SAMD11 - sterile alpha motif domain containing 11 - 1p36.33 |
2875 eQTLs |
CoGTEx v1 v2 | ENSG00000187634 | NCBI 148398 |
Snps | Gene | Statistic | Pvalue | Beta | Carriers | Beta_se | Linear | Tissue |
---|---|---|---|---|---|---|---|---|
chr1_1583688_A_C_b38 | SAMD11 | -3.396 | 0.000737 | -0.051577 | 58 | 0.015187 | yes | ADPSBQ |
chr1_1743570_T_A_b38 | SAMD11 | -3.3 | 0.00103 | -0.087038 | 12 | 0.026375 | yes | ADPSBQ |
chr1_13838_C_T_b38 | SAMD11 | 2.931 | 0.00353 | 0.061201 | 17 | 0.020879 | yes | ADPSBQ |
chr1_61099_T_C_b38 | SAMD11 | 2.83 | 0.00483 | 0.071501 | 8 | 0.025262 | yes | ADPSBQ |
chr1_101335_C_CA_b38 | SAMD11 | 2.73 | 0.00655 | 0.119214 | 3 | 0.043667 | yes | ADPSBQ |
chr1_626636_C_CT_b38 | SAMD11 | 2.613 | 0.00923 | 0.132422 | 3 | 0.050673 | yes | ADPSBQ |
chr1_1615015_CA_C_b38 | SAMD11 | -2.608 | 0.00939 | -0.057633 | 3 | 0.022102 | yes | ADPSBQ |
chr1_13912_G_A_b38 | SAMD11 | 2.6 | 0.0096 | 0.05307 | 18 | 0.020413 | yes | ADPSBQ |
chr1_48067_C_T_b38 | SAMD11 | 3.202 | 0.00145 | 0.102256 | 4 | 0.031937 | no | ADPSBQ |
chr1_109575_CGTGT_C_b38 | SAMD11 | 3.144 | 0.00176 | 0.06664 | 8 | 0.021197 | no | ADPSBQ |
chr1_1690309_T_A_b38 | SAMD11 | -2.883 | 0.0041 | -0.114812 | 4 | 0.039821 | no | ADPSBQ |
chr1_1606559_C_CGGCTGGTCAGGCGTGGGGCGGGCTGGTCAGGCGTGGGGCG_b38 | SAMD11 | -2.856 | 0.00447 | -0.087252 | 9 | 0.030553 | no | ADPSBQ |
chr1_1195500_C_CTTTTTTTTTTT_b38 | SAMD11 | -2.851 | 0.00453 | -0.123755 | 3 | 0.043403 | no | ADPSBQ |
chr1_1593274_CA_C_b38 | SAMD11 | -2.773 | 0.00575 | -0.058451 | 11 | 0.021077 | no | ADPSBQ |
chr1_104159_C_T_b38 | SAMD11 | 2.642 | 0.0085 | 0.085887 | 3 | 0.03251 | no | ADPSBQ |
chr1_1439805_G_C_b38 | SAMD11 | -2.592 | 0.0098 | -0.050984 | 27 | 0.019666 | no | ADPSBQ |
chr1_916683_G_A_b38 | SAMD11 | 5.765 | 1.64e-08 | 0.147519 | 118 | 0.02559 | yes | ADPVSC |
chr1_916657_G_A_b38 | SAMD11 | 5.703 | 2.3e-08 | 0.145532 | 119 | 0.02552 | yes | ADPVSC |
chr1_919598_A_C_b38 | SAMD11 | 5.42 | 1.03e-07 | 0.13582 | 98 | 0.025059 | yes | ADPVSC |
chr1_914991_G_T_b38 | SAMD11 | 5.389 | 1.21e-07 | 0.133168 | 95 | 0.024709 | yes | ADPVSC |
chr1_914838_T_A_b38 | SAMD11 | 5.283 | 2.1e-07 | 0.135283 | 117 | 0.025608 | yes | ADPVSC |
chr1_919397_A_G_b38 | SAMD11 | 5.116 | 4.86e-07 | 0.12914 | 74 | 0.025241 | yes | ADPVSC |
chr1_915400_C_T_b38 | SAMD11 | 5.103 | 5.18e-07 | 0.129007 | 92 | 0.025279 | yes | ADPVSC |
chr1_918574_C_A_b38 | SAMD11 | 5.094 | 5.43e-07 | 0.128649 | 96 | 0.025256 | yes | ADPVSC |
chr1_919695_C_G_b38 | SAMD11 | 5.035 | 7.27e-07 | 0.126551 | 75 | 0.025136 | yes | ADPVSC |
chr1_917495_C_T_b38 | SAMD11 | 4.995 | 8.82e-07 | 0.12601 | 97 | 0.025226 | yes | ADPVSC |
chr1_920719_T_G_b38 | SAMD11 | -4.728 | 3.15e-06 | -0.119493 | 75 | 0.025271 | yes | ADPVSC |
chr1_920728_A_G_b38 | SAMD11 | -4.728 | 3.15e-06 | -0.119493 | 75 | 0.025271 | yes | ADPVSC |
chr1_921096_A_G_b38 | SAMD11 | -4.289 | 2.26e-05 | -0.111356 | 84 | 0.025966 | yes | ADPVSC |
chr1_939779_AGCCAGTGGACGCCGACCT_A_b38 | SAMD11 | 4.26 | 2.55e-05 | 0.109817 | 96 | 0.025778 | yes | ADPVSC |
chr1_916753_C_T_b38 | SAMD11 | 4.238 | 2.8e-05 | 0.137459 | 18 | 0.032434 | yes | ADPVSC |
chr1_933548_A_AG_b38 | SAMD11 | 4.171 | 3.73e-05 | 0.108871 | 82 | 0.026104 | yes | ADPVSC |
chr1_958251_A_G_b38 | SAMD11 | 4.153 | 4.02e-05 | 0.197851 | 5 | 0.047645 | yes | ADPVSC |
chr1_931513_T_C_b38 | SAMD11 | 4.054 | 6.05e-05 | 0.105415 | 116 | 0.026002 | yes | ADPVSC |
chr1_954258_G_C_b38 | SAMD11 | 3.953 | 9.12e-05 | 0.195476 | 4 | 0.049445 | yes | ADPVSC |
chr1_962184_T_C_b38 | SAMD11 | 3.944 | 9.46e-05 | 0.192185 | 5 | 0.048727 | yes | ADPVSC |
chr1_954333_C_A_b38 | SAMD11 | 3.933 | 9.9e-05 | 0.194917 | 4 | 0.049561 | yes | ADPVSC |
chr1_911484_G_C_b38 | SAMD11 | -3.882 | 0.000121 | -0.120085 | 21 | 0.030932 | yes | ADPVSC |
chr1_916119_A_G_b38 | SAMD11 | 3.869 | 0.000127 | 0.133033 | 11 | 0.034381 | yes | ADPVSC |
chr1_962358_C_T_b38 | SAMD11 | -3.857 | 0.000134 | -0.189699 | 5 | 0.049184 | yes | ADPVSC |
chr1_940390_A_G_b38 | SAMD11 | 3.738 | 0.000213 | 0.095852 | 119 | 0.025645 | yes | ADPVSC |
chr1_911428_C_T_b38 | SAMD11 | -3.687 | 0.000259 | -0.114235 | 23 | 0.030987 | yes | ADPVSC |
chr1_920661_G_A_b38 | SAMD11 | -3.605 | 0.000352 | -0.123869 | 11 | 0.034362 | yes | ADPVSC |
chr1_914618_A_G_b38 | SAMD11 | 3.572 | 0.000397 | 0.123545 | 11 | 0.034583 | yes | ADPVSC |
chr1_967384_C_G_b38 | SAMD11 | 3.564 | 0.00041 | 0.097328 | 95 | 0.027311 | yes | ADPVSC |
chr1_942335_C_G_b38 | SAMD11 | 3.509 | 0.000502 | 0.170326 | 6 | 0.048546 | yes | ADPVSC |
chr1_955679_C_T_b38 | SAMD11 | 3.503 | 0.000513 | 0.094593 | 91 | 0.027005 | yes | ADPVSC |
chr1_956565_A_G_b38 | SAMD11 | 3.503 | 0.000513 | 0.094593 | 91 | 0.027005 | yes | ADPVSC |
chr1_950296_C_A_b38 | SAMD11 | 3.499 | 0.000519 | 0.180707 | 3 | 0.051638 | yes | ADPVSC |
chr1_952180_A_C_b38 | SAMD11 | 3.499 | 0.000519 | 0.180707 | 3 | 0.051638 | yes | ADPVSC |
chr1_967865_A_G_b38 | SAMD11 | 3.486 | 0.000545 | 0.089037 | 125 | 0.02554 | yes | ADPVSC |
chr1_911848_C_T_b38 | SAMD11 | -3.408 | 0.000721 | -0.109085 | 19 | 0.032009 | yes | ADPVSC |
chr1_949171_GAGAA_G_b38 | SAMD11 | 3.406 | 0.000726 | 0.091778 | 92 | 0.026944 | yes | ADPVSC |
chr1_946247_G_A_b38 | SAMD11 | 3.397 | 0.00075 | 0.093452 | 93 | 0.02751 | yes | ADPVSC |
chr1_911220_CT_C_b38 | SAMD11 | 3.389 | 0.000772 | 0.11449 | 14 | 0.033785 | yes | ADPVSC |
chr1_920949_C_G_b38 | SAMD11 | -3.381 | 0.000794 | -0.114334 | 13 | 0.033816 | yes | ADPVSC |
chr1_969750_ATG_A_b38 | SAMD11 | 3.356 | 0.000867 | 0.086025 | 109 | 0.025634 | yes | ADPVSC |
chr1_909903_G_T_b38 | SAMD11 | 3.28 | 0.00113 | 0.110267 | 15 | 0.033619 | yes | ADPVSC |
chr1_908677_AAGGTGGGAGGGGAGAGGGGAGGGGATGGGGGAGGGAATGAGGGGAC_A_b38 | SAMD11 | -3.253 | 0.00124 | -0.14672 | 4 | 0.045098 | yes | ADPVSC |
chr1_910698_C_T_b38 | SAMD11 | -3.232 | 0.00133 | -0.104574 | 16 | 0.032354 | yes | ADPVSC |
chr1_967941_G_A_b38 | SAMD11 | 3.228 | 0.00135 | 0.11908 | 9 | 0.036891 | yes | ADPVSC |
chr1_910558_G_A_b38 | SAMD11 | -3.186 | 0.00156 | -0.096537 | 33 | 0.0303 | yes | ADPVSC |
chr1_933741_T_TG_b38 | SAMD11 | 3.185 | 0.00156 | 0.0874 | 52 | 0.027438 | yes | ADPVSC |
chr1_971790_AG_A_b38 | SAMD11 | -3.158 | 0.00171 | -0.082269 | 70 | 0.026049 | yes | ADPVSC |
chr1_926250_G_A_b38 | SAMD11 | 3.155 | 0.00173 | 0.094254 | 51 | 0.029875 | yes | ADPVSC |
chr1_935954_G_T_b38 | SAMD11 | 3.124 | 0.00192 | 0.084099 | 69 | 0.026921 | yes | ADPVSC |
chr1_925308_G_A_b38 | SAMD11 | 3.114 | 0.00198 | 0.091859 | 54 | 0.029499 | yes | ADPVSC |
chr1_940296_GCC_G_b38 | SAMD11 | 3.082 | 0.0022 | 0.081429 | 73 | 0.026418 | yes | ADPVSC |
chr1_965337_CTTAT_C_b38 | SAMD11 | 3.069 | 0.00229 | 0.08477 | 99 | 0.027619 | yes | ADPVSC |
chr1_1079336_C_T_b38 | SAMD11 | 3.035 | 0.00256 | 0.201876 | 3 | 0.066518 | yes | ADPVSC |
chr1_765448_T_A_b38 | SAMD11 | -3.025 | 0.00265 | -0.237996 | 5 | 0.078673 | yes | ADPVSC |
chr1_936972_G_C_b38 | SAMD11 | -3.012 | 0.00276 | -0.083573 | 46 | 0.027744 | yes | ADPVSC |
chr1_953778_G_C_b38 | SAMD11 | 2.999 | 0.00288 | 0.158911 | 3 | 0.052989 | yes | ADPVSC |
chr1_953779_A_C_b38 | SAMD11 | 2.999 | 0.00288 | 0.158911 | 3 | 0.052989 | yes | ADPVSC |
chr1_912710_G_A_b38 | SAMD11 | -2.996 | 0.0029 | -0.095073 | 18 | 0.031729 | yes | ADPVSC |
chr1_913358_C_T_b38 | SAMD11 | -2.996 | 0.0029 | -0.095073 | 18 | 0.031729 | yes | ADPVSC |
chr1_938178_G_T_b38 | SAMD11 | 2.991 | 0.00295 | 0.08177 | 69 | 0.027337 | yes | ADPVSC |
chr1_907236_TA_T_b38 | SAMD11 | -2.985 | 0.00302 | -0.093648 | 33 | 0.031377 | yes | ADPVSC |
chr1_925036_G_A_b38 | SAMD11 | 2.958 | 0.00328 | 0.08792 | 50 | 0.029726 | yes | ADPVSC |
chr1_914682_A_T_b38 | SAMD11 | -2.957 | 0.00329 | -0.091587 | 23 | 0.03097 | yes | ADPVSC |
chr1_965350_G_A_b38 | SAMD11 | 2.952 | 0.00334 | 0.133619 | 24 | 0.045264 | yes | ADPVSC |
chr1_1624591_C_T_b38 | SAMD11 | 2.949 | 0.00338 | 0.16218 | 3 | 0.055001 | yes | ADPVSC |
chr1_960891_C_T_b38 | SAMD11 | 2.939 | 0.00349 | 0.079269 | 105 | 0.026976 | yes | ADPVSC |
chr1_1274256_A_G_b38 | SAMD11 | -2.938 | 0.00349 | -0.115853 | 18 | 0.039431 | yes | ADPVSC |
chr1_1274980_C_T_b38 | SAMD11 | -2.938 | 0.00349 | -0.115853 | 18 | 0.039431 | yes | ADPVSC |
chr1_1275912_C_T_b38 | SAMD11 | -2.938 | 0.00349 | -0.115853 | 18 | 0.039431 | yes | ADPVSC |
chr1_1692900_G_GTT_b38 | SAMD11 | -2.929 | 0.0036 | -0.106723 | 15 | 0.036438 | yes | ADPVSC |
chr1_915810_G_A_b38 | SAMD11 | -2.924 | 0.00365 | -0.090441 | 23 | 0.030928 | yes | ADPVSC |
chr1_912111_G_A_b38 | SAMD11 | -2.919 | 0.00371 | -0.090545 | 23 | 0.031016 | yes | ADPVSC |
chr1_923311_TG_T_b38 | SAMD11 | 2.918 | 0.00373 | 0.086716 | 48 | 0.029721 | yes | ADPVSC |
chr1_914743_C_T_b38 | SAMD11 | -2.914 | 0.00377 | -0.092564 | 18 | 0.031768 | yes | ADPVSC |
chr1_914483_G_GACTGCCCAGCTC_b38 | SAMD11 | -2.899 | 0.00395 | -0.091126 | 21 | 0.03143 | yes | ADPVSC |
chr1_906982_C_T_b38 | SAMD11 | -2.897 | 0.00398 | -0.092873 | 17 | 0.032062 | yes | ADPVSC |
chr1_909894_G_T_b38 | SAMD11 | -2.876 | 0.00424 | -0.090345 | 32 | 0.03141 | yes | ADPVSC |
chr1_1818305_T_TA_b38 | SAMD11 | -2.87 | 0.00432 | -0.077241 | 59 | 0.026911 | yes | ADPVSC |
chr1_913065_G_A_b38 | SAMD11 | -2.866 | 0.00438 | -0.088973 | 23 | 0.031049 | yes | ADPVSC |
chr1_913076_A_G_b38 | SAMD11 | -2.866 | 0.00438 | -0.088973 | 23 | 0.031049 | yes | ADPVSC |
chr1_897018_T_C_b38 | SAMD11 | 2.865 | 0.00439 | 0.08736 | 26 | 0.030492 | yes | ADPVSC |
chr1_910255_C_T_b38 | SAMD11 | -2.86 | 0.00446 | -0.095908 | 13 | 0.033539 | yes | ADPVSC |
chr1_1648518_T_TGCACAC_b38 | SAMD11 | -2.837 | 0.00479 | -0.2185 | 4 | 0.077027 | yes | ADPVSC |
chr1_911018_G_A_b38 | SAMD11 | -2.822 | 0.005 | -0.089053 | 25 | 0.031551 | yes | ADPVSC |
chr1_1279694_A_G_b38 | SAMD11 | -2.809 | 0.00521 | -0.110495 | 18 | 0.039333 | yes | ADPVSC |
chr1_1279698_A_G_b38 | SAMD11 | -2.809 | 0.00521 | -0.110495 | 18 | 0.039333 | yes | ADPVSC |
chr1_1279728_TG_T_b38 | SAMD11 | -2.809 | 0.00521 | -0.110495 | 18 | 0.039333 | yes | ADPVSC |
chr1_927486_C_T_b38 | SAMD11 | 2.807 | 0.00525 | 0.084865 | 52 | 0.030237 | yes | ADPVSC |
chr1_923421_A_G_b38 | SAMD11 | 2.803 | 0.00531 | 0.083266 | 48 | 0.029708 | yes | ADPVSC |
chr1_913274_TG_T_b38 | SAMD11 | -2.791 | 0.00551 | -0.091368 | 15 | 0.03274 | yes | ADPVSC |
chr1_929558_G_A_b38 | SAMD11 | 2.701 | 0.00721 | 0.08018 | 54 | 0.029685 | yes | ADPVSC |
chr1_1835922_G_GA_b38 | SAMD11 | 2.679 | 0.00769 | 0.102878 | 19 | 0.038401 | yes | ADPVSC |
chr1_903175_C_A_b38 | SAMD11 | -2.676 | 0.00777 | -0.08248 | 22 | 0.030826 | yes | ADPVSC |
chr1_1428763_A_G_b38 | SAMD11 | 2.664 | 0.00803 | 0.128288 | 11 | 0.048154 | yes | ADPVSC |
chr1_915824_G_C_b38 | SAMD11 | -2.651 | 0.00834 | -0.081157 | 30 | 0.03061 | yes | ADPVSC |
chr1_906633_T_G_b38 | SAMD11 | -2.648 | 0.00843 | -0.087338 | 13 | 0.032989 | yes | ADPVSC |
chr1_917284_C_T_b38 | SAMD11 | -2.634 | 0.00876 | -0.084116 | 18 | 0.031932 | yes | ADPVSC |
chr1_1208038_T_C_b38 | SAMD11 | -2.621 | 0.00911 | -0.119949 | 11 | 0.045768 | yes | ADPVSC |
chr1_1736801_CA_C_b38 | SAMD11 | -2.598 | 0.00972 | -0.081077 | 62 | 0.031204 | yes | ADPVSC |
chr1_917378_G_C_b38 | SAMD11 | -2.596 | 0.00977 | -0.085008 | 15 | 0.032741 | yes | ADPVSC |
chr1_188252_G_T_b38 | SAMD11 | -2.592 | 0.0099 | -0.093581 | 4 | 0.036105 | yes | ADPVSC |
chr1_966227_C_G_b38 | SAMD11 | 4.025 | 6.81e-05 | 0.194441 | 8 | 0.048304 | no | ADPVSC |
chr1_1057471_AAAG_A_b38 | SAMD11 | 3.752 | 0.000202 | 0.271496 | 3 | 0.072361 | no | ADPVSC |
chr1_1057961_A_G_b38 | SAMD11 | 3.71 | 0.000237 | 0.270985 | 3 | 0.073045 | no | ADPVSC |
chr1_1058952_T_C_b38 | SAMD11 | 3.638 | 0.000311 | 0.267007 | 3 | 0.073398 | no | ADPVSC |
chr1_960326_G_A_b38 | SAMD11 | 3.628 | 0.000323 | 0.145814 | 26 | 0.040197 | no | ADPVSC |
chr1_967617_G_A_b38 | SAMD11 | 3.424 | 0.000681 | 0.125248 | 14 | 0.036577 | no | ADPVSC |
chr1_917584_T_G_b38 | SAMD11 | 3.385 | 0.000781 | 0.111876 | 18 | 0.033046 | no | ADPVSC |
chr1_959193_G_A_b38 | SAMD11 | 3.341 | 0.000914 | 0.144591 | 27 | 0.043281 | no | ADPVSC |
chr1_958339_G_A_b38 | SAMD11 | 3.333 | 0.000939 | 0.155179 | 6 | 0.046556 | no | ADPVSC |
chr1_961945_G_C_b38 | SAMD11 | 3.28 | 0.00113 | 0.157644 | 6 | 0.048063 | no | ADPVSC |
chr1_910958_A_G_b38 | SAMD11 | 3.263 | 0.0012 | 0.109194 | 19 | 0.03346 | no | ADPVSC |
chr1_1058607_T_C_b38 | SAMD11 | 3.24 | 0.0013 | 0.215289 | 9 | 0.066453 | no | ADPVSC |
chr1_950669_ACAG_A_b38 | SAMD11 | 3.121 | 0.00193 | 0.151407 | 5 | 0.048509 | no | ADPVSC |
chr1_960375_A_AG_b38 | SAMD11 | 3.091 | 0.00213 | 0.123235 | 26 | 0.039868 | no | ADPVSC |
chr1_911109_T_C_b38 | SAMD11 | 3.053 | 0.00242 | 0.102421 | 19 | 0.03355 | no | ADPVSC |
chr1_1587222_G_GT_b38 | SAMD11 | 3.045 | 0.00248 | 0.088271 | 35 | 0.02899 | no | ADPVSC |
chr1_1499586_C_CTT_b38 | SAMD11 | 3.031 | 0.0026 | 0.118507 | 13 | 0.0391 | no | ADPVSC |
chr1_108545_C_CAA_b38 | SAMD11 | 3.017 | 0.00272 | 0.199218 | 4 | 0.066034 | no | ADPVSC |
chr1_1725105_T_C_b38 | SAMD11 | 2.964 | 0.00321 | 0.224081 | 6 | 0.075589 | no | ADPVSC |
chr1_967376_AC_A_b38 | SAMD11 | 2.841 | 0.00473 | 0.125811 | 4 | 0.044281 | no | ADPVSC |
chr1_618345_C_T_b38 | SAMD11 | 2.829 | 0.00491 | 0.206778 | 3 | 0.073096 | no | ADPVSC |
chr1_1591419_A_G_b38 | SAMD11 | 2.788 | 0.00556 | 0.097793 | 13 | 0.035079 | no | ADPVSC |
chr1_928252_C_T_b38 | SAMD11 | -2.774 | 0.00581 | -0.121617 | 18 | 0.043848 | no | ADPVSC |
chr1_1070689_G_A_b38 | SAMD11 | 2.76 | 0.00605 | 0.12066 | 3 | 0.04372 | no | ADPVSC |
chr1_1059337_A_G_b38 | SAMD11 | 2.756 | 0.00611 | 0.190302 | 9 | 0.069039 | no | ADPVSC |
chr1_949046_A_AACAGCAAAG_b38 | SAMD11 | 2.749 | 0.00625 | 0.139491 | 4 | 0.05074 | no | ADPVSC |
chr1_507505_G_A_b38 | SAMD11 | 2.712 | 0.00697 | 0.1278 | 3 | 0.047121 | no | ADPVSC |
chr1_966179_G_A_b38 | SAMD11 | 2.695 | 0.00734 | 0.11936 | 22 | 0.044294 | no | ADPVSC |
chr1_1608244_T_C_b38 | SAMD11 | 2.674 | 0.00781 | 0.079699 | 34 | 0.029808 | no | ADPVSC |
chr1_1022587_T_TTGTAGTCTGACCTGTGGTCTGAC_b38 | SAMD11 | 2.651 | 0.00834 | 0.212044 | 5 | 0.079976 | no | ADPVSC |
chr1_128274_A_C_b38 | SAMD11 | -3.383 | 0.00087 | -0.180318 | 4 | 0.053304 | yes | ADRNLG |
chr1_173098_C_T_b38 | SAMD11 | -3.112 | 0.00214 | -0.086776 | 42 | 0.027882 | yes | ADRNLG |
chr1_1437993_G_A_b38 | SAMD11 | 2.998 | 0.00308 | 0.110049 | 11 | 0.036707 | yes | ADRNLG |
chr1_13684_C_T_b38 | SAMD11 | 2.819 | 0.00532 | 0.107131 | 5 | 0.038004 | yes | ADRNLG |
chr1_611010_A_G_b38 | SAMD11 | -2.645 | 0.00886 | -0.135342 | 3 | 0.051178 | yes | ADRNLG |
chr1_861387_G_A_b38 | SAMD11 | 3.522 | 0.000535 | 0.135707 | 21 | 0.038529 | no | ADRNLG |
chr1_111735_C_A_b38 | SAMD11 | -3.277 | 0.00124 | -0.112966 | 14 | 0.03447 | no | ADRNLG |
chr1_127972_G_A_b38 | SAMD11 | -3.043 | 0.00267 | -0.147569 | 5 | 0.048495 | no | ADRNLG |
chr1_1228094_A_G_b38 | SAMD11 | -2.919 | 0.00393 | -0.146147 | 3 | 0.050061 | no | ADRNLG |
chr1_1904424_A_AAAATAAATAAATAAAT_b38 | SAMD11 | 2.846 | 0.00491 | 0.132932 | 4 | 0.046715 | no | ADRNLG |
chr1_133483_G_T_b38 | SAMD11 | -2.752 | 0.00648 | -0.090304 | 21 | 0.032808 | no | ADRNLG |
chr1_591638_G_A_b38 | SAMD11 | 2.677 | 0.00806 | 0.121022 | 3 | 0.045202 | no | ADRNLG |
chr1_505074_C_T_b38 | SAMD11 | -2.67 | 0.00824 | -0.093377 | 15 | 0.034977 | no | ADRNLG |
chr1_643358_G_A_b38 | SAMD11 | 3.758 | 0.000204 | 0.203272 | 9 | 0.054092 | yes | ARTAORT |
chr1_1170732_A_G_b38 | SAMD11 | 3.242 | 0.00132 | 0.302752 | 18 | 0.093396 | yes | ARTAORT |
chr1_1606536_GCT_G_b38 | SAMD11 | -3.001 | 0.0029 | -0.099276 | 24 | 0.033081 | yes | ARTAORT |
chr1_1597462_C_T_b38 | SAMD11 | -2.97 | 0.00321 | -0.10064 | 27 | 0.033885 | yes | ARTAORT |
chr1_1606539_G_GCC_b38 | SAMD11 | -2.968 | 0.00323 | -0.098609 | 24 | 0.033226 | yes | ARTAORT |
chr1_1606532_G_A_b38 | SAMD11 | -2.925 | 0.0037 | -0.097005 | 24 | 0.033168 | yes | ARTAORT |
chr1_642930_G_C_b38 | SAMD11 | 2.884 | 0.0042 | 0.148868 | 12 | 0.051621 | yes | ARTAORT |
chr1_1606552_A_G_b38 | SAMD11 | -2.801 | 0.00541 | -0.086324 | 33 | 0.030822 | yes | ARTAORT |
chr1_455017_T_C_b38 | SAMD11 | -2.746 | 0.00637 | -0.153936 | 4 | 0.05605 | yes | ARTAORT |
chr1_129477_T_G_b38 | SAMD11 | 2.694 | 0.00744 | 0.100639 | 8 | 0.037356 | yes | ARTAORT |
chr1_1587082_G_A_b38 | SAMD11 | -2.679 | 0.00776 | -0.107901 | 9 | 0.04027 | yes | ARTAORT |
chr1_1592572_T_C_b38 | SAMD11 | -2.656 | 0.00831 | -0.082603 | 44 | 0.0311 | yes | ARTAORT |
chr1_591463_G_A_b38 | SAMD11 | 2.625 | 0.00908 | 0.114783 | 5 | 0.043725 | yes | ARTAORT |
chr1_1662933_T_A_b38 | SAMD11 | -2.598 | 0.0098 | -0.074936 | 44 | 0.028839 | yes | ARTAORT |
chr1_1877316_A_AATATAT_b38 | SAMD11 | 3.285 | 0.00113 | 0.22386 | 3 | 0.068147 | no | ARTAORT |
chr1_1602507_C_A_b38 | SAMD11 | -3.112 | 0.00203 | -0.091035 | 42 | 0.029254 | no | ARTAORT |
chr1_1602666_G_A_b38 | SAMD11 | -3.029 | 0.00265 | -0.088762 | 42 | 0.029299 | no | ARTAORT |
chr1_638771_A_T_b38 | SAMD11 | 3.016 | 0.00277 | 0.155303 | 9 | 0.051489 | no | ARTAORT |
chr1_1613330_A_AT_b38 | SAMD11 | -2.841 | 0.00478 | -0.087582 | 38 | 0.030823 | no | ARTAORT |
chr1_1725105_T_C_b38 | SAMD11 | 2.816 | 0.00516 | 0.211464 | 6 | 0.075088 | no | ARTAORT |
chr1_1609070_G_A_b38 | SAMD11 | -2.774 | 0.00586 | -0.082085 | 51 | 0.029589 | no | ARTAORT |
chr1_1610924_C_T_b38 | SAMD11 | -2.773 | 0.00588 | -0.083052 | 50 | 0.029945 | no | ARTAORT |
chr1_1618118_G_A_b38 | SAMD11 | -2.733 | 0.00663 | -0.082271 | 49 | 0.030103 | no | ARTAORT |
chr1_1836856_CT_C_b38 | SAMD11 | -2.69 | 0.00753 | -0.100362 | 14 | 0.037313 | no | ARTAORT |
chr1_1608603_C_A_b38 | SAMD11 | -2.628 | 0.009 | -0.078486 | 50 | 0.029863 | no | ARTAORT |
chr1_1624720_G_A_b38 | SAMD11 | -2.608 | 0.00955 | -0.07917 | 48 | 0.030361 | no | ARTAORT |
chr1_1613090_A_G_b38 | SAMD11 | -2.592 | 0.00999 | -0.078056 | 49 | 0.030115 | no | ARTAORT |
chr1_1692900_G_GTT_b38 | SAMD11 | -4.145 | 5.33e-05 | -0.232506 | 8 | 0.056094 | yes | ARTCRN |
chr1_969663_CAT_C_b38 | SAMD11 | 2.647 | 0.00888 | 0.125144 | 15 | 0.047279 | yes | ARTCRN |
chr1_280592_T_C_b38 | SAMD11 | 2.647 | 0.00888 | 0.138431 | 9 | 0.052305 | yes | ARTCRN |
chr1_633887_G_A_b38 | SAMD11 | 2.641 | 0.00902 | 0.144222 | 9 | 0.054603 | yes | ARTCRN |
chr1_1804004_G_A_b38 | SAMD11 | 3.101 | 0.00225 | 0.106492 | 24 | 0.034338 | no | ARTCRN |
chr1_1546845_A_AAAC_b38 | SAMD11 | -3.042 | 0.00272 | -0.186221 | 8 | 0.061213 | no | ARTCRN |
chr1_958061_C_CT_b38 | SAMD11 | 2.959 | 0.00352 | 0.179782 | 10 | 0.06075 | no | ARTCRN |
chr1_1113913_C_CT_b38 | SAMD11 | 2.959 | 0.00352 | 0.238312 | 4 | 0.080538 | no | ARTCRN |
chr1_128798_C_T_b38 | SAMD11 | -2.804 | 0.00562 | -0.274639 | 3 | 0.097939 | no | ARTCRN |
chr1_1251356_AT_A_b38 | SAMD11 | 2.803 | 0.00565 | 0.154232 | 7 | 0.055025 | no | ARTCRN |
chr1_286272_A_G_b38 | SAMD11 | 2.733 | 0.00693 | 0.122403 | 21 | 0.044787 | no | ARTCRN |
chr1_1650688_T_A_b38 | SAMD11 | 3.325 | 0.000946 | 0.092082 | 40 | 0.027691 | yes | ARTTBL |
chr1_1102614_T_TA_b38 | SAMD11 | 3.183 | 0.00154 | 0.138575 | 21 | 0.043531 | yes | ARTTBL |
chr1_1641642_T_C_b38 | SAMD11 | 3.139 | 0.00179 | 0.086152 | 53 | 0.027444 | yes | ARTTBL |
chr1_1652913_C_T_b38 | SAMD11 | 3.1 | 0.00204 | 0.084959 | 40 | 0.027404 | yes | ARTTBL |
chr1_1147779_G_A_b38 | SAMD11 | 3.072 | 0.00224 | 0.088549 | 25 | 0.028827 | yes | ARTTBL |
chr1_1002192_A_AT_b38 | SAMD11 | 3.032 | 0.00255 | 0.109866 | 7 | 0.036238 | yes | ARTTBL |
chr1_1028565_T_C_b38 | SAMD11 | -3.01 | 0.00274 | -0.237362 | 3 | 0.078855 | yes | ARTTBL |
chr1_1874605_TA_T_b38 | SAMD11 | -2.95 | 0.00333 | -0.122184 | 16 | 0.041422 | yes | ARTTBL |
chr1_1747690_A_G_b38 | SAMD11 | -2.893 | 0.00398 | -0.172377 | 8 | 0.059593 | yes | ARTTBL |
chr1_1823242_G_GAA_b38 | SAMD11 | 2.881 | 0.00413 | 0.190697 | 5 | 0.066195 | yes | ARTTBL |
chr1_1742119_C_CA_b38 | SAMD11 | -2.856 | 0.00447 | -0.172556 | 7 | 0.060426 | yes | ARTTBL |
chr1_1650383_G_T_b38 | SAMD11 | 2.829 | 0.00485 | 0.07748 | 43 | 0.027385 | yes | ARTTBL |
chr1_1124795_T_C_b38 | SAMD11 | 2.821 | 0.00497 | 0.070185 | 142 | 0.024877 | yes | ARTTBL |
chr1_928622_G_C_b38 | SAMD11 | -2.812 | 0.00512 | -0.082312 | 24 | 0.029275 | yes | ARTTBL |
chr1_101895_G_A_b38 | SAMD11 | -2.8 | 0.00531 | -0.07936 | 40 | 0.028345 | yes | ARTTBL |
chr1_1470425_C_CTT_b38 | SAMD11 | 2.771 | 0.00578 | 0.122995 | 17 | 0.044379 | yes | ARTTBL |
chr1_1020847_C_CGG_b38 | SAMD11 | 2.77 | 0.00581 | 0.066168 | 91 | 0.023887 | yes | ARTTBL |
chr1_1427995_A_G_b38 | SAMD11 | 2.736 | 0.00644 | 0.123131 | 6 | 0.045008 | yes | ARTTBL |
chr1_969648_ACGTG_A_b38 | SAMD11 | -2.72 | 0.00675 | -0.191864 | 7 | 0.070538 | yes | ARTTBL |
chr1_269588_A_G_b38 | SAMD11 | -2.677 | 0.00766 | -0.075738 | 68 | 0.028287 | yes | ARTTBL |
chr1_1652061_T_C_b38 | SAMD11 | 2.622 | 0.00899 | 0.067318 | 55 | 0.02567 | yes | ARTTBL |
chr1_1654188_T_G_b38 | SAMD11 | 2.622 | 0.00899 | 0.067318 | 55 | 0.02567 | yes | ARTTBL |
chr1_1651137_C_T_b38 | SAMD11 | 2.616 | 0.00916 | 0.067272 | 54 | 0.025716 | yes | ARTTBL |
chr1_1651267_T_C_b38 | SAMD11 | 2.616 | 0.00916 | 0.067272 | 54 | 0.025716 | yes | ARTTBL |
chr1_1652135_C_G_b38 | SAMD11 | 2.616 | 0.00916 | 0.067272 | 54 | 0.025716 | yes | ARTTBL |
chr1_1652191_C_T_b38 | SAMD11 | 2.616 | 0.00916 | 0.067272 | 54 | 0.025716 | yes | ARTTBL |
chr1_1652592_A_G_b38 | SAMD11 | 2.616 | 0.00916 | 0.067272 | 54 | 0.025716 | yes | ARTTBL |
chr1_1652779_A_G_b38 | SAMD11 | 2.616 | 0.00916 | 0.067272 | 54 | 0.025716 | yes | ARTTBL |
chr1_1653147_A_C_b38 | SAMD11 | 2.616 | 0.00916 | 0.067272 | 54 | 0.025716 | yes | ARTTBL |
chr1_1653396_T_C_b38 | SAMD11 | 2.616 | 0.00916 | 0.067272 | 54 | 0.025716 | yes | ARTTBL |
chr1_1653472_T_C_b38 | SAMD11 | 2.616 | 0.00916 | 0.067272 | 54 | 0.025716 | yes | ARTTBL |
chr1_1653811_G_A_b38 | SAMD11 | 2.616 | 0.00916 | 0.067272 | 54 | 0.025716 | yes | ARTTBL |
chr1_1653893_C_T_b38 | SAMD11 | 2.616 | 0.00916 | 0.067272 | 54 | 0.025716 | yes | ARTTBL |
chr1_1654143_G_A_b38 | SAMD11 | 2.616 | 0.00916 | 0.067272 | 54 | 0.025716 | yes | ARTTBL |
chr1_1651785_C_A_b38 | SAMD11 | 2.592 | 0.00981 | 0.066569 | 54 | 0.02568 | yes | ARTTBL |
chr1_1657093_C_A_b38 | SAMD11 | 3.223 | 0.00135 | 0.094582 | 39 | 0.02935 | no | ARTTBL |
chr1_1641275_A_G_b38 | SAMD11 | 3.22 | 0.00136 | 0.082606 | 66 | 0.02565 | no | ARTTBL |
chr1_1657085_C_CTAA_b38 | SAMD11 | 3.203 | 0.00145 | 0.094483 | 38 | 0.029502 | no | ARTTBL |
chr1_1639348_G_T_b38 | SAMD11 | 3.149 | 0.00174 | 0.078317 | 68 | 0.024874 | no | ARTTBL |
chr1_1468313_A_G_b38 | SAMD11 | -3.108 | 0.00199 | -0.233505 | 3 | 0.075133 | no | ARTTBL |
chr1_1659060_G_A_b38 | SAMD11 | 3.057 | 0.00235 | 0.082037 | 44 | 0.026837 | no | ARTTBL |
chr1_797421_A_G_b38 | SAMD11 | -3.014 | 0.00271 | -0.214273 | 4 | 0.071101 | no | ARTTBL |
chr1_1127861_G_T_b38 | SAMD11 | -3.012 | 0.00272 | -0.072925 | 142 | 0.024212 | no | ARTTBL |
chr1_1663513_C_T_b38 | SAMD11 | 2.994 | 0.00289 | 0.173351 | 14 | 0.057906 | no | ARTTBL |
chr1_1124975_G_C_b38 | SAMD11 | 2.937 | 0.00346 | 0.069894 | 81 | 0.023798 | no | ARTTBL |
chr1_1659940_A_C_b38 | SAMD11 | 2.896 | 0.00394 | 0.09289 | 16 | 0.032076 | no | ARTTBL |
chr1_1657081_C_T_b38 | SAMD11 | 2.886 | 0.00406 | 0.083858 | 38 | 0.029056 | no | ARTTBL |
chr1_1660408_T_C_b38 | SAMD11 | 2.861 | 0.00439 | 0.087493 | 15 | 0.030579 | no | ARTTBL |
chr1_1648636_G_A_b38 | SAMD11 | 2.859 | 0.00442 | 0.072762 | 65 | 0.025446 | no | ARTTBL |
chr1_1668721_C_T_b38 | SAMD11 | 2.858 | 0.00443 | 0.077797 | 42 | 0.027219 | no | ARTTBL |
chr1_1648826_A_G_b38 | SAMD11 | 2.836 | 0.00475 | 0.071881 | 65 | 0.025345 | no | ARTTBL |
chr1_665220_T_C_b38 | SAMD11 | -2.818 | 0.00502 | -0.212787 | 4 | 0.075504 | no | ARTTBL |
chr1_929839_G_A_b38 | SAMD11 | -2.796 | 0.00536 | -0.081987 | 24 | 0.029319 | no | ARTTBL |
chr1_1725745_C_G_b38 | SAMD11 | 2.778 | 0.00567 | 0.079658 | 39 | 0.028674 | no | ARTTBL |
chr1_1497741_CTG_C_b38 | SAMD11 | -2.735 | 0.00646 | -0.155497 | 20 | 0.056864 | no | ARTTBL |
chr1_1290851_G_A_b38 | SAMD11 | 2.696 | 0.00726 | 0.203266 | 3 | 0.075407 | no | ARTTBL |
chr1_932255_C_T_b38 | SAMD11 | -2.689 | 0.0074 | -0.07886 | 24 | 0.029325 | no | ARTTBL |
chr1_1641261_C_T_b38 | SAMD11 | 2.689 | 0.00741 | 0.083104 | 25 | 0.030911 | no | ARTTBL |
chr1_1111365_CA_C_b38 | SAMD11 | 2.658 | 0.00811 | 0.08242 | 19 | 0.031011 | no | ARTTBL |
chr1_1639685_G_A_b38 | SAMD11 | 2.632 | 0.00875 | 0.076966 | 30 | 0.029246 | no | ARTTBL |
chr1_1722690_TA_T_b38 | SAMD11 | 2.617 | 0.00912 | 0.101668 | 4 | 0.038844 | no | ARTTBL |
chr1_19391_G_A_b38 | SAMD11 | -2.607 | 0.00941 | -0.117886 | 5 | 0.045223 | no | ARTTBL |
chr1_799082_G_A_b38 | SAMD11 | 2.601 | 0.00955 | 0.089592 | 12 | 0.034439 | no | ARTTBL |
chr1_966227_C_G_b38 | SAMD11 | 2.597 | 0.00968 | 0.114212 | 13 | 0.04398 | no | ARTTBL |
chr1_1605732_C_T_b38 | SAMD11 | 3.875 | 0.000188 | 0.192159 | 4 | 0.049591 | yes | BRNAMY |
chr1_1000079_A_G_b38 | SAMD11 | -3.819 | 0.000229 | -0.154059 | 5 | 0.040338 | yes | BRNAMY |
chr1_1000112_G_T_b38 | SAMD11 | -3.819 | 0.000229 | -0.154059 | 5 | 0.040338 | yes | BRNAMY |
chr1_1000453_C_G_b38 | SAMD11 | -3.819 | 0.000229 | -0.154059 | 5 | 0.040338 | yes | BRNAMY |
chr1_1000814_A_G_b38 | SAMD11 | -3.819 | 0.000229 | -0.154059 | 5 | 0.040338 | yes | BRNAMY |
chr1_63671_G_A_b38 | SAMD11 | 3.512 | 0.000662 | 0.142863 | 5 | 0.040679 | yes | BRNAMY |
chr1_1236303_A_G_b38 | SAMD11 | -3.462 | 0.000782 | -0.146074 | 4 | 0.042193 | yes | BRNAMY |
chr1_1000830_C_A_b38 | SAMD11 | -3.334 | 0.00119 | -0.132838 | 3 | 0.039842 | yes | BRNAMY |
chr1_1448915_G_A_b38 | SAMD11 | -3.326 | 0.00122 | -0.132054 | 13 | 0.039704 | yes | BRNAMY |
chr1_63697_T_C_b38 | SAMD11 | 3.283 | 0.0014 | 0.12662 | 7 | 0.038568 | yes | BRNAMY |
chr1_1750632_G_A_b38 | SAMD11 | -3.275 | 0.00144 | -0.1328 | 15 | 0.040546 | yes | BRNAMY |
chr1_1773676_TTG_T_b38 | SAMD11 | -3.214 | 0.00175 | -0.153898 | 4 | 0.047881 | yes | BRNAMY |
chr1_1449009_A_T_b38 | SAMD11 | -3.156 | 0.0021 | -0.147531 | 9 | 0.046747 | yes | BRNAMY |
chr1_1013855_G_A_b38 | SAMD11 | -3.135 | 0.00224 | -0.214469 | 3 | 0.068421 | yes | BRNAMY |
chr1_1882426_CAAAAA_C_b38 | SAMD11 | 3.135 | 0.00224 | 0.13413 | 6 | 0.042791 | yes | BRNAMY |
chr1_58814_G_A_b38 | SAMD11 | 3.112 | 0.00241 | 0.145507 | 4 | 0.046759 | yes | BRNAMY |
chr1_1013466_T_TA_b38 | SAMD11 | -3.102 | 0.00248 | -0.244766 | 3 | 0.078909 | yes | BRNAMY |
chr1_1028320_GCC_G_b38 | SAMD11 | -3.093 | 0.00255 | -0.109325 | 29 | 0.035343 | yes | BRNAMY |
chr1_1225476_T_C_b38 | SAMD11 | -3.085 | 0.00261 | -0.142674 | 4 | 0.046248 | yes | BRNAMY |
chr1_1226013_C_T_b38 | SAMD11 | -3.085 | 0.00261 | -0.142674 | 4 | 0.046248 | yes | BRNAMY |
chr1_1664300_T_C_b38 | SAMD11 | 3.076 | 0.00269 | 0.128434 | 4 | 0.041756 | yes | BRNAMY |
chr1_1009731_C_T_b38 | SAMD11 | -3.074 | 0.00271 | -0.231525 | 3 | 0.075324 | yes | BRNAMY |
chr1_1522693_A_G_b38 | SAMD11 | 3.038 | 0.00302 | 0.129509 | 4 | 0.042635 | yes | BRNAMY |
chr1_1222580_T_C_b38 | SAMD11 | -3.006 | 0.00332 | -0.143145 | 3 | 0.047616 | yes | BRNAMY |
chr1_1222594_A_G_b38 | SAMD11 | -3.006 | 0.00332 | -0.143145 | 3 | 0.047616 | yes | BRNAMY |
chr1_1223644_C_T_b38 | SAMD11 | -3.006 | 0.00332 | -0.143145 | 3 | 0.047616 | yes | BRNAMY |
chr1_998762_A_AGGGGAGG_b38 | SAMD11 | -2.974 | 0.00366 | -0.09172 | 23 | 0.030841 | yes | BRNAMY |
chr1_1361679_G_A_b38 | SAMD11 | 2.937 | 0.00408 | 0.115018 | 8 | 0.039157 | yes | BRNAMY |
chr1_55131_A_G_b38 | SAMD11 | 2.92 | 0.0043 | 0.141591 | 4 | 0.048484 | yes | BRNAMY |
chr1_60351_A_G_b38 | SAMD11 | 2.905 | 0.00449 | 0.14068 | 4 | 0.04842 | yes | BRNAMY |
chr1_1010232_C_T_b38 | SAMD11 | -2.849 | 0.00529 | -0.20503 | 3 | 0.07196 | yes | BRNAMY |
chr1_56381_T_C_b38 | SAMD11 | 2.803 | 0.00605 | 0.135814 | 4 | 0.048457 | yes | BRNAMY |
chr1_1235602_C_A_b38 | SAMD11 | -2.801 | 0.00609 | -0.126791 | 3 | 0.045268 | yes | BRNAMY |
chr1_1011654_G_A_b38 | SAMD11 | -2.776 | 0.00654 | -0.18915 | 4 | 0.068145 | yes | BRNAMY |
chr1_1226486_C_T_b38 | SAMD11 | -2.759 | 0.00687 | -0.124242 | 3 | 0.04504 | yes | BRNAMY |
chr1_939779_AGCCAGTGGACGCCGACCT_A_b38 | SAMD11 | -2.736 | 0.00732 | -0.095719 | 21 | 0.03498 | yes | BRNAMY |
chr1_1316929_A_T_b38 | SAMD11 | -2.695 | 0.00821 | -0.11737 | 3 | 0.043544 | yes | BRNAMY |
chr1_1288085_GC_G_b38 | SAMD11 | -2.669 | 0.00884 | -0.119485 | 3 | 0.044769 | yes | BRNAMY |
chr1_1437993_G_A_b38 | SAMD11 | -2.659 | 0.00909 | -0.107854 | 6 | 0.040565 | yes | BRNAMY |
chr1_1582992_C_CT_b38 | SAMD11 | 2.653 | 0.00925 | 0.087836 | 17 | 0.033114 | yes | BRNAMY |
chr1_1015950_G_A_b38 | SAMD11 | -2.637 | 0.00967 | -0.155132 | 5 | 0.058834 | yes | BRNAMY |
chr1_1217733_G_A_b38 | SAMD11 | -2.629 | 0.00987 | -0.116335 | 4 | 0.04425 | yes | BRNAMY |
chr1_995543_A_G_b38 | SAMD11 | -3.816 | 0.000231 | -0.1481 | 4 | 0.038807 | no | BRNAMY |
chr1_1235642_G_C_b38 | SAMD11 | -3.558 | 0.000567 | -0.153312 | 3 | 0.043094 | no | BRNAMY |
chr1_1246371_T_C_b38 | SAMD11 | -3.468 | 0.000766 | -0.150676 | 6 | 0.043447 | no | BRNAMY |
chr1_1238902_T_C_b38 | SAMD11 | -3.4 | 0.000961 | -0.121329 | 17 | 0.035689 | no | BRNAMY |
chr1_1223568_A_G_b38 | SAMD11 | -3.37 | 0.00106 | -0.156142 | 4 | 0.046338 | no | BRNAMY |
chr1_1251285_G_A_b38 | SAMD11 | -3.37 | 0.00106 | -0.149391 | 5 | 0.044336 | no | BRNAMY |
chr1_1251368_T_C_b38 | SAMD11 | -3.37 | 0.00106 | -0.149391 | 5 | 0.044336 | no | BRNAMY |
chr1_1238231_G_A_b38 | SAMD11 | -3.232 | 0.00165 | -0.125944 | 8 | 0.03897 | no | BRNAMY |
chr1_1482316_C_G_b38 | SAMD11 | -3.216 | 0.00174 | -0.117055 | 9 | 0.036399 | no | BRNAMY |
chr1_1014545_C_T_b38 | SAMD11 | -3.187 | 0.0019 | -0.211957 | 3 | 0.066508 | no | BRNAMY |
chr1_1361685_C_T_b38 | SAMD11 | -3.182 | 0.00193 | -0.129698 | 6 | 0.040757 | no | BRNAMY |
chr1_1249880_A_G_b38 | SAMD11 | -3.165 | 0.00204 | -0.131389 | 7 | 0.041515 | no | BRNAMY |
chr1_1251122_A_T_b38 | SAMD11 | -3.165 | 0.00204 | -0.131389 | 7 | 0.041515 | no | BRNAMY |
chr1_1228424_C_T_b38 | SAMD11 | -3.14 | 0.00221 | -0.129944 | 4 | 0.041388 | no | BRNAMY |
chr1_1229369_G_GC_b38 | SAMD11 | -3.14 | 0.00221 | -0.125744 | 6 | 0.040052 | no | BRNAMY |
chr1_1244603_G_A_b38 | SAMD11 | -3.109 | 0.00243 | -0.143388 | 3 | 0.046117 | no | BRNAMY |
chr1_1221049_C_G_b38 | SAMD11 | -3.073 | 0.00272 | -0.115932 | 15 | 0.037731 | no | BRNAMY |
chr1_1007325_A_G_b38 | SAMD11 | -3.069 | 0.00275 | -0.295894 | 3 | 0.096425 | no | BRNAMY |
chr1_1240684_G_GCCGCCCCCATTCACCCCGGCCGTGGTCCCTGCCCCAGCCCCCA_b38 | SAMD11 | -3.053 | 0.00288 | -0.191683 | 4 | 0.062787 | no | BRNAMY |
chr1_1157285_CCCCGCCCCCAGCCCACCCAT_C_b38 | SAMD11 | 3.049 | 0.00292 | 0.095307 | 15 | 0.031255 | no | BRNAMY |
chr1_1231507_T_C_b38 | SAMD11 | -3.035 | 0.00305 | -0.125962 | 4 | 0.041502 | no | BRNAMY |
chr1_1220377_C_T_b38 | SAMD11 | -3.01 | 0.00329 | -0.184314 | 5 | 0.06124 | no | BRNAMY |
chr1_1243102_A_G_b38 | SAMD11 | -3.007 | 0.00331 | -0.136276 | 4 | 0.045319 | no | BRNAMY |
chr1_1251618_G_A_b38 | SAMD11 | -3.007 | 0.00331 | -0.136276 | 4 | 0.045319 | no | BRNAMY |
chr1_1215852_T_C_b38 | SAMD11 | -2.984 | 0.00355 | -0.125052 | 5 | 0.041902 | no | BRNAMY |
chr1_1216593_G_C_b38 | SAMD11 | -2.972 | 0.00369 | -0.125478 | 5 | 0.042227 | no | BRNAMY |
chr1_1191757_A_C_b38 | SAMD11 | -2.965 | 0.00376 | -0.143261 | 3 | 0.048322 | no | BRNAMY |
chr1_1219858_G_A_b38 | SAMD11 | -2.958 | 0.00384 | -0.122553 | 7 | 0.041429 | no | BRNAMY |
chr1_1243650_G_A_b38 | SAMD11 | -2.898 | 0.00459 | -0.131415 | 3 | 0.045353 | no | BRNAMY |
chr1_1240580_G_GC_b38 | SAMD11 | -2.891 | 0.00468 | -0.136796 | 3 | 0.047312 | no | BRNAMY |
chr1_1411323_A_C_b38 | SAMD11 | -2.834 | 0.00553 | -0.10828 | 14 | 0.038205 | no | BRNAMY |
chr1_1188054_T_A_b38 | SAMD11 | -2.817 | 0.00581 | -0.118926 | 5 | 0.042214 | no | BRNAMY |
chr1_1201373_T_C_b38 | SAMD11 | -2.787 | 0.00634 | -0.1127 | 11 | 0.04044 | no | BRNAMY |
chr1_1258206_AT_A_b38 | SAMD11 | -2.772 | 0.00661 | -0.105674 | 14 | 0.038118 | no | BRNAMY |
chr1_1497741_CTG_C_b38 | SAMD11 | -2.761 | 0.00683 | -0.232018 | 4 | 0.084045 | no | BRNAMY |
chr1_1437955_C_G_b38 | SAMD11 | -2.721 | 0.00764 | -0.105237 | 9 | 0.038672 | no | BRNAMY |
chr1_1013312_G_A_b38 | SAMD11 | -2.716 | 0.00776 | -0.204309 | 3 | 0.075238 | no | BRNAMY |
chr1_1477677_TTTTTA_T_b38 | SAMD11 | -2.71 | 0.00788 | -0.227443 | 3 | 0.083924 | no | BRNAMY |
chr1_1308516_C_T_b38 | SAMD11 | 2.683 | 0.0085 | 0.101539 | 15 | 0.037843 | no | BRNAMY |
chr1_1312114_T_C_b38 | SAMD11 | 2.683 | 0.0085 | 0.101539 | 15 | 0.037843 | no | BRNAMY |
chr1_1330125_G_A_b38 | SAMD11 | 2.683 | 0.0085 | 0.101539 | 15 | 0.037843 | no | BRNAMY |
chr1_1196201_T_C_b38 | SAMD11 | -2.653 | 0.00923 | -0.099652 | 12 | 0.037555 | no | BRNAMY |
chr1_1197893_T_C_b38 | SAMD11 | -2.653 | 0.00923 | -0.099652 | 12 | 0.037555 | no | BRNAMY |
chr1_1198407_T_C_b38 | SAMD11 | -2.653 | 0.00923 | -0.099652 | 12 | 0.037555 | no | BRNAMY |
chr1_1198435_T_C_b38 | SAMD11 | -2.653 | 0.00923 | -0.099652 | 12 | 0.037555 | no | BRNAMY |
chr1_1308178_GGGGCGCGGGGA_G_b38 | SAMD11 | -2.65 | 0.00931 | -0.114169 | 4 | 0.043079 | no | BRNAMY |
chr1_1309988_G_A_b38 | SAMD11 | 2.65 | 0.00932 | 0.099111 | 15 | 0.0374 | no | BRNAMY |
chr1_1313807_G_A_b38 | SAMD11 | 2.65 | 0.00932 | 0.099111 | 15 | 0.0374 | no | BRNAMY |
chr1_1479719_T_C_b38 | SAMD11 | -2.634 | 0.00974 | -0.113397 | 12 | 0.04305 | no | BRNAMY |
chr1_1358384_G_C_b38 | SAMD11 | 2.632 | 0.00981 | 0.09826 | 14 | 0.037339 | no | BRNAMY |
chr1_128798_C_T_b38 | SAMD11 | -5.264 | 6.2e-07 | -0.274814 | 3 | 0.052207 | yes | BRNACC |
chr1_1002417_T_A_b38 | SAMD11 | 4.03 | 9.78e-05 | 0.101708 | 12 | 0.025236 | yes | BRNACC |
chr1_1002415_CT_C_b38 | SAMD11 | 3.894 | 0.000162 | 0.096508 | 13 | 0.024784 | yes | BRNACC |
