RASGRP3 - RAS guanyl releasing protein 3 - 2p22.3

Snps	Gene	Statistic	Pvalue	Beta	Carriers	Beta_se	Linear	Tissue
chr2_33557844_G_A_b38	RASGRP3	8.071	5.06e-15	0.193871	13	0.024022	yes	ADPSBQ
chr2_33537896_A_G_b38	RASGRP3	8.051	5.81e-15	0.205337	8	0.025503	yes	ADPSBQ
chr2_33557635_G_A_b38	RASGRP3	7.905	1.66e-14	0.197671	9	0.025004	yes	ADPSBQ
chr2_33531453_C_T_b38	RASGRP3	7.896	1.77e-14	0.197703	10	0.025037	yes	ADPSBQ
chr2_33529269_C_A_b38	RASGRP3	7.859	2.32e-14	0.193875	11	0.02467	yes	ADPSBQ
chr2_33559304_G_A_b38	RASGRP3	7.811	3.25e-14	0.196637	9	0.025174	yes	ADPSBQ
chr2_33526597_C_T_b38	RASGRP3	7.803	3.45e-14	0.197449	9	0.025305	yes	ADPSBQ
chr2_33527062_GC_G_b38	RASGRP3	7.803	3.45e-14	0.197449	9	0.025305	yes	ADPSBQ
chr2_33559734_G_A_b38	RASGRP3	7.73	5.76e-14	0.193861	9	0.025078	yes	ADPSBQ
chr2_33536526_G_A_b38	RASGRP3	7.642	1.07e-13	0.20624	5	0.026989	yes	ADPSBQ
chr2_33536528_G_A_b38	RASGRP3	7.642	1.07e-13	0.20624	5	0.026989	yes	ADPSBQ
chr2_33559068_A_G_b38	RASGRP3	7.623	1.22e-13	0.19752	7	0.02591	yes	ADPSBQ
chr2_33550216_T_A_b38	RASGRP3	7.398	5.72e-13	0.190726	9	0.02578	yes	ADPSBQ
chr2_33550484_C_G_b38	RASGRP3	7.321	9.64e-13	0.189368	9	0.025866	yes	ADPSBQ
chr2_33552022_CAAACA_C_b38	RASGRP3	7.246	1.6e-12	0.189122	8	0.0261	yes	ADPSBQ
chr2_33551676_A_G_b38	RASGRP3	7.229	1.78e-12	0.191028	7	0.026424	yes	ADPSBQ
chr2_33551697_A_T_b38	RASGRP3	7.229	1.78e-12	0.191028	7	0.026424	yes	ADPSBQ
chr2_33554542_A_G_b38	RASGRP3	7.156	2.91e-12	0.185797	9	0.025964	yes	ADPSBQ
chr2_33548469_T_C_b38	RASGRP3	7.058	5.53e-12	0.184929	8	0.0262	yes	ADPSBQ
chr2_33553995_C_T_b38	RASGRP3	6.683	6.14e-11	0.174658	9	0.026134	yes	ADPSBQ
chr2_33537330_C_CCCAACACA_b38	RASGRP3	6.58	1.17e-10	0.15325	26	0.023291	yes	ADPSBQ
chr2_33548762_A_G_b38	RASGRP3	6.486	2.09e-10	0.177731	6	0.027404	yes	ADPSBQ
chr2_33537192_G_GAT_b38	RASGRP3	6.484	2.11e-10	0.164856	7	0.025423	yes	ADPSBQ
chr2_33539987_GAAAAA_G_b38	RASGRP3	6.472	2.27e-10	0.189294	6	0.029247	yes	ADPSBQ
chr2_33561445_C_A_b38	RASGRP3	6.454	2.54e-10	0.134273	28	0.020805	yes	ADPSBQ
chr2_33546942_C_G_b38	RASGRP3	6.406	3.4e-10	0.16631	10	0.025961	yes	ADPSBQ
chr2_33565263_A_G_b38	RASGRP3	6.391	3.71e-10	0.129306	44	0.020231	yes	ADPSBQ
chr2_33586869_A_T_b38	RASGRP3	6.355	4.62e-10	0.130173	31	0.020483	yes	ADPSBQ
chr2_33594385_G_A_b38	RASGRP3	6.248	8.77e-10	0.125526	38	0.02009	yes	ADPSBQ
chr2_33529318_C_T_b38	RASGRP3	6.217	1.05e-09	0.13332	20	0.021444	yes	ADPSBQ
chr2_33594326_C_T_b38	RASGRP3	6.179	1.32e-09	0.124756	38	0.020189	yes	ADPSBQ
chr2_33596963_A_T_b38	RASGRP3	6.172	1.37e-09	0.124895	38	0.020235	yes	ADPSBQ
chr2_33512177_G_A_b38	RASGRP3	6.04	2.98e-09	0.139813	21	0.023148	yes	ADPSBQ
chr2_33596617_C_T_b38	RASGRP3	5.921	5.9e-09	0.120558	37	0.020363	yes	ADPSBQ
chr2_33581561_C_T_b38	RASGRP3	5.828	9.96e-09	0.117902	36	0.020231	yes	ADPSBQ
chr2_33582025_C_T_b38	RASGRP3	5.75	1.54e-08	0.116195	35	0.020209	yes	ADPSBQ
chr2_33590881_T_C_b38	RASGRP3	5.71	1.92e-08	0.107125	48	0.018761	yes	ADPSBQ
chr2_33589264_G_C_b38	RASGRP3	5.668	2.43e-08	0.106753	49	0.018836	yes	ADPSBQ
chr2_33622160_C_T_b38	RASGRP3	5.663	2.49e-08	0.110159	47	0.019453	yes	ADPSBQ
chr2_33540561_TGTGTGTGTGTG_T_b38	RASGRP3	5.65	2.67e-08	0.14265	17	0.025248	yes	ADPSBQ
chr2_33640631_A_C_b38	RASGRP3	5.622	3.11e-08	0.114574	28	0.020378	yes	ADPSBQ
chr2_33596450_T_G_b38	RASGRP3	5.61	3.32e-08	0.106009	49	0.018897	yes	ADPSBQ
chr2_33555164_G_A_b38	RASGRP3	5.59	3.69e-08	0.119621	25	0.021397	yes	ADPSBQ
chr2_33641397_G_C_b38	RASGRP3	5.472	6.98e-08	0.111713	28	0.020415	yes	ADPSBQ
chr2_33639021_G_A_b38	RASGRP3	5.381	1.13e-07	0.109845	28	0.020415	yes	ADPSBQ
chr2_33657078_T_C_b38	RASGRP3	5.333	1.46e-07	0.104664	49	0.019627	yes	ADPSBQ
chr2_33523649_G_A_b38	RASGRP3	5.303	1.7e-07	0.116331	23	0.021937	yes	ADPSBQ
chr2_33656248_TTC_T_b38	RASGRP3	5.294	1.78e-07	0.10867	28	0.020527	yes	ADPSBQ
chr2_33652477_C_A_b38	RASGRP3	5.292	1.8e-07	0.108802	28	0.020558	yes	ADPSBQ
chr2_33650021_A_G_b38	RASGRP3	5.266	2.06e-07	0.108148	28	0.020538	yes	ADPSBQ
chr2_33525341_A_AAT_b38	RASGRP3	5.207	2.79e-07	0.109307	31	0.020994	yes	ADPSBQ
chr2_33556928_C_CACACACATACAT_b38	RASGRP3	5.184	3.14e-07	0.132206	6	0.025505	yes	ADPSBQ
chr2_33670716_C_T_b38	RASGRP3	5.156	3.62e-07	0.102765	34	0.019932	yes	ADPSBQ
chr2_33656848_TA_T_b38	RASGRP3	5.15	3.72e-07	0.101881	44	0.019782	yes	ADPSBQ
chr2_33622592_T_C_b38	RASGRP3	5.115	4.45e-07	0.097043	59	0.018973	yes	ADPSBQ
chr2_33621819_C_A_b38	RASGRP3	4.965	9.39e-07	0.092092	60	0.018548	yes	ADPSBQ
chr2_33623108_T_C_b38	RASGRP3	4.927	1.13e-06	0.092407	60	0.018754	yes	ADPSBQ
chr2_33662459_C_T_b38	RASGRP3	4.82	1.89e-06	0.098797	30	0.020496	yes	ADPSBQ
chr2_33663555_T_C_b38	RASGRP3	4.817	1.92e-06	0.098589	30	0.020466	yes	ADPSBQ
chr2_33521266_C_T_b38	RASGRP3	4.722	3.02e-06	0.096088	39	0.020349	yes	ADPSBQ
chr2_33563965_A_G_b38	RASGRP3	4.675	3.77e-06	0.115107	13	0.024621	yes	ADPSBQ
chr2_33667549_A_G_b38	RASGRP3	4.522	7.63e-06	0.11808	11	0.026113	yes	ADPSBQ
chr2_33667555_A_G_b38	RASGRP3	4.522	7.63e-06	0.11808	11	0.026113	yes	ADPSBQ
chr2_33631243_G_GT_b38	RASGRP3	4.454	1.04e-05	0.116867	10	0.02624	yes	ADPSBQ
chr2_33547053_GAA_G_b38	RASGRP3	4.444	1.09e-05	0.149979	6	0.033751	yes	ADPSBQ
chr2_33627793_A_G_b38	RASGRP3	4.417	1.22e-05	0.113209	11	0.025631	yes	ADPSBQ
chr2_33592302_T_C_b38	RASGRP3	4.395	1.35e-05	0.157327	4	0.035794	yes	ADPSBQ
chr2_33640513_G_C_b38	RASGRP3	4.387	1.4e-05	0.114015	10	0.025992	yes	ADPSBQ
chr2_33626436_A_T_b38	RASGRP3	4.381	1.44e-05	0.083659	53	0.019097	yes	ADPSBQ
chr2_33581900_A_T_b38	RASGRP3	4.378	1.45e-05	0.108601	13	0.024806	yes	ADPSBQ
chr2_33659035_G_A_b38	RASGRP3	4.352	1.63e-05	0.114662	10	0.026347	yes	ADPSBQ
chr2_33661156_C_T_b38	RASGRP3	4.349	1.66e-05	0.084356	40	0.019399	yes	ADPSBQ
chr2_33661310_C_T_b38	RASGRP3	4.349	1.66e-05	0.084356	40	0.019399	yes	ADPSBQ
chr2_33636858_C_G_b38	RASGRP3	4.348	1.66e-05	0.113105	11	0.026015	yes	ADPSBQ
chr2_33637736_A_T_b38	RASGRP3	4.348	1.66e-05	0.113105	11	0.026015	yes	ADPSBQ
chr2_33581338_T_A_b38	RASGRP3	4.336	1.75e-05	0.107405	13	0.02477	yes	ADPSBQ
chr2_33656916_G_A_b38	RASGRP3	4.289	2.15e-05	0.08172	59	0.019054	yes	ADPSBQ
chr2_33565010_T_TACACACACAC_b38	RASGRP3	4.261	2.42e-05	0.128976	3	0.030266	yes	ADPSBQ
chr2_33634816_G_T_b38	RASGRP3	4.235	2.72e-05	0.110265	11	0.026039	yes	ADPSBQ
chr2_33634524_A_G_b38	RASGRP3	4.176	3.49e-05	0.109107	11	0.026129	yes	ADPSBQ
chr2_33624881_G_GT_b38	RASGRP3	4.168	3.62e-05	0.080769	50	0.01938	yes	ADPSBQ
chr2_33573675_A_G_b38	RASGRP3	4.155	3.82e-05	0.156033	3	0.037558	yes	ADPSBQ
chr2_33557001_G_GA_b38	RASGRP3	4.013	6.9e-05	0.166174	3	0.041411	yes	ADPSBQ
chr2_33561192_A_G_b38	RASGRP3	3.941	9.26e-05	0.066714	124	0.016929	yes	ADPSBQ
chr2_33523461_TA_T_b38	RASGRP3	3.91	0.000105	0.089287	14	0.022837	yes	ADPSBQ
chr2_33532487_C_A_b38	RASGRP3	3.89	0.000114	0.064413	148	0.016559	yes	ADPSBQ
chr2_33571267_T_A_b38	RASGRP3	-3.869	0.000124	-0.067074	100	0.017337	yes	ADPSBQ
chr2_33647687_C_CA_b38	RASGRP3	3.857	0.000129	0.087905	31	0.02279	yes	ADPSBQ
chr2_33613720_G_A_b38	RASGRP3	3.793	0.000167	0.094545	15	0.024929	yes	ADPSBQ
chr2_33564467_A_G_b38	RASGRP3	3.769	0.000183	0.068905	82	0.018284	yes	ADPSBQ
chr2_33564001_C_G_b38	RASGRP3	3.766	0.000185	0.068447	80	0.018176	yes	ADPSBQ
chr2_33579727_C_T_b38	RASGRP3	3.754	0.000194	0.135096	4	0.035988	yes	ADPSBQ
chr2_33511010_G_A_b38	RASGRP3	3.731	0.000212	0.11359	9	0.030443	yes	ADPSBQ
chr2_33569371_A_G_b38	RASGRP3	-3.676	0.000263	-0.064205	102	0.017468	yes	ADPSBQ
chr2_33508447_C_T_b38	RASGRP3	3.577	0.000381	0.111598	4	0.031199	yes	ADPSBQ
chr2_33587735_T_A_b38	RASGRP3	3.564	4e-04	0.064342	66	0.018054	yes	ADPSBQ
chr2_33571342_T_C_b38	RASGRP3	-3.553	0.000416	-0.061663	103	0.017354	yes	ADPSBQ
chr2_33514230_T_G_b38	RASGRP3	3.552	0.000417	0.08022	23	0.022583	yes	ADPSBQ
chr2_33605562_C_G_b38	RASGRP3	3.55	0.000421	0.066024	56	0.0186	yes	ADPSBQ
chr2_33572204_C_A_b38	RASGRP3	-3.547	0.000425	-0.062075	101	0.0175	yes	ADPSBQ
chr2_33582793_C_G_b38	RASGRP3	3.544	0.00043	0.063799	66	0.018	yes	ADPSBQ
chr2_33567745_C_T_b38	RASGRP3	-3.524	0.000463	-0.062059	90	0.017609	yes	ADPSBQ
chr2_33518114_A_G_b38	RASGRP3	-3.507	0.000494	-0.061519	75	0.017544	yes	ADPSBQ
chr2_33601894_C_G_b38	RASGRP3	3.497	0.000511	0.063512	65	0.01816	yes	ADPSBQ
chr2_33604404_G_GTA_b38	RASGRP3	3.448	0.000611	0.091344	6	0.026489	yes	ADPSBQ
chr2_33514489_T_C_b38	RASGRP3	-3.419	0.000678	-0.057061	96	0.016688	yes	ADPSBQ
chr2_33598472_A_C_b38	RASGRP3	3.4	0.000725	0.064269	48	0.0189	yes	ADPSBQ
chr2_33571586_T_C_b38	RASGRP3	-3.4	0.000727	-0.056975	127	0.016758	yes	ADPSBQ
chr2_32961194_A_G_b38	RASGRP3	3.393	0.000745	0.062193	65	0.01833	yes	ADPSBQ
chr2_33568339_TA_T_b38	RASGRP3	-3.377	0.000789	-0.05905	109	0.017487	yes	ADPSBQ
chr2_33060651_CTG_C_b38	RASGRP3	3.372	0.000804	0.087533	10	0.025963	yes	ADPSBQ
chr2_33602942_T_C_b38	RASGRP3	3.369	0.00081	0.096275	4	0.028573	yes	ADPSBQ
chr2_33591518_C_T_b38	RASGRP3	3.369	0.000812	0.06407	48	0.019018	yes	ADPSBQ
chr2_33672387_A_G_b38	RASGRP3	3.364	0.000826	0.077596	20	0.023067	yes	ADPSBQ
chr2_33620497_T_C_b38	RASGRP3	3.35	0.000867	0.074557	22	0.022253	yes	ADPSBQ
chr2_32902717_C_T_b38	RASGRP3	-3.348	0.000874	-0.115467	4	0.034489	yes	ADPSBQ
chr2_33519891_C_T_b38	RASGRP3	-3.346	0.000879	-0.058163	91	0.017381	yes	ADPSBQ
chr2_33669574_A_G_b38	RASGRP3	3.343	0.000891	0.078325	18	0.023433	yes	ADPSBQ
chr2_33038840_T_G_b38	RASGRP3	-3.333	0.00092	-0.061151	53	0.018345	yes	ADPSBQ
chr2_33038849_A_G_b38	RASGRP3	-3.333	0.00092	-0.061151	53	0.018345	yes	ADPSBQ
chr2_33575950_G_A_b38	RASGRP3	-3.306	0.00101	-0.05821	94	0.01761	yes	ADPSBQ
chr2_33615450_C_G_b38	RASGRP3	3.304	0.00102	0.090353	6	0.027346	yes	ADPSBQ
chr2_33330787_G_A_b38	RASGRP3	3.297	0.00105	0.057263	83	0.01737	yes	ADPSBQ
chr2_33615793_A_T_b38	RASGRP3	3.282	0.0011	0.089559	6	0.027284	yes	ADPSBQ
chr2_33621944_G_A_b38	RASGRP3	3.25	0.00123	0.088629	6	0.027275	yes	ADPSBQ
chr2_33623483_C_T_b38	RASGRP3	3.25	0.00123	0.088629	6	0.027275	yes	ADPSBQ
chr2_33634843_C_CTT_b38	RASGRP3	3.227	0.00133	0.092822	11	0.028767	yes	ADPSBQ
chr2_33007243_A_T_b38	RASGRP3	-3.214	0.00139	-0.059947	71	0.01865	yes	ADPSBQ
chr2_33669427_A_C_b38	RASGRP3	3.214	0.00139	0.075544	19	0.023506	yes	ADPSBQ
chr2_33068673_G_C_b38	RASGRP3	-3.2	0.00146	-0.068224	42	0.021322	yes	ADPSBQ
chr2_32991192_C_A_b38	RASGRP3	3.193	0.00149	0.087061	6	0.027264	yes	ADPSBQ
chr2_33007962_T_C_b38	RASGRP3	-3.171	0.00161	-0.059187	70	0.018666	yes	ADPSBQ
chr2_33620575_G_A_b38	RASGRP3	3.159	0.00168	0.070513	22	0.02232	yes	ADPSBQ
chr2_33645468_G_C_b38	RASGRP3	3.158	0.00168	0.060801	49	0.019254	yes	ADPSBQ
chr2_33614709_C_CTGTT_b38	RASGRP3	3.155	0.0017	0.063672	36	0.020181	yes	ADPSBQ
chr2_33637426_T_A_b38	RASGRP3	3.153	0.00171	0.070125	24	0.022237	yes	ADPSBQ
chr2_33036306_T_C_b38	RASGRP3	-3.145	0.00176	-0.055255	67	0.017567	yes	ADPSBQ
chr2_33512820_T_A_b38	RASGRP3	-3.145	0.00176	-0.05448	81	0.017325	yes	ADPSBQ
chr2_32957368_G_T_b38	RASGRP3	-3.137	0.00181	-0.057719	75	0.018401	yes	ADPSBQ
chr2_33610975_T_G_b38	RASGRP3	3.129	0.00186	0.064899	33	0.020744	yes	ADPSBQ
chr2_33612720_T_G_b38	RASGRP3	3.129	0.00186	0.064899	33	0.020744	yes	ADPSBQ
chr2_33602361_A_C_b38	RASGRP3	3.102	0.00203	0.053136	104	0.017131	yes	ADPSBQ
chr2_33023258_A_G_b38	RASGRP3	3.093	0.00209	0.067007	22	0.021661	yes	ADPSBQ
chr2_33508652_C_G_b38	RASGRP3	3.093	0.00209	0.056402	71	0.018237	yes	ADPSBQ
chr2_33636091_C_T_b38	RASGRP3	3.066	0.00229	0.059696	48	0.019473	yes	ADPSBQ
chr2_33607432_G_A_b38	RASGRP3	3.05	0.00241	0.083991	6	0.027537	yes	ADPSBQ
chr2_33614844_A_G_b38	RASGRP3	3.046	0.00244	0.05706	57	0.018731	yes	ADPSBQ
chr2_33530852_CT_C_b38	RASGRP3	3.046	0.00244	0.051723	108	0.016981	yes	ADPSBQ
chr2_33591739_A_G_b38	RASGRP3	3.045	0.00245	0.058376	47	0.019173	yes	ADPSBQ
chr2_33577889_G_A_b38	RASGRP3	-3.039	0.0025	-0.054094	96	0.017801	yes	ADPSBQ
chr2_33534694_ATT_A_b38	RASGRP3	-3.031	0.00256	-0.087505	4	0.028869	yes	ADPSBQ
chr2_33592814_T_C_b38	RASGRP3	3.02	0.00265	0.057622	47	0.019079	yes	ADPSBQ
chr2_32891490_G_C_b38	RASGRP3	-3.015	0.0027	-0.05826	39	0.019322	yes	ADPSBQ
chr2_32964838_C_T_b38	RASGRP3	3.014	0.0027	0.082665	6	0.027423	yes	ADPSBQ
chr2_32989251_G_A_b38	RASGRP3	3.011	0.00274	0.082192	6	0.0273	yes	ADPSBQ
chr2_33601612_AT_A_b38	RASGRP3	3.002	0.00282	0.057177	50	0.019048	yes	ADPSBQ
chr2_33661861_G_A_b38	RASGRP3	-3.001	0.00282	-0.050341	124	0.016773	yes	ADPSBQ
chr2_33535943_T_C_b38	RASGRP3	-2.999	0.00284	-0.073233	13	0.024418	yes	ADPSBQ
chr2_33584227_A_G_b38	RASGRP3	2.995	0.00288	0.062092	32	0.020735	yes	ADPSBQ
chr2_33512902_A_G_b38	RASGRP3	-2.994	0.00289	-0.051741	120	0.017284	yes	ADPSBQ
chr2_33042796_T_C_b38	RASGRP3	2.992	0.00291	0.079502	8	0.026573	yes	ADPSBQ
chr2_33543901_C_G_b38	RASGRP3	-2.99	0.00292	-0.053182	82	0.017786	yes	ADPSBQ
chr2_33515662_T_C_b38	RASGRP3	2.982	0.003	0.071754	18	0.024063	yes	ADPSBQ
chr2_33605252_A_G_b38	RASGRP3	2.974	0.00308	0.056561	48	0.019021	yes	ADPSBQ
chr2_33590317_T_G_b38	RASGRP3	2.965	0.00317	0.061157	33	0.020624	yes	ADPSBQ
chr2_32962672_T_C_b38	RASGRP3	-2.964	0.00318	-0.054694	76	0.018453	yes	ADPSBQ
chr2_32963401_A_G_b38	RASGRP3	-2.964	0.00318	-0.054694	76	0.018453	yes	ADPSBQ
chr2_33525341_AAT_A_b38	RASGRP3	-2.949	0.00333	-0.075977	9	0.02576	yes	ADPSBQ
chr2_32978183_C_T_b38	RASGRP3	2.947	0.00335	0.081698	6	0.027719	yes	ADPSBQ
chr2_32984125_G_T_b38	RASGRP3	2.947	0.00335	0.081698	6	0.027719	yes	ADPSBQ
chr2_32987215_A_G_b38	RASGRP3	2.947	0.00335	0.081698	6	0.027719	yes	ADPSBQ
chr2_32987876_C_T_b38	RASGRP3	2.947	0.00335	0.081698	6	0.027719	yes	ADPSBQ
chr2_33606131_A_G_b38	RASGRP3	2.938	0.00345	0.06103	33	0.020772	yes	ADPSBQ
chr2_33065705_G_C_b38	RASGRP3	2.937	0.00347	0.076581	9	0.026077	yes	ADPSBQ
chr2_33631252_G_T_b38	RASGRP3	2.936	0.00348	0.053736	139	0.018305	yes	ADPSBQ
chr2_33611391_T_A_b38	RASGRP3	2.928	0.00356	0.05706	46	0.019486	yes	ADPSBQ
chr2_33005019_T_C_b38	RASGRP3	-2.917	0.00369	-0.051541	103	0.01767	yes	ADPSBQ
chr2_33610355_A_G_b38	RASGRP3	2.913	0.00373	0.060351	33	0.020715	yes	ADPSBQ
chr2_33610531_A_G_b38	RASGRP3	2.913	0.00373	0.060351	33	0.020715	yes	ADPSBQ
chr2_33610715_A_G_b38	RASGRP3	2.913	0.00373	0.060351	33	0.020715	yes	ADPSBQ
chr2_33618402_A_G_b38	RASGRP3	2.913	0.00373	0.060351	33	0.020715	yes	ADPSBQ
chr2_33619352_A_G_b38	RASGRP3	2.913	0.00373	0.060351	33	0.020715	yes	ADPSBQ
chr2_33620490_A_G_b38	RASGRP3	2.913	0.00373	0.060351	33	0.020715	yes	ADPSBQ
chr2_33056704_T_C_b38	RASGRP3	2.904	0.00385	0.0789	7	0.027172	yes	ADPSBQ
chr2_33056709_A_T_b38	RASGRP3	2.904	0.00385	0.0789	7	0.027172	yes	ADPSBQ
chr2_33562267_C_CT_b38	RASGRP3	2.893	0.00398	0.048358	115	0.016715	yes	ADPSBQ
chr2_33615167_A_G_b38	RASGRP3	2.893	0.00398	0.05759	40	0.01991	yes	ADPSBQ
chr2_33615349_G_C_b38	RASGRP3	2.892	0.00399	0.055676	48	0.019252	yes	ADPSBQ
chr2_33615516_T_A_b38	RASGRP3	2.892	0.00399	0.055676	48	0.019252	yes	ADPSBQ
chr2_33040081_C_T_b38	RASGRP3	2.88	0.00415	0.078104	7	0.027123	yes	ADPSBQ
chr2_33043645_C_A_b38	RASGRP3	2.88	0.00415	0.078104	7	0.027123	yes	ADPSBQ
chr2_33057846_G_A_b38	RASGRP3	2.88	0.00415	0.078104	7	0.027123	yes	ADPSBQ
chr2_33057885_G_A_b38	RASGRP3	2.88	0.00415	0.078104	7	0.027123	yes	ADPSBQ
chr2_33551040_C_T_b38	RASGRP3	-2.875	0.00421	-0.06929	15	0.024099	yes	ADPSBQ
chr2_33532968_G_A_b38	RASGRP3	-2.844	0.00463	-0.074727	9	0.026275	yes	ADPSBQ
chr2_32889140_C_CATA_b38	RASGRP3	-2.838	0.00472	-0.048247	118	0.017001	yes	ADPSBQ
chr2_32970699_C_T_b38	RASGRP3	2.827	0.00488	0.076549	7	0.027075	yes	ADPSBQ
chr2_33534062_A_C_b38	RASGRP3	-2.824	0.00493	-0.070485	10	0.024959	yes	ADPSBQ
chr2_33610078_G_C_b38	RASGRP3	2.815	0.00506	0.058322	33	0.020716	yes	ADPSBQ
chr2_33537321_C_CA_b38	RASGRP3	2.812	0.00511	0.048703	90	0.017318	yes	ADPSBQ
chr2_33047387_A_C_b38	RASGRP3	2.812	0.00511	0.07477	8	0.026587	yes	ADPSBQ
chr2_33563203_CTTGTT_C_b38	RASGRP3	2.81	0.00514	0.053489	52	0.019034	yes	ADPSBQ
chr2_33611855_A_C_b38	RASGRP3	2.809	0.00515	0.070758	12	0.025186	yes	ADPSBQ
chr2_33202022_A_AACACACACAC_b38	RASGRP3	-2.809	0.00516	-0.076881	10	0.027366	yes	ADPSBQ
chr2_32924725_T_G_b38	RASGRP3	2.803	0.00526	0.047389	137	0.016907	yes	ADPSBQ
chr2_33533388_C_T_b38	RASGRP3	-2.797	0.00536	-0.070322	11	0.025145	yes	ADPSBQ
chr2_32891852_G_A_b38	RASGRP3	-2.794	0.00541	-0.053545	41	0.019166	yes	ADPSBQ
chr2_33006381_CTTT_C_b38	RASGRP3	2.788	0.0055	0.061205	22	0.021954	yes	ADPSBQ
chr2_33627422_T_C_b38	RASGRP3	2.784	0.00557	0.054036	48	0.019409	yes	ADPSBQ
chr2_33627559_G_A_b38	RASGRP3	2.784	0.00557	0.054036	48	0.019409	yes	ADPSBQ
chr2_33328116_C_T_b38	RASGRP3	2.781	0.00563	0.049465	81	0.017789	yes	ADPSBQ
chr2_33660983_C_T_b38	RASGRP3	-2.778	0.00568	-0.047105	116	0.016959	yes	ADPSBQ
chr2_33509059_T_G_b38	RASGRP3	-2.776	0.00571	-0.05741	30	0.020682	yes	ADPSBQ
chr2_33605964_T_C_b38	RASGRP3	2.773	0.00576	0.06218	21	0.022422	yes	ADPSBQ
chr2_33539996_AAAAAG_A_b38	RASGRP3	-2.771	0.0058	-0.048527	136	0.017515	yes	ADPSBQ
chr2_33520141_T_C_b38	RASGRP3	-2.769	0.00582	-0.047836	107	0.017274	yes	ADPSBQ
chr2_33486164_AT_A_b38	RASGRP3	-2.766	0.00588	-0.055875	54	0.020199	yes	ADPSBQ
chr2_34163298_T_TTC_b38	RASGRP3	-2.758	0.00603	-0.064818	16	0.023504	yes	ADPSBQ
chr2_33658757_C_A_b38	RASGRP3	-2.756	0.00606	-0.047273	112	0.017153	yes	ADPSBQ
chr2_32894731_A_G_b38	RASGRP3	-2.751	0.00615	-0.046567	119	0.016926	yes	ADPSBQ
chr2_33029666_C_T_b38	RASGRP3	2.75	0.00616	0.073997	8	0.026904	yes	ADPSBQ
chr2_33515788_C_T_b38	RASGRP3	-2.747	0.00622	-0.069851	12	0.025425	yes	ADPSBQ
chr2_33553788_G_A_b38	RASGRP3	-2.743	0.00629	-0.067348	14	0.024548	yes	ADPSBQ
chr2_33556856_G_C_b38	RASGRP3	-2.743	0.00629	-0.067348	14	0.024548	yes	ADPSBQ
chr2_32976844_G_A_b38	RASGRP3	2.729	0.00657	0.074923	6	0.027453	yes	ADPSBQ
chr2_32982671_C_T_b38	RASGRP3	2.729	0.00657	0.074923	6	0.027453	yes	ADPSBQ
chr2_33140669_AT_A_b38	RASGRP3	-2.725	0.00665	-0.051791	44	0.019006	yes	ADPSBQ
chr2_33034289_T_C_b38	RASGRP3	2.712	0.00692	0.074443	7	0.027454	yes	ADPSBQ
chr2_33061239_G_C_b38	RASGRP3	2.711	0.00694	0.074955	7	0.027653	yes	ADPSBQ
chr2_32890331_C_CAAAAA_b38	RASGRP3	-2.705	0.00706	-0.117677	4	0.043506	yes	ADPSBQ
chr2_33330188_G_C_b38	RASGRP3	2.702	0.00712	0.048874	78	0.018086	yes	ADPSBQ
chr2_33093619_A_G_b38	RASGRP3	2.7	0.00716	0.047655	84	0.017649	yes	ADPSBQ
chr2_33535555_G_GC_b38	RASGRP3	-2.692	0.00733	-0.066249	13	0.024607	yes	ADPSBQ
chr2_33741270_T_C_b38	RASGRP3	2.685	0.0075	0.075684	6	0.028192	yes	ADPSBQ
chr2_33518880_G_GTCA_b38	RASGRP3	-2.684	0.0075	-0.046574	107	0.01735	yes	ADPSBQ
chr2_33655786_T_C_b38	RASGRP3	-2.684	0.00751	-0.045478	119	0.016945	yes	ADPSBQ
chr2_33008835_G_A_b38	RASGRP3	2.677	0.00767	0.04562	125	0.017042	yes	ADPSBQ
chr2_32892533_C_T_b38	RASGRP3	-2.672	0.00778	-0.051266	41	0.019186	yes	ADPSBQ
chr2_33731949_C_G_b38	RASGRP3	2.665	0.00795	0.077527	5	0.029094	yes	ADPSBQ
chr2_33732506_C_T_b38	RASGRP3	2.665	0.00795	0.077527	5	0.029094	yes	ADPSBQ
chr2_33734078_T_A_b38	RASGRP3	2.665	0.00795	0.077527	5	0.029094	yes	ADPSBQ
chr2_32996915_C_T_b38	RASGRP3	2.664	0.00797	0.052337	44	0.019646	yes	ADPSBQ
chr2_32901601_G_A_b38	RASGRP3	-2.661	0.00804	-0.094257	4	0.035422	yes	ADPSBQ
chr2_33428669_ATTT_A_b38	RASGRP3	2.659	0.00807	0.093255	8	0.035066	yes	ADPSBQ
chr2_33550119_G_T_b38	RASGRP3	-2.653	0.00822	-0.06487	14	0.02445	yes	ADPSBQ
chr2_33548698_A_AATTATT_b38	RASGRP3	-2.652	0.00826	-0.063589	15	0.023981	yes	ADPSBQ
chr2_33025504_A_C_b38	RASGRP3	-2.649	0.00831	-0.057647	21	0.021759	yes	ADPSBQ
chr2_33050130_AT_A_b38	RASGRP3	-2.639	0.00857	-0.050172	44	0.019012	yes	ADPSBQ
chr2_33792363_C_T_b38	RASGRP3	2.638	0.0086	0.08292	4	0.031436	yes	ADPSBQ
chr2_33026928_G_A_b38	RASGRP3	2.633	0.00872	0.070577	8	0.026806	yes	ADPSBQ
chr2_33752604_A_ATTTTTTT_b38	RASGRP3	2.632	0.00874	0.172192	3	0.065417	yes	ADPSBQ
chr2_33740099_T_TTTG_b38	RASGRP3	2.632	0.00874	0.070991	7	0.02697	yes	ADPSBQ
chr2_33534328_C_T_b38	RASGRP3	-2.629	0.00882	-0.067956	9	0.025849	yes	ADPSBQ
chr2_32930449_GCACACA_G_b38	RASGRP3	-2.629	0.00883	-0.069411	8	0.026407	yes	ADPSBQ
chr2_33550598_T_G_b38	RASGRP3	-2.628	0.00885	-0.063459	15	0.024149	yes	ADPSBQ
chr2_33561322_C_T_b38	RASGRP3	-2.624	0.00895	-0.065397	13	0.024922	yes	ADPSBQ
chr2_32887028_A_G_b38	RASGRP3	-2.624	0.00895	-0.044852	115	0.017093	yes	ADPSBQ
chr2_33142059_A_G_b38	RASGRP3	-2.617	0.00912	-0.052122	32	0.019913	yes	ADPSBQ
chr2_33533272_T_C_b38	RASGRP3	-2.614	0.00922	-0.064598	12	0.024713	yes	ADPSBQ
chr2_33090487_G_A_b38	RASGRP3	2.612	0.00927	0.054212	28	0.020755	yes	ADPSBQ
chr2_33023454_G_C_b38	RASGRP3	2.612	0.00928	0.072173	7	0.027635	yes	ADPSBQ
chr2_33538430_G_C_b38	RASGRP3	-2.606	0.00943	-0.066281	10	0.025435	yes	ADPSBQ
chr2_33749131_A_G_b38	RASGRP3	2.606	0.00943	0.073715	7	0.028289	yes	ADPSBQ
chr2_33538452_G_A_b38	RASGRP3	-2.603	0.0095	-0.067664	9	0.025992	yes	ADPSBQ
chr2_33072862_C_T_b38	RASGRP3	2.6	0.0096	0.071848	7	0.027637	yes	ADPSBQ
chr2_33523846_A_G_b38	RASGRP3	-2.597	0.00967	-0.054328	32	0.020918	yes	ADPSBQ
chr2_32896786_TG_T_b38	RASGRP3	-2.589	0.00991	-0.044017	118	0.017004	yes	ADPSBQ
chr2_33596666_T_C_b38	RASGRP3	2.586	0.01	0.048779	52	0.018866	yes	ADPSBQ
chr2_33625315_G_A_b38	RASGRP3	4.932	1.1e-06	0.098577	42	0.019986	no	ADPSBQ
chr2_33605827_ATTTTTCT_A_b38	RASGRP3	4.777	2.33e-06	0.121097	10	0.025351	no	ADPSBQ
chr2_33616325_C_T_b38	RASGRP3	4.415	1.23e-05	0.115217	10	0.026098	no	ADPSBQ
chr2_33606703_C_T_b38	RASGRP3	4.29	2.14e-05	0.113725	10	0.026508	no	ADPSBQ
chr2_33536322_G_GA_b38	RASGRP3	4.272	2.31e-05	0.115086	16	0.026937	no	ADPSBQ
chr2_33606727_T_C_b38	RASGRP3	4.092	4.98e-05	0.116513	4	0.028475	no	ADPSBQ
chr2_33004517_G_A_b38	RASGRP3	3.857	0.00013	0.07028	60	0.018223	no	ADPSBQ
chr2_32993235_T_C_b38	RASGRP3	-3.744	0.000202	-0.070382	43	0.018798	no	ADPSBQ
chr2_32992353_A_G_b38	RASGRP3	-3.71	0.00023	-0.069594	43	0.018761	no	ADPSBQ
chr2_33012456_T_C_b38	RASGRP3	3.698	0.000241	0.063276	91	0.017112	no	ADPSBQ
chr2_33007988_C_G_b38	RASGRP3	3.625	0.000318	0.068174	54	0.018809	no	ADPSBQ
chr2_32994032_C_G_b38	RASGRP3	3.624	0.000319	0.061454	95	0.016959	no	ADPSBQ
chr2_33014179_C_T_b38	RASGRP3	3.619	0.000325	0.067934	54	0.018771	no	ADPSBQ
chr2_33706678_T_C_b38	RASGRP3	3.606	0.000341	0.105745	4	0.029321	no	ADPSBQ
chr2_33509399_C_CA_b38	RASGRP3	3.587	0.000367	0.091672	6	0.025558	no	ADPSBQ
chr2_32991738_A_G_b38	RASGRP3	-3.554	0.000415	-0.066859	43	0.018813	no	ADPSBQ
chr2_32986447_C_G_b38	RASGRP3	3.548	0.000424	0.061054	96	0.017207	no	ADPSBQ
chr2_33004646_G_A_b38	RASGRP3	3.497	0.000511	0.065711	54	0.018789	no	ADPSBQ
chr2_32994080_T_C_b38	RASGRP3	-3.497	0.000511	-0.068233	36	0.019511	no	ADPSBQ
chr2_32795531_C_CTTAT_b38	RASGRP3	3.494	0.000517	0.140504	5	0.040211	no	ADPSBQ
chr2_32969229_T_TGTG_b38	RASGRP3	3.421	0.000674	0.088831	12	0.025965	no	ADPSBQ
chr2_32954704_C_T_b38	RASGRP3	-3.404	0.000716	-0.062272	79	0.018293	no	ADPSBQ
chr2_33548381_A_AAAAAG_b38	RASGRP3	3.404	0.000716	0.100394	12	0.029492	no	ADPSBQ
chr2_32991760_C_G_b38	RASGRP3	-3.391	0.000751	-0.063028	45	0.018588	no	ADPSBQ
chr2_32943951_TTTTTTG_T_b38	RASGRP3	3.386	0.000764	0.092542	11	0.027331	no	ADPSBQ
chr2_33009050_C_T_b38	RASGRP3	-3.353	0.000859	-0.058117	118	0.017333	no	ADPSBQ
chr2_33537323_G_A_b38	RASGRP3	3.331	0.000929	0.054074	153	0.016234	no	ADPSBQ
chr2_32888303_G_C_b38	RASGRP3	-3.155	0.0017	-0.057538	60	0.01824	no	ADPSBQ
chr2_33532718_G_A_b38	RASGRP3	3.107	0.002	0.052418	110	0.016872	no	ADPSBQ
chr2_32895167_G_A_b38	RASGRP3	-3.101	0.00204	-0.056459	60	0.018208	no	ADPSBQ
chr2_33642139_G_T_b38	RASGRP3	3.095	0.00207	0.073815	14	0.023846	no	ADPSBQ
chr2_32957548_T_C_b38	RASGRP3	-3.093	0.00209	-0.057233	73	0.018504	no	ADPSBQ
chr2_33749290_G_T_b38	RASGRP3	3.085	0.00215	0.096077	3	0.031146	no	ADPSBQ
chr2_33734734_G_A_b38	RASGRP3	3.082	0.00217	0.095839	3	0.031094	no	ADPSBQ
chr2_33029656_A_G_b38	RASGRP3	-3.066	0.00228	-0.057226	45	0.018665	no	ADPSBQ
chr2_32956808_C_T_b38	RASGRP3	-3.06	0.00233	-0.056319	79	0.018407	no	ADPSBQ
chr2_32902719_G_A_b38	RASGRP3	-3.043	0.00246	-0.096223	5	0.031619	no	ADPSBQ
chr2_32955630_A_AT_b38	RASGRP3	-2.98	0.00302	-0.054843	77	0.018407	no	ADPSBQ
chr2_32903221_G_A_b38	RASGRP3	2.965	0.00316	0.059202	37	0.019964	no	ADPSBQ
chr2_32990106_A_C_b38	RASGRP3	-2.895	0.00396	-0.087485	6	0.03022	no	ADPSBQ
chr2_33283427_C_CT_b38	RASGRP3	2.865	0.00434	0.168693	5	0.058884	no	ADPSBQ
chr2_32894316_A_G_b38	RASGRP3	-2.862	0.00439	-0.052006	62	0.018174	no	ADPSBQ
chr2_33616849_C_T_b38	RASGRP3	2.852	0.00451	0.053684	54	0.01882	no	ADPSBQ
chr2_33792244_T_C_b38	RASGRP3	2.845	0.00462	0.131897	4	0.046356	no	ADPSBQ
chr2_32988443_A_G_b38	RASGRP3	-2.841	0.00468	-0.085262	7	0.030015	no	ADPSBQ
chr2_32930115_T_C_b38	RASGRP3	2.788	0.0055	0.045982	165	0.016492	no	ADPSBQ
chr2_32973114_G_GT_b38	RASGRP3	2.783	0.00559	0.051803	62	0.018615	no	ADPSBQ
chr2_33781569_AGTGTGT_A_b38	RASGRP3	2.781	0.00563	0.082046	6	0.029507	no	ADPSBQ
chr2_33050130_A_AT_b38	RASGRP3	2.732	0.00651	0.065195	15	0.023862	no	ADPSBQ
chr2_32930838_T_C_b38	RASGRP3	2.695	0.00727	0.044435	158	0.016486	no	ADPSBQ
chr2_32500606_GT_G_b38	RASGRP3	2.671	0.00781	0.062532	14	0.023415	no	ADPSBQ
chr2_33426748_C_G_b38	RASGRP3	2.669	0.00784	0.046577	119	0.017448	no	ADPSBQ
chr2_32926975_T_C_b38	RASGRP3	2.636	0.00864	0.04416	139	0.016751	no	ADPSBQ
chr2_33653281_C_CCTGT_b38	RASGRP3	2.633	0.00872	0.062176	15	0.023612	no	ADPSBQ
chr2_33427673_T_C_b38	RASGRP3	2.629	0.00882	0.045403	131	0.017271	no	ADPSBQ
chr2_33428475_A_G_b38	RASGRP3	2.621	0.00904	0.044944	130	0.017151	no	ADPSBQ
chr2_33034490_T_TA_b38	RASGRP3	-2.598	0.00966	-0.062088	13	0.023903	no	ADPSBQ
chr2_33529318_C_T_b38	RASGRP3	6.834	3.1e-11	0.151748	16	0.022204	yes	ADPVSC
chr2_33561445_C_A_b38	RASGRP3	6.769	4.67e-11	0.150428	18	0.022224	yes	ADPVSC
chr2_33523649_G_A_b38	RASGRP3	6.47	2.88e-10	0.147982	17	0.022872	yes	ADPVSC
chr2_33555164_G_A_b38	RASGRP3	6.15	1.89e-09	0.141921	15	0.023078	yes	ADPVSC
chr2_33539987_GAAAAA_G_b38	RASGRP3	5.803	1.33e-08	0.176676	4	0.030444	yes	ADPVSC
chr2_33525341_A_AAT_b38	RASGRP3	5.537	5.59e-08	0.117414	26	0.021205	yes	ADPVSC
chr2_33512177_G_A_b38	RASGRP3	5.356	1.44e-07	0.128044	16	0.023906	yes	ADPVSC
chr2_33536322_G_GA_b38	RASGRP3	5.037	7.2e-07	0.134548	13	0.026714	yes	ADPVSC
chr2_33512902_A_G_b38	RASGRP3	-5.006	8.37e-07	-0.091603	100	0.018299	yes	ADPVSC
chr2_33569371_A_G_b38	RASGRP3	-4.571	6.48e-06	-0.086009	80	0.018815	yes	ADPVSC
chr2_33520141_T_C_b38	RASGRP3	-4.47	1.02e-05	-0.084263	90	0.018851	yes	ADPVSC
chr2_33567745_C_T_b38	RASGRP3	-4.398	1.4e-05	-0.082909	72	0.018851	yes	ADPVSC
chr2_33518880_G_GTCA_b38	RASGRP3	-4.383	1.5e-05	-0.079373	89	0.018109	yes	ADPVSC
chr2_33543901_C_G_b38	RASGRP3	-4.367	1.61e-05	-0.083386	66	0.019094	yes	ADPVSC
chr2_33571267_T_A_b38	RASGRP3	-4.355	1.69e-05	-0.080687	81	0.018526	yes	ADPVSC
chr2_33572204_C_A_b38	RASGRP3	-4.341	1.8e-05	-0.081344	80	0.01874	yes	ADPVSC
chr2_33568339_TA_T_b38	RASGRP3	-4.33	1.89e-05	-0.080859	88	0.018673	yes	ADPVSC
chr2_33571342_T_C_b38	RASGRP3	-4.241	2.77e-05	-0.07877	81	0.018572	yes	ADPVSC
chr2_33511010_G_A_b38	RASGRP3	4.123	4.56e-05	0.119916	10	0.029086	yes	ADPVSC
chr2_33539996_AAAAAG_A_b38	RASGRP3	-4.096	5.09e-05	-0.073358	104	0.017909	yes	ADPVSC
chr2_33575950_G_A_b38	RASGRP3	-4.078	5.49e-05	-0.076487	78	0.018757	yes	ADPVSC
chr2_33539533_G_T_b38	RASGRP3	-3.952	9.16e-05	-0.06696	115	0.016943	yes	ADPVSC
chr2_33605951_T_C_b38	RASGRP3	-3.935	9.8e-05	-0.06973	101	0.017718	yes	ADPVSC
chr2_33577889_G_A_b38	RASGRP3	-3.932	9.94e-05	-0.074122	78	0.018851	yes	ADPVSC
chr2_33588900_A_AT_b38	RASGRP3	-3.87	0.000127	-0.075663	83	0.019552	yes	ADPVSC
chr2_33514489_T_C_b38	RASGRP3	-3.859	0.000133	-0.067784	78	0.017566	yes	ADPVSC
chr2_33518114_A_G_b38	RASGRP3	-3.819	0.000156	-0.070464	61	0.018452	yes	ADPVSC
chr2_33571586_T_C_b38	RASGRP3	-3.792	0.000172	-0.067853	98	0.017892	yes	ADPVSC
chr2_33660983_C_T_b38	RASGRP3	-3.772	0.000187	-0.067246	91	0.017828	yes	ADPVSC
chr2_33662442_T_C_b38	RASGRP3	-3.748	0.000205	-0.066144	97	0.017648	yes	ADPVSC
chr2_33512820_T_A_b38	RASGRP3	-3.735	0.000215	-0.068438	67	0.018322	yes	ADPVSC
chr2_33523846_A_G_b38	RASGRP3	-3.695	0.00025	-0.080399	23	0.021757	yes	ADPVSC
chr2_33658713_G_A_b38	RASGRP3	-3.655	0.000291	-0.06523	93	0.017845	yes	ADPVSC
chr2_33663649_A_C_b38	RASGRP3	-3.629	0.000321	-0.063602	106	0.017525	yes	ADPVSC
chr2_33540561_TGTGTGTGTGTGTGTGTG_T_b38	RASGRP3	-3.625	0.000326	-0.067119	69	0.018514	yes	ADPVSC
chr2_33658757_C_A_b38	RASGRP3	-3.61	0.000345	-0.065017	88	0.018009	yes	ADPVSC
chr2_33659127_A_G_b38	RASGRP3	-3.592	0.000369	-0.062553	106	0.017414	yes	ADPVSC
chr2_33655774_A_G_b38	RASGRP3	-3.56	0.000416	-0.062984	100	0.017695	yes	ADPVSC
chr2_33661861_G_A_b38	RASGRP3	-3.554	0.000425	-0.063001	98	0.017725	yes	ADPVSC
chr2_33534694_A_AT_b38	RASGRP3	3.55	0.000431	0.07724	25	0.021758	yes	ADPVSC
chr2_33655786_T_C_b38	RASGRP3	-3.547	0.000436	-0.063291	95	0.017842	yes	ADPVSC
chr2_33658170_A_G_b38	RASGRP3	-3.541	0.000446	-0.062787	95	0.017731	yes	ADPVSC
chr2_33589523_A_G_b38	RASGRP3	-3.517	0.000487	-0.062424	104	0.01775	yes	ADPVSC
chr2_33519891_C_T_b38	RASGRP3	-3.517	0.000487	-0.06579	71	0.018707	yes	ADPVSC
chr2_33664742_G_C_b38	RASGRP3	-3.514	0.000493	-0.061565	107	0.017522	yes	ADPVSC
chr2_33668515_A_G_b38	RASGRP3	-3.489	0.000538	-0.061711	99	0.017686	yes	ADPVSC
chr2_33509399_C_CA_b38	RASGRP3	3.483	0.000551	0.090419	6	0.025959	yes	ADPVSC
chr2_33607748_A_G_b38	RASGRP3	-3.457	0.000605	-0.061561	85	0.017807	yes	ADPVSC
chr2_33618669_C_CT_b38	RASGRP3	-3.451	0.000619	-0.061562	84	0.017839	yes	ADPVSC
chr2_33618734_A_G_b38	RASGRP3	-3.451	0.000619	-0.061562	84	0.017839	yes	ADPVSC
chr2_33623108_T_C_b38	RASGRP3	3.446	0.00063	0.066836	52	0.019397	yes	ADPVSC
chr2_33655112_A_AT_b38	RASGRP3	-3.438	0.000649	-0.063435	86	0.018453	yes	ADPVSC
chr2_33586449_C_G_b38	RASGRP3	-3.434	0.000657	-0.06134	101	0.017862	yes	ADPVSC
chr2_33661731_A_G_b38	RASGRP3	-3.431	0.000665	-0.059999	106	0.017488	yes	ADPVSC
chr2_33621819_C_A_b38	RASGRP3	3.429	0.000669	0.06622	52	0.019312	yes	ADPVSC
chr2_33569651_CA_C_b38	RASGRP3	-3.412	0.000711	-0.08034	36	0.023545	yes	ADPVSC
chr2_33664465_T_A_b38	RASGRP3	-3.411	0.000712	-0.060103	102	0.017618	yes	ADPVSC
chr2_33647765_T_C_b38	RASGRP3	-3.411	0.000714	-0.060594	101	0.017766	yes	ADPVSC
chr2_33528012_T_G_b38	RASGRP3	-3.409	0.000719	-0.076412	21	0.022415	yes	ADPVSC
chr2_33527085_G_T_b38	RASGRP3	-3.4	0.000742	-0.078511	18	0.02309	yes	ADPVSC
chr2_33617107_G_A_b38	RASGRP3	-3.399	0.000744	-0.060801	83	0.017886	yes	ADPVSC
chr2_32667414_C_CT_b38	RASGRP3	-3.378	0.000802	-0.155731	4	0.0461	yes	ADPVSC
chr2_33613720_G_A_b38	RASGRP3	3.369	0.000829	0.087567	12	0.025995	yes	ADPVSC
chr2_33592492_A_G_b38	RASGRP3	-3.362	0.00085	-0.059987	101	0.017845	yes	ADPVSC
chr2_33580247_A_G_b38	RASGRP3	-3.356	0.000868	-0.060626	98	0.018068	yes	ADPVSC
chr2_33593131_C_T_b38	RASGRP3	-3.353	0.000876	-0.059884	101	0.01786	yes	ADPVSC
chr2_33666591_A_G_b38	RASGRP3	-3.349	0.000889	-0.05852	111	0.017476	yes	ADPVSC
chr2_33641120_T_C_b38	RASGRP3	-3.313	0.00101	-0.059171	99	0.017861	yes	ADPVSC
chr2_33613986_T_C_b38	RASGRP3	-3.296	0.00107	-0.0584	86	0.017719	yes	ADPVSC
chr2_33597253_G_A_b38	RASGRP3	-3.29	0.00109	-0.059371	96	0.018048	yes	ADPVSC
chr2_32996915_C_T_b38	RASGRP3	3.287	0.0011	0.071664	27	0.021802	yes	ADPVSC
chr2_32930449_GCACACA_G_b38	RASGRP3	-3.277	0.00114	-0.089401	6	0.027281	yes	ADPVSC
chr2_33625063_ATCT_A_b38	RASGRP3	-3.255	0.00123	-0.058874	76	0.018089	yes	ADPVSC
chr2_33590404_A_G_b38	RASGRP3	-3.242	0.00129	-0.057671	102	0.01779	yes	ADPVSC
chr2_32907400_C_CT_b38	RASGRP3	3.232	0.00133	0.075903	12	0.023483	yes	ADPVSC
chr2_33577835_T_C_b38	RASGRP3	-3.214	0.00141	-0.057938	99	0.018025	yes	ADPVSC
chr2_33664871_G_GT_b38	RASGRP3	-3.197	0.0015	-0.057474	98	0.017979	yes	ADPVSC
chr2_33575832_C_A_b38	RASGRP3	-3.194	0.00151	-0.057479	102	0.017994	yes	ADPVSC
chr2_33614957_G_A_b38	RASGRP3	-3.191	0.00153	-0.057345	82	0.017972	yes	ADPVSC
chr2_33535943_T_C_b38	RASGRP3	-3.18	0.00159	-0.080969	10	0.025461	yes	ADPVSC
chr2_33622456_T_TAAAC_b38	RASGRP3	-3.179	0.00159	-0.056783	84	0.017862	yes	ADPVSC
chr2_33525341_AAT_A_b38	RASGRP3	-3.141	0.00181	-0.083431	7	0.026558	yes	ADPVSC
chr2_32948636_G_A_b38	RASGRP3	3.126	0.0019	0.066444	33	0.021254	yes	ADPVSC
chr2_33509059_T_G_b38	RASGRP3	-3.117	0.00196	-0.067446	22	0.021641	yes	ADPVSC
chr2_33615675_TA_T_b38	RASGRP3	-3.077	0.00224	-0.05509	83	0.017907	yes	ADPVSC
chr2_32930449_G_GCGCA_b38	RASGRP3	3.045	0.00248	0.080495	8	0.026437	yes	ADPVSC
chr2_32958539_C_T_b38	RASGRP3	-3.025	0.00265	-0.073089	18	0.024161	yes	ADPVSC
chr2_33547342_C_CTTTTTTT_b38	RASGRP3	3.021	0.00268	0.193117	3	0.063921	yes	ADPVSC
chr2_33669785_CA_C_b38	RASGRP3	-3.017	0.00272	-0.054343	74	0.018014	yes	ADPVSC
chr2_33630364_C_G_b38	RASGRP3	-3.015	0.00273	-0.053642	81	0.017791	yes	ADPVSC
chr2_33576389_C_T_b38	RASGRP3	-3.01	0.00278	-0.05481	96	0.018212	yes	ADPVSC
chr2_32938583_C_A_b38	RASGRP3	3.009	0.00278	0.063088	35	0.020964	yes	ADPVSC
chr2_33474404_G_A_b38	RASGRP3	3.003	0.00284	0.054163	91	0.018036	yes	ADPVSC
chr2_34056691_A_G_b38	RASGRP3	-2.998	0.00289	-0.062934	28	0.020991	yes	ADPVSC
chr2_33177707_A_G_b38	RASGRP3	2.988	0.00298	0.121532	6	0.040668	yes	ADPVSC
chr2_33625060_G_A_b38	RASGRP3	-2.976	0.0031	-0.053475	83	0.017969	yes	ADPVSC
chr2_33409506_G_GT_b38	RASGRP3	-2.953	0.00334	-0.109844	5	0.037203	yes	ADPVSC
chr2_33631185_T_G_b38	RASGRP3	-2.945	0.00342	-0.052884	105	0.017955	yes	ADPVSC
chr2_33625433_A_C_b38	RASGRP3	-2.941	0.00346	-0.05289	78	0.017982	yes	ADPVSC
chr2_33538430_G_C_b38	RASGRP3	-2.917	0.00374	-0.076801	8	0.026332	yes	ADPVSC
chr2_32911868_ATGTGTG_A_b38	RASGRP3	2.916	0.00375	0.070466	11	0.024168	yes	ADPVSC
chr2_33706678_T_C_b38	RASGRP3	2.913	0.00379	0.09021	3	0.030972	yes	ADPVSC
chr2_33386826_C_CT_b38	RASGRP3	2.911	0.00381	0.08277	16	0.028436	yes	ADPVSC
chr2_33670200_G_T_b38	RASGRP3	-2.906	0.00387	-0.051827	80	0.017836	yes	ADPVSC
chr2_33661940_T_G_b38	RASGRP3	-2.9	0.00394	-0.054001	110	0.01862	yes	ADPVSC
chr2_33631637_C_A_b38	RASGRP3	-2.898	0.00396	-0.052065	81	0.017965	yes	ADPVSC
chr2_33537321_C_CA_b38	RASGRP3	2.897	0.00398	0.05249	68	0.018121	yes	ADPVSC
chr2_33591195_C_CT_b38	RASGRP3	-2.894	0.00401	-0.058304	60	0.020147	yes	ADPVSC
chr2_33673146_T_C_b38	RASGRP3	-2.893	0.00403	-0.051226	104	0.017709	yes	ADPVSC
chr2_32945312_C_CT_b38	RASGRP3	-2.869	0.00433	-0.077486	4	0.027004	yes	ADPVSC
chr2_33669621_C_T_b38	RASGRP3	-2.855	0.00453	-0.050879	80	0.017824	yes	ADPVSC
chr2_33669751_C_T_b38	RASGRP3	-2.855	0.00453	-0.050879	80	0.017824	yes	ADPVSC
chr2_33604404_GTA_G_b38	RASGRP3	-2.846	0.00466	-0.055392	45	0.019463	yes	ADPVSC
chr2_34091901_AC_A_b38	RASGRP3	2.837	0.00478	0.060571	25	0.021348	yes	ADPVSC
chr2_33543280_C_G_b38	RASGRP3	-2.832	0.00486	-0.075141	8	0.026533	yes	ADPVSC
chr2_33007243_A_T_b38	RASGRP3	-2.829	0.00491	-0.059121	50	0.020898	yes	ADPVSC
chr2_33538452_G_A_b38	RASGRP3	-2.823	0.00499	-0.075111	8	0.026605	yes	ADPVSC
chr2_33629277_A_G_b38	RASGRP3	-2.819	0.00505	-0.050384	88	0.017871	yes	ADPVSC
chr2_34090755_A_G_b38	RASGRP3	-2.814	0.00513	-0.117813	3	0.041863	yes	ADPVSC
chr2_34161327_G_A_b38	RASGRP3	2.814	0.00514	0.052674	58	0.01872	yes	ADPVSC
chr2_33624514_C_A_b38	RASGRP3	-2.804	0.00529	-0.050104	85	0.017869	yes	ADPVSC
chr2_33535555_G_GC_b38	RASGRP3	-2.788	0.00555	-0.071798	10	0.02575	yes	ADPVSC
chr2_33533388_C_T_b38	RASGRP3	-2.783	0.00564	-0.072801	9	0.026157	yes	ADPVSC
chr2_33631863_T_C_b38	RASGRP3	-2.778	0.00573	-0.049981	105	0.017992	yes	ADPVSC
chr2_32949185_C_G_b38	RASGRP3	-2.761	0.00602	-0.077561	5	0.028087	yes	ADPVSC
chr2_33534328_C_T_b38	RASGRP3	-2.754	0.00615	-0.073753	8	0.026776	yes	ADPVSC
chr2_33007962_T_C_b38	RASGRP3	-2.75	0.00623	-0.057611	48	0.020951	yes	ADPVSC
chr2_33515788_C_T_b38	RASGRP3	-2.746	0.00631	-0.071258	10	0.02595	yes	ADPVSC
chr2_33004447_A_G_b38	RASGRP3	2.743	0.00637	0.053623	52	0.019551	yes	ADPVSC
chr2_33534496_G_A_b38	RASGRP3	-2.738	0.00646	-0.073391	8	0.026803	yes	ADPVSC
chr2_33601956_TA_T_b38	RASGRP3	2.725	0.00672	0.05216	109	0.019144	yes	ADPVSC
chr2_32905755_AG_A_b38	RASGRP3	2.718	0.00686	0.06178	17	0.022731	yes	ADPVSC
chr2_33005867_G_A_b38	RASGRP3	2.708	0.00705	0.053111	51	0.01961	yes	ADPVSC
chr2_33811839_T_C_b38	RASGRP3	-2.706	0.00711	-0.081436	14	0.030097	yes	ADPVSC
chr2_32947240_C_G_b38	RASGRP3	-2.705	0.00713	-0.076468	7	0.028274	yes	ADPVSC
chr2_33476758_C_CGTGCGTGTGT_b38	RASGRP3	2.698	0.00727	0.080014	4	0.029658	yes	ADPVSC
chr2_34043545_CTT_C_b38	RASGRP3	2.697	0.00729	0.054202	48	0.020097	yes	ADPVSC
chr2_33661923_CT_C_b38	RASGRP3	-2.696	0.00732	-0.054342	77	0.020159	yes	ADPVSC
chr2_33525080_C_CA_b38	RASGRP3	-2.694	0.00736	-0.065221	14	0.024211	yes	ADPVSC
chr2_34085758_A_T_b38	RASGRP3	2.679	0.0077	0.055345	37	0.020661	yes	ADPVSC
chr2_34174966_A_AAAAC_b38	RASGRP3	-2.669	0.00793	-0.04894	115	0.018339	yes	ADPVSC
chr2_32945446_C_T_b38	RASGRP3	-2.663	0.00806	-0.076619	5	0.028771	yes	ADPVSC
chr2_33703370_C_T_b38	RASGRP3	-2.662	0.00808	-0.081913	3	0.030769	yes	ADPVSC
chr2_33704352_C_T_b38	RASGRP3	-2.662	0.00808	-0.081913	3	0.030769	yes	ADPVSC
chr2_34091903_ACACACAC_A_b38	RASGRP3	2.659	0.00816	0.05799	22	0.02181	yes	ADPVSC
chr2_32692036_G_GT_b38	RASGRP3	-2.658	0.00818	-0.072555	16	0.0273	yes	ADPVSC
chr2_33632169_T_C_b38	RASGRP3	-2.642	0.00857	-0.047902	77	0.018133	yes	ADPVSC
chr2_33533272_T_C_b38	RASGRP3	-2.638	0.00866	-0.068822	9	0.026087	yes	ADPVSC
chr2_33529319_G_C_b38	RASGRP3	-2.638	0.00867	-0.049705	76	0.018842	yes	ADPVSC
chr2_34154459_G_A_b38	RASGRP3	2.636	0.00872	0.048102	71	0.018249	yes	ADPVSC
chr2_34154500_A_T_b38	RASGRP3	2.636	0.00872	0.048102	71	0.018249	yes	ADPVSC
chr2_34154680_T_C_b38	RASGRP3	2.636	0.00872	0.048102	71	0.018249	yes	ADPVSC
chr2_34154956_C_T_b38	RASGRP3	2.636	0.00872	0.048102	71	0.018249	yes	ADPVSC
chr2_34155006_CT_C_b38	RASGRP3	2.636	0.00872	0.048102	71	0.018249	yes	ADPVSC
chr2_33532968_G_A_b38	RASGRP3	-2.633	0.0088	-0.070439	8	0.026757	yes	ADPVSC
chr2_33325139_A_G_b38	RASGRP3	2.621	0.0091	0.048242	102	0.018406	yes	ADPVSC
chr2_32914994_A_C_b38	RASGRP3	2.611	0.00937	0.05362	33	0.020537	yes	ADPVSC
chr2_32936968_C_A_b38	RASGRP3	-2.607	0.00949	-0.073979	5	0.028382	yes	ADPVSC
chr2_32941116_C_T_b38	RASGRP3	-2.607	0.00949	-0.073979	5	0.028382	yes	ADPVSC
chr2_33474954_T_C_b38	RASGRP3	2.601	0.00963	0.047779	109	0.018366	yes	ADPVSC
chr2_33004517_G_A_b38	RASGRP3	2.599	0.0097	0.052539	42	0.020216	yes	ADPVSC
chr2_33328090_A_G_b38	RASGRP3	2.599	0.00971	0.047456	107	0.018262	yes	ADPVSC
chr2_33233405_G_C_b38	RASGRP3	2.593	0.00986	0.055403	26	0.021366	yes	ADPVSC
chr2_34101578_C_T_b38	RASGRP3	2.593	0.00987	0.066708	10	0.025728	yes	ADPVSC
chr2_33536526_G_A_b38	RASGRP3	8.099	6.87e-15	0.218479	4	0.026978	no	ADPVSC
chr2_33536528_G_A_b38	RASGRP3	8.099	6.87e-15	0.218479	4	0.026978	no	ADPVSC
chr2_33537896_A_G_b38	RASGRP3	8.023	1.17e-14	0.209018	5	0.026051	no	ADPVSC
chr2_33531453_C_T_b38	RASGRP3	8.02	1.2e-14	0.208418	6	0.025988	no	ADPVSC
chr2_33529269_C_A_b38	RASGRP3	7.87	3.38e-14	0.201779	7	0.025638	no	ADPVSC
chr2_33526597_C_T_b38	RASGRP3	7.728	9e-14	0.205389	5	0.026578	no	ADPVSC
chr2_33527062_GC_G_b38	RASGRP3	7.728	9e-14	0.205389	5	0.026578	no	ADPVSC
chr2_33559304_G_A_b38	RASGRP3	7.614	1.94e-13	0.200133	5	0.026283	no	ADPVSC
chr2_33557635_G_A_b38	RASGRP3	7.561	2.78e-13	0.197665	5	0.026141	no	ADPVSC
chr2_33559734_G_A_b38	RASGRP3	7.561	2.78e-13	0.197665	5	0.026141	no	ADPVSC
chr2_33557844_G_A_b38	RASGRP3	7.415	7.4e-13	0.190281	7	0.025663	no	ADPVSC
chr2_33559068_A_G_b38	RASGRP3	7.134	4.65e-12	0.187592	5	0.026296	no	ADPVSC
chr2_33546942_C_G_b38	RASGRP3	7.071	6.96e-12	0.193661	4	0.027389	no	ADPVSC
chr2_33537192_G_GAT_b38	RASGRP3	7.047	8.08e-12	0.185042	4	0.026257	no	ADPVSC
chr2_33551676_A_G_b38	RASGRP3	6.783	4.28e-11	0.190538	3	0.028091	no	ADPVSC
chr2_33551697_A_T_b38	RASGRP3	6.783	4.28e-11	0.190538	3	0.028091	no	ADPVSC
chr2_33552022_CAAACA_C_b38	RASGRP3	6.736	5.73e-11	0.189946	3	0.0282	no	ADPVSC
chr2_33550216_T_A_b38	RASGRP3	6.705	6.92e-11	0.182612	5	0.027235	no	ADPVSC
chr2_33550484_C_G_b38	RASGRP3	6.705	6.92e-11	0.182612	5	0.027235	no	ADPVSC
chr2_33537330_C_CCCAACACA_b38	RASGRP3	6.693	7.47e-11	0.147114	26	0.021982	no	ADPVSC
chr2_33554542_A_G_b38	RASGRP3	6.683	7.9e-11	0.182034	5	0.027236	no	ADPVSC
chr2_33540561_TGTGTGTGTGTG_T_b38	RASGRP3	6.649	9.75e-11	0.170721	11	0.025676	no	ADPVSC
chr2_33521266_C_T_b38	RASGRP3	6.628	1.11e-10	0.14035	31	0.021177	no	ADPVSC
chr2_33548469_T_C_b38	RASGRP3	6.593	1.37e-10	0.181831	4	0.027578	no	ADPVSC
chr2_33553995_C_T_b38	RASGRP3	6.51	2.26e-10	0.179488	5	0.027571	no	ADPVSC
chr2_33548762_A_G_b38	RASGRP3	6.149	1.9e-09	0.171318	4	0.027863	no	ADPVSC
chr2_33556928_C_CACACACATACAT_b38	RASGRP3	6.039	3.56e-09	0.155995	5	0.025831	no	ADPVSC
chr2_33586869_A_T_b38	RASGRP3	5.422	1.02e-07	0.119658	21	0.022068	no	ADPVSC
chr2_33596617_C_T_b38	RASGRP3	5.222	2.86e-07	0.111931	29	0.021434	no	ADPVSC
chr2_33594326_C_T_b38	RASGRP3	5.143	4.25e-07	0.110304	29	0.021447	no	ADPVSC
chr2_33594385_G_A_b38	RASGRP3	5.143	4.25e-07	0.110304	29	0.021447	no	ADPVSC
chr2_33582025_C_T_b38	RASGRP3	5.141	4.29e-07	0.109115	28	0.021223	no	ADPVSC
chr2_33596963_A_T_b38	RASGRP3	5.074	5.99e-07	0.108547	29	0.021394	no	ADPVSC
chr2_33581561_C_T_b38	RASGRP3	4.997	8.75e-07	0.1066	28	0.021333	no	ADPVSC
chr2_33565263_A_G_b38	RASGRP3	4.981	9.45e-07	0.105881	32	0.021257	no	ADPVSC
chr2_33523461_TA_T_b38	RASGRP3	4.972	9.85e-07	0.119794	10	0.024092	no	ADPVSC
chr2_33547053_GAA_G_b38	RASGRP3	4.674	4.05e-06	0.163825	3	0.035049	no	ADPVSC
chr2_33662459_C_T_b38	RASGRP3	4.565	6.66e-06	0.096749	24	0.021192	no	ADPVSC
chr2_33656248_TTC_T_b38	RASGRP3	4.526	7.95e-06	0.096798	22	0.021388	no	ADPVSC
chr2_33650021_A_G_b38	RASGRP3	4.443	1.15e-05	0.095177	22	0.021423	no	ADPVSC
chr2_33663555_T_C_b38	RASGRP3	4.394	1.43e-05	0.093155	24	0.021201	no	ADPVSC
chr2_33652477_C_A_b38	RASGRP3	4.314	2.02e-05	0.092761	22	0.0215	no	ADPVSC
chr2_33657078_T_C_b38	RASGRP3	4.251	2.65e-05	0.08659	35	0.020368	no	ADPVSC
chr2_33641397_G_C_b38	RASGRP3	4.249	2.68e-05	0.091546	22	0.021545	no	ADPVSC
chr2_33590881_T_C_b38	RASGRP3	4.244	2.73e-05	0.085768	39	0.020207	no	ADPVSC
chr2_33640631_A_C_b38	RASGRP3	4.172	3.71e-05	0.089878	22	0.021544	no	ADPVSC
chr2_33670716_C_T_b38	RASGRP3	4.154	4.01e-05	0.086415	27	0.020805	no	ADPVSC
chr2_33622160_C_T_b38	RASGRP3	4.15	4.08e-05	0.083811	38	0.020197	no	ADPVSC
chr2_33639021_G_A_b38	RASGRP3	4.14	4.25e-05	0.0896	22	0.021645	no	ADPVSC
chr2_33656916_G_A_b38	RASGRP3	4.127	4.48e-05	0.081244	45	0.019686	no	ADPVSC
chr2_33596450_T_G_b38	RASGRP3	4.117	4.66e-05	0.083417	39	0.02026	no	ADPVSC
chr2_33589264_G_C_b38	RASGRP3	4.089	5.25e-05	0.082875	39	0.020269	no	ADPVSC
chr2_33625315_G_A_b38	RASGRP3	3.904	0.000111	0.08079	33	0.020695	no	ADPVSC
chr2_33659035_G_A_b38	RASGRP3	3.881	0.000122	0.106788	7	0.027516	no	ADPVSC
chr2_33540615_TTCTC_T_b38	RASGRP3	-3.858	0.000133	-0.070947	86	0.018387	no	ADPVSC
chr2_33557001_G_GA_b38	RASGRP3	3.853	0.000136	0.156868	3	0.040715	no	ADPVSC
chr2_33541741_G_T_b38	RASGRP3	-3.835	0.000146	-0.065431	113	0.017062	no	ADPVSC
chr2_33656848_TA_T_b38	RASGRP3	3.832	0.000148	0.078634	33	0.020523	no	ADPVSC
chr2_33624881_G_GT_b38	RASGRP3	3.803	0.000165	0.076344	40	0.020073	no	ADPVSC
chr2_33661156_C_T_b38	RASGRP3	3.733	0.000217	0.075735	32	0.020288	no	ADPVSC
chr2_33661310_C_T_b38	RASGRP3	3.733	0.000217	0.075735	32	0.020288	no	ADPVSC
chr2_33540888_T_C_b38	RASGRP3	-3.731	0.000218	-0.063591	113	0.017042	no	ADPVSC
chr2_33640513_G_C_b38	RASGRP3	3.686	0.000259	0.100621	7	0.027297	no	ADPVSC
chr2_33622592_T_C_b38	RASGRP3	3.677	0.000269	0.072729	48	0.01978	no	ADPVSC
chr2_33627793_A_G_b38	RASGRP3	3.657	0.000289	0.099495	7	0.027207	no	ADPVSC
chr2_33606703_C_T_b38	RASGRP3	3.648	3e-04	0.102231	7	0.028026	no	ADPVSC
chr2_33616325_C_T_b38	RASGRP3	3.594	0.000367	0.099684	7	0.027739	no	ADPVSC
chr2_33626436_A_T_b38	RASGRP3	3.519	0.000483	0.07086	41	0.020135	no	ADPVSC
chr2_33564467_A_G_b38	RASGRP3	3.512	0.000495	0.067468	56	0.01921	no	ADPVSC
chr2_33667549_A_G_b38	RASGRP3	3.51	0.000499	0.097905	7	0.027892	no	ADPVSC
chr2_33667555_A_G_b38	RASGRP3	3.51	0.000499	0.097905	7	0.027892	no	ADPVSC
chr2_33631243_G_GT_b38	RASGRP3	3.505	0.000508	0.098785	7	0.028181	no	ADPVSC
chr2_33564001_C_G_b38	RASGRP3	3.502	0.000514	0.068036	52	0.019426	no	ADPVSC
chr2_33606727_T_C_b38	RASGRP3	3.483	0.00055	0.102228	4	0.029348	no	ADPVSC
chr2_33634816_G_T_b38	RASGRP3	3.442	0.000639	0.095344	7	0.027701	no	ADPVSC
chr2_33634524_A_G_b38	RASGRP3	3.441	0.00064	0.095839	7	0.027851	no	ADPVSC
chr2_32947069_C_G_b38	RASGRP3	3.359	0.000857	0.075993	18	0.022621	no	ADPVSC
chr2_33547458_G_A_b38	RASGRP3	3.356	0.000865	0.062785	61	0.018706	no	ADPVSC
chr2_33636858_C_G_b38	RASGRP3	3.345	9e-04	0.093147	7	0.027845	no	ADPVSC
chr2_33637736_A_T_b38	RASGRP3	3.345	9e-04	0.093147	7	0.027845	no	ADPVSC
chr2_33581900_A_T_b38	RASGRP3	3.317	0.000994	0.08617	10	0.025979	no	ADPVSC
chr2_33605827_ATTTTTCT_A_b38	RASGRP3	3.306	0.00103	0.089881	7	0.027185	no	ADPVSC
chr2_32944322_C_T_b38	RASGRP3	3.251	0.00125	0.06913	32	0.021264	no	ADPVSC
chr2_32948485_C_T_b38	RASGRP3	3.214	0.00142	0.073437	18	0.022848	no	ADPVSC
chr2_33514230_T_G_b38	RASGRP3	3.211	0.00143	0.072598	21	0.022607	no	ADPVSC
chr2_32947291_C_A_b38	RASGRP3	3.191	0.00153	0.073178	17	0.022932	no	ADPVSC
chr2_32938782_C_T_b38	RASGRP3	-3.186	0.00156	-0.064361	42	0.0202	no	ADPVSC
chr2_33637426_T_A_b38	RASGRP3	3.18	0.00159	0.076077	18	0.023925	no	ADPVSC
chr2_32944077_G_T_b38	RASGRP3	3.139	0.00182	0.066528	33	0.021196	no	ADPVSC
chr2_33515662_T_C_b38	RASGRP3	3.124	0.00192	0.075067	17	0.02403	no	ADPVSC
chr2_32921830_A_G_b38	RASGRP3	3.121	0.00193	0.059208	64	0.018971	no	ADPVSC
chr2_33581338_T_A_b38	RASGRP3	3.118	0.00195	0.081124	10	0.026017	no	ADPVSC
chr2_32988934_CT_C_b38	RASGRP3	3.108	0.00202	0.068283	28	0.021968	no	ADPVSC
chr2_33563965_A_G_b38	RASGRP3	3.107	0.00203	0.0803	10	0.025846	no	ADPVSC
chr2_33532718_G_A_b38	RASGRP3	3.094	0.00212	0.055469	83	0.017929	no	ADPVSC
chr2_32919556_A_G_b38	RASGRP3	3.064	0.00233	0.06567	24	0.021429	no	ADPVSC
chr2_32913484_C_T_b38	RASGRP3	3.033	0.00258	0.064517	26	0.021271	no	ADPVSC
chr2_34216158_A_ATGTGTGTGTGTGTGTGTG_b38	RASGRP3	3	0.00287	0.060021	41	0.020009	no	ADPVSC
chr2_34273001_T_G_b38	RASGRP3	2.997	0.0029	0.168863	5	0.05635	no	ADPVSC
chr2_33731863_C_CCTTTCCTTAACTTCAGGACATACTGGGTTCCAGTATGTCCTTAA_b38	RASGRP3	2.985	0.00301	0.097533	5	0.032676	no	ADPVSC
chr2_32908249_T_G_b38	RASGRP3	2.98	0.00305	0.062863	26	0.021092	no	ADPVSC
chr2_32939379_C_T_b38	RASGRP3	2.964	0.00322	0.067482	18	0.022771	no	ADPVSC
chr2_32967511_C_T_b38	RASGRP3	-2.949	0.00338	-0.070223	19	0.023816	no	ADPVSC
chr2_32912514_C_A_b38	RASGRP3	2.948	0.00339	0.06262	26	0.021242	no	ADPVSC
chr2_32922791_T_C_b38	RASGRP3	2.931	0.00357	0.064895	20	0.022141	no	ADPVSC
chr2_32905757_AG_A_b38	RASGRP3	2.929	0.00359	0.069804	12	0.02383	no	ADPVSC
chr2_33536207_C_T_b38	RASGRP3	-2.927	0.00362	-0.055319	71	0.018903	no	ADPVSC
chr2_32920035_T_C_b38	RASGRP3	2.912	0.00379	0.062931	23	0.021609	no	ADPVSC
chr2_32890331_C_CAAAAAAAAAAAAA_b38	RASGRP3	2.906	0.00387	0.118359	8	0.04073	no	ADPVSC
chr2_33563470_A_ATACT_b38	RASGRP3	-2.902	0.00392	-0.085877	6	0.029596	no	ADPVSC
chr2_33006088_AT_A_b38	RASGRP3	2.901	0.00393	0.078337	14	0.027007	no	ADPVSC
chr2_32973413_A_G_b38	RASGRP3	2.876	0.00424	0.070598	18	0.024543	no	ADPVSC
chr2_33554839_T_C_b38	RASGRP3	2.863	0.00442	0.054866	62	0.019166	no	ADPVSC
chr2_33530852_CT_C_b38	RASGRP3	2.856	0.00452	0.051073	87	0.017884	no	ADPVSC
chr2_32950872_G_A_b38	RASGRP3	2.855	0.00452	0.065574	18	0.022965	no	ADPVSC
chr2_34088573_T_C_b38	RASGRP3	-2.854	0.00455	-0.057588	40	0.02018	no	ADPVSC
chr2_32907670_G_A_b38	RASGRP3	2.853	0.00455	0.061827	22	0.021669	no	ADPVSC
chr2_32943735_A_C_b38	RASGRP3	2.852	0.00458	0.059856	36	0.02099	no	ADPVSC
chr2_33562245_G_C_b38	RASGRP3	-2.843	0.00469	-0.054696	70	0.019236	no	ADPVSC
chr2_33087084_C_CTTTTTTTTTTT_b38	RASGRP3	-2.833	0.00485	-0.134793	5	0.047585	no	ADPVSC
chr2_32937787_A_G_b38	RASGRP3	2.828	0.00492	0.059568	36	0.021063	no	ADPVSC
chr2_34247571_T_C_b38	RASGRP3	2.827	0.00494	0.066696	15	0.023594	no	ADPVSC
chr2_32911795_G_T_b38	RASGRP3	2.816	0.0051	0.060012	25	0.021309	no	ADPVSC
chr2_34174182_A_G_b38	RASGRP3	-2.786	0.0056	-0.050646	122	0.018181	no	ADPVSC
chr2_32910687_T_C_b38	RASGRP3	2.781	0.00567	0.059771	24	0.02149	no	ADPVSC
chr2_33019406_G_T_b38	RASGRP3	2.758	0.00609	0.076229	14	0.027641	no	ADPVSC
chr2_34151569_G_A_b38	RASGRP3	2.757	0.00611	0.050507	66	0.018322	no	ADPVSC
chr2_32921441_C_CT_b38	RASGRP3	2.75	0.00623	0.059563	23	0.021659	no	ADPVSC
chr2_32921442_A_C_b38	RASGRP3	2.75	0.00623	0.059563	23	0.021659	no	ADPVSC
chr2_33546150_G_A_b38	RASGRP3	-2.747	0.00628	-0.051754	70	0.018837	no	ADPVSC
chr2_33539642_C_G_b38	RASGRP3	-2.743	0.00637	-0.051858	72	0.018906	no	ADPVSC
chr2_32976264_G_A_b38	RASGRP3	2.733	0.00656	0.071941	16	0.026326	no	ADPVSC
chr2_33556190_G_A_b38	RASGRP3	-2.733	0.00656	-0.052177	69	0.019094	no	ADPVSC
chr2_34149499_G_A_b38	RASGRP3	2.731	0.00659	0.049987	79	0.018303	no	ADPVSC
chr2_33264255_CA_C_b38	RASGRP3	2.722	0.00677	0.107913	7	0.039641	no	ADPVSC
chr2_34150995_C_T_b38	RASGRP3	2.721	0.00679	0.049862	77	0.018324	no	ADPVSC
chr2_33539434_T_C_b38	RASGRP3	-2.714	0.00694	-0.051337	72	0.018916	no	ADPVSC
chr2_33539436_C_G_b38	RASGRP3	-2.714	0.00694	-0.051337	72	0.018916	no	ADPVSC
chr2_33397506_C_CTT_b38	RASGRP3	2.709	0.00704	0.110294	6	0.040712	no	ADPVSC
chr2_32921523_C_CTTTTT_b38	RASGRP3	2.704	0.00715	0.080924	14	0.029932	no	ADPVSC
chr2_33522519_T_C_b38	RASGRP3	-2.703	0.00716	-0.051544	73	0.019068	no	ADPVSC
chr2_33672387_A_G_b38	RASGRP3	2.701	0.00721	0.064372	15	0.023831	no	ADPVSC
chr2_33540861_TA_T_b38	RASGRP3	-2.698	0.00727	-0.048326	72	0.01791	no	ADPVSC
chr2_34012405_G_T_b38	RASGRP3	2.686	0.00753	0.053537	35	0.01993	no	ADPVSC
chr2_33544520_G_GA_b38	RASGRP3	-2.684	0.00758	-0.052483	64	0.019553	no	ADPVSC
chr2_32933761_C_T_b38	RASGRP3	-2.676	0.00775	-0.052286	55	0.019537	no	ADPVSC
chr2_32933845_T_C_b38	RASGRP3	-2.676	0.00775	-0.052286	55	0.019537	no	ADPVSC
chr2_33539219_T_C_b38	RASGRP3	-2.674	0.00781	-0.050501	74	0.018889	no	ADPVSC
chr2_33534062_A_C_b38	RASGRP3	-2.671	0.00788	-0.069959	8	0.026196	no	ADPVSC
chr2_33508487_T_C_b38	RASGRP3	2.659	0.00815	0.07717	13	0.029023	no	ADPVSC
chr2_33532487_C_A_b38	RASGRP3	2.642	0.00857	0.046874	119	0.017743	no	ADPVSC
chr2_32933593_TTC_T_b38	RASGRP3	-2.632	0.00882	-0.050713	63	0.019269	no	ADPVSC
chr2_33965702_C_T_b38	RASGRP3	2.628	0.00893	0.050531	48	0.019231	no	ADPVSC
chr2_33709749_A_ATTTT_b38	RASGRP3	-2.608	0.00946	-0.130219	4	0.04994	no	ADPVSC
chr2_34011696_CA_C_b38	RASGRP3	-2.601	0.00963	-0.061585	10	0.023674	no	ADPVSC
chr2_32919346_A_AT_b38	RASGRP3	-2.595	0.0098	-0.060659	13	0.023374	no	ADPVSC
chr2_33546942_C_G_b38	RASGRP3	7.8	3.85e-13	0.212347	5	0.027224	yes	ADRNLG
chr2_33586869_A_T_b38	RASGRP3	6.373	1.34e-09	0.140317	16	0.022016	yes	ADRNLG
chr2_33565263_A_G_b38	RASGRP3	6.348	1.54e-09	0.139586	20	0.021988	yes	ADRNLG
chr2_33512177_G_A_b38	RASGRP3	6.005	9.39e-09	0.149701	10	0.024928	yes	ADRNLG
chr2_33596963_A_T_b38	RASGRP3	5.895	1.66e-08	0.131955	17	0.022385	yes	ADRNLG
chr2_33581561_C_T_b38	RASGRP3	5.642	5.96e-08	0.126339	17	0.022393	yes	ADRNLG
chr2_33555164_G_A_b38	RASGRP3	5.593	7.59e-08	0.140454	10	0.025111	yes	ADRNLG
chr2_33596450_T_G_b38	RASGRP3	5.584	7.94e-08	0.118066	24	0.021144	yes	ADRNLG
chr2_33672387_A_G_b38	RASGRP3	5.383	2.12e-07	0.135191	9	0.025115	yes	ADRNLG
chr2_33521266_C_T_b38	RASGRP3	5.364	2.33e-07	0.123489	16	0.023022	yes	ADRNLG
chr2_33536322_G_GA_b38	RASGRP3	5.29	3.32e-07	0.158771	6	0.030016	yes	ADRNLG
chr2_33523649_G_A_b38	RASGRP3	5.289	3.33e-07	0.136368	10	0.025782	yes	ADRNLG
chr2_33669427_A_C_b38	RASGRP3	5.269	3.66e-07	0.134764	8	0.025575	yes	ADRNLG
chr2_33561445_C_A_b38	RASGRP3	5.194	5.22e-07	0.130687	11	0.02516	yes	ADRNLG
chr2_33669574_A_G_b38	RASGRP3	5.143	6.63e-07	0.13208	8	0.02568	yes	ADRNLG
chr2_33657078_T_C_b38	RASGRP3	5.043	1.05e-06	0.107064	22	0.021228	yes	ADRNLG
chr2_33640631_A_C_b38	RASGRP3	4.975	1.44e-06	0.1151	15	0.023135	yes	ADRNLG
chr2_33663555_T_C_b38	RASGRP3	4.945	1.65e-06	0.114452	15	0.023143	yes	ADRNLG
chr2_33616325_C_T_b38	RASGRP3	4.855	2.49e-06	0.135138	7	0.027837	yes	ADRNLG
chr2_33639021_G_A_b38	RASGRP3	4.84	2.66e-06	0.112013	15	0.023143	yes	ADRNLG
chr2_33641397_G_C_b38	RASGRP3	4.84	2.66e-06	0.112013	15	0.023143	yes	ADRNLG
chr2_33525341_A_AAT_b38	RASGRP3	4.805	3.12e-06	0.108171	17	0.022514	yes	ADRNLG
chr2_33650021_A_G_b38	RASGRP3	4.804	3.13e-06	0.111088	15	0.023125	yes	ADRNLG
chr2_33656248_TTC_T_b38	RASGRP3	4.804	3.13e-06	0.111088	15	0.023125	yes	ADRNLG
chr2_33662459_C_T_b38	RASGRP3	4.804	3.13e-06	0.111088	15	0.023125	yes	ADRNLG
chr2_33529318_C_T_b38	RASGRP3	4.794	3.27e-06	0.124073	7	0.02588	yes	ADRNLG
chr2_33622160_C_T_b38	RASGRP3	4.792	3.3e-06	0.100726	25	0.02102	yes	ADRNLG
chr2_33652477_C_A_b38	RASGRP3	4.727	4.4e-06	0.10949	15	0.023163	yes	ADRNLG
chr2_33621819_C_A_b38	RASGRP3	4.652	6.1e-06	0.095484	32	0.020523	yes	ADRNLG
chr2_33623108_T_C_b38	RASGRP3	4.643	6.37e-06	0.09682	31	0.020855	yes	ADRNLG
chr2_33640513_G_C_b38	RASGRP3	4.631	6.69e-06	0.128195	7	0.027681	yes	ADRNLG
chr2_33606703_C_T_b38	RASGRP3	4.607	7.43e-06	0.130183	7	0.028257	yes	ADRNLG
chr2_33636858_C_G_b38	RASGRP3	4.597	7.75e-06	0.128762	7	0.028009	yes	ADRNLG
chr2_33637736_A_T_b38	RASGRP3	4.597	7.75e-06	0.128762	7	0.028009	yes	ADRNLG
chr2_33625315_G_A_b38	RASGRP3	4.581	8.32e-06	0.103122	20	0.022512	yes	ADRNLG
chr2_33656848_TA_T_b38	RASGRP3	4.534	1.02e-05	0.098621	21	0.021752	yes	ADRNLG
chr2_33547053_GAA_G_b38	RASGRP3	4.532	1.03e-05	0.164935	3	0.036394	yes	ADRNLG
chr2_33659035_G_A_b38	RASGRP3	4.502	1.16e-05	0.125249	7	0.027818	yes	ADRNLG
chr2_33634524_A_G_b38	RASGRP3	4.469	1.34e-05	0.125863	7	0.028161	yes	ADRNLG
chr2_33622592_T_C_b38	RASGRP3	4.468	1.35e-05	0.094432	29	0.021137	yes	ADRNLG
chr2_33667549_A_G_b38	RASGRP3	4.438	1.53e-05	0.124992	7	0.028162	yes	ADRNLG
chr2_33667555_A_G_b38	RASGRP3	4.438	1.53e-05	0.124992	7	0.028162	yes	ADRNLG
chr2_33627793_A_G_b38	RASGRP3	4.367	2.06e-05	0.120784	7	0.027657	yes	ADRNLG
chr2_33634816_G_T_b38	RASGRP3	4.332	2.38e-05	0.121269	7	0.027991	yes	ADRNLG
chr2_33605827_ATTTTTCT_A_b38	RASGRP3	4.301	2.7e-05	0.118893	7	0.027643	yes	ADRNLG
chr2_33564001_C_G_b38	RASGRP3	4.299	2.73e-05	0.092024	36	0.021406	yes	ADRNLG
chr2_33670716_C_T_b38	RASGRP3	4.228	3.65e-05	0.095599	19	0.022611	yes	ADRNLG
chr2_33661156_C_T_b38	RASGRP3	4.204	4.01e-05	0.097369	17	0.02316	yes	ADRNLG
chr2_33661310_C_T_b38	RASGRP3	4.204	4.01e-05	0.097369	17	0.02316	yes	ADRNLG
chr2_33591739_A_G_b38	RASGRP3	4.068	6.91e-05	0.088757	21	0.021817	yes	ADRNLG
chr2_33511010_G_A_b38	RASGRP3	4.061	7.1e-05	0.13347	5	0.032862	yes	ADRNLG
chr2_33613720_G_A_b38	RASGRP3	3.991	9.36e-05	0.10706	9	0.026826	yes	ADRNLG
chr2_33631243_G_GT_b38	RASGRP3	3.986	9.55e-05	0.11455	7	0.02874	yes	ADRNLG
chr2_33564467_A_G_b38	RASGRP3	3.973	1e-04	0.085311	37	0.021472	yes	ADRNLG
chr2_33547458_G_A_b38	RASGRP3	3.963	0.000104	0.086398	32	0.0218	yes	ADRNLG
chr2_33598472_A_C_b38	RASGRP3	3.926	0.00012	0.085045	21	0.021661	yes	ADRNLG
chr2_33620497_T_C_b38	RASGRP3	3.921	0.000123	0.097717	13	0.024919	yes	ADRNLG
chr2_33556928_C_CACACACATACAT_b38	RASGRP3	3.904	0.000131	0.119443	3	0.030598	yes	ADRNLG
chr2_33656916_G_A_b38	RASGRP3	3.903	0.000131	0.087274	24	0.022359	yes	ADRNLG
chr2_33596331_G_C_b38	RASGRP3	3.813	0.000185	0.099713	10	0.026152	yes	ADRNLG
chr2_33620575_G_A_b38	RASGRP3	3.81	0.000187	0.0953	13	0.025015	yes	ADRNLG
chr2_33634843_C_CTT_b38	RASGRP3	3.675	0.000308	0.113408	7	0.030855	yes	ADRNLG
chr2_33753914_G_T_b38	RASGRP3	3.662	0.000323	0.106073	6	0.028962	yes	ADRNLG
chr2_33582793_C_G_b38	RASGRP3	3.648	0.00034	0.076836	29	0.021062	yes	ADRNLG
chr2_33624881_G_GT_b38	RASGRP3	3.64	0.000351	0.083266	22	0.022878	yes	ADRNLG
chr2_33592814_T_C_b38	RASGRP3	3.626	0.000368	0.079509	21	0.021926	yes	ADRNLG
chr2_33591518_C_T_b38	RASGRP3	3.622	0.000374	0.079786	21	0.022026	yes	ADRNLG
chr2_33626436_A_T_b38	RASGRP3	3.619	0.000379	0.081437	23	0.022504	yes	ADRNLG
chr2_33590317_T_G_b38	RASGRP3	3.617	0.000381	0.083618	18	0.023116	yes	ADRNLG
chr2_33584227_A_G_b38	RASGRP3	3.609	0.000393	0.084238	17	0.023344	yes	ADRNLG
chr2_33611391_T_A_b38	RASGRP3	3.55	0.000484	0.078956	19	0.02224	yes	ADRNLG
chr2_33536322_GA_G_b38	RASGRP3	-3.542	0.000498	-0.082102	32	0.023177	yes	ADRNLG
chr2_33601894_C_G_b38	RASGRP3	3.487	0.000606	0.071989	31	0.020646	yes	ADRNLG
chr2_33726667_C_G_b38	RASGRP3	3.422	0.000761	0.10033	4	0.029323	yes	ADRNLG
chr2_33561192_A_G_b38	RASGRP3	3.42	0.000765	0.072906	48	0.021317	yes	ADRNLG
chr2_33596666_T_C_b38	RASGRP3	3.409	0.000793	0.072482	28	0.021259	yes	ADRNLG
chr2_33622130_C_CA_b38	RASGRP3	3.392	0.000843	0.105995	8	0.031251	yes	ADRNLG
chr2_33567745_C_T_b38	RASGRP3	-3.36	0.000941	-0.072964	39	0.021717	yes	ADRNLG
chr2_33771977_TC_T_b38	RASGRP3	3.352	0.000967	0.099021	6	0.029544	yes	ADRNLG
chr2_33568339_TA_T_b38	RASGRP3	-3.325	0.00106	-0.074528	44	0.022412	yes	ADRNLG
chr2_33587735_T_A_b38	RASGRP3	3.315	0.0011	0.069412	30	0.02094	yes	ADRNLG
chr2_33519891_C_T_b38	RASGRP3	-3.291	0.00119	-0.071627	43	0.021767	yes	ADRNLG
chr2_33771916_C_T_b38	RASGRP3	3.27	0.00127	0.093954	8	0.028731	yes	ADRNLG
chr2_33771954_G_T_b38	RASGRP3	3.27	0.00127	0.093954	8	0.028731	yes	ADRNLG
chr2_33770343_T_G_b38	RASGRP3	3.252	0.00135	0.073714	22	0.022668	yes	ADRNLG
chr2_33571342_T_C_b38	RASGRP3	-3.247	0.00138	-0.073029	41	0.022491	yes	ADRNLG
chr2_33958895_C_T_b38	RASGRP3	3.239	0.00141	0.179045	3	0.055275	yes	ADRNLG
chr2_33963083_G_A_b38	RASGRP3	3.239	0.00141	0.179045	3	0.055275	yes	ADRNLG
chr2_33931383_A_G_b38	RASGRP3	3.231	0.00145	0.182426	3	0.056464	yes	ADRNLG
chr2_33932829_G_A_b38	RASGRP3	3.231	0.00145	0.182426	3	0.056464	yes	ADRNLG
chr2_33935890_A_G_b38	RASGRP3	3.231	0.00145	0.182426	3	0.056464	yes	ADRNLG
chr2_33936525_T_C_b38	RASGRP3	3.231	0.00145	0.182426	3	0.056464	yes	ADRNLG
chr2_33936710_A_G_b38	RASGRP3	3.231	0.00145	0.182426	3	0.056464	yes	ADRNLG
chr2_33936731_C_G_b38	RASGRP3	3.231	0.00145	0.182426	3	0.056464	yes	ADRNLG
chr2_33937446_T_C_b38	RASGRP3	3.231	0.00145	0.182426	3	0.056464	yes	ADRNLG
chr2_33937710_T_C_b38	RASGRP3	3.231	0.00145	0.182426	3	0.056464	yes	ADRNLG
chr2_33940879_G_C_b38	RASGRP3	3.231	0.00145	0.182426	3	0.056464	yes	ADRNLG
chr2_33940881_G_A_b38	RASGRP3	3.231	0.00145	0.182426	3	0.056464	yes	ADRNLG
chr2_33941588_A_C_b38	RASGRP3	3.231	0.00145	0.182426	3	0.056464	yes	ADRNLG
chr2_33941659_G_A_b38	RASGRP3	3.231	0.00145	0.182426	3	0.056464	yes	ADRNLG
chr2_33941672_T_C_b38	RASGRP3	3.231	0.00145	0.182426	3	0.056464	yes	ADRNLG
chr2_33941674_A_G_b38	RASGRP3	3.231	0.00145	0.182426	3	0.056464	yes	ADRNLG
chr2_33942267_TTAAAA_T_b38	RASGRP3	3.231	0.00145	0.182426	3	0.056464	yes	ADRNLG
chr2_33942532_T_G_b38	RASGRP3	3.231	0.00145	0.182426	3	0.056464	yes	ADRNLG
chr2_33942554_A_G_b38	RASGRP3	3.231	0.00145	0.182426	3	0.056464	yes	ADRNLG
chr2_33942664_T_C_b38	RASGRP3	3.231	0.00145	0.182426	3	0.056464	yes	ADRNLG
chr2_33943025_A_G_b38	RASGRP3	3.231	0.00145	0.182426	3	0.056464	yes	ADRNLG
chr2_33943539_A_G_b38	RASGRP3	3.231	0.00145	0.182426	3	0.056464	yes	ADRNLG
chr2_33943661_C_G_b38	RASGRP3	3.231	0.00145	0.182426	3	0.056464	yes	ADRNLG
chr2_33943743_T_C_b38	RASGRP3	3.231	0.00145	0.182426	3	0.056464	yes	ADRNLG
chr2_33943800_C_G_b38	RASGRP3	3.231	0.00145	0.182426	3	0.056464	yes	ADRNLG
chr2_33944024_T_C_b38	RASGRP3	3.231	0.00145	0.182426	3	0.056464	yes	ADRNLG
chr2_33944149_T_TG_b38	RASGRP3	3.231	0.00145	0.182426	3	0.056464	yes	ADRNLG
chr2_33944284_G_A_b38	RASGRP3	3.231	0.00145	0.182426	3	0.056464	yes	ADRNLG
chr2_33944655_T_C_b38	RASGRP3	3.231	0.00145	0.182426	3	0.056464	yes	ADRNLG
chr2_33944848_G_A_b38	RASGRP3	3.231	0.00145	0.182426	3	0.056464	yes	ADRNLG
chr2_33945091_A_G_b38	RASGRP3	3.231	0.00145	0.182426	3	0.056464	yes	ADRNLG
chr2_33945259_T_A_b38	RASGRP3	3.231	0.00145	0.182426	3	0.056464	yes	ADRNLG
chr2_33945487_G_A_b38	RASGRP3	3.231	0.00145	0.182426	3	0.056464	yes	ADRNLG
chr2_33945627_T_C_b38	RASGRP3	3.231	0.00145	0.182426	3	0.056464	yes	ADRNLG
chr2_33945637_G_C_b38	RASGRP3	3.231	0.00145	0.182426	3	0.056464	yes	ADRNLG
chr2_33945865_T_C_b38	RASGRP3	3.231	0.00145	0.182426	3	0.056464	yes	ADRNLG
chr2_33946100_G_C_b38	RASGRP3	3.231	0.00145	0.182426	3	0.056464	yes	ADRNLG
chr2_33946630_T_C_b38	RASGRP3	3.231	0.00145	0.182426	3	0.056464	yes	ADRNLG
chr2_33957369_G_T_b38	RASGRP3	3.231	0.00145	0.182426	3	0.056464	yes	ADRNLG
chr2_33569371_A_G_b38	RASGRP3	-3.224	0.00149	-0.072388	42	0.022454	yes	ADRNLG
chr2_33605252_A_G_b38	RASGRP3	3.216	0.00153	0.070831	20	0.022028	yes	ADRNLG
chr2_33638203_C_CT_b38	RASGRP3	-3.211	0.00155	-0.081278	17	0.025311	yes	ADRNLG
chr2_33606131_A_G_b38	RASGRP3	3.202	0.0016	0.07382	18	0.023054	yes	ADRNLG
chr2_33771705_T_C_b38	RASGRP3	3.2	0.00161	0.073283	20	0.022898	yes	ADRNLG
chr2_33771715_A_G_b38	RASGRP3	3.2	0.00161	0.073283	20	0.022898	yes	ADRNLG
chr2_33771716_AATTG_A_b38	RASGRP3	3.2	0.00161	0.073283	20	0.022898	yes	ADRNLG
chr2_33577889_G_A_b38	RASGRP3	-3.196	0.00163	-0.072496	40	0.02268	yes	ADRNLG
chr2_33563203_CTTGTT_C_b38	RASGRP3	3.182	0.00171	0.069748	26	0.021919	yes	ADRNLG
chr2_33571267_T_A_b38	RASGRP3	-3.169	0.00178	-0.070038	42	0.022101	yes	ADRNLG
chr2_33605964_T_C_b38	RASGRP3	3.161	0.00183	0.082764	10	0.026181	yes	ADRNLG
chr2_33575950_G_A_b38	RASGRP3	-3.158	0.00185	-0.071291	40	0.022575	yes	ADRNLG
chr2_33794805_GT_G_b38	RASGRP3	3.141	0.00195	0.083176	8	0.026484	yes	ADRNLG
chr2_33572204_C_A_b38	RASGRP3	-3.111	0.00215	-0.070106	42	0.022538	yes	ADRNLG
chr2_33631252_G_T_b38	RASGRP3	3.098	0.00224	0.06269	63	0.020236	yes	ADRNLG
chr2_33771740_G_T_b38	RASGRP3	3.098	0.00224	0.071009	20	0.022922	yes	ADRNLG
chr2_33797230_G_T_b38	RASGRP3	3.093	0.00228	0.087173	9	0.028183	yes	ADRNLG
chr2_33758452_A_G_b38	RASGRP3	-3.088	0.00232	-0.067195	29	0.021763	yes	ADRNLG
chr2_33523461_TA_T_b38	RASGRP3	3.083	0.00235	0.084406	6	0.027377	yes	ADRNLG
chr2_33758476_T_G_b38	RASGRP3	-3.077	0.00239	-0.066804	31	0.021708	yes	ADRNLG
chr2_33721079_C_CGT_b38	RASGRP3	3.077	0.00239	0.09363	4	0.030425	yes	ADRNLG
chr2_33720623_ATGCGATT_A_b38	RASGRP3	3.075	0.00241	0.092843	4	0.030189	yes	ADRNLG
chr2_33648791_T_A_b38	RASGRP3	3.067	0.00247	0.070564	19	0.023006	yes	ADRNLG
chr2_33651073_T_C_b38	RASGRP3	3.067	0.00247	0.070564	19	0.023006	yes	ADRNLG
chr2_33605562_C_G_b38	RASGRP3	3.065	0.00249	0.066665	22	0.021754	yes	ADRNLG
chr2_33768312_A_C_b38	RASGRP3	-3.055	0.00257	-0.066587	29	0.021794	yes	ADRNLG
chr2_33769285_C_A_b38	RASGRP3	-3.055	0.00257	-0.066587	29	0.021794	yes	ADRNLG
chr2_33769488_A_G_b38	RASGRP3	-3.055	0.00257	-0.066587	29	0.021794	yes	ADRNLG
chr2_33769652_G_T_b38	RASGRP3	-3.055	0.00257	-0.066587	29	0.021794	yes	ADRNLG
chr2_33601612_AT_A_b38	RASGRP3	3.047	0.00263	0.065863	27	0.021614	yes	ADRNLG
chr2_33738746_A_C_b38	RASGRP3	3.02	0.00287	0.082919	5	0.027459	yes	ADRNLG
chr2_33637426_T_A_b38	RASGRP3	2.998	0.00308	0.078112	12	0.026058	yes	ADRNLG
chr2_33610078_G_C_b38	RASGRP3	2.991	0.00314	0.06987	17	0.023359	yes	ADRNLG
chr2_33610355_A_G_b38	RASGRP3	2.991	0.00314	0.06987	17	0.023359	yes	ADRNLG
chr2_33610531_A_G_b38	RASGRP3	2.991	0.00314	0.06987	17	0.023359	yes	ADRNLG
chr2_33610715_A_G_b38	RASGRP3	2.991	0.00314	0.06987	17	0.023359	yes	ADRNLG
chr2_33618402_A_G_b38	RASGRP3	2.991	0.00314	0.06987	17	0.023359	yes	ADRNLG
chr2_33619352_A_G_b38	RASGRP3	2.991	0.00314	0.06987	17	0.023359	yes	ADRNLG
chr2_33620490_A_G_b38	RASGRP3	2.991	0.00314	0.06987	17	0.023359	yes	ADRNLG
chr2_33610975_T_G_b38	RASGRP3	2.985	0.00321	0.070063	17	0.023474	yes	ADRNLG
chr2_33612720_T_G_b38	RASGRP3	2.985	0.00321	0.070063	17	0.023474	yes	ADRNLG
chr2_33554839_T_C_b38	RASGRP3	2.969	0.00337	0.066635	32	0.022447	yes	ADRNLG
chr2_33762650_T_A_b38	RASGRP3	-2.967	0.00339	-0.064389	30	0.021704	yes	ADRNLG
chr2_33768405_T_A_b38	RASGRP3	-2.956	0.00351	-0.06441	29	0.021793	yes	ADRNLG
chr2_33768709_T_C_b38	RASGRP3	-2.956	0.00351	-0.06441	29	0.021793	yes	ADRNLG
chr2_33797496_T_C_b38	RASGRP3	2.944	0.00364	0.083897	8	0.028497	yes	ADRNLG
chr2_33664484_C_CTAAA_b38	RASGRP3	2.943	0.00365	0.069074	17	0.023468	yes	ADRNLG
chr2_33509815_G_A_b38	RASGRP3	2.938	0.00371	0.073889	12	0.025153	yes	ADRNLG
chr2_33726462_A_AT_b38	RASGRP3	2.936	0.00373	0.084523	5	0.028789	yes	ADRNLG
chr2_33521739_T_A_b38	RASGRP3	2.933	0.00377	0.072949	12	0.024873	yes	ADRNLG
chr2_33508652_C_G_b38	RASGRP3	2.929	0.00381	0.063042	30	0.021521	yes	ADRNLG
chr2_33769074_A_G_b38	RASGRP3	-2.927	0.00383	-0.063573	30	0.021717	yes	ADRNLG
chr2_33934344_T_C_b38	RASGRP3	2.927	0.00383	0.164241	3	0.056111	yes	ADRNLG
chr2_33934506_C_T_b38	RASGRP3	2.927	0.00383	0.164241	3	0.056111	yes	ADRNLG
chr2_33936833_G_A_b38	RASGRP3	2.927	0.00383	0.164241	3	0.056111	yes	ADRNLG
chr2_33944263_G_A_b38	RASGRP3	2.927	0.00383	0.164241	3	0.056111	yes	ADRNLG
chr2_33954566_C_G_b38	RASGRP3	2.927	0.00383	0.164241	3	0.056111	yes	ADRNLG
chr2_33954956_G_C_b38	RASGRP3	2.927	0.00383	0.164241	3	0.056111	yes	ADRNLG
chr2_33202062_G_C_b38	RASGRP3	2.921	0.00391	0.14142	3	0.048414	yes	ADRNLG
chr2_33518738_C_T_b38	RASGRP3	2.919	0.00393	0.0716	14	0.024531	yes	ADRNLG
chr2_34140008_C_G_b38	RASGRP3	2.907	0.00407	0.187117	3	0.06436	yes	ADRNLG
chr2_33614844_A_G_b38	RASGRP3	2.903	0.00413	0.063867	22	0.021999	yes	ADRNLG
chr2_33933541_CTCCTTCCTTCCT_C_b38	RASGRP3	2.896	0.00422	0.116148	3	0.040106	yes	ADRNLG
chr2_33767664_G_A_b38	RASGRP3	-2.892	0.00427	-0.063224	29	0.021864	yes	ADRNLG
chr2_33945769_TA_T_b38	RASGRP3	2.871	0.00455	0.152476	3	0.053111	yes	ADRNLG
chr2_33517217_G_A_b38	RASGRP3	2.869	0.00458	0.071322	13	0.024858	yes	ADRNLG
chr2_33522218_G_A_b38	RASGRP3	2.863	0.00467	0.071273	12	0.024896	yes	ADRNLG
chr2_33428699_T_A_b38	RASGRP3	2.851	0.00483	0.075529	11	0.02649	yes	ADRNLG
chr2_33794022_T_G_b38	RASGRP3	2.849	0.00486	0.080197	8	0.028148	yes	ADRNLG
chr2_33428683_T_A_b38	RASGRP3	2.845	0.00492	0.080006	8	0.028119	yes	ADRNLG
chr2_33793837_A_C_b38	RASGRP3	2.841	0.00498	0.08198	8	0.028857	yes	ADRNLG
chr2_33765535_C_T_b38	RASGRP3	-2.841	0.00499	-0.062317	29	0.021938	yes	ADRNLG
chr2_33765648_T_C_b38	RASGRP3	-2.841	0.00499	-0.062317	29	0.021938	yes	ADRNLG
chr2_33766277_T_C_b38	RASGRP3	-2.841	0.00499	-0.062317	29	0.021938	yes	ADRNLG
chr2_33766488_G_A_b38	RASGRP3	-2.841	0.00499	-0.062317	29	0.021938	yes	ADRNLG
chr2_33766502_A_C_b38	RASGRP3	-2.841	0.00499	-0.062317	29	0.021938	yes	ADRNLG
chr2_33766946_G_A_b38	RASGRP3	-2.841	0.00499	-0.062317	29	0.021938	yes	ADRNLG
chr2_33758633_A_G_b38	RASGRP3	-2.836	0.00505	-0.061828	30	0.021798	yes	ADRNLG
chr2_33522498_A_G_b38	RASGRP3	2.832	0.00513	0.070624	12	0.024942	yes	ADRNLG
chr2_33764603_A_G_b38	RASGRP3	-2.83	0.00515	-0.062049	29	0.021923	yes	ADRNLG
chr2_33261835_T_G_b38	RASGRP3	2.82	0.0053	0.060912	32	0.021596	yes	ADRNLG
chr2_33764454_T_C_b38	RASGRP3	-2.81	0.00547	-0.061368	30	0.02184	yes	ADRNLG
chr2_33766547_T_G_b38	RASGRP3	-2.81	0.00547	-0.061368	30	0.02184	yes	ADRNLG
chr2_33767410_A_C_b38	RASGRP3	-2.806	0.00554	-0.061685	29	0.021985	yes	ADRNLG
chr2_33767897_C_T_b38	RASGRP3	-2.806	0.00554	-0.061685	29	0.021985	yes	ADRNLG
chr2_33758557_G_A_b38	RASGRP3	-2.802	0.00559	-0.061518	29	0.021952	yes	ADRNLG
chr2_33798456_A_G_b38	RASGRP3	-2.802	0.0056	-0.077823	9	0.027776	yes	ADRNLG
chr2_33604404_G_GTA_b38	RASGRP3	2.801	0.00561	0.083652	4	0.029864	yes	ADRNLG
chr2_33602067_G_C_b38	RASGRP3	2.798	0.00567	0.075739	9	0.027069	yes	ADRNLG
chr2_33758105_T_A_b38	RASGRP3	-2.781	0.00596	-0.061249	28	0.022024	yes	ADRNLG
chr2_33758169_T_C_b38	RASGRP3	-2.781	0.00596	-0.061249	28	0.022024	yes	ADRNLG
chr2_33758243_C_T_b38	RASGRP3	-2.781	0.00596	-0.061249	28	0.022024	yes	ADRNLG
chr2_33758156_C_T_b38	RASGRP3	-2.778	0.00601	-0.060646	29	0.021828	yes	ADRNLG
chr2_33662079_T_C_b38	RASGRP3	2.777	0.00603	0.065055	17	0.023428	yes	ADRNLG
chr2_33664637_A_T_b38	RASGRP3	2.777	0.00603	0.065055	17	0.023428	yes	ADRNLG
chr2_33525341_AAT_A_b38	RASGRP3	-2.758	0.00637	-0.084671	4	0.030698	yes	ADRNLG
chr2_33754448_T_C_b38	RASGRP3	-2.749	0.00656	-0.061065	28	0.022217	yes	ADRNLG
chr2_33765389_GT_G_b38	RASGRP3	-2.748	0.00658	-0.063061	26	0.022952	yes	ADRNLG
chr2_33539650_C_T_b38	RASGRP3	2.746	0.00661	0.067555	13	0.024603	yes	ADRNLG
chr2_33539888_A_T_b38	RASGRP3	2.746	0.00661	0.067555	13	0.024603	yes	ADRNLG
chr2_33932127_T_C_b38	RASGRP3	2.742	0.00668	0.0876	6	0.031946	yes	ADRNLG
chr2_33935703_T_C_b38	RASGRP3	2.742	0.00668	0.0876	6	0.031946	yes	ADRNLG
chr2_33936043_AT_A_b38	RASGRP3	2.742	0.00668	0.0876	6	0.031946	yes	ADRNLG
chr2_33936329_C_T_b38	RASGRP3	2.742	0.00668	0.0876	6	0.031946	yes	ADRNLG
chr2_33764131_T_C_b38	RASGRP3	-2.741	0.00669	-0.060127	29	0.021932	yes	ADRNLG
chr2_33766447_A_G_b38	RASGRP3	-2.741	0.00669	-0.060127	29	0.021932	yes	ADRNLG
chr2_33764670_T_A_b38	RASGRP3	-2.733	0.00686	-0.059941	29	0.021931	yes	ADRNLG
chr2_33770662_T_C_b38	RASGRP3	-2.724	0.00704	-0.060281	29	0.022126	yes	ADRNLG
chr2_33530930_T_C_b38	RASGRP3	2.722	0.0071	0.067525	13	0.024811	yes	ADRNLG
chr2_33428691_T_A_b38	RASGRP3	2.719	0.00716	0.076426	8	0.028113	yes	ADRNLG
chr2_33763276_A_C_b38	RASGRP3	-2.714	0.00726	-0.0593	30	0.021851	yes	ADRNLG
chr2_33763677_T_C_b38	RASGRP3	-2.714	0.00726	-0.0593	30	0.021851	yes	ADRNLG
chr2_33764585_G_A_b38	RASGRP3	-2.714	0.00726	-0.0593	30	0.021851	yes	ADRNLG
chr2_33765176_T_A_b38	RASGRP3	-2.714	0.00726	-0.0593	30	0.021851	yes	ADRNLG
chr2_33525080_C_CA_b38	RASGRP3	-2.712	0.00729	-0.079572	7	0.029337	yes	ADRNLG
chr2_33202022_AACACACAC_A_b38	RASGRP3	2.711	0.00731	0.084573	5	0.031195	yes	ADRNLG
chr2_33662493_G_A_b38	RASGRP3	2.693	0.00772	0.063163	17	0.023458	yes	ADRNLG
chr2_33767220_GAA_G_b38	RASGRP3	-2.691	0.00775	-0.059664	29	0.022171	yes	ADRNLG
chr2_33756434_A_G_b38	RASGRP3	-2.691	0.00775	-0.058963	29	0.021912	yes	ADRNLG
chr2_33760998_A_T_b38	RASGRP3	-2.689	0.0078	-0.056653	34	0.021069	yes	ADRNLG
chr2_33756220_C_T_b38	RASGRP3	-2.679	0.00803	-0.059257	28	0.02212	yes	ADRNLG
chr2_33936931_CTT_C_b38	RASGRP3	2.672	0.00819	0.085733	5	0.032089	yes	ADRNLG
chr2_33917976_C_A_b38	RASGRP3	-2.67	0.00823	-0.056618	45	0.021203	yes	ADRNLG
chr2_33920059_TG_T_b38	RASGRP3	-2.668	0.00829	-0.056166	46	0.021055	yes	ADRNLG
chr2_33762557_G_C_b38	RASGRP3	-2.667	0.0083	-0.058971	29	0.022109	yes	ADRNLG
chr2_33762665_A_G_b38	RASGRP3	-2.667	0.0083	-0.058971	29	0.022109	yes	ADRNLG
chr2_33763206_C_T_b38	RASGRP3	-2.667	0.0083	-0.058971	29	0.022109	yes	ADRNLG
chr2_33765637_C_G_b38	RASGRP3	-2.667	0.0083	-0.058971	29	0.022109	yes	ADRNLG
chr2_33765984_G_C_b38	RASGRP3	-2.667	0.0083	-0.058971	29	0.022109	yes	ADRNLG
chr2_33768109_G_C_b38	RASGRP3	-2.667	0.0083	-0.058971	29	0.022109	yes	ADRNLG
chr2_33768906_G_C_b38	RASGRP3	-2.667	0.0083	-0.058971	29	0.022109	yes	ADRNLG
chr2_33545661_T_C_b38	RASGRP3	2.663	0.00841	0.066366	12	0.024925	yes	ADRNLG
chr2_33428559_G_T_b38	RASGRP3	2.661	0.00845	0.07211	9	0.0271	yes	ADRNLG
chr2_33614709_C_CTGTT_b38	RASGRP3	2.661	0.00846	0.062184	17	0.023372	yes	ADRNLG
chr2_33055167_G_A_b38	RASGRP3	-2.653	0.00863	-0.106686	7	0.040206	yes	ADRNLG
chr2_33627422_T_C_b38	RASGRP3	2.653	0.00864	0.059013	24	0.022242	yes	ADRNLG
chr2_33627559_G_A_b38	RASGRP3	2.653	0.00864	0.059013	24	0.022242	yes	ADRNLG
chr2_34109406_C_G_b38	RASGRP3	-2.647	0.00878	-0.05576	37	0.021061	yes	ADRNLG
chr2_33754928_G_A_b38	RASGRP3	-2.647	0.0088	-0.058732	28	0.022191	yes	ADRNLG
chr2_33755461_G_T_b38	RASGRP3	-2.647	0.0088	-0.058732	28	0.022191	yes	ADRNLG
chr2_33797953_T_C_b38	RASGRP3	2.632	0.00918	0.072099	9	0.027395	yes	ADRNLG
chr2_33798065_T_C_b38	RASGRP3	2.632	0.00918	0.072099	9	0.027395	yes	ADRNLG
chr2_34313104_A_C_b38	RASGRP3	-2.614	0.00965	-0.095832	9	0.036655	yes	ADRNLG
chr2_33509059_T_G_b38	RASGRP3	-2.609	0.00979	-0.073689	6	0.028242	yes	ADRNLG
chr2_33941746_G_A_b38	RASGRP3	2.609	0.0098	0.084235	6	0.032289	yes	ADRNLG
chr2_33531453_C_T_b38	RASGRP3	7.507	2.2e-12	0.202426	4	0.026963	no	ADRNLG
chr2_33526597_C_T_b38	RASGRP3	7.299	7.48e-12	0.20479	3	0.028057	no	ADRNLG
chr2_33527062_GC_G_b38	RASGRP3	7.299	7.48e-12	0.20479	3	0.028057	no	ADRNLG
chr2_33557844_G_A_b38	RASGRP3	7.032	3.47e-11	0.191491	4	0.027229	no	ADRNLG
chr2_33529269_C_A_b38	RASGRP3	6.836	1.06e-10	0.188308	4	0.027548	no	ADRNLG
chr2_33537330_C_CCCAACACA_b38	RASGRP3	6.502	6.68e-10	0.159527	14	0.024535	no	ADRNLG
chr2_33540561_TGTGTGTGTGTG_T_b38	RASGRP3	6.357	1.47e-09	0.176455	7	0.027759	no	ADRNLG
chr2_33594326_C_T_b38	RASGRP3	5.818	2.46e-08	0.131602	16	0.02262	no	ADRNLG
chr2_33594385_G_A_b38	RASGRP3	5.818	2.46e-08	0.131602	16	0.02262	no	ADRNLG
chr2_33596617_C_T_b38	RASGRP3	5.67	5.18e-08	0.128352	16	0.022637	no	ADRNLG
chr2_33590881_T_C_b38	RASGRP3	5.587	7.83e-08	0.118691	23	0.021245	no	ADRNLG
chr2_33582025_C_T_b38	RASGRP3	5.567	8.62e-08	0.126008	16	0.022633	no	ADRNLG
chr2_33589264_G_C_b38	RASGRP3	5.503	1.18e-07	0.117359	23	0.021327	no	ADRNLG
chr2_33563965_A_G_b38	RASGRP3	4.524	1.06e-05	0.12035	9	0.026602	no	ADRNLG
chr2_33581338_T_A_b38	RASGRP3	4.5	1.18e-05	0.119575	9	0.026572	no	ADRNLG
chr2_33581900_A_T_b38	RASGRP3	4.394	1.84e-05	0.117285	9	0.026692	no	ADRNLG
chr2_33176592_A_C_b38	RASGRP3	3.892	0.000137	0.187157	3	0.048091	no	ADRNLG
chr2_33532487_C_A_b38	RASGRP3	3.865	0.000152	0.080469	56	0.020819	no	ADRNLG
chr2_33177707_A_G_b38	RASGRP3	3.806	0.00019	0.187658	3	0.049307	no	ADRNLG
chr2_33151823_TTGTGTGTGTGTG_T_b38	RASGRP3	3.627	0.000367	0.145895	4	0.040221	no	ADRNLG
chr2_33964276_G_A_b38	RASGRP3	3.554	0.000478	0.197861	3	0.055673	no	ADRNLG
chr2_33176504_C_A_b38	RASGRP3	3.553	0.000479	0.174919	3	0.049228	no	ADRNLG
chr2_33176525_GACA_G_b38	RASGRP3	3.553	0.000479	0.174919	3	0.049228	no	ADRNLG
chr2_33176610_A_G_b38	RASGRP3	3.553	0.000479	0.174919	3	0.049228	no	ADRNLG
chr2_33177259_T_C_b38	RASGRP3	3.553	0.000479	0.174919	3	0.049228	no	ADRNLG
chr2_33177488_A_G_b38	RASGRP3	3.553	0.000479	0.174919	3	0.049228	no	ADRNLG
chr2_33177590_C_T_b38	RASGRP3	3.553	0.000479	0.174919	3	0.049228	no	ADRNLG
chr2_33177591_T_G_b38	RASGRP3	3.553	0.000479	0.174919	3	0.049228	no	ADRNLG
chr2_33177613_A_T_b38	RASGRP3	3.553	0.000479	0.174919	3	0.049228	no	ADRNLG
chr2_33177616_C_T_b38	RASGRP3	3.553	0.000479	0.174919	3	0.049228	no	ADRNLG
chr2_33177880_A_C_b38	RASGRP3	3.553	0.000479	0.174919	3	0.049228	no	ADRNLG
chr2_33178333_G_A_b38	RASGRP3	3.553	0.000479	0.174919	3	0.049228	no	ADRNLG
chr2_33178488_T_G_b38	RASGRP3	3.553	0.000479	0.174919	3	0.049228	no	ADRNLG
chr2_33178543_ATTG_A_b38	RASGRP3	3.553	0.000479	0.174919	3	0.049228	no	ADRNLG
chr2_33179042_C_G_b38	RASGRP3	3.553	0.000479	0.174919	3	0.049228	no	ADRNLG
chr2_33179173_T_G_b38	RASGRP3	3.553	0.000479	0.174919	3	0.049228	no	ADRNLG
chr2_33179174_T_C_b38	RASGRP3	3.553	0.000479	0.174919	3	0.049228	no	ADRNLG
chr2_33179198_A_AT_b38	RASGRP3	3.553	0.000479	0.174919	3	0.049228	no	ADRNLG
chr2_33179348_G_A_b38	RASGRP3	3.553	0.000479	0.174919	3	0.049228	no	ADRNLG
chr2_33179798_G_C_b38	RASGRP3	3.553	0.000479	0.174919	3	0.049228	no	ADRNLG
chr2_33179809_C_G_b38	RASGRP3	3.553	0.000479	0.174919	3	0.049228	no	ADRNLG
chr2_33180574_C_G_b38	RASGRP3	3.553	0.000479	0.174919	3	0.049228	no	ADRNLG
chr2_33168355_T_C_b38	RASGRP3	3.536	0.000508	0.219862	3	0.062171	no	ADRNLG
chr2_33945248_A_T_b38	RASGRP3	3.461	0.000663	0.188121	3	0.054356	no	ADRNLG
chr2_33178153_A_G_b38	RASGRP3	3.442	0.000708	0.211553	3	0.06146	no	ADRNLG
chr2_33180746_G_A_b38	RASGRP3	3.358	0.000947	0.166193	3	0.049495	no	ADRNLG
chr2_33180911_G_T_b38	RASGRP3	3.358	0.000947	0.166193	3	0.049495	no	ADRNLG
chr2_33181116_C_T_b38	RASGRP3	3.358	0.000947	0.166193	3	0.049495	no	ADRNLG
chr2_33181606_C_G_b38	RASGRP3	3.358	0.000947	0.166193	3	0.049495	no	ADRNLG
chr2_33183247_T_A_b38	RASGRP3	3.358	0.000947	0.166193	3	0.049495	no	ADRNLG
chr2_33184042_C_T_b38	RASGRP3	3.358	0.000947	0.166193	3	0.049495	no	ADRNLG
chr2_33184621_G_A_b38	RASGRP3	3.358	0.000947	0.166193	3	0.049495	no	ADRNLG
chr2_33184714_C_T_b38	RASGRP3	3.358	0.000947	0.166193	3	0.049495	no	ADRNLG
chr2_33185331_A_G_b38	RASGRP3	3.358	0.000947	0.166193	3	0.049495	no	ADRNLG
chr2_33185336_G_A_b38	RASGRP3	3.358	0.000947	0.166193	3	0.049495	no	ADRNLG
chr2_33185419_C_T_b38	RASGRP3	3.358	0.000947	0.166193	3	0.049495	no	ADRNLG
chr2_33185914_C_G_b38	RASGRP3	3.358	0.000947	0.166193	3	0.049495	no	ADRNLG
chr2_33186498_AG_A_b38	RASGRP3	3.358	0.000947	0.166193	3	0.049495	no	ADRNLG
chr2_33186799_A_G_b38	RASGRP3	3.358	0.000947	0.166193	3	0.049495	no	ADRNLG
chr2_33190077_G_A_b38	RASGRP3	3.358	0.000947	0.166193	3	0.049495	no	ADRNLG
chr2_33193067_A_G_b38	RASGRP3	3.358	0.000947	0.166193	3	0.049495	no	ADRNLG
chr2_33194882_T_A_b38	RASGRP3	3.358	0.000947	0.166193	3	0.049495	no	ADRNLG
chr2_33195059_T_G_b38	RASGRP3	3.358	0.000947	0.166193	3	0.049495	no	ADRNLG
chr2_33196240_C_T_b38	RASGRP3	3.358	0.000947	0.166193	3	0.049495	no	ADRNLG
chr2_33153512_A_G_b38	RASGRP3	3.347	0.000984	0.20694	3	0.061835	no	ADRNLG
chr2_33155254_T_C_b38	RASGRP3	3.347	0.000984	0.20694	3	0.061835	no	ADRNLG
chr2_33537323_G_A_b38	RASGRP3	3.334	0.00103	0.065937	51	0.019776	no	ADRNLG
chr2_33177942_A_G_b38	RASGRP3	3.292	0.00118	0.161816	3	0.049155	no	ADRNLG
chr2_33177947_C_T_b38	RASGRP3	3.292	0.00118	0.161816	3	0.049155	no	ADRNLG
chr2_33742833_C_A_b38	RASGRP3	3.28	0.00123	0.071912	36	0.021924	no	ADRNLG
chr2_33742831_CT_C_b38	RASGRP3	3.208	0.00157	0.071168	36	0.022184	no	ADRNLG
chr2_33409773_A_T_b38	RASGRP3	3.183	0.0017	0.215087	3	0.067571	no	ADRNLG
chr2_33747865_C_T_b38	RASGRP3	3.159	0.00184	0.073346	18	0.023218	no	ADRNLG
chr2_33771480_T_C_b38	RASGRP3	3.133	0.002	0.071133	21	0.022704	no	ADRNLG
chr2_33771584_G_A_b38	RASGRP3	3.133	0.002	0.071133	21	0.022704	no	ADRNLG
chr2_33177659_C_A_b38	RASGRP3	3.113	0.00213	0.200024	3	0.064254	no	ADRNLG
chr2_33770196_A_G_b38	RASGRP3	3.109	0.00216	0.071061	21	0.022857	no	ADRNLG
chr2_33770292_G_C_b38	RASGRP3	3.109	0.00216	0.071061	21	0.022857	no	ADRNLG
chr2_33770360_T_C_b38	RASGRP3	3.109	0.00216	0.071061	21	0.022857	no	ADRNLG
chr2_33770545_C_T_b38	RASGRP3	3.109	0.00216	0.071061	21	0.022857	no	ADRNLG
chr2_33770718_A_C_b38	RASGRP3	3.109	0.00216	0.071061	21	0.022857	no	ADRNLG
chr2_33771282_C_A_b38	RASGRP3	3.109	0.00216	0.071061	21	0.022857	no	ADRNLG
chr2_33771305_A_ATGTC_b38	RASGRP3	3.109	0.00216	0.071061	21	0.022857	no	ADRNLG
chr2_33771310_T_TGTG_b38	RASGRP3	3.109	0.00216	0.071061	21	0.022857	no	ADRNLG
chr2_33739711_G_A_b38	RASGRP3	3.09	0.0023	0.066816	29	0.021622	no	ADRNLG
chr2_33739860_A_G_b38	RASGRP3	3.09	0.0023	0.066816	29	0.021622	no	ADRNLG
chr2_33740039_G_C_b38	RASGRP3	3.09	0.0023	0.066816	29	0.021622	no	ADRNLG
chr2_33740083_G_T_b38	RASGRP3	3.09	0.0023	0.066816	29	0.021622	no	ADRNLG
chr2_33740361_C_G_b38	RASGRP3	3.09	0.0023	0.066816	29	0.021622	no	ADRNLG
chr2_33742821_A_C_b38	RASGRP3	3.09	0.0023	0.064895	31	0.021004	no	ADRNLG
chr2_33947329_C_CAGAA_b38	RASGRP3	-3.086	0.00233	-0.091905	12	0.029782	no	ADRNLG
chr2_33737899_G_A_b38	RASGRP3	3.072	0.00243	0.067612	27	0.022006	no	ADRNLG
chr2_33751824_A_G_b38	RASGRP3	3.066	0.00248	0.072217	17	0.023555	no	ADRNLG
chr2_33537321_C_CA_b38	RASGRP3	3.058	0.00255	0.067934	25	0.022217	no	ADRNLG
chr2_33751718_CT_C_b38	RASGRP3	3.057	0.00255	0.065906	28	0.021559	no	ADRNLG
chr2_33744736_T_G_b38	RASGRP3	3.052	0.0026	0.06608	28	0.021652	no	ADRNLG
chr2_33744737_T_G_b38	RASGRP3	3.052	0.0026	0.06608	28	0.021652	no	ADRNLG
chr2_33744742_G_C_b38	RASGRP3	3.052	0.0026	0.06608	28	0.021652	no	ADRNLG
chr2_33771507_G_A_b38	RASGRP3	3.044	0.00266	0.068895	21	0.022635	no	ADRNLG
chr2_33911403_A_G_b38	RASGRP3	3.041	0.00269	0.157001	5	0.051632	no	ADRNLG
chr2_33911426_A_G_b38	RASGRP3	3.041	0.00269	0.157001	5	0.051632	no	ADRNLG
chr2_33742892_G_A_b38	RASGRP3	3.017	0.0029	0.06482	28	0.021484	no	ADRNLG
chr2_33752444_C_T_b38	RASGRP3	3.017	0.0029	0.06482	28	0.021484	no	ADRNLG
chr2_33770624_C_T_b38	RASGRP3	3.008	0.00298	0.068847	21	0.022886	no	ADRNLG
chr2_33770852_A_G_b38	RASGRP3	3.008	0.00298	0.068847	21	0.022886	no	ADRNLG
chr2_33770953_C_T_b38	RASGRP3	3.008	0.00298	0.068847	21	0.022886	no	ADRNLG
chr2_33745304_C_T_b38	RASGRP3	3.003	0.00303	0.06478	28	0.021573	no	ADRNLG
chr2_33648229_A_G_b38	RASGRP3	3.003	0.00303	0.069452	20	0.02313	no	ADRNLG
chr2_33740473_T_A_b38	RASGRP3	2.983	0.00323	0.064424	28	0.021599	no	ADRNLG
chr2_33740662_G_A_b38	RASGRP3	2.983	0.00323	0.064424	28	0.021599	no	ADRNLG
chr2_33740781_G_T_b38	RASGRP3	2.983	0.00323	0.064424	28	0.021599	no	ADRNLG
chr2_33740910_C_T_b38	RASGRP3	2.983	0.00323	0.064424	28	0.021599	no	ADRNLG
chr2_33741215_T_C_b38	RASGRP3	2.983	0.00323	0.064424	28	0.021599	no	ADRNLG
chr2_33741494_G_A_b38	RASGRP3	2.983	0.00323	0.064424	28	0.021599	no	ADRNLG
chr2_33741755_C_A_b38	RASGRP3	2.983	0.00323	0.064424	28	0.021599	no	ADRNLG
chr2_33741790_C_T_b38	RASGRP3	2.983	0.00323	0.064424	28	0.021599	no	ADRNLG
chr2_33741881_T_C_b38	RASGRP3	2.983	0.00323	0.064424	28	0.021599	no	ADRNLG
chr2_33741952_G_A_b38	RASGRP3	2.983	0.00323	0.064424	28	0.021599	no	ADRNLG
chr2_33742563_T_C_b38	RASGRP3	2.983	0.00323	0.064424	28	0.021599	no	ADRNLG
chr2_33742583_A_G_b38	RASGRP3	2.983	0.00323	0.064424	28	0.021599	no	ADRNLG
chr2_33742674_G_A_b38	RASGRP3	2.983	0.00323	0.064424	28	0.021599	no	ADRNLG
chr2_33743109_C_T_b38	RASGRP3	2.983	0.00323	0.064424	28	0.021599	no	ADRNLG
chr2_33743221_A_G_b38	RASGRP3	2.983	0.00323	0.064424	28	0.021599	no	ADRNLG
chr2_33743236_T_G_b38	RASGRP3	2.983	0.00323	0.064424	28	0.021599	no	ADRNLG
chr2_33743424_T_C_b38	RASGRP3	2.983	0.00323	0.064424	28	0.021599	no	ADRNLG
chr2_33743431_G_C_b38	RASGRP3	2.983	0.00323	0.064424	28	0.021599	no	ADRNLG
chr2_33743651_C_T_b38	RASGRP3	2.983	0.00323	0.064424	28	0.021599	no	ADRNLG
chr2_33744228_T_G_b38	RASGRP3	2.983	0.00323	0.064424	28	0.021599	no	ADRNLG
chr2_33744471_C_A_b38	RASGRP3	2.983	0.00323	0.064424	28	0.021599	no	ADRNLG
chr2_33744899_G_A_b38	RASGRP3	2.983	0.00323	0.064424	28	0.021599	no	ADRNLG
chr2_33745194_G_A_b38	RASGRP3	2.983	0.00323	0.064424	28	0.021599	no	ADRNLG
chr2_33745393_A_G_b38	RASGRP3	2.983	0.00323	0.064424	28	0.021599	no	ADRNLG
chr2_33745457_C_A_b38	RASGRP3	2.983	0.00323	0.064424	28	0.021599	no	ADRNLG
chr2_33745474_G_A_b38	RASGRP3	2.983	0.00323	0.064424	28	0.021599	no	ADRNLG
chr2_33745704_C_T_b38	RASGRP3	2.983	0.00323	0.064424	28	0.021599	no	ADRNLG
chr2_33745889_T_G_b38	RASGRP3	2.983	0.00323	0.064424	28	0.021599	no	ADRNLG
chr2_33745919_T_G_b38	RASGRP3	2.983	0.00323	0.064424	28	0.021599	no	ADRNLG
chr2_33745923_G_A_b38	RASGRP3	2.983	0.00323	0.064424	28	0.021599	no	ADRNLG
chr2_33745939_T_C_b38	RASGRP3	2.983	0.00323	0.064424	28	0.021599	no	ADRNLG
chr2_33746746_G_A_b38	RASGRP3	2.983	0.00323	0.064424	28	0.021599	no	ADRNLG
chr2_33747023_G_A_b38	RASGRP3	2.983	0.00323	0.064424	28	0.021599	no	ADRNLG
chr2_33747077_G_A_b38	RASGRP3	2.983	0.00323	0.064424	28	0.021599	no	ADRNLG
chr2_33747330_A_G_b38	RASGRP3	2.983	0.00323	0.064424	28	0.021599	no	ADRNLG
chr2_33747570_C_T_b38	RASGRP3	2.983	0.00323	0.064424	28	0.021599	no	ADRNLG
chr2_33747719_G_A_b38	RASGRP3	2.983	0.00323	0.064424	28	0.021599	no	ADRNLG
chr2_33748212_A_G_b38	RASGRP3	2.983	0.00323	0.064424	28	0.021599	no	ADRNLG
chr2_33748443_G_A_b38	RASGRP3	2.983	0.00323	0.064424	28	0.021599	no	ADRNLG
chr2_33748597_A_G_b38	RASGRP3	2.983	0.00323	0.064424	28	0.021599	no	ADRNLG
chr2_33748983_G_A_b38	RASGRP3	2.983	0.00323	0.064424	28	0.021599	no	ADRNLG
chr2_33749004_G_A_b38	RASGRP3	2.983	0.00323	0.064424	28	0.021599	no	ADRNLG
chr2_33750298_G_A_b38	RASGRP3	2.983	0.00323	0.064424	28	0.021599	no	ADRNLG
chr2_33750428_G_C_b38	RASGRP3	2.983	0.00323	0.064424	28	0.021599	no	ADRNLG
chr2_33751464_T_C_b38	RASGRP3	2.983	0.00323	0.064424	28	0.021599	no	ADRNLG
chr2_33751474_G_A_b38	RASGRP3	2.983	0.00323	0.064424	28	0.021599	no	ADRNLG
chr2_33751633_G_T_b38	RASGRP3	2.983	0.00323	0.064424	28	0.021599	no	ADRNLG
chr2_33751716_C_A_b38	RASGRP3	2.983	0.00323	0.064424	28	0.021599	no	ADRNLG
chr2_33752452_C_T_b38	RASGRP3	2.983	0.00323	0.064424	28	0.021599	no	ADRNLG
chr2_33752974_A_AG_b38	RASGRP3	2.983	0.00323	0.064424	28	0.021599	no	ADRNLG
chr2_33751863_T_C_b38	RASGRP3	2.978	0.00327	0.065173	27	0.021883	no	ADRNLG
chr2_33768747_A_G_b38	RASGRP3	-2.972	0.00333	-0.06494	28	0.021848	no	ADRNLG
chr2_33745477_T_TCAAA_b38	RASGRP3	2.939	0.0037	0.063612	28	0.021644	no	ADRNLG
chr2_33743908_C_T_b38	RASGRP3	2.929	0.00381	0.064006	27	0.02185	no	ADRNLG
chr2_33745193_T_C_b38	RASGRP3	2.929	0.00381	0.064006	27	0.02185	no	ADRNLG
chr2_33745218_T_C_b38	RASGRP3	2.929	0.00381	0.064006	27	0.02185	no	ADRNLG
chr2_33745728_T_C_b38	RASGRP3	2.929	0.00381	0.064006	27	0.02185	no	ADRNLG
chr2_33752505_C_T_b38	RASGRP3	2.929	0.00381	0.064006	27	0.02185	no	ADRNLG
chr2_33747162_C_T_b38	RASGRP3	2.927	0.00384	0.063344	28	0.021644	no	ADRNLG
chr2_33940657_G_T_b38	RASGRP3	2.915	0.00398	0.162898	3	0.055877	no	ADRNLG
chr2_33746219_A_G_b38	RASGRP3	2.915	0.00398	0.064305	26	0.02206	no	ADRNLG
chr2_33747569_T_A_b38	RASGRP3	2.915	0.00398	0.064305	26	0.02206	no	ADRNLG
chr2_33747909_A_C_b38	RASGRP3	2.915	0.00398	0.064305	26	0.02206	no	ADRNLG
chr2_33747929_T_C_b38	RASGRP3	2.915	0.00398	0.064305	26	0.02206	no	ADRNLG
chr2_33748302_G_A_b38	RASGRP3	2.915	0.00398	0.064305	26	0.02206	no	ADRNLG
chr2_33748556_G_A_b38	RASGRP3	2.915	0.00398	0.064305	26	0.02206	no	ADRNLG
chr2_33752162_T_C_b38	RASGRP3	2.915	0.00398	0.064305	26	0.02206	no	ADRNLG
chr2_33740873_G_A_b38	RASGRP3	2.914	0.00399	0.0624	29	0.021411	no	ADRNLG
chr2_33742219_C_A_b38	RASGRP3	2.914	0.00399	0.0624	29	0.021411	no	ADRNLG
chr2_33744364_G_A_b38	RASGRP3	2.914	0.00399	0.0624	29	0.021411	no	ADRNLG
chr2_33414988_C_G_b38	RASGRP3	2.904	0.00411	0.088223	5	0.030379	no	ADRNLG
chr2_33740579_C_G_b38	RASGRP3	2.903	0.00413	0.060438	33	0.020818	no	ADRNLG
chr2_33196615_G_C_b38	RASGRP3	2.898	0.0042	0.139142	4	0.048018	no	ADRNLG
chr2_33196832_C_A_b38	RASGRP3	2.898	0.0042	0.139142	4	0.048018	no	ADRNLG
chr2_33200788_C_T_b38	RASGRP3	2.898	0.0042	0.139142	4	0.048018	no	ADRNLG
chr2_33201195_G_C_b38	RASGRP3	2.898	0.0042	0.139142	4	0.048018	no	ADRNLG
chr2_33201641_A_AAAG_b38	RASGRP3	2.898	0.0042	0.139142	4	0.048018	no	ADRNLG
chr2_33201902_G_C_b38	RASGRP3	2.898	0.0042	0.139142	4	0.048018	no	ADRNLG
chr2_33201953_C_T_b38	RASGRP3	2.898	0.0042	0.139142	4	0.048018	no	ADRNLG
chr2_33206601_G_A_b38	RASGRP3	2.898	0.0042	0.139142	4	0.048018	no	ADRNLG
chr2_33207373_TA_T_b38	RASGRP3	2.898	0.0042	0.139142	4	0.048018	no	ADRNLG
chr2_33208098_A_G_b38	RASGRP3	2.898	0.0042	0.139142	4	0.048018	no	ADRNLG
chr2_33210000_A_T_b38	RASGRP3	2.898	0.0042	0.139142	4	0.048018	no	ADRNLG
chr2_33752872_ATTT_A_b38	RASGRP3	2.896	0.00422	0.064502	24	0.022274	no	ADRNLG
chr2_33741149_G_T_b38	RASGRP3	2.895	0.00423	0.060878	32	0.021028	no	ADRNLG
chr2_33751025_C_G_b38	RASGRP3	2.895	0.00423	0.060878	32	0.021028	no	ADRNLG
chr2_33752290_T_G_b38	RASGRP3	2.883	0.00439	0.062022	29	0.021513	no	ADRNLG
chr2_33753230_G_A_b38	RASGRP3	2.882	0.0044	0.062379	28	0.021643	no	ADRNLG
chr2_33179455_TA_T_b38	RASGRP3	2.866	0.00462	0.138635	3	0.048376	no	ADRNLG
chr2_33182123_T_C_b38	RASGRP3	2.863	0.00466	0.185115	3	0.064651	no	ADRNLG
chr2_33654678_C_T_b38	RASGRP3	2.86	0.00471	0.062892	33	0.021994	no	ADRNLG
chr2_33415292_A_T_b38	RASGRP3	2.849	0.00487	0.087214	5	0.030617	no	ADRNLG
chr2_33746549_C_A_b38	RASGRP3	2.843	0.00496	0.060451	31	0.021266	no	ADRNLG
chr2_33741768_A_G_b38	RASGRP3	2.84	0.00499	0.067153	17	0.023642	no	ADRNLG
chr2_33734734_G_A_b38	RASGRP3	2.838	0.00503	0.097786	3	0.034454	no	ADRNLG
chr2_32761710_A_G_b38	RASGRP3	-2.837	0.00504	-0.073442	14	0.025885	no	ADRNLG
chr2_33343251_T_A_b38	RASGRP3	2.836	0.00505	0.066906	22	0.023589	no	ADRNLG
chr2_33792503_A_G_b38	RASGRP3	-2.827	0.0052	-0.067762	20	0.023969	no	ADRNLG
chr2_33765440_G_A_b38	RASGRP3	-2.827	0.0052	-0.062398	28	0.022074	no	ADRNLG
chr2_33767629_C_T_b38	RASGRP3	-2.827	0.0052	-0.062398	28	0.022074	no	ADRNLG
chr2_33767683_T_G_b38	RASGRP3	-2.827	0.0052	-0.062398	28	0.022074	no	ADRNLG
chr2_33767692_TCAGAA_T_b38	RASGRP3	-2.827	0.0052	-0.062398	28	0.022074	no	ADRNLG
chr2_33768002_T_C_b38	RASGRP3	-2.827	0.0052	-0.062398	28	0.022074	no	ADRNLG
chr2_33752288_AT_A_b38	RASGRP3	2.825	0.00522	0.060836	29	0.021533	no	ADRNLG
chr2_33748885_A_G_b38	RASGRP3	2.823	0.00527	0.06007	30	0.021282	no	ADRNLG
chr2_32767611_G_A_b38	RASGRP3	-2.816	0.00537	-0.07878	9	0.027975	no	ADRNLG
chr2_33270589_C_CAA_b38	RASGRP3	2.807	0.00552	0.084028	12	0.029935	no	ADRNLG
chr2_33426861_T_C_b38	RASGRP3	2.803	0.00558	0.074007	10	0.026399	no	ADRNLG
chr2_33747529_T_A_b38	RASGRP3	2.786	0.00587	0.059936	29	0.021514	no	ADRNLG
chr2_33666129_G_C_b38	RASGRP3	2.784	0.0059	0.064117	19	0.023028	no	ADRNLG
chr2_33668896_C_T_b38	RASGRP3	2.784	0.0059	0.064117	19	0.023028	no	ADRNLG
chr2_32754147_CT_C_b38	RASGRP3	-2.778	0.00601	-0.076054	10	0.027375	no	ADRNLG
chr2_33764804_G_C_b38	RASGRP3	-2.763	0.00629	-0.061023	28	0.02209	no	ADRNLG
chr2_33765693_G_A_b38	RASGRP3	-2.762	0.00629	-0.06084	28	0.022024	no	ADRNLG
chr2_33343070_G_A_b38	RASGRP3	2.754	0.00645	0.066338	19	0.024086	no	ADRNLG
chr2_32758762_CT_C_b38	RASGRP3	-2.75	0.00653	-0.073574	11	0.026755	no	ADRNLG
chr2_33734614_C_G_b38	RASGRP3	2.742	0.00669	0.060069	27	0.021911	no	ADRNLG
chr2_32764745_A_G_b38	RASGRP3	-2.734	0.00684	-0.070739	12	0.025872	no	ADRNLG
chr2_33568692_C_G_b38	RASGRP3	2.707	0.0074	0.071519	10	0.026417	no	ADRNLG
chr2_33753865_C_T_b38	RASGRP3	-2.706	0.00742	-0.061074	25	0.02257	no	ADRNLG
chr2_33083453_G_C_b38	RASGRP3	-2.702	0.00751	-0.102356	3	0.037883	no	ADRNLG
chr2_33666049_G_A_b38	RASGRP3	2.686	0.00786	0.061965	19	0.023066	no	ADRNLG
chr2_33539996_AAAAAG_A_b38	RASGRP3	-2.68	0.00799	-0.058005	45	0.02164	no	ADRNLG
chr2_33194131_C_G_b38	RASGRP3	2.669	0.00826	0.17084	3	0.064006	no	ADRNLG
chr2_33197748_A_C_b38	RASGRP3	2.669	0.00826	0.17084	3	0.064006	no	ADRNLG
chr2_33198116_A_C_b38	RASGRP3	2.669	0.00826	0.17084	3	0.064006	no	ADRNLG
chr2_33199583_C_G_b38	RASGRP3	2.669	0.00826	0.17084	3	0.064006	no	ADRNLG
chr2_33201943_A_G_b38	RASGRP3	2.669	0.00826	0.17084	3	0.064006	no	ADRNLG
chr2_33204297_CTG_C_b38	RASGRP3	2.669	0.00826	0.17084	3	0.064006	no	ADRNLG
chr2_33205655_C_T_b38	RASGRP3	2.669	0.00826	0.17084	3	0.064006	no	ADRNLG
chr2_33206965_G_T_b38	RASGRP3	2.669	0.00826	0.17084	3	0.064006	no	ADRNLG
chr2_33209330_C_T_b38	RASGRP3	2.669	0.00826	0.17084	3	0.064006	no	ADRNLG
chr2_33749139_C_A_b38	RASGRP3	2.667	0.00831	0.057975	30	0.021739	no	ADRNLG
chr2_33927027_C_G_b38	RASGRP3	2.635	0.00909	0.138117	5	0.052411	no	ADRNLG
chr2_33557844_G_A_b38	RASGRP3	9.46	7.34e-19	0.220826	5	0.023344	yes	ARTAORT
chr2_33531453_C_T_b38	RASGRP3	8.923	3.75e-17	0.218852	4	0.024526	yes	ARTAORT
chr2_33529269_C_A_b38	RASGRP3	8.677	2.18e-16	0.212593	4	0.024499	yes	ARTAORT
chr2_33537330_C_CCCAACACA_b38	RASGRP3	8.128	1e-14	0.160539	22	0.019752	yes	ARTAORT
chr2_33561445_C_A_b38	RASGRP3	7.105	8.01e-12	0.145199	13	0.020435	yes	ARTAORT
chr2_33555164_G_A_b38	RASGRP3	6.204	1.73e-09	0.129556	13	0.020884	yes	ARTAORT
chr2_33529318_C_T_b38	RASGRP3	6.04	4.32e-09	0.130338	10	0.021578	yes	ARTAORT
chr2_33523649_G_A_b38	RASGRP3	5.779	1.8e-08	0.125408	12	0.021699	yes	ARTAORT
chr2_33511010_G_A_b38	RASGRP3	5.438	1.08e-07	0.143452	7	0.026378	yes	ARTAORT
chr2_33521266_C_T_b38	RASGRP3	5.063	7.02e-07	0.094857	29	0.018735	yes	ARTAORT
chr2_33650021_A_G_b38	RASGRP3	4.919	1.4e-06	0.098358	14	0.019995	yes	ARTAORT
chr2_33661156_C_T_b38	RASGRP3	4.913	1.44e-06	0.093344	20	0.019	yes	ARTAORT
chr2_33661310_C_T_b38	RASGRP3	4.913	1.44e-06	0.093344	20	0.019	yes	ARTAORT
chr2_33656248_TTC_T_b38	RASGRP3	4.839	2.04e-06	0.096808	14	0.020005	yes	ARTAORT
chr2_33662459_C_T_b38	RASGRP3	4.806	2.38e-06	0.096509	14	0.02008	yes	ARTAORT
chr2_33639021_G_A_b38	RASGRP3	4.747	3.14e-06	0.095539	15	0.020127	yes	ARTAORT
chr2_33663555_T_C_b38	RASGRP3	4.722	3.52e-06	0.095257	14	0.020173	yes	ARTAORT
chr2_33640631_A_C_b38	RASGRP3	4.696	3.96e-06	0.094295	15	0.020079	yes	ARTAORT
chr2_33532487_C_A_b38	RASGRP3	4.673	4.41e-06	0.076355	92	0.016341	yes	ARTAORT
chr2_33641397_G_C_b38	RASGRP3	4.666	4.54e-06	0.093927	15	0.02013	yes	ARTAORT
chr2_33652477_C_A_b38	RASGRP3	4.654	4.79e-06	0.094263	14	0.020253	yes	ARTAORT
chr2_33561192_A_G_b38	RASGRP3	4.652	4.84e-06	0.074883	87	0.016097	yes	ARTAORT
chr2_33518114_A_G_b38	RASGRP3	-4.478	1.05e-05	-0.074315	47	0.016596	yes	ARTAORT
chr2_33581561_C_T_b38	RASGRP3	4.466	1.11e-05	0.092632	19	0.020744	yes	ARTAORT
chr2_33512820_T_A_b38	RASGRP3	-4.421	1.35e-05	-0.071953	53	0.016276	yes	ARTAORT
chr2_33508487_T_C_b38	RASGRP3	4.418	1.37e-05	0.118248	8	0.026767	yes	ARTAORT
chr2_33519891_C_T_b38	RASGRP3	-4.414	1.39e-05	-0.073007	54	0.01654	yes	ARTAORT
chr2_33514230_T_G_b38	RASGRP3	4.39	1.55e-05	0.090946	16	0.020716	yes	ARTAORT
chr2_33523461_TA_T_b38	RASGRP3	4.171	3.92e-05	0.093394	4	0.022389	yes	ARTAORT
chr2_33514489_T_C_b38	RASGRP3	-4.135	4.55e-05	-0.065539	59	0.015849	yes	ARTAORT
chr2_33586869_A_T_b38	RASGRP3	4.05	6.45e-05	0.085775	16	0.02118	yes	ARTAORT
chr2_33515662_T_C_b38	RASGRP3	4.042	6.66e-05	0.089512	12	0.022145	yes	ARTAORT
chr2_33535555_G_GC_b38	RASGRP3	-3.896	0.000119	-0.088039	8	0.022596	yes	ARTAORT
chr2_33538430_G_C_b38	RASGRP3	-3.83	0.000154	-0.089327	6	0.023321	yes	ARTAORT
chr2_33538452_G_A_b38	RASGRP3	-3.825	0.000158	-0.089941	6	0.023515	yes	ARTAORT
chr2_32533687_G_C_b38	RASGRP3	3.82	0.00016	0.065856	59	0.017238	yes	ARTAORT
chr2_33525699_C_CAA_b38	RASGRP3	3.817	0.000163	0.13699	8	0.03589	yes	ARTAORT
chr2_33901399_T_C_b38	RASGRP3	-3.79	0.00018	-0.059205	91	0.015619	yes	ARTAORT
chr2_33543280_C_G_b38	RASGRP3	-3.784	0.000185	-0.088792	6	0.023466	yes	ARTAORT
chr2_33532968_G_A_b38	RASGRP3	-3.783	0.000185	-0.089227	6	0.023585	yes	ARTAORT
chr2_33535943_T_C_b38	RASGRP3	-3.76	0.000203	-0.084808	8	0.022557	yes	ARTAORT
chr2_33532718_G_A_b38	RASGRP3	3.733	0.000224	0.064134	67	0.017181	yes	ARTAORT
chr2_33530852_CT_C_b38	RASGRP3	3.721	0.000235	0.063271	71	0.017002	yes	ARTAORT
chr2_33527085_G_T_b38	RASGRP3	-3.713	0.000242	-0.077922	14	0.020984	yes	ARTAORT
chr2_33533388_C_T_b38	RASGRP3	-3.703	0.000252	-0.087146	6	0.023535	yes	ARTAORT
chr2_33664871_G_GT_b38	RASGRP3	-3.683	0.000271	-0.059643	88	0.016193	yes	ARTAORT
chr2_33997378_G_A_b38	RASGRP3	-3.682	0.000272	-0.076444	15	0.020764	yes	ARTAORT
chr2_33478490_C_T_b38	RASGRP3	3.673	0.000282	0.061798	59	0.016826	yes	ARTAORT
chr2_33993938_A_G_b38	RASGRP3	-3.673	0.000282	-0.076017	15	0.020699	yes	ARTAORT
chr2_33899086_A_G_b38	RASGRP3	-3.652	0.000305	-0.057223	91	0.015669	yes	ARTAORT
chr2_33901705_A_G_b38	RASGRP3	-3.648	0.000308	-0.057073	91	0.015643	yes	ARTAORT
chr2_33534062_A_C_b38	RASGRP3	-3.646	0.000312	-0.084503	6	0.023179	yes	ARTAORT
chr2_33523846_A_G_b38	RASGRP3	-3.641	0.000317	-0.072378	19	0.019876	yes	ARTAORT
chr2_33571267_T_A_b38	RASGRP3	-3.637	0.000322	-0.062395	59	0.017157	yes	ARTAORT
chr2_33508652_C_G_b38	RASGRP3	3.622	0.00034	0.064908	45	0.017919	yes	ARTAORT
chr2_33968914_A_C_b38	RASGRP3	-3.605	0.000362	-0.075873	14	0.021045	yes	ARTAORT
chr2_33533272_T_C_b38	RASGRP3	-3.6	0.000369	-0.084859	6	0.023571	yes	ARTAORT
chr2_33966273_T_G_b38	RASGRP3	-3.599	0.00037	-0.074653	14	0.020742	yes	ARTAORT
chr2_33663649_A_C_b38	RASGRP3	-3.599	0.000371	-0.056338	99	0.015655	yes	ARTAORT
chr2_33565010_T_TACACACAC_b38	RASGRP3	3.592	0.00038	0.123694	3	0.034431	yes	ARTAORT
chr2_32602437_G_A_b38	RASGRP3	3.584	0.000392	0.061005	57	0.017023	yes	ARTAORT
chr2_32582156_G_T_b38	RASGRP3	3.576	0.000403	0.062329	57	0.017429	yes	ARTAORT
chr2_33564001_C_G_b38	RASGRP3	3.562	0.000424	0.063496	44	0.017824	yes	ARTAORT
chr2_33658170_A_G_b38	RASGRP3	-3.561	0.000426	-0.056916	86	0.015983	yes	ARTAORT
chr2_33658713_G_A_b38	RASGRP3	-3.558	0.000432	-0.056732	86	0.015947	yes	ARTAORT
chr2_33569371_A_G_b38	RASGRP3	-3.555	0.000435	-0.062025	58	0.017446	yes	ARTAORT
chr2_33534496_G_A_b38	RASGRP3	-3.554	0.000438	-0.08348	6	0.023491	yes	ARTAORT
chr2_33870208_A_G_b38	RASGRP3	-3.545	0.000452	-0.056444	81	0.015923	yes	ARTAORT
chr2_33870537_A_G_b38	RASGRP3	-3.545	0.000452	-0.056444	81	0.015923	yes	ARTAORT
chr2_33534328_C_T_b38	RASGRP3	-3.528	0.000481	-0.082865	6	0.023487	yes	ARTAORT
chr2_33662442_T_C_b38	RASGRP3	-3.528	0.000481	-0.055796	89	0.015815	yes	ARTAORT
chr2_33660983_C_T_b38	RASGRP3	-3.516	0.000502	-0.056083	83	0.015951	yes	ARTAORT
chr2_33901404_A_AT_b38	RASGRP3	-3.515	0.000504	-0.056085	82	0.015955	yes	ARTAORT
chr2_33973396_G_A_b38	RASGRP3	-3.498	0.000537	-0.072013	15	0.020588	yes	ARTAORT
chr2_33871833_C_G_b38	RASGRP3	-3.482	0.000567	-0.0548	83	0.015736	yes	ARTAORT
chr2_32612043_A_G_b38	RASGRP3	3.476	0.00058	0.058615	63	0.016862	yes	ARTAORT
chr2_33515788_C_T_b38	RASGRP3	-3.465	0.000604	-0.079722	8	0.023009	yes	ARTAORT
chr2_33658757_C_A_b38	RASGRP3	-3.463	0.000608	-0.05558	81	0.01605	yes	ARTAORT
chr2_33605827_ATTTTTCT_A_b38	RASGRP3	3.461	0.000613	0.090436	5	0.026131	yes	ARTAORT
chr2_33873440_C_T_b38	RASGRP3	-3.456	0.000623	-0.054906	84	0.015887	yes	ARTAORT
chr2_33873577_T_C_b38	RASGRP3	-3.456	0.000623	-0.054906	84	0.015887	yes	ARTAORT
chr2_33873625_A_G_b38	RASGRP3	-3.456	0.000623	-0.054906	84	0.015887	yes	ARTAORT
chr2_33870163_T_A_b38	RASGRP3	-3.45	0.000636	-0.054849	82	0.015897	yes	ARTAORT
chr2_33870164_C_A_b38	RASGRP3	-3.45	0.000636	-0.054849	82	0.015897	yes	ARTAORT
chr2_33870644_C_T_b38	RASGRP3	-3.45	0.000636	-0.054849	82	0.015897	yes	ARTAORT
chr2_33616325_C_T_b38	RASGRP3	3.446	0.000646	0.094047	4	0.027291	yes	ARTAORT
chr2_33606703_C_T_b38	RASGRP3	3.446	0.000647	0.094322	4	0.027374	yes	ARTAORT
chr2_33899714_T_C_b38	RASGRP3	-3.443	0.000652	-0.053497	95	0.015537	yes	ARTAORT
chr2_33525341_AAT_A_b38	RASGRP3	-3.443	0.000654	-0.07842	7	0.022779	yes	ARTAORT
chr2_33901570_T_C_b38	RASGRP3	-3.437	0.000667	-0.054045	92	0.015725	yes	ARTAORT
chr2_33999163_G_T_b38	RASGRP3	-3.43	0.000683	-0.07164	15	0.020885	yes	ARTAORT
chr2_33528012_T_G_b38	RASGRP3	-3.428	0.000688	-0.068825	19	0.020076	yes	ARTAORT
chr2_33509059_T_G_b38	RASGRP3	-3.421	0.000706	-0.069459	16	0.020305	yes	ARTAORT
chr2_33664742_G_C_b38	RASGRP3	-3.407	0.000741	-0.054047	98	0.015861	yes	ARTAORT
chr2_33571342_T_C_b38	RASGRP3	-3.404	0.000749	-0.058127	59	0.017074	yes	ARTAORT
chr2_33980676_T_A_b38	RASGRP3	-3.383	0.000808	-0.059552	36	0.017605	yes	ARTAORT
chr2_33880077_C_G_b38	RASGRP3	-3.383	0.000808	-0.054327	78	0.01606	yes	ARTAORT
chr2_33879601_G_A_b38	RASGRP3	-3.381	0.000812	-0.053458	83	0.015809	yes	ARTAORT
chr2_33387736_G_GTTTT_b38	RASGRP3	-3.38	0.000817	-0.100595	4	0.029765	yes	ARTAORT
chr2_33900593_G_A_b38	RASGRP3	-3.376	0.000828	-0.053375	88	0.015811	yes	ARTAORT
chr2_33856700_C_G_b38	RASGRP3	-3.372	0.000838	-0.053687	90	0.01592	yes	ARTAORT
chr2_33893080_G_A_b38	RASGRP3	-3.371	0.000843	-0.053566	91	0.015892	yes	ARTAORT
chr2_33854093_T_G_b38	RASGRP3	-3.37	0.000844	-0.053748	89	0.015948	yes	ARTAORT
chr2_33854671_C_T_b38	RASGRP3	-3.37	0.000844	-0.053748	89	0.015948	yes	ARTAORT
chr2_33855137_C_T_b38	RASGRP3	-3.37	0.000844	-0.053748	89	0.015948	yes	ARTAORT
chr2_33856769_A_G_b38	RASGRP3	-3.37	0.000844	-0.053748	89	0.015948	yes	ARTAORT
chr2_33858174_T_C_b38	RASGRP3	-3.37	0.000844	-0.053748	89	0.015948	yes	ARTAORT
chr2_33858371_A_G_b38	RASGRP3	-3.37	0.000844	-0.053748	89	0.015948	yes	ARTAORT
chr2_33668515_A_G_b38	RASGRP3	-3.367	0.000854	-0.05313	91	0.01578	yes	ARTAORT
chr2_33512902_A_G_b38	RASGRP3	-3.36	0.000876	-0.054278	79	0.016155	yes	ARTAORT
chr2_33976528_G_T_b38	RASGRP3	-3.355	0.00089	-0.071095	14	0.021191	yes	ARTAORT
chr2_32532531_A_C_b38	RASGRP3	3.353	0.000898	0.096544	3	0.028797	yes	ARTAORT
chr2_33899374_TTA_T_b38	RASGRP3	-3.347	0.000916	-0.052455	94	0.015673	yes	ARTAORT
chr2_33850199_T_C_b38	RASGRP3	-3.346	0.000917	-0.053503	90	0.015988	yes	ARTAORT
chr2_33850935_T_C_b38	RASGRP3	-3.346	0.000917	-0.053503	90	0.015988	yes	ARTAORT
chr2_33856300_T_G_b38	RASGRP3	-3.346	0.000919	-0.053315	90	0.015935	yes	ARTAORT
chr2_33659035_G_A_b38	RASGRP3	3.337	0.000949	0.088381	5	0.026487	yes	ARTAORT
chr2_33923278_G_T_b38	RASGRP3	3.324	0.00099	0.052456	87	0.015779	yes	ARTAORT
chr2_33539996_AAAAAG_A_b38	RASGRP3	-3.324	0.000991	-0.054864	92	0.016505	yes	ARTAORT
chr2_33655774_A_G_b38	RASGRP3	-3.32	0.00101	-0.052486	91	0.01581	yes	ARTAORT
chr2_33572204_C_A_b38	RASGRP3	-3.317	0.00102	-0.058018	57	0.017493	yes	ARTAORT
chr2_33903656_G_A_b38	RASGRP3	-3.315	0.00102	-0.053472	84	0.016129	yes	ARTAORT
chr2_33903875_G_T_b38	RASGRP3	-3.315	0.00102	-0.053472	84	0.016129	yes	ARTAORT
chr2_33907140_T_A_b38	RASGRP3	-3.315	0.00102	-0.053472	84	0.016129	yes	ARTAORT
chr2_33466742_G_A_b38	RASGRP3	3.315	0.00102	0.057214	78	0.01726	yes	ARTAORT
chr2_33647765_T_C_b38	RASGRP3	-3.297	0.00109	-0.051819	93	0.015719	yes	ARTAORT
chr2_33894481_T_TA_b38	RASGRP3	-3.296	0.00109	-0.053159	88	0.016129	yes	ARTAORT
chr2_33659127_A_G_b38	RASGRP3	-3.295	0.00109	-0.052008	97	0.015782	yes	ARTAORT
chr2_33669785_CA_C_b38	RASGRP3	-3.292	0.00111	-0.054087	66	0.016429	yes	ARTAORT
chr2_32533286_A_C_b38	RASGRP3	3.285	0.00113	0.056111	60	0.017079	yes	ARTAORT
chr2_33661731_A_G_b38	RASGRP3	-3.285	0.00113	-0.051907	98	0.0158	yes	ARTAORT
chr2_33906320_ATTAT_A_b38	RASGRP3	-3.279	0.00116	-0.052143	86	0.015904	yes	ARTAORT
chr2_33906396_T_C_b38	RASGRP3	-3.272	0.00119	-0.050637	97	0.015476	yes	ARTAORT
chr2_32521538_G_C_b38	RASGRP3	3.268	0.0012	0.055229	63	0.016902	yes	ARTAORT
chr2_33882632_C_G_b38	RASGRP3	-3.265	0.00122	-0.051383	85	0.01574	yes	ARTAORT
chr2_33876536_C_T_b38	RASGRP3	-3.264	0.00122	-0.052194	80	0.01599	yes	ARTAORT
chr2_33877310_G_A_b38	RASGRP3	-3.264	0.00122	-0.052194	80	0.01599	yes	ARTAORT
chr2_32585226_G_A_b38	RASGRP3	3.26	0.00124	0.056613	57	0.017366	yes	ARTAORT
chr2_33520141_T_C_b38	RASGRP3	-3.255	0.00126	-0.053823	69	0.016537	yes	ARTAORT
chr2_33884597_T_G_b38	RASGRP3	-3.253	0.00127	-0.052151	80	0.016034	yes	ARTAORT
chr2_33897086_T_A_b38	RASGRP3	-3.25	0.00128	-0.051693	90	0.015904	yes	ARTAORT
chr2_33640513_G_C_b38	RASGRP3	3.25	0.00128	0.085738	5	0.026381	yes	ARTAORT
chr2_33664465_T_A_b38	RASGRP3	-3.249	0.00128	-0.0516	93	0.015883	yes	ARTAORT
chr2_33999846_G_A_b38	RASGRP3	-3.248	0.00129	-0.066659	17	0.02052	yes	ARTAORT
chr2_33895329_G_A_b38	RASGRP3	-3.244	0.0013	-0.052311	87	0.016124	yes	ARTAORT
chr2_33666591_A_G_b38	RASGRP3	-3.242	0.00131	-0.051193	100	0.015789	yes	ARTAORT
chr2_33575950_G_A_b38	RASGRP3	-3.23	0.00137	-0.056674	56	0.017545	yes	ARTAORT
chr2_33661861_G_A_b38	RASGRP3	-3.23	0.00137	-0.05121	91	0.015855	yes	ARTAORT
chr2_33872664_C_T_b38	RASGRP3	-3.224	0.00139	-0.05316	90	0.016486	yes	ARTAORT
chr2_33873358_A_G_b38	RASGRP3	-3.224	0.00139	-0.05316	90	0.016486	yes	ARTAORT
chr2_33625433_A_C_b38	RASGRP3	-3.223	0.0014	-0.051751	73	0.016055	yes	ARTAORT
chr2_33577889_G_A_b38	RASGRP3	-3.219	0.00142	-0.056745	57	0.017626	yes	ARTAORT
chr2_33470875_C_T_b38	RASGRP3	3.213	0.00145	0.053138	81	0.01654	yes	ARTAORT
chr2_33630364_C_G_b38	RASGRP3	-3.211	0.00146	-0.050409	77	0.015698	yes	ARTAORT
chr2_33860902_A_G_b38	RASGRP3	-3.209	0.00147	-0.05159	87	0.016078	yes	ARTAORT
chr2_33916419_C_A_b38	RASGRP3	3.206	0.00149	0.051056	85	0.015927	yes	ARTAORT
chr2_33999474_G_A_b38	RASGRP3	-3.205	0.00149	-0.066063	17	0.020611	yes	ARTAORT
chr2_33564467_A_G_b38	RASGRP3	3.202	0.0015	0.056822	47	0.017747	yes	ARTAORT
chr2_33655786_T_C_b38	RASGRP3	-3.201	0.00151	-0.050963	86	0.01592	yes	ARTAORT
chr2_33469036_C_CA_b38	RASGRP3	3.201	0.00151	0.053092	79	0.016585	yes	ARTAORT
chr2_33927716_CA_C_b38	RASGRP3	-3.199	0.00152	-0.116394	3	0.036385	yes	ARTAORT
chr2_33920338_T_C_b38	RASGRP3	3.193	0.00155	0.0504	88	0.015785	yes	ARTAORT
chr2_33924852_G_A_b38	RASGRP3	3.188	0.00158	0.051171	82	0.016052	yes	ARTAORT
chr2_33928095_G_T_b38	RASGRP3	3.179	0.00163	0.051286	80	0.016135	yes	ARTAORT
chr2_33849113_T_G_b38	RASGRP3	-3.178	0.00163	-0.052511	89	0.016523	yes	ARTAORT
chr2_33469436_T_C_b38	RASGRP3	3.177	0.00164	0.053574	69	0.016865	yes	ARTAORT
chr2_33922397_C_T_b38	RASGRP3	3.175	0.00164	0.050347	87	0.015855	yes	ARTAORT
chr2_33874659_C_A_b38	RASGRP3	-3.175	0.00165	-0.050684	81	0.015964	yes	ARTAORT
chr2_33879824_A_T_b38	RASGRP3	-3.172	0.00166	-0.050258	81	0.015845	yes	ARTAORT
chr2_33568339_TA_T_b38	RASGRP3	-3.169	0.00168	-0.055866	62	0.01763	yes	ARTAORT
chr2_33563965_A_G_b38	RASGRP3	3.165	0.0017	0.0792	6	0.025021	yes	ARTAORT
chr2_33894198_T_A_b38	RASGRP3	-3.165	0.0017	-0.051795	86	0.016365	yes	ARTAORT
chr2_33469845_C_T_b38	RASGRP3	3.16	0.00173	0.052736	78	0.016691	yes	ARTAORT
chr2_33958535_TGTGA_T_b38	RASGRP3	3.159	0.00174	0.073562	7	0.023288	yes	ARTAORT
chr2_33631243_G_GT_b38	RASGRP3	3.153	0.00177	0.084425	5	0.026773	yes	ARTAORT
chr2_33477835_C_T_b38	RASGRP3	3.15	0.00179	0.060088	24	0.019075	yes	ARTAORT
chr2_33667549_A_G_b38	RASGRP3	3.149	0.0018	0.084836	5	0.026941	yes	ARTAORT
chr2_33667555_A_G_b38	RASGRP3	3.149	0.0018	0.084836	5	0.026941	yes	ARTAORT
chr2_33826739_G_GT_b38	RASGRP3	-3.143	0.00183	-0.050179	89	0.015963	yes	ARTAORT
chr2_33826741_G_T_b38	RASGRP3	-3.143	0.00183	-0.050179	89	0.015963	yes	ARTAORT
chr2_32633570_A_G_b38	RASGRP3	3.138	0.00186	0.053947	66	0.01719	yes	ARTAORT
chr2_33614957_G_A_b38	RASGRP3	-3.136	0.00187	-0.050537	76	0.016114	yes	ARTAORT
chr2_33855088_C_T_b38	RASGRP3	-3.134	0.00188	-0.050707	84	0.016177	yes	ARTAORT
chr2_33602942_T_C_b38	RASGRP3	3.128	0.00192	0.087927	3	0.028109	yes	ARTAORT
chr2_33470006_T_C_b38	RASGRP3	3.127	0.00193	0.052891	68	0.016914	yes	ARTAORT
chr2_33607748_A_G_b38	RASGRP3	-3.125	0.00195	-0.049216	80	0.015751	yes	ARTAORT
chr2_33903658_T_C_b38	RASGRP3	-3.124	0.00195	-0.050106	85	0.01604	yes	ARTAORT
chr2_33625063_ATCT_A_b38	RASGRP3	-3.123	0.00196	-0.050659	72	0.016222	yes	ARTAORT
chr2_33922852_C_T_b38	RASGRP3	3.119	0.00198	0.050641	89	0.016238	yes	ARTAORT
chr2_33850796_C_T_b38	RASGRP3	-3.114	0.00201	-0.049966	88	0.016044	yes	ARTAORT
chr2_33631637_C_A_b38	RASGRP3	-3.109	0.00205	-0.049047	77	0.015776	yes	ARTAORT
chr2_33849110_G_A_b38	RASGRP3	-3.089	0.00218	-0.051786	95	0.016762	yes	ARTAORT
chr2_33617107_G_A_b38	RASGRP3	-3.089	0.00218	-0.049211	78	0.01593	yes	ARTAORT
chr2_33470311_T_A_b38	RASGRP3	3.086	0.00221	0.05251	68	0.017018	yes	ARTAORT
chr2_33518880_G_GTCA_b38	RASGRP3	-3.082	0.00224	-0.050073	74	0.016247	yes	ARTAORT
chr2_33887455_C_T_b38	RASGRP3	-3.082	0.00224	-0.048721	91	0.015808	yes	ARTAORT
chr2_33470505_G_A_b38	RASGRP3	3.081	0.00225	0.052255	68	0.016963	yes	ARTAORT
chr2_33641120_T_C_b38	RASGRP3	-3.075	0.00229	-0.048891	92	0.015897	yes	ARTAORT
chr2_33902323_G_C_b38	RASGRP3	-3.066	0.00235	-0.04882	78	0.015921	yes	ARTAORT
chr2_33627793_A_G_b38	RASGRP3	3.064	0.00237	0.080208	5	0.02618	yes	ARTAORT
chr2_33916121_T_C_b38	RASGRP3	3.061	0.00239	0.048361	86	0.015798	yes	ARTAORT
chr2_33916638_C_G_b38	RASGRP3	3.061	0.00239	0.048361	86	0.015798	yes	ARTAORT
chr2_33918176_C_T_b38	RASGRP3	3.061	0.00239	0.048361	86	0.015798	yes	ARTAORT
chr2_33918186_C_G_b38	RASGRP3	3.061	0.00239	0.048361	86	0.015798	yes	ARTAORT
chr2_33918623_T_C_b38	RASGRP3	3.061	0.00239	0.048361	86	0.015798	yes	ARTAORT
chr2_33470233_G_A_b38	RASGRP3	3.058	0.00242	0.051796	68	0.016938	yes	ARTAORT
chr2_33470756_C_T_b38	RASGRP3	3.058	0.00242	0.051796	68	0.016938	yes	ARTAORT
chr2_33470439_G_A_b38	RASGRP3	3.058	0.00242	0.051378	70	0.016801	yes	ARTAORT
chr2_33878786_TGAGAGAGAGAGAGA_T_b38	RASGRP3	-3.056	0.00243	-0.084283	3	0.027576	yes	ARTAORT
chr2_33830150_C_T_b38	RASGRP3	-3.056	0.00244	-0.048443	91	0.015853	yes	ARTAORT
chr2_33914372_T_C_b38	RASGRP3	-3.055	0.00244	-0.048893	85	0.016004	yes	ARTAORT
chr2_33990920_C_T_b38	RASGRP3	-3.048	0.0025	-0.062838	16	0.020619	yes	ARTAORT
chr2_32488103_G_A_b38	RASGRP3	3.046	0.00252	0.052468	64	0.017228	yes	ARTAORT
chr2_33537323_G_A_b38	RASGRP3	3.045	0.00252	0.047243	95	0.015514	yes	ARTAORT
chr2_33882293_A_G_b38	RASGRP3	-3.044	0.00253	-0.048128	83	0.015812	yes	ARTAORT
chr2_33917115_G_A_b38	RASGRP3	3.043	0.00254	0.048288	85	0.015868	yes	ARTAORT
chr2_33917151_TA_T_b38	RASGRP3	3.043	0.00254	0.048288	85	0.015868	yes	ARTAORT
chr2_33917155_T_TC_b38	RASGRP3	3.043	0.00254	0.048288	85	0.015868	yes	ARTAORT
chr2_33917195_G_A_b38	RASGRP3	3.043	0.00254	0.048288	85	0.015868	yes	ARTAORT
chr2_33917207_A_G_b38	RASGRP3	3.043	0.00254	0.048288	85	0.015868	yes	ARTAORT
chr2_33917643_A_G_b38	RASGRP3	3.043	0.00254	0.048288	85	0.015868	yes	ARTAORT
chr2_33922129_C_A_b38	RASGRP3	3.043	0.00254	0.048288	85	0.015868	yes	ARTAORT
chr2_33924018_C_T_b38	RASGRP3	3.043	0.00254	0.048288	85	0.015868	yes	ARTAORT
chr2_33883703_T_C_b38	RASGRP3	-3.04	0.00257	-0.047959	83	0.015777	yes	ARTAORT
chr2_33622456_T_TAAAC_b38	RASGRP3	-3.038	0.00258	-0.048473	78	0.015953	yes	ARTAORT
chr2_33914521_G_T_b38	RASGRP3	3.034	0.00261	0.048005	83	0.01582	yes	ARTAORT
chr2_33918218_G_C_b38	RASGRP3	3.033	0.00262	0.047708	88	0.015731	yes	ARTAORT
chr2_33919000_A_G_b38	RASGRP3	3.033	0.00262	0.047708	88	0.015731	yes	ARTAORT
chr2_33919389_T_C_b38	RASGRP3	3.033	0.00262	0.047708	88	0.015731	yes	ARTAORT
chr2_33919483_G_A_b38	RASGRP3	3.033	0.00262	0.047708	88	0.015731	yes	ARTAORT
chr2_33920179_T_C_b38	RASGRP3	3.033	0.00262	0.047708	88	0.015731	yes	ARTAORT
chr2_33920188_G_C_b38	RASGRP3	3.033	0.00262	0.047708	88	0.015731	yes	ARTAORT
chr2_33920241_T_C_b38	RASGRP3	3.033	0.00262	0.047708	88	0.015731	yes	ARTAORT
chr2_33920244_C_G_b38	RASGRP3	3.033	0.00262	0.047708	88	0.015731	yes	ARTAORT
chr2_33920261_T_C_b38	RASGRP3	3.033	0.00262	0.047708	88	0.015731	yes	ARTAORT
chr2_33921328_C_G_b38	RASGRP3	3.033	0.00262	0.047708	88	0.015731	yes	ARTAORT
chr2_33921599_C_T_b38	RASGRP3	3.033	0.00262	0.047708	88	0.015731	yes	ARTAORT
chr2_33921790_T_G_b38	RASGRP3	3.033	0.00262	0.047708	88	0.015731	yes	ARTAORT
chr2_33922544_C_T_b38	RASGRP3	3.033	0.00262	0.047708	88	0.015731	yes	ARTAORT
chr2_33922699_C_T_b38	RASGRP3	3.033	0.00262	0.047708	88	0.015731	yes	ARTAORT
chr2_33923002_A_G_b38	RASGRP3	3.033	0.00262	0.047708	88	0.015731	yes	ARTAORT
chr2_33923138_G_A_b38	RASGRP3	3.033	0.00262	0.047708	88	0.015731	yes	ARTAORT
chr2_33923139_T_C_b38	RASGRP3	3.033	0.00262	0.047708	88	0.015731	yes	ARTAORT
chr2_32661854_G_A_b38	RASGRP3	3.026	0.00268	0.049319	84	0.016296	yes	ARTAORT
chr2_33636858_C_G_b38	RASGRP3	3.023	0.00271	0.081419	5	0.026937	yes	ARTAORT
chr2_33637736_A_T_b38	RASGRP3	3.023	0.00271	0.081419	5	0.026937	yes	ARTAORT
chr2_33919975_A_T_b38	RASGRP3	3.015	0.00278	0.047633	87	0.0158	yes	ARTAORT
chr2_33920525_G_A_b38	RASGRP3	3.015	0.00278	0.047633	87	0.0158	yes	ARTAORT
chr2_33920759_A_G_b38	RASGRP3	3.015	0.00278	0.047633	87	0.0158	yes	ARTAORT
chr2_33922460_G_A_b38	RASGRP3	3.015	0.00278	0.047633	87	0.0158	yes	ARTAORT
chr2_33922582_C_T_b38	RASGRP3	3.015	0.00278	0.047633	87	0.0158	yes	ARTAORT
chr2_33922929_A_G_b38	RASGRP3	3.015	0.00278	0.047633	87	0.0158	yes	ARTAORT
chr2_33923383_G_A_b38	RASGRP3	3.015	0.00278	0.047633	87	0.0158	yes	ARTAORT
chr2_33613986_T_C_b38	RASGRP3	-3.014	0.00279	-0.048174	78	0.015985	yes	ARTAORT
chr2_33914725_A_G_b38	RASGRP3	3.012	0.00281	0.047906	85	0.015907	yes	ARTAORT
chr2_33915253_A_G_b38	RASGRP3	3.012	0.00281	0.047906	85	0.015907	yes	ARTAORT
chr2_33914065_C_G_b38	RASGRP3	-3.012	0.00281	-0.047906	85	0.015907	yes	ARTAORT
chr2_33914156_A_T_b38	RASGRP3	-3.012	0.00281	-0.047906	85	0.015907	yes	ARTAORT
chr2_33615675_TA_T_b38	RASGRP3	-3.011	0.00282	-0.047799	78	0.015876	yes	ARTAORT
chr2_32523993_G_A_b38	RASGRP3	3.009	0.00283	0.052267	61	0.017371	yes	ARTAORT
chr2_33914686_G_A_b38	RASGRP3	3.008	0.00284	0.048217	84	0.016028	yes	ARTAORT
chr2_33605951_T_C_b38	RASGRP3	-3.006	0.00286	-0.048065	92	0.01599	yes	ARTAORT
chr2_33618669_C_CT_b38	RASGRP3	-3.001	0.0029	-0.047979	78	0.015987	yes	ARTAORT
chr2_33543901_C_G_b38	RASGRP3	-2.999	0.00292	-0.051952	50	0.017321	yes	ARTAORT
chr2_33916122_C_T_b38	RASGRP3	2.998	0.00293	0.047786	86	0.015937	yes	ARTAORT
chr2_33812675_G_A_b38	RASGRP3	2.998	0.00293	0.063218	13	0.021085	yes	ARTAORT
chr2_33917134_G_T_b38	RASGRP3	2.996	0.00295	0.047433	85	0.01583	yes	ARTAORT
chr2_33918312_G_A_b38	RASGRP3	2.996	0.00295	0.047433	85	0.01583	yes	ARTAORT
chr2_33913972_A_G_b38	RASGRP3	-2.993	0.00298	-0.04781	84	0.015975	yes	ARTAORT
chr2_33913983_C_T_b38	RASGRP3	-2.993	0.00298	-0.04781	84	0.015975	yes	ARTAORT
chr2_33914272_A_G_b38	RASGRP3	-2.993	0.00298	-0.04781	84	0.015975	yes	ARTAORT
chr2_33914277_G_A_b38	RASGRP3	-2.993	0.00298	-0.04781	84	0.015975	yes	ARTAORT
chr2_33914624_A_G_b38	RASGRP3	2.993	0.00298	0.04781	84	0.015975	yes	ARTAORT
chr2_33914650_C_T_b38	RASGRP3	2.993	0.00298	0.04781	84	0.015975	yes	ARTAORT
chr2_33914962_A_G_b38	RASGRP3	2.993	0.00298	0.04781	84	0.015975	yes	ARTAORT
chr2_33915055_G_T_b38	RASGRP3	2.993	0.00298	0.04781	84	0.015975	yes	ARTAORT
chr2_33915290_G_A_b38	RASGRP3	2.993	0.00298	0.04781	84	0.015975	yes	ARTAORT
chr2_33915455_G_A_b38	RASGRP3	2.993	0.00298	0.04781	84	0.015975	yes	ARTAORT
chr2_33915789_C_A_b38	RASGRP3	2.993	0.00298	0.04781	84	0.015975	yes	ARTAORT
chr2_33829504_C_G_b38	RASGRP3	-2.989	0.00301	-0.04744	90	0.015869	yes	ARTAORT
