RP5-902P8.12 - novel transcript - 1p36.33

Snps	Gene	Statistic	Pvalue	Beta	Carriers	Beta_se	Linear	Tissue
chr1_1235997_A_G_b38	RP5-902P8.12	4.442	1.1e-05	0.058332	14	0.013133	yes	ADPSBQ
chr1_1388583_CTA_C_b38	RP5-902P8.12	4.059	5.69e-05	0.060579	5	0.014923	yes	ADPSBQ
chr1_1239925_G_A_b38	RP5-902P8.12	4.03	6.42e-05	0.06232	4	0.015463	yes	ADPSBQ
chr1_1239126_C_CT_b38	RP5-902P8.12	3.935	9.47e-05	0.054139	7	0.013758	yes	ADPSBQ
chr1_1239127_A_ACATGCATCC_b38	RP5-902P8.12	3.935	9.47e-05	0.054139	7	0.013758	yes	ADPSBQ
chr1_1239574_T_C_b38	RP5-902P8.12	3.935	9.47e-05	0.054139	7	0.013758	yes	ADPSBQ
chr1_1238883_G_A_b38	RP5-902P8.12	3.928	9.76e-05	0.058142	4	0.014803	yes	ADPSBQ
chr1_1210101_CAA_C_b38	RP5-902P8.12	3.908	0.000106	0.056569	5	0.014475	yes	ADPSBQ
chr1_1240367_A_G_b38	RP5-902P8.12	3.903	0.000108	0.053432	7	0.013689	yes	ADPSBQ
chr1_1235869_T_C_b38	RP5-902P8.12	3.895	0.000111	0.057221	4	0.014692	yes	ADPSBQ
chr1_1235602_C_A_b38	RP5-902P8.12	3.889	0.000114	0.051078	10	0.013133	yes	ADPSBQ
chr1_1231710_CCCCCGGGAA_C_b38	RP5-902P8.12	3.871	0.000122	0.048514	13	0.012532	yes	ADPSBQ
chr1_1210031_G_A_b38	RP5-902P8.12	3.85	0.000133	0.057605	5	0.014963	yes	ADPSBQ
chr1_1210061_A_G_b38	RP5-902P8.12	3.85	0.000133	0.057605	5	0.014963	yes	ADPSBQ
chr1_1210087_C_G_b38	RP5-902P8.12	3.85	0.000133	0.057605	5	0.014963	yes	ADPSBQ
chr1_1210386_C_G_b38	RP5-902P8.12	3.85	0.000133	0.057605	5	0.014963	yes	ADPSBQ
chr1_1217733_G_A_b38	RP5-902P8.12	3.837	0.00014	0.050247	10	0.013097	yes	ADPSBQ
chr1_1209119_GGA_G_b38	RP5-902P8.12	3.817	0.000152	0.057463	5	0.015054	yes	ADPSBQ
chr1_1209273_G_A_b38	RP5-902P8.12	3.817	0.000152	0.057463	5	0.015054	yes	ADPSBQ
chr1_1209316_T_C_b38	RP5-902P8.12	3.817	0.000152	0.057463	5	0.015054	yes	ADPSBQ
chr1_1230462_A_ATTT_b38	RP5-902P8.12	3.743	0.000203	0.054842	6	0.014652	yes	ADPSBQ
chr1_1221275_G_A_b38	RP5-902P8.12	3.717	0.000224	0.052669	4	0.014169	yes	ADPSBQ
chr1_1224281_GTTTTA_G_b38	RP5-902P8.12	3.716	0.000225	0.055381	4	0.014903	yes	ADPSBQ
chr1_1227886_G_A_b38	RP5-902P8.12	3.716	0.000225	0.055381	4	0.014903	yes	ADPSBQ
chr1_1230250_G_A_b38	RP5-902P8.12	3.716	0.000225	0.055381	4	0.014903	yes	ADPSBQ
chr1_1211863_A_C_b38	RP5-902P8.12	3.712	0.000229	0.055445	5	0.014939	yes	ADPSBQ
chr1_1212390_G_A_b38	RP5-902P8.12	3.695	0.000244	0.055201	5	0.014939	yes	ADPSBQ
chr1_1211917_G_A_b38	RP5-902P8.12	3.678	0.00026	0.055285	5	0.015029	yes	ADPSBQ
chr1_1214801_G_C_b38	RP5-902P8.12	3.677	0.000261	0.054654	5	0.014865	yes	ADPSBQ
chr1_1223568_A_G_b38	RP5-902P8.12	3.672	0.000267	0.049546	8	0.013495	yes	ADPSBQ
chr1_1931743_CA_C_b38	RP5-902P8.12	3.671	0.000267	0.040998	45	0.011168	yes	ADPSBQ
chr1_1214831_G_A_b38	RP5-902P8.12	3.654	0.000285	0.054287	5	0.014858	yes	ADPSBQ
chr1_1221355_T_C_b38	RP5-902P8.12	3.653	0.000286	0.051599	4	0.014124	yes	ADPSBQ
chr1_1228069_T_C_b38	RP5-902P8.12	3.62	0.000324	0.051089	4	0.014112	yes	ADPSBQ
chr1_1225476_T_C_b38	RP5-902P8.12	3.614	0.000332	0.048714	8	0.013481	yes	ADPSBQ
chr1_1226013_C_T_b38	RP5-902P8.12	3.614	0.000332	0.048714	8	0.013481	yes	ADPSBQ
chr1_1236303_A_G_b38	RP5-902P8.12	3.606	0.000342	0.044926	13	0.01246	yes	ADPSBQ
chr1_1219858_G_A_b38	RP5-902P8.12	3.602	0.000347	0.041281	24	0.011461	yes	ADPSBQ
chr1_1240390_G_A_b38	RP5-902P8.12	3.57	0.000391	0.053851	4	0.015085	yes	ADPSBQ
chr1_1222580_T_C_b38	RP5-902P8.12	3.566	0.000396	0.048596	7	0.013626	yes	ADPSBQ
chr1_1222594_A_G_b38	RP5-902P8.12	3.566	0.000396	0.048596	7	0.013626	yes	ADPSBQ
chr1_1223644_C_T_b38	RP5-902P8.12	3.566	0.000396	0.048596	7	0.013626	yes	ADPSBQ
chr1_1225285_G_A_b38	RP5-902P8.12	3.559	0.000407	0.048712	7	0.013688	yes	ADPSBQ
chr1_1227055_C_A_b38	RP5-902P8.12	3.53	0.000453	0.0485	6	0.013738	yes	ADPSBQ
chr1_1215068_T_C_b38	RP5-902P8.12	3.527	0.000459	0.052823	5	0.014978	yes	ADPSBQ
chr1_1226486_C_T_b38	RP5-902P8.12	3.524	0.000463	0.044726	11	0.012691	yes	ADPSBQ
chr1_1221960_A_G_b38	RP5-902P8.12	3.503	5e-04	0.048311	6	0.013789	yes	ADPSBQ
chr1_1221992_G_A_b38	RP5-902P8.12	3.503	5e-04	0.048311	6	0.013789	yes	ADPSBQ
chr1_1222167_T_C_b38	RP5-902P8.12	3.503	5e-04	0.048311	6	0.013789	yes	ADPSBQ
chr1_1222184_G_A_b38	RP5-902P8.12	3.503	5e-04	0.048311	6	0.013789	yes	ADPSBQ
chr1_1222251_G_A_b38	RP5-902P8.12	3.503	5e-04	0.048311	6	0.013789	yes	ADPSBQ
chr1_1222304_C_T_b38	RP5-902P8.12	3.503	5e-04	0.048311	6	0.013789	yes	ADPSBQ
chr1_1222325_C_G_b38	RP5-902P8.12	3.503	5e-04	0.048311	6	0.013789	yes	ADPSBQ
chr1_1222454_C_T_b38	RP5-902P8.12	3.503	5e-04	0.048311	6	0.013789	yes	ADPSBQ
chr1_1222482_C_T_b38	RP5-902P8.12	3.503	5e-04	0.048311	6	0.013789	yes	ADPSBQ
chr1_1222579_C_T_b38	RP5-902P8.12	3.503	5e-04	0.048311	6	0.013789	yes	ADPSBQ
chr1_1222611_G_A_b38	RP5-902P8.12	3.503	5e-04	0.048311	6	0.013789	yes	ADPSBQ
chr1_1222640_A_C_b38	RP5-902P8.12	3.503	5e-04	0.048311	6	0.013789	yes	ADPSBQ
chr1_1222897_G_A_b38	RP5-902P8.12	3.503	5e-04	0.048311	6	0.013789	yes	ADPSBQ
chr1_1222946_G_A_b38	RP5-902P8.12	3.503	5e-04	0.048311	6	0.013789	yes	ADPSBQ
chr1_1222977_A_G_b38	RP5-902P8.12	3.503	5e-04	0.048311	6	0.013789	yes	ADPSBQ
chr1_1223154_G_GAC_b38	RP5-902P8.12	3.503	5e-04	0.048311	6	0.013789	yes	ADPSBQ
chr1_1223182_AAC_A_b38	RP5-902P8.12	3.503	5e-04	0.048311	6	0.013789	yes	ADPSBQ
chr1_1223593_A_T_b38	RP5-902P8.12	3.503	5e-04	0.048311	6	0.013789	yes	ADPSBQ
chr1_1223595_A_C_b38	RP5-902P8.12	3.503	5e-04	0.048311	6	0.013789	yes	ADPSBQ
chr1_1223640_A_G_b38	RP5-902P8.12	3.503	5e-04	0.048311	6	0.013789	yes	ADPSBQ
chr1_1223682_T_C_b38	RP5-902P8.12	3.503	5e-04	0.048311	6	0.013789	yes	ADPSBQ
chr1_1223727_G_A_b38	RP5-902P8.12	3.503	5e-04	0.048311	6	0.013789	yes	ADPSBQ
chr1_1224105_C_T_b38	RP5-902P8.12	3.503	5e-04	0.048311	6	0.013789	yes	ADPSBQ
chr1_1224349_T_G_b38	RP5-902P8.12	3.503	5e-04	0.048311	6	0.013789	yes	ADPSBQ
chr1_1224844_C_T_b38	RP5-902P8.12	3.503	5e-04	0.048311	6	0.013789	yes	ADPSBQ
chr1_1224846_A_G_b38	RP5-902P8.12	3.503	5e-04	0.048311	6	0.013789	yes	ADPSBQ
chr1_1225429_T_C_b38	RP5-902P8.12	3.503	5e-04	0.048311	6	0.013789	yes	ADPSBQ
chr1_1225720_CGCCACAGACACGGGCCACACACTCCACAT_C_b38	RP5-902P8.12	3.503	5e-04	0.048311	6	0.013789	yes	ADPSBQ
chr1_1225982_A_G_b38	RP5-902P8.12	3.503	5e-04	0.048311	6	0.013789	yes	ADPSBQ
chr1_1227161_G_C_b38	RP5-902P8.12	3.503	5e-04	0.048311	6	0.013789	yes	ADPSBQ
chr1_1227792_T_C_b38	RP5-902P8.12	3.503	5e-04	0.048311	6	0.013789	yes	ADPSBQ
chr1_1227975_T_C_b38	RP5-902P8.12	3.503	5e-04	0.048311	6	0.013789	yes	ADPSBQ
chr1_1229160_G_T_b38	RP5-902P8.12	3.503	5e-04	0.048311	6	0.013789	yes	ADPSBQ
chr1_1229307_G_C_b38	RP5-902P8.12	3.503	5e-04	0.048311	6	0.013789	yes	ADPSBQ
chr1_1229900_GCA_G_b38	RP5-902P8.12	3.503	5e-04	0.048311	6	0.013789	yes	ADPSBQ
chr1_1229940_CAT_C_b38	RP5-902P8.12	3.503	5e-04	0.048311	6	0.013789	yes	ADPSBQ
chr1_1229981_A_G_b38	RP5-902P8.12	3.503	5e-04	0.048311	6	0.013789	yes	ADPSBQ
chr1_1230091_T_C_b38	RP5-902P8.12	3.503	5e-04	0.048311	6	0.013789	yes	ADPSBQ
chr1_1230345_A_G_b38	RP5-902P8.12	3.503	5e-04	0.048311	6	0.013789	yes	ADPSBQ
chr1_1230441_T_C_b38	RP5-902P8.12	3.503	5e-04	0.048311	6	0.013789	yes	ADPSBQ
chr1_1230695_G_A_b38	RP5-902P8.12	3.503	5e-04	0.048311	6	0.013789	yes	ADPSBQ
chr1_1230797_G_C_b38	RP5-902P8.12	3.503	5e-04	0.048311	6	0.013789	yes	ADPSBQ
chr1_1230825_C_T_b38	RP5-902P8.12	3.503	5e-04	0.048311	6	0.013789	yes	ADPSBQ
chr1_1226261_G_A_b38	RP5-902P8.12	3.496	0.000513	0.048454	6	0.013859	yes	ADPSBQ
chr1_1226334_AC_A_b38	RP5-902P8.12	3.496	0.000513	0.048454	6	0.013859	yes	ADPSBQ
chr1_1226338_TGTACGGTCAGGAGGAAACATGGCACCTCCCCTCTGGGGGCTCTTTCCAGAAACCCTCAACCC_T_b38	RP5-902P8.12	3.496	0.000513	0.048454	6	0.013859	yes	ADPSBQ
chr1_1216708_CT_C_b38	RP5-902P8.12	3.47	0.000564	0.050631	4	0.01459	yes	ADPSBQ
chr1_1222245_C_T_b38	RP5-902P8.12	3.47	0.000565	0.047867	6	0.013796	yes	ADPSBQ
chr1_1226620_G_GC_b38	RP5-902P8.12	3.401	0.000724	0.047164	6	0.013868	yes	ADPSBQ
chr1_1226901_G_A_b38	RP5-902P8.12	3.354	0.000856	0.046626	6	0.013902	yes	ADPSBQ
chr1_1226936_G_T_b38	RP5-902P8.12	3.351	0.000865	0.047862	6	0.014282	yes	ADPSBQ
chr1_1195856_G_T_b38	RP5-902P8.12	3.282	0.0011	0.064761	3	0.019733	yes	ADPSBQ
chr1_1256490_C_T_b38	RP5-902P8.12	3.274	0.00113	0.057176	3	0.017463	yes	ADPSBQ
chr1_1186850_G_GT_b38	RP5-902P8.12	3.245	0.00125	0.045261	7	0.013947	yes	ADPSBQ
chr1_1226892_C_T_b38	RP5-902P8.12	3.186	0.00153	0.044473	6	0.013961	yes	ADPSBQ
chr1_928128_G_T_b38	RP5-902P8.12	-3.157	0.00169	-0.044093	18	0.013966	yes	ADPSBQ
chr1_1367954_A_C_b38	RP5-902P8.12	3.125	0.00188	0.059404	3	0.019011	yes	ADPSBQ
chr1_1372220_C_T_b38	RP5-902P8.12	3.125	0.00188	0.059404	3	0.019011	yes	ADPSBQ
chr1_727242_G_A_b38	RP5-902P8.12	-3.118	0.00192	-0.039461	16	0.012656	yes	ADPSBQ
chr1_1250178_T_C_b38	RP5-902P8.12	3.079	0.00219	0.049866	4	0.016194	yes	ADPSBQ
chr1_1238231_G_A_b38	RP5-902P8.12	3.047	0.00243	0.033834	31	0.011104	yes	ADPSBQ
chr1_1732892_C_CTT_b38	RP5-902P8.12	3.04	0.00249	0.081817	3	0.026918	yes	ADPSBQ
chr1_1388565_GTC_G_b38	RP5-902P8.12	-3.034	0.00254	-0.032595	34	0.010745	yes	ADPSBQ
chr1_937396_GCC_G_b38	RP5-902P8.12	-3.006	0.00278	-0.027342	125	0.009095	yes	ADPSBQ
chr1_1224783_G_A_b38	RP5-902P8.12	3.005	0.00278	0.039887	7	0.013272	yes	ADPSBQ
chr1_1219159_G_A_b38	RP5-902P8.12	2.978	0.00304	0.045998	4	0.015446	yes	ADPSBQ
chr1_1228094_A_G_b38	RP5-902P8.12	2.955	0.00327	0.045477	4	0.015391	yes	ADPSBQ
chr1_1219941_C_T_b38	RP5-902P8.12	2.952	0.00331	0.046052	4	0.015602	yes	ADPSBQ
chr1_1301426_A_AT_b38	RP5-902P8.12	2.914	0.00372	0.037479	22	0.012861	yes	ADPSBQ
chr1_1252261_C_T_b38	RP5-902P8.12	2.846	0.0046	0.042995	5	0.015105	yes	ADPSBQ
chr1_1231507_T_C_b38	RP5-902P8.12	2.816	0.00505	0.032482	19	0.011535	yes	ADPSBQ
chr1_1250144_T_C_b38	RP5-902P8.12	2.811	0.00514	0.046357	3	0.016494	yes	ADPSBQ
chr1_1236037_C_T_b38	RP5-902P8.12	2.803	0.00526	0.025771	107	0.009195	yes	ADPSBQ
chr1_1968747_T_C_b38	RP5-902P8.12	-2.771	0.00579	-0.033729	12	0.01217	yes	ADPSBQ
chr1_1221049_C_G_b38	RP5-902P8.12	2.764	0.00592	0.02841	78	0.010279	yes	ADPSBQ
chr1_775930_G_A_b38	RP5-902P8.12	-2.761	0.00597	-0.046834	5	0.016964	yes	ADPSBQ
chr1_1248017_C_T_b38	RP5-902P8.12	2.755	0.00608	0.046387	3	0.016838	yes	ADPSBQ
chr1_2118342_G_GT_b38	RP5-902P8.12	-2.733	0.00649	-0.024149	119	0.008835	yes	ADPSBQ
chr1_758351_A_G_b38	RP5-902P8.12	-2.733	0.0065	-0.035143	14	0.01286	yes	ADPSBQ
chr1_758443_G_C_b38	RP5-902P8.12	-2.732	0.00651	-0.035141	14	0.012861	yes	ADPSBQ
chr1_1217251_C_A_b38	RP5-902P8.12	2.727	0.0066	0.036319	12	0.013316	yes	ADPSBQ
chr1_791554_G_GGAATC_b38	RP5-902P8.12	2.701	0.00714	0.029654	24	0.010977	yes	ADPSBQ
chr1_1242538_CT_C_b38	RP5-902P8.12	2.695	0.00727	0.045038	3	0.016712	yes	ADPSBQ
chr1_1288085_GC_G_b38	RP5-902P8.12	2.645	0.00843	0.035776	12	0.013528	yes	ADPSBQ
chr1_1293731_A_ACGCCCCTGCCCTGGAGGCCC_b38	RP5-902P8.12	-2.64	0.00855	-0.023799	90	0.009016	yes	ADPSBQ
chr1_1230159_G_A_b38	RP5-902P8.12	2.632	0.00874	0.028642	42	0.010881	yes	ADPSBQ
chr1_1252613_C_G_b38	RP5-902P8.12	2.625	0.00893	0.037841	8	0.014416	yes	ADPSBQ
chr1_1971864_C_T_b38	RP5-902P8.12	-2.624	0.00894	-0.023101	105	0.008802	yes	ADPSBQ
chr1_1186903_T_G_b38	RP5-902P8.12	2.615	0.00919	0.037032	6	0.014162	yes	ADPSBQ
chr1_1187536_A_G_b38	RP5-902P8.12	2.608	0.00937	0.037484	5	0.014372	yes	ADPSBQ
chr1_1187557_G_A_b38	RP5-902P8.12	2.608	0.00937	0.037484	5	0.014372	yes	ADPSBQ
chr1_818464_CCT_C_b38	RP5-902P8.12	2.607	0.00941	0.029687	38	0.01139	yes	ADPSBQ
chr1_1228424_C_T_b38	RP5-902P8.12	2.601	0.00955	0.030155	18	0.011592	yes	ADPSBQ
chr1_855085_G_A_b38	RP5-902P8.12	-2.601	0.00956	-0.036651	11	0.014091	yes	ADPSBQ
chr1_1252487_C_A_b38	RP5-902P8.12	2.59	0.00988	0.041266	4	0.015935	yes	ADPSBQ
chr1_1613160_C_CTT_b38	RP5-902P8.12	2.587	0.00995	0.056525	6	0.021848	yes	ADPSBQ
chr1_1240580_G_GC_b38	RP5-902P8.12	3.379	0.000784	0.046173	6	0.013666	no	ADPSBQ
chr1_1425464_CA_C_b38	RP5-902P8.12	3.175	0.00159	0.043662	4	0.01375	no	ADPSBQ
chr1_727034_C_T_b38	RP5-902P8.12	-2.961	0.00321	-0.036055	21	0.012177	no	ADPSBQ
chr1_860178_C_CTTTTTTTT_b38	RP5-902P8.12	-2.932	0.00352	-0.061434	4	0.020952	no	ADPSBQ
chr1_1047464_G_C_b38	RP5-902P8.12	2.88	0.00415	0.049906	3	0.017329	no	ADPSBQ
chr1_1366923_AGTTG_A_b38	RP5-902P8.12	2.855	0.00448	0.058637	6	0.020539	no	ADPSBQ
chr1_1290968_C_G_b38	RP5-902P8.12	2.781	0.00562	0.034512	49	0.012409	no	ADPSBQ
chr1_928131_T_C_b38	RP5-902P8.12	-2.78	0.00564	-0.029842	29	0.010736	no	ADPSBQ
chr1_1229369_G_GC_b38	RP5-902P8.12	2.732	0.00652	0.030776	25	0.011266	no	ADPSBQ
chr1_598934_CG_C_b38	RP5-902P8.12	2.698	0.00721	0.035325	11	0.013094	no	ADPSBQ
chr1_924321_C_G_b38	RP5-902P8.12	2.654	0.00821	0.048464	26	0.018264	no	ADPSBQ
chr1_1606099_G_GGTCAGGCGAGGGGTC_b38	RP5-902P8.12	-2.646	0.0084	-0.025793	52	0.009748	no	ADPSBQ
chr1_2142322_CAGCAGCCGAAGCGCCTCCTTTCAATCCAGGGTCCACACATCCAGCAGCCGAAGCGCCCTCCTTTCAATCCAGGGTCCAGGCATCT_C_b38	RP5-902P8.12	-2.625	0.00892	-0.051213	9	0.019509	no	ADPSBQ
chr1_1160003_G_A_b38	RP5-902P8.12	2.611	0.0093	0.027002	37	0.010343	no	ADPSBQ
chr1_1664514_A_G_b38	RP5-902P8.12	3.226	0.00136	0.097376	3	0.030181	yes	ADPVSC
chr1_1118491_T_C_b38	RP5-902P8.12	-2.996	0.00291	-0.064337	5	0.021474	yes	ADPVSC
chr1_1118832_C_T_b38	RP5-902P8.12	-2.996	0.00291	-0.064337	5	0.021474	yes	ADPVSC
chr1_1120626_G_A_b38	RP5-902P8.12	-2.996	0.00291	-0.064337	5	0.021474	yes	ADPVSC
chr1_1324195_G_A_b38	RP5-902P8.12	-2.639	0.00864	-0.07426	3	0.02814	yes	ADPVSC
chr1_1864337_G_A_b38	RP5-902P8.12	2.621	0.0091	0.026864	40	0.010249	yes	ADPVSC
chr1_1115543_T_C_b38	RP5-902P8.12	-3.086	0.00217	-0.069265	5	0.022448	no	ADPVSC
chr1_1584235_A_AT_b38	RP5-902P8.12	-3.033	0.00258	-0.030205	66	0.00996	no	ADPVSC
chr1_1113344_A_C_b38	RP5-902P8.12	-2.989	0.00298	-0.065392	4	0.021881	no	ADPVSC
chr1_1123518_CGCACACGCCACACACACCTGCGCACACTCCTGCACACACAGTGCACACACCTGCACACACACCTGTGCACACACACCTGT_C_b38	RP5-902P8.12	-2.913	0.00378	-0.065846	3	0.022605	no	ADPVSC
chr1_1113260_C_A_b38	RP5-902P8.12	-2.892	0.00404	-0.063163	4	0.021842	no	ADPVSC
chr1_1116728_A_G_b38	RP5-902P8.12	-2.892	0.00404	-0.063163	4	0.021842	no	ADPVSC
chr1_1124095_ACACACACCTGTG_A_b38	RP5-902P8.12	-2.862	0.00443	-0.061515	4	0.021493	no	ADPVSC
chr1_1115683_C_A_b38	RP5-902P8.12	-2.85	0.0046	-0.062378	5	0.021885	no	ADPVSC
chr1_1119514_G_A_b38	RP5-902P8.12	-2.82	0.00504	-0.059468	6	0.021088	no	ADPVSC
chr1_1120771_G_A_b38	RP5-902P8.12	-2.82	0.00504	-0.059468	6	0.021088	no	ADPVSC
chr1_1120821_T_G_b38	RP5-902P8.12	-2.82	0.00504	-0.059468	6	0.021088	no	ADPVSC
chr1_1118779_C_T_b38	RP5-902P8.12	-2.776	0.00576	-0.059362	9	0.021381	no	ADPVSC
chr1_1118835_A_G_b38	RP5-902P8.12	-2.776	0.00576	-0.059362	9	0.021381	no	ADPVSC
chr1_1119363_C_G_b38	RP5-902P8.12	-2.776	0.00576	-0.059362	9	0.021381	no	ADPVSC
chr1_1123890_G_A_b38	RP5-902P8.12	-2.776	0.00576	-0.061027	4	0.021983	no	ADPVSC
chr1_1118777_T_C_b38	RP5-902P8.12	-2.764	0.00597	-0.059193	10	0.021416	no	ADPVSC
chr1_1114769_G_A_b38	RP5-902P8.12	-2.752	0.0062	-0.059229	5	0.021525	no	ADPVSC
chr1_1022587_T_TTGTAGTCTGACCTGTGGTCTGAC_b38	RP5-902P8.12	2.731	0.0066	0.079564	5	0.029138	no	ADPVSC
chr1_1115321_G_C_b38	RP5-902P8.12	-2.707	0.00709	-0.06018	4	0.022233	no	ADPVSC
chr1_1116489_G_C_b38	RP5-902P8.12	-2.707	0.00709	-0.06018	4	0.022233	no	ADPVSC
chr1_1114143_C_A_b38	RP5-902P8.12	-2.703	0.00717	-0.057146	8	0.021142	no	ADPVSC
chr1_1835922_G_GAA_b38	RP5-902P8.12	2.687	0.00752	0.035871	31	0.013352	no	ADPVSC
chr1_1116304_A_C_b38	RP5-902P8.12	-2.685	0.00757	-0.058148	8	0.02166	no	ADPVSC
chr1_1605629_G_A_b38	RP5-902P8.12	2.679	0.0077	0.034611	5	0.012922	no	ADPVSC
chr1_975523_T_C_b38	RP5-902P8.12	2.656	0.00822	0.054379	6	0.020472	no	ADPVSC
chr1_839480_CACACACCTGGACAA_C_b38	RP5-902P8.12	3.581	0.000434	0.044837	31	0.012521	yes	ADRNLG
chr1_1744096_C_T_b38	RP5-902P8.12	-3.53	0.00052	-0.055149	24	0.015623	yes	ADRNLG
chr1_1744121_A_C_b38	RP5-902P8.12	-3.42	0.000765	-0.053415	27	0.015619	yes	ADRNLG
chr1_1589418_T_TA_b38	RP5-902P8.12	-3.221	0.0015	-0.038918	28	0.012081	yes	ADRNLG
chr1_1170681_G_A_b38	RP5-902P8.12	3.096	0.00226	0.033088	52	0.010688	yes	ADRNLG
chr1_2189679_C_T_b38	RP5-902P8.12	3.031	0.00278	0.03687	28	0.012166	yes	ADRNLG
chr1_2067567_G_A_b38	RP5-902P8.12	-2.991	0.00314	-0.051428	3	0.017192	yes	ADRNLG
chr1_1773676_TTG_T_b38	RP5-902P8.12	2.934	0.00376	0.052463	3	0.017884	yes	ADRNLG
chr1_2090659_G_A_b38	RP5-902P8.12	-2.867	0.00461	-0.046458	8	0.016207	yes	ADRNLG
chr1_2091118_G_A_b38	RP5-902P8.12	-2.867	0.00461	-0.046458	8	0.016207	yes	ADRNLG
chr1_2091238_C_T_b38	RP5-902P8.12	-2.867	0.00461	-0.046458	8	0.016207	yes	ADRNLG
chr1_1339884_A_ACAGCCGCATGTCCCCCAGCAGCCCCCACAGACCCACCCG_b38	RP5-902P8.12	2.749	0.00656	0.041855	8	0.015227	yes	ADRNLG
chr1_2079294_C_T_b38	RP5-902P8.12	-2.729	0.00695	-0.034327	36	0.01258	yes	ADRNLG
chr1_2072553_GC_G_b38	RP5-902P8.12	-2.716	0.00722	-0.035091	40	0.012922	yes	ADRNLG
chr1_1663180_T_C_b38	RP5-902P8.12	-2.672	0.00819	-0.03897	6	0.014585	yes	ADRNLG
chr1_1663182_C_A_b38	RP5-902P8.12	-2.672	0.00819	-0.03897	6	0.014585	yes	ADRNLG
chr1_2069834_A_G_b38	RP5-902P8.12	-2.667	0.00831	-0.034718	40	0.013019	yes	ADRNLG
chr1_1177602_C_T_b38	RP5-902P8.12	-2.66	0.00849	-0.040226	8	0.015125	yes	ADRNLG
chr1_1180614_G_A_b38	RP5-902P8.12	-2.616	0.00961	-0.037051	11	0.014165	yes	ADRNLG
chr1_601606_G_T_b38	RP5-902P8.12	3.059	0.00254	0.043658	8	0.014271	no	ADRNLG
chr1_591626_T_C_b38	RP5-902P8.12	2.87	0.00457	0.052552	4	0.018312	no	ADRNLG
chr1_1281678_G_A_b38	RP5-902P8.12	-2.83	0.00515	-0.069453	3	0.024544	no	ADRNLG
chr1_1075715_A_G_b38	RP5-902P8.12	2.727	0.00698	0.050687	3	0.018587	no	ADRNLG
chr1_2069856_A_C_b38	RP5-902P8.12	-2.707	0.00739	-0.035062	39	0.012951	no	ADRNLG
chr1_1763636_G_A_b38	RP5-902P8.12	-2.684	0.00791	-0.038217	17	0.014239	no	ADRNLG
chr1_2070417_A_G_b38	RP5-902P8.12	-2.679	0.00803	-0.034903	40	0.01303	no	ADRNLG
chr1_261478_C_A_b38	RP5-902P8.12	3.685	0.000269	0.178812	3	0.04853	yes	ARTAORT
chr1_1684789_C_CAAAA_b38	RP5-902P8.12	3.48	0.000571	0.091119	6	0.026181	yes	ARTAORT
chr1_633375_G_A_b38	RP5-902P8.12	-3.128	0.00193	-0.052935	9	0.016926	yes	ARTAORT
chr1_633098_C_T_b38	RP5-902P8.12	-3.12	0.00198	-0.053096	9	0.01702	yes	ARTAORT
chr1_633032_T_C_b38	RP5-902P8.12	-3.112	0.00203	-0.053101	9	0.017061	yes	ARTAORT
chr1_633071_C_T_b38	RP5-902P8.12	-3.112	0.00203	-0.053101	9	0.017061	yes	ARTAORT
chr1_633251_C_T_b38	RP5-902P8.12	-3.065	0.00237	-0.052063	9	0.016988	yes	ARTAORT
chr1_633264_T_C_b38	RP5-902P8.12	-3.01	0.00283	-0.051083	9	0.016973	yes	ARTAORT
chr1_633290_T_C_b38	RP5-902P8.12	-3.01	0.00283	-0.051083	9	0.016973	yes	ARTAORT
chr1_633293_A_G_b38	RP5-902P8.12	-3.01	0.00283	-0.051083	9	0.016973	yes	ARTAORT
chr1_633209_T_C_b38	RP5-902P8.12	-2.937	0.00355	-0.049806	9	0.016955	yes	ARTAORT
chr1_633230_C_T_b38	RP5-902P8.12	-2.937	0.00355	-0.049806	9	0.016955	yes	ARTAORT
chr1_1572877_T_TG_b38	RP5-902P8.12	-2.84	0.00481	-0.047781	12	0.016825	yes	ARTAORT
chr1_633636_C_T_b38	RP5-902P8.12	-2.793	0.00555	-0.048995	9	0.017544	yes	ARTAORT
chr1_633443_C_T_b38	RP5-902P8.12	-2.753	0.00624	-0.048305	6	0.017544	yes	ARTAORT
chr1_633444_C_T_b38	RP5-902P8.12	-2.753	0.00624	-0.048305	6	0.017544	yes	ARTAORT
chr1_633329_A_G_b38	RP5-902P8.12	-2.733	0.00663	-0.047262	9	0.017295	yes	ARTAORT
chr1_1007746_CTTTTTTTTTTTTTTT_C_b38	RP5-902P8.12	2.698	0.00734	0.051355	11	0.019032	yes	ARTAORT
chr1_633182_A_G_b38	RP5-902P8.12	-2.644	0.00861	-0.045137	9	0.017074	yes	ARTAORT
chr1_261753_G_A_b38	RP5-902P8.12	2.636	0.0088	0.151846	4	0.057606	yes	ARTAORT
chr1_272389_C_T_b38	RP5-902P8.12	2.604	0.00964	0.0728	16	0.027954	yes	ARTAORT
chr1_1718311_A_T_b38	RP5-902P8.12	-2.592	0.00999	-0.042235	12	0.016295	yes	ARTAORT
chr1_633420_G_A_b38	RP5-902P8.12	-3.014	0.00278	-0.052725	6	0.017491	no	ARTAORT
chr1_514053_A_G_b38	RP5-902P8.12	2.857	0.00456	0.048058	11	0.016823	no	ARTAORT
chr1_1814797_C_CA_b38	RP5-902P8.12	-2.836	0.00487	-0.05687	12	0.020054	no	ARTAORT
chr1_2103523_C_T_b38	RP5-902P8.12	2.746	0.00638	0.103629	8	0.037739	no	ARTAORT
chr1_632781_C_T_b38	RP5-902P8.12	-2.728	0.00672	-0.048818	3	0.017893	no	ARTAORT
chr1_2189011_G_GA_b38	RP5-902P8.12	-2.728	0.00673	-0.035122	43	0.012875	no	ARTAORT
chr1_660440_G_C_b38	RP5-902P8.12	2.706	0.00717	0.070403	3	0.026013	no	ARTAORT
chr1_1897682_C_CA_b38	RP5-902P8.12	-2.638	0.00876	-0.051088	5	0.019368	no	ARTAORT
chr1_1979469_AAC_A_b38	RP5-902P8.12	-3.569	0.000464	-0.07775	9	0.021783	yes	ARTCRN
chr1_1889659_T_TA_b38	RP5-902P8.12	3.154	0.0019	0.068968	8	0.021866	yes	ARTCRN
chr1_1979465_A_G_b38	RP5-902P8.12	-3.027	0.00285	-0.065802	9	0.021739	yes	ARTCRN
chr1_1739131_T_C_b38	RP5-902P8.12	2.999	0.00311	0.049319	45	0.016443	yes	ARTCRN
chr1_1979456_T_C_b38	RP5-902P8.12	-2.97	0.0034	-0.064524	9	0.021725	yes	ARTCRN
chr1_928189_C_G_b38	RP5-902P8.12	-2.943	0.0037	-0.09547	3	0.032442	yes	ARTCRN
chr1_1731904_CA_C_b38	RP5-902P8.12	2.816	0.00544	0.054672	16	0.019418	yes	ARTCRN
chr1_1739519_C_G_b38	RP5-902P8.12	3.283	0.00124	0.065174	17	0.019853	no	ARTCRN
chr1_2042765_C_CAA_b38	RP5-902P8.12	2.781	0.00602	0.098856	4	0.035544	no	ARTCRN
chr1_1637577_T_C_b38	RP5-902P8.12	-2.757	0.00646	-0.052112	20	0.018902	no	ARTCRN
chr1_1649954_C_CA_b38	RP5-902P8.12	-2.716	0.00729	-0.057686	13	0.021241	no	ARTCRN
chr1_1708474_C_A_b38	RP5-902P8.12	-2.641	0.00902	-0.057569	8	0.021796	no	ARTCRN
chr1_1639348_G_T_b38	RP5-902P8.12	-2.617	0.00967	-0.049232	25	0.018815	no	ARTCRN
chr1_626449_A_G_b38	RP5-902P8.12	-2.608	0.00991	-0.098692	5	0.037841	no	ARTCRN
chr1_1960038_A_G_b38	RP5-902P8.12	-4.602	5.28e-06	-0.079227	7	0.017215	yes	ARTTBL
chr1_1187088_T_C_b38	RP5-902P8.12	3.622	0.000321	0.051483	26	0.014213	yes	ARTTBL
chr1_1190173_A_T_b38	RP5-902P8.12	3.611	0.000335	0.052016	24	0.014406	yes	ARTTBL
chr1_1186277_T_C_b38	RP5-902P8.12	3.506	0.000494	0.049531	27	0.014126	yes	ARTTBL
chr1_1193141_C_T_b38	RP5-902P8.12	3.483	0.000538	0.049905	25	0.014328	yes	ARTTBL
chr1_1186455_C_CTG_b38	RP5-902P8.12	3.428	0.000656	0.048082	28	0.014025	yes	ARTTBL
chr1_1191757_A_C_b38	RP5-902P8.12	3.356	0.00085	0.060595	6	0.018058	yes	ARTTBL
chr1_1194826_G_A_b38	RP5-902P8.12	3.281	0.0011	0.046717	26	0.014239	yes	ARTTBL
chr1_1727506_T_C_b38	RP5-902P8.12	3.23	0.00132	0.045991	50	0.014238	yes	ARTTBL
chr1_1187159_A_G_b38	RP5-902P8.12	3.23	0.00132	0.060213	4	0.018644	yes	ARTTBL
chr1_1189439_C_T_b38	RP5-902P8.12	3.23	0.00132	0.060213	4	0.018644	yes	ARTTBL
chr1_1189840_C_T_b38	RP5-902P8.12	3.23	0.00132	0.060213	4	0.018644	yes	ARTTBL
chr1_1191721_C_A_b38	RP5-902P8.12	3.23	0.00132	0.060213	4	0.018644	yes	ARTTBL
chr1_1192228_G_GT_b38	RP5-902P8.12	3.23	0.00132	0.060213	4	0.018644	yes	ARTTBL
chr1_1806932_C_T_b38	RP5-902P8.12	3.168	0.00162	0.059552	3	0.018796	yes	ARTTBL
chr1_1186335_C_T_b38	RP5-902P8.12	3.166	0.00164	0.058565	4	0.018496	yes	ARTTBL
chr1_1193742_G_C_b38	RP5-902P8.12	3.147	0.00175	0.058567	4	0.018612	yes	ARTTBL
chr1_1194409_G_C_b38	RP5-902P8.12	3.147	0.00175	0.058567	4	0.018612	yes	ARTTBL
chr1_1194540_G_A_b38	RP5-902P8.12	3.147	0.00175	0.058567	4	0.018612	yes	ARTTBL
chr1_1195347_A_C_b38	RP5-902P8.12	3.147	0.00175	0.058567	4	0.018612	yes	ARTTBL
chr1_1738597_C_A_b38	RP5-902P8.12	3.123	0.00189	0.041395	69	0.013254	yes	ARTTBL
chr1_1195672_C_T_b38	RP5-902P8.12	3.091	0.00211	0.058127	3	0.018807	yes	ARTTBL
chr1_1195475_T_C_b38	RP5-902P8.12	3.082	0.00216	0.057309	4	0.018592	yes	ARTTBL
chr1_1187536_A_G_b38	RP5-902P8.12	3.073	0.00223	0.057578	4	0.018736	yes	ARTTBL
chr1_1187557_G_A_b38	RP5-902P8.12	3.073	0.00223	0.057578	4	0.018736	yes	ARTTBL
chr1_1186903_T_G_b38	RP5-902P8.12	3.072	0.00224	0.056608	5	0.018427	yes	ARTTBL
chr1_1288269_T_C_b38	RP5-902P8.12	3.059	0.00234	0.097269	3	0.0318	yes	ARTTBL
chr1_1673968_GA_G_b38	RP5-902P8.12	-3.002	0.00281	-0.041032	52	0.013667	yes	ARTTBL
chr1_1651653_C_T_b38	RP5-902P8.12	-3.001	0.00282	-0.034602	135	0.01153	yes	ARTTBL
chr1_1648518_T_TGCACAC_b38	RP5-902P8.12	-2.96	0.00321	-0.085645	8	0.02893	yes	ARTTBL
chr1_1661562_G_C_b38	RP5-902P8.12	-2.957	0.00325	-0.031179	134	0.010545	yes	ARTTBL
chr1_632730_A_G_b38	RP5-902P8.12	2.927	0.00357	0.048779	7	0.016665	yes	ARTTBL
chr1_1186100_T_C_b38	RP5-902P8.12	2.907	0.00381	0.051623	7	0.017759	yes	ARTTBL
chr1_624767_T_G_b38	RP5-902P8.12	2.906	0.00381	0.047513	3	0.016348	yes	ARTTBL
chr1_633420_G_A_b38	RP5-902P8.12	2.851	0.00453	0.046465	10	0.016298	yes	ARTTBL
chr1_1667424_T_TAAAATA_b38	RP5-902P8.12	-2.789	0.00548	-0.033385	75	0.01197	yes	ARTTBL
chr1_1191950_C_T_b38	RP5-902P8.12	2.759	0.006	0.051197	4	0.018555	yes	ARTTBL
chr1_1661169_C_A_b38	RP5-902P8.12	-2.74	0.00635	-0.033658	52	0.012283	yes	ARTTBL
chr1_2212668_A_G_b38	RP5-902P8.12	2.722	0.00671	0.044667	12	0.016408	yes	ARTTBL
chr1_1667424_T_TAAATA_b38	RP5-902P8.12	2.696	0.00724	0.0308	98	0.011423	yes	ARTTBL
chr1_1648736_G_A_b38	RP5-902P8.12	-2.68	0.0076	-0.031183	124	0.011636	yes	ARTTBL
chr1_1502507_A_T_b38	RP5-902P8.12	-2.673	0.00776	-0.077628	5	0.029045	yes	ARTTBL
chr1_1379093_TG_T_b38	RP5-902P8.12	2.67	0.00783	0.049918	9	0.018697	yes	ARTTBL
chr1_633375_G_A_b38	RP5-902P8.12	2.654	0.0082	0.042409	16	0.01598	yes	ARTTBL
chr1_2143025_C_CT_b38	RP5-902P8.12	-2.651	0.00828	-0.041114	25	0.015511	yes	ARTTBL
chr1_633636_C_T_b38	RP5-902P8.12	2.607	0.00939	0.042548	16	0.016319	yes	ARTTBL
chr1_633588_T_C_b38	RP5-902P8.12	2.601	0.00957	0.041722	12	0.016042	yes	ARTTBL
chr1_633443_C_T_b38	RP5-902P8.12	2.595	0.00974	0.043069	9	0.016599	yes	ARTTBL
chr1_633444_C_T_b38	RP5-902P8.12	2.595	0.00974	0.043069	9	0.016599	yes	ARTTBL
chr1_633574_A_G_b38	RP5-902P8.12	2.587	0.00995	0.041414	12	0.016007	yes	ARTTBL
chr1_1079101_G_GGGGAGGCTGAGGCTATGGGGACTCCGTGCC_b38	RP5-902P8.12	3.871	0.000123	0.131411	6	0.033952	no	ARTTBL
chr1_632644_A_G_b38	RP5-902P8.12	3.222	0.00135	0.055955	5	0.017365	no	ARTTBL
chr1_1470425_C_CTTT_b38	RP5-902P8.12	3.136	0.00181	0.122135	4	0.038947	no	ARTTBL
chr1_1877316_A_AATAT_b38	RP5-902P8.12	3.113	0.00196	0.05793	11	0.018609	no	ARTTBL
chr1_1308548_G_GT_b38	RP5-902P8.12	2.938	0.00345	0.080957	9	0.027551	no	ARTTBL
chr1_1365036_T_TAA_b38	RP5-902P8.12	2.929	0.00355	0.05246	8	0.017912	no	ARTTBL
chr1_1185978_A_C_b38	RP5-902P8.12	2.917	0.00369	0.05283	7	0.01811	no	ARTTBL
chr1_1180931_A_G_b38	RP5-902P8.12	2.866	0.00433	0.035537	125	0.0124	no	ARTTBL
chr1_624752_C_T_b38	RP5-902P8.12	2.804	0.00524	0.045453	5	0.016211	no	ARTTBL
chr1_1182018_A_G_b38	RP5-902P8.12	2.795	0.00538	0.034899	123	0.012485	no	ARTTBL
chr1_1049115_C_G_b38	RP5-902P8.12	-2.776	0.00571	-0.05627	13	0.020271	no	ARTTBL
chr1_632781_C_T_b38	RP5-902P8.12	2.715	0.00686	0.044719	7	0.016473	no	ARTTBL
chr1_1851414_GA_G_b38	RP5-902P8.12	-2.707	0.00701	-0.036002	59	0.013298	no	ARTTBL
chr1_2106797_G_GACTCTTCAGCAGGCCCCTCTGGTGGGCGAGGACCTCCACACGTGTCACCAGGCCAGGTA_b38	RP5-902P8.12	-2.704	0.00708	-0.049062	21	0.018144	no	ARTTBL
chr1_681103_T_A_b38	RP5-902P8.12	2.691	0.00736	0.068127	3	0.025317	no	ARTTBL
chr1_1373006_G_A_b38	RP5-902P8.12	2.689	0.00739	0.047204	10	0.017552	no	ARTTBL
chr1_1994648_T_C_b38	RP5-902P8.12	-2.634	0.0087	-0.030472	149	0.01157	no	ARTTBL
chr1_633553_A_G_b38	RP5-902P8.12	2.633	0.00873	0.042704	10	0.016221	no	ARTTBL
chr1_937396_GCC_G_b38	RP5-902P8.12	4.316	3.66e-05	0.088415	23	0.020484	yes	BRNAMY
chr1_935954_G_T_b38	RP5-902P8.12	-3.755	0.000287	-0.076454	16	0.020361	yes	BRNAMY
chr1_938178_G_T_b38	RP5-902P8.12	-3.128	0.00229	-0.070158	14	0.022428	yes	BRNAMY
chr1_933741_T_TG_b38	RP5-902P8.12	-3.057	0.00285	-0.065545	11	0.021439	yes	BRNAMY
chr1_2120839_CT_C_b38	RP5-902P8.12	3.011	0.00328	0.071746	10	0.023829	yes	BRNAMY
chr1_936972_G_C_b38	RP5-902P8.12	2.911	0.00442	0.064452	11	0.022144	yes	BRNAMY
chr1_2035575_G_A_b38	RP5-902P8.12	-2.788	0.00632	-0.057947	13	0.020785	yes	BRNAMY
chr1_2036515_C_T_b38	RP5-902P8.12	-2.749	0.00705	-0.056498	14	0.020549	yes	BRNAMY
chr1_2037520_G_A_b38	RP5-902P8.12	-2.71	0.00788	-0.055506	14	0.020482	yes	BRNAMY
chr1_911484_G_C_b38	RP5-902P8.12	2.694	0.00825	0.069339	5	0.02574	yes	BRNAMY
chr1_933548_A_AG_b38	RP5-902P8.12	-2.675	0.0087	-0.060303	16	0.022547	yes	BRNAMY
chr1_941767_G_A_b38	RP5-902P8.12	2.65	0.00931	0.062966	7	0.023756	yes	BRNAMY
chr1_749482_G_A_b38	RP5-902P8.12	2.639	0.0096	0.107801	6	0.040846	yes	BRNAMY
chr1_2025860_C_T_b38	RP5-902P8.12	-2.963	0.00378	-0.057504	28	0.019408	no	BRNAMY
chr1_1734308_T_C_b38	RP5-902P8.12	2.796	0.00617	0.106417	3	0.038054	no	BRNAMY
chr1_1732580_T_C_b38	RP5-902P8.12	2.773	0.0066	0.117951	3	0.042539	no	BRNAMY
chr1_2065678_C_CA_b38	RP5-902P8.12	-2.653	0.00925	-0.08131	4	0.030651	no	BRNAMY
chr1_935265_T_C_b38	RP5-902P8.12	2.648	0.00936	0.059204	12	0.022356	no	BRNAMY
chr1_1308178_GGGGCGCGGGGA_G_b38	RP5-902P8.12	3.916	0.000149	0.072975	5	0.018635	yes	BRNACC
chr1_1215852_T_C_b38	RP5-902P8.12	3.216	0.00167	0.060689	6	0.018873	yes	BRNACC
chr1_866664_G_A_b38	RP5-902P8.12	3.211	0.00169	0.08952	3	0.027876	yes	BRNACC
chr1_1231507_T_C_b38	RP5-902P8.12	3.091	0.00248	0.060086	4	0.019442	yes	BRNACC
chr1_1231710_CCCCCGGGAA_C_b38	RP5-902P8.12	3.036	0.00294	0.060773	4	0.020018	yes	BRNACC
chr1_1216593_G_C_b38	RP5-902P8.12	3.034	0.00295	0.057489	6	0.018945	yes	BRNACC
chr1_1791172_A_AT_b38	RP5-902P8.12	2.948	0.00384	0.062312	5	0.021139	yes	BRNACC
chr1_1226486_C_T_b38	RP5-902P8.12	2.881	0.00468	0.057352	4	0.019904	yes	BRNACC
chr1_1235602_C_A_b38	RP5-902P8.12	2.873	0.00481	0.057355	4	0.019967	yes	BRNACC
chr1_1217733_G_A_b38	RP5-902P8.12	2.785	0.00622	0.054102	5	0.019427	yes	BRNACC
chr1_1235997_A_G_b38	RP5-902P8.12	2.754	0.0068	0.059679	3	0.021673	yes	BRNACC
chr1_1236303_A_G_b38	RP5-902P8.12	2.713	0.00765	0.05327	5	0.019637	yes	BRNACC
chr1_2235045_A_AT_b38	RP5-902P8.12	2.629	0.00967	0.043663	14	0.016606	yes	BRNACC
chr1_1398056_C_A_b38	RP5-902P8.12	2.835	0.00537	0.045239	15	0.015956	no	BRNACC
chr1_988731_T_A_b38	RP5-902P8.12	2.667	0.0087	0.048492	9	0.018181	no	BRNACC
chr1_1292284_TTGAG_T_b38	RP5-902P8.12	2.665	0.00875	0.059102	6	0.022178	no	BRNACC
chr1_1235602_C_A_b38	RP5-902P8.12	5.541	1.29e-07	0.098334	4	0.017748	yes	BRNCDT
chr1_1217733_G_A_b38	RP5-902P8.12	5.445	2.02e-07	0.095627	5	0.017561	yes	BRNCDT
chr1_1225476_T_C_b38	RP5-902P8.12	5.343	3.25e-07	0.104087	3	0.01948	yes	BRNCDT
chr1_1226013_C_T_b38	RP5-902P8.12	5.343	3.25e-07	0.104087	3	0.01948	yes	BRNCDT
chr1_1231507_T_C_b38	RP5-902P8.12	5.295	4.07e-07	0.089442	5	0.016893	yes	BRNCDT
chr1_1223568_A_G_b38	RP5-902P8.12	5.269	4.59e-07	0.102518	3	0.019458	yes	BRNCDT
chr1_1228424_C_T_b38	RP5-902P8.12	5.22	5.75e-07	0.087255	5	0.016716	yes	BRNCDT
chr1_1226486_C_T_b38	RP5-902P8.12	5.176	7.02e-07	0.093224	4	0.018011	yes	BRNCDT
chr1_1231710_CCCCCGGGAA_C_b38	RP5-902P8.12	5.126	8.83e-07	0.090525	5	0.017661	yes	BRNCDT
chr1_1235997_A_G_b38	RP5-902P8.12	5.018	1.43e-06	0.096417	4	0.019214	yes	BRNCDT
chr1_1236303_A_G_b38	RP5-902P8.12	5.001	1.55e-06	0.087185	5	0.017434	yes	BRNCDT
chr1_1240367_A_G_b38	RP5-902P8.12	4.937	2.05e-06	0.095412	3	0.019325	yes	BRNCDT
chr1_1239126_C_CT_b38	RP5-902P8.12	4.92	2.21e-06	0.094875	3	0.019282	yes	BRNCDT
chr1_1239127_A_ACATGCATCC_b38	RP5-902P8.12	4.92	2.21e-06	0.094875	3	0.019282	yes	BRNCDT
chr1_1239574_T_C_b38	RP5-902P8.12	4.92	2.21e-06	0.094875	3	0.019282	yes	BRNCDT
chr1_1219941_C_T_b38	RP5-902P8.12	4.865	2.82e-06	0.100969	3	0.020755	yes	BRNCDT
chr1_1235642_G_C_b38	RP5-902P8.12	4.832	3.25e-06	0.091268	3	0.018887	yes	BRNCDT
chr1_1229369_G_GC_b38	RP5-902P8.12	4.752	4.61e-06	0.077851	8	0.016383	yes	BRNCDT
chr1_1216593_G_C_b38	RP5-902P8.12	4.312	2.88e-05	0.074561	6	0.01729	yes	BRNCDT
chr1_1221049_C_G_b38	RP5-902P8.12	4.261	3.54e-05	0.064129	22	0.015049	yes	BRNCDT
chr1_1215852_T_C_b38	RP5-902P8.12	4.114	6.33e-05	0.070685	7	0.017181	yes	BRNCDT
chr1_1308178_GGGGCGCGGGGA_G_b38	RP5-902P8.12	4.049	8.16e-05	0.067979	8	0.01679	yes	BRNCDT
chr1_1202905_C_G_b38	RP5-902P8.12	4.034	8.64e-05	0.084393	3	0.020922	yes	BRNCDT
chr1_1230159_G_A_b38	RP5-902P8.12	3.943	0.000122	0.061588	13	0.015621	yes	BRNCDT
chr1_871922_A_ATT_b38	RP5-902P8.12	-3.659	0.000348	-0.063863	5	0.017453	yes	BRNCDT
chr1_1238902_T_C_b38	RP5-902P8.12	3.642	0.00037	0.052385	27	0.014385	yes	BRNCDT
chr1_1219858_G_A_b38	RP5-902P8.12	3.489	0.000633	0.060778	8	0.01742	yes	BRNCDT
chr1_1258206_AT_A_b38	RP5-902P8.12	3.403	0.000852	0.052045	24	0.015295	yes	BRNCDT
chr1_1259424_T_C_b38	RP5-902P8.12	3.399	0.000863	0.053808	25	0.015831	yes	BRNCDT
chr1_822260_G_A_b38	RP5-902P8.12	3.243	0.00145	0.062478	9	0.019263	yes	BRNCDT
chr1_1191757_A_C_b38	RP5-902P8.12	3.109	0.00224	0.064617	3	0.020785	yes	BRNCDT
chr1_1188054_T_A_b38	RP5-902P8.12	3.109	0.00224	0.052903	9	0.017018	yes	BRNCDT
chr1_906982_C_T_b38	RP5-902P8.12	2.974	0.00342	0.049759	6	0.016732	yes	BRNCDT
chr1_1217251_C_A_b38	RP5-902P8.12	2.969	0.00346	0.056693	5	0.019092	yes	BRNCDT
chr1_1379091_T_G_b38	RP5-902P8.12	-2.963	0.00353	-0.049499	7	0.016704	yes	BRNCDT
chr1_873548_C_T_b38	RP5-902P8.12	2.939	0.00381	0.049273	20	0.016767	yes	BRNCDT
chr1_898818_T_C_b38	RP5-902P8.12	2.901	0.00427	0.052069	4	0.017947	yes	BRNCDT
chr1_906633_T_G_b38	RP5-902P8.12	2.828	0.0053	0.05061	4	0.017893	yes	BRNCDT
chr1_2206830_C_CAA_b38	RP5-902P8.12	2.808	0.00564	0.064017	6	0.022798	yes	BRNCDT
chr1_1657926_A_G_b38	RP5-902P8.12	-2.761	0.00647	-0.048339	3	0.017509	yes	BRNCDT
chr1_839515_CTAGACACACACACCTGGACACACACACG_C_b38	RP5-902P8.12	2.747	0.00674	0.04525	18	0.016475	yes	BRNCDT
chr1_818802_A_G_b38	RP5-902P8.12	2.74	0.00687	0.054194	9	0.019778	yes	BRNCDT
chr1_818812_A_G_b38	RP5-902P8.12	2.74	0.00687	0.054194	9	0.019778	yes	BRNCDT
chr1_818954_T_C_b38	RP5-902P8.12	2.74	0.00687	0.054194	9	0.019778	yes	BRNCDT
chr1_902949_G_GC_b38	RP5-902P8.12	2.729	0.00709	0.049535	4	0.018151	yes	BRNCDT
chr1_1157285_CCCCGCCCCCAGCCCACCCAT_C_b38	RP5-902P8.12	-2.724	0.00721	-0.033993	21	0.012481	yes	BRNCDT
chr1_903007_T_C_b38	RP5-902P8.12	2.723	0.00721	0.049231	4	0.018076	yes	BRNCDT
chr1_1375642_C_T_b38	RP5-902P8.12	2.712	0.00745	0.04889	6	0.018026	yes	BRNCDT
chr1_852305_G_T_b38	RP5-902P8.12	2.703	0.00765	0.05355	11	0.01981	yes	BRNCDT
chr1_852464_C_T_b38	RP5-902P8.12	2.701	0.0077	0.05468	7	0.020246	yes	BRNCDT
chr1_1201373_T_C_b38	RP5-902P8.12	2.685	0.00805	0.044333	16	0.016511	yes	BRNCDT
chr1_873251_G_A_b38	RP5-902P8.12	2.673	0.00833	0.045	20	0.016834	yes	BRNCDT
chr1_853333_T_C_b38	RP5-902P8.12	2.666	0.00849	0.05253	12	0.0197	yes	BRNCDT
chr1_455038_T_C_b38	RP5-902P8.12	-2.631	0.0094	-0.05309	7	0.020182	yes	BRNCDT
chr1_900119_A_G_b38	RP5-902P8.12	2.614	0.00985	0.043316	7	0.016572	yes	BRNCDT
chr1_1380867_A_G_b38	RP5-902P8.12	2.611	0.00993	0.047177	6	0.018069	yes	BRNCDT
chr1_1238231_G_A_b38	RP5-902P8.12	4.474	1.49e-05	0.073243	10	0.01637	no	BRNCDT
chr1_1243650_G_A_b38	RP5-902P8.12	4.231	3.99e-05	0.083628	3	0.019764	no	BRNCDT
chr1_1248686_A_G_b38	RP5-902P8.12	4.006	9.62e-05	0.088513	3	0.022096	no	BRNCDT
chr1_1241217_T_C_b38	RP5-902P8.12	3.799	0.000209	0.077737	3	0.020464	no	BRNCDT
chr1_1244603_G_A_b38	RP5-902P8.12	3.76	0.000241	0.07556	3	0.020096	no	BRNCDT
chr1_1243102_A_G_b38	RP5-902P8.12	3.535	0.000539	0.071074	4	0.020103	no	BRNCDT
chr1_1242865_C_T_b38	RP5-902P8.12	3.522	0.000564	0.070564	4	0.020033	no	BRNCDT
chr1_1248709_A_G_b38	RP5-902P8.12	3.469	0.00068	0.07416	3	0.021381	no	BRNCDT
chr1_1242094_A_G_b38	RP5-902P8.12	3.455	0.000712	0.069866	3	0.020222	no	BRNCDT
chr1_1242250_A_G_b38	RP5-902P8.12	3.455	0.000712	0.069866	3	0.020222	no	BRNCDT
chr1_1251618_G_A_b38	RP5-902P8.12	3.374	0.000938	0.066462	4	0.019697	no	BRNCDT
chr1_1241053_A_G_b38	RP5-902P8.12	3.37	0.000952	0.067665	3	0.020079	no	BRNCDT
chr1_1248597_A_C_b38	RP5-902P8.12	3.329	0.00109	0.061019	6	0.018329	no	BRNCDT
chr1_1246371_T_C_b38	RP5-902P8.12	3.316	0.00114	0.0637	7	0.019207	no	BRNCDT
chr1_1251285_G_A_b38	RP5-902P8.12	3.299	0.00121	0.063747	5	0.019324	no	BRNCDT
chr1_1251368_T_C_b38	RP5-902P8.12	3.299	0.00121	0.063747	5	0.019324	no	BRNCDT
chr1_1157295_AGCCCACCCATCCCGCCCCCAGCCCACCCATCCCATCCCC_A_b38	RP5-902P8.12	3.24	0.00147	0.036126	30	0.011151	no	BRNCDT
chr1_1249880_A_G_b38	RP5-902P8.12	3.157	0.00192	0.055632	10	0.017625	no	BRNCDT
chr1_1280044_T_C_b38	RP5-902P8.12	3.099	0.00231	0.047893	27	0.015453	no	BRNCDT
chr1_1251122_A_T_b38	RP5-902P8.12	3.062	0.0026	0.054081	10	0.017661	no	BRNCDT
chr1_851882_C_G_b38	RP5-902P8.12	2.891	0.0044	0.056015	5	0.019374	no	BRNCDT
chr1_1572877_T_TG_b38	RP5-902P8.12	-2.878	0.00457	-0.047812	10	0.016611	no	BRNCDT
chr1_818464_CCT_C_b38	RP5-902P8.12	2.85	0.00498	0.04755	13	0.016684	no	BRNCDT
chr1_1248905_G_C_b38	RP5-902P8.12	2.843	0.00509	0.072383	3	0.025464	no	BRNCDT
chr1_1182106_A_G_b38	RP5-902P8.12	2.716	0.00737	0.050993	4	0.018776	no	BRNCDT
chr1_1288085_GC_G_b38	RP5-902P8.12	2.713	0.00743	0.051816	3	0.019097	no	BRNCDT
chr1_818469_G_T_b38	RP5-902P8.12	2.693	0.00788	0.045661	12	0.016958	no	BRNCDT
chr1_821224_A_G_b38	RP5-902P8.12	2.654	0.00879	0.051962	5	0.019578	no	BRNCDT
chr1_791545_G_T_b38	RP5-902P8.12	-2.645	0.00902	-0.083116	3	0.031421	no	BRNCDT
chr1_924533_A_G_b38	RP5-902P8.12	-4.004	0.000103	-0.234486	3	0.058561	yes	BRNCHB
chr1_925398_A_G_b38	RP5-902P8.12	-3.776	0.000238	-0.234593	3	0.062121	yes	BRNCHB
chr1_925408_TTGG_T_b38	RP5-902P8.12	-3.776	0.000238	-0.234593	3	0.062121	yes	BRNCHB
chr1_925412_CGCCTGCG_C_b38	RP5-902P8.12	-3.776	0.000238	-0.234593	3	0.062121	yes	BRNCHB
chr1_921797_T_C_b38	RP5-902P8.12	3.494	0.000645	0.195493	4	0.055949	yes	BRNCHB
chr1_924321_C_G_b38	RP5-902P8.12	-3.485	0.000666	-0.222318	4	0.0638	yes	BRNCHB
chr1_924310_C_G_b38	RP5-902P8.12	-3.457	0.000733	-0.220708	4	0.063851	yes	BRNCHB
chr1_928483_G_A_b38	RP5-902P8.12	3.36	0.00102	0.196307	4	0.058433	yes	BRNCHB
chr1_924024_C_G_b38	RP5-902P8.12	-3.299	0.00124	-0.188672	5	0.057185	yes	BRNCHB
chr1_925081_G_A_b38	RP5-902P8.12	-3.273	0.00135	-0.179488	5	0.05484	yes	BRNCHB
chr1_925141_C_A_b38	RP5-902P8.12	-3.273	0.00135	-0.179488	5	0.05484	yes	BRNCHB
chr1_925628_G_C_b38	RP5-902P8.12	-3.273	0.00135	-0.179488	5	0.05484	yes	BRNCHB
chr1_926428_A_G_b38	RP5-902P8.12	-3.273	0.00135	-0.179488	5	0.05484	yes	BRNCHB
chr1_926713_T_C_b38	RP5-902P8.12	-3.273	0.00135	-0.179488	5	0.05484	yes	BRNCHB
chr1_926744_A_G_b38	RP5-902P8.12	-3.273	0.00135	-0.179488	5	0.05484	yes	BRNCHB
chr1_927003_C_T_b38	RP5-902P8.12	-3.273	0.00135	-0.179488	5	0.05484	yes	BRNCHB
chr1_927744_G_T_b38	RP5-902P8.12	-3.273	0.00135	-0.179488	5	0.05484	yes	BRNCHB
chr1_938014_A_G_b38	RP5-902P8.12	3.168	0.0019	0.196443	5	0.061999	yes	BRNCHB
chr1_928463_C_T_b38	RP5-902P8.12	3.087	0.00245	0.18337	3	0.059393	yes	BRNCHB
chr1_1041776_CCGGCCAGTGCCAGGGTCGAGGTGGGCGGCTCCCCCGGGGGAGGGCTG_C_b38	RP5-902P8.12	2.998	0.00324	0.06058	15	0.020206	yes	BRNCHB
chr1_927009_A_G_b38	RP5-902P8.12	-2.917	0.00415	-0.135904	5	0.046597	yes	BRNCHB
chr1_1641819_C_T_b38	RP5-902P8.12	2.887	0.00454	0.092039	8	0.031883	yes	BRNCHB
chr1_1650664_CT_C_b38	RP5-902P8.12	-2.834	0.00531	-0.085377	12	0.03013	yes	BRNCHB
chr1_1649954_C_CA_b38	RP5-902P8.12	2.745	0.00687	0.10058	4	0.036637	yes	BRNCHB
chr1_1086315_A_G_b38	RP5-902P8.12	2.697	0.0079	0.073559	11	0.027277	yes	BRNCHB
chr1_1124794_C_T_b38	RP5-902P8.12	-2.638	0.00932	-0.071567	12	0.027128	yes	BRNCHB
chr1_815963_T_A_b38	RP5-902P8.12	-2.638	0.00932	-0.094373	4	0.035773	yes	BRNCHB
chr1_852305_G_T_b38	RP5-902P8.12	2.62	0.0098	0.093919	8	0.035844	yes	BRNCHB
chr1_933601_C_T_b38	RP5-902P8.12	-3.718	0.000295	-0.181136	8	0.048725	no	BRNCHB
chr1_1664300_T_C_b38	RP5-902P8.12	3.218	0.00162	0.101011	6	0.031385	no	BRNCHB
chr1_1605794_G_C_b38	RP5-902P8.12	2.745	0.00689	0.125069	3	0.04557	no	BRNCHB
chr1_1661562_G_C_b38	RP5-902P8.12	-3.772	0.000224	-0.060637	41	0.016074	yes	BRNCHA
chr1_1991778_A_G_b38	RP5-902P8.12	-3.665	0.000331	-0.069691	15	0.019013	yes	BRNCHA
chr1_1671797_G_A_b38	RP5-902P8.12	-3.079	0.00243	-0.049495	52	0.016078	yes	BRNCHA
chr1_1650000_G_A_b38	RP5-902P8.12	-3.025	0.00287	-0.055467	21	0.018334	yes	BRNCHA
chr1_1991213_T_C_b38	RP5-902P8.12	2.98	0.00331	0.051601	38	0.017317	yes	BRNCHA
chr1_903551_A_C_b38	RP5-902P8.12	-2.916	0.00403	-0.067369	6	0.023102	yes	BRNCHA
chr1_1147418_G_A_b38	RP5-902P8.12	2.878	0.00452	0.064453	4	0.022395	yes	BRNCHA
chr1_1649976_G_A_b38	RP5-902P8.12	-2.846	0.00497	-0.052236	31	0.018352	yes	BRNCHA
chr1_1991835_C_T_b38	RP5-902P8.12	2.825	0.0053	0.048395	34	0.017131	yes	BRNCHA
chr1_1991761_T_C_b38	RP5-902P8.12	2.816	0.00545	0.051911	31	0.018435	yes	BRNCHA
chr1_1968893_A_G_b38	RP5-902P8.12	2.694	0.00778	0.057809	10	0.02146	yes	BRNCHA
chr1_1147410_C_A_b38	RP5-902P8.12	2.628	0.00939	0.061486	3	0.023398	yes	BRNCHA
chr1_1654662_CT_C_b38	RP5-902P8.12	-2.626	0.00944	-0.053615	29	0.020418	yes	BRNCHA
chr1_1991690_A_G_b38	RP5-902P8.12	2.614	0.00977	0.048182	37	0.018434	yes	BRNCHA
chr1_611317_A_G_b38	RP5-902P8.12	2.897	0.00427	0.070139	9	0.024211	no	BRNCHA
chr1_1130186_CAAAAAA_C_b38	RP5-902P8.12	2.878	0.00452	0.096628	5	0.033571	no	BRNCHA
chr1_2067906_T_C_b38	RP5-902P8.12	-2.686	0.00796	-0.072176	3	0.026874	no	BRNCHA
chr1_2074366_C_G_b38	RP5-902P8.12	-2.668	0.00838	-0.078905	3	0.029574	no	BRNCHA
chr1_1668373_C_T_b38	RP5-902P8.12	-2.654	0.00872	-0.052097	25	0.019631	no	BRNCHA
chr1_1042813_G_A_b38	RP5-902P8.12	2.619	0.00962	0.060897	5	0.023251	no	BRNCHA
chr1_1226486_C_T_b38	RP5-902P8.12	4.829	3.12e-06	0.09834	3	0.020363	yes	BRNCTXA
chr1_1236303_A_G_b38	RP5-902P8.12	4.816	3.31e-06	0.095636	4	0.019858	yes	BRNCTXA
chr1_1231710_CCCCCGGGAA_C_b38	RP5-902P8.12	4.726	4.9e-06	0.094059	4	0.019903	yes	BRNCTXA
chr1_1184277_G_C_b38	RP5-902P8.12	4.721	5e-06	0.072274	36	0.015308	yes	BRNCTXA
chr1_1230159_G_A_b38	RP5-902P8.12	4.716	5.12e-06	0.0802	13	0.017007	yes	BRNCTXA
chr1_1221049_C_G_b38	RP5-902P8.12	4.7	5.48e-06	0.075309	22	0.016023	yes	BRNCTXA
chr1_1217733_G_A_b38	RP5-902P8.12	4.432	1.7e-05	0.090004	4	0.020309	yes	BRNCTXA
chr1_1235602_C_A_b38	RP5-902P8.12	4.407	1.89e-05	0.091612	3	0.020787	yes	BRNCTXA
chr1_1186455_C_CTG_b38	RP5-902P8.12	4.315	2.75e-05	0.079359	6	0.018393	yes	BRNCTXA
chr1_1236037_C_T_b38	RP5-902P8.12	4.203	4.32e-05	0.062849	33	0.014954	yes	BRNCTXA
chr1_1196039_C_G_b38	RP5-902P8.12	4.092	6.69e-05	0.083895	5	0.020502	yes	BRNCTXA
chr1_1186277_T_C_b38	RP5-902P8.12	4.063	7.5e-05	0.075213	6	0.018513	yes	BRNCTXA
chr1_1187088_T_C_b38	RP5-902P8.12	4.062	7.52e-05	0.075237	6	0.018521	yes	BRNCTXA
chr1_1190173_A_T_b38	RP5-902P8.12	4.04	8.2e-05	0.074526	6	0.018448	yes	BRNCTXA
chr1_1193141_C_T_b38	RP5-902P8.12	4.04	8.2e-05	0.074526	6	0.018448	yes	BRNCTXA
chr1_1205055_G_T_b38	RP5-902P8.12	4.028	8.57e-05	0.063045	27	0.01565	yes	BRNCTXA
chr1_1193398_C_CTTA_b38	RP5-902P8.12	3.968	0.000108	0.0634	25	0.015979	yes	BRNCTXA
chr1_1238231_G_A_b38	RP5-902P8.12	3.945	0.000118	0.069668	10	0.017661	yes	BRNCTXA
chr1_1229369_G_GC_b38	RP5-902P8.12	3.929	0.000125	0.071683	8	0.018245	yes	BRNCTXA
chr1_1194826_G_A_b38	RP5-902P8.12	3.88	0.000151	0.070272	7	0.018113	yes	BRNCTXA
chr1_1238902_T_C_b38	RP5-902P8.12	3.829	0.000183	0.059994	27	0.015669	yes	BRNCTXA
chr1_1187535_A_G_b38	RP5-902P8.12	3.803	0.000201	0.063232	21	0.016627	yes	BRNCTXA
chr1_1308178_GGGGCGCGGGGA_G_b38	RP5-902P8.12	3.791	0.00021	0.073491	6	0.019384	yes	BRNCTXA
chr1_1259424_T_C_b38	RP5-902P8.12	3.76	0.000236	0.065334	23	0.017378	yes	BRNCTXA
chr1_1195463_A_G_b38	RP5-902P8.12	3.735	0.000259	0.061646	20	0.016506	yes	BRNCTXA
chr1_1189283_G_A_b38	RP5-902P8.12	3.701	0.000293	0.061865	20	0.016715	yes	BRNCTXA
chr1_1216593_G_C_b38	RP5-902P8.12	3.677	0.000319	0.069637	6	0.018936	yes	BRNCTXA
chr1_1219858_G_A_b38	RP5-902P8.12	3.628	0.000382	0.070566	7	0.019452	yes	BRNCTXA
chr1_1173872_A_G_b38	RP5-902P8.12	3.589	0.000438	0.058867	17	0.016403	yes	BRNCTXA
chr1_1197697_A_G_b38	RP5-902P8.12	3.541	0.000519	0.059156	18	0.016705	yes	BRNCTXA
chr1_1197893_T_C_b38	RP5-902P8.12	3.54	0.000521	0.059148	16	0.016709	yes	BRNCTXA
chr1_1198407_T_C_b38	RP5-902P8.12	3.54	0.000521	0.059148	16	0.016709	yes	BRNCTXA
chr1_1198435_T_C_b38	RP5-902P8.12	3.54	0.000521	0.059148	16	0.016709	yes	BRNCTXA
chr1_1182018_A_G_b38	RP5-902P8.12	3.51	0.000578	0.057585	32	0.016405	yes	BRNCTXA
chr1_1431014_G_A_b38	RP5-902P8.12	3.507	0.000584	0.058337	18	0.016634	yes	BRNCTXA
chr1_1436079_A_G_b38	RP5-902P8.12	3.479	0.000645	0.055226	31	0.015874	yes	BRNCTXA
chr1_1199862_A_C_b38	RP5-902P8.12	3.444	0.000729	0.056757	19	0.016482	yes	BRNCTXA
chr1_1196201_T_C_b38	RP5-902P8.12	3.434	0.000752	0.057385	17	0.016709	yes	BRNCTXA
chr1_1258206_AT_A_b38	RP5-902P8.12	3.427	0.000771	0.058327	21	0.01702	yes	BRNCTXA
chr1_1215852_T_C_b38	RP5-902P8.12	3.38	0.000905	0.063451	7	0.01877	yes	BRNCTXA
chr1_1482316_C_G_b38	RP5-902P8.12	3.32	0.00111	0.055225	17	0.016634	yes	BRNCTXA
chr1_1433374_T_C_b38	RP5-902P8.12	3.278	0.00128	0.052568	33	0.016036	yes	BRNCTXA
chr1_1174402_G_A_b38	RP5-902P8.12	3.263	0.00134	0.066689	4	0.020438	yes	BRNCTXA
chr1_1217251_C_A_b38	RP5-902P8.12	3.239	0.00145	0.067521	5	0.020844	yes	BRNCTXA
chr1_1426261_C_T_b38	RP5-902P8.12	3.217	0.00156	0.054438	27	0.016922	yes	BRNCTXA
chr1_1426810_C_G_b38	RP5-902P8.12	3.217	0.00156	0.054438	27	0.016922	yes	BRNCTXA
chr1_1201373_T_C_b38	RP5-902P8.12	3.216	0.00157	0.059626	13	0.018541	yes	BRNCTXA
chr1_1430908_A_G_b38	RP5-902P8.12	3.211	0.00159	0.054827	28	0.017073	yes	BRNCTXA
chr1_1172897_G_A_b38	RP5-902P8.12	3.206	0.00162	0.066208	4	0.020651	yes	BRNCTXA
chr1_1094425_A_G_b38	RP5-902P8.12	3.177	0.00178	0.061984	11	0.01951	yes	BRNCTXA
chr1_1098290_T_C_b38	RP5-902P8.12	3.177	0.00178	0.061984	11	0.01951	yes	BRNCTXA
chr1_1453703_A_G_b38	RP5-902P8.12	3.171	0.00181	0.057603	24	0.018164	yes	BRNCTXA
chr1_1174096_C_A_b38	RP5-902P8.12	3.147	0.00196	0.064798	4	0.020594	yes	BRNCTXA
chr1_1280044_T_C_b38	RP5-902P8.12	3.111	0.0022	0.052798	25	0.016974	yes	BRNCTXA
chr1_1452511_A_G_b38	RP5-902P8.12	3.109	0.00222	0.056182	24	0.018073	yes	BRNCTXA
chr1_1452888_C_A_b38	RP5-902P8.12	3.109	0.00222	0.056182	24	0.018073	yes	BRNCTXA
chr1_1452909_A_C_b38	RP5-902P8.12	3.109	0.00222	0.056182	24	0.018073	yes	BRNCTXA
chr1_1454092_A_G_b38	RP5-902P8.12	3.109	0.00222	0.056182	24	0.018073	yes	BRNCTXA
chr1_1428969_T_C_b38	RP5-902P8.12	3.079	0.00243	0.052282	28	0.016978	yes	BRNCTXA
chr1_1096593_C_T_b38	RP5-902P8.12	3.079	0.00243	0.060738	10	0.019725	yes	BRNCTXA
chr1_1097574_A_G_b38	RP5-902P8.12	3.079	0.00243	0.060738	10	0.019725	yes	BRNCTXA
chr1_1098216_T_C_b38	RP5-902P8.12	3.079	0.00243	0.060738	10	0.019725	yes	BRNCTXA
chr1_1098300_T_A_b38	RP5-902P8.12	3.079	0.00243	0.060738	10	0.019725	yes	BRNCTXA
chr1_1098614_C_T_b38	RP5-902P8.12	3.079	0.00243	0.060738	10	0.019725	yes	BRNCTXA
chr1_1098820_T_C_b38	RP5-902P8.12	3.079	0.00243	0.060738	10	0.019725	yes	BRNCTXA
chr1_1431450_A_G_b38	RP5-902P8.12	3.076	0.00246	0.052259	28	0.016988	yes	BRNCTXA
chr1_1431537_G_C_b38	RP5-902P8.12	3.076	0.00246	0.052259	28	0.016988	yes	BRNCTXA
chr1_1189370_T_C_b38	RP5-902P8.12	3.073	0.00248	0.074303	3	0.02418	yes	BRNCTXA
chr1_1455617_T_G_b38	RP5-902P8.12	3.026	0.00288	0.05483	25	0.018122	yes	BRNCTXA
chr1_1188054_T_A_b38	RP5-902P8.12	3.005	0.00308	0.057053	9	0.018988	yes	BRNCTXA
chr1_1454770_T_C_b38	RP5-902P8.12	3.002	0.0031	0.053914	25	0.017961	yes	BRNCTXA
chr1_1095185_C_T_b38	RP5-902P8.12	3.001	0.00311	0.059222	10	0.019735	yes	BRNCTXA
chr1_1095253_G_A_b38	RP5-902P8.12	3.001	0.00311	0.059222	10	0.019735	yes	BRNCTXA
chr1_1430190_A_C_b38	RP5-902P8.12	2.984	0.00328	0.050664	28	0.016977	yes	BRNCTXA
chr1_1379083_AT_A_b38	RP5-902P8.12	-2.958	0.00355	-0.051209	14	0.01731	yes	BRNCTXA
chr1_808924_C_T_b38	RP5-902P8.12	-2.944	0.00371	-0.063748	3	0.02165	yes	BRNCTXA
chr1_1454315_C_T_b38	RP5-902P8.12	2.923	0.00396	0.052388	22	0.017925	yes	BRNCTXA
chr1_2094922_G_A_b38	RP5-902P8.12	2.92	0.004	0.067044	3	0.022963	yes	BRNCTXA
chr1_1330125_G_A_b38	RP5-902P8.12	-2.888	0.0044	-0.050405	25	0.017451	yes	BRNCTXA
chr1_1050080_T_C_b38	RP5-902P8.12	2.887	0.00442	0.085016	6	0.029449	yes	BRNCTXA
chr1_1223251_A_G_b38	RP5-902P8.12	2.879	0.00452	0.064648	4	0.022451	yes	BRNCTXA
chr1_271413_C_T_b38	RP5-902P8.12	2.864	0.00473	0.068998	4	0.024089	yes	BRNCTXA
chr1_1497605_G_C_b38	RP5-902P8.12	2.856	0.00485	0.049833	25	0.017449	yes	BRNCTXA
chr1_1456182_G_A_b38	RP5-902P8.12	2.85	0.00493	0.05082	17	0.017829	yes	BRNCTXA
chr1_1340697_G_A_b38	RP5-902P8.12	-2.842	0.00505	-0.047642	13	0.016763	yes	BRNCTXA
chr1_1251122_A_T_b38	RP5-902P8.12	2.83	0.00524	0.052882	10	0.018689	yes	BRNCTXA
chr1_1173774_G_A_b38	RP5-902P8.12	2.827	0.00528	0.057452	5	0.020323	yes	BRNCTXA
chr1_1378204_G_C_b38	RP5-902P8.12	-2.806	0.00563	-0.048173	22	0.017171	yes	BRNCTXA
chr1_2094100_G_A_b38	RP5-902P8.12	2.772	0.00621	0.063572	3	0.022931	yes	BRNCTXA
chr1_1453870_A_C_b38	RP5-902P8.12	2.768	0.00629	0.05778	5	0.020873	yes	BRNCTXA
chr1_1445187_T_G_b38	RP5-902P8.12	2.753	0.00657	0.045158	28	0.016402	yes	BRNCTXA
chr1_1445240_A_G_b38	RP5-902P8.12	2.753	0.00657	0.045158	28	0.016402	yes	BRNCTXA
chr1_2087423_G_T_b38	RP5-902P8.12	2.736	0.00691	0.063715	3	0.023292	yes	BRNCTXA
chr1_2092415_G_A_b38	RP5-902P8.12	2.736	0.00691	0.063715	3	0.023292	yes	BRNCTXA
chr1_2093894_C_T_b38	RP5-902P8.12	2.736	0.00691	0.063715	3	0.023292	yes	BRNCTXA
chr1_2095729_C_T_b38	RP5-902P8.12	2.736	0.00691	0.063715	3	0.023292	yes	BRNCTXA
chr1_1370553_CAAA_C_b38	RP5-902P8.12	2.735	0.00691	0.059536	3	0.021764	yes	BRNCTXA
chr1_1379093_TG_T_b38	RP5-902P8.12	2.724	0.00714	0.059041	3	0.021672	yes	BRNCTXA
chr1_1376162_G_C_b38	RP5-902P8.12	-2.708	0.00748	-0.047173	21	0.017418	yes	BRNCTXA
chr1_1377431_C_T_b38	RP5-902P8.12	-2.708	0.00748	-0.047173	21	0.017418	yes	BRNCTXA
chr1_1453961_C_T_b38	RP5-902P8.12	2.693	0.00781	0.056321	5	0.020912	yes	BRNCTXA
chr1_1443457_T_C_b38	RP5-902P8.12	2.69	0.00788	0.045059	30	0.01675	yes	BRNCTXA
chr1_285109_CA_C_b38	RP5-902P8.12	-2.651	0.00882	-0.06885	4	0.025974	yes	BRNCTXA
chr1_1107103_C_T_b38	RP5-902P8.12	2.646	0.00893	0.057241	8	0.02163	yes	BRNCTXA
chr1_1366427_AGTGTGATTGAATGAGT_A_b38	RP5-902P8.12	-2.637	0.00917	-0.045861	19	0.017392	yes	BRNCTXA
chr1_1451968_C_T_b38	RP5-902P8.12	2.632	0.00929	0.049422	12	0.018774	yes	BRNCTXA
chr1_1440834_C_G_b38	RP5-902P8.12	2.63	0.00935	0.044113	30	0.016773	yes	BRNCTXA
chr1_1451787_A_C_b38	RP5-902P8.12	2.621	0.00958	0.046722	19	0.017823	yes	BRNCTXA
chr1_1363898_C_T_b38	RP5-902P8.12	-2.618	0.00968	-0.050048	6	0.019118	yes	BRNCTXA
chr1_1363986_C_T_b38	RP5-902P8.12	-2.618	0.00968	-0.050048	6	0.019118	yes	BRNCTXA
chr1_1365566_G_A_b38	RP5-902P8.12	-2.618	0.00968	-0.050048	6	0.019118	yes	BRNCTXA
chr1_1366529_TTAG_T_b38	RP5-902P8.12	-2.618	0.00968	-0.050048	6	0.019118	yes	BRNCTXA
chr1_1367292_A_AGT_b38	RP5-902P8.12	-2.618	0.00968	-0.050048	6	0.019118	yes	BRNCTXA
chr1_1312114_T_C_b38	RP5-902P8.12	-2.612	0.00984	-0.045164	26	0.017292	yes	BRNCTXA
chr1_1249880_A_G_b38	RP5-902P8.12	2.61	0.0099	0.049126	10	0.018823	yes	BRNCTXA
chr1_1175206_T_C_b38	RP5-902P8.12	3.953	0.000115	0.063329	36	0.016021	no	BRNCTXA
chr1_1235642_G_C_b38	RP5-902P8.12	3.92	0.00013	0.079786	3	0.020356	no	BRNCTXA
chr1_1231507_T_C_b38	RP5-902P8.12	3.862	0.000162	0.073909	5	0.019138	no	BRNCTXA
chr1_1180931_A_G_b38	RP5-902P8.12	3.773	0.000225	0.060276	37	0.015975	no	BRNCTXA
chr1_1228424_C_T_b38	RP5-902P8.12	3.708	0.000286	0.071507	5	0.019285	no	BRNCTXA
chr1_1277830_C_CA_b38	RP5-902P8.12	3.463	0.000682	0.093654	3	0.027045	no	BRNCTXA
chr1_1522693_A_G_b38	RP5-902P8.12	-3.359	0.000974	-0.065475	6	0.019495	no	BRNCTXA
chr1_1092465_T_G_b38	RP5-902P8.12	3.348	0.00101	0.06518	9	0.019467	no	BRNCTXA
chr1_1092466_T_C_b38	RP5-902P8.12	3.348	0.00101	0.06518	9	0.019467	no	BRNCTXA
chr1_1251618_G_A_b38	RP5-902P8.12	2.901	0.00423	0.059306	5	0.020444	no	BRNCTXA
chr1_1453643_A_ATT_b38	RP5-902P8.12	2.884	0.00445	0.053713	15	0.018622	no	BRNCTXA
chr1_1187904_CA_C_b38	RP5-902P8.12	2.772	0.00622	0.056507	3	0.020385	no	BRNCTXA
chr1_1251285_G_A_b38	RP5-902P8.12	2.768	0.00628	0.055839	6	0.020171	no	BRNCTXA
chr1_1251368_T_C_b38	RP5-902P8.12	2.768	0.00628	0.055839	6	0.020171	no	BRNCTXA
chr1_1244603_G_A_b38	RP5-902P8.12	2.692	0.00783	0.056847	4	0.021115	no	BRNCTXA
chr1_1439454_A_G_b38	RP5-902P8.12	2.685	0.00799	0.044558	30	0.016594	no	BRNCTXA
chr1_1098863_C_T_b38	RP5-902P8.12	2.676	0.0082	0.059895	4	0.022379	no	BRNCTXA
chr1_1098246_C_G_b38	RP5-902P8.12	2.649	0.00886	0.05251	9	0.019822	no	BRNCTXA
chr1_285109_C_CA_b38	RP5-902P8.12	3.854	0.000179	0.126879	3	0.03292	yes	BRNCTXB
chr1_1116304_A_C_b38	RP5-902P8.12	3.831	0.000195	0.151078	5	0.039432	yes	BRNCTXB
chr1_1118777_T_C_b38	RP5-902P8.12	3.831	0.000195	0.151078	5	0.039432	yes	BRNCTXB
chr1_1118779_C_T_b38	RP5-902P8.12	3.831	0.000195	0.151078	5	0.039432	yes	BRNCTXB
chr1_1118835_A_G_b38	RP5-902P8.12	3.831	0.000195	0.151078	5	0.039432	yes	BRNCTXB
chr1_1119363_C_G_b38	RP5-902P8.12	3.831	0.000195	0.151078	5	0.039432	yes	BRNCTXB
chr1_1120062_A_G_b38	RP5-902P8.12	3.808	0.000213	0.14861	5	0.039027	yes	BRNCTXB
chr1_1115683_C_A_b38	RP5-902P8.12	3.546	0.000539	0.127698	4	0.036008	yes	BRNCTXB
chr1_1115166_G_GT_b38	RP5-902P8.12	3.54	0.000551	0.136849	6	0.038662	yes	BRNCTXB
chr1_1116992_A_G_b38	RP5-902P8.12	3.54	0.000551	0.136849	6	0.038662	yes	BRNCTXB
chr1_1991835_C_T_b38	RP5-902P8.12	-3.513	0.000605	-0.060495	27	0.017221	yes	BRNCTXB
chr1_1114143_C_A_b38	RP5-902P8.12	3.479	0.00068	0.130032	6	0.03738	yes	BRNCTXB
chr1_1992242_A_G_b38	RP5-902P8.12	-3.347	0.00106	-0.061274	22	0.018305	yes	BRNCTXB
chr1_280726_A_AACACACACAC_b38	RP5-902P8.12	3.288	0.00129	0.110581	4	0.033633	yes	BRNCTXB
chr1_1991213_T_C_b38	RP5-902P8.12	-3.241	0.0015	-0.057802	23	0.017836	yes	BRNCTXB
chr1_1113260_C_A_b38	RP5-902P8.12	3.184	0.00181	0.115623	4	0.036315	yes	BRNCTXB
chr1_1113344_A_C_b38	RP5-902P8.12	3.184	0.00181	0.115623	4	0.036315	yes	BRNCTXB
chr1_1114769_G_A_b38	RP5-902P8.12	3.184	0.00181	0.115623	4	0.036315	yes	BRNCTXB
chr1_1116728_A_G_b38	RP5-902P8.12	3.184	0.00181	0.115623	4	0.036315	yes	BRNCTXB
chr1_1118491_T_C_b38	RP5-902P8.12	3.184	0.00181	0.115623	4	0.036315	yes	BRNCTXB
chr1_1118832_C_T_b38	RP5-902P8.12	3.184	0.00181	0.115623	4	0.036315	yes	BRNCTXB
chr1_1119514_G_A_b38	RP5-902P8.12	3.184	0.00181	0.115623	4	0.036315	yes	BRNCTXB
chr1_1120626_G_A_b38	RP5-902P8.12	3.184	0.00181	0.115623	4	0.036315	yes	BRNCTXB
chr1_1120771_G_A_b38	RP5-902P8.12	3.184	0.00181	0.115623	4	0.036315	yes	BRNCTXB
chr1_1120821_T_G_b38	RP5-902P8.12	3.184	0.00181	0.115623	4	0.036315	yes	BRNCTXB
chr1_1143811_T_C_b38	RP5-902P8.12	3.128	0.00216	0.05958	16	0.019047	yes	BRNCTXB
chr1_1990864_C_T_b38	RP5-902P8.12	-3.124	0.00218	-0.056636	24	0.018127	yes	BRNCTXB
chr1_1115321_G_C_b38	RP5-902P8.12	2.974	0.00348	0.108562	3	0.036498	yes	BRNCTXB
chr1_1116489_G_C_b38	RP5-902P8.12	2.974	0.00348	0.108562	3	0.036498	yes	BRNCTXB
chr1_1123518_CGCACACGCCACACACACCTGCGCACACTCCTGCACACACAGTGCACACACCTGCACACACACCTGTGCACACACACCTGT_C_b38	RP5-902P8.12	2.974	0.00348	0.108562	3	0.036498	yes	BRNCTXB
chr1_1123890_G_A_b38	RP5-902P8.12	2.974	0.00348	0.108562	3	0.036498	yes	BRNCTXB
chr1_1143818_T_C_b38	RP5-902P8.12	2.954	0.00371	0.057601	16	0.019499	yes	BRNCTXB
chr1_820560_C_T_b38	RP5-902P8.12	2.829	0.00539	0.066882	5	0.023643	yes	BRNCTXB
chr1_1992226_A_G_b38	RP5-902P8.12	-2.816	0.00559	-0.050936	29	0.018086	yes	BRNCTXB
chr1_1144486_C_G_b38	RP5-902P8.12	2.801	0.00585	0.054975	16	0.019627	yes	BRNCTXB
chr1_1278491_C_CT_b38	RP5-902P8.12	2.729	0.00721	0.078936	3	0.028928	yes	BRNCTXB
chr1_1171404_T_C_b38	RP5-902P8.12	2.697	0.0079	0.057938	9	0.021484	yes	BRNCTXB
chr1_282728_T_C_b38	RP5-902P8.12	-2.691	0.00803	-0.06537	4	0.024292	yes	BRNCTXB
chr1_1265603_T_TTGTG_b38	RP5-902P8.12	2.635	0.00942	0.063849	3	0.024235	yes	BRNCTXB
chr1_2124387_G_A_b38	RP5-902P8.12	2.628	0.0096	0.111231	3	0.042328	yes	BRNCTXB
chr1_1991778_A_G_b38	RP5-902P8.12	2.616	0.00991	0.053729	10	0.020536	yes	BRNCTXB
chr1_284741_A_C_b38	RP5-902P8.12	3.893	0.000156	0.151229	3	0.038849	no	BRNCTXB
chr1_1306523_C_G_b38	RP5-902P8.12	-2.952	0.00373	-0.088045	7	0.029823	no	BRNCTXB
chr1_1991761_T_C_b38	RP5-902P8.12	-2.868	0.0048	-0.050245	25	0.017518	no	BRNCTXB
chr1_1861110_C_CAA_b38	RP5-902P8.12	2.852	0.00503	0.05955	12	0.020877	no	BRNCTXB
chr1_1131566_A_G_b38	RP5-902P8.12	-2.798	0.00591	-0.054467	33	0.019469	no	BRNCTXB
chr1_1142582_C_T_b38	RP5-902P8.12	-2.772	0.00637	-0.049674	28	0.017922	no	BRNCTXB
chr1_1150799_T_C_b38	RP5-902P8.12	2.769	0.00641	0.053239	15	0.019224	no	BRNCTXB
chr1_1991690_A_G_b38	RP5-902P8.12	-2.761	0.00657	-0.04983	28	0.018046	no	BRNCTXB
chr1_1131572_A_G_b38	RP5-902P8.12	-2.707	0.00767	-0.053275	34	0.01968	no	BRNCTXB
chr1_1131573_T_C_b38	RP5-902P8.12	-2.707	0.00767	-0.053275	34	0.01968	no	BRNCTXB
chr1_1071823_A_G_b38	RP5-902P8.12	-2.693	0.00799	-0.057378	8	0.021308	no	BRNCTXB
chr1_1131008_C_CT_b38	RP5-902P8.12	-2.669	0.00855	-0.051689	34	0.019367	no	BRNCTXB
chr1_1131023_T_C_b38	RP5-902P8.12	-2.669	0.00855	-0.051689	34	0.019367	no	BRNCTXB
chr1_1163334_C_G_b38	RP5-902P8.12	-2.657	0.00883	-0.045708	47	0.017201	no	BRNCTXB
chr1_264730_T_A_b38	RP5-902P8.12	2.638	0.00932	0.091391	7	0.034642	no	BRNCTXB
chr1_1217733_G_A_b38	RP5-902P8.12	4.209	4.87e-05	0.112183	4	0.02665	yes	BRNHPP
chr1_1223568_A_G_b38	RP5-902P8.12	3.908	0.000152	0.111374	3	0.028496	yes	BRNHPP
chr1_1236037_C_T_b38	RP5-902P8.12	3.88	0.000168	0.071511	29	0.018429	yes	BRNHPP
chr1_1231710_CCCCCGGGAA_C_b38	RP5-902P8.12	3.774	0.000248	0.10184	4	0.026988	yes	BRNHPP
chr1_2051721_C_A_b38	RP5-902P8.12	3.746	0.000273	0.07943	12	0.021201	yes	BRNHPP
chr1_1225476_T_C_b38	RP5-902P8.12	3.712	0.000309	0.108229	3	0.029155	yes	BRNHPP
chr1_1226013_C_T_b38	RP5-902P8.12	3.712	0.000309	0.108229	3	0.029155	yes	BRNHPP
chr1_1216593_G_C_b38	RP5-902P8.12	3.599	0.00046	0.091119	5	0.025318	yes	BRNHPP
chr1_1226486_C_T_b38	RP5-902P8.12	3.524	0.000596	0.095753	3	0.027172	yes	BRNHPP
chr1_1235602_C_A_b38	RP5-902P8.12	3.441	0.00079	0.096615	3	0.028076	yes	BRNHPP
chr1_1215852_T_C_b38	RP5-902P8.12	3.433	0.000811	0.086846	6	0.025294	yes	BRNHPP
chr1_1238231_G_A_b38	RP5-902P8.12	3.041	0.00288	0.079149	8	0.026027	yes	BRNHPP
chr1_1230159_G_A_b38	RP5-902P8.12	3.029	0.00299	0.069719	8	0.023019	yes	BRNHPP
chr1_1236303_A_G_b38	RP5-902P8.12	3.011	0.00316	0.07792	5	0.025882	yes	BRNHPP
chr1_1219858_G_A_b38	RP5-902P8.12	2.963	0.00366	0.078721	8	0.026571	yes	BRNHPP
chr1_1246371_T_C_b38	RP5-902P8.12	2.918	0.00418	0.087607	6	0.030021	yes	BRNHPP
chr1_1249880_A_G_b38	RP5-902P8.12	2.848	0.00515	0.079273	9	0.027832	yes	BRNHPP
chr1_1229369_G_GC_b38	RP5-902P8.12	2.843	0.00523	0.075535	5	0.026568	yes	BRNHPP
chr1_1727506_T_C_b38	RP5-902P8.12	2.834	0.00537	0.06466	19	0.022819	yes	BRNHPP
chr1_1865177_G_A_b38	RP5-902P8.12	-2.805	0.00584	-0.069606	10	0.024813	yes	BRNHPP
chr1_1221049_C_G_b38	RP5-902P8.12	2.78	0.00628	0.066228	15	0.023824	yes	BRNHPP
chr1_1994282_G_A_b38	RP5-902P8.12	-2.771	0.00644	-0.060987	16	0.022005	yes	BRNHPP
chr1_1251285_G_A_b38	RP5-902P8.12	2.727	0.00732	0.080997	4	0.029702	yes	BRNHPP
chr1_1251368_T_C_b38	RP5-902P8.12	2.727	0.00732	0.080997	4	0.029702	yes	BRNHPP
chr1_1251122_A_T_b38	RP5-902P8.12	2.725	0.00736	0.07591	9	0.027855	yes	BRNHPP
chr1_1363898_C_T_b38	RP5-902P8.12	-2.676	0.00846	-0.065602	5	0.024517	yes	BRNHPP
chr1_1363986_C_T_b38	RP5-902P8.12	-2.676	0.00846	-0.065602	5	0.024517	yes	BRNHPP
chr1_1365566_G_A_b38	RP5-902P8.12	-2.676	0.00846	-0.065602	5	0.024517	yes	BRNHPP
chr1_1366529_TTAG_T_b38	RP5-902P8.12	-2.676	0.00846	-0.065602	5	0.024517	yes	BRNHPP
chr1_1367292_A_AGT_b38	RP5-902P8.12	-2.676	0.00846	-0.065602	5	0.024517	yes	BRNHPP
chr1_1231507_T_C_b38	RP5-902P8.12	2.67	0.00859	0.073689	3	0.027594	yes	BRNHPP
chr1_1731904_CA_C_b38	RP5-902P8.12	2.669	0.00862	0.063009	12	0.023606	yes	BRNHPP
chr1_2160238_CGTGT_C_b38	RP5-902P8.12	2.654	0.009	0.064858	4	0.024438	yes	BRNHPP
chr1_1411323_A_C_b38	RP5-902P8.12	2.653	0.00903	0.062339	19	0.023502	yes	BRNHPP
chr1_1951106_G_A_b38	RP5-902P8.12	-2.634	0.00951	-0.056019	31	0.021267	yes	BRNHPP
chr1_1951865_G_GT_b38	RP5-902P8.12	-2.634	0.00951	-0.056019	31	0.021267	yes	BRNHPP
chr1_1379093_TG_T_b38	RP5-902P8.12	3.52	0.000604	0.093014	3	0.026423	no	BRNHPP
chr1_1217251_C_A_b38	RP5-902P8.12	3.49	0.000671	0.095855	5	0.027469	no	BRNHPP
chr1_1367511_ATGAG_A_b38	RP5-902P8.12	3.454	0.000756	0.089256	3	0.025841	no	BRNHPP
chr1_1366511_GGTGA_G_b38	RP5-902P8.12	3.346	0.00108	0.08522	4	0.025467	no	BRNHPP
chr1_1363688_C_T_b38	RP5-902P8.12	3.286	0.00132	0.08387	4	0.025522	no	BRNHPP
chr1_1364099_CCA_C_b38	RP5-902P8.12	3.286	0.00132	0.08387	4	0.025522	no	BRNHPP
chr1_1364102_TGTTG_T_b38	RP5-902P8.12	3.286	0.00132	0.08387	4	0.025522	no	BRNHPP
chr1_1235997_A_G_b38	RP5-902P8.12	3.285	0.00133	0.09482	3	0.028867	no	BRNHPP
chr1_1372909_G_A_b38	RP5-902P8.12	3.251	0.00148	0.082301	4	0.025316	no	BRNHPP
chr1_1364282_T_G_b38	RP5-902P8.12	3.233	0.00157	0.081961	4	0.025352	no	BRNHPP
chr1_1364357_A_C_b38	RP5-902P8.12	3.233	0.00157	0.081961	4	0.025352	no	BRNHPP
chr1_1364566_T_C_b38	RP5-902P8.12	3.233	0.00157	0.081961	4	0.025352	no	BRNHPP
chr1_1364694_T_C_b38	RP5-902P8.12	3.233	0.00157	0.081961	4	0.025352	no	BRNHPP
chr1_1364721_C_T_b38	RP5-902P8.12	3.233	0.00157	0.081961	4	0.025352	no	BRNHPP
chr1_1365160_A_G_b38	RP5-902P8.12	3.233	0.00157	0.081961	4	0.025352	no	BRNHPP
chr1_1365198_C_T_b38	RP5-902P8.12	3.233	0.00157	0.081961	4	0.025352	no	BRNHPP
chr1_1366008_A_G_b38	RP5-902P8.12	3.233	0.00157	0.081961	4	0.025352	no	BRNHPP
chr1_1366062_T_C_b38	RP5-902P8.12	3.233	0.00157	0.081961	4	0.025352	no	BRNHPP
chr1_1366145_TGTGAA_T_b38	RP5-902P8.12	3.233	0.00157	0.081961	4	0.025352	no	BRNHPP
chr1_1366187_A_AGT_b38	RP5-902P8.12	3.233	0.00157	0.081961	4	0.025352	no	BRNHPP
chr1_1366292_G_T_b38	RP5-902P8.12	3.233	0.00157	0.081961	4	0.025352	no	BRNHPP
chr1_1366321_TGTGTGTAAATGG_T_b38	RP5-902P8.12	3.233	0.00157	0.081961	4	0.025352	no	BRNHPP
chr1_1366453_G_T_b38	RP5-902P8.12	3.233	0.00157	0.081961	4	0.025352	no	BRNHPP
chr1_1366726_T_G_b38	RP5-902P8.12	3.233	0.00157	0.081961	4	0.025352	no	BRNHPP
chr1_1367258_T_A_b38	RP5-902P8.12	3.233	0.00157	0.081961	4	0.025352	no	BRNHPP
chr1_1367268_TGA_T_b38	RP5-902P8.12	3.233	0.00157	0.081961	4	0.025352	no	BRNHPP
chr1_1367297_GAA_G_b38	RP5-902P8.12	3.233	0.00157	0.081961	4	0.025352	no	BRNHPP
chr1_1367300_T_TGA_b38	RP5-902P8.12	3.233	0.00157	0.081961	4	0.025352	no	BRNHPP
chr1_1367329_A_AGT_b38	RP5-902P8.12	3.233	0.00157	0.081961	4	0.025352	no	BRNHPP
chr1_1367373_T_TGTG_b38	RP5-902P8.12	3.233	0.00157	0.081961	4	0.025352	no	BRNHPP
chr1_1367388_T_TTGG_b38	RP5-902P8.12	3.233	0.00157	0.081961	4	0.025352	no	BRNHPP
chr1_1367462_T_C_b38	RP5-902P8.12	3.233	0.00157	0.081961	4	0.025352	no	BRNHPP
chr1_1367593_G_A_b38	RP5-902P8.12	3.233	0.00157	0.081961	4	0.025352	no	BRNHPP
chr1_1367602_GT_G_b38	RP5-902P8.12	3.233	0.00157	0.081961	4	0.025352	no	BRNHPP
chr1_1367605_GAGTGAGTGTA_G_b38	RP5-902P8.12	3.233	0.00157	0.081961	4	0.025352	no	BRNHPP
chr1_1367670_GGTGA_G_b38	RP5-902P8.12	3.233	0.00157	0.081961	4	0.025352	no	BRNHPP
chr1_1367722_TTTTA_T_b38	RP5-902P8.12	3.233	0.00157	0.081961	4	0.025352	no	BRNHPP
chr1_1367874_A_T_b38	RP5-902P8.12	3.233	0.00157	0.081961	4	0.025352	no	BRNHPP
chr1_1370181_C_T_b38	RP5-902P8.12	3.233	0.00157	0.081961	4	0.025352	no	BRNHPP
chr1_1370317_G_C_b38	RP5-902P8.12	3.233	0.00157	0.081961	4	0.025352	no	BRNHPP
chr1_1370320_A_G_b38	RP5-902P8.12	3.233	0.00157	0.081961	4	0.025352	no	BRNHPP
chr1_1370430_T_C_b38	RP5-902P8.12	3.233	0.00157	0.081961	4	0.025352	no	BRNHPP
chr1_1370532_C_T_b38	RP5-902P8.12	3.233	0.00157	0.081961	4	0.025352	no	BRNHPP
chr1_1370584_G_C_b38	RP5-902P8.12	3.233	0.00157	0.081961	4	0.025352	no	BRNHPP
chr1_1329973_GCGTGTGCCATGCA_G_b38	RP5-902P8.12	3.22	0.00164	0.081562	4	0.025333	no	BRNHPP
chr1_1341550_GCA_G_b38	RP5-902P8.12	3.22	0.00164	0.081562	4	0.025333	no	BRNHPP
chr1_1344048_G_A_b38	RP5-902P8.12	3.22	0.00164	0.081562	4	0.025333	no	BRNHPP
chr1_1364253_C_G_b38	RP5-902P8.12	3.22	0.00164	0.081562	4	0.025333	no	BRNHPP
chr1_1308178_GGGGCGCGGGGA_G_b38	RP5-902P8.12	3.207	0.00171	0.074501	7	0.02323	no	BRNHPP
chr1_1369821_C_T_b38	RP5-902P8.12	3.18	0.00186	0.07863	5	0.02473	no	BRNHPP
chr1_1363880_A_G_b38	RP5-902P8.12	3.152	0.00203	0.079825	4	0.025323	no	BRNHPP
chr1_1367280_T_A_b38	RP5-902P8.12	3.15	0.00205	0.079799	4	0.025332	no	BRNHPP
chr1_1368763_G_A_b38	RP5-902P8.12	3.139	0.00212	0.078226	5	0.024922	no	BRNHPP
chr1_1367919_C_T_b38	RP5-902P8.12	3.092	0.00246	0.076606	5	0.024778	no	BRNHPP
chr1_1367951_C_T_b38	RP5-902P8.12	3.092	0.00246	0.076606	5	0.024778	no	BRNHPP
chr1_1367965_A_G_b38	RP5-902P8.12	3.092	0.00246	0.076606	5	0.024778	no	BRNHPP
chr1_1367970_T_G_b38	RP5-902P8.12	3.092	0.00246	0.076606	5	0.024778	no	BRNHPP
chr1_1367994_C_A_b38	RP5-902P8.12	3.092	0.00246	0.076606	5	0.024778	no	BRNHPP
chr1_1368297_C_T_b38	RP5-902P8.12	3.092	0.00246	0.076606	5	0.024778	no	BRNHPP
chr1_1368514_C_G_b38	RP5-902P8.12	3.092	0.00246	0.076606	5	0.024778	no	BRNHPP
chr1_1368991_C_T_b38	RP5-902P8.12	3.092	0.00246	0.076606	5	0.024778	no	BRNHPP
chr1_1369009_T_C_b38	RP5-902P8.12	3.092	0.00246	0.076606	5	0.024778	no	BRNHPP
chr1_1369012_C_CG_b38	RP5-902P8.12	3.092	0.00246	0.076606	5	0.024778	no	BRNHPP
chr1_1369282_G_A_b38	RP5-902P8.12	3.092	0.00246	0.076606	5	0.024778	no	BRNHPP
chr1_1369320_GT_G_b38	RP5-902P8.12	3.092	0.00246	0.076606	5	0.024778	no	BRNHPP
chr1_1369407_G_A_b38	RP5-902P8.12	3.092	0.00246	0.076606	5	0.024778	no	BRNHPP
chr1_1369476_CTT_C_b38	RP5-902P8.12	3.092	0.00246	0.076606	5	0.024778	no	BRNHPP
chr1_1369556_C_G_b38	RP5-902P8.12	3.092	0.00246	0.076606	5	0.024778	no	BRNHPP
chr1_1369627_T_C_b38	RP5-902P8.12	3.092	0.00246	0.076606	5	0.024778	no	BRNHPP
chr1_1369686_T_C_b38	RP5-902P8.12	3.092	0.00246	0.076606	5	0.024778	no	BRNHPP
chr1_1369716_G_C_b38	RP5-902P8.12	3.092	0.00246	0.076606	5	0.024778	no	BRNHPP
chr1_1369741_C_T_b38	RP5-902P8.12	3.092	0.00246	0.076606	5	0.024778	no	BRNHPP
chr1_1382893_G_A_b38	RP5-902P8.12	3.052	0.00278	0.077943	4	0.025535	no	BRNHPP
chr1_1375642_C_T_b38	RP5-902P8.12	3.046	0.00283	0.077816	4	0.025548	no	BRNHPP
chr1_1383743_T_C_b38	RP5-902P8.12	3.046	0.00283	0.077816	4	0.025548	no	BRNHPP
chr1_1374505_A_G_b38	RP5-902P8.12	2.997	0.00329	0.076091	4	0.025386	no	BRNHPP
chr1_1368177_G_C_b38	RP5-902P8.12	2.984	0.00343	0.074805	5	0.02507	no	BRNHPP
chr1_1380867_A_G_b38	RP5-902P8.12	2.968	0.0036	0.075398	4	0.025408	no	BRNHPP
chr1_1384546_C_T_b38	RP5-902P8.12	2.968	0.0036	0.075398	4	0.025408	no	BRNHPP
chr1_1398218_C_A_b38	RP5-902P8.12	2.968	0.0036	0.075398	4	0.025408	no	BRNHPP
chr1_1400756_GGA_G_b38	RP5-902P8.12	2.968	0.0036	0.075398	4	0.025408	no	BRNHPP
chr1_1401954_G_T_b38	RP5-902P8.12	2.968	0.0036	0.075398	4	0.025408	no	BRNHPP
chr1_1403593_A_G_b38	RP5-902P8.12	2.968	0.0036	0.075398	4	0.025408	no	BRNHPP
chr1_1407565_C_A_b38	RP5-902P8.12	2.968	0.0036	0.075398	4	0.025408	no	BRNHPP
chr1_1370553_CAAA_C_b38	RP5-902P8.12	2.95	0.0038	0.081863	3	0.027747	no	BRNHPP
chr1_1379091_T_G_b38	RP5-902P8.12	-2.94	0.00392	-0.073039	4	0.024843	no	BRNHPP
chr1_1316929_A_T_b38	RP5-902P8.12	2.924	0.00411	0.069105	7	0.023631	no	BRNHPP
chr1_1379083_AT_A_b38	RP5-902P8.12	-2.881	0.00467	-0.062939	12	0.021845	no	BRNHPP
chr1_1370553_CA_C_b38	RP5-902P8.12	-2.849	0.00514	-0.05951	36	0.020889	no	BRNHPP
chr1_2047887_T_C_b38	RP5-902P8.12	-2.828	0.00546	-0.056435	26	0.019955	no	BRNHPP
chr1_1369803_C_CT_b38	RP5-902P8.12	2.801	0.00591	0.066717	6	0.023817	no	BRNHPP
chr1_1366776_G_GAATT_b38	RP5-902P8.12	2.792	0.00608	0.073145	4	0.026202	no	BRNHPP
chr1_1361685_C_T_b38	RP5-902P8.12	2.772	0.00643	0.070698	9	0.025502	no	BRNHPP
chr1_1325753_G_T_b38	RP5-902P8.12	2.696	0.008	0.07484	3	0.027761	no	BRNHPP
chr1_1948594_G_GTT_b38	RP5-902P8.12	-2.653	0.00902	-0.044716	27	0.016853	no	BRNHPP
chr1_1363438_C_CTT_b38	RP5-902P8.12	-2.62	0.00988	-0.055062	16	0.021014	no	BRNHPP
chr1_265009_A_T_b38	RP5-902P8.12	2.985	0.00339	0.050068	9	0.016773	yes	BRNHPT
chr1_2211900_C_CTTTT_b38	RP5-902P8.12	2.715	0.00753	0.076048	3	0.028006	yes	BRNHPT
chr1_2047887_T_C_b38	RP5-902P8.12	-3.543	0.000552	-0.05044	23	0.014238	no	BRNHPT
chr1_2051703_C_T_b38	RP5-902P8.12	-3.306	0.00123	-0.048382	18	0.014636	no	BRNHPT
chr1_1130879_G_C_b38	RP5-902P8.12	-2.964	0.00362	-0.056186	4	0.018959	no	BRNHPT
chr1_1293731_A_ACGCCCCTGCCCTGGAGGCCC_b38	RP5-902P8.12	-2.868	0.00483	-0.045136	17	0.015739	no	BRNHPT
chr1_1216593_G_C_b38	RP5-902P8.12	4.775	4.01e-06	0.087809	6	0.018388	yes	BRNNCC
chr1_1236037_C_T_b38	RP5-902P8.12	4.59	8.9e-06	0.065734	34	0.014323	yes	BRNNCC
chr1_1215852_T_C_b38	RP5-902P8.12	4.586	9.01e-06	0.083102	7	0.018119	yes	BRNNCC
chr1_1221049_C_G_b38	RP5-902P8.12	4.487	1.37e-05	0.072053	22	0.016057	yes	BRNNCC
chr1_1238902_T_C_b38	RP5-902P8.12	4.394	2.01e-05	0.067286	27	0.015314	yes	BRNNCC
chr1_1195463_A_G_b38	RP5-902P8.12	4.358	2.33e-05	0.069887	22	0.016037	yes	BRNNCC
chr1_1240580_G_GC_b38	RP5-902P8.12	4.316	2.77e-05	0.085007	4	0.019696	yes	BRNNCC
chr1_1217733_G_A_b38	RP5-902P8.12	4.287	3.1e-05	0.082971	5	0.019352	yes	BRNNCC
chr1_1217251_C_A_b38	RP5-902P8.12	4.277	3.24e-05	0.082263	6	0.019235	yes	BRNNCC
chr1_1249880_A_G_b38	RP5-902P8.12	4.26	3.47e-05	0.078037	10	0.01832	yes	BRNNCC
chr1_1172462_G_C_b38	RP5-902P8.12	4.212	4.21e-05	0.093993	4	0.022317	yes	BRNNCC
chr1_1189283_G_A_b38	RP5-902P8.12	4.208	4.27e-05	0.068587	21	0.016299	yes	BRNNCC
chr1_1251122_A_T_b38	RP5-902P8.12	4.197	4.46e-05	0.076761	10	0.01829	yes	BRNNCC
chr1_1238231_G_A_b38	RP5-902P8.12	4.161	5.15e-05	0.07442	10	0.017886	yes	BRNNCC
chr1_1174573_G_A_b38	RP5-902P8.12	4.157	5.22e-05	0.093668	4	0.02253	yes	BRNNCC
chr1_1187535_A_G_b38	RP5-902P8.12	4.147	5.45e-05	0.066635	23	0.01607	yes	BRNNCC
chr1_1231710_CCCCCGGGAA_C_b38	RP5-902P8.12	4.125	5.93e-05	0.078893	5	0.019127	yes	BRNNCC
chr1_1197697_A_G_b38	RP5-902P8.12	4.091	6.76e-05	0.065347	21	0.015972	yes	BRNNCC
chr1_1229369_G_GC_b38	RP5-902P8.12	4.087	6.88e-05	0.07561	7	0.0185	yes	BRNNCC
chr1_1177430_G_T_b38	RP5-902P8.12	3.99	1e-04	0.090083	4	0.022578	yes	BRNNCC
chr1_1179288_G_A_b38	RP5-902P8.12	3.99	1e-04	0.090083	4	0.022578	yes	BRNNCC
chr1_1231507_T_C_b38	RP5-902P8.12	3.98	0.000104	0.074769	5	0.018786	yes	BRNNCC
chr1_1193398_C_CTTA_b38	RP5-902P8.12	3.96	0.000112	0.063679	26	0.016079	yes	BRNNCC
chr1_1205055_G_T_b38	RP5-902P8.12	3.96	0.000112	0.061621	30	0.015562	yes	BRNNCC
chr1_1292284_TTGAG_T_b38	RP5-902P8.12	3.952	0.000116	0.078584	8	0.019886	yes	BRNNCC
chr1_1173815_A_G_b38	RP5-902P8.12	3.945	0.000119	0.087092	4	0.022079	yes	BRNNCC
chr1_1230159_G_A_b38	RP5-902P8.12	3.934	0.000124	0.064808	14	0.016472	yes	BRNNCC
chr1_1196201_T_C_b38	RP5-902P8.12	3.906	0.000138	0.062735	20	0.016059	yes	BRNNCC
chr1_1246371_T_C_b38	RP5-902P8.12	3.903	0.000139	0.079088	7	0.020263	yes	BRNNCC
chr1_1178014_C_T_b38	RP5-902P8.12	3.87	0.000158	0.087763	4	0.022678	yes	BRNNCC
chr1_1197893_T_C_b38	RP5-902P8.12	3.837	0.000179	0.061649	19	0.016068	yes	BRNNCC
chr1_1198407_T_C_b38	RP5-902P8.12	3.837	0.000179	0.061649	19	0.016068	yes	BRNNCC
chr1_1198435_T_C_b38	RP5-902P8.12	3.837	0.000179	0.061649	19	0.016068	yes	BRNNCC
chr1_1199862_A_C_b38	RP5-902P8.12	3.809	0.000198	0.059426	23	0.015602	yes	BRNNCC
chr1_1235602_C_A_b38	RP5-902P8.12	3.765	0.000233	0.074222	4	0.019714	yes	BRNNCC
chr1_1174523_C_T_b38	RP5-902P8.12	3.752	0.000244	0.0839	4	0.022362	yes	BRNNCC
chr1_1174747_C_T_b38	RP5-902P8.12	3.752	0.000244	0.0839	4	0.022362	yes	BRNNCC
chr1_1188054_T_A_b38	RP5-902P8.12	3.748	0.000248	0.069166	8	0.018456	yes	BRNNCC
chr1_1174988_C_T_b38	RP5-902P8.12	3.734	0.000261	0.084119	4	0.022526	yes	BRNNCC
chr1_1175040_T_C_b38	RP5-902P8.12	3.734	0.000261	0.084119	4	0.022526	yes	BRNNCC
chr1_1228424_C_T_b38	RP5-902P8.12	3.707	0.000288	0.070008	5	0.018883	yes	BRNNCC
chr1_1251285_G_A_b38	RP5-902P8.12	3.692	0.000304	0.074734	6	0.020241	yes	BRNNCC
chr1_1251368_T_C_b38	RP5-902P8.12	3.692	0.000304	0.074734	6	0.020241	yes	BRNNCC
chr1_1243545_G_A_b38	RP5-902P8.12	3.66	0.000342	0.078852	3	0.021544	yes	BRNNCC
chr1_1243929_G_A_b38	RP5-902P8.12	3.66	0.000342	0.078852	3	0.021544	yes	BRNNCC
chr1_1226486_C_T_b38	RP5-902P8.12	3.654	0.000349	0.071966	4	0.019694	yes	BRNNCC
chr1_1241053_A_G_b38	RP5-902P8.12	3.651	0.000353	0.075678	4	0.020728	yes	BRNNCC
chr1_1241217_T_C_b38	RP5-902P8.12	3.635	0.000374	0.078866	3	0.021697	yes	BRNNCC
chr1_1201373_T_C_b38	RP5-902P8.12	3.63	0.00038	0.066236	15	0.018246	yes	BRNNCC
chr1_1173996_G_A_b38	RP5-902P8.12	3.621	0.000393	0.079954	4	0.022082	yes	BRNNCC
chr1_1187088_T_C_b38	RP5-902P8.12	3.621	0.000393	0.064919	9	0.01793	yes	BRNNCC
chr1_1175206_T_C_b38	RP5-902P8.12	3.616	4e-04	0.056735	38	0.015689	yes	BRNNCC
chr1_1244603_G_A_b38	RP5-902P8.12	3.61	0.000409	0.076801	4	0.021276	yes	BRNNCC
chr1_1236303_A_G_b38	RP5-902P8.12	3.604	0.000417	0.068508	6	0.019006	yes	BRNNCC
chr1_1243650_G_A_b38	RP5-902P8.12	3.593	0.000434	0.076804	4	0.021376	yes	BRNNCC
chr1_1241639_T_C_b38	RP5-902P8.12	3.592	0.000435	0.07669	3	0.021348	yes	BRNNCC
chr1_1242094_A_G_b38	RP5-902P8.12	3.591	0.000437	0.074818	4	0.020836	yes	BRNNCC
chr1_1242250_A_G_b38	RP5-902P8.12	3.591	0.000437	0.074818	4	0.020836	yes	BRNNCC
chr1_1173724_G_T_b38	RP5-902P8.12	3.589	0.000441	0.079981	4	0.022287	yes	BRNNCC
chr1_1223568_A_G_b38	RP5-902P8.12	3.547	0.00051	0.074036	4	0.020872	yes	BRNNCC
chr1_1258206_AT_A_b38	RP5-902P8.12	3.533	0.000536	0.057723	23	0.016338	yes	BRNNCC
chr1_1219858_G_A_b38	RP5-902P8.12	3.53	0.000542	0.065871	9	0.01866	yes	BRNNCC
chr1_1186277_T_C_b38	RP5-902P8.12	3.517	0.000568	0.063327	9	0.018008	yes	BRNNCC
chr1_1178191_A_G_b38	RP5-902P8.12	3.515	0.000572	0.073742	4	0.020981	yes	BRNNCC
chr1_1174845_C_T_b38	RP5-902P8.12	3.505	0.000591	0.078159	4	0.022299	yes	BRNNCC
chr1_1239126_C_CT_b38	RP5-902P8.12	3.474	0.000658	0.071847	3	0.020678	yes	BRNNCC
chr1_1239127_A_ACATGCATCC_b38	RP5-902P8.12	3.474	0.000658	0.071847	3	0.020678	yes	BRNNCC
chr1_1239574_T_C_b38	RP5-902P8.12	3.474	0.000658	0.071847	3	0.020678	yes	BRNNCC
chr1_1186455_C_CTG_b38	RP5-902P8.12	3.471	0.000666	0.061891	10	0.017831	yes	BRNNCC
chr1_1225476_T_C_b38	RP5-902P8.12	3.444	0.00073	0.072265	4	0.020981	yes	BRNNCC
chr1_1226013_C_T_b38	RP5-902P8.12	3.444	0.00073	0.072265	4	0.020981	yes	BRNNCC
chr1_1174174_G_C_b38	RP5-902P8.12	3.419	0.000796	0.075877	4	0.022193	yes	BRNNCC
chr1_1180931_A_G_b38	RP5-902P8.12	3.419	0.000797	0.052992	38	0.015501	yes	BRNNCC
chr1_1173931_G_A_b38	RP5-902P8.12	3.409	0.000825	0.074705	4	0.021916	yes	BRNNCC
chr1_1173935_C_G_b38	RP5-902P8.12	3.409	0.000825	0.074705	4	0.021916	yes	BRNNCC
chr1_1223644_C_T_b38	RP5-902P8.12	3.395	0.000863	0.072302	3	0.021294	yes	BRNNCC
chr1_1222580_T_C_b38	RP5-902P8.12	3.395	0.000865	0.072635	3	0.021395	yes	BRNNCC
chr1_1222594_A_G_b38	RP5-902P8.12	3.395	0.000865	0.072635	3	0.021395	yes	BRNNCC
chr1_1202905_C_G_b38	RP5-902P8.12	3.382	0.000904	0.07255	3	0.021454	yes	BRNNCC
chr1_1194826_G_A_b38	RP5-902P8.12	3.365	0.000957	0.059708	10	0.017743	yes	BRNNCC
chr1_1182018_A_G_b38	RP5-902P8.12	3.35	0.00101	0.053337	35	0.01592	yes	BRNNCC
chr1_1190173_A_T_b38	RP5-902P8.12	3.337	0.00105	0.060046	9	0.017993	yes	BRNNCC
chr1_1193141_C_T_b38	RP5-902P8.12	3.337	0.00105	0.060046	9	0.017993	yes	BRNNCC
chr1_1259424_T_C_b38	RP5-902P8.12	3.317	0.00113	0.056695	24	0.017094	yes	BRNNCC
chr1_1174578_A_G_b38	RP5-902P8.12	3.298	0.0012	0.069826	4	0.02117	yes	BRNNCC
chr1_1373006_G_A_b38	RP5-902P8.12	3.294	0.00121	0.068582	3	0.02082	yes	BRNNCC
chr1_1373007_G_A_b38	RP5-902P8.12	3.294	0.00121	0.068582	3	0.02082	yes	BRNNCC
chr1_1308178_GGGGCGCGGGGA_G_b38	RP5-902P8.12	3.28	0.00127	0.062218	8	0.018972	yes	BRNNCC
chr1_1177741_G_A_b38	RP5-902P8.12	3.274	0.0013	0.069809	4	0.021323	yes	BRNNCC
chr1_1290968_C_G_b38	RP5-902P8.12	3.268	0.00132	0.064804	13	0.019829	yes	BRNNCC
chr1_1240367_A_G_b38	RP5-902P8.12	3.254	0.00139	0.067699	3	0.020805	yes	BRNNCC
chr1_1288085_GC_G_b38	RP5-902P8.12	3.251	0.0014	0.066488	4	0.020449	yes	BRNNCC
chr1_1191757_A_C_b38	RP5-902P8.12	3.246	0.00142	0.068821	3	0.0212	yes	BRNNCC
chr1_2212668_A_G_b38	RP5-902P8.12	3.234	0.00148	0.06938	5	0.021454	yes	BRNNCC
chr1_1370113_A_G_b38	RP5-902P8.12	-3.2	0.00166	-0.051851	20	0.016204	yes	BRNNCC
chr1_1173138_T_C_b38	RP5-902P8.12	3.144	0.00199	0.066397	4	0.02112	yes	BRNNCC
chr1_1235642_G_C_b38	RP5-902P8.12	3.099	0.0023	0.064851	3	0.02093	yes	BRNNCC
chr1_1175607_T_TC_b38	RP5-902P8.12	3.068	0.00253	0.06554	4	0.021361	yes	BRNNCC
chr1_1220751_T_C_b38	RP5-902P8.12	3.007	0.00306	0.059153	6	0.019669	yes	BRNNCC
chr1_1379091_T_G_b38	RP5-902P8.12	-2.956	0.00359	-0.054179	8	0.01833	yes	BRNNCC
chr1_1772160_A_AT_b38	RP5-902P8.12	-2.884	0.00447	-0.059279	3	0.020558	yes	BRNNCC
chr1_1411323_A_C_b38	RP5-902P8.12	2.869	0.00467	0.049322	26	0.017191	yes	BRNNCC
chr1_1174273_G_A_b38	RP5-902P8.12	2.86	0.0048	0.060364	4	0.021109	yes	BRNNCC
chr1_1290261_C_A_b38	RP5-902P8.12	2.843	0.00505	0.061088	12	0.021489	yes	BRNNCC
chr1_1982325_C_T_b38	RP5-902P8.12	-2.832	0.00522	-0.056802	5	0.020058	yes	BRNNCC
chr1_1248062_A_G_b38	RP5-902P8.12	2.815	0.00549	0.068099	3	0.024193	yes	BRNNCC
chr1_1248063_T_C_b38	RP5-902P8.12	2.815	0.00549	0.068099	3	0.024193	yes	BRNNCC
chr1_1248068_A_C_b38	RP5-902P8.12	2.815	0.00549	0.068099	3	0.024193	yes	BRNNCC
chr1_1248069_A_C_b38	RP5-902P8.12	2.815	0.00549	0.068099	3	0.024193	yes	BRNNCC
chr1_1248075_A_C_b38	RP5-902P8.12	2.815	0.00549	0.068099	3	0.024193	yes	BRNNCC
chr1_1248091_G_A_b38	RP5-902P8.12	2.815	0.00549	0.068099	3	0.024193	yes	BRNNCC
chr1_1248092_T_C_b38	RP5-902P8.12	2.815	0.00549	0.068099	3	0.024193	yes	BRNNCC
chr1_1379093_TG_T_b38	RP5-902P8.12	2.803	0.00569	0.05606	6	0.02	yes	BRNNCC
chr1_1367511_ATGAG_A_b38	RP5-902P8.12	2.794	0.00584	0.055859	4	0.019993	yes	BRNNCC
chr1_2205125_C_A_b38	RP5-902P8.12	2.767	0.00631	0.045722	20	0.016521	yes	BRNNCC
chr1_1173872_A_G_b38	RP5-902P8.12	2.76	0.00644	0.042142	24	0.015267	yes	BRNNCC
chr1_1366776_G_GAATT_b38	RP5-902P8.12	2.746	0.00671	0.054445	5	0.019824	yes	BRNNCC
chr1_1184478_C_T_b38	RP5-902P8.12	2.739	0.00685	0.068944	6	0.025168	yes	BRNNCC
chr1_1366681_T_TGA_b38	RP5-902P8.12	2.708	0.0075	0.053446	5	0.019737	yes	BRNNCC
chr1_1341550_GCA_G_b38	RP5-902P8.12	2.684	0.00804	0.052825	6	0.019682	yes	BRNNCC
chr1_1382893_G_A_b38	RP5-902P8.12	2.682	0.00807	0.051976	7	0.019376	yes	BRNNCC
chr1_1366427_AGTGTGATTGAATGAGT_A_b38	RP5-902P8.12	-2.682	0.00809	-0.045175	19	0.016846	yes	BRNNCC
chr1_1378204_G_C_b38	RP5-902P8.12	-2.679	0.00815	-0.044555	22	0.01663	yes	BRNNCC
chr1_1196039_C_G_b38	RP5-902P8.12	2.661	0.00858	0.055802	7	0.02097	yes	BRNNCC
chr1_1898648_CACACACATAAGTTGGATAT_C_b38	RP5-902P8.12	-2.643	0.00903	-0.043366	14	0.016409	yes	BRNNCC
chr1_1384546_C_T_b38	RP5-902P8.12	2.642	0.00905	0.051399	7	0.019452	yes	BRNNCC
chr1_1398218_C_A_b38	RP5-902P8.12	2.642	0.00905	0.051399	7	0.019452	yes	BRNNCC
chr1_1400756_GGA_G_b38	RP5-902P8.12	2.642	0.00905	0.051399	7	0.019452	yes	BRNNCC
chr1_1401954_G_T_b38	RP5-902P8.12	2.642	0.00905	0.051399	7	0.019452	yes	BRNNCC
chr1_1403593_A_G_b38	RP5-902P8.12	2.642	0.00905	0.051399	7	0.019452	yes	BRNNCC
chr1_1407565_C_A_b38	RP5-902P8.12	2.642	0.00905	0.051399	7	0.019452	yes	BRNNCC
chr1_1383743_T_C_b38	RP5-902P8.12	2.634	0.00926	0.051185	7	0.019433	yes	BRNNCC
chr1_1370430_T_C_b38	RP5-902P8.12	2.617	0.00972	0.051037	6	0.019504	yes	BRNNCC
chr1_1370532_C_T_b38	RP5-902P8.12	2.617	0.00972	0.051037	6	0.019504	yes	BRNNCC
chr1_1370584_G_C_b38	RP5-902P8.12	2.617	0.00972	0.051037	6	0.019504	yes	BRNNCC
chr1_1372909_G_A_b38	RP5-902P8.12	2.617	0.00972	0.051037	6	0.019504	yes	BRNNCC
chr1_1181009_A_AGCCCCTGCCCCTGCCCCTGAACCC_b38	RP5-902P8.12	2.614	0.0098	0.063589	4	0.024328	yes	BRNNCC
chr1_1243102_A_G_b38	RP5-902P8.12	3.596	0.00043	0.07558	5	0.02102	no	BRNNCC
chr1_1251618_G_A_b38	RP5-902P8.12	3.535	0.000534	0.073088	5	0.020678	no	BRNNCC
chr1_1242865_C_T_b38	RP5-902P8.12	3.345	0.00102	0.070327	5	0.021023	no	BRNNCC
chr1_1379083_AT_A_b38	RP5-902P8.12	-3.303	0.00118	-0.054794	15	0.016588	no	BRNNCC
chr1_1235997_A_G_b38	RP5-902P8.12	3.274	0.0013	0.067871	4	0.020727	no	BRNNCC
chr1_1313807_G_A_b38	RP5-902P8.12	-3.163	0.00187	-0.053385	25	0.016879	no	BRNNCC
chr1_1976566_T_C_b38	RP5-902P8.12	-3.16	0.00189	-0.044971	38	0.014232	no	BRNNCC
chr1_1174639_A_G_b38	RP5-902P8.12	3.122	0.00213	0.064529	5	0.020669	no	BRNNCC
chr1_1358384_G_C_b38	RP5-902P8.12	-3.064	0.00256	-0.0519	24	0.016939	no	BRNNCC
chr1_1330125_G_A_b38	RP5-902P8.12	-3.023	0.00291	-0.051281	25	0.016964	no	BRNNCC
chr1_1968793_T_C_b38	RP5-902P8.12	-3.022	0.00292	-0.04605	39	0.015237	no	BRNNCC
chr1_1252613_C_G_b38	RP5-902P8.12	3.021	0.00293	0.068926	3	0.022814	no	BRNNCC
chr1_1402457_A_G_b38	RP5-902P8.12	3.015	0.00299	0.051372	24	0.01704	no	BRNNCC
chr1_1387698_A_G_b38	RP5-902P8.12	-3.015	0.00299	-0.051372	24	0.01704	no	BRNNCC
chr1_1389827_C_T_b38	RP5-902P8.12	-3.003	0.0031	-0.050914	23	0.016955	no	BRNNCC
chr1_1394423_A_G_b38	RP5-902P8.12	3.003	0.0031	0.050914	23	0.016955	no	BRNNCC
chr1_1395346_A_G_b38	RP5-902P8.12	3.003	0.0031	0.050914	23	0.016955	no	BRNNCC
chr1_1366561_AGT_A_b38	RP5-902P8.12	-2.996	0.00317	-0.05054	23	0.016869	no	BRNNCC
chr1_1309988_G_A_b38	RP5-902P8.12	-2.978	0.00335	-0.050398	25	0.016924	no	BRNNCC
chr1_1312114_T_C_b38	RP5-902P8.12	-2.978	0.00335	-0.050398	25	0.016924	no	BRNNCC
chr1_1175611_G_C_b38	RP5-902P8.12	2.933	0.00385	0.062956	4	0.021466	no	BRNNCC
chr1_1308516_C_T_b38	RP5-902P8.12	-2.915	0.00407	-0.049653	25	0.017035	no	BRNNCC
chr1_1963538_T_C_b38	RP5-902P8.12	-2.857	0.00485	-0.043658	40	0.015284	no	BRNNCC
chr1_1963533_C_CA_b38	RP5-902P8.12	-2.819	0.00542	-0.042788	41	0.015177	no	BRNNCC
chr1_1606559_C_CGGCTGGTCAGGCGTGGGGCGGGCTGGTCAGGCGTGGGGCG_b38	RP5-902P8.12	2.77	0.00627	0.091763	3	0.03313	no	BRNNCC
chr1_1363456_CAG_C_b38	RP5-902P8.12	-2.767	0.00632	-0.044101	17	0.015938	no	BRNNCC
chr1_1818305_TAAAAAAA_T_b38	RP5-902P8.12	-2.761	0.00643	-0.06098	3	0.022087	no	BRNNCC
chr1_1376162_G_C_b38	RP5-902P8.12	-2.73	0.00703	-0.045965	21	0.016835	no	BRNNCC
chr1_1377431_C_T_b38	RP5-902P8.12	-2.73	0.00703	-0.045965	21	0.016835	no	BRNNCC
chr1_1184277_G_C_b38	RP5-902P8.12	2.727	0.00709	0.044026	36	0.016142	no	BRNNCC
chr1_588022_A_G_b38	RP5-902P8.12	-2.717	0.00731	-0.058074	7	0.021373	no	BRNNCC
chr1_1967499_G_A_b38	RP5-902P8.12	-2.694	0.00781	-0.041156	40	0.015276	no	BRNNCC
chr1_1400410_A_G_b38	RP5-902P8.12	2.684	0.00803	0.045406	20	0.016915	no	BRNNCC
chr1_1883278_C_CA_b38	RP5-902P8.12	-2.68	0.00813	-0.057783	5	0.021561	no	BRNNCC
chr1_588011_C_T_b38	RP5-902P8.12	-2.662	0.00857	-0.056164	6	0.021101	no	BRNNCC
chr1_1746440_A_G_b38	RP5-902P8.12	2.641	0.00909	0.048868	10	0.018507	no	BRNNCC
chr1_1384749_C_G_b38	RP5-902P8.12	-2.636	0.00922	-0.04455	21	0.016903	no	BRNNCC
chr1_1387763_CCT_C_b38	RP5-902P8.12	-2.636	0.00922	-0.04455	21	0.016903	no	BRNNCC
chr1_1388944_G_A_b38	RP5-902P8.12	-2.636	0.00922	-0.04455	21	0.016903	no	BRNNCC
chr1_1306523_C_G_b38	RP5-902P8.12	-2.633	0.00929	-0.066333	6	0.025194	no	BRNNCC
chr1_1367954_A_C_b38	RP5-902P8.12	2.618	0.00969	0.065625	3	0.025067	no	BRNNCC
chr1_1340697_G_A_b38	RP5-902P8.12	-2.616	0.00974	-0.045216	13	0.017283	no	BRNNCC
chr1_1943487_C_G_b38	RP5-902P8.12	-2.615	0.00977	-0.04507	12	0.017234	no	BRNNCC
chr1_1970506_T_A_b38	RP5-902P8.12	2.61	0.0099	0.038994	34	0.014938	no	BRNNCC
chr1_1223568_A_G_b38	RP5-902P8.12	5.231	6.63e-07	0.108822	4	0.020803	yes	BRNPTM
chr1_1221960_A_G_b38	RP5-902P8.12	5.231	6.64e-07	0.110526	3	0.021131	yes	BRNPTM
chr1_1221992_G_A_b38	RP5-902P8.12	5.231	6.64e-07	0.110526	3	0.021131	yes	BRNPTM
chr1_1222167_T_C_b38	RP5-902P8.12	5.231	6.64e-07	0.110526	3	0.021131	yes	BRNPTM
chr1_1222184_G_A_b38	RP5-902P8.12	5.231	6.64e-07	0.110526	3	0.021131	yes	BRNPTM
chr1_1222245_C_T_b38	RP5-902P8.12	5.231	6.64e-07	0.110526	3	0.021131	yes	BRNPTM
chr1_1222251_G_A_b38	RP5-902P8.12	5.231	6.64e-07	0.110526	3	0.021131	yes	BRNPTM
chr1_1222304_C_T_b38	RP5-902P8.12	5.231	6.64e-07	0.110526	3	0.021131	yes	BRNPTM
chr1_1222325_C_G_b38	RP5-902P8.12	5.231	6.64e-07	0.110526	3	0.021131	yes	BRNPTM
chr1_1222454_C_T_b38	RP5-902P8.12	5.231	6.64e-07	0.110526	3	0.021131	yes	BRNPTM
chr1_1222482_C_T_b38	RP5-902P8.12	5.231	6.64e-07	0.110526	3	0.021131	yes	BRNPTM
chr1_1222579_C_T_b38	RP5-902P8.12	5.231	6.64e-07	0.110526	3	0.021131	yes	BRNPTM
chr1_1222580_T_C_b38	RP5-902P8.12	5.231	6.64e-07	0.110526	3	0.021131	yes	BRNPTM
chr1_1222594_A_G_b38	RP5-902P8.12	5.231	6.64e-07	0.110526	3	0.021131	yes	BRNPTM
chr1_1222611_G_A_b38	RP5-902P8.12	5.231	6.64e-07	0.110526	3	0.021131	yes	BRNPTM
chr1_1222640_A_C_b38	RP5-902P8.12	5.231	6.64e-07	0.110526	3	0.021131	yes	BRNPTM
chr1_1222897_G_A_b38	RP5-902P8.12	5.231	6.64e-07	0.110526	3	0.021131	yes	BRNPTM
chr1_1222946_G_A_b38	RP5-902P8.12	5.231	6.64e-07	0.110526	3	0.021131	yes	BRNPTM
chr1_1222977_A_G_b38	RP5-902P8.12	5.231	6.64e-07	0.110526	3	0.021131	yes	BRNPTM
chr1_1223154_G_GAC_b38	RP5-902P8.12	5.231	6.64e-07	0.110526	3	0.021131	yes	BRNPTM
chr1_1223182_AAC_A_b38	RP5-902P8.12	5.231	6.64e-07	0.110526	3	0.021131	yes	BRNPTM
chr1_1223593_A_T_b38	RP5-902P8.12	5.231	6.64e-07	0.110526	3	0.021131	yes	BRNPTM
chr1_1223595_A_C_b38	RP5-902P8.12	5.231	6.64e-07	0.110526	3	0.021131	yes	BRNPTM
chr1_1223682_T_C_b38	RP5-902P8.12	5.231	6.64e-07	0.110526	3	0.021131	yes	BRNPTM
chr1_1223727_G_A_b38	RP5-902P8.12	5.231	6.64e-07	0.110526	3	0.021131	yes	BRNPTM
chr1_1224105_C_T_b38	RP5-902P8.12	5.231	6.64e-07	0.110526	3	0.021131	yes	BRNPTM
chr1_1224349_T_G_b38	RP5-902P8.12	5.231	6.64e-07	0.110526	3	0.021131	yes	BRNPTM
chr1_1224844_C_T_b38	RP5-902P8.12	5.231	6.64e-07	0.110526	3	0.021131	yes	BRNPTM
chr1_1224846_A_G_b38	RP5-902P8.12	5.231	6.64e-07	0.110526	3	0.021131	yes	BRNPTM
chr1_1225429_T_C_b38	RP5-902P8.12	5.231	6.64e-07	0.110526	3	0.021131	yes	BRNPTM
chr1_1225720_CGCCACAGACACGGGCCACACACTCCACAT_C_b38	RP5-902P8.12	5.231	6.64e-07	0.110526	3	0.021131	yes	BRNPTM
chr1_1225982_A_G_b38	RP5-902P8.12	5.231	6.64e-07	0.110526	3	0.021131	yes	BRNPTM
chr1_1226261_G_A_b38	RP5-902P8.12	5.231	6.64e-07	0.110526	3	0.021131	yes	BRNPTM
chr1_1226334_AC_A_b38	RP5-902P8.12	5.231	6.64e-07	0.110526	3	0.021131	yes	BRNPTM
chr1_1226338_TGTACGGTCAGGAGGAAACATGGCACCTCCCCTCTGGGGGCTCTTTCCAGAAACCCTCAACCC_T_b38	RP5-902P8.12	5.231	6.64e-07	0.110526	3	0.021131	yes	BRNPTM
chr1_1227055_C_A_b38	RP5-902P8.12	5.231	6.64e-07	0.110526	3	0.021131	yes	BRNPTM
chr1_1227161_G_C_b38	RP5-902P8.12	5.231	6.64e-07	0.110526	3	0.021131	yes	BRNPTM
chr1_1227792_T_C_b38	RP5-902P8.12	5.231	6.64e-07	0.110526	3	0.021131	yes	BRNPTM
chr1_1227975_T_C_b38	RP5-902P8.12	5.231	6.64e-07	0.110526	3	0.021131	yes	BRNPTM
chr1_1229160_G_T_b38	RP5-902P8.12	5.231	6.64e-07	0.110526	3	0.021131	yes	BRNPTM
chr1_1229307_G_C_b38	RP5-902P8.12	5.231	6.64e-07	0.110526	3	0.021131	yes	BRNPTM
chr1_1229900_GCA_G_b38	RP5-902P8.12	5.231	6.64e-07	0.110526	3	0.021131	yes	BRNPTM
chr1_1229940_CAT_C_b38	RP5-902P8.12	5.231	6.64e-07	0.110526	3	0.021131	yes	BRNPTM
chr1_1229981_A_G_b38	RP5-902P8.12	5.231	6.64e-07	0.110526	3	0.021131	yes	BRNPTM
chr1_1230091_T_C_b38	RP5-902P8.12	5.231	6.64e-07	0.110526	3	0.021131	yes	BRNPTM
chr1_1230345_A_G_b38	RP5-902P8.12	5.231	6.64e-07	0.110526	3	0.021131	yes	BRNPTM
chr1_1230441_T_C_b38	RP5-902P8.12	5.231	6.64e-07	0.110526	3	0.021131	yes	BRNPTM
chr1_1230695_G_A_b38	RP5-902P8.12	5.231	6.64e-07	0.110526	3	0.021131	yes	BRNPTM
chr1_1230797_G_C_b38	RP5-902P8.12	5.231	6.64e-07	0.110526	3	0.021131	yes	BRNPTM
chr1_1230825_C_T_b38	RP5-902P8.12	5.231	6.64e-07	0.110526	3	0.021131	yes	BRNPTM
chr1_1209119_GGA_G_b38	RP5-902P8.12	5.191	7.92e-07	0.116099	3	0.022366	yes	BRNPTM
chr1_1209273_G_A_b38	RP5-902P8.12	5.191	7.92e-07	0.116099	3	0.022366	yes	BRNPTM
chr1_1209316_T_C_b38	RP5-902P8.12	5.191	7.92e-07	0.116099	3	0.022366	yes	BRNPTM
chr1_1210031_G_A_b38	RP5-902P8.12	5.191	7.92e-07	0.116099	3	0.022366	yes	BRNPTM
chr1_1210061_A_G_b38	RP5-902P8.12	5.191	7.92e-07	0.116099	3	0.022366	yes	BRNPTM
chr1_1210087_C_G_b38	RP5-902P8.12	5.191	7.92e-07	0.116099	3	0.022366	yes	BRNPTM
chr1_1210386_C_G_b38	RP5-902P8.12	5.191	7.92e-07	0.116099	3	0.022366	yes	BRNPTM
chr1_1211863_A_C_b38	RP5-902P8.12	5.191	7.92e-07	0.116099	3	0.022366	yes	BRNPTM
chr1_1211917_G_A_b38	RP5-902P8.12	5.191	7.92e-07	0.116099	3	0.022366	yes	BRNPTM
chr1_1240390_G_A_b38	RP5-902P8.12	5.18	8.32e-07	0.115335	3	0.022266	yes	BRNPTM
chr1_1212390_G_A_b38	RP5-902P8.12	5.163	8.98e-07	0.116334	3	0.022534	yes	BRNPTM
chr1_1214801_G_C_b38	RP5-902P8.12	5.105	1.16e-06	0.113675	3	0.022267	yes	BRNPTM
chr1_1215068_T_C_b38	RP5-902P8.12	5.105	1.16e-06	0.113675	3	0.022267	yes	BRNPTM
chr1_1219159_G_A_b38	RP5-902P8.12	5.105	1.16e-06	0.113675	3	0.022267	yes	BRNPTM
chr1_1224783_G_A_b38	RP5-902P8.12	5.06	1.41e-06	0.10639	3	0.021024	yes	BRNPTM
chr1_1226620_G_GC_b38	RP5-902P8.12	5.055	1.44e-06	0.106036	3	0.020977	yes	BRNPTM
chr1_1226892_C_T_b38	RP5-902P8.12	5.055	1.44e-06	0.106036	3	0.020977	yes	BRNPTM
chr1_1226901_G_A_b38	RP5-902P8.12	5.055	1.44e-06	0.106036	3	0.020977	yes	BRNPTM
chr1_1235869_T_C_b38	RP5-902P8.12	5.049	1.48e-06	0.109869	3	0.021761	yes	BRNPTM
chr1_1224281_GTTTTA_G_b38	RP5-902P8.12	5.021	1.67e-06	0.111126	3	0.022131	yes	BRNPTM
chr1_1227886_G_A_b38	RP5-902P8.12	5.021	1.67e-06	0.111126	3	0.022131	yes	BRNPTM
chr1_1230250_G_A_b38	RP5-902P8.12	5.021	1.67e-06	0.111126	3	0.022131	yes	BRNPTM
chr1_1238883_G_A_b38	RP5-902P8.12	5.021	1.67e-06	0.111126	3	0.022131	yes	BRNPTM
chr1_1225476_T_C_b38	RP5-902P8.12	4.995	1.87e-06	0.105744	4	0.02117	yes	BRNPTM
chr1_1226013_C_T_b38	RP5-902P8.12	4.995	1.87e-06	0.105744	4	0.02117	yes	BRNPTM
chr1_1225285_G_A_b38	RP5-902P8.12	4.97	2.08e-06	0.107038	3	0.021535	yes	BRNPTM
chr1_1239925_G_A_b38	RP5-902P8.12	4.923	2.56e-06	0.109352	3	0.022213	yes	BRNPTM
chr1_1202905_C_G_b38	RP5-902P8.12	4.92	2.59e-06	0.109742	4	0.022306	yes	BRNPTM
chr1_1210101_CAA_C_b38	RP5-902P8.12	4.893	2.91e-06	0.104198	3	0.021295	yes	BRNPTM
chr1_1217733_G_A_b38	RP5-902P8.12	4.838	3.68e-06	0.094162	6	0.019463	yes	BRNPTM
chr1_1223640_A_G_b38	RP5-902P8.12	4.786	4.58e-06	0.102964	3	0.021512	yes	BRNPTM
chr1_1223644_C_T_b38	RP5-902P8.12	4.786	4.58e-06	0.102964	3	0.021512	yes	BRNPTM
chr1_1228069_T_C_b38	RP5-902P8.12	4.786	4.58e-06	0.102964	3	0.021512	yes	BRNPTM
chr1_1214831_G_A_b38	RP5-902P8.12	4.76	5.12e-06	0.105466	3	0.022157	yes	BRNPTM
chr1_1226486_C_T_b38	RP5-902P8.12	4.755	5.23e-06	0.091365	5	0.019215	yes	BRNPTM
chr1_1231710_CCCCCGGGAA_C_b38	RP5-902P8.12	4.702	6.51e-06	0.091142	6	0.019382	yes	BRNPTM
chr1_1221275_G_A_b38	RP5-902P8.12	4.693	6.77e-06	0.101687	3	0.021668	yes	BRNPTM
chr1_1221355_T_C_b38	RP5-902P8.12	4.693	6.77e-06	0.101687	3	0.021668	yes	BRNPTM
chr1_1216708_CT_C_b38	RP5-902P8.12	4.661	7.74e-06	0.101684	3	0.021817	yes	BRNPTM
chr1_1235602_C_A_b38	RP5-902P8.12	4.498	1.51e-05	0.090743	5	0.020176	yes	BRNPTM
chr1_1219941_C_T_b38	RP5-902P8.12	4.486	1.59e-05	0.10071	4	0.022452	yes	BRNPTM
chr1_1236303_A_G_b38	RP5-902P8.12	4.416	2.11e-05	0.085496	6	0.019362	yes	BRNPTM
chr1_1226936_G_T_b38	RP5-902P8.12	4.398	2.27e-05	0.096823	3	0.022017	yes	BRNPTM
chr1_1229369_G_GC_b38	RP5-902P8.12	4.266	3.83e-05	0.080792	8	0.018941	yes	BRNPTM
chr1_1239126_C_CT_b38	RP5-902P8.12	4.153	5.94e-05	0.089078	4	0.021452	yes	BRNPTM
chr1_1239127_A_ACATGCATCC_b38	RP5-902P8.12	4.153	5.94e-05	0.089078	4	0.021452	yes	BRNPTM
chr1_1239574_T_C_b38	RP5-902P8.12	4.153	5.94e-05	0.089078	4	0.021452	yes	BRNPTM
chr1_1216593_G_C_b38	RP5-902P8.12	4.146	6.08e-05	0.078615	7	0.01896	yes	BRNPTM
chr1_1185978_A_C_b38	RP5-902P8.12	4.125	6.59e-05	0.094767	3	0.022972	yes	BRNPTM
chr1_1228424_C_T_b38	RP5-902P8.12	4.083	7.75e-05	0.080699	5	0.019764	yes	BRNPTM
chr1_1240367_A_G_b38	RP5-902P8.12	4.011	0.000102	0.085374	4	0.021286	yes	BRNPTM
chr1_1186100_T_C_b38	RP5-902P8.12	4	0.000106	0.091162	3	0.022793	yes	BRNPTM
chr1_1231507_T_C_b38	RP5-902P8.12	3.955	0.000125	0.078253	5	0.019785	yes	BRNPTM
chr1_1186850_G_GT_b38	RP5-902P8.12	3.849	0.000186	0.086873	3	0.022571	yes	BRNPTM
chr1_1248905_G_C_b38	RP5-902P8.12	3.846	0.000188	0.109087	3	0.028364	yes	BRNPTM
chr1_1230159_G_A_b38	RP5-902P8.12	3.828	2e-04	0.072947	13	0.019054	yes	BRNPTM
chr1_1235642_G_C_b38	RP5-902P8.12	3.818	0.000208	0.084116	3	0.022034	yes	BRNPTM
chr1_1187536_A_G_b38	RP5-902P8.12	3.793	0.000228	0.086301	3	0.022756	yes	BRNPTM
chr1_1187557_G_A_b38	RP5-902P8.12	3.793	0.000228	0.086301	3	0.022756	yes	BRNPTM
chr1_1215852_T_C_b38	RP5-902P8.12	3.732	0.000283	0.070369	8	0.018853	yes	BRNPTM
chr1_1186335_C_T_b38	RP5-902P8.12	3.716	0.000301	0.083564	3	0.022489	yes	BRNPTM
chr1_1186903_T_G_b38	RP5-902P8.12	3.716	0.000301	0.083564	3	0.022489	yes	BRNPTM
chr1_1192365_G_GAGTGTAGACACTCCAGTTGGTATA_b38	RP5-902P8.12	3.714	0.000303	0.111546	3	0.030034	yes	BRNPTM
chr1_1187159_A_G_b38	RP5-902P8.12	3.593	0.000464	0.081302	3	0.022629	yes	BRNPTM
chr1_1189439_C_T_b38	RP5-902P8.12	3.593	0.000464	0.081302	3	0.022629	yes	BRNPTM
chr1_1189840_C_T_b38	RP5-902P8.12	3.593	0.000464	0.081302	3	0.022629	yes	BRNPTM
chr1_1191721_C_A_b38	RP5-902P8.12	3.593	0.000464	0.081302	3	0.022629	yes	BRNPTM
chr1_1192228_G_GT_b38	RP5-902P8.12	3.593	0.000464	0.081302	3	0.022629	yes	BRNPTM
chr1_1193742_G_C_b38	RP5-902P8.12	3.593	0.000464	0.081302	3	0.022629	yes	BRNPTM
chr1_1194409_G_C_b38	RP5-902P8.12	3.593	0.000464	0.081302	3	0.022629	yes	BRNPTM
chr1_1194540_G_A_b38	RP5-902P8.12	3.593	0.000464	0.081302	3	0.022629	yes	BRNPTM
chr1_1195347_A_C_b38	RP5-902P8.12	3.593	0.000464	0.081302	3	0.022629	yes	BRNPTM
chr1_1195475_T_C_b38	RP5-902P8.12	3.593	0.000464	0.081302	3	0.022629	yes	BRNPTM
chr1_1195672_C_T_b38	RP5-902P8.12	3.593	0.000464	0.081302	3	0.022629	yes	BRNPTM
chr1_1191950_C_T_b38	RP5-902P8.12	3.541	0.000556	0.08059	3	0.022761	yes	BRNPTM
chr1_1191757_A_C_b38	RP5-902P8.12	3.372	0.000985	0.074527	4	0.022101	yes	BRNPTM
chr1_1186455_C_CTG_b38	RP5-902P8.12	3.115	0.00227	0.059853	9	0.019215	yes	BRNPTM
chr1_1238902_T_C_b38	RP5-902P8.12	3.104	0.00235	0.05431	24	0.017496	yes	BRNPTM
chr1_1246371_T_C_b38	RP5-902P8.12	3.074	0.00258	0.069123	6	0.022485	yes	BRNPTM
chr1_1186277_T_C_b38	RP5-902P8.12	3.033	0.00292	0.058499	9	0.019284	yes	BRNPTM
chr1_1236037_C_T_b38	RP5-902P8.12	2.98	0.00344	0.049194	33	0.016507	yes	BRNPTM
chr1_1217251_C_A_b38	RP5-902P8.12	2.944	0.00384	0.060561	6	0.020568	yes	BRNPTM
chr1_1248864_T_C_b38	RP5-902P8.12	2.931	0.004	0.068807	5	0.023477	yes	BRNPTM
chr1_1196039_C_G_b38	RP5-902P8.12	2.929	0.00402	0.061765	7	0.021084	yes	BRNPTM
chr1_1187088_T_C_b38	RP5-902P8.12	2.921	0.00411	0.056413	9	0.01931	yes	BRNPTM
chr1_1219858_G_A_b38	RP5-902P8.12	2.866	0.00485	0.054244	10	0.018925	yes	BRNPTM
chr1_1190173_A_T_b38	RP5-902P8.12	2.822	0.00553	0.054019	9	0.019145	yes	BRNPTM
chr1_1193141_C_T_b38	RP5-902P8.12	2.822	0.00553	0.054019	9	0.019145	yes	BRNPTM
chr1_967384_C_G_b38	RP5-902P8.12	2.796	0.00597	0.046986	31	0.016806	yes	BRNPTM
chr1_828389_A_AT_b38	RP5-902P8.12	2.783	0.0062	0.055729	14	0.020028	yes	BRNPTM
chr1_975555_G_A_b38	RP5-902P8.12	-2.776	0.00632	-0.059104	5	0.021289	yes	BRNPTM
chr1_960375_A_AG_b38	RP5-902P8.12	2.742	0.00697	0.067113	9	0.024475	yes	BRNPTM
chr1_1251356_AT_A_b38	RP5-902P8.12	2.721	0.00741	0.061944	4	0.022768	yes	BRNPTM
chr1_1248686_A_G_b38	RP5-902P8.12	4.766	4.98e-06	0.115171	3	0.024164	no	BRNPTM
chr1_1235997_A_G_b38	RP5-902P8.12	4.608	9.64e-06	0.096019	5	0.020838	no	BRNPTM
chr1_1252613_C_G_b38	RP5-902P8.12	4.232	4.36e-05	0.096347	3	0.022765	no	BRNPTM
chr1_1248709_A_G_b38	RP5-902P8.12	4.056	8.58e-05	0.096632	3	0.023824	no	BRNPTM
chr1_1238231_G_A_b38	RP5-902P8.12	3.946	0.00013	0.07352	10	0.018631	no	BRNPTM
chr1_1240580_G_GC_b38	RP5-902P8.12	3.891	0.000159	0.081082	4	0.020836	no	BRNPTM
chr1_1243650_G_A_b38	RP5-902P8.12	3.538	0.000561	0.080189	3	0.022664	no	BRNPTM
chr1_1221049_C_G_b38	RP5-902P8.12	3.375	0.000974	0.060572	20	0.017945	no	BRNPTM
chr1_1244603_G_A_b38	RP5-902P8.12	3.339	0.0011	0.076339	3	0.022864	no	BRNPTM
chr1_1251285_G_A_b38	RP5-902P8.12	3.316	0.00119	0.070657	6	0.021307	no	BRNPTM
chr1_1251368_T_C_b38	RP5-902P8.12	3.316	0.00119	0.070657	6	0.021307	no	BRNPTM
chr1_1251618_G_A_b38	RP5-902P8.12	3.283	0.00132	0.070941	5	0.021611	no	BRNPTM
chr1_871922_A_ATT_b38	RP5-902P8.12	-3.114	0.00227	-0.066193	5	0.021253	no	BRNPTM
chr1_1241217_T_C_b38	RP5-902P8.12	3.101	0.00237	0.072235	3	0.023293	no	BRNPTM
chr1_1479704_G_A_b38	RP5-902P8.12	3.006	0.00318	0.081129	3	0.02699	no	BRNPTM
chr1_1251122_A_T_b38	RP5-902P8.12	2.979	0.00346	0.05841	10	0.019607	no	BRNPTM
chr1_1243102_A_G_b38	RP5-902P8.12	2.938	0.00392	0.067307	4	0.022913	no	BRNPTM
chr1_889689_G_C_b38	RP5-902P8.12	2.918	0.00415	0.061656	10	0.021127	no	BRNPTM
chr1_1205055_G_T_b38	RP5-902P8.12	2.895	0.00445	0.049216	27	0.016999	no	BRNPTM
chr1_1201373_T_C_b38	RP5-902P8.12	2.882	0.00463	0.056004	15	0.019434	no	BRNPTM
chr1_1249880_A_G_b38	RP5-902P8.12	2.858	0.00497	0.057919	9	0.020264	no	BRNPTM
chr1_1194826_G_A_b38	RP5-902P8.12	2.839	0.00525	0.052946	10	0.018647	no	BRNPTM
chr1_1242865_C_T_b38	RP5-902P8.12	2.809	0.00574	0.063584	4	0.022636	no	BRNPTM
chr1_1672015_G_C_b38	RP5-902P8.12	-2.709	0.00767	-0.12708	3	0.046912	no	BRNPTM
chr1_1236303_A_G_b38	RP5-902P8.12	4.27	4.45e-05	0.168897	3	0.039553	yes	BRNSPC
chr1_1239126_C_CT_b38	RP5-902P8.12	4.055	9.95e-05	0.166404	3	0.041039	yes	BRNSPC
chr1_1239127_A_ACATGCATCC_b38	RP5-902P8.12	4.055	9.95e-05	0.166404	3	0.041039	yes	BRNSPC
chr1_1239574_T_C_b38	RP5-902P8.12	4.055	9.95e-05	0.166404	3	0.041039	yes	BRNSPC
chr1_1240367_A_G_b38	RP5-902P8.12	4.055	9.95e-05	0.166404	3	0.041039	yes	BRNSPC
chr1_1473134_C_CT_b38	RP5-902P8.12	4.008	0.000118	0.192532	3	0.048031	yes	BRNSPC
chr1_1201373_T_C_b38	RP5-902P8.12	3.812	0.000238	0.138926	8	0.036444	yes	BRNSPC
chr1_1308178_GGGGCGCGGGGA_G_b38	RP5-902P8.12	3.781	0.000266	0.144543	4	0.038227	yes	BRNSPC
chr1_1231507_T_C_b38	RP5-902P8.12	3.751	0.000295	0.146111	3	0.038953	yes	BRNSPC
chr1_1228424_C_T_b38	RP5-902P8.12	3.517	0.000659	0.137974	3	0.039234	yes	BRNSPC
chr1_1215852_T_C_b38	RP5-902P8.12	3.511	0.00067	0.133064	4	0.037894	yes	BRNSPC
chr1_1235642_G_C_b38	RP5-902P8.12	3.511	0.000672	0.145786	3	0.041525	yes	BRNSPC
chr1_1238231_G_A_b38	RP5-902P8.12	3.47	0.00077	0.131456	5	0.037884	yes	BRNSPC
chr1_1229369_G_GC_b38	RP5-902P8.12	3.462	0.000789	0.131743	4	0.038049	yes	BRNSPC
chr1_1185978_A_C_b38	RP5-902P8.12	3.426	0.000889	0.142117	3	0.041478	yes	BRNSPC
chr1_2078844_C_CT_b38	RP5-902P8.12	3.415	0.000923	0.165011	4	0.048321	yes	BRNSPC
chr1_1216593_G_C_b38	RP5-902P8.12	3.35	0.00114	0.127717	4	0.03812	yes	BRNSPC
chr1_1924011_A_G_b38	RP5-902P8.12	-3.349	0.00115	-0.150425	3	0.044918	yes	BRNSPC
chr1_1920497_C_A_b38	RP5-902P8.12	-3.313	0.00129	-0.13293	5	0.040123	yes	BRNSPC
chr1_1191757_A_C_b38	RP5-902P8.12	3.308	0.00131	0.140464	3	0.042464	yes	BRNSPC
chr1_1915143_A_G_b38	RP5-902P8.12	-3.237	0.00164	-0.136063	4	0.042036	yes	BRNSPC
chr1_1188054_T_A_b38	RP5-902P8.12	3.235	0.00165	0.125818	5	0.03889	yes	BRNSPC
chr1_1922882_A_G_b38	RP5-902P8.12	-3.227	0.00169	-0.1351	4	0.041872	yes	BRNSPC
chr1_1925261_C_T_b38	RP5-902P8.12	-3.227	0.00169	-0.1351	4	0.041872	yes	BRNSPC
chr1_1931519_A_G_b38	RP5-902P8.12	-3.227	0.00169	-0.1351	4	0.041872	yes	BRNSPC
chr1_1205055_G_T_b38	RP5-902P8.12	3.21	0.00178	0.115293	18	0.035914	yes	BRNSPC
chr1_1958353_A_T_b38	RP5-902P8.12	-3.184	0.00194	-0.138307	3	0.043445	yes	BRNSPC
chr1_1955580_A_G_b38	RP5-902P8.12	-3.181	0.00195	-0.137191	3	0.043124	yes	BRNSPC
chr1_1772160_A_AT_b38	RP5-902P8.12	3.148	0.00217	0.139107	3	0.044194	yes	BRNSPC
chr1_1954783_T_G_b38	RP5-902P8.12	-3.081	0.00266	-0.13356	3	0.043344	yes	BRNSPC
chr1_1954946_T_C_b38	RP5-902P8.12	-3.081	0.00266	-0.13356	3	0.043344	yes	BRNSPC
chr1_1957586_A_G_b38	RP5-902P8.12	-3.081	0.00266	-0.13356	3	0.043344	yes	BRNSPC
chr1_1846651_T_G_b38	RP5-902P8.12	3.081	0.00266	0.129752	4	0.042113	yes	BRNSPC
chr1_1782906_T_G_b38	RP5-902P8.12	3.052	0.00291	0.128897	4	0.042227	yes	BRNSPC
chr1_1934734_C_G_b38	RP5-902P8.12	-3.04	0.00302	-0.096782	14	0.031832	yes	BRNSPC
chr1_1219858_G_A_b38	RP5-902P8.12	3.018	0.00323	0.126146	3	0.041795	yes	BRNSPC
chr1_1855245_G_A_b38	RP5-902P8.12	3.003	0.00338	0.129515	4	0.04313	yes	BRNSPC
chr1_1855939_G_A_b38	RP5-902P8.12	3.003	0.00338	0.129515	4	0.04313	yes	BRNSPC
chr1_1857246_T_TAA_b38	RP5-902P8.12	3.003	0.00338	0.129515	4	0.04313	yes	BRNSPC
chr1_1857250_C_G_b38	RP5-902P8.12	3.003	0.00338	0.129515	4	0.04313	yes	BRNSPC
chr1_1857305_G_GGGCT_b38	RP5-902P8.12	3.003	0.00338	0.129515	4	0.04313	yes	BRNSPC
chr1_1871210_G_T_b38	RP5-902P8.12	3.003	0.00338	0.129515	4	0.04313	yes	BRNSPC
chr1_1882915_C_T_b38	RP5-902P8.12	3.001	0.00339	0.127792	4	0.042579	yes	BRNSPC
chr1_1221049_C_G_b38	RP5-902P8.12	2.994	0.00347	0.106898	14	0.035705	yes	BRNSPC
chr1_1903242_C_T_b38	RP5-902P8.12	2.985	0.00357	0.128881	4	0.043181	yes	BRNSPC
chr1_1903577_C_T_b38	RP5-902P8.12	2.985	0.00357	0.128881	4	0.043181	yes	BRNSPC
chr1_1906935_C_T_b38	RP5-902P8.12	2.985	0.00357	0.128881	4	0.043181	yes	BRNSPC
chr1_1909167_G_A_b38	RP5-902P8.12	2.985	0.00357	0.128881	4	0.043181	yes	BRNSPC
chr1_1888382_A_AG_b38	RP5-902P8.12	2.982	0.0036	0.13989	4	0.046915	yes	BRNSPC
chr1_1195463_A_G_b38	RP5-902P8.12	2.941	0.00406	0.109848	10	0.037346	yes	BRNSPC
chr1_1881065_G_A_b38	RP5-902P8.12	2.924	0.00428	0.124658	4	0.042635	yes	BRNSPC
chr1_1881798_C_T_b38	RP5-902P8.12	2.924	0.00428	0.124658	4	0.042635	yes	BRNSPC
chr1_1886690_A_C_b38	RP5-902P8.12	2.924	0.00428	0.124658	4	0.042635	yes	BRNSPC
chr1_1775996_G_A_b38	RP5-902P8.12	2.92	0.00433	0.123468	4	0.04229	yes	BRNSPC
chr1_1798974_C_T_b38	RP5-902P8.12	2.92	0.00433	0.123468	4	0.04229	yes	BRNSPC
chr1_1822247_A_G_b38	RP5-902P8.12	2.92	0.00433	0.123468	4	0.04229	yes	BRNSPC
chr1_1837340_C_T_b38	RP5-902P8.12	2.92	0.00433	0.123468	4	0.04229	yes	BRNSPC
chr1_1892085_G_C_b38	RP5-902P8.12	2.892	0.0047	0.123673	4	0.042769	yes	BRNSPC
chr1_1898043_T_C_b38	RP5-902P8.12	2.861	0.00515	0.121622	4	0.042516	yes	BRNSPC
chr1_1898712_C_T_b38	RP5-902P8.12	2.861	0.00515	0.121622	4	0.042516	yes	BRNSPC
chr1_1899188_T_A_b38	RP5-902P8.12	2.861	0.00515	0.121622	4	0.042516	yes	BRNSPC
chr1_1290841_A_G_b38	RP5-902P8.12	2.846	0.00538	0.12712	7	0.044673	yes	BRNSPC
chr1_1775296_C_T_b38	RP5-902P8.12	2.842	0.00543	0.123235	4	0.043355	yes	BRNSPC
chr1_1815255_G_T_b38	RP5-902P8.12	2.842	0.00543	0.123235	4	0.043355	yes	BRNSPC
chr1_1801188_T_C_b38	RP5-902P8.12	2.769	0.0067	0.113595	4	0.041022	yes	BRNSPC
chr1_1880594_A_T_b38	RP5-902P8.12	2.706	0.00802	0.118107	4	0.043654	yes	BRNSPC
chr1_1794187_C_T_b38	RP5-902P8.12	2.682	0.00856	0.115549	4	0.043082	yes	BRNSPC
chr1_1953616_C_T_b38	RP5-902P8.12	-2.656	0.00921	-0.108516	11	0.040861	yes	BRNSPC
chr1_1259424_T_C_b38	RP5-902P8.12	2.654	0.00927	0.107424	10	0.040484	yes	BRNSPC
chr1_1194826_G_A_b38	RP5-902P8.12	2.636	0.00972	0.100943	5	0.038291	yes	BRNSPC
chr1_1864334_AAAG_A_b38	RP5-902P8.12	-2.635	0.00976	-0.092074	11	0.034947	yes	BRNSPC
chr1_1898648_CACACACATAAGTTGGATAT_C_b38	RP5-902P8.12	2.628	0.00993	0.093545	9	0.035589	yes	BRNSPC
chr1_1938493_C_CAT_b38	RP5-902P8.12	-3.075	0.00272	-0.12574	5	0.040894	no	BRNSPC
chr1_1938771_G_A_b38	RP5-902P8.12	-3.075	0.00272	-0.12574	5	0.040894	no	BRNSPC
chr1_1939978_T_C_b38	RP5-902P8.12	-3.075	0.00272	-0.12574	5	0.040894	no	BRNSPC
chr1_1943706_C_T_b38	RP5-902P8.12	-3.075	0.00272	-0.12574	5	0.040894	no	BRNSPC
chr1_1943828_A_G_b38	RP5-902P8.12	-3.075	0.00272	-0.12574	5	0.040894	no	BRNSPC
chr1_1945799_T_G_b38	RP5-902P8.12	-3.075	0.00272	-0.12574	5	0.040894	no	BRNSPC
chr1_1897985_C_G_b38	RP5-902P8.12	3.009	0.00332	0.119377	5	0.039672	no	BRNSPC
chr1_1910289_C_T_b38	RP5-902P8.12	3.001	0.0034	0.119043	5	0.039669	no	BRNSPC
chr1_1910369_G_A_b38	RP5-902P8.12	3.001	0.0034	0.119043	5	0.039669	no	BRNSPC
chr1_1910480_G_A_b38	RP5-902P8.12	3.001	0.0034	0.119043	5	0.039669	no	BRNSPC
chr1_1912140_T_G_b38	RP5-902P8.12	2.99	0.00351	0.118901	5	0.039764	no	BRNSPC
chr1_1943142_A_G_b38	RP5-902P8.12	-2.977	0.00365	-0.121158	5	0.040702	no	BRNSPC
chr1_455038_T_C_b38	RP5-902P8.12	-2.967	0.00376	-0.127003	6	0.042799	no	BRNSPC
chr1_1241053_A_G_b38	RP5-902P8.12	2.949	0.00397	0.133199	3	0.045171	no	BRNSPC
chr1_1242094_A_G_b38	RP5-902P8.12	2.949	0.00397	0.133199	3	0.045171	no	BRNSPC
chr1_1242250_A_G_b38	RP5-902P8.12	2.949	0.00397	0.133199	3	0.045171	no	BRNSPC
chr1_1242865_C_T_b38	RP5-902P8.12	2.949	0.00397	0.133199	3	0.045171	no	BRNSPC
chr1_1243102_A_G_b38	RP5-902P8.12	2.949	0.00397	0.133199	3	0.045171	no	BRNSPC
chr1_1249880_A_G_b38	RP5-902P8.12	2.843	0.00543	0.117838	3	0.041455	no	BRNSPC
chr1_1246371_T_C_b38	RP5-902P8.12	2.769	0.00671	0.126459	3	0.045675	no	BRNSPC
chr1_1776772_TA_T_b38	RP5-902P8.12	2.768	0.00671	0.112002	4	0.040456	no	BRNSPC
chr1_1945913_T_C_b38	RP5-902P8.12	-2.745	0.00719	-0.111081	5	0.040474	no	BRNSPC
chr1_1230159_G_A_b38	RP5-902P8.12	2.71	0.00792	0.094879	11	0.03501	no	BRNSPC
chr1_897376_T_G_b38	RP5-902P8.12	3.984	0.000139	0.089456	4	0.022454	yes	BRNSNG
chr1_1050070_G_A_b38	RP5-902P8.12	3.943	0.000161	0.078783	23	0.019983	yes	BRNSNG
chr1_1023525_A_G_b38	RP5-902P8.12	3.864	0.000213	0.079561	13	0.020592	yes	BRNSNG
chr1_1023351_A_G_b38	RP5-902P8.12	3.731	0.000337	0.076525	13	0.020508	yes	BRNSNG
chr1_1050063_AG_A_b38	RP5-902P8.12	3.636	0.000466	0.072954	24	0.020066	yes	BRNSNG
chr1_1023573_A_G_b38	RP5-902P8.12	3.604	0.000519	0.072521	15	0.020125	yes	BRNSNG
chr1_904478_CGCCTCCTCCGAACGCGGCCGCCTCCTCCTCCGAACGTGGCCTCCTCCGAACGCGGCCGCCTCCTCCTCCGAACGCGGCCGCCTCCTCCTCCGAACGTG_C_b38	RP5-902P8.12	3.54	0.000641	0.08582	3	0.024241	yes	BRNSNG
chr1_1057439_G_A_b38	RP5-902P8.12	-3.504	0.000724	-0.073143	25	0.020876	yes	BRNSNG
chr1_1057980_C_A_b38	RP5-902P8.12	-3.442	0.000885	-0.074281	27	0.021578	yes	BRNSNG
chr1_1020681_A_AG_b38	RP5-902P8.12	3.432	0.000915	0.071857	9	0.020938	yes	BRNSNG
chr1_1020697_C_T_b38	RP5-902P8.12	3.432	0.000915	0.071857	9	0.020938	yes	BRNSNG
chr1_1063661_ATG_A_b38	RP5-902P8.12	-3.387	0.00106	-0.072869	23	0.021516	yes	BRNSNG
chr1_1034279_G_A_b38	RP5-902P8.12	3.382	0.00108	0.068882	13	0.02037	yes	BRNSNG
chr1_1069577_G_A_b38	RP5-902P8.12	-3.378	0.00109	-0.07096	22	0.021005	yes	BRNSNG
chr1_1069600_G_A_b38	RP5-902P8.12	-3.378	0.00109	-0.07096	22	0.021005	yes	BRNSNG
chr1_1026084_G_T_b38	RP5-902P8.12	3.371	0.00111	0.068479	13	0.020314	yes	BRNSNG
chr1_1032846_C_A_b38	RP5-902P8.12	3.366	0.00113	0.068041	14	0.020212	yes	BRNSNG
chr1_1070843_G_A_b38	RP5-902P8.12	-3.353	0.00118	-0.069286	23	0.020663	yes	BRNSNG
chr1_1022868_A_G_b38	RP5-902P8.12	3.334	0.00125	0.068474	14	0.020537	yes	BRNSNG
chr1_1052514_C_CGT_b38	RP5-902P8.12	-3.318	0.00132	-0.066983	24	0.020188	yes	BRNSNG
chr1_1024462_C_T_b38	RP5-902P8.12	3.218	0.00181	0.065102	14	0.020231	yes	BRNSNG
chr1_1025561_G_C_b38	RP5-902P8.12	3.216	0.00182	0.063861	14	0.019857	yes	BRNSNG
chr1_1025970_C_T_b38	RP5-902P8.12	3.216	0.00182	0.063861	14	0.019857	yes	BRNSNG
chr1_1075707_CG_C_b38	RP5-902P8.12	-3.203	0.0019	-0.065632	22	0.020492	yes	BRNSNG
chr1_1240580_G_GC_b38	RP5-902P8.12	3.201	0.00191	0.075504	5	0.023591	yes	BRNSNG
chr1_1050069_G_A_b38	RP5-902P8.12	-3.145	0.00226	-0.065747	26	0.020903	yes	BRNSNG
chr1_1072052_G_A_b38	RP5-902P8.12	-3.123	0.00242	-0.063817	25	0.020432	yes	BRNSNG
chr1_1067673_C_T_b38	RP5-902P8.12	-3.103	0.00258	-0.069667	18	0.022451	yes	BRNSNG
chr1_896109_C_T_b38	RP5-902P8.12	-3.1	0.0026	-0.070162	6	0.022635	yes	BRNSNG
chr1_1021740_G_C_b38	RP5-902P8.12	3.08	0.00276	0.063149	11	0.020503	yes	BRNSNG
chr1_896529_C_T_b38	RP5-902P8.12	-3.044	0.00308	-0.06718	6	0.02207	yes	BRNSNG
chr1_897538_T_C_b38	RP5-902P8.12	3.044	0.00308	0.06718	6	0.02207	yes	BRNSNG
chr1_1073854_T_C_b38	RP5-902P8.12	-3.027	0.00324	-0.061811	23	0.020421	yes	BRNSNG
chr1_896680_G_A_b38	RP5-902P8.12	-3.019	0.00332	-0.068466	5	0.02268	yes	BRNSNG
chr1_896686_G_C_b38	RP5-902P8.12	-3.019	0.00332	-0.068466	5	0.02268	yes	BRNSNG
chr1_896732_T_C_b38	RP5-902P8.12	-3.019	0.00332	-0.068466	5	0.02268	yes	BRNSNG
chr1_896798_A_G_b38	RP5-902P8.12	-3.019	0.00332	-0.068466	5	0.02268	yes	BRNSNG
chr1_896917_CTG_C_b38	RP5-902P8.12	-3.019	0.00332	-0.068466	5	0.02268	yes	BRNSNG
chr1_896938_C_A_b38	RP5-902P8.12	-3.019	0.00332	-0.068466	5	0.02268	yes	BRNSNG
chr1_897792_T_TCGAA_b38	RP5-902P8.12	3.019	0.00332	0.068466	5	0.02268	yes	BRNSNG
chr1_1083182_C_T_b38	RP5-902P8.12	-2.98	0.00372	-0.060393	24	0.020264	yes	BRNSNG
chr1_1075337_C_T_b38	RP5-902P8.12	-2.958	0.00397	-0.060581	20	0.020477	yes	BRNSNG
chr1_1022518_G_T_b38	RP5-902P8.12	2.933	0.00427	0.059207	13	0.020183	yes	BRNSNG
chr1_894801_A_G_b38	RP5-902P8.12	-2.921	0.00443	-0.059773	9	0.020462	yes	BRNSNG
chr1_1079746_A_G_b38	RP5-902P8.12	-2.92	0.00445	-0.060224	21	0.020625	yes	BRNSNG
chr1_1060101_T_G_b38	RP5-902P8.12	-2.914	0.00453	-0.065585	27	0.022511	yes	BRNSNG
chr1_1018652_C_G_b38	RP5-902P8.12	2.876	0.00506	0.059918	11	0.020836	yes	BRNSNG
chr1_1018754_G_A_b38	RP5-902P8.12	2.876	0.00506	0.059918	11	0.020836	yes	BRNSNG
chr1_1048922_T_C_b38	RP5-902P8.12	-2.867	0.00518	-0.057949	26	0.020209	yes	BRNSNG
chr1_1020217_G_T_b38	RP5-902P8.12	2.802	0.00624	0.057925	11	0.02067	yes	BRNSNG
chr1_1083324_A_G_b38	RP5-902P8.12	-2.785	0.00656	-0.056356	22	0.020237	yes	BRNSNG
chr1_897843_C_T_b38	RP5-902P8.12	2.763	0.00698	0.066343	3	0.024013	yes	BRNSNG
chr1_897922_C_T_b38	RP5-902P8.12	2.763	0.00698	0.066343	3	0.024013	yes	BRNSNG
chr1_898261_T_C_b38	RP5-902P8.12	2.763	0.00698	0.066343	3	0.024013	yes	BRNSNG
chr1_898279_T_A_b38	RP5-902P8.12	2.763	0.00698	0.066343	3	0.024013	yes	BRNSNG
chr1_898283_A_G_b38	RP5-902P8.12	2.763	0.00698	0.066343	3	0.024013	yes	BRNSNG
chr1_898444_T_C_b38	RP5-902P8.12	2.763	0.00698	0.066343	3	0.024013	yes	BRNSNG
chr1_1063202_G_C_b38	RP5-902P8.12	-2.762	0.00699	-0.062058	24	0.022468	yes	BRNSNG
chr1_1079877_A_G_b38	RP5-902P8.12	-2.76	0.00704	-0.057517	20	0.020841	yes	BRNSNG
chr1_1067054_C_T_b38	RP5-902P8.12	-2.76	0.00704	-0.063449	17	0.022992	yes	BRNSNG
chr1_1079484_T_A_b38	RP5-902P8.12	-2.743	0.00737	-0.056145	23	0.020467	yes	BRNSNG
chr1_892786_A_G_b38	RP5-902P8.12	2.735	0.00754	0.063018	6	0.023041	yes	BRNSNG
chr1_1082764_T_C_b38	RP5-902P8.12	-2.724	0.00778	-0.055482	23	0.020367	yes	BRNSNG
chr1_904947_G_A_b38	RP5-902P8.12	2.662	0.00924	0.064956	4	0.024404	yes	BRNSNG
chr1_900119_A_G_b38	RP5-902P8.12	2.652	0.0095	0.063641	4	0.024	yes	BRNSNG
chr1_1055037_T_C_b38	RP5-902P8.12	4.283	4.69e-05	0.088057	14	0.020559	no	BRNSNG
chr1_1054900_C_T_b38	RP5-902P8.12	-4.231	5.69e-05	-0.089524	15	0.02116	no	BRNSNG
chr1_1055000_C_T_b38	RP5-902P8.12	3.996	0.000134	0.081124	13	0.020303	no	BRNSNG
chr1_1039411_T_TGGG_b38	RP5-902P8.12	3.198	0.00192	0.077213	6	0.024145	no	BRNSNG
chr1_1524664_A_G_b38	RP5-902P8.12	2.93	0.00432	0.080934	11	0.027625	no	BRNSNG
chr1_1063121_G_C_b38	RP5-902P8.12	2.828	0.0058	0.078292	3	0.027685	no	BRNSNG
chr1_1081817_C_T_b38	RP5-902P8.12	-2.823	0.00588	-0.057829	25	0.020486	no	BRNSNG
chr1_1513923_G_C_b38	RP5-902P8.12	2.819	0.00595	0.080355	11	0.028503	no	BRNSNG
chr1_1516000_T_C_b38	RP5-902P8.12	2.819	0.00595	0.080355	11	0.028503	no	BRNSNG
chr1_1530331_T_C_b38	RP5-902P8.12	2.819	0.00595	0.080355	11	0.028503	no	BRNSNG
chr1_1079456_A_G_b38	RP5-902P8.12	-2.8	0.00628	-0.057898	25	0.020677	no	BRNSNG
chr1_1070426_C_T_b38	RP5-902P8.12	2.714	0.008	0.076041	3	0.028019	no	BRNSNG
chr1_1080171_C_T_b38	RP5-902P8.12	-2.679	0.00882	-0.054496	23	0.020344	no	BRNSNG
chr1_1933640_C_T_b38	RP5-902P8.12	2.657	0.00935	0.103413	3	0.038917	no	BRNSNG
chr1_1111365_CAA_C_b38	RP5-902P8.12	4.605	5.94e-06	0.078648	11	0.01708	yes	BREAST
chr1_1118344_A_G_b38	RP5-902P8.12	3.719	0.000236	0.059487	19	0.015996	yes	BREAST
chr1_1118696_C_T_b38	RP5-902P8.12	3.719	0.000236	0.059487	19	0.015996	yes	BREAST
chr1_1118290_G_A_b38	RP5-902P8.12	3.695	0.000258	0.05925	19	0.016034	yes	BREAST
chr1_1115274_C_CA_b38	RP5-902P8.12	3.602	0.000365	0.057892	20	0.016072	yes	BREAST
chr1_1111994_T_A_b38	RP5-902P8.12	3.59	0.000382	0.057445	20	0.016001	yes	BREAST
chr1_1742119_CA_C_b38	RP5-902P8.12	-3.585	0.000389	-0.053378	25	0.01489	yes	BREAST
chr1_1095185_C_T_b38	RP5-902P8.12	3.577	4e-04	0.055474	20	0.015506	yes	BREAST
chr1_1120968_G_A_b38	RP5-902P8.12	3.509	0.000513	0.056366	16	0.016064	yes	BREAST
chr1_1119513_T_C_b38	RP5-902P8.12	3.5	0.00053	0.056178	20	0.016051	yes	BREAST
chr1_1095253_G_A_b38	RP5-902P8.12	3.498	0.000534	0.054129	21	0.015474	yes	BREAST
chr1_1097574_A_G_b38	RP5-902P8.12	3.498	0.000534	0.054129	21	0.015474	yes	BREAST
chr1_1098246_C_G_b38	RP5-902P8.12	3.485	0.00056	0.053217	19	0.01527	yes	BREAST
chr1_1101933_A_G_b38	RP5-902P8.12	3.462	0.000608	0.05607	20	0.016196	yes	BREAST
chr1_1105444_T_C_b38	RP5-902P8.12	3.462	0.000608	0.05607	20	0.016196	yes	BREAST
chr1_1114570_A_G_b38	RP5-902P8.12	3.462	0.000608	0.05607	20	0.016196	yes	BREAST
chr1_1118777_T_C_b38	RP5-902P8.12	3.444	0.000648	0.085038	11	0.02469	yes	BREAST
chr1_1098290_T_C_b38	RP5-902P8.12	3.437	0.000666	0.052816	23	0.015369	yes	BREAST
chr1_1119514_G_A_b38	RP5-902P8.12	3.427	0.000688	0.085386	8	0.024913	yes	BREAST
chr1_1120771_G_A_b38	RP5-902P8.12	3.427	0.000688	0.085386	8	0.024913	yes	BREAST
chr1_1120821_T_G_b38	RP5-902P8.12	3.427	0.000688	0.085386	8	0.024913	yes	BREAST
chr1_1096593_C_T_b38	RP5-902P8.12	3.421	0.000703	0.052933	21	0.015472	yes	BREAST
chr1_1098216_T_C_b38	RP5-902P8.12	3.421	0.000703	0.052933	21	0.015472	yes	BREAST
chr1_1098300_T_A_b38	RP5-902P8.12	3.421	0.000703	0.052933	21	0.015472	yes	BREAST
chr1_1098614_C_T_b38	RP5-902P8.12	3.421	0.000703	0.052933	21	0.015472	yes	BREAST
chr1_1098820_T_C_b38	RP5-902P8.12	3.421	0.000703	0.052933	21	0.015472	yes	BREAST
chr1_1110693_C_A_b38	RP5-902P8.12	3.418	0.00071	0.054276	15	0.015878	yes	BREAST
chr1_1013466_T_TA_b38	RP5-902P8.12	-3.406	0.000743	-0.087067	10	0.025566	yes	BREAST
chr1_1118779_C_T_b38	RP5-902P8.12	3.393	0.000776	0.083967	10	0.024744	yes	BREAST
chr1_1118835_A_G_b38	RP5-902P8.12	3.393	0.000776	0.083967	10	0.024744	yes	BREAST
chr1_1119363_C_G_b38	RP5-902P8.12	3.393	0.000776	0.083967	10	0.024744	yes	BREAST
chr1_1121335_C_T_b38	RP5-902P8.12	3.364	0.000861	0.054521	19	0.016209	yes	BREAST
chr1_1094425_A_G_b38	RP5-902P8.12	3.356	0.000884	0.051817	22	0.01544	yes	BREAST
chr1_1113121_G_A_b38	RP5-902P8.12	3.333	0.00096	0.0528	15	0.015844	yes	BREAST
chr1_1102708_G_C_b38	RP5-902P8.12	3.304	0.00106	0.052734	18	0.01596	yes	BREAST
chr1_1105414_G_A_b38	RP5-902P8.12	3.304	0.00106	0.052734	18	0.01596	yes	BREAST
chr1_1106320_A_G_b38	RP5-902P8.12	3.304	0.00106	0.052734	18	0.01596	yes	BREAST
chr1_1110784_C_T_b38	RP5-902P8.12	3.304	0.00106	0.052734	18	0.01596	yes	BREAST
chr1_1118491_T_C_b38	RP5-902P8.12	3.288	0.00112	0.083644	7	0.025439	yes	BREAST
chr1_1118832_C_T_b38	RP5-902P8.12	3.288	0.00112	0.083644	7	0.025439	yes	BREAST
chr1_1120626_G_A_b38	RP5-902P8.12	3.288	0.00112	0.083644	7	0.025439	yes	BREAST
chr1_1092465_T_G_b38	RP5-902P8.12	3.251	0.00127	0.050565	19	0.015555	yes	BREAST
chr1_1092466_T_C_b38	RP5-902P8.12	3.251	0.00127	0.050565	19	0.015555	yes	BREAST
chr1_1101480_A_C_b38	RP5-902P8.12	3.221	0.00141	0.051318	18	0.015933	yes	BREAST
chr1_1101923_T_C_b38	RP5-902P8.12	3.221	0.00141	0.051318	18	0.015933	yes	BREAST
chr1_1101987_G_A_b38	RP5-902P8.12	3.221	0.00141	0.051318	18	0.015933	yes	BREAST
chr1_1103617_ACTC_A_b38	RP5-902P8.12	3.221	0.00141	0.051318	18	0.015933	yes	BREAST
chr1_1103888_T_C_b38	RP5-902P8.12	3.221	0.00141	0.051318	18	0.015933	yes	BREAST
chr1_1104437_A_G_b38	RP5-902P8.12	3.221	0.00141	0.051318	18	0.015933	yes	BREAST
chr1_1104646_T_C_b38	RP5-902P8.12	3.221	0.00141	0.051318	18	0.015933	yes	BREAST
chr1_1105092_C_T_b38	RP5-902P8.12	3.221	0.00141	0.051318	18	0.015933	yes	BREAST
chr1_1105560_A_C_b38	RP5-902P8.12	3.221	0.00141	0.051318	18	0.015933	yes	BREAST
chr1_1105605_C_G_b38	RP5-902P8.12	3.221	0.00141	0.051318	18	0.015933	yes	BREAST
chr1_1105739_G_GGGCGTGGT_b38	RP5-902P8.12	3.221	0.00141	0.051318	18	0.015933	yes	BREAST
chr1_1106406_T_C_b38	RP5-902P8.12	3.221	0.00141	0.051318	18	0.015933	yes	BREAST
chr1_1107547_G_T_b38	RP5-902P8.12	3.221	0.00141	0.051318	18	0.015933	yes	BREAST
chr1_1107673_A_G_b38	RP5-902P8.12	3.221	0.00141	0.051318	18	0.015933	yes	BREAST
chr1_1107882_T_C_b38	RP5-902P8.12	3.221	0.00141	0.051318	18	0.015933	yes	BREAST
chr1_1107293_C_T_b38	RP5-902P8.12	3.219	0.00141	0.05113	19	0.015881	yes	BREAST
chr1_1107103_C_T_b38	RP5-902P8.12	3.207	0.00148	0.051291	18	0.015994	yes	BREAST
chr1_1113191_A_G_b38	RP5-902P8.12	3.182	0.00161	0.051215	14	0.016098	yes	BREAST
chr1_1011654_G_A_b38	RP5-902P8.12	-3.176	0.00164	-0.075137	10	0.023656	yes	BREAST
chr1_1106998_A_C_b38	RP5-902P8.12	3.171	0.00167	0.050089	19	0.015798	yes	BREAST
chr1_1116728_A_G_b38	RP5-902P8.12	3.109	0.00204	0.078622	7	0.025287	yes	BREAST
chr1_1114769_G_A_b38	RP5-902P8.12	3.099	0.00211	0.076054	8	0.024539	yes	BREAST
chr1_1108232_CAG_C_b38	RP5-902P8.12	3.091	0.00217	0.060589	7	0.019604	yes	BREAST
chr1_1116304_A_C_b38	RP5-902P8.12	3.066	0.00235	0.074679	10	0.024356	yes	BREAST
chr1_1113260_C_A_b38	RP5-902P8.12	2.957	0.00333	0.074061	7	0.025043	yes	BREAST
chr1_1113344_A_C_b38	RP5-902P8.12	2.957	0.00333	0.074061	7	0.025043	yes	BREAST
chr1_1718313_T_G_b38	RP5-902P8.12	-2.944	0.00347	-0.048342	15	0.016418	yes	BREAST
chr1_1010232_C_T_b38	RP5-902P8.12	-2.907	0.0039	-0.069374	8	0.023864	yes	BREAST
chr1_1092879_C_T_b38	RP5-902P8.12	2.861	0.0045	0.050063	12	0.017499	yes	BREAST
chr1_1115166_G_GT_b38	RP5-902P8.12	2.855	0.00458	0.069055	11	0.024185	yes	BREAST
chr1_1718311_A_T_b38	RP5-902P8.12	-2.836	0.00486	-0.047676	13	0.016813	yes	BREAST
chr1_1108242_G_A_b38	RP5-902P8.12	2.831	0.00493	0.056073	6	0.019806	yes	BREAST
chr1_1010755_T_G_b38	RP5-902P8.12	-2.829	0.00496	-0.060295	9	0.021312	yes	BREAST
chr1_858567_A_G_b38	RP5-902P8.12	2.814	0.0052	0.059583	5	0.021176	yes	BREAST
chr1_858571_A_C_b38	RP5-902P8.12	2.814	0.0052	0.059583	5	0.021176	yes	BREAST
chr1_1108235_CA_C_b38	RP5-902P8.12	2.81	0.00526	0.056103	6	0.019967	yes	BREAST
chr1_1236037_C_T_b38	RP5-902P8.12	2.795	0.0055	0.035174	71	0.012585	yes	BREAST
chr1_1120062_A_G_b38	RP5-902P8.12	2.793	0.00553	0.073369	8	0.026271	yes	BREAST
chr1_1010481_ATTAT_A_b38	RP5-902P8.12	-2.789	0.0056	-0.068273	9	0.024479	yes	BREAST
chr1_1717507_T_C_b38	RP5-902P8.12	-2.754	0.00622	-0.054153	13	0.019662	yes	BREAST
chr1_1109108_ACCACAGCCAAAAGGTGGGAGCAAGTGTCCAC_A_b38	RP5-902P8.12	2.75	0.00629	0.045564	16	0.016569	yes	BREAST
chr1_922063_C_T_b38	RP5-902P8.12	2.741	0.00646	0.094645	5	0.034524	yes	BREAST
chr1_1716247_A_C_b38	RP5-902P8.12	-2.718	0.00692	-0.056821	13	0.020905	yes	BREAST
chr1_1731904_CA_C_b38	RP5-902P8.12	2.707	0.00715	0.040644	32	0.015016	yes	BREAST
chr1_1379894_CA_C_b38	RP5-902P8.12	-2.663	0.00813	-0.050941	3	0.01913	yes	BREAST
chr1_1009731_C_T_b38	RP5-902P8.12	-2.643	0.00861	-0.063506	9	0.024026	yes	BREAST
chr1_1013855_G_A_b38	RP5-902P8.12	-2.631	0.00893	-0.061902	6	0.02353	yes	BREAST
chr1_1722446_C_A_b38	RP5-902P8.12	-2.625	0.00907	-0.059357	7	0.02261	yes	BREAST
chr1_1704916_A_G_b38	RP5-902P8.12	2.612	0.00942	0.053145	11	0.020347	yes	BREAST
chr1_1101579_T_C_b38	RP5-902P8.12	2.608	0.00953	0.048051	7	0.018426	yes	BREAST
chr1_1715218_T_C_b38	RP5-902P8.12	-2.607	0.00956	-0.05203	17	0.019959	yes	BREAST
chr1_1087765_G_A_b38	RP5-902P8.12	2.607	0.00957	0.047033	6	0.018045	yes	BREAST
chr1_1071842_G_T_b38	RP5-902P8.12	2.605	0.00962	0.047194	8	0.018119	yes	BREAST
chr1_1734812_G_A_b38	RP5-902P8.12	-4.499	9.5e-06	-0.068972	44	0.015329	no	BREAST
chr1_1114143_C_A_b38	RP5-902P8.12	3.295	0.00109	0.079018	11	0.023983	no	BREAST
chr1_1103993_C_CT_b38	RP5-902P8.12	3.279	0.00116	0.053125	17	0.016204	no	BREAST
chr1_1099341_T_C_b38	RP5-902P8.12	2.976	0.00313	0.047593	17	0.01599	no	BREAST
chr1_1823242_G_GA_b38	RP5-902P8.12	-2.959	0.00332	-0.061268	11	0.020709	no	BREAST
chr1_1644361_C_T_b38	RP5-902P8.12	-2.932	0.0036	-0.04961	3	0.016918	no	BREAST
chr1_1099309_T_G_b38	RP5-902P8.12	2.855	0.00458	0.046857	15	0.016411	no	BREAST
chr1_626449_A_G_b38	RP5-902P8.12	2.813	0.00521	0.070823	10	0.025178	no	BREAST
chr1_1091690_G_A_b38	RP5-902P8.12	2.8	0.00542	0.049383	11	0.017639	no	BREAST
chr1_1116992_A_G_b38	RP5-902P8.12	2.656	0.00829	0.065448	11	0.02464	no	BREAST
chr1_624752_C_T_b38	RP5-902P8.12	-2.641	0.00867	-0.047054	3	0.017818	no	BREAST
chr1_631490_T_C_b38	RP5-902P8.12	2.621	0.00918	0.077014	6	0.029382	no	BREAST
chr1_929110_C_T_b38	RP5-902P8.12	2.597	0.00983	0.07541	3	0.029035	no	BREAST
chr1_1904424_A_AAAATAAAT_b38	RP5-902P8.12	-3.166	0.00166	-0.023147	120	0.007311	yes	CULTFB
chr1_1958061_C_T_b38	RP5-902P8.12	3.003	0.00284	0.048597	3	0.016184	yes	CULTFB
chr1_2029235_C_T_b38	RP5-902P8.12	2.913	0.00378	0.032986	12	0.011324	yes	CULTFB
chr1_2029969_C_T_b38	RP5-902P8.12	2.913	0.00378	0.032986	12	0.011324	yes	CULTFB
chr1_2031380_T_A_b38	RP5-902P8.12	2.913	0.00378	0.032986	12	0.011324	yes	CULTFB
chr1_2031629_GTGTCTGGGGCGCTAC_G_b38	RP5-902P8.12	2.913	0.00378	0.032986	12	0.011324	yes	CULTFB
chr1_2031648_CCTCTG_C_b38	RP5-902P8.12	2.913	0.00378	0.032986	12	0.011324	yes	CULTFB
chr1_2031655_AGGACCCAGGCATCTG_A_b38	RP5-902P8.12	2.913	0.00378	0.032986	12	0.011324	yes	CULTFB
chr1_2031719_C_T_b38	RP5-902P8.12	2.913	0.00378	0.032986	12	0.011324	yes	CULTFB
chr1_2031852_C_G_b38	RP5-902P8.12	2.913	0.00378	0.032986	12	0.011324	yes	CULTFB
chr1_1367046_G_C_b38	RP5-902P8.12	2.894	0.004	0.053041	4	0.018327	yes	CULTFB
chr1_1367055_T_TGA_b38	RP5-902P8.12	2.891	0.00404	0.053606	4	0.01854	yes	CULTFB
chr1_1585973_T_A_b38	RP5-902P8.12	-2.748	0.00626	-0.032143	24	0.011696	yes	CULTFB
chr1_2033336_T_C_b38	RP5-902P8.12	2.748	0.00626	0.031519	11	0.01147	yes	CULTFB
chr1_2033373_T_G_b38	RP5-902P8.12	2.748	0.00626	0.031519	11	0.01147	yes	CULTFB
chr1_2017202_C_T_b38	RP5-902P8.12	2.721	0.00677	0.030804	11	0.011319	yes	CULTFB
chr1_2031194_A_G_b38	RP5-902P8.12	2.696	0.0073	0.028825	14	0.01069	yes	CULTFB
chr1_2032636_T_C_b38	RP5-902P8.12	2.635	0.00874	0.027278	16	0.010354	yes	CULTFB
chr1_2023934_C_T_b38	RP5-902P8.12	2.622	0.00908	0.027701	14	0.010567	yes	CULTFB
chr1_2033988_G_A_b38	RP5-902P8.12	2.59	0.00994	0.029961	10	0.011569	yes	CULTFB
chr1_624505_A_G_b38	RP5-902P8.12	3.226	0.00136	0.036611	4	0.011348	no	CULTFB
chr1_1422828_G_T_b38	RP5-902P8.12	-2.692	0.0074	-0.045562	4	0.016927	no	CULTFB
chr1_506032_AAAC_A_b38	RP5-902P8.12	2.659	0.00814	0.068344	4	0.025703	no	CULTFB
chr1_899024_C_CT_b38	RP5-902P8.12	-3.956	0.000129	-0.082454	5	0.020841	yes	EBVTLC
chr1_1490027_A_G_b38	RP5-902P8.12	3.74	0.000282	0.094672	12	0.025312	yes	EBVTLC
chr1_1490032_A_G_b38	RP5-902P8.12	3.74	0.000282	0.094672	12	0.025312	yes	EBVTLC
chr1_2075289_T_C_b38	RP5-902P8.12	-3.022	0.00306	-0.052971	18	0.017527	yes	EBVTLC
chr1_1474201_CT_C_b38	RP5-902P8.12	2.976	0.00352	0.076732	14	0.025781	yes	EBVTLC
chr1_901516_T_C_b38	RP5-902P8.12	-2.929	0.00406	-0.051147	18	0.017461	yes	EBVTLC
chr1_1993198_CA_C_b38	RP5-902P8.12	-2.877	0.00475	-0.055869	6	0.01942	yes	EBVTLC
chr1_899452_G_C_b38	RP5-902P8.12	-2.814	0.00571	-0.051789	12	0.018403	yes	EBVTLC
chr1_1485282_A_G_b38	RP5-902P8.12	2.771	0.00648	0.115106	3	0.041547	yes	EBVTLC
chr1_1050063_AG_A_b38	RP5-902P8.12	2.758	0.00672	0.04792	34	0.017376	yes	EBVTLC
chr1_632366_T_C_b38	RP5-902P8.12	2.743	0.00701	0.082951	3	0.030238	yes	EBVTLC
chr1_1134045_C_A_b38	RP5-902P8.12	-2.729	0.0073	-0.048232	25	0.017675	yes	EBVTLC
chr1_1134071_G_A_b38	RP5-902P8.12	-2.727	0.00735	-0.045659	26	0.016746	yes	EBVTLC
chr1_897843_C_T_b38	RP5-902P8.12	-2.716	0.00759	-0.050168	12	0.018474	yes	EBVTLC
chr1_897922_C_T_b38	RP5-902P8.12	-2.716	0.00759	-0.050168	12	0.018474	yes	EBVTLC
chr1_898444_T_C_b38	RP5-902P8.12	-2.716	0.00759	-0.050168	12	0.018474	yes	EBVTLC
chr1_833843_C_G_b38	RP5-902P8.12	2.713	0.00765	0.061064	4	0.022512	yes	EBVTLC
chr1_906982_C_T_b38	RP5-902P8.12	-2.692	0.00811	-0.054337	4	0.020185	yes	EBVTLC
chr1_2068241_G_A_b38	RP5-902P8.12	-2.69	0.00816	-0.052579	8	0.019549	yes	EBVTLC
chr1_2106797_G_GACTCTTCAGCAGGCCCCTCTGGTGGGCGAGGACCTCCACACGTGTCACCAGGCCAGGTA_b38	RP5-902P8.12	-2.686	0.00826	-0.063153	7	0.023515	yes	EBVTLC
chr1_806017_A_G_b38	RP5-902P8.12	-2.68	0.00839	-0.081542	4	0.030427	yes	EBVTLC
chr1_1374694_C_G_b38	RP5-902P8.12	-3.198	0.00177	-0.085105	5	0.026613	no	EBVTLC
chr1_1168157_C_T_b38	RP5-902P8.12	3.106	0.00236	0.107085	3	0.034474	no	EBVTLC
chr1_796338_T_C_b38	RP5-902P8.12	2.995	0.00333	0.070304	3	0.023471	no	EBVTLC
chr1_810809_A_G_b38	RP5-902P8.12	-2.96	0.00371	-0.104414	3	0.035279	no	EBVTLC
chr1_796652_A_C_b38	RP5-902P8.12	2.95	0.00382	0.066494	4	0.022543	no	EBVTLC
chr1_1319750_G_A_b38	RP5-902P8.12	2.829	0.00547	0.09232	5	0.032633	no	EBVTLC
chr1_1476266_T_C_b38	RP5-902P8.12	2.814	0.00571	0.072549	17	0.025779	no	EBVTLC
chr1_821054_G_C_b38	RP5-902P8.12	2.743	0.00701	0.064208	3	0.023407	no	EBVTLC
chr1_898261_T_C_b38	RP5-902P8.12	-2.728	0.00733	-0.049708	13	0.018223	no	EBVTLC
chr1_898279_T_A_b38	RP5-902P8.12	-2.728	0.00733	-0.049708	13	0.018223	no	EBVTLC
chr1_898283_A_G_b38	RP5-902P8.12	-2.728	0.00733	-0.049708	13	0.018223	no	EBVTLC
chr1_1904424_A_AAAATAAATAAATAAAT_b38	RP5-902P8.12	2.715	0.0076	0.071547	3	0.026353	no	EBVTLC
chr1_1492939_C_CA_b38	RP5-902P8.12	2.677	0.00845	0.07795	7	0.029113	no	EBVTLC
chr1_1453643_A_ATT_b38	RP5-902P8.12	2.672	0.00859	0.059557	10	0.022292	no	EBVTLC
chr1_2244139_G_A_b38	RP5-902P8.12	3.689	0.000273	0.090923	3	0.024645	yes	CLNSGM
chr1_2239033_T_C_b38	RP5-902P8.12	3.355	0.000912	0.077206	3	0.023015	yes	CLNSGM
chr1_2241740_A_G_b38	RP5-902P8.12	3.355	0.000912	0.077206	3	0.023015	yes	CLNSGM
chr1_993602_G_GC_b38	RP5-902P8.12	-3.178	0.00166	-0.081546	3	0.025661	yes	CLNSGM
chr1_1131430_C_CTTTTTTTTTTTTTTTT_b38	RP5-902P8.12	-2.897	0.00409	-0.079872	3	0.027572	yes	CLNSGM
chr1_749482_G_A_b38	RP5-902P8.12	2.85	0.00472	0.079225	9	0.027795	yes	CLNSGM
chr1_2224423_G_A_b38	RP5-902P8.12	-2.782	0.0058	-0.059535	3	0.021403	yes	CLNSGM
chr1_995543_A_G_b38	RP5-902P8.12	-2.712	0.00713	-0.039074	24	0.014407	yes	CLNSGM
chr1_1738597_C_A_b38	RP5-902P8.12	-2.699	0.00741	-0.038972	34	0.014439	yes	CLNSGM
chr1_1993198_CA_C_b38	RP5-902P8.12	-2.693	0.00753	-0.038767	24	0.014393	yes	CLNSGM
chr1_1743586_T_TAC_b38	RP5-902P8.12	2.685	0.00772	0.035761	42	0.013319	yes	CLNSGM
chr1_928264_T_C_b38	RP5-902P8.12	3.108	0.00209	0.056196	10	0.018083	no	CLNSGM
chr1_1068824_G_GGCCACGCGGGCTGTGCAGATGCAGGTGCGGCGGGGCGGGGCCACGCGGGCTGTGAAGGTGCAGGTGCGGCGGGGCAGA_b38	RP5-902P8.12	-3.052	0.0025	-0.030208	51	0.009896	no	CLNSGM
chr1_938479_G_T_b38	RP5-902P8.12	3.027	0.00271	0.116842	3	0.038598	no	CLNSGM
chr1_286145_C_CAT_b38	RP5-902P8.12	2.949	0.00348	0.051316	6	0.017403	no	CLNSGM
chr1_2089675_C_T_b38	RP5-902P8.12	-2.835	0.00493	-0.046098	15	0.016258	no	CLNSGM
chr1_1014274_A_G_b38	RP5-902P8.12	-2.763	0.00614	-0.063532	7	0.022997	no	CLNSGM
chr1_1968793_T_C_b38	RP5-902P8.12	-2.734	0.00669	-0.034472	49	0.01261	no	CLNSGM
chr1_631412_T_C_b38	RP5-902P8.12	-2.708	0.00721	-0.096187	3	0.035517	no	CLNSGM
chr1_1960609_G_C_b38	RP5-902P8.12	2.707	0.00724	0.033755	51	0.012471	no	CLNSGM
chr1_1835922_G_GAAA_b38	RP5-902P8.12	2.603	0.00978	0.078206	5	0.030049	no	CLNSGM
chr1_1877316_A_T_b38	RP5-902P8.12	3.659	3e-04	0.04643	36	0.012691	yes	CLNTRN
chr1_599165_G_A_b38	RP5-902P8.12	3.598	0.000375	0.055463	8	0.015414	yes	CLNTRN
chr1_1877314_A_T_b38	RP5-902P8.12	3.104	0.00209	0.047138	14	0.015185	yes	CLNTRN
chr1_1228094_A_G_b38	RP5-902P8.12	3.092	0.00218	0.058516	3	0.018928	yes	CLNTRN
chr1_1731904_CA_C_b38	RP5-902P8.12	3.081	0.00226	0.040366	26	0.013103	yes	CLNTRN
chr1_1956891_C_T_b38	RP5-902P8.12	3.016	0.00278	0.039847	21	0.013212	yes	CLNTRN
chr1_1915022_C_T_b38	RP5-902P8.12	2.895	0.00407	0.039799	16	0.013747	yes	CLNTRN
chr1_1951642_C_T_b38	RP5-902P8.12	2.886	0.00419	0.038759	20	0.01343	yes	CLNTRN
chr1_1955652_CG_C_b38	RP5-902P8.12	2.884	0.00421	0.039069	17	0.013545	yes	CLNTRN
chr1_1955672_GC_G_b38	RP5-902P8.12	2.884	0.00421	0.039069	17	0.013545	yes	CLNTRN
chr1_1956754_C_A_b38	RP5-902P8.12	2.827	0.00502	0.038452	18	0.013602	yes	CLNTRN
chr1_1951498_C_T_b38	RP5-902P8.12	2.819	0.00514	0.037793	20	0.013406	yes	CLNTRN
chr1_1553018_CA_C_b38	RP5-902P8.12	-2.794	0.00554	-0.037605	18	0.013458	yes	CLNTRN
chr1_1955420_C_T_b38	RP5-902P8.12	2.771	0.00594	0.037193	19	0.013422	yes	CLNTRN
chr1_601293_G_A_b38	RP5-902P8.12	2.763	0.00609	0.040884	9	0.014798	yes	CLNTRN
chr1_1936906_CA_C_b38	RP5-902P8.12	2.754	0.00624	0.041154	8	0.014941	yes	CLNTRN
chr1_1957014_G_A_b38	RP5-902P8.12	2.746	0.0064	0.036346	21	0.013235	yes	CLNTRN
chr1_1957636_C_T_b38	RP5-902P8.12	2.746	0.0064	0.036346	21	0.013235	yes	CLNTRN
chr1_1226486_C_T_b38	RP5-902P8.12	2.727	0.00676	0.044166	6	0.016193	yes	CLNTRN
chr1_1219203_A_AC_b38	RP5-902P8.12	-2.703	0.00727	-0.058407	5	0.02161	yes	CLNTRN
chr1_591650_C_T_b38	RP5-902P8.12	2.639	0.00876	0.041604	9	0.015767	yes	CLNTRN
chr1_1339884_A_ACAGCCGCATGTCCCCCAGCAGCCCCCACAGACCCACCCG_b38	RP5-902P8.12	3.492	0.000553	0.04789	19	0.013715	no	CLNTRN
chr1_1168157_C_T_b38	RP5-902P8.12	-3.44	0.000665	-0.112468	4	0.032694	no	CLNTRN
chr1_1530568_G_T_b38	RP5-902P8.12	-3.385	0.000807	-0.0766	9	0.022627	no	CLNTRN
chr1_1530546_A_ATT_b38	RP5-902P8.12	-3.351	0.000909	-0.074863	9	0.022341	no	CLNTRN
chr1_2028422_G_GC_b38	RP5-902P8.12	-3.309	0.00105	-0.042651	24	0.012888	no	CLNTRN
chr1_1530549_G_GA_b38	RP5-902P8.12	-3.167	0.0017	-0.071814	9	0.022677	no	CLNTRN
chr1_1530550_C_A_b38	RP5-902P8.12	-3.167	0.0017	-0.071814	9	0.022677	no	CLNTRN
chr1_1530553_G_A_b38	RP5-902P8.12	-3.167	0.0017	-0.071814	9	0.022677	no	CLNTRN
chr1_2026833_CA_C_b38	RP5-902P8.12	-3.125	0.00195	-0.04046	20	0.012946	no	CLNTRN
chr1_591638_G_A_b38	RP5-902P8.12	3.106	0.00208	0.05223	8	0.016817	no	CLNTRN
chr1_1297187_A_G_b38	RP5-902P8.12	-3.068	0.00236	-0.084717	6	0.027616	no	CLNTRN
chr1_1530555_C_T_b38	RP5-902P8.12	-3.048	0.00251	-0.068512	9	0.022474	no	CLNTRN
chr1_643358_G_A_b38	RP5-902P8.12	3.044	0.00254	0.060473	8	0.019866	no	CLNTRN
chr1_2078844_C_CT_b38	RP5-902P8.12	3.036	0.00261	0.057328	6	0.01888	no	CLNTRN
chr1_2031194_A_G_b38	RP5-902P8.12	-3.016	0.00278	-0.048689	9	0.016144	no	CLNTRN
chr1_1530585_T_G_b38	RP5-902P8.12	-2.802	0.00542	-0.072173	7	0.025759	no	CLNTRN
chr1_605672_T_C_b38	RP5-902P8.12	2.768	0.00599	0.043911	5	0.015862	no	CLNTRN
chr1_2025780_CG_C_b38	RP5-902P8.12	-2.743	0.00647	-0.043974	9	0.016033	no	CLNTRN
chr1_1896717_CT_C_b38	RP5-902P8.12	2.656	0.00834	0.032724	79	0.012323	no	CLNTRN
chr1_1056634_CTTGCTCTCCGGCGTGCATGTGTGGGTGCATGTACGT_C_b38	RP5-902P8.12	2.655	0.00835	0.083601	4	0.031486	no	CLNTRN
chr1_2023934_C_T_b38	RP5-902P8.12	-2.654	0.00839	-0.043149	8	0.016259	no	CLNTRN
chr1_1297163_A_G_b38	RP5-902P8.12	-2.625	0.00912	-0.079084	7	0.030132	no	CLNTRN
chr1_2032636_T_C_b38	RP5-902P8.12	-2.604	0.00968	-0.040711	11	0.015634	no	CLNTRN
chr1_2054114_T_C_b38	RP5-902P8.12	2.595	0.00994	0.036737	28	0.01416	no	CLNTRN
chr1_2244139_G_A_b38	RP5-902P8.12	3.479	0.000586	0.086008	3	0.024725	yes	ESPGSJ
chr1_2239033_T_C_b38	RP5-902P8.12	3.267	0.00122	0.073536	3	0.022507	yes	ESPGSJ
chr1_2241740_A_G_b38	RP5-902P8.12	3.267	0.00122	0.073536	3	0.022507	yes	ESPGSJ
chr1_1425135_T_C_b38	RP5-902P8.12	3.251	0.00129	0.06653	3	0.020464	yes	ESPGSJ
chr1_626516_A_AT_b38	RP5-902P8.12	-3.221	0.00143	-0.081024	5	0.025155	yes	ESPGSJ
chr1_1403127_C_CAAAAAAA_b38	RP5-902P8.12	-3.061	0.00243	-0.079798	4	0.026071	yes	ESPGSJ
chr1_1849781_T_C_b38	RP5-902P8.12	-3.005	0.0029	-0.040709	18	0.013548	yes	ESPGSJ
chr1_1038078_C_T_b38	RP5-902P8.12	2.905	0.00397	0.052633	4	0.018119	yes	ESPGSJ
chr1_1041950_T_C_b38	RP5-902P8.12	2.905	0.00397	0.052633	4	0.018119	yes	ESPGSJ
chr1_2237640_C_T_b38	RP5-902P8.12	2.828	0.00503	0.04438	11	0.015692	yes	ESPGSJ
chr1_2238621_G_A_b38	RP5-902P8.12	2.828	0.00503	0.04438	11	0.015692	yes	ESPGSJ
chr1_2240544_C_T_b38	RP5-902P8.12	2.828	0.00503	0.04438	11	0.015692	yes	ESPGSJ
chr1_1029460_T_C_b38	RP5-902P8.12	2.807	0.00535	0.051109	4	0.018206	yes	ESPGSJ
chr1_1029468_A_T_b38	RP5-902P8.12	2.807	0.00535	0.051109	4	0.018206	yes	ESPGSJ
chr1_1047614_T_C_b38	RP5-902P8.12	2.792	0.0056	0.050491	6	0.018082	yes	ESPGSJ
chr1_1035844_A_G_b38	RP5-902P8.12	2.772	0.00596	0.051117	4	0.018442	yes	ESPGSJ
chr1_1037956_A_G_b38	RP5-902P8.12	2.772	0.00596	0.051117	4	0.018442	yes	ESPGSJ
chr1_1037997_G_A_b38	RP5-902P8.12	2.772	0.00596	0.051117	4	0.018442	yes	ESPGSJ
chr1_1038800_G_T_b38	RP5-902P8.12	2.772	0.00596	0.051117	4	0.018442	yes	ESPGSJ
chr1_1038819_C_T_b38	RP5-902P8.12	2.772	0.00596	0.051117	4	0.018442	yes	ESPGSJ
chr1_1038845_A_G_b38	RP5-902P8.12	2.772	0.00596	0.051117	4	0.018442	yes	ESPGSJ
chr1_1038916_A_G_b38	RP5-902P8.12	2.772	0.00596	0.051117	4	0.018442	yes	ESPGSJ
chr1_1038975_G_A_b38	RP5-902P8.12	2.772	0.00596	0.051117	4	0.018442	yes	ESPGSJ
chr1_1038976_T_C_b38	RP5-902P8.12	2.772	0.00596	0.051117	4	0.018442	yes	ESPGSJ
chr1_1039114_G_T_b38	RP5-902P8.12	2.772	0.00596	0.051117	4	0.018442	yes	ESPGSJ
chr1_1039190_T_G_b38	RP5-902P8.12	2.772	0.00596	0.051117	4	0.018442	yes	ESPGSJ
chr1_1039753_T_A_b38	RP5-902P8.12	2.772	0.00596	0.051117	4	0.018442	yes	ESPGSJ
chr1_1040322_A_G_b38	RP5-902P8.12	2.772	0.00596	0.051117	4	0.018442	yes	ESPGSJ
chr1_514446_TA_T_b38	RP5-902P8.12	-2.712	0.00711	-0.039807	10	0.014677	yes	ESPGSJ
chr1_2160238_C_CGT_b38	RP5-902P8.12	-2.71	0.00716	-0.054603	3	0.020151	yes	ESPGSJ
chr1_1949125_T_TTCCC_b38	RP5-902P8.12	2.704	0.00728	0.040423	12	0.014951	yes	ESPGSJ
chr1_2071051_C_CACCTGGGCGTGTGACCTGGGCGTGTG_b38	RP5-902P8.12	-2.678	0.00785	-0.042312	8	0.015799	yes	ESPGSJ
chr1_1036754_C_T_b38	RP5-902P8.12	2.671	0.008	0.047152	4	0.01765	yes	ESPGSJ
chr1_757414_CA_C_b38	RP5-902P8.12	-2.656	0.00837	-0.048478	7	0.018253	yes	ESPGSJ
chr1_1038288_A_G_b38	RP5-902P8.12	2.652	0.00848	0.048958	4	0.018464	yes	ESPGSJ
chr1_1324174_G_A_b38	RP5-902P8.12	2.62	0.00929	0.050528	10	0.019288	yes	ESPGSJ
chr1_1357246_C_T_b38	RP5-902P8.12	-2.603	0.00974	-0.081093	5	0.031151	yes	ESPGSJ
chr1_632928_G_A_b38	RP5-902P8.12	2.598	0.00989	0.050612	6	0.019484	yes	ESPGSJ
chr1_1425750_T_C_b38	RP5-902P8.12	3.136	0.0019	0.063326	4	0.020196	no	ESPGSJ
chr1_1425822_C_G_b38	RP5-902P8.12	3.039	0.00261	0.062985	3	0.020728	no	ESPGSJ
chr1_1425936_G_A_b38	RP5-902P8.12	3.039	0.00261	0.062985	3	0.020728	no	ESPGSJ
chr1_1426771_G_C_b38	RP5-902P8.12	3.039	0.00261	0.062985	3	0.020728	no	ESPGSJ
chr1_1427080_C_T_b38	RP5-902P8.12	2.953	0.00342	0.061643	3	0.020875	no	ESPGSJ
chr1_2051769_C_T_b38	RP5-902P8.12	-2.862	0.00454	-0.032426	59	0.011331	no	ESPGSJ
chr1_2053731_G_A_b38	RP5-902P8.12	2.846	0.00476	0.037246	37	0.013087	no	ESPGSJ
chr1_2051689_A_T_b38	RP5-902P8.12	-2.823	0.0051	-0.032049	55	0.011351	no	ESPGSJ
chr1_1041776_CCGGCCAGTGCCAGGGTCGAGGTGGGCGGCTCCCCCGGGGGAGGGCTG_C_b38	RP5-902P8.12	2.702	0.00732	0.025462	36	0.009423	no	ESPGSJ
chr1_791549_G_GGAATGGAATC_b38	RP5-902P8.12	-2.68	0.0078	-0.035373	20	0.013198	no	ESPGSJ
chr1_2048285_C_A_b38	RP5-902P8.12	-2.634	0.00891	-0.034507	16	0.013099	no	ESPGSJ
chr1_2049200_G_A_b38	RP5-902P8.12	-2.634	0.00891	-0.034507	16	0.013099	no	ESPGSJ
chr1_660886_G_C_b38	RP5-902P8.12	3.58	0.000383	0.096783	4	0.027034	yes	ESPMCS
chr1_1431026_CCACCCCCT_C_b38	RP5-902P8.12	-3.553	0.000423	-0.039707	26	0.011174	yes	ESPMCS
chr1_1818305_T_TAA_b38	RP5-902P8.12	3.485	0.000542	0.090261	3	0.025896	yes	ESPMCS
chr1_641162_T_C_b38	RP5-902P8.12	-3.437	0.000646	-0.044946	11	0.013076	yes	ESPMCS
chr1_866577_CCTGCACTCACATCCCTGACGTCCTCCCGTGCCCTCACGTGGTCCTCCCT_C_b38	RP5-902P8.12	3.41	0.000712	0.029171	70	0.008555	yes	ESPMCS
chr1_1101496_T_A_b38	RP5-902P8.12	3.41	0.000712	0.043375	8	0.012721	yes	ESPMCS
chr1_1957243_T_C_b38	RP5-902P8.12	-3.348	0.000885	-0.055584	9	0.016601	yes	ESPMCS
chr1_1957760_T_C_b38	RP5-902P8.12	-3.348	0.000885	-0.055584	9	0.016601	yes	ESPMCS
chr1_1428969_T_C_b38	RP5-902P8.12	-3.328	0.000949	-0.035195	58	0.010574	yes	ESPMCS
chr1_1954676_C_G_b38	RP5-902P8.12	-3.286	0.0011	-0.055605	7	0.016923	yes	ESPMCS
chr1_1430190_A_C_b38	RP5-902P8.12	-3.221	0.00137	-0.03416	58	0.010604	yes	ESPMCS
chr1_1431450_A_G_b38	RP5-902P8.12	-3.221	0.00137	-0.03416	58	0.010604	yes	ESPMCS
chr1_1431537_G_C_b38	RP5-902P8.12	-3.208	0.00144	-0.033992	58	0.010596	yes	ESPMCS
chr1_1949580_T_G_b38	RP5-902P8.12	-3.206	0.00145	-0.055054	7	0.017173	yes	ESPMCS
chr1_1949631_G_A_b38	RP5-902P8.12	-3.206	0.00145	-0.055054	7	0.017173	yes	ESPMCS
chr1_1949646_A_G_b38	RP5-902P8.12	-3.206	0.00145	-0.055054	7	0.017173	yes	ESPMCS
chr1_1125772_T_C_b38	RP5-902P8.12	3.178	0.00159	0.043128	5	0.013571	yes	ESPMCS
chr1_641263_G_A_b38	RP5-902P8.12	-3.143	0.00179	-0.040858	12	0.013001	yes	ESPMCS
chr1_1126571_C_T_b38	RP5-902P8.12	3.14	0.00181	0.043255	4	0.013775	yes	ESPMCS
chr1_1101579_T_C_b38	RP5-902P8.12	3.129	0.00188	0.041657	5	0.013315	yes	ESPMCS
chr1_1125735_T_C_b38	RP5-902P8.12	3.105	0.00203	0.041386	5	0.013331	yes	ESPMCS
chr1_1101497_T_A_b38	RP5-902P8.12	3.103	0.00205	0.039129	9	0.012612	yes	ESPMCS
chr1_641308_G_A_b38	RP5-902P8.12	-3.076	0.00224	-0.041639	11	0.013538	yes	ESPMCS
chr1_1953441_G_A_b38	RP5-902P8.12	-3.069	0.00229	-0.053473	6	0.017424	yes	ESPMCS
chr1_1954330_G_A_b38	RP5-902P8.12	-3.069	0.00229	-0.053473	6	0.017424	yes	ESPMCS
chr1_1258333_C_G_b38	RP5-902P8.12	-3.027	0.00262	-0.043574	14	0.014397	yes	ESPMCS
chr1_1258343_A_C_b38	RP5-902P8.12	-3.027	0.00262	-0.043574	14	0.014397	yes	ESPMCS
chr1_1254681_A_G_b38	RP5-902P8.12	-3.025	0.00264	-0.042963	14	0.014203	yes	ESPMCS
chr1_1248597_A_C_b38	RP5-902P8.12	-3.014	0.00273	-0.037007	13	0.012278	yes	ESPMCS
chr1_271413_C_CT_b38	RP5-902P8.12	-3.003	0.00283	-0.053356	6	0.017768	yes	ESPMCS
chr1_1126654_G_A_b38	RP5-902P8.12	2.994	0.00292	0.041785	4	0.013957	yes	ESPMCS
chr1_1125882_A_G_b38	RP5-902P8.12	2.98	0.00305	0.040344	4	0.01354	yes	ESPMCS
chr1_277226_A_C_b38	RP5-902P8.12	2.956	0.00329	0.049965	10	0.016903	yes	ESPMCS
chr1_619415_C_G_b38	RP5-902P8.12	-2.952	0.00333	-0.044694	5	0.015141	yes	ESPMCS
chr1_2094608_G_A_b38	RP5-902P8.12	2.948	0.00337	0.084012	3	0.028495	yes	ESPMCS
chr1_1426261_C_T_b38	RP5-902P8.12	-2.899	0.00393	-0.030735	57	0.010601	yes	ESPMCS
chr1_1426810_C_G_b38	RP5-902P8.12	-2.899	0.00393	-0.030735	57	0.010601	yes	ESPMCS
chr1_1124094_AAC_A_b38	RP5-902P8.12	2.891	0.00404	0.040814	4	0.01412	yes	ESPMCS
chr1_1500729_G_A_b38	RP5-902P8.12	-2.879	0.00419	-0.050285	27	0.017468	yes	ESPMCS
chr1_1124132_T_TACACACCTGAGCACACACACCTGTGC_b38	RP5-902P8.12	2.832	0.00484	0.03975	4	0.014036	yes	ESPMCS
chr1_1439454_A_G_b38	RP5-902P8.12	-2.817	0.00508	-0.029348	54	0.010419	yes	ESPMCS
chr1_1497857_T_TAAAAA_b38	RP5-902P8.12	-2.768	0.00589	-0.0696	4	0.025149	yes	ESPMCS
chr1_1548554_C_CA_b38	RP5-902P8.12	2.69	0.00742	0.0632	5	0.02349	yes	ESPMCS
chr1_2106507_A_G_b38	RP5-902P8.12	2.652	0.0083	0.048866	5	0.018426	yes	ESPMCS
chr1_1296939_G_A_b38	RP5-902P8.12	-2.643	0.00851	-0.038926	26	0.014726	yes	ESPMCS
chr1_1124025_C_T_b38	RP5-902P8.12	2.631	0.00882	0.037584	3	0.014284	yes	ESPMCS
chr1_1124012_G_GCACACACCTGCGTGCACACACCTGCA_b38	RP5-902P8.12	2.623	0.00902	0.037896	3	0.014446	yes	ESPMCS
chr1_2106518_A_G_b38	RP5-902P8.12	2.614	0.00926	0.059017	5	0.022575	yes	ESPMCS
chr1_1303959_T_G_b38	RP5-902P8.12	2.601	0.00962	0.038263	27	0.014712	yes	ESPMCS
chr1_1957772_GGC_G_b38	RP5-902P8.12	-3.554	0.000422	-0.063132	5	0.017765	no	ESPMCS
chr1_1113609_A_G_b38	RP5-902P8.12	3.282	0.00111	0.043429	5	0.013231	no	ESPMCS
chr1_1117566_G_T_b38	RP5-902P8.12	3.204	0.00146	0.04381	4	0.013674	no	ESPMCS
chr1_1122649_A_G_b38	RP5-902P8.12	3.2	0.00148	0.043419	4	0.013569	no	ESPMCS
chr1_1125228_G_A_b38	RP5-902P8.12	3.175	0.00161	0.04385	4	0.01381	no	ESPMCS
chr1_1126222_G_A_b38	RP5-902P8.12	3.123	0.00191	0.043305	4	0.013866	no	ESPMCS
chr1_1123255_G_A_b38	RP5-902P8.12	3.115	0.00196	0.042976	4	0.013797	no	ESPMCS
chr1_1118447_T_TG_b38	RP5-902P8.12	3.106	0.00202	0.042323	4	0.013627	no	ESPMCS
chr1_1120273_C_G_b38	RP5-902P8.12	3.106	0.00202	0.042323	4	0.013627	no	ESPMCS
chr1_1120521_C_A_b38	RP5-902P8.12	3.106	0.00202	0.042323	4	0.013627	no	ESPMCS
chr1_1121559_T_A_b38	RP5-902P8.12	3.106	0.00202	0.042323	4	0.013627	no	ESPMCS
chr1_1126128_G_A_b38	RP5-902P8.12	3.088	0.00215	0.042861	4	0.013879	no	ESPMCS
chr1_1120417_A_G_b38	RP5-902P8.12	3.086	0.00216	0.041603	4	0.013483	no	ESPMCS
chr1_1122042_G_C_b38	RP5-902P8.12	3.086	0.00216	0.041603	4	0.013483	no	ESPMCS
chr1_1110093_G_A_b38	RP5-902P8.12	3.067	0.0023	0.042427	4	0.013832	no	ESPMCS
chr1_1111481_G_A_b38	RP5-902P8.12	3.067	0.0023	0.042427	4	0.013832	no	ESPMCS
chr1_1113703_C_A_b38	RP5-902P8.12	3.067	0.0023	0.042427	4	0.013832	no	ESPMCS
chr1_1118072_G_A_b38	RP5-902P8.12	3.067	0.0023	0.042427	4	0.013832	no	ESPMCS
chr1_1119172_G_A_b38	RP5-902P8.12	3.067	0.0023	0.042427	4	0.013832	no	ESPMCS
chr1_1124663_A_C_b38	RP5-902P8.12	3.067	0.0023	0.042427	4	0.013832	no	ESPMCS
chr1_1122128_C_G_b38	RP5-902P8.12	3.059	0.00236	0.041823	4	0.013673	no	ESPMCS
chr1_1115600_CCCCTCCCCAGGGACCCCCCT_C_b38	RP5-902P8.12	3.058	0.00237	0.047079	7	0.015394	no	ESPMCS
chr1_1123509_G_A_b38	RP5-902P8.12	3.05	0.00243	0.041976	4	0.013762	no	ESPMCS
chr1_1124768_G_T_b38	RP5-902P8.12	3.047	0.00245	0.042358	4	0.013901	no	ESPMCS
chr1_1107147_G_C_b38	RP5-902P8.12	3.045	0.00247	0.042308	4	0.013893	no	ESPMCS
chr1_1111337_G_C_b38	RP5-902P8.12	3.012	0.00275	0.041428	4	0.013753	no	ESPMCS
chr1_1120889_C_T_b38	RP5-902P8.12	2.975	0.00309	0.040305	4	0.013547	no	ESPMCS
chr1_1123889_C_T_b38	RP5-902P8.12	2.969	0.00316	0.04091	4	0.013781	no	ESPMCS
chr1_1430908_A_G_b38	RP5-902P8.12	-2.965	0.00319	-0.031307	58	0.010557	no	ESPMCS
chr1_1113195_CA_C_b38	RP5-902P8.12	2.928	0.00359	0.028228	46	0.009639	no	ESPMCS
chr1_1431813_G_T_b38	RP5-902P8.12	-2.915	0.00374	-0.034099	17	0.011697	no	ESPMCS
chr1_1441187_A_G_b38	RP5-902P8.12	-2.876	0.00423	-0.031232	41	0.010859	no	ESPMCS
chr1_1122144_C_T_b38	RP5-902P8.12	2.868	0.00433	0.039247	4	0.013683	no	ESPMCS
chr1_1953296_CTT_C_b38	RP5-902P8.12	-2.86	0.00444	-0.047614	5	0.016647	no	ESPMCS
chr1_1440834_C_G_b38	RP5-902P8.12	-2.797	0.0054	-0.029467	57	0.010536	no	ESPMCS
chr1_1922424_T_C_b38	RP5-902P8.12	-2.778	0.00572	-0.048134	8	0.01733	no	ESPMCS
chr1_292126_G_A_b38	RP5-902P8.12	2.76	0.00603	0.072892	3	0.026413	no	ESPMCS
chr1_1993198_CA_C_b38	RP5-902P8.12	2.739	0.00642	0.02944	29	0.010749	no	ESPMCS
chr1_1440430_C_G_b38	RP5-902P8.12	-2.709	0.00702	-0.028542	33	0.010536	no	ESPMCS
chr1_1949489_AT_A_b38	RP5-902P8.12	-2.693	0.00736	-0.045313	7	0.016827	no	ESPMCS
chr1_1370553_CA_C_b38	RP5-902P8.12	2.688	0.00747	0.025703	123	0.009562	no	ESPMCS
chr1_1521298_C_CAAA_b38	RP5-902P8.12	-2.668	0.00792	-0.067431	4	0.025274	no	ESPMCS
chr1_1939898_G_A_b38	RP5-902P8.12	-2.666	0.00797	-0.047737	6	0.017908	no	ESPMCS
chr1_1102708_G_C_b38	RP5-902P8.12	2.662	0.00805	0.030543	19	0.011472	no	ESPMCS
chr1_1105414_G_A_b38	RP5-902P8.12	2.662	0.00805	0.030543	19	0.011472	no	ESPMCS
chr1_1106320_A_G_b38	RP5-902P8.12	2.662	0.00805	0.030543	19	0.011472	no	ESPMCS
chr1_1110784_C_T_b38	RP5-902P8.12	2.662	0.00805	0.030543	19	0.011472	no	ESPMCS
chr1_1102615_A_T_b38	RP5-902P8.12	2.631	0.00882	0.052693	3	0.020027	no	ESPMCS
chr1_1433374_T_C_b38	RP5-902P8.12	-2.624	0.009	-0.026745	64	0.010192	no	ESPMCS
chr1_1930002_T_C_b38	RP5-902P8.12	-2.623	0.00903	-0.046834	6	0.017855	no	ESPMCS
chr1_1431014_G_A_b38	RP5-902P8.12	-2.598	0.00971	-0.02689	29	0.010351	no	ESPMCS
chr1_642104_G_A_b38	RP5-902P8.12	-2.595	0.0098	-0.040794	3	0.015723	no	ESPMCS
chr1_1504928_TTG_T_b38	RP5-902P8.12	-3.897	0.000114	-0.060223	3	0.015453	yes	ESPMSL
chr1_1985619_A_G_b38	RP5-902P8.12	-3.302	0.00105	-0.033487	55	0.010142	yes	ESPMSL
chr1_1978006_A_G_b38	RP5-902P8.12	-3.168	0.00165	-0.032567	45	0.01028	yes	ESPMSL
chr1_674381_A_AT_b38	RP5-902P8.12	-2.878	0.00422	-0.035442	17	0.012314	yes	ESPMSL
chr1_611051_T_C_b38	RP5-902P8.12	-2.83	0.0049	-0.050987	5	0.018017	yes	ESPMSL
chr1_777382_T_G_b38	RP5-902P8.12	-2.788	0.00555	-0.051546	3	0.018485	yes	ESPMSL
chr1_1687236_T_G_b38	RP5-902P8.12	2.726	0.00669	0.026498	74	0.009719	yes	ESPMSL
chr1_1686147_T_G_b38	RP5-902P8.12	2.693	0.00738	0.026305	74	0.009768	yes	ESPMSL
chr1_1681928_C_A_b38	RP5-902P8.12	2.602	0.00962	0.025733	74	0.00989	yes	ESPMSL
chr1_783406_A_AT_b38	RP5-902P8.12	-3.596	0.000364	-0.059441	3	0.01653	no	ESPMSL
chr1_1986752_A_G_b38	RP5-902P8.12	-3.439	0.000647	-0.0355	78	0.010324	no	ESPMSL
chr1_1987049_A_G_b38	RP5-902P8.12	-3.37	0.000825	-0.034361	80	0.010195	no	ESPMSL
chr1_1981062_A_G_b38	RP5-902P8.12	-3.267	0.00118	-0.033266	49	0.010181	no	ESPMSL
chr1_1981291_A_G_b38	RP5-902P8.12	-3.267	0.00118	-0.033266	49	0.010181	no	ESPMSL
chr1_1981295_T_C_b38	RP5-902P8.12	-3.267	0.00118	-0.033266	49	0.010181	no	ESPMSL
chr1_1985451_C_T_b38	RP5-902P8.12	-3.212	0.00142	-0.032436	63	0.010097	no	ESPMSL
chr1_1983048_A_G_b38	RP5-902P8.12	-3.209	0.00144	-0.032541	64	0.01014	no	ESPMSL
chr1_1989523_T_C_b38	RP5-902P8.12	-3.198	0.0015	-0.033624	67	0.010514	no	ESPMSL
chr1_1985090_C_T_b38	RP5-902P8.12	-3.189	0.00154	-0.032248	62	0.010114	no	ESPMSL
chr1_1976870_C_CAG_b38	RP5-902P8.12	-3.141	0.00181	-0.03212	44	0.010225	no	ESPMSL
chr1_1987145_C_T_b38	RP5-902P8.12	-3.1	0.00207	-0.031595	48	0.010191	no	ESPMSL
chr1_1986211_T_C_b38	RP5-902P8.12	-3.096	0.0021	-0.032093	44	0.010366	no	ESPMSL
chr1_1991213_T_C_b38	RP5-902P8.12	-3.076	0.00225	-0.03172	66	0.010313	no	ESPMSL
chr1_1977879_G_A_b38	RP5-902P8.12	-3.056	0.0024	-0.031406	45	0.010278	no	ESPMSL
chr1_1983989_A_AT_b38	RP5-902P8.12	-3.05	0.00244	-0.034252	25	0.011229	no	ESPMSL
chr1_1976855_C_CTT_b38	RP5-902P8.12	-3.013	0.00275	-0.033922	26	0.011258	no	ESPMSL
chr1_1984601_T_C_b38	RP5-902P8.12	-2.991	0.00295	-0.030817	45	0.010303	no	ESPMSL
chr1_1978114_T_A_b38	RP5-902P8.12	-2.989	0.00297	-0.030896	45	0.010336	no	ESPMSL
chr1_1976473_C_T_b38	RP5-902P8.12	-2.966	0.0032	-0.030645	44	0.010333	no	ESPMSL
chr1_1976573_T_C_b38	RP5-902P8.12	-2.966	0.0032	-0.030645	44	0.010333	no	ESPMSL
chr1_1976600_C_T_b38	RP5-902P8.12	-2.966	0.0032	-0.030645	44	0.010333	no	ESPMSL
chr1_1976661_G_T_b38	RP5-902P8.12	-2.966	0.0032	-0.030645	44	0.010333	no	ESPMSL
chr1_1976946_C_T_b38	RP5-902P8.12	-2.966	0.0032	-0.030645	44	0.010333	no	ESPMSL
chr1_1977264_C_G_b38	RP5-902P8.12	-2.966	0.0032	-0.030645	44	0.010333	no	ESPMSL
chr1_1977765_A_G_b38	RP5-902P8.12	-2.966	0.0032	-0.030645	44	0.010333	no	ESPMSL
chr1_1978647_G_T_b38	RP5-902P8.12	-2.966	0.0032	-0.030645	44	0.010333	no	ESPMSL
chr1_1980953_G_A_b38	RP5-902P8.12	-2.966	0.0032	-0.030645	44	0.010333	no	ESPMSL
chr1_1981319_G_C_b38	RP5-902P8.12	-2.966	0.0032	-0.030645	44	0.010333	no	ESPMSL
chr1_1986033_G_A_b38	RP5-902P8.12	-2.966	0.0032	-0.030645	44	0.010333	no	ESPMSL
chr1_1986176_A_T_b38	RP5-902P8.12	-2.966	0.0032	-0.030645	44	0.010333	no	ESPMSL
chr1_1986390_T_G_b38	RP5-902P8.12	-2.966	0.0032	-0.030645	44	0.010333	no	ESPMSL
chr1_1986469_A_C_b38	RP5-902P8.12	-2.966	0.0032	-0.030645	44	0.010333	no	ESPMSL
chr1_1987096_A_T_b38	RP5-902P8.12	-2.966	0.0032	-0.030645	44	0.010333	no	ESPMSL
chr1_1987156_G_A_b38	RP5-902P8.12	-2.966	0.0032	-0.030645	44	0.010333	no	ESPMSL
chr1_1978055_C_T_b38	RP5-902P8.12	-2.956	0.00331	-0.03056	44	0.01034	no	ESPMSL
chr1_1983166_A_T_b38	RP5-902P8.12	-2.947	0.0034	-0.030512	44	0.010353	no	ESPMSL
chr1_1983956_TGG_T_b38	RP5-902P8.12	-2.947	0.0034	-0.030512	44	0.010353	no	ESPMSL
chr1_1984595_C_T_b38	RP5-902P8.12	-2.947	0.0034	-0.030512	44	0.010353	no	ESPMSL
chr1_1984859_C_T_b38	RP5-902P8.12	-2.947	0.0034	-0.030512	44	0.010353	no	ESPMSL
chr1_1985148_G_T_b38	RP5-902P8.12	-2.947	0.0034	-0.030512	44	0.010353	no	ESPMSL
chr1_1976646_A_G_b38	RP5-902P8.12	-2.944	0.00343	-0.030582	43	0.010387	no	ESPMSL
chr1_1972273_C_A_b38	RP5-902P8.12	-2.929	0.00359	-0.030776	41	0.010506	no	ESPMSL
chr1_1978404_C_T_b38	RP5-902P8.12	-2.923	0.00366	-0.030149	44	0.010313	no	ESPMSL
chr1_1978415_G_A_b38	RP5-902P8.12	-2.923	0.00366	-0.030149	44	0.010313	no	ESPMSL
chr1_1981144_T_G_b38	RP5-902P8.12	-2.886	0.00412	-0.031485	32	0.010911	no	ESPMSL
chr1_1971123_A_G_b38	RP5-902P8.12	-2.872	0.0043	-0.030932	32	0.010769	no	ESPMSL
chr1_1976990_T_C_b38	RP5-902P8.12	-2.861	0.00444	-0.029501	45	0.01031	no	ESPMSL
chr1_1983507_C_T_b38	RP5-902P8.12	-2.859	0.00447	-0.030529	34	0.010678	no	ESPMSL
chr1_1978429_G_A_b38	RP5-902P8.12	-2.839	0.00477	-0.030228	34	0.010649	no	ESPMSL
chr1_1971434_C_T_b38	RP5-902P8.12	-2.828	0.00492	-0.03054	32	0.010799	no	ESPMSL
chr1_1978562_C_G_b38	RP5-902P8.12	-2.804	0.0053	-0.028872	45	0.010296	no	ESPMSL
chr1_1978573_T_C_b38	RP5-902P8.12	-2.804	0.0053	-0.028872	45	0.010296	no	ESPMSL
chr1_1978797_T_C_b38	RP5-902P8.12	-2.804	0.0053	-0.028872	45	0.010296	no	ESPMSL
chr1_1986010_T_G_b38	RP5-902P8.12	-2.804	0.0053	-0.028872	45	0.010296	no	ESPMSL
chr1_1982826_T_C_b38	RP5-902P8.12	-2.785	0.00561	-0.028727	45	0.010314	no	ESPMSL
chr1_1984586_G_A_b38	RP5-902P8.12	-2.785	0.00561	-0.028727	45	0.010314	no	ESPMSL
chr1_788439_T_A_b38	RP5-902P8.12	-2.785	0.00562	-0.049438	6	0.017755	no	ESPMSL
chr1_1978262_C_T_b38	RP5-902P8.12	-2.762	0.00601	-0.028381	45	0.010275	no	ESPMSL
chr1_1978294_G_T_b38	RP5-902P8.12	-2.762	0.00601	-0.028381	45	0.010275	no	ESPMSL
chr1_777135_T_TC_b38	RP5-902P8.12	-2.746	0.0063	-0.051098	6	0.018606	no	ESPMSL
chr1_866664_G_A_b38	RP5-902P8.12	-2.714	0.00693	-0.050836	13	0.018728	no	ESPMSL
chr1_799082_G_A_b38	RP5-902P8.12	2.702	0.00719	0.038051	12	0.014083	no	ESPMSL
chr1_1970506_T_A_b38	RP5-902P8.12	2.695	0.00733	0.02633	75	0.009768	no	ESPMSL
chr1_1969015_A_G_b38	RP5-902P8.12	-2.692	0.00741	-0.027233	99	0.010118	no	ESPMSL
chr1_1481071_T_C_b38	RP5-902P8.12	-2.668	0.00795	-0.046798	11	0.017543	no	ESPMSL
chr1_1971127_G_A_b38	RP5-902P8.12	-2.654	0.00827	-0.028868	31	0.010877	no	ESPMSL
chr1_1969249_A_AGCCCT_b38	RP5-902P8.12	-2.629	0.0089	-0.030035	25	0.011425	no	ESPMSL
chr1_1968924_GCCCTCCTGGGGGCTCCGGTCCTGCCCAGCAGCCCCAGGTGAGACAGCGCCTGGCGGCCCCTCCCTAGCT_G_b38	RP5-902P8.12	-2.625	0.00901	-0.027512	33	0.010482	no	ESPMSL
chr1_1687734_CAA_C_b38	RP5-902P8.12	2.624	0.00904	0.027399	54	0.010443	no	ESPMSL
chr1_1971027_A_C_b38	RP5-902P8.12	-2.61	0.00939	-0.028386	31	0.010874	no	ESPMSL
chr1_1976566_T_C_b38	RP5-902P8.12	-2.604	0.00957	-0.025845	83	0.009926	no	ESPMSL
chr1_1687643_G_A_b38	RP5-902P8.12	2.591	0.00994	0.024696	83	0.009533	no	ESPMSL
chr1_1706898_T_C_b38	RP5-902P8.12	-3.214	0.00145	-0.049571	7	0.015422	yes	HRTAA
chr1_1642308_C_T_b38	RP5-902P8.12	-3.066	0.00237	-0.050576	7	0.016497	yes	HRTAA
chr1_2211900_C_CTTTTT_b38	RP5-902P8.12	3.011	0.00282	0.061048	6	0.020272	yes	HRTAA
chr1_1706927_A_G_b38	RP5-902P8.12	-2.966	0.00325	-0.045181	8	0.015231	yes	HRTAA
chr1_1704504_A_C_b38	RP5-902P8.12	-2.966	0.00326	-0.046446	8	0.015658	yes	HRTAA
chr1_1704540_G_C_b38	RP5-902P8.12	-2.966	0.00326	-0.046446	8	0.015658	yes	HRTAA
chr1_1706141_C_T_b38	RP5-902P8.12	-2.966	0.00326	-0.046446	8	0.015658	yes	HRTAA
chr1_1707341_C_T_b38	RP5-902P8.12	-2.959	0.00333	-0.047012	7	0.015888	yes	HRTAA
chr1_1703669_G_A_b38	RP5-902P8.12	-2.913	0.00384	-0.046118	8	0.015829	yes	HRTAA
chr1_1703754_T_C_b38	RP5-902P8.12	-2.913	0.00384	-0.046118	8	0.015829	yes	HRTAA
chr1_1704126_C_T_b38	RP5-902P8.12	-2.913	0.00384	-0.046118	8	0.015829	yes	HRTAA
chr1_1708131_C_T_b38	RP5-902P8.12	-2.901	0.00399	-0.048797	5	0.016821	yes	HRTAA
chr1_284929_A_G_b38	RP5-902P8.12	2.893	0.00409	0.053393	6	0.018456	yes	HRTAA
chr1_1708051_G_C_b38	RP5-902P8.12	-2.837	0.00486	-0.046533	4	0.016401	yes	HRTAA
chr1_1719638_C_CTCGCTCTGTCACCCAGGCT_b38	RP5-902P8.12	2.829	0.00499	0.037567	13	0.01328	yes	HRTAA
chr1_1704961_G_A_b38	RP5-902P8.12	-2.792	0.00558	-0.047033	4	0.016848	yes	HRTAA
chr1_1717604_CGCTTTCAGCTAGAGTTTGCTCTCTCTGGTTTTCGGTCTGTGACACACGCAT_C_b38	RP5-902P8.12	2.782	0.00575	0.022456	60	0.008072	yes	HRTAA
chr1_1715135_T_C_b38	RP5-902P8.12	2.756	0.0062	0.039577	11	0.014359	yes	HRTAA
chr1_1182106_A_G_b38	RP5-902P8.12	-2.75	0.00631	-0.03142	15	0.011424	yes	HRTAA
chr1_1708644_AAAAC_A_b38	RP5-902P8.12	-2.746	0.0064	-0.048916	3	0.017814	yes	HRTAA
chr1_1706210_G_A_b38	RP5-902P8.12	-2.744	0.00643	-0.043515	7	0.015858	yes	HRTAA
chr1_1706488_C_G_b38	RP5-902P8.12	-2.744	0.00643	-0.043515	7	0.015858	yes	HRTAA
chr1_598938_G_A_b38	RP5-902P8.12	2.732	0.00666	0.033509	5	0.012264	yes	HRTAA
chr1_1708001_A_T_b38	RP5-902P8.12	-2.712	0.00708	-0.044992	5	0.016591	yes	HRTAA
chr1_1563537_C_CAA_b38	RP5-902P8.12	2.695	0.00744	0.056427	3	0.020939	yes	HRTAA
chr1_1714987_C_T_b38	RP5-902P8.12	2.665	0.0081	0.069076	3	0.025915	yes	HRTAA
chr1_1718786_G_A_b38	RP5-902P8.12	2.665	0.0081	0.069076	3	0.025915	yes	HRTAA
chr1_1719189_G_A_b38	RP5-902P8.12	2.665	0.0081	0.069076	3	0.025915	yes	HRTAA
chr1_1720548_G_A_b38	RP5-902P8.12	2.665	0.0081	0.069076	3	0.025915	yes	HRTAA
chr1_1721336_G_A_b38	RP5-902P8.12	2.665	0.0081	0.069076	3	0.025915	yes	HRTAA
chr1_1717067_A_AT_b38	RP5-902P8.12	2.653	0.00841	0.038777	9	0.014618	yes	HRTAA
chr1_1704673_G_A_b38	RP5-902P8.12	-2.649	0.00849	-0.04221	7	0.015932	yes	HRTAA
chr1_1704489_G_A_b38	RP5-902P8.12	-2.643	0.00864	-0.041589	5	0.015735	yes	HRTAA
chr1_1706748_C_T_b38	RP5-902P8.12	-2.643	0.00864	-0.041589	5	0.015735	yes	HRTAA
chr1_1698048_T_C_b38	RP5-902P8.12	2.643	0.00865	0.050519	7	0.019115	yes	HRTAA
chr1_667265_C_T_b38	RP5-902P8.12	2.638	0.00878	0.038094	17	0.014442	yes	HRTAA
chr1_1708728_C_T_b38	RP5-902P8.12	-2.627	0.00904	-0.044851	3	0.01707	yes	HRTAA
chr1_1708737_G_C_b38	RP5-902P8.12	-2.627	0.00904	-0.044851	3	0.01707	yes	HRTAA
chr1_1708738_G_A_b38	RP5-902P8.12	-2.627	0.00904	-0.044851	3	0.01707	yes	HRTAA
chr1_2216435_A_G_b38	RP5-902P8.12	2.619	0.00926	0.036745	7	0.014029	yes	HRTAA
chr1_1595226_C_G_b38	RP5-902P8.12	2.618	0.00929	0.027224	16	0.010398	yes	HRTAA
chr1_1718040_T_TAG_b38	RP5-902P8.12	2.61	0.00951	0.037639	9	0.014421	yes	HRTAA
chr1_1290232_G_A_b38	RP5-902P8.12	-2.607	0.00959	-0.034125	6	0.01309	yes	HRTAA
chr1_1708393_T_C_b38	RP5-902P8.12	-2.599	0.00982	-0.041774	7	0.016074	yes	HRTAA
chr1_591356_C_G_b38	RP5-902P8.12	3.477	0.000582	0.047753	7	0.013735	no	HRTAA
chr1_1707714_C_G_b38	RP5-902P8.12	-3.129	0.00193	-0.052528	6	0.016788	no	HRTAA
chr1_1707716_T_C_b38	RP5-902P8.12	-3.129	0.00193	-0.052528	6	0.016788	no	HRTAA
chr1_1707744_A_G_b38	RP5-902P8.12	-3.112	0.00203	-0.051618	6	0.016584	no	HRTAA
chr1_1707801_C_G_b38	RP5-902P8.12	-3.076	0.00229	-0.05902	7	0.019187	no	HRTAA
chr1_1739115_T_C_b38	RP5-902P8.12	-2.834	0.0049	-0.054642	10	0.019279	no	HRTAA
chr1_1933640_C_T_b38	RP5-902P8.12	-2.8	0.00544	-0.039515	10	0.014111	no	HRTAA
chr1_1715546_C_T_b38	RP5-902P8.12	2.685	0.00765	0.037107	11	0.013819	no	HRTAA
chr1_1707090_A_G_b38	RP5-902P8.12	-2.67	0.00799	-0.041831	11	0.015665	no	HRTAA
chr1_1939322_T_G_b38	RP5-902P8.12	-2.66	0.00822	-0.038528	9	0.014482	no	HRTAA
chr1_1010755_T_G_b38	RP5-902P8.12	2.63	0.00899	0.035027	7	0.01332	no	HRTAA
chr1_1916540_T_C_b38	RP5-902P8.12	-2.623	0.00916	-0.037259	10	0.014205	no	HRTAA
chr1_1916721_A_G_b38	RP5-902P8.12	-2.623	0.00916	-0.037259	10	0.014205	no	HRTAA
chr1_1917393_A_AAC_b38	RP5-902P8.12	-2.623	0.00916	-0.037259	10	0.014205	no	HRTAA
chr1_1919475_A_G_b38	RP5-902P8.12	-2.623	0.00916	-0.037259	10	0.014205	no	HRTAA
chr1_1922149_C_T_b38	RP5-902P8.12	-2.623	0.00916	-0.037259	10	0.014205	no	HRTAA
chr1_1701564_CG_C_b38	RP5-902P8.12	2.622	0.00919	0.020033	56	0.007641	no	HRTAA
chr1_875916_GCTC_G_b38	RP5-902P8.12	5.294	2.25e-07	0.16472	5	0.031117	yes	HRTLV
chr1_284929_A_G_b38	RP5-902P8.12	3.694	0.00026	0.095513	7	0.025855	yes	HRTLV
chr1_282607_G_A_b38	RP5-902P8.12	3.663	0.000293	0.062977	12	0.017195	yes	HRTLV
chr1_984039_T_C_b38	RP5-902P8.12	-3.241	0.00132	-0.048321	25	0.01491	yes	HRTLV
chr1_284741_A_C_b38	RP5-902P8.12	2.759	0.00613	0.079795	5	0.02892	yes	HRTLV
chr1_1182832_T_C_b38	RP5-902P8.12	-2.695	0.00743	-0.041499	49	0.015401	yes	HRTLV
chr1_1692124_T_G_b38	RP5-902P8.12	2.694	0.00743	0.044529	25	0.016527	yes	HRTLV
chr1_272548_A_C_b38	RP5-902P8.12	2.659	0.00824	0.065798	20	0.024746	yes	HRTLV
chr1_1818305_T_TAA_b38	RP5-902P8.12	2.624	0.00912	0.100616	4	0.038346	yes	HRTLV
chr1_861387_G_A_b38	RP5-902P8.12	2.62	0.00921	0.048784	43	0.018617	yes	HRTLV
chr1_601544_G_A_b38	RP5-902P8.12	-2.617	0.0093	-0.050921	4	0.01946	yes	HRTLV
chr1_1641342_C_A_b38	RP5-902P8.12	5.621	4.19e-08	0.227588	4	0.04049	no	HRTLV
chr1_860178_C_CTTTTTTT_b38	RP5-902P8.12	4.981	1.05e-06	0.120628	6	0.024218	no	HRTLV
chr1_1585973_T_A_b38	RP5-902P8.12	3.574	0.000406	0.072033	18	0.020152	no	HRTLV
chr1_969780_C_T_b38	RP5-902P8.12	-3.532	0.000474	-0.067369	25	0.019074	no	HRTLV
chr1_272389_C_T_b38	RP5-902P8.12	3.478	0.000576	0.109666	12	0.03153	no	HRTLV
chr1_272378_A_T_b38	RP5-902P8.12	3.323	0.000997	0.115928	5	0.03489	no	HRTLV
chr1_2120839_CT_C_b38	RP5-902P8.12	3.242	0.00131	0.056386	34	0.017393	no	HRTLV
chr1_1996920_CA_C_b38	RP5-902P8.12	2.844	0.00474	0.052361	10	0.018408	no	HRTLV
chr1_2035014_C_T_b38	RP5-902P8.12	2.83	0.00495	0.061868	5	0.02186	no	HRTLV
chr1_2028422_G_GC_b38	RP5-902P8.12	2.714	0.00702	0.042854	22	0.01579	no	HRTLV
chr1_2021579_G_A_b38	RP5-902P8.12	2.647	0.00854	0.06167	4	0.023301	no	HRTLV
chr1_2006596_C_CA_b38	RP5-902P8.12	4.127	0.000149	0.117062	6	0.028366	yes	KDNCTX
chr1_1688570_A_T_b38	RP5-902P8.12	4.047	0.000192	0.112565	5	0.027816	yes	KDNCTX
chr1_1684817_G_C_b38	RP5-902P8.12	3.948	0.000263	0.104346	9	0.026433	yes	KDNCTX
chr1_1891444_CG_C_b38	RP5-902P8.12	3.679	0.000602	0.093879	10	0.02552	yes	KDNCTX
chr1_1891450_G_C_b38	RP5-902P8.12	3.679	0.000602	0.093879	10	0.02552	yes	KDNCTX
chr1_1741473_C_T_b38	RP5-902P8.12	3.649	0.000658	0.088935	9	0.02437	yes	KDNCTX
chr1_1707607_C_G_b38	RP5-902P8.12	-3.613	0.000735	-0.074956	17	0.020747	yes	KDNCTX
chr1_1701564_CG_C_b38	RP5-902P8.12	-3.33	0.0017	-0.070993	11	0.021322	yes	KDNCTX
chr1_1691377_C_T_b38	RP5-902P8.12	-3.315	0.00177	-0.091673	6	0.027658	yes	KDNCTX
chr1_1688619_AAAC_A_b38	RP5-902P8.12	3.071	0.00354	0.08629	8	0.028102	yes	KDNCTX
chr1_1828894_T_TAC_b38	RP5-902P8.12	-3.055	0.00371	-0.079004	13	0.025864	yes	KDNCTX
chr1_1864337_G_A_b38	RP5-902P8.12	3.027	0.004	0.087888	6	0.029037	yes	KDNCTX
chr1_1679993_A_G_b38	RP5-902P8.12	2.968	0.00471	0.078285	13	0.026377	yes	KDNCTX
chr1_1758323_T_C_b38	RP5-902P8.12	-2.948	0.00496	-0.074637	16	0.025314	yes	KDNCTX
chr1_1688647_G_A_b38	RP5-902P8.12	2.93	0.00522	0.083489	7	0.028498	yes	KDNCTX
chr1_1688531_T_C_b38	RP5-902P8.12	2.895	0.00574	0.0781	8	0.026982	yes	KDNCTX
chr1_1944074_T_C_b38	RP5-902P8.12	2.877	0.00602	0.072748	14	0.025288	yes	KDNCTX
chr1_1944091_G_C_b38	RP5-902P8.12	2.877	0.00602	0.072748	14	0.025288	yes	KDNCTX
chr1_1944419_C_G_b38	RP5-902P8.12	2.877	0.00602	0.072748	14	0.025288	yes	KDNCTX
chr1_1944675_C_T_b38	RP5-902P8.12	2.877	0.00602	0.072748	14	0.025288	yes	KDNCTX
chr1_1945121_T_C_b38	RP5-902P8.12	2.877	0.00602	0.072748	14	0.025288	yes	KDNCTX
chr1_1946013_C_T_b38	RP5-902P8.12	2.877	0.00602	0.072748	14	0.025288	yes	KDNCTX
chr1_1946058_T_C_b38	RP5-902P8.12	2.877	0.00602	0.072748	14	0.025288	yes	KDNCTX
chr1_1946632_C_T_b38	RP5-902P8.12	2.877	0.00602	0.072748	14	0.025288	yes	KDNCTX
chr1_1947189_C_T_b38	RP5-902P8.12	2.877	0.00602	0.072748	14	0.025288	yes	KDNCTX
chr1_1715745_G_A_b38	RP5-902P8.12	2.852	0.00644	0.0794	10	0.027843	yes	KDNCTX
chr1_1899573_C_T_b38	RP5-902P8.12	2.83	0.00682	0.080823	12	0.028559	yes	KDNCTX
chr1_1901262_C_T_b38	RP5-902P8.12	2.83	0.00682	0.080823	12	0.028559	yes	KDNCTX
chr1_1901386_C_A_b38	RP5-902P8.12	2.83	0.00682	0.080823	12	0.028559	yes	KDNCTX
chr1_1694109_A_ACG_b38	RP5-902P8.12	-2.819	0.00703	-0.071299	13	0.025294	yes	KDNCTX
chr1_1944216_C_T_b38	RP5-902P8.12	2.786	0.00767	0.074281	13	0.026664	yes	KDNCTX
chr1_1844830_C_A_b38	RP5-902P8.12	-2.739	0.00869	-0.072418	12	0.026442	yes	KDNCTX
chr1_1695747_C_T_b38	RP5-902P8.12	-2.704	0.00951	-0.072735	15	0.0269	yes	KDNCTX
chr1_1729296_T_C_b38	RP5-902P8.12	2.704	0.00952	0.07632	7	0.028228	yes	KDNCTX
chr1_1692151_T_C_b38	RP5-902P8.12	3.835	0.000373	0.111376	4	0.029045	no	KDNCTX
chr1_1681928_C_A_b38	RP5-902P8.12	3.8	0.000415	0.097839	11	0.025745	no	KDNCTX
chr1_1706566_G_C_b38	RP5-902P8.12	-3.748	0.000487	-0.09734	10	0.025968	no	KDNCTX
chr1_1742672_C_T_b38	RP5-902P8.12	3.736	0.000506	0.09237	10	0.024727	no	KDNCTX
chr1_1743238_G_C_b38	RP5-902P8.12	3.736	0.000506	0.09237	10	0.024727	no	KDNCTX
chr1_1713751_T_C_b38	RP5-902P8.12	3.72	0.000531	0.099974	10	0.026875	no	KDNCTX
chr1_1880596_T_A_b38	RP5-902P8.12	3.714	0.000541	0.099187	10	0.026706	no	KDNCTX
chr1_1755713_G_A_b38	RP5-902P8.12	3.665	0.000627	0.085218	10	0.023251	no	KDNCTX
chr1_1686147_T_G_b38	RP5-902P8.12	3.593	0.000781	0.093554	11	0.02604	no	KDNCTX
chr1_1846009_AGG_A_b38	RP5-902P8.12	3.575	0.000823	0.097587	11	0.027295	no	KDNCTX
chr1_1846011_G_GTCC_b38	RP5-902P8.12	3.575	0.000823	0.097587	11	0.027295	no	KDNCTX
chr1_1860718_A_C_b38	RP5-902P8.12	3.575	0.000823	0.097587	11	0.027295	no	KDNCTX
chr1_1747472_A_T_b38	RP5-902P8.12	3.551	0.000885	0.092978	10	0.026183	no	KDNCTX
chr1_1748597_C_G_b38	RP5-902P8.12	3.551	0.000885	0.092978	10	0.026183	no	KDNCTX
chr1_1689421_G_A_b38	RP5-902P8.12	3.501	0.00103	0.092039	10	0.026293	no	KDNCTX
chr1_1689446_T_C_b38	RP5-902P8.12	3.501	0.00103	0.092039	10	0.026293	no	KDNCTX
chr1_1769969_CAAAACAAAAACA_C_b38	RP5-902P8.12	3.434	0.00125	0.0929	11	0.027053	no	KDNCTX
chr1_1743586_T_TAC_b38	RP5-902P8.12	3.425	0.00128	0.091058	8	0.026583	no	KDNCTX
chr1_1717953_C_T_b38	RP5-902P8.12	3.419	0.00131	0.089807	11	0.026264	no	KDNCTX
chr1_1703565_T_C_b38	RP5-902P8.12	-3.404	0.00137	-0.08885	11	0.026105	no	KDNCTX
chr1_1704180_T_C_b38	RP5-902P8.12	-3.404	0.00137	-0.08885	11	0.026105	no	KDNCTX
chr1_1704605_G_A_b38	RP5-902P8.12	-3.404	0.00137	-0.08885	11	0.026105	no	KDNCTX
chr1_1716489_A_G_b38	RP5-902P8.12	3.404	0.00137	0.08885	11	0.026105	no	KDNCTX
chr1_1717376_CTAACACCCG_C_b38	RP5-902P8.12	3.404	0.00137	0.08885	11	0.026105	no	KDNCTX
chr1_1688786_G_A_b38	RP5-902P8.12	3.393	0.00141	0.094829	7	0.027945	no	KDNCTX
chr1_1766653_A_G_b38	RP5-902P8.12	3.389	0.00143	0.091524	11	0.027007	no	KDNCTX
chr1_1771864_G_A_b38	RP5-902P8.12	3.389	0.00143	0.091524	11	0.027007	no	KDNCTX
chr1_1772410_T_C_b38	RP5-902P8.12	3.389	0.00143	0.091524	11	0.027007	no	KDNCTX
chr1_1772426_T_A_b38	RP5-902P8.12	3.389	0.00143	0.091524	11	0.027007	no	KDNCTX
chr1_1773460_G_A_b38	RP5-902P8.12	3.389	0.00143	0.091524	11	0.027007	no	KDNCTX
chr1_1773476_C_G_b38	RP5-902P8.12	3.389	0.00143	0.091524	11	0.027007	no	KDNCTX
chr1_1773848_A_C_b38	RP5-902P8.12	3.389	0.00143	0.091524	11	0.027007	no	KDNCTX
chr1_1776461_GAAAC_G_b38	RP5-902P8.12	3.389	0.00143	0.091524	11	0.027007	no	KDNCTX
chr1_1777362_A_G_b38	RP5-902P8.12	3.389	0.00143	0.091524	11	0.027007	no	KDNCTX
chr1_1790040_C_T_b38	RP5-902P8.12	3.389	0.00143	0.091524	11	0.027007	no	KDNCTX
chr1_1808816_G_T_b38	RP5-902P8.12	3.389	0.00143	0.091524	11	0.027007	no	KDNCTX
chr1_1817295_T_C_b38	RP5-902P8.12	3.389	0.00143	0.091524	11	0.027007	no	KDNCTX
chr1_1819825_G_A_b38	RP5-902P8.12	3.389	0.00143	0.091524	11	0.027007	no	KDNCTX
chr1_1827774_A_G_b38	RP5-902P8.12	3.389	0.00143	0.091524	11	0.027007	no	KDNCTX
chr1_1831318_C_T_b38	RP5-902P8.12	3.389	0.00143	0.091524	11	0.027007	no	KDNCTX
chr1_1843381_A_T_b38	RP5-902P8.12	3.389	0.00143	0.091524	11	0.027007	no	KDNCTX
chr1_1847030_A_G_b38	RP5-902P8.12	3.389	0.00143	0.091524	11	0.027007	no	KDNCTX
chr1_1850017_G_T_b38	RP5-902P8.12	3.389	0.00143	0.091524	11	0.027007	no	KDNCTX
chr1_1866508_A_G_b38	RP5-902P8.12	3.389	0.00143	0.091524	11	0.027007	no	KDNCTX
chr1_1875208_T_C_b38	RP5-902P8.12	3.389	0.00143	0.091524	11	0.027007	no	KDNCTX
chr1_1879567_T_C_b38	RP5-902P8.12	3.389	0.00143	0.091524	11	0.027007	no	KDNCTX
chr1_1881249_A_G_b38	RP5-902P8.12	3.389	0.00143	0.091524	11	0.027007	no	KDNCTX
chr1_1886800_G_A_b38	RP5-902P8.12	3.389	0.00143	0.091524	11	0.027007	no	KDNCTX
chr1_1891654_C_CAGAG_b38	RP5-902P8.12	3.389	0.00143	0.091524	11	0.027007	no	KDNCTX
chr1_1705867_T_C_b38	RP5-902P8.12	-3.384	0.00145	-0.07977	17	0.023572	no	KDNCTX
chr1_1762287_A_G_b38	RP5-902P8.12	3.337	0.00166	0.089407	12	0.026792	no	KDNCTX
chr1_1770997_G_A_b38	RP5-902P8.12	3.318	0.00175	0.091756	11	0.027652	no	KDNCTX
chr1_1797530_C_A_b38	RP5-902P8.12	3.316	0.00177	0.089099	11	0.026871	no	KDNCTX
chr1_1836126_C_A_b38	RP5-902P8.12	3.311	0.00179	0.085055	12	0.025686	no	KDNCTX
chr1_1724661_CGATG_C_b38	RP5-902P8.12	3.307	0.00181	0.0836	10	0.025277	no	KDNCTX
chr1_1820356_TA_T_b38	RP5-902P8.12	-3.292	0.0019	-0.096548	5	0.029332	no	KDNCTX
chr1_1791493_C_T_b38	RP5-902P8.12	3.26	0.00207	0.091776	10	0.02815	no	KDNCTX
chr1_1791592_G_A_b38	RP5-902P8.12	3.26	0.00207	0.091776	10	0.02815	no	KDNCTX
chr1_1792927_G_A_b38	RP5-902P8.12	3.26	0.00207	0.091776	10	0.02815	no	KDNCTX
chr1_1687236_T_G_b38	RP5-902P8.12	3.222	0.00231	0.084447	11	0.026206	no	KDNCTX
chr1_1730265_A_G_b38	RP5-902P8.12	3.219	0.00233	0.08999	7	0.027955	no	KDNCTX
chr1_1734263_T_C_b38	RP5-902P8.12	3.214	0.00237	0.082007	9	0.025517	no	KDNCTX
chr1_1752461_G_A_b38	RP5-902P8.12	3.175	0.00264	0.080137	10	0.025237	no	KDNCTX
chr1_1752730_C_G_b38	RP5-902P8.12	3.175	0.00264	0.080137	10	0.025237	no	KDNCTX
chr1_1753319_G_A_b38	RP5-902P8.12	3.175	0.00264	0.080137	10	0.025237	no	KDNCTX
chr1_1753361_G_A_b38	RP5-902P8.12	3.175	0.00264	0.080137	10	0.025237	no	KDNCTX
chr1_1764887_C_A_b38	RP5-902P8.12	3.171	0.00268	0.085598	10	0.026995	no	KDNCTX
chr1_1680214_T_C_b38	RP5-902P8.12	3.165	0.00272	0.082694	11	0.026124	no	KDNCTX
chr1_1680556_A_G_b38	RP5-902P8.12	3.165	0.00272	0.082694	11	0.026124	no	KDNCTX
chr1_1681164_G_A_b38	RP5-902P8.12	3.165	0.00272	0.082694	11	0.026124	no	KDNCTX
chr1_1684266_T_C_b38	RP5-902P8.12	3.165	0.00272	0.082694	11	0.026124	no	KDNCTX
chr1_1687159_G_T_b38	RP5-902P8.12	3.165	0.00272	0.082694	11	0.026124	no	KDNCTX
chr1_1732013_G_A_b38	RP5-902P8.12	3.163	0.00274	0.079393	10	0.025102	no	KDNCTX
chr1_1732412_G_C_b38	RP5-902P8.12	3.163	0.00274	0.079393	10	0.025102	no	KDNCTX
chr1_1732422_G_A_b38	RP5-902P8.12	3.163	0.00274	0.079393	10	0.025102	no	KDNCTX
chr1_1732834_T_TATCG_b38	RP5-902P8.12	3.163	0.00274	0.079393	10	0.025102	no	KDNCTX
chr1_1733576_G_A_b38	RP5-902P8.12	3.163	0.00274	0.079393	10	0.025102	no	KDNCTX
chr1_1735008_G_GGTTT_b38	RP5-902P8.12	3.163	0.00274	0.079393	10	0.025102	no	KDNCTX
chr1_1735370_G_A_b38	RP5-902P8.12	3.163	0.00274	0.079393	10	0.025102	no	KDNCTX
chr1_1735884_C_T_b38	RP5-902P8.12	3.163	0.00274	0.079393	10	0.025102	no	KDNCTX
chr1_1736472_C_T_b38	RP5-902P8.12	3.163	0.00274	0.079393	10	0.025102	no	KDNCTX
chr1_1737703_A_C_b38	RP5-902P8.12	3.163	0.00274	0.079393	10	0.025102	no	KDNCTX
chr1_1737704_C_T_b38	RP5-902P8.12	3.163	0.00274	0.079393	10	0.025102	no	KDNCTX
chr1_1738309_A_G_b38	RP5-902P8.12	3.163	0.00274	0.079393	10	0.025102	no	KDNCTX
chr1_1740107_G_A_b38	RP5-902P8.12	3.163	0.00274	0.079393	10	0.025102	no	KDNCTX
chr1_1740160_G_A_b38	RP5-902P8.12	3.163	0.00274	0.079393	10	0.025102	no	KDNCTX
chr1_1726053_G_C_b38	RP5-902P8.12	3.115	0.00313	0.131685	3	0.04228	no	KDNCTX
chr1_1697467_G_A_b38	RP5-902P8.12	-3.106	0.00322	-0.079186	12	0.025498	no	KDNCTX
chr1_1754482_TCCCTGGGACCGAAGTCGCCCCA_T_b38	RP5-902P8.12	3.105	0.00322	0.076259	11	0.024556	no	KDNCTX
chr1_1684308_G_C_b38	RP5-902P8.12	3.105	0.00322	0.081767	11	0.026338	no	KDNCTX
chr1_1684619_G_A_b38	RP5-902P8.12	3.105	0.00322	0.081767	11	0.026338	no	KDNCTX
chr1_1881082_C_T_b38	RP5-902P8.12	3.102	0.00325	0.085602	11	0.027594	no	KDNCTX
chr1_1688442_T_C_b38	RP5-902P8.12	3.069	0.00356	0.082195	8	0.026782	no	KDNCTX
chr1_1688457_G_A_b38	RP5-902P8.12	3.053	0.00372	0.076316	11	0.024999	no	KDNCTX
chr1_1881428_C_CT_b38	RP5-902P8.12	3.05	0.00375	0.081101	12	0.026589	no	KDNCTX
chr1_1756043_G_T_b38	RP5-902P8.12	3.023	0.00404	0.079148	10	0.026178	no	KDNCTX
chr1_1759354_G_A_b38	RP5-902P8.12	3.023	0.00404	0.079148	10	0.026178	no	KDNCTX
chr1_1759611_C_T_b38	RP5-902P8.12	3.023	0.00404	0.079148	10	0.026178	no	KDNCTX
chr1_1705816_A_G_b38	RP5-902P8.12	-3.018	0.0041	-0.068555	18	0.022717	no	KDNCTX
chr1_1687734_CAA_C_b38	RP5-902P8.12	3.017	0.00411	0.085632	7	0.028381	no	KDNCTX
chr1_1739883_C_T_b38	RP5-902P8.12	3.015	0.00414	0.073656	8	0.024433	no	KDNCTX
chr1_1694167_G_A_b38	RP5-902P8.12	-2.993	0.0044	-0.076758	12	0.02565	no	KDNCTX
chr1_1753033_C_T_b38	RP5-902P8.12	2.984	0.0045	0.075601	11	0.025335	no	KDNCTX
chr1_1877330_T_C_b38	RP5-902P8.12	2.979	0.00457	0.083053	10	0.027882	no	KDNCTX
chr1_1736832_GAAAA_G_b38	RP5-902P8.12	2.969	0.00469	0.076385	10	0.02573	no	KDNCTX
chr1_1728604_T_A_b38	RP5-902P8.12	2.966	0.00473	0.079863	7	0.026926	no	KDNCTX
chr1_1729539_C_A_b38	RP5-902P8.12	2.966	0.00473	0.079863	7	0.026926	no	KDNCTX
chr1_1688586_C_T_b38	RP5-902P8.12	2.963	0.00477	0.083474	7	0.028171	no	KDNCTX
chr1_1683909_A_C_b38	RP5-902P8.12	2.948	0.00497	0.073222	14	0.024838	no	KDNCTX
chr1_1708362_T_C_b38	RP5-902P8.12	-2.919	0.00538	-0.076672	11	0.02627	no	KDNCTX
chr1_1750428_G_C_b38	RP5-902P8.12	2.907	0.00555	0.081975	8	0.028199	no	KDNCTX
chr1_1748780_G_A_b38	RP5-902P8.12	2.903	0.00561	0.072956	13	0.02513	no	KDNCTX
chr1_1944420_A_G_b38	RP5-902P8.12	2.897	0.00571	0.073968	14	0.025534	no	KDNCTX
chr1_1945975_TG_T_b38	RP5-902P8.12	2.883	0.00593	0.069864	16	0.024237	no	KDNCTX
chr1_590378_T_C_b38	RP5-902P8.12	2.881	0.00596	0.115527	6	0.040101	no	KDNCTX
chr1_1738525_G_A_b38	RP5-902P8.12	2.863	0.00625	0.074951	8	0.02618	no	KDNCTX
chr1_1696117_G_A_b38	RP5-902P8.12	-2.793	0.00752	-0.073831	12	0.026432	no	KDNCTX
chr1_1738207_ACT_A_b38	RP5-902P8.12	2.79	0.00759	0.079773	6	0.028593	no	KDNCTX
chr1_1750440_G_A_b38	RP5-902P8.12	2.774	0.00793	0.077485	8	0.027937	no	KDNCTX
chr1_1750280_A_G_b38	RP5-902P8.12	2.771	0.00798	0.068422	13	0.024694	no	KDNCTX
chr1_1944182_G_C_b38	RP5-902P8.12	2.768	0.00804	0.069194	14	0.024996	no	KDNCTX
chr1_1686017_A_AT_b38	RP5-902P8.12	2.76	0.00822	0.070977	12	0.025717	no	KDNCTX
chr1_1687061_C_T_b38	RP5-902P8.12	2.76	0.00822	0.070977	12	0.025717	no	KDNCTX
chr1_1687643_G_A_b38	RP5-902P8.12	2.76	0.00822	0.070977	12	0.025717	no	KDNCTX
chr1_1480990_T_C_b38	RP5-902P8.12	-2.759	0.00825	-0.102919	5	0.03731	no	KDNCTX
chr1_1934896_C_T_b38	RP5-902P8.12	-2.753	0.00838	-0.084217	4	0.030596	no	KDNCTX
chr1_1696366_A_C_b38	RP5-902P8.12	-2.728	0.00894	-0.072523	12	0.026588	no	KDNCTX
chr1_1729998_T_TGGGA_b38	RP5-902P8.12	2.724	0.00903	0.071221	6	0.026146	no	KDNCTX
chr1_1851414_GA_G_b38	RP5-902P8.12	2.723	0.00905	0.084207	6	0.030924	no	KDNCTX
chr1_1849781_T_C_b38	RP5-902P8.12	2.719	0.00914	0.082673	3	0.030402	no	KDNCTX
chr1_1689465_A_G_b38	RP5-902P8.12	2.706	0.00947	0.070601	11	0.026094	no	KDNCTX
chr1_1762759_AAATG_A_b38	RP5-902P8.12	-2.689	0.00989	-0.070577	14	0.026249	no	KDNCTX
chr1_1658422_T_C_b38	RP5-902P8.12	2.687	0.00993	0.087907	3	0.032712	no	KDNCTX
chr1_1902481_G_A_b38	RP5-902P8.12	2.687	0.00993	0.076018	12	0.028289	no	KDNCTX
chr1_1864337_G_A_b38	RP5-902P8.12	3.122	0.00212	0.071608	21	0.022938	yes	LIVER
chr1_1074910_TCACA_T_b38	RP5-902P8.12	-3.108	0.00222	-0.094494	6	0.030408	yes	LIVER
chr1_598944_G_T_b38	RP5-902P8.12	3.013	0.00299	0.094153	3	0.031245	yes	LIVER
chr1_1062056_CTCCCTCCCTTGTCCCCGTTCCCTCCG_C_b38	RP5-902P8.12	3.012	0.003	0.081243	9	0.026972	yes	LIVER
chr1_1074061_G_A_b38	RP5-902P8.12	-2.986	0.00325	-0.091868	6	0.030766	yes	LIVER
chr1_1056344_C_T_b38	RP5-902P8.12	2.877	0.00454	0.075552	18	0.026258	yes	LIVER
chr1_1657926_A_AG_b38	RP5-902P8.12	-2.816	0.00544	-0.082115	9	0.029156	yes	LIVER
chr1_1068249_C_T_b38	RP5-902P8.12	2.754	0.00654	0.063922	26	0.02321	yes	LIVER
chr1_1589495_CTTT_C_b38	RP5-902P8.12	2.743	0.00675	0.069655	17	0.025394	yes	LIVER
chr1_1065797_G_C_b38	RP5-902P8.12	2.648	0.00887	0.061116	25	0.02308	yes	LIVER
chr1_1059011_G_T_b38	RP5-902P8.12	3.371	0.00093	0.087848	17	0.026058	no	LIVER
chr1_1062389_CG_C_b38	RP5-902P8.12	-3.058	0.0026	-0.075306	14	0.024627	no	LIVER
chr1_1057472_AAG_A_b38	RP5-902P8.12	2.971	0.00341	0.076822	18	0.025862	no	LIVER
chr1_1089890_C_T_b38	RP5-902P8.12	-2.869	0.00465	-0.102745	3	0.035809	no	LIVER
chr1_1053552_G_C_b38	RP5-902P8.12	2.84	0.00508	0.076924	17	0.02709	no	LIVER
chr1_1747695_A_G_b38	RP5-902P8.12	2.607	0.00995	0.055456	41	0.02127	no	LIVER
chr1_277226_A_C_b38	RP5-902P8.12	-3.756	0.000195	-0.099443	13	0.026474	yes	LUNG
chr1_1099202_G_A_b38	RP5-902P8.12	3.576	0.000387	0.08406	7	0.023508	yes	LUNG
chr1_1099309_T_G_b38	RP5-902P8.12	3.456	6e-04	0.065661	16	0.018998	yes	LUNG
chr1_1095253_G_A_b38	RP5-902P8.12	3.434	0.000651	0.061716	23	0.017973	yes	LUNG
chr1_1096593_C_T_b38	RP5-902P8.12	3.434	0.000651	0.061716	23	0.017973	yes	LUNG
chr1_1097574_A_G_b38	RP5-902P8.12	3.434	0.000651	0.061716	23	0.017973	yes	LUNG
chr1_1098216_T_C_b38	RP5-902P8.12	3.434	0.000651	0.061716	23	0.017973	yes	LUNG
chr1_1098300_T_A_b38	RP5-902P8.12	3.434	0.000651	0.061716	23	0.017973	yes	LUNG
chr1_1098614_C_T_b38	RP5-902P8.12	3.434	0.000651	0.061716	23	0.017973	yes	LUNG
chr1_1098820_T_C_b38	RP5-902P8.12	3.434	0.000651	0.061716	23	0.017973	yes	LUNG
chr1_1098290_T_C_b38	RP5-902P8.12	3.386	0.000773	0.060218	26	0.017786	yes	LUNG
chr1_1094425_A_G_b38	RP5-902P8.12	3.354	0.000864	0.059868	25	0.017848	yes	LUNG
chr1_1095185_C_T_b38	RP5-902P8.12	3.351	0.000874	0.060322	22	0.018001	yes	LUNG
chr1_1098246_C_G_b38	RP5-902P8.12	3.333	0.00093	0.059308	20	0.017792	yes	LUNG
chr1_1092465_T_G_b38	RP5-902P8.12	3.289	0.00108	0.058946	22	0.01792	yes	LUNG
chr1_1092466_T_C_b38	RP5-902P8.12	3.289	0.00108	0.058946	22	0.01792	yes	LUNG
chr1_591509_C_T_b38	RP5-902P8.12	3.274	0.00114	0.153263	3	0.046808	yes	LUNG
chr1_1099189_A_G_b38	RP5-902P8.12	3.256	0.00121	0.075283	8	0.023118	yes	LUNG
chr1_1134143_T_TC_b38	RP5-902P8.12	3.132	0.00185	0.096165	5	0.030704	yes	LUNG
chr1_1962899_A_C_b38	RP5-902P8.12	3.104	0.00203	0.060251	11	0.01941	yes	LUNG
chr1_1098863_C_T_b38	RP5-902P8.12	2.893	0.004	0.059853	7	0.020688	yes	LUNG
chr1_593901_G_A_b38	RP5-902P8.12	2.842	0.0047	0.114172	3	0.04018	yes	LUNG
chr1_1968747_T_C_b38	RP5-902P8.12	2.84	0.00472	0.05304	13	0.018677	yes	LUNG
chr1_1967961_G_A_b38	RP5-902P8.12	2.785	0.00558	0.049689	14	0.01784	yes	LUNG
chr1_1965567_C_T_b38	RP5-902P8.12	2.783	0.00562	0.052495	13	0.018865	yes	LUNG
chr1_588599_A_G_b38	RP5-902P8.12	2.768	0.00588	0.056036	12	0.020244	yes	LUNG
chr1_1653863_C_A_b38	RP5-902P8.12	-2.768	0.00588	-0.051185	14	0.018492	yes	LUNG
chr1_1890472_C_G_b38	RP5-902P8.12	2.696	0.00729	0.064777	7	0.02403	yes	LUNG
chr1_1120047_GA_G_b38	RP5-902P8.12	2.636	0.00869	0.051522	15	0.019548	yes	LUNG
chr1_1989803_A_G_b38	RP5-902P8.12	2.624	0.00898	0.039756	60	0.01515	yes	LUNG
chr1_1681101_C_T_b38	RP5-902P8.12	2.621	0.00907	0.057418	9	0.021906	yes	LUNG
chr1_291791_T_C_b38	RP5-902P8.12	5.163	3.68e-07	0.195082	7	0.037785	no	LUNG
chr1_288386_G_A_b38	RP5-902P8.12	5.112	4.74e-07	0.172764	8	0.033793	no	LUNG
chr1_292126_G_A_b38	RP5-902P8.12	4.623	4.97e-06	0.154769	9	0.033478	no	LUNG
chr1_1095680_A_G_b38	RP5-902P8.12	4.009	7.16e-05	0.109235	3	0.027249	no	LUNG
chr1_1097584_A_ATT_b38	RP5-902P8.12	3.978	8.12e-05	0.110038	5	0.027663	no	LUNG
chr1_586844_G_A_b38	RP5-902P8.12	3.779	0.000179	0.177887	3	0.047073	no	LUNG
chr1_285175_C_T_b38	RP5-902P8.12	3.59	0.000367	0.081582	12	0.022722	no	LUNG
chr1_1099341_T_C_b38	RP5-902P8.12	3.476	0.00056	0.064861	18	0.018661	no	LUNG
chr1_1810535_C_CA_b38	RP5-902P8.12	3.475	0.000561	0.120148	5	0.034576	no	LUNG
chr1_277677_G_T_b38	RP5-902P8.12	-3.1	0.00206	-0.149407	7	0.048193	no	LUNG
chr1_1531589_C_T_b38	RP5-902P8.12	2.962	0.00322	0.066753	8	0.022539	no	LUNG
chr1_264730_T_A_b38	RP5-902P8.12	2.912	0.00378	0.10087	15	0.034644	no	LUNG
chr1_2006596_C_CA_b38	RP5-902P8.12	-2.865	0.00437	-0.050656	30	0.017681	no	LUNG
chr1_1534402_G_C_b38	RP5-902P8.12	2.815	0.00509	0.064254	5	0.022825	no	LUNG
chr1_1659940_A_C_b38	RP5-902P8.12	-2.797	0.00538	-0.053531	9	0.019136	no	LUNG
chr1_1967961_G_GTGAA_b38	RP5-902P8.12	-2.719	0.0068	-0.045484	22	0.016728	no	LUNG
chr1_1960886_T_C_b38	RP5-902P8.12	-2.716	0.00687	-0.049012	16	0.018046	no	LUNG
chr1_1223251_A_G_b38	RP5-902P8.12	-2.714	0.0069	-0.060434	6	0.022266	no	LUNG
chr1_1637577_T_C_b38	RP5-902P8.12	-2.692	0.00737	-0.042921	32	0.015942	no	LUNG
chr1_2120839_CT_C_b38	RP5-902P8.12	2.669	0.00788	0.046552	42	0.017439	no	LUNG
chr1_1641261_C_T_b38	RP5-902P8.12	-2.641	0.00855	-0.046184	25	0.017485	no	LUNG
chr1_1739996_G_T_b38	RP5-902P8.12	2.613	0.00929	0.111494	3	0.042676	no	LUNG
chr1_1897190_CT_C_b38	RP5-902P8.12	2.59	0.00992	0.047549	10	0.018361	no	LUNG
chr1_1281640_G_C_b38	RP5-902P8.12	3.454	0.000767	0.090923	5	0.02632	yes	SLVRYG
chr1_1281878_G_C_b38	RP5-902P8.12	3.454	0.000767	0.090923	5	0.02632	yes	SLVRYG
chr1_1960047_A_G_b38	RP5-902P8.12	-3.001	0.00329	-0.117261	4	0.03908	yes	SLVRYG
chr1_853415_T_TCTGATCAACATGAGATGACCGCCGTGTGGTAAACTGATGAACCCCGACG_b38	RP5-902P8.12	-2.847	0.0052	-0.049875	6	0.017515	yes	SLVRYG
chr1_1518541_T_C_b38	RP5-902P8.12	2.844	0.00525	0.066089	8	0.023236	yes	SLVRYG
chr1_1280332_C_T_b38	RP5-902P8.12	2.677	0.00849	0.079522	5	0.029705	yes	SLVRYG
chr1_789680_A_AGGAATGGAATGGAAT_b38	RP5-902P8.12	-3.053	0.0028	-0.056567	13	0.018528	no	SLVRYG
chr1_1976834_T_C_b38	RP5-902P8.12	-2.94	0.00395	-0.132812	7	0.045173	no	SLVRYG
chr1_1657081_C_T_b38	RP5-902P8.12	2.891	0.00457	0.058439	9	0.020212	no	SLVRYG
chr1_2093604_C_T_b38	RP5-902P8.12	-2.875	0.00479	-0.054431	19	0.01893	no	SLVRYG
chr1_2098568_CCT_C_b38	RP5-902P8.12	-2.863	0.00497	-0.05459	23	0.019069	no	SLVRYG
chr1_729678_C_G_b38	RP5-902P8.12	2.718	0.00756	0.061015	5	0.022451	no	SLVRYG
chr1_1991468_T_C_b38	RP5-902P8.12	-2.715	0.00763	-0.122535	7	0.045138	no	SLVRYG
chr1_1657093_C_A_b38	RP5-902P8.12	2.632	0.00961	0.053458	9	0.020307	no	SLVRYG
chr1_2101945_G_C_b38	RP5-902P8.12	-2.632	0.00964	-0.050456	22	0.019174	no	SLVRYG
chr1_2124387_G_A_b38	RP5-902P8.12	3.666	0.000267	0.068633	14	0.018721	yes	MSCLSK
chr1_2004501_CAA_C_b38	RP5-902P8.12	3.537	0.000434	0.048544	9	0.013725	yes	MSCLSK
chr1_1641342_C_A_b38	RP5-902P8.12	3.263	0.00116	0.094819	5	0.029063	yes	MSCLSK
chr1_2106797_G_GACTCTTCAGCAGGCCCCTCTGGTGGGCGAGGACCTCCACACGTGTCACCAGGCCAGGTA_b38	RP5-902P8.12	-3.17	0.0016	-0.043465	24	0.013713	yes	MSCLSK
chr1_1679100_A_G_b38	RP5-902P8.12	2.951	0.00329	0.025281	119	0.008567	yes	MSCLSK
chr1_734210_G_T_b38	RP5-902P8.12	2.743	0.00627	0.044524	10	0.016234	yes	MSCLSK
chr1_607319_T_C_b38	RP5-902P8.12	2.711	0.0069	0.033651	23	0.012414	yes	MSCLSK
chr1_641813_G_A_b38	RP5-902P8.12	-2.699	0.00713	-0.032164	6	0.011915	yes	MSCLSK
chr1_591478_T_G_b38	RP5-902P8.12	2.635	0.00861	0.055182	5	0.020939	yes	MSCLSK
chr1_1544705_G_T_b38	RP5-902P8.12	-2.598	0.0096	-0.073581	3	0.028326	yes	MSCLSK
chr1_1605709_G_C_b38	RP5-902P8.12	5.32	1.44e-07	0.146035	3	0.027449	no	MSCLSK
chr1_791544_T_TGAATGGAATGGAATCGAATG_b38	RP5-902P8.12	3.641	0.000294	0.066409	6	0.018241	no	MSCLSK
chr1_1650664_CT_C_b38	RP5-902P8.12	3.516	0.000469	0.034554	63	0.009828	no	MSCLSK
chr1_1993854_C_T_b38	RP5-902P8.12	3.353	0.000846	0.042971	12	0.012814	no	MSCLSK
chr1_1288318_C_T_b38	RP5-902P8.12	3.283	0.00108	0.088175	3	0.026857	no	MSCLSK
chr1_1324055_GCTGAGGGA_G_b38	RP5-902P8.12	3.145	0.00174	0.074952	5	0.023831	no	MSCLSK
chr1_1684789_C_CAAAAA_b38	RP5-902P8.12	3.009	0.00273	0.055831	14	0.018555	no	MSCLSK
chr1_2065711_G_A_b38	RP5-902P8.12	-2.815	0.00503	-0.029319	58	0.010416	no	MSCLSK
chr1_1605794_G_C_b38	RP5-902P8.12	2.776	0.00566	0.0524	7	0.018875	no	MSCLSK
chr1_1030889_ATGTGTGTGTGTGCAGTGCATGGTGCTGTGAGATCAGCG_A_b38	RP5-902P8.12	2.701	0.0071	0.040899	17	0.015143	no	MSCLSK
chr1_1528513_G_C_b38	RP5-902P8.12	2.696	0.00719	0.05879	3	0.021803	no	MSCLSK
chr1_1653863_C_A_b38	RP5-902P8.12	-2.673	0.00771	-0.029671	19	0.0111	no	MSCLSK
chr1_1393952_C_T_b38	RP5-902P8.12	-2.594	0.00971	-0.044729	3	0.017244	no	MSCLSK
chr1_1238902_T_C_b38	RP5-902P8.12	5.151	3.85e-07	0.086009	70	0.016699	yes	NERVET
chr1_1221049_C_G_b38	RP5-902P8.12	4.867	1.56e-06	0.084175	65	0.017294	yes	NERVET
chr1_2065678_C_CA_b38	RP5-902P8.12	4.784	2.32e-06	0.100934	24	0.0211	yes	NERVET
chr1_1236037_C_T_b38	RP5-902P8.12	4.737	2.9e-06	0.07278	93	0.015365	yes	NERVET
chr1_1611570_CTT_C_b38	RP5-902P8.12	4.333	1.8e-05	0.171947	3	0.039679	yes	NERVET
chr1_1258206_AT_A_b38	RP5-902P8.12	4.302	2.07e-05	0.079691	55	0.018525	yes	NERVET
chr1_1231507_T_C_b38	RP5-902P8.12	4.244	2.65e-05	0.087455	13	0.020606	yes	NERVET
chr1_1259424_T_C_b38	RP5-902P8.12	4.148	4e-05	0.080008	63	0.019291	yes	NERVET
chr1_1228424_C_T_b38	RP5-902P8.12	4.069	5.55e-05	0.084358	11	0.020731	yes	NERVET
chr1_1230159_G_A_b38	RP5-902P8.12	4.041	6.22e-05	0.073592	37	0.018209	yes	NERVET
chr1_1281640_G_C_b38	RP5-902P8.12	3.939	9.45e-05	0.102991	9	0.026147	yes	NERVET
chr1_1281878_G_C_b38	RP5-902P8.12	3.939	9.45e-05	0.102991	9	0.026147	yes	NERVET
chr1_1231710_CCCCCGGGAA_C_b38	RP5-902P8.12	3.916	0.000104	0.086344	14	0.02205	yes	NERVET
chr1_1641342_C_A_b38	RP5-902P8.12	3.869	0.000125	0.209705	3	0.054208	yes	NERVET
chr1_1229369_G_GC_b38	RP5-902P8.12	3.844	0.000138	0.077039	20	0.020041	yes	NERVET
chr1_1337898_A_G_b38	RP5-902P8.12	-3.832	0.000145	-0.073003	20	0.019052	yes	NERVET
chr1_1235602_C_A_b38	RP5-902P8.12	3.81	0.000158	0.087489	8	0.022962	yes	NERVET
chr1_1238231_G_A_b38	RP5-902P8.12	3.747	0.000202	0.073886	25	0.01972	yes	NERVET
chr1_1765746_G_T_b38	RP5-902P8.12	3.625	0.000321	0.100946	3	0.027849	yes	NERVET
chr1_1236303_A_G_b38	RP5-902P8.12	3.623	0.000324	0.077642	14	0.02143	yes	NERVET
chr1_1205055_G_T_b38	RP5-902P8.12	3.604	0.000347	0.058742	95	0.016298	yes	NERVET
chr1_1193398_C_CTTA_b38	RP5-902P8.12	3.566	4e-04	0.058174	92	0.016313	yes	NERVET
chr1_1674633_C_CA_b38	RP5-902P8.12	-3.563	0.000405	-0.057961	60	0.016267	yes	NERVET
chr1_1934807_G_A_b38	RP5-902P8.12	3.496	0.000518	0.088381	6	0.02528	yes	NERVET
chr1_1288085_GC_G_b38	RP5-902P8.12	3.488	0.000533	0.082531	9	0.023661	yes	NERVET
chr1_1238883_G_A_b38	RP5-902P8.12	3.393	0.000752	0.087964	4	0.025928	yes	NERVET
chr1_1367028_A_G_b38	RP5-902P8.12	-3.347	0.000883	-0.075966	15	0.022696	yes	NERVET
chr1_1358384_G_C_b38	RP5-902P8.12	-3.323	0.000961	-0.063655	65	0.019155	yes	NERVET
chr1_1235997_A_G_b38	RP5-902P8.12	3.314	0.000992	0.076141	15	0.022976	yes	NERVET
chr1_1226486_C_T_b38	RP5-902P8.12	3.31	0.00101	0.076345	7	0.023068	yes	NERVET
chr1_1224281_GTTTTA_G_b38	RP5-902P8.12	3.295	0.00106	0.085872	4	0.026063	yes	NERVET
chr1_1227886_G_A_b38	RP5-902P8.12	3.295	0.00106	0.085872	4	0.026063	yes	NERVET
chr1_1230250_G_A_b38	RP5-902P8.12	3.295	0.00106	0.085872	4	0.026063	yes	NERVET
chr1_1217733_G_A_b38	RP5-902P8.12	3.278	0.00113	0.076552	8	0.023356	yes	NERVET
chr1_1375678_TA_T_b38	RP5-902P8.12	-3.242	0.00127	-0.065223	29	0.020121	yes	NERVET
chr1_1312114_T_C_b38	RP5-902P8.12	-3.205	0.00145	-0.06051	67	0.018881	yes	NERVET
chr1_1330125_G_A_b38	RP5-902P8.12	-3.204	0.00145	-0.061456	66	0.019182	yes	NERVET
chr1_1240367_A_G_b38	RP5-902P8.12	3.188	0.00153	0.077022	6	0.024164	yes	NERVET
chr1_1240390_G_A_b38	RP5-902P8.12	3.186	0.00154	0.083698	4	0.026269	yes	NERVET
chr1_1235642_G_C_b38	RP5-902P8.12	3.175	0.0016	0.070354	9	0.02216	yes	NERVET
chr1_1221355_T_C_b38	RP5-902P8.12	3.173	0.00161	0.078893	4	0.024861	yes	NERVET
chr1_1239126_C_CT_b38	RP5-902P8.12	3.159	0.00169	0.075941	7	0.024042	yes	NERVET
chr1_1239127_A_ACATGCATCC_b38	RP5-902P8.12	3.159	0.00169	0.075941	7	0.024042	yes	NERVET
chr1_1239574_T_C_b38	RP5-902P8.12	3.159	0.00169	0.075941	7	0.024042	yes	NERVET
chr1_1771973_A_AT_b38	RP5-902P8.12	3.131	0.00185	0.065031	60	0.020771	yes	NERVET
chr1_1653863_C_A_b38	RP5-902P8.12	3.101	0.00205	0.059175	17	0.019082	yes	NERVET
chr1_1379091_T_G_b38	RP5-902P8.12	-3.091	0.00212	-0.06414	18	0.020753	yes	NERVET
chr1_1239925_G_A_b38	RP5-902P8.12	3.079	0.0022	0.084011	4	0.027289	yes	NERVET
chr1_1215852_T_C_b38	RP5-902P8.12	3.057	0.00237	0.061571	17	0.020141	yes	NERVET
chr1_1221275_G_A_b38	RP5-902P8.12	3.046	0.00245	0.076235	4	0.025026	yes	NERVET
chr1_1225285_G_A_b38	RP5-902P8.12	3.041	0.00249	0.074379	6	0.02446	yes	NERVET
