RP11-34P13.13 - novel transcript - 1p36.33

Snps	Gene	Statistic	Pvalue	Beta	Carriers	Beta_se	Linear	Tissue
chr1_271276_G_A_b38	RP11-34P13.13	12.624	5.53e-32	0.11842	3	0.00938	yes	ADPSBQ
chr1_94570_T_G_b38	RP11-34P13.13	9.456	1.17e-19	0.097556	4	0.010317	yes	ADPSBQ
chr1_271569_A_G_b38	RP11-34P13.13	8.324	7.85e-16	0.068493	39	0.008228	yes	ADPSBQ
chr1_202170_C_T_b38	RP11-34P13.13	8.003	8.26e-15	0.078854	3	0.009853	yes	ADPSBQ
chr1_265009_A_T_b38	RP11-34P13.13	7.783	3.96e-14	0.063978	35	0.00822	yes	ADPSBQ
chr1_20316_GA_G_b38	RP11-34P13.13	7.409	5.31e-13	0.072953	8	0.009846	yes	ADPSBQ
chr1_19322_C_T_b38	RP11-34P13.13	-7.26	1.45e-12	-0.082596	15	0.011376	yes	ADPSBQ
chr1_271413_C_T_b38	RP11-34P13.13	6.967	1e-11	0.075615	12	0.010853	yes	ADPSBQ
chr1_280674_A_G_b38	RP11-34P13.13	6.939	1.2e-11	0.077347	4	0.011147	yes	ADPSBQ
chr1_273824_G_T_b38	RP11-34P13.13	6.869	1.88e-11	0.055	40	0.008007	yes	ADPSBQ
chr1_269588_A_G_b38	RP11-34P13.13	6.276	7.44e-10	0.050729	74	0.008083	yes	ADPSBQ
chr1_107970_G_A_b38	RP11-34P13.13	6.192	1.22e-09	0.060125	3	0.00971	yes	ADPSBQ
chr1_282551_T_C_b38	RP11-34P13.13	5.905	6.46e-09	0.054875	22	0.009294	yes	ADPSBQ
chr1_280592_T_C_b38	RP11-34P13.13	5.902	6.56e-09	0.053499	26	0.009065	yes	ADPSBQ
chr1_280599_T_C_b38	RP11-34P13.13	5.546	4.7e-08	0.054	14	0.009737	yes	ADPSBQ
chr1_92930_G_T_b38	RP11-34P13.13	5.536	4.96e-08	0.091109	6	0.016458	yes	ADPSBQ
chr1_280726_A_AACACACACAC_b38	RP11-34P13.13	5.365	1.23e-07	0.07409	8	0.01381	yes	ADPSBQ
chr1_272680_G_A_b38	RP11-34P13.13	5.12	4.35e-07	0.054931	12	0.01073	yes	ADPSBQ
chr1_274015_A_G_b38	RP11-34P13.13	5.098	4.86e-07	0.055766	42	0.01094	yes	ADPSBQ
chr1_282616_G_GA_b38	RP11-34P13.13	5.095	4.92e-07	0.047432	17	0.00931	yes	ADPSBQ
chr1_282607_G_A_b38	RP11-34P13.13	5.061	5.82e-07	0.046843	17	0.009255	yes	ADPSBQ
chr1_264681_A_G_b38	RP11-34P13.13	5.017	7.27e-07	0.060056	14	0.011972	yes	ADPSBQ
chr1_272548_A_C_b38	RP11-34P13.13	5.012	7.46e-07	0.058549	39	0.011683	yes	ADPSBQ
chr1_286158_A_G_b38	RP11-34P13.13	5.008	7.6e-07	0.050503	12	0.010085	yes	ADPSBQ
chr1_284741_A_C_b38	RP11-34P13.13	4.745	2.71e-06	0.074875	7	0.015778	yes	ADPSBQ
chr1_271147_T_G_b38	RP11-34P13.13	4.621	4.85e-06	0.055772	29	0.01207	yes	ADPSBQ
chr1_272505_C_G_b38	RP11-34P13.13	4.364	1.55e-05	0.046526	32	0.010662	yes	ADPSBQ
chr1_20547_A_G_b38	RP11-34P13.13	4.281	2.23e-05	0.044207	6	0.010327	yes	ADPSBQ
chr1_282721_A_G_b38	RP11-34P13.13	4.107	4.66e-05	0.041959	7	0.010216	yes	ADPSBQ
chr1_269781_C_T_b38	RP11-34P13.13	-4.053	5.85e-05	-0.041589	3	0.010262	yes	ADPSBQ
chr1_277834_G_A_b38	RP11-34P13.13	3.984	7.75e-05	0.06002	20	0.015064	yes	ADPSBQ
chr1_94271_C_G_b38	RP11-34P13.13	3.95	8.92e-05	0.033413	77	0.00846	yes	ADPSBQ
chr1_286388_A_G_b38	RP11-34P13.13	3.898	0.00011	0.056498	5	0.014495	yes	ADPSBQ
chr1_282728_T_C_b38	RP11-34P13.13	3.753	0.000195	0.038178	7	0.010173	yes	ADPSBQ
chr1_715769_C_T_b38	RP11-34P13.13	3.712	0.000228	0.051101	21	0.013765	yes	ADPSBQ
chr1_272488_C_G_b38	RP11-34P13.13	3.671	0.000267	0.035369	32	0.009635	yes	ADPSBQ
chr1_264730_T_A_b38	RP11-34P13.13	3.581	0.000375	0.059475	23	0.016609	yes	ADPSBQ
chr1_101225_C_A_b38	RP11-34P13.13	3.57	0.00039	0.032472	23	0.009095	yes	ADPSBQ
chr1_286145_C_CAT_b38	RP11-34P13.13	3.544	0.00043	0.035831	11	0.01011	yes	ADPSBQ
chr1_284929_A_G_b38	RP11-34P13.13	3.446	0.000617	0.049529	9	0.014374	yes	ADPSBQ
chr1_1160003_G_A_b38	RP11-34P13.13	3.418	0.000681	0.028437	37	0.00832	yes	ADPSBQ
chr1_288130_T_C_b38	RP11-34P13.13	-3.299	0.00104	-0.03118	17	0.009452	yes	ADPSBQ
chr1_16103_T_G_b38	RP11-34P13.13	3.287	0.00108	0.026544	51	0.008076	yes	ADPSBQ
chr1_187887_C_G_b38	RP11-34P13.13	3.233	0.0013	0.035191	3	0.010885	yes	ADPSBQ
chr1_285175_C_T_b38	RP11-34P13.13	3.126	0.00187	0.036053	13	0.011533	yes	ADPSBQ
chr1_260937_C_T_b38	RP11-34P13.13	3.108	0.00199	0.041284	8	0.013282	yes	ADPSBQ
chr1_272164_G_A_b38	RP11-34P13.13	3.062	0.00231	0.033531	49	0.01095	yes	ADPSBQ
chr1_1065910_C_T_b38	RP11-34P13.13	-2.906	0.00382	-0.037228	6	0.01281	yes	ADPSBQ
chr1_271578_AT_A_b38	RP11-34P13.13	-2.846	0.0046	-0.030779	4	0.010814	yes	ADPSBQ
chr1_16378_T_C_b38	RP11-34P13.13	-2.842	0.00466	-0.036007	18	0.012669	yes	ADPSBQ
chr1_272675_G_A_b38	RP11-34P13.13	-2.766	0.00588	-0.026532	19	0.009592	yes	ADPSBQ
chr1_860178_C_CTTTTTTT_b38	RP11-34P13.13	2.738	0.00639	0.034821	5	0.012717	yes	ADPSBQ
chr1_271931_T_C_b38	RP11-34P13.13	2.674	0.00773	0.02785	11	0.010414	yes	ADPSBQ
chr1_278075_T_C_b38	RP11-34P13.13	2.609	0.00934	0.059503	4	0.022803	yes	ADPSBQ
chr1_271102_G_A_b38	RP11-34P13.13	2.606	0.00943	0.027709	5	0.010633	yes	ADPSBQ
chr1_518864_T_A_b38	RP11-34P13.13	11.666	4.86e-28	0.121609	5	0.010424	no	ADPSBQ
chr1_187323_G_A_b38	RP11-34P13.13	-7.288	1.2e-12	-0.071881	6	0.009862	no	ADPSBQ
chr1_13613_T_A_b38	RP11-34P13.13	-6.563	1.3e-10	-0.068205	5	0.010392	no	ADPSBQ
chr1_187331_C_G_b38	RP11-34P13.13	-5.769	1.39e-08	-0.057205	10	0.009917	no	ADPSBQ
chr1_272378_A_T_b38	RP11-34P13.13	5.217	2.66e-07	0.084512	13	0.016201	no	ADPSBQ
chr1_19980_G_A_b38	RP11-34P13.13	5.023	7.06e-07	0.085179	5	0.016959	no	ADPSBQ
chr1_272389_C_T_b38	RP11-34P13.13	4.945	1.03e-06	0.073424	26	0.014847	no	ADPSBQ
chr1_280198_C_A_b38	RP11-34P13.13	4.468	9.74e-06	0.06382	6	0.014284	no	ADPSBQ
chr1_272512_A_G_b38	RP11-34P13.13	4.404	1.3e-05	0.048654	32	0.011048	no	ADPSBQ
chr1_278165_CAGG_C_b38	RP11-34P13.13	-3.213	0.00139	-0.031023	12	0.009654	no	ADPSBQ
chr1_183598_C_G_b38	RP11-34P13.13	-2.767	0.00587	-0.02902	3	0.010488	no	ADPSBQ
chr1_1002415_C_CATT_b38	RP11-34P13.13	-2.675	0.00771	-0.043416	12	0.016229	no	ADPSBQ
chr1_518864_T_A_b38	RP11-34P13.13	10.88	2.59e-24	0.139049	4	0.01278	yes	ADPVSC
chr1_94570_T_G_b38	RP11-34P13.13	8.304	1.59e-15	0.097463	5	0.011737	yes	ADPVSC
chr1_20316_GA_G_b38	RP11-34P13.13	8.276	1.95e-15	0.088728	6	0.010721	yes	ADPVSC
chr1_19322_C_T_b38	RP11-34P13.13	-6.914	1.89e-11	-0.094248	11	0.013632	yes	ADPVSC
chr1_271569_A_G_b38	RP11-34P13.13	6.669	8.62e-11	0.06769	28	0.010149	yes	ADPVSC
chr1_107970_G_A_b38	RP11-34P13.13	5.721	2.09e-08	0.063233	3	0.011053	yes	ADPVSC
chr1_284741_A_C_b38	RP11-34P13.13	5.718	2.12e-08	0.097289	6	0.017014	yes	ADPVSC
chr1_265009_A_T_b38	RP11-34P13.13	5.317	1.76e-07	0.051115	27	0.009614	yes	ADPVSC
chr1_269588_A_G_b38	RP11-34P13.13	5.073	6.01e-07	0.049742	61	0.009805	yes	ADPVSC
chr1_280198_C_A_b38	RP11-34P13.13	4.891	1.46e-06	0.082654	5	0.016901	yes	ADPVSC
chr1_285109_CAA_C_b38	RP11-34P13.13	4.816	2.08e-06	0.109422	3	0.02272	yes	ADPVSC
chr1_273824_G_T_b38	RP11-34P13.13	4.749	2.86e-06	0.04565	27	0.009612	yes	ADPVSC
chr1_92930_G_T_b38	RP11-34P13.13	4.551	7.11e-06	0.094927	5	0.020859	yes	ADPVSC
chr1_13613_T_A_b38	RP11-34P13.13	-4.439	1.17e-05	-0.051774	7	0.011663	yes	ADPVSC
chr1_264681_A_G_b38	RP11-34P13.13	4.417	1.29e-05	0.062537	10	0.014159	yes	ADPVSC
chr1_280599_T_C_b38	RP11-34P13.13	4.35	1.73e-05	0.049577	11	0.011396	yes	ADPVSC
chr1_280726_A_AACACACACAC_b38	RP11-34P13.13	4.269	2.46e-05	0.070131	5	0.01643	yes	ADPVSC
chr1_271147_T_G_b38	RP11-34P13.13	4.191	3.42e-05	0.058902	23	0.014054	yes	ADPVSC
chr1_264730_T_A_b38	RP11-34P13.13	4.123	4.55e-05	0.088826	16	0.021544	yes	ADPVSC
chr1_280592_T_C_b38	RP11-34P13.13	4.036	6.51e-05	0.042477	18	0.010523	yes	ADPVSC
chr1_282728_T_C_b38	RP11-34P13.13	3.914	0.000107	0.045758	3	0.011692	yes	ADPVSC
chr1_282721_A_G_b38	RP11-34P13.13	3.821	0.000154	0.043979	3	0.01151	yes	ADPVSC
chr1_272378_A_T_b38	RP11-34P13.13	3.777	0.000183	0.074969	11	0.019851	yes	ADPVSC
chr1_272389_C_T_b38	RP11-34P13.13	3.646	0.000302	0.070043	13	0.019212	yes	ADPVSC
chr1_272164_G_A_b38	RP11-34P13.13	3.61	0.000345	0.044485	37	0.012321	yes	ADPVSC
chr1_282551_T_C_b38	RP11-34P13.13	3.548	0.000435	0.039607	14	0.011164	yes	ADPVSC
chr1_286158_A_G_b38	RP11-34P13.13	3.513	0.000495	0.041905	8	0.01193	yes	ADPVSC
chr1_260937_C_T_b38	RP11-34P13.13	3.41	0.000715	0.052356	5	0.015352	yes	ADPVSC
chr1_284929_A_G_b38	RP11-34P13.13	2.956	0.0033	0.054489	7	0.018434	yes	ADPVSC
chr1_272548_A_C_b38	RP11-34P13.13	2.91	0.00381	0.041842	27	0.014376	yes	ADPVSC
chr1_271578_AT_A_b38	RP11-34P13.13	-2.875	0.00425	-0.034642	5	0.012048	yes	ADPVSC
chr1_278165_CAGG_C_b38	RP11-34P13.13	-2.761	0.00603	-0.031036	9	0.011241	yes	ADPVSC
chr1_98993_G_A_b38	RP11-34P13.13	-2.729	0.00664	-0.035277	8	0.012928	yes	ADPVSC
chr1_601673_G_A_b38	RP11-34P13.13	-2.714	0.00693	-0.04272	3	0.01574	yes	ADPVSC
chr1_282616_G_GA_b38	RP11-34P13.13	2.599	0.0097	0.029061	9	0.011183	yes	ADPVSC
chr1_187323_G_A_b38	RP11-34P13.13	-6.744	5.43e-11	-0.081321	4	0.012058	no	ADPVSC
chr1_271413_C_T_b38	RP11-34P13.13	5.842	1.07e-08	0.071551	12	0.012248	no	ADPVSC
chr1_187331_C_G_b38	RP11-34P13.13	-5.255	2.42e-07	-0.06593	7	0.012547	no	ADPVSC
chr1_274015_A_G_b38	RP11-34P13.13	4.414	1.31e-05	0.057643	29	0.013059	no	ADPVSC
chr1_20547_A_G_b38	RP11-34P13.13	4.247	2.7e-05	0.052248	4	0.012302	no	ADPVSC
chr1_285109_CA_C_b38	RP11-34P13.13	-3.54	0.000447	-0.051146	3	0.014447	no	ADPVSC
chr1_715769_C_T_b38	RP11-34P13.13	3.494	0.00053	0.056596	15	0.0162	no	ADPVSC
chr1_19980_G_A_b38	RP11-34P13.13	2.988	0.00298	0.058995	4	0.019743	no	ADPVSC
chr1_285441_C_T_b38	RP11-34P13.13	2.963	0.00323	0.035513	3	0.011987	no	ADPVSC
chr1_94271_C_G_b38	RP11-34P13.13	2.932	0.00356	0.028636	65	0.009766	no	ADPVSC
chr1_16103_T_G_b38	RP11-34P13.13	2.671	0.00788	0.025107	37	0.009401	no	ADPVSC
chr1_97624_G_C_b38	RP11-34P13.13	2.639	0.00864	0.049833	4	0.018883	no	ADPVSC
chr1_674562_T_C_b38	RP11-34P13.13	2.637	0.0087	0.027171	15	0.010305	no	ADPVSC
chr1_271569_A_G_b38	RP11-34P13.13	5.672	5.12e-08	0.060735	7	0.010707	yes	ADRNLG
chr1_272548_A_C_b38	RP11-34P13.13	4.603	7.55e-06	0.06955	11	0.015109	yes	ADRNLG
chr1_271413_C_T_b38	RP11-34P13.13	4.276	3e-05	0.062821	5	0.014692	yes	ADRNLG
chr1_274015_A_G_b38	RP11-34P13.13	4.27	3.07e-05	0.052973	13	0.012405	yes	ADRNLG
chr1_273824_G_T_b38	RP11-34P13.13	3.836	0.00017	0.039495	12	0.010297	yes	ADRNLG
chr1_280592_T_C_b38	RP11-34P13.13	3.729	0.000253	0.042932	6	0.011514	yes	ADRNLG
chr1_269588_A_G_b38	RP11-34P13.13	3.628	0.000367	0.038371	19	0.010578	yes	ADRNLG
chr1_272164_G_A_b38	RP11-34P13.13	3.546	0.000491	0.045247	20	0.01276	yes	ADRNLG
chr1_265009_A_T_b38	RP11-34P13.13	3.41	0.000791	0.035937	10	0.010537	yes	ADRNLG
chr1_284929_A_G_b38	RP11-34P13.13	3.382	0.000872	0.055466	3	0.016401	yes	ADRNLG
chr1_280599_T_C_b38	RP11-34P13.13	3.329	0.00104	0.039248	5	0.011788	yes	ADRNLG
chr1_1130879_G_C_b38	RP11-34P13.13	3.14	0.00196	0.038615	3	0.012298	yes	ADRNLG
chr1_1002417_T_A_b38	RP11-34P13.13	2.924	0.00387	0.032561	11	0.011135	yes	ADRNLG
chr1_272505_C_G_b38	RP11-34P13.13	2.874	0.00451	0.040938	10	0.014245	yes	ADRNLG
chr1_264681_A_G_b38	RP11-34P13.13	2.827	0.00519	0.038189	4	0.013507	yes	ADRNLG
chr1_13613_T_A_b38	RP11-34P13.13	-2.77	0.00616	-0.033126	3	0.01196	yes	ADRNLG
chr1_271931_T_C_b38	RP11-34P13.13	2.696	0.00764	0.030792	9	0.011421	yes	ADRNLG
chr1_98993_G_A_b38	RP11-34P13.13	-2.693	0.0077	-0.037304	3	0.013851	yes	ADRNLG
chr1_272512_A_G_b38	RP11-34P13.13	2.645	0.00883	0.038624	10	0.0146	yes	ADRNLG
chr1_285175_C_T_b38	RP11-34P13.13	2.637	0.00904	0.037262	5	0.014128	yes	ADRNLG
chr1_272378_A_T_b38	RP11-34P13.13	3.824	0.000178	0.080745	6	0.021117	no	ADRNLG
chr1_19322_C_T_b38	RP11-34P13.13	-3.54	0.000501	-0.055029	3	0.015543	no	ADRNLG
chr1_260937_C_T_b38	RP11-34P13.13	3.045	0.00265	0.048165	3	0.015817	no	ADRNLG
chr1_15118_A_G_b38	RP11-34P13.13	-2.889	0.00431	-0.033333	7	0.011537	no	ADRNLG
chr1_272389_C_T_b38	RP11-34P13.13	2.863	0.00466	0.052853	13	0.018461	no	ADRNLG
chr1_518864_T_A_b38	RP11-34P13.13	10.599	1.17e-22	0.137963	3	0.013017	yes	ARTAORT
chr1_271569_A_G_b38	RP11-34P13.13	7.11	7.78e-12	0.076206	22	0.010718	yes	ARTAORT
chr1_271413_C_T_b38	RP11-34P13.13	6.868	3.47e-11	0.090376	8	0.013159	yes	ARTAORT
chr1_280592_T_C_b38	RP11-34P13.13	6.037	4.4e-09	0.067965	17	0.011258	yes	ARTAORT
chr1_265009_A_T_b38	RP11-34P13.13	5.657	3.46e-08	0.059221	22	0.010469	yes	ARTAORT
chr1_280599_T_C_b38	RP11-34P13.13	5.315	2.02e-07	0.064006	11	0.012043	yes	ARTAORT
chr1_269588_A_G_b38	RP11-34P13.13	5.304	2.14e-07	0.055745	46	0.010511	yes	ARTAORT
chr1_274015_A_G_b38	RP11-34P13.13	4.654	4.8e-06	0.062637	25	0.013459	yes	ARTAORT
chr1_20547_A_G_b38	RP11-34P13.13	4.218	3.22e-05	0.05379	5	0.012753	yes	ARTAORT
chr1_272548_A_C_b38	RP11-34P13.13	4.113	4.99e-05	0.063153	20	0.015355	yes	ARTAORT
chr1_19322_C_T_b38	RP11-34P13.13	-3.861	0.000137	-0.056278	11	0.014576	yes	ARTAORT
chr1_260937_C_T_b38	RP11-34P13.13	3.855	0.00014	0.065921	3	0.017102	yes	ARTAORT
chr1_284741_A_C_b38	RP11-34P13.13	3.845	0.000146	0.074552	5	0.019388	yes	ARTAORT
chr1_271147_T_G_b38	RP11-34P13.13	3.797	0.000176	0.059329	13	0.015625	yes	ARTAORT
chr1_258038_T_C_b38	RP11-34P13.13	3.739	0.000219	0.106846	3	0.028576	yes	ARTAORT
chr1_272389_C_T_b38	RP11-34P13.13	3.686	0.000268	0.073795	16	0.020021	yes	ARTAORT
chr1_280726_A_AACACACACAC_b38	RP11-34P13.13	3.633	0.000327	0.062271	5	0.017141	yes	ARTAORT
chr1_284929_A_G_b38	RP11-34P13.13	3.619	0.000344	0.063763	6	0.017617	yes	ARTAORT
chr1_264681_A_G_b38	RP11-34P13.13	3.491	0.000551	0.053709	5	0.015387	yes	ARTAORT
chr1_273824_G_T_b38	RP11-34P13.13	3.456	0.000622	0.035868	22	0.010377	yes	ARTAORT
chr1_278165_CAGG_C_b38	RP11-34P13.13	-3.233	0.00135	-0.039226	7	0.012132	yes	ARTAORT
chr1_98993_G_A_b38	RP11-34P13.13	-3.149	0.00179	-0.04369	4	0.013872	yes	ARTAORT
chr1_1163962_A_C_b38	RP11-34P13.13	3.143	0.00183	0.048923	5	0.015566	yes	ARTAORT
chr1_272505_C_G_b38	RP11-34P13.13	3.072	0.00231	0.044031	15	0.014331	yes	ARTAORT
chr1_1157219_G_C_b38	RP11-34P13.13	3.002	0.00289	0.043741	9	0.014568	yes	ARTAORT
chr1_272164_G_A_b38	RP11-34P13.13	3.001	0.00291	0.040544	30	0.013511	yes	ARTAORT
chr1_257870_A_G_b38	RP11-34P13.13	2.967	0.00323	0.079603	3	0.026825	yes	ARTAORT
chr1_257871_C_G_b38	RP11-34P13.13	2.963	0.00328	0.079459	3	0.026819	yes	ARTAORT
chr1_715769_C_T_b38	RP11-34P13.13	2.958	0.00333	0.053721	13	0.018159	yes	ARTAORT
chr1_285175_C_T_b38	RP11-34P13.13	2.941	0.00352	0.041559	11	0.014132	yes	ARTAORT
chr1_272512_A_G_b38	RP11-34P13.13	2.866	0.00444	0.044229	15	0.015432	yes	ARTAORT
chr1_1028341_T_C_b38	RP11-34P13.13	-2.848	0.00469	-0.035206	3	0.012361	yes	ARTAORT
chr1_16103_T_G_b38	RP11-34P13.13	2.844	0.00475	0.029571	29	0.010398	yes	ARTAORT
chr1_1152303_T_C_b38	RP11-34P13.13	2.737	0.00655	0.040271	8	0.014713	yes	ARTAORT
chr1_272488_C_G_b38	RP11-34P13.13	2.68	0.00775	0.034167	15	0.012748	yes	ARTAORT
chr1_282551_T_C_b38	RP11-34P13.13	2.651	0.00843	0.031425	11	0.011854	yes	ARTAORT
chr1_94570_T_G_b38	RP11-34P13.13	8.213	5.6e-15	0.101693	4	0.012383	no	ARTAORT
chr1_20316_GA_G_b38	RP11-34P13.13	7.168	5.41e-12	0.085655	5	0.011949	no	ARTAORT
chr1_187323_G_A_b38	RP11-34P13.13	-6.194	1.82e-09	-0.077204	3	0.012463	no	ARTAORT
chr1_13613_T_A_b38	RP11-34P13.13	-5.057	7.24e-07	-0.062998	6	0.012458	no	ARTAORT
chr1_286158_A_G_b38	RP11-34P13.13	4.656	4.75e-06	0.064234	4	0.013796	no	ARTAORT
chr1_187331_C_G_b38	RP11-34P13.13	-4.597	6.22e-06	-0.059361	5	0.012914	no	ARTAORT
chr1_272378_A_T_b38	RP11-34P13.13	4.422	1.34e-05	0.098477	6	0.022267	no	ARTAORT
chr1_92930_G_T_b38	RP11-34P13.13	3.787	0.000182	0.081431	4	0.021501	no	ARTAORT
chr1_280198_C_A_b38	RP11-34P13.13	3.447	0.000643	0.061725	3	0.017906	no	ARTAORT
chr1_1163440_TC_T_b38	RP11-34P13.13	3.434	0.000675	0.05235	5	0.015247	no	ARTAORT
chr1_1161528_T_C_b38	RP11-34P13.13	3.077	0.00228	0.047221	6	0.015348	no	ARTAORT
chr1_1161907_T_C_b38	RP11-34P13.13	3.077	0.00228	0.047221	6	0.015348	no	ARTAORT
chr1_1161955_T_G_b38	RP11-34P13.13	3.077	0.00228	0.047221	6	0.015348	no	ARTAORT
chr1_278075_T_C_b38	RP11-34P13.13	3.074	0.00229	0.083119	3	0.027036	no	ARTAORT
chr1_1161720_C_T_b38	RP11-34P13.13	3.036	0.00259	0.046471	6	0.015304	no	ARTAORT