chr2_33545200_T_C_b38	RASGRP3	-2.988	0.00303	-0.065761	11	0.022009	yes	ARTAORT
chr2_33549383_C_T_b38	RASGRP3	-2.988	0.00303	-0.065761	11	0.022009	yes	ARTAORT
chr2_33550119_G_T_b38	RASGRP3	-2.988	0.00303	-0.065761	11	0.022009	yes	ARTAORT
chr2_33550598_T_G_b38	RASGRP3	-2.988	0.00303	-0.065761	11	0.022009	yes	ARTAORT
chr2_33551040_C_T_b38	RASGRP3	-2.988	0.00303	-0.065761	11	0.022009	yes	ARTAORT
chr2_33553788_G_A_b38	RASGRP3	-2.988	0.00303	-0.065761	11	0.022009	yes	ARTAORT
chr2_33556856_G_C_b38	RASGRP3	-2.988	0.00303	-0.065761	11	0.022009	yes	ARTAORT
chr2_33814555_C_T_b38	RASGRP3	2.987	0.00304	0.049153	77	0.016455	yes	ARTAORT
chr2_33669621_C_T_b38	RASGRP3	-2.982	0.00308	-0.048862	71	0.016384	yes	ARTAORT
chr2_33669751_C_T_b38	RASGRP3	-2.982	0.00308	-0.048862	71	0.016384	yes	ARTAORT
chr2_33634524_A_G_b38	RASGRP3	2.978	0.00312	0.080428	5	0.027005	yes	ARTAORT
chr2_33928652_T_C_b38	RASGRP3	2.974	0.00316	0.047745	83	0.016052	yes	ARTAORT
chr2_33903740_C_A_b38	RASGRP3	2.973	0.00317	0.050076	62	0.016841	yes	ARTAORT
chr2_33546473_C_T_b38	RASGRP3	-2.973	0.00318	-0.065241	11	0.021946	yes	ARTAORT
chr2_33904180_C_G_b38	RASGRP3	-2.971	0.00319	-0.047984	82	0.01615	yes	ARTAORT
chr2_33824008_C_CA_b38	RASGRP3	-2.968	0.00323	-0.050707	53	0.017088	yes	ARTAORT
chr2_33914442_G_T_b38	RASGRP3	-2.966	0.00325	-0.047746	90	0.016099	yes	ARTAORT
chr2_33918501_T_C_b38	RASGRP3	2.957	0.00334	0.047205	88	0.015964	yes	ARTAORT
chr2_32566155_A_T_b38	RASGRP3	2.953	0.00338	0.050532	61	0.01711	yes	ARTAORT
chr2_33923057_C_T_b38	RASGRP3	2.952	0.00339	0.046497	88	0.01575	yes	ARTAORT
chr2_33634816_G_T_b38	RASGRP3	2.95	0.00342	0.079238	5	0.026861	yes	ARTAORT
chr2_33670200_G_T_b38	RASGRP3	-2.948	0.00343	-0.04807	72	0.016305	yes	ARTAORT
chr2_33914744_G_A_b38	RASGRP3	2.943	0.00349	0.047546	89	0.016153	yes	ARTAORT
chr2_33548698_A_AATTATT_b38	RASGRP3	-2.94	0.00353	-0.064818	11	0.02205	yes	ARTAORT
chr2_33919555_T_C_b38	RASGRP3	2.932	0.00361	0.046659	88	0.015913	yes	ARTAORT
chr2_33903737_T_C_b38	RASGRP3	-2.922	0.00373	-0.047169	81	0.016141	yes	ARTAORT
chr2_33903806_G_T_b38	RASGRP3	-2.922	0.00373	-0.047169	81	0.016141	yes	ARTAORT
chr2_33618734_A_G_b38	RASGRP3	-2.92	0.00375	-0.046719	77	0.015999	yes	ARTAORT
chr2_32539855_T_C_b38	RASGRP3	2.918	0.00377	0.049419	63	0.016936	yes	ARTAORT
chr2_33603907_A_C_b38	RASGRP3	2.913	0.00383	0.075408	6	0.025882	yes	ARTAORT
chr2_33655112_A_AT_b38	RASGRP3	-2.911	0.00386	-0.048118	76	0.016532	yes	ARTAORT
chr2_33792850_C_G_b38	RASGRP3	-2.909	0.00388	-0.054995	28	0.018903	yes	ARTAORT
chr2_32537312_C_G_b38	RASGRP3	2.901	0.00399	0.049214	60	0.016967	yes	ARTAORT
chr2_33914767_A_G_b38	RASGRP3	2.898	0.00401	0.046466	84	0.016032	yes	ARTAORT
chr2_33917268_T_G_b38	RASGRP3	2.898	0.00402	0.046318	87	0.015983	yes	ARTAORT
chr2_33904288_G_A_b38	RASGRP3	-2.894	0.00407	-0.046513	83	0.016071	yes	ARTAORT
chr2_33904344_G_C_b38	RASGRP3	-2.894	0.00407	-0.046513	83	0.016071	yes	ARTAORT
chr2_33818642_T_TTTAC_b38	RASGRP3	2.886	0.00416	0.059628	16	0.020658	yes	ARTAORT
chr2_33561322_C_T_b38	RASGRP3	-2.88	0.00425	-0.064496	10	0.022394	yes	ARTAORT
chr2_33812043_G_A_b38	RASGRP3	2.88	0.00425	0.043276	79	0.015026	yes	ARTAORT
chr2_32618227_TA_T_b38	RASGRP3	2.878	0.00428	0.057351	34	0.019931	yes	ARTAORT
chr2_33603617_TC_T_b38	RASGRP3	2.874	0.00433	0.074716	6	0.025999	yes	ARTAORT
chr2_33824143_GA_G_b38	RASGRP3	-2.871	0.00437	-0.045584	91	0.015879	yes	ARTAORT
chr2_33827383_G_A_b38	RASGRP3	-2.871	0.00437	-0.045584	91	0.015879	yes	ARTAORT
chr2_32597890_G_A_b38	RASGRP3	2.869	0.0044	0.049694	62	0.017323	yes	ARTAORT
chr2_33525080_C_CA_b38	RASGRP3	-2.868	0.00441	-0.063927	10	0.022289	yes	ARTAORT
chr2_33545336_G_A_b38	RASGRP3	-2.868	0.00441	-0.063759	10	0.022231	yes	ARTAORT
chr2_33377504_A_G_b38	RASGRP3	-2.868	0.00441	-0.075424	4	0.0263	yes	ARTAORT
chr2_33377860_G_A_b38	RASGRP3	-2.868	0.00441	-0.075424	4	0.0263	yes	ARTAORT
chr2_33378252_G_C_b38	RASGRP3	-2.868	0.00441	-0.075424	4	0.0263	yes	ARTAORT
chr2_33380706_T_C_b38	RASGRP3	-2.868	0.00441	-0.075424	4	0.0263	yes	ARTAORT
chr2_33381113_T_C_b38	RASGRP3	-2.868	0.00441	-0.075424	4	0.0263	yes	ARTAORT
chr2_33388763_C_G_b38	RASGRP3	-2.868	0.00441	-0.075424	4	0.0263	yes	ARTAORT
chr2_33913945_T_C_b38	RASGRP3	-2.867	0.00442	-0.046067	88	0.016067	yes	ARTAORT
chr2_33909787_G_A_b38	RASGRP3	-2.866	0.00443	-0.045766	88	0.015968	yes	ARTAORT
chr2_33863957_C_G_b38	RASGRP3	-2.859	0.00453	-0.045896	84	0.016052	yes	ARTAORT
chr2_33673146_T_C_b38	RASGRP3	-2.849	0.00467	-0.044733	95	0.015699	yes	ARTAORT
chr2_33817569_G_T_b38	RASGRP3	-2.848	0.00469	-0.04532	92	0.015915	yes	ARTAORT
chr2_33917976_C_A_b38	RASGRP3	2.843	0.00476	0.046494	76	0.016354	yes	ARTAORT
chr2_33772378_C_T_b38	RASGRP3	2.84	0.0048	0.073952	5	0.02604	yes	ARTAORT
chr2_33821621_T_G_b38	RASGRP3	-2.832	0.00492	-0.045055	91	0.015907	yes	ARTAORT
chr2_33929051_G_A_b38	RASGRP3	2.825	0.00503	0.045514	86	0.016113	yes	ARTAORT
chr2_33478863_G_A_b38	RASGRP3	2.81	0.00527	0.047857	86	0.017033	yes	ARTAORT
chr2_33908293_G_C_b38	RASGRP3	2.806	0.00532	0.045321	85	0.01615	yes	ARTAORT
chr2_33818642_T_TTGAC_b38	RASGRP3	-2.804	0.00536	-0.044398	93	0.015835	yes	ARTAORT
chr2_33546347_C_G_b38	RASGRP3	-2.8	0.00543	-0.061774	11	0.022063	yes	ARTAORT
chr2_33907314_ATGT_A_b38	RASGRP3	2.798	0.00546	0.045526	93	0.016272	yes	ARTAORT
chr2_32943955_TTG_T_b38	RASGRP3	2.796	0.00549	0.089266	3	0.031923	yes	ARTAORT
chr2_33632169_T_C_b38	RASGRP3	-2.796	0.00549	-0.045033	71	0.016106	yes	ARTAORT
chr2_32550917_C_A_b38	RASGRP3	2.791	0.00557	0.049307	56	0.017666	yes	ARTAORT
chr2_33897399_G_C_b38	RASGRP3	-2.791	0.00557	-0.046108	80	0.01652	yes	ARTAORT
chr2_33593131_C_T_b38	RASGRP3	-2.788	0.00562	-0.045262	93	0.016235	yes	ARTAORT
chr2_33814416_A_G_b38	RASGRP3	-2.784	0.00569	-0.04483	87	0.016102	yes	ARTAORT
chr2_33828104_A_G_b38	RASGRP3	2.778	0.00579	0.043288	97	0.01558	yes	ARTAORT
chr2_33828199_C_A_b38	RASGRP3	2.778	0.00579	0.043288	97	0.01558	yes	ARTAORT
chr2_33831005_C_T_b38	RASGRP3	2.769	0.00596	0.043211	101	0.015606	yes	ARTAORT
chr2_33920059_TG_T_b38	RASGRP3	2.763	0.00606	0.044923	77	0.016258	yes	ARTAORT
chr2_33597253_G_A_b38	RASGRP3	-2.759	0.00613	-0.0452	90	0.016381	yes	ARTAORT
chr2_33581900_A_T_b38	RASGRP3	2.759	0.00613	0.069488	6	0.025184	yes	ARTAORT
chr2_33926793_T_G_b38	RASGRP3	2.759	0.00613	0.044865	77	0.01626	yes	ARTAORT
chr2_33924258_CT_C_b38	RASGRP3	2.755	0.00621	0.044555	96	0.016172	yes	ARTAORT
chr2_32730621_AT_A_b38	RASGRP3	2.744	0.00641	0.050575	45	0.01843	yes	ARTAORT
chr2_33813661_C_T_b38	RASGRP3	-2.738	0.00653	-0.044079	90	0.016099	yes	ARTAORT
chr2_33813911_G_T_b38	RASGRP3	-2.738	0.00653	-0.044079	90	0.016099	yes	ARTAORT
chr2_33637426_T_A_b38	RASGRP3	2.737	0.00655	0.05941	14	0.021707	yes	ARTAORT
chr2_33957321_C_T_b38	RASGRP3	2.734	0.00661	0.05552	17	0.020307	yes	ARTAORT
chr2_33816965_T_TA_b38	RASGRP3	2.719	0.00692	0.050382	52	0.018533	yes	ARTAORT
chr2_33921555_C_CCACACACACACACACACA_b38	RASGRP3	2.71	0.00709	0.055333	19	0.020416	yes	ARTAORT
chr2_33592492_A_G_b38	RASGRP3	-2.707	0.00715	-0.044186	93	0.016321	yes	ARTAORT
chr2_33552018_CAAACAAACA_C_b38	RASGRP3	-2.705	0.0072	-0.059921	11	0.022151	yes	ARTAORT
chr2_33926194_C_T_b38	RASGRP3	2.703	0.00725	0.043668	96	0.016158	yes	ARTAORT
chr2_33576389_C_T_b38	RASGRP3	-2.7	0.00732	-0.044774	91	0.016585	yes	ARTAORT
chr2_33577835_T_C_b38	RASGRP3	-2.695	0.00742	-0.044245	93	0.016419	yes	ARTAORT
chr2_33816443_G_A_b38	RASGRP3	-2.695	0.00743	-0.043152	91	0.016015	yes	ARTAORT
chr2_33918888_T_C_b38	RASGRP3	2.694	0.00744	0.042745	79	0.015868	yes	ARTAORT
chr2_33899837_T_A_b38	RASGRP3	2.69	0.00752	0.046817	54	0.017404	yes	ARTAORT
chr2_33589523_A_G_b38	RASGRP3	-2.686	0.0076	-0.043382	95	0.016148	yes	ARTAORT
chr2_33837776_A_G_b38	RASGRP3	-2.684	0.00765	-0.042805	90	0.015946	yes	ARTAORT
chr2_33924032_T_G_b38	RASGRP3	2.684	0.00766	0.043312	96	0.016137	yes	ARTAORT
chr2_33830433_T_C_b38	RASGRP3	2.684	0.00767	0.041975	100	0.015641	yes	ARTAORT
chr2_33904002_A_C_b38	RASGRP3	-2.683	0.00769	-0.04356	93	0.016238	yes	ARTAORT
chr2_32672139_A_C_b38	RASGRP3	2.682	0.0077	0.074	5	0.027589	yes	ARTAORT
chr2_33857951_CAAAA_C_b38	RASGRP3	-2.682	0.0077	-0.062411	15	0.023268	yes	ARTAORT
chr2_33910901_G_T_b38	RASGRP3	-2.67	0.00798	-0.043531	88	0.016306	yes	ARTAORT
chr2_33912836_G_A_b38	RASGRP3	-2.668	0.00803	-0.042703	87	0.016007	yes	ARTAORT
chr2_32724978_A_C_b38	RASGRP3	2.662	0.00818	0.051678	24	0.019417	yes	ARTAORT
chr2_33945220_C_A_b38	RASGRP3	2.661	0.00818	0.064252	9	0.024142	yes	ARTAORT
chr2_33945232_G_A_b38	RASGRP3	2.661	0.00818	0.064252	9	0.024142	yes	ARTAORT
chr2_33921576_T_C_b38	RASGRP3	2.66	0.00821	0.042747	98	0.01607	yes	ARTAORT
chr2_33919691_T_G_b38	RASGRP3	2.657	0.00827	0.0427	98	0.016068	yes	ARTAORT
chr2_33919720_C_T_b38	RASGRP3	2.657	0.00827	0.0427	98	0.016068	yes	ARTAORT
chr2_33920628_C_T_b38	RASGRP3	2.657	0.00827	0.0427	98	0.016068	yes	ARTAORT
chr2_33375704_A_AT_b38	RASGRP3	-2.654	0.00837	-0.078849	3	0.029714	yes	ARTAORT
chr2_33466679_C_CA_b38	RASGRP3	2.652	0.00841	0.063511	4	0.02395	yes	ARTAORT
chr2_33927628_T_G_b38	RASGRP3	2.651	0.00844	0.042554	99	0.016054	yes	ARTAORT
chr2_33580247_A_G_b38	RASGRP3	-2.649	0.00847	-0.043662	92	0.01648	yes	ARTAORT
chr2_33825424_T_A_b38	RASGRP3	-2.649	0.00847	-0.042215	91	0.015935	yes	ARTAORT
chr2_33912927_G_A_b38	RASGRP3	-2.646	0.00855	-0.042798	95	0.016175	yes	ARTAORT
chr2_32437712_C_T_b38	RASGRP3	2.646	0.00856	0.083021	3	0.031379	yes	ARTAORT
chr2_32691616_G_A_b38	RASGRP3	2.64	0.00871	0.045223	54	0.017133	yes	ARTAORT
chr2_33375788_C_T_b38	RASGRP3	-2.638	0.00876	-0.068679	5	0.026038	yes	ARTAORT
chr2_33575832_C_A_b38	RASGRP3	-2.636	0.00881	-0.043034	95	0.016326	yes	ARTAORT
chr2_33477419_C_G_b38	RASGRP3	-2.629	0.00898	-0.058359	12	0.022198	yes	ARTAORT
chr2_33949285_G_A_b38	RASGRP3	2.622	0.00918	0.049288	26	0.018801	yes	ARTAORT
chr2_33915007_G_A_b38	RASGRP3	2.621	0.0092	0.042497	94	0.016216	yes	ARTAORT
chr2_33849589_T_C_b38	RASGRP3	-2.62	0.00922	-0.05219	21	0.01992	yes	ARTAORT
chr2_33984472_G_GT_b38	RASGRP3	2.616	0.00931	0.044303	86	0.016932	yes	ARTAORT
chr2_33962522_G_A_b38	RASGRP3	2.605	0.00963	0.055019	14	0.021123	yes	ARTAORT
chr2_33816975_A_AC_b38	RASGRP3	-2.601	0.00974	-0.041356	90	0.015903	yes	ARTAORT
chr2_33537417_G_A_b38	RASGRP3	-2.594	0.00992	-0.0555	11	0.021393	yes	ARTAORT
chr2_33557635_G_A_b38	RASGRP3	9.189	5.43e-18	0.225518	3	0.024542	no	ARTAORT
chr2_33559068_A_G_b38	RASGRP3	9.189	5.43e-18	0.225518	3	0.024542	no	ARTAORT
chr2_33559734_G_A_b38	RASGRP3	9.189	5.43e-18	0.225518	3	0.024542	no	ARTAORT
chr2_33526597_C_T_b38	RASGRP3	9.095	1.08e-17	0.230748	3	0.025372	no	ARTAORT
chr2_33527062_GC_G_b38	RASGRP3	9.095	1.08e-17	0.230748	3	0.025372	no	ARTAORT
chr2_33559304_G_A_b38	RASGRP3	9.012	1.97e-17	0.223688	3	0.024821	no	ARTAORT
chr2_33548762_A_G_b38	RASGRP3	8.781	1.04e-16	0.227214	3	0.025876	no	ARTAORT
chr2_33548469_T_C_b38	RASGRP3	8.582	4.28e-16	0.220118	3	0.025649	no	ARTAORT
chr2_33546942_C_G_b38	RASGRP3	8.471	9.36e-16	0.211821	4	0.025006	no	ARTAORT
chr2_33550216_T_A_b38	RASGRP3	8.36	2.03e-15	0.2151	3	0.02573	no	ARTAORT
chr2_33550484_C_G_b38	RASGRP3	8.351	2.16e-15	0.216017	3	0.025869	no	ARTAORT
chr2_33551676_A_G_b38	RASGRP3	8.351	2.16e-15	0.216017	3	0.025869	no	ARTAORT
chr2_33551697_A_T_b38	RASGRP3	8.351	2.16e-15	0.216017	3	0.025869	no	ARTAORT
chr2_33553995_C_T_b38	RASGRP3	8.351	2.16e-15	0.216017	3	0.025869	no	ARTAORT
chr2_33554542_A_G_b38	RASGRP3	8.351	2.16e-15	0.216017	3	0.025869	no	ARTAORT
chr2_33540561_TGTGTGTGTGTG_T_b38	RASGRP3	8.215	5.51e-15	0.196259	8	0.02389	no	ARTAORT
chr2_33552022_CAAACA_C_b38	RASGRP3	8.168	7.61e-15	0.210306	3	0.025748	no	ARTAORT
chr2_33512177_G_A_b38	RASGRP3	7.755	1.22e-13	0.159156	15	0.020522	no	ARTAORT
chr2_33525341_A_AAT_b38	RASGRP3	6.269	1.19e-09	0.127794	15	0.020384	no	ARTAORT
chr2_33536322_G_GA_b38	RASGRP3	5.494	8.09e-08	0.135426	11	0.024649	no	ARTAORT
chr2_33622592_T_C_b38	RASGRP3	4.725	3.47e-06	0.086129	32	0.018229	no	ARTAORT
chr2_33670716_C_T_b38	RASGRP3	4.69	4.08e-06	0.09114	20	0.019435	no	ARTAORT
chr2_33624881_G_GT_b38	RASGRP3	4.657	4.72e-06	0.085944	28	0.018453	no	ARTAORT
chr2_33656916_G_A_b38	RASGRP3	4.656	4.75e-06	0.084711	30	0.018193	no	ARTAORT
chr2_33622160_C_T_b38	RASGRP3	4.65	4.88e-06	0.086975	25	0.018703	no	ARTAORT
chr2_33565263_A_G_b38	RASGRP3	4.642	5.07e-06	0.096441	22	0.020776	no	ARTAORT
chr2_33656848_TA_T_b38	RASGRP3	4.554	7.51e-06	0.090363	16	0.019841	no	ARTAORT
chr2_33626436_A_T_b38	RASGRP3	4.48	1.04e-05	0.081926	31	0.018285	no	ARTAORT
chr2_33625315_G_A_b38	RASGRP3	4.448	1.2e-05	0.085436	23	0.019208	no	ARTAORT
chr2_33596963_A_T_b38	RASGRP3	4.402	1.47e-05	0.091555	19	0.020799	no	ARTAORT
chr2_33621819_C_A_b38	RASGRP3	4.229	3.07e-05	0.075198	36	0.01778	no	ARTAORT
chr2_33657078_T_C_b38	RASGRP3	4.175	3.86e-05	0.081858	20	0.019608	no	ARTAORT
chr2_33596450_T_G_b38	RASGRP3	4.078	5.75e-05	0.077322	29	0.01896	no	ARTAORT
chr2_33582025_C_T_b38	RASGRP3	4.064	6.09e-05	0.084618	18	0.02082	no	ARTAORT
chr2_33623108_T_C_b38	RASGRP3	4.045	6.57e-05	0.072736	35	0.017981	no	ARTAORT
chr2_33596617_C_T_b38	RASGRP3	4.045	6.58e-05	0.084819	18	0.020969	no	ARTAORT
chr2_33594326_C_T_b38	RASGRP3	3.956	9.43e-05	0.082288	19	0.020803	no	ARTAORT
chr2_33594385_G_A_b38	RASGRP3	3.956	9.43e-05	0.082288	19	0.020803	no	ARTAORT
chr2_32623793_CT_C_b38	RASGRP3	3.933	0.000103	0.073909	39	0.01879	no	ARTAORT
chr2_33590881_T_C_b38	RASGRP3	3.917	0.00011	0.074796	28	0.019094	no	ARTAORT
chr2_33537321_C_CA_b38	RASGRP3	3.916	0.00011	0.065655	61	0.016764	no	ARTAORT
chr2_33589264_G_C_b38	RASGRP3	3.809	0.000168	0.07224	29	0.018967	no	ARTAORT
chr2_32623591_T_C_b38	RASGRP3	3.732	0.000225	0.065185	53	0.017466	no	ARTAORT
chr2_32503408_CTTTGTTTG_C_b38	RASGRP3	3.706	0.000249	0.062636	59	0.016902	no	ARTAORT
chr2_32578951_G_A_b38	RASGRP3	3.694	0.00026	0.061817	50	0.016735	no	ARTAORT
chr2_33475871_A_C_b38	RASGRP3	-3.681	0.000273	-0.064799	36	0.017603	no	ARTAORT
chr2_33537330_C_CCCA_b38	RASGRP3	-3.656	3e-04	-0.097489	9	0.026668	no	ARTAORT
chr2_33968698_A_G_b38	RASGRP3	-3.64	0.000318	-0.074224	15	0.02039	no	ARTAORT
chr2_33971819_A_G_b38	RASGRP3	-3.64	0.000318	-0.074224	15	0.02039	no	ARTAORT
chr2_33972070_A_G_b38	RASGRP3	-3.64	0.000318	-0.074224	15	0.02039	no	ARTAORT
chr2_33972444_T_G_b38	RASGRP3	-3.64	0.000318	-0.074224	15	0.02039	no	ARTAORT
chr2_33976304_A_T_b38	RASGRP3	-3.64	0.000318	-0.074224	15	0.02039	no	ARTAORT
chr2_33622130_CA_C_b38	RASGRP3	-3.62	0.000343	-0.067702	31	0.018704	no	ARTAORT
chr2_33967488_C_T_b38	RASGRP3	-3.594	0.000377	-0.073754	15	0.020519	no	ARTAORT
chr2_33980670_A_ATTTATT_b38	RASGRP3	-3.564	0.000421	-0.071588	21	0.020084	no	ARTAORT
chr2_32540930_G_T_b38	RASGRP3	3.543	0.000455	0.061336	54	0.01731	no	ARTAORT
chr2_33967558_C_T_b38	RASGRP3	-3.54	0.00046	-0.070945	17	0.020041	no	ARTAORT
chr2_32447551_G_T_b38	RASGRP3	3.529	0.000479	0.074712	11	0.021171	no	ARTAORT
chr2_32568716_C_T_b38	RASGRP3	3.516	0.000501	0.060827	54	0.017298	no	ARTAORT
chr2_33534694_ATT_A_b38	RASGRP3	-3.512	0.000509	-0.092554	3	0.026352	no	ARTAORT
chr2_33625060_G_A_b38	RASGRP3	-3.46	0.000614	-0.055593	77	0.016067	no	ARTAORT
chr2_33980668_A_ATT_b38	RASGRP3	-3.457	0.000621	-0.06842	21	0.019791	no	ARTAORT
chr2_32534576_C_G_b38	RASGRP3	3.423	0.000701	0.058759	57	0.017167	no	ARTAORT
chr2_33624514_C_A_b38	RASGRP3	-3.421	0.000707	-0.054641	78	0.015974	no	ARTAORT
chr2_33613720_G_A_b38	RASGRP3	3.4	0.000761	0.085614	7	0.025182	no	ARTAORT
chr2_32494625_G_C_b38	RASGRP3	3.37	0.000845	0.058107	58	0.017242	no	ARTAORT
chr2_33816861_C_T_b38	RASGRP3	-3.276	0.00117	-0.051792	87	0.01581	no	ARTAORT
chr2_32597662_A_G_b38	RASGRP3	3.245	0.0013	0.055463	60	0.017094	no	ARTAORT
chr2_33604404_G_GTA_b38	RASGRP3	3.229	0.00137	0.084719	5	0.026239	no	ARTAORT
chr2_33764518_G_GTT_b38	RASGRP3	3.227	0.00138	0.098023	3	0.030373	no	ARTAORT
chr2_34008770_C_T_b38	RASGRP3	-3.221	0.00141	-0.066379	16	0.020606	no	ARTAORT
chr2_33629277_A_G_b38	RASGRP3	-3.206	0.00149	-0.050624	82	0.015793	no	ARTAORT
chr2_34007814_ATCT_A_b38	RASGRP3	-3.204	0.0015	-0.065259	16	0.020371	no	ARTAORT
chr2_34011307_G_A_b38	RASGRP3	-3.178	0.00163	-0.065478	15	0.020602	no	ARTAORT
chr2_33620413_GA_G_b38	RASGRP3	3.148	0.0018	0.077752	4	0.024703	no	ARTAORT
chr2_33812588_C_A_b38	RASGRP3	-3.122	0.00196	-0.050537	88	0.016187	no	ARTAORT
chr2_33629533_C_G_b38	RASGRP3	3.117	0.00199	0.077685	7	0.024923	no	ARTAORT
chr2_32438616_G_A_b38	RASGRP3	3.113	0.00202	0.052306	77	0.016802	no	ARTAORT
chr2_33671460_G_A_b38	RASGRP3	3.104	0.00208	0.077776	6	0.025055	no	ARTAORT
chr2_33631863_T_C_b38	RASGRP3	-3.097	0.00213	-0.048249	101	0.01558	no	ARTAORT
chr2_33607432_G_A_b38	RASGRP3	3.088	0.00219	0.084183	4	0.027258	no	ARTAORT
chr2_33370068_CTCAGTTTCTCATGTGAAAATAATATCTGCCTT_C_b38	RASGRP3	-3.085	0.00221	-0.079849	5	0.025882	no	ARTAORT
chr2_33631185_T_G_b38	RASGRP3	-3.076	0.00228	-0.048054	101	0.015624	no	ARTAORT
chr2_33633545_T_G_b38	RASGRP3	3.059	0.00241	0.084013	3	0.027468	no	ARTAORT
chr2_33812850_A_G_b38	RASGRP3	-3.057	0.00243	-0.049705	88	0.01626	no	ARTAORT
chr2_32578807_C_A_b38	RASGRP3	3.044	0.00253	0.051762	79	0.017007	no	ARTAORT
chr2_33373822_A_C_b38	RASGRP3	-3.038	0.00258	-0.077218	6	0.025415	no	ARTAORT
chr2_33638203_C_CT_b38	RASGRP3	-3.022	0.00272	-0.061577	31	0.020378	no	ARTAORT
chr2_33567745_C_T_b38	RASGRP3	-3.021	0.00273	-0.052921	54	0.017518	no	ARTAORT
chr2_33812722_G_A_b38	RASGRP3	-3.012	0.00281	-0.049273	76	0.016361	no	ARTAORT
chr2_33615450_C_G_b38	RASGRP3	2.994	0.00297	0.079959	4	0.02671	no	ARTAORT
chr2_33615793_A_T_b38	RASGRP3	2.994	0.00297	0.079959	4	0.02671	no	ARTAORT
chr2_33621944_G_A_b38	RASGRP3	2.994	0.00297	0.079959	4	0.02671	no	ARTAORT
chr2_33623483_C_T_b38	RASGRP3	2.994	0.00297	0.079959	4	0.02671	no	ARTAORT
chr2_32463533_A_C_b38	RASGRP3	2.979	0.00311	0.051872	74	0.017411	no	ARTAORT
chr2_32454479_A_AT_b38	RASGRP3	2.97	0.0032	0.051311	82	0.017274	no	ARTAORT
chr2_33812809_C_T_b38	RASGRP3	-2.952	0.00339	-0.047342	99	0.016037	no	ARTAORT
chr2_33668030_G_A_b38	RASGRP3	2.951	0.00341	0.083592	3	0.028331	no	ARTAORT
chr2_33476728_C_CCT_b38	RASGRP3	2.922	0.00373	0.051743	79	0.017707	no	ARTAORT
chr2_33816106_T_G_b38	RASGRP3	2.921	0.00373	0.060307	16	0.020643	no	ARTAORT
chr2_33816477_T_TCATA_b38	RASGRP3	2.914	0.00383	0.059822	16	0.020531	no	ARTAORT
chr2_33984472_G_GTT_b38	RASGRP3	-2.909	0.00388	-0.061877	13	0.021267	no	ARTAORT
chr2_33283061_C_CA_b38	RASGRP3	-2.906	0.00392	-0.082918	10	0.028535	no	ARTAORT
chr2_33548381_A_AAAAAG_b38	RASGRP3	2.902	0.00397	0.085398	6	0.029429	no	ARTAORT
chr2_33815958_A_G_b38	RASGRP3	-2.889	0.00413	-0.047549	76	0.016456	no	ARTAORT
chr2_33816056_A_T_b38	RASGRP3	-2.889	0.00413	-0.047549	76	0.016456	no	ARTAORT
chr2_33818359_A_G_b38	RASGRP3	2.889	0.00413	0.059608	16	0.020634	no	ARTAORT
chr2_33813936_C_T_b38	RASGRP3	2.878	0.00427	0.048025	71	0.016686	no	ARTAORT
chr2_32470691_T_C_b38	RASGRP3	2.868	0.0044	0.049956	71	0.017415	no	ARTAORT
chr2_33946620_GC_G_b38	RASGRP3	2.855	0.00459	0.067105	10	0.023508	no	ARTAORT
chr2_33811559_T_C_b38	RASGRP3	-2.841	0.00479	-0.072386	4	0.025482	no	ARTAORT
chr2_33457670_G_T_b38	RASGRP3	2.838	0.00483	0.048731	48	0.017169	no	ARTAORT
chr2_33906683_C_CATTTATTTATTTATTTATTTATTT_b38	RASGRP3	-2.836	0.00487	-0.053724	27	0.018945	no	ARTAORT
chr2_33816730_T_TTTCC_b38	RASGRP3	-2.834	0.0049	-0.046292	87	0.016336	no	ARTAORT
chr2_32607190_TATC_T_b38	RASGRP3	2.819	0.00512	0.04795	76	0.017009	no	ARTAORT
chr2_33943849_G_A_b38	RASGRP3	2.81	0.00526	0.065917	10	0.023456	no	ARTAORT
chr2_33620497_T_C_b38	RASGRP3	2.809	0.00529	0.062907	12	0.022398	no	ARTAORT
chr2_33816487_G_C_b38	RASGRP3	-2.807	0.00531	-0.046117	86	0.016428	no	ARTAORT
chr2_33477612_G_T_b38	RASGRP3	2.806	0.00532	0.047783	91	0.017028	no	ARTAORT
chr2_32634838_C_G_b38	RASGRP3	2.804	0.00536	0.047319	72	0.016875	no	ARTAORT
chr2_33907675_G_A_b38	RASGRP3	2.79	0.00558	0.045213	94	0.016203	no	ARTAORT
chr2_32540777_C_T_b38	RASGRP3	2.78	0.00577	0.047397	69	0.017051	no	ARTAORT
chr2_33822059_T_A_b38	RASGRP3	2.767	0.00599	0.056826	16	0.020538	no	ARTAORT
chr2_33604404_GTA_G_b38	RASGRP3	-2.758	0.00616	-0.050343	31	0.018254	no	ARTAORT
chr2_32466332_T_G_b38	RASGRP3	2.741	0.00648	0.047727	76	0.017414	no	ARTAORT
chr2_33813753_G_C_b38	RASGRP3	-2.733	0.00664	-0.04481	85	0.016398	no	ARTAORT
chr2_33813961_C_G_b38	RASGRP3	-2.733	0.00664	-0.04481	85	0.016398	no	ARTAORT
chr2_33297463_G_A_b38	RASGRP3	-2.725	0.0068	-0.071289	7	0.026166	no	ARTAORT
chr2_33816067_G_A_b38	RASGRP3	-2.715	0.007	-0.044395	86	0.016355	no	ARTAORT
chr2_33816311_C_T_b38	RASGRP3	-2.715	0.007	-0.044395	86	0.016355	no	ARTAORT
chr2_33816569_C_T_b38	RASGRP3	-2.715	0.007	-0.044395	86	0.016355	no	ARTAORT
chr2_33629657_C_CT_b38	RASGRP3	2.715	0.007	0.061285	10	0.022577	no	ARTAORT
chr2_33530497_CT_C_b38	RASGRP3	2.705	0.0072	0.056321	13	0.020821	no	ARTAORT
chr2_32644180_C_CA_b38	RASGRP3	-2.705	0.0072	-0.05331	18	0.019708	no	ARTAORT
chr2_33815354_C_G_b38	RASGRP3	-2.677	0.00782	-0.043746	85	0.016343	no	ARTAORT
chr2_33272103_G_A_b38	RASGRP3	-2.651	0.00844	-0.072086	7	0.027194	no	ARTAORT
chr2_33772629_T_A_b38	RASGRP3	2.643	0.00862	0.131992	3	0.049938	no	ARTAORT
chr2_32543730_G_A_b38	RASGRP3	2.642	0.00865	0.045075	76	0.01706	no	ARTAORT
chr2_33469706_C_T_b38	RASGRP3	2.642	0.00866	0.045349	69	0.017167	no	ARTAORT
chr2_33611855_A_C_b38	RASGRP3	2.639	0.00872	0.069597	4	0.026368	no	ARTAORT
chr2_33476930_C_CG_b38	RASGRP3	2.638	0.00874	0.045472	89	0.017234	no	ARTAORT
chr2_33477035_T_G_b38	RASGRP3	2.638	0.00874	0.045472	89	0.017234	no	ARTAORT
chr2_33477050_G_GA_b38	RASGRP3	2.638	0.00874	0.045472	89	0.017234	no	ARTAORT
chr2_32629601_AT_A_b38	RASGRP3	2.637	0.00877	0.046732	64	0.017719	no	ARTAORT
chr2_33815678_TTTTA_T_b38	RASGRP3	-2.621	0.00918	-0.042861	87	0.01635	no	ARTAORT
chr2_33282062_CATATAT_C_b38	RASGRP3	-2.621	0.00919	-0.061755	9	0.023562	no	ARTAORT
chr2_33958155_G_GAC_b38	RASGRP3	-2.615	0.00934	-0.06115	12	0.02338	no	ARTAORT
chr2_33121159_CTTT_C_b38	RASGRP3	-2.614	0.00937	-0.097873	3	0.037441	no	ARTAORT
chr2_33837258_A_G_b38	RASGRP3	-2.605	0.00962	-0.072749	7	0.027925	no	ARTAORT
chr2_33467042_C_T_b38	RASGRP3	2.601	0.00973	0.047649	40	0.018318	no	ARTAORT
chr2_32504696_A_T_b38	RASGRP3	2.599	0.0098	0.044005	65	0.016933	no	ARTAORT
chr2_33475238_C_T_b38	RASGRP3	2.596	0.00988	0.058819	10	0.022659	no	ARTAORT
chr2_33512177_G_A_b38	RASGRP3	5.532	1.16e-07	0.188375	7	0.03405	yes	ARTCRN
chr2_33586869_A_T_b38	RASGRP3	4.785	3.66e-06	0.159165	6	0.033264	yes	ARTCRN
chr2_33596963_A_T_b38	RASGRP3	4.302	2.84e-05	0.142319	7	0.033085	yes	ARTCRN
chr2_33594326_C_T_b38	RASGRP3	4.294	2.93e-05	0.143668	6	0.033459	yes	ARTCRN
chr2_33594385_G_A_b38	RASGRP3	4.294	2.93e-05	0.143668	6	0.033459	yes	ARTCRN
chr2_33596617_C_T_b38	RASGRP3	4.294	2.93e-05	0.143668	6	0.033459	yes	ARTCRN
chr2_33548381_A_AAAG_b38	RASGRP3	4.027	8.47e-05	0.171257	4	0.042529	yes	ARTCRN
chr2_33657078_T_C_b38	RASGRP3	3.953	0.000113	0.118158	14	0.029891	yes	ARTCRN
chr2_33634524_A_G_b38	RASGRP3	3.917	0.000129	0.154693	4	0.039488	yes	ARTCRN
chr2_33634816_G_T_b38	RASGRP3	3.917	0.000129	0.154693	4	0.039488	yes	ARTCRN
chr2_33636858_C_G_b38	RASGRP3	3.917	0.000129	0.154693	4	0.039488	yes	ARTCRN
chr2_33637736_A_T_b38	RASGRP3	3.917	0.000129	0.154693	4	0.039488	yes	ARTCRN
chr2_33565263_A_G_b38	RASGRP3	3.902	0.000137	0.126723	13	0.032479	yes	ARTCRN
chr2_33627793_A_G_b38	RASGRP3	3.856	0.000163	0.150351	4	0.03899	yes	ARTCRN
chr2_33616325_C_T_b38	RASGRP3	3.85	0.000166	0.150779	4	0.039161	yes	ARTCRN
chr2_33582025_C_T_b38	RASGRP3	3.822	0.000184	0.127322	6	0.033309	yes	ARTCRN
chr2_33581561_C_T_b38	RASGRP3	3.772	0.000223	0.125393	7	0.033246	yes	ARTCRN
chr2_33605827_ATTTTTCT_A_b38	RASGRP3	3.745	0.000246	0.142601	4	0.038081	yes	ARTCRN
chr2_33631243_G_GT_b38	RASGRP3	3.714	0.000275	0.150458	4	0.040511	yes	ARTCRN
chr2_33640513_G_C_b38	RASGRP3	3.714	0.000275	0.145327	4	0.03913	yes	ARTCRN
chr2_33656848_TA_T_b38	RASGRP3	3.638	0.000364	0.112152	10	0.030831	yes	ARTCRN
chr2_33606703_C_T_b38	RASGRP3	3.635	0.000367	0.144696	4	0.03981	yes	ARTCRN
chr2_33667549_A_G_b38	RASGRP3	3.552	0.000493	0.144718	4	0.040742	yes	ARTCRN
chr2_33667555_A_G_b38	RASGRP3	3.552	0.000493	0.144718	4	0.040742	yes	ARTCRN
chr2_33563588_C_T_b38	RASGRP3	-3.511	0.000569	-0.099692	24	0.028392	yes	ARTCRN
chr2_33634843_C_CTT_b38	RASGRP3	3.431	0.000754	0.159548	3	0.046507	yes	ARTCRN
chr2_33093442_C_G_b38	RASGRP3	-3.37	0.000929	-0.132293	6	0.039258	yes	ARTCRN
chr2_33567745_C_T_b38	RASGRP3	-3.368	0.000934	-0.085031	39	0.025246	yes	ARTCRN
chr2_33659035_G_A_b38	RASGRP3	3.365	0.000942	0.136214	4	0.040474	yes	ARTCRN
chr2_33622160_C_T_b38	RASGRP3	3.318	0.00111	0.096737	15	0.029159	yes	ARTCRN
chr2_33990535_C_CT_b38	RASGRP3	-3.316	0.00111	-0.106693	14	0.032173	yes	ARTCRN
chr2_33511010_G_A_b38	RASGRP3	3.221	0.00153	0.147147	4	0.04568	yes	ARTCRN
chr2_33672387_A_G_b38	RASGRP3	3.219	0.00154	0.116801	5	0.036287	yes	ARTCRN
chr2_33563592_T_TAACA_b38	RASGRP3	-3.17	0.00181	-0.096115	15	0.030321	yes	ARTCRN
chr2_33091518_T_C_b38	RASGRP3	-3.153	0.00191	-0.127332	5	0.040388	yes	ARTCRN
chr2_33092645_AT_A_b38	RASGRP3	-3.082	0.0024	-0.122444	6	0.03973	yes	ARTCRN
chr2_33669574_A_G_b38	RASGRP3	3.043	0.00271	0.110944	5	0.036459	yes	ARTCRN
chr2_33518114_A_G_b38	RASGRP3	-3.027	0.00285	-0.079756	31	0.026344	yes	ARTCRN
chr2_33987310_C_T_b38	RASGRP3	-3.025	0.00287	-0.088534	14	0.029267	yes	ARTCRN
chr2_33571267_T_A_b38	RASGRP3	-3.019	0.00292	-0.076061	43	0.025196	yes	ARTCRN
chr2_33613720_G_A_b38	RASGRP3	2.955	0.00356	0.108235	6	0.036623	yes	ARTCRN
chr2_33563089_C_T_b38	RASGRP3	2.938	0.00376	0.090981	12	0.030967	yes	ARTCRN
chr2_33669427_A_C_b38	RASGRP3	2.913	0.00405	0.106207	5	0.036459	yes	ARTCRN
chr2_33572204_C_A_b38	RASGRP3	-2.909	0.00411	-0.073788	42	0.025369	yes	ARTCRN
chr2_33985223_T_A_b38	RASGRP3	-2.892	0.00432	-0.084946	14	0.02937	yes	ARTCRN
chr2_33985597_T_C_b38	RASGRP3	-2.892	0.00432	-0.084946	14	0.02937	yes	ARTCRN
chr2_33985798_C_T_b38	RASGRP3	-2.892	0.00432	-0.084946	14	0.02937	yes	ARTCRN
chr2_33985843_T_C_b38	RASGRP3	-2.892	0.00432	-0.084946	14	0.02937	yes	ARTCRN
chr2_33985883_T_C_b38	RASGRP3	-2.892	0.00432	-0.084946	14	0.02937	yes	ARTCRN
chr2_33091214_G_A_b38	RASGRP3	-2.889	0.00437	-0.115043	6	0.039827	yes	ARTCRN
chr2_33564001_C_G_b38	RASGRP3	2.887	0.00438	0.086822	22	0.030069	yes	ARTCRN
chr2_33566210_A_C_b38	RASGRP3	-2.876	0.00454	-0.091168	11	0.031698	yes	ARTCRN
chr2_33568339_TA_T_b38	RASGRP3	-2.845	0.00498	-0.07223	47	0.025391	yes	ARTCRN
chr2_33986338_A_G_b38	RASGRP3	-2.84	0.00505	-0.081932	15	0.028846	yes	ARTCRN
chr2_33984835_G_A_b38	RASGRP3	-2.825	0.00529	-0.082556	14	0.029222	yes	ARTCRN
chr2_33519891_C_T_b38	RASGRP3	-2.815	0.00544	-0.073693	37	0.026175	yes	ARTCRN
chr2_33983149_C_T_b38	RASGRP3	-2.815	0.00545	-0.081952	14	0.029118	yes	ARTCRN
chr2_33983389_G_A_b38	RASGRP3	-2.815	0.00545	-0.081952	14	0.029118	yes	ARTCRN
chr2_33569371_A_G_b38	RASGRP3	-2.804	0.00563	-0.071217	45	0.025399	yes	ARTCRN
chr2_33571342_T_C_b38	RASGRP3	-2.778	0.00608	-0.070352	43	0.025328	yes	ARTCRN
chr2_33514489_T_C_b38	RASGRP3	-2.729	0.00701	-0.069474	38	0.025456	yes	ARTCRN
chr2_32847064_C_T_b38	RASGRP3	-2.706	0.00749	-0.071042	31	0.026251	yes	ARTCRN
chr2_33620575_G_A_b38	RASGRP3	2.703	0.00757	0.091429	8	0.033828	yes	ARTCRN
chr2_33982557_G_C_b38	RASGRP3	-2.695	0.00774	-0.074612	19	0.027685	yes	ARTCRN
chr2_33512820_T_A_b38	RASGRP3	-2.691	0.00783	-0.070521	34	0.026206	yes	ARTCRN
chr2_33655774_A_G_b38	RASGRP3	-2.679	0.00809	-0.067675	49	0.025258	yes	ARTCRN
chr2_33508487_T_C_b38	RASGRP3	2.663	0.00847	0.117883	7	0.044261	yes	ARTCRN
chr2_33383890_A_C_b38	RASGRP3	2.657	0.00863	0.092833	6	0.03494	yes	ARTCRN
chr2_33620497_T_C_b38	RASGRP3	2.646	0.00889	0.08958	8	0.03385	yes	ARTCRN
chr2_32873499_C_CA_b38	RASGRP3	-2.634	0.0092	-0.080768	13	0.030661	yes	ARTCRN
chr2_33631185_T_G_b38	RASGRP3	-2.631	0.00928	-0.065677	52	0.024962	yes	ARTCRN
chr2_33593131_C_T_b38	RASGRP3	-2.621	0.00955	-0.066507	47	0.025375	yes	ARTCRN
chr2_33577889_G_A_b38	RASGRP3	-2.619	0.00962	-0.067255	40	0.025684	yes	ARTCRN
chr2_33537330_C_CCCAACACA_b38	RASGRP3	7.099	3.17e-11	0.238276	8	0.033565	no	ARTCRN
chr2_33540561_TGTGTGTGTGTG_T_b38	RASGRP3	6.607	4.73e-10	0.244162	5	0.036958	no	ARTCRN
chr2_33536322_G_GA_b38	RASGRP3	5.176	6.28e-07	0.207175	4	0.040029	no	ARTCRN
chr2_33521266_C_T_b38	RASGRP3	5.064	1.05e-06	0.154384	11	0.030486	no	ARTCRN
chr2_33529318_C_T_b38	RASGRP3	4.839	2.88e-06	0.170643	3	0.035261	no	ARTCRN
chr2_33561445_C_A_b38	RASGRP3	4.624	7.38e-06	0.163261	3	0.03531	no	ARTCRN
chr2_33525341_A_AAT_b38	RASGRP3	4.561	9.66e-06	0.142289	10	0.0312	no	ARTCRN
chr2_33523649_G_A_b38	RASGRP3	4.535	1.08e-05	0.167632	3	0.036965	no	ARTCRN
chr2_33537321_C_CA_b38	RASGRP3	3.757	0.000235	0.099773	27	0.026558	no	ARTCRN
chr2_33652477_C_A_b38	RASGRP3	3.725	0.000265	0.117742	7	0.031609	no	ARTCRN
chr2_33639021_G_A_b38	RASGRP3	3.692	0.000298	0.117257	7	0.03176	no	ARTCRN
chr2_33640631_A_C_b38	RASGRP3	3.692	0.000298	0.117257	7	0.03176	no	ARTCRN
chr2_33641397_G_C_b38	RASGRP3	3.692	0.000298	0.117257	7	0.03176	no	ARTCRN
chr2_33596450_T_G_b38	RASGRP3	3.685	0.000307	0.111502	13	0.030261	no	ARTCRN
chr2_33589264_G_C_b38	RASGRP3	3.663	0.000331	0.111779	12	0.030512	no	ARTCRN
chr2_33590881_T_C_b38	RASGRP3	3.663	0.000331	0.111779	12	0.030512	no	ARTCRN
chr2_33581900_A_T_b38	RASGRP3	3.609	0.000402	0.141896	3	0.039313	no	ARTCRN
chr2_33650021_A_G_b38	RASGRP3	3.562	0.000477	0.112474	7	0.03158	no	ARTCRN
chr2_33581338_T_A_b38	RASGRP3	3.544	0.000508	0.140442	3	0.039634	no	ARTCRN
chr2_33563965_A_G_b38	RASGRP3	3.355	0.000977	0.13219	3	0.039404	no	ARTCRN
chr2_33656248_TTC_T_b38	RASGRP3	3.316	0.00111	0.105071	7	0.031688	no	ARTCRN
chr2_33662459_C_T_b38	RASGRP3	3.195	0.00166	0.10178	7	0.031858	no	ARTCRN
chr2_33663555_T_C_b38	RASGRP3	3.145	0.00195	0.100249	7	0.031871	no	ARTCRN
chr2_33659127_A_G_b38	RASGRP3	-3.137	0.00201	-0.078504	51	0.025028	no	ARTCRN
chr2_33621819_C_A_b38	RASGRP3	3.103	0.00224	0.085385	21	0.027519	no	ARTCRN
chr2_33664871_G_GT_b38	RASGRP3	-3.063	0.00254	-0.079923	45	0.026093	no	ARTCRN
chr2_33623108_T_C_b38	RASGRP3	3.025	0.00287	0.084907	20	0.028068	no	ARTCRN
chr2_33547458_G_A_b38	RASGRP3	3.017	0.00294	0.082684	26	0.027405	no	ARTCRN
chr2_33661731_A_G_b38	RASGRP3	-2.993	0.00317	-0.074738	51	0.024975	no	ARTCRN
chr2_33537323_G_A_b38	RASGRP3	2.915	0.00403	0.075117	44	0.025772	no	ARTCRN
chr2_33625315_G_A_b38	RASGRP3	2.899	0.00424	0.087072	12	0.030038	no	ARTCRN
chr2_33572064_TAATA_T_b38	RASGRP3	-2.876	0.00454	-0.137801	3	0.047918	no	ARTCRN
chr2_33664465_T_A_b38	RASGRP3	-2.875	0.00455	-0.072437	49	0.025196	no	ARTCRN
chr2_33398095_C_G_b38	RASGRP3	-2.847	0.00496	-0.089918	22	0.031589	no	ARTCRN
chr2_33596444_C_T_b38	RASGRP3	-2.842	0.00503	-0.100731	8	0.035445	no	ARTCRN
chr2_33666591_A_G_b38	RASGRP3	-2.706	0.00749	-0.068986	51	0.025492	no	ARTCRN
chr2_33679537_C_CTTT_b38	RASGRP3	-2.705	0.00751	-0.099458	11	0.036765	no	ARTCRN
chr2_34401348_T_TCTGA_b38	RASGRP3	-2.682	0.00803	-0.074322	30	0.02771	no	ARTCRN
chr2_33670716_C_T_b38	RASGRP3	2.67	0.00832	0.081568	10	0.030553	no	ARTCRN
chr2_32820947_GAAGCAGATTCTGGAA_G_b38	RASGRP3	-2.656	0.00865	-0.126448	3	0.047605	no	ARTCRN
chr2_33624881_G_GT_b38	RASGRP3	2.646	0.00891	0.078565	13	0.029695	no	ARTCRN
chr2_33838729_G_A_b38	RASGRP3	2.638	0.0091	0.084573	11	0.032058	no	ARTCRN
chr2_33988983_A_G_b38	RASGRP3	-2.636	0.00915	-0.079352	13	0.030102	no	ARTCRN
chr2_33664742_G_C_b38	RASGRP3	-2.628	0.00938	-0.066611	50	0.025351	no	ARTCRN
chr2_33647765_T_C_b38	RASGRP3	-2.61	0.00987	-0.066088	50	0.025326	no	ARTCRN
chr2_33540561_TGTGTGTGTGTG_T_b38	RASGRP3	7.202	2.12e-12	0.134204	14	0.018634	yes	ARTTBL
chr2_33536526_G_A_b38	RASGRP3	6.885	1.69e-11	0.142932	4	0.02076	yes	ARTTBL
chr2_33536528_G_A_b38	RASGRP3	6.885	1.69e-11	0.142932	4	0.02076	yes	ARTTBL
chr2_33537896_A_G_b38	RASGRP3	6.765	3.65e-11	0.133044	6	0.019667	yes	ARTTBL
chr2_33537330_C_CCCAACACA_b38	RASGRP3	6.522	1.67e-10	0.109201	26	0.016744	yes	ARTTBL
chr2_33526597_C_T_b38	RASGRP3	6.306	6.2e-10	0.122689	8	0.019457	yes	ARTTBL
chr2_33527062_GC_G_b38	RASGRP3	6.306	6.2e-10	0.122689	8	0.019457	yes	ARTTBL
chr2_33548762_A_G_b38	RASGRP3	6.291	6.78e-10	0.128034	6	0.020353	yes	ARTTBL
chr2_33548469_T_C_b38	RASGRP3	6.254	8.46e-10	0.123489	7	0.019747	yes	ARTTBL
chr2_33559734_G_A_b38	RASGRP3	6.239	9.23e-10	0.120995	7	0.019394	yes	ARTTBL
chr2_33537192_G_GAT_b38	RASGRP3	6.222	1.02e-09	0.118227	7	0.019	yes	ARTTBL
chr2_33550484_C_G_b38	RASGRP3	6.205	1.13e-09	0.122987	7	0.01982	yes	ARTTBL
chr2_33559068_A_G_b38	RASGRP3	6.189	1.24e-09	0.123024	6	0.019878	yes	ARTTBL
chr2_33557635_G_A_b38	RASGRP3	6.189	1.24e-09	0.120475	7	0.019467	yes	ARTTBL
chr2_33550216_T_A_b38	RASGRP3	6.188	1.25e-09	0.122841	7	0.019852	yes	ARTTBL
chr2_33559304_G_A_b38	RASGRP3	6.166	1.42e-09	0.120523	7	0.019546	yes	ARTTBL
chr2_33531453_C_T_b38	RASGRP3	6.127	1.78e-09	0.117567	9	0.019187	yes	ARTTBL
chr2_33551676_A_G_b38	RASGRP3	6.074	2.43e-09	0.121841	6	0.02006	yes	ARTTBL
chr2_33551697_A_T_b38	RASGRP3	6.074	2.43e-09	0.121841	6	0.02006	yes	ARTTBL
chr2_33553995_C_T_b38	RASGRP3	6.04	2.95e-09	0.11943	7	0.019772	yes	ARTTBL
chr2_33554542_A_G_b38	RASGRP3	5.994	3.85e-09	0.119069	7	0.019863	yes	ARTTBL
chr2_33552022_CAAACA_C_b38	RASGRP3	5.957	4.78e-09	0.118118	7	0.01983	yes	ARTTBL
chr2_33529269_C_A_b38	RASGRP3	5.873	7.69e-09	0.113357	9	0.019301	yes	ARTTBL
chr2_33557844_G_A_b38	RASGRP3	5.859	8.35e-09	0.110825	10	0.018916	yes	ARTTBL
chr2_33539987_GAAAAA_G_b38	RASGRP3	5.764	1.42e-08	0.12637	5	0.021922	yes	ARTTBL
chr2_33546942_C_G_b38	RASGRP3	5.652	2.63e-08	0.110308	9	0.019516	yes	ARTTBL
chr2_33529318_C_T_b38	RASGRP3	5.334	1.44e-07	0.089349	14	0.01675	yes	ARTTBL
chr2_33547053_GAA_G_b38	RASGRP3	5.198	2.92e-07	0.128512	5	0.024725	yes	ARTTBL
chr2_33540888_T_C_b38	RASGRP3	-4.974	8.96e-07	-0.057274	153	0.011515	yes	ARTTBL
chr2_33541741_G_T_b38	RASGRP3	-4.912	1.21e-06	-0.056727	153	0.011549	yes	ARTTBL
chr2_33577889_G_A_b38	RASGRP3	-4.907	1.24e-06	-0.061619	94	0.012557	yes	ARTTBL
chr2_33539533_G_T_b38	RASGRP3	-4.896	1.31e-06	-0.056412	155	0.011522	yes	ARTTBL
chr2_33512177_G_A_b38	RASGRP3	4.859	1.57e-06	0.082278	23	0.016932	yes	ARTTBL
chr2_33523649_G_A_b38	RASGRP3	4.786	2.23e-06	0.081073	18	0.016939	yes	ARTTBL
chr2_33575950_G_A_b38	RASGRP3	-4.763	2.49e-06	-0.059814	92	0.012559	yes	ARTTBL
chr2_33561445_C_A_b38	RASGRP3	4.74	2.77e-06	0.078949	21	0.016654	yes	ARTTBL
chr2_33571342_T_C_b38	RASGRP3	-4.735	2.84e-06	-0.058759	101	0.01241	yes	ARTTBL
chr2_33581561_C_T_b38	RASGRP3	4.719	3.05e-06	0.070925	35	0.015028	yes	ARTTBL
chr2_33650021_A_G_b38	RASGRP3	4.646	4.3e-06	0.071504	24	0.015389	yes	ARTTBL
chr2_33475871_A_C_b38	RASGRP3	-4.633	4.57e-06	-0.059855	63	0.012918	yes	ARTTBL
chr2_33656248_TTC_T_b38	RASGRP3	4.63	4.65e-06	0.071229	24	0.015385	yes	ARTTBL
chr2_33525341_A_AAT_b38	RASGRP3	4.561	6.39e-06	0.067296	34	0.014756	yes	ARTTBL
chr2_33512902_A_G_b38	RASGRP3	-4.56	6.4e-06	-0.057947	120	0.012707	yes	ARTTBL
chr2_33582025_C_T_b38	RASGRP3	4.552	6.63e-06	0.068341	35	0.015012	yes	ARTTBL
chr2_33539219_T_C_b38	RASGRP3	-4.548	6.76e-06	-0.058086	92	0.012772	yes	ARTTBL
chr2_33581900_A_T_b38	RASGRP3	4.545	6.87e-06	0.083277	13	0.018325	yes	ARTTBL
chr2_33571586_T_C_b38	RASGRP3	-4.532	7.29e-06	-0.05459	124	0.012047	yes	ARTTBL
chr2_33581338_T_A_b38	RASGRP3	4.502	8.33e-06	0.082541	13	0.018334	yes	ARTTBL
chr2_33571267_T_A_b38	RASGRP3	-4.499	8.47e-06	-0.055731	100	0.012388	yes	ARTTBL
chr2_33596617_C_T_b38	RASGRP3	4.477	9.35e-06	0.068318	36	0.015261	yes	ARTTBL
chr2_33518114_A_G_b38	RASGRP3	-4.464	9.91e-06	-0.056358	78	0.012626	yes	ARTTBL
chr2_33529319_G_C_b38	RASGRP3	-4.46	1.01e-05	-0.057644	91	0.012926	yes	ARTTBL
chr2_33546150_G_A_b38	RASGRP3	-4.426	1.17e-05	-0.056468	89	0.012759	yes	ARTTBL
chr2_33555164_G_A_b38	RASGRP3	4.404	1.29e-05	0.074552	19	0.016927	yes	ARTTBL
chr2_33572204_C_A_b38	RASGRP3	-4.396	1.34e-05	-0.054938	100	0.012496	yes	ARTTBL
chr2_33539434_T_C_b38	RASGRP3	-4.382	1.43e-05	-0.056251	90	0.012837	yes	ARTTBL
chr2_33539436_C_G_b38	RASGRP3	-4.382	1.43e-05	-0.056251	90	0.012837	yes	ARTTBL
chr2_33596963_A_T_b38	RASGRP3	4.382	1.43e-05	0.066528	36	0.015183	yes	ARTTBL
chr2_33569371_A_G_b38	RASGRP3	-4.371	1.5e-05	-0.054588	102	0.012488	yes	ARTTBL
chr2_33536207_C_T_b38	RASGRP3	-4.355	1.61e-05	-0.055882	90	0.012833	yes	ARTTBL
chr2_33652477_C_A_b38	RASGRP3	4.349	1.65e-05	0.067434	24	0.015504	yes	ARTTBL
chr2_33512820_T_A_b38	RASGRP3	-4.348	1.65e-05	-0.053764	86	0.012364	yes	ARTTBL
chr2_33539642_C_G_b38	RASGRP3	-4.338	1.73e-05	-0.055764	90	0.012855	yes	ARTTBL
chr2_33563965_A_G_b38	RASGRP3	4.315	1.92e-05	0.078841	13	0.018273	yes	ARTTBL
chr2_33544520_G_GA_b38	RASGRP3	-4.302	2.02e-05	-0.056381	82	0.013105	yes	ARTTBL
chr2_33594326_C_T_b38	RASGRP3	4.301	2.04e-05	0.065044	37	0.015125	yes	ARTTBL
chr2_33565263_A_G_b38	RASGRP3	4.259	2.45e-05	0.063662	46	0.014949	yes	ARTTBL
chr2_33540615_TTCTC_T_b38	RASGRP3	-4.256	2.48e-05	-0.05242	117	0.012318	yes	ARTTBL
chr2_33568339_TA_T_b38	RASGRP3	-4.238	2.68e-05	-0.052624	108	0.012417	yes	ARTTBL
chr2_33586869_A_T_b38	RASGRP3	4.18	3.43e-05	0.064864	32	0.015519	yes	ARTTBL
chr2_33520335_A_G_b38	RASGRP3	-4.175	3.51e-05	-0.053559	97	0.01283	yes	ARTTBL
chr2_33525106_A_T_b38	RASGRP3	-4.169	3.59e-05	-0.05302	110	0.012718	yes	ARTTBL
chr2_33594385_G_A_b38	RASGRP3	4.147	3.95e-05	0.062609	37	0.015099	yes	ARTTBL
chr2_33522519_T_C_b38	RASGRP3	-4.146	3.95e-05	-0.053443	92	0.012889	yes	ARTTBL
chr2_33540561_TGTGTGTGTGTGTGTGTG_T_b38	RASGRP3	-4.145	3.97e-05	-0.052781	92	0.012733	yes	ARTTBL
chr2_33519891_C_T_b38	RASGRP3	-4.114	4.53e-05	-0.05146	96	0.012508	yes	ARTTBL
chr2_33533389_G_A_b38	RASGRP3	-4.112	4.56e-05	-0.052818	83	0.012844	yes	ARTTBL
chr2_33562245_G_C_b38	RASGRP3	-4.052	5.87e-05	-0.052598	89	0.012981	yes	ARTTBL
chr2_33470233_G_A_b38	RASGRP3	4.051	5.88e-05	0.051099	94	0.012613	yes	ARTTBL
chr2_33567745_C_T_b38	RASGRP3	-4.045	6.05e-05	-0.050212	92	0.012415	yes	ARTTBL
chr2_33469436_T_C_b38	RASGRP3	4.025	6.56e-05	0.050656	94	0.012586	yes	ARTTBL
chr2_33556190_G_A_b38	RASGRP3	-4.018	6.76e-05	-0.051768	88	0.012885	yes	ARTTBL
chr2_33523281_G_A_b38	RASGRP3	-4.014	6.86e-05	-0.051857	78	0.012919	yes	ARTTBL
chr2_33470439_G_A_b38	RASGRP3	4.003	7.18e-05	0.050014	97	0.012495	yes	ARTTBL
chr2_33528299_G_A_b38	RASGRP3	-4.002	7.2e-05	-0.051017	98	0.012747	yes	ARTTBL
chr2_33523461_TA_T_b38	RASGRP3	3.978	7.93e-05	0.067953	12	0.01708	yes	ARTTBL
chr2_33470311_T_A_b38	RASGRP3	3.969	8.25e-05	0.050135	94	0.012632	yes	ARTTBL
chr2_33518880_G_GTCA_b38	RASGRP3	-3.963	8.46e-05	-0.051209	106	0.012923	yes	ARTTBL
chr2_33470006_T_C_b38	RASGRP3	3.961	8.51e-05	0.049878	95	0.012591	yes	ARTTBL
chr2_33470875_C_T_b38	RASGRP3	3.961	8.51e-05	0.049357	121	0.01246	yes	ARTTBL
chr2_33470756_C_T_b38	RASGRP3	3.946	9.07e-05	0.049795	95	0.01262	yes	ARTTBL
chr2_33523771_A_G_b38	RASGRP3	-3.943	9.17e-05	-0.050593	82	0.012831	yes	ARTTBL
chr2_33469036_C_CA_b38	RASGRP3	3.94	9.26e-05	0.049173	119	0.012479	yes	ARTTBL
chr2_33525388_G_A_b38	RASGRP3	-3.907	0.000106	-0.050225	79	0.012857	yes	ARTTBL
chr2_33521266_C_T_b38	RASGRP3	3.848	0.000134	0.05932	35	0.015416	yes	ARTTBL
chr2_33469845_C_T_b38	RASGRP3	3.847	0.000135	0.048221	118	0.012536	yes	ARTTBL
chr2_33616325_C_T_b38	RASGRP3	3.799	0.000163	0.075094	10	0.019766	yes	ARTTBL
chr2_33520141_T_C_b38	RASGRP3	-3.781	0.000174	-0.048273	110	0.012766	yes	ARTTBL
chr2_33548381_A_AAAAAG_b38	RASGRP3	3.751	0.000196	0.084635	8	0.022564	yes	ARTTBL
chr2_33526414_G_A_b38	RASGRP3	-3.742	0.000203	-0.047294	83	0.012637	yes	ARTTBL
chr2_33521775_G_C_b38	RASGRP3	-3.717	0.000224	-0.048023	82	0.012919	yes	ARTTBL
chr2_33511010_G_A_b38	RASGRP3	3.712	0.000228	0.078073	11	0.02103	yes	ARTTBL
chr2_33470505_G_A_b38	RASGRP3	3.685	0.000253	0.046296	97	0.012563	yes	ARTTBL
chr2_33627793_A_G_b38	RASGRP3	3.681	0.000257	0.070566	11	0.01917	yes	ARTTBL
chr2_33539996_AAAAAG_A_b38	RASGRP3	-3.658	0.00028	-0.046783	128	0.012789	yes	ARTTBL
chr2_33606703_C_T_b38	RASGRP3	3.63	0.000312	0.073123	10	0.020145	yes	ARTTBL
chr2_33659035_G_A_b38	RASGRP3	3.608	0.000339	0.071794	10	0.019897	yes	ARTTBL
chr2_33477835_C_T_b38	RASGRP3	3.562	0.000402	0.054177	23	0.01521	yes	ARTTBL
chr2_33640513_G_C_b38	RASGRP3	3.529	0.000454	0.069306	10	0.019638	yes	ARTTBL
chr2_33656848_TA_T_b38	RASGRP3	3.494	0.000518	0.051141	40	0.014639	yes	ARTTBL
chr2_33554839_T_C_b38	RASGRP3	3.484	0.000537	0.045754	75	0.013133	yes	ARTTBL
chr2_33634816_G_T_b38	RASGRP3	3.398	0.000731	0.066542	11	0.019581	yes	ARTTBL
chr2_33547458_G_A_b38	RASGRP3	3.382	0.000774	0.044485	77	0.013152	yes	ARTTBL
chr2_33547342_C_CTTTTTT_b38	RASGRP3	3.348	0.000873	0.16995	4	0.050759	yes	ARTTBL
chr2_33622160_C_T_b38	RASGRP3	3.34	9e-04	0.048243	42	0.014445	yes	ARTTBL
chr2_33631243_G_GT_b38	RASGRP3	3.34	9e-04	0.066793	10	0.02	yes	ARTTBL
chr2_33634524_A_G_b38	RASGRP3	3.299	0.00104	0.065322	11	0.019802	yes	ARTTBL
chr2_33470734_A_G_b38	RASGRP3	3.254	0.00121	0.04105	105	0.012616	yes	ARTTBL
chr2_33540861_TA_T_b38	RASGRP3	-3.21	0.00141	-0.039709	91	0.012371	yes	ARTTBL
chr2_33471307_G_GTAGGACTA_b38	RASGRP3	3.207	0.00142	0.040405	105	0.012599	yes	ARTTBL
chr2_33556928_C_CACACACATACAT_b38	RASGRP3	3.18	0.00156	0.065131	4	0.020481	yes	ARTTBL
chr2_33657078_T_C_b38	RASGRP3	3.175	0.00159	0.046351	46	0.014597	yes	ARTTBL
chr2_33478490_C_T_b38	RASGRP3	3.164	0.00165	0.040884	78	0.012922	yes	ARTTBL
chr2_33636858_C_G_b38	RASGRP3	3.149	0.00173	0.061993	11	0.019686	yes	ARTTBL
chr2_33637736_A_T_b38	RASGRP3	3.149	0.00173	0.061993	11	0.019686	yes	ARTTBL
chr2_33469706_C_T_b38	RASGRP3	3.138	0.0018	0.039968	97	0.012737	yes	ARTTBL
chr2_33667549_A_G_b38	RASGRP3	3.064	0.0023	0.060767	11	0.019836	yes	ARTTBL
chr2_33667555_A_G_b38	RASGRP3	3.064	0.0023	0.060767	11	0.019836	yes	ARTTBL
chr2_33596450_T_G_b38	RASGRP3	3.04	0.00248	0.043192	49	0.014207	yes	ARTTBL
chr2_33849589_T_C_b38	RASGRP3	-3.032	0.00255	-0.046087	28	0.015201	yes	ARTTBL
chr2_33476930_C_CG_b38	RASGRP3	3.032	0.00255	0.038745	130	0.01278	yes	ARTTBL
chr2_33477035_T_G_b38	RASGRP3	3.032	0.00255	0.038745	130	0.01278	yes	ARTTBL
chr2_33477050_G_GA_b38	RASGRP3	3.032	0.00255	0.038745	130	0.01278	yes	ARTTBL
chr2_33631185_T_G_b38	RASGRP3	-2.902	0.00387	-0.03483	145	0.012002	yes	ARTTBL
chr2_33589264_G_C_b38	RASGRP3	2.89	0.00402	0.040891	50	0.014151	yes	ARTTBL
chr2_33853897_T_TC_b38	RASGRP3	-2.869	0.00429	-0.043085	31	0.015018	yes	ARTTBL
chr2_33464471_C_CT_b38	RASGRP3	2.862	0.00438	0.03884	59	0.013572	yes	ARTTBL
chr2_33590881_T_C_b38	RASGRP3	2.805	0.00523	0.039556	50	0.014104	yes	ARTTBL
chr2_33470380_ATT_A_b38	RASGRP3	2.788	0.00549	0.041509	88	0.014886	yes	ARTTBL
chr2_33534694_A_AT_b38	RASGRP3	2.786	0.00554	0.041788	33	0.015001	yes	ARTTBL
chr2_33476728_C_CCT_b38	RASGRP3	2.761	0.00598	0.035981	124	0.013034	yes	ARTTBL
chr2_33631863_T_C_b38	RASGRP3	-2.743	0.0063	-0.032849	146	0.011974	yes	ARTTBL
chr2_33400180_G_GCC_b38	RASGRP3	2.742	0.00631	0.079043	6	0.028824	yes	ARTTBL
chr2_33762803_A_G_b38	RASGRP3	2.735	0.00645	0.064127	3	0.023444	yes	ARTTBL
chr2_33509399_C_CA_b38	RASGRP3	2.713	0.00689	0.052437	4	0.019327	yes	ARTTBL
chr2_33569135_T_C_b38	RASGRP3	-2.708	0.00699	-0.061331	5	0.022645	yes	ARTTBL
chr2_33756137_T_C_b38	RASGRP3	2.706	0.00704	0.063462	3	0.023453	yes	ARTTBL
chr2_33622592_T_C_b38	RASGRP3	2.66	0.00806	0.038075	51	0.014314	yes	ARTTBL
chr2_33474954_T_C_b38	RASGRP3	2.632	0.00874	0.0329	136	0.012499	yes	ARTTBL
chr2_33543901_C_G_b38	RASGRP3	-4.891	1.34e-06	-0.063366	78	0.012954	no	ARTTBL
chr2_33514489_T_C_b38	RASGRP3	-4.37	1.51e-05	-0.05195	102	0.011889	no	ARTTBL
chr2_33536322_G_GA_b38	RASGRP3	4.364	1.55e-05	0.084481	17	0.01936	no	ARTTBL
chr2_33639021_G_A_b38	RASGRP3	4.309	1.97e-05	0.068051	22	0.015793	no	ARTTBL
chr2_33641397_G_C_b38	RASGRP3	4.27	2.33e-05	0.067475	22	0.015802	no	ARTTBL
chr2_33640631_A_C_b38	RASGRP3	4.157	3.78e-05	0.065614	22	0.015785	no	ARTTBL
chr2_33670716_C_T_b38	RASGRP3	4.14	4.06e-05	0.062262	29	0.015039	no	ARTTBL
chr2_33625315_G_A_b38	RASGRP3	4.068	5.49e-05	0.060624	33	0.014904	no	ARTTBL
chr2_33662459_C_T_b38	RASGRP3	4.006	7.1e-05	0.061528	25	0.015361	no	ARTTBL
chr2_33548717_A_T_b38	RASGRP3	-3.98	7.89e-05	-0.051001	93	0.012815	no	ARTTBL
chr2_33663555_T_C_b38	RASGRP3	3.939	9.3e-05	0.060478	25	0.015352	no	ARTTBL
chr2_33605827_ATTTTTCT_A_b38	RASGRP3	3.933	9.56e-05	0.076505	9	0.019454	no	ARTTBL
chr2_33546315_C_T_b38	RASGRP3	-3.804	0.00016	-0.050495	66	0.013275	no	ARTTBL
chr2_33604404_G_GTA_b38	RASGRP3	3.774	0.000179	0.074791	6	0.019815	no	ARTTBL
chr2_33606727_T_C_b38	RASGRP3	3.693	0.000245	0.079407	5	0.021502	no	ARTTBL
chr2_32667414_C_CT_b38	RASGRP3	-3.619	0.000325	-0.112416	4	0.031063	no	ARTTBL
chr2_33624881_G_GT_b38	RASGRP3	3.576	0.000382	0.052105	39	0.014571	no	ARTTBL
chr2_33613720_G_A_b38	RASGRP3	3.498	0.000509	0.063592	14	0.018178	no	ARTTBL
chr2_33549339_CAT_C_b38	RASGRP3	-3.493	0.000519	-0.046487	66	0.013308	no	ARTTBL
chr2_33469462_AT_A_b38	RASGRP3	3.473	0.000559	0.076733	3	0.022095	no	ARTTBL
chr2_33559433_G_A_b38	RASGRP3	-3.388	0.000758	-0.045374	60	0.013392	no	ARTTBL
chr2_33568917_T_C_b38	RASGRP3	-3.379	0.000782	-0.06494	8	0.019217	no	ARTTBL
chr2_33461597_C_T_b38	RASGRP3	3.371	0.000807	0.053573	20	0.015894	no	ARTTBL
chr2_33461653_G_C_b38	RASGRP3	3.371	0.000807	0.053573	20	0.015894	no	ARTTBL
chr2_33513546_C_T_b38	RASGRP3	-3.37	0.000809	-0.04465	65	0.01325	no	ARTTBL
chr2_33661156_C_T_b38	RASGRP3	3.344	0.000885	0.049155	32	0.014698	no	ARTTBL
chr2_33661310_C_T_b38	RASGRP3	3.344	0.000885	0.049155	32	0.014698	no	ARTTBL
chr2_33559094_G_A_b38	RASGRP3	-3.327	0.00094	-0.044648	60	0.013419	no	ARTTBL
chr2_33470357_T_C_b38	RASGRP3	3.318	0.000973	0.041731	106	0.012579	no	ARTTBL
chr2_33475238_C_T_b38	RASGRP3	3.311	0.000997	0.059221	11	0.017889	no	ARTTBL
chr2_33462222_A_G_b38	RASGRP3	3.255	0.00121	0.055424	15	0.01703	no	ARTTBL
chr2_33460827_T_C_b38	RASGRP3	3.254	0.00121	0.053208	18	0.016349	no	ARTTBL
chr2_33461382_C_G_b38	RASGRP3	3.25	0.00123	0.05208	19	0.016025	no	ARTTBL
chr2_33656916_G_A_b38	RASGRP3	3.238	0.00128	0.046213	51	0.014271	no	ARTTBL
chr2_33424687_C_CT_b38	RASGRP3	-3.223	0.00135	-0.117979	3	0.036611	no	ARTTBL
chr2_33548672_A_T_b38	RASGRP3	-3.22	0.00136	-0.043118	66	0.013391	no	ARTTBL
chr2_33515662_T_C_b38	RASGRP3	3.212	0.0014	0.054017	20	0.016817	no	ARTTBL
chr2_33514725_A_T_b38	RASGRP3	-3.176	0.00158	-0.040099	93	0.012627	no	ARTTBL
chr2_33460992_G_A_b38	RASGRP3	3.151	0.00172	0.050515	19	0.016034	no	ARTTBL
chr2_33461427_G_A_b38	RASGRP3	3.124	0.00189	0.049596	20	0.015877	no	ARTTBL
chr2_33604404_GTATATA_G_b38	RASGRP3	-3.114	0.00195	-0.061243	6	0.019669	no	ARTTBL
chr2_33461856_C_T_b38	RASGRP3	3.111	0.00197	0.049752	20	0.015993	no	ARTTBL
chr2_33461719_G_A_b38	RASGRP3	3.102	0.00203	0.049534	20	0.01597	no	ARTTBL
chr2_33466952_C_T_b38	RASGRP3	3.092	0.00209	0.053528	13	0.01731	no	ARTTBL
chr2_33514230_T_G_b38	RASGRP3	3.082	0.00216	0.049142	24	0.015943	no	ARTTBL
chr2_33566193_A_G_b38	RASGRP3	-3.045	0.00244	-0.058458	8	0.019197	no	ARTTBL
chr2_33466742_G_A_b38	RASGRP3	3.03	0.00257	0.038776	113	0.012797	no	ARTTBL
chr2_33477612_G_T_b38	RASGRP3	3.022	0.00264	0.037737	133	0.012488	no	ARTTBL
chr2_33462930_G_A_b38	RASGRP3	3.002	0.00281	0.048319	19	0.016096	no	ARTTBL
chr2_33445936_C_T_b38	RASGRP3	2.997	0.00286	0.039648	71	0.01323	no	ARTTBL
chr2_33784409_G_A_b38	RASGRP3	2.973	0.00309	0.038226	91	0.01286	no	ARTTBL
chr2_33634843_C_CTT_b38	RASGRP3	2.937	0.00346	0.06327	10	0.021543	no	ARTTBL
chr2_33456354_ATTCT_A_b38	RASGRP3	2.892	0.00399	0.037703	82	0.013036	no	ARTTBL
chr2_33463160_G_A_b38	RASGRP3	2.889	0.00403	0.046437	19	0.016074	no	ARTTBL
chr2_33454070_C_G_b38	RASGRP3	2.885	0.00408	0.037052	93	0.012845	no	ARTTBL
chr2_33626436_A_T_b38	RASGRP3	2.869	0.00429	0.041464	42	0.014452	no	ARTTBL
chr2_33605951_T_C_b38	RASGRP3	-2.864	0.00436	-0.036185	129	0.012635	no	ARTTBL
chr2_33410494_G_A_b38	RASGRP3	2.853	0.0045	0.043205	33	0.015143	no	ARTTBL
chr2_33764518_G_GTT_b38	RASGRP3	2.844	0.00463	0.070708	3	0.024859	no	ARTTBL
chr2_33780336_C_T_b38	RASGRP3	2.835	0.00477	0.036664	90	0.012933	no	ARTTBL
chr2_33530497_CT_C_b38	RASGRP3	2.83	0.00483	0.044602	19	0.015758	no	ARTTBL
chr2_33787260_C_A_b38	RASGRP3	2.829	0.00486	0.036182	93	0.012791	no	ARTTBL
chr2_33783043_C_T_b38	RASGRP3	2.829	0.00486	0.036158	93	0.012782	no	ARTTBL
chr2_33816796_C_CT_b38	RASGRP3	2.803	0.00525	0.122728	4	0.043778	no	ARTTBL
chr2_33429960_C_T_b38	RASGRP3	-2.794	0.0054	-0.058843	5	0.021059	no	ARTTBL
chr2_33478863_G_A_b38	RASGRP3	2.736	0.00643	0.035191	134	0.012862	no	ARTTBL
chr2_33462974_A_T_b38	RASGRP3	2.723	0.00669	0.044803	18	0.016454	no	ARTTBL
chr2_33432014_G_A_b38	RASGRP3	2.708	0.007	0.048335	13	0.01785	no	ARTTBL
chr2_33474404_G_A_b38	RASGRP3	2.682	0.00756	0.033346	96	0.012435	no	ARTTBL
chr2_33082440_T_A_b38	RASGRP3	2.676	0.00768	0.041224	70	0.015404	no	ARTTBL
chr2_33471417_G_A_b38	RASGRP3	2.676	0.0077	0.043783	18	0.016364	no	ARTTBL
chr2_33567046_T_G_b38	RASGRP3	-2.658	0.00811	-0.060712	5	0.022842	no	ARTTBL
chr2_33782651_G_T_b38	RASGRP3	2.645	0.00842	0.033963	95	0.01284	no	ARTTBL
chr2_33458726_C_G_b38	RASGRP3	2.644	0.00843	0.043743	16	0.016542	no	ARTTBL
chr2_33537330_C_CCCAACACA_b38	RASGRP3	4.945	2.97e-06	0.206056	9	0.041671	yes	BRNAMY
chr2_34432092_T_G_b38	RASGRP3	4.222	5.23e-05	0.166691	10	0.039481	yes	BRNAMY
chr2_34428256_C_G_b38	RASGRP3	4.209	5.49e-05	0.165812	10	0.039393	yes	BRNAMY
chr2_34434254_GC_G_b38	RASGRP3	4.18	6.13e-05	0.166032	10	0.039722	yes	BRNAMY
chr2_33537323_G_A_b38	RASGRP3	3.535	0.000612	0.116076	35	0.032834	yes	BRNAMY
chr2_34251147_C_A_b38	RASGRP3	-3.388	0.000998	-0.12064	29	0.035605	yes	BRNAMY
chr2_32795132_GA_G_b38	RASGRP3	-3.145	0.00217	-0.124043	13	0.039436	yes	BRNAMY
chr2_34035552_A_C_b38	RASGRP3	-3.06	0.00282	-0.114739	31	0.037495	yes	BRNAMY
chr2_32888943_A_C_b38	RASGRP3	3.053	0.00289	0.188211	3	0.061652	yes	BRNAMY
chr2_32889140_C_CATA_b38	RASGRP3	2.869	0.005	0.115269	16	0.040176	yes	BRNAMY
chr2_33249323_T_TCACACA_b38	RASGRP3	-2.849	0.0053	-0.133362	5	0.046814	yes	BRNAMY
chr2_32887028_A_G_b38	RASGRP3	2.818	0.0058	0.114225	16	0.040537	yes	BRNAMY
chr2_32894731_A_G_b38	RASGRP3	2.818	0.0058	0.114225	16	0.040537	yes	BRNAMY
chr2_32896786_TG_T_b38	RASGRP3	2.818	0.0058	0.114225	16	0.040537	yes	BRNAMY
chr2_33532487_C_A_b38	RASGRP3	2.752	0.00701	0.093552	32	0.033998	yes	BRNAMY
chr2_33532718_G_A_b38	RASGRP3	2.744	0.00715	0.095711	20	0.034875	yes	BRNAMY
chr2_34257115_A_ATT_b38	RASGRP3	-2.737	0.0073	-0.121702	24	0.04446	yes	BRNAMY
chr2_34043067_CTTTTTCTTTT_C_b38	RASGRP3	-2.73	0.00745	-0.111661	13	0.040899	yes	BRNAMY
chr2_34050817_A_T_b38	RASGRP3	-2.728	0.0075	-0.100606	26	0.036881	yes	BRNAMY
chr2_32993969_A_AGTGTGTGTGT_b38	RASGRP3	-2.687	0.00841	-0.133896	4	0.049836	yes	BRNAMY
chr2_33338409_G_A_b38	RASGRP3	-2.677	0.00864	-0.102188	20	0.038171	yes	BRNAMY
chr2_33338542_G_A_b38	RASGRP3	-2.677	0.00864	-0.102188	20	0.038171	yes	BRNAMY
chr2_34339375_T_C_b38	RASGRP3	-2.641	0.00956	-0.12382	5	0.046888	yes	BRNAMY
chr2_32890658_C_CTTT_b38	RASGRP3	4.924	3.24e-06	0.307794	4	0.062506	no	BRNAMY
chr2_33537192_G_GAT_b38	RASGRP3	4.292	4.01e-05	0.226961	3	0.052881	no	BRNAMY
chr2_33548469_T_C_b38	RASGRP3	4.059	9.61e-05	0.227876	3	0.056139	no	BRNAMY
chr2_33546942_C_G_b38	RASGRP3	3.939	0.000149	0.216272	4	0.054903	no	BRNAMY
chr2_33551676_A_G_b38	RASGRP3	3.78	0.000263	0.216596	3	0.057303	no	BRNAMY
chr2_33551697_A_T_b38	RASGRP3	3.78	0.000263	0.216596	3	0.057303	no	BRNAMY
chr2_33553995_C_T_b38	RASGRP3	3.78	0.000263	0.216596	3	0.057303	no	BRNAMY
chr2_33554542_A_G_b38	RASGRP3	3.78	0.000263	0.216596	3	0.057303	no	BRNAMY
chr2_33550216_T_A_b38	RASGRP3	3.665	0.000392	0.213244	3	0.058177	no	BRNAMY
chr2_33550484_C_G_b38	RASGRP3	3.665	0.000392	0.213244	3	0.058177	no	BRNAMY
chr2_33552022_CAAACA_C_b38	RASGRP3	3.607	0.00048	0.210471	3	0.058356	no	BRNAMY
chr2_33387736_G_GTT_b38	RASGRP3	3.472	0.000755	0.162515	3	0.046801	no	BRNAMY
chr2_33559304_G_A_b38	RASGRP3	3.427	0.000878	0.192909	3	0.056292	no	BRNAMY
chr2_33557635_G_A_b38	RASGRP3	3.319	0.00125	0.184136	3	0.055486	no	BRNAMY
chr2_33559734_G_A_b38	RASGRP3	3.319	0.00125	0.184136	3	0.055486	no	BRNAMY
chr2_34429810_C_G_b38	RASGRP3	3.298	0.00134	0.123409	16	0.037418	no	BRNAMY
chr2_34323162_A_T_b38	RASGRP3	3.273	0.00145	0.135978	9	0.041539	no	BRNAMY
chr2_34338780_C_T_b38	RASGRP3	-3.235	0.00164	-0.133973	9	0.041419	no	BRNAMY
chr2_34351814_T_C_b38	RASGRP3	-3.235	0.00164	-0.133973	9	0.041419	no	BRNAMY
chr2_34416243_G_T_b38	RASGRP3	-3.226	0.00168	-0.136861	18	0.042425	no	BRNAMY
chr2_33557844_G_A_b38	RASGRP3	3.202	0.00182	0.179322	3	0.056002	no	BRNAMY
chr2_34017147_A_C_b38	RASGRP3	-3.107	0.00244	-0.134888	9	0.043415	no	BRNAMY
chr2_34354744_A_G_b38	RASGRP3	-3.098	0.00251	-0.129732	9	0.041871	no	BRNAMY
chr2_34355544_G_A_b38	RASGRP3	-3.098	0.00251	-0.129732	9	0.041871	no	BRNAMY
chr2_34356414_C_CT_b38	RASGRP3	-3.098	0.00251	-0.129732	9	0.041871	no	BRNAMY
chr2_34357124_C_T_b38	RASGRP3	-3.098	0.00251	-0.129732	9	0.041871	no	BRNAMY
chr2_34360556_T_C_b38	RASGRP3	-3.098	0.00251	-0.129732	9	0.041871	no	BRNAMY
chr2_34363503_G_A_b38	RASGRP3	-3.098	0.00251	-0.129732	9	0.041871	no	BRNAMY
chr2_34366606_C_T_b38	RASGRP3	-3.098	0.00251	-0.129732	9	0.041871	no	BRNAMY
chr2_34369135_T_C_b38	RASGRP3	-3.068	0.00276	-0.126703	9	0.041301	no	BRNAMY
chr2_33332907_A_G_b38	RASGRP3	-3.007	0.00332	-0.140559	5	0.046746	no	BRNAMY
chr2_34402550_A_ATG_b38	RASGRP3	-2.889	0.00472	-0.111796	14	0.038702	no	BRNAMY
chr2_34369405_G_C_b38	RASGRP3	-2.888	0.00472	-0.119729	9	0.041452	no	BRNAMY
chr2_34362142_C_T_b38	RASGRP3	-2.875	0.00492	-0.109856	14	0.038216	no	BRNAMY
chr2_33540561_TGTGTGTGTGTG_T_b38	RASGRP3	2.849	0.00529	0.154385	5	0.054181	no	BRNAMY
chr2_34041985_G_C_b38	RASGRP3	-2.839	0.00546	-0.107418	30	0.03784	no	BRNAMY
chr2_33277760_C_CCTTTCTTTCTTTCTTTCTTTCTTT_b38	RASGRP3	-2.822	0.00572	-0.181901	4	0.064451	no	BRNAMY
chr2_33302232_G_A_b38	RASGRP3	-2.786	0.00635	-0.113798	26	0.040843	no	BRNAMY
chr2_32774896_C_G_b38	RASGRP3	2.777	0.00652	0.113633	9	0.040924	no	BRNAMY
chr2_33811839_T_C_b38	RASGRP3	-2.761	0.00682	-0.178297	5	0.064576	no	BRNAMY
chr2_32599021_C_CA_b38	RASGRP3	2.723	0.0076	0.123402	9	0.04532	no	BRNAMY
chr2_34312578_T_C_b38	RASGRP3	2.714	0.0078	0.103015	16	0.037958	no	BRNAMY
chr2_33388287_G_A_b38	RASGRP3	2.708	0.00794	0.129711	3	0.047906	no	BRNAMY
chr2_33277760_CCTTT_C_b38	RASGRP3	2.703	0.00804	0.150843	5	0.055805	no	BRNAMY
chr2_33328135_C_CAATAAATAAATAAATA_b38	RASGRP3	-2.694	0.00823	-0.141492	6	0.052512	no	BRNAMY
chr2_33555164_G_A_b38	RASGRP3	2.686	0.00844	0.124581	6	0.046385	no	BRNAMY
chr2_32790279_T_G_b38	RASGRP3	2.662	0.00901	0.105063	15	0.039463	no	BRNAMY
chr2_33654622_G_A_b38	RASGRP3	-2.658	0.0091	-0.104682	13	0.039376	no	BRNAMY
chr2_33470380_ATT_A_b38	RASGRP3	2.642	0.00953	0.122399	14	0.046333	no	BRNAMY
chr2_33473129_A_G_b38	RASGRP3	-3.302	0.00126	-0.114568	4	0.0347	yes	BRNACC
chr2_33168399_CA_C_b38	RASGRP3	-3.253	0.00148	-0.100262	12	0.030825	yes	BRNACC
chr2_33472754_G_A_b38	RASGRP3	-3.172	0.00192	-0.111701	4	0.035213	yes	BRNACC
chr2_33530497_CT_C_b38	RASGRP3	3.092	0.00247	0.098944	5	0.032002	yes	BRNACC
chr2_33469790_T_G_b38	RASGRP3	-3.065	0.00268	-0.108694	4	0.035462	yes	BRNACC
chr2_33470014_T_C_b38	RASGRP3	-3.065	0.00268	-0.108694	4	0.035462	yes	BRNACC
chr2_33472085_T_C_b38	RASGRP3	-3.065	0.00268	-0.108694	4	0.035462	yes	BRNACC
chr2_34163867_CATT_C_b38	RASGRP3	2.989	0.00339	0.147726	4	0.049419	yes	BRNACC
chr2_33473933_A_G_b38	RASGRP3	-2.976	0.00353	-0.101379	6	0.034067	yes	BRNACC
chr2_33467980_TTTTCTTTCTTTC_T_b38	RASGRP3	2.935	0.00399	0.104857	7	0.035722	yes	BRNACC
chr2_34373211_G_GTCCC_b38	RASGRP3	-2.858	0.00502	-0.113458	4	0.039702	yes	BRNACC
chr2_33474721_C_T_b38	RASGRP3	-2.849	0.00515	-0.099997	5	0.035096	yes	BRNACC
chr2_33470380_ATT_A_b38	RASGRP3	2.832	0.00542	0.09836	15	0.03473	yes	BRNACC
chr2_33424537_AT_A_b38	RASGRP3	2.811	0.00576	0.107596	3	0.038273	yes	BRNACC
chr2_33540561_TGTGTGTGTGTG_T_b38	RASGRP3	2.807	0.00583	0.113329	4	0.040371	yes	BRNACC
chr2_33473382_C_CA_b38	RASGRP3	-2.791	0.00611	-0.094528	5	0.033867	yes	BRNACC
chr2_32968917_A_ATT_b38	RASGRP3	-2.737	0.00713	-0.125498	4	0.045852	yes	BRNACC
chr2_33508487_T_C_b38	RASGRP3	2.718	0.00753	0.129181	4	0.047525	yes	BRNACC
chr2_33537330_C_CCCAACACA_b38	RASGRP3	3.414	0.00087	0.111285	9	0.032592	no	BRNACC
chr2_32599021_C_CA_b38	RASGRP3	3.37	0.00101	0.099846	14	0.029625	no	BRNACC
chr2_33475871_A_C_b38	RASGRP3	-3.283	0.00134	-0.090641	15	0.027608	no	BRNACC
chr2_33478863_G_A_b38	RASGRP3	3.235	0.00157	0.089939	24	0.027805	no	BRNACC
chr2_33563588_C_T_b38	RASGRP3	-3.007	0.00321	-0.077877	23	0.0259	no	BRNACC
chr2_33556190_G_A_b38	RASGRP3	-2.944	0.00388	-0.077215	27	0.026225	no	BRNACC
chr2_33548717_A_T_b38	RASGRP3	-2.85	0.00514	-0.074917	29	0.026285	no	BRNACC
chr2_33549339_CAT_C_b38	RASGRP3	-2.832	0.00543	-0.075528	22	0.026674	no	BRNACC
chr2_32890658_C_CTTT_b38	RASGRP3	2.815	0.00569	0.152938	4	0.054326	no	BRNACC
chr2_33958155_GACACAC_G_b38	RASGRP3	-2.786	0.0062	-0.109655	3	0.039362	no	BRNACC
chr2_33559094_G_A_b38	RASGRP3	-2.775	0.00639	-0.074999	20	0.027023	no	BRNACC
chr2_33559433_G_A_b38	RASGRP3	-2.775	0.00639	-0.074999	20	0.027023	no	BRNACC
chr2_34371523_G_A_b38	RASGRP3	-2.727	0.00735	-0.105151	4	0.038564	no	BRNACC
chr2_33548672_A_T_b38	RASGRP3	-2.695	0.00804	-0.071308	23	0.026458	no	BRNACC
chr2_33568339_TA_T_b38	RASGRP3	-2.668	0.00869	-0.073361	23	0.027501	no	BRNACC
chr2_33567745_C_T_b38	RASGRP3	-2.638	0.00945	-0.071483	23	0.027102	no	BRNACC
chr2_33477419_C_G_b38	RASGRP3	-4.631	7.73e-06	-0.095768	6	0.020681	yes	BRNCDT
chr2_33540561_TGTGTGTGTGTG_T_b38	RASGRP3	4.253	3.66e-05	0.114741	5	0.02698	yes	BRNCDT
chr2_32894731_A_G_b38	RASGRP3	4.044	8.29e-05	0.06705	31	0.016578	yes	BRNCDT
chr2_32896786_TG_T_b38	RASGRP3	4.044	8.29e-05	0.06705	31	0.016578	yes	BRNCDT
chr2_32889140_C_CATA_b38	RASGRP3	3.968	0.000111	0.066153	31	0.016671	yes	BRNCDT
chr2_32875798_T_C_b38	RASGRP3	3.828	0.000188	0.06693	35	0.017484	yes	BRNCDT
chr2_32845705_G_A_b38	RASGRP3	3.749	0.000251	0.066659	37	0.017779	yes	BRNCDT
chr2_32845129_G_A_b38	RASGRP3	3.629	0.000387	0.0647	36	0.017829	yes	BRNCDT
chr2_32849432_A_G_b38	RASGRP3	3.608	0.000418	0.063413	39	0.017577	yes	BRNCDT
chr2_32837214_C_T_b38	RASGRP3	3.536	0.000537	0.061759	34	0.017464	yes	BRNCDT
chr2_33476758_C_CGTGCGTGTGT_b38	RASGRP3	3.518	0.000573	0.085125	3	0.024199	yes	BRNCDT
chr2_32858582_G_T_b38	RASGRP3	3.506	0.000598	0.062327	38	0.017779	yes	BRNCDT
chr2_32858751_C_T_b38	RASGRP3	3.506	0.000598	0.062327	38	0.017779	yes	BRNCDT
chr2_32859971_C_T_b38	RASGRP3	3.506	0.000598	0.062327	38	0.017779	yes	BRNCDT
chr2_32839953_T_G_b38	RASGRP3	3.501	0.000609	0.062264	37	0.017787	yes	BRNCDT
chr2_32841679_T_C_b38	RASGRP3	3.501	0.000609	0.062264	37	0.017787	yes	BRNCDT
chr2_32888303_G_C_b38	RASGRP3	3.496	0.000619	0.064034	13	0.018318	yes	BRNCDT
chr2_33475871_A_C_b38	RASGRP3	-3.491	0.000629	-0.059444	24	0.017027	yes	BRNCDT
chr2_33974667_A_G_b38	RASGRP3	-3.479	0.000656	-0.05962	30	0.017137	yes	BRNCDT
chr2_32874313_A_G_b38	RASGRP3	3.442	0.000744	0.064899	13	0.018853	yes	BRNCDT
chr2_32898634_C_T_b38	RASGRP3	3.437	0.000758	0.062297	17	0.018126	yes	BRNCDT
chr2_32837414_C_T_b38	RASGRP3	3.436	0.000759	0.060219	32	0.017524	yes	BRNCDT
chr2_33479411_A_ACTC_b38	RASGRP3	-3.432	0.000771	-0.062396	18	0.018181	yes	BRNCDT
chr2_32532134_C_CGTGTGTGTGT_b38	RASGRP3	3.409	0.000833	0.079047	3	0.023186	yes	BRNCDT
chr2_32852603_G_A_b38	RASGRP3	3.371	0.000948	0.059247	40	0.017576	yes	BRNCDT
chr2_33480497_T_C_b38	RASGRP3	3.357	0.000993	0.085992	3	0.025612	yes	BRNCDT
chr2_33480322_C_T_b38	RASGRP3	3.356	0.000999	0.084498	3	0.025181	yes	BRNCDT
chr2_32887622_C_T_b38	RASGRP3	3.336	0.00107	0.060948	17	0.018271	yes	BRNCDT
chr2_33449783_A_C_b38	RASGRP3	-3.302	0.00119	-0.06175	12	0.0187	yes	BRNCDT
chr2_32578807_C_A_b38	RASGRP3	-3.245	0.00144	-0.052018	42	0.016028	yes	BRNCDT
chr2_32860825_AC_A_b38	RASGRP3	3.209	0.00162	0.056126	22	0.017491	yes	BRNCDT
chr2_33476565_C_T_b38	RASGRP3	-3.184	0.00176	-0.084006	3	0.026383	yes	BRNCDT
chr2_33478150_C_G_b38	RASGRP3	-3.184	0.00176	-0.084006	3	0.026383	yes	BRNCDT
chr2_32604895_CT_C_b38	RASGRP3	-3.179	0.00179	-0.068113	11	0.021426	yes	BRNCDT
chr2_33478322_G_A_b38	RASGRP3	3.176	0.00181	0.071867	6	0.02263	yes	BRNCDT
chr2_33479718_C_A_b38	RASGRP3	3.132	0.00208	0.062862	13	0.020072	yes	BRNCDT
chr2_33998628_G_A_b38	RASGRP3	-3.123	0.00214	-0.054461	22	0.017437	yes	BRNCDT
chr2_32790279_T_G_b38	RASGRP3	3.074	0.0025	0.054439	25	0.017707	yes	BRNCDT
chr2_32623793_CT_C_b38	RASGRP3	-3.041	0.00277	-0.058117	21	0.019108	yes	BRNCDT
chr2_32791407_G_C_b38	RASGRP3	3.037	0.00281	0.053145	25	0.017497	yes	BRNCDT
chr2_32701840_A_T_b38	RASGRP3	-3.033	0.00284	-0.055101	25	0.018166	yes	BRNCDT
chr2_34009275_T_G_b38	RASGRP3	-3.022	0.00294	-0.052096	51	0.017238	yes	BRNCDT
chr2_34009297_G_A_b38	RASGRP3	-3.022	0.00294	-0.052096	51	0.017238	yes	BRNCDT
chr2_33985858_CA_C_b38	RASGRP3	2.94	0.00379	0.076662	3	0.026076	yes	BRNCDT
chr2_34009375_C_T_b38	RASGRP3	-2.935	0.00385	-0.054209	17	0.018469	yes	BRNCDT
chr2_34010667_A_C_b38	RASGRP3	-2.935	0.00385	-0.054209	17	0.018469	yes	BRNCDT
chr2_32693653_G_A_b38	RASGRP3	-2.934	0.00386	-0.054716	24	0.01865	yes	BRNCDT
chr2_32786235_T_C_b38	RASGRP3	2.933	0.00387	0.054171	27	0.018469	yes	BRNCDT
chr2_32545090_A_T_b38	RASGRP3	-2.877	0.00459	-0.052407	18	0.018217	yes	BRNCDT
chr2_33996758_C_CA_b38	RASGRP3	-2.876	0.00461	-0.048722	49	0.016943	yes	BRNCDT
chr2_32492140_G_T_b38	RASGRP3	-2.849	0.005	-0.050836	19	0.017846	yes	BRNCDT
chr2_32895343_A_T_b38	RASGRP3	2.844	0.00506	0.050168	32	0.01764	yes	BRNCDT
chr2_32686499_ACAGG_A_b38	RASGRP3	-2.789	0.00595	-0.053038	23	0.019014	yes	BRNCDT
chr2_33798072_A_G_b38	RASGRP3	-2.77	0.00629	-0.055665	12	0.020093	yes	BRNCDT
chr2_33798147_A_T_b38	RASGRP3	-2.77	0.00629	-0.055665	12	0.020093	yes	BRNCDT
chr2_32683317_G_T_b38	RASGRP3	-2.768	0.00634	-0.052048	23	0.018803	yes	BRNCDT
chr2_34011645_A_G_b38	RASGRP3	-2.758	0.00653	-0.047982	25	0.017399	yes	BRNCDT
chr2_32750190_T_C_b38	RASGRP3	-2.745	0.00678	-0.051109	27	0.018622	yes	BRNCDT
chr2_33974654_C_T_b38	RASGRP3	-2.743	0.00681	-0.048431	24	0.017653	yes	BRNCDT
chr2_33974782_G_A_b38	RASGRP3	-2.733	0.00702	-0.048681	23	0.017814	yes	BRNCDT
chr2_34161362_CA_C_b38	RASGRP3	-2.725	0.00717	-0.05834	9	0.021406	yes	BRNCDT
chr2_33464237_G_A_b38	RASGRP3	-2.723	0.00722	-0.06521	4	0.023947	yes	BRNCDT
chr2_32796213_A_G_b38	RASGRP3	2.722	0.00725	0.047264	28	0.017366	yes	BRNCDT
chr2_32804252_T_G_b38	RASGRP3	2.715	0.00739	0.047061	27	0.017333	yes	BRNCDT
chr2_33151823_TTGTGTGTGTGTG_T_b38	RASGRP3	2.699	0.00774	0.091868	3	0.034038	yes	BRNCDT
chr2_34154459_G_A_b38	RASGRP3	-2.696	0.0078	-0.051896	16	0.019247	yes	BRNCDT
chr2_34154500_A_T_b38	RASGRP3	-2.696	0.0078	-0.051896	16	0.019247	yes	BRNCDT
chr2_34154680_T_C_b38	RASGRP3	-2.696	0.0078	-0.051896	16	0.019247	yes	BRNCDT
chr2_34154956_C_T_b38	RASGRP3	-2.696	0.0078	-0.051896	16	0.019247	yes	BRNCDT
chr2_34155006_CT_C_b38	RASGRP3	-2.696	0.0078	-0.051896	16	0.019247	yes	BRNCDT
chr2_34155280_G_A_b38	RASGRP3	-2.696	0.0078	-0.051896	16	0.019247	yes	BRNCDT
chr2_34137662_G_A_b38	RASGRP3	-2.684	0.00807	-0.052429	16	0.019533	yes	BRNCDT
chr2_32635960_T_G_b38	RASGRP3	2.681	0.00815	0.050535	13	0.01885	yes	BRNCDT
chr2_32834303_C_T_b38	RASGRP3	2.681	0.00815	0.049595	32	0.018499	yes	BRNCDT
chr2_32636883_T_C_b38	RASGRP3	-2.68	0.00816	-0.047808	19	0.017837	yes	BRNCDT
chr2_34368928_CT_C_b38	RASGRP3	-2.68	0.00816	-0.061853	3	0.023078	yes	BRNCDT
chr2_32832322_G_A_b38	RASGRP3	2.68	0.00817	0.049096	31	0.018321	yes	BRNCDT
chr2_32830246_G_A_b38	RASGRP3	2.632	0.00936	0.048668	31	0.018491	yes	BRNCDT
chr2_34011443_T_TA_b38	RASGRP3	-2.619	0.00971	-0.047192	32	0.01802	yes	BRNCDT
chr2_33945068_C_T_b38	RASGRP3	-2.618	0.00974	-0.049461	22	0.018895	yes	BRNCDT
chr2_32812150_G_A_b38	RASGRP3	2.614	0.00985	0.048754	31	0.018652	yes	BRNCDT
chr2_34003824_A_G_b38	RASGRP3	-2.613	0.00986	-0.045842	49	0.017542	yes	BRNCDT
chr2_33550216_T_A_b38	RASGRP3	4.699	5.79e-06	0.131115	3	0.027904	no	BRNCDT
chr2_33550484_C_G_b38	RASGRP3	4.699	5.79e-06	0.131115	3	0.027904	no	BRNCDT
chr2_33554542_A_G_b38	RASGRP3	4.699	5.79e-06	0.131115	3	0.027904	no	BRNCDT
chr2_33557635_G_A_b38	RASGRP3	4.231	3.99e-05	0.114624	3	0.027091	no	BRNCDT
chr2_33559734_G_A_b38	RASGRP3	4.231	3.99e-05	0.114624	3	0.027091	no	BRNCDT
chr2_32882944_C_A_b38	RASGRP3	4.21	4.35e-05	0.071176	29	0.016908	no	BRNCDT
chr2_32881258_A_C_b38	RASGRP3	4.209	4.35e-05	0.07147	29	0.016979	no	BRNCDT
chr2_33559304_G_A_b38	RASGRP3	4.152	5.46e-05	0.113224	3	0.027272	no	BRNCDT
chr2_32887028_A_G_b38	RASGRP3	4.048	8.18e-05	0.067582	31	0.016696	no	BRNCDT
chr2_32892533_C_T_b38	RASGRP3	3.969	0.00011	0.079103	7	0.019928	no	BRNCDT
chr2_32894316_A_G_b38	RASGRP3	3.954	0.000117	0.071816	13	0.018161	no	BRNCDT
chr2_32891852_G_A_b38	RASGRP3	3.939	0.000124	0.078563	7	0.019947	no	BRNCDT
chr2_33557844_G_A_b38	RASGRP3	3.882	0.000154	0.10501	4	0.027052	no	BRNCDT
chr2_32875518_T_A_b38	RASGRP3	3.882	0.000154	0.072607	14	0.018705	no	BRNCDT
chr2_32878601_A_G_b38	RASGRP3	3.806	0.000204	0.080213	5	0.021077	no	BRNCDT
chr2_32879000_G_A_b38	RASGRP3	3.806	0.000204	0.080213	5	0.021077	no	BRNCDT
chr2_33537896_A_G_b38	RASGRP3	3.75	0.00025	0.10502	3	0.028004	no	BRNCDT
chr2_32847072_A_G_b38	RASGRP3	3.735	0.000264	0.064485	38	0.017265	no	BRNCDT
chr2_32436886_CTT_C_b38	RASGRP3	-3.734	0.000265	-0.067361	23	0.018039	no	BRNCDT
chr2_32898659_T_C_b38	RASGRP3	3.718	0.000281	0.079473	5	0.021376	no	BRNCDT
chr2_32892657_T_G_b38	RASGRP3	3.616	0.000406	0.077972	4	0.021563	no	BRNCDT
chr2_32893131_G_T_b38	RASGRP3	3.616	0.000406	0.077972	4	0.021563	no	BRNCDT
chr2_32891602_A_AAAAATT_b38	RASGRP3	3.582	0.000457	0.077298	4	0.021578	no	BRNCDT
chr2_32891829_A_G_b38	RASGRP3	3.582	0.000457	0.077298	4	0.021578	no	BRNCDT
chr2_32897642_T_G_b38	RASGRP3	3.582	0.000457	0.077298	4	0.021578	no	BRNCDT
chr2_32880007_C_A_b38	RASGRP3	3.562	0.000491	0.065401	13	0.01836	no	BRNCDT
chr2_32880794_C_T_b38	RASGRP3	3.533	0.000543	0.062114	20	0.017579	no	BRNCDT
chr2_32881118_G_A_b38	RASGRP3	3.533	0.000543	0.062114	20	0.017579	no	BRNCDT
chr2_32728037_CT_C_b38	RASGRP3	-3.532	0.000545	-0.090244	3	0.025548	no	BRNCDT
chr2_34363628_G_T_b38	RASGRP3	-3.507	0.000595	-0.073161	6	0.020861	no	BRNCDT
chr2_34364119_G_C_b38	RASGRP3	-3.507	0.000595	-0.073161	6	0.020861	no	BRNCDT
chr2_34364128_A_T_b38	RASGRP3	-3.507	0.000595	-0.073161	6	0.020861	no	BRNCDT
chr2_34364547_C_A_b38	RASGRP3	-3.507	0.000595	-0.073161	6	0.020861	no	BRNCDT
chr2_34364932_C_T_b38	RASGRP3	-3.507	0.000595	-0.073161	6	0.020861	no	BRNCDT
chr2_34365865_G_A_b38	RASGRP3	-3.504	0.000601	-0.070189	11	0.02003	no	BRNCDT
chr2_32480017_T_C_b38	RASGRP3	-3.494	0.000622	-0.059142	31	0.016926	no	BRNCDT
chr2_32856517_G_A_b38	RASGRP3	3.468	0.00068	0.061124	38	0.017623	no	BRNCDT
chr2_32895167_G_A_b38	RASGRP3	3.468	0.000682	0.063562	13	0.01833	no	BRNCDT
chr2_32463533_A_C_b38	RASGRP3	-3.434	0.000764	-0.058588	35	0.017059	no	BRNCDT
chr2_32874213_C_G_b38	RASGRP3	3.418	0.000809	0.064264	14	0.018803	no	BRNCDT
chr2_32891490_G_C_b38	RASGRP3	3.393	0.00088	0.068148	7	0.020084	no	BRNCDT
chr2_32470691_T_C_b38	RASGRP3	-3.385	0.000905	-0.05684	36	0.016792	no	BRNCDT
chr2_33537330_C_CCCAACACA_b38	RASGRP3	3.382	0.000914	0.082824	8	0.02449	no	BRNCDT
chr2_32899489_G_C_b38	RASGRP3	3.37	0.000953	0.062069	12	0.01842	no	BRNCDT
chr2_33390247_T_C_b38	RASGRP3	3.346	0.00103	0.079402	5	0.023731	no	BRNCDT
chr2_32855606_T_C_b38	RASGRP3	3.345	0.00103	0.058707	41	0.01755	no	BRNCDT
chr2_33478490_C_T_b38	RASGRP3	3.302	0.0012	0.057074	24	0.017287	no	BRNCDT
chr2_32539855_T_C_b38	RASGRP3	-3.294	0.00123	-0.055607	34	0.016884	no	BRNCDT
chr2_33933541_CTCCTTCCTTCCT_C_b38	RASGRP3	3.292	0.00124	0.117848	4	0.035801	no	BRNCDT
chr2_34362552_A_T_b38	RASGRP3	-3.286	0.00126	-0.070241	6	0.021377	no	BRNCDT
chr2_33400898_TAAAA_T_b38	RASGRP3	3.272	0.00132	0.148417	3	0.045362	no	BRNCDT
chr2_32880300_G_T_b38	RASGRP3	3.243	0.00145	0.068889	5	0.021245	no	BRNCDT
chr2_32881183_G_A_b38	RASGRP3	3.243	0.00145	0.068889	5	0.021245	no	BRNCDT
chr2_32881692_A_G_b38	RASGRP3	3.243	0.00145	0.068889	5	0.021245	no	BRNCDT
chr2_32882192_T_C_b38	RASGRP3	3.243	0.00145	0.068889	5	0.021245	no	BRNCDT
chr2_32782925_T_G_b38	RASGRP3	3.236	0.00149	0.059446	27	0.01837	no	BRNCDT
chr2_32791294_G_C_b38	RASGRP3	3.231	0.00151	0.055753	32	0.017256	no	BRNCDT
chr2_32791745_T_C_b38	RASGRP3	3.23	0.00151	0.055146	31	0.017071	no	BRNCDT
chr2_32849873_G_GGTGTGT_b38	RASGRP3	3.201	0.00167	0.06535	8	0.020415	no	BRNCDT
chr2_32835395_T_G_b38	RASGRP3	3.195	0.0017	0.055932	30	0.017509	no	BRNCDT
chr2_32835396_C_T_b38	RASGRP3	3.195	0.0017	0.055932	30	0.017509	no	BRNCDT
chr2_32835652_T_C_b38	RASGRP3	3.195	0.0017	0.055932	30	0.017509	no	BRNCDT
chr2_32836008_G_A_b38	RASGRP3	3.195	0.0017	0.055932	30	0.017509	no	BRNCDT
chr2_32761106_A_G_b38	RASGRP3	-3.169	0.00185	-0.057708	27	0.01821	no	BRNCDT
chr2_32774456_T_C_b38	RASGRP3	-3.169	0.00185	-0.057708	27	0.01821	no	BRNCDT
chr2_32735639_A_C_b38	RASGRP3	-3.155	0.00193	-0.057491	28	0.01822	no	BRNCDT
chr2_33458089_T_A_b38	RASGRP3	3.155	0.00193	0.075405	5	0.023903	no	BRNCDT
chr2_33458663_A_T_b38	RASGRP3	3.155	0.00193	0.075405	5	0.023903	no	BRNCDT
chr2_32736165_T_A_b38	RASGRP3	-3.141	0.00202	-0.056466	28	0.017978	no	BRNCDT
chr2_32741646_CA_C_b38	RASGRP3	-3.13	0.00209	-0.057153	28	0.018259	no	BRNCDT
chr2_32741650_A_T_b38	RASGRP3	-3.13	0.00209	-0.057153	28	0.018259	no	BRNCDT
chr2_33485510_G_A_b38	RASGRP3	3.111	0.00223	0.065528	6	0.021067	no	BRNCDT
chr2_32741657_A_G_b38	RASGRP3	-3.097	0.00233	-0.056799	28	0.018339	no	BRNCDT
chr2_32743186_T_C_b38	RASGRP3	-3.082	0.00244	-0.056426	28	0.018311	no	BRNCDT
chr2_32706077_C_CTTT_b38	RASGRP3	-3.077	0.00248	-0.06271	7	0.020381	no	BRNCDT
chr2_32788799_A_C_b38	RASGRP3	3.077	0.00248	0.057234	26	0.018603	no	BRNCDT
chr2_32466332_T_G_b38	RASGRP3	-3.071	0.00253	-0.053628	36	0.017463	no	BRNCDT
chr2_32773539_G_A_b38	RASGRP3	3.068	0.00255	0.053666	30	0.017494	no	BRNCDT
chr2_32740367_T_A_b38	RASGRP3	-3.067	0.00256	-0.055771	28	0.018182	no	BRNCDT
chr2_32633570_A_G_b38	RASGRP3	-3.064	0.00258	-0.051733	36	0.016885	no	BRNCDT
chr2_32844008_G_T_b38	RASGRP3	3.061	0.00261	0.066133	9	0.021607	no	BRNCDT
chr2_32844978_A_T_b38	RASGRP3	3.052	0.00268	0.063512	16	0.020807	no	BRNCDT
chr2_33448754_AC_A_b38	RASGRP3	3.052	0.00268	0.070571	6	0.023121	no	BRNCDT
chr2_33449317_C_T_b38	RASGRP3	3.052	0.00268	0.070571	6	0.023121	no	BRNCDT
chr2_32758459_C_T_b38	RASGRP3	-3.052	0.00268	-0.056078	27	0.018375	no	BRNCDT
chr2_32883653_C_A_b38	RASGRP3	3.051	0.00269	0.066282	4	0.021728	no	BRNCDT
chr2_32732546_C_G_b38	RASGRP3	-3.049	0.0027	-0.055746	36	0.018281	no	BRNCDT
chr2_32717084_A_G_b38	RASGRP3	-3.046	0.00273	-0.055877	24	0.018343	no	BRNCDT
chr2_32711309_C_T_b38	RASGRP3	-3.022	0.00294	-0.056661	25	0.018747	no	BRNCDT
chr2_32734295_C_G_b38	RASGRP3	-3.02	0.00296	-0.054683	28	0.018104	no	BRNCDT
chr2_32885302_C_G_b38	RASGRP3	3.02	0.00296	0.065704	4	0.021754	no	BRNCDT
chr2_32885970_G_C_b38	RASGRP3	3.02	0.00296	0.065704	4	0.021754	no	BRNCDT
chr2_32886723_G_A_b38	RASGRP3	3.02	0.00296	0.065704	4	0.021754	no	BRNCDT
chr2_32886786_G_A_b38	RASGRP3	3.02	0.00296	0.065704	4	0.021754	no	BRNCDT
chr2_32889792_T_C_b38	RASGRP3	3.02	0.00296	0.065704	4	0.021754	no	BRNCDT
chr2_32895706_G_A_b38	RASGRP3	3.02	0.00296	0.065704	4	0.021754	no	BRNCDT
chr2_32896427_T_C_b38	RASGRP3	3.02	0.00296	0.065704	4	0.021754	no	BRNCDT
chr2_32788373_T_A_b38	RASGRP3	3.015	0.00301	0.053959	33	0.017897	no	BRNCDT
chr2_32844739_A_G_b38	RASGRP3	3.01	0.00305	0.064627	8	0.021468	no	BRNCDT
chr2_32725879_G_T_b38	RASGRP3	-3.003	0.00313	-0.055804	25	0.018585	no	BRNCDT
chr2_32550917_C_A_b38	RASGRP3	-2.997	0.00318	-0.052829	28	0.017624	no	BRNCDT
chr2_32494625_G_C_b38	RASGRP3	-2.982	0.00334	-0.052342	26	0.017554	no	BRNCDT
chr2_32788755_A_G_b38	RASGRP3	2.975	0.00341	0.052803	34	0.017749	no	BRNCDT
chr2_32537312_C_G_b38	RASGRP3	-2.962	0.00354	-0.051746	28	0.017469	no	BRNCDT
chr2_32781425_G_A_b38	RASGRP3	2.959	0.00357	0.054844	27	0.018533	no	BRNCDT
chr2_32753597_G_A_b38	RASGRP3	-2.951	0.00367	-0.054654	27	0.01852	no	BRNCDT
chr2_32777672_T_G_b38	RASGRP3	2.95	0.00368	0.051703	35	0.017527	no	BRNCDT
chr2_32785937_A_AGT_b38	RASGRP3	2.946	0.00372	0.052277	34	0.017745	no	BRNCDT
chr2_32776033_T_C_b38	RASGRP3	2.944	0.00374	0.053621	26	0.018213	no	BRNCDT
chr2_32786454_G_A_b38	RASGRP3	2.935	0.00385	0.054033	27	0.018409	no	BRNCDT
chr2_34047845_CT_C_b38	RASGRP3	2.923	0.004	0.110864	3	0.037933	no	BRNCDT
chr2_32745386_T_C_b38	RASGRP3	-2.922	0.00401	-0.053824	28	0.018421	no	BRNCDT
chr2_32756096_G_A_b38	RASGRP3	-2.911	0.00414	-0.053975	27	0.018544	no	BRNCDT
chr2_34081725_ATGTG_A_b38	RASGRP3	-2.91	0.00415	-0.065714	5	0.022579	no	BRNCDT
chr2_32737112_A_G_b38	RASGRP3	-2.908	0.00418	-0.050348	34	0.017316	no	BRNCDT
chr2_32454479_A_AT_b38	RASGRP3	-2.904	0.00423	-0.049683	39	0.017106	no	BRNCDT
chr2_32760381_C_G_b38	RASGRP3	-2.902	0.00425	-0.053951	27	0.01859	no	BRNCDT
chr2_32759665_C_T_b38	RASGRP3	-2.895	0.00435	-0.053559	27	0.018502	no	BRNCDT
chr2_32769412_T_A_b38	RASGRP3	-2.895	0.00435	-0.053559	27	0.018502	no	BRNCDT
chr2_32521538_G_C_b38	RASGRP3	-2.89	0.00441	-0.049545	32	0.017143	no	BRNCDT
chr2_32687593_G_A_b38	RASGRP3	-2.871	0.00468	-0.053377	24	0.018594	no	BRNCDT
chr2_32528424_A_G_b38	RASGRP3	-2.87	0.00468	-0.050076	33	0.017447	no	BRNCDT
chr2_32789832_G_A_b38	RASGRP3	2.867	0.00473	0.053416	26	0.018631	no	BRNCDT
chr2_32533286_A_C_b38	RASGRP3	-2.862	0.00479	-0.048836	32	0.017062	no	BRNCDT
chr2_32612043_A_G_b38	RASGRP3	-2.859	0.00484	-0.049358	32	0.017264	no	BRNCDT
chr2_33469845_C_T_b38	RASGRP3	2.859	0.00485	0.046631	36	0.016312	no	BRNCDT
chr2_34050036_G_C_b38	RASGRP3	2.855	0.0049	0.138633	3	0.048553	no	BRNCDT
chr2_32580219_T_G_b38	RASGRP3	-2.849	0.00499	-0.048378	23	0.01698	no	BRNCDT
chr2_32733957_T_C_b38	RASGRP3	-2.844	0.00506	-0.054706	36	0.019233	no	BRNCDT
chr2_33727928_C_G_b38	RASGRP3	2.827	0.00532	0.090754	3	0.032101	no	BRNCDT
chr2_33728145_G_A_b38	RASGRP3	2.827	0.00532	0.090754	3	0.032101	no	BRNCDT
chr2_32737389_T_A_b38	RASGRP3	-2.825	0.00536	-0.048932	34	0.017323	no	BRNCDT
chr2_34151569_G_A_b38	RASGRP3	-2.823	0.00539	-0.054355	15	0.019253	no	BRNCDT
chr2_32795635_T_C_b38	RASGRP3	2.821	0.00542	0.048331	32	0.01713	no	BRNCDT
chr2_33469436_T_C_b38	RASGRP3	2.82	0.00544	0.046365	33	0.016441	no	BRNCDT
chr2_32756898_T_C_b38	RASGRP3	-2.809	0.00562	-0.050994	27	0.018154	no	BRNCDT
chr2_33726682_A_G_b38	RASGRP3	2.806	0.00567	0.091818	3	0.032725	no	BRNCDT
chr2_33463361_G_A_b38	RASGRP3	2.799	0.00579	0.06924	5	0.02474	no	BRNCDT
chr2_32553019_TA_T_b38	RASGRP3	-2.794	0.00588	-0.046741	47	0.016732	no	BRNCDT
chr2_32736999_T_C_b38	RASGRP3	-2.792	0.00591	-0.047678	35	0.017077	no	BRNCDT
chr2_32825569_G_A_b38	RASGRP3	2.791	0.00592	0.050958	31	0.018255	no	BRNCDT
chr2_32792961_T_C_b38	RASGRP3	2.787	0.006	0.048486	31	0.0174	no	BRNCDT
chr2_32733120_G_A_b38	RASGRP3	-2.786	0.00601	-0.053815	35	0.019316	no	BRNCDT
chr2_32847357_G_C_b38	RASGRP3	2.785	0.00604	0.060477	8	0.021718	no	BRNCDT
chr2_32820507_A_G_b38	RASGRP3	2.77	0.0063	0.050787	31	0.018334	no	BRNCDT
chr2_32820665_T_C_b38	RASGRP3	2.77	0.0063	0.050787	31	0.018334	no	BRNCDT
chr2_32824481_A_C_b38	RASGRP3	2.77	0.0063	0.050787	31	0.018334	no	BRNCDT
chr2_32918619_C_A_b38	RASGRP3	2.764	0.00642	0.047033	35	0.017019	no	BRNCDT
chr2_32871976_C_G_b38	RASGRP3	2.755	0.00658	0.056109	11	0.020366	no	BRNCDT
chr2_32473706_CGT_C_b38	RASGRP3	-2.751	0.00666	-0.053436	13	0.019425	no	BRNCDT
chr2_33469036_C_CA_b38	RASGRP3	2.748	0.00672	0.045441	34	0.016538	no	BRNCDT
chr2_32749472_G_C_b38	RASGRP3	-2.746	0.00676	-0.050937	27	0.018551	no	BRNCDT
chr2_32889595_C_A_b38	RASGRP3	2.745	0.00678	0.060422	4	0.022012	no	BRNCDT
chr2_32764048_C_T_b38	RASGRP3	2.744	0.0068	0.047896	30	0.017458	no	BRNCDT
chr2_33801277_G_T_b38	RASGRP3	-2.714	0.0074	-0.050354	20	0.01855	no	BRNCDT
chr2_32697558_A_G_b38	RASGRP3	-2.7	0.00771	-0.051612	25	0.019113	no	BRNCDT
chr2_34149978_C_CA_b38	RASGRP3	-2.689	0.00797	-0.064918	3	0.024145	no	BRNCDT
chr2_32566155_A_T_b38	RASGRP3	-2.688	0.00799	-0.04764	28	0.017725	no	BRNCDT
chr2_32743173_T_A_b38	RASGRP3	-2.681	0.00814	-0.046383	36	0.017298	no	BRNCDT
chr2_32743312_G_T_b38	RASGRP3	-2.681	0.00814	-0.046383	36	0.017298	no	BRNCDT
chr2_32727798_A_T_b38	RASGRP3	-2.676	0.00825	-0.050376	25	0.018822	no	BRNCDT
chr2_32695852_C_T_b38	RASGRP3	-2.658	0.0087	-0.050656	25	0.01906	no	BRNCDT
chr2_32820155_T_C_b38	RASGRP3	2.654	0.00881	0.048154	32	0.018147	no	BRNCDT
chr2_32492580_T_C_b38	RASGRP3	-2.652	0.00885	-0.047166	20	0.017787	no	BRNCDT
chr2_33979200_G_A_b38	RASGRP3	-2.648	0.00894	-0.045848	43	0.017312	no	BRNCDT
chr2_33982340_C_T_b38	RASGRP3	-2.648	0.00894	-0.045848	43	0.017312	no	BRNCDT
chr2_33983079_C_G_b38	RASGRP3	-2.648	0.00894	-0.045848	43	0.017312	no	BRNCDT
chr2_32725953_T_TTGAGGCTTGCACCCTCTGAAGCCA_b38	RASGRP3	-2.647	0.00897	-0.050135	23	0.018941	no	BRNCDT
chr2_32803509_A_G_b38	RASGRP3	2.643	0.00908	0.04802	28	0.018171	no	BRNCDT
chr2_33757331_AT_A_b38	RASGRP3	-2.64	0.00916	-0.060103	20	0.022769	no	BRNCDT
chr2_32875981_CA_C_b38	RASGRP3	2.625	0.00953	0.0651	5	0.024796	no	BRNCDT
chr2_32488103_G_A_b38	RASGRP3	-2.614	0.00984	-0.046411	29	0.017754	no	BRNCDT
chr2_32741537_A_C_b38	RASGRP3	-2.611	0.00993	-0.044087	39	0.016886	no	BRNCDT
chr2_32576190_C_G_b38	RASGRP3	-2.61	0.00995	-0.044858	25	0.017186	no	BRNCDT
chr2_33537330_C_CCCAACACA_b38	RASGRP3	5.716	6.76e-08	0.114013	10	0.019946	yes	BRNCHB
chr2_33478490_C_T_b38	RASGRP3	3.304	0.00122	0.05968	23	0.018061	yes	BRNCHB
chr2_33508487_T_C_b38	RASGRP3	3.284	0.00131	0.110214	6	0.03356	yes	BRNCHB
chr2_32907670_G_A_b38	RASGRP3	3.221	0.0016	0.067597	7	0.020983	yes	BRNCHB
chr2_32905755_AG_A_b38	RASGRP3	3.19	0.00177	0.07183	6	0.022515	yes	BRNCHB
chr2_32852727_T_C_b38	RASGRP3	3.129	0.00215	0.075374	4	0.024085	yes	BRNCHB
chr2_32855080_C_T_b38	RASGRP3	3.129	0.00215	0.075374	4	0.024085	yes	BRNCHB
chr2_32855443_A_G_b38	RASGRP3	3.129	0.00215	0.075374	4	0.024085	yes	BRNCHB
chr2_32855592_T_C_b38	RASGRP3	3.129	0.00215	0.075374	4	0.024085	yes	BRNCHB
chr2_33477835_C_T_b38	RASGRP3	3.1	0.00236	0.068043	6	0.021948	yes	BRNCHB
chr2_34365865_G_A_b38	RASGRP3	-3.098	0.00237	-0.061289	13	0.019783	yes	BRNCHB
chr2_33512177_G_A_b38	RASGRP3	3.067	0.00262	0.078072	7	0.025454	yes	BRNCHB
chr2_33511010_G_A_b38	RASGRP3	3.059	0.00268	0.093897	4	0.030694	yes	BRNCHB
chr2_32834104_T_C_b38	RASGRP3	3.041	0.00283	0.056506	24	0.018579	yes	BRNCHB
chr2_32919556_A_G_b38	RASGRP3	3.034	0.0029	0.064446	7	0.021238	yes	BRNCHB
chr2_32920035_T_C_b38	RASGRP3	2.972	0.00351	0.064043	6	0.021553	yes	BRNCHB
chr2_34129874_C_CTTT_b38	RASGRP3	2.918	0.00414	0.135113	3	0.046309	yes	BRNCHB
chr2_33457670_G_T_b38	RASGRP3	2.912	0.00421	0.050415	24	0.017314	yes	BRNCHB
chr2_33449783_A_C_b38	RASGRP3	-2.902	0.00433	-0.061264	12	0.021109	yes	BRNCHB
chr2_32913484_C_T_b38	RASGRP3	2.896	0.00442	0.060056	8	0.020741	yes	BRNCHB
chr2_33414190_AT_A_b38	RASGRP3	-2.836	0.00527	-0.056549	10	0.019937	yes	BRNCHB
chr2_33536322_G_GA_b38	RASGRP3	2.814	0.00564	0.073815	7	0.026234	yes	BRNCHB
chr2_32907599_A_G_b38	RASGRP3	2.75	0.00677	0.053525	11	0.019461	yes	BRNCHB
chr2_32910687_T_C_b38	RASGRP3	2.74	0.00698	0.057283	8	0.020905	yes	BRNCHB
chr2_32911795_G_T_b38	RASGRP3	2.74	0.00698	0.057283	8	0.020905	yes	BRNCHB
chr2_32691743_C_CT_b38	RASGRP3	-2.665	0.00864	-0.051535	19	0.019336	yes	BRNCHB
chr2_33525341_A_AAT_b38	RASGRP3	2.655	0.00889	0.061312	8	0.023092	yes	BRNCHB
chr2_32747559_G_T_b38	RASGRP3	-2.649	0.00904	-0.051593	18	0.019474	yes	BRNCHB
chr2_34223769_G_A_b38	RASGRP3	2.646	0.00912	0.071828	3	0.027146	yes	BRNCHB
chr2_32661068_C_G_b38	RASGRP3	4.446	1.82e-05	0.084296	10	0.018958	no	BRNCHB
chr2_32675263_A_G_b38	RASGRP3	4.255	3.9e-05	0.079579	12	0.018702	no	BRNCHB
chr2_32680370_A_G_b38	RASGRP3	4.169	5.47e-05	0.076911	13	0.01845	no	BRNCHB
chr2_32754827_A_AC_b38	RASGRP3	-4.129	6.38e-05	-0.075551	30	0.0183	no	BRNCHB
chr2_32657999_T_C_b38	RASGRP3	4.124	6.5e-05	0.076263	13	0.018493	no	BRNCHB
chr2_32673147_A_G_b38	RASGRP3	4.119	6.63e-05	0.078505	12	0.01906	no	BRNCHB
chr2_32657720_A_G_b38	RASGRP3	3.999	0.000105	0.074523	13	0.018636	no	BRNCHB
chr2_33470380_ATT_A_b38	RASGRP3	3.812	0.000209	0.079	22	0.020723	no	BRNCHB
chr2_32740716_A_G_b38	RASGRP3	3.763	0.00025	0.083006	4	0.022056	no	BRNCHB
chr2_32705180_C_T_b38	RASGRP3	-3.623	0.000412	-0.06397	31	0.017656	no	BRNCHB
chr2_33478863_G_A_b38	RASGRP3	3.557	0.000519	0.062745	32	0.017638	no	BRNCHB
chr2_32844983_T_TTTTTC_b38	RASGRP3	3.516	0.000599	0.080475	8	0.022889	no	BRNCHB
chr2_32728996_TAC_T_b38	RASGRP3	3.453	0.000742	0.085339	4	0.024715	no	BRNCHB
chr2_32661854_G_A_b38	RASGRP3	-3.437	0.000783	-0.059212	34	0.017226	no	BRNCHB
chr2_33379196_C_CTTTTTTT_b38	RASGRP3	3.308	0.00121	0.095438	4	0.028851	no	BRNCHB
chr2_33529318_C_T_b38	RASGRP3	3.303	0.00123	0.07741	4	0.023435	no	BRNCHB
chr2_32661118_A_T_b38	RASGRP3	3.238	0.00152	0.076225	4	0.023537	no	BRNCHB
chr2_32854515_T_C_b38	RASGRP3	3.207	0.00168	0.073657	6	0.022969	no	BRNCHB
chr2_33475871_A_C_b38	RASGRP3	-3.18	0.00183	-0.054507	19	0.017141	no	BRNCHB
chr2_32844008_G_T_b38	RASGRP3	3.154	0.00199	0.07081	7	0.022453	no	BRNCHB
chr2_32662007_C_G_b38	RASGRP3	3.117	0.00224	0.074089	4	0.02377	no	BRNCHB
chr2_34061179_TA_T_b38	RASGRP3	-3.105	0.00232	-0.067304	6	0.021677	no	BRNCHB
chr2_33469845_C_T_b38	RASGRP3	3.105	0.00232	0.052629	34	0.016951	no	BRNCHB
chr2_32663990_A_AT_b38	RASGRP3	3.089	0.00245	0.073839	4	0.023907	no	BRNCHB
chr2_32859390_C_CA_b38	RASGRP3	3.068	0.00261	0.103009	5	0.033579	no	BRNCHB
chr2_33470006_T_C_b38	RASGRP3	3.062	0.00266	0.051008	32	0.016659	no	BRNCHB
chr2_33470756_C_T_b38	RASGRP3	3.062	0.00266	0.051008	32	0.016659	no	BRNCHB
chr2_32678481_G_A_b38	RASGRP3	3.047	0.00278	0.076997	3	0.02527	no	BRNCHB
chr2_33470505_G_A_b38	RASGRP3	3.037	0.00287	0.049881	33	0.016425	no	BRNCHB
chr2_32666298_T_G_b38	RASGRP3	3.032	0.00292	0.073645	6	0.024289	no	BRNCHB
chr2_32832562_A_C_b38	RASGRP3	3.032	0.00292	0.068453	6	0.02258	no	BRNCHB
chr2_34177389_A_G_b38	RASGRP3	-3.016	0.00307	-0.053028	42	0.017582	no	BRNCHB
chr2_33470233_G_A_b38	RASGRP3	3.013	0.0031	0.050453	31	0.016747	no	BRNCHB
chr2_33470439_G_A_b38	RASGRP3	3.013	0.0031	0.050453	31	0.016747	no	BRNCHB
chr2_33470311_T_A_b38	RASGRP3	3.004	0.00318	0.050256	31	0.016729	no	BRNCHB
chr2_33469436_T_C_b38	RASGRP3	2.996	0.00326	0.050319	31	0.016796	no	BRNCHB
chr2_33828104_A_G_b38	RASGRP3	-2.994	0.00328	-0.05284	38	0.017652	no	BRNCHB
chr2_32661423_T_C_b38	RASGRP3	2.971	0.00352	0.068309	6	0.02299	no	BRNCHB
chr2_33470875_C_T_b38	RASGRP3	2.961	0.00362	0.050013	34	0.016888	no	BRNCHB
chr2_33540561_TGTGTGTGTGTG_T_b38	RASGRP3	2.954	0.00371	0.077247	5	0.02615	no	BRNCHB
chr2_33469036_C_CA_b38	RASGRP3	2.95	0.00375	0.050585	33	0.017145	no	BRNCHB
chr2_33830433_T_C_b38	RASGRP3	-2.934	0.00393	-0.052491	38	0.017889	no	BRNCHB
chr2_33831005_C_T_b38	RASGRP3	-2.934	0.00393	-0.052491	38	0.017889	no	BRNCHB
chr2_33828199_C_A_b38	RASGRP3	-2.918	0.00413	-0.051291	38	0.017578	no	BRNCHB
chr2_32720709_A_G_b38	RASGRP3	2.914	0.00419	0.072984	5	0.02505	no	BRNCHB
chr2_32947069_C_G_b38	RASGRP3	2.903	0.00433	0.065722	5	0.022641	no	BRNCHB
chr2_32948485_C_T_b38	RASGRP3	2.903	0.00433	0.065722	5	0.022641	no	BRNCHB
chr2_33389801_G_A_b38	RASGRP3	-2.859	0.00493	-0.070587	7	0.02469	no	BRNCHB
chr2_32717008_ATT_A_b38	RASGRP3	-2.852	0.00503	-0.060254	13	0.021125	no	BRNCHB
chr2_32838505_T_C_b38	RASGRP3	2.807	0.00574	0.064618	6	0.023017	no	BRNCHB
chr2_33302950_TACACAC_T_b38	RASGRP3	2.793	0.00598	0.124031	3	0.044402	no	BRNCHB
chr2_32947291_C_A_b38	RASGRP3	2.792	0.006	0.063837	5	0.022863	no	BRNCHB
chr2_33565010_T_TAC_b38	RASGRP3	-2.776	0.00629	-0.060708	5	0.021867	no	BRNCHB
chr2_32669896_A_AG_b38	RASGRP3	2.768	0.00644	0.071033	3	0.025665	no	BRNCHB
chr2_33561445_C_A_b38	RASGRP3	2.761	0.00656	0.064324	7	0.023293	no	BRNCHB
chr2_32905757_AG_A_b38	RASGRP3	2.757	0.00664	0.063966	5	0.023198	no	BRNCHB
chr2_32847357_G_C_b38	RASGRP3	2.743	0.00692	0.062314	6	0.022718	no	BRNCHB
chr2_32658130_A_G_b38	RASGRP3	-2.742	0.00693	-0.049501	35	0.018051	no	BRNCHB
chr2_32921441_C_CT_b38	RASGRP3	2.74	0.00699	0.058444	7	0.021333	no	BRNCHB
chr2_32921442_A_C_b38	RASGRP3	2.74	0.00699	0.058444	7	0.021333	no	BRNCHB
chr2_32681591_C_G_b38	RASGRP3	-2.689	0.00807	-0.050078	28	0.018621	no	BRNCHB
chr2_32779222_C_CA_b38	RASGRP3	2.686	0.00815	0.060845	4	0.022655	no	BRNCHB
chr2_32950872_G_A_b38	RASGRP3	2.674	0.00843	0.062186	5	0.023256	no	BRNCHB
chr2_33824143_GA_G_b38	RASGRP3	2.673	0.00845	0.048677	36	0.018211	no	BRNCHB
chr2_33826739_G_GT_b38	RASGRP3	2.673	0.00845	0.048677	36	0.018211	no	BRNCHB
chr2_33826741_G_T_b38	RASGRP3	2.673	0.00845	0.048677	36	0.018211	no	BRNCHB
chr2_33827383_G_A_b38	RASGRP3	2.673	0.00845	0.048677	36	0.018211	no	BRNCHB
chr2_33829504_C_G_b38	RASGRP3	2.667	0.00859	0.048364	36	0.018132	no	BRNCHB
chr2_33830150_C_T_b38	RASGRP3	2.667	0.00859	0.048364	36	0.018132	no	BRNCHB
chr2_33837776_A_G_b38	RASGRP3	2.618	0.00986	0.048303	35	0.018451	no	BRNCHB
chr2_32723971_C_CT_b38	RASGRP3	2.616	0.00991	0.065621	5	0.025081	no	BRNCHB
chr2_33537192_G_GAT_b38	RASGRP3	6.479	9.81e-10	0.138659	3	0.021401	yes	BRNCHA
chr2_33537330_C_CCCAACACA_b38	RASGRP3	6.399	1.49e-09	0.116194	10	0.018157	yes	BRNCHA
chr2_33546942_C_G_b38	RASGRP3	4.946	1.82e-06	0.111727	4	0.022587	yes	BRNCHA
chr2_33125829_CA_C_b38	RASGRP3	-4.258	3.42e-05	-0.079968	25	0.018779	yes	BRNCHA
chr2_33529318_C_T_b38	RASGRP3	4.131	5.68e-05	0.079977	6	0.019359	yes	BRNCHA
chr2_33508487_T_C_b38	RASGRP3	4.066	7.34e-05	0.105153	6	0.025862	yes	BRNCHA
chr2_33985858_CA_C_b38	RASGRP3	3.8	0.000202	0.082871	4	0.021808	yes	BRNCHA
chr2_33561445_C_A_b38	RASGRP3	3.571	0.000463	0.065451	10	0.018326	yes	BRNCHA
chr2_33523649_G_A_b38	RASGRP3	3.541	0.000516	0.071679	7	0.020244	yes	BRNCHA
chr2_33514230_T_G_b38	RASGRP3	3.493	0.000611	0.064604	9	0.018496	yes	BRNCHA
chr2_33530497_CT_C_b38	RASGRP3	3.437	0.000741	0.063049	8	0.018344	yes	BRNCHA
chr2_33555164_G_A_b38	RASGRP3	3.228	0.0015	0.062747	7	0.019437	yes	BRNCHA
chr2_33476930_C_CG_b38	RASGRP3	3.226	0.00151	0.048603	48	0.015064	yes	BRNCHA
chr2_33477035_T_G_b38	RASGRP3	3.226	0.00151	0.048603	48	0.015064	yes	BRNCHA
chr2_33477050_G_GA_b38	RASGRP3	3.226	0.00151	0.048603	48	0.015064	yes	BRNCHA
chr2_32532134_C_CGTGTGTGTGTGT_b38	RASGRP3	3.178	0.00176	0.051142	21	0.016091	yes	BRNCHA
chr2_32948485_C_T_b38	RASGRP3	3.142	0.00198	0.060504	7	0.019258	yes	BRNCHA
chr2_33476343_C_T_b38	RASGRP3	-3.076	0.00245	-0.048264	31	0.015689	yes	BRNCHA
chr2_33515662_T_C_b38	RASGRP3	3.07	0.0025	0.062177	7	0.020255	yes	BRNCHA
chr2_33476728_C_CCT_b38	RASGRP3	3.045	0.00271	0.047162	46	0.01549	yes	BRNCHA
chr2_32947291_C_A_b38	RASGRP3	2.973	0.00338	0.057685	7	0.019404	yes	BRNCHA
chr2_33478863_G_A_b38	RASGRP3	2.918	0.00401	0.046365	43	0.01589	yes	BRNCHA
chr2_32858582_G_T_b38	RASGRP3	2.905	0.00416	0.045813	44	0.015768	yes	BRNCHA
chr2_32858751_C_T_b38	RASGRP3	2.905	0.00416	0.045813	44	0.015768	yes	BRNCHA
chr2_32859971_C_T_b38	RASGRP3	2.905	0.00416	0.045813	44	0.015768	yes	BRNCHA
chr2_33521266_C_T_b38	RASGRP3	2.847	0.00496	0.050395	15	0.017699	yes	BRNCHA
chr2_32881692_A_G_b38	RASGRP3	2.838	0.0051	0.056638	8	0.019959	yes	BRNCHA
chr2_33477612_G_T_b38	RASGRP3	2.836	0.00514	0.043303	49	0.015271	yes	BRNCHA
chr2_32875798_T_C_b38	RASGRP3	2.828	0.00526	0.04473	38	0.015819	yes	BRNCHA
chr2_32939379_C_T_b38	RASGRP3	2.799	0.00572	0.053964	7	0.019277	yes	BRNCHA
chr2_32922791_T_C_b38	RASGRP3	2.793	0.00583	0.05325	8	0.019067	yes	BRNCHA
chr2_32845705_G_A_b38	RASGRP3	2.789	0.00589	0.044031	43	0.015786	yes	BRNCHA
chr2_33470380_ATT_A_b38	RASGRP3	2.789	0.0059	0.051827	26	0.018585	yes	BRNCHA
chr2_32947069_C_G_b38	RASGRP3	2.765	0.00633	0.052683	8	0.019055	yes	BRNCHA
chr2_33727346_T_C_b38	RASGRP3	2.747	0.00668	0.049072	11	0.017866	yes	BRNCHA
chr2_33469845_C_T_b38	RASGRP3	2.742	0.00676	0.04208	39	0.015345	yes	BRNCHA
chr2_33060651_C_CTGTG_b38	RASGRP3	2.741	0.00678	0.047865	29	0.017461	yes	BRNCHA
chr2_33816796_C_CTTTTTTTTT_b38	RASGRP3	-2.741	0.0068	-0.075603	13	0.027587	yes	BRNCHA
chr2_32852603_G_A_b38	RASGRP3	2.738	0.00684	0.042993	46	0.015701	yes	BRNCHA
chr2_32856517_G_A_b38	RASGRP3	2.728	0.00705	0.042799	44	0.015689	yes	BRNCHA
chr2_33072900_A_G_b38	RASGRP3	-2.717	0.00727	-0.042068	18	0.015482	yes	BRNCHA
chr2_32675263_A_G_b38	RASGRP3	2.706	0.00751	0.045825	12	0.016935	yes	BRNCHA
chr2_32930449_G_GCGCA_b38	RASGRP3	2.67	0.00834	0.05732	3	0.021471	yes	BRNCHA
chr2_32871976_C_G_b38	RASGRP3	2.651	0.00878	0.046531	14	0.01755	yes	BRNCHA
chr2_32875981_CA_C_b38	RASGRP3	2.629	0.00937	0.058907	4	0.02241	yes	BRNCHA
chr2_32849432_A_G_b38	RASGRP3	2.622	0.00954	0.041186	45	0.015706	yes	BRNCHA
chr2_33537896_A_G_b38	RASGRP3	6.238	3.48e-09	0.135142	3	0.021666	no	BRNCHA
chr2_33548469_T_C_b38	RASGRP3	5.148	7.29e-07	0.11687	3	0.022702	no	BRNCHA
chr2_33550216_T_A_b38	RASGRP3	4.877	2.48e-06	0.108971	4	0.022344	no	BRNCHA
chr2_33550484_C_G_b38	RASGRP3	4.877	2.48e-06	0.108971	4	0.022344	no	BRNCHA
chr2_33512177_G_A_b38	RASGRP3	4.63	7.28e-06	0.096432	8	0.020827	no	BRNCHA
chr2_33559068_A_G_b38	RASGRP3	4.561	9.76e-06	0.102072	3	0.022378	no	BRNCHA
chr2_33554542_A_G_b38	RASGRP3	4.513	1.2e-05	0.101369	4	0.022462	no	BRNCHA
chr2_33557635_G_A_b38	RASGRP3	4.438	1.64e-05	0.09677	4	0.021804	no	BRNCHA
chr2_33559734_G_A_b38	RASGRP3	4.438	1.64e-05	0.09677	4	0.021804	no	BRNCHA
chr2_33559304_G_A_b38	RASGRP3	4.393	1.98e-05	0.096972	4	0.022075	no	BRNCHA
chr2_33553995_C_T_b38	RASGRP3	4.355	2.31e-05	0.101245	3	0.02325	no	BRNCHA
chr2_33557844_G_A_b38	RASGRP3	4.067	7.32e-05	0.088343	4	0.021724	no	BRNCHA
chr2_33511010_G_A_b38	RASGRP3	3.811	0.000194	0.09582	5	0.025141	no	BRNCHA
chr2_33548381_A_AAAAAG_b38	RASGRP3	3.641	0.000361	0.090523	3	0.02486	no	BRNCHA
chr2_33525341_A_AAT_b38	RASGRP3	3.538	0.000522	0.062982	10	0.017804	no	BRNCHA
chr2_33536322_G_GA_b38	RASGRP3	3.401	0.000839	0.074277	8	0.02184	no	BRNCHA
chr2_33986624_A_G_b38	RASGRP3	3.318	0.00111	0.09524	3	0.028703	no	BRNCHA
chr2_33986646_G_C_b38	RASGRP3	3.318	0.00111	0.09524	3	0.028703	no	BRNCHA
chr2_33129127_A_G_b38	RASGRP3	-3.241	0.00144	-0.047997	44	0.014808	no	BRNCHA
chr2_33469706_C_T_b38	RASGRP3	3.24	0.00144	0.049047	34	0.015138	no	BRNCHA
chr2_33427776_C_CTTTTTTT_b38	RASGRP3	-3.232	0.00148	-0.105836	5	0.032744	no	BRNCHA
chr2_33470357_T_C_b38	RASGRP3	3.146	0.00196	0.047543	35	0.015113	no	BRNCHA
chr2_33470734_A_G_b38	RASGRP3	3.146	0.00196	0.047543	35	0.015113	no	BRNCHA
chr2_33471307_G_GTAGGACTA_b38	RASGRP3	3.146	0.00196	0.047543	35	0.015113	no	BRNCHA
chr2_33123514_A_G_b38	RASGRP3	-3.037	0.00277	-0.046296	44	0.015245	no	BRNCHA
chr2_33474404_G_A_b38	RASGRP3	2.996	0.00315	0.044852	35	0.014969	no	BRNCHA
chr2_33447440_A_AT_b38	RASGRP3	2.985	0.00326	0.05096	16	0.017071	no	BRNCHA
chr2_32855080_C_T_b38	RASGRP3	2.956	0.00356	0.055269	9	0.018696	no	BRNCHA
chr2_32854515_T_C_b38	RASGRP3	2.943	0.00371	0.053809	10	0.018283	no	BRNCHA
chr2_32875518_T_A_b38	RASGRP3	2.895	0.00429	0.052072	16	0.017986	no	BRNCHA
chr2_33448241_A_T_b38	RASGRP3	2.887	0.0044	0.041325	45	0.014313	no	BRNCHA
chr2_32855443_A_G_b38	RASGRP3	2.865	0.00471	0.053376	9	0.018632	no	BRNCHA
chr2_32855592_T_C_b38	RASGRP3	2.865	0.00471	0.053376	9	0.018632	no	BRNCHA
chr2_32990620_G_C_b38	RASGRP3	2.862	0.00474	0.050542	13	0.017657	no	BRNCHA
chr2_33770672_A_G_b38	RASGRP3	-2.854	0.00485	-0.043799	29	0.015344	no	BRNCHA
chr2_32871799_C_CAA_b38	RASGRP3	2.843	0.00502	0.049991	13	0.017582	no	BRNCHA
chr2_32888943_A_C_b38	RASGRP3	2.832	0.00518	0.070204	4	0.024786	no	BRNCHA
chr2_33449417_A_T_b38	RASGRP3	2.808	0.00558	0.04048	40	0.014416	no	BRNCHA
chr2_33453857_A_G_b38	RASGRP3	2.801	0.00569	0.041288	38	0.014738	no	BRNCHA
chr2_33454070_C_G_b38	RASGRP3	2.776	0.00612	0.041204	34	0.014842	no	BRNCHA
chr2_33757835_G_A_b38	RASGRP3	-2.77	0.00623	-0.043394	34	0.015663	no	BRNCHA
chr2_32950872_G_A_b38	RASGRP3	2.754	0.00653	0.05452	7	0.019795	no	BRNCHA
chr2_33958155_GAC_G_b38	RASGRP3	-2.753	0.00656	-0.061908	3	0.022491	no	BRNCHA
chr2_32844983_T_TTTTTC_b38	RASGRP3	2.751	0.00659	0.050094	13	0.018208	no	BRNCHA
chr2_33006088_AT_A_b38	RASGRP3	2.745	0.00671	0.060563	5	0.022063	no	BRNCHA
chr2_33470875_C_T_b38	RASGRP3	2.74	0.00681	0.041783	39	0.015251	no	BRNCHA
chr2_32874313_A_G_b38	RASGRP3	2.731	0.00699	0.048767	15	0.017859	no	BRNCHA
chr2_32976264_G_A_b38	RASGRP3	2.722	0.00717	0.059434	5	0.021833	no	BRNCHA
chr2_32853708_T_G_b38	RASGRP3	2.708	0.00746	0.048668	20	0.017969	no	BRNCHA
chr2_33448870_G_C_b38	RASGRP3	2.707	0.00749	0.039866	35	0.014728	no	BRNCHA
chr2_33771195_C_CA_b38	RASGRP3	-2.685	0.00797	-0.042609	36	0.015867	no	BRNCHA
chr2_32852727_T_C_b38	RASGRP3	2.679	0.00813	0.050077	9	0.018695	no	BRNCHA
chr2_32844008_G_T_b38	RASGRP3	2.678	0.00814	0.048388	11	0.018069	no	BRNCHA
chr2_33966151_A_T_b38	RASGRP3	2.675	0.00821	0.06282	3	0.023484	no	BRNCHA
chr2_32880007_C_A_b38	RASGRP3	2.658	0.00861	0.047364	15	0.017816	no	BRNCHA
chr2_33719192_C_G_b38	RASGRP3	2.651	0.0088	0.053842	7	0.020311	no	BRNCHA
chr2_33722781_G_A_b38	RASGRP3	2.651	0.0088	0.053842	7	0.020311	no	BRNCHA
chr2_32973413_A_G_b38	RASGRP3	2.643	0.009	0.054645	5	0.020677	no	BRNCHA
chr2_33469036_C_CA_b38	RASGRP3	2.615	0.00973	0.040136	38	0.015348	no	BRNCHA
chr2_33550216_T_A_b38	RASGRP3	6.721	2.85e-10	0.174195	3	0.025919	yes	BRNCTXA
chr2_33550484_C_G_b38	RASGRP3	6.721	2.85e-10	0.174195	3	0.025919	yes	BRNCTXA
chr2_33546942_C_G_b38	RASGRP3	6.322	2.35e-09	0.163909	4	0.025926	yes	BRNCTXA
chr2_33554542_A_G_b38	RASGRP3	6.109	7.05e-09	0.162376	3	0.026581	yes	BRNCTXA
chr2_33540561_TGTGTGTGTGTG_T_b38	RASGRP3	6.109	7.05e-09	0.162592	3	0.026617	yes	BRNCTXA
chr2_33537330_C_CCCAACACA_b38	RASGRP3	5.902	2.01e-08	0.145882	6	0.024719	yes	BRNCTXA
chr2_33559304_G_A_b38	RASGRP3	5.763	4e-08	0.151647	3	0.026315	yes	BRNCTXA
chr2_33557635_G_A_b38	RASGRP3	5.748	4.3e-08	0.149366	3	0.025987	yes	BRNCTXA
chr2_33559734_G_A_b38	RASGRP3	5.748	4.3e-08	0.149366	3	0.025987	yes	BRNCTXA
chr2_33557844_G_A_b38	RASGRP3	4.902	2.26e-06	0.13186	3	0.026898	yes	BRNCTXA
chr2_33477419_C_G_b38	RASGRP3	-4.459	1.52e-05	-0.093522	8	0.020975	yes	BRNCTXA
chr2_33529318_C_T_b38	RASGRP3	4.419	1.8e-05	0.106372	4	0.024071	yes	BRNCTXA
chr2_33555164_G_A_b38	RASGRP3	4.182	4.69e-05	0.097111	6	0.023221	yes	BRNCTXA
chr2_33561445_C_A_b38	RASGRP3	4.179	4.75e-05	0.094473	8	0.022607	yes	BRNCTXA
chr2_33523649_G_A_b38	RASGRP3	3.824	0.000186	0.089718	6	0.023464	yes	BRNCTXA
chr2_33512177_G_A_b38	RASGRP3	3.654	0.000347	0.095648	6	0.026176	yes	BRNCTXA
chr2_34243371_G_A_b38	RASGRP3	3.649	0.000353	0.126099	3	0.034556	yes	BRNCTXA
chr2_34244088_G_A_b38	RASGRP3	3.649	0.000353	0.126099	3	0.034556	yes	BRNCTXA
chr2_33521266_C_T_b38	RASGRP3	3.592	0.000433	0.073634	12	0.020498	yes	BRNCTXA
chr2_33596963_A_T_b38	RASGRP3	3.589	0.000438	0.07654	9	0.021326	yes	BRNCTXA
chr2_33594326_C_T_b38	RASGRP3	3.508	0.000582	0.076295	8	0.021748	yes	BRNCTXA
chr2_33594385_G_A_b38	RASGRP3	3.508	0.000582	0.076295	8	0.021748	yes	BRNCTXA
chr2_33525341_A_AAT_b38	RASGRP3	3.49	0.000621	0.073888	8	0.021172	yes	BRNCTXA
chr2_33596617_C_T_b38	RASGRP3	3.453	0.000705	0.075582	8	0.021889	yes	BRNCTXA
chr2_33470380_ATT_A_b38	RASGRP3	3.435	0.00075	0.069446	31	0.020216	yes	BRNCTXA
chr2_33581561_C_T_b38	RASGRP3	3.423	0.000783	0.073904	9	0.021593	yes	BRNCTXA
chr2_33582025_C_T_b38	RASGRP3	3.36	0.000971	0.073363	8	0.021837	yes	BRNCTXA
chr2_33565263_A_G_b38	RASGRP3	3.343	0.00103	0.07323	11	0.021906	yes	BRNCTXA
chr2_34034097_T_A_b38	RASGRP3	3.293	0.00122	0.079965	4	0.024286	yes	BRNCTXA
chr2_33586869_A_T_b38	RASGRP3	3.272	0.0013	0.074623	8	0.022806	yes	BRNCTXA
chr2_33581338_T_A_b38	RASGRP3	3.24	0.00145	0.084387	5	0.026044	yes	BRNCTXA
chr2_33640631_A_C_b38	RASGRP3	3.18	0.00176	0.072623	6	0.022836	yes	BRNCTXA
chr2_33640513_G_C_b38	RASGRP3	3.126	0.0021	0.086791	3	0.027764	yes	BRNCTXA
chr2_33641397_G_C_b38	RASGRP3	3.118	0.00215	0.071578	6	0.02296	yes	BRNCTXA
chr2_33242685_TA_T_b38	RASGRP3	-3.088	0.00237	-0.061479	25	0.01991	yes	BRNCTXA
chr2_33397506_C_CTTT_b38	RASGRP3	-3.006	0.00306	-0.044765	60	0.014891	yes	BRNCTXA
chr2_33563965_A_G_b38	RASGRP3	3	0.00312	0.077607	5	0.025868	yes	BRNCTXA
chr2_33639021_G_A_b38	RASGRP3	2.995	0.00317	0.069726	6	0.023277	yes	BRNCTXA
chr2_33479411_A_ACTC_b38	RASGRP3	-2.956	0.00358	-0.052009	22	0.017595	yes	BRNCTXA
chr2_34034399_T_C_b38	RASGRP3	2.947	0.00367	0.071848	4	0.024377	yes	BRNCTXA
chr2_33543901_C_G_b38	RASGRP3	-2.924	0.00394	-0.052102	25	0.017819	yes	BRNCTXA
chr2_33581900_A_T_b38	RASGRP3	2.921	0.00399	0.077245	5	0.026449	yes	BRNCTXA
chr2_34028026_C_G_b38	RASGRP3	2.879	0.00453	0.066052	6	0.022946	yes	BRNCTXA
chr2_33577889_G_A_b38	RASGRP3	-2.858	0.00482	-0.050792	28	0.017774	yes	BRNCTXA
chr2_33554839_T_C_b38	RASGRP3	2.838	0.00512	0.05089	24	0.017932	yes	BRNCTXA
chr2_33616325_C_T_b38	RASGRP3	2.83	0.00523	0.080751	3	0.028529	yes	BRNCTXA
chr2_33527085_G_T_b38	RASGRP3	-2.82	0.0054	-0.064134	6	0.022746	yes	BRNCTXA
chr2_34034669_A_G_b38	RASGRP3	2.795	0.0058	0.068346	4	0.02445	yes	BRNCTXA
chr2_33596450_T_G_b38	RASGRP3	2.789	0.00591	0.0542	14	0.019433	yes	BRNCTXA
chr2_34024937_G_T_b38	RASGRP3	-2.768	0.00629	-0.070875	3	0.025604	yes	BRNCTXA
chr2_33470380_AT_A_b38	RASGRP3	-2.764	0.00636	-0.064585	6	0.023364	yes	BRNCTXA
chr2_33547458_G_A_b38	RASGRP3	2.757	0.00649	0.048538	26	0.017603	yes	BRNCTXA
chr2_33512902_A_G_b38	RASGRP3	-2.755	0.00654	-0.046335	39	0.01682	yes	BRNCTXA
chr2_33571267_T_A_b38	RASGRP3	-2.749	0.00666	-0.04758	30	0.01731	yes	BRNCTXA
chr2_33464091_C_T_b38	RASGRP3	-2.733	0.00697	-0.068281	6	0.024988	yes	BRNCTXA
chr2_33589264_G_C_b38	RASGRP3	2.722	0.00718	0.0533	13	0.019579	yes	BRNCTXA
chr2_33590881_T_C_b38	RASGRP3	2.722	0.00718	0.0533	13	0.019579	yes	BRNCTXA
chr2_33636858_C_G_b38	RASGRP3	2.706	0.00754	0.077703	3	0.028719	yes	BRNCTXA
chr2_33637736_A_T_b38	RASGRP3	2.706	0.00754	0.077703	3	0.028719	yes	BRNCTXA
chr2_33659035_G_A_b38	RASGRP3	2.701	0.00764	0.077843	3	0.028821	yes	BRNCTXA
chr2_33571342_T_C_b38	RASGRP3	-2.701	0.00765	-0.046959	30	0.017388	yes	BRNCTXA
chr2_33402082_A_AT_b38	RASGRP3	-2.692	0.00784	-0.047499	24	0.017646	yes	BRNCTXA
chr2_34214383_G_A_b38	RASGRP3	2.671	0.00832	0.087373	3	0.032711	yes	BRNCTXA
chr2_33986624_A_G_b38	RASGRP3	2.667	0.00842	0.083107	4	0.031162	yes	BRNCTXA
chr2_33986646_G_C_b38	RASGRP3	2.667	0.00842	0.083107	4	0.031162	yes	BRNCTXA
chr2_33392183_A_AT_b38	RASGRP3	-2.637	0.00917	-0.052046	12	0.019738	yes	BRNCTXA
chr2_33634524_A_G_b38	RASGRP3	2.635	0.00923	0.076378	3	0.028989	yes	BRNCTXA
chr2_33967602_C_T_b38	RASGRP3	2.63	0.00935	0.087572	3	0.033295	yes	BRNCTXA
chr2_34189662_G_GTGTGTGTGTACGTATACACATATATGTATATA_b38	RASGRP3	-2.628	0.0094	-0.048874	43	0.018596	yes	BRNCTXA
chr2_33846061_T_C_b38	RASGRP3	-2.624	0.00951	-0.076733	3	0.029243	yes	BRNCTXA
chr2_33846125_T_C_b38	RASGRP3	-2.624	0.00951	-0.076733	3	0.029243	yes	BRNCTXA
chr2_33846223_T_C_b38	RASGRP3	-2.624	0.00951	-0.076733	3	0.029243	yes	BRNCTXA
chr2_33427777_A_ATTT_b38	RASGRP3	2.62	0.00961	0.11096	3	0.042349	yes	BRNCTXA
chr2_33667549_A_G_b38	RASGRP3	2.618	0.00967	0.07622	3	0.029114	yes	BRNCTXA
chr2_33667555_A_G_b38	RASGRP3	2.618	0.00967	0.07622	3	0.029114	yes	BRNCTXA
chr2_33575950_G_A_b38	RASGRP3	-2.614	0.00977	-0.046477	28	0.017777	yes	BRNCTXA
chr2_33569371_A_G_b38	RASGRP3	-2.612	0.00983	-0.045926	30	0.017582	yes	BRNCTXA
chr2_33536322_G_GA_b38	RASGRP3	3.743	0.000251	0.106108	5	0.028348	no	BRNCTXA
chr2_33656248_TTC_T_b38	RASGRP3	3.187	0.00172	0.069923	7	0.02194	no	BRNCTXA
chr2_33650021_A_G_b38	RASGRP3	3.172	0.00181	0.069327	7	0.021859	no	BRNCTXA
chr2_34089202_G_A_b38	RASGRP3	-3.06	0.00258	-0.055558	41	0.018155	no	BRNCTXA
chr2_33652477_C_A_b38	RASGRP3	3.048	0.00268	0.067482	7	0.022138	no	BRNCTXA
chr2_33657078_T_C_b38	RASGRP3	3.04	0.00275	0.063637	14	0.020932	no	BRNCTXA
chr2_33663555_T_C_b38	RASGRP3	2.953	0.0036	0.064533	8	0.02185	no	BRNCTXA
chr2_32767443_G_GT_b38	RASGRP3	2.917	0.00404	0.073986	3	0.025368	no	BRNCTXA
chr2_33662459_C_T_b38	RASGRP3	2.902	0.00422	0.063895	8	0.022019	no	BRNCTXA
chr2_34050196_C_T_b38	RASGRP3	2.844	0.00503	0.067851	5	0.023861	no	BRNCTXA
chr2_33737380_C_CT_b38	RASGRP3	2.834	0.00518	0.055216	17	0.019484	no	BRNCTXA
chr2_33511010_G_A_b38	RASGRP3	2.833	0.0052	0.091005	3	0.032128	no	BRNCTXA
chr2_33656848_TA_T_b38	RASGRP3	2.82	0.00539	0.060181	11	0.021337	no	BRNCTXA
chr2_33567745_C_T_b38	RASGRP3	-2.808	0.00559	-0.049353	29	0.017576	no	BRNCTXA
chr2_33670716_C_T_b38	RASGRP3	2.743	0.00677	0.058431	9	0.021304	no	BRNCTXA
chr2_34017864_TCCCACATG_T_b38	RASGRP3	2.737	0.00689	0.063859	6	0.023335	no	BRNCTXA
chr2_33478490_C_T_b38	RASGRP3	2.715	0.00734	0.050186	24	0.018487	no	BRNCTXA
chr2_33470311_T_A_b38	RASGRP3	2.698	0.0077	0.046201	33	0.017121	no	BRNCTXA
chr2_33343410_C_CAAA_b38	RASGRP3	-2.698	0.0077	-0.092016	3	0.0341	no	BRNCTXA
chr2_33395907_A_T_b38	RASGRP3	-2.694	0.0078	-0.052117	13	0.019346	no	BRNCTXA
chr2_33568339_TA_T_b38	RASGRP3	-2.688	0.00792	-0.046343	33	0.017238	no	BRNCTXA
chr2_33572204_C_A_b38	RASGRP3	-2.676	0.0082	-0.047275	29	0.017664	no	BRNCTXA
chr2_33470233_G_A_b38	RASGRP3	2.672	0.00829	0.045591	33	0.01706	no	BRNCTXA
chr2_33470756_C_T_b38	RASGRP3	2.672	0.00829	0.045591	33	0.01706	no	BRNCTXA
chr2_34031107_C_A_b38	RASGRP3	2.656	0.00868	0.063339	5	0.023846	no	BRNCTXA
chr2_33470006_T_C_b38	RASGRP3	2.634	0.00926	0.045149	33	0.017144	no	BRNCTXA
chr2_33469845_C_T_b38	RASGRP3	2.629	0.00937	0.045078	37	0.017145	no	BRNCTXA
chr2_33509399_C_CA_b38	RASGRP3	2.626	0.00946	0.069153	3	0.026334	no	BRNCTXA
chr2_33469436_T_C_b38	RASGRP3	2.625	0.00948	0.045575	34	0.01736	no	BRNCTXA
chr2_33523846_A_G_b38	RASGRP3	-2.621	0.0096	-0.055366	9	0.021126	no	BRNCTXA
chr2_33470875_C_T_b38	RASGRP3	2.619	0.00964	0.044496	37	0.016988	no	BRNCTXA
chr2_32903418_G_A_b38	RASGRP3	-2.617	0.00971	-0.087174	3	0.033313	no	BRNCTXA
chr2_33537330_C_CCCAACACA_b38	RASGRP3	4.525	1.32e-05	0.124857	10	0.027592	yes	BRNCTXB
chr2_33537192_G_GAT_b38	RASGRP3	4.04	8.94e-05	0.13422	3	0.03322	yes	BRNCTXB
chr2_33537896_A_G_b38	RASGRP3	3.986	0.00011	0.133792	3	0.033565	yes	BRNCTXB
chr2_33478863_G_A_b38	RASGRP3	3.692	0.000323	0.079815	33	0.021621	yes	BRNCTXB
chr2_34191152_C_T_b38	RASGRP3	-3.327	0.00113	-0.140915	3	0.042352	yes	BRNCTXB
chr2_33478490_C_T_b38	RASGRP3	3.282	0.00132	0.076276	21	0.023242	yes	BRNCTXB
chr2_33973181_TAA_T_b38	RASGRP3	3.277	0.00134	0.077364	20	0.023608	yes	BRNCTXB
chr2_33554542_A_G_b38	RASGRP3	3.274	0.00135	0.116678	3	0.035635	yes	BRNCTXB
chr2_33559304_G_A_b38	RASGRP3	3.236	0.00153	0.111975	3	0.034599	yes	BRNCTXB
chr2_33557635_G_A_b38	RASGRP3	3.232	0.00155	0.110721	3	0.034254	yes	BRNCTXB
chr2_33559734_G_A_b38	RASGRP3	3.232	0.00155	0.110721	3	0.034254	yes	BRNCTXB
chr2_33550216_T_A_b38	RASGRP3	3.223	0.00159	0.115948	3	0.035976	yes	BRNCTXB
chr2_33550484_C_G_b38	RASGRP3	3.223	0.00159	0.115948	3	0.035976	yes	BRNCTXB
chr2_34161126_C_T_b38	RASGRP3	-3.101	0.00235	-0.10856	3	0.035006	yes	BRNCTXB
chr2_33475871_A_C_b38	RASGRP3	-3.085	0.00247	-0.065932	22	0.021372	yes	BRNCTXB
chr2_34294916_C_T_b38	RASGRP3	-3.083	0.00249	-0.109314	3	0.03546	yes	BRNCTXB
chr2_34153762_C_G_b38	RASGRP3	-3.034	0.0029	-0.104641	3	0.03449	yes	BRNCTXB
chr2_34159894_T_C_b38	RASGRP3	-3.032	0.00292	-0.105257	3	0.034714	yes	BRNCTXB
chr2_33557844_G_A_b38	RASGRP3	3.014	0.00308	0.104475	3	0.034659	yes	BRNCTXB
chr2_33089155_CAA_C_b38	RASGRP3	-3.005	0.00317	-0.090311	5	0.030054	yes	BRNCTXB
chr2_34157518_C_T_b38	RASGRP3	-2.862	0.00488	-0.10438	3	0.036465	yes	BRNCTXB
chr2_34313185_T_C_b38	RASGRP3	2.86	0.00492	0.091953	6	0.032156	yes	BRNCTXB
chr2_34146435_A_G_b38	RASGRP3	-2.85	0.00506	-0.097798	3	0.034311	yes	BRNCTXB
chr2_34122285_G_A_b38	RASGRP3	-2.819	0.00554	-0.099906	3	0.035435	yes	BRNCTXB
chr2_34150163_A_C_b38	RASGRP3	-2.819	0.00554	-0.099906	3	0.035435	yes	BRNCTXB
chr2_34152699_G_A_b38	RASGRP3	-2.819	0.00554	-0.099906	3	0.035435	yes	BRNCTXB
chr2_34129486_C_G_b38	RASGRP3	-2.811	0.00568	-0.100117	3	0.035614	yes	BRNCTXB
chr2_34133530_G_A_b38	RASGRP3	-2.811	0.00568	-0.100117	3	0.035614	yes	BRNCTXB
chr2_34134573_G_A_b38	RASGRP3	-2.811	0.00568	-0.100117	3	0.035614	yes	BRNCTXB
chr2_34135099_C_T_b38	RASGRP3	-2.811	0.00568	-0.100117	3	0.035614	yes	BRNCTXB
chr2_34141833_C_T_b38	RASGRP3	-2.811	0.00568	-0.100117	3	0.035614	yes	BRNCTXB
chr2_34150957_C_A_b38	RASGRP3	-2.811	0.00568	-0.100117	3	0.035614	yes	BRNCTXB
chr2_34155578_C_T_b38	RASGRP3	-2.811	0.00568	-0.100117	3	0.035614	yes	BRNCTXB
chr2_34129010_AG_A_b38	RASGRP3	-2.782	0.00617	-0.074213	10	0.026672	yes	BRNCTXB
chr2_34129013_AAC_A_b38	RASGRP3	-2.782	0.00617	-0.074213	10	0.026672	yes	BRNCTXB
chr2_34134021_C_T_b38	RASGRP3	-2.782	0.00617	-0.074213	10	0.026672	yes	BRNCTXB
chr2_34140144_C_A_b38	RASGRP3	-2.782	0.00617	-0.074213	10	0.026672	yes	BRNCTXB
chr2_34116464_G_A_b38	RASGRP3	-2.781	0.00619	-0.099664	3	0.035834	yes	BRNCTXB
chr2_34435484_C_CATT_b38	RASGRP3	2.762	0.00656	0.081255	6	0.029424	yes	BRNCTXB
chr2_34142655_G_A_b38	RASGRP3	-2.752	0.00674	-0.096628	3	0.03511	yes	BRNCTXB
chr2_32711116_C_CAAA_b38	RASGRP3	-2.75	0.00679	-0.101176	6	0.036795	yes	BRNCTXB
chr2_34131221_T_TC_b38	RASGRP3	-2.747	0.00684	-0.097033	3	0.035324	yes	BRNCTXB
chr2_34131226_T_A_b38	RASGRP3	-2.747	0.00684	-0.097033	3	0.035324	yes	BRNCTXB
chr2_34132398_GA_G_b38	RASGRP3	-2.747	0.00684	-0.097033	3	0.035324	yes	BRNCTXB
chr2_34154256_G_A_b38	RASGRP3	-2.747	0.00684	-0.097033	3	0.035324	yes	BRNCTXB
chr2_34155040_T_C_b38	RASGRP3	-2.747	0.00684	-0.097033	3	0.035324	yes	BRNCTXB
chr2_34155900_G_A_b38	RASGRP3	-2.747	0.00684	-0.097033	3	0.035324	yes	BRNCTXB
chr2_34189661_A_AGTGTGTGTGTACGTATACACATATATGTATATAT_b38	RASGRP3	-2.737	0.00704	-0.07962	7	0.02909	yes	BRNCTXB
chr2_34115083_T_C_b38	RASGRP3	-2.712	0.00756	-0.093893	3	0.034619	yes	BRNCTXB
chr2_34157301_CT_C_b38	RASGRP3	-2.701	0.00781	-0.079463	6	0.02942	yes	BRNCTXB
chr2_34127506_AATAT_A_b38	RASGRP3	-2.63	0.00953	-0.069191	13	0.026305	yes	BRNCTXB
chr2_34135263_G_A_b38	RASGRP3	-2.63	0.00953	-0.069191	13	0.026305	yes	BRNCTXB
chr2_34129817_G_A_b38	RASGRP3	-2.614	0.00997	-0.069198	13	0.026471	yes	BRNCTXB
chr2_33474404_G_A_b38	RASGRP3	3.228	0.00157	0.069254	27	0.021452	no	BRNCTXB
chr2_33470380_ATT_A_b38	RASGRP3	3.204	0.00169	0.092551	19	0.028882	no	BRNCTXB
chr2_34190529_A_G_b38	RASGRP3	-3.158	0.00196	-0.129573	3	0.041026	no	BRNCTXB
chr2_34293734_A_C_b38	RASGRP3	-3.111	0.00228	-0.103302	3	0.033206	no	BRNCTXB
chr2_32789947_G_A_b38	RASGRP3	-2.967	0.00356	-0.126177	3	0.042527	no	BRNCTXB
chr2_32789949_G_A_b38	RASGRP3	-2.967	0.00356	-0.126177	3	0.042527	no	BRNCTXB
chr2_33469845_C_T_b38	RASGRP3	2.957	0.00368	0.065157	34	0.022037	no	BRNCTXB
chr2_33034228_TA_T_b38	RASGRP3	-2.911	0.00422	-0.081066	8	0.027848	no	BRNCTXB
chr2_34151215_C_T_b38	RASGRP3	-2.897	0.0044	-0.094348	5	0.032568	no	BRNCTXB
chr2_33018152_G_GT_b38	RASGRP3	2.879	0.00464	0.082135	4	0.028524	no	BRNCTXB
chr2_33470875_C_T_b38	RASGRP3	2.878	0.00466	0.062989	34	0.021889	no	BRNCTXB
chr2_34306178_A_C_b38	RASGRP3	2.823	0.00549	0.09625	3	0.034098	no	BRNCTXB
chr2_32728037_C_CTT_b38	RASGRP3	2.822	0.00549	0.138691	3	0.049141	no	BRNCTXB
chr2_33537330_C_CCCCCCA_b38	RASGRP3	-2.803	0.00581	-0.071512	15	0.025508	no	BRNCTXB
chr2_32933593_TTC_T_b38	RASGRP3	-2.797	0.00593	-0.066371	19	0.023733	no	BRNCTXB
chr2_34277860_C_CTAAATAAATAAATAAATAAA_b38	RASGRP3	-2.795	0.00596	-0.126302	3	0.045196	no	BRNCTXB
chr2_33470311_T_A_b38	RASGRP3	2.77	0.0064	0.060171	30	0.021722	no	BRNCTXB
chr2_33985858_CA_C_b38	RASGRP3	2.753	0.00672	0.094347	3	0.034269	no	BRNCTXB
chr2_32933761_C_T_b38	RASGRP3	-2.744	0.0069	-0.066114	17	0.024093	no	BRNCTXB
chr2_32933845_T_C_b38	RASGRP3	-2.744	0.0069	-0.066114	17	0.024093	no	BRNCTXB
chr2_33471307_G_GTAGGACTA_b38	RASGRP3	2.692	0.00802	0.063443	27	0.02357	no	BRNCTXB
chr2_33025492_A_G_b38	RASGRP3	2.675	0.0084	0.077834	5	0.029094	no	BRNCTXB
chr2_34159314_TC_T_b38	RASGRP3	-2.667	0.00861	-0.087595	4	0.03285	no	BRNCTXB
chr2_33023454_G_C_b38	RASGRP3	2.664	0.00866	0.079696	4	0.029914	no	BRNCTXB
chr2_33029666_C_T_b38	RASGRP3	2.664	0.00866	0.079696	4	0.029914	no	BRNCTXB
chr2_33034289_T_C_b38	RASGRP3	2.664	0.00866	0.079696	4	0.029914	no	BRNCTXB
chr2_32932404_G_A_b38	RASGRP3	2.657	0.00883	0.063403	16	0.023858	no	BRNCTXB
chr2_34311464_G_C_b38	RASGRP3	-2.645	0.00914	-0.087001	4	0.03289	no	BRNCTXB
chr2_33026928_G_A_b38	RASGRP3	2.632	0.00947	0.078955	4	0.029993	no	BRNCTXB
chr2_33047387_A_C_b38	RASGRP3	2.632	0.00947	0.078955	4	0.029993	no	BRNCTXB
chr2_33469036_C_CA_b38	RASGRP3	2.631	0.00952	0.059022	32	0.022437	no	BRNCTXB
chr2_33540561_TGTGTGTGTGTG_T_b38	RASGRP3	2.627	0.00963	0.094985	4	0.036163	no	BRNCTXB
chr2_33019874_AT_A_b38	RASGRP3	2.626	0.00966	0.078007	3	0.029711	no	BRNCTXB
chr2_33965548_C_G_b38	RASGRP3	2.625	0.00967	0.063509	17	0.024194	no	BRNCTXB
chr2_33966164_T_A_b38	RASGRP3	2.625	0.00967	0.063509	17	0.024194	no	BRNCTXB
chr2_33466742_G_A_b38	RASGRP3	2.618	0.00985	0.057806	38	0.022078	no	BRNCTXB
chr2_33014179_C_T_b38	RASGRP3	2.615	0.00995	0.065973	11	0.025231	no	BRNCTXB
chr2_33457670_G_T_b38	RASGRP3	4.384	2.46e-05	0.105568	23	0.024081	yes	BRNHPP
chr2_33475871_A_C_b38	RASGRP3	-3.965	0.000123	-0.100813	18	0.025427	yes	BRNHPP
chr2_33478863_G_A_b38	RASGRP3	3.209	0.0017	0.077643	31	0.024195	yes	BRNHPP
chr2_33537330_C_CCCAACACA_b38	RASGRP3	3.202	0.00173	0.105843	9	0.033057	yes	BRNHPP
chr2_33285451_C_CT_b38	RASGRP3	-3.188	0.00181	-0.096247	9	0.030187	yes	BRNHPP
chr2_33449783_A_C_b38	RASGRP3	-3.172	0.00191	-0.093086	9	0.029344	yes	BRNHPP
chr2_33470380_ATT_A_b38	RASGRP3	3.116	0.00228	0.097377	19	0.031247	yes	BRNHPP
chr2_33453264_C_T_b38	RASGRP3	3.111	0.00232	0.096336	5	0.030971	yes	BRNHPP
chr2_33463160_G_A_b38	RASGRP3	2.988	0.00339	0.098958	4	0.033118	yes	BRNHPP
chr2_32935392_C_A_b38	RASGRP3	-2.983	0.00344	-0.082919	17	0.0278	yes	BRNHPP
chr2_33456412_T_C_b38	RASGRP3	2.886	0.0046	0.091656	5	0.031755	yes	BRNHPP
chr2_33456621_T_G_b38	RASGRP3	2.886	0.0046	0.091656	5	0.031755	yes	BRNHPP
chr2_32949678_C_T_b38	RASGRP3	2.83	0.00544	0.074856	24	0.026453	yes	BRNHPP
chr2_33271299_A_AT_b38	RASGRP3	2.795	0.00602	0.080898	19	0.028946	yes	BRNHPP
chr2_33461719_G_A_b38	RASGRP3	2.769	0.00648	0.09152	4	0.033049	yes	BRNHPP
chr2_33462930_G_A_b38	RASGRP3	2.769	0.00648	0.09152	4	0.033049	yes	BRNHPP
chr2_33780336_C_T_b38	RASGRP3	-2.766	0.00654	-0.071668	24	0.025911	yes	BRNHPP
chr2_33784409_G_A_b38	RASGRP3	-2.745	0.00695	-0.070885	24	0.025824	yes	BRNHPP
chr2_33547053_GAAAAAA_G_b38	RASGRP3	2.717	0.00753	0.092038	4	0.033877	yes	BRNHPP
chr2_33461856_C_T_b38	RASGRP3	2.698	0.00796	0.090223	4	0.033446	yes	BRNHPP
chr2_33556190_G_A_b38	RASGRP3	-2.65	0.0091	-0.071053	25	0.026814	yes	BRNHPP
chr2_33523649_G_A_b38	RASGRP3	2.642	0.00932	0.098539	3	0.037304	yes	BRNHPP
chr2_33782651_G_T_b38	RASGRP3	-2.635	0.00949	-0.068997	24	0.026184	yes	BRNHPP
chr2_33461427_G_A_b38	RASGRP3	2.632	0.00956	0.085401	4	0.032443	yes	BRNHPP
chr2_33469036_C_CA_b38	RASGRP3	3.373	0.000993	0.083309	29	0.024699	no	BRNHPP
chr2_33469845_C_T_b38	RASGRP3	3.373	0.000993	0.083309	29	0.024699	no	BRNHPP
chr2_33470875_C_T_b38	RASGRP3	3.373	0.000993	0.083309	29	0.024699	no	BRNHPP
chr2_33466742_G_A_b38	RASGRP3	3.35	0.00107	0.088787	32	0.026501	no	BRNHPP
chr2_33470311_T_A_b38	RASGRP3	3.341	0.0011	0.082481	26	0.024686	no	BRNHPP
chr2_33448594_T_C_b38	RASGRP3	-3.293	0.00129	-0.105712	4	0.032106	no	BRNHPP
chr2_33470006_T_C_b38	RASGRP3	3.197	0.00176	0.077608	27	0.024277	no	BRNHPP
chr2_33470756_C_T_b38	RASGRP3	3.197	0.00176	0.077608	27	0.024277	no	BRNHPP
chr2_33470233_G_A_b38	RASGRP3	3.164	0.00196	0.077902	26	0.02462	no	BRNHPP
chr2_33470439_G_A_b38	RASGRP3	3.164	0.00196	0.077902	26	0.02462	no	BRNHPP
chr2_33469436_T_C_b38	RASGRP3	3.131	0.00218	0.075814	28	0.024217	no	BRNHPP
chr2_33470505_G_A_b38	RASGRP3	3.094	0.00244	0.073961	28	0.023908	no	BRNHPP
chr2_33271214_C_T_b38	RASGRP3	3.002	0.00324	0.08407	14	0.028	no	BRNHPP
chr2_33277749_AT_A_b38	RASGRP3	2.983	0.00343	0.082189	16	0.02755	no	BRNHPP
chr2_33451333_T_C_b38	RASGRP3	-2.94	0.00391	-0.10103	3	0.03436	no	BRNHPP
chr2_32844977_TA_T_b38	RASGRP3	2.867	0.00487	0.095125	4	0.033178	no	BRNHPP
chr2_33554839_T_C_b38	RASGRP3	2.827	0.00549	0.072764	22	0.025743	no	BRNHPP
chr2_33933541_CTCCTTCCT_C_b38	RASGRP3	-2.826	0.00549	-0.105374	4	0.037285	no	BRNHPP
chr2_33469706_C_T_b38	RASGRP3	2.814	0.0057	0.0716	28	0.025448	no	BRNHPP
chr2_33249578_T_C_b38	RASGRP3	2.803	0.00589	0.075413	26	0.026909	no	BRNHPP
chr2_32969229_T_G_b38	RASGRP3	-2.78	0.00628	-0.084423	10	0.030366	no	BRNHPP
chr2_32820800_G_GT_b38	RASGRP3	2.777	0.00633	0.094737	3	0.034112	no	BRNHPP
chr2_33775111_T_C_b38	RASGRP3	-2.74	0.00706	-0.071689	21	0.026167	no	BRNHPP
chr2_33780594_T_C_b38	RASGRP3	-2.74	0.00706	-0.071689	21	0.026167	no	BRNHPP
