047	23	0.008956	yes	SKNS
chr1_3277784_T_TGCACACACAA_b38	MORN1	-2.908	0.00378	-0.026047	23	0.008956	yes	SKNS
chr1_3277786_T_C_b38	MORN1	-2.908	0.00378	-0.026047	23	0.008956	yes	SKNS
chr1_2345829_CCACA_C_b38	MORN1	-2.906	0.00381	-0.02214	48	0.007619	yes	SKNS
chr1_3261547_C_A_b38	MORN1	-2.894	0.00396	-0.025382	26	0.008772	yes	SKNS
chr1_1938332_A_ACT_b38	MORN1	-2.891	0.004	-0.020488	121	0.007087	yes	SKNS
chr1_3265843_G_C_b38	MORN1	-2.886	0.00406	-0.025322	27	0.008775	yes	SKNS
chr1_3266782_T_A_b38	MORN1	-2.886	0.00406	-0.025322	27	0.008775	yes	SKNS
chr1_1726904_T_C_b38	MORN1	2.884	0.00409	0.019823	138	0.006874	yes	SKNS
chr1_1931580_CA_C_b38	MORN1	-2.884	0.00409	-0.020767	115	0.007202	yes	SKNS
chr1_1942260_G_C_b38	MORN1	-2.881	0.00412	-0.020481	119	0.007108	yes	SKNS
chr1_3263283_C_T_b38	MORN1	-2.874	0.00421	-0.025329	25	0.008812	yes	SKNS
chr1_1727506_T_C_b38	MORN1	2.872	0.00424	0.025194	52	0.008771	yes	SKNS
chr1_3276539_C_T_b38	MORN1	-2.867	0.00431	-0.02614	37	0.009118	yes	SKNS
chr1_1940540_G_A_b38	MORN1	-2.858	0.00443	-0.020347	118	0.007119	yes	SKNS
chr1_1479205_A_C_b38	MORN1	-2.853	0.0045	-0.031795	26	0.011146	yes	SKNS
chr1_3278976_G_A_b38	MORN1	-2.85	0.00454	-0.025597	23	0.00898	yes	SKNS
chr1_1931587_A_G_b38	MORN1	-2.845	0.00461	-0.020421	116	0.007178	yes	SKNS
chr1_1921849_G_T_b38	MORN1	2.843	0.00464	0.022313	49	0.007849	yes	SKNS
chr1_3306142_A_G_b38	MORN1	2.814	0.00507	0.019458	157	0.006914	yes	SKNS
chr1_2324572_A_G_b38	MORN1	-2.803	0.00525	-0.021013	60	0.007497	yes	SKNS
chr1_3268507_C_T_b38	MORN1	-2.801	0.00528	-0.025126	23	0.00897	yes	SKNS
chr1_3269275_G_A_b38	MORN1	-2.801	0.00528	-0.025126	23	0.00897	yes	SKNS
chr1_1937273_T_C_b38	MORN1	-2.796	0.00536	-0.020102	112	0.00719	yes	SKNS
chr1_3295750_C_T_b38	MORN1	2.795	0.00538	0.019449	149	0.006959	yes	SKNS
chr1_1806932_C_T_b38	MORN1	2.766	0.00587	0.030644	6	0.011077	yes	SKNS
chr1_3298428_G_T_b38	MORN1	2.766	0.00587	0.019159	154	0.006927	yes	SKNS
chr1_2360913_G_A_b38	MORN1	2.764	0.00591	0.023434	36	0.008479	yes	SKNS
chr1_2323263_T_C_b38	MORN1	2.759	0.006	0.031898	7	0.011562	yes	SKNS
chr1_2683374_T_C_b38	MORN1	-2.745	0.00625	-0.030032	14	0.010939	yes	SKNS
chr1_3296027_G_C_b38	MORN1	2.745	0.00625	0.019039	156	0.006936	yes	SKNS
chr1_3297538_T_C_b38	MORN1	2.745	0.00625	0.019039	156	0.006936	yes	SKNS
chr1_2344761_T_C_b38	MORN1	2.743	0.00629	0.022822	40	0.00832	yes	SKNS
chr1_3270678_A_AGAGGAGGACAGTCGGGGAGGACAGTCCCG_b38	MORN1	-2.74	0.00634	-0.024718	54	0.00902	yes	SKNS
chr1_1896717_CT_C_b38	MORN1	2.738	0.00639	0.020684	122	0.007555	yes	SKNS
chr1_1634663_C_G_b38	MORN1	-2.734	0.00647	-0.029438	30	0.010768	yes	SKNS
chr1_1934821_C_CGTTGTAGGTACGTGTGTACGTGGGTGTTAGGTTGTAGGTACACACGTGTATATGTGGGTGTTAG_b38	MORN1	-2.728	0.00658	-0.019285	65	0.007069	yes	SKNS
chr1_1933087_C_T_b38	MORN1	-2.72	0.00675	-0.019515	113	0.007176	yes	SKNS
chr1_1933859_A_G_b38	MORN1	-2.72	0.00675	-0.019515	113	0.007176	yes	SKNS
chr1_1849992_T_TG_b38	MORN1	2.72	0.00675	0.024773	18	0.009109	yes	SKNS
chr1_1896396_CT_C_b38	MORN1	2.719	0.00677	0.025002	12	0.009196	yes	SKNS
chr1_3264851_G_A_b38	MORN1	-2.717	0.00679	-0.024061	24	0.008854	yes	SKNS
chr1_3304756_G_GT_b38	MORN1	-2.705	0.00705	-0.021348	53	0.007892	yes	SKNS
chr1_2677412_C_A_b38	MORN1	2.698	0.0072	0.028219	4	0.01046	yes	SKNS
chr1_3276670_A_AGGTGCCATGAACAGAGCCAGCGAGG_b38	MORN1	-2.694	0.00729	-0.024177	22	0.008975	yes	SKNS
chr1_3303386_A_G_b38	MORN1	-2.686	0.00745	-0.021185	53	0.007886	yes	SKNS
chr1_1942014_G_A_b38	MORN1	-2.685	0.00747	-0.019154	117	0.007133	yes	SKNS
chr1_1942075_A_G_b38	MORN1	-2.685	0.00747	-0.019154	117	0.007133	yes	SKNS
chr1_1942086_T_C_b38	MORN1	-2.685	0.00747	-0.019154	117	0.007133	yes	SKNS
chr1_1457611_AAAAC_A_b38	MORN1	-2.67	0.00782	-0.053628	9	0.020087	yes	SKNS
chr1_1462302_A_G_b38	MORN1	2.668	0.00787	0.03381	6	0.012673	yes	SKNS
chr1_2756585_AC_A_b38	MORN1	2.665	0.00794	0.027505	4	0.010322	yes	SKNS
chr1_3299068_T_G_b38	MORN1	2.646	0.00839	0.018375	155	0.006945	yes	SKNS
chr1_3082928_C_T_b38	MORN1	-2.641	0.00851	-0.025405	15	0.00962	yes	SKNS
chr1_2758226_C_G_b38	MORN1	-2.622	0.00899	-0.055678	3	0.021234	yes	SKNS
chr1_3307646_C_T_b38	MORN1	2.618	0.00909	0.018037	156	0.006888	yes	SKNS
chr1_1924659_C_T_b38	MORN1	2.618	0.0091	0.020727	47	0.007918	yes	SKNS
chr1_1757074_G_T_b38	MORN1	2.618	0.0091	0.018998	101	0.007257	yes	SKNS
chr1_1595824_CAGACAGACACAGAGCAGAACAGGGAGAGACAGAGAGAGAGAGACAGAGAGAGGCAGACAGAGACAGAGAGAG_C_b38	MORN1	2.608	0.00936	0.027327	20	0.010478	yes	SKNS
chr1_1891450_G_A_b38	MORN1	2.606	0.00941	0.020424	43	0.007837	yes	SKNS
chr1_3305057_A_T_b38	MORN1	2.603	0.0095	0.018032	155	0.006928	yes	SKNS
chr1_1918697_C_T_b38	MORN1	2.593	0.00979	0.020335	52	0.007844	yes	SKNS
chr1_1750226_C_T_b38	MORN1	2.592	0.0098	0.018759	106	0.007237	yes	SKNS
chr1_3270045_T_A_b38	MORN1	-2.588	0.00993	-0.023697	45	0.009158	yes	SKNS
chr1_3271579_C_G_b38	MORN1	-2.588	0.00993	-0.023697	45	0.009158	yes	SKNS
chr1_3271745_A_G_b38	MORN1	-2.588	0.00993	-0.023697	45	0.009158	yes	SKNS
chr1_3272442_G_A_b38	MORN1	-2.588	0.00993	-0.023697	45	0.009158	yes	SKNS
chr1_3272452_C_T_b38	MORN1	-2.588	0.00993	-0.023697	45	0.009158	yes	SKNS
chr1_3275878_T_C_b38	MORN1	-2.588	0.00993	-0.023697	45	0.009158	yes	SKNS
chr1_3276308_T_C_b38	MORN1	-2.588	0.00993	-0.023697	45	0.009158	yes	SKNS
chr1_3276734_T_C_b38	MORN1	-2.588	0.00993	-0.023697	45	0.009158	yes	SKNS
chr1_3276742_TC_T_b38	MORN1	-2.588	0.00993	-0.023697	45	0.009158	yes	SKNS
chr1_3277425_A_T_b38	MORN1	-2.588	0.00993	-0.023697	45	0.009158	yes	SKNS
chr1_2357811_C_G_b38	MORN1	-6.843	2.13e-11	-0.061583	18	0.008999	no	SKNS
chr1_2357812_T_C_b38	MORN1	-6.843	2.13e-11	-0.061583	18	0.008999	no	SKNS
chr1_2359828_A_G_b38	MORN1	-6.843	2.13e-11	-0.061583	18	0.008999	no	SKNS
chr1_2363591_T_G_b38	MORN1	-6.843	2.13e-11	-0.061583	18	0.008999	no	SKNS
chr1_2369336_A_G_b38	MORN1	-5.816	1.04e-08	-0.051578	22	0.008868	no	SKNS
chr1_2369713_ATAAT_A_b38	MORN1	-5.186	3.06e-07	-0.047225	19	0.009106	no	SKNS
chr1_2345148_G_A_b38	MORN1	-5.061	5.76e-07	-0.054687	8	0.010806	no	SKNS
chr1_2309937_C_CT_b38	MORN1	-4.664	3.93e-06	-0.031056	156	0.006659	no	SKNS
chr1_2340235_T_C_b38	MORN1	4.357	1.58e-05	0.032735	52	0.007513	no	SKNS
chr1_2340764_G_T_b38	MORN1	4.23	2.75e-05	0.032073	49	0.007583	no	SKNS
chr1_2363805_C_CAAACAA_b38	MORN1	4.118	4.42e-05	0.032432	49	0.007875	no	SKNS
chr1_2333631_T_C_b38	MORN1	4.05	5.88e-05	0.03231	35	0.007977	no	SKNS
chr1_3310290_T_A_b38	MORN1	-3.889	0.000114	-0.045137	6	0.011607	no	SKNS
chr1_3310922_A_G_b38	MORN1	-3.885	0.000115	-0.045419	5	0.011692	no	SKNS
chr1_3311588_T_G_b38	MORN1	-3.88	0.000118	-0.045254	5	0.011664	no	SKNS
chr1_3311597_C_T_b38	MORN1	-3.88	0.000118	-0.045254	5	0.011664	no	SKNS
chr1_3312219_G_T_b38	MORN1	-3.88	0.000118	-0.045254	5	0.011664	no	SKNS
chr1_3312621_G_A_b38	MORN1	-3.88	0.000118	-0.045254	5	0.011664	no	SKNS
chr1_3312694_A_G_b38	MORN1	-3.88	0.000118	-0.045254	5	0.011664	no	SKNS
chr1_3313956_T_C_b38	MORN1	-3.88	0.000118	-0.045254	5	0.011664	no	SKNS
chr1_3310606_A_C_b38	MORN1	-3.866	0.000124	-0.045112	5	0.011669	no	SKNS
chr1_3310983_G_A_b38	MORN1	-3.853	0.000131	-0.04486	5	0.011644	no	SKNS
chr1_3313405_G_A_b38	MORN1	-3.821	0.000149	-0.044471	5	0.011639	no	SKNS
chr1_2330544_C_A_b38	MORN1	3.742	0.000202	0.030228	35	0.008078	no	SKNS
chr1_2332227_G_A_b38	MORN1	3.607	0.000339	0.029204	35	0.008096	no	SKNS
chr1_2332449_C_T_b38	MORN1	3.579	0.000376	0.029139	34	0.008141	no	SKNS
chr1_2333899_TGCTGGAAAGAACA_T_b38	MORN1	3.568	0.000393	0.029253	34	0.008199	no	SKNS
chr1_2295727_A_G_b38	MORN1	-3.565	0.000396	-0.025673	97	0.007201	no	SKNS
chr1_2326447_G_C_b38	MORN1	3.502	5e-04	0.028685	34	0.00819	no	SKNS
chr1_3314073_G_GGGGGT_b38	MORN1	-3.484	0.000534	-0.038004	13	0.010908	no	SKNS
chr1_2333258_C_T_b38	MORN1	3.462	0.00058	0.028329	34	0.008184	no	SKNS
chr1_2325579_T_G_b38	MORN1	3.426	0.00066	0.027795	35	0.008113	no	SKNS
chr1_2358373_A_T_b38	MORN1	-3.365	0.000821	-0.031652	19	0.009406	no	SKNS
chr1_2342466_T_C_b38	MORN1	-3.341	0.000894	-0.023511	96	0.007038	no	SKNS
chr1_2324849_C_A_b38	MORN1	3.219	0.00136	0.027621	27	0.00858	no	SKNS
chr1_2380956_C_T_b38	MORN1	-3.188	0.00152	-0.028234	25	0.008856	no	SKNS
chr1_2382101_A_G_b38	MORN1	-3.188	0.00152	-0.028234	25	0.008856	no	SKNS
chr1_2363805_C_CAAACAAA_b38	MORN1	-3.107	0.00199	-0.049407	6	0.015904	no	SKNS
chr1_3269030_G_A_b38	MORN1	-3.028	0.00258	-0.027732	36	0.00916	no	SKNS
chr1_3273438_ATGTG_A_b38	MORN1	-3.008	0.00275	-0.027563	35	0.009163	no	SKNS
chr1_3335602_A_AACACACACAC_b38	MORN1	-2.984	0.00298	-0.040862	5	0.013694	no	SKNS
chr1_3268866_C_T_b38	MORN1	-2.918	0.00367	-0.026701	35	0.00915	no	SKNS
chr1_1939322_T_G_b38	MORN1	-2.879	0.00416	-0.037249	12	0.01294	no	SKNS
chr1_1948594_G_GT_b38	MORN1	2.848	0.00457	0.058761	5	0.020632	no	SKNS
chr1_1925075_G_A_b38	MORN1	-2.84	0.00468	-0.03551	16	0.012502	no	SKNS
chr1_2342840_ATATTT_A_b38	MORN1	-2.839	0.00469	-0.054421	6	0.019167	no	SKNS
chr1_1993370_C_G_b38	MORN1	-2.836	0.00475	-0.019158	148	0.006756	no	SKNS
chr1_1923880_C_T_b38	MORN1	-2.825	0.0049	-0.035132	16	0.012434	no	SKNS
chr1_2137467_G_T_b38	MORN1	-2.824	0.00492	-0.029488	12	0.010442	no	SKNS
chr1_1933640_C_T_b38	MORN1	-2.824	0.00493	-0.035998	13	0.012749	no	SKNS
chr1_2331225_G_A_b38	MORN1	2.777	0.00568	0.037699	3	0.013575	no	SKNS
chr1_3302337_T_C_b38	MORN1	-2.776	0.0057	-0.059499	9	0.021434	no	SKNS
chr1_1686004_G_T_b38	MORN1	-2.746	0.00624	-0.061559	5	0.022418	no	SKNS
chr1_2319918_C_A_b38	MORN1	2.735	0.00644	0.021626	57	0.007906	no	SKNS
chr1_1921945_G_A_b38	MORN1	-2.719	0.00676	-0.035048	12	0.01289	no	SKNS
chr1_2295704_GGGCCACGTGTGGCTATGTGTCCA_G_b38	MORN1	2.699	0.00717	0.021395	47	0.007926	no	SKNS
chr1_2363826_A_AT_b38	MORN1	-2.696	0.00724	-0.035178	8	0.013049	no	SKNS
chr1_1646197_T_C_b38	MORN1	-2.695	0.00727	-0.040617	4	0.015074	no	SKNS
chr1_1923278_C_T_b38	MORN1	-2.683	0.00753	-0.033774	16	0.012589	no	SKNS
chr1_1943993_C_A_b38	MORN1	-2.674	0.00772	-0.035413	11	0.013243	no	SKNS
chr1_1737504_A_C_b38	MORN1	2.669	0.00784	0.018031	169	0.006756	no	SKNS
chr1_2042765_C_CAA_b38	MORN1	-2.656	0.00814	-0.042043	10	0.015828	no	SKNS
chr1_1923107_C_T_b38	MORN1	-2.65	0.00829	-0.033398	16	0.012604	no	SKNS
chr1_1925663_A_G_b38	MORN1	-2.65	0.00829	-0.033398	16	0.012604	no	SKNS
chr1_1926722_C_T_b38	MORN1	-2.65	0.00829	-0.033398	16	0.012604	no	SKNS
chr1_1928702_C_T_b38	MORN1	-2.65	0.00829	-0.033398	16	0.012604	no	SKNS
chr1_1750650_C_G_b38	MORN1	2.644	0.00842	0.023416	45	0.008855	no	SKNS
chr1_3261127_G_GA_b38	MORN1	2.629	0.0088	0.020211	64	0.007686	no	SKNS
chr1_2325159_CCCTTCCTTCCTTT_C_b38	MORN1	2.62	0.00904	0.033912	5	0.012942	no	SKNS
chr1_3307945_G_A_b38	MORN1	-2.618	0.0091	-0.060055	4	0.02294	no	SKNS
chr1_2164982_T_C_b38	MORN1	2.612	0.00926	0.027222	10	0.010423	no	SKNS
chr1_2392569_C_T_b38	MORN1	-2.608	0.00936	-0.022452	27	0.008609	no	SKNS
chr1_1715541_A_C_b38	MORN1	2.602	0.00953	0.04342	4	0.016688	no	SKNS
chr1_1924931_G_A_b38	MORN1	-2.598	0.00964	-0.033179	13	0.012771	no	SKNS
chr1_1929558_G_A_b38	MORN1	-2.598	0.00964	-0.033179	13	0.012771	no	SKNS
chr1_1930002_T_C_b38	MORN1	-2.598	0.00964	-0.033179	13	0.012771	no	SKNS
chr1_1750632_G_A_b38	MORN1	2.593	0.00978	0.023718	45	0.009148	no	SKNS
chr1_2363829_A_T_b38	MORN1	-4.915	2.57e-06	-0.063794	24	0.012979	yes	SNTTRM
chr1_2179937_A_G_b38	MORN1	4.246	4.06e-05	0.058951	32	0.013884	yes	SNTTRM
chr1_2133900_A_G_b38	MORN1	-4.244	4.09e-05	-0.062514	19	0.014731	yes	SNTTRM
chr1_2133904_G_C_b38	MORN1	-4.244	4.09e-05	-0.062514	19	0.014731	yes	SNTTRM
chr1_2131725_G_A_b38	MORN1	-4.168	5.5e-05	-0.060369	23	0.014484	yes	SNTTRM
chr1_2304233_C_T_b38	MORN1	4.154	5.81e-05	0.086775	9	0.020891	yes	SNTTRM
chr1_2179591_T_C_b38	MORN1	4.108	6.93e-05	0.057938	32	0.014103	yes	SNTTRM
chr1_2181237_A_G_b38	MORN1	4.053	8.57e-05	0.055966	44	0.01381	yes	SNTTRM
chr1_2183219_A_AGTCTCC_b38	MORN1	4.046	8.8e-05	0.057342	31	0.014174	yes	SNTTRM
chr1_2346801_C_T_b38	MORN1	-4.012	9.98e-05	-0.053435	42	0.013317	yes	SNTTRM
chr1_2201613_G_T_b38	MORN1	3.98	0.000113	0.054263	33	0.013633	yes	SNTTRM
chr1_2349222_G_A_b38	MORN1	-3.967	0.000118	-0.05257	42	0.013253	yes	SNTTRM
chr1_2210546_C_A_b38	MORN1	3.902	0.000151	0.053084	33	0.013606	yes	SNTTRM
chr1_2207240_A_G_b38	MORN1	3.896	0.000154	0.052782	34	0.013549	yes	SNTTRM
chr1_2145302_A_G_b38	MORN1	3.883	0.000162	0.055434	32	0.014276	yes	SNTTRM
chr1_2147483_C_T_b38	MORN1	3.883	0.000162	0.055434	32	0.014276	yes	SNTTRM
chr1_2151127_T_C_b38	MORN1	3.883	0.000162	0.055434	32	0.014276	yes	SNTTRM
chr1_2154873_A_G_b38	MORN1	3.883	0.000162	0.055434	32	0.014276	yes	SNTTRM
chr1_2195995_C_A_b38	MORN1	3.88	0.000164	0.05286	34	0.013625	yes	SNTTRM
chr1_2181138_C_A_b38	MORN1	3.855	0.00018	0.055617	21	0.014429	yes	SNTTRM
chr1_2353459_T_G_b38	MORN1	3.839	0.00019	0.051007	41	0.013286	yes	SNTTRM
chr1_2356177_T_C_b38	MORN1	3.839	0.00019	0.051007	41	0.013286	yes	SNTTRM
chr1_2130530_T_C_b38	MORN1	-3.829	0.000197	-0.055549	24	0.014506	yes	SNTTRM
chr1_2357308_T_C_b38	MORN1	3.761	0.000252	0.050789	44	0.013503	yes	SNTTRM
chr1_2210506_C_T_b38	MORN1	3.756	0.000258	0.051124	33	0.013613	yes	SNTTRM
chr1_2300128_G_T_b38	MORN1	-3.703	0.000311	-0.050201	48	0.013556	yes	SNTTRM
chr1_2352403_G_T_b38	MORN1	3.698	0.000317	0.049945	41	0.013505	yes	SNTTRM
chr1_2352457_A_G_b38	MORN1	3.698	0.000317	0.049945	41	0.013505	yes	SNTTRM
chr1_2181022_T_C_b38	MORN1	3.692	0.000324	0.049884	43	0.013512	yes	SNTTRM
chr1_2364499_A_G_b38	MORN1	3.68	0.000337	0.05522	13	0.015004	yes	SNTTRM
chr1_2206812_A_G_b38	MORN1	3.674	0.000345	0.049931	33	0.013592	yes	SNTTRM
chr1_2129293_C_T_b38	MORN1	-3.649	0.000377	-0.05308	31	0.014546	yes	SNTTRM
chr1_2111104_A_G_b38	MORN1	-3.638	0.000392	-0.052521	32	0.014436	yes	SNTTRM
chr1_2211288_C_G_b38	MORN1	3.623	0.000413	0.048764	30	0.013458	yes	SNTTRM
chr1_2194503_C_G_b38	MORN1	3.619	0.000419	0.050477	31	0.013948	yes	SNTTRM
chr1_2112615_A_C_b38	MORN1	-3.616	0.000423	-0.05248	21	0.014512	yes	SNTTRM
chr1_2113726_G_A_b38	MORN1	-3.591	0.000463	-0.051277	33	0.01428	yes	SNTTRM
chr1_2110022_C_T_b38	MORN1	-3.541	0.00055	-0.051531	32	0.014552	yes	SNTTRM
chr1_2108082_G_T_b38	MORN1	-3.525	0.000582	-0.050748	32	0.014398	yes	SNTTRM
chr1_2109459_T_C_b38	MORN1	-3.525	0.000582	-0.050748	32	0.014398	yes	SNTTRM
chr1_2109716_C_T_b38	MORN1	-3.525	0.000582	-0.050748	32	0.014398	yes	SNTTRM
chr1_2205929_T_C_b38	MORN1	3.506	0.000621	0.048011	33	0.013695	yes	SNTTRM
chr1_2144131_T_C_b38	MORN1	3.5	0.000633	0.050777	22	0.014506	yes	SNTTRM
chr1_2145689_A_G_b38	MORN1	3.5	0.000633	0.050777	22	0.014506	yes	SNTTRM
chr1_2146433_A_G_b38	MORN1	3.5	0.000633	0.050777	22	0.014506	yes	SNTTRM
chr1_2151163_A_G_b38	MORN1	3.5	0.000633	0.050777	22	0.014506	yes	SNTTRM
chr1_2152098_G_C_b38	MORN1	3.5	0.000633	0.050777	22	0.014506	yes	SNTTRM
chr1_2153594_A_G_b38	MORN1	3.5	0.000633	0.050777	22	0.014506	yes	SNTTRM
chr1_2119063_C_CT_b38	MORN1	-3.48	0.000679	-0.050958	20	0.014644	yes	SNTTRM
chr1_2118160_T_C_b38	MORN1	-3.474	0.000694	-0.052063	20	0.014989	yes	SNTTRM
chr1_2362718_G_A_b38	MORN1	3.464	0.000716	0.053113	11	0.015331	yes	SNTTRM
chr1_2151050_G_A_b38	MORN1	3.447	0.00076	0.050494	21	0.014649	yes	SNTTRM
