RP11-206L10.9 - long intergenic non-protein coding RNA 1409 - 1p36.33

Snps	Gene	Statistic	Pvalue	Beta	Carriers	Beta_se	Linear	Tissue
chr1_683167_G_A_b38	RP11-206L10.9	7.657	9.63e-14	0.078511	6	0.010254	yes	ADPSBQ
chr1_789568_TATGGA_T_b38	RP11-206L10.9	-6.005	3.63e-09	-0.050227	43	0.008364	yes	ADPSBQ
chr1_813498_G_T_b38	RP11-206L10.9	-5.274	1.97e-07	-0.042281	40	0.008016	yes	ADPSBQ
chr1_790933_CGAATGGAATG_C_b38	RP11-206L10.9	-5.107	4.64e-07	-0.038059	41	0.007453	yes	ADPSBQ
chr1_826420_A_T_b38	RP11-206L10.9	-4.47	9.62e-06	-0.032734	56	0.007322	yes	ADPSBQ
chr1_771398_G_A_b38	RP11-206L10.9	-4.276	2.28e-05	-0.032905	76	0.007696	yes	ADPSBQ
chr1_98929_A_G_b38	RP11-206L10.9	4.166	3.64e-05	0.043631	8	0.010472	yes	ADPSBQ
chr1_788757_T_TAATGG_b38	RP11-206L10.9	-4.096	4.9e-05	-0.025929	117	0.006331	yes	ADPSBQ
chr1_1288336_T_C_b38	RP11-206L10.9	3.918	0.000101	0.073165	5	0.018672	yes	ADPSBQ
chr1_1660408_T_C_b38	RP11-206L10.9	3.914	0.000103	0.033055	16	0.008446	yes	ADPSBQ
chr1_1639685_G_A_b38	RP11-206L10.9	3.89	0.000114	0.029864	33	0.007677	yes	ADPSBQ
chr1_799082_G_A_b38	RP11-206L10.9	-3.88	0.000118	-0.036214	12	0.009334	yes	ADPSBQ
chr1_1650098_A_G_b38	RP11-206L10.9	3.715	0.000225	0.055669	5	0.014984	yes	ADPSBQ
chr1_1288338_T_C_b38	RP11-206L10.9	3.681	0.000257	0.087129	3	0.023668	yes	ADPSBQ
chr1_1606539_G_GCC_b38	RP11-206L10.9	3.357	0.000846	0.025188	43	0.007503	yes	ADPSBQ
chr1_1606552_A_G_b38	RP11-206L10.9	3.252	0.00122	0.02333	51	0.007174	yes	ADPSBQ
chr1_1668542_C_T_b38	RP11-206L10.9	3.187	0.00153	0.025133	29	0.007887	yes	ADPSBQ
chr1_1669576_G_A_b38	RP11-206L10.9	3.168	0.00163	0.024638	33	0.007777	yes	ADPSBQ
chr1_1606532_G_A_b38	RP11-206L10.9	3.154	0.00171	0.023916	41	0.007583	yes	ADPSBQ
chr1_789680_A_AGGAATGGAAT_b38	RP11-206L10.9	-3.115	0.00194	-0.021519	70	0.006909	yes	ADPSBQ
chr1_1538924_C_A_b38	RP11-206L10.9	3.109	0.00198	0.021918	63	0.007049	yes	ADPSBQ
chr1_674381_A_AT_b38	RP11-206L10.9	3.069	0.00226	0.025734	26	0.008384	yes	ADPSBQ
chr1_1606536_GCT_G_b38	RP11-206L10.9	3.061	0.00232	0.022985	43	0.007508	yes	ADPSBQ
chr1_1532798_T_C_b38	RP11-206L10.9	3.052	0.00239	0.020375	159	0.006676	yes	ADPSBQ
chr1_1571434_C_CA_b38	RP11-206L10.9	2.931	0.00353	0.022679	52	0.007737	yes	ADPSBQ
chr1_1616048_C_T_b38	RP11-206L10.9	2.895	0.00396	0.019771	77	0.00683	yes	ADPSBQ
chr1_1624323_AT_A_b38	RP11-206L10.9	-2.89	0.00402	-0.019098	97	0.006608	yes	ADPSBQ
chr1_1219203_A_AC_b38	RP11-206L10.9	-2.86	0.00441	-0.038032	4	0.013297	yes	ADPSBQ
chr1_1622510_C_T_b38	RP11-206L10.9	2.836	0.00475	0.019792	70	0.006979	yes	ADPSBQ
chr1_1629572_TG_T_b38	RP11-206L10.9	2.834	0.00478	0.019444	76	0.006861	yes	ADPSBQ
chr1_1618118_G_A_b38	RP11-206L10.9	2.828	0.00487	0.019706	72	0.006969	yes	ADPSBQ
chr1_1708474_C_A_b38	RP11-206L10.9	2.821	0.00498	0.024046	21	0.008525	yes	ADPSBQ
chr1_1625805_G_A_b38	RP11-206L10.9	2.818	0.00502	0.019499	74	0.00692	yes	ADPSBQ
chr1_1613090_A_G_b38	RP11-206L10.9	2.812	0.00512	0.019605	72	0.006973	yes	ADPSBQ
chr1_1548554_C_CA_b38	RP11-206L10.9	2.761	0.00596	0.064609	3	0.023396	yes	ADPSBQ
chr1_1610924_C_T_b38	RP11-206L10.9	2.759	0.00601	0.019224	73	0.006968	yes	ADPSBQ
chr1_1628814_C_T_b38	RP11-206L10.9	2.738	0.0064	0.018913	73	0.006908	yes	ADPSBQ
chr1_127909_G_A_b38	RP11-206L10.9	2.727	0.00662	0.02592	4	0.009506	yes	ADPSBQ
chr1_15015_G_C_b38	RP11-206L10.9	2.72	0.00674	0.023334	26	0.008577	yes	ADPSBQ
chr1_1265603_T_TTGTG_b38	RP11-206L10.9	2.718	0.00679	0.023438	16	0.008622	yes	ADPSBQ
chr1_1605347_C_T_b38	RP11-206L10.9	2.716	0.00683	0.018978	72	0.006987	yes	ADPSBQ
chr1_1020681_A_AG_b38	RP11-206L10.9	2.709	0.00697	0.018842	55	0.006955	yes	ADPSBQ
chr1_667662_G_C_b38	RP11-206L10.9	2.705	0.00705	0.062036	3	0.02293	yes	ADPSBQ
chr1_1624720_G_A_b38	RP11-206L10.9	2.697	0.00724	0.018656	74	0.006918	yes	ADPSBQ
chr1_1628409_C_A_b38	RP11-206L10.9	2.662	0.00802	0.018366	73	0.0069	yes	ADPSBQ
chr1_1609070_G_A_b38	RP11-206L10.9	2.653	0.00823	0.018421	74	0.006943	yes	ADPSBQ
chr1_680812_T_C_b38	RP11-206L10.9	-2.653	0.00823	-0.022288	16	0.008401	yes	ADPSBQ
chr1_1594614_G_C_b38	RP11-206L10.9	2.64	0.00853	0.018709	69	0.007086	yes	ADPSBQ
chr1_133483_G_T_b38	RP11-206L10.9	2.626	0.00889	0.021747	38	0.00828	yes	ADPSBQ
chr1_1596144_GAGAC_G_b38	RP11-206L10.9	2.6	0.00961	0.018282	69	0.007033	yes	ADPSBQ
chr1_1660683_C_T_b38	RP11-206L10.9	2.598	0.00965	0.019232	49	0.007403	yes	ADPSBQ
chr1_1608603_C_A_b38	RP11-206L10.9	2.596	0.00972	0.01811	73	0.006977	yes	ADPSBQ
chr1_677290_A_G_b38	RP11-206L10.9	10.761	1.78e-24	0.126744	5	0.011778	no	ADPSBQ
chr1_777382_T_G_b38	RP11-206L10.9	10.625	5.91e-24	0.119906	3	0.011286	no	ADPSBQ
chr1_677378_T_C_b38	RP11-206L10.9	10.595	7.67e-24	0.123234	5	0.011631	no	ADPSBQ
chr1_800605_G_A_b38	RP11-206L10.9	10.208	2.19e-22	0.112201	7	0.010992	no	ADPSBQ
chr1_778639_A_G_b38	RP11-206L10.9	10.18	2.79e-22	0.112563	6	0.011058	no	ADPSBQ
chr1_788439_T_A_b38	RP11-206L10.9	10.127	4.35e-22	0.110976	7	0.010958	no	ADPSBQ
chr1_809641_G_T_b38	RP11-206L10.9	10.126	4.41e-22	0.108432	10	0.010709	no	ADPSBQ
chr1_788418_CAG_C_b38	RP11-206L10.9	-9.335	3.09e-19	-0.100875	9	0.010806	no	ADPSBQ
chr1_779047_G_A_b38	RP11-206L10.9	-9.304	3.98e-19	-0.100475	13	0.010799	no	ADPSBQ
chr1_788511_G_C_b38	RP11-206L10.9	-9.288	4.54e-19	-0.098804	12	0.010638	no	ADPSBQ
chr1_812761_G_A_b38	RP11-206L10.9	9.202	9.02e-19	0.111212	4	0.012086	no	ADPSBQ
chr1_812899_A_T_b38	RP11-206L10.9	9.137	1.52e-18	0.10484	7	0.011475	no	ADPSBQ
chr1_784109_C_CATAAT_b38	RP11-206L10.9	9.018	3.89e-18	0.107538	7	0.011925	no	ADPSBQ
chr1_783406_A_AT_b38	RP11-206L10.9	9.003	4.36e-18	0.09609	4	0.010673	no	ADPSBQ
chr1_777135_T_TC_b38	RP11-206L10.9	8.882	1.12e-17	0.10739	6	0.012091	no	ADPSBQ
chr1_649157_C_T_b38	RP11-206L10.9	7.406	5.44e-13	0.102579	3	0.013852	no	ADPSBQ
chr1_800909_T_A_b38	RP11-206L10.9	7.029	6.72e-12	0.063781	7	0.009074	no	ADPSBQ
chr1_820560_C_T_b38	RP11-206L10.9	-6.463	2.41e-10	-0.052825	29	0.008174	no	ADPSBQ
chr1_814476_C_T_b38	RP11-206L10.9	-6.173	1.37e-09	-0.052763	27	0.008547	no	ADPSBQ
chr1_817341_A_G_b38	RP11-206L10.9	-6.172	1.38e-09	-0.05292	35	0.008575	no	ADPSBQ
chr1_818094_C_G_b38	RP11-206L10.9	-6.15	1.56e-09	-0.052849	44	0.008593	no	ADPSBQ
chr1_819584_C_T_b38	RP11-206L10.9	-6.03	3.15e-09	-0.052086	33	0.008638	no	ADPSBQ
chr1_819123_G_A_b38	RP11-206L10.9	-5.883	7.3e-09	-0.05069	33	0.008617	no	ADPSBQ
chr1_817186_G_A_b38	RP11-206L10.9	-5.881	7.39e-09	-0.050627	26	0.008609	no	ADPSBQ
chr1_825532_C_T_b38	RP11-206L10.9	-5.832	9.76e-09	-0.050309	23	0.008627	no	ADPSBQ
chr1_825767_T_C_b38	RP11-206L10.9	-5.832	9.76e-09	-0.050309	23	0.008627	no	ADPSBQ
chr1_824320_T_C_b38	RP11-206L10.9	-5.779	1.31e-08	-0.04953	24	0.008571	no	ADPSBQ
chr1_808924_C_T_b38	RP11-206L10.9	-5.57	4.13e-08	-0.050925	10	0.009143	no	ADPSBQ
chr1_826577_A_AT_b38	RP11-206L10.9	-5.552	4.54e-08	-0.047448	24	0.008546	no	ADPSBQ
chr1_794299_C_G_b38	RP11-206L10.9	-5.516	5.53e-08	-0.047779	36	0.008662	no	ADPSBQ
chr1_817514_T_C_b38	RP11-206L10.9	-5.399	1.03e-07	-0.046474	22	0.008607	no	ADPSBQ
chr1_624836_G_A_b38	RP11-206L10.9	5.003	7.79e-07	0.084077	3	0.016806	no	ADPSBQ
chr1_668125_A_C_b38	RP11-206L10.9	4.988	8.37e-07	0.10461	3	0.020971	no	ADPSBQ
chr1_807692_C_A_b38	RP11-206L10.9	-4.916	1.19e-06	-0.065479	10	0.01332	no	ADPSBQ
chr1_814773_T_C_b38	RP11-206L10.9	4.569	6.15e-06	0.042142	5	0.009223	no	ADPSBQ
chr1_806017_A_G_b38	RP11-206L10.9	4.433	1.14e-05	0.065951	9	0.014879	no	ADPSBQ
chr1_1638879_C_T_b38	RP11-206L10.9	4.013	6.91e-05	0.030119	38	0.007506	no	ADPSBQ
chr1_821000_T_A_b38	RP11-206L10.9	-3.899	0.000109	-0.032348	23	0.008296	no	ADPSBQ
chr1_1653863_C_A_b38	RP11-206L10.9	3.731	0.000212	0.032178	15	0.008625	no	ADPSBQ
chr1_1661177_A_G_b38	RP11-206L10.9	3.573	0.000387	0.027576	33	0.007719	no	ADPSBQ
chr1_822427_CCCTGGCCAGCAGATCCACCCTGTCTATACTACCTG_C_b38	RP11-206L10.9	-3.446	0.000615	-0.027852	33	0.008081	no	ADPSBQ
chr1_1746452_A_AC_b38	RP11-206L10.9	3.421	0.000674	0.082482	3	0.024111	no	ADPSBQ
chr1_1293731_A_ACGCCCCTGCCCTGGAGGCCCCGCCCCTGCCCTGGAGGCCC_b38	RP11-206L10.9	3.304	0.00102	0.045229	8	0.013691	no	ADPSBQ
chr1_1665581_C_G_b38	RP11-206L10.9	3.248	0.00124	0.024523	37	0.00755	no	ADPSBQ
chr1_1658830_C_G_b38	RP11-206L10.9	3.222	0.00135	0.02456	34	0.007622	no	ADPSBQ
chr1_262698_G_A_b38	RP11-206L10.9	-3.19	0.00151	-0.025611	33	0.008028	no	ADPSBQ
chr1_1665061_C_T_b38	RP11-206L10.9	3.155	0.0017	0.024396	33	0.007732	no	ADPSBQ
chr1_1171093_G_A_b38	RP11-206L10.9	3.149	0.00174	0.026802	56	0.008512	no	ADPSBQ
chr1_1637577_T_C_b38	RP11-206L10.9	3.13	0.00185	0.023115	39	0.007385	no	ADPSBQ
chr1_681082_T_C_b38	RP11-206L10.9	-3.064	0.0023	-0.025317	18	0.008263	no	ADPSBQ
chr1_1667948_A_G_b38	RP11-206L10.9	3.063	0.00231	0.023787	33	0.007766	no	ADPSBQ
chr1_531693_C_T_b38	RP11-206L10.9	3.023	0.00263	0.020636	89	0.006827	no	ADPSBQ
chr1_1668717_C_G_b38	RP11-206L10.9	3.021	0.00265	0.023485	33	0.007774	no	ADPSBQ
chr1_279524_G_GT_b38	RP11-206L10.9	-2.971	0.00311	-0.023778	35	0.008004	no	ADPSBQ
chr1_173098_C_T_b38	RP11-206L10.9	2.951	0.00332	0.019168	117	0.006497	no	ADPSBQ
chr1_1659940_A_C_b38	RP11-206L10.9	2.915	0.00371	0.02489	18	0.008538	no	ADPSBQ
chr1_281876_AC_A_b38	RP11-206L10.9	-2.899	0.0039	-0.023205	36	0.008003	no	ADPSBQ
chr1_1669613_G_A_b38	RP11-206L10.9	2.859	0.00443	0.022073	34	0.007722	no	ADPSBQ
chr1_1652913_C_T_b38	RP11-206L10.9	2.858	0.00444	0.020723	49	0.007252	no	ADPSBQ
chr1_1634405_CCGG_C_b38	RP11-206L10.9	2.848	0.00457	0.052591	5	0.018464	no	ADPSBQ
chr1_1728671_C_A_b38	RP11-206L10.9	-2.844	0.00464	-0.024784	25	0.008715	no	ADPSBQ
chr1_814617_A_G_b38	RP11-206L10.9	-2.813	0.00509	-0.020036	59	0.007121	no	ADPSBQ
chr1_871922_A_ATTT_b38	RP11-206L10.9	-2.801	0.00529	-0.057487	3	0.020527	no	ADPSBQ
chr1_624767_T_G_b38	RP11-206L10.9	2.794	0.00541	0.026228	4	0.009389	no	ADPSBQ
chr1_281912_C_G_b38	RP11-206L10.9	-2.762	0.00596	-0.023263	25	0.008423	no	ADPSBQ
chr1_928182_A_C_b38	RP11-206L10.9	2.761	0.00597	0.031674	3	0.011471	no	ADPSBQ
chr1_15045_C_T_b38	RP11-206L10.9	2.75	0.00618	0.023618	18	0.008589	no	ADPSBQ
chr1_1650195_A_G_b38	RP11-206L10.9	2.739	0.00637	0.019068	67	0.00696	no	ADPSBQ
chr1_1659060_G_A_b38	RP11-206L10.9	2.717	0.00682	0.019503	52	0.007179	no	ADPSBQ
chr1_624752_C_T_b38	RP11-206L10.9	2.708	0.00699	0.025111	6	0.009272	no	ADPSBQ
chr1_123511_G_A_b38	RP11-206L10.9	-2.69	0.00738	-0.024047	9	0.00894	no	ADPSBQ
chr1_791564_C_G_b38	RP11-206L10.9	-2.684	0.00751	-0.021436	57	0.007987	no	ADPSBQ
chr1_1739131_T_C_b38	RP11-206L10.9	-2.668	0.00788	-0.01756	110	0.006582	no	ADPSBQ
chr1_813885_G_A_b38	RP11-206L10.9	-2.66	0.00806	-0.018192	127	0.006839	no	ADPSBQ
chr1_1639348_G_T_b38	RP11-206L10.9	2.626	0.00889	0.01805	74	0.006873	no	ADPSBQ
chr1_1102094_AAAC_A_b38	RP11-206L10.9	2.625	0.00894	0.041816	3	0.015933	no	ADPSBQ
chr1_1650688_T_A_b38	RP11-206L10.9	2.614	0.00922	0.019202	49	0.007346	no	ADPSBQ
chr1_680742_A_T_b38	RP11-206L10.9	6.901	2.04e-11	0.1008	3	0.014606	yes	ADPVSC
chr1_681103_T_A_b38	RP11-206L10.9	6.284	8.69e-10	0.096592	3	0.015372	yes	ADPVSC
chr1_624836_G_A_b38	RP11-206L10.9	5.959	5.59e-09	0.099968	4	0.016775	yes	ADPVSC
chr1_1498616_T_C_b38	RP11-206L10.9	4.699	3.6e-06	0.111079	3	0.023638	yes	ADPVSC
chr1_820560_C_T_b38	RP11-206L10.9	-4.364	1.63e-05	-0.0388	26	0.00889	yes	ADPVSC
chr1_808924_C_T_b38	RP11-206L10.9	-3.587	0.000377	-0.037506	8	0.010457	yes	ADPVSC
chr1_817186_G_A_b38	RP11-206L10.9	-3.527	0.000469	-0.033921	19	0.009617	yes	ADPVSC
chr1_824320_T_C_b38	RP11-206L10.9	-3.463	0.000591	-0.032443	20	0.009367	yes	ADPVSC
chr1_817341_A_G_b38	RP11-206L10.9	-3.453	0.000614	-0.03312	24	0.009592	yes	ADPVSC
chr1_825532_C_T_b38	RP11-206L10.9	-3.278	0.00114	-0.031318	18	0.009554	yes	ADPVSC
chr1_825767_T_C_b38	RP11-206L10.9	-3.278	0.00114	-0.031318	18	0.009554	yes	ADPVSC
chr1_819123_G_A_b38	RP11-206L10.9	-3.175	0.00161	-0.030067	24	0.009469	yes	ADPVSC
chr1_818094_C_G_b38	RP11-206L10.9	-3.076	0.00224	-0.029751	31	0.009671	yes	ADPVSC
chr1_826577_A_AT_b38	RP11-206L10.9	-3.025	0.00264	-0.028578	19	0.009446	yes	ADPVSC
chr1_819584_C_T_b38	RP11-206L10.9	-3.019	0.0027	-0.028831	24	0.00955	yes	ADPVSC
chr1_975058_A_G_b38	RP11-206L10.9	3.018	0.0027	0.053785	4	0.017819	yes	ADPVSC
chr1_788757_T_TAATGG_b38	RP11-206L10.9	-3.001	0.00286	-0.021868	94	0.007286	yes	ADPVSC
chr1_822427_CCCTGGCCAGCAGATCCACCCTGTCTATACTACCTG_C_b38	RP11-206L10.9	-2.922	0.00367	-0.026525	24	0.009076	yes	ADPVSC
chr1_1502507_A_AT_b38	RP11-206L10.9	2.902	0.00391	0.064881	3	0.022355	yes	ADPVSC
chr1_817514_T_C_b38	RP11-206L10.9	-2.898	0.00396	-0.027312	18	0.009423	yes	ADPVSC
chr1_771398_G_A_b38	RP11-206L10.9	-2.883	0.00415	-0.023825	63	0.008264	yes	ADPVSC
chr1_899576_G_A_b38	RP11-206L10.9	2.869	0.00434	0.051999	4	0.018126	yes	ADPVSC
chr1_1424102_G_T_b38	RP11-206L10.9	2.844	0.00468	0.035309	5	0.012415	yes	ADPVSC
chr1_821000_T_A_b38	RP11-206L10.9	-2.753	0.00617	-0.025543	20	0.009277	yes	ADPVSC
chr1_1544705_G_T_b38	RP11-206L10.9	2.715	0.00692	0.064721	3	0.02384	yes	ADPVSC
chr1_1474819_G_C_b38	RP11-206L10.9	-2.702	0.00718	-0.045977	6	0.017013	yes	ADPVSC
chr1_1288336_T_C_b38	RP11-206L10.9	2.663	0.00807	0.057233	3	0.021496	yes	ADPVSC
chr1_826420_A_T_b38	RP11-206L10.9	-2.66	0.00812	-0.020826	50	0.007829	yes	ADPVSC
chr1_1423191_T_A_b38	RP11-206L10.9	2.656	0.00824	0.032943	5	0.012405	yes	ADPVSC
chr1_1423343_G_T_b38	RP11-206L10.9	2.656	0.00824	0.032943	5	0.012405	yes	ADPVSC
chr1_1423478_C_T_b38	RP11-206L10.9	2.656	0.00824	0.032943	5	0.012405	yes	ADPVSC
chr1_1424078_G_A_b38	RP11-206L10.9	2.656	0.00824	0.032943	5	0.012405	yes	ADPVSC
chr1_1424220_A_G_b38	RP11-206L10.9	2.656	0.00824	0.032943	5	0.012405	yes	ADPVSC
chr1_206074_T_C_b38	RP11-206L10.9	2.607	0.00949	0.020555	67	0.007886	yes	ADPVSC
chr1_1423368_G_A_b38	RP11-206L10.9	2.606	0.0095	0.0325	5	0.01247	yes	ADPVSC
chr1_1415792_A_T_b38	RP11-206L10.9	2.602	0.00962	0.045491	3	0.017484	yes	ADPVSC
chr1_677378_T_C_b38	RP11-206L10.9	7	1.09e-11	0.095289	5	0.013613	no	ADPVSC
chr1_677290_A_G_b38	RP11-206L10.9	6.589	1.41e-10	0.095551	4	0.014501	no	ADPVSC
chr1_809641_G_T_b38	RP11-206L10.9	6.481	2.69e-10	0.084954	8	0.013107	no	ADPVSC
chr1_668074_G_A_b38	RP11-206L10.9	6.307	7.56e-10	0.131853	3	0.020905	no	ADPVSC
chr1_812899_A_T_b38	RP11-206L10.9	6.277	9.02e-10	0.086479	8	0.013777	no	ADPVSC
chr1_683167_G_A_b38	RP11-206L10.9	6.228	1.2e-09	0.07186	6	0.011539	no	ADPVSC
chr1_800605_G_A_b38	RP11-206L10.9	6.194	1.47e-09	0.083408	6	0.013467	no	ADPVSC
chr1_788439_T_A_b38	RP11-206L10.9	6.187	1.53e-09	0.082905	6	0.013401	no	ADPVSC
chr1_778639_A_G_b38	RP11-206L10.9	6.042	3.51e-09	0.081609	6	0.013508	no	ADPVSC
chr1_788511_G_C_b38	RP11-206L10.9	-6.017	4.04e-09	-0.076851	11	0.012772	no	ADPVSC
chr1_812761_G_A_b38	RP11-206L10.9	5.985	4.84e-09	0.087486	3	0.014618	no	ADPVSC
chr1_788418_CAG_C_b38	RP11-206L10.9	-5.969	5.28e-09	-0.07815	8	0.013092	no	ADPVSC
chr1_779047_G_A_b38	RP11-206L10.9	-5.883	8.54e-09	-0.075283	12	0.012796	no	ADPVSC
chr1_777135_T_TC_b38	RP11-206L10.9	5.383	1.25e-07	0.078448	5	0.014572	no	ADPVSC
chr1_784109_C_CATAAT_b38	RP11-206L10.9	5.361	1.41e-07	0.079606	6	0.01485	no	ADPVSC
chr1_800909_T_A_b38	RP11-206L10.9	3.648	3e-04	0.036912	7	0.010119	no	ADPVSC
chr1_860178_C_CTTTTT_b38	RP11-206L10.9	-3.322	0.000977	-0.031694	9	0.009541	no	ADPVSC
chr1_789568_TATGGA_T_b38	RP11-206L10.9	-3.319	0.000985	-0.031286	31	0.009425	no	ADPVSC
chr1_98929_A_G_b38	RP11-206L10.9	3.164	0.00167	0.038113	5	0.012045	no	ADPVSC
chr1_1422946_C_T_b38	RP11-206L10.9	3.079	0.00222	0.05667	3	0.018407	no	ADPVSC
chr1_1153012_T_C_b38	RP11-206L10.9	-3.047	0.00247	-0.046371	5	0.015219	no	ADPVSC
chr1_1424725_G_A_b38	RP11-206L10.9	3.001	0.00286	0.055626	3	0.018536	no	ADPVSC
chr1_790933_CGAATGGAATG_C_b38	RP11-206L10.9	-2.885	0.00413	-0.024558	30	0.008513	no	ADPVSC
chr1_599294_T_G_b38	RP11-206L10.9	2.799	0.00537	0.045469	5	0.016244	no	ADPVSC
chr1_1153485_T_C_b38	RP11-206L10.9	-2.746	0.00631	-0.047002	5	0.017118	no	ADPVSC
chr1_1153768_T_C_b38	RP11-206L10.9	-2.746	0.00631	-0.047002	5	0.017118	no	ADPVSC
chr1_1155177_A_C_b38	RP11-206L10.9	-2.746	0.00631	-0.047002	5	0.017118	no	ADPVSC
chr1_1155933_A_G_b38	RP11-206L10.9	-2.746	0.00631	-0.047002	5	0.017118	no	ADPVSC
chr1_1156125_C_T_b38	RP11-206L10.9	-2.746	0.00631	-0.047002	5	0.017118	no	ADPVSC
chr1_1156322_A_G_b38	RP11-206L10.9	-2.746	0.00631	-0.047002	5	0.017118	no	ADPVSC
chr1_1156447_C_T_b38	RP11-206L10.9	-2.746	0.00631	-0.047002	5	0.017118	no	ADPVSC
chr1_1156691_C_A_b38	RP11-206L10.9	-2.746	0.00631	-0.047002	5	0.017118	no	ADPVSC
chr1_1156907_A_G_b38	RP11-206L10.9	-2.746	0.00631	-0.047002	5	0.017118	no	ADPVSC
chr1_1157020_G_C_b38	RP11-206L10.9	-2.746	0.00631	-0.047002	5	0.017118	no	ADPVSC
chr1_1157044_A_G_b38	RP11-206L10.9	-2.746	0.00631	-0.047002	5	0.017118	no	ADPVSC
chr1_794299_C_G_b38	RP11-206L10.9	-2.74	0.00642	-0.026777	28	0.009773	no	ADPVSC
chr1_1743712_G_A_b38	RP11-206L10.9	2.72	0.00681	0.036595	3	0.013453	no	ADPVSC
chr1_1152743_T_C_b38	RP11-206L10.9	-2.696	0.00732	-0.046276	3	0.017165	no	ADPVSC
chr1_1157209_G_A_b38	RP11-206L10.9	-2.646	0.00848	-0.045662	5	0.017259	no	ADPVSC
chr1_1151436_C_CCCCCAGCCAGAGCCTCAGGGTGAGCTCAAGGCACCAAACCCAGAACGG_b38	RP11-206L10.9	-2.62	0.00912	-0.066781	4	0.025485	no	ADPVSC
chr1_13613_T_A_b38	RP11-206L10.9	2.614	0.00928	0.027024	7	0.010337	no	ADPVSC
chr1_1413406_G_A_b38	RP11-206L10.9	2.595	0.0098	0.044078	4	0.016985	no	ADPVSC
chr1_1573265_C_CAAAA_b38	RP11-206L10.9	3.503	0.000573	0.046842	9	0.013374	yes	ADRNLG
chr1_813498_G_T_b38	RP11-206L10.9	-3.331	0.00104	-0.038056	15	0.011425	yes	ADRNLG
chr1_1729296_T_C_b38	RP11-206L10.9	3.322	0.00107	0.040984	15	0.012337	yes	ADRNLG
chr1_1729287_T_C_b38	RP11-206L10.9	3.247	0.00138	0.038559	17	0.011876	yes	ADRNLG
chr1_1583446_C_CG_b38	RP11-206L10.9	3.214	0.00154	0.051949	3	0.016164	yes	ADRNLG
chr1_800909_T_A_b38	RP11-206L10.9	3.177	0.00173	0.040849	5	0.012857	yes	ADRNLG
chr1_674562_T_C_b38	RP11-206L10.9	3.139	0.00196	0.037759	6	0.012028	yes	ADRNLG
chr1_1456829_G_C_b38	RP11-206L10.9	3.044	0.00266	0.038844	13	0.012761	yes	ADRNLG
chr1_799082_G_A_b38	RP11-206L10.9	-3.04	0.00269	-0.0424	5	0.013945	yes	ADRNLG
chr1_286747_A_G_b38	RP11-206L10.9	2.889	0.00431	0.037953	6	0.013138	yes	ADRNLG
chr1_286985_C_T_b38	RP11-206L10.9	2.889	0.00431	0.037953	6	0.013138	yes	ADRNLG
chr1_1571434_C_CA_b38	RP11-206L10.9	2.886	0.00435	0.033787	14	0.011708	yes	ADRNLG
chr1_1075715_A_G_b38	RP11-206L10.9	2.874	0.00451	0.04536	3	0.015784	yes	ADRNLG
chr1_1565680_A_AG_b38	RP11-206L10.9	2.85	0.00485	0.028462	34	0.009987	yes	ADRNLG
chr1_1541864_T_C_b38	RP11-206L10.9	2.837	0.00504	0.029027	34	0.01023	yes	ADRNLG
chr1_1558726_C_CA_b38	RP11-206L10.9	2.837	0.00504	0.029027	34	0.01023	yes	ADRNLG
chr1_1561821_A_C_b38	RP11-206L10.9	2.837	0.00504	0.029027	34	0.01023	yes	ADRNLG
chr1_1549967_C_G_b38	RP11-206L10.9	2.837	0.00505	0.030678	16	0.010815	yes	ADRNLG
chr1_105737_A_G_b38	RP11-206L10.9	-2.828	0.00518	-0.037052	3	0.013101	yes	ADRNLG
chr1_1551557_A_AG_b38	RP11-206L10.9	2.712	0.00729	0.027657	35	0.010197	yes	ADRNLG
chr1_1551559_A_T_b38	RP11-206L10.9	2.712	0.00729	0.027657	35	0.010197	yes	ADRNLG
chr1_791549_G_GGAATGGAATC_b38	RP11-206L10.9	-2.701	0.00752	-0.029777	17	0.011023	yes	ADRNLG
chr1_1569180_T_A_b38	RP11-206L10.9	2.688	0.00783	0.027085	35	0.010077	yes	ADRNLG
chr1_1550064_GC_G_b38	RP11-206L10.9	2.668	0.00828	0.026969	33	0.010107	yes	ADRNLG
chr1_1550068_C_A_b38	RP11-206L10.9	2.668	0.00828	0.026969	33	0.010107	yes	ADRNLG
chr1_1557495_CAT_C_b38	RP11-206L10.9	2.648	0.00878	0.027185	34	0.010268	yes	ADRNLG
chr1_1542773_T_C_b38	RP11-206L10.9	2.633	0.00916	0.026824	33	0.010189	yes	ADRNLG
chr1_1542793_C_G_b38	RP11-206L10.9	2.633	0.00916	0.026824	33	0.010189	yes	ADRNLG
chr1_1542800_T_C_b38	RP11-206L10.9	2.633	0.00916	0.026824	33	0.010189	yes	ADRNLG
chr1_1543953_A_G_b38	RP11-206L10.9	2.633	0.00916	0.026824	33	0.010189	yes	ADRNLG
chr1_1573079_A_G_b38	RP11-206L10.9	2.611	0.00973	0.02629	36	0.010068	yes	ADRNLG
chr1_677290_A_G_b38	RP11-206L10.9	7.57	1.52e-12	0.118161	4	0.015609	no	ADRNLG
chr1_788418_CAG_C_b38	RP11-206L10.9	-7.565	1.57e-12	-0.123057	4	0.016266	no	ADRNLG
chr1_777382_T_G_b38	RP11-206L10.9	7.526	1.97e-12	0.124854	3	0.016589	no	ADRNLG
chr1_800605_G_A_b38	RP11-206L10.9	7.442	3.25e-12	0.123209	3	0.016557	no	ADRNLG
chr1_677378_T_C_b38	RP11-206L10.9	7.371	4.91e-12	0.115269	4	0.015638	no	ADRNLG
chr1_778639_A_G_b38	RP11-206L10.9	7.311	6.95e-12	0.119614	4	0.01636	no	ADRNLG
chr1_788439_T_A_b38	RP11-206L10.9	7.268	8.97e-12	0.118308	4	0.016279	no	ADRNLG
chr1_788511_G_C_b38	RP11-206L10.9	-7.11	2.23e-11	-0.108136	8	0.015209	no	ADRNLG
chr1_812899_A_T_b38	RP11-206L10.9	7.005	4.05e-11	0.112616	7	0.016076	no	ADRNLG
chr1_779047_G_A_b38	RP11-206L10.9	-6.951	5.5e-11	-0.104476	9	0.01503	no	ADRNLG
chr1_809641_G_T_b38	RP11-206L10.9	6.928	6.27e-11	0.1111	5	0.016036	no	ADRNLG
chr1_784109_C_CATAAT_b38	RP11-206L10.9	6.652	2.93e-10	0.121173	4	0.018215	no	ADRNLG
chr1_812761_G_A_b38	RP11-206L10.9	6.03	8.27e-09	0.102278	6	0.016962	no	ADRNLG
chr1_807692_C_A_b38	RP11-206L10.9	-4.643	6.35e-06	-0.081893	7	0.017637	no	ADRNLG
chr1_808924_C_T_b38	RP11-206L10.9	-4.604	7.54e-06	-0.060972	5	0.013244	no	ADRNLG
chr1_668125_A_C_b38	RP11-206L10.9	4.376	1.98e-05	0.09862	3	0.022537	no	ADRNLG
chr1_820560_C_T_b38	RP11-206L10.9	-4.364	2.09e-05	-0.049759	15	0.011403	no	ADRNLG
chr1_790933_CGAATGGAATG_C_b38	RP11-206L10.9	-3.782	0.000208	-0.043051	13	0.011384	no	ADRNLG
chr1_806017_A_G_b38	RP11-206L10.9	3.743	0.00024	0.083088	5	0.022197	no	ADRNLG
chr1_819123_G_A_b38	RP11-206L10.9	-3.643	0.000347	-0.043592	16	0.011967	no	ADRNLG
chr1_819584_C_T_b38	RP11-206L10.9	-3.643	0.000347	-0.043592	16	0.011967	no	ADRNLG
chr1_794299_C_G_b38	RP11-206L10.9	-3.639	0.000352	-0.042852	18	0.011777	no	ADRNLG
chr1_818094_C_G_b38	RP11-206L10.9	-3.495	0.00059	-0.041646	21	0.011918	no	ADRNLG
chr1_817341_A_G_b38	RP11-206L10.9	-3.492	0.000595	-0.041558	19	0.0119	no	ADRNLG
chr1_825532_C_T_b38	RP11-206L10.9	-3.444	0.000704	-0.041921	12	0.012173	no	ADRNLG
chr1_825767_T_C_b38	RP11-206L10.9	-3.444	0.000704	-0.041921	12	0.012173	no	ADRNLG
chr1_826577_A_AT_b38	RP11-206L10.9	-3.444	0.000704	-0.041921	12	0.012173	no	ADRNLG
chr1_824320_T_C_b38	RP11-206L10.9	-3.435	0.000725	-0.041111	13	0.011967	no	ADRNLG
chr1_789568_TATGGA_T_b38	RP11-206L10.9	-3.269	0.00128	-0.037673	19	0.011525	no	ADRNLG
chr1_817186_G_A_b38	RP11-206L10.9	-3.268	0.00128	-0.039261	15	0.012014	no	ADRNLG
chr1_814476_C_T_b38	RP11-206L10.9	-3.249	0.00137	-0.039983	10	0.012306	no	ADRNLG
chr1_817514_T_C_b38	RP11-206L10.9	-3.158	0.00185	-0.037215	12	0.011786	no	ADRNLG
chr1_674381_A_AT_b38	RP11-206L10.9	3.067	0.00247	0.037785	10	0.012319	no	ADRNLG
chr1_591356_C_G_b38	RP11-206L10.9	2.953	0.00354	0.047045	5	0.015932	no	ADRNLG
chr1_771398_G_A_b38	RP11-206L10.9	-2.821	0.00529	-0.031543	30	0.011181	no	ADRNLG
chr1_598862_C_T_b38	RP11-206L10.9	2.814	0.0054	0.037695	4	0.013395	no	ADRNLG
chr1_1009731_C_T_b38	RP11-206L10.9	-2.736	0.0068	-0.050038	5	0.018287	no	ADRNLG
chr1_789481_G_A_b38	RP11-206L10.9	2.713	0.00728	0.040936	4	0.01509	no	ADRNLG
chr1_1257406_C_A_b38	RP11-206L10.9	2.684	0.00791	0.068011	3	0.025339	no	ADRNLG
chr1_110598_G_A_b38	RP11-206L10.9	-2.666	0.00833	-0.036465	4	0.013677	no	ADRNLG
chr1_624752_C_T_b38	RP11-206L10.9	2.642	0.00892	0.034664	3	0.013119	no	ADRNLG
chr1_1283510_G_C_b38	RP11-206L10.9	2.634	0.00912	0.050002	3	0.018982	no	ADRNLG
chr1_790933_CGAATGGAATG_C_b38	RP11-206L10.9	-5.465	9.42e-08	-0.059336	24	0.010858	yes	ARTAORT
chr1_1649932_C_T_b38	RP11-206L10.9	-3.652	0.000305	-0.033408	79	0.009149	yes	ARTAORT
chr1_1674633_C_CA_b38	RP11-206L10.9	-3.62	0.000344	-0.03617	38	0.009993	yes	ARTAORT
chr1_1432355_G_A_b38	RP11-206L10.9	3.465	0.000604	0.044287	16	0.012782	yes	ARTAORT
chr1_1668721_C_T_b38	RP11-206L10.9	3.35	0.000907	0.035704	26	0.010659	yes	ARTAORT
chr1_1636278_G_T_b38	RP11-206L10.9	-3.337	0.000949	-0.031742	65	0.009513	yes	ARTAORT
chr1_1648736_G_A_b38	RP11-206L10.9	-3.321	0.001	-0.030745	77	0.009258	yes	ARTAORT
chr1_1649976_G_A_b38	RP11-206L10.9	-3.319	0.00101	-0.031283	69	0.009424	yes	ARTAORT
chr1_1650777_G_A_b38	RP11-206L10.9	3.209	0.00147	0.031557	36	0.009832	yes	ARTAORT
chr1_1668108_C_T_b38	RP11-206L10.9	-3.131	0.0019	-0.031691	37	0.010121	yes	ARTAORT
chr1_1584235_A_AT_b38	RP11-206L10.9	3.129	0.00192	0.030799	53	0.009843	yes	ARTAORT
chr1_1657926_A_AG_b38	RP11-206L10.9	3.127	0.00193	0.037388	14	0.011956	yes	ARTAORT
chr1_1739131_T_C_b38	RP11-206L10.9	-3.115	0.00201	-0.028624	67	0.009189	yes	ARTAORT
chr1_1671797_G_A_b38	RP11-206L10.9	-3.106	0.00207	-0.027542	88	0.008867	yes	ARTAORT
chr1_1650195_A_G_b38	RP11-206L10.9	3.102	0.0021	0.031474	36	0.010147	yes	ARTAORT
chr1_1669576_G_A_b38	RP11-206L10.9	3.086	0.00221	0.035067	19	0.011365	yes	ARTAORT
chr1_1648636_G_A_b38	RP11-206L10.9	3.075	0.00229	0.03057	39	0.009943	yes	ARTAORT
chr1_1651137_C_T_b38	RP11-206L10.9	3.074	0.00229	0.030248	36	0.009838	yes	ARTAORT
chr1_1651267_T_C_b38	RP11-206L10.9	3.074	0.00229	0.030248	36	0.009838	yes	ARTAORT
chr1_1651785_C_A_b38	RP11-206L10.9	3.074	0.00229	0.030248	36	0.009838	yes	ARTAORT
chr1_1652061_T_C_b38	RP11-206L10.9	3.074	0.00229	0.030248	36	0.009838	yes	ARTAORT
chr1_1652135_C_G_b38	RP11-206L10.9	3.074	0.00229	0.030248	36	0.009838	yes	ARTAORT
chr1_1652191_C_T_b38	RP11-206L10.9	3.074	0.00229	0.030248	36	0.009838	yes	ARTAORT
chr1_1652592_A_G_b38	RP11-206L10.9	3.074	0.00229	0.030248	36	0.009838	yes	ARTAORT
chr1_1652779_A_G_b38	RP11-206L10.9	3.074	0.00229	0.030248	36	0.009838	yes	ARTAORT
chr1_1653147_A_C_b38	RP11-206L10.9	3.074	0.00229	0.030248	36	0.009838	yes	ARTAORT
chr1_1653396_T_C_b38	RP11-206L10.9	3.074	0.00229	0.030248	36	0.009838	yes	ARTAORT
chr1_1653472_T_C_b38	RP11-206L10.9	3.074	0.00229	0.030248	36	0.009838	yes	ARTAORT
chr1_1653811_G_A_b38	RP11-206L10.9	3.074	0.00229	0.030248	36	0.009838	yes	ARTAORT
chr1_1653893_C_T_b38	RP11-206L10.9	3.074	0.00229	0.030248	36	0.009838	yes	ARTAORT
chr1_1653934_G_A_b38	RP11-206L10.9	3.074	0.00229	0.030248	36	0.009838	yes	ARTAORT
chr1_1654143_G_A_b38	RP11-206L10.9	3.074	0.00229	0.030248	36	0.009838	yes	ARTAORT
chr1_1654188_T_G_b38	RP11-206L10.9	3.074	0.00229	0.030248	36	0.009838	yes	ARTAORT
chr1_1492939_C_CA_b38	RP11-206L10.9	-3.074	0.0023	-0.05707	7	0.018565	yes	ARTAORT
chr1_1659060_G_A_b38	RP11-206L10.9	3.073	0.0023	0.032139	27	0.010457	yes	ARTAORT
chr1_1659114_A_G_b38	RP11-206L10.9	3.064	0.00238	0.030345	37	0.009905	yes	ARTAORT
chr1_1659220_A_G_b38	RP11-206L10.9	3.064	0.00238	0.030345	37	0.009905	yes	ARTAORT
chr1_1671097_G_C_b38	RP11-206L10.9	-3.027	0.00268	-0.030365	39	0.010032	yes	ARTAORT
chr1_1651926_T_C_b38	RP11-206L10.9	3.005	0.00287	0.029605	36	0.009853	yes	ARTAORT
chr1_1668542_C_T_b38	RP11-206L10.9	3.004	0.00288	0.034605	17	0.011519	yes	ARTAORT
chr1_1651574_G_A_b38	RP11-206L10.9	3.004	0.00288	0.029475	36	0.009812	yes	ARTAORT
chr1_1664757_T_C_b38	RP11-206L10.9	2.989	0.00302	0.028819	35	0.009643	yes	ARTAORT
chr1_1658866_G_A_b38	RP11-206L10.9	2.984	0.00307	0.029408	38	0.009855	yes	ARTAORT
chr1_1437993_G_A_b38	RP11-206L10.9	2.975	0.00316	0.037436	14	0.012585	yes	ARTAORT
chr1_1651421_GTAGCCCCTCTGAACGGTCTGTGACACACGCATGCTTTCAGCTAGAGTACTCTA_G_b38	RP11-206L10.9	2.96	0.00331	0.029495	33	0.009965	yes	ARTAORT
chr1_1668717_C_G_b38	RP11-206L10.9	2.941	0.00351	0.033127	20	0.011265	yes	ARTAORT
chr1_1671148_C_T_b38	RP11-206L10.9	-2.926	0.00368	-0.029256	38	0.009997	yes	ARTAORT
chr1_1661420_C_A_b38	RP11-206L10.9	2.921	0.00375	0.029018	37	0.009936	yes	ARTAORT
chr1_1667948_A_G_b38	RP11-206L10.9	2.904	0.00394	0.033187	19	0.011428	yes	ARTAORT
chr1_1434687_C_G_b38	RP11-206L10.9	2.834	0.00489	0.037572	11	0.013258	yes	ARTAORT
chr1_1650383_G_T_b38	RP11-206L10.9	2.813	0.00521	0.029902	25	0.01063	yes	ARTAORT
chr1_1661177_A_G_b38	RP11-206L10.9	2.794	0.00552	0.030652	21	0.010969	yes	ARTAORT
chr1_1442793_G_A_b38	RP11-206L10.9	2.792	0.00555	0.036559	11	0.013093	yes	ARTAORT
chr1_1639685_G_A_b38	RP11-206L10.9	2.787	0.00564	0.030356	22	0.010891	yes	ARTAORT
chr1_1437955_C_G_b38	RP11-206L10.9	2.786	0.00566	0.028583	33	0.01026	yes	ARTAORT
chr1_1675091_A_G_b38	RP11-206L10.9	2.778	0.0058	0.03142	19	0.01131	yes	ARTAORT
chr1_1653863_C_A_b38	RP11-206L10.9	2.769	0.00596	0.032363	14	0.011689	yes	ARTAORT
chr1_1702383_T_C_b38	RP11-206L10.9	2.76	0.00612	0.029505	22	0.01069	yes	ARTAORT
chr1_1479719_T_C_b38	RP11-206L10.9	2.743	0.00643	0.033728	47	0.012296	yes	ARTAORT
chr1_1431813_G_T_b38	RP11-206L10.9	2.735	0.0066	0.034959	13	0.012783	yes	ARTAORT
chr1_1669613_G_A_b38	RP11-206L10.9	2.73	0.00669	0.030726	20	0.011256	yes	ARTAORT
chr1_1648826_A_G_b38	RP11-206L10.9	2.715	0.00699	0.027033	39	0.009957	yes	ARTAORT
chr1_1586962_C_T_b38	RP11-206L10.9	-2.694	0.00743	-0.027153	38	0.010078	yes	ARTAORT
chr1_1650370_C_CT_b38	RP11-206L10.9	2.679	0.00776	0.03342	15	0.012473	yes	ARTAORT
chr1_285109_CA_C_b38	RP11-206L10.9	-2.672	0.00792	-0.04259	4	0.015937	yes	ARTAORT
chr1_1435945_C_CCGGGCGGGGGCG_b38	RP11-206L10.9	2.664	0.00812	0.035317	11	0.013257	yes	ARTAORT
chr1_1660683_C_T_b38	RP11-206L10.9	2.657	0.00829	0.028431	26	0.010701	yes	ARTAORT
chr1_1240580_G_GC_b38	RP11-206L10.9	2.656	0.00831	0.038718	4	0.014579	yes	ARTAORT
chr1_1665061_C_T_b38	RP11-206L10.9	2.642	0.00866	0.028999	21	0.010977	yes	ARTAORT
chr1_1053123_A_T_b38	RP11-206L10.9	2.636	0.0088	0.034895	14	0.013236	yes	ARTAORT
chr1_185194_G_C_b38	RP11-206L10.9	2.636	0.00881	0.050374	9	0.019112	yes	ARTAORT
chr1_1562444_C_T_b38	RP11-206L10.9	2.634	0.00886	0.039197	5	0.014882	yes	ARTAORT
chr1_1665581_C_G_b38	RP11-206L10.9	2.599	0.00979	0.028263	23	0.010875	yes	ARTAORT
chr1_1586987_G_A_b38	RP11-206L10.9	2.598	0.00981	0.025079	54	0.009652	yes	ARTAORT
chr1_182095_T_C_b38	RP11-206L10.9	2.592	0.00998	0.035437	41	0.013671	yes	ARTAORT
chr1_788418_CAG_C_b38	RP11-206L10.9	-9.331	1.91e-18	-0.141238	7	0.015136	no	ARTAORT
chr1_800605_G_A_b38	RP11-206L10.9	9.114	9.37e-18	0.1381	7	0.015152	no	ARTAORT
chr1_778639_A_G_b38	RP11-206L10.9	9.088	1.13e-17	0.138018	7	0.015186	no	ARTAORT
chr1_788439_T_A_b38	RP11-206L10.9	8.977	2.55e-17	0.136598	6	0.015217	no	ARTAORT
chr1_779047_G_A_b38	RP11-206L10.9	-8.6	3.78e-16	-0.128846	13	0.014982	no	ARTAORT
chr1_788511_G_C_b38	RP11-206L10.9	-8.554	5.2e-16	-0.128962	11	0.015075	no	ARTAORT
chr1_809641_G_T_b38	RP11-206L10.9	8.432	1.23e-15	0.127167	10	0.015082	no	ARTAORT
chr1_677378_T_C_b38	RP11-206L10.9	8.37	1.89e-15	0.140501	3	0.016786	no	ARTAORT
chr1_777135_T_TC_b38	RP11-206L10.9	8.088	1.31e-14	0.13074	6	0.016164	no	ARTAORT
chr1_677290_A_G_b38	RP11-206L10.9	7.73	1.45e-13	0.134954	3	0.017459	no	ARTAORT
chr1_783406_A_AT_b38	RP11-206L10.9	7.515	5.92e-13	0.115065	3	0.015312	no	ARTAORT
chr1_812899_A_T_b38	RP11-206L10.9	6.972	1.83e-11	0.115046	10	0.016501	no	ARTAORT
chr1_812761_G_A_b38	RP11-206L10.9	6.898	2.88e-11	0.116165	6	0.01684	no	ARTAORT
chr1_784109_C_CATAAT_b38	RP11-206L10.9	6.604	1.69e-10	0.112425	6	0.017023	no	ARTAORT
chr1_683167_G_A_b38	RP11-206L10.9	6.021	4.82e-09	0.089336	5	0.014839	no	ARTAORT
chr1_818094_C_G_b38	RP11-206L10.9	-5.091	6.14e-07	-0.061343	27	0.01205	no	ARTAORT
chr1_820560_C_T_b38	RP11-206L10.9	-5.061	7.1e-07	-0.0588	12	0.011618	no	ARTAORT
chr1_808924_C_T_b38	RP11-206L10.9	-5.008	9.18e-07	-0.063858	10	0.012752	no	ARTAORT
chr1_800909_T_A_b38	RP11-206L10.9	4.939	1.27e-06	0.062343	5	0.012623	no	ARTAORT
chr1_817341_A_G_b38	RP11-206L10.9	-4.792	2.55e-06	-0.057534	20	0.012007	no	ARTAORT
chr1_794299_C_G_b38	RP11-206L10.9	-4.764	2.9e-06	-0.057604	26	0.012092	no	ARTAORT
chr1_817186_G_A_b38	RP11-206L10.9	-4.743	3.19e-06	-0.057354	12	0.012092	no	ARTAORT
chr1_814476_C_T_b38	RP11-206L10.9	-4.727	3.44e-06	-0.05617	15	0.011883	no	ARTAORT
chr1_819584_C_T_b38	RP11-206L10.9	-4.619	5.62e-06	-0.055967	16	0.012117	no	ARTAORT
chr1_789568_TATGGA_T_b38	RP11-206L10.9	-4.612	5.8e-06	-0.055118	28	0.011951	no	ARTAORT
chr1_826577_A_AT_b38	RP11-206L10.9	-4.575	6.84e-06	-0.056236	8	0.012291	no	ARTAORT
chr1_825532_C_T_b38	RP11-206L10.9	-4.537	8.13e-06	-0.055913	8	0.012325	no	ARTAORT
chr1_825767_T_C_b38	RP11-206L10.9	-4.537	8.13e-06	-0.055913	8	0.012325	no	ARTAORT
chr1_819123_G_A_b38	RP11-206L10.9	-4.498	9.66e-06	-0.054102	16	0.012029	no	ARTAORT
chr1_817514_T_C_b38	RP11-206L10.9	-4.418	1.37e-05	-0.05135	12	0.011624	no	ARTAORT
chr1_813498_G_T_b38	RP11-206L10.9	-4.416	1.38e-05	-0.051701	20	0.011708	no	ARTAORT
chr1_824320_T_C_b38	RP11-206L10.9	-4.348	1.86e-05	-0.052834	10	0.012152	no	ARTAORT
chr1_799082_G_A_b38	RP11-206L10.9	-4.026	7.12e-05	-0.055284	6	0.013733	no	ARTAORT
chr1_1650664_CTTTTT_C_b38	RP11-206L10.9	3.905	0.000115	0.045193	17	0.011572	no	ARTAORT
chr1_598862_C_T_b38	RP11-206L10.9	3.879	0.000128	0.049284	4	0.012707	no	ARTAORT
chr1_806017_A_G_b38	RP11-206L10.9	3.869	0.000133	0.082979	9	0.02145	no	ARTAORT
chr1_771398_G_A_b38	RP11-206L10.9	-3.782	0.000186	-0.042515	52	0.011242	no	ARTAORT
chr1_1670423_AT_A_b38	RP11-206L10.9	-3.742	0.000217	-0.038694	49	0.01034	no	ARTAORT
chr1_821000_T_A_b38	RP11-206L10.9	-3.708	0.000247	-0.044866	8	0.0121	no	ARTAORT
chr1_680812_T_C_b38	RP11-206L10.9	-3.509	0.000514	-0.042148	10	0.01201	no	ARTAORT
chr1_1667424_T_TAAAATA_b38	RP11-206L10.9	-3.309	0.00104	-0.03225	48	0.009745	no	ARTAORT
chr1_826420_A_T_b38	RP11-206L10.9	-3.25	0.00128	-0.031331	44	0.009641	no	ARTAORT
chr1_1651653_C_T_b38	RP11-206L10.9	-3.22	0.00142	-0.028777	89	0.008937	no	ARTAORT
chr1_1652913_C_T_b38	RP11-206L10.9	3.118	0.00199	0.032709	26	0.010489	no	ARTAORT
chr1_1646352_A_C_b38	RP11-206L10.9	-3.117	0.002	-0.041324	8	0.013259	no	ARTAORT
chr1_799080_TG_T_b38	RP11-206L10.9	3.102	0.00209	0.035216	19	0.011351	no	ARTAORT
chr1_1650688_T_A_b38	RP11-206L10.9	3.093	0.00216	0.03257	27	0.010531	no	ARTAORT
chr1_1654662_CT_C_b38	RP11-206L10.9	-3.084	0.00222	-0.030322	60	0.009831	no	ARTAORT
chr1_1611570_CTT_C_b38	RP11-206L10.9	3.05	0.00248	0.073273	3	0.02402	no	ARTAORT
chr1_807692_C_A_b38	RP11-206L10.9	-3.041	0.00255	-0.058936	7	0.019378	no	ARTAORT
chr1_1667424_T_TAAATA_b38	RP11-206L10.9	3.03	0.00265	0.028484	59	0.009401	no	ARTAORT
chr1_186209_T_C_b38	RP11-206L10.9	2.997	0.00294	0.041949	25	0.013997	no	ARTAORT
chr1_1425750_T_C_b38	RP11-206L10.9	-2.99	0.00301	-0.050449	5	0.016874	no	ARTAORT
chr1_1521298_C_CAA_b38	RP11-206L10.9	-2.989	0.00302	-0.072596	4	0.024285	no	ARTAORT
chr1_1425135_T_C_b38	RP11-206L10.9	-2.987	0.00304	-0.051502	5	0.017244	no	ARTAORT
chr1_696963_C_G_b38	RP11-206L10.9	2.985	0.00306	0.064006	7	0.021445	no	ARTAORT
chr1_1588220_CT_C_b38	RP11-206L10.9	2.959	0.00331	0.031523	34	0.010652	no	ARTAORT
chr1_1639348_G_T_b38	RP11-206L10.9	2.95	0.00342	0.02854	43	0.009676	no	ARTAORT
chr1_1425936_G_A_b38	RP11-206L10.9	-2.947	0.00345	-0.050366	4	0.017092	no	ARTAORT
chr1_1590682_T_C_b38	RP11-206L10.9	2.938	0.00354	0.027988	55	0.009525	no	ARTAORT
chr1_1673060_G_A_b38	RP11-206L10.9	-2.935	0.00358	-0.026363	89	0.008982	no	ARTAORT
chr1_1658830_C_G_b38	RP11-206L10.9	2.917	0.00379	0.031631	21	0.010843	no	ARTAORT
chr1_1708474_C_A_b38	RP11-206L10.9	2.9	0.00399	0.034552	11	0.011914	no	ARTAORT
chr1_189771_T_C_b38	RP11-206L10.9	2.858	0.00454	0.043531	16	0.01523	no	ARTAORT
chr1_1674868_G_A_b38	RP11-206L10.9	-2.852	0.00463	-0.025324	89	0.008878	no	ARTAORT
chr1_1673818_A_C_b38	RP11-206L10.9	-2.827	0.005	-0.02527	90	0.008939	no	ARTAORT
chr1_1674720_TGC_T_b38	RP11-206L10.9	-2.813	0.00521	-0.025027	88	0.008896	no	ARTAORT
chr1_1621352_G_A_b38	RP11-206L10.9	-2.786	0.00565	-0.027002	41	0.009691	no	ARTAORT
chr1_1671995_G_T_b38	RP11-206L10.9	-2.786	0.00566	-0.024664	89	0.008854	no	ARTAORT
chr1_182903_C_G_b38	RP11-206L10.9	2.784	0.00569	0.038364	17	0.01378	no	ARTAORT
chr1_206074_T_C_b38	RP11-206L10.9	2.783	0.00572	0.029643	37	0.010653	no	ARTAORT
chr1_1677720_T_G_b38	RP11-206L10.9	-2.749	0.00633	-0.024186	91	0.008799	no	ARTAORT
chr1_1548572_A_AC_b38	RP11-206L10.9	2.734	0.00662	0.068146	4	0.024929	no	ARTAORT
chr1_1677726_A_T_b38	RP11-206L10.9	-2.732	0.00665	-0.02411	91	0.008825	no	ARTAORT
chr1_814773_T_C_b38	RP11-206L10.9	2.718	0.00693	0.033599	6	0.012362	no	ARTAORT
chr1_1725745_C_G_b38	RP11-206L10.9	2.698	0.00736	0.030734	20	0.011393	no	ARTAORT
chr1_1708521_C_G_b38	RP11-206L10.9	2.697	0.00737	0.028485	26	0.010562	no	ARTAORT
chr1_98929_A_G_b38	RP11-206L10.9	2.693	0.00746	0.04168	3	0.015477	no	ARTAORT
chr1_1613769_C_T_b38	RP11-206L10.9	-2.688	0.00757	-0.027135	39	0.010096	no	ARTAORT
chr1_1661562_G_C_b38	RP11-206L10.9	-2.681	0.00774	-0.022483	90	0.008387	no	ARTAORT
chr1_1441187_A_G_b38	RP11-206L10.9	2.676	0.00783	0.033369	28	0.012469	no	ARTAORT
chr1_1624323_AT_A_b38	RP11-206L10.9	-2.666	0.00807	-0.024306	68	0.009117	no	ARTAORT
chr1_1589491_A_G_b38	RP11-206L10.9	2.662	0.00815	0.025435	54	0.009553	no	ARTAORT
chr1_1427080_C_T_b38	RP11-206L10.9	-2.661	0.00818	-0.04561	4	0.017137	no	ARTAORT
chr1_1425822_C_G_b38	RP11-206L10.9	-2.656	0.0083	-0.045391	4	0.017089	no	ARTAORT
chr1_1589151_C_T_b38	RP11-206L10.9	2.653	0.00837	0.026043	50	0.009815	no	ARTAORT
chr1_1622295_G_C_b38	RP11-206L10.9	-2.645	0.00859	-0.025731	41	0.00973	no	ARTAORT
chr1_1589057_T_C_b38	RP11-206L10.9	2.609	0.00951	0.025937	50	0.00994	no	ARTAORT
chr1_1660408_T_C_b38	RP11-206L10.9	2.597	0.00983	0.031294	10	0.012048	no	ARTAORT
chr1_820560_C_T_b38	RP11-206L10.9	-5.278	3.91e-07	-0.090693	10	0.017185	yes	ARTCRN
chr1_814773_T_C_b38	RP11-206L10.9	3.499	0.000595	0.062737	5	0.017932	yes	ARTCRN
chr1_814617_A_G_b38	RP11-206L10.9	-3.009	0.00301	-0.048925	15	0.016257	yes	ARTCRN
chr1_791564_C_G_b38	RP11-206L10.9	-2.847	0.00495	-0.047862	21	0.01681	yes	ARTCRN
chr1_1412042_ATCTAGGTCCCAGGTCCCAGGTCCGTCTAGGTCCCAGGTCCG_A_b38	RP11-206L10.9	2.822	0.00534	0.078608	4	0.027856	yes	ARTCRN
chr1_1086657_C_T_b38	RP11-206L10.9	2.774	0.00615	0.037625	45	0.013565	yes	ARTCRN
chr1_1661562_G_C_b38	RP11-206L10.9	-2.77	0.00622	-0.036013	46	0.013	yes	ARTCRN
chr1_1153012_T_C_b38	RP11-206L10.9	-2.747	0.00665	-0.084489	3	0.030753	yes	ARTCRN
chr1_127909_G_A_b38	RP11-206L10.9	2.741	0.00678	0.051533	7	0.018803	yes	ARTCRN
chr1_771398_G_A_b38	RP11-206L10.9	-2.664	0.00846	-0.044634	28	0.016756	yes	ARTCRN
chr1_1530595_C_T_b38	RP11-206L10.9	2.632	0.00927	0.094545	3	0.035926	yes	ARTCRN
chr1_1530598_G_A_b38	RP11-206L10.9	2.632	0.00927	0.094545	3	0.035926	yes	ARTCRN
chr1_1595740_G_GAGAGAGAC_b38	RP11-206L10.9	2.628	0.00935	0.054792	4	0.020846	yes	ARTCRN
chr1_1074443_G_A_b38	RP11-206L10.9	-2.624	0.00947	-0.046001	7	0.01753	yes	ARTCRN
chr1_1657926_A_AG_b38	RP11-206L10.9	2.62	0.00959	0.044226	12	0.016883	yes	ARTCRN
chr1_800605_G_A_b38	RP11-206L10.9	5.885	2.03e-08	0.137633	3	0.023387	no	ARTCRN
chr1_788418_CAG_C_b38	RP11-206L10.9	-5.544	1.09e-07	-0.131012	3	0.023631	no	ARTCRN
chr1_778639_A_G_b38	RP11-206L10.9	5.452	1.71e-07	0.127956	3	0.023472	no	ARTCRN
chr1_788439_T_A_b38	RP11-206L10.9	5.452	1.71e-07	0.127956	3	0.023472	no	ARTCRN
chr1_809641_G_T_b38	RP11-206L10.9	5.101	8.86e-07	0.115416	5	0.022626	no	ARTCRN
chr1_788511_G_C_b38	RP11-206L10.9	-5.024	1.26e-06	-0.113228	6	0.022537	no	ARTCRN
chr1_779047_G_A_b38	RP11-206L10.9	-4.957	1.71e-06	-0.113822	6	0.022964	no	ARTCRN
chr1_817514_T_C_b38	RP11-206L10.9	-4.854	2.7e-06	-0.087319	6	0.017989	no	ARTCRN
chr1_812761_G_A_b38	RP11-206L10.9	4.677	5.87e-06	0.116789	3	0.024973	no	ARTCRN
chr1_825532_C_T_b38	RP11-206L10.9	-4.674	5.94e-06	-0.08547	7	0.018286	no	ARTCRN
chr1_825767_T_C_b38	RP11-206L10.9	-4.674	5.94e-06	-0.08547	7	0.018286	no	ARTCRN
chr1_817186_G_A_b38	RP11-206L10.9	-4.64	6.86e-06	-0.085656	8	0.018458	no	ARTCRN
chr1_813498_G_T_b38	RP11-206L10.9	-4.519	1.15e-05	-0.078556	8	0.017383	no	ARTCRN
chr1_824320_T_C_b38	RP11-206L10.9	-4.481	1.35e-05	-0.080351	8	0.01793	no	ARTCRN
chr1_819584_C_T_b38	RP11-206L10.9	-4.432	1.66e-05	-0.081196	10	0.01832	no	ARTCRN
chr1_826577_A_AT_b38	RP11-206L10.9	-4.418	1.75e-05	-0.07799	9	0.017651	no	ARTCRN
chr1_819123_G_A_b38	RP11-206L10.9	-4.287	3.01e-05	-0.077995	10	0.018194	no	ARTCRN
chr1_817341_A_G_b38	RP11-206L10.9	-4.276	3.15e-05	-0.078887	11	0.01845	no	ARTCRN
chr1_784109_C_CATAAT_b38	RP11-206L10.9	4.255	3.42e-05	0.108179	3	0.025422	no	ARTCRN
chr1_794299_C_G_b38	RP11-206L10.9	-4.185	4.54e-05	-0.076394	14	0.018254	no	ARTCRN
chr1_799080_TG_T_b38	RP11-206L10.9	4.101	6.33e-05	0.065344	13	0.015933	no	ARTCRN
chr1_789568_TATGGA_T_b38	RP11-206L10.9	-4.093	6.54e-05	-0.073468	14	0.017951	no	ARTCRN
chr1_818094_C_G_b38	RP11-206L10.9	-3.947	0.000115	-0.073952	15	0.018737	no	ARTCRN
chr1_812899_A_T_b38	RP11-206L10.9	3.707	0.000282	0.095202	5	0.02568	no	ARTCRN
chr1_826420_A_T_b38	RP11-206L10.9	-3.648	0.00035	-0.054882	20	0.015045	no	ARTCRN
chr1_275583_T_TTTTA_b38	RP11-206L10.9	-3.571	0.000462	-0.060401	12	0.016916	no	ARTCRN
chr1_808924_C_T_b38	RP11-206L10.9	-3.125	0.00209	-0.060622	5	0.019401	no	ARTCRN
chr1_180958_CCCCTAA_C_b38	RP11-206L10.9	-3.056	0.0026	-0.045696	23	0.014951	no	ARTCRN
chr1_13417_C_CGAGA_b38	RP11-206L10.9	2.903	0.00418	0.052838	11	0.0182	no	ARTCRN
chr1_791545_G_T_b38	RP11-206L10.9	-2.824	0.0053	-0.068322	6	0.024194	no	ARTCRN
chr1_800605_G_A_b38	RP11-206L10.9	12	2.06e-29	0.149444	9	0.012454	yes	ARTTBL
chr1_677378_T_C_b38	RP11-206L10.9	11.825	1.06e-28	0.158717	5	0.013422	yes	ARTTBL
chr1_683167_G_A_b38	RP11-206L10.9	8.694	4.75e-17	0.102863	7	0.011832	yes	ARTTBL
chr1_820560_C_T_b38	RP11-206L10.9	-7.917	1.51e-14	-0.074748	29	0.009441	yes	ARTTBL
chr1_826577_A_AT_b38	RP11-206L10.9	-7.8	3.48e-14	-0.075265	26	0.009649	yes	ARTTBL
chr1_825532_C_T_b38	RP11-206L10.9	-7.775	4.17e-14	-0.076552	23	0.009847	yes	ARTTBL
chr1_825767_T_C_b38	RP11-206L10.9	-7.775	4.17e-14	-0.076552	23	0.009847	yes	ARTTBL
chr1_824320_T_C_b38	RP11-206L10.9	-7.603	1.39e-13	-0.07401	25	0.009734	yes	ARTTBL
chr1_598854_C_T_b38	RP11-206L10.9	7.25	1.54e-12	0.117126	3	0.016155	yes	ARTTBL
chr1_624836_G_A_b38	RP11-206L10.9	7.121	3.64e-12	0.143831	3	0.020198	yes	ARTTBL
chr1_822427_CCCTGGCCAGCAGATCCACCCTGTCTATACTACCTG_C_b38	RP11-206L10.9	-5.914	6.11e-09	-0.055639	30	0.009408	yes	ARTTBL
chr1_771398_G_A_b38	RP11-206L10.9	-5.424	9.02e-08	-0.04882	84	0.009001	yes	ARTTBL
chr1_807808_G_A_b38	RP11-206L10.9	5.165	3.45e-07	0.116698	5	0.022596	yes	ARTTBL
chr1_790933_CGAATGGAATG_C_b38	RP11-206L10.9	-5.108	4.6e-07	-0.045563	44	0.00892	yes	ARTTBL
chr1_799082_G_A_b38	RP11-206L10.9	-4.96	9.6e-07	-0.054754	12	0.011039	yes	ARTTBL
chr1_98929_A_G_b38	RP11-206L10.9	4.944	1.04e-06	0.060687	8	0.012275	yes	ARTTBL
chr1_791564_C_G_b38	RP11-206L10.9	-4.887	1.37e-06	-0.045278	64	0.009266	yes	ARTTBL
chr1_814773_T_C_b38	RP11-206L10.9	4.697	3.39e-06	0.049452	8	0.010528	yes	ARTTBL
chr1_821000_T_A_b38	RP11-206L10.9	-4.077	5.29e-05	-0.04033	25	0.009892	yes	ARTTBL
chr1_607860_C_A_b38	RP11-206L10.9	3.5	0.000505	0.038562	3	0.011017	yes	ARTTBL
chr1_1461195_T_TC_b38	RP11-206L10.9	3.345	0.000884	0.057197	11	0.017102	yes	ARTTBL
chr1_1635226_T_C_b38	RP11-206L10.9	3.231	0.00131	0.03451	14	0.010682	yes	ARTTBL
chr1_1495221_G_A_b38	RP11-206L10.9	3.179	0.00157	0.054639	10	0.017189	yes	ARTTBL
chr1_1495222_T_G_b38	RP11-206L10.9	3.179	0.00157	0.054639	10	0.017189	yes	ARTTBL
chr1_1131008_C_CT_b38	RP11-206L10.9	-3.028	0.00259	-0.02417	112	0.007983	yes	ARTTBL
chr1_820395_A_G_b38	RP11-206L10.9	-3.026	0.00261	-0.031035	23	0.010257	yes	ARTTBL
chr1_1495205_G_A_b38	RP11-206L10.9	3.006	0.00278	0.054075	7	0.01799	yes	ARTTBL
chr1_1131572_A_G_b38	RP11-206L10.9	-2.993	0.0029	-0.024133	118	0.008063	yes	ARTTBL
chr1_1131573_T_C_b38	RP11-206L10.9	-2.993	0.0029	-0.024133	118	0.008063	yes	ARTTBL
chr1_927758_A_C_b38	RP11-206L10.9	2.987	0.00296	0.071776	3	0.024033	yes	ARTTBL
chr1_1133289_GT_G_b38	RP11-206L10.9	-2.94	0.00343	-0.0235	111	0.007993	yes	ARTTBL
chr1_875400_G_C_b38	RP11-206L10.9	2.92	0.00366	0.034464	10	0.011804	yes	ARTTBL
chr1_1041126_AGCGGGGGC_A_b38	RP11-206L10.9	2.89	0.00402	0.018182	47	0.006291	yes	ARTTBL
chr1_612402_C_T_b38	RP11-206L10.9	-2.874	0.00422	-0.046678	3	0.016239	yes	ARTTBL
chr1_1763634_AAG_A_b38	RP11-206L10.9	2.859	0.00442	0.024468	120	0.008557	yes	ARTTBL
chr1_1641342_C_A_b38	RP11-206L10.9	2.826	0.0049	0.086314	4	0.030545	yes	ARTTBL
chr1_598862_C_T_b38	RP11-206L10.9	2.783	0.00559	0.029792	7	0.010706	yes	ARTTBL
chr1_673518_C_T_b38	RP11-206L10.9	-2.774	0.00573	-0.027866	15	0.010044	yes	ARTTBL
chr1_866664_G_A_b38	RP11-206L10.9	-2.768	0.00584	-0.037915	19	0.013696	yes	ARTTBL
chr1_1131566_A_G_b38	RP11-206L10.9	-2.768	0.00585	-0.022114	112	0.007989	yes	ARTTBL
chr1_1586956_T_C_b38	RP11-206L10.9	2.748	0.0062	0.022965	63	0.008356	yes	ARTTBL
chr1_876340_CCCCACGCTCCCCCATACTCG_C_b38	RP11-206L10.9	2.748	0.00622	0.054388	9	0.019795	yes	ARTTBL
chr1_813885_G_A_b38	RP11-206L10.9	-2.747	0.00622	-0.022587	128	0.008221	yes	ARTTBL
chr1_681082_T_C_b38	RP11-206L10.9	-2.708	0.007	-0.027464	19	0.010143	yes	ARTTBL
chr1_1137233_C_G_b38	RP11-206L10.9	2.612	0.00928	0.022025	67	0.008434	yes	ARTTBL
chr1_1537805_T_G_b38	RP11-206L10.9	-2.609	0.00934	-0.059884	5	0.02295	yes	ARTTBL
chr1_739041_A_T_b38	RP11-206L10.9	2.601	0.00956	0.039399	5	0.015146	yes	ARTTBL
chr1_1120024_C_CA_b38	RP11-206L10.9	2.598	0.00964	0.039349	9	0.015145	yes	ARTTBL
chr1_1586987_G_A_b38	RP11-206L10.9	2.594	0.00976	0.021804	62	0.008405	yes	ARTTBL
chr1_1288336_T_C_b38	RP11-206L10.9	2.593	0.00979	0.06221	4	0.023994	yes	ARTTBL
chr1_677290_A_G_b38	RP11-206L10.9	12.004	1.99e-29	0.166113	5	0.013839	no	ARTTBL
chr1_777382_T_G_b38	RP11-206L10.9	11.768	1.82e-28	0.154088	3	0.013094	no	ARTTBL
chr1_778639_A_G_b38	RP11-206L10.9	11.751	2.12e-28	0.146077	10	0.012431	no	ARTTBL
chr1_788439_T_A_b38	RP11-206L10.9	11.554	1.33e-27	0.144643	9	0.012519	no	ARTTBL
chr1_788418_CAG_C_b38	RP11-206L10.9	-11.342	9.28e-27	-0.140505	11	0.012388	no	ARTTBL
chr1_809641_G_T_b38	RP11-206L10.9	11.297	1.4e-26	0.138138	12	0.012228	no	ARTTBL
chr1_788511_G_C_b38	RP11-206L10.9	-10.4	4.08e-23	-0.128623	15	0.012368	no	ARTTBL
chr1_779047_G_A_b38	RP11-206L10.9	-10.049	8.3e-22	-0.125486	17	0.012488	no	ARTTBL
chr1_681103_T_A_b38	RP11-206L10.9	9.895	3.04e-21	0.158783	3	0.016047	no	ARTTBL
chr1_783406_A_AT_b38	RP11-206L10.9	9.764	9.05e-21	0.121113	5	0.012404	no	ARTTBL
chr1_777135_T_TC_b38	RP11-206L10.9	9.196	9.3e-19	0.129621	8	0.014095	no	ARTTBL
chr1_812899_A_T_b38	RP11-206L10.9	9.139	1.46e-18	0.121023	14	0.013242	no	ARTTBL
chr1_784109_C_CATAAT_b38	RP11-206L10.9	8.987	4.89e-18	0.127099	9	0.014143	no	ARTTBL
chr1_800909_T_A_b38	RP11-206L10.9	8.39	4.76e-16	0.087425	6	0.010421	no	ARTTBL
chr1_819584_C_T_b38	RP11-206L10.9	-7.659	9.4e-14	-0.074759	34	0.009761	no	ARTTBL
chr1_817186_G_A_b38	RP11-206L10.9	-7.654	9.75e-14	-0.075568	28	0.009873	no	ARTTBL
chr1_819123_G_A_b38	RP11-206L10.9	-7.634	1.12e-13	-0.074105	34	0.009708	no	ARTTBL
chr1_817514_T_C_b38	RP11-206L10.9	-7.569	1.76e-13	-0.073198	22	0.009671	no	ARTTBL
chr1_817341_A_G_b38	RP11-206L10.9	-7.561	1.86e-13	-0.07384	38	0.009766	no	ARTTBL
chr1_789568_TATGGA_T_b38	RP11-206L10.9	-7.531	2.28e-13	-0.071772	48	0.00953	no	ARTTBL
chr1_812761_G_A_b38	RP11-206L10.9	7.416	5.03e-13	0.103631	9	0.013974	no	ARTTBL
chr1_794299_C_G_b38	RP11-206L10.9	-7.325	9.3e-13	-0.071555	40	0.009768	no	ARTTBL
chr1_668125_A_C_b38	RP11-206L10.9	7.319	9.71e-13	0.180346	3	0.024641	no	ARTTBL
chr1_818094_C_G_b38	RP11-206L10.9	-7.203	2.11e-12	-0.070463	50	0.009782	no	ARTTBL
chr1_814476_C_T_b38	RP11-206L10.9	-6.191	1.22e-09	-0.061508	33	0.009935	no	ARTTBL
chr1_813498_G_T_b38	RP11-206L10.9	-5.484	6.53e-08	-0.051978	40	0.009478	no	ARTTBL
chr1_826420_A_T_b38	RP11-206L10.9	-5.439	8.33e-08	-0.045307	63	0.008331	no	ARTTBL
chr1_808924_C_T_b38	RP11-206L10.9	-5.289	1.83e-07	-0.0562	12	0.010626	no	ARTTBL
chr1_806017_A_G_b38	RP11-206L10.9	4.695	3.43e-06	0.07824	12	0.016665	no	ARTTBL
chr1_799080_TG_T_b38	RP11-206L10.9	4.432	1.14e-05	0.040695	34	0.009183	no	ARTTBL
chr1_807692_C_A_b38	RP11-206L10.9	-4.039	6.18e-05	-0.063623	11	0.015751	no	ARTTBL
chr1_814617_A_G_b38	RP11-206L10.9	-3.659	0.00028	-0.029978	63	0.008194	no	ARTTBL
chr1_788757_T_TAATGG_b38	RP11-206L10.9	-3.596	0.000355	-0.026653	123	0.007412	no	ARTTBL
chr1_680812_T_C_b38	RP11-206L10.9	-3.561	0.000404	-0.036673	15	0.010298	no	ARTTBL
chr1_921797_T_C_b38	RP11-206L10.9	3.529	0.000454	0.058938	17	0.0167	no	ARTTBL
chr1_823246_C_T_b38	RP11-206L10.9	-3.332	0.000926	-0.035251	23	0.010581	no	ARTTBL
chr1_131281_C_G_b38	RP11-206L10.9	3.205	0.00144	0.040375	6	0.012599	no	ARTTBL
chr1_822556_C_A_b38	RP11-206L10.9	-3.159	0.00167	-0.033876	23	0.010722	no	ARTTBL
chr1_1131023_T_C_b38	RP11-206L10.9	-3.058	0.00234	-0.02406	112	0.007867	no	ARTTBL
chr1_1163041_C_T_b38	RP11-206L10.9	-2.947	0.00335	-0.022685	151	0.007697	no	ARTTBL
chr1_739151_G_A_b38	RP11-206L10.9	2.938	0.00345	0.081164	3	0.027628	no	ARTTBL
chr1_1132294_T_TGG_b38	RP11-206L10.9	-2.931	0.00353	-0.023374	101	0.007975	no	ARTTBL
chr1_1114143_C_A_b38	RP11-206L10.9	2.927	0.00357	0.045122	16	0.015416	no	ARTTBL
chr1_1102614_TAAAAAAAAA_T_b38	RP11-206L10.9	2.869	0.00428	0.056155	6	0.01957	no	ARTTBL
chr1_1041119_GGGC_G_b38	RP11-206L10.9	2.869	0.00429	0.017575	40	0.006126	no	ARTTBL
chr1_855085_G_A_b38	RP11-206L10.9	2.86	0.00441	0.03459	6	0.012096	no	ARTTBL
chr1_1115166_G_GT_b38	RP11-206L10.9	2.858	0.00444	0.04388	17	0.015354	no	ARTTBL
chr1_1132216_CAG_C_b38	RP11-206L10.9	-2.84	0.00469	-0.022774	104	0.008019	no	ARTTBL
chr1_1116992_A_G_b38	RP11-206L10.9	2.829	0.00485	0.044033	17	0.015566	no	ARTTBL
chr1_933653_C_T_b38	RP11-206L10.9	2.817	0.00504	0.070822	3	0.025145	no	ARTTBL
chr1_924024_C_G_b38	RP11-206L10.9	-2.8	0.0053	-0.045249	31	0.01616	no	ARTTBL
chr1_1134063_G_A_b38	RP11-206L10.9	-2.782	0.0056	-0.021794	112	0.007834	no	ARTTBL
chr1_818469_G_T_b38	RP11-206L10.9	-2.77	0.00581	-0.027464	41	0.009915	no	ARTTBL
chr1_1134045_C_A_b38	RP11-206L10.9	-2.766	0.00588	-0.021649	113	0.007827	no	ARTTBL
chr1_1163334_C_G_b38	RP11-206L10.9	-2.766	0.00589	-0.021027	139	0.007603	no	ARTTBL
chr1_925474_T_C_b38	RP11-206L10.9	-2.757	0.00605	-0.06526	3	0.023673	no	ARTTBL
chr1_1130649_G_A_b38	RP11-206L10.9	-2.751	0.00614	-0.043543	4	0.015825	no	ARTTBL
chr1_928483_G_A_b38	RP11-206L10.9	2.747	0.00623	0.046595	16	0.016965	no	ARTTBL
chr1_818464_CCT_C_b38	RP11-206L10.9	-2.745	0.00625	-0.027018	42	0.009841	no	ARTTBL
chr1_1118779_C_T_b38	RP11-206L10.9	2.724	0.00667	0.043469	14	0.015958	no	ARTTBL
chr1_1118835_A_G_b38	RP11-206L10.9	2.724	0.00667	0.043469	14	0.015958	no	ARTTBL
chr1_1119363_C_G_b38	RP11-206L10.9	2.724	0.00667	0.043469	14	0.015958	no	ARTTBL
chr1_1288318_C_T_b38	RP11-206L10.9	2.717	0.00682	0.07339	3	0.027015	no	ARTTBL
chr1_1134222_T_C_b38	RP11-206L10.9	2.691	0.00736	0.022229	61	0.008261	no	ARTTBL
chr1_1118777_T_C_b38	RP11-206L10.9	2.668	0.00788	0.042506	15	0.015934	no	ARTTBL
chr1_1167770_G_A_b38	RP11-206L10.9	2.654	0.0082	0.023195	40	0.00874	no	ARTTBL
chr1_1606532_G_A_b38	RP11-206L10.9	2.647	0.00838	0.024244	38	0.00916	no	ARTTBL
chr1_973946_C_T_b38	RP11-206L10.9	-2.636	0.00865	-0.06301	4	0.023907	no	ARTTBL
chr1_1679041_C_G_b38	RP11-206L10.9	2.628	0.00883	0.037389	3	0.014225	no	ARTTBL
chr1_851882_C_G_b38	RP11-206L10.9	-2.625	0.00893	-0.028373	21	0.010811	no	ARTTBL
chr1_1324185_T_TGG_b38	RP11-206L10.9	2.623	0.00897	0.044541	10	0.016979	no	ARTTBL
chr1_1135738_G_C_b38	RP11-206L10.9	-2.617	0.00913	-0.020743	119	0.007926	no	ARTTBL
chr1_1134040_G_C_b38	RP11-206L10.9	2.614	0.00921	0.02257	45	0.008634	no	ARTTBL
chr1_1606539_G_GCC_b38	RP11-206L10.9	2.612	0.00925	0.023965	38	0.009173	no	ARTTBL
chr1_1159358_A_G_b38	RP11-206L10.9	-2.609	0.00935	-0.02033	85	0.007793	no	ARTTBL
chr1_1116304_A_C_b38	RP11-206L10.9	2.59	0.00988	0.041486	13	0.01602	no	ARTTBL
chr1_1606536_GCT_G_b38	RP11-206L10.9	2.586	0.00998	0.023708	38	0.009168	no	ARTTBL
chr1_681103_T_A_b38	RP11-206L10.9	3.582	0.000523	0.075396	3	0.02105	yes	BRNAMY
chr1_1680672_C_T_b38	RP11-206L10.9	3.431	0.000868	0.037738	31	0.011001	yes	BRNAMY
chr1_1708855_TTCCTCCTCC_T_b38	RP11-206L10.9	-3.351	0.00113	-0.039228	27	0.011706	yes	BRNAMY
chr1_1685108_CA_C_b38	RP11-206L10.9	3.295	0.00135	0.041982	15	0.01274	yes	BRNAMY
chr1_1707607_C_G_b38	RP11-206L10.9	-3.276	0.00144	-0.031027	31	0.009471	yes	BRNAMY
chr1_1684266_T_C_b38	RP11-206L10.9	3.158	0.00208	0.032216	31	0.0102	yes	BRNAMY
chr1_1684308_G_C_b38	RP11-206L10.9	3.158	0.00208	0.032216	31	0.0102	yes	BRNAMY
chr1_1684619_G_A_b38	RP11-206L10.9	3.158	0.00208	0.032216	31	0.0102	yes	BRNAMY
chr1_1680214_T_C_b38	RP11-206L10.9	3.13	0.00227	0.032481	32	0.010377	yes	BRNAMY
chr1_1680556_A_G_b38	RP11-206L10.9	3.13	0.00227	0.032481	32	0.010377	yes	BRNAMY
chr1_1679993_A_G_b38	RP11-206L10.9	3.092	0.00256	0.031137	36	0.010069	yes	BRNAMY
chr1_1695747_C_T_b38	RP11-206L10.9	-3.091	0.00257	-0.037939	28	0.012275	yes	BRNAMY
chr1_1686147_T_G_b38	RP11-206L10.9	3.089	0.00258	0.032566	29	0.010542	yes	BRNAMY
chr1_1683909_A_C_b38	RP11-206L10.9	3.052	0.00289	0.031525	35	0.010328	yes	BRNAMY
chr1_1681164_G_A_b38	RP11-206L10.9	2.978	0.00361	0.030508	32	0.010243	yes	BRNAMY
chr1_1687643_G_A_b38	RP11-206L10.9	2.927	0.00421	0.029582	32	0.010107	yes	BRNAMY
chr1_1687153_A_G_b38	RP11-206L10.9	2.898	0.00458	0.03016	34	0.010406	yes	BRNAMY
chr1_1687236_T_G_b38	RP11-206L10.9	2.874	0.00492	0.030207	29	0.010509	yes	BRNAMY
chr1_1708951_C_T_b38	RP11-206L10.9	-2.869	0.00499	-0.032806	26	0.011434	yes	BRNAMY
chr1_1681928_C_A_b38	RP11-206L10.9	2.867	0.00502	0.029081	32	0.010142	yes	BRNAMY
chr1_1687159_G_T_b38	RP11-206L10.9	2.866	0.00504	0.029791	30	0.010395	yes	BRNAMY
chr1_1708362_T_C_b38	RP11-206L10.9	-2.813	0.00587	-0.03053	24	0.010852	yes	BRNAMY
chr1_1686017_A_AT_b38	RP11-206L10.9	2.801	0.00609	0.028712	32	0.010252	yes	BRNAMY
chr1_1687061_C_T_b38	RP11-206L10.9	2.801	0.00609	0.028712	32	0.010252	yes	BRNAMY
chr1_137825_G_A_b38	RP11-206L10.9	-2.745	0.00715	-0.040938	5	0.014916	yes	BRNAMY
chr1_791564_C_G_b38	RP11-206L10.9	-2.664	0.00896	-0.03863	9	0.014501	yes	BRNAMY
chr1_1704180_T_C_b38	RP11-206L10.9	-2.653	0.00925	-0.027936	28	0.010531	yes	BRNAMY
chr1_1706566_G_C_b38	RP11-206L10.9	-2.653	0.00925	-0.027936	28	0.010531	yes	BRNAMY
chr1_1691377_C_T_b38	RP11-206L10.9	-3.321	0.00124	-0.040488	15	0.012192	no	BRNAMY
chr1_1684817_G_C_b38	RP11-206L10.9	3.223	0.0017	0.034292	28	0.01064	no	BRNAMY
chr1_1370553_CA_C_b38	RP11-206L10.9	3.024	0.00315	0.03672	30	0.012144	no	BRNAMY
chr1_771398_G_A_b38	RP11-206L10.9	-2.894	0.00464	-0.039958	16	0.013807	no	BRNAMY
chr1_1102614_TA_T_b38	RP11-206L10.9	2.825	0.00568	0.070653	3	0.025008	no	BRNAMY
chr1_624509_A_G_b38	RP11-206L10.9	2.693	0.00826	0.039832	3	0.01479	no	BRNAMY
chr1_1696758_A_G_b38	RP11-206L10.9	-2.65	0.00933	-0.026985	28	0.010184	no	BRNAMY
chr1_1715745_G_A_b38	RP11-206L10.9	2.643	0.00951	0.027938	27	0.010572	no	BRNAMY
chr1_1689446_T_C_b38	RP11-206L10.9	2.629	0.00988	0.027995	27	0.01065	no	BRNAMY
chr1_1704605_G_A_b38	RP11-206L10.9	-2.625	0.00998	-0.027331	29	0.010411	no	BRNAMY
chr1_98929_A_G_b38	RP11-206L10.9	4.557	1.25e-05	0.065809	3	0.014441	yes	BRNACC
chr1_1629332_G_T_b38	RP11-206L10.9	-3.095	0.00244	-0.032154	14	0.010388	yes	BRNACC
chr1_1630798_C_T_b38	RP11-206L10.9	-2.961	0.00369	-0.030836	13	0.010414	yes	BRNACC
chr1_1661562_G_C_b38	RP11-206L10.9	-2.956	0.00375	-0.026146	30	0.008846	yes	BRNACC
chr1_1670423_AT_A_b38	RP11-206L10.9	-2.954	0.00377	-0.03488	13	0.011808	yes	BRNACC
chr1_1169858_T_C_b38	RP11-206L10.9	2.752	0.00684	0.026055	25	0.009468	yes	BRNACC
chr1_820560_C_T_b38	RP11-206L10.9	-2.706	0.0078	-0.035399	6	0.013083	yes	BRNACC
chr1_1667424_T_TAAAATA_b38	RP11-206L10.9	-2.678	0.00843	-0.028117	14	0.010497	yes	BRNACC
chr1_1651653_C_T_b38	RP11-206L10.9	-3.311	0.00123	-0.032477	29	0.00981	no	BRNACC
chr1_1649932_C_T_b38	RP11-206L10.9	-3.14	0.00212	-0.031008	27	0.009875	no	BRNACC
chr1_1591419_A_G_b38	RP11-206L10.9	-3.119	0.00227	-0.040561	4	0.013006	no	BRNACC
chr1_1673060_G_A_b38	RP11-206L10.9	-2.873	0.0048	-0.025512	37	0.008879	no	BRNACC
chr1_799080_TG_T_b38	RP11-206L10.9	2.871	0.00483	0.033691	10	0.011735	no	BRNACC
chr1_1648736_G_A_b38	RP11-206L10.9	-2.865	0.00491	-0.029392	24	0.010258	no	BRNACC
chr1_1673818_A_C_b38	RP11-206L10.9	-2.864	0.00493	-0.025541	37	0.008917	no	BRNACC
chr1_1017048_G_A_b38	RP11-206L10.9	-2.85	0.00514	-0.027202	37	0.009545	no	BRNACC
chr1_1036800_G_A_b38	RP11-206L10.9	-2.833	0.0054	-0.026435	35	0.009331	no	BRNACC
chr1_1671797_G_A_b38	RP11-206L10.9	-2.818	0.00565	-0.025806	36	0.009159	no	BRNACC
chr1_1032278_C_T_b38	RP11-206L10.9	-2.764	0.0066	-0.026636	38	0.009636	no	BRNACC
chr1_1750632_G_A_b38	RP11-206L10.9	2.737	0.00714	0.036223	11	0.013236	no	BRNACC
chr1_1394752_G_GA_b38	RP11-206L10.9	2.725	0.00739	0.043161	3	0.015841	no	BRNACC
chr1_1674720_TGC_T_b38	RP11-206L10.9	-2.724	0.0074	-0.024567	36	0.009019	no	BRNACC
chr1_1674868_G_A_b38	RP11-206L10.9	-2.724	0.0074	-0.024567	36	0.009019	no	BRNACC
chr1_1034835_G_C_b38	RP11-206L10.9	-2.722	0.00745	-0.026231	36	0.009637	no	BRNACC
chr1_928131_T_C_b38	RP11-206L10.9	-2.714	0.00761	-0.032946	4	0.012138	no	BRNACC
chr1_1023851_G_A_b38	RP11-206L10.9	-2.71	0.00771	-0.027198	32	0.010038	no	BRNACC
chr1_1636278_G_T_b38	RP11-206L10.9	-2.669	0.00866	-0.028356	21	0.010625	no	BRNACC
chr1_1671995_G_T_b38	RP11-206L10.9	-2.647	0.00921	-0.023981	37	0.009061	no	BRNACC
chr1_98929_A_G_b38	RP11-206L10.9	3.295	0.00122	0.054513	3	0.016543	yes	BRNCDT
chr1_1582992_C_CT_b38	RP11-206L10.9	-3.133	0.00207	-0.033778	28	0.010781	yes	BRNCDT
chr1_1533855_G_A_b38	RP11-206L10.9	2.867	0.00473	0.045268	3	0.015788	yes	BRNCDT
chr1_778639_A_G_b38	RP11-206L10.9	6.958	9.47e-11	0.114529	3	0.01646	no	BRNCDT
chr1_788439_T_A_b38	RP11-206L10.9	6.727	3.26e-10	0.109478	4	0.016276	no	BRNCDT
chr1_800605_G_A_b38	RP11-206L10.9	6.727	3.26e-10	0.109478	4	0.016276	no	BRNCDT
chr1_779047_G_A_b38	RP11-206L10.9	-6.683	4.1e-10	-0.10981	4	0.016431	no	BRNCDT
chr1_788418_CAG_C_b38	RP11-206L10.9	-6.651	4.87e-10	-0.107667	4	0.016189	no	BRNCDT
chr1_788511_G_C_b38	RP11-206L10.9	-6.651	4.87e-10	-0.107667	4	0.016189	no	BRNCDT
chr1_809641_G_T_b38	RP11-206L10.9	6.498	1.08e-09	0.104798	4	0.016127	no	BRNCDT
chr1_777382_T_G_b38	RP11-206L10.9	6.479	1.2e-09	0.106924	3	0.016503	no	BRNCDT
chr1_784109_C_CATAAT_b38	RP11-206L10.9	5.34	3.3e-07	0.095089	4	0.017807	no	BRNCDT
chr1_777135_T_TC_b38	RP11-206L10.9	5.167	7.31e-07	0.092492	4	0.017899	no	BRNCDT
chr1_820560_C_T_b38	RP11-206L10.9	-4.905	2.37e-06	-0.062958	9	0.012837	no	BRNCDT
chr1_826577_A_AT_b38	RP11-206L10.9	-4.621	8.05e-06	-0.064262	5	0.013906	no	BRNCDT
chr1_817341_A_G_b38	RP11-206L10.9	-4.402	2e-05	-0.062879	8	0.014284	no	BRNCDT
chr1_818094_C_G_b38	RP11-206L10.9	-4.332	2.66e-05	-0.062336	11	0.014389	no	BRNCDT
chr1_817514_T_C_b38	RP11-206L10.9	-4.318	2.82e-05	-0.059774	5	0.013844	no	BRNCDT
chr1_817186_G_A_b38	RP11-206L10.9	-4.297	3.07e-05	-0.060893	5	0.014171	no	BRNCDT
chr1_824320_T_C_b38	RP11-206L10.9	-4.263	3.52e-05	-0.060289	5	0.014142	no	BRNCDT
chr1_825532_C_T_b38	RP11-206L10.9	-4.263	3.52e-05	-0.060289	5	0.014142	no	BRNCDT
chr1_825767_T_C_b38	RP11-206L10.9	-4.263	3.52e-05	-0.060289	5	0.014142	no	BRNCDT
chr1_819123_G_A_b38	RP11-206L10.9	-4.25	3.7e-05	-0.060178	9	0.01416	no	BRNCDT
chr1_819584_C_T_b38	RP11-206L10.9	-4.25	3.7e-05	-0.060178	9	0.01416	no	BRNCDT
chr1_790933_CGAATGGAATG_C_b38	RP11-206L10.9	-4.16	5.3e-05	-0.047802	14	0.011492	no	BRNCDT
chr1_794299_C_G_b38	RP11-206L10.9	-3.972	0.000109	-0.054353	9	0.013684	no	BRNCDT
chr1_789568_TATGGA_T_b38	RP11-206L10.9	-3.882	0.000154	-0.053256	9	0.013719	no	BRNCDT
chr1_681103_T_A_b38	RP11-206L10.9	3.849	0.000174	0.076325	3	0.019831	no	BRNCDT
chr1_813498_G_T_b38	RP11-206L10.9	-3.691	0.000311	-0.048788	10	0.01322	no	BRNCDT
chr1_808924_C_T_b38	RP11-206L10.9	-3.544	0.000523	-0.048174	4	0.013594	no	BRNCDT
chr1_814476_C_T_b38	RP11-206L10.9	-3.501	0.000609	-0.049272	7	0.014075	no	BRNCDT
chr1_1605794_G_C_b38	RP11-206L10.9	3.442	0.000745	0.070926	4	0.020607	no	BRNCDT
chr1_1605792_C_G_b38	RP11-206L10.9	3.323	0.00112	0.064712	4	0.019476	no	BRNCDT
chr1_771398_G_A_b38	RP11-206L10.9	-3.232	0.0015	-0.041532	22	0.012849	no	BRNCDT
chr1_1588141_CA_C_b38	RP11-206L10.9	3.212	0.00161	0.043134	16	0.01343	no	BRNCDT
chr1_271569_A_G_b38	RP11-206L10.9	-3.151	0.00196	-0.037392	12	0.011868	no	BRNCDT
chr1_1605787_G_A_b38	RP11-206L10.9	2.817	0.00548	0.055955	4	0.019861	no	BRNCDT
chr1_822427_CCCTGGCCAGCAGATCCACCCTGTCTATACTACCTG_C_b38	RP11-206L10.9	-2.674	0.00831	-0.036104	9	0.013503	no	BRNCDT
chr1_826420_A_T_b38	RP11-206L10.9	-2.668	0.00845	-0.030168	21	0.011307	no	BRNCDT
chr1_674562_T_C_b38	RP11-206L10.9	2.641	0.00912	0.034089	8	0.012907	no	BRNCDT
chr1_681103_T_A_b38	RP11-206L10.9	6.009	1.66e-08	0.172542	3	0.028713	yes	BRNCHB
chr1_633365_C_CCA_b38	RP11-206L10.9	3.304	0.00122	0.064158	11	0.019417	yes	BRNCHB
chr1_633329_A_G_b38	RP11-206L10.9	3.141	0.00207	0.065421	7	0.020825	yes	BRNCHB
chr1_1686321_CTTT_C_b38	RP11-206L10.9	3.099	0.00236	0.057956	15	0.0187	yes	BRNCHB
chr1_633375_G_A_b38	RP11-206L10.9	2.847	0.00511	0.061801	6	0.021706	yes	BRNCHB
chr1_1680672_C_T_b38	RP11-206L10.9	2.803	0.00582	0.050009	38	0.017843	yes	BRNCHB
chr1_633032_T_C_b38	RP11-206L10.9	2.767	0.00646	0.058163	7	0.021019	yes	BRNCHB
chr1_633071_C_T_b38	RP11-206L10.9	2.767	0.00646	0.058163	7	0.021019	yes	BRNCHB
chr1_633098_C_T_b38	RP11-206L10.9	2.767	0.00646	0.058163	7	0.021019	yes	BRNCHB
chr1_633182_A_G_b38	RP11-206L10.9	2.767	0.00646	0.058163	7	0.021019	yes	BRNCHB
chr1_633251_C_T_b38	RP11-206L10.9	2.767	0.00646	0.058163	7	0.021019	yes	BRNCHB
chr1_633264_T_C_b38	RP11-206L10.9	2.767	0.00646	0.058163	7	0.021019	yes	BRNCHB
chr1_633290_T_C_b38	RP11-206L10.9	2.767	0.00646	0.058163	7	0.021019	yes	BRNCHB
chr1_633293_A_G_b38	RP11-206L10.9	2.767	0.00646	0.058163	7	0.021019	yes	BRNCHB
chr1_633636_C_T_b38	RP11-206L10.9	2.763	0.00653	0.061161	6	0.022132	yes	BRNCHB
chr1_633209_T_C_b38	RP11-206L10.9	2.758	0.00663	0.058057	7	0.021052	yes	BRNCHB
chr1_633230_C_T_b38	RP11-206L10.9	2.758	0.00663	0.058057	7	0.021052	yes	BRNCHB
chr1_1584235_A_AT_b38	RP11-206L10.9	2.736	0.00706	0.048984	25	0.017901	yes	BRNCHB
chr1_632781_C_T_b38	RP11-206L10.9	2.718	0.00744	0.058939	4	0.021687	yes	BRNCHB
chr1_633443_C_T_b38	RP11-206L10.9	2.66	0.00878	0.059411	4	0.022338	yes	BRNCHB
chr1_633444_C_T_b38	RP11-206L10.9	2.66	0.00878	0.059411	4	0.022338	yes	BRNCHB
chr1_633561_A_G_b38	RP11-206L10.9	2.629	0.00955	0.055755	6	0.021204	yes	BRNCHB
chr1_933038_C_T_b38	RP11-206L10.9	2.623	0.00973	0.048747	11	0.018586	yes	BRNCHB
chr1_790933_CGAATGGAATG_C_b38	RP11-206L10.9	-3.519	0.000592	-0.069583	9	0.019772	no	BRNCHB
chr1_1605794_G_C_b38	RP11-206L10.9	2.89	0.0045	0.089065	3	0.030819	no	BRNCHB
chr1_1750650_C_G_b38	RP11-206L10.9	2.808	0.00573	0.057494	15	0.020474	no	BRNCHB
chr1_1687236_T_G_b38	RP11-206L10.9	2.763	0.00653	0.045943	31	0.016626	no	BRNCHB
chr1_1685108_CA_C_b38	RP11-206L10.9	2.721	0.00738	0.051549	18	0.018946	no	BRNCHB
chr1_814773_T_C_b38	RP11-206L10.9	2.713	0.00755	0.058552	3	0.021585	no	BRNCHB
chr1_1605792_C_G_b38	RP11-206L10.9	2.709	0.00763	0.079102	3	0.029201	no	BRNCHB
chr1_790933_CGAATGGAATG_C_b38	RP11-206L10.9	-4.423	1.74e-05	-0.06982	12	0.015786	yes	BRNCHA
chr1_813498_G_T_b38	RP11-206L10.9	-4.058	7.58e-05	-0.071004	9	0.017499	yes	BRNCHA
chr1_789568_TATGGA_T_b38	RP11-206L10.9	-3.674	0.00032	-0.066166	8	0.018007	yes	BRNCHA
chr1_771398_G_A_b38	RP11-206L10.9	-3.643	0.000359	-0.058296	19	0.016001	yes	BRNCHA
chr1_633365_C_CCA_b38	RP11-206L10.9	3.618	0.000393	0.062107	11	0.017167	yes	BRNCHA
chr1_794299_C_G_b38	RP11-206L10.9	-3.544	0.000511	-0.065353	7	0.018442	yes	BRNCHA
chr1_590378_T_C_b38	RP11-206L10.9	3.499	0.000598	0.081865	11	0.023396	yes	BRNCHA
chr1_820560_C_T_b38	RP11-206L10.9	-3.456	0.000694	-0.061842	5	0.017894	yes	BRNCHA
chr1_817186_G_A_b38	RP11-206L10.9	-3.209	0.0016	-0.061339	3	0.019116	yes	BRNCHA
chr1_1361679_G_A_b38	RP11-206L10.9	-3.05	0.00266	-0.051769	13	0.016974	yes	BRNCHA
chr1_824320_T_C_b38	RP11-206L10.9	-3.035	0.00279	-0.058002	3	0.019113	yes	BRNCHA
chr1_825532_C_T_b38	RP11-206L10.9	-3.035	0.00279	-0.058002	3	0.019113	yes	BRNCHA
chr1_825767_T_C_b38	RP11-206L10.9	-3.035	0.00279	-0.058002	3	0.019113	yes	BRNCHA
chr1_817514_T_C_b38	RP11-206L10.9	-3.028	0.00285	-0.057329	3	0.018931	yes	BRNCHA
chr1_821000_T_A_b38	RP11-206L10.9	-2.958	0.00355	-0.053988	3	0.018254	yes	BRNCHA
chr1_826577_A_AT_b38	RP11-206L10.9	-2.942	0.00372	-0.05549	4	0.018862	yes	BRNCHA
chr1_607319_T_C_b38	RP11-206L10.9	2.913	0.00406	0.060078	5	0.020622	yes	BRNCHA
chr1_630211_C_T_b38	RP11-206L10.9	2.812	0.00551	0.050101	7	0.017817	yes	BRNCHA
chr1_635258_T_C_b38	RP11-206L10.9	2.71	0.00742	0.055441	6	0.020455	yes	BRNCHA
chr1_799082_G_A_b38	RP11-206L10.9	-4.358	2.28e-05	-0.078955	5	0.018118	no	BRNCHA
chr1_818094_C_G_b38	RP11-206L10.9	-3.66	0.000337	-0.068804	9	0.018799	no	BRNCHA
chr1_817341_A_G_b38	RP11-206L10.9	-3.398	0.000847	-0.064762	5	0.019057	no	BRNCHA
chr1_819123_G_A_b38	RP11-206L10.9	-3.301	0.00118	-0.061979	6	0.018776	no	BRNCHA
chr1_819584_C_T_b38	RP11-206L10.9	-3.301	0.00118	-0.061979	6	0.018776	no	BRNCHA
chr1_98929_A_G_b38	RP11-206L10.9	3.247	0.00141	0.077119	3	0.023752	no	BRNCHA
chr1_291791_T_C_b38	RP11-206L10.9	-2.94	0.00375	-0.104392	3	0.035509	no	BRNCHA
chr1_182095_T_C_b38	RP11-206L10.9	-2.924	0.00393	-0.061649	19	0.021083	no	BRNCHA
chr1_814476_C_T_b38	RP11-206L10.9	-2.858	0.0048	-0.050612	7	0.017708	no	BRNCHA
chr1_288386_G_A_b38	RP11-206L10.9	-2.851	0.00491	-0.089702	4	0.031467	no	BRNCHA
chr1_973862_A_G_b38	RP11-206L10.9	2.835	0.00515	0.086673	3	0.030578	no	BRNCHA
chr1_12807_C_T_b38	RP11-206L10.9	-2.748	0.00664	-0.047358	11	0.017231	no	BRNCHA
chr1_790933_CGAATGGAATG_C_b38	RP11-206L10.9	-3.767	0.00023	-0.051573	13	0.013691	yes	BRNCTXA
chr1_1605787_G_A_b38	RP11-206L10.9	3.547	0.000509	0.075156	3	0.02119	yes	BRNCTXA
chr1_1605792_C_G_b38	RP11-206L10.9	3.53	0.00054	0.075932	3	0.021511	yes	BRNCTXA
chr1_1605794_G_C_b38	RP11-206L10.9	3.036	0.00279	0.068689	3	0.022628	yes	BRNCTXA
chr1_820560_C_T_b38	RP11-206L10.9	-2.978	0.00334	-0.043049	9	0.014456	yes	BRNCTXA
chr1_674381_A_AT_b38	RP11-206L10.9	2.835	0.00516	0.039693	14	0.014	yes	BRNCTXA
chr1_789680_A_AGGAATGGAAT_b38	RP11-206L10.9	-2.763	0.00639	-0.031341	28	0.011344	yes	BRNCTXA
chr1_1557495_CAT_C_b38	RP11-206L10.9	-2.755	0.00654	-0.033985	35	0.012337	yes	BRNCTXA
chr1_1551557_A_AG_b38	RP11-206L10.9	-2.744	0.00674	-0.034313	34	0.012504	yes	BRNCTXA
chr1_1551559_A_T_b38	RP11-206L10.9	-2.744	0.00674	-0.034313	34	0.012504	yes	BRNCTXA
chr1_1541864_T_C_b38	RP11-206L10.9	-2.721	0.0072	-0.03445	34	0.012659	yes	BRNCTXA
chr1_1684789_C_CA_b38	RP11-206L10.9	2.609	0.00992	0.073861	3	0.028309	yes	BRNCTXA
chr1_1160239_C_G_b38	RP11-206L10.9	2.608	0.00994	0.032451	23	0.012441	yes	BRNCTXA
chr1_778639_A_G_b38	RP11-206L10.9	5.468	1.67e-07	0.119661	3	0.021885	no	BRNCTXA
chr1_788439_T_A_b38	RP11-206L10.9	5.468	1.67e-07	0.119661	3	0.021885	no	BRNCTXA
chr1_800605_G_A_b38	RP11-206L10.9	5.468	1.67e-07	0.119661	3	0.021885	no	BRNCTXA
chr1_784109_C_CATAAT_b38	RP11-206L10.9	5.3	3.69e-07	0.120511	3	0.022739	no	BRNCTXA
chr1_788418_CAG_C_b38	RP11-206L10.9	-5.088	9.82e-07	-0.112714	3	0.022154	no	BRNCTXA
chr1_788511_G_C_b38	RP11-206L10.9	-5.088	9.82e-07	-0.112714	3	0.022154	no	BRNCTXA
chr1_779047_G_A_b38	RP11-206L10.9	-5.072	1.06e-06	-0.114882	3	0.022651	no	BRNCTXA
chr1_809641_G_T_b38	RP11-206L10.9	5.021	1.33e-06	0.109643	3	0.021836	no	BRNCTXA
chr1_777135_T_TC_b38	RP11-206L10.9	4.743	4.55e-06	0.113531	3	0.023936	no	BRNCTXA
chr1_1742119_CA_C_b38	RP11-206L10.9	3.349	0.00101	0.046564	17	0.013905	no	BRNCTXA
chr1_1716919_CT_C_b38	RP11-206L10.9	-3.015	0.00298	-0.093052	3	0.030861	no	BRNCTXA
chr1_800909_T_A_b38	RP11-206L10.9	2.989	0.00323	0.049141	3	0.016442	no	BRNCTXA
chr1_1147779_G_A_b38	RP11-206L10.9	-2.802	0.00568	-0.039792	8	0.014199	no	BRNCTXA
chr1_817186_G_A_b38	RP11-206L10.9	-2.729	0.00704	-0.041275	7	0.015124	no	BRNCTXA
chr1_824320_T_C_b38	RP11-206L10.9	-2.729	0.00704	-0.041275	7	0.015124	no	BRNCTXA
chr1_825532_C_T_b38	RP11-206L10.9	-2.729	0.00704	-0.041275	7	0.015124	no	BRNCTXA
chr1_825767_T_C_b38	RP11-206L10.9	-2.729	0.00704	-0.041275	7	0.015124	no	BRNCTXA
chr1_826577_A_AT_b38	RP11-206L10.9	-2.729	0.00704	-0.041275	7	0.015124	no	BRNCTXA
chr1_817514_T_C_b38	RP11-206L10.9	-2.704	0.00758	-0.04039	7	0.014938	no	BRNCTXA
chr1_1102614_T_TA_b38	RP11-206L10.9	-2.696	0.00775	-0.062614	7	0.023223	no	BRNCTXA
chr1_681103_T_A_b38	RP11-206L10.9	4.939	2.29e-06	0.097854	3	0.019811	yes	BRNCTXB
chr1_790933_CGAATGGAATG_C_b38	RP11-206L10.9	-3.98	0.000112	-0.054667	7	0.013735	yes	BRNCTXB
chr1_808924_C_T_b38	RP11-206L10.9	-3.513	0.000604	-0.056873	3	0.016189	yes	BRNCTXB
chr1_674381_A_AT_b38	RP11-206L10.9	3.309	0.0012	0.047275	6	0.014285	yes	BRNCTXB
chr1_1265603_T_TTG_b38	RP11-206L10.9	3.238	0.00152	0.048136	3	0.014864	yes	BRNCTXB
chr1_818094_C_G_b38	RP11-206L10.9	-3.059	0.00268	-0.051555	8	0.016852	yes	BRNCTXB
chr1_806017_A_G_b38	RP11-206L10.9	3.046	0.00279	0.076616	3	0.025154	yes	BRNCTXB
chr1_1651653_C_T_b38	RP11-206L10.9	-2.887	0.00453	-0.035112	35	0.012162	yes	BRNCTXB
chr1_955679_C_T_b38	RP11-206L10.9	-2.859	0.00494	-0.033221	32	0.011622	yes	BRNCTXB
chr1_956565_A_G_b38	RP11-206L10.9	-2.859	0.00494	-0.033221	32	0.011622	yes	BRNCTXB
chr1_878767_G_C_b38	RP11-206L10.9	2.835	0.00529	0.054852	3	0.019349	yes	BRNCTXB
chr1_949171_GAGAA_G_b38	RP11-206L10.9	-2.818	0.00557	-0.031946	34	0.011337	yes	BRNCTXB
chr1_917495_C_T_b38	RP11-206L10.9	-2.752	0.00674	-0.032799	30	0.011917	yes	BRNCTXB
chr1_918574_C_A_b38	RP11-206L10.9	-2.752	0.00674	-0.032799	30	0.011917	yes	BRNCTXB
chr1_940390_A_G_b38	RP11-206L10.9	-2.739	0.007	-0.03178	37	0.011602	yes	BRNCTXB
chr1_919695_C_G_b38	RP11-206L10.9	-2.732	0.00714	-0.032867	24	0.01203	yes	BRNCTXB
chr1_1185051_G_A_b38	RP11-206L10.9	2.716	0.00747	0.053249	6	0.019602	yes	BRNCTXB
chr1_914991_G_T_b38	RP11-206L10.9	-2.705	0.00772	-0.032378	30	0.011971	yes	BRNCTXB
chr1_915400_C_T_b38	RP11-206L10.9	-2.677	0.00836	-0.032285	28	0.01206	yes	BRNCTXB
chr1_861387_G_A_b38	RP11-206L10.9	-2.658	0.00882	-0.046757	14	0.017593	yes	BRNCTXB
chr1_1490046_G_A_b38	RP11-206L10.9	2.64	0.00927	0.048322	4	0.018302	yes	BRNCTXB
chr1_1490047_A_G_b38	RP11-206L10.9	2.64	0.00927	0.048322	4	0.018302	yes	BRNCTXB
chr1_788418_CAG_C_b38	RP11-206L10.9	-5.72	6.65e-08	-0.108253	3	0.018927	no	BRNCTXB
chr1_788511_G_C_b38	RP11-206L10.9	-5.72	6.65e-08	-0.108253	3	0.018927	no	BRNCTXB
chr1_779047_G_A_b38	RP11-206L10.9	-5.548	1.49e-07	-0.107267	3	0.019334	no	BRNCTXB
chr1_778639_A_G_b38	RP11-206L10.9	5.543	1.52e-07	0.104415	3	0.018839	no	BRNCTXB
chr1_788439_T_A_b38	RP11-206L10.9	5.543	1.52e-07	0.104415	3	0.018839	no	BRNCTXB
chr1_800605_G_A_b38	RP11-206L10.9	5.543	1.52e-07	0.104415	3	0.018839	no	BRNCTXB
chr1_809641_G_T_b38	RP11-206L10.9	5.543	1.52e-07	0.104415	3	0.018839	no	BRNCTXB
chr1_784109_C_CATAAT_b38	RP11-206L10.9	4.663	7.44e-06	0.095685	3	0.020519	no	BRNCTXB
chr1_777135_T_TC_b38	RP11-206L10.9	4.416	2.05e-05	0.094166	3	0.021322	no	BRNCTXB
chr1_813498_G_T_b38	RP11-206L10.9	-3.655	0.000368	-0.056335	9	0.015414	no	BRNCTXB
chr1_814476_C_T_b38	RP11-206L10.9	-3.466	0.00071	-0.05172	6	0.014921	no	BRNCTXB
chr1_799082_G_A_b38	RP11-206L10.9	-3.284	0.0013	-0.046673	7	0.014211	no	BRNCTXB
chr1_1664417_G_A_b38	RP11-206L10.9	-3.165	0.00192	-0.044746	7	0.014139	no	BRNCTXB
chr1_642930_G_C_b38	RP11-206L10.9	-3.116	0.00224	-0.074458	4	0.023894	no	BRNCTXB
chr1_650383_AACAC_A_b38	RP11-206L10.9	-3.04	0.00285	-0.085377	3	0.028089	no	BRNCTXB
chr1_799080_TG_T_b38	RP11-206L10.9	2.993	0.0033	0.041693	10	0.013933	no	BRNCTXB
chr1_619749_C_G_b38	RP11-206L10.9	2.899	0.00437	0.0839	3	0.028939	no	BRNCTXB
chr1_1631710_T_C_b38	RP11-206L10.9	-2.88	0.00463	-0.047015	5	0.016325	no	BRNCTXB
chr1_807692_C_A_b38	RP11-206L10.9	-2.853	0.00501	-0.071567	3	0.025082	no	BRNCTXB
chr1_939779_AGCCAGTGGACGCCGACCT_A_b38	RP11-206L10.9	-2.753	0.00672	-0.031086	33	0.01129	no	BRNCTXB
chr1_1483898_G_A_b38	RP11-206L10.9	2.749	0.0068	0.050551	14	0.018389	no	BRNCTXB
chr1_1486151_C_A_b38	RP11-206L10.9	2.749	0.0068	0.050551	14	0.018389	no	BRNCTXB
chr1_633365_C_CCA_b38	RP11-206L10.9	2.713	0.00753	0.039132	8	0.014421	no	BRNCTXB
chr1_1649932_C_T_b38	RP11-206L10.9	-2.709	0.00763	-0.032039	33	0.011826	no	BRNCTXB
chr1_643358_G_A_b38	RP11-206L10.9	-2.701	0.0078	-0.067631	3	0.025038	no	BRNCTXB
chr1_1495204_T_C_b38	RP11-206L10.9	2.696	0.00791	0.046305	13	0.017173	no	BRNCTXB
chr1_206074_T_C_b38	RP11-206L10.9	-2.689	0.00809	-0.038253	17	0.014227	no	BRNCTXB
chr1_968046_C_T_b38	RP11-206L10.9	2.666	0.00861	0.034733	13	0.013026	no	BRNCTXB
chr1_1482624_T_C_b38	RP11-206L10.9	2.661	0.00875	0.045717	15	0.017184	no	BRNCTXB
chr1_1442793_G_A_b38	RP11-206L10.9	2.635	0.0094	0.039615	4	0.015032	no	BRNCTXB
chr1_958084_C_T_b38	RP11-206L10.9	-2.633	0.00946	-0.061881	3	0.023503	no	BRNCTXB
chr1_921096_A_G_b38	RP11-206L10.9	2.63	0.00955	0.031641	28	0.012033	no	BRNCTXB
chr1_925308_G_A_b38	RP11-206L10.9	-4.239	4.35e-05	-0.05738	7	0.013538	yes	BRNHPP
chr1_923311_TG_T_b38	RP11-206L10.9	-4.206	4.94e-05	-0.058763	6	0.013971	yes	BRNHPP
chr1_923421_A_G_b38	RP11-206L10.9	-4.206	4.94e-05	-0.058763	6	0.013971	yes	BRNHPP
chr1_925036_G_A_b38	RP11-206L10.9	-3.878	0.00017	-0.054569	6	0.014071	yes	BRNHPP
chr1_926250_G_A_b38	RP11-206L10.9	-3.878	0.00017	-0.054569	6	0.014071	yes	BRNHPP
chr1_927486_C_T_b38	RP11-206L10.9	-3.592	0.000471	-0.052224	6	0.014538	yes	BRNHPP
chr1_922660_C_A_b38	RP11-206L10.9	3.56	0.000527	0.054877	3	0.015416	yes	BRNHPP
chr1_922671_C_T_b38	RP11-206L10.9	3.56	0.000527	0.054877	3	0.015416	yes	BRNHPP
chr1_929558_G_A_b38	RP11-206L10.9	-3.314	0.00121	-0.045105	9	0.013612	yes	BRNHPP
chr1_924305_G_A_b38	RP11-206L10.9	3.296	0.00128	0.04641	8	0.014081	yes	BRNHPP
chr1_960891_C_T_b38	RP11-206L10.9	-3.278	0.00136	-0.04006	31	0.012221	yes	BRNHPP
chr1_779047_G_A_b38	RP11-206L10.9	-3.168	0.00194	-0.068899	3	0.021752	yes	BRNHPP
chr1_788418_CAG_C_b38	RP11-206L10.9	-3.168	0.00194	-0.068899	3	0.021752	yes	BRNHPP
chr1_788511_G_C_b38	RP11-206L10.9	-3.168	0.00194	-0.068899	3	0.021752	yes	BRNHPP
chr1_931558_G_A_b38	RP11-206L10.9	3.12	0.00225	0.046914	4	0.015034	yes	BRNHPP
chr1_910558_G_A_b38	RP11-206L10.9	3.042	0.00287	0.044941	7	0.014774	yes	BRNHPP
chr1_911018_G_A_b38	RP11-206L10.9	3.035	0.00293	0.045384	6	0.014955	yes	BRNHPP
chr1_921056_TG_T_b38	RP11-206L10.9	2.935	0.00397	0.044671	4	0.015218	yes	BRNHPP
chr1_912710_G_A_b38	RP11-206L10.9	2.919	0.00418	0.044748	4	0.015332	yes	BRNHPP
chr1_913358_C_T_b38	RP11-206L10.9	2.919	0.00418	0.044748	4	0.015332	yes	BRNHPP
chr1_914743_C_T_b38	RP11-206L10.9	2.919	0.00418	0.044748	4	0.015332	yes	BRNHPP
chr1_965337_CTTAT_C_b38	RP11-206L10.9	-2.863	0.00493	-0.037358	27	0.013049	yes	BRNHPP
chr1_601229_C_CTACCCA_b38	RP11-206L10.9	2.825	0.00552	0.065299	3	0.023117	yes	BRNHPP
chr1_913274_TG_T_b38	RP11-206L10.9	2.789	0.00612	0.043344	4	0.015539	yes	BRNHPP
chr1_910255_C_T_b38	RP11-206L10.9	2.788	0.00614	0.045446	4	0.016301	yes	BRNHPP
chr1_680702_C_T_b38	RP11-206L10.9	-2.695	0.00801	-0.043642	4	0.016191	yes	BRNHPP
chr1_917284_C_T_b38	RP11-206L10.9	2.683	0.00829	0.041324	4	0.015401	yes	BRNHPP
chr1_917378_G_C_b38	RP11-206L10.9	2.683	0.00829	0.041324	4	0.015401	yes	BRNHPP
chr1_911484_G_C_b38	RP11-206L10.9	2.666	0.0087	0.040608	6	0.015233	yes	BRNHPP
chr1_790933_CGAATGGAATG_C_b38	RP11-206L10.9	-2.664	0.00876	-0.038178	8	0.014333	yes	BRNHPP
chr1_909894_G_T_b38	RP11-206L10.9	2.651	0.00908	0.040969	6	0.015455	yes	BRNHPP
chr1_1553791_CA_C_b38	RP11-206L10.9	-3.222	0.00163	-0.054732	3	0.016986	no	BRNHPP
chr1_98929_A_G_b38	RP11-206L10.9	4.055	8.63e-05	0.088163	3	0.021743	yes	BRNHPT
chr1_903551_A_C_b38	RP11-206L10.9	3.488	0.000666	0.069656	4	0.019969	yes	BRNHPT
chr1_1774506_T_C_b38	RP11-206L10.9	3.286	0.00131	0.046932	22	0.014282	yes	BRNHPT
chr1_1182106_A_G_b38	RP11-206L10.9	3.168	0.00191	0.057735	3	0.018222	yes	BRNHPT
chr1_1177602_C_T_b38	RP11-206L10.9	3.128	0.00218	0.054595	3	0.017454	yes	BRNHPT
chr1_1774165_A_G_b38	RP11-206L10.9	-2.799	0.00591	-0.041262	11	0.01474	yes	BRNHPT
chr1_1605794_G_C_b38	RP11-206L10.9	2.769	0.00644	0.072882	3	0.026317	yes	BRNHPT
chr1_1185051_G_A_b38	RP11-206L10.9	2.757	0.00669	0.062056	4	0.022512	yes	BRNHPT
chr1_1067673_C_T_b38	RP11-206L10.9	2.718	0.00747	0.034758	37	0.012787	yes	BRNHPT
chr1_1589418_T_TA_b38	RP11-206L10.9	2.669	0.00859	0.039514	18	0.014805	yes	BRNHPT
chr1_1062056_CTCCCTCCCTTGTCCCCGTTCCCTCCG_C_b38	RP11-206L10.9	3.174	0.00188	0.053593	4	0.016886	no	BRNHPT
chr1_897376_T_G_b38	RP11-206L10.9	-3.008	0.00316	-0.044947	10	0.014943	no	BRNHPT
chr1_1773215_C_A_b38	RP11-206L10.9	-2.983	0.00341	-0.042642	13	0.014295	no	BRNHPT
chr1_885945_ACAGT_A_b38	RP11-206L10.9	2.859	0.00496	0.047782	6	0.016713	no	BRNHPT
chr1_1771864_G_A_b38	RP11-206L10.9	2.826	0.00547	0.039706	34	0.014052	no	BRNHPT
chr1_1772410_T_C_b38	RP11-206L10.9	2.826	0.00547	0.039706	34	0.014052	no	BRNHPT
chr1_1772426_T_A_b38	RP11-206L10.9	2.826	0.00547	0.039706	34	0.014052	no	BRNHPT
chr1_1767762_C_A_b38	RP11-206L10.9	-2.79	0.00607	-0.040128	13	0.014381	no	BRNHPT
chr1_1774308_G_A_b38	RP11-206L10.9	-2.79	0.00607	-0.040128	13	0.014381	no	BRNHPT
chr1_1776301_T_G_b38	RP11-206L10.9	-2.79	0.00607	-0.040128	13	0.014381	no	BRNHPT
chr1_1674633_C_CA_b38	RP11-206L10.9	-2.789	0.00609	-0.038195	22	0.013695	no	BRNHPT
chr1_1766653_A_G_b38	RP11-206L10.9	2.743	0.00695	0.038666	33	0.014096	no	BRNHPT
chr1_896109_C_T_b38	RP11-206L10.9	2.741	0.00699	0.040964	12	0.014943	no	BRNHPT
chr1_1770997_G_A_b38	RP11-206L10.9	2.723	0.00736	0.036925	35	0.013559	no	BRNHPT
chr1_1769969_CAAAACAAAAACA_C_b38	RP11-206L10.9	2.693	0.00801	0.038776	32	0.014396	no	BRNHPT
chr1_1773460_G_A_b38	RP11-206L10.9	2.648	0.0091	0.037556	33	0.014181	no	BRNHPT
chr1_1773476_C_G_b38	RP11-206L10.9	2.648	0.0091	0.037556	33	0.014181	no	BRNHPT
chr1_1773848_A_C_b38	RP11-206L10.9	2.648	0.0091	0.037556	33	0.014181	no	BRNHPT
chr1_1776461_GAAAC_G_b38	RP11-206L10.9	2.648	0.0091	0.037556	33	0.014181	no	BRNHPT
chr1_1777362_A_G_b38	RP11-206L10.9	2.648	0.0091	0.037556	33	0.014181	no	BRNHPT
chr1_1762287_A_G_b38	RP11-206L10.9	2.621	0.00982	0.037204	34	0.014194	no	BRNHPT
chr1_794299_C_G_b38	RP11-206L10.9	-3.911	0.000135	-0.054966	7	0.014055	yes	BRNNCC
chr1_899024_C_CT_b38	RP11-206L10.9	3.564	0.00048	0.045997	10	0.012904	yes	BRNNCC
chr1_1750632_G_A_b38	RP11-206L10.9	3.084	0.0024	0.039979	11	0.012963	yes	BRNNCC
chr1_51803_T_C_b38	RP11-206L10.9	2.966	0.00348	0.030905	32	0.010421	yes	BRNNCC
chr1_1676790_C_T_b38	RP11-206L10.9	-2.898	0.00428	-0.027419	45	0.009462	yes	BRNNCC
chr1_1750650_C_G_b38	RP11-206L10.9	2.804	0.00567	0.036196	10	0.012909	yes	BRNNCC
chr1_1671995_G_T_b38	RP11-206L10.9	-2.8	0.00573	-0.026581	47	0.009493	yes	BRNNCC
chr1_1677720_T_G_b38	RP11-206L10.9	-2.793	0.00586	-0.026726	45	0.009569	yes	BRNNCC
chr1_1677726_A_T_b38	RP11-206L10.9	-2.793	0.00586	-0.026726	45	0.009569	yes	BRNNCC
chr1_1750658_T_C_b38	RP11-206L10.9	2.723	0.00719	0.032595	15	0.011971	yes	BRNNCC
chr1_1595824_CAGACAGACACAGAGCAGAACAGGGAGAGACAGAGAGAGAGAGACAGAGAGAGGCAGACAGAGACAGAGAGAG_C_b38	RP11-206L10.9	2.623	0.00955	0.046507	4	0.017731	yes	BRNNCC
chr1_906982_C_T_b38	RP11-206L10.9	2.617	0.00971	0.032153	8	0.012285	yes	BRNNCC
chr1_813498_G_T_b38	RP11-206L10.9	-4.632	7.43e-06	-0.059111	7	0.012762	no	BRNNCC
chr1_817341_A_G_b38	RP11-206L10.9	-3.75	0.000246	-0.054734	5	0.014594	no	BRNNCC
chr1_818094_C_G_b38	RP11-206L10.9	-3.746	0.00025	-0.053533	8	0.014292	no	BRNNCC
chr1_817186_G_A_b38	RP11-206L10.9	-3.714	0.000281	-0.05509	3	0.014834	no	BRNNCC
chr1_98929_A_G_b38	RP11-206L10.9	3.56	0.000487	0.060597	3	0.01702	no	BRNNCC
chr1_817514_T_C_b38	RP11-206L10.9	-3.556	0.000494	-0.051547	3	0.014494	no	BRNNCC
chr1_820560_C_T_b38	RP11-206L10.9	-3.554	0.000498	-0.048574	6	0.013667	no	BRNNCC
chr1_824320_T_C_b38	RP11-206L10.9	-3.454	0.000705	-0.050412	3	0.014593	no	BRNNCC
chr1_825532_C_T_b38	RP11-206L10.9	-3.454	0.000705	-0.050412	3	0.014593	no	BRNNCC
chr1_825767_T_C_b38	RP11-206L10.9	-3.454	0.000705	-0.050412	3	0.014593	no	BRNNCC
chr1_814476_C_T_b38	RP11-206L10.9	-3.411	0.000818	-0.045168	6	0.013242	no	BRNNCC
chr1_819123_G_A_b38	RP11-206L10.9	-3.293	0.00122	-0.046739	6	0.014193	no	BRNNCC
chr1_819584_C_T_b38	RP11-206L10.9	-3.293	0.00122	-0.046739	6	0.014193	no	BRNNCC
chr1_826577_A_AT_b38	RP11-206L10.9	-3.186	0.00173	-0.045752	4	0.01436	no	BRNNCC
chr1_789568_TATGGA_T_b38	RP11-206L10.9	-3.086	0.00239	-0.043266	8	0.014019	no	BRNNCC
chr1_1673818_A_C_b38	RP11-206L10.9	-2.918	0.00403	-0.02776	47	0.009514	no	BRNNCC
chr1_659806_T_C_b38	RP11-206L10.9	2.875	0.00458	0.047637	6	0.016568	no	BRNNCC
chr1_681103_T_A_b38	RP11-206L10.9	2.84	0.0051	0.062922	3	0.022159	no	BRNNCC
chr1_1673060_G_A_b38	RP11-206L10.9	-2.835	0.00517	-0.02679	47	0.00945	no	BRNNCC
chr1_1531589_C_T_b38	RP11-206L10.9	2.722	0.0072	0.042137	3	0.015478	no	BRNNCC
chr1_1674720_TGC_T_b38	RP11-206L10.9	-2.71	0.00745	-0.025753	45	0.009502	no	BRNNCC
chr1_1674868_G_A_b38	RP11-206L10.9	-2.71	0.00745	-0.025753	45	0.009502	no	BRNNCC
chr1_826420_A_T_b38	RP11-206L10.9	-2.611	0.00987	-0.031485	17	0.012057	no	BRNNCC
chr1_820560_C_T_b38	RP11-206L10.9	-4.823	3.91e-06	-0.069209	4	0.014349	yes	BRNPTM
chr1_826420_A_T_b38	RP11-206L10.9	-4.271	3.75e-05	-0.04876	17	0.011418	yes	BRNPTM
chr1_1751981_A_T_b38	RP11-206L10.9	3.582	0.000481	0.045538	16	0.012711	yes	BRNPTM
chr1_822427_CCCTGGCCAGCAGATCCACCCTGTCTATACTACCTG_C_b38	RP11-206L10.9	-3.483	0.000677	-0.051211	3	0.014702	yes	BRNPTM
chr1_771398_G_A_b38	RP11-206L10.9	-3.113	0.00228	-0.041127	17	0.013212	yes	BRNPTM
chr1_791544_TGAATG_T_b38	RP11-206L10.9	-2.788	0.00611	-0.042939	5	0.015402	yes	BRNPTM
chr1_778639_A_G_b38	RP11-206L10.9	4.488	1.57e-05	0.085404	3	0.01903	no	BRNPTM
chr1_788439_T_A_b38	RP11-206L10.9	4.488	1.57e-05	0.085404	3	0.01903	no	BRNPTM
chr1_800605_G_A_b38	RP11-206L10.9	4.488	1.57e-05	0.085404	3	0.01903	no	BRNPTM
chr1_809641_G_T_b38	RP11-206L10.9	4.488	1.57e-05	0.085404	3	0.01903	no	BRNPTM
chr1_779047_G_A_b38	RP11-206L10.9	-4.434	1.96e-05	-0.085964	3	0.019386	no	BRNPTM
chr1_788418_CAG_C_b38	RP11-206L10.9	-4.434	1.96e-05	-0.085964	3	0.019386	no	BRNPTM
chr1_788511_G_C_b38	RP11-206L10.9	-4.434	1.96e-05	-0.085964	3	0.019386	no	BRNPTM
chr1_817341_A_G_b38	RP11-206L10.9	-4.333	2.93e-05	-0.067515	4	0.015582	no	BRNPTM
chr1_818094_C_G_b38	RP11-206L10.9	-4.15	6e-05	-0.064271	7	0.015488	no	BRNPTM
chr1_819123_G_A_b38	RP11-206L10.9	-4.036	9.26e-05	-0.061686	5	0.015284	no	BRNPTM
chr1_819584_C_T_b38	RP11-206L10.9	-4.036	9.26e-05	-0.061686	5	0.015284	no	BRNPTM
chr1_784109_C_CATAAT_b38	RP11-206L10.9	4.019	9.88e-05	0.081849	3	0.020366	no	BRNPTM
chr1_826577_A_AT_b38	RP11-206L10.9	-3.86	0.000179	-0.058797	3	0.015233	no	BRNPTM
chr1_813498_G_T_b38	RP11-206L10.9	-3.219	0.00163	-0.045668	6	0.014186	no	BRNPTM
chr1_794299_C_G_b38	RP11-206L10.9	-2.983	0.00342	-0.047494	5	0.015924	no	BRNPTM
chr1_814476_C_T_b38	RP11-206L10.9	-2.976	0.00349	-0.043019	5	0.014456	no	BRNPTM
chr1_777135_T_TC_b38	RP11-206L10.9	2.964	0.00362	0.063089	3	0.021286	no	BRNPTM
chr1_789568_TATGGA_T_b38	RP11-206L10.9	-2.941	0.00387	-0.046601	5	0.015843	no	BRNPTM
chr1_808924_C_T_b38	RP11-206L10.9	-2.885	0.00459	-0.043936	3	0.01523	no	BRNPTM
chr1_633365_C_CCA_b38	RP11-206L10.9	2.705	0.00775	0.037535	8	0.013876	no	BRNPTM
chr1_1606552_A_G_b38	RP11-206L10.9	2.659	0.00882	0.031597	20	0.011881	no	BRNPTM
chr1_790933_CGAATGGAATG_C_b38	RP11-206L10.9	-4.118	7.89e-05	-0.08123	4	0.019728	yes	BRNSPC
chr1_818094_C_G_b38	RP11-206L10.9	-3.696	0.000358	-0.079966	4	0.021636	yes	BRNSPC
chr1_814476_C_T_b38	RP11-206L10.9	-3.539	0.00061	-0.071638	4	0.02024	yes	BRNSPC
chr1_1363601_A_AT_b38	RP11-206L10.9	2.739	0.0073	0.041552	33	0.015172	yes	BRNSPC
chr1_959193_G_A_b38	RP11-206L10.9	-2.642	0.00956	-0.079048	3	0.029916	yes	BRNSPC
chr1_814773_T_C_b38	RP11-206L10.9	3.836	0.000219	0.07244	4	0.018887	no	BRNSPC
chr1_794299_C_G_b38	RP11-206L10.9	-3.045	0.00298	-0.067594	3	0.022199	no	BRNSPC
chr1_813498_G_T_b38	RP11-206L10.9	-2.987	0.00354	-0.064899	3	0.021727	no	BRNSPC
chr1_789568_TATGGA_T_b38	RP11-206L10.9	-2.914	0.0044	-0.064202	4	0.022029	no	BRNSPC
chr1_799080_TG_T_b38	RP11-206L10.9	2.873	0.00496	0.051143	9	0.0178	no	BRNSPC
chr1_1533909_G_C_b38	RP11-206L10.9	2.671	0.00884	0.045221	18	0.016932	no	BRNSPC
chr1_1035169_TG_T_b38	RP11-206L10.9	-3.362	0.00115	-0.043695	13	0.012997	yes	BRNSNG
chr1_820560_C_T_b38	RP11-206L10.9	-3.185	0.002	-0.050927	3	0.015989	yes	BRNSNG
chr1_794299_C_G_b38	RP11-206L10.9	-3.185	0.002	-0.052368	5	0.016444	yes	BRNSNG
chr1_1750650_C_G_b38	RP11-206L10.9	2.881	0.00498	0.040657	9	0.014111	yes	BRNSNG
chr1_789568_TATGGA_T_b38	RP11-206L10.9	-2.808	0.00615	-0.049596	5	0.017665	yes	BRNSNG
chr1_1750658_T_C_b38	RP11-206L10.9	2.742	0.0074	0.037061	10	0.013517	yes	BRNSNG
chr1_1301426_A_AT_b38	RP11-206L10.9	4.261	5.09e-05	0.060949	7	0.014304	no	BRNSNG
chr1_1703565_T_C_b38	RP11-206L10.9	-2.876	0.00505	-0.035841	18	0.012462	no	BRNSNG
chr1_938178_G_T_b38	RP11-206L10.9	2.792	0.00642	0.036277	11	0.012992	no	BRNSNG
chr1_931513_T_C_b38	RP11-206L10.9	2.784	0.00658	0.034812	20	0.012507	no	BRNSNG
chr1_1586987_G_A_b38	RP11-206L10.9	2.755	0.00713	0.038656	9	0.014031	no	BRNSNG
chr1_1586956_T_C_b38	RP11-206L10.9	2.725	0.00775	0.038352	10	0.014072	no	BRNSNG
chr1_1147410_C_A_b38	RP11-206L10.9	-2.724	0.00778	-0.041584	3	0.015266	no	BRNSNG
chr1_818094_C_G_b38	RP11-206L10.9	-2.695	0.00842	-0.048887	4	0.018137	no	BRNSNG
chr1_923311_TG_T_b38	RP11-206L10.9	2.636	0.00991	0.037424	7	0.014196	no	BRNSNG
chr1_923421_A_G_b38	RP11-206L10.9	2.636	0.00991	0.037424	7	0.014196	no	BRNSNG
chr1_812761_G_A_b38	RP11-206L10.9	8.65	2.42e-16	0.128273	4	0.01483	yes	BREAST
chr1_800909_T_A_b38	RP11-206L10.9	6.343	7.53e-10	0.074128	4	0.011686	yes	BREAST
chr1_808924_C_T_b38	RP11-206L10.9	-6.269	1.15e-09	-0.071572	6	0.011416	yes	BREAST
chr1_807692_C_A_b38	RP11-206L10.9	-6.013	4.89e-09	-0.101494	6	0.016878	yes	BREAST
chr1_817186_G_A_b38	RP11-206L10.9	-5.973	6.12e-09	-0.067327	20	0.011272	yes	BREAST
chr1_817341_A_G_b38	RP11-206L10.9	-5.852	1.19e-08	-0.065335	26	0.011165	yes	BREAST
chr1_825532_C_T_b38	RP11-206L10.9	-5.823	1.39e-08	-0.065943	18	0.011325	yes	BREAST
chr1_825767_T_C_b38	RP11-206L10.9	-5.823	1.39e-08	-0.065943	18	0.011325	yes	BREAST
chr1_817514_T_C_b38	RP11-206L10.9	-5.82	1.41e-08	-0.063188	18	0.010857	yes	BREAST
chr1_826577_A_AT_b38	RP11-206L10.9	-5.773	1.82e-08	-0.064925	19	0.011246	yes	BREAST
chr1_790933_CGAATGGAATG_C_b38	RP11-206L10.9	-5.761	1.94e-08	-0.054293	28	0.009424	yes	BREAST
chr1_789568_TATGGA_T_b38	RP11-206L10.9	-5.692	2.81e-08	-0.061565	30	0.010816	yes	BREAST
chr1_771398_G_A_b38	RP11-206L10.9	-5.673	3.1e-08	-0.055542	49	0.00979	yes	BREAST
chr1_824320_T_C_b38	RP11-206L10.9	-5.661	3.31e-08	-0.062828	20	0.011099	yes	BREAST
chr1_819123_G_A_b38	RP11-206L10.9	-5.658	3.36e-08	-0.063037	24	0.011141	yes	BREAST
chr1_819584_C_T_b38	RP11-206L10.9	-5.658	3.36e-08	-0.063037	24	0.011141	yes	BREAST
chr1_818094_C_G_b38	RP11-206L10.9	-5.537	6.37e-08	-0.062329	31	0.011258	yes	BREAST
chr1_624836_G_A_b38	RP11-206L10.9	5.529	6.63e-08	0.111323	3	0.020135	yes	BREAST
chr1_820560_C_T_b38	RP11-206L10.9	-5.464	9.28e-08	-0.059056	21	0.010808	yes	BREAST
chr1_794299_C_G_b38	RP11-206L10.9	-5.375	1.47e-07	-0.059715	27	0.01111	yes	BREAST
chr1_821000_T_A_b38	RP11-206L10.9	-4.977	1.05e-06	-0.055489	20	0.011149	yes	BREAST
chr1_813498_G_T_b38	RP11-206L10.9	-4.943	1.23e-06	-0.052932	26	0.010708	yes	BREAST
chr1_799082_G_A_b38	RP11-206L10.9	-4.697	3.9e-06	-0.056488	7	0.012026	yes	BREAST
chr1_814476_C_T_b38	RP11-206L10.9	-4.681	4.19e-06	-0.052537	18	0.011222	yes	BREAST
chr1_813885_G_A_b38	RP11-206L10.9	-3.9	0.000117	-0.035088	82	0.008997	yes	BREAST
chr1_822427_CCCTGGCCAGCAGATCCACCCTGTCTATACTACCTG_C_b38	RP11-206L10.9	-3.495	0.000539	-0.04022	18	0.011507	yes	BREAST
chr1_624767_T_G_b38	RP11-206L10.9	3.439	0.00066	0.041264	3	0.011999	yes	BREAST
chr1_851430_G_A_b38	RP11-206L10.9	-3.12	0.00197	-0.0632	7	0.020255	yes	BREAST
chr1_799080_TG_T_b38	RP11-206L10.9	3.107	0.00206	0.03286	19	0.010577	yes	BREAST
chr1_1413406_G_A_b38	RP11-206L10.9	3.068	0.00234	0.057723	4	0.018817	yes	BREAST
chr1_1412042_ATCTAGGTCCCAGGTCCCAGGTCCGTCTAGGTCCCAGGTCCG_A_b38	RP11-206L10.9	3.022	0.00271	0.053273	5	0.017627	yes	BREAST
chr1_272675_G_A_b38	RP11-206L10.9	2.894	0.00406	0.034014	10	0.011751	yes	BREAST
chr1_1265603_T_TTGTG_b38	RP11-206L10.9	2.868	0.0044	0.031185	12	0.010873	yes	BREAST
chr1_1726162_T_C_b38	RP11-206L10.9	-2.868	0.0044	-0.024048	96	0.008385	yes	BREAST
chr1_828389_A_AT_b38	RP11-206L10.9	-2.835	0.00487	-0.028972	44	0.010219	yes	BREAST
chr1_590378_T_C_b38	RP11-206L10.9	2.82	0.0051	0.037606	21	0.013337	yes	BREAST
chr1_832873_A_C_b38	RP11-206L10.9	-2.786	0.00566	-0.027676	44	0.009935	yes	BREAST
chr1_1332779_C_T_b38	RP11-206L10.9	2.736	0.00657	0.041488	5	0.015166	yes	BREAST
chr1_823246_C_T_b38	RP11-206L10.9	-2.723	0.00682	-0.033145	18	0.012172	yes	BREAST
chr1_1402944_C_T_b38	RP11-206L10.9	2.692	0.00748	0.050596	4	0.018797	yes	BREAST
chr1_619417_C_T_b38	RP11-206L10.9	2.687	0.00759	0.027766	21	0.010335	yes	BREAST
chr1_1290579_C_G_b38	RP11-206L10.9	2.652	0.00839	0.031027	31	0.011698	yes	BREAST
chr1_586069_T_A_b38	RP11-206L10.9	2.615	0.00934	0.039439	8	0.015083	yes	BREAST
chr1_788814_G_A_b38	RP11-206L10.9	2.597	0.00983	0.062111	6	0.023915	yes	BREAST
chr1_800605_G_A_b38	RP11-206L10.9	10.11	4.51e-21	0.131588	6	0.013016	no	BREAST
chr1_788439_T_A_b38	RP11-206L10.9	10.108	4.57e-21	0.130727	7	0.012933	no	BREAST
chr1_778639_A_G_b38	RP11-206L10.9	10.074	5.98e-21	0.131208	7	0.013025	no	BREAST
chr1_809641_G_T_b38	RP11-206L10.9	9.882	2.61e-20	0.131004	6	0.013256	no	BREAST
chr1_677378_T_C_b38	RP11-206L10.9	9.432	7.97e-19	0.127307	5	0.013498	no	BREAST
chr1_777135_T_TC_b38	RP11-206L10.9	9.424	8.43e-19	0.133108	5	0.014124	no	BREAST
chr1_677290_A_G_b38	RP11-206L10.9	9.258	2.9e-18	0.127314	5	0.013751	no	BREAST
chr1_788418_CAG_C_b38	RP11-206L10.9	-9.162	5.89e-18	-0.117646	10	0.012841	no	BREAST
chr1_680742_A_T_b38	RP11-206L10.9	9.07	1.16e-17	0.136817	3	0.015084	no	BREAST
chr1_788511_G_C_b38	RP11-206L10.9	-8.838	6.25e-17	-0.113604	11	0.012854	no	BREAST
chr1_779047_G_A_b38	RP11-206L10.9	-8.666	2.15e-16	-0.112316	12	0.01296	no	BREAST
chr1_812899_A_T_b38	RP11-206L10.9	8.389	1.52e-15	0.117954	8	0.014061	no	BREAST
chr1_681103_T_A_b38	RP11-206L10.9	7.882	4.92e-14	0.127954	3	0.016234	no	BREAST
chr1_683167_G_A_b38	RP11-206L10.9	7.87	5.31e-14	0.095468	6	0.01213	no	BREAST
chr1_784109_C_CATAAT_b38	RP11-206L10.9	7.862	5.62e-14	0.120756	7	0.01536	no	BREAST
chr1_814619_A_G_b38	RP11-206L10.9	6.406	5.24e-10	0.121707	3	0.018999	no	BREAST
chr1_806017_A_G_b38	RP11-206L10.9	4.865	1.79e-06	0.089092	7	0.018312	no	BREAST
chr1_826420_A_T_b38	RP11-206L10.9	-4.3	2.26e-05	-0.04036	45	0.009386	no	BREAST
chr1_619415_C_G_b38	RP11-206L10.9	3.863	0.000135	0.056774	3	0.014695	no	BREAST
chr1_1303675_C_CCCT_b38	RP11-206L10.9	-2.863	0.00446	-0.036657	3	0.012802	no	BREAST
chr1_624752_C_T_b38	RP11-206L10.9	2.862	0.00448	0.034926	3	0.012204	no	BREAST
chr1_770988_A_G_b38	RP11-206L10.9	-2.85	0.00465	-0.02596	91	0.009109	no	BREAST
chr1_1415792_A_T_b38	RP11-206L10.9	2.839	0.00481	0.055437	3	0.019529	no	BREAST
chr1_1345112_C_T_b38	RP11-206L10.9	2.824	0.00504	0.047864	3	0.016949	no	BREAST
chr1_1346453_C_T_b38	RP11-206L10.9	2.824	0.00504	0.047864	3	0.016949	no	BREAST
chr1_791545_G_T_b38	RP11-206L10.9	-2.709	0.00711	-0.04221	11	0.015583	no	BREAST
chr1_696963_C_G_b38	RP11-206L10.9	2.693	0.00744	0.053204	7	0.019753	no	BREAST
chr1_1419780_C_A_b38	RP11-206L10.9	-2.644	0.00859	-0.068764	3	0.026008	no	BREAST
chr1_973858_G_C_b38	RP11-206L10.9	2.631	0.00891	0.023115	63	0.008785	no	BREAST
chr1_1334606_G_A_b38	RP11-206L10.9	2.606	0.00957	0.04403	3	0.016893	no	BREAST
chr1_1340576_C_T_b38	RP11-206L10.9	2.606	0.00957	0.04403	3	0.016893	no	BREAST
chr1_1341362_GAC_G_b38	RP11-206L10.9	2.606	0.00957	0.04403	3	0.016893	no	BREAST
chr1_677378_T_C_b38	RP11-206L10.9	10.549	3.45e-23	0.104724	4	0.009928	yes	CULTFB
chr1_682706_A_G_b38	RP11-206L10.9	7.694	1.06e-13	0.108197	4	0.014063	yes	CULTFB
chr1_800909_T_A_b38	RP11-206L10.9	6.182	1.52e-09	0.04743	5	0.007672	yes	CULTFB
chr1_813498_G_T_b38	RP11-206L10.9	-5.23	2.7e-07	-0.033281	35	0.006363	yes	CULTFB
chr1_598862_C_T_b38	RP11-206L10.9	4.927	1.21e-06	0.037666	4	0.007645	yes	CULTFB
chr1_680167_C_G_b38	RP11-206L10.9	4.257	2.56e-05	0.0705	3	0.016559	yes	CULTFB
chr1_674381_A_AT_b38	RP11-206L10.9	3.977	8.24e-05	0.027807	19	0.006992	yes	CULTFB
chr1_821000_T_A_b38	RP11-206L10.9	-3.841	0.000142	-0.026988	19	0.007027	yes	CULTFB
chr1_624752_C_T_b38	RP11-206L10.9	3.769	0.000187	0.028481	6	0.007556	yes	CULTFB
chr1_771398_G_A_b38	RP11-206L10.9	-3.605	0.000351	-0.022661	64	0.006287	yes	CULTFB
chr1_624509_A_G_b38	RP11-206L10.9	3.596	0.000363	0.025138	12	0.006991	yes	CULTFB
chr1_674562_T_C_b38	RP11-206L10.9	3.436	0.000651	0.024454	10	0.007118	yes	CULTFB
chr1_1388583_C_A_b38	RP11-206L10.9	-3.152	0.00174	-0.030222	3	0.009587	yes	CULTFB
chr1_799082_G_A_b38	RP11-206L10.9	-2.989	0.00297	-0.024892	7	0.008328	yes	CULTFB
chr1_696963_C_G_b38	RP11-206L10.9	2.897	0.00397	0.031182	12	0.010764	yes	CULTFB
chr1_591242_C_T_b38	RP11-206L10.9	2.896	0.00398	0.027232	12	0.009404	yes	CULTFB
chr1_1641642_T_C_b38	RP11-206L10.9	-2.877	0.00422	-0.017932	47	0.006232	yes	CULTFB
chr1_185795_G_T_b38	RP11-206L10.9	-2.818	0.00507	-0.026018	16	0.009234	yes	CULTFB
chr1_1498616_T_C_b38	RP11-206L10.9	-2.765	0.00594	-0.043372	4	0.015685	yes	CULTFB
chr1_591650_C_T_b38	RP11-206L10.9	2.739	0.00644	0.021488	8	0.007846	yes	CULTFB
chr1_905373_T_C_b38	RP11-206L10.9	2.688	0.00749	0.014127	87	0.005256	yes	CULTFB
chr1_97624_G_C_b38	RP11-206L10.9	-2.645	0.00849	-0.025032	15	0.009465	yes	CULTFB
chr1_1177318_C_CT_b38	RP11-206L10.9	-2.612	0.00932	-0.021992	5	0.008419	yes	CULTFB
chr1_777382_T_G_b38	RP11-206L10.9	9.732	2.77e-20	0.092343	3	0.009489	no	CULTFB
chr1_677290_A_G_b38	RP11-206L10.9	9.705	3.43e-20	0.098392	4	0.010138	no	CULTFB
chr1_800605_G_A_b38	RP11-206L10.9	9.487	1.93e-19	0.089555	5	0.00944	no	CULTFB
chr1_778639_A_G_b38	RP11-206L10.9	9.473	2.15e-19	0.089177	5	0.009413	no	CULTFB
chr1_788439_T_A_b38	RP11-206L10.9	9.33	6.59e-19	0.08693	6	0.009317	no	CULTFB
chr1_788418_CAG_C_b38	RP11-206L10.9	-8.9	1.79e-17	-0.081034	7	0.009105	no	CULTFB
chr1_809641_G_T_b38	RP11-206L10.9	8.467	4.46e-16	0.077927	8	0.009203	no	CULTFB
chr1_788511_G_C_b38	RP11-206L10.9	-8.381	8.37e-16	-0.076281	9	0.009102	no	CULTFB
chr1_681103_T_A_b38	RP11-206L10.9	8.191	3.3e-15	0.09485	4	0.01158	no	CULTFB
chr1_779047_G_A_b38	RP11-206L10.9	-8.125	5.27e-15	-0.073828	10	0.009086	no	CULTFB
chr1_812761_G_A_b38	RP11-206L10.9	7.917	2.27e-14	0.081067	3	0.010239	no	CULTFB
chr1_777135_T_TC_b38	RP11-206L10.9	7.596	2.08e-13	0.078984	4	0.010399	no	CULTFB
chr1_683167_G_A_b38	RP11-206L10.9	7.584	2.24e-13	0.062409	7	0.008229	no	CULTFB
chr1_812899_A_T_b38	RP11-206L10.9	7.271	1.81e-12	0.071223	7	0.009796	no	CULTFB
chr1_820560_C_T_b38	RP11-206L10.9	-6.215	1.26e-09	-0.042823	23	0.00689	no	CULTFB
chr1_784109_C_CATAAT_b38	RP11-206L10.9	6.042	3.4e-09	0.06396	6	0.010586	no	CULTFB
chr1_649157_C_T_b38	RP11-206L10.9	5.848	1.01e-08	0.071781	3	0.012274	no	CULTFB
chr1_817186_G_A_b38	RP11-206L10.9	-5.746	1.78e-08	-0.041347	22	0.007195	no	CULTFB
chr1_817514_T_C_b38	RP11-206L10.9	-5.727	1.97e-08	-0.041329	16	0.007217	no	CULTFB
chr1_825532_C_T_b38	RP11-206L10.9	-5.725	1.99e-08	-0.040803	19	0.007127	no	CULTFB
chr1_825767_T_C_b38	RP11-206L10.9	-5.725	1.99e-08	-0.040803	19	0.007127	no	CULTFB
chr1_826577_A_AT_b38	RP11-206L10.9	-5.714	2.12e-08	-0.040008	20	0.007002	no	CULTFB
chr1_824320_T_C_b38	RP11-206L10.9	-5.714	2.12e-08	-0.039869	22	0.006978	no	CULTFB
chr1_817341_A_G_b38	RP11-206L10.9	-5.535	5.55e-08	-0.039273	28	0.007096	no	CULTFB
chr1_819584_C_T_b38	RP11-206L10.9	-5.469	7.88e-08	-0.038882	25	0.00711	no	CULTFB
chr1_819123_G_A_b38	RP11-206L10.9	-5.422	1.01e-07	-0.038309	25	0.007066	no	CULTFB
chr1_790933_CGAATGGAATG_C_b38	RP11-206L10.9	-5.251	2.43e-07	-0.033366	37	0.006355	no	CULTFB
chr1_818094_C_G_b38	RP11-206L10.9	-5.177	3.53e-07	-0.036415	36	0.007034	no	CULTFB
chr1_794299_C_G_b38	RP11-206L10.9	-4.91	1.32e-06	-0.03412	30	0.00695	no	CULTFB
chr1_789568_TATGGA_T_b38	RP11-206L10.9	-4.887	1.47e-06	-0.033103	36	0.006774	no	CULTFB
chr1_808924_C_T_b38	RP11-206L10.9	-4.823	1.99e-06	-0.03779	8	0.007836	no	CULTFB
chr1_807692_C_A_b38	RP11-206L10.9	-4.818	2.04e-06	-0.055369	7	0.011491	no	CULTFB
chr1_624767_T_G_b38	RP11-206L10.9	4.707	3.43e-06	0.035372	5	0.007514	no	CULTFB
chr1_826420_A_T_b38	RP11-206L10.9	-4.449	1.11e-05	-0.025532	57	0.005739	no	CULTFB
chr1_814476_C_T_b38	RP11-206L10.9	-4.427	1.23e-05	-0.030759	18	0.006948	no	CULTFB
chr1_822427_CCCTGGCCAGCAGATCCACCCTGTCTATACTACCTG_C_b38	RP11-206L10.9	-3.911	0.000108	-0.02549	28	0.006518	no	CULTFB
chr1_791564_C_G_b38	RP11-206L10.9	-3.836	0.000144	-0.025096	50	0.006542	no	CULTFB
chr1_823246_C_T_b38	RP11-206L10.9	-3.2	0.00148	-0.023934	20	0.007479	no	CULTFB
chr1_98929_A_G_b38	RP11-206L10.9	3.075	0.00224	0.026663	8	0.00867	no	CULTFB
chr1_1276547_C_T_b38	RP11-206L10.9	3.068	0.0023	0.032434	7	0.010573	no	CULTFB
chr1_1276564_C_T_b38	RP11-206L10.9	3.068	0.0023	0.032434	7	0.010573	no	CULTFB
chr1_1279400_C_CTTT_b38	RP11-206L10.9	3.049	0.00244	0.045595	3	0.014953	no	CULTFB
chr1_1273803_G_GCGC_b38	RP11-206L10.9	2.931	0.00356	0.030875	7	0.010533	no	CULTFB
chr1_632644_A_G_b38	RP11-206L10.9	-2.867	0.00436	-0.023423	5	0.008171	no	CULTFB
chr1_198894_G_A_b38	RP11-206L10.9	-2.837	0.00477	-0.04055	5	0.014291	no	CULTFB
chr1_1179833_G_T_b38	RP11-206L10.9	-2.788	0.00555	-0.021646	11	0.007764	no	CULTFB
chr1_1181173_C_G_b38	RP11-206L10.9	-2.788	0.00555	-0.021646	11	0.007764	no	CULTFB
chr1_806017_A_G_b38	RP11-206L10.9	2.755	0.00614	0.034257	7	0.012436	no	CULTFB
chr1_1396571_G_GT_b38	RP11-206L10.9	2.73	0.00661	0.041097	3	0.015055	no	CULTFB
chr1_789680_A_AGGAATGGAAT_b38	RP11-206L10.9	-2.71	0.007	-0.015899	52	0.005866	no	CULTFB
chr1_1259165_A_T_b38	RP11-206L10.9	2.7	0.00721	0.030502	4	0.011295	no	CULTFB
chr1_667265_C_T_b38	RP11-206L10.9	2.682	0.00761	0.024665	25	0.009197	no	CULTFB
chr1_1274159_C_A_b38	RP11-206L10.9	2.68	0.00765	0.029658	5	0.011064	no	CULTFB
chr1_1275055_A_G_b38	RP11-206L10.9	2.68	0.00765	0.029658	5	0.011064	no	CULTFB
chr1_1275468_G_A_b38	RP11-206L10.9	2.68	0.00765	0.029658	5	0.011064	no	CULTFB
chr1_1276222_T_TG_b38	RP11-206L10.9	2.68	0.00765	0.029658	5	0.011064	no	CULTFB
chr1_1280815_C_A_b38	RP11-206L10.9	2.68	0.00765	0.029658	5	0.011064	no	CULTFB
chr1_1281168_TC_T_b38	RP11-206L10.9	2.68	0.00765	0.029658	5	0.011064	no	CULTFB
chr1_1281170_TGG_T_b38	RP11-206L10.9	2.68	0.00765	0.029658	5	0.011064	no	CULTFB
chr1_1263238_T_A_b38	RP11-206L10.9	2.673	0.00781	0.029474	6	0.011026	no	CULTFB
chr1_1268558_T_C_b38	RP11-206L10.9	2.673	0.00781	0.029474	6	0.011026	no	CULTFB
chr1_820395_A_G_b38	RP11-206L10.9	-2.663	0.00805	-0.019249	19	0.007228	no	CULTFB
chr1_1180851_T_C_b38	RP11-206L10.9	2.638	0.00866	0.025551	9	0.009686	no	CULTFB
chr1_1159292_A_C_b38	RP11-206L10.9	-4.532	1.38e-05	-0.071176	18	0.015707	yes	EBVTLC
chr1_1160239_C_G_b38	RP11-206L10.9	-4.15	6.22e-05	-0.067499	15	0.016265	yes	EBVTLC
chr1_1160818_C_T_b38	RP11-206L10.9	-4.035	9.6e-05	-0.062995	27	0.015612	yes	EBVTLC
chr1_1159358_A_G_b38	RP11-206L10.9	-3.991	0.000113	-0.062821	19	0.01574	yes	EBVTLC
chr1_1510082_T_TA_b38	RP11-206L10.9	3.982	0.000117	0.102592	3	0.025763	yes	EBVTLC
chr1_1159599_G_A_b38	RP11-206L10.9	-3.82	0.000212	-0.060296	25	0.015784	yes	EBVTLC
chr1_1159105_C_T_b38	RP11-206L10.9	-3.722	0.000301	-0.057758	29	0.015518	yes	EBVTLC
chr1_1160631_C_G_b38	RP11-206L10.9	-3.611	0.000445	-0.057118	29	0.015818	yes	EBVTLC
chr1_1161712_G_A_b38	RP11-206L10.9	-3.611	0.000445	-0.057118	29	0.015818	yes	EBVTLC
chr1_1158683_T_C_b38	RP11-206L10.9	3.149	0.00206	0.054127	15	0.017188	yes	EBVTLC
chr1_1324173_G_GGGCTCGGGGGCTGGGGGGCTGCTGGGCTGAGA_b38	RP11-206L10.9	-3.129	0.0022	-0.045889	8	0.014665	yes	EBVTLC
chr1_1641642_T_C_b38	RP11-206L10.9	3.022	0.00306	0.050723	20	0.016782	yes	EBVTLC
chr1_1159750_T_C_b38	RP11-206L10.9	2.924	0.00413	0.053813	10	0.018404	yes	EBVTLC
chr1_1220305_T_C_b38	RP11-206L10.9	-2.795	0.00604	-0.103976	3	0.037205	yes	EBVTLC
chr1_1161911_C_A_b38	RP11-206L10.9	2.779	0.00632	0.051667	10	0.01859	yes	EBVTLC
chr1_809641_G_T_b38	RP11-206L10.9	4.089	7.83e-05	0.100157	4	0.024493	no	EBVTLC
chr1_788511_G_C_b38	RP11-206L10.9	-3.878	0.000172	-0.097241	4	0.025074	no	EBVTLC
chr1_779047_G_A_b38	RP11-206L10.9	-3.53	0.000588	-0.08697	5	0.024636	no	EBVTLC
chr1_825532_C_T_b38	RP11-206L10.9	-3.275	0.00138	-0.067878	8	0.020726	no	EBVTLC
chr1_825767_T_C_b38	RP11-206L10.9	-3.275	0.00138	-0.067878	8	0.020726	no	EBVTLC
chr1_1035169_TG_T_b38	RP11-206L10.9	-3.253	0.00148	-0.058482	16	0.017975	no	EBVTLC
chr1_820560_C_T_b38	RP11-206L10.9	-3.17	0.00193	-0.062695	10	0.019777	no	EBVTLC
chr1_818094_C_G_b38	RP11-206L10.9	-3.16	0.00199	-0.065449	17	0.020712	no	EBVTLC
chr1_824320_T_C_b38	RP11-206L10.9	-3.143	0.0021	-0.063252	9	0.020122	no	EBVTLC
chr1_789568_TATGGA_T_b38	RP11-206L10.9	-3.136	0.00215	-0.059567	16	0.018992	no	EBVTLC
chr1_808924_C_T_b38	RP11-206L10.9	-3.056	0.00276	-0.067197	4	0.021988	no	EBVTLC
chr1_794299_C_G_b38	RP11-206L10.9	-3.048	0.00283	-0.061597	12	0.020209	no	EBVTLC
chr1_826420_A_T_b38	RP11-206L10.9	-3.046	0.00285	-0.050488	21	0.016576	no	EBVTLC
chr1_817186_G_A_b38	RP11-206L10.9	-2.988	0.0034	-0.063725	9	0.021326	no	EBVTLC
chr1_817514_T_C_b38	RP11-206L10.9	-2.977	0.00351	-0.064105	6	0.02153	no	EBVTLC
chr1_1585973_T_TAATAATAATAATAATAATAATAAA_b38	RP11-206L10.9	-2.973	0.00356	-0.072565	7	0.024409	no	EBVTLC
chr1_819123_G_A_b38	RP11-206L10.9	-2.957	0.00373	-0.061569	12	0.020818	no	EBVTLC
chr1_819584_C_T_b38	RP11-206L10.9	-2.957	0.00373	-0.061569	12	0.020818	no	EBVTLC
chr1_826577_A_AT_b38	RP11-206L10.9	-2.957	0.00373	-0.059784	9	0.020215	no	EBVTLC
chr1_812899_A_T_b38	RP11-206L10.9	2.837	0.00535	0.079363	3	0.027978	no	EBVTLC
chr1_817341_A_G_b38	RP11-206L10.9	-2.824	0.00555	-0.05892	13	0.020865	no	EBVTLC
chr1_1684789_C_CAAAA_b38	RP11-206L10.9	2.81	0.00578	0.100015	3	0.035589	no	EBVTLC
chr1_1026447_G_A_b38	RP11-206L10.9	2.764	0.00661	0.061562	6	0.022274	no	EBVTLC
chr1_1027869_C_T_b38	RP11-206L10.9	2.755	0.00677	0.063286	4	0.022969	no	EBVTLC
chr1_799080_TG_T_b38	RP11-206L10.9	2.685	0.00827	0.050122	9	0.018667	no	EBVTLC
chr1_607319_T_C_b38	RP11-206L10.9	2.62	0.00993	0.055231	6	0.021083	no	EBVTLC
chr1_800909_T_A_b38	RP11-206L10.9	5.043	8.56e-07	0.065568	5	0.013002	yes	CLNSGM
chr1_814476_C_T_b38	RP11-206L10.9	-4.778	2.96e-06	-0.060992	12	0.012766	yes	CLNSGM
chr1_794299_C_G_b38	RP11-206L10.9	-4.033	7.22e-05	-0.052328	18	0.012974	yes	CLNSGM
chr1_1425464_CA_C_b38	RP11-206L10.9	-3.934	0.000107	-0.05991	3	0.01523	yes	CLNSGM
chr1_814773_T_C_b38	RP11-206L10.9	3.819	0.000167	0.051447	4	0.01347	yes	CLNSGM
chr1_1705856_G_A_b38	RP11-206L10.9	3.786	0.00019	0.034318	94	0.009065	yes	CLNSGM
chr1_586069_T_A_b38	RP11-206L10.9	3.591	0.000393	0.072033	3	0.020057	yes	CLNSGM
chr1_624509_A_G_b38	RP11-206L10.9	3.46	0.00063	0.044521	10	0.012866	yes	CLNSGM
chr1_1705799_A_G_b38	RP11-206L10.9	3.153	0.00181	0.029439	93	0.009338	yes	CLNSGM
chr1_1134062_C_T_b38	RP11-206L10.9	-3.118	0.00202	-0.031743	33	0.01018	yes	CLNSGM
chr1_1134070_C_T_b38	RP11-206L10.9	-3.1	0.00215	-0.031286	34	0.010093	yes	CLNSGM
chr1_1425135_T_C_b38	RP11-206L10.9	-3.096	0.00217	-0.055251	4	0.017844	yes	CLNSGM
chr1_813498_G_T_b38	RP11-206L10.9	-2.995	0.00301	-0.03723	14	0.012432	yes	CLNSGM
chr1_624752_C_T_b38	RP11-206L10.9	2.986	0.00309	0.040777	4	0.013656	yes	CLNSGM
chr1_1648852_C_T_b38	RP11-206L10.9	-2.907	0.00397	-0.058712	3	0.0202	yes	CLNSGM
chr1_1428763_A_G_b38	RP11-206L10.9	-2.849	0.00473	-0.050183	7	0.017615	yes	CLNSGM
chr1_1134040_G_C_b38	RP11-206L10.9	-2.848	0.00475	-0.029622	28	0.010402	yes	CLNSGM
chr1_674562_T_C_b38	RP11-206L10.9	2.845	0.00479	0.036913	5	0.012974	yes	CLNSGM
chr1_789568_TATGGA_T_b38	RP11-206L10.9	-2.844	0.0048	-0.036205	19	0.012728	yes	CLNSGM
chr1_1457071_C_T_b38	RP11-206L10.9	2.792	0.00562	0.035442	13	0.012693	yes	CLNSGM
chr1_1426771_G_C_b38	RP11-206L10.9	-2.779	0.00584	-0.051851	3	0.018655	yes	CLNSGM
chr1_1427080_C_T_b38	RP11-206L10.9	-2.752	0.00633	-0.049797	4	0.018093	yes	CLNSGM
chr1_1134095_AAAAAAAG_A_b38	RP11-206L10.9	2.741	0.00655	0.026677	58	0.009733	yes	CLNSGM
chr1_1716097_C_T_b38	RP11-206L10.9	2.718	0.007	0.05278	4	0.019417	yes	CLNSGM
chr1_1721125_G_A_b38	RP11-206L10.9	2.718	0.007	0.05278	4	0.019417	yes	CLNSGM
chr1_1758687_A_AAC_b38	RP11-206L10.9	2.703	0.00733	0.044357	8	0.016413	yes	CLNSGM
chr1_1724035_G_A_b38	RP11-206L10.9	2.695	0.00749	0.035137	29	0.013036	yes	CLNSGM
chr1_1425750_T_C_b38	RP11-206L10.9	-2.695	0.0075	-0.048943	4	0.018163	yes	CLNSGM
chr1_1425822_C_G_b38	RP11-206L10.9	-2.695	0.0075	-0.048943	4	0.018163	yes	CLNSGM
chr1_1425936_G_A_b38	RP11-206L10.9	-2.695	0.0075	-0.048943	4	0.018163	yes	CLNSGM
chr1_285746_C_T_b38	RP11-206L10.9	-2.642	0.00875	-0.050497	5	0.019116	yes	CLNSGM
chr1_1398056_C_A_b38	RP11-206L10.9	2.637	0.00886	0.02752	44	0.010436	yes	CLNSGM
chr1_1753774_C_G_b38	RP11-206L10.9	2.619	0.00934	0.043112	7	0.016462	yes	CLNSGM
chr1_778639_A_G_b38	RP11-206L10.9	7.472	1.18e-12	0.13083	3	0.017509	no	CLNSGM
chr1_788439_T_A_b38	RP11-206L10.9	7.472	1.18e-12	0.13083	3	0.017509	no	CLNSGM
chr1_800605_G_A_b38	RP11-206L10.9	7.472	1.18e-12	0.13083	3	0.017509	no	CLNSGM
chr1_788418_CAG_C_b38	RP11-206L10.9	-7.263	4.32e-12	-0.126566	4	0.017425	no	CLNSGM
chr1_809641_G_T_b38	RP11-206L10.9	6.769	8.49e-11	0.119384	4	0.017638	no	CLNSGM
chr1_779047_G_A_b38	RP11-206L10.9	-6.686	1.37e-10	-0.114467	7	0.01712	no	CLNSGM
chr1_788511_G_C_b38	RP11-206L10.9	-6.686	1.37e-10	-0.114467	7	0.01712	no	CLNSGM
chr1_812761_G_A_b38	RP11-206L10.9	6.473	4.7e-10	0.123506	3	0.019079	no	CLNSGM
chr1_812899_A_T_b38	RP11-206L10.9	6.082	4.18e-09	0.111243	5	0.018291	no	CLNSGM
chr1_784109_C_CATAAT_b38	RP11-206L10.9	5.757	2.39e-08	0.110154	3	0.019134	no	CLNSGM
chr1_1648518_T_TGCACAC_b38	RP11-206L10.9	-4.42	1.45e-05	-0.114499	4	0.025904	no	CLNSGM
chr1_799082_G_A_b38	RP11-206L10.9	-4.273	2.71e-05	-0.061464	6	0.014386	no	CLNSGM
chr1_820560_C_T_b38	RP11-206L10.9	-4.263	2.81e-05	-0.052219	16	0.012249	no	CLNSGM
chr1_799080_TG_T_b38	RP11-206L10.9	3.726	0.000238	0.048411	13	0.012994	no	CLNSGM
chr1_817514_T_C_b38	RP11-206L10.9	-3.643	0.000325	-0.04573	12	0.012553	no	CLNSGM
chr1_825532_C_T_b38	RP11-206L10.9	-3.57	0.000424	-0.047168	11	0.013212	no	CLNSGM
chr1_825767_T_C_b38	RP11-206L10.9	-3.57	0.000424	-0.047168	11	0.013212	no	CLNSGM
chr1_826577_A_AT_b38	RP11-206L10.9	-3.547	0.000462	-0.045942	13	0.012954	no	CLNSGM
chr1_824320_T_C_b38	RP11-206L10.9	-3.546	0.000462	-0.046453	12	0.013099	no	CLNSGM
chr1_817186_G_A_b38	RP11-206L10.9	-3.427	0.000709	-0.045615	11	0.013312	no	CLNSGM
chr1_1451726_A_G_b38	RP11-206L10.9	-3.37	0.000864	-0.093557	3	0.02776	no	CLNSGM
chr1_791564_C_G_b38	RP11-206L10.9	-3.162	0.00175	-0.038348	25	0.012127	no	CLNSGM
chr1_819123_G_A_b38	RP11-206L10.9	-3.154	0.0018	-0.041757	17	0.013239	no	CLNSGM
chr1_819584_C_T_b38	RP11-206L10.9	-3.154	0.0018	-0.041757	17	0.013239	no	CLNSGM
chr1_1623412_T_C_b38	RP11-206L10.9	3.1	0.00215	0.058106	3	0.018747	no	CLNSGM
chr1_818094_C_G_b38	RP11-206L10.9	-3.059	0.00245	-0.040639	22	0.013286	no	CLNSGM
chr1_817341_A_G_b38	RP11-206L10.9	-3.01	0.00286	-0.040146	17	0.013336	no	CLNSGM
chr1_624767_T_G_b38	RP11-206L10.9	2.915	0.00386	0.040317	3	0.01383	no	CLNSGM
chr1_806017_A_G_b38	RP11-206L10.9	2.809	0.00535	0.065816	5	0.023434	no	CLNSGM
chr1_641162_T_C_b38	RP11-206L10.9	-2.797	0.00554	-0.043762	6	0.015646	no	CLNSGM
chr1_1694689_C_CA_b38	RP11-206L10.9	2.791	0.00565	0.074364	4	0.026647	no	CLNSGM
chr1_650815_G_T_b38	RP11-206L10.9	-2.769	0.00602	-0.057514	10	0.020769	no	CLNSGM
chr1_1045707_A_G_b38	RP11-206L10.9	2.704	0.0073	0.037819	10	0.013985	no	CLNSGM
chr1_631495_C_T_b38	RP11-206L10.9	-2.685	0.00772	-0.091526	3	0.034088	no	CLNSGM
chr1_1720192_T_G_b38	RP11-206L10.9	2.674	0.00797	0.026709	85	0.009989	no	CLNSGM
chr1_1425013_C_T_b38	RP11-206L10.9	-2.67	0.00806	-0.044589	20	0.0167	no	CLNSGM
chr1_1757030_C_G_b38	RP11-206L10.9	2.659	0.00833	0.043504	7	0.016363	no	CLNSGM
chr1_1042190_G_A_b38	RP11-206L10.9	2.615	0.00945	0.036114	16	0.013812	no	CLNSGM
chr1_1039282_G_T_b38	RP11-206L10.9	2.597	0.00994	0.037554	8	0.014461	no	CLNSGM
chr1_1715838_C_T_b38	RP11-206L10.9	2.595	0.00999	0.026254	89	0.010117	no	CLNSGM
chr1_677290_A_G_b38	RP11-206L10.9	9.67	2.09e-19	0.144801	4	0.014975	yes	CLNTRN
chr1_677378_T_C_b38	RP11-206L10.9	9.247	4.66e-18	0.138773	4	0.015007	yes	CLNTRN
chr1_817186_G_A_b38	RP11-206L10.9	-5.571	5.67e-08	-0.062365	20	0.011194	yes	CLNTRN
chr1_812761_G_A_b38	RP11-206L10.9	5.562	5.96e-08	0.085526	8	0.015378	yes	CLNTRN
chr1_817341_A_G_b38	RP11-206L10.9	-5.325	2e-07	-0.059935	28	0.011256	yes	CLNTRN
chr1_668125_A_C_b38	RP11-206L10.9	5.177	4.17e-07	0.123852	3	0.023925	yes	CLNTRN
chr1_814773_T_C_b38	RP11-206L10.9	4.998	9.92e-07	0.057784	8	0.011562	yes	CLNTRN
chr1_818094_C_G_b38	RP11-206L10.9	-4.986	1.05e-06	-0.057432	34	0.011518	yes	CLNTRN
chr1_789568_TATGGA_T_b38	RP11-206L10.9	-4.588	6.61e-06	-0.051287	29	0.011179	yes	CLNTRN
chr1_800909_T_A_b38	RP11-206L10.9	4.495	9.98e-06	0.054201	3	0.012058	yes	CLNTRN
chr1_790933_CGAATGGAATG_C_b38	RP11-206L10.9	-4.007	7.79e-05	-0.042015	25	0.010486	yes	CLNTRN
chr1_808924_C_T_b38	RP11-206L10.9	-3.959	9.43e-05	-0.046789	12	0.011819	yes	CLNTRN
chr1_624752_C_T_b38	RP11-206L10.9	3.521	0.000497	0.045193	3	0.012835	yes	CLNTRN
chr1_799082_G_A_b38	RP11-206L10.9	-3.518	0.000503	-0.043278	10	0.012303	yes	CLNTRN
chr1_814617_A_G_b38	RP11-206L10.9	-3.459	0.000621	-0.032173	39	0.009301	yes	CLNTRN
chr1_624767_T_G_b38	RP11-206L10.9	3.441	0.000663	0.044023	3	0.012795	yes	CLNTRN
chr1_1585973_T_A_b38	RP11-206L10.9	3.081	0.00226	0.040052	17	0.013001	yes	CLNTRN
chr1_791564_C_G_b38	RP11-206L10.9	-3.013	0.00281	-0.031373	48	0.010413	yes	CLNTRN
chr1_1708644_AAAAC_A_b38	RP11-206L10.9	-2.883	0.00423	-0.050536	5	0.017529	yes	CLNTRN
chr1_674562_T_C_b38	RP11-206L10.9	2.684	0.00768	0.030072	8	0.011203	yes	CLNTRN
chr1_1702441_T_C_b38	RP11-206L10.9	-2.67	0.008	-0.043281	7	0.016211	yes	CLNTRN
chr1_624509_A_G_b38	RP11-206L10.9	2.661	0.00823	0.031686	7	0.011909	yes	CLNTRN
chr1_98929_A_G_b38	RP11-206L10.9	2.654	0.00839	0.038378	4	0.014461	yes	CLNTRN
chr1_806017_A_G_b38	RP11-206L10.9	2.636	0.00882	0.048588	12	0.01843	yes	CLNTRN
chr1_777382_T_G_b38	RP11-206L10.9	7.888	5.92e-14	0.117927	3	0.01495	no	CLNTRN
chr1_800605_G_A_b38	RP11-206L10.9	7.641	3e-13	0.108218	9	0.014163	no	CLNTRN
chr1_809641_G_T_b38	RP11-206L10.9	7.345	2e-12	0.101782	12	0.013857	no	CLNTRN
chr1_778639_A_G_b38	RP11-206L10.9	7.245	3.73e-12	0.103737	10	0.014318	no	CLNTRN
chr1_788439_T_A_b38	RP11-206L10.9	7.165	6.15e-12	0.101719	9	0.014196	no	CLNTRN
chr1_783406_A_AT_b38	RP11-206L10.9	6.708	9.96e-11	0.097176	5	0.014487	no	CLNTRN
chr1_788418_CAG_C_b38	RP11-206L10.9	-6.3	1.07e-09	-0.088984	12	0.014124	no	CLNTRN
chr1_784109_C_CATAAT_b38	RP11-206L10.9	6.229	1.6e-09	0.094426	9	0.015159	no	CLNTRN
chr1_788511_G_C_b38	RP11-206L10.9	-6.157	2.4e-09	-0.084559	16	0.013733	no	CLNTRN
chr1_812899_A_T_b38	RP11-206L10.9	5.914	9.16e-09	0.087008	14	0.014712	no	CLNTRN
chr1_777135_T_TC_b38	RP11-206L10.9	5.875	1.13e-08	0.090028	8	0.015323	no	CLNTRN
chr1_779047_G_A_b38	RP11-206L10.9	-5.87	1.16e-08	-0.08202	18	0.013973	no	CLNTRN
chr1_814476_C_T_b38	RP11-206L10.9	-5.634	4.09e-08	-0.064092	22	0.011376	no	CLNTRN
chr1_683167_G_A_b38	RP11-206L10.9	5.399	1.37e-07	0.071925	5	0.013322	no	CLNTRN
chr1_820560_C_T_b38	RP11-206L10.9	-5.288	2.4e-07	-0.056853	20	0.010751	no	CLNTRN
chr1_826577_A_AT_b38	RP11-206L10.9	-5.269	2.64e-07	-0.05903	17	0.011203	no	CLNTRN
chr1_825532_C_T_b38	RP11-206L10.9	-5.222	3.34e-07	-0.059488	16	0.011393	no	CLNTRN
chr1_825767_T_C_b38	RP11-206L10.9	-5.222	3.34e-07	-0.059488	16	0.011393	no	CLNTRN
chr1_817514_T_C_b38	RP11-206L10.9	-5.055	7.54e-07	-0.056302	14	0.011138	no	CLNTRN
chr1_824320_T_C_b38	RP11-206L10.9	-5.009	9.43e-07	-0.056069	18	0.011195	no	CLNTRN
chr1_819584_C_T_b38	RP11-206L10.9	-4.989	1.03e-06	-0.057126	24	0.01145	no	CLNTRN
chr1_819123_G_A_b38	RP11-206L10.9	-4.922	1.42e-06	-0.055857	24	0.011348	no	CLNTRN
chr1_794299_C_G_b38	RP11-206L10.9	-4.539	8.21e-06	-0.052671	28	0.011604	no	CLNTRN
chr1_826420_A_T_b38	RP11-206L10.9	-4.496	9.95e-06	-0.042949	38	0.009553	no	CLNTRN
chr1_820395_A_G_b38	RP11-206L10.9	-3.818	0.000164	-0.044827	16	0.011742	no	CLNTRN
chr1_813498_G_T_b38	RP11-206L10.9	-3.573	0.000412	-0.038987	23	0.010912	no	CLNTRN
chr1_771398_G_A_b38	RP11-206L10.9	-3.194	0.00155	-0.033928	54	0.010623	no	CLNTRN
chr1_822427_CCCTGGCCAGCAGATCCACCCTGTCTATACTACCTG_C_b38	RP11-206L10.9	-3.103	0.0021	-0.034041	21	0.010969	no	CLNTRN
chr1_1718663_C_T_b38	RP11-206L10.9	2.806	0.00535	0.034189	26	0.012185	no	CLNTRN
chr1_1716769_C_T_b38	RP11-206L10.9	2.747	0.00637	0.037987	18	0.013826	no	CLNTRN
chr1_681041_T_C_b38	RP11-206L10.9	-2.735	0.00662	-0.030981	9	0.011329	no	CLNTRN
chr1_1722360_C_T_b38	RP11-206L10.9	2.724	0.00684	0.038114	14	0.013994	no	CLNTRN
chr1_1396571_G_GT_b38	RP11-206L10.9	2.714	0.00704	0.057455	5	0.021173	no	CLNTRN
chr1_1718040_T_TAG_b38	RP11-206L10.9	2.679	0.00779	0.035835	20	0.013375	no	CLNTRN
chr1_1715546_C_T_b38	RP11-206L10.9	2.633	0.0089	0.034093	21	0.012948	no	CLNTRN
chr1_799080_TG_T_b38	RP11-206L10.9	2.629	0.009	0.028673	22	0.010904	no	CLNTRN
chr1_1718200_G_A_b38	RP11-206L10.9	2.607	0.0096	0.034316	20	0.013164	no	CLNTRN
chr1_812761_G_A_b38	RP11-206L10.9	7.179	6.61e-12	0.118159	4	0.016459	yes	ESPGSJ
chr1_777135_T_TC_b38	RP11-206L10.9	6.984	2.17e-11	0.117268	4	0.016791	yes	ESPGSJ
chr1_826577_A_AT_b38	RP11-206L10.9	-5.589	5.53e-08	-0.065858	13	0.011784	yes	ESPGSJ
chr1_817341_A_G_b38	RP11-206L10.9	-5.529	7.5e-08	-0.064754	22	0.011711	yes	ESPGSJ
chr1_817186_G_A_b38	RP11-206L10.9	-5.488	9.26e-08	-0.06398	17	0.011658	yes	ESPGSJ
chr1_800909_T_A_b38	RP11-206L10.9	5.218	3.58e-07	0.063898	6	0.012246	yes	ESPGSJ
chr1_818094_C_G_b38	RP11-206L10.9	-5.084	6.85e-07	-0.059619	27	0.011726	yes	ESPGSJ
chr1_820560_C_T_b38	RP11-206L10.9	-5.034	8.7e-07	-0.056738	19	0.01127	yes	ESPGSJ
chr1_799082_G_A_b38	RP11-206L10.9	-4.659	4.95e-06	-0.063466	4	0.013621	yes	ESPGSJ
chr1_814476_C_T_b38	RP11-206L10.9	-4.046	6.78e-05	-0.051521	16	0.012734	yes	ESPGSJ
chr1_771398_G_A_b38	RP11-206L10.9	-3.645	0.00032	-0.037839	47	0.01038	yes	ESPGSJ
chr1_807808_G_A_b38	RP11-206L10.9	3.401	0.000773	0.085117	3	0.02503	yes	ESPGSJ
chr1_823246_C_T_b38	RP11-206L10.9	-3.36	0.000891	-0.040393	14	0.012023	yes	ESPGSJ
chr1_822427_CCCTGGCCAGCAGATCCACCCTGTCTATACTACCTG_C_b38	RP11-206L10.9	-3.205	0.00151	-0.037455	17	0.011688	yes	ESPGSJ
chr1_820395_A_G_b38	RP11-206L10.9	-3.064	0.0024	-0.035733	14	0.011663	yes	ESPGSJ
chr1_598862_C_T_b38	RP11-206L10.9	3.049	0.00252	0.040654	4	0.013331	yes	ESPGSJ
chr1_1171093_G_A_b38	RP11-206L10.9	2.978	0.00316	0.036299	28	0.012187	yes	ESPGSJ
chr1_1595306_CAG_C_b38	RP11-206L10.9	2.887	0.00419	0.029685	66	0.010281	yes	ESPGSJ
chr1_1047133_T_C_b38	RP11-206L10.9	2.88	0.00429	0.047573	4	0.016519	yes	ESPGSJ
chr1_1045707_A_G_b38	RP11-206L10.9	2.779	0.00583	0.043049	6	0.015491	yes	ESPGSJ
chr1_1274159_C_A_b38	RP11-206L10.9	2.773	0.00594	0.052878	3	0.01907	yes	ESPGSJ
chr1_1275055_A_G_b38	RP11-206L10.9	2.773	0.00594	0.052878	3	0.01907	yes	ESPGSJ
chr1_1275468_G_A_b38	RP11-206L10.9	2.773	0.00594	0.052878	3	0.01907	yes	ESPGSJ
chr1_1276222_T_TG_b38	RP11-206L10.9	2.773	0.00594	0.052878	3	0.01907	yes	ESPGSJ
chr1_1280815_C_A_b38	RP11-206L10.9	2.773	0.00594	0.052878	3	0.01907	yes	ESPGSJ
chr1_1281168_TC_T_b38	RP11-206L10.9	2.773	0.00594	0.052878	3	0.01907	yes	ESPGSJ
chr1_1281170_TGG_T_b38	RP11-206L10.9	2.773	0.00594	0.052878	3	0.01907	yes	ESPGSJ
chr1_1423775_C_T_b38	RP11-206L10.9	2.742	0.00652	0.046265	4	0.016876	yes	ESPGSJ
chr1_674562_T_C_b38	RP11-206L10.9	2.741	0.00653	0.031747	11	0.011583	yes	ESPGSJ
chr1_1627156_G_A_b38	RP11-206L10.9	2.687	0.00765	0.039522	6	0.014707	yes	ESPGSJ
chr1_1778596_C_T_b38	RP11-206L10.9	2.643	0.0087	0.028558	23	0.010806	yes	ESPGSJ
chr1_1038288_A_G_b38	RP11-206L10.9	2.634	0.00891	0.040457	4	0.015357	yes	ESPGSJ
chr1_1035844_A_G_b38	RP11-206L10.9	2.613	0.00947	0.040137	4	0.01536	yes	ESPGSJ
chr1_1037956_A_G_b38	RP11-206L10.9	2.613	0.00947	0.040137	4	0.01536	yes	ESPGSJ
chr1_1037997_G_A_b38	RP11-206L10.9	2.613	0.00947	0.040137	4	0.01536	yes	ESPGSJ
chr1_1038800_G_T_b38	RP11-206L10.9	2.613	0.00947	0.040137	4	0.01536	yes	ESPGSJ
chr1_1038819_C_T_b38	RP11-206L10.9	2.613	0.00947	0.040137	4	0.01536	yes	ESPGSJ
chr1_1038845_A_G_b38	RP11-206L10.9	2.613	0.00947	0.040137	4	0.01536	yes	ESPGSJ
chr1_1038916_A_G_b38	RP11-206L10.9	2.613	0.00947	0.040137	4	0.01536	yes	ESPGSJ
chr1_1038975_G_A_b38	RP11-206L10.9	2.613	0.00947	0.040137	4	0.01536	yes	ESPGSJ
chr1_1038976_T_C_b38	RP11-206L10.9	2.613	0.00947	0.040137	4	0.01536	yes	ESPGSJ
chr1_1039114_G_T_b38	RP11-206L10.9	2.613	0.00947	0.040137	4	0.01536	yes	ESPGSJ
chr1_1039190_T_G_b38	RP11-206L10.9	2.613	0.00947	0.040137	4	0.01536	yes	ESPGSJ
chr1_1039753_T_A_b38	RP11-206L10.9	2.613	0.00947	0.040137	4	0.01536	yes	ESPGSJ
chr1_1040322_A_G_b38	RP11-206L10.9	2.613	0.00947	0.040137	4	0.01536	yes	ESPGSJ
chr1_788439_T_A_b38	RP11-206L10.9	8.008	3.34e-14	0.124234	4	0.015513	no	ESPGSJ
chr1_809641_G_T_b38	RP11-206L10.9	7.942	5.17e-14	0.122056	5	0.015368	no	ESPGSJ
chr1_800605_G_A_b38	RP11-206L10.9	7.907	6.51e-14	0.122167	5	0.015451	no	ESPGSJ
chr1_778639_A_G_b38	RP11-206L10.9	7.772	1.56e-13	0.119579	5	0.015385	no	ESPGSJ
chr1_788418_CAG_C_b38	RP11-206L10.9	-7.132	8.81e-12	-0.109848	5	0.015402	no	ESPGSJ
chr1_788511_G_C_b38	RP11-206L10.9	-6.937	2.89e-11	-0.10474	7	0.0151	no	ESPGSJ
chr1_779047_G_A_b38	RP11-206L10.9	-6.676	1.36e-10	-0.099786	9	0.014947	no	ESPGSJ
chr1_812899_A_T_b38	RP11-206L10.9	5.622	4.64e-08	0.09619	6	0.017109	no	ESPGSJ
chr1_824320_T_C_b38	RP11-206L10.9	-5.555	6.58e-08	-0.06499	14	0.0117	no	ESPGSJ
chr1_825532_C_T_b38	RP11-206L10.9	-5.555	6.58e-08	-0.06499	14	0.0117	no	ESPGSJ
chr1_825767_T_C_b38	RP11-206L10.9	-5.555	6.58e-08	-0.06499	14	0.0117	no	ESPGSJ
chr1_819123_G_A_b38	RP11-206L10.9	-5.527	7.6e-08	-0.064309	19	0.011636	no	ESPGSJ
chr1_819584_C_T_b38	RP11-206L10.9	-5.527	7.6e-08	-0.064309	19	0.011636	no	ESPGSJ
chr1_813498_G_T_b38	RP11-206L10.9	-5.337	1.98e-07	-0.06082	16	0.011396	no	ESPGSJ
chr1_794299_C_G_b38	RP11-206L10.9	-5.149	5.01e-07	-0.060188	17	0.011689	no	ESPGSJ
chr1_817514_T_C_b38	RP11-206L10.9	-4.784	2.81e-06	-0.053646	16	0.011212	no	ESPGSJ
chr1_807692_C_A_b38	RP11-206L10.9	-4.672	4.69e-06	-0.089664	4	0.019193	no	ESPGSJ
chr1_789568_TATGGA_T_b38	RP11-206L10.9	-4.548	8.14e-06	-0.051829	21	0.011396	no	ESPGSJ
chr1_784109_C_CATAAT_b38	RP11-206L10.9	4.544	8.3e-06	0.082498	4	0.018157	no	ESPGSJ
chr1_808924_C_T_b38	RP11-206L10.9	-4.494	1.03e-05	-0.058377	5	0.01299	no	ESPGSJ
chr1_791564_C_G_b38	RP11-206L10.9	-4.373	1.74e-05	-0.047678	32	0.010902	no	ESPGSJ
chr1_821000_T_A_b38	RP11-206L10.9	-4.346	1.96e-05	-0.050818	14	0.011694	no	ESPGSJ
chr1_799080_TG_T_b38	RP11-206L10.9	4.097	5.52e-05	0.049218	11	0.012014	no	ESPGSJ
chr1_826420_A_T_b38	RP11-206L10.9	-3.741	0.000223	-0.037191	36	0.00994	no	ESPGSJ
chr1_806017_A_G_b38	RP11-206L10.9	3.602	0.000375	0.072244	6	0.020058	no	ESPGSJ
chr1_98929_A_G_b38	RP11-206L10.9	3.45	0.00065	0.051945	3	0.015058	no	ESPGSJ
chr1_814773_T_C_b38	RP11-206L10.9	3.279	0.00118	0.040727	7	0.012421	no	ESPGSJ
chr1_908962_G_GGTCGGGGTC_b38	RP11-206L10.9	-3.207	0.0015	-0.048069	11	0.01499	no	ESPGSJ
chr1_19391_G_A_b38	RP11-206L10.9	-3.155	0.00178	-0.053421	3	0.016931	no	ESPGSJ
chr1_1725745_C_G_b38	RP11-206L10.9	3.081	0.00227	0.035465	18	0.011511	no	ESPGSJ
chr1_789481_G_A_b38	RP11-206L10.9	3.077	0.00231	0.048668	3	0.015819	no	ESPGSJ
chr1_1041126_AGCGGGGGC_A_b38	RP11-206L10.9	3.074	0.00233	0.023127	29	0.007524	no	ESPGSJ
chr1_1046551_A_G_b38	RP11-206L10.9	3.005	0.00291	0.042632	10	0.014189	no	ESPGSJ
chr1_1590785_G_A_b38	RP11-206L10.9	2.893	0.00412	0.043929	4	0.015182	no	ESPGSJ
chr1_1590792_C_T_b38	RP11-206L10.9	2.87	0.00442	0.044061	4	0.015351	no	ESPGSJ
chr1_1042190_G_A_b38	RP11-206L10.9	2.859	0.00457	0.041286	13	0.014438	no	ESPGSJ
chr1_1052290_T_G_b38	RP11-206L10.9	2.851	0.00469	0.043007	7	0.015087	no	ESPGSJ
chr1_1039514_C_T_b38	RP11-206L10.9	2.831	0.00499	0.040765	11	0.0144	no	ESPGSJ
chr1_1042400_C_T_b38	RP11-206L10.9	2.831	0.00499	0.040765	11	0.0144	no	ESPGSJ
chr1_828014_G_A_b38	RP11-206L10.9	-2.809	0.00533	-0.042974	24	0.015298	no	ESPGSJ
chr1_1036754_C_T_b38	RP11-206L10.9	2.789	0.00566	0.040889	4	0.014661	no	ESPGSJ
chr1_1251618_G_A_b38	RP11-206L10.9	-2.768	0.00602	-0.035939	11	0.012983	no	ESPGSJ
chr1_621475_C_T_b38	RP11-206L10.9	2.763	0.00612	0.066629	4	0.024115	no	ESPGSJ
chr1_1585173_C_T_b38	RP11-206L10.9	2.762	0.00614	0.041741	5	0.015114	no	ESPGSJ
chr1_860178_C_CTTTTTTT_b38	RP11-206L10.9	2.761	0.00615	0.04244	4	0.015371	no	ESPGSJ
chr1_1251285_G_A_b38	RP11-206L10.9	-2.743	0.0065	-0.034989	13	0.012758	no	ESPGSJ
chr1_790933_CGAATGGAATG_C_b38	RP11-206L10.9	-2.732	0.0067	-0.030607	21	0.011201	no	ESPGSJ
chr1_1035987_T_C_b38	RP11-206L10.9	2.725	0.00685	0.044448	4	0.016314	no	ESPGSJ
chr1_1039282_G_T_b38	RP11-206L10.9	2.725	0.00685	0.044448	4	0.016314	no	ESPGSJ
chr1_1045080_G_A_b38	RP11-206L10.9	2.725	0.00685	0.044448	4	0.016314	no	ESPGSJ
chr1_1041119_GGGC_G_b38	RP11-206L10.9	2.703	0.0073	0.020013	25	0.007403	no	ESPGSJ
chr1_1047561_T_C_b38	RP11-206L10.9	2.664	0.00818	0.039202	11	0.014715	no	ESPGSJ
chr1_1585717_C_A_b38	RP11-206L10.9	2.647	0.00859	0.040012	5	0.015116	no	ESPGSJ
chr1_1586215_A_G_b38	RP11-206L10.9	2.647	0.00859	0.040012	5	0.015116	no	ESPGSJ
chr1_890446_C_CA_b38	RP11-206L10.9	2.631	0.00898	0.035636	10	0.013542	no	ESPGSJ
chr1_1038078_C_T_b38	RP11-206L10.9	2.631	0.00899	0.039757	4	0.015109	no	ESPGSJ
chr1_1041950_T_C_b38	RP11-206L10.9	2.631	0.00899	0.039757	4	0.015109	no	ESPGSJ
chr1_1591703_T_C_b38	RP11-206L10.9	-2.63	0.00901	-0.025735	68	0.009784	no	ESPGSJ
chr1_1047064_A_G_b38	RP11-206L10.9	2.615	0.00942	0.038156	9	0.014592	no	ESPGSJ
chr1_598854_C_T_b38	RP11-206L10.9	6.464	2.8e-10	0.084696	3	0.013103	yes	ESPMCS
chr1_790933_CGAATGGAATG_C_b38	RP11-206L10.9	-5.401	1.1e-07	-0.041613	37	0.007704	yes	ESPMCS
chr1_800909_T_A_b38	RP11-206L10.9	5.286	2e-07	0.049429	5	0.00935	yes	ESPMCS
chr1_771398_G_A_b38	RP11-206L10.9	-3.666	0.000277	-0.028785	68	0.007851	yes	ESPMCS
chr1_506937_T_G_b38	RP11-206L10.9	-3.33	0.000943	-0.032977	8	0.009902	yes	ESPMCS
chr1_624752_C_T_b38	RP11-206L10.9	3.219	0.00138	0.03015	4	0.009365	yes	ESPMCS
chr1_591650_C_T_b38	RP11-206L10.9	3.167	0.00165	0.02866	10	0.009051	yes	ESPMCS
chr1_586069_T_A_b38	RP11-206L10.9	3.116	0.00196	0.039121	7	0.012555	yes	ESPMCS
chr1_586303_C_T_b38	RP11-206L10.9	3.075	0.00224	0.045146	3	0.014682	yes	ESPMCS
chr1_600591_A_T_b38	RP11-206L10.9	2.891	0.00403	0.036665	5	0.012682	yes	ESPMCS
chr1_674381_A_AT_b38	RP11-206L10.9	2.891	0.00404	0.024496	21	0.008475	yes	ESPMCS
chr1_1290851_G_A_b38	RP11-206L10.9	-2.829	0.00488	-0.057796	3	0.020427	yes	ESPMCS
chr1_600588_A_G_b38	RP11-206L10.9	2.78	0.00569	0.035761	5	0.012866	yes	ESPMCS
chr1_1694689_C_CA_b38	RP11-206L10.9	2.706	0.00709	0.057488	4	0.021247	yes	ESPMCS
chr1_1248062_A_G_b38	RP11-206L10.9	-2.65	0.00834	-0.030259	6	0.011417	yes	ESPMCS
chr1_1248063_T_C_b38	RP11-206L10.9	-2.65	0.00834	-0.030259	6	0.011417	yes	ESPMCS
chr1_1248068_A_C_b38	RP11-206L10.9	-2.65	0.00834	-0.030259	6	0.011417	yes	ESPMCS
chr1_1248069_A_C_b38	RP11-206L10.9	-2.65	0.00834	-0.030259	6	0.011417	yes	ESPMCS
chr1_1285045_A_G_b38	RP11-206L10.9	-2.639	0.00861	-0.04793	3	0.018159	yes	ESPMCS
chr1_1248075_A_C_b38	RP11-206L10.9	-2.63	0.00885	-0.030026	6	0.011416	yes	ESPMCS
chr1_1248091_G_A_b38	RP11-206L10.9	-2.63	0.00885	-0.030026	6	0.011416	yes	ESPMCS
chr1_1248092_T_C_b38	RP11-206L10.9	-2.63	0.00885	-0.030026	6	0.011416	yes	ESPMCS
chr1_635258_T_C_b38	RP11-206L10.9	2.613	0.00928	0.023127	25	0.008849	yes	ESPMCS
chr1_677290_A_G_b38	RP11-206L10.9	9.68	3.65e-20	0.116485	5	0.012033	no	ESPMCS
chr1_677378_T_C_b38	RP11-206L10.9	9.526	1.25e-19	0.113502	5	0.011916	no	ESPMCS
chr1_788418_CAG_C_b38	RP11-206L10.9	-8.127	4.83e-15	-0.091092	11	0.011209	no	ESPMCS
chr1_788511_G_C_b38	RP11-206L10.9	-8.102	5.78e-15	-0.08873	15	0.010952	no	ESPMCS
chr1_777382_T_G_b38	RP11-206L10.9	8.047	8.53e-15	0.09591	3	0.011919	no	ESPMCS
chr1_779047_G_A_b38	RP11-206L10.9	-8.015	1.07e-14	-0.08714	17	0.010872	no	ESPMCS
chr1_800605_G_A_b38	RP11-206L10.9	7.919	2.09e-14	0.090239	8	0.011395	no	ESPMCS
chr1_778639_A_G_b38	RP11-206L10.9	7.856	3.25e-14	0.08912	9	0.011344	no	ESPMCS
chr1_788439_T_A_b38	RP11-206L10.9	7.769	5.97e-14	0.089186	8	0.01148	no	ESPMCS
chr1_809641_G_T_b38	RP11-206L10.9	7.701	9.51e-14	0.086	11	0.011167	no	ESPMCS
chr1_777135_T_TC_b38	RP11-206L10.9	7.646	1.39e-13	0.090613	7	0.011851	no	ESPMCS
chr1_683167_G_A_b38	RP11-206L10.9	7.47	4.57e-13	0.08154	3	0.010915	no	ESPMCS
chr1_812761_G_A_b38	RP11-206L10.9	6.623	1.06e-10	0.081441	8	0.012296	no	ESPMCS
chr1_812899_A_T_b38	RP11-206L10.9	6.547	1.69e-10	0.076413	13	0.011671	no	ESPMCS
chr1_783406_A_AT_b38	RP11-206L10.9	6.407	3.93e-10	0.072114	3	0.011255	no	ESPMCS
chr1_668125_A_C_b38	RP11-206L10.9	6.4	4.1e-10	0.120957	3	0.0189	no	ESPMCS
chr1_808924_C_T_b38	RP11-206L10.9	-5.639	3.12e-08	-0.050931	11	0.009032	no	ESPMCS
chr1_784109_C_CATAAT_b38	RP11-206L10.9	5.446	8.72e-08	0.068222	8	0.012527	no	ESPMCS
chr1_649157_C_T_b38	RP11-206L10.9	5.32	1.68e-07	0.076008	3	0.014287	no	ESPMCS
chr1_794299_C_G_b38	RP11-206L10.9	-5.301	1.85e-07	-0.046045	33	0.008686	no	ESPMCS
chr1_789568_TATGGA_T_b38	RP11-206L10.9	-5.153	3.93e-07	-0.044586	33	0.008652	no	ESPMCS
chr1_817341_A_G_b38	RP11-206L10.9	-5.076	5.76e-07	-0.043547	35	0.008579	no	ESPMCS
chr1_807692_C_A_b38	RP11-206L10.9	-5.066	6.07e-07	-0.067643	10	0.013353	no	ESPMCS
chr1_819584_C_T_b38	RP11-206L10.9	-5.062	6.19e-07	-0.043057	31	0.008507	no	ESPMCS
chr1_818094_C_G_b38	RP11-206L10.9	-4.974	9.53e-07	-0.043104	40	0.008666	no	ESPMCS
chr1_819123_G_A_b38	RP11-206L10.9	-4.968	9.81e-07	-0.0421	31	0.008474	no	ESPMCS
chr1_826577_A_AT_b38	RP11-206L10.9	-4.945	1.1e-06	-0.042184	24	0.00853	no	ESPMCS
chr1_820560_C_T_b38	RP11-206L10.9	-4.934	1.16e-06	-0.040604	29	0.008229	no	ESPMCS
chr1_817186_G_A_b38	RP11-206L10.9	-4.878	1.51e-06	-0.042287	27	0.008668	no	ESPMCS
chr1_824320_T_C_b38	RP11-206L10.9	-4.832	1.89e-06	-0.040645	26	0.008412	no	ESPMCS
chr1_825532_C_T_b38	RP11-206L10.9	-4.809	2.11e-06	-0.041454	23	0.00862	no	ESPMCS
chr1_825767_T_C_b38	RP11-206L10.9	-4.809	2.11e-06	-0.041454	23	0.00862	no	ESPMCS
chr1_817514_T_C_b38	RP11-206L10.9	-4.568	6.45e-06	-0.039396	19	0.008624	no	ESPMCS
chr1_799082_G_A_b38	RP11-206L10.9	-4.447	1.11e-05	-0.041194	11	0.009264	no	ESPMCS
chr1_813498_G_T_b38	RP11-206L10.9	-4.403	1.35e-05	-0.036221	29	0.008226	no	ESPMCS
chr1_814476_C_T_b38	RP11-206L10.9	-4.339	1.79e-05	-0.037674	22	0.008683	no	ESPMCS
chr1_799080_TG_T_b38	RP11-206L10.9	4.185	3.47e-05	0.032766	29	0.007829	no	ESPMCS
chr1_791564_C_G_b38	RP11-206L10.9	-3.719	0.000227	-0.029644	49	0.007971	no	ESPMCS
chr1_826420_A_T_b38	RP11-206L10.9	-3.331	0.000941	-0.023323	62	0.007002	no	ESPMCS
chr1_789680_A_AGGAATGGAAT_b38	RP11-206L10.9	-3.146	0.00177	-0.02155	59	0.00685	no	ESPMCS
chr1_814773_T_C_b38	RP11-206L10.9	3.081	0.00219	0.028822	5	0.009353	no	ESPMCS
chr1_814617_A_G_b38	RP11-206L10.9	-3.08	0.0022	-0.021746	49	0.00706	no	ESPMCS
chr1_39015_A_C_b38	RP11-206L10.9	-2.823	0.00498	-0.026322	8	0.009324	no	ESPMCS
chr1_1241831_G_C_b38	RP11-206L10.9	-2.743	0.00634	-0.028608	4	0.010428	no	ESPMCS
chr1_821000_T_A_b38	RP11-206L10.9	-2.737	0.00646	-0.022623	25	0.008266	no	ESPMCS
chr1_1587222_G_GT_b38	RP11-206L10.9	-2.659	0.00812	-0.019579	35	0.007362	no	ESPMCS
chr1_1481071_T_C_b38	RP11-206L10.9	2.659	0.00814	0.03248	11	0.012217	no	ESPMCS
chr1_600579_G_A_b38	RP11-206L10.9	2.658	0.00815	0.03992	7	0.015017	no	ESPMCS
chr1_1498115_C_T_b38	RP11-206L10.9	2.64	0.0086	0.056583	3	0.021434	no	ESPMCS
chr1_642104_G_A_b38	RP11-206L10.9	-2.615	0.00924	-0.031104	3	0.011895	no	ESPMCS
chr1_598862_C_T_b38	RP11-206L10.9	2.605	0.0095	0.024028	6	0.009223	no	ESPMCS
chr1_1170732_A_G_b38	RP11-206L10.9	2.603	0.00957	0.055675	28	0.021391	no	ESPMCS
chr1_591181_T_G_b38	RP11-206L10.9	2.597	0.00974	0.048275	3	0.018591	no	ESPMCS
chr1_777135_T_TC_b38	RP11-206L10.9	8.107	6.64e-15	0.105786	6	0.013049	yes	ESPMSL
chr1_624836_G_A_b38	RP11-206L10.9	6.693	7.53e-11	0.133336	3	0.019921	yes	ESPMSL
chr1_820560_C_T_b38	RP11-206L10.9	-5.555	5.11e-08	-0.050033	26	0.009006	yes	ESPMSL
chr1_814476_C_T_b38	RP11-206L10.9	-5.062	6.39e-07	-0.048894	20	0.00966	yes	ESPMSL
chr1_799082_G_A_b38	RP11-206L10.9	-4.82	2.05e-06	-0.049955	12	0.010364	yes	ESPMSL
chr1_790933_CGAATGGAATG_C_b38	RP11-206L10.9	-4.747	2.89e-06	-0.039509	36	0.008322	yes	ESPMSL
chr1_98929_A_G_b38	RP11-206L10.9	3.999	7.59e-05	0.04699	6	0.01175	yes	ESPMSL
chr1_1573265_C_CAAAA_b38	RP11-206L10.9	3.852	0.000137	0.037361	19	0.009698	yes	ESPMSL
chr1_814773_T_C_b38	RP11-206L10.9	3.751	0.000202	0.036937	8	0.009846	yes	ESPMSL
chr1_1465589_T_TA_b38	RP11-206L10.9	3.584	0.000381	0.045753	4	0.012767	yes	ESPMSL
chr1_822427_CCCTGGCCAGCAGATCCACCCTGTCTATACTACCTG_C_b38	RP11-206L10.9	-3.308	0.00103	-0.029809	26	0.009011	yes	ESPMSL
chr1_1538924_C_A_b38	RP11-206L10.9	3.198	0.00149	0.024519	48	0.007666	yes	ESPMSL
chr1_1257406_C_A_b38	RP11-206L10.9	3.012	0.00276	0.058822	4	0.019529	yes	ESPMSL
chr1_624767_T_G_b38	RP11-206L10.9	2.974	0.00312	0.030664	4	0.010312	yes	ESPMSL
chr1_109575_CGT_C_b38	RP11-206L10.9	2.964	0.00322	0.040226	7	0.01357	yes	ESPMSL
chr1_631490_T_C_b38	RP11-206L10.9	2.829	0.0049	0.047616	8	0.016829	yes	ESPMSL
chr1_814617_A_G_b38	RP11-206L10.9	-2.81	0.0052	-0.022253	48	0.007919	yes	ESPMSL
chr1_607379_G_A_b38	RP11-206L10.9	2.76	0.00605	0.043815	7	0.015875	yes	ESPMSL
chr1_788757_T_TAATGG_b38	RP11-206L10.9	-2.701	0.00721	-0.019592	82	0.007253	yes	ESPMSL
chr1_586069_T_A_b38	RP11-206L10.9	2.639	0.00864	0.036218	7	0.013722	yes	ESPMSL
chr1_1571244_CAAAAAAAAAAAAAAAAAA_C_b38	RP11-206L10.9	2.608	0.00944	0.030178	16	0.011569	yes	ESPMSL
chr1_1554246_C_T_b38	RP11-206L10.9	2.6	0.00967	0.021308	41	0.008195	yes	ESPMSL
chr1_677378_T_C_b38	RP11-206L10.9	11.674	3.03e-27	0.149288	3	0.012788	no	ESPMSL
chr1_677290_A_G_b38	RP11-206L10.9	11.25	1.19e-25	0.150644	3	0.01339	no	ESPMSL
chr1_800605_G_A_b38	RP11-206L10.9	10.097	1.8e-21	0.121582	6	0.012041	no	ESPMSL
chr1_788439_T_A_b38	RP11-206L10.9	9.813	1.76e-20	0.11835	6	0.012061	no	ESPMSL
chr1_778639_A_G_b38	RP11-206L10.9	9.78	2.28e-20	0.11771	7	0.012035	no	ESPMSL
chr1_777382_T_G_b38	RP11-206L10.9	9.419	3.9e-19	0.119207	3	0.012655	no	ESPMSL
chr1_809641_G_T_b38	RP11-206L10.9	9.112	4.16e-18	0.108943	9	0.011956	no	ESPMSL
chr1_788418_CAG_C_b38	RP11-206L10.9	-8.768	5.52e-17	-0.106948	8	0.012198	no	ESPMSL
chr1_812761_G_A_b38	RP11-206L10.9	8.607	1.81e-16	0.110069	8	0.012788	no	ESPMSL
chr1_788511_G_C_b38	RP11-206L10.9	-8.233	2.72e-15	-0.100333	11	0.012187	no	ESPMSL
chr1_779047_G_A_b38	RP11-206L10.9	-7.959	1.87e-14	-0.097278	13	0.012223	no	ESPMSL
chr1_812899_A_T_b38	RP11-206L10.9	7.916	2.52e-14	0.099215	11	0.012534	no	ESPMSL
chr1_784109_C_CATAAT_b38	RP11-206L10.9	6.999	1.12e-11	0.09596	6	0.013711	no	ESPMSL
chr1_800909_T_A_b38	RP11-206L10.9	5.751	1.78e-08	0.056731	8	0.009865	no	ESPMSL
chr1_783406_A_AT_b38	RP11-206L10.9	5.554	5.15e-08	0.067424	3	0.01214	no	ESPMSL
chr1_808924_C_T_b38	RP11-206L10.9	-4.847	1.8e-06	-0.049175	9	0.010145	no	ESPMSL
chr1_794299_C_G_b38	RP11-206L10.9	-4.846	1.82e-06	-0.046013	29	0.009495	no	ESPMSL
chr1_817186_G_A_b38	RP11-206L10.9	-4.746	2.91e-06	-0.045582	24	0.009605	no	ESPMSL
chr1_826577_A_AT_b38	RP11-206L10.9	-4.698	3.64e-06	-0.044467	21	0.009466	no	ESPMSL
chr1_817514_T_C_b38	RP11-206L10.9	-4.645	4.64e-06	-0.043064	19	0.009271	no	ESPMSL
chr1_817341_A_G_b38	RP11-206L10.9	-4.642	4.71e-06	-0.044744	32	0.009639	no	ESPMSL
chr1_825532_C_T_b38	RP11-206L10.9	-4.624	5.11e-06	-0.044377	20	0.009597	no	ESPMSL
chr1_825767_T_C_b38	RP11-206L10.9	-4.624	5.11e-06	-0.044377	20	0.009597	no	ESPMSL
chr1_789568_TATGGA_T_b38	RP11-206L10.9	-4.612	5.4e-06	-0.042995	32	0.009322	no	ESPMSL
chr1_806017_A_G_b38	RP11-206L10.9	4.534	7.7e-06	0.071903	9	0.015859	no	ESPMSL
chr1_819123_G_A_b38	RP11-206L10.9	-4.468	1.03e-05	-0.042585	28	0.00953	no	ESPMSL
chr1_819584_C_T_b38	RP11-206L10.9	-4.468	1.03e-05	-0.042585	28	0.00953	no	ESPMSL
chr1_818094_C_G_b38	RP11-206L10.9	-4.431	1.22e-05	-0.042922	36	0.009688	no	ESPMSL
chr1_824320_T_C_b38	RP11-206L10.9	-4.4	1.39e-05	-0.041174	23	0.009357	no	ESPMSL
chr1_598862_C_T_b38	RP11-206L10.9	4.071	5.65e-05	0.040809	4	0.010023	no	ESPMSL
chr1_799080_TG_T_b38	RP11-206L10.9	3.701	0.000246	0.031935	27	0.00863	no	ESPMSL
chr1_813498_G_T_b38	RP11-206L10.9	-3.607	0.000349	-0.032363	28	0.008972	no	ESPMSL
chr1_807692_C_A_b38	RP11-206L10.9	-3.429	0.00067	-0.052573	8	0.015333	no	ESPMSL
chr1_1530600_C_T_b38	RP11-206L10.9	3.381	0.000794	0.095369	3	0.028207	no	ESPMSL
chr1_680812_T_C_b38	RP11-206L10.9	-3.335	0.000933	-0.030625	12	0.009182	no	ESPMSL
chr1_771398_G_A_b38	RP11-206L10.9	-3.205	0.00146	-0.027222	61	0.008493	no	ESPMSL
chr1_1530598_G_A_b38	RP11-206L10.9	3.158	0.00171	0.079971	4	0.025322	no	ESPMSL
chr1_1530585_T_G_b38	RP11-206L10.9	2.994	0.00293	0.060716	5	0.020278	no	ESPMSL
chr1_826420_A_T_b38	RP11-206L10.9	-2.973	0.00313	-0.023981	50	0.008066	no	ESPMSL
chr1_1681370_T_G_b38	RP11-206L10.9	-2.834	0.00483	-0.028122	14	0.009923	no	ESPMSL
chr1_673518_C_T_b38	RP11-206L10.9	-2.822	0.00501	-0.0265	8	0.00939	no	ESPMSL
chr1_1396571_G_GT_b38	RP11-206L10.9	2.818	0.00508	0.050784	4	0.018024	no	ESPMSL
chr1_1450322_CAA_C_b38	RP11-206L10.9	-2.742	0.00638	-0.035285	7	0.012866	no	ESPMSL
chr1_1530595_C_T_b38	RP11-206L10.9	2.712	0.00697	0.065903	4	0.024298	no	ESPMSL
chr1_665220_T_C_b38	RP11-206L10.9	-2.702	0.00719	-0.066847	3	0.024739	no	ESPMSL
chr1_282551_T_C_b38	RP11-206L10.9	2.701	0.00722	0.026605	11	0.009851	no	ESPMSL
chr1_1579410_AT_A_b38	RP11-206L10.9	2.635	0.00876	0.023159	29	0.00879	no	ESPMSL
chr1_1041126_AGCGGGGGC_A_b38	RP11-206L10.9	2.626	0.00897	0.015279	39	0.005818	no	ESPMSL
chr1_591356_C_G_b38	RP11-206L10.9	4.471	1.1e-05	0.053057	7	0.011867	yes	HRTAA
chr1_651032_CATTATTGATATCTTCCTGATATCAAT_C_b38	RP11-206L10.9	3.137	0.00188	0.062034	5	0.019778	yes	HRTAA
chr1_134234_G_A_b38	RP11-206L10.9	2.875	0.00433	0.039386	3	0.013699	yes	HRTAA
chr1_608127_T_C_b38	RP11-206L10.9	2.834	0.00491	0.027183	3	0.009593	yes	HRTAA
chr1_633678_C_T_b38	RP11-206L10.9	-2.767	0.006	-0.029222	7	0.01056	yes	HRTAA
chr1_14464_A_T_b38	RP11-206L10.9	2.758	0.00618	0.026143	11	0.00948	yes	HRTAA
chr1_877371_T_C_b38	RP11-206L10.9	-2.64	0.00871	-0.059894	4	0.022684	yes	HRTAA
chr1_779047_G_A_b38	RP11-206L10.9	-7.335	2.06e-12	-0.086389	11	0.011777	no	HRTAA
chr1_778639_A_G_b38	RP11-206L10.9	7.257	3.38e-12	0.087098	7	0.012002	no	HRTAA
chr1_800605_G_A_b38	RP11-206L10.9	7.251	3.51e-12	0.086772	7	0.011967	no	HRTAA
chr1_809641_G_T_b38	RP11-206L10.9	7.08	1.02e-11	0.083123	8	0.01174	no	HRTAA
chr1_812761_G_A_b38	RP11-206L10.9	7.068	1.1e-11	0.087691	5	0.012407	no	HRTAA
chr1_788418_CAG_C_b38	RP11-206L10.9	-6.891	3.25e-11	-0.083534	7	0.012122	no	HRTAA
chr1_788511_G_C_b38	RP11-206L10.9	-6.795	5.82e-11	-0.080505	9	0.011848	no	HRTAA
chr1_788439_T_A_b38	RP11-206L10.9	6.47	3.96e-10	0.078972	6	0.012206	no	HRTAA
chr1_812899_A_T_b38	RP11-206L10.9	6.144	2.54e-09	0.076855	8	0.012508	no	HRTAA
chr1_777135_T_TC_b38	RP11-206L10.9	5.971	6.63e-09	0.079699	6	0.013348	no	HRTAA
chr1_784109_C_CATAAT_b38	RP11-206L10.9	4.875	1.77e-06	0.065723	6	0.013482	no	HRTAA
chr1_814476_C_T_b38	RP11-206L10.9	-4.415	1.41e-05	-0.042388	15	0.0096	no	HRTAA
chr1_800909_T_A_b38	RP11-206L10.9	4.289	2.42e-05	0.042397	6	0.009885	no	HRTAA
chr1_806017_A_G_b38	RP11-206L10.9	3.934	0.000104	0.059949	8	0.015238	no	HRTAA
chr1_790933_CGAATGGAATG_C_b38	RP11-206L10.9	-3.9	0.000119	-0.031063	26	0.007966	no	HRTAA
chr1_789568_TATGGA_T_b38	RP11-206L10.9	-3.791	0.000181	-0.034155	24	0.00901	no	HRTAA
chr1_817341_A_G_b38	RP11-206L10.9	-3.656	0.000302	-0.03514	20	0.009612	no	HRTAA
chr1_818094_C_G_b38	RP11-206L10.9	-3.626	0.000338	-0.03499	26	0.00965	no	HRTAA
chr1_820560_C_T_b38	RP11-206L10.9	-3.577	0.000405	-0.031941	17	0.00893	no	HRTAA
chr1_817186_G_A_b38	RP11-206L10.9	-3.487	0.000561	-0.033246	15	0.009534	no	HRTAA
chr1_794299_C_G_b38	RP11-206L10.9	-3.447	0.000648	-0.032581	21	0.009453	no	HRTAA
chr1_799082_G_A_b38	RP11-206L10.9	-3.394	0.000782	-0.034144	7	0.010061	no	HRTAA
chr1_199092_A_C_b38	RP11-206L10.9	3.321	0.00101	0.04808	3	0.014476	no	HRTAA
chr1_808924_C_T_b38	RP11-206L10.9	-3.313	0.00104	-0.033959	8	0.010251	no	HRTAA
chr1_590378_T_C_b38	RP11-206L10.9	3.258	0.00125	0.037828	17	0.011609	no	HRTAA
chr1_181113_A_G_b38	RP11-206L10.9	3.065	0.00237	0.032304	11	0.01054	no	HRTAA
chr1_826577_A_AT_b38	RP11-206L10.9	-3.025	0.0027	-0.028194	13	0.009322	no	HRTAA
chr1_819123_G_A_b38	RP11-206L10.9	-3.004	0.00289	-0.028526	18	0.009495	no	HRTAA
chr1_819584_C_T_b38	RP11-206L10.9	-3.004	0.00289	-0.028526	18	0.009495	no	HRTAA
chr1_964575_GGCTGTGGGAGGGGTCCGCGCGTCCGCAGTGGGGATGT_G_b38	RP11-206L10.9	2.93	0.00365	0.05778	5	0.019719	no	HRTAA
chr1_824320_T_C_b38	RP11-206L10.9	-2.887	0.00418	-0.027114	13	0.009393	no	HRTAA
chr1_659806_T_C_b38	RP11-206L10.9	2.881	0.00425	0.034286	9	0.0119	no	HRTAA
chr1_825532_C_T_b38	RP11-206L10.9	-2.838	0.00484	-0.027085	12	0.009543	no	HRTAA
chr1_825767_T_C_b38	RP11-206L10.9	-2.838	0.00484	-0.027085	12	0.009543	no	HRTAA
chr1_813498_G_T_b38	RP11-206L10.9	-2.801	0.00543	-0.024492	21	0.008744	no	HRTAA
chr1_1290841_A_G_b38	RP11-206L10.9	-2.78	0.00578	-0.028174	20	0.010134	no	HRTAA
chr1_969785_A_G_b38	RP11-206L10.9	-2.707	0.00718	-0.039686	15	0.014661	no	HRTAA
chr1_633846_C_A_b38	RP11-206L10.9	2.606	0.00963	0.046958	8	0.018022	no	HRTAA
chr1_598862_C_T_b38	RP11-206L10.9	3.44	0.00066	0.030274	4	0.008801	yes	HRTLV
chr1_1595028_C_CAG_b38	RP11-206L10.9	2.692	0.00748	0.017487	27	0.006496	yes	HRTLV
chr1_799080_TG_T_b38	RP11-206L10.9	2.673	0.00791	0.019127	23	0.007156	yes	HRTLV
chr1_1612562_T_TC_b38	RP11-206L10.9	2.639	0.00874	0.016213	36	0.006145	yes	HRTLV
chr1_1714635_A_G_b38	RP11-206L10.9	2.617	0.0093	0.023526	7	0.00899	yes	HRTLV
chr1_1714638_G_T_b38	RP11-206L10.9	2.617	0.0093	0.023526	7	0.00899	yes	HRTLV
chr1_683167_G_A_b38	RP11-206L10.9	5.001	9.47e-07	0.0498	3	0.009957	no	HRTLV
chr1_800605_G_A_b38	RP11-206L10.9	4.93	1.33e-06	0.051435	5	0.010433	no	HRTLV
chr1_788439_T_A_b38	RP11-206L10.9	4.882	1.67e-06	0.050372	5	0.010318	no	HRTLV
chr1_809641_G_T_b38	RP11-206L10.9	4.878	1.71e-06	0.048471	7	0.009937	no	HRTLV
chr1_778639_A_G_b38	RP11-206L10.9	4.867	1.79e-06	0.050648	5	0.010406	no	HRTLV
chr1_788418_CAG_C_b38	RP11-206L10.9	-4.697	3.95e-06	-0.048836	6	0.010398	no	HRTLV
chr1_788511_G_C_b38	RP11-206L10.9	-4.567	7.09e-06	-0.045652	9	0.009995	no	HRTLV
chr1_812761_G_A_b38	RP11-206L10.9	4.406	1.45e-05	0.0473	4	0.010736	no	HRTLV
chr1_779047_G_A_b38	RP11-206L10.9	-4.291	2.37e-05	-0.043498	10	0.010137	no	HRTLV
chr1_777135_T_TC_b38	RP11-206L10.9	4.216	3.26e-05	0.047424	4	0.011249	no	HRTLV
chr1_812899_A_T_b38	RP11-206L10.9	3.378	0.000821	0.036277	7	0.010738	no	HRTLV
chr1_784109_C_CATAAT_b38	RP11-206L10.9	3.375	0.00083	0.039027	5	0.011563	no	HRTLV
chr1_800909_T_A_b38	RP11-206L10.9	3.311	0.00104	0.027358	6	0.008263	no	HRTLV
chr1_799082_G_A_b38	RP11-206L10.9	-3.076	0.00228	-0.02557	9	0.008313	no	HRTLV
chr1_1111365_CAA_C_b38	RP11-206L10.9	2.972	0.00319	0.025747	8	0.008665	no	HRTLV
chr1_679602_T_C_b38	RP11-206L10.9	2.861	0.00451	0.055836	3	0.019517	no	HRTLV
chr1_791564_C_G_b38	RP11-206L10.9	-2.679	0.00777	-0.018515	38	0.006911	no	HRTLV
chr1_826577_A_AT_b38	RP11-206L10.9	-2.652	0.00842	-0.020351	15	0.007675	no	HRTLV
chr1_1684817_G_C_b38	RP11-206L10.9	3.943	0.000266	0.089734	9	0.022757	yes	KDNCTX
chr1_1686147_T_G_b38	RP11-206L10.9	3.869	0.000335	0.085263	11	0.022036	yes	KDNCTX
chr1_1687734_CAA_C_b38	RP11-206L10.9	3.849	0.000357	0.089572	7	0.023271	yes	KDNCTX
chr1_1687236_T_G_b38	RP11-206L10.9	3.747	0.000489	0.081944	11	0.021869	yes	KDNCTX
chr1_1681928_C_A_b38	RP11-206L10.9	3.6	0.000764	0.080749	11	0.022431	yes	KDNCTX
chr1_1684308_G_C_b38	RP11-206L10.9	3.505	0.00101	0.077664	11	0.022157	yes	KDNCTX
chr1_1684619_G_A_b38	RP11-206L10.9	3.505	0.00101	0.077664	11	0.022157	yes	KDNCTX
chr1_1680214_T_C_b38	RP11-206L10.9	3.502	0.00102	0.077234	11	0.022055	yes	KDNCTX
chr1_1680556_A_G_b38	RP11-206L10.9	3.502	0.00102	0.077234	11	0.022055	yes	KDNCTX
chr1_1681164_G_A_b38	RP11-206L10.9	3.502	0.00102	0.077234	11	0.022055	yes	KDNCTX
chr1_1684266_T_C_b38	RP11-206L10.9	3.502	0.00102	0.077234	11	0.022055	yes	KDNCTX
chr1_1687159_G_T_b38	RP11-206L10.9	3.502	0.00102	0.077234	11	0.022055	yes	KDNCTX
chr1_1695747_C_T_b38	RP11-206L10.9	-3.391	0.00142	-0.075649	15	0.022308	yes	KDNCTX
chr1_1683909_A_C_b38	RP11-206L10.9	3.346	0.00162	0.069979	14	0.020912	yes	KDNCTX
chr1_1686017_A_AT_b38	RP11-206L10.9	3.302	0.00184	0.070987	12	0.021497	yes	KDNCTX
chr1_1687061_C_T_b38	RP11-206L10.9	3.302	0.00184	0.070987	12	0.021497	yes	KDNCTX
chr1_1687643_G_A_b38	RP11-206L10.9	3.302	0.00184	0.070987	12	0.021497	yes	KDNCTX
chr1_1687153_A_G_b38	RP11-206L10.9	3.14	0.00292	0.066516	13	0.021182	yes	KDNCTX
chr1_1686882_T_C_b38	RP11-206L10.9	2.934	0.00515	0.062974	17	0.02146	yes	KDNCTX
chr1_1688570_A_T_b38	RP11-206L10.9	2.906	0.00557	0.074379	5	0.025597	yes	KDNCTX
chr1_1002415_CT_C_b38	RP11-206L10.9	2.796	0.00747	0.072411	4	0.025896	yes	KDNCTX
chr1_1747695_A_G_b38	RP11-206L10.9	2.69	0.00985	0.054743	13	0.020349	yes	KDNCTX
chr1_967617_G_A_b38	RP11-206L10.9	-3.066	0.00359	-0.105305	3	0.034346	no	KDNCTX
chr1_966179_G_A_b38	RP11-206L10.9	-3.031	0.00395	-0.109206	5	0.036025	no	KDNCTX
chr1_959193_G_A_b38	RP11-206L10.9	-3.002	0.00429	-0.116947	5	0.038961	no	KDNCTX
chr1_965350_G_A_b38	RP11-206L10.9	-3.002	0.00429	-0.116947	5	0.038961	no	KDNCTX
chr1_960326_G_A_b38	RP11-206L10.9	-2.925	0.00528	-0.106139	5	0.036282	no	KDNCTX
chr1_960375_A_AG_b38	RP11-206L10.9	-2.808	0.00723	-0.094734	5	0.033734	no	KDNCTX
chr1_1667424_T_TAAATA_b38	RP11-206L10.9	-2.764	0.00814	-0.060366	9	0.021843	no	KDNCTX
chr1_1744854_C_A_b38	RP11-206L10.9	2.748	0.00848	0.055238	8	0.020102	no	KDNCTX
chr1_924533_A_G_b38	RP11-206L10.9	-2.804	0.00565	-0.075698	7	0.026996	yes	LIVER
chr1_1521298_C_CAAA_b38	RP11-206L10.9	-2.761	0.00641	-0.081337	3	0.029464	yes	LIVER
chr1_1130186_CAAAAAA_C_b38	RP11-206L10.9	2.746	0.0067	0.056642	5	0.02063	yes	LIVER
chr1_1481071_T_C_b38	RP11-206L10.9	2.651	0.00879	0.061656	4	0.023254	yes	LIVER
chr1_1138569_C_CA_b38	RP11-206L10.9	3.799	0.000203	0.078523	4	0.020668	no	LIVER
chr1_779047_G_A_b38	RP11-206L10.9	-3.28	0.00126	-0.067729	3	0.020649	no	LIVER
chr1_920661_G_A_b38	RP11-206L10.9	-2.983	0.00328	-0.044322	6	0.014859	no	LIVER
chr1_788511_G_C_b38	RP11-206L10.9	-2.979	0.00333	-0.061791	3	0.020743	no	LIVER
chr1_916119_A_G_b38	RP11-206L10.9	2.963	0.00349	0.043026	7	0.014521	no	LIVER
chr1_916753_C_T_b38	RP11-206L10.9	2.925	0.00392	0.042001	9	0.014359	no	LIVER
chr1_1662738_CT_C_b38	RP11-206L10.9	2.907	0.00415	0.051106	10	0.017582	no	LIVER
chr1_1662855_T_C_b38	RP11-206L10.9	2.907	0.00415	0.051106	10	0.017582	no	LIVER
chr1_938014_A_G_b38	RP11-206L10.9	2.895	0.0043	0.070649	9	0.024407	no	LIVER
chr1_933601_C_T_b38	RP11-206L10.9	-2.855	0.00485	-0.070159	12	0.024575	no	LIVER
chr1_920949_C_G_b38	RP11-206L10.9	-2.733	0.00695	-0.040972	6	0.01499	no	LIVER
chr1_275616_T_C_b38	RP11-206L10.9	2.699	0.00766	0.034581	14	0.012811	no	LIVER
chr1_800605_G_A_b38	RP11-206L10.9	8.836	2.34e-17	0.12218	7	0.013828	yes	LUNG
chr1_788439_T_A_b38	RP11-206L10.9	8.832	2.4e-17	0.121671	7	0.013776	yes	LUNG
chr1_777382_T_G_b38	RP11-206L10.9	8.745	4.65e-17	0.125534	3	0.014355	yes	LUNG
chr1_778639_A_G_b38	RP11-206L10.9	8.646	9.78e-17	0.118473	8	0.013703	yes	LUNG
chr1_788418_CAG_C_b38	RP11-206L10.9	-8.475	3.5e-16	-0.115668	9	0.013648	yes	LUNG
chr1_788511_G_C_b38	RP11-206L10.9	-8.17	3.25e-15	-0.109266	13	0.013375	yes	LUNG
chr1_779047_G_A_b38	RP11-206L10.9	-8.037	8.43e-15	-0.10725	14	0.013345	yes	LUNG
chr1_777135_T_TC_b38	RP11-206L10.9	8.035	8.53e-15	0.117259	7	0.014594	yes	LUNG
chr1_800909_T_A_b38	RP11-206L10.9	7.833	3.53e-14	0.085939	5	0.010971	yes	LUNG
chr1_677290_A_G_b38	RP11-206L10.9	7.792	4.73e-14	0.128282	3	0.016464	yes	LUNG
chr1_812761_G_A_b38	RP11-206L10.9	7.736	6.98e-14	0.112826	8	0.014585	yes	LUNG
chr1_677378_T_C_b38	RP11-206L10.9	7.502	3.46e-13	0.117673	3	0.015686	yes	LUNG
chr1_784109_C_CATAAT_b38	RP11-206L10.9	6.928	1.51e-11	0.107733	7	0.01555	yes	LUNG
chr1_812899_A_T_b38	RP11-206L10.9	6.819	3.01e-11	0.09977	12	0.014632	yes	LUNG
chr1_794299_C_G_b38	RP11-206L10.9	-6.423	3.45e-10	-0.0676	33	0.010525	yes	LUNG
chr1_813498_G_T_b38	RP11-206L10.9	-6.127	1.98e-09	-0.060713	32	0.00991	yes	LUNG
chr1_789568_TATGGA_T_b38	RP11-206L10.9	-6.08	2.59e-09	-0.063189	35	0.010392	yes	LUNG
chr1_817186_G_A_b38	RP11-206L10.9	-5.837	1.03e-08	-0.063085	23	0.010807	yes	LUNG
chr1_818094_C_G_b38	RP11-206L10.9	-5.67	2.58e-08	-0.061501	37	0.010847	yes	LUNG
chr1_820560_C_T_b38	RP11-206L10.9	-5.634	3.13e-08	-0.057757	25	0.010251	yes	LUNG
chr1_826577_A_AT_b38	RP11-206L10.9	-5.614	3.48e-08	-0.060036	20	0.010693	yes	LUNG
chr1_825532_C_T_b38	RP11-206L10.9	-5.588	4.02e-08	-0.060556	19	0.010837	yes	LUNG
chr1_825767_T_C_b38	RP11-206L10.9	-5.588	4.02e-08	-0.060556	19	0.010837	yes	LUNG
chr1_817341_A_G_b38	RP11-206L10.9	-5.582	4.15e-08	-0.060873	31	0.010905	yes	LUNG
chr1_824320_T_C_b38	RP11-206L10.9	-5.519	5.82e-08	-0.058841	21	0.010662	yes	LUNG
chr1_817514_T_C_b38	RP11-206L10.9	-5.392	1.14e-07	-0.056574	19	0.010493	yes	LUNG
chr1_819123_G_A_b38	RP11-206L10.9	-5.193	3.15e-07	-0.056357	28	0.010852	yes	LUNG
chr1_819584_C_T_b38	RP11-206L10.9	-5.162	3.7e-07	-0.056372	28	0.010921	yes	LUNG
chr1_807692_C_A_b38	RP11-206L10.9	-4.668	4.04e-06	-0.075931	9	0.016268	yes	LUNG
chr1_771398_G_A_b38	RP11-206L10.9	-4.216	3.02e-05	-0.04015	67	0.009524	yes	LUNG
chr1_814773_T_C_b38	RP11-206L10.9	4.085	5.22e-05	0.044698	6	0.010941	yes	LUNG
chr1_808924_C_T_b38	RP11-206L10.9	-3.932	9.79e-05	-0.044167	10	0.011234	yes	LUNG
chr1_822427_CCCTGGCCAGCAGATCCACCCTGTCTATACTACCTG_C_b38	RP11-206L10.9	-3.885	0.000118	-0.039833	28	0.010252	yes	LUNG
chr1_826420_A_T_b38	RP11-206L10.9	-3.876	0.000122	-0.036206	47	0.009341	yes	LUNG
chr1_821000_T_A_b38	RP11-206L10.9	-3.806	0.000161	-0.03957	20	0.010397	yes	LUNG
chr1_674562_T_C_b38	RP11-206L10.9	3.546	0.000433	0.036667	12	0.01034	yes	LUNG
chr1_806017_A_G_b38	RP11-206L10.9	3.483	0.000546	0.06443	10	0.018501	yes	LUNG
chr1_1776301_T_G_b38	RP11-206L10.9	3.328	0.000948	0.031908	26	0.009588	yes	LUNG
chr1_1773215_C_A_b38	RP11-206L10.9	3.306	0.00102	0.031637	26	0.00957	yes	LUNG
chr1_1767762_C_A_b38	RP11-206L10.9	3.279	0.00112	0.031435	26	0.009586	yes	LUNG
chr1_1774308_G_A_b38	RP11-206L10.9	3.279	0.00112	0.031435	26	0.009586	yes	LUNG
chr1_789680_A_AGGAATGGAAT_b38	RP11-206L10.9	-3.232	0.00132	-0.026468	63	0.008188	yes	LUNG
chr1_790933_CGAATGGAATG_C_b38	RP11-206L10.9	-3.104	0.00203	-0.029312	33	0.009443	yes	LUNG
chr1_791564_C_G_b38	RP11-206L10.9	-3.036	0.00254	-0.029819	53	0.009821	yes	LUNG
chr1_788757_T_TAATGG_b38	RP11-206L10.9	-2.936	0.0035	-0.023828	100	0.008116	yes	LUNG
chr1_1774165_A_G_b38	RP11-206L10.9	2.865	0.00437	0.027907	24	0.009741	yes	LUNG
chr1_1097584_A_ATT_b38	RP11-206L10.9	2.827	0.0049	0.045102	5	0.015951	yes	LUNG
chr1_1726904_T_C_b38	RP11-206L10.9	2.821	0.005	0.02194	120	0.007776	yes	LUNG
chr1_1288372_TCC_T_b38	RP11-206L10.9	-2.763	0.00597	-0.073575	4	0.026632	yes	LUNG
chr1_1023525_A_G_b38	RP11-206L10.9	2.762	0.00599	0.022346	66	0.008092	yes	LUNG
chr1_1049113_GGC_G_b38	RP11-206L10.9	2.698	0.00724	0.028453	23	0.010545	yes	LUNG
chr1_1023573_A_G_b38	RP11-206L10.9	2.678	0.00769	0.021659	68	0.008089	yes	LUNG
chr1_921797_T_C_b38	RP11-206L10.9	2.664	0.008	0.048646	11	0.018258	yes	LUNG
chr1_1750226_C_T_b38	RP11-206L10.9	2.66	0.00809	0.022	89	0.00827	yes	LUNG
chr1_650383_AACAC_A_b38	RP11-206L10.9	2.652	0.00828	0.055338	7	0.020864	yes	LUNG
chr1_1735008_G_GTTTT_b38	RP11-206L10.9	2.632	0.00877	0.019969	140	0.007586	yes	LUNG
chr1_1754601_G_T_b38	RP11-206L10.9	2.629	0.00887	0.022315	82	0.008489	yes	LUNG
chr1_932716_T_C_b38	RP11-206L10.9	2.604	0.00951	0.054667	9	0.02099	yes	LUNG
chr1_1756186_T_C_b38	RP11-206L10.9	2.602	0.00959	0.021911	83	0.008422	yes	LUNG
chr1_1749637_G_T_b38	RP11-206L10.9	2.6	0.00963	0.021039	92	0.008092	yes	LUNG
chr1_1025561_G_C_b38	RP11-206L10.9	2.6	0.00963	0.022137	52	0.008514	yes	LUNG
chr1_1024462_C_T_b38	RP11-206L10.9	2.599	0.00967	0.022248	53	0.008562	yes	LUNG
chr1_116134_A_G_b38	RP11-206L10.9	-2.598	0.00968	-0.028819	11	0.011091	yes	LUNG
chr1_1757725_C_T_b38	RP11-206L10.9	2.594	0.00981	0.022039	82	0.008497	yes	LUNG
chr1_809641_G_T_b38	RP11-206L10.9	8.422	5.15e-16	0.114042	10	0.01354	no	LUNG
chr1_683167_G_A_b38	RP11-206L10.9	7.044	7.15e-12	0.092069	3	0.01307	no	LUNG
chr1_783406_A_AT_b38	RP11-206L10.9	6.124	2.01e-09	0.082906	4	0.013538	no	LUNG
chr1_814476_C_T_b38	RP11-206L10.9	-4.702	3.44e-06	-0.049287	26	0.010482	no	LUNG
chr1_814619_A_G_b38	RP11-206L10.9	4.621	5.01e-06	0.102205	3	0.022117	no	LUNG
chr1_799082_G_A_b38	RP11-206L10.9	-4.174	3.61e-05	-0.048553	11	0.011633	no	LUNG
chr1_1020855_G_GGC_b38	RP11-206L10.9	3.332	0.000933	0.069631	5	0.020895	no	LUNG
chr1_1029365_A_ATCTATGCAGGCAGGTGGGGGGATCAGTG_b38	RP11-206L10.9	3.084	0.00217	0.027385	38	0.008881	no	LUNG
chr1_940296_G_GCCCCC_b38	RP11-206L10.9	3.045	0.00247	0.070958	3	0.023305	no	LUNG
chr1_280592_T_C_b38	RP11-206L10.9	-2.965	0.00319	-0.031034	18	0.010466	no	LUNG
chr1_598862_C_T_b38	RP11-206L10.9	2.938	0.00348	0.032574	5	0.011088	no	LUNG
chr1_665688_T_A_b38	RP11-206L10.9	2.914	0.00375	0.055697	5	0.019116	no	LUNG
chr1_814962_C_T_b38	RP11-206L10.9	-2.84	0.00472	-0.023576	83	0.008301	no	LUNG
chr1_98929_A_G_b38	RP11-206L10.9	2.798	0.00536	0.03501	7	0.012511	no	LUNG
chr1_1736836_A_G_b38	RP11-206L10.9	2.689	0.00745	0.021431	128	0.007971	no	LUNG
chr1_954258_G_C_b38	RP11-206L10.9	-2.66	0.0081	-0.04112	3	0.015459	no	LUNG
chr1_1693256_GT_G_b38	RP11-206L10.9	-2.656	0.00819	-0.055192	6	0.020778	no	LUNG
chr1_938014_A_G_b38	RP11-206L10.9	2.635	0.00872	0.046145	18	0.017515	no	LUNG
chr1_1068824_G_A_b38	RP11-206L10.9	2.628	0.00889	0.033838	8	0.012877	no	LUNG
chr1_1026830_A_G_b38	RP11-206L10.9	2.617	0.00918	0.021823	64	0.00834	no	LUNG
chr1_1027340_C_T_b38	RP11-206L10.9	2.613	0.00929	0.030848	10	0.011808	no	LUNG
chr1_1774506_T_C_b38	RP11-206L10.9	-2.61	0.00935	-0.024608	67	0.009427	no	LUNG
chr1_989068_GTTGA_G_b38	RP11-206L10.9	-2.598	0.0097	-0.020712	127	0.007973	no	LUNG
chr1_592666_T_C_b38	RP11-206L10.9	2.594	0.00981	0.06803	3	0.026229	no	LUNG
chr1_1744854_C_A_b38	RP11-206L10.9	-2.59	0.0099	-0.019507	88	0.007531	no	LUNG
chr1_1743840_T_C_b38	RP11-206L10.9	-4.432	2.1e-05	-0.074719	12	0.016859	yes	SLVRYG
chr1_1743851_C_T_b38	RP11-206L10.9	-4.423	2.18e-05	-0.074871	11	0.016927	yes	SLVRYG
chr1_1474201_CT_C_b38	RP11-206L10.9	-3.794	0.000235	-0.097289	7	0.025641	yes	SLVRYG
chr1_1744028_A_AC_b38	RP11-206L10.9	-3.681	0.000352	-0.071592	7	0.019449	yes	SLVRYG
chr1_1743886_C_T_b38	RP11-206L10.9	-3.614	0.000444	-0.062156	13	0.017196	yes	SLVRYG
chr1_1687734_CAA_C_b38	RP11-206L10.9	-3.557	0.000541	-0.055296	21	0.015545	yes	SLVRYG
chr1_1098619_C_T_b38	RP11-206L10.9	-3.545	0.000564	-0.053777	32	0.015171	yes	SLVRYG
chr1_1692151_T_C_b38	RP11-206L10.9	-3.533	0.000588	-0.059143	13	0.016742	yes	SLVRYG
chr1_1744052_GAGA_G_b38	RP11-206L10.9	-3.516	0.000623	-0.064022	9	0.01821	yes	SLVRYG
chr1_1124795_T_C_b38	RP11-206L10.9	3.473	0.00072	0.055925	35	0.016103	yes	SLVRYG
chr1_1091421_T_A_b38	RP11-206L10.9	-3.445	0.00079	-0.052756	24	0.015312	yes	SLVRYG
chr1_1750428_G_C_b38	RP11-206L10.9	-3.378	0.000988	-0.062699	18	0.018558	yes	SLVRYG
chr1_1748780_G_A_b38	RP11-206L10.9	-3.325	0.00118	-0.054881	31	0.016508	yes	SLVRYG
chr1_1744652_C_T_b38	RP11-206L10.9	-3.321	0.0012	-0.050981	28	0.015353	yes	SLVRYG
chr1_1749826_A_G_b38	RP11-206L10.9	-3.314	0.00122	-0.051894	34	0.015657	yes	SLVRYG
chr1_1750280_A_G_b38	RP11-206L10.9	-3.289	0.00132	-0.054851	31	0.016676	yes	SLVRYG
chr1_1750440_G_A_b38	RP11-206L10.9	-3.28	0.00137	-0.060932	17	0.018577	yes	SLVRYG
chr1_609015_G_A_b38	RP11-206L10.9	-3.189	0.00183	-0.061723	5	0.019354	yes	SLVRYG
chr1_1746439_GA_G_b38	RP11-206L10.9	3.133	0.00218	0.052064	20	0.016615	yes	SLVRYG
chr1_1753319_G_A_b38	RP11-206L10.9	-3.057	0.00277	-0.051847	27	0.016961	yes	SLVRYG
chr1_1744121_A_C_b38	RP11-206L10.9	-3.05	0.00283	-0.063212	15	0.020727	yes	SLVRYG
chr1_1738207_ACT_A_b38	RP11-206L10.9	-3.041	0.00291	-0.05038	17	0.016569	yes	SLVRYG
chr1_1747472_A_T_b38	RP11-206L10.9	-2.987	0.00342	-0.051333	27	0.017184	yes	SLVRYG
chr1_1748597_C_G_b38	RP11-206L10.9	-2.987	0.00342	-0.051333	27	0.017184	yes	SLVRYG
chr1_1752461_G_A_b38	RP11-206L10.9	-2.987	0.00342	-0.051333	27	0.017184	yes	SLVRYG
chr1_1752730_C_G_b38	RP11-206L10.9	-2.987	0.00342	-0.051333	27	0.017184	yes	SLVRYG
chr1_1753361_G_A_b38	RP11-206L10.9	-2.987	0.00342	-0.051333	27	0.017184	yes	SLVRYG
chr1_1756043_G_T_b38	RP11-206L10.9	-2.987	0.00342	-0.051333	27	0.017184	yes	SLVRYG
chr1_1744096_C_T_b38	RP11-206L10.9	-2.958	0.00374	-0.06317	14	0.021357	yes	SLVRYG
chr1_1091327_C_A_b38	RP11-206L10.9	-2.912	0.0043	-0.043941	25	0.01509	yes	SLVRYG
chr1_1134070_C_T_b38	RP11-206L10.9	2.91	0.00433	0.047602	15	0.016361	yes	SLVRYG
chr1_1687643_G_A_b38	RP11-206L10.9	-2.904	0.0044	-0.044203	26	0.015221	yes	SLVRYG
chr1_1754482_TCCCTGGGACCGAAGTCGCCCCA_T_b38	RP11-206L10.9	-2.894	0.00453	-0.049536	27	0.017115	yes	SLVRYG
chr1_874906_G_A_b38	RP11-206L10.9	-2.881	0.00471	-0.062294	6	0.021621	yes	SLVRYG
chr1_1285574_G_A_b38	RP11-206L10.9	-2.879	0.00474	-0.101714	11	0.035333	yes	SLVRYG
chr1_1742672_C_T_b38	RP11-206L10.9	-2.877	0.00477	-0.046058	24	0.016011	yes	SLVRYG
chr1_1743238_G_C_b38	RP11-206L10.9	-2.877	0.00477	-0.046058	24	0.016011	yes	SLVRYG
chr1_1137233_C_G_b38	RP11-206L10.9	2.87	0.00487	0.048409	14	0.016867	yes	SLVRYG
chr1_1759354_G_A_b38	RP11-206L10.9	-2.853	0.00512	-0.048523	27	0.017009	yes	SLVRYG
chr1_1759611_C_T_b38	RP11-206L10.9	-2.853	0.00512	-0.048523	27	0.017009	yes	SLVRYG
chr1_1095253_G_A_b38	RP11-206L10.9	2.836	0.00538	0.058383	8	0.020585	yes	SLVRYG
chr1_1097574_A_G_b38	RP11-206L10.9	2.836	0.00538	0.058383	8	0.020585	yes	SLVRYG
chr1_1692124_T_G_b38	RP11-206L10.9	-2.82	0.00563	-0.048518	13	0.017203	yes	SLVRYG
chr1_1094425_A_G_b38	RP11-206L10.9	2.818	0.00567	0.057286	9	0.02033	yes	SLVRYG
chr1_1098290_T_C_b38	RP11-206L10.9	2.818	0.00567	0.057286	9	0.02033	yes	SLVRYG
chr1_1049114_GC_G_b38	RP11-206L10.9	-2.793	0.00609	-0.043412	33	0.015542	yes	SLVRYG
chr1_1683909_A_C_b38	RP11-206L10.9	-2.784	0.00626	-0.042933	28	0.015421	yes	SLVRYG
chr1_1687153_A_G_b38	RP11-206L10.9	-2.784	0.00626	-0.042933	28	0.015421	yes	SLVRYG
chr1_1664417_G_A_b38	RP11-206L10.9	2.777	0.00638	0.05129	7	0.018467	yes	SLVRYG
chr1_1752908_C_CCCT_b38	RP11-206L10.9	-2.768	0.00654	-0.048281	26	0.01744	yes	SLVRYG
chr1_1686017_A_AT_b38	RP11-206L10.9	-2.748	0.00694	-0.042763	25	0.015562	yes	SLVRYG
chr1_1687061_C_T_b38	RP11-206L10.9	-2.748	0.00694	-0.042763	25	0.015562	yes	SLVRYG
chr1_1769969_CAAAACAAAAACA_C_b38	RP11-206L10.9	-2.745	0.007	-0.04629	30	0.016864	yes	SLVRYG
chr1_286272_A_G_b38	RP11-206L10.9	-2.733	0.00723	-0.040505	18	0.014819	yes	SLVRYG
chr1_1742432_TA_T_b38	RP11-206L10.9	-2.731	0.00728	-0.043989	23	0.016106	yes	SLVRYG
chr1_1137871_C_A_b38	RP11-206L10.9	2.716	0.0076	0.056145	4	0.020671	yes	SLVRYG
chr1_1095185_C_T_b38	RP11-206L10.9	2.709	0.00776	0.056229	8	0.020758	yes	SLVRYG
chr1_1096593_C_T_b38	RP11-206L10.9	2.709	0.00776	0.056229	8	0.020758	yes	SLVRYG
chr1_1098216_T_C_b38	RP11-206L10.9	2.709	0.00776	0.056229	8	0.020758	yes	SLVRYG
chr1_1098300_T_A_b38	RP11-206L10.9	2.709	0.00776	0.056229	8	0.020758	yes	SLVRYG
chr1_1098614_C_T_b38	RP11-206L10.9	2.709	0.00776	0.056229	8	0.020758	yes	SLVRYG
chr1_1098820_T_C_b38	RP11-206L10.9	2.709	0.00776	0.056229	8	0.020758	yes	SLVRYG
chr1_1764887_C_A_b38	RP11-206L10.9	-2.708	0.00777	-0.046193	29	0.017058	yes	SLVRYG
chr1_1766653_A_G_b38	RP11-206L10.9	-2.708	0.00777	-0.046193	29	0.017058	yes	SLVRYG
chr1_1771864_G_A_b38	RP11-206L10.9	-2.708	0.00777	-0.046193	29	0.017058	yes	SLVRYG
chr1_1772410_T_C_b38	RP11-206L10.9	-2.708	0.00777	-0.046193	29	0.017058	yes	SLVRYG
chr1_1772426_T_A_b38	RP11-206L10.9	-2.708	0.00777	-0.046193	29	0.017058	yes	SLVRYG
chr1_1773460_G_A_b38	RP11-206L10.9	-2.708	0.00777	-0.046193	29	0.017058	yes	SLVRYG
chr1_1773476_C_G_b38	RP11-206L10.9	-2.708	0.00777	-0.046193	29	0.017058	yes	SLVRYG
chr1_1773848_A_C_b38	RP11-206L10.9	-2.708	0.00777	-0.046193	29	0.017058	yes	SLVRYG
chr1_1776461_GAAAC_G_b38	RP11-206L10.9	-2.708	0.00777	-0.046193	29	0.017058	yes	SLVRYG
chr1_1777362_A_G_b38	RP11-206L10.9	-2.708	0.00777	-0.046193	29	0.017058	yes	SLVRYG
chr1_1750508_A_C_b38	RP11-206L10.9	-2.688	0.00823	-0.039108	31	0.014551	yes	SLVRYG
chr1_1686882_T_C_b38	RP11-206L10.9	-2.685	0.00831	-0.042848	29	0.015961	yes	SLVRYG
chr1_1750528_G_A_b38	RP11-206L10.9	-2.654	0.00906	-0.038147	31	0.014376	yes	SLVRYG
chr1_778639_A_G_b38	RP11-206L10.9	4.016	0.000104	0.091961	4	0.022898	no	SLVRYG
chr1_800605_G_A_b38	RP11-206L10.9	4.016	0.000104	0.091961	4	0.022898	no	SLVRYG
chr1_777135_T_TC_b38	RP11-206L10.9	3.792	0.000237	0.089997	4	0.023734	no	SLVRYG
chr1_809641_G_T_b38	RP11-206L10.9	3.72	0.000307	0.083194	5	0.022367	no	SLVRYG
chr1_788439_T_A_b38	RP11-206L10.9	3.599	0.000469	0.08498	3	0.023614	no	SLVRYG
chr1_779047_G_A_b38	RP11-206L10.9	-3.315	0.00122	-0.076918	7	0.023203	no	SLVRYG
chr1_285882_A_G_b38	RP11-206L10.9	-3.259	0.00146	-0.044001	35	0.0135	no	SLVRYG
chr1_281431_A_G_b38	RP11-206L10.9	-3.172	0.00193	-0.062687	8	0.019764	no	SLVRYG
chr1_812899_A_T_b38	RP11-206L10.9	3.163	0.00199	0.077816	5	0.024603	no	SLVRYG
chr1_784109_C_CATAAT_b38	RP11-206L10.9	3.095	0.00246	0.080743	3	0.026086	no	SLVRYG
chr1_1744499_C_T_b38	RP11-206L10.9	-3.089	0.0025	-0.04628	27	0.014982	no	SLVRYG
chr1_788418_CAG_C_b38	RP11-206L10.9	-3.075	0.00261	-0.073204	5	0.023803	no	SLVRYG
chr1_928128_G_T_b38	RP11-206L10.9	3.07	0.00266	0.066233	4	0.021577	no	SLVRYG
chr1_263722_C_G_b38	RP11-206L10.9	-3.045	0.00287	-0.054506	9	0.0179	no	SLVRYG
chr1_951408_G_A_b38	RP11-206L10.9	-3	0.0033	-0.068331	9	0.022778	no	SLVRYG
chr1_951437_C_T_b38	RP11-206L10.9	-3	0.0033	-0.068331	9	0.022778	no	SLVRYG
chr1_1134062_C_T_b38	RP11-206L10.9	2.983	0.00346	0.050033	14	0.01677	no	SLVRYG
chr1_1023789_G_C_b38	RP11-206L10.9	-2.981	0.00349	-0.043382	33	0.014554	no	SLVRYG
chr1_959193_G_A_b38	RP11-206L10.9	-2.971	0.0036	-0.069786	15	0.023487	no	SLVRYG
chr1_790933_CGAATGGAATG_C_b38	RP11-206L10.9	-2.925	0.00413	-0.048595	11	0.016614	no	SLVRYG
chr1_1134222_T_C_b38	RP11-206L10.9	2.91	0.00432	0.046271	16	0.015899	no	SLVRYG
chr1_1023775_G_A_b38	RP11-206L10.9	-2.896	0.0045	-0.043595	35	0.015052	no	SLVRYG
chr1_788511_G_C_b38	RP11-206L10.9	-2.874	0.00481	-0.067873	6	0.023618	no	SLVRYG
chr1_969785_A_G_b38	RP11-206L10.9	-2.84	0.00532	-0.08798	10	0.030983	no	SLVRYG
chr1_1075707_CG_C_b38	RP11-206L10.9	-2.832	0.00544	-0.040878	36	0.014433	no	SLVRYG
chr1_660002_G_T_b38	RP11-206L10.9	2.816	0.00571	0.068811	3	0.024438	no	SLVRYG
chr1_1743586_T_TAC_b38	RP11-206L10.9	-2.796	0.00604	-0.045849	20	0.016399	no	SLVRYG
chr1_1118005_C_T_b38	RP11-206L10.9	2.755	0.0068	0.043347	34	0.015733	no	SLVRYG
chr1_1726904_T_C_b38	RP11-206L10.9	2.737	0.00716	0.041151	28	0.015036	no	SLVRYG
chr1_1695005_CAAA_C_b38	RP11-206L10.9	2.699	0.00798	0.071425	3	0.026466	no	SLVRYG
chr1_878665_C_T_b38	RP11-206L10.9	2.673	0.00859	0.057083	4	0.021358	no	SLVRYG
chr1_1057980_C_A_b38	RP11-206L10.9	-2.658	0.00895	-0.040588	39	0.01527	no	SLVRYG
chr1_1048767_CAAAAAAAAAAA_C_b38	RP11-206L10.9	-2.652	0.00911	-0.040274	35	0.015189	no	SLVRYG
chr1_1469088_T_C_b38	RP11-206L10.9	-2.642	0.00936	-0.077628	7	0.029385	no	SLVRYG
chr1_677290_A_G_b38	RP11-206L10.9	11.528	4.73e-28	0.096856	6	0.008402	yes	MSCLSK
chr1_681103_T_A_b38	RP11-206L10.9	10.983	8.18e-26	0.099949	5	0.0091	yes	MSCLSK
chr1_814619_A_G_b38	RP11-206L10.9	9.6	1.81e-20	0.114315	3	0.011908	yes	MSCLSK
chr1_800605_G_A_b38	RP11-206L10.9	9.545	2.89e-20	0.074895	10	0.007847	yes	MSCLSK
chr1_788418_CAG_C_b38	RP11-206L10.9	-9.496	4.37e-20	-0.07298	13	0.007686	yes	MSCLSK
chr1_788439_T_A_b38	RP11-206L10.9	9.488	4.66e-20	0.074234	10	0.007824	yes	MSCLSK
chr1_777382_T_G_b38	RP11-206L10.9	9.384	1.11e-19	0.075515	5	0.008048	yes	MSCLSK
chr1_778639_A_G_b38	RP11-206L10.9	9.27	2.85e-19	0.073224	9	0.007899	yes	MSCLSK
chr1_683167_G_A_b38	RP11-206L10.9	8.456	1.91e-16	0.058528	10	0.006922	yes	MSCLSK
chr1_777135_T_TC_b38	RP11-206L10.9	7.837	1.95e-14	0.066415	9	0.008474	yes	MSCLSK
chr1_649157_C_T_b38	RP11-206L10.9	7.688	5.69e-14	0.072478	3	0.009427	yes	MSCLSK
chr1_812899_A_T_b38	RP11-206L10.9	7.32	7.54e-13	0.060541	12	0.008271	yes	MSCLSK
chr1_784109_C_CATAAT_b38	RP11-206L10.9	7	6.52e-12	0.060794	10	0.008685	yes	MSCLSK
chr1_682706_A_G_b38	RP11-206L10.9	6.654	6.15e-11	0.086196	4	0.012953	yes	MSCLSK
chr1_812761_G_A_b38	RP11-206L10.9	6.613	8.01e-11	0.057715	7	0.008728	yes	MSCLSK
chr1_680167_C_G_b38	RP11-206L10.9	6.554	1.16e-10	0.101636	3	0.015507	yes	MSCLSK
chr1_818094_C_G_b38	RP11-206L10.9	-5.682	2.03e-08	-0.033226	58	0.005847	yes	MSCLSK
chr1_817514_T_C_b38	RP11-206L10.9	-5.613	2.97e-08	-0.032329	30	0.005759	yes	MSCLSK
chr1_819584_C_T_b38	RP11-206L10.9	-5.584	3.49e-08	-0.032801	42	0.005874	yes	MSCLSK
chr1_817341_A_G_b38	RP11-206L10.9	-5.551	4.18e-08	-0.032486	45	0.005853	yes	MSCLSK
chr1_817186_G_A_b38	RP11-206L10.9	-5.531	4.66e-08	-0.032505	34	0.005877	yes	MSCLSK
chr1_820560_C_T_b38	RP11-206L10.9	-5.505	5.36e-08	-0.031402	36	0.005704	yes	MSCLSK
chr1_825532_C_T_b38	RP11-206L10.9	-5.491	5.78e-08	-0.032354	30	0.005892	yes	MSCLSK
chr1_825767_T_C_b38	RP11-206L10.9	-5.491	5.78e-08	-0.032354	30	0.005892	yes	MSCLSK
chr1_819123_G_A_b38	RP11-206L10.9	-5.485	5.98e-08	-0.03211	42	0.005854	yes	MSCLSK
chr1_790933_CGAATGGAATG_C_b38	RP11-206L10.9	-5.435	7.81e-08	-0.027977	52	0.005147	yes	MSCLSK
chr1_824320_T_C_b38	RP11-206L10.9	-5.424	8.32e-08	-0.031597	32	0.005826	yes	MSCLSK
chr1_826577_A_AT_b38	RP11-206L10.9	-5.33	1.37e-07	-0.031458	29	0.005902	yes	MSCLSK
chr1_807692_C_A_b38	RP11-206L10.9	-5.044	5.96e-07	-0.047152	13	0.009348	yes	MSCLSK
chr1_789568_TATGGA_T_b38	RP11-206L10.9	-5.037	6.17e-07	-0.028938	55	0.005745	yes	MSCLSK
chr1_794299_C_G_b38	RP11-206L10.9	-4.799	1.99e-06	-0.027991	50	0.005833	yes	MSCLSK
chr1_808924_C_T_b38	RP11-206L10.9	-4.787	2.11e-06	-0.030061	14	0.006279	yes	MSCLSK
chr1_624767_T_G_b38	RP11-206L10.9	4.323	1.79e-05	0.027941	5	0.006463	yes	MSCLSK
chr1_814476_C_T_b38	RP11-206L10.9	-4.138	3.98e-05	-0.024015	39	0.005804	yes	MSCLSK
chr1_624752_C_T_b38	RP11-206L10.9	4.014	6.69e-05	0.025732	7	0.006411	yes	MSCLSK
chr1_813498_G_T_b38	RP11-206L10.9	-3.897	0.000108	-0.021645	48	0.005554	yes	MSCLSK
chr1_771398_G_A_b38	RP11-206L10.9	-3.875	0.000118	-0.020194	97	0.005212	yes	MSCLSK
chr1_98929_A_G_b38	RP11-206L10.9	3.669	0.000264	0.027133	8	0.007395	yes	MSCLSK
chr1_1269775_A_C_b38	RP11-206L10.9	-3.633	0.000302	-0.044856	5	0.012345	yes	MSCLSK
chr1_1269099_C_CCAT_b38	RP11-206L10.9	-3.379	0.000771	-0.042617	6	0.012611	yes	MSCLSK
chr1_598862_C_T_b38	RP11-206L10.9	3.333	0.000911	0.020945	7	0.006285	yes	MSCLSK
chr1_813885_G_A_b38	RP11-206L10.9	-3.257	0.00119	-0.015397	164	0.004728	yes	MSCLSK
chr1_814617_A_G_b38	RP11-206L10.9	-3.192	0.00148	-0.015534	75	0.004867	yes	MSCLSK
chr1_1056602_T_C_b38	RP11-206L10.9	3.187	0.00151	0.019901	37	0.006244	yes	MSCLSK
chr1_1261891_CTT_C_b38	RP11-206L10.9	-3.182	0.00153	-0.039672	5	0.012466	yes	MSCLSK
chr1_1259091_CGTGTGTGCAT_C_b38	RP11-206L10.9	-3.172	0.00158	-0.042508	3	0.013399	yes	MSCLSK
chr1_1466535_C_CA_b38	RP11-206L10.9	-3.13	0.00183	-0.021135	19	0.006752	yes	MSCLSK
chr1_680702_C_T_b38	RP11-206L10.9	-3.105	0.00199	-0.01996	15	0.006428	yes	MSCLSK
chr1_1718605_C_T_b38	RP11-206L10.9	-3.072	0.00222	-0.046396	4	0.015102	yes	MSCLSK
chr1_1718611_C_T_b38	RP11-206L10.9	-3.072	0.00222	-0.046396	4	0.015102	yes	MSCLSK
chr1_821000_T_A_b38	RP11-206L10.9	-3.072	0.00222	-0.017573	30	0.005721	yes	MSCLSK
chr1_791564_C_G_b38	RP11-206L10.9	-3.013	0.00269	-0.016309	76	0.005414	yes	MSCLSK
chr1_271406_C_CTTT_b38	RP11-206L10.9	2.98	0.00299	0.039799	3	0.013356	yes	MSCLSK
chr1_101674_C_CA_b38	RP11-206L10.9	2.961	0.00318	0.038403	3	0.012971	yes	MSCLSK
chr1_286388_A_G_b38	RP11-206L10.9	2.874	0.00418	0.0258	5	0.008976	yes	MSCLSK
chr1_828014_G_A_b38	RP11-206L10.9	-2.862	0.00435	-0.021534	50	0.007524	yes	MSCLSK
chr1_1002415_C_CATT_b38	RP11-206L10.9	2.844	0.0046	0.032213	10	0.011327	yes	MSCLSK
chr1_1056602_T_TGTGGGTGCGTGTGC_b38	RP11-206L10.9	-2.826	0.00486	-0.012454	116	0.004407	yes	MSCLSK
chr1_788757_T_TAATGG_b38	RP11-206L10.9	-2.748	0.00616	-0.012044	145	0.004382	yes	MSCLSK
chr1_732216_G_GA_b38	RP11-206L10.9	2.701	0.0071	0.046666	3	0.017277	yes	MSCLSK
chr1_667265_C_T_b38	RP11-206L10.9	2.662	0.00796	0.019606	41	0.007365	yes	MSCLSK
chr1_789680_AGGAATGGAAT_A_b38	RP11-206L10.9	-2.614	0.00916	-0.038191	3	0.01461	yes	MSCLSK
chr1_638771_A_T_b38	RP11-206L10.9	2.612	0.00921	0.022386	15	0.008569	yes	MSCLSK
chr1_868416_G_A_b38	RP11-206L10.9	2.611	0.00925	0.023337	5	0.008939	yes	MSCLSK
chr1_594082_G_A_b38	RP11-206L10.9	2.609	0.00931	0.032164	4	0.012331	yes	MSCLSK
chr1_677378_T_C_b38	RP11-206L10.9	11.409	1.48e-27	0.094208	6	0.008257	no	MSCLSK
chr1_680742_A_T_b38	RP11-206L10.9	11.352	2.55e-27	0.107336	3	0.009455	no	MSCLSK
chr1_809641_G_T_b38	RP11-206L10.9	8.757	1.81e-17	0.068154	14	0.007783	no	MSCLSK
chr1_788511_G_C_b38	RP11-206L10.9	-8.62	5.31e-17	-0.065989	18	0.007655	no	MSCLSK
chr1_783406_A_AT_b38	RP11-206L10.9	8.592	6.6e-17	0.065739	4	0.007651	no	MSCLSK
chr1_779047_G_A_b38	RP11-206L10.9	-8.532	1.05e-16	-0.06547	19	0.007673	no	MSCLSK
chr1_668074_G_A_b38	RP11-206L10.9	7.011	6.07e-12	0.097192	3	0.013863	no	MSCLSK
chr1_624836_G_A_b38	RP11-206L10.9	6.977	7.6e-12	0.081225	3	0.011642	no	MSCLSK
chr1_800909_T_A_b38	RP11-206L10.9	5.886	6.42e-09	0.037116	9	0.006306	no	MSCLSK
chr1_668125_A_C_b38	RP11-206L10.9	5.859	7.46e-09	0.089073	3	0.015201	no	MSCLSK
chr1_673518_C_T_b38	RP11-206L10.9	-4.064	5.42e-05	-0.023257	17	0.005722	no	MSCLSK
chr1_826420_A_T_b38	RP11-206L10.9	-3.972	7.94e-05	-0.019588	76	0.004932	no	MSCLSK
chr1_680812_T_C_b38	RP11-206L10.9	-3.856	0.000127	-0.022575	18	0.005855	no	MSCLSK
chr1_799082_G_A_b38	RP11-206L10.9	-3.808	0.000154	-0.02492	14	0.006544	no	MSCLSK
chr1_814773_T_C_b38	RP11-206L10.9	3.634	0.000301	0.02339	8	0.006436	no	MSCLSK
chr1_799080_TG_T_b38	RP11-206L10.9	3.499	0.000501	0.019268	38	0.005508	no	MSCLSK
chr1_868635_A_G_b38	RP11-206L10.9	3.254	0.0012	0.028154	5	0.008652	no	MSCLSK
chr1_681082_T_C_b38	RP11-206L10.9	-3.243	0.00125	-0.018835	21	0.005809	no	MSCLSK
chr1_1263116_T_TGGTGAACACAGACGCTACAGGC_b38	RP11-206L10.9	-3.196	0.00146	-0.040789	4	0.012762	no	MSCLSK
chr1_1268007_G_A_b38	RP11-206L10.9	-3.196	0.00146	-0.040789	4	0.012762	no	MSCLSK
chr1_1272639_C_CCACGCACCTACCTGCCTGGCTCACCTGCCTGTCACTCACG_b38	RP11-206L10.9	-3.102	0.00201	-0.039691	4	0.012795	no	MSCLSK
chr1_1277633_G_A_b38	RP11-206L10.9	-3.065	0.00227	-0.04013	3	0.013092	no	MSCLSK
chr1_1277746_G_T_b38	RP11-206L10.9	-3.065	0.00227	-0.04013	3	0.013092	no	MSCLSK
chr1_180904_T_TA_b38	RP11-206L10.9	3.048	0.0024	0.039215	5	0.012867	no	MSCLSK
chr1_1217168_G_A_b38	RP11-206L10.9	3.005	0.00276	0.052614	3	0.01751	no	MSCLSK
chr1_1056634_CTTGCTCTCCGGCGTGCATGTGTGGGTGCATGTACGT_C_b38	RP11-206L10.9	2.894	0.00393	0.043442	4	0.015009	no	MSCLSK
chr1_868308_C_G_b38	RP11-206L10.9	2.806	0.00517	0.023081	5	0.008226	no	MSCLSK
chr1_868322_G_A_b38	RP11-206L10.9	2.806	0.00517	0.023081	5	0.008226	no	MSCLSK
chr1_866281_C_T_b38	RP11-206L10.9	2.792	0.0054	0.022546	5	0.008076	no	MSCLSK
chr1_866300_A_C_b38	RP11-206L10.9	2.792	0.0054	0.022546	5	0.008076	no	MSCLSK
chr1_866478_C_T_b38	RP11-206L10.9	2.792	0.0054	0.022546	5	0.008076	no	MSCLSK
chr1_867476_C_T_b38	RP11-206L10.9	2.792	0.0054	0.022546	5	0.008076	no	MSCLSK
chr1_868052_T_C_b38	RP11-206L10.9	2.792	0.0054	0.022546	5	0.008076	no	MSCLSK
chr1_858952_G_A_b38	RP11-206L10.9	2.785	0.00551	0.021149	7	0.007593	no	MSCLSK
chr1_868216_T_C_b38	RP11-206L10.9	2.728	0.00654	0.022201	5	0.008137	no	MSCLSK
chr1_586844_G_A_b38	RP11-206L10.9	2.705	0.00701	0.042177	3	0.015591	no	MSCLSK
chr1_681041_T_C_b38	RP11-206L10.9	-2.656	0.0081	-0.015506	21	0.005837	no	MSCLSK
chr1_814619_A_G_b38	RP11-206L10.9	8.133	3.92e-15	0.184843	3	0.022728	yes	NERVET
chr1_624836_G_A_b38	RP11-206L10.9	7.056	6.32e-12	0.14924	4	0.021151	yes	NERVET
chr1_820560_C_T_b38	RP11-206L10.9	-6.124	1.96e-09	-0.067074	26	0.010953	yes	NERVET
chr1_649157_C_T_b38	RP11-206L10.9	5.783	1.35e-08	0.109826	3	0.01899	yes	NERVET
chr1_791564_C_G_b38	RP11-206L10.9	-4.868	1.55e-06	-0.050479	57	0.010371	yes	NERVET
chr1_814773_T_C_b38	RP11-206L10.9	4.447	1.09e-05	0.05483	8	0.012329	yes	NERVET
chr1_790933_CGAATGGAATG_C_b38	RP11-206L10.9	-4.041	6.24e-05	-0.041454	40	0.010258	yes	NERVET
chr1_821000_T_A_b38	RP11-206L10.9	-4.009	7.11e-05	-0.04437	24	0.011068	yes	NERVET
chr1_674381_A_AT_b38	RP11-206L10.9	3.913	0.000105	0.042906	28	0.010964	yes	NERVET
chr1_1650195_A_G_b38	RP11-206L10.9	3.884	0.000118	0.03537	62	0.009106	yes	NERVET
chr1_1638879_C_T_b38	RP11-206L10.9	3.842	0.000139	0.037612	39	0.00979	yes	NERVET
chr1_1639685_G_A_b38	RP11-206L10.9	3.84	0.00014	0.038775	34	0.010096	yes	NERVET
chr1_1639348_G_T_b38	RP11-206L10.9	3.717	0.000227	0.032817	73	0.008829	yes	NERVET
chr1_1659940_A_C_b38	RP11-206L10.9	3.709	0.000234	0.043818	14	0.011814	yes	NERVET
chr1_1660683_C_T_b38	RP11-206L10.9	3.658	0.000283	0.03567	42	0.00975	yes	NERVET
chr1_1648636_G_A_b38	RP11-206L10.9	3.504	0.000504	0.032301	67	0.009219	yes	NERVET
chr1_1661177_A_G_b38	RP11-206L10.9	3.501	0.000509	0.036155	31	0.010327	yes	NERVET
chr1_1652913_C_T_b38	RP11-206L10.9	3.5	0.000511	0.034111	42	0.009747	yes	NERVET
chr1_1637577_T_C_b38	RP11-206L10.9	3.495	0.000519	0.033969	38	0.009719	yes	NERVET
chr1_1624323_AT_A_b38	RP11-206L10.9	-3.495	0.000521	-0.031549	79	0.009028	yes	NERVET
chr1_1658830_C_G_b38	RP11-206L10.9	3.478	0.000553	0.035366	33	0.010169	yes	NERVET
chr1_1648826_A_G_b38	RP11-206L10.9	3.455	0.000601	0.031658	67	0.009163	yes	NERVET
chr1_1651926_T_C_b38	RP11-206L10.9	3.454	0.000604	0.031654	59	0.009165	yes	NERVET
chr1_1627515_C_T_b38	RP11-206L10.9	-3.449	0.000613	-0.030618	103	0.008876	yes	NERVET
chr1_1668108_C_T_b38	RP11-206L10.9	-3.431	0.000654	-0.031649	60	0.009223	yes	NERVET
chr1_1650777_G_A_b38	RP11-206L10.9	3.43	0.000658	0.031357	59	0.009142	yes	NERVET
chr1_1651421_GTAGCCCCTCTGAACGGTCTGTGACACACGCATGCTTTCAGCTAGAGTACTCTA_G_b38	RP11-206L10.9	3.387	0.000767	0.031285	57	0.009236	yes	NERVET
chr1_1651137_C_T_b38	RP11-206L10.9	3.383	0.000778	0.030946	59	0.009147	yes	NERVET
chr1_1651267_T_C_b38	RP11-206L10.9	3.383	0.000778	0.030946	59	0.009147	yes	NERVET
chr1_1651574_G_A_b38	RP11-206L10.9	3.383	0.000778	0.030946	59	0.009147	yes	NERVET
chr1_1651785_C_A_b38	RP11-206L10.9	3.383	0.000778	0.030946	59	0.009147	yes	NERVET
chr1_1652061_T_C_b38	RP11-206L10.9	3.383	0.000778	0.030946	59	0.009147	yes	NERVET
chr1_1652135_C_G_b38	RP11-206L10.9	3.383	0.000778	0.030946	59	0.009147	yes	NERVET
chr1_1652191_C_T_b38	RP11-206L10.9	3.383	0.000778	0.030946	59	0.009147	yes	NERVET
chr1_1652592_A_G_b38	RP11-206L10.9	3.383	0.000778	0.030946	59	0.009147	yes	NERVET
chr1_1652779_A_G_b38	RP11-206L10.9	3.383	0.000778	0.030946	59	0.009147	yes	NERVET
chr1_1653147_A_C_b38	RP11-206L10.9	3.383	0.000778	0.030946	59	0.009147	yes	NERVET
chr1_1653396_T_C_b38	RP11-206L10.9	3.383	0.000778	0.030946	59	0.009147	yes	NERVET
chr1_1653472_T_C_b38	RP11-206L10.9	3.383	0.000778	0.030946	59	0.009147	yes	NERVET
chr1_1653811_G_A_b38	RP11-206L10.9	3.383	0.000778	0.030946	59	0.009147	yes	NERVET
chr1_1653893_C_T_b38	RP11-206L10.9	3.383	0.000778	0.030946	59	0.009147	yes	NERVET
chr1_1654143_G_A_b38	RP11-206L10.9	3.383	0.000778	0.030946	59	0.009147	yes	NERVET
chr1_1654188_T_G_b38	RP11-206L10.9	3.383	0.000778	0.030946	59	0.009147	yes	NERVET
chr1_1653934_G_A_b38	RP11-206L10.9	3.339	0.00091	0.0306	59	0.009165	yes	NERVET
chr1_1658866_G_A_b38	RP11-206L10.9	3.335	0.000922	0.030516	61	0.00915	yes	NERVET
chr1_1659114_A_G_b38	RP11-206L10.9	3.335	0.000922	0.030516	61	0.00915	yes	NERVET
chr1_1659220_A_G_b38	RP11-206L10.9	3.335	0.000922	0.030516	61	0.00915	yes	NERVET
chr1_696963_C_G_b38	RP11-206L10.9	3.33	0.000939	0.066288	10	0.019907	yes	NERVET
chr1_1660408_T_C_b38	RP11-206L10.9	3.318	0.000978	0.037339	15	0.011253	yes	NERVET
chr1_1625951_G_A_b38	RP11-206L10.9	3.314	0.000992	0.030607	73	0.009235	yes	NERVET
chr1_1659060_G_A_b38	RP11-206L10.9	3.312	0.001	0.032152	44	0.009709	yes	NERVET
chr1_822427_CCCTGGCCAGCAGATCCACCCTGTCTATACTACCTG_C_b38	RP11-206L10.9	-3.309	0.00101	-0.035315	33	0.010672	yes	NERVET
chr1_1661420_C_A_b38	RP11-206L10.9	3.304	0.00103	0.030152	61	0.009127	yes	NERVET
chr1_1668542_C_T_b38	RP11-206L10.9	3.253	0.00122	0.034421	27	0.01058	yes	NERVET
chr1_1668717_C_G_b38	RP11-206L10.9	3.235	0.00131	0.033673	31	0.010411	yes	NERVET
chr1_1708474_C_A_b38	RP11-206L10.9	3.227	0.00134	0.037413	18	0.011592	yes	NERVET
chr1_1675091_A_G_b38	RP11-206L10.9	3.221	0.00137	0.033068	34	0.010266	yes	NERVET
chr1_607860_C_A_b38	RP11-206L10.9	3.204	0.00145	0.04108	3	0.012822	yes	NERVET
chr1_1667948_A_G_b38	RP11-206L10.9	3.127	0.00188	0.032611	31	0.010428	yes	NERVET
chr1_1641275_A_G_b38	RP11-206L10.9	3.113	0.00196	0.028635	67	0.009198	yes	NERVET
chr1_1665061_C_T_b38	RP11-206L10.9	3.105	0.00202	0.03224	31	0.010383	yes	NERVET
chr1_1616048_C_T_b38	RP11-206L10.9	3.084	0.00216	0.029788	58	0.009658	yes	NERVET
chr1_1628814_C_T_b38	RP11-206L10.9	3.061	0.00234	0.029604	57	0.009673	yes	NERVET
chr1_1605347_C_T_b38	RP11-206L10.9	3.051	0.00241	0.029556	57	0.009686	yes	NERVET
chr1_1628409_C_A_b38	RP11-206L10.9	3.036	0.00253	0.029355	57	0.009669	yes	NERVET
chr1_1624720_G_A_b38	RP11-206L10.9	3.026	0.00262	0.029273	58	0.009674	yes	NERVET
chr1_674562_T_C_b38	RP11-206L10.9	3.014	0.00272	0.0338	17	0.011216	yes	NERVET
chr1_1625805_G_A_b38	RP11-206L10.9	3.004	0.00281	0.029026	58	0.009663	yes	NERVET
chr1_1622510_C_T_b38	RP11-206L10.9	3	0.00285	0.029229	55	0.009744	yes	NERVET
chr1_1629572_TG_T_b38	RP11-206L10.9	2.985	0.00299	0.028745	59	0.009631	yes	NERVET
chr1_1650383_G_T_b38	RP11-206L10.9	2.974	0.00309	0.029189	45	0.009814	yes	NERVET
chr1_1665581_C_G_b38	RP11-206L10.9	2.97	0.00313	0.029783	36	0.010028	yes	NERVET
chr1_1664865_A_G_b38	RP11-206L10.9	2.954	0.00329	0.02699	60	0.009136	yes	NERVET
chr1_1618118_G_A_b38	RP11-206L10.9	2.95	0.00334	0.028748	55	0.009744	yes	NERVET
chr1_1669576_G_A_b38	RP11-206L10.9	2.942	0.00343	0.03081	31	0.010473	yes	NERVET
chr1_261495_T_C_b38	RP11-206L10.9	-2.905	0.00385	-0.143591	4	0.049435	yes	NERVET
chr1_1613090_A_G_b38	RP11-206L10.9	2.874	0.00423	0.028065	55	0.009764	yes	NERVET
chr1_1668721_C_T_b38	RP11-206L10.9	2.859	0.00445	0.028275	42	0.009891	yes	NERVET
chr1_1669613_G_A_b38	RP11-206L10.9	2.84	0.00471	0.029458	32	0.010372	yes	NERVET
chr1_1624086_G_A_b38	RP11-206L10.9	2.835	0.00478	0.026083	82	0.0092	yes	NERVET
chr1_1028687_C_T_b38	RP11-206L10.9	-2.821	0.005	-0.060685	9	0.021513	yes	NERVET
chr1_1126414_A_G_b38	RP11-206L10.9	-2.806	0.00523	-0.02603	72	0.009276	yes	NERVET
chr1_1126468_A_G_b38	RP11-206L10.9	-2.806	0.00523	-0.02603	72	0.009276	yes	NERVET
chr1_1594614_G_C_b38	RP11-206L10.9	2.806	0.00523	0.027744	54	0.009888	yes	NERVET
chr1_903551_A_C_b38	RP11-206L10.9	2.738	0.00641	0.034874	11	0.012735	yes	NERVET
chr1_1610924_C_T_b38	RP11-206L10.9	2.736	0.00647	0.026772	56	0.009786	yes	NERVET
chr1_1606539_G_GCC_b38	RP11-206L10.9	2.73	0.00657	0.02865	37	0.010493	yes	NERVET
chr1_1671097_G_C_b38	RP11-206L10.9	-2.719	0.00679	-0.024801	66	0.009121	yes	NERVET
chr1_1664757_T_C_b38	RP11-206L10.9	2.697	0.00726	0.024662	59	0.009145	yes	NERVET
chr1_1596144_GAGAC_G_b38	RP11-206L10.9	2.691	0.00738	0.026408	53	0.009812	yes	NERVET
chr1_1657926_A_AG_b38	RP11-206L10.9	2.684	0.00755	0.029305	26	0.01092	yes	NERVET
chr1_114810_C_T_b38	RP11-206L10.9	-2.668	0.0079	-0.029688	35	0.011127	yes	NERVET
chr1_1608603_C_A_b38	RP11-206L10.9	2.668	0.0079	0.026073	56	0.009773	yes	NERVET
chr1_788757_T_TAATGG_b38	RP11-206L10.9	-2.662	0.00804	-0.023258	107	0.008737	yes	NERVET
chr1_1650370_C_CT_b38	RP11-206L10.9	2.622	0.00904	0.029363	29	0.011201	yes	NERVET
chr1_875916_GCTC_G_b38	RP11-206L10.9	2.621	0.00905	0.058647	4	0.022373	yes	NERVET
chr1_1671148_C_T_b38	RP11-206L10.9	-2.619	0.00912	-0.023878	66	0.009119	yes	NERVET
chr1_1609070_G_A_b38	RP11-206L10.9	2.6	0.00962	0.025328	57	0.009741	yes	NERVET
chr1_1170681_G_A_b38	RP11-206L10.9	-2.595	0.00977	-0.0227	106	0.008748	yes	NERVET
chr1_677290_A_G_b38	RP11-206L10.9	11.061	2.21e-25	0.183403	4	0.016582	no	NERVET
chr1_677378_T_C_b38	RP11-206L10.9	11.039	2.66e-25	0.173017	5	0.015673	no	NERVET
chr1_681103_T_A_b38	RP11-206L10.9	10.016	1.69e-21	0.183139	3	0.018284	no	NERVET
chr1_680742_A_T_b38	RP11-206L10.9	9.733	1.74e-20	0.177794	3	0.018267	no	NERVET
chr1_809641_G_T_b38	RP11-206L10.9	9.415	2.27e-19	0.137233	11	0.014576	no	NERVET
chr1_788511_G_C_b38	RP11-206L10.9	-9.402	2.51e-19	-0.134488	14	0.014304	no	NERVET
chr1_788418_CAG_C_b38	RP11-206L10.9	-9.358	3.58e-19	-0.137056	10	0.014646	no	NERVET
chr1_778639_A_G_b38	RP11-206L10.9	9.285	6.4e-19	0.13869	8	0.014938	no	NERVET
chr1_788439_T_A_b38	RP11-206L10.9	9.285	6.4e-19	0.13869	8	0.014938	no	NERVET
chr1_800605_G_A_b38	RP11-206L10.9	9.195	1.29e-18	0.138479	8	0.01506	no	NERVET
chr1_779047_G_A_b38	RP11-206L10.9	-9.143	1.95e-18	-0.133127	14	0.014561	no	NERVET
chr1_812761_G_A_b38	RP11-206L10.9	8.904	1.24e-17	0.142708	6	0.016027	no	NERVET
chr1_783406_A_AT_b38	RP11-206L10.9	8.462	3.52e-16	0.126328	3	0.014929	no	NERVET
chr1_683167_G_A_b38	RP11-206L10.9	8.351	7.99e-16	0.114017	8	0.013653	no	NERVET
chr1_812899_A_T_b38	RP11-206L10.9	8.335	8.96e-16	0.129748	10	0.015566	no	NERVET
chr1_777135_T_TC_b38	RP11-206L10.9	7.9	2.07e-14	0.129406	7	0.016381	no	NERVET
chr1_784109_C_CATAAT_b38	RP11-206L10.9	7.214	2.25e-12	0.11925	8	0.016531	no	NERVET
chr1_800909_T_A_b38	RP11-206L10.9	6.839	2.54e-11	0.080754	8	0.011808	no	NERVET
chr1_668074_G_A_b38	RP11-206L10.9	6.584	1.25e-10	0.171411	3	0.026033	no	NERVET
chr1_818094_C_G_b38	RP11-206L10.9	-6.082	2.49e-09	-0.067965	42	0.011175	no	NERVET
chr1_819123_G_A_b38	RP11-206L10.9	-6.042	3.13e-09	-0.068096	28	0.01127	no	NERVET
chr1_819584_C_T_b38	RP11-206L10.9	-6.042	3.13e-09	-0.068096	28	0.01127	no	NERVET
chr1_817341_A_G_b38	RP11-206L10.9	-5.988	4.28e-09	-0.067619	31	0.011293	no	NERVET
chr1_789568_TATGGA_T_b38	RP11-206L10.9	-5.908	6.74e-09	-0.064647	42	0.010943	no	NERVET
chr1_825532_C_T_b38	RP11-206L10.9	-5.765	1.5e-08	-0.064811	23	0.011243	no	NERVET
chr1_825767_T_C_b38	RP11-206L10.9	-5.765	1.5e-08	-0.064811	23	0.011243	no	NERVET
chr1_794299_C_G_b38	RP11-206L10.9	-5.735	1.77e-08	-0.064123	38	0.011181	no	NERVET
chr1_826577_A_AT_b38	RP11-206L10.9	-5.701	2.12e-08	-0.063834	23	0.011196	no	NERVET
chr1_817514_T_C_b38	RP11-206L10.9	-5.638	3.01e-08	-0.061535	23	0.010915	no	NERVET
chr1_817186_G_A_b38	RP11-206L10.9	-5.617	3.37e-08	-0.062826	27	0.011186	no	NERVET
chr1_824320_T_C_b38	RP11-206L10.9	-5.609	3.52e-08	-0.062345	25	0.011116	no	NERVET
chr1_813498_G_T_b38	RP11-206L10.9	-5.599	3.7e-08	-0.059834	36	0.010686	no	NERVET
chr1_814476_C_T_b38	RP11-206L10.9	-5.329	1.55e-07	-0.059725	27	0.011207	no	NERVET
chr1_808924_C_T_b38	RP11-206L10.9	-5.22	2.71e-07	-0.067546	11	0.01294	no	NERVET
chr1_807692_C_A_b38	RP11-206L10.9	-4.749	2.74e-06	-0.085286	9	0.017959	no	NERVET
chr1_771398_G_A_b38	RP11-206L10.9	-4.357	1.63e-05	-0.045622	73	0.010471	no	NERVET
chr1_826420_A_T_b38	RP11-206L10.9	-4.334	1.8e-05	-0.041403	60	0.009554	no	NERVET
chr1_806017_A_G_b38	RP11-206L10.9	3.986	7.82e-05	0.07717	10	0.019362	no	NERVET
chr1_799082_G_A_b38	RP11-206L10.9	-3.979	8.04e-05	-0.05228	9	0.013139	no	NERVET
chr1_108545_C_CA_b38	RP11-206L10.9	-3.762	0.000191	-0.040408	33	0.010742	no	NERVET
chr1_261454_T_A_b38	RP11-206L10.9	-3.731	0.000214	-0.204391	3	0.054775	no	NERVET
chr1_98929_A_G_b38	RP11-206L10.9	3.655	0.000287	0.054118	5	0.014808	no	NERVET
chr1_1650688_T_A_b38	RP11-206L10.9	3.414	0.000698	0.033578	42	0.009837	no	NERVET
chr1_261463_C_A_b38	RP11-206L10.9	-3.405	0.00072	-0.186958	3	0.054907	no	NERVET
chr1_598862_C_T_b38	RP11-206L10.9	3.383	0.000777	0.042031	5	0.012422	no	NERVET
chr1_1739131_T_C_b38	RP11-206L10.9	-3.298	0.00105	-0.028532	102	0.008651	no	NERVET
chr1_791549_G_GGAATGGAATC_b38	RP11-206L10.9	-3.277	0.00113	-0.032892	38	0.010038	no	NERVET
chr1_1649932_C_T_b38	RP11-206L10.9	-3.212	0.00141	-0.028675	104	0.008929	no	NERVET
chr1_1653863_C_A_b38	RP11-206L10.9	3.177	0.00159	0.035728	17	0.011246	no	NERVET
chr1_1641261_C_T_b38	RP11-206L10.9	2.994	0.0029	0.032006	27	0.010689	no	NERVET
chr1_1629332_G_T_b38	RP11-206L10.9	-2.962	0.00321	-0.029424	52	0.009934	no	NERVET
chr1_633714_A_G_b38	RP11-206L10.9	2.96	0.00323	0.04989	15	0.016854	no	NERVET
chr1_1702383_T_C_b38	RP11-206L10.9	2.941	0.00344	0.030701	30	0.01044	no	NERVET
chr1_1649976_G_A_b38	RP11-206L10.9	-2.929	0.00357	-0.026626	85	0.009092	no	NERVET
chr1_271413_C_T_b38	RP11-206L10.9	-2.907	0.00382	-0.044457	6	0.015292	no	NERVET
chr1_1651653_C_T_b38	RP11-206L10.9	-2.905	0.00385	-0.02594	117	0.008929	no	NERVET
chr1_1722690_TA_T_b38	RP11-206L10.9	2.902	0.00388	0.040599	4	0.01399	no	NERVET
chr1_1630798_C_T_b38	RP11-206L10.9	-2.897	0.00394	-0.028759	49	0.009927	no	NERVET
chr1_1648736_G_A_b38	RP11-206L10.9	-2.895	0.00398	-0.026413	104	0.009125	no	NERVET
chr1_1621352_G_A_b38	RP11-206L10.9	-2.885	0.0041	-0.027625	56	0.009577	no	NERVET
chr1_1708521_C_G_b38	RP11-206L10.9	2.839	0.00472	0.029221	38	0.010293	no	NERVET
chr1_1075715_A_G_b38	RP11-206L10.9	2.839	0.00473	0.041104	6	0.014481	no	NERVET
chr1_1636278_G_T_b38	RP11-206L10.9	-2.768	0.00587	-0.025892	92	0.009355	no	NERVET
chr1_1613769_C_T_b38	RP11-206L10.9	-2.763	0.00595	-0.027817	50	0.010066	no	NERVET
chr1_1620609_G_A_b38	RP11-206L10.9	-2.742	0.00635	-0.026093	55	0.009517	no	NERVET
chr1_799080_TG_T_b38	RP11-206L10.9	2.702	0.00715	0.028752	31	0.010642	no	NERVET
chr1_1649846_G_A_b38	RP11-206L10.9	2.685	0.00751	0.027742	30	0.010331	no	NERVET
chr1_1622295_G_C_b38	RP11-206L10.9	-2.684	0.00755	-0.025557	55	0.009523	no	NERVET
chr1_817514_T_C_b38	RP11-206L10.9	-5.552	1.58e-07	-0.124101	10	0.022354	yes	OVARY
chr1_817186_G_A_b38	RP11-206L10.9	-5.509	1.92e-07	-0.125704	11	0.022817	yes	OVARY
chr1_825532_C_T_b38	RP11-206L10.9	-5.457	2.44e-07	-0.126396	10	0.023163	yes	OVARY
chr1_825767_T_C_b38	RP11-206L10.9	-5.457	2.44e-07	-0.126396	10	0.023163	yes	OVARY
chr1_826577_A_AT_b38	RP11-206L10.9	-5.457	2.44e-07	-0.126396	10	0.023163	yes	OVARY
chr1_820560_C_T_b38	RP11-206L10.9	-5.305	4.85e-07	-0.120616	11	0.022736	yes	OVARY
chr1_794299_C_G_b38	RP11-206L10.9	-5.259	5.95e-07	-0.118535	16	0.022538	yes	OVARY
chr1_824320_T_C_b38	RP11-206L10.9	-5.249	6.22e-07	-0.119659	11	0.022795	yes	OVARY
chr1_818094_C_G_b38	RP11-206L10.9	-5.026	1.66e-06	-0.116907	14	0.023258	yes	OVARY
chr1_813498_G_T_b38	RP11-206L10.9	-4.99	1.94e-06	-0.111956	13	0.022434	yes	OVARY
chr1_817341_A_G_b38	RP11-206L10.9	-4.989	1.95e-06	-0.117033	12	0.023456	yes	OVARY
chr1_789568_TATGGA_T_b38	RP11-206L10.9	-4.94	2.41e-06	-0.113788	17	0.023032	yes	OVARY
chr1_771398_G_A_b38	RP11-206L10.9	-3.807	0.000218	-0.085717	25	0.022513	yes	OVARY
chr1_808924_C_T_b38	RP11-206L10.9	-3.7	0.00032	-0.108021	3	0.029199	yes	OVARY
chr1_814476_C_T_b38	RP11-206L10.9	-3.654	0.000377	-0.095684	8	0.026187	yes	OVARY
chr1_822427_CCCTGGCCAGCAGATCCACCCTGTCTATACTACCTG_C_b38	RP11-206L10.9	-3.625	0.000416	-0.088939	11	0.024532	yes	OVARY
chr1_1257406_C_A_b38	RP11-206L10.9	3.494	0.000656	0.171552	3	0.049098	yes	OVARY
chr1_822556_C_A_b38	RP11-206L10.9	-3.316	0.00119	-0.08372	10	0.025246	yes	OVARY
chr1_799082_G_A_b38	RP11-206L10.9	-3.253	0.00146	-0.088096	6	0.027081	yes	OVARY
chr1_790933_CGAATGGAATG_C_b38	RP11-206L10.9	-3.21	0.00168	-0.076165	12	0.023729	yes	OVARY
chr1_820395_A_G_b38	RP11-206L10.9	-3.198	0.00175	-0.07866	10	0.024596	yes	OVARY
chr1_821000_T_A_b38	RP11-206L10.9	-2.945	0.00384	-0.07219	10	0.024512	yes	OVARY
chr1_813885_G_A_b38	RP11-206L10.9	-2.869	0.00482	-0.060285	36	0.02101	yes	OVARY
chr1_823246_C_T_b38	RP11-206L10.9	-2.853	0.00506	-0.073264	11	0.025681	yes	OVARY
chr1_1017844_C_T_b38	RP11-206L10.9	2.791	0.00607	0.078757	6	0.028218	yes	OVARY
chr1_822764_A_G_b38	RP11-206L10.9	-2.705	0.00777	-0.070433	10	0.026041	yes	OVARY
chr1_108545_C_CA_b38	RP11-206L10.9	-2.644	0.00923	-0.066313	7	0.025081	yes	OVARY
chr1_677290_A_G_b38	RP11-206L10.9	7.833	1.65e-12	0.236277	3	0.030165	no	OVARY
chr1_677378_T_C_b38	RP11-206L10.9	7.794	2.03e-12	0.23496	3	0.030146	no	OVARY
chr1_778639_A_G_b38	RP11-206L10.9	7.466	1.16e-11	0.227293	3	0.030444	no	OVARY
chr1_788439_T_A_b38	RP11-206L10.9	7.466	1.16e-11	0.227293	3	0.030444	no	OVARY
chr1_788418_CAG_C_b38	RP11-206L10.9	-6.832	3.12e-10	-0.200966	5	0.029417	no	OVARY
chr1_809641_G_T_b38	RP11-206L10.9	6.804	3.6e-10	0.218354	3	0.032093	no	OVARY
chr1_779047_G_A_b38	RP11-206L10.9	-6.559	1.24e-09	-0.205894	5	0.031393	no	OVARY
chr1_788511_G_C_b38	RP11-206L10.9	-6.542	1.35e-09	-0.200441	5	0.030637	no	OVARY
chr1_812899_A_T_b38	RP11-206L10.9	5.896	3.16e-08	0.201581	4	0.034191	no	OVARY
chr1_800909_T_A_b38	RP11-206L10.9	5.78	5.47e-08	0.136361	5	0.023593	no	OVARY
chr1_784109_C_CATAAT_b38	RP11-206L10.9	5.312	4.71e-07	0.180425	3	0.033968	no	OVARY
chr1_819123_G_A_b38	RP11-206L10.9	-4.916	2.67e-06	-0.11684	11	0.023765	no	OVARY
chr1_819584_C_T_b38	RP11-206L10.9	-4.916	2.67e-06	-0.11684	11	0.023765	no	OVARY
chr1_668125_A_C_b38	RP11-206L10.9	4.257	4e-05	0.17815	3	0.041851	no	OVARY
chr1_826420_A_T_b38	RP11-206L10.9	-4.205	4.89e-05	-0.085616	21	0.020362	no	OVARY
chr1_791564_C_G_b38	RP11-206L10.9	-3.059	0.00271	-0.068907	22	0.022524	no	OVARY
chr1_814773_T_C_b38	RP11-206L10.9	2.94	0.0039	0.076926	4	0.026163	no	OVARY
chr1_789680_A_AGGAATGGAAT_b38	RP11-206L10.9	-2.917	0.00418	-0.060388	20	0.020702	no	OVARY
chr1_1041119_GGGC_G_b38	RP11-206L10.9	2.79	0.00609	0.045374	8	0.016264	no	OVARY
chr1_98929_A_G_b38	RP11-206L10.9	2.758	0.00668	0.084124	3	0.030506	no	OVARY
chr1_799080_TG_T_b38	RP11-206L10.9	2.676	0.00842	0.059997	16	0.022417	no	OVARY
chr1_814476_C_T_b38	RP11-206L10.9	-5.225	3.68e-07	-0.04587	17	0.008779	yes	PNCREAS
chr1_807692_C_A_b38	RP11-206L10.9	-4.568	7.74e-06	-0.058097	6	0.012718	yes	PNCREAS
chr1_817341_A_G_b38	RP11-206L10.9	-4.205	3.64e-05	-0.038708	20	0.009205	yes	PNCREAS
chr1_818094_C_G_b38	RP11-206L10.9	-4.114	5.28e-05	-0.038289	24	0.009306	yes	PNCREAS
chr1_1570655_G_A_b38	RP11-206L10.9	-3.314	0.00106	-0.031306	11	0.009448	yes	PNCREAS
chr1_127972_G_A_b38	RP11-206L10.9	3.214	0.00148	0.035939	7	0.011182	yes	PNCREAS
chr1_771398_G_A_b38	RP11-206L10.9	-2.907	0.00397	-0.023038	45	0.007924	yes	PNCREAS
chr1_633423_C_T_b38	RP11-206L10.9	2.895	0.00413	0.045398	4	0.015681	yes	PNCREAS
chr1_94321_C_T_b38	RP11-206L10.9	-2.854	0.00468	-0.028392	5	0.009948	yes	PNCREAS
chr1_624767_T_G_b38	RP11-206L10.9	2.836	0.00495	0.027309	3	0.009631	yes	PNCREAS
chr1_1701564_CG_C_b38	RP11-206L10.9	2.674	0.00798	0.019027	38	0.007115	yes	PNCREAS
chr1_1724543_G_C_b38	RP11-206L10.9	2.608	0.00966	0.050098	4	0.019211	yes	PNCREAS
chr1_788511_G_C_b38	RP11-206L10.9	-6.58	2.76e-10	-0.072424	7	0.011007	no	PNCREAS
chr1_788418_CAG_C_b38	RP11-206L10.9	-6.401	7.61e-10	-0.07098	5	0.011089	no	PNCREAS
chr1_779047_G_A_b38	RP11-206L10.9	-6.326	1.16e-09	-0.070071	8	0.011076	no	PNCREAS
chr1_788439_T_A_b38	RP11-206L10.9	6.228	2e-09	0.06961	5	0.011178	no	PNCREAS
chr1_677378_T_C_b38	RP11-206L10.9	6.135	3.33e-09	0.072882	3	0.01188	no	PNCREAS
chr1_800605_G_A_b38	RP11-206L10.9	6.095	4.14e-09	0.067877	6	0.011137	no	PNCREAS
chr1_778639_A_G_b38	RP11-206L10.9	6.026	6.01e-09	0.066906	6	0.011103	no	PNCREAS
chr1_777135_T_TC_b38	RP11-206L10.9	5.936	9.76e-09	0.069224	5	0.011662	no	PNCREAS
chr1_677290_A_G_b38	RP11-206L10.9	5.861	1.45e-08	0.071462	3	0.012192	no	PNCREAS
chr1_809641_G_T_b38	RP11-206L10.9	5.702	3.35e-08	0.06258	8	0.010976	no	PNCREAS
chr1_812899_A_T_b38	RP11-206L10.9	5.425	1.37e-07	0.06256	8	0.011531	no	PNCREAS
chr1_820560_C_T_b38	RP11-206L10.9	-5.218	3.82e-07	-0.046299	15	0.008874	no	PNCREAS
chr1_783406_A_AT_b38	RP11-206L10.9	5.126	5.94e-07	0.057836	3	0.011283	no	PNCREAS
chr1_683167_G_A_b38	RP11-206L10.9	4.976	1.21e-06	0.051923	3	0.010434	no	PNCREAS
chr1_799082_G_A_b38	RP11-206L10.9	-4.583	7.27e-06	-0.045966	5	0.010031	no	PNCREAS
chr1_812761_G_A_b38	RP11-206L10.9	4.549	8.42e-06	0.057274	5	0.01259	no	PNCREAS
chr1_826577_A_AT_b38	RP11-206L10.9	-4.491	1.09e-05	-0.041229	13	0.009181	no	PNCREAS
chr1_817186_G_A_b38	RP11-206L10.9	-4.31	2.35e-05	-0.039962	16	0.009271	no	PNCREAS
chr1_825532_C_T_b38	RP11-206L10.9	-4.281	2.65e-05	-0.040102	12	0.009367	no	PNCREAS
chr1_825767_T_C_b38	RP11-206L10.9	-4.281	2.65e-05	-0.040102	12	0.009367	no	PNCREAS
chr1_819584_C_T_b38	RP11-206L10.9	-4.259	2.91e-05	-0.039599	16	0.009298	no	PNCREAS
chr1_784109_C_CATAAT_b38	RP11-206L10.9	4.213	3.52e-05	0.052723	5	0.012513	no	PNCREAS
chr1_824320_T_C_b38	RP11-206L10.9	-4.15	4.58e-05	-0.038289	13	0.009227	no	PNCREAS
chr1_819123_G_A_b38	RP11-206L10.9	-4.131	4.94e-05	-0.038058	16	0.009213	no	PNCREAS
chr1_794299_C_G_b38	RP11-206L10.9	-4.106	5.45e-05	-0.038073	19	0.009271	no	PNCREAS
chr1_789568_TATGGA_T_b38	RP11-206L10.9	-3.966	9.54e-05	-0.03561	20	0.008978	no	PNCREAS
chr1_800909_T_A_b38	RP11-206L10.9	3.626	0.000349	0.035334	4	0.009745	no	PNCREAS
chr1_817514_T_C_b38	RP11-206L10.9	-3.591	0.000397	-0.034013	11	0.009472	no	PNCREAS
chr1_813498_G_T_b38	RP11-206L10.9	-3.321	0.00103	-0.028736	16	0.008653	no	PNCREAS
chr1_799080_TG_T_b38	RP11-206L10.9	3.312	0.00106	0.028179	17	0.008509	no	PNCREAS
chr1_1368178_C_CTTTTT_b38	RP11-206L10.9	-2.998	0.00299	-0.035275	4	0.011767	no	PNCREAS
chr1_821000_T_A_b38	RP11-206L10.9	-2.929	0.00372	-0.026047	12	0.008893	no	PNCREAS
chr1_1480990_T_C_b38	RP11-206L10.9	2.821	0.00518	0.030157	22	0.010692	no	PNCREAS
chr1_822427_CCCTGGCCAGCAGATCCACCCTGTCTATACTACCTG_C_b38	RP11-206L10.9	-2.766	0.0061	-0.026093	14	0.009433	no	PNCREAS
chr1_1653825_T_TACACAC_b38	RP11-206L10.9	2.653	0.0085	0.021998	15	0.008292	no	PNCREAS
chr1_677378_T_C_b38	RP11-206L10.9	9.264	3.57e-17	0.187578	3	0.020248	yes	PTTARY
chr1_683167_G_A_b38	RP11-206L10.9	7.778	4.11e-13	0.148343	3	0.019073	yes	PTTARY
chr1_680742_A_T_b38	RP11-206L10.9	7.768	4.35e-13	0.176229	3	0.022685	yes	PTTARY
chr1_789680_A_AGGAATGGAAT_b38	RP11-206L10.9	-4.195	4.13e-05	-0.053848	30	0.012835	yes	PTTARY
chr1_790933_CGAATGGAATG_C_b38	RP11-206L10.9	-4.173	4.52e-05	-0.064272	14	0.015403	yes	PTTARY
chr1_605672_T_C_b38	RP11-206L10.9	3.424	0.000752	0.060724	5	0.017736	yes	PTTARY
chr1_799080_TG_T_b38	RP11-206L10.9	2.971	0.00334	0.047563	11	0.016007	yes	PTTARY
chr1_624767_T_G_b38	RP11-206L10.9	2.903	0.00412	0.054401	3	0.018742	yes	PTTARY
chr1_1388772_G_GA_b38	RP11-206L10.9	2.863	0.00465	0.089496	3	0.031259	yes	PTTARY
chr1_624752_C_T_b38	RP11-206L10.9	2.824	0.00523	0.05212	4	0.018455	yes	PTTARY
chr1_940263_C_G_b38	RP11-206L10.9	-2.691	0.00775	-0.048095	5	0.017876	yes	PTTARY
chr1_1677707_C_T_b38	RP11-206L10.9	-2.687	0.00784	-0.047572	7	0.017707	yes	PTTARY
chr1_681103_T_A_b38	RP11-206L10.9	6.719	1.94e-10	0.151226	4	0.022507	no	PTTARY
chr1_789568_TATGGA_T_b38	RP11-206L10.9	-5.015	1.18e-06	-0.083316	7	0.016614	no	PTTARY
chr1_800909_T_A_b38	RP11-206L10.9	5.003	1.25e-06	0.085335	5	0.017055	no	PTTARY
chr1_794299_C_G_b38	RP11-206L10.9	-4.436	1.53e-05	-0.075667	6	0.017059	no	PTTARY
chr1_818094_C_G_b38	RP11-206L10.9	-4.317	2.51e-05	-0.072745	8	0.016852	no	PTTARY
chr1_820560_C_T_b38	RP11-206L10.9	-4.198	4.08e-05	-0.066569	9	0.015858	no	PTTARY
chr1_824320_T_C_b38	RP11-206L10.9	-4.186	4.28e-05	-0.069601	6	0.016627	no	PTTARY
chr1_825532_C_T_b38	RP11-206L10.9	-4.186	4.28e-05	-0.069601	6	0.016627	no	PTTARY
chr1_825767_T_C_b38	RP11-206L10.9	-4.186	4.28e-05	-0.069601	6	0.016627	no	PTTARY
chr1_826577_A_AT_b38	RP11-206L10.9	-4.186	4.28e-05	-0.069601	6	0.016627	no	PTTARY
chr1_817186_G_A_b38	RP11-206L10.9	-4.175	4.49e-05	-0.069582	6	0.016668	no	PTTARY
chr1_817514_T_C_b38	RP11-206L10.9	-3.975	9.88e-05	-0.064848	7	0.016313	no	PTTARY
chr1_674381_A_AT_b38	RP11-206L10.9	3.936	0.000115	0.061238	12	0.015559	no	PTTARY
chr1_814476_C_T_b38	RP11-206L10.9	-3.846	0.000162	-0.063026	7	0.016388	no	PTTARY
chr1_817341_A_G_b38	RP11-206L10.9	-3.828	0.000174	-0.064889	6	0.016951	no	PTTARY
chr1_819123_G_A_b38	RP11-206L10.9	-3.779	0.000209	-0.063326	7	0.016759	no	PTTARY
chr1_819584_C_T_b38	RP11-206L10.9	-3.779	0.000209	-0.063326	7	0.016759	no	PTTARY
chr1_98929_A_G_b38	RP11-206L10.9	3.776	0.000211	0.082808	4	0.021927	no	PTTARY
chr1_674562_T_C_b38	RP11-206L10.9	3.565	0.000457	0.059262	7	0.016623	no	PTTARY
chr1_813498_G_T_b38	RP11-206L10.9	-3.421	0.000759	-0.0568	9	0.016604	no	PTTARY
chr1_771398_G_A_b38	RP11-206L10.9	-3.307	0.00112	-0.047695	23	0.014421	no	PTTARY
chr1_826420_A_T_b38	RP11-206L10.9	-3.061	0.00251	-0.042154	21	0.01377	no	PTTARY
chr1_813885_G_A_b38	RP11-206L10.9	-2.896	0.00421	-0.038625	50	0.013336	no	PTTARY
chr1_814773_T_C_b38	RP11-206L10.9	2.772	0.0061	0.047819	4	0.017248	no	PTTARY
chr1_1641642_T_C_b38	RP11-206L10.9	-2.729	0.00692	-0.040116	20	0.014697	no	PTTARY
chr1_599165_G_A_b38	RP11-206L10.9	2.697	0.00761	0.050634	5	0.018776	no	PTTARY
chr1_799082_G_A_b38	RP11-206L10.9	-2.613	0.00968	-0.048475	5	0.018554	no	PTTARY
chr1_683167_G_A_b38	RP11-206L10.9	6.125	5.5e-09	0.132745	4	0.021672	yes	PRSTTE
chr1_790933_CGAATGGAATG_C_b38	RP11-206L10.9	-4.385	1.96e-05	-0.075246	15	0.017159	yes	PRSTTE
chr1_674381_A_AT_b38	RP11-206L10.9	4.11	5.98e-05	0.081976	8	0.019944	yes	PRSTTE
chr1_799082_G_A_b38	RP11-206L10.9	-4.099	6.25e-05	-0.088287	4	0.021536	yes	PRSTTE
chr1_808924_C_T_b38	RP11-206L10.9	-4.019	8.58e-05	-0.079518	3	0.019788	yes	PRSTTE
chr1_789568_TATGGA_T_b38	RP11-206L10.9	-3.896	0.000137	-0.0731	12	0.018762	yes	PRSTTE
chr1_813498_G_T_b38	RP11-206L10.9	-3.667	0.000322	-0.070864	9	0.019323	yes	PRSTTE
chr1_818094_C_G_b38	RP11-206L10.9	-3.64	0.000355	-0.072309	16	0.019864	yes	PRSTTE
chr1_586069_T_A_b38	RP11-206L10.9	3.63	0.000368	0.09792	5	0.026972	yes	PRSTTE
chr1_771398_G_A_b38	RP11-206L10.9	-3.617	0.000387	-0.05942	32	0.01643	yes	PRSTTE
chr1_799080_TG_T_b38	RP11-206L10.9	3.567	0.000462	0.064191	13	0.017995	yes	PRSTTE
chr1_1063661_ATG_A_b38	RP11-206L10.9	3.55	0.000492	0.049059	47	0.013821	yes	PRSTTE
chr1_1479205_A_C_b38	RP11-206L10.9	3.527	0.000532	0.07995	8	0.022666	yes	PRSTTE
chr1_111735_C_A_b38	RP11-206L10.9	3.519	0.000547	0.061843	11	0.017572	yes	PRSTTE
chr1_1499279_C_CT_b38	RP11-206L10.9	3.449	7e-04	0.121875	3	0.035336	yes	PRSTTE
chr1_794299_C_G_b38	RP11-206L10.9	-3.412	0.000796	-0.068012	13	0.019934	yes	PRSTTE
chr1_1028320_GCC_G_b38	RP11-206L10.9	3.395	0.000842	0.056386	40	0.016606	yes	PRSTTE
chr1_820560_C_T_b38	RP11-206L10.9	-3.306	0.00114	-0.063514	9	0.019209	yes	PRSTTE
chr1_817186_G_A_b38	RP11-206L10.9	-3.253	0.00136	-0.066265	8	0.020369	yes	PRSTTE
chr1_817341_A_G_b38	RP11-206L10.9	-3.243	0.00141	-0.065169	11	0.020095	yes	PRSTTE
chr1_814476_C_T_b38	RP11-206L10.9	-3.225	0.0015	-0.066028	12	0.020476	yes	PRSTTE
chr1_1069009_T_TC_b38	RP11-206L10.9	3.115	0.00214	0.045888	41	0.014733	yes	PRSTTE
chr1_1083800_T_C_b38	RP11-206L10.9	3.106	0.00221	0.042071	50	0.013547	yes	PRSTTE
chr1_1081790_C_G_b38	RP11-206L10.9	3.04	0.00272	0.042191	55	0.01388	yes	PRSTTE
chr1_819123_G_A_b38	RP11-206L10.9	-3.022	0.00287	-0.060097	10	0.019886	yes	PRSTTE
chr1_819584_C_T_b38	RP11-206L10.9	-3.022	0.00287	-0.060097	10	0.019886	yes	PRSTTE
chr1_1041126_AGCGGGGGC_A_b38	RP11-206L10.9	3.003	0.00305	0.035035	22	0.011668	yes	PRSTTE
chr1_826577_A_AT_b38	RP11-206L10.9	-2.972	0.00336	-0.059774	8	0.020112	yes	PRSTTE
chr1_1041119_GGGC_G_b38	RP11-206L10.9	2.972	0.00336	0.034601	22	0.011643	yes	PRSTTE
chr1_674562_T_C_b38	RP11-206L10.9	2.915	0.00401	0.056381	5	0.019344	yes	PRSTTE
chr1_624767_T_G_b38	RP11-206L10.9	2.905	0.00413	0.057513	3	0.019799	yes	PRSTTE
chr1_908690_A_AGAGGGGACAAGTGG_b38	RP11-206L10.9	-2.89	0.00432	-0.043954	27	0.015209	yes	PRSTTE
chr1_10439_AC_A_b38	RP11-206L10.9	2.882	0.00443	0.059494	5	0.020643	yes	PRSTTE
chr1_824320_T_C_b38	RP11-206L10.9	-2.86	0.00473	-0.057146	8	0.01998	yes	PRSTTE
chr1_598862_C_T_b38	RP11-206L10.9	2.839	0.00505	0.058938	3	0.020764	yes	PRSTTE
chr1_978509_G_A_b38	RP11-206L10.9	2.725	0.00707	0.039185	50	0.014382	yes	PRSTTE
chr1_897580_AT_A_b38	RP11-206L10.9	2.724	0.00707	0.042114	52	0.015458	yes	PRSTTE
chr1_791564_C_G_b38	RP11-206L10.9	-2.619	0.00956	-0.046198	25	0.017638	yes	PRSTTE
chr1_1056597_G_A_b38	RP11-206L10.9	2.615	0.00968	0.035778	57	0.013682	yes	PRSTTE
chr1_905373_T_C_b38	RP11-206L10.9	2.607	0.00988	0.038504	39	0.014767	yes	PRSTTE
chr1_809641_G_T_b38	RP11-206L10.9	7.658	1.1e-12	0.174467	3	0.022783	no	PRSTTE
chr1_777135_T_TC_b38	RP11-206L10.9	7.288	9.4e-12	0.173577	3	0.023816	no	PRSTTE
chr1_778639_A_G_b38	RP11-206L10.9	7.264	1.08e-11	0.168062	3	0.023135	no	PRSTTE
chr1_788439_T_A_b38	RP11-206L10.9	7.264	1.08e-11	0.168062	3	0.023135	no	PRSTTE
chr1_800605_G_A_b38	RP11-206L10.9	7.264	1.08e-11	0.168062	3	0.023135	no	PRSTTE
chr1_788418_CAG_C_b38	RP11-206L10.9	-7.206	1.51e-11	-0.166291	4	0.023078	no	PRSTTE
chr1_779047_G_A_b38	RP11-206L10.9	-7.031	4.05e-11	-0.159366	6	0.022666	no	PRSTTE
chr1_788511_G_C_b38	RP11-206L10.9	-7.031	4.05e-11	-0.159366	6	0.022666	no	PRSTTE
chr1_812899_A_T_b38	RP11-206L10.9	6.601	4.38e-10	0.159084	4	0.0241	no	PRSTTE
chr1_783406_A_AT_b38	RP11-206L10.9	5.529	1.11e-07	0.133024	3	0.024061	no	PRSTTE
chr1_812761_G_A_b38	RP11-206L10.9	4.996	1.38e-06	0.134637	3	0.026952	no	PRSTTE
chr1_784109_C_CATAAT_b38	RP11-206L10.9	4.813	3.12e-06	0.126709	3	0.026326	no	PRSTTE
chr1_814773_T_C_b38	RP11-206L10.9	4.715	4.81e-06	0.094823	3	0.020111	no	PRSTTE
chr1_807692_C_A_b38	RP11-206L10.9	-3.582	0.000438	-0.108513	4	0.030293	no	PRSTTE
chr1_1086657_C_T_b38	RP11-206L10.9	3.577	0.000445	0.048325	51	0.013508	no	PRSTTE
chr1_54586_T_C_b38	RP11-206L10.9	3.145	0.00194	0.043543	37	0.013844	no	PRSTTE
chr1_817514_T_C_b38	RP11-206L10.9	-3.067	0.00249	-0.059133	7	0.019278	no	PRSTTE
chr1_825532_C_T_b38	RP11-206L10.9	-3.04	0.00272	-0.061471	7	0.02022	no	PRSTTE
chr1_825767_T_C_b38	RP11-206L10.9	-3.04	0.00272	-0.061471	7	0.02022	no	PRSTTE
chr1_1101437_T_C_b38	RP11-206L10.9	-2.977	0.00331	-0.048884	18	0.016422	no	PRSTTE
chr1_1101667_C_T_b38	RP11-206L10.9	-2.977	0.00331	-0.048884	18	0.016422	no	PRSTTE
chr1_1112601_G_A_b38	RP11-206L10.9	-2.977	0.00331	-0.048884	18	0.016422	no	PRSTTE
chr1_98945_C_T_b38	RP11-206L10.9	2.959	0.0035	0.048037	32	0.016236	no	PRSTTE
chr1_1073854_T_C_b38	RP11-206L10.9	2.919	0.00396	0.03975	54	0.013619	no	PRSTTE
chr1_13613_T_A_b38	RP11-206L10.9	2.896	0.00424	0.060146	3	0.020766	no	PRSTTE
chr1_1083324_A_G_b38	RP11-206L10.9	2.838	0.00505	0.038643	51	0.013614	no	PRSTTE
chr1_1057439_G_A_b38	RP11-206L10.9	2.833	0.00514	0.041269	55	0.014569	no	PRSTTE
chr1_1075337_C_T_b38	RP11-206L10.9	2.807	0.00555	0.03869	49	0.013783	no	PRSTTE
chr1_1063202_G_C_b38	RP11-206L10.9	2.795	0.00574	0.039689	57	0.014198	no	PRSTTE
chr1_1060101_T_G_b38	RP11-206L10.9	2.785	0.00592	0.040946	56	0.014703	no	PRSTTE
chr1_1485324_C_T_b38	RP11-206L10.9	-2.77	0.0062	-0.070439	4	0.025433	no	PRSTTE
chr1_1495136_G_A_b38	RP11-206L10.9	-2.77	0.0062	-0.070439	4	0.025433	no	PRSTTE
chr1_1124794_C_T_b38	RP11-206L10.9	-2.692	0.00777	-0.043095	20	0.016009	no	PRSTTE
chr1_1479704_G_A_b38	RP11-206L10.9	-2.663	0.00843	-0.067318	4	0.025275	no	PRSTTE
chr1_979472_G_C_b38	RP11-206L10.9	2.662	0.00846	0.038357	51	0.014408	no	PRSTTE
chr1_1057980_C_A_b38	RP11-206L10.9	2.604	0.00997	0.03805	56	0.014609	no	PRSTTE
chr1_683066_G_A_b38	RP11-206L10.9	10.411	7.24e-23	0.156461	3	0.015029	yes	SKINNS
chr1_677378_T_C_b38	RP11-206L10.9	9.527	1.04e-19	0.140933	5	0.014793	yes	SKINNS
chr1_680742_A_T_b38	RP11-206L10.9	9.271	7.95e-19	0.149553	3	0.016131	yes	SKINNS
chr1_681103_T_A_b38	RP11-206L10.9	8.203	2.53e-15	0.134783	5	0.016432	yes	SKINNS
chr1_683167_G_A_b38	RP11-206L10.9	7.541	2.63e-13	0.094351	6	0.012511	yes	SKINNS
chr1_624836_G_A_b38	RP11-206L10.9	6.948	1.32e-11	0.134582	4	0.019369	yes	SKINNS
chr1_790933_CGAATGGAATG_C_b38	RP11-206L10.9	-4.486	9.25e-06	-0.042919	35	0.009568	yes	SKINNS
chr1_39261_T_C_b38	RP11-206L10.9	3.675	0.000267	0.057775	9	0.015723	yes	SKINNS
chr1_681082_T_C_b38	RP11-206L10.9	-3.395	0.000747	-0.036281	15	0.010686	yes	SKINNS
chr1_814773_T_C_b38	RP11-206L10.9	3.245	0.00126	0.036496	8	0.011248	yes	SKINNS
chr1_856473_G_A_b38	RP11-206L10.9	3.208	0.00143	0.04626	4	0.014421	yes	SKINNS
chr1_598862_C_T_b38	RP11-206L10.9	3.198	0.00148	0.037175	4	0.011626	yes	SKINNS
chr1_1480071_C_T_b38	RP11-206L10.9	3.089	0.00213	0.078022	4	0.025259	yes	SKINNS
chr1_624752_C_T_b38	RP11-206L10.9	3.076	0.00223	0.035459	7	0.011529	yes	SKINNS
chr1_791564_C_G_b38	RP11-206L10.9	-3.025	0.00263	-0.029779	58	0.009844	yes	SKINNS
chr1_271931_T_C_b38	RP11-206L10.9	-2.898	0.00394	-0.034679	9	0.011965	yes	SKINNS
chr1_680812_T_C_b38	RP11-206L10.9	-2.814	0.00511	-0.03012	14	0.010704	yes	SKINNS
chr1_1199862_A_C_b38	RP11-206L10.9	-2.761	0.006	-0.025703	50	0.009308	yes	SKINNS
chr1_857948_C_CT_b38	RP11-206L10.9	2.688	0.00746	0.041893	3	0.015587	yes	SKINNS
chr1_624779_A_G_b38	RP11-206L10.9	-2.664	0.008	-0.055753	3	0.020928	yes	SKINNS
chr1_10439_AC_A_b38	RP11-206L10.9	2.627	0.00892	0.029614	15	0.011274	yes	SKINNS
chr1_1195463_A_G_b38	RP11-206L10.9	-2.601	0.00959	-0.024353	48	0.009361	yes	SKINNS
chr1_1131430_C_CTTTTTTTTTTTTTTT_b38	RP11-206L10.9	2.595	0.00976	0.022885	72	0.008817	yes	SKINNS
chr1_799688_A_G_b38	RP11-206L10.9	9.482	1.49e-19	0.143042	3	0.015085	no	SKINNS
chr1_788439_T_A_b38	RP11-206L10.9	9.357	4.03e-19	0.130971	8	0.013997	no	SKINNS
chr1_800605_G_A_b38	RP11-206L10.9	9.206	1.32e-18	0.12904	9	0.014017	no	SKINNS
chr1_778639_A_G_b38	RP11-206L10.9	9.206	1.32e-18	0.12834	9	0.013941	no	SKINNS
chr1_788418_CAG_C_b38	RP11-206L10.9	-9.106	2.88e-18	-0.125015	10	0.013728	no	SKINNS
chr1_809641_G_T_b38	RP11-206L10.9	8.989	7.15e-18	0.123873	10	0.013781	no	SKINNS
chr1_788511_G_C_b38	RP11-206L10.9	-8.878	1.67e-17	-0.119403	13	0.013449	no	SKINNS
chr1_677290_A_G_b38	RP11-206L10.9	8.605	1.31e-16	0.131714	5	0.015306	no	SKINNS
chr1_779047_G_A_b38	RP11-206L10.9	-8.491	3.06e-16	-0.114844	15	0.013525	no	SKINNS
chr1_777135_T_TC_b38	RP11-206L10.9	8.331	9.99e-16	0.127682	8	0.015327	no	SKINNS
chr1_784109_C_CATAAT_b38	RP11-206L10.9	8.148	3.76e-15	0.124222	8	0.015246	no	SKINNS
chr1_812761_G_A_b38	RP11-206L10.9	7.998	1.1e-14	0.125376	5	0.015676	no	SKINNS
chr1_812899_A_T_b38	RP11-206L10.9	7.722	7.61e-14	0.112738	10	0.0146	no	SKINNS
chr1_800909_T_A_b38	RP11-206L10.9	6.801	3.34e-11	0.075485	9	0.011098	no	SKINNS
chr1_668074_G_A_b38	RP11-206L10.9	6.579	1.33e-10	0.154019	3	0.02341	no	SKINNS
chr1_808924_C_T_b38	RP11-206L10.9	-6.048	3.11e-09	-0.069031	10	0.011415	no	SKINNS
chr1_820560_C_T_b38	RP11-206L10.9	-5.97	4.84e-09	-0.060505	30	0.010135	no	SKINNS
chr1_807692_C_A_b38	RP11-206L10.9	-5.934	5.94e-09	-0.097555	8	0.01644	no	SKINNS
chr1_794299_C_G_b38	RP11-206L10.9	-5.857	9.13e-09	-0.062147	35	0.01061	no	SKINNS
chr1_813498_G_T_b38	RP11-206L10.9	-5.818	1.14e-08	-0.060736	31	0.010439	no	SKINNS
chr1_789568_TATGGA_T_b38	RP11-206L10.9	-5.679	2.44e-08	-0.059162	36	0.010417	no	SKINNS
chr1_825532_C_T_b38	RP11-206L10.9	-5.402	1.07e-07	-0.057844	23	0.010708	no	SKINNS
chr1_825767_T_C_b38	RP11-206L10.9	-5.402	1.07e-07	-0.057844	23	0.010708	no	SKINNS
chr1_824320_T_C_b38	RP11-206L10.9	-5.319	1.66e-07	-0.056149	25	0.010557	no	SKINNS
chr1_819584_C_T_b38	RP11-206L10.9	-5.316	1.68e-07	-0.05702	33	0.010726	no	SKINNS
chr1_826577_A_AT_b38	RP11-206L10.9	-5.27	2.13e-07	-0.055934	24	0.010613	no	SKINNS
chr1_818094_C_G_b38	RP11-206L10.9	-5.258	2.26e-07	-0.056688	40	0.010781	no	SKINNS
chr1_817186_G_A_b38	RP11-206L10.9	-5.253	2.32e-07	-0.056442	25	0.010745	no	SKINNS
chr1_817341_A_G_b38	RP11-206L10.9	-5.231	2.6e-07	-0.056339	34	0.010771	no	SKINNS
chr1_819123_G_A_b38	RP11-206L10.9	-5.19	3.21e-07	-0.055318	33	0.010659	no	SKINNS
chr1_817514_T_C_b38	RP11-206L10.9	-5.143	4.06e-07	-0.053495	25	0.010402	no	SKINNS
chr1_771398_G_A_b38	RP11-206L10.9	-4.986	8.85e-07	-0.046079	74	0.009242	no	SKINNS
chr1_806017_A_G_b38	RP11-206L10.9	4.061	5.78e-05	0.072136	11	0.017765	no	SKINNS
chr1_821000_T_A_b38	RP11-206L10.9	-3.986	7.85e-05	-0.041104	25	0.010312	no	SKINNS
chr1_814476_C_T_b38	RP11-206L10.9	-3.798	0.000166	-0.040497	29	0.010663	no	SKINNS
chr1_822427_CCCTGGCCAGCAGATCCACCCTGTCTATACTACCTG_C_b38	RP11-206L10.9	-3.775	0.000181	-0.03908	29	0.010351	no	SKINNS
chr1_826420_A_T_b38	RP11-206L10.9	-3.636	0.00031	-0.032569	56	0.008958	no	SKINNS
chr1_789680_A_AGGAATGGAAT_b38	RP11-206L10.9	-3.565	0.000404	-0.030169	58	0.008463	no	SKINNS
chr1_799082_G_A_b38	RP11-206L10.9	-3.562	0.000408	-0.043009	10	0.012075	no	SKINNS
chr1_624767_T_G_b38	RP11-206L10.9	3.375	0.000802	0.039031	5	0.011563	no	SKINNS
chr1_1773713_T_TGA_b38	RP11-206L10.9	3.239	0.00129	0.038033	11	0.011743	no	SKINNS
chr1_1188405_A_ATT_b38	RP11-206L10.9	-3.167	0.00165	-0.045231	6	0.014282	no	SKINNS
chr1_861387_G_A_b38	RP11-206L10.9	-3.155	0.00171	-0.035959	54	0.011396	no	SKINNS
chr1_1189019_C_G_b38	RP11-206L10.9	-3.121	0.00192	-0.041747	7	0.013374	no	SKINNS
chr1_1186816_A_G_b38	RP11-206L10.9	-3.118	0.00194	-0.040505	9	0.012991	no	SKINNS
chr1_98929_A_G_b38	RP11-206L10.9	3.109	0.002	0.043007	3	0.013835	no	SKINNS
chr1_1196039_C_G_b38	RP11-206L10.9	-3.106	0.00201	-0.035251	15	0.011348	no	SKINNS
chr1_1187016_C_T_b38	RP11-206L10.9	-3.065	0.00231	-0.041165	7	0.013432	no	SKINNS
chr1_1187013_A_AT_b38	RP11-206L10.9	-2.998	0.00287	-0.040465	7	0.013495	no	SKINNS
chr1_1187008_G_A_b38	RP11-206L10.9	-2.955	0.0033	-0.039709	7	0.013439	no	SKINNS
chr1_1189968_T_C_b38	RP11-206L10.9	-2.948	0.00336	-0.038931	8	0.013204	no	SKINNS
chr1_1190856_G_A_b38	RP11-206L10.9	-2.948	0.00336	-0.038931	8	0.013204	no	SKINNS
chr1_1324185_T_TGG_b38	RP11-206L10.9	2.933	0.00353	0.055006	7	0.018755	no	SKINNS
chr1_1194826_G_A_b38	RP11-206L10.9	-2.923	0.00364	-0.029959	23	0.01025	no	SKINNS
chr1_820395_A_G_b38	RP11-206L10.9	-2.898	0.00394	-0.031388	23	0.010829	no	SKINNS
chr1_1191942_G_A_b38	RP11-206L10.9	-2.887	0.00408	-0.039218	7	0.013585	no	SKINNS
chr1_1189730_T_C_b38	RP11-206L10.9	-2.881	0.00416	-0.039342	8	0.013655	no	SKINNS
chr1_868635_A_G_b38	RP11-206L10.9	2.872	0.00427	0.047856	3	0.016662	no	SKINNS
chr1_1197558_G_A_b38	RP11-206L10.9	-2.87	0.0043	-0.039312	8	0.013697	no	SKINNS
chr1_1196061_C_T_b38	RP11-206L10.9	-2.795	0.00541	-0.038589	8	0.013805	no	SKINNS
chr1_1193141_C_T_b38	RP11-206L10.9	-2.793	0.00545	-0.028922	22	0.010356	no	SKINNS
chr1_1196201_T_C_b38	RP11-206L10.9	-2.786	0.00556	-0.026822	40	0.009627	no	SKINNS
chr1_1190173_A_T_b38	RP11-206L10.9	-2.777	0.00571	-0.029029	21	0.010453	no	SKINNS
chr1_1186850_GT_G_b38	RP11-206L10.9	-2.776	0.00573	-0.03602	8	0.012975	no	SKINNS
chr1_1430020_G_C_b38	RP11-206L10.9	-2.774	0.00577	-0.045289	3	0.016325	no	SKINNS
chr1_1197893_T_C_b38	RP11-206L10.9	-2.774	0.00578	-0.026716	40	0.009632	no	SKINNS
chr1_1198407_T_C_b38	RP11-206L10.9	-2.774	0.00578	-0.026716	40	0.009632	no	SKINNS
chr1_1198435_T_C_b38	RP11-206L10.9	-2.774	0.00578	-0.026716	40	0.009632	no	SKINNS
chr1_271406_C_CTTT_b38	RP11-206L10.9	2.76	0.00602	0.06629	3	0.024018	no	SKINNS
chr1_1186644_T_C_b38	RP11-206L10.9	-2.715	0.00689	-0.036392	8	0.013406	no	SKINNS
chr1_1187136_G_A_b38	RP11-206L10.9	-2.715	0.00689	-0.036392	8	0.013406	no	SKINNS
chr1_1187726_G_A_b38	RP11-206L10.9	-2.715	0.00689	-0.036392	8	0.013406	no	SKINNS
chr1_1188877_A_G_b38	RP11-206L10.9	-2.715	0.00689	-0.036392	8	0.013406	no	SKINNS
chr1_1189511_G_A_b38	RP11-206L10.9	-2.715	0.00689	-0.036392	8	0.013406	no	SKINNS
chr1_1190875_G_C_b38	RP11-206L10.9	-2.715	0.00689	-0.036392	8	0.013406	no	SKINNS
chr1_1192000_G_A_b38	RP11-206L10.9	-2.715	0.00689	-0.036392	8	0.013406	no	SKINNS
chr1_1192127_G_A_b38	RP11-206L10.9	-2.715	0.00689	-0.036392	8	0.013406	no	SKINNS
chr1_1192143_C_T_b38	RP11-206L10.9	-2.715	0.00689	-0.036392	8	0.013406	no	SKINNS
chr1_1192951_G_T_b38	RP11-206L10.9	-2.715	0.00689	-0.036392	8	0.013406	no	SKINNS
chr1_1193049_G_A_b38	RP11-206L10.9	-2.715	0.00689	-0.036392	8	0.013406	no	SKINNS
chr1_1194292_G_T_b38	RP11-206L10.9	-2.715	0.00689	-0.036392	8	0.013406	no	SKINNS
chr1_1194327_A_G_b38	RP11-206L10.9	-2.715	0.00689	-0.036392	8	0.013406	no	SKINNS
chr1_1194713_C_T_b38	RP11-206L10.9	-2.715	0.00689	-0.036392	8	0.013406	no	SKINNS
chr1_1013466_T_TA_b38	RP11-206L10.9	-2.71	0.00699	-0.051718	11	0.019085	no	SKINNS
chr1_1185634_G_A_b38	RP11-206L10.9	-2.703	0.00713	-0.035793	9	0.013241	no	SKINNS
chr1_1197874_G_A_b38	RP11-206L10.9	-2.703	0.00714	-0.036325	8	0.013441	no	SKINNS
chr1_1191614_G_A_b38	RP11-206L10.9	-2.701	0.00718	-0.036135	8	0.01338	no	SKINNS
chr1_1197405_C_T_b38	RP11-206L10.9	-2.685	0.00752	-0.03558	9	0.013251	no	SKINNS
chr1_1197586_C_A_b38	RP11-206L10.9	-2.685	0.00752	-0.03558	9	0.013251	no	SKINNS
chr1_1199327_G_A_b38	RP11-206L10.9	-2.685	0.00752	-0.03558	9	0.013251	no	SKINNS
chr1_832736_A_AGTTTT_b38	RP11-206L10.9	-2.678	0.00767	-0.021863	115	0.008163	no	SKINNS
chr1_1197697_A_G_b38	RP11-206L10.9	-2.666	0.00796	-0.025149	47	0.009435	no	SKINNS
chr1_1199253_C_T_b38	RP11-206L10.9	-2.665	0.00798	-0.033673	11	0.012636	no	SKINNS
chr1_1186277_T_C_b38	RP11-206L10.9	-2.663	0.00803	-0.02679	26	0.010061	no	SKINNS
chr1_1186939_C_T_b38	RP11-206L10.9	-2.629	0.00886	-0.035441	8	0.013481	no	SKINNS
chr1_875400_G_C_b38	RP11-206L10.9	2.619	0.00913	0.03319	12	0.012675	no	SKINNS
chr1_69761_A_T_b38	RP11-206L10.9	-2.616	0.00919	-0.043208	6	0.016514	no	SKINNS
chr1_868729_C_A_b38	RP11-206L10.9	2.593	0.00981	0.041757	3	0.016101	no	SKINNS
chr1_1187088_T_C_b38	RP11-206L10.9	-2.593	0.00983	-0.026329	25	0.010155	no	SKINNS
chr1_1185961_C_T_b38	RP11-206L10.9	-2.592	0.00987	-0.03351	9	0.012931	no	SKINNS
chr1_1186455_C_CTG_b38	RP11-206L10.9	-2.587	0.01	-0.025975	27	0.01004	no	SKINNS
chr1_677378_T_C_b38	RP11-206L10.9	12.478	1.55e-31	0.165087	4	0.013231	yes	SKNS
chr1_677290_A_G_b38	RP11-206L10.9	11.004	1.59e-25	0.156108	4	0.014186	yes	SKNS
chr1_812761_G_A_b38	RP11-206L10.9	9.971	1.38e-21	0.143591	4	0.014401	yes	SKNS
chr1_624836_G_A_b38	RP11-206L10.9	8.138	2.84e-15	0.151853	3	0.018659	yes	SKNS
chr1_668125_A_C_b38	RP11-206L10.9	7.93	1.29e-14	0.18677	3	0.023551	yes	SKNS
chr1_790933_CGAATGGAATG_C_b38	RP11-206L10.9	-6.696	5.44e-11	-0.057892	42	0.008646	yes	SKNS
chr1_624752_C_T_b38	RP11-206L10.9	4.477	9.28e-06	0.048728	6	0.010885	yes	SKNS
chr1_814773_T_C_b38	RP11-206L10.9	4.473	9.44e-06	0.047549	7	0.010631	yes	SKNS
chr1_813885_G_A_b38	RP11-206L10.9	-3.966	8.3e-05	-0.031295	138	0.00789	yes	SKNS
chr1_674562_T_C_b38	RP11-206L10.9	3.962	8.43e-05	0.0382	16	0.009641	yes	SKNS
chr1_788757_T_TAATGG_b38	RP11-206L10.9	-3.413	0.00069	-0.025915	115	0.007592	yes	SKNS
chr1_1452812_G_A_b38	RP11-206L10.9	-3.176	0.00158	-0.075714	5	0.023839	yes	SKNS
chr1_598862_C_T_b38	RP11-206L10.9	3.126	0.00187	0.03324	5	0.010634	yes	SKNS
chr1_1578879_A_T_b38	RP11-206L10.9	3.099	0.00204	0.048707	5	0.015717	yes	SKNS
chr1_1457346_G_A_b38	RP11-206L10.9	-3.064	0.00229	-0.073463	3	0.023975	yes	SKNS
chr1_592666_T_C_b38	RP11-206L10.9	2.931	0.00353	0.070747	4	0.024141	yes	SKNS
chr1_600588_A_G_b38	RP11-206L10.9	2.862	0.00437	0.042703	6	0.01492	yes	SKNS
chr1_185795_G_T_b38	RP11-206L10.9	-2.841	0.00468	-0.036752	13	0.012938	yes	SKNS
chr1_878850_T_A_b38	RP11-206L10.9	2.767	0.00586	0.029644	10	0.010714	yes	SKNS
chr1_600591_A_T_b38	RP11-206L10.9	2.704	0.00707	0.040268	6	0.014892	yes	SKNS
chr1_1430020_G_C_b38	RP11-206L10.9	-2.676	0.00769	-0.041122	3	0.015369	yes	SKNS
chr1_828389_A_AT_b38	RP11-206L10.9	-2.664	0.00796	-0.024622	72	0.009244	yes	SKNS
chr1_1452797_C_CA_b38	RP11-206L10.9	-2.629	0.00881	-0.055869	3	0.021251	yes	SKNS
chr1_809641_G_T_b38	RP11-206L10.9	11.677	3.24e-28	0.149343	8	0.012789	no	SKNS
chr1_788418_CAG_C_b38	RP11-206L10.9	-11.634	4.83e-28	-0.145957	9	0.012545	no	SKNS
chr1_788511_G_C_b38	RP11-206L10.9	-11.551	1.05e-27	-0.145978	11	0.012638	no	SKNS
chr1_788439_T_A_b38	RP11-206L10.9	11.451	2.67e-27	0.144543	8	0.012623	no	SKNS
chr1_800605_G_A_b38	RP11-206L10.9	11.418	3.63e-27	0.145055	8	0.012704	no	SKNS
chr1_778639_A_G_b38	RP11-206L10.9	11.377	5.29e-27	0.145408	7	0.012781	no	SKNS
chr1_777382_T_G_b38	RP11-206L10.9	11.363	6e-27	0.148893	3	0.013103	no	SKNS
chr1_779047_G_A_b38	RP11-206L10.9	-10.817	8.54e-25	-0.139708	12	0.012915	no	SKNS
chr1_777135_T_TC_b38	RP11-206L10.9	9.843	4.04e-21	0.138189	7	0.014039	no	SKNS
chr1_683167_G_A_b38	RP11-206L10.9	9.597	3.14e-20	0.111265	6	0.011593	no	SKNS
chr1_783406_A_AT_b38	RP11-206L10.9	8.931	6.84e-18	0.112008	4	0.012542	no	SKNS
chr1_814619_A_G_b38	RP11-206L10.9	8.364	5.31e-16	0.167533	3	0.02003	no	SKNS
chr1_812899_A_T_b38	RP11-206L10.9	8.316	7.58e-16	0.119108	8	0.014322	no	SKNS
chr1_820560_C_T_b38	RP11-206L10.9	-8.173	2.19e-15	-0.073349	34	0.008974	no	SKNS
chr1_800909_T_A_b38	RP11-206L10.9	8.117	3.31e-15	0.081889	9	0.010088	no	SKNS
chr1_794299_C_G_b38	RP11-206L10.9	-7.738	5.08e-14	-0.073302	42	0.009473	no	SKNS
chr1_825532_C_T_b38	RP11-206L10.9	-7.629	1.1e-13	-0.071517	28	0.009375	no	SKNS
chr1_825767_T_C_b38	RP11-206L10.9	-7.629	1.1e-13	-0.071517	28	0.009375	no	SKNS
chr1_789568_TATGGA_T_b38	RP11-206L10.9	-7.575	1.6e-13	-0.070678	49	0.009331	no	SKNS
chr1_817186_G_A_b38	RP11-206L10.9	-7.53	2.18e-13	-0.070927	30	0.00942	no	SKNS
chr1_826577_A_AT_b38	RP11-206L10.9	-7.504	2.61e-13	-0.070058	28	0.009336	no	SKNS
chr1_817514_T_C_b38	RP11-206L10.9	-7.502	2.65e-13	-0.069769	27	0.0093	no	SKNS
chr1_818094_C_G_b38	RP11-206L10.9	-7.477	3.15e-13	-0.071089	51	0.009508	no	SKNS
chr1_784109_C_CATAAT_b38	RP11-206L10.9	7.436	4.15e-13	0.109982	8	0.01479	no	SKNS
chr1_824320_T_C_b38	RP11-206L10.9	-7.378	6.19e-13	-0.068222	31	0.009247	no	SKNS
chr1_819584_C_T_b38	RP11-206L10.9	-7.23	1.68e-12	-0.069174	37	0.009567	no	SKNS
chr1_817341_A_G_b38	RP11-206L10.9	-7.194	2.15e-12	-0.068877	38	0.009575	no	SKNS
chr1_819123_G_A_b38	RP11-206L10.9	-7.162	2.64e-12	-0.068193	37	0.009521	no	SKNS
chr1_813498_G_T_b38	RP11-206L10.9	-7.1	4.01e-12	-0.064205	43	0.009044	no	SKNS
chr1_807692_C_A_b38	RP11-206L10.9	-6.733	4.3e-11	-0.111588	8	0.016573	no	SKNS
chr1_808924_C_T_b38	RP11-206L10.9	-6.69	5.66e-11	-0.07351	8	0.010989	no	SKNS
chr1_771398_G_A_b38	RP11-206L10.9	-5.931	5.42e-09	-0.053021	79	0.00894	no	SKNS
chr1_826420_A_T_b38	RP11-206L10.9	-5.521	5.25e-08	-0.044404	66	0.008042	no	SKNS
chr1_814476_C_T_b38	RP11-206L10.9	-5.195	2.91e-07	-0.050173	31	0.009657	no	SKNS
chr1_821000_T_A_b38	RP11-206L10.9	-5.118	4.32e-07	-0.048309	28	0.009439	no	SKNS
chr1_822427_CCCTGGCCAGCAGATCCACCCTGTCTATACTACCTG_C_b38	RP11-206L10.9	-4.739	2.76e-06	-0.042479	40	0.008964	no	SKNS
chr1_791564_C_G_b38	RP11-206L10.9	-4.646	4.26e-06	-0.041767	68	0.008989	no	SKNS
chr1_624767_T_G_b38	RP11-206L10.9	4.6	5.29e-06	0.050432	5	0.010964	no	SKNS
chr1_799082_G_A_b38	RP11-206L10.9	-4.439	1.1e-05	-0.049623	12	0.011179	no	SKNS
chr1_98929_A_G_b38	RP11-206L10.9	4.137	4.08e-05	0.052637	6	0.012722	no	SKNS
chr1_823246_C_T_b38	RP11-206L10.9	-3.687	0.00025	-0.037253	28	0.010103	no	SKNS
chr1_799080_TG_T_b38	RP11-206L10.9	3.633	0.000307	0.033053	37	0.009097	no	SKNS
chr1_1104154_A_C_b38	RP11-206L10.9	3.566	0.000396	0.098289	4	0.027566	no	SKNS
chr1_806017_A_G_b38	RP11-206L10.9	3.495	0.000514	0.064553	8	0.018472	no	SKNS
chr1_789680_A_AGGAATGGAAT_b38	RP11-206L10.9	-3.405	0.000711	-0.027193	71	0.007986	no	SKNS
chr1_820395_A_G_b38	RP11-206L10.9	-3.369	0.000809	-0.032959	28	0.009783	no	SKNS
chr1_1606532_G_A_b38	RP11-206L10.9	3.303	0.00102	0.029399	42	0.008901	no	SKNS
chr1_791549_G_GGAATGGAATC_b38	RP11-206L10.9	-3.188	0.00152	-0.027366	42	0.008585	no	SKNS
chr1_624509_A_G_b38	RP11-206L10.9	3.108	0.00198	0.030843	13	0.009923	no	SKNS
chr1_822556_C_A_b38	RP11-206L10.9	-3.095	0.00207	-0.0313	29	0.010112	no	SKNS
chr1_674381_A_AT_b38	RP11-206L10.9	3.078	0.00219	0.029748	26	0.009664	no	SKNS
chr1_1606539_G_GCC_b38	RP11-206L10.9	2.934	0.00349	0.025897	44	0.008826	no	SKNS
chr1_1606536_GCT_G_b38	RP11-206L10.9	2.926	0.00358	0.025751	44	0.0088	no	SKNS
chr1_822764_A_G_b38	RP11-206L10.9	-2.888	0.00404	-0.029549	29	0.010233	no	SKNS
chr1_791544_T_TGAATGGAATGGAATC_b38	RP11-206L10.9	-2.884	0.00408	-0.036678	9	0.012717	no	SKNS
chr1_271102_G_A_b38	RP11-206L10.9	2.848	0.00457	0.031677	5	0.011122	no	SKNS
chr1_814617_A_G_b38	RP11-206L10.9	-2.841	0.00467	-0.023332	66	0.008214	no	SKNS
chr1_19004_A_G_b38	RP11-206L10.9	-2.821	0.00496	-0.030253	61	0.010723	no	SKNS
chr1_1635284_T_C_b38	RP11-206L10.9	2.74	0.00636	0.065332	4	0.023847	no	SKNS
chr1_1606552_A_G_b38	RP11-206L10.9	2.728	0.00658	0.02307	50	0.008457	no	SKNS
chr1_832873_A_C_b38	RP11-206L10.9	-2.699	0.00717	-0.024573	75	0.009104	no	SKNS
chr1_1296207_G_A_b38	RP11-206L10.9	-2.596	0.0097	-0.040943	3	0.015774	no	SKNS
chr1_790933_CGAATGGAATG_C_b38	RP11-206L10.9	-3.619	0.00042	-0.054684	15	0.015112	yes	SNTTRM
chr1_771398_G_A_b38	RP11-206L10.9	-3.592	0.00046	-0.058023	26	0.016151	yes	SNTTRM
chr1_826420_A_T_b38	RP11-206L10.9	-3.557	0.000521	-0.057323	18	0.016117	yes	SNTTRM
chr1_1701564_CG_C_b38	RP11-206L10.9	3.431	0.000801	0.048858	18	0.01424	yes	SNTTRM
chr1_817514_T_C_b38	RP11-206L10.9	-3.284	0.00131	-0.055371	9	0.016862	yes	SNTTRM
chr1_1521298_C_CA_b38	RP11-206L10.9	3.169	0.0019	0.071847	6	0.022669	yes	SNTTRM
chr1_788511_G_C_b38	RP11-206L10.9	-3.056	0.00271	-0.069933	4	0.022885	yes	SNTTRM
chr1_1726126_G_A_b38	RP11-206L10.9	3.035	0.00289	0.042634	41	0.014045	yes	SNTTRM
chr1_1265603_T_TTG_b38	RP11-206L10.9	-2.964	0.0036	-0.054594	4	0.018417	yes	SNTTRM
chr1_779047_G_A_b38	RP11-206L10.9	-2.809	0.00572	-0.062211	6	0.022148	yes	SNTTRM
chr1_984475_G_A_b38	RP11-206L10.9	2.716	0.00748	0.055985	3	0.020612	yes	SNTTRM
chr1_1736836_A_G_b38	RP11-206L10.9	2.664	0.00869	0.040039	34	0.015032	yes	SNTTRM
chr1_825532_C_T_b38	RP11-206L10.9	-3.689	0.000328	-0.066757	8	0.018098	no	SNTTRM
chr1_825767_T_C_b38	RP11-206L10.9	-3.689	0.000328	-0.066757	8	0.018098	no	SNTTRM
chr1_826577_A_AT_b38	RP11-206L10.9	-3.689	0.000328	-0.066757	8	0.018098	no	SNTTRM
chr1_824320_T_C_b38	RP11-206L10.9	-3.57	0.000497	-0.063606	9	0.017816	no	SNTTRM
chr1_817186_G_A_b38	RP11-206L10.9	-3.567	0.000502	-0.063629	9	0.017837	no	SNTTRM
chr1_819123_G_A_b38	RP11-206L10.9	-3.511	0.00061	-0.063233	13	0.018011	no	SNTTRM
chr1_819584_C_T_b38	RP11-206L10.9	-3.511	0.00061	-0.063233	13	0.018011	no	SNTTRM
chr1_817341_A_G_b38	RP11-206L10.9	-3.427	0.000812	-0.061312	14	0.01789	no	SNTTRM
chr1_818094_C_G_b38	RP11-206L10.9	-3.396	0.000903	-0.061868	18	0.01822	no	SNTTRM
chr1_820560_C_T_b38	RP11-206L10.9	-3.322	0.00115	-0.058444	9	0.017591	no	SNTTRM
chr1_1220377_C_T_b38	RP11-206L10.9	-3.209	0.00167	-0.078893	8	0.024587	no	SNTTRM
chr1_809641_G_T_b38	RP11-206L10.9	3.208	0.00167	0.078538	3	0.02448	no	SNTTRM
chr1_794299_C_G_b38	RP11-206L10.9	-3.041	0.00284	-0.054062	11	0.017775	no	SNTTRM
chr1_1138569_C_CA_b38	RP11-206L10.9	2.861	0.00491	0.050657	9	0.017706	no	SNTTRM
chr1_860178_C_CTTTTTTT_b38	RP11-206L10.9	-2.852	0.00503	-0.080745	3	0.028309	no	SNTTRM
chr1_812899_A_T_b38	RP11-206L10.9	2.838	0.00525	0.07157	3	0.025216	no	SNTTRM
chr1_790933_CGAATG_C_b38	RP11-206L10.9	2.653	0.00895	0.051603	3	0.01945	no	SNTTRM
chr1_1742432_T_TA_b38	RP11-206L10.9	2.65	0.00903	0.039791	24	0.015017	no	SNTTRM
chr1_820560_C_T_b38	RP11-206L10.9	-6.336	1.73e-09	-0.07985	19	0.012603	yes	SPLEEN
chr1_826577_A_AT_b38	RP11-206L10.9	-6.088	6.39e-09	-0.081278	14	0.01335	yes	SPLEEN
chr1_825532_C_T_b38	RP11-206L10.9	-5.929	1.46e-08	-0.081638	13	0.01377	yes	SPLEEN
chr1_825767_T_C_b38	RP11-206L10.9	-5.929	1.46e-08	-0.081638	13	0.01377	yes	SPLEEN
chr1_817514_T_C_b38	RP11-206L10.9	-5.831	2.4e-08	-0.076519	13	0.013124	yes	SPLEEN
chr1_824320_T_C_b38	RP11-206L10.9	-5.821	2.52e-08	-0.079073	14	0.013584	yes	SPLEEN
chr1_817186_G_A_b38	RP11-206L10.9	-5.796	2.86e-08	-0.08062	14	0.01391	yes	SPLEEN
chr1_819584_C_T_b38	RP11-206L10.9	-5.471	1.43e-07	-0.075421	19	0.013786	yes	SPLEEN
chr1_819123_G_A_b38	RP11-206L10.9	-5.396	2.06e-07	-0.073592	19	0.013639	yes	SPLEEN
chr1_818094_C_G_b38	RP11-206L10.9	-5.322	2.93e-07	-0.075183	23	0.014127	yes	SPLEEN
chr1_817341_A_G_b38	RP11-206L10.9	-5.302	3.22e-07	-0.073366	20	0.013837	yes	SPLEEN
chr1_826420_A_T_b38	RP11-206L10.9	-4.835	2.78e-06	-0.058053	25	0.012006	yes	SPLEEN
chr1_598862_C_T_b38	RP11-206L10.9	4.195	4.22e-05	0.06375	5	0.015196	yes	SPLEEN
chr1_784109_C_CATAAT_b38	RP11-206L10.9	4.131	5.46e-05	0.083377	5	0.020185	yes	SPLEEN
chr1_790933_CGAATGGAATG_C_b38	RP11-206L10.9	-4.066	7.06e-05	-0.053492	22	0.013157	yes	SPLEEN
chr1_820395_A_G_b38	RP11-206L10.9	-3.49	0.000603	-0.050928	13	0.014591	yes	SPLEEN
chr1_822427_CCCTGGCCAGCAGATCCACCCTGTCTATACTACCTG_C_b38	RP11-206L10.9	-3.426	0.000755	-0.046264	17	0.013506	yes	SPLEEN
chr1_807692_C_A_b38	RP11-206L10.9	-3.424	0.000758	-0.069615	6	0.02033	yes	SPLEEN
chr1_821000_T_A_b38	RP11-206L10.9	-3.377	0.000893	-0.048526	13	0.01437	yes	SPLEEN
chr1_823246_C_T_b38	RP11-206L10.9	-3.195	0.00164	-0.048227	13	0.015092	yes	SPLEEN
chr1_771398_G_A_b38	RP11-206L10.9	-3.173	0.00177	-0.0427	40	0.013458	yes	SPLEEN
chr1_624767_T_G_b38	RP11-206L10.9	3.07	0.00246	0.048049	3	0.015653	yes	SPLEEN
chr1_814617_A_G_b38	RP11-206L10.9	-2.946	0.00363	-0.036502	19	0.012392	yes	SPLEEN
chr1_791564_C_G_b38	RP11-206L10.9	-2.921	0.00392	-0.03925	30	0.013436	yes	SPLEEN
chr1_674562_T_C_b38	RP11-206L10.9	2.704	0.00749	0.041096	5	0.015198	yes	SPLEEN
chr1_677378_T_C_b38	RP11-206L10.9	10.225	9.32e-20	0.170286	3	0.016654	no	SPLEEN
chr1_677290_A_G_b38	RP11-206L10.9	9.011	2.45e-16	0.164116	3	0.018213	no	SPLEEN
chr1_800605_G_A_b38	RP11-206L10.9	7.889	2.52e-13	0.131413	5	0.016657	no	SPLEEN
chr1_788418_CAG_C_b38	RP11-206L10.9	-7.668	9.45e-13	-0.127417	6	0.016617	no	SPLEEN
chr1_788439_T_A_b38	RP11-206L10.9	7.57	1.68e-12	0.126514	5	0.016712	no	SPLEEN
chr1_778639_A_G_b38	RP11-206L10.9	7.521	2.24e-12	0.126552	5	0.016826	no	SPLEEN
chr1_788511_G_C_b38	RP11-206L10.9	-6.907	7.61e-11	-0.114294	8	0.016548	no	SPLEEN
chr1_779047_G_A_b38	RP11-206L10.9	-6.687	2.59e-10	-0.109674	9	0.016402	no	SPLEEN
chr1_809641_G_T_b38	RP11-206L10.9	6.497	7.29e-10	0.106948	7	0.016461	no	SPLEEN
chr1_777135_T_TC_b38	RP11-206L10.9	6.431	1.04e-09	0.118333	4	0.018401	no	SPLEEN
chr1_783406_A_AT_b38	RP11-206L10.9	6.085	6.51e-09	0.107449	3	0.017658	no	SPLEEN
chr1_668125_A_C_b38	RP11-206L10.9	5.784	3.03e-08	0.147067	3	0.025425	no	SPLEEN
chr1_794299_C_G_b38	RP11-206L10.9	-5.4	2.02e-07	-0.074521	22	0.0138	no	SPLEEN
chr1_812899_A_T_b38	RP11-206L10.9	5.372	2.31e-07	0.097979	7	0.018238	no	SPLEEN
chr1_812761_G_A_b38	RP11-206L10.9	5.285	3.49e-07	0.104614	3	0.019794	no	SPLEEN
chr1_813498_G_T_b38	RP11-206L10.9	-5.152	6.53e-07	-0.069489	16	0.013487	no	SPLEEN
chr1_799082_G_A_b38	RP11-206L10.9	-5.131	7.2e-07	-0.083006	5	0.016176	no	SPLEEN
chr1_789568_TATGGA_T_b38	RP11-206L10.9	-5.074	9.39e-07	-0.068134	22	0.013428	no	SPLEEN
chr1_799080_TG_T_b38	RP11-206L10.9	4.351	2.23e-05	0.063913	9	0.014689	no	SPLEEN
chr1_814476_C_T_b38	RP11-206L10.9	-4.247	3.42e-05	-0.061677	16	0.014522	no	SPLEEN
chr1_788757_T_TAATGG_b38	RP11-206L10.9	-3.277	0.00125	-0.034681	57	0.010585	no	SPLEEN
chr1_98929_A_G_b38	RP11-206L10.9	3.151	0.0019	0.05301	5	0.016823	no	SPLEEN
chr1_677290_A_G_b38	RP11-206L10.9	7.699	2.65e-13	0.118557	4	0.015399	yes	STMACH
chr1_777382_T_G_b38	RP11-206L10.9	7.65	3.62e-13	0.118179	3	0.015448	yes	STMACH
chr1_677378_T_C_b38	RP11-206L10.9	7.341	2.54e-12	0.11193	4	0.015248	yes	STMACH
chr1_788439_T_A_b38	RP11-206L10.9	7.041	1.6e-11	0.105152	6	0.014933	yes	STMACH
chr1_683167_G_A_b38	RP11-206L10.9	6.615	2.01e-10	0.092568	3	0.013993	yes	STMACH
chr1_788418_CAG_C_b38	RP11-206L10.9	-6.59	2.32e-10	-0.098544	8	0.014953	yes	STMACH
chr1_784109_C_CATAAT_b38	RP11-206L10.9	5.625	4.66e-08	0.091616	6	0.016287	yes	STMACH
chr1_791564_C_G_b38	RP11-206L10.9	-4.145	4.57e-05	-0.043826	35	0.010574	yes	STMACH
chr1_820560_C_T_b38	RP11-206L10.9	-3.869	0.000137	-0.043603	20	0.011269	yes	STMACH
chr1_818094_C_G_b38	RP11-206L10.9	-3.752	0.000215	-0.04509	29	0.012017	yes	STMACH
chr1_921056_TG_T_b38	RP11-206L10.9	3.655	0.00031	0.041877	9	0.011459	yes	STMACH
chr1_817341_A_G_b38	RP11-206L10.9	-3.489	0.000568	-0.042173	24	0.012089	yes	STMACH
chr1_817186_G_A_b38	RP11-206L10.9	-3.443	0.000667	-0.041972	17	0.01219	yes	STMACH
chr1_817514_T_C_b38	RP11-206L10.9	-3.407	0.000756	-0.040649	13	0.01193	yes	STMACH
chr1_819123_G_A_b38	RP11-206L10.9	-3.402	0.000772	-0.040934	22	0.012034	yes	STMACH
chr1_819584_C_T_b38	RP11-206L10.9	-3.402	0.000772	-0.040934	22	0.012034	yes	STMACH
chr1_826577_A_AT_b38	RP11-206L10.9	-3.397	0.000785	-0.040632	17	0.011962	yes	STMACH
chr1_825532_C_T_b38	RP11-206L10.9	-3.388	0.00081	-0.041473	15	0.012241	yes	STMACH
chr1_825767_T_C_b38	RP11-206L10.9	-3.388	0.00081	-0.041473	15	0.012241	yes	STMACH
chr1_824320_T_C_b38	RP11-206L10.9	-3.364	0.000881	-0.0401	17	0.011922	yes	STMACH
chr1_632928_G_A_b38	RP11-206L10.9	-3.207	0.00151	-0.049417	6	0.015411	yes	STMACH
chr1_1459658_G_A_b38	RP11-206L10.9	3.2	0.00154	0.053726	23	0.016788	yes	STMACH
chr1_813498_G_T_b38	RP11-206L10.9	-3.182	0.00163	-0.036359	20	0.011426	yes	STMACH
chr1_900119_A_G_b38	RP11-206L10.9	3.086	0.00224	0.031571	26	0.010229	yes	STMACH
chr1_917378_G_C_b38	RP11-206L10.9	3.052	0.0025	0.0351	10	0.0115	yes	STMACH
chr1_1300330_T_A_b38	RP11-206L10.9	3.021	0.00276	0.045582	23	0.015087	yes	STMACH
chr1_1301656_T_C_b38	RP11-206L10.9	3.021	0.00276	0.045582	23	0.015087	yes	STMACH
chr1_1480990_T_C_b38	RP11-206L10.9	3.002	0.00294	0.04431	23	0.014762	yes	STMACH
chr1_1431026_CCACCCCCT_C_b38	RP11-206L10.9	3	0.00295	0.036939	16	0.012312	yes	STMACH
chr1_897843_C_T_b38	RP11-206L10.9	2.987	0.00308	0.029841	30	0.009991	yes	STMACH
chr1_897922_C_T_b38	RP11-206L10.9	2.987	0.00308	0.029841	30	0.009991	yes	STMACH
chr1_898444_T_C_b38	RP11-206L10.9	2.987	0.00308	0.029841	30	0.009991	yes	STMACH
chr1_1290968_C_G_b38	RP11-206L10.9	2.986	0.00309	0.038648	25	0.012944	yes	STMACH
chr1_913274_TG_T_b38	RP11-206L10.9	2.959	0.00336	0.033786	11	0.011417	yes	STMACH
chr1_898261_T_C_b38	RP11-206L10.9	2.945	0.00351	0.02934	31	0.009963	yes	STMACH
chr1_898279_T_A_b38	RP11-206L10.9	2.945	0.00351	0.02934	31	0.009963	yes	STMACH
chr1_898283_A_G_b38	RP11-206L10.9	2.945	0.00351	0.02934	31	0.009963	yes	STMACH
chr1_899452_G_C_b38	RP11-206L10.9	2.927	0.00372	0.029483	29	0.010074	yes	STMACH
chr1_1486611_G_A_b38	RP11-206L10.9	2.924	0.00375	0.04441	12	0.01519	yes	STMACH
chr1_794299_C_G_b38	RP11-206L10.9	-2.923	0.00377	-0.035241	24	0.012058	yes	STMACH
chr1_918870_A_G_b38	RP11-206L10.9	2.901	0.00403	0.031613	13	0.010899	yes	STMACH
chr1_814476_C_T_b38	RP11-206L10.9	-2.89	0.00417	-0.034179	16	0.011828	yes	STMACH
chr1_789568_TATGGA_T_b38	RP11-206L10.9	-2.884	0.00424	-0.033765	26	0.011707	yes	STMACH
chr1_592666_T_C_b38	RP11-206L10.9	2.882	0.00427	0.073864	3	0.025631	yes	STMACH
chr1_913065_G_A_b38	RP11-206L10.9	2.859	0.00459	0.031121	13	0.010887	yes	STMACH
chr1_913076_A_G_b38	RP11-206L10.9	2.854	0.00466	0.031046	13	0.010879	yes	STMACH
chr1_917859_A_G_b38	RP11-206L10.9	2.82	0.00516	0.032072	11	0.011373	yes	STMACH
chr1_1496973_G_A_b38	RP11-206L10.9	2.801	0.00546	0.042156	10	0.015048	yes	STMACH
chr1_1459632_T_C_b38	RP11-206L10.9	2.793	0.0056	0.046094	18	0.016503	yes	STMACH
chr1_917495_C_T_b38	RP11-206L10.9	-2.779	0.00583	-0.025485	63	0.009169	yes	STMACH
chr1_924305_G_A_b38	RP11-206L10.9	2.773	0.00594	0.028922	21	0.01043	yes	STMACH
chr1_915810_G_A_b38	RP11-206L10.9	2.772	0.00596	0.02985	14	0.010769	yes	STMACH
chr1_915824_G_C_b38	RP11-206L10.9	2.759	0.0062	0.028642	19	0.010382	yes	STMACH
chr1_912111_G_A_b38	RP11-206L10.9	2.754	0.0063	0.02977	14	0.010812	yes	STMACH
chr1_914682_A_T_b38	RP11-206L10.9	2.754	0.0063	0.02977	14	0.010812	yes	STMACH
chr1_1726106_AT_A_b38	RP11-206L10.9	-2.747	0.00643	-0.034341	16	0.012503	yes	STMACH
chr1_1479205_A_C_b38	RP11-206L10.9	2.734	0.00668	0.03725	15	0.013627	yes	STMACH
chr1_914743_C_T_b38	RP11-206L10.9	2.731	0.00674	0.030746	12	0.011259	yes	STMACH
chr1_1479334_A_G_b38	RP11-206L10.9	2.72	0.00696	0.046263	23	0.017011	yes	STMACH
chr1_1307603_G_A_b38	RP11-206L10.9	-2.718	0.007	-0.040908	24	0.015051	yes	STMACH
chr1_1460021_C_CTG_b38	RP11-206L10.9	2.717	0.00702	0.039552	15	0.014558	yes	STMACH
chr1_1460022_CAG_C_b38	RP11-206L10.9	2.717	0.00702	0.039552	15	0.014558	yes	STMACH
chr1_586069_T_A_b38	RP11-206L10.9	2.714	0.00708	0.04678	5	0.017238	yes	STMACH
chr1_918574_C_A_b38	RP11-206L10.9	-2.71	0.00715	-0.024994	62	0.009222	yes	STMACH
chr1_917284_C_T_b38	RP11-206L10.9	2.71	0.00717	0.030445	12	0.011236	yes	STMACH
chr1_912710_G_A_b38	RP11-206L10.9	2.7	0.00738	0.030366	12	0.011248	yes	STMACH
chr1_913358_C_T_b38	RP11-206L10.9	2.7	0.00738	0.030366	12	0.011248	yes	STMACH
chr1_909894_G_T_b38	RP11-206L10.9	2.694	0.0075	0.028636	21	0.010628	yes	STMACH
chr1_896109_C_T_b38	RP11-206L10.9	-2.689	0.00762	-0.027162	38	0.010102	yes	STMACH
chr1_910255_C_T_b38	RP11-206L10.9	2.679	0.00784	0.030436	11	0.011361	yes	STMACH
chr1_1459662_C_T_b38	RP11-206L10.9	2.668	0.00811	0.044691	19	0.016753	yes	STMACH
chr1_791544_T_TGAATGGAATGGAATCGAATG_b38	RP11-206L10.9	-2.663	0.00822	-0.051378	3	0.019297	yes	STMACH
chr1_1459004_T_C_b38	RP11-206L10.9	2.646	0.00863	0.044021	17	0.016639	yes	STMACH
chr1_921096_A_G_b38	RP11-206L10.9	2.645	0.00865	0.024148	57	0.009129	yes	STMACH
chr1_1468048_A_G_b38	RP11-206L10.9	2.614	0.00945	0.039617	18	0.015154	yes	STMACH
chr1_1288341_C_T_b38	RP11-206L10.9	-2.613	0.00949	-0.051109	5	0.019561	yes	STMACH
chr1_927486_C_T_b38	RP11-206L10.9	-2.601	0.00982	-0.02781	32	0.010693	yes	STMACH
chr1_181910_T_A_b38	RP11-206L10.9	2.6	0.00983	0.072738	4	0.027972	yes	STMACH
chr1_1319063_G_A_b38	RP11-206L10.9	-2.597	0.00991	-0.041301	18	0.015901	yes	STMACH
chr1_1319461_C_G_b38	RP11-206L10.9	-2.597	0.00991	-0.041301	18	0.015901	yes	STMACH
chr1_1320023_TG_T_b38	RP11-206L10.9	-2.597	0.00991	-0.041301	18	0.015901	yes	STMACH
chr1_777135_T_TC_b38	RP11-206L10.9	7.124	9.71e-12	0.112491	5	0.015791	no	STMACH
chr1_778639_A_G_b38	RP11-206L10.9	7.099	1.13e-11	0.106171	7	0.014957	no	STMACH
chr1_800605_G_A_b38	RP11-206L10.9	6.995	2.12e-11	0.105767	6	0.01512	no	STMACH
chr1_779047_G_A_b38	RP11-206L10.9	-6.361	8.62e-10	-0.093886	13	0.01476	no	STMACH
chr1_788511_G_C_b38	RP11-206L10.9	-6.26	1.52e-09	-0.092069	11	0.014708	no	STMACH
chr1_809641_G_T_b38	RP11-206L10.9	6.242	1.68e-09	0.092133	9	0.01476	no	STMACH
chr1_812761_G_A_b38	RP11-206L10.9	5.803	1.83e-08	0.089492	8	0.015422	no	STMACH
chr1_812899_A_T_b38	RP11-206L10.9	5.677	3.55e-08	0.08807	11	0.015513	no	STMACH
chr1_668125_A_C_b38	RP11-206L10.9	5.059	7.84e-07	0.109883	3	0.021721	no	STMACH
chr1_783406_A_AT_b38	RP11-206L10.9	4.64	5.46e-06	0.069075	4	0.014888	no	STMACH
chr1_807692_C_A_b38	RP11-206L10.9	-4.284	2.56e-05	-0.07184	9	0.016769	no	STMACH
chr1_58814_G_A_b38	RP11-206L10.9	3.702	0.00026	0.054566	5	0.01474	no	STMACH
chr1_60351_A_G_b38	RP11-206L10.9	3.608	0.000368	0.062318	3	0.017271	no	STMACH
chr1_64931_G_A_b38	RP11-206L10.9	3.562	0.000436	0.061701	3	0.017324	no	STMACH
chr1_589350_C_T_b38	RP11-206L10.9	-3.559	0.00044	-0.087454	3	0.02457	no	STMACH
chr1_624752_C_T_b38	RP11-206L10.9	3.531	0.000487	0.046326	3	0.01312	no	STMACH
chr1_201062_T_G_b38	RP11-206L10.9	3.488	0.000568	0.056238	7	0.016121	no	STMACH
chr1_624767_T_G_b38	RP11-206L10.9	3.486	0.000573	0.045463	3	0.013042	no	STMACH
chr1_56381_T_C_b38	RP11-206L10.9	3.42	0.000725	0.059205	3	0.017314	no	STMACH
chr1_800909_T_A_b38	RP11-206L10.9	3.345	0.000941	0.041294	5	0.012345	no	STMACH
chr1_808924_C_T_b38	RP11-206L10.9	-3.25	0.0013	-0.038479	9	0.01184	no	STMACH
chr1_799080_TG_T_b38	RP11-206L10.9	3.191	0.00159	0.035082	19	0.010995	no	STMACH
chr1_1548554_C_CA_b38	RP11-206L10.9	3.135	0.00191	0.086647	3	0.027635	no	STMACH
chr1_799082_G_A_b38	RP11-206L10.9	-3.12	0.00201	-0.041807	5	0.013401	no	STMACH
chr1_1664417_G_A_b38	RP11-206L10.9	3.071	0.00235	0.033165	21	0.010798	no	STMACH
chr1_666045_G_T_b38	RP11-206L10.9	-3.05	0.00252	-0.068851	4	0.022575	no	STMACH
chr1_55131_A_G_b38	RP11-206L10.9	2.975	0.0032	0.055386	3	0.018619	no	STMACH
chr1_13838_C_T_b38	RP11-206L10.9	2.887	0.0042	0.038759	7	0.013425	no	STMACH
chr1_1281640_G_C_b38	RP11-206L10.9	2.801	0.00547	0.041751	5	0.014906	no	STMACH
chr1_1281878_G_C_b38	RP11-206L10.9	2.801	0.00547	0.041751	5	0.014906	no	STMACH
chr1_13813_T_G_b38	RP11-206L10.9	2.762	0.00614	0.0359	8	0.012997	no	STMACH
chr1_1573265_C_CAAAA_b38	RP11-206L10.9	2.725	0.00686	0.035485	9	0.013024	no	STMACH
chr1_677378_T_C_b38	RP11-206L10.9	13.715	9.1e-33	0.246731	3	0.01799	yes	TESTIS
chr1_677290_A_G_b38	RP11-206L10.9	12.899	6.44e-30	0.24504	3	0.018996	yes	TESTIS
chr1_680742_A_T_b38	RP11-206L10.9	12.604	6.78e-29	0.246587	3	0.019564	yes	TESTIS
chr1_683167_G_A_b38	RP11-206L10.9	10.55	5.6e-22	0.173472	4	0.016443	yes	TESTIS
chr1_681103_T_A_b38	RP11-206L10.9	10.088	1.75e-20	0.217946	4	0.021605	yes	TESTIS
chr1_790933_CGAATGGAATG_C_b38	RP11-206L10.9	-6.064	4.51e-09	-0.078803	24	0.012995	yes	TESTIS
chr1_814476_C_T_b38	RP11-206L10.9	-5.687	3.38e-08	-0.088813	13	0.015616	yes	TESTIS
chr1_820560_C_T_b38	RP11-206L10.9	-4.972	1.19e-06	-0.079903	11	0.01607	yes	TESTIS
chr1_674562_T_C_b38	RP11-206L10.9	4.797	2.68e-06	0.075898	7	0.015822	yes	TESTIS
chr1_821000_T_A_b38	RP11-206L10.9	-4.742	3.44e-06	-0.074126	9	0.015631	yes	TESTIS
chr1_771398_G_A_b38	RP11-206L10.9	-4.335	2.07e-05	-0.059122	38	0.013638	yes	TESTIS
chr1_1015925_A_ATT_b38	RP11-206L10.9	-4.285	2.55e-05	-0.054121	41	0.012629	yes	TESTIS
chr1_1127664_A_G_b38	RP11-206L10.9	-3.997	8.29e-05	-0.067814	6	0.016965	yes	TESTIS
chr1_1017114_A_AT_b38	RP11-206L10.9	-3.744	0.000221	-0.048883	39	0.013055	yes	TESTIS
chr1_1113609_A_G_b38	RP11-206L10.9	3.566	0.000429	0.063715	4	0.017868	yes	TESTIS
chr1_1016623_G_A_b38	RP11-206L10.9	-3.451	0.00065	-0.04294	46	0.012444	yes	TESTIS
chr1_1005429_C_CA_b38	RP11-206L10.9	-3.359	0.000896	-0.041629	48	0.012393	yes	TESTIS
chr1_1005904_C_T_b38	RP11-206L10.9	-3.359	0.000896	-0.041629	48	0.012393	yes	TESTIS
chr1_624767_T_G_b38	RP11-206L10.9	3.31	0.00106	0.056032	4	0.01693	yes	TESTIS
chr1_592666_T_C_b38	RP11-206L10.9	3.287	0.00115	0.1269	3	0.038607	yes	TESTIS
chr1_1122649_A_G_b38	RP11-206L10.9	3.248	0.00131	0.060742	3	0.018701	yes	TESTIS
chr1_1124132_T_TACACACCTGAGCACACACACCTGTGC_b38	RP11-206L10.9	3.24	0.00135	0.062605	3	0.019324	yes	TESTIS
chr1_1130879_G_C_b38	RP11-206L10.9	-3.223	0.00143	-0.052645	7	0.016333	yes	TESTIS
chr1_1124094_AAC_A_b38	RP11-206L10.9	3.203	0.00152	0.062334	3	0.019459	yes	TESTIS
chr1_1074061_G_A_b38	RP11-206L10.9	-3.201	0.00154	-0.056637	6	0.017696	yes	TESTIS
chr1_1018652_C_G_b38	RP11-206L10.9	-3.195	0.00156	-0.041829	33	0.013091	yes	TESTIS
chr1_1018754_G_A_b38	RP11-206L10.9	-3.195	0.00156	-0.041829	33	0.013091	yes	TESTIS
chr1_1021740_G_C_b38	RP11-206L10.9	-3.184	0.00163	-0.041591	33	0.013063	yes	TESTIS
chr1_624509_A_G_b38	RP11-206L10.9	3.174	0.00168	0.050387	8	0.015875	yes	TESTIS
chr1_624752_C_T_b38	RP11-206L10.9	3.156	0.00178	0.052622	5	0.016673	yes	TESTIS
chr1_1125735_T_C_b38	RP11-206L10.9	3.149	0.00183	0.058941	3	0.01872	yes	TESTIS
chr1_791564_C_G_b38	RP11-206L10.9	-3.127	0.00196	-0.046036	30	0.014722	yes	TESTIS
chr1_1067054_C_T_b38	RP11-206L10.9	3.115	0.00204	0.039103	60	0.012552	yes	TESTIS
chr1_1074910_TCACA_T_b38	RP11-206L10.9	-3.101	0.00214	-0.054729	6	0.017651	yes	TESTIS
chr1_1134273_C_T_b38	RP11-206L10.9	-3.094	0.00218	-0.041952	20	0.013557	yes	TESTIS
chr1_1113913_C_CT_b38	RP11-206L10.9	3.081	0.00228	0.056543	13	0.01835	yes	TESTIS
chr1_995982_G_A_b38	RP11-206L10.9	-3.066	0.00239	-0.038723	48	0.012631	yes	TESTIS
chr1_674381_A_AT_b38	RP11-206L10.9	3.038	0.00262	0.046331	14	0.015252	yes	TESTIS
chr1_1004625_A_G_b38	RP11-206L10.9	-3.008	0.00288	-0.037642	52	0.012514	yes	TESTIS
chr1_1133966_C_T_b38	RP11-206L10.9	-3.003	0.00293	-0.046294	10	0.015415	yes	TESTIS
chr1_1123255_G_A_b38	RP11-206L10.9	3.001	0.00295	0.056935	3	0.018974	yes	TESTIS
chr1_1130717_G_A_b38	RP11-206L10.9	-2.998	0.00297	-0.047027	11	0.015684	yes	TESTIS
chr1_1132482_T_C_b38	RP11-206L10.9	-2.929	0.00369	-0.042757	13	0.014598	yes	TESTIS
chr1_1071610_G_A_b38	RP11-206L10.9	2.925	0.00374	0.037353	28	0.012771	yes	TESTIS
chr1_1036800_G_A_b38	RP11-206L10.9	2.916	0.00385	0.036141	66	0.012395	yes	TESTIS
chr1_1055137_C_T_b38	RP11-206L10.9	2.915	0.00386	0.050603	5	0.01736	yes	TESTIS
chr1_1133503_G_A_b38	RP11-206L10.9	-2.91	0.00392	-0.044686	11	0.015358	yes	TESTIS
chr1_1132196_G_A_b38	RP11-206L10.9	-2.892	0.00414	-0.043659	12	0.015097	yes	TESTIS
chr1_1150799_T_C_b38	RP11-206L10.9	-2.884	0.00424	-0.03838	23	0.013306	yes	TESTIS
chr1_1034835_G_C_b38	RP11-206L10.9	2.867	0.00448	0.035908	71	0.012525	yes	TESTIS
chr1_1027511_C_T_b38	RP11-206L10.9	2.863	0.00452	0.035998	68	0.012572	yes	TESTIS
chr1_1592964_C_T_b38	RP11-206L10.9	-2.857	0.00461	-0.062622	3	0.021919	yes	TESTIS
chr1_605672_T_C_b38	RP11-206L10.9	2.843	0.00481	0.045362	8	0.015955	yes	TESTIS
chr1_1056425_GCGGGTA_G_b38	RP11-206L10.9	2.817	0.00521	0.04723	5	0.016766	yes	TESTIS
chr1_1156987_C_T_b38	RP11-206L10.9	-2.812	0.00529	-0.036335	26	0.012921	yes	TESTIS
chr1_1055604_G_A_b38	RP11-206L10.9	2.786	0.00571	0.048536	5	0.017419	yes	TESTIS
chr1_1056278_AC_A_b38	RP11-206L10.9	2.786	0.00571	0.048536	5	0.017419	yes	TESTIS
chr1_1056947_C_T_b38	RP11-206L10.9	2.786	0.00571	0.048536	5	0.017419	yes	TESTIS
chr1_1056662_C_T_b38	RP11-206L10.9	2.773	0.00594	0.040162	18	0.014483	yes	TESTIS
chr1_1129599_C_T_b38	RP11-206L10.9	2.734	0.00667	0.045576	6	0.016668	yes	TESTIS
chr1_1020697_C_T_b38	RP11-206L10.9	-2.73	0.00674	-0.036214	30	0.013263	yes	TESTIS
chr1_1161911_C_A_b38	RP11-206L10.9	-2.724	0.00688	-0.035632	25	0.013082	yes	TESTIS
chr1_1514211_A_G_b38	RP11-206L10.9	2.711	0.00715	0.075573	7	0.027879	yes	TESTIS
chr1_897843_C_T_b38	RP11-206L10.9	2.68	0.00782	0.037469	26	0.013981	yes	TESTIS
chr1_897922_C_T_b38	RP11-206L10.9	2.68	0.00782	0.037469	26	0.013981	yes	TESTIS
chr1_898444_T_C_b38	RP11-206L10.9	2.68	0.00782	0.037469	26	0.013981	yes	TESTIS
chr1_1085026_T_C_b38	RP11-206L10.9	2.623	0.00921	0.032526	37	0.012399	yes	TESTIS
chr1_800605_G_A_b38	RP11-206L10.9	12.753	2.08e-29	0.218852	4	0.017161	no	TESTIS
chr1_778639_A_G_b38	RP11-206L10.9	12.413	3.09e-28	0.213317	4	0.017185	no	TESTIS
chr1_788439_T_A_b38	RP11-206L10.9	12.413	3.09e-28	0.213317	4	0.017185	no	TESTIS
chr1_809641_G_T_b38	RP11-206L10.9	12.356	4.85e-28	0.206999	6	0.016753	no	TESTIS
chr1_788418_CAG_C_b38	RP11-206L10.9	-11.946	1.23e-26	-0.207017	5	0.01733	no	TESTIS
chr1_779047_G_A_b38	RP11-206L10.9	-11.615	1.63e-25	-0.196282	8	0.016899	no	TESTIS
chr1_788511_G_C_b38	RP11-206L10.9	-11.615	1.63e-25	-0.196282	8	0.016899	no	TESTIS
chr1_783406_A_AT_b38	RP11-206L10.9	11.456	5.58e-25	0.195779	3	0.01709	no	TESTIS
chr1_812899_A_T_b38	RP11-206L10.9	11.143	6.23e-24	0.201185	5	0.018055	no	TESTIS
chr1_784109_C_CATAAT_b38	RP11-206L10.9	10.51	7.57e-22	0.207425	4	0.019737	no	TESTIS
chr1_777135_T_TC_b38	RP11-206L10.9	10.038	2.51e-20	0.194237	4	0.01935	no	TESTIS
chr1_812761_G_A_b38	RP11-206L10.9	8.481	1.55e-15	0.175641	4	0.020711	no	TESTIS
chr1_624836_G_A_b38	RP11-206L10.9	6.118	3.35e-09	0.183106	3	0.029927	no	TESTIS
chr1_799082_G_A_b38	RP11-206L10.9	-6.027	5.53e-09	-0.104034	4	0.017262	no	TESTIS
chr1_808924_C_T_b38	RP11-206L10.9	-5.912	1.03e-08	-0.093435	6	0.015805	no	TESTIS
chr1_807692_C_A_b38	RP11-206L10.9	-5.574	6.09e-08	-0.138692	5	0.024882	no	TESTIS
chr1_794299_C_G_b38	RP11-206L10.9	-5.331	2.08e-07	-0.084592	15	0.015868	no	TESTIS
chr1_817186_G_A_b38	RP11-206L10.9	-5.287	2.59e-07	-0.089717	9	0.016971	no	TESTIS
chr1_818094_C_G_b38	RP11-206L10.9	-5.259	2.97e-07	-0.085188	21	0.016197	no	TESTIS
chr1_825532_C_T_b38	RP11-206L10.9	-5.249	3.12e-07	-0.089828	7	0.017113	no	TESTIS
chr1_825767_T_C_b38	RP11-206L10.9	-5.249	3.12e-07	-0.089828	7	0.017113	no	TESTIS
chr1_824320_T_C_b38	RP11-206L10.9	-5.196	4.06e-07	-0.088104	8	0.016958	no	TESTIS
chr1_789568_TATGGA_T_b38	RP11-206L10.9	-5.193	4.11e-07	-0.080791	16	0.015558	no	TESTIS
chr1_817341_A_G_b38	RP11-206L10.9	-5.03	8.99e-07	-0.082852	15	0.01647	no	TESTIS
chr1_826577_A_AT_b38	RP11-206L10.9	-4.978	1.15e-06	-0.083398	8	0.016752	no	TESTIS
chr1_819123_G_A_b38	RP11-206L10.9	-4.936	1.4e-06	-0.081186	13	0.016447	no	TESTIS
chr1_819584_C_T_b38	RP11-206L10.9	-4.936	1.4e-06	-0.081186	13	0.016447	no	TESTIS
chr1_598862_C_T_b38	RP11-206L10.9	4.839	2.21e-06	0.079421	3	0.016412	no	TESTIS
chr1_813498_G_T_b38	RP11-206L10.9	-4.756	3.23e-06	-0.072202	13	0.015181	no	TESTIS
chr1_806017_A_G_b38	RP11-206L10.9	4.644	5.36e-06	0.126108	5	0.027153	no	TESTIS
chr1_817514_T_C_b38	RP11-206L10.9	-4.611	6.23e-06	-0.076126	8	0.016511	no	TESTIS
chr1_1013466_T_TA_b38	RP11-206L10.9	-4.317	2.23e-05	-0.12649	5	0.029299	no	TESTIS
chr1_98929_A_G_b38	RP11-206L10.9	4.315	2.25e-05	0.082008	4	0.019008	no	TESTIS
chr1_799080_TG_T_b38	RP11-206L10.9	4.311	2.29e-05	0.063058	14	0.014628	no	TESTIS
chr1_1117566_G_T_b38	RP11-206L10.9	4.094	5.61e-05	0.076685	3	0.018729	no	TESTIS
chr1_1118447_T_TG_b38	RP11-206L10.9	4.094	5.61e-05	0.076685	3	0.018729	no	TESTIS
chr1_1113575_A_G_b38	RP11-206L10.9	3.987	8.63e-05	0.07858	3	0.019707	no	TESTIS
chr1_1101667_C_T_b38	RP11-206L10.9	-3.95	1e-04	-0.055526	20	0.014058	no	TESTIS
chr1_1112601_G_A_b38	RP11-206L10.9	-3.95	1e-04	-0.055526	20	0.014058	no	TESTIS
chr1_1101437_T_C_b38	RP11-206L10.9	-3.915	0.000115	-0.054851	20	0.014009	no	TESTIS
chr1_1010755_T_G_b38	RP11-206L10.9	-3.81	0.000173	-0.086457	5	0.022694	no	TESTIS
chr1_1118344_A_G_b38	RP11-206L10.9	3.756	0.000212	0.061191	9	0.016292	no	TESTIS
chr1_1118696_C_T_b38	RP11-206L10.9	3.756	0.000212	0.061191	9	0.016292	no	TESTIS
chr1_1115274_C_CA_b38	RP11-206L10.9	3.715	0.000247	0.060137	11	0.016186	no	TESTIS
chr1_1101933_A_G_b38	RP11-206L10.9	3.708	0.000254	0.059626	11	0.016078	no	TESTIS
chr1_1105444_T_C_b38	RP11-206L10.9	3.708	0.000254	0.059626	11	0.016078	no	TESTIS
chr1_1111994_T_A_b38	RP11-206L10.9	3.708	0.000254	0.059626	11	0.016078	no	TESTIS
chr1_1114570_A_G_b38	RP11-206L10.9	3.708	0.000254	0.059626	11	0.016078	no	TESTIS
chr1_1110093_G_A_b38	RP11-206L10.9	3.69	0.000272	0.069952	3	0.018959	no	TESTIS
chr1_1111481_G_A_b38	RP11-206L10.9	3.69	0.000272	0.069952	3	0.018959	no	TESTIS
chr1_1113703_C_A_b38	RP11-206L10.9	3.69	0.000272	0.069952	3	0.018959	no	TESTIS
chr1_1118072_G_A_b38	RP11-206L10.9	3.69	0.000272	0.069952	3	0.018959	no	TESTIS
chr1_1107147_G_C_b38	RP11-206L10.9	3.679	0.000283	0.070913	3	0.019276	no	TESTIS
chr1_1111337_G_C_b38	RP11-206L10.9	3.67	0.000293	0.069595	3	0.018965	no	TESTIS
chr1_1122128_C_G_b38	RP11-206L10.9	3.655	0.000309	0.069475	3	0.019006	no	TESTIS
chr1_1122144_C_T_b38	RP11-206L10.9	3.655	0.000309	0.069475	3	0.019006	no	TESTIS
chr1_1129422_T_C_b38	RP11-206L10.9	-3.651	0.000314	-0.057215	8	0.015671	no	TESTIS
chr1_1118290_G_A_b38	RP11-206L10.9	3.643	0.000324	0.058952	10	0.016183	no	TESTIS
chr1_1011654_G_A_b38	RP11-206L10.9	-3.63	0.000339	-0.093047	5	0.025632	no	TESTIS
chr1_1103993_C_CT_b38	RP11-206L10.9	3.62	0.000353	0.058117	11	0.016056	no	TESTIS
chr1_1154789_GA_G_b38	RP11-206L10.9	-3.618	0.000354	-0.048778	22	0.01348	no	TESTIS
chr1_1010747_GT_G_b38	RP11-206L10.9	-3.606	0.000371	-0.085407	5	0.023687	no	TESTIS
chr1_1101579_T_C_b38	RP11-206L10.9	3.569	0.000424	0.067058	3	0.018787	no	TESTIS
chr1_1014228_G_A_b38	RP11-206L10.9	-3.563	0.000434	-0.044382	51	0.012457	no	TESTIS
chr1_1120273_C_G_b38	RP11-206L10.9	3.551	0.000453	0.067253	3	0.018937	no	TESTIS
chr1_1120521_C_A_b38	RP11-206L10.9	3.551	0.000453	0.067253	3	0.018937	no	TESTIS
chr1_1121559_T_A_b38	RP11-206L10.9	3.551	0.000453	0.067253	3	0.018937	no	TESTIS
chr1_1120417_A_G_b38	RP11-206L10.9	3.5	0.000544	0.065272	3	0.018648	no	TESTIS
chr1_1120889_C_T_b38	RP11-206L10.9	3.5	0.000544	0.065272	3	0.018648	no	TESTIS
chr1_1122042_G_C_b38	RP11-206L10.9	3.5	0.000544	0.065272	3	0.018648	no	TESTIS
chr1_1105739_G_GGGCGTGGT_b38	RP11-206L10.9	3.495	0.000555	0.05763	9	0.016489	no	TESTIS
chr1_681082_T_C_b38	RP11-206L10.9	-3.482	0.000581	-0.053674	11	0.015414	no	TESTIS
chr1_1101480_A_C_b38	RP11-206L10.9	3.381	0.000829	0.055324	10	0.016362	no	TESTIS
chr1_1101923_T_C_b38	RP11-206L10.9	3.381	0.000829	0.055324	10	0.016362	no	TESTIS
chr1_1101987_G_A_b38	RP11-206L10.9	3.381	0.000829	0.055324	10	0.016362	no	TESTIS
chr1_1103617_ACTC_A_b38	RP11-206L10.9	3.381	0.000829	0.055324	10	0.016362	no	TESTIS
chr1_1103888_T_C_b38	RP11-206L10.9	3.381	0.000829	0.055324	10	0.016362	no	TESTIS
chr1_1104437_A_G_b38	RP11-206L10.9	3.381	0.000829	0.055324	10	0.016362	no	TESTIS
chr1_1104646_T_C_b38	RP11-206L10.9	3.381	0.000829	0.055324	10	0.016362	no	TESTIS
chr1_1105092_C_T_b38	RP11-206L10.9	3.381	0.000829	0.055324	10	0.016362	no	TESTIS
chr1_1105560_A_C_b38	RP11-206L10.9	3.381	0.000829	0.055324	10	0.016362	no	TESTIS
chr1_1105605_C_G_b38	RP11-206L10.9	3.381	0.000829	0.055324	10	0.016362	no	TESTIS
chr1_1106406_T_C_b38	RP11-206L10.9	3.381	0.000829	0.055324	10	0.016362	no	TESTIS
chr1_1106998_A_C_b38	RP11-206L10.9	3.381	0.000829	0.055324	10	0.016362	no	TESTIS
chr1_1107103_C_T_b38	RP11-206L10.9	3.381	0.000829	0.055324	10	0.016362	no	TESTIS
chr1_1107547_G_T_b38	RP11-206L10.9	3.381	0.000829	0.055324	10	0.016362	no	TESTIS
chr1_1107673_A_G_b38	RP11-206L10.9	3.381	0.000829	0.055324	10	0.016362	no	TESTIS
chr1_1107882_T_C_b38	RP11-206L10.9	3.381	0.000829	0.055324	10	0.016362	no	TESTIS
chr1_1607341_CT_C_b38	RP11-206L10.9	3.362	0.000887	0.065394	3	0.019451	no	TESTIS
chr1_1016184_A_G_b38	RP11-206L10.9	-3.36	0.000893	-0.041927	54	0.012479	no	TESTIS
chr1_1009184_T_C_b38	RP11-206L10.9	-3.317	0.00104	-0.040343	51	0.012163	no	TESTIS
chr1_1013312_G_A_b38	RP11-206L10.9	-3.316	0.00104	-0.085664	6	0.025834	no	TESTIS
chr1_1126222_G_A_b38	RP11-206L10.9	3.304	0.00108	0.061585	3	0.018639	no	TESTIS
chr1_1005954_G_A_b38	RP11-206L10.9	-3.301	0.00109	-0.040863	48	0.012379	no	TESTIS
chr1_1102708_G_C_b38	RP11-206L10.9	3.296	0.00111	0.053861	10	0.016343	no	TESTIS
chr1_1105414_G_A_b38	RP11-206L10.9	3.296	0.00111	0.053861	10	0.016343	no	TESTIS
chr1_1106320_A_G_b38	RP11-206L10.9	3.296	0.00111	0.053861	10	0.016343	no	TESTIS
chr1_1107293_C_T_b38	RP11-206L10.9	3.296	0.00111	0.053861	10	0.016343	no	TESTIS
chr1_1110784_C_T_b38	RP11-206L10.9	3.296	0.00111	0.053861	10	0.016343	no	TESTIS
chr1_1113191_A_G_b38	RP11-206L10.9	3.294	0.00112	0.054262	8	0.016472	no	TESTIS
chr1_1113121_G_A_b38	RP11-206L10.9	3.286	0.00115	0.053823	8	0.016379	no	TESTIS
chr1_1101497_T_A_b38	RP11-206L10.9	3.28	0.00118	0.05685	5	0.017333	no	TESTIS
chr1_1008307_G_C_b38	RP11-206L10.9	-3.277	0.00119	-0.040144	51	0.01225	no	TESTIS
chr1_1014863_A_C_b38	RP11-206L10.9	-3.27	0.00122	-0.040663	49	0.012434	no	TESTIS
chr1_1119513_T_C_b38	RP11-206L10.9	3.247	0.00131	0.052628	11	0.016207	no	TESTIS
chr1_1121335_C_T_b38	RP11-206L10.9	3.247	0.00131	0.052628	11	0.016207	no	TESTIS
chr1_1009716_C_T_b38	RP11-206L10.9	-3.24	0.00135	-0.083624	7	0.025811	no	TESTIS
chr1_1010481_ATTAT_A_b38	RP11-206L10.9	-3.226	0.00141	-0.08126	7	0.025189	no	TESTIS
chr1_1101496_T_A_b38	RP11-206L10.9	3.226	0.00141	0.056816	5	0.017614	no	TESTIS
chr1_1125228_G_A_b38	RP11-206L10.9	3.22	0.00144	0.061513	3	0.019102	no	TESTIS
chr1_1126571_C_T_b38	RP11-206L10.9	3.22	0.00144	0.061513	3	0.019102	no	TESTIS
chr1_1126654_G_A_b38	RP11-206L10.9	3.22	0.00144	0.061513	3	0.019102	no	TESTIS
chr1_1123509_G_A_b38	RP11-206L10.9	3.21	0.00149	0.060714	3	0.018911	no	TESTIS
chr1_1110693_C_A_b38	RP11-206L10.9	3.207	0.0015	0.052564	8	0.016389	no	TESTIS
chr1_1125882_A_G_b38	RP11-206L10.9	3.166	0.00172	0.059407	3	0.018762	no	TESTIS
chr1_1119172_G_A_b38	RP11-206L10.9	3.15	0.00182	0.060338	3	0.019155	no	TESTIS
chr1_1123889_C_T_b38	RP11-206L10.9	3.15	0.00182	0.060338	3	0.019155	no	TESTIS
chr1_1124663_A_C_b38	RP11-206L10.9	3.15	0.00182	0.060338	3	0.019155	no	TESTIS
chr1_1124768_G_T_b38	RP11-206L10.9	3.15	0.00182	0.060338	3	0.019155	no	TESTIS
chr1_680812_T_C_b38	RP11-206L10.9	-3.111	0.00207	-0.048445	9	0.015573	no	TESTIS
chr1_1120968_G_A_b38	RP11-206L10.9	3.088	0.00223	0.050391	9	0.016317	no	TESTIS
chr1_1688786_G_A_b38	RP11-206L10.9	3.078	0.0023	0.050702	15	0.016473	no	TESTIS
chr1_1096160_A_G_b38	RP11-206L10.9	3.059	0.00244	0.043257	20	0.01414	no	TESTIS
chr1_1067673_C_T_b38	RP11-206L10.9	3.046	0.00255	0.03798	67	0.012468	no	TESTIS
chr1_1022518_G_T_b38	RP11-206L10.9	-3.039	0.00261	-0.03921	39	0.012901	no	TESTIS
chr1_1125772_T_C_b38	RP11-206L10.9	3.028	0.0027	0.057266	3	0.018912	no	TESTIS
chr1_1126128_G_A_b38	RP11-206L10.9	3.028	0.0027	0.057266	3	0.018912	no	TESTIS
chr1_826420_A_T_b38	RP11-206L10.9	-3.006	0.0029	-0.042146	29	0.014019	no	TESTIS
chr1_1135061_C_T_b38	RP11-206L10.9	-2.973	0.00322	-0.049093	6	0.016514	no	TESTIS
chr1_1129155_G_C_b38	RP11-206L10.9	-2.97	0.00325	-0.040062	22	0.01349	no	TESTIS
chr1_1124794_C_T_b38	RP11-206L10.9	-2.96	0.00336	-0.039803	23	0.013449	no	TESTIS
chr1_995512_T_C_b38	RP11-206L10.9	-2.958	0.00338	-0.038019	52	0.012854	no	TESTIS
chr1_995371_C_G_b38	RP11-206L10.9	-2.957	0.00338	-0.037164	47	0.012568	no	TESTIS
chr1_1027226_G_A_b38	RP11-206L10.9	2.953	0.00343	0.036982	72	0.012524	no	TESTIS
chr1_995786_A_G_b38	RP11-206L10.9	-2.941	0.00356	-0.037611	52	0.01279	no	TESTIS
chr1_1130420_C_T_b38	RP11-206L10.9	-2.923	0.00376	-0.044472	12	0.015212	no	TESTIS
chr1_1096804_A_G_b38	RP11-206L10.9	2.896	0.00409	0.040361	21	0.013935	no	TESTIS
chr1_995153_C_G_b38	RP11-206L10.9	-2.889	0.00418	-0.036761	50	0.012725	no	TESTIS
chr1_1020217_G_T_b38	RP11-206L10.9	-2.865	0.0045	-0.037605	34	0.013126	no	TESTIS
chr1_1141684_C_A_b38	RP11-206L10.9	-2.852	0.00469	-0.059432	3	0.020842	no	TESTIS
chr1_598702_A_G_b38	RP11-206L10.9	-2.83	0.005	-0.050881	7	0.017977	no	TESTIS
chr1_1092465_T_G_b38	RP11-206L10.9	2.823	0.00512	0.044214	12	0.015665	no	TESTIS
chr1_1092466_T_C_b38	RP11-206L10.9	2.823	0.00512	0.044214	12	0.015665	no	TESTIS
chr1_1035169_TGG_T_b38	RP11-206L10.9	-2.804	0.00542	-0.043788	10	0.015617	no	TESTIS
chr1_995187_A_G_b38	RP11-206L10.9	-2.803	0.00544	-0.035644	51	0.012718	no	TESTIS
chr1_1153726_G_A_b38	RP11-206L10.9	-2.795	0.00556	-0.035896	26	0.012842	no	TESTIS
chr1_1081790_C_G_b38	RP11-206L10.9	2.77	0.006	0.032292	70	0.011657	no	TESTIS
chr1_910558_G_A_b38	RP11-206L10.9	2.768	0.00603	0.042935	15	0.01551	no	TESTIS
chr1_923311_TG_T_b38	RP11-206L10.9	-2.754	0.0063	-0.040855	24	0.014837	no	TESTIS
chr1_1126311_G_GTT_b38	RP11-206L10.9	2.735	0.00665	0.061336	3	0.022423	no	TESTIS
chr1_514446_TA_T_b38	RP11-206L10.9	2.734	0.00668	0.043957	6	0.016081	no	TESTIS
chr1_1020681_A_AG_b38	RP11-206L10.9	-2.719	0.00697	-0.036024	30	0.013248	no	TESTIS
chr1_1095185_C_T_b38	RP11-206L10.9	2.718	0.007	0.042843	12	0.015764	no	TESTIS
chr1_1096593_C_T_b38	RP11-206L10.9	2.718	0.007	0.042843	12	0.015764	no	TESTIS
chr1_1098216_T_C_b38	RP11-206L10.9	2.718	0.007	0.042843	12	0.015764	no	TESTIS
chr1_1098300_T_A_b38	RP11-206L10.9	2.718	0.007	0.042843	12	0.015764	no	TESTIS
chr1_1098614_C_T_b38	RP11-206L10.9	2.718	0.007	0.042843	12	0.015764	no	TESTIS
chr1_1098820_T_C_b38	RP11-206L10.9	2.718	0.007	0.042843	12	0.015764	no	TESTIS
chr1_1074098_G_C_b38	RP11-206L10.9	2.714	0.00707	0.034851	26	0.012839	no	TESTIS
chr1_1059011_G_T_b38	RP11-206L10.9	2.71	0.00716	0.042359	15	0.015629	no	TESTIS
chr1_1688586_C_T_b38	RP11-206L10.9	2.708	0.00721	0.042173	22	0.015573	no	TESTIS
chr1_1057472_AAG_A_b38	RP11-206L10.9	2.684	0.00773	0.041212	16	0.015354	no	TESTIS
chr1_923421_A_G_b38	RP11-206L10.9	-2.674	0.00796	-0.039346	25	0.014716	no	TESTIS
chr1_911484_G_C_b38	RP11-206L10.9	2.667	0.00812	0.041317	10	0.015493	no	TESTIS
chr1_909894_G_T_b38	RP11-206L10.9	2.664	0.0082	0.04115	18	0.015449	no	TESTIS
chr1_1526169_C_T_b38	RP11-206L10.9	2.661	0.00826	0.067587	13	0.0254	no	TESTIS
chr1_1081961_G_T_b38	RP11-206L10.9	2.644	0.00868	0.033376	29	0.012623	no	TESTIS
chr1_591356_C_G_b38	RP11-206L10.9	2.637	0.00886	0.053717	6	0.020371	no	TESTIS
chr1_1095253_G_A_b38	RP11-206L10.9	2.636	0.00887	0.041464	12	0.015728	no	TESTIS
chr1_1097574_A_G_b38	RP11-206L10.9	2.636	0.00887	0.041464	12	0.015728	no	TESTIS
chr1_897580_AT_A_b38	RP11-206L10.9	2.632	0.00899	0.032454	84	0.012332	no	TESTIS
chr1_927486_C_T_b38	RP11-206L10.9	-2.622	0.00925	-0.039145	26	0.01493	no	TESTIS
chr1_911018_G_A_b38	RP11-206L10.9	2.612	0.00952	0.041544	12	0.015907	no	TESTIS
chr1_1086035_A_G_b38	RP11-206L10.9	2.603	0.00976	0.03384	27	0.013001	no	TESTIS
chr1_812761_G_A_b38	RP11-206L10.9	10.957	3.36e-25	0.162097	6	0.014794	yes	THYROID
chr1_783406_A_AT_b38	RP11-206L10.9	9.996	1.4e-21	0.135782	3	0.013583	yes	THYROID
chr1_820560_C_T_b38	RP11-206L10.9	-7.79	3.86e-14	-0.077207	30	0.009911	yes	THYROID
chr1_794299_C_G_b38	RP11-206L10.9	-7.471	3.55e-13	-0.07613	41	0.01019	yes	THYROID
chr1_814476_C_T_b38	RP11-206L10.9	-7.025	7e-12	-0.07309	29	0.010405	yes	THYROID
chr1_808924_C_T_b38	RP11-206L10.9	-6.48	2.19e-10	-0.072747	10	0.011227	yes	THYROID
chr1_790933_CGAATGGAATG_C_b38	RP11-206L10.9	-5.866	8.08e-09	-0.055941	37	0.009536	yes	THYROID
chr1_799082_G_A_b38	RP11-206L10.9	-5.83	9.93e-09	-0.067433	12	0.011567	yes	THYROID
chr1_598862_C_T_b38	RP11-206L10.9	5.369	1.21e-07	0.061858	5	0.011522	yes	THYROID
chr1_771398_G_A_b38	RP11-206L10.9	-5.03	6.85e-07	-0.047154	75	0.009375	yes	THYROID
chr1_814773_T_C_b38	RP11-206L10.9	4.975	8.97e-07	0.057004	6	0.011458	yes	THYROID
chr1_624767_T_G_b38	RP11-206L10.9	4.859	1.58e-06	0.055126	5	0.011346	yes	THYROID
chr1_821000_T_A_b38	RP11-206L10.9	-4.844	1.7e-06	-0.048735	28	0.010061	yes	THYROID
chr1_822427_CCCTGGCCAGCAGATCCACCCTGTCTATACTACCTG_C_b38	RP11-206L10.9	-4.445	1.08e-05	-0.044999	33	0.010124	yes	THYROID
chr1_791564_C_G_b38	RP11-206L10.9	-4.428	1.17e-05	-0.042062	58	0.009498	yes	THYROID
chr1_624752_C_T_b38	RP11-206L10.9	4.418	1.22e-05	0.050371	6	0.011401	yes	THYROID
chr1_820395_A_G_b38	RP11-206L10.9	-4.053	5.87e-05	-0.041979	27	0.010359	yes	THYROID
chr1_624509_A_G_b38	RP11-206L10.9	3.769	0.000183	0.040068	12	0.010631	yes	THYROID
chr1_789680_A_AGGAATGGAAT_b38	RP11-206L10.9	-3.578	0.00038	-0.030168	65	0.008431	yes	THYROID
chr1_822556_C_A_b38	RP11-206L10.9	-3.39	0.000754	-0.038597	27	0.011386	yes	THYROID
chr1_1451028_T_A_b38	RP11-206L10.9	3.086	0.00214	0.033839	16	0.010966	yes	THYROID
chr1_271406_C_CTTT_b38	RP11-206L10.9	3.047	0.00243	0.075531	3	0.024787	yes	THYROID
chr1_1160818_C_T_b38	RP11-206L10.9	-3.045	0.00245	-0.0244	88	0.008014	yes	THYROID
chr1_638770_T_A_b38	RP11-206L10.9	3.009	0.00275	0.08555	3	0.028433	yes	THYROID
chr1_674381_A_AT_b38	RP11-206L10.9	2.998	0.00285	0.029917	27	0.009978	yes	THYROID
chr1_1522693_A_G_b38	RP11-206L10.9	-2.953	0.00329	-0.027676	34	0.009371	yes	THYROID
chr1_1457033_A_C_b38	RP11-206L10.9	2.899	0.00391	0.028773	35	0.009926	yes	THYROID
chr1_1646352_A_C_b38	RP11-206L10.9	-2.885	0.00408	-0.03425	9	0.011872	yes	THYROID
chr1_1658830_C_G_b38	RP11-206L10.9	2.882	0.00412	0.027625	29	0.009586	yes	THYROID
chr1_1159105_C_T_b38	RP11-206L10.9	-2.83	0.00484	-0.022369	100	0.007904	yes	THYROID
chr1_1160631_C_G_b38	RP11-206L10.9	-2.8	0.0053	-0.022164	99	0.007915	yes	THYROID
chr1_1641275_A_G_b38	RP11-206L10.9	2.78	0.00564	0.024224	63	0.008714	yes	THYROID
chr1_673518_C_T_b38	RP11-206L10.9	-2.761	0.00597	-0.028898	12	0.010467	yes	THYROID
chr1_131281_C_G_b38	RP11-206L10.9	2.754	0.00609	0.036287	7	0.013174	yes	THYROID
chr1_674562_T_C_b38	RP11-206L10.9	2.745	0.00627	0.027471	18	0.010008	yes	THYROID
chr1_118504_C_G_b38	RP11-206L10.9	-2.737	0.00641	-0.029818	10	0.010892	yes	THYROID
chr1_814617_A_G_b38	RP11-206L10.9	-2.721	0.00674	-0.023536	57	0.00865	yes	THYROID
chr1_1303112_G_A_b38	RP11-206L10.9	2.7	0.00717	0.034459	7	0.012764	yes	THYROID
chr1_1192776_CAGTGTAGACACTCCAGTTGGTATG_C_b38	RP11-206L10.9	-2.691	0.00735	-0.039669	4	0.014739	yes	THYROID
chr1_1303800_G_A_b38	RP11-206L10.9	2.688	0.00744	0.035553	7	0.013229	yes	THYROID
chr1_1641261_C_T_b38	RP11-206L10.9	2.68	0.0076	0.026629	28	0.009936	yes	THYROID
chr1_1450636_A_G_b38	RP11-206L10.9	2.664	0.00797	0.029794	14	0.011184	yes	THYROID
chr1_1293731_A_ACGCCCCTGCCCTGGAGGCCCCGCCCCTGCCCTGGAGGCCC_b38	RP11-206L10.9	2.662	0.00801	0.050967	5	0.019143	yes	THYROID
chr1_59941_A_G_b38	RP11-206L10.9	-2.66	0.00807	-0.046148	6	0.017351	yes	THYROID
chr1_1453870_A_C_b38	RP11-206L10.9	2.655	0.00817	0.029868	13	0.011248	yes	THYROID
chr1_1669576_G_A_b38	RP11-206L10.9	2.653	0.00823	0.025817	29	0.009731	yes	THYROID
chr1_1454848_T_C_b38	RP11-206L10.9	2.653	0.00823	0.02632	37	0.009922	yes	THYROID
chr1_1022587_T_TTGTAGTCTGACCTGTGGTCTGAC_b38	RP11-206L10.9	2.644	0.00844	0.066304	4	0.025074	yes	THYROID
chr1_1304555_A_C_b38	RP11-206L10.9	2.637	0.00861	0.034058	7	0.012913	yes	THYROID
chr1_1372909_G_A_b38	RP11-206L10.9	2.634	0.00871	0.034285	10	0.013019	yes	THYROID
chr1_1606099_G_C_b38	RP11-206L10.9	-2.618	0.00911	-0.034288	14	0.013098	yes	THYROID
chr1_1453961_C_T_b38	RP11-206L10.9	2.587	0.00997	0.03011	11	0.01164	yes	THYROID
chr1_677378_T_C_b38	RP11-206L10.9	15.113	8.17e-43	0.210364	4	0.01392	no	THYROID
chr1_677290_A_G_b38	RP11-206L10.9	13.787	6.55e-37	0.204214	4	0.014812	no	THYROID
chr1_799688_A_G_b38	RP11-206L10.9	13.352	5.07e-35	0.18841	3	0.014111	no	THYROID
chr1_800605_G_A_b38	RP11-206L10.9	13.351	5.1e-35	0.179322	8	0.013431	no	THYROID
chr1_809641_G_T_b38	RP11-206L10.9	12.973	2.12e-33	0.172807	10	0.013321	no	THYROID
chr1_788418_CAG_C_b38	RP11-206L10.9	-12.968	2.22e-33	-0.169458	12	0.013068	no	THYROID
chr1_788439_T_A_b38	RP11-206L10.9	12.962	2.35e-33	0.173713	9	0.013402	no	THYROID
chr1_778639_A_G_b38	RP11-206L10.9	12.903	4.19e-33	0.17394	9	0.013481	no	THYROID
chr1_788511_G_C_b38	RP11-206L10.9	-12.418	4.53e-31	-0.161546	15	0.013009	no	THYROID
chr1_777382_T_G_b38	RP11-206L10.9	12.241	2.43e-30	0.172009	5	0.014051	no	THYROID
chr1_779047_G_A_b38	RP11-206L10.9	-12.107	8.67e-30	-0.158949	16	0.013129	no	THYROID
chr1_683167_G_A_b38	RP11-206L10.9	10.799	1.36e-24	0.135379	5	0.012536	no	THYROID
chr1_812899_A_T_b38	RP11-206L10.9	10.51	1.72e-23	0.15386	10	0.01464	no	THYROID
chr1_777135_T_TC_b38	RP11-206L10.9	10.333	7.91e-23	0.160745	7	0.015556	no	THYROID
chr1_784109_C_CATAAT_b38	RP11-206L10.9	9.095	2.19e-18	0.139392	9	0.015326	no	THYROID
chr1_800909_T_A_b38	RP11-206L10.9	8.557	1.41e-16	0.091774	10	0.010725	no	THYROID
chr1_817186_G_A_b38	RP11-206L10.9	-8.053	5.91e-15	-0.082395	30	0.010232	no	THYROID
chr1_825532_C_T_b38	RP11-206L10.9	-7.979	1.01e-14	-0.081617	27	0.010229	no	THYROID
chr1_825767_T_C_b38	RP11-206L10.9	-7.979	1.01e-14	-0.081617	27	0.010229	no	THYROID
chr1_817341_A_G_b38	RP11-206L10.9	-7.911	1.64e-14	-0.082047	36	0.010371	no	THYROID
chr1_819123_G_A_b38	RP11-206L10.9	-7.798	3.66e-14	-0.080526	33	0.010327	no	THYROID
chr1_819584_C_T_b38	RP11-206L10.9	-7.798	3.66e-14	-0.080526	33	0.010327	no	THYROID
chr1_826577_A_AT_b38	RP11-206L10.9	-7.795	3.72e-14	-0.078937	29	0.010126	no	THYROID
chr1_668125_A_C_b38	RP11-206L10.9	7.791	3.82e-14	0.214001	3	0.027466	no	THYROID
chr1_824320_T_C_b38	RP11-206L10.9	-7.694	7.61e-14	-0.077282	30	0.010045	no	THYROID
chr1_817514_T_C_b38	RP11-206L10.9	-7.638	1.12e-13	-0.076671	26	0.010038	no	THYROID
chr1_818094_C_G_b38	RP11-206L10.9	-7.577	1.72e-13	-0.07818	46	0.010319	no	THYROID
chr1_789568_TATGGA_T_b38	RP11-206L10.9	-6.93	1.29e-11	-0.068789	44	0.009926	no	THYROID
chr1_813498_G_T_b38	RP11-206L10.9	-6.766	3.7e-11	-0.066578	35	0.009841	no	THYROID
chr1_98929_A_G_b38	RP11-206L10.9	6.184	1.3e-09	0.07919	9	0.012806	no	THYROID
chr1_826420_A_T_b38	RP11-206L10.9	-5.494	6.24e-08	-0.049504	56	0.00901	no	THYROID
chr1_807692_C_A_b38	RP11-206L10.9	-5.264	2.09e-07	-0.090696	10	0.017228	no	THYROID
chr1_806017_A_G_b38	RP11-206L10.9	4.786	2.24e-06	0.090739	10	0.01896	no	THYROID
chr1_799080_TG_T_b38	RP11-206L10.9	4.779	2.31e-06	0.045953	34	0.009615	no	THYROID
chr1_823246_C_T_b38	RP11-206L10.9	-4.273	2.31e-05	-0.046915	27	0.01098	no	THYROID
chr1_680812_T_C_b38	RP11-206L10.9	-3.398	0.000731	-0.03453	18	0.010161	no	THYROID
chr1_788757_T_TAATGG_b38	RP11-206L10.9	-3.205	0.00144	-0.025555	109	0.007973	no	THYROID
chr1_1605787_G_A_b38	RP11-206L10.9	2.973	0.00309	0.05698	4	0.019168	no	THYROID
chr1_1045707_A_G_b38	RP11-206L10.9	2.969	0.00313	0.040686	10	0.013704	no	THYROID
chr1_1606532_G_A_b38	RP11-206L10.9	2.968	0.00314	0.027424	42	0.009241	no	THYROID
chr1_681082_T_C_b38	RP11-206L10.9	-2.915	0.00372	-0.029491	20	0.010118	no	THYROID
chr1_607860_C_A_b38	RP11-206L10.9	2.912	0.00375	0.034273	3	0.01177	no	THYROID
chr1_1606536_GCT_G_b38	RP11-206L10.9	2.813	0.0051	0.025772	43	0.009161	no	THYROID
chr1_608127_T_C_b38	RP11-206L10.9	2.8	0.0053	0.031896	4	0.01139	no	THYROID
chr1_1634405_C_CGG_b38	RP11-206L10.9	2.789	0.00549	0.063545	4	0.022785	no	THYROID
chr1_1606539_G_GCC_b38	RP11-206L10.9	2.78	0.00565	0.025449	43	0.009156	no	THYROID
chr1_1042400_C_T_b38	RP11-206L10.9	2.768	0.00585	0.035592	20	0.012858	no	THYROID
chr1_1052290_T_G_b38	RP11-206L10.9	2.736	0.00644	0.038203	7	0.013963	no	THYROID
chr1_1045080_G_A_b38	RP11-206L10.9	2.722	0.00671	0.038928	6	0.014299	no	THYROID
chr1_1161712_G_A_b38	RP11-206L10.9	-2.709	0.00698	-0.021436	100	0.007914	no	THYROID
chr1_1039514_C_T_b38	RP11-206L10.9	2.707	0.00703	0.034633	20	0.012795	no	THYROID
chr1_1605792_C_G_b38	RP11-206L10.9	2.704	0.00708	0.049136	5	0.018172	no	THYROID
chr1_1452540_G_A_b38	RP11-206L10.9	2.695	0.00727	0.026903	31	0.009981	no	THYROID
chr1_1035987_T_C_b38	RP11-206L10.9	2.661	0.00805	0.037953	6	0.014265	no	THYROID
chr1_1047064_A_G_b38	RP11-206L10.9	2.658	0.00812	0.03518	16	0.013238	no	THYROID
chr1_1046551_A_G_b38	RP11-206L10.9	2.65	0.0083	0.033209	19	0.012531	no	THYROID
chr1_1661177_A_G_b38	RP11-206L10.9	2.645	0.00843	0.025611	30	0.009683	no	THYROID
chr1_1039282_G_T_b38	RP11-206L10.9	2.641	0.00853	0.037865	6	0.014338	no	THYROID
chr1_1668717_C_G_b38	RP11-206L10.9	2.604	0.00948	0.025277	30	0.009706	no	THYROID
chr1_1647600_C_G_b38	RP11-206L10.9	3.284	0.00139	0.114125	12	0.034751	yes	UTERUS
chr1_814773_T_C_b38	RP11-206L10.9	3.139	0.0022	0.084278	5	0.026845	yes	UTERUS
chr1_1573079_A_G_b38	RP11-206L10.9	-3.114	0.00238	-0.0737	23	0.023663	yes	UTERUS
chr1_1538787_A_G_b38	RP11-206L10.9	-3.032	0.00307	-0.072781	22	0.024006	yes	UTERUS
chr1_1157310_C_T_b38	RP11-206L10.9	3.03	0.00308	0.075795	6	0.025013	yes	UTERUS
chr1_1557495_CAT_C_b38	RP11-206L10.9	-2.981	0.00357	-0.075243	20	0.025238	yes	UTERUS
chr1_1574032_AAAG_A_b38	RP11-206L10.9	-2.955	0.00387	-0.077961	12	0.026382	yes	UTERUS
chr1_1565105_CAAGGCAGGCGGATCATG_C_b38	RP11-206L10.9	-2.823	0.0057	-0.065934	24	0.023357	yes	UTERUS
chr1_1660683_C_T_b38	RP11-206L10.9	2.772	0.0066	0.069721	9	0.025151	yes	UTERUS
chr1_1537493_T_A_b38	RP11-206L10.9	-2.755	0.00693	-0.066341	20	0.02408	yes	UTERUS
chr1_1571794_A_AT_b38	RP11-206L10.9	-2.752	0.00699	-0.064654	21	0.023495	yes	UTERUS
chr1_1550064_GC_G_b38	RP11-206L10.9	-2.71	0.00787	-0.066457	20	0.024522	yes	UTERUS
chr1_1550068_C_A_b38	RP11-206L10.9	-2.71	0.00787	-0.066457	20	0.024522	yes	UTERUS
chr1_1545795_C_A_b38	RP11-206L10.9	-2.68	0.00856	-0.070338	18	0.026245	yes	UTERUS
chr1_800909_T_A_b38	RP11-206L10.9	4.564	1.38e-05	0.123308	3	0.027019	no	UTERUS
chr1_677378_T_C_b38	RP11-206L10.9	4.448	2.18e-05	0.151183	3	0.033988	no	UTERUS
chr1_677290_A_G_b38	RP11-206L10.9	4.361	3.05e-05	0.150761	3	0.034569	no	UTERUS
chr1_778639_A_G_b38	RP11-206L10.9	4.309	3.73e-05	0.162693	3	0.037758	no	UTERUS
chr1_788439_T_A_b38	RP11-206L10.9	4.309	3.73e-05	0.162693	3	0.037758	no	UTERUS
chr1_817514_T_C_b38	RP11-206L10.9	-4.173	6.25e-05	-0.108082	8	0.0259	no	UTERUS
chr1_819123_G_A_b38	RP11-206L10.9	-4.169	6.34e-05	-0.112263	10	0.026926	no	UTERUS
chr1_819584_C_T_b38	RP11-206L10.9	-4.169	6.34e-05	-0.112263	10	0.026926	no	UTERUS
chr1_820560_C_T_b38	RP11-206L10.9	-4.123	7.55e-05	-0.108067	9	0.026213	no	UTERUS
chr1_825532_C_T_b38	RP11-206L10.9	-4.106	8.05e-05	-0.107744	9	0.026243	no	UTERUS
chr1_825767_T_C_b38	RP11-206L10.9	-4.106	8.05e-05	-0.107744	9	0.026243	no	UTERUS
chr1_826577_A_AT_b38	RP11-206L10.9	-4.106	8.05e-05	-0.107744	9	0.026243	no	UTERUS
chr1_818094_C_G_b38	RP11-206L10.9	-4.089	8.56e-05	-0.107409	13	0.026268	no	UTERUS
chr1_817341_A_G_b38	RP11-206L10.9	-4.082	8.78e-05	-0.109423	11	0.026805	no	UTERUS
chr1_779047_G_A_b38	RP11-206L10.9	-4.057	9.63e-05	-0.148321	4	0.036559	no	UTERUS
chr1_788418_CAG_C_b38	RP11-206L10.9	-4.057	9.63e-05	-0.148321	4	0.036559	no	UTERUS
chr1_788511_G_C_b38	RP11-206L10.9	-4.057	9.63e-05	-0.148321	4	0.036559	no	UTERUS
chr1_813498_G_T_b38	RP11-206L10.9	-4.041	0.000102	-0.100605	10	0.024894	no	UTERUS
chr1_817186_G_A_b38	RP11-206L10.9	-4.012	0.000114	-0.104622	10	0.026079	no	UTERUS
chr1_794299_C_G_b38	RP11-206L10.9	-4.006	0.000116	-0.103101	13	0.025736	no	UTERUS
chr1_809641_G_T_b38	RP11-206L10.9	3.926	0.000155	0.146905	3	0.037414	no	UTERUS
chr1_824320_T_C_b38	RP11-206L10.9	-3.739	0.000302	-0.096452	10	0.025794	no	UTERUS
chr1_789568_TATGGA_T_b38	RP11-206L10.9	-3.529	0.000623	-0.090625	14	0.025682	no	UTERUS
chr1_784109_C_CATAAT_b38	RP11-206L10.9	3.432	0.000862	0.131101	3	0.038205	no	UTERUS
chr1_1132482_T_G_b38	RP11-206L10.9	-3.352	0.00112	-0.074135	15	0.022117	no	UTERUS
chr1_808924_C_T_b38	RP11-206L10.9	-3.335	0.00118	-0.108121	3	0.032422	no	UTERUS
chr1_1718824_G_T_b38	RP11-206L10.9	3.09	0.00257	0.154292	3	0.049933	no	UTERUS
chr1_1569180_T_A_b38	RP11-206L10.9	-3.064	0.00278	-0.073972	21	0.024139	no	UTERUS
chr1_1559703_G_C_b38	RP11-206L10.9	-3.042	0.00298	-0.073092	22	0.024028	no	UTERUS
chr1_1568548_G_A_b38	RP11-206L10.9	-3.042	0.00298	-0.073092	22	0.024028	no	UTERUS
chr1_1570587_C_T_b38	RP11-206L10.9	-3.042	0.00298	-0.073092	22	0.024028	no	UTERUS
chr1_1549590_C_G_b38	RP11-206L10.9	-3.006	0.00331	-0.071337	23	0.023728	no	UTERUS
chr1_1553692_A_G_b38	RP11-206L10.9	-3.006	0.00331	-0.071337	23	0.023728	no	UTERUS
chr1_1554694_A_G_b38	RP11-206L10.9	-3.006	0.00331	-0.071337	23	0.023728	no	UTERUS
chr1_1554781_A_G_b38	RP11-206L10.9	-3.006	0.00331	-0.071337	23	0.023728	no	UTERUS
chr1_1554852_T_C_b38	RP11-206L10.9	-3.006	0.00331	-0.071337	23	0.023728	no	UTERUS
chr1_1555247_T_A_b38	RP11-206L10.9	-3.006	0.00331	-0.071337	23	0.023728	no	UTERUS
chr1_1559750_C_CAG_b38	RP11-206L10.9	-3.006	0.00331	-0.071337	23	0.023728	no	UTERUS
chr1_1561628_T_C_b38	RP11-206L10.9	-3.006	0.00331	-0.071337	23	0.023728	no	UTERUS
chr1_1563918_A_G_b38	RP11-206L10.9	-3.006	0.00331	-0.071337	23	0.023728	no	UTERUS
chr1_1565561_A_G_b38	RP11-206L10.9	-3.006	0.00331	-0.071337	23	0.023728	no	UTERUS
chr1_1566086_G_A_b38	RP11-206L10.9	-3.006	0.00331	-0.071337	23	0.023728	no	UTERUS
chr1_1567715_G_A_b38	RP11-206L10.9	-3.006	0.00331	-0.071337	23	0.023728	no	UTERUS
chr1_1567719_A_C_b38	RP11-206L10.9	-3.006	0.00331	-0.071337	23	0.023728	no	UTERUS
chr1_1569661_T_C_b38	RP11-206L10.9	-3.006	0.00331	-0.071337	23	0.023728	no	UTERUS
chr1_1569875_C_T_b38	RP11-206L10.9	-3.006	0.00331	-0.071337	23	0.023728	no	UTERUS
chr1_1570294_CA_C_b38	RP11-206L10.9	-3.006	0.00331	-0.071337	23	0.023728	no	UTERUS
chr1_1572532_A_C_b38	RP11-206L10.9	-3.006	0.00331	-0.071337	23	0.023728	no	UTERUS
chr1_1539491_G_C_b38	RP11-206L10.9	-3.006	0.00332	-0.073923	21	0.024592	no	UTERUS
chr1_1574655_GGC_G_b38	RP11-206L10.9	-2.975	0.00364	-0.071764	22	0.02412	no	UTERUS
chr1_1641275_A_G_b38	RP11-206L10.9	2.975	0.00364	0.074514	10	0.025046	no	UTERUS
chr1_1547630_G_A_b38	RP11-206L10.9	-2.96	0.00381	-0.071653	22	0.024206	no	UTERUS
chr1_1565680_A_AG_b38	RP11-206L10.9	-2.957	0.00384	-0.069419	23	0.023476	no	UTERUS
chr1_1715860_C_T_b38	RP11-206L10.9	2.951	0.00391	0.14937	3	0.050612	no	UTERUS
chr1_1715862_G_A_b38	RP11-206L10.9	2.951	0.00391	0.14937	3	0.050612	no	UTERUS
chr1_1575935_T_C_b38	RP11-206L10.9	-2.94	0.00405	-0.073142	21	0.024882	no	UTERUS
chr1_1702441_T_C_b38	RP11-206L10.9	-2.938	0.00406	-0.167157	4	0.056886	no	UTERUS
chr1_1157309_G_A_b38	RP11-206L10.9	2.894	0.00464	0.072429	5	0.02503	no	UTERUS
chr1_1716796_A_C_b38	RP11-206L10.9	2.881	0.00482	0.137868	4	0.047855	no	UTERUS
chr1_1577491_A_AC_b38	RP11-206L10.9	-2.826	0.00565	-0.066241	24	0.023441	no	UTERUS
chr1_1168009_GGGGCGGAGGGCCGAGCGGGGCCAGCAGACGGGTGA_G_b38	RP11-206L10.9	-2.819	0.00577	-0.05655	9	0.020062	no	UTERUS
chr1_1573654_T_C_b38	RP11-206L10.9	-2.808	0.00596	-0.066785	23	0.023784	no	UTERUS
chr1_1574445_A_G_b38	RP11-206L10.9	-2.808	0.00596	-0.066785	23	0.023784	no	UTERUS
chr1_1575724_G_C_b38	RP11-206L10.9	-2.808	0.00596	-0.066785	23	0.023784	no	UTERUS
chr1_822427_CCCTGGCCAGCAGATCCACCCTGTCTATACTACCTG_C_b38	RP11-206L10.9	-2.794	0.00619	-0.076851	11	0.027503	no	UTERUS
chr1_1157314_CA_C_b38	RP11-206L10.9	2.78	0.00645	0.077661	5	0.027934	no	UTERUS
chr1_1716769_C_T_b38	RP11-206L10.9	2.762	0.0068	0.144426	3	0.052292	no	UTERUS
chr1_1571986_G_A_b38	RP11-206L10.9	-2.76	0.00684	-0.065439	21	0.023711	no	UTERUS
chr1_1555871_T_C_b38	RP11-206L10.9	-2.749	0.00704	-0.068635	19	0.024963	no	UTERUS
chr1_826420_A_T_b38	RP11-206L10.9	-2.742	0.00719	-0.068074	16	0.024826	no	UTERUS
chr1_820395_A_G_b38	RP11-206L10.9	-2.736	0.00731	-0.074711	9	0.027306	no	UTERUS
chr1_1718040_T_TAG_b38	RP11-206L10.9	2.716	0.00773	0.133035	4	0.048977	no	UTERUS
chr1_939570_T_TCCCTGGAGGACC_b38	RP11-206L10.9	-2.696	0.00819	-0.065136	12	0.024161	no	UTERUS
chr1_1703583_A_G_b38	RP11-206L10.9	-2.684	0.00846	-0.145183	6	0.054086	no	UTERUS
chr1_1132482_T_C_b38	RP11-206L10.9	2.673	0.00872	0.075018	5	0.028061	no	UTERUS
chr1_814476_C_T_b38	RP11-206L10.9	-2.652	0.00926	-0.073582	8	0.027746	no	UTERUS
chr1_1573429_CAAAAAAAAAAAAAAAAAA_C_b38	RP11-206L10.9	-2.628	0.00989	-0.063068	22	0.024	no	UTERUS
chr1_1134273_C_T_b38	RP11-206L10.9	3.728	3e-04	0.075022	7	0.020126	yes	VAGINA
chr1_813498_G_T_b38	RP11-206L10.9	-3.235	0.00159	-0.067415	10	0.020841	yes	VAGINA
chr1_817341_A_G_b38	RP11-206L10.9	-3.137	0.00216	-0.072258	11	0.023034	yes	VAGINA
chr1_818094_C_G_b38	RP11-206L10.9	-3.137	0.00216	-0.072258	11	0.023034	yes	VAGINA
chr1_819123_G_A_b38	RP11-206L10.9	-3.137	0.00216	-0.072258	11	0.023034	yes	VAGINA
chr1_819584_C_T_b38	RP11-206L10.9	-3.137	0.00216	-0.072258	11	0.023034	yes	VAGINA
chr1_1688457_G_A_b38	RP11-206L10.9	-3.098	0.00244	-0.063115	8	0.02037	yes	VAGINA
chr1_1143818_T_C_b38	RP11-206L10.9	3.05	0.00284	0.06035	10	0.019786	yes	VAGINA
chr1_1138876_T_C_b38	RP11-206L10.9	3.039	0.00293	0.062558	6	0.020582	yes	VAGINA
chr1_981282_A_C_b38	RP11-206L10.9	2.99	0.0034	0.067758	4	0.022659	yes	VAGINA
chr1_1705799_A_G_b38	RP11-206L10.9	2.978	0.00353	0.046766	39	0.015703	yes	VAGINA
chr1_794299_C_G_b38	RP11-206L10.9	-2.947	0.00388	-0.068401	12	0.023213	yes	VAGINA
chr1_1027633_C_T_b38	RP11-206L10.9	-2.945	0.00391	-0.052217	28	0.017732	yes	VAGINA
chr1_915400_C_T_b38	RP11-206L10.9	-2.942	0.00394	-0.057206	19	0.019446	yes	VAGINA
chr1_976536_C_T_b38	RP11-206L10.9	2.933	0.00405	0.06646	4	0.022662	yes	VAGINA
chr1_1023351_A_G_b38	RP11-206L10.9	2.91	0.00434	0.052959	16	0.018201	yes	VAGINA
chr1_1688442_T_C_b38	RP11-206L10.9	-2.865	0.00495	-0.057106	9	0.019929	yes	VAGINA
chr1_1688786_G_A_b38	RP11-206L10.9	-2.861	0.005	-0.065062	3	0.022737	yes	VAGINA
chr1_919598_A_C_b38	RP11-206L10.9	-2.86	0.00503	-0.055639	20	0.019455	yes	VAGINA
chr1_1160818_C_T_b38	RP11-206L10.9	-2.85	0.00517	-0.052114	22	0.018285	yes	VAGINA
chr1_982112_C_T_b38	RP11-206L10.9	2.839	0.00535	0.064661	4	0.022776	yes	VAGINA
chr1_982890_C_T_b38	RP11-206L10.9	2.839	0.00535	0.064661	4	0.022776	yes	VAGINA
chr1_983237_G_A_b38	RP11-206L10.9	2.839	0.00535	0.064661	4	0.022776	yes	VAGINA
chr1_981935_G_A_b38	RP11-206L10.9	2.832	0.00546	0.062346	5	0.022016	yes	VAGINA
chr1_817514_T_C_b38	RP11-206L10.9	-2.818	0.00568	-0.061658	10	0.021878	yes	VAGINA
chr1_978230_G_A_b38	RP11-206L10.9	2.815	0.00573	0.063639	4	0.022604	yes	VAGINA
chr1_1143811_T_C_b38	RP11-206L10.9	2.794	0.0061	0.054853	10	0.019636	yes	VAGINA
chr1_800909_T_A_b38	RP11-206L10.9	2.786	0.00624	0.067342	4	0.024172	yes	VAGINA
chr1_1705856_G_A_b38	RP11-206L10.9	2.778	0.00638	0.040749	41	0.014668	yes	VAGINA
chr1_1708486_C_A_b38	RP11-206L10.9	2.735	0.00721	0.043302	37	0.015832	yes	VAGINA
chr1_973443_G_A_b38	RP11-206L10.9	2.712	0.0077	0.058281	6	0.021489	yes	VAGINA
chr1_1690308_AT_A_b38	RP11-206L10.9	2.711	0.00773	0.04385	30	0.016175	yes	VAGINA
chr1_674381_A_AT_b38	RP11-206L10.9	2.706	0.00784	0.058666	6	0.021682	yes	VAGINA
chr1_1144486_C_G_b38	RP11-206L10.9	2.701	0.00795	0.053995	9	0.019991	yes	VAGINA
chr1_674562_T_C_b38	RP11-206L10.9	2.695	0.00808	0.060546	4	0.022465	yes	VAGINA
chr1_1653825_T_TACACAC_b38	RP11-206L10.9	-2.681	0.00841	-0.05569	6	0.020771	yes	VAGINA
chr1_1688531_T_C_b38	RP11-206L10.9	-2.668	0.00873	-0.057528	6	0.021565	yes	VAGINA
chr1_1043223_CCT_C_b38	RP11-206L10.9	-2.664	0.00883	-0.04756	33	0.017856	yes	VAGINA
chr1_973929_T_C_b38	RP11-206L10.9	2.656	0.00902	0.053735	7	0.020232	yes	VAGINA
chr1_677290_A_G_b38	RP11-206L10.9	3.813	0.000221	0.119292	3	0.031282	no	VAGINA
chr1_779047_G_A_b38	RP11-206L10.9	-3.647	0.000399	-0.126881	4	0.034791	no	VAGINA
chr1_788418_CAG_C_b38	RP11-206L10.9	-3.645	0.000402	-0.122948	4	0.033731	no	VAGINA
chr1_788511_G_C_b38	RP11-206L10.9	-3.52	0.000617	-0.119974	4	0.034081	no	VAGINA
chr1_967865_A_G_b38	RP11-206L10.9	-3.319	0.00121	-0.058574	35	0.017648	no	VAGINA
chr1_677378_T_C_b38	RP11-206L10.9	3.204	0.00175	0.102088	3	0.031858	no	VAGINA
chr1_920719_T_G_b38	RP11-206L10.9	3.185	0.00186	0.061119	14	0.01919	no	VAGINA
chr1_920728_A_G_b38	RP11-206L10.9	3.185	0.00186	0.061119	14	0.01919	no	VAGINA
chr1_1708505_G_C_b38	RP11-206L10.9	3.181	0.00189	0.049482	21	0.015557	no	VAGINA
chr1_914838_T_A_b38	RP11-206L10.9	-3.12	0.00228	-0.060532	26	0.019402	no	VAGINA
chr1_919397_A_G_b38	RP11-206L10.9	-3.065	0.0027	-0.058714	14	0.019154	no	VAGINA
chr1_919695_C_G_b38	RP11-206L10.9	-3.065	0.0027	-0.058714	14	0.019154	no	VAGINA
chr1_1688570_A_T_b38	RP11-206L10.9	-3.06	0.00275	-0.068257	3	0.022305	no	VAGINA
chr1_916657_G_A_b38	RP11-206L10.9	-3.058	0.00276	-0.059736	27	0.019533	no	VAGINA
chr1_916683_G_A_b38	RP11-206L10.9	-3.058	0.00276	-0.059736	27	0.019533	no	VAGINA
chr1_820560_C_T_b38	RP11-206L10.9	-3.018	0.00313	-0.066389	11	0.021996	no	VAGINA
chr1_1707607_C_G_b38	RP11-206L10.9	2.999	0.00331	0.04165	19	0.013887	no	VAGINA
chr1_817186_G_A_b38	RP11-206L10.9	-2.971	0.00361	-0.067278	10	0.022643	no	VAGINA
chr1_824320_T_C_b38	RP11-206L10.9	-2.971	0.00361	-0.067278	10	0.022643	no	VAGINA
chr1_825532_C_T_b38	RP11-206L10.9	-2.971	0.00361	-0.067278	10	0.022643	no	VAGINA
chr1_825767_T_C_b38	RP11-206L10.9	-2.971	0.00361	-0.067278	10	0.022643	no	VAGINA
chr1_826577_A_AT_b38	RP11-206L10.9	-2.971	0.00361	-0.067278	10	0.022643	no	VAGINA
chr1_917495_C_T_b38	RP11-206L10.9	-2.931	0.00407	-0.055927	20	0.019083	no	VAGINA
chr1_918574_C_A_b38	RP11-206L10.9	-2.931	0.00407	-0.055927	20	0.019083	no	VAGINA
chr1_1025970_C_T_b38	RP11-206L10.9	2.903	0.00442	0.054231	13	0.01868	no	VAGINA
chr1_1150799_T_C_b38	RP11-206L10.9	2.881	0.00472	0.057214	8	0.019856	no	VAGINA
chr1_1157310_C_T_b38	RP11-206L10.9	2.855	0.00509	0.052348	7	0.018333	no	VAGINA
chr1_1157309_G_A_b38	RP11-206L10.9	2.843	0.00528	0.052516	6	0.018473	no	VAGINA
chr1_1050070_G_A_b38	RP11-206L10.9	2.817	0.0057	0.051356	23	0.01823	no	VAGINA
chr1_1157314_CA_C_b38	RP11-206L10.9	2.813	0.00576	0.057968	6	0.020606	no	VAGINA
chr1_1688647_G_A_b38	RP11-206L10.9	-2.803	0.00593	-0.056296	9	0.020081	no	VAGINA
chr1_1022868_A_G_b38	RP11-206L10.9	2.801	0.00597	0.051383	17	0.018344	no	VAGINA
chr1_619417_C_T_b38	RP11-206L10.9	2.795	0.00607	0.060186	7	0.02153	no	VAGINA
chr1_921096_A_G_b38	RP11-206L10.9	2.742	0.00708	0.051329	18	0.018721	no	VAGINA
chr1_1688619_AAAC_A_b38	RP11-206L10.9	-2.74	0.00712	-0.055555	8	0.020276	no	VAGINA
chr1_1142582_C_T_b38	RP11-206L10.9	-2.704	0.00788	-0.050626	21	0.018722	no	VAGINA
chr1_1025561_G_C_b38	RP11-206L10.9	2.701	0.00794	0.050972	13	0.018869	no	VAGINA
chr1_1688586_C_T_b38	RP11-206L10.9	-2.695	0.00808	-0.057293	6	0.021257	no	VAGINA
chr1_812899_A_T_b38	RP11-206L10.9	2.69	0.0082	0.107026	3	0.039787	no	VAGINA
chr1_789568_TATGGA_T_b38	RP11-206L10.9	-2.684	0.00833	-0.061534	12	0.022923	no	VAGINA
chr1_1705816_A_G_b38	RP11-206L10.9	2.67	0.00867	0.043961	24	0.016463	no	VAGINA
chr1_1026084_G_T_b38	RP11-206L10.9	2.66	0.00893	0.051004	13	0.019176	no	VAGINA
chr1_1057439_G_A_b38	RP11-206L10.9	-2.643	0.00935	-0.046707	26	0.01767	no	VAGINA
chr1_677378_T_C_b38	RP11-206L10.9	8.883	7.54e-18	0.053652	6	0.00604	yes	WHLBLD
chr1_677290_A_G_b38	RP11-206L10.9	8.662	4.29e-17	0.055662	5	0.006426	yes	WHLBLD
chr1_778639_A_G_b38	RP11-206L10.9	8.041	4.77e-15	0.045621	10	0.005673	yes	WHLBLD
chr1_624836_G_A_b38	RP11-206L10.9	8.014	5.84e-15	0.068582	3	0.008558	yes	WHLBLD
chr1_800605_G_A_b38	RP11-206L10.9	7.908	1.26e-14	0.045334	9	0.005733	yes	WHLBLD
chr1_668074_G_A_b38	RP11-206L10.9	7.4	4.64e-13	0.075425	3	0.010193	yes	WHLBLD
chr1_777135_T_TC_b38	RP11-206L10.9	6.957	9.16e-12	0.042811	8	0.006154	yes	WHLBLD
chr1_809641_G_T_b38	RP11-206L10.9	6.72	4.22e-11	0.03768	14	0.005607	yes	WHLBLD
chr1_668125_A_C_b38	RP11-206L10.9	6.675	5.65e-11	0.072578	3	0.010873	yes	WHLBLD
chr1_813498_G_T_b38	RP11-206L10.9	-6.548	1.26e-10	-0.026365	41	0.004027	yes	WHLBLD
chr1_649157_C_T_b38	RP11-206L10.9	6.387	3.41e-10	0.045266	3	0.007088	yes	WHLBLD
chr1_789568_TATGGA_T_b38	RP11-206L10.9	-6.238	8.39e-10	-0.025821	50	0.004139	yes	WHLBLD
chr1_818094_C_G_b38	RP11-206L10.9	-6.213	9.75e-10	-0.026547	51	0.004273	yes	WHLBLD
chr1_817514_T_C_b38	RP11-206L10.9	-6.139	1.51e-09	-0.025898	25	0.004218	yes	WHLBLD
chr1_819584_C_T_b38	RP11-206L10.9	-6.036	2.78e-09	-0.025863	34	0.004285	yes	WHLBLD
chr1_794299_C_G_b38	RP11-206L10.9	-5.984	3.75e-09	-0.025231	44	0.004217	yes	WHLBLD
chr1_683167_G_A_b38	RP11-206L10.9	5.981	3.82e-09	0.031628	8	0.005288	yes	WHLBLD
chr1_598854_C_T_b38	RP11-206L10.9	5.941	4.81e-09	0.04172	3	0.007023	yes	WHLBLD
chr1_817341_A_G_b38	RP11-206L10.9	-5.921	5.38e-09	-0.025358	38	0.004282	yes	WHLBLD
chr1_819123_G_A_b38	RP11-206L10.9	-5.904	5.95e-09	-0.025241	34	0.004275	yes	WHLBLD
chr1_820560_C_T_b38	RP11-206L10.9	-5.772	1.25e-08	-0.023861	32	0.004134	yes	WHLBLD
chr1_817186_G_A_b38	RP11-206L10.9	-5.699	1.89e-08	-0.024557	30	0.004309	yes	WHLBLD
chr1_825532_C_T_b38	RP11-206L10.9	-5.546	4.39e-08	-0.02395	25	0.004319	yes	WHLBLD
chr1_825767_T_C_b38	RP11-206L10.9	-5.546	4.39e-08	-0.02395	25	0.004319	yes	WHLBLD
chr1_824320_T_C_b38	RP11-206L10.9	-5.535	4.65e-08	-0.023499	28	0.004245	yes	WHLBLD
chr1_826577_A_AT_b38	RP11-206L10.9	-5.289	1.73e-07	-0.02253	27	0.00426	yes	WHLBLD
chr1_791564_C_G_b38	RP11-206L10.9	-4.748	2.57e-06	-0.01843	75	0.003882	yes	WHLBLD
chr1_826420_A_T_b38	RP11-206L10.9	-3.951	8.71e-05	-0.014214	69	0.003598	yes	WHLBLD
chr1_1297213_G_A_b38	RP11-206L10.9	3.882	0.000115	0.036352	9	0.009363	yes	WHLBLD
chr1_771398_G_A_b38	RP11-206L10.9	-3.82	0.000148	-0.014656	92	0.003837	yes	WHLBLD
chr1_814476_C_T_b38	RP11-206L10.9	-3.728	0.000211	-0.015882	31	0.00426	yes	WHLBLD
chr1_822427_CCCTGGCCAGCAGATCCACCCTGTCTATACTACCTG_C_b38	RP11-206L10.9	-3.607	0.000336	-0.014533	37	0.004029	yes	WHLBLD
chr1_808924_C_T_b38	RP11-206L10.9	-3.337	9e-04	-0.015365	14	0.004605	yes	WHLBLD
chr1_1297167_G_T_b38	RP11-206L10.9	3.276	0.00111	0.031126	9	0.009502	yes	WHLBLD
chr1_1297168_C_T_b38	RP11-206L10.9	3.276	0.00111	0.031126	9	0.009502	yes	WHLBLD
chr1_1297163_A_G_b38	RP11-206L10.9	3.219	0.00135	0.030002	10	0.009319	yes	WHLBLD
chr1_821000_T_A_b38	RP11-206L10.9	-3.217	0.00136	-0.013841	27	0.004302	yes	WHLBLD
chr1_102075_G_A_b38	RP11-206L10.9	-3.182	0.00154	-0.040374	3	0.01269	yes	WHLBLD
chr1_624767_T_G_b38	RP11-206L10.9	3.168	0.00161	0.015261	4	0.004818	yes	WHLBLD
chr1_509574_T_C_b38	RP11-206L10.9	-3.073	0.00222	-0.022485	5	0.007318	yes	WHLBLD
chr1_823246_C_T_b38	RP11-206L10.9	-3.065	0.00228	-0.013843	26	0.004517	yes	WHLBLD
chr1_1428033_GGA_G_b38	RP11-206L10.9	-3.056	0.00234	-0.03628	5	0.011871	yes	WHLBLD
chr1_1763634_AAG_A_b38	RP11-206L10.9	-3.014	0.00269	-0.011175	116	0.003707	yes	WHLBLD
chr1_1293731_A_ACGCCCCTGCCCTGGAGGCCCCGCCCCTGCCCTGGAGGCCC_b38	RP11-206L10.9	3.012	0.00271	0.022008	6	0.007308	yes	WHLBLD
chr1_599294_T_G_b38	RP11-206L10.9	3.002	0.0028	0.026487	4	0.008824	yes	WHLBLD
chr1_1285621_A_G_b38	RP11-206L10.9	2.98	0.003	0.032365	4	0.01086	yes	WHLBLD
chr1_933411_C_T_b38	RP11-206L10.9	-2.93	0.00352	-0.025039	8	0.008546	yes	WHLBLD
chr1_624509_A_G_b38	RP11-206L10.9	2.902	0.00384	0.01233	14	0.004248	yes	WHLBLD
chr1_602067_A_G_b38	RP11-206L10.9	-2.882	0.0041	-0.014256	3	0.004947	yes	WHLBLD
chr1_1286671_A_G_b38	RP11-206L10.9	2.823	0.00492	0.030693	4	0.010874	yes	WHLBLD
chr1_667265_C_T_b38	RP11-206L10.9	2.779	0.00563	0.014269	45	0.005135	yes	WHLBLD
chr1_653516_C_T_b38	RP11-206L10.9	2.768	0.00581	0.020326	4	0.007343	yes	WHLBLD
chr1_1657926_A_AAG_b38	RP11-206L10.9	2.76	0.00597	0.024688	6	0.008946	yes	WHLBLD
chr1_1297194_CGT_C_b38	RP11-206L10.9	2.753	0.00608	0.035556	3	0.012914	yes	WHLBLD
chr1_1007325_A_G_b38	RP11-206L10.9	2.708	0.00696	0.024831	10	0.009169	yes	WHLBLD
chr1_888125_T_C_b38	RP11-206L10.9	2.697	0.00719	0.013719	8	0.005087	yes	WHLBLD
chr1_828014_G_A_b38	RP11-206L10.9	-2.695	0.00724	-0.014938	45	0.005544	yes	WHLBLD
chr1_1297187_A_G_b38	RP11-206L10.9	2.683	0.0075	0.021261	9	0.007924	yes	WHLBLD
chr1_806017_A_G_b38	RP11-206L10.9	2.678	0.00761	0.019612	13	0.007324	yes	WHLBLD
chr1_1424727_C_A_b38	RP11-206L10.9	2.657	0.00808	0.02053	12	0.007725	yes	WHLBLD
chr1_1527386_C_T_b38	RP11-206L10.9	2.62	0.00903	0.017115	29	0.006534	yes	WHLBLD
chr1_602088_G_T_b38	RP11-206L10.9	-2.608	0.00933	-0.012774	5	0.004898	yes	WHLBLD
chr1_788757_T_TAATGGAATGG_b38	RP11-206L10.9	-2.593	0.00973	-0.010073	41	0.003884	yes	WHLBLD
chr1_680742_A_T_b38	RP11-206L10.9	8.552	1.01e-16	0.05786	3	0.006766	no	WHLBLD
chr1_788439_T_A_b38	RP11-206L10.9	8.138	2.32e-15	0.046356	9	0.005696	no	WHLBLD
chr1_788418_CAG_C_b38	RP11-206L10.9	-7.552	1.61e-13	-0.042238	12	0.005593	no	WHLBLD
chr1_783406_A_AT_b38	RP11-206L10.9	7.16	2.37e-12	0.039741	5	0.00555	no	WHLBLD
chr1_681103_T_A_b38	RP11-206L10.9	6.868	1.63e-11	0.049318	4	0.007181	no	WHLBLD
chr1_788511_G_C_b38	RP11-206L10.9	-6.67	5.82e-11	-0.036906	17	0.005533	no	WHLBLD
chr1_779047_G_A_b38	RP11-206L10.9	-6.341	4.49e-10	-0.035319	19	0.00557	no	WHLBLD
chr1_784109_C_CATAAT_b38	RP11-206L10.9	6.084	2.09e-09	0.038369	9	0.006306	no	WHLBLD
chr1_800909_T_A_b38	RP11-206L10.9	5.806	1.04e-08	0.026582	8	0.004579	no	WHLBLD
chr1_812761_G_A_b38	RP11-206L10.9	5.622	2.89e-08	0.03511	8	0.006245	no	WHLBLD
chr1_682706_A_G_b38	RP11-206L10.9	5.243	2.2e-07	0.054255	3	0.010349	no	WHLBLD
chr1_812899_A_T_b38	RP11-206L10.9	5.126	4e-07	0.030728	14	0.005995	no	WHLBLD
chr1_98929_A_G_b38	RP11-206L10.9	4.777	2.24e-06	0.024842	8	0.0052	no	WHLBLD
chr1_598862_C_T_b38	RP11-206L10.9	4.265	2.32e-05	0.019448	7	0.00456	no	WHLBLD
chr1_814619_A_G_b38	RP11-206L10.9	4.131	4.12e-05	0.038093	3	0.009221	no	WHLBLD
chr1_799082_G_A_b38	RP11-206L10.9	-3.779	0.000173	-0.018343	13	0.004854	no	WHLBLD
chr1_814773_T_C_b38	RP11-206L10.9	3.516	0.00047	0.016151	9	0.004593	no	WHLBLD
chr1_807692_C_A_b38	RP11-206L10.9	-3.362	0.000823	-0.023161	11	0.006889	no	WHLBLD
chr1_597685_T_TA_b38	RP11-206L10.9	3.032	0.00254	0.02026	13	0.006682	no	WHLBLD
chr1_807610_C_T_b38	RP11-206L10.9	2.975	0.00305	0.017892	5	0.006015	no	WHLBLD
chr1_789680_A_AGGAATGGAAT_b38	RP11-206L10.9	-2.972	0.00308	-0.010209	76	0.003435	no	WHLBLD
chr1_624752_C_T_b38	RP11-206L10.9	2.951	0.00329	0.014045	6	0.00476	no	WHLBLD
chr1_1605792_C_G_b38	RP11-206L10.9	2.914	0.00371	0.019798	8	0.006795	no	WHLBLD
chr1_257870_A_G_b38	RP11-206L10.9	2.878	0.00414	0.02953	4	0.01026	no	WHLBLD
chr1_257871_C_G_b38	RP11-206L10.9	2.874	0.00419	0.029493	4	0.010261	no	WHLBLD
chr1_591242_C_T_b38	RP11-206L10.9	2.868	0.00428	0.017402	15	0.006069	no	WHLBLD
chr1_1650370_C_CTT_b38	RP11-206L10.9	2.835	0.00474	0.023604	6	0.008326	no	WHLBLD
chr1_1132482_T_G_b38	RP11-206L10.9	-2.738	0.00637	-0.009344	70	0.003413	no	WHLBLD
chr1_455038_T_C_b38	RP11-206L10.9	2.735	0.00642	0.012117	28	0.00443	no	WHLBLD
chr1_791564_C_CGAATG_b38	RP11-206L10.9	2.719	0.00675	0.018358	4	0.006753	no	WHLBLD
chr1_1138569_C_CA_b38	RP11-206L10.9	2.705	0.00703	0.013795	26	0.0051	no	WHLBLD
chr1_1693256_GT_G_b38	RP11-206L10.9	-2.682	0.00751	-0.022892	8	0.008534	no	WHLBLD
chr1_455125_G_T_b38	RP11-206L10.9	2.67	0.0078	0.020794	4	0.007789	no	WHLBLD
chr1_913448_GA_G_b38	RP11-206L10.9	2.617	0.0091	0.023026	11	0.008799	no	WHLBLD

---

Filters:      p-Values >= and <=      Betas >= and <=      Statistic >= and <=      Carriers >= and <=
Positions: left right     Zoom: RP11-206L10.9     Other:     -      +     reset     eQTLs Region
Draw    p-Value Beta Statistic Carriers Beta/sd(t)     Scaling     Sign (red=+, blue-)     Colors: Tissue Sign