chr2_33780926_A_T_b38	RASGRP3	-2.74	0.00706	-0.071689	21	0.026167	no	BRNHPP
chr2_33781101_C_T_b38	RASGRP3	-2.74	0.00706	-0.071689	21	0.026167	no	BRNHPP
chr2_33782026_C_T_b38	RASGRP3	-2.74	0.00706	-0.071689	21	0.026167	no	BRNHPP
chr2_33783427_G_A_b38	RASGRP3	-2.734	0.00717	-0.071676	21	0.026213	no	BRNHPP
chr2_33783921_A_G_b38	RASGRP3	-2.734	0.00717	-0.071676	21	0.026213	no	BRNHPP
chr2_33785901_A_G_b38	RASGRP3	-2.734	0.00717	-0.071676	21	0.026213	no	BRNHPP
chr2_33470357_T_C_b38	RASGRP3	2.731	0.00723	0.068903	29	0.025229	no	BRNHPP
chr2_33470734_A_G_b38	RASGRP3	2.731	0.00723	0.068903	29	0.025229	no	BRNHPP
chr2_33471307_G_GTAGGACTA_b38	RASGRP3	2.731	0.00723	0.068903	29	0.025229	no	BRNHPP
chr2_33465306_G_C_b38	RASGRP3	-2.705	0.00779	-0.09676	4	0.035769	no	BRNHPP
chr2_33442871_G_C_b38	RASGRP3	-2.695	0.00801	-0.075047	17	0.027844	no	BRNHPP
chr2_33547458_G_A_b38	RASGRP3	2.688	0.00817	0.068597	21	0.025516	no	BRNHPP
chr2_33781164_CT_C_b38	RASGRP3	-2.651	0.00908	-0.070131	20	0.026458	no	BRNHPP
chr2_33259143_T_C_b38	RASGRP3	2.635	0.00949	0.074117	15	0.028129	no	BRNHPP
chr2_33473382_C_CA_b38	RASGRP3	-2.634	0.00951	-0.086022	6	0.032657	no	BRNHPP
chr2_33775171_C_A_b38	RASGRP3	-2.617	0.00998	-0.069172	21	0.026434	no	BRNHPP
chr2_33775324_C_A_b38	RASGRP3	-2.617	0.00998	-0.069172	21	0.026434	no	BRNHPP
chr2_33775428_A_C_b38	RASGRP3	-2.617	0.00998	-0.069172	21	0.026434	no	BRNHPP
chr2_33775623_A_C_b38	RASGRP3	-2.617	0.00998	-0.069172	21	0.026434	no	BRNHPP
chr2_33775691_A_G_b38	RASGRP3	-2.617	0.00998	-0.069172	21	0.026434	no	BRNHPP
chr2_33775781_G_C_b38	RASGRP3	-2.617	0.00998	-0.069172	21	0.026434	no	BRNHPP
chr2_33775988_T_C_b38	RASGRP3	-2.617	0.00998	-0.069172	21	0.026434	no	BRNHPP
chr2_33776166_C_G_b38	RASGRP3	-2.617	0.00998	-0.069172	21	0.026434	no	BRNHPP
chr2_33776322_C_T_b38	RASGRP3	-2.617	0.00998	-0.069172	21	0.026434	no	BRNHPP
chr2_33776331_G_A_b38	RASGRP3	-2.617	0.00998	-0.069172	21	0.026434	no	BRNHPP
chr2_33776335_A_G_b38	RASGRP3	-2.617	0.00998	-0.069172	21	0.026434	no	BRNHPP
chr2_33776371_C_T_b38	RASGRP3	-2.617	0.00998	-0.069172	21	0.026434	no	BRNHPP
chr2_33776502_G_A_b38	RASGRP3	-2.617	0.00998	-0.069172	21	0.026434	no	BRNHPP
chr2_33776504_G_A_b38	RASGRP3	-2.617	0.00998	-0.069172	21	0.026434	no	BRNHPP
chr2_33776745_G_C_b38	RASGRP3	-2.617	0.00998	-0.069172	21	0.026434	no	BRNHPP
chr2_33776762_A_G_b38	RASGRP3	-2.617	0.00998	-0.069172	21	0.026434	no	BRNHPP
chr2_33776840_G_T_b38	RASGRP3	-2.617	0.00998	-0.069172	21	0.026434	no	BRNHPP
chr2_33776900_G_T_b38	RASGRP3	-2.617	0.00998	-0.069172	21	0.026434	no	BRNHPP
chr2_33777030_G_T_b38	RASGRP3	-2.617	0.00998	-0.069172	21	0.026434	no	BRNHPP
chr2_33777354_G_A_b38	RASGRP3	-2.617	0.00998	-0.069172	21	0.026434	no	BRNHPP
chr2_33777965_T_G_b38	RASGRP3	-2.617	0.00998	-0.069172	21	0.026434	no	BRNHPP
chr2_34011645_A_G_b38	RASGRP3	-4.161	5.76e-05	-0.112404	26	0.027016	yes	BRNHPT
chr2_33464237_G_A_b38	RASGRP3	-4.002	0.000105	-0.142182	5	0.035525	yes	BRNHPT
chr2_33804425_C_G_b38	RASGRP3	3.912	0.000148	0.137628	4	0.035185	yes	BRNHPT
chr2_33474721_C_T_b38	RASGRP3	-3.462	0.000729	-0.11483	7	0.033173	yes	BRNHPT
chr2_34009375_C_T_b38	RASGRP3	-3.381	0.000956	-0.096701	19	0.028601	yes	BRNHPT
chr2_34010667_A_C_b38	RASGRP3	-3.381	0.000956	-0.096701	19	0.028601	yes	BRNHPT
chr2_34002885_A_G_b38	RASGRP3	-3.232	0.00156	-0.089862	20	0.027802	yes	BRNHPT
chr2_34002898_T_TGATA_b38	RASGRP3	-3.232	0.00156	-0.089862	20	0.027802	yes	BRNHPT
chr2_33808785_C_T_b38	RASGRP3	3.222	0.00161	0.109478	4	0.03398	yes	BRNHPT
chr2_33796538_A_G_b38	RASGRP3	-3.211	0.00167	-0.090053	24	0.028045	yes	BRNHPT
chr2_34000441_T_C_b38	RASGRP3	-3.187	0.0018	-0.085286	20	0.02676	yes	BRNHPT
chr2_33989877_C_A_b38	RASGRP3	-3.163	0.00195	-0.08429	24	0.026647	yes	BRNHPT
chr2_34003189_T_A_b38	RASGRP3	-3.159	0.00197	-0.087573	22	0.027725	yes	BRNHPT
chr2_33809005_C_G_b38	RASGRP3	3.152	0.00202	0.105027	5	0.033326	yes	BRNHPT
chr2_33809706_A_T_b38	RASGRP3	3.152	0.00202	0.105027	5	0.033326	yes	BRNHPT
chr2_34004911_C_A_b38	RASGRP3	-3.125	0.0022	-0.085563	22	0.027384	yes	BRNHPT
chr2_33805527_A_G_b38	RASGRP3	3.121	0.00222	0.102443	6	0.032823	yes	BRNHPT
chr2_33986179_A_G_b38	RASGRP3	-3.111	0.00229	-0.088577	17	0.02847	yes	BRNHPT
chr2_33807295_G_A_b38	RASGRP3	3.078	0.00254	0.104211	4	0.033854	yes	BRNHPT
chr2_33465306_G_C_b38	RASGRP3	-3.074	0.00257	-0.113893	3	0.037044	yes	BRNHPT
chr2_33798122_T_C_b38	RASGRP3	-3.038	0.00288	-0.086614	23	0.02851	yes	BRNHPT
chr2_34008740_G_A_b38	RASGRP3	-3.033	0.00293	-0.108692	6	0.035833	yes	BRNHPT
chr2_33980294_C_G_b38	RASGRP3	-2.992	0.00332	-0.079612	22	0.026609	yes	BRNHPT
chr2_33978479_T_TA_b38	RASGRP3	-2.988	0.00336	-0.084623	22	0.028323	yes	BRNHPT
chr2_33803388_C_T_b38	RASGRP3	2.984	0.0034	0.100489	5	0.033674	yes	BRNHPT
chr2_33796806_G_A_b38	RASGRP3	-2.965	0.0036	-0.082497	24	0.027819	yes	BRNHPT
chr2_33470380_ATT_A_b38	RASGRP3	2.923	0.00409	0.105777	14	0.036184	yes	BRNHPT
chr2_33985858_CA_C_b38	RASGRP3	2.891	0.00451	0.116512	3	0.040308	yes	BRNHPT
chr2_33978473_C_T_b38	RASGRP3	-2.889	0.00453	-0.076666	23	0.026533	yes	BRNHPT
chr2_33982541_G_A_b38	RASGRP3	-2.888	0.00454	-0.076461	24	0.026472	yes	BRNHPT
chr2_33122831_TC_T_b38	RASGRP3	-2.885	0.00459	-0.119264	4	0.04134	yes	BRNHPT
chr2_33622160_C_T_b38	RASGRP3	2.85	0.00509	0.090486	14	0.031748	yes	BRNHPT
chr2_33974667_A_G_b38	RASGRP3	-2.806	0.00579	-0.080934	25	0.02884	yes	BRNHPT
chr2_33796781_A_T_b38	RASGRP3	-2.797	0.00595	-0.077851	24	0.027833	yes	BRNHPT
chr2_33537330_C_CCCAACACA_b38	RASGRP3	2.765	0.00653	0.104952	8	0.037958	yes	BRNHPT
chr2_33906683_C_CATTTATTTATTTATTT_b38	RASGRP3	-2.741	0.007	-0.070355	38	0.02567	yes	BRNHPT
chr2_33902935_A_G_b38	RASGRP3	-2.711	0.00763	-0.134377	5	0.049571	yes	BRNHPT
chr2_32950554_CA_C_b38	RASGRP3	-2.696	0.00796	-0.091615	19	0.033983	yes	BRNHPT
chr2_33466649_C_A_b38	RASGRP3	-2.696	0.00796	-0.099846	3	0.037039	yes	BRNHPT
chr2_33980670_A_ATTTATTTATT_b38	RASGRP3	-2.635	0.00943	-0.069957	31	0.026545	yes	BRNHPT
chr2_33548381_A_AAAG_b38	RASGRP3	2.624	0.00973	0.1062	6	0.040466	yes	BRNHPT
chr2_33449783_A_C_b38	RASGRP3	-3.939	0.000133	-0.117309	11	0.029782	no	BRNHPT
chr2_33809711_C_T_b38	RASGRP3	3.75	0.000266	0.131976	3	0.035194	no	BRNHPT
chr2_33463583_T_C_b38	RASGRP3	-3.644	0.000387	-0.131787	4	0.036162	no	BRNHPT
chr2_33472754_G_A_b38	RASGRP3	-3.433	0.000804	-0.121174	4	0.035302	no	BRNHPT
chr2_33512177_G_A_b38	RASGRP3	3.408	0.000873	0.136969	4	0.04019	no	BRNHPT
chr2_33987127_A_G_b38	RASGRP3	-3.352	0.00105	-0.089898	23	0.026823	no	BRNHPT
chr2_33999082_A_G_b38	RASGRP3	-3.337	0.0011	-0.08874	21	0.026589	no	BRNHPT
chr2_33473933_A_G_b38	RASGRP3	-3.332	0.00113	-0.10799	8	0.032413	no	BRNHPT
chr2_33998838_CT_C_b38	RASGRP3	-3.319	0.00118	-0.087685	22	0.026421	no	BRNHPT
chr2_33998840_T_A_b38	RASGRP3	-3.319	0.00118	-0.087685	22	0.026421	no	BRNHPT
chr2_33992512_A_G_b38	RASGRP3	-3.309	0.00121	-0.087336	21	0.026391	no	BRNHPT
chr2_33985703_A_G_b38	RASGRP3	-3.216	0.00164	-0.085971	22	0.026732	no	BRNHPT
chr2_33986026_C_T_b38	RASGRP3	-3.216	0.00164	-0.085971	22	0.026732	no	BRNHPT
chr2_33996303_GA_G_b38	RASGRP3	-3.138	0.00211	-0.080252	26	0.025573	no	BRNHPT
chr2_34012405_G_T_b38	RASGRP3	-3.131	0.00216	-0.101152	12	0.032311	no	BRNHPT
chr2_33453900_G_T_b38	RASGRP3	-3.124	0.0022	-0.124574	5	0.039878	no	BRNHPT
chr2_33469790_T_G_b38	RASGRP3	-3.111	0.0023	-0.107489	5	0.034553	no	BRNHPT
chr2_33470014_T_C_b38	RASGRP3	-3.111	0.0023	-0.107489	5	0.034553	no	BRNHPT
chr2_33472085_T_C_b38	RASGRP3	-3.111	0.0023	-0.107489	5	0.034553	no	BRNHPT
chr2_33798072_A_G_b38	RASGRP3	-3.103	0.00235	-0.102772	10	0.033116	no	BRNHPT
chr2_33798147_A_T_b38	RASGRP3	-3.103	0.00235	-0.102772	10	0.033116	no	BRNHPT
chr2_33473129_A_G_b38	RASGRP3	-3.101	0.00237	-0.106549	5	0.034363	no	BRNHPT
chr2_33987791_A_T_b38	RASGRP3	-3.096	0.00241	-0.082848	20	0.026762	no	BRNHPT
chr2_33982752_A_G_b38	RASGRP3	-3.064	0.00266	-0.082182	22	0.026826	no	BRNHPT
chr2_33997854_A_G_b38	RASGRP3	-3.053	0.00276	-0.087996	16	0.028827	no	BRNHPT
chr2_33445660_T_C_b38	RASGRP3	-3.02	0.00304	-0.111256	5	0.036835	no	BRNHPT
chr2_33469036_C_CA_b38	RASGRP3	3.001	0.00323	0.082221	29	0.0274	no	BRNHPT
chr2_33809477_A_AATTTTCTCCACTG_b38	RASGRP3	3.001	0.00323	0.088676	23	0.029551	no	BRNHPT
chr2_34363628_G_T_b38	RASGRP3	-2.94	0.00389	-0.097702	7	0.033228	no	BRNHPT
chr2_34364119_G_C_b38	RASGRP3	-2.94	0.00389	-0.097702	7	0.033228	no	BRNHPT
chr2_34364128_A_T_b38	RASGRP3	-2.94	0.00389	-0.097702	7	0.033228	no	BRNHPT
chr2_34364547_C_A_b38	RASGRP3	-2.94	0.00389	-0.097702	7	0.033228	no	BRNHPT
chr2_34364932_C_T_b38	RASGRP3	-2.94	0.00389	-0.097702	7	0.033228	no	BRNHPT
chr2_33993910_A_G_b38	RASGRP3	-2.937	0.00392	-0.078238	20	0.026635	no	BRNHPT
chr2_33979176_T_C_b38	RASGRP3	-2.913	0.00422	-0.077815	20	0.02671	no	BRNHPT
chr2_33799215_G_C_b38	RASGRP3	-2.886	0.00458	-0.09576	10	0.033185	no	BRNHPT
chr2_33464091_C_T_b38	RASGRP3	-2.884	0.0046	-0.107132	6	0.037147	no	BRNHPT
chr2_33801277_G_T_b38	RASGRP3	-2.875	0.00473	-0.085809	15	0.029847	no	BRNHPT
chr2_33973283_A_G_b38	RASGRP3	-2.87	0.0048	-0.082011	19	0.028577	no	BRNHPT
chr2_33988468_C_A_b38	RASGRP3	-2.868	0.00482	-0.0781	19	0.027228	no	BRNHPT
chr2_33989473_C_T_b38	RASGRP3	-2.868	0.00482	-0.0781	19	0.027228	no	BRNHPT
chr2_33469845_C_T_b38	RASGRP3	2.851	0.00508	0.077634	30	0.027234	no	BRNHPT
chr2_33470875_C_T_b38	RASGRP3	2.851	0.00508	0.077634	30	0.027234	no	BRNHPT
chr2_34362552_A_T_b38	RASGRP3	-2.845	0.00517	-0.09582	7	0.033683	no	BRNHPT
chr2_33798322_G_GGAGGCT_b38	RASGRP3	-2.837	0.00529	-0.085965	14	0.030301	no	BRNHPT
chr2_33798665_C_A_b38	RASGRP3	-2.837	0.00529	-0.085965	14	0.030301	no	BRNHPT
chr2_33800188_T_G_b38	RASGRP3	-2.828	0.00543	-0.094536	9	0.033427	no	BRNHPT
chr2_33988240_C_T_b38	RASGRP3	-2.798	0.00593	-0.074659	21	0.026682	no	BRNHPT
chr2_33303352_C_CT_b38	RASGRP3	-2.781	0.00622	-0.144074	3	0.051798	no	BRNHPT
chr2_33995047_A_G_b38	RASGRP3	-2.777	0.00631	-0.074368	20	0.026782	no	BRNHPT
chr2_33796087_C_G_b38	RASGRP3	-2.769	0.00645	-0.092934	10	0.033564	no	BRNHPT
chr2_33985982_AT_A_b38	RASGRP3	-2.759	0.00664	-0.091629	18	0.033212	no	BRNHPT
chr2_33793623_T_G_b38	RASGRP3	-2.749	0.00684	-0.092956	8	0.033817	no	BRNHPT
chr2_34006346_G_GGTGTGT_b38	RASGRP3	-2.738	0.00706	-0.103633	4	0.037855	no	BRNHPT
chr2_33987734_G_T_b38	RASGRP3	-2.729	0.00723	-0.073775	19	0.02703	no	BRNHPT
chr2_33989353_A_G_b38	RASGRP3	-2.729	0.00723	-0.073775	19	0.02703	no	BRNHPT
chr2_33470006_T_C_b38	RASGRP3	2.725	0.00731	0.073497	29	0.026968	no	BRNHPT
chr2_33470756_C_T_b38	RASGRP3	2.725	0.00731	0.073497	29	0.026968	no	BRNHPT
chr2_33473382_C_CA_b38	RASGRP3	-2.723	0.00738	-0.093701	5	0.034417	no	BRNHPT
chr2_33810399_G_T_b38	RASGRP3	2.704	0.00778	0.088889	6	0.032875	no	BRNHPT
chr2_33796780_C_CT_b38	RASGRP3	-2.701	0.00784	-0.078934	17	0.029222	no	BRNHPT
chr2_33470311_T_A_b38	RASGRP3	2.696	0.00795	0.073277	28	0.02718	no	BRNHPT
chr2_32674608_T_C_b38	RASGRP3	-2.683	0.00826	-0.098977	4	0.036896	no	BRNHPT
chr2_33470233_G_A_b38	RASGRP3	2.676	0.00842	0.072683	28	0.027162	no	BRNHPT
chr2_33470439_G_A_b38	RASGRP3	2.676	0.00842	0.072683	28	0.027162	no	BRNHPT
chr2_33800154_A_C_b38	RASGRP3	-2.663	0.00872	-0.090702	8	0.034056	no	BRNHPT
chr2_33975413_ATAGAGATATATCTCTATATTGATACATATG_A_b38	RASGRP3	-2.662	0.00877	-0.066822	29	0.025107	no	BRNHPT
chr2_33810749_C_T_b38	RASGRP3	2.656	0.00891	0.090649	6	0.034134	no	BRNHPT
chr2_33478490_C_T_b38	RASGRP3	2.648	0.0091	0.078795	24	0.029753	no	BRNHPT
chr2_33799313_C_A_b38	RASGRP3	-2.639	0.00934	-0.081064	13	0.030718	no	BRNHPT
chr2_32500606_GT_G_b38	RASGRP3	-2.621	0.00982	-0.092319	5	0.03522	no	BRNHPT
chr2_34094910_TTATA_T_b38	RASGRP3	2.615	0.01	0.08034	15	0.030727	no	BRNHPT
chr2_33985858_CA_C_b38	RASGRP3	3.336	0.00106	0.101074	4	0.030298	yes	BRNNCC
chr2_33550216_T_A_b38	RASGRP3	3.204	0.00163	0.107684	3	0.033606	yes	BRNNCC
chr2_33550484_C_G_b38	RASGRP3	3.204	0.00163	0.107684	3	0.033606	yes	BRNNCC
chr2_33554542_A_G_b38	RASGRP3	3.204	0.00163	0.107684	3	0.033606	yes	BRNNCC
chr2_33537192_G_GAT_b38	RASGRP3	3.169	0.00183	0.10207	3	0.032213	yes	BRNNCC
chr2_33537896_A_G_b38	RASGRP3	3.126	0.0021	0.097904	3	0.031321	yes	BRNNCC
chr2_33661923_CT_C_b38	RASGRP3	3.105	0.00225	0.066603	29	0.021453	yes	BRNNCC
chr2_34009275_T_G_b38	RASGRP3	-3.07	0.00251	-0.05938	46	0.019342	yes	BRNNCC
chr2_34009297_G_A_b38	RASGRP3	-3.07	0.00251	-0.05938	46	0.019342	yes	BRNNCC
chr2_33681193_TTA_T_b38	RASGRP3	3.066	0.00255	0.060485	24	0.019729	yes	BRNNCC
chr2_33761071_T_C_b38	RASGRP3	-2.992	0.00321	-0.051818	44	0.01732	yes	BRNNCC
chr2_34008740_G_A_b38	RASGRP3	-2.93	0.00388	-0.077351	6	0.026401	yes	BRNNCC
chr2_33559304_G_A_b38	RASGRP3	2.921	0.00399	0.092774	3	0.03176	yes	BRNNCC
chr2_33699999_T_C_b38	RASGRP3	-2.892	0.00436	-0.059601	20	0.020611	yes	BRNNCC
chr2_33537330_C_CCCAACACA_b38	RASGRP3	2.886	0.00444	0.078755	9	0.027292	yes	BRNNCC
chr2_33557635_G_A_b38	RASGRP3	2.865	0.00473	0.089856	3	0.031367	yes	BRNNCC
chr2_33559734_G_A_b38	RASGRP3	2.865	0.00473	0.089856	3	0.031367	yes	BRNNCC
chr2_33998628_G_A_b38	RASGRP3	-2.818	0.00544	-0.060596	20	0.021506	yes	BRNNCC
chr2_33631252_G_T_b38	RASGRP3	2.773	0.00621	0.05284	44	0.019054	yes	BRNNCC
chr2_33759434_C_G_b38	RASGRP3	-2.752	0.00661	-0.050901	52	0.018498	yes	BRNNCC
chr2_33974654_C_T_b38	RASGRP3	-2.699	0.00769	-0.057805	22	0.021416	yes	BRNNCC
chr2_33974782_G_A_b38	RASGRP3	-2.65	0.00885	-0.057203	21	0.021585	yes	BRNNCC
chr2_33974667_A_G_b38	RASGRP3	-2.648	0.0089	-0.056024	26	0.021157	yes	BRNNCC
chr2_34011443_T_TA_b38	RASGRP3	-2.642	0.00905	-0.052895	35	0.020018	yes	BRNNCC
chr2_33690999_C_T_b38	RASGRP3	-2.639	0.00914	-0.056463	11	0.021398	yes	BRNNCC
chr2_33387736_G_GTT_b38	RASGRP3	2.619	0.00966	0.069598	5	0.026575	yes	BRNNCC
chr2_33475871_A_C_b38	RASGRP3	-3.418	0.000798	-0.065573	24	0.019183	no	BRNNCC
chr2_33387736_G_GT_b38	RASGRP3	-3.353	0.000996	-0.069572	40	0.020748	no	BRNNCC
chr2_33688766_G_GTATTTATT_b38	RASGRP3	-3.247	0.00142	-0.069343	14	0.021357	no	BRNNCC
chr2_33695122_C_G_b38	RASGRP3	-3.105	0.00225	-0.06383	19	0.020556	no	BRNNCC
chr2_33679032_C_G_b38	RASGRP3	2.959	0.00355	0.056346	36	0.01904	no	BRNNCC
chr2_33692390_T_A_b38	RASGRP3	-2.935	0.00382	-0.060031	20	0.02045	no	BRNNCC
chr2_33673921_C_G_b38	RASGRP3	2.935	0.00383	0.056382	37	0.019212	no	BRNNCC
chr2_33676027_A_T_b38	RASGRP3	2.935	0.00383	0.056382	37	0.019212	no	BRNNCC
chr2_33653353_CATCT_C_b38	RASGRP3	-2.931	0.00387	-0.084838	3	0.028945	no	BRNNCC
chr2_32748689_C_CT_b38	RASGRP3	2.927	0.00392	0.088401	4	0.030207	no	BRNNCC
chr2_33783427_G_A_b38	RASGRP3	-2.876	0.00458	-0.057062	27	0.019843	no	BRNNCC
chr2_33783921_A_G_b38	RASGRP3	-2.876	0.00458	-0.057062	27	0.019843	no	BRNNCC
chr2_33785901_A_G_b38	RASGRP3	-2.876	0.00458	-0.057062	27	0.019843	no	BRNNCC
chr2_33764131_T_C_b38	RASGRP3	-2.873	0.00461	-0.058407	29	0.020327	no	BRNNCC
chr2_33766447_A_G_b38	RASGRP3	-2.873	0.00461	-0.058407	29	0.020327	no	BRNNCC
chr2_33410880_A_ATCTCCTTC_b38	RASGRP3	2.861	0.00479	0.056615	23	0.019791	no	BRNNCC
chr2_33682304_G_A_b38	RASGRP3	2.857	0.00484	0.050412	51	0.017646	no	BRNNCC
chr2_33765176_T_A_b38	RASGRP3	-2.856	0.00486	-0.058271	29	0.020403	no	BRNNCC
chr2_32909975_C_CT_b38	RASGRP3	2.848	0.00497	0.064545	10	0.022659	no	BRNNCC
chr2_33546942_C_G_b38	RASGRP3	2.848	0.00498	0.101791	3	0.035744	no	BRNNCC
chr2_33760824_A_AT_b38	RASGRP3	-2.846	0.005	-0.059347	17	0.020851	no	BRNNCC
chr2_33249323_T_TCACA_b38	RASGRP3	2.846	0.00501	0.07267	8	0.025535	no	BRNNCC
chr2_33775111_T_C_b38	RASGRP3	-2.827	0.0053	-0.056482	27	0.01998	no	BRNNCC
chr2_33780594_T_C_b38	RASGRP3	-2.827	0.0053	-0.056482	27	0.01998	no	BRNNCC
chr2_33780926_A_T_b38	RASGRP3	-2.827	0.0053	-0.056482	27	0.01998	no	BRNNCC
chr2_33781101_C_T_b38	RASGRP3	-2.827	0.0053	-0.056482	27	0.01998	no	BRNNCC
chr2_33782026_C_T_b38	RASGRP3	-2.827	0.0053	-0.056482	27	0.01998	no	BRNNCC
chr2_33556443_T_A_b38	RASGRP3	2.82	0.00541	0.056472	21	0.020027	no	BRNNCC
chr2_34365865_G_A_b38	RASGRP3	-2.791	0.00589	-0.064739	13	0.023193	no	BRNNCC
chr2_33519413_A_G_b38	RASGRP3	2.767	0.00632	0.057284	16	0.020701	no	BRNNCC
chr2_34163298_T_TTCTCTC_b38	RASGRP3	2.757	0.0065	0.058094	18	0.021068	no	BRNNCC
chr2_33781164_CT_C_b38	RASGRP3	-2.749	0.00666	-0.055246	26	0.020096	no	BRNNCC
chr2_33757331_AT_A_b38	RASGRP3	-2.742	0.0068	-0.067145	19	0.024488	no	BRNNCC
chr2_32446738_G_GTTTT_b38	RASGRP3	2.738	0.00689	0.12781	3	0.046687	no	BRNNCC
chr2_33767220_GAA_G_b38	RASGRP3	-2.735	0.00695	-0.056502	28	0.020662	no	BRNNCC
chr2_33768405_T_A_b38	RASGRP3	-2.728	0.00708	-0.055331	29	0.020283	no	BRNNCC
chr2_33768709_T_C_b38	RASGRP3	-2.728	0.00708	-0.055331	29	0.020283	no	BRNNCC
chr2_33770643_T_C_b38	RASGRP3	-2.723	0.00719	-0.055818	30	0.0205	no	BRNNCC
chr2_33770662_T_C_b38	RASGRP3	-2.723	0.00719	-0.055818	30	0.0205	no	BRNNCC
chr2_33765693_G_A_b38	RASGRP3	-2.719	0.00727	-0.054723	29	0.020128	no	BRNNCC
chr2_33762650_T_A_b38	RASGRP3	-2.717	0.0073	-0.055447	29	0.020406	no	BRNNCC
chr2_33763276_A_C_b38	RASGRP3	-2.717	0.0073	-0.055447	29	0.020406	no	BRNNCC
chr2_33763677_T_C_b38	RASGRP3	-2.717	0.0073	-0.055447	29	0.020406	no	BRNNCC
chr2_33769074_A_G_b38	RASGRP3	-2.717	0.0073	-0.055447	29	0.020406	no	BRNNCC
chr2_33765389_GT_G_b38	RASGRP3	-2.702	0.00764	-0.054635	29	0.020222	no	BRNNCC
chr2_33762557_G_C_b38	RASGRP3	-2.693	0.00782	-0.05559	29	0.020639	no	BRNNCC
chr2_33762665_A_G_b38	RASGRP3	-2.693	0.00782	-0.05559	29	0.020639	no	BRNNCC
chr2_33763206_C_T_b38	RASGRP3	-2.693	0.00782	-0.05559	29	0.020639	no	BRNNCC
chr2_33765535_C_T_b38	RASGRP3	-2.693	0.00782	-0.05559	29	0.020639	no	BRNNCC
chr2_33765637_C_G_b38	RASGRP3	-2.693	0.00782	-0.05559	29	0.020639	no	BRNNCC
chr2_33765648_T_C_b38	RASGRP3	-2.693	0.00782	-0.05559	29	0.020639	no	BRNNCC
chr2_33765984_G_C_b38	RASGRP3	-2.693	0.00782	-0.05559	29	0.020639	no	BRNNCC
chr2_33766277_T_C_b38	RASGRP3	-2.693	0.00782	-0.05559	29	0.020639	no	BRNNCC
chr2_33766488_G_A_b38	RASGRP3	-2.693	0.00782	-0.05559	29	0.020639	no	BRNNCC
chr2_33766502_A_C_b38	RASGRP3	-2.693	0.00782	-0.05559	29	0.020639	no	BRNNCC
chr2_33766946_G_A_b38	RASGRP3	-2.693	0.00782	-0.05559	29	0.020639	no	BRNNCC
chr2_33767410_A_C_b38	RASGRP3	-2.693	0.00782	-0.05559	29	0.020639	no	BRNNCC
chr2_33767897_C_T_b38	RASGRP3	-2.693	0.00782	-0.05559	29	0.020639	no	BRNNCC
chr2_33768109_G_C_b38	RASGRP3	-2.693	0.00782	-0.05559	29	0.020639	no	BRNNCC
chr2_33769285_C_A_b38	RASGRP3	-2.693	0.00782	-0.05559	29	0.020639	no	BRNNCC
chr2_33775324_C_A_b38	RASGRP3	-2.68	0.00813	-0.054336	27	0.020275	no	BRNNCC
chr2_33775428_A_C_b38	RASGRP3	-2.68	0.00813	-0.054336	27	0.020275	no	BRNNCC
chr2_33775623_A_C_b38	RASGRP3	-2.68	0.00813	-0.054336	27	0.020275	no	BRNNCC
chr2_33775691_A_G_b38	RASGRP3	-2.68	0.00813	-0.054336	27	0.020275	no	BRNNCC
chr2_33775781_G_C_b38	RASGRP3	-2.68	0.00813	-0.054336	27	0.020275	no	BRNNCC
chr2_33775988_T_C_b38	RASGRP3	-2.68	0.00813	-0.054336	27	0.020275	no	BRNNCC
chr2_33776166_C_G_b38	RASGRP3	-2.68	0.00813	-0.054336	27	0.020275	no	BRNNCC
chr2_33776322_C_T_b38	RASGRP3	-2.68	0.00813	-0.054336	27	0.020275	no	BRNNCC
chr2_33776331_G_A_b38	RASGRP3	-2.68	0.00813	-0.054336	27	0.020275	no	BRNNCC
chr2_33776335_A_G_b38	RASGRP3	-2.68	0.00813	-0.054336	27	0.020275	no	BRNNCC
chr2_33776502_G_A_b38	RASGRP3	-2.68	0.00813	-0.054336	27	0.020275	no	BRNNCC
chr2_33776504_G_A_b38	RASGRP3	-2.68	0.00813	-0.054336	27	0.020275	no	BRNNCC
chr2_33776745_G_C_b38	RASGRP3	-2.68	0.00813	-0.054336	27	0.020275	no	BRNNCC
chr2_33776762_A_G_b38	RASGRP3	-2.68	0.00813	-0.054336	27	0.020275	no	BRNNCC
chr2_33776840_G_T_b38	RASGRP3	-2.68	0.00813	-0.054336	27	0.020275	no	BRNNCC
chr2_33776900_G_T_b38	RASGRP3	-2.68	0.00813	-0.054336	27	0.020275	no	BRNNCC
chr2_33777030_G_T_b38	RASGRP3	-2.68	0.00813	-0.054336	27	0.020275	no	BRNNCC
chr2_33777354_G_A_b38	RASGRP3	-2.68	0.00813	-0.054336	27	0.020275	no	BRNNCC
chr2_33548381_A_AAAAAG_b38	RASGRP3	2.67	0.00837	0.093503	3	0.035026	no	BRNNCC
chr2_33141037_G_A_b38	RASGRP3	2.663	0.00853	0.053201	30	0.019978	no	BRNNCC
chr2_33550119_G_T_b38	RASGRP3	2.661	0.00858	0.071332	4	0.026805	no	BRNNCC
chr2_33553788_G_A_b38	RASGRP3	2.661	0.00858	0.071332	4	0.026805	no	BRNNCC
chr2_33556856_G_C_b38	RASGRP3	2.661	0.00858	0.071332	4	0.026805	no	BRNNCC
chr2_33561322_C_T_b38	RASGRP3	2.661	0.00858	0.071332	4	0.026805	no	BRNNCC
chr2_33688598_G_A_b38	RASGRP3	2.651	0.00883	0.049337	51	0.018612	no	BRNNCC
chr2_33689050_A_T_b38	RASGRP3	2.651	0.00883	0.049337	51	0.018612	no	BRNNCC
chr2_33549383_C_T_b38	RASGRP3	2.641	0.00909	0.070766	4	0.026798	no	BRNNCC
chr2_33550598_T_G_b38	RASGRP3	2.641	0.00909	0.070766	4	0.026798	no	BRNNCC
chr2_33545200_T_C_b38	RASGRP3	2.633	0.00928	0.069785	4	0.026503	no	BRNNCC
chr2_33679620_T_A_b38	RASGRP3	2.632	0.00931	0.049095	46	0.018653	no	BRNNCC
chr2_33775171_C_A_b38	RASGRP3	-2.63	0.00936	-0.052984	28	0.020143	no	BRNNCC
chr2_33776371_C_T_b38	RASGRP3	-2.63	0.00936	-0.052984	28	0.020143	no	BRNNCC
chr2_33777965_T_G_b38	RASGRP3	-2.63	0.00936	-0.052984	28	0.020143	no	BRNNCC
chr2_34133736_C_T_b38	RASGRP3	2.629	0.00938	0.074153	4	0.028202	no	BRNNCC
chr2_33690016_C_G_b38	RASGRP3	2.629	0.00939	0.049041	51	0.018654	no	BRNNCC
chr2_33277760_CCTTT_C_b38	RASGRP3	2.617	0.00971	0.089568	5	0.034224	no	BRNNCC
chr2_33749306_C_G_b38	RASGRP3	2.616	0.00973	0.056683	14	0.021664	no	BRNNCC
chr2_33764495_G_A_b38	RASGRP3	-2.615	0.00978	-0.052319	29	0.02001	no	BRNNCC
chr2_33375242_G_C_b38	RASGRP3	2.608	0.00996	0.055804	24	0.021396	no	BRNNCC
chr2_33990535_C_CT_b38	RASGRP3	3.641	0.000392	0.09204	8	0.025281	yes	BRNPTM
chr2_32659355_C_CTT_b38	RASGRP3	3.398	0.000902	0.146354	3	0.043065	yes	BRNPTM
chr2_33820242_C_CTTTCTTTT_b38	RASGRP3	3.16	0.00197	0.086627	12	0.027413	yes	BRNPTM
chr2_33475871_A_C_b38	RASGRP3	-3.153	0.00201	-0.067265	18	0.021334	yes	BRNPTM
chr2_32980483_G_A_b38	RASGRP3	-3.114	0.00228	-0.085047	3	0.027315	yes	BRNPTM
chr2_33554839_T_C_b38	RASGRP3	3.03	0.00296	0.060457	21	0.019955	yes	BRNPTM
chr2_33996758_C_CA_b38	RASGRP3	-3.025	0.003	-0.065541	38	0.021666	yes	BRNPTM
chr2_33477419_C_G_b38	RASGRP3	-2.921	0.00412	-0.073276	6	0.025086	yes	BRNPTM
chr2_33968914_A_C_b38	RASGRP3	2.877	0.00469	0.07332	9	0.025482	yes	BRNPTM
chr2_33976528_G_T_b38	RASGRP3	2.877	0.00469	0.07332	9	0.025482	yes	BRNPTM
chr2_33968698_A_G_b38	RASGRP3	2.877	0.0047	0.072507	9	0.025203	yes	BRNPTM
chr2_33971819_A_G_b38	RASGRP3	2.877	0.0047	0.072507	9	0.025203	yes	BRNPTM
chr2_33972070_A_G_b38	RASGRP3	2.877	0.0047	0.072507	9	0.025203	yes	BRNPTM
chr2_33972444_T_G_b38	RASGRP3	2.877	0.0047	0.072507	9	0.025203	yes	BRNPTM
chr2_33976304_A_T_b38	RASGRP3	2.877	0.0047	0.072507	9	0.025203	yes	BRNPTM
chr2_33975876_G_A_b38	RASGRP3	-2.876	0.00472	-0.062518	38	0.02174	yes	BRNPTM
chr2_33983653_G_A_b38	RASGRP3	-2.876	0.00472	-0.062518	38	0.02174	yes	BRNPTM
chr2_33983742_G_A_b38	RASGRP3	-2.876	0.00472	-0.062518	38	0.02174	yes	BRNPTM
chr2_33984611_T_C_b38	RASGRP3	-2.876	0.00472	-0.062518	38	0.02174	yes	BRNPTM
chr2_33986100_G_A_b38	RASGRP3	-2.876	0.00472	-0.062518	38	0.02174	yes	BRNPTM
chr2_32956808_C_T_b38	RASGRP3	-2.711	0.00762	-0.06384	16	0.023549	yes	BRNPTM
chr2_33990920_C_T_b38	RASGRP3	2.702	0.00781	0.06637	10	0.02456	yes	BRNPTM
chr2_33984472_G_GTT_b38	RASGRP3	2.702	0.00782	0.067598	8	0.025019	yes	BRNPTM
chr2_33967558_C_T_b38	RASGRP3	2.687	0.00817	0.068564	9	0.025521	yes	BRNPTM
chr2_32953590_A_G_b38	RASGRP3	-2.661	0.00877	-0.07511	3	0.028223	yes	BRNPTM
chr2_33476930_C_CG_b38	RASGRP3	2.659	0.00882	0.057017	36	0.02144	yes	BRNPTM
chr2_33477035_T_G_b38	RASGRP3	2.659	0.00882	0.057017	36	0.02144	yes	BRNPTM
chr2_33477050_G_GA_b38	RASGRP3	2.659	0.00882	0.057017	36	0.02144	yes	BRNPTM
chr2_32969228_T_TG_b38	RASGRP3	-2.652	0.009	-0.071357	3	0.026907	yes	BRNPTM
chr2_34086500_C_CA_b38	RASGRP3	-2.638	0.00936	-0.058466	19	0.022162	yes	BRNPTM
chr2_34009275_T_G_b38	RASGRP3	-4.328	2.99e-05	-0.093575	36	0.021619	no	BRNPTM
chr2_34009297_G_A_b38	RASGRP3	-4.328	2.99e-05	-0.093575	36	0.021619	no	BRNPTM
chr2_33973181_TAA_T_b38	RASGRP3	4.264	3.85e-05	0.087636	23	0.020552	no	BRNPTM
chr2_33967489_A_G_b38	RASGRP3	4.196	5.01e-05	0.087077	21	0.02075	no	BRNPTM
chr2_33965548_C_G_b38	RASGRP3	4.083	7.76e-05	0.084862	21	0.020786	no	BRNPTM
chr2_34011443_T_TA_b38	RASGRP3	-4.025	9.67e-05	-0.089344	26	0.0222	no	BRNPTM
chr2_33966164_T_A_b38	RASGRP3	3.965	0.000121	0.083684	20	0.021104	no	BRNPTM
chr2_33977055_C_T_b38	RASGRP3	3.516	0.000606	0.092206	8	0.026227	no	BRNPTM
chr2_33548381_A_AAAAAG_b38	RASGRP3	3.504	0.000631	0.121811	3	0.034767	no	BRNPTM
chr2_33985858_CA_C_b38	RASGRP3	3.472	0.000703	0.111416	3	0.032087	no	BRNPTM
chr2_34008740_G_A_b38	RASGRP3	-3.365	0.00101	-0.089179	6	0.0265	no	BRNPTM
chr2_33974654_C_T_b38	RASGRP3	-3.291	0.00129	-0.071281	19	0.021656	no	BRNPTM
chr2_33974667_A_G_b38	RASGRP3	-3.12	0.00223	-0.068291	24	0.021888	no	BRNPTM
chr2_34003824_A_G_b38	RASGRP3	-3.07	0.00261	-0.067539	35	0.021999	no	BRNPTM
chr2_33974782_G_A_b38	RASGRP3	-3.067	0.00264	-0.067743	18	0.022088	no	BRNPTM
chr2_32898659_T_C_b38	RASGRP3	3.019	0.00306	0.074208	6	0.024581	no	BRNPTM
chr2_33968631_T_C_b38	RASGRP3	-2.976	0.00349	-0.065334	18	0.021952	no	BRNPTM
chr2_33476343_C_T_b38	RASGRP3	-2.962	0.00364	-0.062298	27	0.021034	no	BRNPTM
chr2_32885302_C_G_b38	RASGRP3	2.852	0.00506	0.070505	5	0.024719	no	BRNPTM
chr2_32885970_G_C_b38	RASGRP3	2.852	0.00506	0.070505	5	0.024719	no	BRNPTM
chr2_32886723_G_A_b38	RASGRP3	2.852	0.00506	0.070505	5	0.024719	no	BRNPTM
chr2_32886786_G_A_b38	RASGRP3	2.852	0.00506	0.070505	5	0.024719	no	BRNPTM
chr2_32889792_T_C_b38	RASGRP3	2.852	0.00506	0.070505	5	0.024719	no	BRNPTM
chr2_32891602_A_AAAAATT_b38	RASGRP3	2.852	0.00506	0.070505	5	0.024719	no	BRNPTM
chr2_32891829_A_G_b38	RASGRP3	2.852	0.00506	0.070505	5	0.024719	no	BRNPTM
chr2_32895706_G_A_b38	RASGRP3	2.852	0.00506	0.070505	5	0.024719	no	BRNPTM
chr2_32896427_T_C_b38	RASGRP3	2.852	0.00506	0.070505	5	0.024719	no	BRNPTM
chr2_32897642_T_G_b38	RASGRP3	2.852	0.00506	0.070505	5	0.024719	no	BRNPTM
chr2_32883653_C_A_b38	RASGRP3	2.844	0.00519	0.070564	5	0.024816	no	BRNPTM
chr2_32892657_T_G_b38	RASGRP3	2.844	0.00519	0.070564	5	0.024816	no	BRNPTM
chr2_32893131_G_T_b38	RASGRP3	2.844	0.00519	0.070564	5	0.024816	no	BRNPTM
chr2_32880300_G_T_b38	RASGRP3	2.812	0.00569	0.072279	4	0.025704	no	BRNPTM
chr2_33511010_G_A_b38	RASGRP3	2.8	0.0059	0.096142	4	0.034341	no	BRNPTM
chr2_32889595_C_A_b38	RASGRP3	2.793	0.00602	0.069181	5	0.024771	no	BRNPTM
chr2_33980676_T_A_b38	RASGRP3	2.79	0.00606	0.05589	23	0.02003	no	BRNPTM
chr2_32878601_A_G_b38	RASGRP3	2.776	0.00632	0.069386	5	0.024995	no	BRNPTM
chr2_32879000_G_A_b38	RASGRP3	2.776	0.00632	0.069386	5	0.024995	no	BRNPTM
chr2_32881183_G_A_b38	RASGRP3	2.776	0.00632	0.069386	5	0.024995	no	BRNPTM
chr2_32881692_A_G_b38	RASGRP3	2.776	0.00632	0.069386	5	0.024995	no	BRNPTM
chr2_32882192_T_C_b38	RASGRP3	2.776	0.00632	0.069386	5	0.024995	no	BRNPTM
chr2_33998628_G_A_b38	RASGRP3	-2.772	0.0064	-0.061325	17	0.022125	no	BRNPTM
chr2_33966151_A_T_b38	RASGRP3	2.738	0.00706	0.090072	3	0.0329	no	BRNPTM
chr2_33474404_G_A_b38	RASGRP3	2.735	0.00711	0.056275	28	0.020572	no	BRNPTM
chr2_33463592_C_CT_b38	RASGRP3	-2.672	0.00852	-0.090588	4	0.033906	no	BRNPTM
chr2_33965467_T_C_b38	RASGRP3	2.657	0.00888	0.087589	3	0.032964	no	BRNPTM
chr2_32911911_C_CATCT_b38	RASGRP3	3.247	0.00159	0.106692	10	0.032862	yes	BRNSPC
chr2_33471202_GT_G_b38	RASGRP3	-3.144	0.00219	-0.145144	3	0.046161	yes	BRNSPC
chr2_33469110_G_C_b38	RASGRP3	-3.078	0.00269	-0.141606	3	0.046002	yes	BRNSPC
chr2_33472507_G_C_b38	RASGRP3	-3.078	0.00269	-0.141606	3	0.046002	yes	BRNSPC
chr2_34131222_T_C_b38	RASGRP3	-3.003	0.00338	-0.099184	25	0.033029	yes	BRNSPC
chr2_33469706_C_T_b38	RASGRP3	2.971	0.00372	0.096248	22	0.032396	yes	BRNSPC
chr2_33470357_T_C_b38	RASGRP3	2.949	0.00397	0.095641	23	0.032433	yes	BRNSPC
chr2_33470734_A_G_b38	RASGRP3	2.949	0.00397	0.095641	23	0.032433	yes	BRNSPC
chr2_33471307_G_GTAGGACTA_b38	RASGRP3	2.938	0.0041	0.0942	23	0.032063	yes	BRNSPC
chr2_33474954_T_C_b38	RASGRP3	2.923	0.00428	0.089534	29	0.030627	yes	BRNSPC
chr2_33464471_C_CT_b38	RASGRP3	2.879	0.00489	0.093007	16	0.03231	yes	BRNSPC
chr2_34057950_A_G_b38	RASGRP3	2.833	0.00557	0.119785	5	0.042275	yes	BRNSPC
chr2_34132989_T_C_b38	RASGRP3	2.722	0.00766	0.086728	18	0.031861	yes	BRNSPC
chr2_33476758_C_CGTGCGTGTGT_b38	RASGRP3	2.683	0.00854	0.121576	3	0.045313	yes	BRNSPC
chr2_33477612_G_T_b38	RASGRP3	2.66	0.0091	0.082901	27	0.031163	yes	BRNSPC
chr2_33656848_TA_T_b38	RASGRP3	2.66	0.00911	0.108788	6	0.0409	yes	BRNSPC
chr2_34116503_C_A_b38	RASGRP3	-2.627	0.00998	-0.086226	17	0.032828	yes	BRNSPC
chr2_33463361_G_A_b38	RASGRP3	-3.416	0.00092	-0.16368	3	0.047916	no	BRNSPC
chr2_33726232_C_CTTT_b38	RASGRP3	3.206	0.00181	0.11333	15	0.035349	no	BRNSPC
chr2_34251131_CTCTCTT_C_b38	RASGRP3	-3.202	0.00183	-0.14169	3	0.04425	no	BRNSPC
chr2_34133342_T_C_b38	RASGRP3	2.988	0.00354	0.09212	20	0.030832	no	BRNSPC
chr2_33473331_C_T_b38	RASGRP3	-2.975	0.00368	-0.143237	3	0.04815	no	BRNSPC
chr2_33473877_C_T_b38	RASGRP3	-2.964	0.00379	-0.100389	13	0.033864	no	BRNSPC
chr2_33586869_A_T_b38	RASGRP3	2.958	0.00387	0.127466	4	0.043097	no	BRNSPC
chr2_33443785_T_C_b38	RASGRP3	-2.803	0.00608	-0.14765	3	0.052672	no	BRNSPC
chr2_33444840_G_A_b38	RASGRP3	-2.803	0.00608	-0.14765	3	0.052672	no	BRNSPC
chr2_33446881_C_G_b38	RASGRP3	-2.803	0.00608	-0.14765	3	0.052672	no	BRNSPC
chr2_34218931_T_C_b38	RASGRP3	2.772	0.00665	0.135216	3	0.048781	no	BRNSPC
chr2_33781569_A_AGT_b38	RASGRP3	-2.726	0.00756	-0.110372	3	0.040482	no	BRNSPC
chr2_32653593_C_CA_b38	RASGRP3	2.701	0.00813	0.106811	7	0.039551	no	BRNSPC
chr2_34128501_T_C_b38	RASGRP3	-2.63	0.00989	-0.087221	17	0.033163	no	BRNSPC
chr2_32856517_G_A_b38	RASGRP3	3.888	0.000196	0.128252	22	0.032986	yes	BRNSNG
chr2_32691790_A_G_b38	RASGRP3	3.855	0.00022	0.146483	6	0.038001	yes	BRNSNG
chr2_32889051_A_C_b38	RASGRP3	3.517	0.000693	0.147916	4	0.042058	yes	BRNSNG
chr2_32889386_T_C_b38	RASGRP3	3.517	0.000693	0.147916	4	0.042058	yes	BRNSNG
chr2_32879311_A_G_b38	RASGRP3	3.468	0.000813	0.153287	3	0.044195	yes	BRNSNG
chr2_32880467_T_C_b38	RASGRP3	3.468	0.000813	0.153287	3	0.044195	yes	BRNSNG
chr2_32882205_C_T_b38	RASGRP3	3.451	0.00086	0.153411	3	0.044451	yes	BRNSNG
chr2_32882722_T_C_b38	RASGRP3	3.451	0.00086	0.153411	3	0.044451	yes	BRNSNG
chr2_32836541_C_CT_b38	RASGRP3	3.263	0.00157	0.123038	4	0.03771	yes	BRNSNG
chr2_33119166_A_ATTT_b38	RASGRP3	3.259	0.00159	0.130521	3	0.040045	yes	BRNSNG
chr2_32892808_T_C_b38	RASGRP3	3.256	0.0016	0.136927	4	0.042049	yes	BRNSNG
chr2_33241988_G_C_b38	RASGRP3	-3.252	0.00163	-0.109857	12	0.033785	yes	BRNSNG
chr2_32887622_C_T_b38	RASGRP3	3.198	0.00192	0.104141	14	0.032564	yes	BRNSNG
chr2_32898634_C_T_b38	RASGRP3	3.198	0.00192	0.104141	14	0.032564	yes	BRNSNG
chr2_32889468_A_T_b38	RASGRP3	3.132	0.00236	0.114589	6	0.036587	yes	BRNSNG
chr2_33111242_C_T_b38	RASGRP3	3.129	0.00238	0.117613	6	0.03759	yes	BRNSNG
chr2_34112153_C_A_b38	RASGRP3	-3.1	0.0026	-0.106258	18	0.03428	yes	BRNSNG
chr2_32844987_C_T_b38	RASGRP3	3.086	0.00272	0.120282	5	0.038982	yes	BRNSNG
chr2_33678193_G_A_b38	RASGRP3	3.068	0.00286	0.101358	14	0.033036	yes	BRNSNG
chr2_34018604_GT_G_b38	RASGRP3	3.049	0.00303	0.100399	14	0.032927	yes	BRNSNG
chr2_33121432_T_G_b38	RASGRP3	3.027	0.00324	0.107752	8	0.035601	yes	BRNSNG
chr2_33119848_C_T_b38	RASGRP3	2.992	0.0036	0.109508	7	0.0366	yes	BRNSNG
chr2_34073432_A_G_b38	RASGRP3	2.99	0.00361	0.194262	4	0.064965	yes	BRNSNG
chr2_33120252_C_T_b38	RASGRP3	2.975	0.00378	0.110881	7	0.037267	yes	BRNSNG
chr2_33473382_C_CA_b38	RASGRP3	-2.961	0.00395	-0.120111	4	0.040571	yes	BRNSNG
chr2_33121269_G_GT_b38	RASGRP3	2.953	0.00403	0.106506	8	0.036064	yes	BRNSNG
chr2_34018087_C_T_b38	RASGRP3	2.943	0.00416	0.097514	14	0.033134	yes	BRNSNG
chr2_33115105_TACAC_T_b38	RASGRP3	2.932	0.00429	0.086214	31	0.029406	yes	BRNSNG
chr2_33676624_C_T_b38	RASGRP3	2.913	0.00454	0.094891	16	0.032579	yes	BRNSNG
chr2_34033831_A_C_b38	RASGRP3	2.889	0.00486	0.097979	16	0.033909	yes	BRNSNG
chr2_33470380_ATT_A_b38	RASGRP3	2.872	0.00512	0.112862	12	0.039303	yes	BRNSNG
chr2_33120320_T_C_b38	RASGRP3	2.848	0.00548	0.1034	8	0.036307	yes	BRNSNG
chr2_34031668_T_C_b38	RASGRP3	2.833	0.00571	0.097019	16	0.034241	yes	BRNSNG
chr2_32754147_CT_C_b38	RASGRP3	2.811	0.00609	0.119415	4	0.04248	yes	BRNSNG
chr2_34081725_ATGTGTGTGTG_A_b38	RASGRP3	2.798	0.00632	0.186107	3	0.066516	yes	BRNSNG
chr2_33254549_G_GTT_b38	RASGRP3	2.791	0.00645	0.105011	15	0.037627	yes	BRNSNG
chr2_33112067_C_T_b38	RASGRP3	2.746	0.00731	0.100235	9	0.0365	yes	BRNSNG
chr2_34020438_G_A_b38	RASGRP3	2.742	0.00741	0.092298	13	0.033667	yes	BRNSNG
chr2_34113474_C_A_b38	RASGRP3	-2.716	0.00796	-0.089147	17	0.032826	yes	BRNSNG
chr2_32741667_A_AAACAAC_b38	RASGRP3	2.702	0.00826	0.114898	4	0.042516	yes	BRNSNG
chr2_32599326_TA_T_b38	RASGRP3	-2.673	0.00895	-0.119992	3	0.044883	yes	BRNSNG
chr2_34022503_A_G_b38	RASGRP3	2.668	0.00908	0.093652	9	0.035099	yes	BRNSNG
chr2_33457670_G_T_b38	RASGRP3	2.665	0.00916	0.0859	16	0.032233	yes	BRNSNG
chr2_34015557_G_A_b38	RASGRP3	2.654	0.00943	0.089208	10	0.033607	yes	BRNSNG
chr2_34016288_C_T_b38	RASGRP3	2.654	0.00943	0.089208	10	0.033607	yes	BRNSNG
chr2_33121226_G_T_b38	RASGRP3	2.649	0.00957	0.09465	8	0.03573	yes	BRNSNG
chr2_34014417_T_C_b38	RASGRP3	-2.639	0.00982	-0.088171	18	0.033406	yes	BRNSNG
chr2_34014531_T_C_b38	RASGRP3	-2.639	0.00982	-0.088171	18	0.033406	yes	BRNSNG
chr2_32548315_CT_C_b38	RASGRP3	-2.638	0.00985	-0.103345	12	0.03917	yes	BRNSNG
chr2_32844977_TA_T_b38	RASGRP3	4.352	3.62e-05	0.15685	6	0.03604	no	BRNSNG
chr2_32731442_C_A_b38	RASGRP3	4.053	0.000109	0.157277	5	0.038803	no	BRNSNG
chr2_32809487_T_C_b38	RASGRP3	3.993	0.000135	0.122848	15	0.030766	no	BRNSNG
chr2_32810369_T_C_b38	RASGRP3	3.993	0.000135	0.122848	15	0.030766	no	BRNSNG
chr2_32847064_C_T_b38	RASGRP3	3.937	0.000165	0.134518	11	0.034168	no	BRNSNG
chr2_32812177_C_G_b38	RASGRP3	3.911	0.00018	0.139582	5	0.035685	no	BRNSNG
chr2_33449783_A_C_b38	RASGRP3	-3.911	0.00018	-0.141756	6	0.036243	no	BRNSNG
chr2_32808723_C_G_b38	RASGRP3	3.889	0.000195	0.143811	4	0.036981	no	BRNSNG
chr2_32808012_C_CA_b38	RASGRP3	3.837	0.000234	0.117971	15	0.030747	no	BRNSNG
chr2_32777672_T_G_b38	RASGRP3	3.824	0.000245	0.120235	20	0.031446	no	BRNSNG
chr2_32788373_T_A_b38	RASGRP3	3.824	0.000245	0.120235	20	0.031446	no	BRNSNG
chr2_32788755_A_G_b38	RASGRP3	3.824	0.000245	0.120235	20	0.031446	no	BRNSNG
chr2_32785937_A_AGT_b38	RASGRP3	3.822	0.000247	0.120149	20	0.03144	no	BRNSNG
chr2_32723556_A_G_b38	RASGRP3	3.816	0.000252	0.15554	4	0.040762	no	BRNSNG
chr2_32791294_G_C_b38	RASGRP3	3.795	0.000271	0.118445	20	0.031211	no	BRNSNG
chr2_32726745_T_A_b38	RASGRP3	3.783	0.000282	0.154071	4	0.040729	no	BRNSNG
chr2_32845705_G_A_b38	RASGRP3	3.773	0.000292	0.12679	23	0.033605	no	BRNSNG
chr2_32847072_A_G_b38	RASGRP3	3.773	0.000292	0.12679	23	0.033605	no	BRNSNG
chr2_32849432_A_G_b38	RASGRP3	3.773	0.000292	0.12679	23	0.033605	no	BRNSNG
chr2_32852603_G_A_b38	RASGRP3	3.773	0.000292	0.12679	23	0.033605	no	BRNSNG
chr2_32855606_T_C_b38	RASGRP3	3.773	0.000292	0.12679	23	0.033605	no	BRNSNG
chr2_32858582_G_T_b38	RASGRP3	3.773	0.000292	0.12679	23	0.033605	no	BRNSNG
chr2_32858751_C_T_b38	RASGRP3	3.773	0.000292	0.12679	23	0.033605	no	BRNSNG
chr2_32859971_C_T_b38	RASGRP3	3.773	0.000292	0.12679	23	0.033605	no	BRNSNG
chr2_32812092_T_C_b38	RASGRP3	3.735	0.000333	0.117464	14	0.031451	no	BRNSNG
chr2_32811257_G_A_b38	RASGRP3	3.725	0.000345	0.117442	14	0.031532	no	BRNSNG
chr2_32790279_T_G_b38	RASGRP3	3.717	0.000354	0.115536	15	0.031083	no	BRNSNG
chr2_32729533_AG_A_b38	RASGRP3	3.669	0.000417	0.15179	4	0.041376	no	BRNSNG
chr2_32729535_G_T_b38	RASGRP3	3.669	0.000417	0.15179	4	0.041376	no	BRNSNG
chr2_32729538_A_ATATT_b38	RASGRP3	3.669	0.000417	0.15179	4	0.041376	no	BRNSNG
chr2_32838794_G_T_b38	RASGRP3	3.666	0.000421	0.135393	6	0.036935	no	BRNSNG
chr2_32848086_C_T_b38	RASGRP3	3.656	0.000436	0.136852	5	0.037433	no	BRNSNG
chr2_32881258_A_C_b38	RASGRP3	3.655	0.000437	0.110789	20	0.030315	no	BRNSNG
chr2_32882944_C_A_b38	RASGRP3	3.655	0.000437	0.110789	20	0.030315	no	BRNSNG
chr2_32862358_G_C_b38	RASGRP3	3.653	0.000439	0.137466	5	0.037629	no	BRNSNG
chr2_32799786_G_A_b38	RASGRP3	3.649	0.000446	0.124394	8	0.034091	no	BRNSNG
chr2_32692898_C_T_b38	RASGRP3	3.62	0.000492	0.149155	4	0.041203	no	BRNSNG
chr2_32728273_T_A_b38	RASGRP3	3.617	0.000497	0.148891	4	0.041166	no	BRNSNG
chr2_32770756_A_G_b38	RASGRP3	3.588	0.000548	0.145025	5	0.040423	no	BRNSNG
chr2_32791745_T_C_b38	RASGRP3	3.569	0.000582	0.111804	19	0.031323	no	BRNSNG
chr2_32858708_C_T_b38	RASGRP3	3.569	0.000583	0.13146	6	0.036837	no	BRNSNG
chr2_32875798_T_C_b38	RASGRP3	3.567	0.000587	0.115909	23	0.032494	no	BRNSNG
chr2_32830343_A_G_b38	RASGRP3	3.562	0.000597	0.139805	5	0.03925	no	BRNSNG
chr2_32842932_C_A_b38	RASGRP3	3.554	0.000612	0.134708	5	0.0379	no	BRNSNG
chr2_32795635_T_C_b38	RASGRP3	3.543	0.000636	0.107701	20	0.030399	no	BRNSNG
chr2_32804252_T_G_b38	RASGRP3	3.536	0.000651	0.107143	17	0.030305	no	BRNSNG
chr2_32796213_A_G_b38	RASGRP3	3.527	0.00067	0.107703	18	0.030537	no	BRNSNG
chr2_32797078_G_T_b38	RASGRP3	3.517	0.000693	0.121102	8	0.034434	no	BRNSNG
chr2_32820800_G_GT_b38	RASGRP3	3.515	0.000697	0.137841	5	0.039215	no	BRNSNG
chr2_32792961_T_C_b38	RASGRP3	3.5	0.000731	0.109922	19	0.031402	no	BRNSNG
chr2_32684857_G_A_b38	RASGRP3	3.486	0.000767	0.14393	4	0.041286	no	BRNSNG
chr2_32887028_A_G_b38	RASGRP3	3.486	0.000768	0.105517	21	0.030271	no	BRNSNG
chr2_32889140_C_CATA_b38	RASGRP3	3.486	0.000768	0.105517	21	0.030271	no	BRNSNG
chr2_32894731_A_G_b38	RASGRP3	3.486	0.000768	0.105517	21	0.030271	no	BRNSNG
chr2_32896786_TG_T_b38	RASGRP3	3.486	0.000768	0.105517	21	0.030271	no	BRNSNG
chr2_32834697_C_G_b38	RASGRP3	3.48	0.000782	0.130367	6	0.037462	no	BRNSNG
chr2_32836639_T_C_b38	RASGRP3	3.48	0.000782	0.130367	6	0.037462	no	BRNSNG
chr2_32821751_T_A_b38	RASGRP3	3.438	0.000898	0.11047	15	0.032134	no	BRNSNG
chr2_32855031_C_G_b38	RASGRP3	3.437	0.000901	0.138366	4	0.040261	no	BRNSNG
chr2_32845129_G_A_b38	RASGRP3	3.435	0.000905	0.117183	22	0.034112	no	BRNSNG
chr2_32806634_T_C_b38	RASGRP3	3.432	0.000914	0.103517	17	0.030161	no	BRNSNG
chr2_32847613_G_T_b38	RASGRP3	3.431	0.000918	0.137992	4	0.040219	no	BRNSNG
chr2_32853641_C_G_b38	RASGRP3	3.431	0.000918	0.137992	4	0.040219	no	BRNSNG
chr2_32861819_T_C_b38	RASGRP3	3.431	0.000918	0.137992	4	0.040219	no	BRNSNG
chr2_32865029_A_G_b38	RASGRP3	3.431	0.000918	0.137992	4	0.040219	no	BRNSNG
chr2_32702020_A_C_b38	RASGRP3	3.419	0.000954	0.125414	8	0.03668	no	BRNSNG
chr2_32818790_T_G_b38	RASGRP3	3.413	0.000973	0.107457	15	0.031485	no	BRNSNG
chr2_32857091_G_A_b38	RASGRP3	3.387	0.00106	0.128055	5	0.037809	no	BRNSNG
chr2_32702796_G_A_b38	RASGRP3	3.361	0.00115	0.141053	4	0.041963	no	BRNSNG
chr2_32704049_G_A_b38	RASGRP3	3.357	0.00116	0.140712	4	0.041913	no	BRNSNG
chr2_32708028_T_G_b38	RASGRP3	3.357	0.00117	0.136434	4	0.040647	no	BRNSNG
chr2_32736473_A_G_b38	RASGRP3	3.348	0.0012	0.103527	17	0.030923	no	BRNSNG
chr2_32698746_C_T_b38	RASGRP3	3.333	0.00126	0.123838	9	0.037159	no	BRNSNG
chr2_32773539_G_A_b38	RASGRP3	3.319	0.00132	0.10784	17	0.032493	no	BRNSNG
chr2_32834735_G_A_b38	RASGRP3	3.313	0.00134	0.124708	6	0.037641	no	BRNSNG
chr2_32791407_G_C_b38	RASGRP3	3.31	0.00135	0.103233	15	0.031191	no	BRNSNG
chr2_32685946_A_G_b38	RASGRP3	3.303	0.00139	0.136706	4	0.041394	no	BRNSNG
chr2_34038316_CTT_C_b38	RASGRP3	3.27	0.00154	0.127596	6	0.039018	no	BRNSNG
chr2_32873108_G_A_b38	RASGRP3	3.248	0.00165	0.127437	5	0.039242	no	BRNSNG
chr2_32711348_A_G_b38	RASGRP3	3.244	0.00167	0.138243	4	0.042611	no	BRNSNG
chr2_32696925_G_A_b38	RASGRP3	3.241	0.00168	0.137935	4	0.042563	no	BRNSNG
chr2_32709521_G_C_b38	RASGRP3	3.236	0.00171	0.132662	4	0.040998	no	BRNSNG
chr2_32686607_C_T_b38	RASGRP3	3.235	0.00171	0.132575	4	0.04098	no	BRNSNG
chr2_32846989_C_T_b38	RASGRP3	3.225	0.00177	0.126395	5	0.039187	no	BRNSNG
chr2_32785688_C_T_b38	RASGRP3	3.214	0.00183	0.137397	4	0.042749	no	BRNSNG
chr2_32776033_T_C_b38	RASGRP3	3.21	0.00185	0.111575	14	0.034755	no	BRNSNG
chr2_32778995_C_A_b38	RASGRP3	3.21	0.00185	0.111575	14	0.034755	no	BRNSNG
chr2_32788394_AAGG_A_b38	RASGRP3	3.21	0.00185	0.137057	4	0.042696	no	BRNSNG
chr2_32880794_C_T_b38	RASGRP3	3.209	0.00186	0.099591	16	0.031039	no	BRNSNG
chr2_32881118_G_A_b38	RASGRP3	3.209	0.00186	0.099591	16	0.031039	no	BRNSNG
chr2_32767869_A_G_b38	RASGRP3	3.205	0.00188	0.13867	4	0.043272	no	BRNSNG
chr2_32793321_A_G_b38	RASGRP3	3.204	0.00189	0.097485	17	0.030424	no	BRNSNG
chr2_32764048_C_T_b38	RASGRP3	3.2	0.00191	0.105374	16	0.032929	no	BRNSNG
chr2_32767611_G_A_b38	RASGRP3	3.199	0.00192	0.13689	4	0.04279	no	BRNSNG
chr2_32732474_C_G_b38	RASGRP3	3.197	0.00193	0.137333	4	0.042959	no	BRNSNG
chr2_32743054_C_T_b38	RASGRP3	3.197	0.00193	0.137333	4	0.042959	no	BRNSNG
chr2_32751993_G_A_b38	RASGRP3	3.197	0.00193	0.137333	4	0.042959	no	BRNSNG
chr2_32752496_C_T_b38	RASGRP3	3.197	0.00193	0.137333	4	0.042959	no	BRNSNG
chr2_32767741_G_A_b38	RASGRP3	3.194	0.00195	0.13649	4	0.042728	no	BRNSNG
chr2_32730794_G_C_b38	RASGRP3	3.194	0.00195	0.137058	4	0.042914	no	BRNSNG
chr2_32733771_CTT_C_b38	RASGRP3	3.194	0.00195	0.137058	4	0.042914	no	BRNSNG
chr2_32734008_G_A_b38	RASGRP3	3.194	0.00195	0.137058	4	0.042914	no	BRNSNG
chr2_32735655_CT_C_b38	RASGRP3	3.194	0.00195	0.137058	4	0.042914	no	BRNSNG
chr2_32737245_C_G_b38	RASGRP3	3.194	0.00195	0.137058	4	0.042914	no	BRNSNG
chr2_32737761_G_A_b38	RASGRP3	3.194	0.00195	0.137058	4	0.042914	no	BRNSNG
chr2_32739186_G_A_b38	RASGRP3	3.194	0.00195	0.137058	4	0.042914	no	BRNSNG
chr2_32750955_C_T_b38	RASGRP3	3.194	0.00195	0.137058	4	0.042914	no	BRNSNG
chr2_32706855_G_A_b38	RASGRP3	3.175	0.00207	0.135393	4	0.04265	no	BRNSNG
chr2_32860825_AC_A_b38	RASGRP3	3.167	0.00212	0.103612	14	0.032716	no	BRNSNG
chr2_32827936_CTGTGTGTG_C_b38	RASGRP3	3.148	0.00224	0.118267	6	0.037564	no	BRNSNG
chr2_32708678_T_TTTGTTG_b38	RASGRP3	3.148	0.00225	0.128187	4	0.040724	no	BRNSNG
chr2_32837214_C_T_b38	RASGRP3	3.138	0.00231	0.101878	21	0.032465	no	BRNSNG
chr2_32758762_CT_C_b38	RASGRP3	3.132	0.00236	0.134002	4	0.042781	no	BRNSNG
chr2_32795531_CTTAT_C_b38	RASGRP3	3.132	0.00236	0.099444	13	0.031752	no	BRNSNG
chr2_32774896_C_G_b38	RASGRP3	3.13	0.00237	0.108806	9	0.034758	no	BRNSNG
chr2_32828843_ATACAT_A_b38	RASGRP3	3.12	0.00244	0.126837	5	0.04065	no	BRNSNG
chr2_32723289_G_A_b38	RASGRP3	3.116	0.00248	0.130255	4	0.041806	no	BRNSNG
chr2_32804010_T_TA_b38	RASGRP3	3.076	0.0028	0.115802	5	0.037649	no	BRNSNG
chr2_32688540_T_G_b38	RASGRP3	3.074	0.00281	0.124525	5	0.040508	no	BRNSNG
chr2_32699174_C_G_b38	RASGRP3	3.052	0.003	0.126653	4	0.041498	no	BRNSNG
chr2_32580219_T_G_b38	RASGRP3	-3.052	0.00301	-0.101393	13	0.033223	no	BRNSNG
chr2_32761775_G_A_b38	RASGRP3	3.044	0.00308	0.131856	4	0.043318	no	BRNSNG
chr2_32764109_CACAT_C_b38	RASGRP3	3.044	0.00308	0.131856	4	0.043318	no	BRNSNG
chr2_33816796_C_CTTTTTTTTT_b38	RASGRP3	-3.036	0.00315	-0.161881	6	0.053318	no	BRNSNG
chr2_32754816_C_CG_b38	RASGRP3	3.034	0.00317	0.133743	4	0.044077	no	BRNSNG
chr2_32797243_A_G_b38	RASGRP3	3.031	0.0032	0.116387	6	0.038401	no	BRNSNG
chr2_33678269_A_G_b38	RASGRP3	3.027	0.00324	0.098291	20	0.032471	no	BRNSNG
chr2_32559699_T_G_b38	RASGRP3	-3.025	0.00326	-0.101448	12	0.033535	no	BRNSNG
chr2_32762628_GT_G_b38	RASGRP3	3	0.00351	0.105424	11	0.035145	no	BRNSNG
chr2_33688766_G_GTATT_b38	RASGRP3	2.999	0.00352	0.096259	27	0.032096	no	BRNSNG
chr2_32682841_ATTG_A_b38	RASGRP3	2.996	0.00355	0.079053	18	0.026387	no	BRNSNG
chr2_33673961_G_A_b38	RASGRP3	2.994	0.00357	0.096522	18	0.032234	no	BRNSNG
chr2_33673967_T_A_b38	RASGRP3	2.994	0.00357	0.096522	18	0.032234	no	BRNSNG
chr2_33674183_T_C_b38	RASGRP3	2.994	0.00357	0.096522	18	0.032234	no	BRNSNG
chr2_32841585_G_A_b38	RASGRP3	2.992	0.0036	0.114885	6	0.038397	no	BRNSNG
chr2_32701481_T_C_b38	RASGRP3	2.99	0.00362	0.122842	4	0.041088	no	BRNSNG
chr2_32871799_C_CAAA_b38	RASGRP3	2.981	0.00371	0.131359	5	0.044062	no	BRNSNG
chr2_32761710_A_G_b38	RASGRP3	2.971	0.00383	0.115915	5	0.03902	no	BRNSNG
chr2_33470006_T_C_b38	RASGRP3	2.967	0.00388	0.09902	17	0.033379	no	BRNSNG
chr2_33470756_C_T_b38	RASGRP3	2.967	0.00388	0.09902	17	0.033379	no	BRNSNG
chr2_33474721_C_T_b38	RASGRP3	-2.965	0.0039	-0.120118	5	0.040519	no	BRNSNG
chr2_32764745_A_G_b38	RASGRP3	2.956	0.00399	0.115457	5	0.039053	no	BRNSNG
chr2_32785385_G_T_b38	RASGRP3	2.937	0.00423	0.115677	5	0.039386	no	BRNSNG
chr2_32488639_A_T_b38	RASGRP3	-2.929	0.00433	-0.096165	15	0.032829	no	BRNSNG
chr2_32730625_T_A_b38	RASGRP3	2.919	0.00445	0.128824	4	0.044128	no	BRNSNG
chr2_32696229_G_A_b38	RASGRP3	2.915	0.00451	0.121322	4	0.041618	no	BRNSNG
chr2_32637586_C_T_b38	RASGRP3	2.902	0.00468	0.113515	6	0.039116	no	BRNSNG
chr2_33675020_C_G_b38	RASGRP3	2.899	0.00473	0.092012	19	0.031742	no	BRNSNG
chr2_32849873_G_GGTGTGT_b38	RASGRP3	2.891	0.00483	0.106757	5	0.036923	no	BRNSNG
chr2_33469845_C_T_b38	RASGRP3	2.891	0.00483	0.09807	19	0.03392	no	BRNSNG
chr2_33683201_G_A_b38	RASGRP3	2.878	0.00502	0.095934	22	0.033328	no	BRNSNG
chr2_33470875_C_T_b38	RASGRP3	2.873	0.0051	0.097184	19	0.033829	no	BRNSNG
chr2_32750215_T_C_b38	RASGRP3	2.868	0.00518	0.123772	4	0.043164	no	BRNSNG
chr2_32839953_T_G_b38	RASGRP3	2.86	0.00529	0.099069	24	0.034637	no	BRNSNG
chr2_32841679_T_C_b38	RASGRP3	2.86	0.00529	0.099069	24	0.034637	no	BRNSNG
chr2_32837414_C_T_b38	RASGRP3	2.85	0.00545	0.094012	20	0.032989	no	BRNSNG
chr2_32721706_GTA_G_b38	RASGRP3	2.843	0.00556	0.090933	24	0.03199	no	BRNSNG
chr2_32721709_CAGTGGAATG_C_b38	RASGRP3	2.843	0.00556	0.090933	24	0.03199	no	BRNSNG
chr2_32721719_A_C_b38	RASGRP3	2.843	0.00556	0.090933	24	0.03199	no	BRNSNG
chr2_32727402_T_C_b38	RASGRP3	2.834	0.00569	0.087172	19	0.030754	no	BRNSNG
chr2_32705531_T_TA_b38	RASGRP3	2.833	0.00571	0.120885	4	0.042668	no	BRNSNG
chr2_32705813_C_A_b38	RASGRP3	2.833	0.00571	0.120885	4	0.042668	no	BRNSNG
chr2_33469036_C_CA_b38	RASGRP3	2.832	0.00573	0.098346	18	0.034728	no	BRNSNG
chr2_33688598_G_A_b38	RASGRP3	2.83	0.00576	0.09782	27	0.034565	no	BRNSNG
chr2_33689050_A_T_b38	RASGRP3	2.83	0.00576	0.09782	27	0.034565	no	BRNSNG
chr2_33690016_C_G_b38	RASGRP3	2.83	0.00576	0.09782	27	0.034565	no	BRNSNG
chr2_34016859_A_G_b38	RASGRP3	2.826	0.00584	0.092708	11	0.032807	no	BRNSNG
chr2_32751858_G_A_b38	RASGRP3	2.823	0.00588	0.117862	4	0.041746	no	BRNSNG
chr2_32715957_G_GTGTTTTGTTTTTTTAAACTA_b38	RASGRP3	2.809	0.00612	0.093157	23	0.033165	no	BRNSNG
chr2_33470439_G_A_b38	RASGRP3	2.809	0.00612	0.095786	16	0.034102	no	BRNSNG
chr2_32872508_G_T_b38	RASGRP3	2.808	0.00614	0.114713	5	0.040851	no	BRNSNG
chr2_33123514_A_G_b38	RASGRP3	-2.808	0.00615	-0.087192	19	0.031057	no	BRNSNG
chr2_32718404_A_G_b38	RASGRP3	2.798	0.00632	0.103996	7	0.037171	no	BRNSNG
chr2_33477419_C_G_b38	RASGRP3	-2.785	0.00656	-0.117664	4	0.042255	no	BRNSNG
chr2_32710427_C_CT_b38	RASGRP3	2.781	0.00662	0.103792	8	0.037319	no	BRNSNG
chr2_33470233_G_A_b38	RASGRP3	2.772	0.00681	0.094453	16	0.03408	no	BRNSNG
chr2_32650988_A_AT_b38	RASGRP3	2.765	0.00693	0.122428	4	0.044277	no	BRNSNG
chr2_33469790_T_G_b38	RASGRP3	-2.763	0.00696	-0.118251	3	0.042791	no	BRNSNG
chr2_33470014_T_C_b38	RASGRP3	-2.763	0.00696	-0.118251	3	0.042791	no	BRNSNG
chr2_33472085_T_C_b38	RASGRP3	-2.763	0.00696	-0.118251	3	0.042791	no	BRNSNG
chr2_32747807_A_G_b38	RASGRP3	2.761	0.00702	0.118347	3	0.042866	no	BRNSNG
chr2_32576190_C_G_b38	RASGRP3	-2.742	0.00739	-0.092379	14	0.033688	no	BRNSNG
chr2_32730547_TA_T_b38	RASGRP3	2.737	0.0075	0.100247	19	0.036627	no	BRNSNG
chr2_32835395_T_G_b38	RASGRP3	2.727	0.00771	0.089318	19	0.032749	no	BRNSNG
chr2_32835396_C_T_b38	RASGRP3	2.727	0.00771	0.089318	19	0.032749	no	BRNSNG
chr2_32835652_T_C_b38	RASGRP3	2.727	0.00771	0.089318	19	0.032749	no	BRNSNG
chr2_32836008_G_A_b38	RASGRP3	2.727	0.00771	0.089318	19	0.032749	no	BRNSNG
chr2_32710172_A_G_b38	RASGRP3	2.726	0.00773	0.089803	26	0.03294	no	BRNSNG
chr2_33679032_C_G_b38	RASGRP3	2.726	0.00774	0.086451	20	0.031717	no	BRNSNG
chr2_32652388_A_G_b38	RASGRP3	2.726	0.00774	0.123316	4	0.045245	no	BRNSNG
chr2_34015325_G_C_b38	RASGRP3	2.725	0.00775	0.090018	11	0.033033	no	BRNSNG
chr2_33684472_T_C_b38	RASGRP3	2.702	0.00826	0.09024	27	0.033392	no	BRNSNG
chr2_33688660_C_T_b38	RASGRP3	2.702	0.00826	0.09024	27	0.033392	no	BRNSNG
chr2_33690134_C_G_b38	RASGRP3	2.702	0.00826	0.09024	27	0.033392	no	BRNSNG
chr2_33691469_AT_A_b38	RASGRP3	2.702	0.00826	0.09024	27	0.033392	no	BRNSNG
chr2_33693183_C_T_b38	RASGRP3	2.702	0.00826	0.09024	27	0.033392	no	BRNSNG
chr2_33693405_C_T_b38	RASGRP3	2.702	0.00826	0.09024	27	0.033392	no	BRNSNG
chr2_33693972_G_T_b38	RASGRP3	2.702	0.00826	0.09024	27	0.033392	no	BRNSNG
chr2_33694557_G_T_b38	RASGRP3	2.702	0.00826	0.09024	27	0.033392	no	BRNSNG
chr2_33697062_G_T_b38	RASGRP3	2.702	0.00826	0.09024	27	0.033392	no	BRNSNG
chr2_33702114_G_A_b38	RASGRP3	-2.7	0.00831	-0.116233	5	0.043048	no	BRNSNG
chr2_33703079_G_A_b38	RASGRP3	-2.7	0.00831	-0.116233	5	0.043048	no	BRNSNG
chr2_32493782_G_A_b38	RASGRP3	-2.682	0.00874	-0.090482	14	0.033739	no	BRNSNG
chr2_33812043_G_A_b38	RASGRP3	-2.682	0.00875	-0.083189	31	0.031023	no	BRNSNG
chr2_32795132_GA_G_b38	RASGRP3	-2.68	0.00879	-0.090781	12	0.033874	no	BRNSNG
chr2_32594702_A_AGATG_b38	RASGRP3	-2.675	0.0089	-0.091287	26	0.034121	no	BRNSNG
chr2_33473129_A_G_b38	RASGRP3	-2.672	0.00899	-0.115026	3	0.043053	no	BRNSNG
chr2_33469706_C_T_b38	RASGRP3	2.671	0.00901	0.091069	19	0.034097	no	BRNSNG
chr2_32765317_G_C_b38	RASGRP3	2.67	0.00903	0.094148	10	0.03526	no	BRNSNG
chr2_32741368_G_T_b38	RASGRP3	2.669	0.00906	0.093439	8	0.035012	no	BRNSNG
chr2_32702014_A_ACAAAAAC_b38	RASGRP3	2.66	0.00928	0.124296	4	0.046725	no	BRNSNG
chr2_32774183_C_CT_b38	RASGRP3	2.645	0.00967	0.093243	9	0.03525	no	BRNSNG
chr2_32751538_A_G_b38	RASGRP3	2.636	0.00992	0.107816	4	0.040904	no	BRNSNG
chr2_32753192_A_G_b38	RASGRP3	2.635	0.00994	0.109289	4	0.041476	no	BRNSNG
chr2_33537192_G_GAT_b38	RASGRP3	7.069	9.57e-12	0.244082	3	0.034528	yes	BREAST
chr2_33552022_CAAACA_C_b38	RASGRP3	6.865	3.38e-11	0.240484	5	0.035029	yes	BREAST
chr2_33540561_TGTGTGTGTGTG_T_b38	RASGRP3	6.667	1.12e-10	0.244064	5	0.036605	yes	BREAST
chr2_33553995_C_T_b38	RASGRP3	6.55	2.25e-10	0.230815	5	0.035238	yes	BREAST
chr2_33596617_C_T_b38	RASGRP3	5.887	9.81e-09	0.153251	28	0.026033	yes	BREAST
chr2_33596963_A_T_b38	RASGRP3	5.719	2.43e-08	0.149041	28	0.02606	yes	BREAST
chr2_33525341_A_AAT_b38	RASGRP3	5.623	4.05e-08	0.150482	18	0.026763	yes	BREAST
chr2_33592302_T_C_b38	RASGRP3	5.082	6.31e-07	0.222466	5	0.043774	yes	BREAST
chr2_33596450_T_G_b38	RASGRP3	5.043	7.63e-07	0.123693	36	0.024527	yes	BREAST
chr2_33590881_T_C_b38	RASGRP3	5.014	8.76e-07	0.121164	37	0.024163	yes	BREAST
chr2_33589264_G_C_b38	RASGRP3	5.004	9.2e-07	0.121999	37	0.024379	yes	BREAST
chr2_33529318_C_T_b38	RASGRP3	4.699	3.87e-06	0.13484	12	0.028698	yes	BREAST
chr2_33564001_C_G_b38	RASGRP3	4.393	1.51e-05	0.102469	53	0.023324	yes	BREAST
chr2_33588900_A_AT_b38	RASGRP3	-4.309	2.18e-05	-0.101468	83	0.023548	yes	BREAST
chr2_33564467_A_G_b38	RASGRP3	4.277	2.49e-05	0.100696	55	0.023543	yes	BREAST
chr2_33579727_C_T_b38	RASGRP3	4.131	4.61e-05	0.18392	5	0.044527	yes	BREAST
chr2_33532487_C_A_b38	RASGRP3	4.057	6.24e-05	0.084648	100	0.020867	yes	BREAST
chr2_33673112_G_T_b38	RASGRP3	-4.012	7.48e-05	-0.090981	96	0.022678	yes	BREAST
chr2_33561445_C_A_b38	RASGRP3	3.976	8.66e-05	0.11024	17	0.027729	yes	BREAST
chr2_33569371_A_G_b38	RASGRP3	-3.876	0.000129	-0.087557	69	0.022591	yes	BREAST
chr2_33555164_G_A_b38	RASGRP3	3.873	0.00013	0.109105	17	0.028171	yes	BREAST
chr2_33571342_T_C_b38	RASGRP3	-3.86	0.000137	-0.086827	69	0.022493	yes	BREAST
chr2_33523649_G_A_b38	RASGRP3	3.844	0.000146	0.107635	16	0.028004	yes	BREAST
chr2_33568339_TA_T_b38	RASGRP3	-3.826	0.000156	-0.085438	75	0.022334	yes	BREAST
chr2_33525699_C_CAA_b38	RASGRP3	3.819	0.000161	0.157032	12	0.041121	yes	BREAST
chr2_33572204_C_A_b38	RASGRP3	-3.809	0.000167	-0.086365	68	0.022672	yes	BREAST
chr2_33521266_C_T_b38	RASGRP3	3.745	0.000213	0.095526	28	0.025508	yes	BREAST
chr2_33571586_T_C_b38	RASGRP3	-3.714	0.00024	-0.081406	84	0.02192	yes	BREAST
chr2_33657078_T_C_b38	RASGRP3	3.685	0.000268	0.096968	30	0.026312	yes	BREAST
chr2_33571267_T_A_b38	RASGRP3	-3.683	0.00027	-0.083224	68	0.022598	yes	BREAST
chr2_33656916_G_A_b38	RASGRP3	3.645	0.000312	0.092156	37	0.025285	yes	BREAST
chr2_33622160_C_T_b38	RASGRP3	3.641	0.000316	0.095203	26	0.026146	yes	BREAST
chr2_33575950_G_A_b38	RASGRP3	-3.629	0.00033	-0.082601	62	0.022762	yes	BREAST
chr2_33530497_CT_C_b38	RASGRP3	3.618	0.000344	0.101499	13	0.028056	yes	BREAST
chr2_33577889_G_A_b38	RASGRP3	-3.567	0.000416	-0.081758	62	0.022923	yes	BREAST
chr2_33611855_A_C_b38	RASGRP3	3.565	0.000418	0.11478	12	0.032193	yes	BREAST
chr2_33537323_G_A_b38	RASGRP3	3.565	0.000418	0.074826	94	0.020989	yes	BREAST
chr2_33567745_C_T_b38	RASGRP3	-3.498	0.000534	-0.080475	61	0.023004	yes	BREAST
chr2_33622592_T_C_b38	RASGRP3	3.473	0.000585	0.088149	35	0.025383	yes	BREAST
chr2_33561192_A_G_b38	RASGRP3	3.332	0.000961	0.070788	101	0.021243	yes	BREAST
chr2_33523461_TA_T_b38	RASGRP3	3.233	0.00135	0.094429	9	0.029211	yes	BREAST
chr2_33656848_TA_T_b38	RASGRP3	3.224	0.00139	0.086177	26	0.026729	yes	BREAST
chr2_33556890_T_TACAC_b38	RASGRP3	-3.207	0.00147	-0.093226	11	0.029066	yes	BREAST
chr2_33590404_A_G_b38	RASGRP3	-3.196	0.00153	-0.070338	100	0.02201	yes	BREAST
chr2_33664871_G_GT_b38	RASGRP3	-3.19	0.00156	-0.069221	98	0.0217	yes	BREAST
chr2_33621819_C_A_b38	RASGRP3	3.171	0.00167	0.077612	38	0.024479	yes	BREAST
chr2_33535943_T_C_b38	RASGRP3	-3.13	0.00191	-0.099967	11	0.03194	yes	BREAST
chr2_33589523_A_G_b38	RASGRP3	-3.122	0.00196	-0.068976	101	0.022093	yes	BREAST
chr2_33605951_T_C_b38	RASGRP3	-3.114	0.00201	-0.069994	98	0.02248	yes	BREAST
chr2_33532968_G_A_b38	RASGRP3	-3.078	0.00227	-0.1007	10	0.032721	yes	BREAST
chr2_33533272_T_C_b38	RASGRP3	-3.056	0.00243	-0.095678	13	0.031313	yes	BREAST
chr2_33340257_C_CA_b38	RASGRP3	-3.049	0.00249	-0.198697	3	0.06517	yes	BREAST
chr2_32795132_GA_G_b38	RASGRP3	-3.029	0.00265	-0.075527	41	0.024935	yes	BREAST
chr2_33525341_AAT_A_b38	RASGRP3	-3.023	0.0027	-0.095542	11	0.031601	yes	BREAST
chr2_33625315_G_A_b38	RASGRP3	2.984	0.00306	0.079654	24	0.026692	yes	BREAST
chr2_33563965_A_G_b38	RASGRP3	2.984	0.00306	0.103971	5	0.034848	yes	BREAST
chr2_33623108_T_C_b38	RASGRP3	2.974	0.00316	0.073646	37	0.024761	yes	BREAST
chr2_33581338_T_A_b38	RASGRP3	2.954	0.00336	0.103632	5	0.035078	yes	BREAST
chr2_33581900_A_T_b38	RASGRP3	2.954	0.00336	0.103632	5	0.035078	yes	BREAST
chr2_33624881_G_GT_b38	RASGRP3	2.939	0.00352	0.075115	30	0.025555	yes	BREAST
chr2_33753914_G_T_b38	RASGRP3	2.923	0.00371	0.102115	9	0.03494	yes	BREAST
chr2_33538430_G_C_b38	RASGRP3	-2.918	0.00377	-0.095998	10	0.0329	yes	BREAST
chr2_33538452_G_A_b38	RASGRP3	-2.918	0.00377	-0.095998	10	0.0329	yes	BREAST
chr2_33543280_C_G_b38	RASGRP3	-2.918	0.00377	-0.095998	10	0.0329	yes	BREAST
chr2_33533388_C_T_b38	RASGRP3	-2.901	0.00397	-0.091275	13	0.03146	yes	BREAST
chr2_33537330_C_CCCA_b38	RASGRP3	-2.878	0.00426	-0.103691	10	0.036027	yes	BREAST
chr2_33117801_T_G_b38	RASGRP3	2.876	0.0043	0.116445	3	0.040491	yes	BREAST
chr2_32912598_G_T_b38	RASGRP3	-2.837	0.00484	-0.132285	3	0.046629	yes	BREAST
chr2_33534328_C_T_b38	RASGRP3	-2.837	0.00484	-0.092666	10	0.032665	yes	BREAST
chr2_33534496_G_A_b38	RASGRP3	-2.837	0.00484	-0.092666	10	0.032665	yes	BREAST
chr2_33607748_A_G_b38	RASGRP3	-2.837	0.00484	-0.062019	88	0.021863	yes	BREAST
chr2_33535555_G_GC_b38	RASGRP3	-2.817	0.00514	-0.091076	11	0.032327	yes	BREAST
chr2_32889612_T_G_b38	RASGRP3	-2.8	0.00542	-0.1189	3	0.042468	yes	BREAST
chr2_33661156_C_T_b38	RASGRP3	2.799	0.00544	0.071846	24	0.025672	yes	BREAST
chr2_33661310_C_T_b38	RASGRP3	2.799	0.00544	0.071846	24	0.025672	yes	BREAST
chr2_33537321_C_CA_b38	RASGRP3	2.795	0.00549	0.063659	53	0.022774	yes	BREAST
chr2_33542583_A_T_b38	RASGRP3	-2.772	0.00589	-0.093754	17	0.033817	yes	BREAST
chr2_33562267_C_CT_b38	RASGRP3	2.762	0.00607	0.06011	75	0.021762	yes	BREAST
chr2_33515788_C_T_b38	RASGRP3	-2.743	0.00643	-0.090302	10	0.032923	yes	BREAST
chr2_33251664_C_CAA_b38	RASGRP3	-2.727	0.00674	-0.147356	4	0.054038	yes	BREAST
chr2_33534062_A_C_b38	RASGRP3	-2.72	0.00687	-0.087663	10	0.032225	yes	BREAST
chr2_33604404_GTA_G_b38	RASGRP3	-2.702	0.00725	-0.062964	48	0.023299	yes	BREAST
chr2_33255545_C_T_b38	RASGRP3	-2.702	0.00726	-0.060893	93	0.02254	yes	BREAST
chr2_32862995_T_TTGTG_b38	RASGRP3	-2.701	0.00727	-0.104831	4	0.03881	yes	BREAST
chr2_33244860_T_TTATC_b38	RASGRP3	-2.689	0.00753	-0.061116	94	0.022724	yes	BREAST
chr2_33661923_CT_C_b38	RASGRP3	-2.687	0.00758	-0.067933	69	0.025283	yes	BREAST
chr2_32885302_C_G_b38	RASGRP3	-2.679	0.00777	-0.07547	14	0.028176	yes	BREAST
chr2_32885970_G_C_b38	RASGRP3	-2.679	0.00777	-0.07547	14	0.028176	yes	BREAST
chr2_33548698_A_AATTATT_b38	RASGRP3	-2.667	0.00803	-0.079614	14	0.02985	yes	BREAST
chr2_33537323_G_C_b38	RASGRP3	-2.641	0.00867	-0.063834	47	0.024172	yes	BREAST
chr2_33551040_C_T_b38	RASGRP3	-2.627	0.00903	-0.077932	15	0.02967	yes	BREAST
chr2_34352231_ATT_A_b38	RASGRP3	-2.625	0.00908	-0.06387	38	0.024334	yes	BREAST
chr2_33531453_C_T_b38	RASGRP3	7.974	2.65e-14	0.260142	6	0.032625	no	BREAST
chr2_33526597_C_T_b38	RASGRP3	7.677	1.93e-13	0.257573	5	0.033553	no	BREAST
chr2_33527062_GC_G_b38	RASGRP3	7.677	1.93e-13	0.257573	5	0.033553	no	BREAST
chr2_33529269_C_A_b38	RASGRP3	7.666	2.07e-13	0.25119	6	0.032768	no	BREAST
chr2_33557844_G_A_b38	RASGRP3	7.604	3.11e-13	0.248993	6	0.032744	no	BREAST
chr2_33537896_A_G_b38	RASGRP3	7.263	2.82e-12	0.25625	3	0.035282	no	BREAST
chr2_33557635_G_A_b38	RASGRP3	7.118	7.06e-12	0.247301	4	0.034744	no	BREAST
chr2_33559304_G_A_b38	RASGRP3	7.118	7.06e-12	0.247301	4	0.034744	no	BREAST
chr2_33550216_T_A_b38	RASGRP3	6.979	1.68e-11	0.247906	4	0.035521	no	BREAST
chr2_33550484_C_G_b38	RASGRP3	6.972	1.75e-11	0.24705	4	0.035436	no	BREAST
chr2_33548469_T_C_b38	RASGRP3	6.883	3.04e-11	0.242399	4	0.035219	no	BREAST
chr2_33554542_A_G_b38	RASGRP3	6.808	4.79e-11	0.24343	4	0.035757	no	BREAST
chr2_33559734_G_A_b38	RASGRP3	6.786	5.46e-11	0.236262	4	0.034814	no	BREAST
chr2_33551676_A_G_b38	RASGRP3	6.776	5.82e-11	0.242135	4	0.035735	no	BREAST
chr2_33551697_A_T_b38	RASGRP3	6.776	5.82e-11	0.242135	4	0.035735	no	BREAST
chr2_33559068_A_G_b38	RASGRP3	6.676	1.06e-10	0.243237	3	0.036434	no	BREAST
chr2_33546942_C_G_b38	RASGRP3	6.635	1.36e-10	0.225342	7	0.033962	no	BREAST
chr2_33548762_A_G_b38	RASGRP3	6.605	1.62e-10	0.245478	3	0.037165	no	BREAST
chr2_33594326_C_T_b38	RASGRP3	5.838	1.28e-08	0.150623	29	0.025799	no	BREAST
chr2_33594385_G_A_b38	RASGRP3	5.838	1.28e-08	0.150623	29	0.025799	no	BREAST
chr2_33537330_C_CCCAACACA_b38	RASGRP3	5.793	1.64e-08	0.174533	17	0.03013	no	BREAST
chr2_33565263_A_G_b38	RASGRP3	5.564	5.51e-08	0.143733	33	0.025831	no	BREAST
chr2_33586869_A_T_b38	RASGRP3	5.547	6.03e-08	0.147056	25	0.02651	no	BREAST
chr2_33581561_C_T_b38	RASGRP3	5.467	9.15e-08	0.14098	26	0.025788	no	BREAST
chr2_33582025_C_T_b38	RASGRP3	5.381	1.42e-07	0.1387	26	0.025778	no	BREAST
chr2_33539987_GAAAAA_G_b38	RASGRP3	5.287	2.28e-07	0.219846	3	0.041579	no	BREAST
chr2_33536322_G_GA_b38	RASGRP3	4.442	1.22e-05	0.153859	10	0.034637	no	BREAST
chr2_33512177_G_A_b38	RASGRP3	4.349	1.83e-05	0.130773	14	0.030066	no	BREAST
chr2_33565010_T_TACACACAC_b38	RASGRP3	4.218	3.2e-05	0.189892	3	0.045017	no	BREAST
chr2_33514230_T_G_b38	RASGRP3	4.099	5.25e-05	0.113062	19	0.027583	no	BREAST
chr2_33511010_G_A_b38	RASGRP3	4.063	6.09e-05	0.149058	7	0.03669	no	BREAST
chr2_33573675_A_G_b38	RASGRP3	3.9	0.000117	0.185489	3	0.047557	no	BREAST
chr2_33515662_T_C_b38	RASGRP3	3.801	0.000172	0.111112	15	0.02923	no	BREAST
chr2_33249323_T_TCA_b38	RASGRP3	3.793	0.000177	0.124819	10	0.032908	no	BREAST
chr2_33591195_C_CT_b38	RASGRP3	-3.741	0.000217	-0.092957	60	0.024849	no	BREAST
chr2_33658713_G_A_b38	RASGRP3	-3.704	0.000249	-0.08039	94	0.021704	no	BREAST
chr2_33662442_T_C_b38	RASGRP3	-3.673	0.000281	-0.078687	98	0.021425	no	BREAST
chr2_33658170_A_G_b38	RASGRP3	-3.508	0.000516	-0.075692	96	0.021579	no	BREAST
chr2_33668515_A_G_b38	RASGRP3	-3.489	0.000551	-0.074605	99	0.021382	no	BREAST
chr2_33670716_C_T_b38	RASGRP3	3.489	0.000552	0.095059	18	0.027245	no	BREAST
chr2_33647765_T_C_b38	RASGRP3	-3.467	0.000596	-0.074319	103	0.021434	no	BREAST
chr2_33508487_T_C_b38	RASGRP3	3.432	0.000678	0.135697	6	0.039544	no	BREAST
chr2_33641120_T_C_b38	RASGRP3	-3.4	0.000759	-0.073332	100	0.021571	no	BREAST
chr2_33655774_A_G_b38	RASGRP3	-3.389	0.000787	-0.072849	100	0.021493	no	BREAST
chr2_33650021_A_G_b38	RASGRP3	3.299	0.00108	0.092586	15	0.028067	no	BREAST
chr2_33620413_GA_G_b38	RASGRP3	3.286	0.00113	0.110123	4	0.033516	no	BREAST
chr2_33675020_C_G_b38	RASGRP3	-3.264	0.00121	-0.072889	73	0.022329	no	BREAST
chr2_33656248_TTC_T_b38	RASGRP3	3.25	0.00127	0.09136	15	0.02811	no	BREAST
chr2_33660983_C_T_b38	RASGRP3	-3.241	0.00131	-0.069832	89	0.021545	no	BREAST
chr2_33673961_G_A_b38	RASGRP3	-3.214	0.00144	-0.07195	74	0.022384	no	BREAST
chr2_33673967_T_A_b38	RASGRP3	-3.214	0.00144	-0.07195	74	0.022384	no	BREAST
chr2_33658757_C_A_b38	RASGRP3	-3.211	0.00145	-0.06995	86	0.021782	no	BREAST
chr2_33577835_T_C_b38	RASGRP3	-3.201	0.0015	-0.070897	98	0.022147	no	BREAST
chr2_33655112_A_AT_b38	RASGRP3	-3.186	0.00158	-0.071708	85	0.022508	no	BREAST
chr2_33674183_T_C_b38	RASGRP3	-3.174	0.00165	-0.070649	76	0.022257	no	BREAST
chr2_33679032_C_G_b38	RASGRP3	-3.145	0.00181	-0.069671	77	0.022153	no	BREAST
chr2_33661731_A_G_b38	RASGRP3	-3.126	0.00193	-0.066299	106	0.021206	no	BREAST
chr2_33614957_G_A_b38	RASGRP3	-3.123	0.00195	-0.068274	85	0.021863	no	BREAST
chr2_32899132_A_C_b38	RASGRP3	-3.12	0.00197	-0.126161	3	0.040439	no	BREAST
chr2_33592492_A_G_b38	RASGRP3	-3.113	0.00202	-0.069013	99	0.022172	no	BREAST
chr2_33639021_G_A_b38	RASGRP3	3.108	0.00205	0.088675	15	0.028534	no	BREAST
chr2_33576389_C_T_b38	RASGRP3	-3.098	0.00212	-0.069476	95	0.022424	no	BREAST
chr2_33586449_C_G_b38	RASGRP3	-3.09	0.00217	-0.069032	98	0.022339	no	BREAST
chr2_33593131_C_T_b38	RASGRP3	-3.09	0.00217	-0.069032	98	0.022339	no	BREAST
chr2_33580247_A_G_b38	RASGRP3	-3.088	0.00219	-0.068928	97	0.02232	no	BREAST
chr2_33569651_CA_C_b38	RASGRP3	-3.073	0.0023	-0.087357	39	0.028424	no	BREAST
chr2_33575832_C_A_b38	RASGRP3	-3.066	0.00235	-0.067869	101	0.022136	no	BREAST
chr2_33652477_C_A_b38	RASGRP3	3.064	0.00237	0.086592	15	0.028264	no	BREAST
chr2_33641397_G_C_b38	RASGRP3	3.062	0.00238	0.087594	15	0.028608	no	BREAST
chr2_33664465_T_A_b38	RASGRP3	-3.058	0.00242	-0.065998	99	0.021585	no	BREAST
chr2_33659127_A_G_b38	RASGRP3	-3.048	0.00249	-0.064803	106	0.021259	no	BREAST
chr2_33673921_C_G_b38	RASGRP3	-3.041	0.00255	-0.06745	79	0.022182	no	BREAST
chr2_33709806_T_TA_b38	RASGRP3	-3.037	0.00258	-0.176013	4	0.057956	no	BREAST
chr2_33640631_A_C_b38	RASGRP3	3.025	0.00268	0.086392	15	0.028556	no	BREAST
chr2_33617107_G_A_b38	RASGRP3	-3.008	0.00283	-0.066293	85	0.022036	no	BREAST
chr2_33534694_ATT_A_b38	RASGRP3	-3.005	0.00286	-0.112459	4	0.037423	no	BREAST
chr2_33678762_C_CACTT_b38	RASGRP3	-2.999	0.00292	-0.065531	91	0.021851	no	BREAST
chr2_33625063_ATCT_A_b38	RASGRP3	-2.96	0.0033	-0.065622	78	0.022167	no	BREAST
chr2_33603617_TC_T_b38	RASGRP3	2.947	0.00344	0.099283	10	0.033687	no	BREAST
chr2_33655786_T_C_b38	RASGRP3	-2.94	0.00352	-0.063709	92	0.021671	no	BREAST
chr2_32891490_G_C_b38	RASGRP3	-2.899	0.00399	-0.07653	20	0.026395	no	BREAST
chr2_33662459_C_T_b38	RASGRP3	2.895	0.00405	0.079383	17	0.027423	no	BREAST
chr2_33615675_TA_T_b38	RASGRP3	-2.888	0.00414	-0.063739	85	0.022073	no	BREAST
chr2_32886786_G_A_b38	RASGRP3	-2.881	0.00422	-0.081612	13	0.028323	no	BREAST
chr2_33618669_C_CT_b38	RASGRP3	-2.879	0.00426	-0.063376	86	0.022016	no	BREAST
chr2_33676027_A_T_b38	RASGRP3	-2.872	0.00434	-0.063781	79	0.022205	no	BREAST
chr2_33597253_G_A_b38	RASGRP3	-2.865	0.00444	-0.065589	93	0.022892	no	BREAST
chr2_33663649_A_C_b38	RASGRP3	-2.856	0.00457	-0.0606	104	0.021219	no	BREAST
chr2_33415292_A_T_b38	RASGRP3	2.854	0.00459	0.098471	5	0.034498	no	BREAST
chr2_33519891_C_T_b38	RASGRP3	-2.849	0.00467	-0.064187	68	0.02253	no	BREAST
chr2_33734282_A_G_b38	RASGRP3	2.836	0.00486	0.15064	3	0.053118	no	BREAST
chr2_32889595_C_A_b38	RASGRP3	-2.831	0.00493	-0.079623	14	0.028123	no	BREAST
chr2_33143787_GT_G_b38	RASGRP3	2.805	0.00533	0.071201	25	0.025382	no	BREAST
chr2_33663555_T_C_b38	RASGRP3	2.794	0.00551	0.076897	17	0.027519	no	BREAST
chr2_33664742_G_C_b38	RASGRP3	-2.786	0.00564	-0.058825	103	0.021111	no	BREAST
chr2_32886723_G_A_b38	RASGRP3	-2.783	0.00571	-0.078289	14	0.028135	no	BREAST
chr2_33545133_A_T_b38	RASGRP3	-2.781	0.00574	-0.115131	3	0.041401	no	BREAST
chr2_32895706_G_A_b38	RASGRP3	-2.754	0.00622	-0.077685	14	0.028208	no	BREAST
chr2_33540561_TGTGTGTGTGTGTGTGTG_T_b38	RASGRP3	-2.751	0.00627	-0.063278	59	0.022999	no	BREAST
chr2_32871832_T_TAGAA_b38	RASGRP3	-2.749	0.00632	-0.070224	41	0.02555	no	BREAST
chr2_33518114_A_G_b38	RASGRP3	-2.743	0.00642	-0.061632	58	0.022468	no	BREAST
chr2_33661861_G_A_b38	RASGRP3	-2.722	0.00685	-0.05845	95	0.021477	no	BREAST
chr2_33603907_A_C_b38	RASGRP3	2.72	0.00688	0.092458	10	0.033992	no	BREAST
chr2_33626436_A_T_b38	RASGRP3	2.715	0.00699	0.068692	33	0.025303	no	BREAST
chr2_32891852_G_A_b38	RASGRP3	-2.703	0.00724	-0.071149	22	0.026327	no	BREAST
chr2_33414988_C_G_b38	RASGRP3	2.694	0.00743	0.092835	5	0.034461	no	BREAST
chr2_32883653_C_A_b38	RASGRP3	-2.69	0.00751	-0.076132	14	0.028298	no	BREAST
chr2_33678269_A_G_b38	RASGRP3	-2.685	0.00763	-0.059744	82	0.022254	no	BREAST
chr2_34200519_A_G_b38	RASGRP3	2.678	0.00779	0.101826	6	0.038026	no	BREAST
chr2_32898659_T_C_b38	RASGRP3	-2.669	0.008	-0.074997	16	0.028103	no	BREAST
chr2_33426861_T_C_b38	RASGRP3	2.668	0.00802	0.077852	13	0.029184	no	BREAST
chr2_33678193_G_A_b38	RASGRP3	-2.666	0.00805	-0.062304	60	0.023368	no	BREAST
chr2_32889792_T_C_b38	RASGRP3	-2.665	0.00807	-0.075161	14	0.028199	no	BREAST
chr2_32896427_T_C_b38	RASGRP3	-2.665	0.00807	-0.075161	14	0.028199	no	BREAST
chr2_33738410_A_T_b38	RASGRP3	2.662	0.00814	0.144934	3	0.054436	no	BREAST
chr2_33618734_A_G_b38	RASGRP3	-2.654	0.00834	-0.058764	85	0.022138	no	BREAST
chr2_33615450_C_G_b38	RASGRP3	2.652	0.00839	0.097044	4	0.03659	no	BREAST
chr2_33615793_A_T_b38	RASGRP3	2.652	0.00839	0.097044	4	0.03659	no	BREAST
chr2_33621944_G_A_b38	RASGRP3	2.652	0.00839	0.097044	4	0.03659	no	BREAST
chr2_33623483_C_T_b38	RASGRP3	2.652	0.00839	0.097044	4	0.03659	no	BREAST
chr2_33276859_A_G_b38	RASGRP3	2.631	0.00891	0.059401	93	0.022574	no	BREAST
chr2_33602942_T_C_b38	RASGRP3	2.631	0.00891	0.100793	3	0.038306	no	BREAST
chr2_33274040_G_A_b38	RASGRP3	2.63	0.00894	0.060148	90	0.022868	no	BREAST
chr2_32892533_C_T_b38	RASGRP3	-2.628	0.00898	-0.069401	22	0.026403	no	BREAST
chr2_33536322_GA_G_b38	RASGRP3	-2.621	0.00918	-0.060787	87	0.023193	no	BREAST
chr2_33629657_C_CT_b38	RASGRP3	2.611	0.00944	0.079786	14	0.030554	no	BREAST
chr2_33561322_C_T_b38	RASGRP3	-2.61	0.00948	-0.080146	13	0.030708	no	BREAST
chr2_33520269_T_C_b38	RASGRP3	2.595	0.0099	0.068191	21	0.026282	no	BREAST
chr2_33427673_T_C_b38	RASGRP3	-5.94	6.07e-09	-0.085394	127	0.014376	yes	CULTFB
chr2_33426748_C_G_b38	RASGRP3	-5.82	1.18e-08	-0.083693	121	0.01438	yes	CULTFB
chr2_33427035_G_T_b38	RASGRP3	-5.769	1.57e-08	-0.082646	121	0.014326	yes	CULTFB
chr2_33427037_T_G_b38	RASGRP3	-5.769	1.57e-08	-0.082646	121	0.014326	yes	CULTFB
chr2_33427522_C_T_b38	RASGRP3	-5.651	2.97e-08	-0.080181	123	0.014188	yes	CULTFB
chr2_33428475_A_G_b38	RASGRP3	-5.572	4.56e-08	-0.079419	126	0.014254	yes	CULTFB
chr2_33423897_T_C_b38	RASGRP3	-5.507	6.45e-08	-0.080097	101	0.014546	yes	CULTFB
chr2_33413779_A_G_b38	RASGRP3	-5.364	1.36e-07	-0.078017	102	0.014544	yes	CULTFB
chr2_33416249_C_T_b38	RASGRP3	-5.158	3.89e-07	-0.075421	110	0.014623	yes	CULTFB
chr2_33427777_A_T_b38	RASGRP3	-5.026	7.47e-07	-0.070837	125	0.014093	yes	CULTFB
chr2_33523461_TA_T_b38	RASGRP3	4.941	1.13e-06	0.097353	10	0.019703	yes	CULTFB
chr2_33475871_A_C_b38	RASGRP3	-4.557	6.85e-06	-0.068694	58	0.015075	yes	CULTFB
chr2_33428911_A_G_b38	RASGRP3	-4.498	8.95e-06	-0.064097	106	0.014251	yes	CULTFB
chr2_33536526_G_A_b38	RASGRP3	4.492	9.16e-06	0.108743	3	0.024206	yes	CULTFB
chr2_33536528_G_A_b38	RASGRP3	4.492	9.16e-06	0.108743	3	0.024206	yes	CULTFB
chr2_33427259_A_T_b38	RASGRP3	-4.486	9.42e-06	-0.063455	107	0.014145	yes	CULTFB
chr2_33537896_A_G_b38	RASGRP3	4.364	1.62e-05	0.103076	3	0.023621	yes	CULTFB
chr2_33423274_C_T_b38	RASGRP3	-4.223	2.96e-05	-0.060474	112	0.014319	yes	CULTFB
chr2_33529318_C_T_b38	RASGRP3	4.169	3.73e-05	0.081305	11	0.019502	yes	CULTFB
chr2_33410432_C_G_b38	RASGRP3	4.164	3.81e-05	0.06126	91	0.014712	yes	CULTFB
chr2_33422417_G_A_b38	RASGRP3	-4.131	4.37e-05	-0.058854	110	0.014247	yes	CULTFB
chr2_33423935_C_G_b38	RASGRP3	-4.025	6.79e-05	-0.061524	70	0.015287	yes	CULTFB
chr2_33428683_T_A_b38	RASGRP3	-4.001	7.47e-05	-0.079913	18	0.019971	yes	CULTFB
chr2_33557635_G_A_b38	RASGRP3	3.969	8.51e-05	0.093353	3	0.02352	yes	CULTFB
chr2_33559304_G_A_b38	RASGRP3	3.969	8.51e-05	0.093353	3	0.02352	yes	CULTFB
chr2_33559068_A_G_b38	RASGRP3	3.961	8.79e-05	0.095161	3	0.024025	yes	CULTFB
chr2_33428699_T_A_b38	RASGRP3	-3.944	9.42e-05	-0.073665	25	0.018678	yes	CULTFB
chr2_33559734_G_A_b38	RASGRP3	3.915	0.000106	0.091888	3	0.02347	yes	CULTFB
chr2_33470380_ATT_A_b38	RASGRP3	3.859	0.000132	0.065629	74	0.017005	yes	CULTFB
chr2_33478490_C_T_b38	RASGRP3	3.755	0.000198	0.056201	72	0.014967	yes	CULTFB
chr2_33427610_G_A_b38	RASGRP3	-3.72	0.000227	-0.084707	8	0.022771	yes	CULTFB
chr2_33420583_A_C_b38	RASGRP3	-3.719	0.000228	-0.05587	80	0.015022	yes	CULTFB
chr2_33523649_G_A_b38	RASGRP3	3.717	0.00023	0.072996	15	0.019641	yes	CULTFB
chr2_33416484_C_G_b38	RASGRP3	-3.657	0.000288	-0.055949	72	0.015298	yes	CULTFB
chr2_33458089_T_A_b38	RASGRP3	3.558	0.000416	0.094296	5	0.026499	yes	CULTFB
chr2_33458663_A_T_b38	RASGRP3	3.558	0.000416	0.094296	5	0.026499	yes	CULTFB
chr2_33552022_CAAACA_C_b38	RASGRP3	3.534	0.000456	0.08594	3	0.024319	yes	CULTFB
chr2_33470875_C_T_b38	RASGRP3	3.513	0.000492	0.050453	108	0.014361	yes	CULTFB
chr2_33548762_A_G_b38	RASGRP3	3.506	0.000505	0.087142	3	0.024857	yes	CULTFB
chr2_33548469_T_C_b38	RASGRP3	3.444	0.000632	0.083565	3	0.024265	yes	CULTFB
chr2_33550484_C_G_b38	RASGRP3	3.444	0.000632	0.083565	3	0.024265	yes	CULTFB
chr2_33551676_A_G_b38	RASGRP3	3.444	0.000632	0.083565	3	0.024265	yes	CULTFB
chr2_33551697_A_T_b38	RASGRP3	3.444	0.000632	0.083565	3	0.024265	yes	CULTFB
chr2_33554542_A_G_b38	RASGRP3	3.444	0.000632	0.083565	3	0.024265	yes	CULTFB
chr2_33553995_C_T_b38	RASGRP3	3.418	0.000693	0.081642	4	0.023884	yes	CULTFB
chr2_33550216_T_A_b38	RASGRP3	3.403	0.000732	0.082548	3	0.024258	yes	CULTFB
chr2_33448754_AC_A_b38	RASGRP3	3.338	0.000921	0.08879	5	0.0266	yes	CULTFB
chr2_33449317_C_T_b38	RASGRP3	3.338	0.000921	0.08879	5	0.0266	yes	CULTFB
chr2_33494042_A_G_b38	RASGRP3	-3.336	0.000928	-0.080649	4	0.024177	yes	CULTFB
chr2_33477835_C_T_b38	RASGRP3	3.279	0.00113	0.061354	18	0.018709	yes	CULTFB
chr2_33478863_G_A_b38	RASGRP3	3.247	0.00126	0.04892	114	0.015068	yes	CULTFB
chr2_33429428_C_T_b38	RASGRP3	-3.202	0.00147	-0.046925	83	0.014656	yes	CULTFB
chr2_33489038_G_A_b38	RASGRP3	-3.141	0.0018	-0.076065	4	0.024215	yes	CULTFB
chr2_33484975_G_T_b38	RASGRP3	-3.093	0.00212	-0.072369	5	0.023399	yes	CULTFB
chr2_33486318_C_G_b38	RASGRP3	-3.073	0.00226	-0.07193	5	0.023409	yes	CULTFB
chr2_33613720_G_A_b38	RASGRP3	3.06	0.00236	0.065652	14	0.021454	yes	CULTFB
chr2_33482289_G_C_b38	RASGRP3	-3.054	0.0024	-0.066779	15	0.021864	yes	CULTFB
chr2_33486716_G_A_b38	RASGRP3	-3.011	0.00277	-0.070682	5	0.023478	yes	CULTFB
chr2_33484894_T_C_b38	RASGRP3	-2.993	0.00293	-0.069924	5	0.023364	yes	CULTFB
chr2_33486492_C_CT_b38	RASGRP3	-2.987	0.00298	-0.066137	13	0.02214	yes	CULTFB
chr2_33428669_ATTT_A_b38	RASGRP3	-2.966	0.0032	-0.095158	5	0.032086	yes	CULTFB
chr2_33834683_T_G_b38	RASGRP3	-2.961	0.00324	-0.059625	14	0.020136	yes	CULTFB
chr2_32643188_T_C_b38	RASGRP3	2.954	0.00332	0.056124	19	0.018998	yes	CULTFB
chr2_33493789_T_C_b38	RASGRP3	-2.939	0.00348	-0.066744	10	0.022713	yes	CULTFB
chr2_33824275_C_T_b38	RASGRP3	-2.937	0.0035	-0.065064	10	0.02215	yes	CULTFB
chr2_33483586_T_TC_b38	RASGRP3	-2.906	0.00386	-0.068264	5	0.023493	yes	CULTFB
chr2_33555164_G_A_b38	RASGRP3	2.881	0.00417	0.055809	17	0.019369	yes	CULTFB
chr2_33566193_A_G_b38	RASGRP3	-2.866	0.00437	-0.065198	5	0.022749	yes	CULTFB
chr2_33482667_T_C_b38	RASGRP3	-2.858	0.00448	-0.068104	5	0.023832	yes	CULTFB
chr2_32905924_A_T_b38	RASGRP3	2.846	0.00465	0.041553	76	0.014602	yes	CULTFB
chr2_33483347_T_C_b38	RASGRP3	-2.838	0.00477	-0.067183	5	0.023675	yes	CULTFB
chr2_33478322_G_A_b38	RASGRP3	2.835	0.00481	0.062842	12	0.022166	yes	CULTFB
chr2_33781569_A_AGT_b38	RASGRP3	2.834	0.00483	0.05192	18	0.018323	yes	CULTFB
chr2_33823361_T_C_b38	RASGRP3	-2.767	0.00592	-0.061301	10	0.022157	yes	CULTFB
chr2_33054064_C_G_b38	RASGRP3	-2.751	0.0062	-0.083986	13	0.030527	yes	CULTFB
chr2_33429935_T_C_b38	RASGRP3	-2.743	0.00635	-0.040458	125	0.014749	yes	CULTFB
chr2_33568917_T_C_b38	RASGRP3	-2.734	0.00653	-0.06214	5	0.022729	yes	CULTFB
chr2_33493612_C_T_b38	RASGRP3	-2.727	0.00665	-0.067179	4	0.02463	yes	CULTFB
chr2_33416785_G_A_b38	RASGRP3	-2.718	0.00685	-0.042326	55	0.015573	yes	CULTFB
chr2_33483591_T_C_b38	RASGRP3	-2.714	0.00692	-0.060077	12	0.022133	yes	CULTFB
chr2_33478150_C_G_b38	RASGRP3	-2.713	0.00694	-0.066972	5	0.024681	yes	CULTFB
chr2_33826217_C_T_b38	RASGRP3	-2.695	0.00732	-0.06358	5	0.023588	yes	CULTFB
chr2_33547053_GAA_G_b38	RASGRP3	2.687	0.00749	0.082801	3	0.030811	yes	CULTFB
chr2_33826476_A_C_b38	RASGRP3	-2.687	0.0075	-0.057321	10	0.021331	yes	CULTFB
chr2_33826485_T_G_b38	RASGRP3	-2.687	0.0075	-0.057321	10	0.021331	yes	CULTFB
chr2_33486900_T_C_b38	RASGRP3	-2.669	0.00791	-0.058378	12	0.021873	yes	CULTFB
chr2_33482114_T_C_b38	RASGRP3	-2.662	0.00807	-0.058508	12	0.021979	yes	CULTFB
chr2_33476930_C_CG_b38	RASGRP3	2.651	0.00833	0.041162	103	0.015527	yes	CULTFB
chr2_33477035_T_G_b38	RASGRP3	2.651	0.00833	0.041162	103	0.015527	yes	CULTFB
chr2_33477050_G_GA_b38	RASGRP3	2.651	0.00833	0.041162	103	0.015527	yes	CULTFB
chr2_33485510_G_A_b38	RASGRP3	-2.644	0.0085	-0.05111	19	0.019328	yes	CULTFB
chr2_33801834_GT_G_b38	RASGRP3	2.621	0.00909	0.042261	50	0.016124	yes	CULTFB
chr2_33483036_TA_T_b38	RASGRP3	-2.621	0.0091	-0.053961	7	0.02059	yes	CULTFB
chr2_32642606_C_T_b38	RASGRP3	2.619	0.00915	0.049329	18	0.018836	yes	CULTFB
chr2_33825471_A_G_b38	RASGRP3	-2.618	0.00917	-0.056284	10	0.021499	yes	CULTFB
chr2_33824414_T_C_b38	RASGRP3	-2.61	0.00938	-0.055461	10	0.021248	yes	CULTFB
chr2_33498624_C_G_b38	RASGRP3	-2.607	0.00946	-0.066025	4	0.025324	yes	CULTFB
chr2_33505224_A_G_b38	RASGRP3	-2.589	0.00998	-0.069009	3	0.026659	yes	CULTFB
chr2_33529269_C_A_b38	RASGRP3	4.724	3.18e-06	0.108172	4	0.022901	no	CULTFB
chr2_33526597_C_T_b38	RASGRP3	4.575	6.32e-06	0.107849	3	0.023576	no	CULTFB
chr2_33527062_GC_G_b38	RASGRP3	4.575	6.32e-06	0.107849	3	0.023576	no	CULTFB
chr2_33418673_T_G_b38	RASGRP3	-4.453	1.09e-05	-0.072177	86	0.016208	no	CULTFB
chr2_33531453_C_T_b38	RASGRP3	4.434	1.19e-05	0.102625	4	0.023144	no	CULTFB
chr2_33426861_T_C_b38	RASGRP3	-4.433	1.2e-05	-0.083097	19	0.018747	no	CULTFB
chr2_33428559_G_T_b38	RASGRP3	-4.336	1.82e-05	-0.082166	18	0.018948	no	CULTFB
chr2_33557844_G_A_b38	RASGRP3	4.285	2.28e-05	0.098114	5	0.022897	no	CULTFB
chr2_33422704_G_A_b38	RASGRP3	-4.218	3.03e-05	-0.060159	105	0.014263	no	CULTFB
chr2_33428691_T_A_b38	RASGRP3	-4.042	6.33e-05	-0.079447	20	0.019656	no	CULTFB
chr2_33426889_G_A_b38	RASGRP3	-3.886	0.000119	-0.086012	9	0.022132	no	CULTFB
chr2_33537192_G_GAT_b38	RASGRP3	3.85	0.000137	0.087296	5	0.022672	no	CULTFB
chr2_33540561_TGTGTGTGTGTG_T_b38	RASGRP3	3.676	0.000268	0.08037	14	0.021862	no	CULTFB
chr2_33469036_C_CA_b38	RASGRP3	3.522	0.000475	0.051379	103	0.014586	no	CULTFB
chr2_33561445_C_A_b38	RASGRP3	3.509	5e-04	0.067362	17	0.019197	no	CULTFB
chr2_33469845_C_T_b38	RASGRP3	3.392	0.00076	0.049471	104	0.014584	no	CULTFB
chr2_33546942_C_G_b38	RASGRP3	3.366	0.000833	0.080528	5	0.023921	no	CULTFB
chr2_33537330_C_CCCAACACA_b38	RASGRP3	3.335	0.000932	0.067856	23	0.02035	no	CULTFB
chr2_33812290_G_T_b38	RASGRP3	-3.198	0.00149	-0.073879	5	0.023101	no	CULTFB
chr2_33539987_GAAAAA_G_b38	RASGRP3	3.071	0.00228	0.082967	3	0.027019	no	CULTFB
chr2_33410880_A_ATCTCCTTC_b38	RASGRP3	-3.068	0.0023	-0.046112	79	0.015032	no	CULTFB
chr2_33470505_G_A_b38	RASGRP3	2.999	0.00287	0.04392	88	0.014644	no	CULTFB
chr2_33470006_T_C_b38	RASGRP3	2.993	0.00293	0.044083	86	0.01473	no	CULTFB
chr2_33470233_G_A_b38	RASGRP3	2.976	0.00309	0.044037	85	0.014797	no	CULTFB
chr2_33470439_G_A_b38	RASGRP3	2.95	0.00335	0.043384	87	0.014705	no	CULTFB
chr2_33470311_T_A_b38	RASGRP3	2.946	0.0034	0.043669	85	0.014824	no	CULTFB
chr2_33471897_ATT_A_b38	RASGRP3	2.927	0.00361	0.055389	21	0.018922	no	CULTFB
chr2_33830883_C_T_b38	RASGRP3	-2.925	0.00363	-0.065794	8	0.022494	no	CULTFB
chr2_33477612_G_T_b38	RASGRP3	2.924	0.00364	0.044733	102	0.015298	no	CULTFB
chr2_33831550_A_G_b38	RASGRP3	-2.917	0.00373	-0.065328	8	0.022397	no	CULTFB
chr2_33470756_C_T_b38	RASGRP3	2.895	0.004	0.042807	86	0.014787	no	CULTFB
chr2_33512177_G_A_b38	RASGRP3	2.873	0.00427	0.060603	14	0.021091	no	CULTFB
chr2_33427776_C_CTTTTTT_b38	RASGRP3	-2.862	0.00443	-0.072456	12	0.025319	no	CULTFB
chr2_33469436_T_C_b38	RASGRP3	2.856	0.00451	0.042621	83	0.014925	no	CULTFB
chr2_33416865_G_A_b38	RASGRP3	-2.784	0.00561	-0.043939	52	0.015781	no	CULTFB
chr2_32548365_C_CTT_b38	RASGRP3	2.758	0.00607	0.1295	4	0.046953	no	CULTFB
chr2_33002109_T_G_b38	RASGRP3	-2.758	0.00607	-0.100878	9	0.036577	no	CULTFB
chr2_33651789_G_A_b38	RASGRP3	2.749	0.00625	0.102481	3	0.037286	no	CULTFB
chr2_33115037_TACACAC_T_b38	RASGRP3	2.747	0.00627	0.047717	27	0.017369	no	CULTFB
chr2_33476728_C_CCT_b38	RASGRP3	2.725	0.0067	0.04334	109	0.015903	no	CULTFB
chr2_32907754_A_G_b38	RASGRP3	2.725	0.0067	0.039872	76	0.014631	no	CULTFB
chr2_33410622_CA_C_b38	RASGRP3	-2.724	0.00673	-0.056003	18	0.02056	no	CULTFB
chr2_33474954_T_C_b38	RASGRP3	2.717	0.00687	0.041382	112	0.015231	no	CULTFB
chr2_33041463_C_T_b38	RASGRP3	-2.71	0.00701	-0.119507	4	0.044097	no	CULTFB
chr2_33476565_C_T_b38	RASGRP3	-2.693	0.00736	-0.066321	5	0.024624	no	CULTFB
chr2_33475238_C_T_b38	RASGRP3	2.671	0.00785	0.058049	8	0.02173	no	CULTFB
chr2_33471935_G_T_b38	RASGRP3	2.641	0.00858	0.050935	16	0.019285	no	CULTFB
chr2_32911226_A_G_b38	RASGRP3	2.62	0.00911	0.038214	77	0.014583	no	CULTFB
chr2_33936672_T_C_b38	RASGRP3	2.614	0.00928	0.113108	4	0.043275	no	CULTFB
chr2_33594385_G_A_b38	RASGRP3	2.593	0.00985	0.047103	30	0.018164	no	CULTFB
chr2_33596617_C_T_b38	RASGRP3	2.588	0.00998	0.047521	29	0.018359	no	CULTFB
chr2_33537192_G_GAT_b38	RASGRP3	5.071	1.44e-06	0.183924	4	0.036267	yes	EBVTLC
chr2_33529269_C_A_b38	RASGRP3	4.595	1.07e-05	0.179161	3	0.03899	yes	EBVTLC
chr2_33531453_C_T_b38	RASGRP3	4.385	2.49e-05	0.175154	3	0.039948	yes	EBVTLC
chr2_33521266_C_T_b38	RASGRP3	4.313	3.31e-05	0.156833	15	0.036366	yes	EBVTLC
chr2_33537330_C_CCCAACACA_b38	RASGRP3	4.258	4.1e-05	0.142672	11	0.033509	yes	EBVTLC
chr2_33512177_G_A_b38	RASGRP3	4.129	6.73e-05	0.152922	7	0.037036	yes	EBVTLC
chr2_33525341_A_AAT_b38	RASGRP3	3.998	0.00011	0.153222	7	0.038325	yes	EBVTLC
chr2_33529318_C_T_b38	RASGRP3	3.817	0.000214	0.139857	5	0.036636	yes	EBVTLC
chr2_33539996_AAAAAG_A_b38	RASGRP3	-3.755	0.000268	-0.114636	29	0.030529	yes	EBVTLC
chr2_33523649_G_A_b38	RASGRP3	3.735	0.000287	0.138219	8	0.037004	yes	EBVTLC
chr2_33464237_G_A_b38	RASGRP3	-3.686	0.000342	-0.143505	4	0.038929	yes	EBVTLC
chr2_33514489_T_C_b38	RASGRP3	-3.58	0.000496	-0.099879	28	0.027901	yes	EBVTLC
chr2_33463583_T_C_b38	RASGRP3	-3.551	0.000549	-0.136206	4	0.038362	yes	EBVTLC
chr2_33557844_G_A_b38	RASGRP3	3.549	0.000552	0.141753	3	0.039945	yes	EBVTLC
chr2_32969229_T_G_b38	RASGRP3	-3.523	0.000603	-0.123404	5	0.03503	yes	EBVTLC
chr2_33478490_C_T_b38	RASGRP3	3.456	0.000758	0.11315	14	0.032744	yes	EBVTLC
chr2_33664073_A_G_b38	RASGRP3	-3.416	0.000866	-0.142272	5	0.041648	yes	EBVTLC
chr2_33508487_T_C_b38	RASGRP3	3.392	0.000939	0.150239	5	0.044295	yes	EBVTLC
chr2_34013397_G_C_b38	RASGRP3	-3.378	0.000982	-0.129973	5	0.038474	yes	EBVTLC
chr2_33512820_T_A_b38	RASGRP3	-3.329	0.00116	-0.09686	22	0.029097	yes	EBVTLC
chr2_33463642_G_A_b38	RASGRP3	-3.326	0.00117	-0.142966	3	0.042987	yes	EBVTLC
chr2_33561445_C_A_b38	RASGRP3	3.278	0.00136	0.121232	7	0.036981	yes	EBVTLC
chr2_33812026_C_CAAA_b38	RASGRP3	3.258	0.00145	0.115664	12	0.035496	yes	EBVTLC
chr2_33477419_C_G_b38	RASGRP3	-3.242	0.00154	-0.124563	4	0.038426	yes	EBVTLC
chr2_33669621_C_T_b38	RASGRP3	-3.211	0.0017	-0.092553	27	0.028827	yes	EBVTLC
chr2_33669751_C_T_b38	RASGRP3	-3.211	0.0017	-0.092553	27	0.028827	yes	EBVTLC
chr2_33670200_G_T_b38	RASGRP3	-3.211	0.0017	-0.092553	27	0.028827	yes	EBVTLC
chr2_33520141_T_C_b38	RASGRP3	-3.156	0.00202	-0.095647	33	0.030304	yes	EBVTLC
chr2_33458317_C_T_b38	RASGRP3	-3.156	0.00202	-0.12343	3	0.039113	yes	EBVTLC
chr2_33511010_G_A_b38	RASGRP3	3.149	0.00206	0.142261	3	0.045176	yes	EBVTLC
chr2_33474721_C_T_b38	RASGRP3	-3.138	0.00213	-0.118823	5	0.03786	yes	EBVTLC
chr2_33519891_C_T_b38	RASGRP3	-3.114	0.0023	-0.095349	29	0.030617	yes	EBVTLC
chr2_33470756_C_T_b38	RASGRP3	3.109	0.00234	0.097581	21	0.03139	yes	EBVTLC
chr2_33555164_G_A_b38	RASGRP3	3.1	0.00241	0.11462	7	0.036978	yes	EBVTLC
chr2_33469436_T_C_b38	RASGRP3	3.077	0.00258	0.097022	20	0.031529	yes	EBVTLC
chr2_33518114_A_G_b38	RASGRP3	-3.062	0.00271	-0.090827	22	0.029663	yes	EBVTLC
chr2_33656248_TTC_T_b38	RASGRP3	3.045	0.00285	0.102033	8	0.033506	yes	EBVTLC
chr2_33470006_T_C_b38	RASGRP3	3.024	0.00305	0.094122	21	0.031125	yes	EBVTLC
chr2_33530497_CT_C_b38	RASGRP3	2.989	0.00339	0.11026	5	0.036893	yes	EBVTLC
chr2_33657078_T_C_b38	RASGRP3	2.986	0.00343	0.093802	17	0.031419	yes	EBVTLC
chr2_33473933_A_G_b38	RASGRP3	-2.981	0.00347	-0.105825	8	0.035499	yes	EBVTLC
chr2_33538430_G_C_b38	RASGRP3	-2.971	0.00358	-0.127861	3	0.043036	yes	EBVTLC
chr2_33663555_T_C_b38	RASGRP3	2.969	0.0036	0.100489	8	0.033847	yes	EBVTLC
chr2_33662459_C_T_b38	RASGRP3	2.965	0.00364	0.099692	8	0.033619	yes	EBVTLC
chr2_33478863_G_A_b38	RASGRP3	2.933	0.00402	0.089876	30	0.030644	yes	EBVTLC
chr2_33465902_A_G_b38	RASGRP3	-2.921	0.00417	-0.098152	12	0.033606	yes	EBVTLC
chr2_33591195_C_CT_b38	RASGRP3	-2.9	0.00443	-0.097528	15	0.033629	yes	EBVTLC
chr2_33528012_T_G_b38	RASGRP3	-2.889	0.00458	-0.102369	8	0.035433	yes	EBVTLC
chr2_33534062_A_C_b38	RASGRP3	-2.873	0.0048	-0.116025	3	0.04038	yes	EBVTLC
chr2_33650021_A_G_b38	RASGRP3	2.861	0.00498	0.095457	8	0.033367	yes	EBVTLC
chr2_33536322_G_GA_b38	RASGRP3	2.858	0.00501	0.12862	4	0.044997	yes	EBVTLC
chr2_33656848_TA_T_b38	RASGRP3	2.85	0.00514	0.092094	14	0.03231	yes	EBVTLC
chr2_33466742_G_A_b38	RASGRP3	2.837	0.00534	0.094289	22	0.033232	yes	EBVTLC
chr2_33512902_A_G_b38	RASGRP3	-2.834	0.00538	-0.089263	35	0.031493	yes	EBVTLC
chr2_33793623_T_G_b38	RASGRP3	-2.831	0.00544	-0.106245	4	0.037534	yes	EBVTLC
chr2_33563470_A_ATACT_b38	RASGRP3	-2.768	0.00652	-0.121541	4	0.043906	yes	EBVTLC
chr2_32762276_AGTGTGTGTGTGT_A_b38	RASGRP3	2.765	0.00659	0.122902	3	0.044451	yes	EBVTLC
chr2_33423092_CA_C_b38	RASGRP3	-2.761	0.00665	-0.091832	12	0.033256	yes	EBVTLC
chr2_33533272_T_C_b38	RASGRP3	-2.738	0.00712	-0.117134	3	0.042781	yes	EBVTLC
chr2_33652477_C_A_b38	RASGRP3	2.737	0.00713	0.092071	8	0.033637	yes	EBVTLC
chr2_33469790_T_G_b38	RASGRP3	-2.737	0.00714	-0.103553	5	0.037839	yes	EBVTLC
chr2_33472085_T_C_b38	RASGRP3	-2.737	0.00714	-0.103553	5	0.037839	yes	EBVTLC
chr2_33253698_A_G_b38	RASGRP3	2.721	0.00747	0.117504	5	0.043187	yes	EBVTLC
chr2_33661156_C_T_b38	RASGRP3	2.7	0.00794	0.087718	11	0.032492	yes	EBVTLC
chr2_33661310_C_T_b38	RASGRP3	2.7	0.00794	0.087718	11	0.032492	yes	EBVTLC
chr2_33258182_C_A_b38	RASGRP3	2.698	0.00797	0.117593	4	0.04358	yes	EBVTLC
chr2_32681978_ATATGTGTGTG_A_b38	RASGRP3	-2.698	0.00798	-0.117176	3	0.043435	yes	EBVTLC
chr2_34410411_T_G_b38	RASGRP3	-2.68	0.00839	-0.098313	7	0.036685	yes	EBVTLC
chr2_33443970_C_T_b38	RASGRP3	2.677	0.00846	0.101875	4	0.038053	yes	EBVTLC
chr2_33311084_A_G_b38	RASGRP3	-2.669	0.00865	-0.099903	9	0.037431	yes	EBVTLC
chr2_33661940_T_G_b38	RASGRP3	-2.666	0.00872	-0.083073	39	0.031156	yes	EBVTLC
chr2_33545200_T_C_b38	RASGRP3	-2.653	0.00904	-0.10519	4	0.039644	yes	EBVTLC
chr2_33525341_AAT_A_b38	RASGRP3	-2.647	0.00919	-0.112916	3	0.042652	yes	EBVTLC
chr2_33106152_T_C_b38	RASGRP3	-2.632	0.0096	-0.088049	27	0.033456	yes	EBVTLC
chr2_33664871_G_GT_b38	RASGRP3	-3.412	0.000879	-0.092076	36	0.026989	no	EBVTLC
chr2_33543901_C_G_b38	RASGRP3	-3.265	0.00142	-0.103181	17	0.031598	no	EBVTLC
chr2_33661861_G_A_b38	RASGRP3	-3.146	0.00209	-0.086352	35	0.027451	no	EBVTLC
chr2_33470233_G_A_b38	RASGRP3	3.124	0.00223	0.097488	21	0.031208	no	EBVTLC
chr2_33470311_T_A_b38	RASGRP3	3.124	0.00223	0.097488	21	0.031208	no	EBVTLC
chr2_33470439_G_A_b38	RASGRP3	3.124	0.00223	0.097488	21	0.031208	no	EBVTLC
chr2_33534694_A_AT_b38	RASGRP3	3.083	0.00254	0.108434	9	0.035176	no	EBVTLC
chr2_33663649_A_C_b38	RASGRP3	-3.065	0.00268	-0.082686	39	0.026974	no	EBVTLC
chr2_34029455_C_T_b38	RASGRP3	-3.064	0.00269	-0.078767	42	0.025707	no	EBVTLC
chr2_34029838_T_TA_b38	RASGRP3	-3.064	0.00269	-0.078767	42	0.025707	no	EBVTLC
chr2_32890658_C_CTTT_b38	RASGRP3	3.056	0.00276	0.1227	4	0.040152	no	EBVTLC
chr2_33540561_TGTGTGTGTGTG_T_b38	RASGRP3	3.037	0.00292	0.111208	9	0.036614	no	EBVTLC
chr2_33569651_CA_C_b38	RASGRP3	-2.992	0.00336	-0.114102	7	0.03814	no	EBVTLC
chr2_34247220_A_T_b38	RASGRP3	-2.952	0.0038	-0.100882	13	0.034176	no	EBVTLC
chr2_33659127_A_G_b38	RASGRP3	-2.943	0.0039	-0.07985	38	0.027132	no	EBVTLC
chr2_33664465_T_A_b38	RASGRP3	-2.943	0.0039	-0.07985	38	0.027132	no	EBVTLC
chr2_33470505_G_A_b38	RASGRP3	2.919	0.00419	0.091082	22	0.031201	no	EBVTLC
chr2_33664742_G_C_b38	RASGRP3	-2.901	0.00441	-0.079983	37	0.027566	no	EBVTLC
chr2_34043066_CCTTTTT_C_b38	RASGRP3	-2.877	0.00474	-0.074966	22	0.026055	no	EBVTLC
chr2_33563038_A_G_b38	RASGRP3	-2.857	0.00504	-0.112024	6	0.039214	no	EBVTLC
chr2_33236551_T_A_b38	RASGRP3	2.85	0.00514	0.127969	3	0.044901	no	EBVTLC
chr2_33470380_ATT_A_b38	RASGRP3	2.811	0.00576	0.100823	24	0.035863	no	EBVTLC
chr2_33661731_A_G_b38	RASGRP3	-2.81	0.00578	-0.076325	38	0.027162	no	EBVTLC
chr2_33296567_A_G_b38	RASGRP3	2.758	0.00672	0.121889	3	0.044195	no	EBVTLC
chr2_33238059_C_CTTAAAGTGAACTCCTGTACTTAAAG_b38	RASGRP3	2.753	0.00682	0.122655	3	0.044555	no	EBVTLC
chr2_33235192_G_A_b38	RASGRP3	2.735	0.00717	0.123235	3	0.045052	no	EBVTLC
chr2_33655112_A_AT_b38	RASGRP3	-2.652	0.00907	-0.085872	22	0.032376	no	EBVTLC
chr2_34024158_G_C_b38	RASGRP3	-2.637	0.00947	-0.069808	37	0.026477	no	EBVTLC
chr2_34113957_TTACATTATA_T_b38	RASGRP3	-2.617	0.01	-0.08332	20	0.031837	no	EBVTLC
chr2_33526597_C_T_b38	RASGRP3	8.503	1.43e-15	0.204448	4	0.024045	yes	CLNSGM
chr2_33527062_GC_G_b38	RASGRP3	8.503	1.43e-15	0.204448	4	0.024045	yes	CLNSGM
chr2_33529269_C_A_b38	RASGRP3	8.493	1.53e-15	0.200896	4	0.023655	yes	CLNSGM
chr2_33531453_C_T_b38	RASGRP3	8.365	3.62e-15	0.198219	4	0.023697	yes	CLNSGM
chr2_33557844_G_A_b38	RASGRP3	7.861	9.92e-14	0.186054	5	0.023667	yes	CLNSGM
chr2_33537896_A_G_b38	RASGRP3	7.561	6.75e-13	0.187567	3	0.024807	yes	CLNSGM
chr2_33557635_G_A_b38	RASGRP3	7.294	3.58e-12	0.18317	3	0.025113	yes	CLNSGM
chr2_33559304_G_A_b38	RASGRP3	7.294	3.58e-12	0.18317	3	0.025113	yes	CLNSGM
chr2_33559734_G_A_b38	RASGRP3	7.189	6.79e-12	0.180499	3	0.025106	yes	CLNSGM
chr2_33559068_A_G_b38	RASGRP3	7.061	1.49e-11	0.17825	3	0.025246	yes	CLNSGM
chr2_33537330_C_CCCAACACA_b38	RASGRP3	7.031	1.78e-11	0.153633	15	0.021852	yes	CLNSGM
chr2_33540561_TGTGTGTGTGTG_T_b38	RASGRP3	6.981	2.4e-11	0.172724	5	0.02474	yes	CLNSGM
chr2_33537192_G_GAT_b38	RASGRP3	6.901	3.87e-11	0.160101	4	0.023198	yes	CLNSGM
chr2_33546942_C_G_b38	RASGRP3	6.527	3.46e-10	0.167753	4	0.025703	yes	CLNSGM
chr2_33552022_CAAACA_C_b38	RASGRP3	6.521	3.58e-10	0.172666	3	0.02648	yes	CLNSGM
chr2_33512177_G_A_b38	RASGRP3	6.43	6.01e-10	0.144135	10	0.022416	yes	CLNSGM
chr2_33548469_T_C_b38	RASGRP3	6.339	1.01e-09	0.168505	3	0.026582	yes	CLNSGM
chr2_33550216_T_A_b38	RASGRP3	6.339	1.01e-09	0.168505	3	0.026582	yes	CLNSGM
chr2_33550484_C_G_b38	RASGRP3	6.339	1.01e-09	0.168505	3	0.026582	yes	CLNSGM
chr2_33554542_A_G_b38	RASGRP3	6.339	1.01e-09	0.168505	3	0.026582	yes	CLNSGM
chr2_33539987_GAAAAA_G_b38	RASGRP3	6.246	1.69e-09	0.174649	3	0.027961	yes	CLNSGM
chr2_33553995_C_T_b38	RASGRP3	6.229	1.86e-09	0.16526	3	0.026529	yes	CLNSGM
chr2_33548762_A_G_b38	RASGRP3	6.082	4.19e-09	0.163698	3	0.026916	yes	CLNSGM
chr2_33561445_C_A_b38	RASGRP3	6.071	4.44e-09	0.124962	12	0.020583	yes	CLNSGM
chr2_33529318_C_T_b38	RASGRP3	5.994	6.76e-09	0.124933	10	0.020844	yes	CLNSGM
chr2_33556928_C_CACACACATACAT_b38	RASGRP3	5.865	1.35e-08	0.139615	5	0.023804	yes	CLNSGM
chr2_33555164_G_A_b38	RASGRP3	5.445	1.19e-07	0.116089	11	0.02132	yes	CLNSGM
chr2_33521266_C_T_b38	RASGRP3	5.211	3.81e-07	0.100279	20	0.019244	yes	CLNSGM
chr2_33572204_C_A_b38	RASGRP3	-4.55	8.23e-06	-0.076309	54	0.016773	yes	CLNSGM
chr2_33581561_C_T_b38	RASGRP3	4.415	1.48e-05	0.084554	24	0.019151	yes	CLNSGM
chr2_33520335_A_G_b38	RASGRP3	-4.412	1.5e-05	-0.07382	63	0.016732	yes	CLNSGM
chr2_33571342_T_C_b38	RASGRP3	-4.408	1.52e-05	-0.073195	56	0.016604	yes	CLNSGM
chr2_33571267_T_A_b38	RASGRP3	-4.399	1.58e-05	-0.073847	54	0.016786	yes	CLNSGM
chr2_33569371_A_G_b38	RASGRP3	-4.394	1.62e-05	-0.074111	54	0.016868	yes	CLNSGM
chr2_33575950_G_A_b38	RASGRP3	-4.354	1.92e-05	-0.07338	53	0.016855	yes	CLNSGM
chr2_33577889_G_A_b38	RASGRP3	-4.284	2.58e-05	-0.072406	54	0.016903	yes	CLNSGM
chr2_33536322_G_GA_b38	RASGRP3	4.274	2.69e-05	0.111213	9	0.026022	yes	CLNSGM
chr2_33512902_A_G_b38	RASGRP3	-4.273	2.7e-05	-0.073073	64	0.0171	yes	CLNSGM
chr2_33539434_T_C_b38	RASGRP3	-4.224	3.31e-05	-0.070894	55	0.016782	yes	CLNSGM
chr2_33523461_TA_T_b38	RASGRP3	4.207	3.56e-05	0.091388	8	0.021724	yes	CLNSGM
chr2_33539436_C_G_b38	RASGRP3	-4.189	3.83e-05	-0.07039	54	0.016804	yes	CLNSGM
chr2_33547053_GAA_G_b38	RASGRP3	4.188	3.84e-05	0.131095	4	0.031299	yes	CLNSGM
chr2_33529319_G_C_b38	RASGRP3	-4.178	4.02e-05	-0.071153	57	0.017032	yes	CLNSGM
chr2_33582025_C_T_b38	RASGRP3	4.166	4.22e-05	0.0804	23	0.0193	yes	CLNSGM
chr2_33596963_A_T_b38	RASGRP3	4.148	4.54e-05	0.080949	23	0.019518	yes	CLNSGM
chr2_33513546_C_T_b38	RASGRP3	-4.13	4.89e-05	-0.072564	36	0.017572	yes	CLNSGM
chr2_33536207_C_T_b38	RASGRP3	-4.106	5.39e-05	-0.069612	54	0.016956	yes	CLNSGM
chr2_33568339_TA_T_b38	RASGRP3	-4.098	5.57e-05	-0.068136	61	0.016628	yes	CLNSGM
chr2_33539642_C_G_b38	RASGRP3	-4.089	5.76e-05	-0.068317	54	0.016706	yes	CLNSGM
chr2_33546150_G_A_b38	RASGRP3	-4.027	7.4e-05	-0.066468	54	0.016505	yes	CLNSGM
chr2_33522519_T_C_b38	RASGRP3	-3.992	8.53e-05	-0.067682	56	0.016956	yes	CLNSGM
chr2_33514725_A_T_b38	RASGRP3	-3.984	8.79e-05	-0.066893	57	0.016791	yes	CLNSGM
chr2_33521775_G_C_b38	RASGRP3	-3.951	1e-04	-0.067045	48	0.016967	yes	CLNSGM
chr2_33533389_G_A_b38	RASGRP3	-3.904	0.00012	-0.065523	51	0.016784	yes	CLNSGM
chr2_33523771_A_G_b38	RASGRP3	-3.891	0.000127	-0.065986	46	0.01696	yes	CLNSGM
chr2_33525106_A_T_b38	RASGRP3	-3.865	0.00014	-0.067633	63	0.017499	yes	CLNSGM
chr2_33526414_G_A_b38	RASGRP3	-3.861	0.000143	-0.064872	46	0.016804	yes	CLNSGM
chr2_33525388_G_A_b38	RASGRP3	-3.814	0.000171	-0.064775	44	0.016983	yes	CLNSGM
chr2_33539219_T_C_b38	RASGRP3	-3.794	0.000184	-0.06369	57	0.016785	yes	CLNSGM
chr2_33523281_G_A_b38	RASGRP3	-3.793	0.000185	-0.065472	43	0.017263	yes	CLNSGM
chr2_33528299_G_A_b38	RASGRP3	-3.782	0.000193	-0.065656	55	0.017361	yes	CLNSGM
chr2_33511010_G_A_b38	RASGRP3	3.777	0.000196	0.112186	3	0.029698	yes	CLNSGM
chr2_33567745_C_T_b38	RASGRP3	-3.727	0.000237	-0.06351	52	0.01704	yes	CLNSGM
chr2_33556190_G_A_b38	RASGRP3	-3.677	0.000286	-0.063773	49	0.017342	yes	CLNSGM
chr2_33562245_G_C_b38	RASGRP3	-3.642	0.000326	-0.062095	57	0.01705	yes	CLNSGM
chr2_33634524_A_G_b38	RASGRP3	3.516	0.000517	0.082953	10	0.023596	yes	CLNSGM
chr2_33637426_T_A_b38	RASGRP3	3.458	0.000635	0.072428	16	0.020944	yes	CLNSGM
chr2_33781569_AGTGTGT_A_b38	RASGRP3	3.424	0.000716	0.097301	4	0.028416	yes	CLNSGM
chr2_33613720_G_A_b38	RASGRP3	3.416	0.000737	0.075536	13	0.022113	yes	CLNSGM
chr2_33640513_G_C_b38	RASGRP3	3.416	0.000737	0.078567	10	0.023002	yes	CLNSGM
chr2_33670716_C_T_b38	RASGRP3	3.365	0.000881	0.06552	20	0.019473	yes	CLNSGM
chr2_33548717_A_T_b38	RASGRP3	-3.343	0.000951	-0.056416	57	0.016878	yes	CLNSGM
chr2_33627793_A_G_b38	RASGRP3	3.322	0.00102	0.076193	10	0.022939	yes	CLNSGM
chr2_33659035_G_A_b38	RASGRP3	3.316	0.00104	0.077142	10	0.023267	yes	CLNSGM
chr2_33636858_C_G_b38	RASGRP3	3.278	0.00119	0.07694	10	0.023469	yes	CLNSGM
chr2_33637736_A_T_b38	RASGRP3	3.278	0.00119	0.07694	10	0.023469	yes	CLNSGM
chr2_33653281_C_CCTGT_b38	RASGRP3	3.22	0.00144	0.072795	9	0.022608	yes	CLNSGM
chr2_33634816_G_T_b38	RASGRP3	3.207	0.00151	0.074968	10	0.023373	yes	CLNSGM
chr2_33656916_G_A_b38	RASGRP3	3.174	0.00168	0.058998	36	0.018586	yes	CLNSGM
chr2_33547458_G_A_b38	RASGRP3	3.116	0.00203	0.054754	38	0.017569	yes	CLNSGM
chr2_33544520_G_GA_b38	RASGRP3	-3.111	0.00207	-0.053958	55	0.017346	yes	CLNSGM
chr2_33787907_A_G_b38	RASGRP3	3.102	0.00213	0.076366	11	0.024621	yes	CLNSGM
chr2_33667549_A_G_b38	RASGRP3	3.083	0.00227	0.072562	10	0.023537	yes	CLNSGM
chr2_33667555_A_G_b38	RASGRP3	3.083	0.00227	0.072562	10	0.023537	yes	CLNSGM
chr2_33548381_A_AAAAAG_b38	RASGRP3	3.073	0.00234	0.095964	4	0.031224	yes	CLNSGM
chr2_33559094_G_A_b38	RASGRP3	-3.037	0.00263	-0.054201	35	0.017845	yes	CLNSGM
chr2_33606703_C_T_b38	RASGRP3	2.999	0.00297	0.072188	9	0.024068	yes	CLNSGM
chr2_33516403_T_C_b38	RASGRP3	2.977	0.00318	0.06205	13	0.02084	yes	CLNSGM
chr2_33559433_G_A_b38	RASGRP3	-2.948	0.00348	-0.052511	35	0.017811	yes	CLNSGM
chr2_33656248_TTC_T_b38	RASGRP3	2.939	0.00359	0.058275	17	0.01983	yes	CLNSGM
chr2_33596450_T_G_b38	RASGRP3	2.917	0.00384	0.055064	29	0.018876	yes	CLNSGM
chr2_33151823_TTGTGTGTGTGTG_T_b38	RASGRP3	2.912	0.0039	0.092806	4	0.031872	yes	CLNSGM
chr2_33622160_C_T_b38	RASGRP3	2.911	0.00391	0.054316	30	0.018657	yes	CLNSGM
chr2_33650021_A_G_b38	RASGRP3	2.89	0.00418	0.057327	17	0.019839	yes	CLNSGM
chr2_33641397_G_C_b38	RASGRP3	2.875	0.00437	0.057871	18	0.020128	yes	CLNSGM
chr2_33525699_C_CAA_b38	RASGRP3	2.868	0.00447	0.086791	11	0.030265	yes	CLNSGM
chr2_33503592_C_CT_b38	RASGRP3	2.866	0.00449	0.064209	10	0.022404	yes	CLNSGM
chr2_33631243_G_GT_b38	RASGRP3	2.864	0.00452	0.067235	10	0.023474	yes	CLNSGM
chr2_33622592_T_C_b38	RASGRP3	2.845	0.0048	0.051939	37	0.018259	yes	CLNSGM
chr2_33652477_C_A_b38	RASGRP3	2.826	0.00507	0.056764	17	0.020084	yes	CLNSGM
chr2_33639021_G_A_b38	RASGRP3	2.795	0.00557	0.056157	18	0.020092	yes	CLNSGM
chr2_32702020_A_ACAAAAC_b38	RASGRP3	2.773	0.00595	0.090969	3	0.032801	yes	CLNSGM
chr2_33590881_T_C_b38	RASGRP3	2.758	0.00622	0.052162	29	0.01891	yes	CLNSGM
chr2_34216158_A_ATGTGTGTGTGTGTGTGTG_b38	RASGRP3	2.751	0.00635	0.052878	26	0.019219	yes	CLNSGM
chr2_34322729_C_CTTT_b38	RASGRP3	2.736	0.00664	0.08845	8	0.032323	yes	CLNSGM
chr2_33662459_C_T_b38	RASGRP3	2.731	0.00673	0.054061	19	0.019792	yes	CLNSGM
chr2_33347117_C_CA_b38	RASGRP3	-2.704	0.00729	-0.053177	19	0.019663	yes	CLNSGM
chr2_33640631_A_C_b38	RASGRP3	2.701	0.00736	0.054451	18	0.020158	yes	CLNSGM
chr2_33589264_G_C_b38	RASGRP3	2.686	0.00769	0.050963	29	0.018971	yes	CLNSGM
chr2_33467980_TTTTCTTTC_T_b38	RASGRP3	2.676	0.00791	0.06107	13	0.022819	yes	CLNSGM
chr2_33546315_C_T_b38	RASGRP3	-2.673	0.00798	-0.046647	41	0.017448	yes	CLNSGM
chr2_33548233_C_T_b38	RASGRP3	-2.646	0.00865	-0.047304	37	0.017881	yes	CLNSGM
chr2_33078842_GTTTTC_G_b38	RASGRP3	-2.62	0.00932	-0.054961	23	0.020981	yes	CLNSGM
chr2_33672387_A_G_b38	RASGRP3	2.596	0.00997	0.055277	15	0.021296	yes	CLNSGM
chr2_33523649_G_A_b38	RASGRP3	5.724	2.83e-08	0.117736	13	0.020567	no	CLNSGM
chr2_33543901_C_G_b38	RASGRP3	-4.764	3.14e-06	-0.083059	40	0.017434	no	CLNSGM
chr2_33520141_T_C_b38	RASGRP3	-4.746	3.41e-06	-0.079186	60	0.016683	no	CLNSGM
chr2_33518114_A_G_b38	RASGRP3	-4.72	3.85e-06	-0.082182	39	0.017413	no	CLNSGM
chr2_33525341_A_AAT_b38	RASGRP3	4.699	4.22e-06	0.093822	17	0.019965	no	CLNSGM
chr2_33512820_T_A_b38	RASGRP3	-4.594	6.77e-06	-0.077355	45	0.016839	no	CLNSGM
chr2_33539533_G_T_b38	RASGRP3	-4.437	1.34e-05	-0.068325	80	0.015397	no	CLNSGM
chr2_33541741_G_T_b38	RASGRP3	-4.325	2.17e-05	-0.067048	79	0.015502	no	CLNSGM
chr2_33519891_C_T_b38	RASGRP3	-4.313	2.29e-05	-0.073757	46	0.017102	no	CLNSGM
chr2_33596617_C_T_b38	RASGRP3	4.307	2.34e-05	0.084244	22	0.019558	no	CLNSGM
chr2_33514489_T_C_b38	RASGRP3	-4.234	3.18e-05	-0.069899	49	0.016508	no	CLNSGM
chr2_33540888_T_C_b38	RASGRP3	-4.196	3.72e-05	-0.064883	79	0.015462	no	CLNSGM
chr2_33518880_G_GTCA_b38	RASGRP3	-4.146	4.58e-05	-0.071353	60	0.017211	no	CLNSGM
chr2_33594326_C_T_b38	RASGRP3	4.142	4.65e-05	0.080554	23	0.019449	no	CLNSGM
chr2_33594385_G_A_b38	RASGRP3	4.142	4.65e-05	0.080554	23	0.019449	no	CLNSGM
chr2_33565263_A_G_b38	RASGRP3	4.094	5.66e-05	0.077339	28	0.018892	no	CLNSGM
chr2_33540615_TTCTC_T_b38	RASGRP3	-4.065	6.36e-05	-0.067251	60	0.016545	no	CLNSGM
chr2_33571586_T_C_b38	RASGRP3	-3.993	8.49e-05	-0.061462	75	0.015394	no	CLNSGM
chr2_33586869_A_T_b38	RASGRP3	3.843	0.000152	0.077315	19	0.020116	no	CLNSGM
chr2_33642124_T_TTTG_b38	RASGRP3	-3.676	0.000287	-0.125058	4	0.03402	no	CLNSGM
chr2_33194207_G_A_b38	RASGRP3	3.592	0.000392	0.191145	3	0.053217	no	CLNSGM
chr2_33205043_C_A_b38	RASGRP3	3.592	0.000392	0.191145	3	0.053217	no	CLNSGM
chr2_33194131_C_G_b38	RASGRP3	3.468	0.000613	0.184316	3	0.053149	no	CLNSGM
chr2_33197748_A_C_b38	RASGRP3	3.468	0.000613	0.184316	3	0.053149	no	CLNSGM
chr2_33198116_A_C_b38	RASGRP3	3.468	0.000613	0.184316	3	0.053149	no	CLNSGM
chr2_33199583_C_G_b38	RASGRP3	3.468	0.000613	0.184316	3	0.053149	no	CLNSGM
chr2_33201943_A_G_b38	RASGRP3	3.468	0.000613	0.184316	3	0.053149	no	CLNSGM
chr2_33204297_CTG_C_b38	RASGRP3	3.468	0.000613	0.184316	3	0.053149	no	CLNSGM
chr2_33205655_C_T_b38	RASGRP3	3.468	0.000613	0.184316	3	0.053149	no	CLNSGM
chr2_33206965_G_T_b38	RASGRP3	3.468	0.000613	0.184316	3	0.053149	no	CLNSGM
chr2_33209330_C_T_b38	RASGRP3	3.468	0.000613	0.184316	3	0.053149	no	CLNSGM
chr2_33605951_T_C_b38	RASGRP3	-3.434	0.000691	-0.055996	66	0.016305	no	CLNSGM
chr2_33155254_T_C_b38	RASGRP3	3.428	0.000705	0.183107	3	0.05341	no	CLNSGM
chr2_33158687_G_A_b38	RASGRP3	3.428	0.000705	0.183107	3	0.05341	no	CLNSGM
chr2_33163621_G_A_b38	RASGRP3	3.428	0.000705	0.183107	3	0.05341	no	CLNSGM
chr2_33540561_TGTGTGTGTGTGTGTG_T_b38	RASGRP3	-3.399	0.000783	-0.097842	8	0.028788	no	CLNSGM
chr2_33554839_T_C_b38	RASGRP3	3.362	0.000889	0.059859	37	0.017803	no	CLNSGM
chr2_33178487_G_A_b38	RASGRP3	3.322	0.00102	0.174925	3	0.052663	no	CLNSGM
chr2_33179409_C_T_b38	RASGRP3	3.322	0.00102	0.174925	3	0.052663	no	CLNSGM
chr2_33616325_C_T_b38	RASGRP3	3.279	0.00118	0.077508	9	0.023636	no	CLNSGM
chr2_33589523_A_G_b38	RASGRP3	-3.227	0.00141	-0.054849	69	0.016999	no	CLNSGM
chr2_33540861_TA_T_b38	RASGRP3	-3.182	0.00164	-0.05198	48	0.016336	no	CLNSGM
chr2_33536322_GA_G_b38	RASGRP3	-3.165	0.00174	-0.056365	62	0.017811	no	CLNSGM
chr2_33605827_ATTTTTCT_A_b38	RASGRP3	3.161	0.00176	0.075445	8	0.02387	no	CLNSGM
chr2_33539996_AAAAAG_A_b38	RASGRP3	-3.145	0.00185	-0.053683	70	0.017068	no	CLNSGM
chr2_33177659_C_A_b38	RASGRP3	3.096	0.00217	0.161606	3	0.052191	no	CLNSGM
chr2_33177466_A_G_b38	RASGRP3	3.091	0.00221	0.161006	3	0.052083	no	CLNSGM
chr2_33593131_C_T_b38	RASGRP3	-3.07	0.00236	-0.052644	66	0.017146	no	CLNSGM
chr2_33588900_A_AT_b38	RASGRP3	-3.068	0.00238	-0.054761	58	0.017847	no	CLNSGM
chr2_33581338_T_A_b38	RASGRP3	3.029	0.0027	0.068071	12	0.022474	no	CLNSGM
chr2_33182123_T_C_b38	RASGRP3	3.013	0.00284	0.155769	3	0.0517	no	CLNSGM
chr2_33537330_C_CCCCA_b38	RASGRP3	-3.012	0.00285	-0.066133	19	0.021956	no	CLNSGM
chr2_33581900_A_T_b38	RASGRP3	3	0.00296	0.067184	12	0.022394	no	CLNSGM
chr2_33586449_C_G_b38	RASGRP3	-2.996	0.003	-0.051248	66	0.017106	no	CLNSGM
chr2_33606727_T_C_b38	RASGRP3	2.963	0.00332	0.076742	5	0.025898	no	CLNSGM
chr2_33153512_A_G_b38	RASGRP3	2.963	0.00333	0.153292	3	0.051741	no	CLNSGM
chr2_33575832_C_A_b38	RASGRP3	-2.897	0.00408	-0.049321	69	0.017023	no	CLNSGM
chr2_33563965_A_G_b38	RASGRP3	2.873	0.00439	0.064319	12	0.022384	no	CLNSGM
chr2_33592492_A_G_b38	RASGRP3	-2.829	0.00504	-0.048256	66	0.01706	no	CLNSGM
chr2_33580247_A_G_b38	RASGRP3	-2.815	0.00525	-0.048749	64	0.01732	no	CLNSGM
chr2_33597253_G_A_b38	RASGRP3	-2.788	0.00569	-0.048398	60	0.017359	no	CLNSGM
chr2_33577835_T_C_b38	RASGRP3	-2.766	0.00608	-0.047451	66	0.017155	no	CLNSGM
chr2_33657078_T_C_b38	RASGRP3	2.741	0.00654	0.052746	29	0.01924	no	CLNSGM
chr2_33656848_TA_T_b38	RASGRP3	2.705	0.00727	0.051645	30	0.019089	no	CLNSGM
chr2_33590404_A_G_b38	RASGRP3	-2.686	0.00769	-0.045682	67	0.017007	no	CLNSGM
chr2_33168355_T_C_b38	RASGRP3	2.666	0.00814	0.135179	3	0.050697	no	CLNSGM
chr2_33537896_A_G_b38	RASGRP3	9.773	9.69e-20	0.230724	3	0.023609	yes	CLNTRN
chr2_33557635_G_A_b38	RASGRP3	9.445	1.1e-18	0.222478	3	0.023555	yes	CLNTRN
chr2_33559304_G_A_b38	RASGRP3	9.445	1.1e-18	0.222478	3	0.023555	yes	CLNTRN
chr2_33559734_G_A_b38	RASGRP3	9.445	1.1e-18	0.222478	3	0.023555	yes	CLNTRN
chr2_33531453_C_T_b38	RASGRP3	9.325	2.63e-18	0.214459	5	0.022998	yes	CLNTRN
chr2_33552022_CAAACA_C_b38	RASGRP3	9.231	5.23e-18	0.222232	3	0.024075	yes	CLNTRN
chr2_33546942_C_G_b38	RASGRP3	9.218	5.75e-18	0.212676	5	0.023072	yes	CLNTRN
chr2_33559068_A_G_b38	RASGRP3	9.211	6.03e-18	0.21882	3	0.023756	yes	CLNTRN
chr2_33529269_C_A_b38	RASGRP3	9.037	2.12e-17	0.209421	5	0.023173	yes	CLNTRN
chr2_33548469_T_C_b38	RASGRP3	9.027	2.28e-17	0.217397	3	0.024084	yes	CLNTRN
chr2_33550484_C_G_b38	RASGRP3	9.027	2.28e-17	0.217397	3	0.024084	yes	CLNTRN
chr2_33553995_C_T_b38	RASGRP3	9.027	2.28e-17	0.217397	3	0.024084	yes	CLNTRN
chr2_33554542_A_G_b38	RASGRP3	9.027	2.28e-17	0.217397	3	0.024084	yes	CLNTRN
chr2_33526597_C_T_b38	RASGRP3	8.996	2.83e-17	0.214359	4	0.023827	yes	CLNTRN
chr2_33527062_GC_G_b38	RASGRP3	8.996	2.83e-17	0.214359	4	0.023827	yes	CLNTRN
chr2_33557844_G_A_b38	RASGRP3	8.813	1.05e-16	0.198309	6	0.022503	yes	CLNTRN
chr2_33548762_A_G_b38	RASGRP3	8.737	1.79e-16	0.215264	3	0.024639	yes	CLNTRN
chr2_33550216_T_A_b38	RASGRP3	8.643	3.45e-16	0.208411	3	0.024113	yes	CLNTRN
chr2_33540561_TGTGTGTGTGTG_T_b38	RASGRP3	8.044	2.1e-14	0.193619	6	0.02407	yes	CLNTRN
chr2_33523649_G_A_b38	RASGRP3	8.044	2.1e-14	0.164999	11	0.020513	yes	CLNTRN
chr2_33561445_C_A_b38	RASGRP3	8.041	2.14e-14	0.16044	13	0.019954	yes	CLNTRN
chr2_33555164_G_A_b38	RASGRP3	7.714	1.86e-13	0.157411	12	0.020407	yes	CLNTRN
chr2_33529318_C_T_b38	RASGRP3	7.661	2.63e-13	0.160815	9	0.020992	yes	CLNTRN
chr2_33512177_G_A_b38	RASGRP3	7.654	2.75e-13	0.157993	15	0.020642	yes	CLNTRN
chr2_33547053_GAA_G_b38	RASGRP3	7.619	3.45e-13	0.222784	3	0.02924	yes	CLNTRN
chr2_33525341_A_AAT_b38	RASGRP3	7.554	5.25e-13	0.142803	19	0.018904	yes	CLNTRN
chr2_33556928_C_CACACACATACAT_b38	RASGRP3	7	1.71e-11	0.168085	3	0.024011	yes	CLNTRN
chr2_33521266_C_T_b38	RASGRP3	6.992	1.79e-11	0.131494	21	0.018805	yes	CLNTRN
chr2_33565263_A_G_b38	RASGRP3	6.974	2.01e-11	0.129512	29	0.018571	yes	CLNTRN
chr2_33594326_C_T_b38	RASGRP3	6.691	1.1e-10	0.126746	23	0.018943	yes	CLNTRN
chr2_33594385_G_A_b38	RASGRP3	6.691	1.1e-10	0.126746	23	0.018943	yes	CLNTRN
chr2_33596617_C_T_b38	RASGRP3	6.579	2.14e-10	0.124251	23	0.018887	yes	CLNTRN
chr2_33596963_A_T_b38	RASGRP3	6.476	3.91e-10	0.122772	23	0.018959	yes	CLNTRN
chr2_33581561_C_T_b38	RASGRP3	6.423	5.31e-10	0.121825	22	0.018968	yes	CLNTRN
chr2_33582025_C_T_b38	RASGRP3	6.364	7.41e-10	0.120677	22	0.018961	yes	CLNTRN
chr2_33596450_T_G_b38	RASGRP3	6.148	2.53e-09	0.109121	32	0.01775	yes	CLNTRN
chr2_33590881_T_C_b38	RASGRP3	6.089	3.5e-09	0.108034	32	0.017741	yes	CLNTRN
chr2_33589264_G_C_b38	RASGRP3	6.084	3.61e-09	0.108267	32	0.017795	yes	CLNTRN
chr2_33564467_A_G_b38	RASGRP3	5.786	1.82e-08	0.099839	52	0.017254	yes	CLNTRN
chr2_33536322_G_GA_b38	RASGRP3	5.772	1.97e-08	0.152136	6	0.026357	yes	CLNTRN
chr2_33622592_T_C_b38	RASGRP3	5.574	5.6e-08	0.104468	34	0.018743	yes	CLNTRN
chr2_33523461_TA_T_b38	RASGRP3	5.432	1.16e-07	0.116757	6	0.021495	yes	CLNTRN
chr2_33534694_A_AT_b38	RASGRP3	5.42	1.23e-07	0.103849	23	0.019159	yes	CLNTRN
chr2_33622160_C_T_b38	RASGRP3	5.36	1.67e-07	0.09966	30	0.018593	yes	CLNTRN
chr2_33656248_TTC_T_b38	RASGRP3	5.24	3.05e-07	0.110375	12	0.021065	yes	CLNTRN
chr2_33564001_C_G_b38	RASGRP3	5.188	3.94e-07	0.092872	47	0.0179	yes	CLNTRN
chr2_33616325_C_T_b38	RASGRP3	5.186	3.98e-07	0.13653	5	0.026327	yes	CLNTRN
chr2_33640513_G_C_b38	RASGRP3	5.107	5.87e-07	0.135259	5	0.026486	yes	CLNTRN
chr2_33508447_C_T_b38	RASGRP3	5.04	8.11e-07	0.147497	3	0.029265	yes	CLNTRN
chr2_33623108_T_C_b38	RASGRP3	5.038	8.17e-07	0.090616	38	0.017986	yes	CLNTRN
chr2_33650021_A_G_b38	RASGRP3	5.037	8.24e-07	0.106167	12	0.021079	yes	CLNTRN
chr2_33621819_C_A_b38	RASGRP3	5.003	9.66e-07	0.089133	38	0.017815	yes	CLNTRN
chr2_33659035_G_A_b38	RASGRP3	4.993	1.02e-06	0.132059	5	0.02645	yes	CLNTRN
chr2_33613720_G_A_b38	RASGRP3	4.96	1.19e-06	0.11525	9	0.023235	yes	CLNTRN
chr2_33508652_C_G_b38	RASGRP3	4.934	1.35e-06	0.086072	49	0.017446	yes	CLNTRN
chr2_33624881_G_GT_b38	RASGRP3	4.927	1.39e-06	0.095455	24	0.019372	yes	CLNTRN
chr2_33657078_T_C_b38	RASGRP3	4.915	1.47e-06	0.095818	27	0.019495	yes	CLNTRN
chr2_33627793_A_G_b38	RASGRP3	4.857	1.93e-06	0.126311	5	0.026006	yes	CLNTRN
chr2_33667549_A_G_b38	RASGRP3	4.808	2.43e-06	0.130161	5	0.027073	yes	CLNTRN
chr2_33667555_A_G_b38	RASGRP3	4.808	2.43e-06	0.130161	5	0.027073	yes	CLNTRN
chr2_33606703_C_T_b38	RASGRP3	4.795	2.58e-06	0.126222	5	0.026325	yes	CLNTRN
chr2_33634816_G_T_b38	RASGRP3	4.71	3.8e-06	0.126262	5	0.026805	yes	CLNTRN
chr2_33634524_A_G_b38	RASGRP3	4.695	4.07e-06	0.126647	5	0.026974	yes	CLNTRN
chr2_33511010_G_A_b38	RASGRP3	4.692	4.13e-06	0.130539	6	0.027819	yes	CLNTRN
chr2_33656848_TA_T_b38	RASGRP3	4.6	6.27e-06	0.090924	22	0.019767	yes	CLNTRN
chr2_33563965_A_G_b38	RASGRP3	4.595	6.39e-06	0.113328	8	0.024661	yes	CLNTRN
chr2_33663555_T_C_b38	RASGRP3	4.574	7.03e-06	0.0968	13	0.021162	yes	CLNTRN
chr2_33569371_A_G_b38	RASGRP3	-4.526	8.71e-06	-0.077213	66	0.01706	yes	CLNTRN
chr2_33620497_T_C_b38	RASGRP3	4.518	9.01e-06	0.095923	14	0.02123	yes	CLNTRN
chr2_33781569_AGTGTGT_A_b38	RASGRP3	4.474	1.1e-05	0.132454	3	0.029607	yes	CLNTRN
chr2_33581900_A_T_b38	RASGRP3	4.457	1.18e-05	0.109843	8	0.024647	yes	CLNTRN
chr2_33622130_C_CA_b38	RASGRP3	4.447	1.23e-05	0.119606	9	0.026893	yes	CLNTRN
chr2_33963502_ATGT_A_b38	RASGRP3	4.429	1.33e-05	0.190653	3	0.043047	yes	CLNTRN
chr2_33620575_G_A_b38	RASGRP3	4.427	1.34e-05	0.093696	14	0.021164	yes	CLNTRN
chr2_33514489_T_C_b38	RASGRP3	-4.407	1.47e-05	-0.07409	56	0.016812	yes	CLNTRN
chr2_33944549_C_T_b38	RASGRP3	4.367	1.74e-05	0.18666	3	0.042738	yes	CLNTRN
chr2_33945642_G_A_b38	RASGRP3	4.367	1.74e-05	0.18666	3	0.042738	yes	CLNTRN
chr2_33568339_TA_T_b38	RASGRP3	-4.363	1.77e-05	-0.073422	72	0.016828	yes	CLNTRN
chr2_33581338_T_A_b38	RASGRP3	4.304	2.29e-05	0.106048	8	0.024642	yes	CLNTRN
chr2_33605827_ATTTTTCT_A_b38	RASGRP3	4.279	2.53e-05	0.108667	6	0.025394	yes	CLNTRN
chr2_33515662_T_C_b38	RASGRP3	4.268	2.65e-05	0.096031	11	0.022498	yes	CLNTRN
chr2_33634843_C_CTT_b38	RASGRP3	4.261	2.74e-05	0.126103	5	0.029598	yes	CLNTRN
chr2_33572204_C_A_b38	RASGRP3	-4.215	3.32e-05	-0.073006	63	0.017322	yes	CLNTRN
chr2_33561192_A_G_b38	RASGRP3	4.204	3.48e-05	0.069525	91	0.016538	yes	CLNTRN
chr2_33637426_T_A_b38	RASGRP3	4.181	3.83e-05	0.097364	9	0.023288	yes	CLNTRN
chr2_33571342_T_C_b38	RASGRP3	-4.14	4.53e-05	-0.070806	63	0.017103	yes	CLNTRN
chr2_33520141_T_C_b38	RASGRP3	-4.11	5.12e-05	-0.071068	70	0.017291	yes	CLNTRN
chr2_33571267_T_A_b38	RASGRP3	-4.109	5.14e-05	-0.070492	63	0.017155	yes	CLNTRN
chr2_33512820_T_A_b38	RASGRP3	-4.108	5.16e-05	-0.070675	53	0.017204	yes	CLNTRN
chr2_33958895_C_T_b38	RASGRP3	4.102	5.29e-05	0.171879	4	0.0419	yes	CLNTRN
chr2_33963083_G_A_b38	RASGRP3	4.102	5.29e-05	0.171879	4	0.0419	yes	CLNTRN
chr2_33647765_T_C_b38	RASGRP3	-4.092	5.53e-05	-0.06856	75	0.016757	yes	CLNTRN
chr2_33512902_A_G_b38	RASGRP3	-4.065	6.16e-05	-0.070544	76	0.017355	yes	CLNTRN
chr2_33514230_T_G_b38	RASGRP3	4.048	6.6e-05	0.087625	13	0.021648	yes	CLNTRN
chr2_33944263_G_A_b38	RASGRP3	4.042	6.75e-05	0.16806	4	0.041575	yes	CLNTRN
chr2_33954566_C_G_b38	RASGRP3	4.042	6.75e-05	0.16806	4	0.041575	yes	CLNTRN
chr2_33954956_G_C_b38	RASGRP3	4.042	6.75e-05	0.16806	4	0.041575	yes	CLNTRN
chr2_33518114_A_G_b38	RASGRP3	-4.034	6.98e-05	-0.070475	46	0.01747	yes	CLNTRN
chr2_33575950_G_A_b38	RASGRP3	-4.017	7.48e-05	-0.070173	60	0.01747	yes	CLNTRN
chr2_33931383_A_G_b38	RASGRP3	4	8.01e-05	0.159538	5	0.039888	yes	CLNTRN
chr2_33932829_G_A_b38	RASGRP3	4	8.01e-05	0.159538	5	0.039888	yes	CLNTRN
chr2_33672387_A_G_b38	RASGRP3	3.975	8.85e-05	0.089184	11	0.022437	yes	CLNTRN
chr2_33543901_C_G_b38	RASGRP3	-3.966	9.17e-05	-0.07206	49	0.01817	yes	CLNTRN
chr2_33577889_G_A_b38	RASGRP3	-3.962	9.31e-05	-0.069476	60	0.017535	yes	CLNTRN
chr2_33641120_T_C_b38	RASGRP3	-3.926	0.000107	-0.065352	74	0.016644	yes	CLNTRN
chr2_33960867_G_C_b38	RASGRP3	3.919	0.00011	0.126802	6	0.032356	yes	CLNTRN
chr2_33960883_A_G_b38	RASGRP3	3.919	0.00011	0.126802	6	0.032356	yes	CLNTRN
chr2_33960991_T_A_b38	RASGRP3	3.919	0.00011	0.126802	6	0.032356	yes	CLNTRN
chr2_33961770_G_A_b38	RASGRP3	3.919	0.00011	0.126802	6	0.032356	yes	CLNTRN
chr2_33962189_G_A_b38	RASGRP3	3.919	0.00011	0.126802	6	0.032356	yes	CLNTRN
chr2_33963279_A_G_b38	RASGRP3	3.919	0.00011	0.126802	6	0.032356	yes	CLNTRN
chr2_33963573_A_G_b38	RASGRP3	3.919	0.00011	0.126802	6	0.032356	yes	CLNTRN
chr2_33940879_G_C_b38	RASGRP3	3.886	0.000126	0.155349	5	0.039973	yes	CLNTRN
chr2_33940881_G_A_b38	RASGRP3	3.886	0.000126	0.155349	5	0.039973	yes	CLNTRN
chr2_33941588_A_C_b38	RASGRP3	3.886	0.000126	0.155349	5	0.039973	yes	CLNTRN
chr2_33941659_G_A_b38	RASGRP3	3.886	0.000126	0.155349	5	0.039973	yes	CLNTRN
chr2_33941672_T_C_b38	RASGRP3	3.886	0.000126	0.155349	5	0.039973	yes	CLNTRN
chr2_33941674_A_G_b38	RASGRP3	3.886	0.000126	0.155349	5	0.039973	yes	CLNTRN
chr2_33942267_TTAAAA_T_b38	RASGRP3	3.886	0.000126	0.155349	5	0.039973	yes	CLNTRN
chr2_33942532_T_G_b38	RASGRP3	3.886	0.000126	0.155349	5	0.039973	yes	CLNTRN
chr2_33942554_A_G_b38	RASGRP3	3.886	0.000126	0.155349	5	0.039973	yes	CLNTRN
chr2_33942664_T_C_b38	RASGRP3	3.886	0.000126	0.155349	5	0.039973	yes	CLNTRN
chr2_33943025_A_G_b38	RASGRP3	3.886	0.000126	0.155349	5	0.039973	yes	CLNTRN
chr2_33943539_A_G_b38	RASGRP3	3.886	0.000126	0.155349	5	0.039973	yes	CLNTRN
chr2_33943661_C_G_b38	RASGRP3	3.886	0.000126	0.155349	5	0.039973	yes	CLNTRN
chr2_33943743_T_C_b38	RASGRP3	3.886	0.000126	0.155349	5	0.039973	yes	CLNTRN
chr2_33943800_C_G_b38	RASGRP3	3.886	0.000126	0.155349	5	0.039973	yes	CLNTRN
chr2_33944024_T_C_b38	RASGRP3	3.886	0.000126	0.155349	5	0.039973	yes	CLNTRN
chr2_33944149_T_TG_b38	RASGRP3	3.886	0.000126	0.155349	5	0.039973	yes	CLNTRN
chr2_33944284_G_A_b38	RASGRP3	3.886	0.000126	0.155349	5	0.039973	yes	CLNTRN
chr2_33944655_T_C_b38	RASGRP3	3.886	0.000126	0.155349	5	0.039973	yes	CLNTRN
chr2_33944848_G_A_b38	RASGRP3	3.886	0.000126	0.155349	5	0.039973	yes	CLNTRN
chr2_33945091_A_G_b38	RASGRP3	3.886	0.000126	0.155349	5	0.039973	yes	CLNTRN
chr2_33945248_A_T_b38	RASGRP3	3.886	0.000126	0.155349	5	0.039973	yes	CLNTRN
chr2_33945259_T_A_b38	RASGRP3	3.886	0.000126	0.155349	5	0.039973	yes	CLNTRN
chr2_33945487_G_A_b38	RASGRP3	3.886	0.000126	0.155349	5	0.039973	yes	CLNTRN
chr2_33945627_T_C_b38	RASGRP3	3.886	0.000126	0.155349	5	0.039973	yes	CLNTRN
chr2_33945637_G_C_b38	RASGRP3	3.886	0.000126	0.155349	5	0.039973	yes	CLNTRN
chr2_33945865_T_C_b38	RASGRP3	3.886	0.000126	0.155349	5	0.039973	yes	CLNTRN
chr2_33946100_G_C_b38	RASGRP3	3.886	0.000126	0.155349	5	0.039973	yes	CLNTRN
chr2_33946630_T_C_b38	RASGRP3	3.886	0.000126	0.155349	5	0.039973	yes	CLNTRN
chr2_33957369_G_T_b38	RASGRP3	3.886	0.000126	0.155349	5	0.039973	yes	CLNTRN
chr2_33946606_G_A_b38	RASGRP3	3.869	0.000134	0.121623	7	0.031433	yes	CLNTRN
chr2_33530852_CT_C_b38	RASGRP3	3.855	0.000142	0.067363	68	0.017475	yes	CLNTRN
chr2_33525699_C_CAA_b38	RASGRP3	3.847	0.000147	0.127943	10	0.03326	yes	CLNTRN
chr2_33962337_C_A_b38	RASGRP3	3.843	0.000149	0.124655	6	0.032436	yes	CLNTRN
chr2_33547458_G_A_b38	RASGRP3	3.842	0.000149	0.064105	51	0.016686	yes	CLNTRN
chr2_33518880_G_GTCA_b38	RASGRP3	-3.838	0.000151	-0.066474	70	0.017318	yes	CLNTRN
chr2_33673146_T_C_b38	RASGRP3	-3.833	0.000154	-0.064061	77	0.016712	yes	CLNTRN
