RP4-758J18.2 - MRPL20 antisense RNA 1 - 1p36.33

Snps	Gene	Statistic	Pvalue	Beta	Carriers	Beta_se	Linear	Tissue
chr1_1389777_G_A_b38	RP4-758J18.2	-8.153	2.77e-15	-0.113067	3	0.013868	yes	ADPSBQ
chr1_1400626_C_T_b38	RP4-758J18.2	-8.141	3.02e-15	-0.11356	3	0.013949	yes	ADPSBQ
chr1_1366183_TGA_T_b38	RP4-758J18.2	-8.003	8.26e-15	-0.112735	3	0.014087	yes	ADPSBQ
chr1_1319648_G_A_b38	RP4-758J18.2	-7.928	1.41e-14	-0.111073	3	0.01401	yes	ADPSBQ
chr1_1356751_A_G_b38	RP4-758J18.2	-7.803	3.45e-14	-0.110248	3	0.01413	yes	ADPSBQ
chr1_1296207_G_A_b38	RP4-758J18.2	-7.643	1.06e-13	-0.105977	3	0.013865	yes	ADPSBQ
chr1_1223061_GCA_G_b38	RP4-758J18.2	-3.887	0.000115	-0.051893	3	0.01335	yes	ADPSBQ
chr1_1481071_T_C_b38	RP4-758J18.2	-3.597	0.000353	-0.045106	12	0.01254	yes	ADPSBQ
chr1_2106507_A_G_b38	RP4-758J18.2	-3.452	0.000602	-0.054906	4	0.015905	yes	ADPSBQ
chr1_1374801_A_G_b38	RP4-758J18.2	-3.395	0.000739	-0.045762	9	0.013478	yes	ADPSBQ
chr1_2296236_A_C_b38	RP4-758J18.2	-3.313	0.000987	-0.041922	5	0.012652	yes	ADPSBQ
chr1_2189598_TGCGGGGGAGCCGAGAGGCGGGGCTGCTG_T_b38	RP4-758J18.2	-3.176	0.00158	-0.048452	3	0.015254	yes	ADPSBQ
chr1_1279441_C_T_b38	RP4-758J18.2	-2.951	0.00331	-0.036785	5	0.012464	yes	ADPSBQ
chr1_2351678_C_T_b38	RP4-758J18.2	-2.918	0.00368	-0.026298	17	0.009012	yes	ADPSBQ
chr1_1378484_AT_A_b38	RP4-758J18.2	2.909	0.00379	0.023594	102	0.008112	yes	ADPSBQ
chr1_1375288_A_C_b38	RP4-758J18.2	2.854	0.00449	0.032294	22	0.011314	yes	ADPSBQ
chr1_1375595_C_T_b38	RP4-758J18.2	2.854	0.00449	0.032294	22	0.011314	yes	ADPSBQ
chr1_1376092_G_A_b38	RP4-758J18.2	2.854	0.00449	0.032294	22	0.011314	yes	ADPSBQ
chr1_1376336_G_A_b38	RP4-758J18.2	2.854	0.00449	0.032294	22	0.011314	yes	ADPSBQ
chr1_1379664_G_A_b38	RP4-758J18.2	2.854	0.00449	0.032294	22	0.011314	yes	ADPSBQ
chr1_1385919_A_AG_b38	RP4-758J18.2	2.78	0.00564	0.031319	26	0.011266	yes	ADPSBQ
chr1_1173996_G_A_b38	RP4-758J18.2	-2.754	0.00609	-0.03236	6	0.011749	yes	ADPSBQ
chr1_601544_G_A_b38	RP4-758J18.2	-2.738	0.00639	-0.027517	9	0.010049	yes	ADPSBQ
chr1_2351215_T_G_b38	RP4-758J18.2	-2.735	0.00646	-0.024628	17	0.009006	yes	ADPSBQ
chr1_715769_C_T_b38	RP4-758J18.2	2.709	0.00697	0.035383	21	0.01306	yes	ADPSBQ
chr1_1415976_G_A_b38	RP4-758J18.2	-2.703	0.0071	-0.029371	32	0.010866	yes	ADPSBQ
chr1_1471663_A_C_b38	RP4-758J18.2	-2.684	0.00751	-0.045897	8	0.0171	yes	ADPSBQ
chr1_1410616_G_T_b38	RP4-758J18.2	-2.672	0.00778	-0.028833	32	0.010791	yes	ADPSBQ
chr1_1412488_C_CAG_b38	RP4-758J18.2	-2.672	0.00778	-0.028833	32	0.010791	yes	ADPSBQ
chr1_1001333_G_T_b38	RP4-758J18.2	-2.647	0.00838	-0.030334	5	0.011461	yes	ADPSBQ
chr1_1411525_T_A_b38	RP4-758J18.2	-2.605	0.00947	-0.027718	28	0.010642	yes	ADPSBQ
chr1_1248798_T_C_b38	RP4-758J18.2	-4.058	5.72e-05	-0.081801	3	0.020158	no	ADPSBQ
chr1_1423775_C_CT_b38	RP4-758J18.2	3.818	0.000151	0.040134	18	0.01051	no	ADPSBQ
chr1_1308552_GGA_G_b38	RP4-758J18.2	-3.806	0.000159	-0.042437	15	0.011151	no	ADPSBQ
chr1_2106511_C_CT_b38	RP4-758J18.2	-3.632	0.000309	-0.075979	3	0.020917	no	ADPSBQ
chr1_2345829_C_CCACACACACA_b38	RP4-758J18.2	-3.225	0.00134	-0.052549	5	0.016296	no	ADPSBQ
chr1_1028325_C_A_b38	RP4-758J18.2	3.21	0.00141	0.042236	4	0.013159	no	ADPSBQ
chr1_1481085_C_G_b38	RP4-758J18.2	-3.112	0.00196	-0.050879	7	0.016348	no	ADPSBQ
chr1_1134222_T_C_b38	RP4-758J18.2	-3.044	0.00246	-0.021494	64	0.007062	no	ADPSBQ
chr1_1374694_C_G_b38	RP4-758J18.2	3.038	0.0025	0.039023	11	0.012844	no	ADPSBQ
chr1_2106518_A_G_b38	RP4-758J18.2	-3.017	0.00268	-0.065669	3	0.021764	no	ADPSBQ
chr1_1372258_T_C_b38	RP4-758J18.2	2.872	0.00425	0.037571	10	0.013082	no	ADPSBQ
chr1_1359138_C_T_b38	RP4-758J18.2	2.834	0.00477	0.032373	36	0.011422	no	ADPSBQ
chr1_1174573_G_A_b38	RP4-758J18.2	-2.812	0.00511	-0.033755	6	0.012002	no	ADPSBQ
chr1_1411929_G_C_b38	RP4-758J18.2	-2.811	0.00513	-0.030126	32	0.010717	no	ADPSBQ
chr1_1375998_T_A_b38	RP4-758J18.2	2.724	0.00666	0.03061	22	0.011236	no	ADPSBQ
chr1_1179288_G_A_b38	RP4-758J18.2	-2.711	0.00694	-0.032303	6	0.011917	no	ADPSBQ
chr1_1177602_C_T_b38	RP4-758J18.2	2.688	0.00742	0.024234	27	0.009015	no	ADPSBQ
chr1_2342999_A_G_b38	RP4-758J18.2	-2.622	0.00901	-0.020096	36	0.007665	no	ADPSBQ
chr1_1154319_G_A_b38	RP4-758J18.2	-2.601	0.00956	-0.058151	4	0.022355	no	ADPSBQ
chr1_1154450_A_G_b38	RP4-758J18.2	-2.601	0.00956	-0.058151	4	0.022355	no	ADPSBQ
chr1_1156196_A_C_b38	RP4-758J18.2	-2.601	0.00956	-0.058151	4	0.022355	no	ADPSBQ
chr1_1156768_G_C_b38	RP4-758J18.2	-2.601	0.00956	-0.058151	4	0.022355	no	ADPSBQ
chr1_1156790_G_C_b38	RP4-758J18.2	-2.601	0.00956	-0.058151	4	0.022355	no	ADPSBQ
chr1_1172462_G_C_b38	RP4-758J18.2	-2.6	0.0096	-0.030035	8	0.011554	no	ADPSBQ
chr1_2280375_C_CA_b38	RP4-758J18.2	-2.595	0.00972	-0.021478	26	0.008276	no	ADPSBQ
chr1_1356751_A_G_b38	RP4-758J18.2	-9.197	2.1e-18	-0.16943	3	0.018423	yes	ADPVSC
chr1_1400626_C_T_b38	RP4-758J18.2	-9.196	2.11e-18	-0.171455	3	0.018645	yes	ADPVSC
chr1_1366183_TGA_T_b38	RP4-758J18.2	-9.164	2.7e-18	-0.168792	3	0.01842	yes	ADPVSC
chr1_1389777_G_A_b38	RP4-758J18.2	-9.157	2.85e-18	-0.168281	3	0.018378	yes	ADPVSC
chr1_1319648_G_A_b38	RP4-758J18.2	-9.147	3.06e-18	-0.16772	3	0.018336	yes	ADPVSC
chr1_1296207_G_A_b38	RP4-758J18.2	-8.57	2.31e-16	-0.155651	3	0.018162	yes	ADPVSC
chr1_1223061_GCA_G_b38	RP4-758J18.2	-5.561	4.94e-08	-0.098232	5	0.017666	yes	ADPVSC
chr1_1279441_C_T_b38	RP4-758J18.2	-4.334	1.85e-05	-0.072945	6	0.01683	yes	ADPVSC
chr1_1288372_TCC_T_b38	RP4-758J18.2	3.794	0.000171	0.117227	5	0.030896	yes	ADPVSC
chr1_1308552_GGA_G_b38	RP4-758J18.2	-3.676	0.000269	-0.058477	14	0.015907	yes	ADPVSC
chr1_1236037_C_T_b38	RP4-758J18.2	-3.62	0.000333	-0.037104	76	0.010251	yes	ADPVSC
chr1_770501_C_T_b38	RP4-758J18.2	-3.379	0.000799	-0.13492	3	0.039926	yes	ADPVSC
chr1_1990027_C_CT_b38	RP4-758J18.2	-3.099	0.00208	-0.074036	6	0.023893	yes	ADPVSC
chr1_1184997_T_A_b38	RP4-758J18.2	-2.919	0.00372	-0.086921	3	0.029782	yes	ADPVSC
chr1_657432_T_C_b38	RP4-758J18.2	-2.842	0.00471	-0.092907	3	0.032688	yes	ADPVSC
chr1_1959595_C_T_b38	RP4-758J18.2	2.774	0.00579	0.057177	4	0.020608	yes	ADPVSC
chr1_1585973_T_A_b38	RP4-758J18.2	-2.762	0.00601	-0.044086	18	0.015961	yes	ADPVSC
chr1_2211900_C_CT_b38	RP4-758J18.2	-2.66	0.00812	-0.047853	11	0.017988	yes	ADPVSC
chr1_1663949_A_G_b38	RP4-758J18.2	-2.657	0.00821	-0.037285	11	0.014034	yes	ADPVSC
chr1_951408_G_A_b38	RP4-758J18.2	-2.653	0.0083	-0.042714	15	0.016102	yes	ADPVSC
chr1_951437_C_T_b38	RP4-758J18.2	-2.653	0.0083	-0.042714	15	0.016102	yes	ADPVSC
chr1_2340807_G_A_b38	RP4-758J18.2	2.627	0.00895	0.030077	29	0.01145	yes	ADPVSC
chr1_896109_C_T_b38	RP4-758J18.2	-2.623	0.00905	-0.029265	48	0.011156	yes	ADPVSC
chr1_967617_G_A_b38	RP4-758J18.2	-2.614	0.0093	-0.037225	14	0.014242	yes	ADPVSC
chr1_1082218_A_G_b38	RP4-758J18.2	2.603	0.00959	0.085646	4	0.032907	yes	ADPVSC
chr1_2340625_G_A_b38	RP4-758J18.2	2.592	0.0099	0.029574	29	0.01141	yes	ADPVSC
chr1_925398_A_G_b38	RP4-758J18.2	2.591	0.00993	0.054372	20	0.020988	yes	ADPVSC
chr1_1074061_G_A_b38	RP4-758J18.2	2.589	0.00998	0.038109	8	0.01472	yes	ADPVSC
chr1_1430020_G_C_b38	RP4-758J18.2	-4.347	1.75e-05	-0.083447	3	0.019195	no	ADPVSC
chr1_973034_C_T_b38	RP4-758J18.2	-3.496	0.000526	-0.07469	8	0.021367	no	ADPVSC
chr1_922063_C_T_b38	RP4-758J18.2	-3.42	0.000692	-0.10103	5	0.029544	no	ADPVSC
chr1_1315752_GAGCGAGGGAGGTGGGGGCGGGGAGGGAGGGAGGGAGGCGGGC_G_b38	RP4-758J18.2	3.296	0.00107	0.040837	21	0.012388	no	ADPVSC
chr1_1481071_T_C_b38	RP4-758J18.2	-3.202	0.00147	-0.065078	7	0.020324	no	ADPVSC
chr1_640426_T_C_b38	RP4-758J18.2	-3.079	0.00222	-0.076086	4	0.024712	no	ADPVSC
chr1_2340564_G_A_b38	RP4-758J18.2	3.063	0.00234	0.034373	30	0.011223	no	ADPVSC
chr1_962358_C_T_b38	RP4-758J18.2	3.022	0.00267	0.057938	5	0.01917	no	ADPVSC
chr1_949046_A_AACAGCAAAG_b38	RP4-758J18.2	-2.973	0.00313	-0.058294	4	0.019607	no	ADPVSC
chr1_962184_T_C_b38	RP4-758J18.2	-2.973	0.00313	-0.056521	5	0.019014	no	ADPVSC
chr1_950296_C_A_b38	RP4-758J18.2	-2.956	0.0033	-0.059336	3	0.020072	no	ADPVSC
chr1_952180_A_C_b38	RP4-758J18.2	-2.956	0.0033	-0.059336	3	0.020072	no	ADPVSC
chr1_1522875_T_G_b38	RP4-758J18.2	-2.951	0.00336	-0.081216	3	0.027524	no	ADPVSC
chr1_2380209_G_A_b38	RP4-758J18.2	-2.92	0.0037	-0.02941	60	0.010071	no	ADPVSC
chr1_1020947_C_T_b38	RP4-758J18.2	2.909	0.00383	0.061127	3	0.021015	no	ADPVSC
chr1_1185051_G_A_b38	RP4-758J18.2	2.875	0.00426	0.051701	8	0.017984	no	ADPVSC
chr1_1479704_G_A_b38	RP4-758J18.2	-2.863	0.00441	-0.047717	7	0.016665	no	ADPVSC
chr1_961945_G_C_b38	RP4-758J18.2	-2.857	0.00451	-0.053307	6	0.018662	no	ADPVSC
chr1_1482316_C_G_b38	RP4-758J18.2	-2.846	0.00465	-0.030262	52	0.010632	no	ADPVSC
chr1_1495136_G_A_b38	RP4-758J18.2	-2.839	0.00475	-0.048575	5	0.017109	no	ADPVSC
chr1_953778_G_C_b38	RP4-758J18.2	-2.824	0.00499	-0.057984	3	0.020535	no	ADPVSC
chr1_953779_A_C_b38	RP4-758J18.2	-2.824	0.00499	-0.057984	3	0.020535	no	ADPVSC
chr1_1009470_A_T_b38	RP4-758J18.2	2.815	0.00512	0.057833	4	0.020543	no	ADPVSC
chr1_2380105_C_T_b38	RP4-758J18.2	-2.807	0.00525	-0.028297	61	0.010082	no	ADPVSC
chr1_1235349_G_A_b38	RP4-758J18.2	-2.782	0.00566	-0.067771	4	0.02436	no	ADPVSC
chr1_954333_C_A_b38	RP4-758J18.2	-2.78	0.00569	-0.053838	4	0.019364	no	ADPVSC
chr1_1485324_C_T_b38	RP4-758J18.2	-2.777	0.00574	-0.047986	4	0.017278	no	ADPVSC
chr1_1515828_G_A_b38	RP4-758J18.2	-2.772	0.00583	-0.04801	4	0.01732	no	ADPVSC
chr1_2340764_G_T_b38	RP4-758J18.2	2.772	0.00584	0.031113	30	0.011225	no	ADPVSC
chr1_2340235_T_C_b38	RP4-758J18.2	2.762	0.00601	0.031	30	0.011224	no	ADPVSC
chr1_2327187_CAG_C_b38	RP4-758J18.2	2.749	0.00626	0.03409	22	0.012402	no	ADPVSC
chr1_889018_A_C_b38	RP4-758J18.2	2.696	0.00732	0.0346	15	0.012836	no	ADPVSC
chr1_2335858_C_T_b38	RP4-758J18.2	2.694	0.00735	0.032758	20	0.012157	no	ADPVSC
chr1_1308551_GGGA_G_b38	RP4-758J18.2	-2.68	0.00767	-0.059772	6	0.022305	no	ADPVSC
chr1_822556_C_A_b38	RP4-758J18.2	-2.68	0.00768	-0.036772	19	0.013723	no	ADPVSC
chr1_2337299_A_G_b38	RP4-758J18.2	2.656	0.00823	0.027163	67	0.010228	no	ADPVSC
chr1_822427_CCCTGGCCAGCAGATCCACCCTGTCTATACTACCTG_C_b38	RP4-758J18.2	-2.649	0.0084	-0.03296	24	0.012443	no	ADPVSC
chr1_1290841_A_G_b38	RP4-758J18.2	-2.642	0.00857	-0.037445	24	0.014173	no	ADPVSC
chr1_917887_G_T_b38	RP4-758J18.2	-2.601	0.00963	-0.0801	5	0.030793	no	ADPVSC
chr1_2289210_C_T_b38	RP4-758J18.2	-3.977	9.89e-05	-0.069928	46	0.017584	yes	ADRNLG
chr1_2289078_A_C_b38	RP4-758J18.2	-3.963	0.000104	-0.068357	43	0.017248	yes	ADRNLG
chr1_2290095_A_G_b38	RP4-758J18.2	-3.553	0.000479	-0.06219	42	0.017502	yes	ADRNLG
chr1_2290195_G_C_b38	RP4-758J18.2	-3.553	0.000479	-0.06219	42	0.017502	yes	ADRNLG
chr1_2290197_A_T_b38	RP4-758J18.2	-3.553	0.000479	-0.06219	42	0.017502	yes	ADRNLG
chr1_2289834_C_A_b38	RP4-758J18.2	-3.437	0.000722	-0.059847	42	0.017413	yes	ADRNLG
chr1_2290637_G_A_b38	RP4-758J18.2	-3.425	0.000751	-0.060323	42	0.01761	yes	ADRNLG
chr1_2028539_C_T_b38	RP4-758J18.2	-3.319	0.00108	-0.05623	41	0.01694	yes	ADRNLG
chr1_2031736_A_G_b38	RP4-758J18.2	-3.28	0.00123	-0.055233	40	0.016838	yes	ADRNLG
chr1_2288986_T_C_b38	RP4-758J18.2	-3.147	0.00191	-0.055435	29	0.017614	yes	ADRNLG
chr1_2377078_C_G_b38	RP4-758J18.2	-3.112	0.00215	-0.088992	3	0.028601	yes	ADRNLG
chr1_2291613_CCT_C_b38	RP4-758J18.2	3.101	0.00222	0.057742	42	0.01862	yes	ADRNLG
chr1_1425135_T_C_b38	RP4-758J18.2	-3.095	0.00226	-0.090514	4	0.029246	yes	ADRNLG
chr1_2003928_C_CGGGCCG_b38	RP4-758J18.2	-3.094	0.00227	-0.05634	23	0.018209	yes	ADRNLG
chr1_2382880_T_C_b38	RP4-758J18.2	-2.975	0.00331	-0.082761	4	0.027823	yes	ADRNLG
chr1_1425750_T_C_b38	RP4-758J18.2	-2.915	0.00398	-0.087801	4	0.030121	yes	ADRNLG
chr1_1425822_C_G_b38	RP4-758J18.2	-2.913	0.00401	-0.090041	3	0.030911	yes	ADRNLG
chr1_1425936_G_A_b38	RP4-758J18.2	-2.913	0.00401	-0.090041	3	0.030911	yes	ADRNLG
chr1_1426771_G_C_b38	RP4-758J18.2	-2.913	0.00401	-0.090041	3	0.030911	yes	ADRNLG
chr1_1427080_C_T_b38	RP4-758J18.2	-2.858	0.00473	-0.088238	3	0.030872	yes	ADRNLG
chr1_2392569_C_T_b38	RP4-758J18.2	-2.836	0.00506	-0.062103	9	0.0219	yes	ADRNLG
chr1_2012279_C_CAAAATAAAAT_b38	RP4-758J18.2	-2.796	0.0057	-0.047071	33	0.016835	yes	ADRNLG
chr1_2035575_G_A_b38	RP4-758J18.2	-2.789	0.00582	-0.05194	20	0.018625	yes	ADRNLG
chr1_2037520_G_A_b38	RP4-758J18.2	-2.745	0.00662	-0.050899	20	0.01854	yes	ADRNLG
chr1_1075715_A_G_b38	RP4-758J18.2	2.725	0.00702	0.077427	3	0.028413	yes	ADRNLG
chr1_1042813_G_A_b38	RP4-758J18.2	-2.703	0.00749	-0.065756	6	0.024327	yes	ADRNLG
chr1_2036515_C_T_b38	RP4-758J18.2	-2.655	0.0086	-0.049008	21	0.018459	yes	ADRNLG
chr1_2289783_A_C_b38	RP4-758J18.2	-2.645	0.00885	-0.054792	9	0.020716	yes	ADRNLG
chr1_1773713_T_A_b38	RP4-758J18.2	-2.622	0.00944	-0.050334	25	0.019195	yes	ADRNLG
chr1_2004695_G_A_b38	RP4-758J18.2	-2.609	0.0098	-0.046051	26	0.017651	yes	ADRNLG
chr1_2025598_T_C_b38	RP4-758J18.2	-3.024	0.00284	-0.049782	35	0.016465	no	ADRNLG
chr1_969780_C_T_b38	RP4-758J18.2	3.016	0.00291	0.083039	9	0.027537	no	ADRNLG
chr1_2363813_T_A_b38	RP4-758J18.2	-2.87	0.00456	-0.082031	6	0.028578	no	ADRNLG
chr1_1426175_T_C_b38	RP4-758J18.2	-2.857	0.00475	-0.081225	5	0.028429	no	ADRNLG
chr1_1835922_G_GAAA_b38	RP4-758J18.2	-2.799	0.00564	-0.121679	3	0.043467	no	ADRNLG
chr1_1994025_C_T_b38	RP4-758J18.2	-2.716	0.00722	-0.0647	9	0.023825	no	ADRNLG
chr1_2053372_G_T_b38	RP4-758J18.2	2.703	0.00749	0.058511	11	0.021648	no	ADRNLG
chr1_1836387_CT_C_b38	RP4-758J18.2	-2.7	0.00756	-0.076373	7	0.028291	no	ADRNLG
chr1_2011852_C_T_b38	RP4-758J18.2	-2.682	0.00796	-0.045572	32	0.016994	no	ADRNLG
chr1_2016961_C_A_b38	RP4-758J18.2	-2.682	0.00796	-0.045572	32	0.016994	no	ADRNLG
chr1_2022373_C_T_b38	RP4-758J18.2	-2.631	0.00921	-0.045111	31	0.017148	no	ADRNLG
chr1_1428763_A_G_b38	RP4-758J18.2	-2.606	0.00987	-0.075843	5	0.029101	no	ADRNLG
chr1_1684789_C_CAAAAA_b38	RP4-758J18.2	-3.223	0.0014	-0.057389	10	0.017804	yes	ARTAORT
chr1_1948938_C_T_b38	RP4-758J18.2	-3.193	0.00155	-0.026809	82	0.008396	yes	ARTAORT
chr1_2205151_C_A_b38	RP4-758J18.2	2.952	0.0034	0.046372	7	0.01571	yes	ARTAORT
chr1_509848_C_T_b38	RP4-758J18.2	2.919	0.00376	0.035891	7	0.012293	yes	ARTAORT
chr1_1279441_C_T_b38	RP4-758J18.2	-2.777	0.00581	-0.04443	3	0.015998	yes	ARTAORT
chr1_1308552_GGA_G_b38	RP4-758J18.2	-2.728	0.00672	-0.040427	10	0.014817	yes	ARTAORT
chr1_1293731_A_ACGCCCCTGCCCTGGAGGCCCCGCCCCTGCCCTGGAGGCCC_b38	RP4-758J18.2	2.72	0.00688	0.056852	4	0.020898	yes	ARTAORT
chr1_2051703_C_T_b38	RP4-758J18.2	2.682	0.0077	0.024572	40	0.009162	yes	ARTAORT
chr1_1768171_CA_C_b38	RP4-758J18.2	2.65	0.00847	0.029009	12	0.010949	yes	ARTAORT
chr1_1398056_C_A_b38	RP4-758J18.2	3.569	0.000414	0.034015	45	0.009531	no	ARTAORT
chr1_1308551_GGGA_G_b38	RP4-758J18.2	-3.101	0.0021	-0.059196	6	0.019091	no	ARTAORT
chr1_1750589_G_A_b38	RP4-758J18.2	-3.015	0.00278	-0.044352	13	0.014709	no	ARTAORT
chr1_1948919_T_TCCTTCCCTCCTCTTTCCCTCCCTTCTTTCCTTCCCTTTCCCTCCCTC_b38	RP4-758J18.2	-2.861	0.00451	-0.024178	80	0.008452	no	ARTAORT
chr1_1085543_A_AG_b38	RP4-758J18.2	2.842	0.00477	0.026268	42	0.009242	no	ARTAORT
chr1_1086315_A_G_b38	RP4-758J18.2	2.839	0.00482	0.026421	37	0.009308	no	ARTAORT
chr1_1481071_T_C_b38	RP4-758J18.2	-2.749	0.00632	-0.053832	6	0.019582	no	ARTAORT
chr1_1086035_A_G_b38	RP4-758J18.2	2.736	0.00656	0.02638	33	0.00964	no	ARTAORT
chr1_1432355_G_A_b38	RP4-758J18.2	2.692	0.00748	0.033461	16	0.01243	no	ARTAORT
chr1_1085026_T_C_b38	RP4-758J18.2	2.677	0.00783	0.025122	40	0.009386	no	ARTAORT
chr1_1081817_C_T_b38	RP4-758J18.2	2.62	0.00921	0.023497	96	0.008968	no	ARTAORT
chr1_601515_T_C_b38	RP4-758J18.2	-2.6	0.00977	-0.031237	10	0.012016	no	ARTAORT
chr1_1053552_G_C_b38	RP4-758J18.2	-3.294	0.0012	-0.065657	12	0.019935	yes	ARTCRN
chr1_1163334_C_G_b38	RP4-758J18.2	-3.213	0.00157	-0.051095	45	0.015902	yes	ARTCRN
chr1_1163041_C_T_b38	RP4-758J18.2	-3.185	0.00172	-0.051986	51	0.016321	yes	ARTCRN
chr1_851639_C_T_b38	RP4-758J18.2	-2.945	0.00367	-0.063545	7	0.021575	yes	ARTCRN
chr1_826893_G_A_b38	RP4-758J18.2	-2.944	0.00368	-0.069817	6	0.023711	yes	ARTCRN
chr1_850867_G_A_b38	RP4-758J18.2	-2.9	0.00421	-0.063498	8	0.021893	yes	ARTCRN
chr1_832736_AGTTTT_A_b38	RP4-758J18.2	2.799	0.00572	0.063754	4	0.02278	yes	ARTCRN
chr1_1223061_GCA_G_b38	RP4-758J18.2	-2.789	0.00588	-0.076806	3	0.027538	yes	ARTCRN
chr1_1055137_C_T_b38	RP4-758J18.2	-2.724	0.00712	-0.058999	3	0.021661	yes	ARTCRN
chr1_818464_CCT_C_b38	RP4-758J18.2	-2.722	0.00716	-0.048756	16	0.017911	yes	ARTCRN
chr1_818469_G_T_b38	RP4-758J18.2	-2.722	0.00716	-0.048756	16	0.017911	yes	ARTCRN
chr1_826372_C_T_b38	RP4-758J18.2	-2.686	0.00794	-0.05405	11	0.020124	yes	ARTCRN
chr1_845405_T_A_b38	RP4-758J18.2	-2.672	0.00827	-0.060795	10	0.022754	yes	ARTCRN
chr1_1057472_AAG_A_b38	RP4-758J18.2	-2.671	0.0083	-0.050446	12	0.018889	yes	ARTCRN
chr1_1055393_C_T_b38	RP4-758J18.2	-2.67	0.00831	-0.053088	5	0.019883	yes	ARTCRN
chr1_1055426_G_A_b38	RP4-758J18.2	-2.67	0.00831	-0.053088	5	0.019883	yes	ARTCRN
chr1_818025_C_A_b38	RP4-758J18.2	-3.406	0.00082	-0.079298	5	0.02328	no	ARTCRN
chr1_827252_T_A_b38	RP4-758J18.2	-3.394	0.000856	-0.077835	5	0.022936	no	ARTCRN
chr1_877363_C_T_b38	RP4-758J18.2	3.361	0.000957	0.071643	8	0.021317	no	ARTCRN
chr1_1235602_C_A_b38	RP4-758J18.2	-3.252	0.00138	-0.074791	3	0.023001	no	ARTCRN
chr1_818045_T_C_b38	RP4-758J18.2	-3.228	0.00149	-0.075755	5	0.023465	no	ARTCRN
chr1_824457_T_A_b38	RP4-758J18.2	-3.228	0.00149	-0.075755	5	0.023465	no	ARTCRN
chr1_1904424_A_AAAATAAATAAAT_b38	RP4-758J18.2	-3.214	0.00156	-0.047477	28	0.014771	no	ARTCRN
chr1_836587_G_A_b38	RP4-758J18.2	3.166	0.00183	0.072147	4	0.022789	no	ARTCRN
chr1_981210_G_A_b38	RP4-758J18.2	3.155	0.00189	0.061641	6	0.019538	no	ARTCRN
chr1_827209_G_C_b38	RP4-758J18.2	-3.11	0.00219	-0.071232	5	0.022904	no	ARTCRN
chr1_814758_G_A_b38	RP4-758J18.2	3.108	0.0022	0.072644	4	0.023371	no	ARTCRN
chr1_821224_A_G_b38	RP4-758J18.2	-3.091	0.00233	-0.069485	7	0.022479	no	ARTCRN
chr1_822354_C_T_b38	RP4-758J18.2	-3.091	0.00233	-0.069485	7	0.022479	no	ARTCRN
chr1_837375_A_C_b38	RP4-758J18.2	-3.091	0.00233	-0.069485	7	0.022479	no	ARTCRN
chr1_840279_A_G_b38	RP4-758J18.2	-3.091	0.00233	-0.069485	7	0.022479	no	ARTCRN
chr1_833843_C_G_b38	RP4-758J18.2	3.044	0.0027	0.06925	3	0.022751	no	ARTCRN
chr1_836443_T_C_b38	RP4-758J18.2	-3.027	0.00285	-0.068788	6	0.022726	no	ARTCRN
chr1_822556_C_A_b38	RP4-758J18.2	-3.02	0.00291	-0.066118	7	0.021894	no	ARTCRN
chr1_822260_G_A_b38	RP4-758J18.2	-3.011	0.003	-0.065717	14	0.021829	no	ARTCRN
chr1_851882_C_G_b38	RP4-758J18.2	-3.001	0.00309	-0.066561	8	0.022182	no	ARTCRN
chr1_1226486_C_T_b38	RP4-758J18.2	-2.935	0.00379	-0.061046	6	0.020796	no	ARTCRN
chr1_869379_C_T_b38	RP4-758J18.2	2.934	0.00381	0.067855	3	0.023129	no	ARTCRN
chr1_843365_A_G_b38	RP4-758J18.2	2.923	0.00394	0.066745	4	0.022838	no	ARTCRN
chr1_855811_G_A_b38	RP4-758J18.2	2.921	0.00395	0.06739	5	0.023069	no	ARTCRN
chr1_822764_A_G_b38	RP4-758J18.2	-2.912	0.00407	-0.06463	7	0.022195	no	ARTCRN
chr1_839801_A_G_b38	RP4-758J18.2	2.902	0.00419	0.06623	5	0.022821	no	ARTCRN
chr1_874906_G_A_b38	RP4-758J18.2	2.893	0.00432	0.061945	10	0.021416	no	ARTCRN
chr1_1133503_G_A_b38	RP4-758J18.2	2.883	0.00444	0.058586	6	0.02032	no	ARTCRN
chr1_841742_A_T_b38	RP4-758J18.2	-2.816	0.00544	-0.063866	7	0.022683	no	ARTCRN
chr1_1228424_C_T_b38	RP4-758J18.2	-2.809	0.00555	-0.056825	5	0.020231	no	ARTCRN
chr1_2065678_C_CA_b38	RP4-758J18.2	-2.805	0.00561	-0.065851	6	0.023478	no	ARTCRN
chr1_1585973_T_A_b38	RP4-758J18.2	-2.801	0.00569	-0.054533	14	0.019472	no	ARTCRN
chr1_816376_T_C_b38	RP4-758J18.2	2.78	0.00604	0.067351	4	0.024229	no	ARTCRN
chr1_1133966_C_T_b38	RP4-758J18.2	2.744	0.00671	0.055603	6	0.020264	no	ARTCRN
chr1_852305_G_T_b38	RP4-758J18.2	-2.741	0.00678	-0.060354	15	0.022022	no	ARTCRN
chr1_815963_T_A_b38	RP4-758J18.2	2.733	0.00693	0.063615	4	0.023275	no	ARTCRN
chr1_833758_CAT_C_b38	RP4-758J18.2	2.729	0.00701	0.062693	5	0.022971	no	ARTCRN
chr1_1216593_G_C_b38	RP4-758J18.2	-2.718	0.00723	-0.053772	7	0.019781	no	ARTCRN
chr1_862060_T_C_b38	RP4-758J18.2	2.705	0.00751	0.06167	3	0.022796	no	ARTCRN
chr1_866087_G_C_b38	RP4-758J18.2	2.705	0.00751	0.06167	3	0.022796	no	ARTCRN
chr1_827212_C_G_b38	RP4-758J18.2	-2.704	0.00755	-0.062736	5	0.023205	no	ARTCRN
chr1_827221_T_C_b38	RP4-758J18.2	-2.704	0.00755	-0.062736	5	0.023205	no	ARTCRN
chr1_878260_A_G_b38	RP4-758J18.2	-2.688	0.00789	-0.060731	14	0.022592	no	ARTCRN
chr1_828811_T_G_b38	RP4-758J18.2	2.67	0.0083	0.060764	5	0.022755	no	ARTCRN
chr1_843942_A_G_b38	RP4-758J18.2	2.666	0.00842	0.060996	5	0.022883	no	ARTCRN
chr1_852226_G_T_b38	RP4-758J18.2	2.666	0.00842	0.060996	5	0.022883	no	ARTCRN
chr1_854133_GA_G_b38	RP4-758J18.2	2.666	0.00842	0.060996	5	0.022883	no	ARTCRN
chr1_823246_C_T_b38	RP4-758J18.2	-2.663	0.00848	-0.056282	7	0.021136	no	ARTCRN
chr1_818802_A_G_b38	RP4-758J18.2	-2.656	0.00866	-0.061545	8	0.023176	no	ARTCRN
chr1_818812_A_G_b38	RP4-758J18.2	-2.656	0.00866	-0.061545	8	0.023176	no	ARTCRN
chr1_818954_T_C_b38	RP4-758J18.2	-2.656	0.00866	-0.061545	8	0.023176	no	ARTCRN
chr1_851771_G_A_b38	RP4-758J18.2	2.608	0.00992	0.060876	6	0.023345	no	ARTCRN
chr1_1400626_C_T_b38	RP4-758J18.2	-9.875	3.6e-21	-0.131412	3	0.013308	yes	ARTTBL
chr1_1389777_G_A_b38	RP4-758J18.2	-9.713	1.38e-20	-0.12856	3	0.013235	yes	ARTTBL
chr1_1366183_TGA_T_b38	RP4-758J18.2	-9.001	4.36e-18	-0.122548	3	0.013615	yes	ARTTBL
chr1_1356751_A_G_b38	RP4-758J18.2	-8.914	8.65e-18	-0.122049	3	0.013692	yes	ARTTBL
chr1_1319648_G_A_b38	RP4-758J18.2	-8.888	1.06e-17	-0.120793	3	0.013591	yes	ARTTBL
chr1_1296207_G_A_b38	RP4-758J18.2	-8.477	2.47e-16	-0.112165	3	0.013232	yes	ARTTBL
chr1_1398056_C_A_b38	RP4-758J18.2	4.187	3.32e-05	0.030921	74	0.007385	yes	ARTTBL
chr1_1279441_C_T_b38	RP4-758J18.2	-3.923	9.93e-05	-0.047403	5	0.012083	yes	ARTTBL
chr1_1515828_G_A_b38	RP4-758J18.2	-3.552	0.000418	-0.044379	5	0.012495	yes	ARTTBL
chr1_1479704_G_A_b38	RP4-758J18.2	-3.522	0.000467	-0.041739	9	0.011852	yes	ARTTBL
chr1_1485324_C_T_b38	RP4-758J18.2	-3.507	0.000492	-0.043843	5	0.0125	yes	ARTTBL
chr1_1495136_G_A_b38	RP4-758J18.2	-3.478	0.000548	-0.042839	6	0.012317	yes	ARTTBL
chr1_1073854_T_C_b38	RP4-758J18.2	3.263	0.00117	0.020977	135	0.006428	yes	ARTTBL
chr1_1083324_A_G_b38	RP4-758J18.2	3.205	0.00144	0.020867	124	0.006511	yes	ARTTBL
chr1_1082764_T_C_b38	RP4-758J18.2	3.165	0.00164	0.020885	147	0.006599	yes	ARTTBL
chr1_1096804_A_G_b38	RP4-758J18.2	3.129	0.00186	0.023742	46	0.007589	yes	ARTTBL
chr1_1079877_A_G_b38	RP4-758J18.2	3.114	0.00195	0.020598	119	0.006615	yes	ARTTBL
chr1_1079746_A_G_b38	RP4-758J18.2	3.03	0.00257	0.019987	122	0.006598	yes	ARTTBL
chr1_1223061_GCA_G_b38	RP4-758J18.2	-3.015	0.00269	-0.038845	4	0.012882	yes	ARTTBL
chr1_1075337_C_T_b38	RP4-758J18.2	2.998	0.00285	0.019504	124	0.006505	yes	ARTTBL
chr1_1726126_G_A_b38	RP4-758J18.2	-2.998	0.00285	-0.019816	139	0.006609	yes	ARTTBL
chr1_1079484_T_A_b38	RP4-758J18.2	2.974	0.00308	0.019299	137	0.00649	yes	ARTTBL
chr1_1070843_G_A_b38	RP4-758J18.2	2.965	0.00317	0.019539	148	0.00659	yes	ARTTBL
chr1_632928_G_A_b38	RP4-758J18.2	2.891	0.004	0.033805	12	0.011691	yes	ARTTBL
chr1_1063015_A_G_b38	RP4-758J18.2	2.888	0.00405	0.022248	42	0.007705	yes	ARTTBL
chr1_1069047_G_A_b38	RP4-758J18.2	2.88	0.00415	0.020583	62	0.007148	yes	ARTTBL
chr1_1096160_A_G_b38	RP4-758J18.2	2.874	0.00422	0.022419	43	0.0078	yes	ARTTBL
chr1_1069577_G_A_b38	RP4-758J18.2	2.859	0.00443	0.018852	146	0.006595	yes	ARTTBL
chr1_1052290_T_G_b38	RP4-758J18.2	2.83	0.00483	0.032237	7	0.01139	yes	ARTTBL
chr1_506937_T_G_b38	RP4-758J18.2	-2.819	0.005	-0.030456	9	0.010803	yes	ARTTBL
chr1_1101667_C_T_b38	RP4-758J18.2	-2.686	0.00746	-0.021029	43	0.007828	yes	ARTTBL
chr1_1112601_G_A_b38	RP4-758J18.2	-2.666	0.00792	-0.020928	42	0.007851	yes	ARTTBL
chr1_769257_G_A_b38	RP4-758J18.2	-2.625	0.00892	-0.039822	3	0.015168	yes	ARTTBL
chr1_1234105_G_A_b38	RP4-758J18.2	-2.622	0.009	-0.042458	4	0.016194	yes	ARTTBL
chr1_1315752_GAGCGAGGGAGGTGGGGGCGGGGAGGGAGGGAGGGAGGCGGGC_G_b38	RP4-758J18.2	2.61	0.00931	0.022141	26	0.008482	yes	ARTTBL
chr1_1101437_T_C_b38	RP4-758J18.2	-2.604	0.00949	-0.020423	43	0.007844	yes	ARTTBL
chr1_1071823_A_G_b38	RP4-758J18.2	3.877	0.00012	0.031197	31	0.008047	no	ARTTBL
chr1_1081790_C_G_b38	RP4-758J18.2	3.413	0.000692	0.022204	138	0.006505	no	ARTTBL
chr1_1081817_C_T_b38	RP4-758J18.2	3.401	0.000723	0.022289	159	0.006553	no	ARTTBL
chr1_1481071_T_C_b38	RP4-758J18.2	-3.382	0.000775	-0.041195	15	0.012181	no	ARTTBL
chr1_1081961_G_T_b38	RP4-758J18.2	3.335	0.000914	0.025071	47	0.007517	no	ARTTBL
chr1_1065530_C_T_b38	RP4-758J18.2	3.308	0.00101	0.035249	9	0.010657	no	ARTTBL
chr1_1083182_C_T_b38	RP4-758J18.2	3.228	0.00133	0.021292	152	0.006596	no	ARTTBL
chr1_632287_C_T_b38	RP4-758J18.2	-3.158	0.00168	-0.066486	3	0.021051	no	ARTTBL
chr1_1877312_A_T_b38	RP4-758J18.2	-3.045	0.00244	-0.032698	12	0.010737	no	ARTTBL
chr1_1071610_G_A_b38	RP4-758J18.2	3.038	0.0025	0.023157	45	0.007623	no	ARTTBL
chr1_1074098_G_C_b38	RP4-758J18.2	3.023	0.00263	0.022825	45	0.00755	no	ARTTBL
chr1_1308552_GGA_G_b38	RP4-758J18.2	-3.018	0.00267	-0.036002	12	0.011929	no	ARTTBL
chr1_1075707_CG_C_b38	RP4-758J18.2	3.014	0.0027	0.019749	150	0.006551	no	ARTTBL
chr1_908799_AATGAGGGGCAGGGGGGAAGGGAGGG_A_b38	RP4-758J18.2	3.007	0.00277	0.046459	10	0.015452	no	ARTTBL
chr1_1043223_CCT_C_b38	RP4-758J18.2	2.976	0.00306	0.020674	152	0.006948	no	ARTTBL
chr1_1091421_T_A_b38	RP4-758J18.2	2.947	0.00336	0.019839	103	0.006733	no	ARTTBL
chr1_1075715_A_G_b38	RP4-758J18.2	2.93	0.00354	0.033846	7	0.011551	no	ARTTBL
chr1_1067552_C_G_b38	RP4-758J18.2	2.925	0.00359	0.022072	46	0.007545	no	ARTTBL
chr1_1048922_T_C_b38	RP4-758J18.2	2.912	0.00375	0.019424	145	0.006671	no	ARTTBL
chr1_1124795_T_C_b38	RP4-758J18.2	-2.882	0.00412	-0.020505	142	0.007115	no	ARTTBL
chr1_1028565_T_C_b38	RP4-758J18.2	-2.837	0.00474	-0.064063	3	0.022583	no	ARTTBL
chr1_632316_C_T_b38	RP4-758J18.2	-2.832	0.00481	-0.059502	3	0.021011	no	ARTTBL
chr1_1080171_C_T_b38	RP4-758J18.2	2.831	0.00483	0.018754	149	0.006625	no	ARTTBL
chr1_1083795_C_G_b38	RP4-758J18.2	2.828	0.00486	0.020443	65	0.007228	no	ARTTBL
chr1_1069600_G_A_b38	RP4-758J18.2	2.82	0.005	0.01862	145	0.006604	no	ARTTBL
chr1_1085543_A_AG_b38	RP4-758J18.2	2.8	0.0053	0.020511	61	0.007325	no	ARTTBL
chr1_1721552_G_A_b38	RP4-758J18.2	2.798	0.00533	0.066913	3	0.023911	no	ARTTBL
chr1_1080437_G_A_b38	RP4-758J18.2	2.796	0.00537	0.020542	54	0.007347	no	ARTTBL
chr1_1086315_A_G_b38	RP4-758J18.2	2.734	0.00647	0.020323	54	0.007433	no	ARTTBL
chr1_1072052_G_A_b38	RP4-758J18.2	2.723	0.00669	0.017954	151	0.006593	no	ARTTBL
chr1_2342840_A_ATATTTTATTT_b38	RP4-758J18.2	2.719	0.00676	0.033208	17	0.012212	no	ARTTBL
chr1_1057980_C_A_b38	RP4-758J18.2	2.679	0.00763	0.018331	166	0.006843	no	ARTTBL
chr1_1056597_G_A_b38	RP4-758J18.2	2.65	0.0083	0.0172	164	0.006491	no	ARTTBL
chr1_1126414_A_G_b38	RP4-758J18.2	-2.642	0.0085	-0.018603	68	0.007042	no	ARTTBL
chr1_1126468_A_G_b38	RP4-758J18.2	-2.642	0.0085	-0.018603	68	0.007042	no	ARTTBL
chr1_1085026_T_C_b38	RP4-758J18.2	2.614	0.00922	0.019012	63	0.007274	no	ARTTBL
chr1_1063202_G_C_b38	RP4-758J18.2	2.606	0.00943	0.017683	159	0.006786	no	ARTTBL
chr1_1057439_G_A_b38	RP4-758J18.2	2.593	0.0098	0.017333	148	0.006686	no	ARTTBL
chr1_1079456_A_G_b38	RP4-758J18.2	2.593	0.0098	0.016883	151	0.006512	no	ARTTBL
chr1_962358_C_T_b38	RP4-758J18.2	2.593	0.0098	0.032862	7	0.012676	no	ARTTBL
chr1_1315752_GAGCGAGGGAGGTGGGGGCGGGGAGGGAGGGAGGGAGGCGGGC_G_b38	RP4-758J18.2	3.842	0.000211	0.111999	3	0.029153	yes	BRNAMY
chr1_505074_C_T_b38	RP4-758J18.2	-3.347	0.00114	-0.105098	5	0.031401	yes	BRNAMY
chr1_931131_C_CCCCT_b38	RP4-758J18.2	-3.182	0.00193	-0.127018	8	0.039912	yes	BRNAMY
chr1_2044256_TAC_T_b38	RP4-758J18.2	-2.876	0.0049	-0.088925	3	0.03092	yes	BRNAMY
chr1_832736_A_AGTTTT_b38	RP4-758J18.2	2.849	0.0053	0.068146	26	0.023919	yes	BRNAMY
chr1_925036_G_A_b38	RP4-758J18.2	-2.827	0.00564	-0.083599	7	0.029568	yes	BRNAMY
chr1_926250_G_A_b38	RP4-758J18.2	-2.827	0.00564	-0.083599	7	0.029568	yes	BRNAMY
chr1_927486_C_T_b38	RP4-758J18.2	-2.827	0.00564	-0.083599	7	0.029568	yes	BRNAMY
chr1_925308_G_A_b38	RP4-758J18.2	-2.772	0.00662	-0.079707	8	0.028758	yes	BRNAMY
chr1_1308516_C_T_b38	RP4-758J18.2	2.768	0.00668	0.074365	15	0.026862	yes	BRNAMY
chr1_1312114_T_C_b38	RP4-758J18.2	2.768	0.00668	0.074365	15	0.026862	yes	BRNAMY
chr1_1330125_G_A_b38	RP4-758J18.2	2.768	0.00668	0.074365	15	0.026862	yes	BRNAMY
chr1_531693_C_T_b38	RP4-758J18.2	-2.703	0.00804	-0.062358	24	0.023069	yes	BRNAMY
chr1_1358384_G_C_b38	RP4-758J18.2	2.64	0.00958	0.070103	14	0.026555	yes	BRNAMY
chr1_1489916_C_T_b38	RP4-758J18.2	3.231	0.00166	0.131462	6	0.04069	no	BRNAMY
chr1_1512376_G_C_b38	RP4-758J18.2	3.177	0.00196	0.124435	10	0.039165	no	BRNAMY
chr1_1501260_A_AT_b38	RP4-758J18.2	3.163	0.00205	0.117544	3	0.037162	no	BRNAMY
chr1_1518285_T_C_b38	RP4-758J18.2	3.158	0.00208	0.109688	12	0.034732	no	BRNAMY
chr1_1473089_T_C_b38	RP4-758J18.2	3.103	0.00247	0.114631	8	0.036942	no	BRNAMY
chr1_1495204_T_C_b38	RP4-758J18.2	3.101	0.00249	0.125	7	0.040312	no	BRNAMY
chr1_1486611_G_A_b38	RP4-758J18.2	3.006	0.00332	0.115846	7	0.038536	no	BRNAMY
chr1_814583_T_TAA_b38	RP4-758J18.2	2.989	0.0035	0.089711	5	0.030011	no	BRNAMY
chr1_1490027_A_G_b38	RP4-758J18.2	2.973	0.00368	0.121382	6	0.040834	no	BRNAMY
chr1_1490032_A_G_b38	RP4-758J18.2	2.973	0.00368	0.121382	6	0.040834	no	BRNAMY
chr1_1488652_A_G_b38	RP4-758J18.2	2.951	0.00393	0.121627	9	0.04122	no	BRNAMY
chr1_1490320_T_C_b38	RP4-758J18.2	2.951	0.00393	0.121627	9	0.04122	no	BRNAMY
chr1_1492292_C_G_b38	RP4-758J18.2	2.951	0.00393	0.121627	9	0.04122	no	BRNAMY
chr1_1492850_G_A_b38	RP4-758J18.2	2.951	0.00393	0.121627	9	0.04122	no	BRNAMY
chr1_1324173_G_GGGCTCGGGGGCTGGGGGGCTGCTGGGCTGAGA_b38	RP4-758J18.2	2.947	0.00397	0.059568	15	0.020215	no	BRNAMY
chr1_1363601_A_AT_b38	RP4-758J18.2	2.934	0.00413	0.066924	32	0.022812	no	BRNAMY
chr1_1496953_T_C_b38	RP4-758J18.2	2.892	0.00467	0.10747	10	0.037157	no	BRNAMY
chr1_531472_G_C_b38	RP4-758J18.2	-2.89	0.0047	-0.069054	21	0.023894	no	BRNAMY
chr1_929558_G_A_b38	RP4-758J18.2	-2.813	0.00588	-0.07862	9	0.027951	no	BRNAMY
chr1_2120839_CT_C_b38	RP4-758J18.2	2.799	0.00613	0.079058	10	0.028249	no	BRNAMY
chr1_1518541_T_C_b38	RP4-758J18.2	2.798	0.00613	0.104861	7	0.037474	no	BRNAMY
chr1_1481959_C_T_b38	RP4-758J18.2	2.796	0.00617	0.108008	8	0.038629	no	BRNAMY
chr1_1513923_G_C_b38	RP4-758J18.2	2.793	0.00624	0.105548	10	0.037797	no	BRNAMY
chr1_1516000_T_C_b38	RP4-758J18.2	2.793	0.00624	0.105548	10	0.037797	no	BRNAMY
chr1_1530331_T_C_b38	RP4-758J18.2	2.793	0.00624	0.105548	10	0.037797	no	BRNAMY
chr1_727477_G_A_b38	RP4-758J18.2	2.791	0.00626	0.091888	6	0.032921	no	BRNAMY
chr1_1482402_A_G_b38	RP4-758J18.2	2.768	0.0067	0.10903	11	0.039395	no	BRNAMY
chr1_1533909_G_C_b38	RP4-758J18.2	2.74	0.00725	0.081312	15	0.02968	no	BRNAMY
chr1_1511945_G_A_b38	RP4-758J18.2	2.716	0.00775	0.107878	10	0.039716	no	BRNAMY
chr1_1482624_T_C_b38	RP4-758J18.2	2.7	0.0081	0.103903	9	0.03848	no	BRNAMY
chr1_814962_C_T_b38	RP4-758J18.2	2.659	0.00909	0.067466	18	0.025374	no	BRNAMY
chr1_726821_G_A_b38	RP4-758J18.2	2.642	0.00952	0.077598	9	0.029369	no	BRNAMY
chr1_839480_CACACACCTGGACAA_C_b38	RP4-758J18.2	2.642	0.00953	0.081079	6	0.030688	no	BRNAMY
chr1_1971183_G_A_b38	RP4-758J18.2	-3.389	0.000947	-0.079842	5	0.023558	yes	BRNACC
chr1_1971918_G_C_b38	RP4-758J18.2	-3.389	0.000947	-0.079842	5	0.023558	yes	BRNACC
chr1_1976644_G_A_b38	RP4-758J18.2	-3.389	0.000947	-0.079842	5	0.023558	yes	BRNACC
chr1_1971220_C_T_b38	RP4-758J18.2	-3.346	0.00109	-0.078527	5	0.023466	yes	BRNACC
chr1_1974351_A_G_b38	RP4-758J18.2	-3.31	0.00123	-0.07908	5	0.023894	yes	BRNACC
chr1_1989803_A_G_b38	RP4-758J18.2	-3.255	0.00147	-0.071093	15	0.021844	yes	BRNACC
chr1_1975657_A_G_b38	RP4-758J18.2	-3.219	0.00165	-0.076842	5	0.023871	yes	BRNACC
chr1_1987702_C_T_b38	RP4-758J18.2	-3.188	0.00182	-0.08085	3	0.025358	yes	BRNACC
chr1_715769_C_T_b38	RP4-758J18.2	3.149	0.00207	0.1326	5	0.042112	yes	BRNACC
chr1_1960886_T_C_b38	RP4-758J18.2	3.132	0.00218	0.077047	5	0.024604	yes	BRNACC
chr1_1704310_C_A_b38	RP4-758J18.2	-2.996	0.00332	-0.055348	33	0.018472	yes	BRNACC
chr1_1714932_G_T_b38	RP4-758J18.2	-2.985	0.00343	-0.055247	31	0.018507	yes	BRNACC
chr1_1002415_CT_C_b38	RP4-758J18.2	2.891	0.00455	0.064432	13	0.022285	yes	BRNACC
chr1_1680672_C_T_b38	RP4-758J18.2	2.881	0.00469	0.056199	39	0.019505	yes	BRNACC
chr1_1606559_C_CGGCTGGTCAGGCGTGGGGCGGGCTGGTCAGGCGTGGGGCG_b38	RP4-758J18.2	2.864	0.00494	0.158141	3	0.055223	yes	BRNACC
chr1_1704835_C_T_b38	RP4-758J18.2	-2.849	0.00515	-0.052084	38	0.018278	yes	BRNACC
chr1_1679993_A_G_b38	RP4-758J18.2	2.812	0.00574	0.051195	34	0.018204	yes	BRNACC
chr1_1706067_ACT_A_b38	RP4-758J18.2	-2.786	0.00619	-0.051668	37	0.018543	yes	BRNACC
chr1_1708855_TTCCTCCTCC_T_b38	RP4-758J18.2	-2.786	0.00619	-0.056859	29	0.020406	yes	BRNACC
chr1_790733_C_CAATGG_b38	RP4-758J18.2	-2.779	0.00632	-0.073466	3	0.026436	yes	BRNACC
chr1_1835922_G_GA_b38	RP4-758J18.2	2.727	0.00734	0.094336	4	0.034593	yes	BRNACC
chr1_1479704_G_A_b38	RP4-758J18.2	-2.68	0.00839	-0.082316	4	0.030718	yes	BRNACC
chr1_1809189_AT_A_b38	RP4-758J18.2	2.675	0.0085	0.075243	18	0.028127	yes	BRNACC
chr1_1002417_T_A_b38	RP4-758J18.2	2.654	0.00902	0.060774	12	0.022899	yes	BRNACC
chr1_1708951_C_T_b38	RP4-758J18.2	-2.63	0.00965	-0.050514	30	0.019208	yes	BRNACC
chr1_1607931_G_A_b38	RP4-758J18.2	-2.627	0.00974	-0.057646	12	0.021948	yes	BRNACC
chr1_1609058_G_A_b38	RP4-758J18.2	-2.627	0.00974	-0.057646	12	0.021948	yes	BRNACC
chr1_1705799_A_G_b38	RP4-758J18.2	-2.986	0.00342	-0.054095	40	0.018114	no	BRNACC
chr1_2371032_C_T_b38	RP4-758J18.2	2.904	0.00439	0.052176	41	0.01797	no	BRNACC
chr1_1715838_C_T_b38	RP4-758J18.2	-2.805	0.00586	-0.052152	38	0.018593	no	BRNACC
chr1_2384278_A_G_b38	RP4-758J18.2	2.67	0.00863	0.047155	40	0.017661	no	BRNACC
chr1_2376477_A_C_b38	RP4-758J18.2	2.656	0.00896	0.050109	37	0.018863	no	BRNACC
chr1_1705856_G_A_b38	RP4-758J18.2	-2.632	0.0096	-0.044718	46	0.016992	no	BRNACC
chr1_1419135_C_G_b38	RP4-758J18.2	-3.447	0.000731	-0.086669	13	0.025141	yes	BRNCDT
chr1_1421170_A_G_b38	RP4-758J18.2	-3.267	0.00134	-0.082593	10	0.025284	yes	BRNCDT
chr1_1410877_A_G_b38	RP4-758J18.2	-3.221	0.00156	-0.081283	12	0.025237	yes	BRNCDT
chr1_1479683_T_G_b38	RP4-758J18.2	-2.888	0.00444	-0.092898	11	0.03217	yes	BRNCDT
chr1_1480096_G_C_b38	RP4-758J18.2	-2.888	0.00444	-0.092898	11	0.03217	yes	BRNCDT
chr1_1461719_G_A_b38	RP4-758J18.2	-2.86	0.00483	-0.099793	3	0.034891	yes	BRNCDT
chr1_1380790_G_A_b38	RP4-758J18.2	2.83	0.00527	0.068144	7	0.024076	yes	BRNCDT
chr1_1936906_C_CA_b38	RP4-758J18.2	2.824	0.00538	0.048345	17	0.017121	yes	BRNCDT
chr1_1318756_G_A_b38	RP4-758J18.2	2.81	0.00561	0.068246	10	0.024289	yes	BRNCDT
chr1_1319063_G_A_b38	RP4-758J18.2	2.81	0.00561	0.068246	10	0.024289	yes	BRNCDT
chr1_1319461_C_G_b38	RP4-758J18.2	2.81	0.00561	0.068246	10	0.024289	yes	BRNCDT
chr1_1320023_TG_T_b38	RP4-758J18.2	2.81	0.00561	0.068246	10	0.024289	yes	BRNCDT
chr1_1322866_A_C_b38	RP4-758J18.2	2.81	0.00561	0.068246	10	0.024289	yes	BRNCDT
chr1_1327211_C_T_b38	RP4-758J18.2	2.81	0.00561	0.068246	10	0.024289	yes	BRNCDT
chr1_1327982_G_A_b38	RP4-758J18.2	2.81	0.00561	0.068246	10	0.024289	yes	BRNCDT
chr1_1330080_T_C_b38	RP4-758J18.2	2.81	0.00561	0.068246	10	0.024289	yes	BRNCDT
chr1_1324149_G_A_b38	RP4-758J18.2	2.808	0.00563	0.033462	30	0.011916	yes	BRNCDT