chr1_2141345_CTT_C_b38	MORN1	-3.389	0.000924	-0.047563	38	0.014036	yes	SNTTRM
chr1_2129085_T_C_b38	MORN1	-3.369	0.000988	-0.050368	20	0.014952	yes	SNTTRM
chr1_2129191_T_C_b38	MORN1	-3.369	0.000988	-0.050368	20	0.014952	yes	SNTTRM
chr1_2127343_CA_C_b38	MORN1	-3.366	0.000999	-0.049432	32	0.014687	yes	SNTTRM
chr1_2120074_T_G_b38	MORN1	-3.344	0.00107	-0.050087	20	0.01498	yes	SNTTRM
chr1_2107454_G_A_b38	MORN1	-3.299	0.00124	-0.048277	32	0.014633	yes	SNTTRM
chr1_2193733_G_A_b38	MORN1	3.262	0.0014	0.062233	8	0.019076	yes	SNTTRM
chr1_2363405_C_T_b38	MORN1	3.255	0.00144	0.049017	15	0.015058	yes	SNTTRM
chr1_3294951_C_T_b38	MORN1	3.217	0.00163	0.131661	7	0.040925	yes	SNTTRM
chr1_2103940_A_G_b38	MORN1	-3.204	0.0017	-0.047041	28	0.014683	yes	SNTTRM
chr1_2104538_G_T_b38	MORN1	-3.204	0.0017	-0.047041	28	0.014683	yes	SNTTRM
chr1_2348378_C_T_b38	MORN1	3.203	0.0017	0.049999	10	0.015608	yes	SNTTRM
chr1_2350696_G_A_b38	MORN1	3.203	0.0017	0.049999	10	0.015608	yes	SNTTRM
chr1_2338659_A_G_b38	MORN1	3.202	0.00171	0.042938	36	0.01341	yes	SNTTRM
chr1_2116057_C_G_b38	MORN1	-3.189	0.00178	-0.048039	20	0.015066	yes	SNTTRM
chr1_2116108_G_A_b38	MORN1	-3.189	0.00178	-0.048039	20	0.015066	yes	SNTTRM
chr1_2204887_GCCCTCAAGCCCCGC_G_b38	MORN1	3.174	0.00187	0.063702	6	0.020068	yes	SNTTRM
chr1_2104824_G_A_b38	MORN1	-3.157	0.00197	-0.04624	24	0.014646	yes	SNTTRM
chr1_2117290_G_A_b38	MORN1	-3.157	0.00197	-0.047377	21	0.015006	yes	SNTTRM
chr1_2118069_G_T_b38	MORN1	-3.12	0.00222	-0.047296	20	0.015158	yes	SNTTRM
chr1_2275005_A_G_b38	MORN1	3.082	0.0025	0.052145	6	0.016917	yes	SNTTRM
chr1_2210401_C_A_b38	MORN1	3.075	0.00255	0.059667	8	0.019403	yes	SNTTRM
chr1_2104245_C_T_b38	MORN1	-3.071	0.00259	-0.044739	24	0.014569	yes	SNTTRM
chr1_2104360_G_A_b38	MORN1	-3.071	0.00259	-0.044739	24	0.014569	yes	SNTTRM
chr1_2380956_C_T_b38	MORN1	-3.056	0.00271	-0.050559	9	0.016544	yes	SNTTRM
chr1_2382101_A_G_b38	MORN1	-3.056	0.00271	-0.050559	9	0.016544	yes	SNTTRM
chr1_2196630_A_G_b38	MORN1	3.024	0.00299	0.058876	8	0.019469	yes	SNTTRM
chr1_2059376_C_T_b38	MORN1	3.01	0.00313	0.099838	8	0.033168	yes	SNTTRM
chr1_2064837_C_T_b38	MORN1	3.01	0.00313	0.099838	8	0.033168	yes	SNTTRM
chr1_2179409_T_G_b38	MORN1	-3.01	0.00313	-0.054197	4	0.018006	yes	SNTTRM
chr1_2064022_T_G_b38	MORN1	3.002	0.00321	0.09858	11	0.032843	yes	SNTTRM
chr1_2367644_G_A_b38	MORN1	-2.95	0.00376	-0.040974	27	0.013891	yes	SNTTRM
chr1_2105944_T_G_b38	MORN1	-2.945	0.00381	-0.049908	7	0.016946	yes	SNTTRM
chr1_2356409_G_C_b38	MORN1	2.932	0.00396	0.04636	12	0.015811	yes	SNTTRM
chr1_2056778_G_T_b38	MORN1	2.923	0.00408	0.099789	8	0.034142	yes	SNTTRM
chr1_2056929_C_G_b38	MORN1	2.923	0.00408	0.099789	8	0.034142	yes	SNTTRM
chr1_2448266_A_G_b38	MORN1	2.92	0.00411	0.044574	36	0.015264	yes	SNTTRM
chr1_2304223_G_A_b38	MORN1	2.919	0.00413	0.066543	3	0.022799	yes	SNTTRM
chr1_2344256_A_T_b38	MORN1	2.909	0.00425	0.050732	5	0.017441	yes	SNTTRM
chr1_2107797_G_T_b38	MORN1	-2.892	0.00447	-0.054534	12	0.018856	yes	SNTTRM
chr1_2391602_T_C_b38	MORN1	-2.877	0.00467	-0.041535	15	0.014435	yes	SNTTRM
chr1_2441419_T_C_b38	MORN1	2.866	0.00483	0.043413	30	0.015147	yes	SNTTRM
chr1_1836856_CT_C_b38	MORN1	-2.848	0.0051	-0.047202	7	0.016576	yes	SNTTRM
chr1_2118756_A_T_b38	MORN1	-2.839	0.00524	-0.041508	24	0.014621	yes	SNTTRM
chr1_2055016_C_T_b38	MORN1	2.836	0.00528	0.093743	8	0.033051	yes	SNTTRM
chr1_2132033_G_C_b38	MORN1	-2.82	0.00553	-0.050442	4	0.017886	yes	SNTTRM
chr1_2287529_G_A_b38	MORN1	-2.805	0.00579	-0.040545	26	0.014455	yes	SNTTRM
chr1_2451600_A_G_b38	MORN1	2.8	0.00586	0.041011	38	0.014644	yes	SNTTRM
chr1_2112598_T_C_b38	MORN1	-2.798	0.00591	-0.041574	22	0.014859	yes	SNTTRM
chr1_2113933_G_C_b38	MORN1	-2.783	0.00617	-0.041352	22	0.014859	yes	SNTTRM
chr1_2113937_A_G_b38	MORN1	-2.783	0.00617	-0.041352	22	0.014859	yes	SNTTRM
chr1_2113941_C_A_b38	MORN1	-2.783	0.00617	-0.041352	22	0.014859	yes	SNTTRM
chr1_2056854_G_C_b38	MORN1	2.779	0.00624	0.097215	7	0.034983	yes	SNTTRM
chr1_2056874_G_C_b38	MORN1	2.779	0.00624	0.097215	7	0.034983	yes	SNTTRM
chr1_2068161_A_T_b38	MORN1	2.762	0.00657	0.092766	7	0.033592	yes	SNTTRM
chr1_2450129_A_G_b38	MORN1	2.755	0.00668	0.04159	37	0.015094	yes	SNTTRM
chr1_2304900_T_C_b38	MORN1	-2.744	0.00691	-0.050177	5	0.018286	yes	SNTTRM
chr1_2113103_T_C_b38	MORN1	-2.741	0.00697	-0.041044	21	0.014975	yes	SNTTRM
chr1_2114443_A_G_b38	MORN1	-2.741	0.00697	-0.041044	21	0.014975	yes	SNTTRM
chr1_2115347_G_A_b38	MORN1	-2.741	0.00697	-0.041044	21	0.014975	yes	SNTTRM
chr1_2440958_A_G_b38	MORN1	2.719	0.00741	0.041058	39	0.015098	yes	SNTTRM
chr1_2441515_A_G_b38	MORN1	2.719	0.00741	0.041058	39	0.015098	yes	SNTTRM
chr1_2441729_A_G_b38	MORN1	2.719	0.00741	0.041058	39	0.015098	yes	SNTTRM
chr1_2443319_A_G_b38	MORN1	2.719	0.00741	0.041058	39	0.015098	yes	SNTTRM
chr1_1553619_CAAAAAAA_C_b38	MORN1	2.703	0.00778	0.045536	12	0.016849	yes	SNTTRM
chr1_2115499_G_T_b38	MORN1	-2.697	0.0079	-0.040525	21	0.015025	yes	SNTTRM
chr1_2364484_C_T_b38	MORN1	-2.68	0.00828	-0.046229	7	0.017247	yes	SNTTRM
chr1_2194537_C_A_b38	MORN1	-2.68	0.0083	-0.047823	7	0.017847	yes	SNTTRM
chr1_2166847_C_T_b38	MORN1	2.67	0.00852	0.052587	4	0.019692	yes	SNTTRM
chr1_2204652_A_G_b38	MORN1	2.669	0.00857	0.052472	9	0.019663	yes	SNTTRM
chr1_2309937_C_CTT_b38	MORN1	2.663	0.00871	0.042903	11	0.016112	yes	SNTTRM
chr1_1555871_T_C_b38	MORN1	2.66	0.00878	0.043701	23	0.01643	yes	SNTTRM
chr1_2128619_C_T_b38	MORN1	-2.642	0.00923	-0.047656	4	0.018037	yes	SNTTRM
chr1_2439244_GC_G_b38	MORN1	2.64	0.00929	0.040336	39	0.015281	yes	SNTTRM
chr1_1996920_CA_C_b38	MORN1	-2.626	0.00966	-0.051527	3	0.019623	yes	SNTTRM
chr1_2367872_A_G_b38	MORN1	-6.473	1.7e-09	-0.078378	27	0.012108	no	SNTTRM
chr1_2368188_T_C_b38	MORN1	-6.473	1.7e-09	-0.078378	27	0.012108	no	SNTTRM
chr1_2364339_A_C_b38	MORN1	-6.347	3.2e-09	-0.077383	25	0.012193	no	SNTTRM
chr1_2366816_A_G_b38	MORN1	-6.347	3.2e-09	-0.077383	25	0.012193	no	SNTTRM
chr1_2366956_CAAAATACATAGA_C_b38	MORN1	-6.242	5.38e-09	-0.075	27	0.012015	no	SNTTRM
chr1_2368473_T_C_b38	MORN1	-6.111	1.02e-08	-0.075524	29	0.012358	no	SNTTRM
chr1_2367456_C_CAA_b38	MORN1	-5.679	8.14e-08	-0.073834	20	0.013001	no	SNTTRM
chr1_2351241_C_T_b38	MORN1	-5.572	1.35e-07	-0.071682	22	0.012865	no	SNTTRM
chr1_2365333_G_A_b38	MORN1	-5.555	1.45e-07	-0.070493	22	0.012689	no	SNTTRM
chr1_2367197_G_A_b38	MORN1	-5.544	1.53e-07	-0.070242	22	0.012671	no	SNTTRM
chr1_2352756_T_C_b38	MORN1	-5.541	1.55e-07	-0.069856	24	0.012608	no	SNTTRM
chr1_2365236_C_T_b38	MORN1	-5.502	1.86e-07	-0.070971	23	0.012899	no	SNTTRM
chr1_2366496_A_T_b38	MORN1	-5.402	2.95e-07	-0.06931	23	0.012831	no	SNTTRM
chr1_2366555_G_C_b38	MORN1	-5.402	2.95e-07	-0.06931	23	0.012831	no	SNTTRM
chr1_2367799_C_T_b38	MORN1	-5.402	2.95e-07	-0.06931	23	0.012831	no	SNTTRM
chr1_2368939_G_C_b38	MORN1	-5.402	2.95e-07	-0.06931	23	0.012831	no	SNTTRM
chr1_2366243_C_T_b38	MORN1	-5.378	3.29e-07	-0.069289	23	0.012885	no	SNTTRM
chr1_2369210_C_T_b38	MORN1	-5.289	4.91e-07	-0.068658	25	0.01298	no	SNTTRM
chr1_2343699_C_T_b38	MORN1	-5.273	5.29e-07	-0.071354	18	0.013532	no	SNTTRM
chr1_2368718_C_A_b38	MORN1	-5.255	5.74e-07	-0.068061	22	0.012952	no	SNTTRM
chr1_2343517_G_A_b38	MORN1	-5.18	8.03e-07	-0.070083	18	0.01353	no	SNTTRM
chr1_2348700_C_T_b38	MORN1	-4.83	3.69e-06	-0.066123	19	0.013689	no	SNTTRM
chr1_2364657_A_T_b38	MORN1	-4.664	7.47e-06	-0.060635	32	0.013002	no	SNTTRM
chr1_2364658_A_T_b38	MORN1	-4.664	7.47e-06	-0.060635	32	0.013002	no	SNTTRM
chr1_2340787_C_T_b38	MORN1	-4.525	1.32e-05	-0.065054	13	0.014375	no	SNTTRM
chr1_2366021_T_C_b38	MORN1	-4.41	2.11e-05	-0.05932	30	0.01345	no	SNTTRM
chr1_2137041_C_T_b38	MORN1	-4.381	2.38e-05	-0.064418	19	0.014705	no	SNTTRM
chr1_2118342_G_GT_b38	MORN1	-4.358	2.6e-05	-0.05711	35	0.013104	no	SNTTRM
chr1_2350539_T_G_b38	MORN1	-4.349	2.7e-05	-0.057471	33	0.013215	no	SNTTRM
chr1_2350750_AGGGGTGGCACG_A_b38	MORN1	-4.297	3.33e-05	-0.065296	12	0.015197	no	SNTTRM
chr1_2359472_G_A_b38	MORN1	4.073	7.91e-05	0.054269	29	0.013323	no	SNTTRM
chr1_2343937_T_G_b38	MORN1	-3.903	0.00015	-0.054723	25	0.014021	no	SNTTRM
chr1_2139901_C_A_b38	MORN1	-3.858	0.000178	-0.055191	24	0.014306	no	SNTTRM
chr1_2140326_A_G_b38	MORN1	-3.858	0.000178	-0.055191	24	0.014306	no	SNTTRM
chr1_2347212_C_T_b38	MORN1	-3.849	0.000183	-0.065592	6	0.01704	no	SNTTRM
chr1_2155655_A_AATG_b38	MORN1	3.777	0.000239	0.055135	25	0.014599	no	SNTTRM
chr1_2351215_T_G_b38	MORN1	-3.773	0.000242	-0.061352	9	0.016262	no	SNTTRM
chr1_2354645_C_T_b38	MORN1	-3.773	0.000242	-0.061352	9	0.016262	no	SNTTRM
chr1_2354688_G_C_b38	MORN1	-3.773	0.000242	-0.061352	9	0.016262	no	SNTTRM
chr1_2362229_A_G_b38	MORN1	-3.773	0.000242	-0.061352	9	0.016262	no	SNTTRM
chr1_2351678_C_T_b38	MORN1	-3.725	0.000288	-0.060032	9	0.016118	no	SNTTRM
chr1_2358849_T_C_b38	MORN1	3.708	0.000305	0.04941	42	0.013324	no	SNTTRM
chr1_2360716_T_C_b38	MORN1	3.708	0.000305	0.04941	42	0.013324	no	SNTTRM
chr1_2360970_T_C_b38	MORN1	3.708	0.000305	0.04941	42	0.013324	no	SNTTRM
chr1_2361332_A_AG_b38	MORN1	3.708	0.000305	0.04941	42	0.013324	no	SNTTRM
chr1_2361548_A_ACT_b38	MORN1	3.708	0.000305	0.04941	42	0.013324	no	SNTTRM
chr1_2347542_C_T_b38	MORN1	-3.635	0.000396	-0.049596	29	0.013643	no	SNTTRM
chr1_2143629_G_C_b38	MORN1	3.613	0.000428	0.052586	24	0.014554	no	SNTTRM
chr1_2153159_T_C_b38	MORN1	3.613	0.000428	0.052586	24	0.014554	no	SNTTRM
chr1_2348393_G_A_b38	MORN1	-3.613	0.000428	-0.056896	10	0.015748	no	SNTTRM
chr1_2342133_C_G_b38	MORN1	-3.597	0.000452	-0.065734	5	0.018272	no	SNTTRM
chr1_2342137_G_A_b38	MORN1	-3.597	0.000452	-0.065734	5	0.018272	no	SNTTRM
chr1_2340625_G_A_b38	MORN1	3.56	0.000514	0.0559	9	0.0157	no	SNTTRM
chr1_2369336_A_G_b38	MORN1	-3.523	0.000586	-0.061106	6	0.017347	no	SNTTRM
chr1_2186506_G_C_b38	MORN1	3.462	0.000722	0.051177	23	0.014784	no	SNTTRM
chr1_2346111_G_C_b38	MORN1	-3.439	0.000781	-0.048111	28	0.013991	no	SNTTRM
chr1_2337211_C_G_b38	MORN1	3.426	0.000816	0.04825	26	0.014084	no	SNTTRM
chr1_2341705_A_G_b38	MORN1	3.403	0.000881	0.04646	39	0.013653	no	SNTTRM
chr1_2164301_G_GACCCCTGGGCCA_b38	MORN1	3.377	0.000963	0.050031	24	0.014817	no	SNTTRM
chr1_2186900_A_G_b38	MORN1	3.373	0.000975	0.04916	24	0.014576	no	SNTTRM
chr1_2186920_A_G_b38	MORN1	3.373	0.000975	0.04916	24	0.014576	no	SNTTRM
chr1_2340807_G_A_b38	MORN1	3.356	0.00103	0.053041	9	0.015805	no	SNTTRM
chr1_2341451_G_A_b38	MORN1	3.356	0.00103	0.053041	9	0.015805	no	SNTTRM
chr1_2340425_C_T_b38	MORN1	-3.35	0.00105	-0.050748	31	0.015147	no	SNTTRM
chr1_2167883_GCCT_G_b38	MORN1	3.313	0.00119	0.048297	23	0.014578	no	SNTTRM
chr1_2380105_C_T_b38	MORN1	-3.262	0.00141	-0.04484	22	0.013748	no	SNTTRM
chr1_2362863_C_CA_b38	MORN1	-3.235	0.00154	-0.057026	7	0.017628	no	SNTTRM
chr1_2158656_T_G_b38	MORN1	3.221	0.00161	0.047573	23	0.01477	no	SNTTRM
chr1_2163759_T_C_b38	MORN1	3.221	0.00161	0.047573	23	0.01477	no	SNTTRM
chr1_2164143_G_T_b38	MORN1	3.221	0.00161	0.047573	23	0.01477	no	SNTTRM
chr1_2367055_C_A_b38	MORN1	3.171	0.00189	0.053433	6	0.016851	no	SNTTRM
chr1_1822300_CT_C_b38	MORN1	-3.16	0.00195	-0.052057	37	0.016472	no	SNTTRM
chr1_2340235_T_C_b38	MORN1	3.14	0.00208	0.047555	11	0.015145	no	SNTTRM
chr1_2108280_G_A_b38	MORN1	-3.084	0.00248	-0.062374	5	0.020225	no	SNTTRM
chr1_2974683_C_CACCTGGGGAACGCGTCACACTTACCTGGGGGAAGCGTCACACTT_b38	MORN1	3.081	0.00251	0.096477	3	0.031318	no	SNTTRM
chr1_2108657_T_C_b38	MORN1	-3.018	0.00305	-0.057227	11	0.018963	no	SNTTRM
chr1_2344634_T_C_b38	MORN1	3	0.00322	0.052853	5	0.017616	no	SNTTRM
chr1_2181226_G_A_b38	MORN1	2.985	0.00338	0.042842	24	0.014355	no	SNTTRM
chr1_2342734_T_C_b38	MORN1	-2.984	0.00339	-0.045585	12	0.015277	no	SNTTRM
chr1_2369713_ATAAT_A_b38	MORN1	-2.968	0.00356	-0.053583	5	0.018055	no	SNTTRM
chr1_2340764_G_T_b38	MORN1	2.964	0.0036	0.046044	10	0.015536	no	SNTTRM
chr1_2389263_T_C_b38	MORN1	-2.961	0.00364	-0.04521	13	0.015271	no	SNTTRM
chr1_2344757_C_A_b38	MORN1	2.936	0.00392	0.051601	5	0.017575	no	SNTTRM
chr1_2344761_T_A_b38	MORN1	2.936	0.00392	0.051601	5	0.017575	no	SNTTRM
chr1_2345727_G_A_b38	MORN1	2.936	0.00392	0.051601	5	0.017575	no	SNTTRM
chr1_2350934_C_T_b38	MORN1	2.936	0.00392	0.051601	5	0.017575	no	SNTTRM
chr1_2189294_T_TG_b38	MORN1	-2.883	0.00459	-0.051243	5	0.017772	no	SNTTRM
chr1_2369355_G_GA_b38	MORN1	-2.881	0.00463	-0.042407	17	0.014721	no	SNTTRM
chr1_2137585_GCCT_G_b38	MORN1	-2.878	0.00466	-0.052633	4	0.018286	no	SNTTRM
chr1_2380209_G_A_b38	MORN1	-2.871	0.00476	-0.040149	21	0.013985	no	SNTTRM
chr1_2303580_T_C_b38	MORN1	-2.869	0.00479	-0.0411	16	0.014326	no	SNTTRM
chr1_2351551_C_T_b38	MORN1	2.832	0.00534	0.051332	4	0.018125	no	SNTTRM
chr1_2112545_C_T_b38	MORN1	-2.799	0.00589	-0.056454	4	0.02017	no	SNTTRM
chr1_2173095_TCCAC_T_b38	MORN1	-2.789	0.00606	-0.051641	3	0.018516	no	SNTTRM
chr1_2163734_CA_C_b38	MORN1	2.784	0.00614	0.045274	19	0.01626	no	SNTTRM
chr1_2345849_ACACACAG_A_b38	MORN1	2.779	0.00624	0.050625	4	0.018214	no	SNTTRM
chr1_2109324_G_A_b38	MORN1	-2.768	0.00644	-0.052605	11	0.019003	no	SNTTRM
chr1_2109338_C_T_b38	MORN1	-2.768	0.00644	-0.052605	11	0.019003	no	SNTTRM
chr1_2150203_C_A_b38	MORN1	2.758	0.00664	0.052532	5	0.019047	no	SNTTRM
chr1_2365220_A_G_b38	MORN1	-2.713	0.00754	-0.050969	4	0.018784	no	SNTTRM
chr1_2142665_G_T_b38	MORN1	2.713	0.00756	0.052889	4	0.019497	no	SNTTRM
chr1_2145827_G_A_b38	MORN1	2.713	0.00756	0.052889	4	0.019497	no	SNTTRM
chr1_2309937_C_CT_b38	MORN1	-2.709	0.00763	-0.035895	43	0.01325	no	SNTTRM
chr1_2302601_CAGG_C_b38	MORN1	-2.699	0.00786	-0.053181	4	0.019704	no	SNTTRM
chr1_2303193_G_A_b38	MORN1	-2.699	0.00786	-0.053181	4	0.019704	no	SNTTRM
chr1_2297717_C_T_b38	MORN1	-2.696	0.00792	-0.049684	6	0.018426	no	SNTTRM
chr1_2369118_G_A_b38	MORN1	-2.688	0.0081	-0.041558	11	0.01546	no	SNTTRM
chr1_2344932_C_T_b38	MORN1	2.686	0.00816	0.049721	3	0.018514	no	SNTTRM
chr1_2357882_G_A_b38	MORN1	2.664	0.00868	0.048564	4	0.018231	no	SNTTRM
chr1_2344932_C_A_b38	MORN1	-2.662	0.00873	-0.047509	5	0.01785	no	SNTTRM
chr1_2350287_A_C_b38	MORN1	-2.662	0.00873	-0.047509	5	0.01785	no	SNTTRM
chr1_2353047_C_T_b38	MORN1	-2.662	0.00873	-0.047509	5	0.01785	no	SNTTRM
chr1_3201737_G_T_b38	MORN1	2.66	0.00878	0.077779	3	0.029241	no	SNTTRM
chr1_2108949_G_A_b38	MORN1	-2.624	0.00969	-0.050378	12	0.019196	no	SNTTRM
chr1_2126311_A_C_b38	MORN1	-2.616	0.00991	-0.055646	3	0.021268	no	SNTTRM
chr1_2126584_A_G_b38	MORN1	-2.616	0.00991	-0.055646	3	0.021268	no	SNTTRM
chr1_2129937_T_C_b38	MORN1	-2.616	0.00991	-0.055646	3	0.021268	no	SNTTRM
chr1_2366816_A_G_b38	MORN1	-5.984	1.1e-08	-0.057009	30	0.009527	yes	SPLEEN
chr1_2364339_A_C_b38	MORN1	-5.935	1.41e-08	-0.055974	32	0.009431	yes	SPLEEN
chr1_2367872_A_G_b38	MORN1	-5.874	1.93e-08	-0.055809	34	0.009501	yes	SPLEEN
chr1_2368188_T_C_b38	MORN1	-5.874	1.93e-08	-0.055809	34	0.009501	yes	SPLEEN
chr1_2368473_T_C_b38	MORN1	-5.827	2.45e-08	-0.055982	36	0.009608	yes	SPLEEN
chr1_2343517_G_A_b38	MORN1	-5.791	2.93e-08	-0.056085	28	0.009685	yes	SPLEEN
chr1_2366956_CAAAATACATAGA_C_b38	MORN1	-5.745	3.69e-08	-0.054749	33	0.009529	yes	SPLEEN
chr1_2343699_C_T_b38	MORN1	-5.739	3.81e-08	-0.055724	28	0.009709	yes	SPLEEN
chr1_2364657_A_T_b38	MORN1	-5.63	6.57e-08	-0.051546	51	0.009156	yes	SPLEEN
chr1_2364658_A_T_b38	MORN1	-5.63	6.57e-08	-0.051546	51	0.009156	yes	SPLEEN
chr1_2352756_T_C_b38	MORN1	-5.619	6.93e-08	-0.05378	30	0.009571	yes	SPLEEN
chr1_2367456_C_CAA_b38	MORN1	-5.614	7.1e-08	-0.055499	23	0.009886	yes	SPLEEN
chr1_2366021_T_C_b38	MORN1	-5.612	7.17e-08	-0.052098	51	0.009284	yes	SPLEEN
chr1_2350539_T_G_b38	MORN1	-5.594	7.83e-08	-0.051694	57	0.009241	yes	SPLEEN
chr1_2368718_C_A_b38	MORN1	-5.539	1.03e-07	-0.053264	29	0.009616	yes	SPLEEN
chr1_2368939_G_C_b38	MORN1	-5.481	1.36e-07	-0.053064	29	0.009681	yes	SPLEEN
chr1_2366555_G_C_b38	MORN1	-5.448	1.6e-07	-0.052866	30	0.009704	yes	SPLEEN
chr1_2367799_C_T_b38	MORN1	-5.445	1.62e-07	-0.053251	29	0.00978	yes	SPLEEN
chr1_2366496_A_T_b38	MORN1	-5.443	1.64e-07	-0.05306	29	0.009748	yes	SPLEEN
chr1_2351241_C_T_b38	MORN1	-5.431	1.73e-07	-0.053715	29	0.00989	yes	SPLEEN
chr1_2348378_C_T_b38	MORN1	5.36	2.44e-07	0.0572	17	0.010671	yes	SPLEEN
chr1_2366243_C_T_b38	MORN1	-5.334	2.77e-07	-0.052064	28	0.00976	yes	SPLEEN
chr1_2367197_G_A_b38	MORN1	-5.319	2.98e-07	-0.051769	29	0.009733	yes	SPLEEN
chr1_2349222_G_A_b38	MORN1	-5.282	3.55e-07	-0.049192	57	0.009314	yes	SPLEEN
chr1_2350696_G_A_b38	MORN1	5.264	3.86e-07	0.056173	18	0.010671	yes	SPLEEN
chr1_2346801_C_T_b38	MORN1	-5.255	4.02e-07	-0.049342	57	0.009389	yes	SPLEEN
chr1_2362718_G_A_b38	MORN1	5.241	4.3e-07	0.05517	17	0.010526	yes	SPLEEN
chr1_2363405_C_T_b38	MORN1	5.231	4.52e-07	0.053884	23	0.010301	yes	SPLEEN
chr1_2365236_C_T_b38	MORN1	-5.22	4.75e-07	-0.050615	29	0.009696	yes	SPLEEN
chr1_2365333_G_A_b38	MORN1	-5.175	5.88e-07	-0.049453	29	0.009556	yes	SPLEEN
chr1_2353743_A_T_b38	MORN1	4.961	1.57e-06	0.051626	27	0.010406	yes	SPLEEN
chr1_2363829_A_T_b38	MORN1	-4.921	1.89e-06	-0.045776	31	0.009302	yes	SPLEEN
chr1_2364499_A_G_b38	MORN1	4.862	2.46e-06	0.050231	19	0.010331	yes	SPLEEN
chr1_2340787_C_T_b38	MORN1	-4.831	2.83e-06	-0.04867	20	0.010075	yes	SPLEEN
chr1_2356409_G_C_b38	MORN1	4.642	6.5e-06	0.049436	22	0.010649	yes	SPLEEN
chr1_2338659_A_G_b38	MORN1	4.582	8.43e-06	0.043388	44	0.00947	yes	SPLEEN
chr1_2347542_C_T_b38	MORN1	-4.53	1.05e-05	-0.040981	51	0.009046	yes	SPLEEN
chr1_2348700_C_T_b38	MORN1	-4.504	1.18e-05	-0.047409	24	0.010527	yes	SPLEEN
chr1_2345849_ACACACAG_A_b38	MORN1	4.427	1.63e-05	0.051949	8	0.011736	yes	SPLEEN
chr1_2345727_G_A_b38	MORN1	4.382	1.96e-05	0.05023	10	0.011462	yes	SPLEEN
chr1_2345774_T_C_b38	MORN1	4.378	2e-05	0.048762	11	0.011139	yes	SPLEEN
chr1_2365220_A_G_b38	MORN1	-4.372	2.04e-05	-0.053732	9	0.01229	yes	SPLEEN
chr1_2367055_C_A_b38	MORN1	4.294	2.82e-05	0.048021	12	0.011183	yes	SPLEEN
chr1_2369210_C_T_b38	MORN1	-4.241	3.51e-05	-0.043473	32	0.010251	yes	SPLEEN
chr1_2346111_G_C_b38	MORN1	-4.212	3.94e-05	-0.038945	50	0.009245	yes	SPLEEN
chr1_2357882_G_A_b38	MORN1	4.151	5.03e-05	0.048961	9	0.011794	yes	SPLEEN
chr1_2353459_T_G_b38	MORN1	4.076	6.78e-05	0.03932	51	0.009646	yes	SPLEEN
chr1_2356177_T_C_b38	MORN1	4.076	6.78e-05	0.03932	51	0.009646	yes	SPLEEN
chr1_2356095_C_T_b38	MORN1	4.001	9.08e-05	0.047168	9	0.011788	yes	SPLEEN
chr1_2358849_T_C_b38	MORN1	3.91	0.000129	0.038128	51	0.009751	yes	SPLEEN
chr1_2360716_T_C_b38	MORN1	3.91	0.000129	0.038128	51	0.009751	yes	SPLEEN
chr1_2360970_T_C_b38	MORN1	3.91	0.000129	0.038128	51	0.009751	yes	SPLEEN
chr1_2361332_A_AG_b38	MORN1	3.91	0.000129	0.038128	51	0.009751	yes	SPLEEN
chr1_2361548_A_ACT_b38	MORN1	3.91	0.000129	0.038128	51	0.009751	yes	SPLEEN
chr1_2352403_G_T_b38	MORN1	3.852	0.000161	0.037469	50	0.009728	yes	SPLEEN
chr1_2352457_A_G_b38	MORN1	3.811	0.000188	0.036987	52	0.009706	yes	SPLEEN
chr1_2344932_C_T_b38	MORN1	3.793	0.000201	0.045185	8	0.011912	yes	SPLEEN
chr1_2344256_A_T_b38	MORN1	3.667	0.00032	0.040024	14	0.010914	yes	SPLEEN
chr1_2385630_A_C_b38	MORN1	-3.654	0.000335	-0.038821	27	0.010623	yes	SPLEEN
chr1_2359472_G_A_b38	MORN1	3.523	0.000537	0.035005	32	0.009936	yes	SPLEEN
chr1_2383824_C_G_b38	MORN1	-3.511	0.00056	-0.035605	40	0.010141	yes	SPLEEN
chr1_2357308_T_C_b38	MORN1	3.492	6e-04	0.034755	57	0.009954	yes	SPLEEN
chr1_2189011_G_GA_b38	MORN1	3.46	0.000669	0.037134	24	0.010732	yes	SPLEEN
chr1_2343937_T_G_b38	MORN1	-3.436	0.000728	-0.034658	37	0.010087	yes	SPLEEN
chr1_2340235_T_C_b38	MORN1	3.381	0.000879	0.035014	23	0.010355	yes	SPLEEN
chr1_2340625_G_A_b38	MORN1	3.35	0.000978	0.03531	19	0.01054	yes	SPLEEN
chr1_2340807_G_A_b38	MORN1	3.305	0.00114	0.035729	17	0.010811	yes	SPLEEN
chr1_2341451_G_A_b38	MORN1	3.265	0.0013	0.034872	18	0.010679	yes	SPLEEN
chr1_1763635_AG_A_b38	MORN1	3.219	0.00152	0.072603	3	0.022553	yes	SPLEEN
chr1_2337229_A_G_b38	MORN1	3.2	0.00161	0.03183	51	0.009946	yes	SPLEEN
chr1_2337299_A_G_b38	MORN1	3.185	0.0017	0.031682	30	0.009947	yes	SPLEEN
chr1_2375533_G_A_b38	MORN1	-3.119	0.0021	-0.032325	31	0.010362	yes	SPLEEN
chr1_2836814_G_C_b38	MORN1	3.109	0.00217	0.079699	3	0.025637	yes	SPLEEN
chr1_2193733_G_A_b38	MORN1	3.084	0.00235	0.040195	11	0.013034	yes	SPLEEN
chr1_1456829_G_C_b38	MORN1	3.078	0.0024	0.044031	17	0.014305	yes	SPLEEN
chr1_2210401_C_A_b38	MORN1	2.968	0.0034	0.038424	12	0.012948	yes	SPLEEN
chr1_2204887_GCCCTCAAGCCCCGC_G_b38	MORN1	2.93	0.00381	0.038298	11	0.01307	yes	SPLEEN
chr1_2343445_C_T_b38	MORN1	2.928	0.00384	0.030826	19	0.010528	yes	SPLEEN
chr1_2388775_C_CA_b38	MORN1	2.914	0.004	0.062899	5	0.021582	yes	SPLEEN
chr1_2698924_C_G_b38	MORN1	2.912	0.00403	0.041417	5	0.014222	yes	SPLEEN
chr1_2036515_C_T_b38	MORN1	-2.881	0.00443	-0.028927	25	0.010041	yes	SPLEEN
chr1_3114427_C_CG_b38	MORN1	2.833	0.00512	0.032362	13	0.011424	yes	SPLEEN
chr1_2383024_G_T_b38	MORN1	-2.811	0.00547	-0.029481	31	0.010489	yes	SPLEEN
chr1_2383716_CA_C_b38	MORN1	-2.811	0.00547	-0.029481	31	0.010489	yes	SPLEEN
chr1_2885647_T_C_b38	MORN1	-2.785	0.00591	-0.063569	6	0.022825	yes	SPLEEN
chr1_2886982_G_A_b38	MORN1	-2.767	0.00624	-0.073589	3	0.026599	yes	SPLEEN
chr1_1991468_T_C_b38	MORN1	2.747	0.00661	0.068347	7	0.024881	yes	SPLEEN
chr1_2340764_G_T_b38	MORN1	2.726	0.00703	0.028434	22	0.010432	yes	SPLEEN
chr1_1681370_T_G_b38	MORN1	-2.698	0.00762	-0.039706	4	0.014718	yes	SPLEEN
chr1_1991761_T_C_b38	MORN1	-2.694	0.0077	-0.028933	36	0.010739	yes	SPLEEN
chr1_2205698_G_A_b38	MORN1	2.694	0.00771	0.035736	12	0.013265	yes	SPLEEN
chr1_2374713_C_T_b38	MORN1	-2.692	0.00774	-0.026402	44	0.009806	yes	SPLEEN
chr1_2375256_C_T_b38	MORN1	-2.685	0.0079	-0.026639	42	0.00992	yes	SPLEEN
chr1_3114625_A_AAC_b38	MORN1	2.633	0.00917	0.030169	15	0.011457	yes	SPLEEN
chr1_2331844_G_C_b38	MORN1	2.626	0.00935	0.040026	7	0.015241	yes	SPLEEN
chr1_2371472_G_A_b38	MORN1	-2.624	0.0094	-0.0301	15	0.011469	yes	SPLEEN
chr1_2186119_C_T_b38	MORN1	2.608	0.00985	0.036596	6	0.014032	yes	SPLEEN
chr1_2344932_C_A_b38	MORN1	-5.194	5.38e-07	-0.060249	10	0.0116	no	SPLEEN
chr1_2369336_A_G_b38	MORN1	-5.145	6.76e-07	-0.05923	12	0.011513	no	SPLEEN
chr1_2346676_G_C_b38	MORN1	-4.982	1.43e-06	-0.05788	10	0.011618	no	SPLEEN
chr1_2350287_A_C_b38	MORN1	-4.982	1.43e-06	-0.05788	10	0.011618	no	SPLEEN
chr1_2353047_C_T_b38	MORN1	-4.947	1.68e-06	-0.05805	10	0.011734	no	SPLEEN
chr1_2341705_A_G_b38	MORN1	4.865	2.43e-06	0.046182	48	0.009492	no	SPLEEN
chr1_2357811_C_G_b38	MORN1	-4.728	4.46e-06	-0.056184	10	0.011883	no	SPLEEN
chr1_2357812_T_C_b38	MORN1	-4.728	4.46e-06	-0.056184	10	0.011883	no	SPLEEN
chr1_2359828_A_G_b38	MORN1	-4.728	4.46e-06	-0.056184	10	0.011883	no	SPLEEN
chr1_2363591_T_G_b38	MORN1	-4.728	4.46e-06	-0.056184	10	0.011883	no	SPLEEN
chr1_2367871_C_T_b38	MORN1	-4.593	8.05e-06	-0.054834	10	0.011939	no	SPLEEN
chr1_2364484_C_T_b38	MORN1	-4.478	1.31e-05	-0.053484	11	0.011944	no	SPLEEN
chr1_2344634_T_C_b38	MORN1	4.416	1.7e-05	0.04996	11	0.011313	no	SPLEEN
chr1_2344757_C_A_b38	MORN1	4.324	2.49e-05	0.049006	11	0.011333	no	SPLEEN
chr1_2344761_T_A_b38	MORN1	4.324	2.49e-05	0.049006	11	0.011333	no	SPLEEN
chr1_2350934_C_T_b38	MORN1	4.324	2.49e-05	0.049006	11	0.011333	no	SPLEEN
chr1_2344980_A_G_b38	MORN1	4.323	2.51e-05	0.04764	12	0.01102	no	SPLEEN
chr1_2351551_C_T_b38	MORN1	4.23	3.66e-05	0.049235	10	0.011638	no	SPLEEN
chr1_2369713_ATAAT_A_b38	MORN1	-4.224	3.75e-05	-0.049042	12	0.01161	no	SPLEEN
chr1_2338460_T_C_b38	MORN1	4.034	8e-05	0.037706	35	0.009347	no	SPLEEN
chr1_2337352_A_G_b38	MORN1	3.879	0.000145	0.038277	31	0.009868	no	SPLEEN
chr1_2338570_C_T_b38	MORN1	3.801	0.000195	0.035929	32	0.009452	no	SPLEEN
chr1_2359882_C_CAA_b38	MORN1	3.702	0.000282	0.047815	5	0.012917	no	SPLEEN
chr1_2344583_G_A_b38	MORN1	3.523	0.000538	0.039102	15	0.0111	no	SPLEEN
chr1_2370252_G_A_b38	MORN1	3.486	0.000611	0.043074	9	0.012355	no	SPLEEN
chr1_2345829_CCACA_C_b38	MORN1	-3.354	0.000965	-0.035319	19	0.01053	no	SPLEEN
chr1_2337211_C_G_b38	MORN1	3.329	0.00105	0.033455	31	0.01005	no	SPLEEN
chr1_2285626_G_A_b38	MORN1	-3.12	0.0021	-0.0386	10	0.012372	no	SPLEEN
chr1_2137467_G_T_b38	MORN1	-2.909	0.00407	-0.042418	5	0.014581	no	SPLEEN
chr1_1905533_AT_A_b38	MORN1	-2.807	0.00553	-0.039226	3	0.013972	no	SPLEEN
chr1_1690741_T_A_b38	MORN1	2.759	0.00637	0.029397	29	0.010654	no	SPLEEN
chr1_3185169_G_A_b38	MORN1	-2.756	0.00643	-0.029779	55	0.010803	no	SPLEEN
chr1_1725745_C_G_b38	MORN1	2.67	0.00826	0.035018	9	0.013115	no	SPLEEN
chr1_2189331_C_CA_b38	MORN1	2.669	0.00828	0.040349	3	0.015117	no	SPLEEN
chr1_2683180_G_A_b38	MORN1	2.663	0.00843	0.06054	3	0.022735	no	SPLEEN
chr1_2372759_GACC_G_b38	MORN1	-2.661	0.00848	-0.02788	31	0.010478	no	SPLEEN
chr1_2372762_C_CTG_b38	MORN1	-2.661	0.00848	-0.02788	31	0.010478	no	SPLEEN
chr1_3196584_A_G_b38	MORN1	2.628	0.0093	0.030276	17	0.011519	no	SPLEEN
chr1_3197254_C_T_b38	MORN1	2.622	0.00947	0.030353	16	0.011577	no	SPLEEN
chr1_3377858_A_G_b38	MORN1	-2.61	0.00979	-0.03343	15	0.012808	no	SPLEEN
chr1_2364339_A_C_b38	MORN1	-7.591	5.28e-13	-0.062941	49	0.008291	yes	STMACH
chr1_2366816_A_G_b38	MORN1	-7.372	2.1e-12	-0.061649	47	0.008363	yes	STMACH
chr1_2343517_G_A_b38	MORN1	-7.371	2.11e-12	-0.064903	40	0.008806	yes	STMACH
chr1_2351241_C_T_b38	MORN1	-7.194	6.31e-12	-0.061687	45	0.008575	yes	STMACH
chr1_2367872_A_G_b38	MORN1	-7.179	6.9e-12	-0.060913	50	0.008485	yes	STMACH
chr1_2368188_T_C_b38	MORN1	-7.179	6.9e-12	-0.060913	50	0.008485	yes	STMACH
chr1_2343699_C_T_b38	MORN1	-7.146	8.48e-12	-0.063288	40	0.008857	yes	STMACH
chr1_2352756_T_C_b38	MORN1	-7.129	9.4e-12	-0.06018	46	0.008442	yes	STMACH
chr1_2366555_G_C_b38	MORN1	-7.113	1.04e-11	-0.060234	46	0.008468	yes	STMACH
chr1_2368473_T_C_b38	MORN1	-7.036	1.65e-11	-0.060293	51	0.008569	yes	STMACH
chr1_2366496_A_T_b38	MORN1	-6.892	3.94e-11	-0.058818	45	0.008535	yes	STMACH
chr1_2368939_G_C_b38	MORN1	-6.834	5.54e-11	-0.058436	45	0.00855	yes	STMACH
chr1_2366243_C_T_b38	MORN1	-6.818	6.11e-11	-0.058431	45	0.00857	yes	STMACH
chr1_2367197_G_A_b38	MORN1	-6.804	6.63e-11	-0.058003	45	0.008525	yes	STMACH
chr1_2367799_C_T_b38	MORN1	-6.763	8.44e-11	-0.057598	46	0.008516	yes	STMACH
chr1_2366956_CAAAATACATAGA_C_b38	MORN1	-6.732	1.01e-10	-0.057964	48	0.00861	yes	STMACH
chr1_2368718_C_A_b38	MORN1	-6.693	1.27e-10	-0.057612	44	0.008608	yes	STMACH
chr1_2367456_C_CAA_b38	MORN1	-6.58	2.46e-10	-0.059562	35	0.009052	yes	STMACH
chr1_2365236_C_T_b38	MORN1	-6.57	2.6e-10	-0.056928	45	0.008665	yes	STMACH
chr1_2365333_G_A_b38	MORN1	-6.558	2.79e-10	-0.056692	44	0.008644	yes	STMACH
chr1_2369210_C_T_b38	MORN1	-6.378	7.81e-10	-0.055654	49	0.008726	yes	STMACH
chr1_2352457_A_G_b38	MORN1	6.265	1.48e-09	0.054454	77	0.008692	yes	STMACH
chr1_2352403_G_T_b38	MORN1	6.227	1.83e-09	0.054302	76	0.008721	yes	STMACH
chr1_2363829_A_T_b38	MORN1	-6.166	2.57e-09	-0.051707	48	0.008386	yes	STMACH
chr1_2353459_T_G_b38	MORN1	6.123	3.25e-09	0.052967	76	0.00865	yes	STMACH
chr1_2356177_T_C_b38	MORN1	6.123	3.25e-09	0.052967	76	0.00865	yes	STMACH
chr1_2358849_T_C_b38	MORN1	5.902	1.08e-08	0.051479	77	0.008722	yes	STMACH
chr1_2360716_T_C_b38	MORN1	5.902	1.08e-08	0.051479	77	0.008722	yes	STMACH
chr1_2360970_T_C_b38	MORN1	5.902	1.08e-08	0.051479	77	0.008722	yes	STMACH
chr1_2361332_A_AG_b38	MORN1	5.902	1.08e-08	0.051479	77	0.008722	yes	STMACH
chr1_2361548_A_ACT_b38	MORN1	5.902	1.08e-08	0.051479	77	0.008722	yes	STMACH
chr1_2357308_T_C_b38	MORN1	5.774	2.14e-08	0.051134	80	0.008856	yes	STMACH
chr1_2383975_C_T_b38	MORN1	-5.273	2.77e-07	-0.056912	16	0.010793	yes	STMACH
chr1_2344932_C_A_b38	MORN1	-5.132	5.5e-07	-0.061185	9	0.011921	yes	STMACH
chr1_2353047_C_T_b38	MORN1	-5.052	8.09e-07	-0.059962	9	0.011868	yes	STMACH
chr1_2350287_A_C_b38	MORN1	-5.039	8.61e-07	-0.059623	9	0.011832	yes	STMACH
chr1_2346676_G_C_b38	MORN1	-5.004	1.02e-06	-0.059298	9	0.011849	yes	STMACH
chr1_2359472_G_A_b38	MORN1	4.837	2.23e-06	0.043874	52	0.009071	yes	STMACH
chr1_2357811_C_G_b38	MORN1	-4.83	2.3e-06	-0.057644	9	0.011934	yes	STMACH
chr1_2357812_T_C_b38	MORN1	-4.83	2.3e-06	-0.057644	9	0.011934	yes	STMACH
chr1_2359828_A_G_b38	MORN1	-4.83	2.3e-06	-0.057644	9	0.011934	yes	STMACH
chr1_2363591_T_G_b38	MORN1	-4.83	2.3e-06	-0.057644	9	0.011934	yes	STMACH
chr1_2367871_C_T_b38	MORN1	-4.83	2.3e-06	-0.057644	9	0.011934	yes	STMACH
chr1_2385630_A_C_b38	MORN1	-4.803	2.6e-06	-0.048939	29	0.010189	yes	STMACH
chr1_2345148_G_A_b38	MORN1	-4.7	4.16e-06	-0.06916	3	0.014714	yes	STMACH
chr1_2375533_G_A_b38	MORN1	-4.335	2.07e-05	-0.042992	32	0.009918	yes	STMACH
chr1_2383024_G_T_b38	MORN1	-4.3	2.4e-05	-0.042454	34	0.009874	yes	STMACH
chr1_2383716_CA_C_b38	MORN1	-4.3	2.4e-05	-0.042454	34	0.009874	yes	STMACH
chr1_2345953_G_A_b38	MORN1	4.223	3.3e-05	0.093785	4	0.022207	yes	STMACH
chr1_2372759_GACC_G_b38	MORN1	-4.146	4.54e-05	-0.041372	33	0.009978	yes	STMACH
chr1_2372762_C_CTG_b38	MORN1	-4.146	4.54e-05	-0.041372	33	0.009978	yes	STMACH
chr1_2350539_T_G_b38	MORN1	-4.103	5.41e-05	-0.03641	81	0.008873	yes	STMACH
chr1_2392897_T_C_b38	MORN1	-4.086	5.8e-05	-0.038572	39	0.00944	yes	STMACH
chr1_2380956_C_T_b38	MORN1	-4.079	5.98e-05	-0.045609	15	0.011183	yes	STMACH
chr1_2382101_A_G_b38	MORN1	-4.079	5.98e-05	-0.045609	15	0.011183	yes	STMACH
chr1_2345442_G_A_b38	MORN1	4.07	6.2e-05	0.091727	4	0.022539	yes	STMACH
chr1_2363405_C_T_b38	MORN1	4.064	6.35e-05	0.041537	29	0.010221	yes	STMACH
chr1_2348378_C_T_b38	MORN1	4.005	8.03e-05	0.042086	23	0.010508	yes	STMACH
chr1_2350696_G_A_b38	MORN1	3.988	8.61e-05	0.041782	24	0.010478	yes	STMACH
chr1_2366021_T_C_b38	MORN1	-3.901	0.000121	-0.035151	74	0.00901	yes	STMACH
chr1_2364657_A_T_b38	MORN1	-3.898	0.000123	-0.035148	76	0.009018	yes	STMACH
chr1_2364658_A_T_b38	MORN1	-3.898	0.000123	-0.035148	76	0.009018	yes	STMACH
chr1_2349222_G_A_b38	MORN1	-3.874	0.000134	-0.03443	84	0.008887	yes	STMACH
chr1_2355481_C_T_b38	MORN1	3.867	0.000139	0.087542	4	0.02264	yes	STMACH
chr1_2392569_C_T_b38	MORN1	-3.849	0.000149	-0.041366	16	0.010748	yes	STMACH
chr1_2363826_A_AT_b38	MORN1	-3.758	0.00021	-0.067975	4	0.018086	yes	STMACH
chr1_2383824_C_G_b38	MORN1	-3.752	0.000215	-0.036193	49	0.009646	yes	STMACH
chr1_2364499_A_G_b38	MORN1	3.751	0.000216	0.038378	26	0.010232	yes	STMACH
chr1_1547458_A_G_b38	MORN1	3.713	0.000249	0.095726	4	0.025783	yes	STMACH
chr1_1739996_G_T_b38	MORN1	3.705	0.000257	0.091014	3	0.024564	yes	STMACH
chr1_2362718_G_A_b38	MORN1	3.671	0.000292	0.038804	22	0.01057	yes	STMACH