chr2_33662442_T_C_b38	RASGRP3	-3.819	0.000163	-0.063811	74	0.016709	yes	CLNTRN
chr2_33658713_G_A_b38	RASGRP3	-3.807	0.000171	-0.064404	71	0.016916	yes	CLNTRN
chr2_33933541_CTCCTTCCTTCCT_C_b38	RASGRP3	3.791	0.000181	0.123432	5	0.032556	yes	CLNTRN
chr2_33961945_G_A_b38	RASGRP3	3.786	0.000185	0.121646	6	0.032131	yes	CLNTRN
chr2_33519891_C_T_b38	RASGRP3	-3.776	0.000193	-0.065662	56	0.017391	yes	CLNTRN
chr2_33592492_A_G_b38	RASGRP3	-3.749	0.000213	-0.06279	80	0.016746	yes	CLNTRN
chr2_33567745_C_T_b38	RASGRP3	-3.727	0.000232	-0.065113	58	0.01747	yes	CLNTRN
chr2_33590404_A_G_b38	RASGRP3	-3.719	0.000239	-0.06238	80	0.016773	yes	CLNTRN
chr2_33525341_AAT_A_b38	RASGRP3	-3.694	0.000262	-0.091098	6	0.024659	yes	CLNTRN
chr2_33601956_TA_T_b38	RASGRP3	3.689	0.000268	0.067424	85	0.018279	yes	CLNTRN
chr2_33660983_C_T_b38	RASGRP3	-3.677	0.00028	-0.061645	70	0.016764	yes	CLNTRN
chr2_33577835_T_C_b38	RASGRP3	-3.675	0.000282	-0.061654	80	0.016777	yes	CLNTRN
chr2_33658757_C_A_b38	RASGRP3	-3.668	0.00029	-0.062315	67	0.016989	yes	CLNTRN
chr2_33597253_G_A_b38	RASGRP3	-3.629	0.000335	-0.062121	73	0.017117	yes	CLNTRN
chr2_33532718_G_A_b38	RASGRP3	3.585	0.000394	0.062364	68	0.017396	yes	CLNTRN
chr2_33532968_G_A_b38	RASGRP3	-3.556	0.000438	-0.09362	4	0.026329	yes	CLNTRN
chr2_33604404_G_GTA_b38	RASGRP3	3.545	0.000456	0.090748	5	0.025598	yes	CLNTRN
chr2_33593131_C_T_b38	RASGRP3	-3.53	0.000481	-0.059233	79	0.016777	yes	CLNTRN
chr2_33668515_A_G_b38	RASGRP3	-3.529	0.000483	-0.059047	74	0.016731	yes	CLNTRN
chr2_33964276_G_A_b38	RASGRP3	3.507	0.000524	0.140787	5	0.040146	yes	CLNTRN
chr2_34038316_C_CT_b38	RASGRP3	3.504	0.000529	0.066766	36	0.019055	yes	CLNTRN
chr2_33658170_A_G_b38	RASGRP3	-3.496	0.000544	-0.058569	73	0.016752	yes	CLNTRN
chr2_33655112_A_AT_b38	RASGRP3	-3.484	0.000568	-0.05949	69	0.017073	yes	CLNTRN
chr2_33508487_T_C_b38	RASGRP3	3.461	0.000617	0.092461	10	0.026716	yes	CLNTRN
chr2_33532487_C_A_b38	RASGRP3	3.459	0.000622	0.058362	95	0.016873	yes	CLNTRN
chr2_33936672_T_C_b38	RASGRP3	3.452	0.000637	0.160504	3	0.046495	yes	CLNTRN
chr2_33669785_CA_C_b38	RASGRP3	-3.447	0.00065	-0.061063	52	0.017717	yes	CLNTRN
chr2_33579727_C_T_b38	RASGRP3	3.443	0.000657	0.115005	5	0.033398	yes	CLNTRN
chr2_33575832_C_A_b38	RASGRP3	-3.437	0.000673	-0.057308	83	0.016676	yes	CLNTRN
chr2_33580247_A_G_b38	RASGRP3	-3.435	0.000678	-0.058442	78	0.017015	yes	CLNTRN
chr2_33576389_C_T_b38	RASGRP3	-3.433	0.000681	-0.059059	76	0.017202	yes	CLNTRN
chr2_33093442_C_G_b38	RASGRP3	-3.431	0.000687	-0.081832	13	0.023851	yes	CLNTRN
chr2_33592302_T_C_b38	RASGRP3	3.431	0.000687	0.11647	4	0.033948	yes	CLNTRN
chr2_33655774_A_G_b38	RASGRP3	-3.418	0.000719	-0.057598	75	0.016851	yes	CLNTRN
chr2_33589523_A_G_b38	RASGRP3	-3.416	0.000725	-0.05691	82	0.016662	yes	CLNTRN
chr2_33548381_A_AAAG_b38	RASGRP3	3.368	0.000856	0.092112	6	0.027346	yes	CLNTRN
chr2_33655786_T_C_b38	RASGRP3	-3.359	0.000884	-0.057	71	0.016969	yes	CLNTRN
chr2_33586449_C_G_b38	RASGRP3	-3.358	0.000886	-0.056578	79	0.016847	yes	CLNTRN
chr2_33525080_C_CA_b38	RASGRP3	-3.342	0.000937	-0.077781	11	0.023272	yes	CLNTRN
chr2_33940268_G_A_b38	RASGRP3	3.337	0.000953	0.167399	3	0.050158	yes	CLNTRN
chr2_33957586_A_G_b38	RASGRP3	3.337	0.000953	0.167399	3	0.050158	yes	CLNTRN
chr2_33538430_G_C_b38	RASGRP3	-3.329	0.000981	-0.085649	4	0.025728	yes	CLNTRN
chr2_33527085_G_T_b38	RASGRP3	-3.315	0.00103	-0.078065	9	0.023548	yes	CLNTRN
chr2_33565010_T_TACACACAC_b38	RASGRP3	3.284	0.00115	0.1118	3	0.034047	yes	CLNTRN
chr2_33569651_CA_C_b38	RASGRP3	-3.28	0.00116	-0.069133	23	0.021074	yes	CLNTRN
chr2_33545200_T_C_b38	RASGRP3	-3.273	0.00119	-0.077762	8	0.02376	yes	CLNTRN
chr2_33538452_G_A_b38	RASGRP3	-3.259	0.00125	-0.084798	4	0.026023	yes	CLNTRN
chr2_33945769_TA_T_b38	RASGRP3	3.249	0.00129	0.124074	5	0.03819	yes	CLNTRN
chr2_33548698_A_AATTATT_b38	RASGRP3	-3.227	0.00139	-0.076232	8	0.023622	yes	CLNTRN
chr2_33550119_G_T_b38	RASGRP3	-3.21	0.00147	-0.076025	8	0.023683	yes	CLNTRN
chr2_33550598_T_G_b38	RASGRP3	-3.21	0.00147	-0.076025	8	0.023683	yes	CLNTRN
chr2_33553788_G_A_b38	RASGRP3	-3.21	0.00147	-0.076025	8	0.023683	yes	CLNTRN
chr2_33556856_G_C_b38	RASGRP3	-3.21	0.00147	-0.076025	8	0.023683	yes	CLNTRN
chr2_32994220_A_G_b38	RASGRP3	3.208	0.00148	0.090369	4	0.02817	yes	CLNTRN
chr2_33934344_T_C_b38	RASGRP3	3.186	0.0016	0.142602	4	0.044764	yes	CLNTRN
chr2_33543280_C_G_b38	RASGRP3	-3.184	0.00161	-0.082489	4	0.025906	yes	CLNTRN
chr2_33622130_CA_C_b38	RASGRP3	-3.157	0.00176	-0.059243	31	0.018767	yes	CLNTRN
chr2_33562267_C_CT_b38	RASGRP3	3.15	0.0018	0.054074	63	0.017166	yes	CLNTRN
chr2_33549383_C_T_b38	RASGRP3	-3.146	0.00182	-0.074577	8	0.023705	yes	CLNTRN
chr2_33934506_C_T_b38	RASGRP3	3.131	0.00191	0.140591	4	0.044896	yes	CLNTRN
chr2_33936833_G_A_b38	RASGRP3	3.131	0.00191	0.140591	4	0.044896	yes	CLNTRN
chr2_33561322_C_T_b38	RASGRP3	-3.123	0.00197	-0.075363	7	0.024134	yes	CLNTRN
chr2_33957936_C_T_b38	RASGRP3	3.113	0.00203	0.155125	3	0.049825	yes	CLNTRN
chr2_33659127_A_G_b38	RASGRP3	-3.1	0.00212	-0.051154	84	0.016503	yes	CLNTRN
chr2_33940657_G_T_b38	RASGRP3	3.097	0.00214	0.12585	5	0.040634	yes	CLNTRN
chr2_33096784_G_A_b38	RASGRP3	3.088	0.0022	0.087125	5	0.028212	yes	CLNTRN
chr2_33515921_T_A_b38	RASGRP3	3.07	0.00234	0.070375	10	0.022921	yes	CLNTRN
chr2_33541741_G_T_b38	RASGRP3	-3.063	0.00239	-0.048623	87	0.015872	yes	CLNTRN
chr2_33947329_CAAAAAAAA_C_b38	RASGRP3	3.054	0.00246	0.095655	8	0.031319	yes	CLNTRN
chr2_33935890_A_G_b38	RASGRP3	3.014	0.0028	0.129884	5	0.043089	yes	CLNTRN
chr2_33936525_T_C_b38	RASGRP3	3.014	0.0028	0.129884	5	0.043089	yes	CLNTRN
chr2_33936710_A_G_b38	RASGRP3	3.014	0.0028	0.129884	5	0.043089	yes	CLNTRN
chr2_33936731_C_G_b38	RASGRP3	3.014	0.0028	0.129884	5	0.043089	yes	CLNTRN
chr2_33937446_T_C_b38	RASGRP3	3.014	0.0028	0.129884	5	0.043089	yes	CLNTRN
chr2_33937710_T_C_b38	RASGRP3	3.014	0.0028	0.129884	5	0.043089	yes	CLNTRN
chr2_33554839_T_C_b38	RASGRP3	2.981	0.00311	0.051021	48	0.017115	yes	CLNTRN
chr2_33661940_T_G_b38	RASGRP3	-2.976	0.00316	-0.051492	89	0.017302	yes	CLNTRN
chr2_33669621_C_T_b38	RASGRP3	-2.976	0.00316	-0.051364	59	0.01726	yes	CLNTRN
chr2_33669751_C_T_b38	RASGRP3	-2.976	0.00316	-0.051364	59	0.01726	yes	CLNTRN
chr2_33670200_G_T_b38	RASGRP3	-2.976	0.00316	-0.051364	59	0.01726	yes	CLNTRN
chr2_33530497_CT_C_b38	RASGRP3	2.969	0.00323	0.063024	15	0.021224	yes	CLNTRN
chr2_33534496_G_A_b38	RASGRP3	-2.968	0.00324	-0.076304	4	0.025708	yes	CLNTRN
chr2_33546473_C_T_b38	RASGRP3	-2.965	0.00327	-0.069994	8	0.023606	yes	CLNTRN
chr2_33924715_T_C_b38	RASGRP3	2.964	0.00328	0.120231	8	0.040566	yes	CLNTRN
chr2_33929095_T_C_b38	RASGRP3	2.964	0.00328	0.120231	8	0.040566	yes	CLNTRN
chr2_33929358_T_C_b38	RASGRP3	2.964	0.00328	0.120231	8	0.040566	yes	CLNTRN
chr2_33534062_A_C_b38	RASGRP3	-2.961	0.00332	-0.074551	4	0.025181	yes	CLNTRN
chr2_32990106_A_C_b38	RASGRP3	2.949	0.00344	0.082894	4	0.028106	yes	CLNTRN
chr2_33551040_C_T_b38	RASGRP3	-2.937	0.00357	-0.068074	9	0.023176	yes	CLNTRN
chr2_32993662_G_A_b38	RASGRP3	2.924	0.00372	0.085264	4	0.029155	yes	CLNTRN
chr2_32994147_CAT_C_b38	RASGRP3	2.924	0.00372	0.085264	4	0.029155	yes	CLNTRN
chr2_32997012_G_A_b38	RASGRP3	2.924	0.00372	0.085264	4	0.029155	yes	CLNTRN
chr2_32997425_C_T_b38	RASGRP3	2.924	0.00372	0.085264	4	0.029155	yes	CLNTRN
chr2_32903383_A_C_b38	RASGRP3	-2.909	0.0039	-0.083657	3	0.028758	yes	CLNTRN
chr2_33664742_G_C_b38	RASGRP3	-2.904	0.00396	-0.048134	84	0.016576	yes	CLNTRN
chr2_33534328_C_T_b38	RASGRP3	-2.899	0.00402	-0.074265	4	0.025614	yes	CLNTRN
chr2_33546347_C_G_b38	RASGRP3	-2.875	0.00433	-0.067118	9	0.023344	yes	CLNTRN
chr2_33545336_G_A_b38	RASGRP3	-2.857	0.00458	-0.068583	7	0.024006	yes	CLNTRN
chr2_33091214_G_A_b38	RASGRP3	-2.852	0.00465	-0.068052	14	0.023863	yes	CLNTRN
chr2_33740099_T_TTTGTTG_b38	RASGRP3	-2.818	0.00516	-0.058788	17	0.020861	yes	CLNTRN
chr2_33523846_A_G_b38	RASGRP3	-2.813	0.00523	-0.062153	12	0.022093	yes	CLNTRN
chr2_33528012_T_G_b38	RASGRP3	-2.772	0.00592	-0.063522	11	0.022914	yes	CLNTRN
chr2_33130069_A_G_b38	RASGRP3	-2.752	0.00628	-0.094973	4	0.034507	yes	CLNTRN
chr2_33103628_A_T_b38	RASGRP3	-2.745	0.00643	-0.052132	52	0.018994	yes	CLNTRN
chr2_33666591_A_G_b38	RASGRP3	-2.731	0.00668	-0.045144	86	0.016527	yes	CLNTRN
chr2_32995224_G_A_b38	RASGRP3	2.726	0.00679	0.080314	4	0.02946	yes	CLNTRN
chr2_33787907_A_G_b38	RASGRP3	2.71	0.00711	0.0686	8	0.02531	yes	CLNTRN
chr2_33517217_G_A_b38	RASGRP3	2.698	0.00738	0.056435	16	0.020919	yes	CLNTRN
chr2_33552018_CAAACAAACA_C_b38	RASGRP3	-2.695	0.00744	-0.064363	8	0.023883	yes	CLNTRN
chr2_33906683_C_CATTTATTTATTTATTTATTTATTT_b38	RASGRP3	-2.688	0.00758	-0.052952	21	0.019696	yes	CLNTRN
chr2_33533388_C_T_b38	RASGRP3	-2.636	0.00882	-0.065254	6	0.024751	yes	CLNTRN
chr2_33511214_C_T_b38	RASGRP3	2.616	0.00936	0.052539	20	0.020087	yes	CLNTRN
chr2_33092645_AT_A_b38	RASGRP3	-2.604	0.00967	-0.063063	13	0.024217	yes	CLNTRN
chr2_33087209_G_A_b38	RASGRP3	2.602	0.00973	0.077319	3	0.029715	yes	CLNTRN
chr2_32495790_G_GT_b38	RASGRP3	2.601	0.00977	0.041804	78	0.016074	yes	CLNTRN
chr2_33537192_G_GAT_b38	RASGRP3	8.66	3.08e-16	0.20051	3	0.023155	no	CLNTRN
chr2_33537330_C_CCCAACACA_b38	RASGRP3	7.293	2.77e-12	0.157793	17	0.021637	no	CLNTRN
chr2_33586869_A_T_b38	RASGRP3	6.15	2.49e-09	0.120965	20	0.019668	no	CLNTRN
chr2_33537321_C_CA_b38	RASGRP3	5.322	2.03e-07	0.088536	53	0.016636	no	CLNTRN
chr2_33625315_G_A_b38	RASGRP3	5.236	3.11e-07	0.10192	22	0.019466	no	CLNTRN
chr2_33670716_C_T_b38	RASGRP3	5.193	3.85e-07	0.104432	17	0.020111	no	CLNTRN
chr2_33640631_A_C_b38	RASGRP3	4.999	9.86e-07	0.105149	13	0.021033	no	CLNTRN
chr2_33652477_C_A_b38	RASGRP3	4.976	1.1e-06	0.105858	12	0.021275	no	CLNTRN
chr2_33641397_G_C_b38	RASGRP3	4.913	1.48e-06	0.103208	13	0.021006	no	CLNTRN
chr2_33626436_A_T_b38	RASGRP3	4.828	2.21e-06	0.094771	24	0.019629	no	CLNTRN
chr2_33636858_C_G_b38	RASGRP3	4.809	2.41e-06	0.130085	5	0.027049	no	CLNTRN
chr2_33637736_A_T_b38	RASGRP3	4.809	2.41e-06	0.130085	5	0.027049	no	CLNTRN
chr2_33656916_G_A_b38	RASGRP3	4.789	2.65e-06	0.092432	26	0.0193	no	CLNTRN
chr2_33631243_G_GT_b38	RASGRP3	4.774	2.83e-06	0.131438	5	0.02753	no	CLNTRN
chr2_33906683_C_CATTTATTTATTTATTTATTT_b38	RASGRP3	4.746	3.22e-06	0.087283	27	0.018389	no	CLNTRN
chr2_33639021_G_A_b38	RASGRP3	4.713	3.75e-06	0.099003	13	0.021005	no	CLNTRN
chr2_33539996_AAAAAG_A_b38	RASGRP3	-4.709	3.83e-06	-0.081596	74	0.017328	no	CLNTRN
chr2_33662459_C_T_b38	RASGRP3	4.394	1.55e-05	0.092478	13	0.021048	no	CLNTRN
chr2_33537323_G_A_b38	RASGRP3	4.188	3.72e-05	0.067786	92	0.016186	no	CLNTRN
chr2_33669427_A_C_b38	RASGRP3	4.087	5.64e-05	0.093026	10	0.022764	no	CLNTRN
chr2_33661156_C_T_b38	RASGRP3	4.018	7.43e-05	0.082596	15	0.020554	no	CLNTRN
chr2_33661310_C_T_b38	RASGRP3	4.018	7.43e-05	0.082596	15	0.020554	no	CLNTRN
chr2_33588900_A_AT_b38	RASGRP3	-3.977	8.76e-05	-0.071151	66	0.01789	no	CLNTRN
chr2_33669574_A_G_b38	RASGRP3	3.898	0.00012	0.089058	10	0.022845	no	CLNTRN
chr2_33548381_A_AAAAAG_b38	RASGRP3	3.86	0.000139	0.109702	6	0.028422	no	CLNTRN
chr2_33615675_TA_T_b38	RASGRP3	-3.821	0.000162	-0.064683	65	0.016927	no	CLNTRN
chr2_33617107_G_A_b38	RASGRP3	-3.817	0.000164	-0.064355	65	0.016859	no	CLNTRN
chr2_33625063_ATCT_A_b38	RASGRP3	-3.781	0.000189	-0.064587	59	0.017084	no	CLNTRN
chr2_33607748_A_G_b38	RASGRP3	-3.764	0.000201	-0.062249	68	0.016537	no	CLNTRN
chr2_33618669_C_CT_b38	RASGRP3	-3.735	0.000225	-0.062572	66	0.016754	no	CLNTRN
chr2_33618734_A_G_b38	RASGRP3	-3.735	0.000225	-0.062572	66	0.016754	no	CLNTRN
chr2_33605951_T_C_b38	RASGRP3	-3.683	0.000274	-0.062148	76	0.016876	no	CLNTRN
chr2_33622456_T_TAAAC_b38	RASGRP3	-3.538	0.000468	-0.059522	66	0.016824	no	CLNTRN
chr2_33613986_T_C_b38	RASGRP3	-3.509	0.000519	-0.058493	68	0.016669	no	CLNTRN
chr2_33614957_G_A_b38	RASGRP3	-3.419	0.000717	-0.057701	65	0.016878	no	CLNTRN
chr2_33509059_T_G_b38	RASGRP3	-3.367	0.000862	-0.073312	14	0.021777	no	CLNTRN
chr2_33625433_A_C_b38	RASGRP3	-3.348	0.000918	-0.057004	61	0.017025	no	CLNTRN
chr2_33661861_G_A_b38	RASGRP3	-3.345	0.00093	-0.055835	77	0.016694	no	CLNTRN
chr2_33571586_T_C_b38	RASGRP3	-3.341	0.000942	-0.054574	82	0.016336	no	CLNTRN
chr2_33663649_A_C_b38	RASGRP3	-3.288	0.00113	-0.054413	84	0.016549	no	CLNTRN
chr2_33630364_C_G_b38	RASGRP3	-3.284	0.00114	-0.055676	63	0.016951	no	CLNTRN
chr2_33534694_ATT_A_b38	RASGRP3	-3.274	0.00119	-0.088967	4	0.027174	no	CLNTRN
chr2_33540861_TA_T_b38	RASGRP3	-3.254	0.00127	-0.056487	53	0.017357	no	CLNTRN
chr2_32711116_C_CAA_b38	RASGRP3	3.23	0.00137	0.105997	7	0.032812	no	CLNTRN
chr2_33567211_TA_T_b38	RASGRP3	-3.213	0.00146	-0.059446	49	0.018504	no	CLNTRN
chr2_34088648_A_G_b38	RASGRP3	-3.204	0.0015	-0.077737	7	0.024262	no	CLNTRN
chr2_33535943_T_C_b38	RASGRP3	-3.183	0.00161	-0.07889	6	0.024783	no	CLNTRN
chr2_33632169_T_C_b38	RASGRP3	-3.176	0.00165	-0.054156	60	0.01705	no	CLNTRN
chr2_33535555_G_GC_b38	RASGRP3	-3.158	0.00175	-0.078525	6	0.024862	no	CLNTRN
chr2_33515788_C_T_b38	RASGRP3	-3.149	0.00181	-0.080483	6	0.02556	no	CLNTRN
chr2_33539533_G_T_b38	RASGRP3	-3.12	0.00199	-0.049236	89	0.01578	no	CLNTRN
chr2_33604404_GTA_G_b38	RASGRP3	-3.115	0.00202	-0.056663	37	0.018192	no	CLNTRN
chr2_33631637_C_A_b38	RASGRP3	-3.06	0.00241	-0.051932	64	0.016969	no	CLNTRN
chr2_33151823_TTGTGTGTGTGTG_T_b38	RASGRP3	3.048	0.00251	0.094739	6	0.031077	no	CLNTRN
chr2_33927027_C_G_b38	RASGRP3	3.013	0.00281	0.119151	9	0.039541	no	CLNTRN
chr2_32461032_CTT_C_b38	RASGRP3	3	0.00293	0.133093	3	0.04436	no	CLNTRN
chr2_33540888_T_C_b38	RASGRP3	-2.986	0.00307	-0.047395	87	0.015875	no	CLNTRN
chr2_33661731_A_G_b38	RASGRP3	-2.978	0.00314	-0.049273	83	0.016544	no	CLNTRN
chr2_33591195_C_CT_b38	RASGRP3	-2.908	0.00391	-0.057369	38	0.019728	no	CLNTRN
chr2_33664871_G_GT_b38	RASGRP3	-2.864	0.00448	-0.048178	77	0.016823	no	CLNTRN
chr2_32461039_T_C_b38	RASGRP3	2.855	0.0046	0.126477	3	0.044294	no	CLNTRN
chr2_33625060_G_A_b38	RASGRP3	-2.85	0.00468	-0.048318	66	0.016953	no	CLNTRN
chr2_33624514_C_A_b38	RASGRP3	-2.839	0.00484	-0.048098	67	0.016943	no	CLNTRN
chr2_33573675_A_G_b38	RASGRP3	2.83	0.00497	0.097917	4	0.034599	no	CLNTRN
chr2_33771916_C_T_b38	RASGRP3	2.814	0.00522	0.068002	15	0.024169	no	CLNTRN
chr2_33771954_G_T_b38	RASGRP3	2.814	0.00522	0.068002	15	0.024169	no	CLNTRN
chr2_33664465_T_A_b38	RASGRP3	-2.808	0.00532	-0.046784	81	0.016663	no	CLNTRN
chr2_33536322_GA_G_b38	RASGRP3	-2.772	0.00592	-0.054513	63	0.019666	no	CLNTRN
chr2_33630302_AT_A_b38	RASGRP3	-2.739	0.00654	-0.050855	66	0.01857	no	CLNTRN
chr2_33629277_A_G_b38	RASGRP3	-2.727	0.00678	-0.045959	70	0.016856	no	CLNTRN
chr2_32607975_C_CA_b38	RASGRP3	-2.723	0.00685	-0.060102	21	0.022072	no	CLNTRN
chr2_33454164_C_T_b38	RASGRP3	-2.717	0.00697	-0.055862	19	0.020557	no	CLNTRN
chr2_33520269_T_C_b38	RASGRP3	2.714	0.00704	0.056989	16	0.021	no	CLNTRN
chr2_33709806_T_TA_b38	RASGRP3	-2.684	0.00769	-0.118921	3	0.044312	no	CLNTRN
chr2_33631185_T_G_b38	RASGRP3	-2.666	0.00809	-0.044067	86	0.016527	no	CLNTRN
chr2_33518738_C_T_b38	RASGRP3	2.661	0.0082	0.055491	17	0.02085	no	CLNTRN
chr2_33547053_GAAAAAA_G_b38	RASGRP3	-2.62	0.00923	-0.059547	11	0.022724	no	CLNTRN
chr2_33522218_G_A_b38	RASGRP3	2.603	0.0097	0.054578	15	0.020965	no	CLNTRN
chr2_33631863_T_C_b38	RASGRP3	-2.603	0.00971	-0.043223	86	0.016606	no	CLNTRN
chr2_33540561_TGTGTGTGTGTGTGTGTG_T_b38	RASGRP3	-2.601	0.00976	-0.044908	54	0.017266	no	CLNTRN
chr2_33647687_C_CA_b38	RASGRP3	2.6	0.00978	0.055635	20	0.021397	no	CLNTRN
chr2_33546942_C_G_b38	RASGRP3	7.42	1.48e-12	0.207719	6	0.027995	yes	ESPGSJ
chr2_33586869_A_T_b38	RASGRP3	6.797	6.67e-11	0.151103	20	0.022232	yes	ESPGSJ
chr2_33552022_CAAACA_C_b38	RASGRP3	6.69	1.25e-10	0.198607	5	0.029687	yes	ESPGSJ
chr2_33512177_G_A_b38	RASGRP3	6.627	1.81e-10	0.165817	14	0.02502	yes	ESPGSJ
chr2_33581561_C_T_b38	RASGRP3	6.449	5.08e-10	0.140001	25	0.021711	yes	ESPGSJ
chr2_33596963_A_T_b38	RASGRP3	6.379	7.57e-10	0.13735	27	0.021533	yes	ESPGSJ
chr2_33565263_A_G_b38	RASGRP3	6.26	1.48e-09	0.135396	28	0.021629	yes	ESPGSJ
chr2_33582025_C_T_b38	RASGRP3	6.255	1.52e-09	0.137704	24	0.022014	yes	ESPGSJ
chr2_33596617_C_T_b38	RASGRP3	6.242	1.63e-09	0.135742	26	0.021746	yes	ESPGSJ
chr2_33594326_C_T_b38	RASGRP3	6.218	1.87e-09	0.135572	26	0.021804	yes	ESPGSJ
chr2_33594385_G_A_b38	RASGRP3	6.218	1.87e-09	0.135572	26	0.021804	yes	ESPGSJ
chr2_33525341_A_AAT_b38	RASGRP3	5.775	2.09e-08	0.146497	16	0.025369	yes	ESPGSJ
chr2_33571342_T_C_b38	RASGRP3	-5.711	2.92e-08	-0.115309	58	0.020191	yes	ESPGSJ
chr2_33571267_T_A_b38	RASGRP3	-5.702	3.05e-08	-0.115356	57	0.020229	yes	ESPGSJ
chr2_33572204_C_A_b38	RASGRP3	-5.626	4.55e-08	-0.115284	56	0.020491	yes	ESPGSJ
chr2_33567745_C_T_b38	RASGRP3	-5.615	4.82e-08	-0.117341	49	0.020898	yes	ESPGSJ
chr2_33569371_A_G_b38	RASGRP3	-5.53	7.49e-08	-0.112607	59	0.020365	yes	ESPGSJ
chr2_33512820_T_A_b38	RASGRP3	-5.52	7.85e-08	-0.11074	51	0.020061	yes	ESPGSJ
chr2_33563965_A_G_b38	RASGRP3	5.519	7.91e-08	0.144554	11	0.026193	yes	ESPGSJ
chr2_33581900_A_T_b38	RASGRP3	5.507	8.4e-08	0.145284	11	0.026381	yes	ESPGSJ
chr2_33575950_G_A_b38	RASGRP3	-5.47	1.01e-07	-0.112638	55	0.020592	yes	ESPGSJ
chr2_33568339_TA_T_b38	RASGRP3	-5.436	1.2e-07	-0.111062	62	0.02043	yes	ESPGSJ
chr2_33581338_T_A_b38	RASGRP3	5.43	1.24e-07	0.14261	11	0.026265	yes	ESPGSJ
chr2_33577889_G_A_b38	RASGRP3	-5.429	1.25e-07	-0.112531	54	0.02073	yes	ESPGSJ
chr2_33657078_T_C_b38	RASGRP3	5.413	1.36e-07	0.118791	28	0.021946	yes	ESPGSJ
chr2_33519891_C_T_b38	RASGRP3	-5.282	2.6e-07	-0.109934	51	0.020811	yes	ESPGSJ
chr2_33596450_T_G_b38	RASGRP3	5.272	2.74e-07	0.108036	36	0.020491	yes	ESPGSJ
chr2_33590881_T_C_b38	RASGRP3	5.168	4.56e-07	0.107283	34	0.020758	yes	ESPGSJ
chr2_33589264_G_C_b38	RASGRP3	5.052	8e-07	0.104629	35	0.02071	yes	ESPGSJ
chr2_33518114_A_G_b38	RASGRP3	-5.013	9.63e-07	-0.10417	44	0.02078	yes	ESPGSJ
chr2_33514489_T_C_b38	RASGRP3	-4.899	1.65e-06	-0.098324	54	0.020071	yes	ESPGSJ
chr2_33622160_C_T_b38	RASGRP3	4.83	2.28e-06	0.104054	29	0.021545	yes	ESPGSJ
chr2_33606703_C_T_b38	RASGRP3	4.802	2.59e-06	0.143361	6	0.029857	yes	ESPGSJ
chr2_33656848_TA_T_b38	RASGRP3	4.729	3.61e-06	0.106623	23	0.022544	yes	ESPGSJ
chr2_33571586_T_C_b38	RASGRP3	-4.694	4.24e-06	-0.09795	65	0.020868	yes	ESPGSJ
chr2_33616325_C_T_b38	RASGRP3	4.663	4.86e-06	0.138575	6	0.029715	yes	ESPGSJ
chr2_33561445_C_A_b38	RASGRP3	4.501	1e-05	0.110842	14	0.024628	yes	ESPGSJ
chr2_33606727_T_C_b38	RASGRP3	4.385	1.66e-05	0.14244	3	0.032486	yes	ESPGSJ
chr2_33529318_C_T_b38	RASGRP3	4.382	1.68e-05	0.112201	10	0.025607	yes	ESPGSJ
chr2_33514230_T_G_b38	RASGRP3	4.339	2.01e-05	0.114418	13	0.026368	yes	ESPGSJ
chr2_33656248_TTC_T_b38	RASGRP3	4.327	2.12e-05	0.102021	16	0.023579	yes	ESPGSJ
chr2_33650021_A_G_b38	RASGRP3	4.31	2.28e-05	0.101461	16	0.023539	yes	ESPGSJ
chr2_33515662_T_C_b38	RASGRP3	4.299	2.39e-05	0.115791	13	0.026935	yes	ESPGSJ
chr2_33652477_C_A_b38	RASGRP3	4.262	2.79e-05	0.100092	16	0.023484	yes	ESPGSJ
chr2_33523649_G_A_b38	RASGRP3	4.254	2.89e-05	0.109475	12	0.025736	yes	ESPGSJ
chr2_33605827_ATTTTTCT_A_b38	RASGRP3	4.248	2.95e-05	0.121388	8	0.028572	yes	ESPGSJ
chr2_33640513_G_C_b38	RASGRP3	4.243	3.02e-05	0.125586	6	0.029599	yes	ESPGSJ
chr2_33634524_A_G_b38	RASGRP3	4.215	3.4e-05	0.125908	6	0.029873	yes	ESPGSJ
chr2_33639021_G_A_b38	RASGRP3	4.205	3.53e-05	0.099605	15	0.023685	yes	ESPGSJ
chr2_33641397_G_C_b38	RASGRP3	4.205	3.53e-05	0.099605	15	0.023685	yes	ESPGSJ
chr2_33659035_G_A_b38	RASGRP3	4.203	3.57e-05	0.124803	6	0.029692	yes	ESPGSJ
chr2_33640631_A_C_b38	RASGRP3	4.176	4e-05	0.099122	15	0.023738	yes	ESPGSJ
chr2_33622592_T_C_b38	RASGRP3	4.164	4.19e-05	0.088626	36	0.021282	yes	ESPGSJ
chr2_33636858_C_G_b38	RASGRP3	4.156	4.33e-05	0.123966	6	0.029826	yes	ESPGSJ
chr2_33637736_A_T_b38	RASGRP3	4.156	4.33e-05	0.123966	6	0.029826	yes	ESPGSJ
chr2_33662459_C_T_b38	RASGRP3	4.149	4.46e-05	0.097985	16	0.023617	yes	ESPGSJ
chr2_33663555_T_C_b38	RASGRP3	4.097	5.52e-05	0.097134	16	0.023709	yes	ESPGSJ
chr2_33631243_G_GT_b38	RASGRP3	4.024	7.41e-05	0.122135	6	0.030352	yes	ESPGSJ
chr2_33543901_C_G_b38	RASGRP3	-4.003	8.06e-05	-0.0846	44	0.021135	yes	ESPGSJ
chr2_33667549_A_G_b38	RASGRP3	3.965	9.38e-05	0.119485	6	0.030137	yes	ESPGSJ
chr2_33667555_A_G_b38	RASGRP3	3.965	9.38e-05	0.119485	6	0.030137	yes	ESPGSJ
chr2_33670716_C_T_b38	RASGRP3	3.952	9.88e-05	0.090089	20	0.022797	yes	ESPGSJ
chr2_33613720_G_A_b38	RASGRP3	3.945	0.000101	0.111067	9	0.028152	yes	ESPGSJ
chr2_33634816_G_T_b38	RASGRP3	3.819	0.000166	0.114057	6	0.029863	yes	ESPGSJ
chr2_33556928_C_CACACACATACAT_b38	RASGRP3	3.782	0.000191	0.113377	3	0.02998	yes	ESPGSJ
chr2_33592302_T_C_b38	RASGRP3	3.687	0.000274	0.146969	3	0.039864	yes	ESPGSJ
chr2_33520141_T_C_b38	RASGRP3	-3.685	0.000276	-0.076851	64	0.020856	yes	ESPGSJ
chr2_33555164_G_A_b38	RASGRP3	3.68	0.000281	0.093636	13	0.025447	yes	ESPGSJ
chr2_33521266_C_T_b38	RASGRP3	3.629	0.000339	0.086351	24	0.023795	yes	ESPGSJ
chr2_33627793_A_G_b38	RASGRP3	3.547	0.000458	0.104997	6	0.029603	yes	ESPGSJ
chr2_33656916_G_A_b38	RASGRP3	3.513	0.000518	0.077286	31	0.022	yes	ESPGSJ
chr2_33647687_C_CA_b38	RASGRP3	3.503	0.000537	0.08361	23	0.023866	yes	ESPGSJ
chr2_33512902_A_G_b38	RASGRP3	-3.46	0.000627	-0.072481	72	0.02095	yes	ESPGSJ
chr2_33470380_AT_A_b38	RASGRP3	-3.436	0.000683	-0.086916	13	0.025299	yes	ESPGSJ
chr2_33518880_G_GTCA_b38	RASGRP3	-3.419	0.000725	-0.070923	66	0.020746	yes	ESPGSJ
chr2_33449783_A_C_b38	RASGRP3	-3.402	0.000768	-0.087151	12	0.025615	yes	ESPGSJ
chr2_33661156_C_T_b38	RASGRP3	3.332	0.000979	0.076427	21	0.022935	yes	ESPGSJ
chr2_33661310_C_T_b38	RASGRP3	3.332	0.000979	0.076427	21	0.022935	yes	ESPGSJ
chr2_33625315_G_A_b38	RASGRP3	3.324	0.00101	0.077136	23	0.023208	yes	ESPGSJ
chr2_33634843_C_CTT_b38	RASGRP3	3.315	0.00104	0.108607	6	0.03276	yes	ESPGSJ
chr2_33537323_G_A_b38	RASGRP3	3.254	0.00128	0.060236	92	0.018513	yes	ESPGSJ
chr2_33844079_A_G_b38	RASGRP3	3.213	0.00147	0.13242	5	0.041212	yes	ESPGSJ
chr2_33575832_C_A_b38	RASGRP3	-3.208	0.00149	-0.064558	70	0.020121	yes	ESPGSJ
chr2_33523461_TA_T_b38	RASGRP3	3.183	0.00163	0.086416	7	0.027151	yes	ESPGSJ
chr2_33605951_T_C_b38	RASGRP3	-3.154	0.00179	-0.062909	66	0.019948	yes	ESPGSJ
chr2_33539996_AAAAAG_A_b38	RASGRP3	-3.124	0.00197	-0.064083	78	0.02051	yes	ESPGSJ
chr2_33580247_A_G_b38	RASGRP3	-3.1	0.00214	-0.063582	67	0.020509	yes	ESPGSJ
chr2_33577835_T_C_b38	RASGRP3	-3.053	0.00249	-0.062236	67	0.020385	yes	ESPGSJ
chr2_33470380_ATT_A_b38	RASGRP3	3.041	0.00258	0.071513	54	0.023514	yes	ESPGSJ
chr2_33494042_A_G_b38	RASGRP3	3.029	0.00269	0.10173	5	0.033585	yes	ESPGSJ
chr2_33672387_A_G_b38	RASGRP3	2.966	0.00329	0.077845	12	0.026249	yes	ESPGSJ
chr2_32781435_A_T_b38	RASGRP3	2.947	0.00348	0.078378	6	0.026593	yes	ESPGSJ
chr2_33603617_TC_T_b38	RASGRP3	2.947	0.00348	0.089221	6	0.030273	yes	ESPGSJ
chr2_33556890_T_TACACACACAC_b38	RASGRP3	-2.946	0.00349	-0.11315	4	0.038403	yes	ESPGSJ
chr2_33296650_G_A_b38	RASGRP3	-2.927	0.00371	-0.088092	5	0.030093	yes	ESPGSJ
chr2_33607432_G_A_b38	RASGRP3	2.925	0.00374	0.091705	5	0.031355	yes	ESPGSJ
chr2_33576389_C_T_b38	RASGRP3	-2.905	0.00397	-0.060477	64	0.020816	yes	ESPGSJ
chr2_33006381_CTTT_C_b38	RASGRP3	2.891	0.00415	0.07085	16	0.024508	yes	ESPGSJ
chr2_32748781_A_G_b38	RASGRP3	-2.872	0.00439	-0.077076	6	0.026834	yes	ESPGSJ
chr2_33276936_A_G_b38	RASGRP3	-2.871	0.00442	-0.063083	35	0.021976	yes	ESPGSJ
chr2_33347117_C_CAA_b38	RASGRP3	-2.834	0.00494	-0.114222	5	0.040307	yes	ESPGSJ
chr2_33493612_C_T_b38	RASGRP3	2.799	0.00548	0.09644	4	0.03445	yes	ESPGSJ
chr2_33603907_A_C_b38	RASGRP3	2.781	0.0058	0.084914	6	0.030537	yes	ESPGSJ
chr2_32753523_T_C_b38	RASGRP3	-2.777	0.00586	-0.074355	6	0.026775	yes	ESPGSJ
chr2_32781092_G_A_b38	RASGRP3	2.753	0.00631	0.0739	6	0.026848	yes	ESPGSJ
chr2_32788689_C_A_b38	RASGRP3	2.753	0.00631	0.0739	6	0.026848	yes	ESPGSJ
chr2_32770911_A_G_b38	RASGRP3	-2.753	0.00631	-0.0739	6	0.026848	yes	ESPGSJ
chr2_32773501_A_G_b38	RASGRP3	-2.753	0.00631	-0.0739	6	0.026848	yes	ESPGSJ
chr2_33563470_A_ATACT_b38	RASGRP3	-2.752	0.00631	-0.097293	4	0.03535	yes	ESPGSJ
chr2_33626436_A_T_b38	RASGRP3	2.746	0.00643	0.062357	29	0.022707	yes	ESPGSJ
chr2_32616560_CA_C_b38	RASGRP3	2.745	0.00645	0.076605	9	0.027906	yes	ESPGSJ
chr2_32750602_G_A_b38	RASGRP3	-2.743	0.00648	-0.07358	6	0.026821	yes	ESPGSJ
chr2_32774081_G_A_b38	RASGRP3	-2.743	0.00648	-0.07358	6	0.026821	yes	ESPGSJ
chr2_32776877_C_T_b38	RASGRP3	-2.743	0.00648	-0.07358	6	0.026821	yes	ESPGSJ
chr2_32770697_T_C_b38	RASGRP3	-2.742	0.00651	-0.074618	5	0.027213	yes	ESPGSJ
chr2_33669427_A_C_b38	RASGRP3	2.736	0.00663	0.072844	11	0.026624	yes	ESPGSJ
chr2_32618228_A_T_b38	RASGRP3	-2.721	0.00693	-0.060948	31	0.022402	yes	ESPGSJ
chr2_33669574_A_G_b38	RASGRP3	2.711	0.00713	0.071795	11	0.026481	yes	ESPGSJ
chr2_33311084_A_G_b38	RASGRP3	-2.692	0.00753	-0.058959	34	0.021899	yes	ESPGSJ
chr2_33383890_A_C_b38	RASGRP3	-2.69	0.00758	-0.075952	6	0.028234	yes	ESPGSJ
chr2_33540561_TGTGTGTGTGTGTGTGTG_T_b38	RASGRP3	-2.674	0.00795	-0.056007	51	0.020945	yes	ESPGSJ
chr2_33373822_A_C_b38	RASGRP3	-2.673	0.00798	-0.086252	3	0.032272	yes	ESPGSJ
chr2_32753076_C_G_b38	RASGRP3	-2.669	0.00807	-0.071482	6	0.026787	yes	ESPGSJ
chr2_33679537_C_CTT_b38	RASGRP3	-2.668	0.00808	-0.107327	7	0.040226	yes	ESPGSJ
chr2_33615793_A_T_b38	RASGRP3	2.665	0.00814	0.082899	5	0.031101	yes	ESPGSJ
chr2_33621944_G_A_b38	RASGRP3	2.665	0.00814	0.082899	5	0.031101	yes	ESPGSJ
chr2_33623483_C_T_b38	RASGRP3	2.665	0.00814	0.082899	5	0.031101	yes	ESPGSJ
chr2_32742993_T_C_b38	RASGRP3	-2.656	0.00838	-0.071198	7	0.02681	yes	ESPGSJ
chr2_32754549_C_T_b38	RASGRP3	-2.649	0.00854	-0.070891	6	0.026761	yes	ESPGSJ
chr2_32754679_C_G_b38	RASGRP3	-2.649	0.00854	-0.070891	6	0.026761	yes	ESPGSJ
chr2_32993969_A_AGT_b38	RASGRP3	2.643	0.00869	0.087471	5	0.033095	yes	ESPGSJ
chr2_33677515_A_G_b38	RASGRP3	2.636	0.00885	0.075012	8	0.028452	yes	ESPGSJ
chr2_33374733_T_C_b38	RASGRP3	-2.634	0.00892	-0.065663	28	0.024928	yes	ESPGSJ
chr2_33615450_C_G_b38	RASGRP3	2.63	0.00902	0.082373	5	0.031318	yes	ESPGSJ
chr2_32725585_C_G_b38	RASGRP3	-2.623	0.00919	-0.067937	10	0.025896	yes	ESPGSJ
chr2_32771489_C_G_b38	RASGRP3	-2.619	0.0093	-0.070482	6	0.026908	yes	ESPGSJ
chr2_33385643_G_A_b38	RASGRP3	-2.617	0.00937	-0.066566	19	0.02544	yes	ESPGSJ
chr2_33330347_T_C_b38	RASGRP3	-2.615	0.00942	-0.057696	32	0.022064	yes	ESPGSJ
chr2_33463583_T_C_b38	RASGRP3	-2.61	0.00954	-0.07433	4	0.028475	yes	ESPGSJ
chr2_33378185_A_G_b38	RASGRP3	-2.596	0.00994	-0.081308	3	0.031321	yes	ESPGSJ
chr2_33537896_A_G_b38	RASGRP3	8.293	5.02e-15	0.234817	4	0.028315	no	ESPGSJ
chr2_33536526_G_A_b38	RASGRP3	7.868	8.37e-14	0.233252	3	0.029645	no	ESPGSJ
chr2_33536528_G_A_b38	RASGRP3	7.868	8.37e-14	0.233252	3	0.029645	no	ESPGSJ
chr2_33557635_G_A_b38	RASGRP3	7.822	1.13e-13	0.220585	5	0.028201	no	ESPGSJ
chr2_33559304_G_A_b38	RASGRP3	7.822	1.13e-13	0.220585	5	0.028201	no	ESPGSJ
chr2_33559734_G_A_b38	RASGRP3	7.822	1.13e-13	0.220585	5	0.028201	no	ESPGSJ
chr2_33526597_C_T_b38	RASGRP3	7.757	1.72e-13	0.225941	4	0.029126	no	ESPGSJ
chr2_33527062_GC_G_b38	RASGRP3	7.757	1.72e-13	0.225941	4	0.029126	no	ESPGSJ
chr2_33531453_C_T_b38	RASGRP3	7.668	3.06e-13	0.217168	5	0.028323	no	ESPGSJ
chr2_33559068_A_G_b38	RASGRP3	7.653	3.36e-13	0.217203	5	0.028381	no	ESPGSJ
chr2_33548469_T_C_b38	RASGRP3	7.353	2.25e-12	0.213185	5	0.028994	no	ESPGSJ
chr2_33529269_C_A_b38	RASGRP3	7.343	2.4e-12	0.207701	5	0.028287	no	ESPGSJ
chr2_33557844_G_A_b38	RASGRP3	7.229	4.87e-12	0.198825	7	0.027505	no	ESPGSJ
chr2_33537192_G_GAT_b38	RASGRP3	7.227	4.92e-12	0.202787	4	0.028061	no	ESPGSJ
chr2_33548762_A_G_b38	RASGRP3	7.178	6.66e-12	0.209262	5	0.029154	no	ESPGSJ
chr2_33550484_C_G_b38	RASGRP3	7.023	1.71e-11	0.206323	5	0.029376	no	ESPGSJ
chr2_33550216_T_A_b38	RASGRP3	7.023	1.72e-11	0.205484	5	0.029259	no	ESPGSJ
chr2_33551676_A_G_b38	RASGRP3	6.907	3.46e-11	0.208186	4	0.030142	no	ESPGSJ
chr2_33551697_A_T_b38	RASGRP3	6.907	3.46e-11	0.208186	4	0.030142	no	ESPGSJ
chr2_33553995_C_T_b38	RASGRP3	6.822	5.73e-11	0.202278	5	0.029649	no	ESPGSJ
chr2_33554542_A_G_b38	RASGRP3	6.822	5.73e-11	0.202278	5	0.029649	no	ESPGSJ
chr2_33537330_C_CCCAACACA_b38	RASGRP3	6.584	2.33e-10	0.169029	17	0.025672	no	ESPGSJ
chr2_33540561_TGTGTGTGTGTG_T_b38	RASGRP3	6.552	2.8e-10	0.181682	10	0.027728	no	ESPGSJ
chr2_33547053_GAA_G_b38	RASGRP3	6.284	1.3e-09	0.228748	4	0.036404	no	ESPGSJ
chr2_33536322_G_GA_b38	RASGRP3	5.205	3.81e-07	0.149384	10	0.028702	no	ESPGSJ
chr2_33588900_A_AT_b38	RASGRP3	-4.358	1.86e-05	-0.094104	58	0.021594	no	ESPGSJ
chr2_33511010_G_A_b38	RASGRP3	4.121	5e-05	0.134013	7	0.032518	no	ESPGSJ
chr2_33621819_C_A_b38	RASGRP3	3.965	9.36e-05	0.08417	37	0.021227	no	ESPGSJ
chr2_33537323_G_C_b38	RASGRP3	-3.84	0.000153	-0.089623	25	0.023338	no	ESPGSJ
chr2_33623108_T_C_b38	RASGRP3	3.684	0.000277	0.079721	37	0.021639	no	ESPGSJ
chr2_33604404_GTA_G_b38	RASGRP3	-3.5	0.000543	-0.078319	28	0.022376	no	ESPGSJ
chr2_33561192_A_G_b38	RASGRP3	3.48	0.000583	0.070392	72	0.020227	no	ESPGSJ
chr2_33564467_A_G_b38	RASGRP3	3.412	0.000741	0.071413	50	0.020927	no	ESPGSJ
chr2_33540861_T_TA_b38	RASGRP3	-3.379	0.000832	-0.11644	7	0.034456	no	ESPGSJ
chr2_33525699_C_CAA_b38	RASGRP3	3.299	0.0011	0.124152	11	0.037631	no	ESPGSJ
chr2_33589523_A_G_b38	RASGRP3	-3.297	0.00111	-0.066561	70	0.020188	no	ESPGSJ
chr2_33467980_TTTTCTTTCTTTC_T_b38	RASGRP3	3.265	0.00123	0.089132	14	0.027296	no	ESPGSJ
chr2_33564001_C_G_b38	RASGRP3	3.244	0.00132	0.068819	46	0.021212	no	ESPGSJ
chr2_33532487_C_A_b38	RASGRP3	3.2	0.00154	0.065485	76	0.020464	no	ESPGSJ
chr2_33586449_C_G_b38	RASGRP3	-3.198	0.00154	-0.065535	67	0.020491	no	ESPGSJ
chr2_33593131_C_T_b38	RASGRP3	-3.198	0.00154	-0.065535	67	0.020491	no	ESPGSJ
chr2_33485510_G_A_b38	RASGRP3	3.078	0.00229	0.078858	15	0.025616	no	ESPGSJ
chr2_33590404_A_G_b38	RASGRP3	-3.075	0.00232	-0.063138	67	0.020535	no	ESPGSJ
chr2_33592492_A_G_b38	RASGRP3	-3.075	0.00232	-0.063138	67	0.020535	no	ESPGSJ
chr2_33508487_T_C_b38	RASGRP3	3.048	0.00253	0.096481	11	0.031649	no	ESPGSJ
chr2_33543280_C_G_b38	RASGRP3	-3.001	0.00294	-0.096064	4	0.032014	no	ESPGSJ
chr2_33562267_C_CT_b38	RASGRP3	2.982	0.00312	0.060428	67	0.020265	no	ESPGSJ
chr2_33538452_G_A_b38	RASGRP3	-2.982	0.00313	-0.096059	4	0.032217	no	ESPGSJ
chr2_33597253_G_A_b38	RASGRP3	-2.973	0.00321	-0.062109	63	0.020893	no	ESPGSJ
chr2_33535943_T_C_b38	RASGRP3	-2.971	0.00323	-0.092603	5	0.031165	no	ESPGSJ
chr2_33512039_C_T_b38	RASGRP3	-2.948	0.00347	-0.105126	4	0.03566	no	ESPGSJ
chr2_33537321_C_CA_b38	RASGRP3	2.937	0.0036	0.060374	49	0.020556	no	ESPGSJ
chr2_33591195_C_CT_b38	RASGRP3	-2.931	0.00366	-0.065741	41	0.022428	no	ESPGSJ
chr2_33546347_C_G_b38	RASGRP3	-2.927	0.00371	-0.083656	8	0.028579	no	ESPGSJ
chr2_33542583_A_T_b38	RASGRP3	-2.917	0.00382	-0.093811	11	0.032156	no	ESPGSJ
chr2_33546473_C_T_b38	RASGRP3	-2.887	0.00421	-0.083986	7	0.029096	no	ESPGSJ
chr2_33535555_G_GC_b38	RASGRP3	-2.877	0.00434	-0.089928	5	0.031262	no	ESPGSJ
chr2_33538430_G_C_b38	RASGRP3	-2.861	0.00455	-0.09199	4	0.032152	no	ESPGSJ
chr2_33518912_G_C_b38	RASGRP3	-2.856	0.00462	-0.115029	3	0.040276	no	ESPGSJ
chr2_33301045_C_G_b38	RASGRP3	-2.848	0.00473	-0.057742	56	0.020274	no	ESPGSJ
chr2_33711450_CAA_C_b38	RASGRP3	-2.831	0.00499	-0.087788	3	0.031012	no	ESPGSJ
chr2_33561322_C_T_b38	RASGRP3	-2.824	0.00509	-0.085159	6	0.030153	no	ESPGSJ
chr2_33680214_T_G_b38	RASGRP3	-2.823	0.00511	-0.088994	4	0.031527	no	ESPGSJ
chr2_33642130_G_T_b38	RASGRP3	2.805	0.0054	0.052681	80	0.018783	no	ESPGSJ
chr2_33545336_G_A_b38	RASGRP3	-2.775	0.0059	-0.082259	6	0.02964	no	ESPGSJ
chr2_33550119_G_T_b38	RASGRP3	-2.761	0.00615	-0.081295	7	0.02944	no	ESPGSJ
chr2_33553788_G_A_b38	RASGRP3	-2.761	0.00615	-0.081295	7	0.02944	no	ESPGSJ
chr2_33556856_G_C_b38	RASGRP3	-2.761	0.00615	-0.081295	7	0.02944	no	ESPGSJ
chr2_33547053_GAAAAAA_G_b38	RASGRP3	-2.714	0.00707	-0.07682	8	0.028308	no	ESPGSJ
chr2_33305323_C_G_b38	RASGRP3	-2.68	0.0078	-0.055317	53	0.02064	no	ESPGSJ
chr2_33511656_T_C_b38	RASGRP3	-2.678	0.00785	-0.106093	3	0.039613	no	ESPGSJ
chr2_33080168_A_G_b38	RASGRP3	2.67	0.00803	0.076344	8	0.028592	no	ESPGSJ
chr2_33515788_C_T_b38	RASGRP3	-2.652	0.00846	-0.086042	4	0.032442	no	ESPGSJ
chr2_33604404_G_GTA_b38	RASGRP3	2.65	0.00851	0.081804	5	0.030867	no	ESPGSJ
chr2_33605847_C_CT_b38	RASGRP3	2.644	0.00867	0.08404	3	0.031788	no	ESPGSJ
chr2_33615675_TA_T_b38	RASGRP3	-2.618	0.00934	-0.053621	55	0.020483	no	ESPGSJ
chr2_33516225_T_C_b38	RASGRP3	-2.611	0.00952	-0.102936	3	0.039419	no	ESPGSJ
chr2_32806967_C_T_b38	RASGRP3	2.604	0.00973	0.065279	12	0.025073	no	ESPGSJ
chr2_33303728_A_G_b38	RASGRP3	-2.596	0.00993	-0.052123	61	0.020076	no	ESPGSJ
chr2_33557635_G_A_b38	RASGRP3	16.423	2.62e-47	0.224393	7	0.013663	yes	ESPMCS
chr2_33559304_G_A_b38	RASGRP3	16.285	1.05e-46	0.224112	7	0.013762	yes	ESPMCS
chr2_33559734_G_A_b38	RASGRP3	16.194	2.63e-46	0.221925	7	0.013704	yes	ESPMCS
chr2_33551676_A_G_b38	RASGRP3	15.627	7.73e-44	0.22494	6	0.014395	yes	ESPMCS
chr2_33551697_A_T_b38	RASGRP3	15.627	7.73e-44	0.22494	6	0.014395	yes	ESPMCS
chr2_33550216_T_A_b38	RASGRP3	15.395	7.77e-43	0.219839	7	0.01428	yes	ESPMCS
chr2_33552022_CAAACA_C_b38	RASGRP3	15.254	3.15e-42	0.219438	7	0.014386	yes	ESPMCS
chr2_33548469_T_C_b38	RASGRP3	15.221	4.34e-42	0.218373	7	0.014347	yes	ESPMCS
chr2_33550484_C_G_b38	RASGRP3	15.221	4.34e-42	0.218373	7	0.014347	yes	ESPMCS
chr2_33554542_A_G_b38	RASGRP3	15.221	4.34e-42	0.218373	7	0.014347	yes	ESPMCS
chr2_33546942_C_G_b38	RASGRP3	15.016	3.31e-41	0.208833	10	0.013908	yes	ESPMCS
chr2_33553995_C_T_b38	RASGRP3	15.009	3.53e-41	0.215858	7	0.014382	yes	ESPMCS
chr2_33540561_TGTGTGTGTGTG_T_b38	RASGRP3	13.926	1.35e-36	0.194269	14	0.01395	yes	ESPMCS
chr2_33537192_G_GAT_b38	RASGRP3	13.584	3.57e-35	0.196979	7	0.014501	yes	ESPMCS
chr2_33565263_A_G_b38	RASGRP3	11.134	1.91e-25	0.131588	36	0.011819	yes	ESPMCS
chr2_33596963_A_T_b38	RASGRP3	10.801	3.36e-24	0.130574	30	0.012089	yes	ESPMCS
chr2_33547053_GAA_G_b38	RASGRP3	10.705	7.61e-24	0.216267	5	0.020202	yes	ESPMCS
chr2_33586869_A_T_b38	RASGRP3	10.689	8.72e-24	0.130717	28	0.012229	yes	ESPMCS
chr2_33594326_C_T_b38	RASGRP3	10.563	2.55e-23	0.128238	30	0.012141	yes	ESPMCS
chr2_33594385_G_A_b38	RASGRP3	10.563	2.55e-23	0.128238	30	0.012141	yes	ESPMCS
chr2_33581561_C_T_b38	RASGRP3	10.404	9.7e-23	0.12625	29	0.012135	yes	ESPMCS
chr2_33582025_C_T_b38	RASGRP3	10.336	1.71e-22	0.126123	28	0.012203	yes	ESPMCS
chr2_33536322_G_GA_b38	RASGRP3	9.902	6.07e-21	0.160833	13	0.016242	yes	ESPMCS
chr2_33589264_G_C_b38	RASGRP3	9.737	2.32e-20	0.111024	41	0.011403	yes	ESPMCS
chr2_33590881_T_C_b38	RASGRP3	9.724	2.58e-20	0.110702	40	0.011385	yes	ESPMCS
chr2_33529318_C_T_b38	RASGRP3	9.695	3.24e-20	0.133518	15	0.013772	yes	ESPMCS
chr2_33596450_T_G_b38	RASGRP3	9.686	3.49e-20	0.110493	41	0.011408	yes	ESPMCS
chr2_33521266_C_T_b38	RASGRP3	9.446	2.35e-19	0.116707	32	0.012355	yes	ESPMCS
chr2_33561445_C_A_b38	RASGRP3	9.429	2.7e-19	0.123387	21	0.013086	yes	ESPMCS
chr2_33556928_C_CACACACATACAT_b38	RASGRP3	9.262	9.98e-19	0.144628	6	0.015616	yes	ESPMCS
chr2_33640631_A_C_b38	RASGRP3	9.202	1.59e-18	0.116331	22	0.012642	yes	ESPMCS
chr2_33523649_G_A_b38	RASGRP3	9.133	2.71e-18	0.125465	20	0.013737	yes	ESPMCS
chr2_33641397_G_C_b38	RASGRP3	9.067	4.52e-18	0.114995	22	0.012683	yes	ESPMCS
chr2_33639021_G_A_b38	RASGRP3	9.052	5.05e-18	0.11501	22	0.012705	yes	ESPMCS
chr2_33555164_G_A_b38	RASGRP3	8.946	1.14e-17	0.120073	20	0.013422	yes	ESPMCS
chr2_33656248_TTC_T_b38	RASGRP3	8.785	3.85e-17	0.112426	22	0.012797	yes	ESPMCS
chr2_33650021_A_G_b38	RASGRP3	8.763	4.56e-17	0.112264	22	0.012811	yes	ESPMCS
chr2_33511010_G_A_b38	RASGRP3	8.73	5.83e-17	0.151318	9	0.017333	yes	ESPMCS
chr2_33652477_C_A_b38	RASGRP3	8.682	8.36e-17	0.111086	22	0.012795	yes	ESPMCS
chr2_33657078_T_C_b38	RASGRP3	8.661	9.8e-17	0.105247	39	0.012152	yes	ESPMCS
chr2_33663555_T_C_b38	RASGRP3	8.603	1.5e-16	0.110295	23	0.01282	yes	ESPMCS
chr2_33662459_C_T_b38	RASGRP3	8.566	1.98e-16	0.109749	23	0.012812	yes	ESPMCS
chr2_33656848_TA_T_b38	RASGRP3	8.095	6.06e-15	0.099474	36	0.012288	yes	ESPMCS
chr2_33564467_A_G_b38	RASGRP3	8.09	6.28e-15	0.089356	69	0.011045	yes	ESPMCS
chr2_33621819_C_A_b38	RASGRP3	8.023	1.01e-14	0.091421	51	0.011396	yes	ESPMCS
chr2_33623108_T_C_b38	RASGRP3	7.988	1.3e-14	0.09217	50	0.011539	yes	ESPMCS
chr2_33564001_C_G_b38	RASGRP3	7.884	2.68e-14	0.088016	65	0.011164	yes	ESPMCS
chr2_33622592_T_C_b38	RASGRP3	7.709	9.02e-14	0.091405	46	0.011857	yes	ESPMCS
chr2_33667549_A_G_b38	RASGRP3	7.546	2.74e-13	0.129096	8	0.017107	yes	ESPMCS
chr2_33667555_A_G_b38	RASGRP3	7.546	2.74e-13	0.129096	8	0.017107	yes	ESPMCS
chr2_33659035_G_A_b38	RASGRP3	7.449	5.27e-13	0.127264	8	0.017084	yes	ESPMCS
chr2_33640513_G_C_b38	RASGRP3	7.394	7.6e-13	0.125072	8	0.016914	yes	ESPMCS
chr2_33636858_C_G_b38	RASGRP3	7.351	1.01e-12	0.125268	8	0.01704	yes	ESPMCS
chr2_33637736_A_T_b38	RASGRP3	7.351	1.01e-12	0.125268	8	0.01704	yes	ESPMCS
chr2_33616325_C_T_b38	RASGRP3	7.33	1.17e-12	0.128079	7	0.017474	yes	ESPMCS
chr2_33508487_T_C_b38	RASGRP3	7.231	2.24e-12	0.130998	12	0.018116	yes	ESPMCS
chr2_33634524_A_G_b38	RASGRP3	7.205	2.65e-12	0.123421	8	0.01713	yes	ESPMCS
chr2_33624881_G_GT_b38	RASGRP3	7.151	3.77e-12	0.087319	37	0.01221	yes	ESPMCS
chr2_33605827_ATTTTTCT_A_b38	RASGRP3	7.128	4.4e-12	0.119054	8	0.016703	yes	ESPMCS
chr2_33672387_A_G_b38	RASGRP3	7.071	6.33e-12	0.102115	14	0.014441	yes	ESPMCS
chr2_33561192_A_G_b38	RASGRP3	7.052	7.18e-12	0.075838	109	0.010754	yes	ESPMCS
chr2_33661156_C_T_b38	RASGRP3	6.972	1.2e-11	0.086607	30	0.012422	yes	ESPMCS
chr2_33661310_C_T_b38	RASGRP3	6.972	1.2e-11	0.086607	30	0.012422	yes	ESPMCS
chr2_33656916_G_A_b38	RASGRP3	6.887	2.06e-11	0.082112	47	0.011923	yes	ESPMCS
chr2_33563965_A_G_b38	RASGRP3	6.884	2.09e-11	0.1113	11	0.016168	yes	ESPMCS
chr2_33631243_G_GT_b38	RASGRP3	6.86	2.43e-11	0.116735	8	0.017016	yes	ESPMCS
chr2_33626436_A_T_b38	RASGRP3	6.854	2.53e-11	0.082808	40	0.012082	yes	ESPMCS
chr2_33634816_G_T_b38	RASGRP3	6.714	6.08e-11	0.114367	8	0.017035	yes	ESPMCS
chr2_33627793_A_G_b38	RASGRP3	6.682	7.4e-11	0.112462	8	0.016831	yes	ESPMCS
chr2_33581900_A_T_b38	RASGRP3	6.617	1.1e-10	0.107888	11	0.016304	yes	ESPMCS
chr2_33532487_C_A_b38	RASGRP3	6.551	1.65e-10	0.069755	125	0.010647	yes	ESPMCS
chr2_33606703_C_T_b38	RASGRP3	6.549	1.67e-10	0.116658	7	0.017812	yes	ESPMCS
chr2_33572204_C_A_b38	RASGRP3	-6.492	2.37e-10	-0.071451	77	0.011007	yes	ESPMCS
chr2_33581338_T_A_b38	RASGRP3	6.448	3.08e-10	0.105446	11	0.016354	yes	ESPMCS
chr2_33571586_T_C_b38	RASGRP3	-6.428	3.46e-10	-0.067871	98	0.010558	yes	ESPMCS
chr2_33568339_TA_T_b38	RASGRP3	-6.418	3.68e-10	-0.070229	85	0.010942	yes	ESPMCS
chr2_33571267_T_A_b38	RASGRP3	-6.387	4.43e-10	-0.069898	78	0.010943	yes	ESPMCS
chr2_33577889_G_A_b38	RASGRP3	-6.37	4.91e-10	-0.070541	74	0.011074	yes	ESPMCS
chr2_33575950_G_A_b38	RASGRP3	-6.304	7.24e-10	-0.069682	74	0.011053	yes	ESPMCS
chr2_33567745_C_T_b38	RASGRP3	-6.301	7.39e-10	-0.069244	72	0.010989	yes	ESPMCS
chr2_33569371_A_G_b38	RASGRP3	-6.224	1.16e-09	-0.068628	80	0.011027	yes	ESPMCS
chr2_33571342_T_C_b38	RASGRP3	-6.166	1.63e-09	-0.067527	79	0.010951	yes	ESPMCS
chr2_33519891_C_T_b38	RASGRP3	-6.1	2.39e-09	-0.068055	73	0.011157	yes	ESPMCS
chr2_33518114_A_G_b38	RASGRP3	-5.792	1.36e-08	-0.067022	59	0.011572	yes	ESPMCS
chr2_33523461_TA_T_b38	RASGRP3	5.749	1.71e-08	0.084217	12	0.014649	yes	ESPMCS
chr2_33512820_T_A_b38	RASGRP3	-5.713	2.09e-08	-0.063984	68	0.0112	yes	ESPMCS
chr2_33508652_C_G_b38	RASGRP3	5.668	2.66e-08	0.065896	62	0.011625	yes	ESPMCS
chr2_33620497_T_C_b38	RASGRP3	5.461	8.06e-08	0.078081	18	0.014298	yes	ESPMCS
chr2_33593131_C_T_b38	RASGRP3	-5.439	9.05e-08	-0.057906	119	0.010646	yes	ESPMCS
chr2_33514489_T_C_b38	RASGRP3	-5.433	9.36e-08	-0.058751	79	0.010814	yes	ESPMCS
chr2_33586449_C_G_b38	RASGRP3	-5.429	9.56e-08	-0.058005	119	0.010685	yes	ESPMCS
chr2_33577835_T_C_b38	RASGRP3	-5.246	2.46e-07	-0.056562	117	0.010782	yes	ESPMCS
chr2_33597253_G_A_b38	RASGRP3	-5.231	2.65e-07	-0.057243	112	0.010943	yes	ESPMCS
chr2_33620575_G_A_b38	RASGRP3	5.226	2.72e-07	0.07486	18	0.014325	yes	ESPMCS
chr2_33575832_C_A_b38	RASGRP3	-5.224	2.75e-07	-0.056185	121	0.010755	yes	ESPMCS
chr2_33589523_A_G_b38	RASGRP3	-5.217	2.84e-07	-0.055548	123	0.010647	yes	ESPMCS
chr2_33604404_G_GTA_b38	RASGRP3	5.198	3.14e-07	0.089042	6	0.017131	yes	ESPMCS
chr2_33576389_C_T_b38	RASGRP3	-5.112	4.83e-07	-0.056347	112	0.011023	yes	ESPMCS
chr2_33592492_A_G_b38	RASGRP3	-5.093	5.31e-07	-0.054784	119	0.010758	yes	ESPMCS
chr2_33590404_A_G_b38	RASGRP3	-5.088	5.43e-07	-0.054594	120	0.01073	yes	ESPMCS
chr2_33536322_GA_G_b38	RASGRP3	-5.047	6.66e-07	-0.058515	99	0.011594	yes	ESPMCS
chr2_33622130_C_CA_b38	RASGRP3	5.025	7.42e-07	0.087496	14	0.017412	yes	ESPMCS
chr2_33520141_T_C_b38	RASGRP3	-5.018	7.69e-07	-0.057039	89	0.011367	yes	ESPMCS
chr2_33530852_CT_C_b38	RASGRP3	5.016	7.77e-07	0.055979	91	0.011161	yes	ESPMCS
chr2_33631252_G_T_b38	RASGRP3	4.966	9.89e-07	0.056512	126	0.011379	yes	ESPMCS
chr2_33512902_A_G_b38	RASGRP3	-4.905	1.33e-06	-0.055899	99	0.011397	yes	ESPMCS
chr2_33539996_AAAAAG_A_b38	RASGRP3	-4.854	1.7e-06	-0.054508	116	0.011229	yes	ESPMCS
chr2_33580247_A_G_b38	RASGRP3	-4.831	1.9e-06	-0.052902	115	0.01095	yes	ESPMCS
chr2_33637426_T_A_b38	RASGRP3	4.783	2.39e-06	0.068921	18	0.01441	yes	ESPMCS
chr2_33537323_G_C_b38	RASGRP3	-4.761	2.65e-06	-0.059192	49	0.012433	yes	ESPMCS
chr2_33677515_A_G_b38	RASGRP3	4.737	2.95e-06	0.078634	10	0.016599	yes	ESPMCS
chr2_33634843_C_CTT_b38	RASGRP3	4.728	3.09e-06	0.091038	7	0.019255	yes	ESPMCS
chr2_33532718_G_A_b38	RASGRP3	4.689	3.7e-06	0.053135	89	0.011332	yes	ESPMCS
chr2_33543901_C_G_b38	RASGRP3	-4.677	3.92e-06	-0.053992	67	0.011545	yes	ESPMCS
chr2_33625063_ATCT_A_b38	RASGRP3	-4.661	4.22e-06	-0.050926	89	0.010926	yes	ESPMCS
chr2_33605951_T_C_b38	RASGRP3	-4.634	4.77e-06	-0.050296	113	0.010853	yes	ESPMCS
chr2_33706678_T_C_b38	RASGRP3	4.63	4.86e-06	0.088876	3	0.019194	yes	ESPMCS
chr2_33611855_A_C_b38	RASGRP3	4.624	4.99e-06	0.074106	12	0.016025	yes	ESPMCS
chr2_33604404_GTA_G_b38	RASGRP3	-4.615	5.22e-06	-0.056199	43	0.012178	yes	ESPMCS
chr2_33617107_G_A_b38	RASGRP3	-4.601	5.55e-06	-0.049974	95	0.010861	yes	ESPMCS
chr2_33614957_G_A_b38	RASGRP3	-4.598	5.64e-06	-0.049862	94	0.010845	yes	ESPMCS
chr2_33547458_G_A_b38	RASGRP3	4.576	6.23e-06	0.051947	71	0.011353	yes	ESPMCS
chr2_33603907_A_C_b38	RASGRP3	4.556	6.83e-06	0.075081	11	0.016481	yes	ESPMCS
chr2_33630364_C_G_b38	RASGRP3	-4.552	6.94e-06	-0.04913	95	0.010793	yes	ESPMCS
chr2_33641120_T_C_b38	RASGRP3	-4.552	6.96e-06	-0.04885	110	0.010733	yes	ESPMCS
chr2_33535943_T_C_b38	RASGRP3	-4.509	8.42e-06	-0.069722	11	0.015462	yes	ESPMCS
chr2_33625433_A_C_b38	RASGRP3	-4.464	1.03e-05	-0.048748	91	0.01092	yes	ESPMCS
chr2_33647765_T_C_b38	RASGRP3	-4.461	1.05e-05	-0.047866	113	0.01073	yes	ESPMCS
chr2_33607748_A_G_b38	RASGRP3	-4.451	1.09e-05	-0.04755	98	0.010684	yes	ESPMCS
chr2_33591195_C_CT_b38	RASGRP3	-4.384	1.47e-05	-0.054268	59	0.012379	yes	ESPMCS
chr2_33632169_T_C_b38	RASGRP3	-4.379	1.5e-05	-0.047911	90	0.01094	yes	ESPMCS
chr2_33538430_G_C_b38	RASGRP3	-4.366	1.59e-05	-0.069483	10	0.015916	yes	ESPMCS
chr2_33658713_G_A_b38	RASGRP3	-4.361	1.63e-05	-0.047428	104	0.010875	yes	ESPMCS
chr2_33618669_C_CT_b38	RASGRP3	-4.359	1.64e-05	-0.047269	96	0.010843	yes	ESPMCS
chr2_33618734_A_G_b38	RASGRP3	-4.341	1.77e-05	-0.047205	95	0.010874	yes	ESPMCS
chr2_33663649_A_C_b38	RASGRP3	-4.338	1.79e-05	-0.046652	120	0.010753	yes	ESPMCS
chr2_33518880_G_GTCA_b38	RASGRP3	-4.279	2.32e-05	-0.049405	89	0.011545	yes	ESPMCS
chr2_33668515_A_G_b38	RASGRP3	-4.279	2.32e-05	-0.045804	111	0.010705	yes	ESPMCS
chr2_33670200_G_T_b38	RASGRP3	-4.273	2.38e-05	-0.046613	88	0.010908	yes	ESPMCS
chr2_33792413_CAGG_C_b38	RASGRP3	4.259	2.53e-05	0.082854	4	0.019454	yes	ESPMCS
chr2_33658170_A_G_b38	RASGRP3	-4.258	2.54e-05	-0.04614	106	0.010837	yes	ESPMCS
chr2_33669785_CA_C_b38	RASGRP3	-4.246	2.68e-05	-0.046995	80	0.011069	yes	ESPMCS
chr2_33631637_C_A_b38	RASGRP3	-4.226	2.91e-05	-0.045784	96	0.010834	yes	ESPMCS
chr2_33662442_T_C_b38	RASGRP3	-4.224	2.93e-05	-0.045492	109	0.010769	yes	ESPMCS
chr2_33669621_C_T_b38	RASGRP3	-4.208	3.14e-05	-0.046108	87	0.010957	yes	ESPMCS
chr2_33669751_C_T_b38	RASGRP3	-4.208	3.14e-05	-0.046108	87	0.010957	yes	ESPMCS
chr2_33666591_A_G_b38	RASGRP3	-4.205	3.18e-05	-0.044757	124	0.010643	yes	ESPMCS
chr2_33781569_AGTGTGT_A_b38	RASGRP3	4.205	3.19e-05	0.079639	6	0.018941	yes	ESPMCS
chr2_33664742_G_C_b38	RASGRP3	-4.191	3.38e-05	-0.044935	121	0.010723	yes	ESPMCS
chr2_33567211_TA_T_b38	RASGRP3	-4.188	3.42e-05	-0.052268	67	0.012479	yes	ESPMCS
chr2_33658757_C_A_b38	RASGRP3	-4.185	3.47e-05	-0.046031	96	0.011	yes	ESPMCS
chr2_33538452_G_A_b38	RASGRP3	-4.174	3.63e-05	-0.066853	10	0.016016	yes	ESPMCS
chr2_33664465_T_A_b38	RASGRP3	-4.174	3.63e-05	-0.045148	114	0.010817	yes	ESPMCS
chr2_33543280_C_G_b38	RASGRP3	-4.159	3.87e-05	-0.066478	10	0.015984	yes	ESPMCS
chr2_33554839_T_C_b38	RASGRP3	4.156	3.91e-05	0.047214	71	0.01136	yes	ESPMCS
chr2_33661731_A_G_b38	RASGRP3	-4.144	4.11e-05	-0.044398	119	0.010713	yes	ESPMCS
chr2_33515788_C_T_b38	RASGRP3	-4.139	4.2e-05	-0.066945	10	0.016174	yes	ESPMCS
chr2_33535555_G_GC_b38	RASGRP3	-4.134	4.29e-05	-0.065098	11	0.015746	yes	ESPMCS
chr2_33659127_A_G_b38	RASGRP3	-4.099	4.97e-05	-0.044039	119	0.010743	yes	ESPMCS
chr2_33661861_G_A_b38	RASGRP3	-4.096	5.04e-05	-0.044507	108	0.010867	yes	ESPMCS
chr2_33525341_AAT_A_b38	RASGRP3	-4.078	5.42e-05	-0.064456	10	0.015805	yes	ESPMCS
chr2_33664871_G_GT_b38	RASGRP3	-4.034	6.49e-05	-0.044703	111	0.011081	yes	ESPMCS
chr2_33660983_C_T_b38	RASGRP3	-4.017	6.97e-05	-0.043922	100	0.010934	yes	ESPMCS
chr2_33532968_G_A_b38	RASGRP3	-4	7.48e-05	-0.064631	10	0.016159	yes	ESPMCS
chr2_33523846_A_G_b38	RASGRP3	-3.975	8.28e-05	-0.052989	27	0.013331	yes	ESPMCS
chr2_33548381_A_AAAG_b38	RASGRP3	3.96	8.78e-05	0.06721	14	0.016972	yes	ESPMCS
chr2_33655774_A_G_b38	RASGRP3	-3.946	9.31e-05	-0.042449	112	0.010759	yes	ESPMCS
chr2_33509059_T_G_b38	RASGRP3	-3.942	9.43e-05	-0.052578	25	0.013337	yes	ESPMCS
chr2_33542583_A_T_b38	RASGRP3	-3.837	0.000144	-0.069176	15	0.01803	yes	ESPMCS
chr2_33527085_G_T_b38	RASGRP3	-3.804	0.000163	-0.053891	21	0.014167	yes	ESPMCS
chr2_33520269_T_C_b38	RASGRP3	3.786	0.000175	0.052966	21	0.013989	yes	ESPMCS
chr2_33731863_C_CCTTTCCTTAACTTCAGGACATACTGGGTTCCAGTATGTCCTTAA_b38	RASGRP3	3.779	0.00018	0.078171	4	0.020686	yes	ESPMCS
chr2_33534694_A_AT_b38	RASGRP3	3.767	0.000188	0.050403	30	0.013379	yes	ESPMCS
chr2_33629277_A_G_b38	RASGRP3	-3.751	2e-04	-0.040526	103	0.010803	yes	ESPMCS
chr2_33541741_G_T_b38	RASGRP3	-3.75	0.000201	-0.038667	133	0.01031	yes	ESPMCS
chr2_33563470_A_ATACT_b38	RASGRP3	-3.725	0.000222	-0.066106	8	0.017746	yes	ESPMCS
chr2_33547053_GAAAAAA_G_b38	RASGRP3	-3.715	0.00023	-0.055446	14	0.014926	yes	ESPMCS
chr2_33534694_ATT_A_b38	RASGRP3	-3.712	0.000233	-0.066038	5	0.017791	yes	ESPMCS
chr2_33528012_T_G_b38	RASGRP3	-3.659	0.000285	-0.050214	25	0.013723	yes	ESPMCS
chr2_33533388_C_T_b38	RASGRP3	-3.643	0.000302	-0.056481	12	0.015503	yes	ESPMCS
chr2_33655786_T_C_b38	RASGRP3	-3.636	0.000311	-0.039587	104	0.010887	yes	ESPMCS
chr2_33673146_T_C_b38	RASGRP3	-3.629	0.000319	-0.039539	113	0.010895	yes	ESPMCS
chr2_33533272_T_C_b38	RASGRP3	-3.62	0.00033	-0.056062	12	0.015486	yes	ESPMCS
chr2_33534496_G_A_b38	RASGRP3	-3.588	0.000372	-0.057256	10	0.015959	yes	ESPMCS
chr2_33403708_C_G_b38	RASGRP3	3.553	0.000423	0.08686	4	0.024447	yes	ESPMCS
chr2_33534062_A_C_b38	RASGRP3	-3.542	0.000441	-0.055964	10	0.015801	yes	ESPMCS
chr2_33534328_C_T_b38	RASGRP3	-3.53	0.000461	-0.0564	10	0.015977	yes	ESPMCS
chr2_33540861_T_TA_b38	RASGRP3	-3.508	5e-04	-0.069768	9	0.019891	yes	ESPMCS
chr2_33540561_TGTGTGTGTGTGTGTGTG_T_b38	RASGRP3	-3.505	0.000506	-0.039842	77	0.011369	yes	ESPMCS
chr2_33540888_T_C_b38	RASGRP3	-3.472	0.000569	-0.035852	133	0.010326	yes	ESPMCS
chr2_33655112_A_AT_b38	RASGRP3	-3.469	0.000575	-0.039183	97	0.011295	yes	ESPMCS
chr2_33539533_G_T_b38	RASGRP3	-3.437	0.000647	-0.035553	135	0.010346	yes	ESPMCS
chr2_33605933_G_A_b38	RASGRP3	-3.431	0.00066	-0.067439	5	0.019655	yes	ESPMCS
chr2_33622130_CA_C_b38	RASGRP3	-3.396	0.000749	-0.042534	42	0.012526	yes	ESPMCS
chr2_33792503_A_G_b38	RASGRP3	-3.385	0.000776	-0.042377	48	0.012517	yes	ESPMCS
chr2_33630302_AT_A_b38	RASGRP3	-3.375	0.000806	-0.040269	96	0.011932	yes	ESPMCS
chr2_33412992_C_G_b38	RASGRP3	3.372	0.000815	0.128782	3	0.038196	yes	ESPMCS
chr2_33545336_G_A_b38	RASGRP3	-3.371	0.000817	-0.051199	13	0.015188	yes	ESPMCS
chr2_33530497_CT_C_b38	RASGRP3	3.364	0.000838	0.048255	18	0.014345	yes	ESPMCS
chr2_33539650_C_T_b38	RASGRP3	3.345	0.000895	0.045698	23	0.01366	yes	ESPMCS
chr2_33539888_A_T_b38	RASGRP3	3.345	0.000895	0.045698	23	0.01366	yes	ESPMCS
chr2_33679576_G_T_b38	RASGRP3	3.34	0.000911	0.057966	4	0.017354	yes	ESPMCS
chr2_33540615_TTCTC_T_b38	RASGRP3	-3.327	0.000953	-0.03667	101	0.01102	yes	ESPMCS
chr2_33546347_C_G_b38	RASGRP3	-3.318	0.000985	-0.049053	16	0.014785	yes	ESPMCS
chr2_33561322_C_T_b38	RASGRP3	-3.305	0.00103	-0.050102	14	0.01516	yes	ESPMCS
chr2_33548698_A_AATTATT_b38	RASGRP3	-3.295	0.00107	-0.049394	15	0.014993	yes	ESPMCS
chr2_33178333_G_A_b38	RASGRP3	3.258	0.00121	0.089903	4	0.027591	yes	ESPMCS
chr2_33178488_T_G_b38	RASGRP3	3.258	0.00121	0.089903	4	0.027591	yes	ESPMCS
chr2_33178543_ATTG_A_b38	RASGRP3	3.258	0.00121	0.089903	4	0.027591	yes	ESPMCS
chr2_33179042_C_G_b38	RASGRP3	3.258	0.00121	0.089903	4	0.027591	yes	ESPMCS
chr2_33179173_T_G_b38	RASGRP3	3.258	0.00121	0.089903	4	0.027591	yes	ESPMCS
chr2_33179174_T_C_b38	RASGRP3	3.258	0.00121	0.089903	4	0.027591	yes	ESPMCS
chr2_33179198_A_AT_b38	RASGRP3	3.258	0.00121	0.089903	4	0.027591	yes	ESPMCS
chr2_33179348_G_A_b38	RASGRP3	3.258	0.00121	0.089903	4	0.027591	yes	ESPMCS
chr2_33546473_C_T_b38	RASGRP3	-3.256	0.00122	-0.048624	15	0.014935	yes	ESPMCS
chr2_33582793_C_G_b38	RASGRP3	3.25	0.00125	0.038873	50	0.011961	yes	ESPMCS
chr2_33179455_TA_T_b38	RASGRP3	3.242	0.00128	0.086233	4	0.026599	yes	ESPMCS
chr2_33539996_AAAAAGAAAAG_A_b38	RASGRP3	-3.219	0.00138	-0.06871	4	0.021345	yes	ESPMCS
chr2_33525699_C_CAA_b38	RASGRP3	3.206	0.00145	0.08072	10	0.025178	yes	ESPMCS
chr2_33577175_G_A_b38	RASGRP3	3.206	0.00145	0.048587	12	0.015155	yes	ESPMCS
chr2_33545200_T_C_b38	RASGRP3	-3.201	0.00147	-0.048206	15	0.015061	yes	ESPMCS
chr2_33591739_A_G_b38	RASGRP3	3.196	0.0015	0.041081	35	0.012853	yes	ESPMCS
chr2_33193067_A_G_b38	RASGRP3	3.192	0.00152	0.088256	4	0.027651	yes	ESPMCS
chr2_33194882_T_A_b38	RASGRP3	3.192	0.00152	0.088256	4	0.027651	yes	ESPMCS
chr2_33195059_T_G_b38	RASGRP3	3.192	0.00152	0.088256	4	0.027651	yes	ESPMCS
chr2_33196240_C_T_b38	RASGRP3	3.192	0.00152	0.088256	4	0.027651	yes	ESPMCS
chr2_33522958_T_C_b38	RASGRP3	-3.189	0.00153	-0.060395	6	0.018936	yes	ESPMCS
chr2_33414534_T_G_b38	RASGRP3	3.155	0.00172	0.116689	3	0.036982	yes	ESPMCS
chr2_33653281_C_CCTGT_b38	RASGRP3	3.149	0.00175	0.047969	14	0.015233	yes	ESPMCS
chr2_33184714_C_T_b38	RASGRP3	3.133	0.00185	0.086644	4	0.027654	yes	ESPMCS
chr2_33186498_AG_A_b38	RASGRP3	3.133	0.00185	0.086644	4	0.027654	yes	ESPMCS
chr2_33756137_T_C_b38	RASGRP3	3.119	0.00194	0.063602	3	0.020394	yes	ESPMCS
chr2_33176592_A_C_b38	RASGRP3	3.112	0.00198	0.085243	4	0.027387	yes	ESPMCS
chr2_33179798_G_C_b38	RASGRP3	3.106	0.00202	0.08575	4	0.027605	yes	ESPMCS
chr2_33179809_C_G_b38	RASGRP3	3.106	0.00202	0.08575	4	0.027605	yes	ESPMCS
chr2_33180574_C_G_b38	RASGRP3	3.106	0.00202	0.08575	4	0.027605	yes	ESPMCS
chr2_33678762_C_CACTT_b38	RASGRP3	-3.099	0.00207	-0.033722	112	0.010882	yes	ESPMCS
chr2_33550119_G_T_b38	RASGRP3	-3.088	0.00215	-0.046401	15	0.015028	yes	ESPMCS
chr2_33553788_G_A_b38	RASGRP3	-3.088	0.00215	-0.046401	15	0.015028	yes	ESPMCS
chr2_33556856_G_C_b38	RASGRP3	-3.088	0.00215	-0.046401	15	0.015028	yes	ESPMCS
chr2_33550598_T_G_b38	RASGRP3	-3.08	0.0022	-0.046292	15	0.01503	yes	ESPMCS
chr2_33545793_CTAT_C_b38	RASGRP3	3.06	0.00235	0.041261	25	0.013485	yes	ESPMCS
chr2_33202062_G_C_b38	RASGRP3	3.047	0.00246	0.08416	4	0.027625	yes	ESPMCS
chr2_33404586_G_GA_b38	RASGRP3	-3.044	0.00248	-0.037272	54	0.012243	yes	ESPMCS
chr2_33551040_C_T_b38	RASGRP3	-3.039	0.00252	-0.045377	15	0.01493	yes	ESPMCS
chr2_33592814_T_C_b38	RASGRP3	3.039	0.00252	0.039277	34	0.012923	yes	ESPMCS
chr2_33180746_G_A_b38	RASGRP3	3.039	0.00252	0.084046	4	0.027657	yes	ESPMCS
chr2_33180911_G_T_b38	RASGRP3	3.039	0.00252	0.084046	4	0.027657	yes	ESPMCS
chr2_33181116_C_T_b38	RASGRP3	3.039	0.00252	0.084046	4	0.027657	yes	ESPMCS
chr2_33181606_C_G_b38	RASGRP3	3.039	0.00252	0.084046	4	0.027657	yes	ESPMCS
chr2_33183247_T_A_b38	RASGRP3	3.039	0.00252	0.084046	4	0.027657	yes	ESPMCS
chr2_33184042_C_T_b38	RASGRP3	3.039	0.00252	0.084046	4	0.027657	yes	ESPMCS
chr2_33184621_G_A_b38	RASGRP3	3.039	0.00252	0.084046	4	0.027657	yes	ESPMCS
chr2_33185331_A_G_b38	RASGRP3	3.039	0.00252	0.084046	4	0.027657	yes	ESPMCS
chr2_33185336_G_A_b38	RASGRP3	3.039	0.00252	0.084046	4	0.027657	yes	ESPMCS
chr2_33185419_C_T_b38	RASGRP3	3.039	0.00252	0.084046	4	0.027657	yes	ESPMCS
chr2_33185914_C_G_b38	RASGRP3	3.039	0.00252	0.084046	4	0.027657	yes	ESPMCS
chr2_33186799_A_G_b38	RASGRP3	3.039	0.00252	0.084046	4	0.027657	yes	ESPMCS
chr2_33190077_G_A_b38	RASGRP3	3.039	0.00252	0.084046	4	0.027657	yes	ESPMCS
chr2_33176504_C_A_b38	RASGRP3	3.033	0.00257	0.084018	4	0.027699	yes	ESPMCS
chr2_33176525_GACA_G_b38	RASGRP3	3.033	0.00257	0.084018	4	0.027699	yes	ESPMCS
chr2_33176610_A_G_b38	RASGRP3	3.033	0.00257	0.084018	4	0.027699	yes	ESPMCS
chr2_33177259_T_C_b38	RASGRP3	3.033	0.00257	0.084018	4	0.027699	yes	ESPMCS
chr2_33177488_A_G_b38	RASGRP3	3.033	0.00257	0.084018	4	0.027699	yes	ESPMCS
chr2_33177590_C_T_b38	RASGRP3	3.033	0.00257	0.084018	4	0.027699	yes	ESPMCS
chr2_33177591_T_G_b38	RASGRP3	3.033	0.00257	0.084018	4	0.027699	yes	ESPMCS
chr2_33177613_A_T_b38	RASGRP3	3.033	0.00257	0.084018	4	0.027699	yes	ESPMCS
chr2_33177616_C_T_b38	RASGRP3	3.033	0.00257	0.084018	4	0.027699	yes	ESPMCS
chr2_33177880_A_C_b38	RASGRP3	3.033	0.00257	0.084018	4	0.027699	yes	ESPMCS
chr2_33556890_T_TACAC_b38	RASGRP3	-3.026	0.00263	-0.043589	16	0.014407	yes	ESPMCS
chr2_34081725_ATGTGTGTGTGTGTG_A_b38	RASGRP3	-3.025	0.00264	-0.056748	7	0.018761	yes	ESPMCS
chr2_33598472_A_C_b38	RASGRP3	3.023	0.00265	0.0389	35	0.012868	yes	ESPMCS
chr2_33792363_C_T_b38	RASGRP3	3.012	0.00275	0.064784	3	0.02151	yes	ESPMCS
chr2_33732506_C_T_b38	RASGRP3	3.006	0.0028	0.056512	4	0.018797	yes	ESPMCS
chr2_33734078_T_A_b38	RASGRP3	3.006	0.0028	0.056512	4	0.018797	yes	ESPMCS
chr2_33536339_G_A_b38	RASGRP3	-3.002	0.00284	-0.069117	4	0.023023	yes	ESPMCS
chr2_33611391_T_A_b38	RASGRP3	2.989	0.00296	0.039473	31	0.013205	yes	ESPMCS
chr2_33549383_C_T_b38	RASGRP3	-2.979	0.00306	-0.044937	15	0.015087	yes	ESPMCS
chr2_33151823_TTGTGTGTGTGTG_T_b38	RASGRP3	2.96	0.00324	0.060446	10	0.020418	yes	ESPMCS
chr2_33675020_C_G_b38	RASGRP3	-2.941	0.00345	-0.032853	89	0.011169	yes	ESPMCS
chr2_33731949_C_G_b38	RASGRP3	2.927	0.0036	0.055192	4	0.018855	yes	ESPMCS
chr2_33678193_G_A_b38	RASGRP3	-2.919	0.0037	-0.033675	76	0.011537	yes	ESPMCS
chr2_33519413_A_G_b38	RASGRP3	-2.909	0.00382	-0.03665	36	0.012599	yes	ESPMCS
chr2_33654678_C_T_b38	RASGRP3	2.908	0.00382	0.034833	68	0.011977	yes	ESPMCS
chr2_33563203_CTTGTT_C_b38	RASGRP3	2.907	0.00384	0.036157	42	0.012438	yes	ESPMCS
chr2_33584227_A_G_b38	RASGRP3	2.892	0.00403	0.039789	25	0.01376	yes	ESPMCS
chr2_33563038_A_G_b38	RASGRP3	-2.888	0.00408	-0.047848	11	0.016568	yes	ESPMCS
chr2_33334913_T_TA_b38	RASGRP3	2.862	0.00442	0.076406	4	0.026698	yes	ESPMCS
chr2_33591518_C_T_b38	RASGRP3	2.859	0.00445	0.036861	35	0.012891	yes	ESPMCS
chr2_33556890_T_TAC_b38	RASGRP3	-2.856	0.00449	-0.065996	4	0.023105	yes	ESPMCS
chr2_34197109_G_A_b38	RASGRP3	-2.855	0.00452	-0.06528	4	0.022867	yes	ESPMCS
chr2_33642142_G_T_b38	RASGRP3	2.848	0.00461	0.047879	7	0.016811	yes	ESPMCS
chr2_33563089_C_T_b38	RASGRP3	2.833	0.00483	0.034324	46	0.012117	yes	ESPMCS
chr2_33177942_A_G_b38	RASGRP3	2.831	0.00486	0.078278	4	0.027648	yes	ESPMCS
chr2_33177947_C_T_b38	RASGRP3	2.831	0.00486	0.078278	4	0.027648	yes	ESPMCS
chr2_33796780_C_CT_b38	RASGRP3	2.829	0.00489	0.035819	36	0.012662	yes	ESPMCS
chr2_33676624_C_T_b38	RASGRP3	-2.829	0.0049	-0.032445	78	0.01147	yes	ESPMCS
chr2_33568692_C_G_b38	RASGRP3	2.823	0.00498	0.040601	17	0.014382	yes	ESPMCS
chr2_33728254_C_T_b38	RASGRP3	2.822	0.005	0.052771	4	0.018702	yes	ESPMCS
chr2_34205463_A_G_b38	RASGRP3	-2.815	0.0051	-0.06169	7	0.021915	yes	ESPMCS
chr2_33566560_TA_T_b38	RASGRP3	2.793	0.00545	0.039663	18	0.014199	yes	ESPMCS
chr2_33725081_ATAT_A_b38	RASGRP3	2.791	0.00549	0.049298	3	0.017665	yes	ESPMCS
chr2_32473706_C_CGTGT_b38	RASGRP3	-2.777	0.00573	-0.053178	12	0.019149	yes	ESPMCS
chr2_33515921_T_A_b38	RASGRP3	2.766	0.00592	0.043883	12	0.015864	yes	ESPMCS
chr2_33727346_T_C_b38	RASGRP3	2.76	0.00604	0.035445	31	0.012844	yes	ESPMCS
chr2_34216850_C_G_b38	RASGRP3	-2.734	0.00652	-0.063435	5	0.023204	yes	ESPMCS
chr2_33664073_A_G_b38	RASGRP3	-2.729	0.00662	-0.046582	9	0.017071	yes	ESPMCS
chr2_34194597_C_T_b38	RASGRP3	-2.729	0.00662	-0.063872	4	0.023408	yes	ESPMCS
chr2_33963502_ATGT_A_b38	RASGRP3	2.719	0.00682	0.088121	3	0.032409	yes	ESPMCS
chr2_34205647_T_C_b38	RASGRP3	-2.711	0.00697	-0.060419	6	0.022284	yes	ESPMCS
chr2_34219887_A_G_b38	RASGRP3	-2.711	0.00697	-0.060419	6	0.022284	yes	ESPMCS
chr2_34194973_ATAAAT_A_b38	RASGRP3	-2.707	0.00707	-0.062421	4	0.023062	yes	ESPMCS
chr2_34195330_G_C_b38	RASGRP3	-2.707	0.00707	-0.062421	4	0.023062	yes	ESPMCS
chr2_34195843_ATC_A_b38	RASGRP3	-2.707	0.00707	-0.062421	4	0.023062	yes	ESPMCS
chr2_34196557_C_T_b38	RASGRP3	-2.707	0.00707	-0.062421	4	0.023062	yes	ESPMCS
chr2_34215948_C_T_b38	RASGRP3	-2.697	0.00728	-0.060414	6	0.022403	yes	ESPMCS
chr2_34216244_C_A_b38	RASGRP3	-2.697	0.00728	-0.060414	6	0.022403	yes	ESPMCS
chr2_34217201_G_C_b38	RASGRP3	-2.697	0.00728	-0.060414	6	0.022403	yes	ESPMCS
chr2_33204297_CTG_C_b38	RASGRP3	2.696	0.00729	0.099635	4	0.036952	yes	ESPMCS
chr2_33205043_C_A_b38	RASGRP3	2.696	0.00729	0.099635	4	0.036952	yes	ESPMCS
chr2_33209330_C_T_b38	RASGRP3	2.696	0.00729	0.099635	4	0.036952	yes	ESPMCS
chr2_33674183_T_C_b38	RASGRP3	-2.689	0.00745	-0.030001	92	0.011158	yes	ESPMCS
chr2_33741270_T_C_b38	RASGRP3	2.682	0.00761	0.04945	5	0.01844	yes	ESPMCS
chr2_33529859_CA_C_b38	RASGRP3	-2.675	0.00775	-0.039294	14	0.014688	yes	ESPMCS
chr2_33537417_G_A_b38	RASGRP3	-2.673	0.0078	-0.039072	15	0.014616	yes	ESPMCS
chr2_34186909_G_A_b38	RASGRP3	-2.636	0.00869	-0.064476	4	0.024457	yes	ESPMCS
chr2_34187310_C_T_b38	RASGRP3	-2.636	0.00869	-0.064476	4	0.024457	yes	ESPMCS
chr2_34191728_C_T_b38	RASGRP3	-2.636	0.00869	-0.064476	4	0.024457	yes	ESPMCS
chr2_34192259_G_A_b38	RASGRP3	-2.636	0.00869	-0.064476	4	0.024457	yes	ESPMCS
chr2_34192263_G_A_b38	RASGRP3	-2.636	0.00869	-0.064476	4	0.024457	yes	ESPMCS
chr2_34210543_G_A_b38	RASGRP3	-2.634	0.00873	-0.060563	5	0.022988	yes	ESPMCS
chr2_33642145_G_T_b38	RASGRP3	2.621	0.00908	0.053405	3	0.020376	yes	ESPMCS
chr2_32943954_TTTG_T_b38	RASGRP3	2.616	0.00921	0.087975	3	0.033629	yes	ESPMCS
chr2_34208798_G_C_b38	RASGRP3	-2.616	0.00922	-0.057966	6	0.022161	yes	ESPMCS
chr2_34210587_A_C_b38	RASGRP3	-2.616	0.00922	-0.057966	6	0.022161	yes	ESPMCS
chr2_34210588_C_A_b38	RASGRP3	-2.616	0.00922	-0.057966	6	0.022161	yes	ESPMCS
chr2_34184158_A_G_b38	RASGRP3	-2.615	0.00924	-0.062972	4	0.024081	yes	ESPMCS
chr2_33050850_C_G_b38	RASGRP3	2.612	0.00933	0.05092	3	0.019497	yes	ESPMCS
chr2_33749131_A_G_b38	RASGRP3	2.608	0.00942	0.048997	6	0.018786	yes	ESPMCS
chr2_33651073_T_C_b38	RASGRP3	2.608	0.00943	0.034198	31	0.013113	yes	ESPMCS
chr2_33679032_C_G_b38	RASGRP3	-2.603	0.00957	-0.029063	96	0.011166	yes	ESPMCS
chr2_34223423_C_T_b38	RASGRP3	-2.602	0.00959	-0.060628	5	0.0233	yes	ESPMCS
chr2_33605252_A_G_b38	RASGRP3	2.601	0.00961	0.033425	35	0.012849	yes	ESPMCS
chr2_34218261_C_A_b38	RASGRP3	-2.6	0.00964	-0.057918	6	0.022275	yes	ESPMCS
chr2_33944549_C_T_b38	RASGRP3	2.593	0.00985	0.085107	3	0.032827	yes	ESPMCS
chr2_33537896_A_G_b38	RASGRP3	17.139	1.85e-50	0.236966	6	0.013827	no	ESPMCS
chr2_33536526_G_A_b38	RASGRP3	16.986	8.77e-50	0.24708	4	0.014546	no	ESPMCS
chr2_33536528_G_A_b38	RASGRP3	16.986	8.77e-50	0.24708	4	0.014546	no	ESPMCS
chr2_33531453_C_T_b38	RASGRP3	16.238	1.69e-46	0.22456	8	0.013829	no	ESPMCS
chr2_33526597_C_T_b38	RASGRP3	16.115	5.83e-46	0.232245	7	0.014412	no	ESPMCS
chr2_33527062_GC_G_b38	RASGRP3	16.115	5.83e-46	0.232245	7	0.014412	no	ESPMCS
chr2_33559068_A_G_b38	RASGRP3	15.839	9.23e-45	0.223562	6	0.014114	no	ESPMCS
chr2_33529269_C_A_b38	RASGRP3	15.757	2.1e-44	0.220907	8	0.014019	no	ESPMCS
chr2_33557844_G_A_b38	RASGRP3	15.195	5.64e-42	0.206317	10	0.013578	no	ESPMCS
chr2_33548762_A_G_b38	RASGRP3	14.581	2.35e-39	0.217944	6	0.014947	no	ESPMCS
chr2_33537330_C_CCCAACACA_b38	RASGRP3	14.055	3.9e-37	0.177069	25	0.012598	no	ESPMCS
chr2_33512177_G_A_b38	RASGRP3	12.004	8.5e-29	0.161317	19	0.013439	no	ESPMCS
chr2_33596617_C_T_b38	RASGRP3	10.41	9.23e-23	0.127557	29	0.012254	no	ESPMCS
chr2_33525341_A_AAT_b38	RASGRP3	9.047	5.26e-18	0.116639	21	0.012892	no	ESPMCS
chr2_33622160_C_T_b38	RASGRP3	8.769	4.34e-17	0.105154	37	0.011991	no	ESPMCS
chr2_33670716_C_T_b38	RASGRP3	8.147	4.2e-15	0.100865	28	0.012381	no	ESPMCS
chr2_33625315_G_A_b38	RASGRP3	8.057	7.93e-15	0.101061	30	0.012543	no	ESPMCS
chr2_33592302_T_C_b38	RASGRP3	7.909	2.25e-14	0.16764	4	0.021195	no	ESPMCS
chr2_33579727_C_T_b38	RASGRP3	7.78	5.52e-14	0.162622	5	0.020902	no	ESPMCS
chr2_33573675_A_G_b38	RASGRP3	7.225	2.33e-12	0.160321	3	0.022189	no	ESPMCS
chr2_33537321_C_CA_b38	RASGRP3	6.795	3.67e-11	0.073188	80	0.010771	no	ESPMCS
chr2_33537323_G_A_b38	RASGRP3	6.772	4.23e-11	0.069629	123	0.010282	no	ESPMCS
chr2_33669427_A_C_b38	RASGRP3	6.566	1.5e-10	0.096261	14	0.01466	no	ESPMCS
chr2_33669574_A_G_b38	RASGRP3	6.45	3.04e-10	0.095011	14	0.01473	no	ESPMCS
chr2_33613720_G_A_b38	RASGRP3	6.29	7.89e-10	0.101055	11	0.016066	no	ESPMCS
chr2_33515662_T_C_b38	RASGRP3	5.413	1.04e-07	0.078173	18	0.014441	no	ESPMCS
chr2_33602942_T_C_b38	RASGRP3	5.242	2.51e-07	0.093414	5	0.017821	no	ESPMCS
chr2_33588900_A_AT_b38	RASGRP3	-5.082	5.6e-07	-0.059215	99	0.011652	no	ESPMCS
chr2_33607432_G_A_b38	RASGRP3	4.879	1.51e-06	0.085098	6	0.017442	no	ESPMCS
chr2_33633545_T_G_b38	RASGRP3	4.85	1.73e-06	0.085182	5	0.017562	no	ESPMCS
chr2_33577495_T_TA_b38	RASGRP3	4.808	2.11e-06	0.081901	5	0.017033	no	ESPMCS
chr2_33514230_T_G_b38	RASGRP3	4.799	2.21e-06	0.066295	21	0.013815	no	ESPMCS
chr2_33615793_A_T_b38	RASGRP3	4.681	3.84e-06	0.080795	6	0.017259	no	ESPMCS
chr2_33621944_G_A_b38	RASGRP3	4.681	3.84e-06	0.080795	6	0.017259	no	ESPMCS
chr2_33623483_C_T_b38	RASGRP3	4.681	3.84e-06	0.080795	6	0.017259	no	ESPMCS
chr2_33603617_TC_T_b38	RASGRP3	4.657	4.3e-06	0.076577	11	0.016444	no	ESPMCS
chr2_33615450_C_G_b38	RASGRP3	4.649	4.45e-06	0.080853	6	0.017391	no	ESPMCS
chr2_33631863_T_C_b38	RASGRP3	-4.54	7.33e-06	-0.048168	125	0.01061	no	ESPMCS
chr2_33631185_T_G_b38	RASGRP3	-4.531	7.64e-06	-0.047971	125	0.010588	no	ESPMCS
chr2_33615675_TA_T_b38	RASGRP3	-4.339	1.79e-05	-0.047573	95	0.010963	no	ESPMCS
chr2_33622456_T_TAAAC_b38	RASGRP3	-4.311	2.02e-05	-0.047001	96	0.010902	no	ESPMCS
chr2_33562267_C_CT_b38	RASGRP3	4.171	3.67e-05	0.045148	91	0.010823	no	ESPMCS
chr2_33613986_T_C_b38	RASGRP3	-4.15	4.02e-05	-0.045117	97	0.010872	no	ESPMCS
chr2_33624514_C_A_b38	RASGRP3	-3.933	9.78e-05	-0.0429	98	0.010907	no	ESPMCS
chr2_33625060_G_A_b38	RASGRP3	-3.908	0.000108	-0.042734	97	0.010934	no	ESPMCS
chr2_33573084_G_C_b38	RASGRP3	-3.874	0.000124	-0.073786	7	0.019048	no	ESPMCS
chr2_33552026_CA_C_b38	RASGRP3	-3.846	0.000138	-0.077912	4	0.020258	no	ESPMCS
chr2_33569651_CA_C_b38	RASGRP3	-3.788	0.000173	-0.052592	41	0.013883	no	ESPMCS
chr2_33518738_C_T_b38	RASGRP3	3.64	0.000306	0.050121	23	0.013768	no	ESPMCS
chr2_33525080_C_CA_b38	RASGRP3	-3.599	0.000357	-0.055218	16	0.015343	no	ESPMCS
chr2_33605847_C_CT_b38	RASGRP3	3.574	0.000392	0.063281	3	0.017708	no	ESPMCS
chr2_33620413_GA_G_b38	RASGRP3	3.557	0.000418	0.057752	6	0.016238	no	ESPMCS
chr2_33177707_A_G_b38	RASGRP3	3.546	0.000435	0.092704	7	0.026144	no	ESPMCS
chr2_33511214_C_T_b38	RASGRP3	3.537	0.000449	0.045741	32	0.012932	no	ESPMCS
chr2_33629533_C_G_b38	RASGRP3	3.529	0.000463	0.059212	8	0.016779	no	ESPMCS
chr2_33642136_G_T_b38	RASGRP3	3.528	0.000464	0.044581	41	0.012635	no	ESPMCS
chr2_33509815_G_A_b38	RASGRP3	3.494	0.000525	0.049161	20	0.01407	no	ESPMCS
chr2_33517217_G_A_b38	RASGRP3	3.467	0.000579	0.048557	21	0.014004	no	ESPMCS
chr2_33545661_T_C_b38	RASGRP3	3.456	0.000603	0.047879	22	0.013854	no	ESPMCS
chr2_33642139_G_T_b38	RASGRP3	3.446	0.000626	0.052583	14	0.015259	no	ESPMCS
chr2_33521739_T_A_b38	RASGRP3	3.418	0.000691	0.047589	21	0.013923	no	ESPMCS
chr2_33522218_G_A_b38	RASGRP3	3.412	0.000706	0.047667	20	0.01397	no	ESPMCS
chr2_33638203_CT_C_b38	RASGRP3	3.409	0.000714	0.069844	3	0.020487	no	ESPMCS
chr2_33529261_A_G_b38	RASGRP3	3.399	0.000741	0.049068	18	0.014437	no	ESPMCS
chr2_33547053_GAAAAAAAAA_G_b38	RASGRP3	-3.399	0.000741	-0.078114	3	0.022984	no	ESPMCS
chr2_33415038_T_C_b38	RASGRP3	3.385	0.000779	0.124722	3	0.03685	no	ESPMCS
chr2_33762803_A_G_b38	RASGRP3	3.333	0.000934	0.068374	3	0.020514	no	ESPMCS
chr2_33547574_G_A_b38	RASGRP3	-3.284	0.00111	-0.075012	3	0.022842	no	ESPMCS
chr2_33550141_G_A_b38	RASGRP3	-3.284	0.00111	-0.075012	3	0.022842	no	ESPMCS
chr2_33559629_G_A_b38	RASGRP3	-3.284	0.00111	-0.075012	3	0.022842	no	ESPMCS
chr2_33546340_A_G_b38	RASGRP3	3.254	0.00123	0.044564	23	0.013693	no	ESPMCS
chr2_33531997_C_CTTTA_b38	RASGRP3	-3.227	0.00135	-0.073388	3	0.022742	no	ESPMCS
chr2_33533281_C_T_b38	RASGRP3	-3.227	0.00135	-0.073388	3	0.022742	no	ESPMCS
chr2_33546422_CA_C_b38	RASGRP3	-3.223	0.00137	-0.059308	4	0.018404	no	ESPMCS
chr2_33522498_A_G_b38	RASGRP3	3.22	0.00138	0.045454	20	0.014118	no	ESPMCS
chr2_34268693_A_G_b38	RASGRP3	-3.199	0.00148	-0.04415	22	0.013801	no	ESPMCS
chr2_34268844_T_G_b38	RASGRP3	-3.199	0.00148	-0.04415	22	0.013801	no	ESPMCS
chr2_33551613_T_G_b38	RASGRP3	3.19	0.00153	0.044036	23	0.013803	no	ESPMCS
chr2_33647687_C_CA_b38	RASGRP3	3.187	0.00154	0.047145	27	0.014793	no	ESPMCS
chr2_33548381_A_AAAAAG_b38	RASGRP3	3.187	0.00154	0.059607	11	0.018704	no	ESPMCS
chr2_32532134_C_CGTGTGTGTGTGT_b38	RASGRP3	-3.177	0.0016	-0.038468	43	0.012107	no	ESPMCS
chr2_33671460_G_A_b38	RASGRP3	3.174	0.00161	0.052166	9	0.016435	no	ESPMCS
chr2_33668030_G_A_b38	RASGRP3	3.159	0.0017	0.055186	7	0.017469	no	ESPMCS
chr2_33538509_A_AATAAATAC_b38	RASGRP3	-3.112	0.00198	-0.069197	3	0.022237	no	ESPMCS
chr2_33642133_G_T_b38	RASGRP3	3.076	0.00223	0.035258	115	0.011462	no	ESPMCS
chr2_33726787_AAGAG_A_b38	RASGRP3	3.069	0.00229	0.037992	43	0.01238	no	ESPMCS
chr2_33535209_G_A_b38	RASGRP3	3.035	0.00255	0.040708	25	0.013413	no	ESPMCS
chr2_33196615_G_C_b38	RASGRP3	2.99	0.00295	0.080815	5	0.027025	no	ESPMCS
chr2_33196832_C_A_b38	RASGRP3	2.99	0.00295	0.080815	5	0.027025	no	ESPMCS
chr2_33200788_C_T_b38	RASGRP3	2.99	0.00295	0.080815	5	0.027025	no	ESPMCS
chr2_33201195_G_C_b38	RASGRP3	2.99	0.00295	0.080815	5	0.027025	no	ESPMCS
chr2_33201641_A_AAAG_b38	RASGRP3	2.99	0.00295	0.080815	5	0.027025	no	ESPMCS
chr2_33201902_G_C_b38	RASGRP3	2.99	0.00295	0.080815	5	0.027025	no	ESPMCS
chr2_33201953_C_T_b38	RASGRP3	2.99	0.00295	0.080815	5	0.027025	no	ESPMCS
chr2_33206601_G_A_b38	RASGRP3	2.99	0.00295	0.080815	5	0.027025	no	ESPMCS
chr2_33207373_TA_T_b38	RASGRP3	2.99	0.00295	0.080815	5	0.027025	no	ESPMCS
chr2_33208098_A_G_b38	RASGRP3	2.99	0.00295	0.080815	5	0.027025	no	ESPMCS
chr2_33210000_A_T_b38	RASGRP3	2.99	0.00295	0.080815	5	0.027025	no	ESPMCS
chr2_33772378_C_T_b38	RASGRP3	2.989	0.00296	0.055804	4	0.018667	no	ESPMCS
chr2_33771977_TC_T_b38	RASGRP3	2.987	0.00298	0.051744	13	0.017326	no	ESPMCS
chr2_33530214_T_A_b38	RASGRP3	-2.986	0.00299	-0.068406	3	0.022907	no	ESPMCS
chr2_33531683_T_C_b38	RASGRP3	-2.986	0.00299	-0.068406	3	0.022907	no	ESPMCS
chr2_33530930_T_C_b38	RASGRP3	2.976	0.00309	0.041339	22	0.013891	no	ESPMCS
chr2_33532401_C_A_b38	RASGRP3	-2.974	0.00311	-0.068166	3	0.022924	no	ESPMCS
chr2_33764518_G_GTT_b38	RASGRP3	2.968	0.00317	0.063127	3	0.021269	no	ESPMCS
chr2_33945769_TA_T_b38	RASGRP3	2.966	0.00319	0.079912	5	0.026947	no	ESPMCS
chr2_33596331_G_C_b38	RASGRP3	2.957	0.00328	0.043406	16	0.014679	no	ESPMCS
chr2_33771916_C_T_b38	RASGRP3	2.953	0.00332	0.050196	17	0.016997	no	ESPMCS
chr2_33771954_G_T_b38	RASGRP3	2.953	0.00332	0.050196	17	0.016997	no	ESPMCS
chr2_33551248_G_C_b38	RASGRP3	-2.899	0.00394	-0.058968	4	0.020342	no	ESPMCS
chr2_33225551_T_C_b38	RASGRP3	2.871	0.0043	0.080958	5	0.028203	no	ESPMCS
chr2_33225956_C_T_b38	RASGRP3	2.871	0.0043	0.080958	5	0.028203	no	ESPMCS
chr2_33226389_G_C_b38	RASGRP3	2.871	0.0043	0.080958	5	0.028203	no	ESPMCS
chr2_33226509_G_C_b38	RASGRP3	2.871	0.0043	0.080958	5	0.028203	no	ESPMCS
chr2_33614844_A_G_b38	RASGRP3	2.855	0.00452	0.035483	40	0.012429	no	ESPMCS
chr2_33135781_G_C_b38	RASGRP3	2.809	0.00519	0.036621	37	0.013035	no	ESPMCS
chr2_33629657_C_CT_b38	RASGRP3	2.802	0.00531	0.041867	18	0.014941	no	ESPMCS
chr2_33601894_C_G_b38	RASGRP3	2.8	0.00534	0.033275	53	0.011883	no	ESPMCS
chr2_33710593_G_A_b38	RASGRP3	-2.795	0.00543	-0.058803	3	0.021042	no	ESPMCS
chr2_34255491_A_G_b38	RASGRP3	2.792	0.00547	0.048021	6	0.0172	no	ESPMCS
chr2_33135271_A_G_b38	RASGRP3	2.78	0.00568	0.036165	37	0.01301	no	ESPMCS
chr2_33695122_C_G_b38	RASGRP3	-2.767	0.0059	-0.037996	33	0.013732	no	ESPMCS
chr2_33531341_C_A_b38	RASGRP3	2.764	0.00595	0.037759	23	0.01366	no	ESPMCS
chr2_33212399_C_T_b38	RASGRP3	2.763	0.00598	0.082251	3	0.029772	no	ESPMCS
chr2_33218858_G_T_b38	RASGRP3	2.763	0.00598	0.082251	3	0.029772	no	ESPMCS
chr2_33716069_GTGCAACCTCGGCTCAC_G_b38	RASGRP3	2.753	0.00615	0.04446	10	0.016148	no	ESPMCS
chr2_33725369_A_C_b38	RASGRP3	2.75	0.00621	0.040021	20	0.014553	no	ESPMCS
chr2_33794085_G_T_b38	RASGRP3	2.75	0.00622	0.034259	36	0.012459	no	ESPMCS
chr2_33605964_T_C_b38	RASGRP3	2.74	0.0064	0.040352	16	0.014727	no	ESPMCS
chr2_33605562_C_G_b38	RASGRP3	2.736	0.00648	0.034336	39	0.012551	no	ESPMCS
chr2_33587735_T_A_b38	RASGRP3	2.735	0.0065	0.032802	51	0.011995	no	ESPMCS
chr2_33699999_T_C_b38	RASGRP3	-2.724	0.00672	-0.037425	34	0.013741	no	ESPMCS
chr2_33796538_A_G_b38	RASGRP3	2.724	0.00672	0.032389	65	0.011892	no	ESPMCS
chr2_33623242_A_ATT_b38	RASGRP3	-2.712	0.00695	-0.076799	6	0.028315	no	ESPMCS
chr2_33796806_G_A_b38	RASGRP3	2.712	0.00696	0.031929	65	0.011773	no	ESPMCS
chr2_33216497_G_C_b38	RASGRP3	2.712	0.00697	0.080628	3	0.029735	no	ESPMCS
chr2_33704218_C_T_b38	RASGRP3	-2.711	0.00698	-0.051008	6	0.018814	no	ESPMCS
chr2_33136358_A_G_b38	RASGRP3	2.678	0.00769	0.035052	36	0.013089	no	ESPMCS
chr2_33226611_CTTAATAATATGCTAA_C_b38	RASGRP3	2.667	0.00795	0.079533	3	0.029822	no	ESPMCS
chr2_33545133_A_T_b38	RASGRP3	-2.659	0.00814	-0.057158	4	0.0215	no	ESPMCS
chr2_34216158_A_G_b38	RASGRP3	-2.65	0.00836	-0.055843	7	0.021077	no	ESPMCS
chr2_33933541_CTCCTTCCTTCCT_C_b38	RASGRP3	2.634	0.00875	0.062354	7	0.023674	no	ESPMCS
chr2_33623242_AT_A_b38	RASGRP3	2.62	0.00909	0.055118	4	0.021033	no	ESPMCS
chr2_33060651_CTG_C_b38	RASGRP3	2.612	0.00933	0.046179	7	0.017681	no	ESPMCS
chr2_33796781_A_T_b38	RASGRP3	2.61	0.00938	0.030705	61	0.011765	no	ESPMCS
chr2_33227046_C_CT_b38	RASGRP3	2.606	0.00947	0.078841	3	0.03025	no	ESPMCS
chr2_32616560_CAAAAAAA_C_b38	RASGRP3	-2.596	0.00977	-0.039471	12	0.015206	no	ESPMCS
chr2_33424687_C_CT_b38	RASGRP3	-2.595	0.00978	-0.091591	4	0.035295	no	ESPMCS
chr2_33531421_G_A_b38	RASGRP3	-2.594	0.00982	-0.058252	3	0.022457	no	ESPMCS
chr2_33212016_T_A_b38	RASGRP3	2.591	0.00989	0.074794	4	0.028865	no	ESPMCS
chr2_33529269_C_A_b38	RASGRP3	10.333	2.63e-22	0.197834	7	0.019146	yes	ESPMSL
chr2_33548469_T_C_b38	RASGRP3	9.967	5.13e-21	0.201079	5	0.020174	yes	ESPMSL
chr2_33557635_G_A_b38	RASGRP3	9.92	7.49e-21	0.198724	5	0.020033	yes	ESPMSL
chr2_33559734_G_A_b38	RASGRP3	9.829	1.56e-20	0.196736	5	0.020017	yes	ESPMSL
chr2_33550484_C_G_b38	RASGRP3	9.775	2.38e-20	0.198809	5	0.020338	yes	ESPMSL
chr2_33559304_G_A_b38	RASGRP3	9.739	3.18e-20	0.196545	5	0.020182	yes	ESPMSL
chr2_33546942_C_G_b38	RASGRP3	9.521	1.77e-19	0.186145	8	0.019552	yes	ESPMSL
chr2_33551676_A_G_b38	RASGRP3	9.506	1.99e-19	0.198927	4	0.020927	yes	ESPMSL
chr2_33551697_A_T_b38	RASGRP3	9.506	1.99e-19	0.198927	4	0.020927	yes	ESPMSL
chr2_33554542_A_G_b38	RASGRP3	9.498	2.12e-19	0.195514	5	0.020585	yes	ESPMSL
chr2_33550216_T_A_b38	RASGRP3	9.459	2.86e-19	0.193121	5	0.020417	yes	ESPMSL
chr2_33553995_C_T_b38	RASGRP3	9.399	4.56e-19	0.193195	5	0.020554	yes	ESPMSL
chr2_33552022_CAAACA_C_b38	RASGRP3	9.308	9.22e-19	0.192789	5	0.020712	yes	ESPMSL
chr2_33537192_G_GAT_b38	RASGRP3	8.617	1.69e-16	0.169157	5	0.019631	yes	ESPMSL
chr2_33540561_TGTGTGTGTGTG_T_b38	RASGRP3	8.195	3.54e-15	0.158809	12	0.019378	yes	ESPMSL
chr2_33529318_C_T_b38	RASGRP3	7.98	1.61e-14	0.130918	16	0.016405	yes	ESPMSL
chr2_33561445_C_A_b38	RASGRP3	7.823	4.77e-14	0.127593	21	0.016309	yes	ESPMSL
chr2_33512177_G_A_b38	RASGRP3	7.808	5.32e-14	0.136326	19	0.017461	yes	ESPMSL
chr2_33523649_G_A_b38	RASGRP3	7.623	1.88e-13	0.126716	21	0.016624	yes	ESPMSL
chr2_33525341_A_AAT_b38	RASGRP3	7.596	2.25e-13	0.125158	20	0.016477	yes	ESPMSL
chr2_33521266_C_T_b38	RASGRP3	7.536	3.35e-13	0.114075	33	0.015136	yes	ESPMSL
chr2_33555164_G_A_b38	RASGRP3	7.508	4.05e-13	0.124511	20	0.016584	yes	ESPMSL
chr2_33536322_G_GA_b38	RASGRP3	7.429	6.84e-13	0.148411	12	0.019977	yes	ESPMSL
chr2_33565263_A_G_b38	RASGRP3	6.889	2.23e-11	0.107104	36	0.015547	yes	ESPMSL
chr2_33581561_C_T_b38	RASGRP3	6.703	7.1e-11	0.105485	28	0.015738	yes	ESPMSL
chr2_33596963_A_T_b38	RASGRP3	6.527	2.07e-10	0.102763	30	0.015745	yes	ESPMSL
chr2_33582025_C_T_b38	RASGRP3	6.472	2.88e-10	0.102465	27	0.015832	yes	ESPMSL
chr2_33523461_TA_T_b38	RASGRP3	6.361	5.58e-10	0.113508	10	0.017846	yes	ESPMSL
chr2_33596617_C_T_b38	RASGRP3	6.296	8.17e-10	0.100152	29	0.015908	yes	ESPMSL
chr2_33586869_A_T_b38	RASGRP3	6.218	1.29e-09	0.100171	27	0.016111	yes	ESPMSL
chr2_33556928_C_CACACACATACAT_b38	RASGRP3	6.211	1.34e-09	0.128234	4	0.020647	yes	ESPMSL
chr2_33594326_C_T_b38	RASGRP3	6.202	1.41e-09	0.098251	30	0.015843	yes	ESPMSL
chr2_33594385_G_A_b38	RASGRP3	6.202	1.41e-09	0.098251	30	0.015843	yes	ESPMSL
chr2_33511010_G_A_b38	RASGRP3	5.952	5.84e-09	0.133948	8	0.022503	yes	ESPMSL
chr2_33518114_A_G_b38	RASGRP3	-5.706	2.27e-08	-0.078917	62	0.01383	yes	ESPMSL
chr2_33519891_C_T_b38	RASGRP3	-5.433	9.73e-08	-0.074033	72	0.013627	yes	ESPMSL
chr2_33540615_TTCTC_T_b38	RASGRP3	-5.408	1.11e-07	-0.071295	98	0.013183	yes	ESPMSL
chr2_33520141_T_C_b38	RASGRP3	-5.39	1.22e-07	-0.072682	90	0.013485	yes	ESPMSL
chr2_33512902_A_G_b38	RASGRP3	-5.381	1.28e-07	-0.073379	96	0.013638	yes	ESPMSL
chr2_33590881_T_C_b38	RASGRP3	5.377	1.3e-07	0.079783	41	0.014838	yes	ESPMSL
chr2_33571267_T_A_b38	RASGRP3	-5.344	1.54e-07	-0.072019	80	0.013477	yes	ESPMSL
chr2_33596450_T_G_b38	RASGRP3	5.329	1.66e-07	0.079185	42	0.014858	yes	ESPMSL
chr2_33512820_T_A_b38	RASGRP3	-5.278	2.16e-07	-0.072675	65	0.01377	yes	ESPMSL
chr2_33575950_G_A_b38	RASGRP3	-5.244	2.57e-07	-0.071769	76	0.013686	yes	ESPMSL
chr2_33569371_A_G_b38	RASGRP3	-5.234	2.7e-07	-0.070879	84	0.013542	yes	ESPMSL
chr2_33577889_G_A_b38	RASGRP3	-5.202	3.18e-07	-0.071354	76	0.013717	yes	ESPMSL
chr2_33571342_T_C_b38	RASGRP3	-5.174	3.66e-07	-0.069795	82	0.01349	yes	ESPMSL
chr2_33589264_G_C_b38	RASGRP3	5.147	4.18e-07	0.076482	42	0.014859	yes	ESPMSL
chr2_33622160_C_T_b38	RASGRP3	5.14	4.34e-07	0.07726	39	0.015032	yes	ESPMSL
chr2_33518880_G_GTCA_b38	RASGRP3	-5.103	5.21e-07	-0.06963	90	0.013645	yes	ESPMSL
chr2_33572204_C_A_b38	RASGRP3	-5.059	6.48e-07	-0.068864	80	0.013613	yes	ESPMSL
chr2_33568339_TA_T_b38	RASGRP3	-5.005	8.43e-07	-0.067919	87	0.013569	yes	ESPMSL
chr2_33514489_T_C_b38	RASGRP3	-4.729	3.15e-06	-0.063654	74	0.01346	yes	ESPMSL
chr2_33543901_C_G_b38	RASGRP3	-4.719	3.29e-06	-0.067705	63	0.014346	yes	ESPMSL
chr2_33514230_T_G_b38	RASGRP3	4.662	4.29e-06	0.083901	17	0.017995	yes	ESPMSL
chr2_33541741_G_T_b38	RASGRP3	-4.648	4.58e-06	-0.057444	129	0.012359	yes	ESPMSL
chr2_33540888_T_C_b38	RASGRP3	-4.643	4.69e-06	-0.057399	129	0.012363	yes	ESPMSL
chr2_33579727_C_T_b38	RASGRP3	4.559	6.87e-06	0.125863	5	0.027608	yes	ESPMSL
chr2_33515662_T_C_b38	RASGRP3	4.436	1.19e-05	0.082431	15	0.018583	yes	ESPMSL
chr2_33477419_C_G_b38	RASGRP3	-4.431	1.22e-05	-0.076386	18	0.017241	yes	ESPMSL
chr2_33539996_AAAAAG_A_b38	RASGRP3	-4.408	1.35e-05	-0.061563	106	0.013966	yes	ESPMSL
chr2_33567745_C_T_b38	RASGRP3	-4.405	1.36e-05	-0.060677	74	0.013774	yes	ESPMSL
chr2_33592302_T_C_b38	RASGRP3	4.39	1.46e-05	0.121866	5	0.027762	yes	ESPMSL
chr2_33621819_C_A_b38	RASGRP3	4.389	1.46e-05	0.063276	52	0.014417	yes	ESPMSL
chr2_33539533_G_T_b38	RASGRP3	-4.341	1.81e-05	-0.053795	130	0.012393	yes	ESPMSL
chr2_33672387_A_G_b38	RASGRP3	4.318	2e-05	0.076554	19	0.017731	yes	ESPMSL
chr2_33564001_C_G_b38	RASGRP3	4.26	2.56e-05	0.061266	64	0.01438	yes	ESPMSL
chr2_33478490_C_T_b38	RASGRP3	4.22	3.04e-05	0.060096	72	0.014242	yes	ESPMSL
chr2_33623108_T_C_b38	RASGRP3	4.188	3.47e-05	0.061195	51	0.014611	yes	ESPMSL
chr2_33476565_C_T_b38	RASGRP3	-4.169	3.76e-05	-0.091341	5	0.021909	yes	ESPMSL
chr2_33564467_A_G_b38	RASGRP3	4.131	4.42e-05	0.059286	68	0.014352	yes	ESPMSL
chr2_33464237_G_A_b38	RASGRP3	-4.06	5.91e-05	-0.071886	16	0.017704	yes	ESPMSL
chr2_33509059_T_G_b38	RASGRP3	-4.006	7.39e-05	-0.069981	17	0.01747	yes	ESPMSL
chr2_33508487_T_C_b38	RASGRP3	3.991	7.84e-05	0.093801	10	0.023502	yes	ESPMSL
chr2_33478150_C_G_b38	RASGRP3	-3.977	8.29e-05	-0.087413	5	0.021977	yes	ESPMSL
chr2_33605827_ATTTTTCT_A_b38	RASGRP3	3.972	8.49e-05	0.083365	7	0.02099	yes	ESPMSL
chr2_33573675_A_G_b38	RASGRP3	3.927	0.000102	0.115637	3	0.029449	yes	ESPMSL
chr2_33463583_T_C_b38	RASGRP3	-3.926	0.000102	-0.069039	16	0.017586	yes	ESPMSL
chr2_33445660_T_C_b38	RASGRP3	-3.892	0.000117	-0.079468	6	0.020417	yes	ESPMSL
chr2_33669785_CA_C_b38	RASGRP3	-3.885	0.00012	-0.052602	72	0.013538	yes	ESPMSL
chr2_33613720_G_A_b38	RASGRP3	3.846	0.00014	0.076242	10	0.019823	yes	ESPMSL
chr2_33605951_T_C_b38	RASGRP3	-3.842	0.000142	-0.051129	103	0.013308	yes	ESPMSL
chr2_33571586_T_C_b38	RASGRP3	-3.829	0.00015	-0.050801	101	0.013269	yes	ESPMSL
chr2_33537321_C_CA_b38	RASGRP3	3.807	0.000163	0.052954	72	0.013909	yes	ESPMSL
chr2_33616325_C_T_b38	RASGRP3	3.78	0.000181	0.080664	7	0.021342	yes	ESPMSL
chr2_33588900_A_AT_b38	RASGRP3	-3.762	0.000194	-0.054347	87	0.014445	yes	ESPMSL
chr2_33592492_A_G_b38	RASGRP3	-3.707	0.00024	-0.049609	102	0.013382	yes	ESPMSL
chr2_33634524_A_G_b38	RASGRP3	3.684	0.000262	0.077083	8	0.020926	yes	ESPMSL
chr2_33667549_A_G_b38	RASGRP3	3.673	0.000272	0.077253	8	0.02103	yes	ESPMSL
chr2_33667555_A_G_b38	RASGRP3	3.673	0.000272	0.077253	8	0.02103	yes	ESPMSL
chr2_33590404_A_G_b38	RASGRP3	-3.668	0.000278	-0.048877	103	0.013325	yes	ESPMSL
chr2_33593131_C_T_b38	RASGRP3	-3.649	0.000299	-0.048735	103	0.013357	yes	ESPMSL
chr2_33634816_G_T_b38	RASGRP3	3.63	0.000321	0.075605	8	0.020829	yes	ESPMSL
chr2_33636858_C_G_b38	RASGRP3	3.623	0.000329	0.075588	8	0.020864	yes	ESPMSL
chr2_33637736_A_T_b38	RASGRP3	3.623	0.000329	0.075588	8	0.020864	yes	ESPMSL
chr2_33611855_A_C_b38	RASGRP3	3.601	0.000357	0.0724	11	0.020104	yes	ESPMSL
chr2_33606703_C_T_b38	RASGRP3	3.596	0.000364	0.077899	7	0.02166	yes	ESPMSL
chr2_33589523_A_G_b38	RASGRP3	-3.596	0.000364	-0.047757	106	0.013279	yes	ESPMSL
chr2_33711450_C_CA_b38	RASGRP3	3.566	0.000407	0.126912	3	0.035586	yes	ESPMSL
chr2_33597253_G_A_b38	RASGRP3	-3.561	0.000414	-0.048482	97	0.013614	yes	ESPMSL
chr2_33627793_A_G_b38	RASGRP3	3.545	0.00044	0.072761	8	0.020526	yes	ESPMSL
chr2_34086021_CTT_C_b38	RASGRP3	-3.515	0.00049	-0.084525	5	0.024045	yes	ESPMSL
chr2_33577835_T_C_b38	RASGRP3	-3.509	0.000501	-0.047052	103	0.013407	yes	ESPMSL
chr2_33586449_C_G_b38	RASGRP3	-3.507	0.000506	-0.046929	103	0.013383	yes	ESPMSL
chr2_33536322_GA_G_b38	RASGRP3	-3.494	0.000529	-0.051405	89	0.014711	yes	ESPMSL
chr2_33591195_C_CT_b38	RASGRP3	-3.473	0.000573	-0.05485	50	0.015795	yes	ESPMSL
chr2_33669621_C_T_b38	RASGRP3	-3.472	0.000574	-0.046879	79	0.013502	yes	ESPMSL
chr2_33669751_C_T_b38	RASGRP3	-3.472	0.000574	-0.046879	79	0.013502	yes	ESPMSL
chr2_33660983_C_T_b38	RASGRP3	-3.463	0.000593	-0.046158	92	0.013329	yes	ESPMSL
chr2_33565010_T_TACACACAC_b38	RASGRP3	3.439	0.000645	0.094701	3	0.027534	yes	ESPMSL
chr2_33463642_G_A_b38	RASGRP3	-3.439	0.000647	-0.067614	10	0.019662	yes	ESPMSL
chr2_33625063_ATCT_A_b38	RASGRP3	-3.427	0.000674	-0.046613	79	0.013602	yes	ESPMSL
chr2_33670200_G_T_b38	RASGRP3	-3.407	0.000724	-0.046	80	0.013501	yes	ESPMSL
chr2_33658757_C_A_b38	RASGRP3	-3.396	0.000754	-0.045696	89	0.013458	yes	ESPMSL
chr2_33630364_C_G_b38	RASGRP3	-3.383	0.00079	-0.045654	82	0.013497	yes	ESPMSL
chr2_33528012_T_G_b38	RASGRP3	-3.352	0.000878	-0.05973	18	0.017817	yes	ESPMSL
chr2_33617107_G_A_b38	RASGRP3	-3.346	0.000899	-0.044801	85	0.01339	yes	ESPMSL
chr2_32678253_CA_C_b38	RASGRP3	3.344	0.000903	0.05322	60	0.015913	yes	ESPMSL
chr2_33614957_G_A_b38	RASGRP3	-3.34	0.000917	-0.044469	85	0.013313	yes	ESPMSL
chr2_33618669_C_CT_b38	RASGRP3	-3.339	0.000919	-0.044599	86	0.013355	yes	ESPMSL
chr2_33618734_A_G_b38	RASGRP3	-3.339	0.000919	-0.044599	86	0.013355	yes	ESPMSL
chr2_33604404_GTA_G_b38	RASGRP3	-3.339	0.000922	-0.050062	46	0.014994	yes	ESPMSL
chr2_33478721_C_T_b38	RASGRP3	-3.334	0.000938	-0.062311	11	0.018691	yes	ESPMSL
chr2_33580247_A_G_b38	RASGRP3	-3.33	0.000949	-0.045176	101	0.013565	yes	ESPMSL
chr2_33607748_A_G_b38	RASGRP3	-3.324	0.000971	-0.044116	87	0.013272	yes	ESPMSL
chr2_33527085_G_T_b38	RASGRP3	-3.32	0.000985	-0.060658	15	0.018272	yes	ESPMSL
chr2_33800448_AT_A_b38	RASGRP3	3.313	0.00101	0.060216	14	0.018174	yes	ESPMSL
chr2_33576389_C_T_b38	RASGRP3	-3.311	0.00102	-0.045209	99	0.013656	yes	ESPMSL
chr2_33661731_A_G_b38	RASGRP3	-3.31	0.00102	-0.04386	107	0.01325	yes	ESPMSL
chr2_33575832_C_A_b38	RASGRP3	-3.297	0.00107	-0.044159	106	0.013394	yes	ESPMSL
chr2_33625433_A_C_b38	RASGRP3	-3.297	0.00107	-0.044936	80	0.013631	yes	ESPMSL
chr2_33659127_A_G_b38	RASGRP3	-3.277	0.00114	-0.043333	108	0.013222	yes	ESPMSL
chr2_33523846_A_G_b38	RASGRP3	-3.263	0.0012	-0.056819	20	0.017414	yes	ESPMSL
chr2_33603617_TC_T_b38	RASGRP3	3.242	0.00129	0.067053	10	0.020682	yes	ESPMSL
chr2_33664871_G_GT_b38	RASGRP3	-3.24	0.0013	-0.04408	103	0.013606	yes	ESPMSL
chr2_33603907_A_C_b38	RASGRP3	3.237	0.00131	0.066884	10	0.020661	yes	ESPMSL
chr2_33637426_T_A_b38	RASGRP3	3.222	0.00138	0.058224	16	0.018069	yes	ESPMSL
chr2_33605847_C_CT_b38	RASGRP3	3.205	0.00146	0.072252	4	0.022542	yes	ESPMSL
chr2_33794022_T_G_b38	RASGRP3	3.199	0.00149	0.05891	13	0.018413	yes	ESPMSL
chr2_33798456_A_G_b38	RASGRP3	-3.198	0.00149	-0.060219	14	0.018828	yes	ESPMSL
chr2_33798035_G_A_b38	RASGRP3	3.197	0.0015	0.058872	14	0.018416	yes	ESPMSL
chr2_33798057_G_A_b38	RASGRP3	3.197	0.0015	0.058872	14	0.018416	yes	ESPMSL
chr2_33798391_T_G_b38	RASGRP3	3.197	0.0015	0.058872	14	0.018416	yes	ESPMSL
chr2_33799757_C_T_b38	RASGRP3	3.197	0.0015	0.058872	14	0.018416	yes	ESPMSL
chr2_33800628_T_A_b38	RASGRP3	3.197	0.0015	0.058872	14	0.018416	yes	ESPMSL
chr2_33631637_C_A_b38	RASGRP3	-3.191	0.00153	-0.043101	84	0.013508	yes	ESPMSL
chr2_33797953_T_C_b38	RASGRP3	3.164	0.00168	0.058284	14	0.018421	yes	ESPMSL
chr2_33798065_T_C_b38	RASGRP3	3.164	0.00168	0.058284	14	0.018421	yes	ESPMSL
chr2_33540861_TA_T_b38	RASGRP3	-3.163	0.00168	-0.043273	77	0.013682	yes	ESPMSL
chr2_33613986_T_C_b38	RASGRP3	-3.161	0.00169	-0.042376	87	0.013405	yes	ESPMSL
chr2_33615675_TA_T_b38	RASGRP3	-3.146	0.00178	-0.04225	85	0.013429	yes	ESPMSL
chr2_33622456_T_TAAAC_b38	RASGRP3	-3.142	0.00181	-0.042259	86	0.01345	yes	ESPMSL
chr2_33469845_C_T_b38	RASGRP3	3.108	0.00202	0.043177	97	0.013893	yes	ESPMSL
chr2_33664465_T_A_b38	RASGRP3	-3.101	0.00207	-0.0415	104	0.013384	yes	ESPMSL
chr2_33276936_A_G_b38	RASGRP3	-3.1	0.00208	-0.046913	47	0.015135	yes	ESPMSL
chr2_33470756_C_T_b38	RASGRP3	3.094	0.00211	0.043413	79	0.014029	yes	ESPMSL
chr2_32508276_C_CTTTT_b38	RASGRP3	3.085	0.00218	0.149895	4	0.048594	yes	ESPMSL
chr2_33473933_A_G_b38	RASGRP3	-3.075	0.00226	-0.051356	23	0.016704	yes	ESPMSL
chr2_33794607_A_G_b38	RASGRP3	3.072	0.00227	0.049135	27	0.015992	yes	ESPMSL
chr2_33450656_A_G_b38	RASGRP3	-3.069	0.0023	-0.069533	4	0.022656	yes	ESPMSL
chr2_33630302_AT_A_b38	RASGRP3	-3.064	0.00233	-0.045189	83	0.014748	yes	ESPMSL
chr2_34398759_A_G_b38	RASGRP3	-3.058	0.00238	-0.070341	5	0.023001	yes	ESPMSL
chr2_33797839_A_G_b38	RASGRP3	3.056	0.00239	0.056779	13	0.018578	yes	ESPMSL
chr2_33631185_T_G_b38	RASGRP3	-3.055	0.0024	-0.040403	112	0.013225	yes	ESPMSL
chr2_33661861_G_A_b38	RASGRP3	-3.051	0.00243	-0.040773	100	0.013362	yes	ESPMSL
chr2_33793837_A_C_b38	RASGRP3	3.047	0.00247	0.057188	13	0.018769	yes	ESPMSL
chr2_33470311_T_A_b38	RASGRP3	3.04	0.00252	0.042741	79	0.014059	yes	ESPMSL
chr2_33470233_G_A_b38	RASGRP3	3.037	0.00255	0.042616	79	0.014033	yes	ESPMSL
chr2_33470439_G_A_b38	RASGRP3	3.033	0.00258	0.042513	79	0.014015	yes	ESPMSL
chr2_33469436_T_C_b38	RASGRP3	3.028	0.00262	0.042443	79	0.014015	yes	ESPMSL
chr2_33470006_T_C_b38	RASGRP3	3.006	0.00282	0.042131	79	0.014017	yes	ESPMSL
chr2_33449783_A_C_b38	RASGRP3	-3.002	0.00285	-0.049124	26	0.016362	yes	ESPMSL
chr2_33464091_C_T_b38	RASGRP3	-2.996	0.00291	-0.055856	17	0.018641	yes	ESPMSL
chr2_33470875_C_T_b38	RASGRP3	2.983	0.00303	0.041166	100	0.0138	yes	ESPMSL
chr2_33470505_G_A_b38	RASGRP3	2.982	0.00304	0.041926	79	0.014058	yes	ESPMSL
chr2_33799779_A_ATG_b38	RASGRP3	2.977	0.00309	0.054021	15	0.018147	yes	ESPMSL
chr2_34081826_C_T_b38	RASGRP3	-2.975	0.00311	-0.071858	5	0.024152	yes	ESPMSL
chr2_33311084_A_G_b38	RASGRP3	-2.947	0.0034	-0.044996	43	0.015271	yes	ESPMSL
chr2_33631863_T_C_b38	RASGRP3	-2.939	0.00348	-0.03891	112	0.013238	yes	ESPMSL
chr2_33469036_C_CA_b38	RASGRP3	2.927	0.00362	0.040374	98	0.013792	yes	ESPMSL
chr2_34087809_G_A_b38	RASGRP3	-2.914	0.00377	-0.07254	5	0.024894	yes	ESPMSL
chr2_34421247_T_C_b38	RASGRP3	-2.913	0.00379	-0.068036	4	0.023357	yes	ESPMSL
chr2_32540777_C_T_b38	RASGRP3	2.908	0.00384	0.041616	78	0.01431	yes	ESPMSL
chr2_33797842_C_G_b38	RASGRP3	2.905	0.00388	0.053035	15	0.018255	yes	ESPMSL
chr2_34084765_A_G_b38	RASGRP3	-2.891	0.00405	-0.069487	6	0.024033	yes	ESPMSL
chr2_34090387_C_T_b38	RASGRP3	-2.886	0.00412	-0.070334	5	0.024371	yes	ESPMSL
chr2_32629601_AT_A_b38	RASGRP3	2.885	0.00413	0.041437	78	0.014365	yes	ESPMSL
chr2_34089874_G_T_b38	RASGRP3	-2.88	0.0042	-0.069804	5	0.024239	yes	ESPMSL
chr2_33330347_T_C_b38	RASGRP3	-2.878	0.00422	-0.043196	46	0.015007	yes	ESPMSL
chr2_34060818_A_G_b38	RASGRP3	-2.876	0.00424	-0.069977	5	0.024329	yes	ESPMSL
chr2_33530852_CT_C_b38	RASGRP3	2.874	0.00428	0.039316	87	0.013681	yes	ESPMSL
chr2_33469790_T_G_b38	RASGRP3	-2.87	0.00433	-0.04853	21	0.01691	yes	ESPMSL
chr2_33470014_T_C_b38	RASGRP3	-2.87	0.00433	-0.04853	21	0.01691	yes	ESPMSL
chr2_33472085_T_C_b38	RASGRP3	-2.87	0.00433	-0.04853	21	0.01691	yes	ESPMSL
chr2_34207312_TAC_T_b38	RASGRP3	-2.861	0.00445	-0.054502	10	0.019052	yes	ESPMSL
chr2_33470380_AT_A_b38	RASGRP3	-2.851	0.00459	-0.051099	14	0.017924	yes	ESPMSL
chr2_32798715_AT_A_b38	RASGRP3	-2.847	0.00464	-0.040099	69	0.014084	yes	ESPMSL
chr2_33629277_A_G_b38	RASGRP3	-2.829	0.00491	-0.038254	90	0.013524	yes	ESPMSL
chr2_33647687_C_CA_b38	RASGRP3	2.822	0.00501	0.051694	25	0.018316	yes	ESPMSL
chr2_33629657_C_CT_b38	RASGRP3	2.82	0.00505	0.051983	15	0.018435	yes	ESPMSL
chr2_34080389_C_G_b38	RASGRP3	-2.815	0.00512	-0.069793	5	0.024791	yes	ESPMSL
chr2_33797496_T_C_b38	RASGRP3	2.812	0.00517	0.053273	12	0.018944	yes	ESPMSL
chr2_33461834_G_T_b38	RASGRP3	-2.811	0.00518	-0.059429	6	0.02114	yes	ESPMSL
chr2_33451360_G_C_b38	RASGRP3	-2.809	0.00522	-0.061918	4	0.022045	yes	ESPMSL
chr2_34076602_T_C_b38	RASGRP3	-2.807	0.00525	-0.069826	5	0.024877	yes	ESPMSL
chr2_34081138_A_G_b38	RASGRP3	-2.807	0.00525	-0.069826	5	0.024877	yes	ESPMSL
chr2_34082367_G_A_b38	RASGRP3	-2.804	0.0053	-0.069489	5	0.024784	yes	ESPMSL
chr2_33241988_G_C_b38	RASGRP3	2.798	0.00539	0.043265	37	0.015461	yes	ESPMSL
chr2_34088628_C_T_b38	RASGRP3	-2.794	0.00546	-0.067981	5	0.024332	yes	ESPMSL
chr2_34077960_G_A_b38	RASGRP3	-2.791	0.00551	-0.070108	5	0.025119	yes	ESPMSL
chr2_34079419_C_T_b38	RASGRP3	-2.791	0.00551	-0.070108	5	0.025119	yes	ESPMSL
chr2_33622130_CA_C_b38	RASGRP3	-2.785	0.00562	-0.043092	40	0.015475	yes	ESPMSL
chr2_33525699_C_CAAA_b38	RASGRP3	-2.767	0.00593	-0.111868	4	0.040432	yes	ESPMSL
chr2_33799471_ATT_A_b38	RASGRP3	2.764	0.00598	0.04266	32	0.015434	yes	ESPMSL
chr2_33624514_C_A_b38	RASGRP3	-2.763	0.006	-0.037761	87	0.013666	yes	ESPMSL
chr2_33625060_G_A_b38	RASGRP3	-2.763	0.006	-0.037761	87	0.013666	yes	ESPMSL
chr2_34086039_G_C_b38	RASGRP3	-2.746	0.00631	-0.067327	5	0.024517	yes	ESPMSL
chr2_33448754_AC_A_b38	RASGRP3	2.744	0.00634	0.063159	5	0.023013	yes	ESPMSL
chr2_33449317_C_T_b38	RASGRP3	2.744	0.00634	0.063159	5	0.023013	yes	ESPMSL
chr2_34075335_C_G_b38	RASGRP3	-2.744	0.00634	-0.067237	5	0.024502	yes	ESPMSL
chr2_34080911_C_G_b38	RASGRP3	-2.744	0.00634	-0.067237	5	0.024502	yes	ESPMSL
chr2_34080966_A_C_b38	RASGRP3	-2.744	0.00634	-0.067237	5	0.024502	yes	ESPMSL
chr2_34088404_A_G_b38	RASGRP3	-2.742	0.00639	-0.06815	4	0.024855	yes	ESPMSL
chr2_34088406_G_A_b38	RASGRP3	-2.742	0.00639	-0.06815	4	0.024855	yes	ESPMSL
chr2_34086487_C_T_b38	RASGRP3	-2.739	0.00644	-0.067152	5	0.024516	yes	ESPMSL
chr2_34073925_T_C_b38	RASGRP3	-2.736	0.0065	-0.067284	5	0.02459	yes	ESPMSL
chr2_34074046_C_T_b38	RASGRP3	-2.736	0.0065	-0.067284	5	0.02459	yes	ESPMSL
chr2_34074321_T_G_b38	RASGRP3	-2.736	0.0065	-0.067284	5	0.02459	yes	ESPMSL
chr2_34074330_T_C_b38	RASGRP3	-2.736	0.0065	-0.067284	5	0.02459	yes	ESPMSL
chr2_34074340_TG_T_b38	RASGRP3	-2.736	0.0065	-0.067284	5	0.02459	yes	ESPMSL
chr2_34074344_AC_A_b38	RASGRP3	-2.736	0.0065	-0.067284	5	0.02459	yes	ESPMSL
chr2_34074373_G_A_b38	RASGRP3	-2.736	0.0065	-0.067284	5	0.02459	yes	ESPMSL
chr2_34074539_T_G_b38	RASGRP3	-2.736	0.0065	-0.067284	5	0.02459	yes	ESPMSL
chr2_34074725_TTA_T_b38	RASGRP3	-2.736	0.0065	-0.067284	5	0.02459	yes	ESPMSL
chr2_34074730_G_T_b38	RASGRP3	-2.736	0.0065	-0.067284	5	0.02459	yes	ESPMSL
chr2_34074732_C_CT_b38	RASGRP3	-2.736	0.0065	-0.067284	5	0.02459	yes	ESPMSL
chr2_34074888_C_T_b38	RASGRP3	-2.736	0.0065	-0.067284	5	0.02459	yes	ESPMSL
chr2_34075596_A_G_b38	RASGRP3	-2.736	0.0065	-0.067284	5	0.02459	yes	ESPMSL
chr2_34075636_G_A_b38	RASGRP3	-2.736	0.0065	-0.067284	5	0.02459	yes	ESPMSL
chr2_34075890_T_C_b38	RASGRP3	-2.736	0.0065	-0.067284	5	0.02459	yes	ESPMSL
chr2_34077829_T_C_b38	RASGRP3	-2.736	0.0065	-0.067284	5	0.02459	yes	ESPMSL
chr2_34077895_A_AG_b38	RASGRP3	-2.736	0.0065	-0.067284	5	0.02459	yes	ESPMSL
chr2_34077971_C_T_b38	RASGRP3	-2.736	0.0065	-0.067284	5	0.02459	yes	ESPMSL
chr2_34078390_T_C_b38	RASGRP3	-2.736	0.0065	-0.067284	5	0.02459	yes	ESPMSL
chr2_34078942_G_A_b38	RASGRP3	-2.736	0.0065	-0.067284	5	0.02459	yes	ESPMSL
chr2_34078943_T_C_b38	RASGRP3	-2.736	0.0065	-0.067284	5	0.02459	yes	ESPMSL
chr2_34079554_GTT_G_b38	RASGRP3	-2.736	0.0065	-0.067284	5	0.02459	yes	ESPMSL
chr2_34079722_T_C_b38	RASGRP3	-2.736	0.0065	-0.067284	5	0.02459	yes	ESPMSL
chr2_34079888_G_C_b38	RASGRP3	-2.736	0.0065	-0.067284	5	0.02459	yes	ESPMSL
chr2_34080050_C_G_b38	RASGRP3	-2.736	0.0065	-0.067284	5	0.02459	yes	ESPMSL
chr2_34080457_T_G_b38	RASGRP3	-2.736	0.0065	-0.067284	5	0.02459	yes	ESPMSL
chr2_34080671_C_T_b38	RASGRP3	-2.736	0.0065	-0.067284	5	0.02459	yes	ESPMSL
chr2_34080724_A_G_b38	RASGRP3	-2.736	0.0065	-0.067284	5	0.02459	yes	ESPMSL
chr2_34080848_A_G_b38	RASGRP3	-2.736	0.0065	-0.067284	5	0.02459	yes	ESPMSL
chr2_34081069_C_T_b38	RASGRP3	-2.736	0.0065	-0.067284	5	0.02459	yes	ESPMSL
chr2_34081186_C_T_b38	RASGRP3	-2.736	0.0065	-0.067284	5	0.02459	yes	ESPMSL
chr2_34081357_A_G_b38	RASGRP3	-2.736	0.0065	-0.067284	5	0.02459	yes	ESPMSL
chr2_34081449_G_A_b38	RASGRP3	-2.736	0.0065	-0.067284	5	0.02459	yes	ESPMSL
chr2_34081700_T_G_b38	RASGRP3	-2.736	0.0065	-0.067284	5	0.02459	yes	ESPMSL
chr2_34081822_C_T_b38	RASGRP3	-2.736	0.0065	-0.067284	5	0.02459	yes	ESPMSL
chr2_34081969_G_A_b38	RASGRP3	-2.736	0.0065	-0.067284	5	0.02459	yes	ESPMSL
chr2_34082012_A_T_b38	RASGRP3	-2.736	0.0065	-0.067284	5	0.02459	yes	ESPMSL
chr2_34082396_T_C_b38	RASGRP3	-2.734	0.00654	-0.066981	5	0.024501	yes	ESPMSL
chr2_34082690_T_C_b38	RASGRP3	-2.734	0.00654	-0.066981	5	0.024501	yes	ESPMSL
chr2_34082691_G_A_b38	RASGRP3	-2.734	0.00654	-0.066981	5	0.024501	yes	ESPMSL
chr2_34082966_G_C_b38	RASGRP3	-2.734	0.00654	-0.066981	5	0.024501	yes	ESPMSL
chr2_34083059_A_G_b38	RASGRP3	-2.734	0.00654	-0.066981	5	0.024501	yes	ESPMSL
chr2_34083075_G_A_b38	RASGRP3	-2.734	0.00654	-0.066981	5	0.024501	yes	ESPMSL
chr2_34083180_A_ACTGT_b38	RASGRP3	-2.734	0.00654	-0.066981	5	0.024501	yes	ESPMSL
chr2_34083202_C_A_b38	RASGRP3	-2.734	0.00654	-0.066981	5	0.024501	yes	ESPMSL
chr2_34083205_G_C_b38	RASGRP3	-2.734	0.00654	-0.066981	5	0.024501	yes	ESPMSL
chr2_34083231_T_A_b38	RASGRP3	-2.734	0.00654	-0.066981	5	0.024501	yes	ESPMSL
chr2_34083431_C_T_b38	RASGRP3	-2.734	0.00654	-0.066981	5	0.024501	yes	ESPMSL
chr2_34083551_C_A_b38	RASGRP3	-2.734	0.00654	-0.066981	5	0.024501	yes	ESPMSL
chr2_34083660_C_T_b38	RASGRP3	-2.734	0.00654	-0.066981	5	0.024501	yes	ESPMSL
chr2_34083683_G_A_b38	RASGRP3	-2.734	0.00654	-0.066981	5	0.024501	yes	ESPMSL
chr2_34084188_G_A_b38	RASGRP3	-2.734	0.00654	-0.066981	5	0.024501	yes	ESPMSL
chr2_34084190_C_G_b38	RASGRP3	-2.734	0.00654	-0.066981	5	0.024501	yes	ESPMSL
chr2_34084724_G_A_b38	RASGRP3	-2.734	0.00654	-0.066981	5	0.024501	yes	ESPMSL
chr2_34084805_A_G_b38	RASGRP3	-2.734	0.00654	-0.066981	5	0.024501	yes	ESPMSL
chr2_34084807_A_G_b38	RASGRP3	-2.734	0.00654	-0.066981	5	0.024501	yes	ESPMSL
chr2_34085098_T_A_b38	RASGRP3	-2.734	0.00654	-0.066981	5	0.024501	yes	ESPMSL
chr2_34085353_T_C_b38	RASGRP3	-2.734	0.00654	-0.066981	5	0.024501	yes	ESPMSL
chr2_34085451_G_A_b38	RASGRP3	-2.734	0.00654	-0.066981	5	0.024501	yes	ESPMSL
chr2_34085730_T_A_b38	RASGRP3	-2.734	0.00654	-0.066981	5	0.024501	yes	ESPMSL
chr2_34086194_C_A_b38	RASGRP3	-2.734	0.00654	-0.066981	5	0.024501	yes	ESPMSL
chr2_34086303_G_A_b38	RASGRP3	-2.734	0.00654	-0.066981	5	0.024501	yes	ESPMSL
chr2_34086656_A_T_b38	RASGRP3	-2.734	0.00654	-0.066981	5	0.024501	yes	ESPMSL
chr2_34086677_C_T_b38	RASGRP3	-2.734	0.00654	-0.066981	5	0.024501	yes	ESPMSL
chr2_34086895_CT_C_b38	RASGRP3	-2.734	0.00654	-0.066981	5	0.024501	yes	ESPMSL
chr2_34087367_T_C_b38	RASGRP3	-2.734	0.00654	-0.066981	5	0.024501	yes	ESPMSL
chr2_34087936_G_A_b38	RASGRP3	-2.734	0.00654	-0.066981	5	0.024501	yes	ESPMSL
chr2_34087970_C_G_b38	RASGRP3	-2.734	0.00654	-0.066981	5	0.024501	yes	ESPMSL
chr2_34088220_C_G_b38	RASGRP3	-2.731	0.0066	-0.066754	5	0.024443	yes	ESPMSL
chr2_34088316_A_G_b38	RASGRP3	-2.731	0.0066	-0.066754	5	0.024443	yes	ESPMSL
chr2_33563470_A_ATACT_b38	RASGRP3	-2.73	0.00662	-0.062263	4	0.02281	yes	ESPMSL
chr2_32663990_A_AT_b38	RASGRP3	-2.72	0.00683	-0.056152	8	0.020647	yes	ESPMSL
chr2_34084061_G_A_b38	RASGRP3	-2.719	0.00684	-0.066372	5	0.024411	yes	ESPMSL
chr2_34080065_G_A_b38	RASGRP3	-2.714	0.00695	-0.066764	5	0.024604	yes	ESPMSL
chr2_34078769_A_G_b38	RASGRP3	-2.712	0.00699	-0.072055	4	0.026574	yes	ESPMSL
chr2_33508652_C_G_b38	RASGRP3	2.709	0.00704	0.039931	58	0.014739	yes	ESPMSL
chr2_33472754_G_A_b38	RASGRP3	-2.708	0.00707	-0.045417	22	0.016773	yes	ESPMSL
chr2_33474721_C_T_b38	RASGRP3	-2.694	0.00737	-0.045662	21	0.016951	yes	ESPMSL
chr2_33458663_A_T_b38	RASGRP3	2.67	0.0079	0.061886	4	0.023178	yes	ESPMSL
chr2_34109238_C_CA_b38	RASGRP3	-2.668	0.00795	-0.052249	26	0.019584	yes	ESPMSL
chr2_33797230_G_T_b38	RASGRP3	2.664	0.00803	0.049598	13	0.018616	yes	ESPMSL
chr2_34074554_G_A_b38	RASGRP3	-2.66	0.00814	-0.065645	5	0.02468	yes	ESPMSL
chr2_34079142_C_T_b38	RASGRP3	-2.66	0.00814	-0.065645	5	0.02468	yes	ESPMSL
chr2_32929177_T_TAA_b38	RASGRP3	-2.645	0.0085	-0.072729	3	0.027498	yes	ESPMSL
chr2_33566193_A_G_b38	RASGRP3	-2.641	0.00859	-0.056888	5	0.021539	yes	ESPMSL
chr2_33456957_G_A_b38	RASGRP3	-2.639	0.00866	-0.05854	4	0.022186	yes	ESPMSL
chr2_33473129_A_G_b38	RASGRP3	-2.633	0.0088	-0.043963	23	0.016699	yes	ESPMSL
chr2_34236339_C_T_b38	RASGRP3	2.63	0.00888	0.039427	50	0.014992	yes	ESPMSL
chr2_33458089_T_A_b38	RASGRP3	2.628	0.00893	0.060687	4	0.023096	yes	ESPMSL
chr2_33799471_AT_A_b38	RASGRP3	-2.624	0.00903	-0.041241	29	0.015717	yes	ESPMSL
chr2_34057627_G_A_b38	RASGRP3	-2.614	0.0093	-0.055398	11	0.021195	yes	ESPMSL
chr2_32826744_T_TCACACA_b38	RASGRP3	-2.611	0.00936	-0.044908	15	0.017198	yes	ESPMSL
chr2_34082188_G_GATCC_b38	RASGRP3	-2.604	0.00957	-0.063983	5	0.024573	yes	ESPMSL
chr2_34377355_T_G_b38	RASGRP3	-2.6	0.00966	-0.043154	23	0.016596	yes	ESPMSL
chr2_33526597_C_T_b38	RASGRP3	10.634	2.18e-23	0.207085	6	0.019474	no	ESPMSL
chr2_33527062_GC_G_b38	RASGRP3	10.634	2.18e-23	0.207085	6	0.019474	no	ESPMSL
chr2_33557844_G_A_b38	RASGRP3	10.608	2.71e-23	0.199767	8	0.018832	no	ESPMSL
chr2_33531453_C_T_b38	RASGRP3	10.521	5.57e-23	0.200614	7	0.019068	no	ESPMSL
chr2_33537896_A_G_b38	RASGRP3	9.892	9.37e-21	0.197428	5	0.019958	no	ESPMSL
chr2_33548762_A_G_b38	RASGRP3	9.644	6.71e-20	0.202073	4	0.020953	no	ESPMSL
chr2_33559068_A_G_b38	RASGRP3	9.48	2.43e-19	0.196514	4	0.020729	no	ESPMSL
chr2_33536526_G_A_b38	RASGRP3	9.356	6.38e-19	0.199088	3	0.021279	no	ESPMSL
chr2_33536528_G_A_b38	RASGRP3	9.356	6.38e-19	0.199088	3	0.021279	no	ESPMSL
chr2_33537330_C_CCCAACACA_b38	RASGRP3	7.147	4.32e-12	0.134159	20	0.01877	no	ESPMSL
chr2_33547053_GAA_G_b38	RASGRP3	7.131	4.79e-12	0.189562	3	0.026582	no	ESPMSL
chr2_33670716_C_T_b38	RASGRP3	5.284	2.1e-07	0.082534	30	0.01562	no	ESPMSL
chr2_33652477_C_A_b38	RASGRP3	4.987	9.22e-07	0.080441	25	0.016131	no	ESPMSL
chr2_33650021_A_G_b38	RASGRP3	4.983	9.38e-07	0.080013	25	0.016056	no	ESPMSL
chr2_33622592_T_C_b38	RASGRP3	4.979	9.56e-07	0.073781	46	0.014817	no	ESPMSL
chr2_33656248_TTC_T_b38	RASGRP3	4.962	1.04e-06	0.079835	25	0.016088	no	ESPMSL
chr2_33639021_G_A_b38	RASGRP3	4.836	1.9e-06	0.07789	25	0.016106	no	ESPMSL
chr2_33641397_G_C_b38	RASGRP3	4.816	2.1e-06	0.077725	25	0.01614	no	ESPMSL
chr2_33640631_A_C_b38	RASGRP3	4.776	2.53e-06	0.077092	25	0.016142	no	ESPMSL
chr2_33656848_TA_T_b38	RASGRP3	4.761	2.71e-06	0.073407	37	0.015418	no	ESPMSL
chr2_33657078_T_C_b38	RASGRP3	4.747	2.9e-06	0.072609	40	0.015297	no	ESPMSL
chr2_33662459_C_T_b38	RASGRP3	4.633	4.91e-06	0.074379	26	0.016054	no	ESPMSL
chr2_33625315_G_A_b38	RASGRP3	4.627	5.04e-06	0.072214	34	0.015607	no	ESPMSL
chr2_33663555_T_C_b38	RASGRP3	4.572	6.46e-06	0.073605	26	0.016097	no	ESPMSL
chr2_33656916_G_A_b38	RASGRP3	4.488	9.44e-06	0.06722	45	0.014977	no	ESPMSL
chr2_33624881_G_GT_b38	RASGRP3	4.254	2.63e-05	0.06509	39	0.015301	no	ESPMSL
chr2_33626436_A_T_b38	RASGRP3	4.203	3.26e-05	0.064208	41	0.015278	no	ESPMSL
chr2_33661156_C_T_b38	RASGRP3	4.179	3.61e-05	0.064803	31	0.015507	no	ESPMSL
chr2_33661310_C_T_b38	RASGRP3	4.179	3.61e-05	0.064803	31	0.015507	no	ESPMSL
chr2_33563965_A_G_b38	RASGRP3	4.162	3.88e-05	0.08304	10	0.019954	no	ESPMSL
chr2_33540561_TGTGTGTGTGTGTGTGTG_T_b38	RASGRP3	-4.01	7.28e-05	-0.054844	75	0.013679	no	ESPMSL
chr2_33581900_A_T_b38	RASGRP3	3.918	0.000105	0.078755	10	0.0201	no	ESPMSL
chr2_33554839_T_C_b38	RASGRP3	3.903	0.000112	0.056176	63	0.014395	no	ESPMSL
chr2_33669427_A_C_b38	RASGRP3	3.898	0.000114	0.069653	19	0.017871	no	ESPMSL
chr2_33581338_T_A_b38	RASGRP3	3.896	0.000115	0.078252	10	0.020084	no	ESPMSL
chr2_33547458_G_A_b38	RASGRP3	3.891	0.000117	0.055203	65	0.014187	no	ESPMSL
chr2_33668515_A_G_b38	RASGRP3	-3.852	0.000137	-0.051319	96	0.013324	no	ESPMSL
chr2_33662442_T_C_b38	RASGRP3	-3.774	0.000185	-0.050148	96	0.013288	no	ESPMSL
chr2_33647765_T_C_b38	RASGRP3	-3.748	0.000205	-0.049844	98	0.0133	no	ESPMSL
chr2_33669574_A_G_b38	RASGRP3	3.744	0.000208	0.066471	19	0.017755	no	ESPMSL
chr2_33658713_G_A_b38	RASGRP3	-3.709	0.000238	-0.049764	93	0.013417	no	ESPMSL
chr2_33658170_A_G_b38	RASGRP3	-3.682	0.000263	-0.049122	95	0.01334	no	ESPMSL
chr2_33641120_T_C_b38	RASGRP3	-3.672	0.000274	-0.048914	96	0.013321	no	ESPMSL
chr2_33631243_G_GT_b38	RASGRP3	3.653	0.000294	0.077553	7	0.021229	no	ESPMSL
chr2_33655774_A_G_b38	RASGRP3	-3.628	0.000323	-0.048342	98	0.013324	no	ESPMSL
chr2_33659035_G_A_b38	RASGRP3	3.575	0.000393	0.075886	7	0.021225	no	ESPMSL
chr2_33607432_G_A_b38	RASGRP3	3.562	0.000413	0.078465	6	0.022026	no	ESPMSL
chr2_33520335_A_G_b38	RASGRP3	-3.473	0.000573	-0.048732	81	0.014034	no	ESPMSL
chr2_33640513_G_C_b38	RASGRP3	3.465	0.000589	0.072719	7	0.020989	no	ESPMSL
chr2_33532487_C_A_b38	RASGRP3	3.447	0.000629	0.046238	118	0.013416	no	ESPMSL
chr2_33467980_TTTTCTTTCTTTC_T_b38	RASGRP3	3.414	0.000706	0.063087	19	0.018478	no	ESPMSL
chr2_33663649_A_C_b38	RASGRP3	-3.407	0.000726	-0.045473	109	0.013349	no	ESPMSL
chr2_33522519_T_C_b38	RASGRP3	-3.398	0.000748	-0.047488	77	0.013976	no	ESPMSL
chr2_34371166_TCACACA_T_b38	RASGRP3	-3.343	0.000909	-0.054066	30	0.016174	no	ESPMSL
chr2_33666591_A_G_b38	RASGRP3	-3.322	0.000978	-0.044213	112	0.013309	no	ESPMSL
chr2_33529319_G_C_b38	RASGRP3	-3.318	0.000992	-0.047071	75	0.014188	no	ESPMSL
chr2_33615793_A_T_b38	RASGRP3	3.3	0.00105	0.072094	6	0.021844	no	ESPMSL
chr2_33621944_G_A_b38	RASGRP3	3.3	0.00105	0.072094	6	0.021844	no	ESPMSL
chr2_33623483_C_T_b38	RASGRP3	3.3	0.00105	0.072094	6	0.021844	no	ESPMSL
chr2_33615450_C_G_b38	RASGRP3	3.298	0.00106	0.072197	6	0.021893	no	ESPMSL
chr2_33655786_T_C_b38	RASGRP3	-3.263	0.0012	-0.043635	94	0.013374	no	ESPMSL
chr2_33632169_T_C_b38	RASGRP3	-3.241	0.00129	-0.044287	78	0.013665	no	ESPMSL
chr2_33664742_G_C_b38	RASGRP3	-3.226	0.00136	-0.043178	111	0.013385	no	ESPMSL
chr2_33655112_A_AT_b38	RASGRP3	-3.223	0.00138	-0.044945	84	0.013946	no	ESPMSL
chr2_33532968_G_A_b38	RASGRP3	-3.22	0.00139	-0.068334	5	0.021223	no	ESPMSL
chr2_33794805_GT_G_b38	RASGRP3	3.194	0.00152	0.057282	14	0.017934	no	ESPMSL
chr2_33878786_TGAGAGAGAGAGAGA_T_b38	RASGRP3	-3.19	0.00154	-0.0748	3	0.023451	no	ESPMSL
chr2_33546150_G_A_b38	RASGRP3	-3.164	0.00168	-0.044385	72	0.014029	no	ESPMSL
chr2_33476758_C_CGTGTGTGTGTGTGT_b38	RASGRP3	-3.153	0.00174	-0.078703	5	0.024963	no	ESPMSL
chr2_33602942_T_C_b38	RASGRP3	3.151	0.00175	0.073148	4	0.023216	no	ESPMSL
chr2_33673146_T_C_b38	RASGRP3	-3.147	0.00177	-0.041585	101	0.013212	no	ESPMSL
chr2_33515788_C_T_b38	RASGRP3	-3.142	0.00181	-0.066088	6	0.021035	no	ESPMSL
chr2_33534062_A_C_b38	RASGRP3	-3.137	0.00183	-0.064029	5	0.020409	no	ESPMSL
chr2_33525699_C_CAA_b38	RASGRP3	3.13	0.00188	0.095543	10	0.030523	no	ESPMSL
chr2_33525341_AAT_A_b38	RASGRP3	-3.115	0.00197	-0.063996	5	0.020543	no	ESPMSL
chr2_32473706_C_CGT_b38	RASGRP3	-3.088	0.00216	-0.046573	38	0.015081	no	ESPMSL
chr2_33538452_G_A_b38	RASGRP3	-3.079	0.00222	-0.064019	5	0.020793	no	ESPMSL
chr2_33543280_C_G_b38	RASGRP3	-3.061	0.00236	-0.063616	5	0.020783	no	ESPMSL
chr2_33714364_G_T_b38	RASGRP3	3.059	0.00237	0.106894	3	0.034947	no	ESPMSL
chr2_33562245_G_C_b38	RASGRP3	-3.055	0.0024	-0.043924	71	0.014376	no	ESPMSL
chr2_33800154_A_C_b38	RASGRP3	3.039	0.00253	0.048163	28	0.015847	no	ESPMSL
chr2_33535555_G_GC_b38	RASGRP3	-3.028	0.00262	-0.06207	6	0.020498	no	ESPMSL
chr2_33544520_G_GA_b38	RASGRP3	-3.017	0.00271	-0.043851	67	0.014533	no	ESPMSL
chr2_33548717_A_T_b38	RASGRP3	-3.017	0.00272	-0.042511	75	0.01409	no	ESPMSL
chr2_33535943_T_C_b38	RASGRP3	-3.016	0.00273	-0.060802	6	0.020163	no	ESPMSL
chr2_33792244_T_C_b38	RASGRP3	3.011	0.00277	0.107639	5	0.035745	no	ESPMSL
chr2_33530497_CT_C_b38	RASGRP3	2.995	0.00292	0.052208	17	0.017431	no	ESPMSL
chr2_33536207_C_T_b38	RASGRP3	-2.978	0.00308	-0.04229	72	0.014201	no	ESPMSL
chr2_33800188_T_G_b38	RASGRP3	2.976	0.0031	0.047148	28	0.015843	no	ESPMSL
chr2_33798147_A_T_b38	RASGRP3	2.947	0.0034	0.045687	31	0.015501	no	ESPMSL
chr2_33799215_G_C_b38	RASGRP3	2.947	0.0034	0.045687	31	0.015501	no	ESPMSL
chr2_34378421_A_AAAAAG_b38	RASGRP3	-2.941	0.00346	-0.136625	3	0.046454	no	ESPMSL
chr2_33671460_G_A_b38	RASGRP3	2.931	0.00357	0.059866	8	0.020425	no	ESPMSL
chr2_33772629_T_A_b38	RASGRP3	2.928	0.00361	0.119362	3	0.040767	no	ESPMSL
chr2_33539642_C_G_b38	RASGRP3	-2.859	0.00448	-0.04055	73	0.014184	no	ESPMSL
chr2_33539436_C_G_b38	RASGRP3	-2.855	0.00453	-0.040602	73	0.01422	no	ESPMSL
chr2_33798072_A_G_b38	RASGRP3	2.85	0.00461	0.044184	31	0.015505	no	ESPMSL
chr2_33538430_G_C_b38	RASGRP3	-2.837	0.0048	-0.05857	5	0.020649	no	ESPMSL
chr2_33523771_A_G_b38	RASGRP3	-2.836	0.0048	-0.039996	68	0.014102	no	ESPMSL
chr2_34081725_ATGTGTGTGTGTGTG_A_b38	RASGRP3	-2.82	0.00504	-0.064256	7	0.022786	no	ESPMSL
chr2_33539434_T_C_b38	RASGRP3	-2.819	0.00506	-0.039948	74	0.01417	no	ESPMSL
chr2_33548381_A_AAAG_b38	RASGRP3	2.815	0.00513	0.059496	12	0.021138	no	ESPMSL
chr2_33794309_A_G_b38	RASGRP3	2.79	0.00553	0.045217	25	0.016208	no	ESPMSL
chr2_32553019_TA_T_b38	RASGRP3	2.786	0.0056	0.039114	89	0.01404	no	ESPMSL
chr2_34264276_A_T_b38	RASGRP3	2.785	0.00562	0.124241	3	0.044619	no	ESPMSL
chr2_33523281_G_A_b38	RASGRP3	-2.778	0.00573	-0.039431	66	0.014193	no	ESPMSL
chr2_33629533_C_G_b38	RASGRP3	2.776	0.00576	0.056078	10	0.0202	no	ESPMSL
chr2_33521775_G_C_b38	RASGRP3	-2.761	0.00603	-0.03846	72	0.013928	no	ESPMSL
chr2_33631252_G_T_b38	RASGRP3	2.748	0.00628	0.039112	120	0.014234	no	ESPMSL
chr2_33534496_G_A_b38	RASGRP3	-2.734	0.00654	-0.056429	5	0.020639	no	ESPMSL
chr2_34098114_T_A_b38	RASGRP3	2.733	0.00655	0.039614	54	0.014492	no	ESPMSL
chr2_33556190_G_A_b38	RASGRP3	-2.725	0.00672	-0.03915	70	0.014367	no	ESPMSL
chr2_33947329_C_CA_b38	RASGRP3	-2.725	0.00672	-0.118257	3	0.043401	no	ESPMSL
chr2_33620413_GA_G_b38	RASGRP3	2.71	0.00702	0.05496	6	0.020281	no	ESPMSL
chr2_32833365_C_CT_b38	RASGRP3	2.709	0.00705	0.119021	3	0.043938	no	ESPMSL
chr2_32523993_G_A_b38	RASGRP3	2.697	0.0073	0.03829	78	0.014197	no	ESPMSL
chr2_34257651_A_G_b38	RASGRP3	2.679	0.00769	0.119668	3	0.044665	no	ESPMSL
chr2_33726232_C_CT_b38	RASGRP3	-2.677	0.00774	-0.037794	57	0.014118	no	ESPMSL
chr2_32633570_A_G_b38	RASGRP3	2.665	0.00802	0.037382	86	0.014028	no	ESPMSL
chr2_33534328_C_T_b38	RASGRP3	-2.663	0.00805	-0.055263	5	0.020749	no	ESPMSL
chr2_33561192_A_G_b38	RASGRP3	2.65	0.00838	0.036009	109	0.01359	no	ESPMSL
chr2_33567211_T_TAA_b38	RASGRP3	-2.645	0.00851	-0.072398	3	0.027377	no	ESPMSL
chr2_32623793_CT_C_b38	RASGRP3	2.638	0.00868	0.038896	57	0.014747	no	ESPMSL
chr2_34252662_GTTGTT_G_b38	RASGRP3	2.637	0.00868	0.041698	37	0.01581	no	ESPMSL
chr2_33533388_C_T_b38	RASGRP3	-2.617	0.0092	-0.052376	7	0.02001	no	ESPMSL
chr2_33794742_T_G_b38	RASGRP3	2.614	0.0093	0.042119	26	0.016114	no	ESPMSL
chr2_32597890_G_A_b38	RASGRP3	2.597	0.00975	0.036786	80	0.014163	no	ESPMSL
chr2_33563038_A_G_b38	RASGRP3	-2.596	0.00978	-0.055341	6	0.021316	no	ESPMSL
chr2_33533389_G_A_b38	RASGRP3	-2.592	0.00989	-0.036504	70	0.014082	no	ESPMSL
chr2_33557635_G_A_b38	RASGRP3	18.776	1.32e-52	0.506385	3	0.026969	yes	HRTAA
chr2_33559734_G_A_b38	RASGRP3	18.506	1.38e-51	0.503265	3	0.027195	yes	HRTAA
chr2_33559304_G_A_b38	RASGRP3	18.363	4.74e-51	0.502157	3	0.027345	yes	HRTAA
chr2_33548469_T_C_b38	RASGRP3	17.381	2.43e-47	0.503945	3	0.028994	yes	HRTAA
chr2_33550216_T_A_b38	RASGRP3	17.201	1.17e-46	0.502269	3	0.0292	yes	HRTAA
chr2_33550484_C_G_b38	RASGRP3	16.982	7.86e-46	0.500066	3	0.029447	yes	HRTAA
chr2_33554542_A_G_b38	RASGRP3	16.808	3.56e-45	0.49732	3	0.029588	yes	HRTAA
chr2_33557844_G_A_b38	RASGRP3	16.797	3.94e-45	0.46461	4	0.027661	yes	HRTAA
chr2_33553995_C_T_b38	RASGRP3	16.36	1.75e-43	0.483806	4	0.029572	yes	HRTAA
chr2_33537330_C_CCCAACACA_b38	RASGRP3	15.847	1.51e-41	0.411497	14	0.025967	yes	HRTAA
chr2_33546942_C_G_b38	RASGRP3	15.47	3.94e-40	0.459965	5	0.029732	yes	HRTAA
chr2_33537192_G_GAT_b38	RASGRP3	15.296	1.78e-39	0.434555	4	0.02841	yes	HRTAA
chr2_33561445_C_A_b38	RASGRP3	11.369	3.7e-25	0.300585	16	0.026439	yes	HRTAA
chr2_33529318_C_T_b38	RASGRP3	11.175	1.75e-24	0.302005	11	0.027025	yes	HRTAA
chr2_33525341_A_AAT_b38	RASGRP3	10.936	1.16e-23	0.280492	19	0.025649	yes	HRTAA
chr2_33596963_A_T_b38	RASGRP3	10.273	2.03e-21	0.271838	18	0.026462	yes	HRTAA
chr2_33586869_A_T_b38	RASGRP3	10.258	2.27e-21	0.286336	13	0.027913	yes	HRTAA
chr2_33565263_A_G_b38	RASGRP3	10.179	4.15e-21	0.271466	24	0.026669	yes	HRTAA
chr2_33555164_G_A_b38	RASGRP3	10.083	8.62e-21	0.281891	14	0.027956	yes	HRTAA
chr2_33594326_C_T_b38	RASGRP3	9.957	2.24e-20	0.267156	17	0.02683	yes	HRTAA
chr2_33594385_G_A_b38	RASGRP3	9.957	2.24e-20	0.267156	17	0.02683	yes	HRTAA
chr2_33536322_G_GA_b38	RASGRP3	9.699	1.56e-19	0.324186	8	0.033424	yes	HRTAA
chr2_33596617_C_T_b38	RASGRP3	9.672	1.92e-19	0.261532	17	0.027041	yes	HRTAA
chr2_33581561_C_T_b38	RASGRP3	9.396	1.47e-18	0.254852	17	0.027122	yes	HRTAA
chr2_33582025_C_T_b38	RASGRP3	9.284	3.35e-18	0.253068	16	0.027258	yes	HRTAA
chr2_33523649_G_A_b38	RASGRP3	9.041	1.95e-17	0.262473	14	0.029032	yes	HRTAA
chr2_33563965_A_G_b38	RASGRP3	8.566	5.64e-16	0.284894	5	0.033258	yes	HRTAA
chr2_33596450_T_G_b38	RASGRP3	8.439	1.36e-15	0.21618	28	0.025616	yes	HRTAA
chr2_33589264_G_C_b38	RASGRP3	8.35	2.52e-15	0.214878	27	0.025734	yes	HRTAA
chr2_33590881_T_C_b38	RASGRP3	8.35	2.52e-15	0.214878	27	0.025734	yes	HRTAA
chr2_33521266_C_T_b38	RASGRP3	8.278	4.13e-15	0.226311	22	0.027339	yes	HRTAA
chr2_33581900_A_T_b38	RASGRP3	8.135	1.09e-14	0.272867	5	0.033543	yes	HRTAA
chr2_33581338_T_A_b38	RASGRP3	8.02	2.37e-14	0.271586	5	0.033863	yes	HRTAA
chr2_33616325_C_T_b38	RASGRP3	7.711	1.84e-13	0.267497	5	0.03469	yes	HRTAA
chr2_33605827_ATTTTTCT_A_b38	RASGRP3	7.645	2.82e-13	0.258516	5	0.033813	yes	HRTAA
chr2_33640513_G_C_b38	RASGRP3	7.343	1.97e-12	0.257446	4	0.035062	yes	HRTAA
chr2_33636858_C_G_b38	RASGRP3	7.254	3.45e-12	0.253382	5	0.03493	yes	HRTAA
chr2_33637736_A_T_b38	RASGRP3	7.254	3.45e-12	0.253382	5	0.03493	yes	HRTAA
chr2_33631243_G_GT_b38	RASGRP3	7.248	3.58e-12	0.261679	4	0.036104	yes	HRTAA
chr2_33537321_C_CA_b38	RASGRP3	7.243	3.7e-12	0.174614	45	0.024109	yes	HRTAA
chr2_33627793_A_G_b38	RASGRP3	7.101	8.98e-12	0.245773	5	0.034613	yes	HRTAA
chr2_33634524_A_G_b38	RASGRP3	6.968	2.03e-11	0.245273	5	0.035199	yes	HRTAA
chr2_33564467_A_G_b38	RASGRP3	6.932	2.53e-11	0.178058	46	0.025686	yes	HRTAA
chr2_33634816_G_T_b38	RASGRP3	6.916	2.78e-11	0.243287	5	0.035175	yes	HRTAA
chr2_33606703_C_T_b38	RASGRP3	6.887	3.32e-11	0.248205	5	0.036038	yes	HRTAA
chr2_33640631_A_C_b38	RASGRP3	6.879	3.49e-11	0.197231	15	0.02867	yes	HRTAA
chr2_33564001_C_G_b38	RASGRP3	6.78	6.33e-11	0.176085	44	0.02597	yes	HRTAA
chr2_33625315_G_A_b38	RASGRP3	6.655	1.34e-10	0.183038	23	0.027504	yes	HRTAA
chr2_33641397_G_C_b38	RASGRP3	6.649	1.38e-10	0.191752	15	0.028837	yes	HRTAA
chr2_33639021_G_A_b38	RASGRP3	6.633	1.53e-10	0.191879	15	0.028929	yes	HRTAA
chr2_33613720_G_A_b38	RASGRP3	6.482	3.71e-10	0.210198	10	0.03243	yes	HRTAA
chr2_33567745_C_T_b38	RASGRP3	-6.461	4.17e-10	-0.155148	49	0.024012	yes	HRTAA
chr2_33571267_T_A_b38	RASGRP3	-6.349	7.96e-10	-0.153059	53	0.024107	yes	HRTAA
chr2_33667549_A_G_b38	RASGRP3	6.337	8.56e-10	0.226471	5	0.035741	yes	HRTAA
chr2_33667555_A_G_b38	RASGRP3	6.337	8.56e-10	0.226471	5	0.035741	yes	HRTAA
chr2_33657078_T_C_b38	RASGRP3	6.321	9.33e-10	0.177518	24	0.028082	yes	HRTAA
chr2_33622160_C_T_b38	RASGRP3	6.321	9.33e-10	0.171549	29	0.027138	yes	HRTAA
chr2_33568339_TA_T_b38	RASGRP3	-6.32	9.43e-10	-0.150882	62	0.023875	yes	HRTAA
chr2_33572204_C_A_b38	RASGRP3	-6.256	1.35e-09	-0.153412	52	0.024522	yes	HRTAA
chr2_33569371_A_G_b38	RASGRP3	-6.252	1.39e-09	-0.152286	56	0.02436	yes	HRTAA
chr2_33659035_G_A_b38	RASGRP3	6.227	1.59e-09	0.226148	4	0.036316	yes	HRTAA
chr2_33650021_A_G_b38	RASGRP3	6.178	2.1e-09	0.179742	14	0.029093	yes	HRTAA
chr2_33652477_C_A_b38	RASGRP3	6.099	3.26e-09	0.177984	14	0.029181	yes	HRTAA
chr2_33656248_TTC_T_b38	RASGRP3	6.096	3.33e-09	0.177398	14	0.029103	yes	HRTAA
chr2_33571342_T_C_b38	RASGRP3	-6.076	3.72e-09	-0.149413	52	0.024591	yes	HRTAA
chr2_33575950_G_A_b38	RASGRP3	-6.014	5.23e-09	-0.148718	50	0.024727	yes	HRTAA
chr2_33656848_TA_T_b38	RASGRP3	6.002	5.61e-09	0.170311	19	0.028378	yes	HRTAA
chr2_33663555_T_C_b38	RASGRP3	5.989	6.01e-09	0.176487	14	0.029469	yes	HRTAA
chr2_33577889_G_A_b38	RASGRP3	-5.972	6.6e-09	-0.148851	49	0.024925	yes	HRTAA
chr2_33509399_C_CA_b38	RASGRP3	5.959	7.08e-09	0.199413	5	0.033463	yes	HRTAA
chr2_33624881_G_GT_b38	RASGRP3	5.956	7.19e-09	0.159277	28	0.026741	yes	HRTAA
chr2_33604404_G_GTA_b38	RASGRP3	5.88	1.09e-08	0.212321	4	0.036112	yes	HRTAA
chr2_33622592_T_C_b38	RASGRP3	5.874	1.12e-08	0.154026	36	0.02622	yes	HRTAA
chr2_33656916_G_A_b38	RASGRP3	5.83	1.43e-08	0.152991	32	0.026241	yes	HRTAA
chr2_33626436_A_T_b38	RASGRP3	5.779	1.88e-08	0.153906	30	0.026634	yes	HRTAA
chr2_33532487_C_A_b38	RASGRP3	5.773	1.94e-08	0.136609	77	0.023663	yes	HRTAA
chr2_33662459_C_T_b38	RASGRP3	5.702	2.83e-08	0.169122	14	0.029661	yes	HRTAA
chr2_33571586_T_C_b38	RASGRP3	-5.518	7.4e-08	-0.127901	69	0.023179	yes	HRTAA
chr2_33543901_C_G_b38	RASGRP3	-5.513	7.61e-08	-0.135349	51	0.024553	yes	HRTAA
chr2_33634843_C_CTT_b38	RASGRP3	5.43	1.17e-07	0.215627	6	0.039713	yes	HRTAA
chr2_33537323_G_A_b38	RASGRP3	5.409	1.29e-07	0.126673	79	0.023418	yes	HRTAA
chr2_33622130_C_CA_b38	RASGRP3	5.314	2.09e-07	0.209888	8	0.039499	yes	HRTAA
chr2_33620497_T_C_b38	RASGRP3	5.293	2.32e-07	0.156756	17	0.029614	yes	HRTAA
chr2_33670716_C_T_b38	RASGRP3	5.267	2.65e-07	0.146738	20	0.02786	yes	HRTAA
chr2_33637426_T_A_b38	RASGRP3	5.246	2.93e-07	0.159404	14	0.030385	yes	HRTAA
chr2_33661156_C_T_b38	RASGRP3	5.233	3.13e-07	0.147936	19	0.02827	yes	HRTAA
chr2_33661310_C_T_b38	RASGRP3	5.233	3.13e-07	0.147936	19	0.02827	yes	HRTAA
chr2_33672387_A_G_b38	RASGRP3	5.192	3.84e-07	0.163661	10	0.031523	yes	HRTAA
chr2_33623108_T_C_b38	RASGRP3	5.154	4.62e-07	0.134548	41	0.026106	yes	HRTAA
chr2_33547458_G_A_b38	RASGRP3	5.153	4.65e-07	0.119886	58	0.023266	yes	HRTAA
chr2_33621819_C_A_b38	RASGRP3	5.126	5.31e-07	0.132877	41	0.025923	yes	HRTAA
chr2_33512902_A_G_b38	RASGRP3	-5.116	5.57e-07	-0.123445	76	0.024129	yes	HRTAA
chr2_33561192_A_G_b38	RASGRP3	5.094	6.19e-07	0.120915	92	0.023736	yes	HRTAA
chr2_33588900_A_AT_b38	RASGRP3	-4.987	1.04e-06	-0.126335	75	0.025331	yes	HRTAA
chr2_33669574_A_G_b38	RASGRP3	4.952	1.23e-06	0.157053	9	0.031716	yes	HRTAA
chr2_33532718_G_A_b38	RASGRP3	4.93	1.36e-06	0.118701	76	0.024075	yes	HRTAA
chr2_33669427_A_C_b38	RASGRP3	4.907	1.52e-06	0.156985	9	0.03199	yes	HRTAA
chr2_33620575_G_A_b38	RASGRP3	4.881	1.71e-06	0.145253	17	0.029756	yes	HRTAA
chr2_33749131_A_G_b38	RASGRP3	4.766	2.93e-06	0.188208	5	0.039492	yes	HRTAA
chr2_33530852_CT_C_b38	RASGRP3	4.668	4.59e-06	0.112156	79	0.024028	yes	HRTAA
chr2_33647765_T_C_b38	RASGRP3	-4.554	7.65e-06	-0.107821	89	0.023676	yes	HRTAA
chr2_33539996_AAAAAG_A_b38	RASGRP3	-4.552	7.71e-06	-0.107603	87	0.023637	yes	HRTAA
chr2_33641120_T_C_b38	RASGRP3	-4.539	8.19e-06	-0.108602	86	0.023928	yes	HRTAA
chr2_33593131_C_T_b38	RASGRP3	-4.538	8.22e-06	-0.108356	83	0.023878	yes	HRTAA
chr2_33586449_C_G_b38	RASGRP3	-4.522	8.83e-06	-0.108089	83	0.023904	yes	HRTAA
chr2_33575832_C_A_b38	RASGRP3	-4.513	9.16e-06	-0.109037	85	0.024159	yes	HRTAA
chr2_33592492_A_G_b38	RASGRP3	-4.512	9.22e-06	-0.109067	83	0.024173	yes	HRTAA
chr2_33589523_A_G_b38	RASGRP3	-4.5	9.74e-06	-0.107725	85	0.023941	yes	HRTAA
chr2_33597253_G_A_b38	RASGRP3	-4.494	9.98e-06	-0.10884	80	0.024219	yes	HRTAA
chr2_33554839_T_C_b38	RASGRP3	4.426	1.34e-05	0.10584	61	0.023913	yes	HRTAA
chr2_33655786_T_C_b38	RASGRP3	-4.352	1.85e-05	-0.104811	80	0.024082	yes	HRTAA
chr2_33605951_T_C_b38	RASGRP3	-4.342	1.93e-05	-0.103943	81	0.023937	yes	HRTAA
chr2_33577835_T_C_b38	RASGRP3	-4.335	1.99e-05	-0.104641	83	0.02414	yes	HRTAA
chr2_33590404_A_G_b38	RASGRP3	-4.327	2.06e-05	-0.104141	83	0.024067	yes	HRTAA
chr2_33518880_G_GTCA_b38	RASGRP3	-4.32	2.12e-05	-0.108509	67	0.025116	yes	HRTAA
chr2_33638203_CT_C_b38	RASGRP3	4.305	2.26e-05	0.172091	5	0.039971	yes	HRTAA
chr2_33661861_G_A_b38	RASGRP3	-4.277	2.55e-05	-0.101993	87	0.023849	yes	HRTAA
chr2_33520141_T_C_b38	RASGRP3	-4.26	2.73e-05	-0.105475	66	0.024758	yes	HRTAA
chr2_33580247_A_G_b38	RASGRP3	-4.254	2.8e-05	-0.10375	82	0.024387	yes	HRTAA
chr2_33664871_G_GT_b38	RASGRP3	-4.16	4.16e-05	-0.101113	86	0.024308	yes	HRTAA
chr2_33658757_C_A_b38	RASGRP3	-4.15	4.34e-05	-0.100799	74	0.024292	yes	HRTAA
chr2_33576389_C_T_b38	RASGRP3	-4.123	4.85e-05	-0.101129	81	0.02453	yes	HRTAA
chr2_33660983_C_T_b38	RASGRP3	-4.11	5.1e-05	-0.099768	76	0.024272	yes	HRTAA
chr2_33655774_A_G_b38	RASGRP3	-4.106	5.2e-05	-0.098075	88	0.023888	yes	HRTAA
chr2_33738746_A_C_b38	RASGRP3	4.097	5.38e-05	0.144882	3	0.035359	yes	HRTAA
chr2_33659127_A_G_b38	RASGRP3	-4.06	6.25e-05	-0.096231	98	0.023699	yes	HRTAA
chr2_33673146_T_C_b38	RASGRP3	-4.054	6.41e-05	-0.094892	90	0.023405	yes	HRTAA
chr2_33536322_GA_G_b38	RASGRP3	-4.03	7.07e-05	-0.101428	67	0.025168	yes	HRTAA
chr2_33663649_A_C_b38	RASGRP3	-4.027	7.16e-05	-0.095666	97	0.023756	yes	HRTAA
chr2_33658713_G_A_b38	RASGRP3	-3.99	8.3e-05	-0.095946	82	0.024047	yes	HRTAA
chr2_33548381_A_AAAG_b38	RASGRP3	3.983	8.54e-05	0.133889	13	0.033614	yes	HRTAA
chr2_33519891_C_T_b38	RASGRP3	-3.982	8.57e-05	-0.097173	55	0.024403	yes	HRTAA
chr2_33617107_G_A_b38	RASGRP3	-3.982	8.58e-05	-0.095459	72	0.023974	yes	HRTAA
chr2_33607748_A_G_b38	RASGRP3	-3.961	9.33e-05	-0.094933	71	0.023967	yes	HRTAA
chr2_33662442_T_C_b38	RASGRP3	-3.956	9.51e-05	-0.094617	85	0.023917	yes	HRTAA
chr2_33661731_A_G_b38	RASGRP3	-3.892	0.000122	-0.092236	98	0.023697	yes	HRTAA
chr2_33540861_TA_T_b38	RASGRP3	-3.888	0.000125	-0.090343	61	0.023238	yes	HRTAA
chr2_33664465_T_A_b38	RASGRP3	-3.882	0.000127	-0.092644	93	0.023865	yes	HRTAA
chr2_33567211_TA_T_b38	RASGRP3	-3.882	0.000127	-0.106923	45	0.027544	yes	HRTAA
chr2_33664742_G_C_b38	RASGRP3	-3.859	0.000139	-0.092129	96	0.023874	yes	HRTAA
chr2_33615675_TA_T_b38	RASGRP3	-3.846	0.000147	-0.092405	72	0.024029	yes	HRTAA
chr2_33618669_C_CT_b38	RASGRP3	-3.827	0.000158	-0.092191	72	0.024091	yes	HRTAA
chr2_33614957_G_A_b38	RASGRP3	-3.822	0.000161	-0.091795	70	0.024018	yes	HRTAA
chr2_33625063_ATCT_A_b38	RASGRP3	-3.818	0.000163	-0.09165	70	0.024002	yes	HRTAA
chr2_33669621_C_T_b38	RASGRP3	-3.814	0.000166	-0.094495	69	0.024775	yes	HRTAA
chr2_33669751_C_T_b38	RASGRP3	-3.814	0.000166	-0.094495	69	0.024775	yes	HRTAA
chr2_33669785_CA_C_b38	RASGRP3	-3.806	0.000171	-0.095662	60	0.025136	yes	HRTAA
chr2_33670200_G_T_b38	RASGRP3	-3.795	0.000178	-0.093824	69	0.024722	yes	HRTAA
chr2_33625060_G_A_b38	RASGRP3	-3.782	0.000187	-0.088548	78	0.023411	yes	HRTAA
chr2_33618734_A_G_b38	RASGRP3	-3.769	0.000197	-0.090879	71	0.024112	yes	HRTAA
chr2_33668515_A_G_b38	RASGRP3	-3.711	0.000246	-0.089033	86	0.023994	yes	HRTAA
chr2_33658170_A_G_b38	RASGRP3	-3.704	0.000252	-0.089335	83	0.024115	yes	HRTAA
chr2_33764518_G_GTT_b38	RASGRP3	3.703	0.000254	0.158016	5	0.042675	yes	HRTAA
chr2_33666591_A_G_b38	RASGRP3	-3.669	0.000288	-0.087865	94	0.023949	yes	HRTAA
chr2_33511010_G_A_b38	RASGRP3	3.648	0.000311	0.163632	5	0.04485	yes	HRTAA
chr2_33514230_T_G_b38	RASGRP3	3.63	0.000333	0.116143	14	0.031993	yes	HRTAA
chr2_33508652_C_G_b38	RASGRP3	3.62	0.000345	0.096782	47	0.026732	yes	HRTAA
chr2_33622456_T_TAAAC_b38	RASGRP3	-3.616	0.000351	-0.087547	73	0.024212	yes	HRTAA
chr2_34047405_C_T_b38	RASGRP3	3.608	0.000361	0.288168	3	0.079872	yes	HRTAA
chr2_33530497_CT_C_b38	RASGRP3	3.588	0.000389	0.108856	12	0.030338	yes	HRTAA
chr2_33655112_A_AT_b38	RASGRP3	-3.524	0.000492	-0.088559	75	0.025133	yes	HRTAA
chr2_34050036_G_C_b38	RASGRP3	3.505	0.000526	0.276795	3	0.078967	yes	HRTAA
chr2_33630364_C_G_b38	RASGRP3	-3.504	0.000528	-0.083361	74	0.023789	yes	HRTAA
chr2_33678762_C_CACTT_b38	RASGRP3	-3.499	0.000537	-0.085899	84	0.024549	yes	HRTAA
chr2_33622130_CA_C_b38	RASGRP3	-3.496	0.000544	-0.09426	36	0.026965	yes	HRTAA
chr2_33631637_C_A_b38	RASGRP3	-3.475	0.000586	-0.082651	76	0.023785	yes	HRTAA
chr2_33508487_T_C_b38	RASGRP3	3.469	0.000599	0.148365	8	0.042769	yes	HRTAA
chr2_33613986_T_C_b38	RASGRP3	-3.459	0.000621	-0.084098	73	0.024313	yes	HRTAA
chr2_33625433_A_C_b38	RASGRP3	-3.453	0.000633	-0.08368	71	0.024232	yes	HRTAA
chr2_33631863_T_C_b38	RASGRP3	-3.453	0.000635	-0.079259	99	0.022957	yes	HRTAA
chr2_33631185_T_G_b38	RASGRP3	-3.426	0.000698	-0.079132	99	0.023098	yes	HRTAA
chr2_33629277_A_G_b38	RASGRP3	-3.426	0.000698	-0.080137	81	0.023391	yes	HRTAA
chr2_33786599_C_T_b38	RASGRP3	-3.391	0.00079	-0.081755	93	0.024111	yes	HRTAA
chr2_33674183_T_C_b38	RASGRP3	-3.382	0.000814	-0.083928	69	0.024813	yes	HRTAA
chr2_33624514_C_A_b38	RASGRP3	-3.38	0.00082	-0.079035	79	0.023383	yes	HRTAA
chr2_33675020_C_G_b38	RASGRP3	-3.369	0.000854	-0.08312	68	0.024675	yes	HRTAA
chr2_33546150_G_A_b38	RASGRP3	-3.354	9e-04	-0.08534	49	0.025448	yes	HRTAA
chr2_33534694_A_AT_b38	RASGRP3	3.344	0.000929	0.098981	20	0.029595	yes	HRTAA
chr2_32924686_G_A_b38	RASGRP3	-3.34	0.000944	-0.145019	6	0.043421	yes	HRTAA
chr2_32930801_C_T_b38	RASGRP3	-3.34	0.000944	-0.145019	6	0.043421	yes	HRTAA
chr2_33673921_C_G_b38	RASGRP3	-3.333	0.000968	-0.08214	77	0.024648	yes	HRTAA
chr2_32930443_G_A_b38	RASGRP3	-3.329	0.000978	-0.14241	7	0.042772	yes	HRTAA
chr2_33679032_C_G_b38	RASGRP3	-3.318	0.00102	-0.082065	74	0.024733	yes	HRTAA
chr2_33591195_C_CT_b38	RASGRP3	-3.309	0.00105	-0.090309	46	0.027294	yes	HRTAA
chr2_33661940_T_G_b38	RASGRP3	-3.308	0.00105	-0.084639	88	0.025589	yes	HRTAA
chr2_33673112_G_T_b38	RASGRP3	-3.285	0.00114	-0.08372	89	0.025488	yes	HRTAA
chr2_32935366_A_T_b38	RASGRP3	-3.284	0.00115	-0.142688	6	0.043453	yes	HRTAA
chr2_32940428_C_G_b38	RASGRP3	-3.284	0.00115	-0.142688	6	0.043453	yes	HRTAA
chr2_32949862_C_T_b38	RASGRP3	-3.284	0.00115	-0.142688	6	0.043453	yes	HRTAA
chr2_33562245_G_C_b38	RASGRP3	-3.252	0.00128	-0.082932	50	0.025501	yes	HRTAA
chr2_33782986_A_C_b38	RASGRP3	-3.242	0.00132	-0.07925	93	0.024444	yes	HRTAA
chr2_33534062_A_C_b38	RASGRP3	-3.209	0.00147	-0.105735	10	0.032947	yes	HRTAA
chr2_33539219_T_C_b38	RASGRP3	-3.203	0.0015	-0.081145	53	0.025332	yes	HRTAA
chr2_33632169_T_C_b38	RASGRP3	-3.202	0.00151	-0.077786	70	0.024296	yes	HRTAA
chr2_33779853_G_A_b38	RASGRP3	-3.2	0.00152	-0.078805	94	0.024624	yes	HRTAA
chr2_33780726_C_A_b38	RASGRP3	-3.2	0.00152	-0.078805	94	0.024624	yes	HRTAA
chr2_33781201_G_C_b38	RASGRP3	-3.2	0.00152	-0.078805	94	0.024624	yes	HRTAA
chr2_33631252_G_T_b38	RASGRP3	3.184	0.0016	0.079657	93	0.025016	yes	HRTAA
chr2_33777074_A_G_b38	RASGRP3	-3.182	0.00161	-0.077974	95	0.024504	yes	HRTAA
chr2_33532968_G_A_b38	RASGRP3	-3.155	0.00177	-0.105732	10	0.033509	yes	HRTAA
chr2_33778798_T_C_b38	RASGRP3	-3.148	0.00181	-0.07728	95	0.02455	yes	HRTAA
chr2_33788893_A_G_b38	RASGRP3	3.138	0.00187	0.077136	49	0.024585	yes	HRTAA
chr2_33543280_C_G_b38	RASGRP3	-3.118	0.002	-0.10314	10	0.033084	yes	HRTAA
chr2_34091931_A_ACACC_b38	RASGRP3	-3.115	0.00202	-0.116214	5	0.037311	yes	HRTAA
chr2_33538452_G_A_b38	RASGRP3	-3.107	0.00207	-0.10347	10	0.033306	yes	HRTAA
chr2_33426889_G_A_b38	RASGRP3	3.091	0.00218	0.107326	8	0.034723	yes	HRTAA
chr2_33534694_ATT_A_b38	RASGRP3	-3.084	0.00223	-0.118221	3	0.038334	yes	HRTAA
chr2_33786410_A_G_b38	RASGRP3	-3.081	0.00225	-0.075224	90	0.024414	yes	HRTAA
chr2_33601956_TA_T_b38	RASGRP3	3.075	0.0023	0.080145	82	0.026062	yes	HRTAA
chr2_33758557_G_A_b38	RASGRP3	-3.068	0.00235	-0.078076	44	0.025449	yes	HRTAA
chr2_33427776_C_CTTT_b38	RASGRP3	3.06	0.00241	0.201532	4	0.06585	yes	HRTAA
chr2_33534328_C_T_b38	RASGRP3	-3.041	0.00257	-0.10104	10	0.033228	yes	HRTAA
chr2_33726787_AAGAG_A_b38	RASGRP3	3.033	0.00263	0.081294	29	0.026806	yes	HRTAA
chr2_33545200_T_C_b38	RASGRP3	-3.029	0.00267	-0.096949	14	0.032012	yes	HRTAA
chr2_33534496_G_A_b38	RASGRP3	-3.028	0.00268	-0.100489	10	0.033188	yes	HRTAA
chr2_34160601_TCA_T_b38	RASGRP3	3.025	0.0027	0.112634	5	0.037234	yes	HRTAA
chr2_33553788_G_A_b38	RASGRP3	-3.021	0.00274	-0.096681	14	0.032004	yes	HRTAA
chr2_33556856_G_C_b38	RASGRP3	-3.021	0.00274	-0.096681	14	0.032004	yes	HRTAA
chr2_33676027_A_T_b38	RASGRP3	-3.015	0.00279	-0.075074	76	0.024904	yes	HRTAA
chr2_33509059_T_G_b38	RASGRP3	-3.009	0.00284	-0.086469	21	0.028734	yes	HRTAA
chr2_33249323_T_TCA_b38	RASGRP3	3.009	0.00284	0.120658	6	0.040102	yes	HRTAA
chr2_33533388_C_T_b38	RASGRP3	-3.004	0.00289	-0.095647	13	0.031839	yes	HRTAA
chr2_33677515_A_G_b38	RASGRP3	3.004	0.00289	0.108079	6	0.035978	yes	HRTAA
chr2_33774195_T_C_b38	RASGRP3	-2.962	0.0033	-0.070936	89	0.023945	yes	HRTAA
chr2_33758452_A_G_b38	RASGRP3	-2.961	0.00331	-0.074966	44	0.025314	yes	HRTAA
chr2_32854515_T_C_b38	RASGRP3	-2.956	0.00336	-0.086205	21	0.029159	yes	HRTAA
chr2_33550119_G_T_b38	RASGRP3	-2.951	0.00342	-0.094552	14	0.032046	yes	HRTAA
chr2_33539434_T_C_b38	RASGRP3	-2.946	0.00347	-0.075568	50	0.025651	yes	HRTAA
chr2_33550598_T_G_b38	RASGRP3	-2.946	0.00347	-0.0946	14	0.032112	yes	HRTAA
chr2_33563592_T_TAACA_b38	RASGRP3	-2.922	0.00374	-0.07709	36	0.026378	yes	HRTAA
chr2_33681193_TTA_T_b38	RASGRP3	-2.92	0.00377	-0.073033	49	0.025014	yes	HRTAA
chr2_33775996_C_A_b38	RASGRP3	-2.917	0.0038	-0.070205	89	0.024066	yes	HRTAA
chr2_33535555_G_GC_b38	RASGRP3	-2.914	0.00384	-0.094611	11	0.032471	yes	HRTAA
chr2_33601810_T_C_b38	RASGRP3	-2.912	0.00385	-0.072221	93	0.024797	yes	HRTAA
chr2_33536207_C_T_b38	RASGRP3	-2.907	0.00392	-0.074536	49	0.025638	yes	HRTAA
chr2_32447551_G_T_b38	RASGRP3	2.904	0.00396	0.094032	5	0.032382	yes	HRTAA
chr2_33551040_C_T_b38	RASGRP3	-2.904	0.00396	-0.091219	15	0.031415	yes	HRTAA
chr2_33716284_C_T_b38	RASGRP3	-2.894	0.00408	-0.067103	75	0.023185	yes	HRTAA
chr2_33533272_T_C_b38	RASGRP3	-2.892	0.00411	-0.0929	13	0.032126	yes	HRTAA
chr2_33527085_G_T_b38	RASGRP3	-2.885	0.00419	-0.083743	19	0.029023	yes	HRTAA
chr2_33548698_A_AATTATT_b38	RASGRP3	-2.884	0.00421	-0.092415	14	0.032046	yes	HRTAA
chr2_33525080_C_CA_b38	RASGRP3	-2.882	0.00424	-0.092433	13	0.032072	yes	HRTAA
chr2_33539642_C_G_b38	RASGRP3	-2.876	0.00431	-0.073707	49	0.025624	yes	HRTAA
chr2_33549383_C_T_b38	RASGRP3	-2.876	0.00432	-0.092477	14	0.032157	yes	HRTAA
chr2_33582793_C_G_b38	RASGRP3	2.866	0.00445	0.072657	42	0.025351	yes	HRTAA
chr2_33715851_G_A_b38	RASGRP3	-2.863	0.00449	-0.066029	82	0.02306	yes	HRTAA
chr2_33546473_C_T_b38	RASGRP3	-2.855	0.0046	-0.090043	14	0.031534	yes	HRTAA
chr2_33521739_T_A_b38	RASGRP3	2.848	0.0047	0.080819	20	0.028375	yes	HRTAA
chr2_33715095_C_G_b38	RASGRP3	-2.83	0.00496	-0.065218	82	0.023042	yes	HRTAA
chr2_32839940_G_A_b38	RASGRP3	-2.827	0.00501	-0.10669	4	0.037735	yes	HRTAA
chr2_33539436_C_G_b38	RASGRP3	-2.822	0.00509	-0.072599	49	0.025724	yes	HRTAA
chr2_34107252_C_A_b38	RASGRP3	2.818	0.00516	0.106045	7	0.037638	yes	HRTAA
chr2_33770643_T_C_b38	RASGRP3	-2.814	0.00522	-0.071331	46	0.025349	yes	HRTAA
chr2_33758105_T_A_b38	RASGRP3	-2.811	0.00526	-0.072	43	0.025613	yes	HRTAA
chr2_33758169_T_C_b38	RASGRP3	-2.811	0.00526	-0.072	43	0.025613	yes	HRTAA
chr2_33758243_C_T_b38	RASGRP3	-2.811	0.00526	-0.072	43	0.025613	yes	HRTAA
chr2_33523846_A_G_b38	RASGRP3	-2.807	0.00533	-0.078128	23	0.027833	yes	HRTAA
chr2_34106235_C_A_b38	RASGRP3	2.794	0.00555	0.106536	7	0.038134	yes	HRTAA
chr2_33792413_CAGG_C_b38	RASGRP3	2.79	0.00561	0.112335	5	0.040268	yes	HRTAA
chr2_33730302_T_C_b38	RASGRP3	-2.788	0.00564	-0.064516	83	0.023141	yes	HRTAA
chr2_33529261_A_G_b38	RASGRP3	2.785	0.00569	0.080374	17	0.028856	yes	HRTAA
chr2_34292399_TTCTCTCTC_T_b38	RASGRP3	2.781	0.00577	0.069457	83	0.02498	yes	HRTAA
chr2_34357401_C_G_b38	RASGRP3	2.778	0.00581	0.182037	4	0.065518	yes	HRTAA
chr2_33546347_C_G_b38	RASGRP3	-2.774	0.00588	-0.088003	14	0.031724	yes	HRTAA
chr2_32902717_C_T_b38	RASGRP3	-2.773	0.00591	-0.124435	4	0.04488	yes	HRTAA
chr2_33525341_AAT_A_b38	RASGRP3	-2.771	0.00594	-0.0904	10	0.032627	yes	HRTAA
chr2_33758633_A_G_b38	RASGRP3	-2.763	0.00608	-0.069043	46	0.024989	yes	HRTAA
chr2_33537323_G_C_b38	RASGRP3	-2.756	0.00621	-0.073302	35	0.026596	yes	HRTAA
chr2_33718935_G_A_b38	RASGRP3	-2.755	0.00622	-0.064881	77	0.023548	yes	HRTAA
chr2_33764518_G_GTTTT_b38	RASGRP3	-2.755	0.00623	-0.082461	22	0.029931	yes	HRTAA
chr2_33528012_T_G_b38	RASGRP3	-2.748	0.00636	-0.07826	21	0.02848	yes	HRTAA
chr2_34095498_G_A_b38	RASGRP3	-2.748	0.00636	-0.094187	11	0.034279	yes	HRTAA
chr2_33478322_G_A_b38	RASGRP3	2.747	0.00638	0.095004	7	0.034587	yes	HRTAA
chr2_33758476_T_G_b38	RASGRP3	-2.739	0.00652	-0.069215	51	0.025268	yes	HRTAA
chr2_33767220_GAA_G_b38	RASGRP3	-2.735	0.0066	-0.069839	45	0.025532	yes	HRTAA
chr2_33522498_A_G_b38	RASGRP3	2.735	0.00661	0.077766	20	0.028434	yes	HRTAA
chr2_33565010_T_TAC_b38	RASGRP3	-2.733	0.00665	-0.079726	17	0.029171	yes	HRTAA
chr2_33587735_T_A_b38	RASGRP3	2.732	0.00667	0.068858	43	0.025204	yes	HRTAA
chr2_34116509_TTTTC_T_b38	RASGRP3	2.723	0.00684	0.230658	3	0.084705	yes	HRTAA
chr2_33769285_C_A_b38	RASGRP3	-2.72	0.0069	-0.068784	46	0.025285	yes	HRTAA
chr2_33647687_C_CA_b38	RASGRP3	2.718	0.00695	0.08167	21	0.030046	yes	HRTAA
chr2_33228066_A_G_b38	RASGRP3	2.71	0.00712	0.169468	3	0.062538	yes	HRTAA
chr2_33767410_A_C_b38	RASGRP3	-2.706	0.00721	-0.068898	46	0.025465	yes	HRTAA
chr2_33765535_C_T_b38	RASGRP3	-2.703	0.00727	-0.068743	46	0.025434	yes	HRTAA
chr2_33765648_T_C_b38	RASGRP3	-2.703	0.00727	-0.068743	46	0.025434	yes	HRTAA
chr2_33766277_T_C_b38	RASGRP3	-2.703	0.00727	-0.068743	46	0.025434	yes	HRTAA
chr2_33766488_G_A_b38	RASGRP3	-2.703	0.00727	-0.068743	46	0.025434	yes	HRTAA
chr2_33766502_A_C_b38	RASGRP3	-2.703	0.00727	-0.068743	46	0.025434	yes	HRTAA
chr2_33766946_G_A_b38	RASGRP3	-2.703	0.00727	-0.068743	46	0.025434	yes	HRTAA
chr2_33722403_G_T_b38	RASGRP3	-2.7	0.00732	-0.062821	77	0.023267	yes	HRTAA
chr2_33770662_T_C_b38	RASGRP3	-2.694	0.00745	-0.068849	45	0.025552	yes	HRTAA
chr2_33679576_G_T_b38	RASGRP3	2.691	0.00752	0.099018	4	0.036793	yes	HRTAA
chr2_33758156_C_T_b38	RASGRP3	-2.69	0.00755	-0.068708	43	0.025544	yes	HRTAA
chr2_33727554_G_A_b38	RASGRP3	-2.678	0.00781	-0.063004	83	0.023526	yes	HRTAA
chr2_32834104_T_C_b38	RASGRP3	-2.676	0.00786	-0.067663	57	0.025286	yes	HRTAA
chr2_33566210_A_C_b38	RASGRP3	-2.671	0.00798	-0.075753	25	0.028364	yes	HRTAA
chr2_33476758_C_CGTGTGT_b38	RASGRP3	2.667	0.00806	0.079982	16	0.029986	yes	HRTAA
chr2_33515788_C_T_b38	RASGRP3	-2.667	0.00806	-0.088235	11	0.033082	yes	HRTAA
chr2_33538430_G_C_b38	RASGRP3	-2.653	0.0084	-0.087828	10	0.033105	yes	HRTAA
chr2_32534576_C_G_b38	RASGRP3	2.652	0.00843	0.067203	48	0.025342	yes	HRTAA
chr2_33552018_CAAACAAACA_C_b38	RASGRP3	-2.65	0.00848	-0.085163	14	0.032141	yes	HRTAA
chr2_33719248_A_G_b38	RASGRP3	-2.645	0.00861	-0.062364	74	0.023582	yes	HRTAA
chr2_33767897_C_T_b38	RASGRP3	-2.638	0.00878	-0.067132	46	0.025452	yes	HRTAA
chr2_33762557_G_C_b38	RASGRP3	-2.637	0.0088	-0.067697	44	0.025672	yes	HRTAA
chr2_33762665_A_G_b38	RASGRP3	-2.637	0.0088	-0.067697	44	0.025672	yes	HRTAA
chr2_33763206_C_T_b38	RASGRP3	-2.637	0.0088	-0.067697	44	0.025672	yes	HRTAA
chr2_33765637_C_G_b38	RASGRP3	-2.637	0.0088	-0.067697	44	0.025672	yes	HRTAA
chr2_33765984_G_C_b38	RASGRP3	-2.637	0.0088	-0.067697	44	0.025672	yes	HRTAA
chr2_33768109_G_C_b38	RASGRP3	-2.637	0.0088	-0.067697	44	0.025672	yes	HRTAA
chr2_32751258_CCACACA_C_b38	RASGRP3	-2.631	0.00894	-0.090822	7	0.034515	yes	HRTAA
chr2_33596444_C_T_b38	RASGRP3	-2.629	0.00901	-0.078969	18	0.030041	yes	HRTAA
chr2_34094910_TTATA_T_b38	RASGRP3	2.621	0.00921	0.083491	20	0.031851	yes	HRTAA
chr2_33764131_T_C_b38	RASGRP3	-2.62	0.00923	-0.065899	47	0.025151	yes	HRTAA
chr2_33522519_T_C_b38	RASGRP3	-2.615	0.00938	-0.067487	51	0.025811	yes	HRTAA
chr2_33529319_G_C_b38	RASGRP3	-2.612	0.00945	-0.067725	50	0.025929	yes	HRTAA
chr2_32987992_C_T_b38	RASGRP3	-2.608	0.00955	-0.115317	5	0.04421	yes	HRTAA
chr2_33716180_T_C_b38	RASGRP3	-2.607	0.00958	-0.060485	86	0.023198	yes	HRTAA
chr2_33642139_G_T_b38	RASGRP3	2.602	0.00971	0.087589	9	0.033656	yes	HRTAA
chr2_33522218_G_A_b38	RASGRP3	2.599	0.0098	0.073835	20	0.028405	yes	HRTAA
chr2_32930447_A_ACGCG_b38	RASGRP3	-2.597	0.00985	-0.120821	5	0.046516	yes	HRTAA
chr2_33768906_G_C_b38	RASGRP3	-2.596	0.00989	-0.066524	44	0.025623	yes	HRTAA
chr2_33766447_A_G_b38	RASGRP3	-2.593	0.00999	-0.065435	47	0.02524	yes	HRTAA
chr2_33531453_C_T_b38	RASGRP3	16.851	2.46e-45	0.490943	3	0.029135	no	HRTAA
chr2_33529269_C_A_b38	RASGRP3	15.866	1.28e-41	0.474809	3	0.029926	no	HRTAA
chr2_33540561_TGTGTGTGTGTG_T_b38	RASGRP3	13.529	6.62e-33	0.399008	10	0.029492	no	HRTAA
chr2_33512177_G_A_b38	RASGRP3	8.666	2.79e-16	0.273637	9	0.031574	no	HRTAA
chr2_33556928_C_CACACACATACAT_b38	RASGRP3	8.373	2.15e-15	0.293223	3	0.035018	no	HRTAA
chr2_33523461_TA_T_b38	RASGRP3	6.139	2.62e-09	0.202212	5	0.03294	no	HRTAA
chr2_33518114_A_G_b38	RASGRP3	-4.613	5.89e-06	-0.112335	47	0.024354	no	HRTAA
chr2_33512820_T_A_b38	RASGRP3	-4.406	1.47e-05	-0.105351	52	0.023911	no	HRTAA
chr2_33548381_A_AAAAAG_b38	RASGRP3	4.401	1.5e-05	0.173564	9	0.039436	no	HRTAA
chr2_33540888_T_C_b38	RASGRP3	-4.314	2.18e-05	-0.096362	89	0.022337	no	HRTAA
chr2_33541741_G_T_b38	RASGRP3	-4.314	2.18e-05	-0.096362	89	0.022337	no	HRTAA
chr2_33787907_A_G_b38	RASGRP3	4.303	2.28e-05	0.156923	9	0.036466	no	HRTAA
chr2_33539533_G_T_b38	RASGRP3	-4.186	3.73e-05	-0.093995	90	0.022454	no	HRTAA
chr2_33514489_T_C_b38	RASGRP3	-4.065	6.15e-05	-0.093278	64	0.022949	no	HRTAA
chr2_33771977_TC_T_b38	RASGRP3	4.018	7.43e-05	0.144865	10	0.036057	no	HRTAA
chr2_33771916_C_T_b38	RASGRP3	3.997	8.08e-05	0.1398	13	0.034978	no	HRTAA
chr2_33771954_G_T_b38	RASGRP3	3.997	8.08e-05	0.1398	13	0.034978	no	HRTAA
chr2_33540615_TTCTC_T_b38	RASGRP3	-3.866	0.000136	-0.094668	66	0.024488	no	HRTAA
chr2_33515662_T_C_b38	RASGRP3	3.846	0.000147	0.135002	10	0.035106	no	HRTAA
chr2_33720623_ATGCGATT_A_b38	RASGRP3	3.812	0.000168	0.134926	5	0.0354	no	HRTAA
chr2_33721079_C_CGT_b38	RASGRP3	3.759	0.000205	0.134005	5	0.035653	no	HRTAA
chr2_33563089_C_T_b38	RASGRP3	3.747	0.000215	0.097228	30	0.025949	no	HRTAA
chr2_33721262_A_T_b38	RASGRP3	3.593	0.000382	0.137274	4	0.038207	no	HRTAA
chr2_33721524_A_G_b38	RASGRP3	3.593	0.000382	0.137274	4	0.038207	no	HRTAA
chr2_33723360_C_A_b38	RASGRP3	3.593	0.000382	0.137274	4	0.038207	no	HRTAA
chr2_33673961_G_A_b38	RASGRP3	-3.549	0.000448	-0.088049	68	0.024809	no	HRTAA
chr2_33673967_T_A_b38	RASGRP3	-3.549	0.000448	-0.088049	68	0.024809	no	HRTAA
chr2_33540561_TGTGTGTGTGTGTGTGTG_T_b38	RASGRP3	-3.432	0.000683	-0.086434	56	0.025186	no	HRTAA
chr2_33556190_G_A_b38	RASGRP3	-3.344	0.000932	-0.085079	48	0.025446	no	HRTAA
chr2_33753914_G_T_b38	RASGRP3	3.298	0.00109	0.115877	9	0.035136	no	HRTAA
chr2_33772378_C_T_b38	RASGRP3	3.209	0.00148	0.122251	3	0.038099	no	HRTAA
chr2_33556890_T_TACACACACAC_b38	RASGRP3	-3.175	0.00165	-0.146755	4	0.046215	no	HRTAA
chr2_33630302_AT_A_b38	RASGRP3	-3.155	0.00177	-0.079275	79	0.025127	no	HRTAA
chr2_33563588_C_T_b38	RASGRP3	-3.145	0.00183	-0.081126	47	0.025795	no	HRTAA
chr2_33725605_A_AT_b38	RASGRP3	3.103	0.0021	0.120487	8	0.038833	no	HRTAA
chr2_32943744_G_A_b38	RASGRP3	-3.102	0.0021	-0.132214	7	0.042623	no	HRTAA
chr2_33726462_A_AT_b38	RASGRP3	3.045	0.00253	0.105839	5	0.034755	no	HRTAA
chr2_32751258_C_CCA_b38	RASGRP3	3.043	0.00255	0.086724	22	0.028497	no	HRTAA
chr2_33790659_C_T_b38	RASGRP3	3.036	0.00261	0.073531	56	0.024219	no	HRTAA
chr2_33721982_T_C_b38	RASGRP3	3.008	0.00285	0.117593	4	0.039089	no	HRTAA
chr2_33559094_G_A_b38	RASGRP3	-3.002	0.00291	-0.080666	33	0.026873	no	HRTAA
chr2_33559433_G_A_b38	RASGRP3	-3.002	0.00291	-0.080666	33	0.026873	no	HRTAA
chr2_33816796_C_CT_b38	RASGRP3	2.995	0.00297	0.253344	3	0.08458	no	HRTAA
chr2_32819863_G_C_b38	RASGRP3	-2.971	0.0032	-0.118422	3	0.039853	no	HRTAA
chr2_33569651_CA_C_b38	RASGRP3	-2.942	0.00351	-0.092113	27	0.031309	no	HRTAA
chr2_32929177_T_TAA_b38	RASGRP3	-2.914	0.00383	-0.135289	3	0.046419	no	HRTAA
chr2_33678193_G_A_b38	RASGRP3	-2.911	0.00388	-0.07484	55	0.025712	no	HRTAA
chr2_33676624_C_T_b38	RASGRP3	-2.902	0.00399	-0.07462	56	0.025716	no	HRTAA
chr2_33733508_C_T_b38	RASGRP3	-2.884	0.00421	-0.08955	14	0.031049	no	HRTAA
chr2_32508276_C_CTTTT_b38	RASGRP3	2.859	0.00455	0.246763	3	0.08631	no	HRTAA
chr2_33537330_C_CCCA_b38	RASGRP3	-2.854	0.00461	-0.110403	8	0.038678	no	HRTAA
chr2_33556890_T_TACAC_b38	RASGRP3	-2.853	0.00463	-0.093221	11	0.032675	no	HRTAA
chr2_32798102_T_TAA_b38	RASGRP3	-2.847	0.00472	-0.101757	5	0.035743	no	HRTAA
chr2_33540553_GTT_G_b38	RASGRP3	2.842	0.00479	0.067242	57	0.02366	no	HRTAA
chr2_32826941_A_G_b38	RASGRP3	-2.836	0.00488	-0.10793	5	0.03806	no	HRTAA
chr2_32800823_C_G_b38	RASGRP3	-2.836	0.00488	-0.101382	7	0.035752	no	HRTAA
chr2_33561322_C_T_b38	RASGRP3	-2.828	0.00499	-0.092616	13	0.032746	no	HRTAA
chr2_33714153_T_TA_b38	RASGRP3	2.822	0.0051	0.106447	5	0.037726	no	HRTAA
chr2_33544520_G_GA_b38	RASGRP3	-2.781	0.00576	-0.074181	43	0.026675	no	HRTAA
chr2_32799782_A_G_b38	RASGRP3	-2.742	0.00647	-0.098546	7	0.035937	no	HRTAA
chr2_32871832_T_TAGAA_b38	RASGRP3	-2.736	0.00659	-0.079294	36	0.028985	no	HRTAA
chr2_33714976_C_T_b38	RASGRP3	2.734	0.00663	0.100086	5	0.036608	no	HRTAA
chr2_33545336_G_A_b38	RASGRP3	-2.717	0.00696	-0.086734	13	0.031919	no	HRTAA
chr2_32805642_G_A_b38	RASGRP3	-2.709	0.00713	-0.096023	7	0.035443	no	HRTAA
chr2_33535124_A_G_b38	RASGRP3	-2.687	0.00761	-0.143395	3	0.053369	no	HRTAA
chr2_33520269_T_C_b38	RASGRP3	2.679	0.0078	0.079182	19	0.029561	no	HRTAA
chr2_33548717_A_T_b38	RASGRP3	-2.677	0.00783	-0.067524	52	0.025223	no	HRTAA
chr2_33604404_GTATATA_G_b38	RASGRP3	-2.673	0.00793	-0.09917	3	0.037101	no	HRTAA
chr2_34360667_G_A_b38	RASGRP3	2.664	0.00813	0.098054	12	0.036801	no	HRTAA
chr2_32728037_C_CT_b38	RASGRP3	-2.655	0.00835	-0.110368	9	0.041569	no	HRTAA
chr2_34119227_G_A_b38	RASGRP3	2.655	0.00835	0.195751	4	0.073729	no	HRTAA
chr2_33285035_C_CTTT_b38	RASGRP3	2.598	0.00985	0.20624	4	0.079393	no	HRTAA
chr2_33546942_C_G_b38	RASGRP3	10.733	4.13e-23	0.294758	4	0.027462	yes	HRTLV
chr2_33529318_C_T_b38	RASGRP3	8.696	1.94e-16	0.20777	8	0.023894	yes	HRTLV
chr2_33512177_G_A_b38	RASGRP3	8.657	2.54e-16	0.222123	8	0.025658	yes	HRTLV
chr2_33525341_A_AAT_b38	RASGRP3	8.266	3.91e-15	0.188823	13	0.022843	yes	HRTLV
chr2_33561445_C_A_b38	RASGRP3	8.136	9.54e-15	0.195406	10	0.024017	yes	HRTLV
chr2_33523649_G_A_b38	RASGRP3	7.241	3.44e-12	0.179751	10	0.024825	yes	HRTLV
chr2_33561192_A_G_b38	RASGRP3	7.071	9.98e-12	0.129345	92	0.018293	yes	HRTLV
chr2_33555164_G_A_b38	RASGRP3	7.058	1.08e-11	0.176248	9	0.02497	yes	HRTLV
chr2_33659035_G_A_b38	RASGRP3	6.912	2.65e-11	0.219383	4	0.031738	yes	HRTLV
chr2_33586869_A_T_b38	RASGRP3	6.751	7.06e-11	0.164585	13	0.024379	yes	HRTLV
chr2_33667549_A_G_b38	RASGRP3	6.747	7.23e-11	0.21776	4	0.032273	yes	HRTLV
chr2_33667555_A_G_b38	RASGRP3	6.747	7.23e-11	0.21776	4	0.032273	yes	HRTLV
chr2_33631243_G_GT_b38	RASGRP3	6.604	1.7e-10	0.208805	4	0.031616	yes	HRTLV
chr2_33532487_C_A_b38	RASGRP3	6.546	2.39e-10	0.119838	85	0.018306	yes	HRTLV
chr2_33640513_G_C_b38	RASGRP3	6.413	5.2e-10	0.202373	4	0.031554	yes	HRTLV
chr2_33565263_A_G_b38	RASGRP3	6.366	6.85e-10	0.153912	20	0.024177	yes	HRTLV
chr2_33537323_G_A_b38	RASGRP3	6.303	9.85e-10	0.106265	87	0.01686	yes	HRTLV
chr2_33634816_G_T_b38	RASGRP3	6.296	1.02e-09	0.199804	4	0.031735	yes	HRTLV
chr2_33627793_A_G_b38	RASGRP3	6.268	1.2e-09	0.197236	4	0.031465	yes	HRTLV
chr2_33663555_T_C_b38	RASGRP3	6.258	1.27e-09	0.153342	11	0.024504	yes	HRTLV
chr2_33662459_C_T_b38	RASGRP3	6.219	1.59e-09	0.152602	11	0.024537	yes	HRTLV
chr2_33652477_C_A_b38	RASGRP3	6.099	3.12e-09	0.149494	11	0.024511	yes	HRTLV
chr2_33634524_A_G_b38	RASGRP3	6.086	3.36e-09	0.1948	4	0.032008	yes	HRTLV
chr2_33636858_C_G_b38	RASGRP3	6.086	3.36e-09	0.1948	4	0.032008	yes	HRTLV
chr2_33637736_A_T_b38	RASGRP3	6.086	3.36e-09	0.1948	4	0.032008	yes	HRTLV
chr2_33650021_A_G_b38	RASGRP3	6.055	3.98e-09	0.147556	11	0.024368	yes	HRTLV
chr2_33581561_C_T_b38	RASGRP3	6.039	4.36e-09	0.146984	13	0.024338	yes	HRTLV
chr2_33616325_C_T_b38	RASGRP3	6.037	4.42e-09	0.194468	4	0.032214	yes	HRTLV
chr2_33596963_A_T_b38	RASGRP3	6.029	4.61e-09	0.144944	15	0.024041	yes	HRTLV
chr2_33596450_T_G_b38	RASGRP3	6.022	4.79e-09	0.135698	22	0.022532	yes	HRTLV
chr2_33582025_C_T_b38	RASGRP3	6.021	4.82e-09	0.147221	12	0.024451	yes	HRTLV
chr2_33657078_T_C_b38	RASGRP3	6	5.42e-09	0.136353	21	0.022726	yes	HRTLV
chr2_33590881_T_C_b38	RASGRP3	5.975	6.21e-09	0.136408	20	0.022829	yes	HRTLV
chr2_33589264_G_C_b38	RASGRP3	5.949	7.16e-09	0.134948	21	0.022683	yes	HRTLV
chr2_33605827_ATTTTTCT_A_b38	RASGRP3	5.869	1.11e-08	0.181196	4	0.030876	yes	HRTLV
chr2_33508652_C_G_b38	RASGRP3	5.864	1.14e-08	0.117749	44	0.020081	yes	HRTLV
chr2_33672387_A_G_b38	RASGRP3	5.69	2.91e-08	0.157774	9	0.02773	yes	HRTLV
chr2_33563965_A_G_b38	RASGRP3	5.616	4.3e-08	0.172718	3	0.030756	yes	HRTLV
chr2_33669574_A_G_b38	RASGRP3	5.61	4.44e-08	0.15663	8	0.027921	yes	HRTLV
chr2_33669427_A_C_b38	RASGRP3	5.599	4.7e-08	0.157123	8	0.028064	yes	HRTLV
chr2_33581900_A_T_b38	RASGRP3	5.568	5.53e-08	0.17229	3	0.030945	yes	HRTLV
chr2_33581338_T_A_b38	RASGRP3	5.439	1.08e-07	0.168736	3	0.031025	yes	HRTLV
chr2_33535943_T_C_b38	RASGRP3	-5.379	1.47e-07	-0.134671	9	0.025038	yes	HRTLV
chr2_33515788_C_T_b38	RASGRP3	-5.366	1.56e-07	-0.139846	9	0.026061	yes	HRTLV
chr2_33525341_AAT_A_b38	RASGRP3	-5.36	1.61e-07	-0.135615	8	0.025302	yes	HRTLV
chr2_33622160_C_T_b38	RASGRP3	5.347	1.72e-07	0.117587	23	0.021993	yes	HRTLV
chr2_33564001_C_G_b38	RASGRP3	5.329	1.89e-07	0.112941	40	0.021194	yes	HRTLV
chr2_33613720_G_A_b38	RASGRP3	5.318	1.99e-07	0.155274	7	0.029197	yes	HRTLV
chr2_33670716_C_T_b38	RASGRP3	5.27	2.54e-07	0.12306	16	0.023351	yes	HRTLV
chr2_33606703_C_T_b38	RASGRP3	5.266	2.58e-07	0.173666	4	0.032976	yes	HRTLV
chr2_33530852_CT_C_b38	RASGRP3	5.262	2.64e-07	0.098718	79	0.01876	yes	HRTLV
chr2_33525080_C_CA_b38	RASGRP3	-5.239	2.97e-07	-0.125079	15	0.023876	yes	HRTLV
chr2_33523461_TA_T_b38	RASGRP3	5.232	3.06e-07	0.137365	3	0.026253	yes	HRTLV
chr2_33621819_C_A_b38	RASGRP3	5.185	3.88e-07	0.109084	30	0.021039	yes	HRTLV
chr2_33532968_G_A_b38	RASGRP3	-5.179	3.99e-07	-0.136051	8	0.026271	yes	HRTLV
chr2_33532718_G_A_b38	RASGRP3	5.153	4.53e-07	0.09833	77	0.019082	yes	HRTLV
chr2_33535555_G_GC_b38	RASGRP3	-5.148	4.64e-07	-0.131188	9	0.025482	yes	HRTLV
chr2_33534062_A_C_b38	RASGRP3	-5.105	5.74e-07	-0.130382	8	0.025541	yes	HRTLV
chr2_33564467_A_G_b38	RASGRP3	5.064	6.99e-07	0.106944	41	0.021117	yes	HRTLV
chr2_33623108_T_C_b38	RASGRP3	5.041	7.81e-07	0.108127	29	0.021448	yes	HRTLV
chr2_33538430_G_C_b38	RASGRP3	-4.958	1.16e-06	-0.127495	8	0.025713	yes	HRTLV
chr2_33543280_C_G_b38	RASGRP3	-4.905	1.5e-06	-0.127767	8	0.026046	yes	HRTLV
chr2_33622130_C_CA_b38	RASGRP3	4.899	1.54e-06	0.154873	10	0.031611	yes	HRTLV
chr2_33562267_C_CT_b38	RASGRP3	4.896	1.56e-06	0.092342	65	0.01886	yes	HRTLV
chr2_33661156_C_T_b38	RASGRP3	4.856	1.89e-06	0.115638	15	0.023815	yes	HRTLV
chr2_33661310_C_T_b38	RASGRP3	4.856	1.89e-06	0.115638	15	0.023815	yes	HRTLV
chr2_33534328_C_T_b38	RASGRP3	-4.843	2.01e-06	-0.126245	8	0.026067	yes	HRTLV
chr2_33533272_T_C_b38	RASGRP3	-4.817	2.27e-06	-0.123311	10	0.025599	yes	HRTLV
chr2_33538452_G_A_b38	RASGRP3	-4.805	2.4e-06	-0.125397	8	0.026096	yes	HRTLV
chr2_33533388_C_T_b38	RASGRP3	-4.785	2.64e-06	-0.122601	10	0.025624	yes	HRTLV
chr2_33509399_C_CA_b38	RASGRP3	4.74	3.24e-06	0.136073	4	0.028705	yes	HRTLV
chr2_33620497_T_C_b38	RASGRP3	4.686	4.16e-06	0.124405	11	0.026551	yes	HRTLV
chr2_33620575_G_A_b38	RASGRP3	4.65	4.89e-06	0.123416	11	0.02654	yes	HRTLV
chr2_33530497_CT_C_b38	RASGRP3	4.578	6.76e-06	0.112989	9	0.024679	yes	HRTLV
chr2_33604404_G_GTA_b38	RASGRP3	4.573	6.92e-06	0.141129	4	0.030862	yes	HRTLV
chr2_33534496_G_A_b38	RASGRP3	-4.537	8.11e-06	-0.118259	8	0.026063	yes	HRTLV
chr2_33622592_T_C_b38	RASGRP3	4.535	8.21e-06	0.099137	28	0.021862	yes	HRTLV
chr2_33509059_T_G_b38	RASGRP3	-4.531	8.35e-06	-0.100744	22	0.022235	yes	HRTLV
chr2_33548698_A_AATTATT_b38	RASGRP3	-4.515	8.97e-06	-0.110096	13	0.024387	yes	HRTLV
chr2_33523846_A_G_b38	RASGRP3	-4.51	9.17e-06	-0.100048	24	0.022185	yes	HRTLV
chr2_33549383_C_T_b38	RASGRP3	-4.419	1.37e-05	-0.108418	13	0.024535	yes	HRTLV
chr2_33550598_T_G_b38	RASGRP3	-4.419	1.37e-05	-0.108418	13	0.024535	yes	HRTLV
chr2_33512820_T_A_b38	RASGRP3	-4.408	1.43e-05	-0.088335	46	0.02004	yes	HRTLV
chr2_33518114_A_G_b38	RASGRP3	-4.388	1.57e-05	-0.090803	40	0.020695	yes	HRTLV
chr2_33545200_T_C_b38	RASGRP3	-4.355	1.81e-05	-0.106753	13	0.024515	yes	HRTLV
chr2_33550119_G_T_b38	RASGRP3	-4.318	2.11e-05	-0.105819	13	0.024506	yes	HRTLV
chr2_33553788_G_A_b38	RASGRP3	-4.318	2.11e-05	-0.105819	13	0.024506	yes	HRTLV
chr2_33556856_G_C_b38	RASGRP3	-4.318	2.11e-05	-0.105819	13	0.024506	yes	HRTLV
chr2_33551040_C_T_b38	RASGRP3	-4.318	2.11e-05	-0.106255	13	0.024607	yes	HRTLV
chr2_33527085_G_T_b38	RASGRP3	-4.277	2.52e-05	-0.098938	19	0.023135	yes	HRTLV
chr2_33656916_G_A_b38	RASGRP3	4.217	3.24e-05	0.092813	28	0.02201	yes	HRTLV
chr2_33634843_C_CTT_b38	RASGRP3	4.216	3.25e-05	0.146813	5	0.034823	yes	HRTLV
chr2_33626436_A_T_b38	RASGRP3	4.179	3.79e-05	0.092585	25	0.022153	yes	HRTLV
chr2_33624881_G_GT_b38	RASGRP3	4.132	4.62e-05	0.092671	23	0.02243	yes	HRTLV
chr2_33546473_C_T_b38	RASGRP3	-4.097	5.33e-05	-0.099708	13	0.024337	yes	HRTLV
chr2_33552018_CAAACAAACA_C_b38	RASGRP3	-4.094	5.39e-05	-0.100938	13	0.024654	yes	HRTLV
chr2_33522958_T_C_b38	RASGRP3	-4.089	5.49e-05	-0.125478	4	0.030683	yes	HRTLV
chr2_33545336_G_A_b38	RASGRP3	-4.089	5.5e-05	-0.101343	11	0.024784	yes	HRTLV
chr2_33561322_C_T_b38	RASGRP3	-4.079	5.73e-05	-0.102199	12	0.025053	yes	HRTLV
chr2_33511010_G_A_b38	RASGRP3	4.065	6.08e-05	0.151163	3	0.037189	yes	HRTLV
chr2_33563470_A_ATACT_b38	RASGRP3	-4.014	7.46e-05	-0.118912	6	0.029623	yes	HRTLV
chr2_33514489_T_C_b38	RASGRP3	-4.005	7.75e-05	-0.078478	53	0.019596	yes	HRTLV
chr2_33546347_C_G_b38	RASGRP3	-3.993	8.13e-05	-0.097491	13	0.024417	yes	HRTLV
chr2_33537417_G_A_b38	RASGRP3	-3.892	0.000121	-0.093245	14	0.023956	yes	HRTLV
chr2_33663649_A_C_b38	RASGRP3	-3.89	0.000122	-0.075149	97	0.01932	yes	HRTLV
chr2_33664465_T_A_b38	RASGRP3	-3.857	0.000139	-0.075074	94	0.019465	yes	HRTLV
chr2_33659127_A_G_b38	RASGRP3	-3.837	0.00015	-0.073557	100	0.01917	yes	HRTLV
chr2_33528012_T_G_b38	RASGRP3	-3.807	0.000169	-0.085931	23	0.022571	yes	HRTLV
chr2_33529859_CA_C_b38	RASGRP3	-3.8	0.000174	-0.092069	13	0.02423	yes	HRTLV
chr2_33512902_A_G_b38	RASGRP3	-3.783	0.000185	-0.077215	69	0.020411	yes	HRTLV
chr2_33537323_G_C_b38	RASGRP3	-3.747	0.000213	-0.074359	40	0.019847	yes	HRTLV
chr2_33758476_T_G_b38	RASGRP3	-3.729	0.000228	-0.078563	48	0.021068	yes	HRTLV
chr2_33518880_G_GTCA_b38	RASGRP3	-3.69	0.000264	-0.075988	63	0.020591	yes	HRTLV
chr2_33771916_C_T_b38	RASGRP3	3.645	0.000312	0.105016	12	0.028809	yes	HRTLV
chr2_33771954_G_T_b38	RASGRP3	3.645	0.000312	0.105016	12	0.028809	yes	HRTLV
chr2_33758452_A_G_b38	RASGRP3	-3.636	0.000323	-0.076725	43	0.021102	yes	HRTLV
chr2_33666591_A_G_b38	RASGRP3	-3.635	0.000325	-0.07119	95	0.019587	yes	HRTLV
chr2_33661861_G_A_b38	RASGRP3	-3.625	0.000336	-0.070134	92	0.019345	yes	HRTLV
chr2_33664742_G_C_b38	RASGRP3	-3.621	0.000342	-0.07072	96	0.01953	yes	HRTLV
chr2_33661731_A_G_b38	RASGRP3	-3.614	0.000351	-0.069566	99	0.019248	yes	HRTLV
chr2_33567745_C_T_b38	RASGRP3	-3.574	0.000407	-0.072318	52	0.020237	yes	HRTLV
chr2_33477936_C_T_b38	RASGRP3	3.571	0.000411	0.081022	17	0.022686	yes	HRTLV
chr2_33508487_T_C_b38	RASGRP3	3.567	0.000418	0.12866	7	0.036073	yes	HRTLV
chr2_33758105_T_A_b38	RASGRP3	-3.562	0.000425	-0.075716	42	0.021257	yes	HRTLV
chr2_33758169_T_C_b38	RASGRP3	-3.562	0.000425	-0.075716	42	0.021257	yes	HRTLV
chr2_33758243_C_T_b38	RASGRP3	-3.562	0.000425	-0.075716	42	0.021257	yes	HRTLV
chr2_33771977_TC_T_b38	RASGRP3	3.553	0.000439	0.105406	9	0.029667	yes	HRTLV
chr2_33758557_G_A_b38	RASGRP3	-3.546	0.000451	-0.075049	43	0.021166	yes	HRTLV
chr2_33653353_CATCT_C_b38	RASGRP3	-3.541	0.00046	-0.10192	8	0.028786	yes	HRTLV
chr2_33519891_C_T_b38	RASGRP3	-3.523	0.000491	-0.070432	53	0.019995	yes	HRTLV
chr2_33476758_C_CGTGCGT_b38	RASGRP3	-3.483	0.000566	-0.098343	6	0.028234	yes	HRTLV
chr2_33664871_G_GT_b38	RASGRP3	-3.464	0.000607	-0.068655	89	0.019822	yes	HRTLV
chr2_33758633_A_G_b38	RASGRP3	-3.453	0.00063	-0.071017	46	0.020566	yes	HRTLV
chr2_33539996_AAAAAG_A_b38	RASGRP3	-3.451	0.000636	-0.069055	83	0.020013	yes	HRTLV
chr2_33669621_C_T_b38	RASGRP3	-3.438	0.000665	-0.068421	71	0.019902	yes	HRTLV
chr2_33669751_C_T_b38	RASGRP3	-3.438	0.000665	-0.068421	71	0.019902	yes	HRTLV
chr2_33670200_G_T_b38	RASGRP3	-3.422	0.000703	-0.067857	72	0.019828	yes	HRTLV
chr2_33758156_C_T_b38	RASGRP3	-3.416	0.000718	-0.071909	43	0.021048	yes	HRTLV
chr2_33563038_A_G_b38	RASGRP3	-3.384	0.000803	-0.0913	9	0.026977	yes	HRTLV
chr2_33547053_GAAAAAA_G_b38	RASGRP3	-3.361	0.000873	-0.084974	10	0.025284	yes	HRTLV
chr2_33802615_A_G_b38	RASGRP3	-3.354	0.000895	-0.098072	7	0.029243	yes	HRTLV
chr2_33519413_A_G_b38	RASGRP3	-3.345	0.000922	-0.070392	33	0.021042	yes	HRTLV
chr2_33637426_T_A_b38	RASGRP3	3.342	0.000932	0.088029	11	0.026339	yes	HRTLV
chr2_33760998_A_T_b38	RASGRP3	-3.33	0.000973	-0.064847	58	0.019475	yes	HRTLV
chr2_33477612_G_T_b38	RASGRP3	-3.326	0.000984	-0.064063	90	0.019259	yes	HRTLV
chr2_33658170_A_G_b38	RASGRP3	-3.307	0.00105	-0.06394	89	0.019333	yes	HRTLV
chr2_33765535_C_T_b38	RASGRP3	-3.295	0.0011	-0.069349	45	0.021045	yes	HRTLV
chr2_33765648_T_C_b38	RASGRP3	-3.295	0.0011	-0.069349	45	0.021045	yes	HRTLV
chr2_33766277_T_C_b38	RASGRP3	-3.295	0.0011	-0.069349	45	0.021045	yes	HRTLV
chr2_33766488_G_A_b38	RASGRP3	-3.295	0.0011	-0.069349	45	0.021045	yes	HRTLV
chr2_33766502_A_C_b38	RASGRP3	-3.295	0.0011	-0.069349	45	0.021045	yes	HRTLV
chr2_33766946_G_A_b38	RASGRP3	-3.295	0.0011	-0.069349	45	0.021045	yes	HRTLV
chr2_33767410_A_C_b38	RASGRP3	-3.276	0.00117	-0.069317	45	0.021157	yes	HRTLV
chr2_33767897_C_T_b38	RASGRP3	-3.276	0.00117	-0.069317	45	0.021157	yes	HRTLV
chr2_33662442_T_C_b38	RASGRP3	-3.266	0.00121	-0.062784	91	0.019226	yes	HRTLV
chr2_33768312_A_C_b38	RASGRP3	-3.249	0.00128	-0.068913	45	0.021211	yes	HRTLV
chr2_33769488_A_G_b38	RASGRP3	-3.249	0.00128	-0.068913	45	0.021211	yes	HRTLV
chr2_33534694_A_AT_b38	RASGRP3	3.247	0.00129	0.074831	21	0.023046	yes	HRTLV
chr2_33753865_C_T_b38	RASGRP3	-3.243	0.00131	-0.068694	38	0.021184	yes	HRTLV
chr2_33754448_T_C_b38	RASGRP3	-3.237	0.00134	-0.06913	43	0.021356	yes	HRTLV
chr2_33658713_G_A_b38	RASGRP3	-3.226	0.00139	-0.062505	88	0.019377	yes	HRTLV
chr2_33571267_T_A_b38	RASGRP3	-3.225	0.00139	-0.063582	60	0.019713	yes	HRTLV
chr2_33647765_T_C_b38	RASGRP3	-3.22	0.00142	-0.060777	94	0.018875	yes	HRTLV
chr2_33668515_A_G_b38	RASGRP3	-3.218	0.00143	-0.062224	91	0.019338	yes	HRTLV
chr2_33769285_C_A_b38	RASGRP3	-3.199	0.00152	-0.067857	45	0.021209	yes	HRTLV
chr2_33756220_C_T_b38	RASGRP3	-3.192	0.00156	-0.067966	42	0.021292	yes	HRTLV
chr2_33569371_A_G_b38	RASGRP3	-3.188	0.00158	-0.063915	63	0.020051	yes	HRTLV
chr2_33766447_A_G_b38	RASGRP3	-3.187	0.00158	-0.066107	46	0.020744	yes	HRTLV
chr2_33515662_T_C_b38	RASGRP3	3.177	0.00163	0.092147	8	0.029003	yes	HRTLV
chr2_33677515_A_G_b38	RASGRP3	3.176	0.00164	0.092427	6	0.029102	yes	HRTLV
chr2_33655774_A_G_b38	RASGRP3	-3.173	0.00166	-0.061127	92	0.019262	yes	HRTLV
chr2_33754928_G_A_b38	RASGRP3	-3.173	0.00166	-0.067919	42	0.021408	yes	HRTLV
chr2_33755461_G_T_b38	RASGRP3	-3.173	0.00166	-0.067919	42	0.021408	yes	HRTLV
chr2_33641120_T_C_b38	RASGRP3	-3.169	0.00168	-0.060024	91	0.018939	yes	HRTLV
chr2_33762665_A_G_b38	RASGRP3	-3.165	0.0017	-0.067445	43	0.021308	yes	HRTLV
chr2_33726667_C_G_b38	RASGRP3	3.144	0.00183	0.090374	5	0.028748	yes	HRTLV
chr2_33764131_T_C_b38	RASGRP3	-3.141	0.00184	-0.065217	46	0.020761	yes	HRTLV
chr2_33768405_T_A_b38	RASGRP3	-3.138	0.00186	-0.065535	46	0.020886	yes	HRTLV
chr2_33768709_T_C_b38	RASGRP3	-3.138	0.00186	-0.065535	46	0.020886	yes	HRTLV
chr2_33568339_TA_T_b38	RASGRP3	-3.134	0.00189	-0.063007	64	0.020107	yes	HRTLV
chr2_33655112_A_AT_b38	RASGRP3	-3.126	0.00194	-0.062529	79	0.020004	yes	HRTLV
chr2_33660983_C_T_b38	RASGRP3	-3.123	0.00196	-0.060436	85	0.019354	yes	HRTLV
chr2_33572204_C_A_b38	RASGRP3	-3.122	0.00196	-0.062074	60	0.019884	yes	HRTLV
chr2_33762557_G_C_b38	RASGRP3	-3.101	0.0021	-0.066172	43	0.021336	yes	HRTLV
chr2_33763206_C_T_b38	RASGRP3	-3.101	0.0021	-0.066172	43	0.021336	yes	HRTLV
chr2_33765637_C_G_b38	RASGRP3	-3.101	0.0021	-0.066172	43	0.021336	yes	HRTLV
chr2_33765984_G_C_b38	RASGRP3	-3.101	0.0021	-0.066172	43	0.021336	yes	HRTLV
chr2_33768109_G_C_b38	RASGRP3	-3.101	0.0021	-0.066172	43	0.021336	yes	HRTLV
chr2_33575950_G_A_b38	RASGRP3	-3.09	0.00218	-0.06183	57	0.020013	yes	HRTLV
chr2_33772378_C_T_b38	RASGRP3	3.087	0.0022	0.097148	4	0.031467	yes	HRTLV
chr2_32798102_T_TAA_b38	RASGRP3	-3.086	0.00221	-0.089074	4	0.028862	yes	HRTLV
chr2_33631185_T_G_b38	RASGRP3	-3.082	0.00224	-0.057971	100	0.018808	yes	HRTLV
chr2_33446098_C_T_b38	RASGRP3	-3.08	0.00225	-0.061075	53	0.019827	yes	HRTLV
chr2_33762650_T_A_b38	RASGRP3	-3.08	0.00226	-0.063922	47	0.020757	yes	HRTLV
chr2_33658757_C_A_b38	RASGRP3	-3.079	0.00226	-0.060025	82	0.019494	yes	HRTLV
chr2_33765440_G_A_b38	RASGRP3	-3.078	0.00227	-0.065596	44	0.02131	yes	HRTLV
chr2_33767629_C_T_b38	RASGRP3	-3.078	0.00227	-0.065596	44	0.02131	yes	HRTLV
chr2_33767683_T_G_b38	RASGRP3	-3.078	0.00227	-0.065596	44	0.02131	yes	HRTLV
chr2_33767692_TCAGAA_T_b38	RASGRP3	-3.078	0.00227	-0.065596	44	0.02131	yes	HRTLV
chr2_33768002_T_C_b38	RASGRP3	-3.078	0.00227	-0.065596	44	0.02131	yes	HRTLV
chr2_33496862_G_C_b38	RASGRP3	3.076	0.00228	0.071832	19	0.023354	yes	HRTLV
chr2_33770643_T_C_b38	RASGRP3	-3.074	0.0023	-0.065408	44	0.021278	yes	HRTLV
chr2_33485510_G_A_b38	RASGRP3	3.071	0.00232	0.071112	15	0.023156	yes	HRTLV
chr2_33767664_G_A_b38	RASGRP3	-3.065	0.00237	-0.065056	45	0.021228	yes	HRTLV
chr2_33577889_G_A_b38	RASGRP3	-3.059	0.00241	-0.061785	56	0.020196	yes	HRTLV
chr2_33768906_G_C_b38	RASGRP3	-3.056	0.00244	-0.065302	43	0.021369	yes	HRTLV
chr2_33476343_C_T_b38	RASGRP3	3.052	0.00247	0.062328	43	0.020423	yes	HRTLV
chr2_33763276_A_C_b38	RASGRP3	-3.035	0.0026	-0.06274	47	0.020671	yes	HRTLV
chr2_33763677_T_C_b38	RASGRP3	-3.035	0.0026	-0.06274	47	0.020671	yes	HRTLV
chr2_33765176_T_A_b38	RASGRP3	-3.035	0.0026	-0.06274	47	0.020671	yes	HRTLV
chr2_33543901_C_G_b38	RASGRP3	-3.027	0.00267	-0.060272	51	0.019909	yes	HRTLV
chr2_33756434_A_G_b38	RASGRP3	-3.014	0.00279	-0.062725	46	0.02081	yes	HRTLV
chr2_33631863_T_C_b38	RASGRP3	-3.01	0.00282	-0.056646	101	0.018817	yes	HRTLV
chr2_33597253_G_A_b38	RASGRP3	-3.006	0.00286	-0.058404	87	0.01943	yes	HRTLV
chr2_33571342_T_C_b38	RASGRP3	-3	0.00292	-0.059242	61	0.019751	yes	HRTLV
chr2_33765693_G_A_b38	RASGRP3	-2.996	0.00295	-0.062638	45	0.020909	yes	HRTLV
chr2_33764585_G_A_b38	RASGRP3	-2.995	0.00296	-0.061575	48	0.020556	yes	HRTLV
chr2_33760824_A_AT_b38	RASGRP3	-2.994	0.00297	-0.064148	44	0.021423	yes	HRTLV
chr2_33769074_A_G_b38	RASGRP3	-2.988	0.00303	-0.062242	47	0.02083	yes	HRTLV
chr2_33501543_C_T_b38	RASGRP3	2.982	0.00308	0.072035	17	0.024154	yes	HRTLV
chr2_33772197_A_T_b38	RASGRP3	-2.982	0.00308	-0.061123	46	0.020495	yes	HRTLV
chr2_33622130_CA_C_b38	RASGRP3	-2.981	0.0031	-0.064623	37	0.021679	yes	HRTLV
chr2_33777074_A_G_b38	RASGRP3	-2.977	0.00313	-0.061172	94	0.020545	yes	HRTLV
chr2_33655786_T_C_b38	RASGRP3	-2.976	0.00315	-0.057562	86	0.019342	yes	HRTLV
chr2_33180454_GT_G_b38	RASGRP3	-2.964	0.00327	-0.066178	45	0.02233	yes	HRTLV
chr2_33520141_T_C_b38	RASGRP3	-2.959	0.00332	-0.058796	65	0.019869	yes	HRTLV
chr2_33625433_A_C_b38	RASGRP3	-2.95	0.00342	-0.057024	73	0.019331	yes	HRTLV
chr2_33768747_A_G_b38	RASGRP3	-2.945	0.00347	-0.061991	45	0.021049	yes	HRTLV
chr2_33779853_G_A_b38	RASGRP3	-2.936	0.00357	-0.060132	93	0.020484	yes	HRTLV
chr2_33780726_C_A_b38	RASGRP3	-2.936	0.00357	-0.060132	93	0.020484	yes	HRTLV
chr2_33781201_G_C_b38	RASGRP3	-2.936	0.00357	-0.060132	93	0.020484	yes	HRTLV
chr2_33669785_CA_C_b38	RASGRP3	-2.924	0.00371	-0.058168	66	0.019895	yes	HRTLV
chr2_33625063_ATCT_A_b38	RASGRP3	-2.92	0.00375	-0.056125	72	0.019222	yes	HRTLV
chr2_33588900_A_AT_b38	RASGRP3	-2.918	0.00377	-0.061285	78	0.021001	yes	HRTLV
chr2_33580247_A_G_b38	RASGRP3	-2.912	0.00385	-0.056519	92	0.01941	yes	HRTLV
chr2_33782986_A_C_b38	RASGRP3	-2.904	0.00395	-0.05982	93	0.0206	yes	HRTLV
chr2_33765389_GT_G_b38	RASGRP3	-2.885	0.00418	-0.062261	41	0.02158	yes	HRTLV
chr2_33592492_A_G_b38	RASGRP3	-2.875	0.00432	-0.055694	92	0.019372	yes	HRTLV
chr2_33678762_C_CACTT_b38	RASGRP3	-2.86	0.00451	-0.056279	87	0.019675	yes	HRTLV
chr2_33778798_T_C_b38	RASGRP3	-2.853	0.00462	-0.058325	93	0.020447	yes	HRTLV
chr2_33764670_T_A_b38	RASGRP3	-2.844	0.00475	-0.059231	46	0.020827	yes	HRTLV
chr2_33576389_C_T_b38	RASGRP3	-2.836	0.00486	-0.055523	90	0.019575	yes	HRTLV
chr2_33774195_T_C_b38	RASGRP3	-2.829	0.00497	-0.056512	88	0.019975	yes	HRTLV
chr2_33461856_C_T_b38	RASGRP3	-2.802	0.0054	-0.066614	17	0.023776	yes	HRTLV
chr2_33625060_G_A_b38	RASGRP3	-2.799	0.00544	-0.053457	80	0.019097	yes	HRTLV
chr2_33514230_T_G_b38	RASGRP3	2.789	0.0056	0.076379	11	0.027381	yes	HRTLV
chr2_33775996_C_A_b38	RASGRP3	-2.782	0.00574	-0.055763	87	0.020048	yes	HRTLV
chr2_33630364_C_G_b38	RASGRP3	-2.777	0.00582	-0.053008	76	0.01909	yes	HRTLV
chr2_33590404_A_G_b38	RASGRP3	-2.762	0.00609	-0.053311	92	0.019305	yes	HRTLV
chr2_32805642_G_A_b38	RASGRP3	-2.754	0.00623	-0.077528	6	0.028152	yes	HRTLV
chr2_33673146_T_C_b38	RASGRP3	-2.752	0.00627	-0.052271	94	0.018996	yes	HRTLV
chr2_33471417_G_A_b38	RASGRP3	-2.744	0.00642	-0.064232	18	0.02341	yes	HRTLV
chr2_33456904_A_AT_b38	RASGRP3	-2.733	0.00662	-0.05397	87	0.019745	yes	HRTLV
chr2_33781569_A_AGT_b38	RASGRP3	-2.728	0.00673	-0.066576	13	0.024405	yes	HRTLV
chr2_33786410_A_G_b38	RASGRP3	-2.726	0.00676	-0.055707	93	0.020433	yes	HRTLV
chr2_33577835_T_C_b38	RASGRP3	-2.711	0.00708	-0.052579	93	0.019394	yes	HRTLV
chr2_33706431_C_G_b38	RASGRP3	-2.699	0.00733	-0.088259	4	0.032701	yes	HRTLV
chr2_32805458_T_G_b38	RASGRP3	-2.689	0.00755	-0.082631	4	0.030729	yes	HRTLV
chr2_33462930_G_A_b38	RASGRP3	-2.678	0.00781	-0.063859	16	0.02385	yes	HRTLV
chr2_33461719_G_A_b38	RASGRP3	-2.668	0.00804	-0.063282	17	0.023723	yes	HRTLV
chr2_33738746_A_C_b38	RASGRP3	2.665	0.0081	0.073067	5	0.02742	yes	HRTLV
chr2_33631637_C_A_b38	RASGRP3	-2.65	0.00844	-0.050707	77	0.019131	yes	HRTLV
chr2_33790659_C_T_b38	RASGRP3	2.646	0.00856	0.052551	54	0.019863	yes	HRTLV
chr2_33586449_C_G_b38	RASGRP3	-2.644	0.00859	-0.051483	91	0.019469	yes	HRTLV
chr2_33589523_A_G_b38	RASGRP3	-2.642	0.00866	-0.051291	94	0.019414	yes	HRTLV
chr2_33463160_G_A_b38	RASGRP3	-2.642	0.00866	-0.06298	16	0.02384	yes	HRTLV
chr2_32798407_A_G_b38	RASGRP3	-2.637	0.00877	-0.079753	4	0.030238	yes	HRTLV
chr2_33679032_C_G_b38	RASGRP3	-2.636	0.00879	-0.052155	77	0.019783	yes	HRTLV
chr2_33788893_A_G_b38	RASGRP3	2.636	0.0088	0.05418	46	0.020551	yes	HRTLV
chr2_33575832_C_A_b38	RASGRP3	-2.633	0.00888	-0.051163	96	0.019431	yes	HRTLV
chr2_33593131_C_T_b38	RASGRP3	-2.627	0.00904	-0.051177	91	0.019482	yes	HRTLV
chr2_33536322_GA_G_b38	RASGRP3	-2.625	0.00908	-0.052908	81	0.020155	yes	HRTLV
chr2_33456354_ATTCT_A_b38	RASGRP3	-2.624	0.00912	-0.053159	56	0.020261	yes	HRTLV
chr2_33277760_C_CCTTTCTTTCTTTCTTTCTTT_b38	RASGRP3	2.596	0.00988	0.094451	9	0.036389	yes	HRTLV
chr2_33537192_G_GAT_b38	RASGRP3	11.634	2.89e-26	0.301733	3	0.025936	no	HRTLV
chr2_33537330_C_CCCAACACA_b38	RASGRP3	9.996	1.29e-20	0.248273	13	0.024837	no	HRTLV
chr2_33540561_TGTGTGTGTGTG_T_b38	RASGRP3	9.246	3.63e-18	0.233178	12	0.02522	no	HRTLV
chr2_33536322_G_GA_b38	RASGRP3	6.624	1.51e-10	0.182514	10	0.027555	no	HRTLV
chr2_33521266_C_T_b38	RASGRP3	6.518	2.83e-10	0.146041	21	0.022407	no	HRTLV
chr2_33656248_TTC_T_b38	RASGRP3	6.417	5.11e-10	0.155586	11	0.024247	no	HRTLV
chr2_33656848_TA_T_b38	RASGRP3	6.125	2.7e-09	0.142006	16	0.023185	no	HRTLV
chr2_33640631_A_C_b38	RASGRP3	6.084	3.4e-09	0.146574	12	0.024093	no	HRTLV
chr2_33641397_G_C_b38	RASGRP3	6.084	3.4e-09	0.146574	12	0.024093	no	HRTLV
chr2_33639021_G_A_b38	RASGRP3	5.911	8.86e-09	0.142554	12	0.024119	no	HRTLV
chr2_33594326_C_T_b38	RASGRP3	5.887	1.01e-08	0.143486	14	0.024374	no	HRTLV
chr2_33594385_G_A_b38	RASGRP3	5.887	1.01e-08	0.143486	14	0.024374	no	HRTLV
chr2_33596617_C_T_b38	RASGRP3	5.887	1.01e-08	0.143486	14	0.024374	no	HRTLV
chr2_33537321_C_CA_b38	RASGRP3	5.816	1.48e-08	0.108354	49	0.018631	no	HRTLV
chr2_33625315_G_A_b38	RASGRP3	5.069	6.83e-07	0.116631	20	0.023009	no	HRTLV
chr2_33534694_ATT_A_b38	RASGRP3	-4.485	1.02e-05	-0.132263	3	0.029491	no	HRTLV
chr2_33537330_C_CCCA_b38	RASGRP3	-4.477	1.06e-05	-0.127169	13	0.028403	no	HRTLV
chr2_33478322_G_A_b38	RASGRP3	4.435	1.27e-05	0.117259	8	0.026438	no	HRTLV
chr2_33476758_C_CGTGTGT_b38	RASGRP3	4.248	2.85e-05	0.099905	18	0.02352	no	HRTLV
chr2_33477439_G_T_b38	RASGRP3	4.223	3.16e-05	0.125008	3	0.0296	no	HRTLV
chr2_33556890_T_TACAC_b38	RASGRP3	-3.996	8.04e-05	-0.094529	15	0.023658	no	HRTLV
chr2_33467042_C_T_b38	RASGRP3	-3.789	0.000181	-0.077127	44	0.020355	no	HRTLV
chr2_33525699_C_CAA_b38	RASGRP3	3.482	0.000568	0.152916	6	0.043913	no	HRTLV
chr2_33605933_G_A_b38	RASGRP3	-3.463	0.000607	-0.114362	3	0.03302	no	HRTLV
chr2_33545661_T_C_b38	RASGRP3	3.41	0.000734	0.076839	21	0.022533	no	HRTLV
chr2_33573084_G_C_b38	RASGRP3	-3.353	0.000896	-0.106402	4	0.031731	no	HRTLV
chr2_33545793_CTAT_C_b38	RASGRP3	3.34	0.00094	0.072878	25	0.021823	no	HRTLV
chr2_33546340_A_G_b38	RASGRP3	3.323	0.000996	0.074622	21	0.022457	no	HRTLV
chr2_33642139_G_T_b38	RASGRP3	3.286	0.00113	0.090166	6	0.027442	no	HRTLV
chr2_33540553_GTT_G_b38	RASGRP3	3.254	0.00126	0.059386	63	0.01825	no	HRTLV
chr2_33529261_A_G_b38	RASGRP3	3.24	0.00132	0.074896	19	0.023115	no	HRTLV
chr2_33769652_G_T_b38	RASGRP3	-3.203	0.0015	-0.068019	45	0.021237	no	HRTLV
chr2_33764454_T_C_b38	RASGRP3	-3.137	0.00187	-0.065716	46	0.02095	no	HRTLV
chr2_33766547_T_G_b38	RASGRP3	-3.137	0.00187	-0.065716	46	0.02095	no	HRTLV
chr2_33767220_GAA_G_b38	RASGRP3	-3.11	0.00204	-0.066473	44	0.02137	no	HRTLV
chr2_33770662_T_C_b38	RASGRP3	-3.072	0.00231	-0.065427	44	0.021295	no	HRTLV
chr2_33471202_GT_G_b38	RASGRP3	3.053	0.00246	0.092672	3	0.030358	no	HRTLV
chr2_33473331_C_T_b38	RASGRP3	3.023	0.00271	0.091803	3	0.030368	no	HRTLV
chr2_33476930_C_CG_b38	RASGRP3	-3.02	0.00274	-0.058859	87	0.019491	no	HRTLV
chr2_33477035_T_G_b38	RASGRP3	-3.02	0.00274	-0.058859	87	0.019491	no	HRTLV
chr2_33477050_G_GA_b38	RASGRP3	-3.02	0.00274	-0.058859	87	0.019491	no	HRTLV
chr2_33140669_A_ATT_b38	RASGRP3	-2.997	0.00294	-0.08028	13	0.026784	no	HRTLV
chr2_33453264_C_T_b38	RASGRP3	-2.982	0.00309	-0.069412	19	0.02328	no	HRTLV
chr2_33483793_C_G_b38	RASGRP3	2.976	0.00315	0.101853	3	0.03423	no	HRTLV
chr2_33463361_G_A_b38	RASGRP3	2.975	0.00316	0.093328	3	0.031372	no	HRTLV
chr2_33764518_G_GTT_b38	RASGRP3	2.967	0.00323	0.10873	4	0.036641	no	HRTLV
chr2_33535209_G_A_b38	RASGRP3	2.961	0.00329	0.064474	23	0.021771	no	HRTLV
chr2_33471935_G_T_b38	RASGRP3	-2.956	0.00335	-0.069248	18	0.023425	no	HRTLV
chr2_33470528_C_T_b38	RASGRP3	-2.944	0.00349	-0.068996	17	0.02344	no	HRTLV
chr2_33464479_A_T_b38	RASGRP3	-2.943	0.00349	-0.056698	86	0.019264	no	HRTLV
chr2_33470734_A_G_b38	RASGRP3	-2.939	0.00353	-0.056053	79	0.019071	no	HRTLV
chr2_33471307_G_GTAGGACTA_b38	RASGRP3	-2.939	0.00353	-0.056053	79	0.019071	no	HRTLV
chr2_33455019_G_C_b38	RASGRP3	-2.929	0.00365	-0.071372	15	0.024371	no	HRTLV
chr2_33539888_A_T_b38	RASGRP3	2.914	0.00382	0.065086	22	0.022332	no	HRTLV
chr2_33539650_C_T_b38	RASGRP3	2.908	0.0039	0.064741	22	0.022266	no	HRTLV
chr2_33764804_G_C_b38	RASGRP3	-2.901	0.00398	-0.06181	44	0.021308	no	HRTLV
chr2_33471535_G_A_b38	RASGRP3	-2.901	0.00399	-0.067778	18	0.023366	no	HRTLV
chr2_33764603_A_G_b38	RASGRP3	-2.895	0.00406	-0.061146	45	0.021121	no	HRTLV
chr2_33461382_C_G_b38	RASGRP3	-2.877	0.00429	-0.06805	16	0.023651	no	HRTLV
chr2_33551613_T_G_b38	RASGRP3	2.877	0.00429	0.064025	22	0.022257	no	HRTLV
chr2_33469706_C_T_b38	RASGRP3	-2.876	0.0043	-0.055618	73	0.019337	no	HRTLV
chr2_33476728_C_CCT_b38	RASGRP3	-2.857	0.00457	-0.056862	88	0.019905	no	HRTLV
chr2_33520269_T_C_b38	RASGRP3	2.851	0.00464	0.066187	20	0.023215	no	HRTLV
chr2_33472507_G_C_b38	RASGRP3	2.84	0.00481	0.084921	3	0.029904	no	HRTLV
chr2_32508276_C_CTTT_b38	RASGRP3	2.833	0.0049	0.146498	6	0.051704	no	HRTLV
chr2_32800823_C_G_b38	RASGRP3	-2.805	0.00534	-0.078875	7	0.028115	no	HRTLV
chr2_33753860_C_CT_b38	RASGRP3	-2.791	0.00558	-0.061421	33	0.022008	no	HRTLV
chr2_33461597_C_T_b38	RASGRP3	-2.786	0.00567	-0.065376	17	0.023469	no	HRTLV
chr2_33461653_G_C_b38	RASGRP3	-2.786	0.00567	-0.065376	17	0.023469	no	HRTLV
chr2_33754343_CT_C_b38	RASGRP3	-2.758	0.00615	-0.070681	23	0.025627	no	HRTLV
chr2_32799782_A_G_b38	RASGRP3	-2.728	0.00673	-0.077107	7	0.028263	no	HRTLV
chr2_33470357_T_C_b38	RASGRP3	-2.72	0.00689	-0.051782	80	0.019037	no	HRTLV
chr2_33787621_C_CTTT_b38	RASGRP3	2.709	0.00711	0.111027	4	0.040979	no	HRTLV
chr2_32772718_T_C_b38	RASGRP3	-2.707	0.00716	-0.083348	3	0.03079	no	HRTLV
chr2_34313033_G_A_b38	RASGRP3	-2.685	0.00764	-0.087373	9	0.032544	no	HRTLV
chr2_33556443_T_A_b38	RASGRP3	-2.678	0.00779	-0.0535	41	0.019974	no	HRTLV
chr2_32798382_A_G_b38	RASGRP3	-2.638	0.00874	-0.075226	6	0.028512	no	HRTLV
chr2_32775270_T_C_b38	RASGRP3	-2.63	0.00895	-0.080984	3	0.030791	no	HRTLV
chr2_33522218_G_A_b38	RASGRP3	2.623	0.00915	0.059455	20	0.02267	no	HRTLV
chr2_32769651_G_GAA_b38	RASGRP3	-2.622	0.00918	-0.081281	3	0.031005	no	HRTLV
chr2_33548381_A_AAAAAG_b38	RASGRP3	2.616	0.00932	0.085874	7	0.032822	no	HRTLV
chr2_34361913_G_A_b38	RASGRP3	-2.613	0.0094	-0.051899	72	0.01986	no	HRTLV
chr2_33454164_C_T_b38	RASGRP3	-2.613	0.00942	-0.064175	15	0.024563	no	HRTLV
chr2_34353639_A_G_b38	RASGRP3	-2.606	0.00958	-0.051911	72	0.019916	no	HRTLV
chr2_32788885_A_AC_b38	RASGRP3	-2.596	0.00987	-0.081076	3	0.031229	no	HRTLV
chr2_33625315_G_A_b38	RASGRP3	3.995	0.000226	0.268015	3	0.067084	yes	KDNCTX
chr2_33589264_G_C_b38	RASGRP3	3.908	0.000297	0.267439	3	0.068431	yes	KDNCTX
chr2_33596450_T_G_b38	RASGRP3	3.908	0.000297	0.267439	3	0.068431	yes	KDNCTX
chr2_33525341_A_AAT_b38	RASGRP3	3.511	0.000998	0.233997	3	0.066653	yes	KDNCTX
chr2_33540561_TGTGTGTGTGTG_T_b38	RASGRP3	3.211	0.00239	0.236145	3	0.073542	yes	KDNCTX
chr2_33624881_G_GT_b38	RASGRP3	3.183	0.00259	0.233247	3	0.073287	yes	KDNCTX
chr2_33626436_A_T_b38	RASGRP3	3.183	0.00259	0.233247	3	0.073287	yes	KDNCTX
chr2_34028517_A_G_b38	RASGRP3	-3.155	0.0028	-0.192623	11	0.061062	yes	KDNCTX
chr2_34029672_T_TAA_b38	RASGRP3	-3.133	0.00298	-0.190262	11	0.060729	yes	KDNCTX
chr2_33458660_G_A_b38	RASGRP3	-3.064	0.00361	-0.229533	3	0.074905	yes	KDNCTX
chr2_34024158_G_C_b38	RASGRP3	-2.995	0.00437	-0.186382	10	0.062226	yes	KDNCTX
chr2_33486164_AT_A_b38	RASGRP3	-2.988	0.00445	-0.214742	5	0.071866	yes	KDNCTX
chr2_34029138_CAA_C_b38	RASGRP3	-2.938	0.00511	-0.208269	7	0.070897	yes	KDNCTX
chr2_32961945_C_CA_b38	RASGRP3	2.915	0.00543	0.235697	3	0.080845	yes	KDNCTX
chr2_32994080_T_C_b38	RASGRP3	2.875	0.00605	0.221345	3	0.076984	yes	KDNCTX
chr2_33241988_G_C_b38	RASGRP3	2.814	0.00712	0.189474	7	0.067329	yes	KDNCTX
chr2_34044537_C_CA_b38	RASGRP3	-2.771	0.00797	-0.193741	6	0.069905	yes	KDNCTX
chr2_33458726_C_G_b38	RASGRP3	-2.701	0.00958	-0.192346	4	0.071206	yes	KDNCTX
chr2_34029441_TCAA_T_b38	RASGRP3	-2.688	0.00991	-0.193223	6	0.071879	yes	KDNCTX
chr2_33656916_G_A_b38	RASGRP3	3.644	0.000668	0.256025	3	0.07025	no	KDNCTX
chr2_33398095_C_G_b38	RASGRP3	3.271	0.00201	0.251273	10	0.07682	no	KDNCTX
chr2_33501543_C_T_b38	RASGRP3	3.256	0.0021	0.271608	4	0.083412	no	KDNCTX
chr2_33506574_G_C_b38	RASGRP3	3.256	0.0021	0.271608	4	0.083412	no	KDNCTX
chr2_33623108_T_C_b38	RASGRP3	3.254	0.00211	0.225133	3	0.069176	no	KDNCTX
chr2_33621819_C_A_b38	RASGRP3	3.146	0.00287	0.21155	4	0.067245	no	KDNCTX
chr2_33398239_C_T_b38	RASGRP3	2.98	0.00455	0.203297	13	0.068212	no	KDNCTX
chr2_33009961_T_G_b38	RASGRP3	-2.686	0.00995	-0.19038	8	0.070869	no	KDNCTX
chr2_33009962_T_C_b38	RASGRP3	-2.686	0.00995	-0.19038	8	0.070869	no	KDNCTX
chr2_33010110_G_A_b38	RASGRP3	-2.686	0.00995	-0.19038	8	0.070869	no	KDNCTX
chr2_33010257_G_A_b38	RASGRP3	-2.686	0.00995	-0.19038	8	0.070869	no	KDNCTX
chr2_33567745_C_T_b38	RASGRP3	-2.685	0.00999	-0.166236	9	0.06191	no	KDNCTX
chr2_33546942_C_G_b38	RASGRP3	5.404	2.22e-07	0.201069	3	0.037208	yes	LIVER
chr2_33540561_TGTGTGTGTGTG_T_b38	RASGRP3	4.683	5.83e-06	0.174692	3	0.037303	yes	LIVER
chr2_33586869_A_T_b38	RASGRP3	4.24	3.7e-05	0.133366	7	0.031456	yes	LIVER
chr2_33525341_A_AAT_b38	RASGRP3	4.198	4.37e-05	0.121138	11	0.028858	yes	LIVER
chr2_32690530_A_C_b38	RASGRP3	3.856	0.000164	0.124559	5	0.032299	yes	LIVER
chr2_33512177_G_A_b38	RASGRP3	3.737	0.000256	0.130745	5	0.034989	yes	LIVER
chr2_32685471_T_C_b38	RASGRP3	3.711	0.000281	0.125429	3	0.033797	yes	LIVER
chr2_32704403_C_G_b38	RASGRP3	3.411	0.000811	0.115671	3	0.033908	yes	LIVER
chr2_32750602_G_A_b38	RASGRP3	3.359	0.000968	0.10235	7	0.030469	yes	LIVER
chr2_33529318_C_T_b38	RASGRP3	3.353	0.000989	0.111012	5	0.033107	yes	LIVER
chr2_33451373_G_T_b38	RASGRP3	-3.284	0.00125	-0.102853	6	0.031316	yes	LIVER
chr2_32727402_T_C_b38	RASGRP3	3.277	0.00127	0.07654	38	0.023354	yes	LIVER
chr2_34419147_C_T_b38	RASGRP3	-3.219	0.00155	-0.090961	12	0.028261	yes	LIVER
chr2_33457536_T_G_b38	RASGRP3	3.195	0.00167	0.091749	10	0.028716	yes	LIVER
chr2_33523649_G_A_b38	RASGRP3	3.194	0.00168	0.111562	6	0.034926	yes	LIVER
chr2_32694599_A_G_b38	RASGRP3	3.163	0.00185	0.107448	3	0.033968	yes	LIVER
chr2_32695291_T_G_b38	RASGRP3	3.163	0.00185	0.107448	3	0.033968	yes	LIVER
chr2_32695591_T_C_b38	RASGRP3	3.163	0.00185	0.107448	3	0.033968	yes	LIVER
chr2_32728953_A_G_b38	RASGRP3	3.159	0.00188	0.095462	8	0.030218	yes	LIVER
chr2_33657078_T_C_b38	RASGRP3	3.126	0.00209	0.09083	12	0.029058	yes	LIVER
chr2_32740453_C_CT_b38	RASGRP3	3.118	0.00215	0.077434	27	0.024836	yes	LIVER
chr2_32685849_T_C_b38	RASGRP3	3.092	0.00233	0.10522	3	0.034025	yes	LIVER
chr2_32715957_G_GTGTTTTGTTTTTTTAAACTA_b38	RASGRP3	3.061	0.00257	0.077453	41	0.025304	yes	LIVER
chr2_33459342_A_G_b38	RASGRP3	3.051	0.00266	0.088521	12	0.029016	yes	LIVER
chr2_32685918_A_G_b38	RASGRP3	3.039	0.00276	0.095985	7	0.031588	yes	LIVER
chr2_33564001_C_G_b38	RASGRP3	3.03	0.00284	0.077689	28	0.025641	yes	LIVER
chr2_34394191_C_T_b38	RASGRP3	-3.019	0.00293	-0.085801	11	0.028419	yes	LIVER
chr2_33589264_G_C_b38	RASGRP3	2.982	0.00329	0.081514	18	0.027334	yes	LIVER
chr2_33590881_T_C_b38	RASGRP3	2.973	0.00338	0.081669	17	0.027468	yes	LIVER
chr2_33596450_T_G_b38	RASGRP3	2.965	0.00347	0.080909	19	0.02729	yes	LIVER
chr2_33565263_A_G_b38	RASGRP3	2.961	0.00352	0.090777	11	0.03066	yes	LIVER
chr2_32710172_A_G_b38	RASGRP3	2.943	0.00371	0.072969	47	0.02479	yes	LIVER
chr2_32721706_GTA_G_b38	RASGRP3	2.907	0.00415	0.070696	45	0.024323	yes	LIVER
chr2_33456354_ATTCT_A_b38	RASGRP3	-2.902	0.00421	-0.074241	31	0.025582	yes	LIVER
chr2_33594326_C_T_b38	RASGRP3	2.902	0.00421	0.088779	10	0.030591	yes	LIVER
chr2_33594385_G_A_b38	RASGRP3	2.902	0.00421	0.088779	10	0.030591	yes	LIVER
chr2_33596617_C_T_b38	RASGRP3	2.902	0.00421	0.088779	10	0.030591	yes	LIVER
chr2_33582025_C_T_b38	RASGRP3	2.9	0.00423	0.089441	9	0.03084	yes	LIVER
chr2_34398678_C_CGT_b38	RASGRP3	-2.895	0.00429	-0.087284	8	0.030145	yes	LIVER
chr2_33581561_C_T_b38	RASGRP3	2.872	0.0046	0.088195	10	0.030704	yes	LIVER
chr2_33596963_A_T_b38	RASGRP3	2.871	0.00462	0.087602	11	0.03051	yes	LIVER
chr2_34313104_A_C_b38	RASGRP3	-2.855	0.00484	-0.125621	8	0.043993	yes	LIVER
chr2_34425046_G_T_b38	RASGRP3	-2.841	0.00505	-0.076487	16	0.026919	yes	LIVER
chr2_32871799_C_CAAA_b38	RASGRP3	2.84	0.00507	0.087571	10	0.030833	yes	LIVER
chr2_33534694_A_AT_b38	RASGRP3	2.815	0.00547	0.082389	13	0.029269	yes	LIVER
chr2_32721709_CAGTGGAATG_C_b38	RASGRP3	2.773	0.00618	0.068209	44	0.024594	yes	LIVER
chr2_32721719_A_C_b38	RASGRP3	2.773	0.00618	0.068209	44	0.024594	yes	LIVER
chr2_32790279_T_G_b38	RASGRP3	2.77	0.00625	0.066901	31	0.024154	yes	LIVER
chr2_34377960_G_A_b38	RASGRP3	-2.768	0.00627	-0.076774	13	0.027734	yes	LIVER
chr2_32473706_C_CGT_b38	RASGRP3	-2.765	0.00633	-0.074552	20	0.026964	yes	LIVER
chr2_33521266_C_T_b38	RASGRP3	2.76	0.00643	0.083917	10	0.030404	yes	LIVER
chr2_34392219_A_C_b38	RASGRP3	-2.754	0.00654	-0.07862	11	0.028549	yes	LIVER
chr2_34107424_G_A_b38	RASGRP3	-2.751	0.00661	-0.069647	20	0.025321	yes	LIVER
chr2_33564467_A_G_b38	RASGRP3	2.742	0.00677	0.070667	28	0.025771	yes	LIVER
chr2_33889632_C_T_b38	RASGRP3	-2.724	0.00714	-0.079424	9	0.029158	yes	LIVER
chr2_33890324_C_T_b38	RASGRP3	-2.724	0.00714	-0.079424	9	0.029158	yes	LIVER
chr2_33890604_T_C_b38	RASGRP3	-2.724	0.00714	-0.079424	9	0.029158	yes	LIVER
chr2_32777672_T_G_b38	RASGRP3	2.722	0.00718	0.064687	40	0.023767	yes	LIVER
chr2_34362552_A_T_b38	RASGRP3	-2.713	0.00737	-0.075241	13	0.027733	yes	LIVER
chr2_34387307_T_G_b38	RASGRP3	-2.71	0.00744	-0.077046	12	0.028433	yes	LIVER
chr2_34387601_T_C_b38	RASGRP3	-2.71	0.00744	-0.077046	12	0.028433	yes	LIVER
chr2_33892431_A_G_b38	RASGRP3	-2.709	0.00746	-0.079078	9	0.029193	yes	LIVER
chr2_33892444_A_G_b38	RASGRP3	-2.709	0.00746	-0.079078	9	0.029193	yes	LIVER
chr2_33472870_C_CAAAAAA_b38	RASGRP3	-2.696	0.00774	-0.142059	3	0.052695	yes	LIVER
chr2_33445936_C_T_b38	RASGRP3	-2.68	0.00809	-0.068502	26	0.025557	yes	LIVER
chr2_33866375_T_C_b38	RASGRP3	-2.671	0.0083	-0.074957	12	0.02806	yes	LIVER
chr2_33869896_T_A_b38	RASGRP3	-2.671	0.0083	-0.074957	12	0.02806	yes	LIVER
chr2_32806634_T_C_b38	RASGRP3	2.667	0.0084	0.06298	32	0.023614	yes	LIVER
chr2_33887886_A_C_b38	RASGRP3	-2.663	0.0085	-0.077543	9	0.029116	yes	LIVER
chr2_32993969_A_AGTGT_b38	RASGRP3	-2.663	0.00851	-0.081084	8	0.030452	yes	LIVER
chr2_34375915_A_G_b38	RASGRP3	-2.655	0.00869	-0.075656	13	0.028493	yes	LIVER
chr2_33555164_G_A_b38	RASGRP3	2.655	0.0087	0.091863	6	0.0346	yes	LIVER
chr2_34103059_T_A_b38	RASGRP3	-2.637	0.00915	-0.066762	20	0.025316	yes	LIVER
chr2_33406668_A_G_b38	RASGRP3	2.617	0.00969	0.071652	15	0.02738	yes	LIVER
chr2_33537330_C_CCCAACACA_b38	RASGRP3	5.536	1.18e-07	0.177408	8	0.032049	no	LIVER
chr2_33537192_G_GAT_b38	RASGRP3	5.405	2.2e-07	0.186605	3	0.034523	no	LIVER
chr2_33536322_G_GA_b38	RASGRP3	3.764	0.000232	0.142602	5	0.03789	no	LIVER
chr2_32694674_C_CT_b38	RASGRP3	3.588	0.000437	0.097683	11	0.027222	no	LIVER
chr2_32701881_C_T_b38	RASGRP3	3.494	0.000608	0.118026	3	0.033775	no	LIVER
chr2_32712115_C_A_b38	RASGRP3	3.494	0.000608	0.118026	3	0.033775	no	LIVER
chr2_32716118_G_A_b38	RASGRP3	3.494	0.000608	0.118026	3	0.033775	no	LIVER
chr2_32742993_T_C_b38	RASGRP3	3.49	0.000617	0.107017	6	0.030662	no	LIVER
chr2_32781435_A_T_b38	RASGRP3	-3.433	0.000752	-0.108199	5	0.031514	no	LIVER
chr2_32753076_C_G_b38	RASGRP3	3.428	0.000766	0.105703	6	0.030834	no	LIVER
chr2_32758413_G_A_b38	RASGRP3	-3.397	0.00085	-0.129702	3	0.038176	no	LIVER
chr2_32706077_CTTTTTTTTTTTTTTTTT_C_b38	RASGRP3	-3.391	0.000868	-0.117158	6	0.034546	no	LIVER
chr2_32748781_A_G_b38	RASGRP3	3.379	0.000907	0.106011	5	0.031378	no	LIVER
chr2_32774081_G_A_b38	RASGRP3	3.379	0.000907	0.106011	5	0.031378	no	LIVER
chr2_32752674_G_A_b38	RASGRP3	3.368	0.00094	0.101659	7	0.030183	no	LIVER
chr2_32754549_C_T_b38	RASGRP3	3.367	0.000944	0.103243	6	0.030666	no	LIVER
chr2_32776877_C_T_b38	RASGRP3	3.302	0.00118	0.101978	6	0.030887	no	LIVER
chr2_32773199_G_T_b38	RASGRP3	3.269	0.00131	0.100015	7	0.030596	no	LIVER
chr2_32788689_C_A_b38	RASGRP3	-3.233	0.00148	-0.100475	6	0.031078	no	LIVER
chr2_32809934_T_C_b38	RASGRP3	-3.221	0.00153	-0.095596	7	0.029675	no	LIVER
chr2_32810462_A_G_b38	RASGRP3	-3.221	0.00153	-0.095596	7	0.029675	no	LIVER
chr2_32679886_A_G_b38	RASGRP3	3.208	0.0016	0.101307	6	0.031579	no	LIVER
chr2_32753523_T_C_b38	RASGRP3	3.196	0.00167	0.098226	6	0.030737	no	LIVER
chr2_32807543_C_T_b38	RASGRP3	-3.193	0.00168	-0.092673	9	0.029022	no	LIVER
chr2_32770911_A_G_b38	RASGRP3	3.173	0.00179	0.099998	5	0.031513	no	LIVER
chr2_32773501_A_G_b38	RASGRP3	3.173	0.00179	0.099998	5	0.031513	no	LIVER
chr2_32781092_G_A_b38	RASGRP3	-3.173	0.00179	-0.099998	5	0.031513	no	LIVER
chr2_32771489_C_G_b38	RASGRP3	3.171	0.00181	0.098007	6	0.030909	no	LIVER
chr2_32754679_C_G_b38	RASGRP3	3.17	0.00181	0.095558	7	0.030145	no	LIVER
chr2_32735024_C_T_b38	RASGRP3	3.125	0.0021	0.095389	8	0.030529	no	LIVER
chr2_33921555_C_CCACACACACACACACACA_b38	RASGRP3	-3.099	0.00228	-0.088459	10	0.028542	no	LIVER
chr2_32739634_G_C_b38	RASGRP3	3.086	0.00238	0.090524	9	0.029335	no	LIVER
chr2_34400635_A_C_b38	RASGRP3	-3.056	0.00261	-0.08592	12	0.028116	no	LIVER
chr2_32770697_T_C_b38	RASGRP3	3.055	0.00262	0.098086	4	0.032102	no	LIVER
chr2_32677018_G_C_b38	RASGRP3	3.042	0.00273	0.090645	8	0.029794	no	LIVER
chr2_32809149_C_T_b38	RASGRP3	-3.042	0.00273	-0.09017	8	0.029644	no	LIVER
chr2_32780850_GTT_G_b38	RASGRP3	-3.016	0.00296	-0.099988	3	0.03315	no	LIVER
chr2_32814183_A_G_b38	RASGRP3	-3.004	0.00308	-0.092511	6	0.030797	no	LIVER
chr2_32814623_A_G_b38	RASGRP3	-3.004	0.00308	-0.092511	6	0.030797	no	LIVER
chr2_32814759_C_T_b38	RASGRP3	-3.004	0.00308	-0.092511	6	0.030797	no	LIVER
chr2_32816211_A_G_b38	RASGRP3	-3.004	0.00308	-0.092511	6	0.030797	no	LIVER
chr2_33561192_A_G_b38	RASGRP3	2.988	0.00323	0.071557	49	0.023948	no	LIVER
chr2_32731056_G_T_b38	RASGRP3	2.943	0.00371	0.089013	9	0.030246	no	LIVER
chr2_34380660_G_A_b38	RASGRP3	-2.93	0.00387	-0.082251	12	0.028074	no	LIVER
chr2_33532487_C_A_b38	RASGRP3	2.925	0.00392	0.070789	47	0.024197	no	LIVER
chr2_32807603_T_C_b38	RASGRP3	-2.916	0.00403	-0.087187	8	0.029895	no	LIVER
chr2_34383137_T_TAACAACAAC_b38	RASGRP3	2.902	0.00421	0.098662	4	0.034	no	LIVER
chr2_32725585_C_G_b38	RASGRP3	2.898	0.00427	0.091058	6	0.031426	no	LIVER
chr2_32816902_T_A_b38	RASGRP3	-2.879	0.00452	-0.088744	6	0.03083	no	LIVER
chr2_32817848_G_T_b38	RASGRP3	-2.879	0.00452	-0.088744	6	0.03083	no	LIVER
chr2_34405645_C_T_b38	RASGRP3	-2.877	0.00454	-0.081509	11	0.028334	no	LIVER
chr2_34409667_G_A_b38	RASGRP3	-2.877	0.00454	-0.081509	11	0.028334	no	LIVER
chr2_34422866_G_A_b38	RASGRP3	-2.877	0.00454	-0.081509	11	0.028334	no	LIVER
chr2_33886694_C_CTCTG_b38	RASGRP3	2.844	0.00501	0.092092	5	0.032379	no	LIVER
chr2_32806967_C_T_b38	RASGRP3	-2.832	0.00519	-0.08507	8	0.030037	no	LIVER
chr2_34380110_A_T_b38	RASGRP3	-2.825	0.00531	-0.078241	14	0.0277	no	LIVER
chr2_33082440_T_A_b38	RASGRP3	2.818	0.00541	0.077676	28	0.02756	no	LIVER
chr2_32688540_T_G_b38	RASGRP3	2.816	0.00544	0.084416	9	0.029975	no	LIVER
chr2_32825749_G_C_b38	RASGRP3	-2.796	0.00578	-0.085797	6	0.030683	no	LIVER
chr2_32755629_C_CGGAGAG_b38	RASGRP3	2.777	0.00612	0.07995	11	0.028794	no	LIVER
chr2_34381944_C_CT_b38	RASGRP3	-2.769	0.00626	-0.076358	14	0.027579	no	LIVER
chr2_34382259_G_T_b38	RASGRP3	-2.769	0.00626	-0.076358	14	0.027579	no	LIVER
chr2_34382409_A_AAT_b38	RASGRP3	-2.769	0.00626	-0.076358	14	0.027579	no	LIVER
chr2_33856927_CT_C_b38	RASGRP3	-2.751	0.0066	-0.077401	11	0.028138	no	LIVER
chr2_33082431_ACTTTTTTT_A_b38	RASGRP3	2.725	0.00712	0.072811	26	0.026724	no	LIVER
chr2_32684857_G_A_b38	RASGRP3	2.708	0.00748	0.087064	6	0.032153	no	LIVER
chr2_34106684_T_C_b38	RASGRP3	-2.704	0.00756	-0.068809	21	0.025449	no	LIVER
chr2_34094905_T_C_b38	RASGRP3	-2.689	0.00788	-0.066268	39	0.02464	no	LIVER
chr2_32817982_G_A_b38	RASGRP3	-2.684	0.008	-0.083083	6	0.030951	no	LIVER
chr2_32791739_G_A_b38	RASGRP3	-2.683	0.00803	-0.081186	7	0.030258	no	LIVER
chr2_32801684_G_T_b38	RASGRP3	-2.671	0.00832	-0.084742	5	0.031732	no	LIVER
chr2_32801685_G_C_b38	RASGRP3	-2.671	0.00832	-0.084742	5	0.031732	no	LIVER
chr2_34282844_C_CT_b38	RASGRP3	2.663	0.0085	0.075597	18	0.028388	no	LIVER
chr2_32768989_T_G_b38	RASGRP3	2.649	0.00885	0.080966	6	0.030565	no	LIVER
chr2_33850689_A_G_b38	RASGRP3	-2.648	0.00888	-0.075114	11	0.02837	no	LIVER
chr2_34163298_T_TTCTCTC_b38	RASGRP3	-2.642	0.00903	-0.067321	26	0.025482	no	LIVER
chr2_33537321_C_CA_b38	RASGRP3	2.639	0.00911	0.065728	30	0.024911	no	LIVER
chr2_34100727_G_C_b38	RASGRP3	-2.631	0.00931	-0.067427	19	0.025629	no	LIVER
chr2_34381416_G_C_b38	RASGRP3	-2.631	0.00932	-0.073995	12	0.028129	no	LIVER
chr2_34386681_C_T_b38	RASGRP3	-2.631	0.00932	-0.073995	12	0.028129	no	LIVER
chr2_34384272_C_G_b38	RASGRP3	-2.611	0.00984	-0.074092	13	0.028373	no	LIVER
chr2_33692390_T_A_b38	RASGRP3	-2.61	0.00987	-0.074732	14	0.028631	no	LIVER
chr2_33512177_G_A_b38	RASGRP3	10.303	1.83e-22	0.210815	19	0.020461	yes	LUNG
chr2_33561445_C_A_b38	RASGRP3	8.175	3.12e-15	0.163107	19	0.019951	yes	LUNG
chr2_33525341_A_AAT_b38	RASGRP3	8.047	7.82e-15	0.152689	24	0.018974	yes	LUNG
chr2_33556928_C_CACACACATACAT_b38	RASGRP3	7.3	1.34e-12	0.172925	4	0.023688	yes	LUNG
chr2_33511010_G_A_b38	RASGRP3	6.598	1.19e-10	0.170998	11	0.025917	yes	LUNG
chr2_33596963_A_T_b38	RASGRP3	6.555	1.55e-10	0.125975	30	0.019219	yes	LUNG
chr2_33656916_G_A_b38	RASGRP3	6.21	1.22e-09	0.112527	41	0.01812	yes	LUNG
chr2_33624881_G_GT_b38	RASGRP3	5.956	5.27e-09	0.107581	40	0.018063	yes	LUNG
chr2_33626436_A_T_b38	RASGRP3	5.824	1.1e-08	0.104646	42	0.017968	yes	LUNG
chr2_33622592_T_C_b38	RASGRP3	5.818	1.14e-08	0.105077	48	0.018061	yes	LUNG
chr2_33589264_G_C_b38	RASGRP3	5.767	1.52e-08	0.104318	41	0.018089	yes	LUNG
chr2_33590881_T_C_b38	RASGRP3	5.756	1.61e-08	0.10367	40	0.01801	yes	LUNG
chr2_33596450_T_G_b38	RASGRP3	5.753	1.63e-08	0.10348	42	0.017987	yes	LUNG
chr2_33622160_C_T_b38	RASGRP3	5.714	2.02e-08	0.104684	38	0.018319	yes	LUNG
chr2_33625315_G_A_b38	RASGRP3	5.558	4.71e-08	0.10341	34	0.018606	yes	LUNG
chr2_33508487_T_C_b38	RASGRP3	5.43	9.28e-08	0.141793	16	0.026111	yes	LUNG
chr2_33564001_C_G_b38	RASGRP3	5.34	1.49e-07	0.090177	66	0.016886	yes	LUNG
chr2_33564467_A_G_b38	RASGRP3	5.279	2.03e-07	0.088681	70	0.016798	yes	LUNG
chr2_33621819_C_A_b38	RASGRP3	5.141	4.11e-07	0.089427	53	0.017395	yes	LUNG
chr2_33657078_T_C_b38	RASGRP3	5.131	4.31e-07	0.097748	33	0.019049	yes	LUNG
chr2_33623108_T_C_b38	RASGRP3	4.961	1e-06	0.087403	52	0.017618	yes	LUNG
chr2_33508447_C_T_b38	RASGRP3	4.91	1.28e-06	0.145711	3	0.029675	yes	LUNG
chr2_33518114_A_G_b38	RASGRP3	-4.903	1.33e-06	-0.081833	65	0.016692	yes	LUNG
chr2_33514230_T_G_b38	RASGRP3	4.807	2.1e-06	0.09609	23	0.019991	yes	LUNG
chr2_33537321_C_CA_b38	RASGRP3	4.771	2.49e-06	0.077091	71	0.016157	yes	LUNG
chr2_33532487_C_A_b38	RASGRP3	4.593	5.69e-06	0.072462	118	0.015775	yes	LUNG
chr2_33515662_T_C_b38	RASGRP3	4.578	6.11e-06	0.097624	18	0.021326	yes	LUNG
chr2_33508652_C_G_b38	RASGRP3	4.511	8.28e-06	0.077282	69	0.017132	yes	LUNG
chr2_33669785_CA_C_b38	RASGRP3	-4.505	8.5e-06	-0.074624	85	0.016565	yes	LUNG
chr2_33658757_C_A_b38	RASGRP3	-4.447	1.1e-05	-0.073329	105	0.016489	yes	LUNG
chr2_33637426_T_A_b38	RASGRP3	4.419	1.25e-05	0.090604	22	0.020504	yes	LUNG
chr2_33658713_G_A_b38	RASGRP3	-4.381	1.48e-05	-0.072701	113	0.016596	yes	LUNG
chr2_33512820_T_A_b38	RASGRP3	-4.371	1.55e-05	-0.071367	72	0.016329	yes	LUNG
chr2_33660983_C_T_b38	RASGRP3	-4.303	2.08e-05	-0.070229	109	0.016322	yes	LUNG
chr2_33668515_A_G_b38	RASGRP3	-4.289	2.2e-05	-0.070522	119	0.016442	yes	LUNG
chr2_33514489_T_C_b38	RASGRP3	-4.251	2.6e-05	-0.067676	83	0.015921	yes	LUNG
chr2_33662442_T_C_b38	RASGRP3	-4.237	2.75e-05	-0.069612	117	0.016428	yes	LUNG
chr2_33655786_T_C_b38	RASGRP3	-4.235	2.78e-05	-0.069175	112	0.016334	yes	LUNG
chr2_33658170_A_G_b38	RASGRP3	-4.206	3.14e-05	-0.069428	114	0.016507	yes	LUNG
chr2_33655774_A_G_b38	RASGRP3	-4.155	3.9e-05	-0.068232	120	0.01642	yes	LUNG
chr2_33572204_C_A_b38	RASGRP3	-4.142	4.13e-05	-0.069479	81	0.016775	yes	LUNG
chr2_33647765_T_C_b38	RASGRP3	-4.136	4.23e-05	-0.068558	120	0.016577	yes	LUNG
chr2_33548381_A_AAAAAG_b38	RASGRP3	4.094	5.05e-05	0.121052	7	0.029571	yes	LUNG
chr2_33519891_C_T_b38	RASGRP3	-4.092	5.08e-05	-0.067431	79	0.016479	yes	LUNG
chr2_33625433_A_C_b38	RASGRP3	-3.99	7.73e-05	-0.066119	96	0.016571	yes	LUNG
chr2_33629533_C_G_b38	RASGRP3	3.986	7.87e-05	0.096552	10	0.024225	yes	LUNG
chr2_33641120_T_C_b38	RASGRP3	-3.965	8.54e-05	-0.066102	118	0.01667	yes	LUNG
chr2_33613720_G_A_b38	RASGRP3	3.96	8.74e-05	0.090002	15	0.022729	yes	LUNG
chr2_33673146_T_C_b38	RASGRP3	-3.905	0.000109	-0.064137	122	0.016424	yes	LUNG
chr2_33571586_T_C_b38	RASGRP3	-3.903	0.00011	-0.063165	102	0.016183	yes	LUNG
chr2_33625063_ATCT_A_b38	RASGRP3	-3.885	0.000118	-0.064945	95	0.016715	yes	LUNG
chr2_33630364_C_G_b38	RASGRP3	-3.869	0.000126	-0.063668	100	0.016456	yes	LUNG
chr2_33530852_CT_C_b38	RASGRP3	3.867	0.000126	0.062433	107	0.016143	yes	LUNG
chr2_33667549_A_G_b38	RASGRP3	3.863	0.000128	0.099782	8	0.025827	yes	LUNG
chr2_33667555_A_G_b38	RASGRP3	3.863	0.000128	0.099782	8	0.025827	yes	LUNG
chr2_33561192_A_G_b38	RASGRP3	3.863	0.000129	0.061993	123	0.016049	yes	LUNG
chr2_33615675_TA_T_b38	RASGRP3	-3.854	0.000133	-0.063387	100	0.016447	yes	LUNG
chr2_33631243_G_GT_b38	RASGRP3	3.833	0.000145	0.097396	8	0.025408	yes	LUNG
chr2_33634816_G_T_b38	RASGRP3	3.833	0.000145	0.096847	8	0.025268	yes	LUNG
chr2_33631637_C_A_b38	RASGRP3	-3.803	0.000163	-0.06206	102	0.01632	yes	LUNG
chr2_33632169_T_C_b38	RASGRP3	-3.802	0.000164	-0.063559	93	0.016717	yes	LUNG
chr2_33670200_G_T_b38	RASGRP3	-3.801	0.000164	-0.062677	94	0.016491	yes	LUNG
chr2_33659035_G_A_b38	RASGRP3	3.8	0.000165	0.096645	8	0.025431	yes	LUNG
chr2_33547458_G_A_b38	RASGRP3	3.795	0.000168	0.065541	63	0.01727	yes	LUNG
chr2_33605951_T_C_b38	RASGRP3	-3.78	0.000178	-0.061858	117	0.016366	yes	LUNG
chr2_33666591_A_G_b38	RASGRP3	-3.777	0.00018	-0.061307	126	0.016231	yes	LUNG
chr2_33655112_A_AT_b38	RASGRP3	-3.776	0.000181	-0.064134	104	0.016983	yes	LUNG
chr2_33669621_C_T_b38	RASGRP3	-3.767	0.000187	-0.062457	93	0.016578	yes	LUNG
chr2_33669751_C_T_b38	RASGRP3	-3.767	0.000187	-0.062457	93	0.016578	yes	LUNG
chr2_33617107_G_A_b38	RASGRP3	-3.76	0.000193	-0.062052	100	0.016504	yes	LUNG
chr2_33568339_TA_T_b38	RASGRP3	-3.759	0.000193	-0.062794	87	0.016706	yes	LUNG
chr2_33597253_G_A_b38	RASGRP3	-3.741	0.000207	-0.06128	115	0.016381	yes	LUNG
chr2_33625060_G_A_b38	RASGRP3	-3.71	0.000234	-0.060653	105	0.016349	yes	LUNG
chr2_33636858_C_G_b38	RASGRP3	3.686	0.000256	0.094285	8	0.025581	yes	LUNG
chr2_33637736_A_T_b38	RASGRP3	3.686	0.000256	0.094285	8	0.025581	yes	LUNG
chr2_33634524_A_G_b38	RASGRP3	3.682	0.00026	0.094479	8	0.025661	yes	LUNG
chr2_33664742_G_C_b38	RASGRP3	-3.679	0.000263	-0.059457	128	0.01616	yes	LUNG
chr2_33622456_T_TAAAC_b38	RASGRP3	-3.668	0.000274	-0.060409	100	0.016471	yes	LUNG
chr2_33618734_A_G_b38	RASGRP3	-3.655	0.000287	-0.060501	100	0.016551	yes	LUNG
chr2_33613986_T_C_b38	RASGRP3	-3.645	0.000299	-0.059853	101	0.01642	yes	LUNG
chr2_33627793_A_G_b38	RASGRP3	3.641	0.000303	0.08993	8	0.024697	yes	LUNG
chr2_33537323_G_A_b38	RASGRP3	3.641	0.000304	0.055105	124	0.015135	yes	LUNG
chr2_33675020_C_G_b38	RASGRP3	-3.636	0.000309	-0.063418	86	0.017441	yes	LUNG
chr2_33388526_C_T_b38	RASGRP3	3.595	0.000361	0.06549	66	0.018219	yes	LUNG
chr2_33663649_A_C_b38	RASGRP3	-3.594	0.000363	-0.057947	130	0.016125	yes	LUNG
chr2_33640513_G_C_b38	RASGRP3	3.592	0.000365	0.090303	8	0.025142	yes	LUNG
chr2_33618669_C_CT_b38	RASGRP3	-3.588	0.000371	-0.059194	101	0.016499	yes	LUNG
chr2_33661861_G_A_b38	RASGRP3	-3.58	0.000382	-0.058256	119	0.016274	yes	LUNG
chr2_33664465_T_A_b38	RASGRP3	-3.565	0.000403	-0.058681	122	0.016459	yes	LUNG
chr2_33607748_A_G_b38	RASGRP3	-3.542	0.000439	-0.057763	102	0.016308	yes	LUNG
chr2_33664871_G_GT_b38	RASGRP3	-3.528	0.000463	-0.057689	126	0.016353	yes	LUNG
chr2_33541741_G_T_b38	RASGRP3	-3.514	0.000487	-0.052224	144	0.014863	yes	LUNG
chr2_33554839_T_C_b38	RASGRP3	3.509	0.000496	0.06053	65	0.017251	yes	LUNG
chr2_33539533_G_T_b38	RASGRP3	-3.508	0.000498	-0.051937	146	0.014806	yes	LUNG
chr2_33540888_T_C_b38	RASGRP3	-3.485	0.000541	-0.051615	144	0.014811	yes	LUNG
chr2_33676624_C_T_b38	RASGRP3	-3.481	0.000549	-0.061719	72	0.017731	yes	LUNG
chr2_33674183_T_C_b38	RASGRP3	-3.452	0.00061	-0.060134	89	0.017421	yes	LUNG
chr2_33629657_C_CT_b38	RASGRP3	3.445	0.000626	0.077008	19	0.022354	yes	LUNG
chr2_33678193_G_A_b38	RASGRP3	-3.443	0.00063	-0.060883	72	0.017684	yes	LUNG
chr2_33659127_A_G_b38	RASGRP3	-3.436	0.000646	-0.055886	130	0.016264	yes	LUNG
chr2_33673961_G_A_b38	RASGRP3	-3.433	0.000652	-0.059999	87	0.017475	yes	LUNG
chr2_33673967_T_A_b38	RASGRP3	-3.433	0.000652	-0.059999	87	0.017475	yes	LUNG
chr2_33605827_ATTTTTCT_A_b38	RASGRP3	3.429	0.000661	0.087521	6	0.025521	yes	LUNG
chr2_33130069_A_G_b38	RASGRP3	-3.429	0.000663	-0.104273	7	0.03041	yes	LUNG
chr2_33121989_T_C_b38	RASGRP3	-3.421	0.000683	-0.078513	14	0.022953	yes	LUNG
chr2_33580247_A_G_b38	RASGRP3	-3.416	0.000694	-0.055249	120	0.016173	yes	LUNG
chr2_33563965_A_G_b38	RASGRP3	3.414	0.000699	0.081378	10	0.023837	yes	LUNG
chr2_33616325_C_T_b38	RASGRP3	3.409	0.000712	0.086948	8	0.025506	yes	LUNG
chr2_33532718_G_A_b38	RASGRP3	3.398	0.000739	0.054825	107	0.016133	yes	LUNG
chr2_33606703_C_T_b38	RASGRP3	3.392	0.000757	0.087117	8	0.025685	yes	LUNG
chr2_33581338_T_A_b38	RASGRP3	3.384	0.000777	0.080904	10	0.023905	yes	LUNG
chr2_33520141_T_C_b38	RASGRP3	-3.382	0.000782	-0.055694	97	0.016466	yes	LUNG
chr2_33581900_A_T_b38	RASGRP3	3.378	0.000794	0.080923	10	0.023955	yes	LUNG
chr2_33121159_C_CT_b38	RASGRP3	3.376	8e-04	0.124008	7	0.036731	yes	LUNG
chr2_33661731_A_G_b38	RASGRP3	-3.353	0.000868	-0.054597	130	0.016284	yes	LUNG
chr2_33606727_T_C_b38	RASGRP3	3.349	0.00088	0.089622	5	0.026759	yes	LUNG
chr2_33135059_A_G_b38	RASGRP3	-3.316	0.000987	-0.079509	15	0.023975	yes	LUNG
chr2_33678762_C_CACTT_b38	RASGRP3	-3.289	0.00108	-0.05586	115	0.016981	yes	LUNG
chr2_33620497_T_C_b38	RASGRP3	3.286	0.0011	0.066354	25	0.020196	yes	LUNG
chr2_33391173_C_A_b38	RASGRP3	3.261	0.0012	0.052533	109	0.01611	yes	LUNG
chr2_33134390_C_T_b38	RASGRP3	-3.26	0.0012	-0.078348	15	0.02403	yes	LUNG
chr2_33634843_C_CTT_b38	RASGRP3	3.249	0.00125	0.092565	7	0.028489	yes	LUNG
chr2_33576389_C_T_b38	RASGRP3	-3.243	0.00127	-0.052934	117	0.016323	yes	LUNG
chr2_33518880_G_GTCA_b38	RASGRP3	-3.232	0.00132	-0.053768	94	0.016634	yes	LUNG
chr2_33478490_C_T_b38	RASGRP3	3.226	0.00135	0.053919	77	0.016714	yes	LUNG
chr2_33385643_G_A_b38	RASGRP3	3.225	0.00135	0.066327	27	0.020565	yes	LUNG
chr2_33382111_T_G_b38	RASGRP3	3.218	0.00139	0.063884	33	0.019855	yes	LUNG
chr2_33567745_C_T_b38	RASGRP3	-3.213	0.00141	-0.054369	73	0.016923	yes	LUNG
chr2_33512902_A_G_b38	RASGRP3	-3.169	0.00164	-0.052476	107	0.016562	yes	LUNG
chr2_33091518_T_C_b38	RASGRP3	-3.165	0.00166	-0.08217	12	0.025962	yes	LUNG
chr2_33135489_G_A_b38	RASGRP3	-3.161	0.00168	-0.076805	14	0.024299	yes	LUNG
chr2_32930449_G_GCGCACACA_b38	RASGRP3	-3.155	0.00172	-0.097734	3	0.030981	yes	LUNG
chr2_33620575_G_A_b38	RASGRP3	3.142	0.00179	0.063559	25	0.020229	yes	LUNG
chr2_33540615_TTCTC_T_b38	RASGRP3	-3.119	0.00193	-0.050008	106	0.016032	yes	LUNG
chr2_32908529_G_A_b38	RASGRP3	-3.107	0.00201	-0.05534	44	0.017813	yes	LUNG
chr2_32904478_A_C_b38	RASGRP3	-3.099	0.00207	-0.054975	45	0.01774	yes	LUNG
chr2_32904614_C_G_b38	RASGRP3	-3.099	0.00207	-0.054975	45	0.01774	yes	LUNG
chr2_33676027_A_T_b38	RASGRP3	-3.091	0.00212	-0.052865	98	0.017102	yes	LUNG
chr2_32905726_T_C_b38	RASGRP3	-3.09	0.00213	-0.054868	45	0.017758	yes	LUNG
chr2_32906125_A_T_b38	RASGRP3	-3.09	0.00213	-0.054868	45	0.017758	yes	LUNG
chr2_32911618_G_C_b38	RASGRP3	-3.09	0.00213	-0.054868	45	0.017758	yes	LUNG
chr2_32905244_T_A_b38	RASGRP3	-3.055	0.00239	-0.054404	45	0.017808	yes	LUNG
chr2_33673921_C_G_b38	RASGRP3	-3.031	0.00258	-0.051803	98	0.017092	yes	LUNG
chr2_33534694_A_AT_b38	RASGRP3	3.011	0.00275	0.057401	30	0.019064	yes	LUNG
chr2_33706678_T_C_b38	RASGRP3	2.994	0.0029	0.082107	4	0.027421	yes	LUNG
chr2_33679032_C_G_b38	RASGRP3	-2.987	0.00297	-0.051173	95	0.017131	yes	LUNG
chr2_32910627_C_T_b38	RASGRP3	-2.987	0.00298	-0.053362	44	0.017866	yes	LUNG
chr2_33591195_C_CT_b38	RASGRP3	-2.973	0.00311	-0.056413	63	0.018974	yes	LUNG
chr2_32920136_A_T_b38	RASGRP3	-2.967	0.00317	-0.050229	64	0.016928	yes	LUNG
chr2_33389120_C_T_b38	RASGRP3	-2.963	0.00321	-0.04925	137	0.016623	yes	LUNG
chr2_32902717_C_T_b38	RASGRP3	-2.952	0.00332	-0.092835	4	0.031444	yes	LUNG
chr2_33118220_A_G_b38	RASGRP3	-2.938	0.00347	-0.085673	6	0.029158	yes	LUNG
chr2_33588900_A_AT_b38	RASGRP3	-2.938	0.00348	-0.051678	103	0.017591	yes	LUNG
chr2_33502501_C_CTT_b38	RASGRP3	-2.9	0.00391	-0.072522	11	0.025004	yes	LUNG
chr2_33092197_G_A_b38	RASGRP3	-2.877	0.00421	-0.0655	17	0.02277	yes	LUNG
chr2_33375242_G_C_b38	RASGRP3	2.875	0.00423	0.050756	77	0.017654	yes	LUNG
chr2_33534062_A_C_b38	RASGRP3	-2.868	0.00432	-0.067757	7	0.023622	yes	LUNG
chr2_33538430_G_C_b38	RASGRP3	-2.848	0.0046	-0.067401	7	0.023666	yes	LUNG
chr2_33543901_C_G_b38	RASGRP3	-2.843	0.00467	-0.047845	71	0.016828	yes	LUNG
chr2_33374733_T_C_b38	RASGRP3	2.838	0.00475	0.054921	49	0.019355	yes	LUNG
chr2_33137576_T_G_b38	RASGRP3	-2.837	0.00477	-0.046803	126	0.0165	yes	LUNG
chr2_33525341_AAT_A_b38	RASGRP3	-2.833	0.00482	-0.067219	7	0.023727	yes	LUNG
chr2_33093442_C_G_b38	RASGRP3	-2.826	0.00493	-0.070897	14	0.02509	yes	LUNG
chr2_33400190_C_CCG_b38	RASGRP3	2.824	0.00495	0.061692	29	0.021842	yes	LUNG
chr2_33441920_G_A_b38	RASGRP3	2.805	0.00526	0.05356	31	0.019096	yes	LUNG
chr2_33496718_G_A_b38	RASGRP3	-2.802	0.0053	-0.063711	14	0.022737	yes	LUNG
chr2_33358127_A_G_b38	RASGRP3	2.788	0.00554	0.083195	4	0.029845	yes	LUNG
chr2_33630302_AT_A_b38	RASGRP3	-2.76	0.00603	-0.049415	98	0.017906	yes	LUNG
chr2_33091214_G_A_b38	RASGRP3	-2.759	0.00604	-0.070069	16	0.0254	yes	LUNG
chr2_33001466_C_T_b38	RASGRP3	-2.756	0.00609	-0.103287	9	0.037474	yes	LUNG
chr2_33638203_CT_C_b38	RASGRP3	2.754	0.00614	0.078613	6	0.028549	yes	LUNG
chr2_33496429_A_G_b38	RASGRP3	-2.742	0.00636	-0.062221	14	0.022694	yes	LUNG
chr2_33543280_C_G_b38	RASGRP3	-2.738	0.00643	-0.066117	6	0.024146	yes	LUNG
chr2_33678269_A_G_b38	RASGRP3	-2.737	0.00644	-0.04806	94	0.017558	yes	LUNG
chr2_33673112_G_T_b38	RASGRP3	-2.737	0.00646	-0.046503	126	0.016993	yes	LUNG
chr2_33653284_GTCTA_G_b38	RASGRP3	-2.721	0.00676	-0.055506	18	0.020396	yes	LUNG
chr2_33622130_C_CA_b38	RASGRP3	2.715	0.00688	0.074434	10	0.027412	yes	LUNG
chr2_33539996_AAAAAG_A_b38	RASGRP3	-2.701	0.00717	-0.045456	114	0.016827	yes	LUNG
chr2_33092645_AT_A_b38	RASGRP3	-2.691	0.0074	-0.069281	14	0.025749	yes	LUNG
chr2_32909975_C_CT_b38	RASGRP3	2.691	0.0074	0.05267	31	0.019576	yes	LUNG
chr2_33535943_T_C_b38	RASGRP3	-2.681	0.0076	-0.061772	9	0.023037	yes	LUNG
chr2_33534328_C_T_b38	RASGRP3	-2.679	0.00766	-0.064554	6	0.024098	yes	LUNG
chr2_33622130_CA_C_b38	RASGRP3	-2.654	0.00824	-0.049358	43	0.018597	yes	LUNG
chr2_33112790_A_G_b38	RASGRP3	2.641	0.00856	0.150199	3	0.05687	yes	LUNG
chr2_33664073_A_G_b38	RASGRP3	-2.638	0.00863	-0.0639	9	0.024222	yes	LUNG
chr2_33538452_G_A_b38	RASGRP3	-2.616	0.00919	-0.063268	6	0.024183	yes	LUNG
chr2_33532968_G_A_b38	RASGRP3	-2.593	0.00982	-0.063688	6	0.02456	yes	LUNG
chr2_33726787_AAGAG_A_b38	RASGRP3	2.588	0.00998	0.045201	51	0.017468	yes	LUNG
chr2_33557844_G_A_b38	RASGRP3	12.181	1.2e-29	0.28202	4	0.023153	no	LUNG
chr2_33531453_C_T_b38	RASGRP3	11.885	1.79e-28	0.283136	4	0.023823	no	LUNG
chr2_33529269_C_A_b38	RASGRP3	11.301	3.35e-26	0.266549	5	0.023586	no	LUNG
chr2_33526597_C_T_b38	RASGRP3	10.985	5.35e-25	0.272906	3	0.024842	no	LUNG
chr2_33527062_GC_G_b38	RASGRP3	10.985	5.35e-25	0.272906	3	0.024842	no	LUNG
chr2_33537330_C_CCCAACACA_b38	RASGRP3	9.844	8.22e-21	0.198354	26	0.020151	no	LUNG
chr2_33546942_C_G_b38	RASGRP3	9.646	4.08e-20	0.239818	5	0.024862	no	LUNG
chr2_33540561_TGTGTGTGTGTG_T_b38	RASGRP3	9.483	1.51e-19	0.222664	11	0.02348	no	LUNG
chr2_33521266_C_T_b38	RASGRP3	8.208	2.46e-15	0.153164	33	0.01866	no	LUNG
chr2_33529318_C_T_b38	RASGRP3	7.976	1.29e-14	0.164501	13	0.020624	no	LUNG
chr2_33523649_G_A_b38	RASGRP3	7.444	5.11e-13	0.154829	17	0.020799	no	LUNG
chr2_33555164_G_A_b38	RASGRP3	7.331	1.09e-12	0.152451	17	0.020796	no	LUNG
chr2_33565263_A_G_b38	RASGRP3	6.725	5.42e-11	0.127451	35	0.018952	no	LUNG
chr2_33581561_C_T_b38	RASGRP3	6.575	1.37e-10	0.126807	27	0.019286	no	LUNG
chr2_33582025_C_T_b38	RASGRP3	6.521	1.91e-10	0.126352	26	0.019377	no	LUNG
chr2_33594326_C_T_b38	RASGRP3	6.444	3.03e-10	0.124781	29	0.019363	no	LUNG
chr2_33594385_G_A_b38	RASGRP3	6.444	3.03e-10	0.124781	29	0.019363	no	LUNG
chr2_33596617_C_T_b38	RASGRP3	6.429	3.32e-10	0.124476	29	0.019362	no	LUNG
chr2_33670716_C_T_b38	RASGRP3	6.402	3.9e-10	0.120747	25	0.018861	no	LUNG
chr2_33652477_C_A_b38	RASGRP3	5.932	6.04e-09	0.118919	18	0.020048	no	LUNG
chr2_33586869_A_T_b38	RASGRP3	5.842	9.96e-09	0.116318	24	0.019909	no	LUNG
chr2_33656248_TTC_T_b38	RASGRP3	5.829	1.07e-08	0.116408	18	0.019971	no	LUNG
chr2_33536322_G_GA_b38	RASGRP3	5.737	1.78e-08	0.142612	13	0.024858	no	LUNG
chr2_33650021_A_G_b38	RASGRP3	5.71	2.07e-08	0.114142	18	0.019988	no	LUNG
chr2_33640631_A_C_b38	RASGRP3	5.635	3.11e-08	0.112945	18	0.020043	no	LUNG
chr2_33641397_G_C_b38	RASGRP3	5.619	3.39e-08	0.112595	18	0.020037	no	LUNG
chr2_33662459_C_T_b38	RASGRP3	5.542	5.15e-08	0.10982	20	0.019817	no	LUNG
chr2_33661156_C_T_b38	RASGRP3	5.504	6.27e-08	0.103577	27	0.018817	no	LUNG
chr2_33661310_C_T_b38	RASGRP3	5.504	6.27e-08	0.103577	27	0.018817	no	LUNG
chr2_33663555_T_C_b38	RASGRP3	5.495	6.58e-08	0.109234	20	0.019877	no	LUNG
chr2_33639021_G_A_b38	RASGRP3	5.452	8.27e-08	0.109353	18	0.020056	no	LUNG
chr2_33523461_TA_T_b38	RASGRP3	5.397	1.11e-07	0.117147	9	0.021706	no	LUNG
chr2_33656848_TA_T_b38	RASGRP3	5.059	6.19e-07	0.097191	29	0.019213	no	LUNG
chr2_33579727_C_T_b38	RASGRP3	4.798	2.19e-06	0.158053	5	0.032943	no	LUNG
chr2_33573675_A_G_b38	RASGRP3	4.756	2.68e-06	0.162361	4	0.034141	no	LUNG
chr2_33592302_T_C_b38	RASGRP3	4.685	3.72e-06	0.154783	5	0.033036	no	LUNG
chr2_33565010_T_TACACACAC_b38	RASGRP3	4.245	2.66e-05	0.137256	3	0.032334	no	LUNG
chr2_33671460_G_A_b38	RASGRP3	4.195	3.29e-05	0.104372	7	0.024877	no	LUNG
chr2_33577889_G_A_b38	RASGRP3	-4.166	3.72e-05	-0.07035	78	0.016885	no	LUNG
chr2_33575950_G_A_b38	RASGRP3	-4.055	5.91e-05	-0.068328	77	0.016848	no	LUNG
chr2_33571267_T_A_b38	RASGRP3	-4.034	6.45e-05	-0.067463	82	0.016722	no	LUNG
chr2_33569371_A_G_b38	RASGRP3	-3.948	9.17e-05	-0.066519	81	0.01685	no	LUNG
chr2_33509399_C_CA_b38	RASGRP3	3.841	0.00014	0.094227	5	0.024532	no	LUNG
chr2_33593131_C_T_b38	RASGRP3	-3.729	0.000217	-0.060177	121	0.016138	no	LUNG
chr2_33624514_C_A_b38	RASGRP3	-3.713	0.000231	-0.060294	107	0.01624	no	LUNG
chr2_33571342_T_C_b38	RASGRP3	-3.69	0.000252	-0.061651	83	0.016707	no	LUNG
chr2_33629277_A_G_b38	RASGRP3	-3.662	0.00028	-0.059163	111	0.016156	no	LUNG
chr2_33672387_A_G_b38	RASGRP3	3.654	0.000289	0.080761	13	0.0221	no	LUNG
chr2_33592492_A_G_b38	RASGRP3	-3.652	0.000291	-0.058813	122	0.016104	no	LUNG
chr2_33614957_G_A_b38	RASGRP3	-3.642	0.000302	-0.060015	99	0.016477	no	LUNG
chr2_33586449_C_G_b38	RASGRP3	-3.634	0.000311	-0.058825	121	0.016185	no	LUNG
chr2_33590404_A_G_b38	RASGRP3	-3.59	0.000368	-0.05795	122	0.016143	no	LUNG
chr2_33633545_T_G_b38	RASGRP3	3.584	0.000375	0.099223	4	0.027681	no	LUNG
chr2_33605847_C_CT_b38	RASGRP3	3.55	0.000427	0.094913	4	0.026737	no	LUNG
chr2_33602942_T_C_b38	RASGRP3	3.547	0.000432	0.099661	4	0.028101	no	LUNG
chr2_33577835_T_C_b38	RASGRP3	-3.532	0.000456	-0.056941	121	0.016123	no	LUNG
chr2_33631185_T_G_b38	RASGRP3	-3.53	0.00046	-0.056619	132	0.016042	no	LUNG
chr2_33589523_A_G_b38	RASGRP3	-3.51	0.000495	-0.056284	125	0.016037	no	LUNG
chr2_33607432_G_A_b38	RASGRP3	3.436	0.000645	0.092725	5	0.026985	no	LUNG
chr2_33631863_T_C_b38	RASGRP3	-3.434	0.000649	-0.055336	131	0.016112	no	LUNG
chr2_33615450_C_G_b38	RASGRP3	3.374	0.000806	0.089924	5	0.026651	no	LUNG
chr2_33521739_T_A_b38	RASGRP3	3.339	0.000911	0.0657	28	0.019675	no	LUNG
chr2_33575832_C_A_b38	RASGRP3	-3.333	0.000931	-0.053334	125	0.016001	no	LUNG
chr2_33615793_A_T_b38	RASGRP3	3.221	0.00137	0.085826	5	0.026647	no	LUNG
chr2_33621944_G_A_b38	RASGRP3	3.221	0.00137	0.085826	5	0.026647	no	LUNG
chr2_33623483_C_T_b38	RASGRP3	3.221	0.00137	0.085826	5	0.026647	no	LUNG
chr2_33668030_G_A_b38	RASGRP3	3.217	0.00139	0.089675	5	0.027875	no	LUNG
chr2_32890331_C_CAAAAA_b38	RASGRP3	-3.202	0.00146	-0.135478	3	0.042311	no	LUNG
chr2_33669427_A_C_b38	RASGRP3	3.157	0.0017	0.069901	13	0.022139	no	LUNG
chr2_33522498_A_G_b38	RASGRP3	3.142	0.00179	0.063	27	0.020053	no	LUNG
chr2_33546340_A_G_b38	RASGRP3	3.109	0.002	0.06108	29	0.019644	no	LUNG
chr2_33611855_A_C_b38	RASGRP3	3.067	0.00229	0.075627	11	0.024658	no	LUNG
chr2_33520269_T_C_b38	RASGRP3	3.064	0.00232	0.06044	27	0.019724	no	LUNG
chr2_33567211_T_TA_b38	RASGRP3	3.056	0.00238	0.104487	3	0.034195	no	LUNG
chr2_33669574_A_G_b38	RASGRP3	3.052	0.00241	0.067345	13	0.022067	no	LUNG
chr2_32985271_ACTGAGCT_A_b38	RASGRP3	3.005	0.00281	0.049737	77	0.016553	no	LUNG
chr2_33539888_A_T_b38	RASGRP3	2.962	0.00322	0.057698	29	0.019479	no	LUNG
chr2_33631252_G_T_b38	RASGRP3	2.957	0.00327	0.04913	135	0.016613	no	LUNG
chr2_33034228_TA_T_b38	RASGRP3	-2.922	0.00366	-0.055443	40	0.018977	no	LUNG
chr2_32905924_A_T_b38	RASGRP3	-2.916	0.00372	-0.047383	82	0.016248	no	LUNG
chr2_33522218_G_A_b38	RASGRP3	2.909	0.00381	0.057946	27	0.019919	no	LUNG
chr2_33517217_G_A_b38	RASGRP3	2.884	0.00412	0.056481	28	0.019587	no	LUNG
chr2_33530930_T_C_b38	RASGRP3	2.87	0.0043	0.05679	28	0.019789	no	LUNG
chr2_33349444_GA_G_b38	RASGRP3	2.849	0.00459	0.057756	17	0.020273	no	LUNG
chr2_32905748_A_AAGAGAGAGAG_b38	RASGRP3	-2.848	0.00461	-0.065729	8	0.023081	no	LUNG
chr2_33539650_C_T_b38	RASGRP3	2.844	0.00466	0.055404	29	0.01948	no	LUNG
chr2_33030015_T_C_b38	RASGRP3	-2.838	0.00475	-0.125027	3	0.044057	no	LUNG
chr2_33030332_C_T_b38	RASGRP3	-2.838	0.00475	-0.125027	3	0.044057	no	LUNG
chr2_33383890_A_C_b38	RASGRP3	2.825	0.00495	0.058632	19	0.020758	no	LUNG
chr2_33518738_C_T_b38	RASGRP3	2.823	0.00497	0.05514	29	0.019531	no	LUNG
chr2_33030370_A_G_b38	RASGRP3	-2.821	0.005	-0.123695	3	0.043847	no	LUNG
chr2_33340257_C_CA_b38	RASGRP3	2.821	0.00501	0.142377	4	0.050479	no	LUNG
chr2_33121159_CTTT_C_b38	RASGRP3	-2.816	0.00508	-0.107557	4	0.038197	no	LUNG
chr2_32902719_G_A_b38	RASGRP3	-2.799	0.00535	-0.082334	5	0.029414	no	LUNG
chr2_32849873_G_GGT_b38	RASGRP3	2.797	0.00539	0.096579	7	0.034534	no	LUNG
chr2_33545661_T_C_b38	RASGRP3	2.792	0.00546	0.055658	28	0.019934	no	LUNG
chr2_33577495_T_TA_b38	RASGRP3	2.746	0.00628	0.07258	4	0.026434	no	LUNG
chr2_33603907_A_C_b38	RASGRP3	2.734	0.0065	0.070509	8	0.025786	no	LUNG
chr2_34396470_A_ATT_b38	RASGRP3	-2.726	0.00666	-0.050571	39	0.01855	no	LUNG
chr2_33509815_G_A_b38	RASGRP3	2.722	0.00674	0.053918	27	0.019806	no	LUNG
chr2_33545793_CTAT_C_b38	RASGRP3	2.706	0.00707	0.052988	30	0.019582	no	LUNG
chr2_33388165_G_A_b38	RASGRP3	2.683	0.00758	0.047833	63	0.017831	no	LUNG
chr2_33515921_T_A_b38	RASGRP3	2.669	0.00789	0.060134	17	0.022532	no	LUNG
chr2_32907754_A_G_b38	RASGRP3	-2.659	0.00811	-0.043315	81	0.016288	no	LUNG
chr2_33362181_A_G_b38	RASGRP3	-2.655	0.00821	-0.075573	3	0.02846	no	LUNG
chr2_33369563_C_CT_b38	RASGRP3	2.655	0.00821	0.05546	19	0.020888	no	LUNG
chr2_33603617_TC_T_b38	RASGRP3	2.625	0.00896	0.067832	8	0.02584	no	LUNG
chr2_33525699_C_CAA_b38	RASGRP3	2.623	0.00903	0.102996	10	0.039273	no	LUNG
chr2_33035784_A_G_b38	RASGRP3	-2.605	0.00949	-0.116636	3	0.044771	no	LUNG
chr2_32977031_G_A_b38	RASGRP3	2.604	0.00952	0.043934	130	0.01687	no	LUNG
chr2_33764518_G_GTT_b38	RASGRP3	2.604	0.00953	0.080016	3	0.030732	no	LUNG
chr2_33511214_C_T_b38	RASGRP3	2.597	0.00973	0.04827	36	0.018589	no	LUNG
chr2_33346723_T_G_b38	RASGRP3	2.588	0.00998	0.070283	3	0.027159	no	LUNG
chr2_33387775_G_A_b38	RASGRP3	2.587	0.01	0.046316	64	0.017903	no	LUNG
chr2_33537896_A_G_b38	RASGRP3	9.7	1.03e-16	0.345367	3	0.035604	yes	SLVRYG
chr2_33557635_G_A_b38	RASGRP3	9.665	1.25e-16	0.351362	3	0.036354	yes	SLVRYG
chr2_33559304_G_A_b38	RASGRP3	9.665	1.25e-16	0.351362	3	0.036354	yes	SLVRYG
chr2_33550216_T_A_b38	RASGRP3	9.38	5.9e-16	0.343273	3	0.036598	yes	SLVRYG
chr2_33548469_T_C_b38	RASGRP3	9.318	8.24e-16	0.348249	3	0.037374	yes	SLVRYG
chr2_33550484_C_G_b38	RASGRP3	9.318	8.24e-16	0.348249	3	0.037374	yes	SLVRYG
chr2_33554542_A_G_b38	RASGRP3	9.318	8.24e-16	0.348249	3	0.037374	yes	SLVRYG
chr2_33559734_G_A_b38	RASGRP3	9.03	3.93e-15	0.335285	3	0.037132	yes	SLVRYG
chr2_33559068_A_G_b38	RASGRP3	8.845	1.06e-14	0.333632	3	0.037718	yes	SLVRYG
chr2_33553995_C_T_b38	RASGRP3	8.735	1.92e-14	0.333228	3	0.038149	yes	SLVRYG
chr2_33557844_G_A_b38	RASGRP3	8.639	3.22e-14	0.315642	3	0.036537	yes	SLVRYG
chr2_33548762_A_G_b38	RASGRP3	8.524	5.95e-14	0.337329	3	0.039574	yes	SLVRYG
chr2_33537330_C_CCCAACACA_b38	RASGRP3	6.496	2.05e-09	0.230394	8	0.035468	yes	SLVRYG
chr2_33529318_C_T_b38	RASGRP3	6.043	1.81e-08	0.223379	4	0.036964	yes	SLVRYG
chr2_33525341_A_AAT_b38	RASGRP3	5.819	5.18e-08	0.213841	8	0.036747	yes	SLVRYG
chr2_33561445_C_A_b38	RASGRP3	5.569	1.64e-07	0.209144	4	0.037556	yes	SLVRYG
chr2_33555164_G_A_b38	RASGRP3	5.478	2.47e-07	0.214569	3	0.039169	yes	SLVRYG
chr2_33536322_G_GA_b38	RASGRP3	5.378	3.86e-07	0.226657	6	0.042142	yes	SLVRYG
chr2_33565263_A_G_b38	RASGRP3	4.89	3.22e-06	0.15603	18	0.031911	yes	SLVRYG
chr2_33589264_G_C_b38	RASGRP3	4.863	3.61e-06	0.148629	19	0.030565	yes	SLVRYG
chr2_33590881_T_C_b38	RASGRP3	4.863	3.61e-06	0.148629	19	0.030565	yes	SLVRYG
chr2_33596450_T_G_b38	RASGRP3	4.863	3.61e-06	0.148629	19	0.030565	yes	SLVRYG
chr2_33586869_A_T_b38	RASGRP3	4.849	3.82e-06	0.164065	13	0.033833	yes	SLVRYG
chr2_33532487_C_A_b38	RASGRP3	4.811	4.48e-06	0.143365	35	0.029798	yes	SLVRYG
chr2_33594326_C_T_b38	RASGRP3	4.711	6.8e-06	0.149766	17	0.031793	yes	SLVRYG
chr2_33594385_G_A_b38	RASGRP3	4.711	6.8e-06	0.149766	17	0.031793	yes	SLVRYG
chr2_33596617_C_T_b38	RASGRP3	4.711	6.8e-06	0.149766	17	0.031793	yes	SLVRYG
chr2_33596963_A_T_b38	RASGRP3	4.711	6.8e-06	0.149766	17	0.031793	yes	SLVRYG
chr2_33561192_A_G_b38	RASGRP3	4.572	1.2e-05	0.134485	33	0.029414	yes	SLVRYG
chr2_33564467_A_G_b38	RASGRP3	4.548	1.32e-05	0.139401	25	0.030653	yes	SLVRYG
chr2_33581561_C_T_b38	RASGRP3	4.43	2.12e-05	0.141025	17	0.031833	yes	SLVRYG
chr2_33582025_C_T_b38	RASGRP3	4.43	2.12e-05	0.141025	17	0.031833	yes	SLVRYG
chr2_33523649_G_A_b38	RASGRP3	4.374	2.65e-05	0.172683	4	0.039481	yes	SLVRYG
chr2_33512177_G_A_b38	RASGRP3	4.335	3.08e-05	0.189669	7	0.043753	yes	SLVRYG
chr2_33564001_C_G_b38	RASGRP3	4.238	4.5e-05	0.139594	21	0.03294	yes	SLVRYG
chr2_33521266_C_T_b38	RASGRP3	4.008	0.000108	0.1529	8	0.038147	yes	SLVRYG
chr2_33537323_G_A_b38	RASGRP3	3.975	0.000122	0.113551	37	0.028566	yes	SLVRYG
chr2_33650021_A_G_b38	RASGRP3	3.949	0.000134	0.135286	11	0.03426	yes	SLVRYG
chr2_33616325_C_T_b38	RASGRP3	3.821	0.000214	0.159628	5	0.041781	yes	SLVRYG
chr2_33652477_C_A_b38	RASGRP3	3.772	0.000254	0.129766	11	0.034398	yes	SLVRYG
chr2_33639021_G_A_b38	RASGRP3	3.743	0.000282	0.129984	11	0.034723	yes	SLVRYG
chr2_33640631_A_C_b38	RASGRP3	3.722	0.000305	0.129463	11	0.034785	yes	SLVRYG
chr2_33641397_G_C_b38	RASGRP3	3.722	0.000305	0.129463	11	0.034785	yes	SLVRYG
chr2_33771977_TC_T_b38	RASGRP3	3.688	0.000343	0.172263	4	0.046713	yes	SLVRYG
chr2_33659035_G_A_b38	RASGRP3	3.68	0.000353	0.157903	5	0.042907	yes	SLVRYG
chr2_33563965_A_G_b38	RASGRP3	3.675	0.00036	0.140194	7	0.038152	yes	SLVRYG
chr2_33640513_G_C_b38	RASGRP3	3.65	0.000392	0.151904	5	0.041617	yes	SLVRYG
chr2_33621819_C_A_b38	RASGRP3	3.643	0.000402	0.110549	22	0.030348	yes	SLVRYG
chr2_33623108_T_C_b38	RASGRP3	3.643	0.000402	0.110549	22	0.030348	yes	SLVRYG
chr2_33663555_T_C_b38	RASGRP3	3.621	0.000434	0.1222	11	0.033747	yes	SLVRYG
chr2_33622160_C_T_b38	RASGRP3	3.61	0.00045	0.117287	17	0.032487	yes	SLVRYG
chr2_33662459_C_T_b38	RASGRP3	3.609	0.000452	0.122298	11	0.033883	yes	SLVRYG
chr2_33634524_A_G_b38	RASGRP3	3.56	0.000536	0.151596	5	0.042586	yes	SLVRYG
chr2_33636858_C_G_b38	RASGRP3	3.56	0.000536	0.151596	5	0.042586	yes	SLVRYG
chr2_33637736_A_T_b38	RASGRP3	3.56	0.000536	0.151596	5	0.042586	yes	SLVRYG
chr2_33991323_CT_C_b38	RASGRP3	3.529	0.000595	0.12626	25	0.035776	yes	SLVRYG
chr2_33771916_C_T_b38	RASGRP3	3.525	0.000603	0.162294	5	0.046036	yes	SLVRYG
chr2_33771954_G_T_b38	RASGRP3	3.525	0.000603	0.162294	5	0.046036	yes	SLVRYG
chr2_33606703_C_T_b38	RASGRP3	3.493	0.000672	0.145312	5	0.041597	yes	SLVRYG
chr2_33581900_A_T_b38	RASGRP3	3.491	0.000677	0.134675	7	0.038573	yes	SLVRYG
chr2_33667549_A_G_b38	RASGRP3	3.419	0.000864	0.149677	5	0.043782	yes	SLVRYG
chr2_33667555_A_G_b38	RASGRP3	3.419	0.000864	0.149677	5	0.043782	yes	SLVRYG
chr2_33581338_T_A_b38	RASGRP3	3.403	0.000912	0.1317	7	0.038706	yes	SLVRYG
chr2_33625315_G_A_b38	RASGRP3	3.381	0.000981	0.109379	16	0.032355	yes	SLVRYG
chr2_33567745_C_T_b38	RASGRP3	-3.35	0.00109	-0.106723	28	0.031857	yes	SLVRYG
chr2_33622592_T_C_b38	RASGRP3	3.316	0.00121	0.1134	17	0.034197	yes	SLVRYG
chr2_33620497_T_C_b38	RASGRP3	3.308	0.00124	0.113478	11	0.0343	yes	SLVRYG
chr2_33620575_G_A_b38	RASGRP3	3.308	0.00124	0.113478	11	0.0343	yes	SLVRYG
chr2_34011443_T_TA_b38	RASGRP3	3.302	0.00127	0.125415	18	0.037978	yes	SLVRYG
chr2_33534694_A_AT_b38	RASGRP3	3.301	0.00127	0.137312	5	0.041593	yes	SLVRYG
chr2_33657078_T_C_b38	RASGRP3	3.292	0.00131	0.111685	15	0.03393	yes	SLVRYG
chr2_33613720_G_A_b38	RASGRP3	3.232	0.00159	0.119287	8	0.036909	yes	SLVRYG
chr2_33975731_C_T_b38	RASGRP3	3.23	0.0016	0.10671	34	0.033038	yes	SLVRYG
chr2_33976154_G_A_b38	RASGRP3	3.23	0.0016	0.10671	34	0.033038	yes	SLVRYG
chr2_33986100_G_A_b38	RASGRP3	3.227	0.00162	0.10769	32	0.033375	yes	SLVRYG
chr2_33605827_ATTTTTCT_A_b38	RASGRP3	3.223	0.00164	0.134579	5	0.041751	yes	SLVRYG
chr2_33530852_CT_C_b38	RASGRP3	3.217	0.00167	0.105261	26	0.032719	yes	SLVRYG
chr2_33537321_C_CA_b38	RASGRP3	3.172	0.00193	0.101977	20	0.032147	yes	SLVRYG
chr2_33623242_AT_A_b38	RASGRP3	3.172	0.00193	0.155472	3	0.049011	yes	SLVRYG
chr2_33622130_C_CA_b38	RASGRP3	3.167	0.00196	0.152063	4	0.048016	yes	SLVRYG
chr2_33975876_G_A_b38	RASGRP3	3.149	0.00208	0.104072	33	0.033054	yes	SLVRYG
chr2_33983653_G_A_b38	RASGRP3	3.149	0.00208	0.104072	33	0.033054	yes	SLVRYG
chr2_33983742_G_A_b38	RASGRP3	3.149	0.00208	0.104072	33	0.033054	yes	SLVRYG
chr2_33984611_T_C_b38	RASGRP3	3.149	0.00208	0.104072	33	0.033054	yes	SLVRYG
chr2_33532718_G_A_b38	RASGRP3	3.111	0.00234	0.10072	26	0.03238	yes	SLVRYG
chr2_34415706_GT_G_b38	RASGRP3	-3.094	0.00247	-0.110357	19	0.035668	yes	SLVRYG
chr2_33624881_G_GT_b38	RASGRP3	3.079	0.00259	0.101785	16	0.033061	yes	SLVRYG
chr2_33996758_C_CA_b38	RASGRP3	3.061	0.00274	0.10048	32	0.032831	yes	SLVRYG
chr2_33634816_G_T_b38	RASGRP3	3.06	0.00274	0.129571	5	0.042343	yes	SLVRYG
chr2_33802615_A_G_b38	RASGRP3	-2.976	0.00354	-0.132498	3	0.044519	yes	SLVRYG
chr2_33979200_G_A_b38	RASGRP3	2.924	0.00414	0.098598	31	0.033717	yes	SLVRYG
chr2_33982340_C_T_b38	RASGRP3	2.924	0.00414	0.098598	31	0.033717	yes	SLVRYG
chr2_33983079_C_G_b38	RASGRP3	2.924	0.00414	0.098598	31	0.033717	yes	SLVRYG
chr2_33770624_C_T_b38	RASGRP3	2.917	0.00424	0.108694	11	0.037268	yes	SLVRYG
chr2_33770852_A_G_b38	RASGRP3	2.917	0.00424	0.108694	11	0.037268	yes	SLVRYG
chr2_33770953_C_T_b38	RASGRP3	2.917	0.00424	0.108694	11	0.037268	yes	SLVRYG
chr2_32894316_A_G_b38	RASGRP3	-2.897	0.00449	-0.099216	13	0.034246	yes	SLVRYG
chr2_33006381_CTTT_C_b38	RASGRP3	2.886	0.00465	0.111837	5	0.038757	yes	SLVRYG
chr2_33543901_C_G_b38	RASGRP3	-2.88	0.00472	-0.100279	19	0.034818	yes	SLVRYG
chr2_33073260_C_T_b38	RASGRP3	2.874	0.00481	0.114232	7	0.039746	yes	SLVRYG
chr2_33626436_A_T_b38	RASGRP3	2.854	0.0051	0.095512	16	0.033462	yes	SLVRYG
chr2_33562267_C_CT_b38	RASGRP3	2.842	0.00529	0.09008	29	0.031699	yes	SLVRYG
chr2_33771740_G_T_b38	RASGRP3	2.829	0.00548	0.105524	11	0.037296	yes	SLVRYG
chr2_33990535_C_CTT_b38	RASGRP3	2.804	0.0059	0.09256	18	0.033009	yes	SLVRYG
chr2_32751258_C_CCA_b38	RASGRP3	2.777	0.00638	0.097073	15	0.034953	yes	SLVRYG
chr2_32844978_A_T_b38	RASGRP3	-2.763	0.00665	-0.096039	20	0.034759	yes	SLVRYG
chr2_33656848_TA_T_b38	RASGRP3	2.732	0.00727	0.090414	15	0.033097	yes	SLVRYG
chr2_33072516_C_A_b38	RASGRP3	2.723	0.00746	0.1095	7	0.040218	yes	SLVRYG
chr2_33133616_C_G_b38	RASGRP3	2.717	0.00758	0.110399	5	0.040636	yes	SLVRYG
chr2_33523461_TA_T_b38	RASGRP3	2.694	0.00809	0.112357	4	0.041707	yes	SLVRYG
chr2_33601956_TA_T_b38	RASGRP3	2.691	0.00815	0.088296	33	0.032806	yes	SLVRYG
chr2_33669427_A_C_b38	RASGRP3	2.668	0.00871	0.107109	7	0.040152	yes	SLVRYG
chr2_33669574_A_G_b38	RASGRP3	2.668	0.00871	0.107109	7	0.040152	yes	SLVRYG
chr2_33998628_G_A_b38	RASGRP3	2.632	0.00963	0.100091	14	0.038032	yes	SLVRYG
chr2_33569371_A_G_b38	RASGRP3	-3.907	0.000156	-0.123414	31	0.031585	no	SLVRYG
chr2_33588900_A_AT_b38	RASGRP3	-3.864	0.000183	-0.126425	25	0.032717	no	SLVRYG
chr2_33656248_TTC_T_b38	RASGRP3	3.841	0.000198	0.132655	11	0.034533	no	SLVRYG
chr2_33571267_T_A_b38	RASGRP3	-3.755	0.000271	-0.117126	31	0.031196	no	SLVRYG
chr2_33572204_C_A_b38	RASGRP3	-3.7	0.000329	-0.116834	31	0.031579	no	SLVRYG
chr2_33571342_T_C_b38	RASGRP3	-3.669	0.000366	-0.113875	32	0.031035	no	SLVRYG
chr2_33568339_TA_T_b38	RASGRP3	-3.608	0.000453	-0.11512	33	0.031904	no	SLVRYG
chr2_33577889_G_A_b38	RASGRP3	-3.546	0.000561	-0.11414	29	0.032186	no	SLVRYG
chr2_33575950_G_A_b38	RASGRP3	-3.51	0.000635	-0.114327	29	0.03257	no	SLVRYG
chr2_33592492_A_G_b38	RASGRP3	-3.489	0.000681	-0.107465	32	0.030798	no	SLVRYG
chr2_33597253_G_A_b38	RASGRP3	-3.488	0.000684	-0.108453	31	0.031089	no	SLVRYG
chr2_33586449_C_G_b38	RASGRP3	-3.48	0.000703	-0.10472	34	0.030091	no	SLVRYG
chr2_33589523_A_G_b38	RASGRP3	-3.48	0.000703	-0.10472	34	0.030091	no	SLVRYG
chr2_33593131_C_T_b38	RASGRP3	-3.48	0.000703	-0.10472	34	0.030091	no	SLVRYG
chr2_33571586_T_C_b38	RASGRP3	-3.458	0.000758	-0.106617	34	0.030835	no	SLVRYG
chr2_33577835_T_C_b38	RASGRP3	-3.454	0.000768	-0.103748	34	0.030038	no	SLVRYG
chr2_33670716_C_T_b38	RASGRP3	3.454	0.000769	0.113032	14	0.032727	no	SLVRYG
chr2_33575832_C_A_b38	RASGRP3	-3.413	0.000882	-0.102131	34	0.029927	no	SLVRYG
chr2_33590404_A_G_b38	RASGRP3	-3.383	0.000973	-0.103554	33	0.03061	no	SLVRYG
chr2_33580247_A_G_b38	RASGRP3	-3.36	0.00105	-0.104409	31	0.031078	no	SLVRYG
chr2_33627793_A_G_b38	RASGRP3	3.356	0.00107	0.139224	5	0.041487	no	SLVRYG
chr2_33606727_T_C_b38	RASGRP3	3.277	0.00138	0.149112	3	0.045502	no	SLVRYG
chr2_33576389_C_T_b38	RASGRP3	-3.249	0.00151	-0.10018	32	0.030836	no	SLVRYG
chr2_33672387_A_G_b38	RASGRP3	3.22	0.00166	0.131121	6	0.040722	no	SLVRYG
chr2_32875798_T_C_b38	RASGRP3	-3.111	0.00234	-0.103831	33	0.033377	no	SLVRYG
chr2_33661156_C_T_b38	RASGRP3	3.066	0.00269	0.105417	11	0.03438	no	SLVRYG
chr2_33661310_C_T_b38	RASGRP3	3.066	0.00269	0.105417	11	0.03438	no	SLVRYG
chr2_33663649_A_C_b38	RASGRP3	-3	0.00329	-0.092107	32	0.0307	no	SLVRYG
chr2_33567211_TA_T_b38	RASGRP3	-2.95	0.00384	-0.102079	24	0.034605	no	SLVRYG
chr2_32847072_A_G_b38	RASGRP3	-2.948	0.00385	-0.099389	33	0.033709	no	SLVRYG
chr2_32845129_G_A_b38	RASGRP3	-2.946	0.00388	-0.099448	33	0.033755	no	SLVRYG
chr2_32845705_G_A_b38	RASGRP3	-2.946	0.00388	-0.099448	33	0.033755	no	SLVRYG
chr2_33591195_C_CT_b38	RASGRP3	-2.945	0.00389	-0.103539	18	0.035157	no	SLVRYG
chr2_33664871_G_GT_b38	RASGRP3	-2.939	0.00396	-0.091821	31	0.031238	no	SLVRYG
chr2_33984472_G_GT_b38	RASGRP3	2.939	0.00396	0.098595	33	0.033545	no	SLVRYG
chr2_32805642_G_A_b38	RASGRP3	-2.935	0.00401	-0.132973	4	0.045306	no	SLVRYG
chr2_32798382_A_G_b38	RASGRP3	-2.922	0.00417	-0.130576	4	0.044688	no	SLVRYG
chr2_32889140_C_CATA_b38	RASGRP3	-2.917	0.00424	-0.095549	26	0.032761	no	SLVRYG
chr2_32894731_A_G_b38	RASGRP3	-2.917	0.00424	-0.095549	26	0.032761	no	SLVRYG
chr2_32896786_TG_T_b38	RASGRP3	-2.917	0.00424	-0.095549	26	0.032761	no	SLVRYG
chr2_33664742_G_C_b38	RASGRP3	-2.915	0.00426	-0.089297	33	0.030634	no	SLVRYG
chr2_33656916_G_A_b38	RASGRP3	2.913	0.00428	0.095086	18	0.03264	no	SLVRYG
chr2_32881258_A_C_b38	RASGRP3	-2.913	0.00428	-0.096488	26	0.033123	no	SLVRYG
chr2_32891852_G_A_b38	RASGRP3	-2.873	0.00483	-0.098056	13	0.034135	no	SLVRYG
chr2_32892533_C_T_b38	RASGRP3	-2.873	0.00483	-0.098056	13	0.034135	no	SLVRYG
chr2_33604404_GTA_G_b38	RASGRP3	-2.854	0.00509	-0.091249	17	0.031968	no	SLVRYG
chr2_33720623_ATGCGATT_A_b38	RASGRP3	2.832	0.00544	0.128305	4	0.045305	no	SLVRYG
chr2_33721079_C_CGT_b38	RASGRP3	2.83	0.00547	0.129895	4	0.045898	no	SLVRYG
chr2_33771282_C_A_b38	RASGRP3	2.826	0.00554	0.104617	12	0.037022	no	SLVRYG
chr2_33771310_T_TGTG_b38	RASGRP3	2.826	0.00554	0.104617	12	0.037022	no	SLVRYG
chr2_33771480_T_C_b38	RASGRP3	2.826	0.00554	0.104617	12	0.037022	no	SLVRYG
chr2_33771705_T_C_b38	RASGRP3	2.826	0.00554	0.104617	12	0.037022	no	SLVRYG
chr2_33770718_A_C_b38	RASGRP3	2.813	0.00575	0.105152	12	0.037382	no	SLVRYG
chr2_33647765_T_C_b38	RASGRP3	-2.811	0.00578	-0.090391	27	0.032153	no	SLVRYG
chr2_32800823_C_G_b38	RASGRP3	-2.803	0.00591	-0.127517	4	0.045486	no	SLVRYG
chr2_32762628_GT_G_b38	RASGRP3	-2.799	0.006	-0.1032	11	0.036876	no	SLVRYG
chr2_32858582_G_T_b38	RASGRP3	-2.797	0.00602	-0.094359	35	0.03373	no	SLVRYG
chr2_32858751_C_T_b38	RASGRP3	-2.797	0.00602	-0.094359	35	0.03373	no	SLVRYG
chr2_32859971_C_T_b38	RASGRP3	-2.797	0.00602	-0.094359	35	0.03373	no	SLVRYG
chr2_32895167_G_A_b38	RASGRP3	-2.792	0.00612	-0.094845	12	0.033973	no	SLVRYG
chr2_32849432_A_G_b38	RASGRP3	-2.79	0.00615	-0.093536	36	0.033525	no	SLVRYG
chr2_32852603_G_A_b38	RASGRP3	-2.79	0.00615	-0.093536	36	0.033525	no	SLVRYG
chr2_33658170_A_G_b38	RASGRP3	-2.777	0.00638	-0.088962	27	0.032035	no	SLVRYG
chr2_33658713_G_A_b38	RASGRP3	-2.775	0.00642	-0.089422	27	0.032222	no	SLVRYG
chr2_33662442_T_C_b38	RASGRP3	-2.775	0.00642	-0.089422	27	0.032222	no	SLVRYG
chr2_32882944_C_A_b38	RASGRP3	-2.774	0.00644	-0.091099	25	0.032843	no	SLVRYG
chr2_32887028_A_G_b38	RASGRP3	-2.774	0.00644	-0.091099	25	0.032843	no	SLVRYG
chr2_33548381_A_AAAAAG_b38	RASGRP3	2.767	0.00656	0.142602	3	0.051529	no	SLVRYG
chr2_32799782_A_G_b38	RASGRP3	-2.762	0.00666	-0.126542	4	0.045813	no	SLVRYG
chr2_32853708_T_G_b38	RASGRP3	-2.759	0.00673	-0.095505	22	0.034619	no	SLVRYG
chr2_33615675_TA_T_b38	RASGRP3	-2.756	0.00678	-0.091935	23	0.033357	no	SLVRYG
chr2_32888303_G_C_b38	RASGRP3	-2.75	0.00689	-0.09393	12	0.03415	no	SLVRYG
chr2_33771305_A_ATGTC_b38	RASGRP3	2.748	0.00693	0.102032	12	0.037124	no	SLVRYG
chr2_32856517_G_A_b38	RASGRP3	-2.748	0.00694	-0.09206	35	0.033499	no	SLVRYG
chr2_33721262_A_T_b38	RASGRP3	2.743	0.00703	0.133545	4	0.048679	no	SLVRYG
chr2_33721524_A_G_b38	RASGRP3	2.743	0.00703	0.133545	4	0.048679	no	SLVRYG
chr2_33721982_T_C_b38	RASGRP3	2.743	0.00703	0.133545	4	0.048679	no	SLVRYG
chr2_33723360_C_A_b38	RASGRP3	2.743	0.00703	0.133545	4	0.048679	no	SLVRYG
chr2_33771584_G_A_b38	RASGRP3	2.738	0.00715	0.102048	12	0.037277	no	SLVRYG
chr2_33641120_T_C_b38	RASGRP3	-2.737	0.00715	-0.090646	26	0.033114	no	SLVRYG
chr2_33770196_A_G_b38	RASGRP3	2.736	0.00718	0.101231	12	0.037	no	SLVRYG
chr2_33770292_G_C_b38	RASGRP3	2.736	0.00718	0.101231	12	0.037	no	SLVRYG
chr2_33770343_T_G_b38	RASGRP3	2.736	0.00718	0.101231	12	0.037	no	SLVRYG
chr2_33770360_T_C_b38	RASGRP3	2.736	0.00718	0.101231	12	0.037	no	SLVRYG
chr2_33770545_C_T_b38	RASGRP3	2.736	0.00718	0.101231	12	0.037	no	SLVRYG
chr2_33771715_A_G_b38	RASGRP3	2.736	0.00718	0.101231	12	0.037	no	SLVRYG
chr2_33771716_AATTG_A_b38	RASGRP3	2.736	0.00718	0.101231	12	0.037	no	SLVRYG
chr2_32891490_G_C_b38	RASGRP3	-2.73	0.0073	-0.093039	12	0.034077	no	SLVRYG
chr2_32880007_C_A_b38	RASGRP3	-2.716	0.00759	-0.09439	11	0.034747	no	SLVRYG
chr2_33980670_A_ATTTATTTATT_b38	RASGRP3	2.684	0.00833	0.085349	28	0.031803	no	SLVRYG
chr2_33666591_A_G_b38	RASGRP3	-2.681	0.00839	-0.081746	35	0.030493	no	SLVRYG
chr2_32526621_G_T_b38	RASGRP3	2.678	0.00846	0.113497	3	0.042383	no	SLVRYG
chr2_33793837_A_C_b38	RASGRP3	-2.666	0.00875	-0.110494	6	0.041443	no	SLVRYG
chr2_33659127_A_G_b38	RASGRP3	-2.661	0.00888	-0.084399	30	0.031717	no	SLVRYG
chr2_33771507_G_A_b38	RASGRP3	2.661	0.00889	0.098114	12	0.036878	no	SLVRYG
chr2_32854515_T_C_b38	RASGRP3	-2.651	0.00914	-0.095635	11	0.036081	no	SLVRYG
chr2_33075931_G_T_b38	RASGRP3	2.646	0.00925	0.1075	6	0.040625	no	SLVRYG
chr2_34009275_T_G_b38	RASGRP3	2.636	0.0095	0.095564	30	0.036247	no	SLVRYG
chr2_34009297_G_A_b38	RASGRP3	2.636	0.0095	0.095564	30	0.036247	no	SLVRYG
chr2_32736791_A_G_b38	RASGRP3	-2.632	0.00962	-0.124845	4	0.047435	no	SLVRYG
chr2_33655112_A_AT_b38	RASGRP3	-2.629	0.0097	-0.086052	27	0.032729	no	SLVRYG
chr2_32837214_C_T_b38	RASGRP3	-2.629	0.0097	-0.086242	26	0.032804	no	SLVRYG
chr2_32837414_C_T_b38	RASGRP3	-2.629	0.0097	-0.086242	26	0.032804	no	SLVRYG
chr2_33550484_C_G_b38	RASGRP3	13.259	1.35e-35	0.215355	8	0.016242	yes	MSCLSK
chr2_33550216_T_A_b38	RASGRP3	13.254	1.43e-35	0.214923	8	0.016216	yes	MSCLSK
chr2_33537896_A_G_b38	RASGRP3	13.217	2.09e-35	0.211591	7	0.016009	yes	MSCLSK
chr2_33559304_G_A_b38	RASGRP3	13.195	2.62e-35	0.209001	8	0.015839	yes	MSCLSK
chr2_33554542_A_G_b38	RASGRP3	13.173	3.32e-35	0.213763	8	0.016228	yes	MSCLSK
chr2_33557635_G_A_b38	RASGRP3	13.009	1.81e-34	0.205966	8	0.015833	yes	MSCLSK
chr2_33548469_T_C_b38	RASGRP3	12.94	3.71e-34	0.21325	7	0.01648	yes	MSCLSK
chr2_33559734_G_A_b38	RASGRP3	12.935	3.9e-34	0.204755	8	0.01583	yes	MSCLSK
chr2_33553995_C_T_b38	RASGRP3	12.769	2.14e-33	0.210108	7	0.016455	yes	MSCLSK
chr2_33559068_A_G_b38	RASGRP3	12.699	4.35e-33	0.207118	6	0.01631	yes	MSCLSK
chr2_33557844_G_A_b38	RASGRP3	12.502	3.22e-32	0.192964	12	0.015435	yes	MSCLSK
chr2_33551676_A_G_b38	RASGRP3	12.382	1.07e-31	0.206937	6	0.016712	yes	MSCLSK
chr2_33551697_A_T_b38	RASGRP3	12.382	1.07e-31	0.206937	6	0.016712	yes	MSCLSK
chr2_33552022_CAAACA_C_b38	RASGRP3	12.36	1.34e-31	0.204193	7	0.01652	yes	MSCLSK
chr2_33548762_A_G_b38	RASGRP3	12.356	1.39e-31	0.212362	5	0.017186	yes	MSCLSK
chr2_33546942_C_G_b38	RASGRP3	11.801	3.39e-29	0.193948	9	0.016435	yes	MSCLSK
chr2_33537330_C_CCCAACACA_b38	RASGRP3	11.728	6.87e-29	0.162985	33	0.013897	yes	MSCLSK
chr2_33531453_C_T_b38	RASGRP3	11.465	8.7e-28	0.185897	9	0.016215	yes	MSCLSK
chr2_33529269_C_A_b38	RASGRP3	11.176	1.34e-26	0.179739	10	0.016082	yes	MSCLSK
chr2_33537192_G_GAT_b38	RASGRP3	11.065	3.81e-26	0.177707	7	0.01606	yes	MSCLSK
chr2_33526597_C_T_b38	RASGRP3	10.292	4.42e-23	0.172906	8	0.0168	yes	MSCLSK
chr2_33527062_GC_G_b38	RASGRP3	10.292	4.42e-23	0.172906	8	0.0168	yes	MSCLSK
chr2_33539987_GAAAAA_G_b38	RASGRP3	9.93	1.07e-21	0.186344	5	0.018766	yes	MSCLSK
chr2_33512177_G_A_b38	RASGRP3	9.221	4.28e-19	0.13297	25	0.01442	yes	MSCLSK
chr2_33561445_C_A_b38	RASGRP3	8.842	9.21e-18	0.12132	28	0.013721	yes	MSCLSK
chr2_33529318_C_T_b38	RASGRP3	8.624	5.17e-17	0.12293	20	0.014255	yes	MSCLSK
chr2_33555164_G_A_b38	RASGRP3	8.23	1.06e-15	0.116119	25	0.014109	yes	MSCLSK
chr2_33525341_A_AAT_b38	RASGRP3	8.086	3.13e-15	0.106785	36	0.013206	yes	MSCLSK
chr2_33547053_GAA_G_b38	RASGRP3	7.934	9.65e-15	0.169803	5	0.021403	yes	MSCLSK
chr2_33536322_G_GA_b38	RASGRP3	7.884	1.38e-14	0.128865	20	0.016345	yes	MSCLSK
chr2_33556928_C_CACACACATACAT_b38	RASGRP3	7.425	3.66e-13	0.124255	7	0.016736	yes	MSCLSK
chr2_33523649_G_A_b38	RASGRP3	7.132	2.7e-12	0.104504	24	0.014652	yes	MSCLSK
chr2_33589264_G_C_b38	RASGRP3	6.898	1.28e-11	0.082648	63	0.011981	yes	MSCLSK
chr2_33596450_T_G_b38	RASGRP3	6.816	2.17e-11	0.082021	63	0.012033	yes	MSCLSK
chr2_33557001_G_GA_b38	RASGRP3	6.793	2.53e-11	0.185059	3	0.027244	yes	MSCLSK
chr2_33590881_T_C_b38	RASGRP3	6.78	2.76e-11	0.081292	62	0.011991	yes	MSCLSK
chr2_33521266_C_T_b38	RASGRP3	6.626	7.36e-11	0.086869	45	0.01311	yes	MSCLSK
chr2_33537321_C_CA_b38	RASGRP3	5.819	9.42e-09	0.064598	102	0.011102	yes	MSCLSK
chr2_33547458_G_A_b38	RASGRP3	5.657	2.33e-08	0.065125	90	0.011512	yes	MSCLSK
chr2_33621819_C_A_b38	RASGRP3	5.544	4.35e-08	0.065663	76	0.011845	yes	MSCLSK
chr2_33564467_A_G_b38	RASGRP3	5.465	6.65e-08	0.063345	102	0.01159	yes	MSCLSK
chr2_33623108_T_C_b38	RASGRP3	5.457	6.96e-08	0.065229	76	0.011954	yes	MSCLSK
chr2_33592302_T_C_b38	RASGRP3	5.44	7.6e-08	0.126204	5	0.023198	yes	MSCLSK
chr2_33523461_TA_T_b38	RASGRP3	5.419	8.51e-08	0.082183	13	0.015165	yes	MSCLSK
chr2_33511010_G_A_b38	RASGRP3	5.386	1.01e-07	0.101568	12	0.018857	yes	MSCLSK
chr2_33554839_T_C_b38	RASGRP3	5.249	2.09e-07	0.060633	92	0.011551	yes	MSCLSK
chr2_33564001_C_G_b38	RASGRP3	5.13	3.85e-07	0.060133	98	0.011721	yes	MSCLSK
chr2_33561192_A_G_b38	RASGRP3	5.118	4.1e-07	0.057058	154	0.011149	yes	MSCLSK
chr2_33613720_G_A_b38	RASGRP3	5.08	4.98e-07	0.080224	22	0.015793	yes	MSCLSK
chr2_33532487_C_A_b38	RASGRP3	4.839	1.64e-06	0.053193	174	0.010993	yes	MSCLSK
chr2_33508487_T_C_b38	RASGRP3	4.825	1.76e-06	0.090985	16	0.018858	yes	MSCLSK
chr2_33514489_T_C_b38	RASGRP3	-4.723	2.86e-06	-0.051267	113	0.010854	yes	MSCLSK
chr2_33620575_G_A_b38	RASGRP3	4.605	4.99e-06	0.064919	33	0.014099	yes	MSCLSK
chr2_33518114_A_G_b38	RASGRP3	-4.468	9.33e-06	-0.051328	87	0.011487	yes	MSCLSK
chr2_33620497_T_C_b38	RASGRP3	4.396	1.29e-05	0.061983	33	0.0141	yes	MSCLSK
chr2_33512820_T_A_b38	RASGRP3	-4.129	4.12e-05	-0.046662	98	0.0113	yes	MSCLSK
chr2_33624881_G_GT_b38	RASGRP3	4.124	4.22e-05	0.051983	62	0.012606	yes	MSCLSK
chr2_33543901_C_G_b38	RASGRP3	-4.072	5.25e-05	-0.048078	93	0.011807	yes	MSCLSK
chr2_33443970_C_T_b38	RASGRP3	-3.901	0.000106	-0.05354	28	0.013725	yes	MSCLSK
chr2_33459342_A_G_b38	RASGRP3	3.795	0.000162	0.052991	40	0.013965	yes	MSCLSK
chr2_33568692_C_G_b38	RASGRP3	3.766	0.000181	0.052761	28	0.01401	yes	MSCLSK
chr2_33509399_C_CA_b38	RASGRP3	3.717	0.000219	0.063757	6	0.017153	yes	MSCLSK
chr2_33508652_C_G_b38	RASGRP3	3.585	0.000362	0.04211	93	0.011745	yes	MSCLSK
chr2_33571267_T_A_b38	RASGRP3	-3.551	0.000412	-0.040138	120	0.011302	yes	MSCLSK
chr2_33749131_A_G_b38	RASGRP3	3.534	0.000439	0.06344	11	0.017952	yes	MSCLSK
chr2_33572204_C_A_b38	RASGRP3	-3.506	0.000487	-0.039745	121	0.011337	yes	MSCLSK
chr2_33457536_T_G_b38	RASGRP3	3.482	0.000531	0.04884	33	0.014025	yes	MSCLSK