chr1_1337736_A_G_b38	RP4-758J18.2	2.782	0.00608	0.062865	7	0.022594	yes	BRNCDT
chr1_1375998_T_A_b38	RP4-758J18.2	2.765	0.00639	0.063852	7	0.023091	yes	BRNCDT
chr1_1279441_C_T_b38	RP4-758J18.2	-2.754	0.0066	-0.069182	3	0.025119	yes	BRNCDT
chr1_2108280_G_A_b38	RP4-758J18.2	2.715	0.0074	0.059336	4	0.021858	yes	BRNCDT
chr1_1375288_A_C_b38	RP4-758J18.2	2.699	0.00774	0.063805	7	0.023639	yes	BRNCDT
chr1_1375595_C_T_b38	RP4-758J18.2	2.699	0.00774	0.063805	7	0.023639	yes	BRNCDT
chr1_1376092_G_A_b38	RP4-758J18.2	2.699	0.00774	0.063805	7	0.023639	yes	BRNCDT
chr1_1376336_G_A_b38	RP4-758J18.2	2.699	0.00774	0.063805	7	0.023639	yes	BRNCDT
chr1_1379664_G_A_b38	RP4-758J18.2	2.699	0.00774	0.063805	7	0.023639	yes	BRNCDT
chr1_1206343_A_G_b38	RP4-758J18.2	-2.639	0.00917	-0.071885	3	0.027237	yes	BRNCDT
chr1_1206770_G_A_b38	RP4-758J18.2	-2.639	0.00917	-0.071885	3	0.027237	yes	BRNCDT
chr1_1477677_TTTTTA_T_b38	RP4-758J18.2	-4.428	1.8e-05	-0.144634	4	0.032667	no	BRNCDT
chr1_1486354_G_C_b38	RP4-758J18.2	-4.258	3.59e-05	-0.13302	4	0.031243	no	BRNCDT
chr1_1477850_C_G_b38	RP4-758J18.2	-4.244	3.79e-05	-0.130297	4	0.0307	no	BRNCDT
chr1_1477855_G_C_b38	RP4-758J18.2	-4.244	3.79e-05	-0.130297	4	0.0307	no	BRNCDT
chr1_1494105_G_A_b38	RP4-758J18.2	-4.184	4.81e-05	-0.129543	4	0.030961	no	BRNCDT
chr1_1495205_G_A_b38	RP4-758J18.2	-4.184	4.81e-05	-0.129543	4	0.030961	no	BRNCDT
chr1_1495221_G_A_b38	RP4-758J18.2	-4.184	4.81e-05	-0.129543	4	0.030961	no	BRNCDT
chr1_1495222_T_G_b38	RP4-758J18.2	-4.184	4.81e-05	-0.129543	4	0.030961	no	BRNCDT
chr1_1495236_T_C_b38	RP4-758J18.2	-4.184	4.81e-05	-0.129543	4	0.030961	no	BRNCDT
chr1_1495327_C_T_b38	RP4-758J18.2	-4.184	4.81e-05	-0.129543	4	0.030961	no	BRNCDT
chr1_1422081_C_T_b38	RP4-758J18.2	-3.672	0.000333	-0.093336	14	0.025421	no	BRNCDT
chr1_1468254_T_A_b38	RP4-758J18.2	-3.603	0.000425	-0.119612	3	0.033197	no	BRNCDT
chr1_1480990_T_C_b38	RP4-758J18.2	-3.598	0.000432	-0.077369	14	0.021502	no	BRNCDT
chr1_1457919_C_A_b38	RP4-758J18.2	-3.344	0.00104	-0.113801	3	0.034029	no	BRNCDT
chr1_1457922_T_C_b38	RP4-758J18.2	-3.344	0.00104	-0.113801	3	0.034029	no	BRNCDT
chr1_1468062_A_T_b38	RP4-758J18.2	-3.32	0.00113	-0.104834	4	0.031576	no	BRNCDT
chr1_1425013_C_T_b38	RP4-758J18.2	-3.147	0.00199	-0.080231	15	0.025498	no	BRNCDT
chr1_1469469_G_C_b38	RP4-758J18.2	-3.105	0.00227	-0.105361	3	0.033931	no	BRNCDT
chr1_1415976_G_A_b38	RP4-758J18.2	-3.037	0.00281	-0.076214	10	0.025095	no	BRNCDT
chr1_1381268_C_T_b38	RP4-758J18.2	3.03	0.00287	0.074221	8	0.024493	no	BRNCDT
chr1_1381294_C_T_b38	RP4-758J18.2	3.03	0.00287	0.074221	8	0.024493	no	BRNCDT
chr1_1485282_A_G_b38	RP4-758J18.2	-3.016	0.003	-0.101252	4	0.03357	no	BRNCDT
chr1_2050574_C_T_b38	RP4-758J18.2	-3.01	0.00305	-0.104365	3	0.034669	no	BRNCDT
chr1_1479324_C_G_b38	RP4-758J18.2	-2.982	0.00333	-0.088154	5	0.029563	no	BRNCDT
chr1_1466535_C_CA_b38	RP4-758J18.2	-2.972	0.00344	-0.057111	8	0.019219	no	BRNCDT
chr1_1410616_G_T_b38	RP4-758J18.2	-2.951	0.00367	-0.07196	11	0.024387	no	BRNCDT
chr1_1412488_C_CAG_b38	RP4-758J18.2	-2.951	0.00367	-0.07196	11	0.024387	no	BRNCDT
chr1_1504291_C_G_b38	RP4-758J18.2	-2.949	0.00369	-0.102911	3	0.034897	no	BRNCDT
chr1_1504666_AAGAG_A_b38	RP4-758J18.2	-2.949	0.00369	-0.102911	3	0.034897	no	BRNCDT
chr1_1461195_T_TC_b38	RP4-758J18.2	-2.936	0.00384	-0.092702	5	0.031571	no	BRNCDT
chr1_1461760_C_A_b38	RP4-758J18.2	-2.923	0.00399	-0.092257	5	0.031561	no	BRNCDT
chr1_1461767_A_G_b38	RP4-758J18.2	-2.923	0.00399	-0.092257	5	0.031561	no	BRNCDT
chr1_1363153_T_G_b38	RP4-758J18.2	2.897	0.00431	0.071177	7	0.024565	no	BRNCDT
chr1_1415754_CCGCT_C_b38	RP4-758J18.2	-2.806	0.00567	-0.065522	5	0.023351	no	BRNCDT
chr1_1415762_ATCCGCT_A_b38	RP4-758J18.2	-2.806	0.00567	-0.065522	5	0.023351	no	BRNCDT
chr1_1523574_C_T_b38	RP4-758J18.2	-2.747	0.00673	-0.097855	3	0.035621	no	BRNCDT
chr1_1368047_ACT_A_b38	RP4-758J18.2	2.747	0.00674	0.068497	6	0.024934	no	BRNCDT
chr1_1359943_G_A_b38	RP4-758J18.2	2.743	0.00681	0.070086	10	0.025547	no	BRNCDT
chr1_1479334_A_G_b38	RP4-758J18.2	-2.733	0.00701	-0.07762	12	0.028397	no	BRNCDT
chr1_1472097_CGGCGG_C_b38	RP4-758J18.2	-2.722	0.00723	-0.09649	3	0.035442	no	BRNCDT
chr1_1357046_C_G_b38	RP4-758J18.2	2.708	0.00754	0.066691	10	0.024628	no	BRNCDT
chr1_1357369_C_T_b38	RP4-758J18.2	2.708	0.00754	0.066691	10	0.024628	no	BRNCDT
chr1_1358907_C_A_b38	RP4-758J18.2	2.708	0.00754	0.066691	10	0.024628	no	BRNCDT
chr1_1359138_C_T_b38	RP4-758J18.2	2.708	0.00754	0.066691	10	0.024628	no	BRNCDT
chr1_1360023_T_C_b38	RP4-758J18.2	2.708	0.00754	0.066691	10	0.024628	no	BRNCDT
chr1_1411929_G_C_b38	RP4-758J18.2	-2.697	0.00777	-0.06366	10	0.0236	no	BRNCDT
chr1_1468048_A_G_b38	RP4-758J18.2	-2.696	0.0078	-0.070527	8	0.02616	no	BRNCDT
chr1_1593732_G_C_b38	RP4-758J18.2	2.689	0.00796	0.036818	39	0.013692	no	BRNCDT
chr1_1534913_G_GC_b38	RP4-758J18.2	-2.613	0.00988	-0.125029	5	0.047853	no	BRNCDT
chr1_1415385_T_C_b38	RP4-758J18.2	-2.612	0.0099	-0.063077	6	0.02415	no	BRNCDT
chr1_1415659_G_C_b38	RP4-758J18.2	-2.612	0.0099	-0.063077	6	0.02415	no	BRNCDT
chr1_1417561_A_G_b38	RP4-758J18.2	-2.612	0.0099	-0.063077	6	0.02415	no	BRNCDT
chr1_1418000_T_C_b38	RP4-758J18.2	-2.612	0.0099	-0.063077	6	0.02415	no	BRNCDT
chr1_1418223_A_G_b38	RP4-758J18.2	-2.612	0.0099	-0.063077	6	0.02415	no	BRNCDT
chr1_1418252_A_G_b38	RP4-758J18.2	-2.612	0.0099	-0.063077	6	0.02415	no	BRNCDT
chr1_1408687_T_C_b38	RP4-758J18.2	-2.609	0.00999	-0.065102	8	0.024955	no	BRNCDT
chr1_1368177_G_C_b38	RP4-758J18.2	-4.986	1.87e-06	-0.107773	4	0.021615	yes	BRNCHB
chr1_1370553_CAAA_C_b38	RP4-758J18.2	-4.931	2.38e-06	-0.11568	4	0.023462	yes	BRNCHB
chr1_1367268_TGA_T_b38	RP4-758J18.2	-4.91	2.61e-06	-0.103594	4	0.0211	yes	BRNCHB
chr1_1374505_A_G_b38	RP4-758J18.2	-4.834	3.61e-06	-0.103424	5	0.021394	yes	BRNCHB
chr1_1364282_T_G_b38	RP4-758J18.2	-4.818	3.87e-06	-0.102862	4	0.021351	yes	BRNCHB
chr1_1364357_A_C_b38	RP4-758J18.2	-4.818	3.87e-06	-0.102862	4	0.021351	yes	BRNCHB
chr1_1364566_T_C_b38	RP4-758J18.2	-4.818	3.87e-06	-0.102862	4	0.021351	yes	BRNCHB
chr1_1364694_T_C_b38	RP4-758J18.2	-4.818	3.87e-06	-0.102862	4	0.021351	yes	BRNCHB
chr1_1364721_C_T_b38	RP4-758J18.2	-4.818	3.87e-06	-0.102862	4	0.021351	yes	BRNCHB
chr1_1365160_A_G_b38	RP4-758J18.2	-4.818	3.87e-06	-0.102862	4	0.021351	yes	BRNCHB
chr1_1365198_C_T_b38	RP4-758J18.2	-4.818	3.87e-06	-0.102862	4	0.021351	yes	BRNCHB
chr1_1366008_A_G_b38	RP4-758J18.2	-4.818	3.87e-06	-0.102862	4	0.021351	yes	BRNCHB
chr1_1366062_T_C_b38	RP4-758J18.2	-4.818	3.87e-06	-0.102862	4	0.021351	yes	BRNCHB
chr1_1366145_TGTGAA_T_b38	RP4-758J18.2	-4.818	3.87e-06	-0.102862	4	0.021351	yes	BRNCHB
chr1_1366187_A_AGT_b38	RP4-758J18.2	-4.818	3.87e-06	-0.102862	4	0.021351	yes	BRNCHB
chr1_1366292_G_T_b38	RP4-758J18.2	-4.818	3.87e-06	-0.102862	4	0.021351	yes	BRNCHB
chr1_1366321_TGTGTGTAAATGG_T_b38	RP4-758J18.2	-4.818	3.87e-06	-0.102862	4	0.021351	yes	BRNCHB
chr1_1366453_G_T_b38	RP4-758J18.2	-4.818	3.87e-06	-0.102862	4	0.021351	yes	BRNCHB
chr1_1366726_T_G_b38	RP4-758J18.2	-4.818	3.87e-06	-0.102862	4	0.021351	yes	BRNCHB
chr1_1367258_T_A_b38	RP4-758J18.2	-4.818	3.87e-06	-0.102862	4	0.021351	yes	BRNCHB
chr1_1367280_T_A_b38	RP4-758J18.2	-4.818	3.87e-06	-0.102862	4	0.021351	yes	BRNCHB
chr1_1367297_GAA_G_b38	RP4-758J18.2	-4.818	3.87e-06	-0.102862	4	0.021351	yes	BRNCHB
chr1_1367300_T_TGA_b38	RP4-758J18.2	-4.818	3.87e-06	-0.102862	4	0.021351	yes	BRNCHB
chr1_1367329_A_AGT_b38	RP4-758J18.2	-4.818	3.87e-06	-0.102862	4	0.021351	yes	BRNCHB
chr1_1367373_T_TGTG_b38	RP4-758J18.2	-4.818	3.87e-06	-0.102862	4	0.021351	yes	BRNCHB
chr1_1367388_T_TTGG_b38	RP4-758J18.2	-4.818	3.87e-06	-0.102862	4	0.021351	yes	BRNCHB
chr1_1367462_T_C_b38	RP4-758J18.2	-4.818	3.87e-06	-0.102862	4	0.021351	yes	BRNCHB
chr1_1367593_G_A_b38	RP4-758J18.2	-4.818	3.87e-06	-0.102862	4	0.021351	yes	BRNCHB
chr1_1367602_GT_G_b38	RP4-758J18.2	-4.818	3.87e-06	-0.102862	4	0.021351	yes	BRNCHB
chr1_1367605_GAGTGAGTGTA_G_b38	RP4-758J18.2	-4.818	3.87e-06	-0.102862	4	0.021351	yes	BRNCHB
chr1_1367670_GGTGA_G_b38	RP4-758J18.2	-4.818	3.87e-06	-0.102862	4	0.021351	yes	BRNCHB
chr1_1367722_TTTTA_T_b38	RP4-758J18.2	-4.818	3.87e-06	-0.102862	4	0.021351	yes	BRNCHB
chr1_1367874_A_T_b38	RP4-758J18.2	-4.818	3.87e-06	-0.102862	4	0.021351	yes	BRNCHB
chr1_1367919_C_T_b38	RP4-758J18.2	-4.818	3.87e-06	-0.102862	4	0.021351	yes	BRNCHB
chr1_1367951_C_T_b38	RP4-758J18.2	-4.818	3.87e-06	-0.102862	4	0.021351	yes	BRNCHB
chr1_1367965_A_G_b38	RP4-758J18.2	-4.818	3.87e-06	-0.102862	4	0.021351	yes	BRNCHB
chr1_1367970_T_G_b38	RP4-758J18.2	-4.818	3.87e-06	-0.102862	4	0.021351	yes	BRNCHB
chr1_1367994_C_A_b38	RP4-758J18.2	-4.818	3.87e-06	-0.102862	4	0.021351	yes	BRNCHB
chr1_1368297_C_T_b38	RP4-758J18.2	-4.818	3.87e-06	-0.102862	4	0.021351	yes	BRNCHB
chr1_1368514_C_G_b38	RP4-758J18.2	-4.818	3.87e-06	-0.102862	4	0.021351	yes	BRNCHB
chr1_1368991_C_T_b38	RP4-758J18.2	-4.818	3.87e-06	-0.102862	4	0.021351	yes	BRNCHB
chr1_1369009_T_C_b38	RP4-758J18.2	-4.818	3.87e-06	-0.102862	4	0.021351	yes	BRNCHB
chr1_1369012_C_CG_b38	RP4-758J18.2	-4.818	3.87e-06	-0.102862	4	0.021351	yes	BRNCHB
chr1_1369282_G_A_b38	RP4-758J18.2	-4.818	3.87e-06	-0.102862	4	0.021351	yes	BRNCHB
chr1_1369320_GT_G_b38	RP4-758J18.2	-4.818	3.87e-06	-0.102862	4	0.021351	yes	BRNCHB
chr1_1369407_G_A_b38	RP4-758J18.2	-4.818	3.87e-06	-0.102862	4	0.021351	yes	BRNCHB
chr1_1369476_CTT_C_b38	RP4-758J18.2	-4.818	3.87e-06	-0.102862	4	0.021351	yes	BRNCHB
chr1_1369556_C_G_b38	RP4-758J18.2	-4.818	3.87e-06	-0.102862	4	0.021351	yes	BRNCHB
chr1_1369627_T_C_b38	RP4-758J18.2	-4.818	3.87e-06	-0.102862	4	0.021351	yes	BRNCHB
chr1_1369686_T_C_b38	RP4-758J18.2	-4.818	3.87e-06	-0.102862	4	0.021351	yes	BRNCHB
chr1_1369716_G_C_b38	RP4-758J18.2	-4.818	3.87e-06	-0.102862	4	0.021351	yes	BRNCHB
chr1_1369741_C_T_b38	RP4-758J18.2	-4.818	3.87e-06	-0.102862	4	0.021351	yes	BRNCHB
chr1_1370181_C_T_b38	RP4-758J18.2	-4.818	3.87e-06	-0.102862	4	0.021351	yes	BRNCHB
chr1_1370317_G_C_b38	RP4-758J18.2	-4.818	3.87e-06	-0.102862	4	0.021351	yes	BRNCHB
chr1_1370320_A_G_b38	RP4-758J18.2	-4.818	3.87e-06	-0.102862	4	0.021351	yes	BRNCHB
chr1_1370430_T_C_b38	RP4-758J18.2	-4.784	4.48e-06	-0.101985	5	0.02132	yes	BRNCHB
chr1_1370532_C_T_b38	RP4-758J18.2	-4.784	4.48e-06	-0.101985	5	0.02132	yes	BRNCHB
chr1_1370584_G_C_b38	RP4-758J18.2	-4.784	4.48e-06	-0.101985	5	0.02132	yes	BRNCHB
chr1_1372909_G_A_b38	RP4-758J18.2	-4.784	4.48e-06	-0.101985	5	0.02132	yes	BRNCHB
chr1_1363880_A_G_b38	RP4-758J18.2	-4.765	4.84e-06	-0.101566	4	0.021313	yes	BRNCHB
chr1_1432355_G_A_b38	RP4-758J18.2	-4.753	5.1e-06	-0.094347	10	0.01985	yes	BRNCHB
chr1_1367511_ATGAG_A_b38	RP4-758J18.2	-4.735	5.5e-06	-0.104018	3	0.021968	yes	BRNCHB
chr1_1369821_C_T_b38	RP4-758J18.2	-4.625	8.71e-06	-0.098769	4	0.021354	yes	BRNCHB
chr1_1344048_G_A_b38	RP4-758J18.2	-4.6	9.69e-06	-0.099261	4	0.02158	yes	BRNCHB
chr1_1341550_GCA_G_b38	RP4-758J18.2	-4.569	1.1e-05	-0.098465	5	0.021553	yes	BRNCHB
chr1_1366681_T_TGA_b38	RP4-758J18.2	-4.564	1.12e-05	-0.099839	4	0.021877	yes	BRNCHB
chr1_1380867_A_G_b38	RP4-758J18.2	-4.516	1.37e-05	-0.098088	5	0.02172	yes	BRNCHB
chr1_1316929_A_T_b38	RP4-758J18.2	-4.504	1.44e-05	-0.093856	6	0.02084	yes	BRNCHB
chr1_1329973_GCGTGTGCCATGCA_G_b38	RP4-758J18.2	-4.503	1.45e-05	-0.098517	4	0.02188	yes	BRNCHB
chr1_1375642_C_T_b38	RP4-758J18.2	-4.498	1.47e-05	-0.097715	5	0.021723	yes	BRNCHB
chr1_1366511_GGTGA_G_b38	RP4-758J18.2	-4.491	1.52e-05	-0.097641	4	0.021742	yes	BRNCHB
chr1_1363688_C_T_b38	RP4-758J18.2	-4.487	1.54e-05	-0.097346	4	0.021693	yes	BRNCHB
chr1_1364099_CCA_C_b38	RP4-758J18.2	-4.487	1.54e-05	-0.097346	4	0.021693	yes	BRNCHB
chr1_1364102_TGTTG_T_b38	RP4-758J18.2	-4.487	1.54e-05	-0.097346	4	0.021693	yes	BRNCHB
chr1_1368763_G_A_b38	RP4-758J18.2	-4.487	1.54e-05	-0.097346	4	0.021693	yes	BRNCHB
chr1_1382893_G_A_b38	RP4-758J18.2	-4.423	2e-05	-0.096561	5	0.021831	yes	BRNCHB
chr1_1407232_G_C_b38	RP4-758J18.2	-4.418	2.03e-05	-0.083929	10	0.018996	yes	BRNCHB
chr1_1437955_C_G_b38	RP4-758J18.2	-4.386	2.31e-05	-0.078638	18	0.017928	yes	BRNCHB
chr1_1366776_G_GAATT_b38	RP4-758J18.2	-4.359	2.58e-05	-0.096398	4	0.022115	yes	BRNCHB
chr1_1384546_C_T_b38	RP4-758J18.2	-4.29	3.4e-05	-0.094515	5	0.022031	yes	BRNCHB
chr1_1398218_C_A_b38	RP4-758J18.2	-4.29	3.4e-05	-0.094515	5	0.022031	yes	BRNCHB
chr1_1400756_GGA_G_b38	RP4-758J18.2	-4.266	3.74e-05	-0.093954	5	0.022026	yes	BRNCHB
chr1_1401954_G_T_b38	RP4-758J18.2	-4.266	3.74e-05	-0.093954	5	0.022026	yes	BRNCHB
chr1_1403593_A_G_b38	RP4-758J18.2	-4.266	3.74e-05	-0.093954	5	0.022026	yes	BRNCHB
chr1_1407565_C_A_b38	RP4-758J18.2	-4.266	3.74e-05	-0.093954	5	0.022026	yes	BRNCHB
chr1_1383743_T_C_b38	RP4-758J18.2	-4.263	3.78e-05	-0.09378	5	0.021997	yes	BRNCHB
chr1_1436388_CA_C_b38	RP4-758J18.2	-4.26	3.82e-05	-0.081309	16	0.019085	yes	BRNCHB
chr1_1308178_GGGGCGCGGGGA_G_b38	RP4-758J18.2	-4.233	4.25e-05	-0.087075	8	0.02057	yes	BRNCHB
chr1_1441187_A_G_b38	RP4-758J18.2	-4.046	8.77e-05	-0.077526	18	0.019163	yes	BRNCHB
chr1_1216593_G_C_b38	RP4-758J18.2	-3.972	0.000116	-0.089656	4	0.022573	yes	BRNCHB
chr1_1379091_T_G_b38	RP4-758J18.2	3.915	0.000143	0.082205	5	0.020996	yes	BRNCHB
chr1_1431813_G_T_b38	RP4-758J18.2	-3.834	0.000193	-0.07932	8	0.020687	yes	BRNCHB
chr1_1431014_G_A_b38	RP4-758J18.2	-3.705	0.000308	-0.069283	14	0.018698	yes	BRNCHB
chr1_1235997_A_G_b38	RP4-758J18.2	-3.698	0.000315	-0.092329	3	0.024964	yes	BRNCHB
chr1_1379093_TG_T_b38	RP4-758J18.2	-3.695	0.000319	-0.086348	4	0.023368	yes	BRNCHB
chr1_1431026_CCACCCCCT_C_b38	RP4-758J18.2	-3.598	0.000449	-0.072388	13	0.020117	yes	BRNCHB
chr1_1538924_C_A_b38	RP4-758J18.2	-3.543	0.000546	-0.068346	18	0.019293	yes	BRNCHB
chr1_1437993_G_A_b38	RP4-758J18.2	-3.418	0.000836	-0.066475	11	0.01945	yes	BRNCHB
chr1_1559703_G_C_b38	RP4-758J18.2	-3.394	0.000906	-0.064548	25	0.019018	yes	BRNCHB
chr1_1568548_G_A_b38	RP4-758J18.2	-3.394	0.000906	-0.064548	25	0.019018	yes	BRNCHB
chr1_1292284_TTGAG_T_b38	RP4-758J18.2	-3.392	0.000913	-0.082192	9	0.024232	yes	BRNCHB
chr1_1549590_C_G_b38	RP4-758J18.2	-3.317	0.00117	-0.061894	28	0.018659	yes	BRNCHB
chr1_1553692_A_G_b38	RP4-758J18.2	-3.317	0.00117	-0.061894	28	0.018659	yes	BRNCHB
chr1_1554694_A_G_b38	RP4-758J18.2	-3.317	0.00117	-0.061894	28	0.018659	yes	BRNCHB
chr1_1554781_A_G_b38	RP4-758J18.2	-3.317	0.00117	-0.061894	28	0.018659	yes	BRNCHB
chr1_1555247_T_A_b38	RP4-758J18.2	-3.317	0.00117	-0.061894	28	0.018659	yes	BRNCHB
chr1_1575935_T_C_b38	RP4-758J18.2	-3.294	0.00126	-0.062596	26	0.019003	yes	BRNCHB
chr1_1566086_G_A_b38	RP4-758J18.2	-3.288	0.00129	-0.061877	29	0.018817	yes	BRNCHB
chr1_1569661_T_C_b38	RP4-758J18.2	-3.252	0.00145	-0.061121	27	0.018794	yes	BRNCHB
chr1_1554852_T_C_b38	RP4-758J18.2	-3.22	0.00161	-0.059935	28	0.018615	yes	BRNCHB
chr1_1570587_C_T_b38	RP4-758J18.2	-3.151	0.00201	-0.060437	25	0.019182	yes	BRNCHB
chr1_1572532_A_C_b38	RP4-758J18.2	-3.147	0.00203	-0.059189	29	0.018806	yes	BRNCHB
chr1_1573079_A_G_b38	RP4-758J18.2	-3.147	0.00203	-0.059189	29	0.018806	yes	BRNCHB
chr1_1565680_A_AG_b38	RP4-758J18.2	-3.049	0.00276	-0.056465	29	0.018517	yes	BRNCHB
chr1_2181022_T_C_b38	RP4-758J18.2	-3.025	0.00298	-0.052355	40	0.017305	yes	BRNCHB
chr1_1050070_G_A_b38	RP4-758J18.2	-2.991	0.00331	-0.053968	35	0.018042	yes	BRNCHB
chr1_1547630_G_A_b38	RP4-758J18.2	-2.985	0.00337	-0.056158	24	0.018814	yes	BRNCHB
chr1_1050063_AG_A_b38	RP4-758J18.2	-2.98	0.00342	-0.055671	33	0.018682	yes	BRNCHB
chr1_2111104_A_G_b38	RP4-758J18.2	2.971	0.00352	0.052402	29	0.017639	yes	BRNCHB
chr1_1570294_CA_C_b38	RP4-758J18.2	-2.961	0.00363	-0.056703	28	0.019152	yes	BRNCHB
chr1_1575864_G_A_b38	RP4-758J18.2	-2.904	0.00431	-0.055927	24	0.019261	yes	BRNCHB
chr1_1558204_T_TAAAAAA_b38	RP4-758J18.2	-2.885	0.00456	-0.057415	13	0.019898	yes	BRNCHB
chr1_1560765_T_C_b38	RP4-758J18.2	-2.879	0.00465	-0.057116	22	0.019839	yes	BRNCHB
chr1_1562261_TTTTC_T_b38	RP4-758J18.2	-2.879	0.00465	-0.057116	22	0.019839	yes	BRNCHB
chr1_1571986_G_A_b38	RP4-758J18.2	-2.875	0.0047	-0.055132	22	0.019177	yes	BRNCHB
chr1_2108082_G_T_b38	RP4-758J18.2	2.867	0.00482	0.050745	29	0.017701	yes	BRNCHB
chr1_2113726_G_A_b38	RP4-758J18.2	2.867	0.00482	0.050745	29	0.017701	yes	BRNCHB
chr1_1566854_CA_C_b38	RP4-758J18.2	-2.848	0.00509	-0.057895	20	0.020325	yes	BRNCHB
chr1_1574655_GGC_G_b38	RP4-758J18.2	-2.84	0.00521	-0.055163	23	0.019422	yes	BRNCHB
chr1_1302795_T_TC_b38	RP4-758J18.2	2.832	0.00533	0.060981	23	0.02153	yes	BRNCHB
chr1_505074_C_T_b38	RP4-758J18.2	-2.812	0.00566	-0.067917	5	0.024152	yes	BRNCHB
chr1_1229369_G_GC_b38	RP4-758J18.2	-2.81	0.0057	-0.064875	5	0.02309	yes	BRNCHB
chr1_2118069_G_T_b38	RP4-758J18.2	2.785	0.00612	0.048805	27	0.017522	yes	BRNCHB
chr1_984121_G_T_b38	RP4-758J18.2	2.779	0.00623	0.047186	41	0.016977	yes	BRNCHB
chr1_1742119_CA_C_b38	RP4-758J18.2	2.769	0.00643	0.056146	14	0.020279	yes	BRNCHB
chr1_2109459_T_C_b38	RP4-758J18.2	2.766	0.00648	0.048734	30	0.017619	yes	BRNCHB
chr1_2109716_C_T_b38	RP4-758J18.2	2.766	0.00648	0.048734	30	0.017619	yes	BRNCHB
chr1_2110022_C_T_b38	RP4-758J18.2	2.762	0.00656	0.048631	30	0.017609	yes	BRNCHB
chr1_1248686_A_G_b38	RP4-758J18.2	-2.728	0.00722	-0.073521	3	0.026946	yes	BRNCHB
chr1_1573429_CAAAAAAAAAAAAAAAAAA_C_b38	RP4-758J18.2	-2.724	0.00731	-0.052141	25	0.019141	yes	BRNCHB
chr1_2181237_A_G_b38	RP4-758J18.2	-2.712	0.00758	-0.046089	36	0.016997	yes	BRNCHB
chr1_505172_T_G_b38	RP4-758J18.2	-2.702	0.00779	-0.065331	4	0.024183	yes	BRNCHB
chr1_2107454_G_A_b38	RP4-758J18.2	2.7	0.00783	0.049235	32	0.018235	yes	BRNCHB
chr1_1571794_A_AT_b38	RP4-758J18.2	-2.698	0.00788	-0.052745	24	0.019551	yes	BRNCHB
chr1_1079877_A_G_b38	RP4-758J18.2	2.687	0.00813	0.047486	31	0.017675	yes	BRNCHB
chr1_1079746_A_G_b38	RP4-758J18.2	2.658	0.00881	0.047335	32	0.017807	yes	BRNCHB
chr1_1574032_AAAG_A_b38	RP4-758J18.2	-2.622	0.00975	-0.054786	15	0.020895	yes	BRNCHB
chr1_1217251_C_A_b38	RP4-758J18.2	-4.665	7.39e-06	-0.105616	4	0.022642	no	BRNCHB
chr1_1325753_G_T_b38	RP4-758J18.2	-4.523	1.33e-05	-0.104276	3	0.023053	no	BRNCHB
chr1_1364253_C_G_b38	RP4-758J18.2	-4.505	1.43e-05	-0.097702	4	0.021689	no	BRNCHB
chr1_1303800_G_A_b38	RP4-758J18.2	-4.5	1.46e-05	-0.101164	4	0.022483	no	BRNCHB
chr1_1304555_A_C_b38	RP4-758J18.2	-4.5	1.46e-05	-0.101164	4	0.022483	no	BRNCHB
chr1_1448915_G_A_b38	RP4-758J18.2	-4.45	1.79e-05	-0.083739	17	0.018816	no	BRNCHB
chr1_1394041_G_A_b38	RP4-758J18.2	-4.443	1.84e-05	-0.101873	3	0.022927	no	BRNCHB
chr1_1215852_T_C_b38	RP4-758J18.2	-4.381	2.37e-05	-0.096104	5	0.021939	no	BRNCHB
chr1_1443457_T_C_b38	RP4-758J18.2	-4.319	3.02e-05	-0.081655	26	0.018904	no	BRNCHB
chr1_1303112_G_A_b38	RP4-758J18.2	-4.265	3.76e-05	-0.096849	4	0.02271	no	BRNCHB
chr1_1434687_C_G_b38	RP4-758J18.2	-4.26	3.82e-05	-0.089047	7	0.020902	no	BRNCHB
chr1_1363898_C_T_b38	RP4-758J18.2	4.244	4.08e-05	0.086948	5	0.020489	no	BRNCHB
chr1_1363986_C_T_b38	RP4-758J18.2	4.244	4.08e-05	0.086948	5	0.020489	no	BRNCHB
chr1_1365566_G_A_b38	RP4-758J18.2	4.244	4.08e-05	0.086948	5	0.020489	no	BRNCHB
chr1_1366529_TTAG_T_b38	RP4-758J18.2	4.244	4.08e-05	0.086948	5	0.020489	no	BRNCHB
chr1_1367292_A_AGT_b38	RP4-758J18.2	4.244	4.08e-05	0.086948	5	0.020489	no	BRNCHB
chr1_1431656_G_A_b38	RP4-758J18.2	-4.215	4.56e-05	-0.089452	6	0.021222	no	BRNCHB
chr1_1369803_C_CT_b38	RP4-758J18.2	-4.135	6.23e-05	-0.086928	5	0.021024	no	BRNCHB
chr1_1440834_C_G_b38	RP4-758J18.2	-4.065	8.15e-05	-0.075795	25	0.018647	no	BRNCHB
chr1_1442793_G_A_b38	RP4-758J18.2	-4.057	8.4e-05	-0.084683	7	0.020874	no	BRNCHB
chr1_1217733_G_A_b38	RP4-758J18.2	-4.041	8.93e-05	-0.094729	3	0.023444	no	BRNCHB
chr1_1433374_T_C_b38	RP4-758J18.2	-4.025	9.48e-05	-0.075539	26	0.018768	no	BRNCHB
chr1_1312114_T_C_b38	RP4-758J18.2	4.015	9.86e-05	0.0776	21	0.01933	no	BRNCHB
chr1_1436079_A_G_b38	RP4-758J18.2	-3.996	0.000106	-0.074203	25	0.018572	no	BRNCHB
chr1_1231710_CCCCCGGGAA_C_b38	RP4-758J18.2	-3.995	0.000106	-0.095272	3	0.02385	no	BRNCHB
chr1_1431450_A_G_b38	RP4-758J18.2	-3.992	0.000107	-0.076125	25	0.01907	no	BRNCHB
chr1_1431537_G_C_b38	RP4-758J18.2	-3.992	0.000107	-0.076125	25	0.01907	no	BRNCHB
chr1_1445187_T_G_b38	RP4-758J18.2	-3.984	0.000111	-0.07533	23	0.018907	no	BRNCHB
chr1_1309988_G_A_b38	RP4-758J18.2	3.955	0.000124	0.076421	21	0.019325	no	BRNCHB
chr1_1313807_G_A_b38	RP4-758J18.2	3.955	0.000124	0.076421	21	0.019325	no	BRNCHB
chr1_1430908_A_G_b38	RP4-758J18.2	-3.922	0.00014	-0.075653	25	0.019291	no	BRNCHB
chr1_1361685_C_T_b38	RP4-758J18.2	-3.916	0.000143	-0.081638	10	0.020845	no	BRNCHB
chr1_1290841_A_G_b38	RP4-758J18.2	-3.879	0.000164	-0.086117	12	0.022199	no	BRNCHB
chr1_1330125_G_A_b38	RP4-758J18.2	3.879	0.000164	0.076457	20	0.01971	no	BRNCHB
chr1_1249880_A_G_b38	RP4-758J18.2	-3.871	0.000168	-0.084921	8	0.021936	no	BRNCHB
chr1_1308516_C_T_b38	RP4-758J18.2	3.859	0.000176	0.074921	21	0.019413	no	BRNCHB
chr1_1411323_A_C_b38	RP4-758J18.2	-3.858	0.000177	-0.078738	20	0.020408	no	BRNCHB
chr1_1447108_A_ATT_b38	RP4-758J18.2	-3.85	0.000182	-0.080511	11	0.020912	no	BRNCHB
chr1_1445240_A_G_b38	RP4-758J18.2	-3.837	0.000191	-0.073202	24	0.019076	no	BRNCHB
chr1_1440430_C_G_b38	RP4-758J18.2	-3.833	0.000194	-0.072612	17	0.018946	no	BRNCHB
chr1_1439454_A_G_b38	RP4-758J18.2	-3.788	0.000228	-0.067356	25	0.017782	no	BRNCHB
chr1_1537493_T_A_b38	RP4-758J18.2	-3.785	0.000231	-0.071972	23	0.019016	no	BRNCHB
chr1_1238231_G_A_b38	RP4-758J18.2	-3.784	0.000232	-0.081772	8	0.021609	no	BRNCHB
chr1_1231507_T_C_b38	RP4-758J18.2	-3.78	0.000235	-0.086085	3	0.022772	no	BRNCHB
chr1_1363456_CAG_C_b38	RP4-758J18.2	3.773	0.000241	0.069984	11	0.018549	no	BRNCHB
chr1_1532798_T_C_b38	RP4-758J18.2	-3.75	0.000263	-0.064611	48	0.017232	no	BRNCHB
chr1_1370113_A_G_b38	RP4-758J18.2	3.737	0.000275	0.070922	17	0.018979	no	BRNCHB
chr1_1438102_G_C_b38	RP4-758J18.2	-3.73	0.000282	-0.071814	11	0.019254	no	BRNCHB
chr1_1428969_T_C_b38	RP4-758J18.2	-3.723	0.000289	-0.072148	25	0.01938	no	BRNCHB
chr1_1430190_A_C_b38	RP4-758J18.2	-3.702	0.000312	-0.071792	25	0.019394	no	BRNCHB
chr1_1248597_A_C_b38	RP4-758J18.2	-3.687	0.000329	-0.087739	6	0.023799	no	BRNCHB
chr1_1251122_A_T_b38	RP4-758J18.2	-3.631	0.000401	-0.079925	8	0.022013	no	BRNCHB
chr1_1435945_C_CCGGGCGGGGGCG_b38	RP4-758J18.2	-3.628	0.000405	-0.07592	8	0.020927	no	BRNCHB
chr1_1366427_AGTGTGATTGAATGAGT_A_b38	RP4-758J18.2	3.587	0.000468	0.069481	13	0.019371	no	BRNCHB
chr1_1223568_A_G_b38	RP4-758J18.2	-3.561	0.000512	-0.087827	3	0.024663	no	BRNCHB
chr1_1387698_A_G_b38	RP4-758J18.2	3.555	0.000524	0.072558	18	0.020413	no	BRNCHB
chr1_1402457_A_G_b38	RP4-758J18.2	-3.546	0.00054	-0.072547	18	0.020461	no	BRNCHB
chr1_1337898_A_G_b38	RP4-758J18.2	3.544	0.000544	0.067286	10	0.018988	no	BRNCHB
chr1_1389827_C_T_b38	RP4-758J18.2	3.543	0.000544	0.071892	17	0.020289	no	BRNCHB
chr1_1394423_A_G_b38	RP4-758J18.2	-3.543	0.000544	-0.071892	17	0.020289	no	BRNCHB
chr1_1395346_A_G_b38	RP4-758J18.2	-3.543	0.000544	-0.071892	17	0.020289	no	BRNCHB
chr1_1358384_G_C_b38	RP4-758J18.2	3.531	0.000569	0.069898	19	0.019798	no	BRNCHB
chr1_1236303_A_G_b38	RP4-758J18.2	-3.531	0.000569	-0.078823	4	0.022326	no	BRNCHB
chr1_1537160_T_G_b38	RP4-758J18.2	-3.528	0.000575	-0.061207	35	0.017351	no	BRNCHB
chr1_1426253_G_A_b38	RP4-758J18.2	-3.528	0.000575	-0.077483	6	0.021965	no	BRNCHB
chr1_1539491_G_C_b38	RP4-758J18.2	-3.525	0.00058	-0.067329	25	0.019101	no	BRNCHB
chr1_1236037_C_T_b38	RP4-758J18.2	-3.517	0.000597	-0.058383	33	0.016602	no	BRNCHB
chr1_1376162_G_C_b38	RP4-758J18.2	3.505	0.000621	0.069808	14	0.019915	no	BRNCHB
chr1_1377431_C_T_b38	RP4-758J18.2	3.505	0.000621	0.069808	14	0.019915	no	BRNCHB
chr1_1384749_C_G_b38	RP4-758J18.2	3.489	0.000657	0.069664	14	0.019969	no	BRNCHB
chr1_1387763_CCT_C_b38	RP4-758J18.2	3.489	0.000657	0.069664	14	0.019969	no	BRNCHB
chr1_1388944_G_A_b38	RP4-758J18.2	3.489	0.000657	0.069664	14	0.019969	no	BRNCHB
chr1_1426261_C_T_b38	RP4-758J18.2	-3.468	0.000705	-0.068152	25	0.01965	no	BRNCHB
chr1_1426810_C_G_b38	RP4-758J18.2	-3.468	0.000705	-0.068152	25	0.01965	no	BRNCHB
chr1_1378204_G_C_b38	RP4-758J18.2	3.461	0.000722	0.067511	15	0.019505	no	BRNCHB
chr1_1131430_C_CTTTTTTTTTTTTTTTT_b38	RP4-758J18.2	3.456	0.000734	0.124869	4	0.036129	no	BRNCHB
chr1_1361679_G_A_b38	RP4-758J18.2	3.448	0.000756	0.070532	11	0.020458	no	BRNCHB
chr1_1555179_A_G_b38	RP4-758J18.2	-3.444	0.000766	-0.067715	22	0.019664	no	BRNCHB
chr1_1366561_AGT_A_b38	RP4-758J18.2	3.441	0.000774	0.067983	18	0.019758	no	BRNCHB
chr1_1538787_A_G_b38	RP4-758J18.2	-3.344	0.00107	-0.063588	28	0.019013	no	BRNCHB
chr1_1225476_T_C_b38	RP4-758J18.2	-3.325	0.00114	-0.085266	3	0.025648	no	BRNCHB
chr1_1226013_C_T_b38	RP4-758J18.2	-3.325	0.00114	-0.085266	3	0.025648	no	BRNCHB
chr1_1555871_T_C_b38	RP4-758J18.2	-3.322	0.00115	-0.066693	21	0.020076	no	BRNCHB
chr1_1559750_C_CAG_b38	RP4-758J18.2	-3.314	0.00118	-0.061984	29	0.018705	no	BRNCHB
chr1_1561628_T_C_b38	RP4-758J18.2	-3.314	0.00118	-0.061984	29	0.018705	no	BRNCHB
chr1_1563918_A_G_b38	RP4-758J18.2	-3.314	0.00118	-0.061984	29	0.018705	no	BRNCHB
chr1_1565561_A_G_b38	RP4-758J18.2	-3.314	0.00118	-0.061984	29	0.018705	no	BRNCHB
chr1_1567715_G_A_b38	RP4-758J18.2	-3.314	0.00118	-0.061984	29	0.018705	no	BRNCHB
chr1_1567719_A_C_b38	RP4-758J18.2	-3.314	0.00118	-0.061984	29	0.018705	no	BRNCHB
chr1_1569875_C_T_b38	RP4-758J18.2	-3.314	0.00118	-0.061984	29	0.018705	no	BRNCHB
chr1_1400410_A_G_b38	RP4-758J18.2	-3.298	0.00125	-0.066701	13	0.020222	no	BRNCHB
chr1_1240580_G_GC_b38	RP4-758J18.2	-3.294	0.00126	-0.081596	3	0.024772	no	BRNCHB
chr1_1569180_T_A_b38	RP4-758J18.2	-3.291	0.00127	-0.062784	27	0.019076	no	BRNCHB
chr1_1545968_T_C_b38	RP4-758J18.2	-3.281	0.00132	-0.067729	11	0.020641	no	BRNCHB
chr1_1242094_A_G_b38	RP4-758J18.2	-3.253	0.00144	-0.077656	3	0.023869	no	BRNCHB
chr1_1242250_A_G_b38	RP4-758J18.2	-3.253	0.00144	-0.077656	3	0.023869	no	BRNCHB
chr1_1663949_A_G_b38	RP4-758J18.2	3.244	0.00149	0.07648	5	0.023573	no	BRNCHB
chr1_1565105_CAAGGCAGGCGGATCATG_C_b38	RP4-758J18.2	-3.242	0.0015	-0.05947	31	0.018341	no	BRNCHB
chr1_1241053_A_G_b38	RP4-758J18.2	-3.231	0.00155	-0.076769	3	0.023758	no	BRNCHB
chr1_1554290_C_T_b38	RP4-758J18.2	-3.227	0.00157	-0.064746	18	0.020064	no	BRNCHB
chr1_1554548_T_C_b38	RP4-758J18.2	-3.223	0.00159	-0.064004	20	0.019861	no	BRNCHB
chr1_1568428_C_G_b38	RP4-758J18.2	-3.214	0.00164	-0.064984	12	0.020221	no	BRNCHB
chr1_1244603_G_A_b38	RP4-758J18.2	-3.207	0.00168	-0.077876	3	0.024285	no	BRNCHB
chr1_1007746_CTTTTTTTTTTTTTT_C_b38	RP4-758J18.2	-3.195	0.00174	-0.070222	11	0.021978	no	BRNCHB
chr1_1259424_T_C_b38	RP4-758J18.2	-3.19	0.00177	-0.065692	18	0.020592	no	BRNCHB
chr1_1533883_G_T_b38	RP4-758J18.2	-3.159	0.00196	-0.098034	3	0.031033	no	BRNCHB
chr1_1246371_T_C_b38	RP4-758J18.2	-3.151	0.00201	-0.07462	6	0.023681	no	BRNCHB
chr1_1258206_AT_A_b38	RP4-758J18.2	-3.112	0.00228	-0.061171	18	0.019659	no	BRNCHB
chr1_1533841_T_C_b38	RP4-758J18.2	-3.106	0.00231	-0.069274	16	0.022302	no	BRNCHB
chr1_1243102_A_G_b38	RP4-758J18.2	-3.093	0.00241	-0.075624	4	0.02445	no	BRNCHB
chr1_1439805_G_C_b38	RP4-758J18.2	-3.09	0.00244	-0.063171	10	0.020444	no	BRNCHB
chr1_1290968_C_G_b38	RP4-758J18.2	-3.056	0.00271	-0.073052	14	0.023903	no	BRNCHB
chr1_1251285_G_A_b38	RP4-758J18.2	-3.043	0.00282	-0.070569	5	0.023191	no	BRNCHB
chr1_1251368_T_C_b38	RP4-758J18.2	-3.043	0.00282	-0.070569	5	0.023191	no	BRNCHB
chr1_1251618_G_A_b38	RP4-758J18.2	-2.989	0.00333	-0.070979	4	0.023749	no	BRNCHB
chr1_1543500_T_G_b38	RP4-758J18.2	-2.985	0.00337	-0.058626	24	0.01964	no	BRNCHB
chr1_1242865_C_T_b38	RP4-758J18.2	-2.959	0.00365	-0.072542	4	0.024512	no	BRNCHB
chr1_1379083_AT_A_b38	RP4-758J18.2	2.911	0.00422	0.056567	11	0.019434	no	BRNCHB
chr1_1570568_AC_A_b38	RP4-758J18.2	-2.886	0.00455	-0.060645	11	0.021015	no	BRNCHB
chr1_1542773_T_C_b38	RP4-758J18.2	-2.842	0.00518	-0.055519	24	0.019533	no	BRNCHB
chr1_1542793_C_G_b38	RP4-758J18.2	-2.842	0.00518	-0.055519	24	0.019533	no	BRNCHB
chr1_1542800_T_C_b38	RP4-758J18.2	-2.842	0.00518	-0.055519	24	0.019533	no	BRNCHB
chr1_1243650_G_A_b38	RP4-758J18.2	-2.842	0.00519	-0.069078	3	0.024309	no	BRNCHB
chr1_1221049_C_G_b38	RP4-758J18.2	-2.825	0.00545	-0.057762	18	0.020447	no	BRNCHB
chr1_1541864_T_C_b38	RP4-758J18.2	-2.82	0.00554	-0.055727	25	0.019765	no	BRNCHB
chr1_1558726_C_CA_b38	RP4-758J18.2	-2.795	0.00595	-0.054254	26	0.019411	no	BRNCHB
chr1_1561821_A_C_b38	RP4-758J18.2	-2.795	0.00595	-0.054254	26	0.019411	no	BRNCHB
chr1_1558347_G_A_b38	RP4-758J18.2	-2.786	0.00611	-0.058608	19	0.021035	no	BRNCHB
chr1_1551557_A_AG_b38	RP4-758J18.2	-2.785	0.00614	-0.054412	25	0.019541	no	BRNCHB
chr1_1551559_A_T_b38	RP4-758J18.2	-2.785	0.00614	-0.054412	25	0.019541	no	BRNCHB
chr1_1575724_G_C_b38	RP4-758J18.2	-2.764	0.00651	-0.052426	26	0.018967	no	BRNCHB
chr1_1573654_T_C_b38	RP4-758J18.2	-2.757	0.00664	-0.052392	27	0.019001	no	BRNCHB
chr1_1577491_A_AC_b38	RP4-758J18.2	-2.745	0.00688	-0.052121	28	0.018987	no	BRNCHB
chr1_1228424_C_T_b38	RP4-758J18.2	-2.741	0.00697	-0.064012	3	0.023357	no	BRNCHB
chr1_1550064_GC_G_b38	RP4-758J18.2	-2.74	0.00698	-0.053924	24	0.01968	no	BRNCHB
chr1_1550068_C_A_b38	RP4-758J18.2	-2.74	0.00698	-0.053924	24	0.01968	no	BRNCHB
chr1_1574445_A_G_b38	RP4-758J18.2	-2.739	0.00701	-0.0525	27	0.01917	no	BRNCHB
chr1_2102533_T_C_b38	RP4-758J18.2	-2.736	0.00705	-0.052856	29	0.019315	no	BRNCHB
chr1_1579717_T_A_b38	RP4-758J18.2	-2.723	0.00734	-0.056846	10	0.020879	no	BRNCHB
chr1_1557495_CAT_C_b38	RP4-758J18.2	-2.719	0.00741	-0.052865	26	0.019442	no	BRNCHB
chr1_1551523_T_C_b38	RP4-758J18.2	-2.684	0.00818	-0.057044	10	0.02125	no	BRNCHB
chr1_1575421_C_T_b38	RP4-758J18.2	-2.672	0.00847	-0.050704	26	0.018975	no	BRNCHB
chr1_1543953_A_G_b38	RP4-758J18.2	-2.656	0.00886	-0.052465	24	0.01975	no	BRNCHB
chr1_2051721_C_A_b38	RP4-758J18.2	-2.639	0.00929	-0.05073	13	0.019221	no	BRNCHB
chr1_1903242_C_T_b38	RP4-758J18.2	-3.603	0.000415	-0.076848	3	0.02133	yes	BRNCHA
chr1_1903577_C_T_b38	RP4-758J18.2	-3.603	0.000415	-0.076848	3	0.02133	yes	BRNCHA
chr1_1906935_C_T_b38	RP4-758J18.2	-3.603	0.000415	-0.076848	3	0.02133	yes	BRNCHA
chr1_1909167_G_A_b38	RP4-758J18.2	-3.603	0.000415	-0.076848	3	0.02133	yes	BRNCHA
chr1_1910289_C_T_b38	RP4-758J18.2	-3.551	0.000499	-0.07265	3	0.020461	yes	BRNCHA
chr1_1910369_G_A_b38	RP4-758J18.2	-3.551	0.000499	-0.07265	3	0.020461	yes	BRNCHA
chr1_1910480_G_A_b38	RP4-758J18.2	-3.551	0.000499	-0.07265	3	0.020461	yes	BRNCHA
chr1_1912140_T_G_b38	RP4-758J18.2	-3.527	0.000541	-0.072342	3	0.020508	yes	BRNCHA
chr1_2124387_G_A_b38	RP4-758J18.2	-3.265	0.00133	-0.105183	4	0.032219	yes	BRNCHA
chr1_1951920_A_G_b38	RP4-758J18.2	3.262	0.00134	0.067633	5	0.020735	yes	BRNCHA
chr1_1956930_A_G_b38	RP4-758J18.2	3.262	0.00134	0.067633	5	0.020735	yes	BRNCHA
chr1_1915143_A_G_b38	RP4-758J18.2	3.232	0.00148	0.068087	3	0.021064	yes	BRNCHA
chr1_1922882_A_G_b38	RP4-758J18.2	3.232	0.00148	0.068087	3	0.021064	yes	BRNCHA
chr1_1925261_C_T_b38	RP4-758J18.2	3.232	0.00148	0.068087	3	0.021064	yes	BRNCHA
chr1_591590_T_C_b38	RP4-758J18.2	3.216	0.00156	0.071738	5	0.022309	yes	BRNCHA
chr1_1871210_G_T_b38	RP4-758J18.2	-3.211	0.00159	-0.068181	3	0.021235	yes	BRNCHA
chr1_1931519_A_G_b38	RP4-758J18.2	3.192	0.00169	0.064142	5	0.020093	yes	BRNCHA
chr1_1960886_T_C_b38	RP4-758J18.2	3.184	0.00173	0.061857	4	0.019426	yes	BRNCHA
chr1_1855245_G_A_b38	RP4-758J18.2	-3.154	0.00191	-0.065649	3	0.020814	yes	BRNCHA
chr1_1855939_G_A_b38	RP4-758J18.2	-3.154	0.00191	-0.065649	3	0.020814	yes	BRNCHA
chr1_1857246_T_TAA_b38	RP4-758J18.2	-3.154	0.00191	-0.065649	3	0.020814	yes	BRNCHA
chr1_1857250_C_G_b38	RP4-758J18.2	-3.154	0.00191	-0.065649	3	0.020814	yes	BRNCHA
chr1_1857305_G_GGGCT_b38	RP4-758J18.2	-3.154	0.00191	-0.065649	3	0.020814	yes	BRNCHA
chr1_1801188_T_C_b38	RP4-758J18.2	-3.131	0.00206	-0.061572	4	0.019668	yes	BRNCHA
chr1_1897985_C_G_b38	RP4-758J18.2	-3.123	0.00211	-0.064382	3	0.020617	yes	BRNCHA
chr1_1962899_A_C_b38	RP4-758J18.2	-3.113	0.00218	-0.064434	3	0.0207	yes	BRNCHA
chr1_1828894_T_TAC_b38	RP4-758J18.2	-3.111	0.00219	-0.045317	40	0.014565	yes	BRNCHA
chr1_1846651_T_G_b38	RP4-758J18.2	-3.109	0.00221	-0.063845	3	0.020536	yes	BRNCHA
chr1_1926870_T_C_b38	RP4-758J18.2	3.098	0.00229	0.044745	34	0.014444	yes	BRNCHA
chr1_1943142_A_G_b38	RP4-758J18.2	3.094	0.00232	0.062674	4	0.020259	yes	BRNCHA
chr1_1883278_C_CA_b38	RP4-758J18.2	-3.079	0.00243	-0.067065	5	0.021784	yes	BRNCHA
chr1_1922670_A_G_b38	RP4-758J18.2	3.071	0.00249	0.045387	35	0.014778	yes	BRNCHA
chr1_1775296_C_T_b38	RP4-758J18.2	-3.062	0.00256	-0.06556	3	0.021409	yes	BRNCHA
chr1_1815255_G_T_b38	RP4-758J18.2	-3.062	0.00256	-0.06556	3	0.021409	yes	BRNCHA
chr1_1968747_T_C_b38	RP4-758J18.2	-3.062	0.00256	-0.06157	4	0.020107	yes	BRNCHA
chr1_1949564_T_TG_b38	RP4-758J18.2	3.057	0.0026	0.061824	5	0.020226	yes	BRNCHA
chr1_1950848_A_G_b38	RP4-758J18.2	3.057	0.0026	0.061824	5	0.020226	yes	BRNCHA
chr1_1951521_C_A_b38	RP4-758J18.2	3.057	0.0026	0.061824	5	0.020226	yes	BRNCHA
chr1_1958353_A_T_b38	RP4-758J18.2	3.052	0.00264	0.060803	6	0.01992	yes	BRNCHA
chr1_1921745_T_C_b38	RP4-758J18.2	3.051	0.00265	0.044894	35	0.014714	yes	BRNCHA
chr1_1918989_A_G_b38	RP4-758J18.2	3.032	0.00282	0.043646	38	0.014396	yes	BRNCHA
chr1_1898043_T_C_b38	RP4-758J18.2	-3.021	0.00292	-0.063796	3	0.02112	yes	BRNCHA
chr1_1898712_C_T_b38	RP4-758J18.2	-3.021	0.00292	-0.063796	3	0.02112	yes	BRNCHA
chr1_1899188_T_A_b38	RP4-758J18.2	-3.021	0.00292	-0.063796	3	0.02112	yes	BRNCHA
chr1_1954783_T_G_b38	RP4-758J18.2	3.007	0.00304	0.057678	7	0.019182	yes	BRNCHA
chr1_1954946_T_C_b38	RP4-758J18.2	3.007	0.00304	0.057678	7	0.019182	yes	BRNCHA
chr1_1880594_A_T_b38	RP4-758J18.2	-3.005	0.00306	-0.05866	5	0.01952	yes	BRNCHA
chr1_1965567_C_T_b38	RP4-758J18.2	-2.965	0.00346	-0.059661	4	0.02012	yes	BRNCHA
chr1_1888382_A_AG_b38	RP4-758J18.2	-2.965	0.00347	-0.069138	3	0.023318	yes	BRNCHA
chr1_1971918_G_C_b38	RP4-758J18.2	-2.962	0.0035	-0.051242	7	0.017302	yes	BRNCHA
chr1_1976644_G_A_b38	RP4-758J18.2	-2.962	0.0035	-0.051242	7	0.017302	yes	BRNCHA
chr1_1775996_G_A_b38	RP4-758J18.2	-2.946	0.00368	-0.061242	3	0.020788	yes	BRNCHA
chr1_1798974_C_T_b38	RP4-758J18.2	-2.946	0.00368	-0.061242	3	0.020788	yes	BRNCHA
chr1_1822247_A_G_b38	RP4-758J18.2	-2.946	0.00368	-0.061242	3	0.020788	yes	BRNCHA
chr1_1837340_C_T_b38	RP4-758J18.2	-2.946	0.00368	-0.061242	3	0.020788	yes	BRNCHA
chr1_1938493_C_CAT_b38	RP4-758J18.2	2.943	0.00371	0.060225	4	0.020464	yes	BRNCHA
chr1_1938771_G_A_b38	RP4-758J18.2	2.943	0.00371	0.060225	4	0.020464	yes	BRNCHA
chr1_1939978_T_C_b38	RP4-758J18.2	2.943	0.00371	0.060225	4	0.020464	yes	BRNCHA
chr1_1943706_C_T_b38	RP4-758J18.2	2.943	0.00371	0.060225	4	0.020464	yes	BRNCHA
chr1_1943828_A_G_b38	RP4-758J18.2	2.943	0.00371	0.060225	4	0.020464	yes	BRNCHA
chr1_1945799_T_G_b38	RP4-758J18.2	2.943	0.00371	0.060225	4	0.020464	yes	BRNCHA
chr1_1794187_C_T_b38	RP4-758J18.2	-2.938	0.00377	-0.061579	3	0.020959	yes	BRNCHA
chr1_1916417_G_T_b38	RP4-758J18.2	2.936	0.00379	0.043358	37	0.014766	yes	BRNCHA
chr1_1957586_A_G_b38	RP4-758J18.2	2.927	0.0039	0.057528	6	0.019656	yes	BRNCHA
chr1_1764023_C_A_b38	RP4-758J18.2	-2.917	0.00401	-0.04298	34	0.014732	yes	BRNCHA
chr1_1914634_G_T_b38	RP4-758J18.2	2.912	0.00408	0.042746	37	0.014679	yes	BRNCHA
chr1_1916670_G_C_b38	RP4-758J18.2	2.912	0.00408	0.042746	37	0.014679	yes	BRNCHA
chr1_1971183_G_A_b38	RP4-758J18.2	-2.912	0.00408	-0.051229	6	0.017595	yes	BRNCHA
chr1_1967961_G_A_b38	RP4-758J18.2	-2.899	0.00425	-0.054471	5	0.018792	yes	BRNCHA