chr1_2395636_C_T_b38	MORN1	-3.661	0.000303	-0.036766	27	0.010043	yes	STMACH
chr1_1729403_C_T_b38	MORN1	3.655	0.000309	0.08892	3	0.024327	yes	STMACH
chr1_1730099_A_G_b38	MORN1	3.655	0.000309	0.08892	3	0.024327	yes	STMACH
chr1_1546962_G_A_b38	MORN1	3.615	0.000359	0.083601	8	0.023128	yes	STMACH
chr1_2353743_A_T_b38	MORN1	3.595	0.000386	0.037494	35	0.010429	yes	STMACH
chr1_2375256_C_T_b38	MORN1	-3.593	0.000389	-0.033622	48	0.009358	yes	STMACH
chr1_1728274_G_C_b38	MORN1	3.592	0.000391	0.086264	3	0.024017	yes	STMACH
chr1_1731093_G_C_b38	MORN1	3.589	0.000394	0.08197	4	0.022836	yes	STMACH
chr1_1735087_A_C_b38	MORN1	3.589	0.000394	0.08197	4	0.022836	yes	STMACH
chr1_1735286_G_A_b38	MORN1	3.589	0.000394	0.08197	4	0.022836	yes	STMACH
chr1_2371077_T_C_b38	MORN1	-3.53	0.000489	-0.032411	74	0.009181	yes	STMACH
chr1_2374713_C_T_b38	MORN1	-3.462	0.000624	-0.032221	50	0.009307	yes	STMACH
chr1_1510082_TA_T_b38	MORN1	3.438	0.000679	0.0609	3	0.017713	yes	STMACH
chr1_2395479_G_A_b38	MORN1	-3.385	0.000818	-0.03404	27	0.010056	yes	STMACH
chr1_2376477_A_C_b38	MORN1	-3.297	0.00111	-0.029503	73	0.008947	yes	STMACH
chr1_2342885_TA_T_b38	MORN1	3.294	0.00112	0.09847	3	0.029897	yes	STMACH
chr1_2348590_C_T_b38	MORN1	3.287	0.00115	0.069431	7	0.021125	yes	STMACH
chr1_2342882_T_TTTTA_b38	MORN1	3.274	0.0012	0.097986	3	0.02993	yes	STMACH
chr1_2342881_ATTTTAT_A_b38	MORN1	3.262	0.00125	0.092742	3	0.028432	yes	STMACH
chr1_2362863_C_CA_b38	MORN1	-3.26	0.00126	-0.041949	9	0.012868	yes	STMACH
chr1_2847503_G_C_b38	MORN1	-3.235	0.00137	-0.031179	60	0.009639	yes	STMACH
chr1_2377643_T_G_b38	MORN1	-3.222	0.00143	-0.029764	69	0.009238	yes	STMACH
chr1_2363827_A_AT_b38	MORN1	-3.189	0.0016	-0.063893	3	0.020034	yes	STMACH
chr1_2356409_G_C_b38	MORN1	3.157	0.00177	0.033445	29	0.010593	yes	STMACH
chr1_2341847_T_C_b38	MORN1	-3.139	0.00189	-0.040254	10	0.012824	yes	STMACH
chr1_2384876_A_G_b38	MORN1	-3.093	0.00219	-0.028302	81	0.009152	yes	STMACH
chr1_3201762_C_T_b38	MORN1	3.021	0.00276	0.046503	5	0.015394	yes	STMACH
chr1_2371032_C_T_b38	MORN1	-3.019	0.00278	-0.028454	68	0.009424	yes	STMACH
chr1_2335494_C_T_b38	MORN1	3.017	0.0028	0.034551	19	0.011453	yes	STMACH
chr1_2840962_A_T_b38	MORN1	-2.999	0.00296	-0.029176	66	0.009729	yes	STMACH
chr1_2342876_AT_A_b38	MORN1	2.963	0.00332	0.068896	4	0.023249	yes	STMACH
chr1_1451726_A_G_b38	MORN1	2.958	0.00338	0.065429	4	0.022122	yes	STMACH
chr1_2384241_A_G_b38	MORN1	-2.919	0.00381	-0.026763	83	0.00917	yes	STMACH
chr1_2214805_CTG_C_b38	MORN1	2.908	0.00394	0.029749	41	0.010229	yes	STMACH
chr1_1455134_T_A_b38	MORN1	2.902	0.00402	0.064783	3	0.022327	yes	STMACH
chr1_2341705_A_G_b38	MORN1	2.891	0.00416	0.026317	72	0.009104	yes	STMACH
chr1_2848524_C_T_b38	MORN1	-2.883	0.00426	-0.028328	55	0.009825	yes	STMACH
chr1_2848606_T_C_b38	MORN1	-2.883	0.00426	-0.028328	55	0.009825	yes	STMACH
chr1_2855091_G_C_b38	MORN1	-2.879	0.00431	-0.028451	54	0.009881	yes	STMACH
chr1_2855482_A_C_b38	MORN1	-2.859	0.00458	-0.028035	55	0.009804	yes	STMACH
chr1_2854939_G_A_b38	MORN1	-2.858	0.0046	-0.027786	56	0.009724	yes	STMACH
chr1_2849749_G_A_b38	MORN1	-2.855	0.00464	-0.028023	55	0.009816	yes	STMACH
chr1_2189331_C_CA_b38	MORN1	2.831	0.00499	0.03857	5	0.013622	yes	STMACH
chr1_2369355_G_GAA_b38	MORN1	-2.829	0.00502	-0.07982	3	0.028212	yes	STMACH
chr1_2853368_C_T_b38	MORN1	-2.82	0.00516	-0.027697	54	0.009821	yes	STMACH
chr1_1454676_T_A_b38	MORN1	2.802	0.00545	0.063605	3	0.0227	yes	STMACH
chr1_1742119_C_CA_b38	MORN1	2.801	0.00546	0.061086	6	0.021806	yes	STMACH
chr1_2860477_C_T_b38	MORN1	-2.801	0.00546	-0.027705	53	0.009891	yes	STMACH
chr1_2854761_C_G_b38	MORN1	-2.78	0.00581	-0.027411	54	0.009858	yes	STMACH
chr1_2854950_G_A_b38	MORN1	-2.78	0.00581	-0.027411	54	0.009858	yes	STMACH
chr1_2855058_G_A_b38	MORN1	-2.78	0.00581	-0.027411	54	0.009858	yes	STMACH
chr1_2855629_G_A_b38	MORN1	-2.779	0.00584	-0.027408	55	0.009862	yes	STMACH
chr1_2855113_C_A_b38	MORN1	-2.779	0.00584	-0.027419	54	0.009866	yes	STMACH
chr1_2382880_T_C_b38	MORN1	-2.777	0.00587	-0.039725	5	0.014304	yes	STMACH
chr1_2398577_C_T_b38	MORN1	2.755	0.00627	0.025703	64	0.00933	yes	STMACH
chr1_2389131_A_AAAG_b38	MORN1	-2.722	0.00692	-0.024116	75	0.00886	yes	STMACH
chr1_3389949_GC_G_b38	MORN1	2.667	0.00812	0.055912	5	0.020964	yes	STMACH
chr1_1657902_T_TA_b38	MORN1	-2.655	0.00841	-0.043808	6	0.016502	yes	STMACH
chr1_2342880_TA_T_b38	MORN1	2.638	0.00883	0.067723	4	0.025672	yes	STMACH
chr1_2342877_T_TTTTA_b38	MORN1	2.628	0.00908	0.067485	4	0.025679	yes	STMACH
chr1_2847758_A_G_b38	MORN1	2.619	0.00932	0.025309	56	0.009663	yes	STMACH
chr1_1811086_T_A_b38	MORN1	2.613	0.00949	0.034867	8	0.013346	yes	STMACH
chr1_1454612_A_G_b38	MORN1	2.602	0.00979	0.058249	4	0.022387	yes	STMACH
chr1_2348700_C_T_b38	MORN1	-6.791	7.15e-11	-0.061604	38	0.009071	no	STMACH
chr1_2369336_A_G_b38	MORN1	-5.433	1.24e-07	-0.062512	12	0.011505	no	STMACH
chr1_2340787_C_T_b38	MORN1	-5.423	1.31e-07	-0.053135	27	0.009798	no	STMACH
chr1_2360913_G_A_b38	MORN1	5.396	1.5e-07	0.056721	21	0.010512	no	STMACH
chr1_2344761_T_C_b38	MORN1	5.295	2.48e-07	0.053972	26	0.010193	no	STMACH
chr1_2365220_A_G_b38	MORN1	-5.076	7.21e-07	-0.063227	7	0.012456	no	STMACH
chr1_2364484_C_T_b38	MORN1	-4.912	1.57e-06	-0.05969	11	0.012152	no	STMACH
chr1_2369713_ATAAT_A_b38	MORN1	-4.843	2.16e-06	-0.055163	13	0.011389	no	STMACH
chr1_2351722_A_G_b38	MORN1	4.78	2.9e-06	0.054657	30	0.011435	no	STMACH
chr1_2343937_T_G_b38	MORN1	-4.536	8.65e-06	-0.04205	54	0.00927	no	STMACH
chr1_2338659_A_G_b38	MORN1	4.158	4.32e-05	0.037347	71	0.008982	no	STMACH
chr1_2350750_AGGGGTGGCACG_A_b38	MORN1	-4.098	5.53e-05	-0.044901	16	0.010957	no	STMACH
chr1_2367644_G_A_b38	MORN1	-3.976	9.01e-05	-0.039392	42	0.009907	no	STMACH
chr1_2357096_C_G_b38	MORN1	3.939	0.000104	0.04865	11	0.012351	no	STMACH
chr1_2351215_T_G_b38	MORN1	-3.906	0.000119	-0.045899	14	0.011751	no	STMACH
chr1_2348393_G_A_b38	MORN1	-3.878	0.000133	-0.043695	15	0.011268	no	STMACH
chr1_2348949_CCT_C_b38	MORN1	3.861	0.000142	0.048466	10	0.012553	no	STMACH
chr1_2347995_C_T_b38	MORN1	3.847	0.000149	0.048011	10	0.012479	no	STMACH
chr1_2350943_C_T_b38	MORN1	3.847	0.000149	0.048011	10	0.012479	no	STMACH
chr1_2351874_C_G_b38	MORN1	3.847	0.000149	0.048011	10	0.012479	no	STMACH
chr1_2354291_A_G_b38	MORN1	3.847	0.000149	0.048011	10	0.012479	no	STMACH
chr1_2357413_G_A_b38	MORN1	3.833	0.000158	0.048295	10	0.0126	no	STMACH
chr1_2358817_G_A_b38	MORN1	3.833	0.000158	0.048295	10	0.0126	no	STMACH
chr1_2354969_C_T_b38	MORN1	3.824	0.000163	0.047903	10	0.012527	no	STMACH
chr1_2355671_C_T_b38	MORN1	3.824	0.000163	0.047903	10	0.012527	no	STMACH
chr1_2356158_C_T_b38	MORN1	3.824	0.000163	0.047903	10	0.012527	no	STMACH
chr1_2361249_C_G_b38	MORN1	3.819	0.000166	0.047831	10	0.012524	no	STMACH
chr1_2342133_C_G_b38	MORN1	-3.808	0.000174	-0.048622	10	0.01277	no	STMACH
chr1_2342137_G_A_b38	MORN1	-3.808	0.000174	-0.048622	10	0.01277	no	STMACH
chr1_2354645_C_T_b38	MORN1	-3.802	0.000178	-0.045364	13	0.011932	no	STMACH
chr1_2354688_G_C_b38	MORN1	-3.802	0.000178	-0.045364	13	0.011932	no	STMACH
chr1_2366312_C_T_b38	MORN1	3.782	0.000192	0.046608	11	0.012323	no	STMACH
chr1_2346801_C_T_b38	MORN1	-3.782	0.000192	-0.034169	83	0.009035	no	STMACH
chr1_2362229_A_G_b38	MORN1	-3.732	0.000232	-0.044629	13	0.011957	no	STMACH
chr1_1589795_G_A_b38	MORN1	3.703	0.000259	0.102647	3	0.027723	no	STMACH
chr1_2345557_C_T_b38	MORN1	3.691	0.000271	0.04542	11	0.012307	no	STMACH
chr1_2351678_C_T_b38	MORN1	-3.69	0.000272	-0.043487	13	0.011785	no	STMACH
chr1_2347212_C_T_b38	MORN1	-3.689	0.000273	-0.043548	12	0.011805	no	STMACH
chr1_2348703_A_G_b38	MORN1	3.663	0.000301	0.047534	10	0.012978	no	STMACH
chr1_2392128_T_C_b38	MORN1	-3.617	0.000356	-0.032011	64	0.008849	no	STMACH
chr1_2404771_C_T_b38	MORN1	-3.573	0.000419	-0.035307	30	0.009882	no	STMACH
chr1_2350540_T_C_b38	MORN1	3.572	0.00042	0.0442	11	0.012373	no	STMACH
chr1_2351827_T_C_b38	MORN1	3.567	0.000427	0.039175	27	0.010982	no	STMACH
chr1_2118713_C_CTGTGTG_b38	MORN1	3.56	0.000439	0.039507	14	0.011098	no	STMACH
chr1_2387989_A_G_b38	MORN1	-3.543	0.000467	-0.031513	66	0.008895	no	STMACH
chr1_2358041_A_G_b38	MORN1	3.525	0.000499	0.044007	10	0.012486	no	STMACH
chr1_2371226_C_CACAACCACA_b38	MORN1	-3.492	0.000561	-0.031738	64	0.009089	no	STMACH
chr1_2337352_A_G_b38	MORN1	3.334	0.000978	0.031635	49	0.00949	no	STMACH
chr1_2364608_C_A_b38	MORN1	3.273	0.00121	0.077918	3	0.023809	no	STMACH
chr1_2359219_C_T_b38	MORN1	3.259	0.00126	0.078928	3	0.024216	no	STMACH
chr1_2351277_T_TA_b38	MORN1	3.097	0.00217	0.046605	5	0.015051	no	STMACH
chr1_2369355_G_GA_b38	MORN1	-3.039	0.00261	-0.032194	29	0.010595	no	STMACH
chr1_1955424_T_C_b38	MORN1	3.035	0.00264	0.062734	8	0.020669	no	STMACH
chr1_2004501_CAA_C_b38	MORN1	3.031	0.00268	0.047284	3	0.015602	no	STMACH
chr1_3223103_C_CTT_b38	MORN1	3.009	0.00287	0.065982	6	0.021929	no	STMACH
chr1_1968747_T_C_b38	MORN1	-3.004	0.00292	-0.037315	8	0.012422	no	STMACH
chr1_2441419_T_C_b38	MORN1	3.003	0.00293	0.027408	61	0.009128	no	STMACH
chr1_2337141_G_A_b38	MORN1	2.986	0.00309	0.029533	32	0.009891	no	STMACH
chr1_2364876_C_T_b38	MORN1	2.914	0.00387	0.068815	3	0.023617	no	STMACH
chr1_1450193_C_T_b38	MORN1	2.911	0.0039	0.051161	8	0.017575	no	STMACH
chr1_3175983_G_GCAGC_b38	MORN1	-2.896	0.0041	-0.030395	24	0.010497	no	STMACH
chr1_1934619_TTGTAGGTACACACGTGTGTACGTGGGTGTTAGGC_T_b38	MORN1	2.883	0.00426	0.038952	13	0.01351	no	STMACH
chr1_2337211_C_G_b38	MORN1	2.871	0.00442	0.027104	47	0.00944	no	STMACH
chr1_2341464_A_G_b38	MORN1	-2.865	0.0045	-0.036442	10	0.012721	no	STMACH
chr1_2855782_C_A_b38	MORN1	-2.854	0.00466	-0.028077	54	0.009839	no	STMACH
chr1_3386981_A_T_b38	MORN1	2.84	0.00486	0.074191	4	0.026124	no	STMACH
chr1_1991468_T_C_b38	MORN1	2.836	0.00491	0.072925	10	0.025711	no	STMACH
chr1_2222256_T_C_b38	MORN1	2.828	0.00504	0.03092	20	0.010935	no	STMACH
chr1_2222257_G_C_b38	MORN1	2.828	0.00504	0.03092	20	0.010935	no	STMACH
chr1_2222258_T_C_b38	MORN1	2.828	0.00504	0.03092	20	0.010935	no	STMACH
chr1_3199280_CG_C_b38	MORN1	2.811	0.00531	0.032819	45	0.011677	no	STMACH
chr1_2369187_T_TA_b38	MORN1	2.799	0.0055	0.060839	3	0.021739	no	STMACH
chr1_2569625_G_A_b38	MORN1	-2.782	0.00578	-0.036495	7	0.013117	no	STMACH
chr1_2856233_T_C_b38	MORN1	-2.777	0.00587	-0.027424	54	0.009875	no	STMACH
chr1_2215527_T_C_b38	MORN1	2.704	0.00728	0.028861	23	0.010673	no	STMACH
chr1_2369118_G_A_b38	MORN1	-2.704	0.0073	-0.031873	14	0.011789	no	STMACH
chr1_1479334_A_G_b38	MORN1	2.677	0.00789	0.047183	23	0.017625	no	STMACH
chr1_2455439_G_A_b38	MORN1	2.673	0.00799	0.039575	3	0.014807	no	STMACH
chr1_2389113_C_CA_b38	MORN1	-2.656	0.00838	-0.025411	43	0.009567	no	STMACH
chr1_1934734_C_G_b38	MORN1	2.655	0.0084	0.025522	33	0.009612	no	STMACH
chr1_1595028_C_CAG_b38	MORN1	2.651	0.0085	0.029905	20	0.01128	no	STMACH
chr1_2217699_C_G_b38	MORN1	2.65	0.00852	0.026912	38	0.010154	no	STMACH
chr1_2353459_T_G_b38	MORN1	6.362	8.63e-10	0.060542	67	0.009517	yes	TESTIS
chr1_2356177_T_C_b38	MORN1	6.362	8.63e-10	0.060542	67	0.009517	yes	TESTIS
chr1_2352403_G_T_b38	MORN1	6.353	9.07e-10	0.060966	66	0.009597	yes	TESTIS
chr1_2352457_A_G_b38	MORN1	6.298	1.24e-09	0.060377	67	0.009587	yes	TESTIS
chr1_2360716_T_C_b38	MORN1	6.298	1.24e-09	0.060377	67	0.009587	yes	TESTIS
chr1_2361332_A_AG_b38	MORN1	6.298	1.24e-09	0.060377	67	0.009587	yes	TESTIS
chr1_2361548_A_ACT_b38	MORN1	6.298	1.24e-09	0.060377	67	0.009587	yes	TESTIS
chr1_2360970_T_C_b38	MORN1	6.194	2.21e-09	0.059739	67	0.009645	yes	TESTIS
chr1_2358849_T_C_b38	MORN1	6.108	3.54e-09	0.059022	67	0.009662	yes	TESTIS
chr1_2368473_T_C_b38	MORN1	-5.932	9.26e-09	-0.057754	45	0.009737	yes	TESTIS
chr1_2357308_T_C_b38	MORN1	5.754	2.38e-08	0.056739	71	0.009861	yes	TESTIS
chr1_2367872_A_G_b38	MORN1	-5.642	4.29e-08	-0.054701	44	0.009696	yes	TESTIS
chr1_2368188_T_C_b38	MORN1	-5.642	4.29e-08	-0.054701	44	0.009696	yes	TESTIS
chr1_2366956_CAAAATACATAGA_C_b38	MORN1	-5.631	4.53e-08	-0.055201	42	0.009803	yes	TESTIS
chr1_2338570_C_T_b38	MORN1	5.577	6e-08	0.053369	41	0.00957	yes	TESTIS
chr1_2338460_T_C_b38	MORN1	5.49	9.33e-08	0.052348	44	0.009535	yes	TESTIS
chr1_2337141_G_A_b38	MORN1	5.426	1.29e-07	0.055224	32	0.010178	yes	TESTIS
chr1_2355481_C_T_b38	MORN1	5.273	2.77e-07	0.124908	3	0.023688	yes	TESTIS
chr1_2364608_C_A_b38	MORN1	5.273	2.77e-07	0.124908	3	0.023688	yes	TESTIS
chr1_2367456_C_CAA_b38	MORN1	-5.086	6.91e-07	-0.053324	31	0.010485	yes	TESTIS
chr1_2348393_G_A_b38	MORN1	-5.047	8.3e-07	-0.058728	14	0.011635	yes	TESTIS
chr1_2340787_C_T_b38	MORN1	-4.996	1.06e-06	-0.05267	27	0.010542	yes	TESTIS
chr1_2359219_C_T_b38	MORN1	4.95	1.32e-06	0.133141	3	0.026898	yes	TESTIS
chr1_2312125_G_A_b38	MORN1	-4.789	2.78e-06	-0.045575	82	0.009516	yes	TESTIS
chr1_2389263_T_C_b38	MORN1	-4.702	4.13e-06	-0.051749	22	0.011005	yes	TESTIS
chr1_2364876_C_T_b38	MORN1	4.548	8.23e-06	0.118994	3	0.026165	yes	TESTIS
chr1_2343517_G_A_b38	MORN1	-4.525	9.1e-06	-0.048128	35	0.010636	yes	TESTIS
chr1_2343699_C_T_b38	MORN1	-4.525	9.1e-06	-0.048128	35	0.010636	yes	TESTIS
chr1_2391602_T_C_b38	MORN1	-4.51	9.72e-06	-0.047375	24	0.010504	yes	TESTIS
chr1_2369187_T_TA_b38	MORN1	4.399	1.57e-05	0.102641	3	0.023332	yes	TESTIS
chr1_2379954_A_G_b38	MORN1	-4.396	1.6e-05	-0.046945	23	0.01068	yes	TESTIS
chr1_2369210_C_T_b38	MORN1	-4.361	1.85e-05	-0.043734	51	0.010028	yes	TESTIS
chr1_2342133_C_G_b38	MORN1	-4.167	4.17e-05	-0.055163	10	0.013237	yes	TESTIS
chr1_2342137_G_A_b38	MORN1	-4.167	4.17e-05	-0.055163	10	0.013237	yes	TESTIS
chr1_2369118_G_A_b38	MORN1	-3.872	0.000136	-0.046709	17	0.012063	yes	TESTIS
chr1_2392569_C_T_b38	MORN1	-3.709	0.000253	-0.043821	13	0.011815	yes	TESTIS
chr1_2367306_CAA_C_b38	MORN1	3.693	0.000268	0.039382	44	0.010663	yes	TESTIS
chr1_2345829_C_CCACACA_b38	MORN1	-3.653	0.000312	-0.054492	5	0.014918	yes	TESTIS
chr1_2337352_A_G_b38	MORN1	3.638	0.00033	0.036774	44	0.010108	yes	TESTIS
chr1_2059376_C_T_b38	MORN1	3.589	0.000395	0.099383	6	0.027694	yes	TESTIS
chr1_2064837_C_T_b38	MORN1	3.589	0.000395	0.099383	6	0.027694	yes	TESTIS
chr1_2338659_A_G_b38	MORN1	3.488	0.00057	0.033433	64	0.009586	yes	TESTIS
chr1_2056778_G_T_b38	MORN1	3.443	0.000667	0.095892	6	0.027847	yes	TESTIS
chr1_2056854_G_C_b38	MORN1	3.443	0.000667	0.095892	6	0.027847	yes	TESTIS
chr1_2056874_G_C_b38	MORN1	3.443	0.000667	0.095892	6	0.027847	yes	TESTIS
chr1_2056929_C_G_b38	MORN1	3.443	0.000667	0.095892	6	0.027847	yes	TESTIS
chr1_2369355_G_GA_b38	MORN1	-3.412	0.000746	-0.03784	28	0.011092	yes	TESTIS
chr1_2360913_G_A_b38	MORN1	3.3	0.0011	0.038805	21	0.011758	yes	TESTIS
chr1_2068161_A_T_b38	MORN1	3.281	0.00117	0.089078	6	0.027146	yes	TESTIS
chr1_1546962_G_A_b38	MORN1	3.213	0.00147	0.08777	5	0.027316	yes	TESTIS
chr1_2380105_C_T_b38	MORN1	-3.195	0.00157	-0.031546	40	0.009873	yes	TESTIS
chr1_3096713_T_C_b38	MORN1	3.113	0.00205	0.030339	78	0.009745	yes	TESTIS
chr1_2309937_C_CT_b38	MORN1	-3.11	0.00208	-0.029908	70	0.009617	yes	TESTIS
chr1_1547458_A_G_b38	MORN1	3.047	0.00254	0.091283	3	0.029954	yes	TESTIS
chr1_2416027_C_T_b38	MORN1	2.956	0.00339	0.033889	18	0.011464	yes	TESTIS
chr1_2073469_G_A_b38	MORN1	2.943	0.00353	0.082192	5	0.027926	yes	TESTIS
chr1_2074426_T_TTGTGGGTC_b38	MORN1	2.943	0.00353	0.082192	5	0.027926	yes	TESTIS
chr1_2075852_C_T_b38	MORN1	2.943	0.00353	0.082192	5	0.027926	yes	TESTIS
chr1_2077119_C_T_b38	MORN1	2.943	0.00353	0.082192	5	0.027926	yes	TESTIS
chr1_2078078_T_C_b38	MORN1	2.943	0.00353	0.082192	5	0.027926	yes	TESTIS
chr1_2079357_A_G_b38	MORN1	2.943	0.00353	0.082192	5	0.027926	yes	TESTIS
chr1_2058306_AT_A_b38	MORN1	2.918	0.00383	0.058131	3	0.019924	yes	TESTIS
chr1_2335858_C_T_b38	MORN1	2.873	0.0044	0.034958	11	0.012169	yes	TESTIS
chr1_2348590_C_T_b38	MORN1	2.86	0.00457	0.081265	4	0.028412	yes	TESTIS
chr1_2416137_G_T_b38	MORN1	2.828	0.00503	0.033385	16	0.011804	yes	TESTIS
chr1_2335368_C_T_b38	MORN1	2.818	0.0052	0.0423	4	0.015012	yes	TESTIS
chr1_2295727_A_G_b38	MORN1	-2.797	0.00553	-0.02831	46	0.01012	yes	TESTIS
chr1_2419962_TC_T_b38	MORN1	2.797	0.00553	0.034667	10	0.012392	yes	TESTIS
chr1_2337299_A_G_b38	MORN1	2.786	0.00571	0.028478	41	0.01022	yes	TESTIS
chr1_2420440_C_T_b38	MORN1	2.78	0.00582	0.031433	19	0.011305	yes	TESTIS
chr1_3097471_G_A_b38	MORN1	2.78	0.00583	0.027659	78	0.009951	yes	TESTIS
chr1_2334355_G_A_b38	MORN1	2.767	0.00605	0.038382	9	0.013871	yes	TESTIS
chr1_1690745_G_GA_b38	MORN1	2.767	0.00606	0.063337	4	0.022892	yes	TESTIS
chr1_2397773_G_A_b38	MORN1	-2.746	0.00645	-0.060407	3	0.022	yes	TESTIS
chr1_3097526_A_G_b38	MORN1	2.736	0.00663	0.027369	79	0.010002	yes	TESTIS
chr1_3097069_G_A_b38	MORN1	2.718	0.007	0.027216	76	0.010013	yes	TESTIS
chr1_3097126_A_G_b38	MORN1	2.718	0.007	0.027216	76	0.010013	yes	TESTIS
chr1_3097219_C_CA_b38	MORN1	2.718	0.007	0.027216	76	0.010013	yes	TESTIS
chr1_2821510_C_T_b38	MORN1	2.718	0.007	0.056579	5	0.020816	yes	TESTIS
chr1_1739115_T_C_b38	MORN1	2.683	0.00775	0.075411	3	0.028106	yes	TESTIS
chr1_2361214_A_C_b38	MORN1	-2.669	0.00808	-0.049549	5	0.018565	yes	TESTIS
chr1_2420707_C_T_b38	MORN1	2.625	0.00915	0.030562	17	0.011641	yes	TESTIS
chr1_2077005_T_C_b38	MORN1	-2.625	0.00916	-0.028109	35	0.010708	yes	TESTIS
chr1_2362718_G_A_b38	MORN1	6.48	4.41e-10	0.068793	21	0.010617	no	TESTIS
chr1_2356409_G_C_b38	MORN1	6.444	5.39e-10	0.068755	23	0.010669	no	TESTIS
chr1_2364499_A_G_b38	MORN1	6.35	9.23e-10	0.065285	26	0.010282	no	TESTIS
chr1_2348378_C_T_b38	MORN1	6.328	1.05e-09	0.068214	19	0.01078	no	TESTIS
chr1_2350696_G_A_b38	MORN1	6.218	1.93e-09	0.066727	20	0.010731	no	TESTIS
chr1_2337211_C_G_b38	MORN1	6.04	5.16e-09	0.058961	41	0.009762	no	TESTIS
chr1_2363405_C_T_b38	MORN1	6.004	6.26e-09	0.063649	28	0.010601	no	TESTIS
chr1_2353743_A_T_b38	MORN1	5.596	5.42e-08	0.060211	30	0.010759	no	TESTIS
chr1_2350750_AGGGGTGGCACG_A_b38	MORN1	-5.482	9.75e-08	-0.0621	15	0.011329	no	TESTIS
chr1_2364339_A_C_b38	MORN1	-5.392	1.53e-07	-0.053346	41	0.009893	no	TESTIS
chr1_2337229_A_G_b38	MORN1	5.332	2.07e-07	0.05233	60	0.009815	no	TESTIS
chr1_2366816_A_G_b38	MORN1	-5.259	2.98e-07	-0.052256	41	0.009937	no	TESTIS
chr1_2352756_T_C_b38	MORN1	-5.095	6.6e-07	-0.050506	42	0.009912	no	TESTIS
chr1_2366555_G_C_b38	MORN1	-5.071	7.41e-07	-0.05083	40	0.010024	no	TESTIS
chr1_2365236_C_T_b38	MORN1	-5.062	7.75e-07	-0.050478	40	0.009973	no	TESTIS
chr1_2368939_G_C_b38	MORN1	-5.017	9.59e-07	-0.050275	40	0.010021	no	TESTIS
chr1_2368718_C_A_b38	MORN1	-4.99	1.09e-06	-0.049831	40	0.009987	no	TESTIS
chr1_2366243_C_T_b38	MORN1	-4.984	1.12e-06	-0.050076	39	0.010047	no	TESTIS
chr1_2366496_A_T_b38	MORN1	-4.939	1.38e-06	-0.049733	40	0.010069	no	TESTIS
chr1_2367799_C_T_b38	MORN1	-4.939	1.38e-06	-0.049733	40	0.010069	no	TESTIS
chr1_2367197_G_A_b38	MORN1	-4.771	3.02e-06	-0.048253	39	0.010114	no	TESTIS
chr1_2362229_A_G_b38	MORN1	-4.76	3.17e-06	-0.059976	12	0.012599	no	TESTIS
chr1_2362863_C_CA_b38	MORN1	-4.696	4.24e-06	-0.060084	11	0.012793	no	TESTIS
chr1_2351241_C_T_b38	MORN1	-4.696	4.25e-06	-0.048801	39	0.010392	no	TESTIS
chr1_2354645_C_T_b38	MORN1	-4.691	4.35e-06	-0.059001	12	0.012578	no	TESTIS
chr1_2354688_G_C_b38	MORN1	-4.691	4.35e-06	-0.059001	12	0.012578	no	TESTIS
chr1_2347212_C_T_b38	MORN1	-4.68	4.57e-06	-0.057226	11	0.012228	no	TESTIS
chr1_2344256_A_T_b38	MORN1	4.653	5.15e-06	0.05145	17	0.011057	no	TESTIS
chr1_2351215_T_G_b38	MORN1	-4.647	5.3e-06	-0.058606	12	0.012612	no	TESTIS
chr1_2351551_C_T_b38	MORN1	4.638	5.53e-06	0.053188	15	0.011469	no	TESTIS
chr1_2341451_G_A_b38	MORN1	4.628	5.77e-06	0.050342	20	0.010879	no	TESTIS
chr1_2365333_G_A_b38	MORN1	-4.62	5.96e-06	-0.046185	40	0.009996	no	TESTIS
chr1_2340625_G_A_b38	MORN1	4.608	6.3e-06	0.049845	21	0.010816	no	TESTIS
chr1_2337131_A_G_b38	MORN1	4.594	6.7e-06	0.045656	45	0.009937	no	TESTIS
chr1_2344757_C_A_b38	MORN1	4.573	7.38e-06	0.051907	16	0.011352	no	TESTIS
chr1_2344761_T_A_b38	MORN1	4.573	7.38e-06	0.051907	16	0.011352	no	TESTIS
chr1_2345727_G_A_b38	MORN1	4.573	7.38e-06	0.051907	16	0.011352	no	TESTIS
chr1_2350934_C_T_b38	MORN1	4.573	7.38e-06	0.051907	16	0.011352	no	TESTIS
chr1_2359472_G_A_b38	MORN1	4.541	8.47e-06	0.043436	51	0.009565	no	TESTIS
chr1_2340807_G_A_b38	MORN1	4.541	8.49e-06	0.049133	21	0.010821	no	TESTIS
chr1_2344634_T_C_b38	MORN1	4.499	1.02e-05	0.05106	16	0.01135	no	TESTIS
chr1_2351678_C_T_b38	MORN1	-4.49	1.06e-05	-0.056702	11	0.012628	no	TESTIS
chr1_2356095_C_T_b38	MORN1	4.406	1.53e-05	0.050746	16	0.011518	no	TESTIS
chr1_2357882_G_A_b38	MORN1	4.406	1.53e-05	0.050746	16	0.011518	no	TESTIS
chr1_2345849_ACACACAG_A_b38	MORN1	4.403	1.55e-05	0.052779	12	0.011987	no	TESTIS
chr1_2344932_C_T_b38	MORN1	4.372	1.76e-05	0.051288	13	0.011731	no	TESTIS
chr1_2340425_C_T_b38	MORN1	-4.37	1.78e-05	-0.042086	62	0.009631	no	TESTIS
chr1_2367055_C_A_b38	MORN1	4.345	1.98e-05	0.048221	19	0.011099	no	TESTIS
chr1_2344980_A_G_b38	MORN1	4.187	3.84e-05	0.046426	18	0.011088	no	TESTIS
chr1_2345774_T_C_b38	MORN1	4.187	3.84e-05	0.046426	18	0.011088	no	TESTIS
chr1_2366021_T_C_b38	MORN1	-4.163	4.24e-05	-0.038716	71	0.0093	no	TESTIS
chr1_2364657_A_T_b38	MORN1	-4.144	4.58e-05	-0.038067	75	0.009185	no	TESTIS
chr1_2364658_A_T_b38	MORN1	-4.144	4.58e-05	-0.038067	75	0.009185	no	TESTIS
chr1_2348700_C_T_b38	MORN1	-4.059	6.47e-05	-0.043729	33	0.010772	no	TESTIS
chr1_2363829_A_T_b38	MORN1	-3.887	0.000128	-0.039158	40	0.010073	no	TESTIS
chr1_2324194_G_A_b38	MORN1	3.829	0.00016	0.073349	4	0.019156	no	TESTIS
chr1_1773715_T_TGAGA_b38	MORN1	3.77	0.000201	0.093135	3	0.024707	no	TESTIS
chr1_2340564_G_A_b38	MORN1	3.73	0.000234	0.041452	19	0.011114	no	TESTIS
chr1_2340235_T_C_b38	MORN1	3.724	0.00024	0.040224	23	0.010803	no	TESTIS
chr1_2341692_GA_G_b38	MORN1	3.72	0.000243	0.037234	39	0.010009	no	TESTIS
chr1_2315074_A_G_b38	MORN1	-3.556	0.000446	-0.038342	28	0.010783	no	TESTIS
chr1_2340764_G_T_b38	MORN1	3.542	0.000468	0.038298	23	0.010811	no	TESTIS
chr1_2343445_C_T_b38	MORN1	3.455	0.00064	0.038723	19	0.011208	no	TESTIS
chr1_2359882_C_CAA_b38	MORN1	3.45	0.000651	0.045453	10	0.013175	no	TESTIS
chr1_2320961_AG_A_b38	MORN1	3.436	0.000685	0.036885	24	0.010735	no	TESTIS
chr1_2346801_C_T_b38	MORN1	-3.431	0.000697	-0.033477	81	0.009758	no	TESTIS
chr1_2350539_T_G_b38	MORN1	-3.425	0.000712	-0.032727	73	0.009556	no	TESTIS
chr1_2377078_C_G_b38	MORN1	-3.423	0.000717	-0.053643	4	0.015671	no	TESTIS
chr1_2349222_G_A_b38	MORN1	-3.415	0.000736	-0.032892	82	0.009631	no	TESTIS
chr1_2344583_G_A_b38	MORN1	3.351	0.000923	0.03791	18	0.011314	no	TESTIS
chr1_2382880_T_C_b38	MORN1	-3.326	0.00101	-0.050651	5	0.015231	no	TESTIS
chr1_2363785_A_AAAAC_b38	MORN1	3.257	0.00127	0.084294	4	0.025882	no	TESTIS
chr1_2380209_G_A_b38	MORN1	-3.198	0.00155	-0.03164	40	0.009894	no	TESTIS
chr1_2314000_T_C_b38	MORN1	-3.175	0.00168	-0.034175	29	0.010765	no	TESTIS
chr1_2767648_A_T_b38	MORN1	-3.167	0.00172	-0.040362	16	0.012747	no	TESTIS
chr1_2758225_G_C_b38	MORN1	-3.114	0.00205	-0.043675	12	0.014024	no	TESTIS
chr1_2314194_C_T_b38	MORN1	-3.098	0.00215	-0.033791	30	0.010906	no	TESTIS
chr1_2245578_C_T_b38	MORN1	-3.039	0.00261	-0.04282	10	0.014091	no	TESTIS
chr1_2325032_T_A_b38	MORN1	3.021	0.00277	0.061951	7	0.02051	no	TESTIS
chr1_2321320_A_G_b38	MORN1	3.009	0.00287	0.031059	40	0.010321	no	TESTIS
chr1_2314131_C_G_b38	MORN1	-2.988	0.00307	-0.032728	32	0.010952	no	TESTIS
chr1_2341705_A_G_b38	MORN1	2.987	0.00308	0.029569	67	0.0099	no	TESTIS
chr1_2327187_CAG_C_b38	MORN1	2.981	0.00313	0.037227	18	0.012487	no	TESTIS
chr1_2409621_C_T_b38	MORN1	-2.953	0.00343	-0.032456	23	0.010992	no	TESTIS
chr1_2314848_G_C_b38	MORN1	-2.9	0.00404	-0.03166	30	0.010917	no	TESTIS
chr1_3369296_G_A_b38	MORN1	2.892	0.00414	0.036403	12	0.012587	no	TESTIS
chr1_2326447_G_C_b38	MORN1	2.853	0.00467	0.033183	22	0.01163	no	TESTIS
chr1_2808134_G_A_b38	MORN1	2.842	0.00483	0.066858	3	0.023524	no	TESTIS
chr1_2313782_C_T_b38	MORN1	-2.825	0.00508	-0.031197	31	0.011042	no	TESTIS
chr1_2342734_T_C_b38	MORN1	-2.812	0.00529	-0.03373	16	0.011996	no	TESTIS
chr1_2064022_T_G_b38	MORN1	2.801	0.00546	0.063433	11	0.022645	no	TESTIS
chr1_2196630_A_G_b38	MORN1	2.801	0.00547	0.037761	12	0.013483	no	TESTIS
chr1_2332063_T_C_b38	MORN1	2.797	0.00554	0.042224	10	0.015098	no	TESTIS
chr1_2316048_A_G_b38	MORN1	-2.737	0.00662	-0.030464	23	0.011131	no	TESTIS
chr1_2333899_TGCTGGAAAGAACA_T_b38	MORN1	2.736	0.00663	0.031763	22	0.011607	no	TESTIS
chr1_2329738_C_T_b38	MORN1	2.719	0.00699	0.04093	13	0.015056	no	TESTIS
chr1_2677333_C_G_b38	MORN1	2.714	0.00709	0.059948	5	0.022091	no	TESTIS
chr1_2333258_C_T_b38	MORN1	2.711	0.00714	0.031566	22	0.011643	no	TESTIS
chr1_2325494_G_A_b38	MORN1	2.708	0.0072	0.040246	11	0.014861	no	TESTIS
chr1_2325768_C_A_b38	MORN1	2.708	0.0072	0.040246	11	0.014861	no	TESTIS
chr1_2326256_G_A_b38	MORN1	2.708	0.0072	0.040246	11	0.014861	no	TESTIS
chr1_2060607_C_T_b38	MORN1	-2.707	0.00723	-0.03787	7	0.013991	no	TESTIS
chr1_2380956_C_T_b38	MORN1	-2.698	0.00741	-0.033167	12	0.012292	no	TESTIS
chr1_2382101_A_G_b38	MORN1	-2.698	0.00741	-0.033167	12	0.012292	no	TESTIS
chr1_2327229_GACACAGAAAC_G_b38	MORN1	-2.679	0.00783	-0.028482	27	0.01063	no	TESTIS
chr1_2320752_A_G_b38	MORN1	2.673	0.00799	0.029631	20	0.011088	no	TESTIS
chr1_2319680_A_G_b38	MORN1	2.671	0.00803	0.029089	25	0.010891	no	TESTIS
chr1_3336650_G_GTC_b38	MORN1	-2.637	0.00886	-0.028402	28	0.010771	no	TESTIS
chr1_2320543_C_T_b38	MORN1	2.628	0.00909	0.029519	19	0.011234	no	TESTIS
chr1_2886982_G_A_b38	MORN1	2.626	0.00913	0.089139	3	0.033942	no	TESTIS
chr1_2327507_C_CA_b38	MORN1	2.622	0.00925	0.039147	10	0.014932	no	TESTIS
chr1_2407956_A_G_b38	MORN1	-2.613	0.00947	-0.03002	15	0.011487	no	TESTIS
chr1_2300128_G_T_b38	MORN1	-2.595	0.00997	-0.025524	80	0.009834	no	TESTIS
chr1_2364339_A_C_b38	MORN1	-11.096	9.65e-26	-0.088121	80	0.007942	yes	THYROID
chr1_2367872_A_G_b38	MORN1	-11.067	1.25e-25	-0.087519	84	0.007908	yes	THYROID
chr1_2368188_T_C_b38	MORN1	-11.058	1.36e-25	-0.087318	84	0.007897	yes	THYROID
chr1_2366816_A_G_b38	MORN1	-10.943	3.8e-25	-0.087413	79	0.007988	yes	THYROID
chr1_2368473_T_C_b38	MORN1	-10.888	6.18e-25	-0.086789	89	0.007971	yes	THYROID
chr1_2366555_G_C_b38	MORN1	-10.753	2.04e-24	-0.086375	77	0.008032	yes	THYROID
chr1_2367799_C_T_b38	MORN1	-10.65	5.07e-24	-0.086206	76	0.008094	yes	THYROID
chr1_2366956_CAAAATACATAGA_C_b38	MORN1	-10.646	5.24e-24	-0.086128	80	0.00809	yes	THYROID
chr1_2366496_A_T_b38	MORN1	-10.596	8.14e-24	-0.085715	76	0.00809	yes	THYROID
chr1_2368939_G_C_b38	MORN1	-10.496	1.95e-23	-0.085104	76	0.008109	yes	THYROID
chr1_2365236_C_T_b38	MORN1	-10.484	2.16e-23	-0.084837	76	0.008092	yes	THYROID
chr1_2352756_T_C_b38	MORN1	-10.478	2.27e-23	-0.084793	77	0.008092	yes	THYROID
chr1_2367197_G_A_b38	MORN1	-10.423	3.65e-23	-0.084667	75	0.008123	yes	THYROID
chr1_2366243_C_T_b38	MORN1	-10.41	4.08e-23	-0.084829	74	0.008148	yes	THYROID
chr1_2365333_G_A_b38	MORN1	-10.325	8.52e-23	-0.084077	75	0.008143	yes	THYROID
chr1_2368718_C_A_b38	MORN1	-10.237	1.81e-22	-0.083329	75	0.00814	yes	THYROID
chr1_2351241_C_T_b38	MORN1	-10.001	1.35e-21	-0.082363	75	0.008236	yes	THYROID
chr1_2348700_C_T_b38	MORN1	-9.54	6.14e-20	-0.082819	60	0.008681	yes	THYROID
chr1_2343699_C_T_b38	MORN1	-9.479	1.01e-19	-0.080124	69	0.008453	yes	THYROID
chr1_2367456_C_CAA_b38	MORN1	-9.451	1.27e-19	-0.08162	57	0.008636	yes	THYROID
chr1_2343517_G_A_b38	MORN1	-9.395	1.99e-19	-0.079532	69	0.008465	yes	THYROID
chr1_2363829_A_T_b38	MORN1	-9.285	4.85e-19	-0.073542	78	0.007921	yes	THYROID
chr1_2369210_C_T_b38	MORN1	-9.274	5.27e-19	-0.076172	90	0.008213	yes	THYROID
chr1_2366021_T_C_b38	MORN1	-8.905	9.75e-18	-0.072692	123	0.008163	yes	THYROID
chr1_2364657_A_T_b38	MORN1	-8.834	1.69e-17	-0.071451	127	0.008088	yes	THYROID
chr1_2364658_A_T_b38	MORN1	-8.834	1.69e-17	-0.071451	127	0.008088	yes	THYROID
chr1_2350750_AGGGGTGGCACG_A_b38	MORN1	-7.685	8.06e-14	-0.075893	29	0.009875	yes	THYROID
chr1_2348393_G_A_b38	MORN1	-7.53	2.37e-13	-0.075971	26	0.01009	yes	THYROID
chr1_2362229_A_G_b38	MORN1	-7.105	4.14e-12	-0.075906	22	0.010683	yes	THYROID
chr1_2351215_T_G_b38	MORN1	-7.099	4.32e-12	-0.075134	23	0.010585	yes	THYROID
chr1_2351678_C_T_b38	MORN1	-6.988	8.91e-12	-0.074397	22	0.010647	yes	THYROID
chr1_2362863_C_CA_b38	MORN1	-6.887	1.7e-11	-0.07792	14	0.011314	yes	THYROID
chr1_2347212_C_T_b38	MORN1	-6.875	1.84e-11	-0.072885	21	0.010601	yes	THYROID
chr1_2353459_T_G_b38	MORN1	6.641	8.09e-11	0.055365	121	0.008337	yes	THYROID
chr1_2356177_T_C_b38	MORN1	6.641	8.09e-11	0.055365	121	0.008337	yes	THYROID
chr1_2352403_G_T_b38	MORN1	6.636	8.37e-11	0.055121	124	0.008307	yes	THYROID
chr1_2360716_T_C_b38	MORN1	6.606	1.01e-10	0.055248	124	0.008364	yes	THYROID
chr1_2360970_T_C_b38	MORN1	6.606	1.01e-10	0.055248	124	0.008364	yes	THYROID
chr1_2361332_A_AG_b38	MORN1	6.606	1.01e-10	0.055248	124	0.008364	yes	THYROID
chr1_2361548_A_ACT_b38	MORN1	6.606	1.01e-10	0.055248	124	0.008364	yes	THYROID
chr1_2358849_T_C_b38	MORN1	6.536	1.55e-10	0.054645	124	0.008361	yes	THYROID
chr1_2352457_A_G_b38	MORN1	6.52	1.71e-10	0.054316	125	0.00833	yes	THYROID
chr1_2357308_T_C_b38	MORN1	6.215	1.08e-09	0.052527	127	0.008452	yes	THYROID
chr1_2350696_G_A_b38	MORN1	6.089	2.26e-09	0.057489	43	0.009442	yes	THYROID
chr1_2348378_C_T_b38	MORN1	6.068	2.55e-09	0.057499	42	0.009476	yes	THYROID
chr1_2364499_A_G_b38	MORN1	6.062	2.64e-09	0.054961	53	0.009066	yes	THYROID
chr1_2359472_G_A_b38	MORN1	6.042	2.97e-09	0.051077	89	0.008454	yes	THYROID
chr1_2362718_G_A_b38	MORN1	6.019	3.38e-09	0.05613	45	0.009325	yes	THYROID
chr1_2363405_C_T_b38	MORN1	5.987	4.07e-09	0.055555	54	0.00928	yes	THYROID
chr1_2356409_G_C_b38	MORN1	5.84	9.36e-09	0.054889	49	0.009398	yes	THYROID
chr1_2342133_C_G_b38	MORN1	-5.817	1.07e-08	-0.066286	17	0.011395	yes	THYROID
chr1_2342137_G_A_b38	MORN1	-5.817	1.07e-08	-0.066286	17	0.011395	yes	THYROID
chr1_2351551_C_T_b38	MORN1	5.37	1.2e-07	0.055108	26	0.010262	yes	THYROID
chr1_2369713_ATAAT_A_b38	MORN1	-5.185	3.14e-07	-0.056118	20	0.010824	yes	THYROID
chr1_2357882_G_A_b38	MORN1	5.173	3.33e-07	0.052138	29	0.010079	yes	THYROID
chr1_2369336_A_G_b38	MORN1	-5.154	3.66e-07	-0.05568	22	0.010803	yes	THYROID
chr1_2369118_G_A_b38	MORN1	-5.149	3.77e-07	-0.056237	23	0.010923	yes	THYROID
chr1_2356095_C_T_b38	MORN1	4.904	1.27e-06	0.050142	28	0.010225	yes	THYROID
chr1_2357811_C_G_b38	MORN1	-4.727	2.96e-06	-0.052162	18	0.011035	yes	THYROID
chr1_2357812_T_C_b38	MORN1	-4.727	2.96e-06	-0.052162	18	0.011035	yes	THYROID
chr1_2359828_A_G_b38	MORN1	-4.727	2.96e-06	-0.052162	18	0.011035	yes	THYROID
chr1_2363591_T_G_b38	MORN1	-4.727	2.96e-06	-0.052162	18	0.011035	yes	THYROID
chr1_2367871_C_T_b38	MORN1	-4.663	4e-06	-0.051612	18	0.011069	yes	THYROID
chr1_2350287_A_C_b38	MORN1	-4.655	4.15e-06	-0.051007	18	0.010957	yes	THYROID
chr1_2353047_C_T_b38	MORN1	-4.607	5.19e-06	-0.050489	18	0.01096	yes	THYROID
chr1_2344932_C_A_b38	MORN1	-4.578	5.93e-06	-0.050286	18	0.010985	yes	THYROID
chr1_2365220_A_G_b38	MORN1	-4.559	6.45e-06	-0.051711	17	0.011342	yes	THYROID
chr1_2359882_C_CAA_b38	MORN1	4.415	1.24e-05	0.047861	22	0.010842	yes	THYROID
chr1_2359882_C_CA_b38	MORN1	-4.29	2.15e-05	-0.044265	32	0.010319	yes	THYROID
chr1_2391602_T_C_b38	MORN1	-4.191	3.28e-05	-0.038217	46	0.009119	yes	THYROID
chr1_2364484_C_T_b38	MORN1	-4.045	6.05e-05	-0.045078	21	0.011143	yes	THYROID
chr1_2340625_G_A_b38	MORN1	3.933	9.55e-05	0.038989	36	0.009912	yes	THYROID
chr1_2345829_C_CCACACA_b38	MORN1	-3.848	0.000134	-0.05105	10	0.013267	yes	THYROID
chr1_2337229_A_G_b38	MORN1	3.8	0.000163	0.033322	105	0.00877	yes	THYROID
chr1_2337239_T_C_b38	MORN1	3.749	0.000198	0.035759	51	0.009537	yes	THYROID
chr1_2319680_A_G_b38	MORN1	3.713	0.000228	0.035798	41	0.009641	yes	THYROID
chr1_2325768_C_T_b38	MORN1	-3.657	0.000282	-0.058047	3	0.015871	yes	THYROID
chr1_2379954_A_G_b38	MORN1	-3.566	0.000398	-0.032986	44	0.009251	yes	THYROID
chr1_2315074_A_G_b38	MORN1	-3.518	0.000474	-0.033818	46	0.009612	yes	THYROID
chr1_2319909_G_A_b38	MORN1	3.493	0.00052	0.033716	44	0.009653	yes	THYROID
chr1_2319721_T_C_b38	MORN1	3.477	0.000551	0.03363	43	0.009672	yes	THYROID
chr1_2328587_C_T_b38	MORN1	-3.474	0.000557	-0.054389	3	0.015656	yes	THYROID
chr1_3313405_G_A_b38	MORN1	-3.362	0.000834	-0.049022	4	0.014583	yes	THYROID
chr1_2361214_A_C_b38	MORN1	-3.335	0.000917	-0.057158	5	0.017141	yes	THYROID
chr1_1582556_T_C_b38	MORN1	3.249	0.00123	0.040449	14	0.012448	yes	THYROID
chr1_3310922_A_G_b38	MORN1	-3.214	0.00139	-0.04693	4	0.0146	yes	THYROID
chr1_2340267_T_C_b38	MORN1	3.175	0.00159	0.03765	14	0.011859	yes	THYROID
chr1_2320961_AG_A_b38	MORN1	3.161	0.00167	0.030573	42	0.009672	yes	THYROID
chr1_2315960_T_C_b38	MORN1	-3.154	0.00171	-0.030849	40	0.009781	yes	THYROID
chr1_2319918_C_A_b38	MORN1	3.145	0.00176	0.030322	51	0.009641	yes	THYROID
chr1_2297717_C_T_b38	MORN1	-3.141	0.00178	-0.034524	22	0.01099	yes	THYROID
chr1_2316048_A_G_b38	MORN1	-3.125	0.00188	-0.030469	41	0.009751	yes	THYROID
chr1_2758226_C_G_b38	MORN1	-3.104	0.00202	-0.079423	3	0.02559	yes	THYROID
chr1_3310983_G_A_b38	MORN1	-3.093	0.00209	-0.045037	4	0.014563	yes	THYROID
chr1_1735008_G_GTTTT_b38	MORN1	3.082	0.00217	0.024968	161	0.008101	yes	THYROID
chr1_3310606_A_C_b38	MORN1	-3.065	0.00229	-0.044787	4	0.014611	yes	THYROID
chr1_2314000_T_C_b38	MORN1	-3.052	0.00239	-0.029682	49	0.009725	yes	THYROID
chr1_1485324_C_T_b38	MORN1	3.017	0.00268	0.045202	5	0.014982	yes	THYROID
chr1_2369187_T_TA_b38	MORN1	2.981	0.00301	0.061597	7	0.020662	yes	THYROID
chr1_2316546_T_C_b38	MORN1	-2.923	0.00362	-0.028564	44	0.00977	yes	THYROID
chr1_2392569_C_T_b38	MORN1	-2.911	0.00377	-0.031204	24	0.010721	yes	THYROID
chr1_2317797_G_A_b38	MORN1	-2.91	0.00377	-0.028597	43	0.009827	yes	THYROID
chr1_1515828_G_A_b38	MORN1	2.894	0.00396	0.044091	5	0.015233	yes	THYROID
chr1_1479704_G_A_b38	MORN1	2.888	0.00404	0.041455	9	0.014353	yes	THYROID
chr1_2303580_T_C_b38	MORN1	-2.886	0.00407	-0.028573	35	0.009901	yes	THYROID
chr1_2314194_C_T_b38	MORN1	-2.877	0.00418	-0.027798	53	0.009662	yes	THYROID
chr1_2320752_A_G_b38	MORN1	2.871	0.00426	0.028666	35	0.009985	yes	THYROID
chr1_3335602_A_AACACACACACAC_b38	MORN1	2.857	0.00446	0.045589	3	0.015959	yes	THYROID
chr1_2298478_C_T_b38	MORN1	-2.844	0.00464	-0.031256	22	0.010991	yes	THYROID
chr1_2313782_C_T_b38	MORN1	-2.831	0.00482	-0.027634	56	0.00976	yes	THYROID
chr1_2363805_C_CAAACAA_b38	MORN1	2.807	0.00519	0.028656	42	0.010209	yes	THYROID
chr1_2340425_C_T_b38	MORN1	-2.794	0.00541	-0.024112	117	0.00863	yes	THYROID
chr1_2314848_G_C_b38	MORN1	-2.76	0.006	-0.026654	56	0.009658	yes	THYROID
chr1_1495136_G_A_b38	MORN1	2.759	0.006	0.04125	6	0.014948	yes	THYROID
chr1_1737504_A_C_b38	MORN1	2.758	0.00603	0.022902	169	0.008305	yes	THYROID
chr1_2380105_C_T_b38	MORN1	-2.743	0.0063	-0.023677	76	0.00863	yes	THYROID
chr1_2345829_CCACA_C_b38	MORN1	-2.731	0.00653	-0.027375	34	0.010023	yes	THYROID
chr1_2320543_C_T_b38	MORN1	2.699	0.00718	0.026948	36	0.009983	yes	THYROID
chr1_2370170_G_T_b38	MORN1	-2.637	0.00863	-0.026212	39	0.009942	yes	THYROID
chr1_2355481_C_T_b38	MORN1	2.593	0.0098	0.053538	7	0.020651	yes	THYROID
chr1_2364608_C_A_b38	MORN1	2.593	0.0098	0.053538	7	0.020651	yes	THYROID
chr1_2349222_G_A_b38	MORN1	-8.267	1.23e-15	-0.068474	144	0.008283	no	THYROID
chr1_2350539_T_G_b38	MORN1	-8.17	2.51e-15	-0.066839	126	0.008181	no	THYROID
chr1_2346801_C_T_b38	MORN1	-8.06	5.59e-15	-0.067533	143	0.008379	no	THYROID
chr1_2340787_C_T_b38	MORN1	-7.755	4.94e-14	-0.069198	53	0.008923	no	THYROID
chr1_2354645_C_T_b38	MORN1	-7.101	4.24e-12	-0.076307	21	0.010745	no	THYROID
chr1_2354688_G_C_b38	MORN1	-7.101	4.24e-12	-0.076307	21	0.010745	no	THYROID
chr1_2343937_T_G_b38	MORN1	-7.038	6.4e-12	-0.059148	102	0.008403	no	THYROID
chr1_2347542_C_T_b38	MORN1	-6.996	8.42e-12	-0.059027	110	0.008437	no	THYROID
chr1_2341705_A_G_b38	MORN1	6.914	1.44e-11	0.057741	133	0.008352	no	THYROID
chr1_2346111_G_C_b38	MORN1	-6.633	8.49e-11	-0.056139	108	0.008463	no	THYROID
chr1_2338659_A_G_b38	MORN1	6.562	1.32e-10	0.054489	121	0.008304	no	THYROID
chr1_2337352_A_G_b38	MORN1	5.929	5.68e-09	0.051119	92	0.008622	no	THYROID
chr1_2353743_A_T_b38	MORN1	5.545	4.75e-08	0.052294	58	0.009431	no	THYROID
chr1_2337299_A_G_b38	MORN1	5.32	1.57e-07	0.046495	82	0.00874	no	THYROID
chr1_2344757_C_A_b38	MORN1	5.301	1.73e-07	0.053698	28	0.01013	no	THYROID
chr1_2344761_T_A_b38	MORN1	5.301	1.73e-07	0.053698	28	0.01013	no	THYROID
chr1_2344634_T_C_b38	MORN1	5.257	2.17e-07	0.053171	28	0.010115	no	THYROID
chr1_2345727_G_A_b38	MORN1	5.253	2.22e-07	0.053274	28	0.010142	no	THYROID
chr1_2350934_C_T_b38	MORN1	5.253	2.22e-07	0.053274	28	0.010142	no	THYROID
chr1_2344256_A_T_b38	MORN1	5.198	2.93e-07	0.051721	30	0.00995	no	THYROID
chr1_2369355_G_GA_b38	MORN1	-5.175	3.3e-07	-0.048735	56	0.009417	no	THYROID
chr1_2367055_C_A_b38	MORN1	5.169	3.4e-07	0.050144	34	0.009701	no	THYROID
chr1_2345849_ACACACAG_A_b38	MORN1	5.013	7.44e-07	0.053305	20	0.010634	no	THYROID
chr1_2344980_A_G_b38	MORN1	4.951	1.01e-06	0.049245	30	0.009947	no	THYROID
chr1_2345774_T_C_b38	MORN1	4.901	1.29e-06	0.048789	30	0.009955	no	THYROID
chr1_2337211_C_G_b38	MORN1	4.858	1.59e-06	0.043851	71	0.009026	no	THYROID
chr1_2338460_T_C_b38	MORN1	4.705	3.28e-06	0.041209	73	0.008758	no	THYROID
chr1_2338570_C_T_b38	MORN1	4.688	3.55e-06	0.041248	69	0.008798	no	THYROID
chr1_2344932_C_T_b38	MORN1	4.666	3.95e-06	0.049116	23	0.010527	no	THYROID
chr1_2367644_G_A_b38	MORN1	-4.65	4.25e-06	-0.041343	76	0.008891	no	THYROID
chr1_2342734_T_C_b38	MORN1	-4.604	5.25e-06	-0.046167	31	0.010027	no	THYROID
chr1_2346676_G_C_b38	MORN1	-4.563	6.33e-06	-0.050137	18	0.010987	no	THYROID
chr1_2340807_G_A_b38	MORN1	4.239	2.67e-05	0.041866	35	0.009877	no	THYROID
chr1_2341451_G_A_b38	MORN1	4.194	3.24e-05	0.041598	34	0.009919	no	THYROID
chr1_2389263_T_C_b38	MORN1	-4.171	3.57e-05	-0.040502	38	0.00971	no	THYROID
chr1_2343445_C_T_b38	MORN1	4.065	5.58e-05	0.039581	35	0.009737	no	THYROID
chr1_2324806_A_T_b38	MORN1	3.895	0.000111	0.035662	73	0.009155	no	THYROID
chr1_2344583_G_A_b38	MORN1	3.864	0.000126	0.038377	32	0.009932	no	THYROID
chr1_2333737_T_C_b38	MORN1	3.848	0.000134	0.035887	62	0.009326	no	THYROID
chr1_2334530_T_G_b38	MORN1	3.777	0.000178	0.035346	61	0.009358	no	THYROID
chr1_2370252_G_A_b38	MORN1	3.767	0.000185	0.040723	19	0.010809	no	THYROID
chr1_2364412_G_GTTGT_b38	MORN1	-3.683	0.000255	-0.037206	36	0.010101	no	THYROID
chr1_2346388_G_A_b38	MORN1	-3.661	0.000277	-0.039424	24	0.010768	no	THYROID
chr1_2359451_C_T_b38	MORN1	-3.66	0.000279	-0.039287	25	0.010734	no	THYROID
chr1_2361727_G_A_b38	MORN1	-3.66	0.000279	-0.039287	25	0.010734	no	THYROID
chr1_2360241_T_C_b38	MORN1	-3.659	0.00028	-0.03914	25	0.010698	no	THYROID
chr1_2348984_A_C_b38	MORN1	-3.64	3e-04	-0.039031	25	0.010722	no	THYROID
chr1_2356078_T_C_b38	MORN1	-3.64	3e-04	-0.039031	25	0.010722	no	THYROID
chr1_2351337_G_C_b38	MORN1	-3.639	0.000302	-0.038888	25	0.010686	no	THYROID
chr1_2353975_G_A_b38	MORN1	-3.615	0.000331	-0.038849	25	0.010748	no	THYROID
chr1_2355508_A_G_b38	MORN1	-3.615	0.000331	-0.038849	25	0.010748	no	THYROID
chr1_2368212_T_C_b38	MORN1	-3.588	0.000366	-0.038566	25	0.010749	no	THYROID
chr1_2352564_T_C_b38	MORN1	-3.586	0.000369	-0.038465	25	0.010727	no	THYROID
chr1_2364485_A_G_b38	MORN1	-3.549	0.000423	-0.035994	37	0.010142	no	THYROID
chr1_2359221_T_C_b38	MORN1	-3.523	0.000465	-0.037523	26	0.010651	no	THYROID
chr1_2340235_T_C_b38	MORN1	3.453	0.000601	0.033338	41	0.009655	no	THYROID
chr1_2309937_C_CT_b38	MORN1	-3.445	0.000618	-0.028367	150	0.008234	no	THYROID
chr1_2364506_G_A_b38	MORN1	-3.355	0.000853	-0.033654	35	0.01003	no	THYROID
chr1_3314073_G_GGGGGT_b38	MORN1	-3.345	0.000883	-0.044354	14	0.013258	no	THYROID
chr1_3311588_T_G_b38	MORN1	-3.334	0.00092	-0.048634	4	0.014588	no	THYROID
chr1_3311597_C_T_b38	MORN1	-3.334	0.00092	-0.048634	4	0.014588	no	THYROID
chr1_3312219_G_T_b38	MORN1	-3.334	0.00092	-0.048634	4	0.014588	no	THYROID
chr1_3312621_G_A_b38	MORN1	-3.334	0.00092	-0.048634	4	0.014588	no	THYROID
chr1_3312694_A_G_b38	MORN1	-3.334	0.00092	-0.048634	4	0.014588	no	THYROID
chr1_3313956_T_C_b38	MORN1	-3.334	0.00092	-0.048634	4	0.014588	no	THYROID
chr1_2341042_C_T_b38	MORN1	3.31	0.000999	0.039588	13	0.011959	no	THYROID
chr1_2340764_G_T_b38	MORN1	3.236	0.00129	0.031434	39	0.009713	no	THYROID
chr1_2324849_C_A_b38	MORN1	3.216	0.00138	0.032995	26	0.010259	no	THYROID
chr1_2316943_G_GC_b38	MORN1	-3.201	0.00146	-0.030986	44	0.00968	no	THYROID
chr1_2316944_G_T_b38	MORN1	-3.201	0.00146	-0.030986	44	0.00968	no	THYROID
chr1_2344510_C_G_b38	MORN1	-3.18	0.00156	-0.03762	15	0.011829	no	THYROID
chr1_2342999_A_G_b38	MORN1	-3.151	0.00172	-0.030214	44	0.009588	no	THYROID
chr1_2304900_T_C_b38	MORN1	-3.128	0.00186	-0.036217	14	0.01158	no	THYROID
chr1_2327034_G_A_b38	MORN1	3.112	0.00197	0.028299	77	0.009094	no	THYROID
chr1_2324977_G_GGCT_b38	MORN1	3.108	0.00199	0.028778	74	0.009258	no	THYROID
chr1_2341692_GAAA_G_b38	MORN1	3.103	0.00202	0.036611	15	0.011798	no	THYROID
chr1_2333631_T_C_b38	MORN1	3.07	0.00226	0.029996	34	0.009772	no	THYROID
chr1_2333899_TGCTGGAAAGAACA_T_b38	MORN1	3.039	0.0025	0.030601	32	0.01007	no	THYROID
chr1_2326424_C_T_b38	MORN1	3.034	0.00254	0.027196	77	0.008963	no	THYROID
chr1_3310290_T_A_b38	MORN1	-3.021	0.00265	-0.043693	5	0.014463	no	THYROID
chr1_2326288_C_T_b38	MORN1	3.019	0.00267	0.026982	77	0.008938	no	THYROID
chr1_2326884_C_T_b38	MORN1	3.019	0.00267	0.026982	77	0.008938	no	THYROID
chr1_3311799_G_T_b38	MORN1	-3.016	0.00269	-0.044671	3	0.014813	no	THYROID
chr1_2409621_C_T_b38	MORN1	-3.011	0.00273	-0.029055	37	0.009648	no	THYROID
chr1_2360913_G_A_b38	MORN1	2.997	0.00287	0.031973	29	0.01067	no	THYROID
chr1_2300527_G_C_b38	MORN1	-2.96	0.00322	-0.034771	13	0.011748	no	THYROID
chr1_2302601_CAGG_C_b38	MORN1	-2.957	0.00326	-0.035653	13	0.012058	no	THYROID
chr1_2303193_G_A_b38	MORN1	-2.957	0.00326	-0.035653	13	0.012058	no	THYROID
chr1_2340564_G_A_b38	MORN1	2.924	0.00362	0.028932	35	0.009896	no	THYROID
chr1_3175572_T_C_b38	MORN1	2.913	0.00374	0.052247	3	0.017936	no	THYROID
chr1_2335494_C_T_b38	MORN1	2.855	0.00448	0.029687	35	0.010399	no	THYROID
chr1_2333258_C_T_b38	MORN1	2.843	0.00465	0.02867	32	0.010084	no	THYROID
chr1_2365383_T_C_b38	MORN1	-2.835	0.00477	-0.028674	37	0.010115	no	THYROID
chr1_2326447_G_C_b38	MORN1	2.835	0.00477	0.028585	32	0.010085	no	THYROID
chr1_2332227_G_A_b38	MORN1	2.833	0.0048	0.028232	33	0.009966	no	THYROID
chr1_2332449_C_T_b38	MORN1	2.824	0.00492	0.028289	32	0.010016	no	THYROID
chr1_2330544_C_A_b38	MORN1	2.81	0.00515	0.028041	33	0.00998	no	THYROID
chr1_2325579_T_G_b38	MORN1	2.798	0.00534	0.027938	33	0.009986	no	THYROID
chr1_2380956_C_T_b38	MORN1	-2.769	0.00583	-0.031023	20	0.011204	no	THYROID
chr1_2382101_A_G_b38	MORN1	-2.769	0.00583	-0.031023	20	0.011204	no	THYROID
chr1_2337141_G_A_b38	MORN1	2.762	0.00595	0.026504	50	0.009595	no	THYROID
chr1_2302522_G_A_b38	MORN1	-2.749	0.0062	-0.032964	13	0.011993	no	THYROID
chr1_2690256_G_T_b38	MORN1	2.743	0.0063	0.063315	5	0.023082	no	THYROID
chr1_3312351_T_C_b38	MORN1	-2.732	0.00651	-0.02938	27	0.010753	no	THYROID
chr1_3313426_T_C_b38	MORN1	-2.732	0.00651	-0.02938	27	0.010753	no	THYROID
chr1_2304217_G_A_b38	MORN1	-2.71	0.00695	-0.035962	8	0.013268	no	THYROID
chr1_2333660_C_T_b38	MORN1	2.702	0.00713	0.036058	9	0.013345	no	THYROID
chr1_3300347_CGATCCCAGTCGTGGTGACTCTGCCCTGGTTGAAGATGCTATGCTGTGGCTGTGATGTTTCA_C_b38	MORN1	-2.695	0.00728	-0.074985	3	0.027827	no	THYROID
chr1_2380209_G_A_b38	MORN1	-2.684	0.00751	-0.02326	75	0.008665	no	THYROID
chr1_3321262_ATATT_A_b38	MORN1	-2.682	0.00757	-0.06868	3	0.025612	no	THYROID
chr1_2320766_C_T_b38	MORN1	2.631	0.00877	0.031313	14	0.0119	no	THYROID
chr1_2363825_TAA_T_b38	MORN1	-2.62	0.00906	-0.020541	119	0.007841	no	THYROID
chr1_3310052_G_C_b38	MORN1	-2.613	0.00923	-0.028177	28	0.010782	no	THYROID
chr1_2367306_CAA_C_b38	MORN1	2.607	0.00942	0.024307	75	0.009325	no	THYROID
chr1_2483757_C_CCCCGTGTGGGGGGCGTTGACT_b38	MORN1	-2.605	0.00946	-0.023263	56	0.00893	no	THYROID
chr1_1934821_C_CATTGTAGGTACGTGTGTACGTGGGTGTTAGGTTGTAGGTACACACGTGTATATGTGGGTGTTAG_b38	MORN1	-2.602	0.00953	-0.070342	4	0.02703	no	THYROID
chr1_2331844_G_C_b38	MORN1	2.594	0.00977	0.034614	15	0.013346	no	THYROID
chr1_2087271_C_T_b38	MORN1	2.591	0.00985	0.068586	7	0.026471	no	THYROID
chr1_2351678_C_T_b38	MORN1	-5.298	6.6e-07	-0.12454	11	0.023509	yes	UTERUS
chr1_2362863_C_CA_b38	MORN1	-5.23	8.82e-07	-0.137212	6	0.026235	yes	UTERUS
chr1_2354645_C_T_b38	MORN1	-5.171	1.13e-06	-0.12538	10	0.024246	yes	UTERUS
chr1_2354688_G_C_b38	MORN1	-5.171	1.13e-06	-0.12538	10	0.024246	yes	UTERUS
chr1_2362229_A_G_b38	MORN1	-5.171	1.13e-06	-0.12538	10	0.024246	yes	UTERUS
chr1_2351215_T_G_b38	MORN1	-5.151	1.23e-06	-0.122059	11	0.023695	yes	UTERUS
chr1_2409621_C_T_b38	MORN1	-5.057	1.84e-06	-0.120942	10	0.023914	yes	UTERUS
chr1_2350750_AGGGGTGGCACG_A_b38	MORN1	-4.714	7.56e-06	-0.1094	12	0.023206	yes	UTERUS
chr1_2347212_C_T_b38	MORN1	-4.516	1.67e-05	-0.114379	9	0.02533	yes	UTERUS
chr1_2342133_C_G_b38	MORN1	-4.501	1.77e-05	-0.114606	8	0.025464	yes	UTERUS
chr1_2342137_G_A_b38	MORN1	-4.501	1.77e-05	-0.114606	8	0.025464	yes	UTERUS
chr1_2348393_G_A_b38	MORN1	-4.457	2.11e-05	-0.106561	11	0.02391	yes	UTERUS
chr1_2338460_T_C_b38	MORN1	4.331	3.43e-05	0.103707	15	0.023946	yes	UTERUS
chr1_2338570_C_T_b38	MORN1	4.331	3.43e-05	0.104715	14	0.024179	yes	UTERUS
chr1_2337211_C_G_b38	MORN1	4.3	3.86e-05	0.109381	15	0.025436	yes	UTERUS
chr1_2368718_C_A_b38	MORN1	-4.265	4.41e-05	-0.092625	23	0.021716	yes	UTERUS
chr1_2389263_T_C_b38	MORN1	-4.257	4.55e-05	-0.105099	11	0.024687	yes	UTERUS
chr1_2391602_T_C_b38	MORN1	-4.179	6.12e-05	-0.097129	13	0.023245	yes	UTERUS
chr1_2369118_G_A_b38	MORN1	-4.146	6.92e-05	-0.108672	8	0.026211	yes	UTERUS
chr1_2379954_A_G_b38	MORN1	-4.109	7.95e-05	-0.098328	12	0.02393	yes	UTERUS
chr1_2365236_C_T_b38	MORN1	-4.066	9.31e-05	-0.088595	24	0.021789	yes	UTERUS
chr1_2366956_CAAAATACATAGA_C_b38	MORN1	-3.873	0.000188	-0.086106	24	0.022232	yes	UTERUS
chr1_2351551_C_T_b38	MORN1	3.858	0.000199	0.103914	8	0.026938	yes	UTERUS
chr1_2367456_C_CAA_b38	MORN1	-3.857	0.000199	-0.088278	19	0.022887	yes	UTERUS
chr1_1649993_A_G_b38	MORN1	3.742	0.000299	0.08841	31	0.023627	yes	UTERUS
chr1_2338659_A_G_b38	MORN1	3.728	0.000314	0.084976	28	0.022791	yes	UTERUS
chr1_2364657_A_T_b38	MORN1	-3.719	0.000325	-0.088248	26	0.023732	yes	UTERUS
chr1_2364658_A_T_b38	MORN1	-3.719	0.000325	-0.088248	26	0.023732	yes	UTERUS
chr1_2361214_A_C_b38	MORN1	-3.715	0.000329	-0.129318	3	0.03481	yes	UTERUS
chr1_2340787_C_T_b38	MORN1	-3.708	0.000337	-0.08462	15	0.022821	yes	UTERUS
chr1_2337239_T_C_b38	MORN1	3.603	0.000484	0.088913	13	0.024675	yes	UTERUS
chr1_2337141_G_A_b38	MORN1	3.532	0.000615	0.098741	7	0.027953	yes	UTERUS
chr1_2356095_C_T_b38	MORN1	3.514	0.000655	0.100231	7	0.028524	yes	UTERUS
chr1_2298478_C_T_b38	MORN1	-3.506	0.000674	-0.098347	5	0.028054	yes	UTERUS
chr1_2340235_T_C_b38	MORN1	3.404	0.000944	0.087071	12	0.025578	yes	UTERUS
chr1_2340764_G_T_b38	MORN1	3.404	0.000944	0.087071	12	0.025578	yes	UTERUS
chr1_2297717_C_T_b38	MORN1	-3.244	0.00158	-0.091822	5	0.028302	yes	UTERUS
chr1_2345774_T_C_b38	MORN1	3.243	0.00159	0.08603	8	0.02653	yes	UTERUS
chr1_2340425_C_T_b38	MORN1	-3.222	0.0017	-0.073584	27	0.022841	yes	UTERUS
chr1_2300128_G_T_b38	MORN1	-3.157	0.00209	-0.076903	20	0.024359	yes	UTERUS
chr1_2430227_C_T_b38	MORN1	-3.123	0.00232	-0.081876	9	0.026221	yes	UTERUS
chr1_2345727_G_A_b38	MORN1	3.08	0.00265	0.08283	8	0.026893	yes	UTERUS
chr1_2344932_C_T_b38	MORN1	3.051	0.00289	0.08318	8	0.02726	yes	UTERUS
chr1_2916767_A_G_b38	MORN1	-2.986	0.00352	-0.083347	6	0.027912	yes	UTERUS
chr1_2917088_C_T_b38	MORN1	-2.986	0.00352	-0.083347	6	0.027912	yes	UTERUS
chr1_2917445_C_T_b38	MORN1	-2.986	0.00352	-0.083347	6	0.027912	yes	UTERUS
chr1_2409065_C_T_b38	MORN1	2.963	0.00378	0.073485	14	0.024805	yes	UTERUS
chr1_1722619_C_T_b38	MORN1	-2.959	0.00382	-0.095584	9	0.032303	yes	UTERUS
chr1_1979469_AAC_A_b38	MORN1	2.936	0.0041	0.095668	3	0.03259	yes	UTERUS
chr1_2404530_C_G_b38	MORN1	2.899	0.00456	0.069704	15	0.024042	yes	UTERUS
chr1_2342999_A_G_b38	MORN1	-2.895	0.00463	-0.075001	10	0.02591	yes	UTERUS
chr1_1722625_A_T_b38	MORN1	-2.893	0.00465	-0.095455	8	0.032993	yes	UTERUS
chr1_1722626_AGCG_A_b38	MORN1	-2.893	0.00465	-0.095455	8	0.032993	yes	UTERUS
chr1_2119213_C_CT_b38	MORN1	-2.879	0.00485	-0.082053	9	0.028505	yes	UTERUS
chr1_1979523_G_A_b38	MORN1	2.875	0.0049	0.103891	3	0.036137	yes	UTERUS
chr1_2005946_C_A_b38	MORN1	2.832	0.00555	0.07664	7	0.027061	yes	UTERUS
chr1_2426653_T_G_b38	MORN1	-2.785	0.00636	-0.06998	9	0.025128	yes	UTERUS
chr1_1979456_T_C_b38	MORN1	2.665	0.00893	0.085503	3	0.032087	yes	UTERUS
chr1_2675106_GAGCAGTGCCCACACCCCCAGGTGAGAATCTGACAGCCCGT_G_b38	MORN1	-2.633	0.00976	-0.083141	3	0.031578	yes	UTERUS
chr1_2324849_C_A_b38	MORN1	2.63	0.00983	0.07084	9	0.026932	yes	UTERUS
chr1_2364339_A_C_b38	MORN1	-5.209	9.65e-07	-0.110612	24	0.021234	no	UTERUS
chr1_2366555_G_C_b38	MORN1	-4.885	3.76e-06	-0.103418	24	0.021171	no	UTERUS
chr1_2368188_T_C_b38	MORN1	-4.613	1.13e-05	-0.100937	24	0.021879	no	UTERUS
chr1_2367872_A_G_b38	MORN1	-4.574	1.33e-05	-0.101723	24	0.022239	no	UTERUS
chr1_2351241_C_T_b38	MORN1	-4.455	2.12e-05	-0.0955	24	0.021438	no	UTERUS
chr1_2366816_A_G_b38	MORN1	-4.405	2.57e-05	-0.096296	23	0.021858	no	UTERUS
chr1_2368473_T_C_b38	MORN1	-4.355	3.13e-05	-0.097228	25	0.022327	no	UTERUS
chr1_2337229_A_G_b38	MORN1	4.348	3.21e-05	0.105537	23	0.02427	no	UTERUS
chr1_2352756_T_C_b38	MORN1	-4.309	3.74e-05	-0.094863	23	0.022017	no	UTERUS
chr1_2365333_G_A_b38	MORN1	-4.232	5.01e-05	-0.093408	23	0.022072	no	UTERUS
chr1_2366496_A_T_b38	MORN1	-4.229	5.07e-05	-0.092375	23	0.021845	no	UTERUS
chr1_2367799_C_T_b38	MORN1	-4.229	5.07e-05	-0.092375	23	0.021845	no	UTERUS
chr1_2348700_C_T_b38	MORN1	-4.227	5.09e-05	-0.093105	23	0.022025	no	UTERUS
chr1_2363405_C_T_b38	MORN1	4.202	5.6e-05	0.098973	14	0.023552	no	UTERUS
chr1_2340564_G_A_b38	MORN1	4.202	5.6e-05	0.10702	11	0.025468	no	UTERUS
chr1_2367197_G_A_b38	MORN1	-4.143	6.99e-05	-0.091306	23	0.022038	no	UTERUS
chr1_2368939_G_C_b38	MORN1	-4.143	6.99e-05	-0.091306	23	0.022038	no	UTERUS
chr1_2366243_C_T_b38	MORN1	-4.106	8.03e-05	-0.092006	23	0.022407	no	UTERUS
chr1_2137585_GCCT_G_b38	MORN1	-4.03	0.000106	-0.115273	5	0.028604	no	UTERUS
chr1_2359472_G_A_b38	MORN1	4.007	0.000116	0.088669	23	0.022126	no	UTERUS
chr1_2350539_T_G_b38	MORN1	-3.998	0.00012	-0.092747	27	0.0232	no	UTERUS
chr1_2189294_T_TG_b38	MORN1	-3.982	0.000127	-0.112862	5	0.028341	no	UTERUS
chr1_2337352_A_G_b38	MORN1	3.846	0.000207	0.089027	22	0.023149	no	UTERUS
chr1_2369210_C_T_b38	MORN1	-3.769	0.000273	-0.085831	24	0.022775	no	UTERUS
chr1_2134596_A_AAT_b38	MORN1	-3.769	0.000273	-0.10767	5	0.02857	no	UTERUS
chr1_2344256_A_T_b38	MORN1	3.701	0.000345	0.095435	9	0.025785	no	UTERUS
chr1_2357308_T_C_b38	MORN1	3.674	0.000379	0.079041	32	0.021511	no	UTERUS
chr1_2179409_T_G_b38	MORN1	-3.674	0.000379	-0.103111	6	0.028062	no	UTERUS
chr1_2362718_G_A_b38	MORN1	3.664	0.000392	0.093202	11	0.025435	no	UTERUS
chr1_2194537_C_A_b38	MORN1	-3.664	0.000393	-0.108189	7	0.029528	no	UTERUS
chr1_2353459_T_G_b38	MORN1	3.662	0.000395	0.078317	31	0.021385	no	UTERUS
chr1_2356177_T_C_b38	MORN1	3.662	0.000395	0.078317	31	0.021385	no	UTERUS
chr1_2358849_T_C_b38	MORN1	3.662	0.000395	0.078317	31	0.021385	no	UTERUS
chr1_2360716_T_C_b38	MORN1	3.662	0.000395	0.078317	31	0.021385	no	UTERUS
chr1_2360970_T_C_b38	MORN1	3.662	0.000395	0.078317	31	0.021385	no	UTERUS
chr1_2361332_A_AG_b38	MORN1	3.662	0.000395	0.078317	31	0.021385	no	UTERUS
chr1_2361548_A_ACT_b38	MORN1	3.662	0.000395	0.078317	31	0.021385	no	UTERUS
chr1_2352457_A_G_b38	MORN1	3.601	0.000488	0.076454	32	0.021231	no	UTERUS
chr1_2357882_G_A_b38	MORN1	3.597	0.000494	0.101014	7	0.028081	no	UTERUS
chr1_2173095_TCCAC_T_b38	MORN1	-3.597	0.000494	-0.105201	5	0.029247	no	UTERUS
chr1_2363829_A_T_b38	MORN1	-3.596	0.000495	-0.078836	23	0.021921	no	UTERUS
chr1_2420841_G_A_b38	MORN1	-3.575	0.000533	-0.082456	14	0.023064	no	UTERUS
chr1_2380105_C_T_b38	MORN1	-3.566	0.000549	-0.081081	20	0.022734	no	UTERUS
chr1_2380209_G_A_b38	MORN1	-3.566	0.000549	-0.081081	20	0.022734	no	UTERUS
chr1_2367055_C_A_b38	MORN1	3.533	0.000615	0.092545	10	0.026197	no	UTERUS
chr1_2352403_G_T_b38	MORN1	3.518	0.000646	0.074785	31	0.021259	no	UTERUS
chr1_2343517_G_A_b38	MORN1	-3.505	0.000676	-0.078351	21	0.022356	no	UTERUS
chr1_2348378_C_T_b38	MORN1	3.504	0.000678	0.088123	12	0.025151	no	UTERUS
chr1_2350696_G_A_b38	MORN1	3.504	0.000678	0.088123	12	0.025151	no	UTERUS
chr1_2366021_T_C_b38	MORN1	-3.456	0.000794	-0.084493	25	0.024445	no	UTERUS
chr1_2346801_C_T_b38	MORN1	-3.442	0.000832	-0.080899	31	0.023502	no	UTERUS
chr1_2349222_G_A_b38	MORN1	-3.442	0.000832	-0.080899	31	0.023502	no	UTERUS
chr1_2343445_C_T_b38	MORN1	3.414	0.000915	0.087096	11	0.025514	no	UTERUS
chr1_2132033_G_C_b38	MORN1	-3.407	0.000936	-0.097524	5	0.028627	no	UTERUS
chr1_2128619_C_T_b38	MORN1	-3.379	0.00103	-0.096952	5	0.028693	no	UTERUS
chr1_2341705_A_G_b38	MORN1	3.376	0.00104	0.078954	31	0.023388	no	UTERUS
chr1_2341692_GA_G_b38	MORN1	3.366	0.00107	0.080358	17	0.023876	no	UTERUS
chr1_2364499_A_G_b38	MORN1	3.365	0.00107	0.082955	13	0.024654	no	UTERUS
chr1_2324806_A_T_b38	MORN1	3.33	0.0012	0.083698	14	0.025132	no	UTERUS
chr1_2343699_C_T_b38	MORN1	-3.318	0.00125	-0.074271	21	0.022382	no	UTERUS
chr1_2324977_G_GGCT_b38	MORN1	3.278	0.00142	0.085364	13	0.026044	no	UTERUS
chr1_2347542_C_T_b38	MORN1	-3.271	0.00146	-0.076806	26	0.023484	no	UTERUS
chr1_2915023_G_T_b38	MORN1	-3.258	0.00151	-0.092151	7	0.02828	no	UTERUS
chr1_2915225_A_G_b38	MORN1	-3.258	0.00151	-0.092151	7	0.02828	no	UTERUS
chr1_2337299_A_G_b38	MORN1	3.219	0.00172	0.073619	23	0.022872	no	UTERUS
chr1_2419005_C_T_b38	MORN1	-3.187	0.0019	-0.075834	14	0.023797	no	UTERUS
chr1_2422217_C_T_b38	MORN1	-3.187	0.0019	-0.075834	14	0.023797	no	UTERUS
chr1_2422225_C_T_b38	MORN1	-3.187	0.0019	-0.075834	14	0.023797	no	UTERUS
chr1_2916203_C_T_b38	MORN1	-3.157	0.00209	-0.089691	7	0.028411	no	UTERUS
chr1_2344980_A_G_b38	MORN1	3.131	0.00226	0.0817	9	0.02609	no	UTERUS
chr1_2353743_A_T_b38	MORN1	3.128	0.00228	0.075975	16	0.024286	no	UTERUS
chr1_2320508_G_A_b38	MORN1	-3.097	0.00251	-0.086631	7	0.027974	no	UTERUS
chr1_2107385_G_A_b38	MORN1	-2.998	0.0034	-0.073706	31	0.024585	no	UTERUS
chr1_2913297_G_A_b38	MORN1	-2.993	0.00346	-0.084489	5	0.028233	no	UTERUS
chr1_2344757_C_A_b38	MORN1	2.968	0.00371	0.07839	9	0.026407	no	UTERUS
chr1_2344761_T_A_b38	MORN1	2.968	0.00371	0.07839	9	0.026407	no	UTERUS
chr1_2350934_C_T_b38	MORN1	2.968	0.00371	0.07839	9	0.026407	no	UTERUS
chr1_2405593_C_T_b38	MORN1	2.966	0.00374	0.074206	13	0.025016	no	UTERUS
chr1_2343937_T_G_b38	MORN1	-2.956	0.00385	-0.066189	27	0.02239	no	UTERUS
chr1_2346111_G_C_b38	MORN1	-2.953	0.00389	-0.070221	24	0.023778	no	UTERUS
chr1_2418469_C_T_b38	MORN1	-2.951	0.00391	-0.070116	14	0.02376	no	UTERUS
chr1_2422265_C_T_b38	MORN1	-2.951	0.00391	-0.070116	14	0.02376	no	UTERUS
chr1_2313466_C_T_b38	MORN1	-2.947	0.00396	-0.072898	25	0.024737	no	UTERUS
chr1_2340807_G_A_b38	MORN1	2.942	0.00402	0.077923	10	0.026487	no	UTERUS
chr1_2341451_G_A_b38	MORN1	2.942	0.00402	0.077923	10	0.026487	no	UTERUS
chr1_2407700_G_A_b38	MORN1	-2.942	0.00402	-0.06876	22	0.023374	no	UTERUS
chr1_2342734_T_C_b38	MORN1	-2.932	0.00414	-0.076019	11	0.025924	no	UTERUS
chr1_2316305_G_C_b38	MORN1	-2.928	0.00419	-0.076261	17	0.026046	no	UTERUS
chr1_2326424_C_T_b38	MORN1	2.915	0.00436	0.072269	14	0.024796	no	UTERUS
chr1_2916729_G_A_b38	MORN1	-2.894	0.00464	-0.082055	5	0.028357	no	UTERUS
chr1_2417413_G_GCCCAGCTT_b38	MORN1	-2.894	0.00464	-0.068782	14	0.02377	no	UTERUS
chr1_2401252_T_TTCCTCCCTCCTCC_b38	MORN1	2.889	0.00471	0.074203	12	0.025688	no	UTERUS
chr1_2327034_G_A_b38	MORN1	2.858	0.00514	0.070563	16	0.024686	no	UTERUS
chr1_2345849_ACACACAG_A_b38	MORN1	2.8	0.00609	0.078769	6	0.028129	no	UTERUS
chr1_2404771_C_T_b38	MORN1	2.786	0.00634	0.068763	13	0.024682	no	UTERUS
chr1_2344634_T_C_b38	MORN1	2.773	0.00659	0.073077	9	0.026356	no	UTERUS
chr1_2326288_C_T_b38	MORN1	2.763	0.00678	0.06746	15	0.024419	no	UTERUS
chr1_2326884_C_T_b38	MORN1	2.763	0.00678	0.06746	15	0.024419	no	UTERUS
chr1_2913357_T_C_b38	MORN1	-2.761	0.00681	-0.07901	11	0.028616	no	UTERUS
chr1_2359882_C_CAA_b38	MORN1	2.753	0.00698	0.081981	7	0.029784	no	UTERUS
chr1_2105944_T_G_b38	MORN1	-2.739	0.00726	-0.074022	9	0.027027	no	UTERUS
chr1_2395636_C_T_b38	MORN1	2.736	0.00731	0.067458	13	0.024655	no	UTERUS
chr1_2333737_T_C_b38	MORN1	2.733	0.00738	0.069127	13	0.025294	no	UTERUS
chr1_2334530_T_G_b38	MORN1	2.733	0.00738	0.069127	13	0.025294	no	UTERUS
chr1_2181022_T_C_b38	MORN1	2.733	0.00739	0.061725	31	0.022589	no	UTERUS
chr1_2916048_CA_C_b38	MORN1	-2.73	0.00745	-0.077952	9	0.028557	no	UTERUS
chr1_2916054_CACAA_C_b38	MORN1	-2.73	0.00745	-0.077952	9	0.028557	no	UTERUS
chr1_2916061_T_G_b38	MORN1	-2.73	0.00745	-0.077952	9	0.028557	no	UTERUS
chr1_2917460_G_A_b38	MORN1	-2.73	0.00745	-0.077952	9	0.028557	no	UTERUS
chr1_2289078_A_C_b38	MORN1	-2.706	0.00795	-0.062704	30	0.023169	no	UTERUS
chr1_1650000_G_A_b38	MORN1	-2.695	0.00822	-0.067565	19	0.025075	no	UTERUS
chr1_1991690_A_G_b38	MORN1	-2.685	0.00845	-0.067321	22	0.025075	no	UTERUS
chr1_1690741_T_A_b38	MORN1	2.639	0.00959	0.079682	8	0.030192	no	UTERUS
chr1_2340625_G_A_b38	MORN1	2.63	0.00984	0.068319	11	0.025978	no	UTERUS
chr1_3329607_A_G_b38	MORN1	3.051	0.00283	0.100858	3	0.03306	yes	VAGINA
chr1_3377101_A_G_b38	MORN1	-2.877	0.00478	-0.061526	24	0.021386	yes	VAGINA
chr1_3332899_G_A_b38	MORN1	2.866	0.00493	0.09535	3	0.033266	yes	VAGINA
chr1_3335411_G_A_b38	MORN1	2.828	0.00552	0.053251	17	0.018831	yes	VAGINA
chr1_3335443_C_T_b38	MORN1	2.828	0.00552	0.053251	17	0.018831	yes	VAGINA
chr1_3354331_G_A_b38	MORN1	-2.708	0.00779	-0.066579	4	0.024583	yes	VAGINA
chr1_3354727_G_A_b38	MORN1	-2.708	0.00779	-0.066579	4	0.024583	yes	VAGINA
chr1_3355405_G_A_b38	MORN1	-2.708	0.00779	-0.066579	4	0.024583	yes	VAGINA
chr1_2101945_G_C_b38	MORN1	2.682	0.0084	0.051212	27	0.019098	yes	VAGINA
chr1_3336677_CAT_C_b38	MORN1	2.629	0.00972	0.050305	17	0.019135	yes	VAGINA
chr1_1657085_C_CTAA_b38	MORN1	3.274	0.0014	0.070983	9	0.021682	no	VAGINA
chr1_3181019_T_C_b38	MORN1	3.046	0.00288	0.094292	3	0.030961	no	VAGINA
chr1_1657093_C_A_b38	MORN1	2.866	0.00494	0.063153	9	0.022035	no	VAGINA
chr1_1726106_AT_A_b38	MORN1	2.861	0.00502	0.075944	6	0.026548	no	VAGINA
chr1_2158087_G_A_b38	MORN1	2.722	0.0075	0.057407	11	0.021093	no	VAGINA
chr1_1650688_T_A_b38	MORN1	2.678	0.00849	0.057433	9	0.02145	no	VAGINA
chr1_3339686_G_A_b38	MORN1	2.632	0.00966	0.049745	18	0.018903	no	VAGINA
chr1_2369210_C_T_b38	MORN1	-8.169	1.85e-15	-0.034045	100	0.004168	yes	WHLBLD
chr1_2364339_A_C_b38	MORN1	-7.331	7.44e-13	-0.030462	91	0.004155	yes	WHLBLD
chr1_2366816_A_G_b38	MORN1	-7.294	9.55e-13	-0.030427	90	0.004171	yes	WHLBLD
chr1_2367872_A_G_b38	MORN1	-7.294	9.58e-13	-0.030623	93	0.004198	yes	WHLBLD
chr1_2368188_T_C_b38	MORN1	-7.277	1.08e-12	-0.030511	93	0.004193	yes	WHLBLD
chr1_2368473_T_C_b38	MORN1	-7.218	1.6e-12	-0.030274	97	0.004194	yes	WHLBLD
chr1_2368939_G_C_b38	MORN1	-7.187	1.97e-12	-0.03046	86	0.004238	yes	WHLBLD
chr1_2343699_C_T_b38	MORN1	-7.173	2.18e-12	-0.031258	77	0.004358	yes	WHLBLD
chr1_2367197_G_A_b38	MORN1	-7.167	2.27e-12	-0.030402	85	0.004242	yes	WHLBLD
chr1_2366555_G_C_b38	MORN1	-7.163	2.33e-12	-0.030219	87	0.004219	yes	WHLBLD
chr1_2343517_G_A_b38	MORN1	-7.111	3.3e-12	-0.030965	77	0.004355	yes	WHLBLD
chr1_2366496_A_T_b38	MORN1	-7.091	3.76e-12	-0.030077	86	0.004241	yes	WHLBLD
chr1_2367799_C_T_b38	MORN1	-7.079	4.07e-12	-0.030012	87	0.004239	yes	WHLBLD
chr1_2348700_C_T_b38	MORN1	-7.076	4.16e-12	-0.031233	73	0.004414	yes	WHLBLD
chr1_2351241_C_T_b38	MORN1	-7.056	4.77e-12	-0.030282	85	0.004292	yes	WHLBLD
chr1_2365236_C_T_b38	MORN1	-7.019	6.07e-12	-0.029549	86	0.00421	yes	WHLBLD
chr1_2352756_T_C_b38	MORN1	-7.018	6.1e-12	-0.029645	88	0.004224	yes	WHLBLD
chr1_2366243_C_T_b38	MORN1	-6.948	9.68e-12	-0.029649	85	0.004267	yes	WHLBLD
chr1_2368718_C_A_b38	MORN1	-6.943	1e-11	-0.029607	84	0.004264	yes	WHLBLD
chr1_2366956_CAAAATACATAGA_C_b38	MORN1	-6.934	1.06e-11	-0.029151	90	0.004204	yes	WHLBLD
chr1_2365333_G_A_b38	MORN1	-6.919	1.17e-11	-0.029079	85	0.004203	yes	WHLBLD
chr1_2367456_C_CAA_b38	MORN1	-6.598	9.16e-11	-0.029651	64	0.004494	yes	WHLBLD
chr1_2389263_T_C_b38	MORN1	-5.75	1.43e-08	-0.027989	40	0.004868	yes	WHLBLD
chr1_2364657_A_T_b38	MORN1	-5.385	1.04e-07	-0.022217	153	0.004126	yes	WHLBLD
chr1_2364658_A_T_b38	MORN1	-5.385	1.04e-07	-0.022217	153	0.004126	yes	WHLBLD
chr1_2340787_C_T_b38	MORN1	-5.294	1.68e-07	-0.023888	58	0.004513	yes	WHLBLD
chr1_2366021_T_C_b38	MORN1	-5.268	1.93e-07	-0.022183	146	0.004211	yes	WHLBLD
chr1_2350539_T_G_b38	MORN1	-5.166	3.27e-07	-0.021754	147	0.004211	yes	WHLBLD
chr1_2349222_G_A_b38	MORN1	-5.083	4.98e-07	-0.021389	168	0.004208	yes	WHLBLD
chr1_2346801_C_T_b38	MORN1	-5.077	5.14e-07	-0.02146	167	0.004227	yes	WHLBLD
chr1_2342133_C_G_b38	MORN1	-5.023	6.71e-07	-0.027861	21	0.005546	yes	WHLBLD
chr1_2342137_G_A_b38	MORN1	-5.023	6.71e-07	-0.027861	21	0.005546	yes	WHLBLD
chr1_2363829_A_T_b38	MORN1	-4.962	9.12e-07	-0.020561	85	0.004144	yes	WHLBLD
chr1_2351215_T_G_b38	MORN1	-4.687	3.44e-06	-0.02512	26	0.00536	yes	WHLBLD
chr1_2350750_AGGGGTGGCACG_A_b38	MORN1	-4.564	6.09e-06	-0.023209	32	0.005085	yes	WHLBLD
chr1_2369713_ATAAT_A_b38	MORN1	-4.552	6.43e-06	-0.024683	24	0.005422	yes	WHLBLD
chr1_2351678_C_T_b38	MORN1	-4.507	7.92e-06	-0.024343	25	0.005402	yes	WHLBLD
chr1_2348393_G_A_b38	MORN1	-4.469	9.39e-06	-0.023316	28	0.005217	yes	WHLBLD
chr1_2369355_G_GA_b38	MORN1	-4.219	2.83e-05	-0.019882	64	0.004712	yes	WHLBLD
chr1_2369336_A_G_b38	MORN1	-4.11	4.52e-05	-0.021708	29	0.005282	yes	WHLBLD
chr1_2347542_C_T_b38	MORN1	-3.959	8.44e-05	-0.017136	132	0.004328	yes	WHLBLD
chr1_2357811_C_G_b38	MORN1	-3.923	9.77e-05	-0.021919	20	0.005588	yes	WHLBLD
chr1_2357812_T_C_b38	MORN1	-3.923	9.77e-05	-0.021919	20	0.005588	yes	WHLBLD
chr1_2359828_A_G_b38	MORN1	-3.923	9.77e-05	-0.021919	20	0.005588	yes	WHLBLD
chr1_2363591_T_G_b38	MORN1	-3.923	9.77e-05	-0.021919	20	0.005588	yes	WHLBLD
chr1_2353459_T_G_b38	MORN1	3.855	0.000128	0.016014	154	0.004154	yes	WHLBLD
chr1_2356177_T_C_b38	MORN1	3.855	0.000128	0.016014	154	0.004154	yes	WHLBLD
chr1_2341705_A_G_b38	MORN1	3.783	0.00017	0.01622	148	0.004287	yes	WHLBLD
chr1_2365220_A_G_b38	MORN1	-3.672	0.000262	-0.021125	18	0.005752	yes	WHLBLD
chr1_2298478_C_T_b38	MORN1	-3.671	0.000263	-0.019734	25	0.005375	yes	WHLBLD
chr1_2351722_A_G_b38	MORN1	3.621	0.000318	0.01971	48	0.005443	yes	WHLBLD
chr1_2360913_G_A_b38	MORN1	3.527	0.000453	0.018153	39	0.005147	yes	WHLBLD
chr1_2344761_T_C_b38	MORN1	3.52	0.000464	0.017821	42	0.005063	yes	WHLBLD
chr1_2681699_T_C_b38	MORN1	-3.425	0.000657	-0.026132	3	0.00763	yes	WHLBLD
chr1_2409621_C_T_b38	MORN1	-3.275	0.00112	-0.015647	47	0.004778	yes	WHLBLD
chr1_2297717_C_T_b38	MORN1	-3.226	0.00132	-0.017409	25	0.005397	yes	WHLBLD
chr1_2031380_T_A_b38	MORN1	-3.225	0.00133	-0.019437	15	0.006027	yes	WHLBLD
chr1_3190822_G_T_b38	MORN1	3.145	0.00174	0.01604	38	0.0051	yes	WHLBLD
chr1_3190983_G_A_b38	MORN1	3.145	0.00174	0.01604	38	0.0051	yes	WHLBLD
chr1_2063845_CT_C_b38	MORN1	-3.063	0.00229	-0.020404	6	0.006662	yes	WHLBLD
chr1_2296236_A_C_b38	MORN1	-3.053	0.00237	-0.024587	4	0.008054	yes	WHLBLD
chr1_2160238_C_CGTGTGTGT_b38	MORN1	3.031	0.00255	0.019645	16	0.006482	yes	WHLBLD
chr1_1743566_T_A_b38	MORN1	3.027	0.00257	0.023974	18	0.007919	yes	WHLBLD
chr1_2351827_T_C_b38	MORN1	3.011	0.00272	0.015635	44	0.005193	yes	WHLBLD
chr1_2288952_C_T_b38	MORN1	2.957	0.00323	0.037005	5	0.012514	yes	WHLBLD
chr1_1714797_C_T_b38	MORN1	-2.938	0.00343	-0.019129	26	0.006512	yes	WHLBLD
chr1_2327151_A_AACAC_b38	MORN1	2.933	0.00349	0.011704	157	0.003991	yes	WHLBLD
chr1_2023934_C_T_b38	MORN1	-2.924	0.00358	-0.016726	15	0.00572	yes	WHLBLD
chr1_2344510_C_G_b38	MORN1	-2.912	0.00372	-0.016933	18	0.005815	yes	WHLBLD
chr1_3185256_C_T_b38	MORN1	2.879	0.00413	0.013937	54	0.004841	yes	WHLBLD
chr1_3185299_C_G_b38	MORN1	2.879	0.00413	0.013937	54	0.004841	yes	WHLBLD
chr1_1717604_CGCTTTCAGCTAGAGTTTGCTCTCTCTGGTTTTCGGTCTGTGACACACGCAT_C_b38	MORN1	-2.876	0.00417	-0.01222	112	0.004248	yes	WHLBLD
chr1_3186748_G_T_b38	MORN1	2.875	0.00418	0.013905	49	0.004836	yes	WHLBLD
chr1_3188596_A_G_b38	MORN1	2.871	0.00424	0.013646	55	0.004754	yes	WHLBLD
chr1_2684677_G_C_b38	MORN1	-2.867	0.00429	-0.016095	25	0.005614	yes	WHLBLD
chr1_1716966_A_G_b38	MORN1	-2.863	0.00435	-0.019814	21	0.006921	yes	WHLBLD
chr1_3181680_AGTCTTACACACG_A_b38	MORN1	2.841	0.00465	0.022191	3	0.00781	yes	WHLBLD
chr1_3191953_G_A_b38	MORN1	-2.816	0.00502	-0.013282	79	0.004716	yes	WHLBLD
chr1_2900016_C_CG_b38	MORN1	2.799	0.00529	0.014709	54	0.005254	yes	WHLBLD
chr1_2324977_G_GGCT_b38	MORN1	2.787	0.0055	0.012237	91	0.004391	yes	WHLBLD
chr1_3195714_G_A_b38	MORN1	2.786	0.0055	0.018151	17	0.006515	yes	WHLBLD
chr1_2363405_C_T_b38	MORN1	2.778	0.00564	0.012909	69	0.004647	yes	WHLBLD
chr1_2327229_GACACAGAAAC_G_b38	MORN1	2.771	0.00576	0.013305	52	0.004801	yes	WHLBLD
chr1_3185198_A_C_b38	MORN1	2.77	0.00577	0.013382	53	0.00483	yes	WHLBLD
chr1_2341042_C_T_b38	MORN1	2.765	0.00587	0.016648	15	0.006021	yes	WHLBLD
chr1_2341692_GAAA_G_b38	MORN1	2.755	0.00605	0.016498	16	0.005988	yes	WHLBLD
chr1_1903513_C_CT_b38	MORN1	2.746	0.00622	0.038038	3	0.013853	yes	WHLBLD
chr1_3192587_G_A_b38	MORN1	-2.711	0.0069	-0.012828	81	0.004732	yes	WHLBLD
chr1_1715546_C_T_b38	MORN1	-2.682	0.00751	-0.01777	24	0.006625	yes	WHLBLD
chr1_2337352_A_G_b38	MORN1	2.68	0.00755	0.011756	101	0.004386	yes	WHLBLD
chr1_2774717_T_A_b38	MORN1	2.678	0.00761	0.03799	6	0.014185	yes	WHLBLD
chr1_2404237_A_G_b38	MORN1	-2.673	0.00773	-0.017522	14	0.006556	yes	WHLBLD
chr1_2338659_A_G_b38	MORN1	2.664	0.00793	0.011284	137	0.004235	yes	WHLBLD
chr1_2342734_T_C_b38	MORN1	-2.651	0.00823	-0.013323	36	0.005026	yes	WHLBLD
chr1_1606492_GTGGGCTGGTCAGGCGTGGGCTGGGC_G_b38	MORN1	-2.649	0.00828	-0.027857	5	0.010516	yes	WHLBLD
chr1_1701568_G_C_b38	MORN1	2.644	0.00841	0.023035	19	0.008712	yes	WHLBLD
chr1_2444607_G_A_b38	MORN1	2.639	0.00853	0.022411	4	0.008492	yes	WHLBLD
chr1_2205698_G_A_b38	MORN1	2.636	0.00861	0.01584	26	0.006009	yes	WHLBLD
chr1_2009834_C_T_b38	MORN1	-2.63	0.00876	-0.014946	14	0.005683	yes	WHLBLD
chr1_2008008_CA_C_b38	MORN1	-2.622	0.00897	-0.014893	14	0.005681	yes	WHLBLD
chr1_2834672_G_A_b38	MORN1	2.621	0.009	0.018354	9	0.007003	yes	WHLBLD
chr1_1480224_A_G_b38	MORN1	2.62	0.00901	0.026546	7	0.010132	yes	WHLBLD
chr1_3202925_C_T_b38	MORN1	2.62	0.00901	0.015071	24	0.005752	yes	WHLBLD
chr1_3229627_A_T_b38	MORN1	2.618	0.00908	0.017682	13	0.006755	yes	WHLBLD
chr1_2327034_G_A_b38	MORN1	2.602	0.0095	0.011344	94	0.00436	yes	WHLBLD
chr1_2862832_C_G_b38	MORN1	2.601	0.00953	0.018622	6	0.007159	yes	WHLBLD
chr1_1791172_A_AT_b38	MORN1	-2.599	0.00958	-0.014314	37	0.005507	yes	WHLBLD
chr1_2873022_T_C_b38	MORN1	2.586	0.00994	0.023613	12	0.009131	yes	WHLBLD
chr1_2362863_C_CA_b38	MORN1	-5.5	5.65e-08	-0.030677	18	0.005578	no	WHLBLD
chr1_2369118_G_A_b38	MORN1	-5.443	7.64e-08	-0.028708	28	0.005274	no	WHLBLD
chr1_2391602_T_C_b38	MORN1	-5.385	1.04e-07	-0.024945	48	0.004632	no	WHLBLD
chr1_2379954_A_G_b38	MORN1	-5.299	1.64e-07	-0.024775	46	0.004675	no	WHLBLD
chr1_2343937_T_G_b38	MORN1	-5.253	2.08e-07	-0.023016	106	0.004381	no	WHLBLD
chr1_2380105_C_T_b38	MORN1	-5.182	3.01e-07	-0.021675	88	0.004183	no	WHLBLD
chr1_2380209_G_A_b38	MORN1	-5.061	5.56e-07	-0.021132	88	0.004176	no	WHLBLD
chr1_2362229_A_G_b38	MORN1	-4.982	8.25e-07	-0.026669	26	0.005353	no	WHLBLD
chr1_2354645_C_T_b38	MORN1	-4.826	1.77e-06	-0.025981	25	0.005384	no	WHLBLD
chr1_2354688_G_C_b38	MORN1	-4.755	2.49e-06	-0.025689	25	0.005403	no	WHLBLD
chr1_2367644_G_A_b38	MORN1	-4.522	7.38e-06	-0.020118	83	0.004449	no	WHLBLD
chr1_2347212_C_T_b38	MORN1	-4.217	2.85e-05	-0.022444	26	0.005322	no	WHLBLD
chr1_2656416_C_A_b38	MORN1	4.05	5.79e-05	0.065806	4	0.016248	no	WHLBLD
chr1_2357308_T_C_b38	MORN1	4.036	6.14e-05	0.016919	160	0.004192	no	WHLBLD
chr1_2392569_C_T_b38	MORN1	-3.968	8.13e-05	-0.020337	29	0.005125	no	WHLBLD
chr1_2367871_C_T_b38	MORN1	-3.94	9.1e-05	-0.022157	19	0.005623	no	WHLBLD
chr1_2358849_T_C_b38	MORN1	3.882	0.000115	0.016188	157	0.00417	no	WHLBLD
chr1_2346676_G_C_b38	MORN1	-3.873	0.000119	-0.021568	20	0.005569	no	WHLBLD
chr1_2352457_A_G_b38	MORN1	3.866	0.000123	0.016065	157	0.004155	no	WHLBLD
chr1_2346111_G_C_b38	MORN1	-3.863	0.000124	-0.01672	130	0.004328	no	WHLBLD
chr1_2350287_A_C_b38	MORN1	-3.846	0.000133	-0.021383	20	0.00556	no	WHLBLD
chr1_2353047_C_T_b38	MORN1	-3.844	0.000134	-0.021386	20	0.005564	no	WHLBLD
chr1_2360716_T_C_b38	MORN1	3.822	0.000146	0.015917	157	0.004165	no	WHLBLD
chr1_2361332_A_AG_b38	MORN1	3.822	0.000146	0.015917	157	0.004165	no	WHLBLD
chr1_2361548_A_ACT_b38	MORN1	3.822	0.000146	0.015917	157	0.004165	no	WHLBLD
chr1_2360970_T_C_b38	MORN1	3.817	0.000149	0.015933	157	0.004174	no	WHLBLD
chr1_2352403_G_T_b38	MORN1	3.781	0.000172	0.015706	154	0.004153	no	WHLBLD
chr1_2364484_C_T_b38	MORN1	-3.776	0.000175	-0.021431	22	0.005675	no	WHLBLD
chr1_2380956_C_T_b38	MORN1	-3.764	0.000184	-0.019912	27	0.00529	no	WHLBLD
chr1_2382101_A_G_b38	MORN1	-3.764	0.000184	-0.019912	27	0.00529	no	WHLBLD
chr1_2344932_C_A_b38	MORN1	-3.76	0.000186	-0.021084	19	0.005607	no	WHLBLD
chr1_2369187_T_TA_b38	MORN1	3.701	0.000235	0.037284	9	0.010075	no	WHLBLD
chr1_2359451_C_T_b38	MORN1	-3.586	0.000363	-0.019372	27	0.005401	no	WHLBLD
chr1_2361727_G_A_b38	MORN1	-3.586	0.000363	-0.019372	27	0.005401	no	WHLBLD
chr1_2360241_T_C_b38	MORN1	-3.571	0.000384	-0.019245	27	0.005389	no	WHLBLD
chr1_2359221_T_C_b38	MORN1	-3.546	0.000422	-0.019029	28	0.005366	no	WHLBLD
chr1_2348984_A_C_b38	MORN1	-3.513	0.000476	-0.018951	27	0.005394	no	WHLBLD
chr1_2352564_T_C_b38	MORN1	-3.513	0.000476	-0.018951	27	0.005394	no	WHLBLD
chr1_2356078_T_C_b38	MORN1	-3.513	0.000476	-0.018951	27	0.005394	no	WHLBLD
chr1_2351337_G_C_b38	MORN1	-3.499	0.000502	-0.018829	27	0.005381	no	WHLBLD
chr1_2017202_C_T_b38	MORN1	-3.496	0.000507	-0.021328	12	0.0061	no	WHLBLD
chr1_2346388_G_A_b38	MORN1	-3.469	0.000559	-0.018787	26	0.005415	no	WHLBLD
chr1_2353975_G_A_b38	MORN1	-3.466	0.000565	-0.018773	27	0.005416	no	WHLBLD
chr1_2355508_A_G_b38	MORN1	-3.466	0.000565	-0.018773	27	0.005416	no	WHLBLD
chr1_2029235_C_T_b38	MORN1	-3.341	0.000888	-0.020211	14	0.00605	no	WHLBLD
chr1_2029969_C_T_b38	MORN1	-3.341	0.000888	-0.020211	14	0.00605	no	WHLBLD
chr1_2031629_GTGTCTGGGGCGCTAC_G_b38	MORN1	-3.341	0.000888	-0.020211	14	0.00605	no	WHLBLD
chr1_2031648_CCTCTG_C_b38	MORN1	-3.341	0.000888	-0.020211	14	0.00605	no	WHLBLD
chr1_2031655_AGGACCCAGGCATCTG_A_b38	MORN1	-3.341	0.000888	-0.020211	14	0.00605	no	WHLBLD
chr1_2031719_C_T_b38	MORN1	-3.341	0.000888	-0.020211	14	0.00605	no	WHLBLD
chr1_2031852_C_G_b38	MORN1	-3.341	0.000888	-0.020211	14	0.00605	no	WHLBLD
chr1_2368212_T_C_b38	MORN1	-3.299	0.00103	-0.017791	27	0.005392	no	WHLBLD
chr1_2033336_T_C_b38	MORN1	-3.296	0.00104	-0.020126	13	0.006105	no	WHLBLD
chr1_2033373_T_G_b38	MORN1	-3.296	0.00104	-0.020126	13	0.006105	no	WHLBLD
chr1_2033988_G_A_b38	MORN1	-3.239	0.00127	-0.019948	12	0.006158	no	WHLBLD
chr1_2364485_A_G_b38	MORN1	-3.209	0.00141	-0.016143	42	0.005031	no	WHLBLD
chr1_2370252_G_A_b38	MORN1	3.191	0.00149	0.016932	24	0.005307	no	WHLBLD
chr1_2382880_T_C_b38	MORN1	-3.184	0.00153	-0.022912	8	0.007197	no	WHLBLD
chr1_2364506_G_A_b38	MORN1	-3.168	0.00162	-0.015781	37	0.004982	no	WHLBLD
chr1_2359219_C_T_b38	MORN1	3.148	0.00172	0.035624	8	0.011315	no	WHLBLD
chr1_2010975_T_C_b38	MORN1	-3.138	0.00178	-0.018399	13	0.005863	no	WHLBLD
chr1_2364876_C_T_b38	MORN1	3.117	0.00191	0.034904	8	0.011198	no	WHLBLD
chr1_2348590_C_T_b38	MORN1	3.084	0.00214	0.034457	10	0.011174	no	WHLBLD
chr1_2347209_A_G_b38	MORN1	-3.077	0.00219	-0.015889	31	0.005164	no	WHLBLD
chr1_2011271_G_GTT_b38	MORN1	-3.051	0.00238	-0.014838	45	0.004863	no	WHLBLD
chr1_2367908_C_T_b38	MORN1	3.048	0.00241	0.039973	3	0.013114	no	WHLBLD
chr1_2345829_C_CCACACA_b38	MORN1	-3.045	0.00243	-0.019755	11	0.006488	no	WHLBLD
chr1_2364412_G_GTTGT_b38	MORN1	-3.03	0.00255	-0.015157	42	0.005003	no	WHLBLD
chr1_2377078_C_G_b38	MORN1	-3.012	0.00271	-0.022348	7	0.007421	no	WHLBLD
chr1_2359472_G_A_b38	MORN1	2.993	0.00287	0.012563	112	0.004197	no	WHLBLD
chr1_2363825_TAA_T_b38	MORN1	-2.991	0.0029	-0.011554	138	0.003863	no	WHLBLD
chr1_2459378_CGGTGGTCCTCCTTCCTGGTGGTTCTCCTTCCTGGTGGTCCTCCTTGCCGGTGGTCCTCCTTGCCGGTGGTCCTCCTTCCTGGTGGTTCTCCTTCCTGGTGGTCCTCCTTCCTGGTGGTCCTCCTTCCTGGTGGTCCTCCTTCCT_C_b38	MORN1	-2.937	0.00344	-0.033342	6	0.011353	no	WHLBLD
chr1_2003927_G_C_b38	MORN1	-2.922	0.00361	-0.016168	18	0.005533	no	WHLBLD
chr1_1999114_T_C_b38	MORN1	-2.915	0.00369	-0.017134	16	0.005877	no	WHLBLD
chr1_2355481_C_T_b38	MORN1	2.831	0.0048	0.030521	8	0.010782	no	WHLBLD
chr1_2364608_C_A_b38	MORN1	2.831	0.0048	0.030521	8	0.010782	no	WHLBLD
chr1_2031194_A_G_b38	MORN1	-2.826	0.00487	-0.016134	17	0.005708	no	WHLBLD
chr1_2275005_A_G_b38	MORN1	2.808	0.00515	0.01402	34	0.004993	no	WHLBLD
chr1_2641760_A_G_b38	MORN1	-2.803	0.00522	-0.01772	12	0.006321	no	WHLBLD
chr1_2642288_A_C_b38	MORN1	-2.803	0.00522	-0.01772	12	0.006321	no	WHLBLD
chr1_2361214_A_C_b38	MORN1	-2.789	0.00545	-0.02268	8	0.008131	no	WHLBLD
chr1_2005928_T_TTC_b38	MORN1	-2.787	0.00549	-0.019097	5	0.006853	no	WHLBLD
chr1_2003636_G_C_b38	MORN1	-2.778	0.00565	-0.015997	16	0.00576	no	WHLBLD
chr1_2004049_G_C_b38	MORN1	-2.765	0.00586	-0.015295	18	0.005531	no	WHLBLD
chr1_2652005_CCAGGTGAGCACCTGACATCGTGGAGCAGCAGCCCACACCCA_C_b38	MORN1	2.762	0.00592	0.040563	3	0.014687	no	WHLBLD
chr1_2345442_G_A_b38	MORN1	2.762	0.00593	0.03298	6	0.011943	no	WHLBLD
chr1_2362718_G_A_b38	MORN1	2.762	0.00593	0.013033	55	0.004719	no	WHLBLD
chr1_2005768_G_A_b38	MORN1	-2.738	0.00637	-0.015932	13	0.005819	no	WHLBLD
chr1_2006475_G_A_b38	MORN1	-2.738	0.00637	-0.015932	13	0.005819	no	WHLBLD
chr1_2607299_C_T_b38	MORN1	2.734	0.00644	0.017036	14	0.006231	no	WHLBLD
chr1_2623690_C_T_b38	MORN1	2.734	0.00644	0.017036	14	0.006231	no	WHLBLD
chr1_2254781_C_T_b38	MORN1	2.73	0.00652	0.022489	5	0.008238	no	WHLBLD
chr1_2796829_C_CA_b38	MORN1	2.725	0.00663	0.017022	14	0.006248	no	WHLBLD
chr1_2060449_TGAGAAGTGGGGCTGAATAGAGGTTTGGCAGTGCTTAGCATAGGGGGCGAGAGTCTCGGCTTCCAGC_T_b38	MORN1	-2.71	0.00692	-0.014739	24	0.005439	no	WHLBLD
chr1_2441501_C_T_b38	MORN1	2.698	0.00718	0.023085	4	0.008558	no	WHLBLD
chr1_2189011_G_GAA_b38	MORN1	2.694	0.00726	0.027759	5	0.010305	no	WHLBLD
chr1_1417051_CA_C_b38	MORN1	2.69	0.00735	0.018557	12	0.006899	no	WHLBLD
chr1_2335494_C_T_b38	MORN1	2.689	0.00736	0.014079	30	0.005235	no	WHLBLD
chr1_2004070_T_C_b38	MORN1	-2.667	0.00787	-0.014787	18	0.005545	no	WHLBLD
chr1_2274946_C_T_b38	MORN1	2.663	0.00794	0.021844	5	0.008202	no	WHLBLD
chr1_3185158_C_T_b38	MORN1	2.659	0.00805	0.012826	53	0.004824	no	WHLBLD
chr1_2760159_C_G_b38	MORN1	-2.639	0.00854	-0.017048	3	0.00646	no	WHLBLD
chr1_2222298_G_A_b38	MORN1	2.637	0.00858	0.022168	6	0.008406	no	WHLBLD
chr1_2602936_G_A_b38	MORN1	2.626	0.00886	0.015814	16	0.006022	no	WHLBLD
chr1_2595132_G_A_b38	MORN1	2.607	0.00937	0.015682	16	0.006016	no	WHLBLD
chr1_2364499_A_G_b38	MORN1	2.603	0.00948	0.012058	61	0.004633	no	WHLBLD
chr1_2401549_T_C_b38	MORN1	-2.591	0.0098	-0.016883	16	0.006516	no	WHLBLD
chr1_2757279_G_A_b38	MORN1	-2.587	0.00991	-0.01747	27	0.006752	no	WHLBLD
chr1_2397773_G_A_b38	MORN1	-2.587	0.00991	-0.02661	3	0.010285	no	WHLBLD

---

Filters:      p-Values >= and <=      Betas >= and <=      Statistic >= and <=      Carriers >= and <=
Positions: left right     Zoom: MORN1     Other:     -      +     reset     eQTLs Region
Draw    p-Value Beta Statistic Carriers Beta/sd(t)     Scaling     Sign (red=+, blue-)     Colors: Tissue Sign