chr1_1162027_CCCCA_C_b38	RP11-34P13.13	3.036	0.00259	0.046471	6	0.015304	no	ARTAORT
chr1_207150_T_G_b38	RP11-34P13.13	-2.799	0.00543	-0.032309	11	0.011541	no	ARTAORT
chr1_1131430_C_CTTTTTTTTTTTTTTT_b38	RP11-34P13.13	2.742	0.00646	0.027505	47	0.010032	no	ARTAORT
chr1_1154630_C_A_b38	RP11-34P13.13	2.644	0.00861	0.038083	9	0.014405	no	ARTAORT
chr1_271569_A_G_b38	RP11-34P13.13	5.708	4.92e-08	0.082617	12	0.014475	yes	ARTCRN
chr1_269588_A_G_b38	RP11-34P13.13	4.465	1.44e-05	0.058386	31	0.013075	yes	ARTCRN
chr1_280599_T_C_b38	RP11-34P13.13	4.235	3.71e-05	0.068523	8	0.016179	yes	ARTCRN
chr1_280198_C_A_b38	RP11-34P13.13	3.835	0.000176	0.095861	3	0.024999	yes	ARTCRN
chr1_20547_A_G_b38	RP11-34P13.13	3.722	0.000268	0.06507	3	0.017485	yes	ARTCRN
chr1_282607_G_A_b38	RP11-34P13.13	3.439	0.000732	0.05473	7	0.015914	yes	ARTCRN
chr1_94271_C_G_b38	RP11-34P13.13	3.406	0.000819	0.049062	30	0.014403	yes	ARTCRN
chr1_280592_T_C_b38	RP11-34P13.13	3.283	0.00124	0.052733	9	0.016061	yes	ARTCRN
chr1_282616_G_GA_b38	RP11-34P13.13	3.158	0.00187	0.052355	5	0.016576	yes	ARTCRN
chr1_265009_A_T_b38	RP11-34P13.13	3.142	0.00198	0.048489	13	0.015432	yes	ARTCRN
chr1_265261_G_A_b38	RP11-34P13.13	3.09	0.00233	0.048635	12	0.01574	yes	ARTCRN
chr1_187331_C_G_b38	RP11-34P13.13	-3.049	0.00266	-0.052381	5	0.017182	yes	ARTCRN
chr1_271413_C_T_b38	RP11-34P13.13	3.004	0.00306	0.055871	6	0.0186	yes	ARTCRN
chr1_207150_T_G_b38	RP11-34P13.13	-2.927	0.00389	-0.047773	7	0.016322	yes	ARTCRN
chr1_272548_A_C_b38	RP11-34P13.13	2.832	0.00518	0.064543	15	0.02279	yes	ARTCRN
chr1_272164_G_A_b38	RP11-34P13.13	2.817	0.00541	0.050805	22	0.018034	yes	ARTCRN
chr1_277834_G_A_b38	RP11-34P13.13	2.809	0.00554	0.086781	7	0.03089	yes	ARTCRN
chr1_101268_G_A_b38	RP11-34P13.13	-2.802	0.00567	-0.041108	12	0.014672	yes	ARTCRN
chr1_1168009_GGGGCGGAGGGCCGAGCGGGGCCAGCAGACGGGTGA_G_b38	RP11-34P13.13	2.775	0.00612	0.030225	13	0.01089	yes	ARTCRN
chr1_274015_A_G_b38	RP11-34P13.13	2.719	0.00722	0.050144	16	0.018442	yes	ARTCRN
chr1_284929_A_G_b38	RP11-34P13.13	2.662	0.0085	0.061562	5	0.023126	yes	ARTCRN
chr1_272389_C_T_b38	RP11-34P13.13	2.718	0.00724	0.081353	5	0.02993	no	ARTCRN
chr1_518864_T_A_b38	RP11-34P13.13	10.524	1.38e-23	0.10023	3	0.009524	yes	ARTTBL
chr1_271569_A_G_b38	RP11-34P13.13	8.307	8.83e-16	0.060734	32	0.007312	yes	ARTTBL
chr1_94570_T_G_b38	RP11-34P13.13	8.152	2.76e-15	0.07022	10	0.008614	yes	ARTTBL
chr1_202170_C_T_b38	RP11-34P13.13	7.364	7.16e-13	0.061259	3	0.008319	yes	ARTTBL
chr1_272378_A_T_b38	RP11-34P13.13	7.307	1.05e-12	0.101022	16	0.013826	yes	ARTTBL
chr1_280674_A_G_b38	RP11-34P13.13	6.439	2.77e-10	0.060807	4	0.009443	yes	ARTTBL
chr1_265009_A_T_b38	RP11-34P13.13	6.426	3e-10	0.045546	30	0.007088	yes	ARTTBL
chr1_280726_A_AACACACACAC_b38	RP11-34P13.13	6.336	5.15e-10	0.072968	8	0.011515	yes	ARTTBL
chr1_20316_GA_G_b38	RP11-34P13.13	6.047	2.85e-09	0.051027	7	0.008439	yes	ARTTBL
chr1_273824_G_T_b38	RP11-34P13.13	6.017	3.39e-09	0.042335	32	0.007036	yes	ARTTBL
chr1_272548_A_C_b38	RP11-34P13.13	5.907	6.34e-09	0.057445	33	0.009724	yes	ARTTBL
chr1_264681_A_G_b38	RP11-34P13.13	5.821	1.03e-08	0.058289	13	0.010014	yes	ARTTBL
chr1_282551_T_C_b38	RP11-34P13.13	5.807	1.11e-08	0.04581	17	0.007888	yes	ARTTBL
chr1_280198_C_A_b38	RP11-34P13.13	5.568	4.16e-08	0.0682	5	0.012249	yes	ARTTBL
chr1_274015_A_G_b38	RP11-34P13.13	5.274	1.97e-07	0.049492	35	0.009383	yes	ARTTBL
chr1_271413_C_T_b38	RP11-34P13.13	5.218	2.63e-07	0.051074	9	0.009788	yes	ARTTBL
chr1_280592_T_C_b38	RP11-34P13.13	5.046	6.26e-07	0.038831	23	0.007695	yes	ARTTBL
chr1_187331_C_G_b38	RP11-34P13.13	-5.012	7.44e-07	-0.04363	8	0.008706	yes	ARTTBL
chr1_286158_A_G_b38	RP11-34P13.13	4.94	1.06e-06	0.043055	7	0.008715	yes	ARTTBL
chr1_280599_T_C_b38	RP11-34P13.13	4.755	2.58e-06	0.038463	16	0.008088	yes	ARTTBL
chr1_271147_T_G_b38	RP11-34P13.13	4.612	5.04e-06	0.047453	22	0.010288	yes	ARTTBL
chr1_284741_A_C_b38	RP11-34P13.13	4.547	6.79e-06	0.063006	6	0.013856	yes	ARTTBL
chr1_260937_C_T_b38	RP11-34P13.13	4.474	9.44e-06	0.048561	9	0.010853	yes	ARTTBL
chr1_92930_G_T_b38	RP11-34P13.13	4.158	3.76e-05	0.059485	7	0.014306	yes	ARTTBL
chr1_715769_C_T_b38	RP11-34P13.13	4.098	4.84e-05	0.046704	18	0.011397	yes	ARTTBL
chr1_271406_C_CTTT_b38	RP11-34P13.13	3.951	8.87e-05	0.07209	3	0.018246	yes	ARTTBL
chr1_282616_G_GA_b38	RP11-34P13.13	3.865	0.000125	0.030739	12	0.007952	yes	ARTTBL
chr1_282607_G_A_b38	RP11-34P13.13	3.843	0.000137	0.030844	11	0.008027	yes	ARTTBL
chr1_633423_C_T_b38	RP11-34P13.13	3.74	0.000205	0.050645	6	0.013541	yes	ARTTBL
chr1_263934_GC_G_b38	RP11-34P13.13	3.626	0.000317	0.028217	19	0.007782	yes	ARTTBL
chr1_20547_A_G_b38	RP11-34P13.13	3.601	0.000347	0.032107	7	0.008916	yes	ARTTBL
chr1_286145_C_CAT_b38	RP11-34P13.13	3.589	0.000363	0.030751	7	0.008567	yes	ARTTBL
chr1_13613_T_A_b38	RP11-34P13.13	-3.563	0.000401	-0.030932	7	0.008681	yes	ARTTBL
chr1_94271_C_G_b38	RP11-34P13.13	3.426	0.000662	0.024698	70	0.007209	yes	ARTTBL
chr1_282728_T_C_b38	RP11-34P13.13	3.138	0.0018	0.026346	6	0.008395	yes	ARTTBL
chr1_1130902_A_G_b38	RP11-34P13.13	3.074	0.00222	0.021448	43	0.006977	yes	ARTTBL
chr1_285175_C_T_b38	RP11-34P13.13	2.906	0.00382	0.02933	11	0.010093	yes	ARTTBL
chr1_815963_T_A_b38	RP11-34P13.13	-2.857	0.00445	-0.025797	10	0.00903	yes	ARTTBL
chr1_285441_C_T_b38	RP11-34P13.13	2.819	0.00501	0.02453	3	0.008703	yes	ARTTBL
chr1_275616_T_C_b38	RP11-34P13.13	2.75	0.00618	0.019702	34	0.007165	yes	ARTTBL
chr1_272680_G_A_b38	RP11-34P13.13	2.711	0.00694	0.025756	8	0.009502	yes	ARTTBL
chr1_282721_A_G_b38	RP11-34P13.13	2.699	0.00718	0.022742	6	0.008425	yes	ARTTBL
chr1_269781_C_T_b38	RP11-34P13.13	-2.689	0.0074	-0.023654	4	0.008797	yes	ARTTBL
chr1_816376_T_C_b38	RP11-34P13.13	-2.616	0.00916	-0.023019	15	0.0088	yes	ARTTBL
chr1_269588_A_G_b38	RP11-34P13.13	7.361	7.3e-13	0.050909	68	0.006916	no	ARTTBL
chr1_272389_C_T_b38	RP11-34P13.13	6.404	3.42e-10	0.080352	32	0.012547	no	ARTTBL
chr1_107970_G_A_b38	RP11-34P13.13	6.34	5.04e-10	0.053035	3	0.008365	no	ARTTBL
chr1_187323_G_A_b38	RP11-34P13.13	-5.595	3.6e-08	-0.048393	5	0.00865	no	ARTTBL
chr1_264730_T_A_b38	RP11-34P13.13	5.385	1.11e-07	0.077917	21	0.014469	no	ARTTBL
chr1_272512_A_G_b38	RP11-34P13.13	5.207	2.78e-07	0.049345	27	0.009477	no	ARTTBL
chr1_272505_C_G_b38	RP11-34P13.13	5.075	5.42e-07	0.04621	27	0.009105	no	ARTTBL
chr1_266093_C_G_b38	RP11-34P13.13	4.862	1.55e-06	0.040418	3	0.008313	no	ARTTBL
chr1_16103_T_G_b38	RP11-34P13.13	4.725	2.97e-06	0.031981	46	0.006768	no	ARTTBL
chr1_272488_C_G_b38	RP11-34P13.13	4.388	1.39e-05	0.036215	27	0.008254	no	ARTTBL
chr1_19322_C_T_b38	RP11-34P13.13	-4.252	2.52e-05	-0.043094	15	0.010136	no	ARTTBL
chr1_278075_T_C_b38	RP11-34P13.13	4.249	2.56e-05	0.090486	3	0.021298	no	ARTTBL
chr1_19980_G_A_b38	RP11-34P13.13	3.774	0.00018	0.052663	5	0.013955	no	ARTTBL
chr1_799082_G_A_b38	RP11-34P13.13	-3.627	0.000316	-0.031691	12	0.008739	no	ARTTBL
chr1_878714_A_G_b38	RP11-34P13.13	2.838	0.00472	0.025698	3	0.009055	no	ARTTBL
chr1_286172_G_GTC_b38	RP11-34P13.13	-2.824	0.00493	-0.023893	14	0.00846	no	ARTTBL
chr1_821099_C_A_b38	RP11-34P13.13	-2.772	0.00577	-0.027338	4	0.009862	no	ARTTBL
chr1_783406_A_AT_b38	RP11-34P13.13	2.724	0.00668	0.028606	5	0.010502	no	ARTTBL
chr1_807641_T_C_b38	RP11-34P13.13	-2.706	0.00705	-0.019285	37	0.007128	no	ARTTBL
chr1_799081_GGA_G_b38	RP11-34P13.13	2.686	0.00746	0.049127	3	0.018289	no	ARTTBL
chr1_280599_T_C_b38	RP11-34P13.13	4.81	4e-06	0.150327	3	0.031254	yes	BRNCHB
chr1_13613_T_A_b38	RP11-34P13.13	-4.596	9.82e-06	-0.154626	3	0.033641	yes	BRNCHB
chr1_280592_T_C_b38	RP11-34P13.13	4.035	9.12e-05	0.111433	9	0.027615	yes	BRNCHB
chr1_286158_A_G_b38	RP11-34P13.13	3.858	0.000177	0.111524	5	0.02891	yes	BRNCHB
chr1_271569_A_G_b38	RP11-34P13.13	3.696	0.000318	0.103972	9	0.028132	yes	BRNCHB
chr1_264681_A_G_b38	RP11-34P13.13	3.657	0.000365	0.136673	6	0.03737	yes	BRNCHB
chr1_109575_CGTGT_C_b38	RP11-34P13.13	3.415	0.000843	0.10293	4	0.030136	yes	BRNCHB
chr1_269588_A_G_b38	RP11-34P13.13	2.979	0.00344	0.078749	24	0.026439	yes	BRNCHB
chr1_187019_G_A_b38	RP11-34P13.13	2.741	0.00697	0.107427	3	0.0392	yes	BRNCHB
chr1_20316_GA_G_b38	RP11-34P13.13	4.715	6e-06	0.156036	3	0.033097	no	BRNCHB
chr1_94570_T_G_b38	RP11-34P13.13	4.064	8.18e-05	0.126632	3	0.031162	no	BRNCHB
chr1_590378_T_C_b38	RP11-34P13.13	2.979	0.00343	0.11801	9	0.039611	no	BRNCHB
chr1_98999_T_TTTTA_b38	RP11-34P13.13	-2.914	0.00419	-0.073109	16	0.025091	no	BRNCHB
chr1_272378_A_T_b38	RP11-34P13.13	2.869	0.00478	0.171183	4	0.059662	no	BRNCHB
chr1_272389_C_T_b38	RP11-34P13.13	2.838	0.00525	0.162586	6	0.057288	no	BRNCHB
chr1_596697_ACATTCATGCTCACTCATACACACCCAGATCATATATACACTCGTGCACACATTCACACTCATACACACCCAAATCATACTCACATTCATGCACACATGTT_A_b38	RP11-34P13.13	2.643	0.0092	0.143445	3	0.054273	no	BRNCHB
chr1_271569_A_G_b38	RP11-34P13.13	4.188	4.54e-05	0.123988	11	0.029607	yes	BRNCHA
chr1_280599_T_C_b38	RP11-34P13.13	3.473	0.000655	0.109091	3	0.031412	yes	BRNCHA
chr1_286158_A_G_b38	RP11-34P13.13	3.412	0.000809	0.105344	5	0.030876	yes	BRNCHA
chr1_264681_A_G_b38	RP11-34P13.13	3.314	0.00113	0.125275	6	0.037806	yes	BRNCHA
chr1_285441_C_T_b38	RP11-34P13.13	3.223	0.00152	0.104581	3	0.032446	yes	BRNCHA
chr1_269588_A_G_b38	RP11-34P13.13	3.055	0.00262	0.078655	28	0.025745	yes	BRNCHA
chr1_282616_G_GA_b38	RP11-34P13.13	3.007	0.00305	0.091816	5	0.030537	yes	BRNCHA
chr1_280592_T_C_b38	RP11-34P13.13	2.971	0.0034	0.086952	9	0.029266	yes	BRNCHA
chr1_19322_C_T_b38	RP11-34P13.13	-2.875	0.00457	-0.118563	6	0.041245	yes	BRNCHA
chr1_185451_A_G_b38	RP11-34P13.13	2.871	0.00462	0.117598	7	0.040963	yes	BRNCHA
chr1_265009_A_T_b38	RP11-34P13.13	2.853	0.00488	0.081765	11	0.028663	yes	BRNCHA
chr1_109575_CGTGT_C_b38	RP11-34P13.13	2.833	0.00517	0.089628	5	0.031634	yes	BRNCHA
chr1_288130_T_C_b38	RP11-34P13.13	-2.828	0.00525	-0.089361	5	0.031594	yes	BRNCHA
chr1_185428_A_G_b38	RP11-34P13.13	2.827	0.00527	0.111121	8	0.039309	yes	BRNCHA
chr1_282607_G_A_b38	RP11-34P13.13	2.823	0.00534	0.086891	5	0.030782	yes	BRNCHA
chr1_285109_CAA_C_b38	RP11-34P13.13	2.809	0.00555	0.144292	3	0.051363	yes	BRNCHA
chr1_285175_C_T_b38	RP11-34P13.13	2.809	0.00557	0.107223	4	0.038177	yes	BRNCHA
chr1_182903_C_G_b38	RP11-34P13.13	2.785	0.00597	0.098847	13	0.035494	yes	BRNCHA
chr1_20316_GA_G_b38	RP11-34P13.13	5.14	7.56e-07	0.164379	3	0.031979	no	BRNCHA
chr1_192025_G_A_b38	RP11-34P13.13	4.222	3.96e-05	0.167466	4	0.039669	no	BRNCHA
chr1_92930_G_T_b38	RP11-34P13.13	3.843	0.000172	0.202061	3	0.052577	no	BRNCHA
chr1_189771_T_C_b38	RP11-34P13.13	3.667	0.000329	0.153906	4	0.041974	no	BRNCHA
chr1_13613_T_A_b38	RP11-34P13.13	-3.619	0.000391	-0.117133	3	0.032369	no	BRNCHA
chr1_596697_ACATTCATGCTCACTCATACACACCCAGATCATATATACACTCGTGCACACATTCACACTCATACACACCCAAATCATACTCACATTCATGCACACATGTT_A_b38	RP11-34P13.13	3.002	0.00309	0.167036	3	0.055646	no	BRNCHA
chr1_839515_CTAGACACACACACCTGGACACACACACG_C_b38	RP11-34P13.13	-2.874	0.00458	-0.079174	18	0.027549	no	BRNCHA
chr1_839480_CACACACCTGGACAA_C_b38	RP11-34P13.13	-2.803	0.00566	-0.078983	17	0.028178	no	BRNCHA
chr1_278240_CA_C_b38	RP11-34P13.13	-2.728	0.00705	-0.099486	3	0.036468	no	BRNCHA
chr1_186209_T_C_b38	RP11-34P13.13	2.692	0.00782	0.103992	8	0.038629	no	BRNCHA
chr1_286158_A_G_b38	RP11-34P13.13	5.956	1.53e-08	0.069963	5	0.011746	yes	BRNCTXA
chr1_271569_A_G_b38	RP11-34P13.13	5.338	3.08e-07	0.058703	11	0.010997	yes	BRNCTXA
chr1_271413_C_T_b38	RP11-34P13.13	5.022	1.32e-06	0.070618	4	0.014061	yes	BRNCTXA
chr1_286145_C_CAT_b38	RP11-34P13.13	4.47	1.45e-05	0.055247	5	0.012359	yes	BRNCTXA
chr1_180958_CCCCTAA_C_b38	RP11-34P13.13	3.962	0.000111	0.041428	16	0.010456	yes	BRNCTXA
chr1_265009_A_T_b38	RP11-34P13.13	3.851	0.000168	0.044243	10	0.011488	yes	BRNCTXA
chr1_272389_C_T_b38	RP11-34P13.13	3.784	0.000216	0.084419	8	0.022312	yes	BRNCTXA
chr1_272378_A_T_b38	RP11-34P13.13	3.446	0.000722	0.082106	6	0.023824	yes	BRNCTXA
chr1_272548_A_C_b38	RP11-34P13.13	3.383	0.000898	0.054853	11	0.016216	yes	BRNCTXA
chr1_866577_CCTGCACTCACATCCCTGACGTCCTCCCGTGCCCTCACGTGGTCCTCCCT_C_b38	RP11-34P13.13	3.334	0.00106	0.029033	32	0.008708	yes	BRNCTXA
chr1_280592_T_C_b38	RP11-34P13.13	3.212	0.00159	0.040404	6	0.012578	yes	BRNCTXA
chr1_288130_T_C_b38	RP11-34P13.13	-3.162	0.00187	-0.040323	3	0.012752	yes	BRNCTXA
chr1_98945_C_T_b38	RP11-34P13.13	-3.056	0.00262	-0.032315	31	0.010576	yes	BRNCTXA
chr1_98999_T_TTTTA_b38	RP11-34P13.13	-3.018	0.00295	-0.029627	20	0.009816	yes	BRNCTXA
chr1_282551_T_C_b38	RP11-34P13.13	2.961	0.00352	0.037049	6	0.012511	yes	BRNCTXA
chr1_939570_T_TCCCTGGAGGACC_b38	RP11-34P13.13	-2.877	0.00455	-0.028133	16	0.009779	yes	BRNCTXA
chr1_264730_T_A_b38	RP11-34P13.13	2.726	0.00712	0.07348	5	0.02696	yes	BRNCTXA
chr1_271147_T_G_b38	RP11-34P13.13	2.623	0.00954	0.043638	9	0.016636	yes	BRNCTXA
chr1_518864_T_A_b38	RP11-34P13.13	5.206	5.71e-07	0.077376	3	0.014863	no	BRNCTXA
chr1_19322_C_T_b38	RP11-34P13.13	-5.158	7.13e-07	-0.076669	6	0.014865	no	BRNCTXA
chr1_13613_T_A_b38	RP11-34P13.13	-4.504	1.26e-05	-0.05827	3	0.012938	no	BRNCTXA
chr1_94570_T_G_b38	RP11-34P13.13	4.338	2.51e-05	0.055897	3	0.012887	no	BRNCTXA
chr1_269588_A_G_b38	RP11-34P13.13	3.427	0.000772	0.035531	28	0.010369	no	BRNCTXA
chr1_284028_C_A_b38	RP11-34P13.13	-3.074	0.00247	-0.041581	4	0.013525	no	BRNCTXA
chr1_1007325_A_G_b38	RP11-34P13.13	-2.673	0.00828	-0.072586	4	0.027156	no	BRNCTXA
chr1_799082_G_A_b38	RP11-34P13.13	-2.623	0.00953	-0.032487	6	0.012384	no	BRNCTXA
chr1_280599_T_C_b38	RP11-34P13.13	4.332	2.87e-05	0.049536	3	0.011434	yes	BRNCTXB
chr1_286158_A_G_b38	RP11-34P13.13	4.16	5.64e-05	0.043231	6	0.010391	yes	BRNCTXB
chr1_264681_A_G_b38	RP11-34P13.13	3.934	0.000133	0.051616	6	0.013119	yes	BRNCTXB
chr1_265009_A_T_b38	RP11-34P13.13	3.704	0.000309	0.035959	12	0.009708	yes	BRNCTXB
chr1_271569_A_G_b38	RP11-34P13.13	3.502	0.000629	0.034136	11	0.009749	yes	BRNCTXB
chr1_286145_C_CAT_b38	RP11-34P13.13	3.41	0.000858	0.034725	6	0.010182	yes	BRNCTXB
chr1_272378_A_T_b38	RP11-34P13.13	3.241	0.0015	0.061923	6	0.019108	yes	BRNCTXB
chr1_269588_A_G_b38	RP11-34P13.13	3.194	0.00175	0.028759	24	0.009003	yes	BRNCTXB
chr1_272389_C_T_b38	RP11-34P13.13	3.073	0.00257	0.057208	8	0.018615	yes	BRNCTXB
chr1_280592_T_C_b38	RP11-34P13.13	2.847	0.0051	0.030544	7	0.010727	yes	BRNCTXB
chr1_857828_C_G_b38	RP11-34P13.13	-2.748	0.00683	-0.027196	22	0.009898	yes	BRNCTXB
chr1_19322_C_T_b38	RP11-34P13.13	-4.093	7.32e-05	-0.05534	4	0.013521	no	BRNCTXB
chr1_94808_CCTTTT_C_b38	RP11-34P13.13	-3.629	0.000404	-0.03407	12	0.009389	no	BRNCTXB
chr1_98945_C_T_b38	RP11-34P13.13	-3.463	0.000719	-0.034583	18	0.009988	no	BRNCTXB
chr1_271413_C_T_b38	RP11-34P13.13	3.45	0.000749	0.046097	3	0.013361	no	BRNCTXB
chr1_272548_A_C_b38	RP11-34P13.13	2.633	0.00945	0.038059	11	0.014453	no	BRNCTXB
chr1_531472_G_C_b38	RP11-34P13.13	-2.619	0.00983	-0.022225	26	0.008486	no	BRNCTXB
chr1_264730_T_A_b38	RP11-34P13.13	3.554	0.000531	0.059659	7	0.016787	yes	BRNHPT
chr1_1002415_C_CATTTT_b38	RP11-34P13.13	3.508	0.000622	0.030789	24	0.008777	yes	BRNHPT
chr1_109575_CGTGT_C_b38	RP11-34P13.13	2.764	0.00655	0.034567	3	0.012508	yes	BRNHPT
chr1_16103_T_G_b38	RP11-34P13.13	3.478	0.00069	0.034835	11	0.010017	no	BRNHPT
chr1_192025_G_A_b38	RP11-34P13.13	3.384	0.000945	0.05284	5	0.015613	no	BRNHPT
chr1_186209_T_C_b38	RP11-34P13.13	3.277	0.00135	0.053287	7	0.016259	no	BRNHPT
chr1_264681_A_G_b38	RP11-34P13.13	3.138	0.00211	0.043875	5	0.013984	no	BRNHPT
chr1_265009_A_T_b38	RP11-34P13.13	3.074	0.00258	0.03286	9	0.010691	no	BRNHPT
chr1_187323_G_A_b38	RP11-34P13.13	-3.003	0.00321	-0.038018	3	0.012659	no	BRNHPT
chr1_271569_A_G_b38	RP11-34P13.13	2.72	0.00743	0.027691	11	0.010181	no	BRNHPT
chr1_1102071_C_CAA_b38	RP11-34P13.13	-2.667	0.00862	-0.039624	5	0.014855	no	BRNHPT
chr1_19322_C_T_b38	RP11-34P13.13	-4.59	1.29e-05	-0.07073	7	0.015411	yes	BRNSPC
chr1_94570_T_G_b38	RP11-34P13.13	5.057	1.93e-06	0.070542	3	0.01395	no	BRNSPC
chr1_518864_T_A_b38	RP11-34P13.13	8.664	2.18e-16	0.11817	3	0.013639	yes	BREAST
chr1_271569_A_G_b38	RP11-34P13.13	5.522	6.87e-08	0.062853	20	0.011383	yes	BREAST
chr1_265009_A_T_b38	RP11-34P13.13	5.301	2.13e-07	0.056144	20	0.010592	yes	BREAST
chr1_280599_T_C_b38	RP11-34P13.13	4.861	1.82e-06	0.057914	10	0.011913	yes	BREAST
chr1_19980_G_A_b38	RP11-34P13.13	4.806	2.36e-06	0.104851	3	0.021817	yes	BREAST
chr1_280592_T_C_b38	RP11-34P13.13	4.646	4.91e-06	0.052511	17	0.011301	yes	BREAST
chr1_273824_G_T_b38	RP11-34P13.13	4.489	9.94e-06	0.047424	23	0.010564	yes	BREAST
chr1_269588_A_G_b38	RP11-34P13.13	4.464	1.11e-05	0.046908	47	0.010507	yes	BREAST
chr1_280198_C_A_b38	RP11-34P13.13	4.456	1.15e-05	0.082509	4	0.018514	yes	BREAST
chr1_13613_T_A_b38	RP11-34P13.13	-4.101	5.21e-05	-0.052333	5	0.012763	yes	BREAST
chr1_271147_T_G_b38	RP11-34P13.13	3.807	0.000168	0.057125	16	0.015005	yes	BREAST
chr1_284741_A_C_b38	RP11-34P13.13	3.8	0.000172	0.083665	3	0.022014	yes	BREAST
chr1_274015_A_G_b38	RP11-34P13.13	3.634	0.000324	0.050456	25	0.013884	yes	BREAST
chr1_264681_A_G_b38	RP11-34P13.13	3.493	0.000544	0.056349	10	0.016133	yes	BREAST
chr1_286158_A_G_b38	RP11-34P13.13	3.482	0.000565	0.045031	6	0.012931	yes	BREAST
chr1_282728_T_C_b38	RP11-34P13.13	3.472	0.000587	0.043245	4	0.012456	yes	BREAST
chr1_16103_T_G_b38	RP11-34P13.13	3.453	0.000629	0.034922	32	0.010115	yes	BREAST
chr1_282721_A_G_b38	RP11-34P13.13	3.321	0.001	0.041158	4	0.012394	yes	BREAST
chr1_92930_G_T_b38	RP11-34P13.13	3.224	0.00139	0.071772	4	0.022263	yes	BREAST
chr1_272505_C_G_b38	RP11-34P13.13	3.203	0.0015	0.042411	21	0.013242	yes	BREAST
chr1_282607_G_A_b38	RP11-34P13.13	3.195	0.00154	0.038265	8	0.011978	yes	BREAST
chr1_282551_T_C_b38	RP11-34P13.13	3.018	0.00274	0.035118	13	0.011635	yes	BREAST
chr1_1005757_AGCCCCCGCAGCAGT_A_b38	RP11-34P13.13	-2.962	0.00328	-0.027532	79	0.009296	yes	BREAST
chr1_1006159_C_T_b38	RP11-34P13.13	2.786	0.00566	0.026047	59	0.009351	yes	BREAST
chr1_282616_G_GA_b38	RP11-34P13.13	2.778	0.00579	0.032941	9	0.011858	yes	BREAST
chr1_1002745_G_A_b38	RP11-34P13.13	2.736	0.00656	0.029146	18	0.010653	yes	BREAST
chr1_1071610_G_A_b38	RP11-34P13.13	-2.648	0.0085	-0.026416	30	0.009977	yes	BREAST
chr1_275704_C_G_b38	RP11-34P13.13	2.638	0.00875	0.051421	4	0.019495	yes	BREAST
chr1_1004716_C_T_b38	RP11-34P13.13	-2.631	0.00891	-0.024739	85	0.009402	yes	BREAST
chr1_284929_A_G_b38	RP11-34P13.13	2.619	0.00923	0.049868	4	0.019041	yes	BREAST
chr1_94570_T_G_b38	RP11-34P13.13	7.764	1.08e-13	0.093678	7	0.012065	no	BREAST
chr1_20316_GA_G_b38	RP11-34P13.13	5.425	1.13e-07	0.067696	5	0.012478	no	BREAST
chr1_271413_C_T_b38	RP11-34P13.13	5.115	5.36e-07	0.071037	6	0.013887	no	BREAST
chr1_187323_G_A_b38	RP11-34P13.13	-5.07	6.69e-07	-0.063796	6	0.012582	no	BREAST
chr1_20547_A_G_b38	RP11-34P13.13	4.842	1.99e-06	0.060358	5	0.012465	no	BREAST
chr1_19322_C_T_b38	RP11-34P13.13	-4.544	7.79e-06	-0.068254	12	0.01502	no	BREAST
chr1_187331_C_G_b38	RP11-34P13.13	-4.373	1.65e-05	-0.055873	9	0.012777	no	BREAST
chr1_278165_CAGG_C_b38	RP11-34P13.13	-3.811	0.000166	-0.046539	6	0.012212	no	BREAST
chr1_285109_CA_C_b38	RP11-34P13.13	-3.716	0.000238	-0.055985	5	0.015066	no	BREAST
chr1_94271_C_G_b38	RP11-34P13.13	3.573	0.000406	0.039448	48	0.011041	no	BREAST
chr1_272488_C_G_b38	RP11-34P13.13	3.389	0.000788	0.041088	21	0.012124	no	BREAST
chr1_288130_T_C_b38	RP11-34P13.13	-3.387	0.000794	-0.041252	10	0.012181	no	BREAST
chr1_272378_A_T_b38	RP11-34P13.13	3.162	0.00171	0.066352	11	0.020983	no	BREAST
chr1_284028_C_A_b38	RP11-34P13.13	-2.902	0.00396	-0.033485	15	0.011537	no	BREAST
chr1_206074_T_C_b38	RP11-34P13.13	2.877	0.00428	0.028398	55	0.00987	no	BREAST
chr1_797421_A_G_b38	RP11-34P13.13	2.867	0.00441	0.081997	3	0.028596	no	BREAST
chr1_19004_A_G_b38	RP11-34P13.13	-2.785	0.00567	-0.03347	45	0.012018	no	BREAST
chr1_272389_C_T_b38	RP11-34P13.13	2.776	0.00583	0.0552	16	0.019887	no	BREAST
chr1_590813_C_T_b38	RP11-34P13.13	2.739	0.0065	0.058678	6	0.021424	no	BREAST
chr1_286158_A_ATG_b38	RP11-34P13.13	-2.735	0.00658	-0.028149	40	0.010293	no	BREAST
chr1_978509_G_A_b38	RP11-34P13.13	-2.707	0.00714	-0.024817	79	0.009167	no	BREAST
chr1_506851_G_T_b38	RP11-34P13.13	-2.666	0.00807	-0.039997	7	0.015005	no	BREAST
chr1_1083795_C_G_b38	RP11-34P13.13	-2.633	0.00887	-0.025111	43	0.009536	no	BREAST
chr1_637064_G_A_b38	RP11-34P13.13	2.603	0.00966	0.044283	7	0.017011	no	BREAST
chr1_979472_G_C_b38	RP11-34P13.13	-2.602	0.00969	-0.023877	82	0.009176	no	BREAST
chr1_20316_GA_G_b38	RP11-34P13.13	7.564	6.65e-13	0.102483	6	0.01355	yes	CLNSGM
chr1_269588_A_G_b38	RP11-34P13.13	6.995	2.21e-11	0.083223	36	0.011898	yes	CLNSGM
chr1_271569_A_G_b38	RP11-34P13.13	6.384	7.79e-10	0.08236	17	0.0129	yes	CLNSGM
chr1_272389_C_T_b38	RP11-34P13.13	6.258	1.59e-09	0.134678	12	0.021523	yes	CLNSGM
chr1_265009_A_T_b38	RP11-34P13.13	6.251	1.64e-09	0.075317	18	0.012048	yes	CLNSGM
chr1_280198_C_A_b38	RP11-34P13.13	6.181	2.43e-09	0.113742	4	0.018403	yes	CLNSGM
chr1_271413_C_T_b38	RP11-34P13.13	5.417	1.37e-07	0.086291	7	0.01593	yes	CLNSGM
chr1_272548_A_C_b38	RP11-34P13.13	5.143	5.29e-07	0.091337	19	0.017758	yes	CLNSGM
chr1_19322_C_T_b38	RP11-34P13.13	-4.94	1.39e-06	-0.082566	11	0.016714	yes	CLNSGM
chr1_264681_A_G_b38	RP11-34P13.13	4.829	2.33e-06	0.085613	8	0.017727	yes	CLNSGM
chr1_260937_C_T_b38	RP11-34P13.13	4.815	2.49e-06	0.087268	4	0.018123	yes	CLNSGM
chr1_286158_A_G_b38	RP11-34P13.13	4.789	2.8e-06	0.070041	7	0.014624	yes	CLNSGM
chr1_13613_T_A_b38	RP11-34P13.13	-4.754	3.3e-06	-0.070198	3	0.014768	yes	CLNSGM
chr1_264730_T_A_b38	RP11-34P13.13	4.745	3.43e-06	0.134727	9	0.028395	yes	CLNSGM
chr1_273824_G_T_b38	RP11-34P13.13	4.695	4.3e-06	0.057164	17	0.012176	yes	CLNSGM
chr1_274015_A_G_b38	RP11-34P13.13	4.454	1.25e-05	0.071341	21	0.016019	yes	CLNSGM
chr1_280592_T_C_b38	RP11-34P13.13	4.42	1.44e-05	0.05862	13	0.013262	yes	CLNSGM
chr1_282551_T_C_b38	RP11-34P13.13	4.376	1.74e-05	0.061306	9	0.014009	yes	CLNSGM
chr1_280726_A_AACACACACAC_b38	RP11-34P13.13	4.312	2.29e-05	0.084982	5	0.019707	yes	CLNSGM
chr1_280599_T_C_b38	RP11-34P13.13	4.226	3.28e-05	0.061854	7	0.014636	yes	CLNSGM
chr1_272680_G_A_b38	RP11-34P13.13	3.898	0.000123	0.059276	4	0.015206	yes	CLNSGM
chr1_271147_T_G_b38	RP11-34P13.13	3.779	0.000195	0.071209	15	0.018843	yes	CLNSGM
chr1_272512_A_G_b38	RP11-34P13.13	3.437	0.000683	0.056031	17	0.0163	yes	CLNSGM
chr1_285675_T_C_b38	RP11-34P13.13	3.369	0.000867	0.085696	3	0.025433	yes	CLNSGM
chr1_271931_T_C_b38	RP11-34P13.13	3.159	0.00177	0.047735	7	0.015112	yes	CLNSGM
chr1_284929_A_G_b38	RP11-34P13.13	3.155	0.00179	0.06907	6	0.021894	yes	CLNSGM
chr1_286145_C_CAT_b38	RP11-34P13.13	3.102	0.00213	0.045884	6	0.014793	yes	CLNSGM
chr1_987103_T_C_b38	RP11-34P13.13	3.089	0.00223	0.041346	13	0.013387	yes	CLNSGM
chr1_991588_C_T_b38	RP11-34P13.13	2.941	0.00356	0.039197	13	0.013328	yes	CLNSGM
chr1_1002415_CT_C_b38	RP11-34P13.13	2.931	0.00368	0.035725	25	0.012189	yes	CLNSGM
chr1_981454_G_A_b38	RP11-34P13.13	-2.923	0.00376	-0.030676	84	0.010493	yes	CLNSGM
chr1_983193_A_G_b38	RP11-34P13.13	-2.923	0.00376	-0.030676	84	0.010493	yes	CLNSGM
chr1_994185_G_T_b38	RP11-34P13.13	2.88	0.00431	0.039562	11	0.013738	yes	CLNSGM
chr1_984121_G_T_b38	RP11-34P13.13	-2.872	0.00442	-0.030209	84	0.01052	yes	CLNSGM
chr1_978230_G_A_b38	RP11-34P13.13	2.863	0.00454	0.037945	12	0.013254	yes	CLNSGM
chr1_983004_G_T_b38	RP11-34P13.13	-2.847	0.00476	-0.030205	86	0.010608	yes	CLNSGM
chr1_1002417_T_A_b38	RP11-34P13.13	2.834	0.00496	0.03666	20	0.012936	yes	CLNSGM
chr1_996120_C_T_b38	RP11-34P13.13	2.829	0.00503	0.039288	11	0.013888	yes	CLNSGM
chr1_101268_G_A_b38	RP11-34P13.13	-2.781	0.0058	-0.037367	15	0.013434	yes	CLNSGM
chr1_272164_G_A_b38	RP11-34P13.13	2.764	0.00612	0.041536	31	0.015029	yes	CLNSGM
chr1_978953_C_G_b38	RP11-34P13.13	-2.76	0.0062	-0.028751	82	0.010419	yes	CLNSGM
chr1_979560_T_C_b38	RP11-34P13.13	-2.756	0.00626	-0.029044	86	0.010539	yes	CLNSGM
chr1_284741_A_C_b38	RP11-34P13.13	2.751	0.00635	0.064332	4	0.023384	yes	CLNSGM
chr1_1019479_TG_T_b38	RP11-34P13.13	-2.738	0.00661	-0.028269	81	0.010325	yes	CLNSGM
chr1_1005757_AGCCCCCGCAGCAGT_A_b38	RP11-34P13.13	-2.733	0.0067	-0.028576	78	0.010455	yes	CLNSGM
chr1_978509_G_A_b38	RP11-34P13.13	-2.727	0.00683	-0.028253	88	0.010362	yes	CLNSGM
chr1_1022868_A_G_b38	RP11-34P13.13	2.695	0.00749	0.028703	46	0.01065	yes	CLNSGM
chr1_285175_C_T_b38	RP11-34P13.13	2.67	0.00806	0.049188	4	0.018422	yes	CLNSGM
chr1_1004716_C_T_b38	RP11-34P13.13	-2.662	0.00825	-0.027877	82	0.010472	yes	CLNSGM
chr1_1023775_G_A_b38	RP11-34P13.13	-2.656	0.0084	-0.028811	75	0.010849	yes	CLNSGM
chr1_989148_C_A_b38	RP11-34P13.13	-2.642	0.00873	-0.027837	81	0.010535	yes	CLNSGM
chr1_995371_C_G_b38	RP11-34P13.13	2.638	0.00884	0.02744	60	0.010402	yes	CLNSGM
chr1_998410_G_A_b38	RP11-34P13.13	-2.63	0.00903	-0.028215	88	0.010726	yes	CLNSGM
chr1_976536_C_T_b38	RP11-34P13.13	2.626	0.00915	0.035355	11	0.013464	yes	CLNSGM
chr1_985597_T_C_b38	RP11-34P13.13	2.625	0.00918	0.035112	13	0.013377	yes	CLNSGM
chr1_998750_G_C_b38	RP11-34P13.13	2.621	0.00927	0.036828	11	0.014049	yes	CLNSGM
chr1_1022518_G_T_b38	RP11-34P13.13	2.62	0.00932	0.02789	43	0.010646	yes	CLNSGM
chr1_518864_T_A_b38	RP11-34P13.13	9.637	5.23e-19	0.14271	3	0.014809	no	CLNSGM
chr1_272378_A_T_b38	RP11-34P13.13	6.339	1e-09	0.144088	9	0.02273	no	CLNSGM
chr1_16103_T_G_b38	RP11-34P13.13	4.862	2e-06	0.053935	32	0.011093	no	CLNSGM
chr1_19980_G_A_b38	RP11-34P13.13	4.613	6.22e-06	0.105829	3	0.022942	no	CLNSGM
chr1_187323_G_A_b38	RP11-34P13.13	-4.535	8.79e-06	-0.066695	4	0.014708	no	CLNSGM
chr1_92930_G_T_b38	RP11-34P13.13	3.744	0.000223	0.091236	4	0.024372	no	CLNSGM
chr1_597873_A_G_b38	RP11-34P13.13	3.693	0.00027	0.102698	3	0.02781	no	CLNSGM
chr1_285720_A_G_b38	RP11-34P13.13	3.606	0.000372	0.094341	3	0.026159	no	CLNSGM
chr1_20547_A_G_b38	RP11-34P13.13	3.454	0.000644	0.05245	4	0.015185	no	CLNSGM
chr1_272505_C_G_b38	RP11-34P13.13	3.18	0.00165	0.049575	17	0.015589	no	CLNSGM
chr1_187331_C_G_b38	RP11-34P13.13	-3.101	0.00214	-0.048275	5	0.015567	no	CLNSGM
chr1_632403_T_C_b38	RP11-34P13.13	3.093	0.0022	0.068993	12	0.022308	no	CLNSGM
chr1_19004_A_G_b38	RP11-34P13.13	-3.026	0.00273	-0.042008	37	0.013883	no	CLNSGM
chr1_272488_C_G_b38	RP11-34P13.13	2.955	0.00341	0.041077	17	0.013899	no	CLNSGM
chr1_632199_C_T_b38	RP11-34P13.13	2.902	0.00403	0.070725	8	0.024374	no	CLNSGM
chr1_995543_A_G_b38	RP11-34P13.13	-2.89	0.00417	-0.035391	24	0.012245	no	CLNSGM
chr1_598818_C_T_b38	RP11-34P13.13	2.879	0.00432	0.054496	4	0.01893	no	CLNSGM
chr1_285746_C_T_b38	RP11-34P13.13	2.872	0.00441	0.059565	5	0.020741	no	CLNSGM
chr1_632487_A_G_b38	RP11-34P13.13	2.855	0.00465	0.061858	11	0.02167	no	CLNSGM
chr1_981282_A_C_b38	RP11-34P13.13	2.765	0.0061	0.0366	12	0.013237	no	CLNSGM
chr1_20316_GA_G_b38	RP11-34P13.13	8.274	4.41e-15	0.072628	3	0.008778	yes	CLNTRN
chr1_271569_A_G_b38	RP11-34P13.13	6.364	7.42e-10	0.050241	20	0.007894	yes	CLNTRN
chr1_271413_C_T_b38	RP11-34P13.13	6.053	4.29e-09	0.060911	8	0.010063	yes	CLNTRN
chr1_187331_C_G_b38	RP11-34P13.13	-5.488	8.7e-08	-0.052891	3	0.009637	yes	CLNTRN
chr1_280674_A_G_b38	RP11-34P13.13	5.411	1.29e-07	0.060584	3	0.011196	yes	CLNTRN
chr1_280599_T_C_b38	RP11-34P13.13	5.361	1.67e-07	0.047477	9	0.008856	yes	CLNTRN
chr1_280592_T_C_b38	RP11-34P13.13	5.236	3.12e-07	0.045613	13	0.008712	yes	CLNTRN
chr1_273824_G_T_b38	RP11-34P13.13	5.188	3.94e-07	0.03969	23	0.00765	yes	CLNTRN
chr1_265009_A_T_b38	RP11-34P13.13	5.09	6.38e-07	0.040772	22	0.008011	yes	CLNTRN
chr1_280198_C_A_b38	RP11-34P13.13	4.88	1.73e-06	0.064297	5	0.013174	yes	CLNTRN
chr1_269588_A_G_b38	RP11-34P13.13	4.333	2.01e-05	0.034605	40	0.007986	yes	CLNTRN
chr1_271147_T_G_b38	RP11-34P13.13	4.323	2.11e-05	0.050174	15	0.011607	yes	CLNTRN
chr1_264681_A_G_b38	RP11-34P13.13	4.244	2.94e-05	0.046694	8	0.011003	yes	CLNTRN
chr1_282721_A_G_b38	RP11-34P13.13	4.058	6.33e-05	0.038545	4	0.009498	yes	CLNTRN
chr1_274015_A_G_b38	RP11-34P13.13	3.974	8.88e-05	0.040562	25	0.010207	yes	CLNTRN
chr1_16103_T_G_b38	RP11-34P13.13	3.905	0.000117	0.028814	32	0.007379	yes	CLNTRN
chr1_282728_T_C_b38	RP11-34P13.13	3.736	0.000224	0.035544	4	0.009515	yes	CLNTRN
chr1_286158_A_G_b38	RP11-34P13.13	3.597	0.000376	0.036517	5	0.010151	yes	CLNTRN
chr1_974039_C_T_b38	RP11-34P13.13	3.597	0.000377	0.032656	11	0.009079	yes	CLNTRN
chr1_282551_T_C_b38	RP11-34P13.13	3.492	0.000553	0.03263	8	0.009345	yes	CLNTRN
chr1_272680_G_A_b38	RP11-34P13.13	3.303	0.00107	0.032215	9	0.009753	yes	CLNTRN
chr1_983747_T_C_b38	RP11-34P13.13	3.277	0.00117	0.027658	14	0.008439	yes	CLNTRN
chr1_757414_CA_C_b38	RP11-34P13.13	-3.194	0.00155	-0.036531	7	0.011437	yes	CLNTRN
chr1_264730_T_A_b38	RP11-34P13.13	3.179	0.00163	0.048636	13	0.0153	yes	CLNTRN
chr1_715769_C_T_b38	RP11-34P13.13	3.168	0.00169	0.042453	11	0.013399	yes	CLNTRN
chr1_973858_G_C_b38	RP11-34P13.13	-3.048	0.00251	-0.021499	47	0.007054	yes	CLNTRN
chr1_272378_A_T_b38	RP11-34P13.13	3.001	0.00292	0.04602	9	0.015336	yes	CLNTRN
chr1_986280_C_T_b38	RP11-34P13.13	2.999	0.00294	0.025643	11	0.00855	yes	CLNTRN
chr1_1004716_C_T_b38	RP11-34P13.13	-2.966	0.00326	-0.020622	81	0.006952	yes	CLNTRN
chr1_986629_G_A_b38	RP11-34P13.13	2.858	0.00457	0.024616	11	0.008614	yes	CLNTRN
chr1_984039_T_C_b38	RP11-34P13.13	-2.768	0.006	-0.021947	23	0.007929	yes	CLNTRN
chr1_998410_G_A_b38	RP11-34P13.13	-2.766	0.00604	-0.018825	90	0.006807	yes	CLNTRN
chr1_139213_A_G_b38	RP11-34P13.13	2.728	0.00675	0.022473	15	0.008238	yes	CLNTRN
chr1_139233_C_A_b38	RP11-34P13.13	2.728	0.00675	0.022473	15	0.008238	yes	CLNTRN
chr1_1005954_G_A_b38	RP11-34P13.13	2.727	0.00678	0.018368	58	0.006736	yes	CLNTRN
chr1_1009184_T_C_b38	RP11-34P13.13	2.719	0.00694	0.01843	57	0.006779	yes	CLNTRN
chr1_1005429_C_CA_b38	RP11-34P13.13	2.717	0.00697	0.018302	58	0.006736	yes	CLNTRN
chr1_1005904_C_T_b38	RP11-34P13.13	2.717	0.00697	0.018302	58	0.006736	yes	CLNTRN
chr1_999842_C_A_b38	RP11-34P13.13	-2.682	0.00772	-0.018643	98	0.006951	yes	CLNTRN
chr1_1157310_C_T_b38	RP11-34P13.13	-2.677	0.00783	-0.020644	11	0.00771	yes	CLNTRN
chr1_989148_C_A_b38	RP11-34P13.13	-2.674	0.00792	-0.018663	93	0.006981	yes	CLNTRN
chr1_1034279_G_A_b38	RP11-34P13.13	2.671	0.00797	0.019684	31	0.007368	yes	CLNTRN
chr1_1157309_G_A_b38	RP11-34P13.13	-2.641	0.0087	-0.020328	11	0.007697	yes	CLNTRN
chr1_1008307_G_C_b38	RP11-34P13.13	2.619	0.00928	0.017677	58	0.00675	yes	CLNTRN
chr1_1006159_C_T_b38	RP11-34P13.13	2.616	0.00934	0.017729	61	0.006777	yes	CLNTRN
chr1_1000731_C_T_b38	RP11-34P13.13	-2.614	0.00939	-0.017864	91	0.006833	yes	CLNTRN
chr1_1020697_C_T_b38	RP11-34P13.13	2.612	0.00947	0.018914	33	0.007242	yes	CLNTRN
chr1_981454_G_A_b38	RP11-34P13.13	-2.609	0.00955	-0.017014	93	0.006522	yes	CLNTRN
chr1_983193_A_G_b38	RP11-34P13.13	-2.609	0.00955	-0.017014	93	0.006522	yes	CLNTRN
chr1_995508_ATTTTT_A_b38	RP11-34P13.13	-2.608	0.00956	-0.018042	86	0.006917	yes	CLNTRN
chr1_94570_T_G_b38	RP11-34P13.13	6.54	2.69e-10	0.06502	5	0.009942	no	CLNTRN
chr1_92930_G_T_b38	RP11-34P13.13	5.35	1.76e-07	0.08536	4	0.015955	no	CLNTRN
chr1_19980_G_A_b38	RP11-34P13.13	4.537	8.3e-06	0.067735	3	0.01493	no	CLNTRN
chr1_13613_T_A_b38	RP11-34P13.13	-4.46	1.16e-05	-0.041514	7	0.009307	no	CLNTRN
chr1_284741_A_C_b38	RP11-34P13.13	4.454	1.19e-05	0.06876	4	0.015438	no	CLNTRN
chr1_19322_C_T_b38	RP11-34P13.13	-4.432	1.32e-05	-0.048786	8	0.011008	no	CLNTRN
chr1_20547_A_G_b38	RP11-34P13.13	4.3	2.32e-05	0.039948	5	0.00929	no	CLNTRN
chr1_981169_A_G_b38	RP11-34P13.13	-3.797	0.000178	-0.028766	22	0.007576	no	CLNTRN
chr1_981210_G_A_b38	RP11-34P13.13	3.626	0.000339	0.034128	8	0.009413	no	CLNTRN
chr1_272548_A_C_b38	RP11-34P13.13	3.451	0.00064	0.038019	25	0.011017	no	CLNTRN
chr1_982260_G_A_b38	RP11-34P13.13	3.308	0.00106	0.028892	11	0.008734	no	CLNTRN
chr1_982858_C_G_b38	RP11-34P13.13	3.308	0.00106	0.028892	11	0.008734	no	CLNTRN
chr1_689819_C_T_b38	RP11-34P13.13	3.277	0.00117	0.041023	3	0.012518	no	CLNTRN
chr1_1005757_AGCCCCCGCAGCAGT_A_b38	RP11-34P13.13	-3.226	0.0014	-0.022169	76	0.006872	no	CLNTRN
chr1_996254_A_AGGGAGGGCAG_b38	RP11-34P13.13	3.065	0.00238	0.025675	13	0.008377	no	CLNTRN
chr1_996168_G_T_b38	RP11-34P13.13	3.055	0.00245	0.02571	13	0.008415	no	CLNTRN
chr1_1004111_TG_T_b38	RP11-34P13.13	3.043	0.00255	0.025296	14	0.008311	no	CLNTRN
chr1_1000335_C_T_b38	RP11-34P13.13	2.973	0.00319	0.025139	13	0.008455	no	CLNTRN
chr1_992361_G_A_b38	RP11-34P13.13	2.869	0.00441	0.024453	12	0.008522	no	CLNTRN
chr1_998741_G_A_b38	RP11-34P13.13	2.863	0.00449	0.024101	14	0.008418	no	CLNTRN
chr1_997077_G_A_b38	RP11-34P13.13	2.854	0.00463	0.024039	13	0.008424	no	CLNTRN
chr1_414665_C_T_b38	RP11-34P13.13	2.818	0.00515	0.024418	20	0.008664	no	CLNTRN
chr1_1023851_G_A_b38	RP11-34P13.13	-2.805	0.00537	-0.019586	79	0.006984	no	CLNTRN
chr1_1002745_G_A_b38	RP11-34P13.13	2.774	0.00589	0.022603	15	0.008148	no	CLNTRN
chr1_1023775_G_A_b38	RP11-34P13.13	-2.747	0.00638	-0.019165	83	0.006976	no	CLNTRN
chr1_1002415_CT_C_b38	RP11-34P13.13	2.736	0.00659	0.021868	29	0.007991	no	CLNTRN
chr1_94271_C_G_b38	RP11-34P13.13	2.698	0.00737	0.022493	44	0.008337	no	CLNTRN
chr1_1023789_G_C_b38	RP11-34P13.13	-2.689	0.00758	-0.017976	83	0.006686	no	CLNTRN
chr1_1164057_G_A_b38	RP11-34P13.13	2.614	0.00939	0.019935	25	0.007625	no	CLNTRN
chr1_271413_C_T_b38	RP11-34P13.13	6.393	6.96e-10	0.071396	9	0.011167	yes	ESPGSJ
chr1_20316_GA_G_b38	RP11-34P13.13	6.06	4.48e-09	0.06695	5	0.011048	yes	ESPGSJ
chr1_265009_A_T_b38	RP11-34P13.13	5.381	1.59e-07	0.050492	20	0.009383	yes	ESPGSJ
chr1_286158_A_G_b38	RP11-34P13.13	4.377	1.71e-05	0.053287	4	0.012173	yes	ESPGSJ
chr1_280592_T_C_b38	RP11-34P13.13	4.256	2.86e-05	0.044558	12	0.01047	yes	ESPGSJ
chr1_273824_G_T_b38	RP11-34P13.13	4.008	7.9e-05	0.038319	18	0.009561	yes	ESPGSJ
chr1_272164_G_A_b38	RP11-34P13.13	3.955	9.74e-05	0.05059	26	0.012791	yes	ESPGSJ
chr1_280599_T_C_b38	RP11-34P13.13	3.925	0.00011	0.042945	9	0.010941	yes	ESPGSJ
chr1_20547_A_G_b38	RP11-34P13.13	3.868	0.000137	0.044689	6	0.011554	yes	ESPGSJ
chr1_274015_A_G_b38	RP11-34P13.13	3.796	0.000181	0.050607	20	0.013333	yes	ESPGSJ
chr1_280674_A_G_b38	RP11-34P13.13	3.431	0.000694	0.047493	3	0.013843	yes	ESPGSJ
chr1_272548_A_C_b38	RP11-34P13.13	3.428	0.000702	0.046495	20	0.013565	yes	ESPGSJ
chr1_264730_T_A_b38	RP11-34P13.13	3.39	0.000802	0.080549	9	0.023761	yes	ESPGSJ
chr1_269588_A_G_b38	RP11-34P13.13	3.338	0.000961	0.03219	41	0.009644	yes	ESPGSJ
chr1_264681_A_G_b38	RP11-34P13.13	3.323	0.00101	0.047982	6	0.014441	yes	ESPGSJ
chr1_517599_AAC_A_b38	RP11-34P13.13	-3.042	0.00258	-0.058477	3	0.019223	yes	ESPGSJ
chr1_1129916_T_C_b38	RP11-34P13.13	2.927	0.0037	0.024384	42	0.008329	yes	ESPGSJ
chr1_1160003_G_A_b38	RP11-34P13.13	2.91	0.00391	0.028533	22	0.009804	yes	ESPGSJ
chr1_271569_A_G_b38	RP11-34P13.13	2.833	0.00496	0.0305	15	0.010767	yes	ESPGSJ
chr1_207150_T_G_b38	RP11-34P13.13	-2.789	0.00565	-0.029793	16	0.010681	yes	ESPGSJ
chr1_660192_G_A_b38	RP11-34P13.13	2.746	0.00642	0.034873	6	0.012698	yes	ESPGSJ
chr1_282551_T_C_b38	RP11-34P13.13	2.739	0.00656	0.029861	8	0.010901	yes	ESPGSJ
chr1_286172_G_GTC_b38	RP11-34P13.13	-2.732	0.00671	-0.033254	5	0.012173	yes	ESPGSJ
chr1_260937_C_T_b38	RP11-34P13.13	2.723	0.00688	0.043595	3	0.016008	yes	ESPGSJ
chr1_1130879_G_C_b38	RP11-34P13.13	2.711	0.00713	0.031295	9	0.011543	yes	ESPGSJ
chr1_272505_C_G_b38	RP11-34P13.13	2.69	0.00758	0.033224	18	0.012351	yes	ESPGSJ
chr1_984475_G_A_b38	RP11-34P13.13	2.66	0.00827	0.030751	8	0.01156	yes	ESPGSJ
chr1_94570_T_G_b38	RP11-34P13.13	6.139	2.91e-09	0.067901	5	0.011061	no	ESPGSJ
chr1_19980_G_A_b38	RP11-34P13.13	5.297	2.42e-07	0.097938	3	0.018489	no	ESPGSJ
chr1_187323_G_A_b38	RP11-34P13.13	-4.466	1.17e-05	-0.052222	3	0.011694	no	ESPGSJ
chr1_92930_G_T_b38	RP11-34P13.13	4.006	7.97e-05	0.080781	3	0.020166	no	ESPGSJ
chr1_107970_G_A_b38	RP11-34P13.13	3.645	0.00032	0.041169	3	0.011295	no	ESPGSJ
chr1_13613_T_A_b38	RP11-34P13.13	-3.492	0.000559	-0.039381	5	0.011278	no	ESPGSJ
chr1_284741_A_C_b38	RP11-34P13.13	3.408	0.000753	0.063364	3	0.018594	no	ESPGSJ
chr1_187331_C_G_b38	RP11-34P13.13	-3.002	0.00293	-0.036181	6	0.012052	no	ESPGSJ
chr1_19322_C_T_b38	RP11-34P13.13	-2.81	0.00531	-0.037502	10	0.013345	no	ESPGSJ
chr1_272378_A_T_b38	RP11-34P13.13	2.807	0.00536	0.056268	6	0.020046	no	ESPGSJ
chr1_272488_C_G_b38	RP11-34P13.13	2.79	0.00564	0.031413	18	0.011258	no	ESPGSJ
chr1_958061_C_CTTT_b38	RP11-34P13.13	2.747	0.00641	0.071941	3	0.026188	no	ESPGSJ
chr1_94271_C_G_b38	RP11-34P13.13	2.708	0.00719	0.026818	47	0.009903	no	ESPGSJ
chr1_1041126_AGCGGGGGC_A_b38	RP11-34P13.13	-2.668	0.00808	-0.017804	29	0.006673	no	ESPGSJ
chr1_282616_G_GA_b38	RP11-34P13.13	2.629	0.00904	0.028741	5	0.010931	no	ESPGSJ
chr1_807641_T_C_b38	RP11-34P13.13	-3.93	9.93e-05	-0.029475	31	0.007501	yes	ESPMCS
chr1_187323_G_A_b38	RP11-34P13.13	-3.376	0.000802	-0.032174	5	0.009529	yes	ESPMCS
chr1_631495_C_T_b38	RP11-34P13.13	3.221	0.00137	0.067322	4	0.020899	yes	ESPMCS
chr1_893503_G_A_b38	RP11-34P13.13	-3.218	0.00139	-0.034785	6	0.01081	yes	ESPMCS
chr1_988819_G_GGAGTGTTTCGGGAGTTCTGGGTTGATTGTTTCTGGAGTTCAGGGTT_b38	RP11-34P13.13	3.072	0.00227	0.035648	11	0.011606	yes	ESPMCS
chr1_903551_A_C_b38	RP11-34P13.13	-3.066	0.00231	-0.028003	12	0.009133	yes	ESPMCS
chr1_187331_C_G_b38	RP11-34P13.13	-3.004	0.00282	-0.029213	7	0.009725	yes	ESPMCS
chr1_666203_G_A_b38	RP11-34P13.13	2.917	0.00372	0.072421	3	0.02483	yes	ESPMCS
chr1_744357_G_C_b38	RP11-34P13.13	2.842	0.0047	0.050377	4	0.017726	yes	ESPMCS
chr1_1129599_C_T_b38	RP11-34P13.13	-2.826	0.00494	-0.026282	12	0.009301	yes	ESPMCS
chr1_740738_C_T_b38	RP11-34P13.13	-2.823	0.00498	-0.033483	5	0.01186	yes	ESPMCS
chr1_649157_C_T_b38	RP11-34P13.13	2.768	0.00589	0.040888	3	0.014773	yes	ESPMCS
chr1_99083_C_T_b38	RP11-34P13.13	-2.663	0.00804	-0.028615	4	0.010745	yes	ESPMCS
chr1_271569_A_G_b38	RP11-34P13.13	2.66	0.00811	0.022475	27	0.00845	yes	ESPMCS
chr1_633423_C_T_b38	RP11-34P13.13	2.636	0.0087	0.037019	9	0.014045	yes	ESPMCS
chr1_272488_C_G_b38	RP11-34P13.13	2.617	0.00918	0.024579	21	0.009391	yes	ESPMCS
chr1_799082_G_A_b38	RP11-34P13.13	-2.6	0.00965	-0.024693	11	0.009498	yes	ESPMCS
chr1_94570_T_G_b38	RP11-34P13.13	4.396	1.39e-05	0.043496	8	0.009894	no	ESPMCS
chr1_20316_GA_G_b38	RP11-34P13.13	3.933	9.81e-05	0.036439	4	0.009266	no	ESPMCS
chr1_20547_A_G_b38	RP11-34P13.13	3.105	0.00203	0.029165	6	0.009393	no	ESPMCS
chr1_674562_T_C_b38	RP11-34P13.13	2.832	0.00485	0.024375	12	0.008609	no	ESPMCS
chr1_103241_C_T_b38	RP11-34P13.13	-2.802	0.00531	-0.045233	6	0.016145	no	ESPMCS
chr1_933411_C_T_b38	RP11-34P13.13	2.703	0.00715	0.046286	5	0.017125	no	ESPMCS
chr1_1002415_C_CATTT_b38	RP11-34P13.13	2.687	0.0075	0.022231	31	0.008275	no	ESPMCS
chr1_597070_A_AATC_b38	RP11-34P13.13	2.631	0.00881	0.046333	9	0.017608	no	ESPMCS
chr1_98999_T_TTTTA_b38	RP11-34P13.13	2.613	0.00929	0.01887	45	0.007221	no	ESPMCS
chr1_20316_GA_G_b38	RP11-34P13.13	7.386	9.09e-13	0.068143	6	0.009226	yes	ESPMSL
chr1_271569_A_G_b38	RP11-34P13.13	6.499	2.44e-10	0.054401	23	0.00837	yes	ESPMSL
chr1_187331_C_G_b38	RP11-34P13.13	-6.378	5.05e-10	-0.06108	5	0.009577	yes	ESPMSL
chr1_269588_A_G_b38	RP11-34P13.13	5.776	1.55e-08	0.04294	61	0.007434	yes	ESPMSL
chr1_265009_A_T_b38	RP11-34P13.13	5.74	1.89e-08	0.04653	24	0.008106	yes	ESPMSL
chr1_273824_G_T_b38	RP11-34P13.13	5.481	7.57e-08	0.042083	28	0.007678	yes	ESPMSL
chr1_286158_A_G_b38	RP11-34P13.13	5.478	7.69e-08	0.05518	3	0.010073	yes	ESPMSL
chr1_284741_A_C_b38	RP11-34P13.13	5.25	2.5e-07	0.083582	3	0.015921	yes	ESPMSL
chr1_274015_A_G_b38	RP11-34P13.13	5.2	3.21e-07	0.054382	28	0.010458	yes	ESPMSL
chr1_280599_T_C_b38	RP11-34P13.13	5.056	6.56e-07	0.047082	10	0.009311	yes	ESPMSL
chr1_280198_C_A_b38	RP11-34P13.13	4.882	1.53e-06	0.068479	3	0.014027	yes	ESPMSL
chr1_92930_G_T_b38	RP11-34P13.13	4.871	1.61e-06	0.080196	5	0.016464	yes	ESPMSL
chr1_20547_A_G_b38	RP11-34P13.13	4.591	5.95e-06	0.043974	7	0.009579	yes	ESPMSL
chr1_280592_T_C_b38	RP11-34P13.13	4.581	6.23e-06	0.04231	13	0.009237	yes	ESPMSL
chr1_280674_A_G_b38	RP11-34P13.13	4.077	5.52e-05	0.045092	3	0.011059	yes	ESPMSL
chr1_264681_A_G_b38	RP11-34P13.13	4.071	5.66e-05	0.04742	8	0.011648	yes	ESPMSL
chr1_282551_T_C_b38	RP11-34P13.13	4.052	6.12e-05	0.036893	11	0.009105	yes	ESPMSL
chr1_19322_C_T_b38	RP11-34P13.13	-4.041	6.4e-05	-0.04506	11	0.011151	yes	ESPMSL
chr1_282721_A_G_b38	RP11-34P13.13	3.758	0.000198	0.035757	5	0.009516	yes	ESPMSL
chr1_282616_G_GA_b38	RP11-34P13.13	3.618	0.000336	0.032618	8	0.009016	yes	ESPMSL
chr1_272548_A_C_b38	RP11-34P13.13	3.604	0.000354	0.044768	22	0.012423	yes	ESPMSL
chr1_282728_T_C_b38	RP11-34P13.13	3.597	0.000363	0.033633	5	0.00935	yes	ESPMSL
chr1_271147_T_G_b38	RP11-34P13.13	3.492	0.000534	0.040943	18	0.011726	yes	ESPMSL
chr1_264730_T_A_b38	RP11-34P13.13	3.471	0.000577	0.055433	18	0.015972	yes	ESPMSL
chr1_282607_G_A_b38	RP11-34P13.13	3.425	0.000679	0.030158	10	0.008805	yes	ESPMSL
chr1_1157219_G_C_b38	RP11-34P13.13	3.348	0.000892	0.037043	8	0.011064	yes	ESPMSL
chr1_280726_A_AACACACACAC_b38	RP11-34P13.13	3.21	0.00144	0.046512	3	0.014492	yes	ESPMSL
chr1_286145_C_CAT_b38	RP11-34P13.13	3.203	0.00147	0.032397	3	0.010115	yes	ESPMSL
chr1_284929_A_G_b38	RP11-34P13.13	3.066	0.00232	0.039259	6	0.012803	yes	ESPMSL
chr1_277834_G_A_b38	RP11-34P13.13	3.051	0.00244	0.046493	13	0.015239	yes	ESPMSL
chr1_715769_C_T_b38	RP11-34P13.13	3.038	0.00254	0.03926	12	0.012921	yes	ESPMSL
chr1_285175_C_T_b38	RP11-34P13.13	3.008	0.0028	0.032337	10	0.010752	yes	ESPMSL
chr1_272680_G_A_b38	RP11-34P13.13	2.978	0.00308	0.031729	6	0.010654	yes	ESPMSL
chr1_455065_G_T_b38	RP11-34P13.13	-2.904	0.00389	-0.02464	19	0.008484	yes	ESPMSL
chr1_1120047_GA_G_b38	RP11-34P13.13	-2.889	0.00408	-0.026058	15	0.00902	yes	ESPMSL
chr1_260937_C_T_b38	RP11-34P13.13	2.851	0.00459	0.036296	4	0.012732	yes	ESPMSL
chr1_1126222_G_A_b38	RP11-34P13.13	-2.812	0.00516	-0.029725	5	0.010569	yes	ESPMSL
chr1_650736_C_A_b38	RP11-34P13.13	-2.689	0.00747	-0.049258	4	0.018319	yes	ESPMSL
chr1_1160003_G_A_b38	RP11-34P13.13	2.648	0.00842	0.021314	24	0.008049	yes	ESPMSL
chr1_1120968_G_A_b38	RP11-34P13.13	-2.643	0.00853	-0.022843	18	0.008641	yes	ESPMSL
chr1_1105739_G_GGGCGTGGT_b38	RP11-34P13.13	-2.617	0.00922	-0.02303	16	0.008801	yes	ESPMSL
chr1_1030484_CTGTGAGATCAGCGTGTGTGTGCAGCGCATGGTGCTG_C_b38	RP11-34P13.13	2.605	0.00953	0.041907	7	0.016085	yes	ESPMSL
chr1_94570_T_G_b38	RP11-34P13.13	7.058	7.68e-12	0.067272	6	0.009532	no	ESPMSL
chr1_271413_C_T_b38	RP11-34P13.13	6.633	1.09e-10	0.070535	7	0.010633	no	ESPMSL
chr1_107970_G_A_b38	RP11-34P13.13	5.316	1.78e-07	0.048708	3	0.009163	no	ESPMSL
chr1_13613_T_A_b38	RP11-34P13.13	-5.239	2.64e-07	-0.051272	4	0.009787	no	ESPMSL
chr1_272378_A_T_b38	RP11-34P13.13	3.712	0.000236	0.061315	12	0.016519	no	ESPMSL
chr1_1130879_G_C_b38	RP11-34P13.13	3.68	0.000266	0.032841	12	0.008924	no	ESPMSL
chr1_272389_C_T_b38	RP11-34P13.13	3.399	0.000744	0.049918	24	0.014684	no	ESPMSL
chr1_16103_T_G_b38	RP11-34P13.13	3.154	0.00174	0.023933	39	0.007589	no	ESPMSL
chr1_94271_C_G_b38	RP11-34P13.13	3.152	0.00175	0.02449	65	0.007769	no	ESPMSL
chr1_1130902_A_G_b38	RP11-34P13.13	2.949	0.00338	0.022404	36	0.007598	no	ESPMSL
chr1_1152303_T_C_b38	RP11-34P13.13	2.881	0.00418	0.033012	6	0.011459	no	ESPMSL
chr1_1126654_G_A_b38	RP11-34P13.13	-2.828	0.00493	-0.030452	4	0.01077	no	ESPMSL
chr1_1125228_G_A_b38	RP11-34P13.13	-2.822	0.00501	-0.030554	3	0.010827	no	ESPMSL
chr1_1123509_G_A_b38	RP11-34P13.13	-2.815	0.00512	-0.030271	3	0.010753	no	ESPMSL
chr1_1126571_C_T_b38	RP11-34P13.13	-2.814	0.00513	-0.030097	4	0.010695	no	ESPMSL
chr1_1124768_G_T_b38	RP11-34P13.13	-2.793	0.00547	-0.030546	3	0.010935	no	ESPMSL
chr1_1154630_C_A_b38	RP11-34P13.13	2.789	0.00554	0.030972	8	0.011104	no	ESPMSL
chr1_1111337_G_C_b38	RP11-34P13.13	-2.719	0.00683	-0.029412	3	0.010817	no	ESPMSL
chr1_1125772_T_C_b38	RP11-34P13.13	-2.718	0.00685	-0.029024	4	0.010677	no	ESPMSL
chr1_1113121_G_A_b38	RP11-34P13.13	-2.713	0.00696	-0.023943	14	0.008826	no	ESPMSL
chr1_1110693_C_A_b38	RP11-34P13.13	-2.697	0.00729	-0.023806	14	0.008826	no	ESPMSL
chr1_1126128_G_A_b38	RP11-34P13.13	-2.692	0.0074	-0.029098	4	0.010809	no	ESPMSL
chr1_1107147_G_C_b38	RP11-34P13.13	-2.684	0.00757	-0.029219	3	0.010885	no	ESPMSL
chr1_1117566_G_T_b38	RP11-34P13.13	-2.671	0.00787	-0.029028	3	0.010866	no	ESPMSL
chr1_1113191_A_G_b38	RP11-34P13.13	-2.655	0.00824	-0.023467	14	0.008837	no	ESPMSL
chr1_1101579_T_C_b38	RP11-34P13.13	-2.654	0.00826	-0.027788	4	0.010468	no	ESPMSL
chr1_1118072_G_A_b38	RP11-34P13.13	-2.644	0.00852	-0.028837	3	0.010906	no	ESPMSL
chr1_1119172_G_A_b38	RP11-34P13.13	-2.644	0.00852	-0.028837	3	0.010906	no	ESPMSL
chr1_1124663_A_C_b38	RP11-34P13.13	-2.644	0.00852	-0.028837	3	0.010906	no	ESPMSL
chr1_1122128_C_G_b38	RP11-34P13.13	-2.644	0.00853	-0.028752	3	0.010875	no	ESPMSL
chr1_1118447_T_TG_b38	RP11-34P13.13	-2.641	0.0086	-0.02868	3	0.01086	no	ESPMSL
chr1_1120273_C_G_b38	RP11-34P13.13	-2.641	0.0086	-0.02868	3	0.01086	no	ESPMSL
chr1_1120521_C_A_b38	RP11-34P13.13	-2.641	0.0086	-0.02868	3	0.01086	no	ESPMSL
chr1_1121559_T_A_b38	RP11-34P13.13	-2.641	0.0086	-0.02868	3	0.01086	no	ESPMSL
chr1_1101496_T_A_b38	RP11-34P13.13	-2.64	0.00862	-0.026513	6	0.010042	no	ESPMSL
chr1_1123255_G_A_b38	RP11-34P13.13	-2.636	0.00872	-0.028606	3	0.010853	no	ESPMSL
chr1_1127664_A_G_b38	RP11-34P13.13	2.62	0.00913	0.024556	10	0.009372	no	ESPMSL
chr1_1123889_C_T_b38	RP11-34P13.13	-2.614	0.0093	-0.028488	3	0.0109	no	ESPMSL
chr1_1124132_T_TACACACCTGAGCACACACACCTGTGC_b38	RP11-34P13.13	-2.613	0.00933	-0.028467	3	0.010895	no	ESPMSL
chr1_1110093_G_A_b38	RP11-34P13.13	-2.596	0.00979	-0.028251	3	0.010883	no	ESPMSL
chr1_1111481_G_A_b38	RP11-34P13.13	-2.596	0.00979	-0.028251	3	0.010883	no	ESPMSL
chr1_1113703_C_A_b38	RP11-34P13.13	-2.596	0.00979	-0.028251	3	0.010883	no	ESPMSL
chr1_271569_A_G_b38	RP11-34P13.13	8.399	1.8e-15	0.053512	21	0.006371	yes	HRTAA
chr1_271413_C_T_b38	RP11-34P13.13	7.306	2.48e-12	0.060497	7	0.008281	yes	HRTAA
chr1_272378_A_T_b38	RP11-34P13.13	6.364	7.31e-10	0.082547	6	0.012971	yes	HRTAA
chr1_272389_C_T_b38	RP11-34P13.13	6.364	7.31e-10	0.082547	6	0.012971	yes	HRTAA
chr1_264730_T_A_b38	RP11-34P13.13	5.783	1.84e-08	0.078411	13	0.013559	yes	HRTAA
chr1_282551_T_C_b38	RP11-34P13.13	5.581	5.35e-08	0.039182	15	0.007021	yes	HRTAA
chr1_265009_A_T_b38	RP11-34P13.13	5.426	1.19e-07	0.036894	20	0.0068	yes	HRTAA
chr1_286158_A_G_b38	RP11-34P13.13	5.359	1.66e-07	0.042302	7	0.007893	yes	HRTAA
chr1_274015_A_G_b38	RP11-34P13.13	5.329	1.94e-07	0.046316	24	0.008691	yes	HRTAA
chr1_269588_A_G_b38	RP11-34P13.13	4.998	9.83e-07	0.030566	44	0.006115	yes	HRTAA
chr1_107970_G_A_b38	RP11-34P13.13	4.902	1.55e-06	0.035891	3	0.007322	yes	HRTAA
chr1_271147_T_G_b38	RP11-34P13.13	4.838	2.1e-06	0.04294	20	0.008876	yes	HRTAA
chr1_273824_G_T_b38	RP11-34P13.13	4.789	2.63e-06	0.031141	18	0.006503	yes	HRTAA
chr1_280592_T_C_b38	RP11-34P13.13	4.738	3.33e-06	0.033483	11	0.007067	yes	HRTAA
chr1_16103_T_G_b38	RP11-34P13.13	4.623	5.62e-06	0.027855	31	0.006025	yes	HRTAA
chr1_19980_G_A_b38	RP11-34P13.13	4.445	1.23e-05	0.054634	4	0.01229	yes	HRTAA
chr1_280599_T_C_b38	RP11-34P13.13	4.269	2.63e-05	0.032336	8	0.007575	yes	HRTAA
chr1_282616_G_GA_b38	RP11-34P13.13	4.201	3.51e-05	0.030602	9	0.007285	yes	HRTAA
chr1_284741_A_C_b38	RP11-34P13.13	4.19	3.67e-05	0.052892	3	0.012624	yes	HRTAA
chr1_282607_G_A_b38	RP11-34P13.13	4.135	4.61e-05	0.029751	10	0.007195	yes	HRTAA
chr1_280198_C_A_b38	RP11-34P13.13	4.124	4.81e-05	0.043095	4	0.010449	yes	HRTAA
chr1_264681_A_G_b38	RP11-34P13.13	4.104	5.23e-05	0.038445	7	0.009368	yes	HRTAA
chr1_94271_C_G_b38	RP11-34P13.13	3.873	0.000132	0.023128	57	0.005971	yes	HRTAA
chr1_272548_A_C_b38	RP11-34P13.13	3.679	0.000278	0.036372	21	0.009887	yes	HRTAA
chr1_598818_C_T_b38	RP11-34P13.13	3.582	0.000398	0.034774	3	0.009708	yes	HRTAA
chr1_13613_T_A_b38	RP11-34P13.13	-3.535	0.000471	-0.027939	4	0.007902	yes	HRTAA
chr1_286145_C_CAT_b38	RP11-34P13.13	3.46	0.000617	0.0263	6	0.0076	yes	HRTAA
chr1_272164_G_A_b38	RP11-34P13.13	3.294	0.00111	0.026939	29	0.008179	yes	HRTAA
chr1_275583_TTTTA_T_b38	RP11-34P13.13	3.121	0.00198	0.022166	10	0.007102	yes	HRTAA
chr1_272488_C_G_b38	RP11-34P13.13	3.046	0.00253	0.022922	19	0.007526	yes	HRTAA
chr1_924305_G_A_b38	RP11-34P13.13	3.032	0.00264	0.018598	26	0.006134	yes	HRTAA
chr1_277677_G_T_b38	RP11-34P13.13	2.967	0.00324	0.054385	6	0.018327	yes	HRTAA
chr1_958061_C_CTTT_b38	RP11-34P13.13	2.941	0.00352	0.044459	5	0.015116	yes	HRTAA
chr1_285441_C_T_b38	RP11-34P13.13	2.718	0.00695	0.021382	3	0.007867	yes	HRTAA
chr1_285109_CA_C_b38	RP11-34P13.13	-2.695	0.00743	-0.024282	4	0.009009	yes	HRTAA
chr1_590378_T_C_b38	RP11-34P13.13	2.623	0.00916	0.024002	17	0.00915	yes	HRTAA
chr1_518864_T_A_b38	RP11-34P13.13	8.776	1.29e-16	0.071485	4	0.008146	no	HRTAA
chr1_20316_GA_G_b38	RP11-34P13.13	7.875	6.25e-14	0.056947	4	0.007232	no	HRTAA
chr1_94570_T_G_b38	RP11-34P13.13	7.258	3.37e-12	0.05441	6	0.007497	no	HRTAA
chr1_187323_G_A_b38	RP11-34P13.13	-5.542	6.55e-08	-0.041942	4	0.007569	no	HRTAA
chr1_20547_A_G_b38	RP11-34P13.13	4.525	8.71e-06	0.035231	4	0.007786	no	HRTAA
chr1_19322_C_T_b38	RP11-34P13.13	-4.22	3.24e-05	-0.03804	12	0.009014	no	HRTAA
chr1_92930_G_T_b38	RP11-34P13.13	4.041	6.77e-05	0.049359	5	0.012215	no	HRTAA
chr1_187331_C_G_b38	RP11-34P13.13	-3.88	0.000128	-0.030524	7	0.007867	no	HRTAA
chr1_286172_G_GTC_b38	RP11-34P13.13	-3.637	0.000324	-0.028398	8	0.007808	no	HRTAA
chr1_281912_C_G_b38	RP11-34P13.13	-3.557	0.000435	-0.024129	20	0.006783	no	HRTAA
chr1_262698_G_A_b38	RP11-34P13.13	-2.988	0.00304	-0.019513	25	0.00653	no	HRTAA
chr1_279524_G_GT_b38	RP11-34P13.13	-2.969	0.00322	-0.019097	25	0.006432	no	HRTAA
chr1_1002417_T_A_b38	RP11-34P13.13	2.826	0.00502	0.019642	21	0.00695	no	HRTAA
chr1_281876_AC_A_b38	RP11-34P13.13	-2.825	0.00505	-0.018501	26	0.00655	no	HRTAA
chr1_1099494_T_A_b38	RP11-34P13.13	-2.798	0.00547	-0.029554	4	0.010561	no	HRTAA
chr1_1099496_C_T_b38	RP11-34P13.13	-2.71	0.00712	-0.02728	5	0.010067	no	HRTAA
chr1_271569_A_G_b38	RP11-34P13.13	5.392	1.13e-07	0.061187	27	0.011347	yes	LUNG
chr1_94570_T_G_b38	RP11-34P13.13	5.043	6.69e-07	0.06639	8	0.013165	yes	LUNG
chr1_280599_T_C_b38	RP11-34P13.13	4.673	3.95e-06	0.058387	11	0.012496	yes	LUNG
chr1_280592_T_C_b38	RP11-34P13.13	4.63	4.8e-06	0.054765	18	0.011828	yes	LUNG
chr1_272378_A_T_b38	RP11-34P13.13	4.454	1.07e-05	0.098864	11	0.022199	yes	LUNG
chr1_265009_A_T_b38	RP11-34P13.13	4.451	1.08e-05	0.050529	27	0.011351	yes	LUNG
chr1_271413_C_T_b38	RP11-34P13.13	4.303	2.08e-05	0.067489	6	0.015685	yes	LUNG
chr1_274015_A_G_b38	RP11-34P13.13	4.224	2.92e-05	0.060152	31	0.014242	yes	LUNG
chr1_272389_C_T_b38	RP11-34P13.13	4.215	3.02e-05	0.083699	24	0.019856	yes	LUNG
chr1_13613_T_A_b38	RP11-34P13.13	-4.194	3.32e-05	-0.055407	6	0.013213	yes	LUNG
chr1_273824_G_T_b38	RP11-34P13.13	4.161	3.8e-05	0.044964	30	0.010805	yes	LUNG
chr1_269588_A_G_b38	RP11-34P13.13	4.122	4.49e-05	0.044946	61	0.010905	yes	LUNG
chr1_92930_G_T_b38	RP11-34P13.13	4.048	6.09e-05	0.086099	6	0.021268	yes	LUNG
chr1_272548_A_C_b38	RP11-34P13.13	3.897	0.000112	0.062549	28	0.01605	yes	LUNG
chr1_19322_C_T_b38	RP11-34P13.13	-3.836	0.000143	-0.059174	12	0.015426	yes	LUNG
chr1_280726_A_AACACACACAC_b38	RP11-34P13.13	3.732	0.000215	0.066127	6	0.01772	yes	LUNG
chr1_264730_T_A_b38	RP11-34P13.13	3.559	0.000412	0.0804	15	0.022589	yes	LUNG
chr1_272164_G_A_b38	RP11-34P13.13	3.209	0.00143	0.043718	40	0.013623	yes	LUNG
chr1_272680_G_A_b38	RP11-34P13.13	3.179	0.00158	0.042887	12	0.013492	yes	LUNG
chr1_102664_A_G_b38	RP11-34P13.13	-3.059	0.00235	-0.041925	11	0.013704	yes	LUNG
chr1_264681_A_G_b38	RP11-34P13.13	3.006	0.0028	0.047417	10	0.015776	yes	LUNG
chr1_271147_T_G_b38	RP11-34P13.13	2.999	0.00286	0.047977	19	0.015995	yes	LUNG
chr1_974039_C_T_b38	RP11-34P13.13	2.954	0.0033	0.034736	22	0.011758	yes	LUNG
chr1_1002415_C_CATTT_b38	RP11-34P13.13	2.821	0.005	0.031325	36	0.011103	yes	LUNG
chr1_202643_C_G_b38	RP11-34P13.13	2.759	0.00603	0.054211	3	0.019648	yes	LUNG
chr1_272488_C_G_b38	RP11-34P13.13	2.674	0.00778	0.034314	23	0.012835	yes	LUNG
chr1_272512_A_G_b38	RP11-34P13.13	2.623	0.00903	0.039864	23	0.015201	yes	LUNG
chr1_971643_G_A_b38	RP11-34P13.13	-2.601	0.00961	-0.076304	3	0.029339	yes	LUNG
chr1_1168162_T_C_b38	RP11-34P13.13	2.596	0.00975	0.041132	6	0.015845	yes	LUNG
chr1_518864_T_A_b38	RP11-34P13.13	8.133	4.22e-15	0.115296	5	0.014176	no	LUNG
chr1_187323_G_A_b38	RP11-34P13.13	-6.366	4.84e-10	-0.08197	5	0.012876	no	LUNG
chr1_20316_GA_G_b38	RP11-34P13.13	5.448	8.45e-08	0.068752	6	0.012619	no	LUNG
chr1_187331_C_G_b38	RP11-34P13.13	-4.946	1.08e-06	-0.064813	7	0.013104	no	LUNG
chr1_20547_A_G_b38	RP11-34P13.13	4.688	3.67e-06	0.060767	5	0.012961	no	LUNG
chr1_286158_A_G_b38	RP11-34P13.13	3.982	7.98e-05	0.054606	5	0.013713	no	LUNG
chr1_19980_G_A_b38	RP11-34P13.13	3.374	0.000805	0.076327	5	0.02262	no	LUNG
chr1_414869_A_G_b38	RP11-34P13.13	2.996	0.00289	0.06875	4	0.02295	no	LUNG
chr1_286145_C_CAT_b38	RP11-34P13.13	2.816	0.00508	0.03708	5	0.013168	no	LUNG
chr1_275583_TTTTA_T_b38	RP11-34P13.13	2.612	0.00931	0.030233	18	0.011576	no	LUNG
chr1_689819_C_T_b38	RP11-34P13.13	2.661	0.00887	0.055411	3	0.020821	yes	SLVRYG
chr1_272488_C_G_b38	RP11-34P13.13	2.638	0.00946	0.047985	9	0.01819	yes	SLVRYG
chr1_681082_T_C_b38	RP11-34P13.13	3.495	0.000669	0.056659	6	0.016213	no	SLVRYG
chr1_518864_T_A_b38	RP11-34P13.13	11.039	2.67e-25	0.181771	3	0.016466	yes	NERVET
chr1_20316_GA_G_b38	RP11-34P13.13	9.853	6.5e-21	0.143481	6	0.014562	yes	NERVET
chr1_271569_A_G_b38	RP11-34P13.13	9.764	1.36e-20	0.124189	29	0.012719	yes	NERVET
chr1_280674_A_G_b38	RP11-34P13.13	9.671	2.9e-20	0.154894	3	0.016017	yes	NERVET
chr1_271413_C_T_b38	RP11-34P13.13	8.567	1.61e-16	0.150707	6	0.017591	yes	NERVET
chr1_280599_T_C_b38	RP11-34P13.13	8.431	4.43e-16	0.116861	14	0.013861	yes	NERVET
chr1_265009_A_T_b38	RP11-34P13.13	8.052	7.01e-15	0.103286	25	0.012827	yes	NERVET
chr1_269588_A_G_b38	RP11-34P13.13	7.455	4.49e-13	0.092976	64	0.012472	yes	NERVET
chr1_280592_T_C_b38	RP11-34P13.13	7.395	6.72e-13	0.098932	21	0.013378	yes	NERVET
chr1_20547_A_G_b38	RP11-34P13.13	6.679	6.96e-11	0.101052	6	0.015131	yes	NERVET
chr1_280726_A_AACACACACAC_b38	RP11-34P13.13	6.568	1.38e-10	0.136975	6	0.020856	yes	NERVET
chr1_280198_C_A_b38	RP11-34P13.13	6.548	1.56e-10	0.147727	5	0.022561	yes	NERVET
chr1_273824_G_T_b38	RP11-34P13.13	6.393	3.99e-10	0.081615	28	0.012767	yes	NERVET
chr1_272548_A_C_b38	RP11-34P13.13	6.344	5.35e-10	0.114058	28	0.017978	yes	NERVET
chr1_274015_A_G_b38	RP11-34P13.13	6.262	8.73e-10	0.104067	29	0.01662	yes	NERVET
chr1_13613_T_A_b38	RP11-34P13.13	-6.097	2.28e-09	-0.092405	8	0.015155	yes	NERVET
chr1_282551_T_C_b38	RP11-34P13.13	6	4e-09	0.084868	17	0.014145	yes	NERVET
chr1_264681_A_G_b38	RP11-34P13.13	5.401	1.06e-07	0.098712	11	0.018275	yes	NERVET
chr1_19322_C_T_b38	RP11-34P13.13	-5.342	1.45e-07	-0.096592	17	0.018081	yes	NERVET
chr1_19980_G_A_b38	RP11-34P13.13	5.313	1.68e-07	0.145331	5	0.027354	yes	NERVET
chr1_16103_T_G_b38	RP11-34P13.13	5.177	3.37e-07	0.062889	44	0.012147	yes	NERVET
chr1_284741_A_C_b38	RP11-34P13.13	5.17	3.49e-07	0.123589	6	0.023905	yes	NERVET
chr1_282607_G_A_b38	RP11-34P13.13	4.997	8.29e-07	0.071158	12	0.01424	yes	NERVET
chr1_282721_A_G_b38	RP11-34P13.13	4.988	8.67e-07	0.077116	6	0.015461	yes	NERVET
chr1_282728_T_C_b38	RP11-34P13.13	4.876	1.49e-06	0.074585	6	0.015296	yes	NERVET
chr1_286158_A_G_b38	RP11-34P13.13	4.837	1.8e-06	0.073739	9	0.015244	yes	NERVET
chr1_282616_G_GA_b38	RP11-34P13.13	4.788	2.27e-06	0.067979	12	0.014198	yes	NERVET
chr1_271147_T_G_b38	RP11-34P13.13	4.776	2.4e-06	0.093253	18	0.019524	yes	NERVET
chr1_272680_G_A_b38	RP11-34P13.13	4.505	8.43e-06	0.077291	5	0.017157	yes	NERVET
chr1_272164_G_A_b38	RP11-34P13.13	4.276	2.32e-05	0.071284	41	0.016672	yes	NERVET
chr1_285675_T_C_b38	RP11-34P13.13	4.148	4e-05	0.112002	6	0.027003	yes	NERVET
chr1_1008307_G_C_b38	RP11-34P13.13	3.742	0.000206	0.041105	84	0.010984	yes	NERVET
chr1_1009184_T_C_b38	RP11-34P13.13	3.71	0.000233	0.040242	84	0.010848	yes	NERVET
chr1_1014733_GAAGT_G_b38	RP11-34P13.13	-3.708	0.000234	-0.039994	136	0.010785	yes	NERVET
chr1_1016623_G_A_b38	RP11-34P13.13	3.68	0.000261	0.041452	74	0.011266	yes	NERVET
chr1_1014863_A_C_b38	RP11-34P13.13	3.659	0.000283	0.040344	80	0.011026	yes	NERVET
chr1_1015915_C_T_b38	RP11-34P13.13	-3.611	0.000339	-0.039171	134	0.010848	yes	NERVET
chr1_285175_C_T_b38	RP11-34P13.13	3.6	0.000353	0.065831	8	0.018288	yes	NERVET
chr1_1005429_C_CA_b38	RP11-34P13.13	3.572	0.000392	0.039702	81	0.011115	yes	NERVET
chr1_1005904_C_T_b38	RP11-34P13.13	3.572	0.000392	0.039702	81	0.011115	yes	NERVET
chr1_1005954_G_A_b38	RP11-34P13.13	3.572	0.000392	0.039702	81	0.011115	yes	NERVET
chr1_1017114_A_AT_b38	RP11-34P13.13	3.563	0.000405	0.041916	62	0.011765	yes	NERVET
chr1_1015903_C_T_b38	RP11-34P13.13	-3.535	0.000448	-0.038457	132	0.010878	yes	NERVET
chr1_275583_TTTTA_T_b38	RP11-34P13.13	3.531	0.000456	0.047513	16	0.013457	yes	NERVET
chr1_978953_C_G_b38	RP11-34P13.13	-3.496	0.000518	-0.036596	120	0.010469	yes	NERVET
chr1_1014228_G_A_b38	RP11-34P13.13	3.437	0.000641	0.037179	89	0.010816	yes	NERVET
chr1_1016184_A_G_b38	RP11-34P13.13	3.383	0.000777	0.036718	88	0.010853	yes	NERVET
chr1_271102_G_A_b38	RP11-34P13.13	3.306	0.00102	0.05259	3	0.015909	yes	NERVET
chr1_941767_G_A_b38	RP11-34P13.13	3.303	0.00103	0.043616	26	0.013206	yes	NERVET
chr1_277834_G_A_b38	RP11-34P13.13	3.267	0.00117	0.080159	14	0.024533	yes	NERVET
chr1_264730_T_A_b38	RP11-34P13.13	3.236	0.0013	0.087202	17	0.026944	yes	NERVET
chr1_799080_TG_T_b38	RP11-34P13.13	3.1	0.00206	0.040386	31	0.01303	yes	NERVET
chr1_995371_C_G_b38	RP11-34P13.13	3.06	0.00234	0.033567	82	0.010971	yes	NERVET
chr1_981210_G_A_b38	RP11-34P13.13	3.004	0.00281	0.043171	19	0.01437	yes	NERVET
chr1_269781_C_T_b38	RP11-34P13.13	-2.974	0.00309	-0.0479	3	0.016106	yes	NERVET
chr1_995153_C_G_b38	RP11-34P13.13	2.951	0.00333	0.032269	91	0.010937	yes	NERVET
chr1_928622_G_C_b38	RP11-34P13.13	2.945	0.00339	0.041699	15	0.014159	yes	NERVET
chr1_1019397_C_A_b38	RP11-34P13.13	-2.926	0.0036	-0.032955	137	0.011261	yes	NERVET
chr1_995187_A_G_b38	RP11-34P13.13	2.917	0.0037	0.031896	92	0.010933	yes	NERVET
chr1_1006159_C_T_b38	RP11-34P13.13	2.9	0.00391	0.031994	90	0.011033	yes	NERVET
chr1_975014_C_T_b38	RP11-34P13.13	2.898	0.00394	0.031803	77	0.010975	yes	NERVET
chr1_1020697_C_T_b38	RP11-34P13.13	2.896	0.00395	0.034154	47	0.011792	yes	NERVET
chr1_588568_C_T_b38	RP11-34P13.13	-2.88	0.00416	-0.042935	6	0.014906	yes	NERVET
chr1_1020217_G_T_b38	RP11-34P13.13	2.855	0.0045	0.033284	54	0.01166	yes	NERVET
chr1_715769_C_T_b38	RP11-34P13.13	2.854	0.00451	0.061939	14	0.0217	yes	NERVET
chr1_1020681_A_AG_b38	RP11-34P13.13	2.853	0.00453	0.033823	46	0.011856	yes	NERVET
chr1_965666_ACC_A_b38	RP11-34P13.13	2.847	0.00461	0.037186	28	0.013061	yes	NERVET
chr1_285441_C_T_b38	RP11-34P13.13	2.844	0.00466	0.043613	4	0.015336	yes	NERVET
chr1_1004625_A_G_b38	RP11-34P13.13	2.84	0.00471	0.031386	90	0.011052	yes	NERVET
chr1_180958_CCCCTAA_C_b38	RP11-34P13.13	2.791	0.00548	0.033415	51	0.011974	yes	NERVET
chr1_81587_C_T_b38	RP11-34P13.13	-2.722	0.00674	-0.065399	3	0.02403	yes	NERVET
chr1_1018652_C_G_b38	RP11-34P13.13	2.7	0.00719	0.031564	53	0.01169	yes	NERVET
chr1_945259_TC_T_b38	RP11-34P13.13	2.69	0.00741	0.035201	27	0.013088	yes	NERVET
chr1_1004716_C_T_b38	RP11-34P13.13	-2.688	0.00745	-0.029521	125	0.010982	yes	NERVET
chr1_1018754_G_A_b38	RP11-34P13.13	2.675	0.00773	0.031168	53	0.01165	yes	NERVET
chr1_946653_G_A_b38	RP11-34P13.13	2.652	0.00828	0.0358	24	0.013499	yes	NERVET
chr1_1021740_G_C_b38	RP11-34P13.13	2.646	0.00842	0.030924	53	0.011687	yes	NERVET
chr1_954724_G_A_b38	RP11-34P13.13	2.645	0.00845	0.035571	23	0.013448	yes	NERVET
chr1_788511_G_C_b38	RP11-34P13.13	-2.642	0.00851	-0.050264	14	0.019022	yes	NERVET
chr1_779047_G_A_b38	RP11-34P13.13	-2.623	0.009	-0.050581	14	0.019281	yes	NERVET
chr1_929839_G_A_b38	RP11-34P13.13	2.612	0.00928	0.036875	16	0.014115	yes	NERVET
chr1_277226_A_C_b38	RP11-34P13.13	2.6	0.00962	0.057976	12	0.022297	yes	NERVET
chr1_276113_T_C_b38	RP11-34P13.13	2.597	0.00971	0.051769	3	0.019935	yes	NERVET
chr1_202170_C_T_b38	RP11-34P13.13	8.527	2.17e-16	0.125339	3	0.0147	no	NERVET
chr1_94570_T_G_b38	RP11-34P13.13	7.151	3.41e-12	0.112665	8	0.015756	no	NERVET
chr1_266093_C_G_b38	RP11-34P13.13	6.961	1.17e-11	0.100474	3	0.014434	no	NERVET
chr1_107970_G_A_b38	RP11-34P13.13	6.052	2.97e-09	0.089289	3	0.014754	no	NERVET
chr1_187331_C_G_b38	RP11-34P13.13	-5.347	1.41e-07	-0.083998	7	0.01571	no	NERVET
chr1_187323_G_A_b38	RP11-34P13.13	-5.188	3.2e-07	-0.080631	4	0.015543	no	NERVET
chr1_272378_A_T_b38	RP11-34P13.13	5.183	3.27e-07	0.137331	14	0.026494	no	NERVET
chr1_272389_C_T_b38	RP11-34P13.13	4.878	1.48e-06	0.115966	26	0.023771	no	NERVET
chr1_201322_A_G_b38	RP11-34P13.13	4.845	1.73e-06	0.167047	3	0.034475	no	NERVET
chr1_1019479_TG_T_b38	RP11-34P13.13	-3.824	0.00015	-0.039705	143	0.010384	no	NERVET
chr1_272505_C_G_b38	RP11-34P13.13	3.761	0.000191	0.065066	22	0.017298	no	NERVET
chr1_92930_G_T_b38	RP11-34P13.13	3.692	0.000249	0.09275	6	0.02512	no	NERVET
chr1_978509_G_A_b38	RP11-34P13.13	-3.529	0.000458	-0.037362	128	0.010586	no	NERVET
chr1_1021472_C_T_b38	RP11-34P13.13	-3.505	0.000502	-0.038098	137	0.010871	no	NERVET
chr1_984121_G_T_b38	RP11-34P13.13	-3.483	0.000543	-0.036942	143	0.010606	no	NERVET
chr1_272488_C_G_b38	RP11-34P13.13	3.451	0.000609	0.053453	22	0.015487	no	NERVET
chr1_1015297_T_C_b38	RP11-34P13.13	-3.371	0.000811	-0.036603	131	0.010857	no	NERVET
chr1_1008588_C_T_b38	RP11-34P13.13	-3.337	0.000917	-0.036658	140	0.010987	no	NERVET
chr1_979472_G_C_b38	RP11-34P13.13	-3.284	0.0011	-0.034845	129	0.01061	no	NERVET
chr1_94271_C_G_b38	RP11-34P13.13	3.266	0.00117	0.041434	69	0.012686	no	NERVET
chr1_272512_A_G_b38	RP11-34P13.13	3.181	0.00157	0.05696	22	0.017906	no	NERVET
chr1_1017048_G_A_b38	RP11-34P13.13	-3.18	0.00157	-0.035616	134	0.011202	no	NERVET
chr1_981454_G_A_b38	RP11-34P13.13	-3.116	0.00195	-0.03304	125	0.010605	no	NERVET
chr1_1023775_G_A_b38	RP11-34P13.13	-3.109	0.00199	-0.033586	129	0.010803	no	NERVET
chr1_983193_A_G_b38	RP11-34P13.13	-3.103	0.00203	-0.032903	126	0.010602	no	NERVET
chr1_285109_CAA_C_b38	RP11-34P13.13	3.08	0.0022	0.081279	6	0.026391	no	NERVET
chr1_1039411_T_TGG_b38	RP11-34P13.13	-3.022	0.00265	-0.034533	106	0.011428	no	NERVET
chr1_1018572_G_A_b38	RP11-34P13.13	-3.004	0.00281	-0.033867	137	0.011274	no	NERVET
chr1_1000731_C_T_b38	RP11-34P13.13	-2.97	0.00313	-0.032272	133	0.010866	no	NERVET
chr1_986336_C_A_b38	RP11-34P13.13	-2.951	0.00333	-0.032925	137	0.011158	no	NERVET
chr1_632821_T_C_b38	RP11-34P13.13	2.939	0.00346	0.090135	3	0.030673	no	NERVET
chr1_983004_G_T_b38	RP11-34P13.13	-2.935	0.0035	-0.031615	144	0.010771	no	NERVET
chr1_973693_C_T_b38	RP11-34P13.13	-2.933	0.00352	-0.032201	79	0.010979	no	NERVET
chr1_995982_G_A_b38	RP11-34P13.13	2.924	0.00363	0.032224	83	0.011021	no	NERVET
chr1_979560_T_C_b38	RP11-34P13.13	-2.912	0.00377	-0.031419	134	0.010791	no	NERVET
chr1_989068_GTTGA_G_b38	RP11-34P13.13	-2.911	0.00377	-0.031926	128	0.010966	no	NERVET
chr1_998410_G_A_b38	RP11-34P13.13	-2.907	0.00382	-0.03168	129	0.010897	no	NERVET
chr1_1067054_C_T_b38	RP11-34P13.13	-2.902	0.00389	-0.032625	98	0.011242	no	NERVET
chr1_860178_C_CTTTTTTTT_b38	RP11-34P13.13	-2.872	0.00427	-0.082144	3	0.028605	no	NERVET
chr1_1005757_AGCCCCCGCAGCAGT_A_b38	RP11-34P13.13	-2.854	0.00451	-0.03129	118	0.010963	no	NERVET
chr1_1023789_G_C_b38	RP11-34P13.13	-2.824	0.00495	-0.030258	136	0.010714	no	NERVET
chr1_799082_G_A_b38	RP11-34P13.13	-2.822	0.00498	-0.045893	9	0.016262	no	NERVET
chr1_286158_A_ATGTG_b38	RP11-34P13.13	2.788	0.00553	0.071754	5	0.025738	no	NERVET
chr1_1057439_G_A_b38	RP11-34P13.13	-2.776	0.00572	-0.030163	130	0.010865	no	NERVET
chr1_995512_T_C_b38	RP11-34P13.13	2.757	0.00606	0.030039	96	0.010894	no	NERVET
chr1_995786_A_G_b38	RP11-34P13.13	2.754	0.00612	0.029912	97	0.010862	no	NERVET
chr1_1052514_C_CGT_b38	RP11-34P13.13	-2.663	0.00802	-0.029756	112	0.011174	no	NERVET
chr1_967384_C_G_b38	RP11-34P13.13	-2.655	0.00821	-0.031453	107	0.011848	no	NERVET
chr1_995508_ATTTTT_A_b38	RP11-34P13.13	-2.65	0.00833	-0.029099	125	0.010982	no	NERVET
chr1_1027511_C_T_b38	RP11-34P13.13	-2.636	0.00867	-0.028744	122	0.010904	no	NERVET
chr1_1028320_GCC_G_b38	RP11-34P13.13	-2.618	0.00913	-0.033723	87	0.012879	no	NERVET
chr1_1032278_C_T_b38	RP11-34P13.13	-2.616	0.00919	-0.029478	140	0.011269	no	NERVET
chr1_1056597_G_A_b38	RP11-34P13.13	-2.614	0.00923	-0.026999	151	0.010327	no	NERVET
chr1_265009_A_T_b38	RP11-34P13.13	4.233	4.39e-05	0.123885	4	0.029269	yes	OVARY
chr1_280599_T_C_b38	RP11-34P13.13	3.998	0.000108	0.132929	4	0.033245	yes	OVARY
chr1_271569_A_G_b38	RP11-34P13.13	3.922	0.000143	0.123012	4	0.031367	yes	OVARY
chr1_280592_T_C_b38	RP11-34P13.13	3.827	0.000202	0.120197	5	0.031405	yes	OVARY
chr1_271413_C_T_b38	RP11-34P13.13	3.377	0.000972	0.13539	3	0.040086	yes	OVARY
chr1_282551_T_C_b38	RP11-34P13.13	3.145	0.00207	0.101117	4	0.032157	yes	OVARY
chr1_878835_A_G_b38	RP11-34P13.13	2.738	0.00707	0.103128	4	0.037669	yes	OVARY
chr1_14930_A_G_b38	RP11-34P13.13	2.704	0.0078	0.070777	16	0.026178	yes	OVARY
chr1_108310_T_C_b38	RP11-34P13.13	2.666	0.00867	0.065011	25	0.024383	yes	OVARY
chr1_591460_T_C_b38	RP11-34P13.13	-2.642	0.00928	-0.122793	3	0.046476	yes	OVARY
chr1_94271_C_G_b38	RP11-34P13.13	5.482	2.17e-07	0.143683	18	0.026209	no	OVARY
chr1_273824_G_T_b38	RP11-34P13.13	5.217	3.82e-07	0.033057	23	0.006336	yes	PNCREAS
chr1_271569_A_G_b38	RP11-34P13.13	4.88	1.9e-06	0.034754	19	0.007122	yes	PNCREAS
chr1_269588_A_G_b38	RP11-34P13.13	4.42	1.47e-05	0.030436	34	0.006886	yes	PNCREAS
chr1_981454_G_A_b38	RP11-34P13.13	-3.655	0.000314	-0.020154	76	0.005514	yes	PNCREAS
chr1_983193_A_G_b38	RP11-34P13.13	-3.634	0.00034	-0.019989	76	0.005501	yes	PNCREAS
chr1_984121_G_T_b38	RP11-34P13.13	-3.468	0.000618	-0.019195	80	0.005535	yes	PNCREAS
chr1_284741_A_C_b38	RP11-34P13.13	3.418	0.000737	0.044215	3	0.012936	yes	PNCREAS
chr1_286158_A_G_b38	RP11-34P13.13	3.385	0.000828	0.029834	3	0.008814	yes	PNCREAS
chr1_978953_C_G_b38	RP11-34P13.13	-3.345	0.00095	-0.018311	71	0.005475	yes	PNCREAS
chr1_1132482_T_C_b38	RP11-34P13.13	3.303	0.0011	0.025789	7	0.007807	yes	PNCREAS
chr1_983004_G_T_b38	RP11-34P13.13	-3.252	0.0013	-0.01824	86	0.005608	yes	PNCREAS
chr1_1130717_G_A_b38	RP11-34P13.13	3.232	0.0014	0.026429	6	0.008178	yes	PNCREAS
chr1_286145_C_CAT_b38	RP11-34P13.13	3.225	0.00143	0.027621	3	0.008564	yes	PNCREAS
chr1_282607_G_A_b38	RP11-34P13.13	3.191	0.0016	0.024365	8	0.007635	yes	PNCREAS
chr1_971790_AG_A_b38	RP11-34P13.13	3.183	0.00164	0.018433	51	0.005791	yes	PNCREAS
chr1_280726_A_AACACACACAC_b38	RP11-34P13.13	3.181	0.00165	0.03624	4	0.011392	yes	PNCREAS
chr1_13613_T_A_b38	RP11-34P13.13	-3.168	0.00173	-0.026348	3	0.008316	yes	PNCREAS
chr1_1130902_A_G_b38	RP11-34P13.13	3.114	0.00206	0.02019	24	0.006483	yes	PNCREAS
chr1_978509_G_A_b38	RP11-34P13.13	-3.018	0.00281	-0.01676	78	0.005553	yes	PNCREAS
chr1_280592_T_C_b38	RP11-34P13.13	3.018	0.00281	0.022142	13	0.007337	yes	PNCREAS
chr1_1134273_C_T_b38	RP11-34P13.13	3.017	0.00282	0.021619	10	0.007167	yes	PNCREAS
chr1_1130420_C_T_b38	RP11-34P13.13	3.016	0.00282	0.02394	7	0.007937	yes	PNCREAS
chr1_282616_G_GA_b38	RP11-34P13.13	2.97	0.00327	0.023435	6	0.007891	yes	PNCREAS
chr1_271413_C_T_b38	RP11-34P13.13	2.945	0.00353	0.026354	8	0.008948	yes	PNCREAS
chr1_1133503_G_A_b38	RP11-34P13.13	2.942	0.00357	0.024048	6	0.008174	yes	PNCREAS
chr1_94134_C_T_b38	RP11-34P13.13	-2.937	0.00362	-0.023791	6	0.008101	yes	PNCREAS
chr1_1056425_GCGGGTA_G_b38	RP11-34P13.13	-2.931	0.0037	-0.024047	3	0.008206	yes	PNCREAS
chr1_979560_T_C_b38	RP11-34P13.13	-2.908	0.00397	-0.016122	84	0.005544	yes	PNCREAS
chr1_264730_T_A_b38	RP11-34P13.13	2.901	0.00405	0.037818	12	0.013034	yes	PNCREAS
chr1_979472_G_C_b38	RP11-34P13.13	-2.877	0.00437	-0.015932	77	0.005538	yes	PNCREAS
chr1_284929_A_G_b38	RP11-34P13.13	2.872	0.00443	0.034124	6	0.011883	yes	PNCREAS
chr1_981210_G_A_b38	RP11-34P13.13	2.871	0.00444	0.023246	6	0.008096	yes	PNCREAS
chr1_1132196_G_A_b38	RP11-34P13.13	2.842	0.00485	0.02262	7	0.007958	yes	PNCREAS
chr1_834583_G_A_b38	RP11-34P13.13	2.837	0.00492	0.024454	4	0.008618	yes	PNCREAS
chr1_600311_T_C_b38	RP11-34P13.13	-2.8	0.00551	-0.033436	5	0.011941	yes	PNCREAS
chr1_973693_C_T_b38	RP11-34P13.13	-2.785	0.00577	-0.015281	54	0.005487	yes	PNCREAS
chr1_969663_CAT_C_b38	RP11-34P13.13	2.741	0.00657	0.017568	25	0.006409	yes	PNCREAS
chr1_1133966_C_T_b38	RP11-34P13.13	2.731	0.00676	0.021899	6	0.008018	yes	PNCREAS
chr1_975093_G_A_b38	RP11-34P13.13	2.708	0.00724	0.020343	10	0.007512	yes	PNCREAS
chr1_863421_G_A_b38	RP11-34P13.13	2.678	0.0079	0.025625	3	0.009569	yes	PNCREAS
chr1_1002415_C_CATTTTT_b38	RP11-34P13.13	-2.673	0.00801	-0.017434	26	0.006521	yes	PNCREAS
chr1_601606_G_T_b38	RP11-34P13.13	-2.672	0.00804	-0.018594	10	0.006959	yes	PNCREAS
chr1_726821_G_A_b38	RP11-34P13.13	2.648	0.00861	0.020549	20	0.007759	yes	PNCREAS
chr1_858952_G_A_b38	RP11-34P13.13	2.628	0.00913	0.023438	5	0.008919	yes	PNCREAS
chr1_868739_A_T_b38	RP11-34P13.13	2.625	0.00921	0.028168	3	0.010732	yes	PNCREAS
chr1_94321_C_T_b38	RP11-34P13.13	-2.622	0.00928	-0.021646	5	0.008255	yes	PNCREAS
chr1_19322_C_T_b38	RP11-34P13.13	-2.622	0.00929	-0.026751	7	0.010204	yes	PNCREAS
chr1_835506_G_A_b38	RP11-34P13.13	2.611	0.00958	0.023251	4	0.008906	yes	PNCREAS
chr1_1129155_G_C_b38	RP11-34P13.13	2.607	0.0097	0.017152	19	0.00658	yes	PNCREAS
chr1_878767_G_C_b38	RP11-34P13.13	2.605	0.00974	0.02788	7	0.010702	yes	PNCREAS
chr1_1020697_C_T_b38	RP11-34P13.13	2.599	0.0099	0.015417	32	0.005931	yes	PNCREAS
chr1_94570_T_G_b38	RP11-34P13.13	5.673	3.88e-08	0.045859	4	0.008083	no	PNCREAS
chr1_265009_A_T_b38	RP11-34P13.13	3.714	0.000252	0.024837	24	0.006688	no	PNCREAS
chr1_272378_A_T_b38	RP11-34P13.13	3.318	0.00104	0.042739	6	0.012882	no	PNCREAS
chr1_94808_CCTTTTCTTTT_C_b38	RP11-34P13.13	-3.073	0.00236	-0.046239	3	0.015048	no	PNCREAS
chr1_967384_C_G_b38	RP11-34P13.13	-3	0.00297	-0.018565	66	0.006187	no	PNCREAS
chr1_983747_T_C_b38	RP11-34P13.13	2.965	0.00332	0.022133	9	0.007464	no	PNCREAS
chr1_511562_C_T_b38	RP11-34P13.13	2.818	0.00522	0.020037	17	0.00711	no	PNCREAS
chr1_274015_A_G_b38	RP11-34P13.13	2.774	0.00596	0.023298	25	0.0084	no	PNCREAS
chr1_260937_C_T_b38	RP11-34P13.13	2.744	0.00652	0.028251	3	0.010297	no	PNCREAS
chr1_92930_G_T_b38	RP11-34P13.13	2.715	0.00709	0.03711	3	0.013668	no	PNCREAS
chr1_1009184_T_C_b38	RP11-34P13.13	2.685	0.00775	0.015277	45	0.00569	no	PNCREAS
chr1_278075_T_C_b38	RP11-34P13.13	2.679	0.00788	0.045482	3	0.016977	no	PNCREAS
chr1_982260_G_A_b38	RP11-34P13.13	2.627	0.00916	0.020421	7	0.007774	no	PNCREAS
chr1_982858_C_G_b38	RP11-34P13.13	2.627	0.00916	0.020421	7	0.007774	no	PNCREAS
chr1_19322_C_T_b38	RP11-34P13.13	-5.574	8.17e-08	-0.155019	6	0.027812	yes	PTTARY
chr1_280592_T_C_b38	RP11-34P13.13	4.775	3.5e-06	0.106183	8	0.022235	yes	PTTARY
chr1_264730_T_A_b38	RP11-34P13.13	4.718	4.51e-06	0.201152	7	0.042632	yes	PTTARY
chr1_265009_A_T_b38	RP11-34P13.13	4.62	6.93e-06	0.098383	9	0.021294	yes	PTTARY
chr1_271569_A_G_b38	RP11-34P13.13	4.326	2.41e-05	0.100677	10	0.02327	yes	PTTARY
chr1_286158_A_G_b38	RP11-34P13.13	4.058	7.15e-05	0.097719	5	0.024081	yes	PTTARY
chr1_13613_T_A_b38	RP11-34P13.13	-3.852	0.000159	-0.091705	4	0.023809	yes	PTTARY
chr1_269588_A_G_b38	RP11-34P13.13	3.824	0.000177	0.075441	26	0.01973	yes	PTTARY
chr1_280726_A_AACACACACAC_b38	RP11-34P13.13	3.747	0.000235	0.12207	5	0.032577	yes	PTTARY
chr1_272389_C_T_b38	RP11-34P13.13	3.593	0.000413	0.152084	8	0.042325	yes	PTTARY
chr1_266093_C_G_b38	RP11-34P13.13	3.548	0.000486	0.08304	3	0.023407	yes	PTTARY
chr1_272548_A_C_b38	RP11-34P13.13	3.414	0.000779	0.101691	11	0.029789	yes	PTTARY
chr1_272378_A_T_b38	RP11-34P13.13	3.4	0.000817	0.152908	6	0.044976	yes	PTTARY
chr1_271147_T_G_b38	RP11-34P13.13	3.319	0.00108	0.095302	11	0.028714	yes	PTTARY
chr1_274015_A_G_b38	RP11-34P13.13	3.099	0.00222	0.096674	12	0.031191	yes	PTTARY
chr1_260937_C_T_b38	RP11-34P13.13	3.003	0.00303	0.100183	3	0.033366	yes	PTTARY
chr1_264681_A_G_b38	RP11-34P13.13	2.976	0.00329	0.08281	6	0.027827	yes	PTTARY
chr1_285441_C_T_b38	RP11-34P13.13	2.919	0.00392	0.069329	3	0.02375	yes	PTTARY
chr1_1169858_T_C_b38	RP11-34P13.13	2.817	0.00534	0.050757	30	0.018017	yes	PTTARY
chr1_98999_TTTTATTTA_T_b38	RP11-34P13.13	2.728	0.00695	0.054781	18	0.020081	yes	PTTARY
chr1_624509_A_G_b38	RP11-34P13.13	2.646	0.0088	0.063544	4	0.024013	yes	PTTARY
chr1_92930_G_T_b38	RP11-34P13.13	6.337	1.57e-09	0.263741	3	0.041617	no	PTTARY
chr1_94570_T_G_b38	RP11-34P13.13	6.317	1.75e-09	0.153712	3	0.024332	no	PTTARY
chr1_284741_A_C_b38	RP11-34P13.13	2.952	0.00355	0.118724	3	0.040222	no	PTTARY
chr1_271569_A_G_b38	RP11-34P13.13	5.312	3.15e-07	0.085546	12	0.016103	yes	PRSTTE
chr1_273824_G_T_b38	RP11-34P13.13	5.276	3.74e-07	0.077442	15	0.014677	yes	PRSTTE
chr1_20316_GA_G_b38	RP11-34P13.13	4.727	4.56e-06	0.084462	3	0.017868	yes	PRSTTE
chr1_264681_A_G_b38	RP11-34P13.13	4.372	2.07e-05	0.086675	7	0.019825	yes	PRSTTE
chr1_269588_A_G_b38	RP11-34P13.13	4.363	2.15e-05	0.063787	31	0.01462	yes	PRSTTE
chr1_995153_C_G_b38	RP11-34P13.13	3.937	0.000118	0.054509	31	0.013847	yes	PRSTTE
chr1_995187_A_G_b38	RP11-34P13.13	3.893	0.000139	0.053594	33	0.013767	yes	PRSTTE
chr1_992993_A_G_b38	RP11-34P13.13	3.875	0.000149	0.051381	43	0.013259	yes	PRSTTE
chr1_981210_G_A_b38	RP11-34P13.13	3.869	0.000153	0.06736	3	0.017412	yes	PRSTTE
chr1_995512_T_C_b38	RP11-34P13.13	3.836	0.000173	0.05289	33	0.013788	yes	PRSTTE
chr1_995786_A_G_b38	RP11-34P13.13	3.592	0.000423	0.050063	33	0.013939	yes	PRSTTE
chr1_1005429_C_CA_b38	RP11-34P13.13	3.451	0.000696	0.048675	28	0.014107	yes	PRSTTE
chr1_1005904_C_T_b38	RP11-34P13.13	3.451	0.000696	0.048675	28	0.014107	yes	PRSTTE
chr1_280599_T_C_b38	RP11-34P13.13	3.425	0.000761	0.06533	3	0.019076	yes	PRSTTE
chr1_982260_G_A_b38	RP11-34P13.13	3.402	0.000823	0.055255	6	0.016241	yes	PRSTTE
chr1_982858_C_G_b38	RP11-34P13.13	3.402	0.000823	0.055255	6	0.016241	yes	PRSTTE
chr1_983747_T_C_b38	RP11-34P13.13	3.399	0.000832	0.052214	8	0.015362	yes	PRSTTE
chr1_995371_C_G_b38	RP11-34P13.13	3.373	0.000909	0.045686	30	0.013545	yes	PRSTTE
chr1_265009_A_T_b38	RP11-34P13.13	3.353	0.000975	0.052346	13	0.015613	yes	PRSTTE
chr1_1006159_C_T_b38	RP11-34P13.13	3.343	0.00101	0.046809	33	0.014004	yes	PRSTTE
chr1_1017048_G_A_b38	RP11-34P13.13	-3.324	0.00107	-0.047029	51	0.014147	yes	PRSTTE
chr1_995982_G_A_b38	RP11-34P13.13	3.298	0.00117	0.044502	30	0.013495	yes	PRSTTE
chr1_190768_G_A_b38	RP11-34P13.13	3.253	0.00136	0.132722	3	0.040805	yes	PRSTTE
chr1_1004625_A_G_b38	RP11-34P13.13	3.241	0.00142	0.045564	32	0.01406	yes	PRSTTE
chr1_1005954_G_A_b38	RP11-34P13.13	3.208	0.00158	0.045366	28	0.01414	yes	PRSTTE
chr1_1018572_G_A_b38	RP11-34P13.13	-3.19	0.00168	-0.045347	51	0.014216	yes	PRSTTE
chr1_1019397_C_A_b38	RP11-34P13.13	-3.19	0.00168	-0.045347	51	0.014216	yes	PRSTTE
chr1_1021472_C_T_b38	RP11-34P13.13	-3.182	0.00172	-0.044832	49	0.014088	yes	PRSTTE
chr1_1008588_C_T_b38	RP11-34P13.13	-3.147	0.00193	-0.044877	51	0.014259	yes	PRSTTE
chr1_280592_T_C_b38	RP11-34P13.13	3.144	0.00195	0.05516	8	0.017543	yes	PRSTTE
chr1_271147_T_G_b38	RP11-34P13.13	3.129	0.00204	0.069051	10	0.022065	yes	PRSTTE
chr1_1008307_G_C_b38	RP11-34P13.13	3.09	0.00232	0.044305	29	0.014338	yes	PRSTTE
chr1_1009184_T_C_b38	RP11-34P13.13	3.089	0.00232	0.043972	29	0.014234	yes	PRSTTE
chr1_274015_A_G_b38	RP11-34P13.13	3.072	0.00245	0.061504	15	0.020018	yes	PRSTTE
chr1_1019479_TG_T_b38	RP11-34P13.13	-3.061	0.00254	-0.04018	56	0.013125	yes	PRSTTE
chr1_993036_G_A_b38	RP11-34P13.13	3.046	0.00266	0.046037	11	0.015113	yes	PRSTTE
chr1_988731_T_A_b38	RP11-34P13.13	3.044	0.00268	0.045256	11	0.014867	yes	PRSTTE
chr1_1014733_GAAGT_G_b38	RP11-34P13.13	-3.036	0.00275	-0.042597	51	0.014032	yes	PRSTTE
chr1_1019636_A_G_b38	RP11-34P13.13	-2.992	0.00316	-0.057657	6	0.019273	yes	PRSTTE
chr1_994949_C_T_b38	RP11-34P13.13	2.99	0.00317	0.046364	9	0.015505	yes	PRSTTE
chr1_994997_C_T_b38	RP11-34P13.13	2.99	0.00317	0.046364	9	0.015505	yes	PRSTTE
chr1_992361_G_A_b38	RP11-34P13.13	2.979	0.00328	0.047933	8	0.016088	yes	PRSTTE
chr1_284929_A_G_b38	RP11-34P13.13	2.961	0.00347	0.072927	5	0.024626	yes	PRSTTE
chr1_996168_G_T_b38	RP11-34P13.13	2.947	0.00363	0.047336	8	0.016062	yes	PRSTTE
chr1_1036754_C_T_b38	RP11-34P13.13	-2.936	0.00375	-0.05872	3	0.019999	yes	PRSTTE
chr1_998741_G_A_b38	RP11-34P13.13	2.935	0.00376	0.04812	7	0.016393	yes	PRSTTE
chr1_272389_C_T_b38	RP11-34P13.13	2.906	0.00412	0.07946	10	0.027346	yes	PRSTTE
chr1_1000335_C_T_b38	RP11-34P13.13	2.903	0.00416	0.04677	8	0.016112	yes	PRSTTE
chr1_182095_T_C_b38	RP11-34P13.13	2.886	0.00438	0.053768	24	0.01863	yes	PRSTTE
chr1_974039_C_T_b38	RP11-34P13.13	2.874	0.00454	0.050369	5	0.017527	yes	PRSTTE
chr1_998410_G_A_b38	RP11-34P13.13	-2.87	0.00459	-0.039899	49	0.0139	yes	PRSTTE
chr1_272378_A_T_b38	RP11-34P13.13	2.856	0.00479	0.083935	6	0.029388	yes	PRSTTE
chr1_997077_G_A_b38	RP11-34P13.13	2.854	0.00482	0.046056	8	0.016137	yes	PRSTTE
chr1_98999_TTTTATTTA_T_b38	RP11-34P13.13	2.852	0.00485	0.042037	15	0.01474	yes	PRSTTE
chr1_105550_G_A_b38	RP11-34P13.13	-2.829	0.0052	-0.052308	3	0.018491	yes	PRSTTE
chr1_996254_A_AGGGAGGGCAG_b38	RP11-34P13.13	2.828	0.00522	0.046606	7	0.016482	yes	PRSTTE
chr1_1004111_TG_T_b38	RP11-34P13.13	2.815	0.00541	0.044033	10	0.015641	yes	PRSTTE
chr1_1015297_T_C_b38	RP11-34P13.13	-2.8	0.00567	-0.039338	51	0.01405	yes	PRSTTE
chr1_1002745_G_A_b38	RP11-34P13.13	2.792	0.0058	0.042591	11	0.015255	yes	PRSTTE
chr1_13912_G_A_b38	RP11-34P13.13	2.788	0.00588	0.051678	7	0.018538	yes	PRSTTE
chr1_986280_C_T_b38	RP11-34P13.13	2.782	0.00597	0.045129	8	0.016221	yes	PRSTTE
chr1_986629_G_A_b38	RP11-34P13.13	2.782	0.00597	0.045129	8	0.016221	yes	PRSTTE
chr1_981169_A_G_b38	RP11-34P13.13	-2.771	0.00618	-0.041762	10	0.015073	yes	PRSTTE
chr1_1015903_C_T_b38	RP11-34P13.13	-2.755	0.00647	-0.038464	52	0.013963	yes	PRSTTE
chr1_989068_GTTGA_G_b38	RP11-34P13.13	-2.754	0.00649	-0.038166	51	0.013858	yes	PRSTTE
chr1_1016184_A_G_b38	RP11-34P13.13	2.748	0.00661	0.039018	33	0.0142	yes	PRSTTE
chr1_1016623_G_A_b38	RP11-34P13.13	2.731	0.00695	0.038832	29	0.014221	yes	PRSTTE
chr1_1000731_C_T_b38	RP11-34P13.13	-2.724	0.00709	-0.03879	49	0.014241	yes	PRSTTE
chr1_998762_A_AGGGGAGG_b38	RP11-34P13.13	-2.663	0.00844	-0.035995	29	0.013516	yes	PRSTTE
chr1_1130420_C_T_b38	RP11-34P13.13	2.648	0.0088	0.044465	9	0.01679	yes	PRSTTE
chr1_1047614_T_C_b38	RP11-34P13.13	-2.641	0.00898	-0.052986	6	0.02006	yes	PRSTTE
chr1_799082_G_A_b38	RP11-34P13.13	-2.631	0.00926	-0.052288	4	0.019876	yes	PRSTTE
chr1_1030889_ATGTGTGTGTGTGCAGTGCATGGTGCTGTGAGATCAGCG_A_b38	RP11-34P13.13	-2.629	0.00929	-0.062157	7	0.023639	yes	PRSTTE
chr1_271413_C_T_b38	RP11-34P13.13	4.189	4.37e-05	0.083023	5	0.019818	no	PRSTTE
chr1_984039_T_C_b38	RP11-34P13.13	-3.794	0.000202	-0.051457	18	0.013561	no	PRSTTE
chr1_1023851_G_A_b38	RP11-34P13.13	-3.605	0.000403	-0.051687	38	0.014337	no	PRSTTE
chr1_192025_G_A_b38	RP11-34P13.13	3.363	0.00094	0.078284	4	0.023276	no	PRSTTE
chr1_1023775_G_A_b38	RP11-34P13.13	-3.133	0.00202	-0.042235	48	0.013483	no	PRSTTE
chr1_19322_C_T_b38	RP11-34P13.13	-2.972	0.00336	-0.065488	6	0.022031	no	PRSTTE
chr1_131281_C_G_b38	RP11-34P13.13	-2.963	0.00345	-0.055105	5	0.018595	no	PRSTTE
chr1_601606_G_T_b38	RP11-34P13.13	-2.831	0.00516	-0.046082	9	0.016277	no	PRSTTE
chr1_1015915_C_T_b38	RP11-34P13.13	-2.797	0.00572	-0.038923	52	0.013917	no	PRSTTE
chr1_650383_A_AAC_b38	RP11-34P13.13	2.762	0.00634	0.066003	4	0.0239	no	PRSTTE
chr1_1027511_C_T_b38	RP11-34P13.13	-2.75	0.00656	-0.037373	51	0.01359	no	PRSTTE
chr1_999842_C_A_b38	RP11-34P13.13	-2.724	0.00709	-0.038708	53	0.014212	no	PRSTTE
chr1_1134102_G_A_b38	RP11-34P13.13	-2.711	0.00735	-0.065025	4	0.023982	no	PRSTTE
chr1_186209_T_C_b38	RP11-34P13.13	2.707	0.00744	0.057777	11	0.021342	no	PRSTTE
chr1_995508_ATTTTT_A_b38	RP11-34P13.13	-2.693	0.00775	-0.037727	48	0.014011	no	PRSTTE
chr1_1036800_G_A_b38	RP11-34P13.13	-2.635	0.00915	-0.035481	51	0.013467	no	PRSTTE
chr1_202170_C_T_b38	RP11-34P13.13	9.615	5.14e-20	0.088486	3	0.009203	yes	SKINNS
chr1_19322_C_T_b38	RP11-34P13.13	-7.716	7.9e-14	-0.078722	19	0.010202	yes	SKINNS
chr1_94570_T_G_b38	RP11-34P13.13	7.384	7.61e-13	0.068553	7	0.009284	yes	SKINNS
chr1_265009_A_T_b38	RP11-34P13.13	6.767	4.14e-11	0.051321	28	0.007584	yes	SKINNS
chr1_271569_A_G_b38	RP11-34P13.13	6.299	7.17e-10	0.051084	27	0.008109	yes	SKINNS
chr1_286158_A_G_b38	RP11-34P13.13	5.863	8.83e-09	0.054208	8	0.009245	yes	SKINNS
chr1_280599_T_C_b38	RP11-34P13.13	5.335	1.52e-07	0.049339	11	0.009248	yes	SKINNS
chr1_286388_A_G_b38	RP11-34P13.13	5.327	1.59e-07	0.072842	3	0.013675	yes	SKINNS
chr1_269588_A_G_b38	RP11-34P13.13	5.242	2.46e-07	0.041251	59	0.00787	yes	SKINNS
chr1_280592_T_C_b38	RP11-34P13.13	5.202	3.01e-07	0.045165	17	0.008682	yes	SKINNS
chr1_264730_T_A_b38	RP11-34P13.13	4.382	1.47e-05	0.075503	15	0.017231	yes	SKINNS
chr1_272680_G_A_b38	RP11-34P13.13	4.221	2.95e-05	0.041993	9	0.009949	yes	SKINNS
chr1_282551_T_C_b38	RP11-34P13.13	4.068	5.61e-05	0.035355	15	0.008691	yes	SKINNS
chr1_92930_G_T_b38	RP11-34P13.13	3.999	7.45e-05	0.061187	7	0.015301	yes	SKINNS
chr1_272378_A_T_b38	RP11-34P13.13	3.844	0.000139	0.06277	10	0.016331	yes	SKINNS
chr1_273824_G_T_b38	RP11-34P13.13	3.784	0.000175	0.030243	26	0.007992	yes	SKINNS
chr1_272488_C_G_b38	RP11-34P13.13	3.771	0.000184	0.032915	26	0.008727	yes	SKINNS
chr1_264681_A_G_b38	RP11-34P13.13	3.609	0.000342	0.041681	11	0.011549	yes	SKINNS
chr1_280726_A_AACACACACAC_b38	RP11-34P13.13	3.531	0.000458	0.049752	4	0.014092	yes	SKINNS
chr1_286145_C_CAT_b38	RP11-34P13.13	3.493	0.000526	0.032216	8	0.009224	yes	SKINNS
chr1_274015_A_G_b38	RP11-34P13.13	3.488	0.000534	0.035657	31	0.010221	yes	SKINNS
chr1_19004_A_G_b38	RP11-34P13.13	-3.306	0.00102	-0.029206	56	0.008835	yes	SKINNS
chr1_260937_C_T_b38	RP11-34P13.13	3.286	0.0011	0.041248	5	0.012552	yes	SKINNS
chr1_187887_C_G_b38	RP11-34P13.13	3.282	0.00111	0.031397	4	0.009565	yes	SKINNS
chr1_272164_G_A_b38	RP11-34P13.13	3.229	0.00133	0.03293	43	0.010198	yes	SKINNS
chr1_271147_T_G_b38	RP11-34P13.13	3.177	0.00159	0.035844	21	0.011282	yes	SKINNS
chr1_978953_C_G_b38	RP11-34P13.13	-3.136	0.00183	-0.020674	110	0.006593	yes	SKINNS
chr1_168098_A_G_b38	RP11-34P13.13	-3.058	0.00236	-0.037399	3	0.012229	yes	SKINNS
chr1_791559_G_C_b38	RP11-34P13.13	2.767	0.00589	0.03078	5	0.011123	yes	SKINNS
chr1_98999_T_TTTTA_b38	RP11-34P13.13	-2.764	0.00595	-0.019924	50	0.007209	yes	SKINNS
chr1_98945_C_T_b38	RP11-34P13.13	-2.754	0.00613	-0.02248	65	0.008163	yes	SKINNS
chr1_188289_G_A_b38	RP11-34P13.13	-2.749	0.00621	-0.024493	13	0.008909	yes	SKINNS
chr1_975093_G_A_b38	RP11-34P13.13	2.654	0.00825	0.026209	10	0.009877	yes	SKINNS
chr1_1010755_T_G_b38	RP11-34P13.13	-2.635	0.00871	-0.030624	10	0.011623	yes	SKINNS
chr1_518864_T_A_b38	RP11-34P13.13	10.582	1.69e-23	0.10854	5	0.010257	no	SKINNS
chr1_20316_GA_G_b38	RP11-34P13.13	7.898	2.23e-14	0.070245	6	0.008894	no	SKINNS
chr1_284741_A_C_b38	RP11-34P13.13	5.866	8.69e-09	0.089238	3	0.015212	no	SKINNS
chr1_271413_C_T_b38	RP11-34P13.13	5.345	1.44e-07	0.059268	7	0.011088	no	SKINNS
chr1_107970_G_A_b38	RP11-34P13.13	5.17	3.54e-07	0.046779	3	0.009048	no	SKINNS
chr1_20547_A_G_b38	RP11-34P13.13	4.972	9.47e-07	0.046296	7	0.009311	no	SKINNS
chr1_13613_T_A_b38	RP11-34P13.13	-4.853	1.68e-06	-0.044408	7	0.00915	no	SKINNS
chr1_187323_G_A_b38	RP11-34P13.13	-4.562	6.56e-06	-0.043509	5	0.009537	no	SKINNS
chr1_187331_C_G_b38	RP11-34P13.13	-4.487	9.19e-06	-0.044351	8	0.009884	no	SKINNS
chr1_272389_C_T_b38	RP11-34P13.13	3.722	0.000223	0.059191	13	0.015904	no	SKINNS
chr1_271406_C_CTTT_b38	RP11-34P13.13	3.69	0.000252	0.071717	3	0.019433	no	SKINNS
chr1_280198_C_A_b38	RP11-34P13.13	3.68	0.000262	0.051916	5	0.014107	no	SKINNS
chr1_272548_A_C_b38	RP11-34P13.13	3.657	0.000285	0.042431	29	0.011602	no	SKINNS
chr1_282728_T_C_b38	RP11-34P13.13	3.525	0.000467	0.032319	4	0.009169	no	SKINNS
chr1_94271_C_G_b38	RP11-34P13.13	3.415	0.000695	0.026632	66	0.007798	no	SKINNS
chr1_282721_A_G_b38	RP11-34P13.13	3.364	0.000836	0.030896	4	0.009185	no	SKINNS
chr1_19980_G_A_b38	RP11-34P13.13	3.101	0.00205	0.055168	3	0.017789	no	SKINNS
chr1_16103_T_G_b38	RP11-34P13.13	3.065	0.00231	0.022202	47	0.007243	no	SKINNS
chr1_983193_A_G_b38	RP11-34P13.13	-2.948	0.00337	-0.019739	116	0.006696	no	SKINNS
chr1_981454_G_A_b38	RP11-34P13.13	-2.931	0.00356	-0.019562	116	0.006675	no	SKINNS
chr1_670270_C_T_b38	RP11-34P13.13	2.924	0.00363	0.038573	3	0.013191	no	SKINNS
chr1_979472_G_C_b38	RP11-34P13.13	-2.82	0.00501	-0.018839	122	0.00668	no	SKINNS
chr1_978509_G_A_b38	RP11-34P13.13	-2.74	0.00638	-0.018217	120	0.006647	no	SKINNS
chr1_979560_T_C_b38	RP11-34P13.13	-2.71	0.00698	-0.01833	127	0.006763	no	SKINNS
chr1_262683_C_CT_b38	RP11-34P13.13	-2.687	0.00747	-0.035023	6	0.013033	no	SKINNS
chr1_983004_G_T_b38	RP11-34P13.13	-2.648	0.00838	-0.017932	134	0.006771	no	SKINNS
chr1_857828_C_G_b38	RP11-34P13.13	-2.607	0.00943	-0.021598	65	0.008283	no	SKINNS
chr1_20316_GA_G_b38	RP11-34P13.13	6.851	2.03e-11	0.053173	6	0.007761	yes	SKNS
chr1_202170_C_T_b38	RP11-34P13.13	6.742	4.07e-11	0.054522	3	0.008087	yes	SKNS
chr1_271569_A_G_b38	RP11-34P13.13	6.311	5.84e-10	0.043309	34	0.006863	yes	SKNS
chr1_271413_C_T_b38	RP11-34P13.13	6.012	3.39e-09	0.054568	10	0.009076	yes	SKNS
chr1_94570_T_G_b38	RP11-34P13.13	5.788	1.21e-08	0.047542	7	0.008213	yes	SKNS
chr1_92930_G_T_b38	RP11-34P13.13	5.363	1.22e-07	0.071153	7	0.013266	yes	SKNS
chr1_265009_A_T_b38	RP11-34P13.13	5.287	1.81e-07	0.037084	32	0.007014	yes	SKNS
chr1_269588_A_G_b38	RP11-34P13.13	5.156	3.56e-07	0.034655	73	0.006722	yes	SKNS
chr1_280592_T_C_b38	RP11-34P13.13	4.895	1.3e-06	0.035706	21	0.007294	yes	SKNS
chr1_272389_C_T_b38	RP11-34P13.13	4.837	1.73e-06	0.062988	25	0.013023	yes	SKNS
chr1_273824_G_T_b38	RP11-34P13.13	4.647	4.25e-06	0.031405	35	0.006758	yes	SKNS
chr1_284741_A_C_b38	RP11-34P13.13	4.523	7.53e-06	0.061761	5	0.013656	yes	SKNS
chr1_264681_A_G_b38	RP11-34P13.13	4.399	1.31e-05	0.043475	11	0.009883	yes	SKNS
chr1_20547_A_G_b38	RP11-34P13.13	4.373	1.47e-05	0.036269	5	0.008293	yes	SKNS
chr1_274015_A_G_b38	RP11-34P13.13	4.35	1.63e-05	0.038998	35	0.008965	yes	SKNS
chr1_272378_A_T_b38	RP11-34P13.13	4.288	2.14e-05	0.060978	14	0.014222	yes	SKNS
chr1_16103_T_G_b38	RP11-34P13.13	4.237	2.66e-05	0.027208	49	0.006421	yes	SKNS
chr1_280726_A_AACACACACAC_b38	RP11-34P13.13	3.957	8.63e-05	0.045936	6	0.01161	yes	SKNS
chr1_1130420_C_T_b38	RP11-34P13.13	3.929	9.65e-05	0.029219	18	0.007437	yes	SKNS
chr1_1130717_G_A_b38	RP11-34P13.13	3.89	0.000113	0.029477	17	0.007577	yes	SKNS
chr1_1137871_C_A_b38	RP11-34P13.13	3.884	0.000116	0.027702	19	0.007132	yes	SKNS
chr1_1133503_G_A_b38	RP11-34P13.13	3.813	0.000154	0.02887	17	0.007572	yes	SKNS
chr1_264730_T_A_b38	RP11-34P13.13	3.794	0.000165	0.053935	19	0.014216	yes	SKNS
chr1_284929_A_G_b38	RP11-34P13.13	3.748	0.000198	0.042774	7	0.011413	yes	SKNS
chr1_1132196_G_A_b38	RP11-34P13.13	3.73	0.000212	0.027722	18	0.007433	yes	SKNS
chr1_1147779_G_A_b38	RP11-34P13.13	3.719	0.000221	0.025365	24	0.00682	yes	SKNS
chr1_1132482_T_C_b38	RP11-34P13.13	3.622	0.00032	0.026354	18	0.007276	yes	SKNS
chr1_1133966_C_T_b38	RP11-34P13.13	3.559	0.000406	0.026285	17	0.007386	yes	SKNS
chr1_186765_T_C_b38	RP11-34P13.13	3.552	0.000416	0.029562	3	0.008322	yes	SKNS
chr1_103241_C_T_b38	RP11-34P13.13	-3.498	0.000508	-0.04732	9	0.013528	yes	SKNS
chr1_1164057_G_A_b38	RP11-34P13.13	3.453	0.000598	0.022349	39	0.006472	yes	SKNS
chr1_1154789_GA_G_b38	RP11-34P13.13	3.395	0.000737	0.022988	32	0.006771	yes	SKNS
chr1_282721_A_G_b38	RP11-34P13.13	3.343	0.000888	0.026692	6	0.007985	yes	SKNS
chr1_1161911_C_A_b38	RP11-34P13.13	3.325	0.000946	0.021413	40	0.006441	yes	SKNS
chr1_282607_G_A_b38	RP11-34P13.13	3.313	0.000986	0.025164	14	0.007596	yes	SKNS
chr1_1159750_T_C_b38	RP11-34P13.13	3.287	0.00108	0.021123	40	0.006427	yes	SKNS
chr1_272488_C_G_b38	RP11-34P13.13	3.267	0.00116	0.026319	26	0.008055	yes	SKNS
chr1_1100425_G_A_b38	RP11-34P13.13	3.162	0.00166	0.018814	71	0.00595	yes	SKNS
chr1_271147_T_G_b38	RP11-34P13.13	3.153	0.00171	0.031954	23	0.010134	yes	SKNS
chr1_1153726_G_A_b38	RP11-34P13.13	3.137	0.0018	0.019996	43	0.006375	yes	SKNS
chr1_272548_A_C_b38	RP11-34P13.13	3.11	0.00197	0.031884	32	0.010253	yes	SKNS
chr1_14542_A_G_b38	RP11-34P13.13	-3.041	0.00247	-0.032128	5	0.010565	yes	SKNS
chr1_61099_T_C_b38	RP11-34P13.13	3.036	0.00251	0.028933	12	0.009528	yes	SKNS
chr1_282728_T_C_b38	RP11-34P13.13	3.023	0.00262	0.024004	6	0.00794	yes	SKNS
chr1_981210_G_A_b38	RP11-34P13.13	3.022	0.00263	0.022884	18	0.007571	yes	SKNS
chr1_1167770_G_A_b38	RP11-34P13.13	3.012	0.00272	0.019489	37	0.00647	yes	SKNS
chr1_1056425_GCGGGTA_G_b38	RP11-34P13.13	-3.003	0.0028	-0.023986	11	0.007988	yes	SKNS
chr1_1173815_A_G_b38	RP11-34P13.13	-2.995	0.00287	-0.028199	7	0.009416	yes	SKNS
chr1_1002417_T_A_b38	RP11-34P13.13	2.972	0.00309	0.022453	25	0.007554	yes	SKNS
chr1_99083_C_T_b38	RP11-34P13.13	-2.965	0.00316	-0.027012	5	0.009109	yes	SKNS
chr1_1056668_C_CGT_b38	RP11-34P13.13	-2.964	0.00317	-0.020175	34	0.006806	yes	SKNS
chr1_285109_CAA_C_b38	RP11-34P13.13	2.957	0.00324	0.042783	6	0.014468	yes	SKNS
chr1_285109_CA_C_b38	RP11-34P13.13	-2.955	0.00327	-0.02969	5	0.010049	yes	SKNS
chr1_285675_T_C_b38	RP11-34P13.13	2.905	0.00382	0.03908	7	0.013451	yes	SKNS
chr1_1056662_C_T_b38	RP11-34P13.13	-2.894	0.00396	-0.019857	33	0.006861	yes	SKNS
chr1_186728_A_T_b38	RP11-34P13.13	2.816	0.00504	0.023961	3	0.008509	yes	SKNS
chr1_1083800_T_C_b38	RP11-34P13.13	-2.805	0.00521	-0.015415	119	0.005495	yes	SKNS
chr1_108030_G_T_b38	RP11-34P13.13	2.764	0.00591	0.028458	11	0.010296	yes	SKNS
chr1_1063661_ATG_A_b38	RP11-34P13.13	-2.75	0.00616	-0.015249	123	0.005545	yes	SKNS
chr1_1075337_C_T_b38	RP11-34P13.13	-2.728	0.00659	-0.014863	120	0.005449	yes	SKNS
chr1_1034279_G_A_b38	RP11-34P13.13	2.722	0.0067	0.016834	48	0.006185	yes	SKNS
chr1_278075_T_C_b38	RP11-34P13.13	2.721	0.00672	0.049225	4	0.018092	yes	SKNS
chr1_1020697_C_T_b38	RP11-34P13.13	2.718	0.00678	0.016637	51	0.006121	yes	SKNS
chr1_286145_C_CAT_b38	RP11-34P13.13	2.708	0.00699	0.02187	8	0.008076	yes	SKNS
chr1_282616_G_GA_b38	RP11-34P13.13	2.705	0.00705	0.020822	13	0.007697	yes	SKNS
chr1_1056597_G_A_b38	RP11-34P13.13	-2.682	0.00755	-0.014423	169	0.005378	yes	SKNS
chr1_64310_A_G_b38	RP11-34P13.13	2.676	0.00769	0.026726	6	0.009989	yes	SKNS
chr1_282551_T_C_b38	RP11-34P13.13	2.664	0.00795	0.020937	16	0.007858	yes	SKNS
chr1_131281_C_G_b38	RP11-34P13.13	-2.661	0.00803	-0.024761	6	0.009305	yes	SKNS
chr1_1075707_CG_C_b38	RP11-34P13.13	-2.661	0.00803	-0.014425	144	0.005421	yes	SKNS
chr1_1173138_T_C_b38	RP11-34P13.13	-2.645	0.00842	-0.023181	10	0.008765	yes	SKNS
chr1_1032846_C_A_b38	RP11-34P13.13	2.614	0.0092	0.015902	55	0.006084	yes	SKNS
chr1_1020681_A_AG_b38	RP11-34P13.13	2.603	0.0095	0.015996	51	0.006146	yes	SKNS
chr1_518864_T_A_b38	RP11-34P13.13	8.52	1.63e-16	0.076907	4	0.009026	no	SKNS
chr1_187323_G_A_b38	RP11-34P13.13	-6.618	8.89e-11	-0.051749	6	0.00782	no	SKNS
chr1_187331_C_G_b38	RP11-34P13.13	-5.607	3.31e-08	-0.044909	9	0.00801	no	SKNS
chr1_19322_C_T_b38	RP11-34P13.13	-5.53	5.03e-08	-0.050621	16	0.009154	no	SKNS
chr1_280599_T_C_b38	RP11-34P13.13	5.31	1.61e-07	0.042063	9	0.007922	no	SKNS
chr1_280198_C_A_b38	RP11-34P13.13	5.095	4.85e-07	0.060583	5	0.011892	no	SKNS
chr1_19980_G_A_b38	RP11-34P13.13	4.685	3.56e-06	0.06681	4	0.01426	no	SKNS
chr1_286158_A_G_b38	RP11-34P13.13	4.315	1.91e-05	0.035727	9	0.008281	no	SKNS
chr1_19004_A_G_b38	RP11-34P13.13	-3.703	0.000236	-0.029541	61	0.007979	no	SKNS
chr1_841166_A_G_b38	RP11-34P13.13	3.496	0.000512	0.022965	43	0.006569	no	SKNS
chr1_103558_C_A_b38	RP11-34P13.13	3.488	0.000527	0.04031	5	0.011557	no	SKNS
chr1_271578_AT_A_b38	RP11-34P13.13	-3.458	0.000587	-0.029926	4	0.008653	no	SKNS
chr1_1138876_T_C_b38	RP11-34P13.13	3.312	0.000989	0.022035	32	0.006653	no	SKNS
chr1_1048922_T_C_b38	RP11-34P13.13	-3.306	0.00101	-0.018718	136	0.005662	no	SKNS
chr1_1049886_C_T_b38	RP11-34P13.13	-3.276	0.00112	-0.018699	162	0.005708	no	SKNS
chr1_104159_C_T_b38	RP11-34P13.13	3.12	0.00191	0.037853	5	0.012132	no	SKNS
chr1_13613_T_A_b38	RP11-34P13.13	-3.09	0.00211	-0.025602	5	0.008286	no	SKNS
chr1_1156987_C_T_b38	RP11-34P13.13	3.02	0.00265	0.019473	41	0.006447	no	SKNS
chr1_1132482_T_G_b38	RP11-34P13.13	-2.969	0.00312	-0.018088	58	0.006092	no	SKNS
chr1_1063202_G_C_b38	RP11-34P13.13	-2.955	0.00326	-0.016585	167	0.005612	no	SKNS
chr1_1158683_T_C_b38	RP11-34P13.13	2.896	0.00394	0.018296	47	0.006319	no	SKNS
chr1_1153291_C_T_b38	RP11-34P13.13	2.872	0.00424	0.018533	43	0.006453	no	SKNS
chr1_1057439_G_A_b38	RP11-34P13.13	-2.867	0.00431	-0.016153	137	0.005635	no	SKNS
chr1_1056602_T_TGTGGGTGCGTGTGC_b38	RP11-34P13.13	-2.845	0.0046	-0.016342	99	0.005743	no	SKNS
chr1_63697_T_C_b38	RP11-34P13.13	2.771	0.00579	0.020563	20	0.007422	no	SKNS
chr1_285175_C_T_b38	RP11-34P13.13	2.763	0.00592	0.02658	11	0.00962	no	SKNS
chr1_1027511_C_T_b38	RP11-34P13.13	-2.728	0.00659	-0.015453	127	0.005665	no	SKNS
chr1_1134273_C_T_b38	RP11-34P13.13	2.681	0.00756	0.017956	30	0.006696	no	SKNS
chr1_61397_G_A_b38	RP11-34P13.13	2.661	0.00802	0.030277	7	0.011377	no	SKNS
chr1_868735_G_A_b38	RP11-34P13.13	-2.623	0.00897	-0.050535	4	0.019266	no	SKNS
chr1_984121_G_T_b38	RP11-34P13.13	-2.615	0.00917	-0.014851	154	0.005679	no	SKNS
chr1_109575_CGTGT_C_b38	RP11-34P13.13	2.605	0.00944	0.021439	9	0.00823	no	SKNS
chr1_280599_T_C_b38	RP11-34P13.13	4.638	8.3e-06	0.047292	8	0.010196	yes	SNTTRM
chr1_271413_C_T_b38	RP11-34P13.13	4.455	1.76e-05	0.056552	5	0.012693	yes	SNTTRM
chr1_280592_T_C_b38	RP11-34P13.13	3.991	0.000108	0.040358	9	0.010112	yes	SNTTRM
chr1_269588_A_G_b38	RP11-34P13.13	3.73	0.000283	0.040497	18	0.010858	yes	SNTTRM
chr1_273824_G_T_b38	RP11-34P13.13	3.644	0.000384	0.039266	7	0.010776	yes	SNTTRM
chr1_272378_A_T_b38	RP11-34P13.13	3.564	0.000509	0.075965	4	0.021317	yes	SNTTRM
chr1_265009_A_T_b38	RP11-34P13.13	3.426	0.000815	0.038461	8	0.011226	yes	SNTTRM
chr1_271569_A_G_b38	RP11-34P13.13	3.417	0.000841	0.03771	8	0.011037	yes	SNTTRM
chr1_282607_G_A_b38	RP11-34P13.13	3.325	0.00114	0.034674	5	0.010429	yes	SNTTRM
chr1_272389_C_T_b38	RP11-34P13.13	3.29	0.00128	0.068062	5	0.020687	yes	SNTTRM
chr1_272680_G_A_b38	RP11-34P13.13	3.115	0.00226	0.043282	3	0.013897	yes	SNTTRM
chr1_285746_C_T_b38	RP11-34P13.13	3.085	0.00247	0.04685	3	0.015185	yes	SNTTRM
chr1_272488_C_G_b38	RP11-34P13.13	2.979	0.00344	0.036387	8	0.012215	yes	SNTTRM
chr1_271147_T_G_b38	RP11-34P13.13	2.811	0.00568	0.039018	5	0.013879	yes	SNTTRM
chr1_272164_G_A_b38	RP11-34P13.13	2.649	0.00906	0.037985	10	0.014341	yes	SNTTRM
chr1_272505_C_G_b38	RP11-34P13.13	2.643	0.0092	0.0381	8	0.014414	yes	SNTTRM
chr1_633846_C_A_b38	RP11-34P13.13	-3.212	0.00165	-0.062036	5	0.019314	no	SNTTRM
chr1_19322_C_T_b38	RP11-34P13.13	-3.065	0.00263	-0.049763	4	0.016235	no	SNTTRM
chr1_1084906_A_C_b38	RP11-34P13.13	3.055	0.00272	0.074924	4	0.024528	no	SNTTRM
chr1_285175_C_T_b38	RP11-34P13.13	2.644	0.00917	0.039454	3	0.01492	no	SNTTRM
chr1_273824_G_T_b38	RP11-34P13.13	4.105	6.05e-05	0.065788	9	0.016026	yes	SPLEEN
chr1_265009_A_T_b38	RP11-34P13.13	4.079	6.7e-05	0.064097	10	0.015714	yes	SPLEEN
chr1_271569_A_G_b38	RP11-34P13.13	3.076	0.00241	0.054817	8	0.017821	yes	SPLEEN
chr1_888125_T_C_b38	RP11-34P13.13	2.861	0.00471	0.055195	4	0.019294	yes	SPLEEN
chr1_1137233_C_G_b38	RP11-34P13.13	2.763	0.0063	0.041296	23	0.014945	yes	SPLEEN
chr1_1056662_C_T_b38	RP11-34P13.13	-2.686	0.0079	-0.040678	14	0.015147	yes	SPLEEN
chr1_1056668_C_CGT_b38	RP11-34P13.13	-2.686	0.0079	-0.040678	14	0.015147	yes	SPLEEN
chr1_715769_C_T_b38	RP11-34P13.13	3.53	0.000524	0.092541	6	0.026216	no	SPLEEN
chr1_1171404_T_C_b38	RP11-34P13.13	2.795	0.00573	0.044924	12	0.016071	no	SPLEEN
chr1_1026830_A_G_b38	RP11-34P13.13	-2.641	0.00896	-0.036517	32	0.013826	no	SPLEEN
chr1_272378_A_T_b38	RP11-34P13.13	2.617	0.00961	0.085743	7	0.03277	no	SPLEEN
chr1_272378_A_T_b38	RP11-34P13.13	5.601	5.29e-08	0.083267	7	0.014867	yes	STMACH
chr1_273824_G_T_b38	RP11-34P13.13	5.278	2.7e-07	0.041028	21	0.007774	yes	STMACH
chr1_265009_A_T_b38	RP11-34P13.13	5.2	3.97e-07	0.040676	19	0.007823	yes	STMACH
chr1_271569_A_G_b38	RP11-34P13.13	4.553	8.03e-06	0.036461	19	0.008008	yes	STMACH
chr1_274015_A_G_b38	RP11-34P13.13	4.446	1.28e-05	0.044157	24	0.009932	yes	STMACH
chr1_264681_A_G_b38	RP11-34P13.13	4.381	1.69e-05	0.0471	8	0.01075	yes	STMACH
chr1_284929_A_G_b38	RP11-34P13.13	4.082	5.89e-05	0.050102	5	0.012273	yes	STMACH
chr1_280592_T_C_b38	RP11-34P13.13	4.046	6.81e-05	0.034384	11	0.008497	yes	STMACH
chr1_264730_T_A_b38	RP11-34P13.13	4.04	6.98e-05	0.062758	12	0.015534	yes	STMACH
chr1_280599_T_C_b38	RP11-34P13.13	3.998	8.25e-05	0.034675	9	0.008672	yes	STMACH
chr1_271147_T_G_b38	RP11-34P13.13	3.709	0.000253	0.040168	14	0.010829	yes	STMACH
chr1_19322_C_T_b38	RP11-34P13.13	-3.638	0.00033	-0.041303	6	0.011355	yes	STMACH
chr1_765743_C_CA_b38	RP11-34P13.13	3.511	0.000523	0.039336	4	0.011203	yes	STMACH
chr1_269588_A_G_b38	RP11-34P13.13	3.432	0.000694	0.027401	34	0.007984	yes	STMACH
chr1_715769_C_T_b38	RP11-34P13.13	3.367	0.000871	0.04042	11	0.012005	yes	STMACH
chr1_286158_A_G_b38	RP11-34P13.13	3.213	0.00148	0.032129	5	0.010001	yes	STMACH
chr1_282551_T_C_b38	RP11-34P13.13	3.186	0.00161	0.02973	10	0.009331	yes	STMACH
chr1_286145_C_CAT_b38	RP11-34P13.13	3.172	0.00169	0.030024	5	0.009466	yes	STMACH
chr1_271413_C_T_b38	RP11-34P13.13	3.17	0.0017	0.033205	8	0.010474	yes	STMACH
chr1_94271_C_G_b38	RP11-34P13.13	2.969	0.00326	0.024279	37	0.008178	yes	STMACH
chr1_272548_A_C_b38	RP11-34P13.13	5.168	4.63e-07	0.057176	22	0.011064	no	STMACH
chr1_272389_C_T_b38	RP11-34P13.13	4.983	1.12e-06	0.063045	19	0.012652	no	STMACH
chr1_518864_T_A_b38	RP11-34P13.13	4.627	5.79e-06	0.053164	3	0.011491	no	STMACH
chr1_20316_GA_G_b38	RP11-34P13.13	4.261	2.82e-05	0.039198	5	0.009199	no	STMACH
chr1_94570_T_G_b38	RP11-34P13.13	4.202	3.61e-05	0.041254	5	0.009819	no	STMACH
chr1_272488_C_G_b38	RP11-34P13.13	3.525	0.000498	0.032352	19	0.009177	no	STMACH
chr1_187331_C_G_b38	RP11-34P13.13	-3.493	0.000559	-0.032638	4	0.009344	no	STMACH
chr1_20547_A_G_b38	RP11-34P13.13	3.433	0.000692	0.030997	6	0.00903	no	STMACH
chr1_272505_C_G_b38	RP11-34P13.13	3.344	0.000944	0.034385	19	0.010283	no	STMACH
chr1_886546_C_G_b38	RP11-34P13.13	-3.284	0.00116	-0.038944	3	0.011857	no	STMACH
chr1_272512_A_G_b38	RP11-34P13.13	3.2	0.00154	0.034603	19	0.010812	no	STMACH
chr1_13613_T_A_b38	RP11-34P13.13	-2.996	0.00299	-0.029269	3	0.009768	no	STMACH
chr1_16103_T_G_b38	RP11-34P13.13	2.791	0.00563	0.023014	20	0.008246	no	STMACH
chr1_517599_AAC_A_b38	RP11-34P13.13	-2.789	0.00566	-0.041568	3	0.014902	no	STMACH
chr1_1120047_GA_G_b38	RP11-34P13.13	-2.766	0.00607	-0.02444	10	0.008837	no	STMACH
chr1_281912_C_G_b38	RP11-34P13.13	-2.619	0.00932	-0.023348	13	0.008914	no	STMACH
chr1_20316_GA_G_b38	RP11-34P13.13	3.595	0.000387	0.052278	5	0.014543	yes	TESTIS
chr1_1002415_C_CATT_b38	RP11-34P13.13	3.412	0.000745	0.088575	5	0.02596	yes	TESTIS
chr1_16378_T_C_b38	RP11-34P13.13	-2.975	0.00319	-0.059341	10	0.019943	yes	TESTIS
chr1_619417_C_T_b38	RP11-34P13.13	2.917	0.00383	0.036141	21	0.01239	yes	TESTIS
chr1_282728_T_C_b38	RP11-34P13.13	2.798	0.00552	0.043832	3	0.015666	yes	TESTIS
chr1_13079_C_G_b38	RP11-34P13.13	2.735	0.00666	0.038305	16	0.014007	yes	TESTIS
chr1_635258_T_C_b38	RP11-34P13.13	2.81	0.00532	0.043963	9	0.015645	no	TESTIS
chr1_271413_C_T_b38	RP11-34P13.13	2.803	0.00544	0.047507	6	0.016951	no	TESTIS
chr1_271276_G_A_b38	RP11-34P13.13	13.586	4.93e-36	0.158603	3	0.011674	yes	THYROID
chr1_518864_T_A_b38	RP11-34P13.13	11.998	2.41e-29	0.159644	5	0.013305	yes	THYROID
chr1_280674_A_G_b38	RP11-34P13.13	7.202	2.18e-12	0.102626	4	0.01425	yes	THYROID
chr1_271413_C_T_b38	RP11-34P13.13	6.878	1.81e-11	0.095842	11	0.013934	yes	THYROID
chr1_273824_G_T_b38	RP11-34P13.13	6.554	1.39e-10	0.067868	29	0.010356	yes	THYROID
chr1_271569_A_G_b38	RP11-34P13.13	6.542	1.49e-10	0.072201	30	0.011036	yes	THYROID
chr1_265009_A_T_b38	RP11-34P13.13	6.38	4.02e-10	0.070515	26	0.011052	yes	THYROID
chr1_286158_A_G_b38	RP11-34P13.13	6.246	8.96e-10	0.081682	6	0.013077	yes	THYROID
chr1_280592_T_C_b38	RP11-34P13.13	6.108	2.02e-09	0.067589	25	0.011065	yes	THYROID
chr1_280599_T_C_b38	RP11-34P13.13	6.034	3.11e-09	0.072382	15	0.011996	yes	THYROID
chr1_272548_A_C_b38	RP11-34P13.13	5.998	3.82e-09	0.090904	30	0.015156	yes	THYROID
chr1_280198_C_A_b38	RP11-34P13.13	5.807	1.13e-08	0.10761	5	0.018531	yes	THYROID
chr1_107970_G_A_b38	RP11-34P13.13	5.539	4.91e-08	0.066591	3	0.012022	yes	THYROID
chr1_19322_C_T_b38	RP11-34P13.13	-5.461	7.46e-08	-0.08108	16	0.014847	yes	THYROID
chr1_269588_A_G_b38	RP11-34P13.13	5.388	1.09e-07	0.056255	64	0.01044	yes	THYROID
chr1_272505_C_G_b38	RP11-34P13.13	5.387	1.1e-07	0.073834	25	0.013706	yes	THYROID
chr1_264681_A_G_b38	RP11-34P13.13	5.355	1.31e-07	0.079525	13	0.014851	yes	THYROID
chr1_271147_T_G_b38	RP11-34P13.13	5.306	1.68e-07	0.079454	24	0.014973	yes	THYROID
chr1_272488_C_G_b38	RP11-34P13.13	5.295	1.78e-07	0.064903	25	0.012258	yes	THYROID
chr1_13613_T_A_b38	RP11-34P13.13	-5.289	1.84e-07	-0.066088	5	0.012496	yes	THYROID
chr1_19980_G_A_b38	RP11-34P13.13	5.141	3.92e-07	0.111052	5	0.021602	yes	THYROID
chr1_274015_A_G_b38	RP11-34P13.13	5.069	5.63e-07	0.072837	31	0.014369	yes	THYROID
chr1_187331_C_G_b38	RP11-34P13.13	-5.029	6.87e-07	-0.06493	7	0.012911	yes	THYROID
chr1_271406_C_CTTT_b38	RP11-34P13.13	4.836	1.76e-06	0.131522	3	0.027195	yes	THYROID
chr1_284741_A_C_b38	RP11-34P13.13	4.786	2.24e-06	0.095537	6	0.019961	yes	THYROID
chr1_286145_C_CAT_b38	RP11-34P13.13	4.538	7.11e-06	0.058601	6	0.012913	yes	THYROID
chr1_272512_A_G_b38	RP11-34P13.13	4.519	7.75e-06	0.065218	25	0.014432	yes	THYROID
chr1_284929_A_G_b38	RP11-34P13.13	4.389	1.39e-05	0.079651	6	0.018147	yes	THYROID
chr1_874496_A_G_b38	RP11-34P13.13	-3.845	0.000136	-0.056971	6	0.014816	yes	THYROID
chr1_276113_T_C_b38	RP11-34P13.13	3.773	0.000181	0.061014	3	0.016173	yes	THYROID
chr1_282728_T_C_b38	RP11-34P13.13	3.613	0.000334	0.043841	6	0.012135	yes	THYROID
chr1_870176_T_A_b38	RP11-34P13.13	-3.598	0.000352	-0.054411	7	0.015121	yes	THYROID
chr1_862646_C_T_b38	RP11-34P13.13	3.598	0.000352	0.05534	5	0.015379	yes	THYROID
chr1_277834_G_A_b38	RP11-34P13.13	3.54	0.000438	0.069169	20	0.019541	yes	THYROID
chr1_280726_A_AACACACACAC_b38	RP11-34P13.13	3.537	0.000441	0.065816	4	0.018606	yes	THYROID
chr1_285175_C_T_b38	RP11-34P13.13	3.516	0.000477	0.052293	11	0.014871	yes	THYROID
chr1_282721_A_G_b38	RP11-34P13.13	3.503	0.000501	0.042646	6	0.012174	yes	THYROID
chr1_858952_G_A_b38	RP11-34P13.13	-3.471	0.000564	-0.055554	4	0.016007	yes	THYROID
chr1_285746_C_T_b38	RP11-34P13.13	3.42	0.000678	0.060876	4	0.017802	yes	THYROID
chr1_280750_T_C_b38	RP11-34P13.13	3.416	0.000686	0.048309	3	0.014141	yes	THYROID
chr1_272164_G_A_b38	RP11-34P13.13	3.391	0.000751	0.045249	46	0.013343	yes	THYROID
chr1_264730_T_A_b38	RP11-34P13.13	3.35	0.00087	0.07637	17	0.0228	yes	THYROID
chr1_861131_C_G_b38	RP11-34P13.13	-3.329	0.000934	-0.050932	4	0.015298	yes	THYROID
chr1_282551_T_C_b38	RP11-34P13.13	3.327	0.000942	0.040175	15	0.012075	yes	THYROID
chr1_865003_C_T_b38	RP11-34P13.13	3.303	0.00102	0.049391	7	0.014953	yes	THYROID
chr1_602088_G_T_b38	RP11-34P13.13	-3.294	0.00106	-0.043187	4	0.01311	yes	THYROID
chr1_105123_C_G_b38	RP11-34P13.13	3.253	0.00122	0.0808	3	0.024836	yes	THYROID
chr1_878665_C_T_b38	RP11-34P13.13	-3.239	0.00128	-0.047261	6	0.014592	yes	THYROID
chr1_601544_G_A_b38	RP11-34P13.13	-3.197	0.00148	-0.04294	6	0.013432	yes	THYROID
chr1_269781_C_T_b38	RP11-34P13.13	-3.088	0.00213	-0.039493	3	0.01279	yes	THYROID
chr1_958061_C_CTTT_b38	RP11-34P13.13	3.057	0.00236	0.08875	5	0.029033	yes	THYROID
chr1_834583_G_A_b38	RP11-34P13.13	-2.991	0.00291	-0.042577	6	0.014234	yes	THYROID
chr1_588011_C_T_b38	RP11-34P13.13	-2.98	0.00302	-0.033652	28	0.011293	yes	THYROID
chr1_1002417_T_A_b38	RP11-34P13.13	2.975	0.00307	0.03411	30	0.011467	yes	THYROID
chr1_833068_G_A_b38	RP11-34P13.13	-2.941	0.00342	-0.042279	7	0.014376	yes	THYROID
chr1_872909_A_T_b38	RP11-34P13.13	-2.933	0.00351	-0.047196	6	0.016093	yes	THYROID
chr1_282616_G_GA_b38	RP11-34P13.13	2.911	0.00376	0.034868	11	0.011977	yes	THYROID
chr1_928261_G_A_b38	RP11-34P13.13	-2.843	0.00465	-0.037909	17	0.013333	yes	THYROID
chr1_601515_T_C_b38	RP11-34P13.13	-2.816	0.00505	-0.034334	10	0.012192	yes	THYROID
chr1_835506_G_A_b38	RP11-34P13.13	-2.807	0.00519	-0.040748	6	0.014516	yes	THYROID
chr1_601606_G_T_b38	RP11-34P13.13	-2.797	0.00535	-0.033065	15	0.01182	yes	THYROID
chr1_16378_T_C_b38	RP11-34P13.13	-2.727	0.00661	-0.043136	21	0.015818	yes	THYROID
chr1_690060_A_C_b38	RP11-34P13.13	-2.721	0.00672	-0.054018	5	0.019849	yes	THYROID
chr1_588022_A_G_b38	RP11-34P13.13	-2.708	0.00699	-0.031264	27	0.011543	yes	THYROID
chr1_928264_T_C_b38	RP11-34P13.13	-2.651	0.00829	-0.033093	21	0.012485	yes	THYROID
chr1_1095680_A_G_b38	RP11-34P13.13	2.601	0.00957	0.045919	3	0.017655	yes	THYROID
chr1_20316_GA_G_b38	RP11-34P13.13	8.29	1.04e-15	0.098069	7	0.01183	no	THYROID
chr1_94570_T_G_b38	RP11-34P13.13	7.697	7.41e-14	0.100128	7	0.013008	no	THYROID
chr1_187323_G_A_b38	RP11-34P13.13	-6.668	6.84e-11	-0.08353	4	0.012527	no	THYROID
chr1_272378_A_T_b38	RP11-34P13.13	5.572	4.1e-08	0.122476	15	0.02198	no	THYROID
chr1_20547_A_G_b38	RP11-34P13.13	5.463	7.38e-08	0.068393	7	0.01252	no	THYROID
chr1_272389_C_T_b38	RP11-34P13.13	5.452	7.81e-08	0.110333	26	0.020236	no	THYROID
chr1_260937_C_T_b38	RP11-34P13.13	4.177	3.48e-05	0.069231	7	0.016574	no	THYROID
chr1_92930_G_T_b38	RP11-34P13.13	4.025	6.57e-05	0.093795	4	0.023302	no	THYROID
chr1_168098_A_G_b38	RP11-34P13.13	-3.814	0.000154	-0.061822	3	0.01621	no	THYROID
chr1_1062056_CTCCCTCCCTTGTCCCCGTTCCCTCCG_C_b38	RP11-34P13.13	2.931	0.00353	0.033465	23	0.011418	no	THYROID
chr1_94271_C_G_b38	RP11-34P13.13	2.704	0.00708	0.028459	76	0.010524	no	THYROID
chr1_102075_G_A_b38	RP11-34P13.13	2.671	0.00782	0.094742	3	0.035477	no	THYROID
chr1_291791_T_C_b38	RP11-34P13.13	2.652	0.00824	0.070666	6	0.026642	no	THYROID
chr1_280599_T_C_b38	RP11-34P13.13	3.754	0.000287	0.104186	4	0.027752	yes	UTERUS
chr1_271569_A_G_b38	RP11-34P13.13	3.586	0.000513	0.097762	3	0.027261	yes	UTERUS
chr1_187323_G_A_b38	RP11-34P13.13	-3.459	0.000787	-0.09677	3	0.027975	yes	UTERUS
chr1_897580_AT_A_b38	RP11-34P13.13	-2.913	0.00439	-0.060754	31	0.020859	yes	UTERUS
chr1_187331_C_G_b38	RP11-34P13.13	-2.892	0.00466	-0.084658	3	0.02927	yes	UTERUS
chr1_715769_C_T_b38	RP11-34P13.13	2.687	0.00839	0.104043	3	0.038719	yes	UTERUS
chr1_841166_A_G_b38	RP11-34P13.13	2.657	0.00913	0.062514	8	0.02353	yes	UTERUS
chr1_265009_A_T_b38	RP11-34P13.13	2.651	0.00929	0.068612	4	0.025885	yes	UTERUS
chr1_280592_T_C_b38	RP11-34P13.13	2.628	0.00989	0.073845	4	0.0281	yes	UTERUS
chr1_1102614_T_TA_b38	RP11-34P13.13	2.778	0.00649	0.093055	3	0.0335	no	UTERUS
chr1_903175_C_A_b38	RP11-34P13.13	-2.633	0.00976	-0.064424	8	0.024471	no	UTERUS
chr1_518864_T_A_b38	RP11-34P13.13	4.566	1.25e-05	0.114885	3	0.025161	yes	VAGINA
chr1_1028324_C_A_b38	RP11-34P13.13	-3.221	0.00166	-0.064259	17	0.019953	yes	VAGINA
chr1_58866_C_G_b38	RP11-34P13.13	3.045	0.00288	0.052951	23	0.017388	yes	VAGINA
chr1_265261_G_A_b38	RP11-34P13.13	-2.912	0.00431	-0.062638	7	0.021513	yes	VAGINA
chr1_928131_T_C_b38	RP11-34P13.13	-2.785	0.00625	-0.061046	8	0.02192	yes	VAGINA
chr1_13684_C_T_b38	RP11-34P13.13	2.716	0.00762	0.057357	5	0.021119	yes	VAGINA
chr1_271569_A_G_b38	RP11-34P13.13	2.69	0.0082	0.062483	4	0.023229	yes	VAGINA
chr1_928121_T_C_b38	RP11-34P13.13	-2.723	0.00747	-0.078451	3	0.028812	no	VAGINA
chr1_39015_A_C_b38	RP11-34P13.13	-2.631	0.00968	-0.06424	4	0.02442	no	VAGINA
chr1_1062896_T_C_b38	RP11-34P13.13	3.455	0.000589	0.109796	5	0.03178	yes	WHLBLD
chr1_1048767_C_CA_b38	RP11-34P13.13	3.163	0.00164	0.109685	3	0.034673	yes	WHLBLD
chr1_1071133_G_A_b38	RP11-34P13.13	3.091	0.00209	0.116623	3	0.037736	yes	WHLBLD
chr1_1126635_C_T_b38	RP11-34P13.13	2.891	0.00398	0.071375	3	0.024689	yes	WHLBLD
chr1_275583_TTTTA_T_b38	RP11-34P13.13	2.724	0.00664	0.037585	14	0.013798	yes	WHLBLD
chr1_1081836_A_G_b38	RP11-34P13.13	2.699	0.00716	0.098741	3	0.036591	yes	WHLBLD
chr1_139781_G_A_b38	RP11-34P13.13	-2.68	0.00757	-0.028983	102	0.010816	yes	WHLBLD
chr1_271406_C_CTTT_b38	RP11-34P13.13	2.665	0.00791	0.07691	3	0.028859	yes	WHLBLD
chr1_1115166_G_GT_b38	RP11-34P13.13	2.65	0.00825	0.055924	16	0.021101	yes	WHLBLD
chr1_1050080_T_C_b38	RP11-34P13.13	2.648	0.00832	0.051121	21	0.019307	yes	WHLBLD
chr1_1116992_A_G_b38	RP11-34P13.13	2.634	0.00865	0.055971	16	0.021246	yes	WHLBLD
chr1_1126910_C_T_b38	RP11-34P13.13	2.626	0.00887	0.065224	3	0.02484	yes	WHLBLD
chr1_1116304_A_C_b38	RP11-34P13.13	2.61	0.00927	0.056183	14	0.021523	yes	WHLBLD
chr1_194639_A_T_b38	RP11-34P13.13	2.59	0.00984	0.038529	15	0.014879	yes	WHLBLD
chr1_1080338_G_A_b38	RP11-34P13.13	2.588	0.00987	0.107685	3	0.041602	yes	WHLBLD
chr1_52238_T_G_b38	RP11-34P13.13	-5.824	9.38e-09	-0.154573	6	0.026541	no	WHLBLD
chr1_128798_C_T_b38	RP11-34P13.13	-3.555	0.000408	-0.112711	6	0.031706	no	WHLBLD
chr1_74681_G_T_b38	RP11-34P13.13	-3.103	0.00201	-0.083875	4	0.02703	no	WHLBLD
chr1_928128_G_T_b38	RP11-34P13.13	-2.851	0.0045	-0.046974	20	0.016475	no	WHLBLD
chr1_186728_A_T_b38	RP11-34P13.13	2.743	0.00628	0.042887	3	0.015637	no	WHLBLD
chr1_49404_C_A_b38	RP11-34P13.13	-2.719	0.00673	-0.032085	65	0.011799	no	WHLBLD
chr1_590813_C_T_b38	RP11-34P13.13	-2.645	0.00838	-0.069009	6	0.026089	no	WHLBLD

---

Filters:      p-Values >= and <=      Betas >= and <=      Statistic >= and <=      Carriers >= and <=
Positions: left right     Zoom: RP11-34P13.13     Other:     -      +     reset     eQTLs Region
Draw    p-Value Beta Statistic Carriers Beta/sd(t)     Scaling     Sign (red=+, blue-)     Colors: Tissue Sign