chr1_1607341_CTT_C_b38 | SAMD11 | 3.404 | 9e-04 | 0.091768 | 13 | 0.026957 | yes | BRNACC |
chr1_1434687_C_G_b38 | SAMD11 | -3.033 | 0.00296 | -0.081535 | 7 | 0.026879 | yes | BRNACC |
chr1_1370553_CA_C_b38 | SAMD11 | 3.014 | 0.00314 | 0.072772 | 32 | 0.024146 | yes | BRNACC |
chr1_1430908_A_G_b38 | SAMD11 | -2.99 | 0.00338 | -0.075484 | 18 | 0.025242 | yes | BRNACC |
chr1_1435945_C_CCGGGCGGGGGCG_b38 | SAMD11 | -2.967 | 0.00363 | -0.080701 | 7 | 0.0272 | yes | BRNACC |
chr1_1851414_GA_G_b38 | SAMD11 | -2.948 | 0.00383 | -0.074268 | 13 | 0.025189 | yes | BRNACC |
chr1_908690_A_AGAGGGGACAAGTGG_b38 | SAMD11 | -2.93 | 0.00406 | -0.072664 | 15 | 0.024803 | yes | BRNACC |
chr1_1426261_C_T_b38 | SAMD11 | -2.922 | 0.00415 | -0.074614 | 17 | 0.025537 | yes | BRNACC |
chr1_1426810_C_G_b38 | SAMD11 | -2.922 | 0.00415 | -0.074614 | 17 | 0.025537 | yes | BRNACC |
chr1_1428969_T_C_b38 | SAMD11 | -2.9 | 0.00443 | -0.072785 | 18 | 0.025095 | yes | BRNACC |
chr1_1020681_A_AG_b38 | SAMD11 | 2.853 | 0.0051 | 0.068722 | 15 | 0.024087 | yes | BRNACC |
chr1_1020697_C_T_b38 | SAMD11 | 2.853 | 0.0051 | 0.068722 | 15 | 0.024087 | yes | BRNACC |
chr1_1120024_C_CA_b38 | SAMD11 | 2.853 | 0.0051 | 0.136857 | 3 | 0.047971 | yes | BRNACC |
chr1_1430190_A_C_b38 | SAMD11 | -2.851 | 0.00513 | -0.071873 | 18 | 0.02521 | yes | BRNACC |
chr1_1431450_A_G_b38 | SAMD11 | -2.851 | 0.00513 | -0.071873 | 18 | 0.02521 | yes | BRNACC |
chr1_1431537_G_C_b38 | SAMD11 | -2.851 | 0.00513 | -0.071873 | 18 | 0.02521 | yes | BRNACC |
chr1_1442793_G_A_b38 | SAMD11 | -2.79 | 0.00613 | -0.07518 | 8 | 0.02695 | yes | BRNACC |
chr1_1021740_G_C_b38 | SAMD11 | 2.787 | 0.00619 | 0.065705 | 17 | 0.02358 | yes | BRNACC |
chr1_1433374_T_C_b38 | SAMD11 | -2.777 | 0.00636 | -0.065667 | 22 | 0.023649 | yes | BRNACC |
chr1_1431026_CCACCCCCT_C_b38 | SAMD11 | -2.758 | 0.00671 | -0.074916 | 10 | 0.027159 | yes | BRNACC |
chr1_919695_C_G_b38 | SAMD11 | -2.708 | 0.00775 | -0.066391 | 20 | 0.024518 | yes | BRNACC |
chr1_1440430_C_G_b38 | SAMD11 | -2.707 | 0.00777 | -0.06583 | 15 | 0.024317 | yes | BRNACC |
chr1_1437993_G_A_b38 | SAMD11 | -2.679 | 0.00842 | -0.066469 | 10 | 0.024813 | yes | BRNACC |
chr1_1439805_G_C_b38 | SAMD11 | -2.677 | 0.00846 | -0.071455 | 9 | 0.026691 | yes | BRNACC |
chr1_1431813_G_T_b38 | SAMD11 | -2.671 | 0.0086 | -0.073255 | 7 | 0.027426 | yes | BRNACC |
chr1_799082_G_A_b38 | SAMD11 | 2.632 | 0.00958 | 0.083604 | 5 | 0.03176 | yes | BRNACC |
chr1_1290968_C_G_b38 | SAMD11 | -3.267 | 0.00142 | -0.103823 | 10 | 0.031782 | no | BRNACC |
chr1_1438102_G_C_b38 | SAMD11 | -2.829 | 0.00547 | -0.072334 | 10 | 0.025572 | no | BRNACC |
chr1_1835922_G_GA_b38 | SAMD11 | 2.773 | 0.00643 | 0.109345 | 4 | 0.039431 | no | BRNACC |
chr1_1292284_TTGAG_T_b38 | SAMD11 | -2.749 | 0.00689 | -0.090081 | 6 | 0.032767 | no | BRNACC |
chr1_911220_CT_C_b38 | SAMD11 | -2.74 | 0.00708 | -0.083944 | 4 | 0.030641 | no | BRNACC |
chr1_1005429_C_CA_b38 | SAMD11 | 2.732 | 0.00723 | 0.062689 | 24 | 0.022942 | no | BRNACC |
chr1_1005904_C_T_b38 | SAMD11 | 2.732 | 0.00723 | 0.062689 | 24 | 0.022942 | no | BRNACC |
chr1_1005954_G_A_b38 | SAMD11 | 2.732 | 0.00723 | 0.062689 | 24 | 0.022942 | no | BRNACC |
chr1_1440834_C_G_b38 | SAMD11 | -2.726 | 0.00736 | -0.064887 | 20 | 0.023804 | no | BRNACC |
chr1_914991_G_T_b38 | SAMD11 | -2.725 | 0.00738 | -0.068641 | 23 | 0.025186 | no | BRNACC |
chr1_911109_T_C_b38 | SAMD11 | -2.721 | 0.00746 | -0.08497 | 4 | 0.031223 | no | BRNACC |
chr1_909903_G_T_b38 | SAMD11 | -2.721 | 0.00747 | -0.081808 | 5 | 0.030068 | no | BRNACC |
chr1_910958_A_G_b38 | SAMD11 | -2.669 | 0.00865 | -0.083118 | 4 | 0.03114 | no | BRNACC |
chr1_1004625_A_G_b38 | SAMD11 | 2.627 | 0.00972 | 0.061875 | 24 | 0.023552 | no | BRNACC |
chr1_1022518_G_T_b38 | SAMD11 | 2.624 | 0.00981 | 0.060823 | 19 | 0.023179 | no | BRNACC |
chr1_1000830_C_A_b38 | SAMD11 | 3.248 | 0.00143 | 0.109244 | 6 | 0.033639 | yes | BRNCDT |
chr1_931513_T_C_b38 | SAMD11 | 3.143 | 0.00201 | 0.086579 | 38 | 0.02755 | yes | BRNCDT |
chr1_995543_A_G_b38 | SAMD11 | 3.121 | 0.00216 | 0.103711 | 7 | 0.033234 | yes | BRNCDT |
chr1_1011654_G_A_b38 | SAMD11 | 3.039 | 0.00279 | 0.175608 | 5 | 0.057781 | yes | BRNCDT |
chr1_1010481_ATTAT_A_b38 | SAMD11 | 2.967 | 0.0035 | 0.170347 | 4 | 0.057422 | yes | BRNCDT |
chr1_921096_A_G_b38 | SAMD11 | -2.849 | 0.00499 | -0.082295 | 34 | 0.028886 | yes | BRNCDT |
chr1_1002415_C_CATT_b38 | SAMD11 | 2.838 | 0.00516 | 0.155738 | 5 | 0.054881 | yes | BRNCDT |
chr1_1000453_C_G_b38 | SAMD11 | 2.834 | 0.00522 | 0.095792 | 12 | 0.033806 | yes | BRNCDT |
chr1_1716919_CT_C_b38 | SAMD11 | -2.826 | 0.00535 | -0.174221 | 4 | 0.061655 | yes | BRNCDT |
chr1_1010232_C_T_b38 | SAMD11 | 2.795 | 0.00585 | 0.166723 | 3 | 0.059643 | yes | BRNCDT |
chr1_1013466_T_TA_b38 | SAMD11 | 2.735 | 0.00697 | 0.187097 | 3 | 0.068401 | yes | BRNCDT |
chr1_946247_G_A_b38 | SAMD11 | 2.728 | 0.00712 | 0.077119 | 37 | 0.02827 | yes | BRNCDT |
chr1_955679_C_T_b38 | SAMD11 | 2.7 | 0.00772 | 0.076815 | 35 | 0.028451 | yes | BRNCDT |
chr1_956565_A_G_b38 | SAMD11 | 2.7 | 0.00772 | 0.076815 | 35 | 0.028451 | yes | BRNCDT |
chr1_1000112_G_T_b38 | SAMD11 | 2.68 | 0.00816 | 0.092006 | 13 | 0.034328 | yes | BRNCDT |
chr1_1010747_GT_G_b38 | SAMD11 | 2.645 | 0.00903 | 0.138516 | 4 | 0.052373 | yes | BRNCDT |
chr1_914991_G_T_b38 | SAMD11 | 2.642 | 0.0091 | 0.077372 | 37 | 0.029286 | yes | BRNCDT |
chr1_933741_T_TG_b38 | SAMD11 | 2.623 | 0.00959 | 0.079838 | 18 | 0.030435 | yes | BRNCDT |
chr1_814476_C_T_b38 | SAMD11 | -3.076 | 0.00249 | -0.116003 | 7 | 0.037713 | no | BRNCDT |
chr1_988598_A_AG_b38 | SAMD11 | 2.948 | 0.0037 | 0.109431 | 7 | 0.037121 | no | BRNCDT |
chr1_1725339_C_A_b38 | SAMD11 | -2.689 | 0.00796 | -0.0711 | 33 | 0.026443 | no | BRNCDT |
chr1_613558_C_T_b38 | SAMD11 | -2.626 | 0.00953 | -0.171809 | 3 | 0.065434 | no | BRNCDT |
chr1_511982_G_A_b38 | SAMD11 | 2.619 | 0.00971 | 0.076493 | 23 | 0.029208 | no | BRNCDT |
chr1_1618982_G_A_b38 | SAMD11 | 3.552 | 0.000529 | 0.072123 | 9 | 0.020307 | yes | BRNCHB |
chr1_1595649_A_G_b38 | SAMD11 | -3.479 | 0.000678 | -0.075948 | 5 | 0.021827 | yes | BRNCHB |
chr1_874906_G_A_b38 | SAMD11 | -3.363 | 0.00101 | -0.077334 | 7 | 0.022997 | yes | BRNCHB |
chr1_1603989_T_C_b38 | SAMD11 | 3.312 | 0.00119 | 0.066506 | 10 | 0.020079 | yes | BRNCHB |
chr1_1609909_G_T_b38 | SAMD11 | 3.312 | 0.00119 | 0.066506 | 10 | 0.020079 | yes | BRNCHB |
chr1_1608244_T_C_b38 | SAMD11 | 3.31 | 0.0012 | 0.067091 | 10 | 0.020271 | yes | BRNCHB |
chr1_1613974_G_A_b38 | SAMD11 | 3.289 | 0.00129 | 0.066804 | 9 | 0.020314 | yes | BRNCHB |
chr1_933741_T_TG_b38 | SAMD11 | 3.214 | 0.00164 | 0.060273 | 14 | 0.018754 | yes | BRNCHB |
chr1_1687734_CA_C_b38 | SAMD11 | 3.202 | 0.0017 | 0.083908 | 3 | 0.026203 | yes | BRNCHB |
chr1_1595702_C_CAG_b38 | SAMD11 | -3.139 | 0.00208 | -0.069222 | 6 | 0.022051 | yes | BRNCHB |
chr1_1617375_T_C_b38 | SAMD11 | 3.128 | 0.00216 | 0.058817 | 17 | 0.018803 | yes | BRNCHB |
chr1_1618213_C_G_b38 | SAMD11 | 3.128 | 0.00216 | 0.058817 | 17 | 0.018803 | yes | BRNCHB |
chr1_1618290_G_C_b38 | SAMD11 | 3.128 | 0.00216 | 0.058817 | 17 | 0.018803 | yes | BRNCHB |
chr1_936972_G_C_b38 | SAMD11 | -3.071 | 0.00259 | -0.05672 | 13 | 0.018472 | yes | BRNCHB |
chr1_1028687_C_T_b38 | SAMD11 | 3.012 | 0.0031 | 0.105961 | 3 | 0.035176 | yes | BRNCHB |
chr1_1616547_T_C_b38 | SAMD11 | 3.006 | 0.00316 | 0.056756 | 16 | 0.018879 | yes | BRNCHB |
chr1_1594618_C_G_b38 | SAMD11 | 2.992 | 0.0033 | 0.059295 | 13 | 0.019819 | yes | BRNCHB |
chr1_1601796_A_C_b38 | SAMD11 | 2.945 | 0.00381 | 0.055928 | 20 | 0.018989 | yes | BRNCHB |
chr1_1604202_G_A_b38 | SAMD11 | 2.945 | 0.00381 | 0.055928 | 20 | 0.018989 | yes | BRNCHB |
chr1_935954_G_T_b38 | SAMD11 | 2.931 | 0.00398 | 0.052036 | 21 | 0.017757 | yes | BRNCHB |
chr1_1593620_G_C_b38 | SAMD11 | -2.927 | 0.00403 | -0.062208 | 6 | 0.021255 | yes | BRNCHB |
chr1_1596449_G_A_b38 | SAMD11 | -2.927 | 0.00403 | -0.062208 | 6 | 0.021255 | yes | BRNCHB |
chr1_1596529_A_G_b38 | SAMD11 | -2.927 | 0.00403 | -0.062208 | 6 | 0.021255 | yes | BRNCHB |
chr1_1615869_C_T_b38 | SAMD11 | 2.918 | 0.00413 | 0.054537 | 16 | 0.018687 | yes | BRNCHB |
chr1_1615322_A_G_b38 | SAMD11 | 2.891 | 0.00448 | 0.054956 | 16 | 0.019009 | yes | BRNCHB |
chr1_1611248_ATC_A_b38 | SAMD11 | -2.874 | 0.00472 | -0.062795 | 5 | 0.021851 | yes | BRNCHB |
chr1_1840043_T_TA_b38 | SAMD11 | 2.868 | 0.0048 | 0.067934 | 3 | 0.023687 | yes | BRNCHB |
chr1_927009_A_G_b38 | SAMD11 | 2.861 | 0.0049 | 0.089824 | 5 | 0.031396 | yes | BRNCHB |
chr1_1613421_T_C_b38 | SAMD11 | 2.86 | 0.00491 | 0.054249 | 16 | 0.018965 | yes | BRNCHB |
chr1_1599234_T_C_b38 | SAMD11 | -2.858 | 0.00495 | -0.06232 | 5 | 0.021806 | yes | BRNCHB |
chr1_1602057_C_T_b38 | SAMD11 | -2.858 | 0.00495 | -0.06232 | 5 | 0.021806 | yes | BRNCHB |
chr1_1595007_A_G_b38 | SAMD11 | -2.853 | 0.00501 | -0.063755 | 4 | 0.022344 | yes | BRNCHB |
chr1_1596899_A_C_b38 | SAMD11 | 2.846 | 0.00512 | 0.059622 | 6 | 0.02095 | yes | BRNCHB |
chr1_973858_G_C_b38 | SAMD11 | -2.835 | 0.0053 | -0.050434 | 26 | 0.017792 | yes | BRNCHB |
chr1_968046_C_T_b38 | SAMD11 | -2.775 | 0.00631 | -0.055953 | 11 | 0.020163 | yes | BRNCHB |
chr1_633209_T_C_b38 | SAMD11 | -2.766 | 0.00648 | -0.057772 | 7 | 0.020887 | yes | BRNCHB |
chr1_633230_C_T_b38 | SAMD11 | -2.766 | 0.00648 | -0.057772 | 7 | 0.020887 | yes | BRNCHB |
chr1_1606507_GTGGGC_G_b38 | SAMD11 | 2.739 | 0.007 | 0.045249 | 45 | 0.01652 | yes | BRNCHB |
chr1_633032_T_C_b38 | SAMD11 | -2.737 | 0.00705 | -0.057116 | 7 | 0.02087 | yes | BRNCHB |
chr1_633071_C_T_b38 | SAMD11 | -2.737 | 0.00705 | -0.057116 | 7 | 0.02087 | yes | BRNCHB |
chr1_633098_C_T_b38 | SAMD11 | -2.737 | 0.00705 | -0.057116 | 7 | 0.02087 | yes | BRNCHB |
chr1_633182_A_G_b38 | SAMD11 | -2.737 | 0.00705 | -0.057116 | 7 | 0.02087 | yes | BRNCHB |
chr1_633251_C_T_b38 | SAMD11 | -2.737 | 0.00705 | -0.057116 | 7 | 0.02087 | yes | BRNCHB |
chr1_633264_T_C_b38 | SAMD11 | -2.737 | 0.00705 | -0.057116 | 7 | 0.02087 | yes | BRNCHB |
chr1_633290_T_C_b38 | SAMD11 | -2.737 | 0.00705 | -0.057116 | 7 | 0.02087 | yes | BRNCHB |
chr1_633293_A_G_b38 | SAMD11 | -2.737 | 0.00705 | -0.057116 | 7 | 0.02087 | yes | BRNCHB |
chr1_923421_A_G_b38 | SAMD11 | 2.688 | 0.00809 | 0.05193 | 11 | 0.019316 | yes | BRNCHB |
chr1_877363_C_T_b38 | SAMD11 | -2.656 | 0.00888 | -0.06436 | 3 | 0.024237 | yes | BRNCHB |
chr1_1627057_C_G_b38 | SAMD11 | -2.649 | 0.00904 | -0.054164 | 13 | 0.020447 | yes | BRNCHB |
chr1_969663_CAT_C_b38 | SAMD11 | -2.615 | 0.00993 | -0.054662 | 9 | 0.0209 | yes | BRNCHB |
chr1_633636_C_T_b38 | SAMD11 | -2.786 | 0.00611 | -0.061158 | 6 | 0.021952 | no | BRNCHB |
chr1_1240684_G_GCCGCCCCCATTCACCCCGGCCGTGGTCCCTGCCCCAGCCCCCA_b38 | SAMD11 | -2.708 | 0.00764 | -0.0855 | 5 | 0.031569 | no | BRNCHB |
chr1_727717_G_C_b38 | SAMD11 | 2.69 | 0.00805 | 0.061808 | 8 | 0.022975 | no | BRNCHB |
chr1_633375_G_A_b38 | SAMD11 | -2.661 | 0.00875 | -0.057517 | 6 | 0.021617 | no | BRNCHB |
chr1_1613322_T_C_b38 | SAMD11 | 2.659 | 0.00879 | 0.050197 | 18 | 0.018876 | no | BRNCHB |
chr1_1168009_GGGGCGGAGGGCCGAGCGGGGCCAGCAGACGGGTGA_G_b38 | SAMD11 | 2.639 | 0.00931 | 0.035652 | 6 | 0.013512 | no | BRNCHB |
chr1_933741_T_TG_b38 | SAMD11 | 5.289 | 3.79e-07 | 0.093397 | 18 | 0.017659 | yes | BRNCHA |
chr1_935265_T_C_b38 | SAMD11 | -4.92 | 2.05e-06 | -0.089429 | 16 | 0.018176 | yes | BRNCHA |
chr1_935954_G_T_b38 | SAMD11 | 4.9 | 2.24e-06 | 0.083421 | 25 | 0.017026 | yes | BRNCHA |
chr1_968046_C_T_b38 | SAMD11 | -4.857 | 2.71e-06 | -0.092843 | 13 | 0.019116 | yes | BRNCHA |
chr1_936972_G_C_b38 | SAMD11 | -4.601 | 8.25e-06 | -0.082679 | 16 | 0.01797 | yes | BRNCHA |
chr1_969663_CAT_C_b38 | SAMD11 | -4.562 | 9.74e-06 | -0.08902 | 11 | 0.019514 | yes | BRNCHA |
chr1_938178_G_T_b38 | SAMD11 | 4.545 | 1.05e-05 | 0.078683 | 25 | 0.017313 | yes | BRNCHA |
chr1_941767_G_A_b38 | SAMD11 | -4.523 | 1.15e-05 | -0.087743 | 10 | 0.019401 | yes | BRNCHA |
chr1_945259_TC_T_b38 | SAMD11 | -4.429 | 1.7e-05 | -0.083706 | 10 | 0.018901 | yes | BRNCHA |
chr1_965666_ACC_A_b38 | SAMD11 | -4.246 | 3.6e-05 | -0.081414 | 10 | 0.019176 | yes | BRNCHA |
chr1_965125_G_C_b38 | SAMD11 | -4.002 | 9.42e-05 | -0.077553 | 11 | 0.01938 | yes | BRNCHA |
chr1_933548_A_AG_b38 | SAMD11 | 3.801 | 0.000201 | 0.06345 | 28 | 0.016694 | yes | BRNCHA |
chr1_954724_G_A_b38 | SAMD11 | -3.789 | 0.00021 | -0.073951 | 9 | 0.019517 | yes | BRNCHA |
chr1_925308_G_A_b38 | SAMD11 | 3.771 | 0.000225 | 0.074614 | 17 | 0.019786 | yes | BRNCHA |
chr1_514446_TA_T_b38 | SAMD11 | -3.766 | 0.000229 | -0.078862 | 8 | 0.020941 | yes | BRNCHA |
chr1_923421_A_G_b38 | SAMD11 | 3.722 | 0.00027 | 0.074784 | 15 | 0.020093 | yes | BRNCHA |
chr1_925036_G_A_b38 | SAMD11 | 3.626 | 0.000382 | 0.073162 | 15 | 0.020178 | yes | BRNCHA |
chr1_926250_G_A_b38 | SAMD11 | 3.626 | 0.000382 | 0.073162 | 15 | 0.020178 | yes | BRNCHA |
chr1_923311_TG_T_b38 | SAMD11 | 3.619 | 0.00039 | 0.073079 | 15 | 0.020191 | yes | BRNCHA |
chr1_1131430_C_CTTTTTTTTTTTTTTTT_b38 | SAMD11 | 3.615 | 0.000397 | 0.132146 | 4 | 0.03656 | yes | BRNCHA |
chr1_1657926_A_G_b38 | SAMD11 | -3.582 | 0.000447 | -0.07874 | 4 | 0.021985 | yes | BRNCHA |
chr1_946653_G_A_b38 | SAMD11 | -3.561 | 0.00048 | -0.072747 | 8 | 0.020427 | yes | BRNCHA |
chr1_927486_C_T_b38 | SAMD11 | 3.546 | 0.000507 | 0.071751 | 15 | 0.020235 | yes | BRNCHA |
chr1_967865_A_G_b38 | SAMD11 | 3.509 | 0.000578 | 0.058137 | 47 | 0.016569 | yes | BRNCHA |
chr1_932255_C_T_b38 | SAMD11 | -3.449 | 0.000711 | -0.073426 | 5 | 0.021287 | yes | BRNCHA |
chr1_929839_G_A_b38 | SAMD11 | -3.436 | 0.000745 | -0.073152 | 5 | 0.021292 | yes | BRNCHA |
chr1_931513_T_C_b38 | SAMD11 | 3.432 | 0.000754 | 0.057986 | 41 | 0.016894 | yes | BRNCHA |
chr1_929558_G_A_b38 | SAMD11 | 3.416 | 0.000798 | 0.065406 | 19 | 0.019149 | yes | BRNCHA |
chr1_931558_G_A_b38 | SAMD11 | -3.369 | 0.000935 | -0.068231 | 7 | 0.020251 | yes | BRNCHA |
chr1_965337_CTTAT_C_b38 | SAMD11 | 3.351 | 0.000993 | 0.058602 | 37 | 0.017486 | yes | BRNCHA |
chr1_1641723_TTCCTCCTCC_T_b38 | SAMD11 | 3.335 | 0.00105 | 0.072032 | 6 | 0.021599 | yes | BRNCHA |
chr1_937396_GCC_G_b38 | SAMD11 | -3.323 | 0.00109 | -0.053803 | 46 | 0.016189 | yes | BRNCHA |
chr1_946247_G_A_b38 | SAMD11 | 3.322 | 0.0011 | 0.059266 | 34 | 0.017839 | yes | BRNCHA |
chr1_928622_G_C_b38 | SAMD11 | -3.28 | 0.00126 | -0.071346 | 4 | 0.021753 | yes | BRNCHA |
chr1_922660_C_A_b38 | SAMD11 | -3.279 | 0.00127 | -0.072807 | 3 | 0.022205 | yes | BRNCHA |
chr1_922671_C_T_b38 | SAMD11 | -3.279 | 0.00127 | -0.072807 | 3 | 0.022205 | yes | BRNCHA |
chr1_955679_C_T_b38 | SAMD11 | 3.256 | 0.00137 | 0.057029 | 33 | 0.017517 | yes | BRNCHA |
chr1_956565_A_G_b38 | SAMD11 | 3.256 | 0.00137 | 0.057029 | 33 | 0.017517 | yes | BRNCHA |
chr1_1695747_C_T_b38 | SAMD11 | 3.145 | 0.00197 | 0.056994 | 41 | 0.018125 | yes | BRNCHA |
chr1_973443_G_A_b38 | SAMD11 | -3.142 | 0.00199 | -0.071872 | 7 | 0.022877 | yes | BRNCHA |
chr1_933038_C_T_b38 | SAMD11 | -3.064 | 0.00255 | -0.056755 | 15 | 0.018525 | yes | BRNCHA |
chr1_108893_C_T_b38 | SAMD11 | 3.062 | 0.00256 | 0.06803 | 8 | 0.022215 | yes | BRNCHA |
chr1_1776772_TAA_T_b38 | SAMD11 | -3.042 | 0.00273 | -0.061593 | 13 | 0.02025 | yes | BRNCHA |
chr1_924305_G_A_b38 | SAMD11 | -3.039 | 0.00275 | -0.061698 | 8 | 0.0203 | yes | BRNCHA |
chr1_960891_C_T_b38 | SAMD11 | 3.037 | 0.00277 | 0.051452 | 42 | 0.01694 | yes | BRNCHA |
chr1_976215_A_G_b38 | SAMD11 | 3.026 | 0.00287 | 0.063866 | 11 | 0.021107 | yes | BRNCHA |
chr1_1582556_T_C_b38 | SAMD11 | 2.988 | 0.00322 | 0.073911 | 4 | 0.024732 | yes | BRNCHA |
chr1_913065_G_A_b38 | SAMD11 | -2.985 | 0.00326 | -0.063283 | 8 | 0.021199 | yes | BRNCHA |
chr1_1553791_CA_C_b38 | SAMD11 | 2.944 | 0.0037 | 0.066805 | 6 | 0.02269 | yes | BRNCHA |
chr1_1694109_A_ACG_b38 | SAMD11 | 2.906 | 0.00415 | 0.046443 | 42 | 0.01598 | yes | BRNCHA |
chr1_1000830_C_A_b38 | SAMD11 | 2.906 | 0.00415 | 0.061355 | 7 | 0.021113 | yes | BRNCHA |
chr1_1695459_A_G_b38 | SAMD11 | 2.894 | 0.00431 | 0.052818 | 39 | 0.018252 | yes | BRNCHA |
chr1_917859_A_G_b38 | SAMD11 | -2.892 | 0.00433 | -0.062618 | 5 | 0.02165 | yes | BRNCHA |
chr1_530938_C_T_b38 | SAMD11 | -2.887 | 0.0044 | -0.066515 | 3 | 0.023039 | yes | BRNCHA |
chr1_611317_A_G_b38 | SAMD11 | 2.839 | 0.00509 | 0.0671 | 9 | 0.023638 | yes | BRNCHA |
chr1_910255_C_T_b38 | SAMD11 | -2.835 | 0.00514 | -0.064291 | 5 | 0.022676 | yes | BRNCHA |
chr1_911428_C_T_b38 | SAMD11 | -2.824 | 0.00532 | -0.061095 | 10 | 0.021638 | yes | BRNCHA |
chr1_906633_T_G_b38 | SAMD11 | -2.821 | 0.00536 | -0.062724 | 4 | 0.022235 | yes | BRNCHA |
chr1_949171_GAGAA_G_b38 | SAMD11 | 2.819 | 0.0054 | 0.048747 | 35 | 0.017294 | yes | BRNCHA |
chr1_939779_AGCCAGTGGACGCCGACCT_A_b38 | SAMD11 | 2.819 | 0.0054 | 0.046893 | 36 | 0.016637 | yes | BRNCHA |
chr1_139213_A_G_b38 | SAMD11 | 2.803 | 0.00565 | 0.059939 | 11 | 0.021382 | yes | BRNCHA |
chr1_139233_C_A_b38 | SAMD11 | 2.803 | 0.00565 | 0.059939 | 11 | 0.021382 | yes | BRNCHA |
chr1_1663038_T_C_b38 | SAMD11 | -2.796 | 0.00578 | -0.049638 | 37 | 0.017756 | yes | BRNCHA |
chr1_908953_ATATGCGGTGATCGGGGTCAGGCCCCCGGGCGCACCTTTGCTGGTATATGCGGGGGTCGGGGTCAGGCCCCCGGGCGCACCGTTGCTGGTATATGCGGGGGTCGGGGTCAGGCCCCCGGGCGCACCGTTGCTGGTATATGCGGTGGTCGGGGTCAGGCCCCCCGGGCGCACTG_A_b38 | SAMD11 | -2.788 | 0.00591 | -0.083626 | 5 | 0.029991 | yes | BRNCHA |
chr1_1546845_A_AAAC_b38 | SAMD11 | 2.773 | 0.00619 | 0.07605 | 4 | 0.027429 | yes | BRNCHA |
chr1_917284_C_T_b38 | SAMD11 | -2.761 | 0.0064 | -0.059347 | 5 | 0.021495 | yes | BRNCHA |
chr1_971790_AG_A_b38 | SAMD11 | -2.753 | 0.00655 | -0.046239 | 27 | 0.016794 | yes | BRNCHA |
chr1_917378_G_C_b38 | SAMD11 | -2.75 | 0.00662 | -0.059387 | 5 | 0.021598 | yes | BRNCHA |
chr1_902949_G_GC_b38 | SAMD11 | -2.718 | 0.00726 | -0.060958 | 4 | 0.022429 | yes | BRNCHA |
chr1_901149_C_G_b38 | SAMD11 | -2.708 | 0.00747 | -0.061265 | 4 | 0.022622 | yes | BRNCHA |
chr1_901544_G_A_b38 | SAMD11 | -2.708 | 0.00747 | -0.061265 | 4 | 0.022622 | yes | BRNCHA |
chr1_903007_T_C_b38 | SAMD11 | -2.708 | 0.00747 | -0.061265 | 4 | 0.022622 | yes | BRNCHA |
chr1_911018_G_A_b38 | SAMD11 | -2.707 | 0.0075 | -0.056459 | 14 | 0.02086 | yes | BRNCHA |
chr1_904947_G_A_b38 | SAMD11 | -2.696 | 0.00772 | -0.059849 | 5 | 0.022196 | yes | BRNCHA |
chr1_913274_TG_T_b38 | SAMD11 | -2.672 | 0.00829 | -0.058816 | 5 | 0.022013 | yes | BRNCHA |
chr1_911484_G_C_b38 | SAMD11 | -2.655 | 0.0087 | -0.058108 | 9 | 0.021888 | yes | BRNCHA |
chr1_912111_G_A_b38 | SAMD11 | -2.65 | 0.00882 | -0.056775 | 8 | 0.021425 | yes | BRNCHA |
chr1_913076_A_G_b38 | SAMD11 | -2.65 | 0.00882 | -0.056775 | 8 | 0.021425 | yes | BRNCHA |
chr1_911848_C_T_b38 | SAMD11 | -2.646 | 0.00893 | -0.058196 | 7 | 0.021996 | yes | BRNCHA |
chr1_899548_A_G_b38 | SAMD11 | -2.629 | 0.00936 | -0.058632 | 4 | 0.022301 | yes | BRNCHA |
chr1_899619_G_A_b38 | SAMD11 | -2.629 | 0.00936 | -0.058632 | 4 | 0.022301 | yes | BRNCHA |
chr1_505074_C_T_b38 | SAMD11 | -2.627 | 0.00941 | -0.056874 | 8 | 0.02165 | yes | BRNCHA |
chr1_914483_G_GACTGCCCAGCTC_b38 | SAMD11 | -3.271 | 0.0013 | -0.071448 | 7 | 0.021845 | no | BRNCHA |
chr1_1097584_A_AT_b38 | SAMD11 | -3.264 | 0.00133 | -0.074225 | 5 | 0.02274 | no | BRNCHA |
chr1_1679085_T_C_b38 | SAMD11 | -2.98 | 0.00331 | -0.050969 | 44 | 0.017101 | no | BRNCHA |
chr1_1577491_A_AC_b38 | SAMD11 | 2.966 | 0.00346 | 0.053285 | 34 | 0.017966 | no | BRNCHA |
chr1_1362780_CAAA_C_b38 | SAMD11 | -2.943 | 0.00371 | -0.077323 | 3 | 0.026273 | no | BRNCHA |
chr1_931131_C_CCCCT_b38 | SAMD11 | 2.937 | 0.00378 | 0.077111 | 17 | 0.026252 | no | BRNCHA |
chr1_1362790_A_ATT_b38 | SAMD11 | -2.896 | 0.00428 | -0.076183 | 3 | 0.026302 | no | BRNCHA |
chr1_904478_CGCCTCCTCCGAACGCGGCCGCCTCCTCCTCCGAACGTGGCCTCCTCCGAACGCGGCCGCCTCCTCCTCCGAACGCGGCCGCCTCCTCCTCCGAACGTG_C_b38 | SAMD11 | -2.892 | 0.00434 | -0.064439 | 4 | 0.022283 | no | BRNCHA |
chr1_1574032_AAAG_A_b38 | SAMD11 | 2.857 | 0.00481 | 0.055929 | 20 | 0.019573 | no | BRNCHA |
chr1_1573429_CAAAAAAAAAAAAAAAAAA_C_b38 | SAMD11 | 2.855 | 0.00485 | 0.049097 | 30 | 0.017196 | no | BRNCHA |
chr1_1492939_C_CA_b38 | SAMD11 | 2.796 | 0.00577 | 0.089907 | 4 | 0.03215 | no | BRNCHA |
chr1_1547630_G_A_b38 | SAMD11 | 2.796 | 0.00578 | 0.049088 | 28 | 0.017556 | no | BRNCHA |
chr1_1565105_CAAGGCAGGCGGATCATG_C_b38 | SAMD11 | 2.784 | 0.00598 | 0.049157 | 35 | 0.017655 | no | BRNCHA |
chr1_906982_C_T_b38 | SAMD11 | -2.775 | 0.00615 | -0.058862 | 6 | 0.021212 | no | BRNCHA |
chr1_1574445_A_G_b38 | SAMD11 | 2.747 | 0.00666 | 0.050233 | 33 | 0.018284 | no | BRNCHA |
chr1_905012_TGCGGGGGAGGCTGTTGGGGACGTTCGTG_T_b38 | SAMD11 | -2.72 | 0.00722 | -0.065135 | 6 | 0.023947 | no | BRNCHA |
chr1_1573654_T_C_b38 | SAMD11 | 2.716 | 0.00729 | 0.048694 | 33 | 0.017926 | no | BRNCHA |
chr1_1726126_G_A_b38 | SAMD11 | 2.714 | 0.00734 | 0.041088 | 57 | 0.015139 | no | BRNCHA |
chr1_1690741_T_A_b38 | SAMD11 | 2.703 | 0.00758 | 0.046962 | 24 | 0.017373 | no | BRNCHA |
chr1_1575724_G_C_b38 | SAMD11 | 2.703 | 0.00758 | 0.048396 | 32 | 0.017906 | no | BRNCHA |
chr1_1572532_A_C_b38 | SAMD11 | 2.676 | 0.00819 | 0.047779 | 33 | 0.017856 | no | BRNCHA |
chr1_1573079_A_G_b38 | SAMD11 | 2.676 | 0.00819 | 0.047779 | 33 | 0.017856 | no | BRNCHA |
chr1_938014_A_G_b38 | SAMD11 | -3.637 | 0.000369 | -0.167851 | 5 | 0.046154 | yes | BRNCTXA |
chr1_928483_G_A_b38 | SAMD11 | -3.579 | 0.000454 | -0.167915 | 4 | 0.046921 | yes | BRNCTXA |
chr1_924533_A_G_b38 | SAMD11 | 3.555 | 0.000494 | 0.178959 | 4 | 0.050337 | yes | BRNCTXA |
chr1_1217251_C_A_b38 | SAMD11 | -3.36 | 0.000968 | -0.085992 | 5 | 0.02559 | yes | BRNCTXA |
chr1_925408_TTGG_T_b38 | SAMD11 | 3.356 | 0.000984 | 0.177759 | 4 | 0.052975 | yes | BRNCTXA |
chr1_925412_CGCCTGCG_C_b38 | SAMD11 | 3.356 | 0.000984 | 0.177759 | 4 | 0.052975 | yes | BRNCTXA |
chr1_1372909_G_A_b38 | SAMD11 | -3.325 | 0.00109 | -0.085237 | 3 | 0.025637 | yes | BRNCTXA |
chr1_925081_G_A_b38 | SAMD11 | 3.318 | 0.00112 | 0.152734 | 6 | 0.046034 | yes | BRNCTXA |
chr1_925141_C_A_b38 | SAMD11 | 3.318 | 0.00112 | 0.152734 | 6 | 0.046034 | yes | BRNCTXA |
chr1_926428_A_G_b38 | SAMD11 | 3.318 | 0.00112 | 0.152734 | 6 | 0.046034 | yes | BRNCTXA |
chr1_926713_T_C_b38 | SAMD11 | 3.318 | 0.00112 | 0.152734 | 6 | 0.046034 | yes | BRNCTXA |
chr1_926744_A_G_b38 | SAMD11 | 3.318 | 0.00112 | 0.152734 | 6 | 0.046034 | yes | BRNCTXA |
chr1_927003_C_T_b38 | SAMD11 | 3.318 | 0.00112 | 0.152734 | 6 | 0.046034 | yes | BRNCTXA |
chr1_927744_G_T_b38 | SAMD11 | 3.318 | 0.00112 | 0.152734 | 6 | 0.046034 | yes | BRNCTXA |
chr1_928463_C_T_b38 | SAMD11 | -3.279 | 0.00127 | -0.148269 | 3 | 0.045222 | yes | BRNCTXA |
chr1_1374505_A_G_b38 | SAMD11 | -3.25 | 0.0014 | -0.081622 | 4 | 0.025118 | yes | BRNCTXA |
chr1_1370430_T_C_b38 | SAMD11 | -3.232 | 0.00149 | -0.082992 | 3 | 0.025679 | yes | BRNCTXA |
chr1_1370532_C_T_b38 | SAMD11 | -3.232 | 0.00149 | -0.082992 | 3 | 0.025679 | yes | BRNCTXA |
chr1_1370584_G_C_b38 | SAMD11 | -3.232 | 0.00149 | -0.082992 | 3 | 0.025679 | yes | BRNCTXA |
chr1_1400756_GGA_G_b38 | SAMD11 | -3.181 | 0.00175 | -0.079598 | 4 | 0.025022 | yes | BRNCTXA |
chr1_1401954_G_T_b38 | SAMD11 | -3.181 | 0.00175 | -0.079598 | 4 | 0.025022 | yes | BRNCTXA |
chr1_1403593_A_G_b38 | SAMD11 | -3.181 | 0.00175 | -0.079598 | 4 | 0.025022 | yes | BRNCTXA |
chr1_1407565_C_A_b38 | SAMD11 | -3.181 | 0.00175 | -0.079598 | 4 | 0.025022 | yes | BRNCTXA |
chr1_1407232_G_C_b38 | SAMD11 | -3.164 | 0.00186 | -0.070361 | 8 | 0.022239 | yes | BRNCTXA |
chr1_275616_T_C_b38 | SAMD11 | 3.118 | 0.00215 | 0.067569 | 14 | 0.021668 | yes | BRNCTXA |
chr1_929375_A_G_b38 | SAMD11 | 3.105 | 0.00224 | 0.195102 | 3 | 0.062827 | yes | BRNCTXA |
chr1_929377_G_A_b38 | SAMD11 | 3.105 | 0.00224 | 0.195102 | 3 | 0.062827 | yes | BRNCTXA |
chr1_925398_A_G_b38 | SAMD11 | 3.104 | 0.00225 | 0.159594 | 4 | 0.051407 | yes | BRNCTXA |
chr1_1369803_C_CT_b38 | SAMD11 | -3.081 | 0.00242 | -0.074549 | 4 | 0.024198 | yes | BRNCTXA |
chr1_925628_G_C_b38 | SAMD11 | 3.065 | 0.00254 | 0.145079 | 6 | 0.047328 | yes | BRNCTXA |
chr1_1375642_C_T_b38 | SAMD11 | -3.002 | 0.00311 | -0.075739 | 4 | 0.025233 | yes | BRNCTXA |
chr1_64613_T_A_b38 | SAMD11 | -2.99 | 0.00322 | -0.097651 | 3 | 0.032659 | yes | BRNCTXA |
chr1_924024_C_G_b38 | SAMD11 | 2.947 | 0.00368 | 0.141718 | 6 | 0.048089 | yes | BRNCTXA |
chr1_1382893_G_A_b38 | SAMD11 | -2.909 | 0.00413 | -0.073824 | 4 | 0.025376 | yes | BRNCTXA |
chr1_1383743_T_C_b38 | SAMD11 | -2.905 | 0.00418 | -0.073243 | 4 | 0.025211 | yes | BRNCTXA |
chr1_1384546_C_T_b38 | SAMD11 | -2.905 | 0.00418 | -0.073243 | 4 | 0.025211 | yes | BRNCTXA |
chr1_1398218_C_A_b38 | SAMD11 | -2.905 | 0.00418 | -0.073243 | 4 | 0.025211 | yes | BRNCTXA |
chr1_1432355_G_A_b38 | SAMD11 | -2.9 | 0.00424 | -0.064422 | 11 | 0.022214 | yes | BRNCTXA |
chr1_1411323_A_C_b38 | SAMD11 | -2.897 | 0.00428 | -0.062269 | 25 | 0.021494 | yes | BRNCTXA |
chr1_911085_C_T_b38 | SAMD11 | -2.895 | 0.00431 | -0.129729 | 4 | 0.044814 | yes | BRNCTXA |
chr1_1380867_A_G_b38 | SAMD11 | -2.88 | 0.00451 | -0.072657 | 4 | 0.025227 | yes | BRNCTXA |
chr1_921797_T_C_b38 | SAMD11 | -2.856 | 0.00485 | -0.124668 | 4 | 0.043657 | yes | BRNCTXA |
chr1_924310_C_G_b38 | SAMD11 | 2.841 | 0.00507 | 0.153218 | 5 | 0.053928 | yes | BRNCTXA |
chr1_1402457_A_G_b38 | SAMD11 | -2.795 | 0.0058 | -0.059817 | 24 | 0.021399 | yes | BRNCTXA |
chr1_1226486_C_T_b38 | SAMD11 | -2.706 | 0.00753 | -0.070904 | 3 | 0.026201 | yes | BRNCTXA |
chr1_1217733_G_A_b38 | SAMD11 | -2.685 | 0.00799 | -0.0695 | 4 | 0.025882 | yes | BRNCTXA |
chr1_924321_C_G_b38 | SAMD11 | 2.664 | 0.0085 | 0.146019 | 4 | 0.054815 | yes | BRNCTXA |
chr1_1370113_A_G_b38 | SAMD11 | 2.663 | 0.00852 | 0.054268 | 20 | 0.020381 | yes | BRNCTXA |
chr1_1437993_G_A_b38 | SAMD11 | -2.652 | 0.0088 | -0.057602 | 11 | 0.021723 | yes | BRNCTXA |
chr1_1379091_T_G_b38 | SAMD11 | 2.608 | 0.00993 | 0.060622 | 7 | 0.023241 | yes | BRNCTXA |
chr1_1341550_GCA_G_b38 | SAMD11 | -2.608 | 0.00994 | -0.068384 | 3 | 0.026217 | yes | BRNCTXA |
chr1_1369821_C_T_b38 | SAMD11 | -3.202 | 0.00164 | -0.080964 | 3 | 0.025286 | no | BRNCTXA |
chr1_1369282_G_A_b38 | SAMD11 | -3.168 | 0.00183 | -0.079704 | 3 | 0.025159 | no | BRNCTXA |
chr1_1369320_GT_G_b38 | SAMD11 | -3.168 | 0.00183 | -0.079704 | 3 | 0.025159 | no | BRNCTXA |
chr1_1369407_G_A_b38 | SAMD11 | -3.168 | 0.00183 | -0.079704 | 3 | 0.025159 | no | BRNCTXA |
chr1_1369476_CTT_C_b38 | SAMD11 | -3.168 | 0.00183 | -0.079704 | 3 | 0.025159 | no | BRNCTXA |
chr1_1369556_C_G_b38 | SAMD11 | -3.168 | 0.00183 | -0.079704 | 3 | 0.025159 | no | BRNCTXA |
chr1_1369627_T_C_b38 | SAMD11 | -3.168 | 0.00183 | -0.079704 | 3 | 0.025159 | no | BRNCTXA |
chr1_1369686_T_C_b38 | SAMD11 | -3.168 | 0.00183 | -0.079704 | 3 | 0.025159 | no | BRNCTXA |
chr1_1369716_G_C_b38 | SAMD11 | -3.168 | 0.00183 | -0.079704 | 3 | 0.025159 | no | BRNCTXA |
chr1_1369741_C_T_b38 | SAMD11 | -3.168 | 0.00183 | -0.079704 | 3 | 0.025159 | no | BRNCTXA |
chr1_1499586_C_CT_b38 | SAMD11 | -3.013 | 0.003 | -0.081668 | 10 | 0.027106 | no | BRNCTXA |
chr1_1367919_C_T_b38 | SAMD11 | -2.989 | 0.00323 | -0.075825 | 3 | 0.025369 | no | BRNCTXA |
chr1_1367951_C_T_b38 | SAMD11 | -2.989 | 0.00323 | -0.075825 | 3 | 0.025369 | no | BRNCTXA |
chr1_1367965_A_G_b38 | SAMD11 | -2.989 | 0.00323 | -0.075825 | 3 | 0.025369 | no | BRNCTXA |
chr1_1367970_T_G_b38 | SAMD11 | -2.989 | 0.00323 | -0.075825 | 3 | 0.025369 | no | BRNCTXA |
chr1_1367994_C_A_b38 | SAMD11 | -2.989 | 0.00323 | -0.075825 | 3 | 0.025369 | no | BRNCTXA |
chr1_1368297_C_T_b38 | SAMD11 | -2.989 | 0.00323 | -0.075825 | 3 | 0.025369 | no | BRNCTXA |
chr1_1368514_C_G_b38 | SAMD11 | -2.989 | 0.00323 | -0.075825 | 3 | 0.025369 | no | BRNCTXA |
chr1_1368991_C_T_b38 | SAMD11 | -2.989 | 0.00323 | -0.075825 | 3 | 0.025369 | no | BRNCTXA |
chr1_1369009_T_C_b38 | SAMD11 | -2.989 | 0.00323 | -0.075825 | 3 | 0.025369 | no | BRNCTXA |
chr1_1369012_C_CG_b38 | SAMD11 | -2.989 | 0.00323 | -0.075825 | 3 | 0.025369 | no | BRNCTXA |
chr1_1379093_TG_T_b38 | SAMD11 | -2.832 | 0.00521 | -0.075389 | 3 | 0.026622 | no | BRNCTXA |
chr1_1368763_G_A_b38 | SAMD11 | -2.803 | 0.00568 | -0.071045 | 3 | 0.025349 | no | BRNCTXA |
chr1_1368177_G_C_b38 | SAMD11 | -2.774 | 0.00618 | -0.070369 | 4 | 0.025367 | no | BRNCTXA |
chr1_280592_T_C_b38 | SAMD11 | 2.766 | 0.00632 | 0.070518 | 6 | 0.025491 | no | BRNCTXA |
chr1_935426_C_CGGAGCTCCTCT_b38 | SAMD11 | -2.651 | 0.00881 | -0.161104 | 3 | 0.060765 | no | BRNCTXA |
chr1_1394041_G_A_b38 | SAMD11 | -2.644 | 0.009 | -0.069357 | 3 | 0.026235 | no | BRNCTXA |
chr1_265261_G_A_b38 | SAMD11 | 3.274 | 0.00135 | 0.076494 | 13 | 0.023362 | yes | BRNCTXB |
chr1_1703583_A_G_b38 | SAMD11 | 3.519 | 0.000592 | 0.137256 | 7 | 0.039004 | no | BRNCTXB |
chr1_272675_G_A_b38 | SAMD11 | 3.408 | 0.000865 | 0.085064 | 9 | 0.024962 | no | BRNCTXB |
chr1_286747_A_G_b38 | SAMD11 | 3.238 | 0.00152 | 0.082622 | 8 | 0.025513 | no | BRNCTXB |
chr1_1707341_C_T_b38 | SAMD11 | 3.217 | 0.00162 | 0.128155 | 3 | 0.039832 | no | BRNCTXB |
chr1_1716588_T_C_b38 | SAMD11 | -3.21 | 0.00166 | -0.12358 | 3 | 0.038503 | no | BRNCTXB |
chr1_1719827_A_G_b38 | SAMD11 | -3.21 | 0.00166 | -0.12358 | 3 | 0.038503 | no | BRNCTXB |
chr1_1714792_T_C_b38 | SAMD11 | -3.198 | 0.00173 | -0.123191 | 3 | 0.038521 | no | BRNCTXB |
chr1_1756753_A_G_b38 | SAMD11 | -3.17 | 0.00189 | -0.112453 | 8 | 0.035474 | no | BRNCTXB |
chr1_1704489_G_A_b38 | SAMD11 | 3.164 | 0.00193 | 0.121895 | 3 | 0.03853 | no | BRNCTXB |
chr1_1706748_C_T_b38 | SAMD11 | 3.164 | 0.00193 | 0.121895 | 3 | 0.03853 | no | BRNCTXB |
chr1_1716210_C_CT_b38 | SAMD11 | -3.13 | 0.00215 | -0.128279 | 6 | 0.040985 | no | BRNCTXB |
chr1_1720288_G_A_b38 | SAMD11 | -3.13 | 0.00215 | -0.128279 | 6 | 0.040985 | no | BRNCTXB |
chr1_1718040_T_TAG_b38 | SAMD11 | -3.032 | 0.00292 | -0.120173 | 3 | 0.039634 | no | BRNCTXB |
chr1_1716966_A_G_b38 | SAMD11 | -2.969 | 0.00354 | -0.10895 | 4 | 0.0367 | no | BRNCTXB |
chr1_1717067_A_AT_b38 | SAMD11 | -2.968 | 0.00355 | -0.118039 | 3 | 0.03977 | no | BRNCTXB |
chr1_1726053_G_C_b38 | SAMD11 | -2.948 | 0.00377 | -0.096783 | 6 | 0.03283 | no | BRNCTXB |
chr1_1703572_A_G_b38 | SAMD11 | 2.941 | 0.00385 | 0.119235 | 9 | 0.04054 | no | BRNCTXB |
chr1_1721197_CA_C_b38 | SAMD11 | -2.939 | 0.00388 | -0.112901 | 3 | 0.038418 | no | BRNCTXB |
chr1_1707744_A_G_b38 | SAMD11 | 2.905 | 0.0043 | 0.116352 | 3 | 0.040057 | no | BRNCTXB |
chr1_1707090_A_G_b38 | SAMD11 | 2.891 | 0.00449 | 0.110547 | 4 | 0.038242 | no | BRNCTXB |
chr1_1710588_C_T_b38 | SAMD11 | -2.876 | 0.00469 | -0.112529 | 4 | 0.039128 | no | BRNCTXB |
chr1_1714988_T_G_b38 | SAMD11 | -2.86 | 0.00491 | -0.113357 | 3 | 0.039632 | no | BRNCTXB |
chr1_1715135_T_C_b38 | SAMD11 | -2.86 | 0.00491 | -0.113357 | 3 | 0.039632 | no | BRNCTXB |
chr1_1715860_C_T_b38 | SAMD11 | -2.86 | 0.00491 | -0.113357 | 3 | 0.039632 | no | BRNCTXB |
chr1_1715862_G_A_b38 | SAMD11 | -2.86 | 0.00491 | -0.113357 | 3 | 0.039632 | no | BRNCTXB |
chr1_1716085_C_T_b38 | SAMD11 | -2.86 | 0.00491 | -0.113357 | 3 | 0.039632 | no | BRNCTXB |
chr1_1716089_G_C_b38 | SAMD11 | -2.86 | 0.00491 | -0.113357 | 3 | 0.039632 | no | BRNCTXB |
chr1_1716247_A_C_b38 | SAMD11 | -2.86 | 0.00491 | -0.113357 | 3 | 0.039632 | no | BRNCTXB |
chr1_1717185_C_A_b38 | SAMD11 | -2.86 | 0.00491 | -0.113357 | 3 | 0.039632 | no | BRNCTXB |
chr1_1718761_A_C_b38 | SAMD11 | -2.86 | 0.00491 | -0.113357 | 3 | 0.039632 | no | BRNCTXB |
chr1_1718824_G_T_b38 | SAMD11 | -2.86 | 0.00491 | -0.113357 | 3 | 0.039632 | no | BRNCTXB |
chr1_1718971_T_C_b38 | SAMD11 | -2.86 | 0.00491 | -0.113357 | 3 | 0.039632 | no | BRNCTXB |
chr1_1719368_T_C_b38 | SAMD11 | -2.86 | 0.00491 | -0.113357 | 3 | 0.039632 | no | BRNCTXB |
chr1_1719406_G_A_b38 | SAMD11 | -2.86 | 0.00491 | -0.113357 | 3 | 0.039632 | no | BRNCTXB |
chr1_1720183_C_T_b38 | SAMD11 | -2.86 | 0.00491 | -0.113357 | 3 | 0.039632 | no | BRNCTXB |
chr1_1720376_T_C_b38 | SAMD11 | -2.86 | 0.00491 | -0.113357 | 3 | 0.039632 | no | BRNCTXB |
chr1_1720472_C_A_b38 | SAMD11 | -2.86 | 0.00491 | -0.113357 | 3 | 0.039632 | no | BRNCTXB |
chr1_1720523_G_A_b38 | SAMD11 | -2.86 | 0.00491 | -0.113357 | 3 | 0.039632 | no | BRNCTXB |
chr1_1720696_C_CTTA_b38 | SAMD11 | -2.86 | 0.00491 | -0.113357 | 3 | 0.039632 | no | BRNCTXB |
chr1_1720787_A_G_b38 | SAMD11 | -2.86 | 0.00491 | -0.113357 | 3 | 0.039632 | no | BRNCTXB |
chr1_1721565_T_C_b38 | SAMD11 | -2.86 | 0.00491 | -0.113357 | 3 | 0.039632 | no | BRNCTXB |
chr1_1721589_C_T_b38 | SAMD11 | -2.86 | 0.00491 | -0.113357 | 3 | 0.039632 | no | BRNCTXB |
chr1_1721864_T_C_b38 | SAMD11 | -2.86 | 0.00491 | -0.113357 | 3 | 0.039632 | no | BRNCTXB |
chr1_1721893_GT_G_b38 | SAMD11 | -2.86 | 0.00491 | -0.113357 | 3 | 0.039632 | no | BRNCTXB |
chr1_1721922_C_T_b38 | SAMD11 | -2.86 | 0.00491 | -0.113357 | 3 | 0.039632 | no | BRNCTXB |
chr1_1721975_C_T_b38 | SAMD11 | -2.86 | 0.00491 | -0.113357 | 3 | 0.039632 | no | BRNCTXB |
chr1_1722360_C_T_b38 | SAMD11 | -2.86 | 0.00491 | -0.113357 | 3 | 0.039632 | no | BRNCTXB |
chr1_1722446_C_A_b38 | SAMD11 | -2.86 | 0.00491 | -0.113357 | 3 | 0.039632 | no | BRNCTXB |
chr1_286985_C_T_b38 | SAMD11 | 2.84 | 0.00522 | 0.072481 | 9 | 0.025525 | no | BRNCTXB |
chr1_1715218_T_C_b38 | SAMD11 | -2.824 | 0.00546 | -0.106516 | 4 | 0.037712 | no | BRNCTXB |
chr1_1703669_G_A_b38 | SAMD11 | 2.813 | 0.00564 | 0.11153 | 3 | 0.039642 | no | BRNCTXB |
chr1_1703754_T_C_b38 | SAMD11 | 2.813 | 0.00564 | 0.11153 | 3 | 0.039642 | no | BRNCTXB |
chr1_1704126_C_T_b38 | SAMD11 | 2.813 | 0.00564 | 0.11153 | 3 | 0.039642 | no | BRNCTXB |
chr1_1704504_A_C_b38 | SAMD11 | 2.813 | 0.00564 | 0.11153 | 3 | 0.039642 | no | BRNCTXB |
chr1_1704540_G_C_b38 | SAMD11 | 2.813 | 0.00564 | 0.11153 | 3 | 0.039642 | no | BRNCTXB |
chr1_1706210_G_A_b38 | SAMD11 | 2.813 | 0.00564 | 0.11153 | 3 | 0.039642 | no | BRNCTXB |
chr1_1706488_C_G_b38 | SAMD11 | 2.813 | 0.00564 | 0.11153 | 3 | 0.039642 | no | BRNCTXB |
chr1_1706898_T_C_b38 | SAMD11 | 2.769 | 0.00642 | 0.109958 | 3 | 0.039711 | no | BRNCTXB |
chr1_1704961_G_A_b38 | SAMD11 | 2.763 | 0.00654 | 0.108559 | 3 | 0.039297 | no | BRNCTXB |
chr1_1714797_C_T_b38 | SAMD11 | -2.754 | 0.00671 | -0.10833 | 3 | 0.039338 | no | BRNCTXB |
chr1_1102071_C_CAAA_b38 | SAMD11 | 2.75 | 0.00679 | 0.13063 | 3 | 0.047509 | no | BRNCTXB |
chr1_1704673_G_A_b38 | SAMD11 | 2.74 | 0.00699 | 0.109285 | 3 | 0.039892 | no | BRNCTXB |
chr1_1713469_C_T_b38 | SAMD11 | -2.738 | 0.00703 | -0.102828 | 5 | 0.037562 | no | BRNCTXB |
chr1_1718593_A_C_b38 | SAMD11 | -2.721 | 0.00737 | -0.107245 | 3 | 0.039409 | no | BRNCTXB |
chr1_1718594_T_C_b38 | SAMD11 | -2.721 | 0.00737 | -0.107245 | 3 | 0.039409 | no | BRNCTXB |
chr1_1715350_T_C_b38 | SAMD11 | -2.714 | 0.00753 | -0.105571 | 3 | 0.038901 | no | BRNCTXB |
chr1_1248218_A_G_b38 | SAMD11 | 2.696 | 0.00791 | 0.108253 | 5 | 0.04015 | no | BRNCTXB |
chr1_1534166_G_A_b38 | SAMD11 | -2.678 | 0.00833 | -0.06053 | 18 | 0.0226 | no | BRNCTXB |
chr1_1720309_G_C_b38 | SAMD11 | -2.668 | 0.00857 | -0.104494 | 3 | 0.039165 | no | BRNCTXB |
chr1_1720498_G_A_b38 | SAMD11 | -2.633 | 0.00947 | -0.102547 | 3 | 0.038951 | no | BRNCTXB |
chr1_1718200_G_A_b38 | SAMD11 | -2.63 | 0.00955 | -0.098761 | 4 | 0.037558 | no | BRNCTXB |
chr1_1716769_C_T_b38 | SAMD11 | -2.617 | 0.0099 | -0.103716 | 3 | 0.039636 | no | BRNCTXB |
chr1_1137118_G_C_b38 | SAMD11 | 4.313 | 3.26e-05 | 0.105307 | 36 | 0.024417 | yes | BRNHPP |
chr1_1126414_A_G_b38 | SAMD11 | -3.896 | 0.000159 | -0.112161 | 16 | 0.028791 | yes | BRNHPP |
chr1_1126468_A_G_b38 | SAMD11 | -3.896 | 0.000159 | -0.112161 | 16 | 0.028791 | yes | BRNHPP |
chr1_1916092_C_T_b38 | SAMD11 | -3.889 | 0.000163 | -0.180407 | 8 | 0.04639 | yes | BRNHPP |
chr1_1916540_T_C_b38 | SAMD11 | -3.889 | 0.000163 | -0.180407 | 8 | 0.04639 | yes | BRNHPP |
chr1_1916721_A_G_b38 | SAMD11 | -3.889 | 0.000163 | -0.180407 | 8 | 0.04639 | yes | BRNHPP |
chr1_1917393_A_AAC_b38 | SAMD11 | -3.889 | 0.000163 | -0.180407 | 8 | 0.04639 | yes | BRNHPP |
chr1_1918091_T_C_b38 | SAMD11 | -3.889 | 0.000163 | -0.180407 | 8 | 0.04639 | yes | BRNHPP |
chr1_1918305_G_A_b38 | SAMD11 | -3.889 | 0.000163 | -0.180407 | 8 | 0.04639 | yes | BRNHPP |
chr1_1919475_A_G_b38 | SAMD11 | -3.889 | 0.000163 | -0.180407 | 8 | 0.04639 | yes | BRNHPP |
chr1_1919773_C_T_b38 | SAMD11 | -3.889 | 0.000163 | -0.180407 | 8 | 0.04639 | yes | BRNHPP |
chr1_1921945_G_A_b38 | SAMD11 | -3.889 | 0.000163 | -0.180407 | 8 | 0.04639 | yes | BRNHPP |
chr1_1921955_T_C_b38 | SAMD11 | -3.889 | 0.000163 | -0.180407 | 8 | 0.04639 | yes | BRNHPP |
chr1_1922149_C_T_b38 | SAMD11 | -3.889 | 0.000163 | -0.180407 | 8 | 0.04639 | yes | BRNHPP |
chr1_1135738_G_C_b38 | SAMD11 | 3.859 | 0.000182 | 0.096285 | 36 | 0.02495 | yes | BRNHPP |
chr1_1919746_G_T_b38 | SAMD11 | -3.833 | 2e-04 | -0.184526 | 9 | 0.048137 | yes | BRNHPP |
chr1_1919749_A_G_b38 | SAMD11 | -3.833 | 2e-04 | -0.184526 | 9 | 0.048137 | yes | BRNHPP |
chr1_1922424_T_C_b38 | SAMD11 | -3.833 | 2e-04 | -0.184526 | 9 | 0.048137 | yes | BRNHPP |
chr1_1922482_T_C_b38 | SAMD11 | -3.833 | 2e-04 | -0.184526 | 9 | 0.048137 | yes | BRNHPP |
chr1_1923107_C_T_b38 | SAMD11 | -3.833 | 2e-04 | -0.184526 | 9 | 0.048137 | yes | BRNHPP |
chr1_1923278_C_T_b38 | SAMD11 | -3.833 | 2e-04 | -0.184526 | 9 | 0.048137 | yes | BRNHPP |
chr1_1142582_C_T_b38 | SAMD11 | 3.802 | 0.000224 | 0.100375 | 25 | 0.026399 | yes | BRNHPP |
chr1_1131566_A_G_b38 | SAMD11 | 3.705 | 0.000317 | 0.093 | 32 | 0.025101 | yes | BRNHPP |
chr1_1923880_C_T_b38 | SAMD11 | -3.691 | 0.000333 | -0.174676 | 9 | 0.047322 | yes | BRNHPP |
chr1_1096160_A_G_b38 | SAMD11 | 3.545 | 0.000555 | 0.112026 | 10 | 0.031602 | yes | BRNHPP |
chr1_1096804_A_G_b38 | SAMD11 | 3.545 | 0.000555 | 0.112026 | 10 | 0.031602 | yes | BRNHPP |
chr1_189771_T_C_b38 | SAMD11 | 3.483 | 0.000685 | 0.178942 | 3 | 0.051371 | yes | BRNHPP |
chr1_976215_A_G_b38 | SAMD11 | 3.467 | 0.000723 | 0.108817 | 9 | 0.031382 | yes | BRNHPP |
chr1_1641642_T_C_b38 | SAMD11 | 3.385 | 0.000953 | 0.106876 | 10 | 0.031572 | yes | BRNHPP |
chr1_907835_C_CCTGCCCGGTCCTTCTGACCAGCCGAGAGAGTA_b38 | SAMD11 | -3.329 | 0.00115 | -0.091066 | 17 | 0.027356 | yes | BRNHPP |
chr1_1124975_G_C_b38 | SAMD11 | -3.206 | 0.00171 | -0.090919 | 23 | 0.02836 | yes | BRNHPP |
chr1_1052514_C_CGT_b38 | SAMD11 | 3.203 | 0.00173 | 0.085904 | 34 | 0.026817 | yes | BRNHPP |
chr1_1691377_C_T_b38 | SAMD11 | 3.154 | 0.00202 | 0.091949 | 15 | 0.029156 | yes | BRNHPP |
chr1_16103_T_G_b38 | SAMD11 | 3.153 | 0.00203 | 0.106448 | 8 | 0.033762 | yes | BRNHPP |
chr1_1124795_T_C_b38 | SAMD11 | -3.151 | 0.00204 | -0.087419 | 36 | 0.027742 | yes | BRNHPP |
chr1_993602_G_GC_b38 | SAMD11 | 3.12 | 0.00225 | 0.174733 | 3 | 0.055996 | yes | BRNHPP |
chr1_1159105_C_T_b38 | SAMD11 | 3.117 | 0.00227 | 0.078577 | 33 | 0.025211 | yes | BRNHPP |
chr1_1160631_C_G_b38 | SAMD11 | 3.117 | 0.00227 | 0.078577 | 33 | 0.025211 | yes | BRNHPP |
chr1_1161712_G_A_b38 | SAMD11 | 3.117 | 0.00227 | 0.078577 | 33 | 0.025211 | yes | BRNHPP |
chr1_991929_T_C_b38 | SAMD11 | 3.068 | 0.00265 | 0.175194 | 3 | 0.057104 | yes | BRNHPP |
chr1_206074_T_C_b38 | SAMD11 | 3.049 | 0.00281 | 0.090657 | 17 | 0.029735 | yes | BRNHPP |
chr1_1000830_C_A_b38 | SAMD11 | 3.027 | 0.003 | 0.102955 | 5 | 0.034007 | yes | BRNHPP |
chr1_986190_T_C_b38 | SAMD11 | 3.01 | 0.00317 | 0.180796 | 3 | 0.060072 | yes | BRNHPP |
chr1_986925_G_GC_b38 | SAMD11 | 3.01 | 0.00317 | 0.180796 | 3 | 0.060072 | yes | BRNHPP |
chr1_987696_A_G_b38 | SAMD11 | 3.01 | 0.00317 | 0.180796 | 3 | 0.060072 | yes | BRNHPP |
chr1_988079_A_G_b38 | SAMD11 | 3.01 | 0.00317 | 0.180796 | 3 | 0.060072 | yes | BRNHPP |
chr1_989518_C_A_b38 | SAMD11 | 3.01 | 0.00317 | 0.180796 | 3 | 0.060072 | yes | BRNHPP |
chr1_990171_AT_A_b38 | SAMD11 | 3.01 | 0.00317 | 0.180796 | 3 | 0.060072 | yes | BRNHPP |
chr1_990304_T_C_b38 | SAMD11 | 3.01 | 0.00317 | 0.180796 | 3 | 0.060072 | yes | BRNHPP |
chr1_990971_C_T_b38 | SAMD11 | 3.01 | 0.00317 | 0.180796 | 3 | 0.060072 | yes | BRNHPP |
chr1_991051_A_T_b38 | SAMD11 | 3.01 | 0.00317 | 0.180796 | 3 | 0.060072 | yes | BRNHPP |
chr1_991241_A_C_b38 | SAMD11 | 3.01 | 0.00317 | 0.180796 | 3 | 0.060072 | yes | BRNHPP |
chr1_993456_C_T_b38 | SAMD11 | 3.01 | 0.00317 | 0.180796 | 3 | 0.060072 | yes | BRNHPP |
chr1_993936_C_T_b38 | SAMD11 | 3.01 | 0.00317 | 0.180796 | 3 | 0.060072 | yes | BRNHPP |
chr1_993947_A_G_b38 | SAMD11 | 3.01 | 0.00317 | 0.180796 | 3 | 0.060072 | yes | BRNHPP |
chr1_1715838_C_T_b38 | SAMD11 | 3.007 | 0.0032 | 0.075206 | 50 | 0.025012 | yes | BRNHPP |
chr1_989249_A_G_b38 | SAMD11 | 2.994 | 0.00333 | 0.179801 | 3 | 0.060061 | yes | BRNHPP |
chr1_993198_G_A_b38 | SAMD11 | 2.991 | 0.00336 | 0.180052 | 3 | 0.060204 | yes | BRNHPP |
chr1_1714932_G_T_b38 | SAMD11 | 2.984 | 0.00343 | 0.074433 | 40 | 0.024947 | yes | BRNHPP |
chr1_1007870_C_T_b38 | SAMD11 | 2.972 | 0.00356 | 0.181997 | 3 | 0.061245 | yes | BRNHPP |
chr1_989223_T_C_b38 | SAMD11 | 2.958 | 0.0037 | 0.177964 | 3 | 0.060156 | yes | BRNHPP |
chr1_1720192_T_G_b38 | SAMD11 | 2.939 | 0.00392 | 0.072843 | 47 | 0.024781 | yes | BRNHPP |
chr1_624752_C_T_b38 | SAMD11 | -2.923 | 0.00413 | -0.108473 | 3 | 0.037114 | yes | BRNHPP |
chr1_1725339_C_A_b38 | SAMD11 | 2.9 | 0.00441 | 0.069331 | 29 | 0.023904 | yes | BRNHPP |
chr1_1130902_A_G_b38 | SAMD11 | 2.815 | 0.00568 | 0.085622 | 10 | 0.03042 | yes | BRNHPP |
chr1_1125786_T_C_b38 | SAMD11 | -2.782 | 0.00624 | -0.082346 | 19 | 0.029598 | yes | BRNHPP |
chr1_988819_G_GGAGTGTTTCGGGAGTTCTGGGTTGATTGTTTCTGGAGTTCAGGGTT_b38 | SAMD11 | 2.775 | 0.00638 | 0.15192 | 3 | 0.054753 | yes | BRNHPP |
chr1_1905247_C_G_b38 | SAMD11 | 2.754 | 0.00678 | 0.129292 | 4 | 0.04695 | yes | BRNHPP |
chr1_995543_A_G_b38 | SAMD11 | 2.739 | 0.00708 | 0.091246 | 6 | 0.033317 | yes | BRNHPP |
chr1_1912140_T_G_b38 | SAMD11 | 2.725 | 0.00735 | 0.102264 | 4 | 0.037522 | yes | BRNHPP |
chr1_1101437_T_C_b38 | SAMD11 | -2.702 | 0.00785 | -0.088465 | 10 | 0.032735 | yes | BRNHPP |
chr1_1101667_C_T_b38 | SAMD11 | -2.702 | 0.00785 | -0.088465 | 10 | 0.032735 | yes | BRNHPP |
chr1_1112601_G_A_b38 | SAMD11 | -2.702 | 0.00785 | -0.088465 | 10 | 0.032735 | yes | BRNHPP |
chr1_1641723_TTCCTCCTCC_T_b38 | SAMD11 | 2.702 | 0.00785 | 0.093099 | 4 | 0.034452 | yes | BRNHPP |
chr1_1163041_C_T_b38 | SAMD11 | 2.693 | 0.00805 | 0.068414 | 43 | 0.025401 | yes | BRNHPP |
chr1_1687643_G_A_b38 | SAMD11 | -2.671 | 0.00857 | -0.066914 | 34 | 0.02505 | yes | BRNHPP |
chr1_1611567_CT_C_b38 | SAMD11 | 2.671 | 0.00858 | 0.075486 | 20 | 0.028264 | yes | BRNHPP |
chr1_861387_G_A_b38 | SAMD11 | 2.67 | 0.0086 | 0.102144 | 15 | 0.038256 | yes | BRNHPP |
chr1_1611571_T_C_b38 | SAMD11 | 2.632 | 0.00956 | 0.073965 | 20 | 0.028098 | yes | BRNHPP |
chr1_1704835_C_T_b38 | SAMD11 | 2.623 | 0.00981 | 0.064797 | 50 | 0.024705 | yes | BRNHPP |
chr1_1127861_G_T_b38 | SAMD11 | 2.62 | 0.00989 | 0.072185 | 33 | 0.02755 | yes | BRNHPP |
chr1_1686882_T_C_b38 | SAMD11 | -2.618 | 0.00995 | -0.064882 | 38 | 0.024783 | yes | BRNHPP |
chr1_1075707_CG_C_b38 | SAMD11 | 3.714 | 0.000307 | 0.09263 | 37 | 0.024942 | no | BRNHPP |
chr1_1081790_C_G_b38 | SAMD11 | 3.707 | 0.000315 | 0.089151 | 39 | 0.024052 | no | BRNHPP |
chr1_1091327_C_A_b38 | SAMD11 | 3.643 | 0.000394 | 0.098077 | 26 | 0.02692 | no | BRNHPP |
chr1_978953_C_G_b38 | SAMD11 | 3.632 | 0.00041 | 0.096015 | 29 | 0.026434 | no | BRNHPP |
chr1_1131008_C_CT_b38 | SAMD11 | 3.61 | 0.000443 | 0.090289 | 32 | 0.025012 | no | BRNHPP |
chr1_1131023_T_C_b38 | SAMD11 | 3.61 | 0.000443 | 0.090289 | 32 | 0.025012 | no | BRNHPP |
chr1_1082764_T_C_b38 | SAMD11 | 3.588 | 0.000478 | 0.088753 | 36 | 0.024737 | no | BRNHPP |
chr1_1081817_C_T_b38 | SAMD11 | 3.585 | 0.000483 | 0.089186 | 44 | 0.024879 | no | BRNHPP |
chr1_1079746_A_G_b38 | SAMD11 | 3.565 | 0.000518 | 0.091277 | 32 | 0.025606 | no | BRNHPP |
chr1_1083182_C_T_b38 | SAMD11 | 3.542 | 0.000561 | 0.088029 | 40 | 0.024854 | no | BRNHPP |
chr1_1085026_T_C_b38 | SAMD11 | 3.534 | 0.000576 | 0.103338 | 17 | 0.029242 | no | BRNHPP |
chr1_1133289_GT_G_b38 | SAMD11 | 3.465 | 0.00073 | 0.088187 | 31 | 0.025453 | no | BRNHPP |
chr1_1083324_A_G_b38 | SAMD11 | 3.463 | 0.000733 | 0.085459 | 34 | 0.024675 | no | BRNHPP |
chr1_1133452_CGCCGCCTGCCTGCCCG_C_b38 | SAMD11 | 3.463 | 0.000734 | 0.089164 | 33 | 0.025748 | no | BRNHPP |
chr1_1075337_C_T_b38 | SAMD11 | 3.418 | 0.000855 | 0.086682 | 32 | 0.025363 | no | BRNHPP |
chr1_933741_T_TG_b38 | SAMD11 | 3.4 | 0.000908 | 0.096698 | 13 | 0.028443 | no | BRNHPP |
chr1_1067673_C_T_b38 | SAMD11 | 3.393 | 0.000927 | 0.087369 | 38 | 0.025747 | no | BRNHPP |
chr1_1069577_G_A_b38 | SAMD11 | 3.389 | 0.000942 | 0.08586 | 38 | 0.025338 | no | BRNHPP |
chr1_1069600_G_A_b38 | SAMD11 | 3.389 | 0.000942 | 0.08586 | 38 | 0.025338 | no | BRNHPP |
chr1_650383_A_AAC_b38 | SAMD11 | 3.371 | 0.001 | 0.168778 | 3 | 0.050072 | no | BRNHPP |
chr1_1070843_G_A_b38 | SAMD11 | 3.368 | 0.00101 | 0.085012 | 39 | 0.025244 | no | BRNHPP |
chr1_1080171_C_T_b38 | SAMD11 | 3.35 | 0.00107 | 0.084007 | 37 | 0.025077 | no | BRNHPP |
chr1_1131572_A_G_b38 | SAMD11 | 3.336 | 0.00112 | 0.085816 | 32 | 0.025723 | no | BRNHPP |
chr1_1131573_T_C_b38 | SAMD11 | 3.336 | 0.00112 | 0.085816 | 32 | 0.025723 | no | BRNHPP |
chr1_1137233_C_G_b38 | SAMD11 | -3.331 | 0.00114 | -0.090071 | 23 | 0.027039 | no | BRNHPP |
chr1_981454_G_A_b38 | SAMD11 | 3.323 | 0.00117 | 0.090987 | 30 | 0.02738 | no | BRNHPP |
chr1_983193_A_G_b38 | SAMD11 | 3.323 | 0.00117 | 0.090987 | 30 | 0.02738 | no | BRNHPP |
chr1_1048767_CAAAAAAAAAAA_C_b38 | SAMD11 | 3.287 | 0.00132 | 0.096933 | 34 | 0.02949 | no | BRNHPP |
chr1_936972_G_C_b38 | SAMD11 | -3.286 | 0.00132 | -0.092691 | 13 | 0.028208 | no | BRNHPP |
chr1_1118005_C_T_b38 | SAMD11 | -3.257 | 0.00145 | -0.088277 | 42 | 0.027103 | no | BRNHPP |
chr1_1072052_G_A_b38 | SAMD11 | 3.231 | 0.00158 | 0.081844 | 39 | 0.025327 | no | BRNHPP |
chr1_1725745_C_G_b38 | SAMD11 | 3.206 | 0.00171 | 0.09395 | 17 | 0.029301 | no | BRNHPP |
chr1_1073854_T_C_b38 | SAMD11 | 3.202 | 0.00173 | 0.081156 | 35 | 0.025345 | no | BRNHPP |
chr1_1143811_T_C_b38 | SAMD11 | -3.196 | 0.00177 | -0.09222 | 16 | 0.028851 | no | BRNHPP |
chr1_1079877_A_G_b38 | SAMD11 | 3.191 | 0.00179 | 0.081991 | 32 | 0.025691 | no | BRNHPP |
chr1_1132216_CAG_C_b38 | SAMD11 | 3.19 | 0.0018 | 0.082899 | 29 | 0.025988 | no | BRNHPP |
chr1_1132294_T_TGG_b38 | SAMD11 | 3.19 | 0.0018 | 0.082899 | 29 | 0.025988 | no | BRNHPP |
chr1_1048922_T_C_b38 | SAMD11 | 3.19 | 0.0018 | 0.082069 | 41 | 0.025728 | no | BRNHPP |
chr1_1134045_C_A_b38 | SAMD11 | 3.156 | 0.00201 | 0.078845 | 33 | 0.024983 | no | BRNHPP |
chr1_1159358_A_G_b38 | SAMD11 | 3.155 | 0.00201 | 0.082498 | 22 | 0.026146 | no | BRNHPP |
chr1_1159599_G_A_b38 | SAMD11 | 3.117 | 0.00227 | 0.078374 | 31 | 0.025144 | no | BRNHPP |
chr1_979472_G_C_b38 | SAMD11 | 3.107 | 0.00234 | 0.083472 | 33 | 0.026863 | no | BRNHPP |
chr1_1086657_C_T_b38 | SAMD11 | 3.016 | 0.00311 | 0.074332 | 35 | 0.024646 | no | BRNHPP |
chr1_1686004_G_T_b38 | SAMD11 | -3.008 | 0.00319 | -0.279676 | 3 | 0.092979 | no | BRNHPP |
chr1_1691417_T_C_b38 | SAMD11 | 3.004 | 0.00322 | 0.077967 | 33 | 0.025955 | no | BRNHPP |
chr1_1134063_G_A_b38 | SAMD11 | 2.993 | 0.00334 | 0.074911 | 32 | 0.025032 | no | BRNHPP |
chr1_1461195_T_TC_b38 | SAMD11 | -2.968 | 0.00359 | -0.175551 | 4 | 0.059139 | no | BRNHPP |
chr1_1160239_C_G_b38 | SAMD11 | 2.954 | 0.00376 | 0.077751 | 21 | 0.026323 | no | BRNHPP |
chr1_1057980_C_A_b38 | SAMD11 | 2.951 | 0.00379 | 0.078363 | 41 | 0.026559 | no | BRNHPP |
chr1_1098619_C_T_b38 | SAMD11 | 2.935 | 0.00398 | 0.078687 | 34 | 0.02681 | no | BRNHPP |
chr1_1060101_T_G_b38 | SAMD11 | 2.93 | 0.00403 | 0.076356 | 43 | 0.026056 | no | BRNHPP |
chr1_978509_G_A_b38 | SAMD11 | 2.923 | 0.00413 | 0.078429 | 32 | 0.026834 | no | BRNHPP |
chr1_202496_T_A_b38 | SAMD11 | 2.92 | 0.00415 | 0.088358 | 23 | 0.030255 | no | BRNHPP |
chr1_1067054_C_T_b38 | SAMD11 | 2.914 | 0.00424 | 0.075923 | 35 | 0.026058 | no | BRNHPP |
chr1_1083800_T_C_b38 | SAMD11 | 2.912 | 0.00426 | 0.073918 | 32 | 0.025382 | no | BRNHPP |
chr1_1008088_T_C_b38 | SAMD11 | 2.887 | 0.00459 | 0.176312 | 4 | 0.061074 | no | BRNHPP |
chr1_1160818_C_T_b38 | SAMD11 | 2.867 | 0.00487 | 0.073249 | 30 | 0.025549 | no | BRNHPP |
chr1_1050066_G_T_b38 | SAMD11 | 2.849 | 0.00514 | 0.07973 | 26 | 0.027984 | no | BRNHPP |
chr1_1144486_C_G_b38 | SAMD11 | -2.827 | 0.00547 | -0.083681 | 16 | 0.029597 | no | BRNHPP |
chr1_983004_G_T_b38 | SAMD11 | 2.827 | 0.00549 | 0.078542 | 34 | 0.027788 | no | BRNHPP |
chr1_1113195_CA_C_b38 | SAMD11 | -2.826 | 0.0055 | -0.086698 | 16 | 0.030681 | no | BRNHPP |
chr1_979560_T_C_b38 | SAMD11 | 2.822 | 0.00555 | 0.078771 | 33 | 0.027909 | no | BRNHPP |
chr1_1063661_ATG_A_b38 | SAMD11 | 2.822 | 0.00556 | 0.073015 | 36 | 0.025876 | no | BRNHPP |
chr1_1134071_G_A_b38 | SAMD11 | 2.803 | 0.00589 | 0.069391 | 32 | 0.02476 | no | BRNHPP |
chr1_1063202_G_C_b38 | SAMD11 | 2.79 | 0.0061 | 0.07216 | 46 | 0.025859 | no | BRNHPP |
chr1_1023789_G_C_b38 | SAMD11 | 2.788 | 0.00614 | 0.075484 | 36 | 0.027076 | no | BRNHPP |
chr1_1143818_T_C_b38 | SAMD11 | -2.787 | 0.00616 | -0.082591 | 16 | 0.029638 | no | BRNHPP |
chr1_1688531_T_C_b38 | SAMD11 | -2.718 | 0.00751 | -0.091088 | 9 | 0.033514 | no | BRNHPP |
chr1_1527938_C_A_b38 | SAMD11 | -2.708 | 0.00772 | -0.205613 | 3 | 0.075917 | no | BRNHPP |
chr1_989068_GTTGA_G_b38 | SAMD11 | 2.702 | 0.00786 | 0.074051 | 35 | 0.027406 | no | BRNHPP |
chr1_1688786_G_A_b38 | SAMD11 | -2.689 | 0.00815 | -0.091446 | 7 | 0.034006 | no | BRNHPP |
chr1_1494105_G_A_b38 | SAMD11 | -2.671 | 0.00857 | -0.17252 | 3 | 0.064582 | no | BRNHPP |
chr1_1495205_G_A_b38 | SAMD11 | -2.671 | 0.00857 | -0.17252 | 3 | 0.064582 | no | BRNHPP |
chr1_1495221_G_A_b38 | SAMD11 | -2.671 | 0.00857 | -0.17252 | 3 | 0.064582 | no | BRNHPP |
chr1_1495222_T_G_b38 | SAMD11 | -2.671 | 0.00857 | -0.17252 | 3 | 0.064582 | no | BRNHPP |
chr1_1495236_T_C_b38 | SAMD11 | -2.671 | 0.00857 | -0.17252 | 3 | 0.064582 | no | BRNHPP |
chr1_1495327_C_T_b38 | SAMD11 | -2.671 | 0.00857 | -0.17252 | 3 | 0.064582 | no | BRNHPP |
chr1_1658422_T_C_b38 | SAMD11 | -2.669 | 0.00863 | -0.096681 | 4 | 0.036225 | no | BRNHPP |
chr1_992967_GGGAGGGTCCATGTGTCCGTCATCTGA_G_b38 | SAMD11 | 2.654 | 0.00899 | 0.074636 | 37 | 0.028121 | no | BRNHPP |
chr1_1496953_T_C_b38 | SAMD11 | -3.255 | 0.00145 | -0.20934 | 9 | 0.064321 | yes | BRNHPT |
chr1_272488_C_G_b38 | SAMD11 | -3.007 | 0.00317 | -0.153381 | 7 | 0.051012 | yes | BRNHPT |
chr1_1492619_A_AC_b38 | SAMD11 | -2.93 | 0.00401 | -0.200109 | 9 | 0.068287 | yes | BRNHPT |
chr1_1476079_T_C_b38 | SAMD11 | -2.875 | 0.00473 | -0.196273 | 9 | 0.068277 | yes | BRNHPT |
chr1_1487887_A_G_b38 | SAMD11 | -2.828 | 0.00544 | -0.187457 | 9 | 0.066292 | yes | BRNHPT |
chr1_1483898_G_A_b38 | SAMD11 | -2.8 | 0.0059 | -0.198178 | 9 | 0.070786 | yes | BRNHPT |
chr1_1486151_C_A_b38 | SAMD11 | -2.8 | 0.0059 | -0.198178 | 9 | 0.070786 | yes | BRNHPT |
chr1_1479683_T_G_b38 | SAMD11 | -2.752 | 0.00677 | -0.256788 | 8 | 0.093305 | yes | BRNHPT |
chr1_1480096_G_C_b38 | SAMD11 | -2.752 | 0.00677 | -0.256788 | 8 | 0.093305 | yes | BRNHPT |
chr1_281912_C_G_b38 | SAMD11 | 2.752 | 0.00679 | 0.121759 | 10 | 0.044251 | yes | BRNHPT |
chr1_1476266_T_C_b38 | SAMD11 | -2.744 | 0.00693 | -0.187476 | 9 | 0.068318 | yes | BRNHPT |
chr1_275616_T_C_b38 | SAMD11 | 2.691 | 0.00806 | 0.108379 | 13 | 0.040267 | yes | BRNHPT |
chr1_841166_A_G_b38 | SAMD11 | 2.689 | 0.00811 | 0.106835 | 15 | 0.039727 | yes | BRNHPT |
chr1_1479334_A_G_b38 | SAMD11 | -2.638 | 0.00937 | -0.216059 | 8 | 0.081905 | yes | BRNHPT |
chr1_1482624_T_C_b38 | SAMD11 | -2.636 | 0.00941 | -0.177514 | 9 | 0.067333 | yes | BRNHPT |
chr1_1488652_A_G_b38 | SAMD11 | -2.636 | 0.00941 | -0.177514 | 9 | 0.067333 | yes | BRNHPT |
chr1_1490320_T_C_b38 | SAMD11 | -2.636 | 0.00941 | -0.177514 | 9 | 0.067333 | yes | BRNHPT |
chr1_1492292_C_G_b38 | SAMD11 | -2.636 | 0.00941 | -0.177514 | 9 | 0.067333 | yes | BRNHPT |
chr1_1492850_G_A_b38 | SAMD11 | -2.636 | 0.00941 | -0.177514 | 9 | 0.067333 | yes | BRNHPT |
chr1_1512376_G_C_b38 | SAMD11 | -2.616 | 0.00995 | -0.152144 | 8 | 0.058151 | yes | BRNHPT |
chr1_791554_G_GGAATC_b38 | SAMD11 | -3.466 | 0.000717 | -0.149264 | 8 | 0.043062 | no | BRNHPT |
chr1_976215_A_G_b38 | SAMD11 | 3.393 | 0.00092 | 0.152346 | 8 | 0.044906 | no | BRNHPT |
chr1_1258333_C_G_b38 | SAMD11 | -2.92 | 0.00413 | -0.238633 | 4 | 0.081725 | no | BRNHPT |
chr1_1258343_A_C_b38 | SAMD11 | -2.92 | 0.00413 | -0.238633 | 4 | 0.081725 | no | BRNHPT |
chr1_996120_C_T_b38 | SAMD11 | -2.902 | 0.00436 | -0.151198 | 3 | 0.052095 | no | BRNHPT |
chr1_1254681_A_G_b38 | SAMD11 | -2.886 | 0.00457 | -0.245611 | 3 | 0.085103 | no | BRNHPT |
chr1_1240684_G_GCCGCCCCCATTCACCCCGGCCGTGGTCCCTGCCCCAGCCCCCA_b38 | SAMD11 | -2.823 | 0.00552 | -0.218333 | 3 | 0.077351 | no | BRNHPT |
chr1_1511945_G_A_b38 | SAMD11 | -2.798 | 0.00593 | -0.162772 | 8 | 0.058168 | no | BRNHPT |
chr1_1054900_C_T_b38 | SAMD11 | 2.792 | 0.00603 | 0.104923 | 22 | 0.037573 | no | BRNHPT |
chr1_1055037_T_C_b38 | SAMD11 | -2.79 | 0.00606 | -0.105146 | 20 | 0.037681 | no | BRNHPT |
chr1_1208038_T_C_b38 | SAMD11 | -2.76 | 0.00662 | -0.208875 | 5 | 0.075681 | no | BRNHPT |
chr1_987103_T_C_b38 | SAMD11 | -2.758 | 0.00667 | -0.145985 | 3 | 0.05294 | no | BRNHPT |
chr1_991588_C_T_b38 | SAMD11 | -2.758 | 0.00667 | -0.145985 | 3 | 0.05294 | no | BRNHPT |
chr1_994185_G_T_b38 | SAMD11 | -2.758 | 0.00667 | -0.145985 | 3 | 0.05294 | no | BRNHPT |
chr1_998750_G_C_b38 | SAMD11 | -2.746 | 0.0069 | -0.144804 | 3 | 0.052739 | no | BRNHPT |
chr1_1000291_C_G_b38 | SAMD11 | -2.742 | 0.00697 | -0.143523 | 3 | 0.052338 | no | BRNHPT |
chr1_907835_C_CCTGCCCGGTCCTTCTGACCAGCCGAGAGAGTA_b38 | SAMD11 | -2.74 | 0.00702 | -0.103419 | 18 | 0.037751 | no | BRNHPT |
chr1_985597_T_C_b38 | SAMD11 | -2.719 | 0.00745 | -0.144286 | 3 | 0.053067 | no | BRNHPT |
chr1_609015_G_A_b38 | SAMD11 | -2.718 | 0.00748 | -0.139085 | 6 | 0.051178 | no | BRNHPT |
chr1_1574032_AAAG_A_b38 | SAMD11 | 2.715 | 0.00754 | 0.124376 | 11 | 0.045814 | no | BRNHPT |
chr1_1675091_A_G_b38 | SAMD11 | 3.434 | 0.000755 | 0.0742 | 19 | 0.021605 | yes | BRNNCC |
chr1_1739519_C_G_b38 | SAMD11 | -2.871 | 0.00464 | -0.069632 | 17 | 0.024252 | yes | BRNNCC |
chr1_1665581_C_G_b38 | SAMD11 | 2.707 | 0.00752 | 0.061353 | 16 | 0.022665 | yes | BRNNCC |
chr1_1668542_C_T_b38 | SAMD11 | 2.685 | 0.00802 | 0.0652 | 12 | 0.024287 | yes | BRNNCC |
chr1_1668717_C_G_b38 | SAMD11 | 2.65 | 0.00885 | 0.063484 | 13 | 0.023956 | yes | BRNNCC |
chr1_1669576_G_A_b38 | SAMD11 | 2.647 | 0.00892 | 0.062954 | 13 | 0.023782 | yes | BRNNCC |
chr1_1669613_G_A_b38 | SAMD11 | 2.642 | 0.00904 | 0.062553 | 13 | 0.023673 | yes | BRNNCC |
chr1_1667948_A_G_b38 | SAMD11 | 2.631 | 0.00933 | 0.063351 | 13 | 0.024075 | yes | BRNNCC |
chr1_1584321_T_C_b38 | SAMD11 | 2.626 | 0.00949 | 0.056368 | 29 | 0.021469 | yes | BRNNCC |
chr1_188252_G_T_b38 | SAMD11 | 3.122 | 0.00213 | 0.089023 | 3 | 0.028518 | no | BRNNCC |
chr1_729678_C_G_b38 | SAMD11 | 3.079 | 0.00244 | 0.098113 | 3 | 0.031864 | no | BRNNCC |
chr1_1726106_AT_A_b38 | SAMD11 | 2.867 | 0.0047 | 0.079382 | 11 | 0.02769 | no | BRNNCC |
chr1_1838449_C_CT_b38 | SAMD11 | -2.799 | 0.00576 | -0.070762 | 9 | 0.025284 | no | BRNNCC |
chr1_1658830_C_G_b38 | SAMD11 | 2.785 | 0.00599 | 0.066935 | 12 | 0.024032 | no | BRNNCC |
chr1_1749605_C_CGTCCATGCATATTTTTCTGTGTGATGTGTCTGTGTGTGTGTCTCAGTGGT_b38 | SAMD11 | -2.727 | 0.00711 | -0.057719 | 27 | 0.021168 | no | BRNNCC |
chr1_1665061_C_T_b38 | SAMD11 | 2.65 | 0.00885 | 0.062225 | 13 | 0.02348 | no | BRNNCC |
chr1_1661177_A_G_b38 | SAMD11 | 2.639 | 0.00914 | 0.06274 | 13 | 0.023775 | no | BRNNCC |
chr1_619417_C_T_b38 | SAMD11 | 2.633 | 0.0093 | 0.071873 | 7 | 0.027301 | no | BRNNCC |
chr1_1625805_G_A_b38 | SAMD11 | 2.621 | 0.00962 | 0.056032 | 32 | 0.021382 | no | BRNNCC |
chr1_1315752_GAGCGAGGGAGGTGGGGGCGGGGAGGGAGGGAGGGAGGCGGGC_G_b38 | SAMD11 | 3.204 | 0.00171 | 0.096242 | 4 | 0.030035 | yes | BRNPTM |
chr1_914991_G_T_b38 | SAMD11 | 2.844 | 0.00518 | 0.064593 | 33 | 0.022709 | yes | BRNPTM |
chr1_915400_C_T_b38 | SAMD11 | 2.724 | 0.00734 | 0.062581 | 31 | 0.022973 | yes | BRNPTM |
chr1_54490_G_A_b38 | SAMD11 | 2.714 | 0.00756 | 0.077505 | 7 | 0.028558 | yes | BRNPTM |
chr1_914618_A_G_b38 | SAMD11 | 2.647 | 0.00913 | 0.082551 | 3 | 0.031187 | yes | BRNPTM |
chr1_103241_C_T_b38 | SAMD11 | -2.979 | 0.00346 | -0.149735 | 3 | 0.050269 | no | BRNPTM |
chr1_836030_C_T_b38 | SAMD11 | -2.713 | 0.00758 | -0.088766 | 7 | 0.032721 | no | BRNPTM |
chr1_98933_T_A_b38 | SAMD11 | -2.657 | 0.00889 | -0.093645 | 3 | 0.035248 | no | BRNPTM |
chr1_791554_G_GGAATC_b38 | SAMD11 | -2.642 | 0.00926 | -0.072416 | 9 | 0.027409 | no | BRNPTM |
chr1_933741_T_TG_b38 | SAMD11 | 3.684 | 0.000373 | 0.16998 | 10 | 0.046139 | yes | BRNSPC |
chr1_935954_G_T_b38 | SAMD11 | 3.544 | 0.000601 | 0.166366 | 15 | 0.046942 | yes | BRNSPC |
chr1_946653_G_A_b38 | SAMD11 | -3.523 | 0.000645 | -0.175487 | 6 | 0.049815 | yes | BRNSPC |
chr1_1363601_A_AT_b38 | SAMD11 | 2.85 | 0.00531 | 0.115489 | 33 | 0.040519 | yes | BRNSPC |
chr1_1662738_CT_C_b38 | SAMD11 | -2.834 | 0.00557 | -0.207034 | 6 | 0.073066 | yes | BRNSPC |
chr1_1662855_T_C_b38 | SAMD11 | -2.834 | 0.00557 | -0.207034 | 6 | 0.073066 | yes | BRNSPC |
chr1_1324149_G_A_b38 | SAMD11 | 2.813 | 0.00592 | 0.103454 | 26 | 0.036783 | yes | BRNSPC |
chr1_933548_A_AG_b38 | SAMD11 | 2.741 | 0.00726 | 0.120105 | 19 | 0.043819 | yes | BRNSPC |
chr1_965337_CTTAT_C_b38 | SAMD11 | 2.72 | 0.00769 | 0.134505 | 18 | 0.049444 | yes | BRNSPC |
chr1_938178_G_T_b38 | SAMD11 | 3.619 | 0.000467 | 0.172247 | 14 | 0.047599 | no | BRNSPC |
chr1_954724_G_A_b38 | SAMD11 | -3.391 | 0.000999 | -0.167534 | 7 | 0.04941 | no | BRNSPC |
chr1_965666_ACC_A_b38 | SAMD11 | -3.327 | 0.00123 | -0.162719 | 7 | 0.048905 | no | BRNSPC |
chr1_945259_TC_T_b38 | SAMD11 | -3.15 | 0.00215 | -0.155443 | 7 | 0.049339 | no | BRNSPC |
chr1_965125_G_C_b38 | SAMD11 | -3.077 | 0.0027 | -0.152628 | 8 | 0.049601 | no | BRNSPC |
chr1_935265_T_C_b38 | SAMD11 | -3.071 | 0.00275 | -0.152231 | 11 | 0.049569 | no | BRNSPC |
chr1_941767_G_A_b38 | SAMD11 | -3.018 | 0.00323 | -0.151063 | 7 | 0.050052 | no | BRNSPC |
chr1_1650452_G_A_b38 | SAMD11 | -2.959 | 0.00385 | -0.256387 | 3 | 0.086634 | no | BRNSPC |
chr1_814476_C_T_b38 | SAMD11 | -2.854 | 0.00525 | -0.157825 | 4 | 0.055299 | no | BRNSPC |
chr1_960891_C_T_b38 | SAMD11 | 2.795 | 0.00622 | 0.12797 | 22 | 0.04578 | no | BRNSPC |
chr1_1902318_T_TA_b38 | SAMD11 | -2.72 | 0.0077 | -0.145671 | 10 | 0.053554 | no | BRNSPC |
chr1_933741_T_TG_b38 | SAMD11 | 4.411 | 2.91e-05 | 0.228479 | 7 | 0.051801 | yes | BRNSNG |
chr1_935954_G_T_b38 | SAMD11 | 3.936 | 0.000165 | 0.191009 | 13 | 0.048532 | yes | BRNSNG |
chr1_931513_T_C_b38 | SAMD11 | 3.882 | 2e-04 | 0.188634 | 20 | 0.048591 | yes | BRNSNG |
chr1_936972_G_C_b38 | SAMD11 | -3.816 | 0.000251 | -0.201314 | 7 | 0.05275 | yes | BRNSNG |
chr1_938178_G_T_b38 | SAMD11 | 3.732 | 0.000337 | 0.189468 | 11 | 0.050773 | yes | BRNSNG |
chr1_916657_G_A_b38 | SAMD11 | 3.671 | 0.000414 | 0.187226 | 25 | 0.051005 | yes | BRNSNG |
chr1_933548_A_AG_b38 | SAMD11 | 3.587 | 0.000549 | 0.173412 | 15 | 0.048344 | yes | BRNSNG |
chr1_916683_G_A_b38 | SAMD11 | 3.522 | 0.000682 | 0.183037 | 24 | 0.051973 | yes | BRNSNG |
chr1_1308549_G_T_b38 | SAMD11 | 3.291 | 0.00144 | 0.139408 | 27 | 0.042361 | yes | BRNSNG |
chr1_914838_T_A_b38 | SAMD11 | 3.29 | 0.00144 | 0.171748 | 25 | 0.052203 | yes | BRNSNG |
chr1_897376_T_G_b38 | SAMD11 | -3.118 | 0.00246 | -0.175351 | 4 | 0.056234 | yes | BRNSNG |
chr1_921096_A_G_b38 | SAMD11 | -3.107 | 0.00255 | -0.168373 | 16 | 0.054196 | yes | BRNSNG |
chr1_919598_A_C_b38 | SAMD11 | 3.102 | 0.00259 | 0.162516 | 20 | 0.052394 | yes | BRNSNG |
chr1_896680_G_A_b38 | SAMD11 | 3.071 | 0.00284 | 0.168905 | 5 | 0.055004 | yes | BRNSNG |
chr1_896686_G_C_b38 | SAMD11 | 3.071 | 0.00284 | 0.168905 | 5 | 0.055004 | yes | BRNSNG |
chr1_896732_T_C_b38 | SAMD11 | 3.071 | 0.00284 | 0.168905 | 5 | 0.055004 | yes | BRNSNG |
chr1_896798_A_G_b38 | SAMD11 | 3.071 | 0.00284 | 0.168905 | 5 | 0.055004 | yes | BRNSNG |
chr1_896917_CTG_C_b38 | SAMD11 | 3.071 | 0.00284 | 0.168905 | 5 | 0.055004 | yes | BRNSNG |
chr1_896938_C_A_b38 | SAMD11 | 3.071 | 0.00284 | 0.168905 | 5 | 0.055004 | yes | BRNSNG |
chr1_897792_T_TCGAA_b38 | SAMD11 | -3.071 | 0.00284 | -0.168905 | 5 | 0.055004 | yes | BRNSNG |
chr1_914991_G_T_b38 | SAMD11 | 3.046 | 0.00306 | 0.159635 | 19 | 0.052404 | yes | BRNSNG |
chr1_897580_AT_A_b38 | SAMD11 | -2.998 | 0.00353 | -0.154959 | 28 | 0.051691 | yes | BRNSNG |
chr1_915400_C_T_b38 | SAMD11 | 2.896 | 0.00477 | 0.152538 | 18 | 0.052681 | yes | BRNSNG |
chr1_946653_G_A_b38 | SAMD11 | -2.888 | 0.00488 | -0.167784 | 4 | 0.058101 | yes | BRNSNG |
chr1_896109_C_T_b38 | SAMD11 | 2.744 | 0.00737 | 0.152489 | 6 | 0.055581 | yes | BRNSNG |
chr1_935265_T_C_b38 | SAMD11 | -2.719 | 0.00789 | -0.144631 | 9 | 0.053194 | yes | BRNSNG |
chr1_14653_C_T_b38 | SAMD11 | 2.709 | 0.00812 | 0.195746 | 3 | 0.072267 | yes | BRNSNG |
chr1_920719_T_G_b38 | SAMD11 | -2.692 | 0.00851 | -0.142163 | 12 | 0.052818 | yes | BRNSNG |
chr1_920728_A_G_b38 | SAMD11 | -2.692 | 0.00851 | -0.142163 | 12 | 0.052818 | yes | BRNSNG |
chr1_917495_C_T_b38 | SAMD11 | 2.683 | 0.00871 | 0.140628 | 19 | 0.052407 | yes | BRNSNG |
chr1_918574_C_A_b38 | SAMD11 | 2.683 | 0.00871 | 0.140628 | 19 | 0.052407 | yes | BRNSNG |
chr1_897018_T_C_b38 | SAMD11 | 2.676 | 0.00888 | 0.151049 | 5 | 0.056438 | yes | BRNSNG |
chr1_905373_T_C_b38 | SAMD11 | -2.648 | 0.0096 | -0.138152 | 14 | 0.052173 | yes | BRNSNG |
chr1_941767_G_A_b38 | SAMD11 | -3.307 | 0.00137 | -0.189625 | 4 | 0.057335 | no | BRNSNG |
chr1_969377_A_ATG_b38 | SAMD11 | -3.151 | 0.00223 | -0.207597 | 3 | 0.065893 | no | BRNSNG |
chr1_897538_T_C_b38 | SAMD11 | -3.023 | 0.00328 | -0.162178 | 6 | 0.053649 | no | BRNSNG |
chr1_896529_C_T_b38 | SAMD11 | 3.023 | 0.00328 | 0.162178 | 6 | 0.053649 | no | BRNSNG |
chr1_954724_G_A_b38 | SAMD11 | -2.972 | 0.00381 | -0.171369 | 4 | 0.057658 | no | BRNSNG |
chr1_1187904_CA_C_b38 | SAMD11 | -2.851 | 0.00543 | -0.168937 | 4 | 0.059254 | no | BRNSNG |
chr1_965666_ACC_A_b38 | SAMD11 | -2.665 | 0.00917 | -0.155728 | 4 | 0.058443 | no | BRNSNG |
chr1_945259_TC_T_b38 | SAMD11 | -2.657 | 0.00937 | -0.152488 | 4 | 0.057399 | no | BRNSNG |
chr1_1367122_G_A_b38 | SAMD11 | 4.372 | 1.66e-05 | 0.344967 | 3 | 0.078906 | yes | BREAST |
chr1_1366951_A_AGT_b38 | SAMD11 | -3.655 | 3e-04 | -0.14318 | 8 | 0.039178 | yes | BREAST |
chr1_1329353_C_G_b38 | SAMD11 | 3.523 | 0.000488 | 0.213306 | 4 | 0.060544 | yes | BREAST |
chr1_1332271_G_A_b38 | SAMD11 | 3.523 | 0.000488 | 0.213306 | 4 | 0.060544 | yes | BREAST |
chr1_1366941_T_TGTGTGCA_b38 | SAMD11 | -3.482 | 0.000565 | -0.135425 | 8 | 0.038889 | yes | BREAST |
chr1_1002192_A_AT_b38 | SAMD11 | 3.313 | 0.00103 | 0.13529 | 4 | 0.040835 | yes | BREAST |
chr1_1425095_A_G_b38 | SAMD11 | 3.285 | 0.00113 | 0.19372 | 5 | 0.058965 | yes | BREAST |
chr1_1882426_CAAAAA_C_b38 | SAMD11 | -3.225 | 0.00139 | -0.109841 | 12 | 0.034057 | yes | BREAST |
chr1_710225_T_A_b38 | SAMD11 | 3.219 | 0.00142 | 0.141998 | 7 | 0.044117 | yes | BREAST |
chr1_1693427_G_A_b38 | SAMD11 | 3.208 | 0.00147 | 0.094903 | 66 | 0.029587 | yes | BREAST |
chr1_1424819_C_T_b38 | SAMD11 | 3.184 | 0.00159 | 0.176383 | 6 | 0.055401 | yes | BREAST |
chr1_1303959_T_G_b38 | SAMD11 | -3.048 | 0.00249 | -0.130474 | 24 | 0.042802 | yes | BREAST |
chr1_1296939_G_A_b38 | SAMD11 | 3.042 | 0.00254 | 0.129944 | 23 | 0.042717 | yes | BREAST |
chr1_14930_A_G_b38 | SAMD11 | -3.04 | 0.00255 | -0.0851 | 33 | 0.027989 | yes | BREAST |
chr1_1297213_G_A_b38 | SAMD11 | 2.774 | 0.00586 | 0.176009 | 7 | 0.063449 | yes | BREAST |
chr1_1319063_G_A_b38 | SAMD11 | -2.648 | 0.00848 | -0.113878 | 24 | 0.043001 | yes | BREAST |
chr1_1319461_C_G_b38 | SAMD11 | -2.648 | 0.00848 | -0.113878 | 24 | 0.043001 | yes | BREAST |
chr1_1320023_TG_T_b38 | SAMD11 | -2.648 | 0.00848 | -0.113878 | 24 | 0.043001 | yes | BREAST |
chr1_1009470_A_T_b38 | SAMD11 | 2.629 | 0.00897 | 0.152638 | 3 | 0.058062 | yes | BREAST |
chr1_1681370_T_G_b38 | SAMD11 | -2.592 | 0.00997 | -0.089647 | 11 | 0.034585 | yes | BREAST |
chr1_1424727_C_A_b38 | SAMD11 | 3.535 | 0.000467 | 0.190172 | 7 | 0.053794 | no | BREAST |
chr1_1372258_T_C_b38 | SAMD11 | -3.268 | 0.0012 | -0.157828 | 6 | 0.048301 | no | BREAST |
chr1_1284756_A_G_b38 | SAMD11 | -2.796 | 0.00548 | -0.129885 | 27 | 0.046448 | no | BREAST |
chr1_1374694_C_G_b38 | SAMD11 | -2.763 | 0.00605 | -0.131343 | 7 | 0.047537 | no | BREAST |
chr1_134266_G_A_b38 | SAMD11 | -2.741 | 0.00647 | -0.109744 | 3 | 0.040042 | no | BREAST |
chr1_1287315_G_C_b38 | SAMD11 | -2.698 | 0.00735 | -0.141733 | 8 | 0.052542 | no | BREAST |
chr1_665220_T_C_b38 | SAMD11 | 2.673 | 0.00791 | 0.187552 | 4 | 0.070176 | no | BREAST |
chr1_1277415_C_A_b38 | SAMD11 | -2.609 | 0.0095 | -0.118201 | 13 | 0.045308 | no | BREAST |
chr1_1278556_G_A_b38 | SAMD11 | -2.609 | 0.0095 | -0.118201 | 13 | 0.045308 | no | BREAST |
chr1_925036_G_A_b38 | SAMD11 | 4.383 | 1.49e-05 | 0.080546 | 51 | 0.018378 | yes | CULTFB |
chr1_926250_G_A_b38 | SAMD11 | 4.32 | 1.96e-05 | 0.079731 | 55 | 0.018456 | yes | CULTFB |
chr1_915824_G_C_b38 | SAMD11 | -4.306 | 2.08e-05 | -0.077335 | 36 | 0.017961 | yes | CULTFB |
chr1_923421_A_G_b38 | SAMD11 | 4.263 | 2.51e-05 | 0.078059 | 50 | 0.018312 | yes | CULTFB |
chr1_925308_G_A_b38 | SAMD11 | 4.238 | 2.78e-05 | 0.07755 | 57 | 0.018298 | yes | CULTFB |
chr1_923311_TG_T_b38 | SAMD11 | 4.188 | 3.44e-05 | 0.077034 | 49 | 0.018394 | yes | CULTFB |
chr1_913274_TG_T_b38 | SAMD11 | -4.157 | 3.93e-05 | -0.080513 | 21 | 0.019368 | yes | CULTFB |
chr1_933741_T_TG_b38 | SAMD11 | 4.155 | 3.96e-05 | 0.069785 | 60 | 0.016797 | yes | CULTFB |
chr1_917378_G_C_b38 | SAMD11 | -4.054 | 6.02e-05 | -0.079213 | 20 | 0.019539 | yes | CULTFB |
chr1_933548_A_AG_b38 | SAMD11 | 4.048 | 6.17e-05 | 0.065671 | 84 | 0.016223 | yes | CULTFB |
chr1_921056_TG_T_b38 | SAMD11 | -3.981 | 8.11e-05 | -0.079114 | 18 | 0.019873 | yes | CULTFB |
chr1_939779_AGCCAGTGGACGCCGACCT_A_b38 | SAMD11 | 3.856 | 0.000134 | 0.061992 | 103 | 0.016076 | yes | CULTFB |
chr1_936972_G_C_b38 | SAMD11 | -3.821 | 0.000153 | -0.064657 | 52 | 0.01692 | yes | CULTFB |
chr1_910255_C_T_b38 | SAMD11 | -3.816 | 0.000156 | -0.075536 | 19 | 0.019792 | yes | CULTFB |
chr1_940390_A_G_b38 | SAMD11 | 3.791 | 0.000172 | 0.060905 | 126 | 0.016064 | yes | CULTFB |
chr1_927486_C_T_b38 | SAMD11 | 3.665 | 0.000279 | 0.067396 | 53 | 0.018388 | yes | CULTFB |
chr1_938178_G_T_b38 | SAMD11 | 3.566 | 0.000406 | 0.060825 | 76 | 0.017059 | yes | CULTFB |
chr1_928622_G_C_b38 | SAMD11 | -3.533 | 0.000457 | -0.068856 | 21 | 0.01949 | yes | CULTFB |
chr1_935954_G_T_b38 | SAMD11 | 3.482 | 0.00055 | 0.058861 | 75 | 0.016903 | yes | CULTFB |
chr1_929558_G_A_b38 | SAMD11 | 3.478 | 0.000558 | 0.062654 | 62 | 0.018012 | yes | CULTFB |
chr1_1009470_A_T_b38 | SAMD11 | -3.416 | 0.000697 | -0.110429 | 4 | 0.032323 | yes | CULTFB |
chr1_932255_C_T_b38 | SAMD11 | -3.389 | 0.000769 | -0.066058 | 21 | 0.019492 | yes | CULTFB |
chr1_929839_G_A_b38 | SAMD11 | -3.339 | 0.000917 | -0.0655 | 21 | 0.019616 | yes | CULTFB |
chr1_1447108_A_ATT_b38 | SAMD11 | -3.317 | 0.000992 | -0.069658 | 22 | 0.021003 | yes | CULTFB |
chr1_1020947_C_T_b38 | SAMD11 | -3.311 | 0.00101 | -0.109363 | 3 | 0.033034 | yes | CULTFB |
chr1_940296_GCC_G_b38 | SAMD11 | 3.279 | 0.00113 | 0.051597 | 92 | 0.015733 | yes | CULTFB |
chr1_789680_A_AGGAAT_b38 | SAMD11 | 3.137 | 0.00183 | 0.075976 | 12 | 0.024222 | yes | CULTFB |
chr1_942335_C_G_b38 | SAMD11 | 3.116 | 0.00196 | 0.088175 | 9 | 0.028293 | yes | CULTFB |
chr1_1497605_G_C_b38 | SAMD11 | -3.114 | 0.00197 | -0.05664 | 56 | 0.018189 | yes | CULTFB |
chr1_902949_G_GC_b38 | SAMD11 | -3.108 | 0.00202 | -0.061247 | 17 | 0.019708 | yes | CULTFB |
chr1_1182832_T_C_b38 | SAMD11 | -3.1 | 0.00207 | -0.056675 | 64 | 0.018282 | yes | CULTFB |
chr1_928210_G_A_b38 | SAMD11 | -3.071 | 0.00228 | -0.07979 | 5 | 0.025983 | yes | CULTFB |
chr1_898261_T_C_b38 | SAMD11 | -3.026 | 0.00263 | -0.053166 | 42 | 0.017571 | yes | CULTFB |
chr1_899452_G_C_b38 | SAMD11 | -3.006 | 0.00281 | -0.0533 | 40 | 0.017734 | yes | CULTFB |
chr1_898279_T_A_b38 | SAMD11 | -2.986 | 0.00299 | -0.052761 | 41 | 0.017669 | yes | CULTFB |
chr1_898283_A_G_b38 | SAMD11 | -2.986 | 0.00299 | -0.052761 | 41 | 0.017669 | yes | CULTFB |
chr1_901149_C_G_b38 | SAMD11 | -2.983 | 0.00302 | -0.058984 | 17 | 0.019772 | yes | CULTFB |
chr1_901544_G_A_b38 | SAMD11 | -2.983 | 0.00302 | -0.058984 | 17 | 0.019772 | yes | CULTFB |
chr1_1289964_TCC_T_b38 | SAMD11 | -2.975 | 0.0031 | -0.161697 | 4 | 0.054348 | yes | CULTFB |
chr1_1512376_G_C_b38 | SAMD11 | -2.964 | 0.00322 | -0.065034 | 41 | 0.021944 | yes | CULTFB |
chr1_898547_T_C_b38 | SAMD11 | -2.946 | 0.00341 | -0.057161 | 19 | 0.019405 | yes | CULTFB |
chr1_897843_C_T_b38 | SAMD11 | -2.916 | 0.00374 | -0.051719 | 40 | 0.017739 | yes | CULTFB |
chr1_897922_C_T_b38 | SAMD11 | -2.916 | 0.00374 | -0.051719 | 40 | 0.017739 | yes | CULTFB |
chr1_898444_T_C_b38 | SAMD11 | -2.916 | 0.00374 | -0.051719 | 40 | 0.017739 | yes | CULTFB |
chr1_632487_A_G_b38 | SAMD11 | -2.906 | 0.00386 | -0.092882 | 14 | 0.031966 | yes | CULTFB |
chr1_897018_T_C_b38 | SAMD11 | 2.88 | 0.00418 | 0.054198 | 25 | 0.018818 | yes | CULTFB |
chr1_973929_T_C_b38 | SAMD11 | -2.88 | 0.00418 | -0.05539 | 27 | 0.019232 | yes | CULTFB |
chr1_1059931_C_T_b38 | SAMD11 | -2.871 | 0.0043 | -0.1561 | 3 | 0.054363 | yes | CULTFB |
chr1_897792_T_TCGAA_b38 | SAMD11 | -2.87 | 0.00432 | -0.049162 | 49 | 0.017132 | yes | CULTFB |
chr1_896680_G_A_b38 | SAMD11 | 2.87 | 0.00432 | 0.049162 | 49 | 0.017132 | yes | CULTFB |
chr1_896686_G_C_b38 | SAMD11 | 2.87 | 0.00432 | 0.049162 | 49 | 0.017132 | yes | CULTFB |
chr1_896732_T_C_b38 | SAMD11 | 2.87 | 0.00432 | 0.049162 | 49 | 0.017132 | yes | CULTFB |
chr1_896917_CTG_C_b38 | SAMD11 | 2.87 | 0.00432 | 0.049162 | 49 | 0.017132 | yes | CULTFB |
chr1_896938_C_A_b38 | SAMD11 | 2.87 | 0.00432 | 0.049162 | 49 | 0.017132 | yes | CULTFB |
chr1_1058201_G_A_b38 | SAMD11 | -2.834 | 0.00482 | -0.136884 | 4 | 0.048301 | yes | CULTFB |
chr1_1513923_G_C_b38 | SAMD11 | -2.811 | 0.00518 | -0.059441 | 45 | 0.021148 | yes | CULTFB |
chr1_931558_G_A_b38 | SAMD11 | -2.803 | 0.0053 | -0.052878 | 24 | 0.018862 | yes | CULTFB |
chr1_896529_C_T_b38 | SAMD11 | 2.799 | 0.00537 | 0.047916 | 51 | 0.017121 | yes | CULTFB |
chr1_896109_C_T_b38 | SAMD11 | 2.798 | 0.00538 | 0.04963 | 51 | 0.017736 | yes | CULTFB |
chr1_896798_A_G_b38 | SAMD11 | 2.781 | 0.00567 | 0.047827 | 49 | 0.017197 | yes | CULTFB |
chr1_1457033_A_C_b38 | SAMD11 | -2.776 | 0.00575 | -0.058799 | 24 | 0.021178 | yes | CULTFB |
chr1_966227_C_G_b38 | SAMD11 | 2.767 | 0.00591 | 0.082151 | 10 | 0.029689 | yes | CULTFB |
chr1_897538_T_C_b38 | SAMD11 | -2.763 | 0.00598 | -0.047424 | 50 | 0.017164 | yes | CULTFB |
chr1_892786_A_G_b38 | SAMD11 | -2.739 | 0.00642 | -0.049419 | 37 | 0.01804 | yes | CULTFB |
chr1_954333_C_A_b38 | SAMD11 | 2.737 | 0.00646 | 0.081969 | 6 | 0.029945 | yes | CULTFB |
chr1_928223_T_A_b38 | SAMD11 | -2.734 | 0.00653 | -0.072298 | 5 | 0.026445 | yes | CULTFB |
chr1_962184_T_C_b38 | SAMD11 | 2.734 | 0.00653 | 0.081673 | 7 | 0.029875 | yes | CULTFB |
chr1_1510122_G_C_b38 | SAMD11 | -2.716 | 0.00689 | -0.076027 | 4 | 0.027995 | yes | CULTFB |
chr1_814476_C_T_b38 | SAMD11 | 2.696 | 0.0073 | 0.056685 | 18 | 0.021025 | yes | CULTFB |
chr1_1063121_G_C_b38 | SAMD11 | -2.695 | 0.00733 | -0.055551 | 19 | 0.020615 | yes | CULTFB |
chr1_954258_G_C_b38 | SAMD11 | 2.669 | 0.0079 | 0.079881 | 6 | 0.029924 | yes | CULTFB |
chr1_1716919_CTTT_C_b38 | SAMD11 | 2.664 | 0.00803 | 0.148306 | 4 | 0.055677 | yes | CULTFB |
chr1_1002195_T_TA_b38 | SAMD11 | 2.66 | 0.00812 | 0.076364 | 3 | 0.028707 | yes | CULTFB |
chr1_897376_T_G_b38 | SAMD11 | -2.66 | 0.00812 | -0.04648 | 45 | 0.017473 | yes | CULTFB |
chr1_907538_T_TA_b38 | SAMD11 | -2.652 | 0.00832 | -0.048166 | 42 | 0.018165 | yes | CULTFB |
chr1_1288341_C_T_b38 | SAMD11 | -2.636 | 0.00871 | -0.075997 | 12 | 0.028832 | yes | CULTFB |
chr1_1530331_T_C_b38 | SAMD11 | -2.633 | 0.00878 | -0.056776 | 46 | 0.021562 | yes | CULTFB |
chr1_1071823_A_G_b38 | SAMD11 | -2.618 | 0.00916 | -0.050802 | 24 | 0.019403 | yes | CULTFB |
chr1_1062896_T_C_b38 | SAMD11 | -2.61 | 0.00938 | -0.129897 | 4 | 0.049767 | yes | CULTFB |
chr1_1023525_A_G_b38 | SAMD11 | -2.604 | 0.00956 | -0.04341 | 64 | 0.016673 | yes | CULTFB |
chr1_922671_C_T_b38 | SAMD11 | -4.463 | 1.04e-05 | -0.08913 | 16 | 0.019969 | no | CULTFB |
chr1_911848_C_T_b38 | SAMD11 | -4.311 | 2.03e-05 | -0.082267 | 24 | 0.019081 | no | CULTFB |
chr1_915810_G_A_b38 | SAMD11 | -4.291 | 2.22e-05 | -0.077858 | 30 | 0.018145 | no | CULTFB |
chr1_911428_C_T_b38 | SAMD11 | -4.279 | 2.34e-05 | -0.079148 | 31 | 0.018497 | no | CULTFB |
chr1_913065_G_A_b38 | SAMD11 | -4.264 | 2.49e-05 | -0.07826 | 29 | 0.018352 | no | CULTFB |
chr1_913076_A_G_b38 | SAMD11 | -4.264 | 2.49e-05 | -0.07826 | 29 | 0.018352 | no | CULTFB |
chr1_914682_A_T_b38 | SAMD11 | -4.25 | 2.65e-05 | -0.077298 | 30 | 0.018189 | no | CULTFB |
chr1_914483_G_GACTGCCCAGCTC_b38 | SAMD11 | -4.239 | 2.77e-05 | -0.07742 | 29 | 0.018263 | no | CULTFB |
chr1_922660_C_A_b38 | SAMD11 | -4.23 | 2.88e-05 | -0.085424 | 16 | 0.020195 | no | CULTFB |
chr1_912111_G_A_b38 | SAMD11 | -4.184 | 3.5e-05 | -0.076535 | 30 | 0.01829 | no | CULTFB |
chr1_911484_G_C_b38 | SAMD11 | -4.162 | 3.85e-05 | -0.077914 | 28 | 0.018722 | no | CULTFB |
chr1_918870_A_G_b38 | SAMD11 | -4.097 | 5.05e-05 | -0.074401 | 30 | 0.018161 | no | CULTFB |
chr1_910558_G_A_b38 | SAMD11 | -4.036 | 6.48e-05 | -0.073649 | 40 | 0.018248 | no | CULTFB |
chr1_921096_A_G_b38 | SAMD11 | -4.016 | 7.02e-05 | -0.066047 | 92 | 0.016444 | no | CULTFB |
chr1_915400_C_T_b38 | SAMD11 | 3.98 | 8.13e-05 | 0.064629 | 93 | 0.016237 | no | CULTFB |
chr1_909894_G_T_b38 | SAMD11 | -3.941 | 9.54e-05 | -0.072964 | 39 | 0.018515 | no | CULTFB |
chr1_914838_T_A_b38 | SAMD11 | 3.928 | 1e-04 | 0.065826 | 122 | 0.016759 | no | CULTFB |
chr1_916683_G_A_b38 | SAMD11 | 3.908 | 0.000109 | 0.06563 | 124 | 0.016795 | no | CULTFB |
chr1_917859_A_G_b38 | SAMD11 | -3.896 | 0.000114 | -0.075671 | 21 | 0.019421 | no | CULTFB |
chr1_911018_G_A_b38 | SAMD11 | -3.884 | 0.000119 | -0.072682 | 33 | 0.018711 | no | CULTFB |
chr1_916657_G_A_b38 | SAMD11 | 3.872 | 0.000125 | 0.06484 | 125 | 0.016745 | no | CULTFB |
chr1_919598_A_C_b38 | SAMD11 | 3.826 | 0.00015 | 0.062105 | 103 | 0.016232 | no | CULTFB |
chr1_917495_C_T_b38 | SAMD11 | 3.814 | 0.000158 | 0.061977 | 101 | 0.01625 | no | CULTFB |
chr1_912710_G_A_b38 | SAMD11 | -3.801 | 0.000166 | -0.072252 | 23 | 0.019009 | no | CULTFB |
chr1_913358_C_T_b38 | SAMD11 | -3.801 | 0.000166 | -0.072252 | 23 | 0.019009 | no | CULTFB |
chr1_955679_C_T_b38 | SAMD11 | 3.784 | 0.000177 | 0.06493 | 96 | 0.017159 | no | CULTFB |
chr1_981935_G_A_b38 | SAMD11 | -3.772 | 0.000185 | -0.074127 | 22 | 0.01965 | no | CULTFB |
chr1_917284_C_T_b38 | SAMD11 | -3.767 | 0.000189 | -0.071622 | 23 | 0.019012 | no | CULTFB |
chr1_956565_A_G_b38 | SAMD11 | 3.761 | 0.000194 | 0.064466 | 96 | 0.01714 | no | CULTFB |
chr1_914991_G_T_b38 | SAMD11 | 3.757 | 0.000196 | 0.060187 | 99 | 0.016018 | no | CULTFB |
chr1_918574_C_A_b38 | SAMD11 | 3.747 | 0.000205 | 0.061002 | 100 | 0.016282 | no | CULTFB |
chr1_975555_G_A_b38 | SAMD11 | -3.696 | 0.000249 | -0.070487 | 28 | 0.019072 | no | CULTFB |
chr1_946247_G_A_b38 | SAMD11 | 3.684 | 0.00026 | 0.063547 | 101 | 0.017248 | no | CULTFB |
chr1_914743_C_T_b38 | SAMD11 | -3.669 | 0.000275 | -0.069777 | 23 | 0.019016 | no | CULTFB |
chr1_982890_C_T_b38 | SAMD11 | -3.655 | 0.000291 | -0.072849 | 21 | 0.019933 | no | CULTFB |
chr1_983237_G_A_b38 | SAMD11 | -3.655 | 0.000291 | -0.072849 | 21 | 0.019933 | no | CULTFB |
chr1_931513_T_C_b38 | SAMD11 | 3.654 | 0.000291 | 0.059782 | 113 | 0.016359 | no | CULTFB |
chr1_965337_CTTAT_C_b38 | SAMD11 | 3.623 | 0.000328 | 0.062998 | 103 | 0.017389 | no | CULTFB |
chr1_949171_GAGAA_G_b38 | SAMD11 | 3.592 | 0.000367 | 0.061783 | 97 | 0.017198 | no | CULTFB |
chr1_978230_G_A_b38 | SAMD11 | -3.546 | 0.000436 | -0.070422 | 20 | 0.019858 | no | CULTFB |
chr1_982112_C_T_b38 | SAMD11 | -3.525 | 0.000472 | -0.070289 | 21 | 0.019942 | no | CULTFB |
chr1_981282_A_C_b38 | SAMD11 | -3.457 | 0.000603 | -0.067607 | 23 | 0.019557 | no | CULTFB |
chr1_971790_AG_A_b38 | SAMD11 | -3.455 | 0.000607 | -0.056766 | 68 | 0.016429 | no | CULTFB |
chr1_976536_C_T_b38 | SAMD11 | -3.447 | 0.000624 | -0.068975 | 20 | 0.020008 | no | CULTFB |
chr1_910698_C_T_b38 | SAMD11 | -3.442 | 0.000636 | -0.067076 | 21 | 0.019486 | no | CULTFB |
chr1_967865_A_G_b38 | SAMD11 | 3.414 | 0.000703 | 0.054746 | 135 | 0.016035 | no | CULTFB |
chr1_1776774_A_T_b38 | SAMD11 | -3.384 | 0.000783 | -0.100043 | 3 | 0.029563 | no | CULTFB |
chr1_960891_C_T_b38 | SAMD11 | 3.349 | 0.000885 | 0.056726 | 110 | 0.016937 | no | CULTFB |
chr1_920719_T_G_b38 | SAMD11 | -3.339 | 0.000918 | -0.054008 | 75 | 0.016176 | no | CULTFB |
chr1_920728_A_G_b38 | SAMD11 | -3.339 | 0.000918 | -0.054008 | 75 | 0.016176 | no | CULTFB |
chr1_969750_ATG_A_b38 | SAMD11 | 3.339 | 0.000918 | 0.053497 | 132 | 0.016024 | no | CULTFB |
chr1_919695_C_G_b38 | SAMD11 | 3.245 | 0.00127 | 0.052417 | 76 | 0.016151 | no | CULTFB |
chr1_961945_G_C_b38 | SAMD11 | 3.13 | 0.00188 | 0.088752 | 10 | 0.028359 | no | CULTFB |
chr1_935265_T_C_b38 | SAMD11 | -3.109 | 0.00201 | -0.054444 | 43 | 0.017514 | no | CULTFB |
chr1_968046_C_T_b38 | SAMD11 | -3.103 | 0.00205 | -0.053614 | 55 | 0.01728 | no | CULTFB |
chr1_898818_T_C_b38 | SAMD11 | -3.088 | 0.00215 | -0.061457 | 17 | 0.019901 | no | CULTFB |
chr1_919397_A_G_b38 | SAMD11 | 3.037 | 0.00254 | 0.049192 | 75 | 0.016199 | no | CULTFB |
chr1_965666_ACC_A_b38 | SAMD11 | -3.009 | 0.00278 | -0.055751 | 30 | 0.018526 | no | CULTFB |
chr1_949046_A_AACAGCAAAG_b38 | SAMD11 | 2.98 | 0.00305 | 0.088315 | 8 | 0.029637 | no | CULTFB |
chr1_1501403_T_C_b38 | SAMD11 | -2.973 | 0.00313 | -0.065557 | 41 | 0.022055 | no | CULTFB |
chr1_1511945_G_A_b38 | SAMD11 | -2.953 | 0.00333 | -0.066116 | 41 | 0.022392 | no | CULTFB |
chr1_904947_G_A_b38 | SAMD11 | -2.942 | 0.00345 | -0.060396 | 15 | 0.020532 | no | CULTFB |
chr1_975093_G_A_b38 | SAMD11 | -2.933 | 0.00355 | -0.064107 | 13 | 0.021859 | no | CULTFB |
chr1_973443_G_A_b38 | SAMD11 | -2.921 | 0.00368 | -0.058398 | 22 | 0.019991 | no | CULTFB |
chr1_924305_G_A_b38 | SAMD11 | -2.901 | 0.00392 | -0.053722 | 32 | 0.018519 | no | CULTFB |
chr1_629218_A_G_b38 | SAMD11 | -2.879 | 0.0042 | -0.121231 | 10 | 0.042115 | no | CULTFB |
chr1_1524664_A_G_b38 | SAMD11 | -2.822 | 0.005 | -0.059959 | 52 | 0.021244 | no | CULTFB |
chr1_969663_CAT_C_b38 | SAMD11 | -2.795 | 0.00544 | -0.051326 | 32 | 0.018366 | no | CULTFB |
chr1_945259_TC_T_b38 | SAMD11 | -2.793 | 0.00546 | -0.051666 | 31 | 0.018497 | no | CULTFB |
chr1_946653_G_A_b38 | SAMD11 | -2.793 | 0.00547 | -0.053736 | 26 | 0.019243 | no | CULTFB |
chr1_504819_C_T_b38 | SAMD11 | 2.783 | 0.00564 | 0.11556 | 3 | 0.04153 | no | CULTFB |
chr1_605526_A_G_b38 | SAMD11 | 2.774 | 0.0058 | 0.088303 | 3 | 0.031837 | no | CULTFB |
chr1_1516000_T_C_b38 | SAMD11 | -2.768 | 0.00589 | -0.059664 | 45 | 0.021555 | no | CULTFB |
chr1_1182018_A_G_b38 | SAMD11 | -2.718 | 0.00684 | -0.04722 | 100 | 0.017371 | no | CULTFB |
chr1_900119_A_G_b38 | SAMD11 | -2.703 | 0.00717 | -0.047469 | 38 | 0.017565 | no | CULTFB |
chr1_914948_CA_C_b38 | SAMD11 | -2.702 | 0.00718 | -0.055266 | 21 | 0.020455 | no | CULTFB |
chr1_1082517_C_A_b38 | SAMD11 | 2.685 | 0.00755 | 0.148654 | 3 | 0.055371 | no | CULTFB |
chr1_928216_A_AC_b38 | SAMD11 | -2.672 | 0.00785 | -0.066131 | 7 | 0.024753 | no | CULTFB |
chr1_1578879_A_T_b38 | SAMD11 | -2.669 | 0.00791 | -0.088024 | 5 | 0.032983 | no | CULTFB |
chr1_976215_A_G_b38 | SAMD11 | 2.665 | 0.00801 | 0.04925 | 41 | 0.018482 | no | CULTFB |
chr1_967384_C_G_b38 | SAMD11 | 2.658 | 0.00817 | 0.047014 | 98 | 0.017688 | no | CULTFB |
chr1_1457071_C_T_b38 | SAMD11 | -2.639 | 0.00864 | -0.055762 | 25 | 0.021133 | no | CULTFB |
chr1_1263831_T_TA_b38 | SAMD11 | -2.624 | 0.00901 | -0.078911 | 4 | 0.030071 | no | CULTFB |
chr1_1177318_C_CT_b38 | SAMD11 | -2.618 | 0.00917 | -0.065732 | 5 | 0.025107 | no | CULTFB |
chr1_1058952_T_C_b38 | SAMD11 | 2.614 | 0.00928 | 0.120958 | 3 | 0.046272 | no | CULTFB |
chr1_1002745_G_A_b38 | SAMD11 | 3.382 | 0.00083 | 0.114656 | 16 | 0.033905 | yes | CLNSGM |
chr1_994949_C_T_b38 | SAMD11 | 3.288 | 0.00115 | 0.115875 | 13 | 0.035239 | yes | CLNSGM |
chr1_994997_C_T_b38 | SAMD11 | 3.288 | 0.00115 | 0.115875 | 13 | 0.035239 | yes | CLNSGM |
chr1_1004111_TG_T_b38 | SAMD11 | 3.244 | 0.00133 | 0.113303 | 15 | 0.034927 | yes | CLNSGM |
chr1_996254_A_AGGGAGGGCAG_b38 | SAMD11 | 3.166 | 0.00173 | 0.112902 | 13 | 0.035656 | yes | CLNSGM |
chr1_1068249_C_T_b38 | SAMD11 | -3.148 | 0.00183 | -0.098716 | 32 | 0.031354 | yes | CLNSGM |
chr1_997077_G_A_b38 | SAMD11 | 3.138 | 0.00189 | 0.110477 | 15 | 0.035201 | yes | CLNSGM |
chr1_996168_G_T_b38 | SAMD11 | 3.092 | 0.0022 | 0.108737 | 15 | 0.035162 | yes | CLNSGM |
chr1_1000335_C_T_b38 | SAMD11 | 3.061 | 0.00243 | 0.108117 | 15 | 0.035317 | yes | CLNSGM |
chr1_1080437_G_A_b38 | SAMD11 | -3.051 | 0.00252 | -0.098621 | 26 | 0.032328 | yes | CLNSGM |
chr1_1064776_C_T_b38 | SAMD11 | -3.036 | 0.00264 | -0.095156 | 36 | 0.031346 | yes | CLNSGM |
chr1_1081961_G_T_b38 | SAMD11 | -3.007 | 0.00289 | -0.09857 | 26 | 0.032778 | yes | CLNSGM |
chr1_1065797_G_C_b38 | SAMD11 | -2.984 | 0.00311 | -0.093071 | 31 | 0.031186 | yes | CLNSGM |
chr1_1057472_AAG_A_b38 | SAMD11 | -2.964 | 0.00331 | -0.104193 | 18 | 0.035149 | yes | CLNSGM |
chr1_992361_G_A_b38 | SAMD11 | 2.853 | 0.00467 | 0.102707 | 13 | 0.035994 | yes | CLNSGM |
chr1_986280_C_T_b38 | SAMD11 | 2.844 | 0.0048 | 0.102702 | 13 | 0.036107 | yes | CLNSGM |
chr1_986629_G_A_b38 | SAMD11 | 2.844 | 0.0048 | 0.102702 | 13 | 0.036107 | yes | CLNSGM |
chr1_1067552_C_G_b38 | SAMD11 | -2.842 | 0.00484 | -0.092846 | 24 | 0.032675 | yes | CLNSGM |
chr1_1056344_C_T_b38 | SAMD11 | -2.788 | 0.0057 | -0.098553 | 18 | 0.035353 | yes | CLNSGM |
chr1_1085543_A_AG_b38 | SAMD11 | -2.781 | 0.00582 | -0.08639 | 35 | 0.031067 | yes | CLNSGM |
chr1_1674633_C_CA_b38 | SAMD11 | -2.777 | 0.00588 | -0.084715 | 35 | 0.030506 | yes | CLNSGM |
chr1_1629332_G_T_b38 | SAMD11 | -2.776 | 0.00591 | -0.085647 | 38 | 0.030856 | yes | CLNSGM |
chr1_1673968_GA_G_b38 | SAMD11 | -2.738 | 0.00661 | -0.094816 | 32 | 0.034631 | yes | CLNSGM |
chr1_1675091_A_G_b38 | SAMD11 | 2.701 | 0.00736 | 0.091546 | 17 | 0.033893 | yes | CLNSGM |
chr1_1059011_G_T_b38 | SAMD11 | -2.668 | 0.0081 | -0.095175 | 17 | 0.035667 | yes | CLNSGM |
chr1_1086315_A_G_b38 | SAMD11 | -2.668 | 0.00811 | -0.081395 | 33 | 0.030512 | yes | CLNSGM |
chr1_1062389_CG_C_b38 | SAMD11 | 2.649 | 0.00855 | 0.083354 | 28 | 0.031461 | yes | CLNSGM |
chr1_993036_G_A_b38 | SAMD11 | 2.643 | 0.00872 | 0.091553 | 16 | 0.034642 | yes | CLNSGM |
chr1_1367036_GTGAATTGGT_G_b38 | SAMD11 | 2.624 | 0.00919 | 0.186647 | 3 | 0.071124 | yes | CLNSGM |
chr1_680702_C_T_b38 | SAMD11 | 2.61 | 0.00959 | 0.105956 | 8 | 0.040603 | yes | CLNSGM |
chr1_1030547_CGCATGGTGCTGAGAGATCAGCATGTGTGTGTGCAGTGCATGGTGCTGTGAGATCAGCGTGTGTGTGTGTGCAGTGCATGGTGCTGAGTGTGAGATCAGCATGTGTGTGTGTGCAGTGCATGGTGCTGTGAGATCAGTGTGTGTGTGTGCAGT_C_b38 | SAMD11 | 2.596 | 0.00997 | 0.199591 | 3 | 0.076885 | yes | CLNSGM |
chr1_1657093_C_A_b38 | SAMD11 | 2.944 | 0.00353 | 0.105672 | 21 | 0.035893 | no | CLNSGM |
chr1_1667424_T_TAAATA_b38 | SAMD11 | 2.933 | 0.00366 | 0.084471 | 56 | 0.028804 | no | CLNSGM |
chr1_1804001_AAAG_A_b38 | SAMD11 | 2.921 | 0.00379 | 0.135421 | 12 | 0.046356 | no | CLNSGM |
chr1_890446_C_CA_b38 | SAMD11 | -2.912 | 0.0039 | -0.112725 | 9 | 0.038706 | no | CLNSGM |
chr1_1673060_G_A_b38 | SAMD11 | -2.862 | 0.00454 | -0.083067 | 70 | 0.02902 | no | CLNSGM |
chr1_816108_G_GA_b38 | SAMD11 | 2.821 | 0.00516 | 0.130591 | 6 | 0.0463 | no | CLNSGM |
chr1_1671995_G_T_b38 | SAMD11 | -2.784 | 0.00575 | -0.079948 | 70 | 0.028712 | no | CLNSGM |
chr1_1630798_C_T_b38 | SAMD11 | -2.757 | 0.00625 | -0.086311 | 35 | 0.031311 | no | CLNSGM |
chr1_1674720_TGC_T_b38 | SAMD11 | -2.731 | 0.00674 | -0.078313 | 71 | 0.028674 | no | CLNSGM |
chr1_1676790_C_T_b38 | SAMD11 | -2.73 | 0.00675 | -0.077818 | 73 | 0.0285 | no | CLNSGM |
chr1_1673818_A_C_b38 | SAMD11 | -2.715 | 0.00706 | -0.078409 | 72 | 0.028875 | no | CLNSGM |
chr1_1674868_G_A_b38 | SAMD11 | -2.691 | 0.00759 | -0.077013 | 72 | 0.028624 | no | CLNSGM |
chr1_1670423_AT_A_b38 | SAMD11 | -2.668 | 0.0081 | -0.090045 | 40 | 0.033744 | no | CLNSGM |
chr1_1365036_T_TA_b38 | SAMD11 | 2.647 | 0.0086 | 0.190473 | 5 | 0.071946 | no | CLNSGM |
chr1_1308551_GGGA_G_b38 | SAMD11 | 2.628 | 0.00909 | 0.169953 | 4 | 0.064668 | no | CLNSGM |
chr1_1650688_T_A_b38 | SAMD11 | 2.603 | 0.00977 | 0.085868 | 22 | 0.032991 | no | CLNSGM |
chr1_1174174_G_C_b38 | SAMD11 | -2.926 | 0.0037 | -0.110006 | 4 | 0.037601 | yes | CLNTRN |
chr1_629906_C_T_b38 | SAMD11 | 2.798 | 0.00547 | 0.094164 | 8 | 0.033649 | yes | CLNTRN |
chr1_1510082_TA_T_b38 | SAMD11 | -2.763 | 0.00609 | -0.121656 | 4 | 0.044034 | yes | CLNTRN |
chr1_1174273_G_A_b38 | SAMD11 | -2.734 | 0.00664 | -0.09367 | 5 | 0.034267 | yes | CLNTRN |
chr1_202496_T_A_b38 | SAMD11 | -2.699 | 0.00735 | -0.0624 | 58 | 0.023117 | yes | CLNTRN |
chr1_1174639_A_G_b38 | SAMD11 | -2.647 | 0.00854 | -0.089038 | 6 | 0.033631 | yes | CLNTRN |
chr1_185795_G_T_b38 | SAMD11 | -2.626 | 0.00909 | -0.092545 | 10 | 0.035243 | yes | CLNTRN |
chr1_1173931_G_A_b38 | SAMD11 | -2.625 | 0.00912 | -0.09159 | 5 | 0.034892 | yes | CLNTRN |
chr1_1173935_C_G_b38 | SAMD11 | -2.625 | 0.00912 | -0.09159 | 5 | 0.034892 | yes | CLNTRN |
chr1_596797_T_TCA_b38 | SAMD11 | 2.596 | 0.00991 | 0.098151 | 7 | 0.037811 | yes | CLNTRN |
chr1_1177430_G_T_b38 | SAMD11 | -2.595 | 0.00993 | -0.099752 | 4 | 0.038443 | yes | CLNTRN |
chr1_1102097_C_A_b38 | SAMD11 | 3.982 | 8.61e-05 | 0.147083 | 3 | 0.03694 | no | CLNTRN |
chr1_591658_C_T_b38 | SAMD11 | -3.556 | 0.000437 | -0.209731 | 4 | 0.058972 | no | CLNTRN |
chr1_890446_C_CA_b38 | SAMD11 | -3.227 | 0.00139 | -0.098595 | 19 | 0.030551 | no | CLNTRN |
chr1_1175607_T_TC_b38 | SAMD11 | -2.913 | 0.00385 | -0.09809 | 6 | 0.033671 | no | CLNTRN |
chr1_1175611_G_C_b38 | SAMD11 | -2.913 | 0.00385 | -0.09809 | 6 | 0.033671 | no | CLNTRN |
chr1_1174845_C_T_b38 | SAMD11 | -2.907 | 0.00393 | -0.109481 | 4 | 0.037667 | no | CLNTRN |
chr1_1174988_C_T_b38 | SAMD11 | -2.907 | 0.00393 | -0.109481 | 4 | 0.037667 | no | CLNTRN |
chr1_1175040_T_C_b38 | SAMD11 | -2.907 | 0.00393 | -0.109481 | 4 | 0.037667 | no | CLNTRN |
chr1_928223_T_A_b38 | SAMD11 | -2.769 | 0.00597 | -0.098748 | 3 | 0.03566 | no | CLNTRN |
chr1_597070_A_AATC_b38 | SAMD11 | -2.761 | 0.00612 | -0.161302 | 5 | 0.058421 | no | CLNTRN |
chr1_1590813_CA_C_b38 | SAMD11 | 2.745 | 0.00642 | 0.085743 | 5 | 0.031234 | no | CLNTRN |
chr1_935265_T_C_b38 | SAMD11 | -2.733 | 0.00665 | -0.063625 | 41 | 0.023279 | no | CLNTRN |
chr1_1178191_A_G_b38 | SAMD11 | -2.73 | 0.0067 | -0.08873 | 7 | 0.032497 | no | CLNTRN |
chr1_935954_G_T_b38 | SAMD11 | 2.727 | 0.00677 | 0.062674 | 63 | 0.022983 | no | CLNTRN |
chr1_1173724_G_T_b38 | SAMD11 | -2.708 | 0.00717 | -0.105276 | 4 | 0.03888 | no | CLNTRN |
chr1_104186_T_C_b38 | SAMD11 | -2.635 | 0.00886 | -0.094904 | 3 | 0.036018 | no | CLNTRN |
chr1_933741_T_TG_b38 | SAMD11 | 2.617 | 0.00934 | 0.060212 | 52 | 0.023012 | no | CLNTRN |
chr1_669882_G_A_b38 | SAMD11 | 2.608 | 0.00955 | 0.088612 | 6 | 0.033971 | no | CLNTRN |
chr1_921096_A_G_b38 | SAMD11 | -4.036 | 7.05e-05 | -0.169783 | 56 | 0.042065 | yes | ESPGSJ |
chr1_904478_CGCCTCCTCCGAACGCGGCCGCCTCCTCCTCCGAACGTGGCCTCCTCCGAACGCGGCCGCCTCCTCCTCCGAACGCGGCCGCCTCCTCCTCCGAACGTG_C_b38 | SAMD11 | -3.902 | 0.00012 | -0.198311 | 7 | 0.050825 | yes | ESPGSJ |
chr1_920719_T_G_b38 | SAMD11 | -3.748 | 0.000217 | -0.152929 | 50 | 0.040798 | yes | ESPGSJ |
chr1_920728_A_G_b38 | SAMD11 | -3.748 | 0.000217 | -0.152929 | 50 | 0.040798 | yes | ESPGSJ |
chr1_940390_A_G_b38 | SAMD11 | 3.736 | 0.000227 | 0.144688 | 87 | 0.038726 | yes | ESPGSJ |
chr1_939779_AGCCAGTGGACGCCGACCT_A_b38 | SAMD11 | 3.669 | 0.000292 | 0.145969 | 66 | 0.03978 | yes | ESPGSJ |
chr1_922660_C_A_b38 | SAMD11 | -3.576 | 0.000412 | -0.180604 | 11 | 0.050498 | yes | ESPGSJ |
chr1_922671_C_T_b38 | SAMD11 | -3.521 | 0.000503 | -0.175175 | 12 | 0.049748 | yes | ESPGSJ |
chr1_1248149_G_C_b38 | SAMD11 | 3.501 | 0.000541 | 0.401115 | 5 | 0.114574 | yes | ESPGSJ |
chr1_897018_T_C_b38 | SAMD11 | 3.452 | 0.000645 | 0.159881 | 16 | 0.04632 | yes | ESPGSJ |
chr1_929839_G_A_b38 | SAMD11 | -3.419 | 0.000724 | -0.170411 | 12 | 0.049843 | yes | ESPGSJ |
chr1_932255_C_T_b38 | SAMD11 | -3.413 | 0.000739 | -0.168522 | 12 | 0.049371 | yes | ESPGSJ |
chr1_191910_C_T_b38 | SAMD11 | -3.353 | 0.000912 | -0.202515 | 4 | 0.060398 | yes | ESPGSJ |
chr1_191870_C_A_b38 | SAMD11 | -3.352 | 0.000914 | -0.19572 | 4 | 0.058382 | yes | ESPGSJ |
chr1_190729_C_T_b38 | SAMD11 | -3.266 | 0.00123 | -0.193658 | 4 | 0.059286 | yes | ESPGSJ |
chr1_928622_G_C_b38 | SAMD11 | -3.228 | 0.0014 | -0.160992 | 12 | 0.049872 | yes | ESPGSJ |
chr1_1182895_C_T_b38 | SAMD11 | 3.112 | 0.00206 | 0.241948 | 4 | 0.077748 | yes | ESPGSJ |
chr1_892786_A_G_b38 | SAMD11 | -3.024 | 0.00273 | -0.132525 | 25 | 0.043822 | yes | ESPGSJ |
chr1_1469469_G_C_b38 | SAMD11 | 3.022 | 0.00274 | 0.285837 | 3 | 0.09457 | yes | ESPGSJ |
chr1_969750_ATG_A_b38 | SAMD11 | 3.018 | 0.00279 | 0.115594 | 90 | 0.038307 | yes | ESPGSJ |
chr1_1468254_T_A_b38 | SAMD11 | 3.014 | 0.00282 | 0.284836 | 3 | 0.094517 | yes | ESPGSJ |
chr1_1461760_C_A_b38 | SAMD11 | 2.948 | 0.00347 | 0.26211 | 7 | 0.088897 | yes | ESPGSJ |
chr1_1248141_G_C_b38 | SAMD11 | 2.911 | 0.0039 | 0.263337 | 7 | 0.090457 | yes | ESPGSJ |
chr1_1180851_T_C_b38 | SAMD11 | 2.91 | 0.00392 | 0.209407 | 4 | 0.071972 | yes | ESPGSJ |
chr1_946247_G_A_b38 | SAMD11 | 2.905 | 0.00397 | 0.125589 | 62 | 0.043226 | yes | ESPGSJ |
chr1_1431014_G_A_b38 | SAMD11 | 2.879 | 0.00431 | 0.13924 | 22 | 0.048366 | yes | ESPGSJ |
chr1_1361836_A_G_b38 | SAMD11 | -2.871 | 0.00441 | -0.219158 | 3 | 0.076341 | yes | ESPGSJ |
chr1_1130477_T_C_b38 | SAMD11 | 2.828 | 0.00503 | 0.253006 | 3 | 0.089458 | yes | ESPGSJ |
chr1_1130478_G_T_b38 | SAMD11 | 2.828 | 0.00503 | 0.253006 | 3 | 0.089458 | yes | ESPGSJ |
chr1_946653_G_A_b38 | SAMD11 | -2.822 | 0.00513 | -0.129072 | 21 | 0.045743 | yes | ESPGSJ |
chr1_981454_G_A_b38 | SAMD11 | 2.819 | 0.00516 | 0.10802 | 85 | 0.038314 | yes | ESPGSJ |
chr1_983193_A_G_b38 | SAMD11 | 2.819 | 0.00516 | 0.10802 | 85 | 0.038314 | yes | ESPGSJ |
chr1_1461767_A_G_b38 | SAMD11 | 2.804 | 0.0054 | 0.251992 | 7 | 0.089859 | yes | ESPGSJ |
chr1_1457919_C_A_b38 | SAMD11 | 2.798 | 0.0055 | 0.30419 | 3 | 0.108706 | yes | ESPGSJ |
chr1_1457922_T_C_b38 | SAMD11 | 2.798 | 0.0055 | 0.30419 | 3 | 0.108706 | yes | ESPGSJ |
chr1_1688409_C_G_b38 | SAMD11 | -2.676 | 0.00791 | -0.114831 | 53 | 0.042917 | yes | ESPGSJ |
chr1_1571434_C_CA_b38 | SAMD11 | 2.675 | 0.00793 | 0.122421 | 30 | 0.04577 | yes | ESPGSJ |
chr1_940296_GCC_G_b38 | SAMD11 | 2.67 | 0.00804 | 0.10978 | 50 | 0.041115 | yes | ESPGSJ |
chr1_1650405_G_A_b38 | SAMD11 | 2.669 | 0.00805 | 0.251538 | 4 | 0.094227 | yes | ESPGSJ |
chr1_1439454_A_G_b38 | SAMD11 | 2.666 | 0.00814 | 0.130901 | 32 | 0.049108 | yes | ESPGSJ |
chr1_894801_A_G_b38 | SAMD11 | 2.657 | 0.00834 | 0.112057 | 30 | 0.042171 | yes | ESPGSJ |
chr1_928483_G_A_b38 | SAMD11 | 2.652 | 0.00846 | 0.256902 | 5 | 0.096856 | yes | ESPGSJ |
chr1_983004_G_T_b38 | SAMD11 | 2.629 | 0.00904 | 0.101851 | 95 | 0.038738 | yes | ESPGSJ |
chr1_933741_T_TG_b38 | SAMD11 | 2.627 | 0.0091 | 0.113863 | 36 | 0.043341 | yes | ESPGSJ |
chr1_965337_CTTAT_C_b38 | SAMD11 | 2.622 | 0.00923 | 0.114147 | 65 | 0.043536 | yes | ESPGSJ |
chr1_917495_C_T_b38 | SAMD11 | 3.993 | 8.38e-05 | 0.165358 | 64 | 0.041409 | no | ESPGSJ |
chr1_919397_A_G_b38 | SAMD11 | 3.985 | 8.65e-05 | 0.162208 | 49 | 0.040703 | no | ESPGSJ |
chr1_918574_C_A_b38 | SAMD11 | 3.942 | 0.000103 | 0.16395 | 63 | 0.041594 | no | ESPGSJ |
chr1_919598_A_C_b38 | SAMD11 | 3.835 | 0.000156 | 0.159482 | 64 | 0.041584 | no | ESPGSJ |
chr1_928210_G_A_b38 | SAMD11 | -3.825 | 0.000162 | -0.231606 | 3 | 0.060556 | no | ESPGSJ |
chr1_919695_C_G_b38 | SAMD11 | 3.762 | 0.000206 | 0.153621 | 51 | 0.04083 | no | ESPGSJ |
chr1_915400_C_T_b38 | SAMD11 | 3.726 | 0.000236 | 0.154972 | 61 | 0.041592 | no | ESPGSJ |
chr1_914991_G_T_b38 | SAMD11 | 3.498 | 0.000546 | 0.143286 | 62 | 0.040959 | no | ESPGSJ |
chr1_904947_G_A_b38 | SAMD11 | -3.433 | 0.00069 | -0.183255 | 6 | 0.053385 | no | ESPGSJ |
chr1_905373_T_C_b38 | SAMD11 | -3.384 | 0.000818 | -0.132695 | 55 | 0.03921 | no | ESPGSJ |
chr1_907538_T_TAA_b38 | SAMD11 | 3.257 | 0.00127 | 0.289347 | 5 | 0.088831 | no | ESPGSJ |
chr1_931513_T_C_b38 | SAMD11 | 3.191 | 0.00158 | 0.132669 | 76 | 0.041579 | no | ESPGSJ |
chr1_955679_C_T_b38 | SAMD11 | 3.139 | 0.00188 | 0.132805 | 59 | 0.042307 | no | ESPGSJ |
chr1_956565_A_G_b38 | SAMD11 | 3.139 | 0.00188 | 0.132805 | 59 | 0.042307 | no | ESPGSJ |
chr1_901149_C_G_b38 | SAMD11 | -3.02 | 0.00276 | -0.156115 | 7 | 0.051688 | no | ESPGSJ |
chr1_901544_G_A_b38 | SAMD11 | -3.02 | 0.00276 | -0.156115 | 7 | 0.051688 | no | ESPGSJ |
chr1_902949_G_GC_b38 | SAMD11 | -2.991 | 0.00304 | -0.154161 | 7 | 0.051545 | no | ESPGSJ |
chr1_898818_T_C_b38 | SAMD11 | -2.99 | 0.00304 | -0.153106 | 8 | 0.051203 | no | ESPGSJ |
chr1_899373_G_C_b38 | SAMD11 | -2.99 | 0.00304 | -0.191199 | 3 | 0.063949 | no | ESPGSJ |
chr1_906633_T_G_b38 | SAMD11 | -2.979 | 0.00315 | -0.150095 | 8 | 0.050377 | no | ESPGSJ |
chr1_898547_T_C_b38 | SAMD11 | -2.96 | 0.00335 | -0.148725 | 9 | 0.050253 | no | ESPGSJ |
chr1_899548_A_G_b38 | SAMD11 | -2.919 | 0.00381 | -0.144004 | 10 | 0.049337 | no | ESPGSJ |
chr1_899619_G_A_b38 | SAMD11 | -2.919 | 0.00381 | -0.144004 | 10 | 0.049337 | no | ESPGSJ |
chr1_916657_G_A_b38 | SAMD11 | 2.875 | 0.00436 | 0.124918 | 78 | 0.043452 | no | ESPGSJ |
chr1_897376_T_G_b38 | SAMD11 | -2.863 | 0.00452 | -0.122937 | 30 | 0.042938 | no | ESPGSJ |
chr1_903007_T_C_b38 | SAMD11 | -2.85 | 0.00471 | -0.14398 | 8 | 0.050526 | no | ESPGSJ |
chr1_914838_T_A_b38 | SAMD11 | 2.843 | 0.00481 | 0.122411 | 77 | 0.043063 | no | ESPGSJ |
chr1_896798_A_G_b38 | SAMD11 | 2.802 | 0.00543 | 0.119214 | 33 | 0.04254 | no | ESPGSJ |
chr1_916683_G_A_b38 | SAMD11 | 2.797 | 0.00552 | 0.121102 | 78 | 0.043294 | no | ESPGSJ |
chr1_1248864_T_C_b38 | SAMD11 | -2.784 | 0.00575 | -0.169005 | 8 | 0.060715 | no | ESPGSJ |
chr1_949171_GAGAA_G_b38 | SAMD11 | 2.744 | 0.00648 | 0.116028 | 60 | 0.04229 | no | ESPGSJ |
chr1_933548_A_AG_b38 | SAMD11 | 2.733 | 0.00668 | 0.11418 | 51 | 0.041775 | no | ESPGSJ |
chr1_913274_TG_T_b38 | SAMD11 | -2.725 | 0.00685 | -0.13649 | 12 | 0.050093 | no | ESPGSJ |
chr1_1183198_G_A_b38 | SAMD11 | 2.708 | 0.00719 | 0.20671 | 3 | 0.076325 | no | ESPGSJ |
chr1_984121_G_T_b38 | SAMD11 | 2.705 | 0.00726 | 0.104914 | 93 | 0.038785 | no | ESPGSJ |
chr1_896680_G_A_b38 | SAMD11 | 2.671 | 0.00801 | 0.11363 | 33 | 0.042536 | no | ESPGSJ |
chr1_896686_G_C_b38 | SAMD11 | 2.671 | 0.00801 | 0.11363 | 33 | 0.042536 | no | ESPGSJ |
chr1_896732_T_C_b38 | SAMD11 | 2.671 | 0.00801 | 0.11363 | 33 | 0.042536 | no | ESPGSJ |
chr1_20316_GA_G_b38 | SAMD11 | -2.668 | 0.00809 | -0.149043 | 5 | 0.055864 | no | ESPGSJ |
chr1_917378_G_C_b38 | SAMD11 | -2.666 | 0.00814 | -0.133914 | 11 | 0.050239 | no | ESPGSJ |
chr1_975093_G_A_b38 | SAMD11 | -2.635 | 0.0089 | -0.141205 | 8 | 0.053594 | no | ESPGSJ |
chr1_965125_G_C_b38 | SAMD11 | -2.632 | 0.00897 | -0.119957 | 23 | 0.04558 | no | ESPGSJ |
chr1_960375_A_AG_b38 | SAMD11 | 2.63 | 0.00902 | 0.170433 | 17 | 0.064799 | no | ESPGSJ |
chr1_896529_C_T_b38 | SAMD11 | 2.598 | 0.00988 | 0.11034 | 34 | 0.042469 | no | ESPGSJ |
chr1_921096_A_G_b38 | SAMD11 | -4.631 | 4.83e-06 | -0.078128 | 93 | 0.016869 | yes | ESPMCS |
chr1_939779_AGCCAGTGGACGCCGACCT_A_b38 | SAMD11 | 4.193 | 3.36e-05 | 0.069839 | 109 | 0.016658 | yes | ESPMCS |
chr1_931513_T_C_b38 | SAMD11 | 4.027 | 6.68e-05 | 0.068618 | 124 | 0.017038 | yes | ESPMCS |
chr1_918574_C_A_b38 | SAMD11 | 3.929 | 9.94e-05 | 0.066291 | 104 | 0.016872 | yes | ESPMCS |
chr1_917495_C_T_b38 | SAMD11 | 3.858 | 0.000132 | 0.064925 | 105 | 0.016829 | yes | ESPMCS |
chr1_916657_G_A_b38 | SAMD11 | 3.847 | 0.000138 | 0.066271 | 127 | 0.017228 | yes | ESPMCS |
chr1_916683_G_A_b38 | SAMD11 | 3.825 | 0.00015 | 0.065801 | 127 | 0.017203 | yes | ESPMCS |
chr1_940390_A_G_b38 | SAMD11 | 3.74 | 0.00021 | 0.062304 | 136 | 0.016661 | yes | ESPMCS |
chr1_919598_A_C_b38 | SAMD11 | 3.728 | 0.000219 | 0.06283 | 108 | 0.016853 | yes | ESPMCS |
chr1_914838_T_A_b38 | SAMD11 | 3.645 | 3e-04 | 0.062916 | 126 | 0.01726 | yes | ESPMCS |
chr1_915400_C_T_b38 | SAMD11 | 3.493 | 0.000528 | 0.059282 | 102 | 0.016974 | yes | ESPMCS |
chr1_920719_T_G_b38 | SAMD11 | -3.423 | 0.00068 | -0.057529 | 81 | 0.016808 | yes | ESPMCS |
chr1_920728_A_G_b38 | SAMD11 | -3.423 | 0.00068 | -0.057529 | 81 | 0.016808 | yes | ESPMCS |
chr1_946247_G_A_b38 | SAMD11 | 3.411 | 0.00071 | 0.060463 | 104 | 0.017727 | yes | ESPMCS |
chr1_949171_GAGAA_G_b38 | SAMD11 | 3.4 | 0.000736 | 0.05926 | 101 | 0.017427 | yes | ESPMCS |
chr1_955679_C_T_b38 | SAMD11 | 3.4 | 0.000736 | 0.05926 | 101 | 0.017427 | yes | ESPMCS |
chr1_956565_A_G_b38 | SAMD11 | 3.4 | 0.000736 | 0.05926 | 101 | 0.017427 | yes | ESPMCS |
chr1_959193_G_A_b38 | SAMD11 | 3.381 | 0.00079 | 0.091766 | 36 | 0.027144 | yes | ESPMCS |
chr1_965337_CTTAT_C_b38 | SAMD11 | 3.366 | 0.000833 | 0.060146 | 107 | 0.017871 | yes | ESPMCS |
chr1_951408_G_A_b38 | SAMD11 | 3.307 | 0.00102 | 0.084714 | 16 | 0.025616 | yes | ESPMCS |
chr1_951437_C_T_b38 | SAMD11 | 3.307 | 0.00102 | 0.084714 | 16 | 0.025616 | yes | ESPMCS |
chr1_919397_A_G_b38 | SAMD11 | 3.177 | 0.0016 | 0.05348 | 80 | 0.016836 | yes | ESPMCS |
chr1_965350_G_A_b38 | SAMD11 | 3.137 | 0.00183 | 0.085816 | 32 | 0.027356 | yes | ESPMCS |
chr1_919695_C_G_b38 | SAMD11 | 3.127 | 0.00189 | 0.05248 | 81 | 0.016782 | yes | ESPMCS |
chr1_598724_A_G_b38 | SAMD11 | 3.052 | 0.00242 | 0.132189 | 3 | 0.043314 | yes | ESPMCS |
chr1_914991_G_T_b38 | SAMD11 | 3.044 | 0.00248 | 0.051243 | 100 | 0.016835 | yes | ESPMCS |
chr1_1798925_C_CTT_b38 | SAMD11 | 2.932 | 0.00355 | 0.092711 | 4 | 0.031621 | yes | ESPMCS |
chr1_958339_G_A_b38 | SAMD11 | 2.911 | 0.00379 | 0.088927 | 5 | 0.030547 | yes | ESPMCS |
chr1_938178_G_T_b38 | SAMD11 | 2.842 | 0.00471 | 0.051953 | 74 | 0.018283 | yes | ESPMCS |
chr1_931131_C_CCCCT_b38 | SAMD11 | 2.812 | 0.00514 | 0.069607 | 56 | 0.024749 | yes | ESPMCS |
chr1_966179_G_A_b38 | SAMD11 | 2.807 | 0.00522 | 0.075135 | 29 | 0.026763 | yes | ESPMCS |
chr1_961945_G_C_b38 | SAMD11 | 2.784 | 0.0056 | 0.08689 | 6 | 0.031206 | yes | ESPMCS |
chr1_104194_C_A_b38 | SAMD11 | -2.78 | 0.00568 | -0.066987 | 7 | 0.024097 | yes | ESPMCS |
chr1_967384_C_G_b38 | SAMD11 | 2.767 | 0.0059 | 0.049336 | 102 | 0.01783 | yes | ESPMCS |
chr1_950669_ACAG_A_b38 | SAMD11 | 2.762 | 0.00598 | 0.088753 | 4 | 0.032128 | yes | ESPMCS |
chr1_940263_C_G_b38 | SAMD11 | 2.73 | 0.00659 | 0.058919 | 19 | 0.021581 | yes | ESPMCS |
chr1_935954_G_T_b38 | SAMD11 | 2.7 | 0.00721 | 0.049073 | 74 | 0.018176 | yes | ESPMCS |
chr1_917584_T_G_b38 | SAMD11 | 2.669 | 0.00791 | 0.05596 | 25 | 0.020969 | yes | ESPMCS |
chr1_623755_T_G_b38 | SAMD11 | -2.66 | 0.00812 | -0.101536 | 5 | 0.038178 | yes | ESPMCS |
chr1_958251_A_G_b38 | SAMD11 | 2.648 | 0.00839 | 0.086595 | 3 | 0.032699 | yes | ESPMCS |
chr1_949046_A_AACAGCAAAG_b38 | SAMD11 | 2.646 | 0.00844 | 0.087167 | 4 | 0.032938 | yes | ESPMCS |
chr1_936972_G_C_b38 | SAMD11 | -2.637 | 0.00866 | -0.047455 | 53 | 0.017994 | yes | ESPMCS |
chr1_969750_ATG_A_b38 | SAMD11 | 2.593 | 0.00984 | 0.042308 | 127 | 0.016317 | yes | ESPMCS |
chr1_960891_C_T_b38 | SAMD11 | 3.766 | 0.000189 | 0.065018 | 114 | 0.017263 | no | ESPMCS |
chr1_1558204_T_TAAAAAA_b38 | SAMD11 | -3.235 | 0.00131 | -0.066746 | 35 | 0.020635 | no | ESPMCS |
chr1_1684789_C_CAAAAA_b38 | SAMD11 | 2.875 | 0.00425 | 0.10498 | 9 | 0.036517 | no | ESPMCS |
chr1_1549967_C_G_b38 | SAMD11 | -2.865 | 0.00437 | -0.054276 | 41 | 0.018942 | no | ESPMCS |
chr1_1560765_T_C_b38 | SAMD11 | -2.819 | 0.00504 | -0.053072 | 66 | 0.018824 | no | ESPMCS |
chr1_1562261_TTTTC_T_b38 | SAMD11 | -2.819 | 0.00504 | -0.053072 | 66 | 0.018824 | no | ESPMCS |
chr1_1551557_A_AG_b38 | SAMD11 | -2.801 | 0.00532 | -0.052547 | 75 | 0.018758 | no | ESPMCS |
chr1_1551559_A_T_b38 | SAMD11 | -2.801 | 0.00532 | -0.052547 | 75 | 0.018758 | no | ESPMCS |
chr1_1557495_CAT_C_b38 | SAMD11 | -2.796 | 0.00541 | -0.052448 | 76 | 0.018758 | no | ESPMCS |
chr1_1555179_A_G_b38 | SAMD11 | -2.769 | 0.00588 | -0.051338 | 59 | 0.018543 | no | ESPMCS |
chr1_1558347_G_A_b38 | SAMD11 | -2.759 | 0.00605 | -0.052292 | 50 | 0.018956 | no | ESPMCS |
chr1_1554548_T_C_b38 | SAMD11 | -2.738 | 0.00643 | -0.050898 | 57 | 0.018587 | no | ESPMCS |
chr1_1558726_C_CA_b38 | SAMD11 | -2.725 | 0.00669 | -0.051129 | 76 | 0.018763 | no | ESPMCS |
chr1_1561821_A_C_b38 | SAMD11 | -2.725 | 0.00669 | -0.051129 | 76 | 0.018763 | no | ESPMCS |
chr1_1542773_T_C_b38 | SAMD11 | -2.723 | 0.00673 | -0.050954 | 73 | 0.018711 | no | ESPMCS |
chr1_1542793_C_G_b38 | SAMD11 | -2.723 | 0.00673 | -0.050954 | 73 | 0.018711 | no | ESPMCS |
chr1_1542800_T_C_b38 | SAMD11 | -2.723 | 0.00673 | -0.050954 | 73 | 0.018711 | no | ESPMCS |
chr1_1574655_GGC_G_b38 | SAMD11 | -2.722 | 0.00675 | -0.050383 | 67 | 0.018508 | no | ESPMCS |
chr1_1550064_GC_G_b38 | SAMD11 | -2.719 | 0.00681 | -0.050559 | 73 | 0.018593 | no | ESPMCS |
chr1_1550068_C_A_b38 | SAMD11 | -2.719 | 0.00681 | -0.050559 | 73 | 0.018593 | no | ESPMCS |
chr1_1541864_T_C_b38 | SAMD11 | -2.714 | 0.00691 | -0.051013 | 75 | 0.018793 | no | ESPMCS |
chr1_13912_G_A_b38 | SAMD11 | -2.661 | 0.00807 | -0.061053 | 16 | 0.02294 | no | ESPMCS |
chr1_1575864_G_A_b38 | SAMD11 | -2.654 | 0.00825 | -0.049622 | 71 | 0.018695 | no | ESPMCS |
chr1_1575935_T_C_b38 | SAMD11 | -2.618 | 0.00916 | -0.048522 | 76 | 0.018534 | no | ESPMCS |
chr1_1509914_T_TA_b38 | SAMD11 | 2.615 | 0.00924 | 0.085681 | 4 | 0.032766 | no | ESPMCS |
chr1_1537493_T_A_b38 | SAMD11 | -2.611 | 0.00936 | -0.047447 | 69 | 0.018175 | no | ESPMCS |
chr1_936972_G_C_b38 | SAMD11 | -5.292 | 2.01e-07 | -0.150277 | 45 | 0.028394 | yes | ESPMSL |
chr1_938178_G_T_b38 | SAMD11 | 4.973 | 9.86e-07 | 0.146198 | 63 | 0.029398 | yes | ESPMSL |
chr1_921096_A_G_b38 | SAMD11 | -4.927 | 1.23e-06 | -0.133195 | 80 | 0.027036 | yes | ESPMSL |
chr1_917495_C_T_b38 | SAMD11 | 4.802 | 2.23e-06 | 0.126335 | 91 | 0.026307 | yes | ESPMSL |
chr1_918574_C_A_b38 | SAMD11 | 4.773 | 2.56e-06 | 0.12614 | 90 | 0.026428 | yes | ESPMSL |
chr1_939779_AGCCAGTGGACGCCGACCT_A_b38 | SAMD11 | 4.772 | 2.58e-06 | 0.129056 | 93 | 0.027045 | yes | ESPMSL |
chr1_916683_G_A_b38 | SAMD11 | 4.769 | 2.61e-06 | 0.130531 | 108 | 0.027369 | yes | ESPMSL |
chr1_933741_T_TG_b38 | SAMD11 | 4.765 | 2.66e-06 | 0.135772 | 53 | 0.028492 | yes | ESPMSL |
chr1_919598_A_C_b38 | SAMD11 | 4.744 | 2.93e-06 | 0.124881 | 92 | 0.026323 | yes | ESPMSL |
chr1_916657_G_A_b38 | SAMD11 | 4.727 | 3.18e-06 | 0.12969 | 108 | 0.027436 | yes | ESPMSL |
chr1_896798_A_G_b38 | SAMD11 | 4.678 | 3.99e-06 | 0.131168 | 54 | 0.028041 | yes | ESPMSL |
chr1_896529_C_T_b38 | SAMD11 | 4.664 | 4.25e-06 | 0.129935 | 56 | 0.027858 | yes | ESPMSL |
chr1_896680_G_A_b38 | SAMD11 | 4.652 | 4.5e-06 | 0.129736 | 54 | 0.027889 | yes | ESPMSL |
chr1_896686_G_C_b38 | SAMD11 | 4.652 | 4.5e-06 | 0.129736 | 54 | 0.027889 | yes | ESPMSL |
chr1_896732_T_C_b38 | SAMD11 | 4.652 | 4.5e-06 | 0.129736 | 54 | 0.027889 | yes | ESPMSL |
chr1_920719_T_G_b38 | SAMD11 | -4.643 | 4.69e-06 | -0.122744 | 70 | 0.026437 | yes | ESPMSL |
chr1_920728_A_G_b38 | SAMD11 | -4.643 | 4.69e-06 | -0.122744 | 70 | 0.026437 | yes | ESPMSL |
chr1_914991_G_T_b38 | SAMD11 | 4.618 | 5.25e-06 | 0.122686 | 84 | 0.026567 | yes | ESPMSL |
chr1_919397_A_G_b38 | SAMD11 | 4.617 | 5.27e-06 | 0.121976 | 70 | 0.026418 | yes | ESPMSL |
chr1_896917_CTG_C_b38 | SAMD11 | 4.595 | 5.83e-06 | 0.127686 | 54 | 0.027786 | yes | ESPMSL |
chr1_896938_C_A_b38 | SAMD11 | 4.595 | 5.83e-06 | 0.127686 | 54 | 0.027786 | yes | ESPMSL |
chr1_897792_T_TCGAA_b38 | SAMD11 | -4.595 | 5.83e-06 | -0.127686 | 54 | 0.027786 | yes | ESPMSL |
chr1_897376_T_G_b38 | SAMD11 | -4.585 | 6.1e-06 | -0.129298 | 50 | 0.028199 | yes | ESPMSL |
chr1_914838_T_A_b38 | SAMD11 | 4.581 | 6.21e-06 | 0.126394 | 107 | 0.027589 | yes | ESPMSL |
chr1_915400_C_T_b38 | SAMD11 | 4.575 | 6.38e-06 | 0.12263 | 87 | 0.026802 | yes | ESPMSL |
chr1_931513_T_C_b38 | SAMD11 | 4.575 | 6.39e-06 | 0.124203 | 109 | 0.027148 | yes | ESPMSL |
chr1_949171_GAGAA_G_b38 | SAMD11 | 4.566 | 6.66e-06 | 0.128326 | 87 | 0.028105 | yes | ESPMSL |
chr1_955679_C_T_b38 | SAMD11 | 4.544 | 7.35e-06 | 0.127797 | 86 | 0.028124 | yes | ESPMSL |
chr1_956565_A_G_b38 | SAMD11 | 4.544 | 7.35e-06 | 0.127797 | 86 | 0.028124 | yes | ESPMSL |
chr1_897538_T_C_b38 | SAMD11 | -4.484 | 9.63e-06 | -0.12458 | 56 | 0.027784 | yes | ESPMSL |
chr1_919695_C_G_b38 | SAMD11 | 4.434 | 1.2e-05 | 0.117066 | 71 | 0.026401 | yes | ESPMSL |
chr1_935265_T_C_b38 | SAMD11 | -4.42 | 1.28e-05 | -0.131631 | 41 | 0.029781 | yes | ESPMSL |
chr1_946247_G_A_b38 | SAMD11 | 4.325 | 1.94e-05 | 0.124083 | 90 | 0.02869 | yes | ESPMSL |
chr1_900119_A_G_b38 | SAMD11 | -4.206 | 3.22e-05 | -0.121542 | 41 | 0.028898 | yes | ESPMSL |
chr1_940390_A_G_b38 | SAMD11 | 4.193 | 3.4e-05 | 0.111033 | 119 | 0.026481 | yes | ESPMSL |
chr1_945259_TC_T_b38 | SAMD11 | -4.137 | 4.3e-05 | -0.126596 | 28 | 0.030601 | yes | ESPMSL |
chr1_896109_C_T_b38 | SAMD11 | 4.049 | 6.21e-05 | 0.116813 | 56 | 0.028853 | yes | ESPMSL |
chr1_932255_C_T_b38 | SAMD11 | -4.027 | 6.77e-05 | -0.130219 | 22 | 0.032333 | yes | ESPMSL |
chr1_892786_A_G_b38 | SAMD11 | -4.014 | 7.14e-05 | -0.11862 | 41 | 0.02955 | yes | ESPMSL |
chr1_933548_A_AG_b38 | SAMD11 | 4.005 | 7.41e-05 | 0.109278 | 71 | 0.027286 | yes | ESPMSL |
chr1_937396_GCC_G_b38 | SAMD11 | -3.952 | 9.2e-05 | -0.106232 | 91 | 0.026883 | yes | ESPMSL |
chr1_965337_CTTAT_C_b38 | SAMD11 | 3.802 | 0.000166 | 0.111146 | 90 | 0.029234 | yes | ESPMSL |
chr1_905373_T_C_b38 | SAMD11 | -3.783 | 0.000179 | -0.100865 | 79 | 0.026664 | yes | ESPMSL |
chr1_899452_G_C_b38 | SAMD11 | -3.778 | 0.000182 | -0.110895 | 42 | 0.029352 | yes | ESPMSL |
chr1_933038_C_T_b38 | SAMD11 | -3.736 | 0.000214 | -0.113029 | 38 | 0.030253 | yes | ESPMSL |
chr1_960891_C_T_b38 | SAMD11 | 3.709 | 0.000238 | 0.104515 | 97 | 0.028182 | yes | ESPMSL |
chr1_965666_ACC_A_b38 | SAMD11 | -3.708 | 0.000239 | -0.114011 | 28 | 0.030749 | yes | ESPMSL |
chr1_890030_G_A_b38 | SAMD11 | 3.707 | 0.00024 | 0.101881 | 68 | 0.027484 | yes | ESPMSL |
chr1_954724_G_A_b38 | SAMD11 | -3.686 | 0.00026 | -0.117288 | 24 | 0.031819 | yes | ESPMSL |
chr1_897843_C_T_b38 | SAMD11 | -3.65 | 0.000298 | -0.10595 | 44 | 0.029028 | yes | ESPMSL |
chr1_897922_C_T_b38 | SAMD11 | -3.65 | 0.000298 | -0.10595 | 44 | 0.029028 | yes | ESPMSL |
chr1_898444_T_C_b38 | SAMD11 | -3.65 | 0.000298 | -0.10595 | 44 | 0.029028 | yes | ESPMSL |
chr1_898261_T_C_b38 | SAMD11 | -3.642 | 0.000307 | -0.105656 | 46 | 0.02901 | yes | ESPMSL |
chr1_898279_T_A_b38 | SAMD11 | -3.642 | 0.000307 | -0.105656 | 46 | 0.02901 | yes | ESPMSL |
chr1_898283_A_G_b38 | SAMD11 | -3.642 | 0.000307 | -0.105656 | 46 | 0.02901 | yes | ESPMSL |
chr1_946653_G_A_b38 | SAMD11 | -3.617 | 0.000337 | -0.112763 | 26 | 0.031174 | yes | ESPMSL |
chr1_918870_A_G_b38 | SAMD11 | -3.612 | 0.000343 | -0.112222 | 25 | 0.031067 | yes | ESPMSL |
chr1_929558_G_A_b38 | SAMD11 | 3.575 | 0.000394 | 0.110543 | 53 | 0.030925 | yes | ESPMSL |
chr1_277226_A_C_b38 | SAMD11 | -3.558 | 0.000419 | -0.190737 | 8 | 0.053603 | yes | ESPMSL |
chr1_894801_A_G_b38 | SAMD11 | 3.493 | 0.000531 | 0.099566 | 50 | 0.028502 | yes | ESPMSL |
chr1_901516_T_C_b38 | SAMD11 | -3.483 | 0.000552 | -0.10186 | 53 | 0.029246 | yes | ESPMSL |
chr1_923421_A_G_b38 | SAMD11 | 3.431 | 0.000664 | 0.107882 | 43 | 0.031439 | yes | ESPMSL |
chr1_925036_G_A_b38 | SAMD11 | 3.431 | 0.000665 | 0.107911 | 45 | 0.031452 | yes | ESPMSL |
chr1_923311_TG_T_b38 | SAMD11 | 3.387 | 0.000779 | 0.106754 | 42 | 0.031523 | yes | ESPMSL |
chr1_925308_G_A_b38 | SAMD11 | 3.375 | 0.00081 | 0.104352 | 50 | 0.030915 | yes | ESPMSL |
chr1_1102097_C_A_b38 | SAMD11 | 3.37 | 0.000827 | 0.148607 | 4 | 0.044102 | yes | ESPMSL |
chr1_931558_G_A_b38 | SAMD11 | -3.278 | 0.00114 | -0.103015 | 25 | 0.031424 | yes | ESPMSL |
chr1_903723_A_G_b38 | SAMD11 | -3.275 | 0.00115 | -0.095931 | 45 | 0.029295 | yes | ESPMSL |
chr1_965125_G_C_b38 | SAMD11 | -3.141 | 0.00181 | -0.095017 | 34 | 0.030254 | yes | ESPMSL |
chr1_104186_T_C_b38 | SAMD11 | -3.134 | 0.00185 | -0.134073 | 4 | 0.042779 | yes | ESPMSL |
chr1_1070426_C_T_b38 | SAMD11 | -3.118 | 0.00196 | -0.109403 | 17 | 0.035089 | yes | ESPMSL |
chr1_1729196_T_G_b38 | SAMD11 | 3.106 | 0.00204 | 0.135891 | 12 | 0.043754 | yes | ESPMSL |
chr1_1067007_A_G_b38 | SAMD11 | -3.087 | 0.00217 | -0.09617 | 27 | 0.031155 | yes | ESPMSL |
chr1_897580_AT_A_b38 | SAMD11 | -3.077 | 0.00224 | -0.083817 | 116 | 0.02724 | yes | ESPMSL |
chr1_1801188_T_C_b38 | SAMD11 | 3.039 | 0.00253 | 0.104778 | 14 | 0.034472 | yes | ESPMSL |
chr1_1372258_T_C_b38 | SAMD11 | -3.037 | 0.00255 | -0.173252 | 5 | 0.057041 | yes | ESPMSL |
chr1_770988_A_G_b38 | SAMD11 | 3.024 | 0.00265 | 0.083333 | 111 | 0.027554 | yes | ESPMSL |
chr1_1153726_G_A_b38 | SAMD11 | 2.983 | 0.00303 | 0.088412 | 33 | 0.02964 | yes | ESPMSL |
chr1_968046_C_T_b38 | SAMD11 | -2.935 | 0.00353 | -0.084404 | 50 | 0.028756 | yes | ESPMSL |
chr1_969663_CAT_C_b38 | SAMD11 | -2.93 | 0.00359 | -0.090895 | 27 | 0.031021 | yes | ESPMSL |
chr1_1846651_T_G_b38 | SAMD11 | 2.929 | 0.0036 | 0.104625 | 12 | 0.03572 | yes | ESPMSL |
chr1_1762759_AAATG_A_b38 | SAMD11 | 2.915 | 0.00377 | 0.078554 | 91 | 0.026953 | yes | ESPMSL |
chr1_1782906_T_G_b38 | SAMD11 | 2.883 | 0.00416 | 0.102293 | 12 | 0.035485 | yes | ESPMSL |
chr1_1840043_T_TA_b38 | SAMD11 | 2.852 | 0.00457 | 0.104251 | 8 | 0.036549 | yes | ESPMSL |
chr1_1822247_A_G_b38 | SAMD11 | 2.818 | 0.00508 | 0.100299 | 12 | 0.035592 | yes | ESPMSL |
chr1_1818305_TAAAAAAA_T_b38 | SAMD11 | 2.816 | 0.00511 | 0.105043 | 9 | 0.037303 | yes | ESPMSL |
chr1_1360901_TAC_T_b38 | SAMD11 | -2.807 | 0.00525 | -0.177648 | 3 | 0.063287 | yes | ESPMSL |
chr1_1342269_G_T_b38 | SAMD11 | -2.805 | 0.00528 | -0.173641 | 3 | 0.061898 | yes | ESPMSL |
chr1_1837340_C_T_b38 | SAMD11 | 2.767 | 0.00592 | 0.09887 | 12 | 0.035729 | yes | ESPMSL |
chr1_1757074_G_T_b38 | SAMD11 | 2.744 | 0.00634 | 0.076066 | 74 | 0.027719 | yes | ESPMSL |
chr1_1357006_CA_C_b38 | SAMD11 | -2.728 | 0.00665 | -0.170421 | 3 | 0.062468 | yes | ESPMSL |
chr1_976536_C_T_b38 | SAMD11 | -2.703 | 0.00718 | -0.089885 | 17 | 0.033257 | yes | ESPMSL |
chr1_1794187_C_T_b38 | SAMD11 | 2.695 | 0.00734 | 0.096672 | 12 | 0.035868 | yes | ESPMSL |
chr1_1374694_C_G_b38 | SAMD11 | -2.693 | 0.00738 | -0.14659 | 7 | 0.054435 | yes | ESPMSL |
chr1_1343267_C_A_b38 | SAMD11 | -2.69 | 0.00744 | -0.164736 | 3 | 0.061233 | yes | ESPMSL |
chr1_1591703_T_C_b38 | SAMD11 | 2.687 | 0.00752 | 0.071998 | 91 | 0.026797 | yes | ESPMSL |
chr1_940296_GCC_G_b38 | SAMD11 | 2.684 | 0.00758 | 0.071443 | 81 | 0.026619 | yes | ESPMSL |
chr1_978230_G_A_b38 | SAMD11 | -2.673 | 0.00783 | -0.087748 | 19 | 0.032825 | yes | ESPMSL |
chr1_1161911_C_A_b38 | SAMD11 | 2.673 | 0.00784 | 0.080899 | 30 | 0.030271 | yes | ESPMSL |
chr1_1881065_G_A_b38 | SAMD11 | 2.668 | 0.00795 | 0.096541 | 12 | 0.036187 | yes | ESPMSL |
chr1_1881798_C_T_b38 | SAMD11 | 2.668 | 0.00795 | 0.096541 | 12 | 0.036187 | yes | ESPMSL |
chr1_1335073_C_T_b38 | SAMD11 | -2.65 | 0.00838 | -0.163777 | 3 | 0.061813 | yes | ESPMSL |
chr1_1340336_T_A_b38 | SAMD11 | -2.65 | 0.00838 | -0.163777 | 3 | 0.061813 | yes | ESPMSL |
chr1_1340746_G_GCA_b38 | SAMD11 | -2.65 | 0.00838 | -0.163777 | 3 | 0.061813 | yes | ESPMSL |
chr1_1340983_T_C_b38 | SAMD11 | -2.65 | 0.00838 | -0.163777 | 3 | 0.061813 | yes | ESPMSL |
chr1_1798974_C_T_b38 | SAMD11 | 2.627 | 0.00894 | 0.094095 | 12 | 0.035813 | yes | ESPMSL |
chr1_1735008_G_GTTTT_b38 | SAMD11 | 2.625 | 0.00901 | 0.067906 | 117 | 0.025871 | yes | ESPMSL |
chr1_1734132_T_G_b38 | SAMD11 | 2.622 | 0.00908 | 0.116315 | 16 | 0.044362 | yes | ESPMSL |
chr1_1769969_CAAAACA_C_b38 | SAMD11 | 2.613 | 0.00932 | 0.070609 | 83 | 0.027021 | yes | ESPMSL |
chr1_1731375_T_C_b38 | SAMD11 | 2.603 | 0.0096 | 0.102836 | 19 | 0.03951 | yes | ESPMSL |
chr1_935954_G_T_b38 | SAMD11 | 4.667 | 4.19e-06 | 0.136376 | 62 | 0.02922 | no | ESPMSL |
chr1_904478_CGCCTCCTCCGAACGCGGCCGCCTCCTCCTCCGAACGTGGCCTCCTCCGAACGCGGCCGCCTCCTCCTCCGAACGCGGCCGCCTCCTCCTCCGAACGTG_C_b38 | SAMD11 | -4.6 | 5.7e-06 | -0.15374 | 13 | 0.033421 | no | ESPMSL |
chr1_897018_T_C_b38 | SAMD11 | 4.413 | 1.32e-05 | 0.134862 | 28 | 0.030563 | no | ESPMSL |
chr1_928622_G_C_b38 | SAMD11 | -4.371 | 1.59e-05 | -0.13973 | 22 | 0.03197 | no | ESPMSL |
chr1_929839_G_A_b38 | SAMD11 | -4.204 | 3.25e-05 | -0.135455 | 22 | 0.032221 | no | ESPMSL |
chr1_913274_TG_T_b38 | SAMD11 | -4.146 | 4.15e-05 | -0.133794 | 20 | 0.032273 | no | ESPMSL |
chr1_913065_G_A_b38 | SAMD11 | -4.105 | 4.91e-05 | -0.127339 | 27 | 0.031019 | no | ESPMSL |
chr1_913076_A_G_b38 | SAMD11 | -4.084 | 5.37e-05 | -0.126625 | 27 | 0.031007 | no | ESPMSL |
chr1_922671_C_T_b38 | SAMD11 | -4.028 | 6.76e-05 | -0.130075 | 21 | 0.032294 | no | ESPMSL |
chr1_917859_A_G_b38 | SAMD11 | -4.008 | 7.33e-05 | -0.128142 | 21 | 0.031972 | no | ESPMSL |
chr1_922660_C_A_b38 | SAMD11 | -4.003 | 7.49e-05 | -0.131012 | 20 | 0.032732 | no | ESPMSL |
chr1_917378_G_C_b38 | SAMD11 | -3.998 | 7.64e-05 | -0.13017 | 19 | 0.032562 | no | ESPMSL |
chr1_914743_C_T_b38 | SAMD11 | -3.916 | 0.000106 | -0.124174 | 22 | 0.03171 | no | ESPMSL |
chr1_911848_C_T_b38 | SAMD11 | -3.892 | 0.000117 | -0.12358 | 24 | 0.03175 | no | ESPMSL |
chr1_912111_G_A_b38 | SAMD11 | -3.887 | 0.000119 | -0.119886 | 28 | 0.030845 | no | ESPMSL |
chr1_903007_T_C_b38 | SAMD11 | -3.88 | 0.000123 | -0.125055 | 19 | 0.032233 | no | ESPMSL |
chr1_912710_G_A_b38 | SAMD11 | -3.875 | 0.000125 | -0.122783 | 22 | 0.031682 | no | ESPMSL |
chr1_913358_C_T_b38 | SAMD11 | -3.875 | 0.000125 | -0.122783 | 22 | 0.031682 | no | ESPMSL |
chr1_901149_C_G_b38 | SAMD11 | -3.83 | 0.000149 | -0.126686 | 17 | 0.033079 | no | ESPMSL |
chr1_917284_C_T_b38 | SAMD11 | -3.82 | 0.000155 | -0.121094 | 22 | 0.031698 | no | ESPMSL |
chr1_904947_G_A_b38 | SAMD11 | -3.792 | 0.000173 | -0.130634 | 13 | 0.034446 | no | ESPMSL |
chr1_921056_TG_T_b38 | SAMD11 | -3.761 | 0.000195 | -0.124955 | 16 | 0.033221 | no | ESPMSL |
chr1_914682_A_T_b38 | SAMD11 | -3.729 | 0.00022 | -0.115858 | 27 | 0.031069 | no | ESPMSL |
chr1_911428_C_T_b38 | SAMD11 | -3.723 | 0.000225 | -0.119293 | 24 | 0.032041 | no | ESPMSL |
chr1_899619_G_A_b38 | SAMD11 | -3.678 | 0.000268 | -0.119919 | 18 | 0.032604 | no | ESPMSL |
chr1_902949_G_GC_b38 | SAMD11 | -3.678 | 0.000268 | -0.122042 | 17 | 0.033183 | no | ESPMSL |
chr1_910255_C_T_b38 | SAMD11 | -3.667 | 0.000279 | -0.121315 | 18 | 0.033082 | no | ESPMSL |
chr1_901544_G_A_b38 | SAMD11 | -3.645 | 0.000303 | -0.120697 | 17 | 0.033115 | no | ESPMSL |
chr1_928223_T_A_b38 | SAMD11 | -3.614 | 0.00034 | -0.154023 | 4 | 0.042614 | no | ESPMSL |
chr1_941767_G_A_b38 | SAMD11 | -3.594 | 0.000367 | -0.111958 | 25 | 0.031154 | no | ESPMSL |
chr1_915824_G_C_b38 | SAMD11 | -3.588 | 0.000375 | -0.109607 | 31 | 0.030546 | no | ESPMSL |
chr1_911484_G_C_b38 | SAMD11 | -3.584 | 0.000381 | -0.114293 | 23 | 0.031891 | no | ESPMSL |
chr1_906677_A_AAACTCAGCTGCCTCTCCCCTTC_b38 | SAMD11 | -3.573 | 0.000396 | -0.106729 | 47 | 0.029867 | no | ESPMSL |
chr1_899548_A_G_b38 | SAMD11 | -3.542 | 0.000445 | -0.114806 | 19 | 0.032413 | no | ESPMSL |
chr1_915810_G_A_b38 | SAMD11 | -3.526 | 0.000471 | -0.109333 | 27 | 0.031005 | no | ESPMSL |
chr1_926250_G_A_b38 | SAMD11 | 3.525 | 0.000472 | 0.111926 | 46 | 0.031748 | no | ESPMSL |
chr1_898547_T_C_b38 | SAMD11 | -3.5 | 0.000518 | -0.111996 | 20 | 0.031996 | no | ESPMSL |
chr1_928210_G_A_b38 | SAMD11 | -3.458 | 0.000603 | -0.142738 | 4 | 0.041276 | no | ESPMSL |
chr1_903175_C_A_b38 | SAMD11 | -3.451 | 0.00062 | -0.108928 | 30 | 0.031567 | no | ESPMSL |
chr1_910698_C_T_b38 | SAMD11 | -3.41 | 0.000717 | -0.110792 | 20 | 0.032492 | no | ESPMSL |
chr1_906633_T_G_b38 | SAMD11 | -3.377 | 0.000805 | -0.111533 | 18 | 0.033023 | no | ESPMSL |
chr1_924305_G_A_b38 | SAMD11 | -3.366 | 0.000836 | -0.103254 | 31 | 0.030672 | no | ESPMSL |
chr1_927486_C_T_b38 | SAMD11 | 3.321 | 0.00098 | 0.105065 | 48 | 0.031635 | no | ESPMSL |
chr1_1741091_CT_C_b38 | SAMD11 | 3.301 | 0.00105 | 0.121291 | 13 | 0.036744 | no | ESPMSL |
chr1_898818_T_C_b38 | SAMD11 | -3.282 | 0.00112 | -0.108144 | 18 | 0.032946 | no | ESPMSL |
chr1_967384_C_G_b38 | SAMD11 | 3.253 | 0.00124 | 0.092959 | 94 | 0.028573 | no | ESPMSL |
chr1_914483_G_GACTGCCCAGCTC_b38 | SAMD11 | -3.207 | 0.00145 | -0.101945 | 25 | 0.031784 | no | ESPMSL |
chr1_1845840_C_G_b38 | SAMD11 | 3.164 | 0.00168 | 0.122232 | 4 | 0.038629 | no | ESPMSL |
chr1_905705_C_G_b38 | SAMD11 | -3.147 | 0.00177 | -0.099266 | 30 | 0.031543 | no | ESPMSL |
chr1_14653_C_T_b38 | SAMD11 | -3.127 | 0.00189 | -0.119242 | 12 | 0.038128 | no | ESPMSL |
chr1_906982_C_T_b38 | SAMD11 | -3.123 | 0.00192 | -0.102192 | 18 | 0.032718 | no | ESPMSL |
chr1_1857305_G_GGGCT_b38 | SAMD11 | 3.111 | 0.002 | 0.112759 | 11 | 0.036241 | no | ESPMSL |
chr1_1087765_G_A_b38 | SAMD11 | -3.101 | 0.00207 | -0.114613 | 10 | 0.036965 | no | ESPMSL |
chr1_1857246_T_TAA_b38 | SAMD11 | 3.074 | 0.00226 | 0.110897 | 11 | 0.036074 | no | ESPMSL |
chr1_1857250_C_G_b38 | SAMD11 | 3.074 | 0.00226 | 0.110897 | 11 | 0.036074 | no | ESPMSL |
chr1_1002195_T_TA_b38 | SAMD11 | 3.01 | 0.00278 | 0.132701 | 4 | 0.04408 | no | ESPMSL |
chr1_1153291_C_T_b38 | SAMD11 | 2.987 | 0.00299 | 0.088526 | 34 | 0.029636 | no | ESPMSL |
chr1_928216_A_AC_b38 | SAMD11 | -2.943 | 0.00344 | -0.119345 | 4 | 0.040551 | no | ESPMSL |
chr1_1912140_T_G_b38 | SAMD11 | 2.941 | 0.00347 | 0.100855 | 15 | 0.034295 | no | ESPMSL |
chr1_899373_G_C_b38 | SAMD11 | -2.928 | 0.00361 | -0.120702 | 7 | 0.041228 | no | ESPMSL |
chr1_1909167_G_A_b38 | SAMD11 | 2.903 | 0.00391 | 0.107757 | 11 | 0.037122 | no | ESPMSL |
chr1_1855939_G_A_b38 | SAMD11 | 2.844 | 0.00469 | 0.103318 | 11 | 0.03633 | no | ESPMSL |
chr1_1910289_C_T_b38 | SAMD11 | 2.811 | 0.00518 | 0.098492 | 12 | 0.035032 | no | ESPMSL |
chr1_1910369_G_A_b38 | SAMD11 | 2.811 | 0.00518 | 0.098492 | 12 | 0.035032 | no | ESPMSL |
chr1_1910480_G_A_b38 | SAMD11 | 2.811 | 0.00518 | 0.098492 | 12 | 0.035032 | no | ESPMSL |
chr1_1742468_G_C_b38 | SAMD11 | 2.807 | 0.00525 | 0.076715 | 118 | 0.027333 | no | ESPMSL |
chr1_1740427_A_T_b38 | SAMD11 | 2.798 | 0.00539 | 0.121646 | 13 | 0.043472 | no | ESPMSL |
chr1_1663180_T_C_b38 | SAMD11 | -2.798 | 0.0054 | -0.096341 | 13 | 0.034435 | no | ESPMSL |
chr1_1663182_C_A_b38 | SAMD11 | -2.798 | 0.0054 | -0.096341 | 13 | 0.034435 | no | ESPMSL |
chr1_1156987_C_T_b38 | SAMD11 | 2.796 | 0.00543 | 0.083869 | 31 | 0.029995 | no | ESPMSL |
chr1_1730989_A_G_b38 | SAMD11 | 2.794 | 0.00547 | 0.121869 | 13 | 0.043624 | no | ESPMSL |
chr1_1731456_A_G_b38 | SAMD11 | 2.794 | 0.00547 | 0.121869 | 13 | 0.043624 | no | ESPMSL |
chr1_1735814_T_C_b38 | SAMD11 | 2.794 | 0.00547 | 0.121869 | 13 | 0.043624 | no | ESPMSL |
chr1_1903242_C_T_b38 | SAMD11 | 2.789 | 0.00555 | 0.104792 | 10 | 0.037574 | no | ESPMSL |
chr1_1906935_C_T_b38 | SAMD11 | 2.789 | 0.00555 | 0.104792 | 10 | 0.037574 | no | ESPMSL |
chr1_1060868_C_T_b38 | SAMD11 | -2.789 | 0.00555 | -0.10735 | 10 | 0.038496 | no | ESPMSL |
chr1_1427468_A_AGCCCCCTCCCCTCCATCACCCTGCCCT_b38 | SAMD11 | 2.781 | 0.00568 | 0.149019 | 4 | 0.053585 | no | ESPMSL |
chr1_1871210_G_T_b38 | SAMD11 | 2.761 | 0.00603 | 0.102716 | 11 | 0.037202 | no | ESPMSL |
chr1_1903577_C_T_b38 | SAMD11 | 2.752 | 0.00619 | 0.102485 | 11 | 0.037235 | no | ESPMSL |
chr1_1732166_A_G_b38 | SAMD11 | 2.736 | 0.0065 | 0.118441 | 13 | 0.043292 | no | ESPMSL |
chr1_789568_TATGGA_T_b38 | SAMD11 | 2.736 | 0.00651 | 0.09675 | 32 | 0.035367 | no | ESPMSL |
chr1_1892085_G_C_b38 | SAMD11 | 2.73 | 0.00661 | 0.099242 | 11 | 0.03635 | no | ESPMSL |
chr1_1754601_G_T_b38 | SAMD11 | 2.714 | 0.00693 | 0.076548 | 72 | 0.0282 | no | ESPMSL |
chr1_1749605_C_CGTCCATGCATATTTTTCTGTGTGATGTGTCTGTGTGTGTGTCTCAGTGGT_b38 | SAMD11 | 2.711 | 0.00701 | 0.064715 | 47 | 0.023873 | no | ESPMSL |
chr1_1130420_C_T_b38 | SAMD11 | 2.706 | 0.00711 | 0.093701 | 17 | 0.034631 | no | ESPMSL |
chr1_910558_G_A_b38 | SAMD11 | -2.704 | 0.00715 | -0.087974 | 29 | 0.032538 | no | ESPMSL |
chr1_1736836_A_G_b38 | SAMD11 | 2.701 | 0.00722 | 0.072273 | 113 | 0.026761 | no | ESPMSL |
chr1_1855245_G_A_b38 | SAMD11 | 2.701 | 0.00722 | 0.098741 | 11 | 0.036563 | no | ESPMSL |
chr1_821000_T_A_b38 | SAMD11 | 2.686 | 0.00754 | 0.09284 | 21 | 0.034564 | no | ESPMSL |
chr1_981282_A_C_b38 | SAMD11 | -2.682 | 0.00763 | -0.08802 | 19 | 0.03282 | no | ESPMSL |
chr1_1898712_C_T_b38 | SAMD11 | 2.672 | 0.00786 | 0.099724 | 10 | 0.037325 | no | ESPMSL |
chr1_1899188_T_A_b38 | SAMD11 | 2.672 | 0.00786 | 0.099724 | 10 | 0.037325 | no | ESPMSL |
chr1_1880594_A_T_b38 | SAMD11 | 2.661 | 0.00811 | 0.092769 | 15 | 0.034861 | no | ESPMSL |
chr1_1757725_C_T_b38 | SAMD11 | 2.65 | 0.00838 | 0.074951 | 72 | 0.028288 | no | ESPMSL |
chr1_1742080_T_C_b38 | SAMD11 | 2.645 | 0.00851 | 0.116096 | 13 | 0.043901 | no | ESPMSL |
chr1_911018_G_A_b38 | SAMD11 | -2.636 | 0.00873 | -0.087857 | 24 | 0.033332 | no | ESPMSL |
chr1_1897985_C_G_b38 | SAMD11 | 2.635 | 0.00874 | 0.092415 | 12 | 0.035072 | no | ESPMSL |
chr1_1886690_A_C_b38 | SAMD11 | 2.635 | 0.00875 | 0.096641 | 11 | 0.036679 | no | ESPMSL |
chr1_1130717_G_A_b38 | SAMD11 | 2.634 | 0.00878 | 0.094363 | 15 | 0.03583 | no | ESPMSL |
chr1_820395_A_G_b38 | SAMD11 | 2.633 | 0.00881 | 0.094369 | 20 | 0.035847 | no | ESPMSL |
chr1_1738597_C_A_b38 | SAMD11 | 2.628 | 0.00893 | 0.080811 | 55 | 0.030752 | no | ESPMSL |
chr1_1732580_T_C_b38 | SAMD11 | 2.624 | 0.00902 | 0.115444 | 14 | 0.043988 | no | ESPMSL |
chr1_1082207_C_T_b38 | SAMD11 | -2.622 | 0.00909 | -0.095965 | 10 | 0.036606 | no | ESPMSL |
chr1_909894_G_T_b38 | SAMD11 | -2.605 | 0.00954 | -0.085936 | 30 | 0.03299 | no | ESPMSL |
chr1_1154789_GA_G_b38 | SAMD11 | 2.602 | 0.0096 | 0.082896 | 26 | 0.031852 | no | ESPMSL |
chr1_1734301_T_C_b38 | SAMD11 | 2.602 | 0.00963 | 0.115813 | 12 | 0.044518 | no | ESPMSL |
chr1_1334606_G_A_b38 | SAMD11 | -2.597 | 0.00975 | -0.142145 | 4 | 0.054729 | no | ESPMSL |
chr1_1340576_C_T_b38 | SAMD11 | -2.597 | 0.00975 | -0.142145 | 4 | 0.054729 | no | ESPMSL |
chr1_1074443_G_A_b38 | SAMD11 | -2.594 | 0.00984 | -0.091025 | 13 | 0.035091 | no | ESPMSL |
chr1_16298_C_T_b38 | SAMD11 | -2.594 | 0.00985 | -0.094891 | 47 | 0.036585 | no | ESPMSL |
chr1_1367175_C_T_b38 | SAMD11 | -2.593 | 0.00988 | -0.17659 | 5 | 0.068114 | no | ESPMSL |
chr1_1882915_C_T_b38 | SAMD11 | 2.592 | 0.0099 | 0.096117 | 11 | 0.037084 | no | ESPMSL |
chr1_1642308_C_T_b38 | SAMD11 | -3.331 | 0.000974 | -0.140241 | 7 | 0.042106 | yes | HRTAA |
chr1_1916092_C_T_b38 | SAMD11 | -2.987 | 0.00305 | -0.107021 | 11 | 0.035832 | yes | HRTAA |
chr1_1923880_C_T_b38 | SAMD11 | -2.92 | 0.00376 | -0.106366 | 10 | 0.036426 | yes | HRTAA |
chr1_1742432_T_TA_b38 | SAMD11 | -2.787 | 0.00566 | -0.059004 | 60 | 0.021172 | yes | HRTAA |
chr1_109575_CGT_C_b38 | SAMD11 | -2.74 | 0.00652 | -0.104889 | 6 | 0.038285 | yes | HRTAA |
chr1_1715553_G_A_b38 | SAMD11 | 2.706 | 0.0072 | 0.0975 | 19 | 0.036034 | yes | HRTAA |
chr1_1918091_T_C_b38 | SAMD11 | -2.689 | 0.00756 | -0.097205 | 10 | 0.036144 | yes | HRTAA |
chr1_1918305_G_A_b38 | SAMD11 | -2.689 | 0.00756 | -0.097205 | 10 | 0.036144 | yes | HRTAA |
chr1_1919773_C_T_b38 | SAMD11 | -2.689 | 0.00756 | -0.097205 | 10 | 0.036144 | yes | HRTAA |
chr1_92836_G_A_b38 | SAMD11 | 2.686 | 0.00764 | 0.089985 | 8 | 0.033505 | yes | HRTAA |
chr1_1916540_T_C_b38 | SAMD11 | -2.676 | 0.00787 | -0.097235 | 10 | 0.03634 | yes | HRTAA |
chr1_1916721_A_G_b38 | SAMD11 | -2.676 | 0.00787 | -0.097235 | 10 | 0.03634 | yes | HRTAA |
chr1_1917393_A_AAC_b38 | SAMD11 | -2.676 | 0.00787 | -0.097235 | 10 | 0.03634 | yes | HRTAA |
chr1_1919475_A_G_b38 | SAMD11 | -2.676 | 0.00787 | -0.097235 | 10 | 0.03634 | yes | HRTAA |
chr1_1922149_C_T_b38 | SAMD11 | -2.676 | 0.00787 | -0.097235 | 10 | 0.03634 | yes | HRTAA |
chr1_1923107_C_T_b38 | SAMD11 | -2.655 | 0.00835 | -0.09829 | 10 | 0.037021 | yes | HRTAA |
chr1_1923278_C_T_b38 | SAMD11 | -2.655 | 0.00835 | -0.09829 | 10 | 0.037021 | yes | HRTAA |
chr1_1919746_G_T_b38 | SAMD11 | -2.652 | 0.00844 | -0.099093 | 10 | 0.037372 | yes | HRTAA |
chr1_1919749_A_G_b38 | SAMD11 | -2.652 | 0.00844 | -0.099093 | 10 | 0.037372 | yes | HRTAA |
chr1_1922482_T_C_b38 | SAMD11 | -2.652 | 0.00844 | -0.099093 | 10 | 0.037372 | yes | HRTAA |
chr1_1369035_CA_C_b38 | SAMD11 | -3.153 | 0.00178 | -0.087595 | 37 | 0.027781 | no | HRTAA |
chr1_1804004_G_A_b38 | SAMD11 | 3.127 | 0.00194 | 0.052711 | 39 | 0.016856 | no | HRTAA |
chr1_1725697_T_C_b38 | SAMD11 | 2.968 | 0.00324 | 0.075844 | 32 | 0.025555 | no | HRTAA |
chr1_1703572_A_G_b38 | SAMD11 | -2.804 | 0.00537 | -0.113912 | 17 | 0.04062 | no | HRTAA |
chr1_907835_C_CCTGCCCGGTCCTTCTGACCAGCCGAGAGAGTA_b38 | SAMD11 | 2.71 | 0.00711 | 0.061949 | 39 | 0.022856 | no | HRTAA |
chr1_650383_AACAC_A_b38 | SAMD11 | 2.641 | 0.0087 | 0.12835 | 6 | 0.048601 | no | HRTAA |
chr1_1921945_G_A_b38 | SAMD11 | -2.622 | 0.00918 | -0.096151 | 9 | 0.036667 | no | HRTAA |
chr1_1921955_T_C_b38 | SAMD11 | -2.607 | 0.00958 | -0.096117 | 9 | 0.036862 | no | HRTAA |
chr1_1725582_T_C_b38 | SAMD11 | 2.607 | 0.0096 | 0.047151 | 88 | 0.018089 | no | HRTAA |
chr1_1110693_C_A_b38 | SAMD11 | 3.127 | 0.00193 | 0.065237 | 13 | 0.02086 | yes | HRTLV |
chr1_1113121_G_A_b38 | SAMD11 | 3.127 | 0.00193 | 0.065237 | 13 | 0.02086 | yes | HRTLV |
chr1_1101480_A_C_b38 | SAMD11 | 2.887 | 0.00416 | 0.059436 | 17 | 0.020587 | yes | HRTLV |
chr1_1101923_T_C_b38 | SAMD11 | 2.887 | 0.00416 | 0.059436 | 17 | 0.020587 | yes | HRTLV |
chr1_1101987_G_A_b38 | SAMD11 | 2.887 | 0.00416 | 0.059436 | 17 | 0.020587 | yes | HRTLV |
chr1_1102708_G_C_b38 | SAMD11 | 2.887 | 0.00416 | 0.059436 | 17 | 0.020587 | yes | HRTLV |
chr1_1103617_ACTC_A_b38 | SAMD11 | 2.887 | 0.00416 | 0.059436 | 17 | 0.020587 | yes | HRTLV |
chr1_1103888_T_C_b38 | SAMD11 | 2.887 | 0.00416 | 0.059436 | 17 | 0.020587 | yes | HRTLV |
chr1_1104437_A_G_b38 | SAMD11 | 2.887 | 0.00416 | 0.059436 | 17 | 0.020587 | yes | HRTLV |
chr1_1104646_T_C_b38 | SAMD11 | 2.887 | 0.00416 | 0.059436 | 17 | 0.020587 | yes | HRTLV |
chr1_1105092_C_T_b38 | SAMD11 | 2.887 | 0.00416 | 0.059436 | 17 | 0.020587 | yes | HRTLV |
chr1_1105414_G_A_b38 | SAMD11 | 2.887 | 0.00416 | 0.059436 | 17 | 0.020587 | yes | HRTLV |
chr1_1105560_A_C_b38 | SAMD11 | 2.887 | 0.00416 | 0.059436 | 17 | 0.020587 | yes | HRTLV |
chr1_1105605_C_G_b38 | SAMD11 | 2.887 | 0.00416 | 0.059436 | 17 | 0.020587 | yes | HRTLV |
chr1_1106320_A_G_b38 | SAMD11 | 2.887 | 0.00416 | 0.059436 | 17 | 0.020587 | yes | HRTLV |
chr1_1106406_T_C_b38 | SAMD11 | 2.887 | 0.00416 | 0.059436 | 17 | 0.020587 | yes | HRTLV |
chr1_1106998_A_C_b38 | SAMD11 | 2.887 | 0.00416 | 0.059436 | 17 | 0.020587 | yes | HRTLV |
chr1_1107103_C_T_b38 | SAMD11 | 2.887 | 0.00416 | 0.059436 | 17 | 0.020587 | yes | HRTLV |
chr1_1107293_C_T_b38 | SAMD11 | 2.887 | 0.00416 | 0.059436 | 17 | 0.020587 | yes | HRTLV |
chr1_1107547_G_T_b38 | SAMD11 | 2.887 | 0.00416 | 0.059436 | 17 | 0.020587 | yes | HRTLV |
chr1_1107673_A_G_b38 | SAMD11 | 2.887 | 0.00416 | 0.059436 | 17 | 0.020587 | yes | HRTLV |
chr1_1107882_T_C_b38 | SAMD11 | 2.887 | 0.00416 | 0.059436 | 17 | 0.020587 | yes | HRTLV |
chr1_1110784_C_T_b38 | SAMD11 | 2.887 | 0.00416 | 0.059436 | 17 | 0.020587 | yes | HRTLV |
chr1_272378_A_T_b38 | SAMD11 | -2.857 | 0.00456 | -0.116228 | 5 | 0.040684 | yes | HRTLV |
chr1_1120968_G_A_b38 | SAMD11 | 2.829 | 0.00497 | 0.058964 | 14 | 0.020845 | yes | HRTLV |
chr1_1129155_G_C_b38 | SAMD11 | -2.824 | 0.00504 | -0.050515 | 26 | 0.017885 | yes | HRTLV |
chr1_101393_T_C_b38 | SAMD11 | -2.817 | 0.00515 | -0.061619 | 5 | 0.021874 | yes | HRTLV |
chr1_1750589_G_A_b38 | SAMD11 | -2.793 | 0.00554 | -0.084767 | 8 | 0.030347 | yes | HRTLV |
chr1_1118290_G_A_b38 | SAMD11 | 2.787 | 0.00564 | 0.05752 | 17 | 0.020638 | yes | HRTLV |
chr1_1111994_T_A_b38 | SAMD11 | 2.72 | 0.00689 | 0.055905 | 18 | 0.020553 | yes | HRTLV |
chr1_1115274_C_CA_b38 | SAMD11 | 2.72 | 0.00689 | 0.055905 | 18 | 0.020553 | yes | HRTLV |
chr1_1103993_C_CT_b38 | SAMD11 | 2.683 | 0.00768 | 0.0553 | 17 | 0.02061 | yes | HRTLV |
chr1_1119513_T_C_b38 | SAMD11 | 2.637 | 0.00877 | 0.054317 | 18 | 0.020596 | yes | HRTLV |
chr1_1303675_C_CCCT_b38 | SAMD11 | 2.637 | 0.00879 | 0.063728 | 3 | 0.024171 | yes | HRTLV |
chr1_16378_T_C_b38 | SAMD11 | 2.63 | 0.00896 | 0.071831 | 10 | 0.027312 | yes | HRTLV |
chr1_1092465_T_G_b38 | SAMD11 | 2.627 | 0.00903 | 0.052544 | 16 | 0.02 | yes | HRTLV |
chr1_1092466_T_C_b38 | SAMD11 | 2.627 | 0.00903 | 0.052544 | 16 | 0.02 | yes | HRTLV |
chr1_1121335_C_T_b38 | SAMD11 | 2.627 | 0.00904 | 0.054014 | 18 | 0.020562 | yes | HRTLV |
chr1_1164837_C_T_b38 | SAMD11 | -3.877 | 0.000129 | -0.107585 | 4 | 0.027751 | no | HRTLV |
chr1_1164939_C_A_b38 | SAMD11 | -3.845 | 0.000146 | -0.106043 | 4 | 0.027582 | no | HRTLV |
chr1_1165623_C_T_b38 | SAMD11 | -3.617 | 0.000347 | -0.099247 | 4 | 0.02744 | no | HRTLV |
chr1_1168310_T_TCA_b38 | SAMD11 | -3.376 | 0.000829 | -0.093847 | 4 | 0.027801 | no | HRTLV |
chr1_1113191_A_G_b38 | SAMD11 | 3.352 | 9e-04 | 0.070611 | 12 | 0.021065 | no | HRTLV |
chr1_1163962_A_C_b38 | SAMD11 | -3.347 | 0.000916 | -0.088992 | 5 | 0.026589 | no | HRTLV |
chr1_1168578_T_G_b38 | SAMD11 | -3.29 | 0.00112 | -0.090597 | 4 | 0.027539 | no | HRTLV |
chr1_1163440_TC_T_b38 | SAMD11 | -3.243 | 0.00131 | -0.085867 | 5 | 0.026478 | no | HRTLV |
chr1_16298_C_T_b38 | SAMD11 | 3.228 | 0.00138 | 0.073023 | 44 | 0.022618 | no | HRTLV |
chr1_1168162_T_C_b38 | SAMD11 | -3.211 | 0.00146 | -0.085591 | 5 | 0.026651 | no | HRTLV |
chr1_128798_C_T_b38 | SAMD11 | -3.192 | 0.00156 | -0.154096 | 3 | 0.048282 | no | HRTLV |
chr1_1161528_T_C_b38 | SAMD11 | -3.139 | 0.00186 | -0.082763 | 6 | 0.026367 | no | HRTLV |
chr1_1161907_T_C_b38 | SAMD11 | -3.139 | 0.00186 | -0.082763 | 6 | 0.026367 | no | HRTLV |
chr1_1161955_T_G_b38 | SAMD11 | -3.139 | 0.00186 | -0.082763 | 6 | 0.026367 | no | HRTLV |
chr1_590813_C_T_b38 | SAMD11 | -3.129 | 0.00192 | -0.120124 | 3 | 0.03839 | no | HRTLV |
chr1_1161720_C_T_b38 | SAMD11 | -3.11 | 0.00204 | -0.081971 | 6 | 0.026354 | no | HRTLV |
chr1_1162027_CCCCA_C_b38 | SAMD11 | -3.11 | 0.00204 | -0.081971 | 6 | 0.026354 | no | HRTLV |
chr1_1742119_CA_C_b38 | SAMD11 | -3.037 | 0.00259 | -0.0598 | 21 | 0.01969 | no | HRTLV |
chr1_599165_G_A_b38 | SAMD11 | -2.934 | 0.0036 | -0.064557 | 8 | 0.022006 | no | HRTLV |
chr1_1130902_A_G_b38 | SAMD11 | -2.917 | 0.00379 | -0.04949 | 32 | 0.016968 | no | HRTLV |
chr1_1105739_G_GGGCGTGGT_b38 | SAMD11 | 2.859 | 0.00453 | 0.05942 | 16 | 0.020784 | no | HRTLV |
chr1_1111365_CAA_C_b38 | SAMD11 | 2.851 | 0.00465 | 0.0674 | 8 | 0.023641 | no | HRTLV |
chr1_1118344_A_G_b38 | SAMD11 | 2.79 | 0.0056 | 0.057963 | 16 | 0.020779 | no | HRTLV |
chr1_1118696_C_T_b38 | SAMD11 | 2.79 | 0.0056 | 0.057963 | 16 | 0.020779 | no | HRTLV |
chr1_1612562_T_TC_b38 | SAMD11 | 2.685 | 0.00763 | 0.044955 | 36 | 0.016741 | no | HRTLV |
chr1_1168009_GGGGCGGAGGGCCGAGCGGGGCCAGCAGACGGGTGA_G_b38 | SAMD11 | -2.678 | 0.00779 | -0.036805 | 25 | 0.013743 | no | HRTLV |
chr1_1130879_G_C_b38 | SAMD11 | -2.603 | 0.00968 | -0.052253 | 13 | 0.020075 | no | HRTLV |
chr1_1768171_CA_C_b38 | SAMD11 | -3.253 | 0.00212 | -0.211005 | 4 | 0.064864 | yes | KDNCTX |
chr1_1912983_T_C_b38 | SAMD11 | -2.86 | 0.00629 | -0.192396 | 7 | 0.067263 | yes | KDNCTX |
chr1_285175_C_T_b38 | SAMD11 | -2.689 | 0.00988 | -0.220052 | 4 | 0.081823 | yes | KDNCTX |
chr1_1330080_T_C_b38 | SAMD11 | 2.786 | 0.00767 | 0.30347 | 4 | 0.108929 | no | KDNCTX |
chr1_1574655_GGC_G_b38 | SAMD11 | 2.772 | 0.00796 | 0.166949 | 10 | 0.060227 | no | KDNCTX |
chr1_667265_C_T_b38 | SAMD11 | -2.746 | 0.00852 | -0.313184 | 4 | 0.114056 | no | KDNCTX |
chr1_1538924_C_A_b38 | SAMD11 | 2.744 | 0.00857 | 0.160005 | 7 | 0.058316 | no | KDNCTX |
chr1_1921045_A_G_b38 | SAMD11 | -2.732 | 0.00884 | -0.182293 | 8 | 0.066723 | no | KDNCTX |
chr1_1547630_G_A_b38 | SAMD11 | 2.716 | 0.00921 | 0.140555 | 14 | 0.051743 | no | KDNCTX |
chr1_1212042_C_T_b38 | SAMD11 | -3.758 | 0.000237 | -0.141273 | 7 | 0.037597 | yes | LIVER |
chr1_1174639_A_G_b38 | SAMD11 | -3.686 | 0.000308 | -0.149845 | 5 | 0.040655 | yes | LIVER |
chr1_1177741_G_A_b38 | SAMD11 | -3.612 | 0.000402 | -0.155547 | 4 | 0.043068 | yes | LIVER |
chr1_1175607_T_TC_b38 | SAMD11 | -3.558 | 0.000486 | -0.150936 | 4 | 0.04242 | yes | LIVER |
chr1_1174578_A_G_b38 | SAMD11 | -3.27 | 0.00131 | -0.138078 | 4 | 0.042229 | yes | LIVER |
chr1_1173138_T_C_b38 | SAMD11 | -3.203 | 0.00163 | -0.142124 | 4 | 0.044368 | yes | LIVER |
chr1_1156987_C_T_b38 | SAMD11 | 3.182 | 0.00174 | 0.097542 | 16 | 0.030654 | yes | LIVER |
chr1_1282558_C_CCA_b38 | SAMD11 | -3.115 | 0.00217 | -0.137101 | 11 | 0.044013 | yes | LIVER |
chr1_1133807_G_A_b38 | SAMD11 | -3.092 | 0.00233 | -0.145359 | 5 | 0.047016 | yes | LIVER |
chr1_1133811_A_G_b38 | SAMD11 | -3.092 | 0.00233 | -0.145359 | 5 | 0.047016 | yes | LIVER |
chr1_1153726_G_A_b38 | SAMD11 | 3.06 | 0.00258 | 0.09304 | 17 | 0.030407 | yes | LIVER |
chr1_1331945_G_GC_b38 | SAMD11 | -2.801 | 0.0057 | -0.172212 | 3 | 0.061481 | yes | LIVER |
chr1_1278491_C_CT_b38 | SAMD11 | -2.79 | 0.00589 | -0.131574 | 4 | 0.047165 | yes | LIVER |
chr1_911484_G_C_b38 | SAMD11 | 2.695 | 0.00777 | 0.094749 | 10 | 0.035163 | yes | LIVER |
chr1_933548_A_AG_b38 | SAMD11 | -2.661 | 0.00856 | -0.081787 | 31 | 0.030738 | yes | LIVER |
chr1_899548_A_G_b38 | SAMD11 | 2.623 | 0.00953 | 0.094945 | 8 | 0.036199 | yes | LIVER |
chr1_899619_G_A_b38 | SAMD11 | 2.623 | 0.00953 | 0.094945 | 8 | 0.036199 | yes | LIVER |
chr1_1207724_C_T_b38 | SAMD11 | -3.954 | 0.000113 | -0.210542 | 3 | 0.053244 | no | LIVER |
chr1_1175611_G_C_b38 | SAMD11 | -3.944 | 0.000118 | -0.166288 | 4 | 0.04216 | no | LIVER |
chr1_1178191_A_G_b38 | SAMD11 | -3.764 | 0.000231 | -0.156854 | 4 | 0.041674 | no | LIVER |
chr1_1181009_A_AGCCCCTGCCCCTGCCCCTGAACCC_b38 | SAMD11 | -3.75 | 0.000244 | -0.181621 | 3 | 0.048435 | no | LIVER |
chr1_1174845_C_T_b38 | SAMD11 | -3.743 | 0.00025 | -0.17111 | 3 | 0.045719 | no | LIVER |
chr1_1174988_C_T_b38 | SAMD11 | -3.743 | 0.00025 | -0.17111 | 3 | 0.045719 | no | LIVER |
chr1_1175040_T_C_b38 | SAMD11 | -3.743 | 0.00025 | -0.17111 | 3 | 0.045719 | no | LIVER |
chr1_1172462_G_C_b38 | SAMD11 | -3.709 | 0.000283 | -0.171308 | 4 | 0.046191 | no | LIVER |
chr1_1178014_C_T_b38 | SAMD11 | -3.708 | 0.000284 | -0.172932 | 3 | 0.04664 | no | LIVER |
chr1_1173996_G_A_b38 | SAMD11 | -3.673 | 0.000323 | -0.168996 | 3 | 0.046016 | no | LIVER |
chr1_1173815_A_G_b38 | SAMD11 | -3.667 | 0.000329 | -0.165659 | 3 | 0.04517 | no | LIVER |
chr1_1174273_G_A_b38 | SAMD11 | -3.665 | 0.000331 | -0.153972 | 4 | 0.042007 | no | LIVER |
chr1_1174523_C_T_b38 | SAMD11 | -3.638 | 0.000366 | -0.168808 | 3 | 0.046401 | no | LIVER |
chr1_1174747_C_T_b38 | SAMD11 | -3.638 | 0.000366 | -0.168808 | 3 | 0.046401 | no | LIVER |
chr1_1177430_G_T_b38 | SAMD11 | -3.638 | 0.000366 | -0.168808 | 3 | 0.046401 | no | LIVER |
chr1_1179288_G_A_b38 | SAMD11 | -3.638 | 0.000366 | -0.168808 | 3 | 0.046401 | no | LIVER |
chr1_1174174_G_C_b38 | SAMD11 | -3.567 | 0.000471 | -0.162326 | 3 | 0.045508 | no | LIVER |
chr1_1173931_G_A_b38 | SAMD11 | -3.477 | 0.000646 | -0.155615 | 3 | 0.044754 | no | LIVER |
chr1_1173935_C_G_b38 | SAMD11 | -3.477 | 0.000646 | -0.155615 | 3 | 0.044754 | no | LIVER |
chr1_1173724_G_T_b38 | SAMD11 | -3.348 | 0.00101 | -0.15827 | 3 | 0.047275 | no | LIVER |
chr1_1174573_G_A_b38 | SAMD11 | -3.346 | 0.00101 | -0.153951 | 3 | 0.046006 | no | LIVER |
chr1_1277269_T_C_b38 | SAMD11 | -3.229 | 0.0015 | -0.151747 | 12 | 0.046996 | no | LIVER |
chr1_1277844_T_A_b38 | SAMD11 | -3.229 | 0.0015 | -0.151747 | 12 | 0.046996 | no | LIVER |
chr1_1278407_T_TA_b38 | SAMD11 | -3.229 | 0.0015 | -0.151747 | 12 | 0.046996 | no | LIVER |
chr1_1282706_C_T_b38 | SAMD11 | -3.229 | 0.0015 | -0.151747 | 12 | 0.046996 | no | LIVER |
chr1_1274972_A_G_b38 | SAMD11 | -3.07 | 0.0025 | -0.143892 | 12 | 0.046874 | no | LIVER |
chr1_1275091_T_C_b38 | SAMD11 | -3.07 | 0.0025 | -0.143892 | 12 | 0.046874 | no | LIVER |
chr1_1275912_C_T_b38 | SAMD11 | -3.06 | 0.00258 | -0.155627 | 7 | 0.050852 | no | LIVER |
chr1_1279694_A_G_b38 | SAMD11 | -3.06 | 0.00258 | -0.155627 | 7 | 0.050852 | no | LIVER |
chr1_1279698_A_G_b38 | SAMD11 | -3.06 | 0.00258 | -0.155627 | 7 | 0.050852 | no | LIVER |
chr1_1279728_TG_T_b38 | SAMD11 | -3.06 | 0.00258 | -0.155627 | 7 | 0.050852 | no | LIVER |
chr1_1274256_A_G_b38 | SAMD11 | -2.88 | 0.0045 | -0.145506 | 7 | 0.050522 | no | LIVER |
chr1_1274980_C_T_b38 | SAMD11 | -2.88 | 0.0045 | -0.145506 | 7 | 0.050522 | no | LIVER |
chr1_1131763_C_T_b38 | SAMD11 | -2.82 | 0.00538 | -0.136496 | 3 | 0.0484 | no | LIVER |
chr1_1153291_C_T_b38 | SAMD11 | 2.721 | 0.00719 | 0.086958 | 15 | 0.031952 | no | LIVER |
chr1_1469285_T_TA_b38 | SAMD11 | 3.145 | 0.00177 | 0.156859 | 3 | 0.049881 | yes | LUNG |
chr1_936972_G_C_b38 | SAMD11 | -3.119 | 0.00193 | -0.063741 | 53 | 0.020437 | yes | LUNG |
chr1_1716919_CTT_C_b38 | SAMD11 | -3.071 | 0.00227 | -0.063907 | 56 | 0.020811 | yes | LUNG |
chr1_933548_A_AG_b38 | SAMD11 | 3.045 | 0.00247 | 0.060245 | 84 | 0.019786 | yes | LUNG |
chr1_915400_C_T_b38 | SAMD11 | 2.936 | 0.0035 | 0.055895 | 98 | 0.019037 | yes | LUNG |
chr1_914991_G_T_b38 | SAMD11 | 2.924 | 0.00363 | 0.0559 | 96 | 0.019119 | yes | LUNG |
chr1_933741_T_TG_b38 | SAMD11 | 2.867 | 0.00435 | 0.058518 | 64 | 0.020414 | yes | LUNG |
chr1_1722599_G_A_b38 | SAMD11 | -2.837 | 0.00476 | -0.064451 | 64 | 0.022714 | yes | LUNG |
chr1_1722619_C_T_b38 | SAMD11 | -2.78 | 0.00567 | -0.067544 | 44 | 0.024298 | yes | LUNG |
chr1_1068824_G_A_b38 | SAMD11 | 2.767 | 0.0059 | 0.085276 | 8 | 0.030824 | yes | LUNG |
chr1_1680254_T_C_b38 | SAMD11 | -2.743 | 0.00633 | -0.179742 | 3 | 0.065526 | yes | LUNG |
chr1_1722625_A_T_b38 | SAMD11 | -2.734 | 0.00651 | -0.067472 | 41 | 0.024678 | yes | LUNG |
chr1_1440430_C_G_b38 | SAMD11 | 2.668 | 0.0079 | 0.061858 | 38 | 0.023183 | yes | LUNG |
chr1_931513_T_C_b38 | SAMD11 | 2.652 | 0.00829 | 0.050777 | 128 | 0.019148 | yes | LUNG |
chr1_938178_G_T_b38 | SAMD11 | 2.644 | 0.00848 | 0.054314 | 79 | 0.020543 | yes | LUNG |
chr1_1634405_C_CGG_b38 | SAMD11 | 2.631 | 0.00881 | 0.144622 | 4 | 0.054967 | yes | LUNG |
chr1_1682717_C_T_b38 | SAMD11 | -2.63 | 0.00884 | -0.1718 | 3 | 0.065325 | yes | LUNG |
chr1_1685551_C_T_b38 | SAMD11 | -2.63 | 0.00884 | -0.1718 | 3 | 0.065325 | yes | LUNG |
chr1_1687330_A_G_b38 | SAMD11 | -2.63 | 0.00884 | -0.1718 | 3 | 0.065325 | yes | LUNG |
chr1_744357_G_C_b38 | SAMD11 | 2.946 | 0.00339 | 0.133584 | 7 | 0.045346 | no | LUNG |
chr1_1834667_C_CT_b38 | SAMD11 | -2.837 | 0.00476 | -0.05708 | 63 | 0.020117 | no | LUNG |
chr1_1694987_G_A_b38 | SAMD11 | -2.818 | 0.00504 | -0.170295 | 4 | 0.060426 | no | LUNG |
chr1_1696214_G_T_b38 | SAMD11 | -2.818 | 0.00504 | -0.170295 | 4 | 0.060426 | no | LUNG |
chr1_1714807_A_G_b38 | SAMD11 | -2.818 | 0.00504 | -0.170295 | 4 | 0.060426 | no | LUNG |
chr1_1719896_T_C_b38 | SAMD11 | -2.818 | 0.00504 | -0.170295 | 4 | 0.060426 | no | LUNG |
chr1_1714987_C_T_b38 | SAMD11 | -2.815 | 0.00509 | -0.162453 | 5 | 0.057702 | no | LUNG |
chr1_1719740_C_T_b38 | SAMD11 | -2.808 | 0.0052 | -0.168607 | 4 | 0.060045 | no | LUNG |
chr1_1718786_G_A_b38 | SAMD11 | -2.793 | 0.00545 | -0.161171 | 5 | 0.05771 | no | LUNG |
chr1_1719189_G_A_b38 | SAMD11 | -2.793 | 0.00545 | -0.161171 | 5 | 0.05771 | no | LUNG |
chr1_1720548_G_A_b38 | SAMD11 | -2.793 | 0.00545 | -0.161171 | 5 | 0.05771 | no | LUNG |
chr1_1721336_G_A_b38 | SAMD11 | -2.793 | 0.00545 | -0.161171 | 5 | 0.05771 | no | LUNG |
chr1_939779_AGCCAGTGGACGCCGACCT_A_b38 | SAMD11 | 2.708 | 0.00704 | 0.052094 | 108 | 0.019239 | no | LUNG |
chr1_1724428_C_CG_b38 | SAMD11 | -2.701 | 0.00717 | -0.156214 | 5 | 0.057831 | no | LUNG |
chr1_1572877_T_TG_b38 | SAMD11 | -2.676 | 0.00773 | -0.070844 | 14 | 0.026475 | no | LUNG |
chr1_1288085_GC_G_b38 | SAMD11 | 4.189 | 5.43e-05 | 0.174039 | 3 | 0.041547 | yes | SLVRYG |
chr1_1372258_T_C_b38 | SAMD11 | -3.643 | 0.000401 | -0.16144 | 3 | 0.044309 | yes | SLVRYG |
chr1_1379091_T_G_b38 | SAMD11 | -3.635 | 0.000412 | -0.132337 | 5 | 0.036402 | yes | SLVRYG |
chr1_1363153_T_G_b38 | SAMD11 | -3.572 | 0.000513 | -0.146415 | 9 | 0.040987 | yes | SLVRYG |
chr1_1368047_ACT_A_b38 | SAMD11 | -3.572 | 0.000513 | -0.146415 | 9 | 0.040987 | yes | SLVRYG |
chr1_1374694_C_G_b38 | SAMD11 | -3.57 | 0.000517 | -0.161132 | 3 | 0.045133 | yes | SLVRYG |
chr1_1428999_C_CA_b38 | SAMD11 | 3.568 | 0.000521 | 0.103777 | 9 | 0.029084 | yes | SLVRYG |
chr1_1378204_G_C_b38 | SAMD11 | -3.559 | 0.000537 | -0.113485 | 13 | 0.031883 | yes | SLVRYG |
chr1_1436079_A_G_b38 | SAMD11 | 3.456 | 0.000763 | 0.108126 | 18 | 0.031286 | yes | SLVRYG |
chr1_1438102_G_C_b38 | SAMD11 | 3.445 | 0.000792 | 0.118463 | 5 | 0.034388 | yes | SLVRYG |
chr1_1330080_T_C_b38 | SAMD11 | -3.369 | 0.00102 | -0.144824 | 9 | 0.042991 | yes | SLVRYG |
chr1_1337898_A_G_b38 | SAMD11 | -3.366 | 0.00103 | -0.107871 | 5 | 0.032046 | yes | SLVRYG |
chr1_1440430_C_G_b38 | SAMD11 | 3.322 | 0.00119 | 0.112732 | 10 | 0.033931 | yes | SLVRYG |
chr1_1440834_C_G_b38 | SAMD11 | 3.27 | 0.00141 | 0.107804 | 18 | 0.032967 | yes | SLVRYG |
chr1_1375678_TA_T_b38 | SAMD11 | -3.236 | 0.00157 | -0.102185 | 10 | 0.031575 | yes | SLVRYG |
chr1_1450322_CAA_C_b38 | SAMD11 | 3.229 | 0.00161 | 0.156025 | 3 | 0.04832 | yes | SLVRYG |
chr1_1433374_T_C_b38 | SAMD11 | 3.199 | 0.00177 | 0.101682 | 18 | 0.031786 | yes | SLVRYG |
chr1_1366427_AGTGTGATTGAATGAGT_A_b38 | SAMD11 | -3.164 | 0.00198 | -0.103893 | 12 | 0.032839 | yes | SLVRYG |
chr1_857828_C_G_b38 | SAMD11 | 3.095 | 0.00246 | 0.100473 | 17 | 0.032465 | yes | SLVRYG |
chr1_1447108_A_ATT_b38 | SAMD11 | 3.084 | 0.00255 | 0.107372 | 7 | 0.03482 | yes | SLVRYG |
chr1_1431026_CCACCCCCT_C_b38 | SAMD11 | 3.041 | 0.00291 | 0.096384 | 15 | 0.0317 | yes | SLVRYG |
chr1_1361679_G_A_b38 | SAMD11 | -3.029 | 0.00302 | -0.102237 | 13 | 0.033755 | yes | SLVRYG |
chr1_1431014_G_A_b38 | SAMD11 | 2.956 | 0.00376 | 0.097933 | 6 | 0.033129 | yes | SLVRYG |
chr1_1411929_G_C_b38 | SAMD11 | 2.903 | 0.00441 | 0.115049 | 8 | 0.039632 | yes | SLVRYG |
chr1_1702383_T_C_b38 | SAMD11 | -2.883 | 0.00468 | -0.090155 | 6 | 0.031268 | yes | SLVRYG |
chr1_1135061_C_T_b38 | SAMD11 | 2.856 | 0.00507 | 0.105508 | 3 | 0.036938 | yes | SLVRYG |
chr1_1435945_C_CCGGGCGGGGGCG_b38 | SAMD11 | 2.664 | 0.00881 | 0.100006 | 4 | 0.037544 | yes | SLVRYG |
chr1_1533754_T_C_b38 | SAMD11 | 2.646 | 0.00925 | 0.087567 | 11 | 0.033093 | yes | SLVRYG |
chr1_1395346_A_G_b38 | SAMD11 | 4.122 | 7.03e-05 | 0.141899 | 19 | 0.034429 | no | SLVRYG |
chr1_1394423_A_G_b38 | SAMD11 | 4.097 | 7.7e-05 | 0.140523 | 19 | 0.034296 | no | SLVRYG |
chr1_1389827_C_T_b38 | SAMD11 | -4.097 | 7.7e-05 | -0.140523 | 19 | 0.034296 | no | SLVRYG |
chr1_1402457_A_G_b38 | SAMD11 | 3.952 | 0.000132 | 0.137141 | 20 | 0.034699 | no | SLVRYG |
chr1_1387698_A_G_b38 | SAMD11 | -3.934 | 0.000141 | -0.136128 | 20 | 0.034599 | no | SLVRYG |
chr1_1411323_A_C_b38 | SAMD11 | 3.926 | 0.000146 | 0.13438 | 20 | 0.034232 | no | SLVRYG |
chr1_1421170_A_G_b38 | SAMD11 | 3.852 | 0.000191 | 0.181981 | 8 | 0.047239 | no | SLVRYG |
chr1_1385919_A_AG_b38 | SAMD11 | -3.741 | 0.000284 | -0.152012 | 5 | 0.040634 | no | SLVRYG |
chr1_1330125_G_A_b38 | SAMD11 | -3.692 | 0.000339 | -0.125652 | 20 | 0.034037 | no | SLVRYG |
chr1_1308516_C_T_b38 | SAMD11 | -3.683 | 0.000349 | -0.12397 | 21 | 0.033659 | no | SLVRYG |
chr1_1445187_T_G_b38 | SAMD11 | 3.659 | 0.00038 | 0.119916 | 16 | 0.032776 | no | SLVRYG |
chr1_1280044_T_C_b38 | SAMD11 | 3.64 | 0.000406 | 0.119141 | 21 | 0.032729 | no | SLVRYG |
chr1_1419135_C_G_b38 | SAMD11 | 3.625 | 0.000427 | 0.169073 | 14 | 0.046637 | no | SLVRYG |
chr1_1422081_C_T_b38 | SAMD11 | 3.625 | 0.000427 | 0.169073 | 14 | 0.046637 | no | SLVRYG |
chr1_1312114_T_C_b38 | SAMD11 | -3.604 | 0.00046 | -0.124073 | 20 | 0.034427 | no | SLVRYG |
chr1_1358384_G_C_b38 | SAMD11 | -3.604 | 0.00046 | -0.124073 | 20 | 0.034427 | no | SLVRYG |
chr1_1309988_G_A_b38 | SAMD11 | -3.588 | 0.000486 | -0.118926 | 22 | 0.033143 | no | SLVRYG |
chr1_1313807_G_A_b38 | SAMD11 | -3.588 | 0.000486 | -0.118926 | 22 | 0.033143 | no | SLVRYG |
chr1_1410877_A_G_b38 | SAMD11 | 3.578 | 0.000503 | 0.152615 | 11 | 0.042654 | no | SLVRYG |
chr1_1366561_AGT_A_b38 | SAMD11 | -3.528 | 0.000597 | -0.120861 | 19 | 0.034257 | no | SLVRYG |
chr1_1445240_A_G_b38 | SAMD11 | 3.433 | 0.000824 | 0.113068 | 18 | 0.032936 | no | SLVRYG |
chr1_1376162_G_C_b38 | SAMD11 | -3.422 | 0.000854 | -0.113629 | 12 | 0.033204 | no | SLVRYG |
chr1_1377431_C_T_b38 | SAMD11 | -3.422 | 0.000854 | -0.113629 | 12 | 0.033204 | no | SLVRYG |
chr1_1384749_C_G_b38 | SAMD11 | -3.422 | 0.000854 | -0.113629 | 12 | 0.033204 | no | SLVRYG |
chr1_1387763_CCT_C_b38 | SAMD11 | -3.422 | 0.000854 | -0.113629 | 12 | 0.033204 | no | SLVRYG |
chr1_1388944_G_A_b38 | SAMD11 | -3.422 | 0.000854 | -0.113629 | 12 | 0.033204 | no | SLVRYG |
chr1_1319063_G_A_b38 | SAMD11 | -3.397 | 0.00093 | -0.155113 | 12 | 0.045667 | no | SLVRYG |
chr1_1319461_C_G_b38 | SAMD11 | -3.397 | 0.00093 | -0.155113 | 12 | 0.045667 | no | SLVRYG |
chr1_1320023_TG_T_b38 | SAMD11 | -3.397 | 0.00093 | -0.155113 | 12 | 0.045667 | no | SLVRYG |
chr1_1324788_C_A_b38 | SAMD11 | -3.389 | 0.000956 | -0.14121 | 10 | 0.041673 | no | SLVRYG |
chr1_1439454_A_G_b38 | SAMD11 | 3.309 | 0.00124 | 0.107253 | 18 | 0.032409 | no | SLVRYG |
chr1_1419214_A_G_b38 | SAMD11 | 3.298 | 0.00129 | 0.128876 | 7 | 0.039076 | no | SLVRYG |
chr1_1400410_A_G_b38 | SAMD11 | 3.279 | 0.00137 | 0.108921 | 13 | 0.033219 | no | SLVRYG |
chr1_1375998_T_A_b38 | SAMD11 | -3.257 | 0.00147 | -0.132471 | 4 | 0.040671 | no | SLVRYG |
chr1_1353443_A_G_b38 | SAMD11 | -3.25 | 0.0015 | -0.137554 | 4 | 0.042322 | no | SLVRYG |
chr1_1322866_A_C_b38 | SAMD11 | -3.236 | 0.00157 | -0.135999 | 10 | 0.042022 | no | SLVRYG |
chr1_1327211_C_T_b38 | SAMD11 | -3.236 | 0.00157 | -0.135999 | 10 | 0.042022 | no | SLVRYG |
chr1_1357046_C_G_b38 | SAMD11 | -3.236 | 0.00157 | -0.135999 | 10 | 0.042022 | no | SLVRYG |
chr1_1357369_C_T_b38 | SAMD11 | -3.236 | 0.00157 | -0.135999 | 10 | 0.042022 | no | SLVRYG |
chr1_1358907_C_A_b38 | SAMD11 | -3.236 | 0.00157 | -0.135999 | 10 | 0.042022 | no | SLVRYG |
chr1_1359943_G_A_b38 | SAMD11 | -3.236 | 0.00157 | -0.135999 | 10 | 0.042022 | no | SLVRYG |
chr1_1360023_T_C_b38 | SAMD11 | -3.236 | 0.00157 | -0.135999 | 10 | 0.042022 | no | SLVRYG |
chr1_1379083_AT_A_b38 | SAMD11 | -3.234 | 0.00158 | -0.104269 | 6 | 0.032238 | no | SLVRYG |
chr1_1385553_G_A_b38 | SAMD11 | -3.171 | 0.00194 | -0.136137 | 4 | 0.042936 | no | SLVRYG |
chr1_1318756_G_A_b38 | SAMD11 | -3.167 | 0.00196 | -0.143539 | 11 | 0.045324 | no | SLVRYG |
chr1_1375288_A_C_b38 | SAMD11 | -3.165 | 0.00197 | -0.131145 | 4 | 0.041437 | no | SLVRYG |
chr1_1375595_C_T_b38 | SAMD11 | -3.165 | 0.00197 | -0.131145 | 4 | 0.041437 | no | SLVRYG |
chr1_1376092_G_A_b38 | SAMD11 | -3.165 | 0.00197 | -0.131145 | 4 | 0.041437 | no | SLVRYG |
chr1_1376336_G_A_b38 | SAMD11 | -3.165 | 0.00197 | -0.131145 | 4 | 0.041437 | no | SLVRYG |
chr1_1379664_G_A_b38 | SAMD11 | -3.165 | 0.00197 | -0.131145 | 4 | 0.041437 | no | SLVRYG |
chr1_1380790_G_A_b38 | SAMD11 | -3.165 | 0.00197 | -0.131145 | 4 | 0.041437 | no | SLVRYG |
chr1_1259424_T_C_b38 | SAMD11 | 3.15 | 0.00207 | 0.111894 | 18 | 0.035525 | no | SLVRYG |
chr1_1443457_T_C_b38 | SAMD11 | 3.111 | 0.00234 | 0.102959 | 19 | 0.033093 | no | SLVRYG |
chr1_1337736_A_G_b38 | SAMD11 | -3.1 | 0.00242 | -0.128353 | 4 | 0.041406 | no | SLVRYG |
chr1_1327982_G_A_b38 | SAMD11 | -3.075 | 0.00262 | -0.131271 | 11 | 0.042694 | no | SLVRYG |
chr1_1426261_C_T_b38 | SAMD11 | 3.045 | 0.00287 | 0.098337 | 17 | 0.032295 | no | SLVRYG |
chr1_1426810_C_G_b38 | SAMD11 | 3.045 | 0.00287 | 0.098337 | 17 | 0.032295 | no | SLVRYG |
chr1_1351517_G_C_b38 | SAMD11 | -3.032 | 0.00299 | -0.121136 | 4 | 0.039952 | no | SLVRYG |
chr1_1341030_C_A_b38 | SAMD11 | -3.008 | 0.00321 | -0.123561 | 11 | 0.041073 | no | SLVRYG |
chr1_1329774_T_C_b38 | SAMD11 | -3.008 | 0.00322 | -0.127034 | 4 | 0.042236 | no | SLVRYG |
chr1_1353091_C_T_b38 | SAMD11 | -3.008 | 0.00322 | -0.127034 | 4 | 0.042236 | no | SLVRYG |
chr1_1430908_A_G_b38 | SAMD11 | 2.966 | 0.00365 | 0.095258 | 17 | 0.032113 | no | SLVRYG |
chr1_1430190_A_C_b38 | SAMD11 | 2.963 | 0.00368 | 0.095696 | 17 | 0.032296 | no | SLVRYG |
chr1_1431450_A_G_b38 | SAMD11 | 2.963 | 0.00368 | 0.095696 | 17 | 0.032296 | no | SLVRYG |
chr1_1431537_G_C_b38 | SAMD11 | 2.963 | 0.00368 | 0.095696 | 17 | 0.032296 | no | SLVRYG |
chr1_1381268_C_T_b38 | SAMD11 | -2.951 | 0.00382 | -0.125405 | 4 | 0.0425 | no | SLVRYG |
chr1_1381294_C_T_b38 | SAMD11 | -2.951 | 0.00382 | -0.125405 | 4 | 0.0425 | no | SLVRYG |
chr1_1370113_A_G_b38 | SAMD11 | -2.926 | 0.00412 | -0.091898 | 15 | 0.03141 | no | SLVRYG |
chr1_1425013_C_T_b38 | SAMD11 | 2.914 | 0.00427 | 0.134599 | 14 | 0.046196 | no | SLVRYG |
chr1_1428969_T_C_b38 | SAMD11 | 2.899 | 0.00446 | 0.093646 | 17 | 0.032299 | no | SLVRYG |
chr1_1157314_CA_C_b38 | SAMD11 | 2.887 | 0.00463 | 0.08639 | 7 | 0.029929 | no | SLVRYG |
chr1_1408687_T_C_b38 | SAMD11 | 2.868 | 0.0049 | 0.125712 | 5 | 0.043837 | no | SLVRYG |
chr1_1327586_C_T_b38 | SAMD11 | -2.813 | 0.00575 | -0.11811 | 4 | 0.041987 | no | SLVRYG |
chr1_1410616_G_T_b38 | SAMD11 | 2.748 | 0.00695 | 0.113296 | 8 | 0.041236 | no | SLVRYG |
chr1_1412488_C_CAG_b38 | SAMD11 | 2.748 | 0.00695 | 0.113296 | 8 | 0.041236 | no | SLVRYG |
chr1_1415976_G_A_b38 | SAMD11 | 2.748 | 0.00695 | 0.113296 | 8 | 0.041236 | no | SLVRYG |
chr1_1258206_AT_A_b38 | SAMD11 | 2.701 | 0.00794 | 0.094824 | 15 | 0.035111 | no | SLVRYG |
chr1_1359138_C_T_b38 | SAMD11 | -2.697 | 0.00803 | -0.118096 | 12 | 0.043793 | no | SLVRYG |
chr1_911163_G_T_b38 | SAMD11 | 3.337 | 0.000896 | 0.102475 | 6 | 0.030707 | yes | MSCLSK |
chr1_667662_G_C_b38 | SAMD11 | 3.006 | 0.00275 | 0.13678 | 3 | 0.045508 | yes | MSCLSK |
chr1_1169204_T_C_b38 | SAMD11 | -2.67 | 0.00777 | -0.075399 | 3 | 0.028234 | yes | MSCLSK |
chr1_12807_C_T_b38 | SAMD11 | 2.597 | 0.00961 | 0.03816 | 37 | 0.014691 | yes | MSCLSK |
chr1_1684789_C_CAAAA_b38 | SAMD11 | 3.489 | 0.000519 | 0.079952 | 16 | 0.022917 | no | MSCLSK |
chr1_1461682_A_G_b38 | SAMD11 | 3.42 | 0.000666 | 0.124868 | 3 | 0.036508 | no | MSCLSK |
chr1_925408_TTGG_T_b38 | SAMD11 | -3.356 | 0.000837 | -0.086802 | 30 | 0.025861 | no | MSCLSK |
chr1_925398_A_G_b38 | SAMD11 | -3.259 | 0.00118 | -0.083634 | 30 | 0.025664 | no | MSCLSK |
chr1_1650744_T_C_b38 | SAMD11 | 3.253 | 0.0012 | 0.070942 | 3 | 0.021807 | no | MSCLSK |
chr1_591626_T_C_b38 | SAMD11 | -3.221 | 0.00134 | -0.065285 | 9 | 0.020271 | no | MSCLSK |
chr1_925412_CGCCTGCG_C_b38 | SAMD11 | -3.144 | 0.00174 | -0.079327 | 31 | 0.025229 | no | MSCLSK |
chr1_729089_G_C_b38 | SAMD11 | 3.025 | 0.00259 | 0.102663 | 11 | 0.033938 | no | MSCLSK |
chr1_927758_A_C_b38 | SAMD11 | 2.868 | 0.00426 | 0.113681 | 3 | 0.039632 | no | MSCLSK |
chr1_783406_A_AT_b38 | SAMD11 | 2.843 | 0.00461 | 0.05969 | 4 | 0.020994 | no | MSCLSK |
chr1_598934_CGG_C_b38 | SAMD11 | -2.736 | 0.00639 | -0.046926 | 9 | 0.017151 | no | MSCLSK |
chr1_832736_A_AGTTTTGTTTT_b38 | SAMD11 | 2.712 | 0.00688 | 0.046333 | 17 | 0.017087 | no | MSCLSK |
chr1_964639_C_T_b38 | SAMD11 | 2.682 | 0.00752 | 0.10848 | 5 | 0.040453 | no | MSCLSK |
chr1_1102071_C_CAAAA_b38 | SAMD11 | -2.614 | 0.00916 | -0.079957 | 4 | 0.030588 | no | MSCLSK |
chr1_916657_G_A_b38 | SAMD11 | 5.608 | 3.54e-08 | 0.108131 | 129 | 0.019283 | yes | NERVET |
chr1_916683_G_A_b38 | SAMD11 | 5.607 | 3.56e-08 | 0.10837 | 128 | 0.019329 | yes | NERVET |
chr1_914838_T_A_b38 | SAMD11 | 5.324 | 1.59e-07 | 0.103357 | 127 | 0.019412 | yes | NERVET |
chr1_929558_G_A_b38 | SAMD11 | 5.16 | 3.67e-07 | 0.110633 | 64 | 0.021439 | yes | NERVET |
chr1_909894_G_T_b38 | SAMD11 | -4.846 | 1.73e-06 | -0.107708 | 39 | 0.022227 | yes | NERVET |
chr1_897538_T_C_b38 | SAMD11 | -4.8 | 2.15e-06 | -0.098004 | 56 | 0.020417 | yes | NERVET |
chr1_897792_T_TCGAA_b38 | SAMD11 | -4.791 | 2.25e-06 | -0.097994 | 54 | 0.020456 | yes | NERVET |
chr1_896680_G_A_b38 | SAMD11 | 4.791 | 2.25e-06 | 0.097994 | 54 | 0.020456 | yes | NERVET |
chr1_896686_G_C_b38 | SAMD11 | 4.791 | 2.25e-06 | 0.097994 | 54 | 0.020456 | yes | NERVET |
chr1_896732_T_C_b38 | SAMD11 | 4.791 | 2.25e-06 | 0.097994 | 54 | 0.020456 | yes | NERVET |
chr1_896917_CTG_C_b38 | SAMD11 | 4.791 | 2.25e-06 | 0.097994 | 54 | 0.020456 | yes | NERVET |
chr1_896938_C_A_b38 | SAMD11 | 4.791 | 2.25e-06 | 0.097994 | 54 | 0.020456 | yes | NERVET |
chr1_915400_C_T_b38 | SAMD11 | 4.78 | 2.37e-06 | 0.091512 | 92 | 0.019147 | yes | NERVET |
chr1_914743_C_T_b38 | SAMD11 | -4.709 | 3.3e-06 | -0.109678 | 19 | 0.023292 | yes | NERVET |
chr1_896798_A_G_b38 | SAMD11 | 4.674 | 3.89e-06 | 0.095935 | 54 | 0.020527 | yes | NERVET |
chr1_896529_C_T_b38 | SAMD11 | 4.648 | 4.37e-06 | 0.094607 | 57 | 0.020352 | yes | NERVET |
chr1_926250_G_A_b38 | SAMD11 | 4.607 | 5.29e-06 | 0.102013 | 55 | 0.022142 | yes | NERVET |
chr1_935954_G_T_b38 | SAMD11 | 4.574 | 6.17e-06 | 0.09074 | 82 | 0.019839 | yes | NERVET |
chr1_920719_T_G_b38 | SAMD11 | -4.569 | 6.3e-06 | -0.087564 | 71 | 0.019165 | yes | NERVET |
chr1_920728_A_G_b38 | SAMD11 | -4.569 | 6.3e-06 | -0.087564 | 71 | 0.019165 | yes | NERVET |
chr1_890030_G_A_b38 | SAMD11 | 4.551 | 6.84e-06 | 0.089674 | 71 | 0.019705 | yes | NERVET |
chr1_903175_C_A_b38 | SAMD11 | -4.541 | 7.17e-06 | -0.09883 | 32 | 0.021766 | yes | NERVET |
chr1_933548_A_AG_b38 | SAMD11 | 4.534 | 7.4e-06 | 0.087778 | 87 | 0.019361 | yes | NERVET |
chr1_925036_G_A_b38 | SAMD11 | 4.526 | 7.65e-06 | 0.09983 | 54 | 0.022055 | yes | NERVET |
chr1_912710_G_A_b38 | SAMD11 | -4.51 | 8.23e-06 | -0.104644 | 19 | 0.023202 | yes | NERVET |
chr1_913358_C_T_b38 | SAMD11 | -4.51 | 8.23e-06 | -0.104644 | 19 | 0.023202 | yes | NERVET |
chr1_938178_G_T_b38 | SAMD11 | 4.48 | 9.44e-06 | 0.090462 | 80 | 0.020194 | yes | NERVET |
chr1_901516_T_C_b38 | SAMD11 | -4.467 | 1e-05 | -0.092039 | 55 | 0.020606 | yes | NERVET |
chr1_910255_C_T_b38 | SAMD11 | -4.463 | 1.02e-05 | -0.106839 | 17 | 0.023941 | yes | NERVET |
chr1_925308_G_A_b38 | SAMD11 | 4.459 | 1.04e-05 | 0.09683 | 58 | 0.021716 | yes | NERVET |
chr1_914682_A_T_b38 | SAMD11 | -4.447 | 1.09e-05 | -0.100141 | 24 | 0.02252 | yes | NERVET |
chr1_913274_TG_T_b38 | SAMD11 | -4.443 | 1.11e-05 | -0.106886 | 16 | 0.024057 | yes | NERVET |
chr1_910698_C_T_b38 | SAMD11 | -4.428 | 1.19e-05 | -0.106279 | 16 | 0.024001 | yes | NERVET |
chr1_912111_G_A_b38 | SAMD11 | -4.426 | 1.2e-05 | -0.099884 | 24 | 0.022566 | yes | NERVET |
chr1_897376_T_G_b38 | SAMD11 | -4.417 | 1.25e-05 | -0.092278 | 49 | 0.020894 | yes | NERVET |
chr1_919397_A_G_b38 | SAMD11 | 4.408 | 1.3e-05 | 0.085234 | 69 | 0.019338 | yes | NERVET |
chr1_915810_G_A_b38 | SAMD11 | -4.402 | 1.33e-05 | -0.098879 | 24 | 0.022462 | yes | NERVET |
chr1_919598_A_C_b38 | SAMD11 | 4.396 | 1.37e-05 | 0.084074 | 99 | 0.019125 | yes | NERVET |
chr1_906677_A_AAACTCAGCTGCCTCTCCCCTTC_b38 | SAMD11 | -4.388 | 1.42e-05 | -0.091276 | 53 | 0.020803 | yes | NERVET |
chr1_966227_C_G_b38 | SAMD11 | 4.384 | 1.44e-05 | 0.154795 | 10 | 0.035309 | yes | NERVET |
chr1_903723_A_G_b38 | SAMD11 | -4.363 | 1.58e-05 | -0.09019 | 47 | 0.020671 | yes | NERVET |
chr1_900119_A_G_b38 | SAMD11 | -4.361 | 1.6e-05 | -0.092905 | 40 | 0.021303 | yes | NERVET |
chr1_911848_C_T_b38 | SAMD11 | -4.357 | 1.62e-05 | -0.101266 | 20 | 0.023241 | yes | NERVET |
chr1_931513_T_C_b38 | SAMD11 | 4.356 | 1.63e-05 | 0.084403 | 127 | 0.019376 | yes | NERVET |
chr1_897018_T_C_b38 | SAMD11 | 4.344 | 1.72e-05 | 0.096647 | 30 | 0.022246 | yes | NERVET |
chr1_919695_C_G_b38 | SAMD11 | 4.341 | 1.75e-05 | 0.082998 | 72 | 0.019121 | yes | NERVET |
chr1_903007_T_C_b38 | SAMD11 | -4.332 | 1.82e-05 | -0.100813 | 21 | 0.023273 | yes | NERVET |
chr1_910558_G_A_b38 | SAMD11 | -4.33 | 1.83e-05 | -0.09538 | 39 | 0.022028 | yes | NERVET |
chr1_913076_A_G_b38 | SAMD11 | -4.323 | 1.89e-05 | -0.098038 | 23 | 0.022678 | yes | NERVET |
chr1_897843_C_T_b38 | SAMD11 | -4.277 | 2.3e-05 | -0.09046 | 43 | 0.021149 | yes | NERVET |
chr1_897922_C_T_b38 | SAMD11 | -4.277 | 2.3e-05 | -0.09046 | 43 | 0.021149 | yes | NERVET |
chr1_899452_G_C_b38 | SAMD11 | -4.247 | 2.62e-05 | -0.090183 | 42 | 0.021236 | yes | NERVET |
chr1_913065_G_A_b38 | SAMD11 | -4.239 | 2.71e-05 | -0.096194 | 23 | 0.022692 | yes | NERVET |
chr1_904478_CGCCTCCTCCGAACGCGGCCGCCTCCTCCTCCGAACGTGGCCTCCTCCGAACGCGGCCGCCTCCTCCTCCGAACGCGGCCGCCTCCTCCTCCGAACGTG_C_b38 | SAMD11 | -4.227 | 2.85e-05 | -0.098902 | 20 | 0.023397 | yes | NERVET |
chr1_898444_T_C_b38 | SAMD11 | -4.224 | 2.89e-05 | -0.089266 | 43 | 0.021132 | yes | NERVET |
chr1_923311_TG_T_b38 | SAMD11 | 4.198 | 3.23e-05 | 0.092973 | 51 | 0.022145 | yes | NERVET |
chr1_896109_C_T_b38 | SAMD11 | 4.19 | 3.34e-05 | 0.088455 | 56 | 0.02111 | yes | NERVET |
chr1_918574_C_A_b38 | SAMD11 | 4.162 | 3.76e-05 | 0.080269 | 97 | 0.019285 | yes | NERVET |
chr1_917495_C_T_b38 | SAMD11 | 4.159 | 3.81e-05 | 0.080111 | 98 | 0.019261 | yes | NERVET |
chr1_914991_G_T_b38 | SAMD11 | 4.159 | 3.81e-05 | 0.080065 | 93 | 0.019251 | yes | NERVET |
chr1_921056_TG_T_b38 | SAMD11 | -4.156 | 3.87e-05 | -0.1016 | 15 | 0.024449 | yes | NERVET |
chr1_927486_C_T_b38 | SAMD11 | 4.141 | 4.12e-05 | 0.092642 | 57 | 0.022374 | yes | NERVET |
chr1_917284_C_T_b38 | SAMD11 | -4.136 | 4.2e-05 | -0.096957 | 19 | 0.023443 | yes | NERVET |
chr1_911018_G_A_b38 | SAMD11 | -4.112 | 4.65e-05 | -0.092012 | 33 | 0.022379 | yes | NERVET |
chr1_914483_G_GACTGCCCAGCTC_b38 | SAMD11 | -4.083 | 5.25e-05 | -0.094659 | 22 | 0.023186 | yes | NERVET |
chr1_898261_T_C_b38 | SAMD11 | -4.062 | 5.71e-05 | -0.085269 | 45 | 0.02099 | yes | NERVET |
chr1_898547_T_C_b38 | SAMD11 | -4.043 | 6.17e-05 | -0.092381 | 22 | 0.022847 | yes | NERVET |
chr1_923421_A_G_b38 | SAMD11 | 4.021 | 6.77e-05 | 0.088946 | 52 | 0.02212 | yes | NERVET |
chr1_905705_C_G_b38 | SAMD11 | -4.02 | 6.79e-05 | -0.087032 | 33 | 0.021649 | yes | NERVET |
chr1_898279_T_A_b38 | SAMD11 | -4.007 | 7.17e-05 | -0.08439 | 44 | 0.021061 | yes | NERVET |
chr1_898283_A_G_b38 | SAMD11 | -4.007 | 7.17e-05 | -0.08439 | 44 | 0.021061 | yes | NERVET |
chr1_911484_G_C_b38 | SAMD11 | -3.998 | 7.44e-05 | -0.08996 | 25 | 0.022501 | yes | NERVET |
chr1_921096_A_G_b38 | SAMD11 | -3.997 | 7.45e-05 | -0.078752 | 86 | 0.019701 | yes | NERVET |
chr1_917859_A_G_b38 | SAMD11 | -3.98 | 8.01e-05 | -0.095765 | 17 | 0.024062 | yes | NERVET |
chr1_917378_G_C_b38 | SAMD11 | -3.977 | 8.11e-05 | -0.096344 | 16 | 0.024226 | yes | NERVET |
chr1_897580_AT_A_b38 | SAMD11 | -3.964 | 8.53e-05 | -0.076888 | 130 | 0.019396 | yes | NERVET |
chr1_960891_C_T_b38 | SAMD11 | 3.961 | 8.63e-05 | 0.078308 | 119 | 0.019768 | yes | NERVET |
chr1_892786_A_G_b38 | SAMD11 | -3.946 | 9.19e-05 | -0.084216 | 42 | 0.021342 | yes | NERVET |
chr1_939779_AGCCAGTGGACGCCGACCT_A_b38 | SAMD11 | 3.922 | 0.000101 | 0.076348 | 102 | 0.019465 | yes | NERVET |
chr1_931558_G_A_b38 | SAMD11 | -3.898 | 0.000111 | -0.089779 | 22 | 0.02303 | yes | NERVET |
chr1_915824_G_C_b38 | SAMD11 | -3.872 | 0.000124 | -0.085713 | 31 | 0.022137 | yes | NERVET |
chr1_911428_C_T_b38 | SAMD11 | -3.863 | 0.000128 | -0.086779 | 27 | 0.022466 | yes | NERVET |
chr1_901149_C_G_b38 | SAMD11 | -3.86 | 0.00013 | -0.092101 | 19 | 0.023864 | yes | NERVET |
chr1_901544_G_A_b38 | SAMD11 | -3.86 | 0.00013 | -0.092101 | 19 | 0.023864 | yes | NERVET |
chr1_899548_A_G_b38 | SAMD11 | -3.832 | 0.000145 | -0.088022 | 21 | 0.022971 | yes | NERVET |
chr1_907236_TA_T_b38 | SAMD11 | -3.82 | 0.000152 | -0.083087 | 48 | 0.021751 | yes | NERVET |
chr1_898818_T_C_b38 | SAMD11 | -3.808 | 0.000159 | -0.089374 | 20 | 0.023471 | yes | NERVET |
chr1_967384_C_G_b38 | SAMD11 | 3.803 | 0.000162 | 0.078025 | 107 | 0.020515 | yes | NERVET |
chr1_902949_G_GC_b38 | SAMD11 | -3.799 | 0.000164 | -0.090444 | 19 | 0.023805 | yes | NERVET |
chr1_918870_A_G_b38 | SAMD11 | -3.792 | 0.000169 | -0.086094 | 25 | 0.022702 | yes | NERVET |
chr1_899619_G_A_b38 | SAMD11 | -3.769 | 0.000185 | -0.086974 | 20 | 0.023076 | yes | NERVET |
chr1_933741_T_TG_b38 | SAMD11 | 3.728 | 0.000217 | 0.075829 | 61 | 0.020343 | yes | NERVET |
chr1_961945_G_C_b38 | SAMD11 | 3.708 | 0.000234 | 0.129992 | 8 | 0.035057 | yes | NERVET |
chr1_965337_CTTAT_C_b38 | SAMD11 | 3.704 | 0.000238 | 0.075812 | 114 | 0.020469 | yes | NERVET |
chr1_962184_T_C_b38 | SAMD11 | 3.673 | 0.000268 | 0.13385 | 6 | 0.036441 | yes | NERVET |
chr1_931131_C_CCCCT_b38 | SAMD11 | 3.634 | 0.000311 | 0.101202 | 60 | 0.027851 | yes | NERVET |
chr1_946247_G_A_b38 | SAMD11 | 3.477 | 0.000556 | 0.071929 | 103 | 0.020689 | yes | NERVET |
chr1_894801_A_G_b38 | SAMD11 | 3.476 | 0.000557 | 0.070534 | 52 | 0.020292 | yes | NERVET |
chr1_954258_G_C_b38 | SAMD11 | 3.469 | 0.000571 | 0.130221 | 4 | 0.037536 | yes | NERVET |
chr1_935265_T_C_b38 | SAMD11 | -3.46 | 0.000591 | -0.073131 | 43 | 0.021137 | yes | NERVET |
chr1_962358_C_T_b38 | SAMD11 | -3.431 | 0.000655 | -0.124804 | 6 | 0.036374 | yes | NERVET |
chr1_942335_C_G_b38 | SAMD11 | 3.431 | 0.000655 | 0.122794 | 6 | 0.035789 | yes | NERVET |
chr1_954333_C_A_b38 | SAMD11 | 3.421 | 0.000681 | 0.127952 | 4 | 0.037407 | yes | NERVET |
chr1_936972_G_C_b38 | SAMD11 | -3.419 | 0.000684 | -0.070385 | 50 | 0.020584 | yes | NERVET |
chr1_958251_A_G_b38 | SAMD11 | 3.385 | 0.000774 | 0.124597 | 5 | 0.036814 | yes | NERVET |
chr1_922671_C_T_b38 | SAMD11 | -3.378 | 0.000792 | -0.08379 | 13 | 0.024804 | yes | NERVET |
chr1_906633_T_G_b38 | SAMD11 | -3.373 | 0.000806 | -0.079436 | 20 | 0.023551 | yes | NERVET |
chr1_949171_GAGAA_G_b38 | SAMD11 | 3.371 | 0.000812 | 0.067954 | 101 | 0.020158 | yes | NERVET |
chr1_922660_C_A_b38 | SAMD11 | -3.353 | 0.000865 | -0.084124 | 12 | 0.02509 | yes | NERVET |
chr1_929839_G_A_b38 | SAMD11 | -3.304 | 0.00103 | -0.081029 | 16 | 0.024526 | yes | NERVET |
chr1_955679_C_T_b38 | SAMD11 | 3.282 | 0.00111 | 0.066827 | 99 | 0.020363 | yes | NERVET |
chr1_956565_A_G_b38 | SAMD11 | 3.282 | 0.00111 | 0.066827 | 99 | 0.020363 | yes | NERVET |
chr1_928622_G_C_b38 | SAMD11 | -3.274 | 0.00114 | -0.080721 | 15 | 0.024656 | yes | NERVET |
chr1_1274972_A_G_b38 | SAMD11 | -3.214 | 0.0014 | -0.09061 | 34 | 0.028191 | yes | NERVET |
chr1_1275091_T_C_b38 | SAMD11 | -3.212 | 0.00141 | -0.090268 | 35 | 0.028105 | yes | NERVET |
chr1_932255_C_T_b38 | SAMD11 | -3.156 | 0.00171 | -0.077474 | 16 | 0.02455 | yes | NERVET |
chr1_1366906_T_G_b38 | SAMD11 | -3.127 | 0.00188 | -0.164463 | 4 | 0.052601 | yes | NERVET |
chr1_904947_G_A_b38 | SAMD11 | -3.117 | 0.00194 | -0.077773 | 16 | 0.024951 | yes | NERVET |
chr1_1278407_T_TA_b38 | SAMD11 | -3.072 | 0.00225 | -0.086035 | 34 | 0.028009 | yes | NERVET |
chr1_906982_C_T_b38 | SAMD11 | -3.07 | 0.00227 | -0.070068 | 23 | 0.022823 | yes | NERVET |
chr1_1277844_T_A_b38 | SAMD11 | -3.069 | 0.00228 | -0.086551 | 34 | 0.028206 | yes | NERVET |
chr1_1282558_C_CCA_b38 | SAMD11 | -3.061 | 0.00234 | -0.080309 | 33 | 0.026239 | yes | NERVET |
chr1_1274980_C_T_b38 | SAMD11 | -3.055 | 0.00238 | -0.091062 | 24 | 0.029807 | yes | NERVET |
chr1_1275912_C_T_b38 | SAMD11 | -3.055 | 0.00238 | -0.091062 | 24 | 0.029807 | yes | NERVET |
chr1_1274256_A_G_b38 | SAMD11 | -3.05 | 0.00242 | -0.090553 | 25 | 0.029685 | yes | NERVET |
chr1_950296_C_A_b38 | SAMD11 | 3.032 | 0.00256 | 0.11785 | 3 | 0.038866 | yes | NERVET |
chr1_952180_A_C_b38 | SAMD11 | 3.032 | 0.00256 | 0.11785 | 3 | 0.038866 | yes | NERVET |
chr1_1277269_T_C_b38 | SAMD11 | -3.013 | 0.00273 | -0.085092 | 33 | 0.028243 | yes | NERVET |
chr1_905373_T_C_b38 | SAMD11 | -3.008 | 0.00278 | -0.058143 | 89 | 0.019331 | yes | NERVET |
chr1_908025_A_G_b38 | SAMD11 | 2.995 | 0.00289 | 0.056951 | 75 | 0.019015 | yes | NERVET |
chr1_958339_G_A_b38 | SAMD11 | 2.963 | 0.0032 | 0.101538 | 8 | 0.034264 | yes | NERVET |
chr1_907538_T_TA_b38 | SAMD11 | -2.962 | 0.00321 | -0.060972 | 48 | 0.020584 | yes | NERVET |
chr1_1476266_T_C_b38 | SAMD11 | -2.942 | 0.00343 | -0.087234 | 42 | 0.029651 | yes | NERVET |
chr1_966179_G_A_b38 | SAMD11 | 2.939 | 0.00346 | 0.089991 | 30 | 0.030622 | yes | NERVET |
chr1_1282706_C_T_b38 | SAMD11 | -2.92 | 0.00367 | -0.081729 | 35 | 0.027985 | yes | NERVET |
chr1_949046_A_AACAGCAAAG_b38 | SAMD11 | 2.914 | 0.00374 | 0.10849 | 5 | 0.037227 | yes | NERVET |
chr1_1002415_CT_C_b38 | SAMD11 | -2.903 | 0.00388 | -0.064401 | 40 | 0.022186 | yes | NERVET |
chr1_967865_A_G_b38 | SAMD11 | 2.879 | 0.00417 | 0.055282 | 149 | 0.019199 | yes | NERVET |
chr1_1279728_TG_T_b38 | SAMD11 | -2.869 | 0.00431 | -0.085282 | 24 | 0.02973 | yes | NERVET |
chr1_284929_A_G_b38 | SAMD11 | -2.85 | 0.00457 | -0.11207 | 7 | 0.039325 | yes | NERVET |
chr1_1279694_A_G_b38 | SAMD11 | -2.846 | 0.00463 | -0.085064 | 23 | 0.029891 | yes | NERVET |
chr1_1703583_A_G_b38 | SAMD11 | -2.827 | 0.0049 | -0.095559 | 36 | 0.033801 | yes | NERVET |
chr1_1279698_A_G_b38 | SAMD11 | -2.81 | 0.00517 | -0.083791 | 23 | 0.029821 | yes | NERVET |
chr1_1716710_G_T_b38 | SAMD11 | -2.797 | 0.00537 | -0.196541 | 3 | 0.070269 | yes | NERVET |
chr1_1002417_T_A_b38 | SAMD11 | -2.786 | 0.00555 | -0.067872 | 28 | 0.024358 | yes | NERVET |
chr1_697250_A_G_b38 | SAMD11 | -2.773 | 0.00577 | -0.102231 | 10 | 0.036862 | yes | NERVET |
chr1_1582556_T_C_b38 | SAMD11 | 2.752 | 0.00616 | 0.076171 | 14 | 0.027678 | yes | NERVET |
chr1_959193_G_A_b38 | SAMD11 | 2.744 | 0.00631 | 0.085476 | 35 | 0.03115 | yes | NERVET |
chr1_1273803_G_GCGC_b38 | SAMD11 | -2.683 | 0.00755 | -0.099475 | 9 | 0.037071 | yes | NERVET |
chr1_1276547_C_T_b38 | SAMD11 | -2.663 | 0.00801 | -0.09892 | 9 | 0.037142 | yes | NERVET |
chr1_1276564_C_T_b38 | SAMD11 | -2.663 | 0.00801 | -0.09892 | 9 | 0.037142 | yes | NERVET |
chr1_1496953_T_C_b38 | SAMD11 | -2.662 | 0.00803 | -0.080778 | 40 | 0.030342 | yes | NERVET |
chr1_1519934_T_G_b38 | SAMD11 | -2.644 | 0.00846 | -0.057333 | 89 | 0.021681 | yes | NERVET |
chr1_1519938_T_C_b38 | SAMD11 | -2.644 | 0.00846 | -0.057333 | 89 | 0.021681 | yes | NERVET |
chr1_1517993_A_G_b38 | SAMD11 | -2.64 | 0.00858 | -0.057228 | 89 | 0.021681 | yes | NERVET |
chr1_893503_G_A_b38 | SAMD11 | 2.628 | 0.00888 | 0.088053 | 4 | 0.033507 | yes | NERVET |
chr1_1426175_T_C_b38 | SAMD11 | -2.627 | 0.00889 | -0.091784 | 14 | 0.034933 | yes | NERVET |
chr1_950669_ACAG_A_b38 | SAMD11 | 2.625 | 0.00895 | 0.092165 | 8 | 0.035111 | yes | NERVET |
chr1_1482624_T_C_b38 | SAMD11 | -2.615 | 0.00921 | -0.078537 | 41 | 0.03003 | yes | NERVET |
chr1_940390_A_G_b38 | SAMD11 | 3.111 | 0.00198 | 0.060967 | 132 | 0.019597 | no | NERVET |
chr1_1524664_A_G_b38 | SAMD11 | -2.92 | 0.00368 | -0.073751 | 53 | 0.025261 | no | NERVET |
chr1_1217168_G_A_b38 | SAMD11 | -2.907 | 0.00383 | -0.20244 | 3 | 0.069648 | no | NERVET |
chr1_925628_G_C_b38 | SAMD11 | 2.885 | 0.0041 | 0.110393 | 23 | 0.03827 | no | NERVET |
chr1_1490027_A_G_b38 | SAMD11 | -2.882 | 0.00414 | -0.086318 | 34 | 0.029952 | no | NERVET |
chr1_1490032_A_G_b38 | SAMD11 | -2.882 | 0.00414 | -0.086318 | 34 | 0.029952 | no | NERVET |
chr1_1814815_A_AAAAAAG_b38 | SAMD11 | -2.857 | 0.00446 | -0.085116 | 17 | 0.029788 | no | NERVET |
chr1_932613_GTTTC_G_b38 | SAMD11 | 2.845 | 0.00463 | 0.133185 | 17 | 0.046807 | no | NERVET |
chr1_973983_A_C_b38 | SAMD11 | -2.835 | 0.00478 | -0.16053 | 4 | 0.056625 | no | NERVET |
chr1_925081_G_A_b38 | SAMD11 | 2.815 | 0.00508 | 0.109658 | 23 | 0.038953 | no | NERVET |
chr1_925141_C_A_b38 | SAMD11 | 2.815 | 0.00508 | 0.109658 | 23 | 0.038953 | no | NERVET |
chr1_1265603_TTG_T_b38 | SAMD11 | 2.792 | 0.00545 | 0.084562 | 10 | 0.030285 | no | NERVET |
chr1_1290579_C_G_b38 | SAMD11 | -2.737 | 0.00645 | -0.070317 | 39 | 0.025694 | no | NERVET |
chr1_967376_AC_A_b38 | SAMD11 | 2.734 | 0.0065 | 0.085846 | 7 | 0.031402 | no | NERVET |
chr1_919049_G_A_b38 | SAMD11 | -2.673 | 0.00779 | -0.125987 | 5 | 0.047137 | no | NERVET |
chr1_927003_C_T_b38 | SAMD11 | 2.657 | 0.00816 | 0.104345 | 24 | 0.039273 | no | NERVET |
chr1_1212042_C_T_b38 | SAMD11 | -2.65 | 0.00833 | -0.060932 | 28 | 0.022996 | no | NERVET |
chr1_974175_A_G_b38 | SAMD11 | 2.639 | 0.00859 | 0.120955 | 3 | 0.045827 | no | NERVET |
chr1_927744_G_T_b38 | SAMD11 | 2.636 | 0.00867 | 0.104381 | 24 | 0.039596 | no | NERVET |
chr1_1725582_T_C_b38 | SAMD11 | 2.63 | 0.00883 | 0.04586 | 121 | 0.017439 | no | NERVET |
chr1_10146_AC_A_b38 | SAMD11 | 2.628 | 0.00888 | 0.057919 | 44 | 0.02204 | no | NERVET |
chr1_1366776_G_GAATT_b38 | SAMD11 | -2.599 | 0.00964 | -0.072218 | 14 | 0.027782 | no | NERVET |
chr1_918425_C_T_b38 | SAMD11 | -2.598 | 0.00967 | -0.122366 | 5 | 0.047098 | no | NERVET |
chr1_910958_A_G_b38 | SAMD11 | 3.195 | 0.00176 | 0.189369 | 13 | 0.059262 | yes | OVARY |
chr1_911109_T_C_b38 | SAMD11 | 3.195 | 0.00176 | 0.189369 | 13 | 0.059262 | yes | OVARY |
chr1_1624086_G_A_b38 | SAMD11 | 3.168 | 0.00193 | 0.174533 | 22 | 0.055099 | yes | OVARY |
chr1_914618_A_G_b38 | SAMD11 | 3.119 | 0.00225 | 0.21995 | 4 | 0.070519 | yes | OVARY |
chr1_1613330_A_AT_b38 | SAMD11 | 2.961 | 0.00366 | 0.167967 | 14 | 0.056723 | yes | OVARY |
chr1_916657_G_A_b38 | SAMD11 | 2.958 | 0.00369 | 0.172996 | 42 | 0.058477 | yes | OVARY |
chr1_916683_G_A_b38 | SAMD11 | 2.958 | 0.00369 | 0.172996 | 42 | 0.058477 | yes | OVARY |
chr1_914838_T_A_b38 | SAMD11 | 2.906 | 0.00431 | 0.169612 | 41 | 0.058357 | yes | OVARY |
chr1_920719_T_G_b38 | SAMD11 | -2.893 | 0.0045 | -0.164204 | 21 | 0.056766 | yes | OVARY |
chr1_920728_A_G_b38 | SAMD11 | -2.893 | 0.0045 | -0.164204 | 21 | 0.056766 | yes | OVARY |
chr1_911220_CT_C_b38 | SAMD11 | 2.884 | 0.00462 | 0.188243 | 7 | 0.06528 | yes | OVARY |
chr1_916119_A_G_b38 | SAMD11 | 2.876 | 0.00473 | 0.202447 | 4 | 0.070401 | yes | OVARY |
chr1_920661_G_A_b38 | SAMD11 | -2.876 | 0.00473 | -0.202447 | 4 | 0.070401 | yes | OVARY |
chr1_919397_A_G_b38 | SAMD11 | 2.866 | 0.00487 | 0.160582 | 21 | 0.05603 | yes | OVARY |
chr1_919695_C_G_b38 | SAMD11 | 2.866 | 0.00487 | 0.160582 | 21 | 0.05603 | yes | OVARY |
chr1_920949_C_G_b38 | SAMD11 | -2.845 | 0.00518 | -0.195657 | 5 | 0.068776 | yes | OVARY |
chr1_915400_C_T_b38 | SAMD11 | 2.833 | 0.00536 | 0.161203 | 28 | 0.056893 | yes | OVARY |
chr1_909903_G_T_b38 | SAMD11 | 2.823 | 0.00553 | 0.179366 | 8 | 0.06354 | yes | OVARY |
chr1_949171_GAGAA_G_b38 | SAMD11 | 2.811 | 0.00572 | 0.164698 | 30 | 0.058583 | yes | OVARY |
chr1_955679_C_T_b38 | SAMD11 | 2.79 | 0.00608 | 0.161355 | 30 | 0.057828 | yes | OVARY |
chr1_956565_A_G_b38 | SAMD11 | 2.79 | 0.00608 | 0.161355 | 30 | 0.057828 | yes | OVARY |
chr1_917495_C_T_b38 | SAMD11 | 2.78 | 0.00627 | 0.15687 | 29 | 0.056434 | yes | OVARY |
chr1_918574_C_A_b38 | SAMD11 | 2.78 | 0.00627 | 0.15687 | 29 | 0.056434 | yes | OVARY |
chr1_940390_A_G_b38 | SAMD11 | 2.769 | 0.00647 | 0.15677 | 43 | 0.056625 | yes | OVARY |
chr1_1280332_C_T_b38 | SAMD11 | -2.728 | 0.00728 | -0.269738 | 3 | 0.098888 | yes | OVARY |
chr1_1625951_G_A_b38 | SAMD11 | 2.723 | 0.00737 | 0.14643 | 21 | 0.053771 | yes | OVARY |
chr1_1182832_T_C_b38 | SAMD11 | -2.7 | 0.00787 | -0.162066 | 26 | 0.060013 | yes | OVARY |
chr1_946247_G_A_b38 | SAMD11 | 2.685 | 0.00822 | 0.1594 | 33 | 0.059362 | yes | OVARY |
chr1_1591703_T_C_b38 | SAMD11 | -3.473 | 0.000703 | -0.165798 | 47 | 0.047733 | no | OVARY |
chr1_1624323_AT_A_b38 | SAMD11 | -3.279 | 0.00134 | -0.177887 | 20 | 0.054252 | no | OVARY |
chr1_1010481_ATTAT_A_b38 | SAMD11 | 3.142 | 0.00209 | 0.320093 | 3 | 0.101873 | no | OVARY |
chr1_1011654_G_A_b38 | SAMD11 | 3.142 | 0.00209 | 0.320093 | 3 | 0.101873 | no | OVARY |
chr1_919598_A_C_b38 | SAMD11 | 3.05 | 0.00279 | 0.171524 | 29 | 0.056239 | no | OVARY |
chr1_1627515_C_T_b38 | SAMD11 | -3.034 | 0.00293 | -0.161058 | 27 | 0.05308 | no | OVARY |
chr1_1312208_G_T_b38 | SAMD11 | -2.988 | 0.00337 | -0.305863 | 4 | 0.102366 | no | OVARY |
chr1_1010232_C_T_b38 | SAMD11 | 2.942 | 0.00388 | 0.292885 | 3 | 0.099569 | no | OVARY |
chr1_1822300_CT_C_b38 | SAMD11 | -2.896 | 0.00445 | -0.167993 | 36 | 0.058005 | no | OVARY |
chr1_1729998_T_TGGGA_b38 | SAMD11 | -2.896 | 0.00446 | -0.180282 | 13 | 0.062262 | no | OVARY |
chr1_1734132_T_G_b38 | SAMD11 | -2.859 | 0.00496 | -0.2803 | 5 | 0.098026 | no | OVARY |
chr1_914991_G_T_b38 | SAMD11 | 2.852 | 0.00508 | 0.160346 | 26 | 0.056227 | no | OVARY |
chr1_1009731_C_T_b38 | SAMD11 | 2.809 | 0.00575 | 0.284303 | 3 | 0.101208 | no | OVARY |
chr1_1729287_T_C_b38 | SAMD11 | -2.798 | 0.00595 | -0.174028 | 12 | 0.062205 | no | OVARY |
chr1_1690741_T_A_b38 | SAMD11 | 2.742 | 0.007 | 0.153278 | 19 | 0.055909 | no | OVARY |
chr1_1274256_A_G_b38 | SAMD11 | -2.738 | 0.00707 | -0.241964 | 9 | 0.088371 | no | OVARY |
chr1_1274980_C_T_b38 | SAMD11 | -2.738 | 0.00707 | -0.241964 | 9 | 0.088371 | no | OVARY |
chr1_1275912_C_T_b38 | SAMD11 | -2.738 | 0.00707 | -0.241964 | 9 | 0.088371 | no | OVARY |
chr1_1279694_A_G_b38 | SAMD11 | -2.738 | 0.00707 | -0.241964 | 9 | 0.088371 | no | OVARY |
chr1_1279698_A_G_b38 | SAMD11 | -2.738 | 0.00707 | -0.241964 | 9 | 0.088371 | no | OVARY |
chr1_1279728_TG_T_b38 | SAMD11 | -2.738 | 0.00707 | -0.241964 | 9 | 0.088371 | no | OVARY |
chr1_1013312_G_A_b38 | SAMD11 | 2.734 | 0.00715 | 0.265949 | 3 | 0.097276 | no | OVARY |
chr1_1714635_A_G_b38 | SAMD11 | -2.731 | 0.00721 | -0.238 | 5 | 0.08714 | no | OVARY |
chr1_1714638_G_T_b38 | SAMD11 | -2.731 | 0.00721 | -0.238 | 5 | 0.08714 | no | OVARY |
chr1_1734308_T_C_b38 | SAMD11 | -2.709 | 0.00769 | -0.257242 | 3 | 0.094973 | no | OVARY |
chr1_1132485_A_C_b38 | SAMD11 | -2.689 | 0.00813 | -0.203481 | 4 | 0.075671 | no | OVARY |
chr1_1010755_T_G_b38 | SAMD11 | 2.676 | 0.00844 | 0.256153 | 3 | 0.095736 | no | OVARY |
chr1_1592964_C_T_b38 | SAMD11 | -2.656 | 0.00893 | -0.219824 | 3 | 0.082772 | no | OVARY |
chr1_1612562_T_TC_b38 | SAMD11 | -2.643 | 0.00925 | -0.141669 | 25 | 0.053599 | no | OVARY |
chr1_1481959_C_T_b38 | SAMD11 | 2.628 | 0.00965 | 0.225995 | 9 | 0.086001 | no | OVARY |
chr1_1729296_T_C_b38 | SAMD11 | -2.622 | 0.0098 | -0.161025 | 12 | 0.061409 | no | OVARY |
chr1_1791172_A_AT_b38 | SAMD11 | 3.517 | 0.000519 | 0.054462 | 19 | 0.015486 | yes | PNCREAS |
chr1_1808642_TTTTG_T_b38 | SAMD11 | 3.377 | 0.000851 | 0.047889 | 23 | 0.014182 | yes | PNCREAS |
chr1_1767762_C_A_b38 | SAMD11 | 3.375 | 0.000855 | 0.048137 | 22 | 0.014261 | yes | PNCREAS |
chr1_1773215_C_A_b38 | SAMD11 | 3.375 | 0.000855 | 0.048137 | 22 | 0.014261 | yes | PNCREAS |
chr1_1774308_G_A_b38 | SAMD11 | 3.375 | 0.000855 | 0.048137 | 22 | 0.014261 | yes | PNCREAS |
chr1_1842237_T_C_b38 | SAMD11 | 3.348 | 0.000939 | 0.047242 | 24 | 0.014109 | yes | PNCREAS |
chr1_1593274_CA_C_b38 | SAMD11 | 3.28 | 0.00119 | 0.059676 | 6 | 0.018193 | yes | PNCREAS |
chr1_1873952_G_A_b38 | SAMD11 | 3.258 | 0.00128 | 0.046385 | 23 | 0.014239 | yes | PNCREAS |
chr1_1878651_C_T_b38 | SAMD11 | 3.258 | 0.00128 | 0.046385 | 23 | 0.014239 | yes | PNCREAS |
chr1_180958_CCCCTAA_C_b38 | SAMD11 | 3.249 | 0.00132 | 0.043303 | 33 | 0.013329 | yes | PNCREAS |
chr1_1890186_G_A_b38 | SAMD11 | 3.242 | 0.00135 | 0.046205 | 23 | 0.014253 | yes | PNCREAS |
chr1_1842213_A_G_b38 | SAMD11 | 3.233 | 0.00139 | 0.04599 | 23 | 0.014223 | yes | PNCREAS |
chr1_1842333_G_A_b38 | SAMD11 | 3.232 | 0.00139 | 0.045944 | 23 | 0.014213 | yes | PNCREAS |
chr1_1842226_T_C_b38 | SAMD11 | 3.229 | 0.00141 | 0.045877 | 23 | 0.014208 | yes | PNCREAS |
chr1_1768171_CA_C_b38 | SAMD11 | 3.218 | 0.00146 | 0.052386 | 8 | 0.016278 | yes | PNCREAS |
chr1_1803531_C_T_b38 | SAMD11 | 3.203 | 0.00154 | 0.045676 | 22 | 0.014261 | yes | PNCREAS |
chr1_1830566_A_T_b38 | SAMD11 | 3.203 | 0.00154 | 0.045676 | 22 | 0.014261 | yes | PNCREAS |
chr1_1839349_C_G_b38 | SAMD11 | 3.203 | 0.00154 | 0.045676 | 22 | 0.014261 | yes | PNCREAS |
chr1_1839350_T_A_b38 | SAMD11 | 3.203 | 0.00154 | 0.045676 | 22 | 0.014261 | yes | PNCREAS |
chr1_1851181_C_T_b38 | SAMD11 | 3.203 | 0.00154 | 0.045676 | 22 | 0.014261 | yes | PNCREAS |
chr1_1842221_C_G_b38 | SAMD11 | 3.201 | 0.00155 | 0.04537 | 24 | 0.014173 | yes | PNCREAS |
chr1_1885444_TTAGA_T_b38 | SAMD11 | 3.146 | 0.00186 | 0.045304 | 21 | 0.014401 | yes | PNCREAS |
chr1_807692_C_A_b38 | SAMD11 | -3.139 | 0.0019 | -0.07471 | 6 | 0.023797 | yes | PNCREAS |
chr1_1838449_C_CT_b38 | SAMD11 | 3.116 | 0.00205 | 0.046276 | 18 | 0.014849 | yes | PNCREAS |
chr1_777135_T_TC_b38 | SAMD11 | 3.088 | 0.00224 | 0.069206 | 5 | 0.02241 | yes | PNCREAS |
chr1_1769737_GA_G_b38 | SAMD11 | 3.032 | 0.00268 | 0.0443 | 18 | 0.01461 | yes | PNCREAS |
chr1_872909_A_T_b38 | SAMD11 | -3.028 | 0.00272 | -0.066231 | 4 | 0.021872 | yes | PNCREAS |
chr1_1861110_C_CAA_b38 | SAMD11 | 2.915 | 0.00388 | 0.051297 | 13 | 0.017598 | yes | PNCREAS |
chr1_1773356_TC_T_b38 | SAMD11 | 2.912 | 0.00391 | 0.043015 | 21 | 0.01477 | yes | PNCREAS |
chr1_1778596_C_T_b38 | SAMD11 | 2.888 | 0.00422 | 0.040563 | 26 | 0.014046 | yes | PNCREAS |
chr1_1845824_TACACACACACACACACACACACACACACAC_T_b38 | SAMD11 | 2.88 | 0.00432 | 0.041035 | 24 | 0.014249 | yes | PNCREAS |
chr1_778639_A_G_b38 | SAMD11 | 2.875 | 0.00438 | 0.061612 | 6 | 0.021428 | yes | PNCREAS |
chr1_1897325_G_A_b38 | SAMD11 | 2.871 | 0.00445 | 0.042837 | 15 | 0.014921 | yes | PNCREAS |
chr1_1524911_C_T_b38 | SAMD11 | 2.823 | 0.00514 | 0.075216 | 12 | 0.026646 | yes | PNCREAS |
chr1_1394752_G_GA_b38 | SAMD11 | 2.819 | 0.0052 | 0.058986 | 7 | 0.020924 | yes | PNCREAS |
chr1_800605_G_A_b38 | SAMD11 | 2.809 | 0.00536 | 0.060515 | 6 | 0.02154 | yes | PNCREAS |
chr1_632487_A_G_b38 | SAMD11 | -2.793 | 0.00563 | -0.074612 | 11 | 0.026713 | yes | PNCREAS |
chr1_1840233_GA_G_b38 | SAMD11 | 2.769 | 0.00605 | 0.042315 | 14 | 0.015283 | yes | PNCREAS |
chr1_1472158_C_G_b38 | SAMD11 | -2.751 | 0.00637 | -0.063837 | 10 | 0.023202 | yes | PNCREAS |
chr1_1764895_A_C_b38 | SAMD11 | 2.712 | 0.00714 | 0.059563 | 6 | 0.021959 | yes | PNCREAS |
chr1_1903309_A_G_b38 | SAMD11 | 2.711 | 0.00718 | 0.040636 | 39 | 0.014992 | yes | PNCREAS |
chr1_1791389_G_A_b38 | SAMD11 | 2.685 | 0.00774 | 0.042849 | 14 | 0.015958 | yes | PNCREAS |
chr1_1921849_G_T_b38 | SAMD11 | 2.666 | 0.00818 | 0.038057 | 28 | 0.014275 | yes | PNCREAS |
chr1_1869595_G_A_b38 | SAMD11 | 2.657 | 0.00838 | 0.038801 | 20 | 0.014601 | yes | PNCREAS |
chr1_1878070_C_T_b38 | SAMD11 | 2.657 | 0.00838 | 0.038801 | 20 | 0.014601 | yes | PNCREAS |
chr1_1881006_GGA_G_b38 | SAMD11 | 2.657 | 0.00838 | 0.038801 | 20 | 0.014601 | yes | PNCREAS |
chr1_1888667_A_C_b38 | SAMD11 | 2.657 | 0.00838 | 0.038801 | 20 | 0.014601 | yes | PNCREAS |
chr1_1805214_T_G_b38 | SAMD11 | 2.656 | 0.00841 | 0.03881 | 19 | 0.01461 | yes | PNCREAS |
chr1_1827615_G_A_b38 | SAMD11 | 2.656 | 0.00841 | 0.03881 | 19 | 0.01461 | yes | PNCREAS |
chr1_1834655_A_C_b38 | SAMD11 | 2.656 | 0.00841 | 0.03881 | 19 | 0.01461 | yes | PNCREAS |
chr1_1782430_T_G_b38 | SAMD11 | 2.648 | 0.00863 | 0.038424 | 20 | 0.014513 | yes | PNCREAS |
chr1_1852145_G_A_b38 | SAMD11 | 2.646 | 0.00867 | 0.038472 | 20 | 0.014541 | yes | PNCREAS |
chr1_1794321_C_T_b38 | SAMD11 | 2.606 | 0.00971 | 0.038163 | 19 | 0.014643 | yes | PNCREAS |
chr1_1837455_C_T_b38 | SAMD11 | 2.606 | 0.00971 | 0.038163 | 19 | 0.014643 | yes | PNCREAS |
chr1_1851762_G_A_b38 | SAMD11 | 2.606 | 0.00971 | 0.038163 | 19 | 0.014643 | yes | PNCREAS |
chr1_1780791_C_T_b38 | SAMD11 | 2.597 | 0.00997 | 0.037757 | 20 | 0.014541 | yes | PNCREAS |
chr1_1783572_C_A_b38 | SAMD11 | 2.597 | 0.00997 | 0.037757 | 20 | 0.014541 | yes | PNCREAS |
chr1_269781_C_T_b38 | SAMD11 | -2.596 | 0.00999 | -0.046358 | 3 | 0.017858 | yes | PNCREAS |
chr1_973946_C_T_b38 | SAMD11 | 4.023 | 7.62e-05 | 0.145852 | 3 | 0.036254 | no | PNCREAS |
chr1_597549_T_C_b38 | SAMD11 | 3.651 | 0.000318 | 0.127862 | 3 | 0.035021 | no | PNCREAS |
chr1_1774165_A_G_b38 | SAMD11 | 3.512 | 0.000528 | 0.051905 | 18 | 0.014779 | no | PNCREAS |
chr1_1776301_T_G_b38 | SAMD11 | 3.427 | 0.000714 | 0.048785 | 22 | 0.014236 | no | PNCREAS |
chr1_588115_AC_A_b38 | SAMD11 | 3.28 | 0.00119 | 0.06487 | 3 | 0.019778 | no | PNCREAS |
chr1_1650405_G_A_b38 | SAMD11 | -3.262 | 0.00126 | -0.080405 | 7 | 0.024651 | no | PNCREAS |
chr1_1879682_G_A_b38 | SAMD11 | 3.22 | 0.00145 | 0.046138 | 23 | 0.014328 | no | PNCREAS |
chr1_1802763_T_TAA_b38 | SAMD11 | 3.179 | 0.00166 | 0.05046 | 13 | 0.015872 | no | PNCREAS |
chr1_788418_CAG_C_b38 | SAMD11 | -3.178 | 0.00167 | -0.068327 | 5 | 0.021498 | no | PNCREAS |
chr1_263722_C_G_b38 | SAMD11 | -3.171 | 0.00171 | -0.04842 | 23 | 0.015267 | no | PNCREAS |
chr1_1558204_T_TAAAAA_b38 | SAMD11 | 3.128 | 0.00197 | 0.098975 | 3 | 0.031637 | no | PNCREAS |
chr1_788439_T_A_b38 | SAMD11 | 3.095 | 0.0022 | 0.066878 | 5 | 0.02161 | no | PNCREAS |
chr1_1774697_T_C_b38 | SAMD11 | 3.053 | 0.00251 | 0.066529 | 6 | 0.021794 | no | PNCREAS |
chr1_788511_G_C_b38 | SAMD11 | -2.945 | 0.00354 | -0.06327 | 7 | 0.021485 | no | PNCREAS |
chr1_1855321_C_CA_b38 | SAMD11 | 2.912 | 0.00391 | 0.044365 | 18 | 0.015233 | no | PNCREAS |
chr1_985353_T_C_b38 | SAMD11 | -2.907 | 0.00398 | -0.071589 | 3 | 0.024625 | no | PNCREAS |
chr1_1881428_C_T_b38 | SAMD11 | 2.892 | 0.00417 | 0.042912 | 18 | 0.014838 | no | PNCREAS |
chr1_1762664_A_G_b38 | SAMD11 | 2.886 | 0.00425 | 0.064092 | 5 | 0.022211 | no | PNCREAS |
chr1_1751888_C_T_b38 | SAMD11 | 2.846 | 0.00479 | 0.045206 | 25 | 0.015882 | no | PNCREAS |
chr1_95068_G_A_b38 | SAMD11 | -2.804 | 0.00545 | -0.069362 | 3 | 0.02474 | no | PNCREAS |
chr1_1240684_G_GCCGCCCCCATTCACCCCGGCCGTGGTCCCTGCCCCAGCCCCCA_b38 | SAMD11 | -2.794 | 0.00561 | -0.065811 | 6 | 0.023555 | no | PNCREAS |
chr1_983004_G_T_b38 | SAMD11 | -2.782 | 0.00582 | -0.034731 | 86 | 0.012485 | no | PNCREAS |
chr1_275583_T_TTTTA_b38 | SAMD11 | -2.728 | 0.00683 | -0.039317 | 24 | 0.014413 | no | PNCREAS |
chr1_1594599_T_C_b38 | SAMD11 | 2.682 | 0.0078 | 0.061279 | 5 | 0.022847 | no | PNCREAS |
chr1_1848356_GC_G_b38 | SAMD11 | 2.672 | 0.00804 | 0.044322 | 12 | 0.016588 | no | PNCREAS |
chr1_1428999_C_CA_b38 | SAMD11 | -2.652 | 0.00851 | -0.041595 | 15 | 0.015682 | no | PNCREAS |
chr1_800909_T_A_b38 | SAMD11 | 2.63 | 0.00907 | 0.047538 | 4 | 0.018075 | no | PNCREAS |
chr1_1810086_A_G_b38 | SAMD11 | 2.614 | 0.00949 | 0.04288 | 13 | 0.016402 | no | PNCREAS |
chr1_921797_T_C_b38 | SAMD11 | -2.612 | 0.00954 | -0.067674 | 9 | 0.025905 | no | PNCREAS |
chr1_1773719_T_A_b38 | SAMD11 | 2.6 | 0.00988 | 0.034542 | 35 | 0.013285 | no | PNCREAS |
chr1_201062_T_G_b38 | SAMD11 | 3.651 | 0.000335 | 0.238588 | 3 | 0.06534 | yes | PTTARY |
chr1_1651653_C_T_b38 | SAMD11 | 3.558 | 0.000469 | 0.116339 | 48 | 0.032701 | yes | PTTARY |
chr1_1877314_A_AT_b38 | SAMD11 | 3.327 | 0.00105 | 0.178564 | 3 | 0.053667 | yes | PTTARY |
chr1_1888382_A_AG_b38 | SAMD11 | 3.216 | 0.00152 | 0.161127 | 3 | 0.050098 | yes | PTTARY |
chr1_58814_G_A_b38 | SAMD11 | 3.177 | 0.00173 | 0.159052 | 4 | 0.05006 | yes | PTTARY |
chr1_1725339_C_A_b38 | SAMD11 | 3.13 | 0.00201 | 0.094043 | 44 | 0.030041 | yes | PTTARY |
chr1_1649993_A_G_b38 | SAMD11 | -3.113 | 0.00213 | -0.090088 | 56 | 0.028939 | yes | PTTARY |
chr1_1600379_C_T_b38 | SAMD11 | 2.982 | 0.00323 | 0.095491 | 27 | 0.032027 | yes | PTTARY |
chr1_1649932_C_T_b38 | SAMD11 | 2.974 | 0.00331 | 0.097651 | 43 | 0.032831 | yes | PTTARY |
chr1_1648736_G_A_b38 | SAMD11 | 2.953 | 0.00353 | 0.096108 | 43 | 0.032549 | yes | PTTARY |
chr1_1636278_G_T_b38 | SAMD11 | 2.933 | 0.00375 | 0.099615 | 35 | 0.033958 | yes | PTTARY |
chr1_60351_A_G_b38 | SAMD11 | 2.907 | 0.00407 | 0.153928 | 4 | 0.052956 | yes | PTTARY |
chr1_1600320_C_G_b38 | SAMD11 | 2.9 | 0.00416 | 0.092929 | 27 | 0.032044 | yes | PTTARY |
chr1_1688586_C_T_b38 | SAMD11 | -2.894 | 0.00423 | -0.109753 | 14 | 0.037924 | yes | PTTARY |
chr1_1801188_T_C_b38 | SAMD11 | 2.892 | 0.00426 | 0.122347 | 6 | 0.042307 | yes | PTTARY |
chr1_56381_T_C_b38 | SAMD11 | 2.801 | 0.00561 | 0.14819 | 4 | 0.052912 | yes | PTTARY |
chr1_650383_A_AAC_b38 | SAMD11 | 2.78 | 0.00596 | 0.160951 | 4 | 0.057892 | yes | PTTARY |
chr1_1290968_C_G_b38 | SAMD11 | -2.74 | 0.00671 | -0.119721 | 13 | 0.043694 | yes | PTTARY |
chr1_1792696_C_CA_b38 | SAMD11 | 2.725 | 0.00701 | 0.089458 | 29 | 0.032826 | yes | PTTARY |
chr1_1688457_G_A_b38 | SAMD11 | -2.709 | 0.00735 | -0.100134 | 15 | 0.036964 | yes | PTTARY |
chr1_1620609_G_A_b38 | SAMD11 | 2.704 | 0.00745 | 0.085254 | 29 | 0.031528 | yes | PTTARY |
chr1_1688442_T_C_b38 | SAMD11 | -2.684 | 0.0079 | -0.098098 | 16 | 0.036552 | yes | PTTARY |
chr1_1654662_CT_C_b38 | SAMD11 | 2.682 | 0.00795 | 0.102067 | 35 | 0.038059 | yes | PTTARY |
chr1_1688786_G_A_b38 | SAMD11 | -2.656 | 0.00856 | -0.106131 | 8 | 0.03996 | yes | PTTARY |
chr1_1613769_C_T_b38 | SAMD11 | 2.654 | 0.00862 | 0.087462 | 27 | 0.032961 | yes | PTTARY |
chr1_1606099_G_GGTCAGGCGAGGGGTC_b38 | SAMD11 | 2.653 | 0.00863 | 0.090326 | 23 | 0.034044 | yes | PTTARY |
chr1_1586962_C_T_b38 | SAMD11 | 2.649 | 0.00872 | 0.091127 | 26 | 0.034397 | yes | PTTARY |
chr1_1595306_CAG_C_b38 | SAMD11 | -2.634 | 0.00912 | -0.090211 | 45 | 0.034251 | yes | PTTARY |
chr1_1621352_G_A_b38 | SAMD11 | 2.632 | 0.00917 | 0.083567 | 29 | 0.031754 | yes | PTTARY |
chr1_1607931_G_A_b38 | SAMD11 | 2.627 | 0.0093 | 0.084458 | 26 | 0.03215 | yes | PTTARY |
chr1_1609058_G_A_b38 | SAMD11 | 2.627 | 0.0093 | 0.084458 | 26 | 0.03215 | yes | PTTARY |
chr1_1622295_G_C_b38 | SAMD11 | 2.61 | 0.00975 | 0.082577 | 29 | 0.031636 | yes | PTTARY |
chr1_1869185_C_CA_b38 | SAMD11 | 3.506 | 0.000565 | 0.20382 | 6 | 0.058141 | no | PTTARY |
chr1_1230159_G_A_b38 | SAMD11 | -3.21 | 0.00155 | -0.113486 | 16 | 0.035357 | no | PTTARY |
chr1_1236037_C_T_b38 | SAMD11 | -3.151 | 0.00188 | -0.100111 | 30 | 0.031773 | no | PTTARY |
chr1_1288341_C_T_b38 | SAMD11 | -3.021 | 0.00286 | -0.183684 | 3 | 0.06081 | no | PTTARY |
chr1_1667424_T_TAAAATA_b38 | SAMD11 | 2.879 | 0.00443 | 0.094877 | 31 | 0.032955 | no | PTTARY |
chr1_1388565_GTC_G_b38 | SAMD11 | 2.877 | 0.00446 | 0.108172 | 12 | 0.037603 | no | PTTARY |
chr1_1661562_G_C_b38 | SAMD11 | 2.87 | 0.00455 | 0.082606 | 51 | 0.028779 | no | PTTARY |
chr1_1235997_A_G_b38 | SAMD11 | -2.854 | 0.00478 | -0.13373 | 3 | 0.046855 | no | PTTARY |
chr1_858049_T_C_b38 | SAMD11 | 2.819 | 0.00531 | 0.097692 | 26 | 0.034654 | no | PTTARY |
chr1_1630798_C_T_b38 | SAMD11 | 2.796 | 0.00569 | 0.091098 | 29 | 0.032584 | no | PTTARY |
chr1_1324185_T_TGG_b38 | SAMD11 | -2.795 | 0.0057 | -0.157639 | 6 | 0.056398 | no | PTTARY |
chr1_64931_G_A_b38 | SAMD11 | 2.745 | 0.00662 | 0.151436 | 3 | 0.055176 | no | PTTARY |
chr1_1221049_C_G_b38 | SAMD11 | -2.709 | 0.00735 | -0.09363 | 20 | 0.034564 | no | PTTARY |
chr1_1629332_G_T_b38 | SAMD11 | 2.682 | 0.00794 | 0.086625 | 31 | 0.032299 | no | PTTARY |
chr1_1716919_CTT_C_b38 | SAMD11 | -2.603 | 0.00994 | -0.095056 | 22 | 0.036515 | no | PTTARY |
chr1_1684817_G_C_b38 | SAMD11 | -4.083 | 6.68e-05 | -0.145155 | 39 | 0.035555 | yes | PRSTTE |
chr1_1686882_T_C_b38 | SAMD11 | -3.957 | 0.000109 | -0.136646 | 49 | 0.034529 | yes | PRSTTE |
chr1_1686017_A_AT_b38 | SAMD11 | -3.919 | 0.000126 | -0.135736 | 44 | 0.034639 | yes | PRSTTE |
chr1_1684308_G_C_b38 | SAMD11 | -3.915 | 0.000128 | -0.136075 | 43 | 0.034754 | yes | PRSTTE |
chr1_1684619_G_A_b38 | SAMD11 | -3.915 | 0.000128 | -0.136075 | 43 | 0.034754 | yes | PRSTTE |
chr1_1681370_T_G_b38 | SAMD11 | -3.876 | 0.000148 | -0.195433 | 5 | 0.050421 | yes | PRSTTE |
chr1_1687236_T_G_b38 | SAMD11 | -3.864 | 0.000155 | -0.134559 | 42 | 0.03482 | yes | PRSTTE |
chr1_1687153_A_G_b38 | SAMD11 | -3.862 | 0.000156 | -0.135711 | 48 | 0.035139 | yes | PRSTTE |
chr1_1687643_G_A_b38 | SAMD11 | -3.834 | 0.000174 | -0.132647 | 44 | 0.034596 | yes | PRSTTE |
chr1_1681928_C_A_b38 | SAMD11 | -3.824 | 0.00018 | -0.137772 | 40 | 0.036025 | yes | PRSTTE |
chr1_1687061_C_T_b38 | SAMD11 | -3.792 | 0.000204 | -0.133106 | 43 | 0.035103 | yes | PRSTTE |
chr1_1687159_G_T_b38 | SAMD11 | -3.786 | 0.000208 | -0.13205 | 43 | 0.034876 | yes | PRSTTE |
chr1_1687734_CAA_C_b38 | SAMD11 | -3.777 | 0.000215 | -0.138262 | 30 | 0.036604 | yes | PRSTTE |
chr1_1683909_A_C_b38 | SAMD11 | -3.775 | 0.000217 | -0.1318 | 50 | 0.034914 | yes | PRSTTE |
chr1_1684266_T_C_b38 | SAMD11 | -3.762 | 0.000227 | -0.130586 | 44 | 0.034711 | yes | PRSTTE |
chr1_1681164_G_A_b38 | SAMD11 | -3.65 | 0.000343 | -0.128851 | 44 | 0.035304 | yes | PRSTTE |
chr1_1688442_T_C_b38 | SAMD11 | -3.504 | 0.000577 | -0.141711 | 25 | 0.04044 | yes | PRSTTE |
chr1_1688328_C_T_b38 | SAMD11 | -3.498 | 0.00059 | -0.14072 | 14 | 0.040228 | yes | PRSTTE |
chr1_1680214_T_C_b38 | SAMD11 | -3.435 | 0.000734 | -0.122146 | 45 | 0.035558 | yes | PRSTTE |
chr1_1223251_A_G_b38 | SAMD11 | 3.381 | 0.000885 | 0.188099 | 3 | 0.055634 | yes | PRSTTE |
chr1_1688457_G_A_b38 | SAMD11 | -3.29 | 0.0012 | -0.13601 | 24 | 0.04134 | yes | PRSTTE |
chr1_1680556_A_G_b38 | SAMD11 | -3.236 | 0.00144 | -0.116556 | 45 | 0.036017 | yes | PRSTTE |
chr1_1701564_CG_C_b38 | SAMD11 | 3.088 | 0.00233 | 0.101197 | 39 | 0.032774 | yes | PRSTTE |
chr1_1688570_A_T_b38 | SAMD11 | -3.029 | 0.00282 | -0.138137 | 10 | 0.04561 | yes | PRSTTE |
chr1_1688586_C_T_b38 | SAMD11 | -2.919 | 0.00396 | -0.128615 | 17 | 0.044065 | yes | PRSTTE |
chr1_1688647_G_A_b38 | SAMD11 | -2.842 | 0.00499 | -0.117734 | 25 | 0.041422 | yes | PRSTTE |
chr1_1706566_G_C_b38 | SAMD11 | 2.812 | 0.00546 | 0.105744 | 37 | 0.037603 | yes | PRSTTE |
chr1_1691377_C_T_b38 | SAMD11 | 2.793 | 0.00579 | 0.105811 | 29 | 0.037889 | yes | PRSTTE |
chr1_1688619_AAAC_A_b38 | SAMD11 | -2.784 | 0.00594 | -0.117847 | 22 | 0.042329 | yes | PRSTTE |
chr1_1704180_T_C_b38 | SAMD11 | 2.758 | 0.00641 | 0.102964 | 37 | 0.037334 | yes | PRSTTE |
chr1_1697467_G_A_b38 | SAMD11 | 2.753 | 0.00651 | 0.102078 | 38 | 0.037079 | yes | PRSTTE |
chr1_1703565_T_C_b38 | SAMD11 | 2.704 | 0.0075 | 0.101785 | 36 | 0.037638 | yes | PRSTTE |
chr1_1132485_A_C_b38 | SAMD11 | 2.668 | 0.00832 | 0.16121 | 4 | 0.060418 | yes | PRSTTE |
chr1_1027633_C_T_b38 | SAMD11 | 2.665 | 0.0084 | 0.102503 | 36 | 0.038464 | yes | PRSTTE |
chr1_1763636_G_A_b38 | SAMD11 | 2.634 | 0.00916 | 0.129117 | 14 | 0.049015 | yes | PRSTTE |
chr1_58866_C_G_b38 | SAMD11 | -2.63 | 0.00926 | -0.106793 | 22 | 0.0406 | yes | PRSTTE |
chr1_1686147_T_G_b38 | SAMD11 | -3.762 | 0.000228 | -0.132789 | 41 | 0.0353 | no | PRSTTE |
chr1_1707607_C_G_b38 | SAMD11 | 3.758 | 0.000231 | 0.115054 | 41 | 0.030614 | no | PRSTTE |
chr1_1689446_T_C_b38 | SAMD11 | -3.687 | 3e-04 | -0.13253 | 35 | 0.035949 | no | PRSTTE |
chr1_1689421_G_A_b38 | SAMD11 | -3.614 | 0.00039 | -0.129842 | 34 | 0.035926 | no | PRSTTE |
chr1_1690308_AT_A_b38 | SAMD11 | 3.402 | 0.000823 | 0.111091 | 56 | 0.032652 | no | PRSTTE |
chr1_1689465_A_G_b38 | SAMD11 | -3.257 | 0.00134 | -0.114513 | 43 | 0.035155 | no | PRSTTE |
chr1_1694109_A_ACG_b38 | SAMD11 | 3.202 | 0.00161 | 0.112512 | 45 | 0.035143 | no | PRSTTE |
chr1_1685108_CA_C_b38 | SAMD11 | -3.115 | 0.00214 | -0.133589 | 20 | 0.042889 | no | PRSTTE |
chr1_1679993_A_G_b38 | SAMD11 | -3.081 | 0.00239 | -0.107519 | 54 | 0.0349 | no | PRSTTE |
chr1_1694167_G_A_b38 | SAMD11 | 3.019 | 0.0029 | 0.105388 | 44 | 0.03491 | no | PRSTTE |
chr1_866577_CCTGCACTCACATCCCTGACGTCCTCCCGTGCCCTCACGTGGTCCTCCCT_C_b38 | SAMD11 | -2.923 | 0.00391 | -0.104329 | 32 | 0.035689 | no | PRSTTE |
chr1_1707623_T_C_b38 | SAMD11 | 2.888 | 0.00435 | 0.084157 | 33 | 0.029138 | no | PRSTTE |
chr1_1708951_C_T_b38 | SAMD11 | 2.846 | 0.00493 | 0.09815 | 38 | 0.034483 | no | PRSTTE |
chr1_1690741_T_A_b38 | SAMD11 | 2.745 | 0.00666 | 0.095997 | 26 | 0.034972 | no | PRSTTE |
chr1_1705867_T_C_b38 | SAMD11 | 2.737 | 0.00681 | 0.091019 | 56 | 0.033252 | no | PRSTTE |
chr1_1720192_T_G_b38 | SAMD11 | 2.673 | 0.0082 | 0.093941 | 64 | 0.035143 | no | PRSTTE |
chr1_180944_A_AC_b38 | SAMD11 | -2.665 | 0.0084 | -0.182958 | 3 | 0.068655 | no | PRSTTE |
chr1_1704605_G_A_b38 | SAMD11 | 2.613 | 0.00973 | 0.098703 | 37 | 0.037775 | no | PRSTTE |
chr1_1705799_A_G_b38 | SAMD11 | 2.607 | 0.00989 | 0.090034 | 60 | 0.034535 | no | PRSTTE |
chr1_49363_C_T_b38 | SAMD11 | 6.881 | 2.03e-11 | 0.271068 | 3 | 0.039396 | yes | SKINNS |
chr1_98999_TTTTA_T_b38 | SAMD11 | 3.302 | 0.00104 | 0.095778 | 3 | 0.02901 | yes | SKINNS |
chr1_1657902_TA_T_b38 | SAMD11 | 3.216 | 0.0014 | 0.088801 | 3 | 0.027616 | yes | SKINNS |
chr1_1725729_A_AT_b38 | SAMD11 | 3.114 | 0.00196 | 0.146957 | 3 | 0.047188 | yes | SKINNS |
chr1_284741_A_C_b38 | SAMD11 | -2.972 | 0.00312 | -0.087428 | 3 | 0.02942 | yes | SKINNS |
chr1_62738_T_C_b38 | SAMD11 | 2.934 | 0.00352 | 0.079986 | 3 | 0.02726 | yes | SKINNS |
chr1_1363456_CAG_C_b38 | SAMD11 | -2.909 | 0.00381 | -0.045813 | 30 | 0.015748 | yes | SKINNS |
chr1_1203533_T_C_b38 | SAMD11 | -2.889 | 0.00405 | -0.062143 | 11 | 0.021508 | yes | SKINNS |
chr1_20144_G_A_b38 | SAMD11 | 2.856 | 0.00449 | 0.051761 | 6 | 0.018126 | yes | SKINNS |
chr1_1585973_T_TAATAATAATAATAATAATAATAAA_b38 | SAMD11 | 2.846 | 0.00463 | 0.053884 | 19 | 0.018934 | yes | SKINNS |
chr1_1301426_A_AT_b38 | SAMD11 | 2.813 | 0.00512 | 0.052736 | 17 | 0.018746 | yes | SKINNS |
chr1_1606507_GTGGGC_G_b38 | SAMD11 | -2.769 | 0.00585 | -0.035507 | 122 | 0.012822 | yes | SKINNS |
chr1_109575_C_CGTGT_b38 | SAMD11 | -2.767 | 0.00589 | -0.085393 | 3 | 0.030858 | yes | SKINNS |
chr1_273824_G_T_b38 | SAMD11 | -2.743 | 0.00634 | -0.041553 | 26 | 0.015151 | yes | SKINNS |
chr1_910255_C_T_b38 | SAMD11 | -2.725 | 0.00669 | -0.044866 | 15 | 0.016466 | yes | SKINNS |
chr1_286145_C_CAT_b38 | SAMD11 | -2.691 | 0.00738 | -0.046974 | 8 | 0.017453 | yes | SKINNS |
chr1_619428_G_A_b38 | SAMD11 | -2.667 | 0.00794 | -0.046677 | 14 | 0.017504 | yes | SKINNS |
chr1_1361685_C_T_b38 | SAMD11 | 2.639 | 0.00862 | 0.047764 | 26 | 0.018102 | yes | SKINNS |
chr1_1022587_T_TTGTAGTCTGACCTGTGGTCTGAC_b38 | SAMD11 | -2.596 | 0.00974 | -0.095735 | 7 | 0.036875 | yes | SKINNS |
chr1_1203822_T_C_b38 | SAMD11 | -2.999 | 0.00286 | -0.064502 | 11 | 0.021511 | no | SKINNS |
chr1_1235349_G_A_b38 | SAMD11 | -2.946 | 0.00339 | -0.090663 | 4 | 0.030776 | no | SKINNS |
chr1_1361679_G_A_b38 | SAMD11 | -2.902 | 0.00389 | -0.049925 | 35 | 0.017202 | no | SKINNS |
chr1_1585973_T_A_b38 | SAMD11 | -2.857 | 0.00448 | -0.055648 | 21 | 0.019479 | no | SKINNS |
chr1_194639_A_T_b38 | SAMD11 | 2.822 | 0.00498 | 0.05469 | 12 | 0.019377 | no | SKINNS |
chr1_820879_G_GTCTACACTACCTGCCTGGCCAGCAGATCCACCCTGTCTACACTACCTGCCTGGGCAGTAGTTCCACGCAATCTCCCCTACCTGCCTCTCCAGCAGACCCGCCCTATCTATACTACTTGCCTGTCCAGCAGATCCACTCTATCTACACGACCTGCCTGTCCAGCAGATCCACCCTGTCTACACTACCTGCTTGTCCAGCAGGTCCACCCTGTCTATACTACCTGCCTGGCCAGTAGATCCACACTA_b38 | SAMD11 | -2.784 | 0.00559 | -0.035459 | 26 | 0.012736 | no | SKINNS |
chr1_756728_G_A_b38 | SAMD11 | -2.739 | 0.00642 | -0.085174 | 4 | 0.031101 | no | SKINNS |
chr1_506937_T_G_b38 | SAMD11 | 2.733 | 0.00652 | 0.053608 | 8 | 0.019614 | no | SKINNS |
chr1_769257_G_A_b38 | SAMD11 | -2.683 | 0.00757 | -0.074332 | 3 | 0.027705 | no | SKINNS |
chr1_1379091_T_G_b38 | SAMD11 | -2.644 | 0.00848 | -0.048331 | 15 | 0.01828 | no | SKINNS |
chr1_1363601_A_AT_b38 | SAMD11 | -2.628 | 0.00888 | -0.03151 | 144 | 0.011989 | no | SKINNS |
chr1_1234105_G_A_b38 | SAMD11 | -2.617 | 0.00918 | -0.079285 | 4 | 0.030302 | no | SKINNS |
chr1_1151436_C_CCCCCAGCCAGAGCCTCAGGGTGAGCTCAAGGCACCAAACCCAGAACGG_b38 | SAMD11 | 2.611 | 0.00932 | 0.125225 | 3 | 0.047952 | no | SKINNS |
chr1_1007358_G_C_b38 | SAMD11 | -2.61 | 0.00937 | -0.112016 | 3 | 0.042923 | no | SKINNS |
chr1_1186850_G_GT_b38 | SAMD11 | 2.605 | 0.00949 | 0.051603 | 6 | 0.019808 | no | SKINNS |
chr1_931513_T_C_b38 | SAMD11 | 6.319 | 5.56e-10 | 0.085898 | 143 | 0.013594 | yes | SKNS |
chr1_916657_G_A_b38 | SAMD11 | 5.57 | 4.05e-08 | 0.078535 | 153 | 0.014101 | yes | SKNS |
chr1_916683_G_A_b38 | SAMD11 | 5.556 | 4.37e-08 | 0.078268 | 153 | 0.014088 | yes | SKNS |
chr1_938178_G_T_b38 | SAMD11 | 5.32 | 1.53e-07 | 0.077986 | 84 | 0.014658 | yes | SKNS |
chr1_914838_T_A_b38 | SAMD11 | 5.299 | 1.7e-07 | 0.075029 | 153 | 0.014158 | yes | SKNS |
chr1_933548_A_AG_b38 | SAMD11 | 5.209 | 2.72e-07 | 0.071403 | 106 | 0.013709 | yes | SKNS |
chr1_935954_G_T_b38 | SAMD11 | 5.123 | 4.21e-07 | 0.074825 | 86 | 0.014606 | yes | SKNS |
chr1_939779_AGCCAGTGGACGCCGACCT_A_b38 | SAMD11 | 5.064 | 5.67e-07 | 0.071707 | 112 | 0.014161 | yes | SKNS |
chr1_965337_CTTAT_C_b38 | SAMD11 | 4.971 | 8.99e-07 | 0.073231 | 122 | 0.014732 | yes | SKNS |
chr1_960891_C_T_b38 | SAMD11 | 4.937 | 1.06e-06 | 0.070187 | 129 | 0.014216 | yes | SKNS |
chr1_946247_G_A_b38 | SAMD11 | 4.775 | 2.32e-06 | 0.070616 | 115 | 0.014787 | yes | SKNS |
chr1_925308_G_A_b38 | SAMD11 | 4.593 | 5.45e-06 | 0.071662 | 67 | 0.015602 | yes | SKNS |
chr1_926250_G_A_b38 | SAMD11 | 4.439 | 1.1e-05 | 0.070541 | 64 | 0.015891 | yes | SKNS |
chr1_949171_GAGAA_G_b38 | SAMD11 | 4.355 | 1.6e-05 | 0.063481 | 110 | 0.014577 | yes | SKNS |
chr1_925036_G_A_b38 | SAMD11 | 4.35 | 1.63e-05 | 0.069209 | 60 | 0.015909 | yes | SKNS |
chr1_955679_C_T_b38 | SAMD11 | 4.343 | 1.68e-05 | 0.063756 | 109 | 0.014679 | yes | SKNS |
chr1_919598_A_C_b38 | SAMD11 | 4.336 | 1.74e-05 | 0.059919 | 122 | 0.01382 | yes | SKNS |
chr1_923421_A_G_b38 | SAMD11 | 4.299 | 2.04e-05 | 0.068051 | 61 | 0.015831 | yes | SKNS |
chr1_956565_A_G_b38 | SAMD11 | 4.294 | 2.09e-05 | 0.06289 | 109 | 0.014648 | yes | SKNS |
chr1_923311_TG_T_b38 | SAMD11 | 4.284 | 2.17e-05 | 0.067862 | 60 | 0.01584 | yes | SKNS |
chr1_933741_T_TG_b38 | SAMD11 | 4.146 | 3.94e-05 | 0.062439 | 58 | 0.015061 | yes | SKNS |
chr1_929558_G_A_b38 | SAMD11 | 4.129 | 4.23e-05 | 0.064133 | 73 | 0.015533 | yes | SKNS |
chr1_918574_C_A_b38 | SAMD11 | 4.097 | 4.83e-05 | 0.056755 | 120 | 0.013852 | yes | SKNS |
chr1_910558_G_A_b38 | SAMD11 | -4.097 | 4.83e-05 | -0.065571 | 44 | 0.016004 | yes | SKNS |
chr1_921096_A_G_b38 | SAMD11 | -4.083 | 5.12e-05 | -0.058179 | 103 | 0.014249 | yes | SKNS |
chr1_915400_C_T_b38 | SAMD11 | 4.074 | 5.32e-05 | 0.056361 | 114 | 0.013833 | yes | SKNS |
chr1_940390_A_G_b38 | SAMD11 | 4.047 | 5.95e-05 | 0.055743 | 148 | 0.013774 | yes | SKNS |
chr1_917495_C_T_b38 | SAMD11 | 4.042 | 6.08e-05 | 0.055862 | 121 | 0.01382 | yes | SKNS |
chr1_920719_T_G_b38 | SAMD11 | -3.974 | 8.04e-05 | -0.054795 | 93 | 0.013788 | yes | SKNS |
chr1_920728_A_G_b38 | SAMD11 | -3.974 | 8.04e-05 | -0.054795 | 93 | 0.013788 | yes | SKNS |
chr1_919695_C_G_b38 | SAMD11 | 3.951 | 8.82e-05 | 0.054499 | 94 | 0.013793 | yes | SKNS |
chr1_936972_G_C_b38 | SAMD11 | -3.946 | 9.02e-05 | -0.059964 | 50 | 0.015197 | yes | SKNS |
chr1_1007746_CTTTTTTTTTTTTTTTTTTTTTTTT_C_b38 | SAMD11 | 3.933 | 9.49e-05 | 0.088691 | 4 | 0.022549 | yes | SKNS |
chr1_897376_T_G_b38 | SAMD11 | -3.923 | 9.9e-05 | -0.059668 | 52 | 0.015211 | yes | SKNS |
chr1_914991_G_T_b38 | SAMD11 | 3.911 | 0.000104 | 0.054149 | 116 | 0.013847 | yes | SKNS |
chr1_967865_A_G_b38 | SAMD11 | 3.87 | 0.000122 | 0.05355 | 164 | 0.013838 | yes | SKNS |
chr1_919397_A_G_b38 | SAMD11 | 3.866 | 0.000124 | 0.053514 | 92 | 0.013842 | yes | SKNS |
chr1_927486_C_T_b38 | SAMD11 | 3.754 | 0.000193 | 0.059895 | 64 | 0.015955 | yes | SKNS |
chr1_945259_TC_T_b38 | SAMD11 | -3.703 | 0.000235 | -0.060328 | 31 | 0.01629 | yes | SKNS |
chr1_911018_G_A_b38 | SAMD11 | -3.695 | 0.000242 | -0.05995 | 39 | 0.016224 | yes | SKNS |
chr1_901516_T_C_b38 | SAMD11 | -3.674 | 0.000263 | -0.055797 | 57 | 0.015188 | yes | SKNS |
chr1_967384_C_G_b38 | SAMD11 | 3.673 | 0.000264 | 0.055866 | 112 | 0.01521 | yes | SKNS |
chr1_1070689_G_A_b38 | SAMD11 | 3.666 | 0.000271 | 0.081846 | 6 | 0.022326 | yes | SKNS |
chr1_1190394_C_G_b38 | SAMD11 | 3.632 | 0.000309 | 0.082671 | 9 | 0.022763 | yes | SKNS |
chr1_455125_G_T_b38 | SAMD11 | -3.596 | 0.000353 | -0.11738 | 3 | 0.032641 | yes | SKNS |
chr1_931558_G_A_b38 | SAMD11 | -3.592 | 0.000359 | -0.058488 | 27 | 0.016283 | yes | SKNS |
chr1_641209_C_T_b38 | SAMD11 | -3.549 | 0.00042 | -0.148181 | 6 | 0.04175 | yes | SKNS |
chr1_1188054_T_A_b38 | SAMD11 | 3.547 | 0.000424 | 0.060443 | 23 | 0.017042 | yes | SKNS |
chr1_596629_T_C_b38 | SAMD11 | -3.534 | 0.000444 | -0.16099 | 3 | 0.04555 | yes | SKNS |
chr1_1067673_C_T_b38 | SAMD11 | 3.513 | 0.000481 | 0.048123 | 126 | 0.013699 | yes | SKNS |
chr1_1188963_C_T_b38 | SAMD11 | 3.512 | 0.000482 | 0.081189 | 8 | 0.023117 | yes | SKNS |
chr1_1190707_C_T_b38 | SAMD11 | 3.512 | 0.000482 | 0.081189 | 8 | 0.023117 | yes | SKNS |
chr1_1191630_G_A_b38 | SAMD11 | 3.512 | 0.000482 | 0.081189 | 8 | 0.023117 | yes | SKNS |
chr1_909894_G_T_b38 | SAMD11 | -3.502 | 5e-04 | -0.05713 | 44 | 0.016313 | yes | SKNS |
chr1_1362470_A_T_b38 | SAMD11 | -3.498 | 0.000508 | -0.071448 | 5 | 0.020426 | yes | SKNS |
chr1_591478_T_G_b38 | SAMD11 | -3.491 | 0.000522 | -0.122261 | 3 | 0.035025 | yes | SKNS |
chr1_968046_C_T_b38 | SAMD11 | -3.47 | 0.000562 | -0.053359 | 57 | 0.015377 | yes | SKNS |
chr1_897580_AT_A_b38 | SAMD11 | -3.462 | 0.000579 | -0.04802 | 160 | 0.01387 | yes | SKNS |
chr1_897792_T_TCGAA_b38 | SAMD11 | -3.449 | 0.000607 | -0.052301 | 56 | 0.015164 | yes | SKNS |
chr1_896917_CTG_C_b38 | SAMD11 | 3.449 | 0.000607 | 0.052301 | 56 | 0.015164 | yes | SKNS |
chr1_896938_C_A_b38 | SAMD11 | 3.449 | 0.000607 | 0.052301 | 56 | 0.015164 | yes | SKNS |
chr1_918425_C_T_b38 | SAMD11 | -3.432 | 0.000646 | -0.118909 | 6 | 0.034648 | yes | SKNS |