chr1_2284470_A_C_b38	RP4-758J18.2	2.87	0.00464	0.042278	27	0.014733	yes	BRNCHA
chr1_1982325_C_T_b38	RP4-758J18.2	-2.865	0.00471	-0.056703	5	0.019793	yes	BRNCHA
chr1_1951510_A_G_b38	RP4-758J18.2	2.861	0.00476	0.057914	5	0.020241	yes	BRNCHA
chr1_1955580_A_G_b38	RP4-758J18.2	2.847	0.00496	0.055672	6	0.019551	yes	BRNCHA
chr1_1782906_T_G_b38	RP4-758J18.2	-2.842	0.00504	-0.05893	3	0.020736	yes	BRNCHA
chr1_1981563_A_G_b38	RP4-758J18.2	-2.838	0.0051	-0.049355	10	0.01739	yes	BRNCHA
chr1_1971220_C_T_b38	RP4-758J18.2	-2.792	0.00584	-0.049166	6	0.017607	yes	BRNCHA
chr1_1450193_C_T_b38	RP4-758J18.2	2.783	0.00601	0.087446	3	0.031427	yes	BRNCHA
chr1_1881065_G_A_b38	RP4-758J18.2	-2.776	0.00613	-0.056331	4	0.020291	yes	BRNCHA
chr1_1881798_C_T_b38	RP4-758J18.2	-2.776	0.00613	-0.056331	4	0.020291	yes	BRNCHA
chr1_1776772_TAA_T_b38	RP4-758J18.2	2.769	0.00626	0.049125	13	0.017742	yes	BRNCHA
chr1_903551_A_C_b38	RP4-758J18.2	-2.764	0.00634	-0.054469	6	0.019703	yes	BRNCHA
chr1_1934565_G_A_b38	RP4-758J18.2	2.761	0.0064	0.041719	36	0.015108	yes	BRNCHA
chr1_1659940_A_C_b38	RP4-758J18.2	2.76	0.00643	0.051233	7	0.018564	yes	BRNCHA
chr1_1866635_T_TAAA_b38	RP4-758J18.2	2.756	0.00649	0.044227	25	0.016046	yes	BRNCHA
chr1_1945913_T_C_b38	RP4-758J18.2	2.755	0.00651	0.055219	4	0.020042	yes	BRNCHA
chr1_1881428_C_CT_b38	RP4-758J18.2	2.752	0.00657	0.040935	42	0.014875	yes	BRNCHA
chr1_1974351_A_G_b38	RP4-758J18.2	-2.736	0.00689	-0.047148	7	0.017234	yes	BRNCHA
chr1_1955018_A_AGGAAGTGCGGCTCACACC_b38	RP4-758J18.2	-2.734	0.00693	-0.055386	6	0.020258	yes	BRNCHA
chr1_1757074_G_T_b38	RP4-758J18.2	-2.731	0.00699	-0.040358	32	0.014777	yes	BRNCHA
chr1_2211900_C_CTTTT_b38	RP4-758J18.2	2.725	0.00711	0.071451	4	0.02622	yes	BRNCHA
chr1_1865278_A_C_b38	RP4-758J18.2	-2.722	0.00718	-0.039589	38	0.014546	yes	BRNCHA
chr1_1754601_G_T_b38	RP4-758J18.2	-2.722	0.00718	-0.040556	32	0.014902	yes	BRNCHA
chr1_1757725_C_T_b38	RP4-758J18.2	-2.722	0.00718	-0.040556	32	0.014902	yes	BRNCHA
chr1_914948_CA_C_b38	RP4-758J18.2	2.718	0.00727	0.055284	5	0.020343	yes	BRNCHA
chr1_1772160_A_AT_b38	RP4-758J18.2	-2.708	0.00747	-0.054647	3	0.020179	yes	BRNCHA
chr1_2108949_G_A_b38	RP4-758J18.2	2.699	0.00767	0.057884	7	0.02145	yes	BRNCHA
chr1_1882915_C_T_b38	RP4-758J18.2	-2.669	0.00835	-0.055671	3	0.020858	yes	BRNCHA
chr1_1886690_A_C_b38	RP4-758J18.2	-2.669	0.00835	-0.055671	3	0.020858	yes	BRNCHA
chr1_1975657_A_G_b38	RP4-758J18.2	-2.665	0.00844	-0.046153	7	0.017316	yes	BRNCHA
chr1_904947_G_A_b38	RP4-758J18.2	2.659	0.0086	0.051507	5	0.019371	yes	BRNCHA
chr1_1987702_C_T_b38	RP4-758J18.2	-2.649	0.00883	-0.053766	3	0.020293	yes	BRNCHA
chr1_1776772_TA_T_b38	RP4-758J18.2	-3.197	0.00166	-0.062973	5	0.019697	no	BRNCHA
chr1_1844830_C_A_b38	RP4-758J18.2	-3.144	0.00197	-0.045157	41	0.014365	no	BRNCHA
chr1_1848037_C_CTA_b38	RP4-758J18.2	-3.144	0.00197	-0.045157	41	0.014365	no	BRNCHA
chr1_1781909_C_T_b38	RP4-758J18.2	-3.071	0.00249	-0.044393	40	0.014456	no	BRNCHA
chr1_1920497_C_A_b38	RP4-758J18.2	3.037	0.00277	0.059864	5	0.019712	no	BRNCHA
chr1_2108280_G_A_b38	RP4-758J18.2	3.028	0.00285	0.066769	5	0.022048	no	BRNCHA
chr1_1928648_C_T_b38	RP4-758J18.2	3.011	0.00301	0.044595	35	0.014812	no	BRNCHA
chr1_2263866_C_CA_b38	RP4-758J18.2	2.934	0.00381	0.055489	5	0.018911	no	BRNCHA
chr1_1758323_T_C_b38	RP4-758J18.2	-2.919	0.004	-0.041029	41	0.014057	no	BRNCHA
chr1_1935938_T_C_b38	RP4-758J18.2	2.803	0.00565	0.043295	29	0.015445	no	BRNCHA
chr1_1769969_CAAAACA_C_b38	RP4-758J18.2	-2.791	0.00587	-0.041236	35	0.014777	no	BRNCHA
chr1_2109346_A_G_b38	RP4-758J18.2	2.776	0.00613	0.060117	6	0.021655	no	BRNCHA
chr1_2109497_T_C_b38	RP4-758J18.2	2.776	0.00613	0.060117	6	0.021655	no	BRNCHA
chr1_1931580_CA_C_b38	RP4-758J18.2	2.748	0.00666	0.040883	34	0.014879	no	BRNCHA
chr1_1931587_A_G_b38	RP4-758J18.2	2.748	0.00666	0.040883	34	0.014879	no	BRNCHA
chr1_1936627_C_G_b38	RP4-758J18.2	2.717	0.00729	0.040715	34	0.014987	no	BRNCHA
chr1_1050070_G_A_b38	RP4-758J18.2	-2.71	0.00743	-0.040898	43	0.015092	no	BRNCHA
chr1_1933087_C_T_b38	RP4-758J18.2	2.707	0.00749	0.040354	34	0.014908	no	BRNCHA
chr1_1933859_A_G_b38	RP4-758J18.2	2.707	0.00749	0.040354	34	0.014908	no	BRNCHA
chr1_1820337_A_G_b38	RP4-758J18.2	-2.693	0.00781	-0.039132	43	0.014533	no	BRNCHA
chr1_1938332_A_ACT_b38	RP4-758J18.2	2.675	0.0082	0.039825	36	0.014886	no	BRNCHA
chr1_1898648_CACACACATAAGTTGGATAT_C_b38	RP4-758J18.2	-2.651	0.00879	-0.044497	11	0.016783	no	BRNCHA
chr1_897538_T_C_b38	RP4-758J18.2	2.631	0.00932	0.041926	15	0.015938	no	BRNCHA
chr1_1437955_C_G_b38	RP4-758J18.2	-3.955	0.000113	-0.053207	26	0.013452	yes	BRNCTXA
chr1_1434687_C_G_b38	RP4-758J18.2	-3.79	0.000211	-0.065316	7	0.017233	yes	BRNCTXA
chr1_1442793_G_A_b38	RP4-758J18.2	-3.402	0.000842	-0.058461	7	0.017186	yes	BRNCTXA
chr1_1431656_G_A_b38	RP4-758J18.2	-3.281	0.00126	-0.058415	6	0.017802	yes	BRNCTXA
chr1_1432355_G_A_b38	RP4-758J18.2	-3.167	0.00184	-0.052203	11	0.016485	yes	BRNCTXA
chr1_1553018_CA_C_b38	RP4-758J18.2	-3.124	0.00211	-0.05167	8	0.016542	yes	BRNCTXA
chr1_1368177_G_C_b38	RP4-758J18.2	-3.113	0.00218	-0.05854	4	0.018803	yes	BRNCTXA
chr1_1400756_GGA_G_b38	RP4-758J18.2	-3.113	0.00219	-0.058146	4	0.018678	yes	BRNCTXA
chr1_1401954_G_T_b38	RP4-758J18.2	-3.113	0.00219	-0.058146	4	0.018678	yes	BRNCTXA
chr1_1403593_A_G_b38	RP4-758J18.2	-3.113	0.00219	-0.058146	4	0.018678	yes	BRNCTXA
chr1_1407565_C_A_b38	RP4-758J18.2	-3.113	0.00219	-0.058146	4	0.018678	yes	BRNCTXA
chr1_921056_TG_T_b38	RP4-758J18.2	3.109	0.00221	0.063309	3	0.020361	yes	BRNCTXA
chr1_1439805_G_C_b38	RP4-758J18.2	-2.976	0.00336	-0.049935	12	0.016779	yes	BRNCTXA
chr1_1369821_C_T_b38	RP4-758J18.2	-2.955	0.00359	-0.055946	3	0.018935	yes	BRNCTXA
chr1_1702383_T_C_b38	RP4-758J18.2	2.951	0.00363	0.050611	8	0.017149	yes	BRNCTXA
chr1_1369282_G_A_b38	RP4-758J18.2	-2.944	0.00371	-0.055449	3	0.018832	yes	BRNCTXA
chr1_1369320_GT_G_b38	RP4-758J18.2	-2.944	0.00371	-0.055449	3	0.018832	yes	BRNCTXA
chr1_1369407_G_A_b38	RP4-758J18.2	-2.944	0.00371	-0.055449	3	0.018832	yes	BRNCTXA
chr1_1369476_CTT_C_b38	RP4-758J18.2	-2.944	0.00371	-0.055449	3	0.018832	yes	BRNCTXA
chr1_1369556_C_G_b38	RP4-758J18.2	-2.944	0.00371	-0.055449	3	0.018832	yes	BRNCTXA
chr1_1369627_T_C_b38	RP4-758J18.2	-2.944	0.00371	-0.055449	3	0.018832	yes	BRNCTXA
chr1_1369686_T_C_b38	RP4-758J18.2	-2.944	0.00371	-0.055449	3	0.018832	yes	BRNCTXA
chr1_1369716_G_C_b38	RP4-758J18.2	-2.944	0.00371	-0.055449	3	0.018832	yes	BRNCTXA
chr1_1369741_C_T_b38	RP4-758J18.2	-2.944	0.00371	-0.055449	3	0.018832	yes	BRNCTXA
chr1_1411323_A_C_b38	RP4-758J18.2	-2.942	0.00373	-0.047112	25	0.016013	yes	BRNCTXA
chr1_1736801_CA_C_b38	RP4-758J18.2	2.909	0.00413	0.047058	27	0.016175	yes	BRNCTXA
chr1_1014733_GAAGT_G_b38	RP4-758J18.2	-2.908	0.00415	-0.044373	38	0.015261	yes	BRNCTXA
chr1_1431813_G_T_b38	RP4-758J18.2	-2.888	0.0044	-0.050205	7	0.017382	yes	BRNCTXA
chr1_1382893_G_A_b38	RP4-758J18.2	-2.875	0.00458	-0.054425	4	0.01893	yes	BRNCTXA
chr1_1383743_T_C_b38	RP4-758J18.2	-2.874	0.00459	-0.054043	4	0.018806	yes	BRNCTXA
chr1_1384546_C_T_b38	RP4-758J18.2	-2.874	0.00459	-0.054043	4	0.018806	yes	BRNCTXA
chr1_1398218_C_A_b38	RP4-758J18.2	-2.874	0.00459	-0.054043	4	0.018806	yes	BRNCTXA
chr1_1380867_A_G_b38	RP4-758J18.2	-2.861	0.00478	-0.05382	4	0.018814	yes	BRNCTXA
chr1_1367919_C_T_b38	RP4-758J18.2	-2.836	0.00515	-0.053773	3	0.018963	yes	BRNCTXA
chr1_1367951_C_T_b38	RP4-758J18.2	-2.836	0.00515	-0.053773	3	0.018963	yes	BRNCTXA
chr1_1367965_A_G_b38	RP4-758J18.2	-2.836	0.00515	-0.053773	3	0.018963	yes	BRNCTXA
chr1_1367970_T_G_b38	RP4-758J18.2	-2.836	0.00515	-0.053773	3	0.018963	yes	BRNCTXA
chr1_1367994_C_A_b38	RP4-758J18.2	-2.836	0.00515	-0.053773	3	0.018963	yes	BRNCTXA
chr1_1368297_C_T_b38	RP4-758J18.2	-2.836	0.00515	-0.053773	3	0.018963	yes	BRNCTXA
chr1_1368514_C_G_b38	RP4-758J18.2	-2.836	0.00515	-0.053773	3	0.018963	yes	BRNCTXA
chr1_1368991_C_T_b38	RP4-758J18.2	-2.836	0.00515	-0.053773	3	0.018963	yes	BRNCTXA
chr1_1369009_T_C_b38	RP4-758J18.2	-2.836	0.00515	-0.053773	3	0.018963	yes	BRNCTXA
chr1_1369012_C_CG_b38	RP4-758J18.2	-2.836	0.00515	-0.053773	3	0.018963	yes	BRNCTXA
chr1_1400410_A_G_b38	RP4-758J18.2	-2.828	0.00527	-0.044841	20	0.015855	yes	BRNCTXA
chr1_1368763_G_A_b38	RP4-758J18.2	-2.818	0.00542	-0.053251	3	0.018894	yes	BRNCTXA
chr1_2215527_T_C_b38	RP4-758J18.2	2.814	0.00549	0.050527	8	0.017955	yes	BRNCTXA
chr1_1978429_G_A_b38	RP4-758J18.2	2.807	0.0056	0.048366	12	0.017227	yes	BRNCTXA
chr1_1983507_C_T_b38	RP4-758J18.2	2.807	0.0056	0.048366	12	0.017227	yes	BRNCTXA
chr1_1370430_T_C_b38	RP4-758J18.2	-2.805	0.00564	-0.054099	3	0.019288	yes	BRNCTXA
chr1_1370532_C_T_b38	RP4-758J18.2	-2.805	0.00564	-0.054099	3	0.019288	yes	BRNCTXA
chr1_1370584_G_C_b38	RP4-758J18.2	-2.805	0.00564	-0.054099	3	0.019288	yes	BRNCTXA
chr1_1402457_A_G_b38	RP4-758J18.2	-2.765	0.00635	-0.044127	24	0.015962	yes	BRNCTXA
chr1_1791172_A_AT_b38	RP4-758J18.2	2.763	0.00638	0.051354	10	0.018584	yes	BRNCTXA
chr1_2222256_T_C_b38	RP4-758J18.2	2.724	0.00716	0.047702	9	0.017514	yes	BRNCTXA
chr1_2222257_G_C_b38	RP4-758J18.2	2.724	0.00716	0.047702	9	0.017514	yes	BRNCTXA
chr1_2222258_T_C_b38	RP4-758J18.2	2.724	0.00716	0.047702	9	0.017514	yes	BRNCTXA
chr1_1976855_C_CTT_b38	RP4-758J18.2	2.715	0.00734	0.048746	9	0.017954	yes	BRNCTXA
chr1_1384749_C_G_b38	RP4-758J18.2	2.708	0.0075	0.043275	21	0.015983	yes	BRNCTXA
chr1_1387763_CCT_C_b38	RP4-758J18.2	2.708	0.0075	0.043275	21	0.015983	yes	BRNCTXA
chr1_1388944_G_A_b38	RP4-758J18.2	2.708	0.0075	0.043275	21	0.015983	yes	BRNCTXA
chr1_1435945_C_CCGGGCGGGGGCG_b38	RP4-758J18.2	-2.704	0.00757	-0.04694	8	0.017357	yes	BRNCTXA
chr1_917859_A_G_b38	RP4-758J18.2	2.697	0.00774	0.053276	4	0.019757	yes	BRNCTXA
chr1_2221645_G_A_b38	RP4-758J18.2	2.69	0.00789	0.047453	9	0.017641	yes	BRNCTXA
chr1_2226499_CG_C_b38	RP4-758J18.2	2.69	0.00789	0.047453	9	0.017641	yes	BRNCTXA
chr1_2230051_C_T_b38	RP4-758J18.2	2.69	0.00789	0.047453	9	0.017641	yes	BRNCTXA
chr1_917284_C_T_b38	RP4-758J18.2	2.667	0.00842	0.051819	4	0.01943	yes	BRNCTXA
chr1_1015903_C_T_b38	RP4-758J18.2	-2.657	0.00867	-0.041864	38	0.015758	yes	BRNCTXA
chr1_1015915_C_T_b38	RP4-758J18.2	-2.657	0.00867	-0.041864	38	0.015758	yes	BRNCTXA
chr1_1378204_G_C_b38	RP4-758J18.2	2.619	0.00965	0.041378	22	0.015799	yes	BRNCTXA
chr1_1084906_A_C_b38	RP4-758J18.2	2.616	0.00972	0.106597	3	0.040746	yes	BRNCTXA
chr1_920719_T_G_b38	RP4-758J18.2	2.614	0.00978	0.039918	23	0.015271	yes	BRNCTXA
chr1_920728_A_G_b38	RP4-758J18.2	2.614	0.00978	0.039918	23	0.015271	yes	BRNCTXA
chr1_1819705_AT_A_b38	RP4-758J18.2	3.991	9.89e-05	0.082239	3	0.020604	no	BRNCTXA
chr1_1441187_A_G_b38	RP4-758J18.2	-3.555	0.000493	-0.056308	20	0.015837	no	BRNCTXA
chr1_1448915_G_A_b38	RP4-758J18.2	-3.507	0.000586	-0.054605	18	0.015572	no	BRNCTXA
chr1_1437993_G_A_b38	RP4-758J18.2	-3.428	0.000769	-0.054766	11	0.015977	no	BRNCTXA
chr1_1436388_CA_C_b38	RP4-758J18.2	-3.416	0.000802	-0.0535	18	0.015662	no	BRNCTXA
chr1_932255_C_T_b38	RP4-758J18.2	3.272	0.0013	0.063929	4	0.019538	no	BRNCTXA
chr1_1449009_A_T_b38	RP4-758J18.2	-3.23	0.0015	-0.056292	14	0.017429	no	BRNCTXA
chr1_924305_G_A_b38	RP4-758J18.2	3.063	0.00256	0.053995	9	0.017626	no	BRNCTXA
chr1_1019790_G_A_b38	RP4-758J18.2	3.019	0.00294	0.08157	3	0.027016	no	BRNCTXA
chr1_1739883_C_T_b38	RP4-758J18.2	2.97	0.00343	0.03909	32	0.013163	no	BRNCTXA
chr1_929839_G_A_b38	RP4-758J18.2	2.92	0.00399	0.057546	4	0.019707	no	BRNCTXA
chr1_1426253_G_A_b38	RP4-758J18.2	-2.897	0.00428	-0.052524	5	0.018131	no	BRNCTXA
chr1_981935_G_A_b38	RP4-758J18.2	2.861	0.00477	0.055747	5	0.019485	no	BRNCTXA
chr1_791549_G_GGAATGGAATC_b38	RP4-758J18.2	-2.849	0.00495	-0.044392	14	0.015583	no	BRNCTXA
chr1_1445187_T_G_b38	RP4-758J18.2	-2.836	0.00514	-0.042618	28	0.015027	no	BRNCTXA
chr1_1445240_A_G_b38	RP4-758J18.2	-2.836	0.00514	-0.042618	28	0.015027	no	BRNCTXA
chr1_1452346_A_G_b38	RP4-758J18.2	-2.802	0.00569	-0.05099	7	0.018199	no	BRNCTXA
chr1_1749826_A_G_b38	RP4-758J18.2	2.797	0.00578	0.036843	48	0.013174	no	BRNCTXA
chr1_1453961_C_T_b38	RP4-758J18.2	-2.796	0.0058	-0.053545	5	0.019153	no	BRNCTXA
chr1_1774721_A_G_b38	RP4-758J18.2	2.779	0.0061	0.045741	12	0.016463	no	BRNCTXA
chr1_1773729_T_A_b38	RP4-758J18.2	2.77	0.00626	0.044006	17	0.015889	no	BRNCTXA
chr1_1452384_G_A_b38	RP4-758J18.2	-2.769	0.00627	-0.050957	7	0.018401	no	BRNCTXA
chr1_1440834_C_G_b38	RP4-758J18.2	-2.763	0.00638	-0.042431	30	0.015356	no	BRNCTXA
chr1_1778596_C_T_b38	RP4-758J18.2	2.748	0.00667	0.044472	15	0.016185	no	BRNCTXA
chr1_1394041_G_A_b38	RP4-758J18.2	-2.725	0.00713	-0.053233	3	0.019534	no	BRNCTXA
chr1_1000814_A_G_b38	RP4-758J18.2	-2.724	0.00716	-0.04903	12	0.018002	no	BRNCTXA
chr1_1453870_A_C_b38	RP4-758J18.2	-2.72	0.00722	-0.052134	5	0.019164	no	BRNCTXA
chr1_893789_AAAAAAAAAAAAAATATATATATATATATATATATAT_A_b38	RP4-758J18.2	2.718	0.00726	0.061571	4	0.022649	no	BRNCTXA
chr1_1450636_A_G_b38	RP4-758J18.2	-2.716	0.00731	-0.049432	6	0.018199	no	BRNCTXA
chr1_1440430_C_G_b38	RP4-758J18.2	-2.705	0.00756	-0.04114	23	0.01521	no	BRNCTXA
chr1_1443457_T_C_b38	RP4-758J18.2	-2.703	0.00759	-0.041533	30	0.015364	no	BRNCTXA
chr1_1456829_G_C_b38	RP4-758J18.2	-2.702	0.00761	-0.048126	17	0.017811	no	BRNCTXA
chr1_924533_A_G_b38	RP4-758J18.2	2.699	0.00769	0.102848	4	0.038112	no	BRNCTXA
chr1_1664417_G_A_b38	RP4-758J18.2	-2.696	0.00776	-0.046041	10	0.01708	no	BRNCTXA
chr1_1773717_T_A_b38	RP4-758J18.2	2.669	0.00837	0.039007	25	0.014614	no	BRNCTXA
chr1_917378_G_C_b38	RP4-758J18.2	2.668	0.00839	0.052121	4	0.019535	no	BRNCTXA
chr1_1451787_A_C_b38	RP4-758J18.2	-2.666	0.00844	-0.043568	19	0.01634	no	BRNCTXA
chr1_1979469_AAC_A_b38	RP4-758J18.2	2.661	0.00858	0.049329	7	0.018541	no	BRNCTXA
chr1_1000079_A_G_b38	RP4-758J18.2	-2.66	0.00858	-0.048348	16	0.018173	no	BRNCTXA
chr1_1773356_TC_T_b38	RP4-758J18.2	2.658	0.00863	0.04291	15	0.016141	no	BRNCTXA
chr1_911484_G_C_b38	RP4-758J18.2	2.649	0.00886	0.04904	8	0.018512	no	BRNCTXA
chr1_1000112_G_T_b38	RP4-758J18.2	-2.627	0.00942	-0.047472	16	0.018068	no	BRNCTXA
chr1_922660_C_A_b38	RP4-758J18.2	2.626	0.00946	0.051143	3	0.019477	no	BRNCTXA
chr1_922671_C_T_b38	RP4-758J18.2	2.626	0.00946	0.051143	3	0.019477	no	BRNCTXA
chr1_1750280_A_G_b38	RP4-758J18.2	2.625	0.00949	0.036502	46	0.013908	no	BRNCTXA
chr1_1265603_T_TTGTG_b38	RP4-758J18.2	3.975	0.000115	0.09856	3	0.024797	yes	BRNCTXB
chr1_2120839_CT_C_b38	RP4-758J18.2	3.626	0.000407	0.081713	9	0.022533	yes	BRNCTXB
chr1_1049114_GC_G_b38	RP4-758J18.2	-3.159	0.00196	-0.057089	40	0.018072	yes	BRNCTXB
chr1_1982325_C_T_b38	RP4-758J18.2	-3.047	0.00278	-0.076113	4	0.024979	yes	BRNCTXB
chr1_2047418_A_G_b38	RP4-758J18.2	2.927	0.00402	0.058169	33	0.019872	yes	BRNCTXB
chr1_2051703_C_T_b38	RP4-758J18.2	2.881	0.00462	0.057703	18	0.020028	yes	BRNCTXB
chr1_2061538_G_T_b38	RP4-758J18.2	-2.85	0.00506	-0.070369	4	0.024687	yes	BRNCTXB
chr1_2051982_T_C_b38	RP4-758J18.2	2.771	0.00639	0.0566	23	0.020429	yes	BRNCTXB
chr1_2051689_A_T_b38	RP4-758J18.2	2.684	0.00819	0.053976	21	0.020109	yes	BRNCTXB
chr1_1279441_C_T_b38	RP4-758J18.2	-2.676	0.00838	-0.090429	3	0.033794	yes	BRNCTXB
chr1_2060286_A_G_b38	RP4-758J18.2	2.646	0.00911	0.058593	11	0.022141	yes	BRNCTXB
chr1_1989803_A_G_b38	RP4-758J18.2	-3.111	0.00228	-0.06375	22	0.020489	no	BRNCTXB
chr1_1591703_T_C_b38	RP4-758J18.2	-2.767	0.00646	-0.050705	27	0.018326	no	BRNCTXB
chr1_1459632_T_C_b38	RP4-758J18.2	-2.75	0.00678	-0.094153	10	0.034237	no	BRNCTXB
chr1_1587082_G_A_b38	RP4-758J18.2	2.732	0.00714	0.075569	3	0.02766	no	BRNCTXB
chr1_2039950_G_C_b38	RP4-758J18.2	2.723	0.00733	0.04718	37	0.017325	no	BRNCTXB
chr1_1468856_C_T_b38	RP4-758J18.2	-2.664	0.00868	-0.078761	6	0.029569	no	BRNCTXB
chr1_1459662_C_T_b38	RP4-758J18.2	-2.623	0.00973	-0.09497	10	0.036207	no	BRNCTXB
chr1_982112_C_T_b38	RP4-758J18.2	3.317	0.00119	0.086528	3	0.026085	yes	BRNHPP
chr1_982890_C_T_b38	RP4-758J18.2	3.317	0.00119	0.086528	3	0.026085	yes	BRNHPP
chr1_983237_G_A_b38	RP4-758J18.2	3.317	0.00119	0.086528	3	0.026085	yes	BRNHPP
chr1_1020847_C_CGGG_b38	RP4-758J18.2	-3.249	0.00149	-0.064726	22	0.019923	yes	BRNHPP
chr1_1424819_C_T_b38	RP4-758J18.2	-3.183	0.00184	-0.131046	3	0.041166	yes	BRNHPP
chr1_971790_AG_A_b38	RP4-758J18.2	3.126	0.00221	0.057528	22	0.018402	yes	BRNHPP
chr1_979560_T_C_b38	RP4-758J18.2	-3.086	0.0025	-0.057886	33	0.018757	yes	BRNHPP
chr1_981454_G_A_b38	RP4-758J18.2	-3.081	0.00254	-0.057359	30	0.018617	yes	BRNHPP
chr1_983193_A_G_b38	RP4-758J18.2	-3.081	0.00254	-0.057359	30	0.018617	yes	BRNHPP
chr1_934909_AGGCGGCTGCGTTACAGGTGGGCGGGGGG_A_b38	RP4-758J18.2	3.024	0.00303	0.075137	10	0.024844	yes	BRNHPP
chr1_1714635_A_G_b38	RP4-758J18.2	-2.984	0.00342	-0.075448	4	0.025282	yes	BRNHPP
chr1_976536_C_T_b38	RP4-758J18.2	2.98	0.00347	0.077376	3	0.025963	yes	BRNHPP
chr1_978230_G_A_b38	RP4-758J18.2	2.98	0.00347	0.077376	3	0.025963	yes	BRNHPP
chr1_981935_G_A_b38	RP4-758J18.2	2.973	0.00355	0.074212	4	0.024965	yes	BRNHPP
chr1_965666_ACC_A_b38	RP4-758J18.2	2.972	0.00356	0.062542	8	0.021047	yes	BRNHPP
chr1_945259_TC_T_b38	RP4-758J18.2	2.969	0.00359	0.061758	8	0.020804	yes	BRNHPP
chr1_1714638_G_T_b38	RP4-758J18.2	-2.942	0.00389	-0.077516	3	0.026344	yes	BRNHPP
chr1_922660_C_A_b38	RP4-758J18.2	2.922	0.00413	0.070512	3	0.02413	yes	BRNHPP
chr1_922671_C_T_b38	RP4-758J18.2	2.922	0.00413	0.070512	3	0.02413	yes	BRNHPP
chr1_979472_G_C_b38	RP4-758J18.2	-2.891	0.00454	-0.052753	33	0.018249	yes	BRNHPP
chr1_924305_G_A_b38	RP4-758J18.2	2.887	0.00459	0.063252	8	0.021912	yes	BRNHPP
chr1_981282_A_C_b38	RP4-758J18.2	2.884	0.00463	0.075487	3	0.026175	yes	BRNHPP
chr1_923311_TG_T_b38	RP4-758J18.2	-2.845	0.0052	-0.063458	6	0.022305	yes	BRNHPP
chr1_923421_A_G_b38	RP4-758J18.2	-2.845	0.0052	-0.063458	6	0.022305	yes	BRNHPP
chr1_960891_C_T_b38	RP4-758J18.2	-2.753	0.00679	-0.052482	31	0.019064	yes	BRNHPP
chr1_978953_C_G_b38	RP4-758J18.2	-2.75	0.00684	-0.050191	29	0.018248	yes	BRNHPP
chr1_973929_T_C_b38	RP4-758J18.2	2.732	0.00721	0.063538	7	0.023257	yes	BRNHPP
chr1_975555_G_A_b38	RP4-758J18.2	2.726	0.00735	0.062696	7	0.023004	yes	BRNHPP
chr1_925308_G_A_b38	RP4-758J18.2	-2.701	0.00788	-0.058611	7	0.021699	yes	BRNHPP
chr1_927486_C_T_b38	RP4-758J18.2	-2.694	0.00804	-0.061658	6	0.022887	yes	BRNHPP
chr1_954724_G_A_b38	RP4-758J18.2	2.637	0.00943	0.056818	7	0.021545	yes	BRNHPP
chr1_969663_CAT_C_b38	RP4-758J18.2	2.636	0.00945	0.055466	10	0.02104	yes	BRNHPP
chr1_928622_G_C_b38	RP4-758J18.2	3.198	0.00176	0.077867	3	0.024352	no	BRNHPP
chr1_1500729_G_A_b38	RP4-758J18.2	-3.157	0.002	-0.109202	10	0.034587	no	BRNHPP
chr1_660993_T_C_b38	RP4-758J18.2	-3.152	0.00203	-0.137025	3	0.043466	no	BRNHPP
chr1_1527386_C_T_b38	RP4-758J18.2	-3.107	0.00234	-0.111355	7	0.035836	no	BRNHPP
chr1_983004_G_T_b38	RP4-758J18.2	-3.07	0.00263	-0.057353	34	0.018684	no	BRNHPP
chr1_1357046_C_G_b38	RP4-758J18.2	3.049	0.0028	0.10207	7	0.033473	no	BRNHPP
chr1_1357369_C_T_b38	RP4-758J18.2	3.049	0.0028	0.10207	7	0.033473	no	BRNHPP
chr1_1359943_G_A_b38	RP4-758J18.2	3.049	0.0028	0.10207	7	0.033473	no	BRNHPP
chr1_1360023_T_C_b38	RP4-758J18.2	3.049	0.0028	0.10207	7	0.033473	no	BRNHPP
chr1_978509_G_A_b38	RP4-758J18.2	-2.955	0.00374	-0.053565	32	0.018128	no	BRNHPP
chr1_929839_G_A_b38	RP4-758J18.2	2.953	0.00376	0.069804	4	0.023637	no	BRNHPP
chr1_932255_C_T_b38	RP4-758J18.2	2.953	0.00376	0.069804	4	0.023637	no	BRNHPP
chr1_1022518_G_T_b38	RP4-758J18.2	2.921	0.00415	0.056424	18	0.019317	no	BRNHPP
chr1_1002415_C_CATT_b38	RP4-758J18.2	2.92	0.00416	0.11117	3	0.038074	no	BRNHPP
chr1_931558_G_A_b38	RP4-758J18.2	2.879	0.0047	0.067088	4	0.023301	no	BRNHPP
chr1_1358907_C_A_b38	RP4-758J18.2	2.863	0.00493	0.096185	7	0.033596	no	BRNHPP
chr1_2109346_A_G_b38	RP4-758J18.2	2.86	0.00498	0.082858	4	0.028975	no	BRNHPP
chr1_2109497_T_C_b38	RP4-758J18.2	2.86	0.00498	0.082858	4	0.028975	no	BRNHPP
chr1_1020681_A_AG_b38	RP4-758J18.2	2.829	0.00546	0.057203	14	0.020224	no	BRNHPP
chr1_1020697_C_T_b38	RP4-758J18.2	2.829	0.00546	0.057203	14	0.020224	no	BRNHPP
chr1_2108949_G_A_b38	RP4-758J18.2	2.813	0.00571	0.077399	5	0.027517	no	BRNHPP
chr1_1021740_G_C_b38	RP4-758J18.2	2.806	0.00583	0.055381	16	0.019738	no	BRNHPP
chr1_2109324_G_A_b38	RP4-758J18.2	2.788	0.00614	0.075302	6	0.02701	no	BRNHPP
chr1_2109338_C_T_b38	RP4-758J18.2	2.788	0.00614	0.075302	6	0.02701	no	BRNHPP
chr1_2108657_T_C_b38	RP4-758J18.2	2.785	0.00619	0.078091	4	0.028037	no	BRNHPP
chr1_1020217_G_T_b38	RP4-758J18.2	2.784	0.00622	0.055273	16	0.019857	no	BRNHPP
chr1_2107797_G_T_b38	RP4-758J18.2	2.754	0.00677	0.076475	5	0.027769	no	BRNHPP
chr1_973443_G_A_b38	RP4-758J18.2	2.747	0.00691	0.063673	7	0.023178	no	BRNHPP
chr1_2325110_T_TTCCC_b38	RP4-758J18.2	-2.746	0.00693	-0.10696	3	0.038953	no	BRNHPP
chr1_1018652_C_G_b38	RP4-758J18.2	2.727	0.00731	0.05423	16	0.019884	no	BRNHPP
chr1_1018754_G_A_b38	RP4-758J18.2	2.727	0.00731	0.05423	16	0.019884	no	BRNHPP
chr1_940390_A_G_b38	RP4-758J18.2	-2.723	0.0074	-0.049356	33	0.018125	no	BRNHPP
chr1_1008307_G_C_b38	RP4-758J18.2	2.722	0.00742	0.05283	21	0.019407	no	BRNHPP
chr1_1009184_T_C_b38	RP4-758J18.2	2.722	0.00742	0.05283	21	0.019407	no	BRNHPP
chr1_939779_AGCCAGTGGACGCCGACCT_A_b38	RP4-758J18.2	-2.714	0.0076	-0.04898	26	0.01805	no	BRNHPP
chr1_2288000_T_G_b38	RP4-758J18.2	2.712	0.00763	0.064875	5	0.023918	no	BRNHPP
chr1_1022868_A_G_b38	RP4-758J18.2	2.701	0.00787	0.051362	20	0.019013	no	BRNHPP
chr1_1359138_C_T_b38	RP4-758J18.2	2.669	0.00863	0.088725	8	0.033242	no	BRNHPP
chr1_969750_ATG_A_b38	RP4-758J18.2	-2.666	0.0087	-0.047138	38	0.017681	no	BRNHPP
chr1_975014_C_T_b38	RP4-758J18.2	2.662	0.0088	0.050896	18	0.019119	no	BRNHPP
chr1_1027226_G_A_b38	RP4-758J18.2	-2.646	0.00921	-0.0483	38	0.018256	no	BRNHPP
chr1_1523187_A_G_b38	RP4-758J18.2	-2.645	0.00922	-0.095082	9	0.035947	no	BRNHPP
chr1_1479205_A_C_b38	RP4-758J18.2	-2.629	0.00965	-0.06817	9	0.025933	no	BRNHPP
chr1_2210401_C_A_b38	RP4-758J18.2	-2.622	0.00984	-0.076719	4	0.02926	no	BRNHPP
chr1_2288174_A_T_b38	RP4-758J18.2	-2.856	0.005	-0.090971	4	0.031854	yes	BRNHPT
chr1_1176929_T_C_b38	RP4-758J18.2	-2.701	0.00784	-0.064824	9	0.023999	yes	BRNHPT
chr1_981935_G_A_b38	RP4-758J18.2	-2.67	0.00857	-0.07651	5	0.028661	yes	BRNHPT
chr1_1169858_T_C_b38	RP4-758J18.2	2.624	0.00975	0.056417	22	0.021505	yes	BRNHPT
chr1_971790_AG_A_b38	RP4-758J18.2	-3.87	0.000172	-0.07972	23	0.020601	no	BRNHPT
chr1_2181138_C_A_b38	RP4-758J18.2	3.205	0.0017	0.070019	20	0.021848	no	BRNHPT
chr1_2385630_A_C_b38	RP4-758J18.2	2.979	0.00346	0.063236	21	0.021231	no	BRNHPT
chr1_866577_CCTGCACTCACATCCCTGACGTCCTCCCGTGCCCTCACGTGGTCCTCCCT_C_b38	RP4-758J18.2	2.973	0.00352	0.059074	26	0.019872	no	BRNHPT
chr1_1048767_CAAAAAAAAAAA_C_b38	RP4-758J18.2	2.948	0.00379	0.068257	32	0.02315	no	BRNHPT
chr1_1661169_C_A_b38	RP4-758J18.2	-2.939	0.00391	-0.071718	12	0.024406	no	BRNHPT
chr1_2383024_G_T_b38	RP4-758J18.2	2.906	0.00431	0.060898	25	0.020958	no	BRNHPT
chr1_2383716_CA_C_b38	RP4-758J18.2	2.906	0.00431	0.060898	25	0.020958	no	BRNHPT
chr1_2285572_G_GTT_b38	RP4-758J18.2	2.852	0.00506	0.088207	4	0.030926	no	BRNHPT
chr1_2377643_T_G_b38	RP4-758J18.2	2.846	0.00516	0.059333	37	0.020851	no	BRNHPT
chr1_2186496_G_GC_b38	RP4-758J18.2	2.808	0.00576	0.060622	18	0.021588	no	BRNHPT
chr1_1653319_A_G_b38	RP4-758J18.2	-2.806	0.00579	-0.068578	12	0.024438	no	BRNHPT
chr1_2224430_C_T_b38	RP4-758J18.2	2.803	0.00584	0.083538	4	0.029803	no	BRNHPT
chr1_2181226_G_A_b38	RP4-758J18.2	2.745	0.00692	0.059784	21	0.02178	no	BRNHPT
chr1_976215_A_G_b38	RP4-758J18.2	2.744	0.00694	0.073358	8	0.026735	no	BRNHPT
chr1_1675132_A_G_b38	RP4-758J18.2	-2.668	0.00861	-0.064622	22	0.02422	no	BRNHPT
chr1_2145689_A_G_b38	RP4-758J18.2	2.665	0.00869	0.057716	23	0.021659	no	BRNHPT
chr1_2186506_G_C_b38	RP4-758J18.2	2.661	0.00879	0.056624	23	0.021281	no	BRNHPT
chr1_2144131_T_C_b38	RP4-758J18.2	2.644	0.00921	0.057293	23	0.021668	no	BRNHPT
chr1_2146433_A_G_b38	RP4-758J18.2	2.644	0.00921	0.057293	23	0.021668	no	BRNHPT
chr1_2151050_G_A_b38	RP4-758J18.2	2.644	0.00921	0.057293	23	0.021668	no	BRNHPT
chr1_2151163_A_G_b38	RP4-758J18.2	2.644	0.00921	0.057293	23	0.021668	no	BRNHPT
chr1_2152098_G_C_b38	RP4-758J18.2	2.644	0.00921	0.057293	23	0.021668	no	BRNHPT
chr1_2153594_A_G_b38	RP4-758J18.2	2.644	0.00921	0.057293	23	0.021668	no	BRNHPT
chr1_2137041_C_T_b38	RP4-758J18.2	-2.635	0.00944	-0.05813	22	0.022059	no	BRNHPT
chr1_1056601_A_ACG_b38	RP4-758J18.2	2.621	0.00983	0.056841	27	0.02169	no	BRNHPT
chr1_1676287_C_T_b38	RP4-758J18.2	2.619	0.00989	0.076436	5	0.029189	no	BRNHPT
chr1_650815_G_T_b38	RP4-758J18.2	2.96	0.00354	0.118055	5	0.039885	yes	BRNNCC
chr1_1855158_CA_C_b38	RP4-758J18.2	2.904	0.0042	0.061961	7	0.021335	yes	BRNNCC
chr1_2105944_T_G_b38	RP4-758J18.2	2.847	0.00499	0.045091	29	0.01584	yes	BRNNCC
chr1_2282992_C_T_b38	RP4-758J18.2	2.822	0.00538	0.048312	22	0.01712	yes	BRNNCC
chr1_2344761_T_C_b38	RP4-758J18.2	-2.741	0.00681	-0.054832	9	0.020003	yes	BRNNCC
chr1_2289210_C_T_b38	RP4-758J18.2	-2.73	0.00704	-0.043817	55	0.016052	yes	BRNNCC
chr1_2308944_C_T_b38	RP4-758J18.2	-2.709	0.00748	-0.070721	3	0.026108	yes	BRNNCC
chr1_590378_T_C_b38	RP4-758J18.2	2.629	0.0094	0.071214	9	0.02709	yes	BRNNCC
chr1_1679100_A_G_b38	RP4-758J18.2	3.709	0.000286	0.05831	40	0.015722	no	BRNNCC
chr1_635258_T_C_b38	RP4-758J18.2	3.013	0.003	0.077805	4	0.025821	no	BRNNCC
chr1_591460_T_C_b38	RP4-758J18.2	3.013	0.003	0.119996	4	0.039825	no	BRNNCC
chr1_2284929_T_G_b38	RP4-758J18.2	2.972	0.00342	0.045304	43	0.015246	no	BRNNCC
chr1_1819705_AT_A_b38	RP4-758J18.2	2.885	0.00445	0.075995	4	0.026343	no	BRNNCC
chr1_629218_A_G_b38	RP4-758J18.2	2.853	0.0049	0.13696	3	0.048005	no	BRNNCC
chr1_1707623_T_C_b38	RP4-758J18.2	-2.84	0.00509	-0.03755	43	0.013222	no	BRNNCC
chr1_2304223_G_A_b38	RP4-758J18.2	-2.763	0.00639	-0.064541	4	0.023358	no	BRNNCC
chr1_1809189_AT_A_b38	RP4-758J18.2	2.736	0.00691	0.060541	32	0.022126	no	BRNNCC
chr1_632403_T_C_b38	RP4-758J18.2	2.694	0.0078	0.101551	4	0.037693	no	BRNNCC
chr1_910698_C_T_b38	RP4-758J18.2	2.68	0.00812	0.05786	6	0.021588	no	BRNNCC
chr1_911484_G_C_b38	RP4-758J18.2	2.675	0.00824	0.05526	8	0.020656	no	BRNNCC
chr1_2340564_G_A_b38	RP4-758J18.2	2.66	0.0086	0.047135	13	0.017719	no	BRNNCC
chr1_2128619_C_T_b38	RP4-758J18.2	2.66	0.00862	0.046531	18	0.017496	no	BRNNCC
chr1_917378_G_C_b38	RP4-758J18.2	2.641	0.00908	0.056398	6	0.021356	no	BRNNCC
chr1_912710_G_A_b38	RP4-758J18.2	2.619	0.00967	0.055013	6	0.021007	no	BRNNCC
chr1_913358_C_T_b38	RP4-758J18.2	2.619	0.00967	0.055013	6	0.021007	no	BRNNCC
chr1_914743_C_T_b38	RP4-758J18.2	2.619	0.00967	0.055013	6	0.021007	no	BRNNCC
chr1_1302795_T_TC_b38	RP4-758J18.2	-2.617	0.00972	-0.048206	27	0.018422	no	BRNNCC
chr1_911484_G_C_b38	RP4-758J18.2	3.584	0.000478	0.088591	8	0.024717	yes	BRNPTM
chr1_590378_T_C_b38	RP4-758J18.2	3.566	0.000509	0.113133	9	0.031724	yes	BRNPTM
chr1_911428_C_T_b38	RP4-758J18.2	3.321	0.00117	0.081981	9	0.024688	yes	BRNPTM
chr1_922660_C_A_b38	RP4-758J18.2	3.313	0.0012	0.08801	3	0.026563	yes	BRNPTM
chr1_922671_C_T_b38	RP4-758J18.2	3.313	0.0012	0.08801	3	0.026563	yes	BRNPTM
chr1_911848_C_T_b38	RP4-758J18.2	3.278	0.00134	0.08209	6	0.025042	yes	BRNPTM
chr1_923421_A_G_b38	RP4-758J18.2	-3.274	0.00136	-0.080726	8	0.024653	yes	BRNPTM
chr1_2395636_C_T_b38	RP4-758J18.2	3.266	0.0014	0.06779	15	0.020758	yes	BRNPTM
chr1_914483_G_GACTGCCCAGCTC_b38	RP4-758J18.2	3.122	0.00222	0.080375	6	0.025745	yes	BRNPTM
chr1_633365_C_CCA_b38	RP4-758J18.2	3.118	0.00225	0.077081	8	0.024723	yes	BRNPTM
chr1_928622_G_C_b38	RP4-758J18.2	3.097	0.0024	0.079791	4	0.02576	yes	BRNPTM
chr1_907236_TA_T_b38	RP4-758J18.2	3.093	0.00243	0.073539	7	0.023779	yes	BRNPTM
chr1_2395479_G_A_b38	RP4-758J18.2	2.994	0.0033	0.061577	16	0.020566	yes	BRNPTM
chr1_1196039_C_G_b38	RP4-758J18.2	-2.977	0.00347	-0.077662	7	0.026084	yes	BRNPTM
chr1_914682_A_T_b38	RP4-758J18.2	2.887	0.00456	0.071912	6	0.024908	yes	BRNPTM
chr1_1362470_A_T_b38	RP4-758J18.2	2.883	0.00462	0.084519	4	0.029321	yes	BRNPTM
chr1_2120839_CT_C_b38	RP4-758J18.2	2.863	0.0049	0.082308	5	0.028748	yes	BRNPTM
chr1_918870_A_G_b38	RP4-758J18.2	2.856	0.00501	0.070565	6	0.024711	yes	BRNPTM
chr1_914948_CA_C_b38	RP4-758J18.2	2.775	0.00633	0.080094	4	0.028859	yes	BRNPTM
chr1_1739883_C_T_b38	RP4-758J18.2	2.771	0.00641	0.051918	28	0.018735	yes	BRNPTM
chr1_1738525_G_A_b38	RP4-758J18.2	2.744	0.00693	0.053885	27	0.019634	yes	BRNPTM
chr1_1363601_A_AT_b38	RP4-758J18.2	2.744	0.00694	0.054589	41	0.019897	yes	BRNPTM
chr1_907538_T_TA_b38	RP4-758J18.2	2.703	0.00779	0.062507	11	0.023123	yes	BRNPTM
chr1_943526_CTTT_C_b38	RP4-758J18.2	2.7	0.00785	0.062014	34	0.022964	yes	BRNPTM
chr1_2383975_C_T_b38	RP4-758J18.2	2.681	0.0083	0.054538	18	0.020341	yes	BRNPTM
chr1_913274_TG_T_b38	RP4-758J18.2	2.621	0.00982	0.066969	5	0.025551	yes	BRNPTM
chr1_917859_A_G_b38	RP4-758J18.2	2.621	0.00982	0.066969	5	0.025551	yes	BRNPTM
chr1_906982_C_T_b38	RP4-758J18.2	3.658	0.000369	0.084862	7	0.0232	no	BRNPTM
chr1_903175_C_A_b38	RP4-758J18.2	3.416	0.00085	0.085836	6	0.025126	no	BRNPTM
chr1_910958_A_G_b38	RP4-758J18.2	3.371	0.000989	0.093439	3	0.027719	no	BRNPTM
chr1_899548_A_G_b38	RP4-758J18.2	3.317	0.00118	0.084566	4	0.025491	no	BRNPTM
chr1_899619_G_A_b38	RP4-758J18.2	3.317	0.00118	0.084566	4	0.025491	no	BRNPTM
chr1_911109_T_C_b38	RP4-758J18.2	3.268	0.00139	0.091013	3	0.027849	no	BRNPTM
chr1_909903_G_T_b38	RP4-758J18.2	3.233	0.00156	0.090025	3	0.027847	no	BRNPTM
chr1_911220_CT_C_b38	RP4-758J18.2	3.233	0.00156	0.090025	3	0.027847	no	BRNPTM
chr1_925308_G_A_b38	RP4-758J18.2	-3.201	0.00172	-0.076603	10	0.023929	no	BRNPTM
chr1_927486_C_T_b38	RP4-758J18.2	-3.175	0.00188	-0.079116	8	0.02492	no	BRNPTM
chr1_923311_TG_T_b38	RP4-758J18.2	-3.168	0.00192	-0.078888	8	0.024902	no	BRNPTM
chr1_925036_G_A_b38	RP4-758J18.2	-3.168	0.00192	-0.078888	8	0.024902	no	BRNPTM
chr1_926250_G_A_b38	RP4-758J18.2	-3.168	0.00192	-0.078888	8	0.024902	no	BRNPTM
chr1_910698_C_T_b38	RP4-758J18.2	3.162	0.00195	0.082108	5	0.025967	no	BRNPTM
chr1_932255_C_T_b38	RP4-758J18.2	3.128	0.00217	0.079458	5	0.025398	no	BRNPTM
chr1_902949_G_GC_b38	RP4-758J18.2	3.07	0.00261	0.078654	4	0.025624	no	BRNPTM
chr1_906633_T_G_b38	RP4-758J18.2	3.047	0.0028	0.0778	4	0.025532	no	BRNPTM
chr1_903007_T_C_b38	RP4-758J18.2	3.042	0.00285	0.078445	4	0.025786	no	BRNPTM
chr1_901149_C_G_b38	RP4-758J18.2	3.042	0.00285	0.078519	4	0.025814	no	BRNPTM
chr1_901544_G_A_b38	RP4-758J18.2	3.042	0.00285	0.078519	4	0.025814	no	BRNPTM
chr1_1692151_T_C_b38	RP4-758J18.2	3.041	0.00285	0.066863	15	0.021985	no	BRNPTM
chr1_931558_G_A_b38	RP4-758J18.2	2.982	0.00342	0.074647	5	0.025032	no	BRNPTM
chr1_912111_G_A_b38	RP4-758J18.2	2.971	0.00355	0.072903	7	0.024542	no	BRNPTM
chr1_913065_G_A_b38	RP4-758J18.2	2.971	0.00355	0.072903	7	0.024542	no	BRNPTM
chr1_913076_A_G_b38	RP4-758J18.2	2.971	0.00355	0.072903	7	0.024542	no	BRNPTM
chr1_904947_G_A_b38	RP4-758J18.2	2.912	0.00424	0.075337	4	0.025874	no	BRNPTM
chr1_910255_C_T_b38	RP4-758J18.2	2.884	0.00461	0.074793	5	0.025936	no	BRNPTM
chr1_911018_G_A_b38	RP4-758J18.2	2.879	0.00467	0.074752	6	0.025961	no	BRNPTM
chr1_1693427_G_A_b38	RP4-758J18.2	-2.879	0.00467	-0.07005	26	0.024332	no	BRNPTM
chr1_898547_T_C_b38	RP4-758J18.2	2.854	0.00504	0.072931	5	0.025558	no	BRNPTM
chr1_929839_G_A_b38	RP4-758J18.2	2.849	0.00511	0.072501	5	0.025451	no	BRNPTM
chr1_905705_C_G_b38	RP4-758J18.2	2.837	0.00529	0.07001	7	0.024678	no	BRNPTM
chr1_909894_G_T_b38	RP4-758J18.2	2.836	0.0053	0.073454	8	0.025899	no	BRNPTM
chr1_898818_T_C_b38	RP4-758J18.2	2.825	0.00547	0.072651	5	0.025713	no	BRNPTM
chr1_2006596_C_CA_b38	RP4-758J18.2	-2.811	0.00571	-0.070421	13	0.025053	no	BRNPTM
chr1_1692124_T_G_b38	RP4-758J18.2	2.808	0.00575	0.05986	17	0.021315	no	BRNPTM
chr1_916753_C_T_b38	RP4-758J18.2	2.806	0.00579	0.076557	3	0.027282	no	BRNPTM
chr1_912710_G_A_b38	RP4-758J18.2	2.794	0.006	0.070902	5	0.025374	no	BRNPTM
chr1_913358_C_T_b38	RP4-758J18.2	2.794	0.006	0.070902	5	0.025374	no	BRNPTM
chr1_914743_C_T_b38	RP4-758J18.2	2.794	0.006	0.070902	5	0.025374	no	BRNPTM
chr1_917284_C_T_b38	RP4-758J18.2	2.794	0.006	0.070902	5	0.025374	no	BRNPTM
chr1_917378_G_C_b38	RP4-758J18.2	2.794	0.006	0.070902	5	0.025374	no	BRNPTM
chr1_921056_TG_T_b38	RP4-758J18.2	2.784	0.00617	0.073766	4	0.026493	no	BRNPTM
chr1_910558_G_A_b38	RP4-758J18.2	2.764	0.00655	0.069246	9	0.025055	no	BRNPTM
chr1_903723_A_G_b38	RP4-758J18.2	2.753	0.00676	0.067119	8	0.024381	no	BRNPTM
chr1_1009716_C_T_b38	RP4-758J18.2	-2.753	0.00676	-0.134203	5	0.04875	no	BRNPTM
chr1_915810_G_A_b38	RP4-758J18.2	2.743	0.00695	0.068072	6	0.024814	no	BRNPTM
chr1_1776772_TAA_T_b38	RP4-758J18.2	2.724	0.00735	0.066954	10	0.02458	no	BRNPTM
chr1_1002415_C_CATT_b38	RP4-758J18.2	2.699	0.00788	0.106752	4	0.039549	no	BRNPTM
chr1_1695459_A_G_b38	RP4-758J18.2	-2.697	0.00792	-0.061276	29	0.022717	no	BRNPTM
chr1_924305_G_A_b38	RP4-758J18.2	2.692	0.00804	0.062469	12	0.023203	no	BRNPTM
chr1_901516_T_C_b38	RP4-758J18.2	2.668	0.00861	0.064499	9	0.024176	no	BRNPTM
chr1_1890770_C_T_b38	RP4-758J18.2	-2.659	0.00882	-0.063246	12	0.023782	no	BRNPTM
chr1_920949_C_G_b38	RP4-758J18.2	-2.635	0.00943	-0.072385	3	0.027466	no	BRNPTM
chr1_1378484_AT_A_b38	RP4-758J18.2	3.644	0.000427	0.12619	20	0.034627	yes	BRNSPC
chr1_2137585_GCCT_G_b38	RP4-758J18.2	-3.522	0.000648	-0.103847	15	0.029488	yes	BRNSPC
chr1_2173095_TCCAC_T_b38	RP4-758J18.2	-3.258	0.00153	-0.100887	14	0.030962	yes	BRNSPC
chr1_2179409_T_G_b38	RP4-758J18.2	-3.258	0.00153	-0.100887	14	0.030962	yes	BRNSPC
chr1_2189294_T_TG_b38	RP4-758J18.2	-3.258	0.00153	-0.108221	11	0.033218	yes	BRNSPC
chr1_2207909_CGTGTGT_C_b38	RP4-758J18.2	-3.141	0.00222	-0.119825	4	0.038153	yes	BRNSPC
chr1_2128619_C_T_b38	RP4-758J18.2	-3.128	0.00231	-0.097103	14	0.031043	yes	BRNSPC
chr1_2132033_G_C_b38	RP4-758J18.2	-3.043	0.00299	-0.096022	13	0.031558	yes	BRNSPC
chr1_2134596_A_AAT_b38	RP4-758J18.2	-3.01	0.00331	-0.093068	14	0.030921	yes	BRNSPC
chr1_2194537_C_A_b38	RP4-758J18.2	-2.885	0.0048	-0.098307	12	0.03408	yes	BRNSPC
chr1_2119789_C_CT_b38	RP4-758J18.2	2.717	0.00776	0.099308	8	0.036548	yes	BRNSPC
chr1_2212052_G_A_b38	RP4-758J18.2	-2.653	0.00927	-0.098236	6	0.037023	yes	BRNSPC
chr1_1725582_T_C_b38	RP4-758J18.2	-3.491	0.000718	-0.094587	30	0.027097	no	BRNSPC
chr1_2335858_C_T_b38	RP4-758J18.2	2.937	0.00411	0.111965	6	0.038116	no	BRNSPC
chr1_2220368_G_C_b38	RP4-758J18.2	-2.766	0.00676	-0.123108	3	0.04451	no	BRNSPC
chr1_2398577_C_T_b38	RP4-758J18.2	-2.686	0.00847	-0.084058	23	0.031295	no	BRNSPC
chr1_2121289_T_A_b38	RP4-758J18.2	-2.685	0.0085	-0.098754	6	0.036782	no	BRNSPC
chr1_2237640_C_T_b38	RP4-758J18.2	-2.644	0.00951	-0.114303	5	0.043226	no	BRNSPC
chr1_2238621_G_A_b38	RP4-758J18.2	-2.644	0.00951	-0.114303	5	0.043226	no	BRNSPC
chr1_2240198_G_C_b38	RP4-758J18.2	-2.644	0.00951	-0.114303	5	0.043226	no	BRNSPC
chr1_2240544_C_T_b38	RP4-758J18.2	-2.644	0.00951	-0.114303	5	0.043226	no	BRNSPC
chr1_1153291_C_T_b38	RP4-758J18.2	-2.805	0.00618	-0.081312	6	0.028984	yes	BRNSNG
chr1_2342840_A_ATATTTTATTTTATTT_b38	RP4-758J18.2	2.801	0.00627	0.10998	5	0.039266	yes	BRNSNG
chr1_866664_G_A_b38	RP4-758J18.2	2.793	0.00641	0.136495	3	0.048874	yes	BRNSNG
chr1_1035169_TGG_T_b38	RP4-758J18.2	2.762	0.00699	0.096567	5	0.034962	yes	BRNSNG
chr1_609015_G_A_b38	RP4-758J18.2	-2.696	0.00841	-0.094036	5	0.03488	yes	BRNSNG
chr1_1168009_GGGGCGGAGGGCCGAGCGGGGCCAGCAGACGGGTGA_G_b38	RP4-758J18.2	-2.885	0.00493	-0.059617	3	0.020667	no	BRNSNG
chr1_1308552_GGA_G_b38	RP4-758J18.2	-3.843	0.000146	-0.056081	12	0.014595	yes	BREAST
chr1_1223061_GCA_G_b38	RP4-758J18.2	-3.814	0.000164	-0.064319	4	0.016866	yes	BREAST
chr1_2071051_C_CACCTGGGCGTGTGACCTGGGCGTGTG_b38	RP4-758J18.2	3.668	0.000286	0.046577	9	0.0127	yes	BREAST
chr1_1279441_C_T_b38	RP4-758J18.2	-3.492	0.000545	-0.055521	5	0.015898	yes	BREAST
chr1_1588141_CA_C_b38	RP4-758J18.2	-3.115	0.002	-0.035296	22	0.01133	yes	BREAST
chr1_1485324_C_T_b38	RP4-758J18.2	-3.083	0.00223	-0.053229	3	0.017266	yes	BREAST
chr1_1584235_A_AT_b38	RP4-758J18.2	-3.055	0.00243	-0.02891	62	0.009462	yes	BREAST
chr1_1606536_GCT_G_b38	RP4-758J18.2	-2.989	0.00301	-0.033957	23	0.01136	yes	BREAST
chr1_2060607_C_T_b38	RP4-758J18.2	2.987	0.00304	0.036618	12	0.012261	yes	BREAST
chr1_2090485_G_GC_b38	RP4-758J18.2	2.947	0.00344	0.039509	7	0.013407	yes	BREAST
chr1_1437955_C_G_b38	RP4-758J18.2	2.942	0.00349	0.030671	42	0.010425	yes	BREAST
chr1_1606539_G_GCC_b38	RP4-758J18.2	-2.871	0.00436	-0.032633	23	0.011368	yes	BREAST
chr1_2055769_T_C_b38	RP4-758J18.2	2.825	0.00502	0.035537	13	0.01258	yes	BREAST
chr1_2068401_C_T_b38	RP4-758J18.2	2.821	0.00508	0.038189	8	0.013536	yes	BREAST
chr1_1602507_C_A_b38	RP4-758J18.2	-2.784	0.00569	-0.029525	32	0.010606	yes	BREAST
chr1_1602666_G_A_b38	RP4-758J18.2	-2.784	0.00569	-0.029525	32	0.010606	yes	BREAST
chr1_2070129_T_C_b38	RP4-758J18.2	2.778	0.00578	0.037381	8	0.013455	yes	BREAST
chr1_1960038_A_G_b38	RP4-758J18.2	2.746	0.00638	0.038336	7	0.013963	yes	BREAST
chr1_2106507_A_G_b38	RP4-758J18.2	-2.741	0.00646	-0.057284	4	0.020899	yes	BREAST
chr1_2103523_C_T_b38	RP4-758J18.2	-2.698	0.00735	-0.066586	8	0.024684	yes	BREAST
chr1_1606552_A_G_b38	RP4-758J18.2	-2.693	0.00745	-0.028869	28	0.010721	yes	BREAST
chr1_1398056_C_A_b38	RP4-758J18.2	2.669	0.00799	0.027043	47	0.010133	yes	BREAST
chr1_1671148_C_T_b38	RP4-758J18.2	2.654	0.00834	0.02692	40	0.010143	yes	BREAST
chr1_2057679_A_C_b38	RP4-758J18.2	2.632	0.00888	0.032938	12	0.012512	yes	BREAST
chr1_1606532_G_A_b38	RP4-758J18.2	-2.629	0.00898	-0.029854	23	0.011357	yes	BREAST
chr1_2056605_G_C_b38	RP4-758J18.2	2.615	0.00934	0.03451	11	0.013197	yes	BREAST
chr1_1685108_CA_C_b38	RP4-758J18.2	-3.805	0.000169	-0.043706	36	0.011487	no	BREAST
chr1_1430020_G_C_b38	RP4-758J18.2	-3.694	0.000259	-0.06689	3	0.01811	no	BREAST
chr1_1245992_C_T_b38	RP4-758J18.2	3.548	0.000446	0.054829	3	0.015455	no	BREAST
chr1_1589418_T_TA_b38	RP4-758J18.2	3.526	0.000483	0.034661	70	0.009831	no	BREAST
chr1_1691377_C_T_b38	RP4-758J18.2	3.443	0.000651	0.035548	47	0.010325	no	BREAST
chr1_1479704_G_A_b38	RP4-758J18.2	-3.286	0.00113	-0.048698	10	0.014818	no	BREAST
chr1_1687153_A_G_b38	RP4-758J18.2	-3.201	0.0015	-0.030833	72	0.009632	no	BREAST
chr1_1993969_A_G_b38	RP4-758J18.2	-3.158	0.00174	-0.0458	5	0.014504	no	BREAST
chr1_1689465_A_G_b38	RP4-758J18.2	-3.134	0.00188	-0.028985	75	0.009248	no	BREAST
chr1_1683909_A_C_b38	RP4-758J18.2	-3.12	0.00197	-0.03013	74	0.009658	no	BREAST
chr1_820879_G_GTCTACACTACCTGCCTGGCCAGCAGATCCACCCTGTCTACACTACCTGCCTGGGCAGTAGTTCCACGCAATCTCCCCTACCTGCCTCTCCAGCAGACCCGCCCTATCTATACTACTTGCCTGTCCAGCAGATCCACTCTATCTACACGACCTGCCTGTCCAGCAGATCCACCCTGTCTACACTACCTGCTTGTCCAGCAGGTCCACCCTGTCTATACTACCTGCCTGGCCAGTAGATCCACACTA_b38	RP4-758J18.2	3.111	0.00203	0.028452	21	0.009146	no	BREAST
chr1_2112692_T_TTGG_b38	RP4-758J18.2	-3.097	0.00213	-0.032631	75	0.010538	no	BREAST
chr1_1694167_G_A_b38	RP4-758J18.2	3.093	0.00216	0.028679	76	0.009273	no	BREAST
chr1_1679993_A_G_b38	RP4-758J18.2	-3.088	0.00219	-0.028707	88	0.009297	no	BREAST
chr1_1680672_C_T_b38	RP4-758J18.2	-3.072	0.00231	-0.030754	71	0.010012	no	BREAST
chr1_1681928_C_A_b38	RP4-758J18.2	-3.071	0.00231	-0.03087	61	0.010053	no	BREAST
chr1_2200395_C_CA_b38	RP4-758J18.2	3.051	0.00247	0.040171	14	0.013167	no	BREAST
chr1_1687643_G_A_b38	RP4-758J18.2	-3.042	0.00254	-0.029312	70	0.009634	no	BREAST
chr1_1715838_C_T_b38	RP4-758J18.2	3.032	0.00262	0.029372	108	0.009687	no	BREAST
chr1_1746263_C_T_b38	RP4-758J18.2	3.004	0.00287	0.033845	37	0.011268	no	BREAST
chr1_1948121_T_G_b38	RP4-758J18.2	-2.994	0.00297	-0.03348	25	0.011184	no	BREAST
chr1_1515828_G_A_b38	RP4-758J18.2	-2.987	0.00303	-0.051734	3	0.017318	no	BREAST
chr1_1694109_A_ACG_b38	RP4-758J18.2	2.982	0.00308	0.027662	81	0.009275	no	BREAST
chr1_1689421_G_A_b38	RP4-758J18.2	-2.971	0.00319	-0.028915	62	0.009733	no	BREAST
chr1_1641342_C_A_b38	RP4-758J18.2	-2.967	0.00323	-0.102837	3	0.034659	no	BREAST
chr1_1704835_C_T_b38	RP4-758J18.2	2.958	0.00332	0.028271	107	0.009556	no	BREAST
chr1_1684308_G_C_b38	RP4-758J18.2	-2.95	0.00341	-0.028554	67	0.00968	no	BREAST
chr1_1684619_G_A_b38	RP4-758J18.2	-2.95	0.00341	-0.028554	67	0.00968	no	BREAST
chr1_1689446_T_C_b38	RP4-758J18.2	-2.945	0.00346	-0.028751	62	0.009762	no	BREAST
chr1_1932079_AC_A_b38	RP4-758J18.2	-2.929	0.00364	-0.030943	49	0.010563	no	BREAST
chr1_1495136_G_A_b38	RP4-758J18.2	-2.925	0.00369	-0.049417	4	0.016898	no	BREAST
chr1_1724489_G_C_b38	RP4-758J18.2	2.91	0.00386	0.028035	111	0.009633	no	BREAST
chr1_1680214_T_C_b38	RP4-758J18.2	-2.906	0.00391	-0.027582	71	0.009491	no	BREAST
chr1_1681164_G_A_b38	RP4-758J18.2	-2.904	0.00394	-0.027722	70	0.009548	no	BREAST
chr1_1720192_T_G_b38	RP4-758J18.2	2.881	0.00423	0.027509	110	0.009549	no	BREAST
chr1_1705856_G_A_b38	RP4-758J18.2	2.851	0.00463	0.025184	110	0.008833	no	BREAST
chr1_1686017_A_AT_b38	RP4-758J18.2	-2.85	0.00465	-0.027298	69	0.009578	no	BREAST
chr1_1715745_G_A_b38	RP4-758J18.2	-2.842	0.00477	-0.027085	66	0.00953	no	BREAST
chr1_1696758_A_G_b38	RP4-758J18.2	2.839	0.00481	0.026166	74	0.009216	no	BREAST
chr1_1688586_C_T_b38	RP4-758J18.2	-2.837	0.00484	-0.032937	30	0.011611	no	BREAST
chr1_1680556_A_G_b38	RP4-758J18.2	-2.833	0.0049	-0.02714	71	0.00958	no	BREAST
chr1_1684266_T_C_b38	RP4-758J18.2	-2.823	0.00505	-0.027099	69	0.009598	no	BREAST
chr1_1687061_C_T_b38	RP4-758J18.2	-2.822	0.00506	-0.027111	68	0.009606	no	BREAST
chr1_1644361_C_T_b38	RP4-758J18.2	-2.812	0.00522	-0.036224	3	0.01288	no	BREAST
chr1_1686321_CTTT_C_b38	RP4-758J18.2	-2.801	0.0054	-0.031484	27	0.01124	no	BREAST
chr1_1688457_G_A_b38	RP4-758J18.2	-2.799	0.00542	-0.03205	35	0.011448	no	BREAST
chr1_1686147_T_G_b38	RP4-758J18.2	-2.797	0.00546	-0.028056	62	0.010029	no	BREAST
chr1_1721125_G_A_b38	RP4-758J18.2	2.759	0.00613	0.042593	7	0.01544	no	BREAST
chr1_1696117_G_A_b38	RP4-758J18.2	2.758	0.00614	0.025495	78	0.009244	no	BREAST
chr1_1716097_C_T_b38	RP4-758J18.2	2.755	0.0062	0.042621	7	0.015471	no	BREAST
chr1_1687236_T_G_b38	RP4-758J18.2	-2.753	0.00623	-0.027381	62	0.009945	no	BREAST
chr1_1706067_ACT_A_b38	RP4-758J18.2	2.749	0.00631	0.02649	108	0.009636	no	BREAST
chr1_1687159_G_T_b38	RP4-758J18.2	-2.748	0.00633	-0.026416	69	0.009612	no	BREAST
chr1_1688442_T_C_b38	RP4-758J18.2	-2.746	0.00637	-0.030993	36	0.011287	no	BREAST
chr1_1690308_AT_A_b38	RP4-758J18.2	2.734	0.00659	0.024064	100	0.0088	no	BREAST
chr1_2211900_C_CT_b38	RP4-758J18.2	-2.726	0.00676	-0.042247	12	0.015499	no	BREAST
chr1_1688570_A_T_b38	RP4-758J18.2	-2.704	0.0072	-0.034513	17	0.012762	no	BREAST
chr1_875929_A_G_b38	RP4-758J18.2	2.677	0.0078	0.085372	3	0.031886	no	BREAST
chr1_1696366_A_C_b38	RP4-758J18.2	2.667	0.00803	0.024533	78	0.009198	no	BREAST
chr1_506937_T_G_b38	RP4-758J18.2	-2.658	0.00825	-0.037712	9	0.014189	no	BREAST
chr1_1186850_G_GT_b38	RP4-758J18.2	-2.653	0.00837	-0.038906	5	0.014664	no	BREAST
chr1_1657926_A_AG_b38	RP4-758J18.2	-2.652	0.00839	-0.033187	13	0.012514	no	BREAST
chr1_1722690_TA_T_b38	RP4-758J18.2	-2.648	0.00849	-0.041485	3	0.015665	no	BREAST
chr1_1713751_T_C_b38	RP4-758J18.2	-2.642	0.00864	-0.024386	70	0.00923	no	BREAST
chr1_1714932_G_T_b38	RP4-758J18.2	2.64	0.00868	0.024621	99	0.009325	no	BREAST
chr1_1586956_T_C_b38	RP4-758J18.2	-2.603	0.00967	-0.027295	42	0.010488	no	BREAST
chr1_1586987_G_A_b38	RP4-758J18.2	-2.603	0.00967	-0.027295	42	0.010488	no	BREAST
chr1_1665581_C_G_b38	RP4-758J18.2	-2.6	0.00976	-0.030319	19	0.011663	no	BREAST
chr1_2055016_C_T_b38	RP4-758J18.2	-2.598	0.00981	-0.063409	10	0.024408	no	BREAST
chr1_1688531_T_C_b38	RP4-758J18.2	-2.598	0.00981	-0.03062	27	0.011788	no	BREAST
chr1_1223061_GCA_G_b38	RP4-758J18.2	-8.02	1.11e-14	-0.093875	3	0.011705	yes	CULTFB
chr1_1279441_C_T_b38	RP4-758J18.2	-7.23	2.36e-12	-0.078696	5	0.010884	yes	CULTFB
chr1_1495136_G_A_b38	RP4-758J18.2	-4.507	8.6e-06	-0.052682	4	0.01169	yes	CULTFB
chr1_1485324_C_T_b38	RP4-758J18.2	-4.47	1.01e-05	-0.05191	4	0.011613	yes	CULTFB
chr1_1479704_G_A_b38	RP4-758J18.2	-4.239	2.77e-05	-0.047765	6	0.011267	yes	CULTFB
chr1_1515828_G_A_b38	RP4-758J18.2	-4.12	4.58e-05	-0.048973	4	0.011887	yes	CULTFB
chr1_2280375_C_CA_b38	RP4-758J18.2	-3.754	0.000199	-0.027904	22	0.007434	yes	CULTFB
chr1_1482316_C_G_b38	RP4-758J18.2	-3.355	0.000869	-0.023028	52	0.006865	yes	CULTFB
chr1_1547675_G_A_b38	RP4-758J18.2	-3.27	0.00117	-0.041104	3	0.01257	yes	CULTFB
chr1_1398056_C_A_b38	RP4-758J18.2	3.244	0.00128	0.02259	61	0.006964	yes	CULTFB
chr1_1582556_T_C_b38	RP4-758J18.2	-2.888	0.00408	-0.030006	5	0.01039	yes	CULTFB
chr1_1953296_CTT_C_b38	RP4-758J18.2	-2.883	0.00415	-0.036381	4	0.01262	yes	CULTFB
chr1_1129599_C_T_b38	RP4-758J18.2	2.847	0.00463	0.026707	6	0.00938	yes	CULTFB
chr1_1308551_GGGA_G_b38	RP4-758J18.2	-2.835	0.0048	-0.042031	6	0.014823	yes	CULTFB
chr1_2132990_A_C_b38	RP4-758J18.2	-2.809	0.00521	-0.029969	6	0.01067	yes	CULTFB
chr1_666028_G_A_b38	RP4-758J18.2	2.804	0.00528	0.02955	6	0.010537	yes	CULTFB
chr1_886546_C_G_b38	RP4-758J18.2	-2.793	0.00546	-0.032098	4	0.011492	yes	CULTFB
chr1_680812_T_C_b38	RP4-758J18.2	2.75	0.00622	0.022884	12	0.008321	yes	CULTFB
chr1_1315752_GAGCGAGGGAGGTGGGGGCGGGGAGGGAGGGAGGGAGGCGGGC_G_b38	RP4-758J18.2	2.723	0.00675	0.021235	23	0.007799	yes	CULTFB
chr1_1545795_C_A_b38	RP4-758J18.2	-2.706	0.0071	-0.018959	65	0.007007	yes	CULTFB
chr1_600579_G_A_b38	RP4-758J18.2	-2.705	0.00712	-0.043327	4	0.01602	yes	CULTFB
chr1_1184277_G_C_b38	RP4-758J18.2	2.682	0.00762	0.018155	93	0.00677	yes	CULTFB
chr1_2284952_A_G_b38	RP4-758J18.2	-2.659	0.00813	-0.017577	51	0.006609	yes	CULTFB
chr1_998762_A_AGGGGAGG_b38	RP4-758J18.2	-2.613	0.00929	-0.015334	92	0.005867	yes	CULTFB
chr1_1308552_GGA_G_b38	RP4-758J18.2	-5.714	2.12e-08	-0.062172	10	0.01088	no	CULTFB
chr1_1174690_G_A_b38	RP4-758J18.2	-5.223	2.8e-07	-0.06162	4	0.011798	no	CULTFB
chr1_1481071_T_C_b38	RP4-758J18.2	-4.326	1.91e-05	-0.05092	10	0.011771	no	CULTFB
chr1_2222104_C_CT_b38	RP4-758J18.2	-3.865	0.000129	-0.041023	15	0.010613	no	CULTFB
chr1_1236037_C_T_b38	RP4-758J18.2	-3.486	0.000543	-0.022122	85	0.006346	no	CULTFB
chr1_1557495_CAT_C_b38	RP4-758J18.2	-3.148	0.00177	-0.022276	74	0.007077	no	CULTFB
chr1_1480990_T_C_b38	RP4-758J18.2	-2.997	0.00289	-0.029723	41	0.009918	no	CULTFB
chr1_1129155_G_C_b38	RP4-758J18.2	-2.956	0.0033	-0.022349	26	0.007561	no	CULTFB
chr1_1931743_CA_C_b38	RP4-758J18.2	-2.863	0.00441	-0.021827	27	0.007624	no	CULTFB
chr1_1168009_GGGGCGGAGGGCCGAGCGGGGCCAGCAGACGGGTGA_G_b38	RP4-758J18.2	-2.849	0.00461	-0.016055	35	0.005636	no	CULTFB
chr1_960375_A_AG_b38	RP4-758J18.2	2.77	0.00586	0.026824	34	0.009684	no	CULTFB
chr1_1541864_T_C_b38	RP4-758J18.2	-2.74	0.0064	-0.019488	74	0.007111	no	CULTFB
chr1_1196039_C_G_b38	RP4-758J18.2	2.73	0.00661	0.022618	17	0.008285	no	CULTFB
chr1_1695005_CAA_C_b38	RP4-758J18.2	-2.721	0.00679	-0.022344	24	0.008213	no	CULTFB
chr1_1143203_C_T_b38	RP4-758J18.2	2.715	0.00691	0.033696	3	0.012412	no	CULTFB
chr1_1558726_C_CA_b38	RP4-758J18.2	-2.686	0.00753	-0.018958	74	0.007059	no	CULTFB
chr1_1561821_A_C_b38	RP4-758J18.2	-2.686	0.00753	-0.018958	74	0.007059	no	CULTFB
chr1_1542793_C_G_b38	RP4-758J18.2	-2.66	0.00811	-0.01867	70	0.007018	no	CULTFB
chr1_1542800_T_C_b38	RP4-758J18.2	-2.66	0.00811	-0.01867	70	0.007018	no	CULTFB
chr1_960326_G_A_b38	RP4-758J18.2	2.655	0.00823	0.026174	32	0.009857	no	CULTFB
chr1_1571794_A_AT_b38	RP4-758J18.2	-2.653	0.00829	-0.018964	65	0.007148	no	CULTFB
chr1_1542773_T_C_b38	RP4-758J18.2	-2.638	0.00867	-0.018524	71	0.007023	no	CULTFB
chr1_1550064_GC_G_b38	RP4-758J18.2	-2.638	0.00867	-0.018524	71	0.007023	no	CULTFB
chr1_1550068_C_A_b38	RP4-758J18.2	-2.638	0.00867	-0.018524	71	0.007023	no	CULTFB
chr1_626516_AT_A_b38	RP4-758J18.2	-2.61	0.00937	-0.049022	3	0.01878	no	CULTFB
chr1_1187088_T_C_b38	RP4-758J18.2	2.6	0.00966	0.019407	24	0.007465	no	CULTFB
chr1_1551557_A_AG_b38	RP4-758J18.2	-2.591	0.00992	-0.018319	73	0.007071	no	CULTFB
chr1_1551559_A_T_b38	RP4-758J18.2	-2.591	0.00992	-0.018319	73	0.007071	no	CULTFB
chr1_992993_A_G_b38	RP4-758J18.2	2.931	0.00404	0.041685	39	0.014222	yes	EBVTLC
chr1_2377643_T_G_b38	RP4-758J18.2	-2.921	0.00417	-0.044657	24	0.015289	yes	EBVTLC
chr1_1004625_A_G_b38	RP4-758J18.2	2.897	0.00447	0.043735	26	0.015095	yes	EBVTLC
chr1_986336_C_A_b38	RP4-758J18.2	-2.846	0.0052	-0.046343	34	0.016283	yes	EBVTLC
chr1_1308549_G_T_b38	RP4-758J18.2	-2.831	0.00543	-0.041795	37	0.014762	yes	EBVTLC
chr1_1006159_C_T_b38	RP4-758J18.2	2.83	0.00546	0.042401	27	0.014984	yes	EBVTLC
chr1_904532_GGCC_G_b38	RP4-758J18.2	-2.725	0.00739	-0.055377	3	0.020324	yes	EBVTLC
chr1_992967_GGGAGGGTCCATGTGTCCGTCATCTGA_G_b38	RP4-758J18.2	-2.711	0.00768	-0.042772	34	0.015777	yes	EBVTLC
chr1_1053552_G_C_b38	RP4-758J18.2	-2.709	0.00773	-0.05437	10	0.020071	yes	EBVTLC
chr1_968046_C_T_b38	RP4-758J18.2	2.694	0.00805	0.042531	22	0.015784	yes	EBVTLC
chr1_989148_C_A_b38	RP4-758J18.2	-2.692	0.0081	-0.04386	36	0.01629	yes	EBVTLC
chr1_1056344_C_T_b38	RP4-758J18.2	-2.69	0.00816	-0.052879	9	0.019659	yes	EBVTLC
chr1_1113260_C_A_b38	RP4-758J18.2	2.662	0.00881	0.073354	4	0.027551	yes	EBVTLC
chr1_1113344_A_C_b38	RP4-758J18.2	2.662	0.00881	0.073354	4	0.027551	yes	EBVTLC
chr1_1114769_G_A_b38	RP4-758J18.2	2.662	0.00881	0.073354	4	0.027551	yes	EBVTLC
chr1_1124095_ACACACACCTGTG_A_b38	RP4-758J18.2	2.656	0.00898	0.078712	3	0.02964	yes	EBVTLC
chr1_904531_C_T_b38	RP4-758J18.2	-2.65	0.00913	-0.054258	3	0.020477	yes	EBVTLC
chr1_995153_C_G_b38	RP4-758J18.2	2.641	0.00935	0.038782	27	0.014684	yes	EBVTLC
chr1_995187_A_G_b38	RP4-758J18.2	2.641	0.00935	0.038782	27	0.014684	yes	EBVTLC
chr1_2342840_A_ATATTT_b38	RP4-758J18.2	-3.313	0.00122	-0.074965	5	0.022629	no	EBVTLC
chr1_1898648_CACACACATAAGTTGGATAT_C_b38	RP4-758J18.2	-3.168	0.00194	-0.04529	19	0.014297	no	EBVTLC
chr1_904561_TCCTCCTCCGAACGTGG_T_b38	RP4-758J18.2	-2.947	0.00385	-0.062452	3	0.02119	no	EBVTLC
chr1_1747241_C_CA_b38	RP4-758J18.2	-2.799	0.00597	-0.053303	29	0.019045	no	EBVTLC
chr1_2370674_CTT_C_b38	RP4-758J18.2	-2.772	0.00644	-0.045265	28	0.016327	no	EBVTLC
chr1_1692124_T_G_b38	RP4-758J18.2	-4.202	3.63e-05	-0.055571	21	0.013225	yes	CLNSGM
chr1_1684817_G_C_b38	RP4-758J18.2	-3.949	0.000101	-0.048183	42	0.012201	yes	CLNSGM
chr1_1692151_T_C_b38	RP4-758J18.2	-3.92	0.000113	-0.051206	24	0.013062	yes	CLNSGM
chr1_1743714_C_CA_b38	RP4-758J18.2	3.625	0.000347	0.043649	51	0.012041	yes	CLNSGM
chr1_1706067_ACT_A_b38	RP4-758J18.2	3.58	0.00041	0.041331	85	0.011546	yes	CLNSGM
chr1_1724489_G_C_b38	RP4-758J18.2	3.562	0.000437	0.04076	81	0.011442	yes	CLNSGM
chr1_1695747_C_T_b38	RP4-758J18.2	3.527	0.000496	0.048446	47	0.013736	yes	CLNSGM
chr1_1687236_T_G_b38	RP4-758J18.2	-3.527	0.000497	-0.04153	48	0.011776	yes	CLNSGM
chr1_1720192_T_G_b38	RP4-758J18.2	3.396	0.000789	0.038763	85	0.011413	yes	CLNSGM
chr1_1695459_A_G_b38	RP4-758J18.2	3.299	0.00111	0.046493	51	0.014095	yes	CLNSGM
chr1_1743886_C_T_b38	RP4-758J18.2	-3.19	0.0016	-0.041414	27	0.012983	yes	CLNSGM
chr1_1697272_G_A_b38	RP4-758J18.2	3.146	0.00185	0.060002	15	0.019072	yes	CLNSGM
chr1_1744028_A_AC_b38	RP4-758J18.2	-3.146	0.00185	-0.045965	15	0.014612	yes	CLNSGM
chr1_1704310_C_A_b38	RP4-758J18.2	3.088	0.00223	0.034112	69	0.011046	yes	CLNSGM
chr1_1686882_T_C_b38	RP4-758J18.2	-3.071	0.00236	-0.034765	64	0.011319	yes	CLNSGM
chr1_1742672_C_T_b38	RP4-758J18.2	-3.032	0.00268	-0.035045	56	0.011559	yes	CLNSGM
chr1_1743238_G_C_b38	RP4-758J18.2	-3.032	0.00268	-0.035045	56	0.011559	yes	CLNSGM
chr1_1688570_A_T_b38	RP4-758J18.2	-3.028	0.00271	-0.0474	7	0.015655	yes	CLNSGM
chr1_1734903_A_G_b38	RP4-758J18.2	3.007	0.0029	0.031828	88	0.010586	yes	CLNSGM
chr1_1750440_G_A_b38	RP4-758J18.2	-2.988	0.00308	-0.03835	43	0.012836	yes	CLNSGM
chr1_1744499_C_T_b38	RP4-758J18.2	-2.952	0.00344	-0.032819	62	0.011118	yes	CLNSGM
chr1_1744052_GAGA_G_b38	RP4-758J18.2	-2.926	0.00374	-0.042284	17	0.014453	yes	CLNSGM
chr1_1943487_C_G_b38	RP4-758J18.2	-2.853	0.00468	-0.038664	14	0.013552	yes	CLNSGM
chr1_1688442_T_C_b38	RP4-758J18.2	-2.785	0.00575	-0.03847	23	0.013814	yes	CLNSGM
chr1_1846009_AGG_A_b38	RP4-758J18.2	-2.755	0.00629	-0.03296	70	0.011966	yes	CLNSGM
chr1_1846011_G_GTCC_b38	RP4-758J18.2	-2.755	0.00629	-0.03296	70	0.011966	yes	CLNSGM
chr1_1948919_T_TCCTTCCCTCCTCTTTCCCTCCCTTCTTTCCTTCCCTTTCCCTCCCTC_b38	RP4-758J18.2	-2.668	0.0081	-0.027512	66	0.010311	yes	CLNSGM
chr1_1792696_C_CA_b38	RP4-758J18.2	2.656	0.0084	0.029991	40	0.011293	yes	CLNSGM
chr1_851639_C_T_b38	RP4-758J18.2	-2.647	0.00861	-0.041683	12	0.015747	yes	CLNSGM
chr1_1708505_G_C_b38	RP4-758J18.2	2.64	0.00879	0.028732	45	0.010884	yes	CLNSGM
chr1_1688457_G_A_b38	RP4-758J18.2	-2.615	0.00945	-0.0368	25	0.014074	yes	CLNSGM
chr1_1681164_G_A_b38	RP4-758J18.2	-3.862	0.000142	-0.044829	54	0.011608	no	CLNSGM
chr1_1641819_C_T_b38	RP4-758J18.2	3.834	0.000158	0.059171	12	0.015431	no	CLNSGM
chr1_1687159_G_T_b38	RP4-758J18.2	-3.834	0.000158	-0.044295	53	0.011553	no	CLNSGM
chr1_1681928_C_A_b38	RP4-758J18.2	-3.828	0.000162	-0.045514	47	0.01189	no	CLNSGM
chr1_1680214_T_C_b38	RP4-758J18.2	-3.828	0.000162	-0.044547	55	0.011637	no	CLNSGM
chr1_1684308_G_C_b38	RP4-758J18.2	-3.765	0.000206	-0.043872	52	0.011652	no	CLNSGM
chr1_1684619_G_A_b38	RP4-758J18.2	-3.765	0.000206	-0.043872	52	0.011652	no	CLNSGM
chr1_1686147_T_G_b38	RP4-758J18.2	-3.755	0.000213	-0.044355	48	0.011811	no	CLNSGM
chr1_1687734_CAA_C_b38	RP4-758J18.2	-3.749	0.000218	-0.045361	38	0.012099	no	CLNSGM
chr1_1680556_A_G_b38	RP4-758J18.2	-3.734	0.000231	-0.043878	55	0.011751	no	CLNSGM
chr1_1684266_T_C_b38	RP4-758J18.2	-3.721	0.000242	-0.043408	53	0.011665	no	CLNSGM
chr1_1687643_G_A_b38	RP4-758J18.2	-3.705	0.000258	-0.042577	55	0.011491	no	CLNSGM
chr1_1679993_A_G_b38	RP4-758J18.2	-3.663	0.000301	-0.041352	71	0.011288	no	CLNSGM
chr1_1686017_A_AT_b38	RP4-758J18.2	-3.647	0.00032	-0.042037	54	0.011527	no	CLNSGM
chr1_1687153_A_G_b38	RP4-758J18.2	-3.555	0.000448	-0.041597	58	0.0117	no	CLNSGM
chr1_1704835_C_T_b38	RP4-758J18.2	3.455	0.000641	0.039789	86	0.011515	no	CLNSGM
chr1_1687061_C_T_b38	RP4-758J18.2	-3.452	0.000649	-0.040126	53	0.011625	no	CLNSGM
chr1_1680672_C_T_b38	RP4-758J18.2	-3.451	0.000652	-0.039888	59	0.011559	no	CLNSGM
chr1_1715838_C_T_b38	RP4-758J18.2	3.421	0.000723	0.039505	89	0.011547	no	CLNSGM
chr1_1705799_A_G_b38	RP4-758J18.2	3.397	0.000788	0.036428	93	0.010724	no	CLNSGM
chr1_1683909_A_C_b38	RP4-758J18.2	-3.375	0.000851	-0.039959	59	0.011841	no	CLNSGM
chr1_1685108_CA_C_b38	RP4-758J18.2	-3.358	0.000901	-0.048305	23	0.014384	no	CLNSGM
chr1_1714932_G_T_b38	RP4-758J18.2	3.352	0.000922	0.037153	71	0.011085	no	CLNSGM
chr1_1717376_CTAACACCCG_C_b38	RP4-758J18.2	-3.332	0.000985	-0.040155	39	0.01205	no	CLNSGM
chr1_1425135_T_C_b38	RP4-758J18.2	-3.314	0.00105	-0.067941	4	0.0205	no	CLNSGM
chr1_1717953_C_T_b38	RP4-758J18.2	-3.295	0.00112	-0.039573	41	0.012008	no	CLNSGM
chr1_1716489_A_G_b38	RP4-758J18.2	-3.285	0.00116	-0.039498	41	0.012024	no	CLNSGM
chr1_822427_CCCTGGCCAGCAGATCCACCCTGTCTATACTACCTG_C_b38	RP4-758J18.2	-3.274	0.0012	-0.046981	12	0.014349	no	CLNSGM
chr1_1743565_AT_A_b38	RP4-758J18.2	3.273	0.00121	0.033069	83	0.010105	no	CLNSGM
chr1_1691417_T_C_b38	RP4-758J18.2	3.271	0.00122	0.041171	58	0.012587	no	CLNSGM
chr1_1706566_G_C_b38	RP4-758J18.2	3.264	0.00125	0.039687	41	0.012159	no	CLNSGM
chr1_1703565_T_C_b38	RP4-758J18.2	3.222	0.00143	0.039018	42	0.012109	no	CLNSGM
chr1_1425464_CA_C_b38	RP4-758J18.2	-3.209	0.0015	-0.05683	3	0.017709	no	CLNSGM
chr1_1704180_T_C_b38	RP4-758J18.2	3.193	0.00158	0.038484	42	0.012052	no	CLNSGM
chr1_1288372_TCC_T_b38	RP4-758J18.2	-3.178	0.00166	-0.106462	4	0.033496	no	CLNSGM
chr1_1742587_G_C_b38	RP4-758J18.2	3.171	0.0017	0.034692	78	0.010941	no	CLNSGM
chr1_1704605_G_A_b38	RP4-758J18.2	3.144	0.00186	0.038061	42	0.012108	no	CLNSGM
chr1_1398056_C_A_b38	RP4-758J18.2	3.101	0.00214	0.037089	44	0.011962	no	CLNSGM
chr1_1716919_CTT_C_b38	RP4-758J18.2	-3.072	0.00235	-0.042523	25	0.013843	no	CLNSGM
chr1_1861110_C_CA_b38	RP4-758J18.2	-3.051	0.00251	-0.033143	54	0.010863	no	CLNSGM
chr1_1740343_C_T_b38	RP4-758J18.2	3.023	0.00275	0.03198	87	0.010579	no	CLNSGM
chr1_1697467_G_A_b38	RP4-758J18.2	2.999	0.00297	0.035864	44	0.011959	no	CLNSGM
chr1_1689446_T_C_b38	RP4-758J18.2	-2.996	0.003	-0.035768	43	0.011938	no	CLNSGM
chr1_1737504_A_C_b38	RP4-758J18.2	2.994	0.00302	0.031808	89	0.010626	no	CLNSGM
chr1_1736729_G_T_b38	RP4-758J18.2	2.981	0.00315	0.031884	87	0.010697	no	CLNSGM
chr1_1731963_A_C_b38	RP4-758J18.2	2.979	0.00316	0.031577	88	0.010599	no	CLNSGM
chr1_1732392_C_T_b38	RP4-758J18.2	2.979	0.00316	0.031577	88	0.010599	no	CLNSGM
chr1_1734174_A_G_b38	RP4-758J18.2	2.979	0.00316	0.031577	88	0.010599	no	CLNSGM
chr1_1735176_C_T_b38	RP4-758J18.2	2.979	0.00316	0.031577	88	0.010599	no	CLNSGM
chr1_1735980_A_C_b38	RP4-758J18.2	2.979	0.00316	0.031577	88	0.010599	no	CLNSGM
chr1_1740703_C_T_b38	RP4-758J18.2	2.979	0.00316	0.031577	88	0.010599	no	CLNSGM
chr1_1738295_G_T_b38	RP4-758J18.2	2.966	0.00329	0.031495	87	0.010617	no	CLNSGM
chr1_1713751_T_C_b38	RP4-758J18.2	-2.966	0.0033	-0.03397	44	0.011455	no	CLNSGM
chr1_1715745_G_A_b38	RP4-758J18.2	-2.955	0.00341	-0.035514	43	0.012019	no	CLNSGM
chr1_1426175_T_C_b38	RP4-758J18.2	-2.953	0.00344	-0.059805	5	0.020255	no	CLNSGM
chr1_1695005_CAA_C_b38	RP4-758J18.2	2.951	0.00345	0.039279	28	0.01331	no	CLNSGM
chr1_1750428_G_C_b38	RP4-758J18.2	-2.949	0.00347	-0.038019	45	0.01289	no	CLNSGM
chr1_1738207_ACT_A_b38	RP4-758J18.2	-2.934	0.00364	-0.036346	40	0.012387	no	CLNSGM
chr1_939570_T_TCCCTGGAGGACC_b38	RP4-758J18.2	-2.922	0.00378	-0.036158	32	0.012373	no	CLNSGM
chr1_1689421_G_A_b38	RP4-758J18.2	-2.918	0.00383	-0.035167	42	0.012053	no	CLNSGM
chr1_1696366_A_C_b38	RP4-758J18.2	2.9	0.00405	0.033303	52	0.011483	no	CLNSGM
chr1_1735008_G_GTTTT_b38	RP4-758J18.2	2.892	0.00415	0.029596	88	0.010234	no	CLNSGM
chr1_1909234_G_A_b38	RP4-758J18.2	-2.855	0.00465	-0.034639	70	0.012133	no	CLNSGM
chr1_1909238_G_A_b38	RP4-758J18.2	-2.855	0.00465	-0.034639	70	0.012133	no	CLNSGM
chr1_1835922_G_GAAA_b38	RP4-758J18.2	-2.841	0.00485	-0.076798	5	0.027034	no	CLNSGM
chr1_1696758_A_G_b38	RP4-758J18.2	2.834	0.00495	0.03283	50	0.011582	no	CLNSGM
chr1_1742432_TA_T_b38	RP4-758J18.2	-2.834	0.00496	-0.03573	34	0.012609	no	CLNSGM
chr1_1689465_A_G_b38	RP4-758J18.2	-2.813	0.00528	-0.031961	54	0.011361	no	CLNSGM
chr1_1860718_A_C_b38	RP4-758J18.2	-2.786	0.00573	-0.033134	72	0.011894	no	CLNSGM
chr1_1184277_G_C_b38	RP4-758J18.2	2.775	0.00592	0.036669	54	0.013214	no	CLNSGM
chr1_1425750_T_C_b38	RP4-758J18.2	-2.755	0.00629	-0.057595	4	0.020908	no	CLNSGM
chr1_1425822_C_G_b38	RP4-758J18.2	-2.755	0.00629	-0.057595	4	0.020908	no	CLNSGM
chr1_1425936_G_A_b38	RP4-758J18.2	-2.755	0.00629	-0.057595	4	0.020908	no	CLNSGM
chr1_1694109_A_ACG_b38	RP4-758J18.2	2.744	0.00649	0.031395	55	0.011442	no	CLNSGM
chr1_1694167_G_A_b38	RP4-758J18.2	2.743	0.00651	0.031232	53	0.011386	no	CLNSGM
chr1_1743851_C_T_b38	RP4-758J18.2	-2.74	0.00656	-0.036809	23	0.013432	no	CLNSGM
chr1_1741276_C_T_b38	RP4-758J18.2	-2.729	0.00679	-0.031388	48	0.011504	no	CLNSGM
chr1_1696117_G_A_b38	RP4-758J18.2	2.726	0.00685	0.031473	53	0.011546	no	CLNSGM
chr1_1426771_G_C_b38	RP4-758J18.2	-2.711	0.00715	-0.058292	3	0.021503	no	CLNSGM
chr1_1462302_A_G_b38	RP4-758J18.2	2.711	0.00716	0.056097	4	0.020694	no	CLNSGM
chr1_1724035_G_A_b38	RP4-758J18.2	2.707	0.00723	0.040642	29	0.015014	no	CLNSGM
chr1_1131430_C_CTTTTTTTTTTTTTTTT_b38	RP4-758J18.2	-2.649	0.00856	-0.066037	3	0.024929	no	CLNSGM
chr1_1427080_C_T_b38	RP4-758J18.2	-2.638	0.00884	-0.055041	4	0.020864	no	CLNSGM
chr1_1688586_C_T_b38	RP4-758J18.2	-2.636	0.0089	-0.039025	16	0.014807	no	CLNSGM
chr1_1773460_G_A_b38	RP4-758J18.2	-2.629	0.00907	-0.031339	68	0.011921	no	CLNSGM
chr1_1773476_C_G_b38	RP4-758J18.2	-2.629	0.00907	-0.031339	68	0.011921	no	CLNSGM
chr1_1791493_C_T_b38	RP4-758J18.2	-2.621	0.00928	-0.031762	67	0.012119	no	CLNSGM
chr1_1791592_G_A_b38	RP4-758J18.2	-2.621	0.00928	-0.031762	67	0.012119	no	CLNSGM
chr1_1792927_G_A_b38	RP4-758J18.2	-2.621	0.00928	-0.031762	67	0.012119	no	CLNSGM
chr1_1901262_C_T_b38	RP4-758J18.2	-2.619	0.00932	-0.031433	70	0.012	no	CLNSGM
chr1_1901386_C_A_b38	RP4-758J18.2	-2.619	0.00932	-0.031433	70	0.012	no	CLNSGM
chr1_1742468_G_C_b38	RP4-758J18.2	2.611	0.00954	0.028907	87	0.01107	no	CLNSGM
chr1_1361679_G_A_b38	RP4-758J18.2	2.611	0.00954	0.039759	19	0.015227	no	CLNSGM
chr1_2053372_G_T_b38	RP4-758J18.2	-2.604	0.00973	-0.035065	20	0.013465	no	CLNSGM
chr1_1905586_C_T_b38	RP4-758J18.2	-2.601	0.00982	-0.031456	68	0.012093	no	CLNSGM
chr1_1762287_A_G_b38	RP4-758J18.2	-2.6	0.00986	-0.03143	70	0.01209	no	CLNSGM
chr1_790933_CGAATGGAATG_C_b38	RP4-758J18.2	-4.019	7.41e-05	-0.04952	25	0.012321	yes	CLNTRN
chr1_2106511_C_CT_b38	RP4-758J18.2	-3.606	0.000364	-0.093613	3	0.02596	yes	CLNTRN
chr1_1340697_G_A_b38	RP4-758J18.2	3.589	0.000388	0.044322	21	0.012349	yes	CLNTRN
chr1_1067054_C_T_b38	RP4-758J18.2	-3.314	0.00104	-0.035007	64	0.010565	yes	CLNTRN
chr1_2106518_A_G_b38	RP4-758J18.2	-3.236	0.00135	-0.090078	3	0.027832	yes	CLNTRN
chr1_591650_C_T_b38	RP4-758J18.2	3.19	0.00157	0.046433	9	0.014555	yes	CLNTRN
chr1_591638_G_A_b38	RP4-758J18.2	3.157	0.00176	0.049239	8	0.015599	yes	CLNTRN
chr1_1087930_T_C_b38	RP4-758J18.2	3.11	0.00206	0.040422	15	0.012999	yes	CLNTRN
chr1_2363813_T_A_b38	RP4-758J18.2	-3.094	0.00216	-0.055657	9	0.017987	yes	CLNTRN
chr1_1085966_A_G_b38	RP4-758J18.2	3.075	0.0023	0.038777	17	0.012608	yes	CLNTRN
chr1_1067673_C_T_b38	RP4-758J18.2	-3.018	0.00277	-0.03229	76	0.010699	yes	CLNTRN
chr1_1986752_A_G_b38	RP4-758J18.2	3.001	0.00292	0.034038	62	0.011342	yes	CLNTRN
chr1_999842_C_A_b38	RP4-758J18.2	-2.973	0.00319	-0.031129	98	0.01047	yes	CLNTRN
chr1_1987049_A_G_b38	RP4-758J18.2	2.971	0.00321	0.03328	63	0.011202	yes	CLNTRN
chr1_1000731_C_T_b38	RP4-758J18.2	-2.969	0.00323	-0.030545	91	0.010287	yes	CLNTRN
chr1_1308552_GGA_G_b38	RP4-758J18.2	-2.964	0.00328	-0.052407	9	0.017681	yes	CLNTRN
chr1_1987547_C_CT_b38	RP4-758J18.2	2.95	0.00343	0.034564	63	0.011715	yes	CLNTRN
chr1_669882_G_A_b38	RP4-758J18.2	2.916	0.00381	0.046851	6	0.016067	yes	CLNTRN
chr1_998410_G_A_b38	RP4-758J18.2	-2.906	0.00393	-0.029843	90	0.010268	yes	CLNTRN
chr1_660192_G_A_b38	RP4-758J18.2	2.885	0.0042	0.047152	7	0.016342	yes	CLNTRN
chr1_989148_C_A_b38	RP4-758J18.2	-2.875	0.00433	-0.03026	93	0.010525	yes	CLNTRN
chr1_1606099_G_GGTCAGGCGAGGGGTC_b38	RP4-758J18.2	2.844	0.00477	0.033734	33	0.011862	yes	CLNTRN
chr1_992993_A_G_b38	RP4-758J18.2	2.837	0.00486	0.027739	82	0.009776	yes	CLNTRN
chr1_1050069_G_A_b38	RP4-758J18.2	-2.83	0.00497	-0.031095	74	0.010987	yes	CLNTRN
chr1_1963538_T_C_b38	RP4-758J18.2	2.824	0.00506	0.030711	55	0.010874	yes	CLNTRN
chr1_1086203_A_C_b38	RP4-758J18.2	2.813	0.00524	0.035901	16	0.012764	yes	CLNTRN
chr1_1969015_A_G_b38	RP4-758J18.2	2.802	0.00541	0.031144	82	0.011113	yes	CLNTRN
chr1_2106507_A_G_b38	RP4-758J18.2	-2.802	0.00541	-0.061465	3	0.021936	yes	CLNTRN
chr1_995371_C_G_b38	RP4-758J18.2	2.789	0.00563	0.028194	59	0.010109	yes	CLNTRN
chr1_1000814_A_G_b38	RP4-758J18.2	-2.785	0.00569	-0.034555	32	0.012407	yes	CLNTRN
chr1_986336_C_A_b38	RP4-758J18.2	-2.781	0.00576	-0.029211	89	0.010503	yes	CLNTRN
chr1_995982_G_A_b38	RP4-758J18.2	2.761	0.00611	0.027956	59	0.010124	yes	CLNTRN
chr1_995512_T_C_b38	RP4-758J18.2	2.745	0.00642	0.027673	68	0.010081	yes	CLNTRN
chr1_995187_A_G_b38	RP4-758J18.2	2.742	0.00648	0.027876	66	0.010167	yes	CLNTRN
chr1_1948121_T_G_b38	RP4-758J18.2	2.712	0.00708	0.034392	24	0.012682	yes	CLNTRN
chr1_995153_C_G_b38	RP4-758J18.2	2.709	0.00714	0.027501	65	0.010152	yes	CLNTRN
chr1_1991213_T_C_b38	RP4-758J18.2	2.705	0.00723	0.029312	57	0.010837	yes	CLNTRN
chr1_1445055_G_A_b38	RP4-758J18.2	2.666	0.00809	0.051908	3	0.019468	yes	CLNTRN
chr1_2094608_G_A_b38	RP4-758J18.2	-2.664	0.00813	-0.083202	3	0.031227	yes	CLNTRN
chr1_1000453_C_G_b38	RP4-758J18.2	-2.651	0.00845	-0.032874	34	0.012399	yes	CLNTRN
chr1_1606089_GGC_G_b38	RP4-758J18.2	2.634	0.00889	0.032783	28	0.012447	yes	CLNTRN
chr1_1002417_T_A_b38	RP4-758J18.2	2.624	0.00915	0.033785	21	0.012878	yes	CLNTRN
chr1_1000079_A_G_b38	RP4-758J18.2	-2.62	0.00925	-0.032765	33	0.012507	yes	CLNTRN
chr1_689819_C_T_b38	RP4-758J18.2	2.618	0.00929	0.049818	3	0.019028	yes	CLNTRN
chr1_995786_A_G_b38	RP4-758J18.2	2.609	0.00954	0.026225	68	0.010051	yes	CLNTRN
chr1_1002415_CT_C_b38	RP4-758J18.2	2.604	0.00969	0.031464	29	0.012085	yes	CLNTRN
chr1_1067159_G_A_b38	RP4-758J18.2	3.661	0.000297	0.04231	40	0.011556	no	CLNTRN
chr1_1430020_G_C_b38	RP4-758J18.2	-3.36	0.000881	-0.062146	3	0.018496	no	CLNTRN
chr1_1963533_C_CA_b38	RP4-758J18.2	3.213	0.00146	0.034272	60	0.010666	no	CLNTRN
chr1_1968793_T_C_b38	RP4-758J18.2	3.201	0.00152	0.0345	59	0.010777	no	CLNTRN
chr1_875916_GCTCCTCCCCCACACTCTCCCACACTCCCCCACACTCCCCCACA_G_b38	RP4-758J18.2	3.133	0.0019	0.034657	39	0.011061	no	CLNTRN
chr1_1990027_C_CT_b38	RP4-758J18.2	3.043	0.00255	0.071797	7	0.023594	no	CLNTRN
chr1_1067007_A_G_b38	RP4-758J18.2	3.029	0.00267	0.035632	25	0.011762	no	CLNTRN
chr1_1985343_C_A_b38	RP4-758J18.2	3.028	0.00268	0.087123	5	0.028772	no	CLNTRN
chr1_1985367_C_T_b38	RP4-758J18.2	3.028	0.00268	0.087123	5	0.028772	no	CLNTRN
chr1_1986857_C_T_b38	RP4-758J18.2	3.028	0.00268	0.087123	5	0.028772	no	CLNTRN
chr1_1987886_G_A_b38	RP4-758J18.2	3.028	0.00268	0.087123	5	0.028772	no	CLNTRN
chr1_1991913_G_A_b38	RP4-758J18.2	2.981	0.00311	0.094676	3	0.031755	no	CLNTRN
chr1_1989803_A_G_b38	RP4-758J18.2	2.972	0.0032	0.032678	52	0.010994	no	CLNTRN
chr1_1973328_G_A_b38	RP4-758J18.2	2.948	0.00345	0.082409	6	0.027954	no	CLNTRN
chr1_1973692_T_C_b38	RP4-758J18.2	2.948	0.00345	0.082409	6	0.027954	no	CLNTRN
chr1_1967499_G_A_b38	RP4-758J18.2	2.947	0.00346	0.032038	56	0.010871	no	CLNTRN
chr1_613200_TG_T_b38	RP4-758J18.2	2.91	0.00389	0.070353	4	0.02418	no	CLNTRN
chr1_2143025_C_CT_b38	RP4-758J18.2	2.898	0.00404	0.040936	18	0.014127	no	CLNTRN
chr1_1970506_T_A_b38	RP4-758J18.2	-2.874	0.00435	-0.031684	53	0.011025	no	CLNTRN
chr1_1991116_A_G_b38	RP4-758J18.2	2.81	0.00528	0.080824	5	0.028761	no	CLNTRN
chr1_1485324_C_T_b38	RP4-758J18.2	-2.779	0.0058	-0.048793	4	0.017557	no	CLNTRN
chr1_1427080_C_T_b38	RP4-758J18.2	-2.767	0.00602	-0.052008	4	0.018798	no	CLNTRN
chr1_1515828_G_A_b38	RP4-758J18.2	-2.764	0.00607	-0.049303	4	0.01784	no	CLNTRN
chr1_1479704_G_A_b38	RP4-758J18.2	-2.694	0.00746	-0.043116	10	0.016003	no	CLNTRN
chr1_1479205_A_C_b38	RP4-758J18.2	2.679	0.0078	0.042839	18	0.015991	no	CLNTRN
chr1_1722619_C_T_b38	RP4-758J18.2	2.652	0.00844	0.033131	41	0.012494	no	CLNTRN
chr1_1976834_T_C_b38	RP4-758J18.2	2.648	0.00854	0.06439	15	0.02432	no	CLNTRN
chr1_1495136_G_A_b38	RP4-758J18.2	-2.638	0.00877	-0.045653	5	0.017304	no	CLNTRN
chr1_2003928_C_CGGGCCG_b38	RP4-758J18.2	-2.606	0.00963	-0.028111	36	0.010789	no	CLNTRN
chr1_2325159_CCCTTCCTTCCTTT_C_b38	RP4-758J18.2	-2.603	0.0097	-0.048596	4	0.018668	no	CLNTRN
chr1_2071051_C_CACCTGGGCGTGTGACCTGGGCGTGTG_b38	RP4-758J18.2	3.405	0.00076	0.04928	8	0.014471	yes	ESPGSJ
chr1_1430020_G_C_b38	RP4-758J18.2	-3.403	0.000766	-0.062938	3	0.018496	yes	ESPGSJ
chr1_2057679_A_C_b38	RP4-758J18.2	3.199	0.00154	0.046125	8	0.014418	yes	ESPGSJ
chr1_2087423_G_T_b38	RP4-758J18.2	3.1	0.00214	0.045602	8	0.01471	yes	ESPGSJ
chr1_2092415_G_A_b38	RP4-758J18.2	3.1	0.00214	0.045602	8	0.01471	yes	ESPGSJ
chr1_2093894_C_T_b38	RP4-758J18.2	3.1	0.00214	0.045602	8	0.01471	yes	ESPGSJ
chr1_2096688_G_T_b38	RP4-758J18.2	3.098	0.00215	0.045532	8	0.014697	yes	ESPGSJ
chr1_1129599_C_T_b38	RP4-758J18.2	3.092	0.00219	0.043826	9	0.014174	yes	ESPGSJ
chr1_2095729_C_T_b38	RP4-758J18.2	3.091	0.0022	0.045469	8	0.014712	yes	ESPGSJ
chr1_1607341_CTT_C_b38	RP4-758J18.2	3.056	0.00246	0.035081	60	0.011479	yes	ESPGSJ
chr1_2087631_G_A_b38	RP4-758J18.2	3.031	0.00267	0.046518	6	0.015347	yes	ESPGSJ
chr1_2068401_C_T_b38	RP4-758J18.2	2.968	0.00326	0.044753	7	0.015078	yes	ESPGSJ
chr1_1515828_G_A_b38	RP4-758J18.2	-2.959	0.00335	-0.051921	3	0.017544	yes	ESPGSJ
chr1_2078844_C_CT_b38	RP4-758J18.2	2.927	0.0037	0.057737	3	0.019723	yes	ESPGSJ
chr1_2094922_G_A_b38	RP4-758J18.2	2.92	0.00379	0.042782	8	0.014651	yes	ESPGSJ
chr1_2094100_G_A_b38	RP4-758J18.2	2.92	0.00379	0.042764	8	0.014645	yes	ESPGSJ
chr1_2070129_T_C_b38	RP4-758J18.2	2.877	0.00433	0.04318	7	0.015007	yes	ESPGSJ
chr1_2061762_C_A_b38	RP4-758J18.2	2.842	0.00482	0.042192	7	0.014845	yes	ESPGSJ
chr1_2082783_G_A_b38	RP4-758J18.2	2.826	0.00505	0.043979	7	0.01556	yes	ESPGSJ
chr1_2089466_C_T_b38	RP4-758J18.2	2.822	0.00512	0.039754	11	0.014085	yes	ESPGSJ
chr1_839543_G_C_b38	RP4-758J18.2	2.803	0.00542	0.035479	23	0.012655	yes	ESPGSJ
chr1_1890770_C_T_b38	RP4-758J18.2	2.733	0.00669	0.032301	22	0.01182	yes	ESPGSJ
chr1_841166_A_G_b38	RP4-758J18.2	-2.72	0.00695	-0.031226	26	0.01148	yes	ESPGSJ
chr1_2056323_C_T_b38	RP4-758J18.2	2.704	0.00727	0.041075	7	0.015188	yes	ESPGSJ
chr1_1631827_G_A_b38	RP4-758J18.2	-2.682	0.00776	-0.036929	12	0.013768	yes	ESPGSJ
chr1_2061187_A_G_b38	RP4-758J18.2	2.674	0.00795	0.040325	7	0.015082	yes	ESPGSJ
chr1_2065120_G_A_b38	RP4-758J18.2	2.674	0.00795	0.040325	7	0.015082	yes	ESPGSJ
chr1_813498_G_T_b38	RP4-758J18.2	-2.659	0.00829	-0.034899	16	0.013123	yes	ESPGSJ
chr1_2098568_CCT_C_b38	RP4-758J18.2	-2.639	0.00879	-0.029498	46	0.011178	yes	ESPGSJ
chr1_2056605_G_C_b38	RP4-758J18.2	2.629	0.00906	0.040359	7	0.015354	yes	ESPGSJ
chr1_2055769_T_C_b38	RP4-758J18.2	2.619	0.00931	0.037364	8	0.014265	yes	ESPGSJ
chr1_1485324_C_T_b38	RP4-758J18.2	-2.61	0.00954	-0.045083	3	0.01727	yes	ESPGSJ
chr1_2075002_G_A_b38	RP4-758J18.2	2.607	0.00964	0.040158	7	0.015406	yes	ESPGSJ
chr1_2398222_A_G_b38	RP4-758J18.2	2.606	0.00965	0.027302	54	0.010475	yes	ESPGSJ
chr1_790136_A_AGAATG_b38	RP4-758J18.2	3.514	0.000515	0.047409	10	0.01349	no	ESPGSJ
chr1_2078147_C_T_b38	RP4-758J18.2	3.103	0.00212	0.046588	7	0.015014	no	ESPGSJ
chr1_2081307_C_T_b38	RP4-758J18.2	2.941	0.00355	0.04452	7	0.015135	no	ESPGSJ
chr1_2090729_G_A_b38	RP4-758J18.2	2.935	0.00361	0.04431	7	0.015095	no	ESPGSJ
chr1_2091127_G_A_b38	RP4-758J18.2	2.935	0.00361	0.04431	7	0.015095	no	ESPGSJ
chr1_1606507_GTGGGC_G_b38	RP4-758J18.2	2.922	0.00377	0.031659	75	0.010834	no	ESPGSJ
chr1_2062283_C_T_b38	RP4-758J18.2	2.919	0.0038	0.043591	7	0.014931	no	ESPGSJ
chr1_2079555_G_A_b38	RP4-758J18.2	2.881	0.00428	0.043456	7	0.015084	no	ESPGSJ
chr1_1621352_G_A_b38	RP4-758J18.2	2.881	0.00428	0.03204	39	0.011122	no	ESPGSJ
chr1_788757_T_TAATGGAATGGAATGG_b38	RP4-758J18.2	2.876	0.00435	0.045461	4	0.015808	no	ESPGSJ
chr1_1620609_G_A_b38	RP4-758J18.2	2.861	0.00455	0.031759	39	0.011101	no	ESPGSJ
chr1_2079413_A_G_b38	RP4-758J18.2	2.853	0.00466	0.04325	7	0.015161	no	ESPGSJ
chr1_2079933_C_A_b38	RP4-758J18.2	2.853	0.00466	0.04325	7	0.015161	no	ESPGSJ
chr1_2118713_C_CTGTGTGTG_b38	RP4-758J18.2	-2.776	0.00589	-0.042965	5	0.015479	no	ESPGSJ
chr1_1613769_C_T_b38	RP4-758J18.2	2.766	0.00607	0.032305	36	0.011681	no	ESPGSJ
chr1_1915022_C_T_b38	RP4-758J18.2	2.757	0.00623	0.032795	21	0.011897	no	ESPGSJ