chr2_33753650_A_G_b38	RASGRP3	3.458	0.000581	0.069492	3	0.020098	yes	MSCLSK
chr2_33534694_A_AT_b38	RASGRP3	3.454	0.000588	0.046029	39	0.013325	yes	MSCLSK
chr2_34207312_T_TAC_b38	RASGRP3	3.402	0.000711	0.069405	5	0.0204	yes	MSCLSK
chr2_33532718_G_A_b38	RASGRP3	3.396	0.000727	0.037978	133	0.011184	yes	MSCLSK
chr2_33566560_TA_T_b38	RASGRP3	3.345	0.000873	0.046612	29	0.013937	yes	MSCLSK
chr2_33455695_G_A_b38	RASGRP3	-3.319	0.000955	-0.043748	55	0.013181	yes	MSCLSK
chr2_33512902_A_G_b38	RASGRP3	-3.305	0.001	-0.037979	143	0.011491	yes	MSCLSK
chr2_33577889_G_A_b38	RASGRP3	-3.3	0.00102	-0.037817	115	0.011459	yes	MSCLSK
chr2_33575950_G_A_b38	RASGRP3	-3.291	0.00105	-0.037666	114	0.011446	yes	MSCLSK
chr2_33569371_A_G_b38	RASGRP3	-3.267	0.00115	-0.037131	122	0.011366	yes	MSCLSK
chr2_33772378_C_T_b38	RASGRP3	3.256	0.00119	0.058207	8	0.017878	yes	MSCLSK
chr2_33539533_G_T_b38	RASGRP3	-3.227	0.00131	-0.033888	192	0.0105	yes	MSCLSK
chr2_33634843_C_CTT_b38	RASGRP3	3.194	0.00147	0.060554	12	0.018957	yes	MSCLSK
chr2_33669785_CA_C_b38	RASGRP3	-3.192	0.00148	-0.036078	111	0.011301	yes	MSCLSK
chr2_33637426_T_A_b38	RASGRP3	3.185	0.00152	0.046129	30	0.014481	yes	MSCLSK
chr2_33740099_T_TTTG_b38	RASGRP3	3.164	0.00163	0.054349	10	0.017177	yes	MSCLSK
chr2_34047405_C_T_b38	RASGRP3	3.148	0.00172	0.1095	7	0.034783	yes	MSCLSK
chr2_33458317_C_T_b38	RASGRP3	3.143	0.00175	0.047041	18	0.014967	yes	MSCLSK
chr2_33530852_CT_C_b38	RASGRP3	3.13	0.00183	0.03517	133	0.011236	yes	MSCLSK
chr2_33638203_CT_C_b38	RASGRP3	3.13	0.00183	0.060469	8	0.01932	yes	MSCLSK
chr2_32711116_C_CA_b38	RASGRP3	3.109	0.00196	0.055252	22	0.01777	yes	MSCLSK
chr2_33520141_T_C_b38	RASGRP3	-3.09	0.00209	-0.035274	129	0.011415	yes	MSCLSK
chr2_33658757_C_A_b38	RASGRP3	-3.078	0.00217	-0.034467	136	0.011197	yes	MSCLSK
chr2_33568339_TA_T_b38	RASGRP3	-3.06	0.0023	-0.034483	132	0.011268	yes	MSCLSK
chr2_33522218_G_A_b38	RASGRP3	3.044	0.00243	0.0408	34	0.013403	yes	MSCLSK
chr2_33567745_C_T_b38	RASGRP3	-3.041	0.00245	-0.034582	109	0.01137	yes	MSCLSK
chr2_33522498_A_G_b38	RASGRP3	3.04	0.00246	0.040953	34	0.013471	yes	MSCLSK
chr2_33641120_T_C_b38	RASGRP3	-3.033	0.00252	-0.033982	143	0.011205	yes	MSCLSK
chr2_33518880_G_GTCA_b38	RASGRP3	-3.019	0.00263	-0.034891	125	0.011556	yes	MSCLSK
chr2_33602067_G_C_b38	RASGRP3	3.011	0.00271	0.04358	24	0.014475	yes	MSCLSK
chr2_33541741_G_T_b38	RASGRP3	-2.992	0.00288	-0.03148	190	0.010522	yes	MSCLSK
chr2_33540888_T_C_b38	RASGRP3	-2.991	0.00289	-0.03143	190	0.010508	yes	MSCLSK
chr2_33571342_T_C_b38	RASGRP3	-2.987	0.00293	-0.033862	122	0.011337	yes	MSCLSK
chr2_33670200_G_T_b38	RASGRP3	-2.977	0.00302	-0.032904	123	0.011052	yes	MSCLSK
chr2_33771916_C_T_b38	RASGRP3	2.938	0.00342	0.048791	28	0.016605	yes	MSCLSK
chr2_33460180_C_T_b38	RASGRP3	2.936	0.00344	0.048036	12	0.01636	yes	MSCLSK
chr2_33655786_T_C_b38	RASGRP3	-2.925	0.00356	-0.032476	144	0.011102	yes	MSCLSK
chr2_34055056_A_G_b38	RASGRP3	2.918	0.00365	0.111487	3	0.03821	yes	MSCLSK
chr2_33669621_C_T_b38	RASGRP3	-2.909	0.00375	-0.032188	122	0.011065	yes	MSCLSK
chr2_33669751_C_T_b38	RASGRP3	-2.909	0.00375	-0.032188	122	0.011065	yes	MSCLSK
chr2_33660983_C_T_b38	RASGRP3	-2.903	0.00382	-0.032341	140	0.01114	yes	MSCLSK
chr2_33536322_GA_G_b38	RASGRP3	-2.901	0.00385	-0.034451	134	0.011876	yes	MSCLSK
chr2_33571586_T_C_b38	RASGRP3	-2.88	0.00411	-0.031649	149	0.01099	yes	MSCLSK
chr2_33463062_C_T_b38	RASGRP3	2.849	0.00453	0.046361	13	0.016272	yes	MSCLSK
chr2_33283427_CTT_C_b38	RASGRP3	2.838	0.00469	0.074032	3	0.026089	yes	MSCLSK
chr2_33442883_GT_G_b38	RASGRP3	2.825	0.00488	0.046603	27	0.016497	yes	MSCLSK
chr2_33540615_TTCTC_T_b38	RASGRP3	-2.814	0.00504	-0.031623	144	0.011237	yes	MSCLSK
chr2_33462856_T_G_b38	RASGRP3	2.806	0.00517	0.045074	14	0.016062	yes	MSCLSK
chr2_33658713_G_A_b38	RASGRP3	-2.785	0.0055	-0.031135	143	0.011178	yes	MSCLSK
chr2_33588900_A_AT_b38	RASGRP3	-2.78	0.0056	-0.033144	132	0.011923	yes	MSCLSK
chr2_34050036_G_C_b38	RASGRP3	2.75	0.00613	0.096876	7	0.035228	yes	MSCLSK
chr2_33726787_AAGAG_A_b38	RASGRP3	2.739	0.00634	0.032483	69	0.011861	yes	MSCLSK
chr2_33518738_C_T_b38	RASGRP3	2.729	0.00652	0.036072	37	0.013216	yes	MSCLSK
chr2_33517217_G_A_b38	RASGRP3	2.728	0.00655	0.036082	37	0.013226	yes	MSCLSK
chr2_33580247_A_G_b38	RASGRP3	-2.727	0.00658	-0.030918	147	0.01134	yes	MSCLSK
chr2_32767453_G_T_b38	RASGRP3	-2.716	0.00679	-0.055381	7	0.020392	yes	MSCLSK
chr2_33509815_G_A_b38	RASGRP3	2.711	0.00689	0.036313	34	0.013395	yes	MSCLSK
chr2_33486164_AT_A_b38	RASGRP3	-2.703	0.00706	-0.035552	68	0.013153	yes	MSCLSK
chr2_33128154_A_G_b38	RASGRP3	2.696	0.00719	0.04423	11	0.016403	yes	MSCLSK
chr2_33576389_C_T_b38	RASGRP3	-2.687	0.00739	-0.030718	144	0.01143	yes	MSCLSK
chr2_33138292_A_G_b38	RASGRP3	2.681	0.00754	0.042913	14	0.016009	yes	MSCLSK
chr2_33738746_A_C_b38	RASGRP3	2.673	0.00772	0.040807	14	0.015269	yes	MSCLSK
chr2_32795531_CTTATTTAT_C_b38	RASGRP3	-2.666	0.00787	-0.086735	3	0.032533	yes	MSCLSK
chr2_33647765_T_C_b38	RASGRP3	-2.666	0.00788	-0.029707	148	0.011144	yes	MSCLSK
chr2_33604404_G_GTA_b38	RASGRP3	2.662	0.00797	0.045703	8	0.017171	yes	MSCLSK
chr2_33661861_G_A_b38	RASGRP3	-2.649	0.00828	-0.02898	153	0.010941	yes	MSCLSK
chr2_33658170_A_G_b38	RASGRP3	-2.648	0.00829	-0.029515	145	0.011145	yes	MSCLSK
chr2_33662442_T_C_b38	RASGRP3	-2.642	0.00844	-0.02935	148	0.011107	yes	MSCLSK
chr2_33753914_G_T_b38	RASGRP3	2.619	0.00902	0.042304	21	0.016151	yes	MSCLSK
chr2_33771954_G_T_b38	RASGRP3	2.619	0.00903	0.043198	28	0.016495	yes	MSCLSK
chr2_33562245_G_C_b38	RASGRP3	-2.618	0.00904	-0.031443	107	0.012008	yes	MSCLSK
chr2_33655774_A_G_b38	RASGRP3	-2.615	0.00913	-0.029001	151	0.01109	yes	MSCLSK
chr2_32795725_G_GTATTATTATTAT_b38	RASGRP3	2.601	0.00951	0.063655	13	0.024472	yes	MSCLSK
chr2_33677515_A_G_b38	RASGRP3	2.6	0.00954	0.042367	15	0.016294	yes	MSCLSK
chr2_33536526_G_A_b38	RASGRP3	11.67	1.21e-28	0.200499	4	0.017181	no	MSCLSK
chr2_33536528_G_A_b38	RASGRP3	11.67	1.21e-28	0.200499	4	0.017181	no	MSCLSK
chr2_33540561_TGTGTGTGTGTG_T_b38	RASGRP3	10.831	3.35e-25	0.171003	16	0.015788	no	MSCLSK
chr2_33582025_C_T_b38	RASGRP3	7.526	1.8e-13	0.096731	44	0.012853	no	MSCLSK
chr2_33594385_G_A_b38	RASGRP3	7.521	1.86e-13	0.096691	47	0.012856	no	MSCLSK
chr2_33581561_C_T_b38	RASGRP3	7.506	2.07e-13	0.096422	45	0.012846	no	MSCLSK
chr2_33594326_C_T_b38	RASGRP3	7.495	2.23e-13	0.096491	47	0.012873	no	MSCLSK
chr2_33596617_C_T_b38	RASGRP3	7.486	2.38e-13	0.096952	46	0.012952	no	MSCLSK
chr2_33596963_A_T_b38	RASGRP3	7.453	2.99e-13	0.096375	47	0.012931	no	MSCLSK
chr2_33586869_A_T_b38	RASGRP3	7.445	3.18e-13	0.09908	38	0.013309	no	MSCLSK
chr2_33565263_A_G_b38	RASGRP3	7.26	1.13e-12	0.09346	57	0.012873	no	MSCLSK
chr2_33622160_C_T_b38	RASGRP3	6.029	2.8e-09	0.075394	57	0.012506	no	MSCLSK
chr2_33625315_G_A_b38	RASGRP3	5.422	8.38e-08	0.069894	52	0.012891	no	MSCLSK
chr2_33581338_T_A_b38	RASGRP3	5.4	9.44e-08	0.086287	16	0.01598	no	MSCLSK
chr2_33581900_A_T_b38	RASGRP3	5.314	1.48e-07	0.084838	16	0.015964	no	MSCLSK
chr2_33616325_C_T_b38	RASGRP3	5.307	1.54e-07	0.091589	11	0.017257	no	MSCLSK
chr2_33563965_A_G_b38	RASGRP3	5.254	2.04e-07	0.083405	16	0.015875	no	MSCLSK
chr2_33627793_A_G_b38	RASGRP3	5.234	2.26e-07	0.088407	12	0.01689	no	MSCLSK
chr2_33565010_T_TACACACAC_b38	RASGRP3	5.195	2.77e-07	0.114161	4	0.021977	no	MSCLSK
chr2_33606727_T_C_b38	RASGRP3	5.183	2.94e-07	0.096393	5	0.018598	no	MSCLSK
chr2_33657078_T_C_b38	RASGRP3	5.17	3.14e-07	0.066503	54	0.012863	no	MSCLSK
chr2_33640631_A_C_b38	RASGRP3	5.1	4.49e-07	0.068581	31	0.013447	no	MSCLSK
chr2_33641397_G_C_b38	RASGRP3	5.099	4.52e-07	0.068718	31	0.013477	no	MSCLSK
chr2_33640513_G_C_b38	RASGRP3	5.041	6.05e-07	0.086165	11	0.017093	no	MSCLSK
chr2_33650021_A_G_b38	RASGRP3	4.997	7.52e-07	0.067222	32	0.013451	no	MSCLSK
chr2_33605827_ATTTTTCT_A_b38	RASGRP3	4.968	8.71e-07	0.083979	11	0.016904	no	MSCLSK
chr2_33656248_TTC_T_b38	RASGRP3	4.964	8.87e-07	0.066782	32	0.013453	no	MSCLSK
chr2_33639021_G_A_b38	RASGRP3	4.954	9.33e-07	0.066894	31	0.013503	no	MSCLSK
chr2_33548381_A_AAAAAG_b38	RASGRP3	4.938	1.01e-06	0.09704	11	0.019652	no	MSCLSK
chr2_33659035_G_A_b38	RASGRP3	4.934	1.03e-06	0.085668	11	0.017361	no	MSCLSK
chr2_33662459_C_T_b38	RASGRP3	4.934	1.03e-06	0.065885	34	0.013352	no	MSCLSK
chr2_33579727_C_T_b38	RASGRP3	4.93	1.05e-06	0.117339	4	0.023803	no	MSCLSK
chr2_33606703_C_T_b38	RASGRP3	4.893	1.26e-06	0.085837	11	0.017542	no	MSCLSK
chr2_33656848_TA_T_b38	RASGRP3	4.837	1.66e-06	0.062571	48	0.012936	no	MSCLSK
chr2_33652477_C_A_b38	RASGRP3	4.822	1.78e-06	0.064954	32	0.013469	no	MSCLSK
chr2_33634816_G_T_b38	RASGRP3	4.798	2e-06	0.082355	12	0.017164	no	MSCLSK
chr2_33663555_T_C_b38	RASGRP3	4.794	2.03e-06	0.064036	34	0.013356	no	MSCLSK
chr2_33573675_A_G_b38	RASGRP3	4.792	2.06e-06	0.117625	3	0.024545	no	MSCLSK
chr2_33670716_C_T_b38	RASGRP3	4.698	3.23e-06	0.061746	41	0.013144	no	MSCLSK
chr2_33634524_A_G_b38	RASGRP3	4.606	4.97e-06	0.0795	12	0.017262	no	MSCLSK
chr2_33636858_C_G_b38	RASGRP3	4.602	5.06e-06	0.079106	12	0.017191	no	MSCLSK
chr2_33637736_A_T_b38	RASGRP3	4.602	5.06e-06	0.079106	12	0.017191	no	MSCLSK
chr2_33631243_G_GT_b38	RASGRP3	4.516	7.52e-06	0.078674	11	0.017422	no	MSCLSK
chr2_33667549_A_G_b38	RASGRP3	4.491	8.41e-06	0.077832	12	0.017329	no	MSCLSK
chr2_33667555_A_G_b38	RASGRP3	4.491	8.41e-06	0.077832	12	0.017329	no	MSCLSK
chr2_33672387_A_G_b38	RASGRP3	4.456	9.89e-06	0.065099	24	0.014611	no	MSCLSK
chr2_33622592_T_C_b38	RASGRP3	4.41	1.21e-05	0.054897	71	0.012447	no	MSCLSK
chr2_33525699_C_CAA_b38	RASGRP3	4.397	1.29e-05	0.09673	20	0.021998	no	MSCLSK
chr2_33515662_T_C_b38	RASGRP3	4.316	1.84e-05	0.065691	22	0.015221	no	MSCLSK
chr2_33514230_T_G_b38	RASGRP3	4.291	2.05e-05	0.061396	28	0.014307	no	MSCLSK
chr2_33656916_G_A_b38	RASGRP3	4.286	2.1e-05	0.054005	70	0.0126	no	MSCLSK
chr2_33631252_G_T_b38	RASGRP3	4.249	2.46e-05	0.048798	175	0.011483	no	MSCLSK
chr2_33669427_A_C_b38	RASGRP3	4.234	2.64e-05	0.062441	23	0.014748	no	MSCLSK
chr2_33622130_C_CA_b38	RASGRP3	4.233	2.65e-05	0.078138	16	0.01846	no	MSCLSK
chr2_33669574_A_G_b38	RASGRP3	4.155	3.71e-05	0.061521	22	0.014808	no	MSCLSK
chr2_33591518_C_T_b38	RASGRP3	4.111	4.45e-05	0.051216	54	0.012457	no	MSCLSK
chr2_33592814_T_C_b38	RASGRP3	4.078	5.11e-05	0.051106	53	0.012531	no	MSCLSK
chr2_33591739_A_G_b38	RASGRP3	4.07	5.29e-05	0.051163	53	0.01257	no	MSCLSK
chr2_33626436_A_T_b38	RASGRP3	3.961	8.31e-05	0.049713	64	0.012551	no	MSCLSK
chr2_33587735_T_A_b38	RASGRP3	3.945	8.87e-05	0.04682	76	0.011868	no	MSCLSK
chr2_33451483_G_C_b38	RASGRP3	-3.943	8.94e-05	-0.06177	14	0.015666	no	MSCLSK
chr2_33520269_T_C_b38	RASGRP3	3.901	0.000106	0.054022	29	0.013848	no	MSCLSK
chr2_33598472_A_C_b38	RASGRP3	3.896	0.000108	0.048263	54	0.012389	no	MSCLSK
chr2_33537323_G_A_b38	RASGRP3	3.854	0.000128	0.041588	168	0.010791	no	MSCLSK
chr2_33519891_C_T_b38	RASGRP3	-3.804	0.000156	-0.042837	108	0.01126	no	MSCLSK
chr2_33706678_T_C_b38	RASGRP3	3.777	0.000174	0.072956	5	0.019316	no	MSCLSK
chr2_33605252_A_G_b38	RASGRP3	3.712	0.000224	0.045954	55	0.01238	no	MSCLSK
chr2_33451373_G_T_b38	RASGRP3	-3.634	0.000302	-0.053359	20	0.014683	no	MSCLSK
chr2_33661156_C_T_b38	RASGRP3	3.631	0.000305	0.046822	46	0.012895	no	MSCLSK
chr2_33661310_C_T_b38	RASGRP3	3.631	0.000305	0.046822	46	0.012895	no	MSCLSK
chr2_33582793_C_G_b38	RASGRP3	3.612	0.000328	0.042842	76	0.011863	no	MSCLSK
chr2_33540861_TA_T_b38	RASGRP3	-3.577	0.000374	-0.039995	111	0.011181	no	MSCLSK
chr2_33545793_CTAT_C_b38	RASGRP3	3.493	0.00051	0.04582	39	0.013117	no	MSCLSK
chr2_33539650_C_T_b38	RASGRP3	3.463	0.000571	0.04592	36	0.013261	no	MSCLSK
chr2_33539888_A_T_b38	RASGRP3	3.463	0.000571	0.04592	36	0.013261	no	MSCLSK
chr2_33601894_C_G_b38	RASGRP3	3.456	0.000584	0.041	75	0.011862	no	MSCLSK
chr2_33596331_G_C_b38	RASGRP3	3.438	0.000625	0.048529	26	0.014117	no	MSCLSK
chr2_33530497_CT_C_b38	RASGRP3	3.437	0.000626	0.048352	26	0.014068	no	MSCLSK
chr2_33545661_T_C_b38	RASGRP3	3.402	0.000712	0.045842	34	0.013476	no	MSCLSK
chr2_33547342_C_CTTTTTTT_b38	RASGRP3	3.399	0.00072	0.139383	3	0.041013	no	MSCLSK
chr2_33611391_T_A_b38	RASGRP3	3.306	0.001	0.04223	50	0.012774	no	MSCLSK
chr2_33515921_T_A_b38	RASGRP3	3.286	0.00107	0.051122	17	0.015556	no	MSCLSK
chr2_33749290_G_T_b38	RASGRP3	3.285	0.00108	0.065224	5	0.019858	no	MSCLSK
chr2_33749611_C_T_b38	RASGRP3	3.271	0.00113	0.059852	7	0.018296	no	MSCLSK
chr2_33751236_C_G_b38	RASGRP3	3.271	0.00113	0.059852	7	0.018296	no	MSCLSK
chr2_33563089_C_T_b38	RASGRP3	3.268	0.00114	0.039135	61	0.011976	no	MSCLSK
chr2_33614844_A_G_b38	RASGRP3	3.243	0.00125	0.039443	62	0.012164	no	MSCLSK
chr2_33734734_G_A_b38	RASGRP3	3.236	0.00127	0.064092	5	0.019804	no	MSCLSK
chr2_33741270_T_C_b38	RASGRP3	3.221	0.00134	0.057798	9	0.017945	no	MSCLSK
chr2_33812026_C_CAA_b38	RASGRP3	-3.203	0.00143	-0.076776	11	0.023973	no	MSCLSK
chr2_33600346_CTT_C_b38	RASGRP3	3.2	0.00145	0.039074	97	0.012212	no	MSCLSK
chr2_33745369_C_T_b38	RASGRP3	3.199	0.00145	0.057998	8	0.018133	no	MSCLSK
chr2_33546340_A_G_b38	RASGRP3	3.132	0.00182	0.041661	36	0.013303	no	MSCLSK
chr2_33443785_T_C_b38	RASGRP3	-3.126	0.00185	-0.058174	9	0.018611	no	MSCLSK
chr2_33521739_T_A_b38	RASGRP3	3.091	0.00208	0.041235	35	0.013339	no	MSCLSK
chr2_33603907_A_C_b38	RASGRP3	3.087	0.00211	0.052281	13	0.016937	no	MSCLSK
chr2_33529261_A_G_b38	RASGRP3	3.061	0.0023	0.04217	29	0.013775	no	MSCLSK
chr2_33605562_C_G_b38	RASGRP3	3.042	0.00245	0.037091	60	0.012195	no	MSCLSK
chr2_33590317_T_G_b38	RASGRP3	3.004	0.00277	0.039803	40	0.01325	no	MSCLSK
chr2_33460317_G_A_b38	RASGRP3	2.982	0.00297	0.052116	10	0.017477	no	MSCLSK
chr2_33760998_A_T_b38	RASGRP3	-2.959	0.0032	-0.033227	110	0.01123	no	MSCLSK
chr2_33596666_T_C_b38	RASGRP3	2.936	0.00344	0.035362	66	0.012043	no	MSCLSK
chr2_33758557_G_A_b38	RASGRP3	-2.932	0.00349	-0.034974	89	0.01193	no	MSCLSK
chr2_33715404_A_C_b38	RASGRP3	2.929	0.00353	0.037819	42	0.012914	no	MSCLSK
chr2_33728254_C_T_b38	RASGRP3	2.916	0.00367	0.053708	8	0.018416	no	MSCLSK
chr2_33758452_A_G_b38	RASGRP3	-2.915	0.00368	-0.034544	90	0.01185	no	MSCLSK
chr2_33584227_A_G_b38	RASGRP3	2.913	0.0037	0.038821	39	0.013325	no	MSCLSK
chr2_33548381_A_AAAG_b38	RASGRP3	2.91	0.00374	0.051099	17	0.017559	no	MSCLSK
chr2_33714976_C_T_b38	RASGRP3	2.904	0.00381	0.04738	13	0.016315	no	MSCLSK
chr2_33474954_T_C_b38	RASGRP3	2.904	0.00381	0.032512	171	0.011196	no	MSCLSK
chr2_33732506_C_T_b38	RASGRP3	2.901	0.00384	0.05378	8	0.018536	no	MSCLSK
chr2_33734078_T_A_b38	RASGRP3	2.901	0.00384	0.05378	8	0.018536	no	MSCLSK
chr2_33603617_TC_T_b38	RASGRP3	2.901	0.00385	0.048977	13	0.016883	no	MSCLSK
chr2_33444840_G_A_b38	RASGRP3	-2.896	0.00391	-0.055295	7	0.019093	no	MSCLSK
chr2_34150829_C_CA_b38	RASGRP3	2.879	0.00412	0.068319	7	0.023728	no	MSCLSK
chr2_34308656_G_T_b38	RASGRP3	2.876	0.00416	0.084088	3	0.029238	no	MSCLSK
chr2_33758105_T_A_b38	RASGRP3	-2.875	0.00417	-0.034358	89	0.011949	no	MSCLSK
chr2_33758169_T_C_b38	RASGRP3	-2.875	0.00417	-0.034358	89	0.011949	no	MSCLSK
chr2_33758243_C_T_b38	RASGRP3	-2.875	0.00417	-0.034358	89	0.011949	no	MSCLSK
chr2_33768312_A_C_b38	RASGRP3	-2.872	0.00422	-0.033865	93	0.011793	no	MSCLSK
chr2_33556890_TAC_T_b38	RASGRP3	-2.871	0.00422	-0.039558	29	0.013777	no	MSCLSK
chr2_33535209_G_A_b38	RASGRP3	2.866	0.00429	0.037505	37	0.013085	no	MSCLSK
chr2_33605847_C_CT_b38	RASGRP3	2.863	0.00434	0.052047	4	0.01818	no	MSCLSK
chr2_33552026_CA_C_b38	RASGRP3	-2.85	0.00451	-0.058822	6	0.020636	no	MSCLSK
chr2_33185786_C_T_b38	RASGRP3	2.84	0.00465	0.094597	4	0.033305	no	MSCLSK
chr2_33769488_A_G_b38	RASGRP3	-2.839	0.00467	-0.033558	92	0.011821	no	MSCLSK
chr2_33565010_T_TACACACACAC_b38	RASGRP3	2.836	0.00471	0.056314	3	0.019854	no	MSCLSK
chr2_33605964_T_C_b38	RASGRP3	2.833	0.00476	0.040623	25	0.01434	no	MSCLSK
chr2_33767664_G_A_b38	RASGRP3	-2.831	0.00479	-0.033384	92	0.011794	no	MSCLSK
chr2_33446881_C_G_b38	RASGRP3	-2.824	0.00488	-0.053483	8	0.018936	no	MSCLSK
chr2_33765440_G_A_b38	RASGRP3	-2.823	0.0049	-0.033343	91	0.01181	no	MSCLSK
chr2_33767629_C_T_b38	RASGRP3	-2.823	0.0049	-0.033343	91	0.01181	no	MSCLSK
chr2_33767683_T_G_b38	RASGRP3	-2.823	0.0049	-0.033343	91	0.01181	no	MSCLSK
chr2_33767692_TCAGAA_T_b38	RASGRP3	-2.823	0.0049	-0.033343	91	0.01181	no	MSCLSK
chr2_33768002_T_C_b38	RASGRP3	-2.823	0.0049	-0.033343	91	0.01181	no	MSCLSK
chr2_33530930_T_C_b38	RASGRP3	2.815	0.00503	0.037474	36	0.013312	no	MSCLSK
chr2_33731949_C_G_b38	RASGRP3	2.813	0.00506	0.052257	8	0.018578	no	MSCLSK
chr2_33769652_G_T_b38	RASGRP3	-2.81	0.00511	-0.03317	92	0.011805	no	MSCLSK
chr2_33769285_C_A_b38	RASGRP3	-2.809	0.00512	-0.033199	92	0.011819	no	MSCLSK
chr2_33768747_A_G_b38	RASGRP3	-2.803	0.00522	-0.032705	93	0.011667	no	MSCLSK
chr2_33772629_T_A_b38	RASGRP3	2.788	0.00546	0.089382	6	0.032056	no	MSCLSK
chr2_33631185_T_G_b38	RASGRP3	-2.786	0.0055	-0.03054	165	0.010962	no	MSCLSK
chr2_33546315_C_T_b38	RASGRP3	-2.762	0.0059	-0.033887	77	0.012267	no	MSCLSK
chr2_33607432_G_A_b38	RASGRP3	2.75	0.00613	0.05041	6	0.018332	no	MSCLSK
chr2_33767897_C_T_b38	RASGRP3	-2.749	0.00616	-0.03257	92	0.01185	no	MSCLSK
chr2_33551613_T_G_b38	RASGRP3	2.741	0.00629	0.036768	35	0.013412	no	MSCLSK
chr2_33765535_C_T_b38	RASGRP3	-2.733	0.00645	-0.032304	92	0.01182	no	MSCLSK
chr2_33765648_T_C_b38	RASGRP3	-2.733	0.00645	-0.032304	92	0.01182	no	MSCLSK
chr2_33766277_T_C_b38	RASGRP3	-2.733	0.00645	-0.032304	92	0.01182	no	MSCLSK
chr2_33766488_G_A_b38	RASGRP3	-2.733	0.00645	-0.032304	92	0.01182	no	MSCLSK
chr2_33766502_A_C_b38	RASGRP3	-2.733	0.00645	-0.032304	92	0.01182	no	MSCLSK
chr2_33766946_G_A_b38	RASGRP3	-2.733	0.00645	-0.032304	92	0.01182	no	MSCLSK
chr2_33768405_T_A_b38	RASGRP3	-2.73	0.00651	-0.03197	94	0.01171	no	MSCLSK
chr2_33768709_T_C_b38	RASGRP3	-2.73	0.00651	-0.03197	94	0.01171	no	MSCLSK
chr2_33562267_C_CT_b38	RASGRP3	2.726	0.0066	0.030419	127	0.011161	no	MSCLSK
chr2_33549339_CAT_C_b38	RASGRP3	-2.724	0.00664	-0.033658	76	0.012358	no	MSCLSK
chr2_33602361_A_C_b38	RASGRP3	2.719	0.00672	0.030872	117	0.011353	no	MSCLSK
chr2_33792244_T_C_b38	RASGRP3	2.716	0.0068	0.082823	5	0.030499	no	MSCLSK
chr2_33548672_A_T_b38	RASGRP3	-2.715	0.00682	-0.033689	77	0.01241	no	MSCLSK
chr2_33758633_A_G_b38	RASGRP3	-2.71	0.00692	-0.031395	96	0.011587	no	MSCLSK
chr2_33767410_A_C_b38	RASGRP3	-2.708	0.00695	-0.032094	92	0.01185	no	MSCLSK
chr2_33451360_G_C_b38	RASGRP3	-2.706	0.007	-0.049557	8	0.018316	no	MSCLSK
chr2_32634838_C_G_b38	RASGRP3	-2.683	0.00748	-0.029764	135	0.011092	no	MSCLSK
chr2_33762557_G_C_b38	RASGRP3	-2.677	0.00763	-0.031896	90	0.011917	no	MSCLSK
chr2_33763206_C_T_b38	RASGRP3	-2.677	0.00763	-0.031896	90	0.011917	no	MSCLSK
chr2_33474404_G_A_b38	RASGRP3	2.677	0.00763	0.030143	129	0.011262	no	MSCLSK
chr2_34081734_T_A_b38	RASGRP3	-2.673	0.00771	-0.060891	3	0.022779	no	MSCLSK
chr2_33726667_C_G_b38	RASGRP3	2.672	0.00773	0.042768	14	0.016005	no	MSCLSK
chr2_33765693_G_A_b38	RASGRP3	-2.667	0.00785	-0.031195	92	0.011698	no	MSCLSK
chr2_33548233_C_T_b38	RASGRP3	-2.665	0.0079	-0.033105	71	0.012424	no	MSCLSK
chr2_33525699_C_CAAA_b38	RASGRP3	-2.661	0.00799	-0.089549	6	0.033652	no	MSCLSK
chr2_33631863_T_C_b38	RASGRP3	-2.657	0.00807	-0.029113	166	0.010956	no	MSCLSK
chr2_33765637_C_G_b38	RASGRP3	-2.656	0.0081	-0.031605	90	0.011898	no	MSCLSK
chr2_33765984_G_C_b38	RASGRP3	-2.656	0.0081	-0.031605	90	0.011898	no	MSCLSK
chr2_33768109_G_C_b38	RASGRP3	-2.656	0.0081	-0.031605	90	0.011898	no	MSCLSK
chr2_33767220_GAA_G_b38	RASGRP3	-2.655	0.00813	-0.03161	91	0.011907	no	MSCLSK
chr2_34309734_T_G_b38	RASGRP3	2.647	0.00832	0.072326	5	0.027321	no	MSCLSK
chr2_34310345_A_T_b38	RASGRP3	2.647	0.00832	0.072326	5	0.027321	no	MSCLSK
chr2_33653284_G_GTCTGTCTA_b38	RASGRP3	2.642	0.00844	0.061255	3	0.023184	no	MSCLSK
chr2_33714630_G_C_b38	RASGRP3	2.637	0.00858	0.042821	13	0.016241	no	MSCLSK
chr2_33731863_C_CCTTTCCTTAACTTCAGGACATACTGGGTTCCAGTATGTCCTTAA_b38	RASGRP3	2.634	0.00865	0.053293	8	0.020234	no	MSCLSK
chr2_33768906_G_C_b38	RASGRP3	-2.628	0.00879	-0.031238	90	0.011886	no	MSCLSK
chr2_33762665_A_G_b38	RASGRP3	-2.627	0.00882	-0.031288	90	0.011911	no	MSCLSK
chr2_33511214_C_T_b38	RASGRP3	2.623	0.00893	0.033255	47	0.012679	no	MSCLSK
chr2_33559094_G_A_b38	RASGRP3	-2.609	0.00929	-0.032634	67	0.012507	no	MSCLSK
chr2_33770643_T_C_b38	RASGRP3	-2.598	0.0096	-0.03074	91	0.011833	no	MSCLSK
chr2_33770662_T_C_b38	RASGRP3	-2.597	0.00963	-0.030837	90	0.011875	no	MSCLSK
chr2_33766447_A_G_b38	RASGRP3	-2.592	0.00977	-0.030413	93	0.011734	no	MSCLSK
chr2_33577495_T_TA_b38	RASGRP3	2.59	0.00982	0.046269	5	0.017864	no	MSCLSK
chr2_33469110_G_C_b38	RASGRP3	-2.586	0.00994	-0.04493	9	0.017376	no	MSCLSK
chr2_33615450_C_G_b38	RASGRP3	2.584	0.00998	0.047449	6	0.018361	no	MSCLSK
chr2_33537896_A_G_b38	RASGRP3	13.434	5.93e-35	0.249856	6	0.018599	yes	NERVET
chr2_33557635_G_A_b38	RASGRP3	13.056	2.27e-33	0.244235	6	0.018707	yes	NERVET
chr2_33559734_G_A_b38	RASGRP3	13.056	2.27e-33	0.244235	6	0.018707	yes	NERVET
chr2_33559304_G_A_b38	RASGRP3	13.035	2.76e-33	0.245425	6	0.018828	yes	NERVET
chr2_33557844_G_A_b38	RASGRP3	12.936	7.12e-33	0.233867	9	0.018078	yes	NERVET
chr2_33536526_G_A_b38	RASGRP3	12.823	2.09e-32	0.258629	3	0.020169	yes	NERVET
chr2_33536528_G_A_b38	RASGRP3	12.823	2.09e-32	0.258629	3	0.020169	yes	NERVET
chr2_33546942_C_G_b38	RASGRP3	12.526	3.46e-31	0.243791	6	0.019462	yes	NERVET
chr2_33550216_T_A_b38	RASGRP3	12.475	5.61e-31	0.24416	6	0.019572	yes	NERVET
chr2_33529269_C_A_b38	RASGRP3	12.429	8.61e-31	0.2275	9	0.018303	yes	NERVET
chr2_33526597_C_T_b38	RASGRP3	12.362	1.62e-30	0.232645	7	0.01882	yes	NERVET
chr2_33527062_GC_G_b38	RASGRP3	12.362	1.62e-30	0.232645	7	0.01882	yes	NERVET
chr2_33559068_A_G_b38	RASGRP3	12.355	1.73e-30	0.243981	4	0.019748	yes	NERVET
chr2_33550484_C_G_b38	RASGRP3	12.285	3.31e-30	0.241303	6	0.019641	yes	NERVET
chr2_33531453_C_T_b38	RASGRP3	12.274	3.66e-30	0.228643	8	0.018628	yes	NERVET
chr2_33554542_A_G_b38	RASGRP3	12.236	5.25e-30	0.240938	6	0.019692	yes	NERVET
chr2_33548469_T_C_b38	RASGRP3	12.111	1.67e-29	0.24109	5	0.019907	yes	NERVET
chr2_33551676_A_G_b38	RASGRP3	11.912	1.04e-28	0.241742	4	0.020294	yes	NERVET
chr2_33551697_A_T_b38	RASGRP3	11.912	1.04e-28	0.241742	4	0.020294	yes	NERVET
chr2_33552022_CAAACA_C_b38	RASGRP3	11.879	1.41e-28	0.23773	5	0.020013	yes	NERVET
chr2_33553995_C_T_b38	RASGRP3	11.764	4.03e-28	0.234238	6	0.019911	yes	NERVET
chr2_33537192_G_GAT_b38	RASGRP3	11.365	1.48e-26	0.211229	7	0.018586	yes	NERVET
chr2_33540561_TGTGTGTGTGTG_T_b38	RASGRP3	10.952	5.74e-25	0.195013	16	0.017806	yes	NERVET
chr2_33561445_C_A_b38	RASGRP3	9.656	3.27e-20	0.156148	21	0.016172	yes	NERVET
chr2_33512177_G_A_b38	RASGRP3	9.451	1.71e-19	0.164134	19	0.017368	yes	NERVET
chr2_33529318_C_T_b38	RASGRP3	8.752	3.97e-17	0.143894	18	0.016441	yes	NERVET
chr2_33555164_G_A_b38	RASGRP3	8.728	4.79e-17	0.147893	18	0.016945	yes	NERVET
chr2_33523649_G_A_b38	RASGRP3	8.423	4.7e-16	0.141059	20	0.016747	yes	NERVET
chr2_33547053_GAA_G_b38	RASGRP3	8.043	7.48e-15	0.216608	3	0.026932	yes	NERVET
chr2_33521266_C_T_b38	RASGRP3	8.016	9.06e-15	0.123729	37	0.015435	yes	NERVET
chr2_33556928_C_CACACACATACAT_b38	RASGRP3	7.947	1.48e-14	0.157133	5	0.019773	yes	NERVET
chr2_33596963_A_T_b38	RASGRP3	7.835	3.26e-14	0.127675	33	0.016295	yes	NERVET
chr2_33594385_G_A_b38	RASGRP3	7.721	7.22e-14	0.12629	32	0.016356	yes	NERVET
chr2_33594326_C_T_b38	RASGRP3	7.67	1.03e-13	0.126107	32	0.016442	yes	NERVET
chr2_33565263_A_G_b38	RASGRP3	7.519	2.91e-13	0.123045	36	0.016365	yes	NERVET
chr2_33525341_A_AAT_b38	RASGRP3	7.428	5.4e-13	0.119569	27	0.016098	yes	NERVET
chr2_33596617_C_T_b38	RASGRP3	7.403	6.35e-13	0.122491	32	0.016545	yes	NERVET
chr2_33581561_C_T_b38	RASGRP3	7.398	6.6e-13	0.122044	31	0.016497	yes	NERVET
chr2_33586869_A_T_b38	RASGRP3	7.322	1.1e-12	0.123805	26	0.016908	yes	NERVET
chr2_33582025_C_T_b38	RASGRP3	7.278	1.47e-12	0.11992	30	0.016478	yes	NERVET
chr2_33596450_T_G_b38	RASGRP3	6.394	3.96e-10	0.096729	46	0.015127	yes	NERVET
chr2_33523461_TA_T_b38	RASGRP3	6.279	7.88e-10	0.111422	11	0.017746	yes	NERVET
chr2_33589264_G_C_b38	RASGRP3	6.239	9.95e-10	0.094748	45	0.015185	yes	NERVET
chr2_33590881_T_C_b38	RASGRP3	6.23	1.05e-09	0.094209	45	0.015122	yes	NERVET
chr2_33547458_G_A_b38	RASGRP3	6.132	1.87e-09	0.084818	65	0.013832	yes	NERVET
chr2_33572204_C_A_b38	RASGRP3	-5.909	6.71e-09	-0.081332	87	0.013765	yes	NERVET
chr2_33508447_C_T_b38	RASGRP3	5.889	7.49e-09	0.140962	3	0.023936	yes	NERVET
chr2_33569371_A_G_b38	RASGRP3	-5.812	1.15e-08	-0.079704	87	0.013713	yes	NERVET
chr2_33568339_TA_T_b38	RASGRP3	-5.804	1.21e-08	-0.079405	95	0.013682	yes	NERVET
chr2_33623108_T_C_b38	RASGRP3	5.773	1.43e-08	0.084978	56	0.014719	yes	NERVET
chr2_33567745_C_T_b38	RASGRP3	-5.724	1.88e-08	-0.079021	79	0.013806	yes	NERVET
chr2_33571267_T_A_b38	RASGRP3	-5.683	2.34e-08	-0.077556	86	0.013646	yes	NERVET
chr2_33514489_T_C_b38	RASGRP3	-5.609	3.52e-08	-0.074204	83	0.01323	yes	NERVET
chr2_33575950_G_A_b38	RASGRP3	-5.606	3.58e-08	-0.077256	83	0.013782	yes	NERVET
chr2_33571342_T_C_b38	RASGRP3	-5.534	5.27e-08	-0.075499	87	0.013644	yes	NERVET
chr2_33622592_T_C_b38	RASGRP3	5.531	5.34e-08	0.082587	54	0.014932	yes	NERVET
chr2_33621819_C_A_b38	RASGRP3	5.496	6.43e-08	0.080392	56	0.014627	yes	NERVET
chr2_33631252_G_T_b38	RASGRP3	5.432	9.06e-08	0.076433	133	0.014072	yes	NERVET
chr2_33577889_G_A_b38	RASGRP3	-5.42	9.61e-08	-0.074986	84	0.013834	yes	NERVET
chr2_33518114_A_G_b38	RASGRP3	-5.404	1.04e-07	-0.075901	65	0.014044	yes	NERVET
chr2_33592302_T_C_b38	RASGRP3	5.391	1.12e-07	0.153866	4	0.028542	yes	NERVET
chr2_33657078_T_C_b38	RASGRP3	5.384	1.16e-07	0.084444	41	0.015685	yes	NERVET
chr2_33554839_T_C_b38	RASGRP3	5.3	1.79e-07	0.073788	71	0.013921	yes	NERVET
chr2_33512820_T_A_b38	RASGRP3	-5.286	1.93e-07	-0.072588	71	0.013732	yes	NERVET
chr2_33519891_C_T_b38	RASGRP3	-5.197	3.05e-07	-0.071931	81	0.013841	yes	NERVET
chr2_33605827_ATTTTTCT_A_b38	RASGRP3	5.179	3.34e-07	0.112846	6	0.021788	yes	NERVET
chr2_33571586_T_C_b38	RASGRP3	-5.151	3.85e-07	-0.068435	107	0.013286	yes	NERVET
chr2_33579727_C_T_b38	RASGRP3	5.008	7.85e-07	0.145501	4	0.029055	yes	NERVET
chr2_33539533_G_T_b38	RASGRP3	-4.935	1.12e-06	-0.061095	153	0.012379	yes	NERVET
chr2_33525699_C_CAA_b38	RASGRP3	4.929	1.15e-06	0.133043	15	0.026989	yes	NERVET
chr2_33540615_TTCTC_T_b38	RASGRP3	-4.889	1.4e-06	-0.065388	114	0.013375	yes	NERVET
chr2_33512902_A_G_b38	RASGRP3	-4.867	1.56e-06	-0.067907	109	0.013952	yes	NERVET
chr2_33540888_T_C_b38	RASGRP3	-4.759	2.6e-06	-0.059008	151	0.012398	yes	NERVET
chr2_33541741_G_T_b38	RASGRP3	-4.743	2.82e-06	-0.059036	151	0.012448	yes	NERVET
chr2_33564467_A_G_b38	RASGRP3	4.643	4.48e-06	0.066689	69	0.014362	yes	NERVET
chr2_33556190_G_A_b38	RASGRP3	-4.616	5.07e-06	-0.06401	86	0.013866	yes	NERVET
chr2_33520141_T_C_b38	RASGRP3	-4.609	5.25e-06	-0.065063	97	0.014117	yes	NERVET
chr2_33605951_T_C_b38	RASGRP3	-4.574	6.16e-06	-0.060799	120	0.013293	yes	NERVET
chr2_33539434_T_C_b38	RASGRP3	-4.533	7.41e-06	-0.062308	92	0.013744	yes	NERVET
chr2_33543901_C_G_b38	RASGRP3	-4.51	8.23e-06	-0.064822	65	0.014373	yes	NERVET
chr2_33617107_G_A_b38	RASGRP3	-4.502	8.56e-06	-0.06028	98	0.013391	yes	NERVET
chr2_33615675_TA_T_b38	RASGRP3	-4.493	8.88e-06	-0.060201	98	0.013398	yes	NERVET
chr2_33514230_T_G_b38	RASGRP3	4.481	9.38e-06	0.078251	20	0.017463	yes	NERVET
chr2_33562245_G_C_b38	RASGRP3	-4.425	1.2e-05	-0.060912	91	0.013764	yes	NERVET
chr2_33516403_T_C_b38	RASGRP3	4.396	1.37e-05	0.076324	20	0.017362	yes	NERVET
chr2_33539436_C_G_b38	RASGRP3	-4.386	1.43e-05	-0.060565	91	0.01381	yes	NERVET
chr2_33539642_C_G_b38	RASGRP3	-4.386	1.43e-05	-0.060565	91	0.01381	yes	NERVET
chr2_33588900_A_AT_b38	RASGRP3	-4.373	1.52e-05	-0.063008	103	0.014408	yes	NERVET
chr2_33539996_AAAAAG_A_b38	RASGRP3	-4.352	1.67e-05	-0.062016	117	0.014251	yes	NERVET
chr2_33536207_C_T_b38	RASGRP3	-4.342	1.74e-05	-0.060044	90	0.013828	yes	NERVET
chr2_33539219_T_C_b38	RASGRP3	-4.323	1.89e-05	-0.059313	94	0.01372	yes	NERVET
chr2_33596444_C_T_b38	RASGRP3	-4.321	1.9e-05	-0.075323	24	0.017431	yes	NERVET
chr2_33792363_C_T_b38	RASGRP3	4.297	2.11e-05	0.109239	3	0.025423	yes	NERVET
chr2_33564001_C_G_b38	RASGRP3	4.295	2.14e-05	0.062343	67	0.014517	yes	NERVET
chr2_33536322_GA_G_b38	RASGRP3	-4.267	2.41e-05	-0.062136	109	0.014563	yes	NERVET
chr2_33618669_C_CT_b38	RASGRP3	-4.261	2.47e-05	-0.057092	100	0.013399	yes	NERVET
chr2_33618734_A_G_b38	RASGRP3	-4.261	2.47e-05	-0.057092	100	0.013399	yes	NERVET
chr2_33611855_A_C_b38	RASGRP3	4.251	2.58e-05	0.086255	10	0.020292	yes	NERVET
chr2_33614957_G_A_b38	RASGRP3	-4.241	2.69e-05	-0.056825	98	0.013398	yes	NERVET
chr2_33546150_G_A_b38	RASGRP3	-4.224	2.9e-05	-0.058391	90	0.013824	yes	NERVET
chr2_33607748_A_G_b38	RASGRP3	-4.153	3.9e-05	-0.055251	101	0.013302	yes	NERVET
chr2_33559094_G_A_b38	RASGRP3	-4.087	5.15e-05	-0.058263	62	0.014255	yes	NERVET
chr2_33559433_G_A_b38	RASGRP3	-4.079	5.33e-05	-0.05802	62	0.014224	yes	NERVET
chr2_33631863_T_C_b38	RASGRP3	-4.071	5.51e-05	-0.053513	131	0.013145	yes	NERVET
chr2_33631185_T_G_b38	RASGRP3	-4.063	5.68e-05	-0.053485	130	0.013163	yes	NERVET
chr2_33625063_ATCT_A_b38	RASGRP3	-4.058	5.82e-05	-0.055081	92	0.013575	yes	NERVET
chr2_33522519_T_C_b38	RASGRP3	-4.055	5.89e-05	-0.056867	91	0.014025	yes	NERVET
chr2_33622456_T_TAAAC_b38	RASGRP3	-4.025	6.66e-05	-0.053788	100	0.013363	yes	NERVET
chr2_33596707_C_G_b38	RASGRP3	-3.999	7.39e-05	-0.068541	26	0.017138	yes	NERVET
chr2_33521775_G_C_b38	RASGRP3	-3.991	7.66e-05	-0.056026	80	0.014039	yes	NERVET
chr2_33520335_A_G_b38	RASGRP3	-3.99	7.68e-05	-0.055429	98	0.013891	yes	NERVET
chr2_33518880_G_GTCA_b38	RASGRP3	-3.984	7.87e-05	-0.05558	95	0.01395	yes	NERVET
chr2_33544520_G_GA_b38	RASGRP3	-3.98	8.01e-05	-0.057166	86	0.014364	yes	NERVET
chr2_33548717_A_T_b38	RASGRP3	-3.845	0.000137	-0.053548	95	0.013925	yes	NERVET
chr2_33630364_C_G_b38	RASGRP3	-3.845	0.000137	-0.051342	96	0.013352	yes	NERVET
chr2_33613986_T_C_b38	RASGRP3	-3.822	0.00015	-0.05109	101	0.013366	yes	NERVET
chr2_33523771_A_G_b38	RASGRP3	-3.753	0.000197	-0.053202	78	0.014176	yes	NERVET
chr2_33567211_TA_T_b38	RASGRP3	-3.747	0.000201	-0.056675	69	0.015124	yes	NERVET
chr2_33631637_C_A_b38	RASGRP3	-3.738	0.000209	-0.050009	97	0.013379	yes	NERVET
chr2_33647765_T_C_b38	RASGRP3	-3.72	0.000224	-0.049426	121	0.013288	yes	NERVET
chr2_33529319_G_C_b38	RASGRP3	-3.713	0.00023	-0.051501	95	0.01387	yes	NERVET
chr2_33625433_A_C_b38	RASGRP3	-3.707	0.000236	-0.050066	94	0.013507	yes	NERVET
chr2_33540561_TGTGTGTGTGTGTGTGTG_T_b38	RASGRP3	-3.701	0.00024	-0.051292	85	0.013858	yes	NERVET
chr2_33525388_G_A_b38	RASGRP3	-3.695	0.000246	-0.052059	77	0.014089	yes	NERVET
chr2_33586449_C_G_b38	RASGRP3	-3.694	0.000247	-0.048861	121	0.013227	yes	NERVET
chr2_33549339_CAT_C_b38	RASGRP3	-3.677	0.000263	-0.052619	69	0.014309	yes	NERVET
chr2_33577835_T_C_b38	RASGRP3	-3.662	0.000279	-0.048645	120	0.013284	yes	NERVET
chr2_33620497_T_C_b38	RASGRP3	3.658	0.000283	0.066008	21	0.018043	yes	NERVET
chr2_33661156_C_T_b38	RASGRP3	3.64	0.000304	0.0572	33	0.015716	yes	NERVET
chr2_33661310_C_T_b38	RASGRP3	3.64	0.000304	0.0572	33	0.015716	yes	NERVET
chr2_33569651_CA_C_b38	RASGRP3	-3.635	0.00031	-0.066398	40	0.018268	yes	NERVET
chr2_33546315_C_T_b38	RASGRP3	-3.635	0.00031	-0.05156	70	0.014186	yes	NERVET
chr2_33597253_G_A_b38	RASGRP3	-3.625	0.000321	-0.049151	114	0.013557	yes	NERVET
chr2_33593131_C_T_b38	RASGRP3	-3.62	0.000328	-0.048116	120	0.013293	yes	NERVET
chr2_33534694_A_AT_b38	RASGRP3	3.609	0.000341	0.058888	31	0.016316	yes	NERVET
chr2_33592492_A_G_b38	RASGRP3	-3.603	0.000349	-0.047825	121	0.013273	yes	NERVET
chr2_33625060_G_A_b38	RASGRP3	-3.602	0.00035	-0.048983	100	0.013597	yes	NERVET
chr2_33624514_C_A_b38	RASGRP3	-3.596	0.000358	-0.048515	101	0.013491	yes	NERVET
chr2_33641120_T_C_b38	RASGRP3	-3.595	0.00036	-0.04804	117	0.013365	yes	NERVET
chr2_33591195_C_CT_b38	RASGRP3	-3.586	0.000371	-0.053888	65	0.015026	yes	NERVET
chr2_33563588_C_T_b38	RASGRP3	-3.564	0.000404	-0.050477	72	0.014164	yes	NERVET
chr2_33658713_G_A_b38	RASGRP3	-3.532	0.000453	-0.047567	114	0.013466	yes	NERVET
chr2_33589523_A_G_b38	RASGRP3	-3.53	0.000458	-0.046621	124	0.013208	yes	NERVET
chr2_33637426_T_A_b38	RASGRP3	3.52	0.000474	0.06388	20	0.018147	yes	NERVET
chr2_33575832_C_A_b38	RASGRP3	-3.508	0.000495	-0.046683	123	0.013306	yes	NERVET
chr2_33632169_T_C_b38	RASGRP3	-3.498	0.000514	-0.047009	92	0.013438	yes	NERVET
chr2_33508487_T_C_b38	RASGRP3	3.481	0.000547	0.080138	13	0.023021	yes	NERVET
chr2_32586423_C_CT_b38	RASGRP3	3.477	0.000555	0.179066	3	0.051497	yes	NERVET
chr2_33620575_G_A_b38	RASGRP3	3.462	0.000586	0.062932	21	0.018178	yes	NERVET
chr2_33580247_A_G_b38	RASGRP3	-3.432	0.000653	-0.046308	118	0.013492	yes	NERVET
chr2_33533389_G_A_b38	RASGRP3	-3.416	0.000692	-0.047879	83	0.014017	yes	NERVET
chr2_33604404_GTATATA_G_b38	RASGRP3	-3.408	0.000711	-0.073032	5	0.021428	yes	NERVET
chr2_33540861_TA_T_b38	RASGRP3	-3.379	0.000788	-0.044524	95	0.013175	yes	NERVET
chr2_33629277_A_G_b38	RASGRP3	-3.374	0.000804	-0.045365	104	0.013447	yes	NERVET
chr2_33662442_T_C_b38	RASGRP3	-3.369	0.000818	-0.045128	118	0.013396	yes	NERVET
chr2_33655774_A_G_b38	RASGRP3	-3.362	0.000839	-0.044892	120	0.013354	yes	NERVET
chr2_33669785_CA_C_b38	RASGRP3	-3.358	0.000851	-0.045823	90	0.013647	yes	NERVET
chr2_33630302_AT_A_b38	RASGRP3	-3.357	0.000853	-0.049033	98	0.014607	yes	NERVET
chr2_33658757_C_A_b38	RASGRP3	-3.352	0.000868	-0.045187	109	0.01348	yes	NERVET
chr2_34368823_G_T_b38	RASGRP3	3.345	0.00089	0.115339	9	0.03448	yes	NERVET
chr2_33658170_A_G_b38	RASGRP3	-3.34	0.000905	-0.044767	116	0.013403	yes	NERVET
chr2_34368928_CT_C_b38	RASGRP3	3.319	0.000976	0.063494	10	0.019133	yes	NERVET
chr2_33590404_A_G_b38	RASGRP3	-3.313	0.000997	-0.043963	121	0.013271	yes	NERVET
chr2_33548672_A_T_b38	RASGRP3	-3.305	0.00102	-0.047328	70	0.01432	yes	NERVET
chr2_33668515_A_G_b38	RASGRP3	-3.304	0.00103	-0.043962	119	0.013306	yes	NERVET
chr2_33576389_C_T_b38	RASGRP3	-3.297	0.00105	-0.044623	116	0.013536	yes	NERVET
chr2_33706678_T_C_b38	RASGRP3	3.29	0.00108	0.077318	3	0.0235	yes	NERVET
chr2_33622130_C_CA_b38	RASGRP3	3.279	0.00112	0.07576	11	0.023108	yes	NERVET
chr2_33655112_A_AT_b38	RASGRP3	-3.229	0.00133	-0.044557	105	0.013798	yes	NERVET
chr2_33532487_C_A_b38	RASGRP3	3.215	0.0014	0.044265	129	0.013768	yes	NERVET
chr2_33660983_C_T_b38	RASGRP3	-3.193	0.00151	-0.042843	112	0.013419	yes	NERVET
chr2_33526414_G_A_b38	RASGRP3	-3.152	0.00173	-0.044596	79	0.014148	yes	NERVET
chr2_33655786_T_C_b38	RASGRP3	-3.132	0.00185	-0.042054	115	0.013429	yes	NERVET
chr2_33561192_A_G_b38	RASGRP3	3.12	0.00192	0.042305	111	0.013558	yes	NERVET
chr2_34369317_A_G_b38	RASGRP3	-3.118	0.00193	-0.042809	127	0.01373	yes	NERVET
chr2_34369371_G_C_b38	RASGRP3	-3.118	0.00193	-0.042809	127	0.01373	yes	NERVET
chr2_34369375_T_C_b38	RASGRP3	-3.118	0.00193	-0.042809	127	0.01373	yes	NERVET
chr2_33792413_CAGG_C_b38	RASGRP3	3.118	0.00194	0.074631	5	0.023938	yes	NERVET
chr2_34354488_G_A_b38	RASGRP3	3.102	0.00204	0.108934	9	0.035112	yes	NERVET
chr2_33036306_T_C_b38	RASGRP3	-3.101	0.00204	-0.044459	54	0.014335	yes	NERVET
chr2_33089155_CAA_C_b38	RASGRP3	-3.1	0.00205	-0.059367	12	0.019148	yes	NERVET
chr2_33477835_C_T_b38	RASGRP3	3.099	0.00206	0.050683	24	0.016354	yes	NERVET
chr2_33673146_T_C_b38	RASGRP3	-3.096	0.00208	-0.040494	123	0.01308	yes	NERVET
chr2_33566210_A_C_b38	RASGRP3	-3.073	0.00225	-0.049293	34	0.016041	yes	NERVET
chr2_32957368_G_T_b38	RASGRP3	-3.046	0.00245	-0.043881	68	0.014407	yes	NERVET
chr2_33638203_C_CT_b38	RASGRP3	-3.036	0.00253	-0.048947	45	0.016122	yes	NERVET
chr2_32954704_C_T_b38	RASGRP3	-3.027	0.00261	-0.043673	70	0.014428	yes	NERVET
chr2_33664465_T_A_b38	RASGRP3	-3.018	0.00269	-0.039693	126	0.013152	yes	NERVET
chr2_34357401_C_G_b38	RASGRP3	3.016	0.00271	0.126974	3	0.042104	yes	NERVET
chr2_33659127_A_G_b38	RASGRP3	-3.012	0.00274	-0.039293	131	0.013046	yes	NERVET
chr2_33523461_TAA_T_b38	RASGRP3	-3.011	0.00275	-0.049021	39	0.016283	yes	NERVET
chr2_32956808_C_T_b38	RASGRP3	-2.985	0.00299	-0.0432	72	0.014474	yes	NERVET
chr2_32955630_A_AT_b38	RASGRP3	-2.966	0.00317	-0.043067	70	0.01452	yes	NERVET
chr2_32943954_TTTG_T_b38	RASGRP3	2.949	0.00335	0.116652	5	0.03956	yes	NERVET
chr2_34332907_GT_G_b38	RASGRP3	-2.946	0.00338	-0.043863	71	0.014887	yes	NERVET
chr2_34049594_C_CT_b38	RASGRP3	-2.946	0.00339	-0.07134	14	0.02422	yes	NERVET
chr2_33004646_G_A_b38	RASGRP3	2.926	0.0036	0.043334	51	0.014809	yes	NERVET
chr2_33475238_C_T_b38	RASGRP3	2.918	0.00369	0.055213	12	0.018921	yes	NERVET
chr2_33622130_CA_C_b38	RASGRP3	-2.914	0.00374	-0.04523	47	0.01552	yes	NERVET
chr2_32984074_C_T_b38	RASGRP3	-2.909	0.0038	-0.048334	30	0.016613	yes	NERVET
chr2_33661861_G_A_b38	RASGRP3	-2.906	0.00384	-0.038149	124	0.013127	yes	NERVET
chr2_34352231_AT_A_b38	RASGRP3	2.904	0.00386	0.053145	17	0.018302	yes	NERVET
chr2_32957548_T_C_b38	RASGRP3	-2.898	0.00394	-0.04216	66	0.01455	yes	NERVET
chr2_32983527_A_T_b38	RASGRP3	-2.893	0.004	-0.048547	29	0.01678	yes	NERVET
chr2_32986039_T_C_b38	RASGRP3	-2.893	0.004	-0.048547	29	0.01678	yes	NERVET
chr2_32973114_G_GT_b38	RASGRP3	2.873	0.00426	0.041877	59	0.014578	yes	NERVET
chr2_33661731_A_G_b38	RASGRP3	-2.852	0.00454	-0.037337	131	0.013093	yes	NERVET
chr2_34246673_T_C_b38	RASGRP3	2.842	0.00468	0.050254	20	0.01768	yes	NERVET
chr2_34246924_T_C_b38	RASGRP3	2.842	0.00468	0.050254	20	0.01768	yes	NERVET
chr2_33563592_T_TAACA_b38	RASGRP3	-2.842	0.00468	-0.042489	51	0.01495	yes	NERVET
chr2_33478490_C_T_b38	RASGRP3	2.836	0.00476	0.039377	83	0.013883	yes	NERVET
chr2_33792503_A_G_b38	RASGRP3	-2.831	0.00485	-0.045697	46	0.016144	yes	NERVET
chr2_34133383_C_G_b38	RASGRP3	2.829	0.00488	0.061389	6	0.021703	yes	NERVET
chr2_34318746_G_A_b38	RASGRP3	-2.828	0.00489	-0.042183	54	0.014916	yes	NERVET
chr2_32961194_A_G_b38	RASGRP3	2.823	0.00496	0.040889	61	0.014482	yes	NERVET
chr2_32981391_A_C_b38	RASGRP3	-2.818	0.00504	-0.046607	30	0.016541	yes	NERVET
chr2_32982837_T_C_b38	RASGRP3	-2.818	0.00504	-0.046607	30	0.016541	yes	NERVET
chr2_34352231_ATT_A_b38	RASGRP3	-2.808	0.00519	-0.043274	42	0.015409	yes	NERVET
chr2_34318312_C_G_b38	RASGRP3	-2.799	0.00533	-0.041694	54	0.014894	yes	NERVET
chr2_33601956_TA_T_b38	RASGRP3	2.799	0.00534	0.040227	125	0.014373	yes	NERVET
chr2_34366652_G_GA_b38	RASGRP3	-2.798	0.00535	-0.041174	52	0.014715	yes	NERVET
chr2_33094313_A_T_b38	RASGRP3	-2.798	0.00536	-0.054786	13	0.019581	yes	NERVET
chr2_33037174_T_TA_b38	RASGRP3	-2.796	0.00538	-0.050364	16	0.01801	yes	NERVET
chr2_32962672_T_C_b38	RASGRP3	-2.793	0.00544	-0.040919	68	0.014651	yes	NERVET
chr2_32963401_A_G_b38	RASGRP3	-2.793	0.00544	-0.040919	68	0.014651	yes	NERVET
chr2_34368805_C_G_b38	RASGRP3	2.788	0.00552	0.111042	3	0.039827	yes	NERVET
chr2_33792244_T_C_b38	RASGRP3	2.784	0.00559	0.10377	3	0.037273	yes	NERVET
chr2_34245101_T_A_b38	RASGRP3	2.781	0.00565	0.0492	20	0.017694	yes	NERVET
chr2_33140669_A_AT_b38	RASGRP3	-2.777	0.0057	-0.0708	5	0.025492	yes	NERVET
chr2_33629657_C_CT_b38	RASGRP3	2.776	0.00573	0.050633	20	0.018241	yes	NERVET
chr2_34276337_A_G_b38	RASGRP3	-2.762	0.00597	-0.036989	135	0.013391	yes	NERVET
chr2_34281051_A_T_b38	RASGRP3	2.76	0.00601	0.056941	13	0.02063	yes	NERVET
chr2_34366540_G_A_b38	RASGRP3	-2.747	0.00624	-0.040462	52	0.014728	yes	NERVET
chr2_34362548_C_G_b38	RASGRP3	-2.746	0.00627	-0.040396	52	0.014711	yes	NERVET
chr2_34317615_T_A_b38	RASGRP3	-2.743	0.00633	-0.040773	54	0.014866	yes	NERVET
chr2_32972273_GT_G_b38	RASGRP3	-2.74	0.00638	-0.039476	83	0.014405	yes	NERVET
chr2_32978051_A_G_b38	RASGRP3	-2.727	0.00664	-0.045126	30	0.016549	yes	NERVET
chr2_32980483_G_A_b38	RASGRP3	-2.727	0.00664	-0.050365	18	0.018472	yes	NERVET
chr2_33073285_TG_T_b38	RASGRP3	2.726	0.00665	0.041527	64	0.015231	yes	NERVET
chr2_34128049_T_A_b38	RASGRP3	2.722	0.00673	0.058737	6	0.021575	yes	NERVET
chr2_32983073_T_C_b38	RASGRP3	-2.722	0.00674	-0.04507	30	0.016559	yes	NERVET
chr2_32983177_C_CAT_b38	RASGRP3	-2.722	0.00674	-0.04507	30	0.016559	yes	NERVET
chr2_34280727_T_A_b38	RASGRP3	2.717	0.00683	0.056357	12	0.020739	yes	NERVET
chr2_33061804_A_G_b38	RASGRP3	-2.713	0.00693	-0.054071	12	0.019933	yes	NERVET
chr2_33061822_C_T_b38	RASGRP3	-2.713	0.00693	-0.054071	12	0.019933	yes	NERVET
chr2_33061864_C_T_b38	RASGRP3	-2.713	0.00693	-0.054071	12	0.019933	yes	NERVET
chr2_33061913_T_A_b38	RASGRP3	-2.713	0.00693	-0.054071	12	0.019933	yes	NERVET
chr2_34363481_A_G_b38	RASGRP3	-2.711	0.00696	-0.039748	53	0.014662	yes	NERVET
chr2_33556890_T_TAC_b38	RASGRP3	-2.705	0.00708	-0.071201	5	0.02632	yes	NERVET
chr2_34325618_C_T_b38	RASGRP3	-2.705	0.00709	-0.04019	54	0.01486	yes	NERVET
chr2_32983625_A_G_b38	RASGRP3	-2.703	0.00712	-0.045201	29	0.016721	yes	NERVET
chr2_34340873_G_A_b38	RASGRP3	-2.703	0.00713	-0.037316	94	0.013807	yes	NERVET
chr2_34359242_AATTTCCACTTTTACGT_A_b38	RASGRP3	-2.691	0.00737	-0.039804	51	0.01479	yes	NERVET
chr2_34354534_A_C_b38	RASGRP3	2.69	0.0074	0.092265	9	0.034294	yes	NERVET
chr2_33093224_G_A_b38	RASGRP3	-2.689	0.00743	-0.053073	13	0.019739	yes	NERVET
chr2_33095213_C_T_b38	RASGRP3	-2.689	0.00743	-0.053073	13	0.019739	yes	NERVET
chr2_33663649_A_C_b38	RASGRP3	-2.686	0.00749	-0.035383	132	0.013174	yes	NERVET
chr2_33946606_G_A_b38	RASGRP3	2.685	0.00753	0.070741	12	0.026351	yes	NERVET
chr2_34361944_T_G_b38	RASGRP3	-2.683	0.00756	-0.039685	51	0.014793	yes	NERVET
chr2_34317663_G_T_b38	RASGRP3	-2.675	0.00775	-0.039848	54	0.014898	yes	NERVET
chr2_34318475_TTACTC_T_b38	RASGRP3	-2.675	0.00775	-0.039848	54	0.014898	yes	NERVET
chr2_34318795_C_T_b38	RASGRP3	-2.675	0.00775	-0.039848	54	0.014898	yes	NERVET
chr2_34319096_C_T_b38	RASGRP3	-2.675	0.00775	-0.039848	54	0.014898	yes	NERVET
chr2_34319831_G_A_b38	RASGRP3	-2.675	0.00775	-0.039848	54	0.014898	yes	NERVET
chr2_34320437_T_A_b38	RASGRP3	-2.675	0.00775	-0.039848	54	0.014898	yes	NERVET
chr2_34112370_G_C_b38	RASGRP3	2.654	0.00822	0.058825	6	0.022161	yes	NERVET
chr2_33299889_T_C_b38	RASGRP3	2.649	0.00835	0.115154	3	0.043471	yes	NERVET
chr2_33091380_G_C_b38	RASGRP3	-2.644	0.00847	-0.051812	14	0.019596	yes	NERVET
chr2_34332263_G_C_b38	RASGRP3	-2.639	0.00859	-0.039453	53	0.014949	yes	NERVET
chr2_34332353_G_T_b38	RASGRP3	-2.639	0.00859	-0.039453	53	0.014949	yes	NERVET
chr2_34337137_A_G_b38	RASGRP3	-2.639	0.00859	-0.039453	53	0.014949	yes	NERVET
chr2_34337320_T_C_b38	RASGRP3	-2.639	0.00859	-0.039453	53	0.014949	yes	NERVET
chr2_34339371_T_C_b38	RASGRP3	-2.639	0.00859	-0.039453	53	0.014949	yes	NERVET
chr2_34341508_C_G_b38	RASGRP3	-2.639	0.00859	-0.039453	53	0.014949	yes	NERVET
chr2_34343674_AT_A_b38	RASGRP3	-2.639	0.00859	-0.039453	53	0.014949	yes	NERVET
chr2_34344929_T_C_b38	RASGRP3	-2.639	0.00859	-0.039453	53	0.014949	yes	NERVET
chr2_34346341_G_A_b38	RASGRP3	-2.639	0.00859	-0.039453	53	0.014949	yes	NERVET
chr2_34347740_T_C_b38	RASGRP3	-2.639	0.00859	-0.039453	53	0.014949	yes	NERVET
chr2_34348428_A_AT_b38	RASGRP3	-2.639	0.00859	-0.039453	53	0.014949	yes	NERVET
chr2_34336802_G_A_b38	RASGRP3	-2.635	0.00869	-0.039407	54	0.014953	yes	NERVET
chr2_33415038_T_C_b38	RASGRP3	2.634	0.00873	0.121515	3	0.046141	yes	NERVET
chr2_34110122_T_G_b38	RASGRP3	2.632	0.00877	0.057701	4	0.021921	yes	NERVET
chr2_33960867_G_C_b38	RASGRP3	2.632	0.00878	0.071496	10	0.027167	yes	NERVET
chr2_33960883_A_G_b38	RASGRP3	2.632	0.00878	0.071496	10	0.027167	yes	NERVET
chr2_33960991_T_A_b38	RASGRP3	2.632	0.00878	0.071496	10	0.027167	yes	NERVET
chr2_33961770_G_A_b38	RASGRP3	2.632	0.00878	0.071496	10	0.027167	yes	NERVET
chr2_33962189_G_A_b38	RASGRP3	2.632	0.00878	0.071496	10	0.027167	yes	NERVET
chr2_33963279_A_G_b38	RASGRP3	2.632	0.00878	0.071496	10	0.027167	yes	NERVET
chr2_33963573_A_G_b38	RASGRP3	2.632	0.00878	0.071496	10	0.027167	yes	NERVET
chr2_33095594_G_C_b38	RASGRP3	-2.629	0.00885	-0.051575	13	0.019619	yes	NERVET
chr2_33565010_T_TAC_b38	RASGRP3	-2.626	0.00893	-0.043717	25	0.016649	yes	NERVET
chr2_34334408_AT_A_b38	RASGRP3	-2.622	0.00904	-0.039198	53	0.014951	yes	NERVET
chr2_33029656_A_G_b38	RASGRP3	-2.621	0.00905	-0.039712	37	0.015149	yes	NERVET
chr2_34127063_C_G_b38	RASGRP3	2.621	0.00907	0.057771	6	0.022046	yes	NERVET
chr2_33034952_C_A_b38	RASGRP3	-2.617	0.00917	-0.052724	12	0.02015	yes	NERVET
chr2_34294712_A_G_b38	RASGRP3	-2.614	0.00924	-0.038274	59	0.014641	yes	NERVET
chr2_33950242_T_TTA_b38	RASGRP3	-2.614	0.00924	-0.039314	51	0.015039	yes	NERVET
chr2_34322684_C_G_b38	RASGRP3	-2.613	0.00928	-0.038902	54	0.01489	yes	NERVET
chr2_33113043_T_C_b38	RASGRP3	-2.612	0.0093	-0.046545	18	0.01782	yes	NERVET
chr2_34274232_T_C_b38	RASGRP3	-2.608	0.00941	-0.039486	53	0.015142	yes	NERVET
chr2_33651789_G_A_b38	RASGRP3	2.606	0.00945	0.096807	3	0.037146	yes	NERVET
chr2_34319746_C_CTGTGTG_b38	RASGRP3	-2.598	0.00969	-0.040894	40	0.015743	yes	NERVET
chr2_33290471_T_C_b38	RASGRP3	2.594	0.00978	0.112864	3	0.043505	yes	NERVET
chr2_34317252_T_C_b38	RASGRP3	-2.594	0.00979	-0.038756	54	0.01494	yes	NERVET
chr2_33548762_A_G_b38	RASGRP3	11.393	1.15e-26	0.242131	3	0.021253	no	NERVET
chr2_33539987_GAAAAA_G_b38	RASGRP3	11.013	3.36e-25	0.244262	3	0.022179	no	NERVET
chr2_33537330_C_CCCAACACA_b38	RASGRP3	10.972	4.83e-25	0.185159	27	0.016876	no	NERVET
chr2_33536322_G_GA_b38	RASGRP3	7.676	9.86e-14	0.160871	14	0.020957	no	NERVET
chr2_33622160_C_T_b38	RASGRP3	6.731	5.03e-11	0.102937	43	0.015293	no	NERVET
chr2_33640631_A_C_b38	RASGRP3	6.621	9.96e-11	0.109035	21	0.016469	no	NERVET
chr2_33641397_G_C_b38	RASGRP3	6.36	4.86e-10	0.105247	21	0.016548	no	NERVET
chr2_33639021_G_A_b38	RASGRP3	6.144	1.75e-09	0.10202	21	0.016606	no	NERVET
chr2_33625315_G_A_b38	RASGRP3	6.029	3.38e-09	0.095898	36	0.015905	no	NERVET
chr2_33670716_C_T_b38	RASGRP3	5.864	8.63e-09	0.095369	28	0.016264	no	NERVET
chr2_33656248_TTC_T_b38	RASGRP3	5.811	1.16e-08	0.096893	21	0.016673	no	NERVET
chr2_33650021_A_G_b38	RASGRP3	5.757	1.57e-08	0.095963	21	0.016669	no	NERVET
chr2_33652477_C_A_b38	RASGRP3	5.746	1.67e-08	0.095791	21	0.016672	no	NERVET
chr2_33509399_C_CA_b38	RASGRP3	5.45	8.21e-08	0.107737	6	0.019768	no	NERVET
chr2_33656848_TA_T_b38	RASGRP3	5.367	1.27e-07	0.084558	34	0.015756	no	NERVET
chr2_33557001_G_GA_b38	RASGRP3	5.349	1.4e-07	0.175654	3	0.03284	no	NERVET
chr2_33548381_A_AAAAAG_b38	RASGRP3	5.297	1.83e-07	0.126472	7	0.023875	no	NERVET
chr2_33624881_G_GT_b38	RASGRP3	5.224	2.66e-07	0.079506	45	0.01522	no	NERVET
chr2_33563965_A_G_b38	RASGRP3	5.163	3.62e-07	0.106625	8	0.020652	no	NERVET
chr2_33631243_G_GT_b38	RASGRP3	5.104	4.88e-07	0.112778	6	0.022097	no	NERVET
chr2_33663555_T_C_b38	RASGRP3	5.037	6.8e-07	0.083427	23	0.016563	no	NERVET
chr2_33616325_C_T_b38	RASGRP3	5.031	7e-07	0.11283	6	0.022426	no	NERVET
chr2_33662459_C_T_b38	RASGRP3	4.985	8.78e-07	0.082518	23	0.016553	no	NERVET
chr2_33626436_A_T_b38	RASGRP3	4.962	9.85e-07	0.075581	47	0.015233	no	NERVET
chr2_33640513_G_C_b38	RASGRP3	4.855	1.65e-06	0.10734	6	0.02211	no	NERVET
chr2_33627793_A_G_b38	RASGRP3	4.852	1.67e-06	0.106606	6	0.02197	no	NERVET
chr2_33656916_G_A_b38	RASGRP3	4.84	1.77e-06	0.073521	53	0.01519	no	NERVET
chr2_33613720_G_A_b38	RASGRP3	4.799	2.16e-06	0.099074	13	0.020646	no	NERVET
chr2_33511010_G_A_b38	RASGRP3	4.796	2.19e-06	0.111007	9	0.023145	no	NERVET
chr2_33581900_A_T_b38	RASGRP3	4.785	2.31e-06	0.100466	8	0.020996	no	NERVET
chr2_33634816_G_T_b38	RASGRP3	4.754	2.67e-06	0.105307	6	0.02215	no	NERVET
chr2_33606727_T_C_b38	RASGRP3	4.742	2.83e-06	0.113299	4	0.023894	no	NERVET
chr2_33669574_A_G_b38	RASGRP3	4.687	3.65e-06	0.08712	12	0.018587	no	NERVET
chr2_33667549_A_G_b38	RASGRP3	4.683	3.73e-06	0.103886	6	0.022185	no	NERVET
chr2_33667555_A_G_b38	RASGRP3	4.683	3.73e-06	0.103886	6	0.022185	no	NERVET
chr2_33581338_T_A_b38	RASGRP3	4.642	4.51e-06	0.098203	8	0.021156	no	NERVET
chr2_33636858_C_G_b38	RASGRP3	4.624	4.89e-06	0.102521	6	0.02217	no	NERVET
chr2_33637736_A_T_b38	RASGRP3	4.624	4.89e-06	0.102521	6	0.02217	no	NERVET
chr2_33606703_C_T_b38	RASGRP3	4.581	5.98e-06	0.106114	6	0.023166	no	NERVET
chr2_33669427_A_C_b38	RASGRP3	4.528	7.58e-06	0.08421	13	0.018597	no	NERVET
chr2_33659035_G_A_b38	RASGRP3	4.513	8.11e-06	0.100934	6	0.022364	no	NERVET
chr2_33672387_A_G_b38	RASGRP3	4.488	9.1e-06	0.082362	14	0.018352	no	NERVET
chr2_33634524_A_G_b38	RASGRP3	4.325	1.87e-05	0.096872	6	0.022399	no	NERVET
chr2_33573675_A_G_b38	RASGRP3	4.133	4.25e-05	0.125094	3	0.030266	no	NERVET
chr2_33615450_C_G_b38	RASGRP3	4.095	4.99e-05	0.089719	5	0.021911	no	NERVET
chr2_33629533_C_G_b38	RASGRP3	4.066	5.63e-05	0.081835	11	0.020127	no	NERVET
chr2_33602942_T_C_b38	RASGRP3	3.986	7.82e-05	0.09178	3	0.023027	no	NERVET
chr2_33537321_C_CA_b38	RASGRP3	3.918	0.000103	0.053683	85	0.013703	no	NERVET
chr2_33615793_A_T_b38	RASGRP3	3.912	0.000105	0.085319	5	0.021809	no	NERVET
chr2_33621944_G_A_b38	RASGRP3	3.826	0.000148	0.08383	5	0.021913	no	NERVET
chr2_33623483_C_T_b38	RASGRP3	3.826	0.000148	0.08383	5	0.021913	no	NERVET
chr2_33607432_G_A_b38	RASGRP3	3.772	0.000183	0.083222	5	0.022066	no	NERVET
chr2_32985271_ACTGAGCT_A_b38	RASGRP3	3.739	0.000208	0.052839	78	0.014132	no	NERVET
chr2_33731863_C_CCTTTCCTTAACTTCAGGACATACTGGGTTCCAGTATGTCCTTAA_b38	RASGRP3	3.663	0.000278	0.091454	5	0.024968	no	NERVET
chr2_33633545_T_G_b38	RASGRP3	3.581	0.000378	0.078787	5	0.021999	no	NERVET
chr2_33605847_C_CT_b38	RASGRP3	3.573	0.00039	0.078768	4	0.022044	no	NERVET
chr2_33412992_C_G_b38	RASGRP3	3.571	0.000393	0.167598	3	0.046936	no	NERVET
chr2_33414534_T_G_b38	RASGRP3	3.571	0.000393	0.167598	3	0.046936	no	NERVET
chr2_33523281_G_A_b38	RASGRP3	-3.547	0.000429	-0.050594	75	0.014263	no	NERVET
chr2_33514725_A_T_b38	RASGRP3	-3.546	0.00043	-0.048744	94	0.013745	no	NERVET
chr2_33565010_T_TACACACAC_b38	RASGRP3	3.526	0.000464	0.099778	3	0.0283	no	NERVET
chr2_33515662_T_C_b38	RASGRP3	3.433	0.00065	0.064983	15	0.018928	no	NERVET
chr2_33740099_T_TTTG_b38	RASGRP3	3.429	0.00066	0.07084	7	0.020659	no	NERVET
chr2_33671460_G_A_b38	RASGRP3	3.265	0.00118	0.067168	8	0.020572	no	NERVET
chr2_33741270_T_C_b38	RASGRP3	3.233	0.00131	0.071221	6	0.022026	no	NERVET
chr2_33082717_G_T_b38	RASGRP3	3.226	0.00134	0.047506	59	0.014726	no	NERVET
chr2_33603907_A_C_b38	RASGRP3	3.206	0.00144	0.065746	11	0.020505	no	NERVET
chr2_33520269_T_C_b38	RASGRP3	3.197	0.00148	0.055522	18	0.017367	no	NERVET
chr2_33603617_TC_T_b38	RASGRP3	3.18	0.00157	0.064953	11	0.020425	no	NERVET
chr2_34294855_A_C_b38	RASGRP3	-3.12	0.00192	-0.045425	55	0.01456	no	NERVET
chr2_33732506_C_T_b38	RASGRP3	3.094	0.0021	0.070436	5	0.022767	no	NERVET
chr2_33734078_T_A_b38	RASGRP3	3.094	0.0021	0.070436	5	0.022767	no	NERVET
chr2_33749611_C_T_b38	RASGRP3	3.082	0.00218	0.069832	4	0.022659	no	NERVET
chr2_33751236_C_G_b38	RASGRP3	3.082	0.00218	0.069832	4	0.022659	no	NERVET
chr2_33749290_G_T_b38	RASGRP3	3.048	0.00244	0.074605	3	0.024477	no	NERVET
chr2_33745369_C_T_b38	RASGRP3	3.038	0.00251	0.067781	5	0.022308	no	NERVET
chr2_33731949_C_G_b38	RASGRP3	3.016	0.0027	0.068809	5	0.022813	no	NERVET
chr2_33014179_C_T_b38	RASGRP3	2.999	0.00286	0.044596	52	0.014871	no	NERVET
chr2_33749131_A_G_b38	RASGRP3	2.996	0.00289	0.06549	8	0.021861	no	NERVET
chr2_33734734_G_A_b38	RASGRP3	2.991	0.00293	0.072688	3	0.024304	no	NERVET
chr2_33811839_T_C_b38	RASGRP3	-2.974	0.00309	-0.068016	20	0.022867	no	NERVET
chr2_33133012_A_C_b38	RASGRP3	2.973	0.0031	0.053644	15	0.018041	no	NERVET
chr2_33038840_T_G_b38	RASGRP3	-2.953	0.00331	-0.043667	47	0.014789	no	NERVET
chr2_33038849_A_G_b38	RASGRP3	-2.953	0.00331	-0.043667	47	0.014789	no	NERVET
chr2_33563089_C_T_b38	RASGRP3	2.947	0.00337	0.045392	40	0.015402	no	NERVET
chr2_33422468_C_T_b38	RASGRP3	2.902	0.00388	0.060285	8	0.020772	no	NERVET
chr2_33620413_GA_G_b38	RASGRP3	2.901	0.0039	0.059914	5	0.020652	no	NERVET
chr2_33050130_ATT_A_b38	RASGRP3	2.876	0.00422	0.042837	80	0.014896	no	NERVET
chr2_33669621_C_T_b38	RASGRP3	-2.866	0.00435	-0.038247	100	0.013345	no	NERVET
chr2_33669751_C_T_b38	RASGRP3	-2.866	0.00435	-0.038247	100	0.013345	no	NERVET
chr2_33670200_G_T_b38	RASGRP3	-2.862	0.0044	-0.038129	101	0.013322	no	NERVET
chr2_33071707_G_A_b38	RASGRP3	2.835	0.00478	0.03798	102	0.013395	no	NERVET
chr2_33427776_C_CTTT_b38	RASGRP3	2.833	0.00481	0.091684	7	0.032361	no	NERVET
chr2_33451360_G_C_b38	RASGRP3	-2.82	0.00501	-0.062675	5	0.022224	no	NERVET
chr2_34247571_T_C_b38	RASGRP3	2.8	0.00532	0.049408	20	0.017645	no	NERVET
chr2_33016600_G_C_b38	RASGRP3	2.793	0.00544	0.039297	63	0.01407	no	NERVET
chr2_33728254_C_T_b38	RASGRP3	2.769	0.00584	0.062737	5	0.022653	no	NERVET
chr2_34280797_A_G_b38	RASGRP3	2.765	0.00592	0.062578	5	0.02263	no	NERVET
chr2_33841342_CAAA_C_b38	RASGRP3	2.763	0.00595	0.046336	52	0.016768	no	NERVET
chr2_33508652_C_G_b38	RASGRP3	2.732	0.00653	0.040388	61	0.014782	no	NERVET
chr2_33513546_C_T_b38	RASGRP3	-2.732	0.00654	-0.039384	65	0.014416	no	NERVET
chr2_32969228_T_TG_b38	RASGRP3	-2.723	0.00672	-0.046907	19	0.017227	no	NERVET
chr2_33411564_A_G_b38	RASGRP3	2.69	0.00741	0.056969	7	0.021182	no	NERVET
chr2_33082441_T_A_b38	RASGRP3	-2.682	0.00758	-0.067655	11	0.025225	no	NERVET
chr2_32986447_C_G_b38	RASGRP3	2.675	0.00773	0.037438	80	0.013994	no	NERVET
chr2_34277085_T_A_b38	RASGRP3	2.675	0.00775	0.063374	3	0.023694	no	NERVET
chr2_33007988_C_G_b38	RASGRP3	2.672	0.00782	0.039784	51	0.014892	no	NERVET
chr2_33456957_G_A_b38	RASGRP3	-2.664	0.00799	-0.059465	5	0.02232	no	NERVET
chr2_33097010_A_C_b38	RASGRP3	-2.662	0.00803	-0.044925	26	0.016874	no	NERVET
chr2_34417108_A_G_b38	RASGRP3	2.655	0.0082	0.041131	43	0.015491	no	NERVET
chr2_33566193_A_G_b38	RASGRP3	-2.628	0.00888	-0.054932	6	0.020904	no	NERVET
chr2_33634843_C_CTT_b38	RASGRP3	2.618	0.00913	0.065518	5	0.025025	no	NERVET
chr2_33647687_C_CA_b38	RASGRP3	2.617	0.00916	0.047014	29	0.017964	no	NERVET
chr2_33092300_G_A_b38	RASGRP3	-2.616	0.0092	-0.043603	28	0.01667	no	NERVET
chr2_33025776_A_G_b38	RASGRP3	2.589	0.00993	0.036412	126	0.014065	no	NERVET
chr2_33512177_G_A_b38	RASGRP3	5.553	1.57e-07	0.198847	4	0.035809	yes	OVARY
chr2_33537330_C_CCCAACACA_b38	RASGRP3	4.91	2.74e-06	0.170041	7	0.034629	yes	OVARY
chr2_33536322_G_GA_b38	RASGRP3	4.811	4.17e-06	0.174029	5	0.03617	yes	OVARY
chr2_33594326_C_T_b38	RASGRP3	3.968	0.000121	0.1286	11	0.032412	yes	OVARY
chr2_33594385_G_A_b38	RASGRP3	3.968	0.000121	0.1286	11	0.032412	yes	OVARY
chr2_33596617_C_T_b38	RASGRP3	3.968	0.000121	0.1286	11	0.032412	yes	OVARY
chr2_33529318_C_T_b38	RASGRP3	3.919	0.000144	0.136691	5	0.034875	yes	OVARY
chr2_33540561_TGTGTGTGTGTGTGTGTG_T_b38	RASGRP3	-3.914	0.000147	-0.108954	24	0.02784	yes	OVARY
chr2_33582025_C_T_b38	RASGRP3	3.752	0.000265	0.120565	11	0.03213	yes	OVARY
chr2_32941718_CT_C_b38	RASGRP3	-3.715	0.000303	-0.138777	4	0.037352	yes	OVARY
chr2_33525699_C_CAA_b38	RASGRP3	3.537	0.000566	0.234247	3	0.066232	yes	OVARY
chr2_33669427_A_C_b38	RASGRP3	3.496	0.000652	0.127183	5	0.036384	yes	OVARY
chr2_33669574_A_G_b38	RASGRP3	3.496	0.000652	0.127183	5	0.036384	yes	OVARY
chr2_33662459_C_T_b38	RASGRP3	3.472	0.000706	0.11264	7	0.03244	yes	OVARY
chr2_33663555_T_C_b38	RASGRP3	3.472	0.000706	0.11264	7	0.03244	yes	OVARY
chr2_33521266_C_T_b38	RASGRP3	3.407	0.000881	0.10548	12	0.030963	yes	OVARY
chr2_33656848_TA_T_b38	RASGRP3	3.403	0.000891	0.10684	11	0.031393	yes	OVARY
chr2_33512902_A_G_b38	RASGRP3	-3.403	0.000893	-0.094704	37	0.027833	yes	OVARY
chr2_33650021_A_G_b38	RASGRP3	3.377	0.000973	0.108215	7	0.032045	yes	OVARY
chr2_33672387_A_G_b38	RASGRP3	3.368	0.001	0.122807	5	0.036462	yes	OVARY
chr2_33518114_A_G_b38	RASGRP3	-3.351	0.00106	-0.098865	18	0.029507	yes	OVARY
chr2_33657078_T_C_b38	RASGRP3	3.314	0.0012	0.105605	12	0.031871	yes	OVARY
chr2_32911911_C_CATCT_b38	RASGRP3	3.281	0.00133	0.107369	10	0.03272	yes	OVARY
chr2_33656248_TTC_T_b38	RASGRP3	3.238	0.00154	0.104539	7	0.03229	yes	OVARY
chr2_33518880_G_GTCA_b38	RASGRP3	-3.113	0.00229	-0.087526	33	0.028113	yes	OVARY
chr2_33537192_G_GAT_b38	RASGRP3	3.106	0.00234	0.11915	3	0.038362	yes	OVARY
chr2_33512820_T_A_b38	RASGRP3	-3.098	0.0024	-0.089064	22	0.028751	yes	OVARY
chr2_33623108_T_C_b38	RASGRP3	3.078	0.00255	0.08672	20	0.028172	yes	OVARY
chr2_33006088_AT_A_b38	RASGRP3	3.074	0.00259	0.136715	6	0.044481	yes	OVARY
chr2_33525341_A_AAT_b38	RASGRP3	3.059	0.00271	0.099272	8	0.032449	yes	OVARY
chr2_33652477_C_A_b38	RASGRP3	3.04	0.00287	0.099442	7	0.032712	yes	OVARY
chr2_33661156_C_T_b38	RASGRP3	3.027	0.00299	0.094023	9	0.031064	yes	OVARY
chr2_33661310_C_T_b38	RASGRP3	3.027	0.00299	0.094023	9	0.031064	yes	OVARY
chr2_33514489_T_C_b38	RASGRP3	-2.982	0.00343	-0.084178	25	0.028229	yes	OVARY
chr2_33625315_G_A_b38	RASGRP3	2.941	0.00389	0.092337	11	0.031395	yes	OVARY
chr2_33621819_C_A_b38	RASGRP3	2.834	0.00536	0.07853	20	0.027714	yes	OVARY
chr2_32762276_AGTGTGTGTGTGTGTGT_A_b38	RASGRP3	-2.822	0.00554	-0.09454	9	0.033501	yes	OVARY
chr2_33548381_A_AAAG_b38	RASGRP3	2.821	0.00555	0.115973	4	0.041107	yes	OVARY
chr2_33520141_T_C_b38	RASGRP3	-2.813	0.00569	-0.077746	32	0.02764	yes	OVARY
chr2_33622160_C_T_b38	RASGRP3	2.788	0.00612	0.086837	13	0.031146	yes	OVARY
chr2_33554839_T_C_b38	RASGRP3	2.772	0.00641	0.077665	20	0.028018	yes	OVARY
chr2_33656916_G_A_b38	RASGRP3	2.76	0.00663	0.082356	16	0.029837	yes	OVARY
chr2_33670716_C_T_b38	RASGRP3	2.691	0.00809	0.091351	7	0.033951	yes	OVARY
chr2_33519891_C_T_b38	RASGRP3	-2.672	0.00852	-0.073625	27	0.027552	yes	OVARY
chr2_33546942_C_G_b38	RASGRP3	5.604	1.24e-07	0.215186	3	0.038396	no	OVARY
chr2_33586869_A_T_b38	RASGRP3	4.833	3.8e-06	0.156651	10	0.03241	no	OVARY
chr2_33555164_G_A_b38	RASGRP3	4.565	1.16e-05	0.15007	7	0.032874	no	OVARY
chr2_33561445_C_A_b38	RASGRP3	4.418	2.11e-05	0.145558	7	0.032946	no	OVARY
chr2_33531453_C_T_b38	RASGRP3	4.379	2.47e-05	0.172358	3	0.03936	no	OVARY
chr2_33539996_AAAAAG_A_b38	RASGRP3	-4.303	3.34e-05	-0.115545	37	0.026855	no	OVARY
chr2_33565263_A_G_b38	RASGRP3	4.159	5.85e-05	0.131124	14	0.03153	no	OVARY
chr2_33529269_C_A_b38	RASGRP3	4.138	6.32e-05	0.164015	3	0.039632	no	OVARY
chr2_33523649_G_A_b38	RASGRP3	4.078	7.98e-05	0.132511	8	0.032498	no	OVARY
chr2_33596963_A_T_b38	RASGRP3	4.018	9.97e-05	0.12853	12	0.031985	no	OVARY
chr2_33511010_G_A_b38	RASGRP3	4.003	0.000106	0.186899	3	0.04669	no	OVARY
chr2_33581561_C_T_b38	RASGRP3	3.796	0.000227	0.120188	12	0.031661	no	OVARY
chr2_33590881_T_C_b38	RASGRP3	3.646	0.000387	0.103593	18	0.02841	no	OVARY
chr2_33589264_G_C_b38	RASGRP3	3.646	0.000388	0.103855	18	0.028487	no	OVARY
chr2_33596450_T_G_b38	RASGRP3	3.623	0.00042	0.102302	19	0.028238	no	OVARY
chr2_33547458_G_A_b38	RASGRP3	3.468	0.000716	0.099452	18	0.028677	no	OVARY
chr2_33564001_C_G_b38	RASGRP3	3.408	0.000877	0.098118	26	0.02879	no	OVARY
chr2_33564467_A_G_b38	RASGRP3	3.254	0.00146	0.093046	28	0.028596	no	OVARY
chr2_33640631_A_C_b38	RASGRP3	3.206	0.0017	0.101495	8	0.03166	no	OVARY
chr2_33641397_G_C_b38	RASGRP3	3.206	0.0017	0.101495	8	0.03166	no	OVARY
chr2_33543901_C_G_b38	RASGRP3	-3.13	0.00217	-0.089235	22	0.028512	no	OVARY
chr2_33508487_T_C_b38	RASGRP3	3.097	0.00241	0.1568	5	0.050636	no	OVARY
chr2_33438404_T_C_b38	RASGRP3	-3.085	0.0025	-0.083319	36	0.027004	no	OVARY
chr2_33639021_G_A_b38	RASGRP3	3.077	0.00256	0.098362	8	0.031963	no	OVARY
chr2_33523461_TA_T_b38	RASGRP3	3.052	0.00277	0.111525	3	0.036544	no	OVARY
chr2_33622130_CA_C_b38	RASGRP3	-2.982	0.00343	-0.088169	17	0.029567	no	OVARY
chr2_33539533_G_T_b38	RASGRP3	-2.937	0.00394	-0.076325	41	0.02599	no	OVARY
chr2_33627793_A_G_b38	RASGRP3	2.868	0.00484	0.114992	3	0.040097	no	OVARY
chr2_32663636_TTATG_T_b38	RASGRP3	2.828	0.00545	0.082633	24	0.029223	no	OVARY
chr2_33541741_G_T_b38	RASGRP3	-2.815	0.00565	-0.073826	41	0.026224	no	OVARY
chr2_32670932_TTTAATTTGAGTTGTTTGTCTTCTTATTGAGTTCTAA_T_b38	RASGRP3	2.736	0.00711	0.085282	10	0.031169	no	OVARY
chr2_33715404_A_C_b38	RASGRP3	2.732	0.00719	0.086067	10	0.031503	no	OVARY
chr2_33616325_C_T_b38	RASGRP3	2.698	0.00792	0.109494	3	0.040578	no	OVARY
chr2_33007243_A_T_b38	RASGRP3	-2.688	0.00814	-0.085946	21	0.031969	no	OVARY
chr2_33007962_T_C_b38	RASGRP3	-2.688	0.00814	-0.085946	21	0.031969	no	OVARY
chr2_33540888_T_C_b38	RASGRP3	-2.67	0.00859	-0.069816	41	0.026153	no	OVARY
chr2_34313185_T_C_b38	RASGRP3	-2.658	0.00888	-0.109372	3	0.041155	no	OVARY
chr2_33515662_T_C_b38	RASGRP3	2.653	0.00899	0.107102	4	0.040366	no	OVARY
chr2_33567745_C_T_b38	RASGRP3	-2.652	0.00903	-0.078818	23	0.029725	no	OVARY
chr2_33539219_T_C_b38	RASGRP3	-2.644	0.00922	-0.073792	28	0.027906	no	OVARY
chr2_33512177_G_A_b38	RASGRP3	6.271	1.57e-09	0.140166	13	0.02235	yes	PNCREAS
chr2_33537896_A_G_b38	RASGRP3	6.222	2.07e-09	0.161522	3	0.025961	yes	PNCREAS
chr2_33475871_A_C_b38	RASGRP3	6.152	3.04e-09	0.109943	32	0.017872	yes	PNCREAS
chr2_33471307_G_GTAGGACTA_b38	RASGRP3	-5.902	1.17e-08	-0.102528	63	0.017373	yes	PNCREAS
chr2_33537192_G_GAT_b38	RASGRP3	5.859	1.47e-08	0.149903	3	0.025586	yes	PNCREAS
chr2_33559734_G_A_b38	RASGRP3	5.824	1.77e-08	0.148957	4	0.025578	yes	PNCREAS
chr2_33470357_T_C_b38	RASGRP3	-5.812	1.88e-08	-0.101099	63	0.017396	yes	PNCREAS
chr2_33470734_A_G_b38	RASGRP3	-5.812	1.88e-08	-0.101099	63	0.017396	yes	PNCREAS
chr2_33557635_G_A_b38	RASGRP3	5.795	2.06e-08	0.148374	4	0.025603	yes	PNCREAS
chr2_33559304_G_A_b38	RASGRP3	5.795	2.06e-08	0.148374	4	0.025603	yes	PNCREAS
chr2_33553995_C_T_b38	RASGRP3	5.686	3.63e-08	0.146874	4	0.02583	yes	PNCREAS
chr2_33554542_A_G_b38	RASGRP3	5.66	4.16e-08	0.146392	4	0.025865	yes	PNCREAS
chr2_33548469_T_C_b38	RASGRP3	5.624	5.01e-08	0.144993	4	0.025783	yes	PNCREAS
chr2_33550484_C_G_b38	RASGRP3	5.624	5.01e-08	0.144993	4	0.025783	yes	PNCREAS
chr2_33551676_A_G_b38	RASGRP3	5.624	5.01e-08	0.144993	4	0.025783	yes	PNCREAS
chr2_33551697_A_T_b38	RASGRP3	5.624	5.01e-08	0.144993	4	0.025783	yes	PNCREAS
chr2_33469706_C_T_b38	RASGRP3	-5.579	6.3e-08	-0.099568	57	0.017847	yes	PNCREAS
chr2_33550216_T_A_b38	RASGRP3	5.574	6.46e-08	0.143893	4	0.025816	yes	PNCREAS
chr2_33531453_C_T_b38	RASGRP3	5.499	9.47e-08	0.134498	7	0.02446	yes	PNCREAS
chr2_33537330_C_CCCAACACA_b38	RASGRP3	5.413	1.45e-07	0.124104	16	0.022926	yes	PNCREAS
chr2_33470505_G_A_b38	RASGRP3	-5.353	1.96e-07	-0.096275	53	0.017986	yes	PNCREAS
chr2_33557844_G_A_b38	RASGRP3	5.348	2.01e-07	0.13015	7	0.024334	yes	PNCREAS
chr2_33470311_T_A_b38	RASGRP3	-5.274	2.89e-07	-0.094694	53	0.017954	yes	PNCREAS
chr2_33529269_C_A_b38	RASGRP3	5.252	3.23e-07	0.128064	7	0.024385	yes	PNCREAS
chr2_33540561_TGTGTGTGTGTG_T_b38	RASGRP3	5.23	3.59e-07	0.131455	8	0.025133	yes	PNCREAS
chr2_33445936_C_T_b38	RASGRP3	-5.161	5.02e-07	-0.094836	43	0.018375	yes	PNCREAS
chr2_33470006_T_C_b38	RASGRP3	-5.155	5.18e-07	-0.092486	53	0.017942	yes	PNCREAS
chr2_33470233_G_A_b38	RASGRP3	-5.155	5.18e-07	-0.092486	53	0.017942	yes	PNCREAS
chr2_33470756_C_T_b38	RASGRP3	-5.155	5.18e-07	-0.092486	53	0.017942	yes	PNCREAS
chr2_33469436_T_C_b38	RASGRP3	-5.116	6.24e-07	-0.092	53	0.017983	yes	PNCREAS
chr2_33511010_G_A_b38	RASGRP3	4.997	1.1e-06	0.137837	6	0.027583	yes	PNCREAS
chr2_33470439_G_A_b38	RASGRP3	-4.993	1.12e-06	-0.088901	55	0.017805	yes	PNCREAS
chr2_33596450_T_G_b38	RASGRP3	4.937	1.45e-06	0.09378	30	0.018996	yes	PNCREAS
chr2_33526597_C_T_b38	RASGRP3	4.928	1.52e-06	0.124116	6	0.025188	yes	PNCREAS
chr2_33527062_GC_G_b38	RASGRP3	4.928	1.52e-06	0.124116	6	0.025188	yes	PNCREAS
chr2_33590881_T_C_b38	RASGRP3	4.899	1.74e-06	0.09328	28	0.019041	yes	PNCREAS
chr2_33589264_G_C_b38	RASGRP3	4.882	1.88e-06	0.093001	29	0.019049	yes	PNCREAS
chr2_33474404_G_A_b38	RASGRP3	-4.878	1.91e-06	-0.085366	59	0.0175	yes	PNCREAS
chr2_33476728_C_CCT_b38	RASGRP3	-4.659	5.18e-06	-0.084771	70	0.018196	yes	PNCREAS
chr2_33474954_T_C_b38	RASGRP3	-4.628	5.95e-06	-0.078294	80	0.016918	yes	PNCREAS
chr2_33467042_C_T_b38	RASGRP3	-4.616	6.28e-06	-0.090353	34	0.019575	yes	PNCREAS
chr2_33469845_C_T_b38	RASGRP3	-4.553	8.29e-06	-0.080822	64	0.017752	yes	PNCREAS
chr2_33469036_C_CA_b38	RASGRP3	-4.49	1.09e-05	-0.07932	65	0.017664	yes	PNCREAS
chr2_33456354_ATTCT_A_b38	RASGRP3	-4.471	1.18e-05	-0.082063	50	0.018354	yes	PNCREAS
chr2_33477612_G_T_b38	RASGRP3	-4.436	1.38e-05	-0.076776	80	0.017308	yes	PNCREAS
chr2_33453857_A_G_b38	RASGRP3	-4.429	1.42e-05	-0.077991	61	0.017611	yes	PNCREAS
chr2_33470380_ATT_A_b38	RASGRP3	-4.422	1.46e-05	-0.088867	52	0.020097	yes	PNCREAS
chr2_33454070_C_G_b38	RASGRP3	-4.368	1.84e-05	-0.078624	58	0.018001	yes	PNCREAS
chr2_33596963_A_T_b38	RASGRP3	4.352	1.97e-05	0.09209	21	0.021161	yes	PNCREAS
chr2_33470380_AT_A_b38	RASGRP3	4.336	2.11e-05	0.098409	11	0.022695	yes	PNCREAS
chr2_33470875_C_T_b38	RASGRP3	-4.334	2.13e-05	-0.075964	67	0.017529	yes	PNCREAS
chr2_33521266_C_T_b38	RASGRP3	4.301	2.45e-05	0.086437	25	0.020098	yes	PNCREAS
chr2_33446098_C_T_b38	RASGRP3	-4.294	2.52e-05	-0.077681	49	0.01809	yes	PNCREAS
chr2_33596617_C_T_b38	RASGRP3	4.282	2.64e-05	0.091027	20	0.021257	yes	PNCREAS
chr2_33594326_C_T_b38	RASGRP3	4.265	2.84e-05	0.090623	20	0.021248	yes	PNCREAS
chr2_33594385_G_A_b38	RASGRP3	4.265	2.84e-05	0.090623	20	0.021248	yes	PNCREAS
chr2_33529318_C_T_b38	RASGRP3	4.263	2.87e-05	0.091495	12	0.021465	yes	PNCREAS
chr2_33448870_G_C_b38	RASGRP3	-4.253	2.98e-05	-0.076742	59	0.018043	yes	PNCREAS
chr2_33473129_A_G_b38	RASGRP3	4.192	3.84e-05	0.089211	17	0.02128	yes	PNCREAS
chr2_33581561_C_T_b38	RASGRP3	4.187	3.92e-05	0.088489	20	0.021132	yes	PNCREAS
chr2_33525341_A_AAT_b38	RASGRP3	4.174	4.13e-05	0.089633	20	0.021472	yes	PNCREAS
chr2_33466742_G_A_b38	RASGRP3	-4.17	4.2e-05	-0.076493	57	0.018343	yes	PNCREAS
chr2_33564001_C_G_b38	RASGRP3	4.16	4.39e-05	0.079499	42	0.019111	yes	PNCREAS
chr2_33582025_C_T_b38	RASGRP3	4.15	4.57e-05	0.087958	19	0.021194	yes	PNCREAS
chr2_33474721_C_T_b38	RASGRP3	4.141	4.75e-05	0.089968	15	0.021728	yes	PNCREAS
chr2_33472754_G_A_b38	RASGRP3	4.097	5.66e-05	0.088199	16	0.021526	yes	PNCREAS
chr2_33473382_C_CA_b38	RASGRP3	4.064	6.47e-05	0.084968	18	0.020906	yes	PNCREAS
chr2_33565263_A_G_b38	RASGRP3	4.052	6.8e-05	0.085629	27	0.021135	yes	PNCREAS
chr2_33561445_C_A_b38	RASGRP3	4.007	8.13e-05	0.085567	15	0.021354	yes	PNCREAS
chr2_33536322_G_GA_b38	RASGRP3	3.932	0.000109	0.109045	7	0.027731	yes	PNCREAS
chr2_33515662_T_C_b38	RASGRP3	3.932	0.000109	0.092418	11	0.023503	yes	PNCREAS
chr2_33564467_A_G_b38	RASGRP3	3.93	0.00011	0.074587	45	0.01898	yes	PNCREAS
chr2_33514230_T_G_b38	RASGRP3	3.831	0.000162	0.086586	13	0.022601	yes	PNCREAS
chr2_33555164_G_A_b38	RASGRP3	3.825	0.000165	0.081414	15	0.021282	yes	PNCREAS
chr2_33591195_C_CT_b38	RASGRP3	-3.799	0.000183	-0.081626	33	0.021486	yes	PNCREAS
chr2_33470014_T_C_b38	RASGRP3	3.792	0.000187	0.082895	16	0.02186	yes	PNCREAS
chr2_33469790_T_G_b38	RASGRP3	3.788	0.000191	0.083228	15	0.021974	yes	PNCREAS
chr2_33472085_T_C_b38	RASGRP3	3.788	0.000191	0.083228	15	0.021974	yes	PNCREAS
chr2_33473933_A_G_b38	RASGRP3	3.712	0.000254	0.078459	19	0.021138	yes	PNCREAS
chr2_33523649_G_A_b38	RASGRP3	3.614	0.000365	0.079141	15	0.021899	yes	PNCREAS
chr2_33556928_C_CACACACATACAT_b38	RASGRP3	3.602	0.000381	0.096811	3	0.026877	yes	PNCREAS
chr2_33449417_A_T_b38	RASGRP3	-3.594	0.000393	-0.064417	63	0.017925	yes	PNCREAS
chr2_33448241_A_T_b38	RASGRP3	-3.55	0.00046	-0.063233	68	0.01781	yes	PNCREAS
chr2_33621819_C_A_b38	RASGRP3	3.535	0.000486	0.065207	33	0.018446	yes	PNCREAS
chr2_33477419_C_G_b38	RASGRP3	3.478	0.000596	0.081207	12	0.02335	yes	PNCREAS
chr2_33623108_T_C_b38	RASGRP3	3.445	0.00067	0.064541	33	0.018736	yes	PNCREAS
chr2_33802013_C_T_b38	RASGRP3	-3.413	0.000751	-0.062137	55	0.018208	yes	PNCREAS
chr2_33457670_G_T_b38	RASGRP3	-3.395	0.000799	-0.062926	38	0.018536	yes	PNCREAS
chr2_33639021_G_A_b38	RASGRP3	3.392	0.000807	0.074224	12	0.021883	yes	PNCREAS
chr2_33641397_G_C_b38	RASGRP3	3.392	0.000807	0.074224	12	0.021883	yes	PNCREAS
chr2_33604404_G_GTA_b38	RASGRP3	3.373	0.000863	0.09321	6	0.027636	yes	PNCREAS
chr2_33640631_A_C_b38	RASGRP3	3.371	0.000868	0.07365	12	0.021847	yes	PNCREAS
chr2_33465969_CA_C_b38	RASGRP3	-3.364	0.000889	-0.071231	34	0.021173	yes	PNCREAS
chr2_33605827_ATTTTTCT_A_b38	RASGRP3	3.33	0.001	0.086458	9	0.025966	yes	PNCREAS
chr2_33467980_TTTTCTTTC_T_b38	RASGRP3	-3.324	0.00102	-0.082927	9	0.024948	yes	PNCREAS
chr2_33606703_C_T_b38	RASGRP3	3.309	0.00107	0.089588	8	0.027073	yes	PNCREAS
chr2_33664871_G_GT_b38	RASGRP3	-3.306	0.00109	-0.061488	65	0.018599	yes	PNCREAS
chr2_33518114_A_G_b38	RASGRP3	-3.276	0.0012	-0.06149	43	0.018768	yes	PNCREAS
chr2_33634524_A_G_b38	RASGRP3	3.276	0.0012	0.087594	8	0.02674	yes	PNCREAS
chr2_33634816_G_T_b38	RASGRP3	3.276	0.0012	0.087594	8	0.02674	yes	PNCREAS
chr2_33666591_A_G_b38	RASGRP3	-3.274	0.00121	-0.058267	76	0.0178	yes	PNCREAS
chr2_33902327_ATTTT_A_b38	RASGRP3	-3.24	0.00136	-0.057165	64	0.017642	yes	PNCREAS
chr2_33636858_C_G_b38	RASGRP3	3.239	0.00136	0.086163	8	0.026599	yes	PNCREAS
chr2_33637736_A_T_b38	RASGRP3	3.239	0.00136	0.086163	8	0.026599	yes	PNCREAS
chr2_33667549_A_G_b38	RASGRP3	3.239	0.00136	0.086163	8	0.026599	yes	PNCREAS
chr2_33667555_A_G_b38	RASGRP3	3.239	0.00136	0.086163	8	0.026599	yes	PNCREAS
chr2_33464471_C_CT_b38	RASGRP3	-3.219	0.00146	-0.062614	32	0.019453	yes	PNCREAS
chr2_33310182_C_T_b38	RASGRP3	-3.212	0.00149	-0.052677	66	0.016402	yes	PNCREAS
chr2_33664742_G_C_b38	RASGRP3	-3.211	0.0015	-0.057592	75	0.017935	yes	PNCREAS
chr2_33730936_A_G_b38	RASGRP3	3.192	0.00159	0.088541	5	0.027735	yes	PNCREAS
chr2_34218931_T_C_b38	RASGRP3	-3.184	0.00164	-0.110194	3	0.034613	yes	PNCREAS
chr2_33616325_C_T_b38	RASGRP3	3.176	0.00168	0.084661	8	0.026658	yes	PNCREAS
chr2_33466649_C_A_b38	RASGRP3	3.162	0.00176	0.073031	11	0.023099	yes	PNCREAS
chr2_33631243_G_GT_b38	RASGRP3	3.159	0.00178	0.087871	7	0.027819	yes	PNCREAS
chr2_33465306_G_C_b38	RASGRP3	3.15	0.00183	0.072894	11	0.02314	yes	PNCREAS
chr2_34277860_C_CTAAA_b38	RASGRP3	-3.133	0.00193	-0.056184	58	0.01793	yes	PNCREAS
chr2_33652477_C_A_b38	RASGRP3	3.131	0.00195	0.069068	12	0.022057	yes	PNCREAS
chr2_33410886_T_TTCTCTCCTTCTCTCCC_b38	RASGRP3	3.097	0.00218	0.084622	6	0.027325	yes	PNCREAS
chr2_33670200_G_T_b38	RASGRP3	-3.078	0.00232	-0.056399	56	0.018324	yes	PNCREAS
chr2_33478863_G_A_b38	RASGRP3	-3.071	0.00237	-0.056348	73	0.018349	yes	PNCREAS
chr2_33522218_G_A_b38	RASGRP3	3.062	0.00244	0.070705	12	0.023093	yes	PNCREAS
chr2_33663649_A_C_b38	RASGRP3	-3.061	0.00244	-0.055107	74	0.018001	yes	PNCREAS
chr2_33669621_C_T_b38	RASGRP3	-3.05	0.00253	-0.056271	55	0.018448	yes	PNCREAS
chr2_33669751_C_T_b38	RASGRP3	-3.05	0.00253	-0.056271	55	0.018448	yes	PNCREAS
chr2_33539888_A_T_b38	RASGRP3	3.045	0.00258	0.06758	14	0.022195	yes	PNCREAS
chr2_33669574_A_G_b38	RASGRP3	3.041	0.00261	0.073727	11	0.024245	yes	PNCREAS
chr2_33672387_A_G_b38	RASGRP3	3.034	0.00267	0.073423	11	0.024203	yes	PNCREAS
chr2_33657078_T_C_b38	RASGRP3	3.024	0.00276	0.061405	24	0.020306	yes	PNCREAS
chr2_33659127_A_G_b38	RASGRP3	-2.995	0.00302	-0.053138	75	0.017741	yes	PNCREAS
chr2_33539650_C_T_b38	RASGRP3	2.959	0.00338	0.065874	14	0.022262	yes	PNCREAS
chr2_33505558_T_C_b38	RASGRP3	2.919	0.00384	0.053148	81	0.01821	yes	PNCREAS
chr2_33518738_C_T_b38	RASGRP3	2.917	0.00386	0.066676	14	0.022858	yes	PNCREAS
chr2_33772629_T_A_b38	RASGRP3	2.916	0.00387	0.127253	5	0.043643	yes	PNCREAS
chr2_33650021_A_G_b38	RASGRP3	2.908	0.00397	0.063979	12	0.022002	yes	PNCREAS
chr2_33656248_TTC_T_b38	RASGRP3	2.908	0.00397	0.063979	12	0.022002	yes	PNCREAS
chr2_33622160_C_T_b38	RASGRP3	2.906	0.00399	0.057702	24	0.019856	yes	PNCREAS
chr2_33669427_A_C_b38	RASGRP3	2.902	0.00404	0.07132	11	0.024575	yes	PNCREAS
chr2_33443111_T_C_b38	RASGRP3	2.897	0.00411	0.063863	15	0.022047	yes	PNCREAS
chr2_33514489_T_C_b38	RASGRP3	-2.893	0.00415	-0.052674	53	0.018206	yes	PNCREAS
chr2_33661731_A_G_b38	RASGRP3	-2.887	0.00424	-0.051605	74	0.017877	yes	PNCREAS
chr2_33463583_T_C_b38	RASGRP3	2.87	0.00446	0.067141	10	0.023397	yes	PNCREAS
chr2_33622592_T_C_b38	RASGRP3	2.868	0.00448	0.056182	31	0.019587	yes	PNCREAS
chr2_34132178_CTTTT_C_b38	RASGRP3	-2.855	0.00467	-0.104059	5	0.036453	yes	PNCREAS
chr2_33281296_C_T_b38	RASGRP3	-2.844	0.00483	-0.047817	63	0.016815	yes	PNCREAS
chr2_33283379_T_A_b38	RASGRP3	-2.844	0.00483	-0.047817	63	0.016815	yes	PNCREAS
chr2_33285823_C_G_b38	RASGRP3	-2.844	0.00483	-0.047817	63	0.016815	yes	PNCREAS
chr2_33286395_G_A_b38	RASGRP3	-2.844	0.00483	-0.047817	63	0.016815	yes	PNCREAS
chr2_33287516_G_T_b38	RASGRP3	-2.844	0.00483	-0.047817	63	0.016815	yes	PNCREAS
chr2_33288583_C_T_b38	RASGRP3	-2.844	0.00483	-0.047817	63	0.016815	yes	PNCREAS
chr2_33289186_G_A_b38	RASGRP3	-2.844	0.00483	-0.047817	63	0.016815	yes	PNCREAS
chr2_33283672_G_A_b38	RASGRP3	-2.837	0.00493	-0.047958	62	0.016905	yes	PNCREAS
chr2_33304059_C_A_b38	RASGRP3	-2.823	0.00514	-0.047473	63	0.016814	yes	PNCREAS
chr2_33487898_T_C_b38	RASGRP3	2.819	0.0052	0.055329	67	0.019627	yes	PNCREAS
chr2_34222364_T_A_b38	RASGRP3	-2.819	0.00521	-0.067984	11	0.024119	yes	PNCREAS
chr2_33303352_C_CTT_b38	RASGRP3	-2.811	0.00533	-0.050939	39	0.018119	yes	PNCREAS
chr2_33627793_A_G_b38	RASGRP3	2.803	0.00547	0.073738	8	0.026311	yes	PNCREAS
chr2_33659035_G_A_b38	RASGRP3	2.802	0.00548	0.076374	7	0.02726	yes	PNCREAS
chr2_33656848_TA_T_b38	RASGRP3	2.788	0.00571	0.057599	20	0.020659	yes	PNCREAS
chr2_33521739_T_A_b38	RASGRP3	2.78	0.00584	0.06376	13	0.022932	yes	PNCREAS
chr2_33664465_T_A_b38	RASGRP3	-2.778	0.00589	-0.05011	72	0.01804	yes	PNCREAS
chr2_33634843_C_CTT_b38	RASGRP3	2.775	0.00594	0.079325	8	0.028584	yes	PNCREAS
chr2_33640513_G_C_b38	RASGRP3	2.766	0.0061	0.074945	7	0.027093	yes	PNCREAS
chr2_33577835_T_C_b38	RASGRP3	-2.765	0.00612	-0.052731	67	0.01907	yes	PNCREAS
chr2_33641120_T_C_b38	RASGRP3	-2.765	0.00612	-0.050934	67	0.018422	yes	PNCREAS
chr2_32500606_G_GT_b38	RASGRP3	2.75	0.00639	0.054538	32	0.01983	yes	PNCREAS
chr2_34216079_G_T_b38	RASGRP3	-2.748	0.00644	-0.064255	13	0.023383	yes	PNCREAS
chr2_33478490_C_T_b38	RASGRP3	-2.743	0.00653	-0.051438	51	0.018752	yes	PNCREAS
chr2_33464237_G_A_b38	RASGRP3	2.737	0.00665	0.064728	10	0.02365	yes	PNCREAS
chr2_33631252_G_T_b38	RASGRP3	2.722	0.00694	0.05134	76	0.018858	yes	PNCREAS
chr2_33512820_T_A_b38	RASGRP3	-2.711	0.00718	-0.050709	49	0.018706	yes	PNCREAS
chr2_33647765_T_C_b38	RASGRP3	-2.702	0.00736	-0.049872	67	0.018455	yes	PNCREAS
chr2_34354534_A_C_b38	RASGRP3	2.694	0.00753	0.115128	5	0.042731	yes	PNCREAS
chr2_33509815_G_A_b38	RASGRP3	2.686	0.00772	0.062787	13	0.023376	yes	PNCREAS
chr2_34116537_CTTTT_C_b38	RASGRP3	-2.682	0.0078	-0.098553	4	0.036743	yes	PNCREAS
chr2_33662459_C_T_b38	RASGRP3	2.68	0.00786	0.059542	12	0.022221	yes	PNCREAS
chr2_33522498_A_G_b38	RASGRP3	2.665	0.0082	0.061989	12	0.023258	yes	PNCREAS
chr2_34210543_G_A_b38	RASGRP3	-2.654	0.00845	-0.101151	3	0.038106	yes	PNCREAS
chr2_33631637_C_A_b38	RASGRP3	-2.654	0.00846	-0.04947	56	0.018638	yes	PNCREAS
chr2_33663555_T_C_b38	RASGRP3	2.653	0.0085	0.058985	12	0.022237	yes	PNCREAS
chr2_33287031_T_C_b38	RASGRP3	-2.65	0.00856	-0.044842	63	0.01692	yes	PNCREAS
chr2_33316720_C_A_b38	RASGRP3	-2.648	0.00861	-0.044759	62	0.016903	yes	PNCREAS
chr2_33438562_C_CA_b38	RASGRP3	-2.645	0.00868	-0.079358	4	0.029998	yes	PNCREAS
chr2_32783851_A_G_b38	RASGRP3	2.645	0.0087	0.07949	4	0.030057	yes	PNCREAS
chr2_32783993_A_G_b38	RASGRP3	2.645	0.0087	0.07949	4	0.030057	yes	PNCREAS
chr2_32784236_G_T_b38	RASGRP3	2.645	0.0087	0.07949	4	0.030057	yes	PNCREAS
chr2_32784344_C_G_b38	RASGRP3	2.645	0.0087	0.07949	4	0.030057	yes	PNCREAS
chr2_32784528_A_T_b38	RASGRP3	2.645	0.0087	0.07949	4	0.030057	yes	PNCREAS
chr2_32784865_T_C_b38	RASGRP3	2.645	0.0087	0.07949	4	0.030057	yes	PNCREAS
chr2_32786481_C_T_b38	RASGRP3	2.645	0.0087	0.07949	4	0.030057	yes	PNCREAS
chr2_32788272_C_T_b38	RASGRP3	2.645	0.0087	0.07949	4	0.030057	yes	PNCREAS
chr2_32788354_C_T_b38	RASGRP3	2.645	0.0087	0.07949	4	0.030057	yes	PNCREAS
chr2_33588900_A_AT_b38	RASGRP3	-2.636	0.00891	-0.053911	55	0.02045	yes	PNCREAS
chr2_34105402_A_G_b38	RASGRP3	-2.635	0.00895	-0.09363	3	0.035536	yes	PNCREAS
chr2_33305323_C_G_b38	RASGRP3	-2.632	0.00903	-0.044553	63	0.016929	yes	PNCREAS
chr2_33658170_A_G_b38	RASGRP3	-2.627	0.00914	-0.048256	65	0.018368	yes	PNCREAS
chr2_34238497_G_A_b38	RASGRP3	-2.627	0.00916	-0.069442	9	0.026437	yes	PNCREAS
chr2_33632169_T_C_b38	RASGRP3	-2.626	0.00918	-0.049499	53	0.018852	yes	PNCREAS
chr2_34208798_G_C_b38	RASGRP3	-2.623	0.00924	-0.098904	3	0.037701	yes	PNCREAS
chr2_34210587_A_C_b38	RASGRP3	-2.623	0.00924	-0.098904	3	0.037701	yes	PNCREAS
chr2_34210588_C_A_b38	RASGRP3	-2.623	0.00924	-0.098904	3	0.037701	yes	PNCREAS
chr2_34218261_C_A_b38	RASGRP3	-2.623	0.00924	-0.098904	3	0.037701	yes	PNCREAS
chr2_33726232_C_CTTTT_b38	RASGRP3	-2.614	0.00951	-0.136733	3	0.052317	yes	PNCREAS
chr2_33580247_A_G_b38	RASGRP3	-2.613	0.00952	-0.049617	68	0.018988	yes	PNCREAS
chr2_33669785_CA_C_b38	RASGRP3	-2.607	0.00968	-0.0495	49	0.018987	yes	PNCREAS
chr2_33576389_C_T_b38	RASGRP3	-2.606	0.00972	-0.049991	66	0.019186	yes	PNCREAS
chr2_33367447_T_A_b38	RASGRP3	2.597	0.00997	0.061722	17	0.02377	yes	PNCREAS
chr2_33517217_G_A_b38	RASGRP3	2.596	0.01	0.059177	15	0.022797	yes	PNCREAS
chr2_33597253_G_A_b38	RASGRP3	-2.596	0.01	-0.050064	64	0.019286	yes	PNCREAS
chr2_33552022_CAAACA_C_b38	RASGRP3	5.639	4.64e-08	0.143812	5	0.025505	no	PNCREAS
chr2_33559068_A_G_b38	RASGRP3	5.622	5.06e-08	0.147787	3	0.026288	no	PNCREAS
chr2_33546942_C_G_b38	RASGRP3	5.516	8.66e-08	0.139895	6	0.02536	no	PNCREAS
chr2_33548762_A_G_b38	RASGRP3	5.341	2.08e-07	0.143325	3	0.026835	no	PNCREAS
chr2_33476930_C_CG_b38	RASGRP3	-4.839	2.29e-06	-0.084149	78	0.017389	no	PNCREAS
chr2_33477035_T_G_b38	RASGRP3	-4.839	2.29e-06	-0.084149	78	0.017389	no	PNCREAS
chr2_33477050_G_GA_b38	RASGRP3	-4.839	2.29e-06	-0.084149	78	0.017389	no	PNCREAS
chr2_33586869_A_T_b38	RASGRP3	4.473	1.17e-05	0.094692	18	0.021171	no	PNCREAS
chr2_33476343_C_T_b38	RASGRP3	4.465	1.21e-05	0.081751	38	0.018309	no	PNCREAS
chr2_33451333_T_C_b38	RASGRP3	3.651	0.000318	0.092229	6	0.025262	no	PNCREAS
chr2_33592302_T_C_b38	RASGRP3	3.539	0.000479	0.131458	3	0.037142	no	PNCREAS
chr2_33448594_T_C_b38	RASGRP3	3.503	0.000545	0.08776	7	0.025053	no	PNCREAS
chr2_33462974_A_T_b38	RASGRP3	-3.493	0.000565	-0.081379	10	0.023296	no	PNCREAS
chr2_33460827_T_C_b38	RASGRP3	-3.464	0.000626	-0.081316	12	0.023475	no	PNCREAS
chr2_33547458_G_A_b38	RASGRP3	3.429	0.00071	0.065135	46	0.018998	no	PNCREAS
chr2_33537321_C_CA_b38	RASGRP3	3.375	0.000855	0.060282	44	0.017859	no	PNCREAS
chr2_33473877_C_T_b38	RASGRP3	3.291	0.00114	0.063577	41	0.019319	no	PNCREAS
chr2_33523461_TA_T_b38	RASGRP3	3.28	0.00118	0.078165	6	0.023828	no	PNCREAS
chr2_33463160_G_A_b38	RASGRP3	-3.205	0.00153	-0.073708	11	0.023001	no	PNCREAS
chr2_33462930_G_A_b38	RASGRP3	-3.094	0.0022	-0.071358	11	0.023067	no	PNCREAS
chr2_33530497_C_CT_b38	RASGRP3	-3.054	0.00251	-0.108306	3	0.035469	no	PNCREAS
chr2_33454164_C_T_b38	RASGRP3	-3.054	0.00251	-0.068087	13	0.022298	no	PNCREAS
chr2_33460992_G_A_b38	RASGRP3	-3.043	0.00259	-0.070603	11	0.023198	no	PNCREAS
chr2_33285451_C_CT_b38	RASGRP3	-3.024	0.00276	-0.057298	32	0.01895	no	PNCREAS
chr2_33453264_C_T_b38	RASGRP3	-2.999	0.00298	-0.06547	14	0.02183	no	PNCREAS
chr2_33461719_G_A_b38	RASGRP3	-2.992	0.00305	-0.067762	12	0.022644	no	PNCREAS
chr2_33461856_C_T_b38	RASGRP3	-2.992	0.00305	-0.067762	12	0.022644	no	PNCREAS
chr2_33581338_T_A_b38	RASGRP3	2.977	0.00319	0.075406	10	0.025327	no	PNCREAS
chr2_32943952_TTTTTG_T_b38	RASGRP3	-2.959	0.00338	-0.070496	15	0.023824	no	PNCREAS
chr2_33455019_G_C_b38	RASGRP3	-2.918	0.00384	-0.065844	12	0.022563	no	PNCREAS
chr2_33581900_A_T_b38	RASGRP3	2.886	0.00424	0.072778	10	0.025215	no	PNCREAS
chr2_33461382_C_G_b38	RASGRP3	-2.858	0.00463	-0.065504	11	0.022923	no	PNCREAS
chr2_33726425_C_T_b38	RASGRP3	2.852	0.00471	0.065748	12	0.023054	no	PNCREAS
chr2_33456621_T_G_b38	RASGRP3	-2.795	0.00559	-0.063088	12	0.022569	no	PNCREAS
chr2_33563965_A_G_b38	RASGRP3	2.784	0.00578	0.06989	10	0.025102	no	PNCREAS
chr2_33642124_T_TTTG_b38	RASGRP3	2.77	0.00603	0.10754	5	0.038828	no	PNCREAS
chr2_33461597_C_T_b38	RASGRP3	-2.764	0.00614	-0.062224	12	0.022512	no	PNCREAS
chr2_33461653_G_C_b38	RASGRP3	-2.764	0.00614	-0.062224	12	0.022512	no	PNCREAS
chr2_33508487_T_C_b38	RASGRP3	2.756	0.00628	0.076472	9	0.027744	no	PNCREAS
chr2_33540861_TA_T_b38	RASGRP3	-2.755	0.0063	-0.051992	43	0.01887	no	PNCREAS
chr2_33548381_A_AAAAAG_b38	RASGRP3	2.754	0.00632	0.078933	8	0.028659	no	PNCREAS
chr2_32620597_A_AT_b38	RASGRP3	-2.752	0.00636	-0.050387	79	0.018311	no	PNCREAS
chr2_32461040_CTCTTCTCTTCTCTTCTCTTCTCTTCTGT_C_b38	RASGRP3	-2.745	0.0065	-0.099589	6	0.036282	no	PNCREAS
chr2_33291085_C_T_b38	RASGRP3	-2.742	0.00655	-0.046658	63	0.017018	no	PNCREAS
chr2_33279511_GT_G_b38	RASGRP3	-2.74	0.00659	-0.046429	77	0.016946	no	PNCREAS
chr2_33554839_T_C_b38	RASGRP3	2.737	0.00665	0.051043	50	0.01865	no	PNCREAS
chr2_33456412_T_C_b38	RASGRP3	-2.728	0.00682	-0.060991	12	0.022354	no	PNCREAS
chr2_33292883_C_T_b38	RASGRP3	-2.711	0.00717	-0.046113	63	0.017007	no	PNCREAS
chr2_32762276_AGTGTGTGTGTGTGTGTGT_A_b38	RASGRP3	2.691	0.00761	0.071065	6	0.02641	no	PNCREAS
chr2_33281290_G_A_b38	RASGRP3	-2.683	0.00779	-0.045728	80	0.017044	no	PNCREAS
chr2_33290450_A_G_b38	RASGRP3	-2.677	0.00793	-0.045458	64	0.016983	no	PNCREAS
chr2_32482920_G_GT_b38	RASGRP3	-2.675	0.00798	-0.07737	5	0.028929	no	PNCREAS
chr2_33427610_G_A_b38	RASGRP3	2.67	0.00808	0.07205	6	0.026983	no	PNCREAS
chr2_33461427_G_A_b38	RASGRP3	-2.643	0.00874	-0.059115	13	0.022369	no	PNCREAS
chr2_33279517_T_C_b38	RASGRP3	-2.63	0.00906	-0.044538	79	0.016932	no	PNCREAS
chr2_33477936_C_T_b38	RASGRP3	2.61	0.00961	0.057246	17	0.021935	no	PNCREAS
chr2_33537192_G_GAT_b38	RASGRP3	11.106	1.52e-22	0.421466	3	0.037949	yes	PTTARY
chr2_33548469_T_C_b38	RASGRP3	10.607	4.6e-21	0.422914	3	0.03987	yes	PTTARY
chr2_33557635_G_A_b38	RASGRP3	10.51	8.89e-21	0.417712	3	0.039743	yes	PTTARY
chr2_33559304_G_A_b38	RASGRP3	10.51	8.89e-21	0.417712	3	0.039743	yes	PTTARY
chr2_33559734_G_A_b38	RASGRP3	10.51	8.89e-21	0.417712	3	0.039743	yes	PTTARY
chr2_33550216_T_A_b38	RASGRP3	10.401	1.87e-20	0.421153	3	0.040493	yes	PTTARY
chr2_33550484_C_G_b38	RASGRP3	10.401	1.87e-20	0.421153	3	0.040493	yes	PTTARY
chr2_33553995_C_T_b38	RASGRP3	10.384	2.09e-20	0.424828	3	0.040911	yes	PTTARY
chr2_33554542_A_G_b38	RASGRP3	10.384	2.09e-20	0.424828	3	0.040911	yes	PTTARY
chr2_33557844_G_A_b38	RASGRP3	10.01	2.58e-19	0.405988	3	0.040556	yes	PTTARY
chr2_33537330_C_CCCAACACA_b38	RASGRP3	9.909	5.08e-19	0.335548	11	0.033864	yes	PTTARY
chr2_33529318_C_T_b38	RASGRP3	7.89	2.08e-13	0.292696	4	0.037098	yes	PTTARY
chr2_33536322_G_GA_b38	RASGRP3	7.224	1.09e-11	0.318012	5	0.044022	yes	PTTARY
chr2_33561445_C_A_b38	RASGRP3	7.218	1.13e-11	0.255126	8	0.035345	yes	PTTARY
chr2_33555164_G_A_b38	RASGRP3	6.887	7.55e-11	0.255352	6	0.037077	yes	PTTARY
chr2_33586869_A_T_b38	RASGRP3	6.815	1.13e-10	0.251208	8	0.036859	yes	PTTARY
chr2_33523649_G_A_b38	RASGRP3	6.771	1.45e-10	0.261508	5	0.038624	yes	PTTARY
chr2_33525341_A_AAT_b38	RASGRP3	6.355	1.43e-09	0.213899	12	0.033657	yes	PTTARY
chr2_33581561_C_T_b38	RASGRP3	5.637	5.96e-08	0.201431	10	0.035732	yes	PTTARY
chr2_33512177_G_A_b38	RASGRP3	5.554	9.03e-08	0.238374	8	0.042923	yes	PTTARY
chr2_33521266_C_T_b38	RASGRP3	5.53	1.02e-07	0.187241	13	0.033862	yes	PTTARY
chr2_33582025_C_T_b38	RASGRP3	5.508	1.13e-07	0.198425	9	0.036027	yes	PTTARY
chr2_33596963_A_T_b38	RASGRP3	5.462	1.42e-07	0.196669	10	0.036009	yes	PTTARY
chr2_33565263_A_G_b38	RASGRP3	5.409	1.83e-07	0.196117	11	0.036257	yes	PTTARY
chr2_33564001_C_G_b38	RASGRP3	5.332	2.66e-07	0.16268	24	0.030509	yes	PTTARY
chr2_33594326_C_T_b38	RASGRP3	5.331	2.68e-07	0.193469	9	0.036295	yes	PTTARY
chr2_33594385_G_A_b38	RASGRP3	5.331	2.68e-07	0.193469	9	0.036295	yes	PTTARY
chr2_33596617_C_T_b38	RASGRP3	5.331	2.68e-07	0.193469	9	0.036295	yes	PTTARY
chr2_33537321_C_CA_b38	RASGRP3	5.121	7.22e-07	0.131336	42	0.025644	yes	PTTARY
chr2_33596450_T_G_b38	RASGRP3	5.061	9.57e-07	0.163776	17	0.03236	yes	PTTARY
chr2_33639021_G_A_b38	RASGRP3	5.049	1.01e-06	0.198895	6	0.039389	yes	PTTARY
chr2_33564467_A_G_b38	RASGRP3	5.023	1.14e-06	0.154426	23	0.030742	yes	PTTARY
chr2_33589264_G_C_b38	RASGRP3	4.938	1.69e-06	0.160679	16	0.03254	yes	PTTARY
chr2_33590881_T_C_b38	RASGRP3	4.938	1.69e-06	0.160679	16	0.03254	yes	PTTARY
chr2_33537323_G_A_b38	RASGRP3	4.899	2.01e-06	0.125187	58	0.025552	yes	PTTARY
chr2_33640631_A_C_b38	RASGRP3	4.83	2.74e-06	0.191807	6	0.03971	yes	PTTARY
chr2_33641397_G_C_b38	RASGRP3	4.83	2.74e-06	0.191807	6	0.03971	yes	PTTARY
chr2_33543280_C_G_b38	RASGRP3	-4.813	2.96e-06	-0.194472	5	0.040402	yes	PTTARY
chr2_33561192_A_G_b38	RASGRP3	4.789	3.3e-06	0.12912	55	0.026962	yes	PTTARY
chr2_33656248_TTC_T_b38	RASGRP3	4.776	3.5e-06	0.18008	7	0.037707	yes	PTTARY
chr2_33525341_AAT_A_b38	RASGRP3	-4.756	3.82e-06	-0.188598	5	0.039654	yes	PTTARY
chr2_33650021_A_G_b38	RASGRP3	4.731	4.26e-06	0.178954	7	0.037822	yes	PTTARY
chr2_33538452_G_A_b38	RASGRP3	-4.64	6.36e-06	-0.188214	5	0.040564	yes	PTTARY
chr2_33581900_A_T_b38	RASGRP3	4.558	9.08e-06	0.204082	4	0.044775	yes	PTTARY
chr2_33652477_C_A_b38	RASGRP3	4.531	1.02e-05	0.176241	7	0.038894	yes	PTTARY
chr2_33662459_C_T_b38	RASGRP3	4.484	1.25e-05	0.171145	7	0.038172	yes	PTTARY
chr2_33663555_T_C_b38	RASGRP3	4.484	1.25e-05	0.171145	7	0.038172	yes	PTTARY
chr2_33581338_T_A_b38	RASGRP3	4.455	1.41e-05	0.19701	4	0.044219	yes	PTTARY
chr2_33563965_A_G_b38	RASGRP3	4.365	2.06e-05	0.197471	4	0.045243	yes	PTTARY
chr2_33534328_C_T_b38	RASGRP3	-4.321	2.47e-05	-0.176373	5	0.040822	yes	PTTARY
chr2_33534496_G_A_b38	RASGRP3	-4.321	2.47e-05	-0.176373	5	0.040822	yes	PTTARY
chr2_33657078_T_C_b38	RASGRP3	4.279	2.94e-05	0.151155	13	0.035327	yes	PTTARY
chr2_33656848_TA_T_b38	RASGRP3	4.196	4.12e-05	0.14806	12	0.03529	yes	PTTARY
chr2_33533388_C_T_b38	RASGRP3	-4.153	4.88e-05	-0.169801	5	0.040882	yes	PTTARY
chr2_33661156_C_T_b38	RASGRP3	4.15	4.95e-05	0.1471	11	0.035444	yes	PTTARY
chr2_33661310_C_T_b38	RASGRP3	4.15	4.95e-05	0.1471	11	0.035444	yes	PTTARY
chr2_33624881_G_GT_b38	RASGRP3	4.129	5.4e-05	0.142205	13	0.034445	yes	PTTARY
chr2_33532968_G_A_b38	RASGRP3	-4.103	5.98e-05	-0.169122	5	0.041219	yes	PTTARY
chr2_33538430_G_C_b38	RASGRP3	-4.08	6.54e-05	-0.165313	5	0.040515	yes	PTTARY
chr2_33605827_ATTTTTCT_A_b38	RASGRP3	4.075	6.68e-05	0.186947	3	0.045877	yes	PTTARY
chr2_33625315_G_A_b38	RASGRP3	4.059	7.13e-05	0.151309	9	0.037282	yes	PTTARY
chr2_33534062_A_C_b38	RASGRP3	-4.018	8.37e-05	-0.16441	5	0.040921	yes	PTTARY
chr2_33546347_C_G_b38	RASGRP3	-3.967	0.000102	-0.151033	7	0.038074	yes	PTTARY
chr2_33546473_C_T_b38	RASGRP3	-3.967	0.000102	-0.151033	7	0.038074	yes	PTTARY
chr2_33533272_T_C_b38	RASGRP3	-3.957	0.000106	-0.160532	5	0.040573	yes	PTTARY
chr2_33545336_G_A_b38	RASGRP3	-3.901	0.000132	-0.150146	6	0.038491	yes	PTTARY
chr2_33529859_CA_C_b38	RASGRP3	-3.877	0.000144	-0.148086	7	0.038195	yes	PTTARY
chr2_33626436_A_T_b38	RASGRP3	3.801	0.000193	0.133501	13	0.035125	yes	PTTARY
chr2_33534694_A_AT_b38	RASGRP3	3.779	0.000209	0.132915	12	0.035168	yes	PTTARY
chr2_33532718_G_A_b38	RASGRP3	3.691	0.000289	0.102085	49	0.027655	yes	PTTARY
chr2_33563470_A_ATACT_b38	RASGRP3	-3.677	0.000305	-0.173653	4	0.047226	yes	PTTARY
chr2_33547053_GAAAAAA_G_b38	RASGRP3	-3.675	0.000307	-0.136836	10	0.037233	yes	PTTARY
chr2_33530852_CT_C_b38	RASGRP3	3.665	0.000318	0.101656	50	0.027735	yes	PTTARY
chr2_33656916_G_A_b38	RASGRP3	3.655	0.00033	0.123954	16	0.033915	yes	PTTARY
chr2_33532487_C_A_b38	RASGRP3	3.644	0.000343	0.097815	57	0.026839	yes	PTTARY
chr2_33622130_C_CA_b38	RASGRP3	3.636	0.000354	0.196925	3	0.054165	yes	PTTARY
chr2_33622592_T_C_b38	RASGRP3	3.615	0.000382	0.121642	17	0.03365	yes	PTTARY
chr2_33622160_C_T_b38	RASGRP3	3.572	0.000446	0.128967	13	0.036105	yes	PTTARY
chr2_33545200_T_C_b38	RASGRP3	-3.553	0.000478	-0.137544	7	0.038716	yes	PTTARY
chr2_33642139_G_T_b38	RASGRP3	3.543	0.000495	0.135589	7	0.038274	yes	PTTARY
chr2_33553788_G_A_b38	RASGRP3	-3.541	0.000498	-0.137634	7	0.038869	yes	PTTARY
chr2_33556856_G_C_b38	RASGRP3	-3.541	0.000498	-0.137634	7	0.038869	yes	PTTARY
chr2_33561322_C_T_b38	RASGRP3	-3.541	0.000498	-0.137634	7	0.038869	yes	PTTARY
chr2_33672387_A_G_b38	RASGRP3	3.538	0.000504	0.142105	6	0.040169	yes	PTTARY
chr2_33550119_G_T_b38	RASGRP3	-3.514	0.000548	-0.136258	7	0.038778	yes	PTTARY
chr2_33562267_C_CT_b38	RASGRP3	3.513	0.000549	0.09585	44	0.027282	yes	PTTARY
chr2_33621819_C_A_b38	RASGRP3	3.469	0.000643	0.11291	23	0.03255	yes	PTTARY
chr2_33670716_C_T_b38	RASGRP3	3.456	0.000672	0.129777	9	0.037549	yes	PTTARY
chr2_33550598_T_G_b38	RASGRP3	-3.385	0.00086	-0.13157	7	0.038869	yes	PTTARY
chr2_33543901_C_G_b38	RASGRP3	-3.363	0.000926	-0.103794	31	0.030861	yes	PTTARY
chr2_33548698_A_AATTATT_b38	RASGRP3	-3.355	0.000954	-0.129943	7	0.038736	yes	PTTARY
chr2_33549383_C_T_b38	RASGRP3	-3.355	0.000954	-0.129943	7	0.038736	yes	PTTARY
chr2_33669427_A_C_b38	RASGRP3	3.333	0.00103	0.136903	5	0.041072	yes	PTTARY
chr2_33623108_T_C_b38	RASGRP3	3.305	0.00113	0.108131	23	0.032721	yes	PTTARY
chr2_33552018_CAAACAAACA_C_b38	RASGRP3	-3.284	0.00121	-0.130019	7	0.039587	yes	PTTARY
chr2_33509399_C_CA_b38	RASGRP3	3.28	0.00123	0.143393	3	0.043718	yes	PTTARY
chr2_33551040_C_T_b38	RASGRP3	-3.27	0.00127	-0.127102	7	0.038871	yes	PTTARY
chr2_33669574_A_G_b38	RASGRP3	3.242	0.00139	0.136361	4	0.042056	yes	PTTARY
chr2_33537323_G_C_b38	RASGRP3	-3.199	0.00161	-0.098282	31	0.030724	yes	PTTARY
chr2_33620497_T_C_b38	RASGRP3	3.181	0.0017	0.127086	8	0.039946	yes	PTTARY
chr2_33620575_G_A_b38	RASGRP3	3.181	0.0017	0.127086	8	0.039946	yes	PTTARY
chr2_33515662_T_C_b38	RASGRP3	3.157	0.00184	0.121365	11	0.038441	yes	PTTARY
chr2_34222364_T_A_b38	RASGRP3	3.122	0.00207	0.140352	5	0.04495	yes	PTTARY
chr2_33527085_G_T_b38	RASGRP3	-3.091	0.00228	-0.113776	10	0.036805	yes	PTTARY
chr2_33548381_A_AAAAAG_b38	RASGRP3	3.084	0.00234	0.164247	3	0.053254	yes	PTTARY
chr2_33536322_GA_G_b38	RASGRP3	-2.984	0.00321	-0.090122	51	0.0302	yes	PTTARY
chr2_33661940_T_G_b38	RASGRP3	-2.97	0.00336	-0.094977	55	0.031984	yes	PTTARY
chr2_33820413_AT_A_b38	RASGRP3	2.969	0.00336	0.12374	13	0.041681	yes	PTTARY
chr2_32642247_A_ATTT_b38	RASGRP3	2.947	0.0036	0.126718	6	0.043002	yes	PTTARY
chr2_33637426_T_A_b38	RASGRP3	2.922	0.00389	0.118473	5	0.040546	yes	PTTARY
chr2_32751940_A_C_b38	RASGRP3	2.866	0.00462	0.130252	3	0.045455	yes	PTTARY
chr2_33661923_CT_C_b38	RASGRP3	-2.859	0.00472	-0.094377	43	0.033016	yes	PTTARY
chr2_33647687_C_CA_b38	RASGRP3	2.853	0.00479	0.110997	11	0.038904	yes	PTTARY
chr2_33556890_T_TACAC_b38	RASGRP3	-2.835	0.00506	-0.106115	7	0.037429	yes	PTTARY
chr2_33577175_G_A_b38	RASGRP3	2.818	0.00532	0.116706	5	0.041409	yes	PTTARY
chr2_33087084_C_CT_b38	RASGRP3	2.794	0.00573	0.200834	3	0.071886	yes	PTTARY
chr2_33071056_A_G_b38	RASGRP3	2.764	0.00625	0.11084	6	0.0401	yes	PTTARY
chr2_33554839_T_C_b38	RASGRP3	2.733	0.00685	0.084977	29	0.031094	yes	PTTARY
chr2_33192558_T_C_b38	RASGRP3	-2.703	0.00748	-0.089762	21	0.033212	yes	PTTARY
chr2_33230675_A_G_b38	RASGRP3	-2.692	0.00772	-0.091539	20	0.034005	yes	PTTARY
chr2_33537330_C_CCCA_b38	RASGRP3	-2.687	0.00783	-0.129083	4	0.048038	yes	PTTARY
chr2_34193013_C_T_b38	RASGRP3	2.658	0.0085	0.127752	7	0.048057	yes	PTTARY
chr2_33162473_T_C_b38	RASGRP3	-2.635	0.00908	-0.087484	21	0.033197	yes	PTTARY
chr2_33563038_A_G_b38	RASGRP3	-2.621	0.00944	-0.113596	6	0.043334	yes	PTTARY
chr2_33679537_C_CTT_b38	RASGRP3	-2.604	0.00993	-0.139073	7	0.053416	yes	PTTARY
chr2_33546942_C_G_b38	RASGRP3	10.051	1.96e-19	0.400318	4	0.039828	no	PTTARY
chr2_33539996_AAAAAG_A_b38	RASGRP3	-4.558	9.07e-06	-0.13002	56	0.028525	no	PTTARY
chr2_33535555_G_GC_b38	RASGRP3	-4.324	2.44e-05	-0.168081	7	0.038873	no	PTTARY
chr2_33535943_T_C_b38	RASGRP3	-3.863	0.000152	-0.150612	7	0.038993	no	PTTARY
chr2_33515788_C_T_b38	RASGRP3	-3.835	0.000169	-0.152083	7	0.039655	no	PTTARY
chr2_33537417_G_A_b38	RASGRP3	-3.719	0.000261	-0.134851	10	0.036257	no	PTTARY
chr2_33508652_C_G_b38	RASGRP3	3.586	0.000424	0.106418	34	0.029679	no	PTTARY
chr2_33512902_A_G_b38	RASGRP3	-3.432	0.000731	-0.099057	47	0.028863	no	PTTARY
chr2_33613720_G_A_b38	RASGRP3	3.277	0.00124	0.151809	4	0.046331	no	PTTARY
chr2_33567745_C_T_b38	RASGRP3	-3.237	0.00142	-0.101435	33	0.031338	no	PTTARY
chr2_33514230_T_G_b38	RASGRP3	3.114	0.00212	0.116339	10	0.037358	no	PTTARY
chr2_33508487_T_C_b38	RASGRP3	3.009	0.00297	0.177361	6	0.058949	no	PTTARY
chr2_33528012_T_G_b38	RASGRP3	-2.995	0.00309	-0.105112	13	0.03509	no	PTTARY
chr2_33673112_G_T_b38	RASGRP3	-2.948	0.00359	-0.092306	51	0.031311	no	PTTARY
chr2_33511010_G_A_b38	RASGRP3	2.947	0.00359	0.159312	5	0.054054	no	PTTARY
chr2_33512820_T_A_b38	RASGRP3	-2.936	0.00372	-0.087423	35	0.029774	no	PTTARY
chr2_33519891_C_T_b38	RASGRP3	-2.931	0.00378	-0.088971	34	0.030351	no	PTTARY
chr2_33664465_T_A_b38	RASGRP3	-2.928	0.00381	-0.085145	57	0.029076	no	PTTARY
chr2_33661861_G_A_b38	RASGRP3	-2.925	0.00385	-0.084679	56	0.028952	no	PTTARY
chr2_33661731_A_G_b38	RASGRP3	-2.903	0.00412	-0.082987	62	0.028583	no	PTTARY
chr2_33514489_T_C_b38	RASGRP3	-2.893	0.00425	-0.083096	38	0.028728	no	PTTARY
chr2_33523846_A_G_b38	RASGRP3	-2.879	0.00443	-0.101487	13	0.035247	no	PTTARY
chr2_33447440_A_AT_b38	RASGRP3	2.857	0.00473	0.099018	20	0.034652	no	PTTARY
chr2_33659127_A_G_b38	RASGRP3	-2.855	0.00477	-0.081705	61	0.028621	no	PTTARY
chr2_33664871_G_GT_b38	RASGRP3	-2.829	0.00515	-0.083931	56	0.029665	no	PTTARY
chr2_32740453_C_CT_b38	RASGRP3	2.794	0.00573	0.087128	26	0.031186	no	PTTARY
chr2_33518880_G_GTCA_b38	RASGRP3	-2.785	0.00588	-0.081748	39	0.029354	no	PTTARY
chr2_33974667_A_G_b38	RASGRP3	-2.749	0.00653	-0.085392	36	0.03106	no	PTTARY
chr2_33968631_T_C_b38	RASGRP3	-2.724	0.00703	-0.08455	30	0.031039	no	PTTARY
chr2_33520141_T_C_b38	RASGRP3	-2.717	0.00717	-0.078819	41	0.029005	no	PTTARY
chr2_33519413_A_G_b38	RASGRP3	-2.641	0.00894	-0.083935	22	0.031783	no	PTTARY
chr2_34160601_T_TCA_b38	RASGRP3	-2.64	0.00897	-0.09964	7	0.037749	no	PTTARY
chr2_33531453_C_T_b38	RASGRP3	7.244	1.21e-11	0.253552	3	0.035002	yes	PRSTTE
chr2_33526597_C_T_b38	RASGRP3	7.225	1.35e-11	0.259629	3	0.035935	yes	PRSTTE
chr2_33527062_GC_G_b38	RASGRP3	7.225	1.35e-11	0.259629	3	0.035935	yes	PRSTTE
chr2_33529269_C_A_b38	RASGRP3	7.22	1.39e-11	0.252126	3	0.034922	yes	PRSTTE
chr2_33537330_C_CCCAACACA_b38	RASGRP3	6.939	6.78e-11	0.21038	13	0.030317	yes	PRSTTE
chr2_33561445_C_A_b38	RASGRP3	4.462	1.42e-05	0.142821	8	0.032006	yes	PRSTTE
chr2_32723971_C_CT_b38	RASGRP3	4.377	2.03e-05	0.149145	10	0.034077	yes	PRSTTE
chr2_32648436_CT_C_b38	RASGRP3	4.325	2.52e-05	0.124392	32	0.028764	yes	PRSTTE
chr2_33537321_C_CA_b38	RASGRP3	4.178	4.57e-05	0.102765	36	0.024596	yes	PRSTTE
chr2_33523649_G_A_b38	RASGRP3	3.965	0.000105	0.133136	8	0.033575	yes	PRSTTE
chr2_33555164_G_A_b38	RASGRP3	3.916	0.000128	0.128695	7	0.032868	yes	PRSTTE
chr2_33523461_TA_T_b38	RASGRP3	3.899	0.000136	0.125073	7	0.032078	yes	PRSTTE
chr2_33532487_C_A_b38	RASGRP3	3.874	0.00015	0.095695	59	0.024704	yes	PRSTTE
chr2_32701765_C_T_b38	RASGRP3	3.824	0.00018	0.169026	3	0.044198	yes	PRSTTE
chr2_33561192_A_G_b38	RASGRP3	3.721	0.000264	0.092788	52	0.024935	yes	PRSTTE
chr2_33509059_T_G_b38	RASGRP3	-3.711	0.000275	-0.1151	11	0.031016	yes	PRSTTE
chr2_33521266_C_T_b38	RASGRP3	3.704	0.000281	0.112233	14	0.030299	yes	PRSTTE
chr2_33523846_A_G_b38	RASGRP3	-3.583	0.000436	-0.112761	12	0.031468	yes	PRSTTE
chr2_32702509_T_C_b38	RASGRP3	3.571	0.000455	0.15428	3	0.043201	yes	PRSTTE
chr2_33515662_T_C_b38	RASGRP3	3.519	0.000548	0.122707	6	0.034873	yes	PRSTTE
chr2_32752637_C_G_b38	RASGRP3	3.373	0.00091	0.139891	3	0.041477	yes	PRSTTE
chr2_32751940_A_C_b38	RASGRP3	3.317	0.0011	0.135078	4	0.040721	yes	PRSTTE
chr2_32712998_C_G_b38	RASGRP3	3.252	0.00137	0.133054	4	0.040919	yes	PRSTTE
chr2_32754580_A_G_b38	RASGRP3	3.231	0.00146	0.137243	3	0.042473	yes	PRSTTE
chr2_33515788_C_T_b38	RASGRP3	-3.197	0.00164	-0.123606	3	0.038667	yes	PRSTTE
chr2_32871799_C_CAA_b38	RASGRP3	3.16	0.00185	0.095651	16	0.030266	yes	PRSTTE
chr2_33642139_G_T_b38	RASGRP3	3.157	0.00187	0.116713	3	0.036975	yes	PRSTTE
chr2_33760867_C_T_b38	RASGRP3	-3.112	0.00216	-0.108434	6	0.034848	yes	PRSTTE
chr2_32711854_T_G_b38	RASGRP3	3.067	0.00249	0.118083	6	0.038497	yes	PRSTTE
chr2_32642247_A_ATTT_b38	RASGRP3	3.058	0.00256	0.126659	5	0.041414	yes	PRSTTE
chr2_32703885_A_G_b38	RASGRP3	3.039	0.00272	0.121635	4	0.040024	yes	PRSTTE
chr2_32704097_A_G_b38	RASGRP3	3.039	0.00272	0.121635	4	0.040024	yes	PRSTTE
chr2_33532968_G_A_b38	RASGRP3	-3.019	0.0029	-0.117249	3	0.038833	yes	PRSTTE
chr2_34413330_T_TA_b38	RASGRP3	2.968	0.00341	0.086571	26	0.029172	yes	PRSTTE
chr2_33533388_C_T_b38	RASGRP3	-2.961	0.00348	-0.112601	3	0.038026	yes	PRSTTE
chr2_32739926_T_G_b38	RASGRP3	2.957	0.00353	0.123333	4	0.041715	yes	PRSTTE
chr2_32704012_C_T_b38	RASGRP3	2.936	0.00375	0.120343	3	0.040986	yes	PRSTTE
chr2_33923255_GTTTTTT_G_b38	RASGRP3	-2.929	0.00383	-0.079649	34	0.02719	yes	PRSTTE
chr2_33562267_C_CT_b38	RASGRP3	2.907	0.00411	0.076458	43	0.026302	yes	PRSTTE
chr2_33535555_G_GC_b38	RASGRP3	-2.893	0.00428	-0.113062	3	0.039081	yes	PRSTTE
chr2_33543280_C_G_b38	RASGRP3	-2.893	0.00428	-0.113062	3	0.039081	yes	PRSTTE
chr2_33921555_C_CCACACACACACACACACA_b38	RASGRP3	-2.875	0.00453	-0.080421	20	0.027977	yes	PRSTTE
chr2_33533272_T_C_b38	RASGRP3	-2.871	0.00458	-0.109282	3	0.038068	yes	PRSTTE
chr2_33760866_T_C_b38	RASGRP3	-2.855	0.00481	-0.105137	4	0.036825	yes	PRSTTE
chr2_33508652_C_G_b38	RASGRP3	2.837	0.00508	0.072708	32	0.02563	yes	PRSTTE
chr2_33522958_T_C_b38	RASGRP3	-2.837	0.00508	-0.124355	3	0.043838	yes	PRSTTE
chr2_32777126_A_T_b38	RASGRP3	2.834	0.00512	0.100517	4	0.035468	yes	PRSTTE
chr2_33630302_AT_A_b38	RASGRP3	-2.805	0.00559	-0.081354	34	0.029006	yes	PRSTTE
chr2_33764603_A_G_b38	RASGRP3	-2.792	0.0058	-0.078197	24	0.028004	yes	PRSTTE
chr2_32695984_G_A_b38	RASGRP3	2.786	0.0059	0.119268	4	0.042807	yes	PRSTTE
chr2_33764454_T_C_b38	RASGRP3	-2.769	0.00622	-0.077607	25	0.028031	yes	PRSTTE
chr2_33766547_T_G_b38	RASGRP3	-2.769	0.00622	-0.077607	25	0.028031	yes	PRSTTE
chr2_33534062_A_C_b38	RASGRP3	-2.763	0.00632	-0.106758	3	0.038636	yes	PRSTTE
chr2_32688690_A_C_b38	RASGRP3	2.763	0.00632	0.105647	6	0.038238	yes	PRSTTE
chr2_33807273_A_G_b38	RASGRP3	2.75	0.00657	0.130077	3	0.047305	yes	PRSTTE
chr2_33538452_G_A_b38	RASGRP3	-2.745	0.00666	-0.107179	3	0.039043	yes	PRSTTE
chr2_33534328_C_T_b38	RASGRP3	-2.742	0.00672	-0.107147	3	0.039073	yes	PRSTTE
chr2_33563038_A_G_b38	RASGRP3	-2.742	0.00672	-0.109488	3	0.039929	yes	PRSTTE
chr2_33764495_G_A_b38	RASGRP3	-2.72	0.00717	-0.075628	24	0.027808	yes	PRSTTE
chr2_33551040_C_T_b38	RASGRP3	-2.709	0.0074	-0.09974	5	0.036821	yes	PRSTTE
chr2_33826216_A_G_b38	RASGRP3	-2.7	0.00758	-0.082258	32	0.030463	yes	PRSTTE
chr2_32708012_A_G_b38	RASGRP3	2.694	0.00772	0.108805	6	0.040383	yes	PRSTTE
chr2_32708739_T_G_b38	RASGRP3	2.694	0.00772	0.108805	6	0.040383	yes	PRSTTE
chr2_33764585_G_A_b38	RASGRP3	-2.643	0.00895	-0.072797	26	0.027547	yes	PRSTTE
chr2_33765176_T_A_b38	RASGRP3	-2.643	0.00895	-0.072797	26	0.027547	yes	PRSTTE
chr2_33764670_T_A_b38	RASGRP3	-2.638	0.00906	-0.073039	25	0.027686	yes	PRSTTE
chr2_34278340_CTG_C_b38	RASGRP3	-2.633	0.00918	-0.096662	5	0.036706	yes	PRSTTE
chr2_32767443_G_GT_b38	RASGRP3	2.631	0.00925	0.095743	6	0.03639	yes	PRSTTE
chr2_33528012_T_G_b38	RASGRP3	-2.63	0.00928	-0.086211	11	0.032784	yes	PRSTTE
chr2_32708138_C_T_b38	RASGRP3	2.622	0.00948	0.10652	6	0.040624	yes	PRSTTE
chr2_33530852_CT_C_b38	RASGRP3	2.62	0.00953	0.065686	46	0.025069	yes	PRSTTE
chr2_32687049_T_C_b38	RASGRP3	2.614	0.00969	0.106267	3	0.040649	yes	PRSTTE
chr2_33763276_A_C_b38	RASGRP3	-2.612	0.00975	-0.072336	26	0.027689	yes	PRSTTE
chr2_33763677_T_C_b38	RASGRP3	-2.612	0.00975	-0.072336	26	0.027689	yes	PRSTTE
chr2_33557844_G_A_b38	RASGRP3	7.357	6.34e-12	0.246431	4	0.033498	no	PRSTTE
chr2_33540561_TGTGTGTGTGTG_T_b38	RASGRP3	5.564	9.38e-08	0.198315	6	0.035644	no	PRSTTE
chr2_33512177_G_A_b38	RASGRP3	5.317	3.09e-07	0.166913	13	0.031394	no	PRSTTE
chr2_33525341_A_AAT_b38	RASGRP3	5.258	4.07e-07	0.151659	13	0.028843	no	PRSTTE
chr2_33547053_GAA_G_b38	RASGRP3	4.571	8.98e-06	0.203004	3	0.044414	no	PRSTTE
chr2_33529318_C_T_b38	RASGRP3	4.083	6.66e-05	0.132632	7	0.032483	no	PRSTTE
chr2_33565263_A_G_b38	RASGRP3	4.006	9.01e-05	0.110904	18	0.027685	no	PRSTTE
chr2_33590881_T_C_b38	RASGRP3	3.936	0.000118	0.103685	21	0.026342	no	PRSTTE
chr2_33589264_G_C_b38	RASGRP3	3.912	0.00013	0.103625	21	0.026492	no	PRSTTE
chr2_33596450_T_G_b38	RASGRP3	3.912	0.00013	0.103625	21	0.026492	no	PRSTTE
chr2_33596963_A_T_b38	RASGRP3	3.891	0.00014	0.109034	16	0.028019	no	PRSTTE
chr2_33650021_A_G_b38	RASGRP3	3.849	0.000164	0.125982	5	0.03273	no	PRSTTE
chr2_33656248_TTC_T_b38	RASGRP3	3.849	0.000164	0.125982	5	0.03273	no	PRSTTE
chr2_33639021_G_A_b38	RASGRP3	3.836	0.000172	0.127076	5	0.033124	no	PRSTTE
chr2_33641397_G_C_b38	RASGRP3	3.836	0.000172	0.127076	5	0.033124	no	PRSTTE
chr2_33581561_C_T_b38	RASGRP3	3.825	0.00018	0.106779	16	0.027917	no	PRSTTE
chr2_33586869_A_T_b38	RASGRP3	3.824	0.00018	0.112858	13	0.029512	no	PRSTTE
chr2_33556928_C_CACACACATACAT_b38	RASGRP3	3.822	0.000182	0.147774	3	0.038666	no	PRSTTE
chr2_33512820_T_A_b38	RASGRP3	-3.812	0.000189	-0.096239	32	0.025246	no	PRSTTE
chr2_33640631_A_C_b38	RASGRP3	3.8	0.000197	0.125416	5	0.033003	no	PRSTTE
chr2_33596617_C_T_b38	RASGRP3	3.793	0.000203	0.106401	16	0.028051	no	PRSTTE
chr2_33594326_C_T_b38	RASGRP3	3.791	0.000205	0.106665	16	0.02814	no	PRSTTE
chr2_33594385_G_A_b38	RASGRP3	3.791	0.000205	0.106665	16	0.02814	no	PRSTTE
chr2_32714377_C_G_b38	RASGRP3	3.766	0.000224	0.161113	4	0.042776	no	PRSTTE
chr2_32714410_G_A_b38	RASGRP3	3.766	0.000224	0.161113	4	0.042776	no	PRSTTE
chr2_33536322_G_GA_b38	RASGRP3	3.754	0.000235	0.143957	9	0.03835	no	PRSTTE
chr2_33582025_C_T_b38	RASGRP3	3.717	0.000269	0.103573	16	0.027865	no	PRSTTE
chr2_33652477_C_A_b38	RASGRP3	3.7	0.000286	0.122305	5	0.033056	no	PRSTTE
chr2_33511010_G_A_b38	RASGRP3	3.509	0.000567	0.146927	5	0.041867	no	PRSTTE
chr2_33670716_C_T_b38	RASGRP3	3.436	0.000731	0.103064	10	0.029993	no	PRSTTE
chr2_33518114_A_G_b38	RASGRP3	-3.43	0.000747	-0.086836	31	0.025315	no	PRSTTE
chr2_33514489_T_C_b38	RASGRP3	-3.429	0.00075	-0.084852	37	0.024744	no	PRSTTE
chr2_32648855_T_A_b38	RASGRP3	3.419	0.000778	0.153382	3	0.044867	no	PRSTTE
chr2_33514230_T_G_b38	RASGRP3	3.412	0.000797	0.118996	6	0.034881	no	PRSTTE
chr2_33569371_A_G_b38	RASGRP3	-3.381	0.000886	-0.085307	42	0.025235	no	PRSTTE
chr2_33519891_C_T_b38	RASGRP3	-3.331	0.00105	-0.087122	30	0.026153	no	PRSTTE
chr2_33575950_G_A_b38	RASGRP3	-3.33	0.00105	-0.083735	41	0.025142	no	PRSTTE
chr2_33577889_G_A_b38	RASGRP3	-3.33	0.00105	-0.083735	41	0.025142	no	PRSTTE
chr2_32723127_A_G_b38	RASGRP3	3.326	0.00107	0.138144	3	0.04153	no	PRSTTE
chr2_33621819_C_A_b38	RASGRP3	3.322	0.00108	0.090988	22	0.027389	no	PRSTTE
chr2_33571342_T_C_b38	RASGRP3	-3.318	0.0011	-0.083302	41	0.025105	no	PRSTTE
chr2_33623108_T_C_b38	RASGRP3	3.313	0.00112	0.092471	21	0.027913	no	PRSTTE
chr2_33662459_C_T_b38	RASGRP3	3.3	0.00116	0.107044	6	0.032438	no	PRSTTE
chr2_32717008_AT_A_b38	RASGRP3	3.289	0.00121	0.124459	5	0.037846	no	PRSTTE
chr2_33622160_C_T_b38	RASGRP3	3.249	0.00138	0.092816	16	0.02857	no	PRSTTE
chr2_34088573_T_C_b38	RASGRP3	-3.245	0.0014	-0.083251	27	0.025655	no	PRSTTE
chr2_33571267_T_A_b38	RASGRP3	-3.238	0.00143	-0.081339	42	0.025117	no	PRSTTE
chr2_33663555_T_C_b38	RASGRP3	3.234	0.00145	0.104375	6	0.032271	no	PRSTTE
chr2_33568339_TA_T_b38	RASGRP3	-3.224	0.0015	-0.080837	45	0.025072	no	PRSTTE
chr2_33572204_C_A_b38	RASGRP3	-3.182	0.00172	-0.079842	42	0.025095	no	PRSTTE
chr2_33535943_T_C_b38	RASGRP3	-3.173	0.00177	-0.120003	3	0.037819	no	PRSTTE
chr2_33525341_AAT_A_b38	RASGRP3	-3.154	0.00188	-0.121203	3	0.038426	no	PRSTTE
chr2_33537323_G_A_b38	RASGRP3	3.091	0.00231	0.07252	57	0.023459	no	PRSTTE
chr2_33518880_G_GTCA_b38	RASGRP3	-3.057	0.00257	-0.082638	40	0.02703	no	PRSTTE
chr2_33512902_A_G_b38	RASGRP3	-3.054	0.0026	-0.08081	43	0.026462	no	PRSTTE
chr2_32720434_C_CT_b38	RASGRP3	3.028	0.00282	0.124346	3	0.041062	no	PRSTTE
chr2_32706204_T_A_b38	RASGRP3	3.024	0.00286	0.120653	4	0.039896	no	PRSTTE
chr2_33588900_A_AT_b38	RASGRP3	-2.996	0.00312	-0.078786	41	0.026301	no	PRSTTE
chr2_33564001_C_G_b38	RASGRP3	2.984	0.00324	0.080005	30	0.026813	no	PRSTTE
chr2_33625315_G_A_b38	RASGRP3	2.975	0.00333	0.090522	12	0.030429	no	PRSTTE
chr2_32696497_T_C_b38	RASGRP3	2.955	0.00354	0.115929	5	0.039226	no	PRSTTE
chr2_32754099_AAAAT_A_b38	RASGRP3	2.944	0.00367	0.12383	3	0.042064	no	PRSTTE
chr2_33657078_T_C_b38	RASGRP3	2.909	0.00408	0.085668	14	0.029446	no	PRSTTE
chr2_33564467_A_G_b38	RASGRP3	2.897	0.00423	0.076536	33	0.026419	no	PRSTTE
chr2_33567745_C_T_b38	RASGRP3	-2.874	0.00454	-0.072614	39	0.025266	no	PRSTTE
chr2_33622592_T_C_b38	RASGRP3	2.873	0.00455	0.084507	16	0.029411	no	PRSTTE
chr2_33758156_C_T_b38	RASGRP3	-2.871	0.00458	-0.080349	23	0.027985	no	PRSTTE
chr2_33923278_G_T_b38	RASGRP3	-2.864	0.00468	-0.070575	56	0.024645	no	PRSTTE
chr2_32659657_G_C_b38	RASGRP3	2.854	0.00483	0.116387	4	0.040785	no	PRSTTE
chr2_33542583_A_T_b38	RASGRP3	-2.842	0.005	-0.120539	6	0.042416	no	PRSTTE
chr2_33563965_A_G_b38	RASGRP3	2.807	0.00554	0.102069	5	0.036356	no	PRSTTE
chr2_34085758_A_T_b38	RASGRP3	2.8	0.00566	0.078589	20	0.028063	no	PRSTTE
chr2_33538430_G_C_b38	RASGRP3	-2.736	0.00684	-0.106302	3	0.038852	no	PRSTTE
chr2_33527085_G_T_b38	RASGRP3	-2.735	0.00686	-0.092824	9	0.033939	no	PRSTTE
chr2_33801834_GT_G_b38	RASGRP3	2.701	0.00758	0.074886	20	0.027728	no	PRSTTE
chr2_33089155_CAA_C_b38	RASGRP3	-2.7	0.0076	-0.095035	7	0.035201	no	PRSTTE
chr2_33605827_ATTTTTCT_A_b38	RASGRP3	2.68	0.00804	0.101484	4	0.037869	no	PRSTTE
chr2_33809706_A_T_b38	RASGRP3	-2.677	0.00812	-0.082183	17	0.030704	no	PRSTTE
chr2_33581338_T_A_b38	RASGRP3	2.676	0.00813	0.097962	5	0.036602	no	PRSTTE
chr2_33581900_A_T_b38	RASGRP3	2.676	0.00813	0.097962	5	0.036602	no	PRSTTE
chr2_33760998_A_T_b38	RASGRP3	-2.675	0.00817	-0.070704	31	0.026435	no	PRSTTE
chr2_32762276_AGTGTGTGTGTGTGTGTGT_A_b38	RASGRP3	2.667	0.00834	0.096166	4	0.036052	no	PRSTTE
chr2_33424687_C_CT_b38	RASGRP3	-2.667	0.00835	-0.15534	3	0.058246	no	PRSTTE
chr2_33756434_A_G_b38	RASGRP3	-2.626	0.00938	-0.072716	25	0.02769	no	PRSTTE
chr2_33656848_TA_T_b38	RASGRP3	2.607	0.00988	0.079096	12	0.030335	no	PRSTTE
chr2_33529318_C_T_b38	RASGRP3	9.858	7.18e-21	0.13397	18	0.01359	yes	SKINNS
chr2_33561445_C_A_b38	RASGRP3	9.734	1.97e-20	0.129915	24	0.013347	yes	SKINNS
chr2_33565263_A_G_b38	RASGRP3	9.287	7e-19	0.122573	37	0.013198	yes	SKINNS
chr2_33596963_A_T_b38	RASGRP3	9.032	5.13e-18	0.118525	34	0.013123	yes	SKINNS
chr2_33523649_G_A_b38	RASGRP3	8.99	7.08e-18	0.12355	22	0.013743	yes	SKINNS
chr2_33582025_C_T_b38	RASGRP3	8.972	8.13e-18	0.118754	30	0.013236	yes	SKINNS
chr2_33581561_C_T_b38	RASGRP3	8.969	8.35e-18	0.118353	31	0.013196	yes	SKINNS
chr2_33521266_C_T_b38	RASGRP3	8.933	1.1e-17	0.113784	34	0.012738	yes	SKINNS
chr2_33590881_T_C_b38	RASGRP3	8.666	8.31e-17	0.106193	43	0.012254	yes	SKINNS
chr2_33589264_G_C_b38	RASGRP3	8.654	9.14e-17	0.106181	44	0.01227	yes	SKINNS
chr2_33555164_G_A_b38	RASGRP3	8.634	1.06e-16	0.120082	22	0.013908	yes	SKINNS
chr2_33596450_T_G_b38	RASGRP3	8.483	3.26e-16	0.104116	45	0.012273	yes	SKINNS
chr2_33537321_C_CA_b38	RASGRP3	8.011	1e-14	0.086942	78	0.010853	yes	SKINNS
chr2_33525341_A_AAT_b38	RASGRP3	7.991	1.15e-14	0.106835	25	0.013369	yes	SKINNS
chr2_33564001_C_G_b38	RASGRP3	7.676	1.04e-13	0.09091	65	0.011843	yes	SKINNS
chr2_33564467_A_G_b38	RASGRP3	7.433	5.47e-13	0.088425	67	0.011896	yes	SKINNS
chr2_33657078_T_C_b38	RASGRP3	7.341	1.01e-12	0.093313	40	0.012711	yes	SKINNS
chr2_33532487_C_A_b38	RASGRP3	7.075	5.83e-12	0.076711	130	0.010843	yes	SKINNS
chr2_33622160_C_T_b38	RASGRP3	7.062	6.33e-12	0.089721	40	0.012705	yes	SKINNS
chr2_33639021_G_A_b38	RASGRP3	7.047	6.99e-12	0.095995	24	0.013623	yes	SKINNS
chr2_33640631_A_C_b38	RASGRP3	7.038	7.39e-12	0.096051	24	0.013647	yes	SKINNS
chr2_33641397_G_C_b38	RASGRP3	6.999	9.51e-12	0.095465	24	0.01364	yes	SKINNS
chr2_33656248_TTC_T_b38	RASGRP3	6.789	3.62e-11	0.092426	24	0.013615	yes	SKINNS
chr2_33621819_C_A_b38	RASGRP3	6.757	4.4e-11	0.082509	52	0.01221	yes	SKINNS
chr2_33623108_T_C_b38	RASGRP3	6.7	6.31e-11	0.082858	52	0.012367	yes	SKINNS
chr2_33656848_TA_T_b38	RASGRP3	6.684	6.95e-11	0.085947	39	0.012858	yes	SKINNS
chr2_33650021_A_G_b38	RASGRP3	6.667	7.73e-11	0.09113	24	0.013669	yes	SKINNS
chr2_33663555_T_C_b38	RASGRP3	6.521	1.89e-10	0.088066	26	0.013504	yes	SKINNS
chr2_33662459_C_T_b38	RASGRP3	6.443	3.05e-10	0.086902	26	0.013489	yes	SKINNS
chr2_33652477_C_A_b38	RASGRP3	6.389	4.22e-10	0.087538	24	0.013702	yes	SKINNS
chr2_33622592_T_C_b38	RASGRP3	6.004	3.99e-09	0.075247	51	0.012532	yes	SKINNS
chr2_33518114_A_G_b38	RASGRP3	-5.964	5e-09	-0.069038	66	0.011575	yes	SKINNS
chr2_33625315_G_A_b38	RASGRP3	5.938	5.8e-09	0.078632	38	0.013241	yes	SKINNS
chr2_33561192_A_G_b38	RASGRP3	5.931	6.04e-09	0.066494	116	0.011211	yes	SKINNS
chr2_33537323_G_A_b38	RASGRP3	5.896	7.37e-09	0.061785	131	0.01048	yes	SKINNS
chr2_33627793_A_G_b38	RASGRP3	5.89	7.6e-09	0.104301	7	0.017708	yes	SKINNS
chr2_33670716_C_T_b38	RASGRP3	5.85	9.53e-09	0.078451	29	0.013411	yes	SKINNS
chr2_33588900_A_AT_b38	RASGRP3	-5.684	2.38e-08	-0.070152	101	0.012342	yes	SKINNS
chr2_33616325_C_T_b38	RASGRP3	5.628	3.23e-08	0.102256	7	0.01817	yes	SKINNS
chr2_33563965_A_G_b38	RASGRP3	5.627	3.25e-08	0.095983	11	0.017059	yes	SKINNS
chr2_33514489_T_C_b38	RASGRP3	-5.568	4.46e-08	-0.06086	87	0.01093	yes	SKINNS
chr2_33640513_G_C_b38	RASGRP3	5.528	5.52e-08	0.09881	7	0.017875	yes	SKINNS
chr2_33530852_CT_C_b38	RASGRP3	5.518	5.84e-08	0.062591	90	0.011344	yes	SKINNS
chr2_33659035_G_A_b38	RASGRP3	5.497	6.52e-08	0.099795	7	0.018155	yes	SKINNS
chr2_33607432_G_A_b38	RASGRP3	5.41	1.03e-07	0.098517	6	0.018209	yes	SKINNS
chr2_33615450_C_G_b38	RASGRP3	5.388	1.16e-07	0.09785	6	0.018162	yes	SKINNS
chr2_33571267_T_A_b38	RASGRP3	-5.36	1.34e-07	-0.064497	80	0.012033	yes	SKINNS
chr2_33508652_C_G_b38	RASGRP3	5.346	1.44e-07	0.064235	62	0.012015	yes	SKINNS
chr2_33631243_G_GT_b38	RASGRP3	5.318	1.67e-07	0.096834	7	0.01821	yes	SKINNS
chr2_33581900_A_T_b38	RASGRP3	5.313	1.7e-07	0.091351	11	0.017192	yes	SKINNS
chr2_33581338_T_A_b38	RASGRP3	5.301	1.82e-07	0.091365	11	0.017236	yes	SKINNS
chr2_33569371_A_G_b38	RASGRP3	-5.292	1.91e-07	-0.06421	80	0.012135	yes	SKINNS
chr2_33634816_G_T_b38	RASGRP3	5.288	1.94e-07	0.096099	7	0.018174	yes	SKINNS
chr2_33606703_C_T_b38	RASGRP3	5.25	2.36e-07	0.097005	7	0.018478	yes	SKINNS
chr2_33621944_G_A_b38	RASGRP3	5.24	2.49e-07	0.094911	6	0.018114	yes	SKINNS
chr2_33623483_C_T_b38	RASGRP3	5.24	2.49e-07	0.094911	6	0.018114	yes	SKINNS
chr2_33636858_C_G_b38	RASGRP3	5.214	2.84e-07	0.095029	7	0.018227	yes	SKINNS
chr2_33637736_A_T_b38	RASGRP3	5.214	2.84e-07	0.095029	7	0.018227	yes	SKINNS
chr2_33512820_T_A_b38	RASGRP3	-5.202	3.01e-07	-0.059193	73	0.011379	yes	SKINNS
chr2_33634524_A_G_b38	RASGRP3	5.2	3.05e-07	0.095196	7	0.018308	yes	SKINNS
chr2_33667549_A_G_b38	RASGRP3	5.063	6.05e-07	0.093152	7	0.018398	yes	SKINNS
chr2_33667555_A_G_b38	RASGRP3	5.063	6.05e-07	0.093152	7	0.018398	yes	SKINNS
chr2_33519891_C_T_b38	RASGRP3	-5.056	6.27e-07	-0.058963	79	0.011663	yes	SKINNS
chr2_33567745_C_T_b38	RASGRP3	-5.03	7.12e-07	-0.060722	74	0.012072	yes	SKINNS
chr2_33532718_G_A_b38	RASGRP3	4.999	8.32e-07	0.05673	91	0.011349	yes	SKINNS
chr2_33548381_A_AAAAAG_b38	RASGRP3	4.974	9.36e-07	0.097145	9	0.019529	yes	SKINNS
chr2_33509059_T_G_b38	RASGRP3	-4.968	9.67e-07	-0.071359	21	0.014365	yes	SKINNS
chr2_33575950_G_A_b38	RASGRP3	-4.956	1.02e-06	-0.060555	75	0.012219	yes	SKINNS
chr2_33572204_C_A_b38	RASGRP3	-4.933	1.14e-06	-0.060108	80	0.012184	yes	SKINNS
chr2_33624881_G_GT_b38	RASGRP3	4.876	1.51e-06	0.062976	45	0.012915	yes	SKINNS
chr2_33568339_TA_T_b38	RASGRP3	-4.867	1.58e-06	-0.058647	88	0.01205	yes	SKINNS
chr2_33605827_ATTTTTCT_A_b38	RASGRP3	4.859	1.63e-06	0.08597	8	0.017692	yes	SKINNS
chr2_33656916_G_A_b38	RASGRP3	4.837	1.82e-06	0.061912	49	0.0128	yes	SKINNS
chr2_33661156_C_T_b38	RASGRP3	4.795	2.22e-06	0.06244	34	0.013021	yes	SKINNS
chr2_33661310_C_T_b38	RASGRP3	4.795	2.22e-06	0.06244	34	0.013021	yes	SKINNS
chr2_33571342_T_C_b38	RASGRP3	-4.785	2.33e-06	-0.05834	82	0.012193	yes	SKINNS
chr2_33672387_A_G_b38	RASGRP3	4.782	2.36e-06	0.073591	16	0.015388	yes	SKINNS
chr2_33577889_G_A_b38	RASGRP3	-4.765	2.56e-06	-0.058283	76	0.012231	yes	SKINNS
chr2_33626436_A_T_b38	RASGRP3	4.714	3.25e-06	0.060441	47	0.012821	yes	SKINNS
chr2_33589523_A_G_b38	RASGRP3	-4.656	4.27e-06	-0.053509	120	0.011493	yes	SKINNS
chr2_33592492_A_G_b38	RASGRP3	-4.615	5.15e-06	-0.053514	115	0.011596	yes	SKINNS
chr2_33586449_C_G_b38	RASGRP3	-4.532	7.52e-06	-0.052191	116	0.011516	yes	SKINNS
chr2_33604404_G_GTA_b38	RASGRP3	4.518	8.01e-06	0.083846	5	0.018558	yes	SKINNS
chr2_33669427_A_C_b38	RASGRP3	4.492	9.01e-06	0.069651	16	0.015507	yes	SKINNS
chr2_33509399_C_CA_b38	RASGRP3	4.487	9.19e-06	0.076486	5	0.017045	yes	SKINNS
chr2_33590404_A_G_b38	RASGRP3	-4.47	9.91e-06	-0.051638	116	0.011551	yes	SKINNS
chr2_33593131_C_T_b38	RASGRP3	-4.421	1.24e-05	-0.051024	115	0.011541	yes	SKINNS
chr2_33597253_G_A_b38	RASGRP3	-4.397	1.37e-05	-0.051751	108	0.011769	yes	SKINNS
chr2_33753650_A_G_b38	RASGRP3	4.385	1.45e-05	0.090418	3	0.020622	yes	SKINNS
chr2_33528012_T_G_b38	RASGRP3	-4.363	1.6e-05	-0.066459	18	0.015233	yes	SKINNS
chr2_33605951_T_C_b38	RASGRP3	-4.354	1.66e-05	-0.049575	113	0.011387	yes	SKINNS
chr2_33669574_A_G_b38	RASGRP3	4.345	1.73e-05	0.068112	15	0.015677	yes	SKINNS
chr2_33607748_A_G_b38	RASGRP3	-4.334	1.81e-05	-0.049212	95	0.011354	yes	SKINNS
chr2_33571586_T_C_b38	RASGRP3	-4.334	1.81e-05	-0.050635	102	0.011683	yes	SKINNS
chr2_33512902_A_G_b38	RASGRP3	-4.309	2.02e-05	-0.049623	111	0.011516	yes	SKINNS
chr2_33618669_C_CT_b38	RASGRP3	-4.27	2.39e-05	-0.04899	96	0.011472	yes	SKINNS
chr2_33634843_C_CTT_b38	RASGRP3	4.268	2.41e-05	0.08745	7	0.020489	yes	SKINNS
chr2_33617107_G_A_b38	RASGRP3	-4.242	2.7e-05	-0.04867	94	0.011475	yes	SKINNS
chr2_33618734_A_G_b38	RASGRP3	-4.237	2.75e-05	-0.048719	95	0.011498	yes	SKINNS
chr2_33523846_A_G_b38	RASGRP3	-4.236	2.76e-05	-0.062858	20	0.014839	yes	SKINNS
chr2_33580247_A_G_b38	RASGRP3	-4.229	2.85e-05	-0.049814	111	0.011779	yes	SKINNS
chr2_33613720_G_A_b38	RASGRP3	4.215	3.03e-05	0.070761	13	0.01679	yes	SKINNS
chr2_33530497_CT_C_b38	RASGRP3	4.177	3.56e-05	0.0595	21	0.014245	yes	SKINNS
chr2_33631252_G_T_b38	RASGRP3	4.17	3.65e-05	0.050526	124	0.012115	yes	SKINNS
chr2_33554839_T_C_b38	RASGRP3	4.16	3.82e-05	0.051567	69	0.012396	yes	SKINNS
chr2_33615675_TA_T_b38	RASGRP3	-4.16	3.82e-05	-0.047547	94	0.01143	yes	SKINNS
chr2_33577835_T_C_b38	RASGRP3	-4.135	4.24e-05	-0.048053	113	0.01162	yes	SKINNS
chr2_33575832_C_A_b38	RASGRP3	-4.132	4.3e-05	-0.04804	117	0.011628	yes	SKINNS
chr2_33740099_T_TTTG_b38	RASGRP3	4.118	4.55e-05	0.074634	6	0.018124	yes	SKINNS
chr2_33518880_G_GTCA_b38	RASGRP3	-4.095	5.02e-05	-0.047818	96	0.011677	yes	SKINNS
chr2_33756137_T_C_b38	RASGRP3	4.058	5.84e-05	0.083096	4	0.020475	yes	SKINNS
chr2_33614957_G_A_b38	RASGRP3	-4.057	5.88e-05	-0.046651	92	0.0115	yes	SKINNS
chr2_33625063_ATCT_A_b38	RASGRP3	-4.016	6.94e-05	-0.046852	87	0.011666	yes	SKINNS
chr2_33576389_C_T_b38	RASGRP3	-4.001	7.39e-05	-0.047419	108	0.011853	yes	SKINNS
chr2_33620413_GA_G_b38	RASGRP3	3.979	8.06e-05	0.067679	6	0.017007	yes	SKINNS
chr2_33539996_AAAAAG_A_b38	RASGRP3	-3.877	0.000121	-0.045771	118	0.011804	yes	SKINNS
chr2_33535943_T_C_b38	RASGRP3	-3.865	0.000128	-0.066353	7	0.017168	yes	SKINNS
chr2_33535555_G_GC_b38	RASGRP3	-3.844	0.000139	-0.066292	7	0.017248	yes	SKINNS
chr2_33757669_T_G_b38	RASGRP3	3.833	0.000145	0.07987	3	0.020839	yes	SKINNS
chr2_33536322_GA_G_b38	RASGRP3	-3.803	0.000163	-0.046154	104	0.012136	yes	SKINNS
chr2_33543901_C_G_b38	RASGRP3	-3.797	0.000167	-0.046036	73	0.012126	yes	SKINNS
chr2_33604404_GTA_G_b38	RASGRP3	-3.788	0.000172	-0.048353	49	0.012764	yes	SKINNS
chr2_33784312_G_A_b38	RASGRP3	3.763	0.00019	0.076335	3	0.020284	yes	SKINNS
chr2_33527085_G_T_b38	RASGRP3	-3.754	0.000197	-0.05932	15	0.015803	yes	SKINNS
chr2_33788399_T_C_b38	RASGRP3	3.751	0.000199	0.077784	3	0.020735	yes	SKINNS
chr2_33788450_A_G_b38	RASGRP3	3.751	0.000199	0.077784	3	0.020735	yes	SKINNS
chr2_33741270_T_C_b38	RASGRP3	3.72	0.000224	0.069416	6	0.018658	yes	SKINNS
chr2_33762803_A_G_b38	RASGRP3	3.72	0.000224	0.07674	4	0.020627	yes	SKINNS
chr2_33622456_T_TAAAC_b38	RASGRP3	-3.717	0.000227	-0.042914	96	0.011545	yes	SKINNS
chr2_33525341_AAT_A_b38	RASGRP3	-3.705	0.000238	-0.066016	6	0.017819	yes	SKINNS
chr2_33613986_T_C_b38	RASGRP3	-3.686	0.000256	-0.042562	97	0.011548	yes	SKINNS
chr2_33749611_C_T_b38	RASGRP3	3.662	0.000281	0.069718	5	0.019041	yes	SKINNS
chr2_33751236_C_G_b38	RASGRP3	3.662	0.000281	0.069718	5	0.019041	yes	SKINNS
chr2_33515788_C_T_b38	RASGRP3	-3.527	0.000464	-0.061122	8	0.017331	yes	SKINNS
chr2_33563470_A_ATACT_b38	RASGRP3	-3.521	0.000474	-0.069545	6	0.019752	yes	SKINNS
chr2_33620575_G_A_b38	RASGRP3	3.513	0.000488	0.05232	21	0.014892	yes	SKINNS
chr2_33745369_C_T_b38	RASGRP3	3.508	0.000497	0.066417	5	0.018933	yes	SKINNS
chr2_33625433_A_C_b38	RASGRP3	-3.505	0.000503	-0.040898	89	0.011669	yes	SKINNS
chr2_33620497_T_C_b38	RASGRP3	3.504	0.000505	0.051965	21	0.014832	yes	SKINNS
chr2_33760552_T_G_b38	RASGRP3	3.493	0.000526	0.073361	3	0.021005	yes	SKINNS
chr2_33769652_G_A_b38	RASGRP3	3.493	0.000526	0.073361	3	0.021005	yes	SKINNS
chr2_33534062_A_C_b38	RASGRP3	-3.49	0.000531	-0.060498	6	0.017333	yes	SKINNS
chr2_33543280_C_G_b38	RASGRP3	-3.486	0.000538	-0.061838	6	0.017736	yes	SKINNS
chr2_33533272_T_C_b38	RASGRP3	-3.478	0.000555	-0.05927	8	0.017042	yes	SKINNS
chr2_33663649_A_C_b38	RASGRP3	-3.475	0.00056	-0.038836	126	0.011175	yes	SKINNS
chr2_33781569_AGTGTGT_A_b38	RASGRP3	3.436	0.000645	0.072633	3	0.021136	yes	SKINNS
chr2_33889747_T_G_b38	RASGRP3	3.423	0.000676	0.127225	4	0.037163	yes	SKINNS
chr2_33662442_T_C_b38	RASGRP3	-3.391	0.000759	-0.038926	111	0.01148	yes	SKINNS
chr2_33534328_C_T_b38	RASGRP3	-3.391	0.00076	-0.060355	6	0.017801	yes	SKINNS
chr2_33533388_C_T_b38	RASGRP3	-3.366	0.000829	-0.057722	8	0.017149	yes	SKINNS
chr2_33520141_T_C_b38	RASGRP3	-3.348	0.000884	-0.039316	97	0.011745	yes	SKINNS
chr2_33677515_A_G_b38	RASGRP3	3.31	0.00101	0.055752	11	0.016842	yes	SKINNS
chr2_33661731_A_G_b38	RASGRP3	-3.309	0.00101	-0.036875	124	0.011144	yes	SKINNS
chr2_33659127_A_G_b38	RASGRP3	-3.294	0.00107	-0.036731	124	0.01115	yes	SKINNS
chr2_33664465_T_A_b38	RASGRP3	-3.291	0.00108	-0.037116	119	0.011278	yes	SKINNS
chr2_33538452_G_A_b38	RASGRP3	-3.286	0.0011	-0.058575	6	0.017824	yes	SKINNS
chr2_33467980_TTTTCTTTCTTTC_T_b38	RASGRP3	3.283	0.00111	0.055314	18	0.016851	yes	SKINNS
chr2_33658713_G_A_b38	RASGRP3	-3.279	0.00112	-0.037899	106	0.011559	yes	SKINNS
chr2_33642139_G_T_b38	RASGRP3	3.263	0.00119	0.05336	13	0.016352	yes	SKINNS
chr2_33532968_G_A_b38	RASGRP3	-3.24	0.00128	-0.058339	6	0.018004	yes	SKINNS
chr2_33647765_T_C_b38	RASGRP3	-3.237	0.0013	-0.036887	115	0.011395	yes	SKINNS
chr2_33731949_C_G_b38	RASGRP3	3.236	0.0013	0.062472	5	0.019308	yes	SKINNS
chr2_33732506_C_T_b38	RASGRP3	3.236	0.0013	0.062472	5	0.019308	yes	SKINNS
chr2_33734078_T_A_b38	RASGRP3	3.236	0.0013	0.062472	5	0.019308	yes	SKINNS
chr2_33537323_G_C_b38	RASGRP3	-3.223	0.00136	-0.041242	47	0.012798	yes	SKINNS
chr2_33728254_C_T_b38	RASGRP3	3.216	0.00139	0.061827	5	0.019223	yes	SKINNS
chr2_33534496_G_A_b38	RASGRP3	-3.212	0.00141	-0.057171	6	0.017797	yes	SKINNS
chr2_33538430_G_C_b38	RASGRP3	-3.21	0.00142	-0.05711	6	0.017791	yes	SKINNS
chr2_33622130_C_CA_b38	RASGRP3	3.205	0.00145	0.06633	9	0.020699	yes	SKINNS
chr2_33630364_C_G_b38	RASGRP3	-3.197	0.00149	-0.036878	93	0.011535	yes	SKINNS
chr2_34050036_G_C_b38	RASGRP3	3.182	0.00156	0.11479	5	0.036071	yes	SKINNS
chr2_33661861_G_A_b38	RASGRP3	-3.176	0.0016	-0.035988	113	0.01133	yes	SKINNS
chr2_33664742_G_C_b38	RASGRP3	-3.168	0.00164	-0.03528	127	0.011137	yes	SKINNS
chr2_33655112_A_AT_b38	RASGRP3	-3.162	0.00167	-0.037211	100	0.011768	yes	SKINNS
chr2_33733257_C_T_b38	RASGRP3	3.138	0.00181	0.042766	34	0.013629	yes	SKINNS
chr2_33631637_C_A_b38	RASGRP3	-3.136	0.00183	-0.036016	96	0.011485	yes	SKINNS
chr2_34290168_C_T_b38	RASGRP3	3.108	0.002	0.057623	7	0.018538	yes	SKINNS
chr2_33540553_GTT_G_b38	RASGRP3	3.104	0.00203	0.035144	72	0.011321	yes	SKINNS
chr2_33525080_C_CA_b38	RASGRP3	-3.1	0.00206	-0.054116	7	0.017457	yes	SKINNS
chr2_33632169_T_C_b38	RASGRP3	-3.081	0.00219	-0.035992	88	0.011682	yes	SKINNS
chr2_33548698_A_AATTATT_b38	RASGRP3	-3.075	0.00224	-0.05097	11	0.016577	yes	SKINNS
chr2_33949560_T_G_b38	RASGRP3	-3.072	0.00226	-0.035077	101	0.01142	yes	SKINNS
chr2_34290058_G_T_b38	RASGRP3	3.071	0.00226	0.056664	7	0.018449	yes	SKINNS
chr2_33807273_A_G_b38	RASGRP3	3.044	0.00248	0.065644	6	0.021568	yes	SKINNS
chr2_33664871_G_GT_b38	RASGRP3	-3.032	0.00257	-0.034615	116	0.011418	yes	SKINNS
chr2_33668515_A_G_b38	RASGRP3	-3.028	0.0026	-0.034661	114	0.011446	yes	SKINNS
chr2_33647687_C_CA_b38	RASGRP3	3.016	0.00271	0.044193	32	0.014652	yes	SKINNS
chr2_33658170_A_G_b38	RASGRP3	-3.013	0.00273	-0.03484	108	0.011564	yes	SKINNS
chr2_33638203_CT_C_b38	RASGRP3	3.012	0.00275	0.060826	4	0.020196	yes	SKINNS
chr2_33549383_C_T_b38	RASGRP3	-2.991	0.00293	-0.049678	11	0.016609	yes	SKINNS
chr2_33954910_A_G_b38	RASGRP3	-2.985	0.00299	-0.034178	98	0.011448	yes	SKINNS
chr2_33660983_C_T_b38	RASGRP3	-2.985	0.00299	-0.034705	103	0.011627	yes	SKINNS
chr2_33563038_A_G_b38	RASGRP3	-2.964	0.0032	-0.052294	10	0.017642	yes	SKINNS
chr2_33638135_T_C_b38	RASGRP3	2.955	0.00329	0.059533	3	0.020145	yes	SKINNS
chr2_33631185_T_G_b38	RASGRP3	-2.954	0.0033	-0.033885	123	0.01147	yes	SKINNS
chr2_33631863_T_C_b38	RASGRP3	-2.937	0.00349	-0.033646	124	0.011457	yes	SKINNS
chr2_33550598_T_G_b38	RASGRP3	-2.925	0.00362	-0.048817	11	0.016692	yes	SKINNS
chr2_33655774_A_G_b38	RASGRP3	-2.922	0.00366	-0.033231	116	0.011374	yes	SKINNS
chr2_33917976_C_A_b38	RASGRP3	-2.918	0.0037	-0.033221	109	0.011384	yes	SKINNS
chr2_33955147_A_T_b38	RASGRP3	-2.918	0.0037	-0.033412	98	0.01145	yes	SKINNS
chr2_33955316_C_T_b38	RASGRP3	-2.918	0.0037	-0.033412	98	0.01145	yes	SKINNS
chr2_33749116_T_A_b38	RASGRP3	2.897	0.00396	0.036518	63	0.012607	yes	SKINNS
chr2_33601956_TA_T_b38	RASGRP3	2.89	0.00403	0.035766	122	0.012374	yes	SKINNS
chr2_33954496_C_T_b38	RASGRP3	-2.89	0.00404	-0.033186	98	0.011481	yes	SKINNS
chr2_33955496_G_A_b38	RASGRP3	-2.89	0.00404	-0.033186	98	0.011481	yes	SKINNS
chr2_33954694_A_G_b38	RASGRP3	-2.885	0.0041	-0.0329	98	0.011404	yes	SKINNS
chr2_33658757_C_A_b38	RASGRP3	-2.876	0.00422	-0.033599	99	0.011682	yes	SKINNS
chr2_33228066_A_G_b38	RASGRP3	2.876	0.00422	0.089605	4	0.031154	yes	SKINNS
chr2_34294381_C_T_b38	RASGRP3	2.87	0.0043	0.051311	12	0.017879	yes	SKINNS
chr2_33952197_A_G_b38	RASGRP3	-2.869	0.00431	-0.032963	97	0.011488	yes	SKINNS
chr2_33952705_C_T_b38	RASGRP3	-2.869	0.00431	-0.032963	97	0.011488	yes	SKINNS
chr2_33953102_A_C_b38	RASGRP3	-2.869	0.00431	-0.032963	97	0.011488	yes	SKINNS
chr2_33953421_A_G_b38	RASGRP3	-2.869	0.00431	-0.032963	97	0.011488	yes	SKINNS
chr2_33953447_A_G_b38	RASGRP3	-2.869	0.00431	-0.032963	97	0.011488	yes	SKINNS
chr2_33953687_T_C_b38	RASGRP3	-2.869	0.00431	-0.032963	97	0.011488	yes	SKINNS
chr2_33953764_A_G_b38	RASGRP3	-2.869	0.00431	-0.032963	97	0.011488	yes	SKINNS
chr2_33897929_A_C_b38	RASGRP3	-2.864	0.00438	-0.033948	89	0.011854	yes	SKINNS
chr2_33378185_A_G_b38	RASGRP3	-2.863	0.00439	-0.04995	5	0.017444	yes	SKINNS
chr2_33666591_A_G_b38	RASGRP3	-2.845	0.00465	-0.031743	130	0.011158	yes	SKINNS
chr2_33103626_TGA_T_b38	RASGRP3	2.842	0.00469	0.044477	11	0.015652	yes	SKINNS
chr2_33954257_T_C_b38	RASGRP3	-2.842	0.00469	-0.032738	97	0.011521	yes	SKINNS
chr2_33669621_C_T_b38	RASGRP3	-2.837	0.00476	-0.032532	91	0.011468	yes	SKINNS
chr2_33669751_C_T_b38	RASGRP3	-2.837	0.00476	-0.032532	91	0.011468	yes	SKINNS
chr2_32921523_C_CTTTTTT_b38	RASGRP3	-2.836	0.00477	-0.102429	3	0.036115	yes	SKINNS
chr2_33952180_A_G_b38	RASGRP3	-2.835	0.00479	-0.032877	95	0.011598	yes	SKINNS
chr2_33477835_C_T_b38	RASGRP3	2.83	0.00487	0.040776	20	0.01441	yes	SKINNS
chr2_33960268_C_A_b38	RASGRP3	-2.813	0.00513	-0.032809	98	0.011664	yes	SKINNS
chr2_33897591_C_T_b38	RASGRP3	-2.81	0.00517	-0.034788	69	0.01238	yes	SKINNS
chr2_33920059_TG_T_b38	RASGRP3	-2.807	0.00522	-0.031968	109	0.011387	yes	SKINNS
chr2_33551040_C_T_b38	RASGRP3	-2.807	0.00523	-0.046332	11	0.016509	yes	SKINNS
chr2_33670200_G_T_b38	RASGRP3	-2.804	0.00526	-0.03211	91	0.011451	yes	SKINNS
chr2_33958535_TGTGA_T_b38	RASGRP3	-2.797	0.00538	-0.045389	9	0.016226	yes	SKINNS
chr2_33653281_C_CCTGT_b38	RASGRP3	2.797	0.00539	0.043037	18	0.015389	yes	SKINNS
chr2_33561322_C_T_b38	RASGRP3	-2.79	0.00549	-0.04713	10	0.016892	yes	SKINNS
chr2_33860541_C_T_b38	RASGRP3	-2.79	0.0055	-0.050059	9	0.017945	yes	SKINNS
chr2_34251141_C_A_b38	RASGRP3	-2.785	0.00557	-0.063951	3	0.022959	yes	SKINNS
chr2_33651073_T_C_b38	RASGRP3	2.782	0.00563	0.037446	32	0.013458	yes	SKINNS
chr2_33550119_G_T_b38	RASGRP3	-2.778	0.0057	-0.046204	11	0.016632	yes	SKINNS
chr2_33960495_C_G_b38	RASGRP3	-2.767	0.00589	-0.03233	97	0.011683	yes	SKINNS
chr2_33637426_T_A_b38	RASGRP3	2.76	0.00602	0.04257	19	0.015425	yes	SKINNS
chr2_33959447_GT_G_b38	RASGRP3	-2.757	0.00608	-0.032207	97	0.011683	yes	SKINNS
chr2_33959937_G_A_b38	RASGRP3	-2.757	0.00608	-0.032207	97	0.011683	yes	SKINNS
chr2_33960001_C_G_b38	RASGRP3	-2.757	0.00608	-0.032207	97	0.011683	yes	SKINNS
chr2_33960038_A_T_b38	RASGRP3	-2.757	0.00608	-0.032207	97	0.011683	yes	SKINNS
chr2_33960694_G_T_b38	RASGRP3	-2.754	0.00613	-0.032151	97	0.011674	yes	SKINNS
chr2_33960700_C_CT_b38	RASGRP3	-2.754	0.00613	-0.032151	97	0.011674	yes	SKINNS
chr2_33960088_C_T_b38	RASGRP3	-2.744	0.00631	-0.032057	97	0.011682	yes	SKINNS
chr2_33960232_A_G_b38	RASGRP3	-2.744	0.00631	-0.032057	97	0.011682	yes	SKINNS
chr2_33960593_C_T_b38	RASGRP3	-2.744	0.00631	-0.032057	97	0.011682	yes	SKINNS
chr2_33934995_T_G_b38	RASGRP3	-2.739	0.00641	-0.043712	11	0.015959	yes	SKINNS
chr2_33629657_C_CT_b38	RASGRP3	2.736	0.00646	0.042566	19	0.015556	yes	SKINNS
chr2_33901656_G_A_b38	RASGRP3	-2.729	0.00661	-0.032135	93	0.011777	yes	SKINNS
chr2_33934608_G_A_b38	RASGRP3	-2.723	0.00672	-0.043381	12	0.015931	yes	SKINNS
chr2_33553788_G_A_b38	RASGRP3	-2.711	0.00697	-0.045307	11	0.016714	yes	SKINNS
chr2_33556856_G_C_b38	RASGRP3	-2.711	0.00697	-0.045307	11	0.016714	yes	SKINNS
chr2_34282459_T_G_b38	RASGRP3	2.702	0.00716	0.049858	8	0.018453	yes	SKINNS
chr2_34283106_CA_C_b38	RASGRP3	2.702	0.00716	0.049858	8	0.018453	yes	SKINNS
chr2_34284263_C_T_b38	RASGRP3	2.702	0.00716	0.049858	8	0.018453	yes	SKINNS
chr2_33546473_C_T_b38	RASGRP3	-2.698	0.00723	-0.044709	11	0.016569	yes	SKINNS
chr2_33960391_ATCTG_A_b38	RASGRP3	-2.696	0.00729	-0.031532	97	0.011698	yes	SKINNS
chr2_34416408_A_G_b38	RASGRP3	2.69	0.0074	0.116262	4	0.043212	yes	SKINNS
chr2_33545200_T_C_b38	RASGRP3	-2.685	0.00753	-0.044725	11	0.016659	yes	SKINNS
chr2_33867079_T_A_b38	RASGRP3	-2.68	0.00763	-0.049901	6	0.01862	yes	SKINNS
chr2_33926793_T_G_b38	RASGRP3	-2.678	0.00767	-0.030662	110	0.011449	yes	SKINNS
chr2_34280727_T_A_b38	RASGRP3	2.676	0.00773	0.048092	12	0.017973	yes	SKINNS
chr2_34283937_G_A_b38	RASGRP3	2.668	0.00791	0.049005	8	0.018368	yes	SKINNS
chr2_34284139_C_T_b38	RASGRP3	2.668	0.00791	0.049005	8	0.018368	yes	SKINNS
chr2_33678762_C_CACTT_b38	RASGRP3	-2.666	0.00796	-0.030778	111	0.011545	yes	SKINNS
chr2_33669785_CA_C_b38	RASGRP3	-2.665	0.00797	-0.031441	82	0.011797	yes	SKINNS
chr2_33860724_C_G_b38	RASGRP3	-2.663	0.00802	-0.046844	10	0.017589	yes	SKINNS
chr2_33960306_G_C_b38	RASGRP3	-2.648	0.00839	-0.030865	98	0.011658	yes	SKINNS
chr2_33960330_A_T_b38	RASGRP3	-2.648	0.00839	-0.030865	98	0.011658	yes	SKINNS
chr2_32973568_G_C_b38	RASGRP3	2.642	0.00853	0.032556	68	0.012322	yes	SKINNS
chr2_33958155_GACACAC_G_b38	RASGRP3	-2.638	0.00863	-0.04811	7	0.018236	yes	SKINNS
chr2_33731863_C_CCTTTCCTTAACTTCAGGACATACTGGGTTCCAGTATGTCCTTAA_b38	RASGRP3	2.626	0.00893	0.056744	5	0.021605	yes	SKINNS
chr2_33552026_CA_C_b38	RASGRP3	-2.625	0.00897	-0.053953	5	0.020554	yes	SKINNS
chr2_33960356_C_T_b38	RASGRP3	-2.624	0.009	-0.030304	101	0.011551	yes	SKINNS
chr2_33940926_G_A_b38	RASGRP3	-2.623	0.00901	-0.042184	11	0.016082	yes	SKINNS
chr2_33960441_A_G_b38	RASGRP3	-2.623	0.00902	-0.030588	98	0.011662	yes	SKINNS
chr2_33792413_CAGG_C_b38	RASGRP3	2.62	0.00909	0.051448	5	0.019636	yes	SKINNS
chr2_33546347_C_G_b38	RASGRP3	-2.617	0.00918	-0.043011	12	0.016437	yes	SKINNS
chr2_34285037_A_T_b38	RASGRP3	2.616	0.0092	0.046714	11	0.017856	yes	SKINNS
chr2_34285126_C_T_b38	RASGRP3	2.611	0.00933	0.048421	9	0.018545	yes	SKINNS
chr2_33648791_T_A_b38	RASGRP3	2.607	0.00944	0.035202	32	0.013503	yes	SKINNS
chr2_34372015_C_A_b38	RASGRP3	2.605	0.00951	0.10896	4	0.041835	yes	SKINNS
chr2_34376264_T_C_b38	RASGRP3	2.605	0.00951	0.10896	4	0.041835	yes	SKINNS
chr2_34378838_C_A_b38	RASGRP3	2.605	0.00951	0.10896	4	0.041835	yes	SKINNS
chr2_34379593_T_C_b38	RASGRP3	2.605	0.00951	0.10896	4	0.041835	yes	SKINNS
chr2_34388036_A_C_b38	RASGRP3	2.605	0.00951	0.10896	4	0.041835	yes	SKINNS
chr2_34388968_A_C_b38	RASGRP3	2.605	0.00951	0.10896	4	0.041835	yes	SKINNS
chr2_33004447_A_G_b38	RASGRP3	2.603	0.00956	0.032744	58	0.012581	yes	SKINNS
chr2_33005867_G_A_b38	RASGRP3	2.603	0.00956	0.032744	58	0.012581	yes	SKINNS
chr2_33655786_T_C_b38	RASGRP3	-2.597	0.0097	-0.029833	109	0.011486	yes	SKINNS
chr2_33537896_A_G_b38	RASGRP3	16.353	1.96e-47	0.238105	6	0.01456	no	SKINNS
chr2_33557635_G_A_b38	RASGRP3	15.812	4.95e-45	0.230446	7	0.014574	no	SKINNS
chr2_33559734_G_A_b38	RASGRP3	15.639	2.86e-44	0.229086	7	0.014648	no	SKINNS
chr2_33557844_G_A_b38	RASGRP3	15.55	7.09e-44	0.21821	10	0.014033	no	SKINNS
chr2_33559304_G_A_b38	RASGRP3	15.513	1.03e-43	0.228348	7	0.01472	no	SKINNS
chr2_33529269_C_A_b38	RASGRP3	15.217	2.04e-42	0.218646	9	0.014369	no	SKINNS
chr2_33559068_A_G_b38	RASGRP3	15.163	3.52e-42	0.228836	6	0.015092	no	SKINNS
chr2_33531453_C_T_b38	RASGRP3	15.033	1.29e-41	0.218554	9	0.014538	no	SKINNS
chr2_33536526_G_A_b38	RASGRP3	14.872	6.45e-41	0.238405	4	0.01603	no	SKINNS
chr2_33536528_G_A_b38	RASGRP3	14.872	6.45e-41	0.238405	4	0.01603	no	SKINNS
chr2_33526597_C_T_b38	RASGRP3	14.575	1.24e-39	0.216259	8	0.014837	no	SKINNS
chr2_33527062_GC_G_b38	RASGRP3	14.575	1.24e-39	0.216259	8	0.014837	no	SKINNS
chr2_33537330_C_CCCAACACA_b38	RASGRP3	14.244	3.27e-38	0.180354	29	0.012662	no	SKINNS
chr2_33554542_A_G_b38	RASGRP3	13.74	4.52e-36	0.216831	7	0.015781	no	SKINNS
chr2_33537192_G_GAT_b38	RASGRP3	13.735	4.71e-36	0.203319	7	0.014802	no	SKINNS
chr2_33550216_T_A_b38	RASGRP3	13.607	1.63e-35	0.213677	7	0.015703	no	SKINNS
chr2_33551676_A_G_b38	RASGRP3	13.555	2.7e-35	0.217524	6	0.016048	no	SKINNS
chr2_33551697_A_T_b38	RASGRP3	13.555	2.7e-35	0.217524	6	0.016048	no	SKINNS
chr2_33552022_CAAACA_C_b38	RASGRP3	13.546	2.93e-35	0.214678	7	0.015848	no	SKINNS
chr2_33548469_T_C_b38	RASGRP3	13.529	3.48e-35	0.213728	7	0.015798	no	SKINNS
chr2_33550484_C_G_b38	RASGRP3	13.529	3.48e-35	0.213728	7	0.015798	no	SKINNS
chr2_33553995_C_T_b38	RASGRP3	13.406	1.13e-34	0.211064	8	0.015744	no	SKINNS
chr2_33540561_TGTGTGTGTGTG_T_b38	RASGRP3	12.923	1.14e-32	0.202173	10	0.015645	no	SKINNS
chr2_33539987_GAAAAA_G_b38	RASGRP3	12.575	2.99e-31	0.232025	3	0.018451	no	SKINNS
chr2_33548762_A_G_b38	RASGRP3	12.511	5.42e-31	0.208569	6	0.016671	no	SKINNS
chr2_33512177_G_A_b38	RASGRP3	12.501	5.96e-31	0.169914	19	0.013592	no	SKINNS
chr2_33546942_C_G_b38	RASGRP3	11.879	1.83e-28	0.189376	9	0.015942	no	SKINNS
chr2_33586869_A_T_b38	RASGRP3	9.758	1.62e-20	0.130176	27	0.01334	no	SKINNS
chr2_33556928_C_CACACACATACAT_b38	RASGRP3	8.923	1.18e-17	0.146912	6	0.016464	no	SKINNS
chr2_33594326_C_T_b38	RASGRP3	8.911	1.3e-17	0.117823	33	0.013222	no	SKINNS
chr2_33594385_G_A_b38	RASGRP3	8.911	1.3e-17	0.117823	33	0.013222	no	SKINNS
chr2_33596617_C_T_b38	RASGRP3	8.894	1.48e-17	0.11782	33	0.013247	no	SKINNS
chr2_33536322_G_GA_b38	RASGRP3	8.711	5.94e-17	0.140695	15	0.016152	no	SKINNS
chr2_33547053_GAA_G_b38	RASGRP3	8.683	7.32e-17	0.192869	4	0.022212	no	SKINNS
chr2_33592302_T_C_b38	RASGRP3	7.863	2.86e-14	0.179087	5	0.022777	no	SKINNS
chr2_33511010_G_A_b38	RASGRP3	7.826	3.7e-14	0.141438	10	0.018074	no	SKINNS
chr2_33579727_C_T_b38	RASGRP3	7.595	1.82e-13	0.180547	4	0.023772	no	SKINNS
chr2_33523461_TA_T_b38	RASGRP3	7.444	5.09e-13	0.110177	13	0.014801	no	SKINNS
chr2_33573675_A_G_b38	RASGRP3	6.822	2.94e-11	0.171924	3	0.025202	no	SKINNS
chr2_33565010_T_TACACACAC_b38	RASGRP3	6.589	1.25e-10	0.151717	3	0.023027	no	SKINNS
chr2_33611855_A_C_b38	RASGRP3	5.997	4.15e-09	0.098159	12	0.016367	no	SKINNS
chr2_33508487_T_C_b38	RASGRP3	5.527	5.55e-08	0.10305	13	0.018645	no	SKINNS
chr2_33606727_T_C_b38	RASGRP3	5.456	8.1e-08	0.106322	3	0.019488	no	SKINNS
chr2_33605847_C_CT_b38	RASGRP3	5.415	1e-07	0.100397	4	0.01854	no	SKINNS
chr2_33603617_TC_T_b38	RASGRP3	5.248	2.38e-07	0.087985	11	0.016765	no	SKINNS
chr2_33603907_A_C_b38	RASGRP3	5.213	2.85e-07	0.08783	11	0.016848	no	SKINNS
chr2_33615793_A_T_b38	RASGRP3	5.145	4.03e-07	0.0931	6	0.018097	no	SKINNS
chr2_33547458_G_A_b38	RASGRP3	5.024	7.34e-07	0.061905	63	0.012322	no	SKINNS
chr2_33602942_T_C_b38	RASGRP3	4.917	1.24e-06	0.0935	4	0.019015	no	SKINNS
chr2_33565010_T_TACACACACAC_b38	RASGRP3	4.907	1.3e-06	0.097656	3	0.0199	no	SKINNS
chr2_33591195_C_CT_b38	RASGRP3	-4.486	9.22e-06	-0.058552	68	0.013051	no	SKINNS
chr2_33577495_T_TA_b38	RASGRP3	4.465	1.02e-05	0.084501	5	0.018927	no	SKINNS
chr2_33567211_TA_T_b38	RASGRP3	-4.277	2.32e-05	-0.05495	69	0.012848	no	SKINNS
chr2_33772378_C_T_b38	RASGRP3	4.211	3.08e-05	0.075861	7	0.018016	no	SKINNS
chr2_33546340_A_G_b38	RASGRP3	4.211	3.08e-05	0.058601	24	0.013918	no	SKINNS
chr2_33633545_T_G_b38	RASGRP3	4.206	3.15e-05	0.079771	5	0.018968	no	SKINNS
chr2_33530930_T_C_b38	RASGRP3	4.178	3.54e-05	0.058144	24	0.013918	no	SKINNS
chr2_33517217_G_A_b38	RASGRP3	4.107	4.77e-05	0.055934	27	0.013619	no	SKINNS
chr2_33522218_G_A_b38	RASGRP3	4.095	5.02e-05	0.057232	23	0.013976	no	SKINNS
chr2_33545793_CTAT_C_b38	RASGRP3	4.07	5.56e-05	0.056095	26	0.013783	no	SKINNS
chr2_33771916_C_T_b38	RASGRP3	4.051	6.01e-05	0.067944	21	0.016771	no	SKINNS
chr2_33771954_G_T_b38	RASGRP3	4.051	6.01e-05	0.067944	21	0.016771	no	SKINNS
chr2_33545661_T_C_b38	RASGRP3	4.003	7.32e-05	0.056667	22	0.014156	no	SKINNS
chr2_33515662_T_C_b38	RASGRP3	3.992	7.65e-05	0.06008	18	0.015049	no	SKINNS
chr2_33770718_A_C_b38	RASGRP3	3.95	9.09e-05	0.051987	46	0.013162	no	SKINNS
chr2_33771705_T_C_b38	RASGRP3	3.938	9.53e-05	0.051987	44	0.013201	no	SKINNS
chr2_33771305_A_ATGTC_b38	RASGRP3	3.932	9.78e-05	0.051874	45	0.013194	no	SKINNS
chr2_33771282_C_A_b38	RASGRP3	3.893	0.000114	0.051481	45	0.013224	no	SKINNS
chr2_33771310_T_TGTG_b38	RASGRP3	3.893	0.000114	0.051481	45	0.013224	no	SKINNS
chr2_33749131_A_G_b38	RASGRP3	3.878	0.000121	0.072252	8	0.01863	no	SKINNS
chr2_33518738_C_T_b38	RASGRP3	3.876	0.000122	0.053126	26	0.013708	no	SKINNS
chr2_33770196_A_G_b38	RASGRP3	3.875	0.000123	0.051004	45	0.013162	no	SKINNS
chr2_33770292_G_C_b38	RASGRP3	3.875	0.000123	0.051004	45	0.013162	no	SKINNS
chr2_33770343_T_G_b38	RASGRP3	3.875	0.000123	0.051004	45	0.013162	no	SKINNS
chr2_33770360_T_C_b38	RASGRP3	3.875	0.000123	0.051004	45	0.013162	no	SKINNS
chr2_33770545_C_T_b38	RASGRP3	3.875	0.000123	0.051004	45	0.013162	no	SKINNS
chr2_33509815_G_A_b38	RASGRP3	3.867	0.000127	0.053323	25	0.013789	no	SKINNS
chr2_33771715_A_G_b38	RASGRP3	3.835	0.000143	0.05051	44	0.01317	no	SKINNS
chr2_33771716_AATTG_A_b38	RASGRP3	3.835	0.000143	0.05051	44	0.01317	no	SKINNS
chr2_33787907_A_G_b38	RASGRP3	3.834	0.000144	0.066651	17	0.017382	no	SKINNS
chr2_33539650_C_T_b38	RASGRP3	3.799	0.000165	0.052925	24	0.01393	no	SKINNS
chr2_33539888_A_T_b38	RASGRP3	3.799	0.000165	0.052925	24	0.01393	no	SKINNS
chr2_33514230_T_G_b38	RASGRP3	3.794	0.000169	0.054141	23	0.014272	no	SKINNS
chr2_33521739_T_A_b38	RASGRP3	3.789	0.000172	0.05324	23	0.014052	no	SKINNS
chr2_33522498_A_G_b38	RASGRP3	3.773	0.000183	0.053281	23	0.01412	no	SKINNS
chr2_33520269_T_C_b38	RASGRP3	3.756	0.000196	0.053493	21	0.014244	no	SKINNS
chr2_33706678_T_C_b38	RASGRP3	3.715	0.000229	0.073904	3	0.019896	no	SKINNS
chr2_33771977_TC_T_b38	RASGRP3	3.679	0.000263	0.06295	18	0.017112	no	SKINNS
chr2_33770624_C_T_b38	RASGRP3	3.655	0.000288	0.048005	46	0.013133	no	SKINNS
chr2_33770852_A_G_b38	RASGRP3	3.655	0.000288	0.048005	46	0.013133	no	SKINNS
chr2_33770953_C_T_b38	RASGRP3	3.655	0.000288	0.048005	46	0.013133	no	SKINNS
chr2_33562267_C_CT_b38	RASGRP3	3.652	0.000291	0.041784	95	0.011441	no	SKINNS
chr2_33511214_C_T_b38	RASGRP3	3.627	0.00032	0.047919	34	0.013213	no	SKINNS
chr2_33771480_T_C_b38	RASGRP3	3.622	0.000325	0.047651	45	0.013154	no	SKINNS
chr2_33562993_CTT_C_b38	RASGRP3	3.592	0.000365	0.053083	18	0.01478	no	SKINNS
chr2_34355904_A_G_b38	RASGRP3	3.563	0.000407	0.144666	3	0.040607	no	SKINNS
chr2_33771740_G_T_b38	RASGRP3	3.541	0.00044	0.046519	44	0.013136	no	SKINNS
chr2_33525699_C_CAA_b38	RASGRP3	3.537	0.000447	0.085411	11	0.024146	no	SKINNS
chr2_33899374_TTA_T_b38	RASGRP3	3.5	0.000511	0.039516	110	0.011289	no	SKINNS
chr2_33529261_A_G_b38	RASGRP3	3.481	0.000549	0.050441	20	0.01449	no	SKINNS
chr2_33890776_C_T_b38	RASGRP3	3.475	0.000562	0.136995	3	0.039427	no	SKINNS
chr2_33531341_C_A_b38	RASGRP3	3.474	0.000562	0.047625	25	0.013707	no	SKINNS
chr2_33931822_T_C_b38	RASGRP3	-3.448	0.000618	-0.058494	9	0.016964	no	SKINNS
chr2_33753914_G_T_b38	RASGRP3	3.44	0.000636	0.057567	16	0.016735	no	SKINNS
chr2_33535209_G_A_b38	RASGRP3	3.417	0.000692	0.04678	25	0.013692	no	SKINNS
chr2_33596331_G_C_b38	RASGRP3	3.398	0.00074	0.05049	16	0.01486	no	SKINNS
chr2_33771584_G_A_b38	RASGRP3	3.382	0.000783	0.044854	44	0.013263	no	SKINNS
chr2_33641120_T_C_b38	RASGRP3	-3.372	0.000811	-0.038546	111	0.011431	no	SKINNS
chr2_33726667_C_G_b38	RASGRP3	3.327	0.00095	0.055327	10	0.016629	no	SKINNS
chr2_34047405_C_T_b38	RASGRP3	3.324	0.000961	0.119038	5	0.035814	no	SKINNS
chr2_33771507_G_A_b38	RASGRP3	3.305	0.00103	0.043303	45	0.013101	no	SKINNS
chr2_33226389_G_C_b38	RASGRP3	3.299	0.00105	0.095091	5	0.028821	no	SKINNS
chr2_33541741_G_T_b38	RASGRP3	-3.286	0.00109	-0.034872	134	0.010611	no	SKINNS
chr2_33914412_A_T_b38	RASGRP3	-3.273	0.00115	-0.039672	80	0.012119	no	SKINNS
chr2_33406365_A_C_b38	RASGRP3	-3.27	0.00116	-0.072274	4	0.022102	no	SKINNS
chr2_33912465_C_T_b38	RASGRP3	-3.21	0.00142	-0.038868	80	0.012109	no	SKINNS
chr2_33910077_G_A_b38	RASGRP3	-3.203	0.00146	-0.038551	81	0.012037	no	SKINNS
chr2_33899837_T_A_b38	RASGRP3	-3.173	0.00161	-0.038753	81	0.012213	no	SKINNS
chr2_33539533_G_T_b38	RASGRP3	-3.171	0.00163	-0.033447	136	0.010549	no	SKINNS
chr2_33749290_G_T_b38	RASGRP3	3.151	0.00174	0.065232	3	0.020705	no	SKINNS
chr2_33792244_T_C_b38	RASGRP3	3.149	0.00175	0.098304	5	0.031213	no	SKINNS
chr2_33540615_TTCTC_T_b38	RASGRP3	-3.146	0.00177	-0.035663	104	0.011337	no	SKINNS
chr2_33476758_C_CGTGCGTGTGT_b38	RASGRP3	3.127	0.00188	0.058033	6	0.018557	no	SKINNS
chr2_33960560_T_C_b38	RASGRP3	-3.125	0.0019	-0.036539	125	0.011694	no	SKINNS
chr2_33872912_A_C_b38	RASGRP3	3.122	0.00192	0.110446	5	0.035381	no	SKINNS
chr2_34354488_G_A_b38	RASGRP3	3.121	0.00192	0.096567	7	0.030942	no	SKINNS
chr2_33551613_T_G_b38	RASGRP3	3.116	0.00195	0.044236	21	0.014198	no	SKINNS
chr2_33925280_G_A_b38	RASGRP3	-3.114	0.00196	-0.037252	83	0.011961	no	SKINNS
chr2_33566560_TA_T_b38	RASGRP3	3.1	0.00206	0.045352	17	0.014629	no	SKINNS
chr2_33568692_C_G_b38	RASGRP3	3.09	0.00213	0.045728	16	0.014799	no	SKINNS
chr2_33900745_G_C_b38	RASGRP3	-3.077	0.00222	-0.037635	81	0.012233	no	SKINNS
chr2_33900948_C_G_b38	RASGRP3	-3.077	0.00222	-0.037635	81	0.012233	no	SKINNS
chr2_34385286_G_T_b38	RASGRP3	3.075	0.00224	0.133252	4	0.04334	no	SKINNS
chr2_33582793_C_G_b38	RASGRP3	3.072	0.00226	0.037964	55	0.012359	no	SKINNS
chr2_34368823_G_T_b38	RASGRP3	3.065	0.00231	0.094337	6	0.030783	no	SKINNS
chr2_33540888_T_C_b38	RASGRP3	-3.057	0.00237	-0.032262	134	0.010553	no	SKINNS
chr2_33892472_C_G_b38	RASGRP3	3.054	0.0024	0.107101	6	0.035075	no	SKINNS
chr2_33895097_A_AGCCAAAACCC_b38	RASGRP3	3.053	0.0024	0.105573	7	0.034575	no	SKINNS
chr2_32446738_G_GTTT_b38	RASGRP3	-3.053	0.0024	-0.071725	13	0.023492	no	SKINNS
chr2_33557710_G_GA_b38	RASGRP3	-3.052	0.00241	-0.06355	3	0.020819	no	SKINNS
chr2_33873157_C_T_b38	RASGRP3	-3.046	0.00246	-0.055073	7	0.018081	no	SKINNS
chr2_33874391_T_A_b38	RASGRP3	-3.046	0.00246	-0.055073	7	0.018081	no	SKINNS
chr2_33874392_C_A_b38	RASGRP3	-3.046	0.00246	-0.055073	7	0.018081	no	SKINNS
chr2_33405626_G_C_b38	RASGRP3	-3.036	0.00254	-0.071505	3	0.023556	no	SKINNS
chr2_33598472_A_C_b38	RASGRP3	3.029	0.0026	0.039568	37	0.013064	no	SKINNS
chr2_33896167_T_A_b38	RASGRP3	3.018	0.00269	0.106187	6	0.03518	no	SKINNS
chr2_33225551_T_C_b38	RASGRP3	3.009	0.00277	0.085134	6	0.028289	no	SKINNS
chr2_33225956_C_T_b38	RASGRP3	3.009	0.00277	0.085134	6	0.028289	no	SKINNS
chr2_33226509_G_C_b38	RASGRP3	3.009	0.00277	0.085134	6	0.028289	no	SKINNS
chr2_33563089_C_T_b38	RASGRP3	3.002	0.00283	0.039495	35	0.013156	no	SKINNS
chr2_33720623_ATGCGATT_A_b38	RASGRP3	2.999	0.00286	0.051364	9	0.017127	no	SKINNS
chr2_33940879_G_A_b38	RASGRP3	-2.998	0.00287	-0.034444	116	0.01149	no	SKINNS
chr2_33934050_C_G_b38	RASGRP3	-2.98	0.00304	-0.033825	120	0.011349	no	SKINNS
chr2_33605964_T_C_b38	RASGRP3	2.975	0.00309	0.044734	15	0.015037	no	SKINNS
chr2_33903655_C_T_b38	RASGRP3	-2.954	0.00331	-0.036049	81	0.012205	no	SKINNS
chr2_33975903_A_ATT_b38	RASGRP3	-2.925	0.00362	-0.032227	105	0.011017	no	SKINNS
chr2_33630302_AT_A_b38	RASGRP3	-2.896	0.00397	-0.036506	90	0.012607	no	SKINNS
chr2_33535944_C_T_b38	RASGRP3	2.895	0.00398	0.037468	38	0.012942	no	SKINNS
chr2_33905157_G_A_b38	RASGRP3	-2.89	0.00404	-0.035329	81	0.012225	no	SKINNS
chr2_33531421_G_A_b38	RASGRP3	-2.886	0.00409	-0.064465	3	0.022336	no	SKINNS
chr2_33734734_G_A_b38	RASGRP3	2.885	0.0041	0.059397	3	0.020585	no	SKINNS
chr2_34394027_C_A_b38	RASGRP3	2.883	0.00413	0.128067	4	0.04442	no	SKINNS
chr2_33933541_CTCCTTCCTTCCTTCCTTCCTTCCTTCCTTCCT_C_b38	RASGRP3	-2.88	0.00417	-0.046909	13	0.016288	no	SKINNS
chr2_33949028_GT_G_b38	RASGRP3	-2.88	0.00417	-0.034205	83	0.011877	no	SKINNS
chr2_33899714_T_C_b38	RASGRP3	2.876	0.00422	0.032848	109	0.011421	no	SKINNS
chr2_33738746_A_C_b38	RASGRP3	2.869	0.00431	0.048285	7	0.016828	no	SKINNS
chr2_33887090_C_T_b38	RASGRP3	-2.852	0.00455	-0.05081	7	0.017817	no	SKINNS
chr2_33772629_T_A_b38	RASGRP3	2.828	0.0049	0.091712	5	0.032433	no	SKINNS
chr2_33914529_T_G_b38	RASGRP3	-2.819	0.00502	-0.033964	79	0.012046	no	SKINNS
chr2_33592814_T_C_b38	RASGRP3	2.816	0.00507	0.037051	37	0.013156	no	SKINNS
chr2_33380424_C_CA_b38	RASGRP3	-2.8	0.00534	-0.05662	6	0.020224	no	SKINNS
chr2_33764518_G_GT_b38	RASGRP3	2.798	0.00537	0.072743	3	0.026001	no	SKINNS
chr2_33006381_CTTT_C_b38	RASGRP3	2.79	0.0055	0.042089	18	0.015085	no	SKINNS
chr2_32943954_TTTG_T_b38	RASGRP3	2.784	0.00559	0.09201	4	0.033047	no	SKINNS
chr2_33721079_C_CGT_b38	RASGRP3	2.781	0.00565	0.048031	9	0.01727	no	SKINNS
chr2_33214400_G_T_b38	RASGRP3	2.777	0.00573	0.06456	5	0.023252	no	SKINNS
chr2_34043067_CTTTTTCTTTT_C_b38	RASGRP3	-2.776	0.00573	-0.037864	48	0.013639	no	SKINNS
chr2_34354534_A_C_b38	RASGRP3	2.772	0.0058	0.08308	7	0.02997	no	SKINNS
chr2_33400702_G_A_b38	RASGRP3	-2.764	0.00594	-0.064154	4	0.023207	no	SKINNS
chr2_33629533_C_G_b38	RASGRP3	2.762	0.00598	0.047136	11	0.017067	no	SKINNS
chr2_33883688_C_G_b38	RASGRP3	-2.758	0.00606	-0.049117	7	0.01781	no	SKINNS
chr2_33886680_T_C_b38	RASGRP3	-2.758	0.00606	-0.049117	7	0.01781	no	SKINNS
chr2_33642130_G_T_b38	RASGRP3	2.757	0.00607	0.030457	112	0.011046	no	SKINNS
chr2_33896328_C_T_b38	RASGRP3	-2.756	0.00609	-0.050385	6	0.018282	no	SKINNS
chr2_34426074_A_G_b38	RASGRP3	2.748	0.00623	0.115859	4	0.042157	no	SKINNS
chr2_33812290_G_T_b38	RASGRP3	-2.745	0.0063	-0.050859	6	0.01853	no	SKINNS
chr2_33563203_CTTGTT_C_b38	RASGRP3	2.735	0.00649	0.035518	42	0.012988	no	SKINNS
chr2_33896941_G_C_b38	RASGRP3	-2.731	0.00656	-0.049219	7	0.018019	no	SKINNS
chr2_33591518_C_T_b38	RASGRP3	2.727	0.00664	0.035741	38	0.013105	no	SKINNS
chr2_33212016_T_A_b38	RASGRP3	2.72	0.00678	0.082026	3	0.030153	no	SKINNS
chr2_33611391_T_A_b38	RASGRP3	2.717	0.00685	0.036471	33	0.013425	no	SKINNS
chr2_33602067_G_C_b38	RASGRP3	2.716	0.00687	0.041727	14	0.015366	no	SKINNS
chr2_33673146_T_C_b38	RASGRP3	-2.708	0.00703	-0.030816	120	0.01138	no	SKINNS
chr2_33392445_A_C_b38	RASGRP3	-2.705	0.00709	-0.060461	4	0.022351	no	SKINNS
chr2_33933541_CTCCTTCCTTCCT_C_b38	RASGRP3	2.694	0.00732	0.070756	5	0.026261	no	SKINNS
chr2_33876322_C_T_b38	RASGRP3	-2.694	0.00733	-0.04722	7	0.017529	no	SKINNS
chr2_33884737_T_C_b38	RASGRP3	-2.692	0.00737	-0.048123	7	0.017876	no	SKINNS
chr2_33886672_G_C_b38	RASGRP3	-2.692	0.00737	-0.048123	7	0.017876	no	SKINNS
chr2_33876331_C_A_b38	RASGRP3	-2.692	0.00737	-0.048285	7	0.017937	no	SKINNS
chr2_33901570_T_C_b38	RASGRP3	2.691	0.0074	0.031051	106	0.01154	no	SKINNS
chr2_33937074_C_A_b38	RASGRP3	-2.683	0.00756	-0.032281	84	0.012029	no	SKINNS
chr2_33668030_G_A_b38	RASGRP3	2.671	0.00785	0.050511	7	0.018913	no	SKINNS
chr2_33888487_G_A_b38	RASGRP3	-2.655	0.00822	-0.04782	7	0.018013	no	SKINNS
chr2_33538880_T_A_b38	RASGRP3	2.655	0.00822	0.035079	32	0.013214	no	SKINNS
chr2_33654678_C_T_b38	RASGRP3	2.654	0.00823	0.032595	75	0.01228	no	SKINNS
chr2_33890131_A_G_b38	RASGRP3	-2.654	0.00823	-0.047511	7	0.0179	no	SKINNS
chr2_33889718_GA_G_b38	RASGRP3	-2.65	0.00835	-0.046732	8	0.017637	no	SKINNS
chr2_33545133_A_T_b38	RASGRP3	-2.646	0.00843	-0.058844	4	0.022239	no	SKINNS
chr2_33591739_A_G_b38	RASGRP3	2.643	0.0085	0.034867	37	0.013192	no	SKINNS
chr2_33936352_A_G_b38	RASGRP3	-2.639	0.0086	-0.031888	83	0.012082	no	SKINNS
chr2_33577175_G_A_b38	RASGRP3	2.636	0.00868	0.043189	10	0.016383	no	SKINNS
chr2_33949382_A_C_b38	RASGRP3	-2.633	0.00875	-0.031815	81	0.012082	no	SKINNS
chr2_33879027_A_G_b38	RASGRP3	2.632	0.00879	0.094026	5	0.035727	no	SKINNS
chr2_32969344_T_TGTG_b38	RASGRP3	-2.628	0.00889	-0.032128	76	0.012226	no	SKINNS
chr2_33951277_G_A_b38	RASGRP3	-2.625	0.00897	-0.038673	22	0.014735	no	SKINNS
chr2_33892274_C_T_b38	RASGRP3	-2.619	0.00912	-0.04727	7	0.01805	no	SKINNS
chr2_33894357_G_A_b38	RASGRP3	-2.619	0.00912	-0.04727	7	0.01805	no	SKINNS
chr2_33894663_T_C_b38	RASGRP3	-2.619	0.00912	-0.04727	7	0.01805	no	SKINNS
chr2_33895008_A_G_b38	RASGRP3	-2.619	0.00912	-0.04727	7	0.01805	no	SKINNS
chr2_33895228_A_G_b38	RASGRP3	-2.619	0.00912	-0.04727	7	0.01805	no	SKINNS
chr2_33896393_T_C_b38	RASGRP3	-2.619	0.00912	-0.04727	7	0.01805	no	SKINNS
chr2_33896740_T_C_b38	RASGRP3	-2.619	0.00912	-0.04727	7	0.01805	no	SKINNS
chr2_33802013_C_T_b38	RASGRP3	-2.619	0.00913	-0.030984	104	0.011832	no	SKINNS
chr2_32970273_G_C_b38	RASGRP3	-2.615	0.00922	-0.031123	89	0.011901	no	SKINNS
chr2_33931800_A_G_b38	RASGRP3	-2.614	0.00926	-0.030903	99	0.011823	no	SKINNS
chr2_33709749_A_AT_b38	RASGRP3	2.613	0.00927	0.045224	18	0.017306	no	SKINNS
chr2_34354532_A_G_b38	RASGRP3	2.613	0.00929	0.117291	3	0.044894	no	SKINNS
chr2_34355835_A_G_b38	RASGRP3	2.607	0.00943	0.11708	3	0.044905	no	SKINNS
chr2_34361298_T_C_b38	RASGRP3	2.607	0.00943	0.11708	3	0.044905	no	SKINNS
chr2_34361909_C_G_b38	RASGRP3	2.607	0.00943	0.11708	3	0.044905	no	SKINNS
chr2_34366811_T_C_b38	RASGRP3	2.607	0.00943	0.11708	3	0.044905	no	SKINNS
chr2_34368940_G_T_b38	RASGRP3	2.607	0.00943	0.11708	3	0.044905	no	SKINNS
chr2_34369062_A_G_b38	RASGRP3	2.607	0.00943	0.11708	3	0.044905	no	SKINNS
chr2_34369810_C_G_b38	RASGRP3	2.607	0.00943	0.11708	3	0.044905	no	SKINNS
chr2_33721262_A_T_b38	RASGRP3	2.606	0.00946	0.048478	7	0.018602	no	SKINNS
chr2_33721524_A_G_b38	RASGRP3	2.606	0.00946	0.048478	7	0.018602	no	SKINNS
chr2_33723360_C_A_b38	RASGRP3	2.606	0.00946	0.048478	7	0.018602	no	SKINNS
chr2_33587735_T_A_b38	RASGRP3	2.598	0.00969	0.032203	55	0.012397	no	SKINNS
chr2_33856655_G_A_b38	RASGRP3	-2.594	0.0098	-0.031221	67	0.012036	no	SKINNS
chr2_33537896_A_G_b38	RASGRP3	14.779	1.11e-41	0.245979	6	0.016644	yes	SKNS
chr2_33536526_G_A_b38	RASGRP3	13.79	3.17e-37	0.245146	4	0.017776	yes	SKNS
chr2_33536528_G_A_b38	RASGRP3	13.79	3.17e-37	0.245146	4	0.017776	yes	SKNS
chr2_33537192_G_GAT_b38	RASGRP3	12.208	2.11e-30	0.205795	6	0.016858	yes	SKNS
chr2_33537330_C_CCCAACACA_b38	RASGRP3	11.945	2.58e-29	0.176456	30	0.014772	yes	SKNS
chr2_33529318_C_T_b38	RASGRP3	10.229	1.51e-22	0.145487	18	0.014223	yes	SKNS
chr2_33512177_G_A_b38	RASGRP3	10.203	1.89e-22	0.157146	21	0.015402	yes	SKNS
chr2_33561445_C_A_b38	RASGRP3	9.503	6.86e-20	0.132212	27	0.013913	yes	SKNS
chr2_33556928_C_CACACACATACAT_b38	RASGRP3	9.29	3.87e-19	0.158419	7	0.017052	yes	SKNS
chr2_33523649_G_A_b38	RASGRP3	8.868	1.12e-17	0.128393	24	0.014478	yes	SKNS
chr2_33525341_A_AAT_b38	RASGRP3	8.728	3.32e-17	0.12041	32	0.013796	yes	SKNS
chr2_33555164_G_A_b38	RASGRP3	8.478	2.25e-16	0.121421	25	0.014322	yes	SKNS
chr2_33521266_C_T_b38	RASGRP3	8.424	3.39e-16	0.112299	44	0.013331	yes	SKNS
chr2_33536322_G_GA_b38	RASGRP3	8.318	7.47e-16	0.142069	19	0.017079	yes	SKNS
chr2_33586869_A_T_b38	RASGRP3	7.58	1.54e-13	0.107235	33	0.014148	yes	SKNS
chr2_33622160_C_T_b38	RASGRP3	7.252	1.45e-12	0.094246	44	0.012997	yes	SKNS
chr2_33639021_G_A_b38	RASGRP3	6.991	8.19e-12	0.096933	25	0.013866	yes	SKNS
chr2_33641397_G_C_b38	RASGRP3	6.982	8.69e-12	0.096811	25	0.013866	yes	SKNS
chr2_33640631_A_C_b38	RASGRP3	6.814	2.57e-11	0.09463	25	0.013887	yes	SKNS
chr2_33657078_T_C_b38	RASGRP3	6.759	3.65e-11	0.088801	48	0.013139	yes	SKNS
chr2_33592302_T_C_b38	RASGRP3	6.561	1.27e-10	0.155408	5	0.023688	yes	SKNS
chr2_33579727_C_T_b38	RASGRP3	6.08	2.29e-09	0.146742	4	0.024136	yes	SKNS
chr2_33625315_G_A_b38	RASGRP3	5.893	6.73e-09	0.079221	40	0.013444	yes	SKNS
chr2_33509399_C_CA_b38	RASGRP3	5.716	1.81e-08	0.101184	4	0.017701	yes	SKNS
chr2_33621819_C_A_b38	RASGRP3	5.576	3.9e-08	0.068834	61	0.012344	yes	SKNS
chr2_33547458_G_A_b38	RASGRP3	5.573	3.98e-08	0.06751	83	0.012114	yes	SKNS
chr2_33670716_C_T_b38	RASGRP3	5.353	1.29e-07	0.073374	31	0.013708	yes	SKNS
chr2_33656916_G_A_b38	RASGRP3	5.342	1.36e-07	0.069268	57	0.012967	yes	SKNS
chr2_33624881_G_GT_b38	RASGRP3	5.296	1.73e-07	0.069544	48	0.01313	yes	SKNS
chr2_33623108_T_C_b38	RASGRP3	5.265	2.03e-07	0.065608	62	0.012461	yes	SKNS
chr2_33534694_A_AT_b38	RASGRP3	5.141	3.84e-07	0.071421	34	0.013893	yes	SKNS
chr2_33616325_C_T_b38	RASGRP3	5.112	4.46e-07	0.096479	7	0.018874	yes	SKNS
chr2_33605827_ATTTTTCT_A_b38	RASGRP3	5.058	5.84e-07	0.092804	8	0.018348	yes	SKNS
chr2_33571586_T_C_b38	RASGRP3	-5.047	6.15e-07	-0.05965	121	0.011818	yes	SKNS
chr2_33661156_C_T_b38	RASGRP3	4.96	9.51e-07	0.066165	37	0.013341	yes	SKNS
chr2_33661310_C_T_b38	RASGRP3	4.96	9.51e-07	0.066165	37	0.013341	yes	SKNS
chr2_33606703_C_T_b38	RASGRP3	4.923	1.14e-06	0.094362	7	0.019168	yes	SKNS
chr2_33626436_A_T_b38	RASGRP3	4.921	1.15e-06	0.064183	51	0.013044	yes	SKNS
chr2_33567745_C_T_b38	RASGRP3	-4.894	1.31e-06	-0.058564	96	0.011967	yes	SKNS
chr2_33569371_A_G_b38	RASGRP3	-4.891	1.33e-06	-0.05883	105	0.012029	yes	SKNS
chr2_33627793_A_G_b38	RASGRP3	4.882	1.39e-06	0.089705	8	0.018375	yes	SKNS
chr2_33508487_T_C_b38	RASGRP3	4.828	1.81e-06	0.096657	16	0.020022	yes	SKNS
chr2_33515662_T_C_b38	RASGRP3	4.8	2.06e-06	0.075613	20	0.015752	yes	SKNS
chr2_33571342_T_C_b38	RASGRP3	-4.757	2.53e-06	-0.057144	105	0.012013	yes	SKNS
chr2_33634524_A_G_b38	RASGRP3	4.745	2.68e-06	0.089577	8	0.018878	yes	SKNS
chr2_33568339_TA_T_b38	RASGRP3	-4.701	3.3e-06	-0.055875	115	0.011886	yes	SKNS
chr2_33613720_G_A_b38	RASGRP3	4.694	3.42e-06	0.081754	13	0.017418	yes	SKNS
chr2_33539996_AAAAAG_A_b38	RASGRP3	-4.685	3.55e-06	-0.056521	134	0.012064	yes	SKNS
chr2_33554839_T_C_b38	RASGRP3	4.665	3.91e-06	0.056621	83	0.012138	yes	SKNS
chr2_33634816_G_T_b38	RASGRP3	4.656	4.07e-06	0.087144	8	0.018715	yes	SKNS
chr2_33514489_T_C_b38	RASGRP3	-4.654	4.12e-06	-0.053277	101	0.011448	yes	SKNS
chr2_33572204_C_A_b38	RASGRP3	-4.649	4.21e-06	-0.056078	103	0.012063	yes	SKNS
chr2_33514230_T_G_b38	RASGRP3	4.625	4.71e-06	0.070099	23	0.015157	yes	SKNS
chr2_33640513_G_C_b38	RASGRP3	4.622	4.77e-06	0.086528	7	0.01872	yes	SKNS
chr2_33571267_T_A_b38	RASGRP3	-4.56	6.36e-06	-0.054934	103	0.012047	yes	SKNS
chr2_33659035_G_A_b38	RASGRP3	4.526	7.43e-06	0.085288	7	0.018846	yes	SKNS
chr2_33631252_G_T_b38	RASGRP3	4.525	7.46e-06	0.054619	143	0.012071	yes	SKNS
chr2_33636858_C_G_b38	RASGRP3	4.517	7.71e-06	0.085006	8	0.018818	yes	SKNS
chr2_33637736_A_T_b38	RASGRP3	4.517	7.71e-06	0.085006	8	0.018818	yes	SKNS
chr2_33518114_A_G_b38	RASGRP3	-4.498	8.42e-06	-0.054801	78	0.012183	yes	SKNS
chr2_33577889_G_A_b38	RASGRP3	-4.486	8.87e-06	-0.054404	99	0.012126	yes	SKNS
chr2_33575950_G_A_b38	RASGRP3	-4.486	8.91e-06	-0.054331	97	0.012113	yes	SKNS
chr2_33512820_T_A_b38	RASGRP3	-4.476	9.32e-06	-0.053735	85	0.012006	yes	SKNS
chr2_33631243_G_GT_b38	RASGRP3	4.425	1.17e-05	0.084342	7	0.019062	yes	SKNS
chr2_33581338_T_A_b38	RASGRP3	4.371	1.49e-05	0.076446	12	0.017489	yes	SKNS
chr2_33581900_A_T_b38	RASGRP3	4.367	1.52e-05	0.076453	12	0.017508	yes	SKNS
chr2_33669574_A_G_b38	RASGRP3	4.364	1.53e-05	0.068929	17	0.015794	yes	SKNS
chr2_33667549_A_G_b38	RASGRP3	4.3	2.03e-05	0.08092	8	0.018819	yes	SKNS
chr2_33667555_A_G_b38	RASGRP3	4.3	2.03e-05	0.08092	8	0.018819	yes	SKNS
chr2_33563965_A_G_b38	RASGRP3	4.252	2.5e-05	0.07397	12	0.017396	yes	SKNS
chr2_33543901_C_G_b38	RASGRP3	-4.182	3.38e-05	-0.051795	81	0.012386	yes	SKNS
chr2_33521739_T_A_b38	RASGRP3	4.137	4.09e-05	0.056971	33	0.013772	yes	SKNS
chr2_33564467_A_G_b38	RASGRP3	4.107	4.64e-05	0.051091	89	0.012441	yes	SKNS
chr2_33508652_C_G_b38	RASGRP3	4.077	5.26e-05	0.049713	80	0.012194	yes	SKNS
chr2_33522218_G_A_b38	RASGRP3	4.059	5.66e-05	0.056776	32	0.013987	yes	SKNS
chr2_33522498_A_G_b38	RASGRP3	4.006	7.05e-05	0.056134	32	0.014012	yes	SKNS
chr2_33564001_C_G_b38	RASGRP3	3.998	7.28e-05	0.049873	87	0.012473	yes	SKNS
chr2_33604404_G_GTA_b38	RASGRP3	3.916	0.000102	0.072632	5	0.018546	yes	SKNS
chr2_33512902_A_G_b38	RASGRP3	-3.907	0.000106	-0.047792	128	0.012234	yes	SKNS
chr2_33537323_G_A_b38	RASGRP3	3.881	0.000117	0.042806	140	0.011028	yes	SKNS
chr2_33509815_G_A_b38	RASGRP3	3.876	0.000119	0.053891	33	0.013902	yes	SKNS
chr2_33545793_CTAT_C_b38	RASGRP3	3.856	0.000129	0.052483	38	0.013611	yes	SKNS
chr2_33604404_GTA_G_b38	RASGRP3	-3.826	0.000145	-0.051087	49	0.013351	yes	SKNS
chr2_33634843_C_CTT_b38	RASGRP3	3.807	0.000157	0.078324	8	0.020575	yes	SKNS
chr2_33518880_G_GTCA_b38	RASGRP3	-3.796	0.000164	-0.046723	112	0.012308	yes	SKNS
chr2_33788893_A_G_b38	RASGRP3	3.78	0.000175	0.046847	77	0.012394	yes	SKNS
chr2_33511214_C_T_b38	RASGRP3	3.757	0.000191	0.049395	45	0.013146	yes	SKNS
chr2_33539650_C_T_b38	RASGRP3	3.7	0.000238	0.051155	34	0.013826	yes	SKNS
chr2_33517217_G_A_b38	RASGRP3	3.697	0.000241	0.050997	35	0.013793	yes	SKNS
chr2_33545661_T_C_b38	RASGRP3	3.68	0.000257	0.051508	33	0.013997	yes	SKNS
chr2_33562267_C_CT_b38	RASGRP3	3.656	0.000281	0.042969	107	0.011753	yes	SKNS
chr2_33539888_A_T_b38	RASGRP3	3.655	0.000282	0.050612	34	0.013845	yes	SKNS
chr2_33790659_C_T_b38	RASGRP3	3.632	0.000308	0.042705	97	0.011758	yes	SKNS
chr2_33520269_T_C_b38	RASGRP3	3.63	0.000311	0.053115	26	0.014634	yes	SKNS
chr2_33529261_A_G_b38	RASGRP3	3.611	0.000334	0.051523	29	0.014268	yes	SKNS
chr2_33525699_C_CAA_b38	RASGRP3	3.591	0.000359	0.083741	17	0.023318	yes	SKNS
chr2_33551613_T_G_b38	RASGRP3	3.581	0.000374	0.04891	35	0.013659	yes	SKNS
chr2_33520141_T_C_b38	RASGRP3	-3.561	0.000403	-0.042967	119	0.012066	yes	SKNS
chr2_33530930_T_C_b38	RASGRP3	3.547	0.000424	0.049514	34	0.01396	yes	SKNS
chr2_33546340_A_G_b38	RASGRP3	3.543	0.000431	0.049022	35	0.013838	yes	SKNS
chr2_33518738_C_T_b38	RASGRP3	3.541	0.000433	0.049286	34	0.013917	yes	SKNS
chr2_33531341_C_A_b38	RASGRP3	3.417	0.000682	0.046488	34	0.013606	yes	SKNS
chr2_32962672_T_C_b38	RASGRP3	-3.338	0.000903	-0.043287	75	0.012968	yes	SKNS
chr2_32963401_A_G_b38	RASGRP3	-3.338	0.000903	-0.043287	75	0.012968	yes	SKNS
chr2_32973114_G_GT_b38	RASGRP3	3.326	0.000942	0.043333	61	0.013029	yes	SKNS
chr2_32955630_A_AT_b38	RASGRP3	-3.323	0.000953	-0.042856	76	0.012898	yes	SKNS
chr2_33641120_T_C_b38	RASGRP3	-3.306	0.00101	-0.039157	123	0.011844	yes	SKNS
chr2_33753865_C_T_b38	RASGRP3	-3.28	0.00111	-0.041649	73	0.0127	yes	SKNS
chr2_33004646_G_A_b38	RASGRP3	3.271	0.00114	0.04314	52	0.01319	yes	SKNS
chr2_33535209_G_A_b38	RASGRP3	3.242	0.00126	0.043864	35	0.013531	yes	SKNS
chr2_33618669_C_CT_b38	RASGRP3	-3.232	0.0013	-0.0388	105	0.012004	yes	SKNS
chr2_33618734_A_G_b38	RASGRP3	-3.232	0.0013	-0.0388	105	0.012004	yes	SKNS
chr2_33009050_C_T_b38	RASGRP3	-3.232	0.00131	-0.040342	116	0.012483	yes	SKNS
chr2_33661731_A_G_b38	RASGRP3	-3.194	0.00149	-0.036836	136	0.011534	yes	SKNS
chr2_33659127_A_G_b38	RASGRP3	-3.192	0.0015	-0.036898	135	0.011559	yes	SKNS
chr2_33625063_ATCT_A_b38	RASGRP3	-3.144	0.00176	-0.037898	98	0.012055	yes	SKNS
chr2_33572064_TAATA_T_b38	RASGRP3	-3.117	0.00192	-0.072744	4	0.023337	yes	SKNS
chr2_33617107_G_A_b38	RASGRP3	-3.102	0.00202	-0.037197	104	0.011991	yes	SKNS
chr2_33664465_T_A_b38	RASGRP3	-3.094	0.00208	-0.03601	129	0.011639	yes	SKNS
chr2_33539219_T_C_b38	RASGRP3	-3.081	0.00217	-0.037323	97	0.012114	yes	SKNS
chr2_33773731_AT_A_b38	RASGRP3	-3.058	0.00234	-0.042104	59	0.013767	yes	SKNS
chr2_33607748_A_G_b38	RASGRP3	-3.028	0.00258	-0.036225	107	0.011964	yes	SKNS
chr2_33664871_G_GT_b38	RASGRP3	-3.028	0.00258	-0.035683	130	0.011786	yes	SKNS
chr2_32996915_C_T_b38	RASGRP3	3.023	0.00262	0.042207	42	0.013961	yes	SKNS
chr2_33588900_A_AT_b38	RASGRP3	-2.987	0.00295	-0.037896	110	0.012688	yes	SKNS
chr2_33592492_A_G_b38	RASGRP3	-2.97	0.00311	-0.035482	130	0.011947	yes	SKNS
chr2_33669621_C_T_b38	RASGRP3	-2.963	0.00319	-0.034952	99	0.011798	yes	SKNS
chr2_33669751_C_T_b38	RASGRP3	-2.963	0.00319	-0.034952	99	0.011798	yes	SKNS
chr2_32760599_G_A_b38	RASGRP3	2.962	0.00319	0.042908	27	0.014485	yes	SKNS
chr2_33614957_G_A_b38	RASGRP3	-2.962	0.0032	-0.035372	103	0.011943	yes	SKNS
chr2_32754371_T_A_b38	RASGRP3	2.961	0.00321	0.041359	34	0.013969	yes	SKNS
chr2_33788399_T_C_b38	RASGRP3	2.956	0.00325	0.064731	3	0.021898	yes	SKNS
chr2_33788450_A_G_b38	RASGRP3	2.956	0.00325	0.064731	3	0.021898	yes	SKNS
chr2_33781569_AGTGTGT_A_b38	RASGRP3	2.937	0.00346	0.06104	7	0.020787	yes	SKNS
chr2_32967511_C_T_b38	RASGRP3	-2.933	0.0035	-0.045096	27	0.015374	yes	SKNS
chr2_33580247_A_G_b38	RASGRP3	-2.924	0.0036	-0.035429	126	0.012116	yes	SKNS
chr2_33664742_G_C_b38	RASGRP3	-2.92	0.00365	-0.033861	139	0.011595	yes	SKNS
chr2_33670200_G_T_b38	RASGRP3	-2.909	0.00377	-0.034333	99	0.0118	yes	SKNS
chr2_33530497_CT_C_b38	RASGRP3	2.9	0.00388	0.04259	23	0.014686	yes	SKNS
chr2_33662442_T_C_b38	RASGRP3	-2.886	0.00406	-0.033937	124	0.011759	yes	SKNS
chr2_32759476_T_G_b38	RASGRP3	2.877	0.00417	0.041702	26	0.014493	yes	SKNS
chr2_33770643_T_C_b38	RASGRP3	-2.869	0.00428	-0.036044	86	0.012562	yes	SKNS
chr2_33590404_A_G_b38	RASGRP3	-2.869	0.00429	-0.034277	129	0.011949	yes	SKNS
chr2_33577835_T_C_b38	RASGRP3	-2.859	0.00441	-0.034171	127	0.01195	yes	SKNS
chr2_33637426_T_A_b38	RASGRP3	2.855	0.00447	0.045125	21	0.015805	yes	SKNS
chr2_33591195_C_CT_b38	RASGRP3	-2.853	0.0045	-0.03878	65	0.013595	yes	SKNS
chr2_32967215_A_G_b38	RASGRP3	-2.851	0.00452	-0.033406	117	0.011715	yes	SKNS
chr2_33770662_T_C_b38	RASGRP3	-2.848	0.00457	-0.035999	85	0.012642	yes	SKNS
chr2_32971452_T_C_b38	RASGRP3	-2.845	0.00461	-0.034334	135	0.012069	yes	SKNS
chr2_33613986_T_C_b38	RASGRP3	-2.837	0.00473	-0.034049	106	0.012003	yes	SKNS
chr2_33562245_G_C_b38	RASGRP3	-2.834	0.00477	-0.034713	94	0.012248	yes	SKNS
chr2_33772197_A_T_b38	RASGRP3	-2.823	0.00493	-0.034946	80	0.012379	yes	SKNS
chr2_33576389_C_T_b38	RASGRP3	-2.823	0.00494	-0.03435	122	0.012168	yes	SKNS
chr2_32760006_T_C_b38	RASGRP3	2.822	0.00494	0.04078	27	0.014449	yes	SKNS
chr2_33516403_T_C_b38	RASGRP3	2.821	0.00496	0.043323	21	0.015357	yes	SKNS
chr2_33466588_A_G_b38	RASGRP3	2.82	0.00499	0.044079	18	0.015633	yes	SKNS
chr2_33566193_A_G_b38	RASGRP3	-2.813	0.00509	-0.050149	10	0.017829	yes	SKNS
chr2_33786599_C_T_b38	RASGRP3	-2.807	0.00518	-0.034057	153	0.012132	yes	SKNS
chr2_33589523_A_G_b38	RASGRP3	-2.807	0.00519	-0.033185	133	0.011823	yes	SKNS
chr2_32954704_C_T_b38	RASGRP3	-2.795	0.00538	-0.036245	77	0.01297	yes	SKNS
chr2_33615675_TA_T_b38	RASGRP3	-2.792	0.00543	-0.033647	103	0.012052	yes	SKNS
chr2_33008835_G_A_b38	RASGRP3	2.78	0.00562	0.033211	120	0.011945	yes	SKNS
chr2_32755120_T_C_b38	RASGRP3	2.777	0.00568	0.040535	24	0.014597	yes	SKNS
chr2_32973568_G_C_b38	RASGRP3	2.762	0.00594	0.034153	85	0.012364	yes	SKNS
chr2_33701006_T_C_b38	RASGRP3	-2.761	0.00595	-0.049308	8	0.017856	yes	SKNS
chr2_33620575_G_A_b38	RASGRP3	2.758	0.00601	0.042377	21	0.015364	yes	SKNS
chr2_32751660_A_G_b38	RASGRP3	-2.755	0.00606	-0.060139	4	0.021827	yes	SKNS
chr2_33663649_A_C_b38	RASGRP3	-2.755	0.00607	-0.031918	138	0.011587	yes	SKNS
chr2_33586449_C_G_b38	RASGRP3	-2.752	0.00612	-0.032658	129	0.011866	yes	SKNS
chr2_33539642_C_G_b38	RASGRP3	-2.739	0.00637	-0.033182	94	0.012115	yes	SKNS
chr2_33753860_C_CT_b38	RASGRP3	-2.734	0.00647	-0.035903	61	0.013134	yes	SKNS
chr2_33666591_A_G_b38	RASGRP3	-2.73	0.00654	-0.03176	140	0.011634	yes	SKNS
chr2_33593131_C_T_b38	RASGRP3	-2.728	0.00659	-0.032428	128	0.011888	yes	SKNS
chr2_33769285_C_A_b38	RASGRP3	-2.721	0.00672	-0.034206	85	0.012572	yes	SKNS
chr2_33539434_T_C_b38	RASGRP3	-2.714	0.00686	-0.032777	95	0.012076	yes	SKNS
chr2_33769652_G_T_b38	RASGRP3	-2.712	0.00691	-0.034165	85	0.0126	yes	SKNS
chr2_33758105_T_A_b38	RASGRP3	-2.71	0.00694	-0.034506	82	0.012731	yes	SKNS
chr2_33758169_T_C_b38	RASGRP3	-2.71	0.00694	-0.034506	82	0.012731	yes	SKNS
chr2_33758243_C_T_b38	RASGRP3	-2.71	0.00694	-0.034506	82	0.012731	yes	SKNS
chr2_33534062_A_C_b38	RASGRP3	-2.702	0.0071	-0.046643	10	0.01726	yes	SKNS
chr2_33548381_A_AAAAAAG_b38	RASGRP3	2.7	0.00716	0.071918	7	0.026637	yes	SKNS
chr2_33768906_G_C_b38	RASGRP3	-2.694	0.00728	-0.034171	83	0.012683	yes	SKNS
chr2_32553019_TA_T_b38	RASGRP3	2.685	0.00747	0.033322	130	0.012409	yes	SKNS
chr2_33539436_C_G_b38	RASGRP3	-2.684	0.00751	-0.032503	94	0.012112	yes	SKNS
chr2_33767897_C_T_b38	RASGRP3	-2.683	0.00752	-0.033951	85	0.012652	yes	SKNS
chr2_33563038_A_G_b38	RASGRP3	-2.674	0.00772	-0.047216	12	0.017655	yes	SKNS
chr2_33764518_G_GTTTT_b38	RASGRP3	-2.674	0.00772	-0.038038	36	0.014225	yes	SKNS
chr2_33661861_G_A_b38	RASGRP3	-2.672	0.00777	-0.031076	125	0.011631	yes	SKNS
chr2_33622456_T_TAAAC_b38	RASGRP3	-2.665	0.00794	-0.031993	104	0.012006	yes	SKNS
chr2_33767410_A_C_b38	RASGRP3	-2.664	0.00795	-0.033742	85	0.012666	yes	SKNS
chr2_33655112_A_AT_b38	RASGRP3	-2.662	0.008	-0.032843	106	0.012338	yes	SKNS
chr2_33769488_A_G_b38	RASGRP3	-2.658	0.00809	-0.033504	85	0.012605	yes	SKNS
chr2_33758156_C_T_b38	RASGRP3	-2.657	0.00812	-0.033233	84	0.012509	yes	SKNS
chr2_33758557_G_A_b38	RASGRP3	-2.656	0.00813	-0.033714	82	0.012691	yes	SKNS
chr2_32754272_T_C_b38	RASGRP3	2.651	0.00826	0.038479	25	0.014514	yes	SKNS
chr2_33758476_T_G_b38	RASGRP3	-2.65	0.00828	-0.032955	95	0.012434	yes	SKNS
chr2_33540553_GTT_G_b38	RASGRP3	2.647	0.00835	0.02996	98	0.011316	yes	SKNS
chr2_32747644_G_C_b38	RASGRP3	-2.647	0.00836	-0.056414	6	0.021311	yes	SKNS
chr2_33795126_C_CAA_b38	RASGRP3	2.646	0.00838	0.062969	3	0.023797	yes	SKNS
chr2_33575832_C_A_b38	RASGRP3	-2.645	0.00841	-0.031561	131	0.011933	yes	SKNS
chr2_33758452_A_G_b38	RASGRP3	-2.644	0.00844	-0.033228	83	0.012569	yes	SKNS
chr2_32751184_G_T_b38	RASGRP3	-2.642	0.00848	-0.0569	5	0.021536	yes	SKNS
chr2_33762557_G_C_b38	RASGRP3	-2.64	0.00852	-0.033498	83	0.012687	yes	SKNS
chr2_33763206_C_T_b38	RASGRP3	-2.64	0.00852	-0.033498	83	0.012687	yes	SKNS
chr2_33765637_C_G_b38	RASGRP3	-2.64	0.00852	-0.033498	83	0.012687	yes	SKNS
chr2_33765984_G_C_b38	RASGRP3	-2.64	0.00852	-0.033498	83	0.012687	yes	SKNS
chr2_33768109_G_C_b38	RASGRP3	-2.64	0.00852	-0.033498	83	0.012687	yes	SKNS
chr2_33754928_G_A_b38	RASGRP3	-2.64	0.00854	-0.03366	82	0.012751	yes	SKNS
chr2_33755461_G_T_b38	RASGRP3	-2.64	0.00854	-0.03366	82	0.012751	yes	SKNS
chr2_33767220_GAA_G_b38	RASGRP3	-2.637	0.00861	-0.033369	84	0.012654	yes	SKNS
chr2_33762665_A_G_b38	RASGRP3	-2.636	0.00863	-0.033417	83	0.012677	yes	SKNS
chr2_33577495_T_TA_b38	RASGRP3	2.635	0.00866	0.04996	5	0.018961	yes	SKNS
chr2_33556190_G_A_b38	RASGRP3	-2.633	0.00871	-0.0319	92	0.012116	yes	SKNS
chr2_33765535_C_T_b38	RASGRP3	-2.628	0.00882	-0.033119	85	0.0126	yes	SKNS
chr2_33765648_T_C_b38	RASGRP3	-2.628	0.00882	-0.033119	85	0.0126	yes	SKNS
chr2_33766277_T_C_b38	RASGRP3	-2.628	0.00882	-0.033119	85	0.0126	yes	SKNS
chr2_33766488_G_A_b38	RASGRP3	-2.628	0.00882	-0.033119	85	0.0126	yes	SKNS
chr2_33766502_A_C_b38	RASGRP3	-2.628	0.00882	-0.033119	85	0.0126	yes	SKNS
chr2_33766946_G_A_b38	RASGRP3	-2.628	0.00882	-0.033119	85	0.0126	yes	SKNS
chr2_33536207_C_T_b38	RASGRP3	-2.628	0.00884	-0.03198	93	0.012169	yes	SKNS
chr2_33765440_G_A_b38	RASGRP3	-2.628	0.00885	-0.032995	85	0.012557	yes	SKNS
chr2_33767629_C_T_b38	RASGRP3	-2.628	0.00885	-0.032995	85	0.012557	yes	SKNS
chr2_33767683_T_G_b38	RASGRP3	-2.628	0.00885	-0.032995	85	0.012557	yes	SKNS
chr2_33767692_TCAGAA_T_b38	RASGRP3	-2.628	0.00885	-0.032995	85	0.012557	yes	SKNS
chr2_33768002_T_C_b38	RASGRP3	-2.628	0.00885	-0.032995	85	0.012557	yes	SKNS
chr2_33768312_A_C_b38	RASGRP3	-2.628	0.00885	-0.033018	86	0.012566	yes	SKNS
chr2_33669785_CA_C_b38	RASGRP3	-2.627	0.00886	-0.031332	93	0.011927	yes	SKNS
chr2_33711839_C_T_b38	RASGRP3	-2.615	0.00918	-0.059221	3	0.022648	yes	SKNS
chr2_33778798_T_C_b38	RASGRP3	-2.606	0.00941	-0.032214	160	0.01236	yes	SKNS
chr2_33620497_T_C_b38	RASGRP3	2.603	0.0095	0.040006	21	0.015369	yes	SKNS
chr2_33567211_TA_T_b38	RASGRP3	-2.601	0.00954	-0.034946	72	0.013434	yes	SKNS
chr2_33764603_A_G_b38	RASGRP3	-2.6	0.00959	-0.032157	86	0.01237	yes	SKNS
chr2_33563470_A_ATACT_b38	RASGRP3	-2.589	0.0099	-0.05092	8	0.019671	yes	SKNS
chr2_33764454_T_C_b38	RASGRP3	-2.585	0.01	-0.032155	87	0.012438	yes	SKNS
chr2_33766547_T_G_b38	RASGRP3	-2.585	0.01	-0.032155	87	0.012438	yes	SKNS
chr2_33557635_G_A_b38	RASGRP3	13.558	3.36e-36	0.228124	7	0.016825	no	SKNS
chr2_33559734_G_A_b38	RASGRP3	13.558	3.36e-36	0.228124	7	0.016825	no	SKNS
chr2_33559304_G_A_b38	RASGRP3	13.53	4.51e-36	0.228294	7	0.016874	no	SKNS
chr2_33559068_A_G_b38	RASGRP3	13.081	4.1e-34	0.229974	5	0.017581	no	SKNS
chr2_33531453_C_T_b38	RASGRP3	12.795	6.97e-33	0.215931	9	0.016877	no	SKNS
chr2_33529269_C_A_b38	RASGRP3	12.769	8.99e-33	0.211717	10	0.016581	no	SKNS
chr2_33526597_C_T_b38	RASGRP3	12.457	1.9e-31	0.214874	8	0.017249	no	SKNS
chr2_33527062_GC_G_b38	RASGRP3	12.457	1.9e-31	0.214874	8	0.017249	no	SKNS
chr2_33540561_TGTGTGTGTGTG_T_b38	RASGRP3	12.416	2.83e-31	0.201136	17	0.0162	no	SKNS
chr2_33554542_A_G_b38	RASGRP3	12.383	3.9e-31	0.21743	7	0.017559	no	SKNS
chr2_33546942_C_G_b38	RASGRP3	12.313	7.62e-31	0.210257	9	0.017075	no	SKNS
chr2_33548469_T_C_b38	RASGRP3	12.293	9.28e-31	0.217877	6	0.017724	no	SKNS
chr2_33548762_A_G_b38	RASGRP3	12.237	1.59e-30	0.226288	4	0.018492	no	SKNS
chr2_33550216_T_A_b38	RASGRP3	12.207	2.13e-30	0.214123	7	0.017541	no	SKNS
chr2_33550484_C_G_b38	RASGRP3	12.08	7.16e-30	0.21289	7	0.017623	no	SKNS
chr2_33553995_C_T_b38	RASGRP3	11.923	3.19e-29	0.211705	7	0.017756	no	SKNS
chr2_33552022_CAAACA_C_b38	RASGRP3	11.78	1.23e-28	0.209521	7	0.017786	no	SKNS
chr2_33551676_A_G_b38	RASGRP3	11.779	1.24e-28	0.211437	6	0.01795	no	SKNS
chr2_33551697_A_T_b38	RASGRP3	11.779	1.24e-28	0.211437	6	0.01795	no	SKNS
chr2_33557844_G_A_b38	RASGRP3	11.76	1.49e-28	0.195618	11	0.016634	no	SKNS
chr2_33539987_GAAAAA_G_b38	RASGRP3	10.022	8.92e-22	0.204932	4	0.020449	no	SKNS
chr2_33547053_GAA_G_b38	RASGRP3	8.021	6.67e-15	0.189019	5	0.023565	no	SKNS
chr2_33565263_A_G_b38	RASGRP3	7.111	3.72e-12	0.098729	47	0.013884	no	SKNS
chr2_33596617_C_T_b38	RASGRP3	7.099	4.02e-12	0.099362	40	0.013996	no	SKNS
chr2_33523461_TA_T_b38	RASGRP3	7.044	5.77e-12	0.10844	14	0.015394	no	SKNS
chr2_33596963_A_T_b38	RASGRP3	6.985	8.53e-12	0.097192	41	0.013915	no	SKNS
chr2_33594385_G_A_b38	RASGRP3	6.873	1.76e-11	0.095271	41	0.013861	no	SKNS
chr2_33594326_C_T_b38	RASGRP3	6.854	1.98e-11	0.09529	41	0.013902	no	SKNS
chr2_33582025_C_T_b38	RASGRP3	6.739	4.14e-11	0.093657	37	0.013897	no	SKNS
chr2_33581561_C_T_b38	RASGRP3	6.716	4.8e-11	0.093276	38	0.01389	no	SKNS
chr2_33656848_TA_T_b38	RASGRP3	6.25	8.39e-10	0.082871	43	0.013259	no	SKNS
chr2_33650021_A_G_b38	RASGRP3	6.238	9.03e-10	0.08632	26	0.013838	no	SKNS
chr2_33656248_TTC_T_b38	RASGRP3	6.238	9.03e-10	0.08632	26	0.013838	no	SKNS
chr2_33511010_G_A_b38	RASGRP3	6.18	1.27e-09	0.120253	12	0.019458	no	SKNS
chr2_33662459_C_T_b38	RASGRP3	6.099	2.05e-09	0.083849	27	0.013747	no	SKNS
chr2_33652477_C_A_b38	RASGRP3	6.052	2.7e-09	0.084322	26	0.013934	no	SKNS
chr2_33663555_T_C_b38	RASGRP3	5.906	6.24e-09	0.081546	27	0.013807	no	SKNS
chr2_33622592_T_C_b38	RASGRP3	5.881	7.19e-09	0.076022	57	0.012927	no	SKNS
chr2_33537321_C_CA_b38	RASGRP3	5.835	9.34e-09	0.067705	86	0.011603	no	SKNS
chr2_33573675_A_G_b38	RASGRP3	5.426	8.76e-08	0.137384	3	0.02532	no	SKNS
chr2_33596450_T_G_b38	RASGRP3	5.25	2.2e-07	0.068066	55	0.012966	no	SKNS
chr2_33589264_G_C_b38	RASGRP3	5.198	2.87e-07	0.067188	55	0.012926	no	SKNS
chr2_33603617_TC_T_b38	RASGRP3	5.17	3.31e-07	0.088324	14	0.017083	no	SKNS
chr2_33548381_A_AAAAAG_b38	RASGRP3	5.164	3.43e-07	0.10713	10	0.020747	no	SKNS
chr2_33607432_G_A_b38	RASGRP3	5.152	3.64e-07	0.094693	6	0.018381	no	SKNS
chr2_33590881_T_C_b38	RASGRP3	5.144	3.78e-07	0.066407	54	0.012909	no	SKNS
chr2_33603907_A_C_b38	RASGRP3	5.14	3.86e-07	0.087908	14	0.017103	no	SKNS
chr2_33615450_C_G_b38	RASGRP3	4.877	1.43e-06	0.089734	6	0.018401	no	SKNS
chr2_33611855_A_C_b38	RASGRP3	4.829	1.8e-06	0.081487	14	0.016876	no	SKNS
chr2_33615793_A_T_b38	RASGRP3	4.77	2.38e-06	0.087345	6	0.01831	no	SKNS
chr2_33621944_G_A_b38	RASGRP3	4.77	2.38e-06	0.087345	6	0.01831	no	SKNS
chr2_33623483_C_T_b38	RASGRP3	4.77	2.38e-06	0.087345	6	0.01831	no	SKNS
chr2_33532487_C_A_b38	RASGRP3	4.682	3.6e-06	0.053215	144	0.011365	no	SKNS
chr2_33602942_T_C_b38	RASGRP3	4.55	6.66e-06	0.088217	4	0.01939	no	SKNS
chr2_33561192_A_G_b38	RASGRP3	4.526	7.42e-06	0.052113	141	0.011514	no	SKNS
chr2_33672387_A_G_b38	RASGRP3	4.462	9.91e-06	0.070145	18	0.015721	no	SKNS
chr2_33669427_A_C_b38	RASGRP3	4.409	1.26e-05	0.069569	18	0.015779	no	SKNS
chr2_33605847_C_CT_b38	RASGRP3	4.321	1.85e-05	0.081432	3	0.018844	no	SKNS
chr2_33530852_CT_C_b38	RASGRP3	4.31	1.95e-05	0.048887	117	0.011344	no	SKNS
chr2_33633545_T_G_b38	RASGRP3	4.289	2.13e-05	0.082767	5	0.019297	no	SKNS
chr2_33540561_TGTGTGTGTGTGTGTGTG_T_b38	RASGRP3	-4.284	2.18e-05	-0.050821	94	0.011863	no	SKNS
chr2_33605951_T_C_b38	RASGRP3	-4.057	5.72e-05	-0.048582	130	0.011976	no	SKNS
chr2_33519891_C_T_b38	RASGRP3	-4.004	7.11e-05	-0.048041	98	0.011998	no	SKNS
chr2_32508276_C_CTTTT_b38	RASGRP3	3.963	8.41e-05	0.133542	6	0.033698	no	SKNS
chr2_33532718_G_A_b38	RASGRP3	3.949	8.91e-05	0.044939	117	0.011381	no	SKNS
chr2_32969344_T_TGTG_b38	RASGRP3	-3.822	0.000148	-0.047427	91	0.01241	no	SKNS
chr2_32967979_AGTTTGTTT_A_b38	RASGRP3	-3.784	0.000172	-0.047029	92	0.012428	no	SKNS
chr2_32970273_G_C_b38	RASGRP3	-3.778	0.000176	-0.046068	109	0.012195	no	SKNS
chr2_32972273_GT_G_b38	RASGRP3	-3.69	0.000247	-0.045951	92	0.012453	no	SKNS
chr2_33539533_G_T_b38	RASGRP3	-3.658	0.00028	-0.039937	158	0.010918	no	SKNS
chr2_33536322_GA_G_b38	RASGRP3	-3.589	0.000362	-0.045424	113	0.012656	no	SKNS
chr2_33515921_T_A_b38	RASGRP3	3.576	0.00038	0.0576	17	0.016106	no	SKNS
chr2_33007243_A_T_b38	RASGRP3	-3.55	0.00042	-0.046614	73	0.013132	no	SKNS
chr2_33007962_T_C_b38	RASGRP3	-3.512	0.000482	-0.046183	72	0.01315	no	SKNS
chr2_33540888_T_C_b38	RASGRP3	-3.463	0.000577	-0.037893	156	0.010942	no	SKNS
chr2_33541741_G_T_b38	RASGRP3	-3.454	0.000595	-0.037719	156	0.010919	no	SKNS
chr2_33629533_C_G_b38	RASGRP3	3.412	0.000693	0.059725	12	0.017503	no	SKNS
chr2_33668030_G_A_b38	RASGRP3	3.382	0.000774	0.064261	7	0.019003	no	SKNS
chr2_32956808_C_T_b38	RASGRP3	-3.339	0.000899	-0.043069	78	0.012898	no	SKNS
chr2_33004517_G_A_b38	RASGRP3	3.241	0.00127	0.042234	57	0.013033	no	SKNS
chr2_33540615_TTCTC_T_b38	RASGRP3	-3.239	0.00127	-0.037466	122	0.011568	no	SKNS
chr2_32957368_G_T_b38	RASGRP3	-3.194	0.00148	-0.041505	73	0.012993	no	SKNS
chr2_33007988_C_G_b38	RASGRP3	3.173	0.0016	0.042124	51	0.013276	no	SKNS
chr2_33014179_C_T_b38	RASGRP3	3.169	0.00162	0.042034	52	0.013265	no	SKNS
chr2_32957548_T_C_b38	RASGRP3	-3.167	0.00163	-0.041197	72	0.01301	no	SKNS
chr2_33004447_A_G_b38	RASGRP3	3.134	0.00182	0.038823	74	0.012388	no	SKNS
chr2_33620413_GA_G_b38	RASGRP3	3.103	0.00202	0.053984	6	0.0174	no	SKNS
chr2_33629657_C_CT_b38	RASGRP3	3.044	0.00245	0.047383	25	0.015567	no	SKNS
chr2_33005867_G_A_b38	RASGRP3	3.027	0.00259	0.037551	73	0.012406	no	SKNS
chr2_33003100_G_A_b38	RASGRP3	2.995	0.00287	0.036892	75	0.012316	no	SKNS
chr2_33623242_A_AT_b38	RASGRP3	-2.994	0.00288	-0.044767	32	0.01495	no	SKNS
chr2_33631185_T_G_b38	RASGRP3	-2.992	0.0029	-0.034662	144	0.011584	no	SKNS
chr2_33690159_TA_T_b38	RASGRP3	-2.916	0.00369	-0.051813	8	0.017766	no	SKNS
chr2_33587735_T_A_b38	RASGRP3	2.886	0.00406	0.036166	68	0.01253	no	SKNS
chr2_33582793_C_G_b38	RASGRP3	2.882	0.00412	0.036165	68	0.012551	no	SKNS
chr2_33688983_A_C_b38	RASGRP3	-2.878	0.00416	-0.051334	8	0.017836	no	SKNS
chr2_33601894_C_G_b38	RASGRP3	2.854	0.00448	0.035875	67	0.012569	no	SKNS
chr2_33658713_G_A_b38	RASGRP3	-2.838	0.00471	-0.033673	119	0.011863	no	SKNS
chr2_32971283_T_G_b38	RASGRP3	-2.836	0.00475	-0.033367	115	0.011766	no	SKNS
chr2_33671460_G_A_b38	RASGRP3	2.829	0.00484	0.050954	8	0.018009	no	SKNS
chr2_33642139_G_T_b38	RASGRP3	2.819	0.005	0.045954	15	0.016302	no	SKNS
chr2_33638203_C_CT_b38	RASGRP3	-2.811	0.00512	-0.040805	45	0.014516	no	SKNS
chr2_33647765_T_C_b38	RASGRP3	-2.801	0.00528	-0.033047	127	0.011798	no	SKNS
chr2_33655774_A_G_b38	RASGRP3	-2.793	0.0054	-0.03285	126	0.01176	no	SKNS
chr2_33006381_CTTT_C_b38	RASGRP3	2.79	0.00547	0.042181	20	0.015121	no	SKNS
chr2_33658170_A_G_b38	RASGRP3	-2.779	0.00565	-0.032855	120	0.011824	no	SKNS
chr2_33597253_G_A_b38	RASGRP3	-2.762	0.00594	-0.033525	122	0.012138	no	SKNS
chr2_33427776_C_CTTTTTTTTT_b38	RASGRP3	-2.756	0.00605	-0.078614	7	0.028526	no	SKNS
chr2_34368823_G_T_b38	RASGRP3	2.742	0.00632	0.085737	9	0.031273	no	SKNS
chr2_33477835_C_T_b38	RASGRP3	2.738	0.00639	0.039545	27	0.014444	no	SKNS
chr2_34314362_C_CTTTT_b38	RASGRP3	2.727	0.0066	0.063799	16	0.023395	no	SKNS
chr2_33012456_T_C_b38	RASGRP3	2.725	0.00663	0.034028	86	0.012486	no	SKNS
chr2_33548360_C_CA_b38	RASGRP3	-2.712	0.0069	-0.060821	13	0.022425	no	SKNS
chr2_33631863_T_C_b38	RASGRP3	-2.707	0.007	-0.031215	145	0.011529	no	SKNS
chr2_33668515_A_G_b38	RASGRP3	-2.703	0.00708	-0.031849	125	0.011781	no	SKNS
chr2_33475238_C_T_b38	RASGRP3	2.688	0.00741	0.044754	15	0.01665	no	SKNS
chr2_33563203_CTTGTT_C_b38	RASGRP3	2.687	0.00744	0.034717	56	0.012922	no	SKNS
chr2_32967697_C_G_b38	RASGRP3	-2.685	0.00747	-0.032715	136	0.012183	no	SKNS
chr2_33792363_C_T_b38	RASGRP3	2.682	0.00755	0.061031	3	0.022756	no	SKNS
chr2_32676493_G_GT_b38	RASGRP3	-2.681	0.00757	-0.028915	186	0.010786	no	SKNS
chr2_33573084_G_C_b38	RASGRP3	-2.671	0.00779	-0.056759	7	0.021248	no	SKNS
chr2_32988934_CT_C_b38	RASGRP3	2.669	0.00785	0.037426	35	0.014024	no	SKNS
chr2_32961194_A_G_b38	RASGRP3	2.667	0.00789	0.034299	67	0.012862	no	SKNS
chr2_33680214_T_G_b38	RASGRP3	-2.663	0.00799	-0.046953	12	0.017634	no	SKNS
chr2_33651073_T_C_b38	RASGRP3	2.659	0.00807	0.036207	41	0.013616	no	SKNS
chr2_32750915_T_C_b38	RASGRP3	-2.653	0.00821	-0.056913	5	0.021451	no	SKNS
chr2_32751020_A_G_b38	RASGRP3	-2.653	0.00821	-0.056913	5	0.021451	no	SKNS
chr2_32751084_T_A_b38	RASGRP3	-2.653	0.00821	-0.056913	5	0.021451	no	SKNS
chr2_33754448_T_C_b38	RASGRP3	-2.647	0.00836	-0.033633	84	0.012707	no	SKNS
chr2_33666129_G_C_b38	RASGRP3	2.641	0.0085	0.035887	42	0.013586	no	SKNS
chr2_33540861_TA_T_b38	RASGRP3	-2.641	0.00851	-0.031524	87	0.011937	no	SKNS
chr2_33474954_T_C_b38	RASGRP3	2.633	0.00872	0.031408	139	0.01193	no	SKNS
chr2_33668896_C_T_b38	RASGRP3	2.633	0.00872	0.035737	42	0.013575	no	SKNS
chr2_33568917_T_C_b38	RASGRP3	-2.631	0.00875	-0.046777	10	0.017777	no	SKNS
chr2_32956811_G_GA_b38	RASGRP3	-2.631	0.00876	-0.03129	103	0.011894	no	SKNS
chr2_32958430_T_C_b38	RASGRP3	-2.631	0.00876	-0.03129	103	0.011894	no	SKNS
chr2_33006381_CTT_C_b38	RASGRP3	-2.599	0.00961	-0.039722	21	0.015284	no	SKNS
chr2_33615349_G_C_b38	RASGRP3	2.592	0.0098	0.03372	52	0.013008	no	SKNS
chr2_33615516_T_A_b38	RASGRP3	2.592	0.0098	0.03372	52	0.013008	no	SKNS
chr2_33721945_A_G_b38	RASGRP3	-2.588	0.00992	-0.044175	12	0.017071	no	SKNS
chr2_33722143_T_C_b38	RASGRP3	-2.588	0.00992	-0.044175	12	0.017071	no	SKNS
chr2_33525341_A_AAT_b38	RASGRP3	5.973	2.01e-08	0.167201	8	0.027994	yes	SNTTRM
chr2_33521266_C_T_b38	RASGRP3	5.719	6.75e-08	0.156433	11	0.027354	yes	SNTTRM
chr2_33523649_G_A_b38	RASGRP3	5.361	3.55e-07	0.166804	5	0.031114	yes	SNTTRM
chr2_33561445_C_A_b38	RASGRP3	5.143	9.44e-07	0.166965	4	0.032461	yes	SNTTRM
chr2_33529318_C_T_b38	RASGRP3	4.973	2e-06	0.166205	4	0.033422	yes	SNTTRM
chr2_33625315_G_A_b38	RASGRP3	4.965	2.06e-06	0.143899	11	0.02898	yes	SNTTRM
chr2_33622160_C_T_b38	RASGRP3	4.865	3.18e-06	0.138094	16	0.028385	yes	SNTTRM
chr2_33537321_C_CA_b38	RASGRP3	4.848	3.43e-06	0.126573	20	0.026109	yes	SNTTRM
chr2_33555164_G_A_b38	RASGRP3	4.792	4.34e-06	0.160365	4	0.033463	yes	SNTTRM
chr2_33621819_C_A_b38	RASGRP3	4.582	1.05e-05	0.129296	19	0.028217	yes	SNTTRM
chr2_33652477_C_A_b38	RASGRP3	4.56	1.15e-05	0.141751	7	0.031089	yes	SNTTRM
chr2_33656248_TTC_T_b38	RASGRP3	4.508	1.42e-05	0.140438	7	0.031154	yes	SNTTRM
chr2_33623108_T_C_b38	RASGRP3	4.484	1.56e-05	0.130301	19	0.029056	yes	SNTTRM
chr2_33662459_C_T_b38	RASGRP3	4.412	2.1e-05	0.136311	7	0.030895	yes	SNTTRM
chr2_33650021_A_G_b38	RASGRP3	4.253	3.95e-05	0.133986	7	0.031506	yes	SNTTRM
chr2_33663555_T_C_b38	RASGRP3	4.189	5.08e-05	0.130526	7	0.031162	yes	SNTTRM
chr2_33622592_T_C_b38	RASGRP3	4.179	5.27e-05	0.121572	18	0.029091	yes	SNTTRM
chr2_33512820_T_A_b38	RASGRP3	-3.753	0.00026	-0.091292	26	0.024326	yes	SNTTRM
chr2_33620575_G_A_b38	RASGRP3	3.721	0.000292	0.135359	3	0.036381	yes	SNTTRM
chr2_33554839_T_C_b38	RASGRP3	3.708	0.000306	0.09734	22	0.026253	yes	SNTTRM
chr2_33596617_C_T_b38	RASGRP3	3.688	0.000328	0.108549	15	0.029433	yes	SNTTRM
chr2_33596963_A_T_b38	RASGRP3	3.674	0.000346	0.10759	15	0.029288	yes	SNTTRM
chr2_33581561_C_T_b38	RASGRP3	3.636	0.000394	0.107365	14	0.029527	yes	SNTTRM
chr2_33582025_C_T_b38	RASGRP3	3.636	0.000394	0.107365	14	0.029527	yes	SNTTRM
chr2_33657078_T_C_b38	RASGRP3	3.586	0.00047	0.106169	14	0.029605	yes	SNTTRM
chr2_33565263_A_G_b38	RASGRP3	3.578	0.000484	0.107502	15	0.030046	yes	SNTTRM
chr2_33519891_C_T_b38	RASGRP3	-3.575	0.000489	-0.091306	25	0.025539	yes	SNTTRM
chr2_33620497_T_C_b38	RASGRP3	3.572	0.000495	0.131877	3	0.036924	yes	SNTTRM
chr2_33594326_C_T_b38	RASGRP3	3.544	0.000544	0.105003	15	0.029625	yes	SNTTRM
chr2_33594385_G_A_b38	RASGRP3	3.544	0.000544	0.105003	15	0.029625	yes	SNTTRM
chr2_33581338_T_A_b38	RASGRP3	3.431	0.000801	0.131871	3	0.038431	yes	SNTTRM
chr2_33581900_A_T_b38	RASGRP3	3.431	0.000801	0.131871	3	0.038431	yes	SNTTRM
chr2_33586869_A_T_b38	RASGRP3	3.345	0.00107	0.106976	10	0.031977	yes	SNTTRM
chr2_33518880_G_GTCA_b38	RASGRP3	-3.302	0.00123	-0.085762	38	0.025975	yes	SNTTRM
chr2_33520141_T_C_b38	RASGRP3	-3.239	0.00152	-0.084999	34	0.026242	yes	SNTTRM
chr2_33563965_A_G_b38	RASGRP3	3.195	0.00174	0.12329	3	0.038584	yes	SNTTRM
chr2_33677515_A_G_b38	RASGRP3	3.19	0.00177	0.11489	4	0.03601	yes	SNTTRM
chr2_33512902_A_G_b38	RASGRP3	-3.126	0.00218	-0.082152	40	0.026282	yes	SNTTRM
chr2_33656848_TA_T_b38	RASGRP3	3.123	0.0022	0.092744	11	0.029696	yes	SNTTRM
chr2_32678253_CA_C_b38	RASGRP3	2.915	0.00418	0.084748	24	0.029074	yes	SNTTRM
chr2_33532718_G_A_b38	RASGRP3	2.913	0.0042	0.074305	27	0.025509	yes	SNTTRM
chr2_34292410_TCTCTCTCTCA_T_b38	RASGRP3	2.889	0.00451	0.079815	14	0.027627	yes	SNTTRM
chr2_33072862_C_T_b38	RASGRP3	2.867	0.00481	0.10652	4	0.037149	yes	SNTTRM
chr2_32637586_C_T_b38	RASGRP3	2.867	0.00482	0.090171	7	0.031455	yes	SNTTRM
chr2_33019874_AT_A_b38	RASGRP3	2.821	0.00553	0.0951	4	0.033717	yes	SNTTRM
chr2_32637345_T_C_b38	RASGRP3	2.819	0.00556	0.086088	8	0.030543	yes	SNTTRM
chr2_34131134_A_G_b38	RASGRP3	-2.691	0.00803	-0.077049	17	0.028628	yes	SNTTRM
chr2_33089155_CAA_C_b38	RASGRP3	-2.691	0.00805	-0.101949	3	0.03789	yes	SNTTRM
chr2_33523461_TA_T_b38	RASGRP3	2.686	0.00814	0.085281	6	0.031746	yes	SNTTRM
chr2_33523846_A_G_b38	RASGRP3	-2.686	0.00816	-0.083689	6	0.031159	yes	SNTTRM
chr2_32969344_T_TGTG_b38	RASGRP3	-2.679	0.00831	-0.074427	27	0.027777	yes	SNTTRM
chr2_33072295_C_T_b38	RASGRP3	2.666	0.00862	0.093902	5	0.035217	yes	SNTTRM
chr2_33539996_AAAAAG_A_b38	RASGRP3	-2.644	0.00918	-0.069479	39	0.026279	yes	SNTTRM
chr2_32967979_AGTTTGTTT_A_b38	RASGRP3	-2.616	0.00991	-0.07258	28	0.02774	yes	SNTTRM
chr2_32972273_GT_G_b38	RASGRP3	-2.616	0.00991	-0.07258	28	0.02774	yes	SNTTRM
chr2_33537330_C_CCCAACACA_b38	RASGRP3	7.901	9.24e-13	0.23589	9	0.029855	no	SNTTRM
chr2_33540561_TGTGTGTGTGTG_T_b38	RASGRP3	7.325	2.06e-11	0.240072	5	0.032774	no	SNTTRM
chr2_33512177_G_A_b38	RASGRP3	7.2	4e-11	0.198744	8	0.027604	no	SNTTRM
chr2_33641397_G_C_b38	RASGRP3	5.316	4.35e-07	0.16547	6	0.031126	no	SNTTRM
chr2_33640631_A_C_b38	RASGRP3	5.18	8.02e-07	0.16358	6	0.031579	no	SNTTRM
chr2_33639021_G_A_b38	RASGRP3	5.028	1.57e-06	0.158314	6	0.031489	no	SNTTRM
chr2_33536322_G_GA_b38	RASGRP3	4.845	3.47e-06	0.173905	4	0.035895	no	SNTTRM
chr2_33626436_A_T_b38	RASGRP3	4.37	2.48e-05	0.128405	12	0.029382	no	SNTTRM
chr2_33624881_G_GT_b38	RASGRP3	4.364	2.54e-05	0.126707	12	0.029033	no	SNTTRM
chr2_33672387_A_G_b38	RASGRP3	4.34	2.8e-05	0.146136	3	0.033672	no	SNTTRM
chr2_33670716_C_T_b38	RASGRP3	4.297	3.31e-05	0.129727	8	0.030188	no	SNTTRM
chr2_33518114_A_G_b38	RASGRP3	-3.795	0.000223	-0.091835	27	0.024197	no	SNTTRM
chr2_33656916_G_A_b38	RASGRP3	3.486	0.000664	0.102925	12	0.029522	no	SNTTRM
chr2_34088753_T_C_b38	RASGRP3	-3.381	0.000948	-0.081748	25	0.024178	no	SNTTRM
chr2_33532487_C_A_b38	RASGRP3	3.358	0.00103	0.081114	42	0.024158	no	SNTTRM
chr2_33661156_C_T_b38	RASGRP3	3.322	0.00116	0.101521	8	0.030562	no	SNTTRM
chr2_33661310_C_T_b38	RASGRP3	3.322	0.00116	0.101521	8	0.030562	no	SNTTRM
chr2_33514230_T_G_b38	RASGRP3	3.299	0.00125	0.104855	6	0.031788	no	SNTTRM
chr2_33669427_A_C_b38	RASGRP3	3.259	0.00142	0.111605	4	0.034244	no	SNTTRM
chr2_33669574_A_G_b38	RASGRP3	3.259	0.00142	0.111605	4	0.034244	no	SNTTRM
chr2_33589264_G_C_b38	RASGRP3	3.219	0.00162	0.096432	16	0.029955	no	SNTTRM
chr2_33596450_T_G_b38	RASGRP3	3.219	0.00162	0.096432	16	0.029955	no	SNTTRM
chr2_33590881_T_C_b38	RASGRP3	3.148	0.00203	0.094072	15	0.029884	no	SNTTRM
chr2_33514489_T_C_b38	RASGRP3	-3.143	0.00206	-0.074376	31	0.023662	no	SNTTRM
chr2_33725915_C_CTTT_b38	RASGRP3	-3.072	0.00258	-0.109897	6	0.035776	no	SNTTRM
chr2_33631185_T_G_b38	RASGRP3	-3.001	0.00322	-0.072264	43	0.024082	no	SNTTRM
chr2_33631863_T_C_b38	RASGRP3	-2.922	0.00409	-0.071409	42	0.02444	no	SNTTRM
chr2_32970699_C_T_b38	RASGRP3	2.901	0.00435	0.112971	3	0.03894	no	SNTTRM
chr2_33508487_T_C_b38	RASGRP3	2.864	0.00486	0.115299	4	0.040259	no	SNTTRM
chr2_33138848_C_CT_b38	RASGRP3	2.818	0.00558	0.121016	7	0.04295	no	SNTTRM
chr2_33632169_T_C_b38	RASGRP3	-2.777	0.00627	-0.07732	27	0.02784	no	SNTTRM
chr2_33633545_T_G_b38	RASGRP3	2.765	0.00649	0.107023	3	0.038701	no	SNTTRM
chr2_33515662_T_C_b38	RASGRP3	2.762	0.00655	0.094573	4	0.034237	no	SNTTRM
chr2_33503592_C_CT_b38	RASGRP3	2.745	0.00689	0.095436	6	0.03477	no	SNTTRM
chr2_32672080_G_T_b38	RASGRP3	2.704	0.00775	0.10959	3	0.040535	no	SNTTRM
chr2_33613986_T_C_b38	RASGRP3	-2.694	0.00797	-0.072478	31	0.026905	no	SNTTRM
chr2_33629277_A_G_b38	RASGRP3	-2.677	0.00836	-0.067586	35	0.025247	no	SNTTRM
chr2_33629533_C_G_b38	RASGRP3	2.652	0.00898	0.09398	5	0.035439	no	SNTTRM
chr2_34086500_C_CAA_b38	RASGRP3	2.637	0.00936	0.067153	20	0.025465	no	SNTTRM
chr2_33328135_C_CAATAAATAAATAAATA_b38	RASGRP3	2.626	0.00965	0.094342	6	0.035924	no	SNTTRM
chr2_32571378_C_CTT_b38	RASGRP3	-2.626	0.00966	-0.138526	4	0.052761	no	SNTTRM
chr2_32981868_T_C_b38	RASGRP3	-2.624	0.0097	-0.083137	10	0.03168	no	SNTTRM
chr2_33557844_G_A_b38	RASGRP3	10.391	3.11e-20	0.287606	3	0.027678	yes	SPLEEN
chr2_33531453_C_T_b38	RASGRP3	10.221	9.56e-20	0.278308	4	0.027228	yes	SPLEEN
chr2_33526597_C_T_b38	RASGRP3	9.649	4.08e-18	0.269308	4	0.027912	yes	SPLEEN
chr2_33527062_GC_G_b38	RASGRP3	9.649	4.08e-18	0.269308	4	0.027912	yes	SPLEEN
chr2_33529269_C_A_b38	RASGRP3	9.586	6.1e-18	0.267023	4	0.027854	yes	SPLEEN
chr2_33512177_G_A_b38	RASGRP3	9.079	1.59e-16	0.224771	10	0.024758	yes	SPLEEN
chr2_33521266_C_T_b38	RASGRP3	7.496	2.6e-12	0.179112	17	0.023894	yes	SPLEEN
chr2_33525341_A_AAT_b38	RASGRP3	7.367	5.5e-12	0.182271	14	0.02474	yes	SPLEEN
chr2_33561445_C_A_b38	RASGRP3	7.2	1.45e-11	0.185535	10	0.025769	yes	SPLEEN
chr2_33581561_C_T_b38	RASGRP3	7.196	1.47e-11	0.166994	18	0.023205	yes	SPLEEN
chr2_33596963_A_T_b38	RASGRP3	7.194	1.5e-11	0.169303	17	0.023535	yes	SPLEEN
chr2_33529318_C_T_b38	RASGRP3	6.975	5.2e-11	0.183447	8	0.026301	yes	SPLEEN
chr2_33582025_C_T_b38	RASGRP3	6.939	6.37e-11	0.162935	17	0.023482	yes	SPLEEN
chr2_33594326_C_T_b38	RASGRP3	6.934	6.54e-11	0.163759	17	0.023617	yes	SPLEEN
chr2_33594385_G_A_b38	RASGRP3	6.934	6.54e-11	0.163759	17	0.023617	yes	SPLEEN
chr2_33555164_G_A_b38	RASGRP3	6.567	4.97e-10	0.173728	10	0.026453	yes	SPLEEN
chr2_33565263_A_G_b38	RASGRP3	6.526	6.22e-10	0.155845	23	0.02388	yes	SPLEEN
chr2_33523649_G_A_b38	RASGRP3	6.498	7.23e-10	0.168761	12	0.025969	yes	SPLEEN
chr2_33650021_A_G_b38	RASGRP3	6.315	1.94e-09	0.150883	13	0.023893	yes	SPLEEN
chr2_33656248_TTC_T_b38	RASGRP3	6.315	1.94e-09	0.150883	13	0.023893	yes	SPLEEN
chr2_33652477_C_A_b38	RASGRP3	6.314	1.95e-09	0.151696	13	0.024026	yes	SPLEEN
chr2_33657078_T_C_b38	RASGRP3	6.243	2.84e-09	0.14369	24	0.023016	yes	SPLEEN
chr2_33662459_C_T_b38	RASGRP3	6.16	4.39e-09	0.147552	14	0.023953	yes	SPLEEN
chr2_33663555_T_C_b38	RASGRP3	6.003	9.93e-09	0.145837	14	0.024293	yes	SPLEEN
chr2_33519891_C_T_b38	RASGRP3	-5.937	1.39e-08	-0.120285	43	0.020259	yes	SPLEEN
chr2_33616325_C_T_b38	RASGRP3	5.82	2.53e-08	0.188241	4	0.032343	yes	SPLEEN
chr2_33605827_ATTTTTCT_A_b38	RASGRP3	5.754	3.54e-08	0.185946	4	0.032318	yes	SPLEEN
chr2_33512820_T_A_b38	RASGRP3	-5.73	3.99e-08	-0.118438	36	0.020671	yes	SPLEEN
chr2_33536322_G_GA_b38	RASGRP3	5.723	4.14e-08	0.198341	3	0.03466	yes	SPLEEN
chr2_33518114_A_G_b38	RASGRP3	-5.638	6.32e-08	-0.118231	33	0.020972	yes	SPLEEN
chr2_33627793_A_G_b38	RASGRP3	5.542	1.01e-07	0.174488	5	0.031487	yes	SPLEEN
chr2_33606703_C_T_b38	RASGRP3	5.536	1.04e-07	0.180611	4	0.032625	yes	SPLEEN
chr2_33661156_C_T_b38	RASGRP3	5.441	1.66e-07	0.131971	16	0.024257	yes	SPLEEN
chr2_33661310_C_T_b38	RASGRP3	5.441	1.66e-07	0.131971	16	0.024257	yes	SPLEEN
chr2_33634524_A_G_b38	RASGRP3	5.407	1.95e-07	0.17237	5	0.031877	yes	SPLEEN
chr2_33634816_G_T_b38	RASGRP3	5.407	1.95e-07	0.17237	5	0.031877	yes	SPLEEN
chr2_33622592_T_C_b38	RASGRP3	5.399	2.03e-07	0.12782	25	0.023676	yes	SPLEEN
chr2_33667549_A_G_b38	RASGRP3	5.304	3.2e-07	0.168497	5	0.031771	yes	SPLEEN
chr2_33667555_A_G_b38	RASGRP3	5.304	3.2e-07	0.168497	5	0.031771	yes	SPLEEN
chr2_33636858_C_G_b38	RASGRP3	5.293	3.36e-07	0.167637	5	0.03167	yes	SPLEEN
chr2_33637736_A_T_b38	RASGRP3	5.293	3.36e-07	0.167637	5	0.03167	yes	SPLEEN
chr2_33659035_G_A_b38	RASGRP3	5.29	3.41e-07	0.171609	4	0.03244	yes	SPLEEN
chr2_33514489_T_C_b38	RASGRP3	-5.226	4.62e-07	-0.107458	41	0.020562	yes	SPLEEN
chr2_33640513_G_C_b38	RASGRP3	5.166	6.14e-07	0.165889	4	0.032114	yes	SPLEEN
chr2_33512902_A_G_b38	RASGRP3	-5.109	8.01e-07	-0.105449	57	0.020642	yes	SPLEEN
chr2_33672387_A_G_b38	RASGRP3	5.008	1.27e-06	0.142946	9	0.028541	yes	SPLEEN
chr2_33523461_TA_T_b38	RASGRP3	5.002	1.31e-06	0.142319	5	0.028453	yes	SPLEEN
chr2_33656848_TA_T_b38	RASGRP3	4.895	2.12e-06	0.119398	21	0.02439	yes	SPLEEN
chr2_33520141_T_C_b38	RASGRP3	-4.885	2.22e-06	-0.101686	53	0.020814	yes	SPLEEN
chr2_33669427_A_C_b38	RASGRP3	4.852	2.58e-06	0.14098	8	0.029058	yes	SPLEEN
chr2_33518880_G_GTCA_b38	RASGRP3	-4.714	4.75e-06	-0.099113	53	0.021024	yes	SPLEEN
chr2_33669574_A_G_b38	RASGRP3	4.653	6.19e-06	0.133943	8	0.028785	yes	SPLEEN
chr2_33548381_A_AAAG_b38	RASGRP3	4.505	1.17e-05	0.160336	4	0.035593	yes	SPLEEN
chr2_33564001_C_G_b38	RASGRP3	4.483	1.29e-05	0.106805	33	0.023826	yes	SPLEEN
chr2_33624881_G_GT_b38	RASGRP3	4.456	1.44e-05	0.109366	20	0.024543	yes	SPLEEN
chr2_33631243_G_GT_b38	RASGRP3	4.443	1.52e-05	0.148976	4	0.033529	yes	SPLEEN
chr2_33571267_T_A_b38	RASGRP3	-4.262	3.21e-05	-0.09198	46	0.02158	yes	SPLEEN
chr2_33515662_T_C_b38	RASGRP3	4.261	3.23e-05	0.129025	7	0.030282	yes	SPLEEN
chr2_33656916_G_A_b38	RASGRP3	4.257	3.29e-05	0.104082	26	0.024452	yes	SPLEEN
chr2_33626436_A_T_b38	RASGRP3	4.245	3.45e-05	0.105507	22	0.024856	yes	SPLEEN
chr2_33634843_C_CTT_b38	RASGRP3	4.241	3.5e-05	0.148972	5	0.035125	yes	SPLEEN
chr2_33613720_G_A_b38	RASGRP3	4.198	4.17e-05	0.131454	7	0.031313	yes	SPLEEN
chr2_33543901_C_G_b38	RASGRP3	-4.191	4.29e-05	-0.08991	37	0.021454	yes	SPLEEN
chr2_33572204_C_A_b38	RASGRP3	-4.106	6.02e-05	-0.088932	46	0.021659	yes	SPLEEN
chr2_33564467_A_G_b38	RASGRP3	4.033	8.02e-05	0.095749	35	0.023739	yes	SPLEEN
chr2_33577889_G_A_b38	RASGRP3	-3.943	0.000114	-0.085557	45	0.021701	yes	SPLEEN
chr2_33575950_G_A_b38	RASGRP3	-3.902	0.000133	-0.085161	44	0.021826	yes	SPLEEN
chr2_33568339_TA_T_b38	RASGRP3	-3.814	0.000186	-0.08201	52	0.021504	yes	SPLEEN
chr2_33547458_G_A_b38	RASGRP3	3.808	0.00019	0.088748	33	0.023306	yes	SPLEEN
chr2_33539533_G_T_b38	RASGRP3	-3.796	0.000199	-0.07486	61	0.019722	yes	SPLEEN
chr2_33539996_AAAAAG_A_b38	RASGRP3	-3.794	2e-04	-0.083751	50	0.022072	yes	SPLEEN
chr2_33536322_GA_G_b38	RASGRP3	-3.692	0.000292	-0.086039	39	0.023301	yes	SPLEEN
chr2_33541741_G_T_b38	RASGRP3	-3.588	0.000427	-0.070403	61	0.019624	yes	SPLEEN
chr2_33540888_T_C_b38	RASGRP3	-3.559	0.000472	-0.069891	61	0.019637	yes	SPLEEN
chr2_33604404_G_GTA_b38	RASGRP3	3.49	0.000602	0.116704	3	0.033435	yes	SPLEEN
chr2_33637426_T_A_b38	RASGRP3	3.408	0.000803	0.103061	8	0.030244	yes	SPLEEN
chr2_33508487_T_C_b38	RASGRP3	3.381	0.00088	0.112768	8	0.033354	yes	SPLEEN
chr2_33540615_TTCTC_T_b38	RASGRP3	-3.358	0.000951	-0.069629	49	0.020732	yes	SPLEEN
chr2_33509059_T_G_b38	RASGRP3	-3.273	0.00127	-0.097217	9	0.029701	yes	SPLEEN
chr2_33515788_C_T_b38	RASGRP3	-3.259	0.00133	-0.108812	4	0.033392	yes	SPLEEN
chr2_33670200_G_T_b38	RASGRP3	-3.206	0.00158	-0.07493	35	0.023372	yes	SPLEEN
chr2_32768989_T_G_b38	RASGRP3	-3.199	0.00162	-0.094567	6	0.029558	yes	SPLEEN
chr2_33669621_C_T_b38	RASGRP3	-3.131	0.00202	-0.073576	34	0.023497	yes	SPLEEN
chr2_33669751_C_T_b38	RASGRP3	-3.131	0.00202	-0.073576	34	0.023497	yes	SPLEEN
chr2_33525341_AAT_A_b38	RASGRP3	-3.113	0.00215	-0.103971	3	0.033402	yes	SPLEEN
chr2_33582793_C_G_b38	RASGRP3	3.112	0.00215	0.071816	27	0.023078	yes	SPLEEN
chr2_33532487_C_A_b38	RASGRP3	3.071	0.00245	0.068129	52	0.022183	yes	SPLEEN
chr2_33601894_C_G_b38	RASGRP3	3.046	0.00265	0.070069	28	0.023002	yes	SPLEEN
chr2_33535943_T_C_b38	RASGRP3	-3.004	0.00304	-0.095684	5	0.031856	yes	SPLEEN
chr2_33648229_A_G_b38	RASGRP3	3.002	0.00306	0.075645	16	0.025202	yes	SPLEEN
chr2_33664871_G_GT_b38	RASGRP3	-2.993	0.00313	-0.067051	45	0.022399	yes	SPLEEN
chr2_32776877_C_T_b38	RASGRP3	-2.992	0.00315	-0.090571	5	0.030276	yes	SPLEEN
chr2_32781092_G_A_b38	RASGRP3	2.992	0.00315	0.090571	5	0.030276	yes	SPLEEN
chr2_32781435_A_T_b38	RASGRP3	2.992	0.00315	0.090571	5	0.030276	yes	SPLEEN
chr2_33151823_TTGTGTGTGTGTG_T_b38	RASGRP3	2.991	0.00315	0.121305	6	0.040551	yes	SPLEEN
chr2_32753523_T_C_b38	RASGRP3	-2.99	0.00317	-0.090708	5	0.030341	yes	SPLEEN
chr2_32754679_C_G_b38	RASGRP3	-2.99	0.00317	-0.090708	5	0.030341	yes	SPLEEN
chr2_33588900_A_AT_b38	RASGRP3	-2.989	0.00317	-0.068982	39	0.023076	yes	SPLEEN
chr2_32754549_C_T_b38	RASGRP3	-2.986	0.00321	-0.090728	5	0.030388	yes	SPLEEN
chr2_33554839_T_C_b38	RASGRP3	2.984	0.00323	0.069705	34	0.023359	yes	SPLEEN
chr2_33532968_G_A_b38	RASGRP3	-2.968	0.00339	-0.101329	3	0.034139	yes	SPLEEN
chr2_33664742_G_C_b38	RASGRP3	-2.966	0.00341	-0.064514	50	0.021749	yes	SPLEEN
chr2_33666591_A_G_b38	RASGRP3	-2.957	0.00351	-0.065216	51	0.022056	yes	SPLEEN
chr2_32739634_G_C_b38	RASGRP3	-2.95	0.00359	-0.083178	8	0.028197	yes	SPLEEN
chr2_33540561_TGTGTGTGTGTGTGTGTG_T_b38	RASGRP3	-2.948	0.00361	-0.065589	38	0.022248	yes	SPLEEN
chr2_33591195_C_CT_b38	RASGRP3	-2.932	0.00379	-0.072884	27	0.024856	yes	SPLEEN
chr2_33661861_G_A_b38	RASGRP3	-2.93	0.00382	-0.065189	45	0.022251	yes	SPLEEN
chr2_33663649_A_C_b38	RASGRP3	-2.912	0.00403	-0.064288	48	0.022078	yes	SPLEEN
chr2_33661731_A_G_b38	RASGRP3	-2.905	0.00411	-0.063496	49	0.021855	yes	SPLEEN
chr2_33664465_T_A_b38	RASGRP3	-2.905	0.00411	-0.063496	49	0.021855	yes	SPLEEN
chr2_33539219_T_C_b38	RASGRP3	-2.902	0.00416	-0.066639	35	0.022965	yes	SPLEEN
chr2_33659127_A_G_b38	RASGRP3	-2.898	0.00421	-0.063374	50	0.02187	yes	SPLEEN
chr2_32750602_G_A_b38	RASGRP3	-2.883	0.0044	-0.087116	5	0.030214	yes	SPLEEN
chr2_32788689_C_A_b38	RASGRP3	2.883	0.0044	0.087116	5	0.030214	yes	SPLEEN
chr2_32748781_A_G_b38	RASGRP3	-2.868	0.00461	-0.087352	5	0.030457	yes	SPLEEN
chr2_32770697_T_C_b38	RASGRP3	-2.868	0.00461	-0.087352	5	0.030457	yes	SPLEEN
chr2_32770911_A_G_b38	RASGRP3	-2.868	0.00461	-0.087352	5	0.030457	yes	SPLEEN
chr2_32773501_A_G_b38	RASGRP3	-2.868	0.00461	-0.087352	5	0.030457	yes	SPLEEN
chr2_32774081_G_A_b38	RASGRP3	-2.868	0.00461	-0.087352	5	0.030457	yes	SPLEEN
chr2_33587735_T_A_b38	RASGRP3	2.858	0.00475	0.065131	28	0.02279	yes	SPLEEN
chr2_33536207_C_T_b38	RASGRP3	-2.848	0.00489	-0.066003	33	0.023172	yes	SPLEEN
chr2_33596666_T_C_b38	RASGRP3	2.825	0.00524	0.065073	26	0.023035	yes	SPLEEN
chr2_32753076_C_G_b38	RASGRP3	-2.819	0.00533	-0.083486	6	0.029612	yes	SPLEEN
chr2_32742993_T_C_b38	RASGRP3	-2.816	0.00538	-0.08541	5	0.030329	yes	SPLEEN
chr2_33093442_C_G_b38	RASGRP3	-2.808	0.00552	-0.087941	8	0.03132	yes	SPLEEN
chr2_33598472_A_C_b38	RASGRP3	2.807	0.00553	0.067281	20	0.023966	yes	SPLEEN
chr2_33653281_C_CCTGT_b38	RASGRP3	2.804	0.00559	0.089771	4	0.032019	yes	SPLEEN
chr2_33527085_G_T_b38	RASGRP3	-2.803	0.00561	-0.087517	6	0.031228	yes	SPLEEN
chr2_33605951_T_C_b38	RASGRP3	-2.767	0.00623	-0.060117	50	0.021728	yes	SPLEEN
chr2_34368823_G_T_b38	RASGRP3	2.759	0.00638	0.133212	5	0.048287	yes	SPLEEN
chr2_33508652_C_G_b38	RASGRP3	2.744	0.00666	0.065658	31	0.023928	yes	SPLEEN
chr2_33534062_A_C_b38	RASGRP3	-2.73	0.00694	-0.088563	4	0.032438	yes	SPLEEN
chr2_33591739_A_G_b38	RASGRP3	2.729	0.00696	0.065778	20	0.024103	yes	SPLEEN
chr2_33539434_T_C_b38	RASGRP3	-2.725	0.00704	-0.06299	34	0.023112	yes	SPLEEN
chr2_33539436_C_G_b38	RASGRP3	-2.725	0.00704	-0.06299	34	0.023112	yes	SPLEEN
chr2_34309734_T_G_b38	RASGRP3	2.72	0.00715	0.13319	3	0.048966	yes	SPLEEN
chr2_34310345_A_T_b38	RASGRP3	2.72	0.00715	0.13319	3	0.048966	yes	SPLEEN
chr2_33538452_G_A_b38	RASGRP3	-2.719	0.00716	-0.093218	3	0.034278	yes	SPLEEN
chr2_33543280_C_G_b38	RASGRP3	-2.719	0.00716	-0.093218	3	0.034278	yes	SPLEEN
chr2_33556890_T_TACACAC_b38	RASGRP3	-2.703	0.00751	-0.085891	6	0.031777	yes	SPLEEN
chr2_33546150_G_A_b38	RASGRP3	-2.696	0.00766	-0.06194	34	0.022974	yes	SPLEEN
chr2_32752674_G_A_b38	RASGRP3	-2.696	0.00766	-0.081449	5	0.030212	yes	SPLEEN
chr2_32801684_G_T_b38	RASGRP3	2.695	0.00768	0.077308	8	0.028684	yes	SPLEEN
chr2_32801685_G_C_b38	RASGRP3	2.695	0.00768	0.077308	8	0.028684	yes	SPLEEN
chr2_32771489_C_G_b38	RASGRP3	-2.693	0.00773	-0.082151	5	0.030507	yes	SPLEEN
chr2_33563470_A_ATACT_b38	RASGRP3	-2.689	0.00782	-0.098358	3	0.036577	yes	SPLEEN
chr2_34354488_G_A_b38	RASGRP3	2.689	0.00782	0.136771	5	0.050863	yes	SPLEEN
chr2_33644161_T_C_b38	RASGRP3	2.688	0.00783	0.066373	19	0.024688	yes	SPLEEN
chr2_33535555_G_GC_b38	RASGRP3	-2.685	0.00792	-0.086326	5	0.032156	yes	SPLEEN
chr2_33528012_T_G_b38	RASGRP3	-2.666	0.00836	-0.077511	10	0.029076	yes	SPLEEN
chr2_33592814_T_C_b38	RASGRP3	2.648	0.0088	0.063469	20	0.02397	yes	SPLEEN
chr2_33601612_AT_A_b38	RASGRP3	2.647	0.00881	0.062522	24	0.023618	yes	SPLEEN
chr2_33538430_G_C_b38	RASGRP3	-2.646	0.00884	-0.087928	4	0.033231	yes	SPLEEN
chr2_33544520_G_GA_b38	RASGRP3	-2.645	0.00886	-0.062687	34	0.023697	yes	SPLEEN
chr2_33671654_G_A_b38	RASGRP3	2.643	0.00891	0.067954	15	0.025709	yes	SPLEEN
chr2_32791739_G_A_b38	RASGRP3	2.637	0.00908	0.075379	8	0.028589	yes	SPLEEN
chr2_32736473_A_G_b38	RASGRP3	-2.634	0.00915	-0.059793	46	0.022701	yes	SPLEEN
chr2_33669785_CA_C_b38	RASGRP3	-2.63	0.00926	-0.063276	32	0.024061	yes	SPLEEN
chr2_33591518_C_T_b38	RASGRP3	2.63	0.00926	0.062868	20	0.023908	yes	SPLEEN
chr2_33091214_G_A_b38	RASGRP3	-2.628	0.00931	-0.084812	7	0.032273	yes	SPLEEN
chr2_32607975_C_CA_b38	RASGRP3	-2.605	0.00993	-0.076896	13	0.02952	yes	SPLEEN
chr2_33523846_A_G_b38	RASGRP3	-2.604	0.00996	-0.073803	10	0.028344	yes	SPLEEN
chr2_33546942_C_G_b38	RASGRP3	9.138	1.1e-16	0.264278	4	0.028922	no	SPLEEN
chr2_33537330_C_CCCAACACA_b38	RASGRP3	8.529	5.06e-15	0.214207	13	0.025115	no	SPLEEN
chr2_33586869_A_T_b38	RASGRP3	7.979	1.47e-13	0.186111	16	0.023326	no	SPLEEN
chr2_33540561_TGTGTGTGTGTG_T_b38	RASGRP3	7.589	1.51e-12	0.216674	8	0.028552	no	SPLEEN
chr2_33596617_C_T_b38	RASGRP3	7.122	2.25e-11	0.169988	16	0.023867	no	SPLEEN
chr2_33639021_G_A_b38	RASGRP3	6.058	7.49e-09	0.145843	14	0.024075	no	SPLEEN
chr2_33641397_G_C_b38	RASGRP3	6.058	7.49e-09	0.145843	14	0.024075	no	SPLEEN
chr2_33640631_A_C_b38	RASGRP3	5.992	1.05e-08	0.144126	14	0.024052	no	SPLEEN
chr2_33590881_T_C_b38	RASGRP3	5.98	1.12e-08	0.13388	21	0.022389	no	SPLEEN
chr2_33596450_T_G_b38	RASGRP3	5.948	1.32e-08	0.134272	21	0.022573	no	SPLEEN
chr2_33589264_G_C_b38	RASGRP3	5.829	2.42e-08	0.131295	21	0.022526	no	SPLEEN
chr2_33622160_C_T_b38	RASGRP3	5.78	3.1e-08	0.131242	22	0.022707	no	SPLEEN
chr2_33563965_A_G_b38	RASGRP3	5.411	1.91e-07	0.159537	7	0.029485	no	SPLEEN
chr2_33581900_A_T_b38	RASGRP3	5.258	3.98e-07	0.155751	7	0.029623	no	SPLEEN
chr2_33670716_C_T_b38	RASGRP3	5.23	4.54e-07	0.125519	17	0.024002	no	SPLEEN
chr2_33581338_T_A_b38	RASGRP3	5.193	5.39e-07	0.154169	7	0.029686	no	SPLEEN
chr2_33621819_C_A_b38	RASGRP3	5.1	8.33e-07	0.111801	26	0.021922	no	SPLEEN
chr2_33623108_T_C_b38	RASGRP3	4.979	1.46e-06	0.11109	26	0.022314	no	SPLEEN
chr2_33625315_G_A_b38	RASGRP3	4.829	2.85e-06	0.117583	19	0.024348	no	SPLEEN
chr2_33569371_A_G_b38	RASGRP3	-4.177	4.53e-05	-0.09008	48	0.021564	no	SPLEEN
chr2_33537321_C_CA_b38	RASGRP3	4.161	4.83e-05	0.098428	26	0.023653	no	SPLEEN
chr2_33571342_T_C_b38	RASGRP3	-4.129	5.5e-05	-0.089035	46	0.021565	no	SPLEEN
chr2_33567745_C_T_b38	RASGRP3	-4.121	5.68e-05	-0.088495	43	0.021475	no	SPLEEN
chr2_33514230_T_G_b38	RASGRP3	3.723	0.000261	0.112151	7	0.030123	no	SPLEEN
chr2_33607432_G_A_b38	RASGRP3	3.599	0.000409	0.124796	3	0.034671	no	SPLEEN
chr2_33561192_A_G_b38	RASGRP3	3.578	0.000442	0.079338	56	0.022174	no	SPLEEN
chr2_33615450_C_G_b38	RASGRP3	3.525	0.000532	0.12087	3	0.034286	no	SPLEEN
chr2_33395286_T_C_b38	RASGRP3	-3.474	0.000639	-0.118827	3	0.034208	no	SPLEEN
chr2_33615793_A_T_b38	RASGRP3	3.425	0.000757	0.116578	3	0.034038	no	SPLEEN
chr2_33621944_G_A_b38	RASGRP3	3.425	0.000757	0.116578	3	0.034038	no	SPLEEN
chr2_33623483_C_T_b38	RASGRP3	3.425	0.000757	0.116578	3	0.034038	no	SPLEEN
chr2_33571586_T_C_b38	RASGRP3	-3.333	0.00104	-0.068938	56	0.020685	no	SPLEEN
chr2_33631252_G_T_b38	RASGRP3	3.234	0.00144	0.072714	58	0.022481	no	SPLEEN
chr2_33677515_A_G_b38	RASGRP3	3.213	0.00155	0.104654	5	0.032577	no	SPLEEN
chr2_33534694_A_AT_b38	RASGRP3	3.16	0.00184	0.090039	13	0.028497	no	SPLEEN
chr2_33620575_G_A_b38	RASGRP3	3.159	0.00185	0.086533	11	0.027393	no	SPLEEN
chr2_33404874_A_G_b38	RASGRP3	3.145	0.00193	0.076748	30	0.024403	no	SPLEEN
chr2_33525699_C_CAA_b38	RASGRP3	3.115	0.00213	0.153442	5	0.049259	no	SPLEEN
chr2_33620497_T_C_b38	RASGRP3	3.112	0.00215	0.085152	11	0.027361	no	SPLEEN
chr2_33611855_A_C_b38	RASGRP3	3.065	0.0025	0.100094	4	0.032661	no	SPLEEN
chr2_33283061_C_CAA_b38	RASGRP3	-3.031	0.00279	-0.11693	5	0.038579	no	SPLEEN
chr2_33647762_A_G_b38	RASGRP3	3.018	0.00291	0.071063	30	0.02355	no	SPLEEN
chr2_32797173_CA_C_b38	RASGRP3	-2.975	0.00332	-0.085556	8	0.028763	no	SPLEEN
chr2_33753784_C_A_b38	RASGRP3	2.972	0.00335	0.068198	33	0.022948	no	SPLEEN
chr2_33653960_T_C_b38	RASGRP3	2.952	0.00357	0.069443	31	0.023525	no	SPLEEN
chr2_32806634_T_C_b38	RASGRP3	-2.929	0.00382	-0.067566	33	0.023066	no	SPLEEN
chr2_33654678_C_T_b38	RASGRP3	2.878	0.00447	0.067723	33	0.023531	no	SPLEEN
chr2_33537323_G_A_b38	RASGRP3	2.856	0.00479	0.060185	55	0.021077	no	SPLEEN
chr2_32808012_C_CA_b38	RASGRP3	-2.838	0.00504	-0.065318	31	0.023015	no	SPLEEN
chr2_32809487_T_C_b38	RASGRP3	-2.838	0.00504	-0.065318	31	0.023015	no	SPLEEN
chr2_32810369_T_C_b38	RASGRP3	-2.838	0.00504	-0.065318	31	0.023015	no	SPLEEN
chr2_33620413_GA_G_b38	RASGRP3	2.817	0.00538	0.092682	3	0.032906	no	SPLEEN
chr2_33347117_C_CAA_b38	RASGRP3	-2.814	0.00542	-0.116307	4	0.041334	no	SPLEEN
chr2_32804252_T_G_b38	RASGRP3	-2.766	0.00625	-0.064995	32	0.023499	no	SPLEEN
chr2_32793321_A_G_b38	RASGRP3	-2.745	0.00664	-0.064793	32	0.023603	no	SPLEEN
chr2_32812092_T_C_b38	RASGRP3	-2.744	0.00666	-0.062799	31	0.022884	no	SPLEEN
chr2_33403407_C_T_b38	RASGRP3	-2.72	0.00714	-0.099027	3	0.036403	no	SPLEEN
chr2_32791407_G_C_b38	RASGRP3	-2.715	0.00724	-0.064557	32	0.023774	no	SPLEEN
chr2_32764048_C_T_b38	RASGRP3	-2.715	0.00726	-0.062448	40	0.023004	no	SPLEEN
chr2_33520335_A_G_b38	RASGRP3	-2.71	0.00736	-0.06224	36	0.022969	no	SPLEEN
chr2_33592492_A_G_b38	RASGRP3	-2.705	0.00746	-0.058069	48	0.021465	no	SPLEEN
chr2_32792961_T_C_b38	RASGRP3	-2.697	0.00764	-0.062338	40	0.023115	no	SPLEEN
chr2_32795635_T_C_b38	RASGRP3	-2.693	0.00772	-0.062141	40	0.023072	no	SPLEEN
chr2_33556190_G_A_b38	RASGRP3	-2.693	0.00773	-0.063695	31	0.023652	no	SPLEEN
chr2_33562245_G_C_b38	RASGRP3	-2.685	0.0079	-0.06261	33	0.023317	no	SPLEEN
chr2_32791745_T_C_b38	RASGRP3	-2.676	0.00811	-0.0622	39	0.023242	no	SPLEEN
chr2_32785937_A_AGT_b38	RASGRP3	-2.667	0.00834	-0.06113	45	0.022924	no	SPLEEN
chr2_33723260_A_C_b38	RASGRP3	-2.663	0.00843	-0.058276	59	0.021887	no	SPLEEN
chr2_33529319_G_C_b38	RASGRP3	-2.657	0.00856	-0.062676	33	0.023587	no	SPLEEN
chr2_33615675_TA_T_b38	RASGRP3	-2.651	0.00873	-0.058063	42	0.021906	no	SPLEEN
chr2_33590404_A_G_b38	RASGRP3	-2.636	0.00911	-0.056786	48	0.021545	no	SPLEEN
chr2_33767078_T_A_b38	RASGRP3	2.629	0.00927	0.060474	29	0.022998	no	SPLEEN
chr2_33723681_A_G_b38	RASGRP3	-2.627	0.00934	-0.058003	56	0.022083	no	SPLEEN
chr2_32796213_A_G_b38	RASGRP3	-2.623	0.00945	-0.061371	34	0.0234	no	SPLEEN
chr2_33593131_C_T_b38	RASGRP3	-2.612	0.00974	-0.056563	47	0.021655	no	SPLEEN
chr2_33577835_T_C_b38	RASGRP3	-2.611	0.00976	-0.056204	49	0.021526	no	SPLEEN
chr2_33614957_G_A_b38	RASGRP3	-2.608	0.00983	-0.056153	43	0.021527	no	SPLEEN
chr2_33766727_A_G_b38	RASGRP3	2.604	0.00997	0.060216	28	0.023128	no	SPLEEN
chr2_33559068_A_G_b38	RASGRP3	8.626	5.67e-16	0.197128	5	0.022852	yes	STMACH
chr2_33557635_G_A_b38	RASGRP3	8.472	1.62e-15	0.193403	5	0.022829	yes	STMACH
chr2_33559304_G_A_b38	RASGRP3	8.459	1.76e-15	0.193789	5	0.022908	yes	STMACH
chr2_33559734_G_A_b38	RASGRP3	8.391	2.8e-15	0.190953	5	0.022757	yes	STMACH
chr2_33557844_G_A_b38	RASGRP3	8.345	3.81e-15	0.18258	7	0.021878	yes	STMACH
chr2_33536526_G_A_b38	RASGRP3	8.31	4.83e-15	0.199341	4	0.023988	yes	STMACH
chr2_33536528_G_A_b38	RASGRP3	8.31	4.83e-15	0.199341	4	0.023988	yes	STMACH
chr2_33531453_C_T_b38	RASGRP3	8.277	6.02e-15	0.188985	5	0.022833	yes	STMACH
chr2_33537896_A_G_b38	RASGRP3	8.271	6.28e-15	0.189597	5	0.022924	yes	STMACH
chr2_33526597_C_T_b38	RASGRP3	8.19	1.08e-14	0.190244	5	0.023229	yes	STMACH
chr2_33527062_GC_G_b38	RASGRP3	8.19	1.08e-14	0.190244	5	0.023229	yes	STMACH
chr2_33529269_C_A_b38	RASGRP3	8.047	2.77e-14	0.17952	6	0.022309	yes	STMACH
chr2_33548762_A_G_b38	RASGRP3	7.901	7.19e-14	0.189552	4	0.023991	yes	STMACH
chr2_33548469_T_C_b38	RASGRP3	7.758	1.81e-13	0.185918	4	0.023964	yes	STMACH
chr2_33550216_T_A_b38	RASGRP3	7.694	2.74e-13	0.180017	5	0.023397	yes	STMACH
chr2_33550484_C_G_b38	RASGRP3	7.693	2.75e-13	0.181272	5	0.023563	yes	STMACH
chr2_33554542_A_G_b38	RASGRP3	7.693	2.75e-13	0.181272	5	0.023563	yes	STMACH
chr2_33553995_C_T_b38	RASGRP3	7.678	3.03e-13	0.183275	4	0.02387	yes	STMACH
chr2_33551676_A_G_b38	RASGRP3	7.678	3.03e-13	0.188553	3	0.024558	yes	STMACH
chr2_33551697_A_T_b38	RASGRP3	7.678	3.03e-13	0.188553	3	0.024558	yes	STMACH
chr2_33552022_CAAACA_C_b38	RASGRP3	7.611	4.65e-13	0.183496	4	0.02411	yes	STMACH
chr2_33546942_C_G_b38	RASGRP3	7.418	1.57e-12	0.16977	7	0.022886	yes	STMACH
chr2_33561445_C_A_b38	RASGRP3	6.714	1.13e-10	0.133358	15	0.019863	yes	STMACH
chr2_33529318_C_T_b38	RASGRP3	6.7	1.22e-10	0.135587	11	0.020237	yes	STMACH
chr2_33556928_C_CACACACATACAT_b38	RASGRP3	6.532	3.24e-10	0.158187	3	0.024216	yes	STMACH
chr2_33512177_G_A_b38	RASGRP3	6.409	6.58e-10	0.132431	13	0.020665	yes	STMACH
chr2_33537192_G_GAT_b38	RASGRP3	6.293	1.27e-09	0.147716	4	0.023473	yes	STMACH
chr2_33586869_A_T_b38	RASGRP3	6.204	2.08e-09	0.116426	23	0.018765	yes	STMACH
chr2_33523649_G_A_b38	RASGRP3	6.117	3.37e-09	0.125877	14	0.020579	yes	STMACH
chr2_33555164_G_A_b38	RASGRP3	5.961	7.85e-09	0.122643	13	0.020572	yes	STMACH
chr2_33581561_C_T_b38	RASGRP3	5.835	1.55e-08	0.111001	22	0.019025	yes	STMACH
chr2_33596963_A_T_b38	RASGRP3	5.813	1.73e-08	0.11013	24	0.018944	yes	STMACH
chr2_33565263_A_G_b38	RASGRP3	5.659	3.92e-08	0.104396	30	0.018449	yes	STMACH
chr2_33547053_GAA_G_b38	RASGRP3	5.651	4.07e-08	0.18255	3	0.032302	yes	STMACH
chr2_33511010_G_A_b38	RASGRP3	5.645	4.2e-08	0.149443	5	0.026473	yes	STMACH
chr2_33594326_C_T_b38	RASGRP3	5.495	9.07e-08	0.105209	23	0.019145	yes	STMACH
chr2_33594385_G_A_b38	RASGRP3	5.495	9.07e-08	0.105209	23	0.019145	yes	STMACH
chr2_33596617_C_T_b38	RASGRP3	5.495	9.07e-08	0.105209	23	0.019145	yes	STMACH
chr2_33582025_C_T_b38	RASGRP3	5.488	9.41e-08	0.105382	21	0.019202	yes	STMACH
chr2_33525341_A_AAT_b38	RASGRP3	5.401	1.46e-07	0.102817	18	0.019038	yes	STMACH
chr2_33557001_G_GA_b38	RASGRP3	5.345	1.94e-07	0.192313	3	0.035981	yes	STMACH
chr2_33579727_C_T_b38	RASGRP3	5.305	2.36e-07	0.174202	4	0.032837	yes	STMACH
chr2_33590881_T_C_b38	RASGRP3	5.239	3.27e-07	0.094163	28	0.017974	yes	STMACH
chr2_33521266_C_T_b38	RASGRP3	5.138	5.36e-07	0.096685	23	0.018818	yes	STMACH
chr2_33596450_T_G_b38	RASGRP3	5.125	5.69e-07	0.092506	29	0.018049	yes	STMACH
chr2_33589264_G_C_b38	RASGRP3	5.081	7.03e-07	0.091887	28	0.018083	yes	STMACH
chr2_33622160_C_T_b38	RASGRP3	5.059	7.84e-07	0.092599	25	0.018305	yes	STMACH
chr2_33573675_A_G_b38	RASGRP3	5.016	9.61e-07	0.172538	3	0.034397	yes	STMACH
chr2_33662459_C_T_b38	RASGRP3	4.962	1.24e-06	0.09515	18	0.019176	yes	STMACH
chr2_33639021_G_A_b38	RASGRP3	4.859	2.01e-06	0.094424	17	0.019431	yes	STMACH
chr2_33663555_T_C_b38	RASGRP3	4.839	2.21e-06	0.093368	18	0.019296	yes	STMACH
chr2_33650021_A_G_b38	RASGRP3	4.813	2.49e-06	0.093184	17	0.019362	yes	STMACH
chr2_33656248_TTC_T_b38	RASGRP3	4.813	2.49e-06	0.093184	17	0.019362	yes	STMACH
chr2_33592302_T_C_b38	RASGRP3	4.74	3.48e-06	0.157357	4	0.033198	yes	STMACH
chr2_33640631_A_C_b38	RASGRP3	4.697	4.22e-06	0.091317	17	0.019441	yes	STMACH
chr2_33641397_G_C_b38	RASGRP3	4.697	4.22e-06	0.091317	17	0.019441	yes	STMACH
chr2_33652477_C_A_b38	RASGRP3	4.563	7.68e-06	0.088531	17	0.019401	yes	STMACH
chr2_33621819_C_A_b38	RASGRP3	4.557	7.91e-06	0.081754	30	0.017942	yes	STMACH
chr2_33508487_T_C_b38	RASGRP3	4.552	8.06e-06	0.121507	8	0.026692	yes	STMACH
chr2_33622592_T_C_b38	RASGRP3	4.466	1.17e-05	0.080961	30	0.018127	yes	STMACH
chr2_33657078_T_C_b38	RASGRP3	4.461	1.2e-05	0.080524	30	0.01805	yes	STMACH
chr2_33623108_T_C_b38	RASGRP3	4.292	2.48e-05	0.077721	30	0.01811	yes	STMACH
chr2_33536322_G_GA_b38	RASGRP3	4.204	3.57e-05	0.103692	9	0.024663	yes	STMACH
chr2_33616325_C_T_b38	RASGRP3	4.133	4.79e-05	0.105409	7	0.025505	yes	STMACH
chr2_33571267_T_A_b38	RASGRP3	-4.105	5.37e-05	-0.071368	57	0.017385	yes	STMACH
chr2_33523461_TA_T_b38	RASGRP3	4.077	6.02e-05	0.089703	8	0.022003	yes	STMACH
chr2_33577889_G_A_b38	RASGRP3	-4.046	6.81e-05	-0.071593	53	0.017693	yes	STMACH
chr2_33575950_G_A_b38	RASGRP3	-4.045	6.86e-05	-0.071372	53	0.017647	yes	STMACH
chr2_33515662_T_C_b38	RASGRP3	3.97	9.23e-05	0.088812	10	0.02237	yes	STMACH
chr2_33567745_C_T_b38	RASGRP3	-3.96	9.61e-05	-0.067881	52	0.017141	yes	STMACH
chr2_33670716_C_T_b38	RASGRP3	3.949	1e-04	0.076732	20	0.01943	yes	STMACH
chr2_33569371_A_G_b38	RASGRP3	-3.946	0.000101	-0.069322	58	0.017567	yes	STMACH
chr2_33512820_T_A_b38	RASGRP3	-3.925	0.00011	-0.067665	44	0.017239	yes	STMACH
chr2_33572204_C_A_b38	RASGRP3	-3.896	0.000124	-0.068156	57	0.017495	yes	STMACH
chr2_33568339_TA_T_b38	RASGRP3	-3.895	0.000124	-0.067319	62	0.017282	yes	STMACH
chr2_33581338_T_A_b38	RASGRP3	3.869	0.000137	0.09296	9	0.024026	yes	STMACH
chr2_33514230_T_G_b38	RASGRP3	3.833	0.000158	0.081899	13	0.021369	yes	STMACH
chr2_33602942_T_C_b38	RASGRP3	3.817	0.000168	0.105506	4	0.027639	yes	STMACH
chr2_33563965_A_G_b38	RASGRP3	3.786	0.000189	0.09076	9	0.023971	yes	STMACH
chr2_33607432_G_A_b38	RASGRP3	3.757	0.000211	0.101823	4	0.027105	yes	STMACH
chr2_33661156_C_T_b38	RASGRP3	3.756	0.000212	0.07114	22	0.01894	yes	STMACH
chr2_33661310_C_T_b38	RASGRP3	3.756	0.000212	0.07114	22	0.01894	yes	STMACH
chr2_33656848_TA_T_b38	RASGRP3	3.73	0.000234	0.06949	26	0.018629	yes	STMACH
chr2_33571342_T_C_b38	RASGRP3	-3.73	0.000234	-0.065147	58	0.017466	yes	STMACH
chr2_33581900_A_T_b38	RASGRP3	3.702	0.000259	0.089068	9	0.024058	yes	STMACH
chr2_33678955_G_GTCTA_b38	RASGRP3	-3.572	0.00042	-0.063116	41	0.01767	yes	STMACH
chr2_33605827_ATTTTTCT_A_b38	RASGRP3	3.565	0.000431	0.092298	6	0.025892	yes	STMACH
chr2_33571586_T_C_b38	RASGRP3	-3.551	0.000454	-0.058079	72	0.016357	yes	STMACH
chr2_33615450_C_G_b38	RASGRP3	3.544	0.000464	0.095371	4	0.026908	yes	STMACH
chr2_33615793_A_T_b38	RASGRP3	3.544	0.000464	0.095371	4	0.026908	yes	STMACH
chr2_33621944_G_A_b38	RASGRP3	3.544	0.000464	0.095371	4	0.026908	yes	STMACH
chr2_33623483_C_T_b38	RASGRP3	3.544	0.000464	0.095371	4	0.026908	yes	STMACH
chr2_33606703_C_T_b38	RASGRP3	3.512	0.000522	0.089119	7	0.025377	yes	STMACH
chr2_33640513_G_C_b38	RASGRP3	3.502	0.000541	0.08816	7	0.025174	yes	STMACH
chr2_33659035_G_A_b38	RASGRP3	3.502	0.000541	0.08816	7	0.025174	yes	STMACH
chr2_33620413_GA_G_b38	RASGRP3	3.439	0.000676	0.086755	4	0.025225	yes	STMACH
chr2_33634524_A_G_b38	RASGRP3	3.424	0.000715	0.087004	7	0.025413	yes	STMACH
chr2_33636858_C_G_b38	RASGRP3	3.424	0.000715	0.087004	7	0.025413	yes	STMACH
chr2_33637736_A_T_b38	RASGRP3	3.424	0.000715	0.087004	7	0.025413	yes	STMACH
chr2_33603907_A_C_b38	RASGRP3	3.417	0.000733	0.086731	7	0.025385	yes	STMACH
chr2_33627793_A_G_b38	RASGRP3	3.406	0.00076	0.086055	7	0.025266	yes	STMACH
chr2_33561192_A_G_b38	RASGRP3	3.375	0.000848	0.053282	72	0.015789	yes	STMACH
chr2_33613720_G_A_b38	RASGRP3	3.274	0.0012	0.080695	8	0.02465	yes	STMACH
chr2_33514489_T_C_b38	RASGRP3	-3.27	0.00121	-0.05516	52	0.016867	yes	STMACH
chr2_33512902_A_G_b38	RASGRP3	-3.265	0.00124	-0.055828	67	0.017098	yes	STMACH
chr2_33631243_G_GT_b38	RASGRP3	3.259	0.00126	0.083073	7	0.025487	yes	STMACH
chr2_33603617_TC_T_b38	RASGRP3	3.253	0.00129	0.082465	7	0.025353	yes	STMACH
chr2_33520141_T_C_b38	RASGRP3	-3.251	0.0013	-0.055136	67	0.016962	yes	STMACH
chr2_33518114_A_G_b38	RASGRP3	-3.24	0.00135	-0.057918	40	0.017879	yes	STMACH
chr2_33656916_G_A_b38	RASGRP3	3.231	0.00139	0.060387	31	0.018688	yes	STMACH
chr2_33667549_A_G_b38	RASGRP3	3.223	0.00143	0.081628	7	0.02533	yes	STMACH
chr2_33667555_A_G_b38	RASGRP3	3.223	0.00143	0.081628	7	0.02533	yes	STMACH
chr2_33543901_C_G_b38	RASGRP3	-3.215	0.00146	-0.055696	47	0.017323	yes	STMACH
chr2_33611855_A_C_b38	RASGRP3	3.214	0.00147	0.080755	8	0.025124	yes	STMACH
chr2_33519891_C_T_b38	RASGRP3	-3.187	0.00161	-0.055533	50	0.017423	yes	STMACH
chr2_33634816_G_T_b38	RASGRP3	3.12	0.00201	0.079148	7	0.025369	yes	STMACH
chr2_32710172_A_G_b38	RASGRP3	-3.026	0.00272	-0.051991	76	0.01718	yes	STMACH
chr2_33604404_G_GTA_b38	RASGRP3	3.018	0.00279	0.080137	5	0.026556	yes	STMACH
chr2_32715957_G_GTGTTTTGTTTTTTTAAACTA_b38	RASGRP3	-3.006	0.0029	-0.05119	71	0.017028	yes	STMACH
chr2_33694154_C_A_b38	RASGRP3	-2.987	0.00308	-0.087852	4	0.029415	yes	STMACH
chr2_33694273_C_G_b38	RASGRP3	-2.987	0.00308	-0.087852	4	0.029415	yes	STMACH
chr2_33694619_C_G_b38	RASGRP3	-2.987	0.00308	-0.087852	4	0.029415	yes	STMACH
chr2_33706037_C_T_b38	RASGRP3	-2.987	0.00308	-0.087852	4	0.029415	yes	STMACH
chr2_33706458_G_A_b38	RASGRP3	-2.987	0.00308	-0.087852	4	0.029415	yes	STMACH
chr2_33089155_CAA_C_b38	RASGRP3	-2.983	0.00312	-0.076787	5	0.02574	yes	STMACH
chr2_33668030_G_A_b38	RASGRP3	2.97	0.00325	0.080664	4	0.027158	yes	STMACH
chr2_33589523_A_G_b38	RASGRP3	-2.886	0.00422	-0.048061	78	0.016652	yes	STMACH
chr2_33634843_C_CTT_b38	RASGRP3	2.885	0.00423	0.082984	7	0.028761	yes	STMACH
chr2_33593131_C_T_b38	RASGRP3	-2.867	0.00447	-0.047678	76	0.016629	yes	STMACH
chr2_32684857_G_A_b38	RASGRP3	-2.806	0.00539	-0.062485	8	0.02227	yes	STMACH
chr2_33586449_C_G_b38	RASGRP3	-2.79	0.00564	-0.046605	76	0.016702	yes	STMACH
chr2_33540888_T_C_b38	RASGRP3	-2.775	0.00591	-0.042721	93	0.015396	yes	STMACH
chr2_33541741_G_T_b38	RASGRP3	-2.769	0.00602	-0.042799	93	0.015459	yes	STMACH
chr2_33525699_C_CAA_b38	RASGRP3	2.766	0.00606	0.102928	7	0.037206	yes	STMACH
chr2_33518880_G_GTCA_b38	RASGRP3	-2.762	0.00614	-0.047661	64	0.017257	yes	STMACH
chr2_33737380_C_CT_b38	RASGRP3	2.72	0.00696	0.062895	16	0.023127	yes	STMACH
chr2_33588900_A_AT_b38	RASGRP3	-2.717	0.00702	-0.052302	53	0.019252	yes	STMACH
chr2_33597253_G_A_b38	RASGRP3	-2.704	0.00729	-0.046467	72	0.017184	yes	STMACH
chr2_33577495_T_TA_b38	RASGRP3	2.696	0.00747	0.070859	5	0.026285	yes	STMACH
chr2_33539533_G_T_b38	RASGRP3	-2.692	0.00756	-0.041378	94	0.015372	yes	STMACH
chr2_32761710_A_G_b38	RASGRP3	-2.689	0.00762	-0.053116	20	0.019753	yes	STMACH
chr2_33567211_T_TA_b38	RASGRP3	2.671	0.00803	0.088478	3	0.033128	yes	STMACH
chr2_33151823_TTGTGTGTGTGTG_T_b38	RASGRP3	2.661	0.00825	0.080547	8	0.030267	yes	STMACH
chr2_33539996_AAAAAG_A_b38	RASGRP3	-2.642	0.00873	-0.044284	78	0.016763	yes	STMACH
chr2_32792961_T_C_b38	RASGRP3	-2.622	0.00923	-0.045859	58	0.017488	yes	STMACH
chr2_33285451_C_CTT_b38	RASGRP3	2.622	0.00924	0.071156	11	0.027137	yes	STMACH
chr2_33575832_C_A_b38	RASGRP3	-2.616	0.00941	-0.043719	79	0.016714	yes	STMACH
chr2_33605951_T_C_b38	RASGRP3	-2.615	0.00942	-0.042824	81	0.016373	yes	STMACH
chr2_33781569_AGTGTGT_A_b38	RASGRP3	2.601	0.00982	0.075641	3	0.029085	yes	STMACH
chr2_32663636_TTATG_T_b38	RASGRP3	2.596	0.00995	0.045171	38	0.0174	yes	STMACH
chr2_33537330_C_CCCAACACA_b38	RASGRP3	6.981	2.3e-11	0.142485	18	0.02041	no	STMACH
chr2_33540561_TGTGTGTGTGTG_T_b38	RASGRP3	6.666	1.5e-10	0.155526	9	0.023333	no	STMACH
chr2_33564001_C_G_b38	RASGRP3	4.234	3.15e-05	0.07474	46	0.017651	no	STMACH
chr2_33625315_G_A_b38	RASGRP3	4.074	6.1e-05	0.078233	22	0.019204	no	STMACH
chr2_33564467_A_G_b38	RASGRP3	3.724	0.000239	0.066536	47	0.017869	no	STMACH
chr2_33606727_T_C_b38	RASGRP3	3.433	0.000692	0.094932	3	0.027653	no	STMACH
chr2_33624881_G_GT_b38	RASGRP3	3.312	0.00105	0.062675	24	0.018921	no	STMACH
chr2_33604404_GTA_G_b38	RASGRP3	-3.301	0.0011	-0.063705	28	0.0193	no	STMACH
chr2_34216158_A_ATGTGTGTGTGTGTG_b38	RASGRP3	3.284	0.00116	0.086655	7	0.026386	no	STMACH
chr2_33626436_A_T_b38	RASGRP3	3.236	0.00137	0.060834	26	0.018801	no	STMACH
chr2_33547458_G_A_b38	RASGRP3	3.099	0.00215	0.053867	42	0.017385	no	STMACH
chr2_33554839_T_C_b38	RASGRP3	3.096	0.00217	0.054436	40	0.01758	no	STMACH
chr2_33685499_C_G_b38	RASGRP3	-3.095	0.00218	-0.094613	3	0.030573	no	STMACH
chr2_33685690_C_T_b38	RASGRP3	-3.095	0.00218	-0.094613	3	0.030573	no	STMACH
chr2_33695574_G_A_b38	RASGRP3	-3.095	0.00218	-0.094613	3	0.030573	no	STMACH
chr2_32837214_C_T_b38	RASGRP3	-3.063	0.00241	-0.054334	61	0.017737	no	STMACH
chr2_32837414_C_T_b38	RASGRP3	-3.063	0.00241	-0.054334	61	0.017737	no	STMACH
chr2_33684367_A_G_b38	RASGRP3	-2.986	0.00309	-0.090955	3	0.030465	no	STMACH
chr2_33691352_T_G_b38	RASGRP3	-2.986	0.00309	-0.090955	3	0.030465	no	STMACH
chr2_32700964_G_A_b38	RASGRP3	-2.898	0.00407	-0.057883	17	0.019973	no	STMACH
chr2_33902327_A_ATTTTTTTTT_b38	RASGRP3	2.891	0.00415	0.067538	16	0.023361	no	STMACH
chr2_33692866_G_A_b38	RASGRP3	-2.886	0.00422	-0.084675	4	0.029342	no	STMACH
chr2_33269965_CT_C_b38	RASGRP3	-2.877	0.00434	-0.057104	31	0.019852	no	STMACH
chr2_32684415_A_G_b38	RASGRP3	-2.87	0.00443	-0.059359	13	0.020679	no	STMACH
chr2_33244860_T_TTATC_b38	RASGRP3	-2.842	0.00483	-0.048558	72	0.017085	no	STMACH
chr2_33532487_C_A_b38	RASGRP3	2.837	0.00491	0.045631	77	0.016087	no	STMACH
chr2_33537321_C_CA_b38	RASGRP3	2.826	0.00507	0.048326	42	0.017101	no	STMACH
chr2_32774183_C_CT_b38	RASGRP3	-2.771	0.00598	-0.050028	34	0.018053	no	STMACH
chr2_33270589_C_CAA_b38	RASGRP3	-2.764	0.0061	-0.05767	21	0.020862	no	STMACH
chr2_34129874_C_CTT_b38	RASGRP3	-2.748	0.00641	-0.135287	4	0.049239	no	STMACH
chr2_33622130_C_CA_b38	RASGRP3	2.71	0.00717	0.068075	11	0.025125	no	STMACH
chr2_33663649_A_C_b38	RASGRP3	-2.699	0.0074	-0.043731	79	0.016204	no	STMACH
chr2_33704218_C_T_b38	RASGRP3	-2.686	0.00769	-0.074186	5	0.027624	no	STMACH
chr2_33666591_A_G_b38	RASGRP3	-2.681	0.0078	-0.043453	79	0.01621	no	STMACH
chr2_34361913_G_A_b38	RASGRP3	-2.657	0.00836	-0.045825	70	0.017247	no	STMACH
chr2_32836541_C_CT_b38	RASGRP3	-2.644	0.00868	-0.053726	18	0.020321	no	STMACH
chr2_33642133_G_T_b38	RASGRP3	2.641	0.00876	0.045342	66	0.01717	no	STMACH
chr2_32762276_AGTGTGTGTGTGTGTGT_A_b38	RASGRP3	-2.628	0.0091	-0.056269	14	0.021415	no	STMACH
chr2_32835395_T_G_b38	RASGRP3	-2.625	0.00917	-0.046994	53	0.017904	no	STMACH
chr2_32835396_C_T_b38	RASGRP3	-2.625	0.00917	-0.046994	53	0.017904	no	STMACH
chr2_32511201_C_CTTTTTTTTT_b38	RASGRP3	2.622	0.00924	0.114495	3	0.043666	no	STMACH
chr2_34202371_A_AT_b38	RASGRP3	2.596	0.00994	0.045835	44	0.017653	no	STMACH
chr2_33478721_C_T_b38	RASGRP3	16.553	7.8e-43	0.373712	9	0.022577	yes	TESTIS
chr2_33476565_C_T_b38	RASGRP3	6.484	4.31e-10	0.234364	3	0.036148	yes	TESTIS
chr2_33478150_C_G_b38	RASGRP3	6.477	4.47e-10	0.23593	3	0.036423	yes	TESTIS
chr2_33548762_A_G_b38	RASGRP3	6.019	5.78e-09	0.224689	3	0.037332	yes	TESTIS
chr2_33478863_G_A_b38	RASGRP3	-6.006	6.2e-09	-0.140344	65	0.023368	yes	TESTIS
chr2_33478490_C_T_b38	RASGRP3	-5.791	1.96e-08	-0.128402	52	0.022171	yes	TESTIS
chr2_33548469_T_C_b38	RASGRP3	5.735	2.64e-08	0.211289	3	0.036843	yes	TESTIS
chr2_33546942_C_G_b38	RASGRP3	5.355	1.85e-07	0.196098	3	0.036623	yes	TESTIS
chr2_33550216_T_A_b38	RASGRP3	5.334	2.05e-07	0.199941	3	0.037481	yes	TESTIS
chr2_33550484_C_G_b38	RASGRP3	5.334	2.05e-07	0.199941	3	0.037481	yes	TESTIS
chr2_33554542_A_G_b38	RASGRP3	5.334	2.05e-07	0.199941	3	0.037481	yes	TESTIS
chr2_33537896_A_G_b38	RASGRP3	5.287	2.59e-07	0.192827	3	0.036474	yes	TESTIS
chr2_33553995_C_T_b38	RASGRP3	5.223	3.55e-07	0.195691	3	0.037467	yes	TESTIS
chr2_33531453_C_T_b38	RASGRP3	5.199	3.99e-07	0.179722	4	0.034568	yes	TESTIS
chr2_33559304_G_A_b38	RASGRP3	5.187	4.23e-07	0.19091	3	0.036806	yes	TESTIS
chr2_33559068_A_G_b38	RASGRP3	5.142	5.28e-07	0.189962	3	0.036946	yes	TESTIS
chr2_33476758_C_CGTGCGT_b38	RASGRP3	5.127	5.67e-07	0.166142	5	0.032407	yes	TESTIS
chr2_33552022_CAAACA_C_b38	RASGRP3	5.102	6.38e-07	0.188973	3	0.037039	yes	TESTIS
chr2_33540561_TGTGTGTGTGTG_T_b38	RASGRP3	5.097	6.55e-07	0.165867	10	0.032543	yes	TESTIS
chr2_33557635_G_A_b38	RASGRP3	5.058	7.9e-07	0.18485	3	0.036549	yes	TESTIS
chr2_33559734_G_A_b38	RASGRP3	4.953	1.3e-06	0.180962	3	0.036537	yes	TESTIS
chr2_33557844_G_A_b38	RASGRP3	4.916	1.54e-06	0.169167	5	0.034409	yes	TESTIS
chr2_33529269_C_A_b38	RASGRP3	4.814	2.47e-06	0.168462	4	0.034991	yes	TESTIS
chr2_33476758_C_CGTGTGTGTGTGTGT_b38	RASGRP3	4.76	3.18e-06	0.200981	3	0.042224	yes	TESTIS
chr2_33712857_C_T_b38	RASGRP3	4.748	3.36e-06	0.103773	79	0.021858	yes	TESTIS
chr2_33547458_G_A_b38	RASGRP3	4.721	3.79e-06	0.112606	44	0.02385	yes	TESTIS
chr2_33834769_G_A_b38	RASGRP3	-4.661	4.98e-06	-0.110187	32	0.023641	yes	TESTIS
chr2_33586869_A_T_b38	RASGRP3	4.53	8.91e-06	0.125113	17	0.02762	yes	TESTIS
chr2_33526597_C_T_b38	RASGRP3	4.487	1.07e-05	0.158986	4	0.035433	yes	TESTIS
chr2_33527062_GC_G_b38	RASGRP3	4.487	1.07e-05	0.158986	4	0.035433	yes	TESTIS
chr2_33745864_G_A_b38	RASGRP3	4.314	2.26e-05	0.09684	55	0.022448	yes	TESTIS
chr2_33733256_C_T_b38	RASGRP3	4.272	2.7e-05	0.09505	61	0.022252	yes	TESTIS
chr2_33748096_CAA_C_b38	RASGRP3	4.247	2.99e-05	0.106317	41	0.025033	yes	TESTIS
chr2_33749139_C_A_b38	RASGRP3	4.241	3.06e-05	0.097357	45	0.022954	yes	TESTIS
chr2_33741149_G_T_b38	RASGRP3	4.227	3.26e-05	0.093474	50	0.022114	yes	TESTIS
chr2_33751025_C_G_b38	RASGRP3	4.227	3.26e-05	0.093474	50	0.022114	yes	TESTIS
chr2_33554839_T_C_b38	RASGRP3	4.2	3.64e-05	0.101525	42	0.024173	yes	TESTIS
chr2_33740579_C_G_b38	RASGRP3	4.184	3.89e-05	0.092607	50	0.022133	yes	TESTIS
chr2_33746549_C_A_b38	RASGRP3	4.157	4.35e-05	0.093713	48	0.022545	yes	TESTIS
chr2_33747162_C_T_b38	RASGRP3	4.122	5.01e-05	0.096051	40	0.0233	yes	TESTIS
chr2_33742833_C_A_b38	RASGRP3	4.105	5.37e-05	0.096571	52	0.023523	yes	TESTIS
chr2_33739711_G_A_b38	RASGRP3	4.068	6.25e-05	0.094537	41	0.02324	yes	TESTIS
chr2_33740039_G_C_b38	RASGRP3	4.068	6.25e-05	0.094537	41	0.02324	yes	TESTIS
chr2_33740083_G_T_b38	RASGRP3	4.068	6.25e-05	0.094537	41	0.02324	yes	TESTIS
chr2_33740361_C_G_b38	RASGRP3	4.068	6.25e-05	0.094537	41	0.02324	yes	TESTIS
chr2_33745477_T_TCAAA_b38	RASGRP3	4.064	6.34e-05	0.09545	40	0.023484	yes	TESTIS
chr2_33547053_GAA_G_b38	RASGRP3	4.056	6.55e-05	0.18539	3	0.045706	yes	TESTIS
chr2_33739860_A_G_b38	RASGRP3	4.055	6.59e-05	0.094976	40	0.023423	yes	TESTIS
chr2_33473331_C_T_b38	RASGRP3	-4.047	6.8e-05	-0.142701	5	0.035262	yes	TESTIS
chr2_33737899_G_A_b38	RASGRP3	4.047	6.81e-05	0.094865	40	0.023443	yes	TESTIS
chr2_33752290_T_G_b38	RASGRP3	4.046	6.83e-05	0.094296	40	0.023307	yes	TESTIS
chr2_33344514_C_A_b38	RASGRP3	4.027	7.37e-05	0.114303	15	0.028385	yes	TESTIS
chr2_33740662_G_A_b38	RASGRP3	4.026	7.4e-05	0.093854	40	0.023313	yes	TESTIS
chr2_33740781_G_T_b38	RASGRP3	4.019	7.61e-05	0.093798	40	0.023339	yes	TESTIS
chr2_33740873_G_A_b38	RASGRP3	4.019	7.61e-05	0.093798	40	0.023339	yes	TESTIS
chr2_33740910_C_T_b38	RASGRP3	4.019	7.61e-05	0.093798	40	0.023339	yes	TESTIS
chr2_33741215_T_C_b38	RASGRP3	4.019	7.61e-05	0.093798	40	0.023339	yes	TESTIS
chr2_33741494_G_A_b38	RASGRP3	4.019	7.61e-05	0.093798	40	0.023339	yes	TESTIS
chr2_33741755_C_A_b38	RASGRP3	4.019	7.61e-05	0.093798	40	0.023339	yes	TESTIS
chr2_33741790_C_T_b38	RASGRP3	4.019	7.61e-05	0.093798	40	0.023339	yes	TESTIS
chr2_33741881_T_C_b38	RASGRP3	4.019	7.61e-05	0.093798	40	0.023339	yes	TESTIS
chr2_33741952_G_A_b38	RASGRP3	4.019	7.61e-05	0.093798	40	0.023339	yes	TESTIS
chr2_33742219_C_A_b38	RASGRP3	4.019	7.61e-05	0.093798	40	0.023339	yes	TESTIS
chr2_33742563_T_C_b38	RASGRP3	4.019	7.61e-05	0.093798	40	0.023339	yes	TESTIS
chr2_33742583_A_G_b38	RASGRP3	4.019	7.61e-05	0.093798	40	0.023339	yes	TESTIS
chr2_33742674_G_A_b38	RASGRP3	4.019	7.61e-05	0.093798	40	0.023339	yes	TESTIS
chr2_33743109_C_T_b38	RASGRP3	4.019	7.61e-05	0.093798	40	0.023339	yes	TESTIS
chr2_33743221_A_G_b38	RASGRP3	4.019	7.61e-05	0.093798	40	0.023339	yes	TESTIS
chr2_33743236_T_G_b38	RASGRP3	4.019	7.61e-05	0.093798	40	0.023339	yes	TESTIS
chr2_33743424_T_C_b38	RASGRP3	4.019	7.61e-05	0.093798	40	0.023339	yes	TESTIS
chr2_33743431_G_C_b38	RASGRP3	4.019	7.61e-05	0.093798	40	0.023339	yes	TESTIS
chr2_33743651_C_T_b38	RASGRP3	4.019	7.61e-05	0.093798	40	0.023339	yes	TESTIS
chr2_33744228_T_G_b38	RASGRP3	4.019	7.61e-05	0.093798	40	0.023339	yes	TESTIS
chr2_33744364_G_A_b38	RASGRP3	4.019	7.61e-05	0.093798	40	0.023339	yes	TESTIS
chr2_33744471_C_A_b38	RASGRP3	4.019	7.61e-05	0.093798	40	0.023339	yes	TESTIS
chr2_33744899_G_A_b38	RASGRP3	4.019	7.61e-05	0.093798	40	0.023339	yes	TESTIS
chr2_33745194_G_A_b38	RASGRP3	4.019	7.61e-05	0.093798	40	0.023339	yes	TESTIS
chr2_33745304_C_T_b38	RASGRP3	4.019	7.61e-05	0.093798	40	0.023339	yes	TESTIS
chr2_33745393_A_G_b38	RASGRP3	4.019	7.61e-05	0.093798	40	0.023339	yes	TESTIS
chr2_33745457_C_A_b38	RASGRP3	4.019	7.61e-05	0.093798	40	0.023339	yes	TESTIS
chr2_33745474_G_A_b38	RASGRP3	4.019	7.61e-05	0.093798	40	0.023339	yes	TESTIS
chr2_33745704_C_T_b38	RASGRP3	4.019	7.61e-05	0.093798	40	0.023339	yes	TESTIS
chr2_33745889_T_G_b38	RASGRP3	4.019	7.61e-05	0.093798	40	0.023339	yes	TESTIS
chr2_33745919_T_G_b38	RASGRP3	4.019	7.61e-05	0.093798	40	0.023339	yes	TESTIS
chr2_33745923_G_A_b38	RASGRP3	4.019	7.61e-05	0.093798	40	0.023339	yes	TESTIS
chr2_33745939_T_C_b38	RASGRP3	4.019	7.61e-05	0.093798	40	0.023339	yes	TESTIS
chr2_33746746_G_A_b38	RASGRP3	4.019	7.61e-05	0.093798	40	0.023339	yes	TESTIS
chr2_33747023_G_A_b38	RASGRP3	4.019	7.61e-05	0.093798	40	0.023339	yes	TESTIS
chr2_33747077_G_A_b38	RASGRP3	4.019	7.61e-05	0.093798	40	0.023339	yes	TESTIS
chr2_33747570_C_T_b38	RASGRP3	4.019	7.61e-05	0.093798	40	0.023339	yes	TESTIS
chr2_33747719_G_A_b38	RASGRP3	4.019	7.61e-05	0.093798	40	0.023339	yes	TESTIS
chr2_33748212_A_G_b38	RASGRP3	4.019	7.61e-05	0.093798	40	0.023339	yes	TESTIS
chr2_33748443_G_A_b38	RASGRP3	4.019	7.61e-05	0.093798	40	0.023339	yes	TESTIS
chr2_33748597_A_G_b38	RASGRP3	4.019	7.61e-05	0.093798	40	0.023339	yes	TESTIS
chr2_33748983_G_A_b38	RASGRP3	4.019	7.61e-05	0.093798	40	0.023339	yes	TESTIS
chr2_33749004_G_A_b38	RASGRP3	4.019	7.61e-05	0.093798	40	0.023339	yes	TESTIS
chr2_33750298_G_A_b38	RASGRP3	4.019	7.61e-05	0.093798	40	0.023339	yes	TESTIS
chr2_33750428_G_C_b38	RASGRP3	4.019	7.61e-05	0.093798	40	0.023339	yes	TESTIS
chr2_33751464_T_C_b38	RASGRP3	4.019	7.61e-05	0.093798	40	0.023339	yes	TESTIS
chr2_33751474_G_A_b38	RASGRP3	4.019	7.61e-05	0.093798	40	0.023339	yes	TESTIS
chr2_33751633_G_T_b38	RASGRP3	4.019	7.61e-05	0.093798	40	0.023339	yes	TESTIS
chr2_33752452_C_T_b38	RASGRP3	4.019	7.61e-05	0.093798	40	0.023339	yes	TESTIS
chr2_33752974_A_AG_b38	RASGRP3	4.018	7.65e-05	0.093102	41	0.023174	yes	TESTIS
chr2_33474954_T_C_b38	RASGRP3	4.017	7.68e-05	0.093404	70	0.023255	yes	TESTIS
chr2_33747529_T_A_b38	RASGRP3	4.015	7.73e-05	0.093519	41	0.023292	yes	TESTIS
chr2_33752288_AT_A_b38	RASGRP3	4.015	7.74e-05	0.093788	39	0.023362	yes	TESTIS
chr2_33747330_A_G_b38	RASGRP3	4.011	7.85e-05	0.092836	41	0.023145	yes	TESTIS
chr2_33536322_G_GA_b38	RASGRP3	4.007	7.98e-05	0.141345	9	0.035275	yes	TESTIS
chr2_33742831_CT_C_b38	RASGRP3	4	8.21e-05	0.094845	52	0.023712	yes	TESTIS
chr2_33752162_T_C_b38	RASGRP3	3.998	8.28e-05	0.094132	39	0.023545	yes	TESTIS
chr2_33438562_C_CA_b38	RASGRP3	3.98	8.88e-05	0.150703	3	0.037864	yes	TESTIS
chr2_33740473_T_A_b38	RASGRP3	3.979	8.92e-05	0.092787	41	0.023318	yes	TESTIS
chr2_33751716_C_A_b38	RASGRP3	3.963	9.5e-05	0.092902	40	0.023442	yes	TESTIS
chr2_33751718_CT_C_b38	RASGRP3	3.963	9.5e-05	0.092902	40	0.023442	yes	TESTIS
chr2_33742892_G_A_b38	RASGRP3	3.956	9.78e-05	0.092163	40	0.023298	yes	TESTIS
chr2_33752444_C_T_b38	RASGRP3	3.956	9.78e-05	0.092163	40	0.023298	yes	TESTIS
chr2_33753230_G_A_b38	RASGRP3	3.948	0.000101	0.092551	40	0.023443	yes	TESTIS
chr2_33748885_A_G_b38	RASGRP3	3.939	0.000105	0.091208	42	0.023157	yes	TESTIS
chr2_33733257_C_T_b38	RASGRP3	3.933	0.000107	0.106068	21	0.026972	yes	TESTIS
chr2_33743908_C_T_b38	RASGRP3	3.917	0.000114	0.092755	39	0.023682	yes	TESTIS
chr2_33745193_T_C_b38	RASGRP3	3.917	0.000114	0.092755	39	0.023682	yes	TESTIS
chr2_33745218_T_C_b38	RASGRP3	3.917	0.000114	0.092755	39	0.023682	yes	TESTIS
chr2_33745728_T_C_b38	RASGRP3	3.917	0.000114	0.092755	39	0.023682	yes	TESTIS
chr2_33746219_A_G_b38	RASGRP3	3.917	0.000114	0.092755	39	0.023682	yes	TESTIS
chr2_33747569_T_A_b38	RASGRP3	3.917	0.000114	0.092755	39	0.023682	yes	TESTIS
chr2_33747909_A_C_b38	RASGRP3	3.917	0.000114	0.092755	39	0.023682	yes	TESTIS
chr2_33747929_T_C_b38	RASGRP3	3.917	0.000114	0.092755	39	0.023682	yes	TESTIS
chr2_33748302_G_A_b38	RASGRP3	3.917	0.000114	0.092755	39	0.023682	yes	TESTIS
chr2_33748556_G_A_b38	RASGRP3	3.917	0.000114	0.092755	39	0.023682	yes	TESTIS
chr2_33751863_T_C_b38	RASGRP3	3.917	0.000114	0.092755	39	0.023682	yes	TESTIS
chr2_33752505_C_T_b38	RASGRP3	3.917	0.000114	0.092755	39	0.023682	yes	TESTIS
chr2_33837508_A_C_b38	RASGRP3	3.878	0.000133	0.087388	49	0.022534	yes	TESTIS
chr2_33744736_T_G_b38	RASGRP3	3.864	0.00014	0.090606	40	0.023449	yes	TESTIS
chr2_33744737_T_G_b38	RASGRP3	3.864	0.00014	0.090606	40	0.023449	yes	TESTIS
chr2_33744742_G_C_b38	RASGRP3	3.864	0.00014	0.090606	40	0.023449	yes	TESTIS
chr2_33798122_T_C_b38	RASGRP3	3.863	0.000141	0.091203	47	0.023611	yes	TESTIS
chr2_33796538_A_G_b38	RASGRP3	3.856	0.000145	0.08854	50	0.022963	yes	TESTIS
chr2_33516403_T_C_b38	RASGRP3	3.839	0.000154	0.106672	16	0.027783	yes	TESTIS
chr2_33631243_G_GT_b38	RASGRP3	3.774	0.000198	0.131836	5	0.034931	yes	TESTIS
chr2_33475238_C_T_b38	RASGRP3	3.762	0.000207	0.119316	9	0.031713	yes	TESTIS
chr2_33734614_C_G_b38	RASGRP3	3.727	0.000236	0.086705	42	0.023261	yes	TESTIS
chr2_33581338_T_A_b38	RASGRP3	3.698	0.000264	0.124975	7	0.033798	yes	TESTIS
chr2_33581900_A_T_b38	RASGRP3	3.698	0.000264	0.124975	7	0.033798	yes	TESTIS
chr2_33471202_GT_G_b38	RASGRP3	-3.687	0.000274	-0.13308	4	0.03609	yes	TESTIS
chr2_33529318_C_T_b38	RASGRP3	3.682	0.00028	0.112524	8	0.03056	yes	TESTIS
chr2_33796806_G_A_b38	RASGRP3	3.661	0.000303	0.083185	49	0.022722	yes	TESTIS
chr2_33445936_C_T_b38	RASGRP3	3.631	0.000338	0.086245	46	0.02375	yes	TESTIS
chr2_33472507_G_C_b38	RASGRP3	-3.623	0.000349	-0.126949	5	0.035041	yes	TESTIS
chr2_33742821_A_C_b38	RASGRP3	3.618	0.000355	0.083152	44	0.022983	yes	TESTIS
chr2_33477835_C_T_b38	RASGRP3	3.616	0.000357	0.104411	13	0.028873	yes	TESTIS
chr2_33477439_G_T_b38	RASGRP3	-3.583	0.000404	-0.128554	3	0.03588	yes	TESTIS
chr2_33836867_C_G_b38	RASGRP3	3.568	0.000426	0.079968	50	0.02241	yes	TESTIS
chr2_33311535_G_GA_b38	RASGRP3	-3.557	0.000444	-0.084284	58	0.023698	yes	TESTIS
chr2_33464479_A_T_b38	RASGRP3	3.544	0.000465	0.081435	77	0.02298	yes	TESTIS
chr2_33710772_G_T_b38	RASGRP3	3.536	0.000479	0.079315	82	0.022431	yes	TESTIS
chr2_33659035_G_A_b38	RASGRP3	3.527	0.000495	0.124036	5	0.035167	yes	TESTIS
chr2_33563089_C_T_b38	RASGRP3	3.501	0.000543	0.090307	25	0.025794	yes	TESTIS
chr2_33737679_T_C_b38	RASGRP3	3.489	0.000568	0.079228	51	0.02271	yes	TESTIS
chr2_33640513_G_C_b38	RASGRP3	3.479	0.000588	0.120945	5	0.034766	yes	TESTIS
chr2_33548381_A_AAAAAG_b38	RASGRP3	3.473	0.000601	0.133649	8	0.038484	yes	TESTIS
chr2_33616325_C_T_b38	RASGRP3	3.453	0.000644	0.121611	5	0.035215	yes	TESTIS
chr2_33606703_C_T_b38	RASGRP3	3.443	0.000669	0.123025	5	0.035736	yes	TESTIS
chr2_33881038_CAT_C_b38	RASGRP3	-3.421	0.00072	-0.075669	50	0.022116	yes	TESTIS
chr2_33627793_A_G_b38	RASGRP3	3.42	0.000725	0.118074	5	0.034529	yes	TESTIS
chr2_33466679_C_CA_b38	RASGRP3	-3.412	0.000745	-0.113179	5	0.033172	yes	TESTIS
chr2_33654678_C_T_b38	RASGRP3	3.406	0.00076	0.082631	47	0.024259	yes	TESTIS
chr2_33669574_A_G_b38	RASGRP3	3.402	0.000772	0.103427	8	0.030404	yes	TESTIS
chr2_33669427_A_C_b38	RASGRP3	3.395	0.00079	0.102824	8	0.030285	yes	TESTIS
chr2_33446098_C_T_b38	RASGRP3	3.39	0.000806	0.079169	49	0.023357	yes	TESTIS
chr2_33469110_G_C_b38	RASGRP3	-3.387	0.000814	-0.11833	5	0.03494	yes	TESTIS
chr2_33634816_G_T_b38	RASGRP3	3.382	0.000827	0.117026	5	0.034602	yes	TESTIS
chr2_33634524_A_G_b38	RASGRP3	3.367	0.000871	0.117253	5	0.034823	yes	TESTIS
chr2_33563965_A_G_b38	RASGRP3	3.365	0.000877	0.111922	7	0.033258	yes	TESTIS
chr2_33863957_C_G_b38	RASGRP3	3.346	0.000938	0.074509	60	0.02227	yes	TESTIS
chr2_33732394_T_C_b38	RASGRP3	3.34	0.000958	0.10033	9	0.030042	yes	TESTIS
chr2_33391173_C_A_b38	RASGRP3	3.333	0.000981	0.079852	66	0.023958	yes	TESTIS
chr2_33672387_A_G_b38	RASGRP3	3.313	0.00105	0.099215	9	0.029944	yes	TESTIS
chr2_33143787_GT_G_b38	RASGRP3	3.307	0.00107	0.088493	18	0.026762	yes	TESTIS
chr2_33519413_A_G_b38	RASGRP3	3.274	0.0012	0.08486	24	0.025921	yes	TESTIS
chr2_33636858_C_G_b38	RASGRP3	3.264	0.00124	0.113159	5	0.034668	yes	TESTIS
chr2_33637736_A_T_b38	RASGRP3	3.264	0.00124	0.113159	5	0.034668	yes	TESTIS
chr2_33479056_A_G_b38	RASGRP3	-3.262	0.00125	-0.100067	11	0.03068	yes	TESTIS
chr2_33809477_A_AATTTTCTCCACTG_b38	RASGRP3	-3.256	0.00128	-0.074886	59	0.023	yes	TESTIS
chr2_33796781_A_T_b38	RASGRP3	3.248	0.00131	0.074686	47	0.022997	yes	TESTIS
chr2_33582793_C_G_b38	RASGRP3	3.245	0.00132	0.076016	38	0.023423	yes	TESTIS
chr2_33667549_A_G_b38	RASGRP3	3.215	0.00147	0.112525	5	0.035001	yes	TESTIS
chr2_33667555_A_G_b38	RASGRP3	3.215	0.00147	0.112525	5	0.035001	yes	TESTIS
chr2_33189551_T_C_b38	RASGRP3	3.213	0.00147	0.092929	15	0.028919	yes	TESTIS
chr2_33863426_A_G_b38	RASGRP3	3.2	0.00154	0.07247	56	0.022648	yes	TESTIS
chr2_33113669_A_G_b38	RASGRP3	3.173	0.00168	0.084616	18	0.026665	yes	TESTIS
chr2_33548381_A_AAAG_b38	RASGRP3	3.173	0.00168	0.110549	10	0.034838	yes	TESTIS
chr2_33478322_G_A_b38	RASGRP3	-3.164	0.00174	-0.102514	8	0.032403	yes	TESTIS
chr2_33474404_G_A_b38	RASGRP3	3.131	0.00193	0.071558	61	0.022853	yes	TESTIS
chr2_33587735_T_A_b38	RASGRP3	3.13	0.00194	0.073452	39	0.023466	yes	TESTIS
chr2_33744320_G_A_b38	RASGRP3	3.101	0.00214	0.090797	9	0.029281	yes	TESTIS
chr2_33744664_C_A_b38	RASGRP3	3.101	0.00214	0.090797	9	0.029281	yes	TESTIS
chr2_33718935_G_A_b38	RASGRP3	3.095	0.00218	0.068706	69	0.022199	yes	TESTIS
chr2_33797997_A_G_b38	RASGRP3	3.094	0.00219	0.072341	56	0.023382	yes	TESTIS
chr2_33716180_T_C_b38	RASGRP3	3.061	0.00243	0.067861	73	0.022169	yes	TESTIS
chr2_33878479_A_C_b38	RASGRP3	3.061	0.00243	0.066015	66	0.02157	yes	TESTIS
chr2_33752910_T_G_b38	RASGRP3	3.06	0.00244	0.092476	8	0.030221	yes	TESTIS
chr2_33448754_AC_A_b38	RASGRP3	-3.039	0.00261	-0.115237	3	0.037924	yes	TESTIS
chr2_33449317_C_T_b38	RASGRP3	-3.039	0.00261	-0.115237	3	0.037924	yes	TESTIS
chr2_33458089_T_A_b38	RASGRP3	-3.039	0.00261	-0.115237	3	0.037924	yes	TESTIS
chr2_33458663_A_T_b38	RASGRP3	-3.039	0.00261	-0.115237	3	0.037924	yes	TESTIS
chr2_33463361_G_A_b38	RASGRP3	-3.023	0.00275	-0.11139	4	0.036848	yes	TESTIS
chr2_33836300_G_T_b38	RASGRP3	3.02	0.00277	0.066851	61	0.022134	yes	TESTIS
chr2_33747865_C_T_b38	RASGRP3	3.019	0.00278	0.078846	23	0.02612	yes	TESTIS
chr2_33118769_C_G_b38	RASGRP3	3.01	0.00286	0.084097	13	0.027942	yes	TESTIS
chr2_33771740_G_T_b38	RASGRP3	3.008	0.00288	0.080328	28	0.026703	yes	TESTIS
chr2_33145390_T_C_b38	RASGRP3	3.005	0.0029	0.086849	15	0.028897	yes	TESTIS
chr2_33431709_A_C_b38	RASGRP3	-3.004	0.00291	-0.077888	29	0.025925	yes	TESTIS
chr2_33745297_G_A_b38	RASGRP3	3.004	0.00292	0.087818	9	0.029232	yes	TESTIS
chr2_33745548_A_G_b38	RASGRP3	3.004	0.00292	0.087818	9	0.029232	yes	TESTIS
chr2_33745920_G_T_b38	RASGRP3	3.004	0.00292	0.087818	9	0.029232	yes	TESTIS
chr2_33676884_G_GT_b38	RASGRP3	2.99	0.00305	0.070615	79	0.023614	yes	TESTIS
chr2_33647762_A_G_b38	RASGRP3	2.988	0.00307	0.073551	44	0.024618	yes	TESTIS
chr2_33653960_T_C_b38	RASGRP3	2.988	0.00307	0.073551	44	0.024618	yes	TESTIS
chr2_33860902_A_G_b38	RASGRP3	2.972	0.00323	0.065074	66	0.021896	yes	TESTIS
chr2_33522958_T_C_b38	RASGRP3	2.97	0.00325	0.114417	4	0.038529	yes	TESTIS
chr2_33722403_G_T_b38	RASGRP3	2.965	0.0033	0.066617	66	0.02247	yes	TESTIS
chr2_33735493_A_G_b38	RASGRP3	2.963	0.00332	0.082831	18	0.027951	yes	TESTIS
chr2_33792850_C_G_b38	RASGRP3	-2.96	0.00336	-0.074112	28	0.025042	yes	TESTIS
chr2_32751258_C_CCACA_b38	RASGRP3	2.959	0.00337	0.130062	4	0.043962	yes	TESTIS
chr2_33725764_T_C_b38	RASGRP3	2.954	0.00342	0.069876	43	0.023654	yes	TESTIS
chr2_33631252_G_T_b38	RASGRP3	2.954	0.00342	0.065756	85	0.022262	yes	TESTIS
chr2_33836798_G_T_b38	RASGRP3	2.951	0.00345	0.064825	59	0.021969	yes	TESTIS
chr2_33753925_A_G_b38	RASGRP3	2.949	0.00347	0.086042	10	0.029174	yes	TESTIS
chr2_33770624_C_T_b38	RASGRP3	2.943	0.00353	0.079219	28	0.026913	yes	TESTIS
chr2_33770852_A_G_b38	RASGRP3	2.943	0.00353	0.079219	28	0.026913	yes	TESTIS
chr2_33770953_C_T_b38	RASGRP3	2.943	0.00353	0.079219	28	0.026913	yes	TESTIS
chr2_33738744_C_A_b38	RASGRP3	2.928	0.0037	0.073586	36	0.025129	yes	TESTIS
chr2_33900928_T_A_b38	RASGRP3	2.927	0.00372	0.092257	9	0.031521	yes	TESTIS
chr2_33733304_G_A_b38	RASGRP3	2.926	0.00373	0.092321	7	0.031549	yes	TESTIS
chr2_33435697_AGCTAAAACAAACACTTACTGGGTG_A_b38	RASGRP3	-2.923	0.00376	-0.075731	29	0.025909	yes	TESTIS
chr2_33112138_T_C_b38	RASGRP3	2.915	0.00385	0.081665	13	0.028011	yes	TESTIS
chr2_33828104_A_G_b38	RASGRP3	-2.909	0.00394	-0.063472	75	0.021822	yes	TESTIS
chr2_33464471_C_CT_b38	RASGRP3	2.899	0.00406	0.070342	37	0.024268	yes	TESTIS
chr2_33736670_T_C_b38	RASGRP3	2.897	0.00408	0.085239	9	0.029422	yes	TESTIS
chr2_33752246_C_A_b38	RASGRP3	2.897	0.00408	0.085239	9	0.029422	yes	TESTIS
chr2_33850796_C_T_b38	RASGRP3	2.892	0.00414	0.064033	64	0.022139	yes	TESTIS
chr2_33634843_C_CTT_b38	RASGRP3	2.892	0.00414	0.110749	5	0.038292	yes	TESTIS
chr2_33719248_A_G_b38	RASGRP3	2.889	0.00418	0.06517	67	0.022554	yes	TESTIS
chr2_33830433_T_C_b38	RASGRP3	-2.889	0.00418	-0.063558	77	0.021998	yes	TESTIS
chr2_33831005_C_T_b38	RASGRP3	-2.889	0.00418	-0.063558	77	0.021998	yes	TESTIS
chr2_34089202_G_A_b38	RASGRP3	-2.887	0.00421	-0.069849	70	0.024195	yes	TESTIS
chr2_33605827_ATTTTTCT_A_b38	RASGRP3	2.884	0.00425	0.098368	6	0.034112	yes	TESTIS
chr2_33738887_G_A_b38	RASGRP3	2.879	0.00431	0.084587	9	0.02938	yes	TESTIS
chr2_33556443_T_A_b38	RASGRP3	2.878	0.00433	0.071008	30	0.024673	yes	TESTIS
chr2_33909672_C_G_b38	RASGRP3	2.869	0.00445	0.085789	18	0.029903	yes	TESTIS
chr2_33909861_T_C_b38	RASGRP3	2.869	0.00445	0.085789	18	0.029903	yes	TESTIS
chr2_33909968_T_C_b38	RASGRP3	2.864	0.00451	0.085108	18	0.029712	yes	TESTIS
chr2_33121731_T_A_b38	RASGRP3	2.863	0.00454	0.065966	70	0.023044	yes	TESTIS
chr2_33812096_A_G_b38	RASGRP3	2.835	0.00493	0.064594	59	0.022785	yes	TESTIS
chr2_33601894_C_G_b38	RASGRP3	2.826	0.00506	0.066125	39	0.023395	yes	TESTIS
chr2_33828199_C_A_b38	RASGRP3	-2.821	0.00514	-0.061307	75	0.021729	yes	TESTIS
chr2_33434222_A_C_b38	RASGRP3	-2.812	0.00528	-0.08138	16	0.028936	yes	TESTIS
chr2_33668967_T_C_b38	RASGRP3	2.81	0.00532	0.062353	65	0.022188	yes	TESTIS
chr2_33824143_GA_G_b38	RASGRP3	2.807	0.00537	0.061901	71	0.022052	yes	TESTIS
chr2_33827383_G_A_b38	RASGRP3	2.807	0.00537	0.061901	71	0.022052	yes	TESTIS
chr2_33850199_T_C_b38	RASGRP3	2.807	0.00537	0.061902	65	0.022053	yes	TESTIS
chr2_33850935_T_C_b38	RASGRP3	2.807	0.00537	0.061902	65	0.022053	yes	TESTIS
chr2_33854671_C_T_b38	RASGRP3	2.801	0.00546	0.06201	64	0.022136	yes	TESTIS
chr2_33855137_C_T_b38	RASGRP3	2.801	0.00546	0.06201	64	0.022136	yes	TESTIS
chr2_33715851_G_A_b38	RASGRP3	2.798	0.00552	0.062445	69	0.022319	yes	TESTIS
chr2_33738365_C_T_b38	RASGRP3	2.795	0.00556	0.082363	9	0.029465	yes	TESTIS
chr2_33856300_T_G_b38	RASGRP3	2.795	0.00556	0.061343	66	0.021946	yes	TESTIS
chr2_33523461_TA_T_b38	RASGRP3	2.794	0.00558	0.084925	7	0.030391	yes	TESTIS
chr2_33856769_A_G_b38	RASGRP3	2.791	0.00564	0.061599	65	0.022073	yes	TESTIS
chr2_33858174_T_C_b38	RASGRP3	2.791	0.00564	0.061599	65	0.022073	yes	TESTIS
chr2_33858371_A_G_b38	RASGRP3	2.791	0.00564	0.061599	65	0.022073	yes	TESTIS
chr2_33158163_AAAGAG_A_b38	RASGRP3	2.781	0.0058	0.092462	6	0.033243	yes	TESTIS
chr2_33748194_G_A_b38	RASGRP3	2.781	0.00581	0.07919	13	0.028476	yes	TESTIS
chr2_33816443_G_A_b38	RASGRP3	2.767	0.00606	0.060896	72	0.02201	yes	TESTIS
chr2_33513546_C_T_b38	RASGRP3	-2.76	0.00619	-0.064367	40	0.023324	yes	TESTIS
chr2_33529859_CA_C_b38	RASGRP3	2.76	0.00619	0.086426	5	0.031318	yes	TESTIS
chr2_33830150_C_T_b38	RASGRP3	2.758	0.00622	0.0609	71	0.022083	yes	TESTIS
chr2_33854093_T_G_b38	RASGRP3	2.755	0.00628	0.060159	67	0.02184	yes	TESTIS
chr2_33602361_A_C_b38	RASGRP3	2.752	0.00632	0.06303	55	0.0229	yes	TESTIS
chr2_33443785_T_C_b38	RASGRP3	-2.747	0.00642	-0.105772	5	0.038505	yes	TESTIS
chr2_33715095_C_G_b38	RASGRP3	2.745	0.00647	0.061388	69	0.022366	yes	TESTIS
chr2_33650021_A_G_b38	RASGRP3	2.743	0.00649	0.073761	17	0.026886	yes	TESTIS
chr2_33879824_A_T_b38	RASGRP3	2.741	0.00653	0.06089	57	0.022213	yes	TESTIS
chr2_33826739_G_GT_b38	RASGRP3	2.739	0.00658	0.060802	69	0.022198	yes	TESTIS
chr2_33826741_G_T_b38	RASGRP3	2.739	0.00658	0.060802	69	0.022198	yes	TESTIS
chr2_33825424_T_A_b38	RASGRP3	2.738	0.0066	0.060237	71	0.022002	yes	TESTIS
chr2_33812809_C_T_b38	RASGRP3	2.735	0.00666	0.060186	80	0.022008	yes	TESTIS
chr2_33671044_C_CA_b38	RASGRP3	2.727	0.00681	0.066631	35	0.02443	yes	TESTIS
chr2_33671049_C_A_b38	RASGRP3	2.727	0.00681	0.066631	35	0.02443	yes	TESTIS
chr2_33311084_A_G_b38	RASGRP3	2.726	0.00684	0.071593	29	0.026265	yes	TESTIS
chr2_33115127_TAC_T_b38	RASGRP3	-2.721	0.00693	-0.062803	55	0.023078	yes	TESTIS
chr2_33718413_G_A_b38	RASGRP3	-2.72	0.00695	-0.087661	9	0.032223	yes	TESTIS
chr2_33730936_A_G_b38	RASGRP3	-2.718	0.00699	-0.081636	11	0.030033	yes	TESTIS
chr2_33566193_A_G_b38	RASGRP3	-2.713	0.0071	-0.098946	5	0.036471	yes	TESTIS
chr2_33568917_T_C_b38	RASGRP3	-2.713	0.0071	-0.098946	5	0.036471	yes	TESTIS
chr2_33749927_C_T_b38	RASGRP3	2.713	0.00711	0.075425	14	0.027804	yes	TESTIS
chr2_33856700_C_G_b38	RASGRP3	2.711	0.00715	0.059264	67	0.021862	yes	TESTIS
chr2_33870537_A_G_b38	RASGRP3	2.709	0.00719	0.059287	63	0.021885	yes	TESTIS
chr2_33880077_C_G_b38	RASGRP3	2.705	0.00726	0.061296	55	0.022657	yes	TESTIS
chr2_33879601_G_A_b38	RASGRP3	2.705	0.00727	0.059844	59	0.022126	yes	TESTIS
chr2_33676624_C_T_b38	RASGRP3	2.704	0.00729	0.066389	47	0.024552	yes	TESTIS
chr2_33909735_A_G_b38	RASGRP3	2.698	0.00742	0.080097	18	0.029685	yes	TESTIS
chr2_33315105_A_AT_b38	RASGRP3	2.694	0.00751	0.068387	41	0.025384	yes	TESTIS
chr2_33678193_G_A_b38	RASGRP3	2.692	0.00756	0.066219	46	0.024602	yes	TESTIS
chr2_33836723_G_A_b38	RASGRP3	2.688	0.00764	0.197843	3	0.0736	yes	TESTIS
chr2_33813911_G_T_b38	RASGRP3	2.687	0.00765	0.05995	72	0.022307	yes	TESTIS
chr2_33818642_T_TTGAC_b38	RASGRP3	2.685	0.00771	0.058241	77	0.021692	yes	TESTIS
chr2_33316720_C_A_b38	RASGRP3	2.672	0.008	0.067787	41	0.025369	yes	TESTIS
chr2_33829504_C_G_b38	RASGRP3	2.672	0.00802	0.059373	70	0.022225	yes	TESTIS
chr2_33726572_A_AGCTAGG_b38	RASGRP3	2.668	0.00809	0.060863	74	0.022808	yes	TESTIS
chr2_33813661_C_T_b38	RASGRP3	2.666	0.00815	0.059477	71	0.02231	yes	TESTIS
chr2_33874579_A_T_b38	RASGRP3	2.662	0.00823	0.09721	5	0.036512	yes	TESTIS
chr2_33456354_ATTCT_A_b38	RASGRP3	2.659	0.00831	0.063345	51	0.023824	yes	TESTIS
chr2_33511214_C_T_b38	RASGRP3	2.652	0.00848	0.075223	13	0.028366	yes	TESTIS
chr2_33711450_CAA_C_b38	RASGRP3	-2.641	0.00875	-0.093319	3	0.035335	yes	TESTIS
chr2_33622130_C_CA_b38	RASGRP3	2.633	0.00895	0.100014	7	0.03798	yes	TESTIS
chr2_33301045_C_G_b38	RASGRP3	2.633	0.00895	0.066023	47	0.025073	yes	TESTIS
chr2_34196517_T_C_b38	RASGRP3	-2.633	0.00896	-0.064155	79	0.024368	yes	TESTIS
chr2_34196936_T_C_b38	RASGRP3	-2.633	0.00896	-0.064155	79	0.024368	yes	TESTIS
chr2_33909787_G_A_b38	RASGRP3	2.632	0.00899	0.058159	62	0.022099	yes	TESTIS
chr2_33202530_C_A_b38	RASGRP3	2.624	0.0092	0.063684	70	0.024272	yes	TESTIS
chr2_33652477_C_A_b38	RASGRP3	2.621	0.00927	0.070468	17	0.026884	yes	TESTIS
chr2_33821621_T_G_b38	RASGRP3	2.62	0.00929	0.057142	72	0.021808	yes	TESTIS
chr2_33446881_C_G_b38	RASGRP3	-2.615	0.00943	-0.104	3	0.03977	yes	TESTIS
chr2_33679032_C_G_b38	RASGRP3	2.615	0.00943	0.061337	61	0.023457	yes	TESTIS
chr2_33744244_A_T_b38	RASGRP3	2.615	0.00944	0.071864	23	0.027485	yes	TESTIS
chr2_33463642_G_A_b38	RASGRP3	2.615	0.00944	0.08913	6	0.034089	yes	TESTIS
chr2_33322839_G_C_b38	RASGRP3	2.613	0.00948	0.066007	41	0.025258	yes	TESTIS
chr2_33877310_G_A_b38	RASGRP3	2.612	0.00951	0.058694	57	0.02247	yes	TESTIS
chr2_33870208_A_G_b38	RASGRP3	2.611	0.00955	0.057055	64	0.021856	yes	TESTIS
chr2_34198423_A_C_b38	RASGRP3	-2.605	0.0097	-0.062861	79	0.024131	yes	TESTIS
chr2_33870644_C_T_b38	RASGRP3	2.604	0.00973	0.057178	63	0.021957	yes	TESTIS
chr2_33837776_A_G_b38	RASGRP3	2.602	0.00978	0.058098	70	0.022326	yes	TESTIS
chr2_33607456_C_A_b38	RASGRP3	2.601	0.0098	0.058238	63	0.022388	yes	TESTIS
chr2_33001466_C_T_b38	RASGRP3	-2.599	0.00988	-0.136183	8	0.052403	yes	TESTIS
chr2_33896162_A_T_b38	RASGRP3	2.598	0.00988	0.09236	6	0.035544	yes	TESTIS
chr2_33656248_TTC_T_b38	RASGRP3	2.598	0.00991	0.069619	17	0.026802	yes	TESTIS
chr2_33598472_A_C_b38	RASGRP3	2.595	0.00997	0.065542	26	0.025254	yes	TESTIS
chr2_33240645_C_CTT_b38	RASGRP3	-2.595	0.00999	-0.1258	5	0.048484	yes	TESTIS
chr2_33512177_G_A_b38	RASGRP3	4.971	1.19e-06	0.14229	17	0.028626	no	TESTIS
chr2_33537330_C_CCCAACACA_b38	RASGRP3	4.813	2.49e-06	0.149765	14	0.031115	no	TESTIS
chr2_33581561_C_T_b38	RASGRP3	4.528	9e-06	0.122483	19	0.027053	no	TESTIS
chr2_33582025_C_T_b38	RASGRP3	4.528	9e-06	0.122483	19	0.027053	no	TESTIS
chr2_33820829_A_G_b38	RASGRP3	4.397	1.58e-05	0.101809	39	0.023152	no	TESTIS
chr2_33596617_C_T_b38	RASGRP3	4.305	2.34e-05	0.116394	20	0.027034	no	TESTIS
chr2_33477419_C_G_b38	RASGRP3	4.256	2.88e-05	0.123626	11	0.029046	no	TESTIS
chr2_33596963_A_T_b38	RASGRP3	4.238	3.11e-05	0.113512	20	0.026787	no	TESTIS
chr2_33594326_C_T_b38	RASGRP3	4.229	3.23e-05	0.11426	20	0.027018	no	TESTIS
chr2_33594385_G_A_b38	RASGRP3	4.229	3.23e-05	0.11426	20	0.027018	no	TESTIS
chr2_33521266_C_T_b38	RASGRP3	4.119	5.08e-05	0.113646	18	0.027591	no	TESTIS
chr2_33565263_A_G_b38	RASGRP3	4.107	5.33e-05	0.109009	24	0.026542	no	TESTIS
chr2_33832286_GTCTGTCTGTCTC_G_b38	RASGRP3	-4.054	6.62e-05	-0.117963	9	0.029101	no	TESTIS
chr2_33817526_C_T_b38	RASGRP3	-4.044	6.88e-05	-0.098925	29	0.024463	no	TESTIS
chr2_33817550_A_C_b38	RASGRP3	-4.044	6.88e-05	-0.098925	29	0.024463	no	TESTIS
chr2_33817552_C_T_b38	RASGRP3	-4.044	6.88e-05	-0.098925	29	0.024463	no	TESTIS
chr2_33817626_T_C_b38	RASGRP3	-4.044	6.88e-05	-0.098925	29	0.024463	no	TESTIS
chr2_33817733_G_A_b38	RASGRP3	-4.044	6.88e-05	-0.098925	29	0.024463	no	TESTIS
chr2_33820392_A_G_b38	RASGRP3	4.002	8.13e-05	0.087839	54	0.021948	no	TESTIS
chr2_33817464_G_A_b38	RASGRP3	-3.984	8.73e-05	-0.097536	29	0.024479	no	TESTIS
chr2_33511010_G_A_b38	RASGRP3	3.745	0.000221	0.146775	5	0.039189	no	TESTIS
chr2_33382004_G_A_b38	RASGRP3	-3.743	0.000222	-0.121306	6	0.032405	no	TESTIS
chr2_33814560_A_G_b38	RASGRP3	-3.733	0.000231	-0.102383	15	0.027426	no	TESTIS
chr2_33822980_C_T_b38	RASGRP3	3.708	0.000254	0.08703	44	0.023468	no	TESTIS
chr2_33354784_C_T_b38	RASGRP3	3.686	0.000276	0.124949	4	0.033902	no	TESTIS
chr2_33818199_A_C_b38	RASGRP3	3.678	0.000285	0.086971	41	0.023649	no	TESTIS
chr2_33819366_G_A_b38	RASGRP3	3.676	0.000287	0.085873	43	0.023362	no	TESTIS
chr2_33819498_A_G_b38	RASGRP3	3.676	0.000287	0.085873	43	0.023362	no	TESTIS
chr2_33822715_G_A_b38	RASGRP3	3.665	0.000298	0.085777	45	0.023401	no	TESTIS
chr2_33822718_C_T_b38	RASGRP3	3.665	0.000298	0.085777	45	0.023401	no	TESTIS
chr2_33822143_T_C_b38	RASGRP3	3.647	0.000318	0.085592	44	0.023466	no	TESTIS
chr2_33749116_T_A_b38	RASGRP3	3.636	0.000332	0.089504	39	0.024615	no	TESTIS
chr2_33555164_G_A_b38	RASGRP3	3.627	0.000344	0.111823	10	0.030834	no	TESTIS
chr2_33818218_ATAAT_A_b38	RASGRP3	-3.609	0.000366	-0.087252	35	0.024174	no	TESTIS
chr2_33819157_T_G_b38	RASGRP3	3.569	0.000425	0.082897	45	0.023227	no	TESTIS
chr2_33824183_T_C_b38	RASGRP3	-3.56	0.000438	-0.093882	18	0.026369	no	TESTIS
chr2_33820945_G_A_b38	RASGRP3	3.549	0.000457	0.082487	45	0.023245	no	TESTIS
chr2_33834835_C_T_b38	RASGRP3	-3.521	0.000506	-0.09575	16	0.027197	no	TESTIS
chr2_33835115_A_T_b38	RASGRP3	-3.521	0.000506	-0.09575	16	0.027197	no	TESTIS
chr2_33525341_A_AAT_b38	RASGRP3	3.502	0.000541	0.094835	18	0.02708	no	TESTIS
chr2_33830483_C_G_b38	RASGRP3	-3.493	0.000559	-0.095565	16	0.027359	no	TESTIS
chr2_33826398_G_A_b38	RASGRP3	-3.492	0.00056	-0.09636	15	0.027592	no	TESTIS
chr2_33675329_A_G_b38	RASGRP3	3.487	0.000571	0.079434	72	0.022779	no	TESTIS
chr2_33820230_T_TTTTA_b38	RASGRP3	3.476	0.000593	0.076811	54	0.022095	no	TESTIS
chr2_33817695_G_C_b38	RASGRP3	-3.465	0.000617	-0.094945	16	0.027398	no	TESTIS
chr2_33391243_T_C_b38	RASGRP3	3.457	0.000636	0.087303	29	0.025255	no	TESTIS
chr2_33813686_G_T_b38	RASGRP3	3.451	0.000648	0.090528	19	0.026229	no	TESTIS
chr2_33819439_TAC_T_b38	RASGRP3	3.449	0.000654	0.082924	43	0.024043	no	TESTIS
chr2_33835638_A_G_b38	RASGRP3	-3.447	0.000658	-0.09424	16	0.027337	no	TESTIS
chr2_33835913_T_G_b38	RASGRP3	-3.447	0.000658	-0.09424	16	0.027337	no	TESTIS
chr2_33836277_T_C_b38	RASGRP3	-3.447	0.000658	-0.09424	16	0.027337	no	TESTIS
chr2_33832608_A_G_b38	RASGRP3	-3.446	0.000662	-0.094972	15	0.027564	no	TESTIS
chr2_33832840_C_G_b38	RASGRP3	-3.446	0.000662	-0.094972	15	0.027564	no	TESTIS
chr2_33819462_G_A_b38	RASGRP3	-3.437	0.000683	-0.092902	17	0.027033	no	TESTIS
chr2_33836210_A_G_b38	RASGRP3	-3.436	0.000685	-0.094148	16	0.027403	no	TESTIS
chr2_33561445_C_A_b38	RASGRP3	3.436	0.000685	0.104148	11	0.030314	no	TESTIS
chr2_33675355_T_G_b38	RASGRP3	3.429	0.000702	0.079311	65	0.02313	no	TESTIS
chr2_33818768_G_A_b38	RASGRP3	-3.409	0.000752	-0.09295	16	0.027265	no	TESTIS
chr2_33840746_C_G_b38	RASGRP3	-3.384	0.000821	-0.092674	16	0.027383	no	TESTIS
chr2_33676583_T_C_b38	RASGRP3	3.369	0.000866	0.078972	84	0.023441	no	TESTIS
chr2_33476758_C_CGTGCGTGT_b38	RASGRP3	-3.355	0.000909	-0.106527	6	0.031752	no	TESTIS
chr2_33590881_T_C_b38	RASGRP3	3.354	0.000911	0.088296	23	0.026324	no	TESTIS
chr2_33818047_G_A_b38	RASGRP3	-3.35	0.000925	-0.09223	15	0.027532	no	TESTIS
chr2_33254549_G_GTTT_b38	RASGRP3	3.34	0.000956	0.173874	5	0.052052	no	TESTIS
chr2_33676854_G_T_b38	RASGRP3	3.324	0.00101	0.078446	82	0.0236	no	TESTIS
chr2_33812277_T_G_b38	RASGRP3	-3.321	0.00102	-0.085638	21	0.025787	no	TESTIS
chr2_33556928_C_CACACACATACAT_b38	RASGRP3	3.315	0.00104	0.115691	4	0.034896	no	TESTIS
chr2_33823135_T_A_b38	RASGRP3	-3.304	0.00108	-0.089962	16	0.027231	no	TESTIS
chr2_33229499_G_C_b38	RASGRP3	3.296	0.00111	0.096648	12	0.029325	no	TESTIS
chr2_33827066_AGTACCATGCTGTTTTGGTTACT_A_b38	RASGRP3	-3.288	0.00114	-0.091599	13	0.027855	no	TESTIS
chr2_33227799_CTT_C_b38	RASGRP3	3.26	0.00126	0.140318	6	0.043045	no	TESTIS
chr2_33406668_A_G_b38	RASGRP3	3.239	0.00135	0.079731	30	0.024616	no	TESTIS
chr2_33322134_CT_C_b38	RASGRP3	3.234	0.00137	0.084482	28	0.026124	no	TESTIS
chr2_33823735_A_G_b38	RASGRP3	-3.23	0.00139	-0.069477	78	0.021509	no	TESTIS
chr2_33589264_G_C_b38	RASGRP3	3.229	0.0014	0.085294	23	0.026411	no	TESTIS
chr2_33596450_T_G_b38	RASGRP3	3.229	0.0014	0.085294	23	0.026411	no	TESTIS
chr2_33709841_G_C_b38	RASGRP3	3.218	0.00145	0.074288	74	0.023085	no	TESTIS
chr2_33826216_A_G_b38	RASGRP3	-3.212	0.00148	-0.084506	48	0.026307	no	TESTIS
chr2_33828746_AT_A_b38	RASGRP3	-3.207	0.00151	-0.069896	75	0.021798	no	TESTIS
chr2_33823336_A_T_b38	RASGRP3	3.198	0.00155	0.068946	80	0.021557	no	TESTIS
chr2_33823395_C_T_b38	RASGRP3	3.198	0.00155	0.068946	80	0.021557	no	TESTIS
chr2_33523649_G_A_b38	RASGRP3	3.165	0.00173	0.100158	8	0.03165	no	TESTIS
chr2_33770196_A_G_b38	RASGRP3	3.134	0.00192	0.084412	29	0.026933	no	TESTIS
chr2_33770292_G_C_b38	RASGRP3	3.134	0.00192	0.084412	29	0.026933	no	TESTIS
chr2_33770343_T_G_b38	RASGRP3	3.134	0.00192	0.084412	29	0.026933	no	TESTIS
chr2_33770360_T_C_b38	RASGRP3	3.134	0.00192	0.084412	29	0.026933	no	TESTIS
chr2_33770545_C_T_b38	RASGRP3	3.134	0.00192	0.084412	29	0.026933	no	TESTIS
chr2_33391711_T_C_b38	RASGRP3	3.128	0.00196	0.092756	12	0.029657	no	TESTIS
chr2_33825565_T_TTTCTTTGGG_b38	RASGRP3	-3.126	0.00197	-0.068911	71	0.022044	no	TESTIS
chr2_33825569_AT_A_b38	RASGRP3	-3.126	0.00197	-0.068911	71	0.022044	no	TESTIS
chr2_33825572_A_ACCC_b38	RASGRP3	-3.126	0.00197	-0.068911	71	0.022044	no	TESTIS
chr2_33825573_T_A_b38	RASGRP3	-3.126	0.00197	-0.068911	71	0.022044	no	TESTIS
chr2_33826462_T_C_b38	RASGRP3	-3.126	0.00197	-0.068911	71	0.022044	no	TESTIS
chr2_33827509_G_A_b38	RASGRP3	-3.126	0.00197	-0.068911	71	0.022044	no	TESTIS
chr2_33828923_A_G_b38	RASGRP3	-3.122	0.00199	-0.067858	76	0.021736	no	TESTIS
chr2_33829955_T_TC_b38	RASGRP3	-3.122	0.00199	-0.067858	76	0.021736	no	TESTIS
chr2_33829194_T_C_b38	RASGRP3	-3.121	0.002	-0.068739	71	0.022022	no	TESTIS
chr2_33829996_A_G_b38	RASGRP3	-3.121	0.002	-0.068739	71	0.022022	no	TESTIS
chr2_33830736_C_CT_b38	RASGRP3	-3.121	0.002	-0.068739	71	0.022022	no	TESTIS
chr2_33830755_T_C_b38	RASGRP3	-3.121	0.002	-0.068739	71	0.022022	no	TESTIS
chr2_33823362_A_G_b38	RASGRP3	3.111	0.00206	0.066829	82	0.021479	no	TESTIS
chr2_33824446_G_A_b38	RASGRP3	-3.108	0.00209	-0.067375	77	0.021677	no	TESTIS
chr2_33771715_A_G_b38	RASGRP3	3.106	0.0021	0.083537	30	0.026894	no	TESTIS
chr2_33771716_AATTG_A_b38	RASGRP3	3.106	0.0021	0.083537	30	0.026894	no	TESTIS
chr2_33679620_T_A_b38	RASGRP3	3.097	0.00216	0.070022	70	0.022607	no	TESTIS
chr2_33819439_T_TAC_b38	RASGRP3	-3.097	0.00217	-0.089531	10	0.028912	no	TESTIS
chr2_33828226_G_A_b38	RASGRP3	-3.082	0.00227	-0.06818	70	0.022119	no	TESTIS
chr2_33138848_C_CT_b38	RASGRP3	3.078	0.0023	0.124661	12	0.040501	no	TESTIS
chr2_32532134_C_CGTGTGTGTGTGT_b38	RASGRP3	-3.045	0.00256	-0.080167	26	0.026325	no	TESTIS
chr2_32571378_C_CTT_b38	RASGRP3	-3.045	0.00256	-0.134767	8	0.044257	no	TESTIS
chr2_33771282_C_A_b38	RASGRP3	3.042	0.00258	0.082506	30	0.027118	no	TESTIS
chr2_33771305_A_ATGTC_b38	RASGRP3	3.042	0.00258	0.082506	30	0.027118	no	TESTIS
chr2_33771310_T_TGTG_b38	RASGRP3	3.042	0.00258	0.082506	30	0.027118	no	TESTIS
chr2_33771705_T_C_b38	RASGRP3	3.042	0.00258	0.082506	30	0.027118	no	TESTIS
chr2_33770718_A_C_b38	RASGRP3	3.041	0.00259	0.083227	30	0.027371	no	TESTIS
chr2_33771480_T_C_b38	RASGRP3	3.038	0.00262	0.082385	30	0.027116	no	TESTIS
chr2_33807242_A_AACAGTGATAGGTATATTCTT_b38	RASGRP3	-3.027	0.00271	-0.110106	7	0.036379	no	TESTIS
chr2_33771507_G_A_b38	RASGRP3	3.025	0.00273	0.081563	30	0.02696	no	TESTIS
chr2_33727946_G_T_b38	RASGRP3	-3.013	0.00283	-0.120744	4	0.040074	no	TESTIS
chr2_33728043_A_T_b38	RASGRP3	-3.013	0.00283	-0.120744	4	0.040074	no	TESTIS
chr2_33825697_C_CT_b38	RASGRP3	-3.012	0.00285	-0.067567	64	0.022434	no	TESTIS
chr2_33771584_G_A_b38	RASGRP3	2.979	0.00316	0.080898	30	0.027158	no	TESTIS
chr2_33725915_C_CTTT_b38	RASGRP3	-2.962	0.00333	-0.094234	14	0.031811	no	TESTIS
chr2_33751824_A_G_b38	RASGRP3	2.951	0.00345	0.079011	22	0.026773	no	TESTIS
chr2_33721865_G_A_b38	RASGRP3	2.947	0.00349	0.070875	37	0.024049	no	TESTIS
chr2_33944412_A_AT_b38	RASGRP3	-2.922	0.00378	-0.121956	5	0.041737	no	TESTIS
chr2_33389120_C_T_b38	RASGRP3	-2.883	0.00425	-0.06977	83	0.024197	no	TESTIS
chr2_33249323_T_TCACACA_b38	RASGRP3	2.876	0.00436	0.088428	9	0.030751	no	TESTIS
chr2_33393218_T_C_b38	RASGRP3	2.865	0.00449	0.084396	10	0.029453	no	TESTIS
chr2_33406107_G_GGCGGGATCT_b38	RASGRP3	2.845	0.00479	0.064432	66	0.022649	no	TESTIS
chr2_33818814_GTTT_G_b38	RASGRP3	-2.827	0.00506	-0.084604	12	0.029931	no	TESTIS
chr2_33863273_C_T_b38	RASGRP3	-2.82	0.00516	-0.064368	84	0.022826	no	TESTIS
chr2_33811360_G_A_b38	RASGRP3	2.82	0.00516	0.06972	28	0.024724	no	TESTIS
chr2_33517217_G_A_b38	RASGRP3	2.812	0.00528	0.081316	12	0.028915	no	TESTIS
chr2_33623242_A_AT_b38	RASGRP3	-2.808	0.00535	-0.08774	14	0.031242	no	TESTIS
chr2_33752872_ATTT_A_b38	RASGRP3	2.806	0.00538	0.071952	29	0.025642	no	TESTIS
chr2_33591518_C_T_b38	RASGRP3	2.797	0.00554	0.071421	26	0.025539	no	TESTIS
chr2_33530930_T_C_b38	RASGRP3	2.784	0.00574	0.079115	13	0.028413	no	TESTIS
chr2_33539650_C_T_b38	RASGRP3	2.764	0.00611	0.077731	13	0.028123	no	TESTIS
chr2_33651073_T_C_b38	RASGRP3	2.755	0.00627	0.074739	22	0.027124	no	TESTIS
chr2_32849873_G_GGT_b38	RASGRP3	2.751	0.00635	0.13138	3	0.047759	no	TESTIS
chr2_33521739_T_A_b38	RASGRP3	2.738	0.0066	0.079655	11	0.029093	no	TESTIS
chr2_33722138_A_AT_b38	RASGRP3	2.727	0.00682	0.065435	39	0.023998	no	TESTIS
chr2_33722197_A_C_b38	RASGRP3	2.727	0.00682	0.065435	39	0.023998	no	TESTIS
chr2_33722280_T_C_b38	RASGRP3	2.727	0.00682	0.065435	39	0.023998	no	TESTIS
chr2_33722343_G_A_b38	RASGRP3	2.727	0.00682	0.065435	39	0.023998	no	TESTIS
chr2_33813104_A_T_b38	RASGRP3	-2.726	0.00684	-0.073572	18	0.026992	no	TESTIS
chr2_34153012_T_TA_b38	RASGRP3	-2.721	0.00693	-0.095487	5	0.03509	no	TESTIS
chr2_33679763_T_C_b38	RASGRP3	2.703	0.00732	0.061337	59	0.022695	no	TESTIS
chr2_33677122_A_G_b38	RASGRP3	2.7	0.00738	0.063727	54	0.023605	no	TESTIS
chr2_33591739_A_G_b38	RASGRP3	2.676	0.00791	0.068422	26	0.025567	no	TESTIS
chr2_33731863_C_CCTTTCCTTAACTTCAGGACATACTGGGTTCCAGTATGTCCTTAA_b38	RASGRP3	2.676	0.00791	0.119604	3	0.044698	no	TESTIS
chr2_33820413_ATTTTTTTTTT_A_b38	RASGRP3	-2.671	0.00802	-0.071709	20	0.026842	no	TESTIS
chr2_33522218_G_A_b38	RASGRP3	2.668	0.0081	0.077508	11	0.029053	no	TESTIS
chr2_33548717_A_T_b38	RASGRP3	-2.648	0.00859	-0.062363	55	0.023555	no	TESTIS
chr2_33863184_T_A_b38	RASGRP3	-2.64	0.00879	-0.063432	39	0.024032	no	TESTIS
chr2_33648791_T_A_b38	RASGRP3	2.635	0.00891	0.071648	22	0.027194	no	TESTIS
chr2_33539888_A_T_b38	RASGRP3	2.631	0.00901	0.074379	13	0.02827	no	TESTIS
chr2_33797953_T_C_b38	RASGRP3	2.629	0.00905	0.080562	9	0.030639	no	TESTIS
chr2_33798035_G_A_b38	RASGRP3	2.629	0.00905	0.080562	9	0.030639	no	TESTIS
chr2_33798057_G_A_b38	RASGRP3	2.629	0.00905	0.080562	9	0.030639	no	TESTIS
chr2_33798065_T_C_b38	RASGRP3	2.629	0.00905	0.080562	9	0.030639	no	TESTIS
chr2_33798391_T_G_b38	RASGRP3	2.629	0.00905	0.080562	9	0.030639	no	TESTIS
chr2_33799757_C_T_b38	RASGRP3	2.629	0.00905	0.080562	9	0.030639	no	TESTIS
chr2_33800628_T_A_b38	RASGRP3	2.629	0.00905	0.080562	9	0.030639	no	TESTIS
chr2_33174001_T_A_b38	RASGRP3	2.625	0.00918	0.063069	40	0.024031	no	TESTIS
chr2_33592814_T_C_b38	RASGRP3	2.618	0.00934	0.06746	25	0.025765	no	TESTIS
chr2_33613720_G_A_b38	RASGRP3	2.607	0.00964	0.084823	10	0.032535	no	TESTIS
chr2_33509815_G_A_b38	RASGRP3	2.606	0.00967	0.076107	11	0.029203	no	TESTIS
chr2_33167643_C_A_b38	RASGRP3	2.596	0.00996	0.063909	33	0.024621	no	TESTIS
chr2_33537330_C_CCCAACACA_b38	RASGRP3	16.891	4.95e-51	0.254892	25	0.01509	yes	THYROID
chr2_33551676_A_G_b38	RASGRP3	16.869	6.28e-51	0.310368	3	0.018398	yes	THYROID
chr2_33551697_A_T_b38	RASGRP3	16.869	6.28e-51	0.310368	3	0.018398	yes	THYROID
chr2_33552022_CAAACA_C_b38	RASGRP3	16.552	1.92e-49	0.307051	3	0.01855	yes	THYROID
chr2_33553995_C_T_b38	RASGRP3	15.987	8.1e-47	0.293122	5	0.018335	yes	THYROID
chr2_33546942_C_G_b38	RASGRP3	15.939	1.35e-46	0.286059	6	0.017947	yes	THYROID
chr2_33512177_G_A_b38	RASGRP3	14.333	2.57e-39	0.225796	17	0.015753	yes	THYROID
chr2_33525341_A_AAT_b38	RASGRP3	12.282	1.65e-30	0.182313	22	0.014844	yes	THYROID
chr2_33521266_C_T_b38	RASGRP3	11.827	1.2e-28	0.169918	33	0.014367	yes	THYROID
chr2_33561445_C_A_b38	RASGRP3	11.532	1.85e-27	0.180405	17	0.015644	yes	THYROID
chr2_33523649_G_A_b38	RASGRP3	10.724	2.65e-24	0.173106	18	0.016142	yes	THYROID
chr2_33596963_A_T_b38	RASGRP3	10.64	5.51e-24	0.157832	31	0.014833	yes	THYROID
chr2_33555164_G_A_b38	RASGRP3	10.539	1.34e-23	0.170367	16	0.016166	yes	THYROID
chr2_33565263_A_G_b38	RASGRP3	10.431	3.41e-23	0.154435	37	0.014805	yes	THYROID
chr2_33596617_C_T_b38	RASGRP3	10.21	2.28e-22	0.152906	30	0.014976	yes	THYROID
chr2_33594326_C_T_b38	RASGRP3	10.139	4.18e-22	0.151245	31	0.014918	yes	THYROID
chr2_33594385_G_A_b38	RASGRP3	10.139	4.18e-22	0.151245	31	0.014918	yes	THYROID
chr2_33581561_C_T_b38	RASGRP3	10.129	4.54e-22	0.152147	29	0.015021	yes	THYROID
chr2_33556928_C_CACACACATACAT_b38	RASGRP3	10.065	7.84e-22	0.194657	4	0.01934	yes	THYROID
chr2_33586869_A_T_b38	RASGRP3	10.035	1.01e-21	0.154318	26	0.015378	yes	THYROID
chr2_33596450_T_G_b38	RASGRP3	9.751	1.08e-20	0.134337	45	0.013777	yes	THYROID
chr2_33589264_G_C_b38	RASGRP3	9.612	3.42e-20	0.132635	45	0.0138	yes	THYROID
chr2_33511010_G_A_b38	RASGRP3	9.606	3.58e-20	0.214049	6	0.022283	yes	THYROID
chr2_33590881_T_C_b38	RASGRP3	9.502	8.39e-20	0.131509	44	0.01384	yes	THYROID
chr2_33547053_GAA_G_b38	RASGRP3	8.649	6.99e-17	0.225364	4	0.026055	yes	THYROID
chr2_33657078_T_C_b38	RASGRP3	8.542	1.58e-16	0.123762	40	0.014488	yes	THYROID
chr2_33639021_G_A_b38	RASGRP3	8.362	6.1e-16	0.126798	26	0.015164	yes	THYROID
chr2_33650021_A_G_b38	RASGRP3	8.323	8.17e-16	0.126361	26	0.015183	yes	THYROID
chr2_33656248_TTC_T_b38	RASGRP3	8.323	8.17e-16	0.126361	26	0.015183	yes	THYROID
chr2_33625315_G_A_b38	RASGRP3	8.318	8.43e-16	0.122004	40	0.014667	yes	THYROID
chr2_33640631_A_C_b38	RASGRP3	8.314	8.72e-16	0.126309	26	0.015193	yes	THYROID
chr2_33537321_C_CA_b38	RASGRP3	8.312	8.84e-16	0.105631	76	0.012708	yes	THYROID
chr2_33641397_G_C_b38	RASGRP3	8.307	9.15e-16	0.126173	26	0.015188	yes	THYROID
chr2_33622160_C_T_b38	RASGRP3	8.26	1.3e-15	0.118465	43	0.014342	yes	THYROID
chr2_33652477_C_A_b38	RASGRP3	8.252	1.37e-15	0.1256	26	0.01522	yes	THYROID
chr2_33656916_G_A_b38	RASGRP3	8.133	3.3e-15	0.114197	54	0.014042	yes	THYROID
chr2_33662459_C_T_b38	RASGRP3	8.123	3.55e-15	0.123037	27	0.015147	yes	THYROID
chr2_33523461_TA_T_b38	RASGRP3	8.089	4.55e-15	0.135463	11	0.016748	yes	THYROID
chr2_33670716_C_T_b38	RASGRP3	8.065	5.4e-15	0.119154	32	0.014774	yes	THYROID
chr2_33663555_T_C_b38	RASGRP3	8.007	8.23e-15	0.121371	27	0.015159	yes	THYROID
chr2_33656848_TA_T_b38	RASGRP3	7.876	2.1e-14	0.115749	38	0.014696	yes	THYROID
chr2_33624881_G_GT_b38	RASGRP3	7.849	2.54e-14	0.11213	49	0.014286	yes	THYROID
chr2_33623108_T_C_b38	RASGRP3	7.835	2.81e-14	0.108045	59	0.01379	yes	THYROID
chr2_33621819_C_A_b38	RASGRP3	7.809	3.37e-14	0.106583	60	0.013648	yes	THYROID
chr2_33532487_C_A_b38	RASGRP3	7.791	3.84e-14	0.095749	137	0.01229	yes	THYROID
chr2_33622592_T_C_b38	RASGRP3	7.781	4.11e-14	0.109763	56	0.014106	yes	THYROID
chr2_33564467_A_G_b38	RASGRP3	7.693	7.65e-14	0.104994	73	0.013648	yes	THYROID
chr2_33564001_C_G_b38	RASGRP3	7.671	8.89e-14	0.105943	68	0.01381	yes	THYROID
chr2_33661156_C_T_b38	RASGRP3	7.658	9.74e-14	0.110953	37	0.014488	yes	THYROID
chr2_33661310_C_T_b38	RASGRP3	7.658	9.74e-14	0.110953	37	0.014488	yes	THYROID
chr2_33626436_A_T_b38	RASGRP3	7.507	2.78e-13	0.107077	51	0.014264	yes	THYROID
chr2_33579727_C_T_b38	RASGRP3	7.294	1.18e-12	0.203713	3	0.027928	yes	THYROID
chr2_33571342_T_C_b38	RASGRP3	-6.733	4.56e-11	-0.090613	90	0.013459	yes	THYROID
chr2_33572204_C_A_b38	RASGRP3	-6.644	7.97e-11	-0.090031	87	0.013552	yes	THYROID
chr2_33571267_T_A_b38	RASGRP3	-6.603	1.03e-10	-0.089799	87	0.0136	yes	THYROID
chr2_33569371_A_G_b38	RASGRP3	-6.545	1.47e-10	-0.089088	88	0.013613	yes	THYROID
chr2_33537323_G_A_b38	RASGRP3	6.54	1.51e-10	0.079353	131	0.012133	yes	THYROID
chr2_33575950_G_A_b38	RASGRP3	-6.523	1.68e-10	-0.088815	85	0.013615	yes	THYROID
chr2_33563965_A_G_b38	RASGRP3	6.478	2.22e-10	0.121321	12	0.018729	yes	THYROID
chr2_33577889_G_A_b38	RASGRP3	-6.432	2.94e-10	-0.087995	85	0.013682	yes	THYROID
chr2_33561192_A_G_b38	RASGRP3	6.307	6.24e-10	0.080689	134	0.012793	yes	THYROID
chr2_33568339_TA_T_b38	RASGRP3	-6.205	1.14e-09	-0.083805	95	0.013506	yes	THYROID
chr2_33518114_A_G_b38	RASGRP3	-6.158	1.51e-09	-0.083448	72	0.013551	yes	THYROID
chr2_33567745_C_T_b38	RASGRP3	-6.156	1.52e-09	-0.084509	80	0.013727	yes	THYROID
chr2_33640513_G_C_b38	RASGRP3	6.1	2.11e-09	0.122225	9	0.020036	yes	THYROID
chr2_33581900_A_T_b38	RASGRP3	6.085	2.31e-09	0.115307	12	0.018949	yes	THYROID
chr2_33605827_ATTTTTCT_A_b38	RASGRP3	6.053	2.79e-09	0.121119	8	0.02001	yes	THYROID
chr2_33581338_T_A_b38	RASGRP3	6.05	2.83e-09	0.11447	12	0.018921	yes	THYROID
chr2_33634524_A_G_b38	RASGRP3	6.019	3.38e-09	0.121874	9	0.020247	yes	THYROID
chr2_33636858_C_G_b38	RASGRP3	6.015	3.47e-09	0.121651	9	0.020225	yes	THYROID
chr2_33637736_A_T_b38	RASGRP3	6.015	3.47e-09	0.121651	9	0.020225	yes	THYROID
chr2_33532718_G_A_b38	RASGRP3	6.009	3.59e-09	0.0777	109	0.012932	yes	THYROID
chr2_33616325_C_T_b38	RASGRP3	5.969	4.5e-09	0.122278	8	0.020485	yes	THYROID
chr2_33530852_CT_C_b38	RASGRP3	5.968	4.54e-09	0.076011	117	0.012736	yes	THYROID
chr2_33659035_G_A_b38	RASGRP3	5.964	4.65e-09	0.120649	9	0.020231	yes	THYROID
chr2_33613720_G_A_b38	RASGRP3	5.932	5.57e-09	0.111106	14	0.01873	yes	THYROID
chr2_33634816_G_T_b38	RASGRP3	5.911	6.29e-09	0.118699	9	0.020082	yes	THYROID
chr2_33627793_A_G_b38	RASGRP3	5.892	6.97e-09	0.116808	9	0.019823	yes	THYROID
chr2_33667549_A_G_b38	RASGRP3	5.89	7.06e-09	0.120264	9	0.020417	yes	THYROID
chr2_33667555_A_G_b38	RASGRP3	5.89	7.06e-09	0.120264	9	0.020417	yes	THYROID
chr2_33588900_A_AT_b38	RASGRP3	-5.89	7.07e-09	-0.083013	109	0.014094	yes	THYROID
chr2_33631243_G_GT_b38	RASGRP3	5.862	8.31e-09	0.119381	9	0.020367	yes	THYROID
chr2_33535555_G_GC_b38	RASGRP3	-5.852	8.77e-09	-0.11361	9	0.019415	yes	THYROID
chr2_33508487_T_C_b38	RASGRP3	5.846	9.06e-09	0.135327	8	0.023148	yes	THYROID
chr2_33606727_T_C_b38	RASGRP3	5.843	9.21e-09	0.129093	3	0.022093	yes	THYROID
chr2_33514489_T_C_b38	RASGRP3	-5.801	1.16e-08	-0.073668	95	0.012698	yes	THYROID
chr2_33515662_T_C_b38	RASGRP3	5.677	2.32e-08	0.102127	14	0.01799	yes	THYROID
chr2_33535943_T_C_b38	RASGRP3	-5.621	3.15e-08	-0.108333	9	0.019274	yes	THYROID
chr2_33512820_T_A_b38	RASGRP3	-5.606	3.42e-08	-0.074534	80	0.013296	yes	THYROID
chr2_33602942_T_C_b38	RASGRP3	5.602	3.48e-08	0.121625	4	0.021709	yes	THYROID
chr2_33543280_C_G_b38	RASGRP3	-5.546	4.73e-08	-0.112029	6	0.0202	yes	THYROID
chr2_33571586_T_C_b38	RASGRP3	-5.536	4.98e-08	-0.072871	116	0.013162	yes	THYROID
chr2_33538452_G_A_b38	RASGRP3	-5.519	5.46e-08	-0.111745	6	0.020247	yes	THYROID
chr2_33538430_G_C_b38	RASGRP3	-5.469	7.15e-08	-0.109614	7	0.020044	yes	THYROID
chr2_33606703_C_T_b38	RASGRP3	5.463	7.38e-08	0.113805	8	0.020833	yes	THYROID
chr2_33533272_T_C_b38	RASGRP3	-5.435	8.55e-08	-0.106265	7	0.019552	yes	THYROID
chr2_33523846_A_G_b38	RASGRP3	-5.42	9.28e-08	-0.089228	26	0.016464	yes	THYROID
chr2_33534062_A_C_b38	RASGRP3	-5.416	9.44e-08	-0.105835	7	0.01954	yes	THYROID
chr2_33672387_A_G_b38	RASGRP3	5.402	1.02e-07	0.092921	18	0.017203	yes	THYROID
chr2_33532968_G_A_b38	RASGRP3	-5.361	1.27e-07	-0.108753	6	0.020288	yes	THYROID
chr2_33519891_C_T_b38	RASGRP3	-5.351	1.33e-07	-0.072033	85	0.013462	yes	THYROID
chr2_33533388_C_T_b38	RASGRP3	-5.291	1.82e-07	-0.104765	6	0.0198	yes	THYROID
chr2_33622130_C_CA_b38	RASGRP3	5.283	1.9e-07	0.111778	14	0.021158	yes	THYROID
chr2_33525341_AAT_A_b38	RASGRP3	-5.282	1.9e-07	-0.104642	7	0.01981	yes	THYROID
chr2_33620497_T_C_b38	RASGRP3	5.264	2.09e-07	0.087284	25	0.016582	yes	THYROID
chr2_33593131_C_T_b38	RASGRP3	-5.233	2.45e-07	-0.069759	126	0.01333	yes	THYROID
chr2_33534496_G_A_b38	RASGRP3	-5.214	2.71e-07	-0.10472	6	0.020085	yes	THYROID
chr2_33603907_A_C_b38	RASGRP3	5.208	2.79e-07	0.101816	11	0.019551	yes	THYROID
chr2_33603617_TC_T_b38	RASGRP3	5.193	3.01e-07	0.101377	11	0.019521	yes	THYROID
chr2_33586449_C_G_b38	RASGRP3	-5.186	3.12e-07	-0.069284	126	0.01336	yes	THYROID
chr2_33534328_C_T_b38	RASGRP3	-5.181	3.2e-07	-0.103894	6	0.020053	yes	THYROID
chr2_33589523_A_G_b38	RASGRP3	-5.179	3.23e-07	-0.068467	130	0.01322	yes	THYROID
chr2_33641120_T_C_b38	RASGRP3	-5.15	3.74e-07	-0.06672	120	0.012955	yes	THYROID
chr2_33647765_T_C_b38	RASGRP3	-5.148	3.79e-07	-0.066305	124	0.012881	yes	THYROID
chr2_33518880_G_GTCA_b38	RASGRP3	-5.148	3.79e-07	-0.068968	106	0.013398	yes	THYROID
chr2_33607432_G_A_b38	RASGRP3	5.141	3.91e-07	0.107405	6	0.02089	yes	THYROID
chr2_33512902_A_G_b38	RASGRP3	-5.141	3.92e-07	-0.068537	116	0.013332	yes	THYROID
chr2_33655774_A_G_b38	RASGRP3	-5.092	5.01e-07	-0.065298	125	0.012823	yes	THYROID
chr2_33662442_T_C_b38	RASGRP3	-5.076	5.43e-07	-0.065215	122	0.012847	yes	THYROID
chr2_33658713_G_A_b38	RASGRP3	-5.074	5.49e-07	-0.065898	117	0.012987	yes	THYROID
chr2_33527085_G_T_b38	RASGRP3	-5.073	5.52e-07	-0.089199	19	0.017583	yes	THYROID
chr2_33575832_C_A_b38	RASGRP3	-5.065	5.75e-07	-0.067089	128	0.013246	yes	THYROID
chr2_33520141_T_C_b38	RASGRP3	-5.036	6.63e-07	-0.067962	108	0.013494	yes	THYROID
chr2_33515788_C_T_b38	RASGRP3	-5.032	6.76e-07	-0.09945	9	0.019762	yes	THYROID
chr2_33620575_G_A_b38	RASGRP3	5.025	7.02e-07	0.083581	25	0.016634	yes	THYROID
chr2_33577835_T_C_b38	RASGRP3	-5.019	7.24e-07	-0.067082	124	0.013367	yes	THYROID
chr2_33509059_T_G_b38	RASGRP3	-5.008	7.61e-07	-0.080103	28	0.015994	yes	THYROID
chr2_33668515_A_G_b38	RASGRP3	-4.996	8.07e-07	-0.06429	123	0.012867	yes	THYROID
chr2_33528012_T_G_b38	RASGRP3	-4.994	8.19e-07	-0.083622	25	0.016746	yes	THYROID
chr2_33607748_A_G_b38	RASGRP3	-4.972	9.09e-07	-0.064846	107	0.013041	yes	THYROID
chr2_33525080_C_CA_b38	RASGRP3	-4.944	1.04e-06	-0.091928	13	0.018594	yes	THYROID
chr2_33590404_A_G_b38	RASGRP3	-4.938	1.07e-06	-0.065618	127	0.013288	yes	THYROID
chr2_33576389_C_T_b38	RASGRP3	-4.927	1.13e-06	-0.066927	119	0.013583	yes	THYROID
chr2_33658170_A_G_b38	RASGRP3	-4.92	1.17e-06	-0.063647	119	0.012936	yes	THYROID
chr2_33605951_T_C_b38	RASGRP3	-4.911	1.23e-06	-0.063871	124	0.013005	yes	THYROID
chr2_33580247_A_G_b38	RASGRP3	-4.908	1.25e-06	-0.065844	123	0.013417	yes	THYROID
chr2_33539996_AAAAAG_A_b38	RASGRP3	-4.9	1.29e-06	-0.065602	126	0.013388	yes	THYROID
chr2_33615675_TA_T_b38	RASGRP3	-4.889	1.37e-06	-0.064739	105	0.013242	yes	THYROID
chr2_33611855_A_C_b38	RASGRP3	4.879	1.44e-06	0.094439	11	0.019358	yes	THYROID
chr2_33615793_A_T_b38	RASGRP3	4.855	1.61e-06	0.101375	6	0.020881	yes	THYROID
chr2_33621944_G_A_b38	RASGRP3	4.855	1.61e-06	0.101375	6	0.020881	yes	THYROID
chr2_33623483_C_T_b38	RASGRP3	4.855	1.61e-06	0.101375	6	0.020881	yes	THYROID
chr2_33592492_A_G_b38	RASGRP3	-4.842	1.72e-06	-0.064192	128	0.013258	yes	THYROID
chr2_33664742_G_C_b38	RASGRP3	-4.839	1.74e-06	-0.062358	135	0.012887	yes	THYROID
chr2_33617107_G_A_b38	RASGRP3	-4.831	1.8e-06	-0.063695	105	0.013184	yes	THYROID
chr2_33597253_G_A_b38	RASGRP3	-4.828	1.84e-06	-0.065591	120	0.013587	yes	THYROID
chr2_33630364_C_G_b38	RASGRP3	-4.827	1.84e-06	-0.064269	101	0.013314	yes	THYROID
chr2_33669427_A_C_b38	RASGRP3	4.813	1.97e-06	0.083357	18	0.017319	yes	THYROID
chr2_33618669_C_CT_b38	RASGRP3	-4.806	2.04e-06	-0.06318	106	0.013147	yes	THYROID
chr2_33615450_C_G_b38	RASGRP3	4.803	2.06e-06	0.100632	6	0.02095	yes	THYROID
chr2_33663649_A_C_b38	RASGRP3	-4.802	2.07e-06	-0.061631	134	0.012834	yes	THYROID
chr2_33605847_C_CT_b38	RASGRP3	4.802	2.08e-06	0.101722	4	0.021183	yes	THYROID
chr2_33664871_G_GT_b38	RASGRP3	-4.791	2.19e-06	-0.062564	129	0.013058	yes	THYROID
chr2_33669785_CA_C_b38	RASGRP3	-4.781	2.29e-06	-0.062587	91	0.01309	yes	THYROID
chr2_33659127_A_G_b38	RASGRP3	-4.775	2.36e-06	-0.060976	134	0.01277	yes	THYROID
chr2_33631185_T_G_b38	RASGRP3	-4.751	2.64e-06	-0.062345	132	0.013122	yes	THYROID
chr2_33661731_A_G_b38	RASGRP3	-4.737	2.83e-06	-0.060503	134	0.012773	yes	THYROID
chr2_33669574_A_G_b38	RASGRP3	4.736	2.84e-06	0.081813	18	0.017274	yes	THYROID
chr2_33655786_T_C_b38	RASGRP3	-4.71	3.22e-06	-0.060653	118	0.012879	yes	THYROID
chr2_33666591_A_G_b38	RASGRP3	-4.71	3.22e-06	-0.060786	137	0.012907	yes	THYROID
chr2_33536322_GA_G_b38	RASGRP3	-4.694	3.46e-06	-0.067617	99	0.014406	yes	THYROID
chr2_33618734_A_G_b38	RASGRP3	-4.693	3.48e-06	-0.061844	105	0.013178	yes	THYROID
chr2_33632169_T_C_b38	RASGRP3	-4.686	3.6e-06	-0.063496	95	0.013552	yes	THYROID
chr2_33631637_C_A_b38	RASGRP3	-4.678	3.72e-06	-0.062306	102	0.013318	yes	THYROID
chr2_33637426_T_A_b38	RASGRP3	4.666	3.94e-06	0.079693	23	0.01708	yes	THYROID
chr2_33660983_C_T_b38	RASGRP3	-4.663	4.01e-06	-0.060216	114	0.012915	yes	THYROID
chr2_33658757_C_A_b38	RASGRP3	-4.66	4.05e-06	-0.060767	110	0.01304	yes	THYROID
chr2_33614957_G_A_b38	RASGRP3	-4.633	4.59e-06	-0.061293	103	0.013228	yes	THYROID
chr2_33631863_T_C_b38	RASGRP3	-4.624	4.79e-06	-0.061003	132	0.013192	yes	THYROID
chr2_33625433_A_C_b38	RASGRP3	-4.616	4.98e-06	-0.062163	98	0.013467	yes	THYROID
chr2_33622456_T_TAAAC_b38	RASGRP3	-4.616	4.98e-06	-0.061189	106	0.013256	yes	THYROID
chr2_33625063_ATCT_A_b38	RASGRP3	-4.607	5.18e-06	-0.062181	96	0.013497	yes	THYROID
chr2_33613986_T_C_b38	RASGRP3	-4.596	5.46e-06	-0.060546	108	0.013174	yes	THYROID
chr2_33655112_A_AT_b38	RASGRP3	-4.592	5.55e-06	-0.061548	110	0.013402	yes	THYROID
chr2_33562267_C_CT_b38	RASGRP3	4.564	6.31e-06	0.059931	95	0.013131	yes	THYROID
chr2_33633545_T_G_b38	RASGRP3	4.534	7.25e-06	0.095165	6	0.02099	yes	THYROID
chr2_33624514_C_A_b38	RASGRP3	-4.517	7.81e-06	-0.060534	104	0.0134	yes	THYROID
chr2_33669621_C_T_b38	RASGRP3	-4.496	8.59e-06	-0.058747	99	0.013065	yes	THYROID
chr2_33669751_C_T_b38	RASGRP3	-4.496	8.59e-06	-0.058747	99	0.013065	yes	THYROID
chr2_33670200_G_T_b38	RASGRP3	-4.476	9.43e-06	-0.058419	100	0.013053	yes	THYROID
chr2_33620413_GA_G_b38	RASGRP3	4.467	9.8e-06	0.086245	6	0.019306	yes	THYROID
chr2_33629277_A_G_b38	RASGRP3	-4.466	9.83e-06	-0.059305	108	0.013278	yes	THYROID
chr2_33604404_G_GTA_b38	RASGRP3	4.446	1.08e-05	0.091437	5	0.020565	yes	THYROID
chr2_33625060_G_A_b38	RASGRP3	-4.435	1.13e-05	-0.059539	103	0.013424	yes	THYROID
chr2_33671460_G_A_b38	RASGRP3	4.419	1.22e-05	0.087298	8	0.019756	yes	THYROID
chr2_33629533_C_G_b38	RASGRP3	4.418	1.22e-05	0.084652	11	0.019159	yes	THYROID
chr2_33664465_T_A_b38	RASGRP3	-4.41	1.27e-05	-0.05706	128	0.012939	yes	THYROID
chr2_33781569_AGTGTGT_A_b38	RASGRP3	4.397	1.34e-05	0.101567	3	0.023097	yes	THYROID
chr2_33661861_G_A_b38	RASGRP3	-4.385	1.42e-05	-0.056506	123	0.012887	yes	THYROID
chr2_33668030_G_A_b38	RASGRP3	4.38	1.44e-05	0.092167	7	0.021043	yes	THYROID
chr2_33772378_C_T_b38	RASGRP3	4.358	1.59e-05	0.091873	5	0.021083	yes	THYROID
chr2_33548698_A_AATTATT_b38	RASGRP3	-4.355	1.61e-05	-0.081886	12	0.018803	yes	THYROID
chr2_33771916_C_T_b38	RASGRP3	4.232	2.76e-05	0.081796	19	0.01933	yes	THYROID
chr2_33771954_G_T_b38	RASGRP3	4.232	2.76e-05	0.081796	19	0.01933	yes	THYROID
chr2_33550598_T_G_b38	RASGRP3	-4.223	2.87e-05	-0.079566	12	0.018843	yes	THYROID
chr2_33591195_C_CT_b38	RASGRP3	-4.22	2.9e-05	-0.063005	66	0.014931	yes	THYROID
chr2_33543901_C_G_b38	RASGRP3	-4.177	3.49e-05	-0.058817	77	0.014082	yes	THYROID
chr2_33545200_T_C_b38	RASGRP3	-4.162	3.71e-05	-0.078348	12	0.018824	yes	THYROID
chr2_33631252_G_T_b38	RASGRP3	4.09	5.01e-05	0.054209	137	0.013253	yes	THYROID
chr2_33546473_C_T_b38	RASGRP3	-4.081	5.21e-05	-0.077278	11	0.018936	yes	THYROID
chr2_33549383_C_T_b38	RASGRP3	-4.073	5.39e-05	-0.077033	12	0.018912	yes	THYROID
chr2_33673146_T_C_b38	RASGRP3	-4.067	5.53e-05	-0.052713	126	0.012962	yes	THYROID
chr2_33551040_C_T_b38	RASGRP3	-4.057	5.76e-05	-0.076958	11	0.018969	yes	THYROID
chr2_33546347_C_G_b38	RASGRP3	-4.049	5.96e-05	-0.076356	12	0.018858	yes	THYROID
chr2_33678762_C_CACTT_b38	RASGRP3	-4.046	6.03e-05	-0.05343	123	0.013205	yes	THYROID
chr2_33630302_AT_A_b38	RASGRP3	-4.03	6.44e-05	-0.057849	105	0.014354	yes	THYROID
chr2_33792244_T_C_b38	RASGRP3	4.021	6.7e-05	0.150243	5	0.037368	yes	THYROID
chr2_33771977_TC_T_b38	RASGRP3	4.007	7.09e-05	0.078993	15	0.019716	yes	THYROID
chr2_33545336_G_A_b38	RASGRP3	-3.98	7.92e-05	-0.076677	9	0.019268	yes	THYROID
chr2_33553788_G_A_b38	RASGRP3	-3.951	8.88e-05	-0.075059	11	0.018995	yes	THYROID
chr2_33556856_G_C_b38	RASGRP3	-3.951	8.88e-05	-0.075059	11	0.018995	yes	THYROID
chr2_33706678_T_C_b38	RASGRP3	3.946	9.09e-05	0.087156	4	0.022089	yes	THYROID
chr2_33548381_A_AAAG_b38	RASGRP3	3.932	9.62e-05	0.080351	13	0.020437	yes	THYROID
chr2_33550119_G_T_b38	RASGRP3	-3.93	9.7e-05	-0.074496	11	0.018958	yes	THYROID
chr2_33004447_A_G_b38	RASGRP3	3.854	0.000131	0.054103	70	0.014037	yes	THYROID
chr2_33634843_C_CTT_b38	RASGRP3	3.846	0.000136	0.08826	8	0.02295	yes	THYROID
chr2_33787907_A_G_b38	RASGRP3	3.827	0.000146	0.074947	11	0.019583	yes	THYROID
chr2_33673961_G_A_b38	RASGRP3	-3.804	0.00016	-0.051203	98	0.013459	yes	THYROID
chr2_33673967_T_A_b38	RASGRP3	-3.804	0.00016	-0.051203	98	0.013459	yes	THYROID
chr2_33525699_C_CAA_b38	RASGRP3	3.799	0.000163	0.118286	10	0.031132	yes	THYROID
chr2_33675020_C_G_b38	RASGRP3	-3.795	0.000166	-0.051217	97	0.013498	yes	THYROID
chr2_33003100_G_A_b38	RASGRP3	3.791	0.000168	0.053179	70	0.014026	yes	THYROID
chr2_33577495_T_TA_b38	RASGRP3	3.79	0.000169	0.084781	3	0.02237	yes	THYROID
chr2_33674183_T_C_b38	RASGRP3	-3.774	0.00018	-0.050529	100	0.01339	yes	THYROID
chr2_32967979_AGTTTGTTT_A_b38	RASGRP3	-3.753	0.000195	-0.052293	86	0.013932	yes	THYROID
chr2_33561322_C_T_b38	RASGRP3	-3.695	0.000244	-0.071171	10	0.019262	yes	THYROID
chr2_33005867_G_A_b38	RASGRP3	3.691	0.000247	0.052023	69	0.014093	yes	THYROID
chr2_32972273_GT_G_b38	RASGRP3	-3.662	0.000276	-0.051167	87	0.013971	yes	THYROID
chr2_33622130_CA_C_b38	RASGRP3	-3.659	0.00028	-0.054593	54	0.014919	yes	THYROID
chr2_33522958_T_C_b38	RASGRP3	-3.636	0.000305	-0.089088	4	0.0245	yes	THYROID
chr2_33556890_TAC_T_b38	RASGRP3	-3.633	0.000309	-0.058204	28	0.016022	yes	THYROID
chr2_33534754_C_T_b38	RASGRP3	3.628	0.000315	0.113179	3	0.031194	yes	THYROID
chr2_33480497_T_C_b38	RASGRP3	3.623	0.000321	0.074426	9	0.020545	yes	THYROID
chr2_32969344_T_TGTG_b38	RASGRP3	-3.62	0.000324	-0.050471	85	0.013941	yes	THYROID
chr2_33552018_CAAACAAACA_C_b38	RASGRP3	-3.61	0.000336	-0.069507	11	0.019252	yes	THYROID
chr2_33676624_C_T_b38	RASGRP3	-3.543	0.000433	-0.048753	84	0.013761	yes	THYROID
chr2_33629657_C_CT_b38	RASGRP3	3.537	0.000443	0.062599	19	0.0177	yes	THYROID
chr2_33093442_C_G_b38	RASGRP3	-3.482	0.000541	-0.065466	20	0.0188	yes	THYROID
chr2_33673921_C_G_b38	RASGRP3	-3.456	0.000595	-0.046052	108	0.013326	yes	THYROID
chr2_33678193_G_A_b38	RASGRP3	-3.453	6e-04	-0.047556	83	0.013771	yes	THYROID
chr2_33563038_A_G_b38	RASGRP3	-3.432	0.000648	-0.069539	10	0.020261	yes	THYROID
chr2_33676027_A_T_b38	RASGRP3	-3.41	0.000701	-0.04549	108	0.01334	yes	THYROID
chr2_33563470_A_ATACT_b38	RASGRP3	-3.384	0.00077	-0.07396	7	0.021855	yes	THYROID
chr2_33537323_G_C_b38	RASGRP3	-3.371	0.000806	-0.050748	50	0.015053	yes	THYROID
chr2_33753914_G_T_b38	RASGRP3	3.366	0.000822	0.064376	14	0.019128	yes	THYROID
chr2_33150012_A_T_b38	RASGRP3	3.325	0.000949	0.154802	3	0.046559	yes	THYROID
chr2_33072036_G_GC_b38	RASGRP3	-3.317	0.000974	-0.052384	47	0.015791	yes	THYROID
chr2_33679032_C_G_b38	RASGRP3	-3.298	0.00104	-0.044094	105	0.013371	yes	THYROID
chr2_33534694_A_AT_b38	RASGRP3	3.277	0.00112	0.053586	28	0.016351	yes	THYROID
chr2_33563203_CTTGTT_C_b38	RASGRP3	3.22	0.00136	0.046932	56	0.014574	yes	THYROID
chr2_33072093_T_C_b38	RASGRP3	-3.203	0.00145	-0.050568	42	0.015789	yes	THYROID
chr2_32973114_G_GT_b38	RASGRP3	3.196	0.00148	0.046228	58	0.014464	yes	THYROID
chr2_33720438_G_T_b38	RASGRP3	3.184	0.00154	0.109479	3	0.03438	yes	THYROID
chr2_33477835_C_T_b38	RASGRP3	3.169	0.00163	0.050589	26	0.015966	yes	THYROID
chr2_33480322_C_T_b38	RASGRP3	3.161	0.00167	0.064502	9	0.020407	yes	THYROID
chr2_33638203_C_CT_b38	RASGRP3	-3.149	0.00173	-0.051007	44	0.016196	yes	THYROID
chr2_33770343_T_G_b38	RASGRP3	3.137	0.0018	0.049859	43	0.015892	yes	THYROID
chr2_33179809_C_G_b38	RASGRP3	3.12	0.00191	0.095157	5	0.030502	yes	THYROID
chr2_32970273_G_C_b38	RASGRP3	-3.106	0.002	-0.04258	102	0.01371	yes	THYROID
chr2_33501543_C_T_b38	RASGRP3	3.104	0.00202	0.053276	24	0.017166	yes	THYROID
chr2_33567211_TA_T_b38	RASGRP3	-3.1	0.00205	-0.047015	70	0.015167	yes	THYROID
chr2_33479411_A_ACTC_b38	RASGRP3	-3.094	0.00208	-0.047455	42	0.015336	yes	THYROID
chr2_33005594_CTT_C_b38	RASGRP3	-3.093	0.00209	-0.043987	84	0.014224	yes	THYROID
chr2_33582793_C_G_b38	RASGRP3	3.082	0.00217	0.042541	70	0.013801	yes	THYROID
chr2_33604404_GTA_G_b38	RASGRP3	-3.076	0.00221	-0.04584	51	0.014903	yes	THYROID
chr2_32810114_C_CA_b38	RASGRP3	-3.071	0.00225	-0.046537	54	0.015155	yes	THYROID
chr2_33178153_A_G_b38	RASGRP3	3.057	0.00235	0.114993	5	0.037611	yes	THYROID
chr2_33770718_A_C_b38	RASGRP3	3.056	0.00236	0.048853	42	0.015988	yes	THYROID
chr2_33537417_G_A_b38	RASGRP3	-3.037	0.00252	-0.055173	13	0.01817	yes	THYROID
chr2_33771507_G_A_b38	RASGRP3	3.035	0.00253	0.048002	42	0.015816	yes	THYROID
chr2_33770196_A_G_b38	RASGRP3	3.029	0.00258	0.048294	42	0.015944	yes	THYROID
chr2_33770292_G_C_b38	RASGRP3	3.029	0.00258	0.048294	42	0.015944	yes	THYROID
chr2_33770360_T_C_b38	RASGRP3	3.029	0.00258	0.048294	42	0.015944	yes	THYROID
chr2_33770545_C_T_b38	RASGRP3	3.029	0.00258	0.048294	42	0.015944	yes	THYROID
chr2_33771282_C_A_b38	RASGRP3	3.029	0.00258	0.048294	42	0.015944	yes	THYROID
chr2_33771310_T_TGTG_b38	RASGRP3	3.029	0.00258	0.048294	42	0.015944	yes	THYROID
chr2_33771305_A_ATGTC_b38	RASGRP3	3.026	0.00261	0.048252	42	0.015947	yes	THYROID
chr2_33177707_A_G_b38	RASGRP3	3.006	0.00278	0.089485	9	0.029772	yes	THYROID
chr2_33121159_CTTT_C_b38	RASGRP3	-2.977	0.00305	-0.092318	5	0.031011	yes	THYROID
chr2_33771705_T_C_b38	RASGRP3	2.975	0.00307	0.047454	41	0.015949	yes	THYROID
chr2_33771715_A_G_b38	RASGRP3	2.975	0.00307	0.047454	41	0.015949	yes	THYROID
chr2_33771716_AATTG_A_b38	RASGRP3	2.975	0.00307	0.047454	41	0.015949	yes	THYROID
chr2_33587735_T_A_b38	RASGRP3	2.973	0.00309	0.041578	69	0.013983	yes	THYROID
chr2_33540615_T_TTC_b38	RASGRP3	2.967	0.00315	0.097999	3	0.033032	yes	THYROID
chr2_33177659_C_A_b38	RASGRP3	2.956	0.00326	0.126761	5	0.042885	yes	THYROID
chr2_33573084_G_C_b38	RASGRP3	-2.949	0.00334	-0.071225	5	0.024152	yes	THYROID
chr2_33601894_C_G_b38	RASGRP3	2.944	0.00339	0.040886	69	0.01389	yes	THYROID
chr2_32996915_C_T_b38	RASGRP3	2.929	0.00355	0.046384	38	0.015834	yes	THYROID
chr2_32607975_C_CA_b38	RASGRP3	-2.905	0.00383	-0.049873	34	0.017168	yes	THYROID
chr2_32956808_C_T_b38	RASGRP3	-2.888	0.00404	-0.041541	73	0.014384	yes	THYROID
chr2_33064486_C_T_b38	RASGRP3	-2.88	0.00415	-0.105975	3	0.0368	yes	THYROID
chr2_32929177_T_TAA_b38	RASGRP3	-2.878	0.00417	-0.071478	5	0.024834	yes	THYROID
chr2_33933541_CTCCTTCCTTCCT_C_b38	RASGRP3	2.868	0.0043	0.082455	7	0.028746	yes	THYROID
chr2_33045803_G_A_b38	RASGRP3	-2.863	0.00437	-0.106469	3	0.037189	yes	THYROID
chr2_34355786_A_G_b38	RASGRP3	2.863	0.00438	0.057214	19	0.019987	yes	THYROID
chr2_33121989_T_C_b38	RASGRP3	-2.853	0.00451	-0.05281	14	0.018511	yes	THYROID
chr2_33047387_A_C_b38	RASGRP3	2.846	0.00461	0.058534	9	0.02057	yes	THYROID
chr2_33343251_T_A_b38	RASGRP3	2.841	0.00467	0.042799	62	0.015063	yes	THYROID
chr2_33092645_AT_A_b38	RASGRP3	-2.841	0.00468	-0.054256	20	0.019098	yes	THYROID
chr2_33770624_C_T_b38	RASGRP3	2.839	0.00471	0.045413	40	0.015997	yes	THYROID
chr2_33770852_A_G_b38	RASGRP3	2.839	0.00471	0.045413	40	0.015997	yes	THYROID
chr2_33770953_C_T_b38	RASGRP3	2.839	0.00471	0.045413	40	0.015997	yes	THYROID
chr2_33176592_A_C_b38	RASGRP3	2.839	0.00472	0.08739	5	0.030787	yes	THYROID
chr2_33003225_A_G_b38	RASGRP3	-2.829	0.00486	-0.037209	109	0.013153	yes	THYROID
chr2_32962672_T_C_b38	RASGRP3	-2.811	0.00514	-0.040635	70	0.014458	yes	THYROID
chr2_32963401_A_G_b38	RASGRP3	-2.811	0.00514	-0.040635	70	0.014458	yes	THYROID
chr2_33506574_G_C_b38	RASGRP3	2.804	0.00524	0.047167	28	0.016822	yes	THYROID
chr2_33539996_AAAAAGAAAAG_A_b38	RASGRP3	-2.797	0.00535	-0.070179	4	0.02509	yes	THYROID
chr2_33056704_T_C_b38	RASGRP3	2.791	0.00545	0.058899	8	0.021103	yes	THYROID
chr2_33056709_A_T_b38	RASGRP3	2.791	0.00545	0.058899	8	0.021103	yes	THYROID
chr2_33771740_G_T_b38	RASGRP3	2.787	0.00553	0.044613	39	0.016009	yes	THYROID
chr2_33004646_G_A_b38	RASGRP3	2.786	0.00553	0.041576	50	0.014922	yes	THYROID
chr2_33566301_C_CAA_b38	RASGRP3	-2.775	0.00573	-0.084607	5	0.030494	yes	THYROID
chr2_33179798_G_C_b38	RASGRP3	2.763	0.00594	0.085309	5	0.030874	yes	THYROID
chr2_33180574_C_G_b38	RASGRP3	2.763	0.00594	0.085309	5	0.030874	yes	THYROID
chr2_34383137_T_TAAC_b38	RASGRP3	-2.757	0.00605	-0.042052	37	0.015255	yes	THYROID
chr2_33184714_C_T_b38	RASGRP3	2.755	0.00608	0.085054	5	0.030871	yes	THYROID
chr2_33186498_AG_A_b38	RASGRP3	2.755	0.00608	0.085054	5	0.030871	yes	THYROID
chr2_32991874_G_C_b38	RASGRP3	-2.751	0.00616	-0.036157	108	0.013145	yes	THYROID
chr2_33168399_CA_C_b38	RASGRP3	-2.749	0.0062	-0.043457	34	0.015809	yes	THYROID
chr2_33519413_A_G_b38	RASGRP3	-2.748	0.00621	-0.042174	37	0.015348	yes	THYROID
chr2_33005984_A_G_b38	RASGRP3	-2.744	0.00629	-0.03591	111	0.013087	yes	THYROID
chr2_32990106_A_C_b38	RASGRP3	2.739	0.00638	0.063753	7	0.023273	yes	THYROID
chr2_33019921_T_C_b38	RASGRP3	-2.734	0.00648	-0.044503	41	0.016279	yes	THYROID
chr2_33042796_T_C_b38	RASGRP3	2.731	0.00653	0.056576	9	0.020712	yes	THYROID
chr2_33007243_A_T_b38	RASGRP3	-2.729	0.00657	-0.041269	64	0.01512	yes	THYROID
chr2_34273001_T_G_b38	RASGRP3	2.728	0.00659	0.126973	4	0.046542	yes	THYROID
chr2_33139310_C_G_b38	RASGRP3	-2.728	0.0066	-0.071848	3	0.026341	yes	THYROID
chr2_33642136_G_T_b38	RASGRP3	2.727	0.00661	0.040635	47	0.0149	yes	THYROID
chr2_33155254_T_C_b38	RASGRP3	2.721	0.00674	0.116886	5	0.042958	yes	THYROID
chr2_33771480_T_C_b38	RASGRP3	2.717	0.00682	0.042969	43	0.015815	yes	THYROID
chr2_33050850_C_G_b38	RASGRP3	2.716	0.00683	0.061774	5	0.02274	yes	THYROID
chr2_32955630_A_AT_b38	RASGRP3	-2.711	0.00693	-0.038881	71	0.01434	yes	THYROID
chr2_33185786_C_T_b38	RASGRP3	2.696	0.00725	0.108407	4	0.040209	yes	THYROID
chr2_33605933_G_A_b38	RASGRP3	-2.695	0.00728	-0.066107	4	0.024533	yes	THYROID
chr2_33179455_TA_T_b38	RASGRP3	2.687	0.00744	0.080693	5	0.030029	yes	THYROID
chr2_33065705_G_C_b38	RASGRP3	2.685	0.00749	0.05551	8	0.020675	yes	THYROID
chr2_33057846_G_A_b38	RASGRP3	2.684	0.00752	0.056495	8	0.021052	yes	THYROID
chr2_33392180_A_G_b38	RASGRP3	-2.677	0.00766	-0.068898	3	0.025732	yes	THYROID
chr2_33679576_G_T_b38	RASGRP3	2.671	0.0078	0.053035	6	0.019853	yes	THYROID
chr2_33180746_G_A_b38	RASGRP3	2.668	0.00787	0.082393	5	0.030881	yes	THYROID
chr2_33180911_G_T_b38	RASGRP3	2.668	0.00787	0.082393	5	0.030881	yes	THYROID
chr2_33181116_C_T_b38	RASGRP3	2.668	0.00787	0.082393	5	0.030881	yes	THYROID
chr2_33181606_C_G_b38	RASGRP3	2.668	0.00787	0.082393	5	0.030881	yes	THYROID
chr2_33183247_T_A_b38	RASGRP3	2.668	0.00787	0.082393	5	0.030881	yes	THYROID
chr2_33184042_C_T_b38	RASGRP3	2.668	0.00787	0.082393	5	0.030881	yes	THYROID
chr2_33184621_G_A_b38	RASGRP3	2.668	0.00787	0.082393	5	0.030881	yes	THYROID
chr2_33185331_A_G_b38	RASGRP3	2.668	0.00787	0.082393	5	0.030881	yes	THYROID
chr2_33185336_G_A_b38	RASGRP3	2.668	0.00787	0.082393	5	0.030881	yes	THYROID
chr2_33185419_C_T_b38	RASGRP3	2.668	0.00787	0.082393	5	0.030881	yes	THYROID
chr2_33185914_C_G_b38	RASGRP3	2.668	0.00787	0.082393	5	0.030881	yes	THYROID
chr2_33186799_A_G_b38	RASGRP3	2.668	0.00787	0.082393	5	0.030881	yes	THYROID
chr2_33190077_G_A_b38	RASGRP3	2.668	0.00787	0.082393	5	0.030881	yes	THYROID
chr2_33176504_C_A_b38	RASGRP3	2.665	0.00795	0.082535	5	0.030973	yes	THYROID
chr2_33176525_GACA_G_b38	RASGRP3	2.665	0.00795	0.082535	5	0.030973	yes	THYROID
chr2_33176610_A_G_b38	RASGRP3	2.665	0.00795	0.082535	5	0.030973	yes	THYROID
chr2_33177259_T_C_b38	RASGRP3	2.665	0.00795	0.082535	5	0.030973	yes	THYROID
chr2_33177488_A_G_b38	RASGRP3	2.665	0.00795	0.082535	5	0.030973	yes	THYROID
chr2_33177590_C_T_b38	RASGRP3	2.665	0.00795	0.082535	5	0.030973	yes	THYROID
chr2_33177591_T_G_b38	RASGRP3	2.665	0.00795	0.082535	5	0.030973	yes	THYROID
chr2_33177613_A_T_b38	RASGRP3	2.665	0.00795	0.082535	5	0.030973	yes	THYROID
chr2_33177616_C_T_b38	RASGRP3	2.665	0.00795	0.082535	5	0.030973	yes	THYROID
chr2_33177880_A_C_b38	RASGRP3	2.665	0.00795	0.082535	5	0.030973	yes	THYROID
chr2_33596666_T_C_b38	RASGRP3	2.664	0.00796	0.03799	58	0.014259	yes	THYROID
chr2_32957368_G_T_b38	RASGRP3	-2.66	0.00805	-0.038111	70	0.014325	yes	THYROID
chr2_33104890_G_A_b38	RASGRP3	2.66	0.00807	0.043504	23	0.016357	yes	THYROID
chr2_33771584_G_A_b38	RASGRP3	2.657	0.00814	0.042459	41	0.01598	yes	THYROID
chr2_33542583_A_T_b38	RASGRP3	-2.657	0.00814	-0.055445	18	0.020868	yes	THYROID
chr2_33673112_G_T_b38	RASGRP3	-2.656	0.00816	-0.035998	136	0.013554	yes	THYROID
chr2_33034289_T_C_b38	RASGRP3	2.655	0.00818	0.056136	8	0.021142	yes	THYROID
chr2_33536339_G_A_b38	RASGRP3	-2.648	0.00836	-0.06952	5	0.026256	yes	THYROID
chr2_33104887_A_T_b38	RASGRP3	2.648	0.00836	0.043202	23	0.016317	yes	THYROID
chr2_33563588_C_T_b38	RASGRP3	-2.646	0.00839	-0.038025	71	0.014369	yes	THYROID
chr2_33677515_A_G_b38	RASGRP3	2.645	0.00844	0.050165	12	0.01897	yes	THYROID
chr2_33529859_CA_C_b38	RASGRP3	-2.641	0.00851	-0.048322	12	0.018294	yes	THYROID
chr2_33789762_A_G_b38	RASGRP3	2.64	0.00854	0.040418	39	0.015307	yes	THYROID
chr2_33182123_T_C_b38	RASGRP3	2.637	0.00863	0.113548	5	0.043062	yes	THYROID
chr2_33004517_G_A_b38	RASGRP3	2.635	0.00868	0.038643	53	0.014666	yes	THYROID
chr2_33007962_T_C_b38	RASGRP3	-2.63	0.0088	-0.039839	63	0.015148	yes	THYROID
chr2_33158687_G_A_b38	RASGRP3	2.625	0.00892	0.117164	4	0.04463	yes	THYROID
chr2_33535944_C_T_b38	RASGRP3	2.621	0.00903	0.038295	48	0.01461	yes	THYROID
chr2_32973568_G_C_b38	RASGRP3	2.615	0.0092	0.03571	80	0.013658	yes	THYROID
chr2_33040081_C_T_b38	RASGRP3	2.612	0.00926	0.054895	8	0.021014	yes	THYROID
chr2_33043645_C_A_b38	RASGRP3	2.612	0.00926	0.054895	8	0.021014	yes	THYROID
chr2_34360667_G_A_b38	RASGRP3	2.612	0.00927	0.055589	11	0.021282	yes	THYROID
chr2_32961194_A_G_b38	RASGRP3	2.611	0.00928	0.03709	63	0.014203	yes	THYROID
chr2_33059010_G_A_b38	RASGRP3	-2.611	0.00929	-0.09632	3	0.036888	yes	THYROID
chr2_33178333_G_A_b38	RASGRP3	2.609	0.00934	0.080755	5	0.030949	yes	THYROID
chr2_33178488_T_G_b38	RASGRP3	2.609	0.00934	0.080755	5	0.030949	yes	THYROID
chr2_33178543_ATTG_A_b38	RASGRP3	2.609	0.00934	0.080755	5	0.030949	yes	THYROID
chr2_33179042_C_G_b38	RASGRP3	2.609	0.00934	0.080755	5	0.030949	yes	THYROID
chr2_33179173_T_G_b38	RASGRP3	2.609	0.00934	0.080755	5	0.030949	yes	THYROID
chr2_33179174_T_C_b38	RASGRP3	2.609	0.00934	0.080755	5	0.030949	yes	THYROID
chr2_33179198_A_AT_b38	RASGRP3	2.609	0.00934	0.080755	5	0.030949	yes	THYROID
chr2_33179348_G_A_b38	RASGRP3	2.609	0.00934	0.080755	5	0.030949	yes	THYROID
chr2_33061239_G_C_b38	RASGRP3	2.606	0.00944	0.055449	7	0.021281	yes	THYROID
chr2_33057962_C_T_b38	RASGRP3	-2.606	0.00944	-0.088992	3	0.034154	yes	THYROID
chr2_33547053_GAAAAAAAAA_G_b38	RASGRP3	-2.604	0.00948	-0.06989	3	0.026836	yes	THYROID
chr2_32648436_CT_C_b38	RASGRP3	2.603	0.00951	0.040857	90	0.015696	yes	THYROID
chr2_33394624_G_A_b38	RASGRP3	2.591	0.00984	0.118328	3	0.045664	yes	THYROID
chr2_33537896_A_G_b38	RASGRP3	19.114	1.27e-61	0.328216	3	0.017172	no	THYROID
chr2_33531453_C_T_b38	RASGRP3	18.902	1.33e-60	0.317603	5	0.016803	no	THYROID
chr2_33557844_G_A_b38	RASGRP3	18.332	7.23e-58	0.304489	6	0.01661	no	THYROID
chr2_33557635_G_A_b38	RASGRP3	18.02	2.24e-56	0.31219	4	0.017325	no	THYROID
chr2_33526597_C_T_b38	RASGRP3	17.968	3.95e-56	0.313184	4	0.01743	no	THYROID
chr2_33527062_GC_G_b38	RASGRP3	17.968	3.95e-56	0.313184	4	0.01743	no	THYROID
chr2_33559734_G_A_b38	RASGRP3	17.859	1.3e-55	0.310116	4	0.017364	no	THYROID
chr2_33529269_C_A_b38	RASGRP3	17.74	4.84e-55	0.305996	5	0.017249	no	THYROID
chr2_33559068_A_G_b38	RASGRP3	17.715	6.35e-55	0.312338	4	0.017631	no	THYROID
chr2_33559304_G_A_b38	RASGRP3	17.551	3.82e-54	0.308627	4	0.017585	no	THYROID
chr2_33548469_T_C_b38	RASGRP3	16.946	2.75e-51	0.305484	4	0.018027	no	THYROID
chr2_33550216_T_A_b38	RASGRP3	16.576	1.48e-49	0.302561	4	0.018253	no	THYROID
chr2_33550484_C_G_b38	RASGRP3	16.576	1.48e-49	0.302561	4	0.018253	no	THYROID
chr2_33548762_A_G_b38	RASGRP3	16.446	6e-49	0.304357	4	0.018506	no	THYROID
chr2_33554542_A_G_b38	RASGRP3	16.383	1.18e-48	0.301643	4	0.018412	no	THYROID
chr2_33537192_G_GAT_b38	RASGRP3	15.608	4.51e-45	0.27385	4	0.017546	no	THYROID
chr2_33540561_TGTGTGTGTGTG_T_b38	RASGRP3	14.607	1.55e-40	0.258829	13	0.017719	no	THYROID
chr2_33536322_G_GA_b38	RASGRP3	11.714	3.43e-28	0.21031	16	0.017954	no	THYROID
chr2_33529318_C_T_b38	RASGRP3	11.418	5.21e-27	0.1833	13	0.016053	no	THYROID
chr2_33582025_C_T_b38	RASGRP3	9.9	3.15e-21	0.149545	28	0.015106	no	THYROID
chr2_33508652_C_G_b38	RASGRP3	6.014	3.49e-09	0.081083	77	0.013483	no	THYROID
chr2_33514230_T_G_b38	RASGRP3	5.801	1.16e-08	0.097953	19	0.016884	no	THYROID
chr2_33547458_G_A_b38	RASGRP3	5.355	1.3e-07	0.073276	71	0.013683	no	THYROID
chr2_33545793_CTAT_C_b38	RASGRP3	4.93	1.12e-06	0.075263	35	0.015265	no	THYROID
chr2_33546340_A_G_b38	RASGRP3	4.682	3.66e-06	0.073085	32	0.015611	no	THYROID
chr2_33522218_G_A_b38	RASGRP3	4.647	4.3e-06	0.072477	31	0.015595	no	THYROID
chr2_33530930_T_C_b38	RASGRP3	4.627	4.73e-06	0.072073	32	0.015577	no	THYROID
chr2_33545661_T_C_b38	RASGRP3	4.609	5.14e-06	0.072769	30	0.015789	no	THYROID
chr2_33554839_T_C_b38	RASGRP3	4.411	1.26e-05	0.062006	71	0.014057	no	THYROID
chr2_33518738_C_T_b38	RASGRP3	4.377	1.47e-05	0.067164	34	0.015345	no	THYROID
chr2_33521739_T_A_b38	RASGRP3	4.372	1.5e-05	0.067891	31	0.01553	no	THYROID
chr2_33522498_A_G_b38	RASGRP3	4.344	1.69e-05	0.067833	31	0.015615	no	THYROID
chr2_33539650_C_T_b38	RASGRP3	4.32	1.88e-05	0.067132	32	0.015541	no	THYROID
chr2_33548381_A_AAAAAG_b38	RASGRP3	4.3	2.05e-05	0.105782	8	0.0246	no	THYROID
chr2_33569651_CA_C_b38	RASGRP3	-4.299	2.07e-05	-0.074216	40	0.017266	no	THYROID
chr2_33520269_T_C_b38	RASGRP3	4.286	2.18e-05	0.067065	28	0.015649	no	THYROID
chr2_33539888_A_T_b38	RASGRP3	4.266	2.38e-05	0.066376	32	0.01556	no	THYROID
chr2_33529261_A_G_b38	RASGRP3	4.245	2.61e-05	0.068878	26	0.016226	no	THYROID
chr2_33517217_G_A_b38	RASGRP3	4.132	4.21e-05	0.063799	33	0.015439	no	THYROID
chr2_33531341_C_A_b38	RASGRP3	4.061	5.67e-05	0.062432	33	0.015374	no	THYROID
chr2_33509815_G_A_b38	RASGRP3	4.043	6.12e-05	0.063177	31	0.015628	no	THYROID
chr2_33509399_C_CA_b38	RASGRP3	3.996	7.41e-05	0.079271	5	0.019839	no	THYROID
chr2_33535209_G_A_b38	RASGRP3	3.911	0.000104	0.059917	34	0.015319	no	THYROID
chr2_33540888_T_C_b38	RASGRP3	-3.846	0.000136	-0.046726	148	0.01215	no	THYROID
chr2_33511214_C_T_b38	RASGRP3	3.822	0.000149	0.056664	42	0.014825	no	THYROID
chr2_33541741_G_T_b38	RASGRP3	-3.821	0.000149	-0.046608	148	0.012197	no	THYROID
chr2_33539533_G_T_b38	RASGRP3	-3.721	0.000221	-0.045658	150	0.012269	no	THYROID
chr2_33642139_G_T_b38	RASGRP3	3.693	0.000246	0.066797	14	0.018088	no	THYROID
chr2_33540561_TGTGTGTGTGTGTGTGTG_T_b38	RASGRP3	-3.679	0.000259	-0.049135	87	0.013354	no	THYROID
chr2_33764518_G_GTT_b38	RASGRP3	3.622	0.000322	0.087079	3	0.024043	no	THYROID
chr2_33537330_C_CCCA_b38	RASGRP3	-3.563	0.000402	-0.080406	11	0.022568	no	THYROID
chr2_33050154_CT_C_b38	RASGRP3	-3.504	0.000499	-0.059751	39	0.017052	no	THYROID
chr2_33515921_T_A_b38	RASGRP3	3.461	0.000583	0.062492	17	0.018054	no	THYROID
chr2_33547053_GAAAAAA_G_b38	RASGRP3	-3.378	0.000788	-0.062649	13	0.018548	no	THYROID
chr2_33540615_TTCTC_T_b38	RASGRP3	-3.3	0.00104	-0.043027	113	0.013039	no	THYROID
chr2_33598472_A_C_b38	RASGRP3	3.279	0.00111	0.04717	53	0.014385	no	THYROID
chr2_33060651_CTG_C_b38	RASGRP3	3.274	0.00113	0.06613	11	0.020198	no	THYROID
chr2_33537367_A_AT_b38	RASGRP3	3.263	0.00118	0.092615	4	0.028384	no	THYROID
chr2_33541391_G_A_b38	RASGRP3	3.241	0.00127	0.100731	5	0.031083	no	THYROID
chr2_33241988_G_C_b38	RASGRP3	3.232	0.00131	0.04659	55	0.014416	no	THYROID
chr2_33551613_T_G_b38	RASGRP3	3.187	0.00153	0.050055	32	0.015706	no	THYROID
chr2_33592814_T_C_b38	RASGRP3	3.138	0.0018	0.045356	52	0.014454	no	THYROID
chr2_34116534_TTTC_T_b38	RASGRP3	3.127	0.00187	0.112457	3	0.035962	no	THYROID
chr2_33530497_CT_C_b38	RASGRP3	3.124	0.00189	0.052209	17	0.016714	no	THYROID
chr2_33788893_A_G_b38	RASGRP3	3.117	0.00193	0.041721	80	0.013383	no	THYROID
chr2_33591739_A_G_b38	RASGRP3	3.115	0.00194	0.044945	52	0.014429	no	THYROID
chr2_33341796_T_C_b38	RASGRP3	3.11	0.00198	0.133397	6	0.042899	no	THYROID
chr2_33749290_G_T_b38	RASGRP3	3.102	0.00203	0.072404	4	0.023338	no	THYROID
chr2_33734734_G_A_b38	RASGRP3	3.073	0.00223	0.071349	4	0.023218	no	THYROID
chr2_33192567_T_C_b38	RASGRP3	-3.049	0.00242	-0.07603	3	0.024934	no	THYROID
chr2_33591518_C_T_b38	RASGRP3	3.011	0.00273	0.043497	53	0.014446	no	THYROID
chr2_34142319_G_A_b38	RASGRP3	2.981	0.00301	0.127419	5	0.042738	no	THYROID
chr2_33540553_GTT_G_b38	RASGRP3	2.976	0.00306	0.037956	99	0.012752	no	THYROID
chr2_33133012_A_C_b38	RASGRP3	2.976	0.00306	0.049936	19	0.016782	no	THYROID
chr2_33480167_T_C_b38	RASGRP3	2.947	0.00336	0.056203	20	0.019073	no	THYROID
chr2_34041853_C_A_b38	RASGRP3	-2.886	0.00406	-0.073541	7	0.025478	no	THYROID
chr2_33638203_CT_C_b38	RASGRP3	2.857	0.00446	0.067001	6	0.023452	no	THYROID
chr2_33590317_T_G_b38	RASGRP3	2.806	0.0052	0.043466	37	0.015488	no	THYROID
chr2_33605252_A_G_b38	RASGRP3	2.802	0.00527	0.040492	52	0.014451	no	THYROID
chr2_33777074_A_G_b38	RASGRP3	-2.788	0.00551	-0.037392	148	0.013413	no	THYROID
chr2_33467980_TTTTCTTTCTTTC_T_b38	RASGRP3	2.781	0.00562	0.049266	24	0.017714	no	THYROID
chr2_33326318_G_T_b38	RASGRP3	2.781	0.00562	0.129804	4	0.046676	no	THYROID
chr2_34041836_A_C_b38	RASGRP3	-2.772	0.00577	-0.087322	8	0.031499	no	THYROID
chr2_32970699_C_T_b38	RASGRP3	2.758	0.00603	0.058214	8	0.021107	no	THYROID
chr2_32991192_C_A_b38	RASGRP3	2.731	0.00653	0.058754	7	0.021512	no	THYROID
chr2_33596331_G_C_b38	RASGRP3	2.729	0.00658	0.045916	24	0.016825	no	THYROID
chr2_33121159_C_CT_b38	RASGRP3	-2.726	0.00663	-0.072979	11	0.02677	no	THYROID
chr2_32988934_CT_C_b38	RASGRP3	2.725	0.00665	0.043547	36	0.015978	no	THYROID
chr2_32964838_C_T_b38	RASGRP3	2.705	0.00706	0.057938	7	0.021417	no	THYROID
chr2_33584227_A_G_b38	RASGRP3	2.702	0.00713	0.042047	36	0.015563	no	THYROID
chr2_32976844_G_A_b38	RASGRP3	2.693	0.00733	0.057663	7	0.021415	no	THYROID
chr2_32982671_C_T_b38	RASGRP3	2.693	0.00733	0.057663	7	0.021415	no	THYROID
chr2_33611391_T_A_b38	RASGRP3	2.692	0.00735	0.039704	49	0.014751	no	THYROID
chr2_33610975_T_G_b38	RASGRP3	2.678	0.00766	0.041668	37	0.015561	no	THYROID
chr2_33612720_T_G_b38	RASGRP3	2.678	0.00766	0.041668	37	0.015561	no	THYROID
chr2_33778798_T_C_b38	RASGRP3	-2.672	0.00779	-0.035763	150	0.013385	no	THYROID
chr2_33478490_C_T_b38	RASGRP3	2.668	0.00788	0.036686	84	0.013751	no	THYROID
chr2_32985271_ACTGAGCT_A_b38	RASGRP3	2.662	0.00802	0.036504	78	0.013714	no	THYROID
chr2_33648791_T_A_b38	RASGRP3	2.635	0.00866	0.040909	39	0.015523	no	THYROID
chr2_33605562_C_G_b38	RASGRP3	2.63	0.0088	0.037675	55	0.014326	no	THYROID
chr2_33393234_CTT_C_b38	RASGRP3	-2.627	0.00887	-0.061084	13	0.023248	no	THYROID
chr2_32798713_AAATAAT_A_b38	RASGRP3	-2.617	0.00913	-0.104576	4	0.039954	no	THYROID
chr2_33014179_C_T_b38	RASGRP3	2.614	0.00922	0.03877	52	0.014833	no	THYROID
chr2_33610355_A_G_b38	RASGRP3	2.611	0.00929	0.040527	37	0.015519	no	THYROID
chr2_33610531_A_G_b38	RASGRP3	2.611	0.00929	0.040527	37	0.015519	no	THYROID
chr2_33610715_A_G_b38	RASGRP3	2.611	0.00929	0.040527	37	0.015519	no	THYROID
chr2_33618402_A_G_b38	RASGRP3	2.611	0.00929	0.040527	37	0.015519	no	THYROID
chr2_33619352_A_G_b38	RASGRP3	2.611	0.00929	0.040527	37	0.015519	no	THYROID
chr2_33620490_A_G_b38	RASGRP3	2.611	0.00929	0.040527	37	0.015519	no	THYROID
chr2_33651073_T_C_b38	RASGRP3	2.61	0.00932	0.04037	39	0.015467	no	THYROID
chr2_33540861_TA_T_b38	RASGRP3	-2.596	0.00971	-0.034661	83	0.013352	no	THYROID
chr2_33546942_C_G_b38	RASGRP3	3.637	0.000431	0.201887	3	0.055505	yes	UTERUS
chr2_32634838_C_G_b38	RASGRP3	3.532	0.000617	0.129878	28	0.036776	yes	UTERUS
chr2_32461343_AGT_A_b38	RASGRP3	3.366	0.00107	0.182404	3	0.054198	yes	UTERUS
chr2_33561445_C_A_b38	RASGRP3	3.339	0.00117	0.159844	5	0.047878	yes	UTERUS
chr2_33725605_A_AT_b38	RASGRP3	3.31	0.00128	0.225256	3	0.068043	yes	UTERUS
chr2_33557844_G_A_b38	RASGRP3	3.263	0.00149	0.173619	3	0.053202	yes	UTERUS
chr2_33571586_T_C_b38	RASGRP3	-3.255	0.00153	-0.121136	32	0.037221	yes	UTERUS
chr2_33567745_C_T_b38	RASGRP3	-3.141	0.0022	-0.129274	22	0.041162	yes	UTERUS
chr2_33508487_T_C_b38	RASGRP3	3.057	0.00284	0.208579	5	0.068234	yes	UTERUS
chr2_33572204_C_A_b38	RASGRP3	-3.041	0.00299	-0.116985	27	0.038475	yes	UTERUS
chr2_33469706_C_T_b38	RASGRP3	3.02	0.00318	0.113752	27	0.037671	yes	UTERUS
chr2_33529269_C_A_b38	RASGRP3	3.017	0.00321	0.169194	3	0.056074	yes	UTERUS
chr2_33569371_A_G_b38	RASGRP3	-3.012	0.00326	-0.115126	27	0.038229	yes	UTERUS
chr2_33571267_T_A_b38	RASGRP3	-3.012	0.00326	-0.115126	27	0.038229	yes	UTERUS
chr2_33467042_C_T_b38	RASGRP3	2.981	0.00358	0.128183	12	0.043002	yes	UTERUS
chr2_33555164_G_A_b38	RASGRP3	2.88	0.00483	0.144321	4	0.050115	yes	UTERUS
chr2_33568339_TA_T_b38	RASGRP3	-2.87	0.00498	-0.114813	28	0.040009	yes	UTERUS
chr2_33586869_A_T_b38	RASGRP3	2.765	0.00673	0.135519	7	0.04901	yes	UTERUS
chr2_33519891_C_T_b38	RASGRP3	-2.76	0.00683	-0.11315	25	0.040994	yes	UTERUS
chr2_34000441_T_C_b38	RASGRP3	-2.74	0.00723	-0.120149	16	0.043849	yes	UTERUS
chr2_33543901_C_G_b38	RASGRP3	-2.733	0.00738	-0.113541	21	0.041545	yes	UTERUS
chr2_33571342_T_C_b38	RASGRP3	-2.703	0.00803	-0.101483	29	0.037544	yes	UTERUS
chr2_33569651_CA_C_b38	RASGRP3	-2.688	0.00837	-0.135038	9	0.050233	yes	UTERUS
chr2_32461039_T_C_b38	RASGRP3	2.685	0.00844	0.174859	4	0.065121	yes	UTERUS
chr2_33523649_G_A_b38	RASGRP3	2.674	0.00872	0.140561	4	0.052574	yes	UTERUS
chr2_33536322_G_GA_b38	RASGRP3	3.757	0.000284	0.211609	3	0.056327	no	UTERUS
chr2_33537330_C_CCCAACACA_b38	RASGRP3	3.702	0.000344	0.170649	8	0.046091	no	UTERUS
chr2_33822568_AT_A_b38	RASGRP3	3.597	0.000495	0.169495	5	0.047125	no	UTERUS
chr2_33512177_G_A_b38	RASGRP3	3.407	0.000935	0.174365	4	0.051177	no	UTERUS
chr2_33974884_CT_C_b38	RASGRP3	3.103	0.00247	0.190282	3	0.061327	no	UTERUS
chr2_33511010_G_A_b38	RASGRP3	3.023	0.00315	0.186806	3	0.061787	no	UTERUS
chr2_34402077_GAA_G_b38	RASGRP3	2.986	0.00353	0.151095	3	0.050605	no	UTERUS
chr2_33575950_G_A_b38	RASGRP3	-2.972	0.00368	-0.114445	26	0.038513	no	UTERUS
chr2_34353064_G_A_b38	RASGRP3	-2.884	0.00477	-0.121126	29	0.042001	no	UTERUS
chr2_33577889_G_A_b38	RASGRP3	-2.839	0.00544	-0.109231	27	0.038469	no	UTERUS
chr2_33604404_GTA_G_b38	RASGRP3	-2.688	0.00837	-0.122609	10	0.045608	no	UTERUS
chr2_33980670_A_ATTTATT_b38	RASGRP3	-2.662	0.009	-0.145879	6	0.054803	no	UTERUS
chr2_33525341_A_AAT_b38	RASGRP3	2.64	0.00956	0.118968	8	0.045056	no	UTERUS
chr2_33512820_T_A_b38	RASGRP3	-2.639	0.00958	-0.108098	22	0.040954	no	UTERUS
chr2_33537330_C_CCCAACACA_b38	RASGRP3	7.169	7.56e-11	0.272225	6	0.037971	yes	VAGINA
chr2_33546942_C_G_b38	RASGRP3	6.169	1.04e-08	0.264987	3	0.042956	yes	VAGINA
chr2_33547458_G_A_b38	RASGRP3	4.791	4.95e-06	0.153937	15	0.032131	yes	VAGINA
chr2_33525341_A_AAT_b38	RASGRP3	4.764	5.55e-06	0.179737	6	0.037731	yes	VAGINA
chr2_33536322_G_GA_b38	RASGRP3	4.523	1.48e-05	0.213021	3	0.047092	yes	VAGINA
chr2_34197420_GTTTTTTTTTTTTTTT_G_b38	RASGRP3	4.443	2.04e-05	0.180324	5	0.040587	yes	VAGINA
chr2_33555164_G_A_b38	RASGRP3	4.358	2.86e-05	0.174052	5	0.039943	yes	VAGINA
chr2_33561445_C_A_b38	RASGRP3	4.358	2.86e-05	0.174052	5	0.039943	yes	VAGINA
chr2_34242872_G_C_b38	RASGRP3	4.295	3.65e-05	0.163771	6	0.038132	yes	VAGINA
chr2_34245101_T_A_b38	RASGRP3	4.295	3.65e-05	0.163771	6	0.038132	yes	VAGINA
chr2_34246673_T_C_b38	RASGRP3	4.295	3.65e-05	0.163771	6	0.038132	yes	VAGINA
chr2_34246924_T_C_b38	RASGRP3	4.295	3.65e-05	0.163771	6	0.038132	yes	VAGINA
chr2_34247571_T_C_b38	RASGRP3	4.251	4.33e-05	0.163549	6	0.038475	yes	VAGINA
chr2_34246314_G_A_b38	RASGRP3	-4.247	4.39e-05	-0.121777	25	0.028671	yes	VAGINA
chr2_34246386_G_T_b38	RASGRP3	-4.247	4.39e-05	-0.121777	25	0.028671	yes	VAGINA
chr2_34207369_C_T_b38	RASGRP3	4.124	7.02e-05	0.189266	3	0.04589	yes	VAGINA
chr2_33586869_A_T_b38	RASGRP3	4.094	7.87e-05	0.158111	9	0.038619	yes	VAGINA
chr2_33596963_A_T_b38	RASGRP3	4.091	7.97e-05	0.152323	11	0.037236	yes	VAGINA
chr2_33594326_C_T_b38	RASGRP3	4.039	9.69e-05	0.151794	10	0.037585	yes	VAGINA
chr2_33594385_G_A_b38	RASGRP3	4.039	9.69e-05	0.151794	10	0.037585	yes	VAGINA
chr2_33596617_C_T_b38	RASGRP3	4.039	9.69e-05	0.151794	10	0.037585	yes	VAGINA
chr2_33565263_A_G_b38	RASGRP3	3.988	0.000117	0.149768	13	0.037551	yes	VAGINA
chr2_33534694_A_AT_b38	RASGRP3	3.944	0.000138	0.172329	5	0.043693	yes	VAGINA
chr2_34232956_T_C_b38	RASGRP3	3.888	0.000169	0.16934	4	0.04355	yes	VAGINA
chr2_33581561_C_T_b38	RASGRP3	3.838	0.000203	0.143585	11	0.037414	yes	VAGINA
chr2_33582025_C_T_b38	RASGRP3	3.797	0.000234	0.143767	10	0.037858	yes	VAGINA
chr2_34241769_G_C_b38	RASGRP3	-3.792	0.000239	-0.119478	17	0.031505	yes	VAGINA
chr2_33841342_CAAAA_C_b38	RASGRP3	3.782	0.000247	0.170377	5	0.045044	yes	VAGINA
chr2_33589264_G_C_b38	RASGRP3	3.777	0.000252	0.117621	18	0.031143	yes	VAGINA
chr2_33590881_T_C_b38	RASGRP3	3.766	0.000262	0.117412	18	0.031173	yes	VAGINA
chr2_34209966_G_T_b38	RASGRP3	-3.743	0.000285	-0.116463	18	0.031118	yes	VAGINA
chr2_33596450_T_G_b38	RASGRP3	3.735	0.000292	0.115408	19	0.030896	yes	VAGINA
chr2_33605827_ATTTTTCT_A_b38	RASGRP3	3.69	0.000342	0.171512	3	0.046474	yes	VAGINA
chr2_34241456_C_T_b38	RASGRP3	-3.672	0.000366	-0.114197	18	0.031103	yes	VAGINA
chr2_34189662_G_GTGTGTGTGTACGTATACACATATATGTATATA_b38	RASGRP3	-3.612	0.00045	-0.109178	32	0.030223	yes	VAGINA
chr2_33554839_T_C_b38	RASGRP3	3.558	0.000543	0.11664	16	0.032785	yes	VAGINA
chr2_33564467_A_G_b38	RASGRP3	3.466	0.000741	0.11039	24	0.031848	yes	VAGINA
chr2_34171059_A_G_b38	RASGRP3	-3.463	0.000749	-0.109719	36	0.031683	yes	VAGINA
chr2_34171203_C_T_b38	RASGRP3	-3.463	0.000749	-0.109719	36	0.031683	yes	VAGINA
chr2_34174182_A_G_b38	RASGRP3	-3.443	0.000802	-0.107361	36	0.031187	yes	VAGINA
chr2_34210168_C_G_b38	RASGRP3	-3.395	0.000942	-0.109769	16	0.032337	yes	VAGINA
chr2_33521266_C_T_b38	RASGRP3	3.367	0.00103	0.131135	7	0.038946	yes	VAGINA
chr2_34234642_G_A_b38	RASGRP3	-3.309	0.00125	-0.101454	34	0.030662	yes	VAGINA
chr2_34234677_T_C_b38	RASGRP3	-3.309	0.00125	-0.101454	34	0.030662	yes	VAGINA
chr2_34205409_G_A_b38	RASGRP3	-3.302	0.00128	-0.102567	35	0.031059	yes	VAGINA
chr2_34205638_G_C_b38	RASGRP3	-3.302	0.00128	-0.102567	35	0.031059	yes	VAGINA
chr2_34209766_G_A_b38	RASGRP3	-3.302	0.00128	-0.102567	35	0.031059	yes	VAGINA
chr2_34237223_T_C_b38	RASGRP3	-3.302	0.00128	-0.102567	35	0.031059	yes	VAGINA
chr2_34237425_G_A_b38	RASGRP3	-3.302	0.00128	-0.102567	35	0.031059	yes	VAGINA
chr2_34237563_G_A_b38	RASGRP3	-3.302	0.00128	-0.102567	35	0.031059	yes	VAGINA
chr2_34238402_G_A_b38	RASGRP3	-3.302	0.00128	-0.102567	35	0.031059	yes	VAGINA
chr2_34266517_A_C_b38	RASGRP3	3.261	0.00146	0.150612	3	0.046183	yes	VAGINA
chr2_34219180_A_T_b38	RASGRP3	-3.26	0.00146	-0.101171	37	0.031034	yes	VAGINA
chr2_34230787_A_G_b38	RASGRP3	-3.227	0.00162	-0.09849	35	0.030516	yes	VAGINA
chr2_34231408_G_A_b38	RASGRP3	-3.227	0.00162	-0.09849	35	0.030516	yes	VAGINA
chr2_33564001_C_G_b38	RASGRP3	3.204	0.00175	0.103252	22	0.032227	yes	VAGINA
chr2_34249406_C_A_b38	RASGRP3	-3.203	0.00175	-0.099396	36	0.03103	yes	VAGINA
chr2_34199820_T_C_b38	RASGRP3	-3.194	0.00181	-0.099209	35	0.031065	yes	VAGINA
chr2_34219703_A_T_b38	RASGRP3	-3.194	0.00181	-0.099209	35	0.031065	yes	VAGINA
chr2_34226108_A_T_b38	RASGRP3	-3.194	0.00181	-0.099209	35	0.031065	yes	VAGINA
chr2_33672387_A_G_b38	RASGRP3	3.189	0.00183	0.138058	4	0.043288	yes	VAGINA
chr2_34229478_A_G_b38	RASGRP3	-3.158	0.00203	-0.097032	34	0.030726	yes	VAGINA
chr2_34230668_G_A_b38	RASGRP3	-3.155	0.00204	-0.095578	35	0.030292	yes	VAGINA
chr2_34230693_CTG_C_b38	RASGRP3	-3.155	0.00204	-0.095578	35	0.030292	yes	VAGINA
chr2_34230733_G_T_b38	RASGRP3	-3.155	0.00204	-0.095578	35	0.030292	yes	VAGINA
chr2_34230746_C_T_b38	RASGRP3	-3.155	0.00204	-0.095578	35	0.030292	yes	VAGINA
chr2_34231053_AGTGT_A_b38	RASGRP3	-3.155	0.00204	-0.095578	35	0.030292	yes	VAGINA
chr2_34231133_A_G_b38	RASGRP3	-3.155	0.00204	-0.095578	35	0.030292	yes	VAGINA
chr2_34231209_T_A_b38	RASGRP3	-3.155	0.00204	-0.095578	35	0.030292	yes	VAGINA
chr2_34231224_C_T_b38	RASGRP3	-3.155	0.00204	-0.095578	35	0.030292	yes	VAGINA
chr2_34231242_C_T_b38	RASGRP3	-3.155	0.00204	-0.095578	35	0.030292	yes	VAGINA
chr2_34231694_A_G_b38	RASGRP3	-3.155	0.00204	-0.095578	35	0.030292	yes	VAGINA
chr2_33548381_A_AAAAAG_b38	RASGRP3	3.155	0.00204	0.177761	3	0.056338	yes	VAGINA
chr2_33563089_C_T_b38	RASGRP3	3.127	0.00224	0.108599	13	0.034733	yes	VAGINA
chr2_34230036_T_C_b38	RASGRP3	-3.115	0.00232	-0.095668	32	0.030712	yes	VAGINA
chr2_34230045_T_A_b38	RASGRP3	-3.115	0.00232	-0.095668	32	0.030712	yes	VAGINA
chr2_34231433_T_C_b38	RASGRP3	-3.106	0.00238	-0.097243	35	0.031306	yes	VAGINA
chr2_34177389_A_G_b38	RASGRP3	-3.104	0.0024	-0.096651	32	0.031135	yes	VAGINA
chr2_34245535_C_T_b38	RASGRP3	-3.104	0.0024	-0.097046	35	0.031269	yes	VAGINA
chr2_34246587_C_T_b38	RASGRP3	-3.104	0.0024	-0.097046	35	0.031269	yes	VAGINA
chr2_34229936_G_C_b38	RASGRP3	-3.088	0.00252	-0.094202	34	0.030508	yes	VAGINA
chr2_34229950_T_C_b38	RASGRP3	-3.088	0.00252	-0.094202	34	0.030508	yes	VAGINA
chr2_34175606_A_C_b38	RASGRP3	-3.076	0.00262	-0.099837	32	0.032454	yes	VAGINA
chr2_33537321_C_CA_b38	RASGRP3	3.072	0.00265	0.101807	17	0.03314	yes	VAGINA
chr2_34200763_T_C_b38	RASGRP3	-3.07	0.00267	-0.096338	34	0.031384	yes	VAGINA
chr2_34212863_A_T_b38	RASGRP3	-3.07	0.00267	-0.096338	34	0.031384	yes	VAGINA
chr2_34212864_A_T_b38	RASGRP3	-3.07	0.00267	-0.096338	34	0.031384	yes	VAGINA
chr2_34224686_C_T_b38	RASGRP3	-3.066	0.0027	-0.096257	35	0.031396	yes	VAGINA
chr2_34227541_C_T_b38	RASGRP3	-3.066	0.0027	-0.096257	35	0.031396	yes	VAGINA
chr2_34200243_G_T_b38	RASGRP3	-3.066	0.0027	-0.096681	34	0.031538	yes	VAGINA
chr2_34248317_A_G_b38	RASGRP3	-3.063	0.00272	-0.09651	34	0.031505	yes	VAGINA
chr2_33616325_C_T_b38	RASGRP3	3.049	0.00284	0.146294	3	0.047975	yes	VAGINA
chr2_34229439_C_A_b38	RASGRP3	-3.028	0.00303	-0.095292	34	0.031465	yes	VAGINA
chr2_34060964_C_A_b38	RASGRP3	-3.003	0.00328	-0.099463	24	0.033124	yes	VAGINA
chr2_33563965_A_G_b38	RASGRP3	2.973	0.00358	0.131976	5	0.044387	yes	VAGINA
chr2_33581900_A_T_b38	RASGRP3	2.973	0.00358	0.131976	5	0.044387	yes	VAGINA
chr2_33669427_A_C_b38	RASGRP3	2.967	0.00366	0.129591	4	0.043682	yes	VAGINA
chr2_33669574_A_G_b38	RASGRP3	2.967	0.00366	0.129591	4	0.043682	yes	VAGINA
chr2_33656916_G_A_b38	RASGRP3	2.961	0.00372	0.107972	12	0.036462	yes	VAGINA
chr2_34222550_A_G_b38	RASGRP3	-2.932	0.00406	-0.092675	34	0.031613	yes	VAGINA
chr2_34175397_C_A_b38	RASGRP3	-2.92	0.00421	-0.093269	31	0.031944	yes	VAGINA
chr2_34119337_AT_A_b38	RASGRP3	2.92	0.00421	0.116263	8	0.039822	yes	VAGINA
chr2_33621819_C_A_b38	RASGRP3	2.918	0.00423	0.092289	20	0.031626	yes	VAGINA
chr2_34174966_A_AAAAC_b38	RASGRP3	-2.917	0.00424	-0.093859	33	0.032175	yes	VAGINA
chr2_34206928_T_G_b38	RASGRP3	-2.907	0.00437	-0.091824	34	0.031584	yes	VAGINA
chr2_34210544_G_C_b38	RASGRP3	-2.907	0.00437	-0.091824	34	0.031584	yes	VAGINA
chr2_34282844_C_CT_b38	RASGRP3	2.895	0.00453	0.108843	10	0.037593	yes	VAGINA
chr2_33581338_T_A_b38	RASGRP3	2.891	0.00459	0.127399	5	0.04407	yes	VAGINA
chr2_33623108_T_C_b38	RASGRP3	2.89	0.00461	0.092073	20	0.031865	yes	VAGINA
chr2_34251164_C_T_b38	RASGRP3	-2.867	0.00492	-0.083983	37	0.029292	yes	VAGINA
chr2_33546315_C_T_b38	RASGRP3	-2.866	0.00494	-0.096672	18	0.033734	yes	VAGINA
chr2_34180751_C_T_b38	RASGRP3	-2.861	0.00502	-0.091704	32	0.032058	yes	VAGINA
chr2_34198999_G_A_b38	RASGRP3	-2.856	0.00508	-0.090854	33	0.031811	yes	VAGINA
chr2_34201237_A_T_b38	RASGRP3	-2.85	0.00517	-0.092005	34	0.03228	yes	VAGINA
chr2_34158405_T_A_b38	RASGRP3	-2.846	0.00524	-0.100118	20	0.035178	yes	VAGINA
chr2_33620497_T_C_b38	RASGRP3	2.845	0.00525	0.105231	8	0.036984	yes	VAGINA
chr2_33620575_G_A_b38	RASGRP3	2.845	0.00525	0.105231	8	0.036984	yes	VAGINA
chr2_33669785_CA_C_b38	RASGRP3	-2.829	0.0055	-0.089626	22	0.031682	yes	VAGINA
chr2_33622160_C_T_b38	RASGRP3	2.807	0.00586	0.106309	12	0.037868	yes	VAGINA
chr2_33474404_G_A_b38	RASGRP3	2.805	0.00591	0.083312	33	0.029706	yes	VAGINA
chr2_34209114_T_G_b38	RASGRP3	-2.783	0.00628	-0.088816	33	0.03191	yes	VAGINA
chr2_34214181_T_G_b38	RASGRP3	-2.78	0.00635	-0.087604	34	0.031514	yes	VAGINA
chr2_34224301_AT_A_b38	RASGRP3	-2.774	0.00645	-0.100393	15	0.036191	yes	VAGINA
chr2_34214365_C_CA_b38	RASGRP3	-2.773	0.00646	-0.089153	22	0.032145	yes	VAGINA
chr2_33669621_C_T_b38	RASGRP3	-2.761	0.0067	-0.085831	24	0.031087	yes	VAGINA
chr2_33669751_C_T_b38	RASGRP3	-2.761	0.0067	-0.085831	24	0.031087	yes	VAGINA
chr2_33670200_G_T_b38	RASGRP3	-2.761	0.0067	-0.085831	24	0.031087	yes	VAGINA
chr2_34061366_G_A_b38	RASGRP3	-2.759	0.00673	-0.092543	16	0.033538	yes	VAGINA
chr2_33549339_CAT_C_b38	RASGRP3	-2.754	0.00683	-0.094212	17	0.034205	yes	VAGINA
chr2_33613720_G_A_b38	RASGRP3	2.751	0.0069	0.128273	4	0.046632	yes	VAGINA
chr2_33548672_A_T_b38	RASGRP3	-2.737	0.00719	-0.092615	18	0.033843	yes	VAGINA
chr2_33627793_A_G_b38	RASGRP3	2.732	0.00729	0.13261	3	0.048545	yes	VAGINA
chr2_34149978_C_CA_b38	RASGRP3	2.727	0.00739	0.116742	5	0.042811	yes	VAGINA
chr2_33514230_T_G_b38	RASGRP3	2.727	0.00739	0.121532	4	0.044574	yes	VAGINA
chr2_33661156_C_T_b38	RASGRP3	2.72	0.00753	0.09821	10	0.036106	yes	VAGINA
chr2_33661310_C_T_b38	RASGRP3	2.72	0.00753	0.09821	10	0.036106	yes	VAGINA
chr2_33520269_T_C_b38	RASGRP3	2.712	0.00771	0.103629	7	0.038211	yes	VAGINA
chr2_34208514_T_C_b38	RASGRP3	-2.7	0.00797	-0.085339	34	0.031607	yes	VAGINA
chr2_33227799_CT_C_b38	RASGRP3	-2.692	0.00815	-0.18075	4	0.067142	yes	VAGINA
chr2_34201071_G_T_b38	RASGRP3	-2.672	0.00862	-0.085664	33	0.032057	yes	VAGINA
chr2_34201079_T_C_b38	RASGRP3	-2.672	0.00862	-0.085664	33	0.032057	yes	VAGINA
chr2_34201682_T_G_b38	RASGRP3	-2.672	0.00862	-0.085664	33	0.032057	yes	VAGINA
chr2_34207256_A_AAT_b38	RASGRP3	-2.664	0.00881	-0.07997	32	0.030015	yes	VAGINA
chr2_34198423_A_C_b38	RASGRP3	-2.653	0.0091	-0.085017	31	0.032048	yes	VAGINA
chr2_33879927_G_C_b38	RASGRP3	-2.642	0.00937	-0.109987	6	0.041626	yes	VAGINA
chr2_34064416_T_TAAAAA_b38	RASGRP3	-2.636	0.00955	-0.099546	8	0.037771	yes	VAGINA
chr2_33811690_C_A_b38	RASGRP3	2.635	0.00958	0.126855	5	0.048151	yes	VAGINA
chr2_34222946_G_A_b38	RASGRP3	-2.623	0.00989	-0.09648	9	0.036785	yes	VAGINA
chr2_34231992_C_G_b38	RASGRP3	3.952	0.000133	0.173558	3	0.043912	no	VAGINA
chr2_34085758_A_T_b38	RASGRP3	3.844	0.000198	0.136171	10	0.035423	no	VAGINA
chr2_33529318_C_T_b38	RASGRP3	3.65	0.000395	0.157847	3	0.043249	no	VAGINA
chr2_33475869_C_G_b38	RASGRP3	-3.582	5e-04	-0.1686	3	0.047071	no	VAGINA
chr2_33523649_G_A_b38	RASGRP3	3.495	0.000673	0.147242	5	0.042133	no	VAGINA
chr2_34106607_A_G_b38	RASGRP3	3.286	0.00135	0.118566	9	0.036083	no	VAGINA
chr2_34163298_T_TTC_b38	RASGRP3	-3.235	0.00159	-0.13912	3	0.043006	no	VAGINA
chr2_33657078_T_C_b38	RASGRP3	3.221	0.00166	0.120436	9	0.037394	no	VAGINA
chr2_34230929_T_C_b38	RASGRP3	-3.153	0.00206	-0.095986	35	0.030441	no	VAGINA
chr2_34230937_A_T_b38	RASGRP3	-3.153	0.00206	-0.095986	35	0.030441	no	VAGINA
chr2_34231009_T_G_b38	RASGRP3	-3.153	0.00206	-0.095986	35	0.030441	no	VAGINA
chr2_34230514_G_T_b38	RASGRP3	-3.153	0.00206	-0.09597	35	0.030442	no	VAGINA
chr2_34091901_AC_A_b38	RASGRP3	3.143	0.00212	0.108124	11	0.0344	no	VAGINA
chr2_34106739_GT_G_b38	RASGRP3	3.135	0.00218	0.113143	9	0.036094	no	VAGINA
chr2_33650021_A_G_b38	RASGRP3	3.128	0.00223	0.120117	7	0.038403	no	VAGINA
chr2_33656248_TTC_T_b38	RASGRP3	3.128	0.00223	0.120117	7	0.038403	no	VAGINA
chr2_34216158_A_ATGTGTG_b38	RASGRP3	3.09	0.00251	0.134925	7	0.043668	no	VAGINA
chr2_34093584_C_G_b38	RASGRP3	3.039	0.00294	0.107226	10	0.035286	no	VAGINA
chr2_33662459_C_T_b38	RASGRP3	3.028	0.00304	0.115456	7	0.038131	no	VAGINA
chr2_33663555_T_C_b38	RASGRP3	3.028	0.00304	0.115456	7	0.038131	no	VAGINA
chr2_34063103_C_T_b38	RASGRP3	-2.9	0.00447	-0.093117	25	0.032111	no	VAGINA
chr2_34227565_A_G_b38	RASGRP3	2.879	0.00475	0.106233	11	0.036894	no	VAGINA
chr2_33816730_T_TTTCC_b38	RASGRP3	-2.857	0.00507	-0.084227	37	0.029481	no	VAGINA
chr2_34091903_ACACACAC_A_b38	RASGRP3	2.794	0.00609	0.103144	8	0.036912	no	VAGINA
chr2_33656848_TA_T_b38	RASGRP3	2.772	0.00649	0.1064	8	0.038384	no	VAGINA
chr2_33652477_C_A_b38	RASGRP3	2.719	0.00755	0.106562	7	0.039188	no	VAGINA
chr2_33670716_C_T_b38	RASGRP3	2.711	0.00772	0.108178	7	0.0399	no	VAGINA
chr2_34088734_T_C_b38	RASGRP3	2.679	0.00846	0.087822	17	0.032781	no	VAGINA
chr2_34066612_A_G_b38	RASGRP3	-2.669	0.0087	-0.087496	25	0.032782	no	VAGINA
chr2_34088753_T_C_b38	RASGRP3	2.666	0.00877	0.08792	17	0.03298	no	VAGINA
chr2_33115127_TAC_T_b38	RASGRP3	-2.665	0.0088	-0.094877	21	0.035601	no	VAGINA
chr2_33347117_C_CA_b38	RASGRP3	2.632	0.00965	0.096265	9	0.036579	no	VAGINA
chr2_34232404_T_C_b38	RASGRP3	2.624	0.00987	0.096816	12	0.036903	no	VAGINA
chr2_33531453_C_T_b38	RASGRP3	5.949	4.59e-09	0.081468	8	0.013694	yes	WHLBLD
chr2_33552022_CAAACA_C_b38	RASGRP3	5.433	8.07e-08	0.07812	6	0.014379	yes	WHLBLD
chr2_33596963_A_T_b38	RASGRP3	4.633	4.42e-06	0.048654	40	0.010501	yes	WHLBLD
chr2_33537330_C_CCCAACACA_b38	RASGRP3	4.614	4.82e-06	0.054044	33	0.011712	yes	WHLBLD
chr2_33594326_C_T_b38	RASGRP3	4.574	5.82e-06	0.048034	40	0.010501	yes	WHLBLD
chr2_33622160_C_T_b38	RASGRP3	4.569	5.95e-06	0.044378	53	0.009713	yes	WHLBLD
chr2_33596617_C_T_b38	RASGRP3	4.548	6.55e-06	0.047961	39	0.010545	yes	WHLBLD
chr2_33581561_C_T_b38	RASGRP3	4.46	9.81e-06	0.046529	38	0.010433	yes	WHLBLD
chr2_33582025_C_T_b38	RASGRP3	4.379	1.4e-05	0.045674	37	0.010429	yes	WHLBLD
chr2_33561445_C_A_b38	RASGRP3	4.267	2.3e-05	0.047532	26	0.011138	yes	WHLBLD
chr2_33561192_A_G_b38	RASGRP3	4.122	4.28e-05	0.035741	149	0.00867	yes	WHLBLD
chr2_33529318_C_T_b38	RASGRP3	4.111	4.49e-05	0.04675	19	0.011372	yes	WHLBLD
chr2_33508652_C_G_b38	RASGRP3	4.062	5.51e-05	0.037451	82	0.00922	yes	WHLBLD
chr2_33523649_G_A_b38	RASGRP3	4.042	5.99e-05	0.046301	23	0.011455	yes	WHLBLD
chr2_33479411_A_ACTC_b38	RASGRP3	3.945	8.94e-05	0.039976	48	0.010134	yes	WHLBLD
chr2_33525341_A_AAT_b38	RASGRP3	3.891	0.000111	0.042008	33	0.010796	yes	WHLBLD
chr2_33512177_G_A_b38	RASGRP3	3.84	0.000136	0.047882	23	0.012471	yes	WHLBLD
chr2_33532487_C_A_b38	RASGRP3	3.786	0.000169	0.032638	161	0.008621	yes	WHLBLD
chr2_33656848_TA_T_b38	RASGRP3	3.641	0.000295	0.036133	44	0.009925	yes	WHLBLD
chr2_34383137_T_TAACAACAAC_b38	RASGRP3	3.606	0.000337	0.045787	13	0.012699	yes	WHLBLD
chr2_33478490_C_T_b38	RASGRP3	3.473	0.000551	0.030882	102	0.008892	yes	WHLBLD
chr2_33477835_C_T_b38	RASGRP3	3.471	0.000557	0.037123	32	0.010696	yes	WHLBLD
chr2_33731863_C_CCTTTCCTTAACTTCAGGACATACTGGGTTCCAGTATGTCCTTAA_b38	RASGRP3	3.328	0.000927	0.054098	7	0.016254	yes	WHLBLD
chr2_33762803_A_G_b38	RASGRP3	3.246	0.00123	0.051556	3	0.015882	yes	WHLBLD
chr2_33758557_G_A_b38	RASGRP3	-3.215	0.00137	-0.030693	77	0.009546	yes	WHLBLD
chr2_33721262_A_T_b38	RASGRP3	3.179	0.00155	0.044426	9	0.013974	yes	WHLBLD
chr2_33721524_A_G_b38	RASGRP3	3.179	0.00155	0.044426	9	0.013974	yes	WHLBLD
chr2_33723360_C_A_b38	RASGRP3	3.179	0.00155	0.044426	9	0.013974	yes	WHLBLD
chr2_33613720_G_A_b38	RASGRP3	3.178	0.00156	0.038255	22	0.012037	yes	WHLBLD
chr2_33765440_G_A_b38	RASGRP3	-3.163	0.00164	-0.030083	78	0.009511	yes	WHLBLD
chr2_33767629_C_T_b38	RASGRP3	-3.163	0.00164	-0.030083	78	0.009511	yes	WHLBLD
chr2_33767683_T_G_b38	RASGRP3	-3.163	0.00164	-0.030083	78	0.009511	yes	WHLBLD
chr2_33767692_TCAGAA_T_b38	RASGRP3	-3.163	0.00164	-0.030083	78	0.009511	yes	WHLBLD
chr2_33768002_T_C_b38	RASGRP3	-3.163	0.00164	-0.030083	78	0.009511	yes	WHLBLD
chr2_33762665_A_G_b38	RASGRP3	-3.15	0.00171	-0.030124	77	0.009562	yes	WHLBLD
chr2_33530852_CT_C_b38	RASGRP3	3.145	0.00175	0.027418	125	0.008719	yes	WHLBLD
chr2_33767664_G_A_b38	RASGRP3	-3.141	0.00177	-0.029776	79	0.009481	yes	WHLBLD
chr2_33762557_G_C_b38	RASGRP3	-3.124	0.00187	-0.029911	77	0.009575	yes	WHLBLD
chr2_33763206_C_T_b38	RASGRP3	-3.124	0.00187	-0.029911	77	0.009575	yes	WHLBLD
chr2_33787907_A_G_b38	RASGRP3	3.115	0.00193	0.042381	16	0.013606	yes	WHLBLD
chr2_33629533_C_G_b38	RASGRP3	3.111	0.00195	0.040296	10	0.012953	yes	WHLBLD
chr2_33765389_GT_G_b38	RASGRP3	-3.107	0.00198	-0.029928	75	0.009632	yes	WHLBLD
chr2_33768906_G_C_b38	RASGRP3	-3.097	0.00205	-0.029635	77	0.009569	yes	WHLBLD
chr2_33770662_T_C_b38	RASGRP3	-3.073	0.00221	-0.029352	79	0.00955	yes	WHLBLD
chr2_33765637_C_G_b38	RASGRP3	-3.07	0.00224	-0.029433	77	0.009588	yes	WHLBLD
chr2_33765984_G_C_b38	RASGRP3	-3.07	0.00224	-0.029433	77	0.009588	yes	WHLBLD
chr2_33768109_G_C_b38	RASGRP3	-3.07	0.00224	-0.029433	77	0.009588	yes	WHLBLD
chr2_33573084_G_C_b38	RASGRP3	-3.068	0.00225	-0.047646	6	0.015532	yes	WHLBLD
chr2_33767897_C_T_b38	RASGRP3	-3.064	0.00228	-0.029293	79	0.009561	yes	WHLBLD
chr2_33753860_C_CT_b38	RASGRP3	-3.063	0.00229	-0.029866	61	0.00975	yes	WHLBLD
chr2_33767410_A_C_b38	RASGRP3	-3.05	0.00239	-0.029159	79	0.00956	yes	WHLBLD
chr2_33770643_T_C_b38	RASGRP3	-3.024	0.00261	-0.028741	80	0.009506	yes	WHLBLD
chr2_33764603_A_G_b38	RASGRP3	-3.018	0.00266	-0.028349	79	0.009394	yes	WHLBLD
chr2_33605933_G_A_b38	RASGRP3	-3.009	0.00273	-0.047502	5	0.015785	yes	WHLBLD
chr2_33758105_T_A_b38	RASGRP3	-3.003	0.00278	-0.028782	76	0.009584	yes	WHLBLD
chr2_33758169_T_C_b38	RASGRP3	-3.003	0.00278	-0.028782	76	0.009584	yes	WHLBLD
chr2_33758243_C_T_b38	RASGRP3	-3.003	0.00278	-0.028782	76	0.009584	yes	WHLBLD
chr2_33758156_C_T_b38	RASGRP3	-3.001	0.0028	-0.028441	78	0.009477	yes	WHLBLD
chr2_33758452_A_G_b38	RASGRP3	-2.997	0.00284	-0.028586	77	0.009539	yes	WHLBLD
chr2_33532968_G_A_b38	RASGRP3	-2.986	0.00294	-0.039565	10	0.01325	yes	WHLBLD
chr2_33475238_C_T_b38	RASGRP3	2.983	0.00297	0.03693	16	0.012379	yes	WHLBLD
chr2_33605951_T_C_b38	RASGRP3	-2.981	0.00299	-0.025711	147	0.008625	yes	WHLBLD
chr2_33409506_G_GTTTT_b38	RASGRP3	2.977	0.00303	0.089692	4	0.030132	yes	WHLBLD
chr2_33764454_T_C_b38	RASGRP3	-2.972	0.00308	-0.028085	81	0.00945	yes	WHLBLD
chr2_33766547_T_G_b38	RASGRP3	-2.972	0.00308	-0.028085	81	0.00945	yes	WHLBLD
chr2_33765535_C_T_b38	RASGRP3	-2.967	0.00313	-0.028387	79	0.009569	yes	WHLBLD
chr2_33765648_T_C_b38	RASGRP3	-2.967	0.00313	-0.028387	79	0.009569	yes	WHLBLD
chr2_33766277_T_C_b38	RASGRP3	-2.967	0.00313	-0.028387	79	0.009569	yes	WHLBLD
chr2_33766488_G_A_b38	RASGRP3	-2.967	0.00313	-0.028387	79	0.009569	yes	WHLBLD
chr2_33766502_A_C_b38	RASGRP3	-2.967	0.00313	-0.028387	79	0.009569	yes	WHLBLD
chr2_33766946_G_A_b38	RASGRP3	-2.967	0.00313	-0.028387	79	0.009569	yes	WHLBLD
chr2_33563470_A_ATACT_b38	RASGRP3	-2.965	0.00315	-0.04171	10	0.014069	yes	WHLBLD
chr2_33734734_G_A_b38	RASGRP3	2.963	0.00317	0.046485	5	0.01569	yes	WHLBLD
chr2_33397506_C_CTTTT_b38	RASGRP3	2.96	0.0032	0.082997	4	0.028042	yes	WHLBLD
chr2_33661156_C_T_b38	RASGRP3	2.953	0.00327	0.029112	41	0.009859	yes	WHLBLD
chr2_33661310_C_T_b38	RASGRP3	2.953	0.00327	0.029112	41	0.009859	yes	WHLBLD
chr2_33754928_G_A_b38	RASGRP3	-2.938	0.00343	-0.028209	76	0.009601	yes	WHLBLD
chr2_33755461_G_T_b38	RASGRP3	-2.938	0.00343	-0.028209	76	0.009601	yes	WHLBLD
chr2_33767220_GAA_G_b38	RASGRP3	-2.918	0.00366	-0.027952	78	0.009581	yes	WHLBLD
chr2_33765693_G_A_b38	RASGRP3	-2.912	0.00373	-0.027498	79	0.009443	yes	WHLBLD
chr2_33521266_C_T_b38	RASGRP3	2.9	0.00387	0.030826	41	0.010631	yes	WHLBLD
chr2_33769285_C_A_b38	RASGRP3	-2.893	0.00395	-0.027626	79	0.009549	yes	WHLBLD
chr2_33523461_TA_T_b38	RASGRP3	2.886	0.00404	0.03371	16	0.01168	yes	WHLBLD
chr2_33754448_T_C_b38	RASGRP3	-2.88	0.00411	-0.027521	78	0.009555	yes	WHLBLD
chr2_33749290_G_T_b38	RASGRP3	2.879	0.00413	0.045164	5	0.015688	yes	WHLBLD
chr2_33769652_G_T_b38	RASGRP3	-2.856	0.00444	-0.027244	79	0.009539	yes	WHLBLD
chr2_33764804_G_C_b38	RASGRP3	-2.852	0.00449	-0.026974	79	0.009458	yes	WHLBLD
chr2_33756220_C_T_b38	RASGRP3	-2.841	0.00466	-0.027292	76	0.009608	yes	WHLBLD
chr2_34243744_C_CA_b38	RASGRP3	-2.84	0.00467	-0.098458	3	0.034673	yes	WHLBLD
chr2_33769488_A_G_b38	RASGRP3	-2.829	0.00482	-0.027047	79	0.009559	yes	WHLBLD
chr2_34034567_G_C_b38	RASGRP3	-2.827	0.00486	-0.062213	3	0.022007	yes	WHLBLD
chr2_33766447_A_G_b38	RASGRP3	-2.814	0.00506	-0.026713	80	0.009494	yes	WHLBLD
chr2_33475871_A_C_b38	RASGRP3	-2.808	0.00514	-0.025224	80	0.008982	yes	WHLBLD
chr2_33563038_A_G_b38	RASGRP3	-2.802	0.00525	-0.03618	14	0.012913	yes	WHLBLD
chr2_33611855_A_C_b38	RASGRP3	2.791	0.00541	0.036308	11	0.013007	yes	WHLBLD
chr2_33615675_TA_T_b38	RASGRP3	-2.787	0.00549	-0.023902	125	0.008577	yes	WHLBLD
chr2_33764131_T_C_b38	RASGRP3	-2.787	0.0055	-0.026403	80	0.009475	yes	WHLBLD
chr2_33553788_G_A_b38	RASGRP3	-2.786	0.0055	-0.033905	16	0.012169	yes	WHLBLD
chr2_33556856_G_C_b38	RASGRP3	-2.786	0.0055	-0.033905	16	0.012169	yes	WHLBLD
chr2_33561322_C_T_b38	RASGRP3	-2.782	0.00558	-0.034141	15	0.012274	yes	WHLBLD
chr2_33532718_G_A_b38	RASGRP3	2.77	0.00578	0.024181	123	0.00873	yes	WHLBLD
chr2_33603617_TC_T_b38	RASGRP3	2.76	0.00596	0.035899	11	0.013007	yes	WHLBLD
chr2_33617107_G_A_b38	RASGRP3	-2.759	0.00598	-0.023669	125	0.008579	yes	WHLBLD
chr2_33768312_A_C_b38	RASGRP3	-2.758	0.006	-0.026318	80	0.009544	yes	WHLBLD
chr2_32911911_CATCT_C_b38	RASGRP3	2.757	0.00601	0.036174	11	0.013119	yes	WHLBLD
chr2_33659035_G_A_b38	RASGRP3	2.755	0.00605	0.03655	12	0.013268	yes	WHLBLD
chr2_33603907_A_C_b38	RASGRP3	2.744	0.00626	0.035735	11	0.013025	yes	WHLBLD
chr2_33550598_T_G_b38	RASGRP3	-2.737	0.00639	-0.033276	16	0.01216	yes	WHLBLD
chr2_33664073_A_G_b38	RASGRP3	-2.719	0.00675	-0.034627	14	0.012737	yes	WHLBLD
chr2_33545200_T_C_b38	RASGRP3	-2.714	0.00684	-0.033038	16	0.012173	yes	WHLBLD
chr2_33669427_A_C_b38	RASGRP3	2.712	0.00687	0.031402	23	0.011578	yes	WHLBLD
chr2_33738746_A_C_b38	RASGRP3	2.71	0.00692	0.032409	14	0.011958	yes	WHLBLD
chr2_33529859_CA_C_b38	RASGRP3	-2.701	0.0071	-0.031949	17	0.011827	yes	WHLBLD
chr2_33749131_A_G_b38	RASGRP3	2.699	0.00716	0.038994	9	0.014449	yes	WHLBLD
chr2_33168399_CAA_C_b38	RASGRP3	-2.679	0.0076	-0.039807	7	0.014861	yes	WHLBLD
chr2_33618734_A_G_b38	RASGRP3	-2.674	0.0077	-0.022964	125	0.008588	yes	WHLBLD
chr2_33607748_A_G_b38	RASGRP3	-2.672	0.00774	-0.022816	127	0.008538	yes	WHLBLD
chr2_33618669_C_CT_b38	RASGRP3	-2.67	0.0078	-0.022893	126	0.008576	yes	WHLBLD
chr2_33535555_G_GC_b38	RASGRP3	-2.656	0.00811	-0.033987	12	0.012795	yes	WHLBLD
chr2_33614957_G_A_b38	RASGRP3	-2.655	0.00815	-0.022793	124	0.008586	yes	WHLBLD
chr2_34081725_ATGTGTGTG_A_b38	RASGRP3	2.654	0.00816	0.056213	5	0.02118	yes	WHLBLD
chr2_33671460_G_A_b38	RASGRP3	2.652	0.00822	0.034796	8	0.013122	yes	WHLBLD
chr2_33522958_T_C_b38	RASGRP3	-2.65	0.00826	-0.04267	3	0.016102	yes	WHLBLD
chr2_33543280_C_G_b38	RASGRP3	-2.646	0.00835	-0.034686	10	0.013108	yes	WHLBLD
chr2_33158163_AAAGAG_A_b38	RASGRP3	-2.646	0.00836	-0.034487	10	0.013034	yes	WHLBLD
chr2_33721982_T_C_b38	RASGRP3	2.635	0.00862	0.037242	9	0.014132	yes	WHLBLD
chr2_33538452_G_A_b38	RASGRP3	-2.619	0.00905	-0.034413	10	0.013142	yes	WHLBLD
chr2_33551040_C_T_b38	RASGRP3	-2.612	0.00923	-0.031313	17	0.011988	yes	WHLBLD
chr2_33592302_T_C_b38	RASGRP3	2.599	0.00958	0.049205	3	0.018931	yes	WHLBLD
chr2_33534328_C_T_b38	RASGRP3	-2.595	0.00969	-0.034034	10	0.013115	yes	WHLBLD
chr2_33534496_G_A_b38	RASGRP3	-2.595	0.00969	-0.034034	10	0.013115	yes	WHLBLD
chr2_33669574_A_G_b38	RASGRP3	2.589	0.00986	0.030102	22	0.011627	yes	WHLBLD
chr2_33557844_G_A_b38	RASGRP3	5.815	9.89e-09	0.077699	10	0.013363	no	WHLBLD
chr2_33537896_A_G_b38	RASGRP3	5.768	1.29e-08	0.079431	7	0.013771	no	WHLBLD
chr2_33529269_C_A_b38	RASGRP3	5.594	3.38e-08	0.07594	9	0.013576	no	WHLBLD
chr2_33559304_G_A_b38	RASGRP3	5.552	4.25e-08	0.076878	7	0.013847	no	WHLBLD
chr2_33557635_G_A_b38	RASGRP3	5.511	5.29e-08	0.075979	7	0.013786	no	WHLBLD
chr2_33526597_C_T_b38	RASGRP3	5.499	5.65e-08	0.077364	7	0.014068	no	WHLBLD
chr2_33527062_GC_G_b38	RASGRP3	5.499	5.65e-08	0.077364	7	0.014068	no	WHLBLD
chr2_33559734_G_A_b38	RASGRP3	5.493	5.86e-08	0.075696	7	0.013781	no	WHLBLD
chr2_33548469_T_C_b38	RASGRP3	5.43	8.21e-08	0.077392	6	0.014253	no	WHLBLD
chr2_33537192_G_GAT_b38	RASGRP3	5.392	1e-07	0.07208	8	0.013367	no	WHLBLD
chr2_33553995_C_T_b38	RASGRP3	5.325	1.43e-07	0.07595	7	0.014262	no	WHLBLD
chr2_33550216_T_A_b38	RASGRP3	5.198	2.77e-07	0.073527	7	0.014146	no	WHLBLD
chr2_33559068_A_G_b38	RASGRP3	5.163	3.3e-07	0.072355	6	0.014013	no	WHLBLD
chr2_33551676_A_G_b38	RASGRP3	5.129	3.95e-07	0.074597	5	0.014545	no	WHLBLD
chr2_33551697_A_T_b38	RASGRP3	5.129	3.95e-07	0.074597	5	0.014545	no	WHLBLD
chr2_33550484_C_G_b38	RASGRP3	5.096	4.65e-07	0.072363	7	0.014199	no	WHLBLD
chr2_33554542_A_G_b38	RASGRP3	5.044	6.04e-07	0.071834	7	0.014241	no	WHLBLD
chr2_33548762_A_G_b38	RASGRP3	4.897	1.25e-06	0.07138	5	0.014577	no	WHLBLD
chr2_33536526_G_A_b38	RASGRP3	4.882	1.35e-06	0.070776	5	0.014496	no	WHLBLD
chr2_33536528_G_A_b38	RASGRP3	4.882	1.35e-06	0.070776	5	0.014496	no	WHLBLD
chr2_33594385_G_A_b38	RASGRP3	4.663	3.84e-06	0.048818	40	0.010469	no	WHLBLD
chr2_33546942_C_G_b38	RASGRP3	4.565	6.07e-06	0.064638	8	0.01416	no	WHLBLD
chr2_33565263_A_G_b38	RASGRP3	4.531	7.1e-06	0.046967	48	0.010366	no	WHLBLD
chr2_33625315_G_A_b38	RASGRP3	4.353	1.58e-05	0.043287	47	0.009945	no	WHLBLD
chr2_33656248_TTC_T_b38	RASGRP3	4.066	5.41e-05	0.041618	30	0.010235	no	WHLBLD
chr2_33624881_G_GT_b38	RASGRP3	4.057	5.63e-05	0.039195	55	0.009661	no	WHLBLD
chr2_33774195_T_C_b38	RASGRP3	-4.054	5.7e-05	-0.03556	154	0.008772	no	WHLBLD
chr2_33639021_G_A_b38	RASGRP3	4.028	6.36e-05	0.041957	30	0.010417	no	WHLBLD
chr2_33537323_G_A_b38	RASGRP3	3.998	7.19e-05	0.032672	160	0.008172	no	WHLBLD
chr2_33539987_GAAAAA_G_b38	RASGRP3	3.984	7.6e-05	0.062645	5	0.015722	no	WHLBLD
chr2_33640631_A_C_b38	RASGRP3	3.978	7.81e-05	0.041498	30	0.010433	no	WHLBLD
chr2_33775996_C_A_b38	RASGRP3	-3.973	7.97e-05	-0.034859	155	0.008775	no	WHLBLD
chr2_33641397_G_C_b38	RASGRP3	3.963	8.31e-05	0.041357	30	0.010437	no	WHLBLD
chr2_33537321_C_CA_b38	RASGRP3	3.948	8.83e-05	0.03435	99	0.008701	no	WHLBLD
chr2_33650021_A_G_b38	RASGRP3	3.945	8.93e-05	0.040387	30	0.010238	no	WHLBLD
chr2_33670716_C_T_b38	RASGRP3	3.94	9.1e-05	0.039387	38	0.009996	no	WHLBLD
chr2_33540561_TGTGTGTGTGTG_T_b38	RASGRP3	3.868	0.000122	0.050462	18	0.013046	no	WHLBLD
chr2_33596450_T_G_b38	RASGRP3	3.839	0.000137	0.037296	54	0.009716	no	WHLBLD
chr2_33621819_C_A_b38	RASGRP3	3.813	0.000152	0.034992	71	0.009178	no	WHLBLD
chr2_33623108_T_C_b38	RASGRP3	3.773	0.000177	0.034915	71	0.009254	no	WHLBLD
chr2_33777074_A_G_b38	RASGRP3	-3.772	0.000178	-0.033858	170	0.008976	no	WHLBLD
chr2_33555164_G_A_b38	RASGRP3	3.77	0.00018	0.04305	23	0.01142	no	WHLBLD
chr2_33590881_T_C_b38	RASGRP3	3.766	0.000182	0.03635	53	0.009651	no	WHLBLD
chr2_33622592_T_C_b38	RASGRP3	3.745	0.000198	0.036188	64	0.009664	no	WHLBLD
chr2_33589264_G_C_b38	RASGRP3	3.744	0.000198	0.036289	54	0.009691	no	WHLBLD
chr2_33778798_T_C_b38	RASGRP3	-3.707	0.00023	-0.033183	171	0.008952	no	WHLBLD
chr2_33656916_G_A_b38	RASGRP3	3.696	0.00024	0.035077	64	0.009492	no	WHLBLD
chr2_33652477_C_A_b38	RASGRP3	3.68	0.000254	0.038041	30	0.010337	no	WHLBLD
chr2_33779853_G_A_b38	RASGRP3	-3.648	0.000287	-0.032619	170	0.008942	no	WHLBLD
chr2_33780726_C_A_b38	RASGRP3	-3.648	0.000287	-0.032619	170	0.008942	no	WHLBLD
chr2_33657078_T_C_b38	RASGRP3	3.633	0.000304	0.035995	49	0.009908	no	WHLBLD
chr2_33781201_G_C_b38	RASGRP3	-3.622	0.000317	-0.032418	169	0.008949	no	WHLBLD
chr2_33735493_A_G_b38	RASGRP3	-3.593	0.000354	-0.036555	40	0.010175	no	WHLBLD
chr2_33772197_A_T_b38	RASGRP3	-3.588	0.00036	-0.033037	78	0.009207	no	WHLBLD
chr2_33740099_T_TTTGTTG_b38	RASGRP3	-3.587	0.000362	-0.0382	30	0.010649	no	WHLBLD
chr2_33786599_C_T_b38	RASGRP3	-3.574	0.00038	-0.031664	162	0.008859	no	WHLBLD
chr2_33782986_A_C_b38	RASGRP3	-3.57	0.000386	-0.031863	166	0.008925	no	WHLBLD
chr2_33586869_A_T_b38	RASGRP3	3.563	0.000395	0.038866	31	0.010907	no	WHLBLD
chr2_33786410_A_G_b38	RASGRP3	-3.531	0.000445	-0.031374	161	0.008884	no	WHLBLD
chr2_33626436_A_T_b38	RASGRP3	3.523	0.00046	0.034111	57	0.009683	no	WHLBLD
chr2_33662459_C_T_b38	RASGRP3	3.492	0.000515	0.035644	32	0.010208	no	WHLBLD
chr2_33663555_T_C_b38	RASGRP3	3.398	0.000725	0.034775	32	0.010235	no	WHLBLD
chr2_33758476_T_G_b38	RASGRP3	-3.365	0.000814	-0.031423	92	0.009337	no	WHLBLD
chr2_33627793_A_G_b38	RASGRP3	3.354	0.000848	0.043415	13	0.012946	no	WHLBLD
chr2_33752910_T_G_b38	RASGRP3	-3.345	0.000876	-0.037237	25	0.011134	no	WHLBLD
chr2_33741270_T_C_b38	RASGRP3	3.331	0.000918	0.047337	8	0.014211	no	WHLBLD
chr2_33564467_A_G_b38	RASGRP3	3.324	0.000941	0.030709	87	0.009238	no	WHLBLD
chr2_33745297_G_A_b38	RASGRP3	-3.246	0.00124	-0.035222	27	0.010851	no	WHLBLD
chr2_33738887_G_A_b38	RASGRP3	-3.218	0.00136	-0.034567	28	0.010742	no	WHLBLD
chr2_33788893_A_G_b38	RASGRP3	3.215	0.00138	0.029603	79	0.009208	no	WHLBLD
chr2_33616325_C_T_b38	RASGRP3	3.193	0.00148	0.042504	12	0.01331	no	WHLBLD
chr2_33745369_C_T_b38	RASGRP3	3.182	0.00154	0.045655	7	0.014349	no	WHLBLD
chr2_33605827_ATTTTTCT_A_b38	RASGRP3	3.155	0.00168	0.041437	10	0.013133	no	WHLBLD
chr2_33745548_A_G_b38	RASGRP3	-3.155	0.00169	-0.034207	27	0.010844	no	WHLBLD
chr2_33756137_T_C_b38	RASGRP3	3.137	0.00179	0.049671	3	0.015835	no	WHLBLD
chr2_33738365_C_T_b38	RASGRP3	-3.107	0.00198	-0.034179	26	0.010999	no	WHLBLD
chr2_33736670_T_C_b38	RASGRP3	-3.104	0.002	-0.033995	26	0.010951	no	WHLBLD
chr2_33745920_G_T_b38	RASGRP3	-3.099	0.00203	-0.033544	27	0.010823	no	WHLBLD
chr2_33606703_C_T_b38	RASGRP3	3.084	0.00214	0.041517	12	0.013463	no	WHLBLD
chr2_33141037_G_A_b38	RASGRP3	-3.078	0.00218	-0.027104	124	0.008805	no	WHLBLD
chr2_33748194_G_A_b38	RASGRP3	-3.068	0.00225	-0.032372	32	0.01055	no	WHLBLD
chr2_33732506_C_T_b38	RASGRP3	3.064	0.00228	0.044961	7	0.014675	no	WHLBLD
chr2_33734078_T_A_b38	RASGRP3	3.064	0.00228	0.044961	7	0.014675	no	WHLBLD
chr2_33520269_T_C_b38	RASGRP3	3.027	0.00257	0.032667	29	0.010791	no	WHLBLD
chr2_33731949_C_G_b38	RASGRP3	3.024	0.0026	0.044565	7	0.014737	no	WHLBLD
chr2_33744320_G_A_b38	RASGRP3	-3.014	0.00268	-0.03269	27	0.010844	no	WHLBLD
chr2_33744664_C_A_b38	RASGRP3	-3.014	0.00268	-0.03269	27	0.010844	no	WHLBLD
chr2_33142651_C_T_b38	RASGRP3	3.013	0.00269	0.031624	30	0.010494	no	WHLBLD
chr2_33728254_C_T_b38	RASGRP3	3.009	0.00273	0.04396	7	0.014612	no	WHLBLD
chr2_33740099_T_TTTG_b38	RASGRP3	3.003	0.00279	0.040771	9	0.013578	no	WHLBLD
chr2_33764518_G_GTT_b38	RASGRP3	3.001	0.0028	0.050547	4	0.016841	no	WHLBLD
chr2_33752246_C_A_b38	RASGRP3	-2.993	0.00287	-0.032755	26	0.010943	no	WHLBLD
chr2_33749611_C_T_b38	RASGRP3	2.992	0.00289	0.043548	6	0.014555	no	WHLBLD
chr2_33751236_C_G_b38	RASGRP3	2.992	0.00289	0.043548	6	0.014555	no	WHLBLD
chr2_33208865_A_ATT_b38	RASGRP3	-2.981	0.00299	-0.031231	43	0.010478	no	WHLBLD
chr2_34292418_T_A_b38	RASGRP3	2.973	0.00307	0.069328	3	0.023323	no	WHLBLD
chr2_33620413_GA_G_b38	RASGRP3	2.968	0.00311	0.038921	5	0.013112	no	WHLBLD
chr2_33476758_C_CGTGCGTGT_b38	RASGRP3	2.941	0.00339	0.034564	15	0.011751	no	WHLBLD
chr2_33764670_T_A_b38	RASGRP3	-2.924	0.00358	-0.027334	81	0.009347	no	WHLBLD
chr2_33733508_C_T_b38	RASGRP3	-2.922	0.00361	-0.032592	25	0.011154	no	WHLBLD
chr2_33564001_C_G_b38	RASGRP3	2.916	0.00367	0.027219	83	0.009333	no	WHLBLD
chr2_33483036_TA_T_b38	RASGRP3	-2.915	0.00369	-0.034961	12	0.011993	no	WHLBLD
chr2_33765176_T_A_b38	RASGRP3	-2.914	0.0037	-0.027393	82	0.009399	no	WHLBLD
chr2_33763677_T_C_b38	RASGRP3	-2.881	0.0041	-0.02706	82	0.009391	no	WHLBLD
chr2_33634816_G_T_b38	RASGRP3	2.878	0.00414	0.038096	13	0.013236	no	WHLBLD
chr2_33636858_C_G_b38	RASGRP3	2.877	0.00415	0.038238	13	0.013289	no	WHLBLD
chr2_33637736_A_T_b38	RASGRP3	2.877	0.00415	0.038238	13	0.013289	no	WHLBLD
chr2_33469436_T_C_b38	RASGRP3	2.877	0.00416	0.02496	121	0.008675	no	WHLBLD
chr2_33634524_A_G_b38	RASGRP3	2.86	0.00439	0.038039	13	0.013302	no	WHLBLD
chr2_33634843_C_CTT_b38	RASGRP3	2.841	0.00466	0.041912	12	0.014754	no	WHLBLD
chr2_33763276_A_C_b38	RASGRP3	-2.829	0.00483	-0.026601	82	0.009403	no	WHLBLD
chr2_33640513_G_C_b38	RASGRP3	2.82	0.00496	0.037046	12	0.013135	no	WHLBLD
chr2_33581338_T_A_b38	RASGRP3	2.814	0.00506	0.036594	12	0.013006	no	WHLBLD
chr2_33571586_T_C_b38	RASGRP3	-2.808	0.00515	-0.024261	135	0.00864	no	WHLBLD
chr2_33139016_G_A_b38	RASGRP3	2.787	0.00549	0.029973	26	0.010755	no	WHLBLD
chr2_33581900_A_T_b38	RASGRP3	2.785	0.00552	0.036214	12	0.013001	no	WHLBLD
chr2_33633545_T_G_b38	RASGRP3	2.781	0.00558	0.040164	5	0.014441	no	WHLBLD
chr2_33758633_A_G_b38	RASGRP3	-2.773	0.00574	-0.025825	83	0.009314	no	WHLBLD
chr2_33479056_A_G_b38	RASGRP3	2.726	0.0066	0.033847	15	0.012416	no	WHLBLD
chr2_33667549_A_G_b38	RASGRP3	2.722	0.00667	0.036604	13	0.013445	no	WHLBLD
chr2_33667555_A_G_b38	RASGRP3	2.722	0.00667	0.036604	13	0.013445	no	WHLBLD
chr2_33769074_A_G_b38	RASGRP3	-2.722	0.00668	-0.025505	84	0.00937	no	WHLBLD
chr2_33768747_A_G_b38	RASGRP3	-2.708	0.00696	-0.025529	80	0.009426	no	WHLBLD
chr2_34327924_C_G_b38	RASGRP3	-2.706	0.00701	-0.038335	8	0.014168	no	WHLBLD
chr2_33762650_T_A_b38	RASGRP3	-2.702	0.00708	-0.025367	83	0.009387	no	WHLBLD
chr2_33764585_G_A_b38	RASGRP3	-2.7	0.00713	-0.025287	82	0.009366	no	WHLBLD
chr2_33672387_A_G_b38	RASGRP3	2.688	0.00739	0.03099	23	0.011529	no	WHLBLD
chr2_34207312_T_TAC_b38	RASGRP3	2.685	0.00745	0.043068	5	0.016038	no	WHLBLD
chr2_33793700_C_T_b38	RASGRP3	2.681	0.00753	0.032884	16	0.012264	no	WHLBLD
chr2_33565010_T_TACACAC_b38	RASGRP3	2.665	0.0079	0.051108	3	0.019175	no	WHLBLD
chr2_33721079_C_CGT_b38	RASGRP3	2.66	0.00803	0.034728	11	0.013058	no	WHLBLD
chr2_33732394_T_C_b38	RASGRP3	-2.655	0.00815	-0.028674	29	0.010802	no	WHLBLD
chr2_32568982_C_CT_b38	RASGRP3	2.65	0.00826	0.038049	11	0.014359	no	WHLBLD
chr2_33607432_G_A_b38	RASGRP3	2.636	0.00861	0.037173	5	0.014102	no	WHLBLD
chr2_33478863_G_A_b38	RASGRP3	2.635	0.00864	0.023156	162	0.008789	no	WHLBLD
chr2_33764495_G_A_b38	RASGRP3	-2.629	0.00878	-0.024664	79	0.009381	no	WHLBLD
chr2_33720623_ATGCGATT_A_b38	RASGRP3	2.629	0.00878	0.03396	11	0.012918	no	WHLBLD
chr2_33756434_A_G_b38	RASGRP3	-2.627	0.00883	-0.024777	81	0.009431	no	WHLBLD
chr2_33744244_A_T_b38	RASGRP3	-2.616	0.00911	-0.025935	53	0.009913	no	WHLBLD
chr2_33781569_AGTGTGT_A_b38	RASGRP3	2.615	0.00914	0.039842	6	0.015234	no	WHLBLD
chr2_33768405_T_A_b38	RASGRP3	-2.61	0.00927	-0.024744	81	0.00948	no	WHLBLD
chr2_33768709_T_C_b38	RASGRP3	-2.61	0.00927	-0.024744	81	0.00948	no	WHLBLD
chr2_33631243_G_GT_b38	RASGRP3	2.607	0.00936	0.035095	12	0.013462	no	WHLBLD
chr2_33563965_A_G_b38	RASGRP3	2.599	0.00958	0.033578	12	0.01292	no	WHLBLD
chr2_32905752_G_GAGAA_b38	RASGRP3	2.586	0.00994	0.043318	3	0.016749	no	WHLBLD

---

Filters:      p-Values >= and <=      Betas >= and <=      Statistic >= and <=      Carriers >= and <=
Positions: left right     Zoom: RASGRP3     Other:     -      +     reset     eQTLs Region
Draw    p-Value Beta Statistic Carriers Beta/sd(t)     Scaling     Sign (red=+, blue-)     Colors: Tissue Sign     Expr-Box: Height: Width: