PLEKHN1 - pleckstrin homology domain containing N1 - 1p36.33

Snps	Gene	Statistic	Pvalue	Beta	Carriers	Beta_se	Linear	Tissue
chr1_962358_C_T_b38	PLEKHN1	-5.243	2.32e-07	-0.110118	4	0.021003	yes	ADPSBQ
chr1_958339_G_A_b38	PLEKHN1	5.198	2.92e-07	0.100155	8	0.019268	yes	ADPSBQ
chr1_958251_A_G_b38	PLEKHN1	5.106	4.65e-07	0.106028	4	0.020764	yes	ADPSBQ
chr1_962184_T_C_b38	PLEKHN1	5.082	5.25e-07	0.106348	4	0.020927	yes	ADPSBQ
chr1_953778_G_C_b38	PLEKHN1	4.995	8.11e-07	0.110926	3	0.022209	yes	ADPSBQ
chr1_953779_A_C_b38	PLEKHN1	4.995	8.11e-07	0.110926	3	0.022209	yes	ADPSBQ
chr1_961945_G_C_b38	PLEKHN1	4.976	8.9e-07	0.099202	7	0.019937	yes	ADPSBQ
chr1_950296_C_A_b38	PLEKHN1	4.939	1.07e-06	0.106643	3	0.021592	yes	ADPSBQ
chr1_952180_A_C_b38	PLEKHN1	4.939	1.07e-06	0.106643	3	0.021592	yes	ADPSBQ
chr1_954333_C_A_b38	PLEKHN1	4.885	1.38e-06	0.103204	3	0.021126	yes	ADPSBQ
chr1_966179_G_A_b38	PLEKHN1	4.872	1.48e-06	0.082677	36	0.016971	yes	ADPSBQ
chr1_954258_G_C_b38	PLEKHN1	4.685	3.59e-06	0.099034	3	0.021137	yes	ADPSBQ
chr1_949046_A_AACAGCAAAG_b38	PLEKHN1	4.514	7.92e-06	0.092953	6	0.020594	yes	ADPSBQ
chr1_966227_C_G_b38	PLEKHN1	4.437	1.12e-05	0.090149	9	0.020319	yes	ADPSBQ
chr1_960375_A_AG_b38	PLEKHN1	4.242	2.63e-05	0.066809	43	0.015749	yes	ADPSBQ
chr1_965350_G_A_b38	PLEKHN1	4.199	3.17e-05	0.074297	37	0.017695	yes	ADPSBQ
chr1_940263_C_G_b38	PLEKHN1	4.135	4.16e-05	0.055078	26	0.013322	yes	ADPSBQ
chr1_959193_G_A_b38	PLEKHN1	4.016	6.82e-05	0.069494	42	0.017305	yes	ADPSBQ
chr1_960326_G_A_b38	PLEKHN1	3.388	0.000759	0.054539	42	0.016099	yes	ADPSBQ
chr1_666028_G_A_b38	PLEKHN1	-3.145	0.00176	-0.053389	10	0.016977	yes	ADPSBQ
chr1_665761_C_T_b38	PLEKHN1	-3.088	0.00212	-0.051212	10	0.016584	yes	ADPSBQ
chr1_967376_AC_A_b38	PLEKHN1	3.073	0.00223	0.057347	6	0.018663	yes	ADPSBQ
chr1_1134102_G_A_b38	PLEKHN1	3.049	0.00241	0.066141	6	0.021692	yes	ADPSBQ
chr1_74336_T_A_b38	PLEKHN1	2.967	0.00315	0.126806	3	0.042743	yes	ADPSBQ
chr1_1017114_A_AT_b38	PLEKHN1	2.659	0.00807	0.031089	70	0.01169	yes	ADPSBQ
chr1_967384_C_G_b38	PLEKHN1	2.625	0.00892	0.030613	118	0.011661	yes	ADPSBQ
chr1_950669_ACAG_A_b38	PLEKHN1	5.024	7.03e-07	0.097841	9	0.019477	no	ADPSBQ
chr1_955641_G_A_b38	PLEKHN1	4.972	9.06e-07	0.106007	3	0.02132	no	ADPSBQ
chr1_942335_C_G_b38	PLEKHN1	4.91	1.23e-06	0.097916	6	0.019943	no	ADPSBQ
chr1_965643_T_C_b38	PLEKHN1	3.865	0.000125	0.085143	3	0.022027	no	ADPSBQ
chr1_951408_G_A_b38	PLEKHN1	3.819	0.00015	0.062229	25	0.016293	no	ADPSBQ
chr1_951437_C_T_b38	PLEKHN1	3.819	0.00015	0.062229	25	0.016293	no	ADPSBQ
chr1_1265603_T_TTGTG_b38	PLEKHN1	3.407	0.000708	0.047852	16	0.014044	no	ADPSBQ
chr1_967617_G_A_b38	PLEKHN1	3.329	0.000933	0.049133	22	0.014757	no	ADPSBQ
chr1_665098_G_A_b38	PLEKHN1	-3.051	0.0024	-0.04952	11	0.01623	no	ADPSBQ
chr1_1456891_T_C_b38	PLEKHN1	3.005	0.00278	0.036248	54	0.012061	no	ADPSBQ
chr1_1034279_G_A_b38	PLEKHN1	2.97	0.00312	0.034317	53	0.011555	no	ADPSBQ
chr1_1108232_CAG_C_b38	PLEKHN1	-2.887	0.00405	-0.052505	8	0.018186	no	ADPSBQ
chr1_668910_A_G_b38	PLEKHN1	2.846	0.00461	0.122344	3	0.042989	no	ADPSBQ
chr1_1108242_G_A_b38	PLEKHN1	-2.836	0.00475	-0.052298	6	0.01844	no	ADPSBQ
chr1_1607341_CTT_C_b38	PLEKHN1	-2.827	0.00489	-0.034395	100	0.012168	no	ADPSBQ
chr1_1163962_A_C_b38	PLEKHN1	-2.825	0.00491	-0.051722	7	0.018306	no	ADPSBQ
chr1_1151436_C_CCCCCAGCCAGAGCCTCAGGGTGAGCTCAAGGCACCAAACCCAGAACGG_b38	PLEKHN1	2.817	0.00503	0.114998	3	0.04082	no	ADPSBQ
chr1_1129155_G_C_b38	PLEKHN1	2.801	0.00529	0.033424	44	0.011933	no	ADPSBQ
chr1_1108235_CA_C_b38	PLEKHN1	-2.787	0.00552	-0.05133	7	0.018417	no	ADPSBQ
chr1_199425_G_C_b38	PLEKHN1	2.707	0.00701	0.043973	5	0.016243	no	ADPSBQ
chr1_632781_C_T_b38	PLEKHN1	2.699	0.00719	0.041653	7	0.015433	no	ADPSBQ
chr1_187019_G_A_b38	PLEKHN1	-2.697	0.00723	-0.055464	3	0.020564	no	ADPSBQ
chr1_1168310_T_TCA_b38	PLEKHN1	-2.643	0.00847	-0.050589	5	0.019141	no	ADPSBQ
chr1_1026084_G_T_b38	PLEKHN1	2.637	0.00861	0.030149	60	0.011431	no	ADPSBQ
chr1_1845824_TACACACACACACACACACACACACACACAC_T_b38	PLEKHN1	-2.617	0.00913	-0.031782	39	0.012143	no	ADPSBQ
chr1_1035169_TG_T_b38	PLEKHN1	-2.606	0.00943	-0.033289	45	0.012774	no	ADPSBQ
chr1_973858_G_C_b38	PLEKHN1	-4.316	2e-05	-0.048677	79	0.011277	yes	ADPVSC
chr1_1062389_CG_C_b38	PLEKHN1	3.609	0.000347	0.044657	37	0.012375	yes	ADPVSC
chr1_1083795_C_G_b38	PLEKHN1	-3.487	0.000543	-0.042806	44	0.012275	yes	ADPVSC
chr1_1158683_T_C_b38	PLEKHN1	3.461	0.000597	0.04287	39	0.012387	yes	ADPVSC
chr1_98999_TTTTATTTA_T_b38	PLEKHN1	-3.434	0.000658	-0.042269	40	0.01231	yes	ADPVSC
chr1_1064776_C_T_b38	PLEKHN1	-3.366	0.000837	-0.040911	57	0.012154	yes	ADPVSC
chr1_996168_G_T_b38	PLEKHN1	3.337	0.000926	0.045492	20	0.013631	yes	ADPVSC
chr1_997077_G_A_b38	PLEKHN1	3.333	0.000939	0.045493	20	0.013649	yes	ADPVSC
chr1_1086315_A_G_b38	PLEKHN1	-3.266	0.00118	-0.039661	41	0.012142	yes	ADPVSC
chr1_1000335_C_T_b38	PLEKHN1	3.253	0.00124	0.044485	20	0.013675	yes	ADPVSC
chr1_1085543_A_AG_b38	PLEKHN1	-3.197	0.0015	-0.0391	43	0.012231	yes	ADPVSC
chr1_1085026_T_C_b38	PLEKHN1	-3.136	0.00184	-0.038103	43	0.012151	yes	ADPVSC
chr1_982260_G_A_b38	PLEKHN1	3.112	0.002	0.04289	17	0.013784	yes	ADPVSC
chr1_982858_C_G_b38	PLEKHN1	3.112	0.002	0.04289	17	0.013784	yes	ADPVSC
chr1_998741_G_A_b38	PLEKHN1	3.074	0.00226	0.042197	20	0.013726	yes	ADPVSC
chr1_994321_C_CA_b38	PLEKHN1	-3.069	0.0023	-0.04086	50	0.013315	yes	ADPVSC
chr1_101225_C_A_b38	PLEKHN1	3.065	0.00232	0.041871	23	0.01366	yes	ADPVSC
chr1_1067054_C_T_b38	PLEKHN1	-3.063	0.00234	-0.03463	85	0.011306	yes	ADPVSC
chr1_1067673_C_T_b38	PLEKHN1	-3.014	0.00275	-0.033868	96	0.011238	yes	ADPVSC
chr1_1161712_G_A_b38	PLEKHN1	-3.001	0.00286	-0.033895	85	0.011295	yes	ADPVSC
chr1_994949_C_T_b38	PLEKHN1	2.991	0.00295	0.039615	23	0.013245	yes	ADPVSC
chr1_994997_C_T_b38	PLEKHN1	2.991	0.00295	0.039615	23	0.013245	yes	ADPVSC
chr1_1147779_G_A_b38	PLEKHN1	2.975	0.00311	0.039582	22	0.013304	yes	ADPVSC
chr1_613558_C_T_b38	PLEKHN1	2.95	0.00336	0.104293	4	0.035348	yes	ADPVSC
chr1_1159105_C_T_b38	PLEKHN1	-2.947	0.0034	-0.03317	85	0.011256	yes	ADPVSC
chr1_1160631_C_G_b38	PLEKHN1	-2.947	0.0034	-0.03317	85	0.011256	yes	ADPVSC
chr1_1069047_G_A_b38	PLEKHN1	-2.945	0.00342	-0.035575	45	0.012081	yes	ADPVSC
chr1_1151436_C_CCCCCAGCCAGAGCCTCAGGGTGAGCTCAAGGCACCAAACCCAGAACGG_b38	PLEKHN1	2.926	0.00363	0.114119	4	0.039004	yes	ADPVSC
chr1_1159750_T_C_b38	PLEKHN1	2.906	0.00386	0.03689	33	0.012694	yes	ADPVSC
chr1_1159358_A_G_b38	PLEKHN1	-2.858	0.00449	-0.032464	69	0.011361	yes	ADPVSC
chr1_1154319_G_A_b38	PLEKHN1	2.85	0.00459	0.106414	4	0.037334	yes	ADPVSC
chr1_1154450_A_G_b38	PLEKHN1	2.85	0.00459	0.106414	4	0.037334	yes	ADPVSC
chr1_1156196_A_C_b38	PLEKHN1	2.85	0.00459	0.106414	4	0.037334	yes	ADPVSC
chr1_1156768_G_C_b38	PLEKHN1	2.85	0.00459	0.106414	4	0.037334	yes	ADPVSC
chr1_1156790_G_C_b38	PLEKHN1	2.85	0.00459	0.106414	4	0.037334	yes	ADPVSC
chr1_1159292_A_C_b38	PLEKHN1	-2.822	0.00501	-0.032173	73	0.011401	yes	ADPVSC
chr1_586303_C_T_b38	PLEKHN1	-2.815	0.00512	-0.06834	3	0.024277	yes	ADPVSC
chr1_993036_G_A_b38	PLEKHN1	2.804	0.0053	0.036246	28	0.012927	yes	ADPVSC
chr1_1130717_G_A_b38	PLEKHN1	2.799	0.00538	0.040384	17	0.014429	yes	ADPVSC
chr1_1161911_C_A_b38	PLEKHN1	2.756	0.00612	0.035388	32	0.01284	yes	ADPVSC
chr1_1137871_C_A_b38	PLEKHN1	2.739	0.00645	0.040073	14	0.014632	yes	ADPVSC
chr1_1160239_C_G_b38	PLEKHN1	-2.706	0.00711	-0.03118	65	0.011524	yes	ADPVSC
chr1_951437_C_CATTTT_b38	PLEKHN1	2.694	0.00736	0.067146	3	0.024925	yes	ADPVSC
chr1_1159599_G_A_b38	PLEKHN1	-2.674	0.0078	-0.03057	80	0.011432	yes	ADPVSC
chr1_1042813_G_A_b38	PLEKHN1	2.658	0.00819	0.04145	10	0.015597	yes	ADPVSC
chr1_1153291_C_T_b38	PLEKHN1	2.656	0.00823	0.033671	34	0.012679	yes	ADPVSC
chr1_1164057_G_A_b38	PLEKHN1	2.645	0.00848	0.034289	31	0.012961	yes	ADPVSC
chr1_1160818_C_T_b38	PLEKHN1	-2.622	0.00907	-0.030188	76	0.011513	yes	ADPVSC
chr1_744357_G_C_b38	PLEKHN1	2.607	0.00949	0.074727	5	0.028668	yes	ADPVSC
chr1_1163041_C_T_b38	PLEKHN1	-2.602	0.00962	-0.029288	110	0.011257	yes	ADPVSC
chr1_983747_T_C_b38	PLEKHN1	2.6	0.00968	0.035007	19	0.013466	yes	ADPVSC
chr1_950669_ACAG_A_b38	PLEKHN1	4.328	1.9e-05	0.090087	5	0.020814	no	ADPVSC
chr1_958339_G_A_b38	PLEKHN1	4.261	2.55e-05	0.085316	6	0.020023	no	ADPVSC
chr1_949046_A_AACAGCAAAG_b38	PLEKHN1	3.948	9.33e-05	0.086041	4	0.021796	no	ADPVSC
chr1_961945_G_C_b38	PLEKHN1	3.776	0.000183	0.078399	6	0.02076	no	ADPVSC
chr1_981169_A_G_b38	PLEKHN1	-3.744	0.000208	-0.047535	28	0.012695	no	ADPVSC
chr1_996254_A_AGGGAGGGCAG_b38	PLEKHN1	3.682	0.000263	0.051134	17	0.013887	no	ADPVSC
chr1_942335_C_G_b38	PLEKHN1	3.6	0.000359	0.075741	6	0.021042	no	ADPVSC
chr1_962184_T_C_b38	PLEKHN1	3.545	0.00044	0.075196	5	0.021214	no	ADPVSC
chr1_953778_G_C_b38	PLEKHN1	3.536	0.000454	0.080929	3	0.022887	no	ADPVSC
chr1_953779_A_C_b38	PLEKHN1	3.536	0.000454	0.080929	3	0.022887	no	ADPVSC
chr1_986629_G_A_b38	PLEKHN1	3.517	0.000486	0.048841	18	0.013886	no	ADPVSC
chr1_954333_C_A_b38	PLEKHN1	3.505	0.000509	0.075643	4	0.021582	no	ADPVSC
chr1_962358_C_T_b38	PLEKHN1	-3.503	0.000513	-0.074963	5	0.021403	no	ADPVSC
chr1_950296_C_A_b38	PLEKHN1	3.498	0.000521	0.078359	3	0.0224	no	ADPVSC
chr1_952180_A_C_b38	PLEKHN1	3.498	0.000521	0.078359	3	0.0224	no	ADPVSC
chr1_954258_G_C_b38	PLEKHN1	3.497	0.000524	0.075312	4	0.021537	no	ADPVSC
chr1_958251_A_G_b38	PLEKHN1	3.469	0.000579	0.072154	5	0.020798	no	ADPVSC
chr1_1028691_C_G_b38	PLEKHN1	3.421	0.000689	0.090942	8	0.026584	no	ADPVSC
chr1_986280_C_T_b38	PLEKHN1	3.415	0.000703	0.047303	18	0.013852	no	ADPVSC
chr1_1028687_C_T_b38	PLEKHN1	3.345	0.000901	0.088618	8	0.026492	no	ADPVSC
chr1_1063015_A_G_b38	PLEKHN1	-3.311	0.00102	-0.041933	33	0.012666	no	ADPVSC
chr1_1170732_A_G_b38	PLEKHN1	3.282	0.00112	0.117245	28	0.035728	no	ADPVSC
chr1_966227_C_G_b38	PLEKHN1	3.248	0.00126	0.068532	8	0.021098	no	ADPVSC
chr1_1068249_C_T_b38	PLEKHN1	-3.242	0.00129	-0.03953	52	0.012195	no	ADPVSC
chr1_992361_G_A_b38	PLEKHN1	3.236	0.00131	0.044525	19	0.013759	no	ADPVSC
chr1_1027633_C_T_b38	PLEKHN1	-3.226	0.00136	-0.036916	79	0.011444	no	ADPVSC
chr1_1067552_C_G_b38	PLEKHN1	-3.205	0.00146	-0.040262	35	0.012561	no	ADPVSC
chr1_1074098_G_C_b38	PLEKHN1	-3.204	0.00147	-0.040508	34	0.012644	no	ADPVSC
chr1_1004111_TG_T_b38	PLEKHN1	3.179	0.0016	0.04308	22	0.013553	no	ADPVSC
chr1_1081961_G_T_b38	PLEKHN1	-3.173	0.00163	-0.039749	37	0.012527	no	ADPVSC
chr1_1143818_T_C_b38	PLEKHN1	3.066	0.00232	0.040541	35	0.013222	no	ADPVSC
chr1_1065797_G_C_b38	PLEKHN1	-3.057	0.00239	-0.036993	51	0.012101	no	ADPVSC
chr1_1052514_C_CGT_b38	PLEKHN1	-3.056	0.0024	-0.034467	92	0.011279	no	ADPVSC
chr1_1143811_T_C_b38	PLEKHN1	3.014	0.00275	0.039442	34	0.013088	no	ADPVSC
chr1_1144486_C_G_b38	PLEKHN1	2.965	0.00321	0.039531	33	0.013334	no	ADPVSC
chr1_1375678_TAA_T_b38	PLEKHN1	-2.955	0.00331	-0.045606	15	0.015431	no	ADPVSC
chr1_1071610_G_A_b38	PLEKHN1	-2.939	0.00348	-0.037501	35	0.012758	no	ADPVSC
chr1_1086657_C_T_b38	PLEKHN1	-2.88	0.00419	-0.030665	107	0.010647	no	ADPVSC
chr1_1043223_CCT_C_b38	PLEKHN1	-2.837	0.00479	-0.03282	116	0.011569	no	ADPVSC
chr1_1063202_G_C_b38	PLEKHN1	-2.835	0.00481	-0.031232	123	0.011016	no	ADPVSC
chr1_1060101_T_G_b38	PLEKHN1	-2.812	0.00517	-0.031028	130	0.011035	no	ADPVSC
chr1_1079456_A_G_b38	PLEKHN1	-2.759	0.00607	-0.02935	121	0.010639	no	ADPVSC
chr1_1063661_ATG_A_b38	PLEKHN1	-2.748	0.00627	-0.030714	97	0.011176	no	ADPVSC
chr1_1086035_A_G_b38	PLEKHN1	-2.748	0.00627	-0.034545	35	0.012572	no	ADPVSC
chr1_1002745_G_A_b38	PLEKHN1	2.731	0.00659	0.036566	22	0.013388	no	ADPVSC
chr1_1101667_C_T_b38	PLEKHN1	2.707	0.00708	0.035154	33	0.012986	no	ADPVSC
chr1_1080437_G_A_b38	PLEKHN1	-2.698	0.00728	-0.033956	39	0.012587	no	ADPVSC
chr1_1663759_G_A_b38	PLEKHN1	-2.691	0.00742	-0.062747	6	0.023318	no	ADPVSC
chr1_1083324_A_G_b38	PLEKHN1	-2.681	0.00765	-0.028596	104	0.010667	no	ADPVSC
chr1_263934_GC_G_b38	PLEKHN1	-2.68	0.00766	-0.038155	16	0.014235	no	ADPVSC
chr1_981935_G_A_b38	PLEKHN1	-2.671	0.00787	-0.036983	16	0.013845	no	ADPVSC
chr1_1101437_T_C_b38	PLEKHN1	2.664	0.00805	0.034628	33	0.013001	no	ADPVSC
chr1_1072052_G_A_b38	PLEKHN1	-2.635	0.00874	-0.028592	119	0.010851	no	ADPVSC
chr1_1124794_C_T_b38	PLEKHN1	2.626	0.00898	0.032985	36	0.012563	no	ADPVSC
chr1_861387_G_A_b38	PLEKHN1	-2.607	0.00948	-0.03941	47	0.015117	no	ADPVSC
chr1_966179_G_A_b38	PLEKHN1	5.886	1.73e-08	0.238592	14	0.040534	yes	ADRNLG
chr1_965350_G_A_b38	PLEKHN1	5.682	4.88e-08	0.238281	13	0.041936	yes	ADRNLG
chr1_959193_G_A_b38	PLEKHN1	5.334	2.69e-07	0.226582	14	0.04248	yes	ADRNLG
chr1_961945_G_C_b38	PLEKHN1	4.652	6.11e-06	0.222631	4	0.047855	yes	ADRNLG
chr1_958339_G_A_b38	PLEKHN1	4.564	8.96e-06	0.225134	3	0.049332	yes	ADRNLG
chr1_966227_C_G_b38	PLEKHN1	4.542	9.83e-06	0.229453	4	0.050518	yes	ADRNLG
chr1_950669_ACAG_A_b38	PLEKHN1	4.472	1.32e-05	0.227948	3	0.050967	yes	ADRNLG
chr1_955679_C_T_b38	PLEKHN1	4.378	1.96e-05	0.117981	40	0.026948	yes	ADRNLG
chr1_956565_A_G_b38	PLEKHN1	4.378	1.96e-05	0.117981	40	0.026948	yes	ADRNLG
chr1_949171_GAGAA_G_b38	PLEKHN1	4.224	3.71e-05	0.113556	41	0.026884	yes	ADRNLG
chr1_939779_AGCCAGTGGACGCCGACCT_A_b38	PLEKHN1	4.202	4.06e-05	0.111174	47	0.02646	yes	ADRNLG
chr1_946247_G_A_b38	PLEKHN1	4.137	5.27e-05	0.114272	41	0.027624	yes	ADRNLG
chr1_914838_T_A_b38	PLEKHN1	4.053	7.34e-05	0.106192	57	0.0262	yes	ADRNLG
chr1_965337_CTTAT_C_b38	PLEKHN1	4.041	7.69e-05	0.112553	45	0.027851	yes	ADRNLG
chr1_960891_C_T_b38	PLEKHN1	4.007	8.78e-05	0.105578	50	0.026347	yes	ADRNLG
chr1_916683_G_A_b38	PLEKHN1	3.976	9.94e-05	0.105338	58	0.026497	yes	ADRNLG
chr1_916657_G_A_b38	PLEKHN1	3.963	0.000104	0.105146	58	0.026529	yes	ADRNLG
chr1_940390_A_G_b38	PLEKHN1	3.928	0.000119	0.102006	58	0.025967	yes	ADRNLG
chr1_951408_G_A_b38	PLEKHN1	3.883	0.000142	0.163689	7	0.042153	yes	ADRNLG
chr1_951437_C_T_b38	PLEKHN1	3.883	0.000142	0.163689	7	0.042153	yes	ADRNLG
chr1_967384_C_G_b38	PLEKHN1	3.876	0.000146	0.10711	40	0.027635	yes	ADRNLG
chr1_949046_A_AACAGCAAAG_b38	PLEKHN1	3.857	0.000157	0.198416	3	0.051448	yes	ADRNLG
chr1_898261_T_C_b38	PLEKHN1	-3.851	0.00016	-0.106877	24	0.02775	yes	ADRNLG
chr1_898279_T_A_b38	PLEKHN1	-3.851	0.00016	-0.106877	24	0.02775	yes	ADRNLG
chr1_898283_A_G_b38	PLEKHN1	-3.851	0.00016	-0.106877	24	0.02775	yes	ADRNLG
chr1_897843_C_T_b38	PLEKHN1	-3.835	0.00017	-0.107502	23	0.028032	yes	ADRNLG
chr1_897922_C_T_b38	PLEKHN1	-3.835	0.00017	-0.107502	23	0.028032	yes	ADRNLG
chr1_898444_T_C_b38	PLEKHN1	-3.835	0.00017	-0.107502	23	0.028032	yes	ADRNLG
chr1_899452_G_C_b38	PLEKHN1	-3.835	0.00017	-0.107502	23	0.028032	yes	ADRNLG
chr1_960375_A_AG_b38	PLEKHN1	3.817	0.000182	0.148397	15	0.038882	yes	ADRNLG
chr1_1182895_C_T_b38	PLEKHN1	-3.71	0.000271	-0.192086	4	0.051773	yes	ADRNLG
chr1_969750_ATG_A_b38	PLEKHN1	3.698	0.000283	0.088742	63	0.023995	yes	ADRNLG
chr1_967865_A_G_b38	PLEKHN1	3.673	0.000311	0.08929	61	0.02431	yes	ADRNLG
chr1_960326_G_A_b38	PLEKHN1	3.668	0.000316	0.149704	14	0.040811	yes	ADRNLG
chr1_915400_C_T_b38	PLEKHN1	3.601	0.000403	0.093827	45	0.026053	yes	ADRNLG
chr1_917284_C_T_b38	PLEKHN1	-3.59	0.000421	-0.111456	11	0.03105	yes	ADRNLG
chr1_917859_A_G_b38	PLEKHN1	-3.59	0.000421	-0.111456	11	0.03105	yes	ADRNLG
chr1_1180851_T_C_b38	PLEKHN1	-3.579	0.000436	-0.164532	5	0.045966	yes	ADRNLG
chr1_896529_C_T_b38	PLEKHN1	3.567	0.000457	0.095057	29	0.026652	yes	ADRNLG
chr1_896680_G_A_b38	PLEKHN1	3.567	0.000457	0.095057	29	0.026652	yes	ADRNLG
chr1_896686_G_C_b38	PLEKHN1	3.567	0.000457	0.095057	29	0.026652	yes	ADRNLG
chr1_896732_T_C_b38	PLEKHN1	3.567	0.000457	0.095057	29	0.026652	yes	ADRNLG
chr1_896917_CTG_C_b38	PLEKHN1	3.567	0.000457	0.095057	29	0.026652	yes	ADRNLG
chr1_896938_C_A_b38	PLEKHN1	3.567	0.000457	0.095057	29	0.026652	yes	ADRNLG
chr1_897792_T_TCGAA_b38	PLEKHN1	-3.567	0.000457	-0.095057	29	0.026652	yes	ADRNLG
chr1_976215_A_G_b38	PLEKHN1	3.554	0.000477	0.099523	20	0.028001	yes	ADRNLG
chr1_917495_C_T_b38	PLEKHN1	3.552	0.00048	0.092236	46	0.025964	yes	ADRNLG
chr1_918574_C_A_b38	PLEKHN1	3.552	0.00048	0.092236	46	0.025964	yes	ADRNLG
chr1_914991_G_T_b38	PLEKHN1	3.548	0.000488	0.090553	45	0.025521	yes	ADRNLG
chr1_918870_A_G_b38	PLEKHN1	-3.535	0.000511	-0.104333	13	0.029516	yes	ADRNLG
chr1_896798_A_G_b38	PLEKHN1	3.525	0.000529	0.094459	29	0.026795	yes	ADRNLG
chr1_674381_A_AT_b38	PLEKHN1	-3.514	0.00055	-0.114865	10	0.032685	yes	ADRNLG
chr1_981935_G_A_b38	PLEKHN1	-3.511	0.000556	-0.107225	11	0.030538	yes	ADRNLG
chr1_912710_G_A_b38	PLEKHN1	-3.507	0.000565	-0.109368	11	0.03119	yes	ADRNLG
chr1_913358_C_T_b38	PLEKHN1	-3.507	0.000565	-0.109368	11	0.03119	yes	ADRNLG
chr1_914743_C_T_b38	PLEKHN1	-3.507	0.000565	-0.109368	11	0.03119	yes	ADRNLG
chr1_906677_A_AAACTCAGCTGCCTCTCCCCTTC_b38	PLEKHN1	-3.469	0.000646	-0.098538	26	0.028409	yes	ADRNLG
chr1_857809_G_A_b38	PLEKHN1	3.451	0.000686	0.157937	6	0.045762	yes	ADRNLG
chr1_915810_G_A_b38	PLEKHN1	-3.449	0.000691	-0.103494	13	0.030006	yes	ADRNLG
chr1_897538_T_C_b38	PLEKHN1	-3.436	0.000723	-0.091667	30	0.026675	yes	ADRNLG
chr1_890030_G_A_b38	PLEKHN1	3.402	0.000814	0.090847	31	0.026705	yes	ADRNLG
chr1_931513_T_C_b38	PLEKHN1	3.399	0.000822	0.089117	53	0.026216	yes	ADRNLG
chr1_914483_G_GACTGCCCAGCTC_b38	PLEKHN1	-3.398	0.000825	-0.104891	11	0.030867	yes	ADRNLG
chr1_924305_G_A_b38	PLEKHN1	-3.369	0.000911	-0.104563	12	0.031036	yes	ADRNLG
chr1_905705_C_G_b38	PLEKHN1	-3.359	0.000944	-0.102686	15	0.030573	yes	ADRNLG
chr1_897376_T_G_b38	PLEKHN1	-3.356	0.000952	-0.091654	26	0.027308	yes	ADRNLG
chr1_903175_C_A_b38	PLEKHN1	-3.325	0.00106	-0.099373	17	0.029884	yes	ADRNLG
chr1_925308_G_A_b38	PLEKHN1	3.315	0.00109	0.098404	22	0.02968	yes	ADRNLG
chr1_920719_T_G_b38	PLEKHN1	-3.315	0.0011	-0.084159	38	0.025387	yes	ADRNLG
chr1_920728_A_G_b38	PLEKHN1	-3.315	0.0011	-0.084159	38	0.025387	yes	ADRNLG
chr1_914682_A_T_b38	PLEKHN1	-3.314	0.0011	-0.099793	13	0.030114	yes	ADRNLG
chr1_1183198_G_A_b38	PLEKHN1	-3.313	0.0011	-0.171162	3	0.051658	yes	ADRNLG
chr1_901516_T_C_b38	PLEKHN1	-3.31	0.00111	-0.090999	30	0.027493	yes	ADRNLG
chr1_923311_TG_T_b38	PLEKHN1	3.298	0.00116	0.09687	20	0.029369	yes	ADRNLG
chr1_919598_A_C_b38	PLEKHN1	3.285	0.00121	0.086274	47	0.026262	yes	ADRNLG
chr1_912111_G_A_b38	PLEKHN1	-3.264	0.0013	-0.098927	13	0.030308	yes	ADRNLG
chr1_967724_C_T_b38	PLEKHN1	-3.257	0.00133	-0.157297	8	0.048294	yes	ADRNLG
chr1_926250_G_A_b38	PLEKHN1	3.212	0.00155	0.097031	22	0.03021	yes	ADRNLG
chr1_913065_G_A_b38	PLEKHN1	-3.18	0.00172	-0.09764	12	0.030702	yes	ADRNLG
chr1_913076_A_G_b38	PLEKHN1	-3.18	0.00172	-0.09764	12	0.030702	yes	ADRNLG
chr1_919695_C_G_b38	PLEKHN1	3.179	0.00172	0.081079	38	0.025503	yes	ADRNLG
chr1_923421_A_G_b38	PLEKHN1	3.12	0.00209	0.091012	21	0.029173	yes	ADRNLG
chr1_1182106_A_G_b38	PLEKHN1	-3.073	0.00243	-0.098116	14	0.031926	yes	ADRNLG
chr1_896109_C_T_b38	PLEKHN1	3.071	0.00245	0.084996	29	0.027681	yes	ADRNLG
chr1_903723_A_G_b38	PLEKHN1	-3.069	0.00246	-0.08688	24	0.028307	yes	ADRNLG
chr1_1950071_C_T_b38	PLEKHN1	3.044	0.00266	0.081276	49	0.026696	yes	ADRNLG
chr1_1952064_G_A_b38	PLEKHN1	3.044	0.00266	0.081276	49	0.026696	yes	ADRNLG
chr1_919397_A_G_b38	PLEKHN1	3.036	0.00273	0.077522	38	0.025531	yes	ADRNLG
chr1_925036_G_A_b38	PLEKHN1	3.03	0.00278	0.090511	21	0.029867	yes	ADRNLG
chr1_931131_C_CCCCT_b38	PLEKHN1	3.028	0.0028	0.119104	26	0.039335	yes	ADRNLG
chr1_1952823_TA_T_b38	PLEKHN1	3.017	0.0029	0.08001	49	0.026518	yes	ADRNLG
chr1_915824_G_C_b38	PLEKHN1	-3.006	0.003	-0.086037	18	0.028623	yes	ADRNLG
chr1_1193652_A_G_b38	PLEKHN1	-2.99	0.00316	-0.147987	3	0.049494	yes	ADRNLG
chr1_907835_C_CCTGCCCGGTCCTTCTGACCAGCCGAGAGAGTA_b38	PLEKHN1	-2.979	0.00327	-0.083156	22	0.027916	yes	ADRNLG
chr1_894801_A_G_b38	PLEKHN1	2.972	0.00334	0.080853	23	0.027205	yes	ADRNLG
chr1_921096_A_G_b38	PLEKHN1	-2.938	0.00371	-0.077957	40	0.026538	yes	ADRNLG
chr1_631412_T_C_b38	PLEKHN1	2.908	0.00406	0.189948	3	0.065308	yes	ADRNLG
chr1_936972_G_C_b38	PLEKHN1	-2.895	0.00423	-0.081247	23	0.028066	yes	ADRNLG
chr1_966426_G_C_b38	PLEKHN1	-2.881	0.00442	-0.149857	9	0.05202	yes	ADRNLG
chr1_1177602_C_T_b38	PLEKHN1	-2.871	0.00455	-0.098457	8	0.034296	yes	ADRNLG
chr1_940263_C_G_b38	PLEKHN1	2.865	0.00463	0.09509	12	0.033186	yes	ADRNLG
chr1_933741_T_TG_b38	PLEKHN1	2.842	0.00497	0.081248	22	0.02859	yes	ADRNLG
chr1_1180614_G_A_b38	PLEKHN1	-2.841	0.00498	-0.091253	11	0.032115	yes	ADRNLG
chr1_108545_C_CA_b38	PLEKHN1	2.824	0.00525	0.088924	13	0.031493	yes	ADRNLG
chr1_935954_G_T_b38	PLEKHN1	2.811	0.00545	0.081498	30	0.02899	yes	ADRNLG
chr1_1580890_C_T_b38	PLEKHN1	2.803	0.00558	0.083527	13	0.0298	yes	ADRNLG
chr1_1904424_A_AAAATAAATAAAT_b38	PLEKHN1	-2.802	0.00561	-0.071133	36	0.025391	yes	ADRNLG
chr1_897580_AT_A_b38	PLEKHN1	-2.777	0.00604	-0.074914	51	0.02698	yes	ADRNLG
chr1_968046_C_T_b38	PLEKHN1	-2.771	0.00615	-0.075873	25	0.027385	yes	ADRNLG
chr1_292126_G_A_b38	PLEKHN1	2.767	0.00621	0.196329	3	0.07096	yes	ADRNLG
chr1_1290841_A_G_b38	PLEKHN1	-2.761	0.00633	-0.106819	13	0.038695	yes	ADRNLG
chr1_1947645_C_T_b38	PLEKHN1	2.749	0.00655	0.082048	44	0.029847	yes	ADRNLG
chr1_910698_C_T_b38	PLEKHN1	-2.736	0.00679	-0.085578	11	0.031273	yes	ADRNLG
chr1_911848_C_T_b38	PLEKHN1	-2.708	0.00738	-0.081422	13	0.030066	yes	ADRNLG
chr1_1570568_AC_A_b38	PLEKHN1	2.701	0.00754	0.079767	15	0.029536	yes	ADRNLG
chr1_1275583_T_C_b38	PLEKHN1	-2.694	0.00768	-0.121354	7	0.045044	yes	ADRNLG
chr1_928264_T_C_b38	PLEKHN1	-2.685	0.00788	-0.095766	8	0.035664	yes	ADRNLG
chr1_938178_G_T_b38	PLEKHN1	2.655	0.00861	0.076329	30	0.028753	yes	ADRNLG
chr1_1944420_A_G_b38	PLEKHN1	2.645	0.00884	0.076275	46	0.028834	yes	ADRNLG
chr1_981454_G_A_b38	PLEKHN1	2.644	0.00888	0.063097	56	0.023869	yes	ADRNLG
chr1_908025_A_G_b38	PLEKHN1	2.605	0.0099	0.070794	23	0.027174	yes	ADRNLG
chr1_900119_A_G_b38	PLEKHN1	-3.987	9.49e-05	-0.112769	21	0.028281	no	ADRNLG
chr1_922671_C_T_b38	PLEKHN1	-3.68	0.000303	-0.116057	10	0.031541	no	ADRNLG
chr1_921056_TG_T_b38	PLEKHN1	-3.519	0.00054	-0.114032	9	0.0324	no	ADRNLG
chr1_922660_C_A_b38	PLEKHN1	-3.516	0.000546	-0.11167	10	0.031757	no	ADRNLG
chr1_903007_T_C_b38	PLEKHN1	-3.45	0.00069	-0.109055	10	0.031614	no	ADRNLG
chr1_917378_G_C_b38	PLEKHN1	-3.366	0.00092	-0.106479	10	0.031632	no	ADRNLG
chr1_982112_C_T_b38	PLEKHN1	-3.264	0.0013	-0.102097	10	0.031276	no	ADRNLG
chr1_913274_TG_T_b38	PLEKHN1	-3.219	0.00151	-0.100939	11	0.031354	no	ADRNLG
chr1_981282_A_C_b38	PLEKHN1	-3.167	0.00179	-0.099297	10	0.031358	no	ADRNLG
chr1_978230_G_A_b38	PLEKHN1	-3.135	0.00199	-0.098743	10	0.031493	no	ADRNLG
chr1_898547_T_C_b38	PLEKHN1	-3.025	0.00283	-0.096822	10	0.032011	no	ADRNLG
chr1_901149_C_G_b38	PLEKHN1	-3.025	0.00283	-0.096822	10	0.032011	no	ADRNLG
chr1_901544_G_A_b38	PLEKHN1	-3.025	0.00283	-0.096822	10	0.032011	no	ADRNLG
chr1_902949_G_GC_b38	PLEKHN1	-3.025	0.00283	-0.096822	10	0.032011	no	ADRNLG
chr1_976536_C_T_b38	PLEKHN1	-3.012	0.00295	-0.096528	9	0.032051	no	ADRNLG
chr1_1951106_G_A_b38	PLEKHN1	3.011	0.00295	0.080388	50	0.026698	no	ADRNLG
chr1_1951865_G_GT_b38	PLEKHN1	3.011	0.00295	0.080388	50	0.026698	no	ADRNLG
chr1_860178_C_CTTTTTT_b38	PLEKHN1	-2.981	0.00325	-0.110097	4	0.036933	no	ADRNLG
chr1_982890_C_T_b38	PLEKHN1	-2.934	0.00376	-0.09226	10	0.031448	no	ADRNLG
chr1_983237_G_A_b38	PLEKHN1	-2.934	0.00376	-0.09226	10	0.031448	no	ADRNLG
chr1_899548_A_G_b38	PLEKHN1	-2.924	0.00387	-0.091026	11	0.031129	no	ADRNLG
chr1_1904424_A_AAAATAAAT_b38	PLEKHN1	2.867	0.0046	0.074823	49	0.026097	no	ADRNLG
chr1_904478_CGCCTCCTCCGAACGCGGCCGCCTCCTCCTCCGAACGTGGCCTCCTCCGAACGCGGCCGCCTCCTCCTCCGAACGCGGCCGCCTCCTCCTCCGAACGTG_C_b38	PLEKHN1	-2.845	0.00492	-0.08706	11	0.030601	no	ADRNLG
chr1_975093_G_A_b38	PLEKHN1	-2.828	0.00518	-0.099256	5	0.035094	no	ADRNLG
chr1_898818_T_C_b38	PLEKHN1	-2.806	0.00553	-0.089707	10	0.03197	no	ADRNLG
chr1_899619_G_A_b38	PLEKHN1	-2.766	0.00623	-0.087355	10	0.031579	no	ADRNLG
chr1_889689_G_C_b38	PLEKHN1	2.713	0.00727	0.095963	20	0.035369	no	ADRNLG
chr1_906633_T_G_b38	PLEKHN1	-2.661	0.00845	-0.085198	10	0.032015	no	ADRNLG
chr1_1725745_C_G_b38	PLEKHN1	-2.637	0.00904	-0.084259	16	0.031947	no	ADRNLG
chr1_904947_G_A_b38	PLEKHN1	-2.614	0.00965	-0.085024	9	0.032524	no	ADRNLG
chr1_966227_C_G_b38	PLEKHN1	3.485	0.000562	0.079692	7	0.022867	yes	ARTAORT
chr1_966179_G_A_b38	PLEKHN1	3.394	0.000777	0.069189	18	0.020387	yes	ARTAORT
chr1_101895_G_A_b38	PLEKHN1	3.261	0.00123	0.048002	29	0.014718	yes	ARTAORT
chr1_965337_CTTAT_C_b38	PLEKHN1	3.168	0.00168	0.042896	79	0.013539	yes	ARTAORT
chr1_598938_G_A_b38	PLEKHN1	3.087	0.0022	0.059324	7	0.019217	yes	ARTAORT
chr1_960891_C_T_b38	PLEKHN1	3	0.00291	0.03939	82	0.01313	yes	ARTAORT
chr1_1634405_CCGG_C_b38	PLEKHN1	2.993	0.00298	0.097206	4	0.032481	yes	ARTAORT
chr1_946247_G_A_b38	PLEKHN1	2.963	0.00328	0.040489	70	0.013664	yes	ARTAORT
chr1_507505_G_A_b38	PLEKHN1	2.957	0.00334	0.063865	5	0.021596	yes	ARTAORT
chr1_956565_A_G_b38	PLEKHN1	2.957	0.00334	0.040481	68	0.013689	yes	ARTAORT
chr1_939779_AGCCAGTGGACGCCGACCT_A_b38	PLEKHN1	2.944	0.00348	0.038737	74	0.013157	yes	ARTAORT
chr1_955679_C_T_b38	PLEKHN1	2.871	0.00437	0.039423	68	0.013732	yes	ARTAORT
chr1_949171_GAGAA_G_b38	PLEKHN1	2.857	0.00456	0.038993	69	0.013649	yes	ARTAORT
chr1_1692124_T_G_b38	PLEKHN1	-2.828	0.00498	-0.040713	31	0.014397	yes	ARTAORT
chr1_1691417_T_C_b38	PLEKHN1	2.817	0.00516	0.037058	77	0.013157	yes	ARTAORT
chr1_95045_A_G_b38	PLEKHN1	2.744	0.00642	0.066375	4	0.02419	yes	ARTAORT
chr1_1725339_C_A_b38	PLEKHN1	2.739	0.0065	0.032426	74	0.011837	yes	ARTAORT
chr1_931513_T_C_b38	PLEKHN1	2.642	0.00865	0.034601	94	0.013097	yes	ARTAORT
chr1_1744028_A_AC_b38	PLEKHN1	-3.807	0.000169	-0.06328	16	0.016623	no	ARTAORT
chr1_962184_T_C_b38	PLEKHN1	3.706	0.000248	0.084069	4	0.022682	no	ARTAORT
chr1_949046_A_AACAGCAAAG_b38	PLEKHN1	3.538	0.000463	0.084057	3	0.023756	no	ARTAORT
chr1_942335_C_G_b38	PLEKHN1	3.51	0.000513	0.081115	3	0.023108	no	ARTAORT
chr1_958251_A_G_b38	PLEKHN1	3.496	0.000541	0.080255	3	0.022959	no	ARTAORT
chr1_962358_C_T_b38	PLEKHN1	-3.485	0.000561	-0.079533	4	0.02282	no	ARTAORT
chr1_950669_ACAG_A_b38	PLEKHN1	3.387	0.000797	0.076292	5	0.022527	no	ARTAORT
chr1_1744052_GAGA_G_b38	PLEKHN1	-3.325	0.000987	-0.053939	19	0.016221	no	ARTAORT
chr1_961945_G_C_b38	PLEKHN1	3.248	0.00129	0.071493	6	0.022012	no	ARTAORT
chr1_596797_T_TCA_b38	PLEKHN1	3.135	0.00188	0.072763	3	0.023211	no	ARTAORT
chr1_592797_C_T_b38	PLEKHN1	3.08	0.00225	0.085041	4	0.02761	no	ARTAORT
chr1_958339_G_A_b38	PLEKHN1	3.075	0.00229	0.06667	5	0.021682	no	ARTAORT
chr1_593750_C_T_b38	PLEKHN1	2.945	0.00347	0.096299	3	0.032702	no	ARTAORT
chr1_1573265_C_CAAA_b38	PLEKHN1	2.938	0.00355	0.088039	5	0.02997	no	ARTAORT
chr1_588445_C_T_b38	PLEKHN1	-2.8	0.00542	-0.053032	3	0.018939	no	ARTAORT
chr1_1695459_A_G_b38	PLEKHN1	2.755	0.00621	0.041118	60	0.014926	no	ARTAORT
chr1_1020855_G_GGC_b38	PLEKHN1	-2.719	0.00691	-0.092906	3	0.034167	no	ARTAORT
chr1_94321_C_T_b38	PLEKHN1	2.673	0.0079	0.047874	8	0.017907	no	ARTAORT
chr1_261753_G_A_b38	PLEKHN1	-2.644	0.00861	-0.154846	4	0.058574	no	ARTAORT
chr1_1717953_C_T_b38	PLEKHN1	-2.616	0.00932	-0.033196	60	0.012689	no	ARTAORT
chr1_1749637_G_T_b38	PLEKHN1	2.602	0.0097	0.033857	64	0.013012	no	ARTAORT
chr1_1367028_A_G_b38	PLEKHN1	3.836	0.000176	0.115882	6	0.030211	yes	ARTCRN
chr1_696963_C_G_b38	PLEKHN1	3.641	0.000359	0.144865	5	0.039787	yes	ARTCRN
chr1_1660408_T_C_b38	PLEKHN1	3.429	0.000758	0.083618	5	0.024384	yes	ARTCRN
chr1_1366941_T_TGTGTGCA_b38	PLEKHN1	3.35	0.000993	0.102893	6	0.030715	yes	ARTCRN
chr1_1366951_A_AGT_b38	PLEKHN1	3.35	0.000993	0.102893	6	0.030715	yes	ARTCRN
chr1_1708474_C_A_b38	PLEKHN1	3.221	0.00153	0.076835	8	0.023857	yes	ARTCRN
chr1_1205055_G_T_b38	PLEKHN1	-3.216	0.00155	-0.066745	39	0.020753	yes	ARTCRN
chr1_1366987_GTGTGTAGTGGATGAGTGTGGA_G_b38	PLEKHN1	-3.206	0.0016	-0.133344	4	0.041586	yes	ARTCRN
chr1_1367013_TG_T_b38	PLEKHN1	-3.206	0.0016	-0.133344	4	0.041586	yes	ARTCRN
chr1_1367021_GGCGAGTATGGA_G_b38	PLEKHN1	-3.206	0.0016	-0.133344	4	0.041586	yes	ARTCRN
chr1_1659940_A_C_b38	PLEKHN1	3.206	0.0016	0.07498	9	0.023386	yes	ARTCRN
chr1_1187088_T_C_b38	PLEKHN1	-3.166	0.00183	-0.074707	9	0.023597	yes	ARTCRN
chr1_1193398_C_CTTA_b38	PLEKHN1	-3.164	0.00184	-0.065394	40	0.020668	yes	ARTCRN
chr1_1668721_C_T_b38	PLEKHN1	3.117	0.00214	0.063236	20	0.020288	yes	ARTCRN
chr1_1729859_A_G_b38	PLEKHN1	-3.048	0.00267	-0.070711	9	0.023197	yes	ARTCRN
chr1_1366976_GTTGAA_G_b38	PLEKHN1	-3.046	0.00268	-0.122751	4	0.040299	yes	ARTCRN
chr1_1591703_T_C_b38	PLEKHN1	-3.019	0.00292	-0.05821	36	0.019279	yes	ARTCRN
chr1_1193141_C_T_b38	PLEKHN1	-3.015	0.00295	-0.073985	7	0.024535	yes	ARTCRN
chr1_1367036_GTGAATTGGT_G_b38	PLEKHN1	-3.012	0.00299	-0.132275	3	0.04392	yes	ARTCRN
chr1_1367046_G_C_b38	PLEKHN1	-3.012	0.00299	-0.132275	3	0.04392	yes	ARTCRN
chr1_1367055_T_TGA_b38	PLEKHN1	-3.01	0.003	-0.132184	3	0.043911	yes	ARTCRN
chr1_1739131_T_C_b38	PLEKHN1	-3.007	0.00303	-0.054623	45	0.018165	yes	ARTCRN
chr1_1659060_G_A_b38	PLEKHN1	3.003	0.00307	0.060659	20	0.020199	yes	ARTCRN
chr1_1652913_C_T_b38	PLEKHN1	2.977	0.00333	0.061698	18	0.020726	yes	ARTCRN
chr1_1668542_C_T_b38	PLEKHN1	2.943	0.00369	0.06478	16	0.022009	yes	ARTCRN
chr1_1668717_C_G_b38	PLEKHN1	2.941	0.00372	0.062318	18	0.02119	yes	ARTCRN
chr1_1669576_G_A_b38	PLEKHN1	2.941	0.00372	0.062318	18	0.02119	yes	ARTCRN
chr1_1669613_G_A_b38	PLEKHN1	2.941	0.00372	0.062318	18	0.02119	yes	ARTCRN
chr1_1481071_T_C_b38	PLEKHN1	2.909	0.00411	0.122689	3	0.04218	yes	ARTCRN
chr1_1722625_A_T_b38	PLEKHN1	-2.902	0.00419	-0.069212	14	0.023849	yes	ARTCRN
chr1_1291864_G_A_b38	PLEKHN1	-2.891	0.00434	-0.108083	3	0.037391	yes	ARTCRN
chr1_1186277_T_C_b38	PLEKHN1	-2.863	0.00472	-0.067226	10	0.023479	yes	ARTCRN
chr1_1194826_G_A_b38	PLEKHN1	-2.848	0.00494	-0.070385	7	0.024714	yes	ARTCRN
chr1_985123_G_A_b38	PLEKHN1	-2.84	0.00505	-0.077232	4	0.027191	yes	ARTCRN
chr1_1650195_A_G_b38	PLEKHN1	2.837	0.0051	0.058855	21	0.020746	yes	ARTCRN
chr1_1586962_C_T_b38	PLEKHN1	-2.835	0.00513	-0.061843	21	0.021814	yes	ARTCRN
chr1_1021740_G_C_b38	PLEKHN1	-2.803	0.00564	-0.05558	22	0.019826	yes	ARTCRN
chr1_1708248_G_A_b38	PLEKHN1	2.794	0.0058	0.110248	5	0.03946	yes	ARTCRN
chr1_1303112_G_A_b38	PLEKHN1	-2.793	0.00581	-0.083799	3	0.030003	yes	ARTCRN
chr1_1651421_GTAGCCCCTCTGAACGGTCTGTGACACACGCATGCTTTCAGCTAGAGTACTCTA_G_b38	PLEKHN1	2.785	0.00595	0.058935	17	0.021159	yes	ARTCRN
chr1_1657085_C_CTAA_b38	PLEKHN1	2.779	0.00607	0.065354	16	0.023521	yes	ARTCRN
chr1_1728671_C_A_b38	PLEKHN1	-2.778	0.00608	-0.067744	8	0.024389	yes	ARTCRN
chr1_1366907_G_A_b38	PLEKHN1	-2.771	0.0062	-0.109921	4	0.039663	yes	ARTCRN
chr1_1366911_A_T_b38	PLEKHN1	-2.771	0.0062	-0.109921	4	0.039663	yes	ARTCRN
chr1_940296_GCC_G_b38	PLEKHN1	2.769	0.00624	0.055689	33	0.020113	yes	ARTCRN
chr1_978230_G_A_b38	PLEKHN1	-2.767	0.00628	-0.068905	9	0.024905	yes	ARTCRN
chr1_973929_T_C_b38	PLEKHN1	-2.744	0.0067	-0.060522	15	0.022052	yes	ARTCRN
chr1_1365566_G_A_b38	PLEKHN1	2.743	0.00673	0.075346	7	0.027468	yes	ARTCRN
chr1_1675091_A_G_b38	PLEKHN1	2.737	0.00685	0.058021	18	0.021199	yes	ARTCRN
chr1_1022518_G_T_b38	PLEKHN1	-2.731	0.00697	-0.053078	26	0.019434	yes	ARTCRN
chr1_1457071_C_T_b38	PLEKHN1	-2.72	0.0072	-0.067046	10	0.024648	yes	ARTCRN
chr1_1162613_A_G_b38	PLEKHN1	2.718	0.00724	0.151783	3	0.055845	yes	ARTCRN
chr1_967865_A_G_b38	PLEKHN1	2.696	0.00771	0.054267	52	0.020127	yes	ARTCRN
chr1_1190173_A_T_b38	PLEKHN1	-2.69	0.00784	-0.067057	7	0.024925	yes	ARTCRN
chr1_1650777_G_A_b38	PLEKHN1	2.688	0.0079	0.055944	19	0.020813	yes	ARTCRN
chr1_1018652_C_G_b38	PLEKHN1	-2.682	0.00804	-0.053761	21	0.020048	yes	ARTCRN
chr1_1018754_G_A_b38	PLEKHN1	-2.682	0.00804	-0.053761	21	0.020048	yes	ARTCRN
chr1_1363456_CAG_C_b38	PLEKHN1	2.681	0.00804	0.065761	13	0.024524	yes	ARTCRN
chr1_1186455_C_CTG_b38	PLEKHN1	-2.676	0.00816	-0.063244	10	0.02363	yes	ARTCRN
chr1_1020697_C_T_b38	PLEKHN1	-2.675	0.0082	-0.053146	20	0.019868	yes	ARTCRN
chr1_1282558_C_CCA_b38	PLEKHN1	-2.672	0.00827	-0.065868	18	0.024654	yes	ARTCRN
chr1_1649932_C_T_b38	PLEKHN1	-2.661	0.00852	-0.054221	35	0.020374	yes	ARTCRN
chr1_1660683_C_T_b38	PLEKHN1	2.657	0.00862	0.059179	13	0.02227	yes	ARTCRN
chr1_1154319_G_A_b38	PLEKHN1	2.657	0.00862	0.151027	3	0.056838	yes	ARTCRN
chr1_1154450_A_G_b38	PLEKHN1	2.657	0.00862	0.151027	3	0.056838	yes	ARTCRN
chr1_1156196_A_C_b38	PLEKHN1	2.657	0.00862	0.151027	3	0.056838	yes	ARTCRN
chr1_1156768_G_C_b38	PLEKHN1	2.657	0.00862	0.151027	3	0.056838	yes	ARTCRN
chr1_1156790_G_C_b38	PLEKHN1	2.657	0.00862	0.151027	3	0.056838	yes	ARTCRN
chr1_1000814_A_G_b38	PLEKHN1	2.653	0.00873	0.064792	15	0.024425	yes	ARTCRN
chr1_1650688_T_A_b38	PLEKHN1	2.623	0.00949	0.054707	18	0.020853	yes	ARTCRN
chr1_194639_A_T_b38	PLEKHN1	4.422	1.73e-05	0.119754	7	0.027078	no	ARTCRN
chr1_984121_G_T_b38	PLEKHN1	3.429	0.000759	0.06356	56	0.018537	no	ARTCRN
chr1_1698022_G_A_b38	PLEKHN1	-3.373	0.000919	-0.168449	6	0.049943	no	ARTCRN
chr1_1707341_C_T_b38	PLEKHN1	3.29	0.00122	0.133242	4	0.040501	no	ARTCRN
chr1_1713611_C_T_b38	PLEKHN1	-3.166	0.00183	-0.08125	15	0.025665	no	ARTCRN
chr1_1722626_AGCG_A_b38	PLEKHN1	-3.083	0.00238	-0.073644	14	0.023883	no	ARTCRN
chr1_981935_G_A_b38	PLEKHN1	-3.056	0.0026	-0.072874	8	0.023844	no	ARTCRN
chr1_1704489_G_A_b38	PLEKHN1	3.054	0.00262	0.116251	3	0.038062	no	ARTCRN
chr1_1706748_C_T_b38	PLEKHN1	3.054	0.00262	0.116251	3	0.038062	no	ARTCRN
chr1_1367175_C_T_b38	PLEKHN1	3.052	0.00263	0.139764	3	0.045787	no	ARTCRN
chr1_1145547_T_TCTGACCTCATGGCCGACCCCAC_b38	PLEKHN1	-2.98	0.0033	-0.057843	21	0.019409	no	ARTCRN
chr1_1704673_G_A_b38	PLEKHN1	2.956	0.00355	0.11002	6	0.037218	no	ARTCRN
chr1_1707090_A_G_b38	PLEKHN1	2.907	0.00413	0.11371	6	0.039119	no	ARTCRN
chr1_1704504_A_C_b38	PLEKHN1	2.906	0.00414	0.109029	7	0.037514	no	ARTCRN
chr1_1704540_G_C_b38	PLEKHN1	2.906	0.00414	0.109029	7	0.037514	no	ARTCRN
chr1_1706141_C_T_b38	PLEKHN1	2.906	0.00414	0.109029	7	0.037514	no	ARTCRN
chr1_1706898_T_C_b38	PLEKHN1	2.906	0.00414	0.109029	7	0.037514	no	ARTCRN
chr1_1706927_A_G_b38	PLEKHN1	2.906	0.00414	0.109029	7	0.037514	no	ARTCRN
chr1_994185_G_T_b38	PLEKHN1	-2.889	0.00436	-0.078895	4	0.027311	no	ARTCRN
chr1_1708393_T_C_b38	PLEKHN1	2.847	0.00495	0.108353	7	0.038058	no	ARTCRN
chr1_633714_A_G_b38	PLEKHN1	-2.841	0.00504	-0.097792	6	0.034423	no	ARTCRN
chr1_985260_C_T_b38	PLEKHN1	-2.84	0.00506	-0.072438	6	0.025507	no	ARTCRN
chr1_1002415_C_CATTTT_b38	PLEKHN1	2.803	0.00564	0.050324	32	0.017952	no	ARTCRN
chr1_1707486_C_T_b38	PLEKHN1	2.795	0.00578	0.105348	6	0.037695	no	ARTCRN
chr1_1703669_G_A_b38	PLEKHN1	2.795	0.00579	0.106317	7	0.038043	no	ARTCRN
chr1_1703754_T_C_b38	PLEKHN1	2.795	0.00579	0.106317	7	0.038043	no	ARTCRN
chr1_1704126_C_T_b38	PLEKHN1	2.795	0.00579	0.106317	7	0.038043	no	ARTCRN
chr1_982112_C_T_b38	PLEKHN1	-2.778	0.00607	-0.069962	8	0.02518	no	ARTCRN
chr1_982890_C_T_b38	PLEKHN1	-2.778	0.00607	-0.069962	8	0.02518	no	ARTCRN
chr1_983237_G_A_b38	PLEKHN1	-2.778	0.00607	-0.069962	8	0.02518	no	ARTCRN
chr1_1366896_G_GT_b38	PLEKHN1	-2.768	0.00627	-0.11719	4	0.042345	no	ARTCRN
chr1_1000079_A_G_b38	PLEKHN1	2.727	0.00705	0.065711	17	0.024093	no	ARTCRN
chr1_286172_G_GTC_b38	PLEKHN1	-2.716	0.00728	-0.074109	6	0.027283	no	ARTCRN
chr1_998750_G_C_b38	PLEKHN1	-2.697	0.00769	-0.071661	5	0.02657	no	ARTCRN
chr1_996120_C_T_b38	PLEKHN1	-2.695	0.00773	-0.073207	4	0.027159	no	ARTCRN
chr1_1000112_G_T_b38	PLEKHN1	2.691	0.00783	0.065139	17	0.024209	no	ARTCRN
chr1_1000453_C_G_b38	PLEKHN1	2.691	0.00783	0.065139	17	0.024209	no	ARTCRN
chr1_1706210_G_A_b38	PLEKHN1	2.687	0.00792	0.103113	6	0.038378	no	ARTCRN
chr1_1706488_C_G_b38	PLEKHN1	2.687	0.00792	0.103113	6	0.038378	no	ARTCRN
chr1_976536_C_T_b38	PLEKHN1	-2.679	0.0081	-0.069077	8	0.025785	no	ARTCRN
chr1_985597_T_C_b38	PLEKHN1	-2.678	0.00812	-0.071321	5	0.026631	no	ARTCRN
chr1_987103_T_C_b38	PLEKHN1	-2.678	0.00812	-0.071321	5	0.026631	no	ARTCRN
chr1_991588_C_T_b38	PLEKHN1	-2.678	0.00812	-0.071321	5	0.026631	no	ARTCRN
chr1_1763636_G_A_b38	PLEKHN1	2.671	0.00829	0.067689	11	0.025344	no	ARTCRN
chr1_1722619_C_T_b38	PLEKHN1	-2.662	0.00851	-0.063774	14	0.023958	no	ARTCRN
chr1_1500729_G_A_b38	PLEKHN1	2.625	0.00945	0.124027	12	0.047255	no	ARTCRN
chr1_966179_G_A_b38	PLEKHN1	4.878	1.43e-06	0.086768	37	0.017788	yes	ARTTBL
chr1_959193_G_A_b38	PLEKHN1	4.12	4.41e-05	0.074075	41	0.017978	yes	ARTTBL
chr1_953778_G_C_b38	PLEKHN1	3.996	7.38e-05	0.089895	4	0.022495	yes	ARTTBL
chr1_953779_A_C_b38	PLEKHN1	3.996	7.38e-05	0.089895	4	0.022495	yes	ARTTBL
chr1_951408_G_A_b38	PLEKHN1	3.986	7.68e-05	0.068761	23	0.017248	yes	ARTTBL
chr1_951437_C_T_b38	PLEKHN1	3.986	7.68e-05	0.068761	23	0.017248	yes	ARTTBL
chr1_939779_AGCCAGTGGACGCCGACCT_A_b38	PLEKHN1	3.876	0.00012	0.043488	115	0.011219	yes	ARTTBL
chr1_897018_T_C_b38	PLEKHN1	3.5	0.000505	0.04539	31	0.012968	yes	ARTTBL
chr1_730906_G_T_b38	PLEKHN1	-3.46	0.000586	-0.136856	4	0.039557	yes	ARTTBL
chr1_960891_C_T_b38	PLEKHN1	3.414	0.00069	0.038886	137	0.011389	yes	ARTTBL
chr1_890030_G_A_b38	PLEKHN1	3.408	0.000706	0.039574	75	0.011613	yes	ARTTBL
chr1_965350_G_A_b38	PLEKHN1	3.363	0.000828	0.063006	39	0.018734	yes	ARTTBL
chr1_955679_C_T_b38	PLEKHN1	3.262	0.00118	0.037764	114	0.011576	yes	ARTTBL
chr1_756728_G_A_b38	PLEKHN1	-3.208	0.00142	-0.083489	6	0.026028	yes	ARTTBL
chr1_960375_A_AG_b38	PLEKHN1	3.179	0.00157	0.052948	42	0.016657	yes	ARTTBL
chr1_730908_A_G_b38	PLEKHN1	-3.176	0.00158	-0.12795	4	0.040287	yes	ARTTBL
chr1_967617_G_A_b38	PLEKHN1	3.166	0.00163	0.048346	23	0.015268	yes	ARTTBL
chr1_956565_A_G_b38	PLEKHN1	3.107	0.00199	0.035943	114	0.011567	yes	ARTTBL
chr1_1588141_C_CA_b38	PLEKHN1	3.073	0.00223	0.110878	4	0.036082	yes	ARTTBL
chr1_949171_GAGAA_G_b38	PLEKHN1	3.064	0.0023	0.035459	115	0.011575	yes	ARTTBL
chr1_965337_CTTAT_C_b38	PLEKHN1	3.034	0.00253	0.03545	130	0.011683	yes	ARTTBL
chr1_1504291_C_G_b38	PLEKHN1	-2.971	0.00311	-0.088499	5	0.029788	yes	ARTTBL
chr1_960326_G_A_b38	PLEKHN1	2.961	0.00321	0.050895	40	0.017188	yes	ARTTBL
chr1_1388583_CTA_C_b38	PLEKHN1	2.945	0.00338	0.054148	6	0.018389	yes	ARTTBL
chr1_1504666_AAGAG_A_b38	PLEKHN1	-2.937	0.00346	-0.087912	5	0.029932	yes	ARTTBL
chr1_946247_G_A_b38	PLEKHN1	2.93	0.00354	0.034431	120	0.011753	yes	ARTTBL
chr1_898818_T_C_b38	PLEKHN1	-2.9	0.0039	-0.040692	19	0.014034	yes	ARTTBL
chr1_1495221_G_A_b38	PLEKHN1	-2.889	0.00403	-0.070539	10	0.02442	yes	ARTTBL
chr1_1495222_T_G_b38	PLEKHN1	-2.889	0.00403	-0.070539	10	0.02442	yes	ARTTBL
chr1_904947_G_A_b38	PLEKHN1	-2.84	0.00469	-0.041771	15	0.014709	yes	ARTTBL
chr1_1531142_C_T_b38	PLEKHN1	-2.828	0.00487	-0.088401	3	0.031258	yes	ARTTBL
chr1_903007_T_C_b38	PLEKHN1	-2.81	0.00515	-0.038728	18	0.013783	yes	ARTTBL
chr1_1269099_C_CCAT_b38	PLEKHN1	-2.805	0.00523	-0.086001	6	0.030662	yes	ARTTBL
chr1_903175_C_A_b38	PLEKHN1	-2.804	0.00523	-0.035742	35	0.012746	yes	ARTTBL
chr1_1248141_G_C_b38	PLEKHN1	-2.791	0.00546	-0.074437	10	0.026674	yes	ARTTBL
chr1_1403127_C_CAAAAAAA_b38	PLEKHN1	-2.733	0.00649	-0.071463	6	0.026149	yes	ARTTBL
chr1_1551454_C_A_b38	PLEKHN1	2.709	0.00697	0.030614	157	0.011299	yes	ARTTBL
chr1_97953_A_G_b38	PLEKHN1	2.692	0.00733	0.043188	3	0.016042	yes	ARTTBL
chr1_1340811_GCACACACCTGCA_G_b38	PLEKHN1	2.65	0.0083	0.07044	7	0.026583	yes	ARTTBL
chr1_1533152_G_A_b38	PLEKHN1	-2.648	0.00833	-0.085412	3	0.03225	yes	ARTTBL
chr1_1461195_T_TC_b38	PLEKHN1	-2.647	0.00837	-0.064461	11	0.024351	yes	ARTTBL
chr1_1494105_G_A_b38	PLEKHN1	-2.636	0.00865	-0.073054	6	0.027716	yes	ARTTBL
chr1_111735_C_A_b38	PLEKHN1	-2.63	0.0088	-0.036728	27	0.013967	yes	ARTTBL
chr1_967865_A_G_b38	PLEKHN1	2.615	0.00919	0.028778	162	0.011006	yes	ARTTBL
chr1_970892_A_C_b38	PLEKHN1	-2.61	0.00931	-0.052266	3	0.020022	yes	ARTTBL
chr1_910698_C_T_b38	PLEKHN1	-2.603	0.00951	-0.035319	22	0.013569	yes	ARTTBL
chr1_1523574_C_T_b38	PLEKHN1	-2.596	0.0097	-0.079454	5	0.030606	yes	ARTTBL
chr1_962358_C_T_b38	PLEKHN1	-4.798	2.1e-06	-0.096774	7	0.020169	no	ARTTBL
chr1_954258_G_C_b38	PLEKHN1	4.798	2.11e-06	0.099867	5	0.020816	no	ARTTBL
chr1_954333_C_A_b38	PLEKHN1	4.798	2.11e-06	0.099867	5	0.020816	no	ARTTBL
chr1_962184_T_C_b38	PLEKHN1	4.765	2.46e-06	0.096501	7	0.020252	no	ARTTBL
chr1_950296_C_A_b38	PLEKHN1	4.765	2.47e-06	0.103863	4	0.021799	no	ARTTBL
chr1_952180_A_C_b38	PLEKHN1	4.765	2.47e-06	0.103863	4	0.021799	no	ARTTBL
chr1_942335_C_G_b38	PLEKHN1	4.746	2.69e-06	0.095936	7	0.020212	no	ARTTBL
chr1_958251_A_G_b38	PLEKHN1	4.743	2.74e-06	0.096283	6	0.020301	no	ARTTBL
chr1_966227_C_G_b38	PLEKHN1	4.714	3.14e-06	0.094448	13	0.020037	no	ARTTBL
chr1_958339_G_A_b38	PLEKHN1	4.668	3.89e-06	0.089721	9	0.01922	no	ARTTBL
chr1_950669_ACAG_A_b38	PLEKHN1	4.635	4.53e-06	0.093058	9	0.020077	no	ARTTBL
chr1_961945_G_C_b38	PLEKHN1	4.619	4.87e-06	0.090329	10	0.019554	no	ARTTBL
chr1_949046_A_AACAGCAAAG_b38	PLEKHN1	4.553	6.6e-06	0.095565	7	0.020987	no	ARTTBL
chr1_955641_G_A_b38	PLEKHN1	3.898	0.00011	0.087345	3	0.022406	no	ARTTBL
chr1_892786_A_G_b38	PLEKHN1	-3.847	0.000134	-0.047747	44	0.012411	no	ARTTBL
chr1_894801_A_G_b38	PLEKHN1	3.8	0.000162	0.044024	57	0.011584	no	ARTTBL
chr1_896109_C_T_b38	PLEKHN1	3.651	0.000288	0.043784	64	0.011992	no	ARTTBL
chr1_897580_AT_A_b38	PLEKHN1	-3.599	0.000351	-0.040608	145	0.011285	no	ARTTBL
chr1_896680_G_A_b38	PLEKHN1	3.589	0.000364	0.041706	62	0.011622	no	ARTTBL
chr1_896686_G_C_b38	PLEKHN1	3.589	0.000364	0.041706	62	0.011622	no	ARTTBL
chr1_896732_T_C_b38	PLEKHN1	3.589	0.000364	0.041706	62	0.011622	no	ARTTBL
chr1_896917_CTG_C_b38	PLEKHN1	3.589	0.000364	0.041706	62	0.011622	no	ARTTBL
chr1_896938_C_A_b38	PLEKHN1	3.589	0.000364	0.041706	62	0.011622	no	ARTTBL
chr1_897792_T_TCGAA_b38	PLEKHN1	-3.589	0.000364	-0.041706	62	0.011622	no	ARTTBL
chr1_896798_A_G_b38	PLEKHN1	3.564	0.000399	0.041524	62	0.011651	no	ARTTBL
chr1_897538_T_C_b38	PLEKHN1	-3.499	0.000508	-0.040716	64	0.011637	no	ARTTBL
chr1_455125_G_T_b38	PLEKHN1	-3.415	0.000689	-0.09569	3	0.028023	no	ARTTBL
chr1_940296_GCC_G_b38	PLEKHN1	3.363	0.000828	0.03636	96	0.010811	no	ARTTBL
chr1_897376_T_G_b38	PLEKHN1	-3.318	0.000969	-0.039136	56	0.011793	no	ARTTBL
chr1_896529_C_T_b38	PLEKHN1	3.313	0.000988	0.038537	65	0.011632	no	ARTTBL
chr1_758207_C_G_b38	PLEKHN1	3.186	0.00153	0.133142	4	0.041785	no	ARTTBL
chr1_905373_T_C_b38	PLEKHN1	-3.124	0.00189	-0.03439	93	0.011008	no	ARTTBL
chr1_1948594_G_GTT_b38	PLEKHN1	3.071	0.00225	0.02895	114	0.009427	no	ARTTBL
chr1_1901223_A_G_b38	PLEKHN1	-3.068	0.00227	-0.116798	3	0.038065	no	ARTTBL
chr1_897843_C_T_b38	PLEKHN1	-3.057	0.00236	-0.0374	48	0.012236	no	ARTTBL
chr1_897922_C_T_b38	PLEKHN1	-3.057	0.00236	-0.0374	48	0.012236	no	ARTTBL
chr1_898444_T_C_b38	PLEKHN1	-3.057	0.00236	-0.0374	48	0.012236	no	ARTTBL
chr1_939570_T_TCCCTGGAGGACC_b38	PLEKHN1	3.056	0.00236	0.036142	55	0.011825	no	ARTTBL
chr1_904478_CGCCTCCTCCGAACGCGGCCGCCTCCTCCTCCGAACGTGGCCTCCTCCGAACGCGGCCGCCTCCTCCTCCGAACGCGGCCGCCTCCTCCTCCGAACGTG_C_b38	PLEKHN1	-3.015	0.0027	-0.042595	17	0.014129	no	ARTTBL
chr1_965643_T_C_b38	PLEKHN1	2.992	0.00291	0.069302	3	0.023165	no	ARTTBL
chr1_900119_A_G_b38	PLEKHN1	-2.989	0.00293	-0.036948	41	0.012361	no	ARTTBL
chr1_964575_GGCTGTGGGAGGGGTCCGCGCGTCCGCAGTGGGGATGT_G_b38	PLEKHN1	-2.967	0.00314	-0.10387	4	0.035004	no	ARTTBL
chr1_899452_G_C_b38	PLEKHN1	-2.92	0.00365	-0.036172	46	0.012386	no	ARTTBL
chr1_928252_C_T_b38	PLEKHN1	-2.909	0.00379	-0.054315	26	0.018672	no	ARTTBL
chr1_1898894_G_C_b38	PLEKHN1	-2.908	0.0038	-0.111458	3	0.038334	no	ARTTBL
chr1_1004111_TG_T_b38	PLEKHN1	2.893	0.00398	0.038023	31	0.013143	no	ARTTBL
chr1_901149_C_G_b38	PLEKHN1	-2.869	0.00429	-0.040545	17	0.014132	no	ARTTBL
chr1_901544_G_A_b38	PLEKHN1	-2.869	0.00429	-0.040545	17	0.014132	no	ARTTBL
chr1_899548_A_G_b38	PLEKHN1	-2.839	0.00471	-0.039119	19	0.01378	no	ARTTBL
chr1_902949_G_GC_b38	PLEKHN1	-2.836	0.00475	-0.040105	17	0.014142	no	ARTTBL
chr1_898547_T_C_b38	PLEKHN1	-2.835	0.00477	-0.03847	21	0.013572	no	ARTTBL
chr1_697250_A_G_b38	PLEKHN1	-2.809	0.00515	-0.060379	9	0.021492	no	ARTTBL
chr1_1900809_G_T_b38	PLEKHN1	-2.805	0.00522	-0.10643	3	0.037942	no	ARTTBL
chr1_898261_T_C_b38	PLEKHN1	-2.78	0.00564	-0.033902	49	0.012195	no	ARTTBL
chr1_898279_T_A_b38	PLEKHN1	-2.78	0.00564	-0.033902	49	0.012195	no	ARTTBL
chr1_898283_A_G_b38	PLEKHN1	-2.78	0.00564	-0.033902	49	0.012195	no	ARTTBL
chr1_899619_G_A_b38	PLEKHN1	-2.767	0.00587	-0.03838	18	0.013873	no	ARTTBL
chr1_1743566_T_A_b38	PLEKHN1	2.766	0.00589	0.055554	18	0.020087	no	ARTTBL
chr1_660002_G_T_b38	PLEKHN1	-2.762	0.00594	-0.060942	4	0.022061	no	ARTTBL
chr1_964569_C_T_b38	PLEKHN1	-2.754	0.0061	-0.092739	4	0.033675	no	ARTTBL
chr1_973858_G_C_b38	PLEKHN1	-2.671	0.00781	-0.030225	87	0.011317	no	ARTTBL
chr1_967376_AC_A_b38	PLEKHN1	2.661	0.00804	0.050155	4	0.018849	no	ARTTBL
chr1_994321_C_CA_b38	PLEKHN1	-2.636	0.00864	-0.03388	71	0.012851	no	ARTTBL
chr1_1512492_GGCGGC_G_b38	PLEKHN1	-2.632	0.00874	-0.080383	5	0.030541	no	ARTTBL
chr1_1129155_G_C_b38	PLEKHN1	-3.182	0.00193	-0.045075	6	0.014166	yes	BRNAMY
chr1_1161528_T_C_b38	PLEKHN1	-2.966	0.00375	-0.055462	3	0.0187	yes	BRNAMY
chr1_1161907_T_C_b38	PLEKHN1	-2.966	0.00375	-0.055462	3	0.0187	yes	BRNAMY
chr1_1161955_T_G_b38	PLEKHN1	-2.966	0.00375	-0.055462	3	0.0187	yes	BRNAMY
chr1_1594995_T_TGAGACA_b38	PLEKHN1	2.85	0.00527	0.040782	8	0.014307	yes	BRNAMY
chr1_1161720_C_T_b38	PLEKHN1	-2.739	0.00726	-0.050781	4	0.01854	yes	BRNAMY
chr1_1162027_CCCCA_C_b38	PLEKHN1	-2.739	0.00726	-0.050781	4	0.01854	yes	BRNAMY
chr1_272505_C_G_b38	PLEKHN1	2.68	0.00858	0.05909	6	0.02205	yes	BRNAMY
chr1_1594817_A_C_b38	PLEKHN1	-2.66	0.00907	-0.039576	7	0.014879	yes	BRNAMY
chr1_1594820_C_T_b38	PLEKHN1	-2.66	0.00907	-0.039576	7	0.014879	yes	BRNAMY
chr1_1193398_C_CTTA_b38	PLEKHN1	-2.648	0.00936	-0.036572	18	0.01381	yes	BRNAMY
chr1_1461760_C_A_b38	PLEKHN1	-2.635	0.00971	-0.069348	3	0.026318	yes	BRNAMY
chr1_1461767_A_G_b38	PLEKHN1	-2.635	0.00971	-0.069348	3	0.026318	yes	BRNAMY
chr1_1743570_T_A_b38	PLEKHN1	3.991	0.000124	0.083777	4	0.020994	no	BRNAMY
chr1_1497741_CTG_C_b38	PLEKHN1	-3.441	0.00084	-0.107534	4	0.031255	no	BRNAMY
chr1_1221049_C_G_b38	PLEKHN1	-2.803	0.00605	-0.040358	15	0.014398	no	BRNAMY
chr1_1295039_T_C_b38	PLEKHN1	-2.745	0.00713	-0.06308	5	0.022977	no	BRNAMY
chr1_1298561_T_C_b38	PLEKHN1	-2.745	0.00713	-0.06308	5	0.022977	no	BRNAMY
chr1_1220377_C_T_b38	PLEKHN1	-2.692	0.00829	-0.062977	5	0.023394	no	BRNAMY
chr1_799082_G_A_b38	PLEKHN1	2.98	0.00348	0.044799	5	0.015032	yes	BRNACC
chr1_1002415_C_CATTTTTT_b38	PLEKHN1	-2.885	0.00463	-0.059511	4	0.020625	yes	BRNACC
chr1_1054900_C_T_b38	PLEKHN1	-2.729	0.00729	-0.03047	20	0.011164	yes	BRNACC
chr1_1722619_C_T_b38	PLEKHN1	-2.639	0.00941	-0.037085	8	0.014052	yes	BRNACC
chr1_1055037_T_C_b38	PLEKHN1	2.629	0.00967	0.029403	18	0.011183	yes	BRNACC
chr1_667265_C_T_b38	PLEKHN1	-3.538	0.000572	-0.074724	6	0.02112	no	BRNACC
chr1_133010_C_T_b38	PLEKHN1	-3.075	0.0026	-0.029379	42	0.009554	no	BRNACC
chr1_1422081_C_T_b38	PLEKHN1	-2.847	0.00518	-0.054389	7	0.019103	no	BRNACC
chr1_1502507_A_T_b38	PLEKHN1	5.579	1.07e-07	0.178111	3	0.031924	yes	BRNCDT
chr1_633678_C_T_b38	PLEKHN1	4.926	2.16e-06	0.104437	4	0.021202	yes	BRNCDT
chr1_1874605_TA_T_b38	PLEKHN1	4.134	5.85e-05	0.115061	4	0.027831	yes	BRNCDT
chr1_633329_A_G_b38	PLEKHN1	4.053	8.03e-05	0.078845	4	0.019455	yes	BRNCDT
chr1_633375_G_A_b38	PLEKHN1	4.046	8.25e-05	0.076038	4	0.018794	yes	BRNCDT
chr1_633209_T_C_b38	PLEKHN1	4.021	9.08e-05	0.075575	4	0.018796	yes	BRNCDT
chr1_633230_C_T_b38	PLEKHN1	4.021	9.08e-05	0.075575	4	0.018796	yes	BRNCDT
chr1_633032_T_C_b38	PLEKHN1	4.007	9.58e-05	0.075429	4	0.018825	yes	BRNCDT
chr1_633071_C_T_b38	PLEKHN1	4.007	9.58e-05	0.075429	4	0.018825	yes	BRNCDT
chr1_633098_C_T_b38	PLEKHN1	4.007	9.58e-05	0.075429	4	0.018825	yes	BRNCDT
chr1_633182_A_G_b38	PLEKHN1	4.007	9.58e-05	0.075429	4	0.018825	yes	BRNCDT
chr1_633636_C_T_b38	PLEKHN1	4.001	9.81e-05	0.078377	4	0.019591	yes	BRNCDT
chr1_633251_C_T_b38	PLEKHN1	3.968	0.000111	0.074889	4	0.018871	yes	BRNCDT
chr1_633264_T_C_b38	PLEKHN1	3.968	0.000111	0.074889	4	0.018871	yes	BRNCDT
chr1_633290_T_C_b38	PLEKHN1	3.968	0.000111	0.074889	4	0.018871	yes	BRNCDT
chr1_633293_A_G_b38	PLEKHN1	3.968	0.000111	0.074889	4	0.018871	yes	BRNCDT
chr1_632781_C_T_b38	PLEKHN1	3.858	0.000168	0.07479	3	0.019383	yes	BRNCDT
chr1_633553_A_G_b38	PLEKHN1	3.527	0.000555	0.067308	4	0.019082	yes	BRNCDT
chr1_1957243_T_C_b38	PLEKHN1	3.513	0.000584	0.097602	4	0.027786	yes	BRNCDT
chr1_1957760_T_C_b38	PLEKHN1	3.513	0.000584	0.097602	4	0.027786	yes	BRNCDT
chr1_633588_T_C_b38	PLEKHN1	3.496	0.000619	0.066599	4	0.019053	yes	BRNCDT
chr1_633574_A_G_b38	PLEKHN1	3.46	0.000701	0.067885	3	0.019622	yes	BRNCDT
chr1_633561_A_G_b38	PLEKHN1	3.454	0.000714	0.06614	4	0.019147	yes	BRNCDT
chr1_123642_T_G_b38	PLEKHN1	-3.446	0.000734	-0.069041	3	0.020033	yes	BRNCDT
chr1_928252_C_T_b38	PLEKHN1	-3.384	0.000909	-0.089833	5	0.02655	yes	BRNCDT
chr1_1351517_G_C_b38	PLEKHN1	-3.321	0.00112	-0.077388	9	0.023303	yes	BRNCDT
chr1_641209_C_T_b38	PLEKHN1	3.261	0.00137	0.133249	3	0.040862	yes	BRNCDT
chr1_598818_C_T_b38	PLEKHN1	3.259	0.00138	0.094785	3	0.029085	yes	BRNCDT
chr1_1050066_G_T_b38	PLEKHN1	3.25	0.00142	0.050414	31	0.015514	yes	BRNCDT
chr1_1057439_G_A_b38	PLEKHN1	3.186	0.00175	0.043981	45	0.013803	yes	BRNCDT
chr1_629218_A_G_b38	PLEKHN1	-3.145	0.002	-0.124046	3	0.039441	yes	BRNCDT
chr1_1206343_A_G_b38	PLEKHN1	-3.091	0.00237	-0.086144	3	0.02787	yes	BRNCDT
chr1_1206770_G_A_b38	PLEKHN1	-3.091	0.00237	-0.086144	3	0.02787	yes	BRNCDT
chr1_1428763_A_G_b38	PLEKHN1	3.05	0.0027	0.086196	6	0.028258	yes	BRNCDT
chr1_633443_C_T_b38	PLEKHN1	2.965	0.00352	0.05907	3	0.019925	yes	BRNCDT
chr1_633444_C_T_b38	PLEKHN1	2.965	0.00352	0.05907	3	0.019925	yes	BRNCDT
chr1_1206176_G_C_b38	PLEKHN1	-2.964	0.00352	-0.081406	3	0.027463	yes	BRNCDT
chr1_1479324_C_G_b38	PLEKHN1	2.939	0.00381	0.089684	5	0.030518	yes	BRNCDT
chr1_1032278_C_T_b38	PLEKHN1	2.929	0.00392	0.043384	52	0.01481	yes	BRNCDT
chr1_1023789_G_C_b38	PLEKHN1	2.919	0.00404	0.04059	46	0.013904	yes	BRNCDT
chr1_263934_GC_G_b38	PLEKHN1	2.907	0.00419	0.055665	5	0.019147	yes	BRNCDT
chr1_1023775_G_A_b38	PLEKHN1	2.906	0.00421	0.039708	54	0.013665	yes	BRNCDT
chr1_667265_C_T_b38	PLEKHN1	-2.837	0.00516	-0.079748	6	0.028105	yes	BRNCDT
chr1_1054900_C_T_b38	PLEKHN1	2.836	0.00519	0.041966	29	0.014798	yes	BRNCDT
chr1_1637577_T_C_b38	PLEKHN1	2.832	0.00524	0.046086	12	0.016271	yes	BRNCDT
chr1_1220751_T_C_b38	PLEKHN1	2.817	0.00548	0.055048	6	0.01954	yes	BRNCDT
chr1_1533653_C_T_b38	PLEKHN1	2.81	0.0056	0.094465	5	0.033619	yes	BRNCDT
chr1_998410_G_A_b38	PLEKHN1	2.778	0.00615	0.040143	40	0.01445	yes	BRNCDT
chr1_633714_A_G_b38	PLEKHN1	2.767	0.00635	0.074645	4	0.026975	yes	BRNCDT
chr1_633420_G_A_b38	PLEKHN1	2.767	0.00636	0.054717	3	0.019775	yes	BRNCDT
chr1_1624086_G_A_b38	PLEKHN1	2.714	0.0074	0.038733	36	0.01427	yes	BRNCDT
chr1_1025029_G_C_b38	PLEKHN1	2.707	0.00755	0.039864	50	0.014724	yes	BRNCDT
chr1_1176929_T_C_b38	PLEKHN1	-2.697	0.00778	-0.045867	9	0.017005	yes	BRNCDT
chr1_1049886_C_T_b38	PLEKHN1	2.693	0.00787	0.040255	48	0.014948	yes	BRNCDT
chr1_597549_T_C_b38	PLEKHN1	2.686	0.00803	0.109868	3	0.040906	yes	BRNCDT
chr1_1000731_C_T_b38	PLEKHN1	2.652	0.00886	0.03814	41	0.014384	yes	BRNCDT
chr1_1075707_CG_C_b38	PLEKHN1	2.633	0.00934	0.037014	41	0.01406	yes	BRNCDT
chr1_1521298_C_CA_b38	PLEKHN1	5.178	6.96e-07	0.134325	5	0.025942	no	BRNCDT
chr1_1955424_T_C_b38	PLEKHN1	4.83	3.29e-06	0.204542	3	0.04235	no	BRNCDT
chr1_1468856_C_T_b38	PLEKHN1	-3.918	0.000134	-0.097626	6	0.024915	no	BRNCDT
chr1_951437_C_CATTTT_b38	PLEKHN1	3.871	0.00016	0.109201	5	0.02821	no	BRNCDT
chr1_660993_T_C_b38	PLEKHN1	-3.804	0.000205	-0.116695	4	0.030675	no	BRNCDT
chr1_1426175_T_C_b38	PLEKHN1	3.788	0.000218	0.097991	5	0.025871	no	BRNCDT
chr1_1468592_C_CG_b38	PLEKHN1	-3.598	0.000433	-0.088669	9	0.024645	no	BRNCDT
chr1_1527957_C_T_b38	PLEKHN1	3.541	0.000528	0.125942	3	0.035565	no	BRNCDT
chr1_619749_C_G_b38	PLEKHN1	3.384	0.000908	0.121636	3	0.035947	no	BRNCDT
chr1_1469469_G_C_b38	PLEKHN1	-3.336	0.00107	-0.11623	3	0.03484	no	BRNCDT
chr1_1470034_T_C_b38	PLEKHN1	-3.186	0.00175	-0.08732	12	0.027412	no	BRNCDT
chr1_1471144_G_C_b38	PLEKHN1	-3.186	0.00175	-0.08732	12	0.027412	no	BRNCDT
chr1_1468062_A_T_b38	PLEKHN1	-3.12	0.00216	-0.102008	4	0.032699	no	BRNCDT
chr1_865003_C_T_b38	PLEKHN1	-3.115	0.0022	-0.074426	3	0.023896	no	BRNCDT
chr1_1469429_A_G_b38	PLEKHN1	-3.086	0.00241	-0.083757	12	0.02714	no	BRNCDT
chr1_598786_T_G_b38	PLEKHN1	3.007	0.00308	0.074322	3	0.024715	no	BRNCDT
chr1_1716919_CT_C_b38	PLEKHN1	2.995	0.0032	0.096009	4	0.032056	no	BRNCDT
chr1_1468254_T_A_b38	PLEKHN1	-2.981	0.00334	-0.103373	3	0.034672	no	BRNCDT
chr1_632487_A_G_b38	PLEKHN1	2.979	0.00336	0.085665	5	0.028755	no	BRNCDT
chr1_1468048_A_G_b38	PLEKHN1	-2.953	0.00365	-0.079315	8	0.026862	no	BRNCDT
chr1_975014_C_T_b38	PLEKHN1	-2.94	0.00379	-0.043109	24	0.014661	no	BRNCDT
chr1_631490_T_C_b38	PLEKHN1	-2.877	0.00458	-0.107106	3	0.037223	no	BRNCDT
chr1_1527938_C_A_b38	PLEKHN1	2.863	0.00479	0.101639	4	0.035507	no	BRNCDT
chr1_1672015_G_C_b38	PLEKHN1	2.854	0.00491	0.117845	3	0.04129	no	BRNCDT
chr1_908799_AATGAGGGGCAGGGGGGAAGGGAGGG_A_b38	PLEKHN1	-2.837	0.00517	-0.10341	3	0.036449	no	BRNCDT
chr1_1055037_T_C_b38	PLEKHN1	-2.782	0.00608	-0.040159	27	0.014436	no	BRNCDT
chr1_1530585_T_G_b38	PLEKHN1	2.765	0.00638	0.091421	4	0.033058	no	BRNCDT
chr1_1533883_G_T_b38	PLEKHN1	2.765	0.0064	0.071985	6	0.026039	no	BRNCDT
chr1_945259_TC_T_b38	PLEKHN1	-2.751	0.00666	-0.046278	10	0.016824	no	BRNCDT
chr1_1473089_T_C_b38	PLEKHN1	-2.71	0.00749	-0.066556	13	0.024558	no	BRNCDT
chr1_1023573_A_G_b38	PLEKHN1	-2.657	0.00871	-0.039666	23	0.014928	no	BRNCDT
chr1_933601_C_T_b38	PLEKHN1	2.636	0.00926	0.080042	8	0.03037	no	BRNCDT
chr1_1043223_CCT_C_b38	PLEKHN1	2.627	0.0095	0.038387	51	0.014614	no	BRNCDT
chr1_1512492_GGCGGC_G_b38	PLEKHN1	2.613	0.00987	0.097696	3	0.037388	no	BRNCDT
chr1_629218_A_G_b38	PLEKHN1	-5.539	1.55e-07	-0.223625	3	0.040371	yes	BRNCHB
chr1_1011654_G_A_b38	PLEKHN1	-4.397	2.21e-05	-0.136094	4	0.030949	yes	BRNCHB
chr1_951437_C_CATTTT_b38	PLEKHN1	4.311	3.13e-05	0.135906	3	0.031529	yes	BRNCHB
chr1_921797_T_C_b38	PLEKHN1	3.718	0.000294	0.124927	4	0.033604	yes	BRNCHB
chr1_1010481_ATTAT_A_b38	PLEKHN1	-3.696	0.000319	-0.118024	4	0.031936	yes	BRNCHB
chr1_1251618_G_A_b38	PLEKHN1	-3.618	0.000419	-0.072119	4	0.019933	yes	BRNCHB
chr1_1243102_A_G_b38	PLEKHN1	-3.475	0.00069	-0.071708	4	0.020638	yes	BRNCHB
chr1_1242865_C_T_b38	PLEKHN1	-3.411	0.000856	-0.070484	4	0.020663	yes	BRNCHB
chr1_1244603_G_A_b38	PLEKHN1	-3.409	0.000862	-0.070159	3	0.020582	yes	BRNCHB
chr1_839480_CACACACCTGGACAA_C_b38	PLEKHN1	3.314	0.00118	0.058537	13	0.017665	yes	BRNCHB
chr1_1591419_A_G_b38	PLEKHN1	3.279	0.00133	0.063744	5	0.019441	yes	BRNCHB
chr1_960375_A_AG_b38	PLEKHN1	-3.273	0.00136	-0.073964	7	0.022601	yes	BRNCHB
chr1_1280044_T_C_b38	PLEKHN1	-3.257	0.00143	-0.054249	21	0.016657	yes	BRNCHB
chr1_1277830_C_CA_b38	PLEKHN1	-3.23	0.00156	-0.079744	4	0.024685	yes	BRNCHB
chr1_928483_G_A_b38	PLEKHN1	3.162	0.00194	0.112094	4	0.035446	yes	BRNCHB
chr1_921056_TG_T_b38	PLEKHN1	-3.127	0.00217	-0.059012	5	0.018872	yes	BRNCHB
chr1_1180851_T_C_b38	PLEKHN1	-3.107	0.00231	-0.077388	3	0.024905	yes	BRNCHB
chr1_935426_C_CGGAGCTCCTCT_b38	PLEKHN1	3.092	0.00242	0.136912	3	0.044283	yes	BRNCHB
chr1_1407232_G_C_b38	PLEKHN1	-2.979	0.00343	-0.049944	10	0.016765	yes	BRNCHB
chr1_414665_C_T_b38	PLEKHN1	-2.976	0.00346	-0.052447	14	0.017621	yes	BRNCHB
chr1_1254681_A_G_b38	PLEKHN1	-2.91	0.00424	-0.082734	4	0.028433	yes	BRNCHB
chr1_1613974_G_A_b38	PLEKHN1	2.901	0.00435	0.053325	9	0.018381	yes	BRNCHB
chr1_839515_CTAGACACACACACCTGGACACACACACG_C_b38	PLEKHN1	2.897	0.00441	0.052904	14	0.018264	yes	BRNCHB
chr1_922660_C_A_b38	PLEKHN1	-2.837	0.00526	-0.056245	3	0.019826	yes	BRNCHB
chr1_922671_C_T_b38	PLEKHN1	-2.837	0.00526	-0.056245	3	0.019826	yes	BRNCHB
chr1_1236303_A_G_b38	PLEKHN1	-2.828	0.0054	-0.054604	4	0.019305	yes	BRNCHB
chr1_960326_G_A_b38	PLEKHN1	-2.827	0.00542	-0.064878	7	0.022952	yes	BRNCHB
chr1_917378_G_C_b38	PLEKHN1	-2.805	0.00579	-0.052671	6	0.018779	yes	BRNCHB
chr1_917284_C_T_b38	PLEKHN1	-2.787	0.0061	-0.051838	6	0.018602	yes	BRNCHB
chr1_1461760_C_A_b38	PLEKHN1	-2.716	0.00749	-0.098897	3	0.036418	yes	BRNCHB
chr1_1461767_A_G_b38	PLEKHN1	-2.716	0.00749	-0.098897	3	0.036418	yes	BRNCHB
chr1_906677_A_AAACTCAGCTGCCTCTCCCCTTC_b38	PLEKHN1	-2.678	0.00832	-0.047453	11	0.017717	yes	BRNCHB
chr1_1308516_C_T_b38	PLEKHN1	2.671	0.00849	0.04535	21	0.016977	yes	BRNCHB
chr1_1739115_T_C_b38	PLEKHN1	2.669	0.00856	0.084525	5	0.031674	yes	BRNCHB
chr1_1013466_T_TA_b38	PLEKHN1	-2.667	0.0086	-0.100958	3	0.037855	yes	BRNCHB
chr1_910558_G_A_b38	PLEKHN1	-2.648	0.00907	-0.046065	13	0.017396	yes	BRNCHB
chr1_919397_A_G_b38	PLEKHN1	2.646	0.00911	0.043242	18	0.016341	yes	BRNCHB
chr1_1312114_T_C_b38	PLEKHN1	2.646	0.00912	0.044933	21	0.016982	yes	BRNCHB
chr1_1367511_ATGAG_A_b38	PLEKHN1	-2.643	0.00921	-0.052063	3	0.019701	yes	BRNCHB
chr1_920719_T_G_b38	PLEKHN1	-2.64	0.00928	-0.043702	17	0.016555	yes	BRNCHB
chr1_920728_A_G_b38	PLEKHN1	-2.64	0.00928	-0.043702	17	0.016555	yes	BRNCHB
chr1_973443_G_A_b38	PLEKHN1	-2.635	0.00941	-0.051782	7	0.019653	yes	BRNCHB
chr1_912710_G_A_b38	PLEKHN1	-2.623	0.00974	-0.048424	6	0.018464	yes	BRNCHB
chr1_913358_C_T_b38	PLEKHN1	-2.623	0.00974	-0.048424	6	0.018464	yes	BRNCHB
chr1_914743_C_T_b38	PLEKHN1	-2.623	0.00974	-0.048424	6	0.018464	yes	BRNCHB
chr1_1309988_G_A_b38	PLEKHN1	2.622	0.00976	0.044459	21	0.016958	yes	BRNCHB
chr1_1313807_G_A_b38	PLEKHN1	2.622	0.00976	0.044459	21	0.016958	yes	BRNCHB
chr1_1370430_T_C_b38	PLEKHN1	-2.615	0.00993	-0.050108	5	0.019158	yes	BRNCHB
chr1_1370532_C_T_b38	PLEKHN1	-2.615	0.00993	-0.050108	5	0.019158	yes	BRNCHB
chr1_1370584_G_C_b38	PLEKHN1	-2.615	0.00993	-0.050108	5	0.019158	yes	BRNCHB
chr1_1372909_G_A_b38	PLEKHN1	-2.615	0.00993	-0.050108	5	0.019158	yes	BRNCHB
chr1_1477850_C_G_b38	PLEKHN1	-3.927	0.000137	-0.140717	3	0.035833	no	BRNCHB
chr1_1477855_G_C_b38	PLEKHN1	-3.927	0.000137	-0.140717	3	0.035833	no	BRNCHB
chr1_1523190_A_G_b38	PLEKHN1	-3.642	0.000385	-0.132133	3	0.036276	no	BRNCHB
chr1_1361685_C_T_b38	PLEKHN1	-3.594	0.000457	-0.064306	10	0.017894	no	BRNCHB
chr1_1251285_G_A_b38	PLEKHN1	-3.589	0.000464	-0.069991	5	0.0195	no	BRNCHB
chr1_1251368_T_C_b38	PLEKHN1	-3.589	0.000464	-0.069991	5	0.0195	no	BRNCHB
chr1_1010747_GT_G_b38	PLEKHN1	-3.577	0.000484	-0.102033	4	0.028525	no	BRNCHB
chr1_904478_CGCCTCCTCCGAACGCGGCCGCCTCCTCCTCCGAACGTGGCCTCCTCCGAACGCGGCCGCCTCCTCCTCCGAACGCGGCCGCCTCCTCCTCCGAACGTG_C_b38	PLEKHN1	-3.551	0.000531	-0.0678	4	0.019095	no	BRNCHB
chr1_1251122_A_T_b38	PLEKHN1	-3.308	0.00121	-0.062484	8	0.018886	no	BRNCHB
chr1_1285621_A_G_b38	PLEKHN1	-3.285	0.0013	-0.137834	3	0.041963	no	BRNCHB
chr1_1286671_A_G_b38	PLEKHN1	-3.285	0.0013	-0.137834	3	0.041963	no	BRNCHB
chr1_1022587_T_TTGTAGTCTGACCTGTGGTCTGAC_b38	PLEKHN1	-3.256	0.00143	-0.123655	4	0.037976	no	BRNCHB
chr1_1249880_A_G_b38	PLEKHN1	-3.256	0.00143	-0.061727	8	0.018958	no	BRNCHB
chr1_973862_A_G_b38	PLEKHN1	-3.21	0.00166	-0.101972	3	0.031767	no	BRNCHB
chr1_1274256_A_G_b38	PLEKHN1	-3.153	0.00199	-0.07357	7	0.023332	no	BRNCHB
chr1_1217251_C_A_b38	PLEKHN1	-3.084	0.00248	-0.061929	4	0.020084	no	BRNCHB
chr1_1369821_C_T_b38	PLEKHN1	-3.061	0.00266	-0.057943	4	0.018928	no	BRNCHB
chr1_667265_C_T_b38	PLEKHN1	-3.041	0.00283	-0.079112	7	0.026013	no	BRNCHB
chr1_1240580_G_GC_b38	PLEKHN1	-3.016	0.00307	-0.063993	3	0.021221	no	BRNCHB
chr1_1259424_T_C_b38	PLEKHN1	-2.995	0.00327	-0.052729	18	0.017606	no	BRNCHB
chr1_1485282_A_G_b38	PLEKHN1	-2.963	0.0036	-0.115117	3	0.038849	no	BRNCHB
chr1_1361679_G_A_b38	PLEKHN1	2.948	0.00378	0.051913	11	0.017612	no	BRNCHB
chr1_1479324_C_G_b38	PLEKHN1	2.882	0.00461	0.100929	3	0.035026	no	BRNCHB
chr1_1812038_G_C_b38	PLEKHN1	2.861	0.00489	0.072403	5	0.025303	no	BRNCHB
chr1_1275091_T_C_b38	PLEKHN1	-2.861	0.00491	-0.066799	10	0.023351	no	BRNCHB
chr1_1010755_T_G_b38	PLEKHN1	-2.855	0.00499	-0.082266	4	0.028817	no	BRNCHB
chr1_1238231_G_A_b38	PLEKHN1	-2.854	0.005	-0.053642	8	0.018794	no	BRNCHB
chr1_1190173_A_T_b38	PLEKHN1	-2.851	0.00506	-0.052603	5	0.018454	no	BRNCHB
chr1_1193141_C_T_b38	PLEKHN1	-2.851	0.00506	-0.052603	5	0.018454	no	BRNCHB
chr1_660993_T_C_b38	PLEKHN1	-2.827	0.00541	-0.093442	4	0.033049	no	BRNCHB
chr1_1194826_G_A_b38	PLEKHN1	-2.777	0.00628	-0.05	6	0.018008	no	BRNCHB
chr1_1282706_C_T_b38	PLEKHN1	-2.77	0.00639	-0.063443	10	0.0229	no	BRNCHB
chr1_1663759_G_A_b38	PLEKHN1	-2.77	0.00641	-0.069684	5	0.025159	no	BRNCHB
chr1_1258206_AT_A_b38	PLEKHN1	-2.763	0.00653	-0.046585	18	0.016859	no	BRNCHB
chr1_1177602_C_T_b38	PLEKHN1	-2.744	0.0069	-0.053026	6	0.019324	no	BRNCHB
chr1_909894_G_T_b38	PLEKHN1	-2.706	0.0077	-0.047301	12	0.017481	no	BRNCHB
chr1_1196039_C_G_b38	PLEKHN1	-2.697	0.0079	-0.056089	3	0.020798	no	BRNCHB
chr1_1246371_T_C_b38	PLEKHN1	-2.673	0.00846	-0.05442	6	0.020361	no	BRNCHB
chr1_1367268_TGA_T_b38	PLEKHN1	-2.667	0.0086	-0.050712	4	0.019016	no	BRNCHB
chr1_1486354_G_C_b38	PLEKHN1	-2.65	0.00903	-0.101211	3	0.0382	no	BRNCHB
chr1_1805416_A_G_b38	PLEKHN1	2.646	0.00912	0.063826	5	0.024122	no	BRNCHB
chr1_1795751_T_TCAAAAAAA_b38	PLEKHN1	2.637	0.00935	0.06935	4	0.026298	no	BRNCHB
chr1_1814717_A_G_b38	PLEKHN1	2.637	0.00935	0.06935	4	0.026298	no	BRNCHB
chr1_1821516_C_T_b38	PLEKHN1	2.637	0.00935	0.06935	4	0.026298	no	BRNCHB
chr1_1827587_T_C_b38	PLEKHN1	2.637	0.00935	0.06935	4	0.026298	no	BRNCHB
chr1_1829550_A_C_b38	PLEKHN1	2.637	0.00935	0.06935	4	0.026298	no	BRNCHB
chr1_1829897_A_C_b38	PLEKHN1	2.637	0.00935	0.06935	4	0.026298	no	BRNCHB
chr1_1834144_T_C_b38	PLEKHN1	2.637	0.00935	0.06935	4	0.026298	no	BRNCHB
chr1_1834920_A_G_b38	PLEKHN1	2.637	0.00935	0.06935	4	0.026298	no	BRNCHB
chr1_1838619_T_C_b38	PLEKHN1	2.637	0.00935	0.06935	4	0.026298	no	BRNCHB
chr1_1235720_T_G_b38	PLEKHN1	-2.635	0.00942	-0.083266	6	0.031606	no	BRNCHB
chr1_1364282_T_G_b38	PLEKHN1	-2.617	0.00988	-0.050265	4	0.019206	no	BRNCHB
chr1_1364357_A_C_b38	PLEKHN1	-2.617	0.00988	-0.050265	4	0.019206	no	BRNCHB
chr1_1364566_T_C_b38	PLEKHN1	-2.617	0.00988	-0.050265	4	0.019206	no	BRNCHB
chr1_1364694_T_C_b38	PLEKHN1	-2.617	0.00988	-0.050265	4	0.019206	no	BRNCHB
chr1_1364721_C_T_b38	PLEKHN1	-2.617	0.00988	-0.050265	4	0.019206	no	BRNCHB
chr1_1365160_A_G_b38	PLEKHN1	-2.617	0.00988	-0.050265	4	0.019206	no	BRNCHB
chr1_1365198_C_T_b38	PLEKHN1	-2.617	0.00988	-0.050265	4	0.019206	no	BRNCHB
chr1_1366008_A_G_b38	PLEKHN1	-2.617	0.00988	-0.050265	4	0.019206	no	BRNCHB
chr1_1366062_T_C_b38	PLEKHN1	-2.617	0.00988	-0.050265	4	0.019206	no	BRNCHB
chr1_1366145_TGTGAA_T_b38	PLEKHN1	-2.617	0.00988	-0.050265	4	0.019206	no	BRNCHB
chr1_1366187_A_AGT_b38	PLEKHN1	-2.617	0.00988	-0.050265	4	0.019206	no	BRNCHB
chr1_1366292_G_T_b38	PLEKHN1	-2.617	0.00988	-0.050265	4	0.019206	no	BRNCHB
chr1_1366321_TGTGTGTAAATGG_T_b38	PLEKHN1	-2.617	0.00988	-0.050265	4	0.019206	no	BRNCHB
chr1_1366453_G_T_b38	PLEKHN1	-2.617	0.00988	-0.050265	4	0.019206	no	BRNCHB
chr1_1366726_T_G_b38	PLEKHN1	-2.617	0.00988	-0.050265	4	0.019206	no	BRNCHB
chr1_1367258_T_A_b38	PLEKHN1	-2.617	0.00988	-0.050265	4	0.019206	no	BRNCHB
chr1_1367280_T_A_b38	PLEKHN1	-2.617	0.00988	-0.050265	4	0.019206	no	BRNCHB
chr1_1367297_GAA_G_b38	PLEKHN1	-2.617	0.00988	-0.050265	4	0.019206	no	BRNCHB
chr1_1367300_T_TGA_b38	PLEKHN1	-2.617	0.00988	-0.050265	4	0.019206	no	BRNCHB
chr1_1367329_A_AGT_b38	PLEKHN1	-2.617	0.00988	-0.050265	4	0.019206	no	BRNCHB
chr1_1367373_T_TGTG_b38	PLEKHN1	-2.617	0.00988	-0.050265	4	0.019206	no	BRNCHB
chr1_1367388_T_TTGG_b38	PLEKHN1	-2.617	0.00988	-0.050265	4	0.019206	no	BRNCHB
chr1_1367462_T_C_b38	PLEKHN1	-2.617	0.00988	-0.050265	4	0.019206	no	BRNCHB
chr1_1367593_G_A_b38	PLEKHN1	-2.617	0.00988	-0.050265	4	0.019206	no	BRNCHB
chr1_1367602_GT_G_b38	PLEKHN1	-2.617	0.00988	-0.050265	4	0.019206	no	BRNCHB
chr1_1367605_GAGTGAGTGTA_G_b38	PLEKHN1	-2.617	0.00988	-0.050265	4	0.019206	no	BRNCHB
chr1_1367670_GGTGA_G_b38	PLEKHN1	-2.617	0.00988	-0.050265	4	0.019206	no	BRNCHB
chr1_1367722_TTTTA_T_b38	PLEKHN1	-2.617	0.00988	-0.050265	4	0.019206	no	BRNCHB
chr1_1367874_A_T_b38	PLEKHN1	-2.617	0.00988	-0.050265	4	0.019206	no	BRNCHB
chr1_1367919_C_T_b38	PLEKHN1	-2.617	0.00988	-0.050265	4	0.019206	no	BRNCHB
chr1_1367951_C_T_b38	PLEKHN1	-2.617	0.00988	-0.050265	4	0.019206	no	BRNCHB
chr1_1367965_A_G_b38	PLEKHN1	-2.617	0.00988	-0.050265	4	0.019206	no	BRNCHB
chr1_1367970_T_G_b38	PLEKHN1	-2.617	0.00988	-0.050265	4	0.019206	no	BRNCHB
chr1_1367994_C_A_b38	PLEKHN1	-2.617	0.00988	-0.050265	4	0.019206	no	BRNCHB
chr1_1368297_C_T_b38	PLEKHN1	-2.617	0.00988	-0.050265	4	0.019206	no	BRNCHB
chr1_1368514_C_G_b38	PLEKHN1	-2.617	0.00988	-0.050265	4	0.019206	no	BRNCHB
chr1_1368991_C_T_b38	PLEKHN1	-2.617	0.00988	-0.050265	4	0.019206	no	BRNCHB
chr1_1369009_T_C_b38	PLEKHN1	-2.617	0.00988	-0.050265	4	0.019206	no	BRNCHB
chr1_1369012_C_CG_b38	PLEKHN1	-2.617	0.00988	-0.050265	4	0.019206	no	BRNCHB
chr1_1369282_G_A_b38	PLEKHN1	-2.617	0.00988	-0.050265	4	0.019206	no	BRNCHB
chr1_1369320_GT_G_b38	PLEKHN1	-2.617	0.00988	-0.050265	4	0.019206	no	BRNCHB
chr1_1369407_G_A_b38	PLEKHN1	-2.617	0.00988	-0.050265	4	0.019206	no	BRNCHB
chr1_1369476_CTT_C_b38	PLEKHN1	-2.617	0.00988	-0.050265	4	0.019206	no	BRNCHB
chr1_1369556_C_G_b38	PLEKHN1	-2.617	0.00988	-0.050265	4	0.019206	no	BRNCHB
chr1_1369627_T_C_b38	PLEKHN1	-2.617	0.00988	-0.050265	4	0.019206	no	BRNCHB
chr1_1369686_T_C_b38	PLEKHN1	-2.617	0.00988	-0.050265	4	0.019206	no	BRNCHB
chr1_1369716_G_C_b38	PLEKHN1	-2.617	0.00988	-0.050265	4	0.019206	no	BRNCHB
chr1_1369741_C_T_b38	PLEKHN1	-2.617	0.00988	-0.050265	4	0.019206	no	BRNCHB
chr1_1370181_C_T_b38	PLEKHN1	-2.617	0.00988	-0.050265	4	0.019206	no	BRNCHB
chr1_1370317_G_C_b38	PLEKHN1	-2.617	0.00988	-0.050265	4	0.019206	no	BRNCHB
chr1_1370320_A_G_b38	PLEKHN1	-2.617	0.00988	-0.050265	4	0.019206	no	BRNCHB
chr1_1366681_T_TGA_b38	PLEKHN1	-2.615	0.00993	-0.051079	4	0.01953	no	BRNCHB
chr1_1285574_G_A_b38	PLEKHN1	-2.615	0.00994	-0.082482	8	0.031539	no	BRNCHB
chr1_1274980_C_T_b38	PLEKHN1	-2.613	0.00999	-0.062455	6	0.023899	no	BRNCHB
chr1_1275912_C_T_b38	PLEKHN1	-2.613	0.00999	-0.062455	6	0.023899	no	BRNCHB
chr1_1479683_T_G_b38	PLEKHN1	-2.613	0.00999	-0.089586	8	0.034281	no	BRNCHB
chr1_1480096_G_C_b38	PLEKHN1	-2.613	0.00999	-0.089586	8	0.034281	no	BRNCHB
chr1_1351517_G_C_b38	PLEKHN1	-4.142	5.45e-05	-0.098363	7	0.02375	yes	BRNCHA
chr1_1716919_CT_C_b38	PLEKHN1	3.739	0.000253	0.128459	3	0.034354	yes	BRNCHA
chr1_1502507_A_T_b38	PLEKHN1	3.687	0.000306	0.121295	3	0.032896	yes	BRNCHA
chr1_1481071_T_C_b38	PLEKHN1	-3.339	0.00104	-0.078148	7	0.023404	yes	BRNCHA
chr1_1533653_C_T_b38	PLEKHN1	3.228	0.0015	0.107721	4	0.033369	yes	BRNCHA
chr1_924310_C_G_b38	PLEKHN1	-3.087	0.00236	-0.115049	5	0.037267	yes	BRNCHA
chr1_925408_TTGG_T_b38	PLEKHN1	-3.005	0.00306	-0.110686	4	0.03683	yes	BRNCHA
chr1_925412_CGCCTGCG_C_b38	PLEKHN1	-3.005	0.00306	-0.110686	4	0.03683	yes	BRNCHA
chr1_929375_A_G_b38	PLEKHN1	-2.968	0.00344	-0.125739	3	0.042368	yes	BRNCHA
chr1_929377_G_A_b38	PLEKHN1	-2.968	0.00344	-0.125739	3	0.042368	yes	BRNCHA
chr1_924321_C_G_b38	PLEKHN1	-2.934	0.00382	-0.109866	4	0.037452	yes	BRNCHA
chr1_596697_ACATTCATGCTCACTCATACACACCCAGATCATATATACACTCGTGCACACATTCACACTCATACACACCCAAATCATACTCACATTCATGCACACATGTT_A_b38	PLEKHN1	-2.933	0.00383	-0.096818	3	0.033012	yes	BRNCHA
chr1_1955424_T_C_b38	PLEKHN1	2.877	0.00454	0.113165	4	0.039336	yes	BRNCHA
chr1_1469429_A_G_b38	PLEKHN1	-2.873	0.00459	-0.071079	11	0.024743	yes	BRNCHA
chr1_1010747_GT_G_b38	PLEKHN1	-2.864	0.00472	-0.08217	3	0.02869	yes	BRNCHA
chr1_928309_A_G_b38	PLEKHN1	-2.854	0.00486	-0.110279	3	0.038642	yes	BRNCHA
chr1_925398_A_G_b38	PLEKHN1	-2.823	0.00534	-0.101101	4	0.035817	yes	BRNCHA
chr1_1011654_G_A_b38	PLEKHN1	-2.771	0.00623	-0.085167	4	0.030739	yes	BRNCHA
chr1_1514211_A_G_b38	PLEKHN1	2.758	0.00646	0.091916	3	0.033324	yes	BRNCHA
chr1_1362780_CAAA_C_b38	PLEKHN1	-2.716	0.00729	-0.059965	3	0.022076	yes	BRNCHA
chr1_280599_T_C_b38	PLEKHN1	-2.7	0.00764	-0.050939	3	0.018865	yes	BRNCHA
chr1_1836387_CT_C_b38	PLEKHN1	-2.689	0.00789	-0.052239	10	0.019427	yes	BRNCHA
chr1_629218_A_G_b38	PLEKHN1	-4.441	1.62e-05	-0.170001	4	0.038277	no	BRNCHA
chr1_1248141_G_C_b38	PLEKHN1	-4.12	5.93e-05	-0.138029	3	0.033501	no	BRNCHA
chr1_1523190_A_G_b38	PLEKHN1	-4.021	8.73e-05	-0.143404	3	0.035661	no	BRNCHA
chr1_1480778_T_C_b38	PLEKHN1	-3.895	0.000142	-0.158465	3	0.040684	no	BRNCHA
chr1_1522875_T_G_b38	PLEKHN1	-3.798	0.000203	-0.149271	3	0.039301	no	BRNCHA
chr1_921797_T_C_b38	PLEKHN1	3.711	0.00028	0.113578	5	0.030604	no	BRNCHA
chr1_667265_C_T_b38	PLEKHN1	-3.649	0.000351	-0.101685	7	0.027866	no	BRNCHA
chr1_1357246_C_T_b38	PLEKHN1	-3.615	0.000396	-0.150826	3	0.041718	no	BRNCHA
chr1_633678_C_T_b38	PLEKHN1	3.551	0.000498	0.080969	3	0.022802	no	BRNCHA
chr1_1468048_A_G_b38	PLEKHN1	-3.537	0.000523	-0.093177	7	0.026341	no	BRNCHA
chr1_908799_AATGAGGGGCAGGGGGGAAGGGAGGG_A_b38	PLEKHN1	-3.48	0.000639	-0.119968	3	0.034476	no	BRNCHA
chr1_597070_A_AATC_b38	PLEKHN1	-3.418	0.000792	-0.142825	3	0.041789	no	BRNCHA
chr1_928483_G_A_b38	PLEKHN1	3.373	0.000923	0.10714	5	0.031765	no	BRNCHA
chr1_1523574_C_T_b38	PLEKHN1	-3.216	0.00156	-0.126579	3	0.039364	no	BRNCHA
chr1_1468094_G_C_b38	PLEKHN1	-3.207	0.00161	-0.081487	6	0.025411	no	BRNCHA
chr1_600579_G_A_b38	PLEKHN1	-3.197	0.00166	-0.107441	3	0.033609	no	BRNCHA
chr1_1468856_C_T_b38	PLEKHN1	-3.188	0.00171	-0.07948	4	0.024933	no	BRNCHA
chr1_1521298_C_CA_b38	PLEKHN1	3.157	0.00189	0.085296	4	0.027018	no	BRNCHA
chr1_1468592_C_CG_b38	PLEKHN1	-3.135	0.00203	-0.076343	7	0.024349	no	BRNCHA
chr1_1461760_C_A_b38	PLEKHN1	-3.102	0.00225	-0.103546	4	0.03338	no	BRNCHA
chr1_1461767_A_G_b38	PLEKHN1	-3.102	0.00225	-0.103546	4	0.03338	no	BRNCHA
chr1_607379_G_A_b38	PLEKHN1	-3.076	0.00245	-0.105221	3	0.034208	no	BRNCHA
chr1_591710_A_G_b38	PLEKHN1	-3.076	0.00245	-0.098353	4	0.031979	no	BRNCHA
chr1_928252_C_T_b38	PLEKHN1	-3.028	0.00285	-0.07665	5	0.025317	no	BRNCHA
chr1_1468062_A_T_b38	PLEKHN1	-3.004	0.00307	-0.103986	3	0.034616	no	BRNCHA
chr1_1477850_C_G_b38	PLEKHN1	-2.963	0.00349	-0.104179	4	0.035159	no	BRNCHA
chr1_1477855_G_C_b38	PLEKHN1	-2.963	0.00349	-0.104179	4	0.035159	no	BRNCHA
chr1_973862_A_G_b38	PLEKHN1	-2.954	0.00359	-0.090857	3	0.030755	no	BRNCHA
chr1_1361163_AACAC_A_b38	PLEKHN1	-2.921	0.00397	-0.119562	3	0.040933	no	BRNCHA
chr1_638771_A_T_b38	PLEKHN1	-2.9	0.00423	-0.069855	7	0.024088	no	BRNCHA
chr1_1531133_G_A_b38	PLEKHN1	2.852	0.0049	0.097318	5	0.034128	no	BRNCHA
chr1_631490_T_C_b38	PLEKHN1	-2.85	0.00493	-0.106461	3	0.03736	no	BRNCHA
chr1_996128_T_A_b38	PLEKHN1	2.82	0.00538	0.089934	5	0.031894	no	BRNCHA
chr1_1747690_A_G_b38	PLEKHN1	-2.795	0.00579	-0.093896	5	0.033593	no	BRNCHA
chr1_660993_T_C_b38	PLEKHN1	-2.784	0.00599	-0.081886	6	0.029415	no	BRNCHA
chr1_1010481_ATTAT_A_b38	PLEKHN1	-2.752	0.00657	-0.088565	3	0.032177	no	BRNCHA
chr1_1470034_T_C_b38	PLEKHN1	-2.735	0.00691	-0.068477	11	0.025037	no	BRNCHA
chr1_1471144_G_C_b38	PLEKHN1	-2.735	0.00691	-0.068477	11	0.025037	no	BRNCHA
chr1_951437_C_CATTTT_b38	PLEKHN1	5.488	1.52e-07	0.165723	4	0.030197	yes	BRNCTXA
chr1_911085_C_T_b38	PLEKHN1	-4.97	1.67e-06	-0.169019	4	0.03401	yes	BRNCTXA
chr1_908799_AATGAGGGGCAGGGGGGAAGGGAGGG_A_b38	PLEKHN1	-4.891	2.37e-06	-0.166405	3	0.03402	yes	BRNCTXA
chr1_928264_T_C_b38	PLEKHN1	-4.204	4.31e-05	-0.089375	6	0.021262	yes	BRNCTXA
chr1_1480778_T_C_b38	PLEKHN1	-4.184	4.67e-05	-0.169715	3	0.040568	yes	BRNCTXA
chr1_1010747_GT_G_b38	PLEKHN1	-4.129	5.78e-05	-0.122846	5	0.02975	yes	BRNCTXA
chr1_591710_A_G_b38	PLEKHN1	-4.085	6.87e-05	-0.141452	4	0.034624	yes	BRNCTXA
chr1_1010755_T_G_b38	PLEKHN1	-3.929	0.000125	-0.113371	5	0.028852	yes	BRNCTXA
chr1_1108232_CAG_C_b38	PLEKHN1	3.82	0.000189	0.085749	4	0.022445	yes	BRNCTXA
chr1_1108235_CA_C_b38	PLEKHN1	3.82	0.000189	0.085749	4	0.022445	yes	BRNCTXA
chr1_928261_G_A_b38	PLEKHN1	-3.756	0.000239	-0.082476	6	0.021957	yes	BRNCTXA
chr1_1013466_T_TA_b38	PLEKHN1	-3.664	0.000335	-0.145459	4	0.039698	yes	BRNCTXA
chr1_285675_T_C_b38	PLEKHN1	3.648	0.000355	0.127571	3	0.034971	yes	BRNCTXA
chr1_1523190_A_G_b38	PLEKHN1	-3.609	0.000408	-0.143489	3	0.039761	yes	BRNCTXA
chr1_271147_T_G_b38	PLEKHN1	3.551	5e-04	0.092801	9	0.026131	yes	BRNCTXA
chr1_264730_T_A_b38	PLEKHN1	3.531	0.000538	0.149813	5	0.042431	yes	BRNCTXA
chr1_1431026_CCACCCCCT_C_b38	PLEKHN1	-3.459	0.000692	-0.060104	13	0.017379	yes	BRNCTXA
chr1_1426253_G_A_b38	PLEKHN1	-3.447	0.000719	-0.065903	5	0.019117	yes	BRNCTXA
chr1_1468254_T_A_b38	PLEKHN1	-3.409	0.00082	-0.124949	3	0.036651	yes	BRNCTXA
chr1_1457071_C_T_b38	PLEKHN1	-3.27	0.00131	-0.054803	19	0.016761	yes	BRNCTXA
chr1_1411323_A_C_b38	PLEKHN1	-3.264	0.00134	-0.055341	25	0.016956	yes	BRNCTXA
chr1_1402457_A_G_b38	PLEKHN1	-3.213	0.00158	-0.054196	24	0.016868	yes	BRNCTXA
chr1_1432355_G_A_b38	PLEKHN1	-3.203	0.00163	-0.056197	11	0.017545	yes	BRNCTXA
chr1_1394423_A_G_b38	PLEKHN1	-3.201	0.00165	-0.054066	24	0.016891	yes	BRNCTXA
chr1_1395346_A_G_b38	PLEKHN1	-3.201	0.00165	-0.054066	24	0.016891	yes	BRNCTXA
chr1_1387698_A_G_b38	PLEKHN1	3.201	0.00165	0.054066	24	0.016891	yes	BRNCTXA
chr1_1389827_C_T_b38	PLEKHN1	3.201	0.00165	0.054066	24	0.016891	yes	BRNCTXA
chr1_1436388_CA_C_b38	PLEKHN1	-3.183	0.00174	-0.053336	18	0.016754	yes	BRNCTXA
chr1_1369821_C_T_b38	PLEKHN1	-3.15	0.00194	-0.063312	3	0.020097	yes	BRNCTXA
chr1_1726106_AT_A_b38	PLEKHN1	3.144	0.00198	0.05767	13	0.018341	yes	BRNCTXA
chr1_1361685_C_T_b38	PLEKHN1	-3.1	0.00228	-0.059085	8	0.019062	yes	BRNCTXA
chr1_1431813_G_T_b38	PLEKHN1	-3.032	0.00282	-0.055992	7	0.018466	yes	BRNCTXA
chr1_1361679_G_A_b38	PLEKHN1	3.007	0.00305	0.053348	13	0.017739	yes	BRNCTXA
chr1_1101579_T_C_b38	PLEKHN1	3.007	0.00305	0.069208	3	0.023015	yes	BRNCTXA
chr1_1431656_G_A_b38	PLEKHN1	-2.977	0.00335	-0.056753	6	0.019064	yes	BRNCTXA
chr1_1358384_G_C_b38	PLEKHN1	2.971	0.00341	0.050111	24	0.016866	yes	BRNCTXA
chr1_1138876_T_C_b38	PLEKHN1	-2.948	0.00367	-0.050281	14	0.017057	yes	BRNCTXA
chr1_1366561_AGT_A_b38	PLEKHN1	2.939	0.00377	0.04963	24	0.016889	yes	BRNCTXA
chr1_1007325_A_G_b38	PLEKHN1	-2.938	0.00378	-0.126849	4	0.043176	yes	BRNCTXA
chr1_1398056_C_A_b38	PLEKHN1	-2.926	0.00392	-0.046465	24	0.015878	yes	BRNCTXA
chr1_1468094_G_C_b38	PLEKHN1	-2.875	0.00457	-0.0731	7	0.025422	yes	BRNCTXA
chr1_1451028_T_A_b38	PLEKHN1	-2.852	0.0049	-0.054044	7	0.018948	yes	BRNCTXA
chr1_1428969_T_C_b38	PLEKHN1	-2.848	0.00496	-0.047433	28	0.016655	yes	BRNCTXA
chr1_1430190_A_C_b38	PLEKHN1	-2.839	0.0051	-0.047205	28	0.016628	yes	BRNCTXA
chr1_1436079_A_G_b38	PLEKHN1	-2.827	0.00528	-0.044371	31	0.015694	yes	BRNCTXA
chr1_1431450_A_G_b38	PLEKHN1	-2.813	0.0055	-0.046909	28	0.016673	yes	BRNCTXA
chr1_1431537_G_C_b38	PLEKHN1	-2.813	0.0055	-0.046909	28	0.016673	yes	BRNCTXA
chr1_190768_G_A_b38	PLEKHN1	2.779	0.00609	0.105381	6	0.037922	yes	BRNCTXA
chr1_951408_G_A_b38	PLEKHN1	-2.776	0.00615	-0.067758	7	0.024413	yes	BRNCTXA
chr1_951437_C_T_b38	PLEKHN1	-2.776	0.00615	-0.067758	7	0.024413	yes	BRNCTXA
chr1_1145547_T_TCTGACCTCATGGCCGACCCCAC_b38	PLEKHN1	-2.773	0.0062	-0.04314	20	0.015559	yes	BRNCTXA
chr1_1430908_A_G_b38	PLEKHN1	-2.756	0.00651	-0.046337	28	0.016813	yes	BRNCTXA
chr1_1330125_G_A_b38	PLEKHN1	2.723	0.00718	0.046549	25	0.017097	yes	BRNCTXA
chr1_1135812_T_C_b38	PLEKHN1	-2.716	0.00732	-0.063345	4	0.023325	yes	BRNCTXA
chr1_1437993_G_A_b38	PLEKHN1	-2.713	0.00737	-0.046756	11	0.017232	yes	BRNCTXA
chr1_1384749_C_G_b38	PLEKHN1	2.713	0.00739	0.046169	21	0.017021	yes	BRNCTXA
chr1_1387763_CCT_C_b38	PLEKHN1	2.713	0.00739	0.046169	21	0.017021	yes	BRNCTXA
chr1_1388944_G_A_b38	PLEKHN1	2.713	0.00739	0.046169	21	0.017021	yes	BRNCTXA
chr1_1379093_TG_T_b38	PLEKHN1	-2.708	0.00749	-0.057355	3	0.021181	yes	BRNCTXA
chr1_1367919_C_T_b38	PLEKHN1	-2.697	0.00774	-0.054582	3	0.020241	yes	BRNCTXA
chr1_1367951_C_T_b38	PLEKHN1	-2.697	0.00774	-0.054582	3	0.020241	yes	BRNCTXA
chr1_1367965_A_G_b38	PLEKHN1	-2.697	0.00774	-0.054582	3	0.020241	yes	BRNCTXA
chr1_1367970_T_G_b38	PLEKHN1	-2.697	0.00774	-0.054582	3	0.020241	yes	BRNCTXA
chr1_1367994_C_A_b38	PLEKHN1	-2.697	0.00774	-0.054582	3	0.020241	yes	BRNCTXA
chr1_1368297_C_T_b38	PLEKHN1	-2.697	0.00774	-0.054582	3	0.020241	yes	BRNCTXA
chr1_1368514_C_G_b38	PLEKHN1	-2.697	0.00774	-0.054582	3	0.020241	yes	BRNCTXA
chr1_1368991_C_T_b38	PLEKHN1	-2.697	0.00774	-0.054582	3	0.020241	yes	BRNCTXA
chr1_1369009_T_C_b38	PLEKHN1	-2.697	0.00774	-0.054582	3	0.020241	yes	BRNCTXA
chr1_1369012_C_CG_b38	PLEKHN1	-2.697	0.00774	-0.054582	3	0.020241	yes	BRNCTXA
chr1_1308516_C_T_b38	PLEKHN1	2.685	0.00801	0.045436	26	0.016924	yes	BRNCTXA
chr1_1431014_G_A_b38	PLEKHN1	-2.684	0.00803	-0.044257	18	0.016492	yes	BRNCTXA
chr1_1312114_T_C_b38	PLEKHN1	2.682	0.00807	0.045259	26	0.016877	yes	BRNCTXA
chr1_1309988_G_A_b38	PLEKHN1	2.673	0.00827	0.04506	26	0.016856	yes	BRNCTXA
chr1_1313807_G_A_b38	PLEKHN1	2.673	0.00827	0.04506	26	0.016856	yes	BRNCTXA
chr1_1407232_G_C_b38	PLEKHN1	-2.65	0.00885	-0.047194	8	0.017812	yes	BRNCTXA
chr1_1101496_T_A_b38	PLEKHN1	2.649	0.00887	0.057685	5	0.021778	yes	BRNCTXA
chr1_1731375_T_C_b38	PLEKHN1	2.616	0.00973	0.056813	9	0.021717	yes	BRNCTXA
chr1_904561_TCCTCCTCCGAACGTGG_T_b38	PLEKHN1	2.615	0.00976	0.052147	8	0.019942	yes	BRNCTXA
chr1_1400410_A_G_b38	PLEKHN1	-2.607	0.00997	-0.04418	20	0.016945	yes	BRNCTXA
chr1_933601_C_T_b38	PLEKHN1	6.453	1.18e-09	0.192511	9	0.029832	no	BRNCTXA
chr1_928252_C_T_b38	PLEKHN1	-5.406	2.25e-07	-0.141919	5	0.026254	no	BRNCTXA
chr1_1742119_C_CA_b38	PLEKHN1	-4.241	3.71e-05	-0.13898	4	0.032769	no	BRNCTXA
chr1_629218_A_G_b38	PLEKHN1	-4.16	5.11e-05	-0.164168	4	0.03946	no	BRNCTXA
chr1_1010481_ATTAT_A_b38	PLEKHN1	-4.15	5.33e-05	-0.143127	5	0.034489	no	BRNCTXA
chr1_660993_T_C_b38	PLEKHN1	-4.032	8.45e-05	-0.13071	6	0.032418	no	BRNCTXA
chr1_607379_G_A_b38	PLEKHN1	-3.853	0.000167	-0.139468	3	0.036201	no	BRNCTXA
chr1_1011654_G_A_b38	PLEKHN1	-3.815	0.000192	-0.132264	6	0.034668	no	BRNCTXA
chr1_1469469_G_C_b38	PLEKHN1	-3.751	0.000244	-0.136491	3	0.036388	no	BRNCTXA
chr1_1522875_T_G_b38	PLEKHN1	-3.739	0.000255	-0.126963	4	0.033956	no	BRNCTXA
chr1_1468062_A_T_b38	PLEKHN1	-3.674	0.000323	-0.126687	4	0.034479	no	BRNCTXA
chr1_1534913_G_GC_b38	PLEKHN1	-3.663	0.000336	-0.168664	5	0.046046	no	BRNCTXA
chr1_631490_T_C_b38	PLEKHN1	-3.656	0.000345	-0.140588	3	0.038456	no	BRNCTXA
chr1_1461760_C_A_b38	PLEKHN1	-3.644	0.00036	-0.122099	5	0.033511	no	BRNCTXA
chr1_1461767_A_G_b38	PLEKHN1	-3.644	0.00036	-0.122099	5	0.033511	no	BRNCTXA
chr1_630555_C_T_b38	PLEKHN1	-3.613	0.000402	-0.130164	3	0.036025	no	BRNCTXA
chr1_1524911_C_T_b38	PLEKHN1	-3.61	0.000407	-0.114475	5	0.031711	no	BRNCTXA
chr1_1251285_G_A_b38	PLEKHN1	-3.567	0.000474	-0.069285	6	0.019424	no	BRNCTXA
chr1_1251368_T_C_b38	PLEKHN1	-3.567	0.000474	-0.069285	6	0.019424	no	BRNCTXA
chr1_1523574_C_T_b38	PLEKHN1	-3.563	0.000481	-0.129968	3	0.03648	no	BRNCTXA
chr1_600579_G_A_b38	PLEKHN1	-3.494	0.000613	-0.124697	3	0.035693	no	BRNCTXA
chr1_1472097_CGGCGG_C_b38	PLEKHN1	-3.48	0.000642	-0.130157	3	0.0374	no	BRNCTXA
chr1_1251618_G_A_b38	PLEKHN1	-3.328	0.00108	-0.065965	5	0.019823	no	BRNCTXA
chr1_1707555_C_T_b38	PLEKHN1	-3.314	0.00113	-0.093879	16	0.028332	no	BRNCTXA
chr1_1244603_G_A_b38	PLEKHN1	-3.229	0.0015	-0.066	4	0.020442	no	BRNCTXA
chr1_1527386_C_T_b38	PLEKHN1	-3.216	0.00157	-0.08963	11	0.027869	no	BRNCTXA
chr1_1461719_G_A_b38	PLEKHN1	-3.194	0.00168	-0.11697	3	0.036624	no	BRNCTXA
chr1_1248115_T_C_b38	PLEKHN1	-3.048	0.00269	-0.074104	3	0.024312	no	BRNCTXA
chr1_1248116_G_A_b38	PLEKHN1	-3.048	0.00269	-0.074104	3	0.024312	no	BRNCTXA
chr1_1248062_A_G_b38	PLEKHN1	-3.02	0.00294	-0.071247	3	0.023595	no	BRNCTXA
chr1_1248063_T_C_b38	PLEKHN1	-3.02	0.00294	-0.071247	3	0.023595	no	BRNCTXA
chr1_1248068_A_C_b38	PLEKHN1	-3.02	0.00294	-0.071247	3	0.023595	no	BRNCTXA
chr1_1248069_A_C_b38	PLEKHN1	-3.02	0.00294	-0.071247	3	0.023595	no	BRNCTXA
chr1_1248075_A_C_b38	PLEKHN1	-3.02	0.00294	-0.071247	3	0.023595	no	BRNCTXA
chr1_1248091_G_A_b38	PLEKHN1	-3.02	0.00294	-0.071247	3	0.023595	no	BRNCTXA
chr1_1248092_T_C_b38	PLEKHN1	-3.02	0.00294	-0.071247	3	0.023595	no	BRNCTXA
chr1_1426261_C_T_b38	PLEKHN1	-2.994	0.00318	-0.049705	27	0.0166	no	BRNCTXA
chr1_1426810_C_G_b38	PLEKHN1	-2.994	0.00318	-0.049705	27	0.0166	no	BRNCTXA
chr1_632821_T_C_b38	PLEKHN1	-2.991	0.00321	-0.111823	3	0.037392	no	BRNCTXA
chr1_1502507_A_T_b38	PLEKHN1	2.958	0.00356	0.099698	3	0.033706	no	BRNCTXA
chr1_1290968_C_G_b38	PLEKHN1	-2.946	0.00369	-0.060892	14	0.02067	no	BRNCTXA
chr1_1241053_A_G_b38	PLEKHN1	-2.94	0.00376	-0.05972	4	0.020316	no	BRNCTXA
chr1_1241217_T_C_b38	PLEKHN1	-2.906	0.00416	-0.059214	4	0.020375	no	BRNCTXA
chr1_1241639_T_C_b38	PLEKHN1	-2.904	0.00419	-0.060693	3	0.020898	no	BRNCTXA
chr1_1534915_T_C_b38	PLEKHN1	-2.895	0.00431	-0.096543	10	0.03335	no	BRNCTXA
chr1_1290841_A_G_b38	PLEKHN1	-2.868	0.00468	-0.056468	12	0.01969	no	BRNCTXA
chr1_1701568_G_C_b38	PLEKHN1	-2.867	0.00469	-0.081123	6	0.028299	no	BRNCTXA
chr1_1357246_C_T_b38	PLEKHN1	-2.866	0.0047	-0.125971	3	0.043946	no	BRNCTXA
chr1_967724_C_T_b38	PLEKHN1	2.856	0.00484	0.092489	6	0.032381	no	BRNCTXA
chr1_1494105_G_A_b38	PLEKHN1	-2.855	0.00487	-0.099575	4	0.034882	no	BRNCTXA
chr1_1495205_G_A_b38	PLEKHN1	-2.855	0.00487	-0.099575	4	0.034882	no	BRNCTXA
chr1_1495221_G_A_b38	PLEKHN1	-2.855	0.00487	-0.099575	4	0.034882	no	BRNCTXA
chr1_1495222_T_G_b38	PLEKHN1	-2.855	0.00487	-0.099575	4	0.034882	no	BRNCTXA
chr1_1495236_T_C_b38	PLEKHN1	-2.855	0.00487	-0.099575	4	0.034882	no	BRNCTXA
chr1_1495327_C_T_b38	PLEKHN1	-2.855	0.00487	-0.099575	4	0.034882	no	BRNCTXA
chr1_1242094_A_G_b38	PLEKHN1	-2.85	0.00493	-0.058285	4	0.020452	no	BRNCTXA
chr1_1242250_A_G_b38	PLEKHN1	-2.85	0.00493	-0.058285	4	0.020452	no	BRNCTXA
chr1_1804004_G_A_b38	PLEKHN1	2.849	0.00495	0.036338	17	0.012756	no	BRNCTXA
chr1_1732685_T_C_b38	PLEKHN1	2.823	0.00535	0.062456	17	0.022125	no	BRNCTXA
chr1_1734899_G_A_b38	PLEKHN1	2.823	0.00535	0.062456	17	0.022125	no	BRNCTXA
chr1_1243650_G_A_b38	PLEKHN1	-2.774	0.00617	-0.057323	4	0.020661	no	BRNCTXA
chr1_1919773_C_T_b38	PLEKHN1	-2.765	0.00634	-0.067781	7	0.024513	no	BRNCTXA
chr1_263934_GC_G_b38	PLEKHN1	2.763	0.00637	0.052935	5	0.019156	no	BRNCTXA
chr1_1242865_C_T_b38	PLEKHN1	-2.741	0.0068	-0.055164	5	0.020123	no	BRNCTXA
chr1_908690_A_AGAGGGGACAAGTGG_b38	PLEKHN1	-2.723	0.00716	-0.042164	25	0.015483	no	BRNCTXA
chr1_1022587_T_TTGTAGTCTGACCTGTGGTCTGAC_b38	PLEKHN1	2.723	0.00717	0.112112	4	0.04117	no	BRNCTXA
chr1_1459632_T_C_b38	PLEKHN1	-2.702	0.00761	-0.069751	10	0.025813	no	BRNCTXA
chr1_1450636_A_G_b38	PLEKHN1	-2.688	0.00793	-0.052121	6	0.019391	no	BRNCTXA
chr1_1774697_T_C_b38	PLEKHN1	2.659	0.00861	0.071417	3	0.026855	no	BRNCTXA
chr1_1246371_T_C_b38	PLEKHN1	-2.642	0.00904	-0.051805	7	0.019608	no	BRNCTXA
chr1_618603_G_A_b38	PLEKHN1	-2.633	0.00927	-0.115896	3	0.044017	no	BRNCTXA
chr1_618345_C_T_b38	PLEKHN1	-2.619	0.00964	-0.100484	4	0.038366	no	BRNCTXA
chr1_1955424_T_C_b38	PLEKHN1	5.474	2.09e-07	0.198222	3	0.036211	yes	BRNCTXB
chr1_1957243_T_C_b38	PLEKHN1	5.349	3.72e-07	0.126361	4	0.023624	yes	BRNCTXB
chr1_1957760_T_C_b38	PLEKHN1	5.349	3.72e-07	0.126361	4	0.023624	yes	BRNCTXB
chr1_1949580_T_G_b38	PLEKHN1	4.018	9.73e-05	0.104142	3	0.025918	yes	BRNCTXB
chr1_1949631_G_A_b38	PLEKHN1	4.018	9.73e-05	0.104142	3	0.025918	yes	BRNCTXB
chr1_1949646_A_G_b38	PLEKHN1	4.018	9.73e-05	0.104142	3	0.025918	yes	BRNCTXB
chr1_1953441_G_A_b38	PLEKHN1	4.018	9.73e-05	0.104142	3	0.025918	yes	BRNCTXB
chr1_1954330_G_A_b38	PLEKHN1	4.018	9.73e-05	0.104142	3	0.025918	yes	BRNCTXB
chr1_1954676_C_G_b38	PLEKHN1	4.018	9.73e-05	0.104142	3	0.025918	yes	BRNCTXB
chr1_928252_C_T_b38	PLEKHN1	-3.906	0.000148	-0.084182	5	0.02155	yes	BRNCTXB
chr1_1479324_C_G_b38	PLEKHN1	3.872	0.000168	0.102846	6	0.026559	yes	BRNCTXB
chr1_1719638_C_CTCGCTCTGTCACCCAGGCT_b38	PLEKHN1	-3.55	0.000532	-0.077294	6	0.021773	yes	BRNCTXB
chr1_1802763_T_TAA_b38	PLEKHN1	-3.374	0.000968	-0.055525	7	0.016455	yes	BRNCTXB
chr1_1949489_AT_A_b38	PLEKHN1	3.37	0.000982	0.084513	3	0.025078	yes	BRNCTXB
chr1_1705198_C_G_b38	PLEKHN1	3.216	0.00163	0.118007	3	0.036694	yes	BRNCTXB
chr1_1963533_C_CA_b38	PLEKHN1	-2.881	0.00462	-0.036166	39	0.012555	yes	BRNCTXB
chr1_1634406_C_CG_b38	PLEKHN1	2.875	0.0047	0.058138	4	0.020223	yes	BRNCTXB
chr1_1010481_ATTAT_A_b38	PLEKHN1	-2.857	0.00496	-0.083305	3	0.029158	yes	BRNCTXB
chr1_1512492_GGCGGC_G_b38	PLEKHN1	2.816	0.00559	0.089614	4	0.031819	yes	BRNCTXB
chr1_633678_C_T_b38	PLEKHN1	2.759	0.00661	0.058188	3	0.021092	yes	BRNCTXB
chr1_1502507_A_T_b38	PLEKHN1	4.761	4.93e-06	0.145186	3	0.030496	no	BRNCTXB
chr1_643358_G_A_b38	PLEKHN1	-4.293	3.36e-05	-0.11878	3	0.027671	no	BRNCTXB
chr1_629218_A_G_b38	PLEKHN1	-4.128	6.4e-05	-0.138775	5	0.033621	no	BRNCTXB
chr1_951437_C_CATTTT_b38	PLEKHN1	3.844	0.000186	0.099216	4	0.025811	no	BRNCTXB
chr1_933601_C_T_b38	PLEKHN1	3.652	0.000372	0.102058	5	0.027943	no	BRNCTXB
chr1_1524911_C_T_b38	PLEKHN1	-2.988	0.00334	-0.090217	4	0.030194	no	BRNCTXB
chr1_273824_G_T_b38	PLEKHN1	2.869	0.00479	0.045455	10	0.015845	no	BRNCTXB
chr1_749482_G_A_b38	PLEKHN1	-2.848	0.00509	-0.088128	6	0.030944	no	BRNCTXB
chr1_1567912_C_CAAAAAAAA_b38	PLEKHN1	2.835	0.00529	0.067937	3	0.023962	no	BRNCTXB
chr1_638771_A_T_b38	PLEKHN1	-2.797	0.00591	-0.071973	4	0.025729	no	BRNCTXB
chr1_1874605_TA_T_b38	PLEKHN1	2.774	0.00632	0.077495	3	0.027933	no	BRNCTXB
chr1_1011654_G_A_b38	PLEKHN1	-2.743	0.00692	-0.078591	3	0.02865	no	BRNCTXB
chr1_908799_AATGAGGGGCAGGGGGGAAGGGAGGG_A_b38	PLEKHN1	-2.704	0.00774	-0.092518	3	0.034214	no	BRNCTXB
chr1_1059337_A_G_b38	PLEKHN1	-2.676	0.00837	-0.090403	3	0.033778	no	BRNCTXB
chr1_1206176_G_C_b38	PLEKHN1	-2.625	0.00967	-0.071069	3	0.027071	no	BRNCTXB
chr1_1206343_A_G_b38	PLEKHN1	-2.625	0.00967	-0.071069	3	0.027071	no	BRNCTXB
chr1_1206770_G_A_b38	PLEKHN1	-2.625	0.00967	-0.071069	3	0.027071	no	BRNCTXB
chr1_190768_G_A_b38	PLEKHN1	3.401	0.000904	0.124355	4	0.036566	yes	BRNHPP
chr1_650383_A_AAC_b38	PLEKHN1	3.125	0.00222	0.079298	3	0.025377	yes	BRNHPP
chr1_992967_GGGAGGGTCCATGTGTCCGTCATCTGA_G_b38	PLEKHN1	3.032	0.00296	0.04261	37	0.014053	yes	BRNHPP
chr1_969780_C_T_b38	PLEKHN1	-3.025	0.00302	-0.061682	9	0.020391	yes	BRNHPP
chr1_995508_ATTTTT_A_b38	PLEKHN1	2.982	0.00345	0.042304	32	0.014185	yes	BRNHPP
chr1_998410_G_A_b38	PLEKHN1	2.982	0.00345	0.042304	32	0.014185	yes	BRNHPP
chr1_989068_GTTGA_G_b38	PLEKHN1	2.94	0.00391	0.040391	35	0.013737	yes	BRNHPP
chr1_1231710_CCCCCGGGAA_C_b38	PLEKHN1	2.92	0.00415	0.055142	4	0.018881	yes	BRNHPP
chr1_1533883_G_T_b38	PLEKHN1	2.847	0.00517	0.073798	5	0.025922	yes	BRNHPP
chr1_999842_C_A_b38	PLEKHN1	2.826	0.0055	0.040043	36	0.014169	yes	BRNHPP
chr1_817186_G_A_b38	PLEKHN1	2.808	0.00579	0.054448	3	0.01939	yes	BRNHPP
chr1_824320_T_C_b38	PLEKHN1	2.808	0.00579	0.054448	3	0.01939	yes	BRNHPP
chr1_825532_C_T_b38	PLEKHN1	2.808	0.00579	0.054448	3	0.01939	yes	BRNHPP
chr1_825767_T_C_b38	PLEKHN1	2.808	0.00579	0.054448	3	0.01939	yes	BRNHPP
chr1_1363601_A_AT_b38	PLEKHN1	-2.771	0.00645	-0.036073	33	0.013019	yes	BRNHPP
chr1_1607341_CTT_C_b38	PLEKHN1	-2.758	0.00669	-0.043091	21	0.015622	yes	BRNHPP
chr1_817514_T_C_b38	PLEKHN1	2.756	0.00674	0.051943	3	0.01885	yes	BRNHPP
chr1_826577_A_AT_b38	PLEKHN1	2.755	0.00675	0.052342	3	0.018998	yes	BRNHPP
chr1_1193398_C_CTTA_b38	PLEKHN1	2.718	0.00752	0.045021	20	0.016566	yes	BRNHPP
chr1_1000731_C_T_b38	PLEKHN1	2.702	0.00786	0.037924	33	0.014036	yes	BRNHPP
chr1_1008588_C_T_b38	PLEKHN1	2.66	0.00885	0.038906	35	0.014627	yes	BRNHPP
chr1_1370553_CA_C_b38	PLEKHN1	-2.652	0.00905	-0.038103	36	0.014368	yes	BRNHPP
chr1_1611571_T_C_b38	PLEKHN1	2.631	0.00959	0.037246	20	0.014156	yes	BRNHPP
chr1_1583688_A_C_b38	PLEKHN1	2.617	0.00997	0.040785	14	0.015585	yes	BRNHPP
chr1_182095_T_C_b38	PLEKHN1	3.017	0.0031	0.058445	19	0.019374	no	BRNHPP
chr1_1235602_C_A_b38	PLEKHN1	2.924	0.00411	0.056927	3	0.019469	no	BRNHPP
chr1_1184277_G_C_b38	PLEKHN1	2.918	0.00418	0.045274	28	0.015515	no	BRNHPP
chr1_1188054_T_A_b38	PLEKHN1	2.911	0.00427	0.048794	7	0.016761	no	BRNHPP
chr1_981454_G_A_b38	PLEKHN1	2.895	0.00448	0.040336	30	0.013932	no	BRNHPP
chr1_983193_A_G_b38	PLEKHN1	2.895	0.00448	0.040336	30	0.013932	no	BRNHPP
chr1_591590_T_C_b38	PLEKHN1	-2.894	0.00449	-0.059516	4	0.020563	no	BRNHPP
chr1_192025_G_A_b38	PLEKHN1	2.872	0.0048	0.068284	4	0.023775	no	BRNHPP
chr1_1000830_C_A_b38	PLEKHN1	2.861	0.00496	0.049201	5	0.017196	no	BRNHPP
chr1_1017048_G_A_b38	PLEKHN1	2.858	0.005	0.040498	38	0.014169	no	BRNHPP
chr1_1217733_G_A_b38	PLEKHN1	2.793	0.00605	0.052869	4	0.01893	no	BRNHPP
chr1_1225476_T_C_b38	PLEKHN1	2.735	0.00715	0.055918	3	0.020444	no	BRNHPP
chr1_1226013_C_T_b38	PLEKHN1	2.735	0.00715	0.055918	3	0.020444	no	BRNHPP
chr1_995543_A_G_b38	PLEKHN1	2.732	0.00721	0.045864	6	0.016788	no	BRNHPP
chr1_983004_G_T_b38	PLEKHN1	2.731	0.00724	0.03831	34	0.014028	no	BRNHPP
chr1_965666_ACC_A_b38	PLEKHN1	-2.728	0.0073	-0.043016	8	0.015768	no	BRNHPP
chr1_1201373_T_C_b38	PLEKHN1	2.721	0.00745	0.045524	14	0.016733	no	BRNHPP
chr1_979560_T_C_b38	PLEKHN1	2.705	0.00779	0.03813	33	0.014096	no	BRNHPP
chr1_1018572_G_A_b38	PLEKHN1	2.672	0.00854	0.038457	39	0.01439	no	BRNHPP
chr1_978953_C_G_b38	PLEKHN1	2.662	0.0088	0.036264	29	0.013624	no	BRNHPP
chr1_590378_T_C_b38	PLEKHN1	-2.657	0.00893	-0.06723	7	0.025306	no	BRNHPP
chr1_965125_G_C_b38	PLEKHN1	-2.644	0.00924	-0.04222	10	0.015966	no	BRNHPP
chr1_1005757_AGCCCCCGCAGCAGT_A_b38	PLEKHN1	2.624	0.00978	0.037279	29	0.014207	no	BRNHPP
chr1_1182106_A_G_b38	PLEKHN1	3.846	0.000188	0.075045	3	0.019515	yes	BRNHPT
chr1_1177602_C_T_b38	PLEKHN1	3.568	0.000507	0.067107	3	0.01881	yes	BRNHPT
chr1_1913504_CT_C_b38	PLEKHN1	3.321	0.00117	0.052105	27	0.015691	yes	BRNHPT
chr1_1664300_T_C_b38	PLEKHN1	3.087	0.00247	0.056003	6	0.01814	yes	BRNHPT
chr1_1728948_T_C_b38	PLEKHN1	2.861	0.00492	0.046264	10	0.016169	yes	BRNHPT
chr1_1934807_G_A_b38	PLEKHN1	4.533	1.31e-05	0.126272	3	0.027855	no	BRNHPT
chr1_1663180_T_C_b38	PLEKHN1	3.619	0.000423	0.066476	5	0.018369	no	BRNHPT
chr1_1663182_C_A_b38	PLEKHN1	3.619	0.000423	0.066476	5	0.018369	no	BRNHPT
chr1_1663949_A_G_b38	PLEKHN1	3.441	0.000782	0.076957	3	0.022366	no	BRNHPT
chr1_1589418_T_TA_b38	PLEKHN1	3.08	0.00253	0.049239	18	0.015985	no	BRNHPT
chr1_1836856_CT_C_b38	PLEKHN1	-3.031	0.00295	-0.056843	4	0.018754	no	BRNHPT
chr1_1774506_T_C_b38	PLEKHN1	3.022	0.00302	0.047292	22	0.015647	no	BRNHPT
chr1_969663_CAT_C_b38	PLEKHN1	-2.985	0.00339	-0.046418	11	0.015548	no	BRNHPT
chr1_965125_G_C_b38	PLEKHN1	-2.969	0.00356	-0.046874	12	0.015787	no	BRNHPT
chr1_1743570_T_A_b38	PLEKHN1	2.939	0.0039	0.079229	4	0.026955	no	BRNHPT
chr1_1171404_T_C_b38	PLEKHN1	2.923	0.0041	0.053235	8	0.018214	no	BRNHPT
chr1_1952590_A_AAAAG_b38	PLEKHN1	-2.912	0.00423	-0.049243	10	0.016911	no	BRNHPT
chr1_1771864_G_A_b38	PLEKHN1	2.887	0.00456	0.044124	34	0.015284	no	BRNHPT
chr1_1772410_T_C_b38	PLEKHN1	2.887	0.00456	0.044124	34	0.015284	no	BRNHPT
chr1_1772426_T_A_b38	PLEKHN1	2.887	0.00456	0.044124	34	0.015284	no	BRNHPT
chr1_1810077_T_A_b38	PLEKHN1	2.878	0.00469	0.045568	17	0.015835	no	BRNHPT
chr1_1742432_T_TA_b38	PLEKHN1	-2.857	0.00499	-0.043701	24	0.015297	no	BRNHPT
chr1_1728965_A_G_b38	PLEKHN1	2.815	0.00564	0.045084	9	0.016013	no	BRNHPT
chr1_1770997_G_A_b38	PLEKHN1	2.805	0.00581	0.041357	35	0.014742	no	BRNHPT
chr1_1728671_C_A_b38	PLEKHN1	2.801	0.00587	0.051827	6	0.018501	no	BRNHPT
chr1_1836126_C_A_b38	PLEKHN1	2.794	0.006	0.041683	35	0.01492	no	BRNHPT
chr1_1613330_A_AT_b38	PLEKHN1	-2.774	0.00637	-0.044771	23	0.016142	no	BRNHPT
chr1_1108232_CAG_C_b38	PLEKHN1	2.74	0.00702	0.060366	4	0.022032	no	BRNHPT
chr1_1108235_CA_C_b38	PLEKHN1	2.74	0.00702	0.060366	4	0.022032	no	BRNHPT
chr1_1734263_T_C_b38	PLEKHN1	2.723	0.00736	0.036927	24	0.013561	no	BRNHPT
chr1_1897325_G_A_b38	PLEKHN1	-2.709	0.00767	-0.04683	8	0.017288	no	BRNHPT
chr1_1766653_A_G_b38	PLEKHN1	2.707	0.0077	0.041591	33	0.015362	no	BRNHPT
chr1_1762287_A_G_b38	PLEKHN1	2.695	0.00797	0.041605	34	0.015435	no	BRNHPT
chr1_1063661_ATG_A_b38	PLEKHN1	2.686	0.00818	0.037479	36	0.013953	no	BRNHPT
chr1_1732013_G_A_b38	PLEKHN1	2.666	0.00865	0.035818	26	0.013433	no	BRNHPT
chr1_1732412_G_C_b38	PLEKHN1	2.666	0.00865	0.035818	26	0.013433	no	BRNHPT
chr1_1732422_G_A_b38	PLEKHN1	2.666	0.00865	0.035818	26	0.013433	no	BRNHPT
chr1_1733576_G_A_b38	PLEKHN1	2.666	0.00865	0.035818	26	0.013433	no	BRNHPT
chr1_1735370_G_A_b38	PLEKHN1	2.666	0.00865	0.035818	26	0.013433	no	BRNHPT
chr1_1735884_C_T_b38	PLEKHN1	2.666	0.00865	0.035818	26	0.013433	no	BRNHPT
chr1_1736472_C_T_b38	PLEKHN1	2.666	0.00865	0.035818	26	0.013433	no	BRNHPT
chr1_1737704_C_T_b38	PLEKHN1	2.666	0.00865	0.035818	26	0.013433	no	BRNHPT
chr1_1738309_A_G_b38	PLEKHN1	2.666	0.00865	0.035818	26	0.013433	no	BRNHPT
chr1_1773460_G_A_b38	PLEKHN1	2.632	0.00952	0.04066	33	0.015449	no	BRNHPT
chr1_1773476_C_G_b38	PLEKHN1	2.632	0.00952	0.04066	33	0.015449	no	BRNHPT
chr1_1773848_A_C_b38	PLEKHN1	2.632	0.00952	0.04066	33	0.015449	no	BRNHPT
chr1_1776461_GAAAC_G_b38	PLEKHN1	2.632	0.00952	0.04066	33	0.015449	no	BRNHPT
chr1_1777362_A_G_b38	PLEKHN1	2.632	0.00952	0.04066	33	0.015449	no	BRNHPT
chr1_1790040_C_T_b38	PLEKHN1	2.632	0.00952	0.04066	33	0.015449	no	BRNHPT
chr1_1791493_C_T_b38	PLEKHN1	2.632	0.00952	0.04066	33	0.015449	no	BRNHPT
chr1_1791592_G_A_b38	PLEKHN1	2.632	0.00952	0.04066	33	0.015449	no	BRNHPT
chr1_1792927_G_A_b38	PLEKHN1	2.632	0.00952	0.04066	33	0.015449	no	BRNHPT
chr1_1811084_T_A_b38	PLEKHN1	2.631	0.00955	0.038629	33	0.014683	no	BRNHPT
chr1_1479324_C_G_b38	PLEKHN1	3.844	0.000174	0.105962	4	0.027565	yes	BRNNCC
chr1_1957243_T_C_b38	PLEKHN1	3.838	0.000178	0.094905	4	0.024729	yes	BRNNCC
chr1_1957760_T_C_b38	PLEKHN1	3.838	0.000178	0.094905	4	0.024729	yes	BRNNCC
chr1_1955424_T_C_b38	PLEKHN1	3.734	0.000261	0.133678	4	0.035799	yes	BRNNCC
chr1_1153291_C_T_b38	PLEKHN1	3.581	0.000452	0.044102	16	0.012315	yes	BRNNCC
chr1_1010747_GT_G_b38	PLEKHN1	-3.43	0.000767	-0.077113	4	0.022483	yes	BRNNCC
chr1_1010755_T_G_b38	PLEKHN1	-3.429	0.00077	-0.071784	4	0.020936	yes	BRNNCC
chr1_921797_T_C_b38	PLEKHN1	3.223	0.00154	0.088422	4	0.027434	yes	BRNNCC
chr1_280599_T_C_b38	PLEKHN1	-3.088	0.00238	-0.050601	3	0.016387	yes	BRNNCC
chr1_928483_G_A_b38	PLEKHN1	3.032	0.00283	0.085519	4	0.028201	yes	BRNNCC
chr1_928252_C_T_b38	PLEKHN1	-3.003	0.0031	-0.065342	3	0.021758	yes	BRNNCC
chr1_123642_T_G_b38	PLEKHN1	-2.817	0.00545	-0.044675	4	0.015857	yes	BRNNCC
chr1_1423062_C_T_b38	PLEKHN1	2.778	0.00613	0.060522	3	0.021789	yes	BRNNCC
chr1_39015_A_C_b38	PLEKHN1	-2.756	0.00652	-0.048629	3	0.017642	yes	BRNNCC
chr1_1423191_T_A_b38	PLEKHN1	2.611	0.00989	0.05311	3	0.020344	yes	BRNNCC
chr1_1423343_G_T_b38	PLEKHN1	2.611	0.00989	0.05311	3	0.020344	yes	BRNNCC
chr1_1423478_C_T_b38	PLEKHN1	2.611	0.00989	0.05311	3	0.020344	yes	BRNNCC
chr1_1424078_G_A_b38	PLEKHN1	2.611	0.00989	0.05311	3	0.020344	yes	BRNNCC
chr1_1424220_A_G_b38	PLEKHN1	2.611	0.00989	0.05311	3	0.020344	yes	BRNNCC
chr1_1739115_T_C_b38	PLEKHN1	3.694	0.000302	0.09819	4	0.026582	no	BRNNCC
chr1_1719638_C_CTCGCTCTGTCACCCAGGCT_b38	PLEKHN1	-3.353	0.000997	-0.065155	6	0.019433	no	BRNNCC
chr1_1022587_T_TTGTAGTCTGACCTGTGGTCTGAC_b38	PLEKHN1	-3.227	0.00152	-0.110404	3	0.034216	no	BRNNCC
chr1_1427029_G_A_b38	PLEKHN1	3.217	0.00156	0.090211	3	0.02804	no	BRNNCC
chr1_629218_A_G_b38	PLEKHN1	-3.208	0.00161	-0.110644	3	0.034488	no	BRNNCC
chr1_1184478_C_T_b38	PLEKHN1	3.173	0.00181	0.061902	6	0.019508	no	BRNNCC
chr1_924533_A_G_b38	PLEKHN1	-3.102	0.00227	-0.090629	3	0.029212	no	BRNNCC
chr1_1499339_T_C_b38	PLEKHN1	3.055	0.00263	0.078003	3	0.025529	no	BRNNCC
chr1_1324134_G_GGCTGGGGGGCTGGGAGGCTGAGAGGCTGGGGAGCTGGGGA_b38	PLEKHN1	3.044	0.00273	0.071865	4	0.023612	no	BRNNCC
chr1_1355705_C_T_b38	PLEKHN1	3.042	0.00275	0.091456	3	0.030069	no	BRNNCC
chr1_951437_C_CATTTT_b38	PLEKHN1	3.039	0.00277	0.069669	4	0.022924	no	BRNNCC
chr1_1450193_C_T_b38	PLEKHN1	3.016	0.00298	0.074066	3	0.024557	no	BRNNCC
chr1_1514211_A_G_b38	PLEKHN1	3.014	0.00299	0.087059	3	0.028882	no	BRNNCC
chr1_1533653_C_T_b38	PLEKHN1	3.012	0.00302	0.093093	4	0.030908	no	BRNNCC
chr1_1558204_T_TAAAAA_b38	PLEKHN1	-2.991	0.00322	-0.081941	3	0.027398	no	BRNNCC
chr1_925398_A_G_b38	PLEKHN1	-2.982	0.0033	-0.093547	3	0.031366	no	BRNNCC
chr1_925408_TTGG_T_b38	PLEKHN1	-2.982	0.0033	-0.093547	3	0.031366	no	BRNNCC
chr1_925412_CGCCTGCG_C_b38	PLEKHN1	-2.982	0.0033	-0.093547	3	0.031366	no	BRNNCC
chr1_1417046_C_T_b38	PLEKHN1	2.924	0.00396	0.060924	3	0.020839	no	BRNNCC
chr1_1008088_T_C_b38	PLEKHN1	2.833	0.00521	0.075016	4	0.026482	no	BRNNCC
chr1_1428999_C_CA_b38	PLEKHN1	2.775	0.00617	0.039319	11	0.014167	no	BRNNCC
chr1_1331045_G_A_b38	PLEKHN1	2.765	0.00635	0.074877	3	0.027078	no	BRNNCC
chr1_1364223_G_A_b38	PLEKHN1	2.765	0.00635	0.074877	3	0.027078	no	BRNNCC
chr1_1366030_CTGTG_C_b38	PLEKHN1	2.765	0.00635	0.074877	3	0.027078	no	BRNNCC
chr1_1367498_T_C_b38	PLEKHN1	2.765	0.00635	0.074877	3	0.027078	no	BRNNCC
chr1_1306149_A_G_b38	PLEKHN1	-2.759	0.00646	-0.067018	3	0.024288	no	BRNNCC
chr1_1363157_C_T_b38	PLEKHN1	-2.754	0.00656	-0.056676	3	0.020576	no	BRNNCC
chr1_1327764_G_A_b38	PLEKHN1	-2.727	0.00711	-0.056593	3	0.020755	no	BRNNCC
chr1_1353203_C_G_b38	PLEKHN1	-2.727	0.00711	-0.056593	3	0.020755	no	BRNNCC
chr1_1375788_G_C_b38	PLEKHN1	2.725	0.00714	0.073918	3	0.027125	no	BRNNCC
chr1_1381507_G_A_b38	PLEKHN1	2.725	0.00714	0.073918	3	0.027125	no	BRNNCC
chr1_1382885_A_G_b38	PLEKHN1	2.725	0.00714	0.073918	3	0.027125	no	BRNNCC
chr1_1477850_C_G_b38	PLEKHN1	-2.724	0.00717	-0.077543	4	0.028471	no	BRNNCC
chr1_1477855_G_C_b38	PLEKHN1	-2.724	0.00717	-0.077543	4	0.028471	no	BRNNCC
chr1_1948594_G_GTTT_b38	PLEKHN1	2.712	0.0074	0.070019	3	0.025814	no	BRNNCC
chr1_1319056_A_G_b38	PLEKHN1	-2.69	0.00789	-0.062571	3	0.023257	no	BRNNCC
chr1_1521298_C_CA_b38	PLEKHN1	2.663	0.00853	0.059176	6	0.022222	no	BRNNCC
chr1_1007870_C_T_b38	PLEKHN1	2.653	0.00877	0.072457	3	0.02731	no	BRNNCC
chr1_1362042_C_T_b38	PLEKHN1	-2.652	0.0088	-0.055428	3	0.0209	no	BRNNCC
chr1_1363031_C_T_b38	PLEKHN1	-2.652	0.0088	-0.055428	3	0.0209	no	BRNNCC
chr1_1531133_G_A_b38	PLEKHN1	2.647	0.00894	0.083936	5	0.031715	no	BRNNCC
chr1_1413406_G_A_b38	PLEKHN1	2.645	0.00898	0.073351	3	0.027735	no	BRNNCC
chr1_1326444_G_C_b38	PLEKHN1	-2.638	0.00915	-0.055568	3	0.021062	no	BRNNCC
chr1_1338970_A_G_b38	PLEKHN1	-2.638	0.00915	-0.055568	3	0.021062	no	BRNNCC
chr1_1344634_A_G_b38	PLEKHN1	-2.638	0.00915	-0.055568	3	0.021062	no	BRNNCC
chr1_1345965_C_T_b38	PLEKHN1	-2.638	0.00915	-0.055568	3	0.021062	no	BRNNCC
chr1_1351747_G_A_b38	PLEKHN1	-2.638	0.00915	-0.055568	3	0.021062	no	BRNNCC
chr1_904561_TCCTCCTCCGAACGTGG_T_b38	PLEKHN1	2.629	0.00941	0.04256	6	0.016192	no	BRNNCC
chr1_1351517_G_C_b38	PLEKHN1	-2.61	0.0099	-0.050778	8	0.019454	no	BRNNCC
chr1_1399922_C_T_b38	PLEKHN1	2.607	0.00998	0.056135	3	0.02153	no	BRNNCC
chr1_1402900_A_G_b38	PLEKHN1	2.607	0.00998	0.056135	3	0.02153	no	BRNNCC
chr1_1403240_CCTTT_C_b38	PLEKHN1	2.607	0.00998	0.056135	3	0.02153	no	BRNNCC
chr1_1405316_T_C_b38	PLEKHN1	2.607	0.00998	0.056135	3	0.02153	no	BRNNCC
chr1_660993_T_C_b38	PLEKHN1	-5.803	4.78e-08	-0.181407	5	0.031262	yes	BRNPTM
chr1_1477850_C_G_b38	PLEKHN1	-5.469	2.26e-07	-0.214354	3	0.039191	yes	BRNPTM
chr1_1477855_G_C_b38	PLEKHN1	-5.469	2.26e-07	-0.214354	3	0.039191	yes	BRNPTM
chr1_1461760_C_A_b38	PLEKHN1	-5.033	1.59e-06	-0.176244	5	0.035017	yes	BRNPTM
chr1_1461767_A_G_b38	PLEKHN1	-5.033	1.59e-06	-0.176244	5	0.035017	yes	BRNPTM
chr1_951437_C_CATTTT_b38	PLEKHN1	4.754	5.25e-06	0.156605	3	0.032945	yes	BRNPTM
chr1_1719638_C_CTCGCTCTGTCACCCAGGCT_b38	PLEKHN1	-4.572	1.12e-05	-0.12889	4	0.028194	yes	BRNPTM
chr1_1010481_ATTAT_A_b38	PLEKHN1	-4.383	2.4e-05	-0.160806	3	0.036688	yes	BRNPTM
chr1_1011654_G_A_b38	PLEKHN1	-4.383	2.4e-05	-0.160806	3	0.036688	yes	BRNPTM
chr1_1010747_GT_G_b38	PLEKHN1	-4.234	4.33e-05	-0.129557	3	0.030599	yes	BRNPTM
chr1_1955424_T_C_b38	PLEKHN1	4.168	5.59e-05	0.230471	3	0.055291	yes	BRNPTM
chr1_1572877_TGG_T_b38	PLEKHN1	-4.019	9.88e-05	-0.129123	3	0.032129	yes	BRNPTM
chr1_1461719_G_A_b38	PLEKHN1	-3.777	0.000241	-0.149126	3	0.039478	yes	BRNPTM
chr1_1010755_T_G_b38	PLEKHN1	-3.742	0.000274	-0.114014	3	0.030471	yes	BRNPTM
chr1_1874605_TA_T_b38	PLEKHN1	3.624	0.000415	0.11983	3	0.033062	yes	BRNPTM
chr1_1472097_CGGCGG_C_b38	PLEKHN1	-3.591	0.000467	-0.138007	3	0.038429	yes	BRNPTM
chr1_123642_T_G_b38	PLEKHN1	-3.575	0.000494	-0.078332	3	0.021913	yes	BRNPTM
chr1_1457919_C_A_b38	PLEKHN1	-3.449	0.000761	-0.153872	3	0.044618	yes	BRNPTM
chr1_1457922_T_C_b38	PLEKHN1	-3.449	0.000761	-0.153872	3	0.044618	yes	BRNPTM
chr1_928252_C_T_b38	PLEKHN1	-3.218	0.00163	-0.097844	3	0.030409	yes	BRNPTM
chr1_1957243_T_C_b38	PLEKHN1	3.215	0.00165	0.112704	3	0.035059	yes	BRNPTM
chr1_1957760_T_C_b38	PLEKHN1	3.215	0.00165	0.112704	3	0.035059	yes	BRNPTM
chr1_591710_A_G_b38	PLEKHN1	-3.174	0.00188	-0.132267	3	0.041669	yes	BRNPTM
chr1_632781_C_T_b38	PLEKHN1	3.155	0.002	0.072989	3	0.023133	yes	BRNPTM
chr1_1009716_C_T_b38	PLEKHN1	-3.115	0.00227	-0.123771	5	0.039733	yes	BRNPTM
chr1_1422280_A_G_b38	PLEKHN1	-3.078	0.00254	-0.140487	3	0.045639	yes	BRNPTM
chr1_643358_G_A_b38	PLEKHN1	-3.038	0.00288	-0.084156	5	0.0277	yes	BRNPTM
chr1_904561_TCCTCCTCCGAACGTGG_T_b38	PLEKHN1	2.976	0.00349	0.072985	4	0.024525	yes	BRNPTM
chr1_633443_C_T_b38	PLEKHN1	2.966	0.0036	0.068612	3	0.023134	yes	BRNPTM
chr1_633444_C_T_b38	PLEKHN1	2.966	0.0036	0.068612	3	0.023134	yes	BRNPTM
chr1_1630225_CGCAGCTCCCTGCTCCCCG_C_b38	PLEKHN1	2.936	0.00393	0.127537	3	0.043433	yes	BRNPTM
chr1_1461195_T_TC_b38	PLEKHN1	-2.894	0.00447	-0.111893	5	0.03867	yes	BRNPTM
chr1_633420_G_A_b38	PLEKHN1	2.871	0.00479	0.066222	3	0.023067	yes	BRNPTM
chr1_272505_C_G_b38	PLEKHN1	2.802	0.00586	0.07371	10	0.026303	yes	BRNPTM
chr1_904531_C_T_b38	PLEKHN1	2.788	0.00611	0.063105	5	0.022638	yes	BRNPTM
chr1_1012158_C_T_b38	PLEKHN1	-2.679	0.00834	-0.08938	5	0.033358	yes	BRNPTM
chr1_928131_T_C_b38	PLEKHN1	-2.665	0.00869	-0.059217	4	0.022224	yes	BRNPTM
chr1_596697_ACATTCATGCTCACTCATACACACCCAGATCATATATACACTCGTGCACACATTCACACTCATACACACCCAAATCATACTCACATTCATGCACACATGTT_A_b38	PLEKHN1	-2.646	0.00915	-0.104756	3	0.039584	yes	BRNPTM
chr1_904532_GGCC_G_b38	PLEKHN1	2.643	0.00923	0.060182	5	0.022767	yes	BRNPTM
chr1_1174174_G_C_b38	PLEKHN1	-2.628	0.00963	-0.064945	4	0.024713	yes	BRNPTM
chr1_629218_A_G_b38	PLEKHN1	-5.578	1.37e-07	-0.227688	3	0.040817	no	BRNPTM
chr1_1469469_G_C_b38	PLEKHN1	-5.162	9e-07	-0.202026	3	0.039137	no	BRNPTM
chr1_1468062_A_T_b38	PLEKHN1	-5.142	9.82e-07	-0.19502	4	0.037924	no	BRNPTM
chr1_633678_C_T_b38	PLEKHN1	5.111	1.13e-06	0.123079	4	0.024081	no	BRNPTM
chr1_1468254_T_A_b38	PLEKHN1	-4.634	8.65e-06	-0.178724	3	0.038567	no	BRNPTM
chr1_1502507_A_T_b38	PLEKHN1	4.523	1.37e-05	0.17363	3	0.038389	no	BRNPTM
chr1_1521298_C_CA_b38	PLEKHN1	4.487	1.58e-05	0.123632	5	0.027553	no	BRNPTM
chr1_1485282_A_G_b38	PLEKHN1	-4.288	3.5e-05	-0.192799	3	0.044961	no	BRNPTM
chr1_1522875_T_G_b38	PLEKHN1	-3.828	0.000201	-0.158633	3	0.041442	no	BRNPTM
chr1_633329_A_G_b38	PLEKHN1	3.827	0.000201	0.087688	4	0.022914	no	BRNPTM
chr1_1739115_T_C_b38	PLEKHN1	3.802	0.00022	0.143733	4	0.037802	no	BRNPTM
chr1_1468048_A_G_b38	PLEKHN1	-3.795	0.000226	-0.112565	7	0.029661	no	BRNPTM
chr1_1468856_C_T_b38	PLEKHN1	-3.659	0.000368	-0.105328	5	0.028788	no	BRNPTM
chr1_633636_C_T_b38	PLEKHN1	3.658	0.000369	0.082739	4	0.022618	no	BRNPTM
chr1_1486354_G_C_b38	PLEKHN1	-3.629	0.000409	-0.157316	3	0.043352	no	BRNPTM
chr1_667265_C_T_b38	PLEKHN1	-3.607	0.000441	-0.117633	5	0.032608	no	BRNPTM
chr1_633032_T_C_b38	PLEKHN1	3.561	0.000517	0.079388	4	0.022291	no	BRNPTM
chr1_633071_C_T_b38	PLEKHN1	3.561	0.000517	0.079388	4	0.022291	no	BRNPTM
chr1_633098_C_T_b38	PLEKHN1	3.561	0.000517	0.079388	4	0.022291	no	BRNPTM
chr1_633182_A_G_b38	PLEKHN1	3.561	0.000517	0.079388	4	0.022291	no	BRNPTM
chr1_633251_C_T_b38	PLEKHN1	3.561	0.000517	0.079388	4	0.022291	no	BRNPTM
chr1_633264_T_C_b38	PLEKHN1	3.561	0.000517	0.079388	4	0.022291	no	BRNPTM
chr1_633290_T_C_b38	PLEKHN1	3.561	0.000517	0.079388	4	0.022291	no	BRNPTM
chr1_633293_A_G_b38	PLEKHN1	3.561	0.000517	0.079388	4	0.022291	no	BRNPTM
chr1_633375_G_A_b38	PLEKHN1	3.546	0.000546	0.079561	4	0.022437	no	BRNPTM
chr1_633209_T_C_b38	PLEKHN1	3.546	0.000547	0.078967	4	0.022272	no	BRNPTM
chr1_633230_C_T_b38	PLEKHN1	3.546	0.000547	0.078967	4	0.022272	no	BRNPTM
chr1_1206176_G_C_b38	PLEKHN1	-3.475	0.000697	-0.111284	3	0.032028	no	BRNPTM
chr1_1206343_A_G_b38	PLEKHN1	-3.475	0.000697	-0.111284	3	0.032028	no	BRNPTM
chr1_1206770_G_A_b38	PLEKHN1	-3.475	0.000697	-0.111284	3	0.032028	no	BRNPTM
chr1_1022587_T_TTGTAGTCTGACCTGTGGTCTGAC_b38	PLEKHN1	-3.388	0.000934	-0.155278	3	0.045831	no	BRNPTM
chr1_633574_A_G_b38	PLEKHN1	3.376	0.000972	0.077479	3	0.02295	no	BRNPTM
chr1_264730_T_A_b38	PLEKHN1	3.368	0.001	0.120572	8	0.035803	no	BRNPTM
chr1_1468094_G_C_b38	PLEKHN1	-3.33	0.00113	-0.096476	7	0.028973	no	BRNPTM
chr1_933601_C_T_b38	PLEKHN1	3.327	0.00115	0.133251	6	0.040056	no	BRNPTM
chr1_1514211_A_G_b38	PLEKHN1	3.179	0.00185	0.118258	3	0.037198	no	BRNPTM
chr1_1523574_C_T_b38	PLEKHN1	-3.169	0.00191	-0.133266	3	0.042059	no	BRNPTM
chr1_633588_T_C_b38	PLEKHN1	3.145	0.00206	0.069775	4	0.022188	no	BRNPTM
chr1_633553_A_G_b38	PLEKHN1	3.108	0.00232	0.069047	4	0.022214	no	BRNPTM
chr1_1468592_C_CG_b38	PLEKHN1	-3.097	0.0024	-0.086198	8	0.027829	no	BRNPTM
chr1_633561_A_G_b38	PLEKHN1	3.053	0.00275	0.068051	4	0.022288	no	BRNPTM
chr1_1494105_G_A_b38	PLEKHN1	-3.05	0.00278	-0.124083	4	0.040688	no	BRNPTM
chr1_1495205_G_A_b38	PLEKHN1	-3.05	0.00278	-0.124083	4	0.040688	no	BRNPTM
chr1_1495221_G_A_b38	PLEKHN1	-3.05	0.00278	-0.124083	4	0.040688	no	BRNPTM
chr1_1495222_T_G_b38	PLEKHN1	-3.05	0.00278	-0.124083	4	0.040688	no	BRNPTM
chr1_1495236_T_C_b38	PLEKHN1	-3.05	0.00278	-0.124083	4	0.040688	no	BRNPTM
chr1_1495327_C_T_b38	PLEKHN1	-3.05	0.00278	-0.124083	4	0.040688	no	BRNPTM
chr1_1324134_G_GGCTGGGGGGCTGGGAGGCTGAGAGGCTGGGGAGCTGGGGA_b38	PLEKHN1	2.858	0.00498	0.113767	3	0.039813	no	BRNPTM
chr1_1351517_G_C_b38	PLEKHN1	-2.8	0.0059	-0.072566	7	0.025921	no	BRNPTM
chr1_1473089_T_C_b38	PLEKHN1	-2.655	0.00894	-0.07053	9	0.026568	no	BRNPTM
chr1_1499339_T_C_b38	PLEKHN1	2.64	0.00931	0.090675	3	0.034345	no	BRNPTM
chr1_632487_A_G_b38	PLEKHN1	2.639	0.00933	0.088412	5	0.033498	no	BRNPTM
chr1_1470034_T_C_b38	PLEKHN1	-2.629	0.0096	-0.078019	9	0.029676	no	BRNPTM
chr1_1471144_G_C_b38	PLEKHN1	-2.629	0.0096	-0.078019	9	0.029676	no	BRNPTM
chr1_1469429_A_G_b38	PLEKHN1	-2.622	0.00978	-0.078179	9	0.029811	no	BRNPTM
chr1_925308_G_A_b38	PLEKHN1	3.834	0.00022	0.05029	10	0.013116	yes	BRNSPC
chr1_925036_G_A_b38	PLEKHN1	3.704	0.000348	0.051626	8	0.013939	yes	BRNSPC
chr1_926250_G_A_b38	PLEKHN1	3.704	0.000348	0.051626	8	0.013939	yes	BRNSPC
chr1_927486_C_T_b38	PLEKHN1	3.681	0.000377	0.051436	8	0.013973	yes	BRNSPC
chr1_909894_G_T_b38	PLEKHN1	-3.551	0.000586	-0.050633	8	0.014258	yes	BRNSPC
chr1_975555_G_A_b38	PLEKHN1	-3.448	0.000829	-0.050939	3	0.014776	yes	BRNSPC
chr1_931558_G_A_b38	PLEKHN1	-3.213	0.00177	-0.043387	4	0.013503	yes	BRNSPC
chr1_929558_G_A_b38	PLEKHN1	3.07	0.00276	0.042622	9	0.013884	yes	BRNSPC
chr1_973929_T_C_b38	PLEKHN1	-3.068	0.00277	-0.043986	6	0.014337	yes	BRNSPC
chr1_285882_A_G_b38	PLEKHN1	-3.064	0.00281	-0.02915	34	0.009514	yes	BRNSPC
chr1_928622_G_C_b38	PLEKHN1	-3	0.00341	-0.043411	3	0.014472	yes	BRNSPC
chr1_924305_G_A_b38	PLEKHN1	-2.917	0.00437	-0.042118	3	0.014441	yes	BRNSPC
chr1_929839_G_A_b38	PLEKHN1	-2.916	0.00438	-0.04097	4	0.01405	yes	BRNSPC
chr1_281912_C_G_b38	PLEKHN1	2.662	0.00904	0.035208	9	0.013225	yes	BRNSPC
chr1_1674633_C_CA_b38	PLEKHN1	-2.641	0.00959	-0.031012	14	0.011741	yes	BRNSPC
chr1_923421_A_G_b38	PLEKHN1	3.499	7e-04	0.047582	9	0.0136	no	BRNSPC
chr1_910558_G_A_b38	PLEKHN1	-3.449	0.000826	-0.047514	9	0.013778	no	BRNSPC
chr1_923311_TG_T_b38	PLEKHN1	3.415	0.000922	0.04666	9	0.013662	no	BRNSPC
chr1_911018_G_A_b38	PLEKHN1	-3.304	0.00132	-0.045917	8	0.013895	no	BRNSPC
chr1_973443_G_A_b38	PLEKHN1	-3.153	0.00213	-0.043513	6	0.013798	no	BRNSPC
chr1_911428_C_T_b38	PLEKHN1	-3.137	0.00224	-0.04275	8	0.013629	no	BRNSPC
chr1_915824_G_C_b38	PLEKHN1	-3.134	0.00227	-0.042929	6	0.013699	no	BRNSPC
chr1_911484_G_C_b38	PLEKHN1	-3.089	0.0026	-0.042142	8	0.013643	no	BRNSPC
chr1_910698_C_T_b38	PLEKHN1	-3.041	0.00301	-0.042947	5	0.014124	no	BRNSPC
chr1_912111_G_A_b38	PLEKHN1	-2.941	0.00406	-0.040654	6	0.013823	no	BRNSPC
chr1_913065_G_A_b38	PLEKHN1	-2.941	0.00406	-0.040654	6	0.013823	no	BRNSPC
chr1_913076_A_G_b38	PLEKHN1	-2.941	0.00406	-0.040654	6	0.013823	no	BRNSPC
chr1_911848_C_T_b38	PLEKHN1	-2.91	0.00446	-0.041618	5	0.014302	no	BRNSPC
chr1_917378_G_C_b38	PLEKHN1	-2.895	0.00466	-0.040258	5	0.013906	no	BRNSPC
chr1_914682_A_T_b38	PLEKHN1	-2.879	0.00488	-0.040619	5	0.01411	no	BRNSPC
chr1_921056_TG_T_b38	PLEKHN1	-2.846	0.00537	-0.041551	4	0.014601	no	BRNSPC
chr1_282616_G_GA_b38	PLEKHN1	2.838	0.0055	0.040328	4	0.014212	no	BRNSPC
chr1_922660_C_A_b38	PLEKHN1	-2.809	0.00598	-0.039198	4	0.013956	no	BRNSPC
chr1_922671_C_T_b38	PLEKHN1	-2.809	0.00598	-0.039198	4	0.013956	no	BRNSPC
chr1_912710_G_A_b38	PLEKHN1	-2.8	0.00613	-0.038418	5	0.01372	no	BRNSPC
chr1_913358_C_T_b38	PLEKHN1	-2.8	0.00613	-0.038418	5	0.01372	no	BRNSPC
chr1_914743_C_T_b38	PLEKHN1	-2.8	0.00613	-0.038418	5	0.01372	no	BRNSPC
chr1_917284_C_T_b38	PLEKHN1	-2.8	0.00613	-0.038418	5	0.01372	no	BRNSPC
chr1_915810_G_A_b38	PLEKHN1	-2.74	0.00728	-0.038588	5	0.014083	no	BRNSPC
chr1_918870_A_G_b38	PLEKHN1	-2.701	0.00811	-0.036348	6	0.013455	no	BRNSPC
chr1_913274_TG_T_b38	PLEKHN1	-2.669	0.00887	-0.037626	5	0.014095	no	BRNSPC
chr1_917859_A_G_b38	PLEKHN1	-2.669	0.00887	-0.037626	5	0.014095	no	BRNSPC
chr1_1834667_C_CT_b38	PLEKHN1	3.609	0.00051	0.037063	12	0.010269	yes	BRNSNG
chr1_890030_G_A_b38	PLEKHN1	-3.263	0.00157	-0.031999	12	0.009806	yes	BRNSNG
chr1_1810535_CA_C_b38	PLEKHN1	3.209	0.00186	0.036787	11	0.011465	yes	BRNSNG
chr1_1284107_T_G_b38	PLEKHN1	3.078	0.00278	0.048957	4	0.015903	yes	BRNSNG
chr1_826420_A_T_b38	PLEKHN1	-2.948	0.00409	-0.031684	10	0.010747	yes	BRNSNG
chr1_613200_TG_T_b38	PLEKHN1	3.593	0.000537	0.045406	6	0.012636	no	BRNSNG
chr1_1750589_G_A_b38	PLEKHN1	3.32	0.00131	0.05527	3	0.016647	no	BRNSNG
chr1_1712515_T_A_b38	PLEKHN1	-2.98	0.00372	-0.036984	4	0.012409	no	BRNSNG
chr1_826431_G_A_b38	PLEKHN1	-2.779	0.00667	-0.03274	8	0.011782	no	BRNSNG
chr1_1634663_C_G_b38	PLEKHN1	-2.707	0.00815	-0.039657	6	0.014649	no	BRNSNG
chr1_727717_G_C_b38	PLEKHN1	-2.661	0.00927	-0.04138	4	0.015553	no	BRNSNG
chr1_981282_A_C_b38	PLEKHN1	-4.284	2.42e-05	-0.083242	7	0.019433	yes	BREAST
chr1_978230_G_A_b38	PLEKHN1	-4.179	3.77e-05	-0.08104	7	0.019393	yes	BREAST
chr1_959193_G_A_b38	PLEKHN1	4.091	5.43e-05	0.096404	27	0.023567	yes	BREAST
chr1_965350_G_A_b38	PLEKHN1	4.053	6.34e-05	0.097864	23	0.024148	yes	BREAST
chr1_939779_AGCCAGTGGACGCCGACCT_A_b38	PLEKHN1	3.857	0.000139	0.058383	65	0.015138	yes	BREAST
chr1_966179_G_A_b38	PLEKHN1	3.707	0.000247	0.089181	22	0.024058	yes	BREAST
chr1_967865_A_G_b38	PLEKHN1	3.581	0.000395	0.050702	102	0.014159	yes	BREAST
chr1_969750_ATG_A_b38	PLEKHN1	3.58	0.000396	0.051065	101	0.014263	yes	BREAST
chr1_1174690_G_A_b38	PLEKHN1	3.544	0.000452	0.093288	4	0.026323	yes	BREAST
chr1_1113195_CA_C_b38	PLEKHN1	-3.534	0.000468	-0.054763	37	0.015495	yes	BREAST
chr1_960326_G_A_b38	PLEKHN1	3.444	0.000649	0.076101	26	0.022098	yes	BREAST
chr1_940390_A_G_b38	PLEKHN1	3.416	0.000717	0.051241	89	0.015001	yes	BREAST
chr1_1124975_G_C_b38	PLEKHN1	-3.347	0.000911	-0.048853	52	0.014594	yes	BREAST
chr1_962358_C_T_b38	PLEKHN1	-3.312	0.00103	-0.094705	5	0.028596	yes	BREAST
chr1_962184_T_C_b38	PLEKHN1	3.307	0.00105	0.094331	5	0.028521	yes	BREAST
chr1_960375_A_AG_b38	PLEKHN1	3.303	0.00106	0.072185	26	0.021854	yes	BREAST
chr1_1056425_GCGGGTA_G_b38	PLEKHN1	3.274	0.00117	0.065919	5	0.020133	yes	BREAST
chr1_965125_G_C_b38	PLEKHN1	-3.233	0.00135	-0.056934	17	0.017612	yes	BREAST
chr1_958251_A_G_b38	PLEKHN1	3.218	0.00142	0.090804	5	0.028216	yes	BREAST
chr1_954333_C_A_b38	PLEKHN1	3.196	0.00153	0.0898	5	0.0281	yes	BREAST
chr1_954258_G_C_b38	PLEKHN1	3.157	0.00174	0.089252	5	0.02827	yes	BREAST
chr1_989148_C_A_b38	PLEKHN1	3.152	0.00177	0.047122	108	0.014948	yes	BREAST
chr1_1047064_A_G_b38	PLEKHN1	3.027	0.00267	0.064363	14	0.021263	yes	BREAST
chr1_1053552_G_C_b38	PLEKHN1	2.937	0.00355	0.055543	25	0.018911	yes	BREAST
chr1_172846_T_C_b38	PLEKHN1	-2.903	0.00394	-0.090147	7	0.031048	yes	BREAST
chr1_651032_CATTATTGATATCTTCCTGATATCAAT_C_b38	PLEKHN1	-2.89	0.00411	-0.14558	3	0.050374	yes	BREAST
chr1_1039514_C_T_b38	PLEKHN1	2.876	0.00429	0.060074	17	0.020886	yes	BREAST
chr1_1042400_C_T_b38	PLEKHN1	2.876	0.00429	0.060074	17	0.020886	yes	BREAST
chr1_949046_A_AACAGCAAAG_b38	PLEKHN1	2.871	0.00436	0.08376	5	0.029171	yes	BREAST
chr1_1125786_T_C_b38	PLEKHN1	-2.837	0.00484	-0.042103	52	0.014839	yes	BREAST
chr1_984608_C_CTTCTTTAT_b38	PLEKHN1	-2.786	0.00565	-0.05614	14	0.02015	yes	BREAST
chr1_1124132_T_TACACACCTGAGCACACACACCTGTGC_b38	PLEKHN1	-2.646	0.00855	-0.061149	3	0.023112	yes	BREAST
chr1_139058_C_G_b38	PLEKHN1	2.644	0.00859	0.055018	4	0.020809	yes	BREAST
chr1_1120417_A_G_b38	PLEKHN1	-2.636	0.00879	-0.060121	3	0.022807	yes	BREAST
chr1_1120889_C_T_b38	PLEKHN1	-2.636	0.00879	-0.060121	3	0.022807	yes	BREAST
chr1_1122042_G_C_b38	PLEKHN1	-2.636	0.00879	-0.060121	3	0.022807	yes	BREAST
chr1_1275583_T_C_b38	PLEKHN1	-2.63	0.00895	-0.068658	14	0.026106	yes	BREAST
chr1_914838_T_A_b38	PLEKHN1	2.62	0.00921	0.039582	91	0.015109	yes	BREAST
chr1_1062056_CTCCCTCCCTTGTCCCCGTTCCCTCCG_C_b38	PLEKHN1	2.618	0.00926	0.04743	15	0.018118	yes	BREAST
chr1_968046_C_T_b38	PLEKHN1	-2.602	0.00968	-0.043054	34	0.016544	yes	BREAST
chr1_916657_G_A_b38	PLEKHN1	2.6	0.00975	0.039208	94	0.01508	yes	BREAST
chr1_1069577_G_A_b38	PLEKHN1	2.593	0.00995	0.036446	92	0.014057	yes	BREAST
chr1_1069600_G_A_b38	PLEKHN1	2.593	0.00995	0.036446	92	0.014057	yes	BREAST
chr1_946247_G_A_b38	PLEKHN1	5.009	9.01e-07	0.080214	65	0.016015	no	BREAST
chr1_967384_C_G_b38	PLEKHN1	4.972	1.08e-06	0.077504	70	0.015589	no	BREAST
chr1_965337_CTTAT_C_b38	PLEKHN1	4.833	2.08e-06	0.076563	73	0.015843	no	BREAST
chr1_949171_GAGAA_G_b38	PLEKHN1	4.81	2.31e-06	0.075188	60	0.015632	no	BREAST
chr1_955679_C_T_b38	PLEKHN1	4.81	2.31e-06	0.075188	60	0.015632	no	BREAST
chr1_956565_A_G_b38	PLEKHN1	4.81	2.31e-06	0.075188	60	0.015632	no	BREAST
chr1_960891_C_T_b38	PLEKHN1	4.772	2.76e-06	0.072794	78	0.015253	no	BREAST
chr1_981935_G_A_b38	PLEKHN1	-4.349	1.83e-05	-0.08186	8	0.018823	no	BREAST
chr1_975093_G_A_b38	PLEKHN1	-4.259	2.69e-05	-0.092352	4	0.021683	no	BREAST
chr1_976536_C_T_b38	PLEKHN1	-4.199	3.47e-05	-0.082838	6	0.01973	no	BREAST
chr1_979472_G_C_b38	PLEKHN1	4.093	5.38e-05	0.057925	82	0.014152	no	BREAST
chr1_978509_G_A_b38	PLEKHN1	4.016	7.35e-05	0.056881	79	0.014163	no	BREAST
chr1_982112_C_T_b38	PLEKHN1	-3.942	9.89e-05	-0.077782	6	0.01973	no	BREAST
chr1_979560_T_C_b38	PLEKHN1	3.927	0.000105	0.056188	86	0.014309	no	BREAST
chr1_983004_G_T_b38	PLEKHN1	3.766	0.000197	0.054757	94	0.014541	no	BREAST
chr1_978953_C_G_b38	PLEKHN1	3.739	0.000218	0.052477	76	0.014033	no	BREAST
chr1_982890_C_T_b38	PLEKHN1	-3.666	0.000287	-0.072468	6	0.019766	no	BREAST
chr1_983237_G_A_b38	PLEKHN1	-3.666	0.000287	-0.072468	6	0.019766	no	BREAST
chr1_1473134_C_CTT_b38	PLEKHN1	-3.516	5e-04	-0.12068	5	0.034321	no	BREAST
chr1_1074910_TCACA_T_b38	PLEKHN1	-3.503	0.000525	-0.075136	6	0.021451	no	BREAST
chr1_951408_G_A_b38	PLEKHN1	3.495	0.00054	0.080814	15	0.023122	no	BREAST
chr1_951437_C_T_b38	PLEKHN1	3.495	0.00054	0.080814	15	0.023122	no	BREAST
chr1_931513_T_C_b38	PLEKHN1	3.457	0.000618	0.051587	85	0.014921	no	BREAST
chr1_981454_G_A_b38	PLEKHN1	3.453	0.000628	0.048999	79	0.014191	no	BREAST
chr1_983193_A_G_b38	PLEKHN1	3.437	0.000664	0.048888	79	0.014224	no	BREAST
chr1_966227_C_G_b38	PLEKHN1	3.421	0.000702	0.092825	8	0.02713	no	BREAST
chr1_1059011_G_T_b38	PLEKHN1	3.281	0.00115	0.060328	25	0.01839	no	BREAST
chr1_1074061_G_A_b38	PLEKHN1	-3.27	0.00119	-0.07236	6	0.022126	no	BREAST
chr1_1056344_C_T_b38	PLEKHN1	3.258	0.00124	0.059897	26	0.018385	no	BREAST
chr1_950296_C_A_b38	PLEKHN1	3.234	0.00134	0.09559	4	0.029555	no	BREAST
chr1_952180_A_C_b38	PLEKHN1	3.234	0.00134	0.09559	4	0.029555	no	BREAST
chr1_938178_G_T_b38	PLEKHN1	3.202	0.0015	0.051026	52	0.015937	no	BREAST
chr1_1019479_TG_T_b38	PLEKHN1	3.141	0.00184	0.044109	89	0.014044	no	BREAST
chr1_1017048_G_A_b38	PLEKHN1	3.126	0.00193	0.046571	98	0.014896	no	BREAST
chr1_690060_A_C_b38	PLEKHN1	-3.115	0.002	-0.093023	4	0.029861	no	BREAST
chr1_1004625_A_G_b38	PLEKHN1	-3.11	0.00204	-0.045425	58	0.014607	no	BREAST
chr1_1057472_AAG_A_b38	PLEKHN1	3.105	0.00207	0.056408	26	0.01817	no	BREAST
chr1_1056278_AC_A_b38	PLEKHN1	3.099	0.00211	0.064935	5	0.020956	no	BREAST
chr1_976215_A_G_b38	PLEKHN1	3.09	0.00218	0.052619	26	0.017031	no	BREAST
chr1_984121_G_T_b38	PLEKHN1	3.086	0.00221	0.045002	89	0.014584	no	BREAST
chr1_999842_C_A_b38	PLEKHN1	3.053	0.00245	0.046015	102	0.015072	no	BREAST
chr1_940263_C_G_b38	PLEKHN1	3.024	0.0027	0.05561	15	0.018392	no	BREAST
chr1_1005757_AGCCCCCGCAGCAGT_A_b38	PLEKHN1	3.018	0.00274	0.043898	79	0.014544	no	BREAST
chr1_950669_ACAG_A_b38	PLEKHN1	3.005	0.00287	0.085296	5	0.028389	no	BREAST
chr1_953778_G_C_b38	PLEKHN1	2.997	0.00294	0.089651	4	0.029914	no	BREAST
chr1_953779_A_C_b38	PLEKHN1	2.997	0.00294	0.089651	4	0.029914	no	BREAST
chr1_1083795_C_G_b38	PLEKHN1	2.989	0.00301	0.044487	43	0.014883	no	BREAST
chr1_975555_G_A_b38	PLEKHN1	-2.975	0.00315	-0.054915	15	0.018461	no	BREAST
chr1_942335_C_G_b38	PLEKHN1	2.974	0.00316	0.080801	7	0.027166	no	BREAST
chr1_1747695_A_G_b38	PLEKHN1	2.967	0.00323	0.037192	88	0.012536	no	BREAST
chr1_1055604_G_A_b38	PLEKHN1	2.958	0.00332	0.062305	5	0.02106	no	BREAST
chr1_1056947_C_T_b38	PLEKHN1	2.958	0.00332	0.062305	5	0.02106	no	BREAST
chr1_1019397_C_A_b38	PLEKHN1	2.929	0.00364	0.043896	104	0.014986	no	BREAST
chr1_1043223_CCT_C_b38	PLEKHN1	2.903	0.00395	0.043684	108	0.015047	no	BREAST
chr1_1018572_G_A_b38	PLEKHN1	2.902	0.00397	0.043679	103	0.015053	no	BREAST
chr1_1006159_C_T_b38	PLEKHN1	-2.89	0.00411	-0.042261	59	0.014624	no	BREAST
chr1_995982_G_A_b38	PLEKHN1	-2.888	0.00414	-0.042165	53	0.0146	no	BREAST
chr1_1036800_G_A_b38	PLEKHN1	2.879	0.00425	0.04196	83	0.014574	no	BREAST
chr1_992993_A_G_b38	PLEKHN1	-2.87	0.00438	-0.040978	78	0.014279	no	BREAST
chr1_1027869_C_T_b38	PLEKHN1	2.87	0.00438	0.060218	9	0.020984	no	BREAST
chr1_1055137_C_T_b38	PLEKHN1	2.868	0.0044	0.059505	6	0.02075	no	BREAST
chr1_1005429_C_CA_b38	PLEKHN1	-2.855	0.00457	-0.041699	53	0.014604	no	BREAST
chr1_1005904_C_T_b38	PLEKHN1	-2.855	0.00457	-0.041699	53	0.014604	no	BREAST
chr1_1005954_G_A_b38	PLEKHN1	-2.855	0.00457	-0.041699	53	0.014604	no	BREAST
chr1_1032278_C_T_b38	PLEKHN1	2.855	0.00458	0.043414	103	0.015205	no	BREAST
chr1_1014733_GAAGT_G_b38	PLEKHN1	2.841	0.00478	0.040941	87	0.014411	no	BREAST
chr1_1089890_C_T_b38	PLEKHN1	-2.836	0.00486	-0.070921	3	0.02501	no	BREAST
chr1_1004716_C_T_b38	PLEKHN1	2.834	0.00488	0.041643	85	0.014693	no	BREAST
chr1_1047561_T_C_b38	PLEKHN1	2.816	0.00516	0.059798	19	0.021233	no	BREAST
chr1_1021472_C_T_b38	PLEKHN1	2.816	0.00517	0.041027	84	0.014571	no	BREAST
chr1_1079456_A_G_b38	PLEKHN1	2.815	0.00517	0.037886	96	0.013457	no	BREAST
chr1_961945_G_C_b38	PLEKHN1	2.797	0.00547	0.078293	6	0.027993	no	BREAST
chr1_1067552_C_G_b38	PLEKHN1	2.796	0.00548	0.043392	30	0.015518	no	BREAST
chr1_1015297_T_C_b38	PLEKHN1	2.769	0.00595	0.040289	81	0.014551	no	BREAST
chr1_1086315_A_G_b38	PLEKHN1	2.762	0.00607	0.041947	35	0.015186	no	BREAST
chr1_967617_G_A_b38	PLEKHN1	2.757	0.00616	0.056296	14	0.02042	no	BREAST
chr1_995371_C_G_b38	PLEKHN1	-2.741	0.00647	-0.039621	52	0.014456	no	BREAST
chr1_1025029_G_C_b38	PLEKHN1	2.731	0.00666	0.041218	103	0.015093	no	BREAST
chr1_1016184_A_G_b38	PLEKHN1	-2.731	0.00667	-0.040104	51	0.014687	no	BREAST
chr1_1684789_C_CAAAAAA_b38	PLEKHN1	2.723	0.00682	0.116732	4	0.042868	no	BREAST
chr1_985260_C_T_b38	PLEKHN1	-2.722	0.00685	-0.053138	8	0.019525	no	BREAST
chr1_1074098_G_C_b38	PLEKHN1	2.718	0.00691	0.042679	29	0.0157	no	BREAST
chr1_1014863_A_C_b38	PLEKHN1	-2.712	0.00704	-0.040253	48	0.014842	no	BREAST
chr1_958339_G_A_b38	PLEKHN1	2.707	0.00714	0.073875	6	0.027287	no	BREAST
chr1_1085543_A_AG_b38	PLEKHN1	2.698	0.00733	0.040631	40	0.015057	no	BREAST
chr1_1060101_T_G_b38	PLEKHN1	2.682	0.00769	0.038688	108	0.014425	no	BREAST
chr1_1079877_A_G_b38	PLEKHN1	2.681	0.00771	0.036874	75	0.013753	no	BREAST
chr1_1534913_G_GC_b38	PLEKHN1	-2.68	0.00773	-0.102551	8	0.038263	no	BREAST
chr1_975014_C_T_b38	PLEKHN1	-2.678	0.00778	-0.039205	51	0.014639	no	BREAST
chr1_1056601_A_ACG_b38	PLEKHN1	2.678	0.00778	0.037592	66	0.014038	no	BREAST
chr1_1014228_G_A_b38	PLEKHN1	-2.678	0.00779	-0.039145	55	0.014618	no	BREAST
chr1_1027226_G_A_b38	PLEKHN1	2.669	0.00799	0.038919	89	0.014582	no	BREAST
chr1_1034835_G_C_b38	PLEKHN1	2.664	0.00812	0.039211	87	0.014721	no	BREAST
chr1_1015903_C_T_b38	PLEKHN1	2.66	0.00821	0.038765	81	0.014575	no	BREAST
chr1_1000731_C_T_b38	PLEKHN1	2.658	0.00826	0.039461	88	0.014848	no	BREAST
chr1_995153_C_G_b38	PLEKHN1	-2.649	0.00848	-0.038312	60	0.014465	no	BREAST
chr1_1079746_A_G_b38	PLEKHN1	2.645	0.00857	0.035933	80	0.013586	no	BREAST
chr1_1008307_G_C_b38	PLEKHN1	-2.628	0.009	-0.038868	54	0.01479	no	BREAST
chr1_1015915_C_T_b38	PLEKHN1	2.627	0.00901	0.038113	82	0.014506	no	BREAST
chr1_1081961_G_T_b38	PLEKHN1	2.608	0.00952	0.040472	31	0.015516	no	BREAST
chr1_878714_A_G_b38	PLEKHN1	2.608	0.00953	0.054401	3	0.020861	no	BREAST
chr1_995187_A_G_b38	PLEKHN1	-2.608	0.00954	-0.037822	61	0.014504	no	BREAST
chr1_1008588_C_T_b38	PLEKHN1	2.607	0.00955	0.038789	91	0.014877	no	BREAST
chr1_985597_T_C_b38	PLEKHN1	-2.605	0.00961	-0.051361	8	0.019718	no	BREAST
chr1_1046551_A_G_b38	PLEKHN1	2.605	0.00962	0.052763	16	0.020258	no	BREAST
chr1_1085026_T_C_b38	PLEKHN1	2.6	0.00975	0.038549	44	0.014827	no	BREAST
chr1_998410_G_A_b38	PLEKHN1	2.599	0.00976	0.038607	88	0.014852	no	BREAST
chr1_966179_G_A_b38	PLEKHN1	12.505	1.22e-30	0.21563	27	0.017244	yes	CULTFB
chr1_962358_C_T_b38	PLEKHN1	-10.326	2.2e-22	-0.210082	7	0.020345	yes	CULTFB
chr1_962184_T_C_b38	PLEKHN1	10.174	7.71e-22	0.208221	7	0.020466	yes	CULTFB
chr1_954258_G_C_b38	PLEKHN1	9.808	1.51e-20	0.202412	6	0.020638	yes	CULTFB
chr1_954333_C_A_b38	PLEKHN1	9.77	2.05e-20	0.20201	6	0.020677	yes	CULTFB
chr1_958251_A_G_b38	PLEKHN1	9.751	2.38e-20	0.203484	6	0.020868	yes	CULTFB
chr1_950296_C_A_b38	PLEKHN1	9.576	9.61e-20	0.209606	5	0.02189	yes	CULTFB
chr1_952180_A_C_b38	PLEKHN1	9.576	9.61e-20	0.209606	5	0.02189	yes	CULTFB
chr1_958339_G_A_b38	PLEKHN1	9.568	1.02e-19	0.185926	10	0.019433	yes	CULTFB
chr1_961945_G_C_b38	PLEKHN1	9.283	9.54e-19	0.183964	10	0.019818	yes	CULTFB
chr1_953778_G_C_b38	PLEKHN1	8.999	8.43e-18	0.203283	5	0.022589	yes	CULTFB
chr1_953779_A_C_b38	PLEKHN1	8.999	8.43e-18	0.203283	5	0.022589	yes	CULTFB
chr1_950669_ACAG_A_b38	PLEKHN1	8.738	6.03e-17	0.176322	10	0.020178	yes	CULTFB
chr1_942335_C_G_b38	PLEKHN1	8.558	2.29e-16	0.171438	9	0.020032	yes	CULTFB
chr1_949046_A_AACAGCAAAG_b38	PLEKHN1	8.516	3.13e-16	0.178644	8	0.020978	yes	CULTFB
chr1_965643_T_C_b38	PLEKHN1	8.294	1.57e-15	0.192216	3	0.023175	yes	CULTFB
chr1_951408_G_A_b38	PLEKHN1	8.289	1.63e-15	0.150692	18	0.01818	yes	CULTFB
chr1_951437_C_T_b38	PLEKHN1	8.289	1.63e-15	0.150692	18	0.01818	yes	CULTFB
chr1_960326_G_A_b38	PLEKHN1	8.069	7.85e-15	0.145381	32	0.018018	yes	CULTFB
chr1_960375_A_AG_b38	PLEKHN1	7.812	4.72e-14	0.138991	34	0.017792	yes	CULTFB
chr1_940263_C_G_b38	PLEKHN1	7.077	6.37e-12	0.103048	24	0.01456	yes	CULTFB
chr1_967617_G_A_b38	PLEKHN1	6.849	2.72e-11	0.114631	16	0.016737	yes	CULTFB
chr1_967941_G_A_b38	PLEKHN1	6.178	1.56e-09	0.113239	8	0.018331	yes	CULTFB
chr1_943526_CT_C_b38	PLEKHN1	-4.897	1.4e-06	-0.152642	5	0.031173	yes	CULTFB
chr1_1394752_G_GAA_b38	PLEKHN1	-4.345	1.75e-05	-0.129489	6	0.029801	yes	CULTFB
chr1_1672015_G_C_b38	PLEKHN1	-4.05	6.12e-05	-0.141021	5	0.034821	yes	CULTFB
chr1_966426_G_C_b38	PLEKHN1	-3.841	0.000142	-0.100371	19	0.026135	yes	CULTFB
chr1_1960047_A_G_b38	PLEKHN1	-3.718	0.000228	-0.144036	5	0.038737	yes	CULTFB
chr1_939779_AGCCAGTGGACGCCGACCT_A_b38	PLEKHN1	3.615	0.000337	0.044232	103	0.012235	yes	CULTFB
chr1_1461283_A_G_b38	PLEKHN1	-3.481	0.000553	-0.103956	8	0.029863	yes	CULTFB
chr1_1461362_AT_A_b38	PLEKHN1	-3.481	0.000553	-0.103956	8	0.029863	yes	CULTFB
chr1_955679_C_T_b38	PLEKHN1	3.388	0.000772	0.044298	96	0.013075	yes	CULTFB
chr1_1502507_A_C_b38	PLEKHN1	-3.322	0.000974	-0.099265	8	0.029883	yes	CULTFB
chr1_956565_A_G_b38	PLEKHN1	3.277	0.00114	0.042826	96	0.013069	yes	CULTFB
chr1_949171_GAGAA_G_b38	PLEKHN1	3.27	0.00116	0.042828	97	0.013096	yes	CULTFB
chr1_967865_A_G_b38	PLEKHN1	3.206	0.00145	0.039108	135	0.012198	yes	CULTFB
chr1_960891_C_T_b38	PLEKHN1	3.141	0.00181	0.040465	110	0.012884	yes	CULTFB
chr1_969663_CAT_C_b38	PLEKHN1	3.132	0.00186	0.043581	32	0.013915	yes	CULTFB
chr1_969785_A_G_b38	PLEKHN1	3.128	0.00189	0.08354	20	0.02671	yes	CULTFB
chr1_945259_TC_T_b38	PLEKHN1	3.103	0.00205	0.043497	31	0.014017	yes	CULTFB
chr1_969780_C_T_b38	PLEKHN1	3.078	0.00223	0.05471	31	0.017776	yes	CULTFB
chr1_940390_A_G_b38	PLEKHN1	3.074	0.00225	0.037721	126	0.012271	yes	CULTFB
chr1_928252_C_T_b38	PLEKHN1	-3.003	0.00284	-0.068886	16	0.02294	yes	CULTFB
chr1_1510082_TA_T_b38	PLEKHN1	-2.99	0.00295	-0.070789	4	0.023672	yes	CULTFB
chr1_1461195_T_TC_b38	PLEKHN1	-2.981	0.00304	-0.079114	11	0.026538	yes	CULTFB
chr1_1834667_C_CTT_b38	PLEKHN1	-2.928	0.0036	-0.094135	4	0.032153	yes	CULTFB
chr1_939570_T_TCCCTGGAGGACC_b38	PLEKHN1	2.924	0.00365	0.037826	49	0.012937	yes	CULTFB
chr1_946653_G_A_b38	PLEKHN1	2.874	0.00426	0.041983	26	0.014606	yes	CULTFB
chr1_940296_GCC_G_b38	PLEKHN1	2.834	0.00483	0.033969	92	0.011987	yes	CULTFB
chr1_1288336_T_C_b38	PLEKHN1	2.802	0.00531	0.096848	4	0.03456	yes	CULTFB
chr1_1458730_G_GTT_b38	PLEKHN1	-2.757	0.00609	-0.081345	7	0.029501	yes	CULTFB
chr1_1324174_G_A_b38	PLEKHN1	2.698	0.00725	0.059357	16	0.021997	yes	CULTFB
chr1_1524911_C_T_b38	PLEKHN1	-2.695	0.00732	-0.076455	11	0.028364	yes	CULTFB
chr1_1768171_CA_C_b38	PLEKHN1	-2.648	0.0084	-0.041542	15	0.015685	yes	CULTFB
chr1_1459273_T_C_b38	PLEKHN1	-2.646	0.00846	-0.080397	8	0.030384	yes	CULTFB
chr1_1459283_AC_A_b38	PLEKHN1	-2.646	0.00846	-0.080397	8	0.030384	yes	CULTFB
chr1_941767_G_A_b38	PLEKHN1	2.634	0.00876	0.037857	29	0.014374	yes	CULTFB
chr1_933411_C_T_b38	PLEKHN1	2.62	0.00911	0.081155	6	0.03097	yes	CULTFB
chr1_966227_C_G_b38	PLEKHN1	12.669	2.71e-31	0.244576	10	0.019304	no	CULTFB
chr1_965350_G_A_b38	PLEKHN1	10.882	2.06e-24	0.199972	27	0.018377	no	CULTFB
chr1_959193_G_A_b38	PLEKHN1	10.784	4.74e-24	0.201885	33	0.018721	no	CULTFB
chr1_967376_AC_A_b38	PLEKHN1	5.394	1.16e-07	0.114102	3	0.021153	no	CULTFB
chr1_969377_A_ATG_b38	PLEKHN1	4.429	1.22e-05	0.075781	11	0.017111	no	CULTFB
chr1_928261_G_A_b38	PLEKHN1	-4.351	1.71e-05	-0.083828	13	0.019267	no	CULTFB
chr1_928264_T_C_b38	PLEKHN1	-4.019	6.94e-05	-0.073584	16	0.018308	no	CULTFB
chr1_1461760_C_A_b38	PLEKHN1	-3.819	0.000155	-0.104507	9	0.027367	no	CULTFB
chr1_1020855_G_GGC_b38	PLEKHN1	-3.794	0.00017	-0.130351	5	0.034353	no	CULTFB
chr1_1461767_A_G_b38	PLEKHN1	-3.609	0.000345	-0.100994	9	0.027984	no	CULTFB
chr1_946247_G_A_b38	PLEKHN1	3.541	0.000443	0.046447	101	0.013115	no	CULTFB
chr1_933601_C_T_b38	PLEKHN1	3.49	0.000535	0.096846	24	0.027748	no	CULTFB
chr1_965337_CTTAT_C_b38	PLEKHN1	3.426	0.000674	0.045315	103	0.013227	no	CULTFB
chr1_1530595_C_T_b38	PLEKHN1	-3.334	0.000932	-0.155686	3	0.046692	no	CULTFB
chr1_856883_A_G_b38	PLEKHN1	3.311	0.00101	0.077275	13	0.02334	no	CULTFB
chr1_1461719_G_A_b38	PLEKHN1	-3.234	0.00132	-0.098459	5	0.03044	no	CULTFB
chr1_1468254_T_A_b38	PLEKHN1	-3.181	0.00158	-0.087206	6	0.027418	no	CULTFB
chr1_1469469_G_C_b38	PLEKHN1	-3.181	0.00158	-0.087206	6	0.027418	no	CULTFB
chr1_984608_C_CTTCTTTAT_b38	PLEKHN1	-3.163	0.00167	-0.054235	20	0.017144	no	CULTFB
chr1_965666_ACC_A_b38	PLEKHN1	3.126	0.0019	0.043947	30	0.014058	no	CULTFB
chr1_108030_G_T_b38	PLEKHN1	-3.017	0.00271	-0.077822	4	0.025791	no	CULTFB
chr1_1769737_GA_G_b38	PLEKHN1	-2.941	0.00345	-0.043459	22	0.014775	no	CULTFB
chr1_1460858_G_T_b38	PLEKHN1	-2.913	0.00377	-0.09084	6	0.031185	no	CULTFB
chr1_1460958_G_A_b38	PLEKHN1	-2.913	0.00377	-0.09084	6	0.031185	no	CULTFB
chr1_965125_G_C_b38	PLEKHN1	2.747	0.00628	0.038497	34	0.014016	no	CULTFB
chr1_903551_A_C_b38	PLEKHN1	-2.733	0.00654	-0.046485	13	0.017006	no	CULTFB
chr1_189695_G_A_b38	PLEKHN1	2.641	0.00858	0.06557	3	0.024829	no	CULTFB
chr1_504819_C_T_b38	PLEKHN1	2.631	0.00883	0.083069	3	0.031571	no	CULTFB
chr1_733845_C_CT_b38	PLEKHN1	2.61	0.00939	0.100205	5	0.038398	no	CULTFB
chr1_967384_C_G_b38	PLEKHN1	2.591	0.0099	0.034824	98	0.013439	no	CULTFB
chr1_814016_T_G_b38	PLEKHN1	2.59	0.00994	0.037088	39	0.014321	no	CULTFB
chr1_1965567_C_T_b38	PLEKHN1	-3.671	0.00036	-0.123001	5	0.033503	yes	EBVTLC
chr1_1962899_A_C_b38	PLEKHN1	-3.463	0.000739	-0.118478	5	0.03421	yes	EBVTLC
chr1_1676287_C_T_b38	PLEKHN1	3.152	0.00204	0.105038	5	0.03332	yes	EBVTLC
chr1_1898648_CACACACATAAGTTGGATAT_C_b38	PLEKHN1	-3.035	0.00295	-0.075942	19	0.025024	yes	EBVTLC
chr1_1596173_G_A_b38	PLEKHN1	2.773	0.00644	0.092625	3	0.033404	yes	EBVTLC
chr1_1840043_T_TA_b38	PLEKHN1	-2.731	0.00727	-0.086218	7	0.031576	yes	EBVTLC
chr1_1744121_A_C_b38	PLEKHN1	-2.694	0.00806	-0.09506	17	0.035282	yes	EBVTLC
chr1_933548_A_AG_b38	PLEKHN1	-2.658	0.00893	-0.075362	30	0.028355	yes	EBVTLC
chr1_1892085_G_C_b38	PLEKHN1	-2.649	0.00915	-0.082531	9	0.031155	yes	EBVTLC
chr1_813885_G_A_b38	PLEKHN1	-2.624	0.00982	-0.067369	35	0.025676	yes	EBVTLC
chr1_1726106_AT_A_b38	PLEKHN1	-2.918	0.0042	-0.09244	8	0.03168	no	EBVTLC
chr1_1712515_T_A_b38	PLEKHN1	-2.785	0.00621	-0.08894	10	0.031935	no	EBVTLC
chr1_1919773_C_T_b38	PLEKHN1	2.732	0.00723	0.124291	3	0.045491	no	EBVTLC
chr1_1002415_C_CATTTTT_b38	PLEKHN1	-2.724	0.0074	-0.073052	12	0.026815	no	EBVTLC
chr1_958061_C_CTT_b38	PLEKHN1	2.705	0.00781	0.096788	7	0.035775	no	EBVTLC
chr1_1452797_CAA_C_b38	PLEKHN1	2.693	0.00808	0.097901	4	0.036349	no	EBVTLC
chr1_916753_C_T_b38	PLEKHN1	3.593	0.00039	0.051687	10	0.014385	yes	CLNSGM
chr1_920661_G_A_b38	PLEKHN1	-3.587	0.000399	-0.054243	6	0.015123	yes	CLNSGM
chr1_916119_A_G_b38	PLEKHN1	3.587	0.000399	0.054243	6	0.015123	yes	CLNSGM
chr1_914618_A_G_b38	PLEKHN1	3.553	0.000452	0.054507	5	0.015341	yes	CLNSGM
chr1_1049113_GGC_G_b38	PLEKHN1	-3.195	0.00157	-0.047019	13	0.014718	yes	CLNSGM
chr1_917584_T_G_b38	PLEKHN1	3.182	0.00164	0.046767	10	0.014698	yes	CLNSGM
chr1_1957243_T_C_b38	PLEKHN1	3.155	0.00179	0.067219	8	0.021306	yes	CLNSGM
chr1_1957760_T_C_b38	PLEKHN1	3.155	0.00179	0.067219	8	0.021306	yes	CLNSGM
chr1_911109_T_C_b38	PLEKHN1	3.053	0.0025	0.044044	11	0.014426	yes	CLNSGM
chr1_910958_A_G_b38	PLEKHN1	3.022	0.00276	0.043613	11	0.014433	yes	CLNSGM
chr1_1120024_C_CA_b38	PLEKHN1	3.008	0.00289	0.07303	4	0.024279	yes	CLNSGM
chr1_1922424_T_C_b38	PLEKHN1	2.959	0.00337	0.058771	7	0.01986	yes	CLNSGM
chr1_98993_G_A_b38	PLEKHN1	2.942	0.00355	0.04914	6	0.016704	yes	CLNSGM
chr1_1923278_C_T_b38	PLEKHN1	2.886	0.00422	0.056986	7	0.019743	yes	CLNSGM
chr1_1925075_G_A_b38	PLEKHN1	2.829	0.00503	0.056386	7	0.019931	yes	CLNSGM
chr1_1220377_C_T_b38	PLEKHN1	2.826	0.00507	0.060289	12	0.02133	yes	CLNSGM
chr1_911220_CT_C_b38	PLEKHN1	2.815	0.00524	0.041408	8	0.014708	yes	CLNSGM
chr1_1943993_C_A_b38	PLEKHN1	2.799	0.00551	0.062443	3	0.022312	yes	CLNSGM
chr1_1922482_T_C_b38	PLEKHN1	2.798	0.00553	0.055567	7	0.01986	yes	CLNSGM
chr1_1923107_C_T_b38	PLEKHN1	2.798	0.00553	0.055567	7	0.01986	yes	CLNSGM
chr1_1923880_C_T_b38	PLEKHN1	2.798	0.00553	0.055567	7	0.01986	yes	CLNSGM
chr1_1925663_A_G_b38	PLEKHN1	2.798	0.00553	0.055567	7	0.01986	yes	CLNSGM
chr1_1926632_G_T_b38	PLEKHN1	2.798	0.00553	0.055567	7	0.01986	yes	CLNSGM
chr1_1926722_C_T_b38	PLEKHN1	2.798	0.00553	0.055567	7	0.01986	yes	CLNSGM
chr1_1927737_T_C_b38	PLEKHN1	2.798	0.00553	0.055567	7	0.01986	yes	CLNSGM
chr1_1928702_C_T_b38	PLEKHN1	2.798	0.00553	0.055567	7	0.01986	yes	CLNSGM
chr1_1929937_C_T_b38	PLEKHN1	2.798	0.00553	0.055567	7	0.01986	yes	CLNSGM
chr1_1919746_G_T_b38	PLEKHN1	2.774	0.00594	0.054539	7	0.019664	yes	CLNSGM
chr1_1919749_A_G_b38	PLEKHN1	2.774	0.00594	0.054539	7	0.019664	yes	CLNSGM
chr1_1385919_A_AG_b38	PLEKHN1	-2.713	0.0071	-0.052674	9	0.019412	yes	CLNSGM
chr1_909903_G_T_b38	PLEKHN1	2.692	0.00756	0.039637	8	0.014724	yes	CLNSGM
chr1_919598_A_C_b38	PLEKHN1	2.671	0.00804	0.029435	62	0.011021	yes	CLNSGM
chr1_1955424_T_C_b38	PLEKHN1	2.633	0.00897	0.075284	7	0.028595	yes	CLNSGM
chr1_1606099_G_C_b38	PLEKHN1	-2.595	0.00999	-0.042113	10	0.016228	yes	CLNSGM
chr1_928309_A_G_b38	PLEKHN1	-4.046	6.85e-05	-0.126059	8	0.031153	no	CLNSGM
chr1_1384749_C_G_b38	PLEKHN1	-3.425	0.000714	-0.051087	23	0.014916	no	CLNSGM
chr1_1387763_CCT_C_b38	PLEKHN1	-3.425	0.000714	-0.051087	23	0.014916	no	CLNSGM
chr1_1388944_G_A_b38	PLEKHN1	-3.425	0.000714	-0.051087	23	0.014916	no	CLNSGM
chr1_1400410_A_G_b38	PLEKHN1	3.425	0.000714	0.051087	23	0.014916	no	CLNSGM
chr1_1376162_G_C_b38	PLEKHN1	-3.383	0.000826	-0.050164	23	0.014827	no	CLNSGM
chr1_1377431_C_T_b38	PLEKHN1	-3.383	0.000826	-0.050164	23	0.014827	no	CLNSGM
chr1_1378204_G_C_b38	PLEKHN1	-3.283	0.00117	-0.047521	25	0.014477	no	CLNSGM
chr1_920949_C_G_b38	PLEKHN1	-3.186	0.00162	-0.047475	7	0.014901	no	CLNSGM
chr1_633846_C_A_b38	PLEKHN1	3.06	0.00244	0.090776	7	0.029662	no	CLNSGM
chr1_659806_T_C_b38	PLEKHN1	2.963	0.00333	0.056152	7	0.018954	no	CLNSGM
chr1_1280044_T_C_b38	PLEKHN1	2.949	0.00348	0.039323	38	0.013337	no	CLNSGM
chr1_1387698_A_G_b38	PLEKHN1	-2.905	0.00398	-0.045866	29	0.015788	no	CLNSGM
chr1_1389827_C_T_b38	PLEKHN1	-2.905	0.00398	-0.045866	29	0.015788	no	CLNSGM
chr1_1394423_A_G_b38	PLEKHN1	2.905	0.00398	0.045866	29	0.015788	no	CLNSGM
chr1_1395346_A_G_b38	PLEKHN1	2.905	0.00398	0.045866	29	0.015788	no	CLNSGM
chr1_1402457_A_G_b38	PLEKHN1	2.905	0.00398	0.045866	29	0.015788	no	CLNSGM
chr1_1380790_G_A_b38	PLEKHN1	-2.831	0.00501	-0.056382	7	0.019919	no	CLNSGM
chr1_1411323_A_C_b38	PLEKHN1	2.81	0.00533	0.04412	29	0.015701	no	CLNSGM
chr1_1366427_AGTGTGATTGAATGAGT_A_b38	PLEKHN1	-2.801	0.00547	-0.040819	24	0.014573	no	CLNSGM
chr1_1331945_G_GC_b38	PLEKHN1	2.796	0.00555	0.062577	6	0.022379	no	CLNSGM
chr1_1381268_C_T_b38	PLEKHN1	-2.784	0.00576	-0.055009	7	0.019757	no	CLNSGM
chr1_1381294_C_T_b38	PLEKHN1	-2.784	0.00576	-0.055009	7	0.019757	no	CLNSGM
chr1_1375288_A_C_b38	PLEKHN1	-2.766	0.00607	-0.054376	7	0.019657	no	CLNSGM
chr1_1375595_C_T_b38	PLEKHN1	-2.766	0.00607	-0.054376	7	0.019657	no	CLNSGM
chr1_1376092_G_A_b38	PLEKHN1	-2.766	0.00607	-0.054376	7	0.019657	no	CLNSGM
chr1_1376336_G_A_b38	PLEKHN1	-2.766	0.00607	-0.054376	7	0.019657	no	CLNSGM
chr1_1379664_G_A_b38	PLEKHN1	-2.766	0.00607	-0.054376	7	0.019657	no	CLNSGM
chr1_1412042_ATCTAGGTCCCAGGTCCCAGGTCCGTCTAGGTCCCAGGTCCG_A_b38	PLEKHN1	2.742	0.00653	0.073236	3	0.026712	no	CLNSGM
chr1_908677_AAGGTGGGAGGGGAGAGGGGAGGGGATGGGGGAGGGAATGAGGGGAC_A_b38	PLEKHN1	-2.721	0.00695	-0.053344	4	0.019607	no	CLNSGM
chr1_1650664_C_CT_b38	PLEKHN1	2.704	0.0073	0.068521	5	0.025341	no	CLNSGM
chr1_919695_C_G_b38	PLEKHN1	2.693	0.00754	0.030058	49	0.011163	no	CLNSGM
chr1_1171093_G_A_b38	PLEKHN1	2.646	0.00864	0.039277	26	0.014844	no	CLNSGM
chr1_1375998_T_A_b38	PLEKHN1	-2.636	0.00888	-0.051576	7	0.019562	no	CLNSGM
chr1_790136_A_AGAATGGAATG_b38	PLEKHN1	2.636	0.00889	0.089224	3	0.03385	no	CLNSGM
chr1_1366561_AGT_A_b38	PLEKHN1	-2.625	0.00917	-0.039958	31	0.015221	no	CLNSGM
chr1_1217168_G_A_b38	PLEKHN1	2.625	0.00919	0.095485	3	0.036381	no	CLNSGM
chr1_1961960_C_G_b38	PLEKHN1	4.67	4.57e-06	0.162129	5	0.034718	yes	CLNTRN
chr1_1961216_G_C_b38	PLEKHN1	4.401	1.51e-05	0.157949	4	0.035892	yes	CLNTRN
chr1_975029_T_C_b38	PLEKHN1	-3.913	0.000113	-0.075171	6	0.019212	yes	CLNTRN
chr1_969785_A_G_b38	PLEKHN1	-3.556	0.000439	-0.091621	18	0.025769	yes	CLNTRN
chr1_1074061_G_A_b38	PLEKHN1	3.321	0.00101	0.068459	6	0.020616	yes	CLNTRN
chr1_1055393_C_T_b38	PLEKHN1	-3.253	0.00127	-0.055959	13	0.017203	yes	CLNTRN
chr1_1055426_G_A_b38	PLEKHN1	-3.253	0.00127	-0.055959	13	0.017203	yes	CLNTRN
chr1_1074910_TCACA_T_b38	PLEKHN1	3.216	0.00145	0.064271	6	0.019987	yes	CLNTRN
chr1_1057460_ATT_A_b38	PLEKHN1	-3.197	0.00154	-0.054706	13	0.017113	yes	CLNTRN
chr1_1573654_T_C_b38	PLEKHN1	3.188	0.00159	0.046654	57	0.014634	yes	CLNTRN
chr1_1574445_A_G_b38	PLEKHN1	3.188	0.00159	0.046654	57	0.014634	yes	CLNTRN
chr1_1036754_C_T_b38	PLEKHN1	-3.179	0.00164	-0.060879	9	0.019153	yes	CLNTRN
chr1_1038078_C_T_b38	PLEKHN1	-3.173	0.00167	-0.063745	7	0.020093	yes	CLNTRN
chr1_1041950_T_C_b38	PLEKHN1	-3.173	0.00167	-0.063745	7	0.020093	yes	CLNTRN
chr1_1055137_C_T_b38	PLEKHN1	-3.124	0.00196	-0.057177	8	0.0183	yes	CLNTRN
chr1_1055604_G_A_b38	PLEKHN1	-3.122	0.00197	-0.058355	7	0.01869	yes	CLNTRN
chr1_1056947_C_T_b38	PLEKHN1	-3.122	0.00197	-0.058355	7	0.01869	yes	CLNTRN
chr1_1045080_G_A_b38	PLEKHN1	-3.101	0.00211	-0.066112	5	0.021316	yes	CLNTRN
chr1_1053552_G_C_b38	PLEKHN1	-3.07	0.00234	-0.052406	24	0.017072	yes	CLNTRN
chr1_1035987_T_C_b38	PLEKHN1	-3.047	0.00252	-0.064652	5	0.021215	yes	CLNTRN
chr1_966426_G_C_b38	PLEKHN1	3.031	0.00265	0.076993	20	0.025401	yes	CLNTRN
chr1_1574032_AAAG_A_b38	PLEKHN1	2.991	0.00302	0.046783	34	0.015643	yes	CLNTRN
chr1_1026447_G_A_b38	PLEKHN1	-2.978	0.00314	-0.057342	16	0.019255	yes	CLNTRN
chr1_1039282_G_T_b38	PLEKHN1	-2.937	0.00357	-0.062977	5	0.021443	yes	CLNTRN
chr1_962358_C_T_b38	PLEKHN1	-2.933	0.00362	-0.069881	6	0.023828	yes	CLNTRN
chr1_1053123_A_T_b38	PLEKHN1	-2.932	0.00363	-0.056751	20	0.019357	yes	CLNTRN
chr1_1056278_AC_A_b38	PLEKHN1	-2.931	0.00364	-0.054687	7	0.018659	yes	CLNTRN
chr1_1569180_T_A_b38	PLEKHN1	2.923	0.00373	0.041294	61	0.014127	yes	CLNTRN
chr1_591452_G_C_b38	PLEKHN1	-2.908	0.00391	-0.080618	4	0.027719	yes	CLNTRN
chr1_1096804_A_G_b38	PLEKHN1	-2.893	0.0041	-0.043996	24	0.015208	yes	CLNTRN
chr1_962184_T_C_b38	PLEKHN1	2.88	0.00427	0.068241	6	0.023697	yes	CLNTRN
chr1_969780_C_T_b38	PLEKHN1	-2.861	0.00452	-0.056753	25	0.019835	yes	CLNTRN
chr1_1051063_C_T_b38	PLEKHN1	-2.856	0.0046	-0.055522	19	0.019443	yes	CLNTRN
chr1_1575724_G_C_b38	PLEKHN1	2.855	0.0046	0.041419	55	0.014506	yes	CLNTRN
chr1_1101437_T_C_b38	PLEKHN1	2.789	0.00563	0.042595	25	0.015272	yes	CLNTRN
chr1_1101667_C_T_b38	PLEKHN1	2.789	0.00563	0.042595	25	0.015272	yes	CLNTRN
chr1_1452797_CAA_C_b38	PLEKHN1	2.757	0.0062	0.04706	16	0.017071	yes	CLNTRN
chr1_1575421_C_T_b38	PLEKHN1	2.756	0.0062	0.039491	56	0.014327	yes	CLNTRN
chr1_1051820_C_T_b38	PLEKHN1	-2.747	0.00638	-0.052872	20	0.019247	yes	CLNTRN
chr1_807433_C_T_b38	PLEKHN1	2.744	0.00643	0.093782	7	0.034172	yes	CLNTRN
chr1_1047133_T_C_b38	PLEKHN1	-2.729	0.00674	-0.060808	4	0.022285	yes	CLNTRN
chr1_1538787_A_G_b38	PLEKHN1	2.728	0.00675	0.039196	62	0.014367	yes	CLNTRN
chr1_1573079_A_G_b38	PLEKHN1	2.709	0.00715	0.038389	62	0.014172	yes	CLNTRN
chr1_1930002_T_C_b38	PLEKHN1	2.691	0.00753	0.062347	8	0.023169	yes	CLNTRN
chr1_1052290_T_G_b38	PLEKHN1	-2.687	0.00762	-0.057736	5	0.021487	yes	CLNTRN
chr1_1916092_C_T_b38	PLEKHN1	2.678	0.00781	0.060597	10	0.022624	yes	CLNTRN
chr1_1096160_A_G_b38	PLEKHN1	-2.663	0.00818	-0.041257	22	0.015495	yes	CLNTRN
chr1_1559750_C_CAG_b38	PLEKHN1	2.655	0.00836	0.037721	63	0.014207	yes	CLNTRN
chr1_1561628_T_C_b38	PLEKHN1	2.655	0.00836	0.037721	63	0.014207	yes	CLNTRN
chr1_1563918_A_G_b38	PLEKHN1	2.655	0.00836	0.037721	63	0.014207	yes	CLNTRN
chr1_1565561_A_G_b38	PLEKHN1	2.655	0.00836	0.037721	63	0.014207	yes	CLNTRN
chr1_1566086_G_A_b38	PLEKHN1	2.655	0.00836	0.037721	63	0.014207	yes	CLNTRN
chr1_1567715_G_A_b38	PLEKHN1	2.655	0.00836	0.037721	63	0.014207	yes	CLNTRN
chr1_1567719_A_C_b38	PLEKHN1	2.655	0.00836	0.037721	63	0.014207	yes	CLNTRN
chr1_1569875_C_T_b38	PLEKHN1	2.655	0.00836	0.037721	63	0.014207	yes	CLNTRN
chr1_1572532_A_C_b38	PLEKHN1	2.655	0.00836	0.037721	63	0.014207	yes	CLNTRN
chr1_1570294_CA_C_b38	PLEKHN1	2.641	0.0087	0.038427	59	0.014549	yes	CLNTRN
chr1_1919773_C_T_b38	PLEKHN1	2.625	0.00911	0.059208	9	0.022554	yes	CLNTRN
chr1_784109_C_CATAAT_b38	PLEKHN1	2.616	0.00935	0.061957	9	0.023683	yes	CLNTRN
chr1_1964118_C_T_b38	PLEKHN1	4.887	1.68e-06	0.185832	3	0.038028	no	CLNTRN
chr1_1963619_C_A_b38	PLEKHN1	3.988	8.39e-05	0.149456	4	0.037476	no	CLNTRN
chr1_807808_G_A_b38	PLEKHN1	3.548	0.000452	0.115148	6	0.032458	no	CLNTRN
chr1_1038288_A_G_b38	PLEKHN1	-3.439	0.000666	-0.071758	6	0.020863	no	CLNTRN
chr1_970892_A_C_b38	PLEKHN1	-3.353	0.000902	-0.072531	5	0.021629	no	CLNTRN
chr1_1047614_T_C_b38	PLEKHN1	-3.336	0.000958	-0.06733	11	0.020183	no	CLNTRN
chr1_1062056_CTCCCTCCCTTGTCCCCGTTCCCTCCG_C_b38	PLEKHN1	-3.158	0.00175	-0.052137	17	0.016512	no	CLNTRN
chr1_1450193_C_T_b38	PLEKHN1	3.084	0.00223	0.07412	7	0.024033	no	CLNTRN
chr1_1059011_G_T_b38	PLEKHN1	-3.082	0.00225	-0.052366	22	0.016993	no	CLNTRN
chr1_1056344_C_T_b38	PLEKHN1	-3.002	0.00291	-0.050253	25	0.016738	no	CLNTRN
chr1_1057472_AAG_A_b38	PLEKHN1	-2.998	0.00294	-0.050224	24	0.01675	no	CLNTRN
chr1_1037956_A_G_b38	PLEKHN1	-2.982	0.0031	-0.061713	5	0.020695	no	CLNTRN
chr1_1037997_G_A_b38	PLEKHN1	-2.982	0.0031	-0.061713	5	0.020695	no	CLNTRN
chr1_1038800_G_T_b38	PLEKHN1	-2.982	0.0031	-0.061713	5	0.020695	no	CLNTRN
chr1_1038819_C_T_b38	PLEKHN1	-2.982	0.0031	-0.061713	5	0.020695	no	CLNTRN
chr1_1038845_A_G_b38	PLEKHN1	-2.982	0.0031	-0.061713	5	0.020695	no	CLNTRN
chr1_1038916_A_G_b38	PLEKHN1	-2.982	0.0031	-0.061713	5	0.020695	no	CLNTRN
chr1_1038975_G_A_b38	PLEKHN1	-2.982	0.0031	-0.061713	5	0.020695	no	CLNTRN
chr1_1038976_T_C_b38	PLEKHN1	-2.982	0.0031	-0.061713	5	0.020695	no	CLNTRN
chr1_1039114_G_T_b38	PLEKHN1	-2.982	0.0031	-0.061713	5	0.020695	no	CLNTRN
chr1_1039190_T_G_b38	PLEKHN1	-2.982	0.0031	-0.061713	5	0.020695	no	CLNTRN
chr1_1039753_T_A_b38	PLEKHN1	-2.982	0.0031	-0.061713	5	0.020695	no	CLNTRN
chr1_1040322_A_G_b38	PLEKHN1	-2.982	0.0031	-0.061713	5	0.020695	no	CLNTRN
chr1_1102614_T_TA_b38	PLEKHN1	2.937	0.00357	0.067308	11	0.022915	no	CLNTRN
chr1_1124975_G_C_b38	PLEKHN1	2.894	0.00409	0.038608	54	0.013342	no	CLNTRN
chr1_1035844_A_G_b38	PLEKHN1	-2.885	0.0042	-0.058572	6	0.0203	no	CLNTRN
chr1_1042190_G_A_b38	PLEKHN1	-2.878	0.0043	-0.056369	18	0.019589	no	CLNTRN
chr1_1091327_C_A_b38	PLEKHN1	-2.849	0.0047	-0.037153	72	0.013042	no	CLNTRN
chr1_875916_GCTCCTCCCCCACACTCTCCCACACTCCCCCACACTCCCCCACA_G_b38	PLEKHN1	2.846	0.00473	0.039925	39	0.014027	no	CLNTRN
chr1_1698022_G_A_b38	PLEKHN1	-2.827	0.00502	-0.100289	11	0.035473	no	CLNTRN
chr1_1500729_G_A_b38	PLEKHN1	2.808	0.00531	0.073841	21	0.026296	no	CLNTRN
chr1_1065530_C_T_b38	PLEKHN1	-2.787	0.00567	-0.062522	3	0.022436	no	CLNTRN
chr1_1029468_A_T_b38	PLEKHN1	-2.784	0.00572	-0.055461	7	0.019922	no	CLNTRN
chr1_1919475_A_G_b38	PLEKHN1	2.734	0.00663	0.061608	9	0.022535	no	CLNTRN
chr1_1126414_A_G_b38	PLEKHN1	2.721	0.00689	0.038022	47	0.013972	no	CLNTRN
chr1_1126468_A_G_b38	PLEKHN1	2.721	0.00689	0.038022	47	0.013972	no	CLNTRN
chr1_1565680_A_AG_b38	PLEKHN1	2.702	0.00729	0.037977	60	0.014055	no	CLNTRN
chr1_1047561_T_C_b38	PLEKHN1	-2.688	0.00759	-0.051668	17	0.01922	no	CLNTRN
chr1_1091421_T_A_b38	PLEKHN1	-2.656	0.00832	-0.034527	69	0.012997	no	CLNTRN
chr1_1468048_A_G_b38	PLEKHN1	2.654	0.00838	0.059925	19	0.02258	no	CLNTRN
chr1_1056425_GCGGGTA_G_b38	PLEKHN1	-2.649	0.0085	-0.046659	7	0.017612	no	CLNTRN
chr1_1923278_C_T_b38	PLEKHN1	2.638	0.00877	0.060694	9	0.023005	no	CLNTRN
chr1_1045707_A_G_b38	PLEKHN1	-2.624	0.00913	-0.054618	7	0.020811	no	CLNTRN
chr1_1934821_C_CGTTGTAGGTACGTGTGTACGTGGGTGTTAGGTTGTAGGTACACACGTGTATATGTGGGTGTTAG_b38	PLEKHN1	2.601	0.00977	0.035148	42	0.013515	no	CLNTRN
chr1_917495_C_T_b38	PLEKHN1	2.941	0.00355	0.038713	64	0.013162	yes	ESPGSJ
chr1_734210_G_T_b38	PLEKHN1	-2.867	0.00447	-0.071539	6	0.024954	yes	ESPGSJ
chr1_919397_A_G_b38	PLEKHN1	2.854	0.00464	0.036955	49	0.012947	yes	ESPGSJ
chr1_734153_G_C_b38	PLEKHN1	-2.821	0.00514	-0.07208	3	0.025551	yes	ESPGSJ
chr1_920719_T_G_b38	PLEKHN1	-2.78	0.00581	-0.03599	50	0.012946	yes	ESPGSJ
chr1_920728_A_G_b38	PLEKHN1	-2.78	0.00581	-0.03599	50	0.012946	yes	ESPGSJ
chr1_918574_C_A_b38	PLEKHN1	2.767	0.00605	0.036614	63	0.013235	yes	ESPGSJ
chr1_919695_C_G_b38	PLEKHN1	2.761	0.00616	0.035782	51	0.012961	yes	ESPGSJ
chr1_921096_A_G_b38	PLEKHN1	-2.727	0.00681	-0.036557	56	0.013407	yes	ESPGSJ
chr1_919598_A_C_b38	PLEKHN1	2.659	0.00829	0.035173	64	0.013226	yes	ESPGSJ
chr1_689962_C_T_b38	PLEKHN1	2.654	0.00842	0.043174	6	0.016268	yes	ESPGSJ
chr1_1170732_A_G_b38	PLEKHN1	3.567	0.000427	0.145256	20	0.040728	no	ESPGSJ
chr1_1007746_CTTTTTTTTTTTTTT_C_b38	PLEKHN1	-3.152	0.0018	-0.049779	20	0.015792	no	ESPGSJ
chr1_1714635_A_G_b38	PLEKHN1	-2.975	0.00319	-0.053888	8	0.018112	no	ESPGSJ
chr1_1714638_G_T_b38	PLEKHN1	-2.975	0.00319	-0.053888	8	0.018112	no	ESPGSJ
chr1_1684789_C_CAAAAA_b38	PLEKHN1	-2.896	0.00409	-0.081232	6	0.028054	no	ESPGSJ
chr1_1030889_ATGTGTGTGTGTGCAGTGCATGGTGCTGTGAGATCAGCG_A_b38	PLEKHN1	2.69	0.00759	0.068683	5	0.025535	no	ESPGSJ
chr1_979472_G_C_b38	PLEKHN1	5.329	1.61e-07	0.053741	119	0.010085	yes	ESPMCS
chr1_978509_G_A_b38	PLEKHN1	5.232	2.63e-07	0.052485	118	0.010031	yes	ESPMCS
chr1_978953_C_G_b38	PLEKHN1	5.132	4.37e-07	0.051231	112	0.009983	yes	ESPMCS
chr1_1081817_C_T_b38	PLEKHN1	4.586	5.94e-06	0.045887	132	0.010005	yes	ESPMCS
chr1_1080171_C_T_b38	PLEKHN1	4.461	1.05e-05	0.044677	127	0.010015	yes	ESPMCS
chr1_1072052_G_A_b38	PLEKHN1	4.216	3.04e-05	0.042447	126	0.010069	yes	ESPMCS
chr1_1083182_C_T_b38	PLEKHN1	4.21	3.12e-05	0.042483	126	0.010091	yes	ESPMCS
chr1_1063202_G_C_b38	PLEKHN1	3.992	7.71e-05	0.040928	131	0.010252	yes	ESPMCS
chr1_1905247_C_G_b38	PLEKHN1	3.742	0.000207	0.076191	3	0.020359	yes	ESPMCS
chr1_983747_T_C_b38	PLEKHN1	-3.682	0.000261	-0.046718	19	0.012687	yes	ESPMCS
chr1_1067673_C_T_b38	PLEKHN1	3.681	0.000263	0.038781	98	0.010537	yes	ESPMCS
chr1_1052514_C_CGT_b38	PLEKHN1	3.667	0.000276	0.037988	105	0.010359	yes	ESPMCS
chr1_975058_A_G_b38	PLEKHN1	-3.495	0.000523	-0.079502	6	0.022745	yes	ESPMCS
chr1_1014863_A_C_b38	PLEKHN1	-3.445	0.000627	-0.036267	74	0.010526	yes	ESPMCS
chr1_1067054_C_T_b38	PLEKHN1	3.412	0.000707	0.036842	85	0.010798	yes	ESPMCS
chr1_1892483_A_G_b38	PLEKHN1	3.31	0.00101	0.063186	9	0.019089	yes	ESPMCS
chr1_1069009_T_TC_b38	PLEKHN1	3.3	0.00105	0.034044	100	0.010317	yes	ESPMCS
chr1_264681_A_G_b38	PLEKHN1	3.223	0.00137	0.056301	11	0.01747	yes	ESPMCS
chr1_1919773_C_T_b38	PLEKHN1	-3.171	0.00163	-0.065838	7	0.020762	yes	ESPMCS
chr1_1002745_G_A_b38	PLEKHN1	-3.151	0.00174	-0.039232	22	0.012451	yes	ESPMCS
chr1_996168_G_T_b38	PLEKHN1	-3.143	0.00179	-0.040434	20	0.012866	yes	ESPMCS
chr1_1002192_A_AT_b38	PLEKHN1	-3.125	0.0019	-0.049635	5	0.015882	yes	ESPMCS
chr1_986280_C_T_b38	PLEKHN1	-3.122	0.00192	-0.0408	18	0.013068	yes	ESPMCS
chr1_1063015_A_G_b38	PLEKHN1	3.119	0.00194	0.03633	37	0.011647	yes	ESPMCS
chr1_996254_A_AGGGAGGGCAG_b38	PLEKHN1	-3.115	0.00197	-0.040423	18	0.012978	yes	ESPMCS
chr1_1055393_C_T_b38	PLEKHN1	3.094	0.0021	0.04372	14	0.014129	yes	ESPMCS
chr1_1055426_G_A_b38	PLEKHN1	3.094	0.0021	0.04372	14	0.014129	yes	ESPMCS
chr1_1057460_ATT_A_b38	PLEKHN1	3.09	0.00213	0.043549	14	0.014093	yes	ESPMCS
chr1_997077_G_A_b38	PLEKHN1	-3.09	0.00213	-0.039769	20	0.012871	yes	ESPMCS
chr1_1083795_C_G_b38	PLEKHN1	3.074	0.00224	0.033789	57	0.010991	yes	ESPMCS
chr1_1080437_G_A_b38	PLEKHN1	3.074	0.00225	0.034536	45	0.011235	yes	ESPMCS
chr1_1056704_T_C_b38	PLEKHN1	3.072	0.00226	0.039686	24	0.012919	yes	ESPMCS
chr1_986629_G_A_b38	PLEKHN1	-3.069	0.00229	-0.04026	18	0.013119	yes	ESPMCS
chr1_817341_A_G_b38	PLEKHN1	3.056	0.00238	0.042301	35	0.013841	yes	ESPMCS
chr1_998762_A_AGGGGAGG_b38	PLEKHN1	3.052	0.00242	0.029255	94	0.009586	yes	ESPMCS
chr1_1916092_C_T_b38	PLEKHN1	-3.019	0.00269	-0.062246	8	0.020619	yes	ESPMCS
chr1_1059011_G_T_b38	PLEKHN1	3.014	0.00273	0.041987	25	0.013929	yes	ESPMCS
chr1_690012_T_C_b38	PLEKHN1	-2.997	0.00289	-0.04774	7	0.015932	yes	ESPMCS
chr1_1085543_A_AG_b38	PLEKHN1	2.991	0.00295	0.032785	55	0.010963	yes	ESPMCS
chr1_1056668_C_CGT_b38	PLEKHN1	2.987	0.00298	0.036864	29	0.012341	yes	ESPMCS
chr1_1063661_ATG_A_b38	PLEKHN1	2.981	0.00304	0.031527	98	0.010576	yes	ESPMCS
chr1_1034279_G_A_b38	PLEKHN1	-2.951	0.00335	-0.032759	45	0.011102	yes	ESPMCS
chr1_1086315_A_G_b38	PLEKHN1	2.939	0.00347	0.032342	50	0.011003	yes	ESPMCS
chr1_1919475_A_G_b38	PLEKHN1	-2.931	0.00356	-0.061174	7	0.020869	yes	ESPMCS
chr1_992361_G_A_b38	PLEKHN1	-2.929	0.00358	-0.03811	19	0.01301	yes	ESPMCS
chr1_1143818_T_C_b38	PLEKHN1	-2.921	0.00368	-0.035859	36	0.012277	yes	ESPMCS
chr1_1056714_T_C_b38	PLEKHN1	2.899	0.00394	0.039031	19	0.013465	yes	ESPMCS
chr1_1919746_G_T_b38	PLEKHN1	-2.892	0.00402	-0.059318	8	0.02051	yes	ESPMCS
chr1_1919749_A_G_b38	PLEKHN1	-2.892	0.00402	-0.059318	8	0.02051	yes	ESPMCS
chr1_1918091_T_C_b38	PLEKHN1	-2.891	0.00404	-0.060555	7	0.020946	yes	ESPMCS
chr1_1918305_G_A_b38	PLEKHN1	-2.891	0.00404	-0.060555	7	0.020946	yes	ESPMCS
chr1_1921945_G_A_b38	PLEKHN1	-2.891	0.00404	-0.060555	7	0.020946	yes	ESPMCS
chr1_1924931_G_A_b38	PLEKHN1	-2.891	0.00404	-0.060555	7	0.020946	yes	ESPMCS
chr1_1929558_G_A_b38	PLEKHN1	-2.891	0.00404	-0.060555	7	0.020946	yes	ESPMCS
chr1_1930002_T_C_b38	PLEKHN1	-2.869	0.00433	-0.061284	6	0.021363	yes	ESPMCS
chr1_1053552_G_C_b38	PLEKHN1	2.868	0.00434	0.040668	29	0.014182	yes	ESPMCS
chr1_975093_G_A_b38	PLEKHN1	-2.867	0.00435	-0.04247	9	0.014814	yes	ESPMCS
chr1_1922149_C_T_b38	PLEKHN1	-2.86	0.00445	-0.06011	7	0.021021	yes	ESPMCS
chr1_1143811_T_C_b38	PLEKHN1	-2.853	0.00455	-0.034739	34	0.012178	yes	ESPMCS
chr1_1050070_G_A_b38	PLEKHN1	-2.845	0.00466	-0.030114	102	0.010586	yes	ESPMCS
chr1_1845824_T_TAC_b38	PLEKHN1	-2.843	0.00468	-0.060396	5	0.021242	yes	ESPMCS
chr1_1048767_CAAAAAAAAAAA_C_b38	PLEKHN1	2.842	0.0047	0.031439	101	0.011063	yes	ESPMCS
chr1_1916540_T_C_b38	PLEKHN1	-2.841	0.00471	-0.05975	7	0.021031	yes	ESPMCS
chr1_1916721_A_G_b38	PLEKHN1	-2.841	0.00471	-0.05975	7	0.021031	yes	ESPMCS
chr1_1917393_A_AAC_b38	PLEKHN1	-2.841	0.00471	-0.05975	7	0.021031	yes	ESPMCS
chr1_1921955_T_C_b38	PLEKHN1	-2.841	0.00471	-0.05975	7	0.021031	yes	ESPMCS
chr1_1042813_G_A_b38	PLEKHN1	-2.833	0.00484	-0.040707	15	0.014371	yes	ESPMCS
chr1_1022518_G_T_b38	PLEKHN1	-2.822	0.00499	-0.029622	66	0.010496	yes	ESPMCS
chr1_1065797_G_C_b38	PLEKHN1	2.819	0.00504	0.030713	54	0.010895	yes	ESPMCS
chr1_1069047_G_A_b38	PLEKHN1	2.819	0.00505	0.030465	55	0.010808	yes	ESPMCS
chr1_984608_C_CTTCTTTAT_b38	PLEKHN1	-2.818	0.00505	-0.040458	18	0.014356	yes	ESPMCS
chr1_1933640_C_T_b38	PLEKHN1	-2.817	0.00507	-0.061333	6	0.021771	yes	ESPMCS
chr1_1018652_C_G_b38	PLEKHN1	-2.816	0.00508	-0.030524	54	0.010839	yes	ESPMCS
chr1_1939898_G_A_b38	PLEKHN1	-2.816	0.00509	-0.060376	6	0.02144	yes	ESPMCS
chr1_1922424_T_C_b38	PLEKHN1	-2.816	0.00509	-0.058468	8	0.020762	yes	ESPMCS
chr1_1923107_C_T_b38	PLEKHN1	-2.806	0.00524	-0.057699	8	0.020561	yes	ESPMCS
chr1_1925663_A_G_b38	PLEKHN1	-2.806	0.00524	-0.057699	8	0.020561	yes	ESPMCS
chr1_1926722_C_T_b38	PLEKHN1	-2.806	0.00524	-0.057699	8	0.020561	yes	ESPMCS
chr1_1928702_C_T_b38	PLEKHN1	-2.806	0.00524	-0.057699	8	0.020561	yes	ESPMCS
chr1_1018754_G_A_b38	PLEKHN1	-2.79	0.00551	-0.030361	53	0.010882	yes	ESPMCS
chr1_1939322_T_G_b38	PLEKHN1	-2.785	0.00559	-0.060018	6	0.021552	yes	ESPMCS
chr1_1021740_G_C_b38	PLEKHN1	-2.767	0.0059	-0.030001	54	0.01084	yes	ESPMCS
chr1_1922482_T_C_b38	PLEKHN1	-2.762	0.006	-0.057107	8	0.020677	yes	ESPMCS
chr1_1926632_G_T_b38	PLEKHN1	-2.762	0.006	-0.057107	8	0.020677	yes	ESPMCS
chr1_1927737_T_C_b38	PLEKHN1	-2.762	0.006	-0.057107	8	0.020677	yes	ESPMCS
chr1_1929937_C_T_b38	PLEKHN1	-2.762	0.006	-0.057107	8	0.020677	yes	ESPMCS
chr1_1144486_C_G_b38	PLEKHN1	-2.756	0.0061	-0.0341	34	0.012374	yes	ESPMCS
chr1_1809189_AT_A_b38	PLEKHN1	2.751	0.0062	0.037663	80	0.013691	yes	ESPMCS
chr1_1943993_C_A_b38	PLEKHN1	-2.747	0.00627	-0.059265	6	0.021576	yes	ESPMCS
chr1_1020217_G_T_b38	PLEKHN1	-2.731	0.00657	-0.029669	54	0.010862	yes	ESPMCS
chr1_998741_G_A_b38	PLEKHN1	-2.729	0.00661	-0.035319	21	0.012942	yes	ESPMCS
chr1_1050066_G_T_b38	PLEKHN1	2.723	0.00674	0.030503	71	0.011202	yes	ESPMCS
chr1_1071610_G_A_b38	PLEKHN1	2.719	0.00681	0.031664	39	0.011644	yes	ESPMCS
chr1_1085026_T_C_b38	PLEKHN1	2.718	0.00685	0.029526	58	0.010865	yes	ESPMCS
chr1_1032846_C_A_b38	PLEKHN1	-2.704	0.00712	-0.02941	52	0.010876	yes	ESPMCS
chr1_967865_A_G_b38	PLEKHN1	2.701	0.00719	0.026977	141	0.009987	yes	ESPMCS
chr1_1067552_C_G_b38	PLEKHN1	2.695	0.00732	0.031246	39	0.011594	yes	ESPMCS
chr1_1925075_G_A_b38	PLEKHN1	-2.686	0.00752	-0.055383	8	0.020622	yes	ESPMCS
chr1_1068249_C_T_b38	PLEKHN1	2.659	0.00812	0.029285	56	0.011012	yes	ESPMCS
chr1_975523_T_C_b38	PLEKHN1	-2.657	0.00817	-0.056006	7	0.021077	yes	ESPMCS
chr1_1056662_C_T_b38	PLEKHN1	2.655	0.00822	0.03264	30	0.012292	yes	ESPMCS
chr1_1064776_C_T_b38	PLEKHN1	2.653	0.00829	0.029128	61	0.010981	yes	ESPMCS
chr1_1023351_A_G_b38	PLEKHN1	-2.633	0.00877	-0.027616	67	0.010488	yes	ESPMCS
chr1_1810535_CA_C_b38	PLEKHN1	2.629	0.00887	0.037236	34	0.014163	yes	ESPMCS
chr1_1715541_A_C_b38	PLEKHN1	2.617	0.00918	0.0627	3	0.023957	yes	ESPMCS
chr1_1923880_C_T_b38	PLEKHN1	-2.604	0.00955	-0.053247	8	0.020451	yes	ESPMCS
chr1_1605792_C_G_b38	PLEKHN1	2.592	0.00987	0.061489	5	0.023724	yes	ESPMCS
chr1_1923278_C_T_b38	PLEKHN1	-2.589	0.00996	-0.052903	8	0.020435	yes	ESPMCS
chr1_1812038_G_C_b38	PLEKHN1	2.588	0.01	0.048027	10	0.018561	yes	ESPMCS
chr1_983004_G_T_b38	PLEKHN1	4.852	1.72e-06	0.049537	131	0.01021	no	ESPMCS
chr1_979560_T_C_b38	PLEKHN1	4.796	2.24e-06	0.048732	126	0.010161	no	ESPMCS
chr1_975014_C_T_b38	PLEKHN1	-4.777	2.45e-06	-0.048887	67	0.010233	no	ESPMCS
chr1_981454_G_A_b38	PLEKHN1	4.672	4e-06	0.046942	117	0.010046	no	ESPMCS
chr1_983193_A_G_b38	PLEKHN1	4.672	4e-06	0.046942	117	0.010046	no	ESPMCS
chr1_974039_C_T_b38	PLEKHN1	-4.275	2.36e-05	-0.058637	14	0.013716	no	ESPMCS
chr1_1082764_T_C_b38	PLEKHN1	4.224	2.94e-05	0.042313	125	0.010017	no	ESPMCS
chr1_1070843_G_A_b38	PLEKHN1	4.194	3.33e-05	0.042032	122	0.010021	no	ESPMCS
chr1_1069577_G_A_b38	PLEKHN1	4.187	3.44e-05	0.041882	121	0.010003	no	ESPMCS
chr1_1075707_CG_C_b38	PLEKHN1	4.179	3.55e-05	0.041434	128	0.009914	no	ESPMCS
chr1_1060101_T_G_b38	PLEKHN1	4.168	3.72e-05	0.042813	136	0.010272	no	ESPMCS
chr1_1057980_C_A_b38	PLEKHN1	4.165	3.76e-05	0.043238	133	0.01038	no	ESPMCS
chr1_1069600_G_A_b38	PLEKHN1	4.155	3.93e-05	0.04164	120	0.010022	no	ESPMCS
chr1_971790_AG_A_b38	PLEKHN1	-4.069	5.64e-05	-0.041118	78	0.010106	no	ESPMCS
chr1_1075337_C_T_b38	PLEKHN1	3.988	7.84e-05	0.040041	106	0.01004	no	ESPMCS
chr1_1079746_A_G_b38	PLEKHN1	3.987	7.87e-05	0.040149	106	0.01007	no	ESPMCS
chr1_1073854_T_C_b38	PLEKHN1	3.921	0.000103	0.038922	113	0.009927	no	ESPMCS
chr1_1079877_A_G_b38	PLEKHN1	3.873	0.000125	0.039132	102	0.010105	no	ESPMCS
chr1_1083800_T_C_b38	PLEKHN1	3.811	0.000159	0.037971	105	0.009964	no	ESPMCS
chr1_1081790_C_G_b38	PLEKHN1	3.808	0.000161	0.037941	117	0.009965	no	ESPMCS
chr1_982260_G_A_b38	PLEKHN1	-3.753	0.000199	-0.048966	18	0.013046	no	ESPMCS
chr1_982858_C_G_b38	PLEKHN1	-3.753	0.000199	-0.048966	18	0.013046	no	ESPMCS
chr1_1043223_CCT_C_b38	PLEKHN1	3.731	0.000216	0.039735	125	0.010649	no	ESPMCS
chr1_789680_A_AGGAATGGAATGGAAT_b38	PLEKHN1	3.728	0.000219	0.041408	45	0.011107	no	ESPMCS
chr1_1083324_A_G_b38	PLEKHN1	3.712	0.000233	0.036816	108	0.009919	no	ESPMCS
chr1_1032278_C_T_b38	PLEKHN1	3.674	0.000269	0.03866	134	0.010523	no	ESPMCS
chr1_1057439_G_A_b38	PLEKHN1	3.669	0.000275	0.037153	118	0.010127	no	ESPMCS
chr1_1027226_G_A_b38	PLEKHN1	3.664	0.000279	0.038094	121	0.010396	no	ESPMCS
chr1_1056597_G_A_b38	PLEKHN1	3.648	0.000297	0.035595	142	0.009756	no	ESPMCS
chr1_978230_G_A_b38	PLEKHN1	-3.636	0.000311	-0.047057	19	0.012943	no	ESPMCS
chr1_1079484_T_A_b38	PLEKHN1	3.556	0.000418	0.035233	119	0.009908	no	ESPMCS
chr1_1036800_G_A_b38	PLEKHN1	3.533	0.000456	0.036532	116	0.01034	no	ESPMCS
chr1_1079456_A_G_b38	PLEKHN1	3.53	0.000461	0.034956	126	0.009902	no	ESPMCS
chr1_969663_CAT_C_b38	PLEKHN1	-3.496	0.000521	-0.042948	27	0.012283	no	ESPMCS
chr1_1023851_G_A_b38	PLEKHN1	3.486	0.000542	0.03615	113	0.010371	no	ESPMCS
chr1_1034835_G_C_b38	PLEKHN1	3.47	0.000573	0.036226	118	0.010439	no	ESPMCS
chr1_1004625_A_G_b38	PLEKHN1	-3.422	0.000682	-0.035607	85	0.010406	no	ESPMCS
chr1_995982_G_A_b38	PLEKHN1	-3.414	0.000703	-0.035067	78	0.010273	no	ESPMCS
chr1_1006159_C_T_b38	PLEKHN1	-3.376	0.000802	-0.03512	86	0.010402	no	ESPMCS
chr1_976536_C_T_b38	PLEKHN1	-3.374	0.000809	-0.044419	17	0.013166	no	ESPMCS
chr1_995371_C_G_b38	PLEKHN1	-3.369	0.000822	-0.034786	77	0.010324	no	ESPMCS
chr1_1016184_A_G_b38	PLEKHN1	-3.367	0.00083	-0.035357	79	0.010502	no	ESPMCS
chr1_981282_A_C_b38	PLEKHN1	-3.363	0.000842	-0.043476	19	0.012929	no	ESPMCS
chr1_999842_C_A_b38	PLEKHN1	3.336	0.000925	0.035555	134	0.010659	no	ESPMCS
chr1_1025029_G_C_b38	PLEKHN1	3.323	0.000966	0.035105	130	0.010564	no	ESPMCS
chr1_1056278_AC_A_b38	PLEKHN1	3.311	0.00101	0.050609	8	0.015286	no	ESPMCS
chr1_1847597_T_C_b38	PLEKHN1	3.295	0.00107	0.063359	9	0.019229	no	ESPMCS
chr1_1086657_C_T_b38	PLEKHN1	3.293	0.00107	0.032607	114	0.009902	no	ESPMCS
chr1_1005954_G_A_b38	PLEKHN1	-3.283	0.00111	-0.034714	76	0.010575	no	ESPMCS
chr1_101550_C_T_b38	PLEKHN1	3.281	0.00112	0.043464	32	0.013247	no	ESPMCS
chr1_995153_C_G_b38	PLEKHN1	-3.274	0.00115	-0.034137	82	0.010427	no	ESPMCS
chr1_1862347_A_C_b38	PLEKHN1	3.264	0.00119	0.062089	10	0.019021	no	ESPMCS
chr1_1864048_A_C_b38	PLEKHN1	3.264	0.00119	0.062089	10	0.019021	no	ESPMCS
chr1_1870733_A_G_b38	PLEKHN1	3.264	0.00119	0.062089	10	0.019021	no	ESPMCS
chr1_1874867_A_G_b38	PLEKHN1	3.264	0.00119	0.062089	10	0.019021	no	ESPMCS
chr1_1880926_CA_C_b38	PLEKHN1	3.264	0.00119	0.062089	10	0.019021	no	ESPMCS
chr1_1881389_G_A_b38	PLEKHN1	3.264	0.00119	0.062089	10	0.019021	no	ESPMCS
chr1_1885731_G_A_b38	PLEKHN1	3.264	0.00119	0.062089	10	0.019021	no	ESPMCS
chr1_1887939_T_C_b38	PLEKHN1	3.264	0.00119	0.062089	10	0.019021	no	ESPMCS
chr1_1048791_CAG_C_b38	PLEKHN1	3.264	0.00119	0.03506	109	0.010743	no	ESPMCS
chr1_1841296_T_C_b38	PLEKHN1	3.26	0.0012	0.062142	10	0.019059	no	ESPMCS
chr1_1849439_T_C_b38	PLEKHN1	3.26	0.0012	0.062142	10	0.019059	no	ESPMCS
chr1_1861564_A_G_b38	PLEKHN1	3.26	0.0012	0.062142	10	0.019059	no	ESPMCS
chr1_1861632_A_G_b38	PLEKHN1	3.26	0.0012	0.062142	10	0.019059	no	ESPMCS
chr1_1861672_A_G_b38	PLEKHN1	3.26	0.0012	0.062142	10	0.019059	no	ESPMCS
chr1_995512_T_C_b38	PLEKHN1	-3.259	0.00121	-0.03372	86	0.010348	no	ESPMCS
chr1_995786_A_G_b38	PLEKHN1	-3.257	0.00122	-0.033511	86	0.010289	no	ESPMCS
chr1_1048922_T_C_b38	PLEKHN1	3.252	0.00124	0.032504	122	0.009996	no	ESPMCS
chr1_1005904_C_T_b38	PLEKHN1	-3.251	0.00124	-0.034374	76	0.010572	no	ESPMCS
chr1_1872863_C_T_b38	PLEKHN1	3.233	0.00132	0.06013	11	0.0186	no	ESPMCS
chr1_1074061_G_A_b38	PLEKHN1	-3.223	0.00137	-0.051759	8	0.016058	no	ESPMCS
chr1_1023775_G_A_b38	PLEKHN1	3.217	0.00139	0.033664	120	0.010465	no	ESPMCS
chr1_1005429_C_CA_b38	PLEKHN1	-3.212	0.00142	-0.033871	77	0.010544	no	ESPMCS
chr1_819123_G_A_b38	PLEKHN1	3.201	0.00147	0.043663	31	0.013642	no	ESPMCS
chr1_995187_A_G_b38	PLEKHN1	-3.187	0.00154	-0.033211	84	0.01042	no	ESPMCS
chr1_1017048_G_A_b38	PLEKHN1	3.185	0.00155	0.034146	126	0.010721	no	ESPMCS
chr1_1055604_G_A_b38	PLEKHN1	3.179	0.00159	0.04864	8	0.0153	no	ESPMCS
chr1_1056947_C_T_b38	PLEKHN1	3.179	0.00159	0.04864	8	0.0153	no	ESPMCS
chr1_821000_T_A_b38	PLEKHN1	3.168	0.00164	0.041359	25	0.013053	no	ESPMCS
chr1_1016623_G_A_b38	PLEKHN1	-3.152	0.00174	-0.033743	70	0.010707	no	ESPMCS
chr1_825532_C_T_b38	PLEKHN1	3.131	0.00186	0.04339	23	0.01386	no	ESPMCS
chr1_825767_T_C_b38	PLEKHN1	3.131	0.00186	0.04339	23	0.01386	no	ESPMCS
chr1_1027511_C_T_b38	PLEKHN1	3.13	0.00187	0.032068	112	0.010245	no	ESPMCS
chr1_1008307_G_C_b38	PLEKHN1	-3.129	0.00187	-0.032664	80	0.010439	no	ESPMCS
chr1_982112_C_T_b38	PLEKHN1	-3.129	0.00188	-0.040824	18	0.013048	no	ESPMCS
chr1_819584_C_T_b38	PLEKHN1	3.125	0.0019	0.042861	31	0.013716	no	ESPMCS
chr1_1055137_C_T_b38	PLEKHN1	3.12	0.00193	0.047065	9	0.015083	no	ESPMCS
chr1_1018572_G_A_b38	PLEKHN1	3.115	0.00196	0.033575	128	0.010778	no	ESPMCS
chr1_1049886_C_T_b38	PLEKHN1	3.103	0.00205	0.031536	129	0.010165	no	ESPMCS
chr1_1019397_C_A_b38	PLEKHN1	3.082	0.00219	0.033083	128	0.010733	no	ESPMCS
chr1_826577_A_AT_b38	PLEKHN1	3.081	0.0022	0.042336	24	0.013741	no	ESPMCS
chr1_986336_C_A_b38	PLEKHN1	3.07	0.00228	0.033028	129	0.010758	no	ESPMCS
chr1_1014228_G_A_b38	PLEKHN1	-3.069	0.00229	-0.032048	81	0.010444	no	ESPMCS
chr1_1009184_T_C_b38	PLEKHN1	-3.066	0.00231	-0.032067	79	0.01046	no	ESPMCS
chr1_998410_G_A_b38	PLEKHN1	3.054	0.0024	0.032009	117	0.010483	no	ESPMCS
chr1_824320_T_C_b38	PLEKHN1	3.036	0.00255	0.041098	26	0.013538	no	ESPMCS
chr1_1004111_TG_T_b38	PLEKHN1	-3.033	0.00257	-0.03885	21	0.012809	no	ESPMCS
chr1_984121_G_T_b38	PLEKHN1	3.027	0.00262	0.031293	133	0.010339	no	ESPMCS
chr1_982890_C_T_b38	PLEKHN1	-3.018	0.00269	-0.039429	18	0.013063	no	ESPMCS
chr1_983237_G_A_b38	PLEKHN1	-3.018	0.00269	-0.039429	18	0.013063	no	ESPMCS
chr1_984475_G_A_b38	PLEKHN1	-3.018	0.0027	-0.046409	9	0.015377	no	ESPMCS
chr1_820560_C_T_b38	PLEKHN1	3.012	0.00275	0.039943	29	0.013261	no	ESPMCS
chr1_1008588_C_T_b38	PLEKHN1	3.001	0.00285	0.032309	127	0.010766	no	ESPMCS
chr1_817514_T_C_b38	PLEKHN1	3	0.00286	0.041532	19	0.013844	no	ESPMCS
chr1_1868514_T_C_b38	PLEKHN1	2.999	0.00287	0.061669	5	0.020566	no	ESPMCS
chr1_1000335_C_T_b38	PLEKHN1	-2.994	0.00292	-0.038674	20	0.012919	no	ESPMCS
chr1_1005757_AGCCCCCGCAGCAGT_A_b38	PLEKHN1	2.977	0.00308	0.031403	111	0.010548	no	ESPMCS
chr1_1004716_C_T_b38	PLEKHN1	2.97	0.00314	0.031768	116	0.010695	no	ESPMCS
chr1_989148_C_A_b38	PLEKHN1	2.967	0.00318	0.032037	129	0.010798	no	ESPMCS
chr1_992993_A_G_b38	PLEKHN1	-2.965	0.00319	-0.0296	102	0.009982	no	ESPMCS
chr1_817186_G_A_b38	PLEKHN1	2.961	0.00324	0.041349	27	0.013965	no	ESPMCS
chr1_1000731_C_T_b38	PLEKHN1	2.96	0.00324	0.030892	120	0.010435	no	ESPMCS
chr1_981210_G_A_b38	PLEKHN1	-2.933	0.00354	-0.042456	12	0.014477	no	ESPMCS
chr1_1050063_AG_A_b38	PLEKHN1	-2.931	0.00356	-0.031112	103	0.010615	no	ESPMCS
chr1_19322_C_T_b38	PLEKHN1	2.886	0.0041	0.053167	13	0.018425	no	ESPMCS
chr1_1070689_G_A_b38	PLEKHN1	2.852	0.00456	0.050087	3	0.017564	no	ESPMCS
chr1_1074910_TCACA_T_b38	PLEKHN1	-2.851	0.00456	-0.044613	8	0.015646	no	ESPMCS
chr1_1023789_G_C_b38	PLEKHN1	2.847	0.00463	0.028865	118	0.010139	no	ESPMCS
chr1_1290579_C_G_b38	PLEKHN1	-2.841	0.00471	-0.039288	41	0.01383	no	ESPMCS
chr1_1649954_C_CA_b38	PLEKHN1	2.84	0.00473	0.038471	22	0.013546	no	ESPMCS
chr1_1825782_G_A_b38	PLEKHN1	-2.821	0.00501	-0.060373	5	0.021402	no	ESPMCS
chr1_860178_C_CTTTT_b38	PLEKHN1	-2.801	0.00533	-0.067898	4	0.024243	no	ESPMCS
chr1_1904424_A_AAAATAAATAAAT_b38	PLEKHN1	2.791	0.00549	0.026743	84	0.009581	no	ESPMCS
chr1_1774697_T_C_b38	PLEKHN1	2.788	0.00555	0.053533	9	0.019205	no	ESPMCS
chr1_731666_G_A_b38	PLEKHN1	2.782	0.00565	0.050786	3	0.018257	no	ESPMCS
chr1_981935_G_A_b38	PLEKHN1	-2.777	0.00572	-0.035475	20	0.012773	no	ESPMCS
chr1_1017114_A_AT_b38	PLEKHN1	-2.769	0.00587	-0.03128	55	0.011296	no	ESPMCS
chr1_989068_GTTGA_G_b38	PLEKHN1	2.765	0.00594	0.029376	119	0.010624	no	ESPMCS
chr1_1021472_C_T_b38	PLEKHN1	2.739	0.00642	0.028975	123	0.010578	no	ESPMCS
chr1_1015297_T_C_b38	PLEKHN1	2.731	0.00657	0.029117	116	0.010661	no	ESPMCS
chr1_1774334_A_G_b38	PLEKHN1	2.723	0.00673	0.051638	9	0.018962	no	ESPMCS
chr1_995508_ATTTTT_A_b38	PLEKHN1	2.721	0.00677	0.02884	115	0.010598	no	ESPMCS
chr1_1014733_GAAGT_G_b38	PLEKHN1	2.714	0.00692	0.028709	121	0.010578	no	ESPMCS
chr1_1764135_G_T_b38	PLEKHN1	2.708	0.00705	0.050273	10	0.018566	no	ESPMCS
chr1_1764392_C_T_b38	PLEKHN1	2.708	0.00705	0.050273	10	0.018566	no	ESPMCS
chr1_1765220_A_G_b38	PLEKHN1	2.708	0.00705	0.050273	10	0.018566	no	ESPMCS
chr1_1767368_C_G_b38	PLEKHN1	2.708	0.00705	0.050273	10	0.018566	no	ESPMCS
chr1_591181_T_G_b38	PLEKHN1	2.704	0.00711	0.079585	3	0.029427	no	ESPMCS
chr1_975555_G_A_b38	PLEKHN1	-2.704	0.00712	-0.033368	26	0.01234	no	ESPMCS
chr1_969750_ATG_A_b38	PLEKHN1	2.7	0.00721	0.027285	127	0.010106	no	ESPMCS
chr1_1056425_GCGGGTA_G_b38	PLEKHN1	2.692	0.00738	0.040473	8	0.015034	no	ESPMCS
chr1_968046_C_T_b38	PLEKHN1	-2.687	0.00749	-0.030355	55	0.011298	no	ESPMCS
chr1_1015915_C_T_b38	PLEKHN1	2.686	0.00752	0.028507	120	0.010614	no	ESPMCS
chr1_800909_T_A_b38	PLEKHN1	-2.678	0.0077	-0.040596	5	0.015161	no	ESPMCS
chr1_1074098_G_C_b38	PLEKHN1	2.666	0.00798	0.030821	38	0.011563	no	ESPMCS
chr1_1814717_A_G_b38	PLEKHN1	2.658	0.00816	0.050417	9	0.018969	no	ESPMCS
chr1_1124794_C_T_b38	PLEKHN1	-2.656	0.0082	-0.030976	38	0.011661	no	ESPMCS
chr1_1830575_T_C_b38	PLEKHN1	2.648	0.0084	0.052614	7	0.019872	no	ESPMCS
chr1_1821516_C_T_b38	PLEKHN1	2.641	0.00858	0.048989	10	0.018552	no	ESPMCS
chr1_1022868_A_G_b38	PLEKHN1	-2.602	0.0096	-0.02802	66	0.01077	no	ESPMCS
chr1_1827587_T_C_b38	PLEKHN1	2.597	0.00974	0.050462	9	0.019434	no	ESPMCS
chr1_1829550_A_C_b38	PLEKHN1	2.597	0.00974	0.050462	9	0.019434	no	ESPMCS
chr1_1829897_A_C_b38	PLEKHN1	2.597	0.00974	0.050462	9	0.019434	no	ESPMCS
chr1_1834144_T_C_b38	PLEKHN1	2.597	0.00974	0.050462	9	0.019434	no	ESPMCS
chr1_1834920_A_G_b38	PLEKHN1	2.597	0.00974	0.050462	9	0.019434	no	ESPMCS
chr1_1838619_T_C_b38	PLEKHN1	2.597	0.00974	0.050462	9	0.019434	no	ESPMCS
chr1_940296_G_GCCCCCCC_b38	PLEKHN1	3.258	0.00122	0.094415	5	0.028982	yes	ESPMSL
chr1_194592_G_A_b38	PLEKHN1	-3.032	0.00259	-0.059104	6	0.019496	yes	ESPMSL
chr1_14930_A_G_b38	PLEKHN1	-2.958	0.00328	-0.039572	43	0.013377	yes	ESPMSL
chr1_1132482_T_C_b38	PLEKHN1	2.939	0.00349	0.044046	18	0.014988	yes	ESPMSL
chr1_1112601_G_A_b38	PLEKHN1	2.914	0.00377	0.040565	34	0.013921	yes	ESPMSL
chr1_14464_A_T_b38	PLEKHN1	2.897	0.00398	0.047858	8	0.016521	yes	ESPMSL
chr1_1960609_G_C_b38	PLEKHN1	2.894	0.00402	0.033801	81	0.011681	yes	ESPMSL
chr1_1132196_G_A_b38	PLEKHN1	2.861	0.00445	0.044131	17	0.015428	yes	ESPMSL
chr1_263835_CCT_C_b38	PLEKHN1	-2.785	0.00562	-0.069775	4	0.025056	yes	ESPMSL
chr1_1133503_G_A_b38	PLEKHN1	2.772	0.00584	0.043525	16	0.015704	yes	ESPMSL
chr1_1130420_C_T_b38	PLEKHN1	2.758	0.00609	0.042467	17	0.015399	yes	ESPMSL
chr1_1615015_CA_C_b38	PLEKHN1	-2.726	0.0067	-0.047649	4	0.017479	yes	ESPMSL
chr1_1075707_CG_C_b38	PLEKHN1	-2.703	0.00717	-0.031885	114	0.011796	yes	ESPMSL
chr1_1111365_CAA_C_b38	PLEKHN1	-2.676	0.00777	-0.045908	9	0.017158	yes	ESPMSL
chr1_1103993_C_CT_b38	PLEKHN1	-2.647	0.00844	-0.040887	18	0.015444	yes	ESPMSL
chr1_1083182_C_T_b38	PLEKHN1	-2.646	0.00847	-0.03168	112	0.011972	yes	ESPMSL
chr1_1949036_C_CTCCT_b38	PLEKHN1	2.638	0.00866	0.060657	6	0.02299	yes	ESPMSL
chr1_1106998_A_C_b38	PLEKHN1	-2.637	0.00869	-0.040365	19	0.015307	yes	ESPMSL
chr1_1107103_C_T_b38	PLEKHN1	-2.627	0.00894	-0.040814	17	0.015534	yes	ESPMSL
chr1_107125_A_G_b38	PLEKHN1	-2.603	0.0096	-0.064281	3	0.024697	yes	ESPMSL
chr1_1072052_G_A_b38	PLEKHN1	-2.599	0.0097	-0.030934	111	0.011903	yes	ESPMSL
chr1_504819_C_T_b38	PLEKHN1	3.707	0.00024	0.104876	6	0.028291	no	ESPMSL
chr1_1096804_A_G_b38	PLEKHN1	-3.404	0.000732	-0.047635	33	0.013994	no	ESPMSL
chr1_115902_T_A_b38	PLEKHN1	3.338	0.000924	0.068745	6	0.020595	no	ESPMSL
chr1_1096160_A_G_b38	PLEKHN1	-3.231	0.00134	-0.045852	32	0.01419	no	ESPMSL
chr1_1130717_G_A_b38	PLEKHN1	3.095	0.00211	0.049172	15	0.015885	no	ESPMSL
chr1_134234_G_A_b38	PLEKHN1	2.987	0.00299	0.069927	4	0.023409	no	ESPMSL
chr1_1101437_T_C_b38	PLEKHN1	2.956	0.00331	0.040807	35	0.013806	no	ESPMSL
chr1_1101667_C_T_b38	PLEKHN1	2.956	0.00331	0.040807	35	0.013806	no	ESPMSL
chr1_1417051_CA_C_b38	PLEKHN1	2.854	0.00454	0.056733	6	0.019878	no	ESPMSL
chr1_981210_G_A_b38	PLEKHN1	2.847	0.00465	0.046561	11	0.016356	no	ESPMSL
chr1_1153291_C_T_b38	PLEKHN1	2.813	0.00516	0.037123	34	0.013199	no	ESPMSL
chr1_1957243_T_C_b38	PLEKHN1	2.811	0.00518	0.063545	8	0.022603	no	ESPMSL
chr1_1957760_T_C_b38	PLEKHN1	2.811	0.00518	0.063545	8	0.022603	no	ESPMSL
chr1_15015_G_C_b38	PLEKHN1	-2.792	0.0055	-0.04355	20	0.015601	no	ESPMSL
chr1_1056662_C_T_b38	PLEKHN1	-2.777	0.00575	-0.039459	26	0.01421	no	ESPMSL
chr1_74555_A_G_b38	PLEKHN1	-2.77	0.00587	-0.042875	20	0.015478	no	ESPMSL
chr1_1949489_AT_A_b38	PLEKHN1	2.686	0.00755	0.062548	6	0.02329	no	ESPMSL
chr1_138156_G_T_b38	PLEKHN1	-2.678	0.00771	-0.042672	41	0.015933	no	ESPMSL
chr1_1049114_GC_G_b38	PLEKHN1	-2.659	0.00815	-0.031527	116	0.011855	no	ESPMSL
chr1_1074660_C_T_b38	PLEKHN1	-2.649	0.0084	-0.065097	4	0.024577	no	ESPMSL
chr1_1079484_T_A_b38	PLEKHN1	-2.639	0.00864	-0.030431	109	0.01153	no	ESPMSL
chr1_1943993_C_A_b38	PLEKHN1	2.614	0.00928	0.060482	7	0.023134	no	ESPMSL
chr1_1074910_TCACA_T_b38	PLEKHN1	2.602	0.00961	0.046912	8	0.018028	no	ESPMSL
chr1_984121_G_T_b38	PLEKHN1	-3.967	9.11e-05	-0.034826	98	0.008779	yes	HRTAA
chr1_1124794_C_T_b38	PLEKHN1	3.936	0.000103	0.037822	34	0.009609	yes	HRTAA
chr1_1820356_TA_T_b38	PLEKHN1	-3.682	0.000274	-0.043542	19	0.011825	yes	HRTAA
chr1_1112601_G_A_b38	PLEKHN1	3.379	0.000822	0.034354	30	0.010166	yes	HRTAA
chr1_913065_G_A_b38	PLEKHN1	3.377	0.00083	0.036574	19	0.010831	yes	HRTAA
chr1_913076_A_G_b38	PLEKHN1	3.377	0.00083	0.036574	19	0.010831	yes	HRTAA
chr1_1073854_T_C_b38	PLEKHN1	-3.353	0.000903	-0.028383	84	0.008466	yes	HRTAA
chr1_1101437_T_C_b38	PLEKHN1	3.35	0.000911	0.033761	31	0.010078	yes	HRTAA
chr1_1101667_C_T_b38	PLEKHN1	3.35	0.000911	0.033761	31	0.010078	yes	HRTAA
chr1_894801_A_G_b38	PLEKHN1	-3.297	0.0011	-0.032243	35	0.009781	yes	HRTAA
chr1_1063661_ATG_A_b38	PLEKHN1	-3.255	0.00126	-0.029151	72	0.008955	yes	HRTAA
chr1_1081790_C_G_b38	PLEKHN1	-3.226	0.00139	-0.027197	90	0.008431	yes	HRTAA
chr1_1589495_CTTT_C_b38	PLEKHN1	3.214	0.00145	0.034697	30	0.010797	yes	HRTAA
chr1_923311_TG_T_b38	PLEKHN1	-3.208	0.00148	-0.034805	35	0.010851	yes	HRTAA
chr1_923421_A_G_b38	PLEKHN1	-3.208	0.00148	-0.034805	35	0.010851	yes	HRTAA
chr1_939779_AGCCAGTGGACGCCGACCT_A_b38	PLEKHN1	-3.197	0.00154	-0.029344	78	0.00918	yes	HRTAA
chr1_912111_G_A_b38	PLEKHN1	3.196	0.00154	0.034633	19	0.010836	yes	HRTAA
chr1_19391_G_A_b38	PLEKHN1	-3.183	0.00161	-0.050032	6	0.015719	yes	HRTAA
chr1_933741_T_TG_b38	PLEKHN1	-3.167	0.0017	-0.032568	37	0.010284	yes	HRTAA
chr1_926250_G_A_b38	PLEKHN1	-3.156	0.00176	-0.035179	37	0.011148	yes	HRTAA
chr1_1650086_C_T_b38	PLEKHN1	3.143	0.00184	0.058869	3	0.01873	yes	HRTAA
chr1_1277830_C_CA_b38	PLEKHN1	3.142	0.00185	0.049609	8	0.015789	yes	HRTAA
chr1_1079484_T_A_b38	PLEKHN1	-3.091	0.00218	-0.026198	88	0.008477	yes	HRTAA
chr1_945259_TC_T_b38	PLEKHN1	3.07	0.00233	0.03341	19	0.010882	yes	HRTAA
chr1_1877316_A_AATAT_b38	PLEKHN1	3.053	0.00247	0.048737	6	0.015966	yes	HRTAA
chr1_914682_A_T_b38	PLEKHN1	3.047	0.00252	0.032876	18	0.010791	yes	HRTAA
chr1_929558_G_A_b38	PLEKHN1	-3.035	0.00262	-0.032819	41	0.010814	yes	HRTAA
chr1_925036_G_A_b38	PLEKHN1	-3.028	0.00268	-0.033235	36	0.010977	yes	HRTAA
chr1_917284_C_T_b38	PLEKHN1	3.023	0.00272	0.0332	15	0.010983	yes	HRTAA
chr1_1081817_C_T_b38	PLEKHN1	-2.976	0.00315	-0.025721	102	0.008641	yes	HRTAA
chr1_918870_A_G_b38	PLEKHN1	2.975	0.00317	0.031927	19	0.010732	yes	HRTAA
chr1_1595028_C_CAG_b38	PLEKHN1	2.971	0.00321	0.032447	22	0.010922	yes	HRTAA
chr1_915810_G_A_b38	PLEKHN1	2.962	0.0033	0.031913	18	0.010775	yes	HRTAA
chr1_911018_G_A_b38	PLEKHN1	2.961	0.00332	0.033257	21	0.011233	yes	HRTAA
chr1_914743_C_T_b38	PLEKHN1	2.934	0.0036	0.032368	15	0.01103	yes	HRTAA
chr1_1341098_T_G_b38	PLEKHN1	2.925	0.0037	0.044607	5	0.015249	yes	HRTAA
chr1_965125_G_C_b38	PLEKHN1	2.917	0.00381	0.031209	24	0.010701	yes	HRTAA
chr1_976215_A_G_b38	PLEKHN1	-2.901	0.004	-0.030612	27	0.010553	yes	HRTAA
chr1_912710_G_A_b38	PLEKHN1	2.892	0.00411	0.031829	15	0.011005	yes	HRTAA
chr1_913358_C_T_b38	PLEKHN1	2.892	0.00411	0.031829	15	0.011005	yes	HRTAA
chr1_982112_C_T_b38	PLEKHN1	2.892	0.00411	0.034162	11	0.011813	yes	HRTAA
chr1_1595306_CAG_C_b38	PLEKHN1	-2.886	0.00419	-0.02891	80	0.010018	yes	HRTAA
chr1_925308_G_A_b38	PLEKHN1	-2.88	0.00426	-0.031529	38	0.010946	yes	HRTAA
chr1_1667424_T_TAAATA_b38	PLEKHN1	-2.871	0.00438	-0.026843	59	0.00935	yes	HRTAA
chr1_935265_T_C_b38	PLEKHN1	2.869	0.00441	0.029978	28	0.01045	yes	HRTAA
chr1_896109_C_T_b38	PLEKHN1	-2.865	0.00446	-0.029748	36	0.010383	yes	HRTAA
chr1_965666_ACC_A_b38	PLEKHN1	2.863	0.0045	0.031303	19	0.010935	yes	HRTAA
chr1_910558_G_A_b38	PLEKHN1	2.861	0.00452	0.030932	29	0.010813	yes	HRTAA
chr1_914483_G_GACTGCCCAGCTC_b38	PLEKHN1	2.848	0.00471	0.031627	17	0.011106	yes	HRTAA
chr1_1147779_G_A_b38	PLEKHN1	2.845	0.00475	0.031424	15	0.011047	yes	HRTAA
chr1_911484_G_C_b38	PLEKHN1	2.832	0.00494	0.03038	19	0.010728	yes	HRTAA
chr1_927486_C_T_b38	PLEKHN1	-2.817	0.00516	-0.030828	38	0.010942	yes	HRTAA
chr1_1584321_T_C_b38	PLEKHN1	-2.81	0.00528	-0.027434	53	0.009763	yes	HRTAA
chr1_1016623_G_A_b38	PLEKHN1	2.808	0.00532	0.025606	57	0.00912	yes	HRTAA
chr1_1023573_A_G_b38	PLEKHN1	2.794	0.00555	0.025908	49	0.009274	yes	HRTAA
chr1_978230_G_A_b38	PLEKHN1	2.77	0.00595	0.032669	12	0.011794	yes	HRTAA
chr1_1600379_C_T_b38	PLEKHN1	2.766	0.00602	0.027761	34	0.010036	yes	HRTAA
chr1_928622_G_C_b38	PLEKHN1	2.764	0.00606	0.031949	10	0.011559	yes	HRTAA
chr1_1009470_A_T_b38	PLEKHN1	2.756	0.00621	0.047973	4	0.017406	yes	HRTAA
chr1_917378_G_C_b38	PLEKHN1	2.756	0.00621	0.03092	13	0.011219	yes	HRTAA
chr1_896529_C_T_b38	PLEKHN1	-2.739	0.00653	-0.027365	36	0.009992	yes	HRTAA
chr1_913274_TG_T_b38	PLEKHN1	2.737	0.00657	0.030918	13	0.011295	yes	HRTAA
chr1_1137871_C_A_b38	PLEKHN1	2.734	0.00662	0.03344	8	0.012229	yes	HRTAA
chr1_982890_C_T_b38	PLEKHN1	2.732	0.00666	0.032388	11	0.011853	yes	HRTAA
chr1_983237_G_A_b38	PLEKHN1	2.732	0.00666	0.032388	11	0.011853	yes	HRTAA
chr1_1049886_C_T_b38	PLEKHN1	-2.712	0.00706	-0.024872	92	0.00917	yes	HRTAA
chr1_1924208_G_A_b38	PLEKHN1	2.706	0.0072	0.026608	36	0.009833	yes	HRTAA
chr1_994321_C_CA_b38	PLEKHN1	-2.695	0.00744	-0.028293	43	0.0105	yes	HRTAA
chr1_1067054_C_T_b38	PLEKHN1	-2.682	0.00772	-0.025017	71	0.009327	yes	HRTAA
chr1_917859_A_G_b38	PLEKHN1	2.672	0.00795	0.029592	15	0.011075	yes	HRTAA
chr1_1667424_T_TAAAATA_b38	PLEKHN1	2.669	0.00803	0.026388	45	0.009888	yes	HRTAA
chr1_915824_G_C_b38	PLEKHN1	2.641	0.00871	0.028298	24	0.010716	yes	HRTAA
chr1_897538_T_C_b38	PLEKHN1	2.632	0.00893	0.026262	36	0.009978	yes	HRTAA
chr1_1606384_A_G_b38	PLEKHN1	2.631	0.00896	0.026276	36	0.009988	yes	HRTAA
chr1_1352542_G_A_b38	PLEKHN1	2.629	0.00901	0.041309	5	0.015715	yes	HRTAA
chr1_1014228_G_A_b38	PLEKHN1	2.616	0.00934	0.023362	63	0.00893	yes	HRTAA
chr1_911428_C_T_b38	PLEKHN1	2.615	0.00938	0.028366	19	0.010849	yes	HRTAA
chr1_1607931_G_A_b38	PLEKHN1	2.598	0.00983	0.02618	33	0.010075	yes	HRTAA
chr1_979560_T_C_b38	PLEKHN1	-5.019	8.89e-07	-0.042772	90	0.008521	no	HRTAA
chr1_978509_G_A_b38	PLEKHN1	-4.855	1.94e-06	-0.041177	86	0.008482	no	HRTAA
chr1_981454_G_A_b38	PLEKHN1	-4.789	2.63e-06	-0.041166	86	0.008595	no	HRTAA
chr1_983193_A_G_b38	PLEKHN1	-4.76	3.01e-06	-0.041022	86	0.008618	no	HRTAA
chr1_979472_G_C_b38	PLEKHN1	-4.752	3.13e-06	-0.040132	87	0.008446	no	HRTAA
chr1_983004_G_T_b38	PLEKHN1	-4.591	6.48e-06	-0.039618	97	0.008629	no	HRTAA
chr1_978953_C_G_b38	PLEKHN1	-4.528	8.57e-06	-0.038706	82	0.008547	no	HRTAA
chr1_989148_C_A_b38	PLEKHN1	-4.208	3.4e-05	-0.037649	101	0.008946	no	HRTAA
chr1_946247_G_A_b38	PLEKHN1	-4.13	4.71e-05	-0.04059	72	0.009829	no	HRTAA
chr1_999842_C_A_b38	PLEKHN1	-4.052	6.48e-05	-0.036029	105	0.008893	no	HRTAA
chr1_1005757_AGCCCCCGCAGCAGT_A_b38	PLEKHN1	-4.011	7.64e-05	-0.035103	84	0.008752	no	HRTAA
chr1_1060101_T_G_b38	PLEKHN1	-3.98	8.63e-05	-0.035093	100	0.008817	no	HRTAA
chr1_998410_G_A_b38	PLEKHN1	-3.919	0.00011	-0.034403	92	0.008779	no	HRTAA
chr1_955679_C_T_b38	PLEKHN1	-3.917	0.000111	-0.038282	71	0.009773	no	HRTAA
chr1_956565_A_G_b38	PLEKHN1	-3.917	0.000111	-0.038282	71	0.009773	no	HRTAA
chr1_1167770_G_A_b38	PLEKHN1	3.911	0.000114	0.039255	25	0.010038	no	HRTAA
chr1_949171_GAGAA_G_b38	PLEKHN1	-3.857	0.00014	-0.037554	72	0.009736	no	HRTAA
chr1_986336_C_A_b38	PLEKHN1	-3.852	0.000143	-0.034744	102	0.00902	no	HRTAA
chr1_989068_GTTGA_G_b38	PLEKHN1	-3.833	0.000154	-0.033822	93	0.008824	no	HRTAA
chr1_992967_GGGAGGGTCCATGTGTCCGTCATCTGA_G_b38	PLEKHN1	-3.819	0.000163	-0.033477	106	0.008765	no	HRTAA
chr1_1000731_C_T_b38	PLEKHN1	-3.792	0.000181	-0.033909	92	0.008943	no	HRTAA
chr1_940390_A_G_b38	PLEKHN1	-3.774	0.000194	-0.033951	96	0.008997	no	HRTAA
chr1_1004716_C_T_b38	PLEKHN1	-3.769	0.000197	-0.033064	92	0.008773	no	HRTAA
chr1_1063202_G_C_b38	PLEKHN1	-3.768	0.000198	-0.032622	106	0.008658	no	HRTAA
chr1_1018572_G_A_b38	PLEKHN1	-3.756	0.000207	-0.03376	100	0.008988	no	HRTAA
chr1_995508_ATTTTT_A_b38	PLEKHN1	-3.723	0.000235	-0.032925	90	0.008843	no	HRTAA
chr1_1019397_C_A_b38	PLEKHN1	-3.722	0.000236	-0.033292	100	0.008946	no	HRTAA
chr1_1017048_G_A_b38	PLEKHN1	-3.703	0.000253	-0.032816	100	0.008861	no	HRTAA
chr1_992993_A_G_b38	PLEKHN1	3.668	0.000289	0.031359	86	0.008549	no	HRTAA
chr1_1006159_C_T_b38	PLEKHN1	3.649	0.00031	0.031506	70	0.008634	no	HRTAA
chr1_1057980_C_A_b38	PLEKHN1	-3.617	0.000349	-0.032213	99	0.008906	no	HRTAA
chr1_1023775_G_A_b38	PLEKHN1	-3.598	0.000375	-0.03193	95	0.008874	no	HRTAA
chr1_1079877_A_G_b38	PLEKHN1	-3.596	0.000377	-0.03078	78	0.008559	no	HRTAA
chr1_1004625_A_G_b38	PLEKHN1	3.552	0.000444	0.030922	68	0.008706	no	HRTAA
chr1_975014_C_T_b38	PLEKHN1	3.495	0.000546	0.031962	54	0.009146	no	HRTAA
chr1_1593732_G_C_b38	PLEKHN1	-3.494	0.000548	-0.032581	73	0.009325	no	HRTAA
chr1_1086657_C_T_b38	PLEKHN1	-3.472	0.000592	-0.029386	83	0.008463	no	HRTAA
chr1_1164057_G_A_b38	PLEKHN1	3.472	0.000593	0.03529	26	0.010165	no	HRTAA
chr1_1159599_G_A_b38	PLEKHN1	-3.456	0.000626	-0.030983	62	0.008964	no	HRTAA
chr1_946653_G_A_b38	PLEKHN1	3.449	0.000644	0.037723	18	0.010938	no	HRTAA
chr1_960891_C_T_b38	PLEKHN1	-3.443	0.000657	-0.032775	87	0.00952	no	HRTAA
chr1_1021472_C_T_b38	PLEKHN1	-3.427	0.000696	-0.030505	90	0.008902	no	HRTAA
chr1_1083324_A_G_b38	PLEKHN1	-3.421	0.00071	-0.029153	79	0.008522	no	HRTAA
chr1_1070843_G_A_b38	PLEKHN1	-3.412	0.000734	-0.029751	89	0.008721	no	HRTAA
chr1_965337_CTTAT_C_b38	PLEKHN1	-3.406	0.000749	-0.033511	81	0.009839	no	HRTAA
chr1_1023851_G_A_b38	PLEKHN1	-3.401	0.000762	-0.031098	86	0.009144	no	HRTAA
chr1_1083800_T_C_b38	PLEKHN1	-3.4	0.000766	-0.029006	76	0.008532	no	HRTAA
chr1_909894_G_T_b38	PLEKHN1	3.39	0.000793	0.038271	26	0.011291	no	HRTAA
chr1_1074443_G_A_b38	PLEKHN1	3.389	0.000795	0.03961	13	0.011688	no	HRTAA
chr1_995786_A_G_b38	PLEKHN1	3.378	0.000825	0.029403	73	0.008704	no	HRTAA
chr1_995371_C_G_b38	PLEKHN1	3.371	0.000848	0.029627	60	0.00879	no	HRTAA
chr1_1056597_G_A_b38	PLEKHN1	-3.367	0.00086	-0.028762	105	0.008543	no	HRTAA
chr1_1069577_G_A_b38	PLEKHN1	-3.367	0.00086	-0.02926	89	0.008692	no	HRTAA
chr1_1069600_G_A_b38	PLEKHN1	-3.367	0.00086	-0.02926	89	0.008692	no	HRTAA
chr1_995512_T_C_b38	PLEKHN1	3.355	0.000895	0.029248	72	0.008717	no	HRTAA
chr1_995153_C_G_b38	PLEKHN1	3.35	0.000912	0.029458	68	0.008794	no	HRTAA
chr1_1594890_G_GAC_b38	PLEKHN1	-3.336	0.000955	-0.03119	73	0.009348	no	HRTAA
chr1_921096_A_G_b38	PLEKHN1	3.33	0.000975	0.031709	61	0.009521	no	HRTAA
chr1_1015297_T_C_b38	PLEKHN1	-3.316	0.00103	-0.029528	89	0.008906	no	HRTAA
chr1_1072052_G_A_b38	PLEKHN1	-3.305	0.00106	-0.028513	94	0.008627	no	HRTAA
chr1_1014733_GAAGT_G_b38	PLEKHN1	-3.301	0.00108	-0.029331	91	0.008886	no	HRTAA
chr1_1005904_C_T_b38	PLEKHN1	3.292	0.00111	0.028894	62	0.008777	no	HRTAA
chr1_1079456_A_G_b38	PLEKHN1	-3.285	0.00114	-0.027283	98	0.008304	no	HRTAA
chr1_1082764_T_C_b38	PLEKHN1	-3.275	0.00118	-0.028254	91	0.008628	no	HRTAA
chr1_1005954_G_A_b38	PLEKHN1	3.273	0.00119	0.028713	62	0.008772	no	HRTAA
chr1_1079746_A_G_b38	PLEKHN1	-3.27	0.0012	-0.028211	79	0.008628	no	HRTAA
chr1_1159292_A_C_b38	PLEKHN1	-3.269	0.00121	-0.029698	52	0.009086	no	HRTAA
chr1_1022868_A_G_b38	PLEKHN1	3.268	0.00121	0.030423	49	0.009311	no	HRTAA
chr1_1057439_G_A_b38	PLEKHN1	-3.265	0.00122	-0.028457	87	0.008717	no	HRTAA
chr1_1156987_C_T_b38	PLEKHN1	3.263	0.00123	0.032799	27	0.010051	no	HRTAA
chr1_1005429_C_CA_b38	PLEKHN1	3.259	0.00125	0.028516	63	0.00875	no	HRTAA
chr1_995982_G_A_b38	PLEKHN1	3.249	0.00129	0.028167	63	0.00867	no	HRTAA
chr1_1008588_C_T_b38	PLEKHN1	-3.247	0.0013	-0.029849	97	0.009193	no	HRTAA
chr1_1075707_CG_C_b38	PLEKHN1	-3.238	0.00134	-0.028036	91	0.008658	no	HRTAA
chr1_1158683_T_C_b38	PLEKHN1	3.231	0.00137	0.031494	31	0.009748	no	HRTAA
chr1_1161911_C_A_b38	PLEKHN1	3.23	0.00137	0.032724	26	0.01013	no	HRTAA
chr1_1153726_G_A_b38	PLEKHN1	3.221	0.00142	0.032555	27	0.010106	no	HRTAA
chr1_1020847_C_CGGG_b38	PLEKHN1	-3.219	0.00143	-0.030243	47	0.009395	no	HRTAA
chr1_995187_A_G_b38	PLEKHN1	3.192	0.00156	0.02831	69	0.00887	no	HRTAA
chr1_1015915_C_T_b38	PLEKHN1	-3.187	0.00159	-0.028503	90	0.008944	no	HRTAA
chr1_1023789_G_C_b38	PLEKHN1	-3.169	0.00169	-0.027481	90	0.008671	no	HRTAA
chr1_1080171_C_T_b38	PLEKHN1	-3.169	0.00169	-0.02741	93	0.00865	no	HRTAA
chr1_1019479_TG_T_b38	PLEKHN1	-3.143	0.00184	-0.027101	97	0.008622	no	HRTAA
chr1_1083182_C_T_b38	PLEKHN1	-3.139	0.00186	-0.027203	95	0.008665	no	HRTAA
chr1_1015903_C_T_b38	PLEKHN1	-3.132	0.0019	-0.028044	90	0.008953	no	HRTAA
chr1_954724_G_A_b38	PLEKHN1	3.129	0.00192	0.035029	16	0.011193	no	HRTAA
chr1_1009184_T_C_b38	PLEKHN1	3.11	0.00205	0.027596	61	0.008873	no	HRTAA
chr1_981169_A_G_b38	PLEKHN1	-3.11	0.00205	-0.031025	27	0.009977	no	HRTAA
chr1_1075337_C_T_b38	PLEKHN1	-3.106	0.00208	-0.026473	79	0.008524	no	HRTAA
chr1_1153291_C_T_b38	PLEKHN1	3.079	0.00227	0.031515	27	0.010235	no	HRTAA
chr1_1368047_ACT_A_b38	PLEKHN1	3.071	0.00233	0.046745	17	0.015222	no	HRTAA
chr1_967384_C_G_b38	PLEKHN1	-3.067	0.00236	-0.030206	73	0.009849	no	HRTAA
chr1_974039_C_T_b38	PLEKHN1	3.065	0.00237	0.035406	13	0.011552	no	HRTAA
chr1_1586626_C_T_b38	PLEKHN1	-3.061	0.0024	-0.028953	63	0.009458	no	HRTAA
chr1_935954_G_T_b38	PLEKHN1	-3.053	0.00247	-0.030668	51	0.010045	no	HRTAA
chr1_1049114_GC_G_b38	PLEKHN1	-3.05	0.00249	-0.026459	91	0.008674	no	HRTAA
chr1_1159750_T_C_b38	PLEKHN1	3.042	0.00256	0.030653	27	0.010076	no	HRTAA
chr1_1080336_G_A_b38	PLEKHN1	3.023	0.00272	0.035479	17	0.011737	no	HRTAA
chr1_286272_A_G_b38	PLEKHN1	-3.019	0.00275	-0.033988	30	0.011257	no	HRTAA
chr1_1586425_A_G_b38	PLEKHN1	-3.015	0.00279	-0.028259	64	0.009374	no	HRTAA
chr1_1159105_C_T_b38	PLEKHN1	-3.01	0.00283	-0.026887	64	0.008932	no	HRTAA
chr1_1161712_G_A_b38	PLEKHN1	-3.01	0.00283	-0.026887	64	0.008932	no	HRTAA
chr1_1124795_T_C_b38	PLEKHN1	3.006	0.00287	0.028598	88	0.009514	no	HRTAA
chr1_1032278_C_T_b38	PLEKHN1	-2.988	0.00304	-0.027434	99	0.009182	no	HRTAA
chr1_975093_G_A_b38	PLEKHN1	2.987	0.00305	0.039724	6	0.013297	no	HRTAA
chr1_1118005_C_T_b38	PLEKHN1	2.96	0.00332	0.027348	79	0.009238	no	HRTAA
chr1_967865_A_G_b38	PLEKHN1	-2.959	0.00333	-0.027073	101	0.009149	no	HRTAA
chr1_1016184_A_G_b38	PLEKHN1	2.957	0.00336	0.026245	66	0.008877	no	HRTAA
chr1_1017114_A_AT_b38	PLEKHN1	2.954	0.00338	0.028279	49	0.009572	no	HRTAA
chr1_1082207_C_T_b38	PLEKHN1	2.954	0.00338	0.035852	10	0.012137	no	HRTAA
chr1_1160239_C_G_b38	PLEKHN1	-2.949	0.00344	-0.026635	49	0.009032	no	HRTAA
chr1_976536_C_T_b38	PLEKHN1	2.94	0.00353	0.035001	11	0.011904	no	HRTAA
chr1_1587547_C_T_b38	PLEKHN1	-2.939	0.00355	-0.028771	53	0.00979	no	HRTAA
chr1_1160631_C_G_b38	PLEKHN1	-2.927	0.00369	-0.026194	64	0.00895	no	HRTAA
chr1_982260_G_A_b38	PLEKHN1	2.927	0.00369	0.031383	17	0.010723	no	HRTAA
chr1_982858_C_G_b38	PLEKHN1	2.927	0.00369	0.031383	17	0.010723	no	HRTAA
chr1_1586679_C_T_b38	PLEKHN1	-2.925	0.00371	-0.027717	63	0.009477	no	HRTAA
chr1_1587413_C_T_b38	PLEKHN1	-2.923	0.00373	-0.02782	62	0.009517	no	HRTAA
chr1_1587352_A_G_b38	PLEKHN1	-2.919	0.00377	-0.027741	65	0.009503	no	HRTAA
chr1_969750_ATG_A_b38	PLEKHN1	-2.91	0.00388	-0.025912	95	0.008905	no	HRTAA
chr1_1008307_G_C_b38	PLEKHN1	2.91	0.00389	0.025778	62	0.00886	no	HRTAA
chr1_1587397_A_AT_b38	PLEKHN1	-2.908	0.0039	-0.028247	57	0.009712	no	HRTAA
chr1_1025029_G_C_b38	PLEKHN1	-2.908	0.00391	-0.026653	100	0.009165	no	HRTAA
chr1_1159358_A_G_b38	PLEKHN1	-2.904	0.00396	-0.026299	51	0.009056	no	HRTAA
chr1_1023525_A_G_b38	PLEKHN1	2.891	0.00412	0.02703	47	0.00935	no	HRTAA
chr1_1039411_T_TGGG_b38	PLEKHN1	2.89	0.00413	0.03001	24	0.010383	no	HRTAA
chr1_1662933_T_A_b38	PLEKHN1	-2.888	0.00416	-0.027329	42	0.009463	no	HRTAA
chr1_1359138_C_T_b38	PLEKHN1	2.878	0.00429	0.043851	23	0.015237	no	HRTAA
chr1_998762_A_AGGGGAGG_b38	PLEKHN1	-2.872	0.00437	-0.024268	73	0.008451	no	HRTAA
chr1_981282_A_C_b38	PLEKHN1	2.865	0.00447	0.033621	12	0.011736	no	HRTAA
chr1_1068824_G_GGCCACGCGGGCTGTGCAGATGCAGGTGCGGCGGGGCGGGGCCACGCGGGCTGTGAAGGTGCAGGTGCGGCGGGGCAGA_b38	PLEKHN1	-2.853	0.00463	-0.020614	50	0.007225	no	HRTAA
chr1_983747_T_C_b38	PLEKHN1	2.85	0.00467	0.029949	20	0.010508	no	HRTAA
chr1_1600320_C_G_b38	PLEKHN1	2.845	0.00474	0.028811	32	0.010126	no	HRTAA
chr1_1589491_A_G_b38	PLEKHN1	-2.843	0.00477	-0.026715	54	0.009397	no	HRTAA
chr1_788757_T_TAATGGAATGG_b38	PLEKHN1	-2.835	0.0049	-0.030592	20	0.010792	no	HRTAA
chr1_1160818_C_T_b38	PLEKHN1	-2.833	0.00492	-0.026055	54	0.009197	no	HRTAA
chr1_1324788_C_A_b38	PLEKHN1	2.83	0.00497	0.041301	21	0.014595	no	HRTAA
chr1_1585345_C_T_b38	PLEKHN1	-2.827	0.00501	-0.027623	53	0.009771	no	HRTAA
chr1_1067673_C_T_b38	PLEKHN1	-2.812	0.00524	-0.026192	75	0.009314	no	HRTAA
chr1_1023351_A_G_b38	PLEKHN1	2.809	0.0053	0.026158	48	0.009312	no	HRTAA
chr1_1087765_G_A_b38	PLEKHN1	2.807	0.00533	0.034611	9	0.012332	no	HRTAA
chr1_1918989_A_G_b38	PLEKHN1	-2.779	0.00579	-0.025097	79	0.00903	no	HRTAA
chr1_1035169_TGG_T_b38	PLEKHN1	2.775	0.00586	0.031084	13	0.0112	no	HRTAA
chr1_1050070_G_A_b38	PLEKHN1	2.773	0.00591	0.025877	76	0.009333	no	HRTAA
chr1_1362790_A_ATT_b38	PLEKHN1	2.772	0.00592	0.0379	6	0.013672	no	HRTAA
chr1_973693_C_T_b38	PLEKHN1	-2.771	0.00594	-0.024579	62	0.00887	no	HRTAA
chr1_1043223_CCT_C_b38	PLEKHN1	-2.769	0.00597	-0.025546	96	0.009225	no	HRTAA
chr1_1050063_AG_A_b38	PLEKHN1	2.748	0.00635	0.025704	76	0.009353	no	HRTAA
chr1_1362780_CAAA_C_b38	PLEKHN1	2.728	0.00675	0.037013	6	0.013569	no	HRTAA
chr1_1048922_T_C_b38	PLEKHN1	-2.728	0.00675	-0.024238	89	0.008886	no	HRTAA
chr1_1015925_A_ATT_b38	PLEKHN1	2.724	0.00683	0.024832	48	0.009117	no	HRTAA
chr1_1052514_C_CGT_b38	PLEKHN1	-2.722	0.00687	-0.024807	70	0.009115	no	HRTAA
chr1_1053552_G_C_b38	PLEKHN1	-2.721	0.00688	-0.030767	25	0.011305	no	HRTAA
chr1_1597128_C_CCCTCAGCTGGACT_b38	PLEKHN1	-2.718	0.00696	-0.024871	60	0.009152	no	HRTAA
chr1_1054900_C_T_b38	PLEKHN1	-2.713	0.00706	-0.027815	42	0.010253	no	HRTAA
chr1_921056_TG_T_b38	PLEKHN1	2.702	0.00729	0.031163	12	0.011535	no	HRTAA
chr1_1357046_C_G_b38	PLEKHN1	2.688	0.00758	0.042045	20	0.015639	no	HRTAA
chr1_1357369_C_T_b38	PLEKHN1	2.688	0.00758	0.042045	20	0.015639	no	HRTAA
chr1_1360023_T_C_b38	PLEKHN1	2.688	0.00758	0.042045	20	0.015639	no	HRTAA
chr1_1050066_G_T_b38	PLEKHN1	-2.681	0.00775	-0.026681	56	0.009953	no	HRTAA
chr1_1014863_A_C_b38	PLEKHN1	2.68	0.00776	0.02411	61	0.008995	no	HRTAA
chr1_1002745_G_A_b38	PLEKHN1	2.678	0.00782	0.026635	26	0.009946	no	HRTAA
chr1_1111365_CA_C_b38	PLEKHN1	2.666	0.00809	0.031142	12	0.011682	no	HRTAA
chr1_1070426_C_T_b38	PLEKHN1	2.665	0.00811	0.031708	15	0.011896	no	HRTAA
chr1_1756186_T_C_b38	PLEKHN1	2.664	0.00814	0.024132	68	0.009059	no	HRTAA
chr1_1586962_C_T_b38	PLEKHN1	2.663	0.00816	0.027318	40	0.010258	no	HRTAA
chr1_1585290_TTTTG_T_b38	PLEKHN1	-2.663	0.00817	-0.025293	62	0.009498	no	HRTAA
chr1_928223_T_A_b38	PLEKHN1	2.655	0.00836	0.039023	3	0.014699	no	HRTAA
chr1_1380790_G_A_b38	PLEKHN1	2.652	0.00842	0.042112	11	0.015877	no	HRTAA
chr1_1379664_G_A_b38	PLEKHN1	2.65	0.00848	0.041311	11	0.01559	no	HRTAA
chr1_1163334_C_G_b38	PLEKHN1	-2.65	0.00848	-0.023326	83	0.008803	no	HRTAA
chr1_1330080_T_C_b38	PLEKHN1	2.64	0.00873	0.04091	19	0.015497	no	HRTAA
chr1_914948_CA_C_b38	PLEKHN1	2.64	0.00874	0.032399	12	0.012275	no	HRTAA
chr1_104159_CA_C_b38	PLEKHN1	-2.614	0.00939	-0.039744	4	0.015202	no	HRTAA
chr1_1804004_G_A_b38	PLEKHN1	2.602	0.00974	0.019531	39	0.007507	no	HRTAA
chr1_1629572_TG_T_b38	PLEKHN1	-2.6	0.00979	-0.025255	48	0.009714	no	HRTAA
chr1_1271835_A_G_b38	PLEKHN1	-2.597	0.00987	-0.047192	5	0.018173	no	HRTAA
chr1_1470425_C_CTTT_b38	PLEKHN1	4.229	3.09e-05	0.11753	4	0.027795	yes	HRTLV
chr1_106691_G_A_b38	PLEKHN1	3.337	0.000949	0.095926	3	0.028748	yes	HRTLV
chr1_1584321_T_C_b38	PLEKHN1	-3.276	0.00117	-0.03069	49	0.009369	yes	HRTLV
chr1_1624323_AT_A_b38	PLEKHN1	3.212	0.00145	0.028709	63	0.008937	yes	HRTLV
chr1_822668_A_G_b38	PLEKHN1	2.991	0.003	0.040276	6	0.013466	yes	HRTLV
chr1_1663038_T_C_b38	PLEKHN1	-2.93	0.00364	-0.027006	63	0.009217	yes	HRTLV
chr1_1102097_C_A_b38	PLEKHN1	2.904	0.00394	0.043418	3	0.014951	yes	HRTLV
chr1_1124794_C_T_b38	PLEKHN1	2.819	0.00512	0.027206	37	0.009649	yes	HRTLV
chr1_1125786_T_C_b38	PLEKHN1	2.807	0.00531	0.026116	64	0.009304	yes	HRTLV
chr1_99083_C_T_b38	PLEKHN1	-2.799	0.00545	-0.038498	6	0.013756	yes	HRTLV
chr1_1606559_C_G_b38	PLEKHN1	-2.776	0.00583	-0.027252	33	0.009816	yes	HRTLV
chr1_1606532_G_A_b38	PLEKHN1	-2.753	0.00624	-0.029583	23	0.010745	yes	HRTLV
chr1_728044_C_T_b38	PLEKHN1	2.705	0.00721	0.070099	6	0.025918	yes	HRTLV
chr1_1606536_GCT_G_b38	PLEKHN1	-2.673	0.0079	-0.028388	24	0.010618	yes	HRTLV
chr1_858567_A_G_b38	PLEKHN1	-2.648	0.00851	-0.036271	10	0.013698	yes	HRTLV
chr1_1605347_C_T_b38	PLEKHN1	-2.625	0.0091	-0.024904	47	0.009489	yes	HRTLV
chr1_1610924_C_T_b38	PLEKHN1	-2.617	0.0093	-0.024784	47	0.00947	yes	HRTLV
chr1_1618118_G_A_b38	PLEKHN1	-2.617	0.0093	-0.024784	47	0.00947	yes	HRTLV
chr1_858571_A_C_b38	PLEKHN1	-2.599	0.00979	-0.035705	10	0.013738	yes	HRTLV
chr1_878260_A_G_b38	PLEKHN1	2.599	0.0098	0.031782	27	0.01223	yes	HRTLV
chr1_1606539_G_GCC_b38	PLEKHN1	-2.596	0.00988	-0.027502	24	0.010594	yes	HRTLV
chr1_1874605_T_TA_b38	PLEKHN1	3.205	0.00149	0.04157	28	0.012972	no	HRTLV
chr1_847938_A_G_b38	PLEKHN1	-3.01	0.00282	-0.039321	7	0.013062	no	HRTLV
chr1_875400_G_C_b38	PLEKHN1	-2.989	0.00302	-0.039223	11	0.013122	no	HRTLV
chr1_855085_G_A_b38	PLEKHN1	-2.957	0.00334	-0.042209	6	0.014272	no	HRTLV
chr1_1130649_G_A_b38	PLEKHN1	2.933	0.0036	0.049269	4	0.016798	no	HRTLV
chr1_1589495_CTTT_C_b38	PLEKHN1	2.915	0.00382	0.03055	25	0.010482	no	HRTLV
chr1_1190043_C_T_b38	PLEKHN1	-2.873	0.00434	-0.044404	3	0.015453	no	HRTLV
chr1_820905_ATCCACCCTGTCTACACTACCTGCTTGTCCAGCAGG_A_b38	PLEKHN1	-2.838	0.00484	-0.037601	6	0.013251	no	HRTLV
chr1_1322213_A_G_b38	PLEKHN1	2.826	0.00502	0.047283	3	0.016732	no	HRTLV
chr1_1329159_G_C_b38	PLEKHN1	2.809	0.00528	0.04532	4	0.016133	no	HRTLV
chr1_1855158_CA_C_b38	PLEKHN1	2.78	0.00576	0.033551	10	0.012068	no	HRTLV
chr1_1627515_C_T_b38	PLEKHN1	2.778	0.00579	0.024378	75	0.008774	no	HRTLV
chr1_860608_C_T_b38	PLEKHN1	-2.771	0.00592	-0.033672	11	0.012152	no	HRTLV
chr1_862060_T_C_b38	PLEKHN1	-2.759	0.00613	-0.035305	8	0.012795	no	HRTLV
chr1_866087_G_C_b38	PLEKHN1	-2.759	0.00613	-0.035305	8	0.012795	no	HRTLV
chr1_833843_C_G_b38	PLEKHN1	-2.755	0.00621	-0.035294	8	0.012811	no	HRTLV
chr1_867116_C_T_b38	PLEKHN1	-2.717	0.00695	-0.035937	6	0.013227	no	HRTLV
chr1_821054_G_C_b38	PLEKHN1	-2.71	0.0071	-0.035707	6	0.013176	no	HRTLV
chr1_185795_G_T_b38	PLEKHN1	-2.708	0.00714	-0.041333	6	0.015264	no	HRTLV
chr1_877363_C_T_b38	PLEKHN1	-2.663	0.00815	-0.031896	16	0.011979	no	HRTLV
chr1_839543_G_C_b38	PLEKHN1	-2.65	0.00846	-0.029381	30	0.011089	no	HRTLV
chr1_914838_T_A_b38	PLEKHN1	2.629	0.00899	0.024869	94	0.009461	no	HRTLV
chr1_843365_A_G_b38	PLEKHN1	-2.628	0.00901	-0.033867	9	0.012887	no	HRTLV
chr1_1613330_A_AT_b38	PLEKHN1	-2.615	0.00935	-0.025908	41	0.009908	no	HRTLV
chr1_1327764_G_A_b38	PLEKHN1	2.611	0.00946	0.039866	5	0.015268	no	HRTLV
chr1_1595028_C_CAG_b38	PLEKHN1	2.604	0.00965	0.026009	27	0.009989	no	HRTLV
chr1_124583_C_T_b38	PLEKHN1	2.598	0.00981	0.035265	8	0.013572	no	HRTLV
chr1_828389_A_AT_b38	PLEKHN1	-3.269	0.00202	-0.245492	6	0.075104	yes	KDNCTX
chr1_872843_G_C_b38	PLEKHN1	-3.113	0.00315	-0.179003	10	0.057495	yes	KDNCTX
chr1_1070426_C_T_b38	PLEKHN1	3.03	0.00397	0.234283	4	0.077323	yes	KDNCTX
chr1_1584235_A_AT_b38	PLEKHN1	-2.929	0.00523	-0.163883	8	0.055945	yes	KDNCTX
chr1_1594890_G_GAC_b38	PLEKHN1	-2.892	0.00579	-0.159805	8	0.055263	yes	KDNCTX
chr1_1616048_C_T_b38	PLEKHN1	-2.825	0.00692	-0.155633	6	0.055091	yes	KDNCTX
chr1_832873_A_C_b38	PLEKHN1	-3.698	0.000567	-0.265513	6	0.071795	no	KDNCTX
chr1_771398_G_A_b38	PLEKHN1	-3.021	0.00407	-0.218092	7	0.072191	no	KDNCTX
chr1_1067007_A_G_b38	PLEKHN1	2.962	0.00478	0.179839	5	0.060717	no	KDNCTX
chr1_1773713_T_TGA_b38	PLEKHN1	-2.801	0.00738	-0.16992	3	0.06067	no	KDNCTX
chr1_1067159_G_A_b38	PLEKHN1	2.764	0.00812	0.18945	7	0.068535	no	KDNCTX
chr1_1928119_T_C_b38	PLEKHN1	-2.692	0.00982	-0.176753	4	0.065666	no	KDNCTX
chr1_840409_TA_T_b38	PLEKHN1	2.925	0.00392	0.067833	21	0.023189	yes	LIVER
chr1_1597128_C_CCCTCAGCTGGACT_b38	PLEKHN1	-2.89	0.00436	-0.053463	36	0.018498	yes	LIVER
chr1_1589495_CTTT_C_b38	PLEKHN1	2.826	0.00528	0.061401	17	0.021725	yes	LIVER
chr1_1612562_T_TC_b38	PLEKHN1	2.756	0.00649	0.054866	20	0.019904	yes	LIVER
chr1_1663759_G_A_b38	PLEKHN1	2.752	0.00659	0.098006	5	0.035619	yes	LIVER
chr1_1007746_CTTTTTTTTTTTTTTT_C_b38	PLEKHN1	-2.702	0.00759	-0.069821	12	0.025836	yes	LIVER
chr1_1118005_C_T_b38	PLEKHN1	-2.653	0.00874	-0.050931	50	0.019194	yes	LIVER
chr1_836030_C_T_b38	PLEKHN1	2.618	0.00967	0.069132	13	0.026411	yes	LIVER
chr1_1684789_C_CA_b38	PLEKHN1	4.009	9.16e-05	0.174027	3	0.043405	no	LIVER
chr1_114810_C_T_b38	PLEKHN1	-3.38	0.000902	-0.080744	13	0.023887	no	LIVER
chr1_1126311_G_GTT_b38	PLEKHN1	-2.961	0.00352	-0.097645	3	0.032982	no	LIVER
chr1_1949125_T_TTCCC_b38	PLEKHN1	2.945	0.00369	0.076114	6	0.025845	no	LIVER
chr1_1634663_C_G_b38	PLEKHN1	2.625	0.00946	0.072471	11	0.027603	no	LIVER
chr1_1588141_CA_C_b38	PLEKHN1	-2.619	0.00964	-0.065154	12	0.024881	no	LIVER
chr1_953778_G_C_b38	PLEKHN1	4.569	6.36e-06	0.109339	3	0.02393	yes	LUNG
chr1_953779_A_C_b38	PLEKHN1	4.569	6.36e-06	0.109339	3	0.02393	yes	LUNG
chr1_950296_C_A_b38	PLEKHN1	4.351	1.68e-05	0.101379	3	0.023298	yes	LUNG
chr1_952180_A_C_b38	PLEKHN1	4.351	1.68e-05	0.101379	3	0.023298	yes	LUNG
chr1_962184_T_C_b38	PLEKHN1	4.224	2.91e-05	0.093241	5	0.022074	yes	LUNG
chr1_962358_C_T_b38	PLEKHN1	-4.146	4.06e-05	-0.09215	5	0.022228	yes	LUNG
chr1_950669_ACAG_A_b38	PLEKHN1	4.032	6.5e-05	0.087891	7	0.021796	yes	LUNG
chr1_958251_A_G_b38	PLEKHN1	4.007	7.21e-05	0.089604	4	0.022362	yes	LUNG
chr1_949046_A_AACAGCAAAG_b38	PLEKHN1	3.874	0.000123	0.08714	5	0.022495	yes	LUNG
chr1_966227_C_G_b38	PLEKHN1	3.865	0.000128	0.084072	10	0.021755	yes	LUNG
chr1_954333_C_A_b38	PLEKHN1	3.85	0.000135	0.087146	3	0.022634	yes	LUNG
chr1_954258_G_C_b38	PLEKHN1	3.814	0.000156	0.086188	3	0.022596	yes	LUNG
chr1_942335_C_G_b38	PLEKHN1	3.801	0.000164	0.083758	5	0.022036	yes	LUNG
chr1_961945_G_C_b38	PLEKHN1	3.743	0.000206	0.080148	7	0.021414	yes	LUNG
chr1_958339_G_A_b38	PLEKHN1	3.478	0.000555	0.07404	6	0.021287	yes	LUNG
chr1_1232800_G_C_b38	PLEKHN1	3.403	0.000728	0.077388	11	0.022743	yes	LUNG
chr1_1235720_T_G_b38	PLEKHN1	3.309	0.00101	0.076447	16	0.023102	yes	LUNG
chr1_674562_T_C_b38	PLEKHN1	3.305	0.00103	0.050451	12	0.015267	yes	LUNG
chr1_1248206_A_G_b38	PLEKHN1	3.256	0.00122	0.108172	4	0.033223	yes	LUNG
chr1_889018_A_C_b38	PLEKHN1	3.235	0.00131	0.049693	17	0.015359	yes	LUNG
chr1_1589160_T_TTTTA_b38	PLEKHN1	-3.114	0.00197	-0.11292	3	0.036264	yes	LUNG
chr1_1248149_G_C_b38	PLEKHN1	3.111	0.00198	0.126895	4	0.040788	yes	LUNG
chr1_889689_G_C_b38	PLEKHN1	3.07	0.00227	0.046913	40	0.015279	yes	LUNG
chr1_1208038_T_C_b38	PLEKHN1	3.049	0.00243	0.066601	11	0.021843	yes	LUNG
chr1_1774697_T_C_b38	PLEKHN1	-2.98	0.00304	-0.063095	12	0.021175	yes	LUNG
chr1_1750632_G_A_b38	PLEKHN1	-2.967	0.00317	-0.045115	40	0.015208	yes	LUNG
chr1_1737789_T_C_b38	PLEKHN1	-2.954	0.0033	-0.058675	9	0.019862	yes	LUNG
chr1_1477677_TTTTTA_T_b38	PLEKHN1	-2.905	0.00385	-0.088064	6	0.030313	yes	LUNG
chr1_1288341_C_T_b38	PLEKHN1	-2.901	0.00391	-0.070032	8	0.024142	yes	LUNG
chr1_1766668_C_T_b38	PLEKHN1	-2.901	0.00391	-0.05843	14	0.020144	yes	LUNG
chr1_1913504_CT_C_b38	PLEKHN1	-2.887	0.00408	-0.039909	81	0.013822	yes	LUNG
chr1_1339884_A_ACAGCCGCATGTCCCCCAGCAGCCCCCACAGACCCACCCGCAGCCGCATGTCCCCCAGCAGCCCCCACAGACCCACCCG_b38	PLEKHN1	-2.887	0.00408	-0.094629	3	0.032781	yes	LUNG
chr1_1688102_G_A_b38	PLEKHN1	-2.88	0.00417	-0.039681	38	0.013777	yes	LUNG
chr1_967376_AC_A_b38	PLEKHN1	2.866	0.00435	0.057264	4	0.019978	yes	LUNG
chr1_1606559_C_CGGCTGGTCAGGCGTGGGGCG_b38	PLEKHN1	2.863	0.0044	0.039512	35	0.013802	yes	LUNG
chr1_1927857_T_C_b38	PLEKHN1	-2.86	0.00444	-0.037624	108	0.013156	yes	LUNG
chr1_1919188_CAGCGGCAGG_C_b38	PLEKHN1	-2.837	0.00476	-0.036423	106	0.012837	yes	LUNG
chr1_1762287_A_G_b38	PLEKHN1	-2.822	0.00499	-0.036156	113	0.012813	yes	LUNG
chr1_1292284_TTGAG_T_b38	PLEKHN1	-2.816	0.00509	-0.047905	25	0.017014	yes	LUNG
chr1_285720_A_G_b38	PLEKHN1	2.792	0.00547	0.074404	3	0.02665	yes	LUNG
chr1_1332815_G_A_b38	PLEKHN1	2.765	0.00594	0.071647	5	0.025916	yes	LUNG
chr1_1964118_C_T_b38	PLEKHN1	2.754	0.00613	0.111155	3	0.040364	yes	LUNG
chr1_1750650_C_G_b38	PLEKHN1	-2.75	0.0062	-0.041424	39	0.015063	yes	LUNG
chr1_123511_G_A_b38	PLEKHN1	-2.697	0.00726	-0.044653	6	0.016555	yes	LUNG
chr1_1739915_G_A_b38	PLEKHN1	-2.692	0.00738	-0.047625	25	0.017694	yes	LUNG
chr1_1963619_C_A_b38	PLEKHN1	2.69	0.00741	0.104519	4	0.038848	yes	LUNG
chr1_1897682_C_CA_b38	PLEKHN1	-2.683	0.00757	-0.04876	7	0.018174	yes	LUNG
chr1_770950_A_AG_b38	PLEKHN1	-2.68	0.00763	-0.066988	3	0.024991	yes	LUNG
chr1_893503_G_A_b38	PLEKHN1	2.666	0.00797	0.054747	4	0.020539	yes	LUNG
chr1_1263831_T_TA_b38	PLEKHN1	-2.646	0.00844	-0.055732	4	0.021066	yes	LUNG
chr1_1054081_G_A_b38	PLEKHN1	-2.616	0.00919	-0.093496	3	0.035737	yes	LUNG
chr1_1942887_C_G_b38	PLEKHN1	-2.596	0.00975	-0.033168	110	0.012777	yes	LUNG
chr1_690060_A_C_b38	PLEKHN1	-2.595	0.00976	-0.063364	4	0.024415	yes	LUNG
chr1_1605649_GGGCTGGTCAGGTGTGGGGTC_G_b38	PLEKHN1	-4.213	3.05e-05	-0.075944	5	0.018026	no	LUNG
chr1_1234105_G_A_b38	PLEKHN1	3.627	0.000321	0.112263	3	0.030956	no	LUNG
chr1_1280332_C_T_b38	PLEKHN1	3.516	0.000484	0.089511	4	0.025461	no	LUNG
chr1_1605732_C_T_b38	PLEKHN1	-3.474	0.000563	-0.065398	8	0.018824	no	LUNG
chr1_1258333_C_G_b38	PLEKHN1	3.432	0.000656	0.071416	13	0.020811	no	LUNG
chr1_1258343_A_C_b38	PLEKHN1	3.432	0.000656	0.071416	13	0.020811	no	LUNG
chr1_1283472_G_T_b38	PLEKHN1	3.379	0.00079	0.088526	4	0.026195	no	LUNG
chr1_1284316_A_AGGGGTGGG_b38	PLEKHN1	3.373	0.000808	0.126738	4	0.037571	no	LUNG
chr1_1235349_G_A_b38	PLEKHN1	3.27	0.00116	0.101986	3	0.031193	no	LUNG
chr1_1254681_A_G_b38	PLEKHN1	3.215	0.0014	0.066123	13	0.020567	no	LUNG
chr1_1248218_A_G_b38	PLEKHN1	3.201	0.00147	0.073484	12	0.022959	no	LUNG
chr1_1912607_C_T_b38	PLEKHN1	-3.137	0.00182	-0.04076	99	0.012995	no	LUNG
chr1_1283510_G_C_b38	PLEKHN1	3.086	0.00216	0.081404	4	0.026382	no	LUNG
chr1_1925307_C_A_b38	PLEKHN1	-3.076	0.00223	-0.040673	104	0.013222	no	LUNG
chr1_1749826_A_G_b38	PLEKHN1	-3.072	0.00226	-0.035784	120	0.011648	no	LUNG
chr1_1762664_A_G_b38	PLEKHN1	-3.071	0.00227	-0.064012	13	0.020845	no	LUNG
chr1_1774506_T_C_b38	PLEKHN1	-3.023	0.00264	-0.041896	67	0.013858	no	LUNG
chr1_591356_C_G_b38	PLEKHN1	3.012	0.00274	0.061842	9	0.02053	no	LUNG
chr1_638771_A_T_b38	PLEKHN1	-3.009	0.00277	-0.067909	11	0.022567	no	LUNG
chr1_1918090_A_G_b38	PLEKHN1	-2.976	0.00308	-0.0391	105	0.013138	no	LUNG
chr1_1909238_G_A_b38	PLEKHN1	-2.975	0.00309	-0.038518	108	0.012946	no	LUNG
chr1_1585973_T_TAATAATAATAATAATAATAATAATAAA_b38	PLEKHN1	2.975	0.00309	0.092193	3	0.030989	no	LUNG
chr1_1744652_C_T_b38	PLEKHN1	-2.941	0.00344	-0.03517	100	0.011957	no	LUNG
chr1_1874605_TA_T_b38	PLEKHN1	-2.936	0.00349	-0.075815	6	0.02582	no	LUNG
chr1_1909234_G_A_b38	PLEKHN1	-2.904	0.00387	-0.037766	106	0.013007	no	LUNG
chr1_1774334_A_G_b38	PLEKHN1	-2.9	0.00392	-0.061166	12	0.021093	no	LUNG
chr1_1913643_T_C_b38	PLEKHN1	-2.898	0.00394	-0.038457	96	0.013269	no	LUNG
chr1_1773460_G_A_b38	PLEKHN1	-2.885	0.0041	-0.037209	107	0.012897	no	LUNG
chr1_1773476_C_G_b38	PLEKHN1	-2.885	0.0041	-0.037209	107	0.012897	no	LUNG
chr1_1746522_GT_G_b38	PLEKHN1	-2.877	0.0042	-0.043579	22	0.015145	no	LUNG
chr1_1929904_C_T_b38	PLEKHN1	-2.853	0.00454	-0.03759	107	0.013176	no	LUNG
chr1_1930143_C_T_b38	PLEKHN1	-2.844	0.00467	-0.037485	107	0.013182	no	LUNG
chr1_1881428_C_CT_b38	PLEKHN1	-2.843	0.00468	-0.037003	102	0.013018	no	LUNG
chr1_1765220_A_G_b38	PLEKHN1	-2.841	0.00471	-0.058704	13	0.020664	no	LUNG
chr1_1672155_G_A_b38	PLEKHN1	2.84	0.00472	0.03699	45	0.013025	no	LUNG
chr1_1248141_G_C_b38	PLEKHN1	2.827	0.00491	0.082251	7	0.029096	no	LUNG
chr1_1905586_C_T_b38	PLEKHN1	-2.82	0.00501	-0.036588	105	0.012973	no	LUNG
chr1_898261_T_C_b38	PLEKHN1	-2.819	0.00504	-0.036681	50	0.013014	no	LUNG
chr1_898279_T_A_b38	PLEKHN1	-2.819	0.00504	-0.036681	50	0.013014	no	LUNG
chr1_898283_A_G_b38	PLEKHN1	-2.819	0.00504	-0.036681	50	0.013014	no	LUNG
chr1_1285621_A_G_b38	PLEKHN1	2.81	0.00517	0.10686	4	0.038024	no	LUNG
chr1_1286671_A_G_b38	PLEKHN1	2.81	0.00517	0.10686	4	0.038024	no	LUNG
chr1_1764135_G_T_b38	PLEKHN1	-2.808	0.0052	-0.057909	13	0.020622	no	LUNG
chr1_1764392_C_T_b38	PLEKHN1	-2.808	0.0052	-0.057909	13	0.020622	no	LUNG
chr1_1767368_C_G_b38	PLEKHN1	-2.808	0.0052	-0.057909	13	0.020622	no	LUNG
chr1_1831318_C_T_b38	PLEKHN1	-2.807	0.00522	-0.036612	105	0.013042	no	LUNG
chr1_1901262_C_T_b38	PLEKHN1	-2.806	0.00524	-0.036208	108	0.012906	no	LUNG
chr1_1901386_C_A_b38	PLEKHN1	-2.806	0.00524	-0.036208	108	0.012906	no	LUNG
chr1_1208816_T_C_b38	PLEKHN1	2.796	0.0054	0.075936	3	0.027157	no	LUNG
chr1_1676287_C_T_b38	PLEKHN1	2.795	0.00542	0.041816	18	0.014963	no	LUNG
chr1_1748780_G_A_b38	PLEKHN1	-2.794	0.00542	-0.034008	118	0.01217	no	LUNG
chr1_969377_A_ATG_b38	PLEKHN1	2.788	0.00554	0.045608	13	0.01636	no	LUNG
chr1_1743886_C_T_b38	PLEKHN1	-2.785	0.00557	-0.037638	51	0.013513	no	LUNG
chr1_1914345_C_T_b38	PLEKHN1	-2.783	0.00562	-0.036618	106	0.013158	no	LUNG
chr1_1914918_G_A_b38	PLEKHN1	-2.783	0.00562	-0.036618	106	0.013158	no	LUNG
chr1_1915326_G_A_b38	PLEKHN1	-2.783	0.00562	-0.036618	106	0.013158	no	LUNG
chr1_1916217_C_T_b38	PLEKHN1	-2.783	0.00562	-0.036618	106	0.013158	no	LUNG
chr1_1744499_C_T_b38	PLEKHN1	-2.781	0.00566	-0.032504	99	0.01169	no	LUNG
chr1_1791493_C_T_b38	PLEKHN1	-2.776	0.00573	-0.035997	106	0.012966	no	LUNG
chr1_1791592_G_A_b38	PLEKHN1	-2.776	0.00573	-0.035997	106	0.012966	no	LUNG
chr1_1757030_C_G_b38	PLEKHN1	-2.775	0.00575	-0.054529	14	0.01965	no	LUNG
chr1_1903309_A_G_b38	PLEKHN1	2.774	0.00578	0.039112	50	0.014101	no	LUNG
chr1_1776461_GAAAC_G_b38	PLEKHN1	-2.771	0.00581	-0.035874	107	0.012944	no	LUNG
chr1_1777362_A_G_b38	PLEKHN1	-2.771	0.00581	-0.035874	107	0.012944	no	LUNG
chr1_1808816_G_T_b38	PLEKHN1	-2.771	0.00581	-0.035874	107	0.012944	no	LUNG
chr1_1819825_G_A_b38	PLEKHN1	-2.771	0.00581	-0.035874	107	0.012944	no	LUNG
chr1_1676790_C_T_b38	PLEKHN1	-2.766	0.00591	-0.031898	115	0.011531	no	LUNG
chr1_1937802_G_T_b38	PLEKHN1	-2.766	0.00591	-0.03584	106	0.012958	no	LUNG
chr1_1902439_C_T_b38	PLEKHN1	-2.761	0.006	-0.035512	108	0.01286	no	LUNG
chr1_1743586_T_TAC_b38	PLEKHN1	-2.76	0.00602	-0.034422	71	0.012472	no	LUNG
chr1_1920695_A_G_b38	PLEKHN1	-2.756	0.00609	-0.036281	108	0.013163	no	LUNG
chr1_1924788_C_T_b38	PLEKHN1	-2.756	0.00609	-0.036281	108	0.013163	no	LUNG
chr1_1925233_T_C_b38	PLEKHN1	-2.754	0.00613	-0.036253	108	0.013163	no	LUNG
chr1_1899573_C_T_b38	PLEKHN1	-2.735	0.00648	-0.035446	107	0.012959	no	LUNG
chr1_1770997_G_A_b38	PLEKHN1	-2.735	0.00649	-0.034247	111	0.012523	no	LUNG
chr1_1792927_G_A_b38	PLEKHN1	-2.734	0.0065	-0.035304	106	0.012912	no	LUNG
chr1_900119_A_G_b38	PLEKHN1	-2.732	0.00654	-0.035611	44	0.013034	no	LUNG
chr1_1866508_A_G_b38	PLEKHN1	-2.726	0.00666	-0.035127	110	0.012884	no	LUNG
chr1_1875208_T_C_b38	PLEKHN1	-2.726	0.00666	-0.035127	110	0.012884	no	LUNG
chr1_1879567_T_C_b38	PLEKHN1	-2.726	0.00666	-0.035127	110	0.012884	no	LUNG
chr1_1886800_G_A_b38	PLEKHN1	-2.726	0.00666	-0.035127	110	0.012884	no	LUNG
chr1_1891654_C_CAGAG_b38	PLEKHN1	-2.726	0.00666	-0.035127	110	0.012884	no	LUNG
chr1_1925281_C_T_b38	PLEKHN1	-2.726	0.00667	-0.035941	107	0.013186	no	LUNG
chr1_1758687_A_AAC_b38	PLEKHN1	-2.723	0.00673	-0.054284	16	0.019937	no	LUNG
chr1_1810077_T_A_b38	PLEKHN1	-2.718	0.00683	-0.036628	62	0.013477	no	LUNG
chr1_1154319_G_A_b38	PLEKHN1	2.718	0.00683	0.109671	4	0.040355	no	LUNG
chr1_1154450_A_G_b38	PLEKHN1	2.718	0.00683	0.109671	4	0.040355	no	LUNG
chr1_1156196_A_C_b38	PLEKHN1	2.718	0.00683	0.109671	4	0.040355	no	LUNG
chr1_1156768_G_C_b38	PLEKHN1	2.718	0.00683	0.109671	4	0.040355	no	LUNG
chr1_1156790_G_C_b38	PLEKHN1	2.718	0.00683	0.109671	4	0.040355	no	LUNG
chr1_1864334_AAAG_A_b38	PLEKHN1	-2.707	0.00705	-0.039344	34	0.014534	no	LUNG
chr1_1764887_C_A_b38	PLEKHN1	-2.704	0.00712	-0.035056	107	0.012966	no	LUNG
chr1_1801780_A_G_b38	PLEKHN1	-2.691	0.00739	-0.037233	60	0.013835	no	LUNG
chr1_1921333_C_T_b38	PLEKHN1	-2.688	0.00747	-0.03503	108	0.013033	no	LUNG
chr1_1766653_A_G_b38	PLEKHN1	-2.687	0.00748	-0.034714	108	0.012918	no	LUNG
chr1_1773848_A_C_b38	PLEKHN1	-2.687	0.00748	-0.034714	108	0.012918	no	LUNG
chr1_1790040_C_T_b38	PLEKHN1	-2.687	0.00748	-0.034714	108	0.012918	no	LUNG
chr1_1817295_T_C_b38	PLEKHN1	-2.687	0.00748	-0.034714	108	0.012918	no	LUNG
chr1_1743565_ATAT_A_b38	PLEKHN1	-2.685	0.00753	-0.030685	83	0.01143	no	LUNG
chr1_1847030_A_G_b38	PLEKHN1	-2.685	0.00753	-0.034781	107	0.012956	no	LUNG
chr1_1850017_G_T_b38	PLEKHN1	-2.685	0.00753	-0.034781	107	0.012956	no	LUNG
chr1_591040_A_C_b38	PLEKHN1	-2.681	0.00762	-0.099252	3	0.037022	no	LUNG
chr1_1891450_G_C_b38	PLEKHN1	-2.678	0.00768	-0.03478	103	0.012986	no	LUNG
chr1_1902481_G_A_b38	PLEKHN1	-2.665	0.00799	-0.03422	107	0.012842	no	LUNG
chr1_1771864_G_A_b38	PLEKHN1	-2.662	0.00805	-0.034224	109	0.012856	no	LUNG
chr1_1772426_T_A_b38	PLEKHN1	-2.662	0.00805	-0.034224	109	0.012856	no	LUNG
chr1_899452_G_C_b38	PLEKHN1	-2.655	0.00821	-0.035046	46	0.013199	no	LUNG
chr1_189811_C_A_b38	PLEKHN1	-2.653	0.00827	-0.06386	5	0.024074	no	LUNG
chr1_1827774_A_G_b38	PLEKHN1	-2.652	0.00829	-0.034339	108	0.012949	no	LUNG
chr1_898444_T_C_b38	PLEKHN1	-2.649	0.00835	-0.034502	48	0.013023	no	LUNG
chr1_1750280_A_G_b38	PLEKHN1	-2.648	0.00838	-0.03208	114	0.012114	no	LUNG
chr1_1935987_G_A_b38	PLEKHN1	-2.644	0.00849	-0.034522	109	0.013058	no	LUNG
chr1_1741473_C_T_b38	PLEKHN1	-2.638	0.00863	-0.032322	70	0.012252	no	LUNG
chr1_1764895_A_C_b38	PLEKHN1	-2.631	0.0088	-0.054538	14	0.020727	no	LUNG
chr1_1937895_C_T_b38	PLEKHN1	-2.631	0.00882	-0.033885	108	0.012881	no	LUNG
chr1_1830575_T_C_b38	PLEKHN1	-2.625	0.00896	-0.056885	10	0.021669	no	LUNG
chr1_1151436_C_CCCCCAGCCAGAGCCTCAGGGTGAGCTCAAGGCACCAAACCCAGAACGG_b38	PLEKHN1	2.624	0.009	0.111763	3	0.042599	no	LUNG
chr1_871922_A_AT_b38	PLEKHN1	-2.617	0.00917	-0.039728	64	0.015179	no	LUNG
chr1_1772410_T_C_b38	PLEKHN1	-2.616	0.00919	-0.033606	109	0.012845	no	LUNG
chr1_1837221_C_G_b38	PLEKHN1	-2.61	0.00936	-0.054113	13	0.020734	no	LUNG
chr1_1752730_C_G_b38	PLEKHN1	-2.6	0.00963	-0.033043	105	0.012709	no	LUNG
chr1_1843381_A_T_b38	PLEKHN1	-2.6	0.00964	-0.033605	108	0.012926	no	LUNG
chr1_788757_T_TAATGGAATGG_b38	PLEKHN1	-2.598	0.00968	-0.034516	38	0.013283	no	LUNG
chr1_1691417_T_C_b38	PLEKHN1	2.588	0.00998	0.031385	107	0.012129	no	LUNG
chr1_1113191_A_G_b38	PLEKHN1	-3.977	0.000121	-0.208181	6	0.05234	yes	SLVRYG
chr1_1157310_C_T_b38	PLEKHN1	3.566	0.000525	0.153581	8	0.043072	yes	SLVRYG
chr1_1157309_G_A_b38	PLEKHN1	3.559	0.000538	0.153385	8	0.043102	yes	SLVRYG
chr1_1660683_C_T_b38	PLEKHN1	3.479	0.000706	0.142948	10	0.041088	yes	SLVRYG
chr1_928463_C_T_b38	PLEKHN1	3.42	0.00086	0.237721	4	0.069506	yes	SLVRYG
chr1_1113121_G_A_b38	PLEKHN1	-3.301	0.00128	-0.16739	7	0.050715	yes	SLVRYG
chr1_1671148_C_T_b38	PLEKHN1	-3.178	0.00189	-0.124756	13	0.039257	yes	SLVRYG
chr1_1648518_T_TGCACAC_b38	PLEKHN1	3.133	0.00218	0.241375	3	0.077038	yes	SLVRYG
chr1_1110693_C_A_b38	PLEKHN1	-3.115	0.00231	-0.159254	7	0.051118	yes	SLVRYG
chr1_1017048_G_A_b38	PLEKHN1	2.951	0.00382	0.118272	36	0.040081	yes	SLVRYG
chr1_1005757_AGCCCCCGCAGCAGT_A_b38	PLEKHN1	2.883	0.00468	0.113598	34	0.039404	yes	SLVRYG
chr1_1652913_C_T_b38	PLEKHN1	2.865	0.00493	0.119191	9	0.041598	yes	SLVRYG
chr1_1157314_CA_C_b38	PLEKHN1	2.859	0.00502	0.122544	7	0.042861	yes	SLVRYG
chr1_1650688_T_A_b38	PLEKHN1	2.817	0.00569	0.117835	9	0.041833	yes	SLVRYG
chr1_1103993_C_CT_b38	PLEKHN1	-2.806	0.00586	-0.154824	7	0.055167	yes	SLVRYG
chr1_933601_C_T_b38	PLEKHN1	-2.801	0.00595	-0.217364	8	0.077592	yes	SLVRYG
chr1_1664865_A_G_b38	PLEKHN1	2.797	0.00602	0.110589	13	0.039533	yes	SLVRYG
chr1_1657081_C_T_b38	PLEKHN1	2.759	0.00672	0.124857	9	0.045256	yes	SLVRYG
chr1_1023351_A_G_b38	PLEKHN1	-2.754	0.00682	-0.110655	17	0.040179	yes	SLVRYG
chr1_1023525_A_G_b38	PLEKHN1	-2.754	0.00682	-0.110655	17	0.040179	yes	SLVRYG
chr1_1109108_ACCACAGCCAAAAGGTGGGAGCAAGTGTCCAC_A_b38	PLEKHN1	-2.723	0.00746	-0.143228	7	0.052605	yes	SLVRYG
chr1_1023789_G_C_b38	PLEKHN1	2.701	0.00794	0.100478	33	0.037206	yes	SLVRYG
chr1_101225_C_A_b38	PLEKHN1	2.674	0.00855	0.12515	7	0.046798	yes	SLVRYG
chr1_1121335_C_T_b38	PLEKHN1	-2.673	0.00857	-0.142408	9	0.053268	yes	SLVRYG
chr1_1658830_C_G_b38	PLEKHN1	2.667	0.00872	0.114368	8	0.042877	yes	SLVRYG
chr1_1032846_C_A_b38	PLEKHN1	-2.632	0.00961	-0.105531	14	0.040091	yes	SLVRYG
chr1_1648636_G_A_b38	PLEKHN1	2.618	0.01	0.103091	16	0.039373	yes	SLVRYG
chr1_983193_A_G_b38	PLEKHN1	3.621	0.000434	0.1408	35	0.038888	no	SLVRYG
chr1_981454_G_A_b38	PLEKHN1	3.531	0.000591	0.134962	36	0.038219	no	SLVRYG
chr1_1660408_T_C_b38	PLEKHN1	3.39	0.00095	0.153185	4	0.045181	no	SLVRYG
chr1_979472_G_C_b38	PLEKHN1	3.357	0.00106	0.127145	40	0.037879	no	SLVRYG
chr1_978953_C_G_b38	PLEKHN1	3.352	0.00108	0.124198	39	0.037052	no	SLVRYG
chr1_1004716_C_T_b38	PLEKHN1	3.318	0.0012	0.131557	35	0.039644	no	SLVRYG
chr1_979560_T_C_b38	PLEKHN1	3.31	0.00124	0.127569	36	0.038542	no	SLVRYG
chr1_983004_G_T_b38	PLEKHN1	3.304	0.00126	0.132538	35	0.040112	no	SLVRYG
chr1_1650777_G_A_b38	PLEKHN1	3.26	0.00146	0.129076	12	0.039592	no	SLVRYG
chr1_1651137_C_T_b38	PLEKHN1	3.26	0.00146	0.129076	12	0.039592	no	SLVRYG
chr1_1651267_T_C_b38	PLEKHN1	3.26	0.00146	0.129076	12	0.039592	no	SLVRYG
chr1_1651421_GTAGCCCCTCTGAACGGTCTGTGACACACGCATGCTTTCAGCTAGAGTACTCTA_G_b38	PLEKHN1	3.26	0.00146	0.129076	12	0.039592	no	SLVRYG
chr1_1651574_G_A_b38	PLEKHN1	3.26	0.00146	0.129076	12	0.039592	no	SLVRYG
chr1_1651785_C_A_b38	PLEKHN1	3.26	0.00146	0.129076	12	0.039592	no	SLVRYG
chr1_1651926_T_C_b38	PLEKHN1	3.26	0.00146	0.129076	12	0.039592	no	SLVRYG
chr1_1652061_T_C_b38	PLEKHN1	3.26	0.00146	0.129076	12	0.039592	no	SLVRYG
chr1_1652135_C_G_b38	PLEKHN1	3.26	0.00146	0.129076	12	0.039592	no	SLVRYG
chr1_1652191_C_T_b38	PLEKHN1	3.26	0.00146	0.129076	12	0.039592	no	SLVRYG
chr1_1652592_A_G_b38	PLEKHN1	3.26	0.00146	0.129076	12	0.039592	no	SLVRYG
chr1_1652779_A_G_b38	PLEKHN1	3.26	0.00146	0.129076	12	0.039592	no	SLVRYG
chr1_1653147_A_C_b38	PLEKHN1	3.26	0.00146	0.129076	12	0.039592	no	SLVRYG
chr1_1653396_T_C_b38	PLEKHN1	3.26	0.00146	0.129076	12	0.039592	no	SLVRYG
chr1_1653472_T_C_b38	PLEKHN1	3.26	0.00146	0.129076	12	0.039592	no	SLVRYG
chr1_1653811_G_A_b38	PLEKHN1	3.26	0.00146	0.129076	12	0.039592	no	SLVRYG
chr1_1653893_C_T_b38	PLEKHN1	3.26	0.00146	0.129076	12	0.039592	no	SLVRYG
chr1_1653934_G_A_b38	PLEKHN1	3.26	0.00146	0.129076	12	0.039592	no	SLVRYG
chr1_1654143_G_A_b38	PLEKHN1	3.26	0.00146	0.129076	12	0.039592	no	SLVRYG
chr1_1654188_T_G_b38	PLEKHN1	3.26	0.00146	0.129076	12	0.039592	no	SLVRYG
chr1_1008588_C_T_b38	PLEKHN1	3.24	0.00155	0.13042	35	0.040254	no	SLVRYG
chr1_928483_G_A_b38	PLEKHN1	3.226	0.00162	0.224864	5	0.069701	no	SLVRYG
chr1_1650664_CTTTTT_C_b38	PLEKHN1	3.214	0.00169	0.142392	6	0.044297	no	SLVRYG
chr1_1120047_GA_G_b38	PLEKHN1	-3.2	0.00177	-0.188807	6	0.059002	no	SLVRYG
chr1_1015925_A_ATT_b38	PLEKHN1	-3.133	0.00218	-0.124914	16	0.039867	no	SLVRYG
chr1_1671097_G_C_b38	PLEKHN1	-3.12	0.00227	-0.125049	12	0.040078	no	SLVRYG
chr1_992967_GGGAGGGTCCATGTGTCCGTCATCTGA_G_b38	PLEKHN1	3.105	0.00238	0.121582	37	0.039153	no	SLVRYG
chr1_1015915_C_T_b38	PLEKHN1	3.084	0.00254	0.123467	35	0.040035	no	SLVRYG
chr1_1048922_T_C_b38	PLEKHN1	3.071	0.00265	0.114752	35	0.037363	no	SLVRYG
chr1_978509_G_A_b38	PLEKHN1	3.035	0.00296	0.115216	40	0.037968	no	SLVRYG
chr1_1658866_G_A_b38	PLEKHN1	2.995	0.00334	0.118234	13	0.039476	no	SLVRYG
chr1_1659114_A_G_b38	PLEKHN1	2.995	0.00334	0.118234	13	0.039476	no	SLVRYG
chr1_1659220_A_G_b38	PLEKHN1	2.995	0.00334	0.118234	13	0.039476	no	SLVRYG
chr1_1661420_C_A_b38	PLEKHN1	2.995	0.00334	0.118234	13	0.039476	no	SLVRYG
chr1_1130879_G_C_b38	PLEKHN1	2.978	0.00352	0.14728	5	0.049458	no	SLVRYG
chr1_1018572_G_A_b38	PLEKHN1	2.976	0.00354	0.120646	37	0.040541	no	SLVRYG
chr1_1015903_C_T_b38	PLEKHN1	2.95	0.00383	0.118694	36	0.040234	no	SLVRYG
chr1_1014733_GAAGT_G_b38	PLEKHN1	2.915	0.00426	0.114313	37	0.039218	no	SLVRYG
chr1_1664757_T_C_b38	PLEKHN1	2.906	0.00438	0.113668	13	0.03912	no	SLVRYG
chr1_1019397_C_A_b38	PLEKHN1	2.863	0.00496	0.11454	37	0.040004	no	SLVRYG
chr1_998410_G_A_b38	PLEKHN1	2.86	0.00501	0.115879	36	0.040511	no	SLVRYG
chr1_53920_G_C_b38	PLEKHN1	-2.857	0.00506	-0.221118	3	0.077403	no	SLVRYG
chr1_999842_C_A_b38	PLEKHN1	2.846	0.00522	0.118381	37	0.041589	no	SLVRYG
chr1_1650195_A_G_b38	PLEKHN1	2.827	0.00553	0.114356	12	0.040455	no	SLVRYG
chr1_60249_C_T_b38	PLEKHN1	-2.815	0.00571	-0.202712	4	0.072005	no	SLVRYG
chr1_998762_A_AGGGGAGG_b38	PLEKHN1	2.805	0.00589	0.103672	30	0.036963	no	SLVRYG
chr1_1151436_C_CCCCCAGCCAGAGCCTCAGGGTGAGCTCAAGGCACCAAACCCAGAACGG_b38	PLEKHN1	2.775	0.00642	0.251011	3	0.09046	no	SLVRYG
chr1_1118344_A_G_b38	PLEKHN1	-2.768	0.00654	-0.142548	10	0.051491	no	SLVRYG
chr1_1118696_C_T_b38	PLEKHN1	-2.768	0.00654	-0.142548	10	0.051491	no	SLVRYG
chr1_1025029_G_C_b38	PLEKHN1	2.764	0.00662	0.108425	38	0.039222	no	SLVRYG
chr1_726821_G_A_b38	PLEKHN1	-2.751	0.00687	-0.124431	12	0.045227	no	SLVRYG
chr1_1016623_G_A_b38	PLEKHN1	-2.75	0.0069	-0.110853	19	0.040314	no	SLVRYG
chr1_927744_G_T_b38	PLEKHN1	-2.748	0.00694	-0.208344	9	0.075817	no	SLVRYG
chr1_1668108_C_T_b38	PLEKHN1	-2.729	0.00732	-0.109992	13	0.040302	no	SLVRYG
chr1_974039_C_T_b38	PLEKHN1	-2.728	0.00735	-0.141967	5	0.052045	no	SLVRYG
chr1_989068_GTTGA_G_b38	PLEKHN1	2.704	0.00786	0.109623	35	0.04054	no	SLVRYG
chr1_1101480_A_C_b38	PLEKHN1	-2.676	0.00851	-0.144287	8	0.053917	no	SLVRYG
chr1_1101923_T_C_b38	PLEKHN1	-2.676	0.00851	-0.144287	8	0.053917	no	SLVRYG
chr1_1101987_G_A_b38	PLEKHN1	-2.676	0.00851	-0.144287	8	0.053917	no	SLVRYG
chr1_1103617_ACTC_A_b38	PLEKHN1	-2.676	0.00851	-0.144287	8	0.053917	no	SLVRYG
chr1_1103888_T_C_b38	PLEKHN1	-2.676	0.00851	-0.144287	8	0.053917	no	SLVRYG
chr1_1104437_A_G_b38	PLEKHN1	-2.676	0.00851	-0.144287	8	0.053917	no	SLVRYG
chr1_1104646_T_C_b38	PLEKHN1	-2.676	0.00851	-0.144287	8	0.053917	no	SLVRYG
chr1_1105092_C_T_b38	PLEKHN1	-2.676	0.00851	-0.144287	8	0.053917	no	SLVRYG
chr1_1105560_A_C_b38	PLEKHN1	-2.676	0.00851	-0.144287	8	0.053917	no	SLVRYG
chr1_1105605_C_G_b38	PLEKHN1	-2.676	0.00851	-0.144287	8	0.053917	no	SLVRYG
chr1_1105739_G_GGGCGTGGT_b38	PLEKHN1	-2.676	0.00851	-0.144287	8	0.053917	no	SLVRYG
chr1_1106406_T_C_b38	PLEKHN1	-2.676	0.00851	-0.144287	8	0.053917	no	SLVRYG
chr1_1107103_C_T_b38	PLEKHN1	-2.676	0.00851	-0.144287	8	0.053917	no	SLVRYG
chr1_1107547_G_T_b38	PLEKHN1	-2.676	0.00851	-0.144287	8	0.053917	no	SLVRYG
chr1_1107673_A_G_b38	PLEKHN1	-2.676	0.00851	-0.144287	8	0.053917	no	SLVRYG
chr1_1107882_T_C_b38	PLEKHN1	-2.676	0.00851	-0.144287	8	0.053917	no	SLVRYG
chr1_925081_G_A_b38	PLEKHN1	-2.646	0.00925	-0.191061	8	0.072198	no	SLVRYG
chr1_925141_C_A_b38	PLEKHN1	-2.646	0.00925	-0.191061	8	0.072198	no	SLVRYG
chr1_925628_G_C_b38	PLEKHN1	-2.646	0.00925	-0.191061	8	0.072198	no	SLVRYG
chr1_926428_A_G_b38	PLEKHN1	-2.646	0.00925	-0.191061	8	0.072198	no	SLVRYG
chr1_926713_T_C_b38	PLEKHN1	-2.646	0.00925	-0.191061	8	0.072198	no	SLVRYG
chr1_926744_A_G_b38	PLEKHN1	-2.646	0.00925	-0.191061	8	0.072198	no	SLVRYG
chr1_927003_C_T_b38	PLEKHN1	-2.646	0.00925	-0.191061	8	0.072198	no	SLVRYG
chr1_927009_A_G_b38	PLEKHN1	-2.646	0.00925	-0.191061	8	0.072198	no	SLVRYG
chr1_1118005_C_T_b38	PLEKHN1	-2.635	0.00954	-0.105591	34	0.04007	no	SLVRYG
chr1_975029_T_C_b38	PLEKHN1	7.676	6.2e-14	0.135477	11	0.017648	yes	MSCLSK
chr1_975014_C_T_b38	PLEKHN1	7.529	1.77e-13	0.092557	100	0.012294	yes	MSCLSK
chr1_969640_A_G_b38	PLEKHN1	5.173	3.09e-07	0.243647	3	0.047096	yes	MSCLSK
chr1_978509_G_A_b38	PLEKHN1	-4.857	1.5e-06	-0.05929	167	0.012208	yes	MSCLSK
chr1_979472_G_C_b38	PLEKHN1	-4.768	2.31e-06	-0.058259	168	0.012219	yes	MSCLSK
chr1_978953_C_G_b38	PLEKHN1	-4.426	1.13e-05	-0.053662	156	0.012124	yes	MSCLSK
chr1_983747_T_C_b38	PLEKHN1	4.339	1.66e-05	0.064862	34	0.014948	yes	MSCLSK
chr1_1080338_G_A_b38	PLEKHN1	4.21	2.93e-05	0.205645	3	0.048851	yes	MSCLSK
chr1_983193_A_G_b38	PLEKHN1	-4.12	4.3e-05	-0.050466	165	0.01225	yes	MSCLSK
chr1_969648_ACGTG_A_b38	PLEKHN1	4.075	5.18e-05	0.163042	6	0.040009	yes	MSCLSK
chr1_60351_A_G_b38	PLEKHN1	4.007	6.89e-05	0.090419	11	0.022567	yes	MSCLSK
chr1_981169_A_G_b38	PLEKHN1	-3.945	8.85e-05	-0.055834	49	0.014151	yes	MSCLSK
chr1_64931_G_A_b38	PLEKHN1	3.928	9.5e-05	0.090829	9	0.023122	yes	MSCLSK
chr1_1007325_A_G_b38	PLEKHN1	3.839	0.000136	0.131038	12	0.034134	yes	MSCLSK
chr1_986336_C_A_b38	PLEKHN1	-3.815	0.000149	-0.049893	178	0.013077	yes	MSCLSK
chr1_999842_C_A_b38	PLEKHN1	-3.811	0.000152	-0.04948	187	0.012982	yes	MSCLSK
chr1_1477850_C_G_b38	PLEKHN1	3.741	2e-04	0.125525	8	0.033557	yes	MSCLSK
chr1_1477855_G_C_b38	PLEKHN1	3.741	2e-04	0.125525	8	0.033557	yes	MSCLSK
chr1_1007358_G_C_b38	PLEKHN1	3.727	0.000211	0.151072	4	0.040536	yes	MSCLSK
chr1_975058_A_G_b38	PLEKHN1	-3.725	0.000213	-0.113457	6	0.030461	yes	MSCLSK
chr1_1018572_G_A_b38	PLEKHN1	-3.68	0.000253	-0.047166	184	0.012818	yes	MSCLSK
chr1_1017048_G_A_b38	PLEKHN1	-3.637	0.000298	-0.046329	179	0.012739	yes	MSCLSK
chr1_1019397_C_A_b38	PLEKHN1	-3.593	0.000353	-0.045881	184	0.012771	yes	MSCLSK
chr1_58814_G_A_b38	PLEKHN1	3.591	0.000354	0.072267	13	0.020122	yes	MSCLSK
chr1_1054900_C_T_b38	PLEKHN1	-3.493	0.00051	-0.046186	92	0.013221	yes	MSCLSK
chr1_992993_A_G_b38	PLEKHN1	3.484	0.000527	0.042756	155	0.012271	yes	MSCLSK
chr1_1474819_G_C_b38	PLEKHN1	3.468	0.000559	0.094241	10	0.027172	yes	MSCLSK
chr1_982260_G_A_b38	PLEKHN1	3.454	0.000588	0.054025	27	0.01564	yes	MSCLSK
chr1_982858_C_G_b38	PLEKHN1	3.454	0.000588	0.054025	27	0.01564	yes	MSCLSK
chr1_992967_GGGAGGGTCCATGTGTCCGTCATCTGA_G_b38	PLEKHN1	-3.432	0.000637	-0.043284	192	0.01261	yes	MSCLSK
chr1_1023789_G_C_b38	PLEKHN1	-3.426	0.000652	-0.042634	169	0.012444	yes	MSCLSK
chr1_1050906_C_T_b38	PLEKHN1	3.41	0.000691	0.130544	3	0.038283	yes	MSCLSK
chr1_1052636_T_C_b38	PLEKHN1	3.41	0.000691	0.130544	3	0.038283	yes	MSCLSK
chr1_1053192_GGTGTCTGCACGTGGGTGTCTGCATGTGGGTGTCTGTGCCCTCAAGTGTCTC_G_b38	PLEKHN1	3.41	0.000691	0.130544	3	0.038283	yes	MSCLSK
chr1_989148_C_A_b38	PLEKHN1	-3.386	0.000752	-0.043911	183	0.012967	yes	MSCLSK
chr1_1006159_C_T_b38	PLEKHN1	3.383	0.000761	0.042145	121	0.012458	yes	MSCLSK
chr1_1479205_A_C_b38	PLEKHN1	3.371	0.000796	0.06694	30	0.01986	yes	MSCLSK
chr1_1500729_G_A_b38	PLEKHN1	3.331	0.000915	0.082584	39	0.024792	yes	MSCLSK
chr1_1055563_G_C_b38	PLEKHN1	3.316	0.000966	0.125069	3	0.037721	yes	MSCLSK
chr1_1058479_G_A_b38	PLEKHN1	3.245	0.00123	0.141801	3	0.043694	yes	MSCLSK
chr1_1059015_AG_A_b38	PLEKHN1	3.245	0.00123	0.141801	3	0.043694	yes	MSCLSK
chr1_1055037_T_C_b38	PLEKHN1	3.243	0.00124	0.04268	84	0.01316	yes	MSCLSK
chr1_1050630_T_C_b38	PLEKHN1	3.242	0.00125	0.150657	3	0.046471	yes	MSCLSK
chr1_1004625_A_G_b38	PLEKHN1	3.241	0.00126	0.040511	119	0.012501	yes	MSCLSK
chr1_1023851_G_A_b38	PLEKHN1	-3.238	0.00127	-0.041441	160	0.0128	yes	MSCLSK
chr1_1014863_A_C_b38	PLEKHN1	3.188	0.0015	0.040418	105	0.012679	yes	MSCLSK
chr1_1057439_G_A_b38	PLEKHN1	-3.187	0.00151	-0.039639	164	0.012438	yes	MSCLSK
chr1_1022868_A_G_b38	PLEKHN1	3.175	0.00157	0.041201	93	0.012975	yes	MSCLSK
chr1_1514366_A_G_b38	PLEKHN1	3.16	0.00165	0.088592	8	0.028034	yes	MSCLSK
chr1_1023775_G_A_b38	PLEKHN1	-3.15	0.00171	-0.039789	173	0.012632	yes	MSCLSK
chr1_1039411_T_TGG_b38	PLEKHN1	-3.149	0.00171	-0.041529	133	0.013187	yes	MSCLSK
chr1_1485282_A_G_b38	PLEKHN1	3.144	0.00174	0.094226	12	0.02997	yes	MSCLSK
chr1_56381_T_C_b38	PLEKHN1	3.144	0.00175	0.071405	11	0.022712	yes	MSCLSK
chr1_1071133_G_A_b38	PLEKHN1	3.135	0.0018	0.142608	3	0.045488	yes	MSCLSK
chr1_1523187_A_G_b38	PLEKHN1	3.123	0.00187	0.072868	41	0.023332	yes	MSCLSK
chr1_1039411_T_TGGG_b38	PLEKHN1	3.118	0.00191	0.04413	49	0.014155	yes	MSCLSK
chr1_1479683_T_G_b38	PLEKHN1	3.102	0.00201	0.0784	44	0.025277	yes	MSCLSK
chr1_1480096_G_C_b38	PLEKHN1	3.102	0.00201	0.0784	44	0.025277	yes	MSCLSK
chr1_998750_G_C_b38	PLEKHN1	3.077	0.00218	0.050836	17	0.016521	yes	MSCLSK
chr1_1486354_G_C_b38	PLEKHN1	3.047	0.00241	0.10228	9	0.033567	yes	MSCLSK
chr1_1071101_C_A_b38	PLEKHN1	3.022	0.00261	0.125691	5	0.04159	yes	MSCLSK
chr1_1479334_A_G_b38	PLEKHN1	3.013	0.00269	0.070834	45	0.023511	yes	MSCLSK
chr1_1054120_G_A_b38	PLEKHN1	3	0.00281	0.071552	4	0.023855	yes	MSCLSK
chr1_1057980_C_A_b38	PLEKHN1	-2.965	0.00314	-0.037661	184	0.012703	yes	MSCLSK
chr1_1055000_C_T_b38	PLEKHN1	2.944	0.00336	0.039283	73	0.013345	yes	MSCLSK
chr1_1050446_G_A_b38	PLEKHN1	2.941	0.00339	0.134485	3	0.045722	yes	MSCLSK
chr1_1056524_C_T_b38	PLEKHN1	2.941	0.00339	0.115336	3	0.039221	yes	MSCLSK
chr1_1059925_CT_C_b38	PLEKHN1	2.91	0.00374	0.126044	3	0.043316	yes	MSCLSK
chr1_1025029_G_C_b38	PLEKHN1	-2.897	0.00389	-0.037526	187	0.012951	yes	MSCLSK
chr1_1058201_G_A_b38	PLEKHN1	2.893	0.00394	0.119245	3	0.041212	yes	MSCLSK
chr1_1059390_C_A_b38	PLEKHN1	2.89	0.00398	0.124758	3	0.043168	yes	MSCLSK
chr1_1054081_G_A_b38	PLEKHN1	2.881	0.0041	0.113844	3	0.039512	yes	MSCLSK
chr1_1048922_T_C_b38	PLEKHN1	-2.865	0.0043	-0.035705	169	0.012461	yes	MSCLSK
chr1_1471992_T_C_b38	PLEKHN1	2.857	0.00441	0.043989	97	0.015395	yes	MSCLSK
chr1_1069566_G_A_b38	PLEKHN1	2.852	0.00449	0.124704	3	0.043733	yes	MSCLSK
chr1_629626_T_C_b38	PLEKHN1	2.848	0.00454	0.073761	7	0.025899	yes	MSCLSK
chr1_1069009_T_TC_b38	PLEKHN1	-2.84	0.00466	-0.03559	148	0.012533	yes	MSCLSK
chr1_1000814_A_G_b38	PLEKHN1	-2.83	0.00481	-0.043919	53	0.015521	yes	MSCLSK
chr1_1000291_C_G_b38	PLEKHN1	2.827	0.00485	0.046857	17	0.016575	yes	MSCLSK
chr1_1014228_G_A_b38	PLEKHN1	2.826	0.00487	0.035381	117	0.012521	yes	MSCLSK
chr1_1081587_G_A_b38	PLEKHN1	2.823	0.0049	0.117015	5	0.041445	yes	MSCLSK
chr1_1000731_C_T_b38	PLEKHN1	-2.819	0.00497	-0.036063	167	0.012793	yes	MSCLSK
chr1_995187_A_G_b38	PLEKHN1	2.812	0.00507	0.035683	118	0.012688	yes	MSCLSK
chr1_1514211_A_G_b38	PLEKHN1	2.81	0.0051	0.072278	20	0.025717	yes	MSCLSK
chr1_1495221_G_A_b38	PLEKHN1	2.796	0.00533	0.081948	12	0.029309	yes	MSCLSK
chr1_1495222_T_G_b38	PLEKHN1	2.796	0.00533	0.081948	12	0.029309	yes	MSCLSK
chr1_985597_T_C_b38	PLEKHN1	2.766	0.00584	0.046012	17	0.016634	yes	MSCLSK
chr1_995153_C_G_b38	PLEKHN1	2.757	0.00599	0.035019	117	0.0127	yes	MSCLSK
chr1_987103_T_C_b38	PLEKHN1	2.753	0.00607	0.045788	17	0.016632	yes	MSCLSK
chr1_1081492_G_A_b38	PLEKHN1	2.734	0.00642	0.113895	5	0.041652	yes	MSCLSK
chr1_991588_C_T_b38	PLEKHN1	2.727	0.00656	0.045252	17	0.016593	yes	MSCLSK
chr1_972790_C_G_b38	PLEKHN1	2.722	0.00667	0.080085	15	0.029421	yes	MSCLSK
chr1_1550173_CA_C_b38	PLEKHN1	2.711	0.0069	0.079833	3	0.029451	yes	MSCLSK
chr1_1533018_T_C_b38	PLEKHN1	2.705	0.00702	0.06582	34	0.024335	yes	MSCLSK
chr1_994185_G_T_b38	PLEKHN1	2.691	0.00732	0.045147	15	0.016778	yes	MSCLSK
chr1_1016184_A_G_b38	PLEKHN1	2.679	0.00758	0.033759	113	0.012602	yes	MSCLSK
chr1_262683_C_CT_b38	PLEKHN1	2.675	0.00766	0.066568	8	0.024885	yes	MSCLSK
chr1_1075450_A_G_b38	PLEKHN1	2.669	0.00779	0.108945	5	0.040814	yes	MSCLSK
chr1_1082218_A_G_b38	PLEKHN1	2.669	0.00779	0.108945	5	0.040814	yes	MSCLSK
chr1_1527386_C_T_b38	PLEKHN1	2.666	0.00787	0.066256	35	0.024854	yes	MSCLSK
chr1_94699_G_A_b38	PLEKHN1	2.664	0.00792	0.103574	4	0.038882	yes	MSCLSK
chr1_1032278_C_T_b38	PLEKHN1	-2.653	0.00817	-0.034265	189	0.012914	yes	MSCLSK
chr1_92836_G_A_b38	PLEKHN1	-2.646	0.00834	-0.061712	8	0.023319	yes	MSCLSK
chr1_1000079_A_G_b38	PLEKHN1	-2.645	0.00837	-0.040844	59	0.015443	yes	MSCLSK
chr1_1074345_G_GGGTCATGCT_b38	PLEKHN1	2.64	0.00851	0.108573	5	0.041133	yes	MSCLSK
chr1_1075479_G_A_b38	PLEKHN1	2.64	0.00851	0.108573	5	0.041133	yes	MSCLSK
chr1_1075491_G_C_b38	PLEKHN1	2.64	0.00851	0.108573	5	0.041133	yes	MSCLSK
chr1_1526169_C_T_b38	PLEKHN1	2.632	0.00868	0.061413	32	0.023329	yes	MSCLSK
chr1_1499586_C_CT_b38	PLEKHN1	2.623	0.00893	0.048103	31	0.018341	yes	MSCLSK
chr1_1934821_C_CATTGTAGGTACGTGTGTACGTGGGTGTTAGGTTGTAGGTACACACGTGTATATGTGGGTGTTAG_b38	PLEKHN1	2.621	0.00897	0.101397	5	0.038681	yes	MSCLSK
chr1_55131_A_G_b38	PLEKHN1	2.617	0.00909	0.062721	10	0.023969	yes	MSCLSK
chr1_1000453_C_G_b38	PLEKHN1	-2.609	0.0093	-0.040507	57	0.015526	yes	MSCLSK
chr1_969562_A_G_b38	PLEKHN1	2.606	0.00938	0.095778	14	0.036756	yes	MSCLSK
chr1_1081836_A_G_b38	PLEKHN1	2.584	0.00999	0.115491	3	0.044693	yes	MSCLSK
chr1_1008683_G_A_b38	PLEKHN1	4.693	3.3e-06	0.225056	3	0.047956	no	MSCLSK
chr1_1007026_G_A_b38	PLEKHN1	4.485	8.64e-06	0.205346	3	0.045781	no	MSCLSK
chr1_974039_C_T_b38	PLEKHN1	4.483	8.72e-06	0.07173	26	0.016	no	MSCLSK
chr1_983004_G_T_b38	PLEKHN1	-4.269	2.27e-05	-0.053115	189	0.012443	no	MSCLSK
chr1_979560_T_C_b38	PLEKHN1	-4.263	2.32e-05	-0.052763	175	0.012377	no	MSCLSK
chr1_981454_G_A_b38	PLEKHN1	-4.05	5.76e-05	-0.049473	164	0.012217	no	MSCLSK
chr1_1028565_T_C_b38	PLEKHN1	3.835	0.000138	0.167559	3	0.043695	no	MSCLSK
chr1_791549_G_GGAATGGAATC_b38	PLEKHN1	-3.711	0.000225	-0.053736	44	0.014482	no	MSCLSK
chr1_1009184_T_C_b38	PLEKHN1	3.471	0.000553	0.043438	111	0.012513	no	MSCLSK
chr1_1004716_C_T_b38	PLEKHN1	-3.431	0.00064	-0.043174	162	0.012583	no	MSCLSK
chr1_61920_G_A_b38	PLEKHN1	3.242	0.00125	0.110453	5	0.034066	no	MSCLSK
chr1_868735_G_A_b38	PLEKHN1	-3.221	0.00134	-0.144702	3	0.044928	no	MSCLSK
chr1_1005757_AGCCCCCGCAGCAGT_A_b38	PLEKHN1	-3.197	0.00146	-0.040148	153	0.012558	no	MSCLSK
chr1_1023525_A_G_b38	PLEKHN1	3.183	0.00153	0.041535	90	0.013048	no	MSCLSK
chr1_1052514_C_CGT_b38	PLEKHN1	-3.147	0.00173	-0.040825	142	0.012973	no	MSCLSK
chr1_1023573_A_G_b38	PLEKHN1	3.053	0.00236	0.03998	91	0.013096	no	MSCLSK
chr1_1048791_CAG_C_b38	PLEKHN1	-3.024	0.0026	-0.040257	157	0.013313	no	MSCLSK
chr1_1023351_A_G_b38	PLEKHN1	3.003	0.00278	0.03897	89	0.012979	no	MSCLSK
chr1_75200_G_C_b38	PLEKHN1	2.974	0.00305	0.144737	3	0.048664	no	MSCLSK
chr1_998410_G_A_b38	PLEKHN1	-2.933	0.00348	-0.037404	162	0.012752	no	MSCLSK
chr1_1049886_C_T_b38	PLEKHN1	-2.924	0.00358	-0.036961	181	0.01264	no	MSCLSK
chr1_76522_C_A_b38	PLEKHN1	2.892	0.00396	0.095996	6	0.033195	no	MSCLSK
chr1_791559_G_C_b38	PLEKHN1	2.88	0.00411	0.059441	5	0.02064	no	MSCLSK
chr1_1002415_CT_C_b38	PLEKHN1	2.808	0.00513	0.041352	54	0.014725	no	MSCLSK
chr1_789680_A_AGGAATGGAATGGAAT_b38	PLEKHN1	-2.755	0.00605	-0.036641	71	0.013302	no	MSCLSK
chr1_995371_C_G_b38	PLEKHN1	2.745	0.00622	0.034702	106	0.012642	no	MSCLSK
chr1_1002417_T_A_b38	PLEKHN1	2.742	0.00628	0.043471	39	0.015853	no	MSCLSK
chr1_984121_G_T_b38	PLEKHN1	-2.737	0.00636	-0.034218	181	0.0125	no	MSCLSK
chr1_1468636_G_A_b38	PLEKHN1	2.707	0.00696	0.085443	10	0.031559	no	MSCLSK
chr1_63671_G_A_b38	PLEKHN1	2.701	0.0071	0.04456	23	0.016497	no	MSCLSK
chr1_1063121_G_C_b38	PLEKHN1	2.686	0.00741	0.042723	27	0.015904	no	MSCLSK
chr1_1471663_A_C_b38	PLEKHN1	2.681	0.00753	0.087977	8	0.032816	no	MSCLSK
chr1_898676_A_C_b38	PLEKHN1	-2.679	0.00757	-0.071368	14	0.026636	no	MSCLSK
chr1_899257_AC_A_b38	PLEKHN1	-2.679	0.00757	-0.071368	14	0.026636	no	MSCLSK
chr1_1716966_A_G_b38	PLEKHN1	-2.679	0.00758	-0.05439	19	0.020304	no	MSCLSK
chr1_1716710_G_T_b38	PLEKHN1	2.675	0.00766	0.130106	3	0.048633	no	MSCLSK
chr1_1015925_A_ATT_b38	PLEKHN1	2.632	0.0087	0.034488	85	0.013105	no	MSCLSK
chr1_1951642_C_T_b38	PLEKHN1	2.624	0.00891	0.03765	47	0.01435	no	MSCLSK
chr1_1951498_C_T_b38	PLEKHN1	2.607	0.00935	0.037432	47	0.014358	no	MSCLSK
chr1_1022518_G_T_b38	PLEKHN1	2.602	0.00949	0.033396	87	0.012836	no	MSCLSK
chr1_791545_G_T_b38	PLEKHN1	-2.595	0.00969	-0.061722	18	0.023789	no	MSCLSK
chr1_1818305_TAAAAAAA_T_b38	PLEKHN1	2.586	0.00993	0.045509	12	0.017598	no	MSCLSK
chr1_966227_C_G_b38	PLEKHN1	6.47	2.51e-10	0.109143	10	0.01687	yes	NERVET
chr1_962358_C_T_b38	PLEKHN1	-6.375	4.45e-10	-0.110062	6	0.017264	yes	NERVET
chr1_950669_ACAG_A_b38	PLEKHN1	6.261	8.74e-10	0.103956	8	0.016603	yes	NERVET
chr1_958251_A_G_b38	PLEKHN1	6.25	9.33e-10	0.109349	5	0.017495	yes	NERVET
chr1_949046_A_AACAGCAAAG_b38	PLEKHN1	6.225	1.08e-09	0.109816	5	0.017641	yes	NERVET
chr1_954258_G_C_b38	PLEKHN1	6.196	1.29e-09	0.11066	4	0.017861	yes	NERVET
chr1_962184_T_C_b38	PLEKHN1	6.192	1.31e-09	0.107542	6	0.017368	yes	NERVET
chr1_961945_G_C_b38	PLEKHN1	6.181	1.4e-09	0.103317	8	0.016715	yes	NERVET
chr1_954333_C_A_b38	PLEKHN1	6.098	2.27e-09	0.108635	4	0.017815	yes	NERVET
chr1_950296_C_A_b38	PLEKHN1	6.024	3.48e-09	0.111305	3	0.018477	yes	NERVET
chr1_952180_A_C_b38	PLEKHN1	6.024	3.48e-09	0.111305	3	0.018477	yes	NERVET
chr1_958339_G_A_b38	PLEKHN1	6.019	3.58e-09	0.098009	8	0.016283	yes	NERVET
chr1_953778_G_C_b38	PLEKHN1	5.942	5.55e-09	0.113556	3	0.01911	yes	NERVET
chr1_953779_A_C_b38	PLEKHN1	5.942	5.55e-09	0.113556	3	0.01911	yes	NERVET
chr1_942335_C_G_b38	PLEKHN1	5.931	5.91e-09	0.101305	6	0.01708	yes	NERVET
chr1_966179_G_A_b38	PLEKHN1	5.917	6.41e-09	0.086197	30	0.014568	yes	NERVET
chr1_959193_G_A_b38	PLEKHN1	5.566	4.43e-08	0.082723	35	0.014862	yes	NERVET
chr1_965350_G_A_b38	PLEKHN1	5.557	4.65e-08	0.084955	30	0.015288	yes	NERVET
chr1_960326_G_A_b38	PLEKHN1	5.245	2.39e-07	0.072226	34	0.013771	yes	NERVET
chr1_960375_A_AG_b38	PLEKHN1	5.038	6.77e-07	0.068043	35	0.013506	yes	NERVET
chr1_951408_G_A_b38	PLEKHN1	4.773	2.45e-06	0.067967	21	0.014241	yes	NERVET
chr1_951437_C_T_b38	PLEKHN1	4.773	2.45e-06	0.067967	21	0.014241	yes	NERVET
chr1_939779_AGCCAGTGGACGCCGACCT_A_b38	PLEKHN1	4.76	2.6e-06	0.044956	102	0.009445	yes	NERVET
chr1_928252_C_T_b38	PLEKHN1	-4.364	1.58e-05	-0.068048	24	0.015593	yes	NERVET
chr1_955679_C_T_b38	PLEKHN1	4.348	1.69e-05	0.042918	99	0.009871	yes	NERVET
chr1_956565_A_G_b38	PLEKHN1	4.348	1.69e-05	0.042918	99	0.009871	yes	NERVET
chr1_946247_G_A_b38	PLEKHN1	4.3	2.09e-05	0.043198	103	0.010047	yes	NERVET
chr1_949171_GAGAA_G_b38	PLEKHN1	4.285	2.23e-05	0.041922	101	0.009783	yes	NERVET
chr1_965337_CTTAT_C_b38	PLEKHN1	4.184	3.43e-05	0.041709	114	0.009968	yes	NERVET
chr1_960891_C_T_b38	PLEKHN1	4.097	4.94e-05	0.039553	119	0.009654	yes	NERVET
chr1_928261_G_A_b38	PLEKHN1	-4.035	6.4e-05	-0.056449	16	0.013991	yes	NERVET
chr1_928264_T_C_b38	PLEKHN1	-3.937	9.51e-05	-0.052398	18	0.013308	yes	NERVET
chr1_940390_A_G_b38	PLEKHN1	3.936	9.58e-05	0.037477	132	0.009523	yes	NERVET
chr1_914838_T_A_b38	PLEKHN1	3.885	0.000117	0.037384	127	0.009622	yes	NERVET
chr1_916683_G_A_b38	PLEKHN1	3.861	0.000129	0.037115	128	0.009613	yes	NERVET
chr1_916657_G_A_b38	PLEKHN1	3.842	0.000139	0.036849	129	0.009591	yes	NERVET
chr1_931513_T_C_b38	PLEKHN1	3.84	0.00014	0.036537	127	0.009515	yes	NERVET
chr1_911109_T_C_b38	PLEKHN1	3.762	0.00019	0.044	26	0.011695	yes	NERVET
chr1_967384_C_G_b38	PLEKHN1	3.745	0.000203	0.037583	107	0.010035	yes	NERVET
chr1_910958_A_G_b38	PLEKHN1	3.73	0.000215	0.043631	26	0.011696	yes	NERVET
chr1_1388772_G_GA_b38	PLEKHN1	-3.503	0.000504	-0.079217	5	0.022612	yes	NERVET
chr1_967617_G_A_b38	PLEKHN1	3.485	0.000539	0.044232	19	0.012692	yes	NERVET
chr1_920719_T_G_b38	PLEKHN1	-3.431	0.000656	-0.032453	71	0.00946	yes	NERVET
chr1_920728_A_G_b38	PLEKHN1	-3.431	0.000656	-0.032453	71	0.00946	yes	NERVET
chr1_940263_C_G_b38	PLEKHN1	3.397	0.00074	0.040406	22	0.011894	yes	NERVET
chr1_1187016_C_T_b38	PLEKHN1	-3.287	0.00109	-0.050071	6	0.015233	yes	NERVET
chr1_1757030_C_G_b38	PLEKHN1	-3.262	0.00119	-0.049276	13	0.015107	yes	NERVET
chr1_1524911_C_T_b38	PLEKHN1	-3.251	0.00123	-0.06439	12	0.019805	yes	NERVET
chr1_600572_T_C_b38	PLEKHN1	-3.25	0.00124	-0.052991	5	0.016303	yes	NERVET
chr1_1187013_A_AT_b38	PLEKHN1	-3.23	0.00133	-0.049403	6	0.015297	yes	NERVET
chr1_1186850_G_GT_b38	PLEKHN1	3.17	0.00162	0.045384	8	0.014315	yes	NERVET
chr1_600588_A_G_b38	PLEKHN1	-3.158	0.00169	-0.057325	5	0.018152	yes	NERVET
chr1_1195100_G_A_b38	PLEKHN1	-3.145	0.00177	-0.045412	8	0.014438	yes	NERVET
chr1_272680_G_A_b38	PLEKHN1	3.139	0.0018	0.046464	5	0.014801	yes	NERVET
chr1_1766668_C_T_b38	PLEKHN1	-3.075	0.00223	-0.04868	13	0.01583	yes	NERVET
chr1_897580_AT_A_b38	PLEKHN1	-3.072	0.00225	-0.029323	130	0.009546	yes	NERVET
chr1_768562_G_C_b38	PLEKHN1	-3.062	0.00233	-0.085879	6	0.028047	yes	NERVET
chr1_908025_A_G_b38	PLEKHN1	3.053	0.0024	0.028368	75	0.009293	yes	NERVET
chr1_1764135_G_T_b38	PLEKHN1	-3.044	0.00247	-0.049165	12	0.016154	yes	NERVET
chr1_1764392_C_T_b38	PLEKHN1	-3.044	0.00247	-0.049165	12	0.016154	yes	NERVET
chr1_1767368_C_G_b38	PLEKHN1	-3.044	0.00247	-0.049165	12	0.016154	yes	NERVET
chr1_600591_A_T_b38	PLEKHN1	-3.034	0.00255	-0.055209	5	0.018198	yes	NERVET
chr1_665220_T_C_b38	PLEKHN1	-3.024	0.00263	-0.097525	3	0.032245	yes	NERVET
chr1_1774334_A_G_b38	PLEKHN1	-3.022	0.00265	-0.049868	11	0.0165	yes	NERVET
chr1_919397_A_G_b38	PLEKHN1	3.019	0.00267	0.028859	69	0.009558	yes	NERVET
chr1_1240390_G_A_b38	PLEKHN1	3.004	0.00281	0.048787	4	0.016241	yes	NERVET
chr1_1764895_A_C_b38	PLEKHN1	-2.998	0.00286	-0.047141	15	0.015723	yes	NERVET
chr1_1892483_A_G_b38	PLEKHN1	-2.953	0.0033	-0.049098	11	0.016624	yes	NERVET
chr1_1189019_C_G_b38	PLEKHN1	-2.952	0.00332	-0.044347	6	0.015023	yes	NERVET
chr1_627983_C_T_b38	PLEKHN1	-2.949	0.00335	-0.040945	7	0.013886	yes	NERVET
chr1_1187008_G_A_b38	PLEKHN1	-2.943	0.00342	-0.044596	6	0.015155	yes	NERVET
chr1_1191942_G_A_b38	PLEKHN1	-2.938	0.00347	-0.04461	6	0.015185	yes	NERVET
chr1_1248798_T_C_b38	PLEKHN1	-2.924	0.00363	-0.074399	3	0.025448	yes	NERVET
chr1_600536_A_G_b38	PLEKHN1	-2.912	0.00377	-0.044362	6	0.015234	yes	NERVET
chr1_1241831_G_C_b38	PLEKHN1	2.911	0.00377	0.045081	4	0.015485	yes	NERVET
chr1_1238883_G_A_b38	PLEKHN1	2.903	0.00387	0.046632	4	0.016064	yes	NERVET
chr1_1197405_C_T_b38	PLEKHN1	-2.892	0.00401	-0.04346	7	0.01503	yes	NERVET
chr1_1764994_G_A_b38	PLEKHN1	-2.885	0.0041	-0.065647	10	0.022754	yes	NERVET
chr1_1199253_C_T_b38	PLEKHN1	-2.881	0.00415	-0.040605	10	0.014096	yes	NERVET
chr1_1186816_A_G_b38	PLEKHN1	-2.876	0.00421	-0.042685	7	0.014841	yes	NERVET
chr1_1189968_T_C_b38	PLEKHN1	-2.876	0.00421	-0.042685	7	0.014841	yes	NERVET
chr1_1190856_G_A_b38	PLEKHN1	-2.876	0.00421	-0.042685	7	0.014841	yes	NERVET
chr1_1197586_C_A_b38	PLEKHN1	-2.869	0.0043	-0.042879	7	0.014944	yes	NERVET
chr1_1199327_G_A_b38	PLEKHN1	-2.869	0.0043	-0.042879	7	0.014944	yes	NERVET
chr1_1765220_A_G_b38	PLEKHN1	-2.869	0.00431	-0.046485	12	0.016204	yes	NERVET
chr1_1186644_T_C_b38	PLEKHN1	-2.861	0.00441	-0.042914	7	0.014998	yes	NERVET
chr1_1187136_G_A_b38	PLEKHN1	-2.861	0.00441	-0.042914	7	0.014998	yes	NERVET
chr1_1187726_G_A_b38	PLEKHN1	-2.861	0.00441	-0.042914	7	0.014998	yes	NERVET
chr1_1188877_A_G_b38	PLEKHN1	-2.861	0.00441	-0.042914	7	0.014998	yes	NERVET
chr1_1189511_G_A_b38	PLEKHN1	-2.861	0.00441	-0.042914	7	0.014998	yes	NERVET
chr1_1190875_G_C_b38	PLEKHN1	-2.861	0.00441	-0.042914	7	0.014998	yes	NERVET
chr1_1191614_G_A_b38	PLEKHN1	-2.861	0.00441	-0.042914	7	0.014998	yes	NERVET
chr1_1192000_G_A_b38	PLEKHN1	-2.861	0.00441	-0.042914	7	0.014998	yes	NERVET
chr1_1192127_G_A_b38	PLEKHN1	-2.861	0.00441	-0.042914	7	0.014998	yes	NERVET
chr1_1192143_C_T_b38	PLEKHN1	-2.861	0.00441	-0.042914	7	0.014998	yes	NERVET
chr1_1192951_G_T_b38	PLEKHN1	-2.861	0.00441	-0.042914	7	0.014998	yes	NERVET
chr1_1193049_G_A_b38	PLEKHN1	-2.861	0.00441	-0.042914	7	0.014998	yes	NERVET
chr1_1194292_G_T_b38	PLEKHN1	-2.861	0.00441	-0.042914	7	0.014998	yes	NERVET
chr1_1194327_A_G_b38	PLEKHN1	-2.861	0.00441	-0.042914	7	0.014998	yes	NERVET
chr1_1194713_C_T_b38	PLEKHN1	-2.861	0.00441	-0.042914	7	0.014998	yes	NERVET
chr1_1186939_C_T_b38	PLEKHN1	-2.859	0.00445	-0.042949	7	0.015025	yes	NERVET
chr1_1480990_T_C_b38	PLEKHN1	-2.855	0.00449	-0.039844	41	0.013954	yes	NERVET
chr1_634553_G_A_b38	PLEKHN1	-2.851	0.00456	-0.039562	7	0.013877	yes	NERVET
chr1_1351373_ACGGGGGGAG_A_b38	PLEKHN1	2.823	0.00496	0.044667	4	0.015822	yes	NERVET
chr1_601667_C_T_b38	PLEKHN1	-2.822	0.00498	-0.0405	4	0.014351	yes	NERVET
chr1_630596_C_T_b38	PLEKHN1	-2.813	0.00511	-0.039113	7	0.013903	yes	NERVET
chr1_51972_GGAC_G_b38	PLEKHN1	-2.802	0.00529	-0.066532	7	0.023743	yes	NERVET
chr1_1837221_C_G_b38	PLEKHN1	-2.791	0.00547	-0.045636	12	0.01635	yes	NERVET
chr1_1197874_G_A_b38	PLEKHN1	-2.774	0.00576	-0.041743	7	0.015047	yes	NERVET
chr1_896680_G_A_b38	PLEKHN1	2.773	0.00578	0.028179	54	0.010163	yes	NERVET
chr1_896686_G_C_b38	PLEKHN1	2.773	0.00578	0.028179	54	0.010163	yes	NERVET
chr1_896732_T_C_b38	PLEKHN1	2.773	0.00578	0.028179	54	0.010163	yes	NERVET
chr1_896917_CTG_C_b38	PLEKHN1	2.773	0.00578	0.028179	54	0.010163	yes	NERVET
chr1_896938_C_A_b38	PLEKHN1	2.773	0.00578	0.028179	54	0.010163	yes	NERVET
chr1_897792_T_TCGAA_b38	PLEKHN1	-2.773	0.00578	-0.028179	54	0.010163	yes	NERVET
chr1_929375_A_G_b38	PLEKHN1	2.77	0.00583	0.064774	15	0.023382	yes	NERVET
chr1_929377_G_A_b38	PLEKHN1	2.77	0.00583	0.064774	15	0.023382	yes	NERVET
chr1_897376_T_G_b38	PLEKHN1	-2.747	0.00624	-0.028421	49	0.010345	yes	NERVET
chr1_1774697_T_C_b38	PLEKHN1	-2.745	0.00628	-0.044921	13	0.016363	yes	NERVET
chr1_770072_T_A_b38	PLEKHN1	-2.736	0.00646	-0.076228	6	0.027859	yes	NERVET
chr1_1239925_G_A_b38	PLEKHN1	2.729	0.00659	0.046095	4	0.016888	yes	NERVET
chr1_788920_C_T_b38	PLEKHN1	-2.729	0.0066	-0.078832	5	0.028887	yes	NERVET
chr1_804185_G_C_b38	PLEKHN1	-2.729	0.0066	-0.078832	5	0.028887	yes	NERVET
chr1_804863_T_C_b38	PLEKHN1	-2.729	0.0066	-0.078832	5	0.028887	yes	NERVET
chr1_805036_A_G_b38	PLEKHN1	-2.729	0.0066	-0.078832	5	0.028887	yes	NERVET
chr1_1324055_GCTGAGGGA_G_b38	PLEKHN1	-2.712	0.00694	-0.071261	4	0.026277	yes	NERVET
chr1_1224281_GTTTTA_G_b38	PLEKHN1	2.695	0.00729	0.043546	4	0.016156	yes	NERVET
chr1_1227886_G_A_b38	PLEKHN1	2.695	0.00729	0.043546	4	0.016156	yes	NERVET
chr1_1230250_G_A_b38	PLEKHN1	2.695	0.00729	0.043546	4	0.016156	yes	NERVET
chr1_1821516_C_T_b38	PLEKHN1	-2.691	0.00738	-0.04352	12	0.016172	yes	NERVET
chr1_1841296_T_C_b38	PLEKHN1	-2.688	0.00745	-0.044543	12	0.016572	yes	NERVET
chr1_1849439_T_C_b38	PLEKHN1	-2.688	0.00745	-0.044543	12	0.016572	yes	NERVET
chr1_1219941_C_T_b38	PLEKHN1	2.686	0.0075	0.045186	5	0.016825	yes	NERVET
chr1_1758687_A_AAC_b38	PLEKHN1	-2.668	0.00791	-0.040366	16	0.015132	yes	NERVET
chr1_1795751_T_TCAAAAAAA_b38	PLEKHN1	-2.667	0.00792	-0.043651	11	0.016367	yes	NERVET
chr1_1192301_G_A_b38	PLEKHN1	-2.666	0.00795	-0.040723	7	0.015275	yes	NERVET
chr1_1814717_A_G_b38	PLEKHN1	-2.661	0.00807	-0.043933	11	0.016511	yes	NERVET
chr1_1812038_G_C_b38	PLEKHN1	-2.659	0.0081	-0.042582	13	0.016012	yes	NERVET
chr1_1872863_C_T_b38	PLEKHN1	-2.656	0.00818	-0.043049	13	0.016208	yes	NERVET
chr1_938178_G_T_b38	PLEKHN1	2.655	0.00821	0.026574	80	0.01001	yes	NERVET
chr1_1522875_T_G_b38	PLEKHN1	-2.654	0.00822	-0.060204	8	0.022681	yes	NERVET
chr1_1223251_A_G_b38	PLEKHN1	2.646	0.00842	0.037747	11	0.014264	yes	NERVET
chr1_1306149_A_G_b38	PLEKHN1	2.645	0.00844	0.054027	4	0.020422	yes	NERVET
chr1_897538_T_C_b38	PLEKHN1	-2.641	0.00854	-0.026816	56	0.010152	yes	NERVET
chr1_906677_A_AAACTCAGCTGCCTCTCCCCTTC_b38	PLEKHN1	-2.639	0.00861	-0.027186	53	0.010303	yes	NERVET
chr1_16378_T_C_b38	PLEKHN1	-2.635	0.0087	-0.04563	17	0.017318	yes	NERVET
chr1_630211_C_T_b38	PLEKHN1	-2.634	0.00872	-0.030468	27	0.011566	yes	NERVET
chr1_1874867_A_G_b38	PLEKHN1	-2.629	0.00884	-0.043577	12	0.016573	yes	NERVET
chr1_1880926_CA_C_b38	PLEKHN1	-2.629	0.00884	-0.043577	12	0.016573	yes	NERVET
chr1_1881389_G_A_b38	PLEKHN1	-2.629	0.00884	-0.043577	12	0.016573	yes	NERVET
chr1_1885731_G_A_b38	PLEKHN1	-2.629	0.00884	-0.043577	12	0.016573	yes	NERVET
chr1_1887939_T_C_b38	PLEKHN1	-2.629	0.00884	-0.043577	12	0.016573	yes	NERVET
chr1_631495_C_T_b38	PLEKHN1	2.625	0.00895	0.080787	5	0.030773	yes	NERVET
chr1_1189730_T_C_b38	PLEKHN1	-2.622	0.00903	-0.040556	7	0.015466	yes	NERVET
chr1_896798_A_G_b38	PLEKHN1	2.605	0.00948	0.026563	54	0.010196	yes	NERVET
chr1_1332779_C_T_b38	PLEKHN1	-2.595	0.00977	-0.048968	5	0.018872	yes	NERVET
chr1_1375698_G_T_b38	PLEKHN1	2.592	0.00984	0.045368	4	0.017503	yes	NERVET
chr1_1376153_G_C_b38	PLEKHN1	2.592	0.00984	0.045368	4	0.017503	yes	NERVET
chr1_1376752_T_C_b38	PLEKHN1	2.592	0.00984	0.045368	4	0.017503	yes	NERVET
chr1_1378635_C_T_b38	PLEKHN1	2.592	0.00984	0.045368	4	0.017503	yes	NERVET
chr1_1378792_C_T_b38	PLEKHN1	2.592	0.00984	0.045368	4	0.017503	yes	NERVET
chr1_1378865_C_T_b38	PLEKHN1	2.592	0.00984	0.045368	4	0.017503	yes	NERVET
chr1_1379334_A_G_b38	PLEKHN1	2.592	0.00984	0.045368	4	0.017503	yes	NERVET
chr1_1231507_T_C_b38	PLEKHN1	2.589	0.00992	0.033344	13	0.012878	yes	NERVET
chr1_1597451_GCTCCTC_G_b38	PLEKHN1	2.588	0.00996	0.080839	3	0.031238	yes	NERVET
chr1_1762664_A_G_b38	PLEKHN1	-2.587	0.00997	-0.043695	10	0.016887	yes	NERVET
chr1_915400_C_T_b38	PLEKHN1	4.009	7.12e-05	0.03779	92	0.009427	no	NERVET
chr1_1735932_A_G_b38	PLEKHN1	-4.002	7.31e-05	-0.059683	15	0.014912	no	NERVET
chr1_1731456_A_G_b38	PLEKHN1	-3.774	0.000182	-0.055786	17	0.014782	no	NERVET
chr1_919598_A_C_b38	PLEKHN1	3.757	0.000194	0.035322	99	0.009401	no	NERVET
chr1_1732166_A_G_b38	PLEKHN1	-3.735	0.000211	-0.054752	17	0.014658	no	NERVET
chr1_918574_C_A_b38	PLEKHN1	3.636	0.000308	0.034432	97	0.009469	no	NERVET
chr1_917495_C_T_b38	PLEKHN1	3.62	0.000328	0.034237	98	0.009458	no	NERVET
chr1_1732580_T_C_b38	PLEKHN1	-3.617	0.000331	-0.053853	18	0.01489	no	NERVET
chr1_1730989_A_G_b38	PLEKHN1	-3.611	0.000339	-0.053653	17	0.014859	no	NERVET
chr1_1735814_T_C_b38	PLEKHN1	-3.611	0.000339	-0.053653	17	0.014859	no	NERVET
chr1_1734308_T_C_b38	PLEKHN1	-3.608	0.000343	-0.05129	18	0.014218	no	NERVET
chr1_921096_A_G_b38	PLEKHN1	-3.595	0.000359	-0.034742	86	0.009663	no	NERVET
chr1_1739915_G_A_b38	PLEKHN1	-3.58	0.00038	-0.050187	20	0.014018	no	NERVET
chr1_914991_G_T_b38	PLEKHN1	3.547	0.00043	0.033549	93	0.009459	no	NERVET
chr1_1740427_A_T_b38	PLEKHN1	-3.527	0.000463	-0.052453	17	0.014873	no	NERVET
chr1_1742080_T_C_b38	PLEKHN1	-3.527	0.000463	-0.052453	17	0.014873	no	NERVET
chr1_1803982_T_TA_b38	PLEKHN1	3.448	0.000617	0.084308	6	0.024454	no	NERVET
chr1_1729196_T_G_b38	PLEKHN1	-3.422	0.000677	-0.054065	11	0.0158	no	NERVET
chr1_1734301_T_C_b38	PLEKHN1	-3.36	0.000843	-0.050748	16	0.015101	no	NERVET
chr1_1737789_T_C_b38	PLEKHN1	-3.305	0.00102	-0.0509	8	0.015401	no	NERVET
chr1_1739519_C_G_b38	PLEKHN1	-3.178	0.00158	-0.035742	42	0.011245	no	NERVET
chr1_1360507_T_TGGGGGGC_b38	PLEKHN1	3.101	0.00204	0.047701	4	0.015381	no	NERVET
chr1_919695_C_G_b38	PLEKHN1	3.098	0.00206	0.02925	72	0.00944	no	NERVET
chr1_1753774_C_G_b38	PLEKHN1	-3.098	0.00207	-0.04718	13	0.015229	no	NERVET
chr1_1729859_A_G_b38	PLEKHN1	-3.082	0.00218	-0.036148	20	0.01173	no	NERVET
chr1_1360502_G_GGGGGCGGGC_b38	PLEKHN1	3.066	0.0023	0.048688	4	0.01588	no	NERVET
chr1_1670423_AT_A_b38	PLEKHN1	-3.04	0.0025	-0.033335	59	0.010965	no	NERVET
chr1_1734132_T_G_b38	PLEKHN1	-2.986	0.00298	-0.045598	22	0.015272	no	NERVET
chr1_1731375_T_C_b38	PLEKHN1	-2.965	0.00318	-0.042411	25	0.014301	no	NERVET
chr1_104194_C_A_b38	PLEKHN1	-2.889	0.00404	-0.03822	8	0.013229	no	NERVET
chr1_916753_C_T_b38	PLEKHN1	2.877	0.0042	0.033122	26	0.011512	no	NERVET
chr1_630668_G_A_b38	PLEKHN1	-2.832	0.00483	-0.03932	7	0.013886	no	NERVET
chr1_940296_GCC_G_b38	PLEKHN1	2.817	0.00506	0.026233	93	0.009313	no	NERVET
chr1_1905247_C_G_b38	PLEKHN1	-2.805	0.00524	-0.046782	7	0.016678	no	NERVET
chr1_1353091_C_T_b38	PLEKHN1	2.768	0.00588	0.047651	9	0.017218	no	NERVET
chr1_1303112_G_A_b38	PLEKHN1	2.755	0.0061	0.039668	8	0.014399	no	NERVET
chr1_1360989_GAC_G_b38	PLEKHN1	2.708	0.00701	0.048717	3	0.017987	no	NERVET
chr1_1353443_A_G_b38	PLEKHN1	2.706	0.00706	0.045914	10	0.016966	no	NERVET
chr1_916119_A_G_b38	PLEKHN1	2.689	0.00742	0.033201	14	0.012345	no	NERVET
chr1_917584_T_G_b38	PLEKHN1	2.667	0.00792	0.031846	23	0.011941	no	NERVET
chr1_601436_C_T_b38	PLEKHN1	-2.664	0.00798	-0.038921	3	0.014608	no	NERVET
chr1_1363031_C_T_b38	PLEKHN1	2.663	0.00802	0.048203	3	0.018104	no	NERVET
chr1_1847597_T_C_b38	PLEKHN1	-2.661	0.00806	-0.044681	11	0.01679	no	NERVET
chr1_1354531_G_A_b38	PLEKHN1	2.652	0.00827	0.04792	3	0.018068	no	NERVET
chr1_1353203_C_G_b38	PLEKHN1	2.638	0.00862	0.04792	3	0.018166	no	NERVET
chr1_1360302_A_G_b38	PLEKHN1	2.632	0.00878	0.047285	3	0.017967	no	NERVET
chr1_1351517_G_C_b38	PLEKHN1	2.622	0.00904	0.040846	13	0.015579	no	NERVET
chr1_1728671_C_A_b38	PLEKHN1	-2.615	0.00923	-0.031816	23	0.012169	no	NERVET
chr1_1352542_G_A_b38	PLEKHN1	2.606	0.00945	0.046768	3	0.017946	no	NERVET
chr1_911220_CT_C_b38	PLEKHN1	2.595	0.00977	0.03145	18	0.012122	no	NERVET
chr1_1319056_A_G_b38	PLEKHN1	2.587	0.00998	0.053776	3	0.020784	no	NERVET
chr1_855085_G_A_b38	PLEKHN1	2.723	0.00738	0.051276	3	0.018832	yes	OVARY
chr1_1029365_A_ATCTATGCAGGCAGGTGGGGGGATCAGTG_b38	PLEKHN1	2.683	0.00827	0.039706	12	0.0148	yes	OVARY
chr1_823913_T_A_b38	PLEKHN1	2.619	0.00989	0.049386	3	0.018856	yes	OVARY
chr1_619417_C_T_b38	PLEKHN1	2.618	0.00993	0.041855	8	0.01599	yes	OVARY
chr1_1607341_CTT_C_b38	PLEKHN1	3.045	0.00283	0.041237	31	0.013541	no	OVARY
chr1_1650664_C_CT_b38	PLEKHN1	-2.898	0.00442	-0.064889	6	0.02239	no	OVARY
chr1_1555179_A_G_b38	PLEKHN1	2.788	0.00612	0.040512	22	0.01453	no	OVARY
chr1_1555871_T_C_b38	PLEKHN1	2.778	0.0063	0.040091	25	0.014431	no	OVARY
chr1_1554548_T_C_b38	PLEKHN1	2.731	0.00722	0.040143	21	0.0147	no	OVARY
chr1_1100425_G_A_b38	PLEKHN1	-2.695	0.00799	-0.038375	18	0.014239	no	OVARY
chr1_633887_G_A_b38	PLEKHN1	-3.222	0.00144	-0.056454	19	0.017524	yes	PNCREAS
chr1_60332_T_C_b38	PLEKHN1	3.194	0.00159	0.048689	40	0.015246	yes	PNCREAS
chr1_62239_TAC_T_b38	PLEKHN1	3.182	0.00165	0.047499	51	0.014927	yes	PNCREAS
chr1_981935_G_A_b38	PLEKHN1	-3.174	0.00169	-0.052036	17	0.016396	yes	PNCREAS
chr1_61989_G_C_b38	PLEKHN1	3.076	0.00233	0.048106	56	0.015637	yes	PNCREAS
chr1_58771_T_C_b38	PLEKHN1	3.063	0.00243	0.04694	41	0.015326	yes	PNCREAS
chr1_971790_AG_A_b38	PLEKHN1	-3.059	0.00246	-0.043548	51	0.014234	yes	PNCREAS
chr1_61987_A_G_b38	PLEKHN1	2.986	0.00311	0.046999	53	0.015742	yes	PNCREAS
chr1_981282_A_C_b38	PLEKHN1	-2.874	0.00441	-0.047252	17	0.016443	yes	PNCREAS
chr1_57158_G_C_b38	PLEKHN1	2.795	0.00559	0.095769	3	0.034265	yes	PNCREAS
chr1_982112_C_T_b38	PLEKHN1	-2.78	0.00586	-0.046049	17	0.016567	yes	PNCREAS
chr1_978230_G_A_b38	PLEKHN1	-2.759	0.00622	-0.045771	17	0.016587	yes	PNCREAS
chr1_982890_C_T_b38	PLEKHN1	-2.735	0.00668	-0.045403	17	0.016598	yes	PNCREAS
chr1_983237_G_A_b38	PLEKHN1	-2.735	0.00668	-0.045403	17	0.016598	yes	PNCREAS
chr1_54844_G_A_b38	PLEKHN1	2.708	0.00724	0.038955	53	0.014385	yes	PNCREAS
chr1_976536_C_T_b38	PLEKHN1	-2.648	0.00862	-0.04426	16	0.016715	yes	PNCREAS
chr1_62777_A_T_b38	PLEKHN1	2.636	0.00892	0.038831	57	0.014731	yes	PNCREAS
chr1_57856_T_A_b38	PLEKHN1	2.632	0.00903	0.039279	59	0.014925	yes	PNCREAS
chr1_969750_ATG_A_b38	PLEKHN1	3.742	0.000226	0.052384	63	0.013998	no	PNCREAS
chr1_257870_A_G_b38	PLEKHN1	3.34	0.000966	0.125978	3	0.037718	no	PNCREAS
chr1_1606532_G_A_b38	PLEKHN1	-3.327	0.00101	-0.055954	18	0.016818	no	PNCREAS
chr1_257871_C_G_b38	PLEKHN1	3.302	0.0011	0.12475	3	0.037782	no	PNCREAS
chr1_967865_A_G_b38	PLEKHN1	3.282	0.00118	0.04636	71	0.014127	no	PNCREAS
chr1_1606539_G_GCC_b38	PLEKHN1	-3.215	0.00148	-0.053701	19	0.016706	no	PNCREAS
chr1_64548_A_C_b38	PLEKHN1	3.11	0.00209	0.05402	23	0.017371	no	PNCREAS
chr1_64552_G_A_b38	PLEKHN1	3.11	0.00209	0.05402	23	0.017371	no	PNCREAS
chr1_1606536_GCT_G_b38	PLEKHN1	-3.109	0.0021	-0.051713	19	0.016636	no	PNCREAS
chr1_966179_G_A_b38	PLEKHN1	2.952	0.00346	0.068869	17	0.023332	no	PNCREAS
chr1_984121_G_T_b38	PLEKHN1	2.917	0.00386	0.039892	80	0.013676	no	PNCREAS
chr1_285109_CAA_C_b38	PLEKHN1	2.889	0.00421	0.107753	4	0.0373	no	PNCREAS
chr1_668910_A_G_b38	PLEKHN1	2.801	0.00549	0.127125	3	0.045382	no	PNCREAS
chr1_1606552_A_G_b38	PLEKHN1	-2.785	0.00577	-0.043194	25	0.01551	no	PNCREAS
chr1_1606559_C_G_b38	PLEKHN1	-2.773	0.00597	-0.043301	25	0.015615	no	PNCREAS
chr1_981454_G_A_b38	PLEKHN1	2.717	0.00704	0.037198	76	0.013689	no	PNCREAS
chr1_983193_A_G_b38	PLEKHN1	2.671	0.00807	0.036482	76	0.01366	no	PNCREAS
chr1_265261_G_A_b38	PLEKHN1	2.599	0.00991	0.049782	10	0.019156	no	PNCREAS
chr1_1101496_T_A_b38	PLEKHN1	2.598	0.00995	0.051964	6	0.020004	no	PNCREAS
chr1_1115600_CCCCTCCCCAGGGACCCCCCT_C_b38	PLEKHN1	3.857	0.000156	0.13012	5	0.033736	yes	PTTARY
chr1_1124768_G_T_b38	PLEKHN1	3.762	0.000223	0.121589	3	0.032322	yes	PTTARY
chr1_791545_G_T_b38	PLEKHN1	3.658	0.000326	0.15017	6	0.041049	yes	PTTARY
chr1_1119172_G_A_b38	PLEKHN1	3.513	0.000551	0.113592	3	0.032339	yes	PTTARY
chr1_1120273_C_G_b38	PLEKHN1	3.513	0.000551	0.113592	3	0.032339	yes	PTTARY
chr1_1120521_C_A_b38	PLEKHN1	3.513	0.000551	0.113592	3	0.032339	yes	PTTARY
chr1_1121559_T_A_b38	PLEKHN1	3.513	0.000551	0.113592	3	0.032339	yes	PTTARY
chr1_1122128_C_G_b38	PLEKHN1	3.513	0.000551	0.113592	3	0.032339	yes	PTTARY
chr1_1123255_G_A_b38	PLEKHN1	3.513	0.000551	0.113592	3	0.032339	yes	PTTARY
chr1_1123889_C_T_b38	PLEKHN1	3.513	0.000551	0.113592	3	0.032339	yes	PTTARY
chr1_1124663_A_C_b38	PLEKHN1	3.513	0.000551	0.113592	3	0.032339	yes	PTTARY
chr1_1113913_C_CT_b38	PLEKHN1	3.501	0.000574	0.134598	6	0.038444	yes	PTTARY
chr1_1101579_T_C_b38	PLEKHN1	3.457	0.00067	0.109831	3	0.031773	yes	PTTARY
chr1_1124094_AAC_A_b38	PLEKHN1	3.444	7e-04	0.112266	3	0.032594	yes	PTTARY
chr1_1122144_C_T_b38	PLEKHN1	3.41	0.000788	0.11031	3	0.032347	yes	PTTARY
chr1_1122649_A_G_b38	PLEKHN1	3.386	0.000858	0.108571	3	0.032069	yes	PTTARY
chr1_1107147_G_C_b38	PLEKHN1	3.287	0.0012	0.106094	3	0.032276	yes	PTTARY
chr1_1110093_G_A_b38	PLEKHN1	3.287	0.0012	0.106094	3	0.032276	yes	PTTARY
chr1_1111337_G_C_b38	PLEKHN1	3.287	0.0012	0.106094	3	0.032276	yes	PTTARY
chr1_1111481_G_A_b38	PLEKHN1	3.287	0.0012	0.106094	3	0.032276	yes	PTTARY
chr1_1113703_C_A_b38	PLEKHN1	3.287	0.0012	0.106094	3	0.032276	yes	PTTARY
chr1_1117566_G_T_b38	PLEKHN1	3.287	0.0012	0.106094	3	0.032276	yes	PTTARY
chr1_1118072_G_A_b38	PLEKHN1	3.287	0.0012	0.106094	3	0.032276	yes	PTTARY
chr1_1118447_T_TG_b38	PLEKHN1	3.287	0.0012	0.106094	3	0.032276	yes	PTTARY
chr1_1120417_A_G_b38	PLEKHN1	3.217	0.00151	0.102094	3	0.031734	yes	PTTARY
chr1_1120889_C_T_b38	PLEKHN1	3.217	0.00151	0.102094	3	0.031734	yes	PTTARY
chr1_1122042_G_C_b38	PLEKHN1	3.217	0.00151	0.102094	3	0.031734	yes	PTTARY
chr1_1123509_G_A_b38	PLEKHN1	3.217	0.00151	0.102094	3	0.031734	yes	PTTARY
chr1_1124132_T_TACACACCTGAGCACACACACCTGTGC_b38	PLEKHN1	3.149	0.00189	0.100695	3	0.031974	yes	PTTARY
chr1_1101497_T_A_b38	PLEKHN1	3.098	0.00223	0.093588	5	0.030207	yes	PTTARY
chr1_1101496_T_A_b38	PLEKHN1	2.977	0.00328	0.090306	5	0.030337	yes	PTTARY
chr1_1113609_A_G_b38	PLEKHN1	2.945	0.00362	0.092612	3	0.03145	yes	PTTARY
chr1_1684789_C_CAAAA_b38	PLEKHN1	2.926	0.00384	0.116708	5	0.039883	yes	PTTARY
chr1_1124025_C_T_b38	PLEKHN1	2.874	0.0045	0.095004	3	0.03306	yes	PTTARY
chr1_1934821_C_G_b38	PLEKHN1	2.832	0.00511	0.056453	32	0.019933	yes	PTTARY
chr1_857809_G_A_b38	PLEKHN1	-2.786	0.00586	-0.10486	6	0.037641	yes	PTTARY
chr1_1124012_G_GCACACACCTGCGTGCACACACCTGCA_b38	PLEKHN1	2.648	0.00875	0.088876	3	0.033562	yes	PTTARY
chr1_1497605_G_C_b38	PLEKHN1	-2.623	0.00939	-0.059396	27	0.02264	yes	PTTARY
chr1_1130879_G_C_b38	PLEKHN1	-3.856	0.000156	-0.106676	5	0.027666	no	PTTARY
chr1_1129599_C_T_b38	PLEKHN1	3.754	0.000229	0.108615	6	0.02893	no	PTTARY
chr1_1126571_C_T_b38	PLEKHN1	3.673	0.000309	0.117788	3	0.03207	no	PTTARY
chr1_1126654_G_A_b38	PLEKHN1	3.673	0.000309	0.117788	3	0.03207	no	PTTARY
chr1_1129422_T_C_b38	PLEKHN1	-3.647	0.00034	-0.104876	5	0.028759	no	PTTARY
chr1_1126222_G_A_b38	PLEKHN1	3.56	0.000465	0.112374	3	0.031565	no	PTTARY
chr1_1125772_T_C_b38	PLEKHN1	3.549	0.000485	0.113018	3	0.031848	no	PTTARY
chr1_1126128_G_A_b38	PLEKHN1	3.53	0.000519	0.11354	3	0.032168	no	PTTARY
chr1_1125735_T_C_b38	PLEKHN1	3.374	0.000892	0.106267	3	0.031494	no	PTTARY
chr1_1125882_A_G_b38	PLEKHN1	3.374	0.000892	0.106267	3	0.031494	no	PTTARY
chr1_866675_C_T_b38	PLEKHN1	3.291	0.00119	0.133	5	0.040419	no	PTTARY
chr1_1134748_T_G_b38	PLEKHN1	-3.25	0.00136	-0.11802	3	0.03631	no	PTTARY
chr1_1368178_C_CTTTTT_b38	PLEKHN1	3.184	0.00169	0.093982	4	0.02952	no	PTTARY
chr1_866664_G_A_b38	PLEKHN1	3.174	0.00175	0.108456	6	0.034173	no	PTTARY
chr1_1127664_A_G_b38	PLEKHN1	-2.948	0.00359	-0.088297	5	0.029953	no	PTTARY
chr1_1113575_A_G_b38	PLEKHN1	2.933	0.00376	0.096522	3	0.032911	no	PTTARY
chr1_1497606_C_G_b38	PLEKHN1	-2.612	0.00971	-0.06826	10	0.026137	no	PTTARY
chr1_983004_G_T_b38	PLEKHN1	6.677	2.89e-10	0.159991	57	0.023962	yes	PRSTTE
chr1_981454_G_A_b38	PLEKHN1	6.611	4.15e-10	0.156292	51	0.023643	yes	PRSTTE
chr1_983193_A_G_b38	PLEKHN1	6.611	4.15e-10	0.156292	51	0.023643	yes	PRSTTE
chr1_978509_G_A_b38	PLEKHN1	6.564	5.36e-10	0.156544	50	0.02385	yes	PRSTTE
chr1_979472_G_C_b38	PLEKHN1	6.5	7.56e-10	0.155452	51	0.023916	yes	PRSTTE
chr1_978953_C_G_b38	PLEKHN1	6.455	9.64e-10	0.154029	47	0.023863	yes	PRSTTE
chr1_979560_T_C_b38	PLEKHN1	6.092	6.53e-09	0.14798	54	0.02429	yes	PRSTTE
chr1_971790_AG_A_b38	PLEKHN1	-5.247	4.29e-07	-0.137308	39	0.026169	yes	PRSTTE
chr1_975014_C_T_b38	PLEKHN1	-5.115	7.96e-07	-0.13188	30	0.025785	yes	PRSTTE
chr1_1005429_C_CA_b38	PLEKHN1	-5.068	9.87e-07	-0.138851	28	0.027397	yes	PRSTTE
chr1_1005904_C_T_b38	PLEKHN1	-5.068	9.87e-07	-0.138851	28	0.027397	yes	PRSTTE
chr1_1005954_G_A_b38	PLEKHN1	-4.928	1.87e-06	-0.135235	28	0.02744	yes	PRSTTE
chr1_1014228_G_A_b38	PLEKHN1	-4.891	2.21e-06	-0.135429	29	0.027692	yes	PRSTTE
chr1_982260_G_A_b38	PLEKHN1	-4.854	2.6e-06	-0.153765	6	0.031678	yes	PRSTTE
chr1_982858_C_G_b38	PLEKHN1	-4.854	2.6e-06	-0.153765	6	0.031678	yes	PRSTTE
chr1_995371_C_G_b38	PLEKHN1	-4.851	2.63e-06	-0.128112	30	0.026407	yes	PRSTTE
chr1_1009184_T_C_b38	PLEKHN1	-4.752	4.09e-06	-0.131546	29	0.027682	yes	PRSTTE
chr1_995982_G_A_b38	PLEKHN1	-4.746	4.21e-06	-0.125005	30	0.026341	yes	PRSTTE
chr1_1014863_A_C_b38	PLEKHN1	-4.739	4.33e-06	-0.130885	29	0.027619	yes	PRSTTE
chr1_1008307_G_C_b38	PLEKHN1	-4.673	5.79e-06	-0.130541	29	0.027937	yes	PRSTTE
chr1_973693_C_T_b38	PLEKHN1	4.578	8.7e-06	0.11279	39	0.024637	yes	PRSTTE
chr1_1016623_G_A_b38	PLEKHN1	-4.573	8.91e-06	-0.126299	29	0.027621	yes	PRSTTE
chr1_1016184_A_G_b38	PLEKHN1	-4.539	1.03e-05	-0.125298	33	0.027607	yes	PRSTTE
chr1_983747_T_C_b38	PLEKHN1	-4.531	1.06e-05	-0.136776	8	0.030187	yes	PRSTTE
chr1_1004625_A_G_b38	PLEKHN1	-4.376	2.04e-05	-0.120999	32	0.027648	yes	PRSTTE
chr1_981169_A_G_b38	PLEKHN1	4.294	2.86e-05	0.126539	10	0.029472	yes	PRSTTE
chr1_974039_C_T_b38	PLEKHN1	-4.263	3.25e-05	-0.146408	5	0.034346	yes	PRSTTE
chr1_1006159_C_T_b38	PLEKHN1	-4.256	3.33e-05	-0.117714	33	0.027657	yes	PRSTTE
chr1_1023789_G_C_b38	PLEKHN1	4.191	4.33e-05	0.112437	47	0.026826	yes	PRSTTE
chr1_1017114_A_AT_b38	PLEKHN1	-4.185	4.44e-05	-0.119995	24	0.028672	yes	PRSTTE
chr1_1015925_A_ATT_b38	PLEKHN1	-4.09	6.49e-05	-0.11356	25	0.027767	yes	PRSTTE
chr1_1063202_G_C_b38	PLEKHN1	4.04	7.91e-05	0.101457	57	0.025116	yes	PRSTTE
chr1_1069600_G_A_b38	PLEKHN1	3.979	9.99e-05	0.097981	55	0.024622	yes	PRSTTE
chr1_1101437_T_C_b38	PLEKHN1	-3.968	0.000104	-0.115751	18	0.029173	yes	PRSTTE
chr1_1101667_C_T_b38	PLEKHN1	-3.968	0.000104	-0.115751	18	0.029173	yes	PRSTTE
chr1_1112601_G_A_b38	PLEKHN1	-3.968	0.000104	-0.115751	18	0.029173	yes	PRSTTE
chr1_1081817_C_T_b38	PLEKHN1	3.966	0.000105	0.098689	58	0.024883	yes	PRSTTE
chr1_1082764_T_C_b38	PLEKHN1	3.95	0.000112	0.095683	59	0.024226	yes	PRSTTE
chr1_1020697_C_T_b38	PLEKHN1	-3.936	0.000118	-0.108519	23	0.02757	yes	PRSTTE
chr1_1069577_G_A_b38	PLEKHN1	3.935	0.000118	0.09678	56	0.024593	yes	PRSTTE
chr1_1070843_G_A_b38	PLEKHN1	3.918	0.000126	0.095928	57	0.024484	yes	PRSTTE
chr1_981210_G_A_b38	PLEKHN1	-3.897	0.000137	-0.136347	3	0.034984	yes	PRSTTE
chr1_1075707_CG_C_b38	PLEKHN1	3.852	0.000163	0.093319	60	0.024227	yes	PRSTTE
chr1_1020681_A_AG_b38	PLEKHN1	-3.816	0.000186	-0.105741	23	0.027712	yes	PRSTTE
chr1_1072052_G_A_b38	PLEKHN1	3.811	0.000189	0.09184	61	0.024096	yes	PRSTTE
chr1_1060101_T_G_b38	PLEKHN1	3.8	0.000198	0.099293	56	0.02613	yes	PRSTTE
chr1_1083182_C_T_b38	PLEKHN1	3.79	0.000205	0.092913	60	0.024514	yes	PRSTTE
chr1_1080171_C_T_b38	PLEKHN1	3.763	0.000226	0.094304	58	0.025059	yes	PRSTTE
chr1_1057439_G_A_b38	PLEKHN1	3.756	0.000233	0.0974	55	0.025933	yes	PRSTTE
chr1_1018652_C_G_b38	PLEKHN1	-3.724	0.000261	-0.105305	23	0.028275	yes	PRSTTE
chr1_1018754_G_A_b38	PLEKHN1	-3.724	0.000261	-0.105305	23	0.028275	yes	PRSTTE
chr1_976536_C_T_b38	PLEKHN1	-3.716	0.000269	-0.123413	8	0.03321	yes	PRSTTE
chr1_967865_A_G_b38	PLEKHN1	3.709	0.000276	0.096592	52	0.02604	yes	PRSTTE
chr1_1020217_G_T_b38	PLEKHN1	-3.691	0.000296	-0.104134	24	0.028217	yes	PRSTTE
chr1_1022518_G_T_b38	PLEKHN1	-3.683	0.000305	-0.101578	27	0.027584	yes	PRSTTE
chr1_1021740_G_C_b38	PLEKHN1	-3.657	0.000335	-0.10231	24	0.027979	yes	PRSTTE
chr1_1057980_C_A_b38	PLEKHN1	3.656	0.000336	0.094931	56	0.025968	yes	PRSTTE
chr1_1124794_C_T_b38	PLEKHN1	-3.637	0.000359	-0.103664	20	0.028502	yes	PRSTTE
chr1_1048791_CAG_C_b38	PLEKHN1	3.634	0.000363	0.105537	38	0.029038	yes	PRSTTE
chr1_1079877_A_G_b38	PLEKHN1	3.631	0.000367	0.091597	49	0.025224	yes	PRSTTE
chr1_1081790_C_G_b38	PLEKHN1	3.611	0.000395	0.089745	55	0.024854	yes	PRSTTE
chr1_1096160_A_G_b38	PLEKHN1	3.604	0.000405	0.103976	20	0.028851	yes	PRSTTE
chr1_1052514_C_CGT_b38	PLEKHN1	3.602	0.000408	0.097193	42	0.026986	yes	PRSTTE
chr1_1075337_C_T_b38	PLEKHN1	3.584	0.000435	0.088177	49	0.024604	yes	PRSTTE
chr1_969663_CAT_C_b38	PLEKHN1	-3.569	0.000459	-0.105586	16	0.029584	yes	PRSTTE
chr1_1023351_A_G_b38	PLEKHN1	-3.559	0.000476	-0.09937	30	0.027922	yes	PRSTTE
chr1_1023525_A_G_b38	PLEKHN1	-3.558	0.000478	-0.098883	31	0.027794	yes	PRSTTE
chr1_1079746_A_G_b38	PLEKHN1	3.543	0.000504	0.089028	50	0.02513	yes	PRSTTE
chr1_1004111_TG_T_b38	PLEKHN1	-3.541	0.000506	-0.110011	10	0.031066	yes	PRSTTE
chr1_1023851_G_A_b38	PLEKHN1	3.459	0.000677	0.099948	38	0.028899	yes	PRSTTE
chr1_1048767_CAAAAAAAAAAA_C_b38	PLEKHN1	3.449	7e-04	0.10146	35	0.029416	yes	PRSTTE
chr1_1126645_A_G_b38	PLEKHN1	-3.448	0.000703	-0.100782	30	0.02923	yes	PRSTTE
chr1_1083324_A_G_b38	PLEKHN1	3.44	0.000721	0.083868	51	0.024377	yes	PRSTTE
chr1_1091421_T_A_b38	PLEKHN1	3.437	0.00073	0.089732	42	0.026108	yes	PRSTTE
chr1_1023573_A_G_b38	PLEKHN1	-3.436	0.000732	-0.095385	32	0.027759	yes	PRSTTE
chr1_1079484_T_A_b38	PLEKHN1	3.434	0.000736	0.088156	53	0.025668	yes	PRSTTE
chr1_1125786_T_C_b38	PLEKHN1	-3.421	0.00077	-0.099489	31	0.029078	yes	PRSTTE
chr1_1124795_T_C_b38	PLEKHN1	-3.421	0.000772	-0.097607	51	0.028535	yes	PRSTTE
chr1_1056597_G_A_b38	PLEKHN1	3.33	0.00105	0.081488	57	0.024467	yes	PRSTTE
chr1_1096804_A_G_b38	PLEKHN1	3.281	0.00124	0.093909	21	0.028624	yes	PRSTTE
chr1_981282_A_C_b38	PLEKHN1	-3.27	0.00129	-0.106396	9	0.032542	yes	PRSTTE
chr1_996168_G_T_b38	PLEKHN1	-3.26	0.00133	-0.104723	8	0.032125	yes	PRSTTE
chr1_986280_C_T_b38	PLEKHN1	-3.257	0.00134	-0.105414	8	0.032364	yes	PRSTTE
chr1_986629_G_A_b38	PLEKHN1	-3.257	0.00134	-0.105414	8	0.032364	yes	PRSTTE
chr1_1658422_T_C_b38	PLEKHN1	-3.238	0.00143	-0.106607	12	0.032922	yes	PRSTTE
chr1_992361_G_A_b38	PLEKHN1	-3.212	0.00156	-0.103496	8	0.03222	yes	PRSTTE
chr1_968046_C_T_b38	PLEKHN1	-3.194	0.00165	-0.090924	25	0.028463	yes	PRSTTE
chr1_1022868_A_G_b38	PLEKHN1	-3.185	0.0017	-0.092012	29	0.028888	yes	PRSTTE
chr1_984608_C_CTTCTTTAT_b38	PLEKHN1	-3.166	0.00181	-0.107634	10	0.033993	yes	PRSTTE
chr1_997077_G_A_b38	PLEKHN1	-3.158	0.00186	-0.101954	8	0.032284	yes	PRSTTE
chr1_973443_G_A_b38	PLEKHN1	-3.112	0.00216	-0.105881	8	0.034023	yes	PRSTTE
chr1_1000335_C_T_b38	PLEKHN1	-3.076	0.00243	-0.099345	8	0.032302	yes	PRSTTE
chr1_996254_A_AGGGAGGGCAG_b38	PLEKHN1	-3.062	0.00253	-0.101088	7	0.033013	yes	PRSTTE
chr1_982112_C_T_b38	PLEKHN1	-3.042	0.0027	-0.100241	9	0.032951	yes	PRSTTE
chr1_982890_C_T_b38	PLEKHN1	-3.042	0.0027	-0.100241	9	0.032951	yes	PRSTTE
chr1_983237_G_A_b38	PLEKHN1	-3.042	0.0027	-0.100241	9	0.032951	yes	PRSTTE
chr1_1002192_A_AT_b38	PLEKHN1	-3.042	0.0027	-0.126586	3	0.041616	yes	PRSTTE
chr1_985123_G_A_b38	PLEKHN1	-3.029	0.00281	-0.108551	5	0.035834	yes	PRSTTE
chr1_1002745_G_A_b38	PLEKHN1	-3.025	0.00285	-0.092441	11	0.030558	yes	PRSTTE
chr1_1113195_CA_C_b38	PLEKHN1	-3.017	0.00292	-0.091432	23	0.030308	yes	PRSTTE
chr1_976215_A_G_b38	PLEKHN1	2.999	0.00309	0.093226	18	0.031082	yes	PRSTTE
chr1_998741_G_A_b38	PLEKHN1	-2.986	0.00322	-0.098323	7	0.032928	yes	PRSTTE
chr1_981935_G_A_b38	PLEKHN1	-2.979	0.00329	-0.093195	12	0.031285	yes	PRSTTE
chr1_1079456_A_G_b38	PLEKHN1	2.968	0.0034	0.075072	56	0.025292	yes	PRSTTE
chr1_1126414_A_G_b38	PLEKHN1	-2.908	0.0041	-0.083017	28	0.028551	yes	PRSTTE
chr1_1126468_A_G_b38	PLEKHN1	-2.908	0.0041	-0.083017	28	0.028551	yes	PRSTTE
chr1_1063661_ATG_A_b38	PLEKHN1	2.887	0.00437	0.072958	47	0.025274	yes	PRSTTE
chr1_1055000_C_T_b38	PLEKHN1	-2.882	0.00443	-0.08239	25	0.028585	yes	PRSTTE
chr1_1265603_TTG_T_b38	PLEKHN1	-2.877	0.0045	-0.113806	4	0.039556	yes	PRSTTE
chr1_783406_A_AT_b38	PLEKHN1	2.848	0.0049	0.131081	3	0.046022	yes	PRSTTE
chr1_985260_C_T_b38	PLEKHN1	-2.831	0.00516	-0.097002	5	0.034259	yes	PRSTTE
chr1_945259_TC_T_b38	PLEKHN1	-2.828	0.00521	-0.090174	13	0.031885	yes	PRSTTE
chr1_946653_G_A_b38	PLEKHN1	-2.799	0.00568	-0.088893	13	0.031755	yes	PRSTTE
chr1_965125_G_C_b38	PLEKHN1	-2.797	0.00571	-0.08608	16	0.030772	yes	PRSTTE
chr1_1080437_G_A_b38	PLEKHN1	2.749	0.00659	0.073729	23	0.026823	yes	PRSTTE
chr1_1641642_T_C_b38	PLEKHN1	2.743	0.0067	0.0823	20	0.030004	yes	PRSTTE
chr1_934909_AGGCGGCTGCGTTACAGGTGGGCGGGGGG_A_b38	PLEKHN1	-2.74	0.00677	-0.084627	9	0.030889	yes	PRSTTE
chr1_965666_ACC_A_b38	PLEKHN1	-2.723	0.0071	-0.085506	14	0.0314	yes	PRSTTE
chr1_973929_T_C_b38	PLEKHN1	-2.708	0.00742	-0.090079	8	0.033264	yes	PRSTTE
chr1_985597_T_C_b38	PLEKHN1	-2.703	0.00754	-0.093314	5	0.034528	yes	PRSTTE
chr1_1124975_G_C_b38	PLEKHN1	-2.696	0.00769	-0.075011	33	0.027827	yes	PRSTTE
chr1_1020847_C_CGGG_b38	PLEKHN1	2.69	0.00782	0.072201	29	0.026844	yes	PRSTTE
chr1_1086203_A_C_b38	PLEKHN1	-2.679	0.00806	-0.083075	12	0.03101	yes	PRSTTE
chr1_1670423_AT_A_b38	PLEKHN1	-2.677	0.00812	-0.092764	17	0.034655	yes	PRSTTE
chr1_994949_C_T_b38	PLEKHN1	-2.677	0.00812	-0.083823	9	0.031316	yes	PRSTTE
chr1_994997_C_T_b38	PLEKHN1	-2.677	0.00812	-0.083823	9	0.031316	yes	PRSTTE
chr1_1651653_C_T_b38	PLEKHN1	-2.668	0.00831	-0.072767	52	0.02727	yes	PRSTTE
chr1_1659940_A_C_b38	PLEKHN1	2.65	0.00876	0.090257	7	0.034059	yes	PRSTTE
chr1_1673968_GA_G_b38	PLEKHN1	-2.64	0.00901	-0.078624	24	0.029779	yes	PRSTTE
chr1_958061_C_CT_b38	PLEKHN1	-2.64	0.00902	-0.109021	6	0.041299	yes	PRSTTE
chr1_1641819_C_T_b38	PLEKHN1	2.632	0.00923	0.091826	7	0.03489	yes	PRSTTE
chr1_1054900_C_T_b38	PLEKHN1	2.629	0.00929	0.07573	28	0.028803	yes	PRSTTE
chr1_998750_G_C_b38	PLEKHN1	-2.623	0.00946	-0.089225	6	0.034015	yes	PRSTTE
chr1_984121_G_T_b38	PLEKHN1	5.95	1.36e-08	0.143074	53	0.024044	no	PRSTTE
chr1_1000731_C_T_b38	PLEKHN1	5.205	5.24e-07	0.14179	49	0.027243	no	PRSTTE
chr1_998410_G_A_b38	PLEKHN1	5.03	1.18e-06	0.134609	49	0.026763	no	PRSTTE
chr1_986336_C_A_b38	PLEKHN1	4.946	1.72e-06	0.134971	52	0.027287	no	PRSTTE
chr1_995508_ATTTTT_A_b38	PLEKHN1	4.924	1.9e-06	0.132813	48	0.026974	no	PRSTTE
chr1_969750_ATG_A_b38	PLEKHN1	4.865	2.48e-06	0.121694	51	0.025013	no	PRSTTE
chr1_989068_GTTGA_G_b38	PLEKHN1	4.829	2.92e-06	0.129234	51	0.026764	no	PRSTTE
chr1_995153_C_G_b38	PLEKHN1	-4.811	3.15e-06	-0.131396	31	0.027309	no	PRSTTE
chr1_995187_A_G_b38	PLEKHN1	-4.738	4.34e-06	-0.12877	33	0.027176	no	PRSTTE
chr1_992967_GGGAGGGTCCATGTGTCCGTCATCTGA_G_b38	PLEKHN1	4.733	4.45e-06	0.125214	53	0.026457	no	PRSTTE
chr1_995512_T_C_b38	PLEKHN1	-4.703	5.07e-06	-0.127954	33	0.027208	no	PRSTTE
chr1_1008588_C_T_b38	PLEKHN1	4.672	5.79e-06	0.129939	51	0.02781	no	PRSTTE
chr1_1004716_C_T_b38	PLEKHN1	4.663	6.03e-06	0.129118	48	0.027689	no	PRSTTE
chr1_999842_C_A_b38	PLEKHN1	4.625	7.11e-06	0.127493	53	0.027566	no	PRSTTE
chr1_1005757_AGCCCCCGCAGCAGT_A_b38	PLEKHN1	4.471	1.37e-05	0.122724	45	0.027451	no	PRSTTE
chr1_995786_A_G_b38	PLEKHN1	-4.448	1.51e-05	-0.122477	33	0.027536	no	PRSTTE
chr1_989148_C_A_b38	PLEKHN1	4.328	2.48e-05	0.117597	49	0.02717	no	PRSTTE
chr1_967384_C_G_b38	PLEKHN1	4.327	2.5e-05	0.113458	45	0.026224	no	PRSTTE
chr1_1050066_G_T_b38	PLEKHN1	4.071	6.99e-05	0.111806	29	0.027464	no	PRSTTE
chr1_1015915_C_T_b38	PLEKHN1	4.039	7.93e-05	0.110534	52	0.027369	no	PRSTTE
chr1_992993_A_G_b38	PLEKHN1	-4.001	9.19e-05	-0.106374	43	0.026587	no	PRSTTE
chr1_1018572_G_A_b38	PLEKHN1	3.97	0.000104	0.111834	51	0.02817	no	PRSTTE
chr1_1019397_C_A_b38	PLEKHN1	3.97	0.000104	0.111834	51	0.02817	no	PRSTTE
chr1_1014733_GAAGT_G_b38	PLEKHN1	3.953	0.00011	0.109691	51	0.027745	no	PRSTTE
chr1_1021472_C_T_b38	PLEKHN1	3.918	0.000126	0.10948	49	0.027941	no	PRSTTE
chr1_1015297_T_C_b38	PLEKHN1	3.895	0.000138	0.107927	51	0.027711	no	PRSTTE
chr1_1023775_G_A_b38	PLEKHN1	3.874	0.000149	0.103607	48	0.026743	no	PRSTTE
chr1_1015903_C_T_b38	PLEKHN1	3.848	0.000165	0.106	52	0.027547	no	PRSTTE
chr1_975093_G_A_b38	PLEKHN1	-3.8	0.000198	-0.135489	5	0.035656	no	PRSTTE
chr1_1039411_T_TGG_b38	PLEKHN1	3.773	0.000219	0.108301	40	0.028707	no	PRSTTE
chr1_1049886_C_T_b38	PLEKHN1	3.767	0.000224	0.10291	43	0.027322	no	PRSTTE
chr1_1017048_G_A_b38	PLEKHN1	3.748	0.000239	0.105771	51	0.02822	no	PRSTTE
chr1_1069009_T_TC_b38	PLEKHN1	3.652	0.00034	0.096387	41	0.026392	no	PRSTTE
chr1_1067054_C_T_b38	PLEKHN1	3.623	0.000378	0.093877	41	0.025913	no	PRSTTE
chr1_1025029_G_C_b38	PLEKHN1	3.53	0.000527	0.099526	48	0.028195	no	PRSTTE
chr1_960891_C_T_b38	PLEKHN1	3.527	0.000533	0.10151	48	0.028784	no	PRSTTE
chr1_939779_AGCCAGTGGACGCCGACCT_A_b38	PLEKHN1	3.507	0.000571	0.093764	46	0.026735	no	PRSTTE
chr1_949171_GAGAA_G_b38	PLEKHN1	3.506	0.000573	0.098506	42	0.028095	no	PRSTTE
chr1_955679_C_T_b38	PLEKHN1	3.506	0.000573	0.098506	42	0.028095	no	PRSTTE
chr1_956565_A_G_b38	PLEKHN1	3.506	0.000573	0.098506	42	0.028095	no	PRSTTE
chr1_1118005_C_T_b38	PLEKHN1	-3.501	0.000583	-0.10401	35	0.029705	no	PRSTTE
chr1_946247_G_A_b38	PLEKHN1	3.466	0.00066	0.100779	43	0.029078	no	PRSTTE
chr1_940390_A_G_b38	PLEKHN1	3.39	0.000858	0.08849	57	0.026104	no	PRSTTE
chr1_1067673_C_T_b38	PLEKHN1	3.375	0.000905	0.087139	46	0.025823	no	PRSTTE
chr1_975555_G_A_b38	PLEKHN1	-3.372	0.000911	-0.110657	11	0.032812	no	PRSTTE
chr1_978230_G_A_b38	PLEKHN1	-3.354	0.000972	-0.110744	9	0.033023	no	PRSTTE
chr1_1048922_T_C_b38	PLEKHN1	3.323	0.00108	0.087086	53	0.026205	no	PRSTTE
chr1_1083800_T_C_b38	PLEKHN1	3.295	0.00118	0.080473	50	0.024421	no	PRSTTE
chr1_1019479_TG_T_b38	PLEKHN1	3.257	0.00134	0.085655	56	0.026299	no	PRSTTE
chr1_1086657_C_T_b38	PLEKHN1	3.234	0.00145	0.079478	51	0.024577	no	PRSTTE
chr1_1032278_C_T_b38	PLEKHN1	3.162	0.00184	0.088128	49	0.027869	no	PRSTTE
chr1_965337_CTTAT_C_b38	PLEKHN1	3.144	0.00195	0.09051	47	0.028792	no	PRSTTE
chr1_1758687_A_AAC_b38	PLEKHN1	3.135	0.00201	0.137082	6	0.043732	no	PRSTTE
chr1_1073854_T_C_b38	PLEKHN1	3.072	0.00245	0.07548	54	0.024569	no	PRSTTE
chr1_920719_T_G_b38	PLEKHN1	-3.046	0.00266	-0.080302	35	0.02636	no	PRSTTE
chr1_920728_A_G_b38	PLEKHN1	-3.046	0.00266	-0.080302	35	0.02636	no	PRSTTE
chr1_791554_G_GGAATC_b38	PLEKHN1	-3.039	0.00272	-0.100395	9	0.033035	no	PRSTTE
chr1_1043223_CCT_C_b38	PLEKHN1	2.994	0.00314	0.084813	46	0.028326	no	PRSTTE
chr1_1708001_A_T_b38	PLEKHN1	-2.948	0.00362	-0.164216	3	0.055705	no	PRSTTE
chr1_1027511_C_T_b38	PLEKHN1	2.945	0.00365	0.080227	51	0.02724	no	PRSTTE
chr1_1127258_C_A_b38	PLEKHN1	2.937	0.00375	0.080694	45	0.027479	no	PRSTTE
chr1_919397_A_G_b38	PLEKHN1	2.878	0.00448	0.076015	35	0.026409	no	PRSTTE
chr1_1757030_C_G_b38	PLEKHN1	2.875	0.00453	0.123361	5	0.042914	no	PRSTTE
chr1_1034835_G_C_b38	PLEKHN1	2.862	0.0047	0.078178	54	0.027313	no	PRSTTE
chr1_1020847_C_CGG_b38	PLEKHN1	-2.849	0.00489	-0.067506	43	0.023694	no	PRSTTE
chr1_1753774_C_G_b38	PLEKHN1	2.839	0.00505	0.124193	5	0.043749	no	PRSTTE
chr1_1050069_G_A_b38	PLEKHN1	2.835	0.0051	0.080347	42	0.028336	no	PRSTTE
chr1_1723766_C_T_b38	PLEKHN1	2.825	0.00526	0.09746	11	0.0345	no	PRSTTE
chr1_1756753_A_G_b38	PLEKHN1	2.81	0.0055	0.113185	12	0.040284	no	PRSTTE
chr1_1036800_G_A_b38	PLEKHN1	2.793	0.00578	0.075453	51	0.027011	no	PRSTTE
chr1_1641723_TTCCTCCTCC_T_b38	PLEKHN1	2.792	0.0058	0.104792	3	0.037529	no	PRSTTE
chr1_1606559_C_CGGCTGGTCAGGCGTGGGGCGGGCTGGTCAGGCGTGGGGCG_b38	PLEKHN1	-2.783	0.00595	-0.137311	4	0.049333	no	PRSTTE
chr1_1751888_C_T_b38	PLEKHN1	2.779	0.00602	0.095811	17	0.034471	no	PRSTTE
chr1_919695_C_G_b38	PLEKHN1	2.751	0.00655	0.07269	36	0.026427	no	PRSTTE
chr1_1027226_G_A_b38	PLEKHN1	2.744	0.00668	0.07453	54	0.027159	no	PRSTTE
chr1_1041776_CCGGCCAGTGCCAGGGTCGAGGTGGGCGGCTCCCCCGGGGGAGGGCTG_C_b38	PLEKHN1	2.726	0.00703	0.059646	27	0.021877	no	PRSTTE
chr1_1098619_C_T_b38	PLEKHN1	2.706	0.00746	0.072516	51	0.026797	no	PRSTTE
chr1_1769969_CAAAACA_C_b38	PLEKHN1	2.693	0.00775	0.076289	32	0.028329	no	PRSTTE
chr1_1447108_A_ATT_b38	PLEKHN1	2.687	0.00788	0.091445	9	0.034029	no	PRSTTE
chr1_918574_C_A_b38	PLEKHN1	2.623	0.00946	0.068588	46	0.026148	no	PRSTTE
chr1_919598_A_C_b38	PLEKHN1	2.61	0.00981	0.067329	48	0.025796	no	PRSTTE
chr1_931513_T_C_b38	PLEKHN1	2.608	0.00988	0.071811	51	0.027539	no	PRSTTE
chr1_1000814_A_G_b38	PLEKHN1	2.606	0.00994	0.0815	19	0.03128	no	PRSTTE
chr1_984608_C_CTTCTTTAT_b38	PLEKHN1	-5.242	2.46e-07	-0.061218	17	0.011679	yes	SKINNS
chr1_982260_G_A_b38	PLEKHN1	-4.719	3.18e-06	-0.047867	19	0.010144	yes	SKINNS
chr1_982858_C_G_b38	PLEKHN1	-4.719	3.18e-06	-0.047867	19	0.010144	yes	SKINNS
chr1_981210_G_A_b38	PLEKHN1	-4.667	4.04e-06	-0.050336	15	0.010785	yes	SKINNS
chr1_983747_T_C_b38	PLEKHN1	-4.576	6.15e-06	-0.044386	24	0.009699	yes	SKINNS
chr1_1009470_A_T_b38	PLEKHN1	-4.572	6.26e-06	-0.082681	3	0.018083	yes	SKINNS
chr1_984475_G_A_b38	PLEKHN1	-4.507	8.42e-06	-0.051211	11	0.011363	yes	SKINNS
chr1_996168_G_T_b38	PLEKHN1	-4.169	3.67e-05	-0.042278	20	0.01014	yes	SKINNS
chr1_997077_G_A_b38	PLEKHN1	-4.062	5.74e-05	-0.041285	20	0.010163	yes	SKINNS
chr1_994949_C_T_b38	PLEKHN1	-4.056	5.9e-05	-0.03981	23	0.009816	yes	SKINNS
chr1_994997_C_T_b38	PLEKHN1	-4.056	5.9e-05	-0.03981	23	0.009816	yes	SKINNS
chr1_996254_A_AGGGAGGGCAG_b38	PLEKHN1	-3.923	0.000101	-0.040802	17	0.010402	yes	SKINNS
chr1_1000335_C_T_b38	PLEKHN1	-3.891	0.000115	-0.039448	20	0.010138	yes	SKINNS
chr1_993036_G_A_b38	PLEKHN1	-3.794	0.000168	-0.036676	31	0.009666	yes	SKINNS
chr1_992361_G_A_b38	PLEKHN1	-3.756	0.000195	-0.038648	18	0.010289	yes	SKINNS
chr1_984039_T_C_b38	PLEKHN1	3.747	0.000203	0.034627	39	0.009242	yes	SKINNS
chr1_993198_G_A_b38	PLEKHN1	-3.662	0.000281	-0.062433	6	0.01705	yes	SKINNS
chr1_986629_G_A_b38	PLEKHN1	-3.652	0.000291	-0.037966	17	0.010396	yes	SKINNS
chr1_988731_T_A_b38	PLEKHN1	-3.651	0.000292	-0.034441	29	0.009432	yes	SKINNS
chr1_986280_C_T_b38	PLEKHN1	-3.627	0.00032	-0.03775	17	0.010409	yes	SKINNS
chr1_1002745_G_A_b38	PLEKHN1	-3.623	0.000325	-0.035349	23	0.009757	yes	SKINNS
chr1_986925_G_GC_b38	PLEKHN1	-3.542	0.000439	-0.06148	5	0.017357	yes	SKINNS
chr1_990171_AT_A_b38	PLEKHN1	-3.523	0.000471	-0.060818	5	0.017264	yes	SKINNS
chr1_991051_A_T_b38	PLEKHN1	-3.523	0.000471	-0.060818	5	0.017264	yes	SKINNS
chr1_991241_A_C_b38	PLEKHN1	-3.523	0.000471	-0.060818	5	0.017264	yes	SKINNS
chr1_991929_T_C_b38	PLEKHN1	-3.523	0.000471	-0.060818	5	0.017264	yes	SKINNS
chr1_975058_A_G_b38	PLEKHN1	-3.437	0.000643	-0.068707	4	0.019991	yes	SKINNS
chr1_984121_G_T_b38	PLEKHN1	3.391	0.000759	0.027302	136	0.008052	yes	SKINNS
chr1_1009731_C_T_b38	PLEKHN1	-3.387	0.000769	-0.056331	8	0.016631	yes	SKINNS
chr1_1074061_G_A_b38	PLEKHN1	-3.341	0.000904	-0.039856	11	0.011928	yes	SKINNS
chr1_1074910_TCACA_T_b38	PLEKHN1	-3.329	0.000943	-0.039316	11	0.011809	yes	SKINNS
chr1_987696_A_G_b38	PLEKHN1	-3.309	0.00101	-0.05717	5	0.017277	yes	SKINNS
chr1_988079_A_G_b38	PLEKHN1	-3.309	0.00101	-0.05717	5	0.017277	yes	SKINNS
chr1_989518_C_A_b38	PLEKHN1	-3.309	0.00101	-0.05717	5	0.017277	yes	SKINNS
chr1_990971_C_T_b38	PLEKHN1	-3.309	0.00101	-0.05717	5	0.017277	yes	SKINNS
chr1_993456_C_T_b38	PLEKHN1	-3.309	0.00101	-0.05717	5	0.017277	yes	SKINNS
chr1_993936_C_T_b38	PLEKHN1	-3.309	0.00101	-0.05717	5	0.017277	yes	SKINNS
chr1_993947_A_G_b38	PLEKHN1	-3.309	0.00101	-0.05717	5	0.017277	yes	SKINNS
chr1_999842_C_A_b38	PLEKHN1	3.302	0.00104	0.027888	138	0.008447	yes	SKINNS
chr1_988369_T_C_b38	PLEKHN1	-3.287	0.00109	-0.056217	5	0.017102	yes	SKINNS
chr1_998741_G_A_b38	PLEKHN1	-3.263	0.00119	-0.033324	20	0.010213	yes	SKINNS
chr1_990304_T_C_b38	PLEKHN1	-3.258	0.00121	-0.056322	5	0.017289	yes	SKINNS
chr1_1000731_C_T_b38	PLEKHN1	3.252	0.00123	0.027083	124	0.008329	yes	SKINNS
chr1_986190_T_C_b38	PLEKHN1	-3.239	0.00129	-0.056588	5	0.017473	yes	SKINNS
chr1_1008088_T_C_b38	PLEKHN1	-3.177	0.00159	-0.052799	7	0.016621	yes	SKINNS
chr1_998410_G_A_b38	PLEKHN1	3.163	0.00167	0.026256	121	0.008301	yes	SKINNS
chr1_1056668_C_CGT_b38	PLEKHN1	3.148	0.00175	0.029809	30	0.009469	yes	SKINNS
chr1_984109_C_T_b38	PLEKHN1	3.079	0.0022	0.051712	4	0.016794	yes	SKINNS
chr1_1007870_C_T_b38	PLEKHN1	-3.058	0.00236	-0.049552	7	0.016204	yes	SKINNS
chr1_1010232_C_T_b38	PLEKHN1	-3.04	0.0025	-0.050088	7	0.016474	yes	SKINNS
chr1_1013490_C_G_b38	PLEKHN1	-3.014	0.00272	-0.050469	6	0.016743	yes	SKINNS
chr1_1013541_T_C_b38	PLEKHN1	-3.014	0.00272	-0.050469	6	0.016743	yes	SKINNS
chr1_858792_G_T_b38	PLEKHN1	2.984	0.003	0.078952	3	0.026455	yes	SKINNS
chr1_993602_G_GC_b38	PLEKHN1	-2.982	0.00302	-0.047747	7	0.016012	yes	SKINNS
chr1_1063202_G_C_b38	PLEKHN1	2.978	0.00306	0.024505	143	0.008229	yes	SKINNS
chr1_1129422_T_C_b38	PLEKHN1	-2.961	0.00323	-0.032911	12	0.011115	yes	SKINNS
chr1_989249_A_G_b38	PLEKHN1	-2.955	0.0033	-0.049852	6	0.016872	yes	SKINNS
chr1_988988_C_T_b38	PLEKHN1	-2.929	0.00357	-0.049297	5	0.016831	yes	SKINNS
chr1_1069009_T_TC_b38	PLEKHN1	2.919	0.00369	0.024168	106	0.008281	yes	SKINNS
chr1_989223_T_C_b38	PLEKHN1	-2.866	0.00436	-0.047356	6	0.016526	yes	SKINNS
chr1_1606041_G_A_b38	PLEKHN1	-2.828	0.0049	-0.092282	3	0.032632	yes	SKINNS
chr1_1056714_T_C_b38	PLEKHN1	2.807	0.00522	0.028361	20	0.010104	yes	SKINNS
chr1_1014274_A_G_b38	PLEKHN1	-2.799	0.00534	-0.043071	15	0.015387	yes	SKINNS
chr1_1011654_G_A_b38	PLEKHN1	-2.794	0.00543	-0.044845	11	0.016049	yes	SKINNS
chr1_1056662_C_T_b38	PLEKHN1	2.789	0.00552	0.026682	29	0.009568	yes	SKINNS
chr1_996128_T_A_b38	PLEKHN1	-2.781	0.00565	-0.045495	15	0.016361	yes	SKINNS
chr1_998719_G_C_b38	PLEKHN1	-2.761	0.00599	-0.049013	7	0.01775	yes	SKINNS
chr1_998726_A_G_b38	PLEKHN1	-2.761	0.00599	-0.049013	7	0.01775	yes	SKINNS
chr1_1005757_AGCCCCCGCAGCAGT_A_b38	PLEKHN1	2.756	0.00609	0.022728	112	0.008247	yes	SKINNS
chr1_728044_C_T_b38	PLEKHN1	2.745	0.0063	0.061123	9	0.022268	yes	SKINNS
chr1_1050066_G_T_b38	PLEKHN1	2.736	0.00647	0.024578	74	0.008984	yes	SKINNS
chr1_107125_A_G_b38	PLEKHN1	-2.736	0.00647	-0.047313	3	0.017294	yes	SKINNS
chr1_1057980_C_A_b38	PLEKHN1	2.724	0.00671	0.022827	133	0.008381	yes	SKINNS
chr1_265261_G_A_b38	PLEKHN1	-2.707	0.00705	-0.028958	22	0.010698	yes	SKINNS
chr1_796578_C_T_b38	PLEKHN1	2.692	0.00736	0.071687	4	0.026626	yes	SKINNS
chr1_1065797_G_C_b38	PLEKHN1	2.656	0.0082	0.023173	56	0.008726	yes	SKINNS
chr1_1069577_G_A_b38	PLEKHN1	2.648	0.00839	0.021262	120	0.008031	yes	SKINNS
chr1_1016060_CT_C_b38	PLEKHN1	-2.638	0.00864	-0.029889	8	0.011332	yes	SKINNS
chr1_1013855_G_A_b38	PLEKHN1	-2.634	0.00874	-0.043832	7	0.016644	yes	SKINNS
chr1_1009716_C_T_b38	PLEKHN1	-2.597	0.00971	-0.043417	20	0.016718	yes	SKINNS
chr1_1536667_C_T_b38	PLEKHN1	-2.596	0.00976	-0.038193	3	0.014715	yes	SKINNS
chr1_1017114_A_AT_b38	PLEKHN1	-4.924	1.2e-06	-0.042202	61	0.008571	no	SKINNS
chr1_1015925_A_ATT_b38	PLEKHN1	-4.904	1.32e-06	-0.040274	64	0.008212	no	SKINNS
chr1_995153_C_G_b38	PLEKHN1	-4.735	2.94e-06	-0.038332	87	0.008095	no	SKINNS
chr1_995786_A_G_b38	PLEKHN1	-4.683	3.76e-06	-0.037801	93	0.008072	no	SKINNS
chr1_995187_A_G_b38	PLEKHN1	-4.675	3.89e-06	-0.037788	89	0.008082	no	SKINNS
chr1_995371_C_G_b38	PLEKHN1	-4.619	5.04e-06	-0.037458	77	0.008109	no	SKINNS
chr1_1006159_C_T_b38	PLEKHN1	-4.609	5.29e-06	-0.037585	86	0.008155	no	SKINNS
chr1_975014_C_T_b38	PLEKHN1	-4.551	6.89e-06	-0.036682	80	0.00806	no	SKINNS
chr1_992993_A_G_b38	PLEKHN1	-4.497	8.78e-06	-0.035879	106	0.007978	no	SKINNS
chr1_995512_T_C_b38	PLEKHN1	-4.497	8.8e-06	-0.036652	92	0.008151	no	SKINNS
chr1_1014863_A_C_b38	PLEKHN1	-4.432	1.18e-05	-0.036236	75	0.008176	no	SKINNS
chr1_1005904_C_T_b38	PLEKHN1	-4.43	1.19e-05	-0.036216	76	0.008176	no	SKINNS
chr1_1005429_C_CA_b38	PLEKHN1	-4.424	1.22e-05	-0.036074	77	0.008154	no	SKINNS
chr1_1016623_G_A_b38	PLEKHN1	-4.406	1.32e-05	-0.036344	71	0.008248	no	SKINNS
chr1_995982_G_A_b38	PLEKHN1	-4.386	1.44e-05	-0.035956	78	0.008199	no	SKINNS
chr1_1005954_G_A_b38	PLEKHN1	-4.377	1.5e-05	-0.035796	76	0.008178	no	SKINNS
chr1_1016184_A_G_b38	PLEKHN1	-4.372	1.53e-05	-0.035349	80	0.008084	no	SKINNS
chr1_1004625_A_G_b38	PLEKHN1	-4.318	1.94e-05	-0.035318	85	0.008178	no	SKINNS
chr1_974039_C_T_b38	PLEKHN1	-4.123	4.46e-05	-0.042675	19	0.010351	no	SKINNS
chr1_1014228_G_A_b38	PLEKHN1	-4.041	6.26e-05	-0.032692	82	0.008089	no	SKINNS
chr1_978812_G_C_b38	PLEKHN1	-4.019	6.85e-05	-0.073148	5	0.0182	no	SKINNS
chr1_1089890_C_T_b38	PLEKHN1	-3.926	9.99e-05	-0.057408	3	0.014622	no	SKINNS
chr1_1007746_CTTTTTTTTTTTTTT_C_b38	PLEKHN1	-3.893	0.000114	-0.040972	25	0.010523	no	SKINNS
chr1_1018652_C_G_b38	PLEKHN1	-3.861	0.00013	-0.033064	51	0.008565	no	SKINNS
chr1_1018754_G_A_b38	PLEKHN1	-3.861	0.00013	-0.033064	51	0.008565	no	SKINNS
chr1_1020217_G_T_b38	PLEKHN1	-3.823	0.000151	-0.032998	50	0.008632	no	SKINNS
chr1_975523_T_C_b38	PLEKHN1	-3.818	0.000154	-0.067798	6	0.017758	no	SKINNS
chr1_985353_T_C_b38	PLEKHN1	-3.694	0.000248	-0.065533	3	0.017739	no	SKINNS
chr1_983004_G_T_b38	PLEKHN1	3.671	0.000271	0.030051	134	0.008186	no	SKINNS
chr1_1009184_T_C_b38	PLEKHN1	-3.668	0.000274	-0.030029	78	0.008187	no	SKINNS
chr1_979560_T_C_b38	PLEKHN1	3.663	0.000279	0.029967	127	0.00818	no	SKINNS
chr1_1008307_G_C_b38	PLEKHN1	-3.626	0.000321	-0.029572	79	0.008155	no	SKINNS
chr1_981680_C_G_b38	PLEKHN1	-3.619	0.00033	-0.065857	5	0.018198	no	SKINNS
chr1_1004111_TG_T_b38	PLEKHN1	-3.588	0.00037	-0.035933	22	0.010015	no	SKINNS
chr1_979847_A_G_b38	PLEKHN1	-3.556	0.000417	-0.063501	6	0.017859	no	SKINNS
chr1_979472_G_C_b38	PLEKHN1	3.547	0.00043	0.028708	122	0.008093	no	SKINNS
chr1_986336_C_A_b38	PLEKHN1	3.499	0.000514	0.030132	131	0.008612	no	SKINNS
chr1_1017048_G_A_b38	PLEKHN1	3.494	0.000524	0.029094	137	0.008327	no	SKINNS
chr1_1127664_A_G_b38	PLEKHN1	-3.492	0.000527	-0.040984	10	0.011736	no	SKINNS
chr1_978509_G_A_b38	PLEKHN1	3.482	0.000547	0.02804	120	0.008053	no	SKINNS
chr1_1129599_C_T_b38	PLEKHN1	3.466	0.00058	0.040331	11	0.011636	no	SKINNS
chr1_993140_A_G_b38	PLEKHN1	-3.397	0.000741	-0.060558	4	0.017825	no	SKINNS
chr1_1021740_G_C_b38	PLEKHN1	-3.397	0.000742	-0.029172	49	0.008587	no	SKINNS
chr1_1018572_G_A_b38	PLEKHN1	3.39	0.000761	0.028543	139	0.008419	no	SKINNS
chr1_989068_GTTGA_G_b38	PLEKHN1	3.368	0.000824	0.02816	123	0.008362	no	SKINNS
chr1_989148_C_A_b38	PLEKHN1	3.365	0.000831	0.028723	134	0.008535	no	SKINNS
chr1_971790_AG_A_b38	PLEKHN1	-3.304	0.00103	-0.02769	75	0.00838	no	SKINNS
chr1_1022518_G_T_b38	PLEKHN1	-3.289	0.00109	-0.027574	58	0.008385	no	SKINNS
chr1_1124025_C_T_b38	PLEKHN1	3.25	0.00124	0.045636	3	0.01404	no	SKINNS
chr1_983193_A_G_b38	PLEKHN1	3.191	0.00152	0.025976	116	0.00814	no	SKINNS
chr1_1020697_C_T_b38	PLEKHN1	-3.174	0.00161	-0.028539	40	0.008992	no	SKINNS
chr1_1101579_T_C_b38	PLEKHN1	3.161	0.00168	0.039	8	0.012337	no	SKINNS
chr1_52188_A_ATAAT_b38	PLEKHN1	-3.159	0.00169	-0.091984	4	0.029115	no	SKINNS
chr1_1126571_C_T_b38	PLEKHN1	3.15	0.00175	0.041773	5	0.013263	no	SKINNS
chr1_1126654_G_A_b38	PLEKHN1	3.132	0.00185	0.041823	5	0.013353	no	SKINNS
chr1_1019397_C_A_b38	PLEKHN1	3.118	0.00194	0.026139	141	0.008385	no	SKINNS
chr1_1125228_G_A_b38	PLEKHN1	3.089	0.00214	0.041722	4	0.013508	no	SKINNS
chr1_1015903_C_T_b38	PLEKHN1	3.082	0.00218	0.025174	118	0.008168	no	SKINNS
chr1_995508_ATTTTT_A_b38	PLEKHN1	3.081	0.00219	0.025991	119	0.008436	no	SKINNS
chr1_1113609_A_G_b38	PLEKHN1	3.067	0.0023	0.038681	5	0.012614	no	SKINNS
chr1_1125772_T_C_b38	PLEKHN1	3.061	0.00234	0.04021	6	0.013135	no	SKINNS
chr1_1124012_G_GCACACACCTGCGTGCACACACCTGCA_b38	PLEKHN1	3.06	0.00234	0.04411	3	0.014413	no	SKINNS
chr1_981454_G_A_b38	PLEKHN1	3.053	0.0024	0.024791	116	0.008121	no	SKINNS
chr1_1125882_A_G_b38	PLEKHN1	3.045	0.00246	0.040062	5	0.013156	no	SKINNS
chr1_1015915_C_T_b38	PLEKHN1	3.04	0.00251	0.02479	120	0.008156	no	SKINNS
chr1_1126128_G_A_b38	PLEKHN1	2.999	0.00286	0.03999	5	0.013336	no	SKINNS
chr1_1015950_G_A_b38	PLEKHN1	-2.996	0.00289	-0.043682	14	0.014582	no	SKINNS
chr1_1125735_T_C_b38	PLEKHN1	2.99	0.00295	0.038808	6	0.012981	no	SKINNS
chr1_1020681_A_AG_b38	PLEKHN1	-2.979	0.00305	-0.026908	39	0.009032	no	SKINNS
chr1_1123255_G_A_b38	PLEKHN1	2.974	0.0031	0.04025	4	0.013536	no	SKINNS
chr1_1111337_G_C_b38	PLEKHN1	2.969	0.00315	0.03891	5	0.013104	no	SKINNS
chr1_1022868_A_G_b38	PLEKHN1	-2.964	0.0032	-0.025215	60	0.008506	no	SKINNS
chr1_1124094_AAC_A_b38	PLEKHN1	2.955	0.00329	0.04035	4	0.013654	no	SKINNS
chr1_1110093_G_A_b38	PLEKHN1	2.952	0.00333	0.039359	4	0.013333	no	SKINNS
chr1_1111481_G_A_b38	PLEKHN1	2.952	0.00333	0.039359	4	0.013333	no	SKINNS
chr1_1113703_C_A_b38	PLEKHN1	2.952	0.00333	0.039359	4	0.013333	no	SKINNS
chr1_1126222_G_A_b38	PLEKHN1	2.949	0.00335	0.03885	5	0.013172	no	SKINNS
chr1_1119172_G_A_b38	PLEKHN1	2.944	0.00341	0.039899	4	0.013552	no	SKINNS
chr1_1123889_C_T_b38	PLEKHN1	2.944	0.00341	0.039899	4	0.013552	no	SKINNS
chr1_1124663_A_C_b38	PLEKHN1	2.944	0.00341	0.039899	4	0.013552	no	SKINNS
chr1_984145_TAGTC_T_b38	PLEKHN1	2.936	0.00349	0.049516	4	0.016864	no	SKINNS
chr1_1120273_C_G_b38	PLEKHN1	2.934	0.00352	0.039373	4	0.013418	no	SKINNS
chr1_1120521_C_A_b38	PLEKHN1	2.934	0.00352	0.039373	4	0.013418	no	SKINNS
chr1_1121559_T_A_b38	PLEKHN1	2.934	0.00352	0.039373	4	0.013418	no	SKINNS
chr1_1122128_C_G_b38	PLEKHN1	2.934	0.00352	0.039373	4	0.013418	no	SKINNS
chr1_1122144_C_T_b38	PLEKHN1	2.934	0.00352	0.039373	4	0.013418	no	SKINNS
chr1_1124132_T_TACACACCTGAGCACACACACCTGTGC_b38	PLEKHN1	2.927	0.00359	0.039522	4	0.013501	no	SKINNS
chr1_1124768_G_T_b38	PLEKHN1	2.927	0.00359	0.039947	4	0.013646	no	SKINNS
chr1_1118072_G_A_b38	PLEKHN1	2.922	0.00366	0.039242	4	0.013432	no	SKINNS
chr1_1117566_G_T_b38	PLEKHN1	2.913	0.00376	0.038755	4	0.013304	no	SKINNS
chr1_1118447_T_TG_b38	PLEKHN1	2.913	0.00376	0.038755	4	0.013304	no	SKINNS
chr1_969780_C_T_b38	PLEKHN1	-2.91	0.0038	-0.032862	30	0.011294	no	SKINNS
chr1_727837_C_T_b38	PLEKHN1	2.905	0.00386	0.085991	4	0.029602	no	SKINNS
chr1_1123509_G_A_b38	PLEKHN1	2.896	0.00396	0.038877	4	0.013422	no	SKINNS
chr1_1042813_G_A_b38	PLEKHN1	-2.894	0.00399	-0.036686	7	0.012677	no	SKINNS
chr1_1122649_A_G_b38	PLEKHN1	2.891	0.00402	0.038592	4	0.013347	no	SKINNS
chr1_1120417_A_G_b38	PLEKHN1	2.888	0.00407	0.038393	4	0.013295	no	SKINNS
chr1_1122042_G_C_b38	PLEKHN1	2.888	0.00407	0.038393	4	0.013295	no	SKINNS
chr1_1019479_TG_T_b38	PLEKHN1	2.887	0.00408	0.022682	136	0.007857	no	SKINNS
chr1_275583_TTTTA_T_b38	PLEKHN1	-2.884	0.00411	-0.030721	10	0.010652	no	SKINNS
chr1_1102614_T_TA_b38	PLEKHN1	-2.875	0.00423	-0.03933	24	0.013679	no	SKINNS
chr1_969785_A_G_b38	PLEKHN1	-2.87	0.0043	-0.047298	20	0.016481	no	SKINNS
chr1_966426_G_C_b38	PLEKHN1	2.862	0.0044	0.046005	22	0.016073	no	SKINNS
chr1_1021472_C_T_b38	PLEKHN1	2.862	0.00441	0.023178	126	0.008099	no	SKINNS
chr1_1048922_T_C_b38	PLEKHN1	2.834	0.00481	0.023257	119	0.008207	no	SKINNS
chr1_992967_GGGAGGGTCCATGTGTCCGTCATCTGA_G_b38	PLEKHN1	2.831	0.00486	0.02393	141	0.008454	no	SKINNS
chr1_1120889_C_T_b38	PLEKHN1	2.827	0.00491	0.037687	4	0.013332	no	SKINNS
chr1_1107147_G_C_b38	PLEKHN1	2.814	0.00511	0.037881	4	0.013462	no	SKINNS
chr1_1130879_G_C_b38	PLEKHN1	-2.807	0.00523	-0.030314	16	0.010801	no	SKINNS
chr1_978953_C_G_b38	PLEKHN1	2.78	0.00567	0.022369	110	0.008047	no	SKINNS
chr1_1023351_A_G_b38	PLEKHN1	-2.779	0.00569	-0.02364	57	0.008508	no	SKINNS
chr1_1015942_C_T_b38	PLEKHN1	-2.76	0.00601	-0.03995	15	0.014473	no	SKINNS
chr1_1015297_T_C_b38	PLEKHN1	2.755	0.00611	0.022361	120	0.008117	no	SKINNS
chr1_1048791_CAG_C_b38	PLEKHN1	2.743	0.00634	0.023772	116	0.008668	no	SKINNS
chr1_1015336_A_T_b38	PLEKHN1	-2.734	0.00651	-0.045813	6	0.016758	no	SKINNS
chr1_988819_G_GGAGTGTTTCGGGAGTTCTGGGTTGATTGTTTCTGGAGTTCAGGGTT_b38	PLEKHN1	-2.73	0.00658	-0.039688	10	0.014536	no	SKINNS
chr1_1014733_GAAGT_G_b38	PLEKHN1	2.714	0.0069	0.022104	123	0.008144	no	SKINNS
chr1_1010481_ATTAT_A_b38	PLEKHN1	-2.707	0.00706	-0.043362	12	0.016021	no	SKINNS
chr1_1004716_C_T_b38	PLEKHN1	2.706	0.00707	0.022535	119	0.008328	no	SKINNS
chr1_1101496_T_A_b38	PLEKHN1	2.679	0.00765	0.032527	11	0.012141	no	SKINNS
chr1_1023775_G_A_b38	PLEKHN1	2.673	0.00779	0.022097	130	0.008266	no	SKINNS
chr1_1002192_A_AT_b38	PLEKHN1	-2.656	0.0082	-0.033825	5	0.012737	no	SKINNS
chr1_1067054_C_T_b38	PLEKHN1	2.654	0.00824	0.022089	101	0.008323	no	SKINNS
chr1_1661562_G_C_b38	PLEKHN1	-2.633	0.00877	-0.019974	114	0.007587	no	SKINNS
chr1_134065_C_CTTT_b38	PLEKHN1	2.625	0.00897	0.074972	4	0.028563	no	SKINNS
chr1_969648_ACGTG_A_b38	PLEKHN1	2.62	0.0091	0.071214	4	0.027184	no	SKINNS
chr1_969637_T_C_b38	PLEKHN1	2.602	0.00957	0.061664	10	0.023698	no	SKINNS
chr1_1056704_T_C_b38	PLEKHN1	2.595	0.00977	0.025675	23	0.009894	no	SKINNS
chr1_983747_T_C_b38	PLEKHN1	-5.327	1.48e-07	-0.070965	28	0.013322	yes	SKNS
chr1_981210_G_A_b38	PLEKHN1	-5.171	3.3e-07	-0.076411	18	0.014777	yes	SKNS
chr1_982260_G_A_b38	PLEKHN1	-5.163	3.44e-07	-0.07145	23	0.013839	yes	SKNS
chr1_982858_C_G_b38	PLEKHN1	-5.163	3.44e-07	-0.07145	23	0.013839	yes	SKNS
chr1_984039_T_C_b38	PLEKHN1	4.421	1.19e-05	0.054142	46	0.012246	yes	SKNS
chr1_975014_C_T_b38	PLEKHN1	-4.251	2.52e-05	-0.048806	85	0.011482	yes	SKNS
chr1_988731_T_A_b38	PLEKHN1	-4.23	2.75e-05	-0.056394	34	0.013332	yes	SKNS
chr1_988988_C_T_b38	PLEKHN1	-4.216	2.92e-05	-0.099066	4	0.023496	yes	SKNS
chr1_993036_G_A_b38	PLEKHN1	-4.159	3.72e-05	-0.056067	35	0.013481	yes	SKNS
chr1_995153_C_G_b38	PLEKHN1	-4.099	4.8e-05	-0.046719	96	0.011399	yes	SKNS
chr1_1004625_A_G_b38	PLEKHN1	-4.097	4.84e-05	-0.046372	99	0.011319	yes	SKNS
chr1_986280_C_T_b38	PLEKHN1	-4.091	4.96e-05	-0.057562	23	0.01407	yes	SKNS
chr1_992361_G_A_b38	PLEKHN1	-4.078	5.23e-05	-0.057101	24	0.014001	yes	SKNS
chr1_995187_A_G_b38	PLEKHN1	-4.075	5.3e-05	-0.046483	98	0.011407	yes	SKNS
chr1_994949_C_T_b38	PLEKHN1	-4.045	6e-05	-0.055269	28	0.013663	yes	SKNS
chr1_994997_C_T_b38	PLEKHN1	-4.045	6e-05	-0.055269	28	0.013663	yes	SKNS
chr1_988819_G_GGAGTGTTTCGGGAGTTCTGGGTTGATTGTTTCTGGAGTTCAGGGTT_b38	PLEKHN1	-4.044	6.03e-05	-0.082999	8	0.020524	yes	SKNS
chr1_986629_G_A_b38	PLEKHN1	-4.036	6.22e-05	-0.056871	23	0.014089	yes	SKNS
chr1_984109_C_T_b38	PLEKHN1	4.019	6.68e-05	0.097359	4	0.024225	yes	SKNS
chr1_996254_A_AGGGAGGGCAG_b38	PLEKHN1	-4.005	7.08e-05	-0.057103	23	0.014257	yes	SKNS
chr1_995371_C_G_b38	PLEKHN1	-4.002	7.17e-05	-0.045264	88	0.011311	yes	SKNS
chr1_995982_G_A_b38	PLEKHN1	-3.963	8.42e-05	-0.044916	90	0.011335	yes	SKNS
chr1_996168_G_T_b38	PLEKHN1	-3.947	8.96e-05	-0.054761	26	0.013873	yes	SKNS
chr1_995512_T_C_b38	PLEKHN1	-3.937	9.35e-05	-0.044891	101	0.011403	yes	SKNS
chr1_1005429_C_CA_b38	PLEKHN1	-3.935	9.41e-05	-0.044759	87	0.011374	yes	SKNS
chr1_1005904_C_T_b38	PLEKHN1	-3.935	9.41e-05	-0.044759	87	0.011374	yes	SKNS
chr1_1005954_G_A_b38	PLEKHN1	-3.935	9.41e-05	-0.044759	87	0.011374	yes	SKNS
chr1_978812_G_C_b38	PLEKHN1	-3.93	9.62e-05	-0.098329	6	0.025021	yes	SKNS
chr1_995786_A_G_b38	PLEKHN1	-3.925	9.79e-05	-0.044694	102	0.011386	yes	SKNS
chr1_997077_G_A_b38	PLEKHN1	-3.88	0.000118	-0.05375	26	0.013854	yes	SKNS
chr1_1009184_T_C_b38	PLEKHN1	-3.871	0.000122	-0.043852	89	0.01133	yes	SKNS
chr1_984145_TAGTC_T_b38	PLEKHN1	3.854	0.00013	0.093419	3	0.02424	yes	SKNS
chr1_1014274_A_G_b38	PLEKHN1	-3.829	0.000144	-0.082893	10	0.021649	yes	SKNS
chr1_974039_C_T_b38	PLEKHN1	-3.813	0.000153	-0.055421	20	0.014535	yes	SKNS
chr1_1000335_C_T_b38	PLEKHN1	-3.811	0.000155	-0.053103	26	0.013936	yes	SKNS
chr1_1014863_A_C_b38	PLEKHN1	-3.778	0.000176	-0.043607	84	0.011543	yes	SKNS
chr1_998741_G_A_b38	PLEKHN1	-3.738	0.000206	-0.051778	28	0.013853	yes	SKNS
chr1_1012158_C_T_b38	PLEKHN1	-3.73	0.000212	-0.078271	15	0.020985	yes	SKNS
chr1_1008307_G_C_b38	PLEKHN1	-3.726	0.000215	-0.042469	89	0.011398	yes	SKNS
chr1_951437_C_CATTTT_b38	PLEKHN1	3.656	0.000281	0.088602	5	0.024234	yes	SKNS
chr1_986190_T_C_b38	PLEKHN1	-3.653	0.000284	-0.087205	5	0.02387	yes	SKNS
chr1_986925_G_GC_b38	PLEKHN1	-3.643	0.000296	-0.087271	5	0.023954	yes	SKNS
chr1_993602_G_GC_b38	PLEKHN1	-3.641	0.000298	-0.084785	5	0.023285	yes	SKNS
chr1_975523_T_C_b38	PLEKHN1	-3.628	0.000314	-0.088684	7	0.024448	yes	SKNS
chr1_993140_A_G_b38	PLEKHN1	-3.62	0.000322	-0.089294	4	0.024665	yes	SKNS
chr1_979847_A_G_b38	PLEKHN1	-3.618	0.000325	-0.088352	7	0.024418	yes	SKNS
chr1_1016623_G_A_b38	PLEKHN1	-3.604	0.000342	-0.041921	80	0.011631	yes	SKNS
chr1_987696_A_G_b38	PLEKHN1	-3.601	0.000347	-0.086639	5	0.024059	yes	SKNS
chr1_989223_T_C_b38	PLEKHN1	-3.549	0.00042	-0.084152	5	0.02371	yes	SKNS
chr1_988079_A_G_b38	PLEKHN1	-3.525	0.00046	-0.084076	5	0.023851	yes	SKNS
chr1_989518_C_A_b38	PLEKHN1	-3.525	0.00046	-0.084076	5	0.023851	yes	SKNS
chr1_990971_C_T_b38	PLEKHN1	-3.525	0.00046	-0.084076	5	0.023851	yes	SKNS
chr1_993936_C_T_b38	PLEKHN1	-3.525	0.00046	-0.084076	5	0.023851	yes	SKNS
chr1_993947_A_G_b38	PLEKHN1	-3.525	0.00046	-0.084076	5	0.023851	yes	SKNS
chr1_990171_AT_A_b38	PLEKHN1	-3.516	0.000476	-0.084171	5	0.023942	yes	SKNS
chr1_991051_A_T_b38	PLEKHN1	-3.516	0.000476	-0.084171	5	0.023942	yes	SKNS
chr1_991241_A_C_b38	PLEKHN1	-3.516	0.000476	-0.084171	5	0.023942	yes	SKNS
chr1_991929_T_C_b38	PLEKHN1	-3.516	0.000476	-0.084171	5	0.023942	yes	SKNS
chr1_1013041_A_AAAC_b38	PLEKHN1	-3.487	0.00053	-0.088024	3	0.025247	yes	SKNS
chr1_985268_T_C_b38	PLEKHN1	-3.482	0.000538	-0.086531	3	0.02485	yes	SKNS
chr1_1010232_C_T_b38	PLEKHN1	-3.478	0.000547	-0.082097	6	0.023606	yes	SKNS
chr1_990304_T_C_b38	PLEKHN1	-3.475	0.000553	-0.082894	5	0.023855	yes	SKNS
chr1_993456_C_T_b38	PLEKHN1	-3.469	0.000565	-0.082398	6	0.023755	yes	SKNS
chr1_988369_T_C_b38	PLEKHN1	-3.436	0.000636	-0.081468	5	0.02371	yes	SKNS
chr1_1010481_ATTAT_A_b38	PLEKHN1	-3.401	0.000721	-0.077073	9	0.022659	yes	SKNS
chr1_1014545_C_T_b38	PLEKHN1	-3.374	0.000796	-0.075619	9	0.022415	yes	SKNS
chr1_993198_G_A_b38	PLEKHN1	-3.371	0.000803	-0.081292	5	0.024115	yes	SKNS
chr1_1017114_A_AT_b38	PLEKHN1	-3.368	0.000811	-0.040615	68	0.012058	yes	SKNS
chr1_989249_A_G_b38	PLEKHN1	-3.345	0.000882	-0.079572	5	0.023792	yes	SKNS
chr1_1011654_G_A_b38	PLEKHN1	-3.338	0.000901	-0.075975	9	0.022757	yes	SKNS
chr1_1013312_G_A_b38	PLEKHN1	-3.276	0.00112	-0.072696	14	0.022193	yes	SKNS
chr1_1009716_C_T_b38	PLEKHN1	-3.274	0.00113	-0.073259	15	0.022378	yes	SKNS
chr1_1002745_G_A_b38	PLEKHN1	-3.236	0.00129	-0.043577	31	0.013464	yes	SKNS
chr1_1008527_C_G_b38	PLEKHN1	-3.215	0.00138	-0.07144	15	0.022219	yes	SKNS
chr1_1009731_C_T_b38	PLEKHN1	-3.21	0.00141	-0.075596	7	0.023552	yes	SKNS
chr1_653516_C_T_b38	PLEKHN1	-3.189	0.00151	-0.079596	4	0.024957	yes	SKNS
chr1_1013855_G_A_b38	PLEKHN1	-3.179	0.00156	-0.075008	5	0.023593	yes	SKNS
chr1_979560_T_C_b38	PLEKHN1	3.173	0.0016	0.035988	140	0.011342	yes	SKNS
chr1_1008088_T_C_b38	PLEKHN1	-3.171	0.00161	-0.075411	7	0.02378	yes	SKNS
chr1_981169_A_G_b38	PLEKHN1	3.17	0.00161	0.040316	43	0.012717	yes	SKNS
chr1_985353_T_C_b38	PLEKHN1	-3.133	0.00182	-0.074566	5	0.023798	yes	SKNS
chr1_1013490_C_G_b38	PLEKHN1	-3.132	0.00183	-0.075369	4	0.024062	yes	SKNS
chr1_1013541_T_C_b38	PLEKHN1	-3.132	0.00183	-0.075369	4	0.024062	yes	SKNS
chr1_996128_T_A_b38	PLEKHN1	-3.112	0.00196	-0.070473	12	0.022648	yes	SKNS
chr1_134266_G_A_b38	PLEKHN1	-3.099	0.00204	-0.06016	4	0.019412	yes	SKNS
chr1_1002195_T_TA_b38	PLEKHN1	-3.062	0.00231	-0.056272	5	0.018375	yes	SKNS
chr1_1470425_C_CTT_b38	PLEKHN1	-3.046	0.00244	-0.062223	19	0.020431	yes	SKNS
chr1_138593_G_T_b38	PLEKHN1	-3.01	0.00273	-0.053888	3	0.0179	yes	SKNS
chr1_983193_A_G_b38	PLEKHN1	3.001	0.00281	0.033472	134	0.011152	yes	SKNS
chr1_979472_G_C_b38	PLEKHN1	2.934	0.00349	0.033324	133	0.011359	yes	SKNS
chr1_981454_G_A_b38	PLEKHN1	2.928	0.00356	0.03268	132	0.011162	yes	SKNS
chr1_1089890_C_T_b38	PLEKHN1	-2.904	0.00383	-0.057802	7	0.019903	yes	SKNS
chr1_984121_G_T_b38	PLEKHN1	2.886	0.00406	0.032456	154	0.011247	yes	SKNS
chr1_978509_G_A_b38	PLEKHN1	2.862	0.00437	0.032408	133	0.011322	yes	SKNS
chr1_1004111_TG_T_b38	PLEKHN1	-2.862	0.00438	-0.039747	28	0.013889	yes	SKNS
chr1_999842_C_A_b38	PLEKHN1	2.839	0.0047	0.033479	156	0.011793	yes	SKNS
chr1_1065797_G_C_b38	PLEKHN1	2.809	0.00516	0.033686	66	0.011994	yes	SKNS
chr1_1384256_T_G_b38	PLEKHN1	-2.746	0.00623	-0.048275	3	0.017577	yes	SKNS
chr1_1877316_A_AATATAT_b38	PLEKHN1	-2.667	0.00788	-0.072604	7	0.02722	yes	SKNS
chr1_285109_C_CA_b38	PLEKHN1	-2.655	0.00816	-0.059704	6	0.022484	yes	SKNS
chr1_514053_A_G_b38	PLEKHN1	-2.63	0.00879	-0.045148	9	0.017168	yes	SKNS
chr1_986336_C_A_b38	PLEKHN1	2.618	0.00909	0.030858	161	0.011786	yes	SKNS
chr1_1016060_CT_C_b38	PLEKHN1	-2.611	0.00927	-0.041873	5	0.016035	yes	SKNS
chr1_1023851_G_A_b38	PLEKHN1	2.605	0.00944	0.030061	143	0.011539	yes	SKNS
chr1_984475_G_A_b38	PLEKHN1	-4.813	1.94e-06	-0.076988	13	0.015997	no	SKNS
chr1_1006159_C_T_b38	PLEKHN1	-4.192	3.23e-05	-0.047198	101	0.011259	no	SKNS
chr1_654132_T_C_b38	PLEKHN1	-4.146	3.94e-05	-0.108151	4	0.026088	no	SKNS
chr1_992993_A_G_b38	PLEKHN1	-3.878	0.000118	-0.042895	126	0.011061	no	SKNS
chr1_876340_CCCCACGCTCCCCCATACTCG_C_b38	PLEKHN1	-3.831	0.000143	-0.113367	6	0.029588	no	SKNS
chr1_983004_G_T_b38	PLEKHN1	3.787	0.00017	0.042693	152	0.011275	no	SKNS
chr1_969377_A_ATG_b38	PLEKHN1	3.699	0.000239	0.056166	18	0.015185	no	SKNS
chr1_1014228_G_A_b38	PLEKHN1	-3.661	0.000276	-0.041669	92	0.011382	no	SKNS
chr1_981680_C_G_b38	PLEKHN1	-3.617	0.000326	-0.089819	6	0.024829	no	SKNS
chr1_960684_C_G_b38	PLEKHN1	3.467	0.000568	0.091942	4	0.026518	no	SKNS
chr1_1015925_A_ATT_b38	PLEKHN1	-3.383	0.00077	-0.039994	71	0.011823	no	SKNS
chr1_960953_C_T_b38	PLEKHN1	3.383	0.00077	0.0904	4	0.026724	no	SKNS
chr1_962350_C_T_b38	PLEKHN1	3.374	0.000795	0.093336	3	0.027665	no	SKNS
chr1_951679_G_A_b38	PLEKHN1	3.356	0.000848	0.08954	4	0.026682	no	SKNS
chr1_1015950_G_A_b38	PLEKHN1	-3.326	0.000942	-0.068444	13	0.020579	no	SKNS
chr1_998719_G_C_b38	PLEKHN1	-3.311	0.000992	-0.078719	8	0.023773	no	SKNS
chr1_998726_A_G_b38	PLEKHN1	-3.311	0.000992	-0.078719	8	0.023773	no	SKNS
chr1_1016184_A_G_b38	PLEKHN1	-3.276	0.00112	-0.03726	92	0.011373	no	SKNS
chr1_943937_C_T_b38	PLEKHN1	3.27	0.00114	0.08592	4	0.026274	no	SKNS
chr1_942335_C_G_b38	PLEKHN1	3.228	0.00133	0.071582	6	0.022179	no	SKNS
chr1_984608_C_CTTCTTTAT_b38	PLEKHN1	-3.207	0.00142	-0.051501	20	0.016061	no	SKNS
chr1_975058_A_G_b38	PLEKHN1	-3.205	0.00143	-0.079524	7	0.024815	no	SKNS
chr1_951004_G_A_b38	PLEKHN1	3.16	0.00167	0.083151	4	0.026311	no	SKNS
chr1_954915_G_C_b38	PLEKHN1	3.128	0.00186	0.083648	4	0.026744	no	SKNS
chr1_945010_C_A_b38	PLEKHN1	3.122	0.0019	0.083149	4	0.026637	no	SKNS
chr1_954333_C_A_b38	PLEKHN1	3.019	0.00265	0.069659	4	0.023071	no	SKNS
chr1_967941_G_A_b38	PLEKHN1	3.012	0.00272	0.050032	13	0.016612	no	SKNS
chr1_954258_G_C_b38	PLEKHN1	3.009	0.00274	0.069302	4	0.02303	no	SKNS
chr1_966227_C_G_b38	PLEKHN1	3.009	0.00275	0.066132	9	0.021982	no	SKNS
chr1_517599_A_AAC_b38	PLEKHN1	-2.984	0.00297	-0.039667	36	0.013291	no	SKNS
chr1_966689_T_C_b38	PLEKHN1	2.982	0.003	0.08031	3	0.026933	no	SKNS
chr1_1306523_C_G_b38	PLEKHN1	-2.959	0.00322	-0.052913	23	0.017881	no	SKNS
chr1_962358_C_T_b38	PLEKHN1	-2.953	0.00329	-0.067044	5	0.022707	no	SKNS
chr1_1015336_A_T_b38	PLEKHN1	-2.945	0.00338	-0.070651	5	0.023994	no	SKNS
chr1_599751_T_G_b38	PLEKHN1	2.944	0.00338	0.059504	14	0.020212	no	SKNS
chr1_971790_AG_A_b38	PLEKHN1	-2.926	0.00358	-0.03335	90	0.011398	no	SKNS
chr1_958251_A_G_b38	PLEKHN1	2.923	0.00362	0.065462	5	0.022397	no	SKNS
chr1_1068249_C_T_b38	PLEKHN1	2.885	0.00407	0.034884	69	0.012092	no	SKNS
chr1_962184_T_C_b38	PLEKHN1	2.879	0.00415	0.065818	5	0.02286	no	SKNS
chr1_1722626_AGCG_A_b38	PLEKHN1	2.843	0.00464	0.041055	54	0.01444	no	SKNS
chr1_98929_A_G_b38	PLEKHN1	-2.823	0.00494	-0.053711	6	0.019029	no	SKNS
chr1_1728671_C_A_b38	PLEKHN1	2.805	0.00521	0.040983	26	0.01461	no	SKNS
chr1_1722625_A_T_b38	PLEKHN1	2.804	0.00523	0.040585	54	0.014475	no	SKNS
chr1_1022518_G_T_b38	PLEKHN1	-2.782	0.0056	-0.032363	68	0.011635	no	SKNS
chr1_961945_G_C_b38	PLEKHN1	2.763	0.00592	0.061201	6	0.022149	no	SKNS
chr1_1089099_C_T_b38	PLEKHN1	-2.76	0.00597	-0.081186	3	0.02941	no	SKNS
chr1_1015942_C_T_b38	PLEKHN1	-2.746	0.00623	-0.055594	14	0.020242	no	SKNS
chr1_1064776_C_T_b38	PLEKHN1	2.722	0.00671	0.032773	76	0.012041	no	SKNS
chr1_953778_G_C_b38	PLEKHN1	2.708	0.00698	0.066913	3	0.024708	no	SKNS
chr1_953779_A_C_b38	PLEKHN1	2.708	0.00698	0.066913	3	0.024708	no	SKNS
chr1_97624_G_C_b38	PLEKHN1	2.703	0.0071	0.060181	10	0.022267	no	SKNS
chr1_966426_G_C_b38	PLEKHN1	2.688	0.00742	0.061577	26	0.022912	no	SKNS
chr1_1056597_G_A_b38	PLEKHN1	2.686	0.00747	0.028641	169	0.010665	no	SKNS
chr1_1048922_T_C_b38	PLEKHN1	2.665	0.00793	0.030029	136	0.011267	no	SKNS
chr1_950296_C_A_b38	PLEKHN1	2.639	0.00856	0.063601	3	0.024101	no	SKNS
chr1_952180_A_C_b38	PLEKHN1	2.639	0.00856	0.063601	3	0.024101	no	SKNS
chr1_975029_T_C_b38	PLEKHN1	-2.629	0.00881	-0.044009	8	0.016739	no	SKNS
chr1_286158_A_ATGTG_b38	PLEKHN1	-2.616	0.00914	-0.07364	3	0.028148	no	SKNS
chr1_1192365_G_GAGTGTAGACACTCCAGTTGGTATA_b38	PLEKHN1	-2.61	0.00932	-0.069979	6	0.026815	no	SKNS
chr1_1020217_G_T_b38	PLEKHN1	-2.601	0.00956	-0.03094	58	0.011896	no	SKNS
chr1_1018652_C_G_b38	PLEKHN1	-2.601	0.00957	-0.030935	59	0.011896	no	SKNS
chr1_1290261_C_A_b38	PLEKHN1	3.152	0.002	0.081305	11	0.025795	yes	SNTTRM
chr1_905373_T_C_b38	PLEKHN1	-3.024	0.003	-0.050491	37	0.016698	yes	SNTTRM
chr1_1698022_G_A_b38	PLEKHN1	2.894	0.00445	0.144262	4	0.049851	yes	SNTTRM
chr1_969785_A_G_b38	PLEKHN1	-2.891	0.00449	-0.105638	8	0.036541	yes	SNTTRM
chr1_1035169_TG_T_b38	PLEKHN1	-2.835	0.00529	-0.061468	17	0.021678	yes	SNTTRM
chr1_988598_A_AG_b38	PLEKHN1	-2.716	0.00748	-0.062741	6	0.0231	yes	SNTTRM
chr1_1573265_C_CAAA_b38	PLEKHN1	2.695	0.00794	0.096931	4	0.035965	yes	SNTTRM
chr1_1400410_A_G_b38	PLEKHN1	2.65	0.00903	0.063447	15	0.023945	yes	SNTTRM
chr1_1384749_C_G_b38	PLEKHN1	-2.628	0.0096	-0.062035	15	0.023606	yes	SNTTRM
chr1_1387763_CCT_C_b38	PLEKHN1	-2.628	0.0096	-0.062035	15	0.023606	yes	SNTTRM
chr1_1388944_G_A_b38	PLEKHN1	-2.628	0.0096	-0.062035	15	0.023606	yes	SNTTRM
chr1_1579410_AT_A_b38	PLEKHN1	3.375	0.000969	0.07237	18	0.021445	no	SNTTRM
chr1_897376_T_G_b38	PLEKHN1	-3.175	0.00186	-0.059927	18	0.018873	no	SNTTRM
chr1_896917_CTG_C_b38	PLEKHN1	3.116	0.00225	0.057741	20	0.01853	no	SNTTRM
chr1_896938_C_A_b38	PLEKHN1	3.116	0.00225	0.057741	20	0.01853	no	SNTTRM
chr1_897792_T_TCGAA_b38	PLEKHN1	-3.116	0.00225	-0.057741	20	0.01853	no	SNTTRM
chr1_1691121_A_G_b38	PLEKHN1	-3.056	0.00271	-0.084772	3	0.027737	no	SNTTRM
chr1_897538_T_C_b38	PLEKHN1	-2.954	0.00371	-0.054933	20	0.018597	no	SNTTRM
chr1_896680_G_A_b38	PLEKHN1	2.908	0.00427	0.054467	20	0.018733	no	SNTTRM
chr1_896686_G_C_b38	PLEKHN1	2.908	0.00427	0.054467	20	0.018733	no	SNTTRM
chr1_896732_T_C_b38	PLEKHN1	2.908	0.00427	0.054467	20	0.018733	no	SNTTRM
chr1_896798_A_G_b38	PLEKHN1	2.908	0.00427	0.054467	20	0.018733	no	SNTTRM
chr1_1724543_G_C_b38	PLEKHN1	2.821	0.00552	0.124329	3	0.044069	no	SNTTRM
chr1_828389_A_AT_b38	PLEKHN1	2.806	0.00577	0.060638	23	0.021609	no	SNTTRM
chr1_908025_A_G_b38	PLEKHN1	-2.794	0.00597	-0.054643	18	0.019555	no	SNTTRM
chr1_900119_A_G_b38	PLEKHN1	-2.734	0.00711	-0.057602	12	0.02107	no	SNTTRM
chr1_899452_G_C_b38	PLEKHN1	-2.73	0.00718	-0.057097	13	0.020911	no	SNTTRM
chr1_896529_C_T_b38	PLEKHN1	2.663	0.0087	0.050032	21	0.018786	no	SNTTRM
chr1_105737_A_G_b38	PLEKHN1	2.633	0.00947	0.063926	3	0.024282	no	SNTTRM
chr1_966426_G_C_b38	PLEKHN1	4.332	2.42e-05	0.145487	18	0.033588	yes	SPLEEN
chr1_889689_G_C_b38	PLEKHN1	4.139	5.28e-05	0.090694	22	0.021912	yes	SPLEEN
chr1_969785_A_G_b38	PLEKHN1	-3.757	0.00023	-0.131772	17	0.035076	yes	SPLEEN
chr1_1613322_T_C_b38	PLEKHN1	-3.407	0.000806	-0.067565	19	0.019833	yes	SPLEEN
chr1_1613421_T_C_b38	PLEKHN1	-3.407	0.000806	-0.067565	19	0.019833	yes	SPLEEN
chr1_1601796_A_C_b38	PLEKHN1	-3.376	0.000895	-0.06592	25	0.019525	yes	SPLEEN
chr1_1604202_G_A_b38	PLEKHN1	-3.371	0.000911	-0.066187	24	0.019634	yes	SPLEEN
chr1_1466535_C_CA_b38	PLEKHN1	3.358	0.000951	0.096667	3	0.028783	yes	SPLEEN
chr1_1617375_T_C_b38	PLEKHN1	-3.341	0.00101	-0.067455	18	0.02019	yes	SPLEEN
chr1_1618213_C_G_b38	PLEKHN1	-3.341	0.00101	-0.067455	18	0.02019	yes	SPLEEN
chr1_1618290_G_C_b38	PLEKHN1	-3.341	0.00101	-0.067455	18	0.02019	yes	SPLEEN
chr1_1616547_T_C_b38	PLEKHN1	-3.319	0.00109	-0.067102	17	0.02022	yes	SPLEEN
chr1_1596144_GAGAC_G_b38	PLEKHN1	-3.312	0.00111	-0.068603	19	0.020711	yes	SPLEEN
chr1_1454579_T_C_b38	PLEKHN1	3.302	0.00115	0.139242	4	0.042166	yes	SPLEEN
chr1_1454581_T_C_b38	PLEKHN1	3.302	0.00115	0.139242	4	0.042166	yes	SPLEEN
chr1_1454582_A_C_b38	PLEKHN1	3.302	0.00115	0.139242	4	0.042166	yes	SPLEEN
chr1_1454587_T_C_b38	PLEKHN1	3.302	0.00115	0.139242	4	0.042166	yes	SPLEEN
chr1_1592572_T_C_b38	PLEKHN1	-3.273	0.00127	-0.070318	17	0.021485	yes	SPLEEN
chr1_1619986_T_C_b38	PLEKHN1	-3.201	0.00161	-0.066949	16	0.020913	yes	SPLEEN
chr1_1649932_C_T_b38	PLEKHN1	-3.186	0.00169	-0.057595	51	0.018077	yes	SPLEEN
chr1_1605347_C_T_b38	PLEKHN1	-3.167	0.0018	-0.067065	20	0.021176	yes	SPLEEN
chr1_1454612_A_G_b38	PLEKHN1	3.164	0.00182	0.12645	5	0.039966	yes	SPLEEN
chr1_1594614_G_C_b38	PLEKHN1	-3.149	0.00191	-0.06719	18	0.021334	yes	SPLEEN
chr1_1609909_G_T_b38	PLEKHN1	-3.13	0.00203	-0.065332	14	0.020875	yes	SPLEEN
chr1_1603989_T_C_b38	PLEKHN1	-3.09	0.00231	-0.063511	15	0.020551	yes	SPLEEN
chr1_1589618_A_T_b38	PLEKHN1	-3.075	0.00242	-0.065699	16	0.021365	yes	SPLEEN
chr1_1615322_A_G_b38	PLEKHN1	-3.043	0.00268	-0.061966	17	0.020365	yes	SPLEEN
chr1_1459273_T_C_b38	PLEKHN1	3.004	0.00303	0.11068	7	0.036846	yes	SPLEEN
chr1_1459283_AC_A_b38	PLEKHN1	3.004	0.00303	0.11068	7	0.036846	yes	SPLEEN
chr1_1594570_A_G_b38	PLEKHN1	-2.977	0.00329	-0.059183	21	0.019877	yes	SPLEEN
chr1_1648736_G_A_b38	PLEKHN1	-2.936	0.00374	-0.053377	51	0.018178	yes	SPLEEN
chr1_1584235_A_AT_b38	PLEKHN1	-2.928	0.00384	-0.054781	33	0.018712	yes	SPLEEN
chr1_1602666_G_A_b38	PLEKHN1	-2.893	0.00428	-0.062016	15	0.021439	yes	SPLEEN
chr1_272488_C_G_b38	PLEKHN1	-2.892	0.00428	-0.073617	7	0.025452	yes	SPLEEN
chr1_1615869_C_T_b38	PLEKHN1	-2.889	0.00432	-0.058197	17	0.020144	yes	SPLEEN
chr1_1602507_C_A_b38	PLEKHN1	-2.86	0.00472	-0.061222	15	0.021405	yes	SPLEEN
chr1_1622510_C_T_b38	PLEKHN1	-2.848	0.00489	-0.059333	19	0.02083	yes	SPLEEN
chr1_1585345_C_T_b38	PLEKHN1	-2.845	0.00494	-0.063213	19	0.022221	yes	SPLEEN
chr1_1653319_A_G_b38	PLEKHN1	-2.835	0.00509	-0.059101	13	0.020845	yes	SPLEEN
chr1_1649993_A_G_b38	PLEKHN1	2.806	0.00556	0.051026	55	0.018187	yes	SPLEEN
chr1_1649976_G_A_b38	PLEKHN1	-2.798	0.00568	-0.050708	41	0.018122	yes	SPLEEN
chr1_1608603_C_A_b38	PLEKHN1	-2.795	0.00574	-0.058918	19	0.02108	yes	SPLEEN
chr1_1609070_G_A_b38	PLEKHN1	-2.795	0.00574	-0.058918	19	0.02108	yes	SPLEEN
chr1_1613090_A_G_b38	PLEKHN1	-2.795	0.00574	-0.058918	19	0.02108	yes	SPLEEN
chr1_966227_C_G_b38	PLEKHN1	2.779	0.00602	0.084635	7	0.030457	yes	SPLEEN
chr1_1618118_G_A_b38	PLEKHN1	-2.77	0.00617	-0.058218	19	0.021016	yes	SPLEEN
chr1_1610924_C_T_b38	PLEKHN1	-2.768	0.0062	-0.058362	19	0.021082	yes	SPLEEN
chr1_1007325_A_G_b38	PLEKHN1	2.759	0.00637	0.120964	4	0.043837	yes	SPLEEN
chr1_1636278_G_T_b38	PLEKHN1	-2.755	0.00645	-0.049808	47	0.018077	yes	SPLEEN
chr1_1587547_C_T_b38	PLEKHN1	-2.753	0.00649	-0.061938	19	0.022499	yes	SPLEEN
chr1_1596899_A_C_b38	PLEKHN1	-2.745	0.00664	-0.062395	9	0.022731	yes	SPLEEN
chr1_971790_AG_A_b38	PLEKHN1	-2.742	0.00671	-0.045482	42	0.01659	yes	SPLEEN
chr1_1502507_A_C_b38	PLEKHN1	2.74	0.00675	0.100102	7	0.036537	yes	SPLEEN
chr1_1661169_C_A_b38	PLEKHN1	-2.737	0.00681	-0.057943	12	0.021174	yes	SPLEEN
chr1_969780_C_T_b38	PLEKHN1	-2.723	0.00708	-0.070545	21	0.025904	yes	SPLEEN
chr1_727717_G_C_b38	PLEKHN1	-2.717	0.00722	-0.059603	23	0.02194	yes	SPLEEN
chr1_967724_C_T_b38	PLEKHN1	2.682	0.00797	0.086892	11	0.032394	yes	SPLEEN
chr1_1497741_CTG_C_b38	PLEKHN1	2.659	0.00853	0.114233	7	0.042967	yes	SPLEEN
chr1_1734812_G_A_b38	PLEKHN1	-2.637	0.00907	-0.059467	30	0.022552	yes	SPLEEN
chr1_1455134_T_A_b38	PLEKHN1	2.622	0.00947	0.109084	4	0.041607	yes	SPLEEN
chr1_958251_A_G_b38	PLEKHN1	3.446	0.000704	0.104109	3	0.030215	no	SPLEEN
chr1_1650000_G_A_b38	PLEKHN1	-3.418	0.000775	-0.062156	33	0.018184	no	SPLEEN
chr1_962184_T_C_b38	PLEKHN1	3.179	0.00173	0.098111	3	0.030865	no	SPLEEN
chr1_1608244_T_C_b38	PLEKHN1	-3.021	0.00287	-0.063085	12	0.020882	no	SPLEEN
chr1_962358_C_T_b38	PLEKHN1	-2.837	0.00505	-0.089107	3	0.031405	no	SPLEEN
chr1_1625805_G_A_b38	PLEKHN1	-2.704	0.00748	-0.056229	20	0.020791	no	SPLEEN
chr1_1587082_G_A_b38	PLEKHN1	-2.692	0.00775	-0.070771	3	0.02629	no	SPLEEN
chr1_1590682_T_C_b38	PLEKHN1	-2.604	0.00997	-0.052615	22	0.020209	no	SPLEEN
chr1_857809_G_A_b38	PLEKHN1	3.518	0.000511	0.092176	9	0.026205	yes	STMACH
chr1_1019479_TG_T_b38	PLEKHN1	3.343	0.000947	0.047264	85	0.014138	yes	STMACH
chr1_851430_G_A_b38	PLEKHN1	-3.329	0.000992	-0.120702	6	0.036253	yes	STMACH
chr1_15118_A_G_b38	PLEKHN1	-3.27	0.00122	-0.067954	9	0.020784	yes	STMACH
chr1_958339_G_A_b38	PLEKHN1	3.18	0.00165	0.087332	3	0.027467	yes	STMACH
chr1_950669_ACAG_A_b38	PLEKHN1	3.179	0.00165	0.090985	3	0.028623	yes	STMACH
chr1_966227_C_G_b38	PLEKHN1	3.046	0.00255	0.080845	8	0.026545	yes	STMACH
chr1_504819_C_T_b38	PLEKHN1	2.854	0.00465	0.109487	3	0.038357	yes	STMACH
chr1_974039_C_T_b38	PLEKHN1	-2.851	0.0047	-0.059068	8	0.020719	yes	STMACH
chr1_995786_A_G_b38	PLEKHN1	-2.831	0.00499	-0.042268	57	0.01493	yes	STMACH
chr1_506937_T_G_b38	PLEKHN1	2.813	0.00527	0.069725	5	0.024784	yes	STMACH
chr1_995512_T_C_b38	PLEKHN1	-2.785	0.00573	-0.041554	57	0.014918	yes	STMACH
chr1_588568_C_T_b38	PLEKHN1	2.783	0.00577	0.060368	3	0.021692	yes	STMACH
chr1_954258_G_C_b38	PLEKHN1	2.729	0.00678	0.078746	3	0.028858	yes	STMACH
chr1_954333_C_A_b38	PLEKHN1	2.729	0.00678	0.078746	3	0.028858	yes	STMACH
chr1_1627156_G_A_b38	PLEKHN1	-2.71	0.00716	-0.066828	5	0.024658	yes	STMACH
chr1_1606532_G_A_b38	PLEKHN1	2.675	0.00794	0.052967	15	0.019803	yes	STMACH
chr1_998410_G_A_b38	PLEKHN1	2.61	0.00956	0.039589	81	0.015168	yes	STMACH
chr1_966179_G_A_b38	PLEKHN1	3.329	0.000993	0.083887	19	0.025197	no	STMACH
chr1_959193_G_A_b38	PLEKHN1	2.973	0.00322	0.077102	23	0.025932	no	STMACH
chr1_960375_A_AG_b38	PLEKHN1	2.958	0.00337	0.071769	23	0.024263	no	STMACH
chr1_999842_C_A_b38	PLEKHN1	2.937	0.0036	0.045765	86	0.015583	no	STMACH
chr1_1649954_C_CA_b38	PLEKHN1	2.877	0.00434	0.057919	14	0.020135	no	STMACH
chr1_598938_G_A_b38	PLEKHN1	2.871	0.00442	0.064774	4	0.022563	no	STMACH
chr1_989148_C_A_b38	PLEKHN1	2.857	0.00461	0.044952	80	0.015735	no	STMACH
chr1_600311_T_C_b38	PLEKHN1	2.844	0.0048	0.103704	3	0.036463	no	STMACH
chr1_965350_G_A_b38	PLEKHN1	2.826	0.00507	0.074542	21	0.026378	no	STMACH
chr1_588022_A_G_b38	PLEKHN1	2.815	0.00524	0.05683	15	0.020189	no	STMACH
chr1_607319_T_C_b38	PLEKHN1	2.814	0.00525	0.056797	16	0.02018	no	STMACH
chr1_1624723_C_T_b38	PLEKHN1	-2.808	0.00535	-0.055798	10	0.01987	no	STMACH
chr1_588011_C_T_b38	PLEKHN1	2.802	0.00545	0.055026	16	0.019638	no	STMACH
chr1_903175_C_A_b38	PLEKHN1	-2.757	0.00623	-0.051392	18	0.018638	no	STMACH
chr1_1000731_C_T_b38	PLEKHN1	2.75	0.00636	0.041544	82	0.015105	no	STMACH
chr1_1641723_TTCCTCCTCC_T_b38	PLEKHN1	2.746	0.00644	0.058896	5	0.021447	no	STMACH
chr1_995508_ATTTTT_A_b38	PLEKHN1	2.724	0.00688	0.041591	78	0.015271	no	STMACH
chr1_975014_C_T_b38	PLEKHN1	-2.707	0.00722	-0.039709	53	0.014667	no	STMACH
chr1_986336_C_A_b38	PLEKHN1	2.703	0.00732	0.042756	80	0.015821	no	STMACH
chr1_1180851_T_C_b38	PLEKHN1	-2.662	0.00825	-0.075958	4	0.028539	no	STMACH
chr1_1587222_G_GT_b38	PLEKHN1	2.621	0.00926	0.043377	29	0.016549	no	STMACH
chr1_982260_G_A_b38	PLEKHN1	-7.083	1.25e-11	-0.162429	8	0.022933	yes	TESTIS
chr1_982858_C_G_b38	PLEKHN1	-7.083	1.25e-11	-0.162429	8	0.022933	yes	TESTIS
chr1_976215_A_G_b38	PLEKHN1	-7.046	1.57e-11	-0.148473	22	0.021073	yes	TESTIS
chr1_981282_A_C_b38	PLEKHN1	6.819	6.12e-11	0.147639	13	0.021652	yes	TESTIS
chr1_976536_C_T_b38	PLEKHN1	6.752	9.07e-11	0.15124	11	0.022399	yes	TESTIS
chr1_983747_T_C_b38	PLEKHN1	-6.424	6.04e-10	-0.142143	11	0.022125	yes	TESTIS
chr1_978230_G_A_b38	PLEKHN1	6.375	8e-10	0.140031	13	0.021965	yes	TESTIS
chr1_974039_C_T_b38	PLEKHN1	-5.929	9.4e-09	-0.146774	6	0.024756	yes	TESTIS
chr1_982112_C_T_b38	PLEKHN1	5.904	1.07e-08	0.132976	12	0.022522	yes	TESTIS
chr1_982890_C_T_b38	PLEKHN1	5.904	1.07e-08	0.132976	12	0.022522	yes	TESTIS
chr1_983237_G_A_b38	PLEKHN1	5.904	1.07e-08	0.132976	12	0.022522	yes	TESTIS
chr1_975093_G_A_b38	PLEKHN1	5.67	3.7e-08	0.147216	5	0.025964	yes	TESTIS
chr1_981210_G_A_b38	PLEKHN1	-5.502	8.81e-08	-0.140687	5	0.025571	yes	TESTIS
chr1_988731_T_A_b38	PLEKHN1	-5.388	1.57e-07	-0.117185	15	0.021751	yes	TESTIS
chr1_995543_A_G_b38	PLEKHN1	-5.334	2.05e-07	-0.118339	17	0.022186	yes	TESTIS
chr1_981935_G_A_b38	PLEKHN1	5.088	6.84e-07	0.112593	14	0.02213	yes	TESTIS
chr1_981169_A_G_b38	PLEKHN1	5.017	9.61e-07	0.106614	15	0.021253	yes	TESTIS
chr1_987103_T_C_b38	PLEKHN1	4.979	1.15e-06	0.121187	8	0.02434	yes	TESTIS
chr1_991588_C_T_b38	PLEKHN1	4.979	1.15e-06	0.121187	8	0.02434	yes	TESTIS
chr1_973443_G_A_b38	PLEKHN1	4.91	1.59e-06	0.113174	11	0.023052	yes	TESTIS
chr1_994949_C_T_b38	PLEKHN1	-4.877	1.85e-06	-0.109666	12	0.022484	yes	TESTIS
chr1_994997_C_T_b38	PLEKHN1	-4.877	1.85e-06	-0.109666	12	0.022484	yes	TESTIS
chr1_992361_G_A_b38	PLEKHN1	-4.869	1.93e-06	-0.113087	10	0.023228	yes	TESTIS
chr1_1000453_C_G_b38	PLEKHN1	-4.842	2.18e-06	-0.109837	21	0.022682	yes	TESTIS
chr1_993036_G_A_b38	PLEKHN1	-4.795	2.71e-06	-0.107548	16	0.022431	yes	TESTIS
chr1_1000814_A_G_b38	PLEKHN1	-4.745	3.41e-06	-0.108175	19	0.022799	yes	TESTIS
chr1_986629_G_A_b38	PLEKHN1	-4.71	3.98e-06	-0.11007	10	0.023368	yes	TESTIS
chr1_986280_C_T_b38	PLEKHN1	-4.706	4.06e-06	-0.109651	10	0.0233	yes	TESTIS
chr1_1000112_G_T_b38	PLEKHN1	-4.674	4.7e-06	-0.105275	23	0.022524	yes	TESTIS
chr1_985597_T_C_b38	PLEKHN1	4.651	5.2e-06	0.114291	8	0.024572	yes	TESTIS
chr1_985260_C_T_b38	PLEKHN1	4.626	5.81e-06	0.109979	10	0.023772	yes	TESTIS
chr1_996168_G_T_b38	PLEKHN1	-4.621	5.96e-06	-0.107036	11	0.023165	yes	TESTIS
chr1_984039_T_C_b38	PLEKHN1	4.557	7.9e-06	0.092449	23	0.020287	yes	TESTIS
chr1_996254_A_AGGGAGGGCAG_b38	PLEKHN1	-4.553	8.04e-06	-0.108524	9	0.023835	yes	TESTIS
chr1_998741_G_A_b38	PLEKHN1	-4.488	1.07e-05	-0.104451	11	0.023272	yes	TESTIS
chr1_973858_G_C_b38	PLEKHN1	4.456	1.23e-05	0.085537	45	0.019195	yes	TESTIS
chr1_1060868_C_T_b38	PLEKHN1	4.443	1.3e-05	0.118853	7	0.02675	yes	TESTIS
chr1_997077_G_A_b38	PLEKHN1	-4.44	1.32e-05	-0.10316	11	0.023234	yes	TESTIS
chr1_975555_G_A_b38	PLEKHN1	4.424	1.41e-05	0.096933	16	0.021909	yes	TESTIS
chr1_1000291_C_G_b38	PLEKHN1	4.421	1.43e-05	0.107208	8	0.024247	yes	TESTIS
chr1_1074443_G_A_b38	PLEKHN1	4.404	1.54e-05	0.108912	10	0.024728	yes	TESTIS
chr1_1130420_C_T_b38	PLEKHN1	-4.365	1.82e-05	-0.102133	12	0.023398	yes	TESTIS
chr1_1000335_C_T_b38	PLEKHN1	-4.338	2.04e-05	-0.100973	11	0.023279	yes	TESTIS
chr1_1000079_A_G_b38	PLEKHN1	-4.334	2.08e-05	-0.099007	21	0.022845	yes	TESTIS
chr1_1133966_C_T_b38	PLEKHN1	-4.325	2.16e-05	-0.102693	10	0.023746	yes	TESTIS
chr1_1133503_G_A_b38	PLEKHN1	-4.301	2.39e-05	-0.101676	11	0.023643	yes	TESTIS
chr1_1132196_G_A_b38	PLEKHN1	-4.213	3.44e-05	-0.09803	12	0.023266	yes	TESTIS
chr1_913065_G_A_b38	PLEKHN1	4.21	3.49e-05	0.100824	10	0.023948	yes	TESTIS
chr1_913076_A_G_b38	PLEKHN1	4.21	3.49e-05	0.100824	10	0.023948	yes	TESTIS
chr1_1070426_C_T_b38	PLEKHN1	4.203	3.59e-05	0.102804	12	0.024458	yes	TESTIS
chr1_1082207_C_T_b38	PLEKHN1	4.183	3.9e-05	0.110121	7	0.026325	yes	TESTIS
chr1_1370113_A_G_b38	PLEKHN1	-4.181	3.94e-05	-0.098317	26	0.023515	yes	TESTIS
chr1_1130717_G_A_b38	PLEKHN1	-4.149	4.49e-05	-0.100502	11	0.024221	yes	TESTIS
chr1_1087765_G_A_b38	PLEKHN1	4.127	4.91e-05	0.107105	8	0.025951	yes	TESTIS
chr1_912111_G_A_b38	PLEKHN1	4.091	5.68e-05	0.098269	10	0.024018	yes	TESTIS
chr1_973929_T_C_b38	PLEKHN1	4.082	5.91e-05	0.092266	11	0.022605	yes	TESTIS
chr1_1063121_G_C_b38	PLEKHN1	4.039	7.03e-05	0.097625	11	0.024172	yes	TESTIS
chr1_1137871_C_A_b38	PLEKHN1	-4.034	7.15e-05	-0.090415	13	0.022411	yes	TESTIS
chr1_1071842_G_T_b38	PLEKHN1	3.983	8.77e-05	0.106902	8	0.026837	yes	TESTIS
chr1_1027340_C_T_b38	PLEKHN1	3.983	8.8e-05	0.106748	7	0.026804	yes	TESTIS
chr1_1147418_G_A_b38	PLEKHN1	-3.899	0.000122	-0.090399	12	0.023188	yes	TESTIS
chr1_927486_C_T_b38	PLEKHN1	-3.894	0.000125	-0.089762	26	0.023052	yes	TESTIS
chr1_1290968_C_G_b38	PLEKHN1	3.89	0.000127	0.097488	25	0.02506	yes	TESTIS
chr1_1002745_G_A_b38	PLEKHN1	-3.862	0.000141	-0.085699	15	0.022188	yes	TESTIS
chr1_1277415_C_A_b38	PLEKHN1	3.814	0.00017	0.126243	7	0.0331	yes	TESTIS
chr1_1278556_G_A_b38	PLEKHN1	3.814	0.00017	0.126243	7	0.0331	yes	TESTIS
chr1_1240684_G_GCCGCCCCCATTCACCCCGGCCGTGGTCCCTGCCCCAGCCCCCA_b38	PLEKHN1	3.812	0.000171	0.140047	10	0.036743	yes	TESTIS
chr1_1309988_G_A_b38	PLEKHN1	-3.78	0.000193	-0.09165	37	0.024245	yes	TESTIS
chr1_1147410_C_A_b38	PLEKHN1	-3.77	0.000201	-0.087961	12	0.023334	yes	TESTIS
chr1_1312114_T_C_b38	PLEKHN1	-3.739	0.000226	-0.091282	35	0.024411	yes	TESTIS
chr1_1481959_C_T_b38	PLEKHN1	3.72	0.000242	0.117113	15	0.031478	yes	TESTIS
chr1_1067007_A_G_b38	PLEKHN1	3.715	0.000247	0.082241	19	0.022136	yes	TESTIS
chr1_1366561_AGT_A_b38	PLEKHN1	-3.712	0.00025	-0.092871	35	0.025018	yes	TESTIS
chr1_1137233_C_G_b38	PLEKHN1	-3.709	0.000253	-0.074426	40	0.020067	yes	TESTIS
chr1_1313807_G_A_b38	PLEKHN1	-3.641	0.000326	-0.088554	37	0.024322	yes	TESTIS
chr1_1153291_C_T_b38	PLEKHN1	-3.636	0.000332	-0.072717	27	0.02	yes	TESTIS
chr1_1308516_C_T_b38	PLEKHN1	-3.636	0.000332	-0.085283	41	0.023457	yes	TESTIS
chr1_1358384_G_C_b38	PLEKHN1	-3.626	0.000345	-0.090285	35	0.024901	yes	TESTIS
chr1_984475_G_A_b38	PLEKHN1	-3.607	0.00037	-0.097873	6	0.027135	yes	TESTIS
chr1_911848_C_T_b38	PLEKHN1	3.606	0.000371	0.088228	10	0.024469	yes	TESTIS
chr1_1279694_A_G_b38	PLEKHN1	3.587	0.000398	0.108418	10	0.030224	yes	TESTIS
chr1_1279698_A_G_b38	PLEKHN1	3.587	0.000398	0.108418	10	0.030224	yes	TESTIS
chr1_1279728_TG_T_b38	PLEKHN1	3.587	0.000398	0.108418	10	0.030224	yes	TESTIS
chr1_1132482_T_C_b38	PLEKHN1	-3.561	0.000437	-0.080875	13	0.02271	yes	TESTIS
chr1_1277830_C_CA_b38	PLEKHN1	3.556	0.000446	0.111061	5	0.031234	yes	TESTIS
chr1_1275912_C_T_b38	PLEKHN1	3.543	0.000466	0.107973	10	0.030471	yes	TESTIS
chr1_1330125_G_A_b38	PLEKHN1	-3.543	0.000467	-0.087577	35	0.024719	yes	TESTIS
chr1_1275583_T_C_b38	PLEKHN1	3.527	0.000494	0.116873	7	0.033133	yes	TESTIS
chr1_984608_C_CTTCTTTAT_b38	PLEKHN1	-3.526	0.000496	-0.090845	13	0.025762	yes	TESTIS
chr1_1057460_ATT_A_b38	PLEKHN1	3.521	0.000505	0.089829	7	0.025512	yes	TESTIS
chr1_1274256_A_G_b38	PLEKHN1	3.516	0.000514	0.10548	11	0.029999	yes	TESTIS
chr1_1055393_C_T_b38	PLEKHN1	3.503	0.000539	0.089271	7	0.025483	yes	TESTIS
chr1_1055426_G_A_b38	PLEKHN1	3.503	0.000539	0.089271	7	0.025483	yes	TESTIS
chr1_1395346_A_G_b38	PLEKHN1	3.49	0.000565	0.088717	34	0.025421	yes	TESTIS
chr1_1134273_C_T_b38	PLEKHN1	-3.476	0.000595	-0.073515	20	0.021151	yes	TESTIS
chr1_1067159_G_A_b38	PLEKHN1	3.473	6e-04	0.075493	33	0.021737	yes	TESTIS
chr1_929558_G_A_b38	PLEKHN1	-3.472	0.000602	-0.076786	32	0.022115	yes	TESTIS
chr1_1426175_T_C_b38	PLEKHN1	3.466	0.000615	0.117109	5	0.033788	yes	TESTIS
chr1_1278491_C_CT_b38	PLEKHN1	3.449	0.000653	0.102898	8	0.029832	yes	TESTIS
chr1_1280044_T_C_b38	PLEKHN1	3.449	0.000654	0.077052	44	0.022341	yes	TESTIS
chr1_1055137_C_T_b38	PLEKHN1	3.448	0.000656	0.093236	5	0.027041	yes	TESTIS
chr1_1074061_G_A_b38	PLEKHN1	-3.426	0.000708	-0.094766	6	0.027658	yes	TESTIS
chr1_1394423_A_G_b38	PLEKHN1	3.418	0.00073	0.086639	34	0.025351	yes	TESTIS
chr1_1074910_TCACA_T_b38	PLEKHN1	-3.385	0.000818	-0.093332	6	0.027571	yes	TESTIS
chr1_1055604_G_A_b38	PLEKHN1	3.381	0.000831	0.091678	5	0.027118	yes	TESTIS
chr1_1056278_AC_A_b38	PLEKHN1	3.381	0.000831	0.091678	5	0.027118	yes	TESTIS
chr1_1056947_C_T_b38	PLEKHN1	3.381	0.000831	0.091678	5	0.027118	yes	TESTIS
chr1_926250_G_A_b38	PLEKHN1	-3.367	0.000872	-0.079088	25	0.02349	yes	TESTIS
chr1_1473089_T_C_b38	PLEKHN1	3.364	0.000881	0.105712	18	0.031425	yes	TESTIS
chr1_1486151_C_A_b38	PLEKHN1	3.36	0.000893	0.107746	19	0.032066	yes	TESTIS
chr1_1065797_G_C_b38	PLEKHN1	3.358	0.000899	0.065644	36	0.019547	yes	TESTIS
chr1_1363898_C_T_b38	PLEKHN1	-3.346	0.000938	-0.087549	10	0.026167	yes	TESTIS
chr1_1363986_C_T_b38	PLEKHN1	-3.346	0.000938	-0.087549	10	0.026167	yes	TESTIS
chr1_1366529_TTAG_T_b38	PLEKHN1	-3.346	0.000938	-0.087549	10	0.026167	yes	TESTIS
chr1_1367292_A_AGT_b38	PLEKHN1	-3.346	0.000938	-0.087549	10	0.026167	yes	TESTIS
chr1_1402457_A_G_b38	PLEKHN1	3.341	0.000954	0.084827	34	0.02539	yes	TESTIS
chr1_1274980_C_T_b38	PLEKHN1	3.336	0.00097	0.101098	10	0.030305	yes	TESTIS
chr1_1002417_T_A_b38	PLEKHN1	3.322	0.00102	0.087807	10	0.026433	yes	TESTIS
chr1_921056_TG_T_b38	PLEKHN1	3.312	0.00106	0.08825	4	0.026649	yes	TESTIS
chr1_1483898_G_A_b38	PLEKHN1	3.305	0.00108	0.106984	19	0.032365	yes	TESTIS
chr1_1482624_T_C_b38	PLEKHN1	3.299	0.0011	0.103208	19	0.031283	yes	TESTIS
chr1_1487887_A_G_b38	PLEKHN1	3.299	0.0011	0.103208	19	0.031283	yes	TESTIS
chr1_1488652_A_G_b38	PLEKHN1	3.299	0.0011	0.103208	19	0.031283	yes	TESTIS
chr1_1490320_T_C_b38	PLEKHN1	3.299	0.0011	0.103208	19	0.031283	yes	TESTIS
chr1_1492292_C_G_b38	PLEKHN1	3.299	0.0011	0.103208	19	0.031283	yes	TESTIS
chr1_1492619_A_AC_b38	PLEKHN1	3.299	0.0011	0.103208	19	0.031283	yes	TESTIS
chr1_1492850_G_A_b38	PLEKHN1	3.299	0.0011	0.103208	19	0.031283	yes	TESTIS
chr1_1411323_A_C_b38	PLEKHN1	3.283	0.00116	0.083823	34	0.025531	yes	TESTIS
chr1_1156987_C_T_b38	PLEKHN1	-3.276	0.00119	-0.065998	26	0.020147	yes	TESTIS
chr1_1387698_A_G_b38	PLEKHN1	-3.27	0.00122	-0.082798	34	0.025321	yes	TESTIS
chr1_1389827_C_T_b38	PLEKHN1	-3.27	0.00122	-0.082798	34	0.025321	yes	TESTIS
chr1_1144486_C_G_b38	PLEKHN1	-3.251	0.0013	-0.069775	25	0.021465	yes	TESTIS
chr1_1490027_A_G_b38	PLEKHN1	3.248	0.00131	0.102301	16	0.031492	yes	TESTIS
chr1_1490032_A_G_b38	PLEKHN1	3.248	0.00131	0.102301	16	0.031492	yes	TESTIS
chr1_1085966_A_G_b38	PLEKHN1	3.227	0.00141	0.076402	13	0.023675	yes	TESTIS
chr1_1379091_T_G_b38	PLEKHN1	-3.223	0.00143	-0.086435	10	0.02682	yes	TESTIS
chr1_925036_G_A_b38	PLEKHN1	-3.22	0.00144	-0.074705	25	0.023203	yes	TESTIS
chr1_1365566_G_A_b38	PLEKHN1	-3.216	0.00146	-0.083582	10	0.025989	yes	TESTIS
chr1_969562_A_G_b38	PLEKHN1	3.207	0.00151	0.189392	4	0.059063	yes	TESTIS
chr1_969637_T_C_b38	PLEKHN1	3.207	0.00151	0.189392	4	0.059063	yes	TESTIS
chr1_1486611_G_A_b38	PLEKHN1	3.203	0.00152	0.104782	12	0.032713	yes	TESTIS
chr1_1147779_G_A_b38	PLEKHN1	-3.18	0.00165	-0.068071	21	0.021404	yes	TESTIS
chr1_1159750_T_C_b38	PLEKHN1	-3.177	0.00166	-0.065073	24	0.020484	yes	TESTIS
chr1_1161911_C_A_b38	PLEKHN1	-3.156	0.00178	-0.06441	25	0.020408	yes	TESTIS
chr1_1054900_C_T_b38	PLEKHN1	-3.156	0.00178	-0.066475	40	0.021063	yes	TESTIS
chr1_1319063_G_A_b38	PLEKHN1	-3.153	0.0018	-0.108011	16	0.034253	yes	TESTIS
chr1_1319461_C_G_b38	PLEKHN1	-3.153	0.0018	-0.108011	16	0.034253	yes	TESTIS
chr1_1320023_TG_T_b38	PLEKHN1	-3.153	0.0018	-0.108011	16	0.034253	yes	TESTIS
chr1_1153726_G_A_b38	PLEKHN1	-3.149	0.00182	-0.06314	26	0.020049	yes	TESTIS
chr1_925308_G_A_b38	PLEKHN1	-3.144	0.00186	-0.073815	25	0.023481	yes	TESTIS
chr1_1143818_T_C_b38	PLEKHN1	-3.142	0.00186	-0.067076	26	0.021345	yes	TESTIS
chr1_1143811_T_C_b38	PLEKHN1	-3.136	0.00191	-0.06679	25	0.021301	yes	TESTIS
chr1_1318756_G_A_b38	PLEKHN1	-3.133	0.00193	-0.10619	16	0.033897	yes	TESTIS
chr1_1422081_C_T_b38	PLEKHN1	3.123	0.00199	0.106107	20	0.033976	yes	TESTIS
chr1_1476266_T_C_b38	PLEKHN1	3.12	0.002	0.098545	19	0.031581	yes	TESTIS
chr1_1062056_CTCCCTCCCTTGTCCCCGTTCCCTCCG_C_b38	PLEKHN1	3.114	0.00205	0.074529	12	0.023935	yes	TESTIS
chr1_1290579_C_G_b38	PLEKHN1	3.106	0.0021	0.080018	19	0.025763	yes	TESTIS
chr1_923311_TG_T_b38	PLEKHN1	-3.092	0.0022	-0.071648	24	0.023169	yes	TESTIS
chr1_1150799_T_C_b38	PLEKHN1	-3.088	0.00223	-0.064256	23	0.020807	yes	TESTIS
chr1_923421_A_G_b38	PLEKHN1	-3.066	0.00239	-0.070429	25	0.022968	yes	TESTIS
chr1_1460021_C_CTG_b38	PLEKHN1	3.061	0.00243	0.102946	11	0.03363	yes	TESTIS
chr1_1460022_CAG_C_b38	PLEKHN1	3.061	0.00243	0.102946	11	0.03363	yes	TESTIS
chr1_1537160_T_G_b38	PLEKHN1	3.044	0.00257	0.062576	53	0.020557	yes	TESTIS
chr1_1063015_A_G_b38	PLEKHN1	3.037	0.00263	0.062166	23	0.02047	yes	TESTIS
chr1_1445187_T_G_b38	PLEKHN1	3.036	0.00263	0.073021	26	0.02405	yes	TESTIS
chr1_1315752_GAGCGAGGGAGGTGGGGGCGGGGAGGGAGGGAGGGAGGCGGGC_G_b38	PLEKHN1	-3.029	0.00269	-0.071425	15	0.023579	yes	TESTIS
chr1_1055000_C_T_b38	PLEKHN1	3.003	0.00293	0.063564	32	0.021167	yes	TESTIS
chr1_1080336_G_A_b38	PLEKHN1	3.001	0.00295	0.072631	15	0.024204	yes	TESTIS
chr1_1055037_T_C_b38	PLEKHN1	2.999	0.00296	0.063399	38	0.021137	yes	TESTIS
chr1_1087930_T_C_b38	PLEKHN1	2.997	0.00298	0.072155	12	0.024075	yes	TESTIS
chr1_1419135_C_G_b38	PLEKHN1	2.995	0.003	0.100773	20	0.033643	yes	TESTIS
chr1_1363880_A_G_b38	PLEKHN1	2.982	0.00312	0.085501	6	0.028668	yes	TESTIS
chr1_1373007_G_A_b38	PLEKHN1	2.975	0.0032	0.090079	4	0.030276	yes	TESTIS
chr1_1364282_T_G_b38	PLEKHN1	2.969	0.00326	0.08564	6	0.028845	yes	TESTIS
chr1_1364694_T_C_b38	PLEKHN1	2.969	0.00326	0.08564	6	0.028845	yes	TESTIS
chr1_1364721_C_T_b38	PLEKHN1	2.969	0.00326	0.08564	6	0.028845	yes	TESTIS
chr1_1365160_A_G_b38	PLEKHN1	2.969	0.00326	0.08564	6	0.028845	yes	TESTIS
chr1_1365198_C_T_b38	PLEKHN1	2.969	0.00326	0.08564	6	0.028845	yes	TESTIS
chr1_1366008_A_G_b38	PLEKHN1	2.969	0.00326	0.08564	6	0.028845	yes	TESTIS
chr1_1366062_T_C_b38	PLEKHN1	2.969	0.00326	0.08564	6	0.028845	yes	TESTIS
chr1_1366145_TGTGAA_T_b38	PLEKHN1	2.969	0.00326	0.08564	6	0.028845	yes	TESTIS
chr1_1366187_A_AGT_b38	PLEKHN1	2.969	0.00326	0.08564	6	0.028845	yes	TESTIS
chr1_1366321_TGTGTGTAAATGG_T_b38	PLEKHN1	2.969	0.00326	0.08564	6	0.028845	yes	TESTIS
chr1_1366453_G_T_b38	PLEKHN1	2.969	0.00326	0.08564	6	0.028845	yes	TESTIS
chr1_1366726_T_G_b38	PLEKHN1	2.969	0.00326	0.08564	6	0.028845	yes	TESTIS
chr1_1367258_T_A_b38	PLEKHN1	2.969	0.00326	0.08564	6	0.028845	yes	TESTIS
chr1_1367268_TGA_T_b38	PLEKHN1	2.969	0.00326	0.08564	6	0.028845	yes	TESTIS
chr1_1367297_GAA_G_b38	PLEKHN1	2.969	0.00326	0.08564	6	0.028845	yes	TESTIS
chr1_1367329_A_AGT_b38	PLEKHN1	2.969	0.00326	0.08564	6	0.028845	yes	TESTIS
chr1_1367373_T_TGTG_b38	PLEKHN1	2.969	0.00326	0.08564	6	0.028845	yes	TESTIS
chr1_1367388_T_TTGG_b38	PLEKHN1	2.969	0.00326	0.08564	6	0.028845	yes	TESTIS
chr1_1367511_ATGAG_A_b38	PLEKHN1	2.969	0.00326	0.08564	6	0.028845	yes	TESTIS
chr1_1367593_G_A_b38	PLEKHN1	2.969	0.00326	0.08564	6	0.028845	yes	TESTIS
chr1_1367602_GT_G_b38	PLEKHN1	2.969	0.00326	0.08564	6	0.028845	yes	TESTIS
chr1_1367605_GAGTGAGTGTA_G_b38	PLEKHN1	2.969	0.00326	0.08564	6	0.028845	yes	TESTIS
chr1_1367670_GGTGA_G_b38	PLEKHN1	2.969	0.00326	0.08564	6	0.028845	yes	TESTIS
chr1_1367722_TTTTA_T_b38	PLEKHN1	2.969	0.00326	0.08564	6	0.028845	yes	TESTIS
chr1_1367874_A_T_b38	PLEKHN1	2.969	0.00326	0.08564	6	0.028845	yes	TESTIS
chr1_1367919_C_T_b38	PLEKHN1	2.969	0.00326	0.08564	6	0.028845	yes	TESTIS
chr1_1367951_C_T_b38	PLEKHN1	2.969	0.00326	0.08564	6	0.028845	yes	TESTIS
chr1_1367965_A_G_b38	PLEKHN1	2.969	0.00326	0.08564	6	0.028845	yes	TESTIS
chr1_1367970_T_G_b38	PLEKHN1	2.969	0.00326	0.08564	6	0.028845	yes	TESTIS
chr1_1367994_C_A_b38	PLEKHN1	2.969	0.00326	0.08564	6	0.028845	yes	TESTIS
chr1_1368297_C_T_b38	PLEKHN1	2.969	0.00326	0.08564	6	0.028845	yes	TESTIS
chr1_1369282_G_A_b38	PLEKHN1	2.965	0.0033	0.084943	6	0.028645	yes	TESTIS
chr1_1369320_GT_G_b38	PLEKHN1	2.965	0.0033	0.084943	6	0.028645	yes	TESTIS
chr1_1369407_G_A_b38	PLEKHN1	2.965	0.0033	0.084943	6	0.028645	yes	TESTIS
chr1_1369476_CTT_C_b38	PLEKHN1	2.965	0.0033	0.084943	6	0.028645	yes	TESTIS
chr1_1369556_C_G_b38	PLEKHN1	2.965	0.0033	0.084943	6	0.028645	yes	TESTIS
chr1_1369627_T_C_b38	PLEKHN1	2.965	0.0033	0.084943	6	0.028645	yes	TESTIS
chr1_1369686_T_C_b38	PLEKHN1	2.965	0.0033	0.084943	6	0.028645	yes	TESTIS
chr1_1369716_G_C_b38	PLEKHN1	2.965	0.0033	0.084943	6	0.028645	yes	TESTIS
chr1_1369741_C_T_b38	PLEKHN1	2.965	0.0033	0.084943	6	0.028645	yes	TESTIS
chr1_1369821_C_T_b38	PLEKHN1	2.965	0.0033	0.084943	6	0.028645	yes	TESTIS
chr1_1370181_C_T_b38	PLEKHN1	2.965	0.0033	0.084943	6	0.028645	yes	TESTIS
chr1_1370317_G_C_b38	PLEKHN1	2.965	0.0033	0.084943	6	0.028645	yes	TESTIS
chr1_1370320_A_G_b38	PLEKHN1	2.965	0.0033	0.084943	6	0.028645	yes	TESTIS
chr1_1363456_CAG_C_b38	PLEKHN1	-2.963	0.00332	-0.071566	18	0.024152	yes	TESTIS
chr1_1367028_A_G_b38	PLEKHN1	-2.961	0.00334	-0.089533	8	0.030232	yes	TESTIS
chr1_1088408_C_T_b38	PLEKHN1	2.941	0.00356	0.073279	11	0.024917	yes	TESTIS
chr1_973862_A_G_b38	PLEKHN1	2.938	0.00359	0.131317	4	0.04469	yes	TESTIS
chr1_1086203_A_C_b38	PLEKHN1	2.93	0.00368	0.070163	12	0.023944	yes	TESTIS
chr1_1378204_G_C_b38	PLEKHN1	-2.928	0.00371	-0.073148	26	0.024986	yes	TESTIS
chr1_1361679_G_A_b38	PLEKHN1	-2.926	0.00373	-0.074672	22	0.02552	yes	TESTIS
chr1_1276547_C_T_b38	PLEKHN1	2.925	0.00374	0.10928	4	0.037356	yes	TESTIS
chr1_1276564_C_T_b38	PLEKHN1	2.925	0.00374	0.10928	4	0.037356	yes	TESTIS
chr1_1049113_GGC_G_b38	PLEKHN1	2.911	0.0039	0.072322	16	0.024841	yes	TESTIS
chr1_1955424_T_C_b38	PLEKHN1	2.911	0.0039	0.136508	9	0.046887	yes	TESTIS
chr1_1167770_G_A_b38	PLEKHN1	-2.91	0.00392	-0.059703	23	0.020516	yes	TESTIS
chr1_1368177_G_C_b38	PLEKHN1	2.904	0.00399	0.083627	9	0.028793	yes	TESTIS
chr1_994321_C_CA_b38	PLEKHN1	2.904	0.00399	0.070623	22	0.024316	yes	TESTIS
chr1_1366292_G_T_b38	PLEKHN1	2.901	0.00403	0.083919	6	0.028931	yes	TESTIS
chr1_1364566_T_C_b38	PLEKHN1	2.898	0.00407	0.084265	6	0.029078	yes	TESTIS
chr1_1367280_T_A_b38	PLEKHN1	2.896	0.00409	0.083665	6	0.028885	yes	TESTIS
chr1_1290841_A_G_b38	PLEKHN1	2.878	0.00433	0.075835	17	0.026354	yes	TESTIS
chr1_1370532_C_T_b38	PLEKHN1	2.877	0.00434	0.080961	7	0.028139	yes	TESTIS
chr1_1086035_A_G_b38	PLEKHN1	2.876	0.00435	0.058437	27	0.02032	yes	TESTIS
chr1_1084906_A_C_b38	PLEKHN1	2.875	0.00436	0.163217	4	0.056769	yes	TESTIS
chr1_1366427_AGTGTGATTGAATGAGT_A_b38	PLEKHN1	-2.872	0.00441	-0.072631	26	0.025293	yes	TESTIS
chr1_1369803_C_CT_b38	PLEKHN1	2.871	0.00442	0.079246	6	0.027603	yes	TESTIS
chr1_1056344_C_T_b38	PLEKHN1	2.87	0.00443	0.068474	17	0.023859	yes	TESTIS
chr1_1002415_CT_C_b38	PLEKHN1	2.867	0.00447	0.064129	23	0.022368	yes	TESTIS
chr1_1549967_C_G_b38	PLEKHN1	2.862	0.00455	0.062637	22	0.021888	yes	TESTIS
chr1_1366681_T_TGA_b38	PLEKHN1	2.843	0.00482	0.082346	6	0.028969	yes	TESTIS
chr1_1445240_A_G_b38	PLEKHN1	2.841	0.00484	0.069534	29	0.024474	yes	TESTIS
chr1_1067552_C_G_b38	PLEKHN1	2.84	0.00486	0.056734	26	0.019979	yes	TESTIS
chr1_1285621_A_G_b38	PLEKHN1	2.838	0.00489	0.174948	3	0.061653	yes	TESTIS
chr1_1286671_A_G_b38	PLEKHN1	2.838	0.00489	0.174948	3	0.061653	yes	TESTIS
chr1_1170732_A_G_b38	PLEKHN1	2.834	0.00494	0.172177	17	0.060747	yes	TESTIS
chr1_1482402_A_G_b38	PLEKHN1	2.833	0.00497	0.077282	29	0.027282	yes	TESTIS
chr1_1367462_T_C_b38	PLEKHN1	2.824	0.0051	0.081243	6	0.028767	yes	TESTIS
chr1_1081961_G_T_b38	PLEKHN1	2.821	0.00515	0.055706	29	0.019748	yes	TESTIS
chr1_1364357_A_C_b38	PLEKHN1	2.809	0.00534	0.080955	6	0.028823	yes	TESTIS
chr1_1368514_C_G_b38	PLEKHN1	2.809	0.00534	0.080955	6	0.028823	yes	TESTIS
chr1_1074098_G_C_b38	PLEKHN1	2.8	0.00549	0.056285	26	0.020104	yes	TESTIS
chr1_1698048_T_C_b38	PLEKHN1	2.794	0.00559	0.122407	3	0.043816	yes	TESTIS
chr1_1428763_A_G_b38	PLEKHN1	2.783	0.00576	0.098198	8	0.035279	yes	TESTIS
chr1_1028979_GCCACGCCACCCTCTCCCAAGGAACCGAGCCCCAGCCCCTCGTGGGCCAAGGGCGCCCACAC_G_b38	PLEKHN1	-2.781	0.00581	-0.088676	5	0.031888	yes	TESTIS
chr1_1368991_C_T_b38	PLEKHN1	2.779	0.00584	0.080643	6	0.029018	yes	TESTIS
chr1_1449831_A_G_b38	PLEKHN1	2.779	0.00584	0.071557	29	0.025749	yes	TESTIS
chr1_1164057_G_A_b38	PLEKHN1	-2.776	0.00589	-0.056824	25	0.020471	yes	TESTIS
chr1_1810535_C_CA_b38	PLEKHN1	2.766	0.00608	0.122204	4	0.044185	yes	TESTIS
chr1_908025_A_G_b38	PLEKHN1	-2.761	0.00616	-0.055577	32	0.02013	yes	TESTIS
chr1_1558204_T_TAAAAA_b38	PLEKHN1	-2.756	0.00626	-0.126996	4	0.046083	yes	TESTIS
chr1_1241217_T_C_b38	PLEKHN1	2.756	0.00626	0.085081	4	0.030874	yes	TESTIS
chr1_1306366_T_C_b38	PLEKHN1	2.754	0.00629	0.131409	3	0.047714	yes	TESTIS
chr1_1246371_T_C_b38	PLEKHN1	2.749	0.00638	0.084784	6	0.030837	yes	TESTIS
chr1_1056425_GCGGGTA_G_b38	PLEKHN1	2.743	0.0065	0.072129	5	0.026296	yes	TESTIS
chr1_1366828_A_G_b38	PLEKHN1	2.737	0.00661	0.088487	4	0.032326	yes	TESTIS
chr1_1366830_G_A_b38	PLEKHN1	2.723	0.0069	0.088751	4	0.032594	yes	TESTIS
chr1_1443457_T_C_b38	PLEKHN1	2.719	0.00697	0.065962	30	0.024258	yes	TESTIS
chr1_1376162_G_C_b38	PLEKHN1	-2.713	0.0071	-0.068456	26	0.025231	yes	TESTIS
chr1_1377431_C_T_b38	PLEKHN1	-2.713	0.0071	-0.068456	26	0.025231	yes	TESTIS
chr1_1957243_T_C_b38	PLEKHN1	2.713	0.0071	0.098104	9	0.036161	yes	TESTIS
chr1_1957760_T_C_b38	PLEKHN1	2.713	0.0071	0.098104	9	0.036161	yes	TESTIS
chr1_1243102_A_G_b38	PLEKHN1	2.713	0.0071	0.082935	5	0.030571	yes	TESTIS
chr1_1366835_G_GGTGA_b38	PLEKHN1	2.708	0.00721	0.088286	4	0.032606	yes	TESTIS
chr1_1472158_C_G_b38	PLEKHN1	2.703	0.00731	0.09792	10	0.036228	yes	TESTIS
chr1_1273803_G_GCGC_b38	PLEKHN1	2.698	0.00742	0.099881	4	0.037019	yes	TESTIS
chr1_1062389_CG_C_b38	PLEKHN1	-2.694	0.00751	-0.054313	27	0.02016	yes	TESTIS
chr1_1242094_A_G_b38	PLEKHN1	2.681	0.00779	0.082267	5	0.03068	yes	TESTIS
chr1_1242250_A_G_b38	PLEKHN1	2.681	0.00779	0.082267	5	0.03068	yes	TESTIS
chr1_1433374_T_C_b38	PLEKHN1	2.677	0.00789	0.061433	38	0.022951	yes	TESTIS
chr1_1574032_AAAG_A_b38	PLEKHN1	2.671	0.00804	0.06474	22	0.024241	yes	TESTIS
chr1_1135738_G_C_b38	PLEKHN1	2.669	0.00806	0.050688	66	0.018989	yes	TESTIS
chr1_1042813_G_A_b38	PLEKHN1	-2.668	0.0081	-0.065414	10	0.02452	yes	TESTIS
chr1_1241053_A_G_b38	PLEKHN1	2.662	0.00823	0.08188	5	0.030755	yes	TESTIS
chr1_1461760_C_A_b38	PLEKHN1	2.661	0.00826	0.11969	8	0.044978	yes	TESTIS
chr1_1088200_A_AC_b38	PLEKHN1	2.661	0.00826	0.075888	8	0.028519	yes	TESTIS
chr1_1158683_T_C_b38	PLEKHN1	-2.648	0.00859	-0.054131	30	0.020446	yes	TESTIS
chr1_1370553_CAAA_C_b38	PLEKHN1	2.642	0.00873	0.079603	4	0.030129	yes	TESTIS
chr1_1363688_C_T_b38	PLEKHN1	2.631	0.00902	0.076013	6	0.028894	yes	TESTIS
chr1_1364099_CCA_C_b38	PLEKHN1	2.631	0.00902	0.076013	6	0.028894	yes	TESTIS
chr1_1364102_TGTTG_T_b38	PLEKHN1	2.631	0.00902	0.076013	6	0.028894	yes	TESTIS
chr1_1368763_G_A_b38	PLEKHN1	2.631	0.00902	0.076013	6	0.028894	yes	TESTIS
chr1_1479719_T_C_b38	PLEKHN1	2.627	0.00912	0.060699	37	0.02311	yes	TESTIS
chr1_1479683_T_G_b38	PLEKHN1	2.622	0.00925	0.114643	15	0.043731	yes	TESTIS
chr1_1480096_G_C_b38	PLEKHN1	2.622	0.00925	0.114643	15	0.043731	yes	TESTIS
chr1_931558_G_A_b38	PLEKHN1	2.614	0.00945	0.061008	14	0.023337	yes	TESTIS
chr1_1242865_C_T_b38	PLEKHN1	2.614	0.00945	0.079342	5	0.030351	yes	TESTIS
chr1_1440834_C_G_b38	PLEKHN1	2.613	0.00948	0.063274	29	0.024213	yes	TESTIS
chr1_968046_C_T_b38	PLEKHN1	2.61	0.00955	0.054775	30	0.020984	yes	TESTIS
chr1_1138876_T_C_b38	PLEKHN1	-2.603	0.00975	-0.055518	20	0.021327	yes	TESTIS
chr1_1558204_T_TAAAAAA_b38	PLEKHN1	2.602	0.00977	0.06007	21	0.023082	yes	TESTIS
chr1_1053552_G_C_b38	PLEKHN1	2.599	0.00988	0.062964	19	0.024229	yes	TESTIS
chr1_994185_G_T_b38	PLEKHN1	4.947	1.34e-06	0.122331	7	0.024729	no	TESTIS
chr1_1000830_C_A_b38	PLEKHN1	-4.874	1.88e-06	-0.110448	12	0.02266	no	TESTIS
chr1_996120_C_T_b38	PLEKHN1	4.7	4.16e-06	0.116357	7	0.024755	no	TESTIS
chr1_985123_G_A_b38	PLEKHN1	4.671	4.76e-06	0.116547	9	0.024952	no	TESTIS
chr1_914483_G_GACTGCCCAGCTC_b38	PLEKHN1	4.572	7.41e-06	0.113254	7	0.024773	no	TESTIS
chr1_998750_G_C_b38	PLEKHN1	4.492	1.05e-05	0.107916	9	0.024024	no	TESTIS
chr1_975029_T_C_b38	PLEKHN1	-4.357	1.88e-05	-0.12854	3	0.029503	no	TESTIS
chr1_1306523_C_G_b38	PLEKHN1	-4.308	2.32e-05	-0.140193	12	0.032544	no	TESTIS
chr1_1307327_A_G_b38	PLEKHN1	-4.236	3.13e-05	-0.141866	21	0.03349	no	TESTIS
chr1_1134040_G_C_b38	PLEKHN1	-4.069	6.22e-05	-0.07936	30	0.019504	no	TESTIS
chr1_914682_A_T_b38	PLEKHN1	4.01	7.88e-05	0.097392	9	0.024286	no	TESTIS
chr1_915810_G_A_b38	PLEKHN1	3.954	9.87e-05	0.096241	9	0.024343	no	TESTIS
chr1_1001870_C_G_b38	PLEKHN1	3.909	0.000118	0.092545	10	0.023674	no	TESTIS
chr1_1004111_TG_T_b38	PLEKHN1	-3.843	0.000152	-0.086815	14	0.022589	no	TESTIS
chr1_1134062_C_T_b38	PLEKHN1	-3.837	0.000156	-0.075432	35	0.01966	no	TESTIS
chr1_917284_C_T_b38	PLEKHN1	3.815	0.00017	0.098077	6	0.025712	no	TESTIS
chr1_917378_G_C_b38	PLEKHN1	3.815	0.00017	0.098077	6	0.025712	no	TESTIS
chr1_917859_A_G_b38	PLEKHN1	3.815	0.00017	0.098077	6	0.025712	no	TESTIS
chr1_1307603_G_A_b38	PLEKHN1	-3.809	0.000173	-0.124846	21	0.032774	no	TESTIS
chr1_1134070_C_T_b38	PLEKHN1	-3.64	0.000327	-0.070768	37	0.019441	no	TESTIS
chr1_791545_G_T_b38	PLEKHN1	3.639	0.000329	0.133995	8	0.036825	no	TESTIS
chr1_1258206_AT_A_b38	PLEKHN1	3.632	0.000337	0.089978	26	0.024772	no	TESTIS
chr1_1134222_T_C_b38	PLEKHN1	-3.627	0.000343	-0.070613	37	0.019467	no	TESTIS
chr1_1284756_A_G_b38	PLEKHN1	3.591	0.000392	0.123514	17	0.034394	no	TESTIS
chr1_913274_TG_T_b38	PLEKHN1	3.544	0.000465	0.090716	6	0.025596	no	TESTIS
chr1_914743_C_T_b38	PLEKHN1	3.544	0.000465	0.090716	6	0.025596	no	TESTIS
chr1_1306420_A_G_b38	PLEKHN1	-3.504	0.000538	-0.122528	21	0.034972	no	TESTIS
chr1_1277844_T_A_b38	PLEKHN1	3.474	0.000599	0.102817	13	0.0296	no	TESTIS
chr1_915824_G_C_b38	PLEKHN1	3.473	0.000601	0.081324	13	0.023417	no	TESTIS
chr1_912710_G_A_b38	PLEKHN1	3.437	0.000681	0.087341	6	0.02541	no	TESTIS
chr1_913358_C_T_b38	PLEKHN1	3.437	0.000681	0.087341	6	0.02541	no	TESTIS
chr1_1221049_C_G_b38	PLEKHN1	3.402	0.000771	0.080193	29	0.023571	no	TESTIS
chr1_918870_A_G_b38	PLEKHN1	3.396	0.000788	0.082015	9	0.02415	no	TESTIS
chr1_1419214_A_G_b38	PLEKHN1	3.358	0.000898	0.111649	7	0.033245	no	TESTIS
chr1_1468048_A_G_b38	PLEKHN1	3.351	0.000921	0.121949	12	0.036391	no	TESTIS
chr1_632535_A_G_b38	PLEKHN1	-3.338	0.000962	-0.109238	4	0.032721	no	TESTIS
chr1_1259424_T_C_b38	PLEKHN1	3.319	0.00103	0.085705	32	0.025826	no	TESTIS
chr1_922671_C_T_b38	PLEKHN1	3.304	0.00108	0.085029	6	0.025733	no	TESTIS
chr1_1295039_T_C_b38	PLEKHN1	3.291	0.00113	0.115004	21	0.034941	no	TESTIS
chr1_1298561_T_C_b38	PLEKHN1	3.291	0.00113	0.115004	21	0.034941	no	TESTIS
chr1_924305_G_A_b38	PLEKHN1	3.274	0.0012	0.078123	13	0.023865	no	TESTIS
chr1_1282558_C_CCA_b38	PLEKHN1	3.229	0.0014	0.083683	19	0.02592	no	TESTIS
chr1_914948_CA_C_b38	PLEKHN1	3.175	0.00167	0.079384	9	0.025	no	TESTIS
chr1_1064776_C_T_b38	PLEKHN1	3.153	0.0018	0.061757	38	0.019589	no	TESTIS
chr1_1277269_T_C_b38	PLEKHN1	3.129	0.00195	0.092039	15	0.029415	no	TESTIS
chr1_1278407_T_TA_b38	PLEKHN1	3.129	0.00195	0.092039	15	0.029415	no	TESTIS
chr1_1275091_T_C_b38	PLEKHN1	3.113	0.00206	0.090268	16	0.029001	no	TESTIS
chr1_922660_C_A_b38	PLEKHN1	3.105	0.00211	0.080586	6	0.025954	no	TESTIS
chr1_1080437_G_A_b38	PLEKHN1	3.091	0.0022	0.059625	32	0.019288	no	TESTIS
chr1_1016060_CT_C_b38	PLEKHN1	-3.08	0.00228	-0.084761	3	0.027518	no	TESTIS
chr1_928622_G_C_b38	PLEKHN1	3.064	0.00241	0.073809	11	0.024087	no	TESTIS
chr1_1282706_C_T_b38	PLEKHN1	3.057	0.00246	0.089941	16	0.029419	no	TESTIS
chr1_1519934_T_G_b38	PLEKHN1	3.039	0.00261	0.063844	50	0.021009	no	TESTIS
chr1_1519938_T_C_b38	PLEKHN1	3.039	0.00261	0.063844	50	0.021009	no	TESTIS
chr1_1068249_C_T_b38	PLEKHN1	3.029	0.0027	0.059062	36	0.0195	no	TESTIS
chr1_1474201_CT_C_b38	PLEKHN1	3.013	0.00283	0.088027	17	0.029214	no	TESTIS
chr1_1369012_C_CG_b38	PLEKHN1	3.001	0.00295	0.087558	6	0.029181	no	TESTIS
chr1_1369009_T_C_b38	PLEKHN1	2.99	0.00305	0.0873	6	0.029201	no	TESTIS
chr1_1069047_G_A_b38	PLEKHN1	2.989	0.00305	0.056581	34	0.018927	no	TESTIS
chr1_929839_G_A_b38	PLEKHN1	2.982	0.00312	0.072603	11	0.024344	no	TESTIS
chr1_1372909_G_A_b38	PLEKHN1	2.968	0.00327	0.088012	5	0.029651	no	TESTIS
chr1_1370430_T_C_b38	PLEKHN1	2.938	0.00359	0.084848	6	0.02888	no	TESTIS
chr1_1370584_G_C_b38	PLEKHN1	2.938	0.00359	0.084848	6	0.02888	no	TESTIS
chr1_1274972_A_G_b38	PLEKHN1	2.935	0.00362	0.085841	15	0.029246	no	TESTIS
chr1_1374505_A_G_b38	PLEKHN1	2.921	0.00379	0.085359	6	0.029221	no	TESTIS
chr1_1248141_G_C_b38	PLEKHN1	2.919	0.00381	0.134449	5	0.046056	no	TESTIS
chr1_1059011_G_T_b38	PLEKHN1	2.904	0.00399	0.070991	15	0.024445	no	TESTIS
chr1_591460_T_C_b38	PLEKHN1	2.89	0.00416	0.117282	5	0.040575	no	TESTIS
chr1_1300330_T_A_b38	PLEKHN1	2.879	0.00431	0.097745	21	0.033952	no	TESTIS
chr1_1301656_T_C_b38	PLEKHN1	2.879	0.00431	0.097745	21	0.033952	no	TESTIS
chr1_1296794_GC_G_b38	PLEKHN1	2.867	0.00448	0.175828	3	0.061336	no	TESTIS
chr1_1373006_G_A_b38	PLEKHN1	2.789	0.00567	0.086355	3	0.030961	no	TESTIS
chr1_650383_A_AAC_b38	PLEKHN1	2.787	0.0057	0.102255	5	0.036685	no	TESTIS
chr1_1367300_T_TGA_b38	PLEKHN1	2.782	0.00579	0.081704	5	0.029369	no	TESTIS
chr1_1294390_T_C_b38	PLEKHN1	2.766	0.00608	0.175349	3	0.063401	no	TESTIS
chr1_1300412_C_T_b38	PLEKHN1	2.766	0.00608	0.175349	3	0.063401	no	TESTIS
chr1_1306341_GAGA_G_b38	PLEKHN1	2.766	0.00608	0.175349	3	0.063401	no	TESTIS
chr1_1470034_T_C_b38	PLEKHN1	2.756	0.00626	0.101128	15	0.036697	no	TESTIS
chr1_1471144_G_C_b38	PLEKHN1	2.756	0.00626	0.101128	15	0.036697	no	TESTIS
chr1_906633_T_G_b38	PLEKHN1	2.753	0.00631	0.065503	12	0.023795	no	TESTIS
chr1_932255_C_T_b38	PLEKHN1	2.729	0.00677	0.06669	11	0.024434	no	TESTIS
chr1_910698_C_T_b38	PLEKHN1	2.703	0.00732	0.070071	6	0.025927	no	TESTIS
chr1_911018_G_A_b38	PLEKHN1	2.692	0.00754	0.067067	12	0.024909	no	TESTIS
chr1_910255_C_T_b38	PLEKHN1	2.687	0.00765	0.069629	6	0.025909	no	TESTIS
chr1_1057472_AAG_A_b38	PLEKHN1	2.673	0.00799	0.064318	16	0.024065	no	TESTIS
chr1_911428_C_T_b38	PLEKHN1	2.663	0.00821	0.065336	10	0.024531	no	TESTIS
chr1_1469429_A_G_b38	PLEKHN1	2.636	0.00889	0.095763	15	0.036335	no	TESTIS
chr1_1411525_T_A_b38	PLEKHN1	2.622	0.00925	0.088749	9	0.033853	no	TESTIS
chr1_1249880_A_G_b38	PLEKHN1	2.605	0.0097	0.074081	11	0.028436	no	TESTIS
chr1_967724_C_T_b38	PLEKHN1	3.546	0.000428	0.079147	22	0.022321	yes	THYROID
chr1_1553791_CA_C_b38	PLEKHN1	3.496	0.000514	0.05038	26	0.014411	yes	THYROID
chr1_1627515_C_T_b38	PLEKHN1	-3.207	0.00143	-0.037914	114	0.011821	yes	THYROID
chr1_1002195_T_TA_b38	PLEKHN1	3.158	0.00168	0.062157	5	0.01968	yes	THYROID
chr1_173098_C_T_b38	PLEKHN1	-3.095	0.00208	-0.035391	113	0.011437	yes	THYROID
chr1_1864334_AAAG_A_b38	PLEKHN1	-3.087	0.00213	-0.043889	39	0.014218	yes	THYROID
chr1_920719_T_G_b38	PLEKHN1	-3.082	0.00217	-0.037756	77	0.012252	yes	THYROID
chr1_920728_A_G_b38	PLEKHN1	-3.082	0.00217	-0.037756	77	0.012252	yes	THYROID
chr1_1707801_C_G_b38	PLEKHN1	-3.076	0.00221	-0.083761	8	0.027232	yes	THYROID
chr1_919397_A_G_b38	PLEKHN1	3.049	0.00242	0.03723	77	0.012212	yes	THYROID
chr1_919695_C_G_b38	PLEKHN1	3.046	0.00244	0.037167	78	0.0122	yes	THYROID
chr1_940296_GCC_G_b38	PLEKHN1	2.997	0.00287	0.03564	93	0.011894	yes	THYROID
chr1_1634406_C_G_b38	PLEKHN1	2.982	0.003	0.079325	5	0.026603	yes	THYROID
chr1_1706927_A_G_b38	PLEKHN1	-2.958	0.00324	-0.067275	11	0.022745	yes	THYROID
chr1_1773676_TTGTGTGTG_T_b38	PLEKHN1	2.896	0.00395	0.067417	4	0.023282	yes	THYROID
chr1_1616048_C_T_b38	PLEKHN1	2.88	0.00415	0.035782	73	0.012425	yes	THYROID
chr1_1612560_G_GT_b38	PLEKHN1	2.863	0.00437	0.036116	62	0.012615	yes	THYROID
chr1_1628409_C_A_b38	PLEKHN1	2.798	0.00534	0.034666	71	0.012389	yes	THYROID
chr1_531693_C_T_b38	PLEKHN1	-2.785	0.00555	-0.033342	86	0.01197	yes	THYROID
chr1_1866635_T_TAAA_b38	PLEKHN1	-2.779	0.00565	-0.035504	79	0.012775	yes	THYROID
chr1_869213_TA_T_b38	PLEKHN1	2.772	0.00577	0.053528	4	0.019307	yes	THYROID
chr1_1625951_G_A_b38	PLEKHN1	2.769	0.00583	0.033911	86	0.012246	yes	THYROID
chr1_1628814_C_T_b38	PLEKHN1	2.766	0.00589	0.034345	71	0.012419	yes	THYROID
chr1_1951106_G_A_b38	PLEKHN1	-2.758	0.00602	-0.033952	125	0.012309	yes	THYROID
chr1_1951865_G_GT_b38	PLEKHN1	-2.758	0.00602	-0.033952	125	0.012309	yes	THYROID
chr1_1618118_G_A_b38	PLEKHN1	2.754	0.0061	0.034664	68	0.012586	yes	THYROID
chr1_1952823_TA_T_b38	PLEKHN1	-2.721	0.00673	-0.033424	124	0.012283	yes	THYROID
chr1_1629572_TG_T_b38	PLEKHN1	2.718	0.0068	0.033556	74	0.012346	yes	THYROID
chr1_917495_C_T_b38	PLEKHN1	2.707	0.00702	0.033168	101	0.012254	yes	THYROID
chr1_918574_C_A_b38	PLEKHN1	2.707	0.00702	0.033168	101	0.012254	yes	THYROID
chr1_608127_T_C_b38	PLEKHN1	2.684	0.00752	0.044237	4	0.016482	yes	THYROID
chr1_921096_A_G_b38	PLEKHN1	-2.653	0.00822	-0.033276	88	0.012542	yes	THYROID
chr1_1950071_C_T_b38	PLEKHN1	-2.648	0.00834	-0.03267	124	0.012336	yes	THYROID
chr1_1952064_G_A_b38	PLEKHN1	-2.648	0.00834	-0.03267	124	0.012336	yes	THYROID
chr1_1610924_C_T_b38	PLEKHN1	2.648	0.00835	0.033285	68	0.012569	yes	THYROID
chr1_1804000_AAAAG_A_b38	PLEKHN1	2.642	0.00849	0.089359	4	0.03382	yes	THYROID
chr1_1836856_CT_C_b38	PLEKHN1	2.624	0.00897	0.038586	29	0.014708	yes	THYROID
chr1_1777680_C_T_b38	PLEKHN1	2.618	0.00911	0.058364	3	0.022294	yes	THYROID
chr1_1866635_T_TA_b38	PLEKHN1	2.613	0.00924	0.032746	79	0.01253	yes	THYROID
chr1_1634405_CCGG_C_b38	PLEKHN1	2.603	0.00951	0.086508	4	0.033234	yes	THYROID
chr1_1758323_T_C_b38	PLEKHN1	2.601	0.00956	0.029994	115	0.01153	yes	THYROID
chr1_1498115_C_T_b38	PLEKHN1	-2.594	0.00978	-0.104588	3	0.040326	yes	THYROID
chr1_954724_G_A_b38	PLEKHN1	-3.261	0.00118	-0.046727	25	0.014328	no	THYROID
chr1_969663_CAT_C_b38	PLEKHN1	-3.209	0.00142	-0.044489	33	0.013865	no	THYROID
chr1_1792696_C_CA_b38	PLEKHN1	3.152	0.00172	0.039218	63	0.012441	no	THYROID
chr1_1746440_A_G_b38	PLEKHN1	-3.065	0.00229	-0.04435	29	0.014469	no	THYROID
chr1_966426_G_C_b38	PLEKHN1	3.041	0.00248	0.069795	26	0.022955	no	THYROID
chr1_969785_A_G_b38	PLEKHN1	-3.011	0.00274	-0.071112	25	0.02362	no	THYROID
chr1_969780_C_T_b38	PLEKHN1	-2.983	0.003	-0.049669	35	0.016652	no	THYROID
chr1_1173774_G_A_b38	PLEKHN1	2.965	0.00317	0.041119	28	0.013869	no	THYROID
chr1_607860_C_A_b38	PLEKHN1	2.845	0.00462	0.048453	3	0.017029	no	THYROID
chr1_1426771_G_C_b38	PLEKHN1	2.816	0.00505	0.071452	3	0.025369	no	THYROID
chr1_1965250_G_GA_b38	PLEKHN1	2.812	0.00512	0.03753	38	0.013347	no	THYROID
chr1_1571434_C_CA_b38	PLEKHN1	2.799	0.00532	0.039385	47	0.014071	no	THYROID
chr1_928309_A_G_b38	PLEKHN1	-2.793	0.00541	-0.088255	12	0.031594	no	THYROID
chr1_908677_AAGGTGGGAGGGGAGAGGGGAGGGGATGGGGGAGGGAATGAGGGGAC_A_b38	PLEKHN1	-2.792	0.00543	-0.056018	8	0.020061	no	THYROID
chr1_1465589_T_TA_b38	PLEKHN1	-2.707	0.00703	-0.060157	4	0.022225	no	THYROID
chr1_1592964_C_T_b38	PLEKHN1	-2.691	0.00736	-0.058335	5	0.021679	no	THYROID
chr1_1134222_T_C_b38	PLEKHN1	2.689	0.0074	0.033959	56	0.012629	no	THYROID
chr1_1062389_CG_C_b38	PLEKHN1	2.688	0.00742	0.034808	43	0.012949	no	THYROID
chr1_1965001_G_A_b38	PLEKHN1	2.668	0.00787	0.035711	37	0.013384	no	THYROID
chr1_1174402_G_A_b38	PLEKHN1	2.65	0.0083	0.038109	23	0.01438	no	THYROID
chr1_1425750_T_C_b38	PLEKHN1	2.645	0.00842	0.065532	4	0.024774	no	THYROID
chr1_1427080_C_T_b38	PLEKHN1	2.641	0.00853	0.067295	3	0.025484	no	THYROID
chr1_1425822_C_G_b38	PLEKHN1	2.618	0.00912	0.06634	3	0.025342	no	THYROID
chr1_1407232_G_C_b38	PLEKHN1	2.618	0.00912	0.042111	18	0.016087	no	THYROID
chr1_1425135_T_C_b38	PLEKHN1	2.613	0.00926	0.06217	4	0.023797	no	THYROID
chr1_1573654_T_C_b38	PLEKHN1	2.611	0.00931	0.034622	82	0.013262	no	THYROID
chr1_1574445_A_G_b38	PLEKHN1	2.611	0.00931	0.034622	82	0.013262	no	THYROID
chr1_531472_G_C_b38	PLEKHN1	-2.597	0.00967	-0.032419	86	0.012482	no	THYROID
chr1_1842235_C_A_b38	PLEKHN1	-2.991	0.00347	-0.084315	10	0.028188	yes	UTERUS
chr1_511982_G_A_b38	PLEKHN1	-2.916	0.00434	-0.081302	15	0.02788	yes	UTERUS
chr1_967865_A_G_b38	PLEKHN1	2.9	0.00455	0.076582	36	0.026404	yes	UTERUS
chr1_505074_C_T_b38	PLEKHN1	-2.74	0.00724	-0.085204	8	0.0311	yes	UTERUS
chr1_16298_C_T_b38	PLEKHN1	2.723	0.00759	0.101171	15	0.037154	yes	UTERUS
chr1_16103_T_G_b38	PLEKHN1	3.022	0.00316	0.103776	6	0.034338	no	UTERUS
chr1_455125_G_T_b38	PLEKHN1	-2.933	0.00413	-0.161116	3	0.054936	no	UTERUS
chr1_1607341_CT_C_b38	PLEKHN1	2.745	0.00713	0.106236	3	0.038701	no	UTERUS
chr1_1099341_T_C_b38	PLEKHN1	2.727	0.0075	0.090093	5	0.033037	no	UTERUS
chr1_855378_GTA_G_b38	PLEKHN1	3.94	0.00014	0.326901	11	0.082977	yes	VAGINA
chr1_853333_T_C_b38	PLEKHN1	3.692	0.000341	0.303819	11	0.082298	yes	VAGINA
chr1_841742_A_T_b38	PLEKHN1	3.653	0.00039	0.296852	10	0.081254	yes	VAGINA
chr1_822427_CCCTGGCCAGCAGATCCACCCTGTCTATACTACCTG_C_b38	PLEKHN1	3.621	0.000437	0.289473	10	0.079944	yes	VAGINA
chr1_851882_C_G_b38	PLEKHN1	3.584	0.000497	0.302499	9	0.08441	yes	VAGINA
chr1_845405_T_A_b38	PLEKHN1	3.507	0.000645	0.291852	11	0.083209	yes	VAGINA
chr1_849670_G_A_b38	PLEKHN1	3.507	0.000645	0.291852	11	0.083209	yes	VAGINA
chr1_850609_T_C_b38	PLEKHN1	3.507	0.000645	0.291852	11	0.083209	yes	VAGINA
chr1_820395_A_G_b38	PLEKHN1	3.497	0.000667	0.270397	10	0.077317	yes	VAGINA
chr1_850867_G_A_b38	PLEKHN1	3.495	0.000671	0.280259	9	0.08018	yes	VAGINA
chr1_822764_A_G_b38	PLEKHN1	3.483	0.000699	0.28106	10	0.080686	yes	VAGINA
chr1_836443_T_C_b38	PLEKHN1	3.473	0.000725	0.27972	9	0.080553	yes	VAGINA
chr1_827105_C_A_b38	PLEKHN1	-3.472	0.000726	-0.298479	5	0.085963	yes	VAGINA
chr1_852464_C_T_b38	PLEKHN1	3.47	0.000732	0.291348	10	0.083965	yes	VAGINA
chr1_818045_T_C_b38	PLEKHN1	3.417	0.000874	0.293993	8	0.086043	yes	VAGINA
chr1_824457_T_A_b38	PLEKHN1	3.417	0.000874	0.293993	8	0.086043	yes	VAGINA
chr1_826893_G_A_b38	PLEKHN1	3.417	0.000874	0.293993	8	0.086043	yes	VAGINA
chr1_851639_C_T_b38	PLEKHN1	3.41	0.000894	0.270153	10	0.079219	yes	VAGINA
chr1_821224_A_G_b38	PLEKHN1	3.405	0.00091	0.275838	10	0.081017	yes	VAGINA
chr1_822354_C_T_b38	PLEKHN1	3.405	0.00091	0.275838	10	0.081017	yes	VAGINA
chr1_837375_A_C_b38	PLEKHN1	3.405	0.00091	0.275838	10	0.081017	yes	VAGINA
chr1_840279_A_G_b38	PLEKHN1	3.405	0.00091	0.275838	10	0.081017	yes	VAGINA
chr1_818025_C_A_b38	PLEKHN1	3.392	0.00095	0.295593	7	0.087148	yes	VAGINA
chr1_827252_T_A_b38	PLEKHN1	3.392	0.00095	0.295593	7	0.087148	yes	VAGINA
chr1_827092_C_T_b38	PLEKHN1	-3.323	0.00119	-0.283836	5	0.085428	yes	VAGINA
chr1_1194931_T_C_b38	PLEKHN1	3.3	0.00128	0.341676	3	0.103533	yes	VAGINA
chr1_830725_T_A_b38	PLEKHN1	3.262	0.00145	0.252017	11	0.077253	yes	VAGINA
chr1_818802_A_G_b38	PLEKHN1	3.261	0.00146	0.28761	9	0.0882	yes	VAGINA
chr1_818812_A_G_b38	PLEKHN1	3.261	0.00146	0.28761	9	0.0882	yes	VAGINA
chr1_818954_T_C_b38	PLEKHN1	3.261	0.00146	0.28761	9	0.0882	yes	VAGINA
chr1_826420_A_T_b38	PLEKHN1	3.228	0.00162	0.234038	16	0.072492	yes	VAGINA
chr1_827209_G_C_b38	PLEKHN1	3.208	0.00173	0.279075	7	0.08698	yes	VAGINA
chr1_827212_C_G_b38	PLEKHN1	3.178	0.0019	0.273412	7	0.086041	yes	VAGINA
chr1_827221_T_C_b38	PLEKHN1	3.178	0.0019	0.273412	7	0.086041	yes	VAGINA
chr1_826352_C_T_b38	PLEKHN1	3.151	0.00207	0.251107	12	0.079683	yes	VAGINA
chr1_826372_C_T_b38	PLEKHN1	3.151	0.00207	0.237905	13	0.075509	yes	VAGINA
chr1_823246_C_T_b38	PLEKHN1	3.113	0.00233	0.245671	11	0.078922	yes	VAGINA
chr1_820510_A_T_b38	PLEKHN1	2.991	0.0034	0.262623	8	0.087808	yes	VAGINA
chr1_822260_G_A_b38	PLEKHN1	2.95	0.00385	0.242034	11	0.082048	yes	VAGINA
chr1_851771_G_A_b38	PLEKHN1	-2.931	0.00407	-0.268788	5	0.091698	yes	VAGINA
chr1_843942_A_G_b38	PLEKHN1	-2.922	0.00419	-0.25026	6	0.08566	yes	VAGINA
chr1_852226_G_T_b38	PLEKHN1	-2.922	0.00419	-0.25026	6	0.08566	yes	VAGINA
chr1_854133_GA_G_b38	PLEKHN1	-2.922	0.00419	-0.25026	6	0.08566	yes	VAGINA
chr1_855811_G_A_b38	PLEKHN1	-2.922	0.00419	-0.25026	6	0.08566	yes	VAGINA
chr1_836030_C_T_b38	PLEKHN1	2.882	0.00471	0.22181	11	0.076969	yes	VAGINA
chr1_817186_G_A_b38	PLEKHN1	2.88	0.00474	0.236472	10	0.082121	yes	VAGINA
chr1_824320_T_C_b38	PLEKHN1	2.88	0.00474	0.236472	10	0.082121	yes	VAGINA
chr1_825532_C_T_b38	PLEKHN1	2.88	0.00474	0.236472	10	0.082121	yes	VAGINA
chr1_825767_T_C_b38	PLEKHN1	2.88	0.00474	0.236472	10	0.082121	yes	VAGINA
chr1_826577_A_AT_b38	PLEKHN1	2.88	0.00474	0.236472	10	0.082121	yes	VAGINA
chr1_843365_A_G_b38	PLEKHN1	-2.872	0.00486	-0.239353	6	0.083351	yes	VAGINA
chr1_1191630_G_A_b38	PLEKHN1	2.807	0.00587	0.295373	3	0.105232	yes	VAGINA
chr1_847938_A_G_b38	PLEKHN1	-2.793	0.00611	-0.231927	6	0.083034	yes	VAGINA
chr1_847601_C_T_b38	PLEKHN1	-2.792	0.00614	-0.24157	7	0.086537	yes	VAGINA
chr1_851615_G_A_b38	PLEKHN1	-2.79	0.00616	-0.24164	6	0.086602	yes	VAGINA
chr1_1188963_C_T_b38	PLEKHN1	2.779	0.00637	0.294886	3	0.106129	yes	VAGINA
chr1_1190707_C_T_b38	PLEKHN1	2.779	0.00637	0.294886	3	0.106129	yes	VAGINA
chr1_828389_AT_A_b38	PLEKHN1	-2.754	0.00683	-0.234823	6	0.085256	yes	VAGINA
chr1_833758_CAT_C_b38	PLEKHN1	-2.754	0.00683	-0.234823	6	0.085256	yes	VAGINA
chr1_713812_A_T_b38	PLEKHN1	-2.736	0.0072	-0.268043	3	0.097977	yes	VAGINA
chr1_817341_A_G_b38	PLEKHN1	2.733	0.00726	0.230014	11	0.084156	yes	VAGINA
chr1_818094_C_G_b38	PLEKHN1	2.733	0.00726	0.230014	11	0.084156	yes	VAGINA
chr1_819123_G_A_b38	PLEKHN1	2.733	0.00726	0.230014	11	0.084156	yes	VAGINA
chr1_819584_C_T_b38	PLEKHN1	2.733	0.00726	0.230014	11	0.084156	yes	VAGINA
chr1_816376_T_C_b38	PLEKHN1	-2.721	0.00752	-0.246745	4	0.090698	yes	VAGINA
chr1_817514_T_C_b38	PLEKHN1	2.71	0.00775	0.215091	10	0.079368	yes	VAGINA
chr1_839801_A_G_b38	PLEKHN1	-2.682	0.00837	-0.228497	6	0.085181	yes	VAGINA
chr1_822556_C_A_b38	PLEKHN1	2.654	0.00906	0.216984	10	0.08175	yes	VAGINA
chr1_846465_A_G_b38	PLEKHN1	-2.652	0.00912	-0.266395	3	0.100449	yes	VAGINA
chr1_16103_T_G_b38	PLEKHN1	-2.651	0.00916	-0.200951	9	0.075814	yes	VAGINA
chr1_722408_G_C_b38	PLEKHN1	2.646	0.00927	0.232324	11	0.087795	yes	VAGINA
chr1_836587_G_A_b38	PLEKHN1	-2.637	0.00952	-0.218267	6	0.082783	yes	VAGINA
chr1_943526_CTTT_C_b38	PLEKHN1	-3.437	0.000816	-0.229904	32	0.066882	no	VAGINA
chr1_818464_CCT_C_b38	PLEKHN1	3.356	0.00107	0.254369	12	0.075804	no	VAGINA
chr1_818469_G_T_b38	PLEKHN1	3.356	0.00107	0.254369	12	0.075804	no	VAGINA
chr1_826431_G_A_b38	PLEKHN1	3.281	0.00137	0.227692	17	0.069394	no	VAGINA
chr1_1194820_G_A_b38	PLEKHN1	3.257	0.00148	0.338454	3	0.103929	no	VAGINA
chr1_1882426_CAAAAA_C_b38	PLEKHN1	-3.188	0.00184	-0.295884	3	0.092824	no	VAGINA
chr1_815963_T_A_b38	PLEKHN1	-3.098	0.00244	-0.268363	5	0.08662	no	VAGINA
chr1_852019_G_T_b38	PLEKHN1	3.051	0.00283	0.24688	10	0.080915	no	VAGINA
chr1_938014_A_G_b38	PLEKHN1	2.992	0.00339	0.447684	5	0.149651	no	VAGINA
chr1_852305_G_T_b38	PLEKHN1	2.93	0.00409	0.233802	11	0.079802	no	VAGINA
chr1_1190394_C_G_b38	PLEKHN1	2.897	0.0045	0.29141	4	0.100581	no	VAGINA
chr1_851805_G_A_b38	PLEKHN1	2.736	0.0072	0.2189	8	0.080004	no	VAGINA
chr1_1734812_G_A_b38	PLEKHN1	-2.729	0.00735	-0.228864	13	0.08387	no	VAGINA
chr1_821099_C_A_b38	PLEKHN1	-2.684	0.00833	-0.259723	3	0.09675	no	VAGINA
chr1_943937_C_T_b38	PLEKHN1	5.235	2.29e-07	0.102506	4	0.019581	yes	WHLBLD
chr1_960684_C_G_b38	PLEKHN1	5.229	2.36e-07	0.102914	4	0.019681	yes	WHLBLD
chr1_951679_G_A_b38	PLEKHN1	5.217	2.51e-07	0.102634	4	0.019672	yes	WHLBLD
chr1_1162613_A_G_b38	PLEKHN1	4.712	3.05e-06	0.143163	3	0.030383	yes	WHLBLD
chr1_951437_C_CATTTT_b38	PLEKHN1	4.576	5.78e-06	0.078362	7	0.017126	yes	WHLBLD
chr1_969785_A_G_b38	PLEKHN1	-4.455	9.99e-06	-0.073723	32	0.016547	yes	WHLBLD
chr1_954915_G_C_b38	PLEKHN1	4.414	1.21e-05	0.088402	4	0.020029	yes	WHLBLD
chr1_951004_G_A_b38	PLEKHN1	4.292	2.06e-05	0.084301	4	0.019642	yes	WHLBLD
chr1_1512497_C_G_b38	PLEKHN1	4.214	2.89e-05	0.116345	3	0.027608	yes	WHLBLD
chr1_966426_G_C_b38	PLEKHN1	4.197	3.12e-05	0.069081	30	0.016462	yes	WHLBLD
chr1_945010_C_A_b38	PLEKHN1	4.196	3.13e-05	0.084941	4	0.020242	yes	WHLBLD
chr1_960953_C_T_b38	PLEKHN1	4.078	5.15e-05	0.081542	4	0.019994	yes	WHLBLD
chr1_969780_C_T_b38	PLEKHN1	-3.941	9.08e-05	-0.047071	46	0.011945	yes	WHLBLD
chr1_966689_T_C_b38	PLEKHN1	3.912	0.000102	0.080558	3	0.020591	yes	WHLBLD
chr1_1650452_G_A_b38	PLEKHN1	3.808	0.000155	0.061844	18	0.016242	yes	WHLBLD
chr1_962350_C_T_b38	PLEKHN1	3.703	0.000233	0.077371	3	0.020895	yes	WHLBLD
chr1_957080_G_C_b38	PLEKHN1	3.684	0.00025	0.071614	5	0.019438	yes	WHLBLD
chr1_1332815_G_A_b38	PLEKHN1	3.659	0.000276	0.064467	7	0.017619	yes	WHLBLD
chr1_1084906_A_C_b38	PLEKHN1	3.555	0.000408	0.080667	8	0.022691	yes	WHLBLD
chr1_1104154_A_C_b38	PLEKHN1	3.539	0.000434	0.112571	3	0.031813	yes	WHLBLD
chr1_1964894_G_A_b38	PLEKHN1	3.504	0.000492	0.096445	3	0.027521	yes	WHLBLD
chr1_1965657_TG_T_b38	PLEKHN1	3.485	0.000528	0.097042	3	0.027843	yes	WHLBLD
chr1_1743566_T_A_b38	PLEKHN1	3.465	0.000568	0.053219	18	0.01536	yes	WHLBLD
chr1_1170732_A_G_b38	PLEKHN1	3.409	0.000697	0.089904	41	0.026376	yes	WHLBLD
chr1_1504928_TTG_T_b38	PLEKHN1	3.407	7e-04	0.045003	6	0.013208	yes	WHLBLD
chr1_1530568_G_T_b38	PLEKHN1	3.387	0.000752	0.063016	11	0.018604	yes	WHLBLD
chr1_1500745_A_C_b38	PLEKHN1	3.358	0.000834	0.046836	59	0.013946	yes	WHLBLD
chr1_1533909_G_C_b38	PLEKHN1	3.319	0.000957	0.030636	81	0.009229	yes	WHLBLD
chr1_1421814_G_A_b38	PLEKHN1	3.291	0.00106	0.055816	14	0.016959	yes	WHLBLD
chr1_1732166_A_G_b38	PLEKHN1	-3.244	0.00125	-0.042868	20	0.013215	yes	WHLBLD
chr1_1753774_C_G_b38	PLEKHN1	-3.234	0.00129	-0.044114	15	0.013642	yes	WHLBLD
chr1_609014_A_G_b38	PLEKHN1	3.225	0.00133	0.069157	3	0.021442	yes	WHLBLD
chr1_1143203_C_T_b38	PLEKHN1	-3.219	0.00135	-0.054205	3	0.016837	yes	WHLBLD
chr1_1758687_A_AAC_b38	PLEKHN1	-3.205	0.00142	-0.043381	18	0.013536	yes	WHLBLD
chr1_1949036_C_CTCCT_b38	PLEKHN1	3.185	0.00152	0.051301	8	0.016108	yes	WHLBLD
chr1_1530585_T_G_b38	PLEKHN1	3.178	0.00156	0.066573	8	0.020948	yes	WHLBLD
chr1_1730989_A_G_b38	PLEKHN1	-3.171	0.0016	-0.042247	20	0.013324	yes	WHLBLD
chr1_1735814_T_C_b38	PLEKHN1	-3.171	0.0016	-0.042247	20	0.013324	yes	WHLBLD
chr1_1740427_A_T_b38	PLEKHN1	-3.165	0.00163	-0.04206	20	0.013289	yes	WHLBLD
chr1_928131_T_C_b38	PLEKHN1	3.145	0.00174	0.031551	31	0.010031	yes	WHLBLD
chr1_1731456_A_G_b38	PLEKHN1	-3.092	0.00208	-0.041064	20	0.013279	yes	WHLBLD
chr1_1530549_G_GA_b38	PLEKHN1	3.085	0.00213	0.057699	11	0.018702	yes	WHLBLD
chr1_1530550_C_A_b38	PLEKHN1	3.085	0.00213	0.057699	11	0.018702	yes	WHLBLD
chr1_1530553_G_A_b38	PLEKHN1	3.085	0.00213	0.057699	11	0.018702	yes	WHLBLD
chr1_1530546_A_ATT_b38	PLEKHN1	3.064	0.00228	0.056675	11	0.018496	yes	WHLBLD
chr1_1742080_T_C_b38	PLEKHN1	-3.055	0.00235	-0.040749	20	0.013339	yes	WHLBLD
chr1_1757030_C_G_b38	PLEKHN1	-3.049	0.0024	-0.041783	15	0.013704	yes	WHLBLD
chr1_1474201_CT_C_b38	PLEKHN1	3.019	0.00265	0.035993	45	0.011924	yes	WHLBLD
chr1_965337_CTTAT_C_b38	PLEKHN1	3.016	0.00267	0.026966	140	0.00894	yes	WHLBLD
chr1_1630225_CGCAGCTCCCTGCTCCCCG_C_b38	PLEKHN1	3.005	0.00276	0.066142	12	0.022008	yes	WHLBLD
chr1_1732580_T_C_b38	PLEKHN1	-2.977	0.00303	-0.039992	21	0.013434	yes	WHLBLD
chr1_1530555_C_T_b38	PLEKHN1	2.949	0.00331	0.054393	11	0.018443	yes	WHLBLD
chr1_896109_C_T_b38	PLEKHN1	2.948	0.00332	0.027053	72	0.009176	yes	WHLBLD
chr1_1650405_G_A_b38	PLEKHN1	2.946	0.00334	0.047683	19	0.016184	yes	WHLBLD
chr1_1756753_A_G_b38	PLEKHN1	-2.945	0.00336	-0.038741	37	0.013156	yes	WHLBLD
chr1_985123_G_A_b38	PLEKHN1	-2.931	0.00351	-0.033879	13	0.01156	yes	WHLBLD
chr1_1734301_T_C_b38	PLEKHN1	-2.904	0.00381	-0.039136	19	0.013474	yes	WHLBLD
chr1_1961960_C_G_b38	PLEKHN1	2.902	0.00385	0.077904	4	0.026847	yes	WHLBLD
chr1_1950139_G_A_b38	PLEKHN1	2.9	0.00387	0.094009	3	0.032422	yes	WHLBLD
chr1_1964118_C_T_b38	PLEKHN1	2.894	0.00394	0.07184	6	0.02482	yes	WHLBLD
chr1_960891_C_T_b38	PLEKHN1	2.893	0.00396	0.024979	150	0.008635	yes	WHLBLD
chr1_1963619_C_A_b38	PLEKHN1	2.887	0.00403	0.070408	7	0.024385	yes	WHLBLD
chr1_1492939_C_CA_b38	PLEKHN1	2.877	0.00415	0.04418	19	0.015355	yes	WHLBLD
chr1_758207_C_G_b38	PLEKHN1	2.869	0.00427	0.093908	4	0.032737	yes	WHLBLD
chr1_1454587_T_C_b38	PLEKHN1	2.86	0.00438	0.064645	6	0.022603	yes	WHLBLD
chr1_1675132_A_G_b38	PLEKHN1	-2.846	0.00458	-0.02502	86	0.008792	yes	WHLBLD
chr1_899452_G_C_b38	PLEKHN1	-2.829	0.00482	-0.026432	50	0.009342	yes	WHLBLD
chr1_1454581_T_C_b38	PLEKHN1	2.816	0.00503	0.063869	6	0.022682	yes	WHLBLD
chr1_1454582_A_C_b38	PLEKHN1	2.816	0.00503	0.063869	6	0.022682	yes	WHLBLD
chr1_1662738_CT_C_b38	PLEKHN1	2.811	0.0051	0.038201	38	0.013589	yes	WHLBLD
chr1_1502507_A_T_b38	PLEKHN1	2.81	0.00512	0.059763	5	0.02127	yes	WHLBLD
chr1_1409847_G_T_b38	PLEKHN1	2.803	0.00523	0.05374	5	0.019172	yes	WHLBLD
chr1_969663_CAT_C_b38	PLEKHN1	-2.802	0.00525	-0.027102	37	0.009673	yes	WHLBLD
chr1_29571_G_C_b38	PLEKHN1	-2.797	0.00532	-0.032508	10	0.01162	yes	WHLBLD
chr1_1729196_T_G_b38	PLEKHN1	-2.787	0.00548	-0.037992	17	0.01363	yes	WHLBLD
chr1_1675228_C_CG_b38	PLEKHN1	-2.781	0.00559	-0.02445	104	0.008792	yes	WHLBLD
chr1_1457919_C_A_b38	PLEKHN1	2.78	0.00561	0.056073	12	0.020173	yes	WHLBLD
chr1_928128_G_T_b38	PLEKHN1	2.777	0.00566	0.036169	20	0.013024	yes	WHLBLD
chr1_1459391_A_G_b38	PLEKHN1	2.764	0.00589	0.054953	13	0.019884	yes	WHLBLD
chr1_1662855_T_C_b38	PLEKHN1	2.756	0.00603	0.036978	39	0.013418	yes	WHLBLD
chr1_1459357_C_A_b38	PLEKHN1	2.743	0.00627	0.054099	13	0.019722	yes	WHLBLD
chr1_1469429_A_G_b38	PLEKHN1	2.73	0.00653	0.038896	44	0.01425	yes	WHLBLD
chr1_897376_T_G_b38	PLEKHN1	-2.724	0.00664	-0.02414	65	0.008863	yes	WHLBLD
chr1_1950299_A_G_b38	PLEKHN1	2.721	0.0067	0.085212	3	0.031316	yes	WHLBLD
chr1_1951351_C_T_b38	PLEKHN1	2.721	0.0067	0.085212	3	0.031316	yes	WHLBLD
chr1_1020855_G_GGC_b38	PLEKHN1	-2.72	0.00671	-0.066235	4	0.024348	yes	WHLBLD
chr1_1960047_A_G_b38	PLEKHN1	-2.718	0.00676	-0.071852	5	0.026438	yes	WHLBLD
chr1_1454579_T_C_b38	PLEKHN1	2.713	0.00687	0.061857	6	0.022804	yes	WHLBLD
chr1_1460370_T_C_b38	PLEKHN1	2.706	0.00701	0.052876	13	0.019542	yes	WHLBLD
chr1_1533095_G_A_b38	PLEKHN1	2.705	0.00702	0.047756	25	0.017653	yes	WHLBLD
chr1_15045_C_T_b38	PLEKHN1	2.691	0.00733	0.029059	23	0.0108	yes	WHLBLD
chr1_1163334_C_G_b38	PLEKHN1	-2.678	0.00761	-0.022232	138	0.008303	yes	WHLBLD
chr1_1735932_A_G_b38	PLEKHN1	-2.677	0.00762	-0.035762	18	0.013357	yes	WHLBLD
chr1_898444_T_C_b38	PLEKHN1	-2.673	0.00772	-0.02478	52	0.009271	yes	WHLBLD
chr1_1670423_AT_A_b38	PLEKHN1	-2.667	0.00786	-0.025912	77	0.009716	yes	WHLBLD
chr1_180904_T_TA_b38	PLEKHN1	-2.661	0.00799	-0.054636	8	0.020529	yes	WHLBLD
chr1_897843_C_T_b38	PLEKHN1	-2.657	0.0081	-0.024631	52	0.009271	yes	WHLBLD
chr1_897922_C_T_b38	PLEKHN1	-2.657	0.0081	-0.024631	52	0.009271	yes	WHLBLD
chr1_1138954_G_A_b38	PLEKHN1	-2.656	0.00811	-0.044665	3	0.016814	yes	WHLBLD
chr1_1107439_G_A_b38	PLEKHN1	-2.653	0.00818	-0.048275	3	0.018195	yes	WHLBLD
chr1_1454676_T_A_b38	PLEKHN1	2.648	0.0083	0.056898	7	0.021485	yes	WHLBLD
chr1_1027340_C_T_b38	PLEKHN1	-2.648	0.00832	-0.032732	11	0.012362	yes	WHLBLD
chr1_1496953_T_C_b38	PLEKHN1	2.647	0.00834	0.033775	48	0.012761	yes	WHLBLD
chr1_1074660_C_T_b38	PLEKHN1	-2.619	0.00904	-0.045134	5	0.017234	yes	WHLBLD
chr1_896529_C_T_b38	PLEKHN1	2.614	0.00916	0.02305	72	0.008817	yes	WHLBLD
chr1_1157209_G_A_b38	PLEKHN1	2.613	0.0092	0.04827	6	0.018472	yes	WHLBLD
chr1_1471144_G_C_b38	PLEKHN1	2.609	0.0093	0.037506	44	0.014373	yes	WHLBLD
chr1_1470034_T_C_b38	PLEKHN1	2.602	0.0095	0.037199	44	0.014296	yes	WHLBLD
chr1_1001870_C_G_b38	PLEKHN1	-2.597	0.00964	-0.028234	17	0.010873	yes	WHLBLD
chr1_1163041_C_T_b38	PLEKHN1	-2.588	0.00989	-0.021708	150	0.008388	yes	WHLBLD
chr1_1137230_T_G_b38	PLEKHN1	-2.588	0.00989	-0.042716	4	0.016506	yes	WHLBLD
chr1_962358_C_T_b38	PLEKHN1	-5.139	3.73e-07	-0.079749	7	0.015517	no	WHLBLD
chr1_962184_T_C_b38	PLEKHN1	4.994	7.78e-07	0.077351	7	0.01549	no	WHLBLD
chr1_966227_C_G_b38	PLEKHN1	4.975	8.53e-07	0.073581	14	0.01479	no	WHLBLD
chr1_961945_G_C_b38	PLEKHN1	4.942	1.01e-06	0.072894	10	0.01475	no	WHLBLD
chr1_950296_C_A_b38	PLEKHN1	4.882	1.35e-06	0.080799	4	0.016551	no	WHLBLD
chr1_952180_A_C_b38	PLEKHN1	4.882	1.35e-06	0.080799	4	0.016551	no	WHLBLD
chr1_949046_A_AACAGCAAAG_b38	PLEKHN1	4.868	1.44e-06	0.075863	7	0.015584	no	WHLBLD
chr1_954258_G_C_b38	PLEKHN1	4.843	1.63e-06	0.076608	5	0.015818	no	WHLBLD
chr1_954333_C_A_b38	PLEKHN1	4.791	2.09e-06	0.075628	5	0.015784	no	WHLBLD
chr1_953778_G_C_b38	PLEKHN1	4.671	3.71e-06	0.078992	4	0.016912	no	WHLBLD
chr1_953779_A_C_b38	PLEKHN1	4.671	3.71e-06	0.078992	4	0.016912	no	WHLBLD
chr1_958251_A_G_b38	PLEKHN1	4.575	5.8e-06	0.071541	6	0.015639	no	WHLBLD
chr1_942335_C_G_b38	PLEKHN1	4.486	8.7e-06	0.067757	8	0.015104	no	WHLBLD
chr1_955641_G_A_b38	PLEKHN1	4.479	8.97e-06	0.073748	3	0.016464	no	WHLBLD
chr1_950669_ACAG_A_b38	PLEKHN1	4.282	2.15e-05	0.063851	10	0.01491	no	WHLBLD
chr1_965643_T_C_b38	PLEKHN1	4.103	4.64e-05	0.069298	3	0.016888	no	WHLBLD
chr1_1219702_C_G_b38	PLEKHN1	4.017	6.64e-05	0.107063	4	0.026651	no	WHLBLD
chr1_967376_AC_A_b38	PLEKHN1	3.926	9.63e-05	0.055228	6	0.014066	no	WHLBLD
chr1_1297194_CGT_C_b38	PLEKHN1	3.889	0.000112	0.124402	3	0.031991	no	WHLBLD
chr1_967369_C_G_b38	PLEKHN1	3.657	0.000277	0.059376	5	0.016234	no	WHLBLD
chr1_613558_C_T_b38	PLEKHN1	3.634	0.000303	0.090397	3	0.024876	no	WHLBLD
chr1_596671_A_C_b38	PLEKHN1	3.559	0.000402	0.119886	3	0.033685	no	WHLBLD
chr1_958339_G_A_b38	PLEKHN1	3.53	0.000448	0.05147	10	0.014582	no	WHLBLD
chr1_1485282_A_G_b38	PLEKHN1	3.404	0.000709	0.067728	13	0.019898	no	WHLBLD
chr1_973929_T_C_b38	PLEKHN1	-3.273	0.00113	-0.032767	28	0.010011	no	WHLBLD
chr1_1285621_A_G_b38	PLEKHN1	3.141	0.00177	0.084952	4	0.027048	no	WHLBLD
chr1_973443_G_A_b38	PLEKHN1	-3.135	0.0018	-0.032689	25	0.010426	no	WHLBLD
chr1_1663513_C_T_b38	PLEKHN1	3.096	0.00206	0.065507	16	0.021161	no	WHLBLD
chr1_1154319_G_A_b38	PLEKHN1	3.068	0.00225	0.083399	4	0.027185	no	WHLBLD
chr1_1154450_A_G_b38	PLEKHN1	3.068	0.00225	0.083399	4	0.027185	no	WHLBLD
chr1_1156196_A_C_b38	PLEKHN1	3.068	0.00225	0.083399	4	0.027185	no	WHLBLD
chr1_1156768_G_C_b38	PLEKHN1	3.068	0.00225	0.083399	4	0.027185	no	WHLBLD
chr1_1156790_G_C_b38	PLEKHN1	3.068	0.00225	0.083399	4	0.027185	no	WHLBLD
chr1_1500729_G_A_b38	PLEKHN1	3.035	0.00251	0.049325	34	0.016253	no	WHLBLD
chr1_967724_C_T_b38	PLEKHN1	2.975	0.00305	0.04803	22	0.016147	no	WHLBLD
chr1_1280332_C_T_b38	PLEKHN1	2.953	0.00327	0.047381	10	0.016047	no	WHLBLD
chr1_1102614_T_TAA_b38	PLEKHN1	-2.931	0.0035	-0.077466	5	0.026426	no	WHLBLD
chr1_280674_A_G_b38	PLEKHN1	2.913	0.00371	0.03833	4	0.013157	no	WHLBLD
chr1_896917_CTG_C_b38	PLEKHN1	2.875	0.00419	0.025329	69	0.008811	no	WHLBLD
chr1_896938_C_A_b38	PLEKHN1	2.875	0.00419	0.025329	69	0.008811	no	WHLBLD
chr1_897792_T_TCGAA_b38	PLEKHN1	-2.875	0.00419	-0.025329	69	0.008811	no	WHLBLD
chr1_896680_G_A_b38	PLEKHN1	2.862	0.00436	0.025253	69	0.008824	no	WHLBLD
chr1_896686_G_C_b38	PLEKHN1	2.862	0.00436	0.025253	69	0.008824	no	WHLBLD
chr1_896732_T_C_b38	PLEKHN1	2.862	0.00436	0.025253	69	0.008824	no	WHLBLD
chr1_896798_A_G_b38	PLEKHN1	2.816	0.00503	0.024866	69	0.008831	no	WHLBLD
chr1_1081152_A_AG_b38	PLEKHN1	-2.804	0.00521	-0.076524	4	0.02729	no	WHLBLD
chr1_1061514_C_G_b38	PLEKHN1	2.762	0.00593	0.078153	3	0.028299	no	WHLBLD
chr1_1460021_C_CTG_b38	PLEKHN1	2.756	0.00603	0.039581	28	0.014363	no	WHLBLD
chr1_1460022_CAG_C_b38	PLEKHN1	2.756	0.00603	0.039581	28	0.014363	no	WHLBLD
chr1_897538_T_C_b38	PLEKHN1	-2.728	0.00656	-0.024068	71	0.008824	no	WHLBLD
chr1_1614340_C_T_b38	PLEKHN1	-2.715	0.00681	-0.03388	11	0.012477	no	WHLBLD
chr1_971790_AG_A_b38	PLEKHN1	-2.685	0.00745	-0.022228	98	0.008278	no	WHLBLD
chr1_904478_CGCCTCCTCCGAACGCGGCCGCCTCCTCCTCCGAACGTGGCCTCCTCCGAACGCGGCCGCCTCCTCCTCCGAACGCGGCCGCCTCCTCCTCCGAACGTG_C_b38	PLEKHN1	-2.678	0.00761	-0.028324	19	0.010578	no	WHLBLD
chr1_1468094_G_C_b38	PLEKHN1	2.665	0.0079	0.038948	19	0.014613	no	WHLBLD
chr1_1468062_A_T_b38	PLEKHN1	2.661	0.00799	0.05188	8	0.019495	no	WHLBLD
chr1_733845_C_CT_b38	PLEKHN1	2.625	0.00889	0.068541	7	0.026114	no	WHLBLD
chr1_1050063_AG_A_b38	PLEKHN1	-2.597	0.00962	-0.022383	132	0.008617	no	WHLBLD

---

Filters:      p-Values >= and <=      Betas >= and <=      Statistic >= and <=      Carriers >= and <=
Positions: left right     Zoom: PLEKHN1     Other:     -      +     reset     eQTLs Region
Draw    p-Value Beta Statistic Carriers Beta/sd(t)     Scaling     Sign (red=+, blue-)     Colors: Tissue Sign