chr1_1521298_C_CA_b38	RP4-758J18.2	-2.709	0.00718	-0.04966	10	0.018334	no	ESPGSJ
chr1_1928119_T_C_b38	RP4-758J18.2	2.697	0.00743	0.033295	16	0.012346	no	ESPGSJ
chr1_1989523_T_C_b38	RP4-758J18.2	2.692	0.00754	0.028967	54	0.010761	no	ESPGSJ
chr1_2079861_C_T_b38	RP4-758J18.2	2.683	0.00775	0.04128	7	0.015389	no	ESPGSJ
chr1_1600320_C_G_b38	RP4-758J18.2	2.657	0.00835	0.031109	31	0.011709	no	ESPGSJ
chr1_1912983_T_C_b38	RP4-758J18.2	2.65	0.00852	0.031088	21	0.011731	no	ESPGSJ
chr1_713812_A_T_b38	RP4-758J18.2	2.627	0.0091	0.03888	8	0.0148	no	ESPGSJ
chr1_852305_G_T_b38	RP4-758J18.2	-2.614	0.00946	-0.035237	27	0.013483	no	ESPGSJ
chr1_2090485_G_GC_b38	RP4-758J18.2	2.61	0.00956	0.038048	8	0.01458	no	ESPGSJ
chr1_1884183_G_A_b38	RP4-758J18.2	2.602	0.00977	0.031242	19	0.012006	no	ESPGSJ
chr1_1308552_GGA_G_b38	RP4-758J18.2	-5.548	5.08e-08	-0.062837	17	0.011326	yes	ESPMCS
chr1_1388583_C_A_b38	RP4-758J18.2	-4.406	1.34e-05	-0.056566	3	0.012839	yes	ESPMCS
chr1_1479704_G_A_b38	RP4-758J18.2	-4.308	2.05e-05	-0.050497	9	0.011722	yes	ESPMCS
chr1_1495136_G_A_b38	RP4-758J18.2	-4.219	3e-05	-0.054175	3	0.01284	yes	ESPMCS
chr1_1582556_T_C_b38	RP4-758J18.2	-3.665	0.000278	-0.042027	9	0.011466	yes	ESPMCS
chr1_1070689_G_A_b38	RP4-758J18.2	3.374	0.000807	0.041768	3	0.012378	yes	ESPMCS
chr1_1054900_C_T_b38	RP4-758J18.2	3.361	0.000846	0.026761	56	0.007962	yes	ESPMCS
chr1_1428763_A_G_b38	RP4-758J18.2	-3.269	0.00117	-0.043826	13	0.013408	yes	ESPMCS
chr1_1426175_T_C_b38	RP4-758J18.2	-3.248	0.00125	-0.043272	11	0.013321	yes	ESPMCS
chr1_1380790_G_A_b38	RP4-758J18.2	3.203	0.00146	0.041018	13	0.012806	yes	ESPMCS
chr1_1375288_A_C_b38	RP4-758J18.2	3.197	0.00149	0.040845	13	0.012778	yes	ESPMCS
chr1_1375595_C_T_b38	RP4-758J18.2	3.197	0.00149	0.040845	13	0.012778	yes	ESPMCS
chr1_1376092_G_A_b38	RP4-758J18.2	3.197	0.00149	0.040845	13	0.012778	yes	ESPMCS
chr1_1376336_G_A_b38	RP4-758J18.2	3.197	0.00149	0.040845	13	0.012778	yes	ESPMCS
chr1_1379664_G_A_b38	RP4-758J18.2	3.197	0.00149	0.040845	13	0.012778	yes	ESPMCS
chr1_1840233_GA_G_b38	RP4-758J18.2	3.189	0.00153	0.028432	18	0.008916	yes	ESPMCS
chr1_1942258_G_A_b38	RP4-758J18.2	-3.171	0.00163	-0.023075	106	0.007278	yes	ESPMCS
chr1_1426771_G_C_b38	RP4-758J18.2	-3.151	0.00174	-0.045994	4	0.014598	yes	ESPMCS
chr1_1425822_C_G_b38	RP4-758J18.2	-3.128	0.00188	-0.045683	4	0.014607	yes	ESPMCS
chr1_1425936_G_A_b38	RP4-758J18.2	-3.128	0.00188	-0.045683	4	0.014607	yes	ESPMCS
chr1_1427080_C_T_b38	RP4-758J18.2	-3.099	0.00207	-0.045375	4	0.014641	yes	ESPMCS
chr1_1942014_G_A_b38	RP4-758J18.2	-3.086	0.00216	-0.022505	106	0.007292	yes	ESPMCS
chr1_1942075_A_G_b38	RP4-758J18.2	-3.086	0.00216	-0.022505	106	0.007292	yes	ESPMCS
chr1_1942086_T_C_b38	RP4-758J18.2	-3.086	0.00216	-0.022505	106	0.007292	yes	ESPMCS
chr1_1940540_G_A_b38	RP4-758J18.2	-3.08	0.0022	-0.022386	107	0.007269	yes	ESPMCS
chr1_1942260_G_C_b38	RP4-758J18.2	-3.08	0.0022	-0.022386	107	0.007269	yes	ESPMCS
chr1_1866635_T_TA_b38	RP4-758J18.2	3.058	0.00237	0.024771	61	0.008101	yes	ESPMCS
chr1_1936627_C_G_b38	RP4-758J18.2	-3.04	0.00251	-0.022093	104	0.007268	yes	ESPMCS
chr1_1055037_T_C_b38	RP4-758J18.2	-3.017	0.0027	-0.024069	49	0.007977	yes	ESPMCS
chr1_1937841_ACACCAGGTCCACCTCTGGACACAGGTCCACC_A_b38	RP4-758J18.2	-3.005	0.00282	-0.021812	107	0.007259	yes	ESPMCS
chr1_1938054_ACT_A_b38	RP4-758J18.2	-3.004	0.00282	-0.021808	107	0.00726	yes	ESPMCS
chr1_1904424_A_AAAATAAATAAAT_b38	RP4-758J18.2	2.988	0.00297	0.020224	84	0.006768	yes	ESPMCS
chr1_1749637_G_T_b38	RP4-758J18.2	2.954	0.00331	0.021354	87	0.007229	yes	ESPMCS
chr1_1938332_A_ACT_b38	RP4-758J18.2	-2.912	0.00378	-0.020985	110	0.007207	yes	ESPMCS
chr1_1385919_A_AG_b38	RP4-758J18.2	2.893	0.00401	0.035917	17	0.012414	yes	ESPMCS
chr1_2063845_CT_C_b38	RP4-758J18.2	2.885	0.00411	0.033227	5	0.011516	yes	ESPMCS
chr1_1937273_T_C_b38	RP4-758J18.2	-2.883	0.00414	-0.021137	101	0.007332	yes	ESPMCS
chr1_1933087_C_T_b38	RP4-758J18.2	-2.88	0.00418	-0.020853	104	0.007241	yes	ESPMCS
chr1_1933859_A_G_b38	RP4-758J18.2	-2.88	0.00418	-0.020853	104	0.007241	yes	ESPMCS
chr1_1935938_T_C_b38	RP4-758J18.2	-2.868	0.00434	-0.021284	91	0.007422	yes	ESPMCS
chr1_1375998_T_A_b38	RP4-758J18.2	2.867	0.00435	0.036213	13	0.012632	yes	ESPMCS
chr1_1764023_C_A_b38	RP4-758J18.2	2.853	0.00455	0.021491	83	0.007534	yes	ESPMCS
chr1_1750226_C_T_b38	RP4-758J18.2	2.849	0.0046	0.021521	82	0.007554	yes	ESPMCS
chr1_1942887_C_G_b38	RP4-758J18.2	-2.834	0.00481	-0.021645	109	0.007637	yes	ESPMCS
chr1_1936077_C_T_b38	RP4-758J18.2	-2.812	0.00515	-0.020114	114	0.007153	yes	ESPMCS
chr1_1931587_A_G_b38	RP4-758J18.2	-2.806	0.00525	-0.020388	105	0.007267	yes	ESPMCS
chr1_1947648_G_A_b38	RP4-758J18.2	2.803	0.00529	0.024086	25	0.008592	yes	ESPMCS
chr1_1417046_C_T_b38	RP4-758J18.2	-2.795	0.00542	-0.03362	12	0.012028	yes	ESPMCS
chr1_1757074_G_T_b38	RP4-758J18.2	2.794	0.00544	0.020901	80	0.007481	yes	ESPMCS
chr1_1932082_AAAAAC_A_b38	RP4-758J18.2	-2.789	0.00553	-0.051815	6	0.018579	yes	ESPMCS
chr1_1944074_T_C_b38	RP4-758J18.2	-2.783	0.00563	-0.02138	109	0.007683	yes	ESPMCS
chr1_1944091_G_C_b38	RP4-758J18.2	-2.783	0.00563	-0.02138	109	0.007683	yes	ESPMCS
chr1_1940973_C_T_b38	RP4-758J18.2	-2.773	0.0058	-0.020249	108	0.007302	yes	ESPMCS
chr1_1931580_CA_C_b38	RP4-758J18.2	-2.771	0.00583	-0.020179	104	0.007282	yes	ESPMCS
chr1_1897682_CA_C_b38	RP4-758J18.2	2.771	0.00584	0.02544	15	0.009182	yes	ESPMCS
chr1_1810086_A_G_b38	RP4-758J18.2	2.76	0.00604	0.025585	19	0.009271	yes	ESPMCS
chr1_1380513_C_T_b38	RP4-758J18.2	2.758	0.00606	0.035434	6	0.012847	yes	ESPMCS
chr1_1381290_C_G_b38	RP4-758J18.2	2.758	0.00606	0.035434	6	0.012847	yes	ESPMCS
chr1_1375698_G_T_b38	RP4-758J18.2	2.753	0.00617	0.035279	6	0.012817	yes	ESPMCS
chr1_1376153_G_C_b38	RP4-758J18.2	2.753	0.00617	0.035279	6	0.012817	yes	ESPMCS
chr1_1376752_T_C_b38	RP4-758J18.2	2.753	0.00617	0.035279	6	0.012817	yes	ESPMCS
chr1_1378635_C_T_b38	RP4-758J18.2	2.753	0.00617	0.035279	6	0.012817	yes	ESPMCS
chr1_1378792_C_T_b38	RP4-758J18.2	2.753	0.00617	0.035279	6	0.012817	yes	ESPMCS
chr1_1378865_C_T_b38	RP4-758J18.2	2.753	0.00617	0.035279	6	0.012817	yes	ESPMCS
chr1_1379334_A_G_b38	RP4-758J18.2	2.753	0.00617	0.035279	6	0.012817	yes	ESPMCS
chr1_1891450_G_A_b38	RP4-758J18.2	2.751	0.0062	0.023153	31	0.008417	yes	ESPMCS
chr1_1768171_CA_C_b38	RP4-758J18.2	2.734	0.00652	0.024585	17	0.008993	yes	ESPMCS
chr1_1938467_C_T_b38	RP4-758J18.2	2.732	0.00655	0.023325	25	0.008537	yes	ESPMCS
chr1_1944675_C_T_b38	RP4-758J18.2	-2.721	0.00678	-0.020832	110	0.007656	yes	ESPMCS
chr1_1946058_T_C_b38	RP4-758J18.2	-2.721	0.00678	-0.020832	110	0.007656	yes	ESPMCS
chr1_1945121_T_C_b38	RP4-758J18.2	-2.721	0.00678	-0.020859	110	0.007667	yes	ESPMCS
chr1_1946632_C_T_b38	RP4-758J18.2	-2.72	0.00679	-0.020836	109	0.00766	yes	ESPMCS
chr1_1754601_G_T_b38	RP4-758J18.2	2.716	0.00689	0.020734	78	0.007635	yes	ESPMCS
chr1_1415976_G_A_b38	RP4-758J18.2	-2.715	0.0069	-0.032702	22	0.012046	yes	ESPMCS
chr1_1944420_A_G_b38	RP4-758J18.2	-2.699	0.00724	-0.020604	111	0.007635	yes	ESPMCS
chr1_1944419_C_G_b38	RP4-758J18.2	-2.691	0.0074	-0.020539	111	0.007631	yes	ESPMCS
chr1_1757725_C_T_b38	RP4-758J18.2	2.69	0.00742	0.020583	78	0.007651	yes	ESPMCS
chr1_1921745_T_C_b38	RP4-758J18.2	-2.689	0.00744	-0.019535	101	0.007264	yes	ESPMCS
chr1_1947189_C_T_b38	RP4-758J18.2	-2.676	0.00774	-0.020483	109	0.007654	yes	ESPMCS
chr1_1934896_C_T_b38	RP4-758J18.2	2.656	0.00821	0.02349	20	0.008845	yes	ESPMCS
chr1_1410616_G_T_b38	RP4-758J18.2	-2.643	0.00852	-0.031604	23	0.011957	yes	ESPMCS
chr1_1412488_C_CAG_b38	RP4-758J18.2	-2.643	0.00852	-0.031604	23	0.011957	yes	ESPMCS
chr1_1937895_C_T_b38	RP4-758J18.2	-2.64	0.0086	-0.020209	109	0.007656	yes	ESPMCS
chr1_1922670_A_G_b38	RP4-758J18.2	-2.633	0.00877	-0.019224	103	0.007301	yes	ESPMCS
chr1_1928648_C_T_b38	RP4-758J18.2	-2.633	0.00877	-0.019224	103	0.007301	yes	ESPMCS
chr1_1864350_C_T_b38	RP4-758J18.2	2.632	0.00879	0.021976	31	0.008349	yes	ESPMCS
chr1_1756186_T_C_b38	RP4-758J18.2	2.631	0.00882	0.019543	82	0.007428	yes	ESPMCS
chr1_1236037_C_T_b38	RP4-758J18.2	-2.625	0.00898	-0.019562	87	0.007452	yes	ESPMCS
chr1_1359138_C_T_b38	RP4-758J18.2	2.6	0.00965	0.032005	27	0.01231	yes	ESPMCS
chr1_1340697_G_A_b38	RP4-758J18.2	3.271	0.00116	0.028592	28	0.00874	no	ESPMCS
chr1_1383798_AG_A_b38	RP4-758J18.2	3.127	0.00189	0.038919	7	0.012445	no	ESPMCS
chr1_1425750_T_C_b38	RP4-758J18.2	-3.117	0.00195	-0.044943	5	0.014418	no	ESPMCS
chr1_1399922_C_T_b38	RP4-758J18.2	-3.046	0.00246	-0.037643	8	0.012356	no	ESPMCS
chr1_1279441_C_T_b38	RP4-758J18.2	-3.038	0.00253	-0.041861	3	0.013778	no	ESPMCS
chr1_2056364_G_A_b38	RP4-758J18.2	3.02	0.00268	0.028002	50	0.009272	no	ESPMCS
chr1_2055097_C_T_b38	RP4-758J18.2	3.02	0.00268	0.029615	12	0.009808	no	ESPMCS
chr1_1374694_C_G_b38	RP4-758J18.2	2.986	0.00299	0.045142	6	0.015118	no	ESPMCS
chr1_1050063_AG_A_b38	RP4-758J18.2	-2.984	0.003	-0.022401	103	0.007506	no	ESPMCS
chr1_1055000_C_T_b38	RP4-758J18.2	-2.971	0.00314	-0.023586	45	0.007939	no	ESPMCS
chr1_1385553_G_A_b38	RP4-758J18.2	2.951	0.00334	0.03395	21	0.011503	no	ESPMCS
chr1_2059802_C_G_b38	RP4-758J18.2	2.91	0.0038	0.027455	16	0.009434	no	ESPMCS
chr1_1411929_G_C_b38	RP4-758J18.2	-2.908	0.00383	-0.034626	22	0.011907	no	ESPMCS
chr1_1385384_G_A_b38	RP4-758J18.2	2.906	0.00385	0.03652	7	0.012567	no	ESPMCS
chr1_2059575_A_G_b38	RP4-758J18.2	2.905	0.00386	0.027289	17	0.009392	no	ESPMCS
chr1_2059863_G_A_b38	RP4-758J18.2	2.905	0.00386	0.027289	17	0.009392	no	ESPMCS
chr1_1403240_CCTTT_C_b38	RP4-758J18.2	-2.905	0.00386	-0.035932	8	0.012368	no	ESPMCS
chr1_2065748_A_G_b38	RP4-758J18.2	2.889	0.00406	0.02725	16	0.009432	no	ESPMCS
chr1_2060951_G_A_b38	RP4-758J18.2	2.866	0.00437	0.027044	16	0.009437	no	ESPMCS
chr1_2063734_T_G_b38	RP4-758J18.2	2.866	0.00437	0.027044	16	0.009437	no	ESPMCS
chr1_1944182_G_C_b38	RP4-758J18.2	-2.862	0.00442	-0.022034	108	0.007699	no	ESPMCS
chr1_1402900_A_G_b38	RP4-758J18.2	-2.851	0.00457	-0.035502	8	0.012451	no	ESPMCS
chr1_1405316_T_C_b38	RP4-758J18.2	-2.851	0.00457	-0.035502	8	0.012451	no	ESPMCS
chr1_2059684_G_A_b38	RP4-758J18.2	2.849	0.0046	0.027197	15	0.009546	no	ESPMCS
chr1_2061309_C_T_b38	RP4-758J18.2	2.849	0.0046	0.027197	15	0.009546	no	ESPMCS
chr1_2063382_G_A_b38	RP4-758J18.2	2.849	0.0046	0.027197	15	0.009546	no	ESPMCS
chr1_1395050_G_A_b38	RP4-758J18.2	-2.84	0.00473	-0.035804	7	0.012608	no	ESPMCS
chr1_1945842_A_AAAAGAAC_b38	RP4-758J18.2	-2.836	0.00479	-0.022418	77	0.007906	no	ESPMCS
chr1_1381268_C_T_b38	RP4-758J18.2	2.831	0.00486	0.035988	14	0.012711	no	ESPMCS
chr1_1381294_C_T_b38	RP4-758J18.2	2.831	0.00486	0.035988	14	0.012711	no	ESPMCS
chr1_1408687_T_C_b38	RP4-758J18.2	-2.817	0.00507	-0.034575	16	0.012273	no	ESPMCS
chr1_1425013_C_T_b38	RP4-758J18.2	-2.79	0.00552	-0.034146	37	0.012241	no	ESPMCS
chr1_1034279_G_A_b38	RP4-758J18.2	-2.772	0.00581	-0.021799	45	0.007863	no	ESPMCS
chr1_1945975_TG_T_b38	RP4-758J18.2	-2.748	0.00624	-0.021029	112	0.007651	no	ESPMCS
chr1_1050070_G_A_b38	RP4-758J18.2	-2.746	0.00628	-0.020579	102	0.007493	no	ESPMCS
chr1_2206830_C_CAA_b38	RP4-758J18.2	2.742	0.00636	0.029589	21	0.01079	no	ESPMCS
chr1_1946013_C_T_b38	RP4-758J18.2	-2.74	0.0064	-0.021057	109	0.007685	no	ESPMCS
chr1_2058057_C_T_b38	RP4-758J18.2	2.738	0.00644	0.026382	14	0.009636	no	ESPMCS
chr1_2058514_T_A_b38	RP4-758J18.2	2.738	0.00644	0.026382	14	0.009636	no	ESPMCS
chr1_1947645_C_T_b38	RP4-758J18.2	-2.722	0.00675	-0.021297	103	0.007823	no	ESPMCS
chr1_1372258_T_C_b38	RP4-758J18.2	2.718	0.00684	0.043106	4	0.015861	no	ESPMCS
chr1_2060449_TGAGAAGTGGGGCTGAATAGAGGTTTGGCAGTGCTTAGCATAGGGGGCGAGAGTCTCGGCTTCCAGC_T_b38	RP4-758J18.2	2.705	0.00711	0.025695	16	0.0095	no	ESPMCS
chr1_1361836_A_G_b38	RP4-758J18.2	2.641	0.00856	0.039636	3	0.015006	no	ESPMCS
chr1_1057439_G_A_b38	RP4-758J18.2	2.633	0.00876	0.019005	118	0.007217	no	ESPMCS
chr1_1938125_TCA_T_b38	RP4-758J18.2	-2.617	0.00918	-0.020013	108	0.007647	no	ESPMCS
chr1_1758323_T_C_b38	RP4-758J18.2	2.61	0.00938	0.01879	94	0.0072	no	ESPMCS
chr1_1279441_C_T_b38	RP4-758J18.2	-3.154	0.00173	-0.045931	3	0.014562	yes	ESPMSL
chr1_1649993_A_G_b38	RP4-758J18.2	-3.153	0.00174	-0.024013	121	0.007617	yes	ESPMSL
chr1_1430020_G_C_b38	RP4-758J18.2	-2.92	0.00371	-0.04322	3	0.014804	yes	ESPMSL
chr1_2108949_G_A_b38	RP4-758J18.2	-2.875	0.00425	-0.032424	21	0.011276	yes	ESPMSL
chr1_633887_G_A_b38	RP4-758J18.2	2.794	0.00546	0.028889	19	0.010341	yes	ESPMSL
chr1_2380956_C_T_b38	RP4-758J18.2	-2.654	0.00828	-0.02707	16	0.0102	yes	ESPMSL
chr1_2382101_A_G_b38	RP4-758J18.2	-2.654	0.00828	-0.02707	16	0.0102	yes	ESPMSL
chr1_906677_A_AAACTCAGCTGCCTCTCCCCTTC_b38	RP4-758J18.2	2.654	0.00829	0.023531	47	0.008868	yes	ESPMSL
chr1_740738_C_T_b38	RP4-758J18.2	2.648	0.00842	0.039047	4	0.014745	yes	ESPMSL
chr1_2207925_T_C_b38	RP4-758J18.2	2.619	0.00916	0.031096	4	0.011873	yes	ESPMSL
chr1_1768171_CA_C_b38	RP4-758J18.2	2.611	0.00938	0.025945	14	0.009938	yes	ESPMSL
chr1_1481071_T_C_b38	RP4-758J18.2	-3.66	0.000286	-0.052579	11	0.014365	no	ESPMSL
chr1_908962_G_GGTCGGGGTC_b38	RP4-758J18.2	-3.194	0.00152	-0.040977	16	0.012829	no	ESPMSL
chr1_1349974_T_C_b38	RP4-758J18.2	3.091	0.00214	0.090261	3	0.029202	no	ESPMSL
chr1_1650195_A_G_b38	RP4-758J18.2	-3.01	0.00278	-0.025849	46	0.008588	no	ESPMSL
chr1_1248709_A_G_b38	RP4-758J18.2	-2.795	0.00544	-0.033218	10	0.011884	no	ESPMSL
chr1_634112_T_C_b38	RP4-758J18.2	2.786	0.00559	0.032255	44	0.011577	no	ESPMSL
chr1_1650383_G_T_b38	RP4-758J18.2	-2.686	0.00753	-0.024689	35	0.00919	no	ESPMSL
chr1_1481085_C_G_b38	RP4-758J18.2	-2.676	0.00777	-0.051897	6	0.019396	no	ESPMSL
chr1_1630798_C_T_b38	RP4-758J18.2	2.673	0.00782	0.022827	50	0.008539	no	ESPMSL
chr1_820879_G_GTCTACACTACCTGCCTGGCCAGCAGATCCACCCTGTCTACACTACCTGCCTGGGCAGTAGTTCCACGCAATCTCCCCTACCTGCCTCTCCAGCAGACCCGCCCTATCTATACTACTTGCCTGTCCAGCAGATCCACTCTATCTACACGACCTGCCTGTCCAGCAGATCCACCCTGTCTACACTACCTGCTTGTCCAGCAGGTCCACCCTGTCTATACTACCTGCCTGGCCAGTAGATCCACACTA_b38	RP4-758J18.2	2.619	0.00916	0.021827	25	0.008334	no	ESPMSL
chr1_1308552_GGA_G_b38	RP4-758J18.2	-3.831	0.000155	-0.081629	12	0.021305	yes	HRTAA
chr1_1705856_G_A_b38	RP4-758J18.2	3.671	0.000286	0.046253	118	0.012601	yes	HRTAA
chr1_1694109_A_ACG_b38	RP4-758J18.2	3.66	0.000298	0.04849	66	0.013248	yes	HRTAA
chr1_1713751_T_C_b38	RP4-758J18.2	-3.55	0.000447	-0.049371	55	0.013908	yes	HRTAA
chr1_1308551_GGGA_G_b38	RP4-758J18.2	-3.53	0.00048	-0.109394	4	0.030987	yes	HRTAA
chr1_1697467_G_A_b38	RP4-758J18.2	3.504	0.000528	0.04847	57	0.013833	yes	HRTAA
chr1_1724489_G_C_b38	RP4-758J18.2	3.45	0.000641	0.046667	94	0.013527	yes	HRTAA
chr1_1720192_T_G_b38	RP4-758J18.2	3.449	0.000642	0.04705	99	0.01364	yes	HRTAA
chr1_1715838_C_T_b38	RP4-758J18.2	3.447	0.000647	0.047038	103	0.013645	yes	HRTAA
chr1_1694167_G_A_b38	RP4-758J18.2	3.447	0.000647	0.046091	64	0.013371	yes	HRTAA
chr1_1706067_ACT_A_b38	RP4-758J18.2	3.354	0.000899	0.045801	98	0.013656	yes	HRTAA
chr1_1704835_C_T_b38	RP4-758J18.2	3.346	0.000925	0.04532	99	0.013546	yes	HRTAA
chr1_1703565_T_C_b38	RP4-758J18.2	3.33	0.000976	0.047525	53	0.014271	yes	HRTAA
chr1_1706566_G_C_b38	RP4-758J18.2	3.274	0.00118	0.04651	54	0.014206	yes	HRTAA
chr1_1717953_C_T_b38	RP4-758J18.2	-3.263	0.00123	-0.046733	52	0.014324	yes	HRTAA
chr1_1704605_G_A_b38	RP4-758J18.2	3.257	0.00126	0.046409	54	0.01425	yes	HRTAA
chr1_1696366_A_C_b38	RP4-758J18.2	3.249	0.00129	0.043452	65	0.013372	yes	HRTAA
chr1_1691377_C_T_b38	RP4-758J18.2	3.237	0.00134	0.048423	36	0.014961	yes	HRTAA
chr1_1716489_A_G_b38	RP4-758J18.2	-3.208	0.00148	-0.045613	53	0.014218	yes	HRTAA
chr1_1705867_T_C_b38	RP4-758J18.2	3.197	0.00153	0.039176	95	0.012253	yes	HRTAA
chr1_1704180_T_C_b38	RP4-758J18.2	3.185	0.0016	0.045167	54	0.01418	yes	HRTAA
chr1_1704310_C_A_b38	RP4-758J18.2	3.171	0.00167	0.041545	82	0.0131	yes	HRTAA
chr1_1696117_G_A_b38	RP4-758J18.2	3.149	0.0018	0.04249	64	0.013492	yes	HRTAA
chr1_1724661_CGATG_C_b38	RP4-758J18.2	-3.148	0.00181	-0.044394	47	0.014101	yes	HRTAA
chr1_1065530_C_T_b38	RP4-758J18.2	3.06	0.00241	0.067937	4	0.0222	yes	HRTAA
chr1_1717376_CTAACACCCG_C_b38	RP4-758J18.2	-3.02	0.00275	-0.043554	51	0.014422	yes	HRTAA
chr1_1696758_A_G_b38	RP4-758J18.2	3.009	0.00285	0.041036	60	0.01364	yes	HRTAA
chr1_1684308_G_C_b38	RP4-758J18.2	-3.005	0.00288	-0.04259	59	0.014172	yes	HRTAA
chr1_1684619_G_A_b38	RP4-758J18.2	-3.005	0.00288	-0.04259	59	0.014172	yes	HRTAA
chr1_2337352_A_G_b38	RP4-758J18.2	2.986	0.00306	0.04196	58	0.014051	yes	HRTAA
chr1_1896396_CT_C_b38	RP4-758J18.2	2.984	0.00308	0.052781	10	0.017689	yes	HRTAA
chr1_1695747_C_T_b38	RP4-758J18.2	2.979	0.00313	0.046654	62	0.01566	yes	HRTAA
chr1_1075337_C_T_b38	RP4-758J18.2	2.96	0.00332	0.037926	79	0.012813	yes	HRTAA
chr1_1705799_A_G_b38	RP4-758J18.2	2.93	0.00365	0.037112	114	0.012668	yes	HRTAA
chr1_1069009_T_TC_b38	RP4-758J18.2	2.914	0.00383	0.040259	76	0.013814	yes	HRTAA
chr1_1079746_A_G_b38	RP4-758J18.2	2.91	0.00389	0.037815	79	0.012996	yes	HRTAA
chr1_1081790_C_G_b38	RP4-758J18.2	2.887	0.00418	0.03665	90	0.012696	yes	HRTAA
chr1_1705816_A_G_b38	RP4-758J18.2	2.886	0.00418	0.03568	87	0.012362	yes	HRTAA
chr1_2342734_T_C_b38	RP4-758J18.2	-2.874	0.00434	-0.045343	20	0.015776	yes	HRTAA
chr1_1680214_T_C_b38	RP4-758J18.2	-2.807	0.00532	-0.039323	62	0.014008	yes	HRTAA
chr1_1366987_GTGTGTAGTGGATGAGTGTGGA_G_b38	RP4-758J18.2	-2.805	0.00535	-0.099381	3	0.035424	yes	HRTAA
chr1_1680556_A_G_b38	RP4-758J18.2	-2.793	0.00555	-0.039275	62	0.01406	yes	HRTAA
chr1_1681164_G_A_b38	RP4-758J18.2	-2.793	0.00555	-0.039275	62	0.01406	yes	HRTAA
chr1_1708855_TTCCTCCTCC_T_b38	RP4-758J18.2	2.764	0.00606	0.041848	66	0.015141	yes	HRTAA
chr1_1686882_T_C_b38	RP4-758J18.2	-2.76	0.00614	-0.03699	77	0.013403	yes	HRTAA
chr1_1688409_C_G_b38	RP4-758J18.2	-2.753	0.00627	-0.040646	54	0.014766	yes	HRTAA
chr1_1681928_C_A_b38	RP4-758J18.2	-2.729	0.00673	-0.039033	57	0.014304	yes	HRTAA
chr1_1079877_A_G_b38	RP4-758J18.2	2.727	0.00676	0.035345	78	0.01296	yes	HRTAA
chr1_2337239_T_C_b38	RP4-758J18.2	2.712	0.00708	0.041334	33	0.015243	yes	HRTAA
chr1_1075707_CG_C_b38	RP4-758J18.2	2.708	0.00715	0.035378	91	0.013062	yes	HRTAA
chr1_1083800_T_C_b38	RP4-758J18.2	2.701	0.00731	0.034824	76	0.012895	yes	HRTAA
chr1_1366896_G_GT_b38	RP4-758J18.2	-2.698	0.00738	-0.094076	3	0.034872	yes	HRTAA
chr1_1083324_A_G_b38	RP4-758J18.2	2.661	0.00821	0.034289	79	0.012887	yes	HRTAA
chr1_1367013_TG_T_b38	RP4-758J18.2	-2.659	0.00827	-0.090946	3	0.034209	yes	HRTAA
chr1_1855321_C_CA_b38	RP4-758J18.2	2.652	0.00844	0.04771	15	0.017994	yes	HRTAA
chr1_790733_C_CAATGG_b38	RP4-758J18.2	2.614	0.00939	0.051427	3	0.019672	yes	HRTAA
chr1_1689446_T_C_b38	RP4-758J18.2	-3.775	0.000193	-0.052673	52	0.013952	no	HRTAA
chr1_1689421_G_A_b38	RP4-758J18.2	-3.773	0.000194	-0.052731	51	0.013977	no	HRTAA
chr1_1691417_T_C_b38	RP4-758J18.2	3.654	0.000304	0.052065	68	0.014247	no	HRTAA
chr1_1689465_A_G_b38	RP4-758J18.2	-3.39	0.000792	-0.045698	61	0.01348	no	HRTAA
chr1_1708951_C_T_b38	RP4-758J18.2	3.305	0.00107	0.045542	64	0.013781	no	HRTAA
chr1_1714932_G_T_b38	RP4-758J18.2	3.267	0.00121	0.042971	81	0.013151	no	HRTAA
chr1_1686017_A_AT_b38	RP4-758J18.2	-3.046	0.00252	-0.042539	62	0.013966	no	HRTAA
chr1_2333660_C_T_b38	RP4-758J18.2	3.022	0.00272	0.062736	4	0.020757	no	HRTAA
chr1_1687061_C_T_b38	RP4-758J18.2	-3.02	0.00274	-0.042405	61	0.014042	no	HRTAA
chr1_1687159_G_T_b38	RP4-758J18.2	-2.948	0.00345	-0.041493	60	0.014076	no	HRTAA
chr1_1079484_T_A_b38	RP4-758J18.2	2.881	0.00425	0.036729	88	0.012749	no	HRTAA
chr1_1073854_T_C_b38	RP4-758J18.2	2.871	0.00439	0.036651	84	0.012768	no	HRTAA
chr1_1684266_T_C_b38	RP4-758J18.2	-2.857	0.00458	-0.040521	60	0.014185	no	HRTAA
chr1_1687236_T_G_b38	RP4-758J18.2	-2.84	0.00482	-0.040578	56	0.01429	no	HRTAA
chr1_1366923_AGTTG_A_b38	RP4-758J18.2	-2.825	0.00505	-0.089754	3	0.031773	no	HRTAA
chr1_1898648_CACACACATAAGTTGGATAT_C_b38	RP4-758J18.2	-2.813	0.00524	-0.042396	28	0.015073	no	HRTAA
chr1_1367036_GTGAATTGGT_G_b38	RP4-758J18.2	-2.807	0.00532	-0.097844	3	0.034852	no	HRTAA
chr1_1687643_G_A_b38	RP4-758J18.2	-2.802	0.00541	-0.039221	63	0.013997	no	HRTAA
chr1_1687734_CAA_C_b38	RP4-758J18.2	-2.794	0.00554	-0.042108	39	0.015071	no	HRTAA
chr1_1366907_G_A_b38	RP4-758J18.2	-2.784	0.00571	-0.091489	3	0.032865	no	HRTAA
chr1_1366911_A_T_b38	RP4-758J18.2	-2.784	0.00571	-0.091489	3	0.032865	no	HRTAA
chr1_1687153_A_G_b38	RP4-758J18.2	-2.767	0.00601	-0.038557	67	0.013934	no	HRTAA
chr1_1686147_T_G_b38	RP4-758J18.2	-2.728	0.00674	-0.039158	56	0.014353	no	HRTAA
chr1_1223061_GCA_G_b38	RP4-758J18.2	-2.716	0.00698	-0.071033	3	0.026151	no	HRTAA
chr1_916753_C_T_b38	RP4-758J18.2	-2.698	0.00738	-0.047863	16	0.017743	no	HRTAA
chr1_621475_C_T_b38	RP4-758J18.2	2.675	0.00788	0.096437	4	0.036051	no	HRTAA
chr1_1683909_A_C_b38	RP4-758J18.2	-2.674	0.00791	-0.037512	67	0.014029	no	HRTAA
chr1_1715745_G_A_b38	RP4-758J18.2	-2.664	0.00813	-0.037925	52	0.014234	no	HRTAA
chr1_1848358_A_T_b38	RP4-758J18.2	2.647	0.00855	0.048993	11	0.018508	no	HRTAA
chr1_1366976_GTTGAA_G_b38	RP4-758J18.2	-2.646	0.00858	-0.089129	3	0.033688	no	HRTAA
chr1_1697272_G_A_b38	RP4-758J18.2	2.638	0.00876	0.058975	19	0.022352	no	HRTAA
chr1_1079456_A_G_b38	RP4-758J18.2	2.621	0.00921	0.032877	98	0.012544	no	HRTAA
chr1_1847293_A_ACAACAAAATCCCTTTTT_b38	RP4-758J18.2	-2.611	0.00949	-0.062203	5	0.023827	no	HRTAA
chr1_1856365_C_G_b38	RP4-758J18.2	-2.611	0.00949	-0.062203	5	0.023827	no	HRTAA
chr1_1891375_G_A_b38	RP4-758J18.2	-2.611	0.00949	-0.062203	5	0.023827	no	HRTAA
chr1_1780989_A_C_b38	RP4-758J18.2	-2.603	0.0097	-0.061724	5	0.023715	no	HRTAA
chr1_1761550_G_A_b38	RP4-758J18.2	-2.597	0.00988	-0.062795	4	0.024184	no	HRTAA
chr1_1657902_T_TA_b38	RP4-758J18.2	3.149	0.0018	0.069359	7	0.022028	yes	HRTLV
chr1_1028979_GCCACGCCACCCTCTCCCAAGGAACCGAGCCCCAGCCCCTCGTGGGCCAAGGGCGCCCACAC_G_b38	RP4-758J18.2	3.078	0.00227	0.069623	6	0.022623	yes	HRTLV
chr1_1602507_C_A_b38	RP4-758J18.2	-3.077	0.00228	-0.042681	39	0.013873	yes	HRTLV
chr1_1622295_G_C_b38	RP4-758J18.2	3.061	0.00239	0.041586	38	0.013584	yes	HRTLV
chr1_1190394_C_G_b38	RP4-758J18.2	-2.928	0.00365	-0.066404	3	0.022676	yes	HRTLV
chr1_1606532_G_A_b38	RP4-758J18.2	-2.924	0.0037	-0.045723	23	0.015637	yes	HRTLV
chr1_1602666_G_A_b38	RP4-758J18.2	-2.832	0.00493	-0.03947	39	0.013938	yes	HRTLV
chr1_1184478_C_T_b38	RP4-758J18.2	-2.72	0.0069	-0.058601	21	0.021546	yes	HRTLV
chr1_1945913_T_C_b38	RP4-758J18.2	-2.687	0.00759	-0.04517	10	0.016809	yes	HRTLV
chr1_1945799_T_G_b38	RP4-758J18.2	-2.631	0.00894	-0.045552	10	0.017316	yes	HRTLV
chr1_2337239_T_C_b38	RP4-758J18.2	2.616	0.00932	0.038251	34	0.014621	yes	HRTLV
chr1_1924011_A_G_b38	RP4-758J18.2	-2.614	0.00939	-0.047492	7	0.018171	yes	HRTLV
chr1_1938054_ACT_A_b38	RP4-758J18.2	-2.599	0.00978	-0.033992	90	0.013078	yes	HRTLV
chr1_618877_G_A_b38	RP4-758J18.2	4.045	6.58e-05	0.109148	3	0.026982	no	HRTLV
chr1_1609196_CA_C_b38	RP4-758J18.2	3.92	0.000109	0.057507	37	0.014671	no	HRTLV
chr1_1624323_AT_A_b38	RP4-758J18.2	3.515	0.000505	0.045641	63	0.012986	no	HRTLV
chr1_1612562_T_TC_b38	RP4-758J18.2	3.506	0.000521	0.047857	36	0.013649	no	HRTLV
chr1_1589418_T_TA_b38	RP4-758J18.2	3.475	0.000582	0.047872	55	0.013774	no	HRTLV
chr1_1190043_C_T_b38	RP4-758J18.2	-3.308	0.00105	-0.074192	3	0.02243	no	HRTLV
chr1_1607931_G_A_b38	RP4-758J18.2	3.285	0.00114	0.044255	38	0.013473	no	HRTLV
chr1_1609070_G_A_b38	RP4-758J18.2	-3.272	0.00119	-0.044703	48	0.013662	no	HRTLV
chr1_1600320_C_G_b38	RP4-758J18.2	3.259	0.00124	0.044423	36	0.013629	no	HRTLV
chr1_1606559_C_G_b38	RP4-758J18.2	-3.256	0.00125	-0.046381	33	0.014244	no	HRTLV
chr1_1609058_G_A_b38	RP4-758J18.2	3.247	0.00129	0.043672	38	0.01345	no	HRTLV
chr1_1362790_A_ATT_b38	RP4-758J18.2	3.241	0.00132	0.061892	8	0.019095	no	HRTLV
chr1_1608603_C_A_b38	RP4-758J18.2	-3.191	0.00156	-0.043841	47	0.013741	no	HRTLV
chr1_1621352_G_A_b38	RP4-758J18.2	3.186	0.00159	0.043351	38	0.013607	no	HRTLV
chr1_1610924_C_T_b38	RP4-758J18.2	-3.167	0.00169	-0.0435	47	0.013736	no	HRTLV
chr1_1618118_G_A_b38	RP4-758J18.2	-3.167	0.00169	-0.0435	47	0.013736	no	HRTLV
chr1_1606539_G_GCC_b38	RP4-758J18.2	-3.138	0.00186	-0.048229	24	0.015367	no	HRTLV
chr1_1622510_C_T_b38	RP4-758J18.2	-3.108	0.00205	-0.043001	46	0.013834	no	HRTLV
chr1_1629572_TG_T_b38	RP4-758J18.2	-3.103	0.00209	-0.04257	48	0.01372	no	HRTLV
chr1_1589491_A_G_b38	RP4-758J18.2	-3.097	0.00213	-0.041	52	0.013237	no	HRTLV
chr1_1600379_C_T_b38	RP4-758J18.2	3.09	0.00218	0.04165	38	0.013479	no	HRTLV
chr1_1613769_C_T_b38	RP4-758J18.2	3.063	0.00238	0.042965	37	0.014027	no	HRTLV
chr1_1613090_A_G_b38	RP4-758J18.2	-3.059	0.00241	-0.042189	47	0.013793	no	HRTLV
chr1_1594614_G_C_b38	RP4-758J18.2	-3.047	0.00251	-0.042339	45	0.013897	no	HRTLV
chr1_1590682_T_C_b38	RP4-758J18.2	-3.044	0.00253	-0.040369	51	0.013262	no	HRTLV
chr1_1628409_C_A_b38	RP4-758J18.2	-3.003	0.00289	-0.041141	47	0.013701	no	HRTLV
chr1_1620609_G_A_b38	RP4-758J18.2	2.988	0.00303	0.040626	38	0.013595	no	HRTLV
chr1_1628814_C_T_b38	RP4-758J18.2	-2.987	0.00304	-0.041044	47	0.013742	no	HRTLV
chr1_1595028_C_CAG_b38	RP4-758J18.2	2.978	0.00313	0.043212	27	0.014511	no	HRTLV
chr1_1592572_T_C_b38	RP4-758J18.2	-2.958	0.00333	-0.040582	45	0.013719	no	HRTLV
chr1_1589151_C_T_b38	RP4-758J18.2	-2.955	0.00336	-0.039487	50	0.013364	no	HRTLV
chr1_1589057_T_C_b38	RP4-758J18.2	-2.948	0.00344	-0.039591	50	0.013429	no	HRTLV
chr1_1616048_C_T_b38	RP4-758J18.2	-2.928	0.00366	-0.040069	50	0.013685	no	HRTLV
chr1_1606536_GCT_G_b38	RP4-758J18.2	-2.908	0.00389	-0.044921	24	0.015445	no	HRTLV
chr1_1597128_C_CCCTCAGCTGGACT_b38	RP4-758J18.2	-2.902	0.00397	-0.036937	64	0.012729	no	HRTLV
chr1_1383798_AG_A_b38	RP4-758J18.2	2.894	0.00407	0.06736	6	0.023273	no	HRTLV
chr1_1624720_G_A_b38	RP4-758J18.2	-2.839	0.00482	-0.039299	48	0.013841	no	HRTLV
chr1_1625805_G_A_b38	RP4-758J18.2	-2.826	0.00501	-0.039178	48	0.013863	no	HRTLV
chr1_1303675_C_CCCT_b38	RP4-758J18.2	2.813	0.00522	0.055783	3	0.019832	no	HRTLV
chr1_1625951_G_A_b38	RP4-758J18.2	-2.806	0.00533	-0.037212	55	0.013261	no	HRTLV
chr1_1627515_C_T_b38	RP4-758J18.2	2.775	0.00586	0.035482	75	0.012788	no	HRTLV
chr1_1589495_CTTT_C_b38	RP4-758J18.2	2.764	0.00605	0.042282	25	0.015298	no	HRTLV
chr1_1606532_GTGGGCTGGGCTGGTCAGGCA_G_b38	RP4-758J18.2	2.748	0.00635	0.037392	36	0.013609	no	HRTLV
chr1_1594890_G_GAC_b38	RP4-758J18.2	-2.736	0.00657	-0.035476	74	0.012967	no	HRTLV
chr1_1385384_G_A_b38	RP4-758J18.2	2.734	0.00661	0.06281	6	0.022972	no	HRTLV
chr1_1596144_GAGAC_G_b38	RP4-758J18.2	-2.731	0.00667	-0.037511	46	0.013734	no	HRTLV
chr1_1613330_A_AT_b38	RP4-758J18.2	-2.73	0.00669	-0.039381	41	0.014427	no	HRTLV
chr1_1395050_G_A_b38	RP4-758J18.2	-2.722	0.00684	-0.062937	6	0.023119	no	HRTLV
chr1_1375698_G_T_b38	RP4-758J18.2	2.714	0.00701	0.060943	6	0.022455	no	HRTLV
chr1_1376153_G_C_b38	RP4-758J18.2	2.714	0.00701	0.060943	6	0.022455	no	HRTLV
chr1_1376752_T_C_b38	RP4-758J18.2	2.714	0.00701	0.060943	6	0.022455	no	HRTLV
chr1_1378635_C_T_b38	RP4-758J18.2	2.714	0.00701	0.060943	6	0.022455	no	HRTLV
chr1_1378792_C_T_b38	RP4-758J18.2	2.714	0.00701	0.060943	6	0.022455	no	HRTLV
chr1_1378865_C_T_b38	RP4-758J18.2	2.714	0.00701	0.060943	6	0.022455	no	HRTLV
chr1_1379334_A_G_b38	RP4-758J18.2	2.714	0.00701	0.060943	6	0.022455	no	HRTLV
chr1_1415221_G_T_b38	RP4-758J18.2	-2.713	0.00704	-0.055449	11	0.02044	no	HRTLV
chr1_1605347_C_T_b38	RP4-758J18.2	-2.703	0.00725	-0.037353	47	0.013821	no	HRTLV
chr1_1208038_T_C_b38	RP4-758J18.2	-2.7	0.00732	-0.065489	10	0.024259	no	HRTLV
chr1_1417561_A_G_b38	RP4-758J18.2	-2.698	0.00736	-0.056152	11	0.020814	no	HRTLV
chr1_1593732_G_C_b38	RP4-758J18.2	-2.684	0.00766	-0.034295	76	0.012778	no	HRTLV
chr1_1380513_C_T_b38	RP4-758J18.2	2.661	0.00819	0.060947	6	0.022903	no	HRTLV
chr1_1381290_C_G_b38	RP4-758J18.2	2.661	0.00819	0.060947	6	0.022903	no	HRTLV
chr1_1587352_A_G_b38	RP4-758J18.2	-2.658	0.00827	-0.036059	66	0.013568	no	HRTLV
chr1_800909_T_A_b38	RP4-758J18.2	2.634	0.00886	0.049043	6	0.018622	no	HRTLV
chr1_1624086_G_A_b38	RP4-758J18.2	-2.632	0.0089	-0.034003	66	0.012917	no	HRTLV
chr1_1378484_AT_A_b38	RP4-758J18.2	2.608	0.00953	0.042374	57	0.016245	no	HRTLV
chr1_1658830_C_G_b38	RP4-758J18.2	-3.604	0.000755	-0.1781	3	0.049418	yes	KDNCTX
chr1_2342999_A_G_b38	RP4-758J18.2	3.309	0.0018	0.148322	4	0.044822	yes	KDNCTX
chr1_975555_G_A_b38	RP4-758J18.2	3.224	0.0023	0.136697	7	0.042399	yes	KDNCTX
chr1_939779_AGCCAGTGGACGCCGACCT_A_b38	RP4-758J18.2	-3.146	0.00287	-0.112858	20	0.035868	yes	KDNCTX
chr1_1744854_C_A_b38	RP4-758J18.2	2.819	0.00704	0.102821	8	0.03648	yes	KDNCTX
chr1_2347209_A_G_b38	RP4-758J18.2	2.768	0.00805	0.138338	4	0.049979	yes	KDNCTX
chr1_2189679_C_T_b38	RP4-758J18.2	2.891	0.0058	0.131034	8	0.045331	no	KDNCTX
chr1_1668721_C_T_b38	RP4-758J18.2	-2.875	0.00605	-0.133887	4	0.046565	no	KDNCTX
chr1_1670423_AT_A_b38	RP4-758J18.2	2.818	0.00705	0.1383	10	0.049083	no	KDNCTX
chr1_2054074_C_G_b38	RP4-758J18.2	-2.751	0.00841	-0.125914	4	0.045766	no	KDNCTX
chr1_2054114_T_C_b38	RP4-758J18.2	-2.751	0.00841	-0.125914	4	0.045766	no	KDNCTX
chr1_2337239_T_C_b38	RP4-758J18.2	4.136	5.6e-05	0.090434	18	0.021867	yes	LIVER
chr1_2375256_C_T_b38	RP4-758J18.2	3.677	0.000318	0.073328	28	0.019942	yes	LIVER
chr1_2374713_C_T_b38	RP4-758J18.2	3.62	0.00039	0.072369	28	0.019991	yes	LIVER
chr1_2337299_A_G_b38	RP4-758J18.2	3.615	0.000397	0.076656	26	0.021206	yes	LIVER
chr1_2342133_C_G_b38	RP4-758J18.2	-3.513	0.000569	-0.092159	8	0.026231	yes	LIVER
chr1_2342137_G_A_b38	RP4-758J18.2	-3.513	0.000569	-0.092159	8	0.026231	yes	LIVER
chr1_2041023_T_C_b38	RP4-758J18.2	3.275	0.00129	0.107484	4	0.032824	yes	LIVER
chr1_2385630_A_C_b38	RP4-758J18.2	3.262	0.00134	0.070722	19	0.021682	yes	LIVER
chr1_1565105_CAAGGCAGGCGGATCATG_C_b38	RP4-758J18.2	-3.211	0.00159	-0.072308	31	0.022522	yes	LIVER
chr1_1570294_CA_C_b38	RP4-758J18.2	-3.196	0.00167	-0.072085	26	0.022555	yes	LIVER
chr1_2375533_G_A_b38	RP4-758J18.2	3.105	0.00224	0.066327	21	0.021362	yes	LIVER
chr1_2354645_C_T_b38	RP4-758J18.2	-3.09	0.00235	-0.079744	9	0.02581	yes	LIVER
chr1_2354688_G_C_b38	RP4-758J18.2	-3.09	0.00235	-0.079744	9	0.02581	yes	LIVER
chr1_2362229_A_G_b38	RP4-758J18.2	-3.09	0.00235	-0.079744	9	0.02581	yes	LIVER
chr1_2383024_G_T_b38	RP4-758J18.2	3.079	0.00243	0.065929	21	0.021411	yes	LIVER
chr1_2383716_CA_C_b38	RP4-758J18.2	3.079	0.00243	0.065929	21	0.021411	yes	LIVER
chr1_2384278_A_G_b38	RP4-758J18.2	3.04	0.00275	0.059534	42	0.019583	yes	LIVER
chr1_1558204_T_TAAAAAA_b38	RP4-758J18.2	-2.993	0.00318	-0.070866	15	0.023674	yes	LIVER
chr1_2298039_C_T_b38	RP4-758J18.2	2.935	0.00381	0.078316	4	0.026687	yes	LIVER
chr1_2372759_GACC_G_b38	RP4-758J18.2	2.931	0.00385	0.062823	21	0.021434	yes	LIVER
chr1_2372762_C_CTG_b38	RP4-758J18.2	2.931	0.00385	0.062823	21	0.021434	yes	LIVER
chr1_1573265_C_CAAAA_b38	RP4-758J18.2	-2.925	0.00392	-0.077759	12	0.026585	yes	LIVER
chr1_2043456_T_C_b38	RP4-758J18.2	2.912	0.00408	0.098485	3	0.033816	yes	LIVER
chr1_1565680_A_AG_b38	RP4-758J18.2	-2.907	0.00415	-0.067453	28	0.023206	yes	LIVER
chr1_1569180_T_A_b38	RP4-758J18.2	-2.895	0.0043	-0.066941	29	0.023124	yes	LIVER
chr1_2379954_A_G_b38	RP4-758J18.2	-2.887	0.0044	-0.06198	17	0.021468	yes	LIVER
chr1_2290929_G_A_b38	RP4-758J18.2	2.869	0.00465	0.06116	30	0.021318	yes	LIVER
chr1_1559750_C_CAG_b38	RP4-758J18.2	-2.868	0.00466	-0.065633	30	0.022882	yes	LIVER
chr1_1561628_T_C_b38	RP4-758J18.2	-2.868	0.00466	-0.065633	30	0.022882	yes	LIVER
chr1_1563918_A_G_b38	RP4-758J18.2	-2.868	0.00466	-0.065633	30	0.022882	yes	LIVER
chr1_1565561_A_G_b38	RP4-758J18.2	-2.868	0.00466	-0.065633	30	0.022882	yes	LIVER
chr1_1566086_G_A_b38	RP4-758J18.2	-2.868	0.00466	-0.065633	30	0.022882	yes	LIVER
chr1_1567715_G_A_b38	RP4-758J18.2	-2.868	0.00466	-0.065633	30	0.022882	yes	LIVER
chr1_1567719_A_C_b38	RP4-758J18.2	-2.868	0.00466	-0.065633	30	0.022882	yes	LIVER
chr1_1569875_C_T_b38	RP4-758J18.2	-2.868	0.00466	-0.065633	30	0.022882	yes	LIVER
chr1_2341705_A_G_b38	RP4-758J18.2	2.859	0.0048	0.059221	47	0.020717	yes	LIVER
chr1_2337352_A_G_b38	RP4-758J18.2	2.847	0.00497	0.061554	32	0.021624	yes	LIVER
chr1_2351215_T_G_b38	RP4-758J18.2	-2.843	0.00502	-0.072803	10	0.025604	yes	LIVER
chr1_1538787_A_G_b38	RP4-758J18.2	-2.843	0.00502	-0.064854	29	0.022809	yes	LIVER
chr1_2291058_G_A_b38	RP4-758J18.2	2.829	0.00524	0.060871	30	0.021515	yes	LIVER
chr1_2316305_G_A_b38	RP4-758J18.2	2.801	0.0057	0.080071	3	0.028586	yes	LIVER
chr1_2362863_C_CA_b38	RP4-758J18.2	-2.794	0.00581	-0.074482	7	0.026657	yes	LIVER
chr1_2371226_C_CACAACCACA_b38	RP4-758J18.2	2.755	0.00651	0.057595	42	0.020902	yes	LIVER
chr1_2290536_C_CG_b38	RP4-758J18.2	2.75	0.00662	0.05927	30	0.021553	yes	LIVER
chr1_1539491_G_C_b38	RP4-758J18.2	-2.738	0.00685	-0.063276	28	0.023109	yes	LIVER
chr1_1549590_C_G_b38	RP4-758J18.2	-2.722	0.00719	-0.06192	29	0.022751	yes	LIVER
chr1_1553692_A_G_b38	RP4-758J18.2	-2.722	0.00719	-0.06192	29	0.022751	yes	LIVER
chr1_1554694_A_G_b38	RP4-758J18.2	-2.722	0.00719	-0.06192	29	0.022751	yes	LIVER
chr1_1554781_A_G_b38	RP4-758J18.2	-2.722	0.00719	-0.06192	29	0.022751	yes	LIVER
chr1_1554852_T_C_b38	RP4-758J18.2	-2.722	0.00719	-0.06192	29	0.022751	yes	LIVER
chr1_1555247_T_A_b38	RP4-758J18.2	-2.722	0.00719	-0.06192	29	0.022751	yes	LIVER
chr1_2351678_C_T_b38	RP4-758J18.2	-2.713	0.00737	-0.068887	10	0.025395	yes	LIVER
chr1_2326052_C_T_b38	RP4-758J18.2	2.702	0.0076	0.057943	18	0.021445	yes	LIVER
chr1_1551557_A_AG_b38	RP4-758J18.2	-2.688	0.00791	-0.062705	26	0.023323	yes	LIVER
chr1_1551559_A_T_b38	RP4-758J18.2	-2.688	0.00791	-0.062705	26	0.023323	yes	LIVER
chr1_1572532_A_C_b38	RP4-758J18.2	-2.683	0.00803	-0.061648	30	0.022978	yes	LIVER
chr1_1573079_A_G_b38	RP4-758J18.2	-2.683	0.00803	-0.061648	30	0.022978	yes	LIVER
chr1_1547630_G_A_b38	RP4-758J18.2	-2.681	0.00809	-0.057548	28	0.021469	yes	LIVER
chr1_2297717_C_T_b38	RP4-758J18.2	-2.669	0.00837	-0.06543	10	0.024518	yes	LIVER
chr1_2326492_G_A_b38	RP4-758J18.2	2.666	0.00843	0.057974	17	0.021747	yes	LIVER
chr1_2298478_C_T_b38	RP4-758J18.2	-2.656	0.00867	-0.064777	10	0.024389	yes	LIVER
chr1_2292427_C_T_b38	RP4-758J18.2	2.629	0.00935	0.054844	33	0.020857	yes	LIVER
chr1_2043528_G_A_b38	RP4-758J18.2	2.623	0.00953	0.086235	6	0.032878	yes	LIVER
chr1_2324806_A_T_b38	RP4-758J18.2	3.997	9.6e-05	0.08166	26	0.020429	no	LIVER
chr1_2333737_T_C_b38	RP4-758J18.2	3.76	0.000234	0.077038	25	0.020487	no	LIVER
chr1_2334530_T_G_b38	RP4-758J18.2	3.714	0.000278	0.076764	24	0.020671	no	LIVER
chr1_2329106_G_A_b38	RP4-758J18.2	3.669	0.000327	0.073061	49	0.019914	no	LIVER
chr1_2324977_G_GGCT_b38	RP4-758J18.2	3.622	0.000387	0.074087	28	0.020453	no	LIVER
chr1_2392897_T_C_b38	RP4-758J18.2	3.494	0.00061	0.074355	20	0.021283	no	LIVER
chr1_2376477_A_C_b38	RP4-758J18.2	3.398	0.000849	0.067828	48	0.019961	no	LIVER
chr1_2323077_G_A_b38	RP4-758J18.2	3.375	0.000919	0.071292	36	0.021126	no	LIVER
chr1_2327034_G_A_b38	RP4-758J18.2	3.341	0.00103	0.068322	29	0.020448	no	LIVER
chr1_2326288_C_T_b38	RP4-758J18.2	3.26	0.00135	0.066441	27	0.020383	no	LIVER
chr1_2326424_C_T_b38	RP4-758J18.2	3.26	0.00135	0.066441	27	0.020383	no	LIVER
chr1_2326884_C_T_b38	RP4-758J18.2	3.26	0.00135	0.066441	27	0.020383	no	LIVER
chr1_2392128_T_C_b38	RP4-758J18.2	3.191	0.00169	0.065713	42	0.020594	no	LIVER
chr1_1111365_CA_C_b38	RP4-758J18.2	-3.108	0.00222	-0.083408	6	0.026838	no	LIVER
chr1_2338659_A_G_b38	RP4-758J18.2	3.06	0.00258	0.064057	41	0.020933	no	LIVER
chr1_2348393_G_A_b38	RP4-758J18.2	-2.993	0.00318	-0.075587	10	0.025255	no	LIVER
chr1_2387989_A_G_b38	RP4-758J18.2	2.976	0.00335	0.061618	43	0.020702	no	LIVER
chr1_1685108_CA_C_b38	RP4-758J18.2	-2.899	0.00425	-0.066758	16	0.023027	no	LIVER
chr1_1056597_G_A_b38	RP4-758J18.2	2.889	0.00437	0.053061	54	0.018364	no	LIVER
chr1_2391602_T_C_b38	RP4-758J18.2	-2.881	0.00448	-0.061848	17	0.021467	no	LIVER
chr1_2384876_A_G_b38	RP4-758J18.2	2.873	0.00459	0.059061	50	0.020554	no	LIVER
chr1_2383824_C_G_b38	RP4-758J18.2	2.856	0.00483	0.058304	28	0.020413	no	LIVER
chr1_2350750_AGGGGTGGCACG_A_b38	RP4-758J18.2	-2.829	0.00524	-0.069288	13	0.024494	no	LIVER
chr1_2371077_T_C_b38	RP4-758J18.2	2.759	0.00645	0.056876	44	0.020615	no	LIVER
chr1_2290738_G_A_b38	RP4-758J18.2	2.724	0.00714	0.076226	3	0.027984	no	LIVER
chr1_2384241_A_G_b38	RP4-758J18.2	2.692	0.00782	0.055672	50	0.020679	no	LIVER
chr1_2389263_T_C_b38	RP4-758J18.2	-2.647	0.00889	-0.059987	16	0.022658	no	LIVER
chr1_2364657_A_T_b38	RP4-758J18.2	-2.647	0.00889	-0.055371	37	0.020918	no	LIVER
chr1_2364658_A_T_b38	RP4-758J18.2	-2.647	0.00889	-0.055371	37	0.020918	no	LIVER
chr1_2341692_GA_G_b38	RP4-758J18.2	2.626	0.00945	0.057289	21	0.021818	no	LIVER
chr1_1366183_TGA_T_b38	RP4-758J18.2	-8.834	2.37e-17	-0.132354	3	0.014983	yes	LUNG
chr1_1319648_G_A_b38	RP4-758J18.2	-8.804	2.97e-17	-0.130524	3	0.014825	yes	LUNG
chr1_1389777_G_A_b38	RP4-758J18.2	-8.712	5.98e-17	-0.130438	3	0.014973	yes	LUNG
chr1_1356751_A_G_b38	RP4-758J18.2	-8.569	1.75e-16	-0.128754	3	0.015026	yes	LUNG
chr1_1400626_C_T_b38	RP4-758J18.2	-8.564	1.8e-16	-0.12897	3	0.015059	yes	LUNG
chr1_1296207_G_A_b38	RP4-758J18.2	-8.548	2.03e-16	-0.124316	3	0.014543	yes	LUNG
chr1_1223061_GCA_G_b38	RP4-758J18.2	-4.559	6.66e-06	-0.065538	3	0.014376	yes	LUNG
chr1_1279441_C_T_b38	RP4-758J18.2	-4.422	1.23e-05	-0.061431	4	0.013893	yes	LUNG
chr1_1174690_G_A_b38	RP4-758J18.2	-3.606	0.000346	-0.052339	4	0.014514	yes	LUNG
chr1_2342840_A_ATATTTTATTT_b38	RP4-758J18.2	3.373	0.000809	0.047017	13	0.01394	yes	LUNG
chr1_1481071_T_C_b38	RP4-758J18.2	-3.123	0.00191	-0.046251	13	0.01481	yes	LUNG
chr1_1308552_GGA_G_b38	RP4-758J18.2	-2.792	0.00547	-0.036039	13	0.012909	yes	LUNG
chr1_1089921_T_C_b38	RP4-758J18.2	2.788	0.00553	0.036186	5	0.012978	yes	LUNG
chr1_1485324_C_T_b38	RP4-758J18.2	-2.788	0.00554	-0.038192	3	0.0137	yes	LUNG
chr1_857828_C_G_b38	RP4-758J18.2	2.767	0.0059	0.026621	62	0.009621	yes	LUNG
chr1_1773715_T_TGAGAGA_b38	RP4-758J18.2	-2.76	0.00602	-0.044201	3	0.016015	yes	LUNG
chr1_1814287_G_A_b38	RP4-758J18.2	-2.727	0.00664	-0.035574	4	0.013044	yes	LUNG
chr1_1657926_A_G_b38	RP4-758J18.2	2.722	0.00673	0.028972	5	0.010642	yes	LUNG
chr1_1547675_G_A_b38	RP4-758J18.2	-2.711	0.00698	-0.037758	3	0.01393	yes	LUNG
chr1_1515828_G_A_b38	RP4-758J18.2	-2.668	0.00791	-0.036969	3	0.013857	yes	LUNG
chr1_1340697_G_A_b38	RP4-758J18.2	2.668	0.00792	0.024298	30	0.009108	yes	LUNG
chr1_1056602_T_C_b38	RP4-758J18.2	2.658	0.00815	0.027546	31	0.010365	yes	LUNG
chr1_2026833_CA_C_b38	RP4-758J18.2	-2.634	0.00874	-0.024864	21	0.00944	yes	LUNG
chr1_1813304_C_T_b38	RP4-758J18.2	-2.619	0.00912	-0.037071	3	0.014155	yes	LUNG
chr1_2032636_T_C_b38	RP4-758J18.2	-2.618	0.00916	-0.026285	17	0.010042	yes	LUNG
chr1_1775447_G_A_b38	RP4-758J18.2	-2.594	0.0098	-0.033231	5	0.01281	yes	LUNG
chr1_1236037_C_T_b38	RP4-758J18.2	-3.306	0.00102	-0.026011	95	0.007867	no	LUNG
chr1_1725582_T_C_b38	RP4-758J18.2	-3.251	0.00124	-0.023152	119	0.007123	no	LUNG
chr1_1075715_A_G_b38	RP4-758J18.2	2.899	0.00393	0.036107	7	0.012455	no	LUNG
chr1_1495136_G_A_b38	RP4-758J18.2	-2.84	0.00471	-0.038555	4	0.013574	no	LUNG
chr1_940687_C_T_b38	RP4-758J18.2	-2.809	0.00519	-0.041512	3	0.01478	no	LUNG
chr1_2288952_C_T_b38	RP4-758J18.2	-2.785	0.00558	-0.068028	3	0.024423	no	LUNG
chr1_2325110_T_TTCCC_b38	RP4-758J18.2	2.666	0.00796	0.046437	6	0.017419	no	LUNG
chr1_1479704_G_A_b38	RP4-758J18.2	-2.63	0.00885	-0.033157	9	0.01261	no	LUNG
chr1_626516_A_AT_b38	RP4-758J18.2	2.591	0.00988	0.052365	5	0.02021	no	LUNG
chr1_2275005_A_G_b38	RP4-758J18.2	3.712	0.000316	0.071702	9	0.019318	yes	SLVRYG
chr1_2283304_C_T_b38	RP4-758J18.2	-3.454	0.000767	-0.063386	25	0.01835	yes	SLVRYG
chr1_2118713_C_CTG_b38	RP4-758J18.2	-3.298	0.00129	-0.081327	3	0.024658	yes	SLVRYG
chr1_2369336_A_G_b38	RP4-758J18.2	2.9	0.00445	0.064872	7	0.022368	yes	SLVRYG
chr1_1474201_CT_C_b38	RP4-758J18.2	-2.9	0.00445	-0.091228	7	0.031457	yes	SLVRYG
chr1_2231034_C_T_b38	RP4-758J18.2	-2.84	0.00532	-0.072102	5	0.025389	yes	SLVRYG
chr1_925081_G_A_b38	RP4-758J18.2	-2.761	0.00668	-0.093838	8	0.033986	yes	SLVRYG
chr1_925141_C_A_b38	RP4-758J18.2	-2.761	0.00668	-0.093838	8	0.033986	yes	SLVRYG
chr1_925628_G_C_b38	RP4-758J18.2	-2.761	0.00668	-0.093838	8	0.033986	yes	SLVRYG
chr1_926428_A_G_b38	RP4-758J18.2	-2.761	0.00668	-0.093838	8	0.033986	yes	SLVRYG
chr1_926713_T_C_b38	RP4-758J18.2	-2.761	0.00668	-0.093838	8	0.033986	yes	SLVRYG
chr1_926744_A_G_b38	RP4-758J18.2	-2.761	0.00668	-0.093838	8	0.033986	yes	SLVRYG
chr1_927003_C_T_b38	RP4-758J18.2	-2.761	0.00668	-0.093838	8	0.033986	yes	SLVRYG
chr1_927009_A_G_b38	RP4-758J18.2	-2.761	0.00668	-0.093838	8	0.033986	yes	SLVRYG
chr1_961945_G_C_b38	RP4-758J18.2	-2.714	0.00765	-0.082757	3	0.030497	yes	SLVRYG
chr1_2274142_C_A_b38	RP4-758J18.2	2.712	0.00769	0.04643	28	0.017122	yes	SLVRYG
chr1_928483_G_A_b38	RP4-758J18.2	2.687	0.00825	0.089492	5	0.033307	yes	SLVRYG
chr1_958339_G_A_b38	RP4-758J18.2	-2.685	0.0083	-0.079476	3	0.029599	yes	SLVRYG
chr1_2277312_A_C_b38	RP4-758J18.2	2.682	0.00836	0.065663	3	0.024479	yes	SLVRYG
chr1_1835922_G_GA_b38	RP4-758J18.2	2.675	0.00854	0.0669	7	0.02501	yes	SLVRYG
chr1_1240684_G_GCCGCCCCCATTCACCCCGGCCGTGGTCCCTGCCCCAGCCCCCA_b38	RP4-758J18.2	-2.648	0.0092	-0.073235	8	0.027653	yes	SLVRYG
chr1_2344932_C_A_b38	RP4-758J18.2	2.629	0.0097	0.061329	6	0.023326	yes	SLVRYG
chr1_2346676_G_C_b38	RP4-758J18.2	2.629	0.0097	0.061329	6	0.023326	yes	SLVRYG
chr1_2350287_A_C_b38	RP4-758J18.2	2.629	0.0097	0.061329	6	0.023326	yes	SLVRYG
chr1_2353047_C_T_b38	RP4-758J18.2	2.629	0.0097	0.061329	6	0.023326	yes	SLVRYG
chr1_2280205_T_A_b38	RP4-758J18.2	2.626	0.00977	0.059887	4	0.022802	yes	SLVRYG
chr1_2323077_G_A_b38	RP4-758J18.2	2.795	0.00607	0.050918	23	0.01822	no	SLVRYG
chr1_2365220_A_G_b38	RP4-758J18.2	2.72	0.00752	0.06352	6	0.023354	no	SLVRYG
chr1_2233384_G_T_b38	RP4-758J18.2	-2.712	0.00768	-0.06789	5	0.025029	no	SLVRYG
chr1_924024_C_G_b38	RP4-758J18.2	-2.663	0.00881	-0.089678	9	0.03367	no	SLVRYG
chr1_1213936_C_G_b38	RP4-758J18.2	-2.65	0.00914	-0.088272	4	0.033304	no	SLVRYG
chr1_1389777_G_A_b38	RP4-758J18.2	-9.333	1.7e-19	-0.15325	3	0.01642	yes	MSCLSK
chr1_1400626_C_T_b38	RP4-758J18.2	-9.285	2.53e-19	-0.154419	3	0.016631	yes	MSCLSK
chr1_1366183_TGA_T_b38	RP4-758J18.2	-9.04	1.87e-18	-0.150823	3	0.016684	yes	MSCLSK
chr1_1319648_G_A_b38	RP4-758J18.2	-8.944	4.08e-18	-0.148716	3	0.016628	yes	MSCLSK
chr1_1356751_A_G_b38	RP4-758J18.2	-8.614	5.59e-17	-0.144817	3	0.016813	yes	MSCLSK
chr1_1296207_G_A_b38	RP4-758J18.2	-8.526	1.11e-16	-0.13906	3	0.01631	yes	MSCLSK
chr1_1430020_G_C_b38	RP4-758J18.2	-4.43	1.11e-05	-0.074567	3	0.016833	yes	MSCLSK
chr1_1223061_GCA_G_b38	RP4-758J18.2	-3.921	9.76e-05	-0.06398	4	0.016315	yes	MSCLSK
chr1_1279441_C_T_b38	RP4-758J18.2	-3.525	0.000453	-0.053338	6	0.015129	yes	MSCLSK
chr1_1725339_C_A_b38	RP4-758J18.2	-3.306	0.001	-0.026002	133	0.007865	yes	MSCLSK
chr1_1174690_G_A_b38	RP4-758J18.2	-3.244	0.00124	-0.0533	4	0.016431	yes	MSCLSK
chr1_670270_C_T_b38	RP4-758J18.2	3.2	0.00144	0.055618	3	0.017378	yes	MSCLSK
chr1_631412_T_C_b38	RP4-758J18.2	3.2	0.00144	0.068365	10	0.021365	yes	MSCLSK
chr1_1248798_T_C_b38	RP4-758J18.2	-3.166	0.00162	-0.081817	3	0.025839	yes	MSCLSK
chr1_588111_A_C_b38	RP4-758J18.2	3.165	0.00162	0.084302	3	0.026634	yes	MSCLSK
chr1_656888_G_T_b38	RP4-758J18.2	3.147	0.00172	0.03743	4	0.011892	yes	MSCLSK
chr1_1120968_G_A_b38	RP4-758J18.2	3.137	0.00178	0.036434	21	0.011614	yes	MSCLSK
chr1_1495136_G_A_b38	RP4-758J18.2	-3.13	0.00183	-0.047847	7	0.015289	yes	MSCLSK
chr1_1184997_T_A_b38	RP4-758J18.2	-3.124	0.00187	-0.081719	3	0.026161	yes	MSCLSK
chr1_2026833_CA_C_b38	RP4-758J18.2	-3.06	0.00231	-0.030445	31	0.009949	yes	MSCLSK
chr1_1684817_G_C_b38	RP4-758J18.2	3.057	0.00233	0.027807	96	0.009097	yes	MSCLSK
chr1_1119513_T_C_b38	RP4-758J18.2	3.002	0.00278	0.034453	31	0.011475	yes	MSCLSK
chr1_1308552_GGA_G_b38	RP4-758J18.2	-2.982	0.00297	-0.039214	22	0.013148	yes	MSCLSK
chr1_1115274_C_CA_b38	RP4-758J18.2	2.949	0.00331	0.03386	31	0.011482	yes	MSCLSK
chr1_1114570_A_G_b38	RP4-758J18.2	2.944	0.00335	0.033977	31	0.01154	yes	MSCLSK
chr1_1515828_G_A_b38	RP4-758J18.2	-2.936	0.00345	-0.045671	6	0.015557	yes	MSCLSK
chr1_1118344_A_G_b38	RP4-758J18.2	2.934	0.00346	0.033985	27	0.011582	yes	MSCLSK
chr1_1118696_C_T_b38	RP4-758J18.2	2.934	0.00346	0.033985	27	0.011582	yes	MSCLSK
chr1_1118290_G_A_b38	RP4-758J18.2	2.917	0.00366	0.033684	28	0.011548	yes	MSCLSK
chr1_1485324_C_T_b38	RP4-758J18.2	-2.913	0.00371	-0.04476	6	0.015368	yes	MSCLSK
chr1_1111994_T_A_b38	RP4-758J18.2	2.912	0.00371	0.033452	31	0.011487	yes	MSCLSK
chr1_1177602_C_T_b38	RP4-758J18.2	2.903	0.00382	0.032829	28	0.011307	yes	MSCLSK
chr1_1687734_CAA_C_b38	RP4-758J18.2	2.894	0.00393	0.026336	88	0.0091	yes	MSCLSK
chr1_2220171_C_CA_b38	RP4-758J18.2	-2.891	0.00398	-0.029846	53	0.010325	yes	MSCLSK
chr1_1101933_A_G_b38	RP4-758J18.2	2.83	0.00481	0.032781	31	0.011585	yes	MSCLSK
chr1_1105444_T_C_b38	RP4-758J18.2	2.83	0.00481	0.032781	31	0.011585	yes	MSCLSK
chr1_1113121_G_A_b38	RP4-758J18.2	2.816	0.00502	0.032882	17	0.011678	yes	MSCLSK
chr1_1479704_G_A_b38	RP4-758J18.2	-2.807	0.00515	-0.039941	13	0.014229	yes	MSCLSK
chr1_1107293_C_T_b38	RP4-758J18.2	2.802	0.00523	0.032005	29	0.011421	yes	MSCLSK
chr1_1428004_G_C_b38	RP4-758J18.2	-2.797	0.00532	-0.077348	3	0.027658	yes	MSCLSK
chr1_1324149_G_A_b38	RP4-758J18.2	2.795	0.00534	0.020146	132	0.007207	yes	MSCLSK
chr1_1106998_A_C_b38	RP4-758J18.2	2.773	0.00572	0.031663	30	0.011418	yes	MSCLSK
chr1_2388775_CAAAA_C_b38	RP4-758J18.2	2.77	0.00577	0.033664	34	0.012154	yes	MSCLSK
chr1_1110693_C_A_b38	RP4-758J18.2	2.763	0.0059	0.032378	17	0.011719	yes	MSCLSK
chr1_1113191_A_G_b38	RP4-758J18.2	2.744	0.00625	0.032337	16	0.011787	yes	MSCLSK
chr1_1182106_A_G_b38	RP4-758J18.2	2.737	0.00637	0.031144	34	0.011379	yes	MSCLSK
chr1_1729373_A_G_b38	RP4-758J18.2	2.704	0.00703	0.026507	60	0.009802	yes	MSCLSK
chr1_1482316_C_G_b38	RP4-758J18.2	-2.673	0.00772	-0.023672	74	0.008857	yes	MSCLSK
chr1_1684266_T_C_b38	RP4-758J18.2	2.65	0.00824	0.023049	116	0.008696	yes	MSCLSK
chr1_1686147_T_G_b38	RP4-758J18.2	2.64	0.00849	0.023427	105	0.008873	yes	MSCLSK
chr1_1728604_T_A_b38	RP4-758J18.2	2.636	0.0086	0.025958	62	0.009848	yes	MSCLSK
chr1_2022166_C_T_b38	RP4-758J18.2	2.63	0.00873	0.080211	3	0.030493	yes	MSCLSK
chr1_1684308_G_C_b38	RP4-758J18.2	2.621	0.00897	0.022838	114	0.008713	yes	MSCLSK
chr1_1684619_G_A_b38	RP4-758J18.2	2.621	0.00897	0.022838	114	0.008713	yes	MSCLSK
chr1_1374801_A_G_b38	RP4-758J18.2	-3.683	0.00025	-0.062109	10	0.016862	no	MSCLSK
chr1_1427080_C_T_b38	RP4-758J18.2	-3.396	0.000726	-0.05567	6	0.016392	no	MSCLSK
chr1_1415754_CCGCT_C_b38	RP4-758J18.2	-3.266	0.00115	-0.044129	16	0.013511	no	MSCLSK
chr1_1415762_ATCCGCT_A_b38	RP4-758J18.2	-3.266	0.00115	-0.044129	16	0.013511	no	MSCLSK
chr1_1374694_C_G_b38	RP4-758J18.2	3.252	0.00121	0.051591	12	0.015864	no	MSCLSK
chr1_1425936_G_A_b38	RP4-758J18.2	-3.21	0.00139	-0.052652	6	0.016403	no	MSCLSK
chr1_1695005_CAA_C_b38	RP4-758J18.2	-3.2	0.00144	-0.03405	46	0.01064	no	MSCLSK
chr1_1684789_C_CAAA_b38	RP4-758J18.2	3.141	0.00176	0.037865	37	0.012054	no	MSCLSK
chr1_1470425_C_CTT_b38	RP4-758J18.2	-3.137	0.00179	-0.046798	23	0.014918	no	MSCLSK
chr1_1418181_A_G_b38	RP4-758J18.2	-3.118	0.0019	-0.041691	18	0.013371	no	MSCLSK
chr1_1422081_C_T_b38	RP4-758J18.2	-3.109	0.00196	-0.044259	52	0.014235	no	MSCLSK
chr1_1425822_C_G_b38	RP4-758J18.2	-3.08	0.00216	-0.050561	6	0.016415	no	MSCLSK
chr1_1425135_T_C_b38	RP4-758J18.2	-3.072	0.00222	-0.048406	8	0.015756	no	MSCLSK
chr1_1417000_C_T_b38	RP4-758J18.2	-3.057	0.00233	-0.041397	17	0.01354	no	MSCLSK
chr1_1664099_T_C_b38	RP4-758J18.2	3.05	0.00238	0.033354	28	0.010934	no	MSCLSK
chr1_1425750_T_C_b38	RP4-758J18.2	-3.046	0.00242	-0.04904	7	0.0161	no	MSCLSK
chr1_1419214_A_G_b38	RP4-758J18.2	-3.009	0.00272	-0.040699	24	0.013524	no	MSCLSK
chr1_1419135_C_G_b38	RP4-758J18.2	-3	0.0028	-0.042516	50	0.014171	no	MSCLSK
chr1_586844_G_A_b38	RP4-758J18.2	-2.983	0.00296	-0.086999	3	0.029161	no	MSCLSK
chr1_1340697_G_A_b38	RP4-758J18.2	2.959	0.0032	0.029314	42	0.009907	no	MSCLSK
chr1_2067525_T_C_b38	RP4-758J18.2	-2.954	0.00326	-0.106324	5	0.035999	no	MSCLSK
chr1_1411929_G_C_b38	RP4-758J18.2	-2.936	0.00344	-0.040374	34	0.013749	no	MSCLSK
chr1_1410590_A_G_b38	RP4-758J18.2	-2.926	0.00356	-0.039476	17	0.013492	no	MSCLSK
chr1_1375288_A_C_b38	RP4-758J18.2	2.924	0.00357	0.040943	24	0.014	no	MSCLSK
chr1_1375595_C_T_b38	RP4-758J18.2	2.924	0.00357	0.040943	24	0.014	no	MSCLSK
chr1_1376092_G_A_b38	RP4-758J18.2	2.924	0.00357	0.040943	24	0.014	no	MSCLSK
chr1_1376336_G_A_b38	RP4-758J18.2	2.924	0.00357	0.040943	24	0.014	no	MSCLSK
chr1_1416747_CT_C_b38	RP4-758J18.2	-2.916	0.00367	-0.038794	17	0.013302	no	MSCLSK
chr1_1408286_G_A_b38	RP4-758J18.2	-2.915	0.00368	-0.040672	11	0.013951	no	MSCLSK
chr1_1663038_T_C_b38	RP4-758J18.2	2.914	0.00369	0.026824	105	0.009204	no	MSCLSK
chr1_1413898_T_C_b38	RP4-758J18.2	-2.911	0.00373	-0.039282	17	0.013493	no	MSCLSK
chr1_1409306_A_G_b38	RP4-758J18.2	-2.903	0.00383	-0.040448	11	0.013933	no	MSCLSK
chr1_1121335_C_T_b38	RP4-758J18.2	2.893	0.00394	0.033283	29	0.011503	no	MSCLSK
chr1_1408687_T_C_b38	RP4-758J18.2	-2.884	0.00406	-0.040611	26	0.014081	no	MSCLSK
chr1_600315_C_T_b38	RP4-758J18.2	2.88	0.00411	0.071673	4	0.024884	no	MSCLSK
chr1_1426771_G_C_b38	RP4-758J18.2	-2.878	0.00414	-0.048033	5	0.016689	no	MSCLSK
chr1_1452797_C_CA_b38	RP4-758J18.2	2.855	0.00444	0.064782	3	0.02269	no	MSCLSK
chr1_1403240_CCTTT_C_b38	RP4-758J18.2	-2.855	0.00444	-0.041199	11	0.014431	no	MSCLSK
chr1_1415221_G_T_b38	RP4-758J18.2	-2.83	0.0048	-0.037288	18	0.013175	no	MSCLSK
chr1_1103993_C_CT_b38	RP4-758J18.2	2.82	0.00495	0.032601	28	0.011561	no	MSCLSK
chr1_1380790_G_A_b38	RP4-758J18.2	2.804	0.0052	0.039733	24	0.014169	no	MSCLSK
chr1_1375998_T_A_b38	RP4-758J18.2	2.803	0.00522	0.039002	24	0.013916	no	MSCLSK
chr1_1102708_G_C_b38	RP4-758J18.2	2.798	0.0053	0.032122	28	0.011481	no	MSCLSK
chr1_1106320_A_G_b38	RP4-758J18.2	2.798	0.0053	0.032122	28	0.011481	no	MSCLSK
chr1_1110784_C_T_b38	RP4-758J18.2	2.798	0.0053	0.032122	28	0.011481	no	MSCLSK
chr1_1379664_G_A_b38	RP4-758J18.2	2.788	0.00547	0.039295	24	0.014097	no	MSCLSK
chr1_1417046_C_T_b38	RP4-758J18.2	-2.781	0.00559	-0.038033	15	0.013678	no	MSCLSK
chr1_1383798_AG_A_b38	RP4-758J18.2	2.778	0.00563	0.039842	12	0.014342	no	MSCLSK
chr1_1380513_C_T_b38	RP4-758J18.2	2.777	0.00565	0.040274	10	0.014503	no	MSCLSK
chr1_1381290_C_G_b38	RP4-758J18.2	2.777	0.00565	0.040274	10	0.014503	no	MSCLSK
chr1_1402900_A_G_b38	RP4-758J18.2	-2.776	0.00566	-0.040223	11	0.014489	no	MSCLSK
chr1_1405316_T_C_b38	RP4-758J18.2	-2.776	0.00566	-0.040223	11	0.014489	no	MSCLSK
chr1_625820_C_T_b38	RP4-758J18.2	-2.774	0.0057	-0.072522	7	0.026144	no	MSCLSK
chr1_1417561_A_G_b38	RP4-758J18.2	-2.772	0.00573	-0.037201	18	0.013419	no	MSCLSK
chr1_1107103_C_T_b38	RP4-758J18.2	2.765	0.00586	0.031748	28	0.011483	no	MSCLSK
chr1_1399922_C_T_b38	RP4-758J18.2	-2.763	0.00588	-0.039961	11	0.01446	no	MSCLSK
chr1_1418000_T_C_b38	RP4-758J18.2	-2.761	0.00593	-0.036803	19	0.013331	no	MSCLSK
chr1_1418252_A_G_b38	RP4-758J18.2	-2.761	0.00593	-0.036803	19	0.013331	no	MSCLSK
chr1_1105414_G_A_b38	RP4-758J18.2	2.74	0.00631	0.031577	27	0.011523	no	MSCLSK
chr1_1101480_A_C_b38	RP4-758J18.2	2.733	0.00645	0.031356	28	0.011473	no	MSCLSK
chr1_1101923_T_C_b38	RP4-758J18.2	2.733	0.00645	0.031356	28	0.011473	no	MSCLSK
chr1_1101987_G_A_b38	RP4-758J18.2	2.733	0.00645	0.031356	28	0.011473	no	MSCLSK
chr1_1103617_ACTC_A_b38	RP4-758J18.2	2.733	0.00645	0.031356	28	0.011473	no	MSCLSK
chr1_1103888_T_C_b38	RP4-758J18.2	2.733	0.00645	0.031356	28	0.011473	no	MSCLSK
chr1_1104437_A_G_b38	RP4-758J18.2	2.733	0.00645	0.031356	28	0.011473	no	MSCLSK
chr1_1104646_T_C_b38	RP4-758J18.2	2.733	0.00645	0.031356	28	0.011473	no	MSCLSK
chr1_1105092_C_T_b38	RP4-758J18.2	2.733	0.00645	0.031356	28	0.011473	no	MSCLSK
chr1_1105560_A_C_b38	RP4-758J18.2	2.733	0.00645	0.031356	28	0.011473	no	MSCLSK
chr1_1105605_C_G_b38	RP4-758J18.2	2.733	0.00645	0.031356	28	0.011473	no	MSCLSK
chr1_1106406_T_C_b38	RP4-758J18.2	2.733	0.00645	0.031356	28	0.011473	no	MSCLSK
chr1_1107547_G_T_b38	RP4-758J18.2	2.733	0.00645	0.031356	28	0.011473	no	MSCLSK
chr1_1107673_A_G_b38	RP4-758J18.2	2.733	0.00645	0.031356	28	0.011473	no	MSCLSK
chr1_1107882_T_C_b38	RP4-758J18.2	2.733	0.00645	0.031356	28	0.011473	no	MSCLSK
chr1_1415976_G_A_b38	RP4-758J18.2	-2.726	0.00659	-0.037975	34	0.013931	no	MSCLSK
chr1_1395050_G_A_b38	RP4-758J18.2	-2.724	0.00664	-0.039534	11	0.014515	no	MSCLSK
chr1_1744052_GAGA_G_b38	RP4-758J18.2	2.698	0.00715	0.029521	35	0.01094	no	MSCLSK
chr1_1692124_T_G_b38	RP4-758J18.2	2.689	0.00735	0.026847	49	0.009983	no	MSCLSK
chr1_1105739_G_GGGCGTGGT_b38	RP4-758J18.2	2.687	0.0074	0.031045	26	0.011555	no	MSCLSK
chr1_1385384_G_A_b38	RP4-758J18.2	2.686	0.00743	0.038823	11	0.014456	no	MSCLSK
chr1_1692151_T_C_b38	RP4-758J18.2	2.686	0.00743	0.027176	49	0.010119	no	MSCLSK
chr1_1388565_GTC_G_b38	RP4-758J18.2	2.681	0.00752	0.028293	35	0.010552	no	MSCLSK
chr1_1375698_G_T_b38	RP4-758J18.2	2.667	0.00784	0.038375	10	0.014387	no	MSCLSK
chr1_1376153_G_C_b38	RP4-758J18.2	2.667	0.00784	0.038375	10	0.014387	no	MSCLSK
chr1_1376752_T_C_b38	RP4-758J18.2	2.667	0.00784	0.038375	10	0.014387	no	MSCLSK
chr1_1378635_C_T_b38	RP4-758J18.2	2.667	0.00784	0.038375	10	0.014387	no	MSCLSK
chr1_1378792_C_T_b38	RP4-758J18.2	2.667	0.00784	0.038375	10	0.014387	no	MSCLSK
chr1_1378865_C_T_b38	RP4-758J18.2	2.667	0.00784	0.038375	10	0.014387	no	MSCLSK
chr1_1379334_A_G_b38	RP4-758J18.2	2.667	0.00784	0.038375	10	0.014387	no	MSCLSK
chr1_1418223_A_G_b38	RP4-758J18.2	-2.665	0.00789	-0.035667	19	0.013383	no	MSCLSK
chr1_1410616_G_T_b38	RP4-758J18.2	-2.657	0.00809	-0.036765	34	0.013839	no	MSCLSK
chr1_1412488_C_CAG_b38	RP4-758J18.2	-2.657	0.00809	-0.036765	34	0.013839	no	MSCLSK
chr1_1681928_C_A_b38	RP4-758J18.2	2.656	0.00812	0.023518	106	0.008856	no	MSCLSK
chr1_1417031_A_G_b38	RP4-758J18.2	-2.621	0.00898	-0.035637	16	0.013598	no	MSCLSK
chr1_505572_T_G_b38	RP4-758J18.2	2.618	0.00905	0.030783	3	0.011757	no	MSCLSK
chr1_1415385_T_C_b38	RP4-758J18.2	-2.606	0.00936	-0.035112	18	0.013471	no	MSCLSK
chr1_1415659_G_C_b38	RP4-758J18.2	-2.606	0.00936	-0.035112	18	0.013471	no	MSCLSK
chr1_1457919_C_A_b38	RP4-758J18.2	2.606	0.00938	0.053471	14	0.020521	no	MSCLSK
chr1_1529961_C_T_b38	RP4-758J18.2	2.603	0.00947	0.093637	3	0.035979	no	MSCLSK
chr1_1481071_T_C_b38	RP4-758J18.2	-2.596	0.00965	-0.042488	14	0.016367	no	MSCLSK
chr1_1366830_G_A_b38	RP4-758J18.2	-3.821	0.000151	-0.036514	7	0.009557	yes	NERVET
chr1_1366828_A_G_b38	RP4-758J18.2	-3.781	0.000177	-0.036249	7	0.009587	yes	NERVET
chr1_1366835_G_GGTGA_b38	RP4-758J18.2	-3.7	0.000242	-0.035352	7	0.009555	yes	NERVET
chr1_964872_G_A_b38	RP4-758J18.2	-3.363	0.000835	-0.051504	4	0.015314	yes	NERVET
chr1_1366776_G_GAATT_b38	RP4-758J18.2	-3.236	0.0013	-0.028059	14	0.008672	yes	NERVET
chr1_2284470_A_C_b38	RP4-758J18.2	3.235	0.0013	0.020625	63	0.006375	yes	NERVET
chr1_1364566_T_C_b38	RP4-758J18.2	-3.095	0.00209	-0.026772	13	0.008649	yes	NERVET
chr1_1365036_T_TAA_b38	RP4-758J18.2	-3.071	0.00226	-0.027587	10	0.008985	yes	NERVET
chr1_1170681_G_A_b38	RP4-758J18.2	3.05	0.00242	0.017863	106	0.005856	yes	NERVET
chr1_1316929_A_T_b38	RP4-758J18.2	-3.049	0.00243	-0.026891	13	0.008818	yes	NERVET
chr1_1279441_C_T_b38	RP4-758J18.2	-3.032	0.00256	-0.031927	6	0.010529	yes	NERVET
chr1_1364253_C_G_b38	RP4-758J18.2	-3.02	0.00266	-0.026403	13	0.008741	yes	NERVET
chr1_1329973_GCGTGTGCCATGCA_G_b38	RP4-758J18.2	-3.015	0.00271	-0.027145	12	0.009004	yes	NERVET
chr1_2283304_C_T_b38	RP4-758J18.2	-3.006	0.00279	-0.018248	91	0.006071	yes	NERVET
chr1_1370430_T_C_b38	RP4-758J18.2	-2.981	0.00303	-0.025618	15	0.008595	yes	NERVET
chr1_1370584_G_C_b38	RP4-758J18.2	-2.981	0.00303	-0.025618	15	0.008595	yes	NERVET
chr1_1370553_CAAA_C_b38	RP4-758J18.2	-2.977	0.00306	-0.02711	10	0.009107	yes	NERVET
chr1_1341550_GCA_G_b38	RP4-758J18.2	-2.969	0.00314	-0.026004	14	0.008757	yes	NERVET
chr1_1248798_T_C_b38	RP4-758J18.2	-2.955	0.00328	-0.048196	3	0.016307	yes	NERVET
chr1_1370532_C_T_b38	RP4-758J18.2	-2.954	0.00329	-0.025268	15	0.008553	yes	NERVET
chr1_2076742_GA_G_b38	RP4-758J18.2	-2.941	0.00344	-0.023727	11	0.008069	yes	NERVET
chr1_1382893_G_A_b38	RP4-758J18.2	-2.927	0.00359	-0.026571	13	0.009077	yes	NERVET
chr1_1380867_A_G_b38	RP4-758J18.2	-2.92	0.00367	-0.026909	12	0.009214	yes	NERVET
chr1_1366511_GGTGA_G_b38	RP4-758J18.2	-2.885	0.00409	-0.024772	14	0.008586	yes	NERVET
chr1_791545_G_T_b38	RP4-758J18.2	-2.883	0.00412	-0.031903	15	0.011066	yes	NERVET
chr1_1363688_C_T_b38	RP4-758J18.2	-2.873	0.00425	-0.024747	14	0.008612	yes	NERVET
chr1_1364099_CCA_C_b38	RP4-758J18.2	-2.873	0.00425	-0.024747	14	0.008612	yes	NERVET
chr1_1364102_TGTTG_T_b38	RP4-758J18.2	-2.873	0.00425	-0.024747	14	0.008612	yes	NERVET
chr1_1368763_G_A_b38	RP4-758J18.2	-2.873	0.00425	-0.024747	14	0.008612	yes	NERVET
chr1_1367280_T_A_b38	RP4-758J18.2	-2.865	0.00436	-0.024571	14	0.008577	yes	NERVET
chr1_1369821_C_T_b38	RP4-758J18.2	-2.857	0.00448	-0.024528	14	0.008586	yes	NERVET
chr1_1344048_G_A_b38	RP4-758J18.2	-2.856	0.00448	-0.025696	12	0.008996	yes	NERVET
chr1_1367919_C_T_b38	RP4-758J18.2	-2.846	0.00463	-0.02438	14	0.008568	yes	NERVET
chr1_1369407_G_A_b38	RP4-758J18.2	-2.843	0.00466	-0.024356	13	0.008566	yes	NERVET
chr1_1364282_T_G_b38	RP4-758J18.2	-2.841	0.00469	-0.02437	14	0.008577	yes	NERVET
chr1_1364694_T_C_b38	RP4-758J18.2	-2.841	0.00469	-0.02437	14	0.008577	yes	NERVET
chr1_1364721_C_T_b38	RP4-758J18.2	-2.841	0.00469	-0.02437	14	0.008577	yes	NERVET
chr1_1365160_A_G_b38	RP4-758J18.2	-2.841	0.00469	-0.02437	14	0.008577	yes	NERVET
chr1_1365198_C_T_b38	RP4-758J18.2	-2.841	0.00469	-0.02437	14	0.008577	yes	NERVET
chr1_1366008_A_G_b38	RP4-758J18.2	-2.841	0.00469	-0.02437	14	0.008577	yes	NERVET
chr1_1366062_T_C_b38	RP4-758J18.2	-2.841	0.00469	-0.02437	14	0.008577	yes	NERVET
chr1_1366145_TGTGAA_T_b38	RP4-758J18.2	-2.841	0.00469	-0.02437	14	0.008577	yes	NERVET
chr1_1366453_G_T_b38	RP4-758J18.2	-2.841	0.00469	-0.02437	14	0.008577	yes	NERVET
chr1_1366726_T_G_b38	RP4-758J18.2	-2.841	0.00469	-0.02437	14	0.008577	yes	NERVET
chr1_1367258_T_A_b38	RP4-758J18.2	-2.841	0.00469	-0.02437	14	0.008577	yes	NERVET
chr1_1367297_GAA_G_b38	RP4-758J18.2	-2.841	0.00469	-0.02437	14	0.008577	yes	NERVET
chr1_1367329_A_AGT_b38	RP4-758J18.2	-2.841	0.00469	-0.02437	14	0.008577	yes	NERVET
chr1_1367373_T_TGTG_b38	RP4-758J18.2	-2.841	0.00469	-0.02437	14	0.008577	yes	NERVET
chr1_1367593_G_A_b38	RP4-758J18.2	-2.841	0.00469	-0.02437	14	0.008577	yes	NERVET
chr1_1367602_GT_G_b38	RP4-758J18.2	-2.841	0.00469	-0.02437	14	0.008577	yes	NERVET
chr1_1367605_GAGTGAGTGTA_G_b38	RP4-758J18.2	-2.841	0.00469	-0.02437	14	0.008577	yes	NERVET
chr1_1367670_GGTGA_G_b38	RP4-758J18.2	-2.841	0.00469	-0.02437	14	0.008577	yes	NERVET
chr1_1367722_TTTTA_T_b38	RP4-758J18.2	-2.841	0.00469	-0.02437	14	0.008577	yes	NERVET
chr1_1367874_A_T_b38	RP4-758J18.2	-2.841	0.00469	-0.02437	14	0.008577	yes	NERVET
chr1_1367951_C_T_b38	RP4-758J18.2	-2.841	0.00469	-0.02437	14	0.008577	yes	NERVET
chr1_1367965_A_G_b38	RP4-758J18.2	-2.841	0.00469	-0.02437	14	0.008577	yes	NERVET
chr1_1367970_T_G_b38	RP4-758J18.2	-2.841	0.00469	-0.02437	14	0.008577	yes	NERVET
chr1_1367994_C_A_b38	RP4-758J18.2	-2.841	0.00469	-0.02437	14	0.008577	yes	NERVET
chr1_1368297_C_T_b38	RP4-758J18.2	-2.841	0.00469	-0.02437	14	0.008577	yes	NERVET
chr1_1341030_C_A_b38	RP4-758J18.2	-2.841	0.0047	-0.029227	23	0.010287	yes	NERVET
chr1_1369282_G_A_b38	RP4-758J18.2	-2.837	0.00475	-0.024352	14	0.008583	yes	NERVET
chr1_1369320_GT_G_b38	RP4-758J18.2	-2.837	0.00475	-0.024352	14	0.008583	yes	NERVET
chr1_1369476_CTT_C_b38	RP4-758J18.2	-2.837	0.00475	-0.024352	14	0.008583	yes	NERVET
chr1_1369556_C_G_b38	RP4-758J18.2	-2.837	0.00475	-0.024352	14	0.008583	yes	NERVET
chr1_1369627_T_C_b38	RP4-758J18.2	-2.837	0.00475	-0.024352	14	0.008583	yes	NERVET
chr1_1369686_T_C_b38	RP4-758J18.2	-2.837	0.00475	-0.024352	14	0.008583	yes	NERVET
chr1_1369716_G_C_b38	RP4-758J18.2	-2.837	0.00475	-0.024352	14	0.008583	yes	NERVET
chr1_1369741_C_T_b38	RP4-758J18.2	-2.837	0.00475	-0.024352	14	0.008583	yes	NERVET
chr1_1370181_C_T_b38	RP4-758J18.2	-2.837	0.00475	-0.024352	14	0.008583	yes	NERVET
chr1_1370317_G_C_b38	RP4-758J18.2	-2.837	0.00475	-0.024352	14	0.008583	yes	NERVET
chr1_1370320_A_G_b38	RP4-758J18.2	-2.837	0.00475	-0.024352	14	0.008583	yes	NERVET
chr1_1698048_T_C_b38	RP4-758J18.2	-2.807	0.00521	-0.039048	6	0.013911	yes	NERVET
chr1_1366292_G_T_b38	RP4-758J18.2	-2.806	0.00522	-0.024119	14	0.008595	yes	NERVET
chr1_1366321_TGTGTGTAAATGG_T_b38	RP4-758J18.2	-2.801	0.00531	-0.024055	14	0.008588	yes	NERVET
chr1_1452346_A_G_b38	RP4-758J18.2	-2.799	0.00535	-0.023365	12	0.008348	yes	NERVET
chr1_1522875_T_G_b38	RP4-758J18.2	2.78	0.00565	0.040386	8	0.014526	yes	NERVET
chr1_1369009_T_C_b38	RP4-758J18.2	-2.766	0.0059	-0.023834	14	0.008616	yes	NERVET
chr1_1407565_C_A_b38	RP4-758J18.2	-2.753	0.00613	-0.026278	12	0.009544	yes	NERVET
chr1_1223061_GCA_G_b38	RP4-758J18.2	-2.753	0.00613	-0.030836	4	0.011199	yes	NERVET
chr1_1452384_G_A_b38	RP4-758J18.2	-2.742	0.00634	-0.023393	10	0.008531	yes	NERVET
chr1_1369012_C_CG_b38	RP4-758J18.2	-2.735	0.00648	-0.02356	14	0.008614	yes	NERVET
chr1_1366187_A_AGT_b38	RP4-758J18.2	-2.732	0.00654	-0.023456	14	0.008586	yes	NERVET
chr1_1368514_C_G_b38	RP4-758J18.2	-2.731	0.00655	-0.023488	14	0.0086	yes	NERVET
chr1_1364357_A_C_b38	RP4-758J18.2	-2.725	0.00667	-0.023367	14	0.008574	yes	NERVET
chr1_1367462_T_C_b38	RP4-758J18.2	-2.722	0.00674	-0.023712	13	0.008712	yes	NERVET
chr1_1367268_TGA_T_b38	RP4-758J18.2	-2.719	0.00679	-0.023232	14	0.008544	yes	NERVET
chr1_1379093_TG_T_b38	RP4-758J18.2	-2.704	0.0071	-0.02613	8	0.009662	yes	NERVET
chr1_1081836_A_G_b38	RP4-758J18.2	2.697	0.00724	0.054955	3	0.020373	yes	NERVET
chr1_1363880_A_G_b38	RP4-758J18.2	-2.677	0.0077	-0.022938	14	0.00857	yes	NERVET
chr1_1366681_T_TGA_b38	RP4-758J18.2	-2.662	0.00804	-0.023125	14	0.008686	yes	NERVET
chr1_1357046_C_G_b38	RP4-758J18.2	-2.659	0.0081	-0.028689	22	0.010788	yes	NERVET
chr1_1357369_C_T_b38	RP4-758J18.2	-2.659	0.0081	-0.028689	22	0.010788	yes	NERVET
chr1_1360023_T_C_b38	RP4-758J18.2	-2.659	0.0081	-0.028689	22	0.010788	yes	NERVET
chr1_1367388_T_TTGG_b38	RP4-758J18.2	-2.655	0.00819	-0.02291	14	0.008627	yes	NERVET
chr1_1497874_G_A_b38	RP4-758J18.2	2.649	0.00835	0.058466	3	0.02207	yes	NERVET
chr1_1304555_A_C_b38	RP4-758J18.2	-2.623	0.009	-0.024368	8	0.009289	yes	NERVET
chr1_2263234_ATT_A_b38	RP4-758J18.2	-2.608	0.00941	-0.017438	55	0.006687	yes	NERVET
chr1_2089758_A_G_b38	RP4-758J18.2	-2.593	0.00982	-0.019065	36	0.007353	yes	NERVET
chr1_1073612_C_T_b38	RP4-758J18.2	2.592	0.00985	0.049778	4	0.019205	yes	NERVET
chr1_1367511_ATGAG_A_b38	RP4-758J18.2	-2.592	0.00985	-0.022565	13	0.008706	yes	NERVET
chr1_1498115_C_T_b38	RP4-758J18.2	4.938	1.11e-06	0.087084	4	0.017635	no	NERVET
chr1_1184997_T_A_b38	RP4-758J18.2	-3.452	0.000607	-0.058201	3	0.016858	no	NERVET
chr1_958061_C_CTT_b38	RP4-758J18.2	-3.321	0.000967	-0.02928	25	0.008816	no	NERVET
chr1_1499339_T_C_b38	RP4-758J18.2	3.317	0.000983	0.044121	4	0.013302	no	NERVET
chr1_1497741_CTG_C_b38	RP4-758J18.2	3.193	0.0015	0.042359	17	0.013266	no	NERVET
chr1_1297213_G_A_b38	RP4-758J18.2	3.125	0.00189	0.050336	9	0.016106	no	NERVET
chr1_1773676_TTGTGTGTG_T_b38	RP4-758J18.2	-3.103	0.00203	-0.035883	4	0.011563	no	NERVET
chr1_1296939_G_A_b38	RP4-758J18.2	2.961	0.00322	0.03036	26	0.010252	no	NERVET
chr1_1245992_C_T_b38	RP4-758J18.2	2.948	0.00336	0.030624	3	0.010387	no	NERVET
chr1_1297163_A_G_b38	RP4-758J18.2	2.943	0.00341	0.046662	9	0.015854	no	NERVET
chr1_1303959_T_G_b38	RP4-758J18.2	-2.928	0.00358	-0.030613	27	0.010456	no	NERVET
chr1_1375678_TAA_T_b38	RP4-758J18.2	-2.892	0.00401	-0.024151	16	0.008352	no	NERVET
chr1_1372909_G_A_b38	RP4-758J18.2	-2.88	0.00417	-0.025624	13	0.008899	no	NERVET
chr1_1367300_T_TGA_b38	RP4-758J18.2	-2.838	0.00473	-0.024587	13	0.008662	no	NERVET
chr1_1297167_G_T_b38	RP4-758J18.2	2.829	0.00487	0.046015	8	0.016266	no	NERVET
chr1_1297168_C_T_b38	RP4-758J18.2	2.829	0.00487	0.046015	8	0.016266	no	NERVET
chr1_875929_A_G_b38	RP4-758J18.2	2.813	0.00512	0.069336	3	0.024648	no	NERVET
chr1_1373006_G_A_b38	RP4-758J18.2	-2.788	0.00552	-0.025524	9	0.009155	no	NERVET
chr1_1373007_G_A_b38	RP4-758J18.2	-2.779	0.00568	-0.02517	11	0.009058	no	NERVET
chr1_506937_T_G_b38	RP4-758J18.2	-2.762	0.00598	-0.025925	10	0.009387	no	NERVET
chr1_2234971_T_C_b38	RP4-758J18.2	-2.751	0.00617	-0.017117	72	0.006221	no	NERVET
chr1_1324788_C_A_b38	RP4-758J18.2	-2.74	0.00639	-0.028133	22	0.010269	no	NERVET
chr1_1327982_G_A_b38	RP4-758J18.2	-2.698	0.00724	-0.028803	24	0.010677	no	NERVET
chr1_2025860_C_T_b38	RP4-758J18.2	-2.665	0.00797	-0.016199	103	0.006079	no	NERVET
chr1_1374505_A_G_b38	RP4-758J18.2	-2.622	0.00903	-0.022855	15	0.008716	no	NERVET
chr1_1708951_C_T_b38	RP4-758J18.2	-2.594	0.00979	-0.015848	94	0.00611	no	NERVET
chr1_1327211_C_T_b38	RP4-758J18.2	-2.591	0.00988	-0.027654	23	0.010674	no	NERVET
chr1_1708855_TTCCTCCTCC_T_b38	RP4-758J18.2	-2.587	0.00998	-0.016589	99	0.006412	no	NERVET
chr1_505172_T_G_b38	RP4-758J18.2	-3.135	0.00214	-0.071831	7	0.022913	yes	OVARY
chr1_1056602_T_TGTGGGTGCGTGTGC_b38	RP4-758J18.2	-2.898	0.00442	-0.04684	24	0.016163	yes	OVARY
chr1_1137233_C_G_b38	RP4-758J18.2	2.846	0.00517	0.051847	15	0.01822	yes	OVARY
chr1_531693_C_T_b38	RP4-758J18.2	-2.814	0.00567	-0.050824	20	0.018062	yes	OVARY
chr1_505074_C_T_b38	RP4-758J18.2	-2.795	0.006	-0.058975	8	0.021101	yes	OVARY
chr1_1118005_C_T_b38	RP4-758J18.2	2.634	0.0095	0.045924	33	0.017438	yes	OVARY
chr1_2389131_A_AAAG_b38	RP4-758J18.2	-3.249	0.00148	-0.045913	33	0.014131	no	OVARY
chr1_2370032_C_G_b38	RP4-758J18.2	-3.187	0.00181	-0.064919	6	0.020373	no	OVARY
chr1_2389113_C_CA_b38	RP4-758J18.2	-3.154	0.00201	-0.047846	23	0.015169	no	OVARY
chr1_2384876_A_G_b38	RP4-758J18.2	-3.09	0.00246	-0.045835	38	0.014833	no	OVARY
chr1_2384241_A_G_b38	RP4-758J18.2	-2.988	0.00337	-0.044469	37	0.014883	no	OVARY
chr1_958061_C_CT_b38	RP4-758J18.2	2.784	0.00619	0.052645	12	0.01891	no	OVARY
chr1_1367028_A_G_b38	RP4-758J18.2	2.769	0.00647	0.063017	4	0.022761	no	OVARY
chr1_2371077_T_C_b38	RP4-758J18.2	-2.705	0.00778	-0.041614	33	0.015387	no	OVARY
chr1_2387989_A_G_b38	RP4-758J18.2	-2.665	0.00869	-0.040475	30	0.015186	no	OVARY
chr1_1368178_C_CTTTTT_b38	RP4-758J18.2	-2.619	0.00989	-0.062347	3	0.023806	no	OVARY
chr1_2065678_C_CAA_b38	RP4-758J18.2	-3.961	9.76e-05	-0.085525	8	0.021594	yes	PNCREAS
chr1_924533_A_G_b38	RP4-758J18.2	3.747	0.000222	0.081736	13	0.021812	yes	PNCREAS
chr1_924310_C_G_b38	RP4-758J18.2	3.386	0.000825	0.072701	13	0.021473	yes	PNCREAS
chr1_924321_C_G_b38	RP4-758J18.2	3.242	0.00135	0.065525	15	0.020211	yes	PNCREAS
chr1_813885_G_A_b38	RP4-758J18.2	2.956	0.00342	0.032737	68	0.011076	yes	PNCREAS
chr1_822668_A_G_b38	RP4-758J18.2	-2.833	0.00499	-0.051281	3	0.018101	yes	PNCREAS
chr1_1582556_T_C_b38	RP4-758J18.2	-2.761	0.00618	-0.042785	8	0.015493	yes	PNCREAS
chr1_1955806_G_A_b38	RP4-758J18.2	2.722	0.00695	0.035296	18	0.012968	yes	PNCREAS
chr1_1991690_A_G_b38	RP4-758J18.2	2.627	0.00914	0.030574	56	0.011637	yes	PNCREAS
chr1_1102071_C_CA_b38	RP4-758J18.2	-3.154	0.00181	-0.056093	8	0.017785	no	PNCREAS
chr1_1388565_GTC_G_b38	RP4-758J18.2	3.05	0.00253	0.043842	17	0.014372	no	PNCREAS
chr1_2079137_C_T_b38	RP4-758J18.2	3.036	0.00266	0.046659	12	0.015371	no	PNCREAS
chr1_659806_T_C_b38	RP4-758J18.2	2.843	0.00483	0.051105	10	0.017973	no	PNCREAS
chr1_1950071_C_A_b38	RP4-758J18.2	2.763	0.00615	0.034426	22	0.012459	no	PNCREAS
chr1_737737_T_C_b38	RP4-758J18.2	-2.759	0.00623	-0.070125	8	0.025419	no	PNCREAS
chr1_1955652_CG_C_b38	RP4-758J18.2	2.695	0.00752	0.034593	19	0.012837	no	PNCREAS
chr1_1955672_GC_G_b38	RP4-758J18.2	2.695	0.00752	0.034593	19	0.012837	no	PNCREAS
chr1_1956754_C_A_b38	RP4-758J18.2	2.695	0.00752	0.034593	19	0.012837	no	PNCREAS
chr1_1955061_GCGGCTC_G_b38	RP4-758J18.2	2.66	0.00833	0.032577	33	0.012248	no	PNCREAS
chr1_1955068_ACACCGGAAGTGC_A_b38	RP4-758J18.2	2.66	0.00833	0.032577	33	0.012248	no	PNCREAS
chr1_1838449_C_CT_b38	RP4-758J18.2	2.599	0.00992	0.033652	18	0.01295	no	PNCREAS
chr1_1619986_T_C_b38	RP4-758J18.2	3.496	0.000585	0.046888	15	0.013413	yes	PTTARY
chr1_1238902_T_C_b38	RP4-758J18.2	-3.484	0.000609	-0.042835	25	0.012294	yes	PTTARY
chr1_659806_T_C_b38	RP4-758J18.2	3.33	0.00104	0.065205	6	0.019582	yes	PTTARY
chr1_1306523_C_G_b38	RP4-758J18.2	3.313	0.0011	0.068591	5	0.020706	yes	PTTARY
chr1_1282706_C_T_b38	RP4-758J18.2	-3.129	0.00202	-0.054664	8	0.01747	yes	PTTARY
chr1_1277269_T_C_b38	RP4-758J18.2	-3.093	0.00227	-0.054284	7	0.017548	yes	PTTARY
chr1_1277844_T_A_b38	RP4-758J18.2	-3.093	0.00227	-0.054284	7	0.017548	yes	PTTARY
chr1_1278407_T_TA_b38	RP4-758J18.2	-3.093	0.00227	-0.054284	7	0.017548	yes	PTTARY
chr1_1221049_C_G_b38	RP4-758J18.2	-3.062	0.00251	-0.039786	20	0.012994	yes	PTTARY
chr1_591242_C_T_b38	RP4-758J18.2	-3.036	0.00273	-0.078535	5	0.025872	yes	PTTARY
chr1_1388565_GTC_G_b38	RP4-758J18.2	2.929	0.0038	0.041586	12	0.014196	yes	PTTARY
chr1_1251285_G_A_b38	RP4-758J18.2	-2.901	0.00415	-0.049637	5	0.017111	yes	PTTARY
chr1_1251368_T_C_b38	RP4-758J18.2	-2.901	0.00415	-0.049637	5	0.017111	yes	PTTARY
chr1_1601796_A_C_b38	RP4-758J18.2	2.873	0.00451	0.036558	23	0.012724	yes	PTTARY
chr1_1274972_A_G_b38	RP4-758J18.2	-2.831	0.00512	-0.050182	7	0.017724	yes	PTTARY
chr1_1534218_C_G_b38	RP4-758J18.2	-2.807	0.00551	-0.034373	53	0.012246	yes	PTTARY
chr1_1534219_G_C_b38	RP4-758J18.2	-2.807	0.00551	-0.034373	53	0.012246	yes	PTTARY
chr1_1275091_T_C_b38	RP4-758J18.2	-2.758	0.00636	-0.048662	8	0.017643	yes	PTTARY
chr1_1230159_G_A_b38	RP4-758J18.2	-2.754	0.00644	-0.037037	16	0.013447	yes	PTTARY
chr1_1991761_T_C_b38	RP4-758J18.2	-2.731	0.00688	-0.032478	35	0.011891	yes	PTTARY
chr1_1419214_A_G_b38	RP4-758J18.2	-2.711	0.0073	-0.057758	3	0.021305	yes	PTTARY
chr1_1251618_G_A_b38	RP4-758J18.2	-2.71	0.00733	-0.047003	4	0.017345	yes	PTTARY
chr1_1366828_A_G_b38	RP4-758J18.2	-2.686	0.00784	-0.051626	4	0.019217	yes	PTTARY
chr1_1307327_A_G_b38	RP4-758J18.2	2.676	0.00809	0.057017	9	0.021309	yes	PTTARY
chr1_1307603_G_A_b38	RP4-758J18.2	2.676	0.00809	0.057017	9	0.021309	yes	PTTARY
chr1_1251122_A_T_b38	RP4-758J18.2	-2.669	0.00825	-0.041621	8	0.015596	yes	PTTARY
chr1_1293731_A_ACGCCCCTGCCCTGGAGGCCC_b38	RP4-758J18.2	2.658	0.00851	0.0336	23	0.012642	yes	PTTARY
chr1_1282558_C_CCA_b38	RP4-758J18.2	-3.584	0.000427	-0.058654	9	0.016366	no	PTTARY
chr1_1615869_C_T_b38	RP4-758J18.2	3.1	0.00222	0.040266	19	0.01299	no	PTTARY
chr1_1617375_T_C_b38	RP4-758J18.2	3.094	0.00226	0.040607	18	0.013123	no	PTTARY
chr1_1618213_C_G_b38	RP4-758J18.2	3.094	0.00226	0.040607	18	0.013123	no	PTTARY
chr1_1618290_G_C_b38	RP4-758J18.2	3.094	0.00226	0.040607	18	0.013123	no	PTTARY
chr1_1258206_AT_A_b38	RP4-758J18.2	-3.067	0.00247	-0.041083	18	0.013396	no	PTTARY
chr1_1240684_G_GCCGCCCCCATTCACCCCGGCCGTGGTCCCTGCCCCAGCCCCCA_b38	RP4-758J18.2	-2.97	0.00335	-0.071722	5	0.024148	no	PTTARY
chr1_1278491_C_CT_b38	RP4-758J18.2	-2.897	0.0042	-0.050655	5	0.017486	no	PTTARY
chr1_1259424_T_C_b38	RP4-758J18.2	-2.887	0.00433	-0.039992	19	0.013852	no	PTTARY
chr1_1613322_T_C_b38	RP4-758J18.2	2.875	0.00449	0.037593	19	0.013075	no	PTTARY
chr1_1613421_T_C_b38	RP4-758J18.2	2.869	0.00457	0.038289	17	0.013347	no	PTTARY
chr1_1616547_T_C_b38	RP4-758J18.2	2.862	0.00467	0.038086	17	0.013308	no	PTTARY
chr1_1280044_T_C_b38	RP4-758J18.2	-2.848	0.00487	-0.037161	23	0.013048	no	PTTARY
chr1_1232800_G_C_b38	RP4-758J18.2	-2.845	0.00492	-0.084358	3	0.029655	no	PTTARY
chr1_1604202_G_A_b38	RP4-758J18.2	2.82	0.00529	0.036217	22	0.012842	no	PTTARY
chr1_1624723_C_T_b38	RP4-758J18.2	-2.804	0.00555	-0.044014	5	0.015695	no	PTTARY
chr1_1595649_A_G_b38	RP4-758J18.2	-2.767	0.0062	-0.041356	7	0.014946	no	PTTARY
chr1_1594570_A_G_b38	RP4-758J18.2	2.719	0.00713	0.035001	21	0.012872	no	PTTARY
chr1_1653319_A_G_b38	RP4-758J18.2	2.711	0.0073	0.037429	15	0.013807	no	PTTARY
chr1_1661169_C_A_b38	RP4-758J18.2	2.702	0.0075	0.036719	15	0.01359	no	PTTARY
chr1_1979465_A_G_b38	RP4-758J18.2	-2.657	0.00854	-0.039574	9	0.014897	no	PTTARY
chr1_1309988_G_A_b38	RP4-758J18.2	2.652	0.00865	0.036438	23	0.013738	no	PTTARY
chr1_1615322_A_G_b38	RP4-758J18.2	2.647	0.00879	0.035004	18	0.013225	no	PTTARY
chr1_1825782_G_A_b38	RP4-758J18.2	-3.35	0.000983	-0.098783	3	0.029487	yes	PRSTTE
chr1_2037520_G_A_b38	RP4-758J18.2	-3.283	0.00123	-0.050755	24	0.015461	yes	PRSTTE
chr1_1939322_T_G_b38	RP4-758J18.2	-3.231	0.00146	-0.085257	3	0.026383	yes	PRSTTE
chr1_1939898_G_A_b38	RP4-758J18.2	-3.231	0.00146	-0.085257	3	0.026383	yes	PRSTTE
chr1_1943993_C_A_b38	RP4-758J18.2	-3.231	0.00146	-0.085257	3	0.026383	yes	PRSTTE
chr1_2036515_C_T_b38	RP4-758J18.2	-3.231	0.00147	-0.049567	25	0.015341	yes	PRSTTE
chr1_1758687_A_AAC_b38	RP4-758J18.2	3.221	0.00151	0.077853	6	0.02417	yes	PRSTTE
chr1_1479324_C_G_b38	RP4-758J18.2	3.141	0.00197	0.114748	3	0.036537	yes	PRSTTE
chr1_903723_A_G_b38	RP4-758J18.2	3.125	0.00207	0.050959	17	0.016306	yes	PRSTTE
chr1_2035575_G_A_b38	RP4-758J18.2	-3.124	0.00208	-0.048934	23	0.015661	yes	PRSTTE
chr1_2037392_A_G_b38	RP4-758J18.2	-2.991	0.00317	-0.051446	12	0.017201	yes	PRSTTE
chr1_1812407_T_TAC_b38	RP4-758J18.2	2.986	0.00322	0.059579	5	0.019954	yes	PRSTTE
chr1_903175_C_A_b38	RP4-758J18.2	2.985	0.00323	0.051769	11	0.017343	yes	PRSTTE
chr1_1934807_G_A_b38	RP4-758J18.2	-2.984	0.00324	-0.069136	3	0.023171	yes	PRSTTE
chr1_901516_T_C_b38	RP4-758J18.2	2.968	0.0034	0.049059	21	0.016527	yes	PRSTTE
chr1_1757030_C_G_b38	RP4-758J18.2	2.814	0.00543	0.066909	5	0.023774	yes	PRSTTE
chr1_1753774_C_G_b38	RP4-758J18.2	2.779	0.00602	0.067356	5	0.024236	yes	PRSTTE
chr1_2035177_A_G_b38	RP4-758J18.2	-2.754	0.00648	-0.048196	11	0.017499	yes	PRSTTE
chr1_933038_C_T_b38	RP4-758J18.2	2.741	0.00674	0.043686	16	0.015937	yes	PRSTTE
chr1_897843_C_T_b38	RP4-758J18.2	2.736	0.00683	0.044339	20	0.016204	yes	PRSTTE
chr1_897922_C_T_b38	RP4-758J18.2	2.736	0.00683	0.044339	20	0.016204	yes	PRSTTE
chr1_898444_T_C_b38	RP4-758J18.2	2.736	0.00683	0.044339	20	0.016204	yes	PRSTTE
chr1_1707714_C_G_b38	RP4-758J18.2	-2.725	0.00707	-0.082284	4	0.0302	yes	PRSTTE
chr1_1707716_T_C_b38	RP4-758J18.2	-2.725	0.00707	-0.082284	4	0.0302	yes	PRSTTE
chr1_2027822_A_G_b38	RP4-758J18.2	-2.711	0.00735	-0.050391	10	0.018586	yes	PRSTTE
chr1_1704673_G_A_b38	RP4-758J18.2	-2.704	0.0075	-0.080697	5	0.029843	yes	PRSTTE
chr1_2019182_G_A_b38	RP4-758J18.2	-2.675	0.00815	-0.044827	14	0.016756	yes	PRSTTE
chr1_940296_GCC_G_b38	RP4-758J18.2	-2.668	0.00833	-0.03994	37	0.014971	yes	PRSTTE
chr1_1722940_TAAG_T_b38	RP4-758J18.2	2.655	0.00863	0.053211	18	0.020038	yes	PRSTTE
chr1_2137041_C_T_b38	RP4-758J18.2	-2.643	0.00893	-0.03853	29	0.014577	yes	PRSTTE
chr1_1706027_G_A_b38	RP4-758J18.2	-2.636	0.00912	-0.075672	5	0.028707	yes	PRSTTE
chr1_1706210_G_A_b38	RP4-758J18.2	-2.631	0.00924	-0.077138	5	0.029316	yes	PRSTTE
chr1_1706488_C_G_b38	RP4-758J18.2	-2.613	0.00973	-0.076734	5	0.029367	yes	PRSTTE
chr1_1740427_A_T_b38	RP4-758J18.2	2.608	0.00988	0.063853	5	0.024488	yes	PRSTTE
chr1_1742080_T_C_b38	RP4-758J18.2	2.608	0.00988	0.063853	5	0.024488	yes	PRSTTE
chr1_1830575_T_C_b38	RP4-758J18.2	3.49	0.000607	0.087384	4	0.02504	no	PRSTTE
chr1_1872863_C_T_b38	RP4-758J18.2	3.39	0.000857	0.079726	7	0.023516	no	PRSTTE
chr1_1837221_C_G_b38	RP4-758J18.2	3.366	0.000931	0.082711	5	0.024572	no	PRSTTE
chr1_1827587_T_C_b38	RP4-758J18.2	3.334	0.00104	0.084798	4	0.025436	no	PRSTTE
chr1_1829550_A_C_b38	RP4-758J18.2	3.334	0.00104	0.084798	4	0.025436	no	PRSTTE
chr1_1829897_A_C_b38	RP4-758J18.2	3.334	0.00104	0.084798	4	0.025436	no	PRSTTE
chr1_1834144_T_C_b38	RP4-758J18.2	3.334	0.00104	0.084798	4	0.025436	no	PRSTTE
chr1_1834920_A_G_b38	RP4-758J18.2	3.334	0.00104	0.084798	4	0.025436	no	PRSTTE
chr1_1838619_T_C_b38	RP4-758J18.2	3.334	0.00104	0.084798	4	0.025436	no	PRSTTE
chr1_1841296_T_C_b38	RP4-758J18.2	3.281	0.00124	0.078697	6	0.023983	no	PRSTTE
chr1_1847597_T_C_b38	RP4-758J18.2	3.281	0.00124	0.078697	6	0.023983	no	PRSTTE
chr1_1849439_T_C_b38	RP4-758J18.2	3.281	0.00124	0.078697	6	0.023983	no	PRSTTE
chr1_1861564_A_G_b38	RP4-758J18.2	3.281	0.00124	0.078697	6	0.023983	no	PRSTTE
chr1_1861632_A_G_b38	RP4-758J18.2	3.281	0.00124	0.078697	6	0.023983	no	PRSTTE
chr1_1861672_A_G_b38	RP4-758J18.2	3.281	0.00124	0.078697	6	0.023983	no	PRSTTE
chr1_1862347_A_C_b38	RP4-758J18.2	3.281	0.00124	0.078697	6	0.023983	no	PRSTTE
chr1_1864048_A_C_b38	RP4-758J18.2	3.281	0.00124	0.078697	6	0.023983	no	PRSTTE
chr1_1870733_A_G_b38	RP4-758J18.2	3.281	0.00124	0.078697	6	0.023983	no	PRSTTE
chr1_1874867_A_G_b38	RP4-758J18.2	3.281	0.00124	0.078697	6	0.023983	no	PRSTTE
chr1_1880926_CA_C_b38	RP4-758J18.2	3.281	0.00124	0.078697	6	0.023983	no	PRSTTE
chr1_1881389_G_A_b38	RP4-758J18.2	3.281	0.00124	0.078697	6	0.023983	no	PRSTTE
chr1_1885731_G_A_b38	RP4-758J18.2	3.281	0.00124	0.078697	6	0.023983	no	PRSTTE
chr1_1887939_T_C_b38	RP4-758J18.2	3.281	0.00124	0.078697	6	0.023983	no	PRSTTE
chr1_1774697_T_C_b38	RP4-758J18.2	3.254	0.00136	0.082315	4	0.025298	no	PRSTTE
chr1_1706963_G_A_b38	RP4-758J18.2	-3.171	0.00178	-0.102405	4	0.032294	no	PRSTTE
chr1_1892483_A_G_b38	RP4-758J18.2	3.168	0.0018	0.077301	5	0.024398	no	PRSTTE
chr1_1613160_C_CTT_b38	RP4-758J18.2	3.141	0.00197	0.080179	5	0.025524	no	PRSTTE
chr1_1916092_C_T_b38	RP4-758J18.2	-3.117	0.00213	-0.082421	3	0.026446	no	PRSTTE
chr1_1916540_T_C_b38	RP4-758J18.2	-3.117	0.00213	-0.082421	3	0.026446	no	PRSTTE
chr1_1916721_A_G_b38	RP4-758J18.2	-3.117	0.00213	-0.082421	3	0.026446	no	PRSTTE
chr1_1917393_A_AAC_b38	RP4-758J18.2	-3.117	0.00213	-0.082421	3	0.026446	no	PRSTTE
chr1_1918091_T_C_b38	RP4-758J18.2	-3.117	0.00213	-0.082421	3	0.026446	no	PRSTTE
chr1_1918305_G_A_b38	RP4-758J18.2	-3.117	0.00213	-0.082421	3	0.026446	no	PRSTTE
chr1_1919475_A_G_b38	RP4-758J18.2	-3.117	0.00213	-0.082421	3	0.026446	no	PRSTTE
chr1_1919773_C_T_b38	RP4-758J18.2	-3.117	0.00213	-0.082421	3	0.026446	no	PRSTTE
chr1_1921945_G_A_b38	RP4-758J18.2	-3.117	0.00213	-0.082421	3	0.026446	no	PRSTTE
chr1_1921955_T_C_b38	RP4-758J18.2	-3.117	0.00213	-0.082421	3	0.026446	no	PRSTTE
chr1_1922149_C_T_b38	RP4-758J18.2	-3.117	0.00213	-0.082421	3	0.026446	no	PRSTTE
chr1_1924931_G_A_b38	RP4-758J18.2	-3.117	0.00213	-0.082421	3	0.026446	no	PRSTTE
chr1_1929558_G_A_b38	RP4-758J18.2	-3.117	0.00213	-0.082421	3	0.026446	no	PRSTTE
chr1_1930002_T_C_b38	RP4-758J18.2	-3.117	0.00213	-0.082421	3	0.026446	no	PRSTTE
chr1_1933640_C_T_b38	RP4-758J18.2	-3.117	0.00213	-0.082421	3	0.026446	no	PRSTTE
chr1_1764135_G_T_b38	RP4-758J18.2	3.1	0.00224	0.075941	5	0.024497	no	PRSTTE
chr1_1764392_C_T_b38	RP4-758J18.2	3.1	0.00224	0.075941	5	0.024497	no	PRSTTE
chr1_1765220_A_G_b38	RP4-758J18.2	3.1	0.00224	0.075941	5	0.024497	no	PRSTTE
chr1_1766668_C_T_b38	RP4-758J18.2	3.1	0.00224	0.075941	5	0.024497	no	PRSTTE
chr1_1767368_C_G_b38	RP4-758J18.2	3.1	0.00224	0.075941	5	0.024497	no	PRSTTE
chr1_1821516_C_T_b38	RP4-758J18.2	3.085	0.00235	0.076479	5	0.024789	no	PRSTTE
chr1_1762664_A_G_b38	RP4-758J18.2	3.042	0.0027	0.075374	5	0.024776	no	PRSTTE
chr1_1919746_G_T_b38	RP4-758J18.2	-3.017	0.00292	-0.076287	5	0.025287	no	PRSTTE
chr1_1919749_A_G_b38	RP4-758J18.2	-3.017	0.00292	-0.076287	5	0.025287	no	PRSTTE
chr1_1764895_A_C_b38	RP4-758J18.2	2.99	0.00317	0.07303	5	0.024422	no	PRSTTE
chr1_1774334_A_G_b38	RP4-758J18.2	2.987	0.00321	0.074735	4	0.025024	no	PRSTTE
chr1_2289589_G_GGTGCAGGGCAGGGCAGGAGAACCAAGATCGTGGGGGTGGGGGA_b38	RP4-758J18.2	2.979	0.00329	0.099277	3	0.033327	no	PRSTTE
chr1_1814717_A_G_b38	RP4-758J18.2	2.974	0.00334	0.075414	4	0.025358	no	PRSTTE
chr1_906677_A_AAACTCAGCTGCCTCTCCCCTTC_b38	RP4-758J18.2	2.967	0.00341	0.04952	20	0.016688	no	PRSTTE
chr1_911848_C_T_b38	RP4-758J18.2	2.899	0.0042	0.051754	9	0.01785	no	PRSTTE
chr1_905705_C_G_b38	RP4-758J18.2	2.897	0.00423	0.049211	11	0.016985	no	PRSTTE
chr1_1868514_T_C_b38	RP4-758J18.2	2.883	0.00442	0.077901	3	0.027025	no	PRSTTE
chr1_1734132_T_G_b38	RP4-758J18.2	2.879	0.00447	0.070175	6	0.024375	no	PRSTTE
chr1_1925075_G_A_b38	RP4-758J18.2	-2.86	0.00474	-0.073773	5	0.025799	no	PRSTTE
chr1_1923278_C_T_b38	RP4-758J18.2	-2.835	0.0051	-0.071919	5	0.025365	no	PRSTTE
chr1_917284_C_T_b38	RP4-758J18.2	2.771	0.00618	0.050126	8	0.018091	no	PRSTTE
chr1_917859_A_G_b38	RP4-758J18.2	2.771	0.00618	0.050126	8	0.018091	no	PRSTTE
chr1_1812038_G_C_b38	RP4-758J18.2	2.768	0.00622	0.068842	5	0.024869	no	PRSTTE
chr1_1922424_T_C_b38	RP4-758J18.2	-2.765	0.00628	-0.070768	5	0.025595	no	PRSTTE
chr1_1922482_T_C_b38	RP4-758J18.2	-2.765	0.00628	-0.070768	5	0.025595	no	PRSTTE
chr1_1923107_C_T_b38	RP4-758J18.2	-2.765	0.00628	-0.070768	5	0.025595	no	PRSTTE
chr1_1925663_A_G_b38	RP4-758J18.2	-2.765	0.00628	-0.070768	5	0.025595	no	PRSTTE
chr1_1926632_G_T_b38	RP4-758J18.2	-2.765	0.00628	-0.070768	5	0.025595	no	PRSTTE
chr1_1926722_C_T_b38	RP4-758J18.2	-2.765	0.00628	-0.070768	5	0.025595	no	PRSTTE
chr1_1927737_T_C_b38	RP4-758J18.2	-2.765	0.00628	-0.070768	5	0.025595	no	PRSTTE
chr1_1928702_C_T_b38	RP4-758J18.2	-2.765	0.00628	-0.070768	5	0.025595	no	PRSTTE
chr1_1929937_C_T_b38	RP4-758J18.2	-2.765	0.00628	-0.070768	5	0.025595	no	PRSTTE
chr1_910255_C_T_b38	RP4-758J18.2	2.76	0.00638	0.050751	7	0.018389	no	PRSTTE
chr1_1587082_G_A_b38	RP4-758J18.2	-2.758	0.00641	-0.055383	6	0.020078	no	PRSTTE
chr1_923311_TG_T_b38	RP4-758J18.2	-2.755	0.00647	-0.047745	17	0.017331	no	PRSTTE
chr1_1708001_A_T_b38	RP4-758J18.2	-2.738	0.0068	-0.084677	3	0.03093	no	PRSTTE
chr1_915810_G_A_b38	RP4-758J18.2	2.735	0.00685	0.047153	11	0.017239	no	PRSTTE
chr1_912710_G_A_b38	RP4-758J18.2	2.727	0.00702	0.049439	8	0.01813	no	PRSTTE
chr1_913358_C_T_b38	RP4-758J18.2	2.727	0.00702	0.049439	8	0.01813	no	PRSTTE
chr1_1722619_C_T_b38	RP4-758J18.2	2.723	0.0071	0.04894	20	0.017972	no	PRSTTE
chr1_1809189_AT_A_b38	RP4-758J18.2	2.72	0.00715	0.048451	40	0.01781	no	PRSTTE
chr1_910698_C_T_b38	RP4-758J18.2	2.713	0.00731	0.050166	7	0.018491	no	PRSTTE
chr1_918870_A_G_b38	RP4-758J18.2	2.711	0.00736	0.046772	11	0.017255	no	PRSTTE
chr1_1923880_C_T_b38	RP4-758J18.2	-2.705	0.00749	-0.068481	5	0.02532	no	PRSTTE
chr1_1732580_T_C_b38	RP4-758J18.2	2.697	0.00766	0.066489	5	0.024652	no	PRSTTE
chr1_926250_G_A_b38	RP4-758J18.2	-2.677	0.00811	-0.047486	17	0.017739	no	PRSTTE
chr1_1679993_A_G_b38	RP4-758J18.2	-2.676	0.00814	-0.038045	54	0.014219	no	PRSTTE
chr1_925308_G_A_b38	RP4-758J18.2	-2.653	0.00869	-0.046685	18	0.017597	no	PRSTTE
chr1_900119_A_G_b38	RP4-758J18.2	2.645	0.0089	0.043193	18	0.016332	no	PRSTTE
chr1_917378_G_C_b38	RP4-758J18.2	2.639	0.00905	0.047729	8	0.018088	no	PRSTTE
chr1_1967499_G_A_b38	RP4-758J18.2	2.638	0.00906	0.040052	34	0.015182	no	PRSTTE
chr1_925036_G_A_b38	RP4-758J18.2	-2.637	0.0091	-0.046233	17	0.017535	no	PRSTTE
chr1_1795751_T_TCAAAAAAA_b38	RP4-758J18.2	2.627	0.00936	0.06661	4	0.025357	no	PRSTTE
chr1_912111_G_A_b38	RP4-758J18.2	2.615	0.00967	0.045404	11	0.017363	no	PRSTTE
chr1_914682_A_T_b38	RP4-758J18.2	2.615	0.00967	0.045404	11	0.017363	no	PRSTTE
chr1_1739883_C_T_b38	RP4-758J18.2	3.213	0.00141	0.023096	86	0.007189	yes	SKINNS
chr1_1130186_C_CAAAAAAA_b38	RP4-758J18.2	3.207	0.00144	0.044762	10	0.013957	yes	SKINNS
chr1_1729998_T_TGGGA_b38	RP4-758J18.2	3.123	0.0019	0.023862	48	0.00764	yes	SKINNS
chr1_1729296_T_C_b38	RP4-758J18.2	3.105	0.00202	0.024946	43	0.008033	yes	SKINNS
chr1_1501260_A_AT_b38	RP4-758J18.2	3.041	0.0025	0.029925	21	0.00984	yes	SKINNS
chr1_911848_C_T_b38	RP4-758J18.2	2.997	0.00288	0.02644	23	0.008821	yes	SKINNS
chr1_1028320_GCCCCCCC_G_b38	RP4-758J18.2	2.961	0.00323	0.071262	5	0.024065	yes	SKINNS
chr1_591460_T_C_b38	RP4-758J18.2	-2.952	0.00332	-0.041919	13	0.014199	yes	SKINNS
chr1_1729287_T_C_b38	RP4-758J18.2	2.927	0.0036	0.023399	45	0.007995	yes	SKINNS
chr1_1534166_G_A_b38	RP4-758J18.2	-2.876	0.00423	-0.021344	55	0.007422	yes	SKINNS
chr1_1485324_C_T_b38	RP4-758J18.2	-2.855	0.0045	-0.036528	3	0.012794	yes	SKINNS
chr1_2367456_C_CA_b38	RP4-758J18.2	2.806	0.00524	0.047339	4	0.016871	yes	SKINNS
chr1_1735008_G_GGTTT_b38	RP4-758J18.2	2.723	0.00673	0.020111	86	0.007386	yes	SKINNS
chr1_1549973_C_CA_b38	RP4-758J18.2	2.719	0.0068	0.04494	3	0.016527	yes	SKINNS
chr1_2359716_T_C_b38	RP4-758J18.2	2.712	0.00696	0.066031	3	0.024352	yes	SKINNS
chr1_1515828_G_A_b38	RP4-758J18.2	-2.686	0.00751	-0.034826	3	0.012968	yes	SKINNS
chr1_2325146_C_T_b38	RP4-758J18.2	2.66	0.0081	0.037896	7	0.014248	yes	SKINNS
chr1_1738525_G_A_b38	RP4-758J18.2	2.632	0.00879	0.019504	77	0.007411	yes	SKINNS
chr1_1744854_C_A_b38	RP4-758J18.2	2.625	0.00896	0.017704	83	0.006744	yes	SKINNS
chr1_1741733_T_C_b38	RP4-758J18.2	2.624	0.00899	0.018379	101	0.007005	yes	SKINNS
chr1_1736472_C_T_b38	RP4-758J18.2	2.591	0.00988	0.018981	88	0.007325	yes	SKINNS
chr1_917859_A_G_b38	RP4-758J18.2	2.587	0.01	0.023501	18	0.009084	yes	SKINNS
chr1_1400626_C_T_b38	RP4-758J18.2	-7.888	2.39e-14	-0.106533	3	0.013505	no	SKINNS
chr1_1389777_G_A_b38	RP4-758J18.2	-7.803	4.35e-14	-0.105364	3	0.013504	no	SKINNS
chr1_1296207_G_A_b38	RP4-758J18.2	-7.427	5.71e-13	-0.098744	3	0.013296	no	SKINNS
chr1_1366183_TGA_T_b38	RP4-758J18.2	-7.232	2.09e-12	-0.098614	3	0.013636	no	SKINNS
chr1_1356751_A_G_b38	RP4-758J18.2	-7.23	2.11e-12	-0.098778	3	0.013661	no	SKINNS
chr1_1319648_G_A_b38	RP4-758J18.2	-7.21	2.41e-12	-0.097768	3	0.01356	no	SKINNS
chr1_1223061_GCA_G_b38	RP4-758J18.2	-4.616	5.12e-06	-0.062722	3	0.013587	no	SKINNS
chr1_1279441_C_T_b38	RP4-758J18.2	-4.529	7.63e-06	-0.057572	4	0.012712	no	SKINNS
chr1_1525710_A_G_b38	RP4-758J18.2	3.563	0.000406	0.025361	90	0.007118	no	SKINNS
chr1_1236037_C_T_b38	RP4-758J18.2	-3.322	0.000968	-0.024677	85	0.007429	no	SKINNS
chr1_1398056_C_A_b38	RP4-758J18.2	3.218	0.00138	0.024061	72	0.007477	no	SKINNS
chr1_1050080_T_C_b38	RP4-758J18.2	-3.213	0.00141	-0.041561	17	0.012934	no	SKINNS
chr1_1864335_AAG_A_b38	RP4-758J18.2	-3.207	0.00144	-0.069928	3	0.021806	no	SKINNS
chr1_1308552_GGA_G_b38	RP4-758J18.2	-3.066	0.0023	-0.033261	17	0.010847	no	SKINNS
chr1_1430020_G_C_b38	RP4-758J18.2	-2.961	0.00323	-0.041767	3	0.014106	no	SKINNS
chr1_1174690_G_A_b38	RP4-758J18.2	-2.929	0.00358	-0.040451	3	0.013812	no	SKINNS
chr1_1738309_A_G_b38	RP4-758J18.2	2.861	0.00443	0.020783	88	0.007265	no	SKINNS
chr1_1657902_T_TA_b38	RP4-758J18.2	2.804	0.00527	0.033682	13	0.012013	no	SKINNS
chr1_1055307_G_A_b38	RP4-758J18.2	-2.803	0.00528	-0.065732	3	0.023447	no	SKINNS
chr1_1055502_C_T_b38	RP4-758J18.2	-2.778	0.00569	-0.064089	3	0.023067	no	SKINNS
chr1_1056491_G_C_b38	RP4-758J18.2	-2.778	0.00569	-0.064089	3	0.023067	no	SKINNS
chr1_1324195_G_A_b38	RP4-758J18.2	-2.746	0.00627	-0.061486	3	0.02239	no	SKINNS
chr1_2280205_T_A_b38	RP4-758J18.2	-2.723	0.00672	-0.026679	9	0.009797	no	SKINNS
chr1_1740017_C_T_b38	RP4-758J18.2	2.714	0.0069	0.019778	89	0.007286	no	SKINNS
chr1_2331983_C_CCTGCGCCTCTCCCGCCG_b38	RP4-758J18.2	-2.698	0.00725	-0.045922	5	0.017023	no	SKINNS
chr1_1546845_A_AAAC_b38	RP4-758J18.2	-2.691	0.00738	-0.029066	17	0.0108	no	SKINNS
chr1_1740107_G_A_b38	RP4-758J18.2	2.691	0.00739	0.019528	90	0.007256	no	SKINNS
chr1_1495136_G_A_b38	RP4-758J18.2	-2.674	0.00777	-0.033943	4	0.012694	no	SKINNS
chr1_1740160_G_A_b38	RP4-758J18.2	2.65	0.00834	0.019322	89	0.007292	no	SKINNS
chr1_921096_A_G_b38	RP4-758J18.2	2.65	0.00834	0.019862	86	0.007496	no	SKINNS
chr1_1742672_C_T_b38	RP4-758J18.2	2.63	0.00883	0.019918	89	0.007573	no	SKINNS
chr1_1743238_G_C_b38	RP4-758J18.2	2.63	0.00883	0.019918	89	0.007573	no	SKINNS
chr1_912111_G_A_b38	RP4-758J18.2	2.599	0.00965	0.022321	27	0.008587	no	SKINNS
chr1_1400626_C_T_b38	RP4-758J18.2	-8.748	2.84e-17	-0.105964	3	0.012113	yes	SKNS
chr1_1389777_G_A_b38	RP4-758J18.2	-8.718	3.58e-17	-0.104875	3	0.012029	yes	SKNS
chr1_1366183_TGA_T_b38	RP4-758J18.2	-8.161	2.41e-15	-0.10036	3	0.012298	yes	SKNS
chr1_1319648_G_A_b38	RP4-758J18.2	-7.962	1.03e-14	-0.097684	3	0.012269	yes	SKNS
chr1_1356751_A_G_b38	RP4-758J18.2	-7.847	2.34e-14	-0.096999	3	0.012362	yes	SKNS
chr1_1296207_G_A_b38	RP4-758J18.2	-7.373	6.39e-13	-0.089208	3	0.012099	yes	SKNS
chr1_1315752_GAGCGAGGGAGGTGGGGGCGGGGAGGGAGGGAGGGAGGCGGGC_G_b38	RP4-758J18.2	4.384	1.4e-05	0.032866	31	0.007496	yes	SKNS
chr1_1572877_TG_T_b38	RP4-758J18.2	-3.881	0.000117	-0.028149	31	0.007254	yes	SKNS
chr1_1573429_CAAAAAAAAAAAAAAAAAA_C_b38	RP4-758J18.2	-3.782	0.000173	-0.025073	92	0.006629	yes	SKNS
chr1_1993705_G_GGGCACAGTGGCTCATGCCTGTAATCCCAGCAACATGGGAGCCTGAGGTGGGAGGCTCTCTTGAGGCCAGGAGTTTGAGACCAGCCTGGGCAACATAGTGAGACCCCCCACCCCCCGCCATTTCTAGGAAAAAAAAAAAAAGTGGCCA_b38	RP4-758J18.2	-3.714	0.000225	-0.067972	6	0.0183	yes	SKNS
chr1_1573776_A_G_b38	RP4-758J18.2	-3.665	0.000272	-0.025678	38	0.007007	yes	SKNS
chr1_1575864_G_A_b38	RP4-758J18.2	-3.639	0.000301	-0.024642	89	0.006772	yes	SKNS
chr1_1571986_G_A_b38	RP4-758J18.2	-3.621	0.000322	-0.023313	85	0.006439	yes	SKNS
chr1_1537160_T_G_b38	RP4-758J18.2	-3.574	0.000383	-0.023107	123	0.006465	yes	SKNS
chr1_1537493_T_A_b38	RP4-758J18.2	-3.561	0.000403	-0.023433	89	0.006581	yes	SKNS
chr1_1574655_GGC_G_b38	RP4-758J18.2	-3.544	0.000429	-0.023863	87	0.006734	yes	SKNS
chr1_896798_A_G_b38	RP4-758J18.2	-3.513	0.000481	-0.023664	56	0.006737	yes	SKNS
chr1_1579717_T_A_b38	RP4-758J18.2	-3.488	0.000527	-0.023932	41	0.006861	yes	SKNS
chr1_1525710_A_G_b38	RP4-758J18.2	3.477	0.000549	0.021335	104	0.006136	yes	SKNS
chr1_1570568_AC_A_b38	RP4-758J18.2	-3.455	0.000593	-0.02419	44	0.007001	yes	SKNS
chr1_1539491_G_C_b38	RP4-758J18.2	-3.447	0.000612	-0.022943	100	0.006657	yes	SKNS
chr1_1580890_C_T_b38	RP4-758J18.2	-3.434	0.000641	-0.024042	38	0.007001	yes	SKNS
chr1_1568428_C_G_b38	RP4-758J18.2	-3.351	0.000862	-0.022433	48	0.006694	yes	SKNS
chr1_1720192_T_G_b38	RP4-758J18.2	-3.339	9e-04	-0.020613	163	0.006174	yes	SKNS
chr1_1551454_C_A_b38	RP4-758J18.2	-3.312	0.000989	-0.020238	170	0.00611	yes	SKNS
chr1_1538924_C_A_b38	RP4-758J18.2	-3.301	0.00103	-0.021718	69	0.006579	yes	SKNS
chr1_1559703_G_C_b38	RP4-758J18.2	-3.296	0.00105	-0.021662	96	0.006573	yes	SKNS
chr1_1568548_G_A_b38	RP4-758J18.2	-3.296	0.00105	-0.021662	96	0.006573	yes	SKNS
chr1_1575935_T_C_b38	RP4-758J18.2	-3.286	0.00108	-0.021748	98	0.006619	yes	SKNS
chr1_1506787_C_CT_b38	RP4-758J18.2	3.283	0.0011	0.055221	4	0.016822	yes	SKNS
chr1_1708855_TTCCTCCTCC_T_b38	RP4-758J18.2	-3.277	0.00112	-0.021868	106	0.006673	yes	SKNS
chr1_1532798_T_C_b38	RP4-758J18.2	-3.269	0.00115	-0.020685	158	0.006327	yes	SKNS
chr1_1570587_C_T_b38	RP4-758J18.2	-3.263	0.00117	-0.021458	96	0.006577	yes	SKNS
chr1_1223061_GCA_G_b38	RP4-758J18.2	-3.262	0.00118	-0.03736	5	0.011452	yes	SKNS
chr1_1706067_ACT_A_b38	RP4-758J18.2	-3.238	0.00128	-0.020231	164	0.006248	yes	SKNS
chr1_1724489_G_C_b38	RP4-758J18.2	-3.231	0.00131	-0.020211	159	0.006255	yes	SKNS
chr1_1571794_A_AT_b38	RP4-758J18.2	-3.168	0.00162	-0.021522	94	0.006793	yes	SKNS
chr1_1548572_A_C_b38	RP4-758J18.2	-3.143	0.00177	-0.018655	105	0.005935	yes	SKNS
chr1_1321228_G_A_b38	RP4-758J18.2	3.12	0.0019	0.027663	15	0.008866	yes	SKNS
chr1_1575421_C_T_b38	RP4-758J18.2	-3.119	0.00191	-0.020699	100	0.006636	yes	SKNS
chr1_1579410_AT_A_b38	RP4-758J18.2	-3.088	0.00212	-0.02309	41	0.007478	yes	SKNS
chr1_1569180_T_A_b38	RP4-758J18.2	-3.078	0.00219	-0.020376	106	0.00662	yes	SKNS
chr1_1575724_G_C_b38	RP4-758J18.2	-3.064	0.00229	-0.020458	99	0.006676	yes	SKNS
chr1_1549590_C_G_b38	RP4-758J18.2	-3.056	0.00235	-0.019961	107	0.006531	yes	SKNS
chr1_1573654_T_C_b38	RP4-758J18.2	-3.056	0.00236	-0.020569	103	0.006731	yes	SKNS
chr1_1574445_A_G_b38	RP4-758J18.2	-3.056	0.00236	-0.020569	103	0.006731	yes	SKNS
chr1_1111365_CA_C_b38	RP4-758J18.2	-3.048	0.00241	-0.024623	18	0.008077	yes	SKNS
chr1_1704310_C_A_b38	RP4-758J18.2	-3.036	0.00251	-0.018313	137	0.006031	yes	SKNS
chr1_1248798_T_C_b38	RP4-758J18.2	-3.024	0.00262	-0.056724	3	0.01876	yes	SKNS
chr1_1569661_T_C_b38	RP4-758J18.2	-2.996	0.00286	-0.019387	102	0.006471	yes	SKNS
chr1_1715838_C_T_b38	RP4-758J18.2	-2.994	0.00288	-0.01864	172	0.006225	yes	SKNS
chr1_1279441_C_T_b38	RP4-758J18.2	-2.994	0.00288	-0.031658	7	0.010573	yes	SKNS
chr1_1560765_T_C_b38	RP4-758J18.2	-2.962	0.00319	-0.020092	88	0.006784	yes	SKNS
chr1_1562261_TTTTC_T_b38	RP4-758J18.2	-2.962	0.00319	-0.020092	88	0.006784	yes	SKNS
chr1_1554852_T_C_b38	RP4-758J18.2	-2.949	0.00333	-0.019202	108	0.006511	yes	SKNS
chr1_1572532_A_C_b38	RP4-758J18.2	-2.937	0.00346	-0.019325	112	0.00658	yes	SKNS
chr1_1547630_G_A_b38	RP4-758J18.2	-2.926	0.00358	-0.018905	98	0.00646	yes	SKNS
chr1_967384_C_G_b38	RP4-758J18.2	-2.922	0.00362	-0.019789	112	0.006772	yes	SKNS
chr1_592666_T_C_b38	RP4-758J18.2	2.919	0.00365	0.056391	4	0.019316	yes	SKNS
chr1_1566854_CA_C_b38	RP4-758J18.2	-2.91	0.00377	-0.021272	69	0.007311	yes	SKNS
chr1_1555871_T_C_b38	RP4-758J18.2	-2.905	0.00383	-0.019433	82	0.00669	yes	SKNS
chr1_1573079_A_G_b38	RP4-758J18.2	-2.9	0.00388	-0.019065	112	0.006573	yes	SKNS
chr1_1293731_A_ACGCCCCTGCCCTGGAGGCCC_b38	RP4-758J18.2	2.896	0.00394	0.018454	87	0.006373	yes	SKNS
chr1_1553692_A_G_b38	RP4-758J18.2	-2.891	0.004	-0.018845	108	0.006519	yes	SKNS
chr1_1554694_A_G_b38	RP4-758J18.2	-2.891	0.004	-0.018845	108	0.006519	yes	SKNS
chr1_1555247_T_A_b38	RP4-758J18.2	-2.891	0.004	-0.018845	108	0.006519	yes	SKNS
chr1_840409_TA_T_b38	RP4-758J18.2	-2.89	0.00401	-0.021865	68	0.007565	yes	SKNS
chr1_1559750_C_CAG_b38	RP4-758J18.2	-2.883	0.0041	-0.018953	112	0.006575	yes	SKNS
chr1_1561628_T_C_b38	RP4-758J18.2	-2.883	0.0041	-0.018953	112	0.006575	yes	SKNS
chr1_1563918_A_G_b38	RP4-758J18.2	-2.883	0.0041	-0.018953	112	0.006575	yes	SKNS
chr1_1565561_A_G_b38	RP4-758J18.2	-2.883	0.0041	-0.018953	112	0.006575	yes	SKNS
chr1_1566086_G_A_b38	RP4-758J18.2	-2.883	0.0041	-0.018953	112	0.006575	yes	SKNS
chr1_1567715_G_A_b38	RP4-758J18.2	-2.883	0.0041	-0.018953	112	0.006575	yes	SKNS
chr1_1567719_A_C_b38	RP4-758J18.2	-2.883	0.0041	-0.018953	112	0.006575	yes	SKNS
chr1_1569875_C_T_b38	RP4-758J18.2	-2.883	0.0041	-0.018953	112	0.006575	yes	SKNS
chr1_1714932_G_T_b38	RP4-758J18.2	-2.869	0.00428	-0.017356	134	0.006049	yes	SKNS
chr1_1554781_A_G_b38	RP4-758J18.2	-2.83	0.00483	-0.018435	108	0.006514	yes	SKNS
chr1_1577491_A_AC_b38	RP4-758J18.2	-2.805	0.00521	-0.018865	105	0.006725	yes	SKNS
chr1_1482316_C_G_b38	RP4-758J18.2	-2.802	0.00527	-0.018359	62	0.006553	yes	SKNS
chr1_1555179_A_G_b38	RP4-758J18.2	-2.788	0.00549	-0.01866	78	0.006692	yes	SKNS
chr1_1565105_CAAGGCAGGCGGATCATG_C_b38	RP4-758J18.2	-2.787	0.00551	-0.018253	114	0.006549	yes	SKNS
chr1_1542773_T_C_b38	RP4-758J18.2	-2.786	0.00552	-0.018729	98	0.006722	yes	SKNS
chr1_2253095_GAA_G_b38	RP4-758J18.2	-2.784	0.00557	-0.018451	96	0.006628	yes	SKNS
chr1_2233496_G_T_b38	RP4-758J18.2	-2.777	0.00567	-0.016467	154	0.005929	yes	SKNS
chr1_1384256_T_G_b38	RP4-758J18.2	-2.77	0.00581	-0.026255	3	0.00948	yes	SKNS
chr1_1542793_C_G_b38	RP4-758J18.2	-2.738	0.00639	-0.018376	97	0.006712	yes	SKNS
chr1_1542800_T_C_b38	RP4-758J18.2	-2.738	0.00639	-0.018376	97	0.006712	yes	SKNS
chr1_2241549_T_C_b38	RP4-758J18.2	-2.731	0.00651	-0.016298	154	0.005967	yes	SKNS
chr1_1543500_T_G_b38	RP4-758J18.2	-2.726	0.00661	-0.018226	97	0.006685	yes	SKNS
chr1_1545795_C_A_b38	RP4-758J18.2	-2.72	0.00674	-0.018308	87	0.00673	yes	SKNS
chr1_1550064_GC_G_b38	RP4-758J18.2	-2.717	0.0068	-0.018192	98	0.006696	yes	SKNS
chr1_1550068_C_A_b38	RP4-758J18.2	-2.717	0.0068	-0.018192	98	0.006696	yes	SKNS
chr1_1554548_T_C_b38	RP4-758J18.2	-2.715	0.00684	-0.018228	75	0.006713	yes	SKNS
chr1_1554290_C_T_b38	RP4-758J18.2	-2.711	0.00692	-0.018074	75	0.006667	yes	SKNS
chr1_1724661_CGATG_C_b38	RP4-758J18.2	2.705	0.00706	0.017568	73	0.006496	yes	SKNS
chr1_1543953_A_G_b38	RP4-758J18.2	-2.704	0.00708	-0.018229	98	0.006742	yes	SKNS
chr1_1462302_A_G_b38	RP4-758J18.2	2.691	0.00735	0.029832	6	0.011086	yes	SKNS
chr1_1698048_T_C_b38	RP4-758J18.2	-2.687	0.00744	-0.041327	7	0.015381	yes	SKNS
chr1_2262576_C_A_b38	RP4-758J18.2	-2.682	0.00755	-0.015903	155	0.00593	yes	SKNS
chr1_2235168_G_GT_b38	RP4-758J18.2	-2.682	0.00755	-0.015978	154	0.005958	yes	SKNS
chr1_1485324_C_T_b38	RP4-758J18.2	-2.659	0.00806	-0.030693	4	0.011541	yes	SKNS
chr1_1554246_C_T_b38	RP4-758J18.2	-2.657	0.00811	-0.018467	57	0.006949	yes	SKNS
chr1_1515828_G_A_b38	RP4-758J18.2	-2.638	0.00858	-0.030887	4	0.011708	yes	SKNS
chr1_1558347_G_A_b38	RP4-758J18.2	-2.635	0.00867	-0.01815	67	0.006889	yes	SKNS
chr1_1692900_G_GTT_b38	RP4-758J18.2	-2.631	0.00875	-0.022678	15	0.008618	yes	SKNS
chr1_1174690_G_A_b38	RP4-758J18.2	-2.626	0.00888	-0.030032	4	0.011436	yes	SKNS
chr1_1708951_C_T_b38	RP4-758J18.2	-2.623	0.00898	-0.016396	102	0.006252	yes	SKNS
chr1_903175_C_A_b38	RP4-758J18.2	2.622	0.009	0.018675	36	0.007124	yes	SKNS
chr1_828389_A_AT_b38	RP4-758J18.2	-2.614	0.00921	-0.019335	72	0.007397	yes	SKNS
chr1_814016_T_G_b38	RP4-758J18.2	-2.61	0.00931	-0.018622	48	0.007135	yes	SKNS
chr1_2370674_CTT_C_b38	RP4-758J18.2	-2.601	0.00956	-0.016909	127	0.006502	yes	SKNS
chr1_1308552_GGA_G_b38	RP4-758J18.2	-4.116	4.46e-05	-0.039804	18	0.00967	no	SKNS
chr1_901812_A_G_b38	RP4-758J18.2	3.775	0.000178	0.03997	16	0.010588	no	SKNS
chr1_901516_T_C_b38	RP4-758J18.2	3.646	0.000292	0.024551	57	0.006733	no	SKNS
chr1_1545968_T_C_b38	RP4-758J18.2	-3.623	0.000319	-0.024431	45	0.006743	no	SKNS
chr1_897580_AT_A_b38	RP4-758J18.2	3.519	0.00047	0.021624	160	0.006145	no	SKNS
chr1_896917_CTG_C_b38	RP4-758J18.2	-3.469	0.000565	-0.023311	56	0.00672	no	SKNS
chr1_896938_C_A_b38	RP4-758J18.2	-3.469	0.000565	-0.023311	56	0.00672	no	SKNS
chr1_897792_T_TCGAA_b38	RP4-758J18.2	3.469	0.000565	0.023311	56	0.00672	no	SKNS
chr1_897538_T_C_b38	RP4-758J18.2	3.436	0.000637	0.023017	59	0.0067	no	SKNS
chr1_903723_A_G_b38	RP4-758J18.2	3.43	0.000651	0.023191	50	0.006762	no	SKNS
chr1_900119_A_G_b38	RP4-758J18.2	3.416	0.000684	0.023747	41	0.006952	no	SKNS
chr1_896680_G_A_b38	RP4-758J18.2	-3.406	0.00071	-0.022912	56	0.006728	no	SKNS
chr1_896686_G_C_b38	RP4-758J18.2	-3.406	0.00071	-0.022912	56	0.006728	no	SKNS
chr1_896732_T_C_b38	RP4-758J18.2	-3.406	0.00071	-0.022912	56	0.006728	no	SKNS
chr1_896529_C_T_b38	RP4-758J18.2	-3.403	0.000716	-0.022693	60	0.006668	no	SKNS
chr1_898676_A_C_b38	RP4-758J18.2	3.4	0.000725	0.046347	9	0.013632	no	SKNS
chr1_899257_AC_A_b38	RP4-758J18.2	3.4	0.000725	0.046347	9	0.013632	no	SKNS
chr1_1430020_G_C_b38	RP4-758J18.2	-3.352	0.00086	-0.041059	3	0.012251	no	SKNS
chr1_939779_AGCCAGTGGACGCCGACCT_A_b38	RP4-758J18.2	-3.334	0.000917	-0.0212	112	0.006359	no	SKNS
chr1_1551523_T_C_b38	RP4-758J18.2	-3.234	0.0013	-0.022702	38	0.007019	no	SKNS
chr1_896109_C_T_b38	RP4-758J18.2	-3.21	0.00141	-0.021899	59	0.006823	no	SKNS
chr1_899452_G_C_b38	RP4-758J18.2	3.18	0.00156	0.022455	41	0.007061	no	SKNS
chr1_1570655_G_A_b38	RP4-758J18.2	-3.173	0.0016	-0.026424	19	0.008328	no	SKNS
chr1_1290232_G_A_b38	RP4-758J18.2	3.167	0.00163	0.034531	8	0.010903	no	SKNS
chr1_1704835_C_T_b38	RP4-758J18.2	-3.134	0.00182	-0.019441	167	0.006203	no	SKNS
chr1_1705799_A_G_b38	RP4-758J18.2	-3.102	0.00202	-0.018286	168	0.005894	no	SKNS
chr1_897376_T_G_b38	RP4-758J18.2	3.096	0.00206	0.020984	52	0.006778	no	SKNS
chr1_1538787_A_G_b38	RP4-758J18.2	-3.09	0.0021	-0.020405	110	0.006603	no	SKNS
chr1_906677_A_AAACTCAGCTGCCTCTCCCCTTC_b38	RP4-758J18.2	3.079	0.00219	0.020842	55	0.00677	no	SKNS
chr1_897843_C_T_b38	RP4-758J18.2	3.042	0.00246	0.021298	43	0.007001	no	SKNS
chr1_897922_C_T_b38	RP4-758J18.2	3.042	0.00246	0.021298	43	0.007001	no	SKNS
chr1_1407232_G_C_b38	RP4-758J18.2	-3.003	0.0028	-0.022698	30	0.007558	no	SKNS
chr1_898261_T_C_b38	RP4-758J18.2	3	0.00282	0.020816	44	0.006938	no	SKNS
chr1_898279_T_A_b38	RP4-758J18.2	3	0.00282	0.020816	44	0.006938	no	SKNS
chr1_898283_A_G_b38	RP4-758J18.2	3	0.00282	0.020816	44	0.006938	no	SKNS
chr1_898444_T_C_b38	RP4-758J18.2	2.959	0.00322	0.020718	43	0.007001	no	SKNS
chr1_2235045_A_AT_b38	RP4-758J18.2	-2.911	0.00376	-0.020072	49	0.006896	no	SKNS
chr1_1547675_G_A_b38	RP4-758J18.2	-2.876	0.00418	-0.034256	3	0.01191	no	SKNS
chr1_1378484_AT_A_b38	RP4-758J18.2	2.852	0.00451	0.02139	102	0.0075	no	SKNS
chr1_1541864_T_C_b38	RP4-758J18.2	-2.774	0.00573	-0.01879	102	0.006774	no	SKNS
chr1_1818305_TAAAAAAA_T_b38	RP4-758J18.2	-2.763	0.00592	-0.023437	12	0.008482	no	SKNS
chr1_1297163_A_G_b38	RP4-758J18.2	2.762	0.00595	0.046151	11	0.016712	no	SKNS
chr1_1934734_C_G_b38	RP4-758J18.2	2.74	0.00635	0.017163	69	0.006265	no	SKNS
chr1_1747695_A_G_b38	RP4-758J18.2	-2.724	0.00665	-0.014907	129	0.005471	no	SKNS
chr1_908690_A_AGAGGGGACAAGTGG_b38	RP4-758J18.2	-2.71	0.00695	-0.016526	88	0.006099	no	SKNS
chr1_1361163_AACAC_A_b38	RP4-758J18.2	2.707	0.007	0.043622	15	0.016114	no	SKNS
chr1_832873_A_C_b38	RP4-758J18.2	-2.705	0.00706	-0.019699	75	0.007283	no	SKNS
chr1_899576_G_A_b38	RP4-758J18.2	2.659	0.00806	0.038608	5	0.014518	no	SKNS
chr1_1574032_AAAG_A_b38	RP4-758J18.2	-2.654	0.00819	-0.019708	60	0.007425	no	SKNS
chr1_1297167_G_T_b38	RP4-758J18.2	2.654	0.00819	0.045253	10	0.017051	no	SKNS
chr1_1297168_C_T_b38	RP4-758J18.2	2.654	0.00819	0.045253	10	0.017051	no	SKNS
chr1_1129599_C_T_b38	RP4-758J18.2	2.629	0.00882	0.022829	14	0.008685	no	SKNS
chr1_1473134_C_CTT_b38	RP4-758J18.2	2.625	0.0089	0.034763	10	0.013241	no	SKNS
chr1_931513_T_C_b38	RP4-758J18.2	-2.613	0.00922	-0.01622	143	0.006207	no	SKNS
chr1_1739915_G_A_b38	RP4-758J18.2	-2.609	0.00935	-0.023242	27	0.00891	no	SKNS
chr1_1551557_A_AG_b38	RP4-758J18.2	-2.606	0.00941	-0.017485	102	0.006709	no	SKNS
chr1_1551559_A_T_b38	RP4-758J18.2	-2.606	0.00941	-0.017485	102	0.006709	no	SKNS
chr1_1046551_A_G_b38	RP4-758J18.2	-3.317	0.00117	-0.064148	7	0.019339	yes	SNTTRM
chr1_1029460_T_C_b38	RP4-758J18.2	-3.199	0.00172	-0.058135	3	0.018172	yes	SNTTRM
chr1_1029468_A_T_b38	RP4-758J18.2	-3.19	0.00177	-0.058757	3	0.018417	yes	SNTTRM
chr1_2211900_C_CTTT_b38	RP4-758J18.2	3.004	0.00318	0.083413	3	0.027766	yes	SNTTRM
chr1_1482316_C_G_b38	RP4-758J18.2	-2.961	0.00363	-0.033114	26	0.011182	yes	SNTTRM
chr1_1425135_T_C_b38	RP4-758J18.2	-2.935	0.00393	-0.065222	3	0.022223	yes	SNTTRM
chr1_1648826_A_G_b38	RP4-758J18.2	-2.813	0.00565	-0.036502	24	0.012976	yes	SNTTRM
chr1_791554_G_GGAATC_b38	RP4-758J18.2	-2.779	0.00624	-0.041139	6	0.014803	yes	SNTTRM
chr1_1657093_C_A_b38	RP4-758J18.2	-2.694	0.00796	-0.040546	16	0.015048	yes	SNTTRM
chr1_1027869_C_T_b38	RP4-758J18.2	-2.691	0.00803	-0.050067	3	0.018604	yes	SNTTRM
chr1_2293845_G_A_b38	RP4-758J18.2	2.681	0.00827	0.033841	32	0.012623	yes	SNTTRM
chr1_1053552_G_C_b38	RP4-758J18.2	-2.641	0.00927	-0.043945	7	0.016642	yes	SNTTRM
chr1_2376477_A_C_b38	RP4-758J18.2	-2.636	0.00938	-0.029281	40	0.011107	yes	SNTTRM
chr1_1042190_G_A_b38	RP4-758J18.2	-2.621	0.00979	-0.049687	7	0.018957	yes	SNTTRM
chr1_1026447_G_A_b38	RP4-758J18.2	-2.616	0.00992	-0.048583	5	0.01857	yes	SNTTRM
chr1_1288085_GC_G_b38	RP4-758J18.2	-3.601	0.000447	-0.068398	4	0.018996	no	SNTTRM
chr1_1479704_G_A_b38	RP4-758J18.2	-3.505	0.000623	-0.059201	6	0.016891	no	SNTTRM
chr1_1647600_C_G_b38	RP4-758J18.2	-3.277	0.00134	-0.061241	14	0.018688	no	SNTTRM
chr1_2106470_GTGGGCGAGGACCTCCACACGTGTCACCAGGCCAGGTAACTCTCAGCAAGCCCCTCTGGTGGGCGAGGACCTCCACACGTGTCACCAGGCCAGGTAACTCTCAGCAAGCCCCTCCA_G_b38	RP4-758J18.2	3.136	0.00211	0.066742	3	0.021283	no	SNTTRM
chr1_1651137_C_T_b38	RP4-758J18.2	-2.974	0.00349	-0.038648	20	0.012996	no	SNTTRM
chr1_1651267_T_C_b38	RP4-758J18.2	-2.974	0.00349	-0.038648	20	0.012996	no	SNTTRM
chr1_1651421_GTAGCCCCTCTGAACGGTCTGTGACACACGCATGCTTTCAGCTAGAGTACTCTA_G_b38	RP4-758J18.2	-2.974	0.00349	-0.038648	20	0.012996	no	SNTTRM
chr1_1651785_C_A_b38	RP4-758J18.2	-2.974	0.00349	-0.038648	20	0.012996	no	SNTTRM
chr1_1651926_T_C_b38	RP4-758J18.2	-2.974	0.00349	-0.038648	20	0.012996	no	SNTTRM
chr1_1652061_T_C_b38	RP4-758J18.2	-2.974	0.00349	-0.038648	20	0.012996	no	SNTTRM
chr1_1652135_C_G_b38	RP4-758J18.2	-2.974	0.00349	-0.038648	20	0.012996	no	SNTTRM
chr1_1652191_C_T_b38	RP4-758J18.2	-2.974	0.00349	-0.038648	20	0.012996	no	SNTTRM
chr1_1652592_A_G_b38	RP4-758J18.2	-2.974	0.00349	-0.038648	20	0.012996	no	SNTTRM
chr1_1652779_A_G_b38	RP4-758J18.2	-2.974	0.00349	-0.038648	20	0.012996	no	SNTTRM
chr1_1653147_A_C_b38	RP4-758J18.2	-2.974	0.00349	-0.038648	20	0.012996	no	SNTTRM
chr1_1653396_T_C_b38	RP4-758J18.2	-2.974	0.00349	-0.038648	20	0.012996	no	SNTTRM
chr1_1653472_T_C_b38	RP4-758J18.2	-2.974	0.00349	-0.038648	20	0.012996	no	SNTTRM
chr1_1653811_G_A_b38	RP4-758J18.2	-2.974	0.00349	-0.038648	20	0.012996	no	SNTTRM
chr1_1653893_C_T_b38	RP4-758J18.2	-2.974	0.00349	-0.038648	20	0.012996	no	SNTTRM
chr1_1653934_G_A_b38	RP4-758J18.2	-2.974	0.00349	-0.038648	20	0.012996	no	SNTTRM
chr1_1654143_G_A_b38	RP4-758J18.2	-2.974	0.00349	-0.038648	20	0.012996	no	SNTTRM
chr1_1654188_T_G_b38	RP4-758J18.2	-2.974	0.00349	-0.038648	20	0.012996	no	SNTTRM
chr1_1651574_G_A_b38	RP4-758J18.2	-2.967	0.00356	-0.038516	20	0.01298	no	SNTTRM
chr1_1650383_G_T_b38	RP4-758J18.2	-2.96	0.00364	-0.03871	18	0.013078	no	SNTTRM
chr1_2213842_A_G_b38	RP4-758J18.2	2.959	0.00365	0.042186	9	0.014256	no	SNTTRM
chr1_1041776_CCGGCCAGTGCCAGGGTCGAGGTGGGCGGCTCCCCCGGGGGAGGGCTG_C_b38	RP4-758J18.2	-2.944	0.00383	-0.03057	23	0.010384	no	SNTTRM
chr1_1652913_C_T_b38	RP4-758J18.2	-2.922	0.00409	-0.039694	16	0.013587	no	SNTTRM
chr1_1650777_G_A_b38	RP4-758J18.2	-2.839	0.00523	-0.036879	20	0.012989	no	SNTTRM
chr1_1648636_G_A_b38	RP4-758J18.2	-2.795	0.00595	-0.036205	24	0.012952	no	SNTTRM
chr1_1582556_T_C_b38	RP4-758J18.2	-2.785	0.00614	-0.046768	6	0.016794	no	SNTTRM
chr1_1662396_T_C_b38	RP4-758J18.2	-2.761	0.00658	-0.06001	7	0.021736	no	SNTTRM
chr1_2371032_C_T_b38	RP4-758J18.2	-2.721	0.00738	-0.030137	41	0.011075	no	SNTTRM
chr1_984475_G_A_b38	RP4-758J18.2	2.697	0.0079	0.049265	3	0.018267	no	SNTTRM
chr1_2130530_T_C_b38	RP4-758J18.2	-2.662	0.00873	-0.034073	24	0.0128	no	SNTTRM
chr1_729678_C_G_b38	RP4-758J18.2	2.653	0.00895	0.049348	3	0.018602	no	SNTTRM
chr1_817514_T_C_b38	RP4-758J18.2	-3.529	0.000525	-0.038887	13	0.011019	yes	SPLEEN
chr1_824320_T_C_b38	RP4-758J18.2	-3.326	0.00106	-0.038057	14	0.011442	yes	SPLEEN
chr1_825532_C_T_b38	RP4-758J18.2	-3.312	0.00111	-0.038538	13	0.011635	yes	SPLEEN
chr1_825767_T_C_b38	RP4-758J18.2	-3.312	0.00111	-0.038538	13	0.011635	yes	SPLEEN
chr1_817186_G_A_b38	RP4-758J18.2	-3.256	0.00134	-0.038165	14	0.011723	yes	SPLEEN
chr1_840409_TA_T_b38	RP4-758J18.2	-3.167	0.0018	-0.033193	37	0.010482	yes	SPLEEN
chr1_818094_C_G_b38	RP4-758J18.2	-3.008	0.003	-0.035518	23	0.011809	yes	SPLEEN
chr1_826577_A_AT_b38	RP4-758J18.2	-2.946	0.00363	-0.033567	14	0.011395	yes	SPLEEN
chr1_1379091_T_G_b38	RP4-758J18.2	2.912	0.00403	0.041362	8	0.014203	yes	SPLEEN
chr1_1697272_G_A_b38	RP4-758J18.2	2.711	0.00733	0.037977	16	0.014006	yes	SPLEEN
chr1_826420_A_T_b38	RP4-758J18.2	-2.705	0.00747	-0.02695	25	0.009964	yes	SPLEEN
chr1_823246_C_T_b38	RP4-758J18.2	-2.661	0.00847	-0.032287	13	0.012132	yes	SPLEEN
chr1_619428_G_A_b38	RP4-758J18.2	2.658	0.00855	0.034059	4	0.012815	yes	SPLEEN
chr1_1695459_A_G_b38	RP4-758J18.2	2.646	0.00883	0.030169	31	0.0114	yes	SPLEEN
chr1_1606089_GGC_G_b38	RP4-758J18.2	-2.608	0.00985	-0.025834	21	0.009906	yes	SPLEEN
chr1_813498_G_T_b38	RP4-758J18.2	-3.486	0.000611	-0.038831	16	0.011139	no	SPLEEN
chr1_1684789_C_CAAAAA_b38	RP4-758J18.2	-3.431	0.000741	-0.067255	4	0.019603	no	SPLEEN
chr1_2254781_C_T_b38	RP4-758J18.2	3.295	0.00118	0.052544	3	0.015948	no	SPLEEN
chr1_2274946_C_T_b38	RP4-758J18.2	3.295	0.00118	0.052544	3	0.015948	no	SPLEEN
chr1_2222104_C_CT_b38	RP4-758J18.2	-3.208	0.00157	-0.048642	8	0.015162	no	SPLEEN
chr1_1912983_T_C_b38	RP4-758J18.2	3.162	0.00183	0.032683	17	0.010335	no	SPLEEN
chr1_819584_C_T_b38	RP4-758J18.2	-3.101	0.00223	-0.035814	19	0.01155	no	SPLEEN
chr1_819123_G_A_b38	RP4-758J18.2	-3.06	0.00254	-0.034926	19	0.011413	no	SPLEEN
chr1_820560_C_T_b38	RP4-758J18.2	-3.024	0.00284	-0.032719	19	0.010819	no	SPLEEN
chr1_817341_A_G_b38	RP4-758J18.2	-3.022	0.00287	-0.034928	20	0.011558	no	SPLEEN
chr1_1936906_CA_C_b38	RP4-758J18.2	2.978	0.00329	0.034947	6	0.011734	no	SPLEEN
chr1_1768171_CA_C_b38	RP4-758J18.2	2.939	0.00371	0.037123	3	0.012632	no	SPLEEN
chr1_2287389_G_T_b38	RP4-758J18.2	-2.917	0.00397	-0.026807	54	0.009191	no	SPLEEN
chr1_1901149_A_AAAGAAAGGAAGAAAGG_b38	RP4-758J18.2	-2.897	0.00422	-0.02912	51	0.010051	no	SPLEEN
chr1_1802763_T_TAA_b38	RP4-758J18.2	2.872	0.00455	0.031974	10	0.011132	no	SPLEEN
chr1_1897682_CA_C_b38	RP4-758J18.2	2.834	0.0051	0.033394	6	0.011782	no	SPLEEN
chr1_2222298_G_A_b38	RP4-758J18.2	2.805	0.00557	0.045824	3	0.016338	no	SPLEEN
chr1_1861110_C_CA_b38	RP4-758J18.2	-2.697	0.00763	-0.023693	42	0.008784	no	SPLEEN
chr1_1376162_G_C_b38	RP4-758J18.2	2.664	0.0084	0.033196	25	0.012461	no	SPLEEN
chr1_1377431_C_T_b38	RP4-758J18.2	2.664	0.0084	0.033196	25	0.012461	no	SPLEEN
chr1_1949125_T_TTCCC_b38	RP4-758J18.2	2.639	0.00901	0.034183	7	0.012951	no	SPLEEN
chr1_1379083_AT_A_b38	RP4-758J18.2	2.624	0.0094	0.031129	14	0.011861	no	SPLEEN
chr1_1308552_GGA_G_b38	RP4-758J18.2	-2.619	0.00954	-0.039312	7	0.01501	no	SPLEEN
chr1_1903309_A_G_b38	RP4-758J18.2	2.615	0.00966	0.028828	30	0.011025	no	SPLEEN
chr1_1918697_C_T_b38	RP4-758J18.2	2.61	0.00979	0.026717	21	0.010236	no	SPLEEN
chr1_820395_A_G_b38	RP4-758J18.2	-2.607	0.00989	-0.03075	13	0.011797	no	SPLEEN
chr1_1891450_G_A_b38	RP4-758J18.2	2.604	0.00996	0.026881	15	0.010323	no	SPLEEN
chr1_619428_G_A_b38	RP4-758J18.2	3.335	0.000975	0.062343	5	0.018696	yes	STMACH
chr1_1468636_G_A_b38	RP4-758J18.2	3.058	0.00245	0.090401	3	0.029558	yes	STMACH
chr1_1461283_A_G_b38	RP4-758J18.2	2.946	0.0035	0.084522	4	0.028688	yes	STMACH
chr1_1461362_AT_A_b38	RP4-758J18.2	2.946	0.0035	0.084522	4	0.028688	yes	STMACH
chr1_1459799_T_G_b38	RP4-758J18.2	2.937	0.0036	0.086544	3	0.029468	yes	STMACH
chr1_1460858_G_T_b38	RP4-758J18.2	2.937	0.0036	0.086544	3	0.029468	yes	STMACH
chr1_1460958_G_A_b38	RP4-758J18.2	2.937	0.0036	0.086544	3	0.029468	yes	STMACH
chr1_2282992_C_T_b38	RP4-758J18.2	2.921	0.00379	0.038064	38	0.013032	yes	STMACH
chr1_1306584_G_A_b38	RP4-758J18.2	2.897	0.00407	0.084226	6	0.02907	yes	STMACH
chr1_1430020_G_C_b38	RP4-758J18.2	-2.839	0.00488	-0.070157	3	0.024714	yes	STMACH
chr1_1459357_C_A_b38	RP4-758J18.2	2.788	0.00568	0.076781	5	0.027536	yes	STMACH
chr1_1459391_A_G_b38	RP4-758J18.2	2.788	0.00568	0.076781	5	0.027536	yes	STMACH
chr1_1460370_T_C_b38	RP4-758J18.2	2.788	0.00568	0.076781	5	0.027536	yes	STMACH
chr1_591638_G_A_b38	RP4-758J18.2	2.773	0.00594	0.053499	4	0.019291	yes	STMACH
chr1_2363813_T_A_b38	RP4-758J18.2	-2.768	0.00603	-0.055291	9	0.019975	yes	STMACH
chr1_1071823_A_G_b38	RP4-758J18.2	2.664	0.0082	0.039197	15	0.014716	yes	STMACH
chr1_665688_T_A_b38	RP4-758J18.2	2.618	0.00936	0.077294	4	0.029529	yes	STMACH
chr1_2283304_C_T_b38	RP4-758J18.2	2.61	0.00956	0.034077	49	0.013055	yes	STMACH
chr1_690060_A_C_b38	RP4-758J18.2	3.043	0.00258	0.068665	5	0.022567	no	STMACH
chr1_1701309_A_G_b38	RP4-758J18.2	-2.779	0.00583	-0.074265	4	0.026719	no	STMACH
chr1_1240684_G_GCCGCCCCCATTCACCCCGGCCGTGGTCCCTGCCCCAGCCCCCA_b38	RP4-758J18.2	-2.742	0.00652	-0.057688	9	0.021038	no	STMACH
chr1_1458967_T_C_b38	RP4-758J18.2	2.739	0.00657	0.073941	6	0.026994	no	STMACH
chr1_1257407_C_G_b38	RP4-758J18.2	-2.67	0.00804	-0.084918	3	0.031802	no	STMACH
chr1_588022_A_G_b38	RP4-758J18.2	3.586	4e-04	0.037919	12	0.010575	yes	TESTIS
chr1_2372127_A_G_b38	RP4-758J18.2	-3.02	0.00277	-0.034411	4	0.011395	yes	TESTIS
chr1_1969249_A_AGCCCT_b38	RP4-758J18.2	-2.995	0.003	-0.028668	14	0.009571	yes	TESTIS
chr1_1081790_C_G_b38	RP4-758J18.2	2.961	0.00335	0.021943	70	0.007412	yes	TESTIS
chr1_1967961_G_A_b38	RP4-758J18.2	2.956	0.0034	0.029568	8	0.010004	yes	TESTIS
chr1_1086657_C_T_b38	RP4-758J18.2	2.932	0.00366	0.021874	69	0.007461	yes	TESTIS
chr1_697250_A_G_b38	RP4-758J18.2	2.846	0.00477	0.044829	6	0.015751	yes	TESTIS
chr1_1994025_C_T_b38	RP4-758J18.2	2.817	0.0052	0.028086	16	0.009968	yes	TESTIS
chr1_1877314_A_T_b38	RP4-758J18.2	-2.812	0.00529	-0.025073	21	0.008917	yes	TESTIS
chr1_1707217_G_A_b38	RP4-758J18.2	-2.796	0.00555	-0.048125	3	0.017212	yes	TESTIS
chr1_1083182_C_T_b38	RP4-758J18.2	2.789	0.00567	0.021351	76	0.007656	yes	TESTIS
chr1_1083324_A_G_b38	RP4-758J18.2	2.783	0.00577	0.020735	65	0.00745	yes	TESTIS
chr1_1079456_A_G_b38	RP4-758J18.2	2.782	0.00579	0.020871	77	0.007503	yes	TESTIS
chr1_592666_T_C_b38	RP4-758J18.2	2.782	0.0058	0.068797	3	0.024733	yes	TESTIS
chr1_1223061_GCA_G_b38	RP4-758J18.2	-2.775	0.00591	-0.037965	3	0.013683	yes	TESTIS
chr1_1417046_C_T_b38	RP4-758J18.2	2.731	0.00674	0.036412	5	0.013333	yes	TESTIS
chr1_1075337_C_T_b38	RP4-758J18.2	2.731	0.00674	0.020714	62	0.007586	yes	TESTIS
chr1_1082764_T_C_b38	RP4-758J18.2	2.699	0.00741	0.020473	74	0.007587	yes	TESTIS
chr1_1416747_CT_C_b38	RP4-758J18.2	2.695	0.00749	0.036024	5	0.013367	yes	TESTIS
chr1_1079877_A_G_b38	RP4-758J18.2	2.685	0.0077	0.020719	60	0.007715	yes	TESTIS
chr1_905012_TGCGGGGGAGGCTGTTGGGGACGTTCGTG_T_b38	RP4-758J18.2	2.682	0.00778	0.025713	17	0.009588	yes	TESTIS
chr1_1079484_T_A_b38	RP4-758J18.2	2.661	0.00826	0.020018	71	0.007523	yes	TESTIS
chr1_1738525_G_A_b38	RP4-758J18.2	2.659	0.0083	0.020976	47	0.007888	yes	TESTIS
chr1_1969229_T_A_b38	RP4-758J18.2	-2.649	0.00855	-0.024483	15	0.009241	yes	TESTIS
chr1_1079746_A_G_b38	RP4-758J18.2	2.643	0.0087	0.020158	64	0.007626	yes	TESTIS
chr1_2102314_G_GT_b38	RP4-758J18.2	-2.636	0.00888	-0.024859	14	0.00943	yes	TESTIS
chr1_1409623_T_C_b38	RP4-758J18.2	2.597	0.00992	0.034989	5	0.013472	yes	TESTIS
chr1_1932396_CA_C_b38	RP4-758J18.2	-3.653	0.000312	-0.035577	10	0.009741	no	TESTIS
chr1_2383999_G_A_b38	RP4-758J18.2	-3.271	0.00121	-0.036656	5	0.011207	no	TESTIS
chr1_1028687_C_T_b38	RP4-758J18.2	-3.125	0.00197	-0.066714	3	0.021348	no	TESTIS
chr1_1028691_C_G_b38	RP4-758J18.2	-3.014	0.00282	-0.065812	3	0.021832	no	TESTIS
chr1_609143_T_C_b38	RP4-758J18.2	2.907	0.00395	0.028009	16	0.009634	no	TESTIS
chr1_1729287_T_C_b38	RP4-758J18.2	2.842	0.00483	0.02492	27	0.008768	no	TESTIS
chr1_820879_G_GTCTACACTACCTGCCTGGCCAGCAGATCCACCCTGTCTACACTACCTGCCTGGGCAGTAGTTCCACGCAATCTCCCCTACCTGCCTCTCCAGCAGACCCGCCCTATCTATACTACTTGCCTGTCCAGCAGATCCACTCTATCTACACGACCTGCCTGTCCAGCAGATCCACCCTGTCTACACTACCTGCTTGTCCAGCAGGTCCACCCTGTCTATACTACCTGCCTGGCCAGTAGATCCACACTA_b38	RP4-758J18.2	2.841	0.00484	0.02123	20	0.007472	no	TESTIS
chr1_632781_C_T_b38	RP4-758J18.2	2.84	0.00485	0.031223	5	0.010993	no	TESTIS
chr1_1937046_G_A_b38	RP4-758J18.2	-2.804	0.00541	-0.027292	13	0.009732	no	TESTIS
chr1_633420_G_A_b38	RP4-758J18.2	2.767	0.00605	0.030223	6	0.010923	no	TESTIS
chr1_1845824_TAC_T_b38	RP4-758J18.2	2.764	0.0061	0.030404	4	0.010999	no	TESTIS
chr1_1931966_T_C_b38	RP4-758J18.2	-2.756	0.00626	-0.02328	47	0.008448	no	TESTIS
chr1_1728905_T_C_b38	RP4-758J18.2	2.738	0.00659	0.023321	30	0.008517	no	TESTIS
chr1_1728908_A_G_b38	RP4-758J18.2	2.738	0.00659	0.023321	30	0.008517	no	TESTIS
chr1_1417031_A_G_b38	RP4-758J18.2	2.714	0.00709	0.035716	6	0.013162	no	TESTIS
chr1_2004695_G_A_b38	RP4-758J18.2	2.69	0.0076	0.020835	41	0.007747	no	TESTIS
chr1_633182_A_G_b38	RP4-758J18.2	2.677	0.00789	0.028282	10	0.010566	no	TESTIS
chr1_2003928_C_CGGGCCG_b38	RP4-758J18.2	2.667	0.00811	0.021493	38	0.008058	no	TESTIS
chr1_1205055_G_T_b38	RP4-758J18.2	2.663	0.00821	0.022274	48	0.008363	no	TESTIS
chr1_2004070_T_C_b38	RP4-758J18.2	-2.655	0.0084	-0.026908	9	0.010134	no	TESTIS
chr1_669882_G_A_b38	RP4-758J18.2	2.653	0.00845	0.030132	9	0.011356	no	TESTIS
chr1_1152709_T_C_b38	RP4-758J18.2	2.643	0.00871	0.037897	3	0.01434	no	TESTIS
chr1_632730_A_G_b38	RP4-758J18.2	2.632	0.00899	0.030001	4	0.0114	no	TESTIS
chr1_2004049_G_C_b38	RP4-758J18.2	-2.614	0.00946	-0.026408	9	0.010104	no	TESTIS
chr1_1016060_CT_C_b38	RP4-758J18.2	-2.611	0.00953	-0.029352	3	0.011241	no	TESTIS
chr1_1999114_T_C_b38	RP4-758J18.2	-2.603	0.00976	-0.027721	8	0.01065	no	TESTIS
chr1_888125_T_C_b38	RP4-758J18.2	-4.139	4.09e-05	-0.039143	9	0.009457	yes	THYROID
chr1_1356751_A_G_b38	RP4-758J18.2	-3.839	0.000139	-0.050256	3	0.01309	yes	THYROID
chr1_1296207_G_A_b38	RP4-758J18.2	-3.834	0.000142	-0.049343	3	0.01287	yes	THYROID
chr1_1389777_G_A_b38	RP4-758J18.2	-3.813	0.000154	-0.049134	3	0.012885	yes	THYROID
chr1_1400626_C_T_b38	RP4-758J18.2	-3.748	0.000199	-0.048605	3	0.01297	yes	THYROID
chr1_1319648_G_A_b38	RP4-758J18.2	-3.545	0.000429	-0.046209	3	0.013035	yes	THYROID
chr1_1366183_TGA_T_b38	RP4-758J18.2	-3.537	0.000442	-0.046292	3	0.013089	yes	THYROID
chr1_2051721_C_A_b38	RP4-758J18.2	3.237	0.00129	0.022488	43	0.006947	yes	THYROID
chr1_1394041_G_A_b38	RP4-758J18.2	3.13	0.00185	0.03357	6	0.010726	yes	THYROID
chr1_1370553_CAAA_C_b38	RP4-758J18.2	3.123	0.00189	0.031357	9	0.010041	yes	THYROID
chr1_1375642_C_T_b38	RP4-758J18.2	2.944	0.00339	0.029317	12	0.00996	yes	THYROID
chr1_1366511_GGTGA_G_b38	RP4-758J18.2	2.94	0.00343	0.028392	11	0.009657	yes	THYROID
chr1_1379093_TG_T_b38	RP4-758J18.2	2.913	0.00373	0.03162	7	0.010853	yes	THYROID
chr1_1370532_C_T_b38	RP4-758J18.2	2.902	0.00387	0.02825	12	0.009735	yes	THYROID
chr1_1372909_G_A_b38	RP4-758J18.2	2.887	0.00406	0.029563	10	0.010242	yes	THYROID
chr1_1369012_C_CG_b38	RP4-758J18.2	2.845	0.00462	0.027884	11	0.0098	yes	THYROID
chr1_1369009_T_C_b38	RP4-758J18.2	2.832	0.00481	0.027763	11	0.009803	yes	THYROID
chr1_1368991_C_T_b38	RP4-758J18.2	2.831	0.00483	0.027613	11	0.009755	yes	THYROID
chr1_1341550_GCA_G_b38	RP4-758J18.2	2.823	0.00494	0.028067	12	0.009941	yes	THYROID
chr1_1369803_C_CT_b38	RP4-758J18.2	2.803	0.00526	0.025417	10	0.009068	yes	THYROID
chr1_1366321_TGTGTGTAAATGG_T_b38	RP4-758J18.2	2.763	0.00593	0.026826	11	0.009709	yes	THYROID
chr1_1364253_C_G_b38	RP4-758J18.2	2.739	0.00638	0.027021	11	0.009865	yes	THYROID
chr1_1367511_ATGAG_A_b38	RP4-758J18.2	2.7	0.00717	0.026583	10	0.009847	yes	THYROID
chr1_1814815_A_G_b38	RP4-758J18.2	-2.694	0.0073	-0.041708	3	0.015484	yes	THYROID
chr1_1370430_T_C_b38	RP4-758J18.2	2.678	0.00766	0.026214	12	0.00979	yes	THYROID
chr1_1370584_G_C_b38	RP4-758J18.2	2.678	0.00766	0.026214	12	0.00979	yes	THYROID
chr1_1363688_C_T_b38	RP4-758J18.2	2.677	0.00767	0.025979	11	0.009704	yes	THYROID
chr1_1364099_CCA_C_b38	RP4-758J18.2	2.677	0.00767	0.025979	11	0.009704	yes	THYROID
chr1_1364102_TGTTG_T_b38	RP4-758J18.2	2.677	0.00767	0.025979	11	0.009704	yes	THYROID
chr1_1368763_G_A_b38	RP4-758J18.2	2.677	0.00767	0.025979	11	0.009704	yes	THYROID
chr1_967376_AC_A_b38	RP4-758J18.2	-2.659	0.00808	-0.029167	4	0.010967	yes	THYROID
chr1_1696758_A_G_b38	RP4-758J18.2	2.655	0.00819	0.016821	101	0.006336	yes	THYROID
chr1_1366187_A_AGT_b38	RP4-758J18.2	2.641	0.00853	0.025641	11	0.00971	yes	THYROID
chr1_1374505_A_G_b38	RP4-758J18.2	2.638	0.0086	0.026403	12	0.010009	yes	THYROID
chr1_1108235_CA_C_b38	RP4-758J18.2	2.636	0.00865	0.027359	8	0.010379	yes	THYROID
chr1_2288986_T_C_b38	RP4-758J18.2	-2.636	0.00866	-0.017228	68	0.006536	yes	THYROID
chr1_1365036_T_TAA_b38	RP4-758J18.2	2.635	0.00867	0.026394	8	0.010016	yes	THYROID
chr1_1363880_A_G_b38	RP4-758J18.2	2.631	0.00878	0.025406	11	0.009657	yes	THYROID
chr1_1364357_A_C_b38	RP4-758J18.2	2.625	0.00894	0.025461	11	0.009701	yes	THYROID
chr1_1368514_C_G_b38	RP4-758J18.2	2.625	0.00894	0.025461	11	0.009701	yes	THYROID
chr1_1367388_T_TTGG_b38	RP4-758J18.2	2.619	0.00909	0.025556	11	0.009759	yes	THYROID
chr1_1746263_C_T_b38	RP4-758J18.2	2.613	0.00925	0.020029	51	0.007665	yes	THYROID
chr1_1705856_G_A_b38	RP4-758J18.2	2.604	0.00948	0.015388	172	0.005909	yes	THYROID
chr1_1364282_T_G_b38	RP4-758J18.2	2.603	0.00952	0.02531	11	0.009724	yes	THYROID
chr1_1364694_T_C_b38	RP4-758J18.2	2.603	0.00952	0.02531	11	0.009724	yes	THYROID
chr1_1364721_C_T_b38	RP4-758J18.2	2.603	0.00952	0.02531	11	0.009724	yes	THYROID
chr1_1365160_A_G_b38	RP4-758J18.2	2.603	0.00952	0.02531	11	0.009724	yes	THYROID
chr1_1365198_C_T_b38	RP4-758J18.2	2.603	0.00952	0.02531	11	0.009724	yes	THYROID
chr1_1366008_A_G_b38	RP4-758J18.2	2.603	0.00952	0.02531	11	0.009724	yes	THYROID
chr1_1366062_T_C_b38	RP4-758J18.2	2.603	0.00952	0.02531	11	0.009724	yes	THYROID
chr1_1366145_TGTGAA_T_b38	RP4-758J18.2	2.603	0.00952	0.02531	11	0.009724	yes	THYROID
chr1_1366453_G_T_b38	RP4-758J18.2	2.603	0.00952	0.02531	11	0.009724	yes	THYROID
chr1_1366726_T_G_b38	RP4-758J18.2	2.603	0.00952	0.02531	11	0.009724	yes	THYROID
chr1_1367258_T_A_b38	RP4-758J18.2	2.603	0.00952	0.02531	11	0.009724	yes	THYROID
chr1_1367297_GAA_G_b38	RP4-758J18.2	2.603	0.00952	0.02531	11	0.009724	yes	THYROID
chr1_1367300_T_TGA_b38	RP4-758J18.2	2.603	0.00952	0.02531	11	0.009724	yes	THYROID
chr1_1367329_A_AGT_b38	RP4-758J18.2	2.603	0.00952	0.02531	11	0.009724	yes	THYROID
chr1_1367373_T_TGTG_b38	RP4-758J18.2	2.603	0.00952	0.02531	11	0.009724	yes	THYROID
chr1_1367593_G_A_b38	RP4-758J18.2	2.603	0.00952	0.02531	11	0.009724	yes	THYROID
chr1_1367602_GT_G_b38	RP4-758J18.2	2.603	0.00952	0.02531	11	0.009724	yes	THYROID
chr1_1367605_GAGTGAGTGTA_G_b38	RP4-758J18.2	2.603	0.00952	0.02531	11	0.009724	yes	THYROID
chr1_1367670_GGTGA_G_b38	RP4-758J18.2	2.603	0.00952	0.02531	11	0.009724	yes	THYROID
chr1_1367722_TTTTA_T_b38	RP4-758J18.2	2.603	0.00952	0.02531	11	0.009724	yes	THYROID
chr1_1367874_A_T_b38	RP4-758J18.2	2.603	0.00952	0.02531	11	0.009724	yes	THYROID
chr1_1367919_C_T_b38	RP4-758J18.2	2.603	0.00952	0.02531	11	0.009724	yes	THYROID
chr1_1367951_C_T_b38	RP4-758J18.2	2.603	0.00952	0.02531	11	0.009724	yes	THYROID
chr1_1367965_A_G_b38	RP4-758J18.2	2.603	0.00952	0.02531	11	0.009724	yes	THYROID
chr1_1367970_T_G_b38	RP4-758J18.2	2.603	0.00952	0.02531	11	0.009724	yes	THYROID
chr1_1367994_C_A_b38	RP4-758J18.2	2.603	0.00952	0.02531	11	0.009724	yes	THYROID
chr1_1368297_C_T_b38	RP4-758J18.2	2.603	0.00952	0.02531	11	0.009724	yes	THYROID
chr1_1316929_A_T_b38	RP4-758J18.2	2.6	0.0096	0.024849	14	0.009557	yes	THYROID
chr1_1367462_T_C_b38	RP4-758J18.2	2.599	0.00963	0.025333	11	0.009748	yes	THYROID
chr1_1701564_CG_C_b38	RP4-758J18.2	3.776	0.000179	0.024018	79	0.006361	no	THYROID
chr1_789481_G_A_b38	RP4-758J18.2	3.621	0.000324	0.038396	7	0.010605	no	THYROID
chr1_1308178_GGGGCGCGGGGA_G_b38	RP4-758J18.2	3.301	0.00103	0.028777	20	0.008718	no	THYROID
chr1_1403593_A_G_b38	RP4-758J18.2	3.291	0.00107	0.033841	11	0.010283	no	THYROID
chr1_1398218_C_A_b38	RP4-758J18.2	3.266	0.00117	0.033629	11	0.010298	no	THYROID
chr1_1400756_GGA_G_b38	RP4-758J18.2	3.266	0.00117	0.033629	11	0.010298	no	THYROID
chr1_1401954_G_T_b38	RP4-758J18.2	3.266	0.00117	0.033629	11	0.010298	no	THYROID
chr1_1442793_G_A_b38	RP4-758J18.2	3.226	0.00134	0.028675	16	0.008888	no	THYROID
chr1_1716097_C_T_b38	RP4-758J18.2	3.162	0.00166	0.035522	9	0.011234	no	THYROID
chr1_1437993_G_A_b38	RP4-758J18.2	3.134	0.00182	0.025851	26	0.008248	no	THYROID
chr1_1721125_G_A_b38	RP4-758J18.2	3.132	0.00184	0.03502	9	0.011183	no	THYROID
chr1_1383743_T_C_b38	RP4-758J18.2	3.105	0.00201	0.03181	11	0.010245	no	THYROID
chr1_1480224_A_G_b38	RP4-758J18.2	3.103	0.00202	0.050075	6	0.016138	no	THYROID
chr1_2217310_C_CA_b38	RP4-758J18.2	-3.094	0.00209	-0.032608	13	0.010541	no	THYROID
chr1_1382893_G_A_b38	RP4-758J18.2	3.088	0.00213	0.03171	11	0.010271	no	THYROID
chr1_1384546_C_T_b38	RP4-758J18.2	3.067	0.00228	0.032294	11	0.01053	no	THYROID
chr1_1407565_C_A_b38	RP4-758J18.2	2.966	0.00316	0.031539	11	0.010635	no	THYROID
chr1_1058003_G_A_b38	RP4-758J18.2	2.956	0.00326	0.039554	3	0.013379	no	THYROID
chr1_1380867_A_G_b38	RP4-758J18.2	2.923	0.00362	0.030517	11	0.010439	no	THYROID
chr1_1451028_T_A_b38	RP4-758J18.2	2.882	0.00413	0.024922	16	0.008649	no	THYROID
chr1_625820_C_T_b38	RP4-758J18.2	-2.846	0.00461	-0.060302	5	0.021191	no	THYROID
chr1_1325753_G_T_b38	RP4-758J18.2	2.841	0.00468	0.02968	7	0.010447	no	THYROID
chr1_1806932_C_T_b38	RP4-758J18.2	2.839	0.0047	0.029103	5	0.010249	no	THYROID
chr1_1324139_GGGGGCTGGGGGGCTGAGGGGCTGGGGGGCTGA_G_b38	RP4-758J18.2	2.832	0.00482	0.033008	17	0.011657	no	THYROID
chr1_1074660_C_T_b38	RP4-758J18.2	2.783	0.00559	0.03639	4	0.013075	no	THYROID
chr1_1948121_T_G_b38	RP4-758J18.2	-2.775	0.00573	-0.020622	41	0.007432	no	THYROID
chr1_1366830_G_A_b38	RP4-758J18.2	2.767	0.00587	0.030774	6	0.011122	no	THYROID
chr1_1439805_G_C_b38	RP4-758J18.2	2.76	0.00599	0.023282	24	0.008436	no	THYROID
chr1_1390113_C_CA_b38	RP4-758J18.2	-2.758	0.00602	-0.038415	4	0.013927	no	THYROID
chr1_1708362_T_C_b38	RP4-758J18.2	2.687	0.00744	0.018468	75	0.006872	no	THYROID
chr1_1431656_G_A_b38	RP4-758J18.2	2.668	0.00787	0.024251	15	0.009089	no	THYROID
chr1_1962899_A_C_b38	RP4-758J18.2	2.634	0.00869	0.023613	11	0.008964	no	THYROID
chr1_1366835_G_GGTGA_b38	RP4-758J18.2	2.626	0.00891	0.029175	6	0.011111	no	THYROID
chr1_2277312_A_C_b38	RP4-758J18.2	2.623	0.00899	0.024283	11	0.009259	no	THYROID
chr1_1441187_A_G_b38	RP4-758J18.2	2.617	0.00915	0.020634	49	0.007886	no	THYROID
chr1_1329973_GCGTGTGCCATGCA_G_b38	RP4-758J18.2	2.613	0.00923	0.026365	11	0.010089	no	THYROID
chr1_1344048_G_A_b38	RP4-758J18.2	2.61	0.00933	0.026301	11	0.010078	no	THYROID
chr1_1705867_T_C_b38	RP4-758J18.2	2.604	0.00948	0.015142	150	0.005814	no	THYROID
chr1_1707607_C_G_b38	RP4-758J18.2	2.602	0.00955	0.014068	102	0.005407	no	THYROID
chr1_1690308_AT_A_b38	RP4-758J18.2	-3.297	0.00134	-0.063152	23	0.019152	yes	UTERUS
chr1_828389_A_AT_b38	RP4-758J18.2	-3.049	0.00291	-0.064616	22	0.021189	yes	UTERUS
chr1_1814815_A_AAAAAAG_b38	RP4-758J18.2	2.956	0.00385	0.079724	4	0.026968	yes	UTERUS
chr1_2102533_T_C_b38	RP4-758J18.2	2.926	0.00421	0.06106	25	0.020867	yes	UTERUS
chr1_1980146_G_A_b38	RP4-758J18.2	-2.908	0.00445	-0.075389	4	0.025927	yes	UTERUS
chr1_1980150_G_A_b38	RP4-758J18.2	-2.762	0.00679	-0.070927	4	0.02568	yes	UTERUS
chr1_1372258_T_C_b38	RP4-758J18.2	2.63	0.00983	0.088191	3	0.033532	yes	UTERUS
chr1_1708951_C_T_b38	RP4-758J18.2	-2.916	0.00434	-0.056044	24	0.01922	no	UTERUS
chr1_1967961_G_A_b38	RP4-758J18.2	2.857	0.00517	0.061633	6	0.021575	no	UTERUS
chr1_1290579_C_G_b38	RP4-758J18.2	2.724	0.00756	0.075057	9	0.027553	no	UTERUS
chr1_1695459_A_G_b38	RP4-758J18.2	3.601	0.000468	0.063981	24	0.017769	yes	VAGINA
chr1_632403_T_C_b38	RP4-758J18.2	-3.593	0.000481	-0.1108	4	0.030836	yes	VAGINA
chr1_2207937_T_C_b38	RP4-758J18.2	-3.372	0.00102	-0.061036	9	0.018104	yes	VAGINA
chr1_2089758_A_G_b38	RP4-758J18.2	-3.339	0.00113	-0.06434	12	0.01927	yes	VAGINA
chr1_591242_C_T_b38	RP4-758J18.2	-3.303	0.00127	-0.094562	4	0.028627	yes	VAGINA
chr1_1695747_C_T_b38	RP4-758J18.2	3.228	0.00162	0.05906	23	0.018294	yes	VAGINA
chr1_1976855_C_CTT_b38	RP4-758J18.2	3.161	0.002	0.058409	7	0.018476	yes	VAGINA
chr1_2079677_C_G_b38	RP4-758J18.2	-3.103	0.0024	-0.059462	8	0.01916	yes	VAGINA
chr1_591689_C_A_b38	RP4-758J18.2	-3.064	0.00272	-0.088668	4	0.028942	yes	VAGINA
chr1_2102314_G_GT_b38	RP4-758J18.2	-3.038	0.00294	-0.057189	8	0.018825	yes	VAGINA
chr1_2072659_G_A_b38	RP4-758J18.2	-2.992	0.00338	-0.057803	8	0.019317	yes	VAGINA
chr1_2074688_G_A_b38	RP4-758J18.2	-2.992	0.00338	-0.057803	8	0.019317	yes	VAGINA
chr1_2207909_CGTGTGTGTGTGTGTGTGTGT_C_b38	RP4-758J18.2	-2.971	0.00361	-0.051684	12	0.017397	yes	VAGINA
chr1_2210427_C_T_b38	RP4-758J18.2	-2.971	0.00361	-0.051684	12	0.017397	yes	VAGINA
chr1_633032_T_C_b38	RP4-758J18.2	-2.932	0.00406	-0.067215	3	0.022924	yes	VAGINA
chr1_633071_C_T_b38	RP4-758J18.2	-2.932	0.00406	-0.067215	3	0.022924	yes	VAGINA
chr1_633098_C_T_b38	RP4-758J18.2	-2.932	0.00406	-0.067215	3	0.022924	yes	VAGINA
chr1_633251_C_T_b38	RP4-758J18.2	-2.932	0.00406	-0.067215	3	0.022924	yes	VAGINA
chr1_633264_T_C_b38	RP4-758J18.2	-2.932	0.00406	-0.067215	3	0.022924	yes	VAGINA
chr1_633290_T_C_b38	RP4-758J18.2	-2.932	0.00406	-0.067215	3	0.022924	yes	VAGINA
chr1_633293_A_G_b38	RP4-758J18.2	-2.932	0.00406	-0.067215	3	0.022924	yes	VAGINA
chr1_633420_G_A_b38	RP4-758J18.2	-2.914	0.00428	-0.067084	3	0.02302	yes	VAGINA
chr1_633443_C_T_b38	RP4-758J18.2	-2.914	0.00428	-0.067084	3	0.02302	yes	VAGINA
chr1_633444_C_T_b38	RP4-758J18.2	-2.914	0.00428	-0.067084	3	0.02302	yes	VAGINA
chr1_1774165_A_G_b38	RP4-758J18.2	2.88	0.00473	0.054236	11	0.018829	yes	VAGINA
chr1_633182_A_G_b38	RP4-758J18.2	-2.871	0.00487	-0.06643	3	0.023142	yes	VAGINA
chr1_633209_T_C_b38	RP4-758J18.2	-2.871	0.00487	-0.06643	3	0.023142	yes	VAGINA
chr1_633230_C_T_b38	RP4-758J18.2	-2.871	0.00487	-0.06643	3	0.023142	yes	VAGINA
chr1_2170248_G_A_b38	RP4-758J18.2	-2.856	0.00509	-0.049222	13	0.017236	yes	VAGINA
chr1_2155442_GTGA_G_b38	RP4-758J18.2	-2.846	0.00523	-0.049863	12	0.017518	yes	VAGINA
chr1_2067567_G_A_b38	RP4-758J18.2	-2.845	0.00526	-0.062563	4	0.021994	yes	VAGINA
chr1_2076742_GA_G_b38	RP4-758J18.2	-2.829	0.00551	-0.056629	5	0.020019	yes	VAGINA
chr1_2211079_A_C_b38	RP4-758J18.2	-2.816	0.00572	-0.048898	12	0.017364	yes	VAGINA
chr1_2173542_A_G_b38	RP4-758J18.2	-2.815	0.00573	-0.049273	12	0.017501	yes	VAGINA
chr1_2148243_A_G_b38	RP4-758J18.2	-2.788	0.0062	-0.052165	8	0.018711	yes	VAGINA
chr1_2131710_C_T_b38	RP4-758J18.2	-2.784	0.00628	-0.049267	12	0.0177	yes	VAGINA
chr1_2138882_T_C_b38	RP4-758J18.2	2.777	0.0064	0.048962	12	0.017632	yes	VAGINA
chr1_2140117_A_G_b38	RP4-758J18.2	2.777	0.0064	0.048962	12	0.017632	yes	VAGINA
chr1_2141561_A_G_b38	RP4-758J18.2	2.777	0.0064	0.048962	12	0.017632	yes	VAGINA
chr1_2134510_C_T_b38	RP4-758J18.2	-2.777	0.0064	-0.048962	12	0.017632	yes	VAGINA
chr1_2134519_C_T_b38	RP4-758J18.2	-2.777	0.0064	-0.048962	12	0.017632	yes	VAGINA
chr1_2137733_C_T_b38	RP4-758J18.2	-2.777	0.0064	-0.048962	12	0.017632	yes	VAGINA
chr1_2144121_T_G_b38	RP4-758J18.2	-2.777	0.0064	-0.048962	12	0.017632	yes	VAGINA
chr1_2145821_C_T_b38	RP4-758J18.2	-2.777	0.0064	-0.048962	12	0.017632	yes	VAGINA
chr1_2145970_A_G_b38	RP4-758J18.2	-2.777	0.0064	-0.048962	12	0.017632	yes	VAGINA
chr1_2146946_C_T_b38	RP4-758J18.2	-2.777	0.0064	-0.048962	12	0.017632	yes	VAGINA
chr1_2147005_T_G_b38	RP4-758J18.2	-2.777	0.0064	-0.048962	12	0.017632	yes	VAGINA
chr1_2147043_T_A_b38	RP4-758J18.2	-2.777	0.0064	-0.048962	12	0.017632	yes	VAGINA
chr1_2147118_T_A_b38	RP4-758J18.2	-2.777	0.0064	-0.048962	12	0.017632	yes	VAGINA
chr1_2149374_G_T_b38	RP4-758J18.2	-2.777	0.0064	-0.048962	12	0.017632	yes	VAGINA
chr1_2151019_C_T_b38	RP4-758J18.2	-2.777	0.0064	-0.048962	12	0.017632	yes	VAGINA
chr1_2151283_T_C_b38	RP4-758J18.2	-2.777	0.0064	-0.048962	12	0.017632	yes	VAGINA
chr1_2151734_A_G_b38	RP4-758J18.2	-2.777	0.0064	-0.048962	12	0.017632	yes	VAGINA
chr1_2155206_T_C_b38	RP4-758J18.2	-2.777	0.0064	-0.048962	12	0.017632	yes	VAGINA
chr1_2155318_A_G_b38	RP4-758J18.2	-2.777	0.0064	-0.048962	12	0.017632	yes	VAGINA
chr1_2155596_GTGA_G_b38	RP4-758J18.2	-2.777	0.0064	-0.048962	12	0.017632	yes	VAGINA
chr1_2156665_A_G_b38	RP4-758J18.2	-2.777	0.0064	-0.048962	12	0.017632	yes	VAGINA
chr1_2157138_G_A_b38	RP4-758J18.2	-2.777	0.0064	-0.048962	12	0.017632	yes	VAGINA
chr1_2157315_A_C_b38	RP4-758J18.2	-2.777	0.0064	-0.048962	12	0.017632	yes	VAGINA
chr1_2158078_C_CT_b38	RP4-758J18.2	-2.777	0.0064	-0.048962	12	0.017632	yes	VAGINA
chr1_2159377_T_C_b38	RP4-758J18.2	-2.777	0.0064	-0.048962	12	0.017632	yes	VAGINA
chr1_2159958_A_G_b38	RP4-758J18.2	-2.777	0.0064	-0.048962	12	0.017632	yes	VAGINA
chr1_2162295_C_T_b38	RP4-758J18.2	-2.777	0.0064	-0.048962	12	0.017632	yes	VAGINA
chr1_2164260_C_T_b38	RP4-758J18.2	-2.777	0.0064	-0.048962	12	0.017632	yes	VAGINA
chr1_2167643_G_A_b38	RP4-758J18.2	-2.777	0.0064	-0.048962	12	0.017632	yes	VAGINA
chr1_2175622_G_T_b38	RP4-758J18.2	-2.777	0.0064	-0.048962	12	0.017632	yes	VAGINA
chr1_2178821_G_A_b38	RP4-758J18.2	-2.777	0.0064	-0.048962	12	0.017632	yes	VAGINA
chr1_2182126_T_G_b38	RP4-758J18.2	-2.777	0.0064	-0.048962	12	0.017632	yes	VAGINA
chr1_2127141_G_C_b38	RP4-758J18.2	-2.774	0.00646	-0.049047	12	0.017684	yes	VAGINA
chr1_2127704_G_A_b38	RP4-758J18.2	-2.774	0.00646	-0.049047	12	0.017684	yes	VAGINA
chr1_2158087_G_A_b38	RP4-758J18.2	-2.772	0.0065	-0.050734	11	0.018305	yes	VAGINA
chr1_2185716_G_A_b38	RP4-758J18.2	-2.762	0.00667	-0.048933	12	0.017714	yes	VAGINA
chr1_1767762_C_A_b38	RP4-758J18.2	2.744	0.00704	0.050529	12	0.018415	yes	VAGINA
chr1_1773215_C_A_b38	RP4-758J18.2	2.744	0.00704	0.050529	12	0.018415	yes	VAGINA
chr1_1774308_G_A_b38	RP4-758J18.2	2.744	0.00704	0.050529	12	0.018415	yes	VAGINA
chr1_1803531_C_T_b38	RP4-758J18.2	2.744	0.00704	0.050529	12	0.018415	yes	VAGINA
chr1_1830566_A_T_b38	RP4-758J18.2	2.744	0.00704	0.050529	12	0.018415	yes	VAGINA
chr1_1839349_C_G_b38	RP4-758J18.2	2.744	0.00704	0.050529	12	0.018415	yes	VAGINA
chr1_1839350_T_A_b38	RP4-758J18.2	2.744	0.00704	0.050529	12	0.018415	yes	VAGINA
chr1_1851181_C_T_b38	RP4-758J18.2	2.744	0.00704	0.050529	12	0.018415	yes	VAGINA
chr1_851430_G_A_b38	RP4-758J18.2	2.731	0.00731	0.080272	6	0.029397	yes	VAGINA
chr1_2172996_C_T_b38	RP4-758J18.2	-2.73	0.00732	-0.047025	13	0.017224	yes	VAGINA
chr1_1864350_C_T_b38	RP4-758J18.2	2.727	0.00739	0.049263	13	0.018067	yes	VAGINA
chr1_1842237_T_C_b38	RP4-758J18.2	2.697	0.00804	0.048937	14	0.018146	yes	VAGINA
chr1_1780791_C_T_b38	RP4-758J18.2	2.688	0.00824	0.050452	11	0.018768	yes	VAGINA
chr1_1783572_C_A_b38	RP4-758J18.2	2.688	0.00824	0.050452	11	0.018768	yes	VAGINA
chr1_1794321_C_T_b38	RP4-758J18.2	2.688	0.00824	0.050452	11	0.018768	yes	VAGINA
chr1_1837455_C_T_b38	RP4-758J18.2	2.688	0.00824	0.050452	11	0.018768	yes	VAGINA
chr1_1851762_G_A_b38	RP4-758J18.2	2.688	0.00824	0.050452	11	0.018768	yes	VAGINA
chr1_1852145_G_A_b38	RP4-758J18.2	2.688	0.00824	0.050452	11	0.018768	yes	VAGINA
chr1_1688570_A_T_b38	RP4-758J18.2	-2.67	0.00868	-0.056353	3	0.021108	yes	VAGINA
chr1_2162307_G_T_b38	RP4-758J18.2	-2.661	0.00889	-0.046806	12	0.017589	yes	VAGINA
chr1_2107293_C_T_b38	RP4-758J18.2	-2.655	0.00904	-0.047131	12	0.017751	yes	VAGINA
chr1_2112353_G_A_b38	RP4-758J18.2	-2.655	0.00904	-0.047131	12	0.017751	yes	VAGINA
chr1_2112691_GTT_G_b38	RP4-758J18.2	-2.655	0.00904	-0.047131	12	0.017751	yes	VAGINA
chr1_2112696_T_G_b38	RP4-758J18.2	-2.655	0.00904	-0.047131	12	0.017751	yes	VAGINA
chr1_2114437_G_A_b38	RP4-758J18.2	-2.655	0.00904	-0.047131	12	0.017751	yes	VAGINA
chr1_2114447_G_T_b38	RP4-758J18.2	-2.655	0.00904	-0.047131	12	0.017751	yes	VAGINA
chr1_2121074_A_G_b38	RP4-758J18.2	-2.646	0.00927	-0.046976	12	0.017753	yes	VAGINA
chr1_1746439_GA_G_b38	RP4-758J18.2	2.635	0.00958	0.045346	27	0.017212	yes	VAGINA
chr1_1842213_A_G_b38	RP4-758J18.2	2.629	0.00971	0.048469	13	0.018433	yes	VAGINA
chr1_1842221_C_G_b38	RP4-758J18.2	2.629	0.00971	0.048469	13	0.018433	yes	VAGINA
chr1_1842333_G_A_b38	RP4-758J18.2	2.629	0.00971	0.048469	13	0.018433	yes	VAGINA
chr1_2071051_C_CACCTGGGCGTGTG_b38	RP4-758J18.2	-3.619	0.00044	-0.069821	8	0.019293	no	VAGINA
chr1_2075942_A_G_b38	RP4-758J18.2	-3.357	0.00107	-0.065642	7	0.019554	no	VAGINA
chr1_2077249_T_C_b38	RP4-758J18.2	-3.357	0.00107	-0.065642	7	0.019554	no	VAGINA
chr1_2079109_C_T_b38	RP4-758J18.2	-3.357	0.00107	-0.065642	7	0.019554	no	VAGINA
chr1_2079131_T_C_b38	RP4-758J18.2	-3.357	0.00107	-0.065642	7	0.019554	no	VAGINA
chr1_1768171_CA_C_b38	RP4-758J18.2	3.337	0.00114	0.071596	3	0.021453	no	VAGINA
chr1_2087436_G_A_b38	RP4-758J18.2	-3.143	0.00212	-0.061182	7	0.019465	no	VAGINA
chr1_2090943_G_A_b38	RP4-758J18.2	-3.143	0.00212	-0.061182	7	0.019465	no	VAGINA
chr1_2085363_T_C_b38	RP4-758J18.2	-3.137	0.00217	-0.061125	7	0.019488	no	VAGINA
chr1_2085406_G_A_b38	RP4-758J18.2	-3.137	0.00217	-0.061125	7	0.019488	no	VAGINA
chr1_2086202_C_T_b38	RP4-758J18.2	-3.137	0.00217	-0.061125	7	0.019488	no	VAGINA
chr1_650815_G_T_b38	RP4-758J18.2	3.065	0.00271	0.096149	3	0.031373	no	VAGINA
chr1_2096462_G_A_b38	RP4-758J18.2	-3.055	0.00279	-0.051638	18	0.016902	no	VAGINA
chr1_2074854_G_GT_b38	RP4-758J18.2	-3.03	0.00302	-0.062916	5	0.020765	no	VAGINA
chr1_1703968_A_G_b38	RP4-758J18.2	-2.999	0.00332	-0.129625	3	0.043227	no	VAGINA
chr1_2081714_C_T_b38	RP4-758J18.2	-2.889	0.00461	-0.058394	14	0.020211	no	VAGINA
chr1_2079137_C_T_b38	RP4-758J18.2	-2.862	0.005	-0.054284	9	0.018969	no	VAGINA
chr1_935426_C_CGGAGCTCCTCT_b38	RP4-758J18.2	2.835	0.00541	0.137403	6	0.048473	no	VAGINA
chr1_1088408_C_T_b38	RP4-758J18.2	2.817	0.00571	0.061269	3	0.021753	no	VAGINA
chr1_1363601_A_AT_b38	RP4-758J18.2	2.773	0.00647	0.043316	37	0.015618	no	VAGINA
chr1_1714987_C_T_b38	RP4-758J18.2	-2.756	0.00679	-0.116405	3	0.042231	no	VAGINA
chr1_1718786_G_A_b38	RP4-758J18.2	-2.756	0.00679	-0.116405	3	0.042231	no	VAGINA
chr1_1719189_G_A_b38	RP4-758J18.2	-2.756	0.00679	-0.116405	3	0.042231	no	VAGINA
chr1_1720548_G_A_b38	RP4-758J18.2	-2.756	0.00679	-0.116405	3	0.042231	no	VAGINA
chr1_1721336_G_A_b38	RP4-758J18.2	-2.756	0.00679	-0.116405	3	0.042231	no	VAGINA
chr1_2093604_C_T_b38	RP4-758J18.2	-2.754	0.00685	-0.047846	22	0.017376	no	VAGINA
chr1_1724428_C_CG_b38	RP4-758J18.2	-2.694	0.00811	-0.113869	3	0.042269	no	VAGINA
chr1_660769_C_T_b38	RP4-758J18.2	-2.683	0.00837	-0.059237	7	0.02208	no	VAGINA
chr1_870176_T_A_b38	RP4-758J18.2	-2.669	0.00869	-0.074197	3	0.027797	no	VAGINA
chr1_932613_GTTTC_G_b38	RP4-758J18.2	-2.657	0.00899	-0.147583	5	0.055542	no	VAGINA
chr1_1890770_C_T_b38	RP4-758J18.2	2.651	0.00914	0.046677	16	0.017607	no	VAGINA
chr1_1701564_CG_C_b38	RP4-758J18.2	2.645	0.00929	0.043983	19	0.016627	no	VAGINA
chr1_1403593_A_G_b38	RP4-758J18.2	3.316	0.00097	0.039588	14	0.01194	yes	WHLBLD
chr1_605526_A_G_b38	RP4-758J18.2	-3.238	0.00127	-0.048447	3	0.01496	yes	WHLBLD
chr1_1400756_GGA_G_b38	RP4-758J18.2	3.193	0.00148	0.038192	14	0.011959	yes	WHLBLD
chr1_1401954_G_T_b38	RP4-758J18.2	3.193	0.00148	0.038192	14	0.011959	yes	WHLBLD
chr1_1398218_C_A_b38	RP4-758J18.2	3.092	0.00208	0.03701	14	0.01197	yes	WHLBLD
chr1_1382893_G_A_b38	RP4-758J18.2	3.089	0.0021	0.036753	14	0.011898	yes	WHLBLD
chr1_1056602_T_TGTGGGTGCGTGTGC_b38	RP4-758J18.2	-2.952	0.00329	-0.02258	112	0.00765	yes	WHLBLD
chr1_1056601_A_ACG_b38	RP4-758J18.2	-2.934	0.00347	-0.022883	114	0.007798	yes	WHLBLD
chr1_2003928_C_CGGGCCG_b38	RP4-758J18.2	2.919	0.00365	0.023389	78	0.008013	yes	WHLBLD
chr1_1726126_G_A_b38	RP4-758J18.2	-2.917	0.00367	-0.022539	155	0.007727	yes	WHLBLD
chr1_1056714_T_C_b38	RP4-758J18.2	-2.893	0.00396	-0.028385	26	0.009812	yes	WHLBLD
chr1_1375642_C_T_b38	RP4-758J18.2	2.88	0.00411	0.033396	15	0.011594	yes	WHLBLD
chr1_1056662_C_T_b38	RP4-758J18.2	-2.831	0.0048	-0.026247	36	0.009273	yes	WHLBLD
chr1_1074910_TCACA_T_b38	RP4-758J18.2	2.809	0.00513	0.032533	13	0.011581	yes	WHLBLD
chr1_1056704_T_C_b38	RP4-758J18.2	-2.806	0.00518	-0.026915	29	0.009592	yes	WHLBLD
chr1_992361_G_A_b38	RP4-758J18.2	2.79	0.00543	0.027942	25	0.010014	yes	WHLBLD
chr1_1374505_A_G_b38	RP4-758J18.2	2.784	0.00553	0.032261	15	0.011586	yes	WHLBLD
chr1_984475_G_A_b38	RP4-758J18.2	2.783	0.00555	0.031479	14	0.011311	yes	WHLBLD
chr1_1055604_G_A_b38	RP4-758J18.2	-2.72	0.00672	-0.030169	14	0.011091	yes	WHLBLD
chr1_1056947_C_T_b38	RP4-758J18.2	-2.72	0.00672	-0.030169	14	0.011091	yes	WHLBLD
chr1_1380867_A_G_b38	RP4-758J18.2	2.699	0.00714	0.033099	12	0.012262	yes	WHLBLD
chr1_2287338_A_AT_b38	RP4-758J18.2	-2.698	0.00717	-0.021969	101	0.008143	yes	WHLBLD
chr1_1056278_AC_A_b38	RP4-758J18.2	-2.623	0.00893	-0.029066	14	0.01108	yes	WHLBLD
chr1_1057472_AAG_A_b38	RP4-758J18.2	-2.623	0.00894	-0.026402	42	0.010066	yes	WHLBLD
chr1_1394041_G_A_b38	RP4-758J18.2	2.604	0.00944	0.034427	7	0.01322	yes	WHLBLD
chr1_1402457_A_G_b38	RP4-758J18.2	2.588	0.00989	0.027317	78	0.010556	yes	WHLBLD
chr1_1400626_C_T_b38	RP4-758J18.2	-5.743	1.48e-08	-0.093141	3	0.016218	no	WHLBLD
chr1_1389777_G_A_b38	RP4-758J18.2	-5.703	1.85e-08	-0.091809	3	0.016099	no	WHLBLD
chr1_1366183_TGA_T_b38	RP4-758J18.2	-5.401	9.59e-08	-0.08749	3	0.0162	no	WHLBLD
chr1_1319648_G_A_b38	RP4-758J18.2	-5.256	2.05e-07	-0.085076	3	0.016186	no	WHLBLD
chr1_1356751_A_G_b38	RP4-758J18.2	-4.93	1.07e-06	-0.080518	3	0.016333	no	WHLBLD
chr1_1296207_G_A_b38	RP4-758J18.2	-4.645	4.18e-06	-0.073582	3	0.01584	no	WHLBLD
chr1_1184997_T_A_b38	RP4-758J18.2	-3.294	0.00104	-0.078932	3	0.023959	no	WHLBLD
chr1_1074061_G_A_b38	RP4-758J18.2	3.253	0.0012	0.038358	13	0.01179	no	WHLBLD
chr1_2004141_A_C_b38	RP4-758J18.2	3.22	0.00135	0.031619	30	0.009818	no	WHLBLD
chr1_1481071_T_C_b38	RP4-758J18.2	-3.045	0.00243	-0.045845	14	0.015055	no	WHLBLD
chr1_1383743_T_C_b38	RP4-758J18.2	3.04	0.00247	0.035875	14	0.011802	no	WHLBLD
chr1_591478_T_G_b38	RP4-758J18.2	-3.014	0.00269	-0.059148	4	0.019627	no	WHLBLD
chr1_1818305_TA_T_b38	RP4-758J18.2	-2.888	0.00401	-0.057609	3	0.019946	no	WHLBLD
chr1_1407565_C_A_b38	RP4-758J18.2	2.871	0.00424	0.036432	12	0.012691	no	WHLBLD
chr1_1521298_C_CAAA_b38	RP4-758J18.2	2.81	0.00511	0.057966	8	0.020627	no	WHLBLD
chr1_2106542_CCA_C_b38	RP4-758J18.2	2.778	0.00564	0.072507	5	0.026097	no	WHLBLD
chr1_1379093_TG_T_b38	RP4-758J18.2	2.722	0.00667	0.03491	9	0.012824	no	WHLBLD
chr1_1993705_G_GGGCACAGTGGCTCATGCCTGTAATCCCAGCAACATGGGAGCCTGAGGTGGGAGGCTCTCTTGAGGCCAGGAGTTTGAGACCAGCCTGGGCAACATAGTGAGACCCCCCACCCCCCGCCATTTCTAGGAAAAAAAAAAAAAGTGGCCA_b38	RP4-758J18.2	-2.716	0.00681	-0.07049	5	0.025957	no	WHLBLD
chr1_2285870_G_GTT_b38	RP4-758J18.2	-2.711	0.0069	-0.041511	8	0.015312	no	WHLBLD
chr1_1407232_G_C_b38	RP4-758J18.2	2.679	0.00759	0.026185	30	0.009775	no	WHLBLD
chr1_996168_G_T_b38	RP4-758J18.2	2.664	0.00794	0.026357	27	0.009895	no	WHLBLD
chr1_997077_G_A_b38	RP4-758J18.2	2.65	0.00825	0.026229	27	0.009896	no	WHLBLD
chr1_996254_A_AGGGAGGGCAG_b38	RP4-758J18.2	2.633	0.00869	0.026515	24	0.010071	no	WHLBLD
chr1_1000335_C_T_b38	RP4-758J18.2	2.627	0.00883	0.026009	27	0.009901	no	WHLBLD
chr1_998741_G_A_b38	RP4-758J18.2	2.61	0.00928	0.026089	26	0.009996	no	WHLBLD
chr1_1804000_AAAAG_A_b38	RP4-758J18.2	2.594	0.00972	0.062505	4	0.024097	no	WHLBLD

---

Filters:      p-Values >= and <=      Betas >= and <=      Statistic >= and <=      Carriers >= and <=
Positions: left right     Zoom: RP4-758J18.2     Other:     -      +     reset     eQTLs Region
Draw    p-Value Beta Statistic Carriers Beta/sd(t)     Scaling     Sign (red=+, blue-)     Colors: Tissue Sign