chr1_1225476_T_C_b38	RP5-902P8.12	3.04	0.0025	0.07151	10	0.023521	yes	NERVET
chr1_1226013_C_T_b38	RP5-902P8.12	3.04	0.0025	0.07151	10	0.023521	yes	NERVET
chr1_1216593_G_C_b38	RP5-902P8.12	3.009	0.00276	0.062204	14	0.02067	yes	NERVET
chr1_1370113_A_G_b38	RP5-902P8.12	-3.004	0.00281	-0.054685	50	0.018204	yes	NERVET
chr1_1309988_G_A_b38	RP5-902P8.12	-3.003	0.00281	-0.056503	69	0.018813	yes	NERVET
chr1_1313807_G_A_b38	RP5-902P8.12	-3.003	0.00281	-0.056503	69	0.018813	yes	NERVET
chr1_1219941_C_T_b38	RP5-902P8.12	2.979	0.00305	0.081013	5	0.027197	yes	NERVET
chr1_1223640_A_G_b38	RP5-902P8.12	2.971	0.00313	0.073296	5	0.024673	yes	NERVET
chr1_1222245_C_T_b38	RP5-902P8.12	2.952	0.00331	0.072925	5	0.0247	yes	NERVET
chr1_1780989_A_C_b38	RP5-902P8.12	2.942	0.00342	0.079278	4	0.026947	yes	NERVET
chr1_814476_C_T_b38	RP5-902P8.12	-2.933	0.00352	-0.056911	27	0.019402	yes	NERVET
chr1_1365566_G_A_b38	RP5-902P8.12	-2.932	0.00354	-0.058452	20	0.019938	yes	NERVET
chr1_1212390_G_A_b38	RP5-902P8.12	2.931	0.00354	0.077694	5	0.026506	yes	NERVET
chr1_1363898_C_T_b38	RP5-902P8.12	-2.931	0.00355	-0.058864	20	0.020085	yes	NERVET
chr1_1366529_TTAG_T_b38	RP5-902P8.12	-2.931	0.00355	-0.058864	20	0.020085	yes	NERVET
chr1_1741276_C_T_b38	RP5-902P8.12	2.931	0.00355	0.0464	72	0.015832	yes	NERVET
chr1_1806456_G_A_b38	RP5-902P8.12	2.926	0.0036	0.078234	4	0.026736	yes	NERVET
chr1_1806461_C_T_b38	RP5-902P8.12	2.926	0.0036	0.078234	4	0.026736	yes	NERVET
chr1_1394041_G_A_b38	RP5-902P8.12	2.926	0.00361	0.074304	6	0.025398	yes	NERVET
chr1_1223644_C_T_b38	RP5-902P8.12	2.918	0.0037	0.070532	7	0.024172	yes	NERVET
chr1_1249880_A_G_b38	RP5-902P8.12	2.909	0.0038	0.061686	24	0.021205	yes	NERVET
chr1_1221960_A_G_b38	RP5-902P8.12	2.909	0.0038	0.071829	5	0.024693	yes	NERVET
chr1_1221992_G_A_b38	RP5-902P8.12	2.909	0.0038	0.071829	5	0.024693	yes	NERVET
chr1_1222167_T_C_b38	RP5-902P8.12	2.909	0.0038	0.071829	5	0.024693	yes	NERVET
chr1_1222184_G_A_b38	RP5-902P8.12	2.909	0.0038	0.071829	5	0.024693	yes	NERVET
chr1_1222251_G_A_b38	RP5-902P8.12	2.909	0.0038	0.071829	5	0.024693	yes	NERVET
chr1_1222304_C_T_b38	RP5-902P8.12	2.909	0.0038	0.071829	5	0.024693	yes	NERVET
chr1_1222325_C_G_b38	RP5-902P8.12	2.909	0.0038	0.071829	5	0.024693	yes	NERVET
chr1_1222454_C_T_b38	RP5-902P8.12	2.909	0.0038	0.071829	5	0.024693	yes	NERVET
chr1_1222482_C_T_b38	RP5-902P8.12	2.909	0.0038	0.071829	5	0.024693	yes	NERVET
chr1_1222579_C_T_b38	RP5-902P8.12	2.909	0.0038	0.071829	5	0.024693	yes	NERVET
chr1_1222611_G_A_b38	RP5-902P8.12	2.909	0.0038	0.071829	5	0.024693	yes	NERVET
chr1_1222640_A_C_b38	RP5-902P8.12	2.909	0.0038	0.071829	5	0.024693	yes	NERVET
chr1_1222897_G_A_b38	RP5-902P8.12	2.909	0.0038	0.071829	5	0.024693	yes	NERVET
chr1_1222946_G_A_b38	RP5-902P8.12	2.909	0.0038	0.071829	5	0.024693	yes	NERVET
chr1_1222977_A_G_b38	RP5-902P8.12	2.909	0.0038	0.071829	5	0.024693	yes	NERVET
chr1_1223154_G_GAC_b38	RP5-902P8.12	2.909	0.0038	0.071829	5	0.024693	yes	NERVET
chr1_1223182_AAC_A_b38	RP5-902P8.12	2.909	0.0038	0.071829	5	0.024693	yes	NERVET
chr1_1223593_A_T_b38	RP5-902P8.12	2.909	0.0038	0.071829	5	0.024693	yes	NERVET
chr1_1223595_A_C_b38	RP5-902P8.12	2.909	0.0038	0.071829	5	0.024693	yes	NERVET
chr1_1223682_T_C_b38	RP5-902P8.12	2.909	0.0038	0.071829	5	0.024693	yes	NERVET
chr1_1224105_C_T_b38	RP5-902P8.12	2.909	0.0038	0.071829	5	0.024693	yes	NERVET
chr1_1224349_T_G_b38	RP5-902P8.12	2.909	0.0038	0.071829	5	0.024693	yes	NERVET
chr1_1224844_C_T_b38	RP5-902P8.12	2.909	0.0038	0.071829	5	0.024693	yes	NERVET
chr1_1224846_A_G_b38	RP5-902P8.12	2.909	0.0038	0.071829	5	0.024693	yes	NERVET
chr1_1225429_T_C_b38	RP5-902P8.12	2.909	0.0038	0.071829	5	0.024693	yes	NERVET
chr1_1225720_CGCCACAGACACGGGCCACACACTCCACAT_C_b38	RP5-902P8.12	2.909	0.0038	0.071829	5	0.024693	yes	NERVET
chr1_1225982_A_G_b38	RP5-902P8.12	2.909	0.0038	0.071829	5	0.024693	yes	NERVET
chr1_1226261_G_A_b38	RP5-902P8.12	2.909	0.0038	0.071829	5	0.024693	yes	NERVET
chr1_1226334_AC_A_b38	RP5-902P8.12	2.909	0.0038	0.071829	5	0.024693	yes	NERVET
chr1_1226338_TGTACGGTCAGGAGGAAACATGGCACCTCCCCTCTGGGGGCTCTTTCCAGAAACCCTCAACCC_T_b38	RP5-902P8.12	2.909	0.0038	0.071829	5	0.024693	yes	NERVET
chr1_1227161_G_C_b38	RP5-902P8.12	2.909	0.0038	0.071829	5	0.024693	yes	NERVET
chr1_1227792_T_C_b38	RP5-902P8.12	2.909	0.0038	0.071829	5	0.024693	yes	NERVET
chr1_1227975_T_C_b38	RP5-902P8.12	2.909	0.0038	0.071829	5	0.024693	yes	NERVET
chr1_1229160_G_T_b38	RP5-902P8.12	2.909	0.0038	0.071829	5	0.024693	yes	NERVET
chr1_1229307_G_C_b38	RP5-902P8.12	2.909	0.0038	0.071829	5	0.024693	yes	NERVET
chr1_1229900_GCA_G_b38	RP5-902P8.12	2.909	0.0038	0.071829	5	0.024693	yes	NERVET
chr1_1229940_CAT_C_b38	RP5-902P8.12	2.909	0.0038	0.071829	5	0.024693	yes	NERVET
chr1_1229981_A_G_b38	RP5-902P8.12	2.909	0.0038	0.071829	5	0.024693	yes	NERVET
chr1_1230091_T_C_b38	RP5-902P8.12	2.909	0.0038	0.071829	5	0.024693	yes	NERVET
chr1_1230345_A_G_b38	RP5-902P8.12	2.909	0.0038	0.071829	5	0.024693	yes	NERVET
chr1_1230441_T_C_b38	RP5-902P8.12	2.909	0.0038	0.071829	5	0.024693	yes	NERVET
chr1_1230695_G_A_b38	RP5-902P8.12	2.909	0.0038	0.071829	5	0.024693	yes	NERVET
chr1_1230797_G_C_b38	RP5-902P8.12	2.909	0.0038	0.071829	5	0.024693	yes	NERVET
chr1_1230825_C_T_b38	RP5-902P8.12	2.909	0.0038	0.071829	5	0.024693	yes	NERVET
chr1_1891375_G_A_b38	RP5-902P8.12	2.909	0.00381	0.077409	4	0.026614	yes	NERVET
chr1_1230462_A_ATTT_b38	RP5-902P8.12	2.901	0.0039	0.078212	4	0.026963	yes	NERVET
chr1_1839692_C_CA_b38	RP5-902P8.12	2.895	0.00397	0.076173	4	0.026313	yes	NERVET
chr1_1308516_C_T_b38	RP5-902P8.12	-2.891	0.00402	-0.053914	71	0.018647	yes	NERVET
chr1_1366561_AGT_A_b38	RP5-902P8.12	-2.881	0.00415	-0.055227	64	0.019168	yes	NERVET
chr1_1235869_T_C_b38	RP5-902P8.12	2.861	0.00442	0.073967	5	0.025854	yes	NERVET
chr1_1222580_T_C_b38	RP5-902P8.12	2.859	0.00444	0.069221	7	0.024209	yes	NERVET
chr1_1222594_A_G_b38	RP5-902P8.12	2.859	0.00444	0.069221	7	0.024209	yes	NERVET
chr1_1649954_C_CA_b38	RP5-902P8.12	2.858	0.00446	0.055669	24	0.019481	yes	NERVET
chr1_1361679_G_A_b38	RP5-902P8.12	-2.846	0.00462	-0.055763	39	0.019592	yes	NERVET
chr1_1847293_A_ACAACAAAATCCCTTTTT_b38	RP5-902P8.12	2.84	0.00471	0.07601	4	0.026764	yes	NERVET
chr1_1856365_C_G_b38	RP5-902P8.12	2.84	0.00471	0.07601	4	0.026764	yes	NERVET
chr1_1219159_G_A_b38	RP5-902P8.12	2.84	0.00472	0.077479	4	0.027285	yes	NERVET
chr1_1223727_G_A_b38	RP5-902P8.12	2.832	0.00483	0.069936	5	0.024697	yes	NERVET
chr1_1224783_G_A_b38	RP5-902P8.12	2.829	0.00487	0.066691	6	0.023573	yes	NERVET
chr1_1612560_G_GT_b38	RP5-902P8.12	2.813	0.00512	0.04686	49	0.016659	yes	NERVET
chr1_1897682_C_CA_b38	RP5-902P8.12	2.803	0.00527	0.070522	4	0.025157	yes	NERVET
chr1_1215068_T_C_b38	RP5-902P8.12	2.796	0.00539	0.074523	5	0.026654	yes	NERVET
chr1_1226892_C_T_b38	RP5-902P8.12	2.795	0.0054	0.068799	5	0.024612	yes	NERVET
chr1_1479205_A_C_b38	RP5-902P8.12	-2.793	0.00544	-0.064133	24	0.022963	yes	NERVET
chr1_1760401_G_A_b38	RP5-902P8.12	2.792	0.00545	0.073225	4	0.026223	yes	NERVET
chr1_1736832_GAAAA_G_b38	RP5-902P8.12	2.789	0.00551	0.043964	73	0.015766	yes	NERVET
chr1_1251122_A_T_b38	RP5-902P8.12	2.788	0.00552	0.058593	24	0.021016	yes	NERVET
chr1_1227055_C_A_b38	RP5-902P8.12	2.781	0.00564	0.06853	5	0.024644	yes	NERVET
chr1_1226620_G_GC_b38	RP5-902P8.12	2.767	0.00589	0.067936	5	0.024555	yes	NERVET
chr1_1325753_G_T_b38	RP5-902P8.12	2.767	0.00589	0.067762	7	0.024494	yes	NERVET
chr1_1223568_A_G_b38	RP5-902P8.12	2.759	0.00602	0.066222	8	0.024	yes	NERVET
chr1_1661177_A_G_b38	RP5-902P8.12	2.751	0.00617	0.048424	31	0.017601	yes	NERVET
chr1_1773729_T_A_b38	RP5-902P8.12	2.75	0.00619	0.046331	54	0.016846	yes	NERVET
chr1_1216708_CT_C_b38	RP5-902P8.12	2.742	0.00635	0.07017	4	0.025595	yes	NERVET
chr1_1773717_T_A_b38	RP5-902P8.12	2.741	0.00637	0.043126	80	0.015735	yes	NERVET
chr1_1228069_T_C_b38	RP5-902P8.12	2.74	0.00639	0.068093	4	0.024854	yes	NERVET
chr1_1214801_G_C_b38	RP5-902P8.12	2.738	0.00643	0.07248	5	0.026475	yes	NERVET
chr1_1744854_C_A_b38	RP5-902P8.12	2.732	0.00654	0.040029	76	0.014653	yes	NERVET
chr1_1729296_T_C_b38	RP5-902P8.12	2.703	0.00712	0.048966	38	0.018113	yes	NERVET
chr1_455125_G_T_b38	RP5-902P8.12	2.699	0.0072	0.094618	4	0.03505	yes	NERVET
chr1_967941_G_A_b38	RP5-902P8.12	-2.699	0.00721	-0.060359	10	0.022362	yes	NERVET
chr1_1240684_G_GCCGCCCCCATTCACCCCGGCCGTGGTCCCTGCCGCAGCCCCCA_b38	RP5-902P8.12	2.689	0.00742	0.08285	5	0.03081	yes	NERVET
chr1_1226901_G_A_b38	RP5-902P8.12	2.671	0.00782	0.065819	5	0.02464	yes	NERVET
chr1_1667424_T_TAAATA_b38	RP5-902P8.12	2.662	0.00804	0.041714	79	0.015669	yes	NERVET
chr1_1303800_G_A_b38	RP5-902P8.12	2.655	0.00822	0.064144	8	0.024163	yes	NERVET
chr1_1639685_G_A_b38	RP5-902P8.12	2.639	0.0086	0.045557	34	0.017264	yes	NERVET
chr1_1195463_A_G_b38	RP5-902P8.12	2.636	0.00867	0.044776	54	0.016987	yes	NERVET
chr1_1665061_C_T_b38	RP5-902P8.12	2.633	0.00876	0.046487	31	0.017659	yes	NERVET
chr1_1890472_C_G_b38	RP5-902P8.12	-2.625	0.00896	-0.064589	10	0.024609	yes	NERVET
chr1_1186277_T_C_b38	RP5-902P8.12	2.624	0.00897	0.04729	31	0.018021	yes	NERVET
chr1_1214831_G_A_b38	RP5-902P8.12	2.619	0.00911	0.070012	5	0.026733	yes	NERVET
chr1_1387698_A_G_b38	RP5-902P8.12	-2.612	0.00929	-0.051124	64	0.019571	yes	NERVET
chr1_1729287_T_C_b38	RP5-902P8.12	2.612	0.00929	0.047031	39	0.018004	yes	NERVET
chr1_1669613_G_A_b38	RP5-902P8.12	2.612	0.00931	0.045997	32	0.017612	yes	NERVET
chr1_1402457_A_G_b38	RP5-902P8.12	2.595	0.00976	0.051326	64	0.019779	yes	NERVET
chr1_1186455_C_CTG_b38	RP5-902P8.12	2.593	0.00983	0.04701	31	0.018132	yes	NERVET
chr1_1744499_C_T_b38	RP5-902P8.12	2.589	0.00992	0.038813	94	0.014989	yes	NERVET
chr1_1281631_A_C_b38	RP5-902P8.12	3.58	0.000381	0.087387	16	0.024413	no	NERVET
chr1_1741473_C_T_b38	RP5-902P8.12	3.483	0.000543	0.05604	62	0.016088	no	NERVET
chr1_1663180_T_C_b38	RP5-902P8.12	3.278	0.00113	0.065283	17	0.019917	no	NERVET
chr1_1663182_C_A_b38	RP5-902P8.12	3.278	0.00113	0.065283	17	0.019917	no	NERVET
chr1_1662933_T_A_b38	RP5-902P8.12	3.174	0.00161	0.053033	44	0.016709	no	NERVET
chr1_1664099_T_C_b38	RP5-902P8.12	3.086	0.00215	0.060259	22	0.019529	no	NERVET
chr1_683199_T_G_b38	RP5-902P8.12	3.017	0.00269	0.100665	6	0.033363	no	NERVET
chr1_1127664_A_G_b38	RP5-902P8.12	-2.972	0.00311	-0.065815	8	0.022145	no	NERVET
chr1_1367292_A_AGT_b38	RP5-902P8.12	-2.932	0.00353	-0.058795	20	0.020052	no	NERVET
chr1_1363986_C_T_b38	RP5-902P8.12	-2.923	0.00364	-0.058848	20	0.020135	no	NERVET
chr1_1734263_T_C_b38	RP5-902P8.12	2.899	0.00392	0.046411	75	0.016008	no	NERVET
chr1_1740160_G_A_b38	RP5-902P8.12	2.886	0.00409	0.045365	80	0.01572	no	NERVET
chr1_1740017_C_T_b38	RP5-902P8.12	2.874	0.00424	0.045015	82	0.015661	no	NERVET
chr1_1773713_T_A_b38	RP5-902P8.12	2.863	0.00439	0.047421	55	0.016564	no	NERVET
chr1_1663949_A_G_b38	RP5-902P8.12	2.835	0.00479	0.06117	13	0.021578	no	NERVET
chr1_1265603_TTG_T_b38	RP5-902P8.12	2.833	0.00481	0.067913	10	0.023972	no	NERVET
chr1_1736472_C_T_b38	RP5-902P8.12	2.831	0.00485	0.044635	79	0.015769	no	NERVET
chr1_1737704_C_T_b38	RP5-902P8.12	2.821	0.005	0.044385	80	0.015737	no	NERVET
chr1_1738309_A_G_b38	RP5-902P8.12	2.821	0.005	0.044385	80	0.015737	no	NERVET
chr1_1733576_G_A_b38	RP5-902P8.12	2.814	0.0051	0.044556	79	0.015832	no	NERVET
chr1_1740107_G_A_b38	RP5-902P8.12	2.808	0.0052	0.043882	81	0.015628	no	NERVET
chr1_860178_C_CTTTTTTT_b38	RP5-902P8.12	2.779	0.00568	0.076437	8	0.02751	no	NERVET
chr1_1737703_A_C_b38	RP5-902P8.12	2.763	0.00595	0.042585	81	0.01541	no	NERVET
chr1_1732412_G_C_b38	RP5-902P8.12	2.747	0.00624	0.04341	80	0.0158	no	NERVET
chr1_1732422_G_A_b38	RP5-902P8.12	2.747	0.00624	0.04341	80	0.0158	no	NERVET
chr1_1735370_G_A_b38	RP5-902P8.12	2.747	0.00624	0.04341	80	0.0158	no	NERVET
chr1_1735884_C_T_b38	RP5-902P8.12	2.747	0.00624	0.04341	80	0.0158	no	NERVET
chr1_1948412_A_AATATAT_b38	RP5-902P8.12	2.747	0.00625	0.050925	27	0.018538	no	NERVET
chr1_586069_T_A_b38	RP5-902P8.12	2.736	0.00646	0.07896	8	0.028861	no	NERVET
chr1_866577_CCTGCACTCACATCCCTGACGTCCTCCCGTGCCCTCACGTGGTCCTCCCT_C_b38	RP5-902P8.12	2.732	0.00654	0.039267	81	0.014373	no	NERVET
chr1_1732013_G_A_b38	RP5-902P8.12	2.719	0.0068	0.042876	80	0.015772	no	NERVET
chr1_1943487_C_G_b38	RP5-902P8.12	2.707	0.00705	0.05097	23	0.018831	no	NERVET
chr1_1363456_CAG_C_b38	RP5-902P8.12	-2.7	0.00718	-0.049171	33	0.018209	no	NERVET
chr1_1628409_C_A_b38	RP5-902P8.12	2.684	0.00753	0.044112	57	0.016432	no	NERVET
chr1_1671995_G_T_b38	RP5-902P8.12	-2.661	0.00805	-0.040134	114	0.01508	no	NERVET
chr1_975029_T_C_b38	RP5-902P8.12	2.658	0.00813	0.056522	11	0.021264	no	NERVET
chr1_1650664_CTTTTT_C_b38	RP5-902P8.12	2.653	0.00826	0.046724	32	0.017614	no	NERVET
chr1_1664300_T_C_b38	RP5-902P8.12	2.651	0.0083	0.051708	18	0.019505	no	NERVET
chr1_1628814_C_T_b38	RP5-902P8.12	2.646	0.00843	0.043511	57	0.016445	no	NERVET
chr1_1668717_C_G_b38	RP5-902P8.12	2.626	0.00894	0.046531	31	0.017722	no	NERVET
chr1_1738525_G_A_b38	RP5-902P8.12	2.619	0.00911	0.042502	67	0.016229	no	NERVET
chr1_1732834_T_TATCG_b38	RP5-902P8.12	2.618	0.00914	0.041389	80	0.01581	no	NERVET
chr1_1735008_G_GGTTT_b38	RP5-902P8.12	2.617	0.00916	0.041647	78	0.015915	no	NERVET
chr1_1280044_T_C_b38	RP5-902P8.12	2.604	0.00952	0.047172	73	0.018117	no	NERVET
chr1_1742672_C_T_b38	RP5-902P8.12	2.602	0.00955	0.041647	81	0.016003	no	NERVET
chr1_1743238_G_C_b38	RP5-902P8.12	2.602	0.00955	0.041647	81	0.016003	no	NERVET
chr1_1217251_C_A_b38	RP5-902P8.12	2.594	0.0098	0.064124	8	0.024724	no	NERVET
chr1_1808384_AC_A_b38	RP5-902P8.12	3.847	0.000188	0.13567	3	0.035267	yes	OVARY
chr1_1829288_T_C_b38	RP5-902P8.12	3.847	0.000188	0.13567	3	0.035267	yes	OVARY
chr1_1832335_G_A_b38	RP5-902P8.12	3.847	0.000188	0.13567	3	0.035267	yes	OVARY
chr1_1947325_T_G_b38	RP5-902P8.12	3.83	0.000201	0.136896	3	0.035746	yes	OVARY
chr1_1806932_C_T_b38	RP5-902P8.12	3.735	0.000283	0.114029	3	0.030533	yes	OVARY
chr1_875400_G_C_b38	RP5-902P8.12	3.539	0.000562	0.094809	8	0.026788	yes	OVARY
chr1_1930586_C_T_b38	RP5-902P8.12	3.526	0.000588	0.1257	3	0.03565	yes	OVARY
chr1_1236037_C_T_b38	RP5-902P8.12	3.513	0.000614	0.067621	37	0.019247	yes	OVARY
chr1_878850_T_A_b38	RP5-902P8.12	3.433	0.000807	0.090825	5	0.026458	yes	OVARY
chr1_1716097_C_T_b38	RP5-902P8.12	3.406	0.000882	0.11671	3	0.034262	yes	OVARY
chr1_1721125_G_A_b38	RP5-902P8.12	3.406	0.000882	0.11671	3	0.034262	yes	OVARY
chr1_1884183_G_A_b38	RP5-902P8.12	3.327	0.00115	0.075502	13	0.022695	yes	OVARY
chr1_1849992_T_TG_b38	RP5-902P8.12	3.267	0.0014	0.084719	6	0.025933	yes	OVARY
chr1_877363_C_T_b38	RP5-902P8.12	3.257	0.00145	0.082299	11	0.025271	yes	OVARY
chr1_858567_A_G_b38	RP5-902P8.12	3.223	0.00161	0.091935	6	0.028528	yes	OVARY
chr1_858571_A_C_b38	RP5-902P8.12	3.223	0.00161	0.091935	6	0.028528	yes	OVARY
chr1_1238231_G_A_b38	RP5-902P8.12	3.185	0.00182	0.078048	9	0.024507	yes	OVARY
chr1_1195463_A_G_b38	RP5-902P8.12	3.151	0.00203	0.066567	20	0.021126	yes	OVARY
chr1_796338_T_C_b38	RP5-902P8.12	3.076	0.00257	0.088292	4	0.028704	yes	OVARY
chr1_1864350_C_T_b38	RP5-902P8.12	3.076	0.00257	0.067735	13	0.022024	yes	OVARY
chr1_885945_ACAGT_A_b38	RP5-902P8.12	3.074	0.00259	0.07038	14	0.022897	yes	OVARY
chr1_1231507_T_C_b38	RP5-902P8.12	3.055	0.00275	0.078453	5	0.025684	yes	OVARY
chr1_1231710_CCCCCGGGAA_C_b38	RP5-902P8.12	3.044	0.00284	0.082769	6	0.027194	yes	OVARY
chr1_771398_G_A_b38	RP5-902P8.12	-3.042	0.00285	-0.071665	25	0.023556	yes	OVARY
chr1_1248218_A_G_b38	RP5-902P8.12	3.004	0.00321	0.11841	3	0.039414	yes	OVARY
chr1_1534915_T_C_b38	RP5-902P8.12	3	0.00325	0.130377	6	0.043455	yes	OVARY
chr1_874906_G_A_b38	RP5-902P8.12	3	0.00325	0.075348	14	0.025114	yes	OVARY
chr1_1769737_GA_G_b38	RP5-902P8.12	2.968	0.00359	0.069863	9	0.023541	yes	OVARY
chr1_818464_CCT_C_b38	RP5-902P8.12	-2.965	0.00362	-0.07493	13	0.025272	yes	OVARY
chr1_818469_G_T_b38	RP5-902P8.12	-2.965	0.00362	-0.07493	13	0.025272	yes	OVARY
chr1_798969_T_C_b38	RP5-902P8.12	2.952	0.00376	0.08758	3	0.029665	yes	OVARY
chr1_1229369_G_GC_b38	RP5-902P8.12	2.927	0.00406	0.071239	10	0.024342	yes	OVARY
chr1_832736_A_AGTTTT_b38	RP5-902P8.12	-2.919	0.00416	-0.054762	42	0.018764	yes	OVARY
chr1_1197697_A_G_b38	RP5-902P8.12	2.914	0.00422	0.062932	19	0.021598	yes	OVARY
chr1_791101_T_TGG_b38	RP5-902P8.12	2.905	0.00433	0.083307	8	0.028676	yes	OVARY
chr1_1187535_A_G_b38	RP5-902P8.12	2.862	0.00493	0.060787	21	0.02124	yes	OVARY
chr1_1189283_G_A_b38	RP5-902P8.12	2.862	0.00493	0.060787	21	0.02124	yes	OVARY
chr1_813498_G_T_b38	RP5-902P8.12	-2.853	0.00506	-0.069671	13	0.024421	yes	OVARY
chr1_1996920_C_CA_b38	RP5-902P8.12	2.837	0.0053	0.106993	3	0.037714	yes	OVARY
chr1_855085_G_A_b38	RP5-902P8.12	2.831	0.0054	0.085874	3	0.030333	yes	OVARY
chr1_1205055_G_T_b38	RP5-902P8.12	2.829	0.00543	0.06217	33	0.021977	yes	OVARY
chr1_1184478_C_T_b38	RP5-902P8.12	2.815	0.00566	0.086079	8	0.030579	yes	OVARY
chr1_1235602_C_A_b38	RP5-902P8.12	2.808	0.00576	0.082293	3	0.029302	yes	OVARY
chr1_817514_T_C_b38	RP5-902P8.12	-2.803	0.00585	-0.0696	10	0.024829	yes	OVARY
chr1_1184277_G_C_b38	RP5-902P8.12	2.798	0.00595	0.060601	44	0.02166	yes	OVARY
chr1_727034_C_T_b38	RP5-902P8.12	2.794	0.00602	0.071727	9	0.025674	yes	OVARY
chr1_800909_T_A_b38	RP5-902P8.12	2.793	0.00604	0.073796	5	0.026425	yes	OVARY
chr1_823913_T_A_b38	RP5-902P8.12	2.785	0.00617	0.084494	3	0.030338	yes	OVARY
chr1_1574032_AAAG_A_b38	RP5-902P8.12	2.782	0.00622	0.065107	18	0.0234	yes	OVARY
chr1_878260_A_G_b38	RP5-902P8.12	-2.78	0.00626	-0.076879	13	0.027653	yes	OVARY
chr1_1199862_A_C_b38	RP5-902P8.12	2.761	0.00661	0.059606	19	0.021586	yes	OVARY
chr1_827092_C_T_b38	RP5-902P8.12	2.751	0.0068	0.081509	4	0.029625	yes	OVARY
chr1_796652_A_C_b38	RP5-902P8.12	2.72	0.00744	0.075368	5	0.027706	yes	OVARY
chr1_1215852_T_C_b38	RP5-902P8.12	2.72	0.00745	0.067559	8	0.024842	yes	OVARY
chr1_820905_ATCCACCCTGTCTACACTACCTGCTTGTCCAGCAGG_A_b38	RP5-902P8.12	2.717	0.00751	0.080857	3	0.029759	yes	OVARY
chr1_821054_G_C_b38	RP5-902P8.12	2.717	0.00751	0.080857	3	0.029759	yes	OVARY
chr1_1193398_C_CTTA_b38	RP5-902P8.12	2.706	0.00774	0.059042	34	0.021817	yes	OVARY
chr1_1937046_G_A_b38	RP5-902P8.12	2.706	0.00774	0.072014	5	0.026612	yes	OVARY
chr1_818025_C_A_b38	RP5-902P8.12	-2.706	0.00775	-0.080763	6	0.029847	yes	OVARY
chr1_827252_T_A_b38	RP5-902P8.12	-2.706	0.00775	-0.080763	6	0.029847	yes	OVARY
chr1_827212_C_G_b38	RP5-902P8.12	-2.705	0.00777	-0.079525	6	0.0294	yes	OVARY
chr1_1679085_T_C_b38	RP5-902P8.12	2.701	0.00785	0.056427	27	0.020887	yes	OVARY
chr1_839480_CACACACCTGGACAA_C_b38	RP5-902P8.12	-2.699	0.00791	-0.062965	19	0.023331	yes	OVARY
chr1_818802_A_G_b38	RP5-902P8.12	-2.691	0.00809	-0.080182	8	0.029799	yes	OVARY
chr1_818812_A_G_b38	RP5-902P8.12	-2.691	0.00809	-0.080182	8	0.029799	yes	OVARY
chr1_818954_T_C_b38	RP5-902P8.12	-2.691	0.00809	-0.080182	8	0.029799	yes	OVARY
chr1_1226486_C_T_b38	RP5-902P8.12	2.689	0.00814	0.079535	3	0.029583	yes	OVARY
chr1_758351_A_G_b38	RP5-902P8.12	2.688	0.00816	0.069857	8	0.025991	yes	OVARY
chr1_1238902_T_C_b38	RP5-902P8.12	2.68	0.00833	0.05822	30	0.021721	yes	OVARY
chr1_632403_T_C_b38	RP5-902P8.12	2.678	0.00839	0.096812	6	0.036151	yes	OVARY
chr1_791101_T_G_b38	RP5-902P8.12	-2.673	0.0085	-0.076821	8	0.028736	yes	OVARY
chr1_274015_A_G_b38	RP5-902P8.12	-2.67	0.00857	-0.091319	6	0.034198	yes	OVARY
chr1_791100_G_GGGA_b38	RP5-902P8.12	2.658	0.00888	0.07647	8	0.028775	yes	OVARY
chr1_827221_T_C_b38	RP5-902P8.12	-2.638	0.00939	-0.077737	6	0.029471	yes	OVARY
chr1_1111365_CAA_C_b38	RP5-902P8.12	2.633	0.00953	0.074435	4	0.028275	yes	OVARY
chr1_878367_G_A_b38	RP5-902P8.12	-2.627	0.00968	-0.07108	12	0.027061	yes	OVARY
chr1_832873_A_C_b38	RP5-902P8.12	-2.619	0.0099	-0.059887	24	0.02287	yes	OVARY
chr1_818045_T_C_b38	RP5-902P8.12	-2.617	0.00994	-0.077517	7	0.029616	yes	OVARY
chr1_824457_T_A_b38	RP5-902P8.12	-2.617	0.00994	-0.077517	7	0.029616	yes	OVARY
chr1_1881428_C_T_b38	RP5-902P8.12	3.601	0.000453	0.087004	8	0.024161	no	OVARY
chr1_1890770_C_T_b38	RP5-902P8.12	3.479	0.000691	0.075501	17	0.021703	no	OVARY
chr1_1948037_T_A_b38	RP5-902P8.12	3.404	0.00089	0.093873	5	0.027581	no	OVARY
chr1_1767762_C_A_b38	RP5-902P8.12	3.354	0.00105	0.076229	12	0.022728	no	OVARY
chr1_1773215_C_A_b38	RP5-902P8.12	3.354	0.00105	0.076229	12	0.022728	no	OVARY
chr1_1774308_G_A_b38	RP5-902P8.12	3.354	0.00105	0.076229	12	0.022728	no	OVARY
chr1_1776301_T_G_b38	RP5-902P8.12	3.354	0.00105	0.076229	12	0.022728	no	OVARY
chr1_590378_T_C_b38	RP5-902P8.12	3.344	0.00109	0.1026	10	0.030685	no	OVARY
chr1_1896396_CT_C_b38	RP5-902P8.12	3.287	0.00131	0.086224	4	0.026234	no	OVARY
chr1_1907077_C_A_b38	RP5-902P8.12	3.28	0.00134	0.083772	7	0.025544	no	OVARY
chr1_1803531_C_T_b38	RP5-902P8.12	3.247	0.00149	0.073415	13	0.02261	no	OVARY
chr1_1830566_A_T_b38	RP5-902P8.12	3.247	0.00149	0.073415	13	0.02261	no	OVARY
chr1_1839349_C_G_b38	RP5-902P8.12	3.247	0.00149	0.073415	13	0.02261	no	OVARY
chr1_1839350_T_A_b38	RP5-902P8.12	3.247	0.00149	0.073415	13	0.02261	no	OVARY
chr1_1851181_C_T_b38	RP5-902P8.12	3.247	0.00149	0.073415	13	0.02261	no	OVARY
chr1_1791389_G_A_b38	RP5-902P8.12	3.231	0.00157	0.080219	8	0.024825	no	OVARY
chr1_1873952_G_A_b38	RP5-902P8.12	3.219	0.00163	0.072857	13	0.022634	no	OVARY
chr1_1878651_C_T_b38	RP5-902P8.12	3.219	0.00163	0.072857	13	0.022634	no	OVARY
chr1_1879682_G_A_b38	RP5-902P8.12	3.219	0.00163	0.072857	13	0.022634	no	OVARY
chr1_1890186_G_A_b38	RP5-902P8.12	3.188	0.00181	0.07235	13	0.022696	no	OVARY
chr1_1780791_C_T_b38	RP5-902P8.12	3.144	0.00208	0.073306	10	0.023316	no	OVARY
chr1_1782430_T_G_b38	RP5-902P8.12	3.144	0.00208	0.073306	10	0.023316	no	OVARY
chr1_1783572_C_A_b38	RP5-902P8.12	3.144	0.00208	0.073306	10	0.023316	no	OVARY
chr1_1794321_C_T_b38	RP5-902P8.12	3.144	0.00208	0.073306	10	0.023316	no	OVARY
chr1_1805214_T_G_b38	RP5-902P8.12	3.144	0.00208	0.073306	10	0.023316	no	OVARY
chr1_1827615_G_A_b38	RP5-902P8.12	3.144	0.00208	0.073306	10	0.023316	no	OVARY
chr1_1834655_A_C_b38	RP5-902P8.12	3.144	0.00208	0.073306	10	0.023316	no	OVARY
chr1_1837455_C_T_b38	RP5-902P8.12	3.144	0.00208	0.073306	10	0.023316	no	OVARY
chr1_1851762_G_A_b38	RP5-902P8.12	3.144	0.00208	0.073306	10	0.023316	no	OVARY
chr1_1852145_G_A_b38	RP5-902P8.12	3.144	0.00208	0.073306	10	0.023316	no	OVARY
chr1_1869595_G_A_b38	RP5-902P8.12	3.118	0.00226	0.072817	10	0.023356	no	OVARY
chr1_1878070_C_T_b38	RP5-902P8.12	3.118	0.00226	0.072817	10	0.023356	no	OVARY
chr1_1881006_GGA_G_b38	RP5-902P8.12	3.118	0.00226	0.072817	10	0.023356	no	OVARY
chr1_1888667_A_C_b38	RP5-902P8.12	3.118	0.00226	0.072817	10	0.023356	no	OVARY
chr1_862060_T_C_b38	RP5-902P8.12	3.111	0.00231	0.083226	6	0.026756	no	OVARY
chr1_866087_G_C_b38	RP5-902P8.12	3.111	0.00231	0.083226	6	0.026756	no	OVARY
chr1_860995_T_C_b38	RP5-902P8.12	3.068	0.00263	0.081656	6	0.026613	no	OVARY
chr1_1902056_G_A_b38	RP5-902P8.12	3.028	0.00298	0.07211	10	0.023817	no	OVARY
chr1_1885444_TTAGA_T_b38	RP5-902P8.12	3.014	0.00312	0.069557	11	0.023081	no	OVARY
chr1_1810086_A_G_b38	RP5-902P8.12	3.013	0.00312	0.075201	8	0.024956	no	OVARY
chr1_1865951_T_A_b38	RP5-902P8.12	3.006	0.00319	0.071699	10	0.023854	no	OVARY
chr1_869379_C_T_b38	RP5-902P8.12	2.983	0.00343	0.080468	6	0.02698	no	OVARY
chr1_867116_C_T_b38	RP5-902P8.12	2.973	0.00353	0.085694	3	0.028826	no	OVARY
chr1_1221049_C_G_b38	RP5-902P8.12	2.958	0.00369	0.065214	29	0.022043	no	OVARY
chr1_1793064_C_CA_b38	RP5-902P8.12	2.928	0.00405	0.069911	10	0.023877	no	OVARY
chr1_1676287_C_T_b38	RP5-902P8.12	2.911	0.00425	0.08073	3	0.027729	no	OVARY
chr1_873251_G_A_b38	RP5-902P8.12	-2.893	0.00449	-0.066215	24	0.022887	no	OVARY
chr1_873548_C_T_b38	RP5-902P8.12	-2.893	0.00449	-0.066215	24	0.022887	no	OVARY
chr1_1803982_T_TA_b38	RP5-902P8.12	2.869	0.00482	0.144634	3	0.050409	no	OVARY
chr1_1774165_A_G_b38	RP5-902P8.12	2.868	0.00484	0.067529	10	0.023545	no	OVARY
chr1_1661169_C_A_b38	RP5-902P8.12	-2.864	0.0049	-0.06875	12	0.024008	no	OVARY
chr1_1891450_G_A_b38	RP5-902P8.12	2.859	0.00498	0.06803	10	0.023799	no	OVARY
chr1_1842213_A_G_b38	RP5-902P8.12	2.826	0.00547	0.064152	14	0.022699	no	OVARY
chr1_1842221_C_G_b38	RP5-902P8.12	2.826	0.00547	0.064152	14	0.022699	no	OVARY
chr1_1842333_G_A_b38	RP5-902P8.12	2.826	0.00547	0.064152	14	0.022699	no	OVARY
chr1_1903603_G_A_b38	RP5-902P8.12	2.804	0.00584	0.06961	7	0.024823	no	OVARY
chr1_1903617_C_T_b38	RP5-902P8.12	2.804	0.00584	0.06961	7	0.024823	no	OVARY
chr1_2042765_C_CA_b38	RP5-902P8.12	2.804	0.00584	0.090421	6	0.032248	no	OVARY
chr1_863020_A_G_b38	RP5-902P8.12	2.782	0.00623	0.065373	15	0.023502	no	OVARY
chr1_863579_G_A_b38	RP5-902P8.12	2.782	0.00623	0.065373	15	0.023502	no	OVARY
chr1_2079230_A_G_b38	RP5-902P8.12	-2.77	0.00645	-0.169955	3	0.061363	no	OVARY
chr1_1808642_TTTTG_T_b38	RP5-902P8.12	2.75	0.00682	0.062563	14	0.022748	no	OVARY
chr1_2018334_A_AATAAC_b38	RP5-902P8.12	-2.73	0.00724	-0.057359	20	0.021013	no	OVARY
chr1_1217733_G_A_b38	RP5-902P8.12	2.72	0.00744	0.078194	3	0.028748	no	OVARY
chr1_1845824_TACACACACACACACACACACACACACACAC_T_b38	RP5-902P8.12	2.714	0.00758	0.061682	14	0.022729	no	OVARY
chr1_1900918_G_A_b38	RP5-902P8.12	2.705	0.00777	0.065991	8	0.024396	no	OVARY
chr1_1907199_A_G_b38	RP5-902P8.12	2.705	0.00777	0.065991	8	0.024396	no	OVARY
chr1_1901149_A_AAAGAAAGG_b38	RP5-902P8.12	2.698	0.00793	0.058039	19	0.021514	no	OVARY
chr1_1897325_G_A_b38	RP5-902P8.12	2.695	0.00799	0.065863	7	0.024437	no	OVARY
chr1_1725582_T_C_b38	RP5-902P8.12	-2.691	0.00808	-0.049246	37	0.0183	no	OVARY
chr1_696963_C_G_b38	RP5-902P8.12	2.645	0.00921	0.11565	4	0.043728	no	OVARY
chr1_1903309_A_G_b38	RP5-902P8.12	2.644	0.00924	0.064391	21	0.024358	no	OVARY
chr1_1842237_T_C_b38	RP5-902P8.12	2.636	0.00944	0.059198	15	0.02246	no	OVARY
chr1_1842226_T_C_b38	RP5-902P8.12	2.629	0.00962	0.060967	14	0.023191	no	OVARY
chr1_1924659_C_T_b38	RP5-902P8.12	2.624	0.00974	0.061282	14	0.02335	no	OVARY
chr1_1912983_T_C_b38	RP5-902P8.12	2.622	0.00982	0.060162	13	0.022948	no	OVARY
chr1_2055132_C_T_b38	RP5-902P8.12	-2.618	0.00991	-0.135978	5	0.051931	no	OVARY
chr1_506032_AAAC_A_b38	RP5-902P8.12	3.864	0.000143	0.104173	3	0.026963	yes	PNCREAS
chr1_1650664_CTTTTT_C_b38	RP5-902P8.12	3.733	0.000234	0.038921	16	0.010426	yes	PNCREAS
chr1_1474819_G_C_b38	RP5-902P8.12	-3.35	0.000932	-0.053418	7	0.015944	yes	PNCREAS
chr1_1650383_G_T_b38	RP5-902P8.12	3.273	0.00122	0.032056	21	0.009795	yes	PNCREAS
chr1_1369803_C_CT_b38	RP5-902P8.12	-3.173	0.0017	-0.039026	4	0.012299	yes	PNCREAS
chr1_511562_C_T_b38	RP5-902P8.12	3.106	0.00212	0.032784	17	0.010557	yes	PNCREAS
chr1_1479683_T_G_b38	RP5-902P8.12	-2.999	0.00298	-0.048355	21	0.016124	yes	PNCREAS
chr1_1480096_G_C_b38	RP5-902P8.12	-2.999	0.00298	-0.048355	21	0.016124	yes	PNCREAS
chr1_1120062_A_G_b38	RP5-902P8.12	-2.966	0.00331	-0.052957	6	0.017855	yes	PNCREAS
chr1_1657085_C_CTAA_b38	RP5-902P8.12	2.944	0.00355	0.031097	20	0.010564	yes	PNCREAS
chr1_1650688_T_A_b38	RP5-902P8.12	2.912	0.00392	0.028102	22	0.009652	yes	PNCREAS
chr1_1702383_T_C_b38	RP5-902P8.12	2.902	0.00404	0.028912	18	0.009964	yes	PNCREAS
chr1_1257406_C_A_b38	RP5-902P8.12	-2.895	0.00413	-0.064162	4	0.022165	yes	PNCREAS
chr1_1657081_C_T_b38	RP5-902P8.12	2.811	0.00533	0.028939	20	0.010295	yes	PNCREAS
chr1_1118491_T_C_b38	RP5-902P8.12	-2.783	0.00579	-0.050117	5	0.018005	yes	PNCREAS
chr1_1118832_C_T_b38	RP5-902P8.12	-2.783	0.00579	-0.050117	5	0.018005	yes	PNCREAS
chr1_1120626_G_A_b38	RP5-902P8.12	-2.783	0.00579	-0.050117	5	0.018005	yes	PNCREAS
chr1_1468062_A_T_b38	RP5-902P8.12	-2.779	0.00587	-0.047626	5	0.017137	yes	PNCREAS
chr1_271569_A_G_b38	RP5-902P8.12	2.76	0.0062	0.030197	19	0.010939	yes	PNCREAS
chr1_1450322_CAA_C_b38	RP5-902P8.12	-2.73	0.00679	-0.043488	4	0.01593	yes	PNCREAS
chr1_1495205_G_A_b38	RP5-902P8.12	-2.707	0.00727	-0.046446	5	0.017161	yes	PNCREAS
chr1_1116728_A_G_b38	RP5-902P8.12	-2.666	0.00818	-0.047305	5	0.017744	yes	PNCREAS
chr1_1494105_G_A_b38	RP5-902P8.12	-2.663	0.00825	-0.053815	4	0.020207	yes	PNCREAS
chr1_1495236_T_C_b38	RP5-902P8.12	-2.663	0.00825	-0.053815	4	0.020207	yes	PNCREAS
chr1_1119514_G_A_b38	RP5-902P8.12	-2.625	0.0092	-0.047321	5	0.018028	yes	PNCREAS
chr1_1120771_G_A_b38	RP5-902P8.12	-2.625	0.0092	-0.047321	5	0.018028	yes	PNCREAS
chr1_1120821_T_G_b38	RP5-902P8.12	-2.625	0.0092	-0.047321	5	0.018028	yes	PNCREAS
chr1_1113344_A_C_b38	RP5-902P8.12	-2.622	0.00929	-0.046024	5	0.017556	yes	PNCREAS
chr1_1716097_C_T_b38	RP5-902P8.12	3.327	0.00101	0.056455	3	0.01697	no	PNCREAS
chr1_1185051_G_A_b38	RP5-902P8.12	-3.247	0.00133	-0.05317	4	0.016374	no	PNCREAS
chr1_1157285_CCCCGCCCCCAGCCCACCCAT_C_b38	RP5-902P8.12	-3.211	0.0015	-0.026562	21	0.008272	no	PNCREAS
chr1_1721125_G_A_b38	RP5-902P8.12	3.092	0.00222	0.052114	3	0.016856	no	PNCREAS
chr1_1641342_C_A_b38	RP5-902P8.12	3.065	0.00242	0.080594	3	0.026296	no	PNCREAS
chr1_601293_G_A_b38	RP5-902P8.12	2.857	0.00463	0.03193	8	0.011175	no	PNCREAS
chr1_2102533_T_C_b38	RP5-902P8.12	2.777	0.0059	0.024593	60	0.008856	no	PNCREAS
chr1_1525710_A_G_b38	RP5-902P8.12	-2.769	0.00604	-0.0222	62	0.008016	no	PNCREAS
chr1_633423_C_T_b38	RP5-902P8.12	2.714	0.00712	0.052577	4	0.019374	no	PNCREAS
chr1_1504291_C_G_b38	RP5-902P8.12	-2.708	0.00724	-0.058108	4	0.021459	no	PNCREAS
chr1_1504666_AAGAG_A_b38	RP5-902P8.12	-2.708	0.00724	-0.058108	4	0.021459	no	PNCREAS
chr1_789481_G_A_b38	RP5-902P8.12	2.608	0.00966	0.033649	6	0.012903	no	PNCREAS
chr1_1284756_A_G_b38	RP5-902P8.12	-2.603	0.00981	-0.040985	23	0.015747	no	PNCREAS
chr1_1235602_C_A_b38	RP5-902P8.12	8.354	1.19e-14	0.178954	4	0.021422	yes	PTTARY
chr1_1236303_A_G_b38	RP5-902P8.12	8.181	3.5e-14	0.170179	5	0.020803	yes	PTTARY
chr1_1226486_C_T_b38	RP5-902P8.12	8.111	5.38e-14	0.172127	4	0.021221	yes	PTTARY
chr1_1231710_CCCCCGGGAA_C_b38	RP5-902P8.12	8.084	6.35e-14	0.171911	4	0.021265	yes	PTTARY
chr1_1217733_G_A_b38	RP5-902P8.12	7.756	4.67e-13	0.168299	5	0.021698	yes	PTTARY
chr1_1235997_A_G_b38	RP5-902P8.12	7.15	1.68e-11	0.16541	3	0.023133	yes	PTTARY
chr1_1215852_T_C_b38	RP5-902P8.12	6.912	6.55e-11	0.141214	7	0.02043	yes	PTTARY
chr1_1223568_A_G_b38	RP5-902P8.12	6.855	9.07e-11	0.163219	3	0.023811	yes	PTTARY
chr1_1216593_G_C_b38	RP5-902P8.12	6.837	1e-10	0.141718	6	0.020728	yes	PTTARY
chr1_1231507_T_C_b38	RP5-902P8.12	6.823	1.08e-10	0.143396	5	0.021015	yes	PTTARY
chr1_1228424_C_T_b38	RP5-902P8.12	6.526	5.63e-10	0.135263	6	0.020725	yes	PTTARY
chr1_1238231_G_A_b38	RP5-902P8.12	6.447	8.66e-10	0.131088	7	0.020332	yes	PTTARY
chr1_1219858_G_A_b38	RP5-902P8.12	6.405	1.09e-09	0.131631	8	0.020552	yes	PTTARY
chr1_1217251_C_A_b38	RP5-902P8.12	6.352	1.45e-09	0.148674	5	0.023406	yes	PTTARY
chr1_1238902_T_C_b38	RP5-902P8.12	6.346	1.5e-09	0.105288	25	0.016591	yes	PTTARY
chr1_1229369_G_GC_b38	RP5-902P8.12	6.262	2.35e-09	0.127542	7	0.020366	yes	PTTARY
chr1_1221049_C_G_b38	RP5-902P8.12	6.047	7.32e-09	0.106167	20	0.017556	yes	PTTARY
chr1_1230159_G_A_b38	RP5-902P8.12	5.936	1.31e-08	0.107685	16	0.018141	yes	PTTARY
chr1_1224783_G_A_b38	RP5-902P8.12	5.873	1.8e-08	0.137451	3	0.023402	yes	PTTARY
chr1_1202905_C_G_b38	RP5-902P8.12	5.405	1.87e-07	0.135712	3	0.025109	yes	PTTARY
chr1_1235642_G_C_b38	RP5-902P8.12	5.36	2.32e-07	0.127527	3	0.023792	yes	PTTARY
chr1_1251122_A_T_b38	RP5-902P8.12	5.188	5.3e-07	0.111044	8	0.021406	yes	PTTARY
chr1_1185978_A_C_b38	RP5-902P8.12	5.152	6.25e-07	0.127852	3	0.024814	yes	PTTARY
chr1_1236037_C_T_b38	RP5-902P8.12	5.143	6.53e-07	0.085408	30	0.016606	yes	PTTARY
chr1_1186850_G_GT_b38	RP5-902P8.12	4.858	2.42e-06	0.119374	3	0.024572	yes	PTTARY
chr1_1201373_T_C_b38	RP5-902P8.12	4.827	2.78e-06	0.102197	9	0.021171	yes	PTTARY
chr1_1259424_T_C_b38	RP5-902P8.12	4.634	6.52e-06	0.089469	19	0.019306	yes	PTTARY
chr1_1175206_T_C_b38	RP5-902P8.12	4.528	1.03e-05	0.082549	36	0.018232	yes	PTTARY
chr1_1193398_C_CTTA_b38	RP5-902P8.12	4.443	1.48e-05	0.081032	24	0.018239	yes	PTTARY
chr1_1205055_G_T_b38	RP5-902P8.12	4.392	1.84e-05	0.079018	26	0.017993	yes	PTTARY
chr1_1251618_G_A_b38	RP5-902P8.12	4.375	1.97e-05	0.106078	4	0.024244	yes	PTTARY
chr1_1180931_A_G_b38	RP5-902P8.12	4.361	2.09e-05	0.078095	39	0.01791	yes	PTTARY
chr1_1258206_AT_A_b38	RP5-902P8.12	4.304	2.65e-05	0.081118	18	0.018848	yes	PTTARY
chr1_1188054_T_A_b38	RP5-902P8.12	4.301	2.68e-05	0.091379	8	0.021247	yes	PTTARY
chr1_1251285_G_A_b38	RP5-902P8.12	4.214	3.82e-05	0.101386	5	0.024058	yes	PTTARY
chr1_1251368_T_C_b38	RP5-902P8.12	4.214	3.82e-05	0.101386	5	0.024058	yes	PTTARY
chr1_1182018_A_G_b38	RP5-902P8.12	4.2	4.05e-05	0.076189	36	0.018141	yes	PTTARY
chr1_1288085_GC_G_b38	RP5-902P8.12	4.017	8.39e-05	0.097842	5	0.024356	yes	PTTARY
chr1_1184277_G_C_b38	RP5-902P8.12	3.708	0.000272	0.068003	34	0.018338	yes	PTTARY
chr1_1134040_G_C_b38	RP5-902P8.12	-3.705	0.000274	-0.068391	19	0.018457	yes	PTTARY
chr1_1441187_A_G_b38	RP5-902P8.12	3.696	0.000285	0.07295	18	0.01974	yes	PTTARY
chr1_1248686_A_G_b38	RP5-902P8.12	3.643	0.000345	0.10344	3	0.028397	yes	PTTARY
chr1_1280044_T_C_b38	RP5-902P8.12	3.639	0.00035	0.067428	23	0.018529	yes	PTTARY
chr1_1378204_G_C_b38	RP5-902P8.12	-3.586	0.000424	-0.069384	19	0.019349	yes	PTTARY
chr1_1376162_G_C_b38	RP5-902P8.12	-3.524	0.000528	-0.069111	18	0.019609	yes	PTTARY
chr1_1377431_C_T_b38	RP5-902P8.12	-3.524	0.000528	-0.069111	18	0.019609	yes	PTTARY
chr1_1372909_G_A_b38	RP5-902P8.12	3.516	0.000544	0.082109	5	0.023352	yes	PTTARY
chr1_1373006_G_A_b38	RP5-902P8.12	3.512	0.000551	0.086148	3	0.024528	yes	PTTARY
chr1_1373007_G_A_b38	RP5-902P8.12	3.512	0.000551	0.086148	3	0.024528	yes	PTTARY
chr1_1134070_C_T_b38	RP5-902P8.12	-3.481	0.000615	-0.061958	26	0.017797	yes	PTTARY
chr1_1366427_AGTGTGATTGAATGAGT_A_b38	RP5-902P8.12	-3.461	0.00066	-0.06743	17	0.019481	yes	PTTARY
chr1_1274256_A_G_b38	RP5-902P8.12	3.414	0.000779	0.089556	6	0.026234	yes	PTTARY
chr1_1135738_G_C_b38	RP5-902P8.12	3.409	0.000791	0.058068	46	0.017032	yes	PTTARY
chr1_1384749_C_G_b38	RP5-902P8.12	-3.406	8e-04	-0.067313	18	0.019764	yes	PTTARY
chr1_1387763_CCT_C_b38	RP5-902P8.12	-3.406	8e-04	-0.067313	18	0.019764	yes	PTTARY
chr1_1388944_G_A_b38	RP5-902P8.12	-3.406	8e-04	-0.067313	18	0.019764	yes	PTTARY
chr1_1134062_C_T_b38	RP5-902P8.12	-3.39	0.000844	-0.061949	24	0.018272	yes	PTTARY
chr1_1366561_AGT_A_b38	RP5-902P8.12	-3.375	0.000889	-0.06688	21	0.019815	yes	PTTARY
chr1_1363880_A_G_b38	RP5-902P8.12	3.374	0.000894	0.077437	5	0.022953	yes	PTTARY
chr1_1436388_CA_C_b38	RP5-902P8.12	3.356	0.000949	0.066166	17	0.019715	yes	PTTARY
chr1_1275912_C_T_b38	RP5-902P8.12	3.352	0.000964	0.089698	5	0.026763	yes	PTTARY
chr1_1431014_G_A_b38	RP5-902P8.12	3.31	0.00111	0.06209	19	0.018759	yes	PTTARY
chr1_1279698_A_G_b38	RP5-902P8.12	3.307	0.00112	0.086808	5	0.026247	yes	PTTARY
chr1_1369282_G_A_b38	RP5-902P8.12	3.3	0.00115	0.073963	6	0.022411	yes	PTTARY
chr1_1369320_GT_G_b38	RP5-902P8.12	3.3	0.00115	0.073963	6	0.022411	yes	PTTARY
chr1_1369407_G_A_b38	RP5-902P8.12	3.3	0.00115	0.073963	6	0.022411	yes	PTTARY
chr1_1369476_CTT_C_b38	RP5-902P8.12	3.3	0.00115	0.073963	6	0.022411	yes	PTTARY
chr1_1369556_C_G_b38	RP5-902P8.12	3.3	0.00115	0.073963	6	0.022411	yes	PTTARY
chr1_1369627_T_C_b38	RP5-902P8.12	3.3	0.00115	0.073963	6	0.022411	yes	PTTARY
chr1_1369686_T_C_b38	RP5-902P8.12	3.3	0.00115	0.073963	6	0.022411	yes	PTTARY
chr1_1369716_G_C_b38	RP5-902P8.12	3.3	0.00115	0.073963	6	0.022411	yes	PTTARY
chr1_1369741_C_T_b38	RP5-902P8.12	3.3	0.00115	0.073963	6	0.022411	yes	PTTARY
chr1_1369821_C_T_b38	RP5-902P8.12	3.3	0.00115	0.073963	6	0.022411	yes	PTTARY
chr1_1411323_A_C_b38	RP5-902P8.12	3.299	0.00115	0.065724	23	0.01992	yes	PTTARY
chr1_1374505_A_G_b38	RP5-902P8.12	3.288	0.0012	0.075648	6	0.023008	yes	PTTARY
chr1_1274980_C_T_b38	RP5-902P8.12	3.283	0.00122	0.087231	5	0.026574	yes	PTTARY
chr1_1248709_A_G_b38	RP5-902P8.12	3.282	0.00122	0.087124	3	0.026543	yes	PTTARY
chr1_1134071_G_A_b38	RP5-902P8.12	3.281	0.00122	0.055029	43	0.01677	yes	PTTARY
chr1_1400410_A_G_b38	RP5-902P8.12	3.273	0.00126	0.065046	17	0.019875	yes	PTTARY
chr1_1279694_A_G_b38	RP5-902P8.12	3.271	0.00127	0.086519	5	0.026454	yes	PTTARY
chr1_1279728_TG_T_b38	RP5-902P8.12	3.271	0.00127	0.086519	5	0.026454	yes	PTTARY
chr1_1394423_A_G_b38	RP5-902P8.12	3.256	0.00133	0.064811	21	0.019905	yes	PTTARY
chr1_1395346_A_G_b38	RP5-902P8.12	3.256	0.00133	0.064811	21	0.019905	yes	PTTARY
chr1_1387698_A_G_b38	RP5-902P8.12	-3.256	0.00133	-0.064811	21	0.019905	yes	PTTARY
chr1_1389827_C_T_b38	RP5-902P8.12	-3.256	0.00133	-0.064811	21	0.019905	yes	PTTARY
chr1_1402457_A_G_b38	RP5-902P8.12	3.244	0.00139	0.064702	21	0.019946	yes	PTTARY
chr1_820395_A_G_b38	RP5-902P8.12	-3.244	0.00139	-0.071505	6	0.022044	yes	PTTARY
chr1_1367919_C_T_b38	RP5-902P8.12	3.234	0.00143	0.072767	6	0.022504	yes	PTTARY
chr1_1367951_C_T_b38	RP5-902P8.12	3.234	0.00143	0.072767	6	0.022504	yes	PTTARY
chr1_1367965_A_G_b38	RP5-902P8.12	3.234	0.00143	0.072767	6	0.022504	yes	PTTARY
chr1_1367970_T_G_b38	RP5-902P8.12	3.234	0.00143	0.072767	6	0.022504	yes	PTTARY
chr1_1367994_C_A_b38	RP5-902P8.12	3.234	0.00143	0.072767	6	0.022504	yes	PTTARY
chr1_1368297_C_T_b38	RP5-902P8.12	3.234	0.00143	0.072767	6	0.022504	yes	PTTARY
chr1_1368514_C_G_b38	RP5-902P8.12	3.234	0.00143	0.072767	6	0.022504	yes	PTTARY
chr1_1368991_C_T_b38	RP5-902P8.12	3.234	0.00143	0.072767	6	0.022504	yes	PTTARY
chr1_1369009_T_C_b38	RP5-902P8.12	3.234	0.00143	0.072767	6	0.022504	yes	PTTARY
chr1_1369012_C_CG_b38	RP5-902P8.12	3.234	0.00143	0.072767	6	0.022504	yes	PTTARY
chr1_1132216_CAG_C_b38	RP5-902P8.12	3.22	0.0015	0.057372	39	0.01782	yes	PTTARY
chr1_1134045_C_A_b38	RP5-902P8.12	3.217	0.00152	0.055425	43	0.017228	yes	PTTARY
chr1_1442793_G_A_b38	RP5-902P8.12	3.213	0.00153	0.069528	7	0.021638	yes	PTTARY
chr1_1370430_T_C_b38	RP5-902P8.12	3.202	0.00159	0.073199	6	0.022859	yes	PTTARY
chr1_1370532_C_T_b38	RP5-902P8.12	3.202	0.00159	0.073199	6	0.022859	yes	PTTARY
chr1_1370584_G_C_b38	RP5-902P8.12	3.202	0.00159	0.073199	6	0.022859	yes	PTTARY
chr1_1182106_A_G_b38	RP5-902P8.12	3.199	0.00161	0.070815	9	0.022136	yes	PTTARY
chr1_1132294_T_TGG_b38	RP5-902P8.12	3.191	0.00165	0.057105	38	0.017896	yes	PTTARY
chr1_1370181_C_T_b38	RP5-902P8.12	3.187	0.00168	0.073198	5	0.022971	yes	PTTARY
chr1_1370317_G_C_b38	RP5-902P8.12	3.187	0.00168	0.073198	5	0.022971	yes	PTTARY
chr1_1370320_A_G_b38	RP5-902P8.12	3.187	0.00168	0.073198	5	0.022971	yes	PTTARY
chr1_1134063_G_A_b38	RP5-902P8.12	3.177	0.00173	0.054329	43	0.017098	yes	PTTARY
chr1_1367280_T_A_b38	RP5-902P8.12	3.174	0.00175	0.073185	5	0.02306	yes	PTTARY
chr1_1358384_G_C_b38	RP5-902P8.12	-3.172	0.00176	-0.063164	21	0.01991	yes	PTTARY
chr1_1137118_G_C_b38	RP5-902P8.12	3.169	0.00177	0.053936	46	0.017019	yes	PTTARY
chr1_1370113_A_G_b38	RP5-902P8.12	-3.158	0.00184	-0.061443	18	0.019458	yes	PTTARY
chr1_1330125_G_A_b38	RP5-902P8.12	-3.157	0.00185	-0.062512	22	0.019803	yes	PTTARY
chr1_1375642_C_T_b38	RP5-902P8.12	3.136	0.00198	0.072192	6	0.023022	yes	PTTARY
chr1_1364282_T_G_b38	RP5-902P8.12	3.12	0.00208	0.071992	5	0.023076	yes	PTTARY
chr1_1364357_A_C_b38	RP5-902P8.12	3.12	0.00208	0.071992	5	0.023076	yes	PTTARY
chr1_1364694_T_C_b38	RP5-902P8.12	3.12	0.00208	0.071992	5	0.023076	yes	PTTARY
chr1_1364721_C_T_b38	RP5-902P8.12	3.12	0.00208	0.071992	5	0.023076	yes	PTTARY
chr1_1365160_A_G_b38	RP5-902P8.12	3.12	0.00208	0.071992	5	0.023076	yes	PTTARY
chr1_1365198_C_T_b38	RP5-902P8.12	3.12	0.00208	0.071992	5	0.023076	yes	PTTARY
chr1_1366008_A_G_b38	RP5-902P8.12	3.12	0.00208	0.071992	5	0.023076	yes	PTTARY
chr1_1366062_T_C_b38	RP5-902P8.12	3.12	0.00208	0.071992	5	0.023076	yes	PTTARY
chr1_1366145_TGTGAA_T_b38	RP5-902P8.12	3.12	0.00208	0.071992	5	0.023076	yes	PTTARY
chr1_1366321_TGTGTGTAAATGG_T_b38	RP5-902P8.12	3.12	0.00208	0.071992	5	0.023076	yes	PTTARY
chr1_1366453_G_T_b38	RP5-902P8.12	3.12	0.00208	0.071992	5	0.023076	yes	PTTARY
chr1_1366726_T_G_b38	RP5-902P8.12	3.12	0.00208	0.071992	5	0.023076	yes	PTTARY
chr1_1367258_T_A_b38	RP5-902P8.12	3.12	0.00208	0.071992	5	0.023076	yes	PTTARY
chr1_1367268_TGA_T_b38	RP5-902P8.12	3.12	0.00208	0.071992	5	0.023076	yes	PTTARY
chr1_1367297_GAA_G_b38	RP5-902P8.12	3.12	0.00208	0.071992	5	0.023076	yes	PTTARY
chr1_1367300_T_TGA_b38	RP5-902P8.12	3.12	0.00208	0.071992	5	0.023076	yes	PTTARY
chr1_1367329_A_AGT_b38	RP5-902P8.12	3.12	0.00208	0.071992	5	0.023076	yes	PTTARY
chr1_1367373_T_TGTG_b38	RP5-902P8.12	3.12	0.00208	0.071992	5	0.023076	yes	PTTARY
chr1_1367462_T_C_b38	RP5-902P8.12	3.12	0.00208	0.071992	5	0.023076	yes	PTTARY
chr1_1367593_G_A_b38	RP5-902P8.12	3.12	0.00208	0.071992	5	0.023076	yes	PTTARY
chr1_1367602_GT_G_b38	RP5-902P8.12	3.12	0.00208	0.071992	5	0.023076	yes	PTTARY
chr1_1367605_GAGTGAGTGTA_G_b38	RP5-902P8.12	3.12	0.00208	0.071992	5	0.023076	yes	PTTARY
chr1_1367670_GGTGA_G_b38	RP5-902P8.12	3.12	0.00208	0.071992	5	0.023076	yes	PTTARY
chr1_1367722_TTTTA_T_b38	RP5-902P8.12	3.12	0.00208	0.071992	5	0.023076	yes	PTTARY
chr1_1367874_A_T_b38	RP5-902P8.12	3.12	0.00208	0.071992	5	0.023076	yes	PTTARY
chr1_1366292_G_T_b38	RP5-902P8.12	3.102	0.0022	0.071609	5	0.023083	yes	PTTARY
chr1_1368763_G_A_b38	RP5-902P8.12	3.095	0.00225	0.069894	6	0.022581	yes	PTTARY
chr1_1368177_G_C_b38	RP5-902P8.12	3.088	0.00231	0.069224	7	0.022416	yes	PTTARY
chr1_1365036_T_TAA_b38	RP5-902P8.12	3.086	0.00233	0.076189	3	0.024692	yes	PTTARY
chr1_1431026_CCACCCCCT_C_b38	RP5-902P8.12	3.078	0.00239	0.061718	13	0.020054	yes	PTTARY
chr1_1367954_A_C_b38	RP5-902P8.12	3.071	0.00243	0.090733	3	0.029543	yes	PTTARY
chr1_1366187_A_AGT_b38	RP5-902P8.12	3.063	0.0025	0.070787	5	0.023112	yes	PTTARY
chr1_1361685_C_T_b38	RP5-902P8.12	3.053	0.00258	0.069093	10	0.022629	yes	PTTARY
chr1_1133289_GT_G_b38	RP5-902P8.12	3.051	0.0026	0.053618	41	0.017575	yes	PTTARY
chr1_1448915_G_A_b38	RP5-902P8.12	3.046	0.00264	0.059597	17	0.019568	yes	PTTARY
chr1_1366511_GGTGA_G_b38	RP5-902P8.12	3.027	0.00281	0.070075	5	0.023153	yes	PTTARY
chr1_1363688_C_T_b38	RP5-902P8.12	2.979	0.00326	0.068966	5	0.023154	yes	PTTARY
chr1_1364099_CCA_C_b38	RP5-902P8.12	2.979	0.00326	0.068966	5	0.023154	yes	PTTARY
chr1_1364102_TGTTG_T_b38	RP5-902P8.12	2.979	0.00326	0.068966	5	0.023154	yes	PTTARY
chr1_820510_A_T_b38	RP5-902P8.12	-2.978	0.00326	-0.068903	6	0.023134	yes	PTTARY
chr1_1432355_G_A_b38	RP5-902P8.12	2.964	0.00342	0.062488	11	0.021085	yes	PTTARY
chr1_2011271_G_GT_b38	RP5-902P8.12	-2.962	0.00343	-0.0494	53	0.016677	yes	PTTARY
chr1_1133452_CGCCGCCTGCCTGCCCG_C_b38	RP5-902P8.12	2.956	0.0035	0.052175	43	0.017649	yes	PTTARY
chr1_1367511_ATGAG_A_b38	RP5-902P8.12	2.948	0.00359	0.06991	4	0.023714	yes	PTTARY
chr1_1379093_TG_T_b38	RP5-902P8.12	2.948	0.00359	0.070236	5	0.023826	yes	PTTARY
chr1_1189283_G_A_b38	RP5-902P8.12	2.945	0.00362	0.061627	12	0.020924	yes	PTTARY
chr1_1308516_C_T_b38	RP5-902P8.12	-2.932	0.00377	-0.057893	23	0.019748	yes	PTTARY
chr1_1187535_A_G_b38	RP5-902P8.12	2.928	0.00381	0.060244	14	0.020572	yes	PTTARY
chr1_1426253_G_A_b38	RP5-902P8.12	2.919	0.00392	0.064056	7	0.021946	yes	PTTARY
chr1_1312114_T_C_b38	RP5-902P8.12	-2.914	0.00399	-0.057374	23	0.019692	yes	PTTARY
chr1_1367388_T_TTGG_b38	RP5-902P8.12	2.905	0.00409	0.067504	5	0.023235	yes	PTTARY
chr1_1195463_A_G_b38	RP5-902P8.12	2.904	0.00411	0.060052	13	0.020679	yes	PTTARY
chr1_1290579_C_G_b38	RP5-902P8.12	2.894	0.00424	0.061032	13	0.021091	yes	PTTARY
chr1_1496973_G_A_b38	RP5-902P8.12	2.881	0.0044	0.07721	9	0.026799	yes	PTTARY
chr1_1364566_T_C_b38	RP5-902P8.12	2.88	0.00442	0.066768	5	0.023185	yes	PTTARY
chr1_1394041_G_A_b38	RP5-902P8.12	2.88	0.00443	0.06868	5	0.023851	yes	PTTARY
chr1_1439805_G_C_b38	RP5-902P8.12	2.875	0.00449	0.058976	12	0.020513	yes	PTTARY
chr1_1131566_A_G_b38	RP5-902P8.12	2.87	0.00456	0.05042	43	0.017568	yes	PTTARY
chr1_1361679_G_A_b38	RP5-902P8.12	-2.848	0.00487	-0.060207	14	0.021143	yes	PTTARY
chr1_1380867_A_G_b38	RP5-902P8.12	2.828	0.00517	0.065548	6	0.023176	yes	PTTARY
chr1_1382893_G_A_b38	RP5-902P8.12	2.828	0.00517	0.065548	6	0.023176	yes	PTTARY
chr1_1877316_A_AATAT_b38	RP5-902P8.12	2.822	0.00527	0.090655	4	0.032126	yes	PTTARY
chr1_1173872_A_G_b38	RP5-902P8.12	2.816	0.00536	0.051637	25	0.018335	yes	PTTARY
chr1_1134095_AAAAAAAG_A_b38	RP5-902P8.12	2.814	0.00539	0.053673	43	0.019074	yes	PTTARY
chr1_1197893_T_C_b38	RP5-902P8.12	2.793	0.00573	0.057591	11	0.020616	yes	PTTARY
chr1_1198407_T_C_b38	RP5-902P8.12	2.793	0.00573	0.057591	11	0.020616	yes	PTTARY
chr1_1198435_T_C_b38	RP5-902P8.12	2.793	0.00573	0.057591	11	0.020616	yes	PTTARY
chr1_1431656_G_A_b38	RP5-902P8.12	2.789	0.00581	0.061042	7	0.021889	yes	PTTARY
chr1_1131008_C_CT_b38	RP5-902P8.12	2.781	0.00595	0.048969	43	0.01761	yes	PTTARY
chr1_1131023_T_C_b38	RP5-902P8.12	2.781	0.00595	0.048969	43	0.01761	yes	PTTARY
chr1_1435945_C_CCGGGCGGGGGCG_b38	RP5-902P8.12	2.78	0.00597	0.059931	8	0.02156	yes	PTTARY
chr1_1309988_G_A_b38	RP5-902P8.12	-2.779	0.00598	-0.054804	23	0.019719	yes	PTTARY
chr1_1366776_G_GAATT_b38	RP5-902P8.12	2.775	0.00606	0.065321	5	0.023543	yes	PTTARY
chr1_1364253_C_G_b38	RP5-902P8.12	2.755	0.00642	0.064381	5	0.02337	yes	PTTARY
chr1_1313807_G_A_b38	RP5-902P8.12	-2.738	0.00675	-0.053788	23	0.019644	yes	PTTARY
chr1_1383743_T_C_b38	RP5-902P8.12	2.735	0.0068	0.063903	6	0.023362	yes	PTTARY
chr1_1384546_C_T_b38	RP5-902P8.12	2.735	0.0068	0.063903	6	0.023362	yes	PTTARY
chr1_1398218_C_A_b38	RP5-902P8.12	2.735	0.0068	0.063903	6	0.023362	yes	PTTARY
chr1_1196201_T_C_b38	RP5-902P8.12	2.733	0.00685	0.056112	12	0.020532	yes	PTTARY
chr1_1434687_C_G_b38	RP5-902P8.12	2.731	0.00688	0.059487	7	0.02178	yes	PTTARY
chr1_2004141_A_C_b38	RP5-902P8.12	-2.726	0.00699	-0.057627	8	0.02114	yes	PTTARY
chr1_272548_A_C_b38	RP5-902P8.12	2.726	0.007	0.078492	11	0.028796	yes	PTTARY
chr1_1363456_CAG_C_b38	RP5-902P8.12	-2.722	0.00708	-0.053107	15	0.019512	yes	PTTARY
chr1_1369803_C_CT_b38	RP5-902P8.12	2.715	0.00721	0.060449	7	0.022263	yes	PTTARY
chr1_1329973_GCGTGTGCCATGCA_G_b38	RP5-902P8.12	2.714	0.00724	0.063792	5	0.023504	yes	PTTARY
chr1_1400756_GGA_G_b38	RP5-902P8.12	2.711	0.0073	0.063291	6	0.023343	yes	PTTARY
chr1_1401954_G_T_b38	RP5-902P8.12	2.711	0.0073	0.063291	6	0.023343	yes	PTTARY
chr1_1403593_A_G_b38	RP5-902P8.12	2.711	0.0073	0.063291	6	0.023343	yes	PTTARY
chr1_1407565_C_A_b38	RP5-902P8.12	2.711	0.0073	0.063291	6	0.023343	yes	PTTARY
chr1_1182832_T_C_b38	RP5-902P8.12	2.707	0.00738	0.051857	24	0.019154	yes	PTTARY
chr1_1197697_A_G_b38	RP5-902P8.12	2.703	0.00748	0.055971	12	0.020708	yes	PTTARY
chr1_1499586_C_CT_b38	RP5-902P8.12	2.699	0.00757	0.067836	9	0.025138	yes	PTTARY
chr1_822556_C_A_b38	RP5-902P8.12	-2.684	0.0079	-0.062098	7	0.023136	yes	PTTARY
chr1_1190173_A_T_b38	RP5-902P8.12	2.677	0.00805	0.05947	5	0.022212	yes	PTTARY
chr1_1193141_C_T_b38	RP5-902P8.12	2.677	0.00805	0.05947	5	0.022212	yes	PTTARY
chr1_1194826_G_A_b38	RP5-902P8.12	2.677	0.00805	0.05947	5	0.022212	yes	PTTARY
chr1_1130420_C_T_b38	RP5-902P8.12	-2.669	0.00825	-0.058815	8	0.02204	yes	PTTARY
chr1_1366681_T_TGA_b38	RP5-902P8.12	2.66	0.00845	0.062807	5	0.023607	yes	PTTARY
chr1_826893_G_A_b38	RP5-902P8.12	-2.62	0.00948	-0.061571	6	0.023499	yes	PTTARY
chr1_1370553_CA_C_b38	RP5-902P8.12	-2.616	0.00958	-0.04427	63	0.01692	yes	PTTARY
chr1_789680_A_AGGAATGGAAT_b38	RP5-902P8.12	-2.607	0.00983	-0.044336	30	0.017005	yes	PTTARY
chr1_1303800_G_A_b38	RP5-902P8.12	2.604	0.00992	0.064672	5	0.024834	yes	PTTARY
chr1_1304555_A_C_b38	RP5-902P8.12	2.604	0.00992	0.064672	5	0.024834	yes	PTTARY
chr1_1132196_G_A_b38	RP5-902P8.12	-2.603	0.00995	-0.056059	9	0.021537	yes	PTTARY
chr1_1256888_G_GA_b38	RP5-902P8.12	-2.602	0.00997	-0.071962	5	0.027653	yes	PTTARY
chr1_1132482_T_C_b38	RP5-902P8.12	-2.602	0.00998	-0.055354	9	0.021276	yes	PTTARY
chr1_1249880_A_G_b38	RP5-902P8.12	4.869	2.31e-06	0.108896	7	0.022366	no	PTTARY
chr1_1241639_T_C_b38	RP5-902P8.12	4.322	2.46e-05	0.109759	3	0.025395	no	PTTARY
chr1_1242094_A_G_b38	RP5-902P8.12	4.322	2.46e-05	0.109759	3	0.025395	no	PTTARY
chr1_1242250_A_G_b38	RP5-902P8.12	4.322	2.46e-05	0.109759	3	0.025395	no	PTTARY
chr1_1241053_A_G_b38	RP5-902P8.12	4.235	3.52e-05	0.106683	3	0.025193	no	PTTARY
chr1_1242865_C_T_b38	RP5-902P8.12	4.112	5.76e-05	0.10352	3	0.025173	no	PTTARY
chr1_1243545_G_A_b38	RP5-902P8.12	4.079	6.57e-05	0.105143	3	0.025776	no	PTTARY
chr1_1243929_G_A_b38	RP5-902P8.12	4.079	6.57e-05	0.105143	3	0.025776	no	PTTARY
chr1_1244603_G_A_b38	RP5-902P8.12	4.014	8.5e-05	0.102295	3	0.025486	no	PTTARY
chr1_1241217_T_C_b38	RP5-902P8.12	3.931	0.000117	0.100196	3	0.025487	no	PTTARY
chr1_1308178_GGGGCGCGGGGA_G_b38	RP5-902P8.12	3.907	0.000129	0.083439	8	0.021357	no	PTTARY
chr1_1243102_A_G_b38	RP5-902P8.12	3.907	0.000129	0.098677	3	0.02526	no	PTTARY
chr1_1246371_T_C_b38	RP5-902P8.12	3.889	0.000138	0.098331	4	0.025285	no	PTTARY
chr1_1243650_G_A_b38	RP5-902P8.12	3.782	0.000206	0.097257	3	0.025715	no	PTTARY
chr1_1177602_C_T_b38	RP5-902P8.12	3.301	0.00115	0.071959	8	0.0218	no	PTTARY
chr1_1426261_C_T_b38	RP5-902P8.12	3.29	0.00119	0.062812	25	0.019094	no	PTTARY
chr1_1426810_C_G_b38	RP5-902P8.12	3.29	0.00119	0.062812	25	0.019094	no	PTTARY
chr1_2001028_G_A_b38	RP5-902P8.12	-3.246	0.00138	-0.056746	22	0.017483	no	PTTARY
chr1_1430908_A_G_b38	RP5-902P8.12	3.209	0.00156	0.061122	25	0.019048	no	PTTARY
chr1_1428969_T_C_b38	RP5-902P8.12	3.208	0.00156	0.061464	25	0.01916	no	PTTARY
chr1_1998227_A_G_b38	RP5-902P8.12	-3.167	0.00179	-0.055349	23	0.017478	no	PTTARY
chr1_1999756_G_T_b38	RP5-902P8.12	-3.144	0.00192	-0.054805	24	0.017431	no	PTTARY
chr1_1997968_T_C_b38	RP5-902P8.12	-3.127	0.00203	-0.054484	23	0.017422	no	PTTARY
chr1_1999504_C_T_b38	RP5-902P8.12	-3.099	0.00223	-0.053851	23	0.017379	no	PTTARY
chr1_1998395_A_C_b38	RP5-902P8.12	-3.076	0.0024	-0.053783	23	0.017484	no	PTTARY
chr1_1998420_T_C_b38	RP5-902P8.12	-3.076	0.0024	-0.053783	23	0.017484	no	PTTARY
chr1_1998438_C_A_b38	RP5-902P8.12	-3.076	0.0024	-0.053783	23	0.017484	no	PTTARY
chr1_1998952_C_G_b38	RP5-902P8.12	-3.076	0.0024	-0.053783	23	0.017484	no	PTTARY
chr1_1999073_A_G_b38	RP5-902P8.12	-3.076	0.0024	-0.053783	23	0.017484	no	PTTARY
chr1_1431450_A_G_b38	RP5-902P8.12	3.032	0.00276	0.058093	25	0.01916	no	PTTARY
chr1_1431537_G_C_b38	RP5-902P8.12	3.032	0.00276	0.058093	25	0.01916	no	PTTARY
chr1_1131572_A_G_b38	RP5-902P8.12	3.027	0.00281	0.053397	44	0.017643	no	PTTARY
chr1_1131573_T_C_b38	RP5-902P8.12	3.027	0.00281	0.053397	44	0.017643	no	PTTARY
chr1_1999315_C_T_b38	RP5-902P8.12	-3.023	0.00284	-0.052693	24	0.017431	no	PTTARY
chr1_1999366_G_C_b38	RP5-902P8.12	-3.023	0.00284	-0.052693	24	0.017431	no	PTTARY
chr1_1999542_T_C_b38	RP5-902P8.12	-3.023	0.00284	-0.052693	24	0.017431	no	PTTARY
chr1_1430190_A_C_b38	RP5-902P8.12	3.018	0.00288	0.057768	25	0.019142	no	PTTARY
chr1_1995825_A_G_b38	RP5-902P8.12	-3.003	0.00303	-0.052164	24	0.017373	no	PTTARY
chr1_1997149_G_A_b38	RP5-902P8.12	-3.003	0.00303	-0.052164	24	0.017373	no	PTTARY
chr1_1997160_C_T_b38	RP5-902P8.12	-3.003	0.00303	-0.052164	24	0.017373	no	PTTARY
chr1_1994282_G_A_b38	RP5-902P8.12	-2.97	0.00335	-0.053171	23	0.017901	no	PTTARY
chr1_1998718_C_CA_b38	RP5-902P8.12	-2.917	0.00394	-0.050955	23	0.017467	no	PTTARY
chr1_1240648_T_TCATTCACCCCGGCCGTGGTCCCTGCCCCAGCCCCCGCCGCCCC_b38	RP5-902P8.12	-2.868	0.00458	-0.03867	37	0.013482	no	PTTARY
chr1_1433374_T_C_b38	RP5-902P8.12	2.859	0.00471	0.052574	30	0.018387	no	PTTARY
chr1_1994839_A_T_b38	RP5-902P8.12	-2.855	0.00477	-0.049424	25	0.017312	no	PTTARY
chr1_1365566_G_A_b38	RP5-902P8.12	-2.839	0.005	-0.061021	8	0.021492	no	PTTARY
chr1_1363898_C_T_b38	RP5-902P8.12	-2.82	0.00529	-0.06059	8	0.021485	no	PTTARY
chr1_1363986_C_T_b38	RP5-902P8.12	-2.82	0.00529	-0.06059	8	0.021485	no	PTTARY
chr1_1366529_TTAG_T_b38	RP5-902P8.12	-2.82	0.00529	-0.06059	8	0.021485	no	PTTARY
chr1_1367292_A_AGT_b38	RP5-902P8.12	-2.82	0.00529	-0.06059	8	0.021485	no	PTTARY
chr1_1996920_CA_C_b38	RP5-902P8.12	-2.813	0.00541	-0.061308	9	0.021796	no	PTTARY
chr1_1127861_G_T_b38	RP5-902P8.12	2.778	0.00601	0.049754	44	0.017913	no	PTTARY
chr1_1379091_T_G_b38	RP5-902P8.12	-2.742	0.00668	-0.059919	8	0.021854	no	PTTARY
chr1_1251356_AT_A_b38	RP5-902P8.12	2.624	0.00938	0.059358	5	0.022624	no	PTTARY
chr1_1440834_C_G_b38	RP5-902P8.12	2.617	0.00956	0.048954	27	0.018706	no	PTTARY
chr1_1443457_T_C_b38	RP5-902P8.12	2.617	0.00956	0.048954	27	0.018706	no	PTTARY
chr1_1236303_A_G_b38	RP5-902P8.12	3.925	0.000123	0.091923	3	0.02342	yes	PRSTTE
chr1_1228424_C_T_b38	RP5-902P8.12	3.406	0.000812	0.076108	4	0.022346	yes	PRSTTE
chr1_1216593_G_C_b38	RP5-902P8.12	3.312	0.00112	0.075413	3	0.022768	yes	PRSTTE
chr1_789680_A_AGGAATGGAATGGAAT_b38	RP5-902P8.12	3.161	0.00184	0.054877	21	0.017359	yes	PRSTTE
chr1_1215852_T_C_b38	RP5-902P8.12	3.127	0.00206	0.071827	3	0.022971	yes	PRSTTE
chr1_789680_A_AGGAATGGAAT_b38	RP5-902P8.12	-3.049	0.00264	-0.049748	29	0.016318	yes	PRSTTE
chr1_1663949_A_G_b38	RP5-902P8.12	2.939	0.00372	0.066203	8	0.022525	yes	PRSTTE
chr1_2132990_A_C_b38	RP5-902P8.12	2.916	0.00399	0.0805	3	0.027606	yes	PRSTTE
chr1_933601_C_T_b38	RP5-902P8.12	-2.848	0.00491	-0.105675	7	0.03711	yes	PRSTTE
chr1_1649932_C_T_b38	RP5-902P8.12	-2.837	0.00507	-0.048765	48	0.017189	yes	PRSTTE
chr1_1641275_A_G_b38	RP5-902P8.12	2.807	0.00556	0.050793	24	0.018098	yes	PRSTTE
chr1_1173872_A_G_b38	RP5-902P8.12	2.774	0.00612	0.049222	23	0.017745	yes	PRSTTE
chr1_1099341_T_C_b38	RP5-902P8.12	-2.744	0.00669	-0.067129	5	0.024466	yes	PRSTTE
chr1_1648736_G_A_b38	RP5-902P8.12	-2.718	0.0072	-0.047436	45	0.01745	yes	PRSTTE
chr1_285109_C_CA_b38	RP5-902P8.12	-2.687	0.00787	-0.085761	3	0.031912	yes	PRSTTE
chr1_1470425_C_CT_b38	RP5-902P8.12	-2.669	0.00829	-0.103256	3	0.038683	yes	PRSTTE
chr1_1118491_T_C_b38	RP5-902P8.12	-2.614	0.00969	-0.087359	3	0.033415	yes	PRSTTE
chr1_1118832_C_T_b38	RP5-902P8.12	-2.614	0.00969	-0.087359	3	0.033415	yes	PRSTTE
chr1_1120626_G_A_b38	RP5-902P8.12	-2.614	0.00969	-0.087359	3	0.033415	yes	PRSTTE
chr1_1182018_A_G_b38	RP5-902P8.12	2.609	0.00984	0.045865	44	0.01758	yes	PRSTTE
chr1_1231710_CCCCCGGGAA_C_b38	RP5-902P8.12	3.278	0.00125	0.077815	3	0.02374	no	PRSTTE
chr1_1308178_GGGGCGCGGGGA_G_b38	RP5-902P8.12	3.079	0.0024	0.064894	8	0.021078	no	PRSTTE
chr1_1612562_T_TC_b38	RP5-902P8.12	-3.027	0.00283	-0.051848	25	0.017129	no	PRSTTE
chr1_1231507_T_C_b38	RP5-902P8.12	3.019	0.0029	0.067876	5	0.022483	no	PRSTTE
chr1_2062283_C_T_b38	RP5-902P8.12	2.994	0.00314	0.066158	6	0.022099	no	PRSTTE
chr1_2057679_A_C_b38	RP5-902P8.12	2.982	0.00326	0.06333	7	0.021238	no	PRSTTE
chr1_2060607_C_T_b38	RP5-902P8.12	2.952	0.00358	0.062076	7	0.021028	no	PRSTTE
chr1_601673_G_A_b38	RP5-902P8.12	2.936	0.00376	0.083848	3	0.028559	no	PRSTTE
chr1_2061762_C_A_b38	RP5-902P8.12	2.9	0.00419	0.061996	7	0.021378	no	PRSTTE
chr1_2056323_C_T_b38	RP5-902P8.12	2.896	0.00425	0.063322	7	0.021869	no	PRSTTE
chr1_2061187_A_G_b38	RP5-902P8.12	2.896	0.00425	0.063322	7	0.021869	no	PRSTTE
chr1_2065120_G_A_b38	RP5-902P8.12	2.896	0.00425	0.063322	7	0.021869	no	PRSTTE
chr1_1600379_C_T_b38	RP5-902P8.12	-2.859	0.00475	-0.049967	23	0.017476	no	PRSTTE
chr1_1595028_C_CAG_b38	RP5-902P8.12	-2.828	0.00522	-0.054689	13	0.01934	no	PRSTTE
chr1_2056605_G_C_b38	RP5-902P8.12	2.789	0.00585	0.062157	7	0.022286	no	PRSTTE
chr1_1607931_G_A_b38	RP5-902P8.12	-2.767	0.00625	-0.047955	24	0.017333	no	PRSTTE
chr1_1609058_G_A_b38	RP5-902P8.12	-2.767	0.00625	-0.047955	24	0.017333	no	PRSTTE
chr1_1600320_C_G_b38	RP5-902P8.12	-2.757	0.00643	-0.047885	23	0.017366	no	PRSTTE
chr1_1099309_T_G_b38	RP5-902P8.12	-2.719	0.00719	-0.067077	4	0.024671	no	PRSTTE
chr1_1662396_T_C_b38	RP5-902P8.12	2.719	0.00719	0.094405	6	0.034726	no	PRSTTE
chr1_1654662_CT_C_b38	RP5-902P8.12	-2.716	0.00726	-0.0516	31	0.019002	no	PRSTTE
chr1_1370113_A_G_b38	RP5-902P8.12	-2.714	0.00728	-0.054481	16	0.020071	no	PRSTTE
chr1_1238231_G_A_b38	RP5-902P8.12	2.707	0.00745	0.059924	7	0.022139	no	PRSTTE
chr1_1229369_G_GC_b38	RP5-902P8.12	2.687	0.00788	0.059093	7	0.021992	no	PRSTTE
chr1_1606089_GGC_G_b38	RP5-902P8.12	-2.662	0.00848	-0.052294	18	0.019648	no	PRSTTE
chr1_2059723_G_A_b38	RP5-902P8.12	2.657	0.00858	0.054607	21	0.020549	no	PRSTTE
chr1_813885_G_A_b38	RP5-902P8.12	-2.629	0.0093	-0.043915	50	0.016703	no	PRSTTE
chr1_932613_GTTTC_G_b38	RP5-902P8.12	-2.623	0.00945	-0.110928	5	0.042287	no	PRSTTE
chr1_633423_C_T_b38	RP5-902P8.12	3.666	0.000276	0.083387	5	0.022747	yes	SKINNS
chr1_1533883_G_T_b38	RP5-902P8.12	3.113	0.00197	0.056138	13	0.018032	yes	SKINNS
chr1_1663759_G_A_b38	RP5-902P8.12	3.044	0.00247	0.061281	8	0.020133	yes	SKINNS
chr1_2067567_G_A_b38	RP5-902P8.12	-2.935	0.00351	-0.040208	11	0.013701	yes	SKINNS
chr1_2059575_A_G_b38	RP5-902P8.12	-2.905	0.00385	-0.035172	23	0.012106	yes	SKINNS
chr1_2059863_G_A_b38	RP5-902P8.12	-2.905	0.00385	-0.035172	23	0.012106	yes	SKINNS
chr1_1288341_C_T_b38	RP5-902P8.12	2.871	0.00429	0.054142	11	0.018859	yes	SKINNS
chr1_1361833_G_C_b38	RP5-902P8.12	-2.836	0.00477	-0.039394	13	0.01389	yes	SKINNS
chr1_2076742_GA_G_b38	RP5-902P8.12	-2.816	0.00508	-0.035862	14	0.012736	yes	SKINNS
chr1_899576_G_A_b38	RP5-902P8.12	2.725	0.00668	0.063834	4	0.023422	yes	SKINNS
chr1_1126414_A_G_b38	RP5-902P8.12	-2.7	0.00719	-0.027392	64	0.010144	yes	SKINNS
chr1_1126468_A_G_b38	RP5-902P8.12	-2.7	0.00719	-0.027392	64	0.010144	yes	SKINNS
chr1_791544_TGAATG_T_b38	RP5-902P8.12	-2.699	0.00722	-0.037224	12	0.013792	yes	SKINNS
chr1_1471663_A_C_b38	RP5-902P8.12	2.699	0.00722	0.067067	7	0.02485	yes	SKINNS
chr1_898676_A_C_b38	RP5-902P8.12	2.683	0.00757	0.058962	8	0.021977	yes	SKINNS
chr1_899257_AC_A_b38	RP5-902P8.12	2.683	0.00757	0.058962	8	0.021977	yes	SKINNS
chr1_2079677_C_G_b38	RP5-902P8.12	-2.676	0.00773	-0.034287	17	0.012814	yes	SKINNS
chr1_2074688_G_A_b38	RP5-902P8.12	-2.666	0.00796	-0.03452	17	0.01295	yes	SKINNS
chr1_901812_A_G_b38	RP5-902P8.12	2.653	0.00826	0.04365	17	0.016452	yes	SKINNS
chr1_665220_T_C_b38	RP5-902P8.12	-2.634	0.00874	-0.084558	3	0.032107	yes	SKINNS
chr1_1516109_T_C_b38	RP5-902P8.12	2.611	0.00934	0.052883	13	0.020256	yes	SKINNS
chr1_629218_A_G_b38	RP5-902P8.12	3.357	0.000857	0.082663	12	0.024627	no	SKINNS
chr1_1650370_C_CTT_b38	RP5-902P8.12	3.307	0.00102	0.087406	4	0.026429	no	SKINNS
chr1_689962_C_T_b38	RP5-902P8.12	3.263	0.00119	0.040801	12	0.012504	no	SKINNS
chr1_285441_C_T_b38	RP5-902P8.12	3.261	0.0012	0.043518	3	0.013346	no	SKINNS
chr1_1692900_G_GT_b38	RP5-902P8.12	-3.184	0.00156	-0.059878	4	0.018807	no	SKINNS
chr1_1572877_TGG_T_b38	RP5-902P8.12	3.13	0.00186	0.06285	6	0.020081	no	SKINNS
chr1_2059684_G_A_b38	RP5-902P8.12	-3.009	0.00277	-0.036784	21	0.012225	no	SKINNS
chr1_2061309_C_T_b38	RP5-902P8.12	-3.009	0.00277	-0.036784	21	0.012225	no	SKINNS
chr1_2063382_G_A_b38	RP5-902P8.12	-3.009	0.00277	-0.036784	21	0.012225	no	SKINNS
chr1_2065748_A_G_b38	RP5-902P8.12	-3	0.00285	-0.036376	22	0.012125	no	SKINNS
chr1_2058057_C_T_b38	RP5-902P8.12	-2.975	0.00309	-0.036681	20	0.012331	no	SKINNS
chr1_2058514_T_A_b38	RP5-902P8.12	-2.975	0.00309	-0.036681	20	0.012331	no	SKINNS
chr1_2060951_G_A_b38	RP5-902P8.12	-2.947	0.00338	-0.035739	22	0.012128	no	SKINNS
chr1_2063734_T_G_b38	RP5-902P8.12	-2.947	0.00338	-0.035739	22	0.012128	no	SKINNS
chr1_2059802_C_G_b38	RP5-902P8.12	-2.907	0.00383	-0.035298	22	0.012142	no	SKINNS
chr1_632821_T_C_b38	RP5-902P8.12	2.86	0.00443	0.074639	4	0.026094	no	SKINNS
chr1_1516110_G_A_b38	RP5-902P8.12	2.793	0.00544	0.058523	12	0.02095	no	SKINNS
chr1_2060449_TGAGAAGTGGGGCTGAATAGAGGTTTGGCAGTGCTTAGCATAGGGGGCGAGAGTCTCGGCTTCCAGC_T_b38	RP5-902P8.12	-2.786	0.00556	-0.033841	22	0.012147	no	SKINNS
chr1_1340697_G_A_b38	RP5-902P8.12	-2.752	0.00616	-0.031376	31	0.011401	no	SKINNS
chr1_1527957_C_T_b38	RP5-902P8.12	2.73	0.00659	0.066583	6	0.02439	no	SKINNS
chr1_588101_T_C_b38	RP5-902P8.12	2.73	0.00659	0.090092	3	0.033002	no	SKINNS
chr1_2063845_CT_C_b38	RP5-902P8.12	-2.694	0.00733	-0.039703	7	0.014739	no	SKINNS
chr1_272164_G_A_b38	RP5-902P8.12	2.642	0.00852	0.039514	43	0.014954	no	SKINNS
chr1_2044942_C_T_b38	RP5-902P8.12	2.639	0.00861	0.112119	3	0.04249	no	SKINNS
chr1_2099538_G_A_b38	RP5-902P8.12	-2.638	0.00864	-0.027683	55	0.010495	no	SKINNS
chr1_1687734_CA_C_b38	RP5-902P8.12	-2.63	0.00882	-0.041858	3	0.015913	no	SKINNS
chr1_1184711_G_A_b38	RP5-902P8.12	2.628	0.00888	0.061109	3	0.02325	no	SKINNS
chr1_1773715_T_TGAGA_b38	RP5-902P8.12	3.486	0.000531	0.107344	4	0.030794	yes	SKNS
chr1_875916_GCTCCTCCCCCACACTCTCCCACACTCCCCCACACTCCCCCACA_G_b38	RP5-902P8.12	3.149	0.00173	0.0386	58	0.012258	yes	SKNS
chr1_1924231_CCCT_C_b38	RP5-902P8.12	-3.033	0.00254	-0.125821	3	0.041483	yes	SKNS
chr1_1170681_G_A_b38	RP5-902P8.12	-2.999	0.00283	-0.03417	115	0.011393	yes	SKNS
chr1_632535_A_G_b38	RP5-902P8.12	-2.92	0.00365	-0.056863	4	0.019476	yes	SKNS
chr1_2181827_G_A_b38	RP5-902P8.12	2.684	0.00751	0.048382	7	0.018028	yes	SKNS
chr1_1293731_A_ACGCCCCTGCCCTGGAGGCCC_b38	RP5-902P8.12	-2.671	0.00778	-0.031674	87	0.011856	yes	SKNS
chr1_629292_A_C_b38	RP5-902P8.12	2.658	0.00809	0.134539	3	0.050612	yes	SKNS
chr1_899373_G_C_b38	RP5-902P8.12	2.602	0.00953	0.048347	5	0.018582	yes	SKNS
chr1_2160238_CGTGT_C_b38	RP5-902P8.12	3.158	0.00168	0.043045	25	0.013629	no	SKNS
chr1_1901223_A_G_b38	RP5-902P8.12	2.698	0.00721	0.111126	3	0.041195	no	SKNS
chr1_1409306_A_G_b38	RP5-902P8.12	2.688	0.0074	0.050546	9	0.018801	no	SKNS
chr1_1134102_G_A_b38	RP5-902P8.12	-2.684	0.0075	-0.059791	7	0.022278	no	SKNS
chr1_958081_TC_T_b38	RP5-902P8.12	2.596	0.0097	0.063925	13	0.024626	no	SKNS
chr1_2220140_C_A_b38	RP5-902P8.12	-2.955	0.0037	-0.059978	21	0.020297	yes	SNTTRM
chr1_1932082_AAAAAC_A_b38	RP5-902P8.12	-2.896	0.00442	-0.104522	5	0.036093	yes	SNTTRM
chr1_878850_T_A_b38	RP5-902P8.12	2.888	0.00452	0.071204	5	0.024651	yes	SNTTRM
chr1_1132482_T_G_b38	RP5-902P8.12	2.767	0.00646	0.051395	23	0.018572	yes	SNTTRM
chr1_1793064_C_CA_b38	RP5-902P8.12	2.712	0.00757	0.060587	10	0.02234	yes	SNTTRM
chr1_1132216_CAG_C_b38	RP5-902P8.12	2.693	0.00799	0.049651	36	0.018435	yes	SNTTRM
chr1_1217733_G_A_b38	RP5-902P8.12	2.692	0.00802	0.090131	3	0.033484	yes	SNTTRM
chr1_1290579_C_G_b38	RP5-902P8.12	-2.643	0.00921	-0.070199	15	0.026564	yes	SNTTRM
chr1_1701564_CG_C_b38	RP5-902P8.12	2.624	0.00971	0.052814	18	0.020129	yes	SNTTRM
chr1_1934821_C_CGTTGTAGGTACGTGTGTACGTGGGTGTTAGGTTGTAGGTACACACGTGTATATGTGGGTGTTAG_b38	RP5-902P8.12	3.336	0.0011	0.063405	18	0.019007	no	SNTTRM
chr1_1695005_CAA_C_b38	RP5-902P8.12	3.181	0.00183	0.070915	16	0.022295	no	SNTTRM
chr1_1499586_C_CTT_b38	RP5-902P8.12	2.936	0.00392	0.094294	3	0.032116	no	SNTTRM
chr1_1308549_G_T_b38	RP5-902P8.12	-2.912	0.00422	-0.053829	45	0.018488	no	SNTTRM
chr1_2225467_AT_A_b38	RP5-902P8.12	-2.882	0.00461	-0.078161	3	0.027123	no	SNTTRM
chr1_2222135_C_G_b38	RP5-902P8.12	-2.877	0.00468	-0.056182	23	0.019527	no	SNTTRM
chr1_2217699_C_G_b38	RP5-902P8.12	-2.834	0.00531	-0.057752	23	0.020376	no	SNTTRM
chr1_2219851_AAAAAC_A_b38	RP5-902P8.12	-2.834	0.00531	-0.057752	23	0.020376	no	SNTTRM
chr1_976215_A_G_b38	RP5-902P8.12	2.742	0.00694	0.060328	20	0.021999	no	SNTTRM
chr1_1992764_A_G_b38	RP5-902P8.12	-2.736	0.00707	-0.138435	5	0.050597	no	SNTTRM
chr1_1002415_C_CATTTTTT_b38	RP5-902P8.12	2.699	0.00787	0.094114	4	0.034875	no	SNTTRM
chr1_1274256_A_G_b38	RP5-902P8.12	-2.664	0.00867	-0.079207	9	0.02973	no	SNTTRM
chr1_1274980_C_T_b38	RP5-902P8.12	-2.664	0.00867	-0.079207	9	0.02973	no	SNTTRM
chr1_1275912_C_T_b38	RP5-902P8.12	-2.664	0.00867	-0.079207	9	0.02973	no	SNTTRM
chr1_1363438_C_CTT_b38	RP5-902P8.12	-2.661	0.00875	-0.055076	16	0.020697	no	SNTTRM
chr1_2222256_T_C_b38	RP5-902P8.12	-2.625	0.00968	-0.060942	8	0.023217	no	SNTTRM
chr1_2222257_G_C_b38	RP5-902P8.12	-2.625	0.00968	-0.060942	8	0.023217	no	SNTTRM
chr1_2222258_T_C_b38	RP5-902P8.12	-2.625	0.00968	-0.060942	8	0.023217	no	SNTTRM
chr1_1370113_A_G_b38	RP5-902P8.12	-4.237	3.57e-05	-0.079523	26	0.018771	yes	SPLEEN
chr1_1423062_C_T_b38	RP5-902P8.12	4.151	5.03e-05	0.094976	6	0.022878	yes	SPLEEN
chr1_1325353_A_C_b38	RP5-902P8.12	-4.09	6.43e-05	-0.110901	3	0.027118	yes	SPLEEN
chr1_1423368_G_A_b38	RP5-902P8.12	4.036	7.92e-05	0.090554	6	0.022434	yes	SPLEEN
chr1_1366561_AGT_A_b38	RP5-902P8.12	-3.877	0.000146	-0.076303	34	0.019679	yes	SPLEEN
chr1_1423191_T_A_b38	RP5-902P8.12	3.848	0.000164	0.086291	7	0.022425	yes	SPLEEN
chr1_1423343_G_T_b38	RP5-902P8.12	3.848	0.000164	0.086291	7	0.022425	yes	SPLEEN
chr1_1423478_C_T_b38	RP5-902P8.12	3.848	0.000164	0.086291	7	0.022425	yes	SPLEEN
chr1_1424078_G_A_b38	RP5-902P8.12	3.848	0.000164	0.086291	7	0.022425	yes	SPLEEN
chr1_1424220_A_G_b38	RP5-902P8.12	3.848	0.000164	0.086291	7	0.022425	yes	SPLEEN
chr1_1417561_A_G_b38	RP5-902P8.12	3.835	0.000172	0.083935	11	0.021884	yes	SPLEEN
chr1_1379083_AT_A_b38	RP5-902P8.12	-3.823	0.00018	-0.07236	14	0.018927	yes	SPLEEN
chr1_1312114_T_C_b38	RP5-902P8.12	-3.819	0.000182	-0.072652	34	0.019022	yes	SPLEEN
chr1_1308516_C_T_b38	RP5-902P8.12	-3.75	0.000236	-0.070283	36	0.01874	yes	SPLEEN
chr1_1418000_T_C_b38	RP5-902P8.12	3.74	0.000245	0.081171	12	0.021702	yes	SPLEEN
chr1_1418223_A_G_b38	RP5-902P8.12	3.74	0.000245	0.081171	12	0.021702	yes	SPLEEN
chr1_1418252_A_G_b38	RP5-902P8.12	3.74	0.000245	0.081171	12	0.021702	yes	SPLEEN
chr1_1415221_G_T_b38	RP5-902P8.12	3.74	0.000245	0.081965	11	0.021917	yes	SPLEEN
chr1_1387698_A_G_b38	RP5-902P8.12	-3.693	0.000291	-0.077373	33	0.020949	yes	SPLEEN
chr1_1389827_C_T_b38	RP5-902P8.12	-3.693	0.000291	-0.077373	33	0.020949	yes	SPLEEN
chr1_1236037_C_T_b38	RP5-902P8.12	3.655	0.000334	0.058271	42	0.015943	yes	SPLEEN
chr1_1418181_A_G_b38	RP5-902P8.12	3.653	0.000336	0.080009	12	0.0219	yes	SPLEEN
chr1_1330125_G_A_b38	RP5-902P8.12	-3.618	0.000383	-0.072378	34	0.020007	yes	SPLEEN
chr1_1358384_G_C_b38	RP5-902P8.12	-3.618	0.000383	-0.072378	34	0.020007	yes	SPLEEN
chr1_1366427_AGTGTGATTGAATGAGT_A_b38	RP5-902P8.12	-3.603	0.000403	-0.069321	25	0.019237	yes	SPLEEN
chr1_1394423_A_G_b38	RP5-902P8.12	3.563	0.000467	0.075212	33	0.021112	yes	SPLEEN
chr1_1384749_C_G_b38	RP5-902P8.12	-3.548	0.000492	-0.071517	25	0.020159	yes	SPLEEN
chr1_1387763_CCT_C_b38	RP5-902P8.12	-3.548	0.000492	-0.071517	25	0.020159	yes	SPLEEN
chr1_1388944_G_A_b38	RP5-902P8.12	-3.548	0.000492	-0.071517	25	0.020159	yes	SPLEEN
chr1_1304573_A_G_b38	RP5-902P8.12	-3.54	0.000505	-0.095839	3	0.02707	yes	SPLEEN
chr1_1295028_A_C_b38	RP5-902P8.12	3.54	0.000505	0.095839	3	0.02707	yes	SPLEEN
chr1_1295309_C_T_b38	RP5-902P8.12	3.54	0.000505	0.095839	3	0.02707	yes	SPLEEN
chr1_1296127_G_A_b38	RP5-902P8.12	3.54	0.000505	0.095839	3	0.02707	yes	SPLEEN
chr1_1299382_AG_A_b38	RP5-902P8.12	3.54	0.000505	0.095839	3	0.02707	yes	SPLEEN
chr1_1308178_GGGGCGCGGGGA_G_b38	RP5-902P8.12	3.537	0.000511	0.072991	6	0.020636	yes	SPLEEN
chr1_1379091_T_G_b38	RP5-902P8.12	-3.534	0.000517	-0.080846	8	0.02288	yes	SPLEEN
chr1_1378204_G_C_b38	RP5-902P8.12	-3.517	0.000548	-0.070717	23	0.020105	yes	SPLEEN
chr1_1416747_CT_C_b38	RP5-902P8.12	3.489	0.000606	0.076719	11	0.021991	yes	SPLEEN
chr1_1367028_A_G_b38	RP5-902P8.12	-3.481	0.000624	-0.078299	7	0.022497	yes	SPLEEN
chr1_1395346_A_G_b38	RP5-902P8.12	3.475	0.000635	0.073703	33	0.021209	yes	SPLEEN
chr1_1402457_A_G_b38	RP5-902P8.12	3.475	0.000635	0.073703	33	0.021209	yes	SPLEEN
chr1_1376162_G_C_b38	RP5-902P8.12	-3.463	0.000662	-0.069359	25	0.020027	yes	SPLEEN
chr1_1377431_C_T_b38	RP5-902P8.12	-3.463	0.000662	-0.069359	25	0.020027	yes	SPLEEN
chr1_1309988_G_A_b38	RP5-902P8.12	-3.438	0.000723	-0.065792	36	0.019137	yes	SPLEEN
chr1_1313807_G_A_b38	RP5-902P8.12	-3.438	0.000723	-0.065792	36	0.019137	yes	SPLEEN
chr1_1111365_CA_C_b38	RP5-902P8.12	3.427	0.000752	0.066135	8	0.019299	yes	SPLEEN
chr1_1400410_A_G_b38	RP5-902P8.12	3.417	0.000776	0.069582	26	0.020361	yes	SPLEEN
chr1_1411323_A_C_b38	RP5-902P8.12	3.405	0.00081	0.072115	33	0.021178	yes	SPLEEN
chr1_1426261_C_T_b38	RP5-902P8.12	3.388	0.000858	0.065363	32	0.019291	yes	SPLEEN
chr1_1426810_C_G_b38	RP5-902P8.12	3.388	0.000858	0.065363	32	0.019291	yes	SPLEEN
chr1_1230159_G_A_b38	RP5-902P8.12	3.357	0.000956	0.061337	17	0.018272	yes	SPLEEN
chr1_1415011_A_G_b38	RP5-902P8.12	3.332	0.00104	0.074084	11	0.022237	yes	SPLEEN
chr1_1415385_T_C_b38	RP5-902P8.12	3.332	0.00104	0.074084	11	0.022237	yes	SPLEEN
chr1_1415659_G_C_b38	RP5-902P8.12	3.332	0.00104	0.074084	11	0.022237	yes	SPLEEN
chr1_1363898_C_T_b38	RP5-902P8.12	-3.327	0.00106	-0.068755	9	0.020667	yes	SPLEEN
chr1_1363986_C_T_b38	RP5-902P8.12	-3.327	0.00106	-0.068755	9	0.020667	yes	SPLEEN
chr1_1410590_A_G_b38	RP5-902P8.12	3.319	0.00109	0.073977	11	0.022288	yes	SPLEEN
chr1_1424102_G_T_b38	RP5-902P8.12	3.313	0.00111	0.074458	8	0.022477	yes	SPLEEN
chr1_1302224_T_C_b38	RP5-902P8.12	-3.271	0.00128	-0.08917	3	0.027261	yes	SPLEEN
chr1_1388565_GTC_G_b38	RP5-902P8.12	-3.263	0.00131	-0.064531	15	0.019774	yes	SPLEEN
chr1_1409623_T_C_b38	RP5-902P8.12	3.26	0.00133	0.068759	13	0.021094	yes	SPLEEN
chr1_1413898_T_C_b38	RP5-902P8.12	3.241	0.00141	0.072713	11	0.022434	yes	SPLEEN
chr1_1417000_C_T_b38	RP5-902P8.12	3.241	0.00141	0.072713	11	0.022434	yes	SPLEEN
chr1_1430908_A_G_b38	RP5-902P8.12	3.232	0.00146	0.0632	31	0.019557	yes	SPLEEN
chr1_1403240_CCTTT_C_b38	RP5-902P8.12	3.23	0.00146	0.077199	7	0.023902	yes	SPLEEN
chr1_1496973_G_A_b38	RP5-902P8.12	3.226	0.00149	0.083721	11	0.025955	yes	SPLEEN
chr1_1367292_A_AGT_b38	RP5-902P8.12	-3.199	0.00162	-0.065732	9	0.020548	yes	SPLEEN
chr1_1409306_A_G_b38	RP5-902P8.12	3.187	0.00169	0.07172	8	0.022503	yes	SPLEEN
chr1_1366529_TTAG_T_b38	RP5-902P8.12	-3.183	0.00171	-0.065294	9	0.020512	yes	SPLEEN
chr1_1385384_G_A_b38	RP5-902P8.12	-3.17	0.00178	-0.07838	6	0.024723	yes	SPLEEN
chr1_1408286_G_A_b38	RP5-902P8.12	3.17	0.00178	0.071584	8	0.022581	yes	SPLEEN
chr1_1399922_C_T_b38	RP5-902P8.12	3.165	0.00181	0.076858	7	0.02428	yes	SPLEEN
chr1_1402900_A_G_b38	RP5-902P8.12	3.165	0.00181	0.076858	7	0.02428	yes	SPLEEN
chr1_1405316_T_C_b38	RP5-902P8.12	3.165	0.00181	0.076858	7	0.02428	yes	SPLEEN
chr1_1428969_T_C_b38	RP5-902P8.12	3.154	0.00188	0.061715	31	0.019565	yes	SPLEEN
chr1_1430190_A_C_b38	RP5-902P8.12	3.154	0.00188	0.061715	31	0.019565	yes	SPLEEN
chr1_1177602_C_T_b38	RP5-902P8.12	3.147	0.00192	0.060021	14	0.019073	yes	SPLEEN
chr1_1395050_G_A_b38	RP5-902P8.12	3.126	0.00205	0.077244	6	0.024707	yes	SPLEEN
chr1_1258206_AT_A_b38	RP5-902P8.12	3.118	0.00211	0.05837	31	0.018719	yes	SPLEEN
chr1_1425013_C_T_b38	RP5-902P8.12	3.08	0.00238	0.075784	23	0.024602	yes	SPLEEN
chr1_1180614_G_A_b38	RP5-902P8.12	3.076	0.00242	0.057467	15	0.018685	yes	SPLEEN
chr1_1291509_G_A_b38	RP5-902P8.12	3.069	0.00247	0.094565	3	0.030811	yes	SPLEEN
chr1_1422081_C_T_b38	RP5-902P8.12	3.049	0.00263	0.075187	24	0.024662	yes	SPLEEN
chr1_1415754_CCGCT_C_b38	RP5-902P8.12	3.039	0.00272	0.068808	10	0.022644	yes	SPLEEN
chr1_1415762_ATCCGCT_A_b38	RP5-902P8.12	3.039	0.00272	0.068808	10	0.022644	yes	SPLEEN
chr1_1383798_AG_A_b38	RP5-902P8.12	-3.037	0.00274	-0.076486	6	0.025188	yes	SPLEEN
chr1_1259424_T_C_b38	RP5-902P8.12	2.978	0.00329	0.058017	35	0.019484	yes	SPLEEN
chr1_1182106_A_G_b38	RP5-902P8.12	2.946	0.00363	0.055503	17	0.018841	yes	SPLEEN
chr1_1411525_T_A_b38	RP5-902P8.12	2.924	0.00389	0.067038	16	0.022929	yes	SPLEEN
chr1_1365566_G_A_b38	RP5-902P8.12	-2.919	0.00394	-0.060013	9	0.020558	yes	SPLEEN
chr1_1306149_A_G_b38	RP5-902P8.12	-2.887	0.00436	-0.074598	5	0.025844	yes	SPLEEN
chr1_1419135_C_G_b38	RP5-902P8.12	2.87	0.00457	0.069715	23	0.024288	yes	SPLEEN
chr1_1306523_C_G_b38	RP5-902P8.12	-2.867	0.00462	-0.067781	11	0.023643	yes	SPLEEN
chr1_1291869_T_C_b38	RP5-902P8.12	2.866	0.00463	0.085236	3	0.029739	yes	SPLEEN
chr1_1337898_A_G_b38	RP5-902P8.12	-2.838	0.00504	-0.053931	11	0.019001	yes	SPLEEN
chr1_1431450_A_G_b38	RP5-902P8.12	2.836	0.00507	0.055518	31	0.019576	yes	SPLEEN
chr1_1431537_G_C_b38	RP5-902P8.12	2.836	0.00507	0.055518	31	0.019576	yes	SPLEEN
chr1_1367175_C_T_b38	RP5-902P8.12	-2.83	0.00517	-0.085887	5	0.03035	yes	SPLEEN
chr1_1410616_G_T_b38	RP5-902P8.12	2.8	0.00564	0.064554	17	0.023051	yes	SPLEEN
chr1_1412488_C_CAG_b38	RP5-902P8.12	2.8	0.00564	0.064554	17	0.023051	yes	SPLEEN
chr1_1415976_G_A_b38	RP5-902P8.12	2.8	0.00564	0.064554	17	0.023051	yes	SPLEEN
chr1_1363456_CAG_C_b38	RP5-902P8.12	-2.799	0.00566	-0.054106	14	0.019329	yes	SPLEEN
chr1_1419214_A_G_b38	RP5-902P8.12	2.797	0.0057	0.063139	16	0.022571	yes	SPLEEN
chr1_1447108_A_ATT_b38	RP5-902P8.12	2.785	0.00591	0.054688	13	0.019639	yes	SPLEEN
chr1_1417031_A_G_b38	RP5-902P8.12	2.739	0.00675	0.063265	9	0.023094	yes	SPLEEN
chr1_1293731_A_ACGCCCCTGCCCTGGAGGCCC_b38	RP5-902P8.12	-2.71	0.00735	-0.041012	44	0.015132	yes	SPLEEN
chr1_1411929_G_C_b38	RP5-902P8.12	2.707	0.00742	0.062209	17	0.02298	yes	SPLEEN
chr1_1341550_GCA_G_b38	RP5-902P8.12	2.702	0.00753	0.069286	3	0.025644	yes	SPLEEN
chr1_1417046_C_T_b38	RP5-902P8.12	2.689	0.00783	0.062901	9	0.023396	yes	SPLEEN
chr1_1282558_C_CCA_b38	RP5-902P8.12	2.682	0.00797	0.051362	22	0.019148	yes	SPLEEN
chr1_1433374_T_C_b38	RP5-902P8.12	2.665	0.00837	0.049834	35	0.018699	yes	SPLEEN
chr1_1291377_G_A_b38	RP5-902P8.12	2.663	0.00843	0.079425	3	0.02983	yes	SPLEEN
chr1_1238231_G_A_b38	RP5-902P8.12	2.659	0.00852	0.048945	14	0.018408	yes	SPLEEN
chr1_1436079_A_G_b38	RP5-902P8.12	2.635	0.00912	0.047981	35	0.018208	yes	SPLEEN
chr1_1421170_A_G_b38	RP5-902P8.12	2.619	0.00954	0.061887	20	0.023627	yes	SPLEEN
chr1_1339884_A_ACAGCCGCATGTCCCCCAGCAGCCCCCACAGACCCACCCG_b38	RP5-902P8.12	-2.61	0.0098	-0.05133	9	0.019668	yes	SPLEEN
chr1_1238902_T_C_b38	RP5-902P8.12	3.866	0.000153	0.064909	37	0.016791	no	SPLEEN
chr1_1221049_C_G_b38	RP5-902P8.12	3.749	0.000237	0.063238	35	0.016868	no	SPLEEN
chr1_1322213_A_G_b38	RP5-902P8.12	-3.734	0.00025	-0.098156	4	0.026284	no	SPLEEN
chr1_1319056_A_G_b38	RP5-902P8.12	-3.4	0.000826	-0.093029	4	0.027365	no	SPLEEN
chr1_1329159_G_C_b38	RP5-902P8.12	-3.348	0.000987	-0.08912	4	0.026622	no	SPLEEN
chr1_1324149_G_A_b38	RP5-902P8.12	-3.146	0.00193	-0.041136	45	0.013077	no	SPLEEN
chr1_1341079_C_A_b38	RP5-902P8.12	-3.144	0.00194	-0.07458	5	0.02372	no	SPLEEN
chr1_1360507_T_TGGGGGGC_b38	RP5-902P8.12	-3.134	0.002	-0.069071	5	0.02204	no	SPLEEN
chr1_1324173_G_GGGCTCGGGGGCTGGGGGGCTGCTGGGCTGAGA_b38	RP5-902P8.12	-3.069	0.00247	-0.039809	15	0.01297	no	SPLEEN
chr1_1327764_G_A_b38	RP5-902P8.12	-3.057	0.00257	-0.073649	5	0.024095	no	SPLEEN
chr1_1360502_G_GGGGGCGGGC_b38	RP5-902P8.12	-3.044	0.00268	-0.06851	5	0.02251	no	SPLEEN
chr1_1362470_A_T_b38	RP5-902P8.12	-3.01	0.00298	-0.065821	4	0.021868	no	SPLEEN
chr1_1380513_C_T_b38	RP5-902P8.12	-2.978	0.00329	-0.075081	5	0.02521	no	SPLEEN
chr1_1381290_C_G_b38	RP5-902P8.12	-2.978	0.00329	-0.075081	5	0.02521	no	SPLEEN
chr1_1341098_T_G_b38	RP5-902P8.12	-2.955	0.00353	-0.071723	5	0.024273	no	SPLEEN
chr1_1360989_GAC_G_b38	RP5-902P8.12	-2.94	0.0037	-0.072128	5	0.024531	no	SPLEEN
chr1_1354531_G_A_b38	RP5-902P8.12	-2.932	0.00379	-0.071525	5	0.024397	no	SPLEEN
chr1_1360302_A_G_b38	RP5-902P8.12	-2.932	0.00379	-0.071525	5	0.024397	no	SPLEEN
chr1_1363031_C_T_b38	RP5-902P8.12	-2.899	0.0042	-0.0733	4	0.025289	no	SPLEEN
chr1_1363157_C_T_b38	RP5-902P8.12	-2.899	0.0042	-0.0733	4	0.025289	no	SPLEEN
chr1_1431026_CCACCCCCT_C_b38	RP5-902P8.12	2.881	0.00444	0.061231	15	0.021257	no	SPLEEN
chr1_1693256_GT_G_b38	RP5-902P8.12	2.879	0.00445	0.09809	3	0.034067	no	SPLEEN
chr1_1375698_G_T_b38	RP5-902P8.12	-2.87	0.00458	-0.07144	5	0.024894	no	SPLEEN
chr1_1376153_G_C_b38	RP5-902P8.12	-2.87	0.00458	-0.07144	5	0.024894	no	SPLEEN
chr1_1376752_T_C_b38	RP5-902P8.12	-2.87	0.00458	-0.07144	5	0.024894	no	SPLEEN
chr1_1378635_C_T_b38	RP5-902P8.12	-2.87	0.00458	-0.07144	5	0.024894	no	SPLEEN
chr1_1378792_C_T_b38	RP5-902P8.12	-2.87	0.00458	-0.07144	5	0.024894	no	SPLEEN
chr1_1378865_C_T_b38	RP5-902P8.12	-2.87	0.00458	-0.07144	5	0.024894	no	SPLEEN
chr1_1379334_A_G_b38	RP5-902P8.12	-2.87	0.00458	-0.07144	5	0.024894	no	SPLEEN
chr1_1326444_G_C_b38	RP5-902P8.12	-2.869	0.00459	-0.070594	5	0.024604	no	SPLEEN
chr1_1338970_A_G_b38	RP5-902P8.12	-2.869	0.00459	-0.070594	5	0.024604	no	SPLEEN
chr1_1344634_A_G_b38	RP5-902P8.12	-2.869	0.00459	-0.070594	5	0.024604	no	SPLEEN
chr1_1345965_C_T_b38	RP5-902P8.12	-2.869	0.00459	-0.070594	5	0.024604	no	SPLEEN
chr1_1351747_G_A_b38	RP5-902P8.12	-2.869	0.00459	-0.070594	5	0.024604	no	SPLEEN
chr1_1352542_G_A_b38	RP5-902P8.12	-2.869	0.00459	-0.070594	5	0.024604	no	SPLEEN
chr1_1362042_C_T_b38	RP5-902P8.12	-2.847	0.00491	-0.070449	5	0.024748	no	SPLEEN
chr1_1353987_CTG_C_b38	RP5-902P8.12	-2.84	0.00501	-0.068251	6	0.024031	no	SPLEEN
chr1_2119213_C_CT_b38	RP5-902P8.12	2.812	0.00545	0.050904	15	0.018104	no	SPLEEN
chr1_1423761_CCAT_C_b38	RP5-902P8.12	2.776	0.00606	0.079998	3	0.028813	no	SPLEEN
chr1_1363438_C_CTT_b38	RP5-902P8.12	-2.775	0.00609	-0.047511	20	0.017124	no	SPLEEN
chr1_1353203_C_G_b38	RP5-902P8.12	-2.723	0.00708	-0.066581	5	0.024447	no	SPLEEN
chr1_935426_C_CGGAGCTCCTCT_b38	RP5-902P8.12	2.71	0.00736	0.088959	13	0.032828	no	SPLEEN
chr1_1423775_C_T_b38	RP5-902P8.12	2.685	0.00791	0.073646	3	0.027429	no	SPLEEN
chr1_1102614_T_TA_b38	RP5-902P8.12	2.655	0.00862	0.062419	7	0.02351	no	SPLEEN
chr1_1094425_A_G_b38	RP5-902P8.12	3.353	0.000914	0.041134	17	0.012268	yes	STMACH
chr1_1098290_T_C_b38	RP5-902P8.12	3.295	0.00112	0.040192	18	0.012199	yes	STMACH
chr1_1726106_AT_A_b38	RP5-902P8.12	-3.246	0.00132	-0.044895	16	0.013833	yes	STMACH
chr1_1098863_C_T_b38	RP5-902P8.12	3.233	0.00138	0.04831	4	0.014944	yes	STMACH
chr1_1932081_AAAAAAC_A_b38	RP5-902P8.12	-3.201	0.00154	-0.039072	29	0.012207	yes	STMACH
chr1_1690745_G_GA_b38	RP5-902P8.12	-3.2	0.00154	-0.084895	3	0.026528	yes	STMACH
chr1_2213842_A_G_b38	RP5-902P8.12	3.095	0.00218	0.034392	25	0.011112	yes	STMACH
chr1_960375_A_AG_b38	RP5-902P8.12	-3.083	0.00227	-0.048337	23	0.015681	yes	STMACH
chr1_1101496_T_A_b38	RP5-902P8.12	3.02	0.00277	0.04421	5	0.014637	yes	STMACH
chr1_1101497_T_A_b38	RP5-902P8.12	2.998	0.00297	0.043746	5	0.014591	yes	STMACH
chr1_832736_A_AGTTTTGTTTT_b38	RP5-902P8.12	-2.955	0.0034	-0.039764	10	0.013456	yes	STMACH
chr1_1106998_A_C_b38	RP5-902P8.12	2.896	0.00409	0.036706	15	0.012676	yes	STMACH
chr1_1115274_C_CA_b38	RP5-902P8.12	2.884	0.00424	0.036943	15	0.012808	yes	STMACH
chr1_1734812_G_A_b38	RP5-902P8.12	-2.878	0.00433	-0.036888	39	0.012819	yes	STMACH
chr1_1118447_T_TG_b38	RP5-902P8.12	2.861	0.00455	0.045745	3	0.015987	yes	STMACH
chr1_1125735_T_C_b38	RP5-902P8.12	2.851	0.00469	0.043179	5	0.015143	yes	STMACH
chr1_1107147_G_C_b38	RP5-902P8.12	2.834	0.00495	0.045791	3	0.016157	yes	STMACH
chr1_1120047_GA_G_b38	RP5-902P8.12	2.826	0.00507	0.03724	10	0.013179	yes	STMACH
chr1_1110093_G_A_b38	RP5-902P8.12	2.798	0.00552	0.045321	3	0.016199	yes	STMACH
chr1_1111481_G_A_b38	RP5-902P8.12	2.798	0.00552	0.045321	3	0.016199	yes	STMACH
chr1_1113703_C_A_b38	RP5-902P8.12	2.798	0.00552	0.045321	3	0.016199	yes	STMACH
chr1_959193_G_A_b38	RP5-902P8.12	-2.779	0.00584	-0.046731	23	0.016816	yes	STMACH
chr1_1726053_G_C_b38	RP5-902P8.12	-2.773	0.00594	-0.042384	14	0.015284	yes	STMACH
chr1_1120417_A_G_b38	RP5-902P8.12	2.766	0.00607	0.043819	3	0.015841	yes	STMACH
chr1_1120889_C_T_b38	RP5-902P8.12	2.766	0.00607	0.043819	3	0.015841	yes	STMACH
chr1_1122042_G_C_b38	RP5-902P8.12	2.766	0.00607	0.043819	3	0.015841	yes	STMACH
chr1_1111994_T_A_b38	RP5-902P8.12	2.766	0.00607	0.035487	15	0.01283	yes	STMACH
chr1_1113121_G_A_b38	RP5-902P8.12	2.757	0.00623	0.036233	10	0.013141	yes	STMACH
chr1_1114570_A_G_b38	RP5-902P8.12	2.748	0.0064	0.035484	15	0.012913	yes	STMACH
chr1_1125882_A_G_b38	RP5-902P8.12	2.739	0.00658	0.043117	4	0.015743	yes	STMACH
chr1_1117566_G_T_b38	RP5-902P8.12	2.729	0.00677	0.04387	3	0.016074	yes	STMACH
chr1_1111337_G_C_b38	RP5-902P8.12	2.72	0.00695	0.043328	4	0.015928	yes	STMACH
chr1_1113609_A_G_b38	RP5-902P8.12	2.714	0.00707	0.041406	4	0.015255	yes	STMACH
chr1_1000079_A_G_b38	RP5-902P8.12	-2.713	0.0071	-0.031438	35	0.011588	yes	STMACH
chr1_1105739_G_GGGCGTGGT_b38	RP5-902P8.12	2.711	0.00713	0.035652	11	0.013149	yes	STMACH
chr1_1118072_G_A_b38	RP5-902P8.12	2.706	0.00725	0.044036	3	0.016274	yes	STMACH
chr1_1099309_T_G_b38	RP5-902P8.12	2.69	0.0076	0.034544	11	0.012842	yes	STMACH
chr1_1120968_G_A_b38	RP5-902P8.12	2.681	0.00779	0.034883	12	0.013009	yes	STMACH
chr1_1101933_A_G_b38	RP5-902P8.12	2.681	0.0078	0.034683	15	0.012937	yes	STMACH
chr1_1105444_T_C_b38	RP5-902P8.12	2.681	0.0078	0.034683	15	0.012937	yes	STMACH
chr1_1124132_T_TACACACCTGAGCACACACACCTGTGC_b38	RP5-902P8.12	2.677	0.00789	0.04352	3	0.016257	yes	STMACH
chr1_1111365_CAA_C_b38	RP5-902P8.12	2.652	0.00849	0.037925	6	0.014302	yes	STMACH
chr1_2222256_T_C_b38	RP5-902P8.12	2.645	0.00864	0.031125	20	0.011766	yes	STMACH
chr1_2222257_G_C_b38	RP5-902P8.12	2.645	0.00864	0.031125	20	0.011766	yes	STMACH
chr1_2222258_T_C_b38	RP5-902P8.12	2.645	0.00864	0.031125	20	0.011766	yes	STMACH
chr1_2222135_C_G_b38	RP5-902P8.12	2.644	0.00868	0.027638	42	0.010454	yes	STMACH
chr1_1750658_T_C_b38	RP5-902P8.12	-2.631	0.009	-0.030824	28	0.011714	yes	STMACH
chr1_632928_G_A_b38	RP5-902P8.12	-2.618	0.00934	-0.045159	6	0.017249	yes	STMACH
chr1_1123509_G_A_b38	RP5-902P8.12	2.61	0.00957	0.042489	3	0.016281	yes	STMACH
chr1_1095185_C_T_b38	RP5-902P8.12	3.267	0.00123	0.04029	16	0.012331	no	STMACH
chr1_1096593_C_T_b38	RP5-902P8.12	3.267	0.00123	0.04029	16	0.012331	no	STMACH
chr1_1098216_T_C_b38	RP5-902P8.12	3.267	0.00123	0.04029	16	0.012331	no	STMACH
chr1_1098300_T_A_b38	RP5-902P8.12	3.267	0.00123	0.04029	16	0.012331	no	STMACH
chr1_1098614_C_T_b38	RP5-902P8.12	3.267	0.00123	0.04029	16	0.012331	no	STMACH
chr1_1098820_T_C_b38	RP5-902P8.12	3.267	0.00123	0.04029	16	0.012331	no	STMACH
chr1_1098246_C_G_b38	RP5-902P8.12	3.244	0.00133	0.040343	13	0.012435	no	STMACH
chr1_1092465_T_G_b38	RP5-902P8.12	3.176	0.00167	0.039308	15	0.012375	no	STMACH
chr1_1092466_T_C_b38	RP5-902P8.12	3.176	0.00167	0.039308	15	0.012375	no	STMACH
chr1_1095253_G_A_b38	RP5-902P8.12	3.116	0.00203	0.038409	16	0.012326	no	STMACH
chr1_1097574_A_G_b38	RP5-902P8.12	3.116	0.00203	0.038409	16	0.012326	no	STMACH
chr1_1263831_T_TA_b38	RP5-902P8.12	3.007	0.00289	0.05373	5	0.017869	no	STMACH
chr1_1245399_G_C_b38	RP5-902P8.12	2.824	0.0051	0.054792	3	0.019402	no	STMACH
chr1_2226499_CG_C_b38	RP5-902P8.12	2.808	0.00535	0.032092	22	0.011428	no	STMACH
chr1_286985_C_T_b38	RP5-902P8.12	2.795	0.00557	0.038371	8	0.013729	no	STMACH
chr1_1259165_A_T_b38	RP5-902P8.12	2.765	0.00609	0.054408	5	0.019677	no	STMACH
chr1_1290722_G_A_b38	RP5-902P8.12	2.76	0.00619	0.067492	3	0.024456	no	STMACH
chr1_2025860_C_T_b38	RP5-902P8.12	-2.751	0.00634	-0.028406	63	0.010324	no	STMACH
chr1_2230051_C_T_b38	RP5-902P8.12	2.734	0.00668	0.031355	22	0.011469	no	STMACH
chr1_2221645_G_A_b38	RP5-902P8.12	2.718	0.00699	0.031169	22	0.011466	no	STMACH
chr1_1101480_A_C_b38	RP5-902P8.12	2.708	0.0072	0.034958	13	0.012908	no	STMACH
chr1_1101923_T_C_b38	RP5-902P8.12	2.708	0.0072	0.034958	13	0.012908	no	STMACH
chr1_1101987_G_A_b38	RP5-902P8.12	2.708	0.0072	0.034958	13	0.012908	no	STMACH
chr1_1103617_ACTC_A_b38	RP5-902P8.12	2.708	0.0072	0.034958	13	0.012908	no	STMACH
chr1_1103888_T_C_b38	RP5-902P8.12	2.708	0.0072	0.034958	13	0.012908	no	STMACH
chr1_1104437_A_G_b38	RP5-902P8.12	2.708	0.0072	0.034958	13	0.012908	no	STMACH
chr1_1104646_T_C_b38	RP5-902P8.12	2.708	0.0072	0.034958	13	0.012908	no	STMACH
chr1_1105092_C_T_b38	RP5-902P8.12	2.708	0.0072	0.034958	13	0.012908	no	STMACH
chr1_1105560_A_C_b38	RP5-902P8.12	2.708	0.0072	0.034958	13	0.012908	no	STMACH
chr1_1105605_C_G_b38	RP5-902P8.12	2.708	0.0072	0.034958	13	0.012908	no	STMACH
chr1_1106406_T_C_b38	RP5-902P8.12	2.708	0.0072	0.034958	13	0.012908	no	STMACH
chr1_1107103_C_T_b38	RP5-902P8.12	2.708	0.0072	0.034958	13	0.012908	no	STMACH
chr1_1107547_G_T_b38	RP5-902P8.12	2.708	0.0072	0.034958	13	0.012908	no	STMACH
chr1_1107673_A_G_b38	RP5-902P8.12	2.708	0.0072	0.034958	13	0.012908	no	STMACH
chr1_1107882_T_C_b38	RP5-902P8.12	2.708	0.0072	0.034958	13	0.012908	no	STMACH
chr1_286747_A_G_b38	RP5-902P8.12	2.694	0.00751	0.037723	7	0.014003	no	STMACH
chr1_2215527_T_C_b38	RP5-902P8.12	2.693	0.00753	0.030871	23	0.011464	no	STMACH
chr1_1103993_C_CT_b38	RP5-902P8.12	2.666	0.00813	0.034277	13	0.012855	no	STMACH
chr1_1107293_C_T_b38	RP5-902P8.12	2.641	0.00876	0.033623	14	0.012733	no	STMACH
chr1_1861110_C_CA_b38	RP5-902P8.12	-2.64	0.00877	-0.025449	56	0.009638	no	STMACH
chr1_1274159_C_A_b38	RP5-902P8.12	2.631	0.00901	0.052435	5	0.019932	no	STMACH
chr1_1275055_A_G_b38	RP5-902P8.12	2.631	0.00901	0.052435	5	0.019932	no	STMACH
chr1_1275468_G_A_b38	RP5-902P8.12	2.631	0.00901	0.052435	5	0.019932	no	STMACH
chr1_1276222_T_TG_b38	RP5-902P8.12	2.631	0.00901	0.052435	5	0.019932	no	STMACH
chr1_1265603_T_TTGTGTG_b38	RP5-902P8.12	2.597	0.00994	0.04094	4	0.015767	no	STMACH
chr1_814476_C_T_b38	RP5-902P8.12	3.627	0.000343	0.051571	13	0.014218	yes	TESTIS
chr1_1379083_AT_A_b38	RP5-902P8.12	-3.189	0.0016	-0.045136	14	0.014152	yes	TESTIS
chr1_1351587_A_G_b38	RP5-902P8.12	-3.17	0.0017	-0.094374	3	0.029767	yes	TESTIS
chr1_1538924_C_A_b38	RP5-902P8.12	3.148	0.00183	0.037953	27	0.012058	yes	TESTIS
chr1_1379091_T_G_b38	RP5-902P8.12	-3.012	0.00285	-0.045505	10	0.01511	yes	TESTIS
chr1_282728_T_C_b38	RP5-902P8.12	3	0.00295	0.046425	3	0.015475	yes	TESTIS
chr1_660993_T_C_b38	RP5-902P8.12	-2.968	0.00326	-0.069799	9	0.023514	yes	TESTIS
chr1_1545795_C_A_b38	RP5-902P8.12	2.943	0.00354	0.035617	38	0.012102	yes	TESTIS
chr1_1416747_CT_C_b38	RP5-902P8.12	2.937	0.00361	0.054141	5	0.018435	yes	TESTIS
chr1_1773715_T_TGAGAGA_b38	RP5-902P8.12	2.92	0.0038	0.059677	4	0.02044	yes	TESTIS
chr1_282721_A_G_b38	RP5-902P8.12	2.917	0.00383	0.044813	3	0.015361	yes	TESTIS
chr1_839543_G_C_b38	RP5-902P8.12	-2.909	0.00394	-0.038857	26	0.01336	yes	TESTIS
chr1_597685_T_TA_b38	RP5-902P8.12	-2.891	0.00416	-0.062286	4	0.021546	yes	TESTIS
chr1_1125786_T_C_b38	RP5-902P8.12	-2.822	0.00513	-0.031848	45	0.011284	yes	TESTIS
chr1_1220424_T_C_b38	RP5-902P8.12	-2.799	0.0055	-0.046443	4	0.016594	yes	TESTIS
chr1_1376162_G_C_b38	RP5-902P8.12	-2.749	0.00638	-0.038973	26	0.014176	yes	TESTIS
chr1_1377431_C_T_b38	RP5-902P8.12	-2.749	0.00638	-0.038973	26	0.014176	yes	TESTIS
chr1_1115600_CCCCTCCCCAGGGACCCCCCT_C_b38	RP5-902P8.12	-2.73	0.00676	-0.048087	7	0.017617	yes	TESTIS
chr1_1606099_G_C_b38	RP5-902P8.12	2.706	0.00726	0.046466	7	0.017174	yes	TESTIS
chr1_1096597_A_T_b38	RP5-902P8.12	-2.692	0.00755	-0.043913	5	0.016311	yes	TESTIS
chr1_1864334_AAAG_A_b38	RP5-902P8.12	2.638	0.00882	0.038078	15	0.014433	yes	TESTIS
chr1_262683_C_CT_b38	RP5-902P8.12	-2.976	0.00318	-0.064397	3	0.021636	no	TESTIS
chr1_277834_G_A_b38	RP5-902P8.12	2.83	0.00501	0.072512	10	0.025626	no	TESTIS
chr1_1569661_T_C_b38	RP5-902P8.12	2.816	0.00522	0.033174	45	0.011779	no	TESTIS
chr1_860178_C_CTTTTTTTTT_b38	RP5-902P8.12	-2.816	0.00523	-0.064869	3	0.023038	no	TESTIS
chr1_1212042_C_T_b38	RP5-902P8.12	2.786	0.00572	0.035013	19	0.012569	no	TESTIS
chr1_828389_AT_A_b38	RP5-902P8.12	-2.764	0.00611	-0.046298	5	0.016753	no	TESTIS
chr1_1547630_G_A_b38	RP5-902P8.12	2.695	0.00748	0.031585	42	0.011719	no	TESTIS
chr1_1418181_A_G_b38	RP5-902P8.12	2.671	0.00802	0.048433	6	0.01813	no	TESTIS
chr1_1259424_T_C_b38	RP5-902P8.12	2.647	0.0086	0.038705	32	0.014621	no	TESTIS
chr1_1378204_G_C_b38	RP5-902P8.12	-2.645	0.00864	-0.037257	26	0.014083	no	TESTIS
chr1_634112_T_C_b38	RP5-902P8.12	-2.612	0.00951	-0.040034	42	0.015328	no	TESTIS
chr1_816376_T_C_b38	RP5-902P8.12	-2.612	0.00952	-0.043112	6	0.016508	no	TESTIS
chr1_629218_A_G_b38	RP5-902P8.12	-2.598	0.00991	-0.074339	7	0.028617	no	TESTIS
chr1_1228094_A_G_b38	RP5-902P8.12	4.415	1.23e-05	0.088108	3	0.019955	yes	THYROID
chr1_1216708_CT_C_b38	RP5-902P8.12	4.036	6.28e-05	0.077578	3	0.01922	yes	THYROID
chr1_1224281_GTTTTA_G_b38	RP5-902P8.12	3.906	0.000107	0.076309	3	0.019535	yes	THYROID
chr1_1227886_G_A_b38	RP5-902P8.12	3.906	0.000107	0.076309	3	0.019535	yes	THYROID
chr1_1230250_G_A_b38	RP5-902P8.12	3.906	0.000107	0.076309	3	0.019535	yes	THYROID
chr1_1221275_G_A_b38	RP5-902P8.12	3.894	0.000112	0.072131	3	0.018524	yes	THYROID
chr1_1202905_C_G_b38	RP5-902P8.12	3.891	0.000113	0.070739	6	0.018179	yes	THYROID
chr1_1240390_G_A_b38	RP5-902P8.12	3.765	0.000186	0.074112	3	0.019682	yes	THYROID
chr1_1221355_T_C_b38	RP5-902P8.12	3.703	0.000236	0.068361	3	0.018459	yes	THYROID
chr1_1226620_G_GC_b38	RP5-902P8.12	3.682	0.000256	0.066936	4	0.018179	yes	THYROID
chr1_1226901_G_A_b38	RP5-902P8.12	3.682	0.000256	0.066936	4	0.018179	yes	THYROID
chr1_1235997_A_G_b38	RP5-902P8.12	3.648	0.000292	0.06481	10	0.017765	yes	THYROID
chr1_1228069_T_C_b38	RP5-902P8.12	3.635	0.000306	0.067023	3	0.018437	yes	THYROID
chr1_1219159_G_A_b38	RP5-902P8.12	3.614	0.000332	0.072523	3	0.020066	yes	THYROID
chr1_1222245_C_T_b38	RP5-902P8.12	3.593	0.00036	0.065521	4	0.018237	yes	THYROID
chr1_1224783_G_A_b38	RP5-902P8.12	3.566	0.000397	0.061559	5	0.017264	yes	THYROID
chr1_1215068_T_C_b38	RP5-902P8.12	3.552	0.000418	0.069818	4	0.019655	yes	THYROID
chr1_1214801_G_C_b38	RP5-902P8.12	3.519	0.000472	0.069098	4	0.019634	yes	THYROID
chr1_1226892_C_T_b38	RP5-902P8.12	3.512	0.000485	0.064359	4	0.018325	yes	THYROID
chr1_1225285_G_A_b38	RP5-902P8.12	3.511	0.000487	0.063653	5	0.01813	yes	THYROID
chr1_1223640_A_G_b38	RP5-902P8.12	3.51	0.000487	0.063927	4	0.01821	yes	THYROID
chr1_1221960_A_G_b38	RP5-902P8.12	3.503	5e-04	0.063746	4	0.018195	yes	THYROID
chr1_1221992_G_A_b38	RP5-902P8.12	3.503	5e-04	0.063746	4	0.018195	yes	THYROID
chr1_1222167_T_C_b38	RP5-902P8.12	3.503	5e-04	0.063746	4	0.018195	yes	THYROID
chr1_1222184_G_A_b38	RP5-902P8.12	3.503	5e-04	0.063746	4	0.018195	yes	THYROID
chr1_1222304_C_T_b38	RP5-902P8.12	3.503	5e-04	0.063746	4	0.018195	yes	THYROID
chr1_1222325_C_G_b38	RP5-902P8.12	3.503	5e-04	0.063746	4	0.018195	yes	THYROID
chr1_1222454_C_T_b38	RP5-902P8.12	3.503	5e-04	0.063746	4	0.018195	yes	THYROID
chr1_1222482_C_T_b38	RP5-902P8.12	3.503	5e-04	0.063746	4	0.018195	yes	THYROID
chr1_1222579_C_T_b38	RP5-902P8.12	3.503	5e-04	0.063746	4	0.018195	yes	THYROID
chr1_1222611_G_A_b38	RP5-902P8.12	3.503	5e-04	0.063746	4	0.018195	yes	THYROID
chr1_1222640_A_C_b38	RP5-902P8.12	3.503	5e-04	0.063746	4	0.018195	yes	THYROID
chr1_1222897_G_A_b38	RP5-902P8.12	3.503	5e-04	0.063746	4	0.018195	yes	THYROID
chr1_1222946_G_A_b38	RP5-902P8.12	3.503	5e-04	0.063746	4	0.018195	yes	THYROID
chr1_1222977_A_G_b38	RP5-902P8.12	3.503	5e-04	0.063746	4	0.018195	yes	THYROID
chr1_1223154_G_GAC_b38	RP5-902P8.12	3.503	5e-04	0.063746	4	0.018195	yes	THYROID
chr1_1223182_AAC_A_b38	RP5-902P8.12	3.503	5e-04	0.063746	4	0.018195	yes	THYROID
chr1_1223593_A_T_b38	RP5-902P8.12	3.503	5e-04	0.063746	4	0.018195	yes	THYROID
chr1_1223595_A_C_b38	RP5-902P8.12	3.503	5e-04	0.063746	4	0.018195	yes	THYROID
chr1_1223682_T_C_b38	RP5-902P8.12	3.503	5e-04	0.063746	4	0.018195	yes	THYROID
chr1_1224105_C_T_b38	RP5-902P8.12	3.503	5e-04	0.063746	4	0.018195	yes	THYROID
chr1_1224349_T_G_b38	RP5-902P8.12	3.503	5e-04	0.063746	4	0.018195	yes	THYROID
chr1_1224844_C_T_b38	RP5-902P8.12	3.503	5e-04	0.063746	4	0.018195	yes	THYROID
chr1_1224846_A_G_b38	RP5-902P8.12	3.503	5e-04	0.063746	4	0.018195	yes	THYROID
chr1_1225429_T_C_b38	RP5-902P8.12	3.503	5e-04	0.063746	4	0.018195	yes	THYROID
chr1_1225720_CGCCACAGACACGGGCCACACACTCCACAT_C_b38	RP5-902P8.12	3.503	5e-04	0.063746	4	0.018195	yes	THYROID
chr1_1225982_A_G_b38	RP5-902P8.12	3.503	5e-04	0.063746	4	0.018195	yes	THYROID
chr1_1227161_G_C_b38	RP5-902P8.12	3.503	5e-04	0.063746	4	0.018195	yes	THYROID
chr1_1227792_T_C_b38	RP5-902P8.12	3.503	5e-04	0.063746	4	0.018195	yes	THYROID
chr1_1227975_T_C_b38	RP5-902P8.12	3.503	5e-04	0.063746	4	0.018195	yes	THYROID
chr1_1229160_G_T_b38	RP5-902P8.12	3.503	5e-04	0.063746	4	0.018195	yes	THYROID
chr1_1229307_G_C_b38	RP5-902P8.12	3.503	5e-04	0.063746	4	0.018195	yes	THYROID
chr1_1229900_GCA_G_b38	RP5-902P8.12	3.503	5e-04	0.063746	4	0.018195	yes	THYROID
chr1_1229940_CAT_C_b38	RP5-902P8.12	3.503	5e-04	0.063746	4	0.018195	yes	THYROID
chr1_1229981_A_G_b38	RP5-902P8.12	3.503	5e-04	0.063746	4	0.018195	yes	THYROID
chr1_1230091_T_C_b38	RP5-902P8.12	3.503	5e-04	0.063746	4	0.018195	yes	THYROID
chr1_1230345_A_G_b38	RP5-902P8.12	3.503	5e-04	0.063746	4	0.018195	yes	THYROID
chr1_1230441_T_C_b38	RP5-902P8.12	3.503	5e-04	0.063746	4	0.018195	yes	THYROID
chr1_1230695_G_A_b38	RP5-902P8.12	3.503	5e-04	0.063746	4	0.018195	yes	THYROID
chr1_1230797_G_C_b38	RP5-902P8.12	3.503	5e-04	0.063746	4	0.018195	yes	THYROID
chr1_1230825_C_T_b38	RP5-902P8.12	3.503	5e-04	0.063746	4	0.018195	yes	THYROID
chr1_1187536_A_G_b38	RP5-902P8.12	3.503	0.000501	0.065134	4	0.018594	yes	THYROID
chr1_1187557_G_A_b38	RP5-902P8.12	3.503	0.000501	0.065134	4	0.018594	yes	THYROID
chr1_1231710_CCCCCGGGAA_C_b38	RP5-902P8.12	3.498	0.000511	0.056462	14	0.016143	yes	THYROID
chr1_1223644_C_T_b38	RP5-902P8.12	3.492	0.000521	0.062986	5	0.018037	yes	THYROID
chr1_1222580_T_C_b38	RP5-902P8.12	3.487	0.000532	0.062856	5	0.018028	yes	THYROID
chr1_1222594_A_G_b38	RP5-902P8.12	3.487	0.000532	0.062856	5	0.018028	yes	THYROID
chr1_1223727_G_A_b38	RP5-902P8.12	3.485	0.000534	0.063397	4	0.018189	yes	THYROID
chr1_1222251_G_A_b38	RP5-902P8.12	3.466	0.000574	0.062906	4	0.018151	yes	THYROID
chr1_1223568_A_G_b38	RP5-902P8.12	3.464	0.000577	0.061995	6	0.017896	yes	THYROID
chr1_1226486_C_T_b38	RP5-902P8.12	3.445	0.000618	0.057309	8	0.016635	yes	THYROID
chr1_1239126_C_CT_b38	RP5-902P8.12	3.429	0.000655	0.061969	6	0.018072	yes	THYROID
chr1_1239127_A_ACATGCATCC_b38	RP5-902P8.12	3.429	0.000655	0.061969	6	0.018072	yes	THYROID
chr1_1239574_T_C_b38	RP5-902P8.12	3.429	0.000655	0.061969	6	0.018072	yes	THYROID
chr1_624767_T_G_b38	RP5-902P8.12	3.42	0.000678	0.053844	5	0.015745	yes	THYROID
chr1_1227055_C_A_b38	RP5-902P8.12	3.419	0.000678	0.062036	4	0.018142	yes	THYROID
chr1_1191757_A_C_b38	RP5-902P8.12	3.414	0.000691	0.062241	5	0.018229	yes	THYROID
chr1_1187159_A_G_b38	RP5-902P8.12	3.408	0.000706	0.063092	4	0.018512	yes	THYROID
chr1_1189439_C_T_b38	RP5-902P8.12	3.408	0.000706	0.063092	4	0.018512	yes	THYROID
chr1_1189840_C_T_b38	RP5-902P8.12	3.408	0.000706	0.063092	4	0.018512	yes	THYROID
chr1_1191721_C_A_b38	RP5-902P8.12	3.408	0.000706	0.063092	4	0.018512	yes	THYROID
chr1_1192228_G_GT_b38	RP5-902P8.12	3.408	0.000706	0.063092	4	0.018512	yes	THYROID
chr1_1193742_G_C_b38	RP5-902P8.12	3.408	0.000706	0.063092	4	0.018512	yes	THYROID
chr1_1194409_G_C_b38	RP5-902P8.12	3.408	0.000706	0.063092	4	0.018512	yes	THYROID
chr1_1194540_G_A_b38	RP5-902P8.12	3.408	0.000706	0.063092	4	0.018512	yes	THYROID
chr1_1195347_A_C_b38	RP5-902P8.12	3.408	0.000706	0.063092	4	0.018512	yes	THYROID
chr1_591626_T_C_b38	RP5-902P8.12	3.385	0.000767	0.067367	4	0.0199	yes	THYROID
chr1_1235602_C_A_b38	RP5-902P8.12	3.358	0.000844	0.056411	9	0.016798	yes	THYROID
chr1_1211917_G_A_b38	RP5-902P8.12	3.357	0.000848	0.066494	4	0.019808	yes	THYROID
chr1_2222256_T_C_b38	RP5-902P8.12	3.356	0.00085	0.046199	27	0.013765	yes	THYROID
chr1_2222257_G_C_b38	RP5-902P8.12	3.356	0.00085	0.046199	27	0.013765	yes	THYROID
chr1_2222258_T_C_b38	RP5-902P8.12	3.356	0.00085	0.046199	27	0.013765	yes	THYROID
chr1_1185978_A_C_b38	RP5-902P8.12	3.351	0.000866	0.061521	6	0.018359	yes	THYROID
chr1_1209119_GGA_G_b38	RP5-902P8.12	3.351	0.000866	0.066734	4	0.019916	yes	THYROID
chr1_1209273_G_A_b38	RP5-902P8.12	3.351	0.000866	0.066734	4	0.019916	yes	THYROID
chr1_1209316_T_C_b38	RP5-902P8.12	3.351	0.000866	0.066734	4	0.019916	yes	THYROID
chr1_1211863_A_C_b38	RP5-902P8.12	3.347	0.000877	0.065921	4	0.019694	yes	THYROID
chr1_1228424_C_T_b38	RP5-902P8.12	3.344	0.000887	0.050683	15	0.015156	yes	THYROID
chr1_1210031_G_A_b38	RP5-902P8.12	3.341	0.000897	0.066158	4	0.019801	yes	THYROID
chr1_1210061_A_G_b38	RP5-902P8.12	3.341	0.000897	0.066158	4	0.019801	yes	THYROID
chr1_1210087_C_G_b38	RP5-902P8.12	3.341	0.000897	0.066158	4	0.019801	yes	THYROID
chr1_1210386_C_G_b38	RP5-902P8.12	3.341	0.000897	0.066158	4	0.019801	yes	THYROID
chr1_2225467_AT_A_b38	RP5-902P8.12	3.331	0.000927	0.052134	9	0.015649	yes	THYROID
chr1_2230051_C_T_b38	RP5-902P8.12	3.33	0.000933	0.045282	29	0.013599	yes	THYROID
chr1_1226261_G_A_b38	RP5-902P8.12	3.328	0.000937	0.060938	4	0.018308	yes	THYROID
chr1_1226334_AC_A_b38	RP5-902P8.12	3.328	0.000937	0.060938	4	0.018308	yes	THYROID
chr1_1226338_TGTACGGTCAGGAGGAAACATGGCACCTCCCCTCTGGGGGCTCTTTCCAGAAACCCTCAACCC_T_b38	RP5-902P8.12	3.328	0.000937	0.060938	4	0.018308	yes	THYROID
chr1_1195475_T_C_b38	RP5-902P8.12	3.318	0.000974	0.061322	4	0.018484	yes	THYROID
chr1_2226499_CG_C_b38	RP5-902P8.12	3.3	0.00104	0.044815	29	0.013581	yes	THYROID
chr1_1212390_G_A_b38	RP5-902P8.12	3.271	0.00114	0.06491	4	0.019843	yes	THYROID
chr1_1214831_G_A_b38	RP5-902P8.12	3.265	0.00117	0.063873	4	0.019564	yes	THYROID
chr1_1195672_C_T_b38	RP5-902P8.12	3.264	0.00117	0.061038	3	0.018701	yes	THYROID
chr1_789680_A_AGGAATGGAAT_b38	RP5-902P8.12	-3.26	0.00119	-0.037793	65	0.011591	yes	THYROID
chr1_1225476_T_C_b38	RP5-902P8.12	3.254	0.00121	0.057889	7	0.017789	yes	THYROID
chr1_1226013_C_T_b38	RP5-902P8.12	3.254	0.00121	0.057889	7	0.017789	yes	THYROID
chr1_1186335_C_T_b38	RP5-902P8.12	3.241	0.00127	0.059645	4	0.018404	yes	THYROID
chr1_1240367_A_G_b38	RP5-902P8.12	3.24	0.00127	0.058399	6	0.018023	yes	THYROID
chr1_2221645_G_A_b38	RP5-902P8.12	3.23	0.00132	0.043867	29	0.013581	yes	THYROID
chr1_1235869_T_C_b38	RP5-902P8.12	3.175	0.00159	0.061517	3	0.019376	yes	THYROID
chr1_1186903_T_G_b38	RP5-902P8.12	3.157	0.00169	0.057939	5	0.018355	yes	THYROID
chr1_1235642_G_C_b38	RP5-902P8.12	3.131	0.00184	0.052171	9	0.016662	yes	THYROID
chr1_1231507_T_C_b38	RP5-902P8.12	3.092	0.0021	0.047508	16	0.015363	yes	THYROID
chr1_1186100_T_C_b38	RP5-902P8.12	3.032	0.00255	0.055028	5	0.018149	yes	THYROID
chr1_1429865_C_T_b38	RP5-902P8.12	3.02	0.00265	0.112191	4	0.037143	yes	THYROID
chr1_1240684_G_GCCGCCCCCATTCACCCCGGCCGTGGTCCCTGCCGCAGCCCCCA_b38	RP5-902P8.12	3.018	0.00267	0.070703	4	0.023426	yes	THYROID
chr1_2215527_T_C_b38	RP5-902P8.12	3.01	0.00274	0.04091	29	0.013589	yes	THYROID
chr1_904561_TCCTCCTCCGAACGTGG_T_b38	RP5-902P8.12	2.969	0.00313	0.044956	21	0.01514	yes	THYROID
chr1_624505_A_G_b38	RP5-902P8.12	2.96	0.00323	0.047856	4	0.01617	yes	THYROID
chr1_1191950_C_T_b38	RP5-902P8.12	2.941	0.00342	0.054198	4	0.018429	yes	THYROID
chr1_1238231_G_A_b38	RP5-902P8.12	2.938	0.00345	0.04352	27	0.014811	yes	THYROID
chr1_624752_C_T_b38	RP5-902P8.12	2.895	0.00396	0.045775	6	0.015811	yes	THYROID
chr1_1229369_G_GC_b38	RP5-902P8.12	2.874	0.00423	0.042407	23	0.014756	yes	THYROID
chr1_283828_T_C_b38	RP5-902P8.12	2.851	0.00454	0.044012	4	0.01544	yes	THYROID
chr1_1663038_T_C_b38	RP5-902P8.12	-2.807	0.0052	-0.033992	87	0.012111	yes	THYROID
chr1_1210101_CAA_C_b38	RP5-902P8.12	2.799	0.00533	0.051783	4	0.018504	yes	THYROID
chr1_1217733_G_A_b38	RP5-902P8.12	2.718	0.00679	0.046387	9	0.017064	yes	THYROID
chr1_1981144_T_G_b38	RP5-902P8.12	-2.645	0.00844	-0.033318	39	0.012599	yes	THYROID
chr1_1832335_G_A_b38	RP5-902P8.12	2.601	0.00957	0.057391	3	0.022064	yes	THYROID
chr1_1216593_G_C_b38	RP5-902P8.12	2.595	0.00975	0.039087	16	0.015065	yes	THYROID
chr1_1219941_C_T_b38	RP5-902P8.12	3.717	0.000225	0.075819	3	0.0204	no	THYROID
chr1_1238883_G_A_b38	RP5-902P8.12	3.686	0.000253	0.071968	3	0.019526	no	THYROID
chr1_1230462_A_ATTT_b38	RP5-902P8.12	3.661	0.000278	0.071558	4	0.019547	no	THYROID
chr1_1239925_G_A_b38	RP5-902P8.12	3.593	0.000359	0.073084	3	0.020341	no	THYROID
chr1_2216191_C_A_b38	RP5-902P8.12	3.096	0.00207	0.043828	20	0.014158	no	THYROID
chr1_1554326_G_A_b38	RP5-902P8.12	3.016	0.00269	0.09112	3	0.030213	no	THYROID
chr1_1219858_G_A_b38	RP5-902P8.12	2.996	0.00287	0.043903	24	0.014654	no	THYROID
chr1_1763636_G_A_b38	RP5-902P8.12	-2.932	0.00352	-0.042525	32	0.014502	no	THYROID
chr1_904532_GGCC_G_b38	RP5-902P8.12	2.904	0.00385	0.040582	29	0.013975	no	THYROID
chr1_904531_C_T_b38	RP5-902P8.12	2.849	0.00456	0.039674	29	0.013924	no	THYROID
chr1_1054120_G_A_b38	RP5-902P8.12	-2.836	0.00475	-0.060854	3	0.021459	no	THYROID
chr1_626516_AT_A_b38	RP5-902P8.12	2.829	0.00486	0.079608	4	0.02814	no	THYROID
chr1_790733_C_CAATGG_b38	RP5-902P8.12	2.814	0.00508	0.044843	8	0.015933	no	THYROID
chr1_964828_G_A_b38	RP5-902P8.12	2.713	0.0069	0.106041	3	0.039092	no	THYROID
chr1_2213842_A_G_b38	RP5-902P8.12	2.699	0.0072	0.035193	32	0.013042	no	THYROID
chr1_262683_C_CT_b38	RP5-902P8.12	-2.689	0.0074	-0.062088	5	0.023086	no	THYROID
chr1_1490122_A_G_b38	RP5-902P8.12	-2.684	0.0075	-0.075437	4	0.028101	no	THYROID
chr1_1971127_G_A_b38	RP5-902P8.12	-2.626	0.0089	-0.032214	40	0.012267	no	THYROID
chr1_1808384_AC_A_b38	RP5-902P8.12	2.607	0.00941	0.057114	3	0.021909	no	THYROID
chr1_1829288_T_C_b38	RP5-902P8.12	2.607	0.00941	0.057114	3	0.021909	no	THYROID
chr1_925408_TTGG_T_b38	RP5-902P8.12	3.81	0.000236	0.158105	9	0.041502	yes	UTERUS
chr1_925412_CGCCTGCG_C_b38	RP5-902P8.12	3.81	0.000236	0.158105	9	0.041502	yes	UTERUS
chr1_925081_G_A_b38	RP5-902P8.12	3.722	0.000321	0.177105	7	0.047579	yes	UTERUS
chr1_925141_C_A_b38	RP5-902P8.12	3.722	0.000321	0.177105	7	0.047579	yes	UTERUS
chr1_925628_G_C_b38	RP5-902P8.12	3.722	0.000321	0.177105	7	0.047579	yes	UTERUS
chr1_926428_A_G_b38	RP5-902P8.12	3.49	0.000709	0.176631	7	0.050606	yes	UTERUS
chr1_926713_T_C_b38	RP5-902P8.12	3.49	0.000709	0.176631	7	0.050606	yes	UTERUS
chr1_926744_A_G_b38	RP5-902P8.12	3.49	0.000709	0.176631	7	0.050606	yes	UTERUS
chr1_927003_C_T_b38	RP5-902P8.12	3.49	0.000709	0.176631	7	0.050606	yes	UTERUS
chr1_927009_A_G_b38	RP5-902P8.12	3.46	0.000784	0.154298	7	0.044591	yes	UTERUS
chr1_925398_A_G_b38	RP5-902P8.12	3.449	0.000813	0.138843	9	0.040254	yes	UTERUS
chr1_1679085_T_C_b38	RP5-902P8.12	3.224	0.00169	0.073636	19	0.022838	yes	UTERUS
chr1_1170732_A_G_b38	RP5-902P8.12	-3.089	0.00258	-0.204757	10	0.066287	yes	UTERUS
chr1_1546962_G_A_b38	RP5-902P8.12	-3.064	0.00278	-0.141036	5	0.046026	yes	UTERUS
chr1_927744_G_T_b38	RP5-902P8.12	2.746	0.0071	0.15591	7	0.056771	yes	UTERUS
chr1_1969015_A_G_b38	RP5-902P8.12	-2.707	0.00794	-0.064119	28	0.023685	yes	UTERUS
chr1_1002195_T_TA_b38	RP5-902P8.12	-2.658	0.00909	-0.082355	4	0.03098	yes	UTERUS
chr1_1594995_T_TGAGACA_b38	RP5-902P8.12	-2.642	0.00951	-0.0668	8	0.025281	yes	UTERUS
chr1_1764994_G_A_b38	RP5-902P8.12	-3.372	0.00105	-0.1807	4	0.053581	no	UTERUS
chr1_2007629_CA_C_b38	RP5-902P8.12	3.081	0.00264	0.08197	21	0.026603	no	UTERUS
chr1_929839_G_A_b38	RP5-902P8.12	3.047	0.00293	0.083752	5	0.027487	no	UTERUS
chr1_932255_C_T_b38	RP5-902P8.12	2.943	0.004	0.080793	5	0.027449	no	UTERUS
chr1_1657902_T_TA_b38	RP5-902P8.12	-2.897	0.00459	-0.107616	3	0.037142	no	UTERUS
chr1_1002415_C_CATTT_b38	RP5-902P8.12	-2.752	0.007	-0.073059	10	0.026551	no	UTERUS
chr1_928622_G_C_b38	RP5-902P8.12	2.677	0.00863	0.07418	5	0.027709	no	UTERUS
chr1_1002415_C_CATTTTTT_b38	RP5-902P8.12	-3.275	0.00139	-0.146676	3	0.04479	yes	VAGINA
chr1_1948594_G_GTT_b38	RP5-902P8.12	-3.177	0.00191	-0.053782	31	0.016928	yes	VAGINA
chr1_1810535_CA_C_b38	RP5-902P8.12	2.742	0.00708	0.083631	8	0.030504	yes	VAGINA
chr1_1727506_T_C_b38	RP5-902P8.12	2.73	0.00733	0.073339	12	0.026869	yes	VAGINA
chr1_1716210_C_CT_b38	RP5-902P8.12	2.654	0.00908	0.096416	9	0.036335	yes	VAGINA
chr1_1720288_G_A_b38	RP5-902P8.12	2.654	0.00908	0.096416	9	0.036335	yes	VAGINA
chr1_976215_A_G_b38	RP5-902P8.12	2.808	0.00586	0.063889	14	0.022756	no	VAGINA
chr1_935431_G_A_b38	RP5-902P8.12	4	7.13e-05	0.113151	8	0.028289	yes	WHLBLD
chr1_807774_C_T_b38	RP5-902P8.12	3.713	0.000224	0.115319	9	0.031057	yes	WHLBLD
chr1_807214_C_T_b38	RP5-902P8.12	3.704	0.000232	0.111349	7	0.030065	yes	WHLBLD
chr1_273824_G_T_b38	RP5-902P8.12	3.675	0.00026	0.046429	37	0.012635	yes	WHLBLD
chr1_758207_C_G_b38	RP5-902P8.12	3.635	0.000301	0.152143	4	0.04185	yes	WHLBLD
chr1_1192636_G_GACACTCCAGTTGGTATGAGTGTAGACACTCCAGTTCGTATCAGTGTAA_b38	RP5-902P8.12	3.621	0.000318	0.099613	5	0.027509	yes	WHLBLD
chr1_2080325_A_AGTGCGCGTGGACGTGGCGGTGCGCGTGGACGTGGCG_b38	RP5-902P8.12	3.404	0.000708	0.102687	9	0.030164	yes	WHLBLD
chr1_1324195_G_A_b38	RP5-902P8.12	3.361	0.000826	0.113214	4	0.033685	yes	WHLBLD
chr1_969648_ACGTG_A_b38	RP5-902P8.12	3.332	0.000916	0.108639	7	0.032607	yes	WHLBLD
chr1_858792_G_T_b38	RP5-902P8.12	3.263	0.00117	0.117481	4	0.036007	yes	WHLBLD
chr1_2103488_A_G_b38	RP5-902P8.12	3.175	0.00157	0.086592	18	0.027271	yes	WHLBLD
chr1_2074426_T_TTGTGGGTC_b38	RP5-902P8.12	3.147	0.00173	0.090828	15	0.02886	yes	WHLBLD
chr1_2075852_C_T_b38	RP5-902P8.12	3.147	0.00173	0.090828	15	0.02886	yes	WHLBLD
chr1_2077119_C_T_b38	RP5-902P8.12	3.147	0.00173	0.090828	15	0.02886	yes	WHLBLD
chr1_2078078_T_C_b38	RP5-902P8.12	3.147	0.00173	0.090828	15	0.02886	yes	WHLBLD
chr1_2101019_TAAA_T_b38	RP5-902P8.12	3.124	0.00187	0.085979	3	0.027523	yes	WHLBLD
chr1_2083306_C_T_b38	RP5-902P8.12	2.99	0.0029	0.08686	13	0.029048	yes	WHLBLD
chr1_1766410_CAAAAAAAAAAAAAAAAAAAAAA_C_b38	RP5-902P8.12	2.985	0.00295	0.122975	3	0.041192	yes	WHLBLD
chr1_1747789_G_A_b38	RP5-902P8.12	2.954	0.00325	0.099978	4	0.033839	yes	WHLBLD
chr1_807696_C_CA_b38	RP5-902P8.12	2.938	0.00343	0.099955	5	0.034022	yes	WHLBLD
chr1_1701568_G_C_b38	RP5-902P8.12	2.916	0.00368	0.063311	19	0.021714	yes	WHLBLD
chr1_1647600_C_G_b38	RP5-902P8.12	-2.908	0.00377	-0.046439	69	0.015967	yes	WHLBLD
chr1_280198_C_A_b38	RP5-902P8.12	2.889	0.004	0.065659	6	0.022727	yes	WHLBLD
chr1_1219702_C_G_b38	RP5-902P8.12	2.889	0.00401	0.099462	4	0.034429	yes	WHLBLD
chr1_1056602_T_TGTGGGTGCGTGTGC_b38	RP5-902P8.12	-2.862	0.00436	-0.029555	112	0.010326	yes	WHLBLD
chr1_1752624_C_T_b38	RP5-902P8.12	2.86	0.00439	0.091607	4	0.032034	yes	WHLBLD
chr1_2055016_C_T_b38	RP5-902P8.12	2.851	0.00451	0.08124	15	0.028496	yes	WHLBLD
chr1_1423761_CCAT_C_b38	RP5-902P8.12	2.828	0.00484	0.062699	6	0.022172	yes	WHLBLD
chr1_2079230_A_G_b38	RP5-902P8.12	2.812	0.00508	0.08021	21	0.028521	yes	WHLBLD
chr1_894257_C_T_b38	RP5-902P8.12	-2.806	0.00518	-0.100305	3	0.035749	yes	WHLBLD
chr1_1766459_CT_C_b38	RP5-902P8.12	2.799	0.0053	0.112907	3	0.040344	yes	WHLBLD
chr1_807281_A_C_b38	RP5-902P8.12	2.795	0.00536	0.096778	5	0.034628	yes	WHLBLD
chr1_626636_CT_C_b38	RP5-902P8.12	2.793	0.00539	0.084739	3	0.030342	yes	WHLBLD
chr1_904561_TCCTCCTCCGAACGTGG_T_b38	RP5-902P8.12	2.75	0.00615	0.040782	21	0.014832	yes	WHLBLD
chr1_1056601_A_ACG_b38	RP5-902P8.12	-2.724	0.00664	-0.028688	114	0.010532	yes	WHLBLD
chr1_624509_AAGGG_A_b38	RP5-902P8.12	2.72	0.00672	0.057984	3	0.021317	yes	WHLBLD
chr1_2068161_A_T_b38	RP5-902P8.12	2.72	0.00672	0.077891	15	0.028636	yes	WHLBLD
chr1_264730_T_A_b38	RP5-902P8.12	2.698	0.00718	0.070106	22	0.025988	yes	WHLBLD
chr1_1056602_T_C_b38	RP5-902P8.12	2.697	0.00718	0.03994	40	0.014807	yes	WHLBLD
chr1_1741174_TTCA_T_b38	RP5-902P8.12	2.68	0.00756	0.08091	6	0.030187	yes	WHLBLD
chr1_1741497_G_A_b38	RP5-902P8.12	2.68	0.00756	0.08091	6	0.030187	yes	WHLBLD
chr1_788814_G_A_b38	RP5-902P8.12	2.677	0.00762	0.079183	8	0.029574	yes	WHLBLD
chr1_1740869_C_T_b38	RP5-902P8.12	2.67	0.00778	0.08034	6	0.030087	yes	WHLBLD
chr1_284028_C_A_b38	RP5-902P8.12	2.66	0.00803	0.03688	26	0.013865	yes	WHLBLD
chr1_284929_A_G_b38	RP5-902P8.12	2.642	0.00847	0.05579	9	0.02112	yes	WHLBLD
chr1_2105801_T_C_b38	RP5-902P8.12	2.616	0.00911	0.071935	14	0.027494	yes	WHLBLD
chr1_1029365_A_ATCTATGCAGGCAGGTGGGGGGATCAGTG_b38	RP5-902P8.12	2.609	0.00931	0.031452	47	0.012056	yes	WHLBLD
chr1_804185_G_C_b38	RP5-902P8.12	2.592	0.00977	0.083059	7	0.032044	yes	WHLBLD
chr1_804863_T_C_b38	RP5-902P8.12	2.592	0.00977	0.083059	7	0.032044	yes	WHLBLD
chr1_805036_A_G_b38	RP5-902P8.12	2.592	0.00977	0.083059	7	0.032044	yes	WHLBLD
chr1_860178_C_CTTTT_b38	RP5-902P8.12	5.611	3.08e-08	0.137035	5	0.024422	no	WHLBLD
chr1_1499279_C_CT_b38	RP5-902P8.12	3.71	0.000227	0.105769	6	0.028513	no	WHLBLD
chr1_286272_A_G_b38	RP5-902P8.12	3.686	0.000248	0.044293	71	0.012016	no	WHLBLD
chr1_808696_A_C_b38	RP5-902P8.12	3.453	0.000595	0.143157	3	0.041465	no	WHLBLD
chr1_287171_T_A_b38	RP5-902P8.12	3.339	0.000891	0.036753	72	0.011006	no	WHLBLD
chr1_611267_G_A_b38	RP5-902P8.12	3.246	0.00123	0.08651	3	0.026647	no	WHLBLD
chr1_1749512_C_T_b38	RP5-902P8.12	3.241	0.00126	0.105574	3	0.032579	no	WHLBLD
chr1_2073469_G_A_b38	RP5-902P8.12	3.152	0.0017	0.091908	15	0.029162	no	WHLBLD
chr1_2079357_A_G_b38	RP5-902P8.12	3.152	0.0017	0.091908	15	0.029162	no	WHLBLD
chr1_2069762_G_C_b38	RP5-902P8.12	3.151	0.00171	0.090899	15	0.028848	no	WHLBLD
chr1_1324174_G_A_b38	RP5-902P8.12	3.132	0.00182	0.060328	13	0.019261	no	WHLBLD
chr1_594082_G_A_b38	RP5-902P8.12	3.1	0.00203	0.091418	4	0.029493	no	WHLBLD
chr1_633672_C_T_b38	RP5-902P8.12	2.955	0.00325	0.120664	4	0.040836	no	WHLBLD
chr1_271569_A_G_b38	RP5-902P8.12	2.92	0.00364	0.039359	36	0.013481	no	WHLBLD
chr1_591478_T_G_b38	RP5-902P8.12	2.876	0.00417	0.07621	4	0.026499	no	WHLBLD
chr1_642891_G_A_b38	RP5-902P8.12	2.865	0.00431	0.058812	5	0.020527	no	WHLBLD
chr1_1291864_G_A_b38	RP5-902P8.12	2.836	0.00472	0.067556	3	0.02382	no	WHLBLD
chr1_632387_G_A_b38	RP5-902P8.12	2.812	0.00508	0.080039	4	0.028462	no	WHLBLD
chr1_1168157_C_T_b38	RP5-902P8.12	2.711	0.0069	0.091395	6	0.033712	no	WHLBLD
chr1_969785_A_G_b38	RP5-902P8.12	-2.709	0.00694	-0.058136	32	0.021458	no	WHLBLD
chr1_1836387_CTT_C_b38	RP5-902P8.12	2.7	0.00712	0.03795	39	0.014054	no	WHLBLD
chr1_1002192_A_AT_b38	RP5-902P8.12	2.694	0.00725	0.04569	7	0.016958	no	WHLBLD
chr1_1726649_G_A_b38	RP5-902P8.12	2.666	0.00788	0.075774	9	0.028419	no	WHLBLD
chr1_1157306_CCCGCCCCCAGCCCACCCATCCCATCCCCGCCCACCCATCCCATCCCCG_C_b38	RP5-902P8.12	2.661	0.00801	0.05464	14	0.020536	no	WHLBLD
chr1_1034279_G_A_b38	RP5-902P8.12	2.622	0.00896	0.031041	54	0.011839	no	WHLBLD
chr1_1288085_GC_G_b38	RP5-902P8.12	2.589	0.00986	0.042636	11	0.016467	no	WHLBLD

---

Filters:      p-Values >= and <=      Betas >= and <=      Statistic >= and <=      Carriers >= and <=
Positions: left right     Zoom: RP5-902P8.12     Other:     -      +     reset     eQTLs Region
Draw    p-Value Beta Statistic Carriers Beta/sd(t)     Scaling     Sign (red=+, blue-)     Colors: Tissue Sign