chr1_965666_ACC_A_b38 | SAMD11 | -3.42 | 0.000675 | -0.056478 | 30 | 0.016516 | yes | SKNS |
chr1_911848_C_T_b38 | SAMD11 | -3.412 | 0.000694 | -0.058096 | 22 | 0.017028 | yes | SKNS |
chr1_903723_A_G_b38 | SAMD11 | -3.406 | 0.000709 | -0.051969 | 50 | 0.015258 | yes | SKNS |
chr1_908799_AATGAGGGGCAGGGGGGAAGGGAGGG_A_b38 | SAMD11 | -3.405 | 0.000712 | -0.110399 | 11 | 0.032423 | yes | SKNS |
chr1_946653_G_A_b38 | SAMD11 | -3.391 | 0.000747 | -0.056957 | 29 | 0.016796 | yes | SKNS |
chr1_890030_G_A_b38 | SAMD11 | 3.377 | 0.000785 | 0.049418 | 70 | 0.014632 | yes | SKNS |
chr1_896798_A_G_b38 | SAMD11 | 3.37 | 0.000806 | 0.051267 | 56 | 0.015212 | yes | SKNS |
chr1_897538_T_C_b38 | SAMD11 | -3.331 | 0.000924 | -0.050388 | 59 | 0.015125 | yes | SKNS |
chr1_896680_G_A_b38 | SAMD11 | 3.326 | 0.000942 | 0.050508 | 56 | 0.015186 | yes | SKNS |
chr1_896686_G_C_b38 | SAMD11 | 3.326 | 0.000942 | 0.050508 | 56 | 0.015186 | yes | SKNS |
chr1_896732_T_C_b38 | SAMD11 | 3.326 | 0.000942 | 0.050508 | 56 | 0.015186 | yes | SKNS |
chr1_965125_G_C_b38 | SAMD11 | -3.311 | 0.000994 | -0.053978 | 35 | 0.016305 | yes | SKNS |
chr1_912111_G_A_b38 | SAMD11 | -3.306 | 0.00101 | -0.054535 | 28 | 0.016497 | yes | SKNS |
chr1_599288_T_C_b38 | SAMD11 | 3.268 | 0.00115 | 0.165182 | 3 | 0.050551 | yes | SKNS |
chr1_896529_C_T_b38 | SAMD11 | 3.225 | 0.00134 | 0.048567 | 60 | 0.015061 | yes | SKNS |
chr1_894801_A_G_b38 | SAMD11 | 3.224 | 0.00134 | 0.0485 | 52 | 0.015045 | yes | SKNS |
chr1_591658_C_T_b38 | SAMD11 | -3.215 | 0.00138 | -0.135387 | 5 | 0.042113 | yes | SKNS |
chr1_935265_T_C_b38 | SAMD11 | -3.211 | 0.0014 | -0.051006 | 45 | 0.015883 | yes | SKNS |
chr1_927003_C_T_b38 | SAMD11 | 3.202 | 0.00145 | 0.092879 | 26 | 0.029009 | yes | SKNS |
chr1_924024_C_G_b38 | SAMD11 | 3.196 | 0.00148 | 0.090142 | 27 | 0.028208 | yes | SKNS |
chr1_928216_A_AC_b38 | SAMD11 | -3.17 | 0.00161 | -0.063771 | 9 | 0.020119 | yes | SKNS |
chr1_937396_GCC_G_b38 | SAMD11 | -3.167 | 0.00163 | -0.0451 | 121 | 0.01424 | yes | SKNS |
chr1_901812_A_G_b38 | SAMD11 | -3.149 | 0.00173 | -0.075524 | 16 | 0.023982 | yes | SKNS |
chr1_903175_C_A_b38 | SAMD11 | -3.149 | 0.00173 | -0.050466 | 36 | 0.016028 | yes | SKNS |
chr1_1431026_CCACCCCCT_C_b38 | SAMD11 | 3.147 | 0.00174 | 0.053273 | 43 | 0.01693 | yes | SKNS |
chr1_926713_T_C_b38 | SAMD11 | 3.146 | 0.00175 | 0.091541 | 26 | 0.029094 | yes | SKNS |
chr1_941767_G_A_b38 | SAMD11 | -3.124 | 0.00188 | -0.052455 | 28 | 0.016793 | yes | SKNS |
chr1_911163_G_T_b38 | SAMD11 | -3.108 | 0.00198 | -0.111091 | 6 | 0.035739 | yes | SKNS |
chr1_954724_G_A_b38 | SAMD11 | -3.088 | 0.00212 | -0.052414 | 25 | 0.016974 | yes | SKNS |
chr1_914682_A_T_b38 | SAMD11 | -3.083 | 0.00216 | -0.051013 | 27 | 0.016547 | yes | SKNS |
chr1_1220305_T_C_b38 | SAMD11 | -3.076 | 0.0022 | -0.139559 | 4 | 0.045365 | yes | SKNS |
chr1_915810_G_A_b38 | SAMD11 | -3.051 | 0.00239 | -0.050254 | 27 | 0.016471 | yes | SKNS |
chr1_911085_C_T_b38 | SAMD11 | -3.046 | 0.00244 | -0.095312 | 13 | 0.031293 | yes | SKNS |
chr1_926428_A_G_b38 | SAMD11 | 3.044 | 0.00245 | 0.087774 | 26 | 0.028836 | yes | SKNS |
chr1_926744_A_G_b38 | SAMD11 | 3.044 | 0.00245 | 0.087774 | 26 | 0.028836 | yes | SKNS |
chr1_1804000_AAAAG_A_b38 | SAMD11 | 3.034 | 0.00253 | 0.132431 | 4 | 0.043648 | yes | SKNS |
chr1_596797_T_TCA_b38 | SAMD11 | -3.02 | 0.00265 | -0.078032 | 7 | 0.025835 | yes | SKNS |
chr1_1000112_G_T_b38 | SAMD11 | 3.007 | 0.00276 | 0.050562 | 48 | 0.016815 | yes | SKNS |
chr1_913076_A_G_b38 | SAMD11 | -2.995 | 0.00287 | -0.0496 | 27 | 0.016559 | yes | SKNS |
chr1_913065_G_A_b38 | SAMD11 | -2.971 | 0.0031 | -0.049197 | 27 | 0.01656 | yes | SKNS |
chr1_925081_G_A_b38 | SAMD11 | 2.962 | 0.00319 | 0.085275 | 26 | 0.028786 | yes | SKNS |
chr1_925141_C_A_b38 | SAMD11 | 2.962 | 0.00319 | 0.085275 | 26 | 0.028786 | yes | SKNS |
chr1_925628_G_C_b38 | SAMD11 | 2.959 | 0.00322 | 0.084471 | 25 | 0.028544 | yes | SKNS |
chr1_1049113_GGC_G_b38 | SAMD11 | -2.956 | 0.00325 | -0.053771 | 28 | 0.018189 | yes | SKNS |
chr1_914743_C_T_b38 | SAMD11 | -2.954 | 0.00327 | -0.050029 | 22 | 0.016935 | yes | SKNS |
chr1_1248864_T_C_b38 | SAMD11 | 2.947 | 0.00335 | 0.059986 | 18 | 0.020353 | yes | SKNS |
chr1_1018572_G_A_b38 | SAMD11 | 2.937 | 0.00346 | 0.041828 | 156 | 0.014243 | yes | SKNS |
chr1_912710_G_A_b38 | SAMD11 | -2.936 | 0.00347 | -0.049684 | 22 | 0.016924 | yes | SKNS |
chr1_913358_C_T_b38 | SAMD11 | -2.936 | 0.00347 | -0.049684 | 22 | 0.016924 | yes | SKNS |
chr1_899452_G_C_b38 | SAMD11 | -2.918 | 0.00367 | -0.046561 | 41 | 0.015954 | yes | SKNS |
chr1_1000079_A_G_b38 | SAMD11 | 2.903 | 0.00385 | 0.048897 | 47 | 0.016843 | yes | SKNS |
chr1_919049_G_A_b38 | SAMD11 | -2.902 | 0.00386 | -0.100757 | 6 | 0.034715 | yes | SKNS |
chr1_906677_A_AAACTCAGCTGCCTCTCCCCTTC_b38 | SAMD11 | -2.902 | 0.00386 | -0.044369 | 55 | 0.015288 | yes | SKNS |
chr1_629626_T_C_b38 | SAMD11 | -2.884 | 0.00408 | -0.08416 | 5 | 0.029178 | yes | SKNS |
chr1_914483_G_GACTGCCCAGCTC_b38 | SAMD11 | -2.881 | 0.00412 | -0.048587 | 25 | 0.016864 | yes | SKNS |
chr1_641308_G_A_b38 | SAMD11 | -2.874 | 0.00421 | -0.064085 | 13 | 0.022296 | yes | SKNS |
chr1_929839_G_A_b38 | SAMD11 | -2.86 | 0.0044 | -0.049604 | 20 | 0.017343 | yes | SKNS |
chr1_979472_G_C_b38 | SAMD11 | 2.841 | 0.00467 | 0.039291 | 133 | 0.013831 | yes | SKNS |
chr1_940296_GCC_G_b38 | SAMD11 | 2.835 | 0.00476 | 0.03924 | 100 | 0.013843 | yes | SKNS |
chr1_1290430_C_CGG_b38 | SAMD11 | -2.829 | 0.00484 | -0.145959 | 3 | 0.051589 | yes | SKNS |
chr1_984121_G_T_b38 | SAMD11 | 2.82 | 0.00498 | 0.038611 | 154 | 0.013691 | yes | SKNS |
chr1_896109_C_T_b38 | SAMD11 | 2.816 | 0.00504 | 0.043442 | 59 | 0.015427 | yes | SKNS |
chr1_922660_C_A_b38 | SAMD11 | -2.81 | 0.00514 | -0.049435 | 18 | 0.017594 | yes | SKNS |
chr1_917284_C_T_b38 | SAMD11 | -2.804 | 0.00523 | -0.047541 | 22 | 0.016953 | yes | SKNS |
chr1_922671_C_T_b38 | SAMD11 | -2.792 | 0.00543 | -0.048751 | 19 | 0.017462 | yes | SKNS |
chr1_918870_A_G_b38 | SAMD11 | -2.781 | 0.00561 | -0.045879 | 27 | 0.016497 | yes | SKNS |
chr1_813978_C_T_b38 | SAMD11 | -2.77 | 0.00581 | -0.04997 | 31 | 0.018042 | yes | SKNS |
chr1_915824_G_C_b38 | SAMD11 | -2.768 | 0.00584 | -0.044948 | 34 | 0.01624 | yes | SKNS |
chr1_1067054_C_T_b38 | SAMD11 | 2.759 | 0.00601 | 0.038186 | 115 | 0.013843 | yes | SKNS |
chr1_898444_T_C_b38 | SAMD11 | -2.758 | 0.00601 | -0.043616 | 43 | 0.015813 | yes | SKNS |
chr1_928252_C_T_b38 | SAMD11 | -2.758 | 0.00602 | -0.06693 | 24 | 0.024269 | yes | SKNS |
chr1_897843_C_T_b38 | SAMD11 | -2.752 | 0.00612 | -0.043542 | 43 | 0.01582 | yes | SKNS |
chr1_897922_C_T_b38 | SAMD11 | -2.752 | 0.00612 | -0.043542 | 43 | 0.01582 | yes | SKNS |
chr1_913274_TG_T_b38 | SAMD11 | -2.749 | 0.00619 | -0.048142 | 19 | 0.017515 | yes | SKNS |
chr1_985123_G_A_b38 | SAMD11 | -2.745 | 0.00625 | -0.052069 | 12 | 0.018969 | yes | SKNS |
chr1_1023775_G_A_b38 | SAMD11 | 2.737 | 0.00641 | 0.037514 | 158 | 0.013706 | yes | SKNS |
chr1_1175206_T_C_b38 | SAMD11 | 2.737 | 0.00642 | 0.040851 | 124 | 0.014928 | yes | SKNS |
chr1_1340811_GCACACACCTGCA_G_b38 | SAMD11 | 2.731 | 0.00653 | 0.103084 | 5 | 0.037751 | yes | SKNS |
chr1_1019790_G_A_b38 | SAMD11 | -2.723 | 0.00668 | -0.075249 | 3 | 0.027635 | yes | SKNS |
chr1_641263_G_A_b38 | SAMD11 | -2.702 | 0.00711 | -0.058772 | 13 | 0.021751 | yes | SKNS |
chr1_917378_G_C_b38 | SAMD11 | -2.693 | 0.0073 | -0.047389 | 18 | 0.017597 | yes | SKNS |
chr1_657467_G_A_b38 | SAMD11 | -2.693 | 0.0073 | -0.05945 | 4 | 0.022076 | yes | SKNS |
chr1_925398_A_G_b38 | SAMD11 | 2.691 | 0.00734 | 0.076786 | 24 | 0.028533 | yes | SKNS |
chr1_1000453_C_G_b38 | SAMD11 | 2.681 | 0.00756 | 0.04502 | 48 | 0.01679 | yes | SKNS |
chr1_917859_A_G_b38 | SAMD11 | -2.672 | 0.00776 | -0.04636 | 20 | 0.017348 | yes | SKNS |
chr1_1086657_C_T_b38 | SAMD11 | 2.665 | 0.00794 | 0.035411 | 126 | 0.013289 | yes | SKNS |
chr1_925408_TTGG_T_b38 | SAMD11 | 2.664 | 0.00795 | 0.076567 | 24 | 0.028739 | yes | SKNS |
chr1_925412_CGCCTGCG_C_b38 | SAMD11 | 2.664 | 0.00795 | 0.076567 | 24 | 0.028739 | yes | SKNS |
chr1_927744_G_T_b38 | SAMD11 | 2.651 | 0.00826 | 0.077895 | 27 | 0.029381 | yes | SKNS |
chr1_657478_C_A_b38 | SAMD11 | -2.647 | 0.00836 | -0.057653 | 4 | 0.021779 | yes | SKNS |
chr1_932255_C_T_b38 | SAMD11 | -2.643 | 0.00846 | -0.045782 | 20 | 0.017323 | yes | SKNS |
chr1_898261_T_C_b38 | SAMD11 | -2.638 | 0.0086 | -0.041362 | 44 | 0.015682 | yes | SKNS |
chr1_898279_T_A_b38 | SAMD11 | -2.638 | 0.0086 | -0.041362 | 44 | 0.015682 | yes | SKNS |
chr1_898283_A_G_b38 | SAMD11 | -2.638 | 0.0086 | -0.041362 | 44 | 0.015682 | yes | SKNS |
chr1_985260_C_T_b38 | SAMD11 | -2.632 | 0.00875 | -0.047152 | 14 | 0.017918 | yes | SKNS |
chr1_1331045_G_A_b38 | SAMD11 | 2.631 | 0.00876 | 0.085672 | 3 | 0.032564 | yes | SKNS |
chr1_1375788_G_C_b38 | SAMD11 | 2.617 | 0.00911 | 0.089589 | 3 | 0.034229 | yes | SKNS |
chr1_1381507_G_A_b38 | SAMD11 | 2.617 | 0.00911 | 0.089589 | 3 | 0.034229 | yes | SKNS |
chr1_1382885_A_G_b38 | SAMD11 | 2.617 | 0.00911 | 0.089589 | 3 | 0.034229 | yes | SKNS |
chr1_1579410_AT_A_b38 | SAMD11 | 2.617 | 0.00912 | 0.044265 | 41 | 0.016914 | yes | SKNS |
chr1_928622_G_C_b38 | SAMD11 | -2.612 | 0.00926 | -0.045169 | 20 | 0.017294 | yes | SKNS |
chr1_966227_C_G_b38 | SAMD11 | 2.604 | 0.00948 | 0.069792 | 9 | 0.026807 | yes | SKNS |
chr1_1342269_G_T_b38 | SAMD11 | 2.598 | 0.00964 | 0.083639 | 3 | 0.032196 | yes | SKNS |
chr1_624836_G_A_b38 | SAMD11 | -2.594 | 0.00975 | -0.092048 | 3 | 0.035486 | yes | SKNS |
chr1_933601_C_T_b38 | SAMD11 | 3.92 | 1e-04 | 0.113394 | 30 | 0.028927 | no | SKNS |
chr1_1427029_G_A_b38 | SAMD11 | 3.512 | 0.000482 | 0.124051 | 4 | 0.035321 | no | SKNS |
chr1_973929_T_C_b38 | SAMD11 | -3.446 | 0.000613 | -0.058208 | 26 | 0.01689 | no | SKNS |
chr1_263934_GC_G_b38 | SAMD11 | -3.402 | 0.00072 | -0.06105 | 16 | 0.017947 | no | SKNS |
chr1_969750_ATG_A_b38 | SAMD11 | 3.368 | 0.000813 | 0.047044 | 157 | 0.013969 | no | SKNS |
chr1_1194820_G_A_b38 | SAMD11 | 3.345 | 0.00088 | 0.080512 | 7 | 0.024067 | no | SKNS |
chr1_1194931_T_C_b38 | SAMD11 | 3.345 | 0.00088 | 0.080512 | 7 | 0.024067 | no | SKNS |
chr1_598934_CGG_C_b38 | SAMD11 | -3.293 | 0.00106 | -0.068651 | 4 | 0.020847 | no | SKNS |
chr1_983004_G_T_b38 | SAMD11 | 3.243 | 0.00126 | 0.044648 | 152 | 0.013769 | no | SKNS |
chr1_1199727_C_T_b38 | SAMD11 | 3.156 | 0.00169 | 0.077568 | 6 | 0.024576 | no | SKNS |
chr1_1199728_C_G_b38 | SAMD11 | 3.156 | 0.00169 | 0.077568 | 6 | 0.024576 | no | SKNS |
chr1_1315752_GAGCGAGGGAGGTGGGGGCGGGGAGGGAGGGAGGGAGGCGGGC_G_b38 | SAMD11 | -3.111 | 0.00197 | -0.053073 | 31 | 0.017061 | no | SKNS |
chr1_1181009_A_AGCCCCTGCCCCTGCCCCTGAACCC_b38 | SAMD11 | 3.081 | 0.00217 | 0.080459 | 6 | 0.026112 | no | SKNS |
chr1_969663_CAT_C_b38 | SAMD11 | -3.054 | 0.00237 | -0.050214 | 31 | 0.016441 | no | SKNS |
chr1_1288336_T_C_b38 | SAMD11 | 2.961 | 0.0032 | 0.127849 | 3 | 0.04318 | no | SKNS |
chr1_1190043_C_T_b38 | SAMD11 | 2.926 | 0.00358 | 0.066411 | 9 | 0.022696 | no | SKNS |
chr1_1028320_GC_G_b38 | SAMD11 | -2.918 | 0.00367 | -0.065804 | 15 | 0.022553 | no | SKNS |
chr1_1368178_C_CTTTTT_b38 | SAMD11 | -2.897 | 0.00392 | -0.062692 | 5 | 0.021639 | no | SKNS |
chr1_1019397_C_A_b38 | SAMD11 | 2.884 | 0.00408 | 0.041082 | 159 | 0.014243 | no | SKNS |
chr1_1198122_C_T_b38 | SAMD11 | 2.875 | 0.00419 | 0.070108 | 6 | 0.024381 | no | SKNS |
chr1_1198550_A_G_b38 | SAMD11 | 2.875 | 0.00419 | 0.070108 | 6 | 0.024381 | no | SKNS |
chr1_1198673_G_A_b38 | SAMD11 | 2.875 | 0.00419 | 0.070108 | 6 | 0.024381 | no | SKNS |
chr1_971790_AG_A_b38 | SAMD11 | -2.861 | 0.00439 | -0.039702 | 90 | 0.013876 | no | SKNS |
chr1_928141_C_G_b38 | SAMD11 | 2.859 | 0.00441 | 0.072569 | 3 | 0.025381 | no | SKNS |
chr1_1365036_T_TA_b38 | SAMD11 | 2.857 | 0.00445 | 0.092061 | 11 | 0.032227 | no | SKNS |
chr1_1025029_G_C_b38 | SAMD11 | 2.817 | 0.00503 | 0.040471 | 154 | 0.014369 | no | SKNS |
chr1_1179288_G_A_b38 | SAMD11 | 2.781 | 0.0056 | 0.066312 | 8 | 0.023841 | no | SKNS |
chr1_1017048_G_A_b38 | SAMD11 | 2.769 | 0.00581 | 0.039223 | 155 | 0.014164 | no | SKNS |
chr1_1197935_AAC_A_b38 | SAMD11 | 2.768 | 0.00583 | 0.074442 | 5 | 0.02689 | no | SKNS |
chr1_1747690_A_G_b38 | SAMD11 | -2.767 | 0.00585 | -0.104091 | 9 | 0.037618 | no | SKNS |
chr1_1023789_G_C_b38 | SAMD11 | 2.742 | 0.00631 | 0.037576 | 135 | 0.013703 | no | SKNS |
chr1_979560_T_C_b38 | SAMD11 | 2.73 | 0.00653 | 0.037777 | 140 | 0.013835 | no | SKNS |
chr1_668135_C_A_b38 | SAMD11 | 2.718 | 0.00677 | 0.128753 | 3 | 0.047363 | no | SKNS |
chr1_668136_C_A_b38 | SAMD11 | 2.705 | 0.00705 | 0.128098 | 3 | 0.047358 | no | SKNS |
chr1_1001870_C_G_b38 | SAMD11 | -2.696 | 0.00724 | -0.048459 | 15 | 0.017975 | no | SKNS |
chr1_1080336_G_A_b38 | SAMD11 | -2.695 | 0.00726 | -0.046845 | 26 | 0.017381 | no | SKNS |
chr1_1177430_G_T_b38 | SAMD11 | 2.679 | 0.00762 | 0.06376 | 8 | 0.023802 | no | SKNS |
chr1_1431450_A_G_b38 | SAMD11 | 2.65 | 0.00829 | 0.042895 | 84 | 0.016187 | no | SKNS |
chr1_978509_G_A_b38 | SAMD11 | 2.645 | 0.00841 | 0.036481 | 133 | 0.013794 | no | SKNS |
chr1_1431537_G_C_b38 | SAMD11 | 2.636 | 0.00864 | 0.042656 | 84 | 0.016184 | no | SKNS |
chr1_1419135_C_G_b38 | SAMD11 | 2.634 | 0.00868 | 0.060556 | 44 | 0.022987 | no | SKNS |
chr1_1431813_G_T_b38 | SAMD11 | 2.626 | 0.00888 | 0.047771 | 24 | 0.01819 | no | SKNS |
chr1_1032278_C_T_b38 | SAMD11 | 2.622 | 0.00899 | 0.037239 | 152 | 0.014201 | no | SKNS |
chr1_1174988_C_T_b38 | SAMD11 | 2.605 | 0.00943 | 0.061478 | 8 | 0.023596 | no | SKNS |
chr1_1175040_T_C_b38 | SAMD11 | 2.605 | 0.00943 | 0.061478 | 8 | 0.023596 | no | SKNS |
chr1_1175832_G_GAGAGGCTGCCGCTGTGCCGGTGGAGAGGCTGCCGCCGTGCAGGTGGAA_b38 | SAMD11 | 2.603 | 0.00951 | 0.066584 | 5 | 0.025585 | no | SKNS |
chr1_1339884_A_ACAGCCGCATGTCCCCCAGCAGCCCCCACAGACCCACCCGCAGCCGCATGTCCCCCAGCAGCCCCCACAGACCCACCCG_b38 | SAMD11 | 2.602 | 0.00952 | 0.103748 | 4 | 0.039868 | no | SKNS |
chr1_1452812_G_A_b38 | SAMD11 | 2.589 | 0.00988 | 0.111764 | 5 | 0.043166 | no | SKNS |
chr1_98945_C_T_b38 | SAMD11 | 3.627 | 0.000408 | 0.119596 | 23 | 0.032978 | yes | SNTTRM |
chr1_1020847_C_CGG_b38 | SAMD11 | 3.502 | 0.00063 | 0.098009 | 28 | 0.02799 | yes | SNTTRM |
chr1_285175_C_T_b38 | SAMD11 | 3.228 | 0.00157 | 0.15814 | 3 | 0.048987 | yes | SNTTRM |
chr1_1004625_A_G_b38 | SAMD11 | 3.135 | 0.00212 | 0.095957 | 27 | 0.030612 | yes | SNTTRM |
chr1_1006159_C_T_b38 | SAMD11 | 3.135 | 0.00212 | 0.095957 | 27 | 0.030612 | yes | SNTTRM |
chr1_1016184_A_G_b38 | SAMD11 | 3.048 | 0.00278 | 0.092902 | 28 | 0.030478 | yes | SNTTRM |
chr1_1002745_G_A_b38 | SAMD11 | 3.032 | 0.00292 | 0.107005 | 7 | 0.035287 | yes | SNTTRM |
chr1_1005429_C_CA_b38 | SAMD11 | 2.997 | 0.00325 | 0.091959 | 23 | 0.030684 | yes | SNTTRM |
chr1_1005904_C_T_b38 | SAMD11 | 2.997 | 0.00325 | 0.091959 | 23 | 0.030684 | yes | SNTTRM |
chr1_1005954_G_A_b38 | SAMD11 | 2.997 | 0.00325 | 0.091959 | 23 | 0.030684 | yes | SNTTRM |
chr1_1016623_G_A_b38 | SAMD11 | 2.95 | 0.00376 | 0.089246 | 23 | 0.030254 | yes | SNTTRM |
chr1_1014863_A_C_b38 | SAMD11 | 2.846 | 0.00512 | 0.086877 | 24 | 0.030521 | yes | SNTTRM |
chr1_1008307_G_C_b38 | SAMD11 | 2.842 | 0.00519 | 0.085031 | 24 | 0.029918 | yes | SNTTRM |
chr1_1009184_T_C_b38 | SAMD11 | 2.842 | 0.00519 | 0.085031 | 24 | 0.029918 | yes | SNTTRM |
chr1_994949_C_T_b38 | SAMD11 | 2.81 | 0.00571 | 0.103082 | 5 | 0.036689 | yes | SNTTRM |
chr1_994997_C_T_b38 | SAMD11 | 2.81 | 0.00571 | 0.103082 | 5 | 0.036689 | yes | SNTTRM |
chr1_995153_C_G_b38 | SAMD11 | 2.725 | 0.0073 | 0.084316 | 24 | 0.030944 | yes | SNTTRM |
chr1_1017114_A_AT_b38 | SAMD11 | 2.723 | 0.00734 | 0.088801 | 18 | 0.032616 | yes | SNTTRM |
chr1_995371_C_G_b38 | SAMD11 | 2.697 | 0.0079 | 0.082863 | 22 | 0.030724 | yes | SNTTRM |
chr1_986629_G_A_b38 | SAMD11 | 2.671 | 0.0085 | 0.099286 | 5 | 0.037168 | yes | SNTTRM |
chr1_992361_G_A_b38 | SAMD11 | 2.671 | 0.0085 | 0.099286 | 5 | 0.037168 | yes | SNTTRM |
chr1_995187_A_G_b38 | SAMD11 | 2.655 | 0.00891 | 0.08115 | 26 | 0.030569 | yes | SNTTRM |
chr1_986280_C_T_b38 | SAMD11 | 2.65 | 0.00903 | 0.098658 | 5 | 0.03723 | yes | SNTTRM |
chr1_1026830_A_G_b38 | SAMD11 | 3.903 | 0.00015 | 0.127353 | 19 | 0.032628 | no | SNTTRM |
chr1_1022518_G_T_b38 | SAMD11 | 3.859 | 0.000177 | 0.113688 | 22 | 0.029459 | no | SNTTRM |
chr1_1022868_A_G_b38 | SAMD11 | 3.599 | 0.000449 | 0.111909 | 21 | 0.031092 | no | SNTTRM |
chr1_1021740_G_C_b38 | SAMD11 | 3.598 | 0.000451 | 0.10878 | 18 | 0.03023 | no | SNTTRM |
chr1_1020681_A_AG_b38 | SAMD11 | 3.559 | 0.000517 | 0.107856 | 18 | 0.030304 | no | SNTTRM |
chr1_1018652_C_G_b38 | SAMD11 | 3.488 | 0.000661 | 0.105292 | 19 | 0.030189 | no | SNTTRM |
chr1_1018754_G_A_b38 | SAMD11 | 3.488 | 0.000661 | 0.105292 | 19 | 0.030189 | no | SNTTRM |
chr1_1034279_G_A_b38 | SAMD11 | 3.482 | 0.000673 | 0.115215 | 12 | 0.033085 | no | SNTTRM |
chr1_1020697_C_T_b38 | SAMD11 | 3.43 | 0.000804 | 0.104207 | 18 | 0.030382 | no | SNTTRM |
chr1_1023351_A_G_b38 | SAMD11 | 3.429 | 0.000806 | 0.104052 | 21 | 0.030342 | no | SNTTRM |
chr1_1023525_A_G_b38 | SAMD11 | 3.419 | 0.000836 | 0.102546 | 22 | 0.029996 | no | SNTTRM |
chr1_1020217_G_T_b38 | SAMD11 | 3.415 | 0.000847 | 0.103873 | 19 | 0.030419 | no | SNTTRM |
chr1_1023573_A_G_b38 | SAMD11 | 3.404 | 0.000878 | 0.102657 | 22 | 0.030156 | no | SNTTRM |
chr1_1025561_G_C_b38 | SAMD11 | 3.221 | 0.00161 | 0.105315 | 15 | 0.032697 | no | SNTTRM |
chr1_1025970_C_T_b38 | SAMD11 | 3.221 | 0.00161 | 0.105315 | 15 | 0.032697 | no | SNTTRM |
chr1_1026084_G_T_b38 | SAMD11 | 3.216 | 0.00163 | 0.106495 | 15 | 0.033115 | no | SNTTRM |
chr1_633423_C_T_b38 | SAMD11 | -3.158 | 0.00196 | -0.175493 | 3 | 0.055567 | no | SNTTRM |
chr1_1032846_C_A_b38 | SAMD11 | 3.015 | 0.00308 | 0.099349 | 14 | 0.032955 | no | SNTTRM |
chr1_1024462_C_T_b38 | SAMD11 | 2.991 | 0.00331 | 0.100952 | 15 | 0.033747 | no | SNTTRM |
chr1_998762_A_AGGGGAGG_b38 | SAMD11 | -2.871 | 0.00477 | -0.081603 | 32 | 0.028426 | no | SNTTRM |
chr1_997077_G_A_b38 | SAMD11 | 2.812 | 0.00567 | 0.103497 | 6 | 0.036807 | no | SNTTRM |
chr1_1004111_TG_T_b38 | SAMD11 | 2.787 | 0.00611 | 0.101197 | 6 | 0.036316 | no | SNTTRM |
chr1_1000335_C_T_b38 | SAMD11 | 2.779 | 0.00625 | 0.102345 | 6 | 0.036833 | no | SNTTRM |
chr1_1005757_AGCCCCCGCAGCAGT_A_b38 | SAMD11 | -2.778 | 0.00626 | -0.087968 | 39 | 0.031665 | no | SNTTRM |
chr1_1004716_C_T_b38 | SAMD11 | -2.753 | 0.00674 | -0.09011 | 41 | 0.032737 | no | SNTTRM |
chr1_1048791_CAG_C_b38 | SAMD11 | -2.74 | 0.00699 | -0.089065 | 35 | 0.032507 | no | SNTTRM |
chr1_799080_TG_T_b38 | SAMD11 | -2.736 | 0.00707 | -0.103989 | 6 | 0.038008 | no | SNTTRM |
chr1_996168_G_T_b38 | SAMD11 | 2.734 | 0.00712 | 0.101055 | 6 | 0.036968 | no | SNTTRM |
chr1_1434687_C_G_b38 | SAMD11 | -2.715 | 0.00751 | -0.118398 | 4 | 0.043613 | no | SNTTRM |
chr1_999842_C_A_b38 | SAMD11 | -2.706 | 0.0077 | -0.088568 | 47 | 0.032731 | no | SNTTRM |
chr1_1008588_C_T_b38 | SAMD11 | -2.676 | 0.00839 | -0.085292 | 45 | 0.031876 | no | SNTTRM |
chr1_1439805_G_C_b38 | SAMD11 | -2.62 | 0.00982 | -0.101973 | 8 | 0.038926 | no | SNTTRM |
chr1_1864334_AAAG_A_b38 | SAMD11 | -3.459 | 0.000671 | -0.133392 | 15 | 0.03856 | yes | SPLEEN |
chr1_789481_G_A_b38 | SAMD11 | -3.246 | 0.00139 | -0.164111 | 3 | 0.050557 | yes | SPLEEN |
chr1_689962_C_T_b38 | SAMD11 | 3.091 | 0.0023 | 0.124384 | 7 | 0.040238 | yes | SPLEEN |
chr1_1351587_A_G_b38 | SAMD11 | 3.062 | 0.00253 | 0.238707 | 3 | 0.077961 | yes | SPLEEN |
chr1_288130_T_C_b38 | SAMD11 | -2.945 | 0.00364 | -0.121771 | 8 | 0.041343 | yes | SPLEEN |
chr1_626516_A_AT_b38 | SAMD11 | 2.896 | 0.00424 | 0.154402 | 7 | 0.053325 | yes | SPLEEN |
chr1_94134_C_T_b38 | SAMD11 | 2.805 | 0.00557 | 0.130874 | 4 | 0.046666 | yes | SPLEEN |
chr1_1129155_G_C_b38 | SAMD11 | -2.785 | 0.00591 | -0.099189 | 17 | 0.035621 | yes | SPLEEN |
chr1_1497606_C_G_b38 | SAMD11 | -2.765 | 0.00627 | -0.119238 | 9 | 0.043129 | yes | SPLEEN |
chr1_94321_C_T_b38 | SAMD11 | 2.68 | 0.00802 | 0.126489 | 3 | 0.047197 | yes | SPLEEN |
chr1_1423775_C_CT_b38 | SAMD11 | 2.621 | 0.00949 | 0.129873 | 9 | 0.04955 | yes | SPLEEN |
chr1_591658_C_T_b38 | SAMD11 | -2.619 | 0.00954 | -0.198906 | 3 | 0.07594 | yes | SPLEEN |
chr1_1279694_A_G_b38 | SAMD11 | -2.613 | 0.0097 | -0.117127 | 13 | 0.04482 | yes | SPLEEN |
chr1_1279698_A_G_b38 | SAMD11 | -2.613 | 0.0097 | -0.117127 | 13 | 0.04482 | yes | SPLEEN |
chr1_1279728_TG_T_b38 | SAMD11 | -2.613 | 0.0097 | -0.117127 | 13 | 0.04482 | yes | SPLEEN |
chr1_610933_G_A_b38 | SAMD11 | 3.4 | 0.000825 | 0.191424 | 3 | 0.056304 | no | SPLEEN |
chr1_1835922_G_GAAA_b38 | SAMD11 | -3.256 | 0.00134 | -0.266253 | 3 | 0.08178 | no | SPLEEN |
chr1_591689_C_A_b38 | SAMD11 | 3.143 | 0.00195 | 0.140352 | 8 | 0.044655 | no | SPLEEN |
chr1_590217_C_A_b38 | SAMD11 | 3.069 | 0.00247 | 0.159865 | 4 | 0.052086 | no | SPLEEN |
chr1_1519934_T_G_b38 | SAMD11 | -2.822 | 0.00529 | -0.105558 | 44 | 0.037404 | no | SPLEEN |
chr1_1519938_T_C_b38 | SAMD11 | -2.822 | 0.00529 | -0.105558 | 44 | 0.037404 | no | SPLEEN |
chr1_1494105_G_A_b38 | SAMD11 | 2.822 | 0.0053 | 0.21029 | 5 | 0.074527 | no | SPLEEN |
chr1_1495236_T_C_b38 | SAMD11 | 2.822 | 0.0053 | 0.21029 | 5 | 0.074527 | no | SPLEEN |
chr1_1277830_C_CA_b38 | SAMD11 | -2.797 | 0.0057 | -0.132306 | 5 | 0.0473 | no | SPLEEN |
chr1_1517993_A_G_b38 | SAMD11 | -2.735 | 0.00684 | -0.102484 | 44 | 0.037468 | no | SPLEEN |
chr1_1690745_G_GA_b38 | SAMD11 | -2.65 | 0.00875 | -0.22564 | 3 | 0.08516 | no | SPLEEN |
chr1_1897190_CT_C_b38 | SAMD11 | 2.643 | 0.00891 | 0.114186 | 4 | 0.043197 | no | SPLEEN |
chr1_858049_T_C_b38 | SAMD11 | 2.642 | 0.00894 | 0.107771 | 40 | 0.040789 | no | SPLEEN |
chr1_1471992_T_C_b38 | SAMD11 | -2.632 | 0.00919 | -0.103352 | 37 | 0.03926 | no | SPLEEN |
chr1_929375_A_G_b38 | SAMD11 | 2.609 | 0.00982 | 0.210157 | 9 | 0.080555 | no | SPLEEN |
chr1_929377_G_A_b38 | SAMD11 | 2.609 | 0.00982 | 0.210157 | 9 | 0.080555 | no | SPLEEN |
chr1_1549967_C_G_b38 | SAMD11 | -3.502 | 0.000542 | -0.118883 | 19 | 0.033951 | yes | STMACH |
chr1_1028979_GCCACGCCACCCTCTCCCAAGGAACCGAGCCCCAGCCCCTCGTGGGCCAAGGGCGCCCACAC_G_b38 | SAMD11 | 3 | 0.00295 | 0.152704 | 4 | 0.050893 | yes | STMACH |
chr1_596700_T_C_b38 | SAMD11 | 2.87 | 0.00443 | 0.112614 | 11 | 0.039239 | yes | STMACH |
chr1_1292284_TTGAG_T_b38 | SAMD11 | -2.808 | 0.00535 | -0.121979 | 16 | 0.043435 | yes | STMACH |
chr1_596797_T_TCA_b38 | SAMD11 | 2.792 | 0.00562 | 0.144892 | 6 | 0.051901 | yes | STMACH |
chr1_1530555_C_T_b38 | SAMD11 | -2.769 | 0.00601 | -0.173082 | 5 | 0.062502 | yes | STMACH |
chr1_1495327_C_T_b38 | SAMD11 | -2.75 | 0.00637 | -0.195847 | 3 | 0.071222 | yes | STMACH |
chr1_1306149_A_G_b38 | SAMD11 | 2.706 | 0.00724 | 0.151178 | 3 | 0.055861 | yes | STMACH |
chr1_1554290_C_T_b38 | SAMD11 | -2.684 | 0.00773 | -0.087963 | 27 | 0.032772 | yes | STMACH |
chr1_98929_A_G_b38 | SAMD11 | -2.648 | 0.00858 | -0.116577 | 5 | 0.044028 | yes | STMACH |
chr1_601606_G_T_b38 | SAMD11 | 2.635 | 0.0089 | 0.096626 | 10 | 0.03667 | yes | STMACH |
chr1_1375788_G_C_b38 | SAMD11 | -2.621 | 0.00928 | -0.173973 | 3 | 0.066389 | yes | STMACH |
chr1_1381507_G_A_b38 | SAMD11 | -2.621 | 0.00928 | -0.173973 | 3 | 0.066389 | yes | STMACH |
chr1_1382885_A_G_b38 | SAMD11 | -2.621 | 0.00928 | -0.173973 | 3 | 0.066389 | yes | STMACH |
chr1_857809_G_A_b38 | SAMD11 | 2.602 | 0.00979 | 0.127701 | 9 | 0.049084 | yes | STMACH |
chr1_1588220_CT_C_b38 | SAMD11 | -3.019 | 0.00278 | -0.095256 | 28 | 0.031555 | no | STMACH |
chr1_1558347_G_A_b38 | SAMD11 | -3.006 | 0.0029 | -0.102909 | 22 | 0.03424 | no | STMACH |
chr1_1431813_G_T_b38 | SAMD11 | -2.965 | 0.0033 | -0.114442 | 11 | 0.038596 | no | STMACH |
chr1_1343267_C_A_b38 | SAMD11 | -2.95 | 0.00346 | -0.178805 | 4 | 0.060615 | no | STMACH |
chr1_1597462_C_T_b38 | SAMD11 | -2.926 | 0.00372 | -0.112262 | 14 | 0.038362 | no | STMACH |
chr1_1441187_A_G_b38 | SAMD11 | -2.913 | 0.00389 | -0.107732 | 24 | 0.036988 | no | STMACH |
chr1_1545795_C_A_b38 | SAMD11 | -2.762 | 0.00615 | -0.092359 | 35 | 0.033443 | no | STMACH |
chr1_1442793_G_A_b38 | SAMD11 | -2.746 | 0.00644 | -0.116614 | 5 | 0.042469 | no | STMACH |
chr1_15211_T_G_b38 | SAMD11 | 2.735 | 0.00665 | 0.120642 | 13 | 0.04411 | no | STMACH |
chr1_1436388_CA_C_b38 | SAMD11 | -2.734 | 0.00667 | -0.099882 | 25 | 0.03653 | no | STMACH |
chr1_1589151_C_T_b38 | SAMD11 | -2.723 | 0.00689 | -0.085496 | 33 | 0.031398 | no | STMACH |
chr1_1116728_A_G_b38 | SAMD11 | -2.705 | 0.00727 | -0.159512 | 4 | 0.058975 | no | STMACH |
chr1_1367498_T_C_b38 | SAMD11 | -2.693 | 0.00752 | -0.175516 | 3 | 0.06517 | no | STMACH |
chr1_1113260_C_A_b38 | SAMD11 | -2.676 | 0.0079 | -0.15682 | 4 | 0.058597 | no | STMACH |
chr1_1364223_G_A_b38 | SAMD11 | -2.653 | 0.00845 | -0.17352 | 3 | 0.065404 | no | STMACH |
chr1_1366030_CTGTG_C_b38 | SAMD11 | -2.653 | 0.00845 | -0.17352 | 3 | 0.065404 | no | STMACH |
chr1_1120062_A_G_b38 | SAMD11 | -2.638 | 0.00882 | -0.151084 | 6 | 0.057262 | no | STMACH |
chr1_1495236_T_C_b38 | SAMD11 | -2.599 | 0.00986 | -0.180642 | 3 | 0.069495 | no | STMACH |
chr1_48067_C_T_b38 | SAMD11 | 3.422 | 0.000718 | 0.107781 | 3 | 0.031493 | yes | TESTIS |
chr1_1530585_T_G_b38 | SAMD11 | -3.412 | 0.000744 | -0.127668 | 6 | 0.037413 | yes | TESTIS |
chr1_979472_G_C_b38 | SAMD11 | 3.397 | 0.000785 | 0.048777 | 70 | 0.014359 | yes | TESTIS |
chr1_63697_T_C_b38 | SAMD11 | 3.351 | 0.000921 | 0.058682 | 17 | 0.017511 | yes | TESTIS |
chr1_598862_C_T_b38 | SAMD11 | 3.311 | 0.00106 | 0.068261 | 3 | 0.020616 | yes | TESTIS |
chr1_1113195_CA_C_b38 | SAMD11 | -3.226 | 0.00141 | -0.053165 | 33 | 0.016479 | yes | TESTIS |
chr1_978509_G_A_b38 | SAMD11 | 3.192 | 0.00158 | 0.045978 | 69 | 0.014406 | yes | TESTIS |
chr1_979560_T_C_b38 | SAMD11 | 3.19 | 0.00159 | 0.046578 | 73 | 0.014602 | yes | TESTIS |
chr1_978953_C_G_b38 | SAMD11 | 3.108 | 0.00209 | 0.045014 | 64 | 0.014483 | yes | TESTIS |
chr1_983004_G_T_b38 | SAMD11 | 3.053 | 0.0025 | 0.044799 | 78 | 0.014675 | yes | TESTIS |
chr1_983193_A_G_b38 | SAMD11 | 3.008 | 0.00288 | 0.044365 | 67 | 0.014749 | yes | TESTIS |
chr1_1592964_C_T_b38 | SAMD11 | 2.99 | 0.00305 | 0.080421 | 3 | 0.026899 | yes | TESTIS |
chr1_981454_G_A_b38 | SAMD11 | 2.976 | 0.00319 | 0.043688 | 67 | 0.014681 | yes | TESTIS |
chr1_1812407_T_TAC_b38 | SAMD11 | 2.863 | 0.00452 | 0.059793 | 9 | 0.020881 | yes | TESTIS |
chr1_1050066_G_T_b38 | SAMD11 | 2.846 | 0.00476 | 0.04707 | 38 | 0.016537 | yes | TESTIS |
chr1_1461195_T_TC_b38 | SAMD11 | -2.822 | 0.00513 | -0.10828 | 6 | 0.038372 | yes | TESTIS |
chr1_1083182_C_T_b38 | SAMD11 | 2.791 | 0.00564 | 0.041213 | 76 | 0.014768 | yes | TESTIS |
chr1_202496_T_A_b38 | SAMD11 | -2.752 | 0.00633 | -0.042792 | 49 | 0.015549 | yes | TESTIS |
chr1_1749605_C_CGTCCATGCATATTTTTCTGTGTGATGTGTCTGTGTGTGTGTCTCAGTGGT_b38 | SAMD11 | 2.72 | 0.00695 | 0.034686 | 34 | 0.012751 | yes | TESTIS |
chr1_1082764_T_C_b38 | SAMD11 | 2.711 | 0.00714 | 0.039674 | 74 | 0.014633 | yes | TESTIS |
chr1_1657902_T_TA_b38 | SAMD11 | 2.709 | 0.00719 | 0.065396 | 9 | 0.024142 | yes | TESTIS |
chr1_1715553_G_A_b38 | SAMD11 | 2.646 | 0.00863 | 0.065197 | 16 | 0.02464 | yes | TESTIS |
chr1_1734301_T_C_b38 | SAMD11 | 2.636 | 0.00889 | 0.066958 | 6 | 0.025405 | yes | TESTIS |
chr1_207150_T_G_b38 | SAMD11 | 3.214 | 0.00147 | 0.061676 | 9 | 0.019187 | no | TESTIS |
chr1_63671_G_A_b38 | SAMD11 | 3.105 | 0.00211 | 0.057376 | 14 | 0.018481 | no | TESTIS |
chr1_57856_T_A_b38 | SAMD11 | -2.998 | 0.00297 | -0.048465 | 61 | 0.016166 | no | TESTIS |
chr1_1714674_G_C_b38 | SAMD11 | 2.954 | 0.00342 | 0.063539 | 18 | 0.021511 | no | TESTIS |
chr1_959193_G_A_b38 | SAMD11 | 2.953 | 0.00343 | 0.072343 | 19 | 0.024501 | no | TESTIS |
chr1_1000079_A_G_b38 | SAMD11 | 2.892 | 0.00414 | 0.052779 | 21 | 0.01825 | no | TESTIS |
chr1_857809_G_A_b38 | SAMD11 | 2.858 | 0.0046 | 0.070699 | 9 | 0.024736 | no | TESTIS |
chr1_940263_C_G_b38 | SAMD11 | 2.835 | 0.00494 | 0.054867 | 11 | 0.019356 | no | TESTIS |
chr1_1153397_T_C_b38 | SAMD11 | 2.817 | 0.00522 | 0.097813 | 3 | 0.034728 | no | TESTIS |
chr1_951408_G_A_b38 | SAMD11 | 2.815 | 0.00525 | 0.066404 | 10 | 0.023592 | no | TESTIS |
chr1_951437_C_T_b38 | SAMD11 | 2.815 | 0.00525 | 0.066404 | 10 | 0.023592 | no | TESTIS |
chr1_61851_T_A_b38 | SAMD11 | -2.778 | 0.00586 | -0.042736 | 58 | 0.015384 | no | TESTIS |
chr1_975014_C_T_b38 | SAMD11 | -2.712 | 0.00712 | -0.04068 | 43 | 0.014998 | no | TESTIS |
chr1_984121_G_T_b38 | SAMD11 | 2.712 | 0.00712 | 0.040126 | 76 | 0.014795 | no | TESTIS |
chr1_1708521_C_G_b38 | SAMD11 | -2.691 | 0.00758 | -0.047618 | 16 | 0.017696 | no | TESTIS |
chr1_966179_G_A_b38 | SAMD11 | 2.635 | 0.0089 | 0.065115 | 18 | 0.024711 | no | TESTIS |
chr1_958339_G_A_b38 | SAMD11 | 2.629 | 0.00907 | 0.074402 | 3 | 0.028304 | no | TESTIS |
chr1_961945_G_C_b38 | SAMD11 | 2.611 | 0.00954 | 0.07673 | 3 | 0.029386 | no | TESTIS |
chr1_1684789_C_CAAAA_b38 | SAMD11 | 3.401 | 0.000725 | 0.156982 | 12 | 0.046161 | yes | THYROID |
chr1_187323_G_A_b38 | SAMD11 | 3.188 | 0.00152 | 0.101755 | 4 | 0.031922 | yes | THYROID |
chr1_710225_T_A_b38 | SAMD11 | -2.84 | 0.00469 | -0.1315 | 5 | 0.046303 | yes | THYROID |
chr1_1480778_T_C_b38 | SAMD11 | -2.717 | 0.00682 | -0.178775 | 4 | 0.065809 | yes | THYROID |
chr1_1650405_G_A_b38 | SAMD11 | 2.71 | 0.00696 | 0.125843 | 10 | 0.046436 | yes | THYROID |
chr1_1423775_C_CT_b38 | SAMD11 | 2.678 | 0.00764 | 0.09234 | 18 | 0.034478 | yes | THYROID |
chr1_1763634_AAG_A_b38 | SAMD11 | 2.665 | 0.00795 | 0.066469 | 99 | 0.024942 | yes | THYROID |
chr1_1049115_C_G_b38 | SAMD11 | 2.661 | 0.00804 | 0.112783 | 10 | 0.042382 | yes | THYROID |
chr1_1624723_C_T_b38 | SAMD11 | -3.655 | 0.000284 | -0.108975 | 15 | 0.029816 | no | THYROID |
chr1_1627156_G_A_b38 | SAMD11 | -3.315 | 0.000982 | -0.114596 | 10 | 0.034568 | no | THYROID |
chr1_869213_TA_T_b38 | SAMD11 | -3.275 | 0.00113 | -0.119595 | 4 | 0.036521 | no | THYROID |
chr1_1595366_G_C_b38 | SAMD11 | -3.228 | 0.00133 | -0.096601 | 10 | 0.029924 | no | THYROID |
chr1_1609890_C_T_b38 | SAMD11 | -3.171 | 0.00161 | -0.107224 | 12 | 0.033811 | no | THYROID |
chr1_1585372_T_A_b38 | SAMD11 | -3.155 | 0.0017 | -0.107919 | 10 | 0.034209 | no | THYROID |
chr1_1590785_G_A_b38 | SAMD11 | -3.102 | 0.00203 | -0.106264 | 10 | 0.034256 | no | THYROID |
chr1_1585717_C_A_b38 | SAMD11 | -3.06 | 0.00233 | -0.107781 | 10 | 0.035226 | no | THYROID |
chr1_1590792_C_T_b38 | SAMD11 | -2.961 | 0.00321 | -0.106255 | 9 | 0.035881 | no | THYROID |
chr1_1586215_A_G_b38 | SAMD11 | -2.93 | 0.00355 | -0.102526 | 10 | 0.034997 | no | THYROID |
chr1_1585173_C_T_b38 | SAMD11 | -2.819 | 0.005 | -0.097387 | 11 | 0.034544 | no | THYROID |
chr1_1725582_T_C_b38 | SAMD11 | 2.787 | 0.00552 | 0.056334 | 125 | 0.020212 | no | THYROID |
chr1_657643_A_C_b38 | SAMD11 | -2.723 | 0.00669 | -0.201437 | 3 | 0.073965 | no | THYROID |
chr1_1630685_AG_A_b38 | SAMD11 | 2.692 | 0.00735 | 0.075409 | 20 | 0.028016 | no | THYROID |
chr1_1668373_C_T_b38 | SAMD11 | -2.681 | 0.00758 | -0.073037 | 56 | 0.027243 | no | THYROID |
chr1_1041126_AGCGGGGGC_A_b38 | SAMD11 | 2.666 | 0.00791 | 0.047728 | 50 | 0.0179 | no | THYROID |
chr1_1663513_C_T_b38 | SAMD11 | 2.659 | 0.00809 | 0.158214 | 10 | 0.059507 | no | THYROID |
chr1_1660683_C_T_b38 | SAMD11 | 2.65 | 0.0083 | 0.069049 | 35 | 0.026053 | no | THYROID |
chr1_19583_A_G_b38 | SAMD11 | 2.638 | 0.0086 | 0.079403 | 15 | 0.0301 | no | THYROID |
chr1_1684817_G_C_b38 | SAMD11 | 2.632 | 0.00875 | 0.062115 | 89 | 0.023601 | no | THYROID |
chr1_1661169_C_A_b38 | SAMD11 | 2.61 | 0.00932 | 0.065606 | 48 | 0.025137 | no | THYROID |
chr1_1002415_C_CATTT_b38 | SAMD11 | 3.037 | 0.00302 | 0.309844 | 10 | 0.102035 | yes | UTERUS |
chr1_1571244_CAAAAAAAAAAAAAAAAAA_C_b38 | SAMD11 | -3.029 | 0.0031 | -0.426688 | 7 | 0.140884 | yes | UTERUS |
chr1_790933_CGAATGGAATG_C_b38 | SAMD11 | 2.679 | 0.00859 | 0.269343 | 9 | 0.10055 | yes | UTERUS |
chr1_928261_G_A_b38 | SAMD11 | -2.666 | 0.0089 | -0.33513 | 4 | 0.125697 | yes | UTERUS |
chr1_940263_C_G_b38 | SAMD11 | -3.09 | 0.00257 | -0.346593 | 6 | 0.112168 | no | UTERUS |
chr1_1308548_G_GT_b38 | SAMD11 | 3.012 | 0.00326 | 0.507417 | 3 | 0.168477 | no | UTERUS |
chr1_1207724_C_T_b38 | SAMD11 | -2.972 | 0.00368 | -0.40831 | 3 | 0.137399 | no | UTERUS |
chr1_937404_C_A_b38 | SAMD11 | -3.414 | 0.000882 | -0.474939 | 3 | 0.139104 | yes | VAGINA |
chr1_1763636_G_A_b38 | SAMD11 | 2.856 | 0.00509 | 0.20421 | 14 | 0.071505 | yes | VAGINA |
chr1_1585973_T_A_b38 | SAMD11 | -2.848 | 0.0052 | -0.348031 | 4 | 0.122184 | yes | VAGINA |
chr1_623755_T_G_b38 | SAMD11 | -2.78 | 0.00634 | -0.380387 | 3 | 0.13681 | yes | VAGINA |
chr1_1606099_G_GGTCAGGCGAGGGGTC_b38 | SAMD11 | 2.695 | 0.00808 | 0.207259 | 10 | 0.076893 | yes | VAGINA |
chr1_601606_G_T_b38 | SAMD11 | -2.683 | 0.00835 | -0.226481 | 4 | 0.084402 | yes | VAGINA |
chr1_1194820_G_A_b38 | SAMD11 | 2.661 | 0.0089 | 0.2951 | 3 | 0.110904 | yes | VAGINA |
chr1_39015_A_C_b38 | SAMD11 | -3.879 | 0.000175 | -0.353381 | 4 | 0.091112 | no | VAGINA |
chr1_1763634_AAG_A_b38 | SAMD11 | -2.877 | 0.00478 | -0.20568 | 24 | 0.071493 | no | VAGINA |
chr1_1479324_C_G_b38 | SAMD11 | -2.794 | 0.0061 | -0.436432 | 3 | 0.156228 | no | VAGINA |
chr1_1680672_C_T_b38 | SAMD11 | -2.784 | 0.00627 | -0.185927 | 30 | 0.066788 | no | VAGINA |
chr1_275583_T_TTTTATTTA_b38 | SAMD11 | -2.672 | 0.00862 | -0.381274 | 3 | 0.142685 | no | VAGINA |
chr1_1170732_A_G_b38 | SAMD11 | -2.638 | 0.00948 | -0.692883 | 6 | 0.262647 | no | VAGINA |
Filters: p-Values >= and <= Betas >= and <= Statistic >= and <= Carriers >= and <=
Positions: left right Zoom: SAMD11 Other: eQTLs Region
Scaling (red=+, blue-) Colors: