SLC35E2 - solute carrier family 35 member E2A - 1p36.33

Snps	Gene	Statistic	Pvalue	Beta	Carriers	Beta_se	Linear	Tissue
chr1_1677720_T_G_b38	SLC35E2	8.404	4.31e-16	0.100957	129	0.012012	yes	ADPSBQ
chr1_1762759_A_AAATG_b38	SLC35E2	-8.4	4.45e-16	-0.179249	3	0.021339	yes	ADPSBQ
chr1_1673060_G_A_b38	SLC35E2	8.384	5.01e-16	0.101972	127	0.012162	yes	ADPSBQ
chr1_1677726_A_T_b38	SLC35E2	8.354	6.27e-16	0.10068	129	0.012051	yes	ADPSBQ
chr1_1674868_G_A_b38	SLC35E2	8.292	9.95e-16	0.100438	126	0.012112	yes	ADPSBQ
chr1_1673818_A_C_b38	SLC35E2	8.273	1.15e-15	0.100134	128	0.012104	yes	ADPSBQ
chr1_1674720_TGC_T_b38	SLC35E2	8.231	1.56e-15	0.100008	125	0.01215	yes	ADPSBQ
chr1_1671995_G_T_b38	SLC35E2	8.21	1.82e-15	0.098839	126	0.012039	yes	ADPSBQ
chr1_1676790_C_T_b38	SLC35E2	8.187	2.16e-15	0.097751	128	0.011939	yes	ADPSBQ
chr1_1671797_G_A_b38	SLC35E2	7.839	2.67e-14	0.096726	122	0.012339	yes	ADPSBQ
chr1_1673968_GA_G_b38	SLC35E2	7.415	5.11e-13	0.106765	52	0.014399	yes	ADPSBQ
chr1_1868925_C_T_b38	SLC35E2	-7.32	9.71e-13	-0.157322	3	0.021492	yes	ADPSBQ
chr1_1649932_C_T_b38	SLC35E2	6.559	1.33e-10	0.081802	116	0.012471	yes	ADPSBQ
chr1_1742587_G_C_b38	SLC35E2	6.458	2.48e-10	0.080942	133	0.012534	yes	ADPSBQ
chr1_1648736_G_A_b38	SLC35E2	6.449	2.62e-10	0.081786	115	0.012683	yes	ADPSBQ
chr1_1739131_T_C_b38	SLC35E2	6.356	4.61e-10	0.079285	110	0.012475	yes	ADPSBQ
chr1_1651653_C_T_b38	SLC35E2	6.184	1.28e-09	0.077474	129	0.012529	yes	ADPSBQ
chr1_1660683_C_T_b38	SLC35E2	-6.132	1.74e-09	-0.086222	49	0.014061	yes	ADPSBQ
chr1_1658115_G_A_b38	SLC35E2	-6.117	1.9e-09	-0.155264	4	0.025382	yes	ADPSBQ
chr1_1744854_C_A_b38	SLC35E2	-6.086	2.27e-09	-0.074403	84	0.012225	yes	ADPSBQ
chr1_1671148_C_T_b38	SLC35E2	6.019	3.36e-09	0.077167	72	0.012821	yes	ADPSBQ
chr1_1708474_C_A_b38	SLC35E2	-5.915	6.1e-09	-0.096113	21	0.01625	yes	ADPSBQ
chr1_1650195_A_G_b38	SLC35E2	-5.888	7.1e-09	-0.078109	67	0.013266	yes	ADPSBQ
chr1_1744652_C_T_b38	SLC35E2	-5.882	7.36e-09	-0.07598	108	0.012918	yes	ADPSBQ
chr1_1743586_T_TAC_b38	SLC35E2	-5.853	8.66e-09	-0.079438	73	0.013573	yes	ADPSBQ
chr1_1722626_AGCG_A_b38	SLC35E2	5.752	1.52e-08	0.091909	46	0.015979	yes	ADPSBQ
chr1_1722625_A_T_b38	SLC35E2	5.676	2.32e-08	0.090933	46	0.016021	yes	ADPSBQ
chr1_1671097_G_C_b38	SLC35E2	5.675	2.33e-08	0.072748	74	0.012819	yes	ADPSBQ
chr1_1670423_AT_A_b38	SLC35E2	5.662	2.5e-08	0.08452	61	0.014927	yes	ADPSBQ
chr1_1692286_C_A_b38	SLC35E2	5.657	2.57e-08	0.108077	6	0.019105	yes	ADPSBQ
chr1_1661420_C_A_b38	SLC35E2	-5.636	2.88e-08	-0.074025	70	0.013133	yes	ADPSBQ
chr1_1659114_A_G_b38	SLC35E2	-5.629	2.99e-08	-0.073989	70	0.013144	yes	ADPSBQ
chr1_1659220_A_G_b38	SLC35E2	-5.629	2.99e-08	-0.073989	70	0.013144	yes	ADPSBQ
chr1_1661562_G_C_b38	SLC35E2	5.593	3.64e-08	0.065008	125	0.011622	yes	ADPSBQ
chr1_1675091_A_G_b38	SLC35E2	-5.586	3.78e-08	-0.08122	37	0.01454	yes	ADPSBQ
chr1_1692151_T_C_b38	SLC35E2	-5.586	3.79e-08	-0.084966	40	0.015211	yes	ADPSBQ
chr1_1658866_G_A_b38	SLC35E2	-5.585	3.81e-08	-0.073232	71	0.013113	yes	ADPSBQ
chr1_1668108_C_T_b38	SLC35E2	5.574	4.04e-08	0.073177	66	0.013128	yes	ADPSBQ
chr1_1636278_G_T_b38	SLC35E2	5.552	4.55e-08	0.072506	101	0.01306	yes	ADPSBQ
chr1_1722619_C_T_b38	SLC35E2	5.533	5.03e-08	0.08858	48	0.016009	yes	ADPSBQ
chr1_1744499_C_T_b38	SLC35E2	-5.457	7.55e-08	-0.068468	108	0.012546	yes	ADPSBQ
chr1_1750226_C_T_b38	SLC35E2	5.432	8.64e-08	0.07114	98	0.013096	yes	ADPSBQ
chr1_1658830_C_G_b38	SLC35E2	-5.41	9.69e-08	-0.079212	34	0.014641	yes	ADPSBQ
chr1_1668721_C_T_b38	SLC35E2	-5.389	1.09e-07	-0.073933	48	0.01372	yes	ADPSBQ
chr1_1667948_A_G_b38	SLC35E2	-5.368	1.21e-07	-0.080027	33	0.014908	yes	ADPSBQ
chr1_1730405_G_C_b38	SLC35E2	5.36	1.26e-07	0.075203	86	0.014029	yes	ADPSBQ
chr1_1674633_C_CA_b38	SLC35E2	5.352	1.32e-07	0.073739	62	0.013778	yes	ADPSBQ
chr1_1744028_A_AC_b38	SLC35E2	-5.346	1.36e-07	-0.090306	23	0.016891	yes	ADPSBQ
chr1_1664865_A_G_b38	SLC35E2	-5.336	1.43e-07	-0.070548	66	0.013221	yes	ADPSBQ
chr1_1747695_A_G_b38	SLC35E2	-5.283	1.89e-07	-0.058529	126	0.011079	yes	ADPSBQ
chr1_1708521_C_G_b38	SLC35E2	-5.269	2.03e-07	-0.075594	43	0.014347	yes	ADPSBQ
chr1_1743565_ATAT_A_b38	SLC35E2	-5.266	2.05e-07	-0.065601	93	0.012456	yes	ADPSBQ
chr1_1650777_G_A_b38	SLC35E2	-5.262	2.1e-07	-0.069702	66	0.013247	yes	ADPSBQ
chr1_1743886_C_T_b38	SLC35E2	-5.258	2.14e-07	-0.078233	49	0.014878	yes	ADPSBQ
chr1_1668717_C_G_b38	SLC35E2	-5.245	2.3e-07	-0.078345	33	0.014938	yes	ADPSBQ
chr1_1651137_C_T_b38	SLC35E2	-5.236	2.4e-07	-0.069456	66	0.013264	yes	ADPSBQ
chr1_1651267_T_C_b38	SLC35E2	-5.236	2.4e-07	-0.069456	66	0.013264	yes	ADPSBQ
chr1_1651574_G_A_b38	SLC35E2	-5.236	2.4e-07	-0.069456	66	0.013264	yes	ADPSBQ
chr1_1651785_C_A_b38	SLC35E2	-5.236	2.4e-07	-0.069456	66	0.013264	yes	ADPSBQ
chr1_1652061_T_C_b38	SLC35E2	-5.236	2.4e-07	-0.069456	66	0.013264	yes	ADPSBQ
chr1_1652135_C_G_b38	SLC35E2	-5.236	2.4e-07	-0.069456	66	0.013264	yes	ADPSBQ
chr1_1652191_C_T_b38	SLC35E2	-5.236	2.4e-07	-0.069456	66	0.013264	yes	ADPSBQ
chr1_1652592_A_G_b38	SLC35E2	-5.236	2.4e-07	-0.069456	66	0.013264	yes	ADPSBQ
chr1_1652779_A_G_b38	SLC35E2	-5.236	2.4e-07	-0.069456	66	0.013264	yes	ADPSBQ
chr1_1653147_A_C_b38	SLC35E2	-5.236	2.4e-07	-0.069456	66	0.013264	yes	ADPSBQ
chr1_1653396_T_C_b38	SLC35E2	-5.236	2.4e-07	-0.069456	66	0.013264	yes	ADPSBQ
chr1_1653472_T_C_b38	SLC35E2	-5.236	2.4e-07	-0.069456	66	0.013264	yes	ADPSBQ
chr1_1653811_G_A_b38	SLC35E2	-5.236	2.4e-07	-0.069456	66	0.013264	yes	ADPSBQ
chr1_1653893_C_T_b38	SLC35E2	-5.236	2.4e-07	-0.069456	66	0.013264	yes	ADPSBQ
chr1_1654143_G_A_b38	SLC35E2	-5.236	2.4e-07	-0.069456	66	0.013264	yes	ADPSBQ
chr1_1654188_T_G_b38	SLC35E2	-5.236	2.4e-07	-0.069456	66	0.013264	yes	ADPSBQ
chr1_1728671_C_A_b38	SLC35E2	5.232	2.45e-07	0.087544	25	0.016732	yes	ADPSBQ
chr1_1668542_C_T_b38	SLC35E2	-5.232	2.46e-07	-0.079383	29	0.015173	yes	ADPSBQ
chr1_1744052_GAGA_G_b38	SLC35E2	-5.227	2.51e-07	-0.084983	29	0.016257	yes	ADPSBQ
chr1_1729859_A_G_b38	SLC35E2	5.193	3e-07	0.084191	21	0.016213	yes	ADPSBQ
chr1_1651926_T_C_b38	SLC35E2	-5.191	3.03e-07	-0.068848	66	0.013263	yes	ADPSBQ
chr1_1653934_G_A_b38	SLC35E2	-5.188	3.07e-07	-0.068898	66	0.013279	yes	ADPSBQ
chr1_1646352_A_C_b38	SLC35E2	5.182	3.17e-07	0.094414	10	0.018219	yes	ADPSBQ
chr1_1757725_C_T_b38	SLC35E2	5.18	3.19e-07	0.069406	91	0.013398	yes	ADPSBQ
chr1_1654662_CT_C_b38	SLC35E2	5.179	3.22e-07	0.072949	86	0.014087	yes	ADPSBQ
chr1_1752126_G_A_b38	SLC35E2	5.166	3.44e-07	0.072964	69	0.014125	yes	ADPSBQ
chr1_1669613_G_A_b38	SLC35E2	-5.164	3.46e-07	-0.076619	34	0.014836	yes	ADPSBQ
chr1_1743851_C_T_b38	SLC35E2	-5.16	3.54e-07	-0.075508	48	0.014632	yes	ADPSBQ
chr1_1664757_T_C_b38	SLC35E2	-5.154	3.66e-07	-0.06691	65	0.012983	yes	ADPSBQ
chr1_1743840_T_C_b38	SLC35E2	-5.149	3.74e-07	-0.075759	48	0.014712	yes	ADPSBQ
chr1_1661177_A_G_b38	SLC35E2	-5.116	4.44e-07	-0.076238	33	0.014903	yes	ADPSBQ
chr1_1659060_G_A_b38	SLC35E2	-5.111	4.54e-07	-0.070482	52	0.01379	yes	ADPSBQ
chr1_1743565_AT_A_b38	SLC35E2	5.106	4.66e-07	0.060522	138	0.011853	yes	ADPSBQ
chr1_1649976_G_A_b38	SLC35E2	5.101	4.78e-07	0.065299	96	0.012802	yes	ADPSBQ
chr1_1688328_C_T_b38	SLC35E2	-5.093	4.96e-07	-0.074394	33	0.014606	yes	ADPSBQ
chr1_1665061_C_T_b38	SLC35E2	-5.09	5.03e-07	-0.075805	33	0.014892	yes	ADPSBQ
chr1_1639348_G_T_b38	SLC35E2	-5.089	5.06e-07	-0.067166	74	0.013198	yes	ADPSBQ
chr1_1749637_G_T_b38	SLC35E2	5.076	5.42e-07	0.063711	99	0.012552	yes	ADPSBQ
chr1_1669576_G_A_b38	SLC35E2	-5.071	5.55e-07	-0.075974	33	0.014982	yes	ADPSBQ
chr1_1758323_T_C_b38	SLC35E2	5.065	5.72e-07	0.064225	111	0.01268	yes	ADPSBQ
chr1_1692124_T_G_b38	SLC35E2	-5.053	6.07e-07	-0.07646	41	0.015132	yes	ADPSBQ
chr1_1651421_GTAGCCCCTCTGAACGGTCTGTGACACACGCATGCTTTCAGCTAGAGTACTCTA_G_b38	SLC35E2	-5.023	7.06e-07	-0.067356	63	0.013411	yes	ADPSBQ
chr1_1755523_C_T_b38	SLC35E2	5.002	7.84e-07	0.063129	133	0.012622	yes	ADPSBQ
chr1_1722690_TA_T_b38	SLC35E2	-5	7.92e-07	-0.099358	5	0.019873	yes	ADPSBQ
chr1_1754601_G_T_b38	SLC35E2	4.991	8.27e-07	0.06693	91	0.013411	yes	ADPSBQ
chr1_1757074_G_T_b38	SLC35E2	4.989	8.36e-07	0.06604	93	0.013238	yes	ADPSBQ
chr1_1665581_C_G_b38	SLC35E2	-4.955	9.87e-07	-0.07218	37	0.014568	yes	ADPSBQ
chr1_1648826_A_G_b38	SLC35E2	-4.92	1.17e-06	-0.065803	73	0.013376	yes	ADPSBQ
chr1_1755504_T_C_b38	SLC35E2	4.895	1.32e-06	0.062207	126	0.012709	yes	ADPSBQ
chr1_1648636_G_A_b38	SLC35E2	-4.861	1.56e-06	-0.065341	73	0.013441	yes	ADPSBQ
chr1_1756186_T_C_b38	SLC35E2	4.846	1.67e-06	0.063935	95	0.013193	yes	ADPSBQ
chr1_1750508_A_C_b38	SLC35E2	-4.826	1.84e-06	-0.055995	123	0.011602	yes	ADPSBQ
chr1_1637577_T_C_b38	SLC35E2	-4.796	2.13e-06	-0.06839	39	0.014259	yes	ADPSBQ
chr1_1760882_T_C_b38	SLC35E2	4.767	2.44e-06	0.060822	115	0.012758	yes	ADPSBQ
chr1_1652913_C_T_b38	SLC35E2	-4.76	2.53e-06	-0.066569	49	0.013985	yes	ADPSBQ
chr1_1750440_G_A_b38	SLC35E2	-4.753	2.61e-06	-0.068776	77	0.01447	yes	ADPSBQ
chr1_1659940_A_C_b38	SLC35E2	-4.749	2.66e-06	-0.078221	18	0.016472	yes	ADPSBQ
chr1_1750428_G_C_b38	SLC35E2	-4.729	2.92e-06	-0.069054	78	0.014602	yes	ADPSBQ
chr1_1743714_C_CA_b38	SLC35E2	4.685	3.6e-06	0.065343	79	0.013947	yes	ADPSBQ
chr1_1764023_C_A_b38	SLC35E2	4.679	3.7e-06	0.061596	97	0.013165	yes	ADPSBQ
chr1_1667424_T_TAAAATA_b38	SLC35E2	4.678	3.71e-06	0.061429	75	0.013131	yes	ADPSBQ
chr1_1660408_T_C_b38	SLC35E2	-4.661	4.03e-06	-0.076506	16	0.016415	yes	ADPSBQ
chr1_1779667_T_TTG_b38	SLC35E2	4.657	4.1e-06	0.06418	77	0.013782	yes	ADPSBQ
chr1_1960609_G_C_b38	SLC35E2	-4.617	4.93e-06	-0.058539	106	0.012679	yes	ADPSBQ
chr1_1586962_C_T_b38	SLC35E2	4.566	6.25e-06	0.060546	68	0.013262	yes	ADPSBQ
chr1_1750280_A_G_b38	SLC35E2	-4.534	7.21e-06	-0.059694	124	0.013165	yes	ADPSBQ
chr1_1739519_C_G_b38	SLC35E2	4.432	1.14e-05	0.067741	48	0.015285	yes	ADPSBQ
chr1_1639685_G_A_b38	SLC35E2	-4.426	1.17e-05	-0.066165	33	0.014948	yes	ADPSBQ
chr1_1749826_A_G_b38	SLC35E2	-4.423	1.19e-05	-0.055431	135	0.012532	yes	ADPSBQ
chr1_1986752_A_G_b38	SLC35E2	4.413	1.24e-05	0.059536	105	0.01349	yes	ADPSBQ
chr1_1591703_T_C_b38	SLC35E2	4.352	1.63e-05	0.05391	110	0.012386	yes	ADPSBQ
chr1_1612562_T_TC_b38	SLC35E2	4.348	1.66e-05	0.056139	68	0.012911	yes	ADPSBQ
chr1_1702383_T_C_b38	SLC35E2	-4.315	1.92e-05	-0.067276	29	0.015591	yes	ADPSBQ
chr1_1844830_C_A_b38	SLC35E2	4.314	1.93e-05	0.055867	113	0.012951	yes	ADPSBQ
chr1_1744121_A_C_b38	SLC35E2	-4.313	1.93e-05	-0.080004	59	0.018549	yes	ADPSBQ
chr1_1650664_CTTTTT_C_b38	SLC35E2	-4.303	2.02e-05	-0.063839	37	0.014835	yes	ADPSBQ
chr1_1848037_C_CTA_b38	SLC35E2	4.299	2.06e-05	0.055574	114	0.012928	yes	ADPSBQ
chr1_1987049_A_G_b38	SLC35E2	4.295	2.09e-05	0.057191	107	0.013314	yes	ADPSBQ
chr1_1781909_C_T_b38	SLC35E2	4.293	2.11e-05	0.054938	115	0.012796	yes	ADPSBQ
chr1_1613769_C_T_b38	SLC35E2	4.198	3.18e-05	0.057449	61	0.013686	yes	ADPSBQ
chr1_1649846_G_A_b38	SLC35E2	-4.189	3.3e-05	-0.061754	34	0.014743	yes	ADPSBQ
chr1_1589495_CTTT_C_b38	SLC35E2	4.168	3.61e-05	0.059787	46	0.014344	yes	ADPSBQ
chr1_1936906_C_CA_b38	SLC35E2	-4.118	4.46e-05	-0.060233	66	0.014626	yes	ADPSBQ
chr1_1762759_AAATG_A_b38	SLC35E2	4.108	4.65e-05	0.053002	114	0.012903	yes	ADPSBQ
chr1_1650688_T_A_b38	SLC35E2	-4.057	5.75e-05	-0.057739	49	0.014232	yes	ADPSBQ
chr1_1744096_C_T_b38	SLC35E2	-4.022	6.64e-05	-0.074236	62	0.018456	yes	ADPSBQ
chr1_1600379_C_T_b38	SLC35E2	4.021	6.68e-05	0.052943	64	0.013168	yes	ADPSBQ
chr1_1606384_A_G_b38	SLC35E2	3.999	7.3e-05	0.051974	74	0.012997	yes	ADPSBQ
chr1_1653863_C_A_b38	SLC35E2	-3.996	7.38e-05	-0.067265	15	0.016832	yes	ADPSBQ
chr1_1600320_C_G_b38	SLC35E2	3.978	7.96e-05	0.052516	62	0.013202	yes	ADPSBQ
chr1_1641275_A_G_b38	SLC35E2	-3.976	8.03e-05	-0.053569	73	0.013473	yes	ADPSBQ
chr1_1621352_G_A_b38	SLC35E2	3.97	8.21e-05	0.051985	70	0.013094	yes	ADPSBQ
chr1_1697979_G_A_b38	SLC35E2	-3.969	8.24e-05	-0.077936	6	0.019635	yes	ADPSBQ
chr1_1650383_G_T_b38	SLC35E2	-3.954	8.78e-05	-0.056304	53	0.01424	yes	ADPSBQ
chr1_1620609_G_A_b38	SLC35E2	3.938	9.36e-05	0.051682	67	0.013124	yes	ADPSBQ
chr1_1936906_CA_C_b38	SLC35E2	3.936	9.44e-05	0.06307	16	0.016025	yes	ADPSBQ
chr1_1717507_T_C_b38	SLC35E2	3.933	9.54e-05	0.081026	17	0.020601	yes	ADPSBQ
chr1_1743544_CA_C_b38	SLC35E2	3.913	0.000104	0.048873	118	0.01249	yes	ADPSBQ
chr1_1828894_T_TAC_b38	SLC35E2	3.911	0.000104	0.051117	108	0.013071	yes	ADPSBQ
chr1_1609058_G_A_b38	SLC35E2	3.884	0.000116	0.051275	64	0.013203	yes	ADPSBQ
chr1_1723766_C_T_b38	SLC35E2	-3.872	0.000122	-0.067614	27	0.017462	yes	ADPSBQ
chr1_1629332_G_T_b38	SLC35E2	3.865	0.000126	0.052936	63	0.013698	yes	ADPSBQ
chr1_1658422_T_C_b38	SLC35E2	3.863	0.000127	0.063014	25	0.016314	yes	ADPSBQ
chr1_1607931_G_A_b38	SLC35E2	3.843	0.000137	0.051031	63	0.013278	yes	ADPSBQ
chr1_1667424_T_TAAATA_b38	SLC35E2	-3.843	0.000137	-0.049014	93	0.012754	yes	ADPSBQ
chr1_1650000_G_A_b38	SLC35E2	3.795	0.000166	0.049618	79	0.013076	yes	ADPSBQ
chr1_2415084_G_C_b38	SLC35E2	3.747	0.000199	0.053507	39	0.01428	yes	ADPSBQ
chr1_2415085_T_C_b38	SLC35E2	3.747	0.000199	0.053507	39	0.01428	yes	ADPSBQ
chr1_1638879_C_T_b38	SLC35E2	-3.736	0.000208	-0.054947	38	0.014707	yes	ADPSBQ
chr1_1722599_G_A_b38	SLC35E2	3.722	0.00022	0.05666	69	0.015225	yes	ADPSBQ
chr1_1622295_G_C_b38	SLC35E2	3.698	0.000241	0.048998	67	0.01325	yes	ADPSBQ
chr1_1865278_A_C_b38	SLC35E2	3.697	0.000241	0.047699	105	0.012901	yes	ADPSBQ
chr1_1675228_C_CG_b38	SLC35E2	3.692	0.000246	0.052175	83	0.014132	yes	ADPSBQ
chr1_1649993_A_G_b38	SLC35E2	-3.68	0.000258	-0.045984	140	0.012495	yes	ADPSBQ
chr1_1630798_C_T_b38	SLC35E2	3.626	0.000316	0.04996	60	0.013777	yes	ADPSBQ
chr1_1793064_C_CA_b38	SLC35E2	3.606	0.000341	0.053321	40	0.014786	yes	ADPSBQ
chr1_1937273_T_C_b38	SLC35E2	-3.585	0.000369	-0.046965	109	0.0131	yes	ADPSBQ
chr1_1951498_C_T_b38	SLC35E2	3.559	0.000407	0.051591	36	0.014496	yes	ADPSBQ
chr1_1951642_C_T_b38	SLC35E2	3.559	0.000407	0.051591	36	0.014496	yes	ADPSBQ
chr1_1934565_G_A_b38	SLC35E2	-3.546	0.000427	-0.047895	114	0.013507	yes	ADPSBQ
chr1_1606507_GTGGGC_G_b38	SLC35E2	3.536	0.000444	0.045186	139	0.01278	yes	ADPSBQ
chr1_1937046_G_A_b38	SLC35E2	3.534	0.000447	0.057986	18	0.01641	yes	ADPSBQ
chr1_1676287_C_T_b38	SLC35E2	-3.514	0.000481	-0.059218	15	0.016854	yes	ADPSBQ
chr1_1641261_C_T_b38	SLC35E2	-3.51	0.000489	-0.055101	27	0.0157	yes	ADPSBQ
chr1_1904424_A_AAAATAAATAAAT_b38	SLC35E2	3.482	0.00054	0.042576	97	0.012226	yes	ADPSBQ
chr1_1950071_C_A_b38	SLC35E2	3.457	0.000591	0.049577	38	0.01434	yes	ADPSBQ
chr1_1969479_G_A_b38	SLC35E2	3.418	0.00068	0.050732	30	0.014841	yes	ADPSBQ
chr1_1650664_CT_C_b38	SLC35E2	3.373	0.000799	0.052179	46	0.015468	yes	ADPSBQ
chr1_1675132_A_G_b38	SLC35E2	3.371	0.000805	0.048514	71	0.014391	yes	ADPSBQ
chr1_1904424_A_AAAATAAAT_b38	SLC35E2	-3.36	0.000838	-0.040565	130	0.012073	yes	ADPSBQ
chr1_1938332_A_ACT_b38	SLC35E2	-3.341	0.000895	-0.043232	118	0.012939	yes	ADPSBQ
chr1_1936077_C_T_b38	SLC35E2	-3.323	0.000955	-0.043633	115	0.013131	yes	ADPSBQ
chr1_1750589_G_A_b38	SLC35E2	-3.307	0.00101	-0.07246	16	0.021909	yes	ADPSBQ
chr1_1969249_A_AGCCCT_b38	SLC35E2	3.233	0.00131	0.048869	28	0.015118	yes	ADPSBQ
chr1_1865951_T_A_b38	SLC35E2	3.231	0.00131	0.047563	35	0.01472	yes	ADPSBQ
chr1_1991690_A_G_b38	SLC35E2	3.228	0.00132	0.042228	102	0.01308	yes	ADPSBQ
chr1_1635226_T_C_b38	SLC35E2	-3.212	0.0014	-0.056301	14	0.017529	yes	ADPSBQ
chr1_1869595_G_A_b38	SLC35E2	3.136	0.00181	0.046094	34	0.014698	yes	ADPSBQ
chr1_1907199_A_G_b38	SLC35E2	3.133	0.00183	0.046393	32	0.014806	yes	ADPSBQ
chr1_1990027_C_CT_b38	SLC35E2	3.11	0.00198	0.099528	7	0.032006	yes	ADPSBQ
chr1_1775296_C_T_b38	SLC35E2	3.104	0.00202	0.056772	13	0.018293	yes	ADPSBQ
chr1_1777680_C_T_b38	SLC35E2	3.102	0.00203	0.078259	3	0.025232	yes	ADPSBQ
chr1_1989523_T_C_b38	SLC35E2	3.101	0.00204	0.042015	95	0.013549	yes	ADPSBQ
chr1_1677707_C_T_b38	SLC35E2	-3.091	0.0021	-0.058561	13	0.018946	yes	ADPSBQ
chr1_1849992_T_TG_b38	SLC35E2	3.088	0.00212	0.05089	18	0.016478	yes	ADPSBQ
chr1_1827615_G_A_b38	SLC35E2	3.074	0.00223	0.04505	34	0.014656	yes	ADPSBQ
chr1_1815255_G_T_b38	SLC35E2	3.065	0.00229	0.056543	12	0.018445	yes	ADPSBQ
chr1_1791389_G_A_b38	SLC35E2	3.064	0.0023	0.047716	26	0.015575	yes	ADPSBQ
chr1_1725697_T_C_b38	SLC35E2	3.054	0.00238	0.049892	45	0.016337	yes	ADPSBQ
chr1_1892085_G_C_b38	SLC35E2	3.042	0.00247	0.054282	12	0.017843	yes	ADPSBQ
chr1_1845824_TACACAC_T_b38	SLC35E2	3.027	0.00259	0.049918	22	0.01649	yes	ADPSBQ
chr1_1738597_C_A_b38	SLC35E2	3.019	0.00266	0.046409	64	0.015371	yes	ADPSBQ
chr1_1783572_C_A_b38	SLC35E2	3.015	0.00269	0.044229	34	0.014668	yes	ADPSBQ
chr1_1837455_C_T_b38	SLC35E2	3.015	0.00269	0.044229	34	0.014668	yes	ADPSBQ
chr1_1851762_G_A_b38	SLC35E2	3.015	0.00269	0.044229	34	0.014668	yes	ADPSBQ
chr1_1852145_G_A_b38	SLC35E2	3.015	0.00269	0.044229	34	0.014668	yes	ADPSBQ
chr1_1876492_C_CGA_b38	SLC35E2	3.013	0.00271	0.056729	4	0.018826	yes	ADPSBQ
chr1_1738606_C_T_b38	SLC35E2	2.962	0.0032	0.045326	63	0.015302	yes	ADPSBQ
chr1_1794187_C_T_b38	SLC35E2	2.958	0.00324	0.052117	13	0.017617	yes	ADPSBQ
chr1_1590682_T_C_b38	SLC35E2	-2.957	0.00325	-0.039146	82	0.013238	yes	ADPSBQ
chr1_1881065_G_A_b38	SLC35E2	2.956	0.00326	0.053229	12	0.018009	yes	ADPSBQ
chr1_1881798_C_T_b38	SLC35E2	2.956	0.00326	0.053229	12	0.018009	yes	ADPSBQ
chr1_1943403_C_G_b38	SLC35E2	2.947	0.00335	0.078425	4	0.026608	yes	ADPSBQ
chr1_1688102_G_A_b38	SLC35E2	-2.944	0.00339	-0.043869	41	0.014903	yes	ADPSBQ
chr1_1606532_GTGGGCTGGGCTGGTCAGGCA_G_b38	SLC35E2	2.942	0.00341	0.040042	56	0.013612	yes	ADPSBQ
chr1_1886690_A_C_b38	SLC35E2	2.941	0.00342	0.052895	12	0.017983	yes	ADPSBQ
chr1_1897325_G_A_b38	SLC35E2	2.939	0.00344	0.044244	27	0.015055	yes	ADPSBQ
chr1_2493326_G_A_b38	SLC35E2	2.922	0.00363	0.036208	124	0.012392	yes	ADPSBQ
chr1_1668373_C_T_b38	SLC35E2	2.918	0.00368	0.04422	70	0.015155	yes	ADPSBQ
chr1_1589418_T_TA_b38	SLC35E2	2.915	0.00371	0.040239	81	0.013802	yes	ADPSBQ
chr1_1968893_A_G_b38	SLC35E2	2.913	0.00374	0.042235	34	0.014501	yes	ADPSBQ
chr1_965125_G_C_b38	SLC35E2	2.911	0.00376	0.043748	37	0.015027	yes	ADPSBQ
chr1_1878070_C_T_b38	SLC35E2	2.91	0.00377	0.042373	35	0.01456	yes	ADPSBQ
chr1_1881006_GGA_G_b38	SLC35E2	2.91	0.00377	0.042373	35	0.01456	yes	ADPSBQ
chr1_1888667_A_C_b38	SLC35E2	2.91	0.00377	0.042373	35	0.01456	yes	ADPSBQ
chr1_1871210_G_T_b38	SLC35E2	2.91	0.00377	0.053418	12	0.018358	yes	ADPSBQ
chr1_1907077_C_A_b38	SLC35E2	2.906	0.00382	0.045198	28	0.015553	yes	ADPSBQ
chr1_1857305_G_GGGCT_b38	SLC35E2	2.903	0.00385	0.052225	12	0.017988	yes	ADPSBQ
chr1_1882915_C_T_b38	SLC35E2	2.899	0.0039	0.052538	12	0.018122	yes	ADPSBQ
chr1_1657081_C_T_b38	SLC35E2	-2.888	0.00404	-0.043602	46	0.015099	yes	ADPSBQ
chr1_1782430_T_G_b38	SLC35E2	2.88	0.00415	0.041895	35	0.014549	yes	ADPSBQ
chr1_1805214_T_G_b38	SLC35E2	2.88	0.00415	0.041895	35	0.014549	yes	ADPSBQ
chr1_1834655_A_C_b38	SLC35E2	2.88	0.00415	0.041895	35	0.014549	yes	ADPSBQ
chr1_1880594_A_T_b38	SLC35E2	2.866	0.00432	0.048691	19	0.016987	yes	ADPSBQ
chr1_1857246_T_TAA_b38	SLC35E2	2.852	0.00452	0.05116	12	0.017937	yes	ADPSBQ
chr1_1857250_C_G_b38	SLC35E2	2.852	0.00452	0.05116	12	0.017937	yes	ADPSBQ
chr1_2053253_A_G_b38	SLC35E2	2.846	0.0046	0.03834	60	0.013471	yes	ADPSBQ
chr1_1624323_AT_A_b38	SLC35E2	2.844	0.00463	0.036759	97	0.012924	yes	ADPSBQ
chr1_1732892_CT_C_b38	SLC35E2	2.834	0.00477	0.050752	13	0.017906	yes	ADPSBQ
chr1_1903603_G_A_b38	SLC35E2	2.832	0.0048	0.042009	32	0.014832	yes	ADPSBQ
chr1_1903617_C_T_b38	SLC35E2	2.832	0.0048	0.042009	32	0.014832	yes	ADPSBQ
chr1_1900918_G_A_b38	SLC35E2	2.819	0.00501	0.041761	32	0.014815	yes	ADPSBQ
chr1_1855245_G_A_b38	SLC35E2	2.817	0.00503	0.050767	12	0.01802	yes	ADPSBQ
chr1_1650370_C_CT_b38	SLC35E2	-2.815	0.00506	-0.045417	31	0.016132	yes	ADPSBQ
chr1_1627515_C_T_b38	SLC35E2	2.807	0.00519	0.035491	127	0.012643	yes	ADPSBQ
chr1_1808642_TTTTG_T_b38	SLC35E2	2.806	0.0052	0.041129	37	0.014656	yes	ADPSBQ
chr1_1822247_A_G_b38	SLC35E2	2.806	0.00521	0.04916	14	0.017521	yes	ADPSBQ
chr1_946653_G_A_b38	SLC35E2	2.804	0.00523	0.043847	28	0.015635	yes	ADPSBQ
chr1_1845824_TACACACACACACACACACACACACACACAC_T_b38	SLC35E2	2.804	0.00524	0.04067	39	0.014504	yes	ADPSBQ
chr1_1780791_C_T_b38	SLC35E2	2.801	0.00529	0.040822	35	0.014575	yes	ADPSBQ
chr1_1794321_C_T_b38	SLC35E2	2.801	0.00529	0.040822	35	0.014575	yes	ADPSBQ
chr1_1884183_G_A_b38	SLC35E2	2.794	0.0054	0.040332	38	0.014434	yes	ADPSBQ
chr1_1657085_C_CTAA_b38	SLC35E2	-2.787	0.00552	-0.042469	46	0.01524	yes	ADPSBQ
chr1_1798974_C_T_b38	SLC35E2	2.784	0.00557	0.04926	13	0.017693	yes	ADPSBQ
chr1_812761_G_A_b38	SLC35E2	-2.779	0.00565	-0.070394	4	0.025327	yes	ADPSBQ
chr1_1840043_T_TA_b38	SLC35E2	2.769	0.00583	0.049715	9	0.017953	yes	ADPSBQ
chr1_1855939_G_A_b38	SLC35E2	2.757	0.00604	0.04959	12	0.017987	yes	ADPSBQ
chr1_1662738_CT_C_b38	SLC35E2	-2.747	0.00622	-0.05461	37	0.019876	yes	ADPSBQ
chr1_1586956_T_C_b38	SLC35E2	-2.737	0.00642	-0.03704	75	0.013534	yes	ADPSBQ
chr1_1743712_G_A_b38	SLC35E2	2.734	0.00647	0.059737	8	0.021847	yes	ADPSBQ
chr1_1649954_C_CA_b38	SLC35E2	-2.724	0.00667	-0.046709	23	0.017146	yes	ADPSBQ
chr1_1845840_C_G_b38	SLC35E2	2.721	0.00673	0.050799	7	0.01867	yes	ADPSBQ
chr1_1662855_T_C_b38	SLC35E2	-2.713	0.0069	-0.053725	37	0.019806	yes	ADPSBQ
chr1_1837340_C_T_b38	SLC35E2	2.71	0.00696	0.047341	14	0.017471	yes	ADPSBQ
chr1_1588141_CA_C_b38	SLC35E2	-2.708	0.007	-0.042435	38	0.015672	yes	ADPSBQ
chr1_1846651_T_G_b38	SLC35E2	2.698	0.00722	0.047249	14	0.017515	yes	ADPSBQ
chr1_1775996_G_A_b38	SLC35E2	2.693	0.00732	0.046957	15	0.017438	yes	ADPSBQ
chr1_1584321_T_C_b38	SLC35E2	-2.67	0.00783	-0.03567	85	0.01336	yes	ADPSBQ
chr1_965666_ACC_A_b38	SLC35E2	2.669	0.00784	0.040386	33	0.01513	yes	ADPSBQ
chr1_2292928_G_T_b38	SLC35E2	-2.668	0.00788	-0.056733	7	0.021266	yes	ADPSBQ
chr1_1586987_G_A_b38	SLC35E2	-2.664	0.00797	-0.036498	72	0.013701	yes	ADPSBQ
chr1_1864350_C_T_b38	SLC35E2	2.663	0.00799	0.038134	40	0.014321	yes	ADPSBQ
chr1_1782906_T_G_b38	SLC35E2	2.662	0.00801	0.046351	15	0.017411	yes	ADPSBQ
chr1_1839349_C_G_b38	SLC35E2	2.654	0.00819	0.038912	37	0.01466	yes	ADPSBQ
chr1_1839350_T_A_b38	SLC35E2	2.654	0.00819	0.038912	37	0.01466	yes	ADPSBQ
chr1_1851181_C_T_b38	SLC35E2	2.629	0.00881	0.038619	37	0.014687	yes	ADPSBQ
chr1_1801188_T_C_b38	SLC35E2	2.617	0.00914	0.045037	15	0.017211	yes	ADPSBQ
chr1_1976870_C_CAG_b38	SLC35E2	2.615	0.0092	0.034934	57	0.013361	yes	ADPSBQ
chr1_1980742_C_T_b38	SLC35E2	2.605	0.00946	0.061972	4	0.023791	yes	ADPSBQ
chr1_1842403_C_A_b38	SLC35E2	2.6	0.00958	0.069547	3	0.026745	yes	ADPSBQ
chr1_1851999_C_A_b38	SLC35E2	2.6	0.00958	0.069547	3	0.026745	yes	ADPSBQ
chr1_1693256_GT_G_b38	SLC35E2	-2.596	0.00969	-0.08147	8	0.031378	yes	ADPSBQ
chr1_1976855_C_CTT_b38	SLC35E2	2.59	0.00986	0.039641	31	0.015304	yes	ADPSBQ
chr1_1751981_A_T_b38	SLC35E2	-6.52	1.69e-10	-0.098409	47	0.015092	no	ADPSBQ
chr1_1743238_G_C_b38	SLC35E2	-6.16	1.47e-09	-0.081284	93	0.013195	no	ADPSBQ
chr1_1742672_C_T_b38	SLC35E2	-6.079	2.37e-09	-0.080038	94	0.013167	no	ADPSBQ
chr1_1753033_C_T_b38	SLC35E2	-5.752	1.52e-08	-0.075894	125	0.013194	no	ADPSBQ
chr1_1752461_G_A_b38	SLC35E2	-5.703	1.99e-08	-0.076072	114	0.013339	no	ADPSBQ
chr1_1752730_C_G_b38	SLC35E2	-5.694	2.1e-08	-0.075991	114	0.013345	no	ADPSBQ
chr1_1753319_G_A_b38	SLC35E2	-5.546	4.69e-08	-0.074339	114	0.013403	no	ADPSBQ
chr1_1753361_G_A_b38	SLC35E2	-5.546	4.69e-08	-0.074339	114	0.013403	no	ADPSBQ
chr1_1756043_G_T_b38	SLC35E2	-5.409	9.77e-08	-0.073044	115	0.013505	no	ADPSBQ
chr1_1754482_TCCCTGGGACCGAAGTCGCCCCA_T_b38	SLC35E2	-5.226	2.53e-07	-0.070783	115	0.013545	no	ADPSBQ
chr1_1759611_C_T_b38	SLC35E2	-5.015	7.35e-07	-0.068176	116	0.013596	no	ADPSBQ
chr1_1759354_G_A_b38	SLC35E2	-4.927	1.13e-06	-0.06689	114	0.013577	no	ADPSBQ
chr1_1755713_G_A_b38	SLC35E2	-4.857	1.59e-06	-0.064514	104	0.013282	no	ADPSBQ
chr1_1747472_A_T_b38	SLC35E2	-4.802	2.07e-06	-0.065046	116	0.013545	no	ADPSBQ
chr1_1748597_C_G_b38	SLC35E2	-4.784	2.26e-06	-0.06483	116	0.013552	no	ADPSBQ
chr1_1820337_A_G_b38	SLC35E2	4.767	2.44e-06	0.060347	120	0.012658	no	ADPSBQ
chr1_1752908_C_CCCT_b38	SLC35E2	-4.728	2.93e-06	-0.065707	96	0.013897	no	ADPSBQ
chr1_1748780_G_A_b38	SLC35E2	-4.609	5.13e-06	-0.061313	128	0.013304	no	ADPSBQ
chr1_1849781_T_C_b38	SLC35E2	-4.591	5.56e-06	-0.067334	35	0.014666	no	ADPSBQ
chr1_1969015_A_G_b38	SLC35E2	4.46	1.01e-05	0.061504	121	0.013791	no	ADPSBQ
chr1_1865177_G_A_b38	SLC35E2	-4.345	1.69e-05	-0.063737	35	0.014671	no	ADPSBQ
chr1_1746440_A_G_b38	SLC35E2	-4.338	1.73e-05	-0.067971	33	0.015669	no	ADPSBQ
chr1_1963533_C_CA_b38	SLC35E2	4.272	2.31e-05	0.055066	112	0.01289	no	ADPSBQ
chr1_1970506_T_A_b38	SLC35E2	-4.242	2.63e-05	-0.055448	93	0.01307	no	ADPSBQ
chr1_1866635_T_TA_b38	SLC35E2	4.078	5.27e-05	0.057858	71	0.014188	no	ADPSBQ
chr1_1717604_CGCTTTCAGCTAGAGTTTGCTCTCTCTGGTTTTCGGTCTGTGACACACGCAT_C_b38	SLC35E2	4.045	6.03e-05	0.051807	104	0.012806	no	ADPSBQ
chr1_1798925_C_CT_b38	SLC35E2	-4.026	6.55e-05	-0.056748	50	0.014097	no	ADPSBQ
chr1_1769969_CAAAACA_C_b38	SLC35E2	3.997	7.37e-05	0.050998	109	0.01276	no	ADPSBQ
chr1_1750528_G_A_b38	SLC35E2	-3.995	7.44e-05	-0.04702	118	0.011771	no	ADPSBQ
chr1_1963538_T_C_b38	SLC35E2	3.99	7.58e-05	0.05167	104	0.01295	no	ADPSBQ
chr1_1987547_C_CT_b38	SLC35E2	3.959	8.59e-05	0.055138	110	0.013926	no	ADPSBQ
chr1_1864334_AAAG_A_b38	SLC35E2	-3.948	8.98e-05	-0.064736	33	0.016396	no	ADPSBQ
chr1_1967499_G_A_b38	SLC35E2	3.94	9.3e-05	0.051135	105	0.01298	no	ADPSBQ
chr1_1770997_G_A_b38	SLC35E2	-3.928	9.74e-05	-0.052704	120	0.013417	no	ADPSBQ
chr1_1968793_T_C_b38	SLC35E2	3.882	0.000117	0.050322	109	0.012962	no	ADPSBQ
chr1_1746522_GT_G_b38	SLC35E2	-3.88	0.000118	-0.06066	33	0.015635	no	ADPSBQ
chr1_1688442_T_C_b38	SLC35E2	-3.806	0.000158	-0.057068	49	0.014994	no	ADPSBQ
chr1_1901149_A_AAAGAAAGG_b38	SLC35E2	3.798	0.000163	0.04974	77	0.013096	no	ADPSBQ
chr1_1734308_T_C_b38	SLC35E2	3.751	0.000197	0.0733	20	0.019543	no	ADPSBQ
chr1_1945842_A_AAAAGAAC_b38	SLC35E2	-3.703	0.000237	-0.050513	91	0.013642	no	ADPSBQ
chr1_1831318_C_T_b38	SLC35E2	-3.676	0.000262	-0.05099	116	0.013871	no	ADPSBQ
chr1_1773460_G_A_b38	SLC35E2	-3.675	0.000263	-0.050358	118	0.013702	no	ADPSBQ
chr1_1773476_C_G_b38	SLC35E2	-3.675	0.000263	-0.050358	118	0.013702	no	ADPSBQ
chr1_1764887_C_A_b38	SLC35E2	-3.67	0.000268	-0.050562	117	0.013777	no	ADPSBQ
chr1_1727506_T_C_b38	SLC35E2	3.657	0.000281	0.061356	44	0.016776	no	ADPSBQ
chr1_1771864_G_A_b38	SLC35E2	-3.627	0.000316	-0.050007	118	0.013788	no	ADPSBQ
chr1_1772426_T_A_b38	SLC35E2	-3.627	0.000316	-0.050007	118	0.013788	no	ADPSBQ
chr1_1773848_A_C_b38	SLC35E2	-3.627	0.000316	-0.050007	118	0.013788	no	ADPSBQ
chr1_1776461_GAAAC_G_b38	SLC35E2	-3.627	0.000316	-0.050007	118	0.013788	no	ADPSBQ
chr1_1777362_A_G_b38	SLC35E2	-3.627	0.000316	-0.050007	118	0.013788	no	ADPSBQ
chr1_1790040_C_T_b38	SLC35E2	-3.627	0.000316	-0.050007	118	0.013788	no	ADPSBQ
chr1_1791493_C_T_b38	SLC35E2	-3.627	0.000316	-0.050007	118	0.013788	no	ADPSBQ
chr1_1791592_G_A_b38	SLC35E2	-3.627	0.000316	-0.050007	118	0.013788	no	ADPSBQ
chr1_1595028_C_CAG_b38	SLC35E2	3.625	0.000318	0.052634	40	0.014519	no	ADPSBQ
chr1_1736729_G_T_b38	SLC35E2	3.625	0.000318	0.046211	150	0.012748	no	ADPSBQ
chr1_1772410_T_C_b38	SLC35E2	-3.621	0.000322	-0.049816	118	0.013756	no	ADPSBQ
chr1_1792927_G_A_b38	SLC35E2	-3.617	0.000328	-0.049723	118	0.013748	no	ADPSBQ
chr1_1881249_A_G_b38	SLC35E2	-3.612	0.000333	-0.050133	119	0.013878	no	ADPSBQ
chr1_1731904_CA_C_b38	SLC35E2	3.604	0.000344	0.054267	46	0.015055	no	ADPSBQ
chr1_1708855_TTCCTCCTCC_T_b38	SLC35E2	3.601	0.000348	0.049057	103	0.013625	no	ADPSBQ
chr1_1881428_C_CT_b38	SLC35E2	-3.595	0.000356	-0.050097	115	0.013935	no	ADPSBQ
chr1_1866508_A_G_b38	SLC35E2	-3.588	0.000366	-0.049567	120	0.013816	no	ADPSBQ
chr1_1879567_T_C_b38	SLC35E2	-3.588	0.000366	-0.049567	120	0.013816	no	ADPSBQ
chr1_1886800_G_A_b38	SLC35E2	-3.588	0.000366	-0.049567	120	0.013816	no	ADPSBQ
chr1_1891654_C_CAGAG_b38	SLC35E2	-3.588	0.000366	-0.049567	120	0.013816	no	ADPSBQ
chr1_1698048_T_C_b38	SLC35E2	-3.585	0.000369	-0.110232	4	0.030745	no	ADPSBQ
chr1_1860718_A_C_b38	SLC35E2	-3.582	0.000374	-0.049537	121	0.013829	no	ADPSBQ
chr1_1808816_G_T_b38	SLC35E2	-3.582	0.000374	-0.049435	118	0.013803	no	ADPSBQ
chr1_1817295_T_C_b38	SLC35E2	-3.582	0.000374	-0.049435	118	0.013803	no	ADPSBQ
chr1_1819825_G_A_b38	SLC35E2	-3.582	0.000374	-0.049435	118	0.013803	no	ADPSBQ
chr1_1827774_A_G_b38	SLC35E2	-3.582	0.000374	-0.049435	118	0.013803	no	ADPSBQ
chr1_1846009_AGG_A_b38	SLC35E2	-3.578	0.000379	-0.049589	118	0.013858	no	ADPSBQ
chr1_1846011_G_GTCC_b38	SLC35E2	-3.578	0.000379	-0.049589	118	0.013858	no	ADPSBQ
chr1_1843381_A_T_b38	SLC35E2	-3.565	0.000398	-0.049327	118	0.013835	no	ADPSBQ
chr1_1847030_A_G_b38	SLC35E2	-3.565	0.000398	-0.049327	118	0.013835	no	ADPSBQ
chr1_1850017_G_T_b38	SLC35E2	-3.565	0.000398	-0.049327	118	0.013835	no	ADPSBQ
chr1_1762287_A_G_b38	SLC35E2	-3.56	0.000406	-0.049223	122	0.013827	no	ADPSBQ
chr1_1769969_CAAAACAAAAACA_C_b38	SLC35E2	-3.547	0.000426	-0.047963	123	0.013524	no	ADPSBQ
chr1_1951106_G_A_b38	SLC35E2	-3.544	0.00043	-0.048524	118	0.01369	no	ADPSBQ
chr1_1952823_TA_T_b38	SLC35E2	-3.542	0.000433	-0.048373	117	0.013655	no	ADPSBQ
chr1_1916417_G_T_b38	SLC35E2	-3.539	0.000438	-0.047407	111	0.013396	no	ADPSBQ
chr1_1698022_G_A_b38	SLC35E2	-3.532	0.000449	-0.136377	14	0.038608	no	ADPSBQ
chr1_1766653_A_G_b38	SLC35E2	-3.53	0.000453	-0.048673	118	0.013787	no	ADPSBQ
chr1_1951865_G_GT_b38	SLC35E2	-3.528	0.000456	-0.0484	118	0.013717	no	ADPSBQ
chr1_1836126_C_A_b38	SLC35E2	-3.515	0.000479	-0.046816	123	0.01332	no	ADPSBQ
chr1_1914634_G_T_b38	SLC35E2	-3.507	0.000493	-0.046596	111	0.013285	no	ADPSBQ
chr1_1916670_G_C_b38	SLC35E2	-3.507	0.000493	-0.046596	111	0.013285	no	ADPSBQ
chr1_1688619_AAAC_A_b38	SLC35E2	-3.506	0.000495	-0.054502	44	0.015545	no	ADPSBQ
chr1_1968103_A_ATGAG_b38	SLC35E2	3.491	0.000523	0.049303	38	0.014123	no	ADPSBQ
chr1_1740343_C_T_b38	SLC35E2	3.487	0.00053	0.044205	151	0.012676	no	ADPSBQ
chr1_1912607_C_T_b38	SLC35E2	-3.477	0.00055	-0.048437	113	0.013929	no	ADPSBQ
chr1_1950071_C_T_b38	SLC35E2	-3.47	0.000564	-0.04756	117	0.013705	no	ADPSBQ
chr1_1952064_G_A_b38	SLC35E2	-3.47	0.000564	-0.04756	117	0.013705	no	ADPSBQ
chr1_1877330_T_C_b38	SLC35E2	-3.446	0.000617	-0.048028	100	0.013938	no	ADPSBQ
chr1_1688457_G_A_b38	SLC35E2	-3.442	0.000624	-0.0526	49	0.015281	no	ADPSBQ
chr1_1731963_A_C_b38	SLC35E2	3.432	0.000649	0.043522	152	0.012683	no	ADPSBQ
chr1_1688647_G_A_b38	SLC35E2	-3.424	0.000666	-0.052671	48	0.015382	no	ADPSBQ
chr1_1952590_A_AAAAG_b38	SLC35E2	3.419	0.000679	0.048218	43	0.014104	no	ADPSBQ
chr1_1926870_T_C_b38	SLC35E2	-3.418	0.000682	-0.044996	102	0.013165	no	ADPSBQ
chr1_1735176_C_T_b38	SLC35E2	3.417	0.000683	0.043438	151	0.012711	no	ADPSBQ
chr1_1881082_C_T_b38	SLC35E2	-3.408	0.000706	-0.047135	119	0.01383	no	ADPSBQ
chr1_1797530_C_A_b38	SLC35E2	-3.396	0.000737	-0.046304	118	0.013635	no	ADPSBQ
chr1_1922670_A_G_b38	SLC35E2	-3.393	0.000746	-0.044876	108	0.013228	no	ADPSBQ
chr1_1835922_G_GAAA_b38	SLC35E2	-3.39	0.000753	-0.109182	9	0.032207	no	ADPSBQ
chr1_1940540_G_A_b38	SLC35E2	-3.39	0.000754	-0.044326	114	0.013077	no	ADPSBQ
chr1_1940973_C_T_b38	SLC35E2	-3.389	0.000756	-0.044024	116	0.012991	no	ADPSBQ
chr1_1985619_A_G_b38	SLC35E2	3.379	0.000782	0.045134	75	0.013356	no	ADPSBQ
chr1_1938054_ACT_A_b38	SLC35E2	-3.37	0.000809	-0.044109	114	0.013089	no	ADPSBQ
chr1_1928648_C_T_b38	SLC35E2	-3.367	0.000818	-0.044412	108	0.013192	no	ADPSBQ
chr1_1909234_G_A_b38	SLC35E2	-3.361	0.000834	-0.046953	120	0.013969	no	ADPSBQ
chr1_1937841_ACACCAGGTCCACCTCTGGACACAGGTCCACC_A_b38	SLC35E2	-3.359	0.000842	-0.043914	114	0.013075	no	ADPSBQ
chr1_1948919_T_TCCTTCCCTCCTCTTTCCCTCCCTTCTTTCCTTCCCTTTCCCTCCCTC_b38	SLC35E2	-3.358	0.000844	-0.040333	106	0.012011	no	ADPSBQ
chr1_2301093_G_A_b38	SLC35E2	-3.354	0.000857	-0.061234	10	0.01826	no	ADPSBQ
chr1_2293719_T_A_b38	SLC35E2	-3.352	0.000863	-0.057732	16	0.017226	no	ADPSBQ
chr1_1969235_A_G_b38	SLC35E2	3.346	0.00088	0.049928	29	0.014921	no	ADPSBQ
chr1_1688531_T_C_b38	SLC35E2	-3.346	0.000881	-0.054178	34	0.016193	no	ADPSBQ
chr1_1936627_C_G_b38	SLC35E2	-3.345	0.000884	-0.044671	106	0.013356	no	ADPSBQ
chr1_1909238_G_A_b38	SLC35E2	-3.338	0.000907	-0.04646	122	0.01392	no	ADPSBQ
chr1_1942014_G_A_b38	SLC35E2	-3.335	0.000915	-0.0436	113	0.013073	no	ADPSBQ
chr1_1942075_A_G_b38	SLC35E2	-3.335	0.000915	-0.0436	113	0.013073	no	ADPSBQ
chr1_1942086_T_C_b38	SLC35E2	-3.335	0.000915	-0.0436	113	0.013073	no	ADPSBQ
chr1_1945975_TG_T_b38	SLC35E2	-3.321	0.00096	-0.044652	123	0.013444	no	ADPSBQ
chr1_1929306_C_T_b38	SLC35E2	3.32	0.000965	0.049425	28	0.014887	no	ADPSBQ
chr1_1967980_A_AAGAATGAG_b38	SLC35E2	3.309	0.001	0.047063	37	0.014221	no	ADPSBQ
chr1_1931587_A_G_b38	SLC35E2	-3.307	0.00101	-0.043767	110	0.013234	no	ADPSBQ
chr1_1905586_C_T_b38	SLC35E2	-3.306	0.00101	-0.046156	117	0.013961	no	ADPSBQ
chr1_1968900_A_G_b38	SLC35E2	3.305	0.00102	0.046566	40	0.014091	no	ADPSBQ
chr1_1966152_C_T_b38	SLC35E2	3.303	0.00102	0.046735	38	0.01415	no	ADPSBQ
chr1_1740703_C_T_b38	SLC35E2	3.297	0.00104	0.041925	152	0.012716	no	ADPSBQ
chr1_1969006_C_T_b38	SLC35E2	3.297	0.00105	0.046032	41	0.013964	no	ADPSBQ
chr1_1966606_G_A_b38	SLC35E2	3.296	0.00105	0.047122	36	0.014296	no	ADPSBQ
chr1_1734174_A_G_b38	SLC35E2	3.295	0.00105	0.041824	152	0.012694	no	ADPSBQ
chr1_1942260_G_C_b38	SLC35E2	-3.293	0.00106	-0.042945	115	0.013042	no	ADPSBQ
chr1_1942258_G_A_b38	SLC35E2	-3.291	0.00107	-0.042928	114	0.013042	no	ADPSBQ
chr1_1963738_C_T_b38	SLC35E2	3.286	0.00109	0.046757	37	0.014229	no	ADPSBQ
chr1_1965114_C_T_b38	SLC35E2	3.286	0.00109	0.046757	37	0.014229	no	ADPSBQ
chr1_1966910_C_T_b38	SLC35E2	3.286	0.00109	0.046757	37	0.014229	no	ADPSBQ
chr1_1732392_C_T_b38	SLC35E2	3.281	0.00111	0.041699	152	0.01271	no	ADPSBQ
chr1_1734903_A_G_b38	SLC35E2	3.281	0.00111	0.041699	152	0.01271	no	ADPSBQ
chr1_1735980_A_C_b38	SLC35E2	3.281	0.00111	0.041699	152	0.01271	no	ADPSBQ
chr1_1695459_A_G_b38	SLC35E2	3.28	0.00111	0.049782	98	0.015179	no	ADPSBQ
chr1_1736836_A_G_b38	SLC35E2	3.279	0.00111	0.042082	142	0.012835	no	ADPSBQ
chr1_1964663_G_A_b38	SLC35E2	3.278	0.00112	0.046326	38	0.014132	no	ADPSBQ
chr1_1965001_G_A_b38	SLC35E2	3.271	0.00114	0.04609	40	0.01409	no	ADPSBQ
chr1_1738295_G_T_b38	SLC35E2	3.269	0.00115	0.041862	149	0.012804	no	ADPSBQ
chr1_1963406_G_A_b38	SLC35E2	3.266	0.00116	0.046146	38	0.014128	no	ADPSBQ
chr1_1931580_CA_C_b38	SLC35E2	-3.263	0.00117	-0.043322	109	0.013275	no	ADPSBQ
chr1_1899573_C_T_b38	SLC35E2	-3.262	0.00118	-0.045438	119	0.01393	no	ADPSBQ
chr1_1962845_T_C_b38	SLC35E2	3.262	0.00118	0.046172	38	0.014157	no	ADPSBQ
chr1_1933087_C_T_b38	SLC35E2	-3.261	0.00119	-0.043115	108	0.013222	no	ADPSBQ
chr1_1933859_A_G_b38	SLC35E2	-3.261	0.00119	-0.043115	108	0.013222	no	ADPSBQ
chr1_1968585_TG_T_b38	SLC35E2	3.255	0.00121	0.046069	38	0.014153	no	ADPSBQ
chr1_1964101_A_G_b38	SLC35E2	3.255	0.00121	0.046026	38	0.014141	no	ADPSBQ
chr1_1964746_T_C_b38	SLC35E2	3.255	0.00121	0.046026	38	0.014141	no	ADPSBQ
chr1_1964784_C_T_b38	SLC35E2	3.255	0.00121	0.046026	38	0.014141	no	ADPSBQ
chr1_1966030_A_G_b38	SLC35E2	3.255	0.00121	0.046026	38	0.014141	no	ADPSBQ
chr1_1966314_C_G_b38	SLC35E2	3.255	0.00121	0.046026	38	0.014141	no	ADPSBQ
chr1_1966930_G_A_b38	SLC35E2	3.255	0.00121	0.046026	38	0.014141	no	ADPSBQ
chr1_1967246_T_C_b38	SLC35E2	3.255	0.00121	0.046026	38	0.014141	no	ADPSBQ
chr1_1967338_G_C_b38	SLC35E2	3.255	0.00121	0.046026	38	0.014141	no	ADPSBQ
chr1_1967340_C_A_b38	SLC35E2	3.255	0.00121	0.046026	38	0.014141	no	ADPSBQ
chr1_1967389_T_C_b38	SLC35E2	3.255	0.00121	0.046026	38	0.014141	no	ADPSBQ
chr1_1967396_C_A_b38	SLC35E2	3.255	0.00121	0.046026	38	0.014141	no	ADPSBQ
chr1_1967420_G_A_b38	SLC35E2	3.255	0.00121	0.046026	38	0.014141	no	ADPSBQ
chr1_1967495_T_C_b38	SLC35E2	3.255	0.00121	0.046026	38	0.014141	no	ADPSBQ
chr1_1967536_G_A_b38	SLC35E2	3.255	0.00121	0.046026	38	0.014141	no	ADPSBQ
chr1_1967725_G_C_b38	SLC35E2	3.255	0.00121	0.046026	38	0.014141	no	ADPSBQ
chr1_1967840_A_T_b38	SLC35E2	3.255	0.00121	0.046026	38	0.014141	no	ADPSBQ
chr1_1967880_T_C_b38	SLC35E2	3.255	0.00121	0.046026	38	0.014141	no	ADPSBQ
chr1_1968422_C_T_b38	SLC35E2	3.255	0.00121	0.046026	38	0.014141	no	ADPSBQ
chr1_1901262_C_T_b38	SLC35E2	-3.252	0.00122	-0.045246	120	0.013915	no	ADPSBQ
chr1_1901386_C_A_b38	SLC35E2	-3.252	0.00122	-0.045246	120	0.013915	no	ADPSBQ
chr1_1688786_G_A_b38	SLC35E2	-3.244	0.00126	-0.054304	27	0.016741	no	ADPSBQ
chr1_1976566_T_C_b38	SLC35E2	3.241	0.00127	0.040896	115	0.012619	no	ADPSBQ
chr1_1968924_GCCCTCCTGGGGGCTCCGGTCCTGCCCAGCAGCCCCAGGTGAGACAGCGCCTGGCGGCCCCTCCCTAGCT_G_b38	SLC35E2	3.24	0.00127	0.045203	41	0.01395	no	ADPSBQ
chr1_1968667_T_TCTC_b38	SLC35E2	3.235	0.00129	0.045635	38	0.014106	no	ADPSBQ
chr1_1595306_CAG_C_b38	SLC35E2	-3.231	0.00131	-0.043722	133	0.013531	no	ADPSBQ
chr1_1965250_G_GA_b38	SLC35E2	3.227	0.00133	0.045424	41	0.014075	no	ADPSBQ
chr1_1918090_A_G_b38	SLC35E2	-3.22	0.00136	-0.044498	119	0.013819	no	ADPSBQ
chr1_1919188_CAGCGGCAGG_C_b38	SLC35E2	-3.219	0.00137	-0.043756	121	0.013593	no	ADPSBQ
chr1_1968130_GTGAA_G_b38	SLC35E2	3.218	0.00137	0.045754	37	0.01422	no	ADPSBQ
chr1_1956754_C_A_b38	SLC35E2	3.216	0.00138	0.046798	33	0.014553	no	ADPSBQ
chr1_2676824_ACGGCC_A_b38	SLC35E2	-3.213	0.00139	-0.106817	6	0.033242	no	ADPSBQ
chr1_1969238_C_T_b38	SLC35E2	3.209	0.00141	0.047747	29	0.014877	no	ADPSBQ
chr1_996133_A_C_b38	SLC35E2	-3.196	0.00148	-0.100407	3	0.031419	no	ADPSBQ
chr1_1921333_C_T_b38	SLC35E2	-3.193	0.0015	-0.043591	123	0.013653	no	ADPSBQ
chr1_1921745_T_C_b38	SLC35E2	-3.189	0.00151	-0.042082	107	0.013194	no	ADPSBQ
chr1_1810086_A_G_b38	SLC35E2	3.183	0.00155	0.050509	24	0.01587	no	ADPSBQ
chr1_1688586_C_T_b38	SLC35E2	-3.178	0.00157	-0.050869	38	0.016006	no	ADPSBQ
chr1_1968012_GTGAA_G_b38	SLC35E2	3.174	0.00159	0.044813	39	0.014117	no	ADPSBQ
chr1_1688570_A_T_b38	SLC35E2	-3.17	0.00161	-0.05385	19	0.016986	no	ADPSBQ
chr1_1955672_GC_G_b38	SLC35E2	3.168	0.00163	0.04625	32	0.014599	no	ADPSBQ
chr1_1946058_T_C_b38	SLC35E2	-3.167	0.00163	-0.042924	122	0.013552	no	ADPSBQ
chr1_1946013_C_T_b38	SLC35E2	-3.162	0.00166	-0.042937	121	0.013577	no	ADPSBQ
chr1_1985090_C_T_b38	SLC35E2	3.16	0.00167	0.042457	82	0.013436	no	ADPSBQ
chr1_1902439_C_T_b38	SLC35E2	-3.153	0.00171	-0.043967	119	0.013945	no	ADPSBQ
chr1_1589057_T_C_b38	SLC35E2	-3.152	0.00172	-0.042093	79	0.013355	no	ADPSBQ
chr1_1929713_G_A_b38	SLC35E2	3.147	0.00175	0.046626	29	0.014816	no	ADPSBQ
chr1_1969229_T_A_b38	SLC35E2	3.142	0.00178	0.047106	29	0.014992	no	ADPSBQ
chr1_1875208_T_C_b38	SLC35E2	-3.141	0.00178	-0.043568	119	0.013869	no	ADPSBQ
chr1_1914345_C_T_b38	SLC35E2	-3.14	0.00179	-0.043275	120	0.013781	no	ADPSBQ
chr1_1914918_G_A_b38	SLC35E2	-3.14	0.00179	-0.043275	120	0.013781	no	ADPSBQ
chr1_1916217_C_T_b38	SLC35E2	-3.14	0.00179	-0.043275	120	0.013781	no	ADPSBQ
chr1_1915022_C_T_b38	SLC35E2	3.127	0.00187	0.045771	33	0.014637	no	ADPSBQ
chr1_1955652_CG_C_b38	SLC35E2	3.116	0.00194	0.045365	33	0.014561	no	ADPSBQ
chr1_1880596_T_A_b38	SLC35E2	-3.105	0.00201	-0.044249	104	0.014253	no	ADPSBQ
chr1_1948938_C_T_b38	SLC35E2	-3.103	0.00202	-0.037153	106	0.011972	no	ADPSBQ
chr1_1945121_T_C_b38	SLC35E2	-3.099	0.00205	-0.04187	123	0.013509	no	ADPSBQ
chr1_1938467_C_T_b38	SLC35E2	3.099	0.00205	0.04614	28	0.014887	no	ADPSBQ
chr1_1944074_T_C_b38	SLC35E2	-3.098	0.00206	-0.041928	121	0.013535	no	ADPSBQ
chr1_1944091_G_C_b38	SLC35E2	-3.098	0.00206	-0.041928	121	0.013535	no	ADPSBQ
chr1_1915326_G_A_b38	SLC35E2	-3.094	0.00209	-0.042787	120	0.013831	no	ADPSBQ
chr1_1947189_C_T_b38	SLC35E2	-3.093	0.00209	-0.041753	123	0.0135	no	ADPSBQ
chr1_1944182_G_C_b38	SLC35E2	-3.092	0.0021	-0.04201	121	0.013588	no	ADPSBQ
chr1_1944420_A_G_b38	SLC35E2	-3.089	0.00212	-0.041683	123	0.013493	no	ADPSBQ
chr1_1902481_G_A_b38	SLC35E2	-3.088	0.00212	-0.042882	119	0.013885	no	ADPSBQ
chr1_1985451_C_T_b38	SLC35E2	3.088	0.00213	0.041326	83	0.013383	no	ADPSBQ
chr1_1589151_C_T_b38	SLC35E2	-3.084	0.00216	-0.041149	79	0.013345	no	ADPSBQ
chr1_1918989_A_G_b38	SLC35E2	-3.073	0.00224	-0.040627	110	0.013222	no	ADPSBQ
chr1_1944419_C_G_b38	SLC35E2	-3.068	0.00227	-0.041477	123	0.013521	no	ADPSBQ
chr1_1946632_C_T_b38	SLC35E2	-3.068	0.00227	-0.041477	123	0.013521	no	ADPSBQ
chr1_1991761_T_C_b38	SLC35E2	3.064	0.0023	0.040596	86	0.01325	no	ADPSBQ
chr1_1891450_G_A_b38	SLC35E2	3.063	0.00231	0.044124	40	0.014406	no	ADPSBQ
chr1_1944216_C_T_b38	SLC35E2	-3.061	0.00233	-0.042033	118	0.013733	no	ADPSBQ
chr1_1931743_CA_C_b38	SLC35E2	-3.055	0.00237	-0.049203	45	0.016106	no	ADPSBQ
chr1_1948515_C_T_b38	SLC35E2	-3.055	0.00237	-0.040617	132	0.013297	no	ADPSBQ
chr1_1938125_TCA_T_b38	SLC35E2	-3.051	0.0024	-0.041139	120	0.013486	no	ADPSBQ
chr1_1942887_C_G_b38	SLC35E2	-3.049	0.00242	-0.040928	123	0.013425	no	ADPSBQ
chr1_1746439_GA_G_b38	SLC35E2	3.048	0.00242	0.043417	98	0.014244	no	ADPSBQ
chr1_1942186_G_A_b38	SLC35E2	3.047	0.00243	0.0454	28	0.014902	no	ADPSBQ
chr1_1927692_C_T_b38	SLC35E2	3.046	0.00244	0.045663	27	0.014993	no	ADPSBQ
chr1_1466535_C_CA_b38	SLC35E2	3.04	0.00249	0.060515	13	0.019905	no	ADPSBQ
chr1_1947648_G_A_b38	SLC35E2	3.039	0.0025	0.045365	28	0.01493	no	ADPSBQ
chr1_1957014_G_A_b38	SLC35E2	3.035	0.00252	0.043021	40	0.014173	no	ADPSBQ
chr1_1957636_C_T_b38	SLC35E2	3.035	0.00252	0.043021	40	0.014173	no	ADPSBQ
chr1_1901149_A_AAAGAAAGGAAGAAAGG_b38	SLC35E2	-3.028	0.00259	-0.040865	122	0.013495	no	ADPSBQ
chr1_1981144_T_G_b38	SLC35E2	3.024	0.00262	0.043971	39	0.014539	no	ADPSBQ
chr1_1891444_CG_C_b38	SLC35E2	-3.024	0.00262	-0.041966	111	0.013878	no	ADPSBQ
chr1_1983048_A_G_b38	SLC35E2	3.021	0.00265	0.040718	85	0.013479	no	ADPSBQ
chr1_1937802_G_T_b38	SLC35E2	-3.015	0.0027	-0.041917	118	0.013905	no	ADPSBQ
chr1_1913643_T_C_b38	SLC35E2	-3.011	0.00273	-0.042847	108	0.014228	no	ADPSBQ
chr1_1296207_G_A_b38	SLC35E2	3.008	0.00276	0.082274	3	0.027351	no	ADPSBQ
chr1_1956891_C_T_b38	SLC35E2	2.996	0.00287	0.042478	40	0.014177	no	ADPSBQ
chr1_1924788_C_T_b38	SLC35E2	-2.991	0.00292	-0.041014	123	0.013715	no	ADPSBQ
chr1_1928119_T_C_b38	SLC35E2	2.982	0.003	0.044942	27	0.01507	no	ADPSBQ
chr1_1708951_C_T_b38	SLC35E2	2.981	0.00301	0.03846	98	0.012902	no	ADPSBQ
chr1_1948519_T_C_b38	SLC35E2	-2.981	0.00301	-0.03965	132	0.013301	no	ADPSBQ
chr1_1937895_C_T_b38	SLC35E2	-2.972	0.0031	-0.040067	122	0.01348	no	ADPSBQ
chr1_2290738_G_A_b38	SLC35E2	-2.97	0.00312	-0.050117	18	0.016873	no	ADPSBQ
chr1_1938221_TCA_T_b38	SLC35E2	2.969	0.00313	0.044043	29	0.014834	no	ADPSBQ
chr1_1691417_T_C_b38	SLC35E2	2.969	0.00313	0.041115	105	0.013849	no	ADPSBQ
chr1_1948594_G_GTTT_b38	SLC35E2	-2.967	0.00315	-0.086068	8	0.029006	no	ADPSBQ
chr1_1935938_T_C_b38	SLC35E2	-2.962	0.0032	-0.04007	92	0.013528	no	ADPSBQ
chr1_1925281_C_T_b38	SLC35E2	-2.947	0.00335	-0.040596	121	0.013775	no	ADPSBQ
chr1_1680672_C_T_b38	SLC35E2	-2.941	0.00342	-0.039828	100	0.013543	no	ADPSBQ
chr1_1679993_A_G_b38	SLC35E2	-2.939	0.00344	-0.037723	128	0.012834	no	ADPSBQ
chr1_1925233_T_C_b38	SLC35E2	-2.924	0.00361	-0.040223	122	0.013755	no	ADPSBQ
chr1_1920695_A_G_b38	SLC35E2	-2.923	0.00362	-0.040201	122	0.013755	no	ADPSBQ
chr1_1934896_C_T_b38	SLC35E2	2.914	0.00372	0.045131	22	0.015486	no	ADPSBQ
chr1_1319648_G_A_b38	SLC35E2	2.913	0.00373	0.080862	3	0.027758	no	ADPSBQ
chr1_1737504_A_C_b38	SLC35E2	2.902	0.00387	0.036706	156	0.012648	no	ADPSBQ
chr1_1948037_T_A_b38	SLC35E2	2.894	0.00397	0.048042	18	0.016603	no	ADPSBQ
chr1_1955080_C_CGGCTCACACCGGAAGTGAGGCTCACACCGGAAGTGA_b38	SLC35E2	-2.893	0.00398	-0.039296	103	0.013582	no	ADPSBQ
chr1_1935987_G_A_b38	SLC35E2	-2.885	0.00407	-0.03926	124	0.013606	no	ADPSBQ
chr1_1978114_T_A_b38	SLC35E2	2.881	0.00413	0.038786	57	0.013463	no	ADPSBQ
chr1_1891450_G_C_b38	SLC35E2	-2.88	0.00414	-0.040235	111	0.013969	no	ADPSBQ
chr1_2298039_C_T_b38	SLC35E2	-2.877	0.00419	-0.048443	17	0.016839	no	ADPSBQ
chr1_1944675_C_T_b38	SLC35E2	-2.871	0.00426	-0.03894	121	0.013564	no	ADPSBQ
chr1_1971864_C_T_b38	SLC35E2	2.87	0.00427	0.036243	105	0.012628	no	ADPSBQ
chr1_1356751_A_G_b38	SLC35E2	2.87	0.00428	0.080218	3	0.027954	no	ADPSBQ
chr1_1927857_T_C_b38	SLC35E2	-2.867	0.00432	-0.039434	122	0.013755	no	ADPSBQ
chr1_1930143_C_T_b38	SLC35E2	-2.859	0.00442	-0.039386	122	0.013776	no	ADPSBQ
chr1_1366183_TGA_T_b38	SLC35E2	2.857	0.00445	0.079845	3	0.027949	no	ADPSBQ
chr1_1909237_G_T_b38	SLC35E2	2.856	0.00447	0.041067	40	0.014381	no	ADPSBQ
chr1_1697272_G_A_b38	SLC35E2	2.854	0.00449	0.059195	34	0.02074	no	ADPSBQ
chr1_1925307_C_A_b38	SLC35E2	-2.846	0.00461	-0.03963	115	0.013926	no	ADPSBQ
chr1_1742432_T_TA_b38	SLC35E2	2.838	0.00473	0.039072	86	0.01377	no	ADPSBQ
chr1_1990864_C_T_b38	SLC35E2	2.834	0.00478	0.038522	100	0.013592	no	ADPSBQ
chr1_2459410_TGGTGGTCCTCCTTGCC_T_b38	SLC35E2	-2.807	0.00519	-0.038994	56	0.01389	no	ADPSBQ
chr1_1768171_CA_C_b38	SLC35E2	2.805	0.00523	0.044947	21	0.016025	no	ADPSBQ
chr1_1688409_C_G_b38	SLC35E2	-2.803	0.00525	-0.03801	85	0.01356	no	ADPSBQ
chr1_1929904_C_T_b38	SLC35E2	-2.802	0.00528	-0.038485	122	0.013737	no	ADPSBQ
chr1_1597128_C_CCCTCAGCTGGACT_b38	SLC35E2	-2.8	0.0053	-0.035207	93	0.012574	no	ADPSBQ
chr1_1991213_T_C_b38	SLC35E2	2.792	0.00544	0.037876	93	0.013567	no	ADPSBQ
chr1_1906439_C_T_b38	SLC35E2	2.772	0.00577	0.039788	39	0.014352	no	ADPSBQ
chr1_1955420_C_T_b38	SLC35E2	2.763	0.00593	0.040674	32	0.014719	no	ADPSBQ
chr1_1885444_TTAGA_T_b38	SLC35E2	2.757	0.00605	0.039976	37	0.014502	no	ADPSBQ
chr1_1978262_C_T_b38	SLC35E2	2.756	0.00606	0.036829	58	0.013364	no	ADPSBQ
chr1_1978294_G_T_b38	SLC35E2	2.756	0.00606	0.036829	58	0.013364	no	ADPSBQ
chr1_1955806_G_A_b38	SLC35E2	2.754	0.00609	0.040842	30	0.014828	no	ADPSBQ
chr1_1223061_GCA_G_b38	SLC35E2	2.745	0.00627	0.069575	3	0.025348	no	ADPSBQ
chr1_1986211_T_C_b38	SLC35E2	2.736	0.00644	0.03702	56	0.013531	no	ADPSBQ
chr1_1947645_C_T_b38	SLC35E2	-2.728	0.0066	-0.037181	117	0.013631	no	ADPSBQ
chr1_1986010_T_G_b38	SLC35E2	2.716	0.00682	0.036535	57	0.01345	no	ADPSBQ
chr1_1978562_C_G_b38	SLC35E2	2.716	0.00683	0.03629	59	0.013361	no	ADPSBQ
chr1_1978573_T_C_b38	SLC35E2	2.716	0.00683	0.03629	59	0.013361	no	ADPSBQ
chr1_1792696_C_CA_b38	SLC35E2	2.716	0.00684	0.037382	66	0.013765	no	ADPSBQ
chr1_2316305_G_A_b38	SLC35E2	-2.709	0.00697	-0.047986	12	0.017711	no	ADPSBQ
chr1_1918697_C_T_b38	SLC35E2	2.709	0.00698	0.039649	42	0.014638	no	ADPSBQ
chr1_1924659_C_T_b38	SLC35E2	2.705	0.00706	0.039608	40	0.014644	no	ADPSBQ
chr1_1984586_G_A_b38	SLC35E2	2.702	0.00712	0.036379	57	0.013464	no	ADPSBQ
chr1_2304920_G_A_b38	SLC35E2	-2.695	0.00726	-0.047752	12	0.017716	no	ADPSBQ
chr1_2342881_ATTTTAT_A_b38	SLC35E2	2.695	0.00727	0.109997	5	0.040811	no	ADPSBQ
chr1_1978404_C_T_b38	SLC35E2	2.692	0.00733	0.036141	57	0.013424	no	ADPSBQ
chr1_1978415_G_A_b38	SLC35E2	2.692	0.00733	0.036141	57	0.013424	no	ADPSBQ
chr1_1981319_G_C_b38	SLC35E2	2.68	0.0076	0.036185	56	0.013502	no	ADPSBQ
chr1_1986033_G_A_b38	SLC35E2	2.68	0.0076	0.036185	56	0.013502	no	ADPSBQ
chr1_1986176_A_T_b38	SLC35E2	2.68	0.0076	0.036185	56	0.013502	no	ADPSBQ
chr1_1986390_T_G_b38	SLC35E2	2.68	0.0076	0.036185	56	0.013502	no	ADPSBQ
chr1_1986469_A_C_b38	SLC35E2	2.68	0.0076	0.036185	56	0.013502	no	ADPSBQ
chr1_1987096_A_T_b38	SLC35E2	2.68	0.0076	0.036185	56	0.013502	no	ADPSBQ
chr1_1987156_G_A_b38	SLC35E2	2.68	0.0076	0.036185	56	0.013502	no	ADPSBQ
chr1_1978647_G_T_b38	SLC35E2	2.68	0.0076	0.035944	58	0.013413	no	ADPSBQ
chr1_1977879_G_A_b38	SLC35E2	2.667	0.00789	0.035716	58	0.013391	no	ADPSBQ
chr1_1679100_A_G_b38	SLC35E2	-2.667	0.0079	-0.034478	102	0.012929	no	ADPSBQ
chr1_1983166_A_T_b38	SLC35E2	2.666	0.00793	0.036036	56	0.013518	no	ADPSBQ
chr1_1983956_TGG_T_b38	SLC35E2	2.666	0.00793	0.036036	56	0.013518	no	ADPSBQ
chr1_1984859_C_T_b38	SLC35E2	2.666	0.00793	0.036036	56	0.013518	no	ADPSBQ
chr1_1985148_G_T_b38	SLC35E2	2.666	0.00793	0.036036	56	0.013518	no	ADPSBQ
chr1_1978797_T_C_b38	SLC35E2	2.662	0.00801	0.035666	58	0.013397	no	ADPSBQ
chr1_1976990_T_C_b38	SLC35E2	2.659	0.00808	0.035714	58	0.013431	no	ADPSBQ
chr1_1984595_C_T_b38	SLC35E2	2.654	0.00821	0.035773	57	0.01348	no	ADPSBQ
chr1_1912983_T_C_b38	SLC35E2	2.652	0.00825	0.037921	43	0.0143	no	ADPSBQ
chr1_1982826_T_C_b38	SLC35E2	2.648	0.00834	0.03552	58	0.013413	no	ADPSBQ
chr1_1924208_G_A_b38	SLC35E2	2.645	0.00842	0.03877	48	0.014657	no	ADPSBQ
chr1_1708505_G_C_b38	SLC35E2	2.643	0.00848	0.032247	89	0.012203	no	ADPSBQ
chr1_1976473_C_T_b38	SLC35E2	2.626	0.0089	0.035316	57	0.013449	no	ADPSBQ
chr1_1976573_T_C_b38	SLC35E2	2.626	0.0089	0.035316	57	0.013449	no	ADPSBQ
chr1_1976661_G_T_b38	SLC35E2	2.626	0.0089	0.035316	57	0.013449	no	ADPSBQ
chr1_1976946_C_T_b38	SLC35E2	2.626	0.0089	0.035316	57	0.013449	no	ADPSBQ
chr1_1977264_C_G_b38	SLC35E2	2.626	0.0089	0.035316	57	0.013449	no	ADPSBQ
chr1_1977765_A_G_b38	SLC35E2	2.626	0.0089	0.035316	57	0.013449	no	ADPSBQ
chr1_1980953_G_A_b38	SLC35E2	2.626	0.0089	0.035316	57	0.013449	no	ADPSBQ
chr1_1614340_C_T_b38	SLC35E2	2.626	0.00891	0.050457	9	0.019216	no	ADPSBQ
chr1_1596144_GAGAC_G_b38	SLC35E2	-2.625	0.00892	-0.036097	69	0.01375	no	ADPSBQ
chr1_2121289_T_A_b38	SLC35E2	2.624	0.00895	0.044863	15	0.017096	no	ADPSBQ
chr1_1615869_C_T_b38	SLC35E2	2.623	0.00898	0.036766	57	0.014018	no	ADPSBQ
chr1_1984601_T_C_b38	SLC35E2	2.619	0.00909	0.035333	57	0.013494	no	ADPSBQ
chr1_1978055_C_T_b38	SLC35E2	2.618	0.00911	0.035247	57	0.013465	no	ADPSBQ
chr1_1726126_G_A_b38	SLC35E2	2.597	0.00967	0.033172	140	0.012773	no	ADPSBQ
chr1_1589491_A_G_b38	SLC35E2	-2.591	0.00984	-0.034008	79	0.013125	no	ADPSBQ
chr1_799082_G_A_b38	SLC35E2	2.589	0.00989	0.047637	12	0.018397	no	ADPSBQ
chr1_1976646_A_G_b38	SLC35E2	2.588	0.00993	0.034968	56	0.013511	no	ADPSBQ
chr1_1593732_G_C_b38	SLC35E2	-2.588	0.00993	-0.032559	122	0.01258	no	ADPSBQ
chr1_1726162_T_C_b38	SLC35E2	2.588	0.00994	0.034678	126	0.013401	no	ADPSBQ
chr1_1913254_C_T_b38	SLC35E2	2.586	0.00999	0.036637	78	0.014169	no	ADPSBQ
chr1_1673060_G_A_b38	SLC35E2	8.981	1.08e-17	0.118498	109	0.013194	yes	ADPVSC
chr1_1673818_A_C_b38	SLC35E2	8.939	1.48e-17	0.116887	112	0.013076	yes	ADPVSC
chr1_1674868_G_A_b38	SLC35E2	8.93	1.59e-17	0.117405	110	0.013147	yes	ADPVSC
chr1_1674720_TGC_T_b38	SLC35E2	8.882	2.28e-17	0.117142	109	0.013188	yes	ADPVSC
chr1_1677720_T_G_b38	SLC35E2	8.847	2.97e-17	0.116026	112	0.013115	yes	ADPVSC
chr1_1671995_G_T_b38	SLC35E2	8.833	3.3e-17	0.115416	110	0.013066	yes	ADPVSC
chr1_1677726_A_T_b38	SLC35E2	8.756	5.85e-17	0.115179	112	0.013154	yes	ADPVSC
chr1_1676790_C_T_b38	SLC35E2	8.727	7.24e-17	0.113514	112	0.013007	yes	ADPVSC
chr1_1648736_G_A_b38	SLC35E2	8.186	3.69e-15	0.114906	95	0.014037	yes	ADPVSC
chr1_1671797_G_A_b38	SLC35E2	8.168	4.21e-15	0.109584	107	0.013417	yes	ADPVSC
chr1_1651653_C_T_b38	SLC35E2	7.734	8.63e-14	0.107823	104	0.013941	yes	ADPVSC
chr1_1649932_C_T_b38	SLC35E2	7.732	8.75e-14	0.108634	96	0.01405	yes	ADPVSC
chr1_1661562_G_C_b38	SLC35E2	7.441	6.23e-13	0.09548	105	0.012832	yes	ADPVSC
chr1_1646352_A_C_b38	SLC35E2	6.825	3.29e-11	0.138453	7	0.020286	yes	ADPVSC
chr1_1654662_CT_C_b38	SLC35E2	6.652	9.6e-11	0.103723	68	0.015593	yes	ADPVSC
chr1_1667424_T_TAAAATA_b38	SLC35E2	6.235	1.15e-09	0.092106	60	0.014772	yes	ADPVSC
chr1_1670423_AT_A_b38	SLC35E2	6.008	4.24e-09	0.100722	54	0.016764	yes	ADPVSC
chr1_1675228_C_CG_b38	SLC35E2	5.812	1.27e-08	0.087987	71	0.015139	yes	ADPVSC
chr1_1675132_A_G_b38	SLC35E2	5.796	1.38e-08	0.086762	62	0.014969	yes	ADPVSC
chr1_1742587_G_C_b38	SLC35E2	5.708	2.24e-08	0.080594	106	0.01412	yes	ADPVSC
chr1_1674633_C_CA_b38	SLC35E2	5.62	3.59e-08	0.082391	55	0.01466	yes	ADPVSC
chr1_1613769_C_T_b38	SLC35E2	5.531	5.78e-08	0.087834	46	0.015881	yes	ADPVSC
chr1_1612562_T_TC_b38	SLC35E2	5.53	5.81e-08	0.080006	56	0.014468	yes	ADPVSC
chr1_1667424_T_TAAATA_b38	SLC35E2	-5.491	7.12e-08	-0.076914	82	0.014006	yes	ADPVSC
chr1_1620609_G_A_b38	SLC35E2	5.454	8.68e-08	0.082018	53	0.015039	yes	ADPVSC
chr1_1622295_G_C_b38	SLC35E2	5.38	1.28e-07	0.081344	53	0.015121	yes	ADPVSC
chr1_1586962_C_T_b38	SLC35E2	5.276	2.18e-07	0.079454	61	0.015061	yes	ADPVSC
chr1_1708474_C_A_b38	SLC35E2	-5.251	2.47e-07	-0.095499	16	0.018188	yes	ADPVSC
chr1_1621352_G_A_b38	SLC35E2	5.237	2.66e-07	0.07953	53	0.015188	yes	ADPVSC
chr1_1743565_ATAT_A_b38	SLC35E2	-5.121	4.74e-07	-0.072086	73	0.014076	yes	ADPVSC
chr1_1676287_C_T_b38	SLC35E2	-5.07	6.1e-07	-0.092541	14	0.018252	yes	ADPVSC
chr1_1730405_G_C_b38	SLC35E2	4.992	8.96e-07	0.078229	67	0.015671	yes	ADPVSC
chr1_1600379_C_T_b38	SLC35E2	4.961	1.04e-06	0.075387	49	0.015197	yes	ADPVSC
chr1_1609058_G_A_b38	SLC35E2	4.959	1.05e-06	0.075031	50	0.015129	yes	ADPVSC
chr1_1755504_T_C_b38	SLC35E2	4.916	1.3e-06	0.069029	108	0.014043	yes	ADPVSC
chr1_1692151_T_C_b38	SLC35E2	-4.911	1.32e-06	-0.082221	35	0.016741	yes	ADPVSC
chr1_1607931_G_A_b38	SLC35E2	4.85	1.77e-06	0.073837	49	0.015223	yes	ADPVSC
chr1_1744652_C_T_b38	SLC35E2	-4.815	2.09e-06	-0.070525	85	0.014646	yes	ADPVSC
chr1_1726053_G_C_b38	SLC35E2	4.811	2.14e-06	0.102133	15	0.021231	yes	ADPVSC
chr1_1744499_C_T_b38	SLC35E2	-4.807	2.18e-06	-0.069451	84	0.014449	yes	ADPVSC
chr1_1744854_C_A_b38	SLC35E2	-4.781	2.47e-06	-0.066361	69	0.013882	yes	ADPVSC
chr1_1692286_C_A_b38	SLC35E2	4.665	4.23e-06	0.097672	4	0.020939	yes	ADPVSC
chr1_1653319_A_G_b38	SLC35E2	4.615	5.3e-06	0.073656	36	0.015959	yes	ADPVSC
chr1_1650664_CT_C_b38	SLC35E2	4.609	5.46e-06	0.079008	38	0.017143	yes	ADPVSC
chr1_1743544_CA_C_b38	SLC35E2	4.546	7.26e-06	0.063295	93	0.013923	yes	ADPVSC
chr1_1749637_G_T_b38	SLC35E2	4.523	8.05e-06	0.064938	76	0.014357	yes	ADPVSC
chr1_1606532_GTGGGCTGGGCTGGTCAGGCA_G_b38	SLC35E2	4.486	9.5e-06	0.06916	41	0.015416	yes	ADPVSC
chr1_1595028_C_CAG_b38	SLC35E2	4.482	9.67e-06	0.073379	32	0.016371	yes	ADPVSC
chr1_1606507_GTGGGC_G_b38	SLC35E2	4.471	1.02e-05	0.061706	108	0.013801	yes	ADPVSC
chr1_1750226_C_T_b38	SLC35E2	4.46	1.07e-05	0.06701	74	0.015025	yes	ADPVSC
chr1_1747695_A_G_b38	SLC35E2	-4.381	1.51e-05	-0.054636	102	0.012472	yes	ADPVSC
chr1_1764023_C_A_b38	SLC35E2	4.379	1.52e-05	0.065654	73	0.014992	yes	ADPVSC
chr1_1750428_G_C_b38	SLC35E2	-4.356	1.69e-05	-0.071467	62	0.016407	yes	ADPVSC
chr1_1755523_C_T_b38	SLC35E2	4.352	1.72e-05	0.06161	112	0.014157	yes	ADPVSC
chr1_1744096_C_T_b38	SLC35E2	-4.349	1.74e-05	-0.087478	53	0.020115	yes	ADPVSC
chr1_1743714_C_CA_b38	SLC35E2	4.346	1.76e-05	0.067975	61	0.015641	yes	ADPVSC
chr1_1750440_G_A_b38	SLC35E2	-4.334	1.86e-05	-0.071318	60	0.016457	yes	ADPVSC
chr1_1601796_A_C_b38	SLC35E2	4.311	2.06e-05	0.06563	60	0.015225	yes	ADPVSC
chr1_1757725_C_T_b38	SLC35E2	4.264	2.51e-05	0.064358	71	0.015093	yes	ADPVSC
chr1_1679100_A_G_b38	SLC35E2	-4.232	2.88e-05	-0.059704	83	0.014108	yes	ADPVSC
chr1_1740869_C_T_b38	SLC35E2	-4.231	2.89e-05	-0.163331	4	0.038601	yes	ADPVSC
chr1_1741174_TTCA_T_b38	SLC35E2	-4.231	2.89e-05	-0.163331	4	0.038601	yes	ADPVSC
chr1_1741497_G_A_b38	SLC35E2	-4.231	2.89e-05	-0.163331	4	0.038601	yes	ADPVSC
chr1_1742672_C_T_b38	SLC35E2	-4.224	2.97e-05	-0.063251	77	0.014973	yes	ADPVSC
chr1_1743238_G_C_b38	SLC35E2	-4.224	2.97e-05	-0.063251	77	0.014973	yes	ADPVSC
chr1_1731093_G_C_b38	SLC35E2	-4.211	3.15e-05	-0.158896	4	0.037733	yes	ADPVSC
chr1_1735087_A_C_b38	SLC35E2	-4.211	3.15e-05	-0.158896	4	0.037733	yes	ADPVSC
chr1_1735286_G_A_b38	SLC35E2	-4.211	3.15e-05	-0.158896	4	0.037733	yes	ADPVSC
chr1_1591703_T_C_b38	SLC35E2	4.206	3.22e-05	0.061406	90	0.0146	yes	ADPVSC
chr1_1756186_T_C_b38	SLC35E2	4.198	3.33e-05	0.062221	74	0.014822	yes	ADPVSC
chr1_1604202_G_A_b38	SLC35E2	4.192	3.42e-05	0.064217	59	0.015321	yes	ADPVSC
chr1_1744121_A_C_b38	SLC35E2	-4.171	3.72e-05	-0.084097	54	0.02016	yes	ADPVSC
chr1_1743886_C_T_b38	SLC35E2	-4.155	3.98e-05	-0.071131	34	0.017118	yes	ADPVSC
chr1_1726649_G_A_b38	SLC35E2	-4.122	4.58e-05	-0.153734	5	0.037299	yes	ADPVSC
chr1_1970506_T_A_b38	SLC35E2	-4.113	4.74e-05	-0.059214	71	0.014396	yes	ADPVSC
chr1_1754601_G_T_b38	SLC35E2	4.111	4.78e-05	0.062146	71	0.015115	yes	ADPVSC
chr1_1757074_G_T_b38	SLC35E2	4.093	5.17e-05	0.06122	72	0.014959	yes	ADPVSC
chr1_1743565_AT_A_b38	SLC35E2	4.023	6.87e-05	0.053646	113	0.013334	yes	ADPVSC
chr1_1668721_C_T_b38	SLC35E2	-4.014	7.14e-05	-0.064802	31	0.016145	yes	ADPVSC
chr1_1665061_C_T_b38	SLC35E2	-3.986	8e-05	-0.068698	20	0.017236	yes	ADPVSC
chr1_1743840_T_C_b38	SLC35E2	-3.979	8.22e-05	-0.068164	35	0.01713	yes	ADPVSC
chr1_1753033_C_T_b38	SLC35E2	-3.964	8.73e-05	-0.060519	103	0.015266	yes	ADPVSC
chr1_1722625_A_T_b38	SLC35E2	3.948	9.31e-05	0.072139	36	0.018272	yes	ADPVSC
chr1_1671148_C_T_b38	SLC35E2	3.928	0.000101	0.058789	46	0.014965	yes	ADPVSC
chr1_1750280_A_G_b38	SLC35E2	-3.923	0.000103	-0.058045	105	0.014796	yes	ADPVSC
chr1_1971864_C_T_b38	SLC35E2	3.911	0.000108	0.056308	73	0.014396	yes	ADPVSC
chr1_1744052_GAGA_G_b38	SLC35E2	-3.91	0.000108	-0.071367	25	0.018252	yes	ADPVSC
chr1_1668108_C_T_b38	SLC35E2	3.906	0.00011	0.059661	42	0.015273	yes	ADPVSC
chr1_1744028_A_AC_b38	SLC35E2	-3.906	0.00011	-0.073699	20	0.01887	yes	ADPVSC
chr1_1589495_CTTT_C_b38	SLC35E2	3.899	0.000113	0.063895	43	0.016388	yes	ADPVSC
chr1_1752126_G_A_b38	SLC35E2	3.89	0.000117	0.061758	56	0.015876	yes	ADPVSC
chr1_1743586_T_TAC_b38	SLC35E2	-3.887	0.000119	-0.060616	59	0.015593	yes	ADPVSC
chr1_1820337_A_G_b38	SLC35E2	3.887	0.000119	0.056733	87	0.014597	yes	ADPVSC
chr1_1801188_T_C_b38	SLC35E2	3.86	0.000132	0.07212	12	0.018684	yes	ADPVSC
chr1_1722626_AGCG_A_b38	SLC35E2	3.839	0.000143	0.07037	36	0.018328	yes	ADPVSC
chr1_1650195_A_G_b38	SLC35E2	-3.816	0.000157	-0.057519	44	0.015071	yes	ADPVSC
chr1_1594570_A_G_b38	SLC35E2	3.804	0.000164	0.058597	56	0.015402	yes	ADPVSC
chr1_1743851_C_T_b38	SLC35E2	-3.792	0.000173	-0.064963	35	0.017133	yes	ADPVSC
chr1_1671097_G_C_b38	SLC35E2	3.789	0.000175	0.057381	44	0.015144	yes	ADPVSC
chr1_1837255_A_AT_b38	SLC35E2	3.774	0.000185	0.069555	17	0.018429	yes	ADPVSC
chr1_1677707_C_T_b38	SLC35E2	-3.755	0.000199	-0.078399	13	0.020876	yes	ADPVSC
chr1_1692124_T_G_b38	SLC35E2	-3.748	0.000204	-0.06327	33	0.016879	yes	ADPVSC
chr1_1991690_A_G_b38	SLC35E2	3.745	0.000207	0.055669	79	0.014865	yes	ADPVSC
chr1_995982_G_A_b38	SLC35E2	3.737	0.000213	0.052251	77	0.013982	yes	ADPVSC
chr1_1752461_G_A_b38	SLC35E2	-3.732	0.000217	-0.057069	94	0.015291	yes	ADPVSC
chr1_1753361_G_A_b38	SLC35E2	-3.732	0.000217	-0.057069	94	0.015291	yes	ADPVSC
chr1_1848037_C_CTA_b38	SLC35E2	3.73	0.000219	0.055265	86	0.014816	yes	ADPVSC
chr1_1736729_G_T_b38	SLC35E2	3.72	0.000228	0.052088	122	0.014003	yes	ADPVSC
chr1_1753319_G_A_b38	SLC35E2	-3.716	0.000232	-0.056733	94	0.015268	yes	ADPVSC
chr1_1752730_C_G_b38	SLC35E2	-3.705	0.000241	-0.056798	94	0.01533	yes	ADPVSC
chr1_1865278_A_C_b38	SLC35E2	3.678	0.000267	0.054448	76	0.014804	yes	ADPVSC
chr1_1650383_G_T_b38	SLC35E2	-3.665	0.000281	-0.0614	27	0.016754	yes	ADPVSC
chr1_1751981_A_T_b38	SLC35E2	-3.656	0.000291	-0.065445	35	0.017903	yes	ADPVSC
chr1_1759611_C_T_b38	SLC35E2	-3.655	0.000292	-0.055393	98	0.015157	yes	ADPVSC
chr1_1991761_T_C_b38	SLC35E2	3.652	0.000295	0.055299	72	0.015144	yes	ADPVSC
chr1_1613974_G_A_b38	SLC35E2	3.641	0.000307	0.060004	34	0.01648	yes	ADPVSC
chr1_1722619_C_T_b38	SLC35E2	3.641	0.000308	0.06674	37	0.018331	yes	ADPVSC
chr1_1976566_T_C_b38	SLC35E2	3.633	0.000317	0.052491	81	0.014448	yes	ADPVSC
chr1_1658866_G_A_b38	SLC35E2	-3.623	0.00033	-0.055384	42	0.015289	yes	ADPVSC
chr1_1659114_A_G_b38	SLC35E2	-3.623	0.00033	-0.055384	42	0.015289	yes	ADPVSC
chr1_1659220_A_G_b38	SLC35E2	-3.623	0.00033	-0.055384	42	0.015289	yes	ADPVSC
chr1_1661420_C_A_b38	SLC35E2	-3.623	0.00033	-0.055384	42	0.015289	yes	ADPVSC
chr1_1752908_C_CCCT_b38	SLC35E2	-3.62	0.000332	-0.057976	79	0.016014	yes	ADPVSC
chr1_1725582_T_C_b38	SLC35E2	3.618	0.000335	0.048537	102	0.013414	yes	ADPVSC
chr1_1639348_G_T_b38	SLC35E2	-3.614	0.000341	-0.05413	52	0.014979	yes	ADPVSC
chr1_1650777_G_A_b38	SLC35E2	-3.596	0.000363	-0.055398	40	0.015404	yes	ADPVSC
chr1_1004625_A_G_b38	SLC35E2	3.595	0.000365	0.050564	82	0.014064	yes	ADPVSC
chr1_1794187_C_T_b38	SLC35E2	3.587	0.000376	0.070448	10	0.019638	yes	ADPVSC
chr1_1639685_G_A_b38	SLC35E2	-3.584	0.00038	-0.062023	21	0.017305	yes	ADPVSC
chr1_1731963_A_C_b38	SLC35E2	3.583	0.000382	0.049613	124	0.013847	yes	ADPVSC
chr1_1361679_G_A_b38	SLC35E2	3.563	0.000411	0.069383	30	0.019471	yes	ADPVSC
chr1_1736836_A_G_b38	SLC35E2	3.563	0.000411	0.049754	115	0.013965	yes	ADPVSC
chr1_1866635_T_TA_b38	SLC35E2	3.548	0.000435	0.055976	60	0.015777	yes	ADPVSC
chr1_1735176_C_T_b38	SLC35E2	3.545	0.000439	0.049289	123	0.013903	yes	ADPVSC
chr1_1844830_C_A_b38	SLC35E2	3.538	0.000451	0.05217	85	0.014747	yes	ADPVSC
chr1_1798974_C_T_b38	SLC35E2	3.535	0.000456	0.069522	10	0.019668	yes	ADPVSC
chr1_1618982_G_A_b38	SLC35E2	3.528	0.000467	0.058274	35	0.016517	yes	ADPVSC
chr1_1775996_G_A_b38	SLC35E2	3.524	0.000474	0.069005	11	0.019581	yes	ADPVSC
chr1_995371_C_G_b38	SLC35E2	3.524	0.000474	0.049317	76	0.013994	yes	ADPVSC
chr1_1748780_G_A_b38	SLC35E2	-3.518	0.000485	-0.052175	108	0.014832	yes	ADPVSC
chr1_1759354_G_A_b38	SLC35E2	-3.515	0.00049	-0.053327	96	0.01517	yes	ADPVSC
chr1_1306183_A_G_b38	SLC35E2	-3.508	0.000504	-0.148172	5	0.042241	yes	ADPVSC
chr1_1320653_C_T_b38	SLC35E2	-3.508	0.000504	-0.148172	5	0.042241	yes	ADPVSC
chr1_1659060_G_A_b38	SLC35E2	-3.497	0.000524	-0.056676	32	0.016209	yes	ADPVSC
chr1_1651137_C_T_b38	SLC35E2	-3.49	0.000537	-0.053905	40	0.015445	yes	ADPVSC
chr1_1651267_T_C_b38	SLC35E2	-3.49	0.000537	-0.053905	40	0.015445	yes	ADPVSC
chr1_1652061_T_C_b38	SLC35E2	-3.49	0.000537	-0.053905	40	0.015445	yes	ADPVSC
chr1_1652135_C_G_b38	SLC35E2	-3.49	0.000537	-0.053905	40	0.015445	yes	ADPVSC
chr1_1652191_C_T_b38	SLC35E2	-3.49	0.000537	-0.053905	40	0.015445	yes	ADPVSC
chr1_1652592_A_G_b38	SLC35E2	-3.49	0.000537	-0.053905	40	0.015445	yes	ADPVSC
chr1_1652779_A_G_b38	SLC35E2	-3.49	0.000537	-0.053905	40	0.015445	yes	ADPVSC
chr1_1653147_A_C_b38	SLC35E2	-3.49	0.000537	-0.053905	40	0.015445	yes	ADPVSC
chr1_1653396_T_C_b38	SLC35E2	-3.49	0.000537	-0.053905	40	0.015445	yes	ADPVSC
chr1_1653472_T_C_b38	SLC35E2	-3.49	0.000537	-0.053905	40	0.015445	yes	ADPVSC
chr1_1653811_G_A_b38	SLC35E2	-3.49	0.000537	-0.053905	40	0.015445	yes	ADPVSC
chr1_1653893_C_T_b38	SLC35E2	-3.49	0.000537	-0.053905	40	0.015445	yes	ADPVSC
chr1_1654143_G_A_b38	SLC35E2	-3.49	0.000537	-0.053905	40	0.015445	yes	ADPVSC
chr1_1654188_T_G_b38	SLC35E2	-3.49	0.000537	-0.053905	40	0.015445	yes	ADPVSC
chr1_1660683_C_T_b38	SLC35E2	-3.479	0.000558	-0.057715	27	0.016587	yes	ADPVSC
chr1_1756043_G_T_b38	SLC35E2	-3.449	0.000623	-0.052616	96	0.015255	yes	ADPVSC
chr1_1648826_A_G_b38	SLC35E2	-3.446	0.000629	-0.052466	48	0.015224	yes	ADPVSC
chr1_1881065_G_A_b38	SLC35E2	3.446	0.00063	0.068128	10	0.019772	yes	ADPVSC
chr1_1881798_C_T_b38	SLC35E2	3.446	0.00063	0.068128	10	0.019772	yes	ADPVSC
chr1_1732392_C_T_b38	SLC35E2	3.424	0.000681	0.047713	124	0.013934	yes	ADPVSC
chr1_1734174_A_G_b38	SLC35E2	3.424	0.000681	0.047713	124	0.013934	yes	ADPVSC
chr1_1734903_A_G_b38	SLC35E2	3.424	0.000681	0.047713	124	0.013934	yes	ADPVSC
chr1_1735980_A_C_b38	SLC35E2	3.424	0.000681	0.047713	124	0.013934	yes	ADPVSC
chr1_1740343_C_T_b38	SLC35E2	3.424	0.000681	0.047713	124	0.013934	yes	ADPVSC
chr1_1651926_T_C_b38	SLC35E2	-3.42	0.00069	-0.053012	40	0.015499	yes	ADPVSC
chr1_1319750_G_A_b38	SLC35E2	-3.418	0.000696	-0.135862	7	0.039751	yes	ADPVSC
chr1_1754482_TCCCTGGGACCGAAGTCGCCCCA_T_b38	SLC35E2	-3.414	0.000707	-0.052277	96	0.015314	yes	ADPVSC
chr1_1651574_G_A_b38	SLC35E2	-3.413	0.000707	-0.052789	40	0.015465	yes	ADPVSC
chr1_1664865_A_G_b38	SLC35E2	-3.4	0.000741	-0.051735	41	0.015214	yes	ADPVSC
chr1_1609909_G_T_b38	SLC35E2	3.393	0.00076	0.055432	38	0.016335	yes	ADPVSC
chr1_1361163_AACAC_A_b38	SLC35E2	-3.392	0.000764	-0.135337	9	0.039901	yes	ADPVSC
chr1_1740703_C_T_b38	SLC35E2	3.391	0.000765	0.047241	124	0.01393	yes	ADPVSC
chr1_1112601_G_A_b38	SLC35E2	3.381	0.000794	0.056038	32	0.016576	yes	ADPVSC
chr1_1652913_C_T_b38	SLC35E2	-3.378	0.000801	-0.055705	30	0.016489	yes	ADPVSC
chr1_1653934_G_A_b38	SLC35E2	-3.376	0.000809	-0.052257	40	0.01548	yes	ADPVSC
chr1_1648636_G_A_b38	SLC35E2	-3.374	0.000814	-0.051368	48	0.015225	yes	ADPVSC
chr1_1815255_G_T_b38	SLC35E2	3.369	0.000829	0.068447	10	0.020318	yes	ADPVSC
chr1_1781909_C_T_b38	SLC35E2	3.361	0.000853	0.049192	87	0.014638	yes	ADPVSC
chr1_1101667_C_T_b38	SLC35E2	3.36	0.000856	0.055366	33	0.01648	yes	ADPVSC
chr1_1775296_C_T_b38	SLC35E2	3.358	0.000859	0.067923	11	0.020225	yes	ADPVSC
chr1_1886690_A_C_b38	SLC35E2	3.357	0.000865	0.066818	10	0.019906	yes	ADPVSC
chr1_1062389_CG_C_b38	SLC35E2	3.345	0.000902	0.052899	37	0.015815	yes	ADPVSC
chr1_1714635_A_G_b38	SLC35E2	3.345	0.000902	0.068258	13	0.020408	yes	ADPVSC
chr1_1659940_A_C_b38	SLC35E2	-3.329	0.000953	-0.066341	9	0.019928	yes	ADPVSC
chr1_1594618_C_G_b38	SLC35E2	3.328	0.000957	0.0546	40	0.016407	yes	ADPVSC
chr1_1651421_GTAGCCCCTCTGAACGGTCTGTGACACACGCATGCTTTCAGCTAGAGTACTCTA_G_b38	SLC35E2	-3.322	0.000976	-0.051813	38	0.015596	yes	ADPVSC
chr1_1101437_T_C_b38	SLC35E2	3.314	0.001	0.054684	33	0.016499	yes	ADPVSC
chr1_1603989_T_C_b38	SLC35E2	3.309	0.00102	0.05365	39	0.016212	yes	ADPVSC
chr1_1707801_C_G_b38	SLC35E2	-3.298	0.00106	-0.102515	9	0.031086	yes	ADPVSC
chr1_995512_T_C_b38	SLC35E2	3.295	0.00107	0.045864	88	0.013917	yes	ADPVSC
chr1_1006159_C_T_b38	SLC35E2	3.295	0.00107	0.046353	83	0.014068	yes	ADPVSC
chr1_1651785_C_A_b38	SLC35E2	-3.294	0.00108	-0.050943	40	0.015467	yes	ADPVSC
chr1_1755713_G_A_b38	SLC35E2	-3.283	0.00112	-0.049506	86	0.01508	yes	ADPVSC
chr1_1920497_C_A_b38	SLC35E2	-3.281	0.00112	-0.064721	12	0.019723	yes	ADPVSC
chr1_1871210_G_T_b38	SLC35E2	3.276	0.00114	0.06645	10	0.020282	yes	ADPVSC
chr1_1714638_G_T_b38	SLC35E2	3.276	0.00115	0.068316	11	0.020856	yes	ADPVSC
chr1_1857305_G_GGGCT_b38	SLC35E2	3.264	0.00119	0.065241	10	0.01999	yes	ADPVSC
chr1_1016623_G_A_b38	SLC35E2	3.261	0.0012	0.047118	70	0.014447	yes	ADPVSC
chr1_1738295_G_T_b38	SLC35E2	3.26	0.00121	0.045396	123	0.013925	yes	ADPVSC
chr1_1005954_G_A_b38	SLC35E2	3.256	0.00123	0.045859	77	0.014086	yes	ADPVSC
chr1_1009184_T_C_b38	SLC35E2	3.241	0.00129	0.045898	77	0.014163	yes	ADPVSC
chr1_1637577_T_C_b38	SLC35E2	-3.23	0.00134	-0.052054	30	0.016114	yes	ADPVSC
chr1_1014863_A_C_b38	SLC35E2	3.225	0.00136	0.046255	74	0.014341	yes	ADPVSC
chr1_1857246_T_TAA_b38	SLC35E2	3.225	0.00137	0.064288	10	0.019937	yes	ADPVSC
chr1_1857250_C_G_b38	SLC35E2	3.225	0.00137	0.064288	10	0.019937	yes	ADPVSC
chr1_1882915_C_T_b38	SLC35E2	3.222	0.00138	0.064593	10	0.020047	yes	ADPVSC
chr1_1737504_A_C_b38	SLC35E2	3.221	0.00138	0.044361	128	0.013771	yes	ADPVSC
chr1_1008307_G_C_b38	SLC35E2	3.207	0.00145	0.045256	78	0.014111	yes	ADPVSC
chr1_1394423_A_G_b38	SLC35E2	-3.205	0.00146	-0.061128	46	0.019072	yes	ADPVSC
chr1_1855939_G_A_b38	SLC35E2	3.198	0.0015	0.06389	10	0.019981	yes	ADPVSC
chr1_1439805_G_C_b38	SLC35E2	-3.197	0.0015	-0.060347	19	0.018876	yes	ADPVSC
chr1_1880594_A_T_b38	SLC35E2	3.178	0.0016	0.061725	12	0.019424	yes	ADPVSC
chr1_1746440_A_G_b38	SLC35E2	-3.162	0.00169	-0.056707	29	0.017932	yes	ADPVSC
chr1_1389827_C_T_b38	SLC35E2	3.159	0.00171	0.060273	46	0.019082	yes	ADPVSC
chr1_1653863_C_A_b38	SLC35E2	-3.144	0.00179	-0.060422	10	0.019216	yes	ADPVSC
chr1_992993_A_G_b38	SLC35E2	3.143	0.00179	0.042685	98	0.013579	yes	ADPVSC
chr1_1855245_G_A_b38	SLC35E2	3.141	0.00181	0.063464	10	0.020204	yes	ADPVSC
chr1_1297051_CCA_C_b38	SLC35E2	-3.138	0.00183	-0.133516	5	0.042552	yes	ADPVSC
chr1_995786_A_G_b38	SLC35E2	3.136	0.00184	0.043419	89	0.013846	yes	ADPVSC
chr1_1361685_C_T_b38	SLC35E2	-3.133	0.00186	-0.063487	23	0.020263	yes	ADPVSC
chr1_1016184_A_G_b38	SLC35E2	3.132	0.00186	0.045278	76	0.014455	yes	ADPVSC
chr1_1005904_C_T_b38	SLC35E2	3.123	0.00192	0.0441	77	0.014121	yes	ADPVSC
chr1_1746522_GT_G_b38	SLC35E2	-3.118	0.00195	-0.054589	32	0.017505	yes	ADPVSC
chr1_1763635_AG_A_b38	SLC35E2	-3.116	0.00197	-0.101048	3	0.032427	yes	ADPVSC
chr1_1395346_A_G_b38	SLC35E2	-3.109	0.00201	-0.059502	45	0.01914	yes	ADPVSC
chr1_1779667_T_TTG_b38	SLC35E2	3.091	0.00213	0.050194	53	0.016237	yes	ADPVSC
chr1_1366561_AGT_A_b38	SLC35E2	3.09	0.00214	0.057129	48	0.018488	yes	ADPVSC
chr1_1005429_C_CA_b38	SLC35E2	3.09	0.00214	0.043525	78	0.014086	yes	ADPVSC
chr1_1926870_T_C_b38	SLC35E2	-3.09	0.00214	-0.04603	82	0.014897	yes	ADPVSC
chr1_1330125_G_A_b38	SLC35E2	3.073	0.00226	0.057001	49	0.018546	yes	ADPVSC
chr1_1018652_C_G_b38	SLC35E2	3.064	0.00233	0.04563	52	0.014891	yes	ADPVSC
chr1_972790_C_G_b38	SLC35E2	-3.063	0.00234	-0.09659	10	0.031535	yes	ADPVSC
chr1_1660408_T_C_b38	SLC35E2	-3.061	0.00235	-0.057025	9	0.018627	yes	ADPVSC
chr1_1760882_T_C_b38	SLC35E2	3.052	0.00242	0.044283	91	0.014508	yes	ADPVSC
chr1_1017114_A_AT_b38	SLC35E2	3.051	0.00243	0.046619	60	0.01528	yes	ADPVSC
chr1_1020697_C_T_b38	SLC35E2	3.049	0.00245	0.046463	42	0.01524	yes	ADPVSC
chr1_995153_C_G_b38	SLC35E2	3.048	0.00246	0.042644	84	0.013992	yes	ADPVSC
chr1_1387698_A_G_b38	SLC35E2	3.04	0.00252	0.058345	47	0.019193	yes	ADPVSC
chr1_1960609_G_C_b38	SLC35E2	-3.036	0.00256	-0.044714	75	0.014729	yes	ADPVSC
chr1_1014228_G_A_b38	SLC35E2	3.036	0.00256	0.042945	80	0.014147	yes	ADPVSC
chr1_1357246_C_T_b38	SLC35E2	-3.021	0.00268	-0.124277	8	0.041132	yes	ADPVSC
chr1_1749826_A_G_b38	SLC35E2	-3.01	0.00278	-0.043785	110	0.014546	yes	ADPVSC
chr1_995187_A_G_b38	SLC35E2	3.009	0.00279	0.041985	86	0.013952	yes	ADPVSC
chr1_1934565_G_A_b38	SLC35E2	-2.999	0.00287	-0.04602	92	0.015343	yes	ADPVSC
chr1_1868514_T_C_b38	SLC35E2	2.996	0.00291	0.084246	5	0.028119	yes	ADPVSC
chr1_982260_G_A_b38	SLC35E2	2.993	0.00294	0.052653	17	0.017593	yes	ADPVSC
chr1_982858_C_G_b38	SLC35E2	2.993	0.00294	0.052653	17	0.017593	yes	ADPVSC
chr1_1934821_C_G_b38	SLC35E2	-2.978	0.00308	-0.042328	49	0.014214	yes	ADPVSC
chr1_1402457_A_G_b38	SLC35E2	-2.975	0.00311	-0.057373	47	0.019286	yes	ADPVSC
chr1_1341803_C_T_b38	SLC35E2	-2.965	0.00321	-0.126168	5	0.042548	yes	ADPVSC
chr1_1371538_C_T_b38	SLC35E2	-2.965	0.00321	-0.126168	5	0.042548	yes	ADPVSC
chr1_1373079_A_G_b38	SLC35E2	-2.965	0.00321	-0.126168	5	0.042548	yes	ADPVSC
chr1_1373582_C_T_b38	SLC35E2	-2.965	0.00321	-0.126168	5	0.042548	yes	ADPVSC
chr1_1375923_C_T_b38	SLC35E2	-2.965	0.00321	-0.126168	5	0.042548	yes	ADPVSC
chr1_1376025_T_C_b38	SLC35E2	-2.965	0.00321	-0.126168	5	0.042548	yes	ADPVSC
chr1_1378550_G_A_b38	SLC35E2	-2.954	0.00332	-0.126049	5	0.042672	yes	ADPVSC
chr1_1378591_C_T_b38	SLC35E2	-2.954	0.00332	-0.126049	5	0.042672	yes	ADPVSC
chr1_1380206_G_A_b38	SLC35E2	-2.954	0.00332	-0.126049	5	0.042672	yes	ADPVSC
chr1_1382829_CAACAATCCAGT_C_b38	SLC35E2	-2.954	0.00332	-0.126049	5	0.042672	yes	ADPVSC
chr1_1395579_C_T_b38	SLC35E2	-2.954	0.00332	-0.126049	5	0.042672	yes	ADPVSC
chr1_1406131_A_G_b38	SLC35E2	-2.954	0.00332	-0.126049	5	0.042672	yes	ADPVSC
chr1_1739115_T_C_b38	SLC35E2	-2.952	0.00334	-0.105352	6	0.035688	yes	ADPVSC
chr1_1312114_T_C_b38	SLC35E2	2.942	0.00345	0.053066	52	0.018038	yes	ADPVSC
chr1_1345423_G_A_b38	SLC35E2	-2.941	0.00346	-0.133602	3	0.045428	yes	ADPVSC
chr1_985353_T_C_b38	SLC35E2	2.94	0.00348	0.090278	3	0.03071	yes	ADPVSC
chr1_1916417_G_T_b38	SLC35E2	-2.936	0.00352	-0.044124	90	0.01503	yes	ADPVSC
chr1_2392897_T_C_b38	SLC35E2	2.935	0.00353	0.043365	60	0.014774	yes	ADPVSC
chr1_1922670_A_G_b38	SLC35E2	-2.934	0.00354	-0.04413	88	0.015042	yes	ADPVSC
chr1_1937841_ACACCAGGTCCACCTCTGGACACAGGTCCACC_A_b38	SLC35E2	-2.934	0.00354	-0.043984	92	0.014993	yes	ADPVSC
chr1_1940540_G_A_b38	SLC35E2	-2.934	0.00354	-0.043984	92	0.014993	yes	ADPVSC
chr1_1411323_A_C_b38	SLC35E2	-2.931	0.00358	-0.056433	48	0.019256	yes	ADPVSC
chr1_1758323_T_C_b38	SLC35E2	2.929	0.0036	0.042992	81	0.01468	yes	ADPVSC
chr1_1384749_C_G_b38	SLC35E2	2.928	0.00361	0.055564	35	0.018977	yes	ADPVSC
chr1_1387763_CCT_C_b38	SLC35E2	2.928	0.00361	0.055564	35	0.018977	yes	ADPVSC
chr1_1388944_G_A_b38	SLC35E2	2.928	0.00361	0.055564	35	0.018977	yes	ADPVSC
chr1_1764994_G_A_b38	SLC35E2	-2.928	0.00361	-0.120727	4	0.041233	yes	ADPVSC
chr1_1742119_C_CA_b38	SLC35E2	-2.928	0.00361	-0.109204	4	0.037301	yes	ADPVSC
chr1_2697914_C_G_b38	SLC35E2	2.918	0.00373	0.049496	31	0.016965	yes	ADPVSC
chr1_1714674_G_C_b38	SLC35E2	2.914	0.00377	0.060481	31	0.020757	yes	ADPVSC
chr1_1650688_T_A_b38	SLC35E2	-2.913	0.00378	-0.048818	29	0.016759	yes	ADPVSC
chr1_1928648_C_T_b38	SLC35E2	-2.912	0.00379	-0.043709	88	0.01501	yes	ADPVSC
chr1_1938054_ACT_A_b38	SLC35E2	-2.91	0.00382	-0.043756	92	0.015036	yes	ADPVSC
chr1_1664757_T_C_b38	SLC35E2	-2.909	0.00383	-0.044491	41	0.015295	yes	ADPVSC
chr1_1641261_C_T_b38	SLC35E2	-2.907	0.00385	-0.052905	18	0.018198	yes	ADPVSC
chr1_1596899_A_C_b38	SLC35E2	2.907	0.00386	0.050265	27	0.017293	yes	ADPVSC
chr1_1828894_T_TAC_b38	SLC35E2	2.893	0.00403	0.043445	77	0.015018	yes	ADPVSC
chr1_1032846_C_A_b38	SLC35E2	2.888	0.00409	0.044064	46	0.015257	yes	ADPVSC
chr1_1914634_G_T_b38	SLC35E2	-2.876	0.00425	-0.043103	90	0.014989	yes	ADPVSC
chr1_1916670_G_C_b38	SLC35E2	-2.876	0.00425	-0.043103	90	0.014989	yes	ADPVSC
chr1_1323853_G_GA_b38	SLC35E2	-2.875	0.00425	-0.126403	4	0.043961	yes	ADPVSC
chr1_1627057_C_G_b38	SLC35E2	-2.871	0.0043	-0.049745	37	0.017324	yes	ADPVSC
chr1_1466535_C_CA_b38	SLC35E2	2.868	0.00435	0.068166	7	0.023768	yes	ADPVSC
chr1_1898043_T_C_b38	SLC35E2	2.865	0.00439	0.057673	10	0.02013	yes	ADPVSC
chr1_1825782_G_A_b38	SLC35E2	-2.861	0.00444	-0.082136	5	0.028706	yes	ADPVSC
chr1_1762759_AAATG_A_b38	SLC35E2	2.861	0.00445	0.042507	86	0.014858	yes	ADPVSC
chr1_1015925_A_ATT_b38	SLC35E2	2.859	0.00448	0.041953	58	0.014676	yes	ADPVSC
chr1_1981144_T_G_b38	SLC35E2	2.855	0.00452	0.047912	28	0.016779	yes	ADPVSC
chr1_2383024_G_T_b38	SLC35E2	2.855	0.00453	0.043951	54	0.015396	yes	ADPVSC
chr1_2383716_CA_C_b38	SLC35E2	2.855	0.00453	0.043951	54	0.015396	yes	ADPVSC
chr1_1931587_A_G_b38	SLC35E2	-2.844	0.00468	-0.042454	90	0.014927	yes	ADPVSC
chr1_1729859_A_G_b38	SLC35E2	2.843	0.0047	0.051508	15	0.018119	yes	ADPVSC
chr1_1026084_G_T_b38	SLC35E2	2.84	0.00475	0.043341	46	0.015262	yes	ADPVSC
chr1_1877316_A_T_b38	SLC35E2	2.839	0.00476	0.044589	62	0.015707	yes	ADPVSC
chr1_2375256_C_T_b38	SLC35E2	2.839	0.00476	0.040652	79	0.014322	yes	ADPVSC
chr1_2698995_G_C_b38	SLC35E2	2.838	0.00478	0.077155	8	0.02719	yes	ADPVSC
chr1_1400410_A_G_b38	SLC35E2	-2.835	0.00482	-0.053954	36	0.019034	yes	ADPVSC
chr1_1935938_T_C_b38	SLC35E2	-2.83	0.00489	-0.043251	76	0.015284	yes	ADPVSC
chr1_1940973_C_T_b38	SLC35E2	-2.83	0.0049	-0.042227	94	0.014923	yes	ADPVSC
chr1_1375678_TAA_T_b38	SLC35E2	-2.829	0.00491	-0.055717	15	0.019695	yes	ADPVSC
chr1_2207111_G_C_b38	SLC35E2	2.827	0.00493	0.066192	7	0.023411	yes	ADPVSC
chr1_2313782_C_T_b38	SLC35E2	-2.821	0.00503	-0.045249	48	0.016041	yes	ADPVSC
chr1_998719_G_C_b38	SLC35E2	2.82	0.00505	0.085598	5	0.030359	yes	ADPVSC
chr1_998726_A_G_b38	SLC35E2	2.82	0.00505	0.085598	5	0.030359	yes	ADPVSC
chr1_1025561_G_C_b38	SLC35E2	2.814	0.00514	0.042674	46	0.015166	yes	ADPVSC
chr1_1882449_A_AAG_b38	SLC35E2	2.811	0.00519	0.07243	4	0.025769	yes	ADPVSC
chr1_2372759_GACC_G_b38	SLC35E2	2.81	0.0052	0.043998	52	0.015658	yes	ADPVSC
chr1_2372762_C_CTG_b38	SLC35E2	2.81	0.0052	0.043998	52	0.015658	yes	ADPVSC
chr1_1302799_C_A_b38	SLC35E2	-2.806	0.00526	-0.128678	3	0.045855	yes	ADPVSC
chr1_1991835_C_T_b38	SLC35E2	2.804	0.0053	0.044678	61	0.015934	yes	ADPVSC
chr1_1978429_G_A_b38	SLC35E2	2.803	0.00532	0.044974	32	0.016048	yes	ADPVSC
chr1_1413611_CT_C_b38	SLC35E2	-2.801	0.00534	-0.1328	3	0.047413	yes	ADPVSC
chr1_1417340_A_G_b38	SLC35E2	-2.801	0.00534	-0.1328	3	0.047413	yes	ADPVSC
chr1_2375533_G_A_b38	SLC35E2	2.795	0.00544	0.043445	52	0.015543	yes	ADPVSC
chr1_1971127_G_A_b38	SLC35E2	2.792	0.00548	0.045096	30	0.016149	yes	ADPVSC
chr1_1936077_C_T_b38	SLC35E2	-2.792	0.00549	-0.041318	95	0.014799	yes	ADPVSC
chr1_973034_C_T_b38	SLC35E2	-2.791	0.0055	-0.085706	8	0.030703	yes	ADPVSC
chr1_1993346_G_A_b38	SLC35E2	2.789	0.00554	0.039943	98	0.014322	yes	ADPVSC
chr1_2205151_C_A_b38	SLC35E2	2.785	0.00561	0.071514	8	0.025678	yes	ADPVSC
chr1_1938332_A_ACT_b38	SLC35E2	-2.784	0.00562	-0.041062	96	0.014748	yes	ADPVSC
chr1_1358384_G_C_b38	SLC35E2	2.784	0.00563	0.051604	49	0.018536	yes	ADPVSC
chr1_1649846_G_A_b38	SLC35E2	-2.782	0.00566	-0.048288	20	0.017356	yes	ADPVSC
chr1_1936627_C_G_b38	SLC35E2	-2.781	0.00567	-0.042142	87	0.015152	yes	ADPVSC
chr1_1431014_G_A_b38	SLC35E2	-2.779	0.00571	-0.047751	30	0.017183	yes	ADPVSC
chr1_1004716_C_T_b38	SLC35E2	-2.776	0.00576	-0.039342	114	0.01417	yes	ADPVSC
chr1_1074098_G_C_b38	SLC35E2	-2.772	0.00583	-0.044837	34	0.016174	yes	ADPVSC
chr1_1026830_A_G_b38	SLC35E2	2.771	0.00584	0.0409	62	0.014758	yes	ADPVSC
chr1_1722599_G_A_b38	SLC35E2	2.771	0.00586	0.049714	47	0.017944	yes	ADPVSC
chr1_1739996_G_T_b38	SLC35E2	-2.767	0.00592	-0.11518	3	0.041626	yes	ADPVSC
chr1_1296403_A_G_b38	SLC35E2	-2.765	0.00595	-0.129499	3	0.046828	yes	ADPVSC
chr1_1411847_T_TCCAGGTC_b38	SLC35E2	-2.765	0.00596	-0.123346	4	0.04461	yes	ADPVSC
chr1_1308516_C_T_b38	SLC35E2	2.763	0.00599	0.049198	54	0.017803	yes	ADPVSC
chr1_1931580_CA_C_b38	SLC35E2	-2.763	0.00599	-0.041432	89	0.014995	yes	ADPVSC
chr1_1028979_GCCACGCCACCCTCTCCCAAGGAACCGAGCCCCAGCCCCTCGTGGGCCAAGGGCGCCCACAC_G_b38	SLC35E2	2.762	0.00602	0.065314	9	0.023651	yes	ADPVSC
chr1_1921745_T_C_b38	SLC35E2	-2.759	0.00607	-0.041487	88	0.015038	yes	ADPVSC
chr1_1067552_C_G_b38	SLC35E2	-2.751	0.00621	-0.044213	35	0.016071	yes	ADPVSC
chr1_2314194_C_T_b38	SLC35E2	-2.75	0.00622	-0.043778	46	0.015917	yes	ADPVSC
chr1_1641275_A_G_b38	SLC35E2	-2.75	0.00623	-0.042227	50	0.015354	yes	ADPVSC
chr1_1071610_G_A_b38	SLC35E2	-2.739	0.00643	-0.044627	35	0.016291	yes	ADPVSC
chr1_1722940_TAAG_T_b38	SLC35E2	2.739	0.00643	0.056842	28	0.020751	yes	ADPVSC
chr1_1942014_G_A_b38	SLC35E2	-2.739	0.00644	-0.041017	93	0.014975	yes	ADPVSC
chr1_1942075_A_G_b38	SLC35E2	-2.739	0.00644	-0.041017	93	0.014975	yes	ADPVSC
chr1_1942086_T_C_b38	SLC35E2	-2.739	0.00644	-0.041017	93	0.014975	yes	ADPVSC
chr1_1942260_G_C_b38	SLC35E2	-2.739	0.00644	-0.041017	93	0.014975	yes	ADPVSC
chr1_1005757_AGCCCCCGCAGCAGT_A_b38	SLC35E2	-2.737	0.00648	-0.038719	106	0.014147	yes	ADPVSC
chr1_1933087_C_T_b38	SLC35E2	-2.737	0.00649	-0.041235	87	0.015068	yes	ADPVSC
chr1_1933859_A_G_b38	SLC35E2	-2.737	0.00649	-0.041235	87	0.015068	yes	ADPVSC
chr1_1983507_C_T_b38	SLC35E2	2.731	0.0066	0.043697	32	0.016002	yes	ADPVSC
chr1_2371472_G_A_b38	SLC35E2	2.73	0.00661	0.047578	22	0.017426	yes	ADPVSC
chr1_1376162_G_C_b38	SLC35E2	2.73	0.00662	0.051784	35	0.018971	yes	ADPVSC
chr1_1377431_C_T_b38	SLC35E2	2.73	0.00662	0.051784	35	0.018971	yes	ADPVSC
chr1_2374713_C_T_b38	SLC35E2	2.727	0.00667	0.038662	82	0.014177	yes	ADPVSC
chr1_1992068_C_T_b38	SLC35E2	-2.726	0.0067	-0.097809	9	0.035882	yes	ADPVSC
chr1_1431026_CCACCCCCT_C_b38	SLC35E2	-2.722	0.00677	-0.049629	25	0.018231	yes	ADPVSC
chr1_1366427_AGTGTGATTGAATGAGT_A_b38	SLC35E2	2.718	0.00685	0.050366	34	0.018528	yes	ADPVSC
chr1_1378204_G_C_b38	SLC35E2	2.711	0.00701	0.050506	37	0.018633	yes	ADPVSC
chr1_1818305_TAAAAAAA_T_b38	SLC35E2	2.703	0.00716	0.056416	7	0.02087	yes	ADPVSC
chr1_1296364_G_T_b38	SLC35E2	-2.703	0.00717	-0.125257	3	0.046341	yes	ADPVSC
chr1_1299211_G_A_b38	SLC35E2	-2.703	0.00717	-0.125257	3	0.046341	yes	ADPVSC
chr1_1305900_C_T_b38	SLC35E2	-2.703	0.00717	-0.125257	3	0.046341	yes	ADPVSC
chr1_1312175_C_T_b38	SLC35E2	-2.703	0.00717	-0.125257	3	0.046341	yes	ADPVSC
chr1_1318689_A_C_b38	SLC35E2	-2.703	0.00717	-0.125257	3	0.046341	yes	ADPVSC
chr1_1320870_C_A_b38	SLC35E2	-2.703	0.00717	-0.125257	3	0.046341	yes	ADPVSC
chr1_1330068_G_A_b38	SLC35E2	-2.703	0.00717	-0.125257	3	0.046341	yes	ADPVSC
chr1_1334108_G_A_b38	SLC35E2	-2.703	0.00717	-0.125257	3	0.046341	yes	ADPVSC
chr1_1342873_C_T_b38	SLC35E2	-2.703	0.00717	-0.125257	3	0.046341	yes	ADPVSC
chr1_1343373_C_T_b38	SLC35E2	-2.703	0.00717	-0.125257	3	0.046341	yes	ADPVSC
chr1_1352103_A_C_b38	SLC35E2	-2.703	0.00717	-0.125257	3	0.046341	yes	ADPVSC
chr1_1353044_C_T_b38	SLC35E2	-2.703	0.00717	-0.125257	3	0.046341	yes	ADPVSC
chr1_1356127_G_C_b38	SLC35E2	-2.703	0.00717	-0.125257	3	0.046341	yes	ADPVSC
chr1_1359713_GACCCCACCCC_G_b38	SLC35E2	-2.703	0.00717	-0.125257	3	0.046341	yes	ADPVSC
chr1_1378109_C_T_b38	SLC35E2	-2.703	0.00717	-0.125257	3	0.046341	yes	ADPVSC
chr1_1395686_G_A_b38	SLC35E2	-2.703	0.00717	-0.125257	3	0.046341	yes	ADPVSC
chr1_1063015_A_G_b38	SLC35E2	-2.696	0.00731	-0.043746	33	0.016225	yes	ADPVSC
chr1_1748597_C_G_b38	SLC35E2	-2.696	0.00732	-0.042022	95	0.015588	yes	ADPVSC
chr1_1969229_T_A_b38	SLC35E2	2.692	0.0074	0.045361	23	0.016851	yes	ADPVSC
chr1_1942258_G_A_b38	SLC35E2	-2.69	0.00745	-0.040283	92	0.014977	yes	ADPVSC
chr1_1309988_G_A_b38	SLC35E2	2.689	0.00747	0.047898	54	0.017812	yes	ADPVSC
chr1_1313807_G_A_b38	SLC35E2	2.689	0.00747	0.047898	54	0.017812	yes	ADPVSC
chr1_2413252_A_G_b38	SLC35E2	-2.685	0.00756	-0.056436	8	0.021019	yes	ADPVSC
chr1_2413486_T_C_b38	SLC35E2	-2.685	0.00756	-0.056436	8	0.021019	yes	ADPVSC
chr1_1096804_A_G_b38	SLC35E2	-2.685	0.00756	-0.04506	31	0.016782	yes	ADPVSC
chr1_1394041_G_A_b38	SLC35E2	-2.682	0.00762	-0.065122	6	0.024279	yes	ADPVSC
chr1_1375678_TA_T_b38	SLC35E2	2.674	0.00781	0.051523	22	0.01927	yes	ADPVSC
chr1_1680672_C_T_b38	SLC35E2	-2.669	0.00793	-0.040564	84	0.0152	yes	ADPVSC
chr1_1370429_C_G_b38	SLC35E2	-2.665	0.00801	-0.105658	7	0.039643	yes	ADPVSC
chr1_1160003_G_A_b38	SLC35E2	2.665	0.00801	0.044501	37	0.016697	yes	ADPVSC
chr1_1777680_C_T_b38	SLC35E2	2.656	0.00823	0.074004	4	0.027863	yes	ADPVSC
chr1_1747472_A_T_b38	SLC35E2	-2.656	0.00823	-0.04131	95	0.015555	yes	ADPVSC
chr1_2197362_G_C_b38	SLC35E2	2.654	0.00827	0.061446	7	0.023151	yes	ADPVSC
chr1_1965250_G_GA_b38	SLC35E2	2.65	0.00836	0.043736	25	0.016502	yes	ADPVSC
chr1_1888382_A_AG_b38	SLC35E2	2.646	0.00847	0.061171	5	0.023119	yes	ADPVSC
chr1_946247_G_A_b38	SLC35E2	-2.641	0.00859	-0.040413	93	0.015303	yes	ADPVSC
chr1_1606559_C_CGGCTGGTCAGGCGTGGGGCG_b38	SLC35E2	-2.637	0.00869	-0.043929	30	0.016659	yes	ADPVSC
chr1_1324788_C_A_b38	SLC35E2	2.637	0.0087	0.065593	17	0.024877	yes	ADPVSC
chr1_955679_C_T_b38	SLC35E2	-2.63	0.00886	-0.039549	91	0.015036	yes	ADPVSC
chr1_956565_A_G_b38	SLC35E2	-2.63	0.00886	-0.039549	91	0.015036	yes	ADPVSC
chr1_1069047_G_A_b38	SLC35E2	-2.627	0.00893	-0.040564	45	0.015439	yes	ADPVSC
chr1_1366271_AGT_A_b38	SLC35E2	-2.617	0.0092	-0.120819	3	0.046161	yes	ADPVSC
chr1_967384_C_G_b38	SLC35E2	-2.617	0.00922	-0.039813	95	0.015216	yes	ADPVSC
chr1_1412179_C_T_b38	SLC35E2	-2.606	0.00951	-0.113518	4	0.043564	yes	ADPVSC
chr1_986629_G_A_b38	SLC35E2	2.602	0.0096	0.046397	18	0.017829	yes	ADPVSC
chr1_986280_C_T_b38	SLC35E2	2.602	0.00962	0.046235	18	0.01777	yes	ADPVSC
chr1_1096160_A_G_b38	SLC35E2	-2.601	0.00964	-0.043787	31	0.016835	yes	ADPVSC
chr1_1968012_GTGAA_G_b38	SLC35E2	2.596	0.00977	0.042834	26	0.016498	yes	ADPVSC
chr1_2331844_G_C_b38	SLC35E2	-2.595	0.0098	-0.057596	10	0.022191	yes	ADPVSC
chr1_1366299_AGT_A_b38	SLC35E2	-2.595	0.00981	-0.120216	3	0.046326	yes	ADPVSC
chr1_1965001_G_A_b38	SLC35E2	2.594	0.00984	0.043027	24	0.016588	yes	ADPVSC
chr1_1978932_G_A_b38	SLC35E2	2.591	0.00993	0.047323	16	0.018268	yes	ADPVSC
chr1_1585717_C_A_b38	SLC35E2	-2.59	0.00994	-0.058182	8	0.022461	yes	ADPVSC
chr1_1586215_A_G_b38	SLC35E2	-2.59	0.00994	-0.058182	8	0.022461	yes	ADPVSC
chr1_2197209_G_A_b38	SLC35E2	2.59	0.00996	0.060117	7	0.023215	yes	ADPVSC
chr1_1636278_G_T_b38	SLC35E2	7.132	4.7e-12	0.105171	82	0.014746	no	ADPVSC
chr1_1673968_GA_G_b38	SLC35E2	6.729	5.96e-11	0.105317	50	0.015651	no	ADPVSC
chr1_1660318_C_T_b38	SLC35E2	6.715	6.49e-11	0.145167	3	0.021617	no	ADPVSC
chr1_1649976_G_A_b38	SLC35E2	6.544	1.85e-10	0.093095	75	0.014227	no	ADPVSC
chr1_1739131_T_C_b38	SLC35E2	5.31	1.83e-07	0.073102	75	0.013767	no	ADPVSC
chr1_1672155_G_A_b38	SLC35E2	-4.945	1.13e-06	-0.078268	39	0.015828	no	ADPVSC
chr1_1661169_C_A_b38	SLC35E2	4.941	1.15e-06	0.078563	35	0.015901	no	ADPVSC
chr1_1600320_C_G_b38	SLC35E2	4.839	1.87e-06	0.073985	46	0.015288	no	ADPVSC
chr1_1650000_G_A_b38	SLC35E2	4.745	2.91e-06	0.068642	61	0.014466	no	ADPVSC
chr1_1658422_T_C_b38	SLC35E2	4.681	3.92e-06	0.082393	21	0.017602	no	ADPVSC
chr1_1708521_C_G_b38	SLC35E2	-4.657	4.37e-06	-0.074812	33	0.016063	no	ADPVSC
chr1_1615869_C_T_b38	SLC35E2	4.65	4.53e-06	0.072308	50	0.015551	no	ADPVSC
chr1_1835922_G_GAAA_b38	SLC35E2	-4.451	1.11e-05	-0.155557	7	0.034951	no	ADPVSC
chr1_1649993_A_G_b38	SLC35E2	-4.422	1.27e-05	-0.059575	121	0.013473	no	ADPVSC
chr1_1617375_T_C_b38	SLC35E2	4.399	1.4e-05	0.068038	52	0.015468	no	ADPVSC
chr1_1618213_C_G_b38	SLC35E2	4.399	1.4e-05	0.068038	52	0.015468	no	ADPVSC
chr1_1618290_G_C_b38	SLC35E2	4.399	1.4e-05	0.068038	52	0.015468	no	ADPVSC
chr1_1667948_A_G_b38	SLC35E2	-4.284	2.31e-05	-0.07397	20	0.017268	no	ADPVSC
chr1_1668717_C_G_b38	SLC35E2	-4.2	3.29e-05	-0.072595	20	0.017283	no	ADPVSC
chr1_1671724_C_T_b38	SLC35E2	-4.195	3.37e-05	-0.068044	32	0.016222	no	ADPVSC
chr1_1669576_G_A_b38	SLC35E2	-4.181	3.57e-05	-0.0721	20	0.017244	no	ADPVSC
chr1_1616547_T_C_b38	SLC35E2	4.173	3.7e-05	0.065835	48	0.015777	no	ADPVSC
chr1_1629332_G_T_b38	SLC35E2	4.148	4.1e-05	0.067841	45	0.016356	no	ADPVSC
chr1_1615322_A_G_b38	SLC35E2	4.138	4.28e-05	0.065147	49	0.015743	no	ADPVSC
chr1_1606384_A_G_b38	SLC35E2	4.136	4.31e-05	0.063655	51	0.015389	no	ADPVSC
chr1_1630798_C_T_b38	SLC35E2	4.125	4.52e-05	0.06649	45	0.01612	no	ADPVSC
chr1_1669613_G_A_b38	SLC35E2	-4.121	4.58e-05	-0.070787	21	0.017175	no	ADPVSC
chr1_1613322_T_C_b38	SLC35E2	4.12	4.62e-05	0.064072	51	0.015552	no	ADPVSC
chr1_1613421_T_C_b38	SLC35E2	4.081	5.43e-05	0.064056	49	0.015698	no	ADPVSC
chr1_1668542_C_T_b38	SLC35E2	-4.067	5.74e-05	-0.070803	19	0.017409	no	ADPVSC
chr1_1619986_T_C_b38	SLC35E2	4.029	6.72e-05	0.064368	42	0.015977	no	ADPVSC
chr1_1728274_G_C_b38	SLC35E2	-3.892	0.000116	-0.153397	3	0.039409	no	ADPVSC
chr1_1661177_A_G_b38	SLC35E2	-3.821	0.000154	-0.065829	20	0.017227	no	ADPVSC
chr1_1688328_C_T_b38	SLC35E2	-3.8	0.000167	-0.064142	24	0.01688	no	ADPVSC
chr1_1729403_C_T_b38	SLC35E2	-3.761	0.000194	-0.14826	3	0.039418	no	ADPVSC
chr1_1730099_A_G_b38	SLC35E2	-3.761	0.000194	-0.14826	3	0.039418	no	ADPVSC
chr1_1840043_T_TA_b38	SLC35E2	3.743	0.000208	0.073492	8	0.019633	no	ADPVSC
chr1_1597128_C_CCCTCAGCTGGACT_b38	SLC35E2	-3.687	0.000258	-0.053491	77	0.014506	no	ADPVSC
chr1_2383824_C_G_b38	SLC35E2	3.645	0.000303	0.052714	76	0.014462	no	ADPVSC
chr1_1675091_A_G_b38	SLC35E2	-3.644	0.000305	-0.060719	24	0.016665	no	ADPVSC
chr1_1134273_C_T_b38	SLC35E2	3.616	0.000338	0.058617	31	0.016212	no	ADPVSC
chr1_1650370_C_CT_b38	SLC35E2	-3.599	0.00036	-0.072314	15	0.020095	no	ADPVSC
chr1_1665581_C_G_b38	SLC35E2	-3.589	0.000373	-0.060329	23	0.01681	no	ADPVSC
chr1_1717507_T_C_b38	SLC35E2	3.583	0.000382	0.082679	14	0.023079	no	ADPVSC
chr1_983004_G_T_b38	SLC35E2	-3.564	0.000409	-0.050157	116	0.014073	no	ADPVSC
chr1_1822247_A_G_b38	SLC35E2	3.562	0.000413	0.069237	11	0.019439	no	ADPVSC
chr1_1638879_C_T_b38	SLC35E2	-3.561	0.000414	-0.060291	24	0.016931	no	ADPVSC
chr1_1608244_T_C_b38	SLC35E2	3.553	0.000427	0.058186	34	0.016378	no	ADPVSC
chr1_1132482_T_C_b38	SLC35E2	3.497	0.000524	0.061193	20	0.017501	no	ADPVSC
chr1_1948594_G_GTTT_b38	SLC35E2	-3.475	0.000567	-0.113623	7	0.032699	no	ADPVSC
chr1_1719638_C_CTCGCTCTGTCACCCAGGCT_b38	SLC35E2	3.469	0.000579	0.078527	18	0.022636	no	ADPVSC
chr1_1986752_A_G_b38	SLC35E2	3.424	0.00068	0.052866	74	0.015439	no	ADPVSC
chr1_1837340_C_T_b38	SLC35E2	3.406	0.000727	0.066611	11	0.019559	no	ADPVSC
chr1_1846651_T_G_b38	SLC35E2	3.389	0.000772	0.066176	11	0.019528	no	ADPVSC
chr1_1595366_G_C_b38	SLC35E2	-3.368	0.000831	-0.065376	9	0.019412	no	ADPVSC
chr1_1130717_G_A_b38	SLC35E2	3.348	0.000892	0.061342	17	0.018323	no	ADPVSC
chr1_1591419_A_G_b38	SLC35E2	3.334	0.000935	0.064438	13	0.019325	no	ADPVSC
chr1_1658830_C_G_b38	SLC35E2	-3.307	0.00103	-0.055515	22	0.016785	no	ADPVSC
chr1_1132196_G_A_b38	SLC35E2	3.284	0.00111	0.058992	19	0.017961	no	ADPVSC
chr1_1782906_T_G_b38	SLC35E2	3.268	0.00118	0.063441	12	0.019416	no	ADPVSC
chr1_1967499_G_A_b38	SLC35E2	3.259	0.00122	0.050306	65	0.015437	no	ADPVSC
chr1_1134222_T_C_b38	SLC35E2	3.257	0.00122	0.048791	54	0.014979	no	ADPVSC
chr1_981454_G_A_b38	SLC35E2	-3.256	0.00123	-0.04546	103	0.013963	no	ADPVSC
chr1_1963538_T_C_b38	SLC35E2	3.238	0.0013	0.049811	63	0.015381	no	ADPVSC
chr1_1968793_T_C_b38	SLC35E2	3.213	0.00142	0.049194	67	0.015312	no	ADPVSC
chr1_1022518_G_T_b38	SLC35E2	3.203	0.00147	0.046296	59	0.014455	no	ADPVSC
chr1_1431656_G_A_b38	SLC35E2	-3.197	0.0015	-0.066092	11	0.020671	no	ADPVSC
chr1_1133503_G_A_b38	SLC35E2	3.188	0.00155	0.05817	18	0.018247	no	ADPVSC
chr1_1830575_T_C_b38	SLC35E2	3.177	0.0016	0.081758	8	0.025732	no	ADPVSC
chr1_1133966_C_T_b38	SLC35E2	3.176	0.00161	0.057778	17	0.018191	no	ADPVSC
chr1_1716796_A_C_b38	SLC35E2	3.175	0.00162	0.073552	16	0.023169	no	ADPVSC
chr1_1750508_A_C_b38	SLC35E2	-3.174	0.00162	-0.041717	101	0.013144	no	ADPVSC
chr1_983193_A_G_b38	SLC35E2	-3.157	0.00171	-0.044221	103	0.014006	no	ADPVSC
chr1_1704673_G_A_b38	SLC35E2	-3.145	0.00179	-0.080582	13	0.025625	no	ADPVSC
chr1_1963533_C_CA_b38	SLC35E2	3.141	0.00181	0.047828	67	0.015228	no	ADPVSC
chr1_1945913_T_C_b38	SLC35E2	-3.135	0.00184	-0.059309	12	0.018917	no	ADPVSC
chr1_1892085_G_C_b38	SLC35E2	3.127	0.00189	0.062472	9	0.019977	no	ADPVSC
chr1_1706963_G_A_b38	SLC35E2	-3.118	0.00195	-0.085836	11	0.027531	no	ADPVSC
chr1_1715541_A_C_b38	SLC35E2	3.113	0.00198	0.101741	3	0.032678	no	ADPVSC
chr1_1091421_T_A_b38	SLC35E2	-3.103	0.00205	-0.046776	79	0.015075	no	ADPVSC
chr1_1594131_T_C_b38	SLC35E2	-3.103	0.00205	-0.049865	35	0.016072	no	ADPVSC
chr1_1029365_A_ATCTATGCAGGCAGGTGGGGGGATCAGTG_b38	SLC35E2	3.099	0.00208	0.048685	35	0.015712	no	ADPVSC
chr1_1020217_G_T_b38	SLC35E2	3.098	0.00209	0.046057	51	0.014866	no	ADPVSC
chr1_1945842_A_AAAAGAAC_b38	SLC35E2	-3.09	0.00214	-0.04896	70	0.015847	no	ADPVSC
chr1_1596162_GAGC_G_b38	SLC35E2	-3.085	0.00218	-0.059529	6	0.019299	no	ADPVSC
chr1_1021740_G_C_b38	SLC35E2	3.076	0.00225	0.045902	50	0.014925	no	ADPVSC
chr1_1707744_A_G_b38	SLC35E2	-3.064	0.00233	-0.081006	12	0.026436	no	ADPVSC
chr1_1721197_CA_C_b38	SLC35E2	3.062	0.00235	0.072215	14	0.023583	no	ADPVSC
chr1_1987049_A_G_b38	SLC35E2	3.062	0.00235	0.046786	76	0.015281	no	ADPVSC
chr1_1714988_T_G_b38	SLC35E2	3.056	0.0024	0.073753	14	0.024136	no	ADPVSC
chr1_1715011_G_A_b38	SLC35E2	3.056	0.0024	0.073753	14	0.024136	no	ADPVSC
chr1_1876492_C_CGA_b38	SLC35E2	3.051	0.00243	0.063609	5	0.020849	no	ADPVSC
chr1_1065797_G_C_b38	SLC35E2	-3.042	0.00251	-0.046941	51	0.015433	no	ADPVSC
chr1_979560_T_C_b38	SLC35E2	-3.04	0.00252	-0.042643	109	0.014029	no	ADPVSC
chr1_1130420_C_T_b38	SLC35E2	3.036	0.00255	0.055343	18	0.018228	no	ADPVSC
chr1_1864334_AAAG_A_b38	SLC35E2	-3.034	0.00257	-0.051881	31	0.017101	no	ADPVSC
chr1_1707714_C_G_b38	SLC35E2	-3.029	0.00261	-0.081528	11	0.026914	no	ADPVSC
chr1_1707716_T_C_b38	SLC35E2	-3.029	0.00261	-0.081528	11	0.026914	no	ADPVSC
chr1_1437993_G_A_b38	SLC35E2	-3.026	0.00264	-0.055249	19	0.01826	no	ADPVSC
chr1_1018754_G_A_b38	SLC35E2	3.023	0.00266	0.04522	51	0.014956	no	ADPVSC
chr1_1845824_TACACAC_T_b38	SLC35E2	3.019	0.0027	0.055761	15	0.018468	no	ADPVSC
chr1_978953_C_G_b38	SLC35E2	-2.996	0.0029	-0.042325	96	0.014125	no	ADPVSC
chr1_1113195_CA_C_b38	SLC35E2	2.979	0.00307	0.050008	38	0.016787	no	ADPVSC
chr1_1022587_T_TTGTAGTCTGACCTGTGGTCTGAC_b38	SLC35E2	2.977	0.00309	0.131417	5	0.044139	no	ADPVSC
chr1_979472_G_C_b38	SLC35E2	-2.973	0.00313	-0.041783	105	0.014056	no	ADPVSC
chr1_978509_G_A_b38	SLC35E2	-2.969	0.00317	-0.041543	102	0.013994	no	ADPVSC
chr1_1721975_C_T_b38	SLC35E2	2.949	0.00338	0.071688	14	0.024311	no	ADPVSC
chr1_1903577_C_T_b38	SLC35E2	2.943	0.00344	0.060076	11	0.02041	no	ADPVSC
chr1_1720309_G_C_b38	SLC35E2	2.941	0.00346	0.071473	14	0.024299	no	ADPVSC
chr1_1720498_G_A_b38	SLC35E2	2.94	0.00347	0.071075	14	0.024175	no	ADPVSC
chr1_1708131_C_T_b38	SLC35E2	-2.938	0.00349	-0.079453	10	0.027041	no	ADPVSC
chr1_1614340_C_T_b38	SLC35E2	2.931	0.00357	0.062186	8	0.021215	no	ADPVSC
chr1_1595306_CAG_C_b38	SLC35E2	-2.93	0.00358	-0.046392	101	0.015832	no	ADPVSC
chr1_1717067_A_AT_b38	SLC35E2	2.929	0.00359	0.068881	17	0.023515	no	ADPVSC
chr1_1079456_A_G_b38	SLC35E2	-2.928	0.00361	-0.039677	121	0.013551	no	ADPVSC
chr1_1134070_C_T_b38	SLC35E2	2.926	0.00363	0.04478	49	0.015304	no	ADPVSC
chr1_1903242_C_T_b38	SLC35E2	2.918	0.00372	0.060643	9	0.02078	no	ADPVSC
chr1_1906935_C_T_b38	SLC35E2	2.918	0.00372	0.060643	9	0.02078	no	ADPVSC
chr1_1721922_C_T_b38	SLC35E2	2.917	0.00374	0.070923	14	0.024315	no	ADPVSC
chr1_1596173_G_A_b38	SLC35E2	-2.904	0.00389	-0.056026	6	0.019295	no	ADPVSC
chr1_1020681_A_AG_b38	SLC35E2	2.899	0.00395	0.044533	41	0.01536	no	ADPVSC
chr1_1708855_TTCCTCCTCC_T_b38	SLC35E2	2.897	0.00398	0.04472	88	0.015439	no	ADPVSC
chr1_2263866_C_CA_b38	SLC35E2	-2.88	0.00419	-0.052857	18	0.01835	no	ADPVSC
chr1_1593732_G_C_b38	SLC35E2	-2.868	0.00436	-0.041877	94	0.014604	no	ADPVSC
chr1_1943142_A_G_b38	SLC35E2	-2.865	0.00439	-0.056402	11	0.019685	no	ADPVSC
chr1_1898712_C_T_b38	SLC35E2	2.855	0.00453	0.058211	9	0.02039	no	ADPVSC
chr1_1899188_T_A_b38	SLC35E2	2.855	0.00453	0.058211	9	0.02039	no	ADPVSC
chr1_1971027_A_C_b38	SLC35E2	2.85	0.0046	0.046384	30	0.016274	no	ADPVSC
chr1_1025970_C_T_b38	SLC35E2	2.848	0.00463	0.042987	47	0.015094	no	ADPVSC
chr1_1706898_T_C_b38	SLC35E2	-2.844	0.00469	-0.072582	12	0.025523	no	ADPVSC
chr1_1727506_T_C_b38	SLC35E2	2.838	0.00478	0.049419	42	0.017416	no	ADPVSC
chr1_1910289_C_T_b38	SLC35E2	2.837	0.00478	0.055294	11	0.019488	no	ADPVSC
chr1_1910369_G_A_b38	SLC35E2	2.837	0.00478	0.055294	11	0.019488	no	ADPVSC
chr1_1910480_G_A_b38	SLC35E2	2.837	0.00478	0.055294	11	0.019488	no	ADPVSC
chr1_1706927_A_G_b38	SLC35E2	-2.833	0.00485	-0.071345	13	0.025184	no	ADPVSC
chr1_1714797_C_T_b38	SLC35E2	2.827	0.00493	0.063435	19	0.022436	no	ADPVSC
chr1_965337_CTTAT_C_b38	SLC35E2	-2.827	0.00493	-0.043269	99	0.015304	no	ADPVSC
chr1_1716769_C_T_b38	SLC35E2	2.826	0.00495	0.068836	15	0.024357	no	ADPVSC
chr1_1971434_C_T_b38	SLC35E2	2.822	0.00501	0.045471	31	0.016111	no	ADPVSC
chr1_1915143_A_G_b38	SLC35E2	-2.816	0.0051	-0.057848	9	0.020542	no	ADPVSC
chr1_1847597_T_C_b38	SLC35E2	2.815	0.00511	0.071642	9	0.025447	no	ADPVSC
chr1_1717604_CGCTTTCAGCTAGAGTTTGCTCTCTCTGGTTTTCGGTCTGTGACACACGCAT_C_b38	SLC35E2	2.815	0.00512	0.041246	74	0.014652	no	ADPVSC
chr1_1063661_ATG_A_b38	SLC35E2	-2.806	0.00526	-0.03998	97	0.014246	no	ADPVSC
chr1_1366923_AGTTG_A_b38	SLC35E2	-2.803	0.00531	-0.091987	5	0.032815	no	ADPVSC
chr1_1715860_C_T_b38	SLC35E2	2.799	0.00538	0.068373	14	0.024431	no	ADPVSC
chr1_1715862_G_A_b38	SLC35E2	2.799	0.00538	0.068373	14	0.024431	no	ADPVSC
chr1_1716085_C_T_b38	SLC35E2	2.799	0.00538	0.068373	14	0.024431	no	ADPVSC
chr1_1716089_G_C_b38	SLC35E2	2.799	0.00538	0.068373	14	0.024431	no	ADPVSC
chr1_1717185_C_A_b38	SLC35E2	2.799	0.00538	0.068373	14	0.024431	no	ADPVSC
chr1_1718761_A_C_b38	SLC35E2	2.799	0.00538	0.068373	14	0.024431	no	ADPVSC
chr1_1718824_G_T_b38	SLC35E2	2.799	0.00538	0.068373	14	0.024431	no	ADPVSC
chr1_1718971_T_C_b38	SLC35E2	2.799	0.00538	0.068373	14	0.024431	no	ADPVSC
chr1_1719368_T_C_b38	SLC35E2	2.799	0.00538	0.068373	14	0.024431	no	ADPVSC
chr1_1719406_G_A_b38	SLC35E2	2.799	0.00538	0.068373	14	0.024431	no	ADPVSC
chr1_1720183_C_T_b38	SLC35E2	2.799	0.00538	0.068373	14	0.024431	no	ADPVSC
chr1_1720376_T_C_b38	SLC35E2	2.799	0.00538	0.068373	14	0.024431	no	ADPVSC
chr1_1720472_C_A_b38	SLC35E2	2.799	0.00538	0.068373	14	0.024431	no	ADPVSC
chr1_1720523_G_A_b38	SLC35E2	2.799	0.00538	0.068373	14	0.024431	no	ADPVSC
chr1_1720696_C_CTTA_b38	SLC35E2	2.799	0.00538	0.068373	14	0.024431	no	ADPVSC
chr1_1720787_A_G_b38	SLC35E2	2.799	0.00538	0.068373	14	0.024431	no	ADPVSC
chr1_1721565_T_C_b38	SLC35E2	2.799	0.00538	0.068373	14	0.024431	no	ADPVSC
chr1_1721589_C_T_b38	SLC35E2	2.799	0.00538	0.068373	14	0.024431	no	ADPVSC
chr1_1721864_T_C_b38	SLC35E2	2.799	0.00538	0.068373	14	0.024431	no	ADPVSC
chr1_1721893_GT_G_b38	SLC35E2	2.799	0.00538	0.068373	14	0.024431	no	ADPVSC
chr1_1707341_C_T_b38	SLC35E2	-2.798	0.00539	-0.072473	13	0.025898	no	ADPVSC
chr1_1611248_ATC_A_b38	SLC35E2	-2.792	0.0055	-0.049376	18	0.017687	no	ADPVSC
chr1_1609890_C_T_b38	SLC35E2	-2.789	0.00553	-0.059541	12	0.021345	no	ADPVSC
chr1_1134062_C_T_b38	SLC35E2	2.787	0.00557	0.043293	47	0.015532	no	ADPVSC
chr1_1708001_A_T_b38	SLC35E2	-2.78	0.00569	-0.075168	9	0.027038	no	ADPVSC
chr1_1596590_GAC_G_b38	SLC35E2	-2.779	0.00571	-0.048456	20	0.017438	no	ADPVSC
chr1_1132485_A_C_b38	SLC35E2	2.777	0.00575	0.056505	15	0.020351	no	ADPVSC
chr1_1747690_A_G_b38	SLC35E2	-2.776	0.00576	-0.117198	3	0.042215	no	ADPVSC
chr1_1034279_G_A_b38	SLC35E2	2.773	0.00581	0.04313	38	0.015551	no	ADPVSC
chr1_1969015_A_G_b38	SLC35E2	2.773	0.00582	0.043897	92	0.015832	no	ADPVSC
chr1_1706210_G_A_b38	SLC35E2	-2.771	0.00584	-0.071022	13	0.025626	no	ADPVSC
chr1_1706488_C_G_b38	SLC35E2	-2.771	0.00584	-0.071022	13	0.025626	no	ADPVSC
chr1_1707634_A_T_b38	SLC35E2	-2.771	0.00586	-0.080702	12	0.029129	no	ADPVSC
chr1_1715135_T_C_b38	SLC35E2	2.764	0.00598	0.067075	15	0.024269	no	ADPVSC
chr1_1944216_C_T_b38	SLC35E2	-2.764	0.00598	-0.042403	94	0.015343	no	ADPVSC
chr1_1431813_G_T_b38	SLC35E2	-2.763	0.00599	-0.054103	14	0.019579	no	ADPVSC
chr1_1068249_C_T_b38	SLC35E2	-2.763	0.006	-0.043115	52	0.015606	no	ADPVSC
chr1_1716966_A_G_b38	SLC35E2	2.762	0.00601	0.063378	14	0.022947	no	ADPVSC
chr1_1015903_C_T_b38	SLC35E2	-2.757	0.0061	-0.039966	110	0.014496	no	ADPVSC
chr1_1734812_G_A_b38	SLC35E2	2.756	0.00612	0.049851	42	0.018089	no	ADPVSC
chr1_1704504_A_C_b38	SLC35E2	-2.75	0.00623	-0.069977	14	0.025443	no	ADPVSC
chr1_2377643_T_G_b38	SLC35E2	2.747	0.00629	0.040057	101	0.014583	no	ADPVSC
chr1_1971123_A_G_b38	SLC35E2	2.738	0.00645	0.043854	32	0.016015	no	ADPVSC
chr1_1124975_G_C_b38	SLC35E2	2.737	0.00648	0.040819	65	0.014915	no	ADPVSC
chr1_1718301_C_T_b38	SLC35E2	2.735	0.00652	0.051642	14	0.018883	no	ADPVSC
chr1_1716247_A_C_b38	SLC35E2	2.732	0.00657	0.066213	14	0.024232	no	ADPVSC
chr1_1303800_G_A_b38	SLC35E2	-2.732	0.00657	-0.06134	9	0.022449	no	ADPVSC
chr1_1015297_T_C_b38	SLC35E2	-2.729	0.00664	-0.039023	112	0.0143	no	ADPVSC
chr1_1713469_C_T_b38	SLC35E2	2.726	0.00669	0.060789	23	0.022298	no	ADPVSC
chr1_1841296_T_C_b38	SLC35E2	2.725	0.00671	0.068346	10	0.025081	no	ADPVSC
chr1_1849439_T_C_b38	SLC35E2	2.725	0.00671	0.068346	10	0.025081	no	ADPVSC
chr1_1861564_A_G_b38	SLC35E2	2.725	0.00671	0.068346	10	0.025081	no	ADPVSC
chr1_1861632_A_G_b38	SLC35E2	2.725	0.00671	0.068346	10	0.025081	no	ADPVSC
chr1_1861672_A_G_b38	SLC35E2	2.725	0.00671	0.068346	10	0.025081	no	ADPVSC
chr1_1718593_A_C_b38	SLC35E2	2.717	0.00687	0.064389	17	0.023695	no	ADPVSC
chr1_1718594_T_C_b38	SLC35E2	2.717	0.00687	0.064389	17	0.023695	no	ADPVSC
chr1_1987547_C_CT_b38	SLC35E2	2.716	0.00689	0.044379	80	0.016339	no	ADPVSC
chr1_1827587_T_C_b38	SLC35E2	2.711	0.00699	0.06909	9	0.025481	no	ADPVSC
chr1_1829550_A_C_b38	SLC35E2	2.711	0.00699	0.06909	9	0.025481	no	ADPVSC
chr1_1829897_A_C_b38	SLC35E2	2.711	0.00699	0.06909	9	0.025481	no	ADPVSC
chr1_1834144_T_C_b38	SLC35E2	2.711	0.00699	0.06909	9	0.025481	no	ADPVSC
chr1_1834920_A_G_b38	SLC35E2	2.711	0.00699	0.06909	9	0.025481	no	ADPVSC
chr1_1838619_T_C_b38	SLC35E2	2.711	0.00699	0.06909	9	0.025481	no	ADPVSC
chr1_1750528_G_A_b38	SLC35E2	-2.707	0.00707	-0.035953	99	0.013279	no	ADPVSC
chr1_960891_C_T_b38	SLC35E2	-2.701	0.00721	-0.040371	105	0.014946	no	ADPVSC
chr1_1912140_T_G_b38	SLC35E2	2.696	0.00731	0.051574	14	0.019127	no	ADPVSC
chr1_1922882_A_G_b38	SLC35E2	-2.691	0.00743	-0.055003	9	0.020441	no	ADPVSC
chr1_1706141_C_T_b38	SLC35E2	-2.689	0.00747	-0.068568	14	0.025501	no	ADPVSC
chr1_1704540_G_C_b38	SLC35E2	-2.682	0.00763	-0.06852	14	0.025551	no	ADPVSC
chr1_1422379_G_A_b38	SLC35E2	-2.679	0.00769	-0.116064	5	0.043326	no	ADPVSC
chr1_1707090_A_G_b38	SLC35E2	-2.679	0.0077	-0.070818	14	0.026438	no	ADPVSC
chr1_1100425_G_A_b38	SLC35E2	2.679	0.0077	0.039102	62	0.014597	no	ADPVSC
chr1_1938493_C_CAT_b38	SLC35E2	-2.677	0.00773	-0.052782	11	0.019716	no	ADPVSC
chr1_1938771_G_A_b38	SLC35E2	-2.677	0.00773	-0.052782	11	0.019716	no	ADPVSC
chr1_1939978_T_C_b38	SLC35E2	-2.677	0.00773	-0.052782	11	0.019716	no	ADPVSC
chr1_1943828_A_G_b38	SLC35E2	-2.677	0.00773	-0.052782	11	0.019716	no	ADPVSC
chr1_1943706_C_T_b38	SLC35E2	-2.672	0.00784	-0.0522	12	0.019534	no	ADPVSC
chr1_1706027_G_A_b38	SLC35E2	-2.669	0.00791	-0.067914	13	0.025442	no	ADPVSC
chr1_1584321_T_C_b38	SLC35E2	-2.668	0.00794	-0.040381	76	0.015136	no	ADPVSC
chr1_1594890_G_GAC_b38	SLC35E2	-2.663	0.00806	-0.039338	93	0.014772	no	ADPVSC
chr1_1909167_G_A_b38	SLC35E2	2.66	0.00814	0.055335	9	0.020806	no	ADPVSC
chr1_1718200_G_A_b38	SLC35E2	2.659	0.00816	0.06277	15	0.02361	no	ADPVSC
chr1_951437_C_CATTTT_b38	SLC35E2	2.656	0.00824	0.084425	3	0.031792	no	ADPVSC
chr1_1936906_C_CA_b38	SLC35E2	-2.648	0.00842	-0.044186	49	0.016687	no	ADPVSC
chr1_1721552_G_A_b38	SLC35E2	-2.639	0.00865	-0.113864	3	0.043153	no	ADPVSC
chr1_1081790_C_G_b38	SLC35E2	-2.634	0.00876	-0.035541	115	0.013492	no	ADPVSC
chr1_1718040_T_TAG_b38	SLC35E2	2.631	0.00884	0.063186	15	0.024014	no	ADPVSC
chr1_1024462_C_T_b38	SLC35E2	2.631	0.00884	0.040227	48	0.015289	no	ADPVSC
chr1_1056597_G_A_b38	SLC35E2	-2.626	0.00896	-0.036223	121	0.013792	no	ADPVSC
chr1_1083795_C_G_b38	SLC35E2	-2.621	0.0091	-0.041298	44	0.015755	no	ADPVSC
chr1_1150799_T_C_b38	SLC35E2	2.618	0.00918	0.043487	29	0.016609	no	ADPVSC
chr1_1049886_C_T_b38	SLC35E2	-2.618	0.00919	-0.037874	112	0.014469	no	ADPVSC
chr1_1015915_C_T_b38	SLC35E2	-2.616	0.00923	-0.037838	112	0.014463	no	ADPVSC
chr1_1624723_C_T_b38	SLC35E2	-2.609	0.00942	-0.048465	16	0.018574	no	ADPVSC
chr1_1905533_AT_A_b38	SLC35E2	2.606	0.0095	0.053547	5	0.020546	no	ADPVSC
chr1_1703669_G_A_b38	SLC35E2	-2.606	0.00952	-0.067214	13	0.025797	no	ADPVSC
chr1_1611570_CT_C_b38	SLC35E2	-2.601	0.00965	-0.057485	9	0.022105	no	ADPVSC
chr1_1837221_C_G_b38	SLC35E2	2.598	0.00971	0.064268	10	0.024733	no	ADPVSC
chr1_1707555_C_T_b38	SLC35E2	-2.597	0.00975	-0.069118	33	0.026613	no	ADPVSC
chr1_1288336_T_C_b38	SLC35E2	-2.593	0.00986	-0.109061	3	0.042059	no	ADPVSC
chr1_1021472_C_T_b38	SLC35E2	-2.591	0.00992	-0.036655	115	0.014147	no	ADPVSC
chr1_1728671_C_A_b38	SLC35E2	2.591	0.00993	0.047153	19	0.018201	no	ADPVSC
chr1_1674720_TGC_T_b38	SLC35E2	5.17	5.86e-07	0.101218	53	0.019578	yes	ADRNLG
chr1_1674868_G_A_b38	SLC35E2	5.133	6.95e-07	0.100273	54	0.019534	yes	ADRNLG
chr1_1676790_C_T_b38	SLC35E2	5.103	8.01e-07	0.098183	55	0.019241	yes	ADRNLG
chr1_1671995_G_T_b38	SLC35E2	4.99	1.35e-06	0.095572	56	0.019154	yes	ADRNLG
chr1_1677720_T_G_b38	SLC35E2	4.989	1.35e-06	0.097738	54	0.01959	yes	ADRNLG
chr1_1677726_A_T_b38	SLC35E2	4.989	1.35e-06	0.097738	54	0.01959	yes	ADRNLG
chr1_1673818_A_C_b38	SLC35E2	4.892	2.11e-06	0.096094	55	0.019643	yes	ADRNLG
chr1_1671797_G_A_b38	SLC35E2	4.794	3.27e-06	0.094504	53	0.019714	yes	ADRNLG
chr1_1673060_G_A_b38	SLC35E2	4.769	3.65e-06	0.095572	53	0.020041	yes	ADRNLG
chr1_1646352_A_C_b38	SLC35E2	4.245	3.4e-05	0.134929	6	0.031783	yes	ADRNLG
chr1_1648736_G_A_b38	SLC35E2	4.017	8.46e-05	0.086334	51	0.021493	yes	ADRNLG
chr1_1651653_C_T_b38	SLC35E2	4.011	8.66e-05	0.084703	55	0.021119	yes	ADRNLG
chr1_1649932_C_T_b38	SLC35E2	3.913	0.000127	0.082875	48	0.021181	yes	ADRNLG
chr1_1649976_G_A_b38	SLC35E2	3.683	0.000299	0.082961	40	0.022524	yes	ADRNLG
chr1_1654662_CT_C_b38	SLC35E2	3.678	0.000305	0.08978	31	0.024408	yes	ADRNLG
chr1_969780_C_T_b38	SLC35E2	3.578	0.000439	0.120528	9	0.033688	yes	ADRNLG
chr1_1636278_G_T_b38	SLC35E2	3.495	0.000589	0.076798	46	0.021974	yes	ADRNLG
chr1_1650664_CT_C_b38	SLC35E2	3.451	0.000687	0.088552	17	0.02566	yes	ADRNLG
chr1_1739131_T_C_b38	SLC35E2	3.434	0.000729	0.07014	48	0.020425	yes	ADRNLG
chr1_1650000_G_A_b38	SLC35E2	3.356	0.000952	0.074836	30	0.022298	yes	ADRNLG
chr1_809641_G_T_b38	SLC35E2	-3.313	0.0011	-0.128116	5	0.038672	yes	ADRNLG
chr1_1675228_C_CG_b38	SLC35E2	3.271	0.00127	0.071654	34	0.021908	yes	ADRNLG
chr1_1674633_C_CA_b38	SLC35E2	3.155	0.00186	0.072447	25	0.022964	yes	ADRNLG
chr1_788511_G_C_b38	SLC35E2	3.053	0.00259	0.113031	8	0.037024	yes	ADRNLG
chr1_1661169_C_A_b38	SLC35E2	2.984	0.00322	0.068763	20	0.023046	yes	ADRNLG
chr1_812761_G_A_b38	SLC35E2	-2.888	0.00432	-0.115986	6	0.040163	yes	ADRNLG
chr1_1675132_A_G_b38	SLC35E2	2.872	0.00453	0.06661	26	0.023189	yes	ADRNLG
chr1_779047_G_A_b38	SLC35E2	2.854	0.00479	0.10424	9	0.036525	yes	ADRNLG
chr1_1672155_G_A_b38	SLC35E2	-2.849	0.00486	-0.06547	22	0.022978	yes	ADRNLG
chr1_800605_G_A_b38	SLC35E2	-2.83	0.00515	-0.115571	3	0.040836	yes	ADRNLG
chr1_1673968_GA_G_b38	SLC35E2	2.814	0.0054	0.070271	18	0.024968	yes	ADRNLG
chr1_1670423_AT_A_b38	SLC35E2	2.814	0.0054	0.073643	23	0.026171	yes	ADRNLG
chr1_1650195_A_G_b38	SLC35E2	-2.812	0.00544	-0.070014	16	0.024901	yes	ADRNLG
chr1_965666_ACC_A_b38	SLC35E2	2.81	0.00547	0.07208	13	0.025655	yes	ADRNLG
chr1_1425013_C_T_b38	SLC35E2	-2.796	0.0057	-0.090284	18	0.032287	yes	ADRNLG
chr1_917284_C_T_b38	SLC35E2	2.785	0.00588	0.072685	11	0.026095	yes	ADRNLG
chr1_917859_A_G_b38	SLC35E2	2.785	0.00588	0.072685	11	0.026095	yes	ADRNLG
chr1_1744096_C_T_b38	SLC35E2	-2.781	0.00595	-0.082972	24	0.029831	yes	ADRNLG
chr1_1637577_T_C_b38	SLC35E2	-2.775	0.00607	-0.074584	7	0.026881	yes	ADRNLG
chr1_788439_T_A_b38	SLC35E2	-2.767	0.00622	-0.110604	4	0.039978	yes	ADRNLG
chr1_788418_CAG_C_b38	SLC35E2	2.748	0.00657	0.110784	4	0.040316	yes	ADRNLG
chr1_1193398_C_CTTA_b38	SLC35E2	-2.748	0.00657	-0.061761	46	0.022477	yes	ADRNLG
chr1_1663038_T_C_b38	SLC35E2	2.723	0.00706	0.065251	28	0.02396	yes	ADRNLG
chr1_1205055_G_T_b38	SLC35E2	-2.688	0.00781	-0.060271	47	0.02242	yes	ADRNLG
chr1_1737789_T_C_b38	SLC35E2	2.684	0.00791	0.089464	5	0.033332	yes	ADRNLG
chr1_1649993_A_G_b38	SLC35E2	-2.678	0.00804	-0.057091	61	0.021316	yes	ADRNLG
chr1_778639_A_G_b38	SLC35E2	-2.625	0.00937	-0.105797	4	0.040307	yes	ADRNLG
chr1_946653_G_A_b38	SLC35E2	2.621	0.00948	0.067811	12	0.025874	yes	ADRNLG
chr1_1723766_C_T_b38	SLC35E2	-2.62	0.0095	-0.0784	10	0.029925	yes	ADRNLG
chr1_1684789_C_CAAAAA_b38	SLC35E2	-3.173	0.00176	-0.145209	4	0.04577	no	ADRNLG
chr1_922660_C_A_b38	SLC35E2	2.971	0.00335	0.078973	10	0.026584	no	ADRNLG
chr1_922671_C_T_b38	SLC35E2	2.936	0.00373	0.077776	10	0.026493	no	ADRNLG
chr1_973443_G_A_b38	SLC35E2	2.935	0.00375	0.078772	10	0.026843	no	ADRNLG
chr1_927009_A_G_b38	SLC35E2	2.875	0.0045	0.131268	8	0.045663	no	ADRNLG
chr1_1752126_G_A_b38	SLC35E2	2.756	0.00641	0.065962	30	0.023931	no	ADRNLG
chr1_969663_CAT_C_b38	SLC35E2	2.729	0.00695	0.066081	15	0.024217	no	ADRNLG
chr1_917378_G_C_b38	SLC35E2	2.723	0.00707	0.072173	10	0.026505	no	ADRNLG
chr1_1614340_C_T_b38	SLC35E2	2.707	0.0074	0.085535	3	0.031596	no	ADRNLG
chr1_928223_T_A_b38	SLC35E2	2.664	0.00837	0.091292	3	0.034265	no	ADRNLG
chr1_935265_T_C_b38	SLC35E2	2.659	0.00849	0.063079	20	0.02372	no	ADRNLG
chr1_928210_G_A_b38	SLC35E2	2.645	0.00885	0.089237	3	0.033738	no	ADRNLG
chr1_1674720_TGC_T_b38	SLC35E2	8.563	4.91e-16	0.11418	88	0.013335	yes	ARTAORT
chr1_1674868_G_A_b38	SLC35E2	8.551	5.33e-16	0.113859	89	0.013316	yes	ARTAORT
chr1_1677720_T_G_b38	SLC35E2	8.494	7.97e-16	0.11213	91	0.013202	yes	ARTAORT
chr1_1677726_A_T_b38	SLC35E2	8.406	1.47e-15	0.111491	91	0.013264	yes	ARTAORT
chr1_1671995_G_T_b38	SLC35E2	8.35	2.18e-15	0.111295	89	0.013329	yes	ARTAORT
chr1_1673060_G_A_b38	SLC35E2	8.325	2.58e-15	0.112785	89	0.013548	yes	ARTAORT
chr1_1676790_C_T_b38	SLC35E2	8.29	3.29e-15	0.108156	92	0.013047	yes	ARTAORT
chr1_1673818_A_C_b38	SLC35E2	8.247	4.42e-15	0.111278	90	0.013493	yes	ARTAORT
chr1_1671797_G_A_b38	SLC35E2	7.606	3.27e-13	0.10343	88	0.013599	yes	ARTAORT
chr1_1651653_C_T_b38	SLC35E2	6.128	2.64e-09	0.086473	89	0.014111	yes	ARTAORT
chr1_1649932_C_T_b38	SLC35E2	6.1	3.1e-09	0.088549	79	0.014517	yes	ARTAORT
chr1_1658422_T_C_b38	SLC35E2	6.058	3.92e-09	0.108812	17	0.017963	yes	ARTAORT
chr1_1648736_G_A_b38	SLC35E2	5.917	8.52e-09	0.086891	77	0.014685	yes	ARTAORT
chr1_1649976_G_A_b38	SLC35E2	5.43	1.13e-07	0.081808	69	0.015067	yes	ARTAORT
chr1_1674633_C_CA_b38	SLC35E2	5.42	1.18e-07	0.086884	38	0.016029	yes	ARTAORT
chr1_1675228_C_CG_b38	SLC35E2	5.063	7.02e-07	0.081824	57	0.016161	yes	ARTAORT
chr1_1676287_C_T_b38	SLC35E2	-5.023	8.52e-07	-0.100719	7	0.020051	yes	ARTAORT
chr1_1650664_CT_C_b38	SLC35E2	4.777	2.73e-06	0.080372	33	0.016826	yes	ARTAORT
chr1_1654662_CT_C_b38	SLC35E2	4.772	2.8e-06	0.075562	60	0.015836	yes	ARTAORT
chr1_1675091_A_G_b38	SLC35E2	-4.726	3.45e-06	-0.085923	19	0.01818	yes	ARTAORT
chr1_1675132_A_G_b38	SLC35E2	4.725	3.47e-06	0.078507	45	0.016616	yes	ARTAORT
chr1_1667424_T_TAAAATA_b38	SLC35E2	4.603	6.05e-06	0.072579	48	0.015769	yes	ARTAORT
chr1_1612562_T_TC_b38	SLC35E2	4.585	6.54e-06	0.071704	40	0.015637	yes	ARTAORT
chr1_1670423_AT_A_b38	SLC35E2	4.54	7.99e-06	0.076388	49	0.016824	yes	ARTAORT
chr1_1672155_G_A_b38	SLC35E2	-4.518	8.82e-06	-0.078576	28	0.017391	yes	ARTAORT
chr1_1650000_G_A_b38	SLC35E2	4.215	3.26e-05	0.06555	54	0.015552	yes	ARTAORT
chr1_1970506_T_A_b38	SLC35E2	-4.207	3.37e-05	-0.064298	64	0.015282	yes	ARTAORT
chr1_1650195_A_G_b38	SLC35E2	-4.163	4.06e-05	-0.068605	36	0.016481	yes	ARTAORT
chr1_1743714_C_CA_b38	SLC35E2	4.125	4.74e-05	0.067319	50	0.016318	yes	ARTAORT
chr1_1671724_C_T_b38	SLC35E2	-4.069	5.98e-05	-0.072079	23	0.017716	yes	ARTAORT
chr1_1739131_T_C_b38	SLC35E2	4.066	6.04e-05	0.060768	67	0.014945	yes	ARTAORT
chr1_1600320_C_G_b38	SLC35E2	4.037	6.79e-05	0.065388	35	0.016196	yes	ARTAORT
chr1_1753033_C_T_b38	SLC35E2	-4.021	7.24e-05	-0.064716	83	0.016093	yes	ARTAORT
chr1_1667424_T_TAAATA_b38	SLC35E2	-3.942	9.97e-05	-0.060303	59	0.015299	yes	ARTAORT
chr1_1600379_C_T_b38	SLC35E2	3.861	0.000137	0.061464	38	0.015921	yes	ARTAORT
chr1_1664757_T_C_b38	SLC35E2	-3.854	0.000141	-0.060527	35	0.015703	yes	ARTAORT
chr1_1595028_C_CAG_b38	SLC35E2	3.846	0.000145	0.067929	25	0.017663	yes	ARTAORT
chr1_1752126_G_A_b38	SLC35E2	3.845	0.000146	0.065572	41	0.017054	yes	ARTAORT
chr1_1650383_G_T_b38	SLC35E2	-3.836	0.000151	-0.066312	25	0.017287	yes	ARTAORT
chr1_1743586_T_TAC_b38	SLC35E2	-3.825	0.000158	-0.062501	51	0.016341	yes	ARTAORT
chr1_1671097_G_C_b38	SLC35E2	3.81	0.000167	0.062294	39	0.016352	yes	ARTAORT
chr1_1620609_G_A_b38	SLC35E2	3.746	0.000213	0.058781	41	0.015691	yes	ARTAORT
chr1_1622295_G_C_b38	SLC35E2	3.746	0.000214	0.059249	41	0.015817	yes	ARTAORT
chr1_1621352_G_A_b38	SLC35E2	3.745	0.000214	0.059067	41	0.015772	yes	ARTAORT
chr1_1742587_G_C_b38	SLC35E2	3.724	0.000233	0.055613	89	0.014936	yes	ARTAORT
chr1_1671148_C_T_b38	SLC35E2	3.702	0.000253	0.060333	38	0.016299	yes	ARTAORT
chr1_1606507_GTGGGC_G_b38	SLC35E2	3.688	0.000266	0.054729	104	0.014841	yes	ARTAORT
chr1_1746522_GT_G_b38	SLC35E2	-3.667	0.000288	-0.070584	17	0.019247	yes	ARTAORT
chr1_1650777_G_A_b38	SLC35E2	-3.657	0.000299	-0.058807	36	0.016082	yes	ARTAORT
chr1_1759611_C_T_b38	SLC35E2	-3.652	0.000305	-0.059707	83	0.01635	yes	ARTAORT
chr1_1945975_TG_T_b38	SLC35E2	-3.604	0.000364	-0.057954	86	0.016081	yes	ARTAORT
chr1_1651137_C_T_b38	SLC35E2	-3.585	0.00039	-0.05766	36	0.016083	yes	ARTAORT
chr1_1651267_T_C_b38	SLC35E2	-3.585	0.00039	-0.05766	36	0.016083	yes	ARTAORT
chr1_1651785_C_A_b38	SLC35E2	-3.585	0.00039	-0.05766	36	0.016083	yes	ARTAORT
chr1_1652061_T_C_b38	SLC35E2	-3.585	0.00039	-0.05766	36	0.016083	yes	ARTAORT
chr1_1652135_C_G_b38	SLC35E2	-3.585	0.00039	-0.05766	36	0.016083	yes	ARTAORT
chr1_1652191_C_T_b38	SLC35E2	-3.585	0.00039	-0.05766	36	0.016083	yes	ARTAORT
chr1_1652592_A_G_b38	SLC35E2	-3.585	0.00039	-0.05766	36	0.016083	yes	ARTAORT
chr1_1652779_A_G_b38	SLC35E2	-3.585	0.00039	-0.05766	36	0.016083	yes	ARTAORT
chr1_1653147_A_C_b38	SLC35E2	-3.585	0.00039	-0.05766	36	0.016083	yes	ARTAORT
chr1_1653396_T_C_b38	SLC35E2	-3.585	0.00039	-0.05766	36	0.016083	yes	ARTAORT
chr1_1653472_T_C_b38	SLC35E2	-3.585	0.00039	-0.05766	36	0.016083	yes	ARTAORT
chr1_1653811_G_A_b38	SLC35E2	-3.585	0.00039	-0.05766	36	0.016083	yes	ARTAORT
chr1_1653893_C_T_b38	SLC35E2	-3.585	0.00039	-0.05766	36	0.016083	yes	ARTAORT
chr1_1653934_G_A_b38	SLC35E2	-3.585	0.00039	-0.05766	36	0.016083	yes	ARTAORT
chr1_1654143_G_A_b38	SLC35E2	-3.585	0.00039	-0.05766	36	0.016083	yes	ARTAORT
chr1_1654188_T_G_b38	SLC35E2	-3.585	0.00039	-0.05766	36	0.016083	yes	ARTAORT
chr1_1679100_A_G_b38	SLC35E2	-3.547	0.000449	-0.054361	62	0.015326	yes	ARTAORT
chr1_1960609_G_C_b38	SLC35E2	-3.54	0.000461	-0.054274	63	0.015333	yes	ARTAORT
chr1_1752461_G_A_b38	SLC35E2	-3.538	0.000464	-0.057584	78	0.016277	yes	ARTAORT
chr1_1661420_C_A_b38	SLC35E2	-3.516	0.000502	-0.057071	37	0.016232	yes	ARTAORT
chr1_1649993_A_G_b38	SLC35E2	-3.516	0.000503	-0.053348	94	0.015174	yes	ARTAORT
chr1_1651926_T_C_b38	SLC35E2	-3.513	0.000507	-0.056599	36	0.01611	yes	ARTAORT
chr1_1651574_G_A_b38	SLC35E2	-3.504	0.000525	-0.056213	36	0.016044	yes	ARTAORT
chr1_1659114_A_G_b38	SLC35E2	-3.502	0.000529	-0.056748	37	0.016206	yes	ARTAORT
chr1_1659220_A_G_b38	SLC35E2	-3.502	0.000529	-0.056748	37	0.016206	yes	ARTAORT
chr1_1609058_G_A_b38	SLC35E2	3.502	0.000529	0.055532	40	0.015859	yes	ARTAORT
chr1_1752730_C_G_b38	SLC35E2	-3.496	0.00054	-0.057234	78	0.016371	yes	ARTAORT
chr1_1637577_T_C_b38	SLC35E2	-3.49	0.000551	-0.05932	26	0.016996	yes	ARTAORT
chr1_1744499_C_T_b38	SLC35E2	-3.48	0.000572	-0.052344	73	0.015041	yes	ARTAORT
chr1_1749826_A_G_b38	SLC35E2	-3.467	0.000599	-0.053466	88	0.01542	yes	ARTAORT
chr1_1607931_G_A_b38	SLC35E2	3.455	0.000625	0.055184	39	0.015971	yes	ARTAORT
chr1_1668717_C_G_b38	SLC35E2	-3.451	0.000635	-0.063554	20	0.018418	yes	ARTAORT
chr1_1660683_C_T_b38	SLC35E2	-3.45	0.000636	-0.060219	26	0.017454	yes	ARTAORT
chr1_1669576_G_A_b38	SLC35E2	-3.448	0.00064	-0.064167	19	0.018608	yes	ARTAORT
chr1_1613769_C_T_b38	SLC35E2	3.447	0.000643	0.056785	39	0.016471	yes	ARTAORT
chr1_1665061_C_T_b38	SLC35E2	-3.444	0.000651	-0.061657	21	0.017903	yes	ARTAORT
chr1_1641275_A_G_b38	SLC35E2	-3.429	0.000685	-0.055927	39	0.016308	yes	ARTAORT
chr1_1651421_GTAGCCCCTCTGAACGGTCTGTGACACACGCATGCTTTCAGCTAGAGTACTCTA_G_b38	SLC35E2	-3.422	0.000704	-0.055777	33	0.016301	yes	ARTAORT
chr1_1606532_GTGGGCTGGGCTGGTCAGGCA_G_b38	SLC35E2	3.421	0.000707	0.055675	35	0.016276	yes	ARTAORT
chr1_1744652_C_T_b38	SLC35E2	-3.403	0.000751	-0.052461	74	0.015415	yes	ARTAORT
chr1_1658866_G_A_b38	SLC35E2	-3.401	0.000758	-0.054848	38	0.016128	yes	ARTAORT
chr1_1658830_C_G_b38	SLC35E2	-3.4	0.00076	-0.060304	21	0.017735	yes	ARTAORT
chr1_1630798_C_T_b38	SLC35E2	3.399	0.000763	0.054838	39	0.016133	yes	ARTAORT
chr1_1708521_C_G_b38	SLC35E2	-3.348	0.000914	-0.057748	26	0.017251	yes	ARTAORT
chr1_1668721_C_T_b38	SLC35E2	-3.347	0.000914	-0.058633	26	0.017516	yes	ARTAORT
chr1_1952823_TA_T_b38	SLC35E2	-3.346	0.000919	-0.056003	82	0.016737	yes	ARTAORT
chr1_1669613_G_A_b38	SLC35E2	-3.343	0.000929	-0.061477	20	0.01839	yes	ARTAORT
chr1_1617375_T_C_b38	SLC35E2	3.316	0.00102	0.055665	38	0.016788	yes	ARTAORT
chr1_1618213_C_G_b38	SLC35E2	3.316	0.00102	0.055665	38	0.016788	yes	ARTAORT
chr1_1618290_G_C_b38	SLC35E2	3.316	0.00102	0.055665	38	0.016788	yes	ARTAORT
chr1_1652913_C_T_b38	SLC35E2	-3.315	0.00102	-0.057028	26	0.017203	yes	ARTAORT
chr1_1744854_C_A_b38	SLC35E2	-3.312	0.00103	-0.047086	60	0.014216	yes	ARTAORT
chr1_1750280_A_G_b38	SLC35E2	-3.308	0.00105	-0.052441	84	0.015853	yes	ARTAORT
chr1_1944216_C_T_b38	SLC35E2	-3.308	0.00105	-0.054268	84	0.016406	yes	ARTAORT
chr1_1753361_G_A_b38	SLC35E2	-3.299	0.00108	-0.054227	78	0.016436	yes	ARTAORT
chr1_1661177_A_G_b38	SLC35E2	-3.285	0.00114	-0.058937	21	0.017942	yes	ARTAORT
chr1_1971864_C_T_b38	SLC35E2	3.277	0.00116	0.051538	64	0.015725	yes	ARTAORT
chr1_1955080_C_CGGCTCACACCGGAAGTGAGGCTCACACCGGAAGTGA_b38	SLC35E2	-3.272	0.00119	-0.053872	71	0.016465	yes	ARTAORT
chr1_1743238_G_C_b38	SLC35E2	-3.272	0.00119	-0.051768	65	0.015822	yes	ARTAORT
chr1_1950071_C_T_b38	SLC35E2	-3.265	0.00121	-0.054814	82	0.016788	yes	ARTAORT
chr1_1951106_G_A_b38	SLC35E2	-3.265	0.00121	-0.054814	82	0.016788	yes	ARTAORT
chr1_1952064_G_A_b38	SLC35E2	-3.265	0.00121	-0.054814	82	0.016788	yes	ARTAORT
chr1_1668108_C_T_b38	SLC35E2	3.251	0.00128	0.053999	37	0.016612	yes	ARTAORT
chr1_2200395_C_CA_b38	SLC35E2	3.25	0.00128	0.063671	14	0.019589	yes	ARTAORT
chr1_1648826_A_G_b38	SLC35E2	-3.249	0.00128	-0.052903	39	0.016282	yes	ARTAORT
chr1_1639348_G_T_b38	SLC35E2	-3.245	0.0013	-0.051446	43	0.015855	yes	ARTAORT
chr1_1629332_G_T_b38	SLC35E2	3.243	0.00131	0.053075	41	0.016368	yes	ARTAORT
chr1_1743544_CA_C_b38	SLC35E2	3.228	0.00138	0.04629	87	0.01434	yes	ARTAORT
chr1_1606384_A_G_b38	SLC35E2	3.227	0.00138	0.0514	44	0.015926	yes	ARTAORT
chr1_1708474_C_A_b38	SLC35E2	-3.225	0.00139	-0.062943	11	0.019519	yes	ARTAORT
chr1_1753319_G_A_b38	SLC35E2	-3.224	0.0014	-0.052842	78	0.016391	yes	ARTAORT
chr1_1677707_C_T_b38	SLC35E2	-3.211	0.00146	-0.070606	9	0.021986	yes	ARTAORT
chr1_1951865_G_GT_b38	SLC35E2	-3.21	0.00146	-0.054073	82	0.016844	yes	ARTAORT
chr1_1948919_T_TCCTTCCCTCCTCTTTCCCTCCCTTCTTTCCTTCCCTTTCCCTCCCTC_b38	SLC35E2	-3.21	0.00147	-0.046028	80	0.01434	yes	ARTAORT
chr1_1659060_G_A_b38	SLC35E2	-3.19	0.00157	-0.054753	27	0.017165	yes	ARTAORT
chr1_1650688_T_A_b38	SLC35E2	-3.172	0.00166	-0.054843	27	0.017291	yes	ARTAORT
chr1_1948594_G_GTTT_b38	SLC35E2	-3.171	0.00167	-0.097696	7	0.030805	yes	ARTAORT
chr1_1742672_C_T_b38	SLC35E2	-3.156	0.00175	-0.049812	66	0.015782	yes	ARTAORT
chr1_1773676_TTGTGTG_T_b38	SLC35E2	3.149	0.0018	0.074635	4	0.023702	yes	ARTAORT
chr1_1616547_T_C_b38	SLC35E2	3.138	0.00186	0.052775	37	0.01682	yes	ARTAORT
chr1_1746440_A_G_b38	SLC35E2	-3.126	0.00194	-0.060599	17	0.019388	yes	ARTAORT
chr1_1615869_C_T_b38	SLC35E2	3.124	0.00195	0.052353	37	0.01676	yes	ARTAORT
chr1_1748780_G_A_b38	SLC35E2	-3.12	0.00198	-0.050638	86	0.016232	yes	ARTAORT
chr1_1648636_G_A_b38	SLC35E2	-3.119	0.00198	-0.05094	39	0.016332	yes	ARTAORT
chr1_1750226_C_T_b38	SLC35E2	3.116	0.002	0.049493	64	0.015881	yes	ARTAORT
chr1_1731904_CA_C_b38	SLC35E2	3.11	0.00204	0.052223	33	0.016793	yes	ARTAORT
chr1_1684789_C_CAAAA_b38	SLC35E2	3.107	0.00206	0.100329	6	0.032288	yes	ARTAORT
chr1_1653319_A_G_b38	SLC35E2	3.097	0.00213	0.052665	28	0.017004	yes	ARTAORT
chr1_1944074_T_C_b38	SLC35E2	-3.095	0.00215	-0.050923	84	0.016455	yes	ARTAORT
chr1_1944091_G_C_b38	SLC35E2	-3.095	0.00215	-0.050923	84	0.016455	yes	ARTAORT
chr1_1591703_T_C_b38	SLC35E2	3.09	0.00218	0.045377	73	0.014683	yes	ARTAORT
chr1_1665581_C_G_b38	SLC35E2	-3.089	0.00219	-0.054961	23	0.017794	yes	ARTAORT
chr1_1744052_GAGA_G_b38	SLC35E2	-3.087	0.0022	-0.060644	19	0.019645	yes	ARTAORT
chr1_1945121_T_C_b38	SLC35E2	-3.066	0.00236	-0.050463	85	0.016461	yes	ARTAORT
chr1_1944182_G_C_b38	SLC35E2	-3.063	0.00238	-0.049745	85	0.016242	yes	ARTAORT
chr1_1744028_A_AC_b38	SLC35E2	-3.059	0.00241	-0.06193	16	0.020243	yes	ARTAORT
chr1_1934565_G_A_b38	SLC35E2	-3.058	0.00242	-0.048068	76	0.01572	yes	ARTAORT
chr1_1945842_A_AAAAGAAC_b38	SLC35E2	-3.057	0.00243	-0.051615	57	0.016886	yes	ARTAORT
chr1_1940973_C_T_b38	SLC35E2	-3.005	0.00287	-0.04688	77	0.015602	yes	ARTAORT
chr1_1754482_TCCCTGGGACCGAAGTCGCCCCA_T_b38	SLC35E2	-2.991	0.003	-0.049496	78	0.016547	yes	ARTAORT
chr1_1661169_C_A_b38	SLC35E2	2.987	0.00304	0.051669	27	0.017296	yes	ARTAORT
chr1_1755504_T_C_b38	SLC35E2	2.978	0.00313	0.044893	85	0.015077	yes	ARTAORT
chr1_1750428_G_C_b38	SLC35E2	-2.971	0.0032	-0.052092	54	0.017533	yes	ARTAORT
chr1_1944675_C_T_b38	SLC35E2	-2.969	0.00322	-0.048735	85	0.016417	yes	ARTAORT
chr1_1946013_C_T_b38	SLC35E2	-2.969	0.00322	-0.048735	85	0.016417	yes	ARTAORT
chr1_1946058_T_C_b38	SLC35E2	-2.969	0.00322	-0.048735	85	0.016417	yes	ARTAORT
chr1_1946632_C_T_b38	SLC35E2	-2.969	0.00322	-0.048735	85	0.016417	yes	ARTAORT
chr1_1750440_G_A_b38	SLC35E2	-2.959	0.00332	-0.052211	53	0.017646	yes	ARTAORT
chr1_1944420_A_G_b38	SLC35E2	-2.939	0.00354	-0.048046	86	0.01635	yes	ARTAORT
chr1_1942014_G_A_b38	SLC35E2	-2.937	0.00355	-0.045922	75	0.015634	yes	ARTAORT
chr1_1942075_A_G_b38	SLC35E2	-2.937	0.00355	-0.045922	75	0.015634	yes	ARTAORT
chr1_1942086_T_C_b38	SLC35E2	-2.937	0.00355	-0.045922	75	0.015634	yes	ARTAORT
chr1_1987547_C_CT_b38	SLC35E2	2.934	0.00359	0.049036	74	0.016714	yes	ARTAORT
chr1_1948938_C_T_b38	SLC35E2	-2.933	0.00361	-0.042017	82	0.014327	yes	ARTAORT
chr1_1757074_G_T_b38	SLC35E2	2.927	0.00367	0.046966	59	0.016043	yes	ARTAORT
chr1_1613974_G_A_b38	SLC35E2	2.924	0.0037	0.050705	27	0.01734	yes	ARTAORT
chr1_1957014_G_A_b38	SLC35E2	2.918	0.00378	0.049057	27	0.016813	yes	ARTAORT
chr1_1957636_C_T_b38	SLC35E2	2.918	0.00378	0.049057	27	0.016813	yes	ARTAORT
chr1_2334639_T_C_b38	SLC35E2	-2.906	0.00392	-0.042834	105	0.01474	yes	ARTAORT
chr1_1845824_TACACAC_T_b38	SLC35E2	2.903	0.00396	0.052226	17	0.017993	yes	ARTAORT
chr1_1937802_G_T_b38	SLC35E2	-2.888	0.00414	-0.047902	83	0.016585	yes	ARTAORT
chr1_1618982_G_A_b38	SLC35E2	2.888	0.00415	0.049938	28	0.017294	yes	ARTAORT
chr1_1664865_A_G_b38	SLC35E2	-2.887	0.00416	-0.047327	35	0.016395	yes	ARTAORT
chr1_1743840_T_C_b38	SLC35E2	-2.886	0.00417	-0.0537	25	0.018606	yes	ARTAORT
chr1_1956891_C_T_b38	SLC35E2	2.884	0.00419	0.048499	27	0.016815	yes	ARTAORT
chr1_1931743_CA_C_b38	SLC35E2	-2.882	0.00423	-0.055635	24	0.019306	yes	ARTAORT
chr1_1743851_C_T_b38	SLC35E2	-2.876	0.0043	-0.052822	26	0.018365	yes	ARTAORT
chr1_1936077_C_T_b38	SLC35E2	-2.859	0.00453	-0.044506	78	0.015567	yes	ARTAORT
chr1_1936627_C_G_b38	SLC35E2	-2.859	0.00454	-0.045286	71	0.015842	yes	ARTAORT
chr1_1942258_G_A_b38	SLC35E2	-2.857	0.00456	-0.044843	75	0.015694	yes	ARTAORT
chr1_1754601_G_T_b38	SLC35E2	2.853	0.00461	0.046289	59	0.016223	yes	ARTAORT
chr1_1757725_C_T_b38	SLC35E2	2.853	0.00461	0.046289	59	0.016223	yes	ARTAORT
chr1_1940540_G_A_b38	SLC35E2	-2.853	0.00462	-0.044582	76	0.015628	yes	ARTAORT
chr1_1942260_G_C_b38	SLC35E2	-2.853	0.00462	-0.044582	76	0.015628	yes	ARTAORT
chr1_1009731_C_T_b38	SLC35E2	2.833	0.00491	0.090599	3	0.031984	yes	ARTAORT
chr1_1756186_T_C_b38	SLC35E2	2.83	0.00495	0.045016	61	0.015905	yes	ARTAORT
chr1_1944419_C_G_b38	SLC35E2	-2.825	0.00502	-0.046104	86	0.016318	yes	ARTAORT
chr1_1603989_T_C_b38	SLC35E2	2.804	0.00536	0.048131	30	0.017166	yes	ARTAORT
chr1_1609909_G_T_b38	SLC35E2	2.804	0.00536	0.048131	30	0.017166	yes	ARTAORT
chr1_1947189_C_T_b38	SLC35E2	-2.801	0.00542	-0.046118	85	0.016467	yes	ARTAORT
chr1_1936906_C_CA_b38	SLC35E2	-2.796	0.00549	-0.047963	45	0.017155	yes	ARTAORT
chr1_1722626_AGCG_A_b38	SLC35E2	2.793	0.00553	0.053611	25	0.019191	yes	ARTAORT
chr1_1937273_T_C_b38	SLC35E2	-2.785	0.00567	-0.043614	72	0.015658	yes	ARTAORT
chr1_1926870_T_C_b38	SLC35E2	-2.782	0.00573	-0.04319	68	0.015527	yes	ARTAORT
chr1_1932081_AAAAAAC_A_b38	SLC35E2	-2.774	0.00587	-0.054436	30	0.019626	yes	ARTAORT
chr1_1881065_G_A_b38	SLC35E2	2.772	0.00589	0.055453	10	0.020002	yes	ARTAORT
chr1_1881798_C_T_b38	SLC35E2	2.772	0.00589	0.055453	10	0.020002	yes	ARTAORT
chr1_986629_G_A_b38	SLC35E2	2.764	0.00605	0.05224	15	0.018901	yes	ARTAORT
chr1_1650664_CTTTTT_C_b38	SLC35E2	-2.762	0.00608	-0.053139	17	0.019239	yes	ARTAORT
chr1_1986752_A_G_b38	SLC35E2	2.76	0.00612	0.046058	69	0.016689	yes	ARTAORT
chr1_1886690_A_C_b38	SLC35E2	2.751	0.00628	0.055155	10	0.020049	yes	ARTAORT
chr1_2676830_TGGAACAGCACCCACACCCCCA_T_b38	SLC35E2	-2.747	0.00635	-0.144711	3	0.052675	yes	ARTAORT
chr1_1969235_A_G_b38	SLC35E2	2.741	0.00647	0.049299	20	0.017983	yes	ARTAORT
chr1_1916417_G_T_b38	SLC35E2	-2.741	0.00647	-0.043675	72	0.015934	yes	ARTAORT
chr1_1937841_ACACCAGGTCCACCTCTGGACACAGGTCCACC_A_b38	SLC35E2	-2.741	0.00648	-0.042693	76	0.015577	yes	ARTAORT
chr1_1938054_ACT_A_b38	SLC35E2	-2.741	0.00648	-0.042693	76	0.015577	yes	ARTAORT
chr1_1914634_G_T_b38	SLC35E2	-2.74	0.00648	-0.043363	72	0.015823	yes	ARTAORT
chr1_1916670_G_C_b38	SLC35E2	-2.74	0.00648	-0.043363	72	0.015823	yes	ARTAORT
chr1_1969238_C_T_b38	SLC35E2	2.738	0.00654	0.04916	20	0.017958	yes	ARTAORT
chr1_2331844_G_C_b38	SLC35E2	-2.733	0.00664	-0.063297	10	0.023163	yes	ARTAORT
chr1_1945913_T_C_b38	SLC35E2	-2.719	0.00691	-0.052804	12	0.019419	yes	ARTAORT
chr1_1871210_G_T_b38	SLC35E2	2.718	0.00694	0.055662	10	0.020483	yes	ARTAORT
chr1_1987049_A_G_b38	SLC35E2	2.715	0.00699	0.044524	71	0.016398	yes	ARTAORT
chr1_1948515_C_T_b38	SLC35E2	-2.713	0.00704	-0.044608	91	0.016444	yes	ARTAORT
chr1_1659940_A_C_b38	SLC35E2	-2.708	0.00713	-0.05686	10	0.020996	yes	ARTAORT
chr1_1722625_A_T_b38	SLC35E2	2.7	0.00732	0.051994	25	0.01926	yes	ARTAORT
chr1_1892085_G_C_b38	SLC35E2	2.7	0.00732	0.05405	10	0.020022	yes	ARTAORT
chr1_1948519_T_C_b38	SLC35E2	-2.687	0.0076	-0.044192	91	0.016448	yes	ARTAORT
chr1_1934619_TTGTAGGTACACACGTGTGTACGTGGGTGTTAGGC_T_b38	SLC35E2	-2.682	0.0077	-0.059387	12	0.022142	yes	ARTAORT
chr1_2325287_C_CCT_b38	SLC35E2	-2.681	0.00773	-0.041958	55	0.015651	yes	ARTAORT
chr1_1723766_C_T_b38	SLC35E2	-2.68	0.00774	-0.050375	22	0.018794	yes	ARTAORT
chr1_1692286_C_A_b38	SLC35E2	2.666	0.00807	0.061661	3	0.02313	yes	ARTAORT
chr1_1942887_C_G_b38	SLC35E2	-2.661	0.00819	-0.043298	85	0.016271	yes	ARTAORT
chr1_1882426_C_CA_b38	SLC35E2	-2.654	0.00835	-0.093302	7	0.03515	yes	ARTAORT
chr1_1192365_G_GAGTGTAGACACTCCAGTTGGTATA_b38	SLC35E2	-2.654	0.00836	-0.097587	4	0.036771	yes	ARTAORT
chr1_1882915_C_T_b38	SLC35E2	2.651	0.00843	0.053457	10	0.020166	yes	ARTAORT
chr1_1594618_C_G_b38	SLC35E2	2.65	0.00846	0.045167	32	0.017046	yes	ARTAORT
chr1_986280_C_T_b38	SLC35E2	2.649	0.00849	0.050068	15	0.018903	yes	ARTAORT
chr1_1933087_C_T_b38	SLC35E2	-2.639	0.00873	-0.041631	72	0.015777	yes	ARTAORT
chr1_1933859_A_G_b38	SLC35E2	-2.639	0.00873	-0.041631	72	0.015777	yes	ARTAORT
chr1_1956754_C_A_b38	SLC35E2	2.635	0.00883	0.045869	22	0.017408	yes	ARTAORT
chr1_2691530_A_G_b38	SLC35E2	-2.627	0.00903	-0.1162	3	0.04423	yes	ARTAORT
chr1_1828894_T_TAC_b38	SLC35E2	2.626	0.00905	0.041836	66	0.01593	yes	ARTAORT
chr1_1953296_CTT_C_b38	SLC35E2	-2.622	0.00918	-0.073399	4	0.027999	yes	ARTAORT
chr1_2325494_G_A_b38	SLC35E2	-2.621	0.00918	-0.059526	13	0.022708	yes	ARTAORT
chr1_2325768_C_A_b38	SLC35E2	-2.621	0.00918	-0.059526	13	0.022708	yes	ARTAORT
chr1_2326256_G_A_b38	SLC35E2	-2.621	0.00918	-0.059526	13	0.022708	yes	ARTAORT
chr1_1597128_C_CCCTCAGCTGGACT_b38	SLC35E2	-2.615	0.00934	-0.04004	54	0.01531	yes	ARTAORT
chr1_1748597_C_G_b38	SLC35E2	-2.609	0.0095	-0.04374	78	0.016763	yes	ARTAORT
chr1_1591419_A_G_b38	SLC35E2	2.608	0.00953	0.049796	13	0.019091	yes	ARTAORT
chr1_1914345_C_T_b38	SLC35E2	-2.608	0.00955	-0.043646	83	0.016737	yes	ARTAORT
chr1_1914918_G_A_b38	SLC35E2	-2.608	0.00955	-0.043646	83	0.016737	yes	ARTAORT
chr1_1755523_C_T_b38	SLC35E2	2.607	0.00956	0.039628	89	0.015199	yes	ARTAORT
chr1_1915326_G_A_b38	SLC35E2	-2.603	0.00968	-0.043331	84	0.016647	yes	ARTAORT
chr1_1916217_C_T_b38	SLC35E2	-2.603	0.00968	-0.043331	84	0.016647	yes	ARTAORT
chr1_1955420_C_T_b38	SLC35E2	2.6	0.00976	0.045096	22	0.017346	yes	ARTAORT
chr1_1775296_C_T_b38	SLC35E2	2.599	0.00978	0.05344	10	0.020561	yes	ARTAORT
chr1_1815255_G_T_b38	SLC35E2	2.599	0.00978	0.05344	10	0.020561	yes	ARTAORT
chr1_1935938_T_C_b38	SLC35E2	-2.597	0.00983	-0.040955	65	0.015768	yes	ARTAORT
chr1_1635226_T_C_b38	SLC35E2	-2.594	0.00992	-0.054614	9	0.021051	yes	ARTAORT
chr1_1931587_A_G_b38	SLC35E2	-2.594	0.00994	-0.04154	72	0.016016	yes	ARTAORT
chr1_1673968_GA_G_b38	SLC35E2	6.46	3.96e-10	0.112581	33	0.017428	no	ARTAORT
chr1_1661562_G_C_b38	SLC35E2	5.099	5.9e-07	0.068315	90	0.013399	no	ARTAORT
chr1_1636278_G_T_b38	SLC35E2	4.81	2.35e-06	0.073845	65	0.015354	no	ARTAORT
chr1_1340697_G_A_b38	SLC35E2	3.96	9.26e-05	0.0728	19	0.018383	no	ARTAORT
chr1_1641261_C_T_b38	SLC35E2	-3.95	9.64e-05	-0.072142	18	0.018264	no	ARTAORT
chr1_1646352_A_C_b38	SLC35E2	3.891	0.000122	0.084086	8	0.021609	no	ARTAORT
chr1_1427468_A_T_b38	SLC35E2	-3.699	0.000255	-0.077604	3	0.02098	no	ARTAORT
chr1_2342840_A_ATATTT_b38	SLC35E2	-3.663	0.000292	-0.084228	13	0.022991	no	ARTAORT
chr1_1691377_C_T_b38	SLC35E2	-3.544	0.000453	-0.058874	39	0.01661	no	ARTAORT
chr1_1755713_G_A_b38	SLC35E2	-3.53	0.000478	-0.055498	74	0.015723	no	ARTAORT
chr1_1586962_C_T_b38	SLC35E2	3.525	0.000486	0.057918	38	0.01643	no	ARTAORT
chr1_1668542_C_T_b38	SLC35E2	-3.525	0.000486	-0.066378	17	0.01883	no	ARTAORT
chr1_1743570_T_A_b38	SLC35E2	3.522	0.000492	0.092966	7	0.026397	no	ARTAORT
chr1_1667948_A_G_b38	SLC35E2	-3.499	0.000534	-0.065329	19	0.01867	no	ARTAORT
chr1_1976566_T_C_b38	SLC35E2	3.417	0.000717	0.053598	69	0.015687	no	ARTAORT
chr1_1759354_G_A_b38	SLC35E2	-3.411	0.000731	-0.05568	80	0.016322	no	ARTAORT
chr1_1689421_G_A_b38	SLC35E2	3.406	0.000744	0.051185	61	0.015028	no	ARTAORT
chr1_1589495_CTTT_C_b38	SLC35E2	3.371	0.000841	0.060263	23	0.017875	no	ARTAORT
chr1_1638879_C_T_b38	SLC35E2	-3.296	0.00109	-0.057041	25	0.017307	no	ARTAORT
chr1_1756043_G_T_b38	SLC35E2	-3.277	0.00117	-0.05385	80	0.016434	no	ARTAORT
chr1_1888382_A_AG_b38	SLC35E2	3.27	0.00119	0.073212	5	0.02239	no	ARTAORT
chr1_1689446_T_C_b38	SLC35E2	3.207	0.00148	0.048065	62	0.014987	no	ARTAORT
chr1_1747695_A_G_b38	SLC35E2	-3.174	0.00165	-0.04138	81	0.013038	no	ARTAORT
chr1_1639685_G_A_b38	SLC35E2	-3.127	0.00193	-0.055793	22	0.017842	no	ARTAORT
chr1_1752908_C_CCCT_b38	SLC35E2	-3.101	0.0021	-0.053851	61	0.017367	no	ARTAORT
chr1_1744121_A_C_b38	SLC35E2	-3.089	0.00219	-0.067467	38	0.02184	no	ARTAORT
chr1_1773713_T_A_b38	SLC35E2	-3.075	0.00229	-0.051011	46	0.016587	no	ARTAORT
chr1_1649846_G_A_b38	SLC35E2	-3.062	0.00239	-0.057801	14	0.018878	no	ARTAORT
chr1_1613421_T_C_b38	SLC35E2	3.059	0.00241	0.051722	37	0.01691	no	ARTAORT
chr1_1615322_A_G_b38	SLC35E2	3.056	0.00243	0.051452	37	0.016834	no	ARTAORT
chr1_1604202_G_A_b38	SLC35E2	2.997	0.00294	0.049914	45	0.016653	no	ARTAORT
chr1_1601796_A_C_b38	SLC35E2	2.974	0.00316	0.049467	46	0.016631	no	ARTAORT
chr1_1746263_C_T_b38	SLC35E2	-2.971	0.0032	-0.055699	30	0.018748	no	ARTAORT
chr1_1613322_T_C_b38	SLC35E2	2.945	0.00347	0.049716	38	0.01688	no	ARTAORT
chr1_1644361_C_T_b38	SLC35E2	2.923	0.00372	0.060306	3	0.020632	no	ARTAORT
chr1_1050080_T_C_b38	SLC35E2	-2.903	0.00396	-0.086866	9	0.029922	no	ARTAORT
chr1_1743565_ATAT_A_b38	SLC35E2	-2.9	0.004	-0.042283	66	0.014582	no	ARTAORT
chr1_1690308_AT_A_b38	SLC35E2	-2.897	0.00403	-0.040167	94	0.013865	no	ARTAORT
chr1_1160003_G_A_b38	SLC35E2	2.889	0.00413	0.051574	23	0.017849	no	ARTAORT
chr1_1751981_A_T_b38	SLC35E2	-2.881	0.00423	-0.053422	31	0.01854	no	ARTAORT
chr1_1614340_C_T_b38	SLC35E2	2.83	0.00495	0.063147	5	0.022309	no	ARTAORT
chr1_1744096_C_T_b38	SLC35E2	-2.827	0.005	-0.060579	38	0.021429	no	ARTAORT
chr1_1898043_T_C_b38	SLC35E2	2.815	0.00518	0.05678	9	0.020169	no	ARTAORT
chr1_1921333_C_T_b38	SLC35E2	-2.798	0.00545	-0.046453	84	0.0166	no	ARTAORT
chr1_1657085_C_CTAA_b38	SLC35E2	-2.761	0.0061	-0.052356	24	0.018964	no	ARTAORT
chr1_2677443_C_A_b38	SLC35E2	-2.749	0.00632	-0.126595	3	0.046048	no	ARTAORT
chr1_2677444_C_A_b38	SLC35E2	-2.749	0.00632	-0.126595	3	0.046048	no	ARTAORT
chr1_1668373_C_T_b38	SLC35E2	2.733	0.00663	0.051722	38	0.018927	no	ARTAORT
chr1_1898712_C_T_b38	SLC35E2	2.732	0.00666	0.055675	9	0.020381	no	ARTAORT
chr1_1899188_T_A_b38	SLC35E2	2.732	0.00666	0.055675	9	0.020381	no	ARTAORT
chr1_1708362_T_C_b38	SLC35E2	-2.729	0.0067	-0.043145	55	0.015809	no	ARTAORT
chr1_1611570_CT_C_b38	SLC35E2	-2.728	0.00673	-0.065497	7	0.024012	no	ARTAORT
chr1_1750528_G_A_b38	SLC35E2	-2.721	0.00687	-0.038328	77	0.014087	no	ARTAORT
chr1_1594570_A_G_b38	SLC35E2	2.72	0.00689	0.045254	44	0.016638	no	ARTAORT
chr1_1924207_T_C_b38	SLC35E2	-2.717	0.00696	-0.044205	44	0.016272	no	ARTAORT
chr1_1619986_T_C_b38	SLC35E2	2.697	0.00737	0.046418	33	0.017209	no	ARTAORT
chr1_2262484_G_A_b38	SLC35E2	2.695	0.00741	0.041318	53	0.015329	no	ARTAORT
chr1_1698048_T_C_b38	SLC35E2	-2.674	0.00788	-0.103088	4	0.038548	no	ARTAORT
chr1_1743886_C_T_b38	SLC35E2	-2.661	0.0082	-0.048367	30	0.018179	no	ARTAORT
chr1_1660408_T_C_b38	SLC35E2	-2.653	0.00839	-0.052495	10	0.01979	no	ARTAORT
chr1_1903577_C_T_b38	SLC35E2	2.648	0.0085	0.054667	10	0.020645	no	ARTAORT
chr1_2207909_C_CGT_b38	SLC35E2	-2.634	0.00885	-0.066989	3	0.025433	no	ARTAORT
chr1_1627057_C_G_b38	SLC35E2	-2.63	0.00897	-0.048204	29	0.018331	no	ARTAORT
chr1_1750508_A_C_b38	SLC35E2	-2.621	0.0092	-0.03612	81	0.013783	no	ARTAORT
chr1_1694167_G_A_b38	SLC35E2	-2.608	0.00954	-0.037492	73	0.014376	no	ARTAORT
chr1_1689465_A_G_b38	SLC35E2	2.608	0.00955	0.037698	72	0.014456	no	ARTAORT
chr1_1606089_GGC_G_b38	SLC35E2	2.602	0.0097	0.047049	28	0.018081	no	ARTAORT
chr1_1606094_G_GAGGGGTC_b38	SLC35E2	2.597	0.00984	0.047399	28	0.018251	no	ARTAORT
chr1_1776772_TA_T_b38	SLC35E2	2.596	0.00986	0.053947	8	0.020778	no	ARTAORT
chr1_2247560_C_T_b38	SLC35E2	2.594	0.00993	0.039426	55	0.015199	no	ARTAORT
chr1_2257757_A_T_b38	SLC35E2	2.594	0.00993	0.039426	55	0.015199	no	ARTAORT
chr1_2268965_C_T_b38	SLC35E2	2.594	0.00993	0.039426	55	0.015199	no	ARTAORT
chr1_1913504_CT_C_b38	SLC35E2	-2.594	0.00993	-0.046098	59	0.017772	no	ARTAORT
chr1_1920695_A_G_b38	SLC35E2	-2.593	0.00997	-0.043279	84	0.016694	no	ARTAORT
chr1_1925233_T_C_b38	SLC35E2	-2.593	0.00997	-0.043279	84	0.016694	no	ARTAORT
chr1_1925281_C_T_b38	SLC35E2	-2.593	0.00997	-0.043279	84	0.016694	no	ARTAORT
chr1_1722690_TA_T_b38	SLC35E2	-5.267	4.1e-07	-0.177203	3	0.033643	yes	ARTCRN
chr1_1674868_G_A_b38	SLC35E2	4.936	1.87e-06	0.113207	44	0.022935	yes	ARTCRN
chr1_1674720_TGC_T_b38	SLC35E2	4.868	2.54e-06	0.112651	43	0.023142	yes	ARTCRN
chr1_1677720_T_G_b38	SLC35E2	4.81	3.29e-06	0.108996	45	0.022662	yes	ARTCRN
chr1_1677726_A_T_b38	SLC35E2	4.794	3.52e-06	0.108654	45	0.022666	yes	ARTCRN
chr1_1673060_G_A_b38	SLC35E2	4.763	4.03e-06	0.113968	41	0.023926	yes	ARTCRN
chr1_1676790_C_T_b38	SLC35E2	4.741	4.44e-06	0.106343	46	0.022431	yes	ARTCRN
chr1_1673818_A_C_b38	SLC35E2	4.669	6.08e-06	0.107702	44	0.02307	yes	ARTCRN
chr1_1671995_G_T_b38	SLC35E2	4.514	1.18e-05	0.104865	43	0.023231	yes	ARTCRN
chr1_1654662_CT_C_b38	SLC35E2	4.171	4.8e-05	0.119214	22	0.028582	yes	ARTCRN
chr1_1671797_G_A_b38	SLC35E2	4.148	5.27e-05	0.100452	41	0.024218	yes	ARTCRN
chr1_1708474_C_A_b38	SLC35E2	-4.034	8.24e-05	-0.121593	8	0.030143	yes	ARTCRN
chr1_1688328_C_T_b38	SLC35E2	-3.94	0.000118	-0.109441	15	0.027779	yes	ARTCRN
chr1_2334639_T_C_b38	SLC35E2	-3.774	0.000221	-0.086618	60	0.022954	yes	ARTCRN
chr1_1717507_T_C_b38	SLC35E2	3.63	0.000374	0.136969	8	0.037735	yes	ARTCRN
chr1_1674633_C_CA_b38	SLC35E2	3.455	0.000692	0.088036	25	0.025479	yes	ARTCRN
chr1_2308567_T_C_b38	SLC35E2	-3.426	0.000767	-0.103696	9	0.030271	yes	ARTCRN
chr1_1648736_G_A_b38	SLC35E2	3.386	0.000878	0.087656	37	0.025887	yes	ARTCRN
chr1_2325287_C_CCT_b38	SLC35E2	-3.382	0.00089	-0.086206	26	0.025487	yes	ARTCRN
chr1_1651653_C_T_b38	SLC35E2	3.326	0.00108	0.085215	41	0.025621	yes	ARTCRN
chr1_1649932_C_T_b38	SLC35E2	3.189	0.0017	0.082695	35	0.025933	yes	ARTCRN
chr1_814962_C_T_b38	SLC35E2	-3.072	0.00247	-0.088314	28	0.028748	yes	ARTCRN
chr1_1661562_G_C_b38	SLC35E2	3.036	0.00277	0.069951	46	0.023039	yes	ARTCRN
chr1_1724543_G_C_b38	SLC35E2	-3.03	0.00283	-0.200654	5	0.066233	yes	ARTCRN
chr1_1636278_G_T_b38	SLC35E2	2.973	0.00337	0.078569	34	0.026423	yes	ARTCRN
chr1_1722626_AGCG_A_b38	SLC35E2	2.905	0.00416	0.08932	14	0.030751	yes	ARTCRN
chr1_1722619_C_T_b38	SLC35E2	2.893	0.00431	0.088652	14	0.030647	yes	ARTCRN
chr1_1722625_A_T_b38	SLC35E2	2.866	0.00468	0.087787	14	0.030634	yes	ARTCRN
chr1_1744028_A_AC_b38	SLC35E2	-2.828	0.00525	-0.09548	10	0.033766	yes	ARTCRN
chr1_2429870_C_A_b38	SLC35E2	2.825	0.00529	0.069428	40	0.024576	yes	ARTCRN
chr1_2429693_C_T_b38	SLC35E2	-2.815	0.00545	-0.08157	11	0.028979	yes	ARTCRN
chr1_1739131_T_C_b38	SLC35E2	2.793	0.00581	0.065357	45	0.0234	yes	ARTCRN
chr1_1533855_G_A_b38	SLC35E2	2.781	0.00603	0.09895	5	0.035585	yes	ARTCRN
chr1_1649976_G_A_b38	SLC35E2	2.779	0.00607	0.071938	32	0.02589	yes	ARTCRN
chr1_1713469_C_A_b38	SLC35E2	-2.719	0.00721	-0.186344	3	0.068528	yes	ARTCRN
chr1_2369336_A_G_b38	SLC35E2	-2.655	0.00867	-0.078243	11	0.029468	yes	ARTCRN
chr1_1653825_T_TACACAC_b38	SLC35E2	2.619	0.00961	0.079857	9	0.030492	yes	ARTCRN
chr1_1703968_A_G_b38	SLC35E2	-2.613	0.00977	-0.163836	6	0.062697	yes	ARTCRN
chr1_1650195_A_G_b38	SLC35E2	-3.805	0.000197	-0.099584	21	0.026169	no	ARTCRN
chr1_1675091_A_G_b38	SLC35E2	-3.792	0.000206	-0.101282	18	0.026707	no	ARTCRN
chr1_1673968_GA_G_b38	SLC35E2	3.654	0.000343	0.102025	18	0.027925	no	ARTCRN
chr1_1693256_GT_G_b38	SLC35E2	-3.58	0.000446	-0.176054	5	0.049172	no	ARTCRN
chr1_1651421_GTAGCCCCTCTGAACGGTCTGTGACACACGCATGCTTTCAGCTAGAGTACTCTA_G_b38	SLC35E2	-3.469	0.000661	-0.093119	17	0.026845	no	ARTCRN
chr1_1698022_G_A_b38	SLC35E2	-3.428	0.000762	-0.219542	6	0.06405	no	ARTCRN
chr1_1702383_T_C_b38	SLC35E2	-3.399	0.000839	-0.099942	16	0.029399	no	ARTCRN
chr1_1637577_T_C_b38	SLC35E2	-3.231	0.00148	-0.085954	20	0.026601	no	ARTCRN
chr1_1660683_C_T_b38	SLC35E2	-3.191	0.00169	-0.090443	13	0.028344	no	ARTCRN
chr1_1651137_C_T_b38	SLC35E2	-3.153	0.00191	-0.083845	19	0.026593	no	ARTCRN
chr1_1651267_T_C_b38	SLC35E2	-3.153	0.00191	-0.083845	19	0.026593	no	ARTCRN
chr1_1651574_G_A_b38	SLC35E2	-3.153	0.00191	-0.083845	19	0.026593	no	ARTCRN
chr1_1651785_C_A_b38	SLC35E2	-3.153	0.00191	-0.083845	19	0.026593	no	ARTCRN
chr1_1651926_T_C_b38	SLC35E2	-3.153	0.00191	-0.083845	19	0.026593	no	ARTCRN
chr1_1652061_T_C_b38	SLC35E2	-3.153	0.00191	-0.083845	19	0.026593	no	ARTCRN
chr1_1652135_C_G_b38	SLC35E2	-3.153	0.00191	-0.083845	19	0.026593	no	ARTCRN
chr1_1652191_C_T_b38	SLC35E2	-3.153	0.00191	-0.083845	19	0.026593	no	ARTCRN
chr1_1652592_A_G_b38	SLC35E2	-3.153	0.00191	-0.083845	19	0.026593	no	ARTCRN
chr1_1652779_A_G_b38	SLC35E2	-3.153	0.00191	-0.083845	19	0.026593	no	ARTCRN
chr1_1653147_A_C_b38	SLC35E2	-3.153	0.00191	-0.083845	19	0.026593	no	ARTCRN
chr1_1653396_T_C_b38	SLC35E2	-3.153	0.00191	-0.083845	19	0.026593	no	ARTCRN
chr1_1653472_T_C_b38	SLC35E2	-3.153	0.00191	-0.083845	19	0.026593	no	ARTCRN
chr1_1653811_G_A_b38	SLC35E2	-3.153	0.00191	-0.083845	19	0.026593	no	ARTCRN
chr1_1653893_C_T_b38	SLC35E2	-3.153	0.00191	-0.083845	19	0.026593	no	ARTCRN
chr1_1653934_G_A_b38	SLC35E2	-3.153	0.00191	-0.083845	19	0.026593	no	ARTCRN
chr1_1654143_G_A_b38	SLC35E2	-3.153	0.00191	-0.083845	19	0.026593	no	ARTCRN
chr1_1654188_T_G_b38	SLC35E2	-3.153	0.00191	-0.083845	19	0.026593	no	ARTCRN
chr1_1714674_G_C_b38	SLC35E2	3.152	0.00191	0.121732	14	0.038618	no	ARTCRN
chr1_1658830_C_G_b38	SLC35E2	-3.151	0.00192	-0.084843	18	0.026923	no	ARTCRN
chr1_1657085_C_CTAA_b38	SLC35E2	-3.137	0.00201	-0.094157	16	0.030019	no	ARTCRN
chr1_1671148_C_T_b38	SLC35E2	3.123	0.0021	0.078136	25	0.025018	no	ARTCRN
chr1_1658866_G_A_b38	SLC35E2	-3.102	0.00225	-0.080738	21	0.026028	no	ARTCRN
chr1_1659114_A_G_b38	SLC35E2	-3.102	0.00225	-0.080738	21	0.026028	no	ARTCRN
chr1_1659220_A_G_b38	SLC35E2	-3.102	0.00225	-0.080738	21	0.026028	no	ARTCRN
chr1_1661420_C_A_b38	SLC35E2	-3.102	0.00225	-0.080738	21	0.026028	no	ARTCRN
chr1_2326492_G_A_b38	SLC35E2	-3.075	0.00245	-0.082817	16	0.026929	no	ARTCRN
chr1_2324572_A_G_b38	SLC35E2	-3.061	0.00256	-0.075889	23	0.024794	no	ARTCRN
chr1_2326052_C_T_b38	SLC35E2	-3.056	0.0026	-0.081228	16	0.026582	no	ARTCRN
chr1_2328611_G_A_b38	SLC35E2	-3.056	0.0026	-0.081228	16	0.026582	no	ARTCRN
chr1_1650777_G_A_b38	SLC35E2	-3.019	0.00292	-0.080247	19	0.026579	no	ARTCRN
chr1_2333587_G_A_b38	SLC35E2	-3.01	0.003	-0.079089	17	0.026275	no	ARTCRN
chr1_2333780_C_T_b38	SLC35E2	-3.01	0.003	-0.079089	17	0.026275	no	ARTCRN
chr1_1667948_A_G_b38	SLC35E2	-2.972	0.00338	-0.081989	17	0.027585	no	ARTCRN
chr1_1649846_G_A_b38	SLC35E2	-2.959	0.00352	-0.084192	12	0.028452	no	ARTCRN
chr1_1684789_C_CAAAAA_b38	SLC35E2	-2.953	0.00359	-0.137754	4	0.046651	no	ARTCRN
chr1_2299360_T_C_b38	SLC35E2	-2.945	0.00368	-0.069497	37	0.023602	no	ARTCRN
chr1_2436793_T_C_b38	SLC35E2	2.932	0.00382	0.071307	49	0.024319	no	ARTCRN
chr1_2364484_C_T_b38	SLC35E2	-2.904	0.00417	-0.091305	9	0.031445	no	ARTCRN
chr1_1661177_A_G_b38	SLC35E2	-2.903	0.00419	-0.078805	18	0.02715	no	ARTCRN
chr1_1641261_C_T_b38	SLC35E2	-2.897	0.00425	-0.08299	14	0.028642	no	ARTCRN
chr1_1665061_C_T_b38	SLC35E2	-2.878	0.00451	-0.077932	18	0.027082	no	ARTCRN
chr1_1671097_G_C_b38	SLC35E2	2.857	0.0048	0.073476	23	0.025718	no	ARTCRN
chr1_2327187_CAG_C_b38	SLC35E2	2.857	0.00481	0.079071	18	0.027678	no	ARTCRN
chr1_1657081_C_T_b38	SLC35E2	-2.838	0.00509	-0.08416	16	0.02966	no	ARTCRN
chr1_1639685_G_A_b38	SLC35E2	-2.836	0.00512	-0.079527	18	0.028047	no	ARTCRN
chr1_2691474_C_G_b38	SLC35E2	-2.802	0.00566	-0.127465	5	0.045485	no	ARTCRN
chr1_2428501_C_T_b38	SLC35E2	-2.801	0.00568	-0.085261	9	0.030441	no	ARTCRN
chr1_1638879_C_T_b38	SLC35E2	-2.798	0.00573	-0.077173	19	0.027583	no	ARTCRN
chr1_1664865_A_G_b38	SLC35E2	-2.778	0.00608	-0.072856	20	0.026226	no	ARTCRN
chr1_2333631_T_C_b38	SLC35E2	2.767	0.00628	0.072527	20	0.026214	no	ARTCRN
chr1_1668717_C_G_b38	SLC35E2	-2.76	0.00641	-0.075291	18	0.027281	no	ARTCRN
chr1_1669576_G_A_b38	SLC35E2	-2.76	0.00641	-0.075291	18	0.027281	no	ARTCRN
chr1_1669613_G_A_b38	SLC35E2	-2.76	0.00641	-0.075291	18	0.027281	no	ARTCRN
chr1_1668542_C_T_b38	SLC35E2	-2.753	0.00655	-0.078003	16	0.028339	no	ARTCRN
chr1_899576_G_A_b38	SLC35E2	-2.749	0.00662	-0.151064	3	0.054959	no	ARTCRN
chr1_1665581_C_G_b38	SLC35E2	-2.744	0.00671	-0.071774	21	0.026154	no	ARTCRN
chr1_1652913_C_T_b38	SLC35E2	-2.737	0.00685	-0.073102	18	0.026709	no	ARTCRN
chr1_2050397_C_T_b38	SLC35E2	2.736	0.00688	0.078012	18	0.028517	no	ARTCRN
chr1_1648826_A_G_b38	SLC35E2	-2.733	0.00694	-0.072039	23	0.026361	no	ARTCRN
chr1_1650383_G_T_b38	SLC35E2	-2.731	0.00697	-0.07722	15	0.028276	no	ARTCRN
chr1_1668108_C_T_b38	SLC35E2	2.698	0.00767	0.071456	21	0.026484	no	ARTCRN
chr1_2287526_C_T_b38	SLC35E2	-2.688	0.00788	-0.070729	24	0.026308	no	ARTCRN
chr1_2287529_G_A_b38	SLC35E2	-2.688	0.00788	-0.070729	24	0.026308	no	ARTCRN
chr1_1659060_G_A_b38	SLC35E2	-2.688	0.0079	-0.070045	20	0.026059	no	ARTCRN
chr1_1648636_G_A_b38	SLC35E2	-2.681	0.00806	-0.07143	23	0.026646	no	ARTCRN
chr1_1688647_G_A_b38	SLC35E2	-2.673	0.00825	-0.081319	19	0.030425	no	ARTCRN
chr1_2675482_T_C_b38	SLC35E2	2.671	0.00828	0.09041	14	0.033843	no	ARTCRN
chr1_1948412_A_AATATAT_b38	SLC35E2	2.662	0.0085	0.076462	13	0.02872	no	ARTCRN
chr1_2305258_A_G_b38	SLC35E2	-2.656	0.00865	-0.086997	7	0.032757	no	ARTCRN
chr1_898676_A_C_b38	SLC35E2	-2.644	0.00895	-0.149548	3	0.056558	no	ARTCRN
chr1_899257_AC_A_b38	SLC35E2	-2.644	0.00895	-0.149548	3	0.056558	no	ARTCRN
chr1_2427409_G_C_b38	SLC35E2	-2.633	0.00923	-0.077573	11	0.02946	no	ARTCRN
chr1_2477921_G_A_b38	SLC35E2	-2.632	0.00925	-0.06224	55	0.023644	no	ARTCRN
chr1_2325642_ATTT_A_b38	SLC35E2	-2.623	0.0095	-0.073895	17	0.028172	no	ARTCRN
chr1_1762759_A_AAATG_b38	SLC35E2	-8.627	7.91e-17	-0.187795	3	0.021768	yes	ARTTBL
chr1_1868925_C_T_b38	SLC35E2	-8.141	2.98e-15	-0.179044	3	0.021992	yes	ARTTBL
chr1_1677726_A_T_b38	SLC35E2	7.944	1.25e-14	0.103068	131	0.012974	yes	ARTTBL
chr1_1677720_T_G_b38	SLC35E2	7.923	1.45e-14	0.10289	131	0.012987	yes	ARTTBL
chr1_1674868_G_A_b38	SLC35E2	7.914	1.55e-14	0.102418	132	0.012942	yes	ARTTBL
chr1_1674720_TGC_T_b38	SLC35E2	7.904	1.66e-14	0.102941	130	0.013023	yes	ARTTBL
chr1_1673060_G_A_b38	SLC35E2	7.78	4.03e-14	0.101979	131	0.013108	yes	ARTTBL
chr1_1673818_A_C_b38	SLC35E2	7.769	4.34e-14	0.101141	133	0.013018	yes	ARTTBL
chr1_1676790_C_T_b38	SLC35E2	7.726	5.9e-14	0.098891	134	0.012801	yes	ARTTBL
chr1_1671995_G_T_b38	SLC35E2	7.669	8.75e-14	0.099802	132	0.013013	yes	ARTTBL
chr1_1671797_G_A_b38	SLC35E2	7.504	2.76e-13	0.098866	127	0.013175	yes	ARTTBL
chr1_1673968_GA_G_b38	SLC35E2	6.231	9.65e-10	0.097699	52	0.015679	yes	ARTTBL
chr1_1648736_G_A_b38	SLC35E2	5.784	1.27e-08	0.077457	124	0.013391	yes	ARTTBL
chr1_1651653_C_T_b38	SLC35E2	5.527	5.2e-08	0.073657	135	0.013328	yes	ARTTBL
chr1_1688328_C_T_b38	SLC35E2	-5.489	6.36e-08	-0.085035	27	0.015492	yes	ARTTBL
chr1_1744854_C_A_b38	SLC35E2	-5.443	8.15e-08	-0.068252	90	0.01254	yes	ARTTBL
chr1_1670423_AT_A_b38	SLC35E2	5.354	1.3e-07	0.083616	68	0.015617	yes	ARTTBL
chr1_1649932_C_T_b38	SLC35E2	5.35	1.33e-07	0.071962	122	0.01345	yes	ARTTBL
chr1_1708474_C_A_b38	SLC35E2	-5.323	1.53e-07	-0.090355	27	0.016976	yes	ARTTBL
chr1_1649976_G_A_b38	SLC35E2	5.259	2.13e-07	0.069422	106	0.013201	yes	ARTTBL
chr1_1636278_G_T_b38	SLC35E2	5.099	4.8e-07	0.069932	109	0.013713	yes	ARTTBL
chr1_1637577_T_C_b38	SLC35E2	-4.877	1.44e-06	-0.072092	37	0.014782	yes	ARTTBL
chr1_1708521_C_G_b38	SLC35E2	-4.812	1.97e-06	-0.072945	46	0.015159	yes	ARTTBL
chr1_1739131_T_C_b38	SLC35E2	4.764	2.47e-06	0.061423	111	0.012892	yes	ARTTBL
chr1_1658115_G_A_b38	SLC35E2	-4.721	3.04e-06	-0.132559	4	0.028081	yes	ARTTBL
chr1_1675091_A_G_b38	SLC35E2	-4.702	3.31e-06	-0.075556	29	0.016068	yes	ARTTBL
chr1_1646352_A_C_b38	SLC35E2	4.676	3.75e-06	0.088894	11	0.019012	yes	ARTTBL
chr1_1659940_A_C_b38	SLC35E2	-4.617	4.93e-06	-0.081893	16	0.017738	yes	ARTTBL
chr1_1660408_T_C_b38	SLC35E2	-4.61	5.1e-06	-0.077937	15	0.016908	yes	ARTTBL
chr1_1675132_A_G_b38	SLC35E2	4.562	6.33e-06	0.065056	83	0.014259	yes	ARTTBL
chr1_1667948_A_G_b38	SLC35E2	-4.524	7.54e-06	-0.0736	28	0.016268	yes	ARTTBL
chr1_1613769_C_T_b38	SLC35E2	4.499	8.44e-06	0.06471	61	0.014382	yes	ARTTBL
chr1_1612562_T_TC_b38	SLC35E2	4.496	8.56e-06	0.060286	71	0.013408	yes	ARTTBL
chr1_1676287_C_T_b38	SLC35E2	-4.486	8.96e-06	-0.077522	17	0.017281	yes	ARTTBL
chr1_1750508_A_C_b38	SLC35E2	-4.469	9.7e-06	-0.054652	124	0.01223	yes	ARTTBL
chr1_1671148_C_T_b38	SLC35E2	4.458	1.02e-05	0.061821	62	0.013867	yes	ARTTBL
chr1_1661562_G_C_b38	SLC35E2	4.394	1.35e-05	0.054104	134	0.012314	yes	ARTTBL
chr1_1743565_ATAT_A_b38	SLC35E2	-4.381	1.43e-05	-0.057619	89	0.013152	yes	ARTTBL
chr1_1665581_C_G_b38	SLC35E2	-4.371	1.5e-05	-0.069012	31	0.015788	yes	ARTTBL
chr1_1650195_A_G_b38	SLC35E2	-4.371	1.5e-05	-0.062161	56	0.014221	yes	ARTTBL
chr1_1654662_CT_C_b38	SLC35E2	4.344	1.68e-05	0.0653	89	0.01503	yes	ARTTBL
chr1_1726649_G_A_b38	SLC35E2	-4.327	1.82e-05	-0.145237	7	0.033566	yes	ARTTBL
chr1_1660683_C_T_b38	SLC35E2	-4.323	1.85e-05	-0.064886	40	0.015009	yes	ARTTBL
chr1_1650000_G_A_b38	SLC35E2	4.297	2.07e-05	0.05917	86	0.013771	yes	ARTTBL
chr1_1629332_G_T_b38	SLC35E2	4.288	2.15e-05	0.061104	64	0.01425	yes	ARTTBL
chr1_1668721_C_T_b38	SLC35E2	-4.267	2.36e-05	-0.064395	42	0.015093	yes	ARTTBL
chr1_1667424_T_TAAAATA_b38	SLC35E2	4.198	3.18e-05	0.058713	75	0.013987	yes	ARTTBL
chr1_1740869_C_T_b38	SLC35E2	-4.181	3.41e-05	-0.141095	6	0.033746	yes	ARTTBL
chr1_1741174_TTCA_T_b38	SLC35E2	-4.181	3.41e-05	-0.141095	6	0.033746	yes	ARTTBL
chr1_1741497_G_A_b38	SLC35E2	-4.181	3.41e-05	-0.141095	6	0.033746	yes	ARTTBL
chr1_1731093_G_C_b38	SLC35E2	-4.09	5e-05	-0.136667	6	0.033411	yes	ARTTBL
chr1_1735087_A_C_b38	SLC35E2	-4.09	5e-05	-0.136667	6	0.033411	yes	ARTTBL
chr1_1735286_G_A_b38	SLC35E2	-4.09	5e-05	-0.136667	6	0.033411	yes	ARTTBL
chr1_1661420_C_A_b38	SLC35E2	-4.08	5.22e-05	-0.057212	59	0.014022	yes	ARTTBL
chr1_1671097_G_C_b38	SLC35E2	4.066	5.54e-05	0.056901	62	0.013995	yes	ARTTBL
chr1_1751442_C_T_b38	SLC35E2	4.06	5.67e-05	0.081468	3	0.020065	yes	ARTTBL
chr1_1658866_G_A_b38	SLC35E2	-4.044	6.06e-05	-0.056761	59	0.014035	yes	ARTTBL
chr1_1659114_A_G_b38	SLC35E2	-4.044	6.06e-05	-0.056761	59	0.014035	yes	ARTTBL
chr1_1659220_A_G_b38	SLC35E2	-4.044	6.06e-05	-0.056761	59	0.014035	yes	ARTTBL
chr1_1648826_A_G_b38	SLC35E2	-4.036	6.27e-05	-0.056815	65	0.014077	yes	ARTTBL
chr1_1675228_C_CG_b38	SLC35E2	4.033	6.34e-05	0.057152	99	0.01417	yes	ARTTBL
chr1_1674633_C_CA_b38	SLC35E2	3.995	7.4e-05	0.058291	65	0.014589	yes	ARTTBL
chr1_1746522_GT_G_b38	SLC35E2	-3.988	7.63e-05	-0.066631	33	0.016707	yes	ARTTBL
chr1_1639348_G_T_b38	SLC35E2	-3.982	7.81e-05	-0.05514	68	0.013846	yes	ARTTBL
chr1_1622295_G_C_b38	SLC35E2	3.964	8.43e-05	0.054172	71	0.013667	yes	ARTTBL
chr1_1667424_T_TAAATA_b38	SLC35E2	-3.947	9.02e-05	-0.052759	98	0.013367	yes	ARTTBL
chr1_1586962_C_T_b38	SLC35E2	3.943	9.16e-05	0.056641	70	0.014364	yes	ARTTBL
chr1_1722626_AGCG_A_b38	SLC35E2	3.932	9.58e-05	0.065322	55	0.016612	yes	ARTTBL
chr1_1756043_G_T_b38	SLC35E2	-3.906	0.000106	-0.057163	112	0.014635	yes	ARTTBL
chr1_1672155_G_A_b38	SLC35E2	-3.902	0.000108	-0.057279	57	0.01468	yes	ARTTBL
chr1_1755504_T_C_b38	SLC35E2	3.901	0.000108	0.05205	127	0.013341	yes	ARTTBL
chr1_1620609_G_A_b38	SLC35E2	3.9	0.000109	0.053146	71	0.013626	yes	ARTTBL
chr1_1648636_G_A_b38	SLC35E2	-3.874	0.000121	-0.054823	65	0.014153	yes	ARTTBL
chr1_1668108_C_T_b38	SLC35E2	3.871	0.000123	0.055329	57	0.014295	yes	ARTTBL
chr1_1650370_C_CT_b38	SLC35E2	-3.866	0.000125	-0.066661	26	0.017242	yes	ARTTBL
chr1_1606507_GTGGGC_G_b38	SLC35E2	3.858	0.000129	0.050251	144	0.013026	yes	ARTTBL
chr1_1742587_G_C_b38	SLC35E2	3.853	0.000131	0.051519	132	0.01337	yes	ARTTBL
chr1_1639685_G_A_b38	SLC35E2	-3.852	0.000132	-0.062584	30	0.016249	yes	ARTTBL
chr1_1743886_C_T_b38	SLC35E2	-3.834	0.000141	-0.061204	45	0.015961	yes	ARTTBL
chr1_1664865_A_G_b38	SLC35E2	-3.814	0.000153	-0.054116	55	0.014188	yes	ARTTBL
chr1_1743714_C_CA_b38	SLC35E2	3.809	0.000157	0.057194	73	0.015016	yes	ARTTBL
chr1_1722625_A_T_b38	SLC35E2	3.804	0.000159	0.063295	55	0.016637	yes	ARTTBL
chr1_1722690_TA_T_b38	SLC35E2	-3.804	0.00016	-0.082112	4	0.021587	yes	ARTTBL
chr1_1752126_G_A_b38	SLC35E2	3.795	0.000165	0.056707	66	0.014942	yes	ARTTBL
chr1_1736832_GA_G_b38	SLC35E2	-3.788	0.00017	-0.140263	4	0.037026	yes	ARTTBL
chr1_1722619_C_T_b38	SLC35E2	3.779	0.000176	0.063358	58	0.016766	yes	ARTTBL
chr1_1671724_C_T_b38	SLC35E2	-3.771	0.000182	-0.056608	48	0.015013	yes	ARTTBL
chr1_1752908_C_CCCT_b38	SLC35E2	-3.764	0.000187	-0.056756	88	0.015081	yes	ARTTBL
chr1_1621352_G_A_b38	SLC35E2	3.719	0.000222	0.050966	73	0.013705	yes	ARTTBL
chr1_1904424_A_AAAATAAATAAAT_b38	SLC35E2	3.712	0.000228	0.047761	98	0.012866	yes	ARTTBL
chr1_1936906_C_CA_b38	SLC35E2	-3.655	0.000283	-0.056524	63	0.015464	yes	ARTTBL
chr1_1649846_G_A_b38	SLC35E2	-3.649	0.00029	-0.058888	28	0.016137	yes	ARTTBL
chr1_1755523_C_T_b38	SLC35E2	3.633	0.000308	0.048964	133	0.013476	yes	ARTTBL
chr1_1606384_A_G_b38	SLC35E2	3.614	0.000331	0.049062	73	0.013575	yes	ARTTBL
chr1_1652913_C_T_b38	SLC35E2	-3.587	0.000367	-0.054856	40	0.015293	yes	ARTTBL
chr1_1630798_C_T_b38	SLC35E2	3.582	0.000374	0.051075	61	0.01426	yes	ARTTBL
chr1_1750528_G_A_b38	SLC35E2	-3.559	0.000407	-0.044747	118	0.012573	yes	ARTTBL
chr1_1692124_T_G_b38	SLC35E2	-3.557	0.00041	-0.056714	43	0.015946	yes	ARTTBL
chr1_1606532_GTGGGCTGGGCTGGTCAGGCA_G_b38	SLC35E2	3.555	0.000413	0.049366	58	0.013887	yes	ARTTBL
chr1_1653863_C_A_b38	SLC35E2	-3.532	0.00045	-0.063115	15	0.01787	yes	ARTTBL
chr1_1591703_T_C_b38	SLC35E2	3.526	0.000459	0.046101	116	0.013074	yes	ARTTBL
chr1_1651421_GTAGCCCCTCTGAACGGTCTGTGACACACGCATGCTTTCAGCTAGAGTACTCTA_G_b38	SLC35E2	-3.5	0.000505	-0.050691	51	0.014481	yes	ARTTBL
chr1_1650664_CT_C_b38	SLC35E2	3.486	0.000532	0.055755	49	0.015994	yes	ARTTBL
chr1_1641261_C_T_b38	SLC35E2	-3.453	0.000599	-0.059489	25	0.017226	yes	ARTTBL
chr1_1651926_T_C_b38	SLC35E2	-3.443	0.000622	-0.049327	54	0.014326	yes	ARTTBL
chr1_1652061_T_C_b38	SLC35E2	-3.424	0.000667	-0.04897	55	0.014304	yes	ARTTBL
chr1_1654188_T_G_b38	SLC35E2	-3.424	0.000667	-0.04897	55	0.014304	yes	ARTTBL
chr1_1593732_G_C_b38	SLC35E2	-3.415	0.000689	-0.044789	127	0.013117	yes	ARTTBL
chr1_1650777_G_A_b38	SLC35E2	-3.409	0.000704	-0.048782	54	0.014311	yes	ARTTBL
chr1_1744052_GAGA_G_b38	SLC35E2	-3.408	0.000705	-0.05946	28	0.017446	yes	ARTTBL
chr1_1651137_C_T_b38	SLC35E2	-3.405	0.000713	-0.048796	54	0.01433	yes	ARTTBL
chr1_1651267_T_C_b38	SLC35E2	-3.405	0.000713	-0.048796	54	0.01433	yes	ARTTBL
chr1_1652135_C_G_b38	SLC35E2	-3.405	0.000713	-0.048796	54	0.01433	yes	ARTTBL
chr1_1652191_C_T_b38	SLC35E2	-3.405	0.000713	-0.048796	54	0.01433	yes	ARTTBL
chr1_1652592_A_G_b38	SLC35E2	-3.405	0.000713	-0.048796	54	0.01433	yes	ARTTBL
chr1_1652779_A_G_b38	SLC35E2	-3.405	0.000713	-0.048796	54	0.01433	yes	ARTTBL
chr1_1653147_A_C_b38	SLC35E2	-3.405	0.000713	-0.048796	54	0.01433	yes	ARTTBL
chr1_1653396_T_C_b38	SLC35E2	-3.405	0.000713	-0.048796	54	0.01433	yes	ARTTBL
chr1_1653472_T_C_b38	SLC35E2	-3.405	0.000713	-0.048796	54	0.01433	yes	ARTTBL
chr1_1653811_G_A_b38	SLC35E2	-3.405	0.000713	-0.048796	54	0.01433	yes	ARTTBL
chr1_1653893_C_T_b38	SLC35E2	-3.405	0.000713	-0.048796	54	0.01433	yes	ARTTBL
chr1_1654143_G_A_b38	SLC35E2	-3.405	0.000713	-0.048796	54	0.01433	yes	ARTTBL
chr1_1664757_T_C_b38	SLC35E2	-3.388	0.000759	-0.048244	54	0.014241	yes	ARTTBL
chr1_1759354_G_A_b38	SLC35E2	-3.385	0.000766	-0.050006	111	0.014773	yes	ARTTBL
chr1_1653934_G_A_b38	SLC35E2	-3.381	0.000778	-0.048481	54	0.01434	yes	ARTTBL
chr1_1743586_T_TAC_b38	SLC35E2	-3.37	0.000808	-0.049519	74	0.014694	yes	ARTTBL
chr1_1641275_A_G_b38	SLC35E2	-3.359	0.000842	-0.048184	66	0.014347	yes	ARTTBL
chr1_1486611_G_A_b38	SLC35E2	-3.34	0.000899	-0.071738	25	0.02148	yes	ARTTBL
chr1_1743712_G_A_b38	SLC35E2	3.301	0.00103	0.077604	5	0.023508	yes	ARTTBL
chr1_1017803_A_AGT_b38	SLC35E2	3.298	0.00104	0.067012	10	0.020317	yes	ARTTBL
chr1_1750226_C_T_b38	SLC35E2	3.298	0.00104	0.046692	93	0.014158	yes	ARTTBL
chr1_1651574_G_A_b38	SLC35E2	-3.293	0.00106	-0.047178	54	0.014327	yes	ARTTBL
chr1_1651785_C_A_b38	SLC35E2	-3.242	0.00126	-0.046444	54	0.014324	yes	ARTTBL
chr1_1728274_G_C_b38	SLC35E2	-3.242	0.00127	-0.111897	5	0.034519	yes	ARTTBL
chr1_1904424_A_AAAATAAAT_b38	SLC35E2	-3.23	0.00132	-0.042429	121	0.013135	yes	ARTTBL
chr1_1017844_C_T_b38	SLC35E2	3.223	0.00135	0.061404	17	0.019054	yes	ARTTBL
chr1_2334639_T_C_b38	SLC35E2	-3.212	0.0014	-0.042122	158	0.013114	yes	ARTTBL
chr1_1038078_C_T_b38	SLC35E2	3.211	0.00141	0.063753	14	0.019856	yes	ARTTBL
chr1_1041950_T_C_b38	SLC35E2	3.21	0.00141	0.063804	14	0.019877	yes	ARTTBL
chr1_1729859_A_G_b38	SLC35E2	3.209	0.00142	0.053662	25	0.016725	yes	ARTTBL
chr1_1476079_T_C_b38	SLC35E2	-3.205	0.00143	-0.065939	44	0.020572	yes	ARTTBL
chr1_2264013_TA_T_b38	SLC35E2	3.205	0.00143	0.044383	128	0.013847	yes	ARTTBL
chr1_1036754_C_T_b38	SLC35E2	3.198	0.00147	0.061644	15	0.019273	yes	ARTTBL
chr1_1481959_C_T_b38	SLC35E2	-3.195	0.00148	-0.066645	31	0.020857	yes	ARTTBL
chr1_1969238_C_T_b38	SLC35E2	3.173	0.0016	0.050195	29	0.015818	yes	ARTTBL
chr1_1764023_C_A_b38	SLC35E2	3.167	0.00163	0.045023	91	0.014214	yes	ARTTBL
chr1_1746440_A_G_b38	SLC35E2	-3.163	0.00165	-0.052523	35	0.016605	yes	ARTTBL
chr1_1969235_A_G_b38	SLC35E2	3.16	0.00167	0.050176	29	0.01588	yes	ARTTBL
chr1_1051820_C_T_b38	SLC35E2	3.155	0.0017	0.062217	31	0.019723	yes	ARTTBL
chr1_1729403_C_T_b38	SLC35E2	-3.112	0.00196	-0.107963	5	0.034689	yes	ARTTBL
chr1_1730099_A_G_b38	SLC35E2	-3.112	0.00196	-0.107963	5	0.034689	yes	ARTTBL
chr1_1757725_C_T_b38	SLC35E2	3.095	0.00207	0.044448	87	0.014359	yes	ARTTBL
chr1_1969249_A_AGCCCT_b38	SLC35E2	3.075	0.00222	0.049163	28	0.015988	yes	ARTTBL
chr1_1051063_C_T_b38	SLC35E2	3.072	0.00224	0.06202	30	0.02019	yes	ARTTBL
chr1_1755713_G_A_b38	SLC35E2	-3.067	0.00228	-0.045385	97	0.0148	yes	ARTTBL
chr1_1053123_A_T_b38	SLC35E2	3.06	0.00233	0.060458	31	0.019756	yes	ARTTBL
chr1_1472158_C_G_b38	SLC35E2	-3.043	0.00246	-0.072261	20	0.023746	yes	ARTTBL
chr1_1756186_T_C_b38	SLC35E2	3.022	0.00264	0.042316	91	0.014002	yes	ARTTBL
chr1_1483898_G_A_b38	SLC35E2	-3.018	0.00267	-0.064125	46	0.021246	yes	ARTTBL
chr1_1486151_C_A_b38	SLC35E2	-3.018	0.00267	-0.064125	46	0.021246	yes	ARTTBL
chr1_1742119_C_CA_b38	SLC35E2	-3.016	0.00268	-0.101945	7	0.033797	yes	ARTTBL
chr1_1978932_G_A_b38	SLC35E2	2.986	0.00296	0.051968	19	0.017402	yes	ARTTBL
chr1_1984601_T_C_b38	SLC35E2	2.97	0.00312	0.043376	54	0.014606	yes	ARTTBL
chr1_1728671_C_A_b38	SLC35E2	2.969	0.00313	0.05123	27	0.017254	yes	ARTTBL
chr1_1029365_A_ATCTATGCAGGCAGGTGGGGGGATCAGTG_b38	SLC35E2	2.96	0.00322	0.044182	39	0.014928	yes	ARTTBL
chr1_1754601_G_T_b38	SLC35E2	2.931	0.00353	0.042095	87	0.014364	yes	ARTTBL
chr1_1977879_G_A_b38	SLC35E2	2.909	0.00379	0.042133	56	0.014484	yes	ARTTBL
chr1_2689953_T_G_b38	SLC35E2	-2.902	0.00387	-0.072774	8	0.025079	yes	ARTTBL
chr1_1022518_G_T_b38	SLC35E2	2.878	0.00417	0.039746	65	0.01381	yes	ARTTBL
chr1_2331844_G_C_b38	SLC35E2	-2.868	0.0043	-0.060566	16	0.021116	yes	ARTTBL
chr1_1779667_T_TTG_b38	SLC35E2	2.867	0.00432	0.041884	79	0.014612	yes	ARTTBL
chr1_1169858_T_C_b38	SLC35E2	2.863	0.00436	0.040328	58	0.014084	yes	ARTTBL
chr1_1976990_T_C_b38	SLC35E2	2.861	0.0044	0.041794	54	0.01461	yes	ARTTBL
chr1_1688102_G_A_b38	SLC35E2	-2.86	0.00441	-0.045494	35	0.015909	yes	ARTTBL
chr1_1679100_A_G_b38	SLC35E2	-2.857	0.00445	-0.038177	109	0.013363	yes	ARTTBL
chr1_1743570_T_A_b38	SLC35E2	2.851	0.00454	0.068095	11	0.023885	yes	ARTTBL
chr1_1986211_T_C_b38	SLC35E2	2.845	0.00462	0.041696	54	0.014656	yes	ARTTBL
chr1_1476266_T_C_b38	SLC35E2	-2.839	0.0047	-0.057761	48	0.020343	yes	ARTTBL
chr1_1978114_T_A_b38	SLC35E2	2.838	0.00473	0.041637	55	0.014673	yes	ARTTBL
chr1_1428033_GGA_G_b38	SLC35E2	-2.837	0.00473	-0.157259	3	0.055422	yes	ARTTBL
chr1_2301093_G_A_b38	SLC35E2	-2.837	0.00474	-0.053095	11	0.018716	yes	ARTTBL
chr1_1027869_C_T_b38	SLC35E2	2.834	0.00479	0.056346	14	0.019886	yes	ARTTBL
chr1_1944216_C_T_b38	SLC35E2	-2.83	0.00484	-0.040582	116	0.014341	yes	ARTTBL
chr1_1978262_C_T_b38	SLC35E2	2.823	0.00495	0.041329	54	0.014642	yes	ARTTBL
chr1_1978294_G_T_b38	SLC35E2	2.823	0.00495	0.041329	54	0.014642	yes	ARTTBL
chr1_1584321_T_C_b38	SLC35E2	-2.808	0.00517	-0.038626	89	0.013754	yes	ARTTBL
chr1_1982826_T_C_b38	SLC35E2	2.807	0.00519	0.041184	54	0.014672	yes	ARTTBL
chr1_1983166_A_T_b38	SLC35E2	2.807	0.00519	0.041184	54	0.014672	yes	ARTTBL
chr1_1983956_TGG_T_b38	SLC35E2	2.807	0.00519	0.041184	54	0.014672	yes	ARTTBL
chr1_1984586_G_A_b38	SLC35E2	2.807	0.00519	0.041184	54	0.014672	yes	ARTTBL
chr1_1984595_C_T_b38	SLC35E2	2.807	0.00519	0.041184	54	0.014672	yes	ARTTBL
chr1_1984859_C_T_b38	SLC35E2	2.807	0.00519	0.041184	54	0.014672	yes	ARTTBL
chr1_1985148_G_T_b38	SLC35E2	2.807	0.00519	0.041184	54	0.014672	yes	ARTTBL
chr1_1978006_A_G_b38	SLC35E2	2.806	0.00521	0.040759	56	0.014526	yes	ARTTBL
chr1_1981062_A_G_b38	SLC35E2	2.805	0.00522	0.040903	58	0.014581	yes	ARTTBL
chr1_1981291_A_G_b38	SLC35E2	2.805	0.00522	0.040903	58	0.014581	yes	ARTTBL
chr1_1981295_T_C_b38	SLC35E2	2.805	0.00522	0.040903	58	0.014581	yes	ARTTBL
chr1_1978404_C_T_b38	SLC35E2	2.796	0.00536	0.04094	54	0.014641	yes	ARTTBL
chr1_1978415_G_A_b38	SLC35E2	2.796	0.00536	0.04094	54	0.014641	yes	ARTTBL
chr1_2268951_C_A_b38	SLC35E2	2.792	0.00543	0.0371	108	0.013288	yes	ARTTBL
chr1_1972273_C_A_b38	SLC35E2	2.785	0.00555	0.041245	51	0.014808	yes	ARTTBL
chr1_1977765_A_G_b38	SLC35E2	2.766	0.00588	0.040546	54	0.014658	yes	ARTTBL
chr1_1978562_C_G_b38	SLC35E2	2.766	0.00588	0.040546	54	0.014658	yes	ARTTBL
chr1_1978573_T_C_b38	SLC35E2	2.766	0.00588	0.040546	54	0.014658	yes	ARTTBL
chr1_1978647_G_T_b38	SLC35E2	2.766	0.00588	0.040546	54	0.014658	yes	ARTTBL
chr1_1978797_T_C_b38	SLC35E2	2.766	0.00588	0.040546	54	0.014658	yes	ARTTBL
chr1_1980953_G_A_b38	SLC35E2	2.766	0.00588	0.040546	54	0.014658	yes	ARTTBL
chr1_1981319_G_C_b38	SLC35E2	2.766	0.00588	0.040546	54	0.014658	yes	ARTTBL
chr1_1986010_T_G_b38	SLC35E2	2.766	0.00588	0.040546	54	0.014658	yes	ARTTBL
chr1_1986033_G_A_b38	SLC35E2	2.766	0.00588	0.040546	54	0.014658	yes	ARTTBL
chr1_1986176_A_T_b38	SLC35E2	2.766	0.00588	0.040546	54	0.014658	yes	ARTTBL
chr1_1986390_T_G_b38	SLC35E2	2.766	0.00588	0.040546	54	0.014658	yes	ARTTBL
chr1_1986469_A_C_b38	SLC35E2	2.766	0.00588	0.040546	54	0.014658	yes	ARTTBL
chr1_1987096_A_T_b38	SLC35E2	2.766	0.00588	0.040546	54	0.014658	yes	ARTTBL
chr1_1987156_G_A_b38	SLC35E2	2.766	0.00588	0.040546	54	0.014658	yes	ARTTBL
chr1_1978055_C_T_b38	SLC35E2	2.764	0.00592	0.040522	54	0.014662	yes	ARTTBL
chr1_1976473_C_T_b38	SLC35E2	2.76	0.00599	0.040425	54	0.014647	yes	ARTTBL
chr1_1976573_T_C_b38	SLC35E2	2.76	0.00599	0.040425	54	0.014647	yes	ARTTBL
chr1_1976661_G_T_b38	SLC35E2	2.76	0.00599	0.040425	54	0.014647	yes	ARTTBL
chr1_1976946_C_T_b38	SLC35E2	2.76	0.00599	0.040425	54	0.014647	yes	ARTTBL
chr1_1977264_C_G_b38	SLC35E2	2.76	0.00599	0.040425	54	0.014647	yes	ARTTBL
chr1_1022868_A_G_b38	SLC35E2	2.754	0.00609	0.038468	69	0.013966	yes	ARTTBL
chr1_1482624_T_C_b38	SLC35E2	-2.752	0.00613	-0.057	47	0.020711	yes	ARTTBL
chr1_1488652_A_G_b38	SLC35E2	-2.752	0.00613	-0.057	47	0.020711	yes	ARTTBL
chr1_1490320_T_C_b38	SLC35E2	-2.752	0.00613	-0.057	47	0.020711	yes	ARTTBL
chr1_1492292_C_G_b38	SLC35E2	-2.752	0.00613	-0.057	47	0.020711	yes	ARTTBL
chr1_1492850_G_A_b38	SLC35E2	-2.752	0.00613	-0.057	47	0.020711	yes	ARTTBL
chr1_1473089_T_C_b38	SLC35E2	-2.751	0.00615	-0.057003	45	0.020722	yes	ARTTBL
chr1_2249085_G_A_b38	SLC35E2	2.733	0.0065	0.036065	111	0.013197	yes	ARTTBL
chr1_1757074_G_T_b38	SLC35E2	2.732	0.00651	0.038847	89	0.01422	yes	ARTTBL
chr1_2500892_C_A_b38	SLC35E2	2.725	0.00665	0.035886	109	0.013168	yes	ARTTBL
chr1_1976600_C_T_b38	SLC35E2	2.71	0.00696	0.039671	54	0.01464	yes	ARTTBL
chr1_978812_G_C_b38	SLC35E2	2.704	0.00708	0.07843	6	0.029007	yes	ARTTBL
chr1_1490046_G_A_b38	SLC35E2	-2.694	0.00729	-0.061457	7	0.022812	yes	ARTTBL
chr1_1490047_A_G_b38	SLC35E2	-2.694	0.00729	-0.061457	7	0.022812	yes	ARTTBL
chr1_2241549_T_C_b38	SLC35E2	2.693	0.00731	0.034648	149	0.012865	yes	ARTTBL
chr1_1985619_A_G_b38	SLC35E2	2.685	0.00748	0.038884	76	0.014479	yes	ARTTBL
chr1_1489916_C_T_b38	SLC35E2	-2.684	0.00752	-0.054499	24	0.020308	yes	ARTTBL
chr1_2244722_C_T_b38	SLC35E2	2.682	0.00756	0.035185	112	0.01312	yes	ARTTBL
chr1_1220377_C_T_b38	SLC35E2	-2.682	0.00756	-0.062841	26	0.023433	yes	ARTTBL
chr1_1021740_G_C_b38	SLC35E2	2.672	0.00777	0.037901	56	0.014182	yes	ARTTBL
chr1_1009716_C_T_b38	SLC35E2	2.672	0.00777	0.069012	19	0.025824	yes	ARTTBL
chr1_1971127_G_A_b38	SLC35E2	2.67	0.00782	0.041779	36	0.015647	yes	ARTTBL
chr1_1976646_A_G_b38	SLC35E2	2.665	0.00795	0.039157	53	0.014696	yes	ARTTBL
chr1_1492619_A_AC_b38	SLC35E2	-2.656	0.00814	-0.054687	48	0.020587	yes	ARTTBL
chr1_1981144_T_G_b38	SLC35E2	2.655	0.00817	0.042798	33	0.016118	yes	ARTTBL
chr1_1497105_T_G_b38	SLC35E2	-2.655	0.00818	-0.062377	5	0.023496	yes	ARTTBL
chr1_1650383_G_T_b38	SLC35E2	-2.654	0.00821	-0.040718	43	0.015344	yes	ARTTBL
chr1_1018652_C_G_b38	SLC35E2	2.651	0.00828	0.03782	54	0.014267	yes	ARTTBL
chr1_1018754_G_A_b38	SLC35E2	2.651	0.00828	0.03782	54	0.014267	yes	ARTTBL
chr1_975523_T_C_b38	SLC35E2	2.645	0.00841	0.074263	8	0.028074	yes	ARTTBL
chr1_1020217_G_T_b38	SLC35E2	2.642	0.00849	0.037619	56	0.014238	yes	ARTTBL
chr1_1770997_G_A_b38	SLC35E2	-2.638	0.0086	-0.037701	120	0.014293	yes	ARTTBL
chr1_1731375_T_C_b38	SLC35E2	-2.635	0.00867	-0.052619	28	0.019968	yes	ARTTBL
chr1_1866635_T_TA_b38	SLC35E2	2.631	0.00877	0.039794	66	0.015125	yes	ARTTBL
chr1_1721552_G_A_b38	SLC35E2	-2.626	0.00889	-0.122977	3	0.046827	yes	ARTTBL
chr1_1024462_C_T_b38	SLC35E2	2.625	0.00891	0.038111	57	0.014516	yes	ARTTBL
chr1_2699998_G_C_b38	SLC35E2	-2.621	0.00902	-0.089304	6	0.034069	yes	ARTTBL
chr1_2324806_A_T_b38	SLC35E2	-2.619	0.00908	-0.03584	76	0.013685	yes	ARTTBL
chr1_2238792_C_T_b38	SLC35E2	2.614	0.00923	0.03451	110	0.013205	yes	ARTTBL
chr1_1650688_T_A_b38	SLC35E2	-2.607	0.00939	-0.040582	40	0.015565	yes	ARTTBL
chr1_2244599_C_T_b38	SLC35E2	2.605	0.00945	0.034256	111	0.013149	yes	ARTTBL
chr1_1743602_T_C_b38	SLC35E2	-2.602	0.00954	-0.093069	4	0.035773	yes	ARTTBL
chr1_1020681_A_AG_b38	SLC35E2	2.598	0.00966	0.037998	47	0.014628	yes	ARTTBL
chr1_1487887_A_G_b38	SLC35E2	-2.592	0.00982	-0.054078	48	0.020864	yes	ARTTBL
chr1_2262576_C_A_b38	SLC35E2	2.591	0.00983	0.033547	146	0.012946	yes	ARTTBL
chr1_1968103_A_ATGAG_b38	SLC35E2	2.589	0.00991	0.039605	36	0.0153	yes	ARTTBL
chr1_1835922_G_GAAA_b38	SLC35E2	-4.948	1.02e-06	-0.150203	10	0.030356	no	ARTTBL
chr1_1665061_C_T_b38	SLC35E2	-4.525	7.5e-06	-0.072999	28	0.016131	no	ARTTBL
chr1_1661177_A_G_b38	SLC35E2	-4.523	7.59e-06	-0.073067	28	0.016155	no	ARTTBL
chr1_1668717_C_G_b38	SLC35E2	-4.437	1.12e-05	-0.072234	28	0.016278	no	ARTTBL
chr1_1668542_C_T_b38	SLC35E2	-4.435	1.12e-05	-0.072889	26	0.016433	no	ARTTBL
chr1_1750428_G_C_b38	SLC35E2	-4.427	1.17e-05	-0.06869	76	0.015518	no	ARTTBL
chr1_1658830_C_G_b38	SLC35E2	-4.421	1.2e-05	-0.070151	30	0.015867	no	ARTTBL
chr1_1669613_G_A_b38	SLC35E2	-4.39	1.38e-05	-0.07107	29	0.016189	no	ARTTBL
chr1_1750440_G_A_b38	SLC35E2	-4.381	1.43e-05	-0.06821	75	0.015568	no	ARTTBL
chr1_1753033_C_T_b38	SLC35E2	-4.365	1.54e-05	-0.062811	120	0.01439	no	ARTTBL
chr1_1669576_G_A_b38	SLC35E2	-4.352	1.63e-05	-0.070781	28	0.016263	no	ARTTBL
chr1_1658422_T_C_b38	SLC35E2	4.323	1.85e-05	0.071071	30	0.016439	no	ARTTBL
chr1_1752461_G_A_b38	SLC35E2	-4.26	2.43e-05	-0.061806	110	0.014508	no	ARTTBL
chr1_1751981_A_T_b38	SLC35E2	-4.25	2.54e-05	-0.068903	48	0.016212	no	ARTTBL
chr1_1747695_A_G_b38	SLC35E2	-4.225	2.83e-05	-0.050486	123	0.01195	no	ARTTBL
chr1_1600379_C_T_b38	SLC35E2	4.223	2.86e-05	0.057991	66	0.013733	no	ARTTBL
chr1_1659060_G_A_b38	SLC35E2	-4.209	3.03e-05	-0.062731	44	0.014905	no	ARTTBL
chr1_1589495_CTTT_C_b38	SLC35E2	4.171	3.56e-05	0.063509	47	0.015227	no	ARTTBL
chr1_1752730_C_G_b38	SLC35E2	-4.155	3.81e-05	-0.060391	110	0.014535	no	ARTTBL
chr1_1691377_C_T_b38	SLC35E2	-4.142	4.03e-05	-0.060883	55	0.014701	no	ARTTBL
chr1_1600320_C_G_b38	SLC35E2	4.13	4.23e-05	0.057192	63	0.013847	no	ARTTBL
chr1_1924231_CCCT_C_b38	SLC35E2	-4.121	4.41e-05	-0.213794	3	0.051885	no	ARTTBL
chr1_1753319_G_A_b38	SLC35E2	-4.069	5.47e-05	-0.059307	110	0.014576	no	ARTTBL
chr1_1753361_G_A_b38	SLC35E2	-4.069	5.47e-05	-0.059307	110	0.014576	no	ARTTBL
chr1_1864334_AAAG_A_b38	SLC35E2	-3.991	7.54e-05	-0.066791	35	0.016736	no	ARTTBL
chr1_1725582_T_C_b38	SLC35E2	3.839	0.000139	0.047052	134	0.012257	no	ARTTBL
chr1_1849781_T_C_b38	SLC35E2	-3.824	0.000148	-0.060431	32	0.015805	no	ARTTBL
chr1_1865177_G_A_b38	SLC35E2	-3.79	0.000169	-0.060399	31	0.015937	no	ARTTBL
chr1_1717507_T_C_b38	SLC35E2	3.786	0.000171	0.078065	24	0.020621	no	ARTTBL
chr1_1692151_T_C_b38	SLC35E2	-3.762	0.000188	-0.060133	44	0.015984	no	ARTTBL
chr1_1609058_G_A_b38	SLC35E2	3.76	0.00019	0.051614	66	0.013728	no	ARTTBL
chr1_1595028_C_CAG_b38	SLC35E2	3.749	0.000198	0.057159	42	0.015248	no	ARTTBL
chr1_1607931_G_A_b38	SLC35E2	3.731	0.000212	0.051537	65	0.013814	no	ARTTBL
chr1_1744499_C_T_b38	SLC35E2	-3.729	0.000214	-0.049316	113	0.013225	no	ARTTBL
chr1_1744652_C_T_b38	SLC35E2	-3.72	0.000221	-0.050676	111	0.013622	no	ARTTBL
chr1_1692286_C_A_b38	SLC35E2	3.676	0.000262	0.074105	4	0.020158	no	ARTTBL
chr1_1750280_A_G_b38	SLC35E2	-3.674	0.000264	-0.05161	125	0.014047	no	ARTTBL
chr1_1743238_G_C_b38	SLC35E2	-3.648	0.000291	-0.051652	94	0.014159	no	ARTTBL
chr1_1945975_TG_T_b38	SLC35E2	-3.645	0.000295	-0.05198	118	0.014261	no	ARTTBL
chr1_1749826_A_G_b38	SLC35E2	-3.635	0.000306	-0.048682	134	0.013392	no	ARTTBL
chr1_1742672_C_T_b38	SLC35E2	-3.632	0.000309	-0.051422	95	0.014157	no	ARTTBL
chr1_1743840_T_C_b38	SLC35E2	-3.61	0.000337	-0.057978	43	0.016062	no	ARTTBL
chr1_1754482_TCCCTGGGACCGAAGTCGCCCCA_T_b38	SLC35E2	-3.582	0.000373	-0.052404	112	0.014629	no	ARTTBL
chr1_1743851_C_T_b38	SLC35E2	-3.557	0.00041	-0.05712	42	0.016058	no	ARTTBL
chr1_1945842_A_AAAAGAAC_b38	SLC35E2	-3.545	0.000428	-0.051679	83	0.014576	no	ARTTBL
chr1_1746263_C_T_b38	SLC35E2	-3.544	0.00043	-0.056339	48	0.015896	no	ARTTBL
chr1_1748780_G_A_b38	SLC35E2	-3.519	0.000472	-0.050127	126	0.014245	no	ARTTBL
chr1_1595306_CAG_C_b38	SLC35E2	-3.494	0.000516	-0.05038	122	0.014418	no	ARTTBL
chr1_1649993_A_G_b38	SLC35E2	-3.487	0.00053	-0.04622	146	0.013254	no	ARTTBL
chr1_1594890_G_GAC_b38	SLC35E2	-3.473	0.000559	-0.046138	123	0.013287	no	ARTTBL
chr1_1759611_C_T_b38	SLC35E2	-3.35	0.000867	-0.049476	113	0.014768	no	ARTTBL
chr1_1597128_C_CCCTCAGCTGGACT_b38	SLC35E2	-3.348	0.000873	-0.043763	99	0.01307	no	ARTTBL
chr1_1697272_G_A_b38	SLC35E2	3.285	0.00109	0.07098	37	0.021607	no	ARTTBL
chr1_1744121_A_C_b38	SLC35E2	-3.277	0.00112	-0.060947	68	0.018599	no	ARTTBL
chr1_1744028_A_AC_b38	SLC35E2	-3.266	0.00116	-0.059313	22	0.018161	no	ARTTBL
chr1_1689421_G_A_b38	SLC35E2	3.24	0.00127	0.04522	78	0.013957	no	ARTTBL
chr1_1689446_T_C_b38	SLC35E2	3.224	0.00135	0.04544	77	0.014095	no	ARTTBL
chr1_1638879_C_T_b38	SLC35E2	-3.185	0.00154	-0.050619	33	0.015894	no	ARTTBL
chr1_1644361_C_T_b38	SLC35E2	3.17	0.00162	0.058171	3	0.01835	no	ARTTBL
chr1_1045080_G_A_b38	SLC35E2	3.123	0.00189	0.067573	9	0.021634	no	ARTTBL
chr1_1035987_T_C_b38	SLC35E2	3.107	0.002	0.066362	10	0.02136	no	ARTTBL
chr1_1698048_T_C_b38	SLC35E2	-3.083	0.00216	-0.096701	7	0.031364	no	ARTTBL
chr1_1739996_G_T_b38	SLC35E2	-3.079	0.00219	-0.107973	5	0.035071	no	ARTTBL
chr1_1039282_G_T_b38	SLC35E2	3.072	0.00224	0.065646	10	0.021371	no	ARTTBL
chr1_1723766_C_T_b38	SLC35E2	-3.068	0.00227	-0.055279	29	0.018017	no	ARTTBL
chr1_1716710_G_T_b38	SLC35E2	-3.063	0.00231	-0.144363	3	0.047131	no	ARTTBL
chr1_1047133_T_C_b38	SLC35E2	3.06	0.00233	0.069175	6	0.022608	no	ARTTBL
chr1_1035844_A_G_b38	SLC35E2	3.055	0.00237	0.061779	12	0.020221	no	ARTTBL
chr1_1037956_A_G_b38	SLC35E2	3.055	0.00237	0.061779	12	0.020221	no	ARTTBL
chr1_1037997_G_A_b38	SLC35E2	3.055	0.00237	0.061779	12	0.020221	no	ARTTBL
chr1_1038800_G_T_b38	SLC35E2	3.055	0.00237	0.061779	12	0.020221	no	ARTTBL
chr1_1038819_C_T_b38	SLC35E2	3.055	0.00237	0.061779	12	0.020221	no	ARTTBL
chr1_1038845_A_G_b38	SLC35E2	3.055	0.00237	0.061779	12	0.020221	no	ARTTBL
chr1_1038916_A_G_b38	SLC35E2	3.055	0.00237	0.061779	12	0.020221	no	ARTTBL
chr1_1038975_G_A_b38	SLC35E2	3.055	0.00237	0.061779	12	0.020221	no	ARTTBL
chr1_1038976_T_C_b38	SLC35E2	3.055	0.00237	0.061779	12	0.020221	no	ARTTBL
chr1_1039114_G_T_b38	SLC35E2	3.055	0.00237	0.061779	12	0.020221	no	ARTTBL
chr1_1039190_T_G_b38	SLC35E2	3.055	0.00237	0.061779	12	0.020221	no	ARTTBL
chr1_1039753_T_A_b38	SLC35E2	3.055	0.00237	0.061779	12	0.020221	no	ARTTBL
chr1_1040322_A_G_b38	SLC35E2	3.055	0.00237	0.061779	12	0.020221	no	ARTTBL
chr1_1730405_G_C_b38	SLC35E2	3.053	0.00238	0.045121	88	0.014779	no	ARTTBL
chr1_1677707_C_T_b38	SLC35E2	-3.038	0.0025	-0.057002	17	0.018764	no	ARTTBL
chr1_1798925_C_CT_b38	SLC35E2	-3.024	0.00262	-0.044119	53	0.014589	no	ARTTBL
chr1_1052290_T_G_b38	SLC35E2	3.006	0.00277	0.066934	7	0.022264	no	ARTTBL
chr1_1969229_T_A_b38	SLC35E2	3.004	0.00279	0.047704	29	0.015879	no	ARTTBL
chr1_1224137_T_C_b38	SLC35E2	-3	0.00283	-0.081654	3	0.027216	no	ARTTBL
chr1_1944182_G_C_b38	SLC35E2	-2.969	0.00313	-0.04224	118	0.014227	no	ARTTBL
chr1_1738207_ACT_A_b38	SLC35E2	2.966	0.00316	0.044615	66	0.015044	no	ARTTBL
chr1_1748597_C_G_b38	SLC35E2	-2.951	0.00332	-0.043975	111	0.014904	no	ARTTBL
chr1_1018298_T_C_b38	SLC35E2	2.929	0.00355	0.05876	11	0.020063	no	ARTTBL
chr1_1960609_G_C_b38	SLC35E2	-2.916	0.0037	-0.03966	106	0.013601	no	ARTTBL
chr1_1747472_A_T_b38	SLC35E2	-2.9	0.00389	-0.043255	111	0.014917	no	ARTTBL
chr1_1749605_C_CGTCCATGCATATTTTTCTGTGTGATGTGTCTGTGTGTGTGTCTCAGTGGT_b38	SLC35E2	-2.88	0.00414	-0.035188	61	0.012218	no	ARTTBL
chr1_1901149_A_AAAGAAAGG_b38	SLC35E2	2.872	0.00425	0.039047	78	0.013596	no	ARTTBL
chr1_1029468_A_T_b38	SLC35E2	2.854	0.00449	0.057057	13	0.019993	no	ARTTBL
chr1_2662748_AGCAACCACACGCACAGG_A_b38	SLC35E2	-2.844	0.00464	-0.077741	13	0.027337	no	ARTTBL
chr1_1946058_T_C_b38	SLC35E2	-2.836	0.00475	-0.04071	118	0.014356	no	ARTTBL
chr1_1596144_GAGAC_G_b38	SLC35E2	-2.83	0.00484	-0.040889	55	0.014448	no	ARTTBL
chr1_1625951_G_A_b38	SLC35E2	-2.821	0.00497	-0.038671	76	0.013707	no	ARTTBL
chr1_1038288_A_G_b38	SLC35E2	2.818	0.00501	0.057001	13	0.020225	no	ARTTBL
chr1_1965001_G_A_b38	SLC35E2	2.817	0.00504	0.042633	38	0.015136	no	ARTTBL
chr1_1965250_G_GA_b38	SLC35E2	2.815	0.00506	0.042721	38	0.015174	no	ARTTBL
chr1_1981476_T_A_b38	SLC35E2	2.809	0.00516	0.053509	3	0.019049	no	ARTTBL
chr1_1946013_C_T_b38	SLC35E2	-2.805	0.00523	-0.040375	117	0.014396	no	ARTTBL
chr1_1814815_A_AAAAAAG_b38	SLC35E2	-2.803	0.00525	-0.059079	16	0.021076	no	ARTTBL
chr1_988598_A_AG_b38	SLC35E2	2.799	0.00531	0.051157	16	0.018274	no	ARTTBL
chr1_1047614_T_C_b38	SLC35E2	2.787	0.00552	0.056264	20	0.020187	no	ARTTBL
chr1_1947189_C_T_b38	SLC35E2	-2.765	0.00589	-0.039633	118	0.014333	no	ARTTBL
chr1_1744096_C_T_b38	SLC35E2	-2.757	0.00604	-0.052282	66	0.018964	no	ARTTBL
chr1_1944074_T_C_b38	SLC35E2	-2.746	0.00624	-0.03923	118	0.014285	no	ARTTBL
chr1_1944091_G_C_b38	SLC35E2	-2.746	0.00624	-0.03923	118	0.014285	no	ARTTBL
chr1_1946632_C_T_b38	SLC35E2	-2.743	0.0063	-0.039367	118	0.014351	no	ARTTBL
chr1_1944419_C_G_b38	SLC35E2	-2.741	0.00633	-0.039308	120	0.01434	no	ARTTBL
chr1_1944675_C_T_b38	SLC35E2	-2.737	0.00642	-0.039195	119	0.014322	no	ARTTBL
chr1_1050069_G_A_b38	SLC35E2	-2.726	0.00663	-0.039804	125	0.014603	no	ARTTBL
chr1_1495204_T_C_b38	SLC35E2	-2.708	0.00699	-0.054824	36	0.020243	no	ARTTBL
chr1_1693256_GT_G_b38	SLC35E2	-2.702	0.00712	-0.090886	8	0.033633	no	ARTTBL
chr1_2252606_GC_G_b38	SLC35E2	2.7	0.00716	0.034997	147	0.012961	no	ARTTBL
chr1_2253720_G_A_b38	SLC35E2	2.7	0.00716	0.034997	147	0.012961	no	ARTTBL
chr1_2255546_G_A_b38	SLC35E2	2.7	0.00716	0.034997	147	0.012961	no	ARTTBL
chr1_1945121_T_C_b38	SLC35E2	-2.695	0.00727	-0.038455	120	0.014268	no	ARTTBL
chr1_1011654_G_A_b38	SLC35E2	2.692	0.00734	0.068322	14	0.025382	no	ARTTBL
chr1_1937802_G_T_b38	SLC35E2	-2.689	0.0074	-0.039416	116	0.01466	no	ARTTBL
chr1_1969479_G_A_b38	SLC35E2	2.686	0.00747	0.042903	30	0.015973	no	ARTTBL
chr1_996133_A_C_b38	SLC35E2	-2.684	0.00752	-0.088966	3	0.033151	no	ARTTBL
chr1_2252962_T_G_b38	SLC35E2	2.681	0.00757	0.034786	147	0.012974	no	ARTTBL
chr1_2261200_G_C_b38	SLC35E2	2.681	0.00757	0.034786	147	0.012974	no	ARTTBL
chr1_2619655_CA_C_b38	SLC35E2	2.68	0.00759	0.040467	59	0.015097	no	ARTTBL
chr1_1340697_G_A_b38	SLC35E2	2.68	0.00759	0.043833	30	0.016354	no	ARTTBL
chr1_1749637_G_T_b38	SLC35E2	2.678	0.00764	0.036154	95	0.013499	no	ARTTBL
chr1_1938125_TCA_T_b38	SLC35E2	-2.677	0.00766	-0.038473	117	0.01437	no	ARTTBL
chr1_1728604_T_A_b38	SLC35E2	2.676	0.0077	0.043148	48	0.016126	no	ARTTBL
chr1_1056704_T_C_b38	SLC35E2	2.671	0.0078	0.04257	31	0.015937	no	ARTTBL
chr1_2251031_G_A_b38	SLC35E2	2.668	0.00788	0.034733	146	0.013021	no	ARTTBL
chr1_1944420_A_G_b38	SLC35E2	-2.666	0.00792	-0.037974	121	0.014244	no	ARTTBL
chr1_1029460_T_C_b38	SLC35E2	2.655	0.00817	0.053004	13	0.019963	no	ARTTBL
chr1_1594614_G_C_b38	SLC35E2	-2.655	0.00818	-0.038994	55	0.014687	no	ARTTBL
chr1_1987145_C_T_b38	SLC35E2	2.651	0.00827	0.038654	58	0.01458	no	ARTTBL
chr1_1981466_C_A_b38	SLC35E2	2.649	0.00832	0.04902	5	0.018504	no	ARTTBL
chr1_1968924_GCCCTCCTGGGGGCTCCGGTCCTGCCCAGCAGCCCCAGGTGAGACAGCGCCTGGCGGCCCCTCCCTAGCT_G_b38	SLC35E2	2.637	0.00861	0.03966	40	0.015038	no	ARTTBL
chr1_1969006_C_T_b38	SLC35E2	2.633	0.00871	0.039796	39	0.015112	no	ARTTBL
chr1_1708362_T_C_b38	SLC35E2	-2.633	0.00872	-0.037968	69	0.01442	no	ARTTBL
chr1_1702383_T_C_b38	SLC35E2	-2.628	0.00886	-0.041011	36	0.015608	no	ARTTBL
chr1_1717604_CGCTTTCAGCTAGAGTTTGCTCTCTCTGGTTTTCGGTCTGTGACACACGCAT_C_b38	SLC35E2	2.625	0.00893	0.035221	108	0.013419	no	ARTTBL
chr1_1714988_T_G_b38	SLC35E2	2.617	0.00913	0.058402	24	0.022316	no	ARTTBL
chr1_1589151_C_T_b38	SLC35E2	-2.615	0.00919	-0.037161	62	0.014211	no	ARTTBL
chr1_1690308_AT_A_b38	SLC35E2	-2.615	0.00919	-0.032819	132	0.012552	no	ARTTBL
chr1_992993_A_G_b38	SLC35E2	2.614	0.0092	0.034289	123	0.013116	no	ARTTBL
chr1_1763635_AG_A_b38	SLC35E2	-2.611	0.00929	-0.06855	9	0.026255	no	ARTTBL
chr1_1715011_G_A_b38	SLC35E2	2.609	0.00934	0.057938	24	0.022206	no	ARTTBL
chr1_1010481_ATTAT_A_b38	SLC35E2	2.605	0.00946	0.066787	14	0.025639	no	ARTTBL
chr1_1942887_C_G_b38	SLC35E2	-2.6	0.00958	-0.037353	117	0.014365	no	ARTTBL
chr1_2233496_G_T_b38	SLC35E2	2.592	0.00981	0.033252	147	0.012828	no	ARTTBL
chr1_1459658_G_A_b38	SLC35E2	-2.589	0.00989	-0.063548	39	0.024543	no	ARTTBL
chr1_1240684_G_GCCGCCCCCATTCACCCCGGCCGTGGTCCCTGCCCCAGCCCCCA_b38	SLC35E2	-4.055	9.77e-05	-0.186671	4	0.046037	yes	BRNAMY
chr1_2415084_G_C_b38	SLC35E2	3.736	0.000307	0.101391	7	0.027137	yes	BRNAMY
chr1_2415085_T_C_b38	SLC35E2	3.736	0.000307	0.101391	7	0.027137	yes	BRNAMY
chr1_749482_G_A_b38	SLC35E2	3.599	0.000492	0.179417	6	0.049847	yes	BRNAMY
chr1_1591703_T_C_b38	SLC35E2	3.449	0.000816	0.080752	26	0.023412	yes	BRNAMY
chr1_815963_T_A_b38	SLC35E2	-3.271	0.00146	-0.119217	3	0.036443	yes	BRNAMY
chr1_1591419_A_G_b38	SLC35E2	3.232	0.00165	0.097176	7	0.030069	yes	BRNAMY
chr1_1285574_G_A_b38	SLC35E2	-2.983	0.00356	-0.139049	5	0.046615	yes	BRNAMY
chr1_1585173_C_T_b38	SLC35E2	-2.976	0.00363	-0.10124	4	0.034014	yes	BRNAMY
chr1_1986752_A_G_b38	SLC35E2	2.958	0.00384	0.083214	19	0.028127	yes	BRNAMY
chr1_2617426_CA_C_b38	SLC35E2	-2.954	0.00389	-0.095126	4	0.032204	yes	BRNAMY
chr1_1987049_A_G_b38	SLC35E2	2.872	0.00495	0.080971	19	0.028192	yes	BRNAMY
chr1_1242865_C_T_b38	SLC35E2	-2.836	0.0055	-0.095938	4	0.033828	yes	BRNAMY
chr1_1284756_A_G_b38	SLC35E2	-2.833	0.00555	-0.130343	6	0.046006	yes	BRNAMY
chr1_1127258_C_A_b38	SLC35E2	2.802	0.00606	0.073946	23	0.026386	yes	BRNAMY
chr1_2287338_A_ATT_b38	SLC35E2	2.778	0.00649	0.075693	12	0.027244	yes	BRNAMY
chr1_1127861_G_T_b38	SLC35E2	2.778	0.00649	0.071856	28	0.025863	yes	BRNAMY
chr1_1363898_C_T_b38	SLC35E2	2.775	0.00656	0.08841	4	0.031862	yes	BRNAMY
chr1_1363986_C_T_b38	SLC35E2	2.775	0.00656	0.08841	4	0.031862	yes	BRNAMY
chr1_1365566_G_A_b38	SLC35E2	2.775	0.00656	0.08841	4	0.031862	yes	BRNAMY
chr1_1366529_TTAG_T_b38	SLC35E2	2.775	0.00656	0.08841	4	0.031862	yes	BRNAMY
chr1_1367292_A_AGT_b38	SLC35E2	2.775	0.00656	0.08841	4	0.031862	yes	BRNAMY
chr1_2423447_G_A_b38	SLC35E2	2.741	0.00721	0.067962	27	0.02479	yes	BRNAMY
chr1_1129916_T_C_b38	SLC35E2	2.734	0.00736	0.070849	17	0.02591	yes	BRNAMY
chr1_2416137_G_T_b38	SLC35E2	2.719	0.00769	0.086911	3	0.031969	yes	BRNAMY
chr1_2531975_G_A_b38	SLC35E2	2.718	0.0077	0.074907	23	0.027555	yes	BRNAMY
chr1_1130902_A_G_b38	SLC35E2	2.715	0.00777	0.076698	8	0.028249	yes	BRNAMY
chr1_1243102_A_G_b38	SLC35E2	-2.701	0.00809	-0.093281	4	0.034537	yes	BRNAMY
chr1_1251618_G_A_b38	SLC35E2	-2.701	0.00809	-0.093281	4	0.034537	yes	BRNAMY
chr1_1613160_C_CTT_b38	SLC35E2	-2.694	0.00825	-0.123852	4	0.045979	yes	BRNAMY
chr1_2532310_G_T_b38	SLC35E2	2.68	0.00856	0.07353	23	0.027432	yes	BRNAMY
chr1_1631710_T_C_b38	SLC35E2	2.669	0.00885	0.092697	5	0.034734	yes	BRNAMY
chr1_871922_A_AT_b38	SLC35E2	2.666	0.0089	0.082794	15	0.031051	yes	BRNAMY
chr1_1590785_G_A_b38	SLC35E2	-2.652	0.00926	-0.093449	3	0.035232	yes	BRNAMY
chr1_1246371_T_C_b38	SLC35E2	-2.64	0.00957	-0.088714	6	0.033597	yes	BRNAMY
chr1_1948594_G_GTTT_b38	SLC35E2	-3.712	0.000334	-0.162953	3	0.043895	no	BRNAMY
chr1_832873_A_C_b38	SLC35E2	3.601	0.00049	0.104669	17	0.02907	no	BRNAMY
chr1_840409_TA_T_b38	SLC35E2	3.144	0.00218	0.086733	14	0.027588	no	BRNAMY
chr1_874906_G_A_b38	SLC35E2	-3.142	0.00219	-0.118297	7	0.037652	no	BRNAMY
chr1_2496273_C_T_b38	SLC35E2	3.127	0.0023	0.081285	20	0.025994	no	BRNAMY
chr1_771398_G_A_b38	SLC35E2	3.069	0.00275	0.091155	16	0.029701	no	BRNAMY
chr1_847601_C_T_b38	SLC35E2	-3.05	0.00291	-0.111225	4	0.036463	no	BRNAMY
chr1_2409065_C_T_b38	SLC35E2	2.985	0.00354	0.086248	8	0.028889	no	BRNAMY
chr1_2499178_C_T_b38	SLC35E2	2.952	0.00391	0.075952	23	0.025727	no	BRNAMY
chr1_2500892_C_A_b38	SLC35E2	2.924	0.00425	0.07533	22	0.025762	no	BRNAMY
chr1_2404530_C_G_b38	SLC35E2	2.92	0.0043	0.082436	9	0.028231	no	BRNAMY
chr1_2405593_C_T_b38	SLC35E2	2.92	0.0043	0.082436	9	0.028231	no	BRNAMY
chr1_2493326_G_A_b38	SLC35E2	2.898	0.00459	0.072609	24	0.025055	no	BRNAMY
chr1_2501323_G_A_b38	SLC35E2	2.886	0.00476	0.078288	23	0.027129	no	BRNAMY
chr1_1717604_CGCTTTCAGCTAGAGTTTGCTCTCTCTGGTTTTCGGTCTGTGACACACGCAT_C_b38	SLC35E2	2.881	0.00482	0.078613	14	0.027285	no	BRNAMY
chr1_818161_G_A_b38	SLC35E2	-2.85	0.00528	-0.105431	3	0.036992	no	BRNAMY
chr1_1601796_A_C_b38	SLC35E2	2.848	0.00532	0.074624	16	0.026206	no	BRNAMY
chr1_1604202_G_A_b38	SLC35E2	2.846	0.00535	0.075288	15	0.026455	no	BRNAMY
chr1_1232800_G_C_b38	SLC35E2	-2.807	0.00598	-0.124791	5	0.044455	no	BRNAMY
chr1_851615_G_A_b38	SLC35E2	-2.788	0.00632	-0.100651	3	0.036101	no	BRNAMY
chr1_1107103_C_T_b38	SLC35E2	-2.76	0.00685	-0.100831	6	0.036537	no	BRNAMY
chr1_1664099_T_C_b38	SLC35E2	2.751	0.00702	0.086641	4	0.031494	no	BRNAMY
chr1_2502461_C_T_b38	SLC35E2	2.739	0.00727	0.072299	27	0.0264	no	BRNAMY
chr1_2377643_T_G_b38	SLC35E2	2.7	0.00812	0.067156	29	0.024876	no	BRNAMY
chr1_2325110_T_TTCCC_b38	SLC35E2	2.688	0.00839	0.14422	3	0.053657	no	BRNAMY
chr1_2384241_A_G_b38	SLC35E2	2.682	0.00853	0.065688	33	0.024493	no	BRNAMY
chr1_2508246_G_C_b38	SLC35E2	2.678	0.00861	0.071086	26	0.026541	no	BRNAMY
chr1_2395479_G_A_b38	SLC35E2	2.675	0.0087	0.079566	7	0.029749	no	BRNAMY
chr1_2395636_C_T_b38	SLC35E2	2.675	0.0087	0.079566	7	0.029749	no	BRNAMY
chr1_1110693_C_A_b38	SLC35E2	-2.661	0.00903	-0.09457	4	0.035534	no	BRNAMY
chr1_1113121_G_A_b38	SLC35E2	-2.661	0.00903	-0.09457	4	0.035534	no	BRNAMY
chr1_1113191_A_G_b38	SLC35E2	-2.661	0.00903	-0.09457	4	0.035534	no	BRNAMY
chr1_1407232_G_C_b38	SLC35E2	-2.658	0.00912	-0.077328	5	0.029095	no	BRNAMY
chr1_828389_A_AT_b38	SLC35E2	2.644	0.00948	0.078338	16	0.029631	no	BRNAMY
chr1_1120968_G_A_b38	SLC35E2	-2.643	0.00949	-0.094728	4	0.035837	no	BRNAMY
chr1_1240684_G_GCCGCCCCCATTCACCCCGGCCGTGGTCCCTGCCCCAGCCCCCA_b38	SLC35E2	-3.686	0.000342	-0.181657	3	0.049279	yes	BRNACC
chr1_2384241_A_G_b38	SLC35E2	3.487	0.000681	0.080501	37	0.023086	yes	BRNACC
chr1_2383824_C_G_b38	SLC35E2	3.484	0.000689	0.08052	24	0.023111	yes	BRNACC
chr1_2384278_A_G_b38	SLC35E2	3.441	0.000797	0.075112	40	0.021829	yes	BRNACC
chr1_2384876_A_G_b38	SLC35E2	3.381	0.000974	0.078291	37	0.023158	yes	BRNACC
chr1_2371032_C_T_b38	SLC35E2	3.363	0.00103	0.075219	41	0.022368	yes	BRNACC
chr1_1524664_A_G_b38	SLC35E2	3.258	0.00146	0.116602	9	0.035787	yes	BRNACC
chr1_2383024_G_T_b38	SLC35E2	3.156	0.00202	0.076788	22	0.024331	yes	BRNACC
chr1_2383716_CA_C_b38	SLC35E2	3.156	0.00202	0.076788	22	0.024331	yes	BRNACC
chr1_2376477_A_C_b38	SLC35E2	3.154	0.00203	0.074045	37	0.023475	yes	BRNACC
chr1_2342840_A_ATATTT_b38	SLC35E2	-3.125	0.00223	-0.136443	5	0.043663	yes	BRNACC
chr1_2572136_C_CTT_b38	SLC35E2	-3.018	0.0031	-0.08869	14	0.029382	yes	BRNACC
chr1_2383975_C_T_b38	SLC35E2	2.975	0.00354	0.080709	12	0.027131	yes	BRNACC
chr1_2371226_C_CACAACCACA_b38	SLC35E2	2.954	0.00377	0.070917	34	0.024006	yes	BRNACC
chr1_2385630_A_C_b38	SLC35E2	2.916	0.00423	0.072111	20	0.024731	yes	BRNACC
chr1_2371077_T_C_b38	SLC35E2	2.867	0.00489	0.069553	34	0.024262	yes	BRNACC
chr1_2371472_G_A_b38	SLC35E2	2.841	0.00527	0.08198	8	0.028852	yes	BRNACC
chr1_2375533_G_A_b38	SLC35E2	2.835	0.00537	0.070069	21	0.024717	yes	BRNACC
chr1_1265603_T_TTG_b38	SLC35E2	-2.831	0.00543	-0.088992	5	0.031433	yes	BRNACC
chr1_2392128_T_C_b38	SLC35E2	2.811	0.00576	0.067143	34	0.023883	yes	BRNACC
chr1_1518285_T_C_b38	SLC35E2	2.81	0.00577	0.100357	12	0.035709	yes	BRNACC
chr1_2387989_A_G_b38	SLC35E2	2.784	0.00623	0.066706	34	0.023958	yes	BRNACC
chr1_2370674_CTT_C_b38	SLC35E2	2.745	0.00698	0.070984	26	0.025862	yes	BRNACC
chr1_749482_G_A_b38	SLC35E2	2.737	0.00714	0.152004	6	0.055546	yes	BRNACC
chr1_1663180_T_C_b38	SLC35E2	2.727	0.00735	0.092827	4	0.034042	yes	BRNACC
chr1_1663182_C_A_b38	SLC35E2	2.727	0.00735	0.092827	4	0.034042	yes	BRNACC
chr1_2375256_C_T_b38	SLC35E2	2.69	0.00815	0.063203	24	0.023492	yes	BRNACC
chr1_2005948_A_C_b38	SLC35E2	-2.674	0.00853	-0.090899	5	0.033993	yes	BRNACC
chr1_2374713_C_T_b38	SLC35E2	2.64	0.00938	0.062068	24	0.02351	yes	BRNACC
chr1_814758_G_A_b38	SLC35E2	-2.636	0.00948	-0.101186	3	0.038383	yes	BRNACC
chr1_2500892_C_A_b38	SLC35E2	3.443	0.00079	0.084097	31	0.024424	no	BRNACC
chr1_2377643_T_G_b38	SLC35E2	3.39	0.000945	0.079047	30	0.02332	no	BRNACC
chr1_1650000_G_A_b38	SLC35E2	3.125	0.00223	0.085738	14	0.027437	no	BRNACC
chr1_1570655_G_A_b38	SLC35E2	3.115	0.0023	0.104629	3	0.033588	no	BRNACC
chr1_1839692_C_CA_b38	SLC35E2	3.046	0.00285	0.10806	3	0.03548	no	BRNACC
chr1_2372759_GACC_G_b38	SLC35E2	2.985	0.00343	0.073497	21	0.024621	no	BRNACC
chr1_2372762_C_CTG_b38	SLC35E2	2.985	0.00343	0.073497	21	0.024621	no	BRNACC
chr1_2533890_G_A_b38	SLC35E2	2.966	0.00364	0.076247	34	0.025709	no	BRNACC
chr1_2532310_G_T_b38	SLC35E2	2.956	0.00375	0.075391	35	0.025506	no	BRNACC
chr1_2389131_A_AAAG_b38	SLC35E2	2.946	0.00386	0.065893	30	0.022366	no	BRNACC
chr1_2533656_C_T_b38	SLC35E2	2.937	0.00396	0.074751	35	0.025449	no	BRNACC
chr1_2531975_G_A_b38	SLC35E2	2.879	0.00472	0.074269	35	0.025797	no	BRNACC
chr1_2289783_A_C_b38	SLC35E2	2.852	0.0051	0.09194	5	0.032231	no	BRNACC
chr1_1765746_G_T_b38	SLC35E2	2.714	0.00761	0.096713	4	0.035632	no	BRNACC
chr1_1664099_T_C_b38	SLC35E2	2.701	0.00789	0.085203	6	0.031539	no	BRNACC
chr1_2379954_A_G_b38	SLC35E2	-2.681	0.00837	-0.070608	17	0.026338	no	BRNACC
chr1_2031736_A_G_b38	SLC35E2	2.676	0.00848	0.063311	33	0.023656	no	BRNACC
chr1_1705867_T_C_b38	SLC35E2	-2.663	0.00879	-0.055305	38	0.020765	no	BRNACC
chr1_2028539_C_T_b38	SLC35E2	2.646	0.00923	0.063064	33	0.023835	no	BRNACC
chr1_1729539_C_A_b38	SLC35E2	2.644	0.00929	0.074729	12	0.028267	no	BRNACC
chr1_2391602_T_C_b38	SLC35E2	-2.621	0.00988	-0.067629	17	0.025799	no	BRNACC
chr1_1591703_T_C_b38	SLC35E2	3.342	0.00105	0.069019	34	0.020654	yes	BRNCDT
chr1_1677720_T_G_b38	SLC35E2	3.33	0.00109	0.065503	46	0.019668	yes	BRNCDT
chr1_1677726_A_T_b38	SLC35E2	3.33	0.00109	0.065503	46	0.019668	yes	BRNCDT
chr1_1670423_AT_A_b38	SLC35E2	3.293	0.00123	0.079	21	0.023987	yes	BRNCDT
chr1_1674720_TGC_T_b38	SLC35E2	3.21	0.00162	0.062945	45	0.019607	yes	BRNCDT
chr1_1674868_G_A_b38	SLC35E2	3.21	0.00162	0.062945	45	0.019607	yes	BRNCDT
chr1_1650452_G_A_b38	SLC35E2	-3.143	0.00201	-0.133594	4	0.042501	yes	BRNCDT
chr1_1265603_T_TTG_b38	SLC35E2	-3.096	0.00233	-0.085961	5	0.027761	yes	BRNCDT
chr1_1676790_C_T_b38	SLC35E2	3.094	0.00235	0.060709	45	0.019623	yes	BRNCDT
chr1_988598_A_AG_b38	SLC35E2	3.042	0.00276	0.086054	7	0.028287	yes	BRNCDT
chr1_1650000_G_A_b38	SLC35E2	2.886	0.00447	0.068821	21	0.023846	yes	BRNCDT
chr1_832873_A_C_b38	SLC35E2	2.877	0.00459	0.073545	21	0.025566	yes	BRNCDT
chr1_1648736_G_A_b38	SLC35E2	2.842	0.00509	0.063023	35	0.022175	yes	BRNCDT
chr1_1232800_G_C_b38	SLC35E2	-2.8	0.00578	-0.11811	5	0.042187	yes	BRNCDT
chr1_2383824_C_G_b38	SLC35E2	2.78	0.00612	0.058813	28	0.021155	yes	BRNCDT
chr1_1725582_T_C_b38	SLC35E2	2.704	0.00763	0.049606	49	0.018345	yes	BRNCDT
chr1_1641275_A_G_b38	SLC35E2	-2.657	0.00872	-0.059273	22	0.022309	yes	BRNCDT
chr1_969377_A_ATG_b38	SLC35E2	2.636	0.00925	0.080863	4	0.030673	yes	BRNCDT
chr1_2677450_C_A_b38	SLC35E2	2.624	0.00956	0.075972	7	0.02895	yes	BRNCDT
chr1_2124349_ACGGCGGTGGTTAGGGTCACGGCGGCGGTTAGGGTCACGGCGGTGGTTAGGGTCACGGTGGTGGTTAGG_A_b38	SLC35E2	-3.727	0.000272	-0.160621	3	0.043099	no	BRNCDT
chr1_1671097_G_C_b38	SLC35E2	3.494	0.000622	0.072723	26	0.020813	no	BRNCDT
chr1_1673818_A_C_b38	SLC35E2	3.478	0.000658	0.067993	47	0.019549	no	BRNCDT
chr1_1673060_G_A_b38	SLC35E2	3.347	0.00103	0.065236	47	0.019489	no	BRNCDT
chr1_1673968_GA_G_b38	SLC35E2	3.345	0.00103	0.077661	16	0.023216	no	BRNCDT
chr1_1671148_C_T_b38	SLC35E2	3.315	0.00114	0.068222	27	0.020579	no	BRNCDT
chr1_1698048_T_C_b38	SLC35E2	-3.286	0.00126	-0.165956	4	0.050498	no	BRNCDT
chr1_1671995_G_T_b38	SLC35E2	3.257	0.00139	0.0636	47	0.019525	no	BRNCDT
chr1_1650664_CTTTTT_C_b38	SLC35E2	-3.235	0.00149	-0.086065	7	0.026604	no	BRNCDT
chr1_1671797_G_A_b38	SLC35E2	3.207	0.00164	0.062797	46	0.019583	no	BRNCDT
chr1_2377643_T_G_b38	SLC35E2	3.174	0.00182	0.066411	40	0.020926	no	BRNCDT
chr1_1649976_G_A_b38	SLC35E2	3.118	0.00218	0.070155	29	0.022501	no	BRNCDT
chr1_2389131_A_AAAG_b38	SLC35E2	3.025	0.00292	0.063104	37	0.020859	no	BRNCDT
chr1_1631710_T_C_b38	SLC35E2	2.968	0.00348	0.092931	4	0.031313	no	BRNCDT
chr1_1664865_A_G_b38	SLC35E2	-2.945	0.00373	-0.064867	20	0.022023	no	BRNCDT
chr1_1668108_C_T_b38	SLC35E2	2.777	0.00618	0.060637	22	0.021838	no	BRNCDT
chr1_1606094_G_GAGGGGTC_b38	SLC35E2	2.716	0.00737	0.074298	10	0.027354	no	BRNCDT
chr1_1660683_C_T_b38	SLC35E2	-2.679	0.0082	-0.065465	11	0.02444	no	BRNCDT
chr1_1743565_ATAT_A_b38	SLC35E2	-2.667	0.00849	-0.05299	38	0.019872	no	BRNCDT
chr1_1759611_C_T_b38	SLC35E2	-3.928	0.000136	-0.094865	39	0.024151	yes	BRNCHB
chr1_1759354_G_A_b38	SLC35E2	-3.897	0.000153	-0.095361	38	0.024471	yes	BRNCHB
chr1_1752908_C_CCCT_b38	SLC35E2	-3.865	0.000173	-0.099411	30	0.025723	yes	BRNCHB
chr1_1743851_C_T_b38	SLC35E2	-3.786	0.00023	-0.10775	13	0.028462	yes	BRNCHB
chr1_1744052_GAGA_G_b38	SLC35E2	-3.703	0.00031	-0.110293	10	0.029785	yes	BRNCHB
chr1_1743840_T_C_b38	SLC35E2	-3.663	0.000357	-0.105565	14	0.028816	yes	BRNCHB
chr1_1731375_T_C_b38	SLC35E2	-3.581	0.000478	-0.148263	6	0.041403	yes	BRNCHB
chr1_1744499_C_T_b38	SLC35E2	-3.484	0.000667	-0.082361	34	0.023637	yes	BRNCHB
chr1_1743886_C_T_b38	SLC35E2	-3.466	0.000709	-0.098934	14	0.02854	yes	BRNCHB
chr1_1752461_G_A_b38	SLC35E2	-3.46	0.000726	-0.084045	37	0.024292	yes	BRNCHB
chr1_1752730_C_G_b38	SLC35E2	-3.46	0.000726	-0.084045	37	0.024292	yes	BRNCHB
chr1_1753319_G_A_b38	SLC35E2	-3.46	0.000726	-0.084045	37	0.024292	yes	BRNCHB
chr1_1753361_G_A_b38	SLC35E2	-3.46	0.000726	-0.084045	37	0.024292	yes	BRNCHB
chr1_1753033_C_T_b38	SLC35E2	-3.4	0.000888	-0.084184	39	0.024759	yes	BRNCHB
chr1_1969249_A_AGCCCT_b38	SLC35E2	3.382	0.000943	0.106734	9	0.031557	yes	BRNCHB
chr1_1744028_A_AC_b38	SLC35E2	-3.381	0.000947	-0.107233	8	0.031717	yes	BRNCHB
chr1_1688647_G_A_b38	SLC35E2	-3.377	0.000961	-0.10141	14	0.030033	yes	BRNCHB
chr1_1969238_C_T_b38	SLC35E2	3.303	0.00123	0.103969	9	0.031478	yes	BRNCHB
chr1_2420440_C_T_b38	SLC35E2	3.221	0.0016	0.09905	8	0.030748	yes	BRNCHB
chr1_1980953_G_A_b38	SLC35E2	3.193	0.00175	0.092482	15	0.028963	yes	BRNCHB
chr1_1750440_G_A_b38	SLC35E2	-3.181	0.00182	-0.084729	29	0.026634	yes	BRNCHB
chr1_1692151_T_C_b38	SLC35E2	-3.175	0.00186	-0.091898	14	0.028944	yes	BRNCHB
chr1_1734132_T_G_b38	SLC35E2	-3.163	0.00193	-0.134657	6	0.04257	yes	BRNCHB
chr1_1479719_T_C_b38	SLC35E2	-3.142	0.00207	-0.095891	23	0.03052	yes	BRNCHB
chr1_1948121_T_G_b38	SLC35E2	3.134	0.00212	0.089473	12	0.028546	yes	BRNCHB
chr1_2420707_C_T_b38	SLC35E2	3.114	0.00226	0.097619	7	0.031348	yes	BRNCHB
chr1_1731456_A_G_b38	SLC35E2	-3.114	0.00226	-0.129262	5	0.041512	yes	BRNCHB
chr1_2419962_TC_T_b38	SLC35E2	3.111	0.00228	0.100963	5	0.03245	yes	BRNCHB
chr1_1755713_G_A_b38	SLC35E2	-3.109	0.0023	-0.075008	36	0.024129	yes	BRNCHB
chr1_1744854_C_A_b38	SLC35E2	-3.104	0.00233	-0.076135	26	0.024525	yes	BRNCHB
chr1_1986752_A_G_b38	SLC35E2	3.098	0.00237	0.080307	29	0.02592	yes	BRNCHB
chr1_1978055_C_T_b38	SLC35E2	3.084	0.00248	0.090382	15	0.029311	yes	BRNCHB
chr1_1750280_A_G_b38	SLC35E2	-3.083	0.00249	-0.074197	40	0.024065	yes	BRNCHB
chr1_1983989_A_AT_b38	SLC35E2	3.076	0.00254	0.097163	9	0.031586	yes	BRNCHB
chr1_1972273_C_A_b38	SLC35E2	3.075	0.00255	0.089509	15	0.029107	yes	BRNCHB
chr1_1976473_C_T_b38	SLC35E2	3.075	0.00255	0.089509	15	0.029107	yes	BRNCHB
chr1_1976573_T_C_b38	SLC35E2	3.075	0.00255	0.089509	15	0.029107	yes	BRNCHB
chr1_1976600_C_T_b38	SLC35E2	3.075	0.00255	0.089509	15	0.029107	yes	BRNCHB
chr1_1976646_A_G_b38	SLC35E2	3.075	0.00255	0.089509	15	0.029107	yes	BRNCHB
chr1_1976661_G_T_b38	SLC35E2	3.075	0.00255	0.089509	15	0.029107	yes	BRNCHB
chr1_1976946_C_T_b38	SLC35E2	3.075	0.00255	0.089509	15	0.029107	yes	BRNCHB
chr1_1977264_C_G_b38	SLC35E2	3.075	0.00255	0.089509	15	0.029107	yes	BRNCHB
chr1_1977765_A_G_b38	SLC35E2	3.075	0.00255	0.089509	15	0.029107	yes	BRNCHB
chr1_1977879_G_A_b38	SLC35E2	3.075	0.00255	0.089509	15	0.029107	yes	BRNCHB
chr1_1978006_A_G_b38	SLC35E2	3.075	0.00255	0.089509	15	0.029107	yes	BRNCHB
chr1_1978114_T_A_b38	SLC35E2	3.075	0.00255	0.089509	15	0.029107	yes	BRNCHB
chr1_1978262_C_T_b38	SLC35E2	3.075	0.00255	0.089509	15	0.029107	yes	BRNCHB
chr1_1978294_G_T_b38	SLC35E2	3.075	0.00255	0.089509	15	0.029107	yes	BRNCHB
chr1_1978404_C_T_b38	SLC35E2	3.075	0.00255	0.089509	15	0.029107	yes	BRNCHB
chr1_1978415_G_A_b38	SLC35E2	3.075	0.00255	0.089509	15	0.029107	yes	BRNCHB
chr1_1978562_C_G_b38	SLC35E2	3.075	0.00255	0.089509	15	0.029107	yes	BRNCHB
chr1_1978573_T_C_b38	SLC35E2	3.075	0.00255	0.089509	15	0.029107	yes	BRNCHB
chr1_1978647_G_T_b38	SLC35E2	3.075	0.00255	0.089509	15	0.029107	yes	BRNCHB
chr1_1978797_T_C_b38	SLC35E2	3.075	0.00255	0.089509	15	0.029107	yes	BRNCHB
chr1_1981319_G_C_b38	SLC35E2	3.075	0.00255	0.089509	15	0.029107	yes	BRNCHB
chr1_1982826_T_C_b38	SLC35E2	3.075	0.00255	0.089509	15	0.029107	yes	BRNCHB
chr1_1983166_A_T_b38	SLC35E2	3.075	0.00255	0.089509	15	0.029107	yes	BRNCHB
chr1_1983956_TGG_T_b38	SLC35E2	3.075	0.00255	0.089509	15	0.029107	yes	BRNCHB
chr1_1984586_G_A_b38	SLC35E2	3.075	0.00255	0.089509	15	0.029107	yes	BRNCHB
chr1_1984595_C_T_b38	SLC35E2	3.075	0.00255	0.089509	15	0.029107	yes	BRNCHB
chr1_1984859_C_T_b38	SLC35E2	3.075	0.00255	0.089509	15	0.029107	yes	BRNCHB
chr1_1985148_G_T_b38	SLC35E2	3.075	0.00255	0.089509	15	0.029107	yes	BRNCHB
chr1_1986010_T_G_b38	SLC35E2	3.075	0.00255	0.089509	15	0.029107	yes	BRNCHB
chr1_1986033_G_A_b38	SLC35E2	3.075	0.00255	0.089509	15	0.029107	yes	BRNCHB
chr1_1986176_A_T_b38	SLC35E2	3.075	0.00255	0.089509	15	0.029107	yes	BRNCHB
chr1_1986211_T_C_b38	SLC35E2	3.075	0.00255	0.089509	15	0.029107	yes	BRNCHB
chr1_1986390_T_G_b38	SLC35E2	3.075	0.00255	0.089509	15	0.029107	yes	BRNCHB
chr1_1986469_A_C_b38	SLC35E2	3.075	0.00255	0.089509	15	0.029107	yes	BRNCHB
chr1_1987096_A_T_b38	SLC35E2	3.075	0.00255	0.089509	15	0.029107	yes	BRNCHB
chr1_1987156_G_A_b38	SLC35E2	3.075	0.00255	0.089509	15	0.029107	yes	BRNCHB
chr1_1969229_T_A_b38	SLC35E2	3.049	0.00277	0.096567	9	0.031669	yes	BRNCHB
chr1_1750428_G_C_b38	SLC35E2	-3.049	0.00277	-0.080258	30	0.026326	yes	BRNCHB
chr1_1732580_T_C_b38	SLC35E2	-3.041	0.00284	-0.12762	5	0.041966	yes	BRNCHB
chr1_1692124_T_G_b38	SLC35E2	-3.035	0.00289	-0.088485	13	0.029152	yes	BRNCHB
chr1_1969235_A_G_b38	SLC35E2	3.021	0.00302	0.097323	9	0.032212	yes	BRNCHB
chr1_1987049_A_G_b38	SLC35E2	3.011	0.00311	0.078018	29	0.02591	yes	BRNCHB
chr1_1686321_CTTT_C_b38	SLC35E2	-3.003	0.00319	-0.087101	15	0.029005	yes	BRNCHB
chr1_1730989_A_G_b38	SLC35E2	-2.981	0.00341	-0.124156	5	0.04165	yes	BRNCHB
chr1_1732166_A_G_b38	SLC35E2	-2.981	0.00341	-0.124156	5	0.04165	yes	BRNCHB
chr1_1734301_T_C_b38	SLC35E2	-2.981	0.00341	-0.124156	5	0.04165	yes	BRNCHB
chr1_1735814_T_C_b38	SLC35E2	-2.981	0.00341	-0.124156	5	0.04165	yes	BRNCHB
chr1_1735932_A_G_b38	SLC35E2	-2.981	0.00341	-0.124156	5	0.04165	yes	BRNCHB
chr1_1740427_A_T_b38	SLC35E2	-2.981	0.00341	-0.124156	5	0.04165	yes	BRNCHB
chr1_1742080_T_C_b38	SLC35E2	-2.981	0.00341	-0.124156	5	0.04165	yes	BRNCHB
chr1_1976990_T_C_b38	SLC35E2	2.98	0.00342	0.08709	15	0.029222	yes	BRNCHB
chr1_1968893_A_G_b38	SLC35E2	2.955	0.00369	0.092967	9	0.03146	yes	BRNCHB
chr1_2417420_T_TTCCCAGCC_b38	SLC35E2	2.913	0.0042	0.09171	7	0.031484	yes	BRNCHB
chr1_1987547_C_CT_b38	SLC35E2	2.898	0.00439	0.080761	28	0.027868	yes	BRNCHB
chr1_1978429_G_A_b38	SLC35E2	2.863	0.00487	0.088007	10	0.030742	yes	BRNCHB
chr1_1983507_C_T_b38	SLC35E2	2.863	0.00487	0.088007	10	0.030742	yes	BRNCHB
chr1_2416027_C_T_b38	SLC35E2	2.862	0.00489	0.088303	8	0.030853	yes	BRNCHB
chr1_1984601_T_C_b38	SLC35E2	2.849	0.00508	0.083274	15	0.029229	yes	BRNCHB
chr1_1758687_A_AAC_b38	SLC35E2	-2.846	0.00512	-0.120471	5	0.042326	yes	BRNCHB
chr1_1729196_T_G_b38	SLC35E2	-2.834	0.00531	-0.127171	3	0.044871	yes	BRNCHB
chr1_1945842_A_AAAAGAAC_b38	SLC35E2	-2.808	0.00574	-0.071738	31	0.025552	yes	BRNCHB
chr1_1687159_G_T_b38	SLC35E2	-2.806	0.00577	-0.071717	32	0.025562	yes	BRNCHB
chr1_1971434_C_T_b38	SLC35E2	2.785	0.00613	0.085974	10	0.030871	yes	BRNCHB
chr1_2416137_G_T_b38	SLC35E2	2.729	0.0072	0.086676	7	0.03176	yes	BRNCHB
chr1_1716796_A_C_b38	SLC35E2	-2.701	0.00781	-0.12472	3	0.046176	yes	BRNCHB
chr1_1743586_T_TAC_b38	SLC35E2	-2.697	0.00789	-0.071618	26	0.026553	yes	BRNCHB
chr1_1687153_A_G_b38	SLC35E2	-2.671	0.0085	-0.067784	35	0.025376	yes	BRNCHB
chr1_1750508_A_C_b38	SLC35E2	-2.669	0.00854	-0.059139	41	0.022155	yes	BRNCHB
chr1_826352_C_T_b38	SLC35E2	2.668	0.00858	0.097212	11	0.03644	yes	BRNCHB
chr1_2416398_G_GCGACA_b38	SLC35E2	2.665	0.00864	0.081584	9	0.030612	yes	BRNCHB
chr1_1981144_T_G_b38	SLC35E2	2.658	0.00883	0.083678	10	0.031486	yes	BRNCHB
chr1_1686017_A_AT_b38	SLC35E2	-2.65	0.00901	-0.066996	34	0.025278	yes	BRNCHB
chr1_1687061_C_T_b38	SLC35E2	-2.65	0.00901	-0.066996	34	0.025278	yes	BRNCHB
chr1_1748780_G_A_b38	SLC35E2	-2.647	0.00909	-0.065087	40	0.024589	yes	BRNCHB
chr1_1748597_C_G_b38	SLC35E2	-2.621	0.00978	-0.065841	37	0.025122	yes	BRNCHB
chr1_861387_G_A_b38	SLC35E2	2.619	0.00983	0.095595	16	0.036498	yes	BRNCHB
chr1_1691417_T_C_b38	SLC35E2	2.617	0.00989	0.067289	34	0.025714	yes	BRNCHB
chr1_1981062_A_G_b38	SLC35E2	2.614	0.00997	0.07499	17	0.028688	yes	BRNCHB
chr1_1981291_A_G_b38	SLC35E2	2.614	0.00997	0.07499	17	0.028688	yes	BRNCHB
chr1_1981295_T_C_b38	SLC35E2	2.614	0.00997	0.07499	17	0.028688	yes	BRNCHB
chr1_1688328_C_T_b38	SLC35E2	-3.794	0.000223	-0.108407	12	0.02857	no	BRNCHB
chr1_1743565_ATAT_A_b38	SLC35E2	-3.731	0.000281	-0.089879	32	0.024091	no	BRNCHB
chr1_1240684_G_GCCGCCCCCATTCACCCCGGCCGTGGTCCCTGCCCCAGCCCCCA_b38	SLC35E2	-3.717	0.000296	-0.178967	5	0.048153	no	BRNCHB
chr1_1751981_A_T_b38	SLC35E2	-3.693	0.000321	-0.106544	15	0.028849	no	BRNCHB
chr1_1754482_TCCCTGGGACCGAAGTCGCCCCA_T_b38	SLC35E2	-3.507	0.000617	-0.086674	37	0.024712	no	BRNCHB
chr1_1050080_T_C_b38	SLC35E2	-3.504	0.000624	-0.184602	4	0.052686	no	BRNCHB
chr1_1756043_G_T_b38	SLC35E2	-3.487	0.000662	-0.085517	38	0.024527	no	BRNCHB
chr1_818094_C_G_b38	SLC35E2	3.472	0.000695	0.128473	8	0.036999	no	BRNCHB
chr1_1688442_T_C_b38	SLC35E2	-3.344	0.00107	-0.09877	15	0.029539	no	BRNCHB
chr1_1688786_G_A_b38	SLC35E2	-3.338	0.00109	-0.11062	7	0.033138	no	BRNCHB
chr1_789568_TATGGA_T_b38	SLC35E2	3.305	0.00122	0.122808	7	0.037162	no	BRNCHB
chr1_1688570_A_T_b38	SLC35E2	-3.289	0.00128	-0.107255	9	0.032609	no	BRNCHB
chr1_2312125_G_A_b38	SLC35E2	-3.192	0.00176	-0.079313	40	0.024849	no	BRNCHB
chr1_1747695_A_G_b38	SLC35E2	-3.192	0.00176	-0.071115	39	0.02228	no	BRNCHB
chr1_1744652_C_T_b38	SLC35E2	-3.171	0.00188	-0.076889	37	0.024249	no	BRNCHB
chr1_1742672_C_T_b38	SLC35E2	-3.14	0.00208	-0.07829	31	0.024932	no	BRNCHB
chr1_1743238_G_C_b38	SLC35E2	-3.14	0.00208	-0.07829	31	0.024932	no	BRNCHB
chr1_1688586_C_T_b38	SLC35E2	-3.13	0.00214	-0.098822	11	0.031568	no	BRNCHB
chr1_749482_G_A_b38	SLC35E2	3.058	0.00269	0.168098	7	0.054967	no	BRNCHB
chr1_1936906_C_CA_b38	SLC35E2	-3.045	0.0028	-0.105768	13	0.034737	no	BRNCHB
chr1_1688531_T_C_b38	SLC35E2	-3.027	0.00296	-0.096369	11	0.031836	no	BRNCHB
chr1_1985090_C_T_b38	SLC35E2	3.007	0.00316	0.085894	23	0.028569	no	BRNCHB
chr1_1985451_C_T_b38	SLC35E2	3.007	0.00316	0.085894	23	0.028569	no	BRNCHB
chr1_1688619_AAAC_A_b38	SLC35E2	-3.004	0.00318	-0.093539	11	0.031139	no	BRNCHB
chr1_1866635_T_TA_b38	SLC35E2	2.971	0.00352	0.084126	26	0.02832	no	BRNCHB
chr1_794299_C_G_b38	SLC35E2	2.948	0.00377	0.107552	6	0.036481	no	BRNCHB
chr1_849670_G_A_b38	SLC35E2	2.945	0.00381	0.11195	8	0.038016	no	BRNCHB
chr1_850609_T_C_b38	SLC35E2	2.945	0.00381	0.11195	8	0.038016	no	BRNCHB
chr1_855378_GTA_G_b38	SLC35E2	2.945	0.00381	0.11195	8	0.038016	no	BRNCHB
chr1_1985619_A_G_b38	SLC35E2	2.939	0.00388	0.083638	21	0.028459	no	BRNCHB
chr1_1864334_AAAG_A_b38	SLC35E2	-2.927	0.00402	-0.09191	10	0.031398	no	BRNCHB
chr1_1983048_A_G_b38	SLC35E2	2.916	0.00416	0.083688	24	0.028698	no	BRNCHB
chr1_1688457_G_A_b38	SLC35E2	-2.913	0.0042	-0.08814	16	0.030258	no	BRNCHB
chr1_1968924_GCCCTCCTGGGGGCTCCGGTCCTGCCCAGCAGCCCCAGGTGAGACAGCGCCTGGCGGCCCCTCCCTAGCT_G_b38	SLC35E2	2.901	0.00435	0.091163	11	0.031425	no	BRNCHB
chr1_1969006_C_T_b38	SLC35E2	2.901	0.00435	0.091163	11	0.031425	no	BRNCHB
chr1_853333_T_C_b38	SLC35E2	2.891	0.00448	0.106006	9	0.036666	no	BRNCHB
chr1_847601_C_T_b38	SLC35E2	-2.875	0.0047	-0.105607	5	0.036729	no	BRNCHB
chr1_1797530_C_A_b38	SLC35E2	-2.862	0.00489	-0.074535	35	0.026042	no	BRNCHB
chr1_1987145_C_T_b38	SLC35E2	2.851	0.00504	0.082006	16	0.02876	no	BRNCHB
chr1_1769969_CAAAACAAAAACA_C_b38	SLC35E2	-2.833	0.00533	-0.075199	35	0.026548	no	BRNCHB
chr1_819123_G_A_b38	SLC35E2	2.83	0.00538	0.104125	5	0.036797	no	BRNCHB
chr1_819584_C_T_b38	SLC35E2	2.83	0.00538	0.104125	5	0.036797	no	BRNCHB
chr1_1710588_C_T_b38	SLC35E2	-2.825	0.00546	-0.12865	3	0.045548	no	BRNCHB
chr1_1836126_C_A_b38	SLC35E2	-2.824	0.00547	-0.071254	38	0.025235	no	BRNCHB
chr1_1751888_C_T_b38	SLC35E2	-2.819	0.00555	-0.110216	7	0.0391	no	BRNCHB
chr1_1831318_C_T_b38	SLC35E2	-2.809	0.00572	-0.073842	35	0.026291	no	BRNCHB
chr1_1764887_C_A_b38	SLC35E2	-2.801	0.00586	-0.073316	35	0.026179	no	BRNCHB
chr1_791544_TGAATG_T_b38	SLC35E2	2.782	0.00618	0.090596	6	0.032566	no	BRNCHB
chr1_871922_A_AT_b38	SLC35E2	2.781	0.0062	0.08601	26	0.030931	no	BRNCHB
chr1_817341_A_G_b38	SLC35E2	2.779	0.00624	0.106502	4	0.038325	no	BRNCHB
chr1_1955080_C_CGGCTCACACCGGAAGTGAGGCTCACACCGGAAGTGA_b38	SLC35E2	-2.774	0.00633	-0.074028	33	0.026689	no	BRNCHB
chr1_1950071_C_T_b38	SLC35E2	-2.773	0.00634	-0.074101	34	0.02672	no	BRNCHB
chr1_1951106_G_A_b38	SLC35E2	-2.773	0.00634	-0.074101	34	0.02672	no	BRNCHB
chr1_1951865_G_GT_b38	SLC35E2	-2.773	0.00634	-0.074101	34	0.02672	no	BRNCHB
chr1_1952064_G_A_b38	SLC35E2	-2.773	0.00634	-0.074101	34	0.02672	no	BRNCHB
chr1_1952823_TA_T_b38	SLC35E2	-2.773	0.00634	-0.074101	34	0.02672	no	BRNCHB
chr1_1770997_G_A_b38	SLC35E2	-2.769	0.00641	-0.070064	38	0.0253	no	BRNCHB
chr1_818161_G_A_b38	SLC35E2	-2.759	0.00661	-0.102928	5	0.037304	no	BRNCHB
chr1_1698048_T_C_b38	SLC35E2	-2.725	0.00728	-0.158518	4	0.058167	no	BRNCHB
chr1_852305_G_T_b38	SLC35E2	2.712	0.00756	0.101894	8	0.037566	no	BRNCHB
chr1_1284756_A_G_b38	SLC35E2	-2.709	0.00762	-0.145712	9	0.053782	no	BRNCHB
chr1_1808816_G_T_b38	SLC35E2	-2.701	0.00781	-0.070686	36	0.026171	no	BRNCHB
chr1_1817295_T_C_b38	SLC35E2	-2.701	0.00781	-0.070686	36	0.026171	no	BRNCHB
chr1_1819825_G_A_b38	SLC35E2	-2.701	0.00781	-0.070686	36	0.026171	no	BRNCHB
chr1_1827774_A_G_b38	SLC35E2	-2.701	0.00781	-0.070686	36	0.026171	no	BRNCHB
chr1_1771864_G_A_b38	SLC35E2	-2.69	0.00804	-0.069843	37	0.02596	no	BRNCHB
chr1_1772426_T_A_b38	SLC35E2	-2.69	0.00804	-0.069843	37	0.02596	no	BRNCHB
chr1_1713469_C_T_b38	SLC35E2	-2.689	0.00807	-0.11446	5	0.042563	no	BRNCHB
chr1_1746522_GT_G_b38	SLC35E2	-2.686	0.00815	-0.086752	7	0.032299	no	BRNCHB
chr1_1423775_C_CT_b38	SLC35E2	2.683	0.00822	0.107399	4	0.040032	no	BRNCHB
chr1_1684789_C_CAAA_b38	SLC35E2	-2.682	0.00823	-0.104052	8	0.038791	no	BRNCHB
chr1_1944182_G_C_b38	SLC35E2	-2.681	0.00826	-0.069042	36	0.025753	no	BRNCHB
chr1_1968900_A_G_b38	SLC35E2	2.679	0.00831	0.085927	11	0.032074	no	BRNCHB
chr1_1969015_A_G_b38	SLC35E2	2.671	0.0085	0.073852	33	0.02765	no	BRNCHB
chr1_1944420_A_G_b38	SLC35E2	-2.668	0.00857	-0.069494	37	0.026046	no	BRNCHB
chr1_1773460_G_A_b38	SLC35E2	-2.663	0.00869	-0.069928	36	0.026256	no	BRNCHB
chr1_1773476_C_G_b38	SLC35E2	-2.663	0.00869	-0.069928	36	0.026256	no	BRNCHB
chr1_1773848_A_C_b38	SLC35E2	-2.663	0.00869	-0.069928	36	0.026256	no	BRNCHB
chr1_1776461_GAAAC_G_b38	SLC35E2	-2.663	0.00869	-0.069928	36	0.026256	no	BRNCHB
chr1_1777362_A_G_b38	SLC35E2	-2.663	0.00869	-0.069928	36	0.026256	no	BRNCHB
chr1_1790040_C_T_b38	SLC35E2	-2.663	0.00869	-0.069928	36	0.026256	no	BRNCHB
chr1_1695459_A_G_b38	SLC35E2	2.661	0.00875	0.07355	33	0.027643	no	BRNCHB
chr1_1881428_C_CT_b38	SLC35E2	-2.659	0.00879	-0.068879	33	0.025901	no	BRNCHB
chr1_1718200_G_A_b38	SLC35E2	-2.641	0.00925	-0.117219	3	0.044385	no	BRNCHB
chr1_1963738_C_T_b38	SLC35E2	2.64	0.00928	0.083494	10	0.031627	no	BRNCHB
chr1_1964101_A_G_b38	SLC35E2	2.64	0.00928	0.083494	10	0.031627	no	BRNCHB
chr1_1964746_T_C_b38	SLC35E2	2.64	0.00928	0.083494	10	0.031627	no	BRNCHB
chr1_1964784_C_T_b38	SLC35E2	2.64	0.00928	0.083494	10	0.031627	no	BRNCHB
chr1_1965114_C_T_b38	SLC35E2	2.64	0.00928	0.083494	10	0.031627	no	BRNCHB
chr1_1966030_A_G_b38	SLC35E2	2.64	0.00928	0.083494	10	0.031627	no	BRNCHB
chr1_1966314_C_G_b38	SLC35E2	2.64	0.00928	0.083494	10	0.031627	no	BRNCHB
chr1_1966910_C_T_b38	SLC35E2	2.64	0.00928	0.083494	10	0.031627	no	BRNCHB
chr1_1966930_G_A_b38	SLC35E2	2.64	0.00928	0.083494	10	0.031627	no	BRNCHB
chr1_1967246_T_C_b38	SLC35E2	2.64	0.00928	0.083494	10	0.031627	no	BRNCHB
chr1_1967338_G_C_b38	SLC35E2	2.64	0.00928	0.083494	10	0.031627	no	BRNCHB
chr1_1967340_C_A_b38	SLC35E2	2.64	0.00928	0.083494	10	0.031627	no	BRNCHB
chr1_1967389_T_C_b38	SLC35E2	2.64	0.00928	0.083494	10	0.031627	no	BRNCHB
chr1_1967396_C_A_b38	SLC35E2	2.64	0.00928	0.083494	10	0.031627	no	BRNCHB
chr1_1967420_G_A_b38	SLC35E2	2.64	0.00928	0.083494	10	0.031627	no	BRNCHB
chr1_1967495_T_C_b38	SLC35E2	2.64	0.00928	0.083494	10	0.031627	no	BRNCHB
chr1_1967536_G_A_b38	SLC35E2	2.64	0.00928	0.083494	10	0.031627	no	BRNCHB
chr1_1967725_G_C_b38	SLC35E2	2.64	0.00928	0.083494	10	0.031627	no	BRNCHB
chr1_1967840_A_T_b38	SLC35E2	2.64	0.00928	0.083494	10	0.031627	no	BRNCHB
chr1_1967880_T_C_b38	SLC35E2	2.64	0.00928	0.083494	10	0.031627	no	BRNCHB
chr1_1968012_GTGAA_G_b38	SLC35E2	2.64	0.00928	0.083494	10	0.031627	no	BRNCHB
chr1_1968103_A_ATGAG_b38	SLC35E2	2.64	0.00928	0.083494	10	0.031627	no	BRNCHB
chr1_1968130_GTGAA_G_b38	SLC35E2	2.64	0.00928	0.083494	10	0.031627	no	BRNCHB
chr1_1968422_C_T_b38	SLC35E2	2.64	0.00928	0.083494	10	0.031627	no	BRNCHB
chr1_1968585_TG_T_b38	SLC35E2	2.64	0.00928	0.083494	10	0.031627	no	BRNCHB
chr1_1968667_T_TCTC_b38	SLC35E2	2.64	0.00928	0.083494	10	0.031627	no	BRNCHB
chr1_1772410_T_C_b38	SLC35E2	-2.625	0.00966	-0.067853	37	0.025846	no	BRNCHB
chr1_1962845_T_C_b38	SLC35E2	2.617	0.0099	0.082371	10	0.03148	no	BRNCHB
chr1_1743851_C_T_b38	SLC35E2	-5.109	8.71e-07	-0.123694	16	0.024209	yes	BRNCHA
chr1_1744499_C_T_b38	SLC35E2	-4.786	3.71e-06	-0.099042	43	0.020696	yes	BRNCHA
chr1_1742672_C_T_b38	SLC35E2	-4.53	1.11e-05	-0.09769	37	0.021564	yes	BRNCHA
chr1_1743238_G_C_b38	SLC35E2	-4.53	1.11e-05	-0.09769	37	0.021564	yes	BRNCHA
chr1_1991778_A_G_b38	SLC35E2	-4.187	4.56e-05	-0.105693	15	0.025246	yes	BRNCHA
chr1_1743586_T_TAC_b38	SLC35E2	-4.03	8.43e-05	-0.088477	32	0.021953	yes	BRNCHA
chr1_1688328_C_T_b38	SLC35E2	-4.008	9.17e-05	-0.103653	15	0.025859	yes	BRNCHA
chr1_1744652_C_T_b38	SLC35E2	-4.008	9.2e-05	-0.086578	44	0.021604	yes	BRNCHA
chr1_1753033_C_T_b38	SLC35E2	-3.961	0.00011	-0.086963	49	0.021957	yes	BRNCHA
chr1_1692124_T_G_b38	SLC35E2	-3.876	0.000152	-0.095411	19	0.024617	yes	BRNCHA
chr1_1695459_A_G_b38	SLC35E2	3.868	0.000157	0.095406	39	0.024668	yes	BRNCHA
chr1_1752908_C_CCCT_b38	SLC35E2	-3.789	0.00021	-0.087966	37	0.023213	yes	BRNCHA
chr1_1675091_A_G_b38	SLC35E2	-3.68	0.000314	-0.090506	17	0.024593	yes	BRNCHA
chr1_1750428_G_C_b38	SLC35E2	-3.673	0.000322	-0.090248	32	0.024573	yes	BRNCHA
chr1_1697272_G_A_b38	SLC35E2	3.662	0.000335	0.122632	11	0.033484	yes	BRNCHA
chr1_1750440_G_A_b38	SLC35E2	-3.66	0.000337	-0.090449	32	0.024712	yes	BRNCHA
chr1_1686147_T_G_b38	SLC35E2	-3.596	0.000425	-0.084692	34	0.023553	yes	BRNCHA
chr1_1687153_A_G_b38	SLC35E2	-3.553	0.000495	-0.082103	39	0.023109	yes	BRNCHA
chr1_1687643_G_A_b38	SLC35E2	-3.551	0.000498	-0.081029	39	0.022817	yes	BRNCHA
chr1_1743565_AT_A_b38	SLC35E2	3.534	0.000529	0.067959	54	0.019231	yes	BRNCHA
chr1_1671097_G_C_b38	SLC35E2	3.528	0.000539	0.079925	28	0.022652	yes	BRNCHA
chr1_1671148_C_T_b38	SLC35E2	3.518	0.00056	0.078492	29	0.022313	yes	BRNCHA
chr1_1687236_T_G_b38	SLC35E2	-3.505	0.000586	-0.082298	34	0.023482	yes	BRNCHA
chr1_1687159_G_T_b38	SLC35E2	-3.503	0.00059	-0.081818	36	0.023359	yes	BRNCHA
chr1_1660683_C_T_b38	SLC35E2	-3.498	6e-04	-0.090068	15	0.025747	yes	BRNCHA
chr1_1635226_T_C_b38	SLC35E2	-3.486	0.000626	-0.106254	6	0.030484	yes	BRNCHA
chr1_1686321_CTTT_C_b38	SLC35E2	-3.455	0.000696	-0.090502	15	0.026191	yes	BRNCHA
chr1_1686017_A_AT_b38	SLC35E2	-3.442	0.000728	-0.079447	38	0.023079	yes	BRNCHA
chr1_1687061_C_T_b38	SLC35E2	-3.442	0.000728	-0.079447	38	0.023079	yes	BRNCHA
chr1_1747695_A_G_b38	SLC35E2	-3.427	0.000766	-0.068169	48	0.019889	yes	BRNCHA
chr1_1681928_C_A_b38	SLC35E2	-3.385	0.000888	-0.077665	37	0.022947	yes	BRNCHA
chr1_1680214_T_C_b38	SLC35E2	-3.355	0.000983	-0.077589	38	0.023129	yes	BRNCHA
chr1_1680556_A_G_b38	SLC35E2	-3.355	0.000983	-0.077589	38	0.023129	yes	BRNCHA
chr1_1681164_G_A_b38	SLC35E2	-3.355	0.000983	-0.077589	38	0.023129	yes	BRNCHA
chr1_1683909_A_C_b38	SLC35E2	-3.351	0.000993	-0.077206	40	0.023037	yes	BRNCHA
chr1_1688570_A_T_b38	SLC35E2	-3.334	0.00105	-0.10077	9	0.030223	yes	BRNCHA
chr1_1684266_T_C_b38	SLC35E2	-3.33	0.00107	-0.076831	37	0.023075	yes	BRNCHA
chr1_1684308_G_C_b38	SLC35E2	-3.33	0.00107	-0.076831	37	0.023075	yes	BRNCHA
chr1_1684619_G_A_b38	SLC35E2	-3.33	0.00107	-0.076831	37	0.023075	yes	BRNCHA
chr1_1591703_T_C_b38	SLC35E2	3.309	0.00115	0.076941	35	0.023254	yes	BRNCHA
chr1_1695747_C_T_b38	SLC35E2	3.219	0.00154	0.080208	41	0.024916	yes	BRNCHA
chr1_1667948_A_G_b38	SLC35E2	-3.21	0.00159	-0.081717	14	0.025459	yes	BRNCHA
chr1_1660408_T_C_b38	SLC35E2	-3.189	0.00171	-0.091378	6	0.028658	yes	BRNCHA
chr1_1665581_C_G_b38	SLC35E2	-3.188	0.00171	-0.081418	15	0.025539	yes	BRNCHA
chr1_1600320_C_G_b38	SLC35E2	3.175	0.00178	0.076661	20	0.024146	yes	BRNCHA
chr1_1679993_A_G_b38	SLC35E2	-3.122	0.00212	-0.07124	46	0.022822	yes	BRNCHA
chr1_1668542_C_T_b38	SLC35E2	-3.111	0.00219	-0.080332	13	0.025823	yes	BRNCHA
chr1_1684817_G_C_b38	SLC35E2	-3.088	0.00236	-0.072401	35	0.023446	yes	BRNCHA
chr1_1600379_C_T_b38	SLC35E2	3.074	0.00247	0.074495	20	0.024237	yes	BRNCHA
chr1_1595028_C_CAG_b38	SLC35E2	3.073	0.00248	0.080523	15	0.026208	yes	BRNCHA
chr1_1669576_G_A_b38	SLC35E2	-3.072	0.00248	-0.078388	14	0.025521	yes	BRNCHA
chr1_1750508_A_C_b38	SLC35E2	-3.06	0.00258	-0.062467	47	0.020412	yes	BRNCHA
chr1_1851414_GA_G_b38	SLC35E2	-3.051	0.00265	-0.079572	18	0.026083	yes	BRNCHA
chr1_1750528_G_A_b38	SLC35E2	-3.032	0.00282	-0.062067	45	0.020473	yes	BRNCHA
chr1_1661420_C_A_b38	SLC35E2	-3.03	0.00283	-0.072047	24	0.023778	yes	BRNCHA
chr1_1669613_G_A_b38	SLC35E2	-3.007	0.00305	-0.07672	14	0.025517	yes	BRNCHA
chr1_1661177_A_G_b38	SLC35E2	-2.994	0.00317	-0.07814	13	0.026102	yes	BRNCHA
chr1_1739131_T_C_b38	SLC35E2	2.988	0.00323	0.066871	38	0.022378	yes	BRNCHA
chr1_1664865_A_G_b38	SLC35E2	-2.98	0.00331	-0.07104	23	0.023837	yes	BRNCHA
chr1_1607931_G_A_b38	SLC35E2	2.975	0.00336	0.072258	20	0.024287	yes	BRNCHA
chr1_1609058_G_A_b38	SLC35E2	2.975	0.00336	0.072258	20	0.024287	yes	BRNCHA
chr1_1986752_A_G_b38	SLC35E2	2.958	0.00354	0.07197	41	0.024331	yes	BRNCHA
chr1_1658866_G_A_b38	SLC35E2	-2.952	0.00361	-0.070177	24	0.023775	yes	BRNCHA
chr1_1659114_A_G_b38	SLC35E2	-2.952	0.00361	-0.070177	24	0.023775	yes	BRNCHA
chr1_1659220_A_G_b38	SLC35E2	-2.952	0.00361	-0.070177	24	0.023775	yes	BRNCHA
chr1_1650664_CTTTTT_C_b38	SLC35E2	-2.934	0.00381	-0.084959	8	0.028954	yes	BRNCHA
chr1_1688619_AAAC_A_b38	SLC35E2	-2.933	0.00382	-0.086971	11	0.029651	yes	BRNCHA
chr1_1820337_A_G_b38	SLC35E2	2.919	0.00399	0.066713	43	0.022853	yes	BRNCHA
chr1_2416398_G_GCGACA_b38	SLC35E2	2.898	0.00425	0.077308	12	0.026673	yes	BRNCHA
chr1_1987547_C_CT_b38	SLC35E2	2.889	0.00437	0.07085	41	0.024523	yes	BRNCHA
chr1_1668717_C_G_b38	SLC35E2	-2.883	0.00446	-0.075358	13	0.026141	yes	BRNCHA
chr1_1668721_C_T_b38	SLC35E2	-2.879	0.00451	-0.070311	17	0.024422	yes	BRNCHA
chr1_2415084_G_C_b38	SLC35E2	2.877	0.00454	0.072535	14	0.025215	yes	BRNCHA
chr1_2415085_T_C_b38	SLC35E2	2.877	0.00454	0.072535	14	0.025215	yes	BRNCHA
chr1_1590682_T_C_b38	SLC35E2	-2.864	0.00471	-0.065618	34	0.02291	yes	BRNCHA
chr1_1688647_G_A_b38	SLC35E2	-2.864	0.00472	-0.082946	13	0.028963	yes	BRNCHA
chr1_2431388_C_T_b38	SLC35E2	2.84	0.00506	0.070426	21	0.024795	yes	BRNCHA
chr1_1658830_C_G_b38	SLC35E2	-2.824	0.00532	-0.073648	13	0.026081	yes	BRNCHA
chr1_2430581_G_T_b38	SLC35E2	2.82	0.00537	0.069786	22	0.024743	yes	BRNCHA
chr1_1651926_T_C_b38	SLC35E2	-2.812	0.00551	-0.069151	22	0.024589	yes	BRNCHA
chr1_2416137_G_T_b38	SLC35E2	2.809	0.00555	0.077963	10	0.027751	yes	BRNCHA
chr1_1991761_T_C_b38	SLC35E2	2.808	0.00557	0.06952	31	0.024756	yes	BRNCHA
chr1_1746522_GT_G_b38	SLC35E2	-2.807	0.00559	-0.078872	11	0.028099	yes	BRNCHA
chr1_2426653_T_G_b38	SLC35E2	-2.806	0.00561	-0.074421	14	0.026523	yes	BRNCHA
chr1_1650777_G_A_b38	SLC35E2	-2.803	0.00566	-0.06845	22	0.024423	yes	BRNCHA
chr1_1651137_C_T_b38	SLC35E2	-2.803	0.00566	-0.06845	22	0.024423	yes	BRNCHA
chr1_1651267_T_C_b38	SLC35E2	-2.803	0.00566	-0.06845	22	0.024423	yes	BRNCHA
chr1_1651574_G_A_b38	SLC35E2	-2.803	0.00566	-0.06845	22	0.024423	yes	BRNCHA
chr1_1651785_C_A_b38	SLC35E2	-2.803	0.00566	-0.06845	22	0.024423	yes	BRNCHA
chr1_1652061_T_C_b38	SLC35E2	-2.803	0.00566	-0.06845	22	0.024423	yes	BRNCHA
chr1_1652135_C_G_b38	SLC35E2	-2.803	0.00566	-0.06845	22	0.024423	yes	BRNCHA
chr1_1652191_C_T_b38	SLC35E2	-2.803	0.00566	-0.06845	22	0.024423	yes	BRNCHA
chr1_1652592_A_G_b38	SLC35E2	-2.803	0.00566	-0.06845	22	0.024423	yes	BRNCHA
chr1_1652779_A_G_b38	SLC35E2	-2.803	0.00566	-0.06845	22	0.024423	yes	BRNCHA
chr1_1653147_A_C_b38	SLC35E2	-2.803	0.00566	-0.06845	22	0.024423	yes	BRNCHA
chr1_1653396_T_C_b38	SLC35E2	-2.803	0.00566	-0.06845	22	0.024423	yes	BRNCHA
chr1_1653472_T_C_b38	SLC35E2	-2.803	0.00566	-0.06845	22	0.024423	yes	BRNCHA
chr1_1653811_G_A_b38	SLC35E2	-2.803	0.00566	-0.06845	22	0.024423	yes	BRNCHA
chr1_1653893_C_T_b38	SLC35E2	-2.803	0.00566	-0.06845	22	0.024423	yes	BRNCHA
chr1_1653934_G_A_b38	SLC35E2	-2.803	0.00566	-0.06845	22	0.024423	yes	BRNCHA
chr1_1654143_G_A_b38	SLC35E2	-2.803	0.00566	-0.06845	22	0.024423	yes	BRNCHA
chr1_1654188_T_G_b38	SLC35E2	-2.803	0.00566	-0.06845	22	0.024423	yes	BRNCHA
chr1_828389_A_AT_b38	SLC35E2	2.789	0.00589	0.07602	18	0.027255	yes	BRNCHA
chr1_1659060_G_A_b38	SLC35E2	-2.77	0.00625	-0.069168	16	0.024975	yes	BRNCHA
chr1_1610924_C_T_b38	SLC35E2	-2.746	0.00669	-0.065572	30	0.02388	yes	BRNCHA
chr1_1665061_C_T_b38	SLC35E2	-2.742	0.00677	-0.072166	13	0.026319	yes	BRNCHA
chr1_1652913_C_T_b38	SLC35E2	-2.698	0.00769	-0.070369	14	0.026081	yes	BRNCHA
chr1_1653863_C_A_b38	SLC35E2	-2.695	0.00776	-0.08535	4	0.031672	yes	BRNCHA
chr1_1586962_C_T_b38	SLC35E2	2.669	0.00836	0.068745	23	0.025758	yes	BRNCHA
chr1_1741276_C_T_b38	SLC35E2	-2.659	0.0086	-0.059728	31	0.022462	yes	BRNCHA
chr1_1650195_A_G_b38	SLC35E2	-2.651	0.0088	-0.06296	23	0.023754	yes	BRNCHA
chr1_1707555_C_T_b38	SLC35E2	2.637	0.00914	0.127689	13	0.048413	yes	BRNCHA
chr1_1866635_T_TA_b38	SLC35E2	2.634	0.00924	0.066845	30	0.025382	yes	BRNCHA
chr1_1629332_G_T_b38	SLC35E2	2.632	0.00928	0.068281	19	0.025943	yes	BRNCHA
chr1_1688786_G_A_b38	SLC35E2	-2.631	0.00931	-0.082167	7	0.031232	yes	BRNCHA
chr1_1948121_T_G_b38	SLC35E2	2.625	0.00946	0.070091	15	0.026699	yes	BRNCHA
chr1_1757074_G_T_b38	SLC35E2	2.617	0.00969	0.061131	32	0.023362	yes	BRNCHA
chr1_1991213_T_C_b38	SLC35E2	2.612	0.00981	0.061096	38	0.023388	yes	BRNCHA
chr1_1743565_ATAT_A_b38	SLC35E2	-5.43	1.95e-07	-0.112272	37	0.020676	no	BRNCHA
chr1_1744028_A_AC_b38	SLC35E2	-5.016	1.33e-06	-0.132502	11	0.026417	no	BRNCHA
chr1_1743840_T_C_b38	SLC35E2	-4.987	1.52e-06	-0.123239	17	0.02471	no	BRNCHA
chr1_1744052_GAGA_G_b38	SLC35E2	-4.872	2.54e-06	-0.124602	14	0.025576	no	BRNCHA
chr1_1744854_C_A_b38	SLC35E2	-4.62	7.6e-06	-0.09586	32	0.020748	no	BRNCHA
chr1_1751981_A_T_b38	SLC35E2	-4.525	1.14e-05	-0.112507	18	0.024861	no	BRNCHA
chr1_1754482_TCCCTGGGACCGAAGTCGCCCCA_T_b38	SLC35E2	-4.143	5.42e-05	-0.091994	43	0.022205	no	BRNCHA
chr1_1752461_G_A_b38	SLC35E2	-4.113	6.1e-05	-0.091063	43	0.022141	no	BRNCHA
chr1_1752730_C_G_b38	SLC35E2	-4.113	6.1e-05	-0.091063	43	0.022141	no	BRNCHA
chr1_1753319_G_A_b38	SLC35E2	-4.113	6.1e-05	-0.091063	43	0.022141	no	BRNCHA
chr1_1753361_G_A_b38	SLC35E2	-4.113	6.1e-05	-0.091063	43	0.022141	no	BRNCHA
chr1_1759354_G_A_b38	SLC35E2	-4.107	6.24e-05	-0.090193	44	0.021959	no	BRNCHA
chr1_1743886_C_T_b38	SLC35E2	-4.105	6.3e-05	-0.10441	17	0.025434	no	BRNCHA
chr1_1692151_T_C_b38	SLC35E2	-4.087	6.76e-05	-0.10285	18	0.025165	no	BRNCHA
chr1_1756043_G_T_b38	SLC35E2	-4.054	7.67e-05	-0.089282	44	0.022021	no	BRNCHA
chr1_1759611_C_T_b38	SLC35E2	-4.036	8.25e-05	-0.088063	45	0.02182	no	BRNCHA
chr1_1755504_T_C_b38	SLC35E2	3.939	0.00012	0.087197	49	0.022136	no	BRNCHA
chr1_2656382_G_A_b38	SLC35E2	-3.912	0.000133	-0.194458	4	0.049707	no	BRNCHA
chr1_1742587_G_C_b38	SLC35E2	3.731	0.000261	0.081441	52	0.02183	no	BRNCHA
chr1_1755713_G_A_b38	SLC35E2	-3.708	0.000284	-0.080929	41	0.021827	no	BRNCHA
chr1_1755523_C_T_b38	SLC35E2	3.631	0.000375	0.0846	51	0.023299	no	BRNCHA
chr1_1748597_C_G_b38	SLC35E2	-3.449	0.00071	-0.079583	43	0.023071	no	BRNCHA
chr1_1747472_A_T_b38	SLC35E2	-3.448	0.000713	-0.079728	43	0.02312	no	BRNCHA
chr1_1750280_A_G_b38	SLC35E2	-3.434	0.000749	-0.077426	46	0.022546	no	BRNCHA
chr1_1748780_G_A_b38	SLC35E2	-3.365	0.000947	-0.07659	47	0.022758	no	BRNCHA
chr1_1691417_T_C_b38	SLC35E2	3.337	0.00104	0.077337	42	0.023176	no	BRNCHA
chr1_1744121_A_C_b38	SLC35E2	-3.188	0.00171	-0.093166	21	0.02922	no	BRNCHA
chr1_1744096_C_T_b38	SLC35E2	-3.172	0.0018	-0.096	18	0.030268	no	BRNCHA
chr1_1279441_C_T_b38	SLC35E2	3.154	0.00191	0.130639	3	0.041421	no	BRNCHA
chr1_1749826_A_G_b38	SLC35E2	-3.099	0.00228	-0.068602	48	0.022137	no	BRNCHA
chr1_2428423_C_A_b38	SLC35E2	-3.08	0.00242	-0.074429	21	0.024169	no	BRNCHA
chr1_1637577_T_C_b38	SLC35E2	-3.062	0.00256	-0.077645	14	0.025356	no	BRNCHA
chr1_1596144_GAGAC_G_b38	SLC35E2	-3.056	0.00261	-0.073372	28	0.024011	no	BRNCHA
chr1_1605347_C_T_b38	SLC35E2	-3.022	0.00291	-0.072558	29	0.024011	no	BRNCHA
chr1_2427316_G_C_b38	SLC35E2	-3.02	0.00292	-0.073435	21	0.024313	no	BRNCHA
chr1_1589618_A_T_b38	SLC35E2	-3.007	0.00304	-0.071665	28	0.023833	no	BRNCHA
chr1_1589151_C_T_b38	SLC35E2	-2.997	0.00314	-0.068755	33	0.022944	no	BRNCHA
chr1_1589057_T_C_b38	SLC35E2	-2.981	0.0033	-0.06875	33	0.023061	no	BRNCHA
chr1_1592572_T_C_b38	SLC35E2	-2.979	0.00332	-0.071035	28	0.023845	no	BRNCHA
chr1_2409621_C_T_b38	SLC35E2	-2.961	0.00351	-0.071141	19	0.024029	no	BRNCHA
chr1_1589495_CTTT_C_b38	SLC35E2	2.957	0.00356	0.081384	14	0.027525	no	BRNCHA
chr1_1668108_C_T_b38	SLC35E2	2.951	0.00362	0.069166	25	0.02344	no	BRNCHA
chr1_1680672_C_T_b38	SLC35E2	-2.949	0.00364	-0.071165	47	0.02413	no	BRNCHA
chr1_1969015_A_G_b38	SLC35E2	2.925	0.00392	0.069438	48	0.023742	no	BRNCHA
chr1_1991690_A_G_b38	SLC35E2	2.91	0.0041	0.071694	37	0.024635	no	BRNCHA
chr1_2427505_A_C_b38	SLC35E2	-2.909	0.00411	-0.071265	24	0.024494	no	BRNCHA
chr1_1594614_G_C_b38	SLC35E2	-2.908	0.00413	-0.069249	29	0.023813	no	BRNCHA
chr1_2429381_C_G_b38	SLC35E2	-2.869	0.00465	-0.069775	21	0.024322	no	BRNCHA
chr1_1688409_C_G_b38	SLC35E2	-2.861	0.00477	-0.066687	32	0.023312	no	BRNCHA
chr1_828389_AT_A_b38	SLC35E2	-2.849	0.00493	-0.094766	3	0.033258	no	BRNCHA
chr1_1195463_A_G_b38	SLC35E2	-2.837	0.00512	-0.075558	20	0.026634	no	BRNCHA
chr1_1608603_C_A_b38	SLC35E2	-2.829	0.00523	-0.067408	30	0.023824	no	BRNCHA
chr1_1609070_G_A_b38	SLC35E2	-2.829	0.00523	-0.067408	30	0.023824	no	BRNCHA
chr1_1648826_A_G_b38	SLC35E2	-2.809	0.00555	-0.068564	24	0.024405	no	BRNCHA
chr1_1648636_G_A_b38	SLC35E2	-2.808	0.00557	-0.068419	24	0.024365	no	BRNCHA
chr1_2385549_C_CG_b38	SLC35E2	-2.802	0.00567	-0.095528	4	0.034091	no	BRNCHA
chr1_1936906_C_CA_b38	SLC35E2	-2.797	0.00577	-0.071751	24	0.025657	no	BRNCHA
chr1_1987049_A_G_b38	SLC35E2	2.791	0.00586	0.066357	42	0.023773	no	BRNCHA
chr1_1760882_T_C_b38	SLC35E2	2.784	0.00598	0.063568	43	0.02283	no	BRNCHA
chr1_1708855_TTCCTCCTCC_T_b38	SLC35E2	2.774	0.00617	0.069139	36	0.024926	no	BRNCHA
chr1_1764887_C_A_b38	SLC35E2	-2.76	0.00643	-0.064469	44	0.023362	no	BRNCHA
chr1_1770997_G_A_b38	SLC35E2	-2.75	0.00661	-0.062698	46	0.022799	no	BRNCHA
chr1_1836126_C_A_b38	SLC35E2	-2.728	0.00705	-0.06146	47	0.022529	no	BRNCHA
chr1_1686882_T_C_b38	SLC35E2	-2.726	0.00709	-0.061168	45	0.022438	no	BRNCHA
chr1_1843381_A_T_b38	SLC35E2	-2.705	0.00752	-0.06247	45	0.02309	no	BRNCHA
chr1_1846009_AGG_A_b38	SLC35E2	-2.705	0.00752	-0.06247	45	0.02309	no	BRNCHA
chr1_1846011_G_GTCC_b38	SLC35E2	-2.705	0.00752	-0.06247	45	0.02309	no	BRNCHA
chr1_1847030_A_G_b38	SLC35E2	-2.705	0.00752	-0.06247	45	0.02309	no	BRNCHA
chr1_1850017_G_T_b38	SLC35E2	-2.705	0.00752	-0.06247	45	0.02309	no	BRNCHA
chr1_1769969_CAAAACAAAAACA_C_b38	SLC35E2	-2.703	0.00757	-0.064508	44	0.023863	no	BRNCHA
chr1_1860718_A_C_b38	SLC35E2	-2.7	0.00765	-0.062395	46	0.023113	no	BRNCHA
chr1_1866508_A_G_b38	SLC35E2	-2.7	0.00765	-0.062395	46	0.023113	no	BRNCHA
chr1_1875208_T_C_b38	SLC35E2	-2.7	0.00765	-0.062395	46	0.023113	no	BRNCHA
chr1_1879567_T_C_b38	SLC35E2	-2.7	0.00765	-0.062395	46	0.023113	no	BRNCHA
chr1_2430227_C_T_b38	SLC35E2	-2.684	0.008	-0.068417	18	0.02549	no	BRNCHA
chr1_839543_G_C_b38	SLC35E2	-2.684	0.008	-0.074819	15	0.027876	no	BRNCHA
chr1_1831318_C_T_b38	SLC35E2	-2.677	0.00816	-0.062221	44	0.023242	no	BRNCHA
chr1_1773460_G_A_b38	SLC35E2	-2.673	0.00825	-0.062093	45	0.023227	no	BRNCHA
chr1_1773476_C_G_b38	SLC35E2	-2.673	0.00825	-0.062093	45	0.023227	no	BRNCHA
chr1_1773848_A_C_b38	SLC35E2	-2.673	0.00825	-0.062093	45	0.023227	no	BRNCHA
chr1_1776461_GAAAC_G_b38	SLC35E2	-2.673	0.00825	-0.062093	45	0.023227	no	BRNCHA
chr1_1777362_A_G_b38	SLC35E2	-2.673	0.00825	-0.062093	45	0.023227	no	BRNCHA
chr1_1790040_C_T_b38	SLC35E2	-2.673	0.00825	-0.062093	45	0.023227	no	BRNCHA
chr1_1808816_G_T_b38	SLC35E2	-2.673	0.00825	-0.062093	45	0.023227	no	BRNCHA
chr1_1817295_T_C_b38	SLC35E2	-2.673	0.00825	-0.062093	45	0.023227	no	BRNCHA
chr1_1819825_G_A_b38	SLC35E2	-2.673	0.00825	-0.062093	45	0.023227	no	BRNCHA
chr1_1827774_A_G_b38	SLC35E2	-2.673	0.00825	-0.062093	45	0.023227	no	BRNCHA
chr1_851771_G_A_b38	SLC35E2	-2.673	0.00826	-0.093964	3	0.035152	no	BRNCHA
chr1_1891450_G_C_b38	SLC35E2	-2.655	0.00871	-0.062075	44	0.023385	no	BRNCHA
chr1_1881428_C_CT_b38	SLC35E2	-2.648	0.00888	-0.062254	42	0.023512	no	BRNCHA
chr1_1708951_C_T_b38	SLC35E2	2.645	0.00894	0.065405	35	0.024727	no	BRNCHA
chr1_1743544_CA_C_b38	SLC35E2	2.639	0.0091	0.059025	50	0.022369	no	BRNCHA
chr1_1881249_A_G_b38	SLC35E2	-2.635	0.00919	-0.060706	46	0.023037	no	BRNCHA
chr1_1886800_G_A_b38	SLC35E2	-2.635	0.00919	-0.060706	46	0.023037	no	BRNCHA
chr1_1891654_C_CAGAG_b38	SLC35E2	-2.635	0.00919	-0.060706	46	0.023037	no	BRNCHA
chr1_1771864_G_A_b38	SLC35E2	-2.626	0.00943	-0.060621	46	0.023084	no	BRNCHA
chr1_1772426_T_A_b38	SLC35E2	-2.626	0.00943	-0.060621	46	0.023084	no	BRNCHA
chr1_928128_G_T_b38	SLC35E2	2.626	0.00945	0.097164	3	0.037006	no	BRNCHA
chr1_878367_G_A_b38	SLC35E2	2.621	0.00958	0.092441	6	0.035276	no	BRNCHA
chr1_1791493_C_T_b38	SLC35E2	-2.617	0.00967	-0.061077	44	0.023335	no	BRNCHA
chr1_1791592_G_A_b38	SLC35E2	-2.617	0.00967	-0.061077	44	0.023335	no	BRNCHA
chr1_1792927_G_A_b38	SLC35E2	-2.617	0.00967	-0.061077	44	0.023335	no	BRNCHA
chr1_2389263_T_C_b38	SLC35E2	-2.616	0.00972	-0.064282	19	0.024576	no	BRNCHA
chr1_833758_CAT_C_b38	SLC35E2	-2.61	0.00987	-0.087454	3	0.033507	no	BRNCHA
chr1_1864334_AAAG_A_b38	SLC35E2	-2.607	0.00997	-0.07237	15	0.027765	no	BRNCHA
chr1_839543_G_C_b38	SLC35E2	-3.519	0.00056	-0.09011	18	0.025605	yes	BRNCTXA
chr1_1664099_T_C_b38	SLC35E2	3.372	0.000932	0.093122	8	0.027619	yes	BRNCTXA
chr1_1738207_ACT_A_b38	SLC35E2	3.222	0.00153	0.071891	24	0.02231	yes	BRNCTXA
chr1_1688328_C_T_b38	SLC35E2	-3.201	0.00164	-0.073701	17	0.023024	yes	BRNCTXA
chr1_832873_A_C_b38	SLC35E2	3.139	0.00201	0.073844	24	0.023523	yes	BRNCTXA
chr1_2342840_A_ATATTTTATTT_b38	SLC35E2	3.121	0.00213	0.124527	5	0.039895	yes	BRNCTXA
chr1_1591703_T_C_b38	SLC35E2	3.067	0.00253	0.064516	38	0.021039	yes	BRNCTXA
chr1_1664865_A_G_b38	SLC35E2	-3.058	0.0026	-0.06701	20	0.02191	yes	BRNCTXA
chr1_818161_G_A_b38	SLC35E2	-3.006	0.00306	-0.087819	10	0.029216	yes	BRNCTXA
chr1_861387_G_A_b38	SLC35E2	2.849	0.00495	0.079703	22	0.027978	yes	BRNCTXA
chr1_1734812_G_A_b38	SLC35E2	2.818	0.00543	0.076463	20	0.027134	yes	BRNCTXA
chr1_2363825_TAA_T_b38	SLC35E2	2.812	0.00552	0.05559	47	0.019768	yes	BRNCTXA
chr1_1736801_CA_C_b38	SLC35E2	2.797	0.00577	0.069285	27	0.02477	yes	BRNCTXA
chr1_814758_G_A_b38	SLC35E2	-2.797	0.00578	-0.090467	3	0.032347	yes	BRNCTXA
chr1_1664417_G_A_b38	SLC35E2	-2.756	0.00651	-0.071897	10	0.026083	yes	BRNCTXA
chr1_1730265_A_G_b38	SLC35E2	2.722	0.00719	0.069936	14	0.025694	yes	BRNCTXA
chr1_1660683_C_T_b38	SLC35E2	-2.708	0.00748	-0.065576	14	0.024213	yes	BRNCTXA
chr1_1661420_C_A_b38	SLC35E2	-2.703	0.00759	-0.059796	21	0.022119	yes	BRNCTXA
chr1_2367055_C_A_b38	SLC35E2	2.677	0.00819	0.067815	12	0.025337	yes	BRNCTXA
chr1_1812038_G_C_b38	SLC35E2	2.63	0.00934	0.103207	3	0.039235	yes	BRNCTXA
chr1_1925075_G_A_b38	SLC35E2	-2.629	0.00937	-0.092464	6	0.035169	yes	BRNCTXA
chr1_1010755_T_G_b38	SLC35E2	-2.618	0.00967	-0.11111	5	0.042438	yes	BRNCTXA
chr1_1773676_TTG_T_b38	SLC35E2	-3.477	0.000649	-0.120761	3	0.034732	no	BRNCTXA
chr1_1729539_C_A_b38	SLC35E2	3.293	0.00121	0.080741	16	0.024519	no	BRNCTXA
chr1_2342840_A_ATATTTTATTTTATTT_b38	SLC35E2	3.259	0.00136	0.129326	5	0.039677	no	BRNCTXA
chr1_1589495_CTTT_C_b38	SLC35E2	3.232	0.00149	0.080122	16	0.024792	no	BRNCTXA
chr1_853333_T_C_b38	SLC35E2	3.178	0.00177	0.094148	13	0.029624	no	BRNCTXA
chr1_1586962_C_T_b38	SLC35E2	3.138	0.00202	0.075503	21	0.024063	no	BRNCTXA
chr1_1728604_T_A_b38	SLC35E2	3.122	0.00213	0.075446	17	0.02417	no	BRNCTXA
chr1_1739131_T_C_b38	SLC35E2	3.097	0.0023	0.064305	39	0.020761	no	BRNCTXA
chr1_2359882_C_CAA_b38	SLC35E2	3.084	0.0024	0.085677	8	0.027779	no	BRNCTXA
chr1_791101_T_G_b38	SLC35E2	3.06	0.00259	0.094405	5	0.030856	no	BRNCTXA
chr1_791101_T_TGG_b38	SLC35E2	-3.06	0.00259	-0.094405	5	0.030856	no	BRNCTXA
chr1_749482_G_A_b38	SLC35E2	3.053	0.00265	0.139293	6	0.045627	no	BRNCTXA
chr1_791100_G_GGGA_b38	SLC35E2	-3.01	0.00303	-0.093247	5	0.030984	no	BRNCTXA
chr1_1805416_A_G_b38	SLC35E2	2.977	0.00336	0.108747	3	0.036535	no	BRNCTXA
chr1_851741_T_A_b38	SLC35E2	-2.964	0.00349	-0.096692	3	0.032627	no	BRNCTXA
chr1_1705198_C_G_b38	SLC35E2	-2.95	0.00365	-0.14871	4	0.050415	no	BRNCTXA
chr1_1650664_CTTTTT_C_b38	SLC35E2	-2.898	0.00427	-0.074438	9	0.025688	no	BRNCTXA
chr1_1948594_G_GTTT_b38	SLC35E2	-2.888	0.00441	-0.122274	4	0.042345	no	BRNCTXA
chr1_863020_A_G_b38	SLC35E2	-2.885	0.00444	-0.074272	18	0.025743	no	BRNCTXA
chr1_863579_G_A_b38	SLC35E2	-2.885	0.00444	-0.074272	18	0.025743	no	BRNCTXA
chr1_771398_G_A_b38	SLC35E2	2.881	0.00449	0.069956	25	0.024282	no	BRNCTXA
chr1_851771_G_A_b38	SLC35E2	-2.819	0.00541	-0.09221	4	0.032709	no	BRNCTXA
chr1_1115166_G_GT_b38	SLC35E2	-2.818	0.00543	-0.144895	4	0.051421	no	BRNCTXA
chr1_1116992_A_G_b38	SLC35E2	-2.818	0.00543	-0.144895	4	0.051421	no	BRNCTXA
chr1_1773711_T_TGAGA_b38	SLC35E2	2.808	0.00559	0.089353	5	0.031817	no	BRNCTXA
chr1_1774697_T_C_b38	SLC35E2	2.777	0.00612	0.106854	3	0.038472	no	BRNCTXA
chr1_2359472_G_A_b38	SLC35E2	2.762	0.0064	0.058836	33	0.021302	no	BRNCTXA
chr1_1658866_G_A_b38	SLC35E2	-2.752	0.00659	-0.060812	21	0.022096	no	BRNCTXA
chr1_1659114_A_G_b38	SLC35E2	-2.752	0.00659	-0.060812	21	0.022096	no	BRNCTXA
chr1_1659220_A_G_b38	SLC35E2	-2.752	0.00659	-0.060812	21	0.022096	no	BRNCTXA
chr1_1742468_G_C_b38	SLC35E2	-2.752	0.00659	-0.057687	57	0.020962	no	BRNCTXA
chr1_960326_G_A_b38	SLC35E2	-2.752	0.0066	-0.09355	12	0.033999	no	BRNCTXA
chr1_1742432_TA_T_b38	SLC35E2	2.749	0.00664	0.060656	26	0.022062	no	BRNCTXA
chr1_852305_G_T_b38	SLC35E2	2.742	0.00679	0.080408	13	0.029327	no	BRNCTXA
chr1_1664300_T_C_b38	SLC35E2	2.728	0.00707	0.074097	6	0.027162	no	BRNCTXA
chr1_1734263_T_C_b38	SLC35E2	2.705	0.00756	0.054793	35	0.020259	no	BRNCTXA
chr1_847601_C_T_b38	SLC35E2	-2.7	0.00766	-0.078532	10	0.029088	no	BRNCTXA
chr1_1668108_C_T_b38	SLC35E2	2.685	0.008	0.058897	22	0.021936	no	BRNCTXA
chr1_1013466_T_TA_b38	SLC35E2	-2.662	0.00854	-0.154453	4	0.058023	no	BRNCTXA
chr1_849670_G_A_b38	SLC35E2	2.648	0.00888	0.079506	13	0.03002	no	BRNCTXA
chr1_850609_T_C_b38	SLC35E2	2.648	0.00888	0.079506	13	0.03002	no	BRNCTXA
chr1_855378_GTA_G_b38	SLC35E2	2.648	0.00888	0.079506	13	0.03002	no	BRNCTXA
chr1_1708737_G_C_b38	SLC35E2	2.636	0.00919	0.105433	3	0.039993	no	BRNCTXA
chr1_1639348_G_T_b38	SLC35E2	-2.629	0.00938	-0.058004	23	0.022063	no	BRNCTXA
chr1_1707634_A_T_b38	SLC35E2	2.627	0.00944	0.115611	4	0.044014	no	BRNCTXA
chr1_830627_A_C_b38	SLC35E2	-2.62	0.00961	-0.090792	3	0.034649	no	BRNCTXA
chr1_2124387_G_A_b38	SLC35E2	-3.135	0.00211	-0.171445	3	0.054686	yes	BRNCTXB
chr1_828389_A_AT_b38	SLC35E2	2.798	0.00589	0.079154	14	0.028285	yes	BRNCTXB
chr1_2300128_G_T_b38	SLC35E2	-2.681	0.00826	-0.065175	40	0.024308	yes	BRNCTXB
chr1_2415084_G_C_b38	SLC35E2	2.63	0.00954	0.067733	13	0.025756	yes	BRNCTXB
chr1_2415085_T_C_b38	SLC35E2	2.63	0.00954	0.067733	13	0.025756	yes	BRNCTXB
chr1_1717604_CGCTTTCAGCTAGAGTTTGCTCTCTCTGGTTTTCGGTCTGTGACACACGCAT_C_b38	SLC35E2	3.028	0.00295	0.068847	26	0.022734	no	BRNCTXB
chr1_1744121_A_C_b38	SLC35E2	-2.958	0.00366	-0.088393	20	0.029882	no	BRNCTXB
chr1_1743565_ATAT_A_b38	SLC35E2	-2.958	0.00366	-0.066955	27	0.022637	no	BRNCTXB
chr1_2342840_A_ATATTT_b38	SLC35E2	-2.733	0.00713	-0.104022	6	0.038063	no	BRNCTXB
chr1_2313466_C_T_b38	SLC35E2	-2.685	0.00817	-0.061862	36	0.023041	no	BRNCTXB
chr1_1744096_C_T_b38	SLC35E2	-2.661	0.00875	-0.085586	18	0.032167	no	BRNCTXB
chr1_1688328_C_T_b38	SLC35E2	-3.941	0.000135	-0.090175	14	0.02288	yes	BRNHPP
chr1_1679993_A_G_b38	SLC35E2	-3.389	0.000942	-0.071234	39	0.021022	yes	BRNHPP
chr1_1753033_C_T_b38	SLC35E2	-3.333	0.00113	-0.074184	38	0.022256	yes	BRNHPP
chr1_922660_C_A_b38	SLC35E2	3.27	0.00139	0.096673	3	0.029567	yes	BRNHPP
chr1_922671_C_T_b38	SLC35E2	3.27	0.00139	0.096673	3	0.029567	yes	BRNHPP
chr1_1934565_G_A_b38	SLC35E2	-3.241	0.00153	-0.078119	27	0.024102	yes	BRNHPP
chr1_1936077_C_T_b38	SLC35E2	-3.239	0.00154	-0.075613	30	0.023341	yes	BRNHPP
chr1_1742587_G_C_b38	SLC35E2	3.207	0.0017	0.068486	45	0.021352	yes	BRNHPP
chr1_1744854_C_A_b38	SLC35E2	-3.121	0.00225	-0.070403	22	0.022561	yes	BRNHPP
chr1_1688442_T_C_b38	SLC35E2	-3.094	0.00244	-0.080913	10	0.026155	yes	BRNHPP
chr1_1586962_C_T_b38	SLC35E2	3.072	0.00262	0.07919	17	0.02578	yes	BRNHPP
chr1_1942258_G_A_b38	SLC35E2	-3.056	0.00275	-0.074883	25	0.024505	yes	BRNHPP
chr1_1937841_ACACCAGGTCCACCTCTGGACACAGGTCCACC_A_b38	SLC35E2	-3.048	0.00281	-0.074229	26	0.024351	yes	BRNHPP
chr1_1938054_ACT_A_b38	SLC35E2	-3.048	0.00281	-0.074229	26	0.024351	yes	BRNHPP
chr1_1940540_G_A_b38	SLC35E2	-3.048	0.00281	-0.074229	26	0.024351	yes	BRNHPP
chr1_1940973_C_T_b38	SLC35E2	-3.048	0.00281	-0.074229	26	0.024351	yes	BRNHPP
chr1_1942014_G_A_b38	SLC35E2	-3.048	0.00281	-0.074229	26	0.024351	yes	BRNHPP
chr1_1942075_A_G_b38	SLC35E2	-3.048	0.00281	-0.074229	26	0.024351	yes	BRNHPP
chr1_1942086_T_C_b38	SLC35E2	-3.048	0.00281	-0.074229	26	0.024351	yes	BRNHPP
chr1_1942260_G_C_b38	SLC35E2	-3.048	0.00281	-0.074229	26	0.024351	yes	BRNHPP
chr1_1606384_A_G_b38	SLC35E2	3.041	0.00288	0.072911	18	0.023978	yes	BRNHPP
chr1_1936627_C_G_b38	SLC35E2	-3.04	0.00289	-0.074457	25	0.024496	yes	BRNHPP
chr1_1938332_A_ACT_b38	SLC35E2	-3.023	0.00304	-0.07392	26	0.024453	yes	BRNHPP
chr1_1926870_T_C_b38	SLC35E2	-3.022	0.00305	-0.072187	25	0.023889	yes	BRNHPP
chr1_1937273_T_C_b38	SLC35E2	-3.02	0.00307	-0.074144	25	0.024552	yes	BRNHPP
chr1_1933087_C_T_b38	SLC35E2	-3.007	0.0032	-0.073491	25	0.02444	yes	BRNHPP
chr1_1933859_A_G_b38	SLC35E2	-3.007	0.0032	-0.073491	25	0.02444	yes	BRNHPP
chr1_1680672_C_T_b38	SLC35E2	-2.995	0.00331	-0.066202	35	0.022103	yes	BRNHPP
chr1_1935938_T_C_b38	SLC35E2	-2.931	0.00403	-0.072899	21	0.024873	yes	BRNHPP
chr1_1398056_C_A_b38	SLC35E2	-2.912	0.00426	-0.066911	20	0.022977	yes	BRNHPP
chr1_1589495_CTTT_C_b38	SLC35E2	2.907	0.00432	0.080503	11	0.027693	yes	BRNHPP
chr1_1921745_T_C_b38	SLC35E2	-2.899	0.00442	-0.070257	26	0.024231	yes	BRNHPP
chr1_1922670_A_G_b38	SLC35E2	-2.894	0.0045	-0.069835	26	0.024132	yes	BRNHPP
chr1_1928648_C_T_b38	SLC35E2	-2.894	0.0045	-0.069835	26	0.024132	yes	BRNHPP
chr1_1916417_G_T_b38	SLC35E2	-2.874	0.00477	-0.068155	27	0.023716	yes	BRNHPP
chr1_1914634_G_T_b38	SLC35E2	-2.868	0.00486	-0.068056	27	0.02373	yes	BRNHPP
chr1_1916670_G_C_b38	SLC35E2	-2.868	0.00486	-0.068056	27	0.02373	yes	BRNHPP
chr1_1751981_A_T_b38	SLC35E2	-2.848	0.00514	-0.074732	14	0.026236	yes	BRNHPP
chr1_1676790_C_T_b38	SLC35E2	2.844	0.00521	0.059662	40	0.020979	yes	BRNHPP
chr1_1673818_A_C_b38	SLC35E2	2.834	0.00537	0.060371	41	0.021303	yes	BRNHPP
chr1_1931580_CA_C_b38	SLC35E2	-2.83	0.00543	-0.069474	25	0.024548	yes	BRNHPP
chr1_1931587_A_G_b38	SLC35E2	-2.83	0.00543	-0.069474	25	0.024548	yes	BRNHPP
chr1_1948121_T_G_b38	SLC35E2	2.826	0.00549	0.074654	11	0.026412	yes	BRNHPP
chr1_1671995_G_T_b38	SLC35E2	2.817	0.00565	0.059713	41	0.021199	yes	BRNHPP
chr1_1739131_T_C_b38	SLC35E2	2.812	0.00573	0.062806	36	0.022337	yes	BRNHPP
chr1_1752908_C_CCCT_b38	SLC35E2	-2.756	0.00673	-0.067165	26	0.024367	yes	BRNHPP
chr1_1918989_A_G_b38	SLC35E2	-2.739	0.00706	-0.06303	28	0.023008	yes	BRNHPP
chr1_1674720_TGC_T_b38	SLC35E2	2.714	0.00759	0.057293	40	0.021108	yes	BRNHPP
chr1_1674868_G_A_b38	SLC35E2	2.714	0.00759	0.057293	40	0.021108	yes	BRNHPP
chr1_1673060_G_A_b38	SLC35E2	2.702	0.00786	0.05741	41	0.021249	yes	BRNHPP
chr1_1755713_G_A_b38	SLC35E2	-2.661	0.00881	-0.060719	30	0.022814	yes	BRNHPP
chr1_1629332_G_T_b38	SLC35E2	2.635	0.00948	0.066807	16	0.025353	yes	BRNHPP
chr1_1686321_CTTT_C_b38	SLC35E2	-2.633	0.00955	-0.064867	13	0.024638	yes	BRNHPP
chr1_1648736_G_A_b38	SLC35E2	2.629	0.00964	0.067319	28	0.025604	yes	BRNHPP
chr1_1606559_C_CGGCTGGTCAGGCGTGGGGCGGGCTGGTCAGGCGTGGGGCG_b38	SLC35E2	-3.651	0.000384	-0.1876	3	0.051387	no	BRNHPP
chr1_1744052_GAGA_G_b38	SLC35E2	-3.57	0.000509	-0.090049	12	0.025224	no	BRNHPP
chr1_1688570_A_T_b38	SLC35E2	-3.485	0.000682	-0.095999	8	0.027548	no	BRNHPP
chr1_1597128_C_CCCTCAGCTGGACT_b38	SLC35E2	-3.474	0.000706	-0.076479	23	0.022013	no	BRNHPP
chr1_1594890_G_GAC_b38	SLC35E2	-3.464	0.00073	-0.079977	29	0.023085	no	BRNHPP
chr1_1593732_G_C_b38	SLC35E2	-3.45	0.000767	-0.078863	30	0.022859	no	BRNHPP
chr1_1968793_T_C_b38	SLC35E2	3.426	0.000831	0.077651	28	0.022664	no	BRNHPP
chr1_1963538_T_C_b38	SLC35E2	3.373	0.000991	0.07635	29	0.022633	no	BRNHPP
chr1_1967499_G_A_b38	SLC35E2	3.373	0.000991	0.07635	29	0.022633	no	BRNHPP
chr1_1688786_G_A_b38	SLC35E2	-3.306	0.00124	-0.092586	7	0.028004	no	BRNHPP
chr1_1744499_C_T_b38	SLC35E2	-3.292	0.0013	-0.071269	30	0.021652	no	BRNHPP
chr1_1963533_C_CA_b38	SLC35E2	3.216	0.00166	0.071843	30	0.022342	no	BRNHPP
chr1_914948_CA_C_b38	SLC35E2	3.151	0.00204	0.101946	3	0.032354	no	BRNHPP
chr1_1744028_A_AC_b38	SLC35E2	-3.137	0.00213	-0.082943	10	0.026441	no	BRNHPP
chr1_1688619_AAAC_A_b38	SLC35E2	-3.137	0.00213	-0.083966	10	0.026768	no	BRNHPP
chr1_1755504_T_C_b38	SLC35E2	3.132	0.00217	0.069808	41	0.022287	no	BRNHPP
chr1_1600379_C_T_b38	SLC35E2	3.114	0.00229	0.07477	16	0.024011	no	BRNHPP
chr1_1743851_C_T_b38	SLC35E2	-3.107	0.00234	-0.074891	14	0.024103	no	BRNHPP
chr1_2312125_G_A_b38	SLC35E2	-3.105	0.00236	-0.070769	35	0.02279	no	BRNHPP
chr1_1688647_G_A_b38	SLC35E2	-3.075	0.00259	-0.079001	13	0.025687	no	BRNHPP
chr1_1688531_T_C_b38	SLC35E2	-3.049	0.00281	-0.08471	9	0.027785	no	BRNHPP
chr1_1636278_G_T_b38	SLC35E2	3.027	0.00301	0.07954	25	0.02628	no	BRNHPP
chr1_1600320_C_G_b38	SLC35E2	2.988	0.00338	0.072317	16	0.024201	no	BRNHPP
chr1_1969238_C_T_b38	SLC35E2	2.979	0.00348	0.078779	9	0.026443	no	BRNHPP
chr1_1969249_A_AGCCCT_b38	SLC35E2	2.979	0.00348	0.078779	9	0.026443	no	BRNHPP
chr1_1595306_CAG_C_b38	SLC35E2	-2.957	0.00372	-0.072814	33	0.024623	no	BRNHPP
chr1_1743840_T_C_b38	SLC35E2	-2.94	0.00392	-0.072591	13	0.02469	no	BRNHPP
chr1_1688586_C_T_b38	SLC35E2	-2.873	0.00478	-0.078441	10	0.027302	no	BRNHPP
chr1_1969235_A_G_b38	SLC35E2	2.858	0.005	0.077072	9	0.026965	no	BRNHPP
chr1_1744096_C_T_b38	SLC35E2	-2.847	0.00517	-0.083426	17	0.029305	no	BRNHPP
chr1_1758323_T_C_b38	SLC35E2	2.809	0.00578	0.061294	33	0.021823	no	BRNHPP
chr1_1752461_G_A_b38	SLC35E2	-2.804	0.00587	-0.064378	33	0.022963	no	BRNHPP
chr1_1752730_C_G_b38	SLC35E2	-2.804	0.00587	-0.064378	33	0.022963	no	BRNHPP
chr1_1753319_G_A_b38	SLC35E2	-2.804	0.00587	-0.064378	33	0.022963	no	BRNHPP
chr1_1753361_G_A_b38	SLC35E2	-2.804	0.00587	-0.064378	33	0.022963	no	BRNHPP
chr1_1750440_G_A_b38	SLC35E2	-2.793	0.00605	-0.06851	24	0.024529	no	BRNHPP
chr1_1969229_T_A_b38	SLC35E2	2.786	0.00618	0.074195	9	0.026634	no	BRNHPP
chr1_828389_A_AT_b38	SLC35E2	2.782	0.00625	0.075433	14	0.027115	no	BRNHPP
chr1_923311_TG_T_b38	SLC35E2	-2.781	0.00626	-0.076734	6	0.027589	no	BRNHPP
chr1_923421_A_G_b38	SLC35E2	-2.781	0.00626	-0.076734	6	0.027589	no	BRNHPP
chr1_1607931_G_A_b38	SLC35E2	2.744	0.00697	0.066677	16	0.024297	no	BRNHPP
chr1_1609058_G_A_b38	SLC35E2	2.744	0.00697	0.066677	16	0.024297	no	BRNHPP
chr1_1756043_G_T_b38	SLC35E2	-2.742	0.00702	-0.062667	34	0.022858	no	BRNHPP
chr1_1595028_C_CAG_b38	SLC35E2	2.737	0.00711	0.070906	11	0.025906	no	BRNHPP
chr1_1688457_G_A_b38	SLC35E2	-2.724	0.00738	-0.0732	12	0.026873	no	BRNHPP
chr1_1968893_A_G_b38	SLC35E2	2.723	0.0074	0.076989	8	0.028274	no	BRNHPP
chr1_1754482_TCCCTGGGACCGAAGTCGCCCCA_T_b38	SLC35E2	-2.712	0.00763	-0.061639	33	0.022726	no	BRNHPP
chr1_1759354_G_A_b38	SLC35E2	-2.711	0.00766	-0.061818	34	0.022801	no	BRNHPP
chr1_1969015_A_G_b38	SLC35E2	2.694	0.00804	0.064474	31	0.023934	no	BRNHPP
chr1_1750428_G_C_b38	SLC35E2	-2.677	0.00844	-0.066028	24	0.024668	no	BRNHPP
chr1_988598_A_AG_b38	SLC35E2	2.665	0.00873	0.081426	7	0.030557	no	BRNHPP
chr1_1681928_C_A_b38	SLC35E2	-2.663	0.00876	-0.057384	30	0.021545	no	BRNHPP
chr1_1970506_T_A_b38	SLC35E2	-2.654	0.009	-0.058629	31	0.022092	no	BRNHPP
chr1_1686147_T_G_b38	SLC35E2	-2.651	0.00908	-0.058221	28	0.021964	no	BRNHPP
chr1_1687159_G_T_b38	SLC35E2	-2.648	0.00915	-0.057233	29	0.021615	no	BRNHPP
chr1_1759611_C_T_b38	SLC35E2	-2.645	0.00923	-0.059626	35	0.022544	no	BRNHPP
chr1_1687643_G_A_b38	SLC35E2	-2.642	0.00931	-0.055295	34	0.02093	no	BRNHPP
chr1_1750280_A_G_b38	SLC35E2	-2.634	0.00952	-0.060452	34	0.022953	no	BRNHPP
chr1_1684266_T_C_b38	SLC35E2	-2.631	0.00959	-0.057483	29	0.021846	no	BRNHPP
chr1_1684308_G_C_b38	SLC35E2	-2.631	0.00959	-0.057483	29	0.021846	no	BRNHPP
chr1_1684619_G_A_b38	SLC35E2	-2.631	0.00959	-0.057483	29	0.021846	no	BRNHPP
chr1_1755523_C_T_b38	SLC35E2	2.622	0.00983	0.057616	43	0.021971	no	BRNHPP
chr1_1650000_G_A_b38	SLC35E2	3.841	0.000191	0.097724	15	0.025441	yes	BRNHPT
chr1_2438059_T_C_b38	SLC35E2	3.074	0.00258	0.068834	35	0.02239	yes	BRNHPT
chr1_958061_C_CTT_b38	SLC35E2	-2.969	0.00356	-0.085933	7	0.02894	yes	BRNHPT
chr1_1591703_T_C_b38	SLC35E2	2.947	0.0038	0.06552	27	0.022229	yes	BRNHPT
chr1_2213543_G_T_b38	SLC35E2	2.893	0.00448	0.069872	16	0.02415	yes	BRNHPT
chr1_1898648_CACACACATAAGTTGGATAT_C_b38	SLC35E2	2.873	0.00476	0.071242	12	0.024801	yes	BRNHPT
chr1_2463629_A_C_b38	SLC35E2	2.871	0.00478	0.068421	26	0.023828	yes	BRNHPT
chr1_2467324_T_C_b38	SLC35E2	2.87	0.0048	0.069607	27	0.024255	yes	BRNHPT
chr1_1002415_C_CATTTTT_b38	SLC35E2	2.838	0.00527	0.065363	16	0.023028	yes	BRNHPT
chr1_2462787_T_G_b38	SLC35E2	2.832	0.00537	0.074282	11	0.026228	yes	BRNHPT
chr1_2466668_C_T_b38	SLC35E2	2.832	0.00537	0.074282	11	0.026228	yes	BRNHPT
chr1_2469095_C_T_b38	SLC35E2	2.814	0.00566	0.075817	10	0.026941	yes	BRNHPT
chr1_1725582_T_C_b38	SLC35E2	2.809	0.00574	0.051703	42	0.018404	yes	BRNHPT
chr1_1728604_T_A_b38	SLC35E2	2.794	0.00599	0.072225	11	0.025846	yes	BRNHPT
chr1_2465316_C_T_b38	SLC35E2	2.774	0.00637	0.066629	27	0.024022	yes	BRNHPT
chr1_2465880_G_A_b38	SLC35E2	2.774	0.00637	0.066629	27	0.024022	yes	BRNHPT
chr1_2466557_C_T_b38	SLC35E2	2.774	0.00637	0.066629	27	0.024022	yes	BRNHPT
chr1_2466937_A_G_b38	SLC35E2	2.774	0.00637	0.066629	27	0.024022	yes	BRNHPT
chr1_2468165_G_C_b38	SLC35E2	2.774	0.00637	0.066629	27	0.024022	yes	BRNHPT
chr1_2468175_A_G_b38	SLC35E2	2.774	0.00637	0.066629	27	0.024022	yes	BRNHPT
chr1_2464124_G_A_b38	SLC35E2	2.771	0.00641	0.072835	11	0.026285	yes	BRNHPT
chr1_2465735_G_A_b38	SLC35E2	2.771	0.00641	0.072835	11	0.026285	yes	BRNHPT
chr1_878367_G_A_b38	SLC35E2	2.759	0.00664	0.104238	3	0.037782	yes	BRNHPT
chr1_1742468_G_C_b38	SLC35E2	-2.729	0.00724	-0.058749	42	0.021526	yes	BRNHPT
chr1_1595028_C_CAG_b38	SLC35E2	2.729	0.00725	0.072336	11	0.02651	yes	BRNHPT
chr1_2465697_C_T_b38	SLC35E2	2.728	0.00725	0.073585	10	0.02697	yes	BRNHPT
chr1_2450690_G_A_b38	SLC35E2	2.689	0.00812	0.103357	3	0.038438	yes	BRNHPT
chr1_874906_G_A_b38	SLC35E2	-2.65	0.00905	-0.088461	6	0.033377	yes	BRNHPT
chr1_1913254_C_T_b38	SLC35E2	-2.617	0.00994	-0.063122	24	0.024123	yes	BRNHPT
chr1_1717604_CGCTTTCAGCTAGAGTTTGCTCTCTCTGGTTTTCGGTCTGTGACACACGCAT_C_b38	SLC35E2	3.634	0.000402	0.079883	24	0.021982	no	BRNHPT
chr1_1943487_C_G_b38	SLC35E2	3.545	0.000548	0.087381	15	0.024649	no	BRNHPT
chr1_1586962_C_T_b38	SLC35E2	3.274	0.00136	0.080766	17	0.024671	no	BRNHPT
chr1_2420707_C_T_b38	SLC35E2	3.223	0.00161	0.083263	9	0.025836	no	BRNHPT
chr1_2420440_C_T_b38	SLC35E2	3.209	0.00168	0.081863	10	0.025508	no	BRNHPT
chr1_2419962_TC_T_b38	SLC35E2	3.201	0.00172	0.089885	5	0.028081	no	BRNHPT
chr1_2417420_T_TTCCCAGCC_b38	SLC35E2	3.146	0.00206	0.080925	9	0.025723	no	BRNHPT
chr1_1688328_C_T_b38	SLC35E2	-3.146	0.00206	-0.075603	13	0.024032	no	BRNHPT
chr1_2416137_G_T_b38	SLC35E2	3.03	0.00296	0.078868	8	0.026029	no	BRNHPT
chr1_1773676_TTG_T_b38	SLC35E2	-3.029	0.00296	-0.108544	4	0.035833	no	BRNHPT
chr1_2459928_G_A_b38	SLC35E2	2.971	0.00354	0.080785	9	0.02719	no	BRNHPT
chr1_2441650_G_T_b38	SLC35E2	2.926	0.00406	0.074202	14	0.025357	no	BRNHPT
chr1_2416398_G_GCGACA_b38	SLC35E2	2.917	0.00417	0.075273	8	0.025803	no	BRNHPT
chr1_2467442_GCCTTCCTCA_G_b38	SLC35E2	2.906	0.00431	0.069172	27	0.023807	no	BRNHPT
chr1_853333_T_C_b38	SLC35E2	2.848	0.00513	0.096381	6	0.033846	no	BRNHPT
chr1_1971183_G_A_b38	SLC35E2	2.83	0.00539	0.07949	5	0.028085	no	BRNHPT
chr1_871922_A_AT_b38	SLC35E2	2.813	0.00567	0.080827	25	0.02873	no	BRNHPT
chr1_1729539_C_A_b38	SLC35E2	2.727	0.00728	0.071684	10	0.026287	no	BRNHPT
chr1_1650664_CTTTTT_C_b38	SLC35E2	-2.652	0.00901	-0.076137	7	0.028712	no	BRNHPT
chr1_1663038_T_C_b38	SLC35E2	2.65	0.00906	0.064579	30	0.024372	no	BRNHPT
chr1_1974351_A_G_b38	SLC35E2	2.627	0.00966	0.07216	6	0.027469	no	BRNHPT
chr1_1589418_T_TA_b38	SLC35E2	2.617	0.00992	0.067683	18	0.025859	no	BRNHPT
chr1_2442681_C_T_b38	SLC35E2	2.617	0.00994	0.070229	10	0.02684	no	BRNHPT
chr1_2444536_G_GT_b38	SLC35E2	2.617	0.00994	0.070229	10	0.02684	no	BRNHPT
chr1_839543_G_C_b38	SLC35E2	-3.362	0.000966	-0.076156	12	0.02265	yes	BRNNCC
chr1_815963_T_A_b38	SLC35E2	-3.156	0.00191	-0.093108	3	0.029506	yes	BRNNCC
chr1_1986752_A_G_b38	SLC35E2	2.959	0.00356	0.058877	31	0.019901	yes	BRNNCC
chr1_2416398_G_GCGACA_b38	SLC35E2	2.903	0.00421	0.063834	9	0.021986	yes	BRNNCC
chr1_1688328_C_T_b38	SLC35E2	-2.887	0.00442	-0.060253	13	0.020869	yes	BRNNCC
chr1_2427812_G_T_b38	SLC35E2	-2.871	0.00465	-0.075658	3	0.026355	yes	BRNNCC
chr1_2416137_G_T_b38	SLC35E2	2.855	0.00487	0.064577	7	0.022618	yes	BRNNCC
chr1_1948121_T_G_b38	SLC35E2	2.851	0.00492	0.060626	13	0.021262	yes	BRNNCC
chr1_828389_A_AT_b38	SLC35E2	2.842	0.00506	0.062493	21	0.021987	yes	BRNNCC
chr1_2463629_A_C_b38	SLC35E2	2.823	0.00535	0.055206	32	0.019554	yes	BRNNCC
chr1_2467324_T_C_b38	SLC35E2	2.797	0.00579	0.054572	33	0.019513	yes	BRNNCC
chr1_1987049_A_G_b38	SLC35E2	2.777	0.00613	0.054841	32	0.019745	yes	BRNNCC
chr1_2068241_G_A_b38	SLC35E2	-2.767	0.00633	-0.063043	7	0.022788	yes	BRNNCC
chr1_2469095_C_T_b38	SLC35E2	2.738	0.00687	0.059918	14	0.021881	yes	BRNNCC
chr1_2457996_G_A_b38	SLC35E2	2.726	0.00712	0.052417	30	0.019227	yes	BRNNCC
chr1_833758_CAT_C_b38	SLC35E2	-2.724	0.00717	-0.078058	3	0.02866	yes	BRNNCC
chr1_1671995_G_T_b38	SLC35E2	2.72	0.00725	0.046174	47	0.016976	yes	BRNNCC
chr1_827252_T_A_b38	SLC35E2	2.697	0.00773	0.076773	3	0.028463	yes	BRNNCC
chr1_1586987_G_A_b38	SLC35E2	-2.683	0.00806	-0.05311	24	0.019796	yes	BRNNCC
chr1_828389_AT_A_b38	SLC35E2	-2.676	0.00821	-0.076355	3	0.02853	yes	BRNNCC
chr1_839480_CACACACCTGGACAA_C_b38	SLC35E2	2.667	0.00842	0.058478	15	0.021923	yes	BRNNCC
chr1_2417420_T_TTCCCAGCC_b38	SLC35E2	2.658	0.00866	0.059432	8	0.022362	yes	BRNNCC
chr1_826893_G_A_b38	SLC35E2	2.655	0.00872	0.073761	4	0.027779	yes	BRNNCC
chr1_2465316_C_T_b38	SLC35E2	2.634	0.00925	0.051188	33	0.01943	yes	BRNNCC
chr1_2465880_G_A_b38	SLC35E2	2.634	0.00925	0.051188	33	0.01943	yes	BRNNCC
chr1_2466557_C_T_b38	SLC35E2	2.634	0.00925	0.051188	33	0.01943	yes	BRNNCC
chr1_2466937_A_G_b38	SLC35E2	2.634	0.00925	0.051188	33	0.01943	yes	BRNNCC
chr1_2468165_G_C_b38	SLC35E2	2.634	0.00925	0.051188	33	0.01943	yes	BRNNCC
chr1_2468175_A_G_b38	SLC35E2	2.634	0.00925	0.051188	33	0.01943	yes	BRNNCC
chr1_1987145_C_T_b38	SLC35E2	2.629	0.00939	0.055287	17	0.021028	yes	BRNNCC
chr1_1591703_T_C_b38	SLC35E2	2.618	0.0097	0.046406	34	0.017729	yes	BRNNCC
chr1_818161_G_A_b38	SLC35E2	-2.617	0.00972	-0.071495	6	0.027323	yes	BRNNCC
chr1_2415043_T_C_b38	SLC35E2	4.064	7.53e-05	0.112177	3	0.027604	no	BRNNCC
chr1_2415084_G_C_b38	SLC35E2	3.344	0.00103	0.068851	11	0.02059	no	BRNNCC
chr1_2415085_T_C_b38	SLC35E2	3.344	0.00103	0.068851	11	0.02059	no	BRNNCC
chr1_1606559_C_CGGCTGGTCAGGCGTGGGGCGGGCTGGTCAGGCGTGGGGCG_b38	SLC35E2	-3.291	0.00123	-0.131791	3	0.040046	no	BRNNCC
chr1_1969015_A_G_b38	SLC35E2	3.121	0.00213	0.061989	36	0.019859	no	BRNNCC
chr1_1279441_C_T_b38	SLC35E2	2.967	0.00346	0.098515	3	0.033201	no	BRNNCC
chr1_853333_T_C_b38	SLC35E2	2.928	0.0039	0.080773	9	0.027584	no	BRNNCC
chr1_2245578_C_T_b38	SLC35E2	-2.844	0.00503	-0.080055	4	0.028147	no	BRNNCC
chr1_1967499_G_A_b38	SLC35E2	2.778	0.00613	0.051697	40	0.018612	no	BRNNCC
chr1_1751981_A_T_b38	SLC35E2	-2.773	0.0062	-0.058201	17	0.020985	no	BRNNCC
chr1_749482_G_A_b38	SLC35E2	2.764	0.00637	0.109715	8	0.039691	no	BRNNCC
chr1_1968793_T_C_b38	SLC35E2	2.757	0.00651	0.051478	39	0.018673	no	BRNNCC
chr1_1969006_C_T_b38	SLC35E2	2.74	0.00684	0.05937	13	0.021668	no	BRNNCC
chr1_2462787_T_G_b38	SLC35E2	2.732	0.007	0.058581	15	0.021445	no	BRNNCC
chr1_1963538_T_C_b38	SLC35E2	2.723	0.00718	0.050885	40	0.018688	no	BRNNCC
chr1_1673968_GA_G_b38	SLC35E2	2.722	0.00721	0.055458	19	0.020374	no	BRNNCC
chr1_2377643_T_G_b38	SLC35E2	2.698	0.00771	0.049476	42	0.018337	no	BRNNCC
chr1_1968900_A_G_b38	SLC35E2	2.69	0.0079	0.058699	13	0.021823	no	BRNNCC
chr1_1115166_G_GT_b38	SLC35E2	-2.686	0.00799	-0.11398	6	0.042435	no	BRNNCC
chr1_1116992_A_G_b38	SLC35E2	-2.686	0.00799	-0.11398	6	0.042435	no	BRNNCC
chr1_1968924_GCCCTCCTGGGGGCTCCGGTCCTGCCCAGCAGCCCCAGGTGAGACAGCGCCTGGCGGCCCCTCCCTAGCT_G_b38	SLC35E2	2.676	0.00823	0.058133	13	0.021727	no	BRNNCC
chr1_1968893_A_G_b38	SLC35E2	2.657	0.00867	0.059248	10	0.022297	no	BRNNCC
chr1_1725582_T_C_b38	SLC35E2	2.632	0.00931	0.044215	47	0.016798	no	BRNNCC
chr1_1684789_C_CAAA_b38	SLC35E2	-2.625	0.0095	-0.082149	7	0.031294	no	BRNNCC
chr1_1968012_GTGAA_G_b38	SLC35E2	2.625	0.0095	0.058359	12	0.022232	no	BRNNCC
chr1_1987145_C_T_b38	SLC35E2	3.465	0.00072	0.073597	16	0.021239	yes	BRNPTM
chr1_1977879_G_A_b38	SLC35E2	3.41	0.000867	0.073479	15	0.021546	yes	BRNPTM
chr1_1981062_A_G_b38	SLC35E2	3.409	0.000871	0.073162	16	0.021462	yes	BRNPTM
chr1_1981291_A_G_b38	SLC35E2	3.409	0.000871	0.073162	16	0.021462	yes	BRNPTM
chr1_1981295_T_C_b38	SLC35E2	3.409	0.000871	0.073162	16	0.021462	yes	BRNPTM
chr1_1980953_G_A_b38	SLC35E2	3.342	0.00109	0.07186	15	0.0215	yes	BRNPTM
chr1_1972273_C_A_b38	SLC35E2	3.258	0.00143	0.070912	15	0.021765	yes	BRNPTM
chr1_1976473_C_T_b38	SLC35E2	3.258	0.00143	0.070912	15	0.021765	yes	BRNPTM
chr1_1976573_T_C_b38	SLC35E2	3.258	0.00143	0.070912	15	0.021765	yes	BRNPTM
chr1_1976600_C_T_b38	SLC35E2	3.258	0.00143	0.070912	15	0.021765	yes	BRNPTM
chr1_1976646_A_G_b38	SLC35E2	3.258	0.00143	0.070912	15	0.021765	yes	BRNPTM
chr1_1976661_G_T_b38	SLC35E2	3.258	0.00143	0.070912	15	0.021765	yes	BRNPTM
chr1_1976946_C_T_b38	SLC35E2	3.258	0.00143	0.070912	15	0.021765	yes	BRNPTM
chr1_1977264_C_G_b38	SLC35E2	3.258	0.00143	0.070912	15	0.021765	yes	BRNPTM
chr1_1977765_A_G_b38	SLC35E2	3.258	0.00143	0.070912	15	0.021765	yes	BRNPTM
chr1_1978006_A_G_b38	SLC35E2	3.258	0.00143	0.070912	15	0.021765	yes	BRNPTM
chr1_1978262_C_T_b38	SLC35E2	3.258	0.00143	0.070912	15	0.021765	yes	BRNPTM
chr1_1978294_G_T_b38	SLC35E2	3.258	0.00143	0.070912	15	0.021765	yes	BRNPTM
chr1_1978404_C_T_b38	SLC35E2	3.258	0.00143	0.070912	15	0.021765	yes	BRNPTM
chr1_1978415_G_A_b38	SLC35E2	3.258	0.00143	0.070912	15	0.021765	yes	BRNPTM
chr1_1978562_C_G_b38	SLC35E2	3.258	0.00143	0.070912	15	0.021765	yes	BRNPTM
chr1_1978573_T_C_b38	SLC35E2	3.258	0.00143	0.070912	15	0.021765	yes	BRNPTM
chr1_1978647_G_T_b38	SLC35E2	3.258	0.00143	0.070912	15	0.021765	yes	BRNPTM
chr1_1978797_T_C_b38	SLC35E2	3.258	0.00143	0.070912	15	0.021765	yes	BRNPTM
chr1_1981319_G_C_b38	SLC35E2	3.258	0.00143	0.070912	15	0.021765	yes	BRNPTM
chr1_1982826_T_C_b38	SLC35E2	3.258	0.00143	0.070912	15	0.021765	yes	BRNPTM
chr1_1983166_A_T_b38	SLC35E2	3.258	0.00143	0.070912	15	0.021765	yes	BRNPTM
chr1_1983956_TGG_T_b38	SLC35E2	3.258	0.00143	0.070912	15	0.021765	yes	BRNPTM
chr1_1984586_G_A_b38	SLC35E2	3.258	0.00143	0.070912	15	0.021765	yes	BRNPTM
chr1_1984595_C_T_b38	SLC35E2	3.258	0.00143	0.070912	15	0.021765	yes	BRNPTM
chr1_1984859_C_T_b38	SLC35E2	3.258	0.00143	0.070912	15	0.021765	yes	BRNPTM
chr1_1985148_G_T_b38	SLC35E2	3.258	0.00143	0.070912	15	0.021765	yes	BRNPTM
chr1_1986010_T_G_b38	SLC35E2	3.258	0.00143	0.070912	15	0.021765	yes	BRNPTM
chr1_1986033_G_A_b38	SLC35E2	3.258	0.00143	0.070912	15	0.021765	yes	BRNPTM
chr1_1986176_A_T_b38	SLC35E2	3.258	0.00143	0.070912	15	0.021765	yes	BRNPTM
chr1_1986211_T_C_b38	SLC35E2	3.258	0.00143	0.070912	15	0.021765	yes	BRNPTM
chr1_1986390_T_G_b38	SLC35E2	3.258	0.00143	0.070912	15	0.021765	yes	BRNPTM
chr1_1986469_A_C_b38	SLC35E2	3.258	0.00143	0.070912	15	0.021765	yes	BRNPTM
chr1_1987096_A_T_b38	SLC35E2	3.258	0.00143	0.070912	15	0.021765	yes	BRNPTM
chr1_1987156_G_A_b38	SLC35E2	3.258	0.00143	0.070912	15	0.021765	yes	BRNPTM
chr1_1636278_G_T_b38	SLC35E2	3.249	0.00148	0.064257	25	0.019778	yes	BRNPTM
chr1_1985090_C_T_b38	SLC35E2	3.242	0.00151	0.070438	22	0.021727	yes	BRNPTM
chr1_1985451_C_T_b38	SLC35E2	3.242	0.00151	0.070438	22	0.021727	yes	BRNPTM
chr1_1976990_T_C_b38	SLC35E2	3.191	0.00178	0.070021	15	0.021945	yes	BRNPTM
chr1_1984601_T_C_b38	SLC35E2	3.191	0.00178	0.070021	15	0.021945	yes	BRNPTM
chr1_1983048_A_G_b38	SLC35E2	3.168	0.00192	0.069258	23	0.021865	yes	BRNPTM
chr1_1648736_G_A_b38	SLC35E2	3.13	0.00216	0.060378	29	0.019289	yes	BRNPTM
chr1_1637577_T_C_b38	SLC35E2	-3.127	0.00218	-0.064871	12	0.020746	yes	BRNPTM
chr1_2416137_G_T_b38	SLC35E2	3.023	0.00302	0.067705	7	0.022395	yes	BRNPTM
chr1_914948_CA_C_b38	SLC35E2	3.004	0.0032	0.079688	4	0.026523	yes	BRNPTM
chr1_915824_G_C_b38	SLC35E2	2.979	0.00346	0.066964	8	0.022478	yes	BRNPTM
chr1_1650664_CTTTTT_C_b38	SLC35E2	-2.941	0.00388	-0.06351	9	0.021597	yes	BRNPTM
chr1_1651653_C_T_b38	SLC35E2	2.935	0.00395	0.055854	35	0.019028	yes	BRNPTM
chr1_924305_G_A_b38	SLC35E2	2.893	0.00448	0.061743	12	0.021341	yes	BRNPTM
chr1_2689999_C_T_b38	SLC35E2	-2.884	0.0046	-0.076679	3	0.026588	yes	BRNPTM
chr1_1978055_C_T_b38	SLC35E2	2.877	0.0047	0.061602	16	0.02141	yes	BRNPTM
chr1_1649932_C_T_b38	SLC35E2	2.866	0.00485	0.054807	32	0.019121	yes	BRNPTM
chr1_1979456_T_C_b38	SLC35E2	2.866	0.00485	0.068729	7	0.023979	yes	BRNPTM
chr1_1979465_A_G_b38	SLC35E2	2.857	0.00499	0.067738	7	0.023709	yes	BRNPTM
chr1_1981144_T_G_b38	SLC35E2	2.799	0.00592	0.062219	12	0.022232	yes	BRNPTM
chr1_828389_A_AT_b38	SLC35E2	2.793	0.00601	0.063968	14	0.0229	yes	BRNPTM
chr1_1650195_A_G_b38	SLC35E2	-2.778	0.00628	-0.054568	18	0.019641	yes	BRNPTM
chr1_1649976_G_A_b38	SLC35E2	2.773	0.00637	0.05459	25	0.019685	yes	BRNPTM
chr1_1654662_CT_C_b38	SLC35E2	2.767	0.0065	0.058846	25	0.02127	yes	BRNPTM
chr1_1976855_C_CTT_b38	SLC35E2	2.762	0.00659	0.065137	8	0.023585	yes	BRNPTM
chr1_2416398_G_GCGACA_b38	SLC35E2	2.759	0.00665	0.060682	9	0.021997	yes	BRNPTM
chr1_2433984_T_TC_b38	SLC35E2	-2.735	0.00711	-0.049954	32	0.018262	yes	BRNPTM
chr1_2372759_GACC_G_b38	SLC35E2	2.721	0.00741	0.048765	24	0.017921	yes	BRNPTM
chr1_2372762_C_CTG_b38	SLC35E2	2.721	0.00741	0.048765	24	0.017921	yes	BRNPTM
chr1_973443_G_A_b38	SLC35E2	2.717	0.00748	0.065569	6	0.02413	yes	BRNPTM
chr1_2295727_A_G_b38	SLC35E2	-2.69	0.00808	-0.051645	25	0.019195	yes	BRNPTM
chr1_1398056_C_A_b38	SLC35E2	-2.673	0.00848	-0.051018	20	0.019084	yes	BRNPTM
chr1_1670423_AT_A_b38	SLC35E2	2.672	0.00851	0.056728	15	0.021229	yes	BRNPTM
chr1_1639685_G_A_b38	SLC35E2	-2.664	0.0087	-0.062884	9	0.023601	yes	BRNPTM
chr1_1639348_G_T_b38	SLC35E2	-2.645	0.00919	-0.051502	19	0.019475	yes	BRNPTM
chr1_2420440_C_T_b38	SLC35E2	2.642	0.00925	0.05788	9	0.021904	yes	BRNPTM
chr1_914483_G_GACTGCCCAGCTC_b38	SLC35E2	2.638	0.00936	0.063364	6	0.024018	yes	BRNPTM
chr1_1606094_G_GAGGGGTC_b38	SLC35E2	2.615	0.00999	0.065482	7	0.025044	yes	BRNPTM
chr1_1650000_G_A_b38	SLC35E2	3.666	0.000359	0.072781	18	0.019853	no	BRNPTM
chr1_1978114_T_A_b38	SLC35E2	3.21	0.00168	0.068638	16	0.021383	no	BRNPTM
chr1_922660_C_A_b38	SLC35E2	3.203	0.00171	0.078783	3	0.024594	no	BRNPTM
chr1_922671_C_T_b38	SLC35E2	3.203	0.00171	0.078783	3	0.024594	no	BRNPTM
chr1_925308_G_A_b38	SLC35E2	-3.021	0.00304	-0.067039	10	0.022188	no	BRNPTM
chr1_1522693_A_G_b38	SLC35E2	3.014	0.0031	0.071578	6	0.023748	no	BRNPTM
chr1_1423775_C_CT_b38	SLC35E2	2.99	0.00335	0.088387	5	0.029565	no	BRNPTM
chr1_923421_A_G_b38	SLC35E2	-2.964	0.00362	-0.067953	8	0.022927	no	BRNPTM
chr1_2417420_T_TTCCCAGCC_b38	SLC35E2	2.963	0.00363	0.065518	8	0.022111	no	BRNPTM
chr1_923311_TG_T_b38	SLC35E2	-2.951	0.00376	-0.06819	8	0.023107	no	BRNPTM
chr1_925036_G_A_b38	SLC35E2	-2.951	0.00376	-0.06819	8	0.023107	no	BRNPTM
chr1_926250_G_A_b38	SLC35E2	-2.951	0.00376	-0.06819	8	0.023107	no	BRNPTM
chr1_1773676_TTG_T_b38	SLC35E2	-2.934	0.00396	-0.087764	4	0.029915	no	BRNPTM
chr1_1985619_A_G_b38	SLC35E2	2.88	0.00466	0.06311	20	0.021915	no	BRNPTM
chr1_1482316_C_G_b38	SLC35E2	-2.868	0.00482	-0.057457	14	0.020031	no	BRNPTM
chr1_1983989_A_AT_b38	SLC35E2	2.863	0.0049	0.067771	9	0.023669	no	BRNPTM
chr1_1658422_T_C_b38	SLC35E2	2.833	0.00536	0.067016	5	0.023658	no	BRNPTM
chr1_2377643_T_G_b38	SLC35E2	2.819	0.00557	0.050981	36	0.018082	no	BRNPTM
chr1_1606099_G_GGTCAGGCGAGGGGTC_b38	SLC35E2	2.816	0.00562	0.065222	9	0.023158	no	BRNPTM
chr1_1324139_GGGGGCTGGGGGGCTGAGGGGCTGGGGGGCTGA_G_b38	SLC35E2	2.779	0.00626	0.111965	3	0.040285	no	BRNPTM
chr1_932255_C_T_b38	SLC35E2	2.771	0.00642	0.065491	5	0.023636	no	BRNPTM
chr1_909894_G_T_b38	SLC35E2	2.77	0.00644	0.066338	8	0.023951	no	BRNPTM
chr1_1586962_C_T_b38	SLC35E2	2.746	0.0069	0.056632	17	0.020626	no	BRNPTM
chr1_1864334_AAAG_A_b38	SLC35E2	-2.738	0.00706	-0.064229	9	0.023462	no	BRNPTM
chr1_1713469_C_T_b38	SLC35E2	-2.731	0.00719	-0.085704	4	0.03138	no	BRNPTM
chr1_1943487_C_G_b38	SLC35E2	2.722	0.00739	0.059296	8	0.021786	no	BRNPTM
chr1_2676849_C_A_b38	SLC35E2	-2.714	0.00756	-0.067784	9	0.024978	no	BRNPTM
chr1_1979469_AAC_A_b38	SLC35E2	2.686	0.00818	0.06433	7	0.023948	no	BRNPTM
chr1_2420707_C_T_b38	SLC35E2	2.68	0.00832	0.059956	8	0.022371	no	BRNPTM
chr1_928622_G_C_b38	SLC35E2	2.671	0.00855	0.064105	4	0.024004	no	BRNPTM
chr1_927486_C_T_b38	SLC35E2	-2.657	0.00889	-0.061817	8	0.023268	no	BRNPTM
chr1_929839_G_A_b38	SLC35E2	2.651	0.00903	0.06256	5	0.023598	no	BRNPTM
chr1_2419962_TC_T_b38	SLC35E2	2.646	0.00916	0.061177	6	0.023121	no	BRNPTM
chr1_2340425_C_T_b38	SLC35E2	-2.639	0.00934	-0.045955	45	0.017415	no	BRNPTM
chr1_1284756_A_G_b38	SLC35E2	-2.619	0.00987	-0.111809	8	0.042689	no	BRNPTM
chr1_1285574_G_A_b38	SLC35E2	-2.619	0.00987	-0.111809	8	0.042689	no	BRNPTM
chr1_1976870_C_CAG_b38	SLC35E2	2.615	0.00999	0.055114	15	0.021077	no	BRNPTM
chr1_2375533_G_A_b38	SLC35E2	3.689	0.000367	0.090573	19	0.024555	yes	BRNSPC
chr1_2372759_GACC_G_b38	SLC35E2	3.533	0.000624	0.087467	19	0.024757	yes	BRNSPC
chr1_2372762_C_CTG_b38	SLC35E2	3.533	0.000624	0.087467	19	0.024757	yes	BRNSPC
chr1_2371472_G_A_b38	SLC35E2	3.277	0.00145	0.102331	7	0.031231	yes	BRNSPC
chr1_2389131_A_AAAG_b38	SLC35E2	2.842	0.00543	0.063129	32	0.022212	yes	BRNSPC
chr1_2420954_C_CTT_b38	SLC35E2	-2.733	0.00743	-0.083957	11	0.030722	yes	BRNSPC
chr1_2348720_G_GGCACGCACACACAC_b38	SLC35E2	2.669	0.00888	0.067766	16	0.025391	yes	BRNSPC
chr1_2383024_G_T_b38	SLC35E2	4.101	8.4e-05	0.097142	21	0.023689	no	BRNSPC
chr1_2383716_CA_C_b38	SLC35E2	4.101	8.4e-05	0.097142	21	0.023689	no	BRNSPC
chr1_2392897_T_C_b38	SLC35E2	3.922	0.000161	0.093581	20	0.023859	no	BRNSPC
chr1_2383824_C_G_b38	SLC35E2	3.922	0.000161	0.092131	23	0.02349	no	BRNSPC
chr1_2385630_A_C_b38	SLC35E2	3.486	0.00073	0.085808	18	0.024615	no	BRNSPC
chr1_2424713_C_A_b38	SLC35E2	3.263	0.00151	0.116622	3	0.035737	no	BRNSPC
chr1_1736832_GAAAA_G_b38	SLC35E2	3.01	0.00331	0.078883	17	0.026207	no	BRNSPC
chr1_2374713_C_T_b38	SLC35E2	2.999	0.00342	0.074723	20	0.024914	no	BRNSPC
chr1_2375256_C_T_b38	SLC35E2	2.999	0.00342	0.074723	20	0.024914	no	BRNSPC
chr1_2430581_G_T_b38	SLC35E2	2.987	0.00354	0.085087	12	0.028486	no	BRNSPC
chr1_2005908_CTCTCTCTCTCTCTCTCTCGT_C_b38	SLC35E2	2.814	0.00589	0.089468	19	0.031791	no	BRNSPC
chr1_1776772_TAA_T_b38	SLC35E2	2.813	0.0059	0.09741	7	0.034625	no	BRNSPC
chr1_1931743_CA_C_b38	SLC35E2	2.782	0.00646	0.096351	9	0.034635	no	BRNSPC
chr1_2025598_T_C_b38	SLC35E2	2.773	0.00662	0.072337	20	0.026083	no	BRNSPC
chr1_1738207_ACT_A_b38	SLC35E2	2.773	0.00663	0.076658	15	0.027649	no	BRNSPC
chr1_2425690_G_GT_b38	SLC35E2	2.752	0.00703	0.088728	6	0.032241	no	BRNSPC
chr1_2395479_G_A_b38	SLC35E2	2.75	0.00708	0.079988	8	0.02909	no	BRNSPC
chr1_2395636_C_T_b38	SLC35E2	2.75	0.00708	0.079988	8	0.02909	no	BRNSPC
chr1_2383975_C_T_b38	SLC35E2	2.733	0.00742	0.075188	13	0.027512	no	BRNSPC
chr1_2392128_T_C_b38	SLC35E2	2.728	0.00753	0.063023	36	0.023101	no	BRNSPC
chr1_2409065_C_T_b38	SLC35E2	2.726	0.00757	0.077717	10	0.028508	no	BRNSPC
chr1_2427409_G_C_b38	SLC35E2	2.725	0.00759	0.095292	4	0.034967	no	BRNSPC
chr1_2428501_C_T_b38	SLC35E2	2.725	0.00759	0.095292	4	0.034967	no	BRNSPC
chr1_2404530_C_G_b38	SLC35E2	2.703	0.00807	0.077209	9	0.028561	no	BRNSPC
chr1_2405593_C_T_b38	SLC35E2	2.703	0.00807	0.077209	9	0.028561	no	BRNSPC
chr1_2431388_C_T_b38	SLC35E2	2.691	0.00836	0.078541	10	0.02919	no	BRNSPC
chr1_2387989_A_G_b38	SLC35E2	2.675	0.00874	0.063786	37	0.02385	no	BRNSPC
chr1_2005948_A_C_b38	SLC35E2	-2.658	0.00915	-0.093038	4	0.035001	no	BRNSPC
chr1_2384876_A_G_b38	SLC35E2	2.657	0.00917	0.062281	40	0.023437	no	BRNSPC
chr1_2295983_C_T_b38	SLC35E2	2.654	0.00925	0.07758	11	0.029231	no	BRNSPC
chr1_2426634_C_T_b38	SLC35E2	2.634	0.00978	0.062562	34	0.023752	no	BRNSPC
chr1_1712515_T_A_b38	SLC35E2	2.629	0.00991	0.092967	5	0.035362	no	BRNSPC
chr1_2466668_C_T_b38	SLC35E2	4.744	8.03e-06	0.116791	8	0.024618	yes	BRNSNG
chr1_2462787_T_G_b38	SLC35E2	4.627	1.27e-05	0.114093	8	0.024658	yes	BRNSNG
chr1_2469095_C_T_b38	SLC35E2	4.519	1.92e-05	0.118188	7	0.026151	yes	BRNSNG
chr1_2464124_G_A_b38	SLC35E2	4.458	2.43e-05	0.111033	8	0.024904	yes	BRNSNG
chr1_2465735_G_A_b38	SLC35E2	4.458	2.43e-05	0.111033	8	0.024904	yes	BRNSNG
chr1_2459928_G_A_b38	SLC35E2	4.228	5.74e-05	0.109179	6	0.025821	yes	BRNSNG
chr1_2465697_C_T_b38	SLC35E2	4.209	6.17e-05	0.110818	7	0.02633	yes	BRNSNG
chr1_2467324_T_C_b38	SLC35E2	4.098	9.24e-05	0.094535	16	0.023067	yes	BRNSNG
chr1_2465316_C_T_b38	SLC35E2	4.096	9.32e-05	0.093443	16	0.022813	yes	BRNSNG
chr1_2465880_G_A_b38	SLC35E2	4.096	9.32e-05	0.093443	16	0.022813	yes	BRNSNG
chr1_2466557_C_T_b38	SLC35E2	4.096	9.32e-05	0.093443	16	0.022813	yes	BRNSNG
chr1_2466937_A_G_b38	SLC35E2	4.096	9.32e-05	0.093443	16	0.022813	yes	BRNSNG
chr1_2468165_G_C_b38	SLC35E2	4.096	9.32e-05	0.093443	16	0.022813	yes	BRNSNG
chr1_2468175_A_G_b38	SLC35E2	4.096	9.32e-05	0.093443	16	0.022813	yes	BRNSNG
chr1_2463629_A_C_b38	SLC35E2	4.035	0.000116	0.091853	17	0.022765	yes	BRNSNG
chr1_2460052_G_A_b38	SLC35E2	4.008	0.000128	0.102095	8	0.025476	yes	BRNSNG
chr1_2440882_C_T_b38	SLC35E2	3.937	0.000165	0.091509	13	0.023243	yes	BRNSNG
chr1_2441650_G_T_b38	SLC35E2	3.834	0.000236	0.096087	10	0.02506	yes	BRNSNG
chr1_2471060_G_A_b38	SLC35E2	3.834	0.000237	0.086307	30	0.022513	yes	BRNSNG
chr1_1845824_TACACAC_T_b38	SLC35E2	3.811	0.000256	0.106559	4	0.02796	yes	BRNSNG
chr1_2438059_T_C_b38	SLC35E2	3.644	0.000454	0.080854	21	0.022191	yes	BRNSNG
chr1_2442681_C_T_b38	SLC35E2	3.595	0.000535	0.093754	8	0.026081	yes	BRNSNG
chr1_2444536_G_GT_b38	SLC35E2	3.595	0.000535	0.093754	8	0.026081	yes	BRNSNG
chr1_2457996_G_A_b38	SLC35E2	3.568	0.000586	0.082277	15	0.023062	yes	BRNSNG
chr1_2469925_T_G_b38	SLC35E2	3.529	0.000666	0.086593	16	0.024539	yes	BRNSNG
chr1_2437267_T_C_b38	SLC35E2	3.474	0.000798	0.091173	12	0.026245	yes	BRNSNG
chr1_2455830_G_A_b38	SLC35E2	3.462	0.000831	0.091719	8	0.026497	yes	BRNSNG
chr1_2458892_G_A_b38	SLC35E2	3.432	0.000914	0.091673	7	0.026709	yes	BRNSNG
chr1_2467710_A_G_b38	SLC35E2	3.37	0.00112	0.082231	28	0.024404	yes	BRNSNG
chr1_2457713_G_A_b38	SLC35E2	3.353	0.00118	0.086854	8	0.025902	yes	BRNSNG
chr1_2452317_A_G_b38	SLC35E2	3.35	0.00119	0.077441	17	0.023119	yes	BRNSNG
chr1_2450542_C_T_b38	SLC35E2	3.158	0.00217	0.085346	7	0.027023	yes	BRNSNG
chr1_2436289_T_A_b38	SLC35E2	3.107	0.00255	0.124544	3	0.040087	yes	BRNSNG
chr1_2461209_G_C_b38	SLC35E2	3.097	0.00262	0.076325	28	0.024642	yes	BRNSNG
chr1_2464099_G_C_b38	SLC35E2	3.033	0.00318	0.07333	29	0.024179	yes	BRNSNG
chr1_1904424_A_AAAATAAATAAAT_b38	SLC35E2	3.01	0.0034	0.063158	24	0.020979	yes	BRNSNG
chr1_1752126_G_A_b38	SLC35E2	3	0.00351	0.079227	13	0.026412	yes	BRNSNG
chr1_2461871_C_CA_b38	SLC35E2	2.992	0.0036	0.069669	30	0.023287	yes	BRNSNG
chr1_2462635_T_C_b38	SLC35E2	2.992	0.0036	0.069669	30	0.023287	yes	BRNSNG
chr1_2467442_GCCTTCCTCA_G_b38	SLC35E2	2.984	0.00368	0.071294	15	0.023891	yes	BRNSNG
chr1_2459813_A_C_b38	SLC35E2	2.902	0.00469	0.068039	28	0.023446	yes	BRNSNG
chr1_2459619_TGTGGTCCTCCTTGCCTGTGGTCTTCCTTTCCG_T_b38	SLC35E2	-2.89	0.00485	-0.068385	25	0.02366	yes	BRNSNG
chr1_2455662_C_T_b38	SLC35E2	2.86	0.00529	0.067454	25	0.023588	yes	BRNSNG
chr1_749482_G_A_b38	SLC35E2	2.795	0.00636	0.131928	6	0.047196	yes	BRNSNG
chr1_2453797_T_C_b38	SLC35E2	2.787	0.00651	0.065928	28	0.023654	yes	BRNSNG
chr1_2459276_C_G_b38	SLC35E2	2.766	0.00692	0.063271	31	0.022876	yes	BRNSNG
chr1_2450129_A_G_b38	SLC35E2	2.76	0.00703	0.065081	29	0.023577	yes	BRNSNG
chr1_2363827_A_T_b38	SLC35E2	-2.757	0.00709	-0.094919	6	0.034424	yes	BRNSNG
chr1_2448266_A_G_b38	SLC35E2	2.736	0.00751	0.065022	29	0.023762	yes	BRNSNG
chr1_1747695_A_G_b38	SLC35E2	-2.709	0.00812	-0.057576	21	0.021257	yes	BRNSNG
chr1_2440958_A_G_b38	SLC35E2	2.655	0.00941	0.063753	29	0.02401	yes	BRNSNG
chr1_2441515_A_G_b38	SLC35E2	2.655	0.00941	0.063753	29	0.02401	yes	BRNSNG
chr1_2441729_A_G_b38	SLC35E2	2.655	0.00941	0.063753	29	0.02401	yes	BRNSNG
chr1_2443319_A_G_b38	SLC35E2	2.655	0.00941	0.063753	29	0.02401	yes	BRNSNG
chr1_2451600_A_G_b38	SLC35E2	2.649	0.00958	0.063402	28	0.023938	yes	BRNSNG
chr1_2452669_T_C_b38	SLC35E2	2.649	0.00958	0.063402	28	0.023938	yes	BRNSNG
chr1_2043528_G_A_b38	SLC35E2	-2.644	0.0097	-0.110416	3	0.041758	yes	BRNSNG
chr1_2437336_T_C_b38	SLC35E2	4.096	9.33e-05	0.086213	25	0.021049	no	BRNSNG
chr1_2450100_C_T_b38	SLC35E2	3.584	0.000554	0.090885	9	0.025358	no	BRNSNG
chr1_2447809_G_A_b38	SLC35E2	3.396	0.00103	0.089163	8	0.026252	no	BRNSNG
chr1_1846651_T_G_b38	SLC35E2	3.222	0.00178	0.097056	3	0.030122	no	BRNSNG
chr1_1775996_G_A_b38	SLC35E2	3.011	0.0034	0.090857	3	0.030172	no	BRNSNG
chr1_1782906_T_G_b38	SLC35E2	3.011	0.0034	0.090857	3	0.030172	no	BRNSNG
chr1_1798974_C_T_b38	SLC35E2	3.011	0.0034	0.090857	3	0.030172	no	BRNSNG
chr1_1822247_A_G_b38	SLC35E2	3.011	0.0034	0.090857	3	0.030172	no	BRNSNG
chr1_1837340_C_T_b38	SLC35E2	3.011	0.0034	0.090857	3	0.030172	no	BRNSNG
chr1_1794187_C_T_b38	SLC35E2	2.882	0.00497	0.087686	3	0.030427	no	BRNSNG
chr1_1898648_CACACACATAAGTTGGATAT_C_b38	SLC35E2	2.786	0.00654	0.066742	12	0.023958	no	BRNSNG
chr1_1855245_G_A_b38	SLC35E2	2.783	0.00658	0.085691	3	0.030786	no	BRNSNG
chr1_1855939_G_A_b38	SLC35E2	2.783	0.00658	0.085691	3	0.030786	no	BRNSNG
chr1_1857246_T_TAA_b38	SLC35E2	2.783	0.00658	0.085691	3	0.030786	no	BRNSNG
chr1_1857250_C_G_b38	SLC35E2	2.783	0.00658	0.085691	3	0.030786	no	BRNSNG
chr1_1857305_G_GGGCT_b38	SLC35E2	2.783	0.00658	0.085691	3	0.030786	no	BRNSNG
chr1_1871210_G_T_b38	SLC35E2	2.783	0.00658	0.085691	3	0.030786	no	BRNSNG
chr1_1727506_T_C_b38	SLC35E2	2.776	0.00672	0.084561	10	0.030462	no	BRNSNG
chr1_1816644_CT_C_b38	SLC35E2	2.738	0.00749	0.078339	17	0.028617	no	BRNSNG
chr1_1903242_C_T_b38	SLC35E2	2.722	0.00782	0.083515	3	0.03068	no	BRNSNG
chr1_1903577_C_T_b38	SLC35E2	2.722	0.00782	0.083515	3	0.03068	no	BRNSNG
chr1_1906935_C_T_b38	SLC35E2	2.722	0.00782	0.083515	3	0.03068	no	BRNSNG
chr1_1909167_G_A_b38	SLC35E2	2.722	0.00782	0.083515	3	0.03068	no	BRNSNG
chr1_1606559_C_CGGCTGGTCAGGCGTGGGGCGGGCTGGTCAGGCGTGGGGCG_b38	SLC35E2	-2.691	0.00853	-0.125421	4	0.04661	no	BRNSNG
chr1_1912140_T_G_b38	SLC35E2	2.654	0.00944	0.078416	4	0.029548	no	BRNSNG
chr1_2435820_TG_T_b38	SLC35E2	2.65	0.00955	0.076755	12	0.028969	no	BRNSNG
chr1_1668108_C_T_b38	SLC35E2	2.647	0.00961	0.06933	11	0.026189	no	BRNSNG
chr1_1676790_C_T_b38	SLC35E2	6.697	9.38e-11	0.093751	100	0.013999	yes	BREAST
chr1_1671797_G_A_b38	SLC35E2	6.326	8.34e-10	0.091217	93	0.01442	yes	BREAST
chr1_1742587_G_C_b38	SLC35E2	5.825	1.38e-08	0.088663	84	0.015222	yes	BREAST
chr1_1744499_C_T_b38	SLC35E2	-5.74	2.17e-08	-0.085424	78	0.014882	yes	BREAST
chr1_1744652_C_T_b38	SLC35E2	-5.349	1.67e-07	-0.081673	76	0.015269	yes	BREAST
chr1_1743565_ATAT_A_b38	SLC35E2	-5.303	2.11e-07	-0.076489	61	0.014425	yes	BREAST
chr1_1730405_G_C_b38	SLC35E2	5.265	2.55e-07	0.088628	58	0.016833	yes	BREAST
chr1_1670423_AT_A_b38	SLC35E2	5.137	4.83e-07	0.083925	57	0.016339	yes	BREAST
chr1_1646352_A_C_b38	SLC35E2	5.113	5.44e-07	0.111026	8	0.021716	yes	BREAST
chr1_1743586_T_TAC_b38	SLC35E2	-5.062	6.96e-07	-0.080095	54	0.015823	yes	BREAST
chr1_1742672_C_T_b38	SLC35E2	-5.001	9.33e-07	-0.077933	67	0.015582	yes	BREAST
chr1_1743238_G_C_b38	SLC35E2	-5.001	9.33e-07	-0.077933	67	0.015582	yes	BREAST
chr1_1692124_T_G_b38	SLC35E2	-4.934	1.29e-06	-0.086161	33	0.017463	yes	BREAST
chr1_1651653_C_T_b38	SLC35E2	4.908	1.46e-06	0.073636	90	0.015004	yes	BREAST
chr1_1673968_GA_G_b38	SLC35E2	4.898	1.53e-06	0.080993	47	0.016537	yes	BREAST
chr1_1743565_AT_A_b38	SLC35E2	4.784	2.61e-06	0.067247	100	0.014056	yes	BREAST
chr1_1636278_G_T_b38	SLC35E2	4.736	3.26e-06	0.073766	73	0.015574	yes	BREAST
chr1_1692151_T_C_b38	SLC35E2	-4.725	3.43e-06	-0.082965	32	0.017559	yes	BREAST
chr1_1743714_C_CA_b38	SLC35E2	4.557	7.34e-06	0.076015	52	0.01668	yes	BREAST
chr1_1753033_C_T_b38	SLC35E2	-4.528	8.37e-06	-0.072719	88	0.01606	yes	BREAST
chr1_2288986_T_C_b38	SLC35E2	-4.413	1.39e-05	-0.069299	45	0.015705	yes	BREAST
chr1_1883278_C_CA_b38	SLC35E2	4.41	1.4e-05	0.104793	5	0.02376	yes	BREAST
chr1_1753319_G_A_b38	SLC35E2	-4.26	2.68e-05	-0.069272	80	0.016262	yes	BREAST
chr1_1725582_T_C_b38	SLC35E2	4.242	2.89e-05	0.05849	93	0.013788	yes	BREAST
chr1_1752461_G_A_b38	SLC35E2	-4.223	3.13e-05	-0.068675	80	0.016262	yes	BREAST
chr1_1752730_C_G_b38	SLC35E2	-4.223	3.13e-05	-0.068675	80	0.016262	yes	BREAST
chr1_1753361_G_A_b38	SLC35E2	-4.223	3.13e-05	-0.068675	80	0.016262	yes	BREAST
chr1_1668108_C_T_b38	SLC35E2	4.126	4.69e-05	0.066011	39	0.015998	yes	BREAST
chr1_1755504_T_C_b38	SLC35E2	4.123	4.75e-05	0.063814	83	0.015477	yes	BREAST
chr1_1749826_A_G_b38	SLC35E2	-4.111	4.98e-05	-0.063013	96	0.015326	yes	BREAST
chr1_1759611_C_T_b38	SLC35E2	-4.105	5.13e-05	-0.065884	85	0.016051	yes	BREAST
chr1_1743851_C_T_b38	SLC35E2	-4.09	5.44e-05	-0.074395	25	0.018189	yes	BREAST
chr1_1679100_A_G_b38	SLC35E2	-4.085	5.56e-05	-0.062287	73	0.015249	yes	BREAST
chr1_1755523_C_T_b38	SLC35E2	4.084	5.57e-05	0.06352	89	0.015552	yes	BREAST
chr1_1759354_G_A_b38	SLC35E2	-4.072	5.86e-05	-0.065502	82	0.016086	yes	BREAST
chr1_1674633_C_CA_b38	SLC35E2	4.036	6.79e-05	0.065561	52	0.016245	yes	BREAST
chr1_1744052_GAGA_G_b38	SLC35E2	-4	7.85e-05	-0.080547	14	0.020137	yes	BREAST
chr1_1743886_C_T_b38	SLC35E2	-3.981	8.46e-05	-0.071134	32	0.017867	yes	BREAST
chr1_1671148_C_T_b38	SLC35E2	3.978	8.57e-05	0.06436	40	0.016179	yes	BREAST
chr1_1743840_T_C_b38	SLC35E2	-3.968	8.92e-05	-0.073715	24	0.018577	yes	BREAST
chr1_1756043_G_T_b38	SLC35E2	-3.964	9.06e-05	-0.064088	82	0.016167	yes	BREAST
chr1_1773713_T_A_b38	SLC35E2	-3.934	0.000102	-0.06567	46	0.016695	yes	BREAST
chr1_1660683_C_T_b38	SLC35E2	-3.931	0.000103	-0.066233	29	0.016847	yes	BREAST
chr1_1671097_G_C_b38	SLC35E2	3.91	0.000112	0.063281	40	0.016183	yes	BREAST
chr1_1775296_C_T_b38	SLC35E2	3.886	0.000124	0.085437	5	0.021988	yes	BREAST
chr1_1815255_G_T_b38	SLC35E2	3.886	0.000124	0.085437	5	0.021988	yes	BREAST
chr1_1754482_TCCCTGGGACCGAAGTCGCCCCA_T_b38	SLC35E2	-3.884	0.000125	-0.063394	80	0.016323	yes	BREAST
chr1_1650195_A_G_b38	SLC35E2	-3.867	0.000133	-0.063375	37	0.016388	yes	BREAST
chr1_1855245_G_A_b38	SLC35E2	3.847	0.000144	0.082017	5	0.021321	yes	BREAST
chr1_1731904_CA_C_b38	SLC35E2	3.846	0.000144	0.070205	32	0.018252	yes	BREAST
chr1_1736729_G_T_b38	SLC35E2	3.843	0.000146	0.058113	97	0.015124	yes	BREAST
chr1_1855939_G_A_b38	SLC35E2	3.842	0.000147	0.081917	5	0.02132	yes	BREAST
chr1_1871210_G_T_b38	SLC35E2	3.832	0.000153	0.083878	5	0.021891	yes	BREAST
chr1_1731963_A_C_b38	SLC35E2	3.824	0.000157	0.057509	97	0.015038	yes	BREAST
chr1_1735176_C_T_b38	SLC35E2	3.824	0.000157	0.057509	97	0.015038	yes	BREAST
chr1_1857305_G_GGGCT_b38	SLC35E2	3.801	0.000172	0.081605	5	0.021472	yes	BREAST
chr1_1747695_A_G_b38	SLC35E2	-3.795	0.000176	-0.050295	88	0.013254	yes	BREAST
chr1_1738295_G_T_b38	SLC35E2	3.792	0.000178	0.056966	97	0.015023	yes	BREAST
chr1_1857246_T_TAA_b38	SLC35E2	3.779	0.000187	0.080725	5	0.021362	yes	BREAST
chr1_1857250_C_G_b38	SLC35E2	3.779	0.000187	0.080725	5	0.021362	yes	BREAST
chr1_1664757_T_C_b38	SLC35E2	-3.778	0.000188	-0.05998	40	0.015876	yes	BREAST
chr1_1737504_A_C_b38	SLC35E2	3.777	0.000189	0.055695	104	0.014746	yes	BREAST
chr1_1631710_T_C_b38	SLC35E2	3.776	0.000189	0.082425	8	0.021827	yes	BREAST
chr1_1794187_C_T_b38	SLC35E2	3.75	0.000209	0.079826	5	0.021286	yes	BREAST
chr1_1748780_G_A_b38	SLC35E2	-3.747	0.000212	-0.059632	93	0.015915	yes	BREAST
chr1_1756186_T_C_b38	SLC35E2	3.743	0.000215	0.060346	57	0.016124	yes	BREAST
chr1_1736836_A_G_b38	SLC35E2	3.742	0.000216	0.056214	96	0.015022	yes	BREAST
chr1_1734903_A_G_b38	SLC35E2	3.741	0.000216	0.056062	98	0.014984	yes	BREAST
chr1_1744028_A_AC_b38	SLC35E2	-3.736	0.00022	-0.076053	15	0.020354	yes	BREAST
chr1_1661420_C_A_b38	SLC35E2	-3.718	0.000236	-0.058901	42	0.01584	yes	BREAST
chr1_1732392_C_T_b38	SLC35E2	3.692	0.000261	0.055602	98	0.015059	yes	BREAST
chr1_1735980_A_C_b38	SLC35E2	3.692	0.000261	0.055602	98	0.015059	yes	BREAST
chr1_1740343_C_T_b38	SLC35E2	3.692	0.000261	0.055602	98	0.015059	yes	BREAST
chr1_1882915_C_T_b38	SLC35E2	3.687	0.000266	0.07983	5	0.021651	yes	BREAST
chr1_1740703_C_T_b38	SLC35E2	3.686	0.000267	0.055448	98	0.015043	yes	BREAST
chr1_1798974_C_T_b38	SLC35E2	3.67	0.000284	0.078022	5	0.021261	yes	BREAST
chr1_1881065_G_A_b38	SLC35E2	3.669	0.000284	0.079021	5	0.021537	yes	BREAST
chr1_1881798_C_T_b38	SLC35E2	3.669	0.000284	0.079021	5	0.021537	yes	BREAST
chr1_1932079_AC_A_b38	SLC35E2	-3.661	0.000294	-0.062041	49	0.016949	yes	BREAST
chr1_1898043_T_C_b38	SLC35E2	3.65	0.000306	0.080003	5	0.021922	yes	BREAST
chr1_1886690_A_C_b38	SLC35E2	3.63	0.000329	0.078562	5	0.021643	yes	BREAST
chr1_1650383_G_T_b38	SLC35E2	-3.628	0.000331	-0.060597	32	0.016701	yes	BREAST
chr1_1750226_C_T_b38	SLC35E2	3.622	0.000338	0.061239	57	0.016905	yes	BREAST
chr1_1750528_G_A_b38	SLC35E2	-3.615	0.000348	-0.050392	83	0.013939	yes	BREAST
chr1_1658866_G_A_b38	SLC35E2	-3.614	0.000349	-0.057544	42	0.015922	yes	BREAST
chr1_1659114_A_G_b38	SLC35E2	-3.614	0.000349	-0.057544	42	0.015922	yes	BREAST
chr1_1659220_A_G_b38	SLC35E2	-3.614	0.000349	-0.057544	42	0.015922	yes	BREAST
chr1_1752908_C_CCCT_b38	SLC35E2	-3.612	0.000352	-0.060401	67	0.016723	yes	BREAST
chr1_1676287_C_T_b38	SLC35E2	-3.608	0.000357	-0.071601	11	0.019844	yes	BREAST
chr1_1734174_A_G_b38	SLC35E2	3.593	0.000377	0.053993	98	0.015027	yes	BREAST
chr1_1888382_A_AG_b38	SLC35E2	3.588	0.000384	0.085477	3	0.023821	yes	BREAST
chr1_1772160_A_AT_b38	SLC35E2	3.587	0.000386	0.076407	3	0.021303	yes	BREAST
chr1_1750280_A_G_b38	SLC35E2	-3.587	0.000387	-0.058401	87	0.016283	yes	BREAST
chr1_1612562_T_TC_b38	SLC35E2	3.571	0.000409	0.054845	50	0.015357	yes	BREAST
chr1_1755713_G_A_b38	SLC35E2	-3.532	0.000473	-0.058438	73	0.016548	yes	BREAST
chr1_1675091_A_G_b38	SLC35E2	-3.521	0.000491	-0.067892	16	0.019279	yes	BREAST
chr1_1650777_G_A_b38	SLC35E2	-3.519	0.000495	-0.056225	40	0.015977	yes	BREAST
chr1_1840043_T_TA_b38	SLC35E2	3.507	0.000517	0.076837	3	0.021909	yes	BREAST
chr1_1639348_G_T_b38	SLC35E2	-3.486	0.000558	-0.054386	49	0.015602	yes	BREAST
chr1_1667948_A_G_b38	SLC35E2	-3.477	0.000575	-0.066588	16	0.019149	yes	BREAST
chr1_1749637_G_T_b38	SLC35E2	3.453	0.000628	0.054656	58	0.01583	yes	BREAST
chr1_1668542_C_T_b38	SLC35E2	-3.434	0.000671	-0.065983	15	0.019212	yes	BREAST
chr1_1650664_CTTTTT_C_b38	SLC35E2	-3.43	0.000681	-0.063865	22	0.018619	yes	BREAST
chr1_1668717_C_G_b38	SLC35E2	-3.404	0.000746	-0.064726	17	0.019012	yes	BREAST
chr1_1945842_A_AAAAGAAC_b38	SLC35E2	-3.387	0.000794	-0.057977	58	0.017119	yes	BREAST
chr1_1751981_A_T_b38	SLC35E2	-3.386	0.000795	-0.0637	35	0.018811	yes	BREAST
chr1_1748597_C_G_b38	SLC35E2	-3.386	0.000797	-0.055542	82	0.016405	yes	BREAST
chr1_1757074_G_T_b38	SLC35E2	3.378	0.000818	0.055616	55	0.016463	yes	BREAST
chr1_1668721_C_T_b38	SLC35E2	-3.371	0.00084	-0.059479	25	0.017646	yes	BREAST
chr1_1672155_G_A_b38	SLC35E2	-3.353	0.000894	-0.05934	32	0.017698	yes	BREAST
chr1_1648826_A_G_b38	SLC35E2	-3.347	0.000914	-0.053165	48	0.015886	yes	BREAST
chr1_1747472_A_T_b38	SLC35E2	-3.341	0.000933	-0.054991	82	0.016461	yes	BREAST
chr1_1764023_C_A_b38	SLC35E2	3.316	0.00102	0.055657	54	0.016784	yes	BREAST
chr1_1664865_A_G_b38	SLC35E2	-3.298	0.00108	-0.052679	40	0.015974	yes	BREAST
chr1_1708855_TTCCTCCTCC_T_b38	SLC35E2	3.282	0.00114	0.054103	70	0.016487	yes	BREAST
chr1_1909167_G_A_b38	SLC35E2	3.26	0.00123	0.072714	5	0.022305	yes	BREAST
chr1_1746522_GT_G_b38	SLC35E2	-3.258	0.00124	-0.06341	20	0.019465	yes	BREAST
chr1_1669613_G_A_b38	SLC35E2	-3.236	0.00134	-0.062223	17	0.019231	yes	BREAST
chr1_1648636_G_A_b38	SLC35E2	-3.223	0.0014	-0.051172	48	0.015876	yes	BREAST
chr1_1845840_C_G_b38	SLC35E2	3.195	0.00154	0.070095	4	0.02194	yes	BREAST
chr1_1595028_C_CAG_b38	SLC35E2	3.164	0.0017	0.054277	32	0.017153	yes	BREAST
chr1_1882449_A_AAG_b38	SLC35E2	3.136	0.00187	0.084435	5	0.026924	yes	BREAST
chr1_1739131_T_C_b38	SLC35E2	3.13	0.00191	0.048272	68	0.015424	yes	BREAST
chr1_1770997_G_A_b38	SLC35E2	-3.128	0.00192	-0.051472	83	0.016456	yes	BREAST
chr1_1920497_C_A_b38	SLC35E2	-3.118	0.00199	-0.064488	8	0.020684	yes	BREAST
chr1_1659940_A_C_b38	SLC35E2	-3.11	0.00204	-0.064104	11	0.020612	yes	BREAST
chr1_1738606_C_T_b38	SLC35E2	3.098	0.00212	0.05737	37	0.018521	yes	BREAST
chr1_1702383_T_C_b38	SLC35E2	-3.078	0.00226	-0.054944	21	0.017849	yes	BREAST
chr1_1880596_T_A_b38	SLC35E2	-3.073	0.0023	-0.052594	74	0.017117	yes	BREAST
chr1_1903577_C_T_b38	SLC35E2	3.066	0.00235	0.068576	5	0.022363	yes	BREAST
chr1_2338720_A_G_b38	SLC35E2	3.063	0.00238	0.092167	4	0.030092	yes	BREAST
chr1_1926870_T_C_b38	SLC35E2	-3.051	0.00247	-0.049399	62	0.016192	yes	BREAST
chr1_1722690_TA_T_b38	SLC35E2	-3.043	0.00253	-0.076787	3	0.025231	yes	BREAST
chr1_1715541_A_C_b38	SLC35E2	3.04	0.00256	0.106515	3	0.035036	yes	BREAST
chr1_1739883_C_T_b38	SLC35E2	-3.025	0.00268	-0.044867	67	0.014831	yes	BREAST
chr1_1669576_G_A_b38	SLC35E2	-3.013	0.00279	-0.058589	16	0.019447	yes	BREAST
chr1_1970506_T_A_b38	SLC35E2	-2.979	0.00311	-0.046846	69	0.015728	yes	BREAST
chr1_1665061_C_T_b38	SLC35E2	-2.948	0.00343	-0.055249	18	0.018742	yes	BREAST
chr1_1935938_T_C_b38	SLC35E2	-2.937	0.00355	-0.050312	58	0.017131	yes	BREAST
chr1_1615869_C_T_b38	SLC35E2	2.932	0.0036	0.049661	42	0.016936	yes	BREAST
chr1_1779667_T_TTG_b38	SLC35E2	2.913	0.00383	0.049446	46	0.016976	yes	BREAST
chr1_1688328_C_T_b38	SLC35E2	-2.899	0.004	-0.053757	18	0.018546	yes	BREAST
chr1_1820337_A_G_b38	SLC35E2	2.882	0.00422	0.046599	69	0.01617	yes	BREAST
chr1_1937273_T_C_b38	SLC35E2	-2.871	0.00437	-0.046948	67	0.016355	yes	BREAST
chr1_1776772_TA_T_b38	SLC35E2	2.868	0.0044	0.059866	9	0.020875	yes	BREAST
chr1_1737703_A_C_b38	SLC35E2	-2.854	0.0046	-0.043526	67	0.015252	yes	BREAST
chr1_1758323_T_C_b38	SLC35E2	2.83	0.00494	0.044518	67	0.015731	yes	BREAST
chr1_1937841_ACACCAGGTCCACCTCTGGACACAGGTCCACC_A_b38	SLC35E2	-2.826	0.005	-0.046199	70	0.016346	yes	BREAST
chr1_1940540_G_A_b38	SLC35E2	-2.826	0.005	-0.046199	70	0.016346	yes	BREAST
chr1_1940973_C_T_b38	SLC35E2	-2.826	0.005	-0.046199	70	0.016346	yes	BREAST
chr1_1942014_G_A_b38	SLC35E2	-2.826	0.005	-0.046199	70	0.016346	yes	BREAST
chr1_1942075_A_G_b38	SLC35E2	-2.826	0.005	-0.046199	70	0.016346	yes	BREAST
chr1_1942086_T_C_b38	SLC35E2	-2.826	0.005	-0.046199	70	0.016346	yes	BREAST
chr1_1942260_G_C_b38	SLC35E2	-2.826	0.005	-0.046199	70	0.016346	yes	BREAST
chr1_2308567_T_C_b38	SLC35E2	-2.826	0.00501	-0.057588	13	0.020378	yes	BREAST
chr1_1661177_A_G_b38	SLC35E2	-2.823	0.00505	-0.053355	18	0.018899	yes	BREAST
chr1_1773460_G_A_b38	SLC35E2	-2.821	0.00508	-0.047027	83	0.016671	yes	BREAST
chr1_1773476_C_G_b38	SLC35E2	-2.821	0.00508	-0.047027	83	0.016671	yes	BREAST
chr1_1932081_AAAAAAC_A_b38	SLC35E2	-2.814	0.0052	-0.057429	26	0.020411	yes	BREAST
chr1_1934565_G_A_b38	SLC35E2	-2.802	0.00538	-0.047301	69	0.016878	yes	BREAST
chr1_1938054_ACT_A_b38	SLC35E2	-2.798	0.00545	-0.04585	70	0.016385	yes	BREAST
chr1_1781909_C_T_b38	SLC35E2	2.795	0.00549	0.044898	68	0.016062	yes	BREAST
chr1_1623412_T_C_b38	SLC35E2	2.795	0.0055	0.078733	3	0.028167	yes	BREAST
chr1_1846009_AGG_A_b38	SLC35E2	-2.791	0.00557	-0.047396	83	0.016983	yes	BREAST
chr1_1846011_G_GTCC_b38	SLC35E2	-2.791	0.00557	-0.047396	83	0.016983	yes	BREAST
chr1_1938493_C_CAT_b38	SLC35E2	-2.784	0.00569	-0.058645	6	0.021068	yes	BREAST
chr1_1938771_G_A_b38	SLC35E2	-2.784	0.00569	-0.058645	6	0.021068	yes	BREAST
chr1_1939978_T_C_b38	SLC35E2	-2.784	0.00569	-0.058645	6	0.021068	yes	BREAST
chr1_1943828_A_G_b38	SLC35E2	-2.784	0.00569	-0.058645	6	0.021068	yes	BREAST
chr1_1881082_C_T_b38	SLC35E2	-2.775	0.00584	-0.047498	82	0.017116	yes	BREAST
chr1_1843381_A_T_b38	SLC35E2	-2.762	0.00608	-0.047104	82	0.017057	yes	BREAST
chr1_1847030_A_G_b38	SLC35E2	-2.762	0.00608	-0.047104	82	0.017057	yes	BREAST
chr1_1850017_G_T_b38	SLC35E2	-2.762	0.00608	-0.047104	82	0.017057	yes	BREAST
chr1_1663759_G_A_b38	SLC35E2	-2.761	0.00609	-0.080719	7	0.029235	yes	BREAST
chr1_1851414_GA_G_b38	SLC35E2	-2.761	0.0061	-0.048331	41	0.017507	yes	BREAST
chr1_1881249_A_G_b38	SLC35E2	-2.76	0.00611	-0.047234	82	0.017115	yes	BREAST
chr1_1916417_G_T_b38	SLC35E2	-2.747	0.00636	-0.04565	70	0.016621	yes	BREAST
chr1_1735008_G_GGTTT_b38	SLC35E2	-2.746	0.00638	-0.042837	64	0.015602	yes	BREAST
chr1_1860718_A_C_b38	SLC35E2	-2.742	0.00645	-0.046662	84	0.01702	yes	BREAST
chr1_1844830_C_A_b38	SLC35E2	2.724	0.0068	0.044734	66	0.016422	yes	BREAST
chr1_1831318_C_T_b38	SLC35E2	-2.717	0.00695	-0.045714	82	0.016827	yes	BREAST
chr1_1866508_A_G_b38	SLC35E2	-2.712	0.00704	-0.046365	83	0.017095	yes	BREAST
chr1_1875208_T_C_b38	SLC35E2	-2.712	0.00704	-0.046365	83	0.017095	yes	BREAST
chr1_1879567_T_C_b38	SLC35E2	-2.712	0.00704	-0.046365	83	0.017095	yes	BREAST
chr1_1886800_G_A_b38	SLC35E2	-2.712	0.00704	-0.046365	83	0.017095	yes	BREAST
chr1_1891654_C_CAGAG_b38	SLC35E2	-2.712	0.00704	-0.046365	83	0.017095	yes	BREAST
chr1_1943706_C_T_b38	SLC35E2	-2.709	0.0071	-0.056823	7	0.020974	yes	BREAST
chr1_1881428_C_CT_b38	SLC35E2	-2.702	0.00725	-0.046227	80	0.017108	yes	BREAST
chr1_1848037_C_CTA_b38	SLC35E2	2.698	0.00733	0.044547	66	0.016508	yes	BREAST
chr1_1764887_C_A_b38	SLC35E2	-2.697	0.00737	-0.045334	83	0.016812	yes	BREAST
chr1_1773848_A_C_b38	SLC35E2	-2.697	0.00737	-0.045334	83	0.016812	yes	BREAST
chr1_1776461_GAAAC_G_b38	SLC35E2	-2.697	0.00737	-0.045334	83	0.016812	yes	BREAST
chr1_1777362_A_G_b38	SLC35E2	-2.697	0.00737	-0.045334	83	0.016812	yes	BREAST
chr1_1790040_C_T_b38	SLC35E2	-2.697	0.00737	-0.045334	83	0.016812	yes	BREAST
chr1_1791493_C_T_b38	SLC35E2	-2.697	0.00737	-0.045334	83	0.016812	yes	BREAST
chr1_1791592_G_A_b38	SLC35E2	-2.697	0.00737	-0.045334	83	0.016812	yes	BREAST
chr1_1792927_G_A_b38	SLC35E2	-2.697	0.00737	-0.045334	83	0.016812	yes	BREAST
chr1_1808816_G_T_b38	SLC35E2	-2.697	0.00737	-0.045334	83	0.016812	yes	BREAST
chr1_1817295_T_C_b38	SLC35E2	-2.697	0.00737	-0.045334	83	0.016812	yes	BREAST
chr1_1819825_G_A_b38	SLC35E2	-2.697	0.00737	-0.045334	83	0.016812	yes	BREAST
chr1_1827774_A_G_b38	SLC35E2	-2.697	0.00737	-0.045334	83	0.016812	yes	BREAST
chr1_1922670_A_G_b38	SLC35E2	-2.696	0.00739	-0.044706	67	0.016584	yes	BREAST
chr1_1679993_A_G_b38	SLC35E2	-2.691	0.0075	-0.040567	88	0.015076	yes	BREAST
chr1_1891444_CG_C_b38	SLC35E2	-2.686	0.0076	-0.045808	78	0.017055	yes	BREAST
chr1_1877316_A_T_b38	SLC35E2	2.679	0.00776	0.046653	49	0.017415	yes	BREAST
chr1_1944216_C_T_b38	SLC35E2	-2.668	0.00801	-0.045123	81	0.016913	yes	BREAST
chr1_1771864_G_A_b38	SLC35E2	-2.659	0.00822	-0.044398	84	0.016697	yes	BREAST
chr1_1772426_T_A_b38	SLC35E2	-2.659	0.00822	-0.044398	84	0.016697	yes	BREAST
chr1_1942258_G_A_b38	SLC35E2	-2.658	0.00826	-0.043356	69	0.016314	yes	BREAST
chr1_1928648_C_T_b38	SLC35E2	-2.656	0.0083	-0.044038	67	0.016581	yes	BREAST
chr1_1933087_C_T_b38	SLC35E2	-2.656	0.0083	-0.044038	67	0.016581	yes	BREAST
chr1_1933859_A_G_b38	SLC35E2	-2.656	0.0083	-0.044038	67	0.016581	yes	BREAST
chr1_2106511_C_CT_b38	SLC35E2	-2.651	0.00843	-0.107249	4	0.040461	yes	BREAST
chr1_1914634_G_T_b38	SLC35E2	-2.65	0.00845	-0.043527	70	0.016426	yes	BREAST
chr1_1916670_G_C_b38	SLC35E2	-2.65	0.00845	-0.043527	70	0.016426	yes	BREAST
chr1_1714635_A_G_b38	SLC35E2	2.646	0.00853	0.057072	12	0.021566	yes	BREAST
chr1_1658830_C_G_b38	SLC35E2	-2.646	0.00854	-0.049155	19	0.018577	yes	BREAST
chr1_1891450_G_C_b38	SLC35E2	-2.634	0.00885	-0.044933	78	0.017061	yes	BREAST
chr1_1776772_TAA_T_b38	SLC35E2	-2.629	0.00896	-0.04684	36	0.017815	yes	BREAST
chr1_1419135_C_G_b38	SLC35E2	-2.626	0.00904	-0.071592	27	0.027258	yes	BREAST
chr1_1659060_G_A_b38	SLC35E2	-2.626	0.00905	-0.045359	31	0.017274	yes	BREAST
chr1_1708951_C_T_b38	SLC35E2	2.624	0.0091	0.040033	68	0.015256	yes	BREAST
chr1_1671724_C_T_b38	SLC35E2	-2.623	0.00913	-0.046935	27	0.017895	yes	BREAST
chr1_1936627_C_G_b38	SLC35E2	-2.613	0.00939	-0.043547	67	0.016665	yes	BREAST
chr1_1921745_T_C_b38	SLC35E2	-2.607	0.00955	-0.042978	65	0.016485	yes	BREAST
chr1_1421170_A_G_b38	SLC35E2	-2.606	0.00957	-0.072385	22	0.027772	yes	BREAST
chr1_1766653_A_G_b38	SLC35E2	-2.602	0.00968	-0.043594	83	0.016751	yes	BREAST
chr1_1641275_A_G_b38	SLC35E2	-2.6	0.00974	-0.042394	48	0.016304	yes	BREAST
chr1_1638879_C_T_b38	SLC35E2	-2.595	0.00989	-0.046797	23	0.018033	yes	BREAST
chr1_1725339_C_A_b38	SLC35E2	2.592	0.00997	0.038936	62	0.01502	yes	BREAST
chr1_1677726_A_T_b38	SLC35E2	6.853	3.64e-11	0.096571	102	0.014091	no	BREAST
chr1_1673060_G_A_b38	SLC35E2	6.839	3.96e-11	0.097524	99	0.01426	no	BREAST
chr1_1677720_T_G_b38	SLC35E2	6.797	5.13e-11	0.096061	102	0.014134	no	BREAST
chr1_1673818_A_C_b38	SLC35E2	6.771	6e-11	0.094995	101	0.01403	no	BREAST
chr1_1674720_TGC_T_b38	SLC35E2	6.758	6.5e-11	0.095764	99	0.014171	no	BREAST
chr1_1674868_G_A_b38	SLC35E2	6.758	6.5e-11	0.095764	99	0.014171	no	BREAST
chr1_1671995_G_T_b38	SLC35E2	6.65	1.24e-10	0.092432	99	0.0139	no	BREAST
chr1_1743544_CA_C_b38	SLC35E2	6.503	2.98e-10	0.093554	80	0.014387	no	BREAST
chr1_1648736_G_A_b38	SLC35E2	5.418	1.18e-07	0.081693	81	0.015078	no	BREAST
chr1_1649932_C_T_b38	SLC35E2	5.074	6.56e-07	0.075445	84	0.014868	no	BREAST
chr1_1692286_C_A_b38	SLC35E2	4.778	2.68e-06	0.106168	5	0.022218	no	BREAST
chr1_1732892_CT_C_b38	SLC35E2	4.776	2.71e-06	0.105067	6	0.021998	no	BREAST
chr1_1675228_C_CG_b38	SLC35E2	4.722	3.49e-06	0.077267	62	0.016365	no	BREAST
chr1_1649976_G_A_b38	SLC35E2	4.62	5.54e-06	0.070262	67	0.015208	no	BREAST
chr1_1661562_G_C_b38	SLC35E2	4.592	6.3e-06	0.062976	95	0.013716	no	BREAST
chr1_1744854_C_A_b38	SLC35E2	-4.509	9.12e-06	-0.065965	61	0.014631	no	BREAST
chr1_1675132_A_G_b38	SLC35E2	4.42	1.35e-05	0.073245	53	0.016571	no	BREAST
chr1_1744121_A_C_b38	SLC35E2	-4.346	1.85e-05	-0.091981	43	0.021162	no	BREAST
chr1_1837255_A_AT_b38	SLC35E2	4.283	2.43e-05	0.085345	12	0.019927	no	BREAST
chr1_1654662_CT_C_b38	SLC35E2	4.217	3.22e-05	0.069546	63	0.016492	no	BREAST
chr1_1752126_G_A_b38	SLC35E2	4.112	4.97e-05	0.071247	41	0.017326	no	BREAST
chr1_1835922_G_GAAA_b38	SLC35E2	-4.111	5e-05	-0.168163	4	0.04091	no	BREAST
chr1_1425464_CA_C_b38	SLC35E2	-4.094	5.36e-05	-0.100427	3	0.024532	no	BREAST
chr1_1744096_C_T_b38	SLC35E2	-4.063	6.09e-05	-0.08545	47	0.021032	no	BREAST
chr1_1667424_T_TAAAATA_b38	SLC35E2	3.936	0.000101	0.060452	58	0.015359	no	BREAST
chr1_1750508_A_C_b38	SLC35E2	-3.897	0.000118	-0.053651	86	0.013768	no	BREAST
chr1_1677707_C_T_b38	SLC35E2	-3.865	0.000134	-0.086744	8	0.022442	no	BREAST
chr1_1754601_G_T_b38	SLC35E2	3.801	0.000172	0.063842	53	0.016795	no	BREAST
chr1_1757725_C_T_b38	SLC35E2	3.801	0.000172	0.063842	53	0.016795	no	BREAST
chr1_1750589_G_A_b38	SLC35E2	-3.701	0.000253	-0.085788	15	0.023183	no	BREAST
chr1_2314622_G_T_b38	SLC35E2	3.611	0.000354	0.09218	3	0.025529	no	BREAST
chr1_2316619_C_T_b38	SLC35E2	3.608	0.000357	0.092069	3	0.025518	no	BREAST
chr1_1613769_C_T_b38	SLC35E2	3.594	0.000376	0.057359	46	0.015959	no	BREAST
chr1_2311682_G_C_b38	SLC35E2	3.58	0.000395	0.091127	3	0.025452	no	BREAST
chr1_1650000_G_A_b38	SLC35E2	3.576	0.000403	0.054767	57	0.015317	no	BREAST
chr1_1898712_C_T_b38	SLC35E2	3.509	0.000514	0.0783	4	0.022316	no	BREAST
chr1_1899188_T_A_b38	SLC35E2	3.509	0.000514	0.0783	4	0.022316	no	BREAST
chr1_1652061_T_C_b38	SLC35E2	-3.482	0.000565	-0.055662	41	0.015984	no	BREAST
chr1_1654188_T_G_b38	SLC35E2	-3.482	0.000565	-0.055662	41	0.015984	no	BREAST
chr1_1653934_G_A_b38	SLC35E2	-3.482	0.000565	-0.05594	40	0.016064	no	BREAST
chr1_1651137_C_T_b38	SLC35E2	-3.481	0.000567	-0.055791	40	0.016026	no	BREAST
chr1_1651267_T_C_b38	SLC35E2	-3.481	0.000567	-0.055791	40	0.016026	no	BREAST
chr1_1651574_G_A_b38	SLC35E2	-3.481	0.000567	-0.055791	40	0.016026	no	BREAST
chr1_1651785_C_A_b38	SLC35E2	-3.481	0.000567	-0.055791	40	0.016026	no	BREAST
chr1_1652135_C_G_b38	SLC35E2	-3.481	0.000567	-0.055791	40	0.016026	no	BREAST
chr1_1652191_C_T_b38	SLC35E2	-3.481	0.000567	-0.055791	40	0.016026	no	BREAST
chr1_1652592_A_G_b38	SLC35E2	-3.481	0.000567	-0.055791	40	0.016026	no	BREAST
chr1_1652779_A_G_b38	SLC35E2	-3.481	0.000567	-0.055791	40	0.016026	no	BREAST
chr1_1653147_A_C_b38	SLC35E2	-3.481	0.000567	-0.055791	40	0.016026	no	BREAST
chr1_1653396_T_C_b38	SLC35E2	-3.481	0.000567	-0.055791	40	0.016026	no	BREAST
chr1_1653472_T_C_b38	SLC35E2	-3.481	0.000567	-0.055791	40	0.016026	no	BREAST
chr1_1653811_G_A_b38	SLC35E2	-3.481	0.000567	-0.055791	40	0.016026	no	BREAST
chr1_1653893_C_T_b38	SLC35E2	-3.481	0.000567	-0.055791	40	0.016026	no	BREAST
chr1_1654143_G_A_b38	SLC35E2	-3.481	0.000567	-0.055791	40	0.016026	no	BREAST
chr1_1822247_A_G_b38	SLC35E2	3.48	0.000569	0.073274	6	0.021054	no	BREAST
chr1_1837340_C_T_b38	SLC35E2	3.479	0.000572	0.072804	6	0.020928	no	BREAST
chr1_1845824_TACACAC_T_b38	SLC35E2	3.47	0.000592	0.066743	14	0.019237	no	BREAST
chr1_1782906_T_G_b38	SLC35E2	3.441	0.000655	0.072265	6	0.021	no	BREAST
chr1_1814797_CAAAAAAAAA_C_b38	SLC35E2	3.437	0.000665	0.07719	5	0.022461	no	BREAST
chr1_1866635_T_TA_b38	SLC35E2	3.435	0.000669	0.060518	43	0.017617	no	BREAST
chr1_1892085_G_C_b38	SLC35E2	3.425	0.000693	0.07454	4	0.021762	no	BREAST
chr1_1651926_T_C_b38	SLC35E2	-3.425	0.000693	-0.054825	40	0.016007	no	BREAST
chr1_1846651_T_G_b38	SLC35E2	3.412	0.000727	0.071302	6	0.0209	no	BREAST
chr1_1897985_C_G_b38	SLC35E2	3.399	0.00076	0.071115	6	0.020921	no	BREAST
chr1_1651421_GTAGCCCCTCTGAACGGTCTGTGACACACGCATGCTTTCAGCTAGAGTACTCTA_G_b38	SLC35E2	-3.395	0.00077	-0.054536	39	0.016062	no	BREAST
chr1_1760882_T_C_b38	SLC35E2	3.39	0.000785	0.052545	73	0.0155	no	BREAST
chr1_1775996_G_A_b38	SLC35E2	3.375	0.000826	0.071177	6	0.021087	no	BREAST
chr1_1629332_G_T_b38	SLC35E2	3.254	0.00126	0.051609	49	0.015862	no	BREAST
chr1_1936077_C_T_b38	SLC35E2	-3.251	0.00127	-0.052085	75	0.016022	no	BREAST
chr1_1621352_G_A_b38	SLC35E2	3.23	0.00136	0.048995	52	0.015167	no	BREAST
chr1_1750440_G_A_b38	SLC35E2	-3.228	0.00138	-0.057979	53	0.017963	no	BREAST
chr1_1591703_T_C_b38	SLC35E2	3.201	0.0015	0.048058	84	0.015013	no	BREAST
chr1_1606532_GTGGGCTGGGCTGGTCAGGCA_G_b38	SLC35E2	3.195	0.00153	0.049271	42	0.015419	no	BREAST
chr1_1903242_C_T_b38	SLC35E2	3.125	0.00194	0.070622	4	0.022598	no	BREAST
chr1_1906935_C_T_b38	SLC35E2	3.125	0.00194	0.070622	4	0.022598	no	BREAST
chr1_1750428_G_C_b38	SLC35E2	-3.121	0.00197	-0.055182	57	0.017683	no	BREAST
chr1_1774721_A_G_b38	SLC35E2	-3.106	0.00207	-0.055765	24	0.017956	no	BREAST
chr1_1801188_T_C_b38	SLC35E2	3.094	0.00215	0.06464	6	0.020894	no	BREAST
chr1_1880594_A_T_b38	SLC35E2	3.038	0.00258	0.065226	6	0.021472	no	BREAST
chr1_2329564_T_A_b38	SLC35E2	3.037	0.00259	0.091787	4	0.030227	no	BREAST
chr1_2330023_G_A_b38	SLC35E2	3.037	0.00259	0.091787	4	0.030227	no	BREAST
chr1_2330168_G_A_b38	SLC35E2	3.037	0.00259	0.091787	4	0.030227	no	BREAST
chr1_1727506_T_C_b38	SLC35E2	3.028	0.00266	0.059705	28	0.019716	no	BREAST
chr1_1835922_GA_G_b38	SLC35E2	3	0.0029	0.086068	3	0.028685	no	BREAST
chr1_2325021_C_T_b38	SLC35E2	2.987	0.00303	0.088595	5	0.029659	no	BREAST
chr1_1915143_A_G_b38	SLC35E2	-2.984	0.00306	-0.064688	5	0.021677	no	BREAST
chr1_1741276_C_T_b38	SLC35E2	-2.955	0.00335	-0.045859	60	0.015517	no	BREAST
chr1_1606384_A_G_b38	SLC35E2	2.951	0.0034	0.043524	56	0.014749	no	BREAST
chr1_1619986_T_C_b38	SLC35E2	2.947	0.00344	0.051334	34	0.01742	no	BREAST
chr1_2309937_C_CTT_b38	SLC35E2	-2.924	0.0037	-0.045684	48	0.015626	no	BREAST
chr1_1943142_A_G_b38	SLC35E2	-2.909	0.00388	-0.061617	6	0.021183	no	BREAST
chr1_2303464_C_T_b38	SLC35E2	-2.895	0.00405	-0.054024	17	0.018663	no	BREAST
chr1_1620609_G_A_b38	SLC35E2	2.881	0.00423	0.044086	51	0.015302	no	BREAST
chr1_1742432_T_TA_b38	SLC35E2	2.868	0.00441	0.046039	65	0.016055	no	BREAST
chr1_1922882_A_G_b38	SLC35E2	-2.864	0.00446	-0.061759	5	0.021564	no	BREAST
chr1_1925261_C_T_b38	SLC35E2	-2.864	0.00446	-0.061759	5	0.021564	no	BREAST
chr1_1609058_G_A_b38	SLC35E2	2.861	0.0045	0.04323	50	0.015112	no	BREAST
chr1_1658422_T_C_b38	SLC35E2	2.847	0.0047	0.056031	20	0.019682	no	BREAST
chr1_1607931_G_A_b38	SLC35E2	2.842	0.00476	0.043362	49	0.015256	no	BREAST
chr1_1622295_G_C_b38	SLC35E2	2.835	0.00487	0.043354	51	0.015292	no	BREAST
chr1_1660408_T_C_b38	SLC35E2	-2.834	0.00488	-0.056105	10	0.019795	no	BREAST
chr1_1410616_G_T_b38	SLC35E2	-2.828	0.00498	-0.07357	18	0.026015	no	BREAST
chr1_1412488_C_CAG_b38	SLC35E2	-2.828	0.00498	-0.07357	18	0.026015	no	BREAST
chr1_1415976_G_A_b38	SLC35E2	-2.828	0.00498	-0.07357	18	0.026015	no	BREAST
chr1_1411929_G_C_b38	SLC35E2	-2.794	0.00552	-0.073071	18	0.026153	no	BREAST
chr1_1613160_C_CT_b38	SLC35E2	2.782	0.00571	0.040312	57	0.014488	no	BREAST
chr1_1938332_A_ACT_b38	SLC35E2	-2.776	0.00582	-0.044906	73	0.016177	no	BREAST
chr1_1876492_C_CGA_b38	SLC35E2	2.761	0.00609	0.06053	4	0.021923	no	BREAST
chr1_1425013_C_T_b38	SLC35E2	-2.751	0.00627	-0.074318	32	0.027015	no	BREAST
chr1_1600379_C_T_b38	SLC35E2	2.74	0.00648	0.042015	48	0.015335	no	BREAST
chr1_1667424_T_TAAATA_b38	SLC35E2	-2.723	0.00681	-0.04124	71	0.015142	no	BREAST
chr1_1630798_C_T_b38	SLC35E2	2.722	0.00684	0.043924	46	0.016138	no	BREAST
chr1_1649846_G_A_b38	SLC35E2	-2.721	0.00686	-0.051641	17	0.01898	no	BREAST
chr1_1408687_T_C_b38	SLC35E2	-2.717	0.00695	-0.072925	14	0.026843	no	BREAST
chr1_2334682_C_T_b38	SLC35E2	2.715	0.00697	0.077752	5	0.028633	no	BREAST
chr1_1811082_T_TA_b38	SLC35E2	-2.712	0.00704	-0.042624	53	0.015717	no	BREAST
chr1_1910289_C_T_b38	SLC35E2	2.707	0.00715	0.057676	5	0.021307	no	BREAST
chr1_1910369_G_A_b38	SLC35E2	2.707	0.00715	0.057676	5	0.021307	no	BREAST
chr1_1910480_G_A_b38	SLC35E2	2.707	0.00715	0.057676	5	0.021307	no	BREAST
chr1_1351587_A_G_b38	SLC35E2	2.697	0.00737	0.113837	4	0.042215	no	BREAST
chr1_2694607_GAAACC_G_b38	SLC35E2	2.696	0.00739	0.051823	23	0.019225	no	BREAST
chr1_1637577_T_C_b38	SLC35E2	-2.695	0.00739	-0.047507	25	0.017625	no	BREAST
chr1_1472158_C_G_b38	SLC35E2	-2.691	0.00749	-0.074247	9	0.027592	no	BREAST
chr1_1936906_C_CA_b38	SLC35E2	-2.69	0.00752	-0.047576	43	0.017688	no	BREAST
chr1_1377480_C_CA_b38	SLC35E2	-2.686	0.00759	-0.084066	3	0.031294	no	BREAST
chr1_2289210_C_T_b38	SLC35E2	-2.676	0.00782	-0.041024	89	0.015328	no	BREAST
chr1_1410877_A_G_b38	SLC35E2	-2.668	0.00801	-0.071554	24	0.026818	no	BREAST
chr1_1586962_C_T_b38	SLC35E2	2.658	0.00825	0.043243	50	0.016269	no	BREAST
chr1_1650405_G_A_b38	SLC35E2	-2.651	0.00842	-0.073819	11	0.027845	no	BREAST
chr1_2304233_C_T_b38	SLC35E2	-2.646	0.00853	-0.053421	18	0.020186	no	BREAST
chr1_1600320_C_G_b38	SLC35E2	2.643	0.0086	0.040642	47	0.015374	no	BREAST
chr1_1945913_T_C_b38	SLC35E2	-2.632	0.00891	-0.053151	7	0.020198	no	BREAST
chr1_1726904_T_C_b38	SLC35E2	2.62	0.00921	0.040834	80	0.015587	no	BREAST
chr1_1732834_T_TATCG_b38	SLC35E2	-2.603	0.00965	-0.040753	66	0.015653	no	BREAST
chr1_1423191_T_A_b38	SLC35E2	-2.602	0.00968	-0.065788	7	0.02528	no	BREAST
chr1_1773356_TC_T_b38	SLC35E2	-2.6	0.00975	-0.045853	29	0.017635	no	BREAST
chr1_2374713_C_T_b38	SLC35E2	2.598	0.00981	0.037726	73	0.014522	no	BREAST
chr1_1960609_G_C_b38	SLC35E2	-2.591	0.00999	-0.040998	58	0.015822	no	BREAST
chr1_1676790_C_T_b38	SLC35E2	14.145	2.63e-37	0.167937	112	0.011872	yes	CULTFB
chr1_1674868_G_A_b38	SLC35E2	13.973	1.37e-36	0.168778	110	0.012079	yes	CULTFB
chr1_1674720_TGC_T_b38	SLC35E2	13.956	1.6e-36	0.169705	108	0.01216	yes	CULTFB
chr1_1677726_A_T_b38	SLC35E2	13.853	4.26e-36	0.166925	112	0.01205	yes	CULTFB
chr1_1671995_G_T_b38	SLC35E2	13.852	4.32e-36	0.168202	109	0.012143	yes	CULTFB
chr1_1677720_T_G_b38	SLC35E2	13.822	5.7e-36	0.167031	112	0.012084	yes	CULTFB
chr1_1673818_A_C_b38	SLC35E2	13.575	5.9e-35	0.165296	110	0.012176	yes	CULTFB
chr1_1673060_G_A_b38	SLC35E2	13.461	1.73e-34	0.167787	107	0.012465	yes	CULTFB
chr1_1671797_G_A_b38	SLC35E2	12.563	7.19e-31	0.159863	105	0.012725	yes	CULTFB
chr1_1673968_GA_G_b38	SLC35E2	10.542	3.65e-23	0.166142	44	0.01576	yes	CULTFB
chr1_1648736_G_A_b38	SLC35E2	10.353	1.76e-22	0.145113	87	0.014017	yes	CULTFB
chr1_1651653_C_T_b38	SLC35E2	10.273	3.4e-22	0.141779	100	0.0138	yes	CULTFB
chr1_1649932_C_T_b38	SLC35E2	10.241	4.46e-22	0.142781	87	0.013943	yes	CULTFB
chr1_1739131_T_C_b38	SLC35E2	9.852	1.06e-20	0.130621	107	0.013259	yes	CULTFB
chr1_1636278_G_T_b38	SLC35E2	9.515	1.55e-19	0.139987	74	0.014712	yes	CULTFB
chr1_1649976_G_A_b38	SLC35E2	8.965	1.1e-17	0.131597	67	0.014679	yes	CULTFB
chr1_1661562_G_C_b38	SLC35E2	8.19	3.3e-15	0.104199	104	0.012722	yes	CULTFB
chr1_1674633_C_CA_b38	SLC35E2	8.092	6.67e-15	0.128109	42	0.015832	yes	CULTFB
chr1_1667424_T_TAAAATA_b38	SLC35E2	7.854	3.53e-14	0.119179	63	0.015174	yes	CULTFB
chr1_1660683_C_T_b38	SLC35E2	-7.358	1.02e-12	-0.121646	37	0.016533	yes	CULTFB
chr1_1671148_C_T_b38	SLC35E2	7.337	1.17e-12	0.111529	57	0.0152	yes	CULTFB
chr1_1637577_T_C_b38	SLC35E2	-7.324	1.28e-12	-0.122685	30	0.016751	yes	CULTFB
chr1_1670423_AT_A_b38	SLC35E2	7.301	1.49e-12	0.128522	44	0.017604	yes	CULTFB
chr1_1654662_CT_C_b38	SLC35E2	7.297	1.52e-12	0.123599	58	0.016938	yes	CULTFB
chr1_1658830_C_G_b38	SLC35E2	-7.221	2.51e-12	-0.125045	27	0.017317	yes	CULTFB
chr1_1629332_G_T_b38	SLC35E2	7.186	3.14e-12	0.112722	53	0.015685	yes	CULTFB
chr1_1650000_G_A_b38	SLC35E2	7.165	3.61e-12	0.11035	58	0.015401	yes	CULTFB
chr1_1664865_A_G_b38	SLC35E2	-7.123	4.75e-12	-0.110868	50	0.015565	yes	CULTFB
chr1_1639348_G_T_b38	SLC35E2	-7.113	5.05e-12	-0.109774	61	0.015432	yes	CULTFB
chr1_1667424_T_TAAATA_b38	SLC35E2	-7.108	5.21e-12	-0.108161	71	0.015216	yes	CULTFB
chr1_1671097_G_C_b38	SLC35E2	7.054	7.4e-12	0.107995	56	0.01531	yes	CULTFB
chr1_1664757_T_C_b38	SLC35E2	-7.034	8.42e-12	-0.109715	49	0.015598	yes	CULTFB
chr1_1722690_TA_T_b38	SLC35E2	-7.029	8.7e-12	-0.155285	6	0.022093	yes	CULTFB
chr1_1728671_C_A_b38	SLC35E2	6.989	1.12e-11	0.133375	24	0.019083	yes	CULTFB
chr1_1668721_C_T_b38	SLC35E2	-6.96	1.34e-11	-0.117878	34	0.016936	yes	CULTFB
chr1_1613769_C_T_b38	SLC35E2	6.944	1.49e-11	0.109853	49	0.015819	yes	CULTFB
chr1_1729859_A_G_b38	SLC35E2	6.934	1.59e-11	0.130004	20	0.018749	yes	CULTFB
chr1_1722626_AGCG_A_b38	SLC35E2	6.927	1.66e-11	0.125052	39	0.018053	yes	CULTFB
chr1_1722625_A_T_b38	SLC35E2	6.91	1.85e-11	0.12465	39	0.018039	yes	CULTFB
chr1_1661420_C_A_b38	SLC35E2	-6.899	1.98e-11	-0.107032	55	0.015513	yes	CULTFB
chr1_1612562_T_TC_b38	SLC35E2	6.883	2.19e-11	0.102789	55	0.014933	yes	CULTFB
chr1_1659114_A_G_b38	SLC35E2	-6.867	2.43e-11	-0.106839	55	0.015559	yes	CULTFB
chr1_1659220_A_G_b38	SLC35E2	-6.867	2.43e-11	-0.106839	55	0.015559	yes	CULTFB
chr1_1659060_G_A_b38	SLC35E2	-6.862	2.51e-11	-0.114548	38	0.016694	yes	CULTFB
chr1_1658866_G_A_b38	SLC35E2	-6.812	3.43e-11	-0.105525	56	0.015492	yes	CULTFB
chr1_1667948_A_G_b38	SLC35E2	-6.764	4.63e-11	-0.120678	25	0.017842	yes	CULTFB
chr1_1649846_G_A_b38	SLC35E2	-6.685	7.51e-11	-0.116241	24	0.017387	yes	CULTFB
chr1_1648826_A_G_b38	SLC35E2	-6.673	8.09e-11	-0.106508	57	0.01596	yes	CULTFB
chr1_1668108_C_T_b38	SLC35E2	6.665	8.5e-11	0.105776	50	0.01587	yes	CULTFB
chr1_1630798_C_T_b38	SLC35E2	6.618	1.14e-10	0.104971	47	0.015862	yes	CULTFB
chr1_1675228_C_CG_b38	SLC35E2	6.539	1.84e-10	0.100264	74	0.015334	yes	CULTFB
chr1_1651421_GTAGCCCCTCTGAACGGTCTGTGACACACGCATGCTTTCAGCTAGAGTACTCTA_G_b38	SLC35E2	-6.531	1.92e-10	-0.104335	47	0.015975	yes	CULTFB
chr1_1639685_G_A_b38	SLC35E2	-6.526	1.99e-10	-0.115041	27	0.017629	yes	CULTFB
chr1_1722619_C_T_b38	SLC35E2	6.51	2.18e-10	0.11731	41	0.018019	yes	CULTFB
chr1_1651137_C_T_b38	SLC35E2	-6.448	3.18e-10	-0.102763	49	0.015937	yes	CULTFB
chr1_1651267_T_C_b38	SLC35E2	-6.448	3.18e-10	-0.102763	49	0.015937	yes	CULTFB
chr1_1652135_C_G_b38	SLC35E2	-6.448	3.18e-10	-0.102763	49	0.015937	yes	CULTFB
chr1_1652191_C_T_b38	SLC35E2	-6.448	3.18e-10	-0.102763	49	0.015937	yes	CULTFB
chr1_1652592_A_G_b38	SLC35E2	-6.448	3.18e-10	-0.102763	49	0.015937	yes	CULTFB
chr1_1652779_A_G_b38	SLC35E2	-6.448	3.18e-10	-0.102763	49	0.015937	yes	CULTFB
chr1_1653147_A_C_b38	SLC35E2	-6.448	3.18e-10	-0.102763	49	0.015937	yes	CULTFB
chr1_1653396_T_C_b38	SLC35E2	-6.448	3.18e-10	-0.102763	49	0.015937	yes	CULTFB
chr1_1653472_T_C_b38	SLC35E2	-6.448	3.18e-10	-0.102763	49	0.015937	yes	CULTFB
chr1_1653811_G_A_b38	SLC35E2	-6.448	3.18e-10	-0.102763	49	0.015937	yes	CULTFB
chr1_1653893_C_T_b38	SLC35E2	-6.448	3.18e-10	-0.102763	49	0.015937	yes	CULTFB
chr1_1653934_G_A_b38	SLC35E2	-6.448	3.18e-10	-0.102763	49	0.015937	yes	CULTFB
chr1_1654143_G_A_b38	SLC35E2	-6.448	3.18e-10	-0.102763	49	0.015937	yes	CULTFB
chr1_1652061_T_C_b38	SLC35E2	-6.399	4.27e-10	-0.10169	50	0.015892	yes	CULTFB
chr1_1654188_T_G_b38	SLC35E2	-6.399	4.27e-10	-0.10169	50	0.015892	yes	CULTFB
chr1_1651926_T_C_b38	SLC35E2	-6.382	4.72e-10	-0.10195	49	0.015976	yes	CULTFB
chr1_1650195_A_G_b38	SLC35E2	-6.368	5.13e-10	-0.102081	51	0.016031	yes	CULTFB
chr1_1651574_G_A_b38	SLC35E2	-6.348	5.77e-10	-0.101339	49	0.015964	yes	CULTFB
chr1_1692286_C_A_b38	SLC35E2	6.32	6.81e-10	0.142589	3	0.022562	yes	CULTFB
chr1_1650777_G_A_b38	SLC35E2	-6.316	6.97e-10	-0.100402	49	0.015897	yes	CULTFB
chr1_1651785_C_A_b38	SLC35E2	-6.296	7.85e-10	-0.100527	49	0.015968	yes	CULTFB
chr1_1648636_G_A_b38	SLC35E2	-6.287	8.25e-10	-0.101508	57	0.016145	yes	CULTFB
chr1_1652913_C_T_b38	SLC35E2	-6.257	9.87e-10	-0.1072	34	0.017134	yes	CULTFB
chr1_1621352_G_A_b38	SLC35E2	6.247	1.04e-09	0.095053	57	0.015216	yes	CULTFB
chr1_1660408_T_C_b38	SLC35E2	-6.223	1.2e-09	-0.120083	12	0.019296	yes	CULTFB
chr1_1730405_G_C_b38	SLC35E2	6.186	1.49e-09	0.1001	74	0.016182	yes	CULTFB
chr1_1675132_A_G_b38	SLC35E2	6.101	2.43e-09	0.094526	63	0.015493	yes	CULTFB
chr1_1708474_C_A_b38	SLC35E2	-6.091	2.57e-09	-0.112733	16	0.018508	yes	CULTFB
chr1_1606384_A_G_b38	SLC35E2	6.047	3.32e-09	0.090836	61	0.015022	yes	CULTFB
chr1_1739519_C_G_b38	SLC35E2	6.02	3.86e-09	0.107172	41	0.017803	yes	CULTFB
chr1_1620609_G_A_b38	SLC35E2	5.997	4.41e-09	0.091712	54	0.015294	yes	CULTFB
chr1_1649993_A_G_b38	SLC35E2	-5.916	6.93e-09	-0.085032	114	0.014372	yes	CULTFB
chr1_1676287_C_T_b38	SLC35E2	-5.828	1.13e-08	-0.112255	12	0.019262	yes	CULTFB
chr1_1622295_G_C_b38	SLC35E2	5.823	1.17e-08	0.089032	54	0.01529	yes	CULTFB
chr1_1641261_C_T_b38	SLC35E2	-5.768	1.58e-08	-0.108567	19	0.018823	yes	CULTFB
chr1_1641275_A_G_b38	SLC35E2	-5.765	1.61e-08	-0.095359	55	0.016542	yes	CULTFB
chr1_1638879_C_T_b38	SLC35E2	-5.758	1.66e-08	-0.098961	33	0.017185	yes	CULTFB
chr1_1708521_C_G_b38	SLC35E2	-5.755	1.7e-08	-0.098113	32	0.017049	yes	CULTFB
chr1_1742587_G_C_b38	SLC35E2	5.736	1.88e-08	0.083288	113	0.01452	yes	CULTFB
chr1_1600320_C_G_b38	SLC35E2	5.523	5.91e-08	0.086029	49	0.015576	yes	CULTFB
chr1_1600379_C_T_b38	SLC35E2	5.5	6.67e-08	0.084674	51	0.015395	yes	CULTFB
chr1_1658422_T_C_b38	SLC35E2	5.471	7.76e-08	0.104519	14	0.019103	yes	CULTFB
chr1_1650688_T_A_b38	SLC35E2	-5.458	8.32e-08	-0.095032	35	0.017411	yes	CULTFB
chr1_1609058_G_A_b38	SLC35E2	5.449	8.72e-08	0.084507	51	0.015508	yes	CULTFB
chr1_1672155_G_A_b38	SLC35E2	-5.426	9.85e-08	-0.087797	42	0.016181	yes	CULTFB
chr1_1607931_G_A_b38	SLC35E2	5.416	1.04e-07	0.084572	50	0.015614	yes	CULTFB
chr1_1650664_CTTTTT_C_b38	SLC35E2	-5.297	1.92e-07	-0.098201	24	0.018537	yes	CULTFB
chr1_1755504_T_C_b38	SLC35E2	5.182	3.45e-07	0.074823	112	0.014439	yes	CULTFB
chr1_1606532_GTGGGCTGGGCTGGTCAGGCA_G_b38	SLC35E2	5.075	5.89e-07	0.079416	48	0.015649	yes	CULTFB
chr1_1743714_C_CA_b38	SLC35E2	5.072	5.96e-07	0.084123	59	0.016586	yes	CULTFB
chr1_1589495_CTTT_C_b38	SLC35E2	5.062	6.27e-07	0.087615	35	0.017309	yes	CULTFB
chr1_1635226_T_C_b38	SLC35E2	-5.021	7.67e-07	-0.106959	11	0.021303	yes	CULTFB
chr1_1595028_C_CAG_b38	SLC35E2	4.969	9.9e-07	0.086052	30	0.017319	yes	CULTFB
chr1_1671724_C_T_b38	SLC35E2	-4.967	9.96e-07	-0.082849	35	0.016679	yes	CULTFB
chr1_1757725_C_T_b38	SLC35E2	4.946	1.1e-06	0.075454	82	0.015255	yes	CULTFB
chr1_1752126_G_A_b38	SLC35E2	4.861	1.66e-06	0.078746	60	0.016199	yes	CULTFB
chr1_1754601_G_T_b38	SLC35E2	4.823	1.99e-06	0.073557	82	0.01525	yes	CULTFB
chr1_1744854_C_A_b38	SLC35E2	-4.817	2.05e-06	-0.068108	73	0.014139	yes	CULTFB
chr1_1692151_T_C_b38	SLC35E2	-4.729	3.11e-06	-0.079919	35	0.0169	yes	CULTFB
chr1_1679100_A_G_b38	SLC35E2	-4.713	3.34e-06	-0.073731	82	0.015644	yes	CULTFB
chr1_1586962_C_T_b38	SLC35E2	4.706	3.46e-06	0.076492	53	0.016255	yes	CULTFB
chr1_1750226_C_T_b38	SLC35E2	4.688	3.76e-06	0.070157	88	0.014965	yes	CULTFB
chr1_1597128_C_CCCTCAGCTGGACT_b38	SLC35E2	-4.673	4.03e-06	-0.071615	69	0.015327	yes	CULTFB
chr1_1594890_G_GAC_b38	SLC35E2	-4.669	4.1e-06	-0.069993	96	0.014991	yes	CULTFB
chr1_1764023_C_A_b38	SLC35E2	4.659	4.29e-06	0.070232	86	0.015073	yes	CULTFB
chr1_1756186_T_C_b38	SLC35E2	4.589	5.93e-06	0.068985	85	0.015033	yes	CULTFB
chr1_1722599_G_A_b38	SLC35E2	4.579	6.19e-06	0.080328	55	0.017541	yes	CULTFB
chr1_1650383_G_T_b38	SLC35E2	-4.532	7.68e-06	-0.077573	38	0.017118	yes	CULTFB
chr1_1717507_T_C_b38	SLC35E2	4.524	7.95e-06	0.102693	15	0.0227	yes	CULTFB
chr1_1725582_T_C_b38	SLC35E2	4.514	8.32e-06	0.061425	120	0.013609	yes	CULTFB
chr1_1926870_T_C_b38	SLC35E2	-4.513	8.34e-06	-0.065399	101	0.01449	yes	CULTFB
chr1_1743851_C_T_b38	SLC35E2	-4.513	8.37e-06	-0.07911	34	0.017531	yes	CULTFB
chr1_1649954_C_CA_b38	SLC35E2	-4.507	8.56e-06	-0.09105	17	0.0202	yes	CULTFB
chr1_1702383_T_C_b38	SLC35E2	-4.496	9.03e-06	-0.084291	19	0.01875	yes	CULTFB
chr1_1657085_C_CTAA_b38	SLC35E2	-4.457	1.07e-05	-0.083543	31	0.018746	yes	CULTFB
chr1_1658115_G_A_b38	SLC35E2	-4.451	1.1e-05	-0.141448	3	0.031778	yes	CULTFB
chr1_1591703_T_C_b38	SLC35E2	4.437	1.17e-05	0.06655	93	0.014998	yes	CULTFB
chr1_1866635_T_TA_b38	SLC35E2	4.403	1.37e-05	0.074753	58	0.01698	yes	CULTFB
chr1_1743840_T_C_b38	SLC35E2	-4.398	1.39e-05	-0.077468	36	0.017613	yes	CULTFB
chr1_1942014_G_A_b38	SLC35E2	-4.357	1.67e-05	-0.063763	109	0.014634	yes	CULTFB
chr1_1942075_A_G_b38	SLC35E2	-4.357	1.67e-05	-0.063763	109	0.014634	yes	CULTFB
chr1_1942086_T_C_b38	SLC35E2	-4.357	1.67e-05	-0.063763	109	0.014634	yes	CULTFB
chr1_1723766_C_T_b38	SLC35E2	-4.339	1.8e-05	-0.088722	24	0.020446	yes	CULTFB
chr1_1940973_C_T_b38	SLC35E2	-4.338	1.81e-05	-0.063435	113	0.014624	yes	CULTFB
chr1_1940540_G_A_b38	SLC35E2	-4.333	1.85e-05	-0.063723	111	0.014707	yes	CULTFB
chr1_1942258_G_A_b38	SLC35E2	-4.333	1.85e-05	-0.063723	111	0.014707	yes	CULTFB
chr1_1942260_G_C_b38	SLC35E2	-4.333	1.85e-05	-0.063723	111	0.014707	yes	CULTFB
chr1_1757074_G_T_b38	SLC35E2	4.315	2e-05	0.065103	84	0.015088	yes	CULTFB
chr1_1595306_CAG_C_b38	SLC35E2	-4.311	2.03e-05	-0.072524	102	0.016822	yes	CULTFB
chr1_1931587_A_G_b38	SLC35E2	-4.292	2.21e-05	-0.063167	110	0.014716	yes	CULTFB
chr1_1714674_G_C_b38	SLC35E2	4.292	2.21e-05	0.092832	31	0.02163	yes	CULTFB
chr1_1744499_C_T_b38	SLC35E2	-4.29	2.23e-05	-0.062746	87	0.014627	yes	CULTFB
chr1_1760882_T_C_b38	SLC35E2	4.282	2.31e-05	0.064731	97	0.015117	yes	CULTFB
chr1_1937841_ACACCAGGTCCACCTCTGGACACAGGTCCACC_A_b38	SLC35E2	-4.263	2.5e-05	-0.062572	111	0.014677	yes	CULTFB
chr1_1931580_CA_C_b38	SLC35E2	-4.246	2.69e-05	-0.062672	109	0.01476	yes	CULTFB
chr1_1937273_T_C_b38	SLC35E2	-4.236	2.8e-05	-0.062115	105	0.014662	yes	CULTFB
chr1_1938054_ACT_A_b38	SLC35E2	-4.219	3.02e-05	-0.061997	111	0.014693	yes	CULTFB
chr1_1969249_A_AGCCCT_b38	SLC35E2	4.215	3.07e-05	0.075143	24	0.017827	yes	CULTFB
chr1_1934565_G_A_b38	SLC35E2	-4.2	3.27e-05	-0.062874	111	0.014968	yes	CULTFB
chr1_1938332_A_ACT_b38	SLC35E2	-4.2	3.27e-05	-0.06164	112	0.014676	yes	CULTFB
chr1_1848037_C_CTA_b38	SLC35E2	4.193	3.38e-05	0.062944	100	0.015013	yes	CULTFB
chr1_1762759_AAATG_A_b38	SLC35E2	4.185	3.49e-05	0.063036	100	0.015063	yes	CULTFB
chr1_1844830_C_A_b38	SLC35E2	4.171	3.7e-05	0.0626	99	0.015009	yes	CULTFB
chr1_1840043_T_TA_b38	SLC35E2	4.169	3.73e-05	0.083839	8	0.020109	yes	CULTFB
chr1_1969479_G_A_b38	SLC35E2	4.163	3.83e-05	0.072598	26	0.017439	yes	CULTFB
chr1_1755523_C_T_b38	SLC35E2	4.16	3.88e-05	0.061424	119	0.014766	yes	CULTFB
chr1_1779667_T_TTG_b38	SLC35E2	4.152	4.01e-05	0.069268	59	0.016683	yes	CULTFB
chr1_1935938_T_C_b38	SLC35E2	-4.151	4.02e-05	-0.062432	93	0.015039	yes	CULTFB
chr1_1969235_A_G_b38	SLC35E2	4.145	4.12e-05	0.072847	25	0.017573	yes	CULTFB
chr1_1967980_A_AAGAATGAG_b38	SLC35E2	4.137	4.27e-05	0.07027	29	0.016987	yes	CULTFB
chr1_1661169_C_A_b38	SLC35E2	4.124	4.51e-05	0.069404	34	0.01683	yes	CULTFB
chr1_1657081_C_T_b38	SLC35E2	-4.123	4.52e-05	-0.07641	31	0.018531	yes	CULTFB
chr1_1968900_A_G_b38	SLC35E2	4.123	4.52e-05	0.068465	33	0.016606	yes	CULTFB
chr1_1936077_C_T_b38	SLC35E2	-4.111	4.76e-05	-0.060796	113	0.014789	yes	CULTFB
chr1_1692124_T_G_b38	SLC35E2	-4.094	5.1e-05	-0.069157	36	0.016892	yes	CULTFB
chr1_1708855_TTCCTCCTCC_T_b38	SLC35E2	4.088	5.24e-05	0.065223	83	0.015956	yes	CULTFB
chr1_1969238_C_T_b38	SLC35E2	4.075	5.51e-05	0.071509	25	0.017547	yes	CULTFB
chr1_1781909_C_T_b38	SLC35E2	4.057	5.94e-05	0.06072	99	0.014966	yes	CULTFB
chr1_1749637_G_T_b38	SLC35E2	4.054	6.01e-05	0.059606	88	0.014702	yes	CULTFB
chr1_1936627_C_G_b38	SLC35E2	-4.052	6.07e-05	-0.060514	104	0.014934	yes	CULTFB
chr1_1653319_A_G_b38	SLC35E2	4.052	6.08e-05	0.068084	35	0.016804	yes	CULTFB
chr1_1650664_CT_C_b38	SLC35E2	4.049	6.13e-05	0.080527	24	0.019886	yes	CULTFB
chr1_1960609_G_C_b38	SLC35E2	-4.042	6.33e-05	-0.059825	92	0.014801	yes	CULTFB
chr1_1914634_G_T_b38	SLC35E2	-4.039	6.4e-05	-0.059257	110	0.01467	yes	CULTFB
chr1_1916670_G_C_b38	SLC35E2	-4.039	6.4e-05	-0.059257	110	0.01467	yes	CULTFB
chr1_1732892_CT_C_b38	SLC35E2	4.038	6.43e-05	0.085427	8	0.021156	yes	CULTFB
chr1_1933087_C_T_b38	SLC35E2	-4.033	6.56e-05	-0.05949	107	0.014751	yes	CULTFB
chr1_1933859_A_G_b38	SLC35E2	-4.033	6.56e-05	-0.05949	107	0.014751	yes	CULTFB
chr1_1921745_T_C_b38	SLC35E2	-4.031	6.63e-05	-0.059054	106	0.014652	yes	CULTFB
chr1_1593732_G_C_b38	SLC35E2	-4.026	6.76e-05	-0.060571	97	0.015046	yes	CULTFB
chr1_1968924_GCCCTCCTGGGGGCTCCGGTCCTGCCCAGCAGCCCCAGGTGAGACAGCGCCTGGCGGCCCCTCCCTAGCT_G_b38	SLC35E2	4.02	6.92e-05	0.0668	33	0.016616	yes	CULTFB
chr1_1969006_C_T_b38	SLC35E2	4.008	7.28e-05	0.066275	34	0.016537	yes	CULTFB
chr1_1968012_GTGAA_G_b38	SLC35E2	3.993	7.73e-05	0.066999	31	0.01678	yes	CULTFB
chr1_1734308_T_C_b38	SLC35E2	3.989	7.87e-05	0.093839	19	0.023527	yes	CULTFB
chr1_1922670_A_G_b38	SLC35E2	-3.983	8.05e-05	-0.058589	107	0.014711	yes	CULTFB
chr1_1916417_G_T_b38	SLC35E2	-3.971	8.44e-05	-0.058502	110	0.014732	yes	CULTFB
chr1_1963738_C_T_b38	SLC35E2	3.966	8.61e-05	0.066868	30	0.01686	yes	CULTFB
chr1_1965114_C_T_b38	SLC35E2	3.966	8.61e-05	0.066868	30	0.01686	yes	CULTFB
chr1_1966910_C_T_b38	SLC35E2	3.966	8.61e-05	0.066868	30	0.01686	yes	CULTFB
chr1_1747695_A_G_b38	SLC35E2	-3.963	8.73e-05	-0.051701	101	0.013046	yes	CULTFB
chr1_1744052_GAGA_G_b38	SLC35E2	-3.951	9.14e-05	-0.074509	25	0.018857	yes	CULTFB
chr1_1970506_T_A_b38	SLC35E2	-3.941	9.53e-05	-0.060486	80	0.015348	yes	CULTFB
chr1_1968793_T_C_b38	SLC35E2	3.938	9.67e-05	0.058977	94	0.014978	yes	CULTFB
chr1_1928648_C_T_b38	SLC35E2	-3.92	0.000104	-0.057503	107	0.01467	yes	CULTFB
chr1_1627057_C_G_b38	SLC35E2	-3.908	0.000109	-0.067113	36	0.017172	yes	CULTFB
chr1_1743238_G_C_b38	SLC35E2	-3.906	0.00011	-0.06009	73	0.015384	yes	CULTFB
chr1_1963533_C_CA_b38	SLC35E2	3.902	0.000111	0.058306	98	0.014943	yes	CULTFB
chr1_1606507_GTGGGC_G_b38	SLC35E2	3.896	0.000114	0.056203	132	0.014425	yes	CULTFB
chr1_1743544_CA_C_b38	SLC35E2	3.883	0.00012	0.055687	102	0.014342	yes	CULTFB
chr1_1953296_CTT_C_b38	SLC35E2	-3.876	0.000123	-0.116027	4	0.029932	yes	CULTFB
chr1_1963406_G_A_b38	SLC35E2	3.873	0.000125	0.065114	30	0.016813	yes	CULTFB
chr1_1743886_C_T_b38	SLC35E2	-3.872	0.000125	-0.06671	40	0.017228	yes	CULTFB
chr1_1967499_G_A_b38	SLC35E2	3.87	0.000127	0.057575	93	0.014878	yes	CULTFB
chr1_1715541_A_C_b38	SLC35E2	3.855	0.000134	0.135223	3	0.035073	yes	CULTFB
chr1_1584321_T_C_b38	SLC35E2	-3.855	0.000134	-0.061286	73	0.015897	yes	CULTFB
chr1_1969229_T_A_b38	SLC35E2	3.846	0.000139	0.067757	25	0.017616	yes	CULTFB
chr1_1964101_A_G_b38	SLC35E2	3.84	0.000142	0.064726	30	0.016854	yes	CULTFB
chr1_1964746_T_C_b38	SLC35E2	3.84	0.000142	0.064726	30	0.016854	yes	CULTFB
chr1_1964784_C_T_b38	SLC35E2	3.84	0.000142	0.064726	30	0.016854	yes	CULTFB
chr1_1966030_A_G_b38	SLC35E2	3.84	0.000142	0.064726	30	0.016854	yes	CULTFB
chr1_1966314_C_G_b38	SLC35E2	3.84	0.000142	0.064726	30	0.016854	yes	CULTFB
chr1_1966930_G_A_b38	SLC35E2	3.84	0.000142	0.064726	30	0.016854	yes	CULTFB
chr1_1967246_T_C_b38	SLC35E2	3.84	0.000142	0.064726	30	0.016854	yes	CULTFB
chr1_1967338_G_C_b38	SLC35E2	3.84	0.000142	0.064726	30	0.016854	yes	CULTFB
chr1_1967340_C_A_b38	SLC35E2	3.84	0.000142	0.064726	30	0.016854	yes	CULTFB
chr1_1967389_T_C_b38	SLC35E2	3.84	0.000142	0.064726	30	0.016854	yes	CULTFB
chr1_1967396_C_A_b38	SLC35E2	3.84	0.000142	0.064726	30	0.016854	yes	CULTFB
chr1_1967420_G_A_b38	SLC35E2	3.84	0.000142	0.064726	30	0.016854	yes	CULTFB
chr1_1967495_T_C_b38	SLC35E2	3.84	0.000142	0.064726	30	0.016854	yes	CULTFB
chr1_1967536_G_A_b38	SLC35E2	3.84	0.000142	0.064726	30	0.016854	yes	CULTFB
chr1_1967725_G_C_b38	SLC35E2	3.84	0.000142	0.064726	30	0.016854	yes	CULTFB
chr1_1967840_A_T_b38	SLC35E2	3.84	0.000142	0.064726	30	0.016854	yes	CULTFB
chr1_1967880_T_C_b38	SLC35E2	3.84	0.000142	0.064726	30	0.016854	yes	CULTFB
chr1_1968422_C_T_b38	SLC35E2	3.84	0.000142	0.064726	30	0.016854	yes	CULTFB
chr1_1615869_C_T_b38	SLC35E2	3.836	0.000145	0.06088	56	0.015871	yes	CULTFB
chr1_1968585_TG_T_b38	SLC35E2	3.835	0.000145	0.064221	31	0.016748	yes	CULTFB
chr1_1964663_G_A_b38	SLC35E2	3.822	0.000153	0.065043	29	0.017019	yes	CULTFB
chr1_1968103_A_ATGAG_b38	SLC35E2	3.801	0.000166	0.064122	30	0.016868	yes	CULTFB
chr1_1968667_T_TCTC_b38	SLC35E2	3.796	0.000169	0.064112	30	0.016887	yes	CULTFB
chr1_1820337_A_G_b38	SLC35E2	3.795	0.00017	0.056256	107	0.014824	yes	CULTFB
chr1_2055132_C_T_b38	SLC35E2	-3.794	0.00017	-0.168864	13	0.044506	yes	CULTFB
chr1_1742672_C_T_b38	SLC35E2	-3.788	0.000175	-0.058144	74	0.015351	yes	CULTFB
chr1_1966152_C_T_b38	SLC35E2	3.777	0.000182	0.064364	29	0.017043	yes	CULTFB
chr1_1904424_A_AAAATAAATAAAT_b38	SLC35E2	3.764	0.000191	0.053221	89	0.014139	yes	CULTFB
chr1_1758323_T_C_b38	SLC35E2	3.762	0.000193	0.056185	93	0.014934	yes	CULTFB
chr1_1842403_C_A_b38	SLC35E2	3.761	0.000193	0.124347	3	0.033059	yes	CULTFB
chr1_1851999_C_A_b38	SLC35E2	3.761	0.000193	0.124347	3	0.033059	yes	CULTFB
chr1_1968130_GTGAA_G_b38	SLC35E2	3.757	0.000197	0.063728	29	0.016961	yes	CULTFB
chr1_1950071_C_A_b38	SLC35E2	3.741	0.000209	0.060631	43	0.016207	yes	CULTFB
chr1_1752461_G_A_b38	SLC35E2	-3.733	0.000216	-0.057122	90	0.015304	yes	CULTFB
chr1_1918091_T_C_b38	SLC35E2	-3.724	0.000224	-0.107081	9	0.028756	yes	CULTFB
chr1_1918305_G_A_b38	SLC35E2	-3.724	0.000224	-0.107081	9	0.028756	yes	CULTFB
chr1_1966606_G_A_b38	SLC35E2	3.72	0.000227	0.063185	29	0.016985	yes	CULTFB
chr1_1951498_C_T_b38	SLC35E2	3.711	0.000235	0.060659	42	0.016345	yes	CULTFB
chr1_1951642_C_T_b38	SLC35E2	3.701	0.000244	0.060362	42	0.016311	yes	CULTFB
chr1_1749826_A_G_b38	SLC35E2	-3.699	0.000245	-0.053797	105	0.014543	yes	CULTFB
chr1_1925075_G_A_b38	SLC35E2	-3.688	0.000256	-0.102339	12	0.027749	yes	CULTFB
chr1_1627515_C_T_b38	SLC35E2	3.685	0.00026	0.056414	97	0.015311	yes	CULTFB
chr1_1976855_C_CTT_b38	SLC35E2	3.677	0.000267	0.065191	25	0.017728	yes	CULTFB
chr1_1743565_AT_A_b38	SLC35E2	3.671	0.000273	0.051067	120	0.013911	yes	CULTFB
chr1_1743586_T_TAC_b38	SLC35E2	-3.663	0.000282	-0.05876	53	0.016041	yes	CULTFB
chr1_1921945_G_A_b38	SLC35E2	-3.652	0.000294	-0.103393	10	0.028314	yes	CULTFB
chr1_1924931_G_A_b38	SLC35E2	-3.652	0.000294	-0.103393	10	0.028314	yes	CULTFB
chr1_1929558_G_A_b38	SLC35E2	-3.652	0.000294	-0.103393	10	0.028314	yes	CULTFB
chr1_1617375_T_C_b38	SLC35E2	3.649	0.000297	0.058686	53	0.016082	yes	CULTFB
chr1_1618213_C_G_b38	SLC35E2	3.649	0.000297	0.058686	53	0.016082	yes	CULTFB
chr1_1618290_G_C_b38	SLC35E2	3.649	0.000297	0.058686	53	0.016082	yes	CULTFB
chr1_1963538_T_C_b38	SLC35E2	3.64	0.000307	0.05404	92	0.014845	yes	CULTFB
chr1_1916540_T_C_b38	SLC35E2	-3.628	0.000322	-0.104051	9	0.028683	yes	CULTFB
chr1_1916721_A_G_b38	SLC35E2	-3.628	0.000322	-0.104051	9	0.028683	yes	CULTFB
chr1_1917393_A_AAC_b38	SLC35E2	-3.628	0.000322	-0.104051	9	0.028683	yes	CULTFB
chr1_1919475_A_G_b38	SLC35E2	-3.628	0.000322	-0.104051	9	0.028683	yes	CULTFB
chr1_1923107_C_T_b38	SLC35E2	-3.626	0.000324	-0.100801	12	0.027802	yes	CULTFB
chr1_1925663_A_G_b38	SLC35E2	-3.626	0.000324	-0.100801	12	0.027802	yes	CULTFB
chr1_1926722_C_T_b38	SLC35E2	-3.626	0.000324	-0.100801	12	0.027802	yes	CULTFB
chr1_1928702_C_T_b38	SLC35E2	-3.626	0.000324	-0.100801	12	0.027802	yes	CULTFB
chr1_1957760_T_C_b38	SLC35E2	-3.612	0.000341	-0.111239	6	0.030793	yes	CULTFB
chr1_1939898_G_A_b38	SLC35E2	-3.597	0.000361	-0.106323	8	0.02956	yes	CULTFB
chr1_1752908_C_CCCT_b38	SLC35E2	-3.592	0.000368	-0.058286	70	0.016227	yes	CULTFB
chr1_1688328_C_T_b38	SLC35E2	-3.591	0.000369	-0.06149	30	0.017122	yes	CULTFB
chr1_1624323_AT_A_b38	SLC35E2	3.578	0.000388	0.055123	73	0.015408	yes	CULTFB
chr1_1918989_A_G_b38	SLC35E2	-3.575	0.000392	-0.052008	110	0.014549	yes	CULTFB
chr1_1976566_T_C_b38	SLC35E2	3.568	0.000402	0.054184	86	0.015186	yes	CULTFB
chr1_1744096_C_T_b38	SLC35E2	-3.567	0.000404	-0.07774	57	0.021795	yes	CULTFB
chr1_1672015_G_C_b38	SLC35E2	-3.564	0.000407	-0.152786	5	0.042864	yes	CULTFB
chr1_1921955_T_C_b38	SLC35E2	-3.559	0.000416	-0.100541	10	0.028252	yes	CULTFB
chr1_2070779_G_A_b38	SLC35E2	-3.557	0.000418	-0.139389	15	0.039185	yes	CULTFB
chr1_1916092_C_T_b38	SLC35E2	-3.555	0.000422	-0.1004	10	0.028245	yes	CULTFB
chr1_1753361_G_A_b38	SLC35E2	-3.554	0.000424	-0.05459	90	0.015362	yes	CULTFB
chr1_1957243_T_C_b38	SLC35E2	-3.553	0.000426	-0.107858	7	0.030361	yes	CULTFB
chr1_1922424_T_C_b38	SLC35E2	-3.539	0.000448	-0.098285	12	0.027774	yes	CULTFB
chr1_1922482_T_C_b38	SLC35E2	-3.539	0.000448	-0.098285	12	0.027774	yes	CULTFB
chr1_1926632_G_T_b38	SLC35E2	-3.539	0.000448	-0.098285	12	0.027774	yes	CULTFB
chr1_1927737_T_C_b38	SLC35E2	-3.539	0.000448	-0.098285	12	0.027774	yes	CULTFB
chr1_1929937_C_T_b38	SLC35E2	-3.539	0.000448	-0.098285	12	0.027774	yes	CULTFB
chr1_2054960_T_A_b38	SLC35E2	-3.533	0.000457	-0.154608	13	0.043761	yes	CULTFB
chr1_1943993_C_A_b38	SLC35E2	-3.512	0.000493	-0.105242	8	0.029964	yes	CULTFB
chr1_1756043_G_T_b38	SLC35E2	-3.512	0.000494	-0.053979	91	0.01537	yes	CULTFB
chr1_1835922_G_GAAA_b38	SLC35E2	-3.511	0.000496	-0.137153	7	0.039063	yes	CULTFB
chr1_1613322_T_C_b38	SLC35E2	3.508	0.000502	0.056289	51	0.016047	yes	CULTFB
chr1_1657093_C_A_b38	SLC35E2	-3.495	0.000525	-0.065709	32	0.0188	yes	CULTFB
chr1_1865278_A_C_b38	SLC35E2	3.493	0.000529	0.053412	87	0.015291	yes	CULTFB
chr1_1945842_A_AAAAGAAC_b38	SLC35E2	-3.477	0.000562	-0.05643	64	0.016232	yes	CULTFB
chr1_1922149_C_T_b38	SLC35E2	-3.467	0.000581	-0.097673	10	0.028171	yes	CULTFB
chr1_1613421_T_C_b38	SLC35E2	3.465	0.000585	0.055966	50	0.01615	yes	CULTFB
chr1_1616547_T_C_b38	SLC35E2	3.464	0.000588	0.055911	51	0.016141	yes	CULTFB
chr1_1965250_G_GA_b38	SLC35E2	3.458	6e-04	0.057924	33	0.01675	yes	CULTFB
chr1_1943403_C_G_b38	SLC35E2	3.455	0.000608	0.112956	4	0.032695	yes	CULTFB
chr1_1948919_T_TCCTTCCCTCCTCTTTCCCTCCCTTCTTTCCTTCCCTTTCCCTCCCTC_b38	SLC35E2	-3.453	0.000612	-0.04746	88	0.013745	yes	CULTFB
chr1_1726053_G_C_b38	SLC35E2	3.421	0.000685	0.076576	17	0.022382	yes	CULTFB
chr1_1769969_CAAAACA_C_b38	SLC35E2	3.42	0.000688	0.051345	94	0.015012	yes	CULTFB
chr1_1755713_G_A_b38	SLC35E2	-3.411	0.000712	-0.052984	80	0.015534	yes	CULTFB
chr1_1754482_TCCCTGGGACCGAAGTCGCCCCA_T_b38	SLC35E2	-3.409	0.000716	-0.0522	91	0.015312	yes	CULTFB
chr1_1608244_T_C_b38	SLC35E2	3.407	0.00072	0.05711	36	0.01676	yes	CULTFB
chr1_1919773_C_T_b38	SLC35E2	-3.406	0.000723	-0.096502	10	0.028331	yes	CULTFB
chr1_1923278_C_T_b38	SLC35E2	-3.404	0.000729	-0.094587	12	0.027787	yes	CULTFB
chr1_1698048_T_C_b38	SLC35E2	-3.401	0.000736	-0.110569	8	0.032507	yes	CULTFB
chr1_1668373_C_T_b38	SLC35E2	3.401	0.000736	0.061714	55	0.018144	yes	CULTFB
chr1_1955420_C_T_b38	SLC35E2	3.394	0.000756	0.055791	39	0.016438	yes	CULTFB
chr1_1546962_G_A_b38	SLC35E2	-3.373	0.000814	-0.133622	13	0.039614	yes	CULTFB
chr1_1962845_T_C_b38	SLC35E2	3.336	0.000928	0.056627	30	0.016976	yes	CULTFB
chr1_1744028_A_AC_b38	SLC35E2	-3.327	0.000957	-0.062982	23	0.018932	yes	CULTFB
chr1_1047614_T_C_b38	SLC35E2	3.323	0.00097	0.078319	16	0.023568	yes	CULTFB
chr1_1924231_CCCT_C_b38	SLC35E2	-3.317	0.00099	-0.184156	3	0.055518	yes	CULTFB
chr1_1715553_G_A_b38	SLC35E2	3.295	0.00107	0.082077	30	0.024911	yes	CULTFB
chr1_1750280_A_G_b38	SLC35E2	-3.293	0.00107	-0.048899	99	0.014847	yes	CULTFB
chr1_1750528_G_A_b38	SLC35E2	-3.292	0.00108	-0.046126	90	0.014012	yes	CULTFB
chr1_1613974_G_A_b38	SLC35E2	3.279	0.00113	0.055361	34	0.016883	yes	CULTFB
chr1_1697979_G_A_b38	SLC35E2	-3.27	0.00117	-0.072688	6	0.022228	yes	CULTFB
chr1_1931743_CA_C_b38	SLC35E2	-3.268	0.00117	-0.059395	27	0.018173	yes	CULTFB
chr1_1618982_G_A_b38	SLC35E2	3.266	0.00118	0.05533	34	0.016942	yes	CULTFB
chr1_1220377_C_T_b38	SLC35E2	-3.259	0.00121	-0.096156	17	0.029505	yes	CULTFB
chr1_1707555_C_T_b38	SLC35E2	-3.257	0.00122	-0.094149	38	0.028906	yes	CULTFB
chr1_1919746_G_T_b38	SLC35E2	-3.246	0.00127	-0.089842	12	0.02768	yes	CULTFB
chr1_1919749_A_G_b38	SLC35E2	-3.246	0.00127	-0.089842	12	0.02768	yes	CULTFB
chr1_1956754_C_A_b38	SLC35E2	3.238	0.0013	0.053253	39	0.016446	yes	CULTFB
chr1_1720288_G_A_b38	SLC35E2	3.232	0.00133	0.083804	30	0.025928	yes	CULTFB
chr1_1939322_T_G_b38	SLC35E2	-3.225	0.00136	-0.095943	8	0.029753	yes	CULTFB
chr1_1624086_G_A_b38	SLC35E2	-3.213	0.00142	-0.050705	79	0.01578	yes	CULTFB
chr1_932613_GTTTC_G_b38	SLC35E2	3.211	0.00143	0.118393	19	0.036874	yes	CULTFB
chr1_1748780_G_A_b38	SLC35E2	-3.182	0.00157	-0.048087	102	0.01511	yes	CULTFB
chr1_1774697_T_C_b38	SLC35E2	3.181	0.00158	0.086318	12	0.027136	yes	CULTFB
chr1_1759611_C_T_b38	SLC35E2	-3.173	0.00162	-0.048796	92	0.01538	yes	CULTFB
chr1_1615322_A_G_b38	SLC35E2	3.161	0.00169	0.051453	51	0.016277	yes	CULTFB
chr1_1609909_G_T_b38	SLC35E2	3.15	0.00175	0.053102	37	0.016856	yes	CULTFB
chr1_1948938_C_T_b38	SLC35E2	-3.144	0.00179	-0.04385	87	0.013948	yes	CULTFB
chr1_1957772_GGC_G_b38	SLC35E2	-3.124	0.00191	-0.102186	4	0.032712	yes	CULTFB
chr1_1662855_T_C_b38	SLC35E2	-3.115	0.00197	-0.075157	29	0.024128	yes	CULTFB
chr1_908943_CGTTGCTGGT_C_b38	SLC35E2	3.113	0.00198	0.064737	26	0.020796	yes	CULTFB
chr1_1596899_A_C_b38	SLC35E2	3.111	0.00199	0.056092	25	0.018028	yes	CULTFB
chr1_1955652_CG_C_b38	SLC35E2	3.096	0.00209	0.051173	38	0.016526	yes	CULTFB
chr1_1955672_GC_G_b38	SLC35E2	3.096	0.00209	0.051173	38	0.016526	yes	CULTFB
chr1_1603989_T_C_b38	SLC35E2	3.091	0.00213	0.051968	38	0.016813	yes	CULTFB
chr1_1047561_T_C_b38	SLC35E2	3.079	0.00222	0.071043	23	0.023073	yes	CULTFB
chr1_1716210_C_CT_b38	SLC35E2	3.074	0.00225	0.080289	30	0.026119	yes	CULTFB
chr1_1766668_C_T_b38	SLC35E2	3.067	0.00231	0.082045	12	0.026754	yes	CULTFB
chr1_1662738_CT_C_b38	SLC35E2	-3.065	0.00232	-0.075074	28	0.024494	yes	CULTFB
chr1_1971864_C_T_b38	SLC35E2	3.064	0.00233	0.046414	80	0.01515	yes	CULTFB
chr1_1736836_A_G_b38	SLC35E2	3.061	0.00235	0.045742	120	0.014944	yes	CULTFB
chr1_1051063_C_T_b38	SLC35E2	3.046	0.00247	0.069989	23	0.022981	yes	CULTFB
chr1_1732685_T_C_b38	SLC35E2	3.034	0.00257	0.077291	43	0.025475	yes	CULTFB
chr1_1734899_G_A_b38	SLC35E2	3.034	0.00257	0.077291	43	0.025475	yes	CULTFB
chr1_1160003_G_A_b38	SLC35E2	3.033	0.00257	0.057372	19	0.018915	yes	CULTFB
chr1_1999860_A_T_b38	SLC35E2	3.03	0.0026	0.060777	14	0.020061	yes	CULTFB
chr1_1614340_C_T_b38	SLC35E2	3.028	0.00262	0.072685	5	0.024005	yes	CULTFB
chr1_1604202_G_A_b38	SLC35E2	3.024	0.00265	0.048967	62	0.01619	yes	CULTFB
chr1_1923880_C_T_b38	SLC35E2	-3.017	0.00271	-0.083624	12	0.027717	yes	CULTFB
chr1_1798925_C_CT_b38	SLC35E2	-3.01	0.00278	-0.050204	38	0.01668	yes	CULTFB
chr1_1042190_G_A_b38	SLC35E2	3.008	0.00279	0.068177	28	0.022669	yes	CULTFB
chr1_1759354_G_A_b38	SLC35E2	-3.004	0.00282	-0.046369	90	0.015434	yes	CULTFB
chr1_1047064_A_G_b38	SLC35E2	2.996	0.0029	0.069015	17	0.023036	yes	CULTFB
chr1_1714635_A_G_b38	SLC35E2	2.995	0.00291	0.064225	12	0.021445	yes	CULTFB
chr1_1601796_A_C_b38	SLC35E2	2.971	0.00315	0.048019	63	0.016165	yes	CULTFB
chr1_2003636_G_C_b38	SLC35E2	2.958	0.00328	0.059443	14	0.020099	yes	CULTFB
chr1_1714638_G_T_b38	SLC35E2	2.956	0.0033	0.06419	10	0.021718	yes	CULTFB
chr1_1708486_C_A_b38	SLC35E2	2.952	0.00334	0.041458	92	0.014045	yes	CULTFB
chr1_1725697_T_C_b38	SLC35E2	2.944	0.00343	0.053144	43	0.018053	yes	CULTFB
chr1_1457615_C_A_b38	SLC35E2	-2.936	0.00351	-0.06419	23	0.021862	yes	CULTFB
chr1_1703583_A_G_b38	SLC35E2	-2.91	0.00381	-0.078155	31	0.026855	yes	CULTFB
chr1_1594570_A_G_b38	SLC35E2	2.909	0.00382	0.04682	57	0.016096	yes	CULTFB
chr1_1739115_T_C_b38	SLC35E2	-2.903	0.0039	-0.123281	5	0.042469	yes	CULTFB
chr1_1855158_CA_C_b38	SLC35E2	2.902	0.00391	0.057769	14	0.01991	yes	CULTFB
chr1_2000742_G_C_b38	SLC35E2	2.9	0.00393	0.057857	14	0.019949	yes	CULTFB
chr1_1737789_T_C_b38	SLC35E2	2.9	0.00394	0.072039	10	0.024845	yes	CULTFB
chr1_2003928_C_CGGGCCG_b38	SLC35E2	-2.897	0.00397	-0.045332	58	0.01565	yes	CULTFB
chr1_1876492_C_CGA_b38	SLC35E2	2.88	0.00419	0.062252	4	0.021617	yes	CULTFB
chr1_2004070_T_C_b38	SLC35E2	2.879	0.0042	0.057088	14	0.019829	yes	CULTFB
chr1_1762664_A_G_b38	SLC35E2	2.874	0.00426	0.080159	10	0.027891	yes	CULTFB
chr1_1611248_ATC_A_b38	SLC35E2	-2.87	0.00431	-0.052182	19	0.018181	yes	CULTFB
chr1_1841296_T_C_b38	SLC35E2	2.86	0.00445	0.077674	12	0.027158	yes	CULTFB
chr1_1849439_T_C_b38	SLC35E2	2.86	0.00445	0.077674	12	0.027158	yes	CULTFB
chr1_1872863_C_T_b38	SLC35E2	2.86	0.00445	0.077674	12	0.027158	yes	CULTFB
chr1_1874867_A_G_b38	SLC35E2	2.86	0.00445	0.077674	12	0.027158	yes	CULTFB
chr1_1880926_CA_C_b38	SLC35E2	2.86	0.00445	0.077674	12	0.027158	yes	CULTFB
chr1_1881389_G_A_b38	SLC35E2	2.86	0.00445	0.077674	12	0.027158	yes	CULTFB
chr1_1885731_G_A_b38	SLC35E2	2.86	0.00445	0.077674	12	0.027158	yes	CULTFB
chr1_1887939_T_C_b38	SLC35E2	2.86	0.00445	0.077674	12	0.027158	yes	CULTFB
chr1_1053123_A_T_b38	SLC35E2	2.857	0.0045	0.065175	23	0.022813	yes	CULTFB
chr1_1375678_TAA_T_b38	SLC35E2	-2.854	0.00453	-0.057736	12	0.020228	yes	CULTFB
chr1_1957636_C_T_b38	SLC35E2	2.85	0.00459	0.045509	46	0.015969	yes	CULTFB
chr1_1724543_G_C_b38	SLC35E2	-2.848	0.00461	-0.125174	6	0.043945	yes	CULTFB
chr1_1715011_G_A_b38	SLC35E2	2.836	0.0048	0.068435	15	0.024134	yes	CULTFB
chr1_1957014_G_A_b38	SLC35E2	2.831	0.00487	0.045241	46	0.015982	yes	CULTFB
chr1_1861564_A_G_b38	SLC35E2	2.821	0.00502	0.077434	11	0.027447	yes	CULTFB
chr1_1861632_A_G_b38	SLC35E2	2.821	0.00502	0.077434	11	0.027447	yes	CULTFB
chr1_1861672_A_G_b38	SLC35E2	2.821	0.00502	0.077434	11	0.027447	yes	CULTFB
chr1_1862347_A_C_b38	SLC35E2	2.821	0.00502	0.077434	11	0.027447	yes	CULTFB
chr1_1864048_A_C_b38	SLC35E2	2.821	0.00502	0.077434	11	0.027447	yes	CULTFB
chr1_1870733_A_G_b38	SLC35E2	2.821	0.00502	0.077434	11	0.027447	yes	CULTFB
chr1_1956891_C_T_b38	SLC35E2	2.821	0.00502	0.045091	46	0.015983	yes	CULTFB
chr1_2003927_G_C_b38	SLC35E2	2.818	0.00507	0.055971	14	0.019865	yes	CULTFB
chr1_1026447_G_A_b38	SLC35E2	2.81	0.00519	0.063619	22	0.022638	yes	CULTFB
chr1_2004049_G_C_b38	SLC35E2	2.804	0.00528	0.055677	14	0.019853	yes	CULTFB
chr1_2010191_G_C_b38	SLC35E2	2.802	0.00533	0.056377	13	0.020123	yes	CULTFB
chr1_1714988_T_G_b38	SLC35E2	2.801	0.00533	0.067954	15	0.024257	yes	CULTFB
chr1_1937046_G_A_b38	SLC35E2	2.798	0.00539	0.053543	20	0.019138	yes	CULTFB
chr1_1596162_GAGC_G_b38	SLC35E2	-2.797	0.0054	-0.056276	6	0.020122	yes	CULTFB
chr1_1039514_C_T_b38	SLC35E2	2.791	0.00551	0.061942	24	0.022197	yes	CULTFB
chr1_1042400_C_T_b38	SLC35E2	2.791	0.00551	0.061942	24	0.022197	yes	CULTFB
chr1_2005928_T_TTC_b38	SLC35E2	2.789	0.00553	0.065312	4	0.023417	yes	CULTFB
chr1_1770997_G_A_b38	SLC35E2	-2.788	0.00555	-0.043053	95	0.015443	yes	CULTFB
chr1_1051820_C_T_b38	SLC35E2	2.785	0.0056	0.063237	23	0.022708	yes	CULTFB
chr1_1594618_C_G_b38	SLC35E2	2.777	0.00573	0.047553	40	0.017122	yes	CULTFB
chr1_1157219_G_C_b38	SLC35E2	2.776	0.00576	0.077259	4	0.027833	yes	CULTFB
chr1_2462476_AC_A_b38	SLC35E2	2.77	0.00585	0.078204	3	0.028229	yes	CULTFB
chr1_1955806_G_A_b38	SLC35E2	2.763	0.00599	0.046063	36	0.016672	yes	CULTFB
chr1_1743712_G_A_b38	SLC35E2	2.744	0.00634	0.076407	5	0.027846	yes	CULTFB
chr1_2459211_G_A_b38	SLC35E2	2.742	0.00637	0.076904	3	0.028044	yes	CULTFB
chr1_1010481_ATTAT_A_b38	SLC35E2	2.739	0.00642	0.078948	15	0.028821	yes	CULTFB
chr1_1011654_G_A_b38	SLC35E2	2.739	0.00643	0.081513	13	0.029762	yes	CULTFB
chr1_2305258_A_G_b38	SLC35E2	-2.737	0.00647	-0.061071	9	0.022315	yes	CULTFB
chr1_1999114_T_C_b38	SLC35E2	2.735	0.00652	0.056321	14	0.020596	yes	CULTFB
chr1_2007034_T_G_b38	SLC35E2	2.703	0.00715	0.056541	11	0.020917	yes	CULTFB
chr1_1459658_G_A_b38	SLC35E2	-2.701	0.0072	-0.077803	34	0.028805	yes	CULTFB
chr1_2225467_A_AT_b38	SLC35E2	-2.687	0.0075	-0.049232	28	0.018324	yes	CULTFB
chr1_1459662_C_T_b38	SLC35E2	-2.686	0.00753	-0.076125	28	0.028344	yes	CULTFB
chr1_1657926_A_AG_b38	SLC35E2	-2.678	0.0077	-0.053513	19	0.019983	yes	CULTFB
chr1_1265603_T_TTGTGTG_b38	SLC35E2	2.663	0.00805	0.06689	3	0.025118	yes	CULTFB
chr1_2235710_C_T_b38	SLC35E2	2.662	0.00808	0.040816	67	0.015334	yes	CULTFB
chr1_1596173_G_A_b38	SLC35E2	-2.66	0.00812	-0.053252	7	0.020021	yes	CULTFB
chr1_2691579_A_C_b38	SLC35E2	2.647	0.00844	0.067153	8	0.025372	yes	CULTFB
chr1_2207937_T_C_b38	SLC35E2	2.638	0.00865	0.048395	24	0.018345	yes	CULTFB
chr1_2465015_G_T_b38	SLC35E2	-2.638	0.00867	-0.132985	3	0.05042	yes	CULTFB
chr1_1849781_T_C_b38	SLC35E2	-2.633	0.00879	-0.047807	26	0.018159	yes	CULTFB
chr1_1013466_T_TA_b38	SLC35E2	2.631	0.00883	0.086608	13	0.032919	yes	CULTFB
chr1_1500729_G_A_b38	SLC35E2	-2.622	0.00906	-0.077908	27	0.02971	yes	CULTFB
chr1_2231505_C_T_b38	SLC35E2	2.619	0.00914	0.04318	49	0.016486	yes	CULTFB
chr1_2008632_C_T_b38	SLC35E2	2.618	0.00917	0.052269	13	0.019964	yes	CULTFB
chr1_2008948_G_C_b38	SLC35E2	2.618	0.00917	0.052269	13	0.019964	yes	CULTFB
chr1_1002417_T_A_b38	SLC35E2	2.615	0.00924	0.052949	24	0.020246	yes	CULTFB
chr1_1170732_A_G_b38	SLC35E2	-2.614	0.00927	-0.129936	31	0.0497	yes	CULTFB
chr1_2226509_T_C_b38	SLC35E2	2.606	0.00948	0.039557	70	0.015177	yes	CULTFB
chr1_1588059_G_A_b38	SLC35E2	2.603	0.00958	0.076214	4	0.02928	yes	CULTFB
chr1_1145547_T_TCTGACCTCATGGCCGACCCCAC_b38	SLC35E2	2.603	0.00958	0.043775	35	0.016818	yes	CULTFB
chr1_1497741_CTG_C_b38	SLC35E2	-2.596	0.00977	-0.099326	17	0.038264	yes	CULTFB
chr1_1888382_A_AG_b38	SLC35E2	2.59	0.00993	0.058038	8	0.022405	yes	CULTFB
chr1_1646352_A_C_b38	SLC35E2	8.928	1.45e-17	0.176052	13	0.019719	no	CULTFB
chr1_1675091_A_G_b38	SLC35E2	-8.319	1.31e-15	-0.143468	26	0.017246	no	CULTFB
chr1_1665581_C_G_b38	SLC35E2	-6.99	1.12e-11	-0.119153	29	0.017047	no	CULTFB
chr1_1762759_A_AAATG_b38	SLC35E2	-6.981	1.18e-11	-0.172167	3	0.024661	no	CULTFB
chr1_1661177_A_G_b38	SLC35E2	-6.971	1.25e-11	-0.122683	26	0.017598	no	CULTFB
chr1_1665061_C_T_b38	SLC35E2	-6.957	1.37e-11	-0.122634	25	0.017628	no	CULTFB
chr1_1668542_C_T_b38	SLC35E2	-6.904	1.92e-11	-0.125715	22	0.01821	no	CULTFB
chr1_1668717_C_G_b38	SLC35E2	-6.861	2.51e-11	-0.121578	26	0.017719	no	CULTFB
chr1_1669613_G_A_b38	SLC35E2	-6.652	9.21e-11	-0.118579	26	0.017826	no	CULTFB
chr1_1669576_G_A_b38	SLC35E2	-6.506	2.24e-10	-0.116053	26	0.017837	no	CULTFB
chr1_1659940_A_C_b38	SLC35E2	-5.875	8.72e-09	-0.121956	12	0.020758	no	CULTFB
chr1_1868925_C_T_b38	SLC35E2	-5.714	2.11e-08	-0.143983	3	0.025197	no	CULTFB
chr1_1653863_C_A_b38	SLC35E2	-5.327	1.64e-07	-0.105275	11	0.019761	no	CULTFB
chr1_1751981_A_T_b38	SLC35E2	-4.892	1.43e-06	-0.087289	31	0.017843	no	CULTFB
chr1_1981144_T_G_b38	SLC35E2	4.554	6.94e-06	0.078104	31	0.01715	no	CULTFB
chr1_1744652_C_T_b38	SLC35E2	-4.471	1.01e-05	-0.066688	87	0.014916	no	CULTFB
chr1_1753033_C_T_b38	SLC35E2	-4.316	1.99e-05	-0.064937	99	0.015046	no	CULTFB
chr1_1953441_G_A_b38	SLC35E2	-4.296	2.17e-05	-0.135637	5	0.031574	no	CULTFB
chr1_1845824_TACACAC_T_b38	SLC35E2	4.195	3.34e-05	0.076208	23	0.018165	no	CULTFB
chr1_1954330_G_A_b38	SLC35E2	-4.195	3.35e-05	-0.13258	5	0.031608	no	CULTFB
chr1_1949580_T_G_b38	SLC35E2	-4.17	3.71e-05	-0.129409	6	0.031032	no	CULTFB
chr1_1949631_G_A_b38	SLC35E2	-4.17	3.71e-05	-0.129409	6	0.031032	no	CULTFB
chr1_1949646_A_G_b38	SLC35E2	-4.17	3.71e-05	-0.129409	6	0.031032	no	CULTFB
chr1_1744121_A_C_b38	SLC35E2	-4.054	6.02e-05	-0.088097	53	0.02173	no	CULTFB
chr1_1743565_ATAT_A_b38	SLC35E2	-3.968	8.57e-05	-0.057298	82	0.014442	no	CULTFB
chr1_1978429_G_A_b38	SLC35E2	3.951	9.15e-05	0.065646	34	0.016614	no	CULTFB
chr1_1677707_C_T_b38	SLC35E2	-3.878	0.000123	-0.079222	16	0.020428	no	CULTFB
chr1_1968893_A_G_b38	SLC35E2	3.836	0.000145	0.066036	28	0.017215	no	CULTFB
chr1_1954676_C_G_b38	SLC35E2	-3.829	0.000149	-0.121072	5	0.03162	no	CULTFB
chr1_1983507_C_T_b38	SLC35E2	3.822	0.000153	0.063659	34	0.016656	no	CULTFB
chr1_1971123_A_G_b38	SLC35E2	3.819	0.000154	0.06355	34	0.016639	no	CULTFB
chr1_1619986_T_C_b38	SLC35E2	3.805	0.000163	0.063409	44	0.016665	no	CULTFB
chr1_1828894_T_TAC_b38	SLC35E2	3.8	0.000167	0.057679	91	0.01518	no	CULTFB
chr1_1837340_C_T_b38	SLC35E2	3.776	0.000183	0.073352	15	0.019427	no	CULTFB
chr1_1949489_AT_A_b38	SLC35E2	-3.771	0.000187	-0.114869	6	0.030464	no	CULTFB
chr1_1717604_CGCTTTCAGCTAGAGTTTGCTCTCTCTGGTTTTCGGTCTGTGACACACGCAT_C_b38	SLC35E2	3.752	0.000201	0.05614	80	0.014964	no	CULTFB
chr1_1971127_G_A_b38	SLC35E2	3.75	0.000202	0.062428	33	0.016647	no	CULTFB
chr1_1798974_C_T_b38	SLC35E2	3.731	0.000217	0.072883	14	0.019533	no	CULTFB
chr1_1971434_C_T_b38	SLC35E2	3.711	0.000235	0.061645	34	0.016613	no	CULTFB
chr1_1750508_A_C_b38	SLC35E2	-3.697	0.000248	-0.050725	95	0.01372	no	CULTFB
chr1_1846651_T_G_b38	SLC35E2	3.697	0.000248	0.071815	15	0.019426	no	CULTFB
chr1_1822247_A_G_b38	SLC35E2	3.692	0.000252	0.071297	15	0.01931	no	CULTFB
chr1_1794187_C_T_b38	SLC35E2	3.69	0.000254	0.072136	14	0.019548	no	CULTFB
chr1_1971027_A_C_b38	SLC35E2	3.653	0.000293	0.061061	33	0.016717	no	CULTFB
chr1_1952823_TA_T_b38	SLC35E2	-3.645	0.000301	-0.056545	94	0.015511	no	CULTFB
chr1_1855245_G_A_b38	SLC35E2	3.643	0.000303	0.072567	13	0.019918	no	CULTFB
chr1_1987547_C_CT_b38	SLC35E2	3.639	0.000308	0.059191	84	0.016265	no	CULTFB
chr1_1625951_G_A_b38	SLC35E2	-3.635	0.000314	-0.058114	66	0.015989	no	CULTFB
chr1_1782906_T_G_b38	SLC35E2	3.631	0.000318	0.070225	15	0.019341	no	CULTFB
chr1_1752730_C_G_b38	SLC35E2	-3.631	0.000318	-0.05557	90	0.015306	no	CULTFB
chr1_1750440_G_A_b38	SLC35E2	-3.62	0.000331	-0.060734	60	0.016778	no	CULTFB
chr1_1950071_C_T_b38	SLC35E2	-3.604	0.000351	-0.056251	94	0.015606	no	CULTFB
chr1_1952064_G_A_b38	SLC35E2	-3.604	0.000351	-0.056251	94	0.015606	no	CULTFB
chr1_1750428_G_C_b38	SLC35E2	-3.6	0.000357	-0.06077	59	0.016882	no	CULTFB
chr1_1855939_G_A_b38	SLC35E2	3.575	0.000391	0.071473	13	0.019991	no	CULTFB
chr1_1930002_T_C_b38	SLC35E2	-3.575	0.000392	-0.103068	9	0.028831	no	CULTFB
chr1_1943142_A_G_b38	SLC35E2	-3.573	0.000395	-0.071857	12	0.020112	no	CULTFB
chr1_1753319_G_A_b38	SLC35E2	-3.543	0.00044	-0.054375	90	0.015345	no	CULTFB
chr1_1857246_T_TAA_b38	SLC35E2	3.543	0.000441	0.070481	13	0.019894	no	CULTFB
chr1_1857250_C_G_b38	SLC35E2	3.543	0.000441	0.070481	13	0.019894	no	CULTFB
chr1_1857305_G_GGGCT_b38	SLC35E2	3.543	0.000441	0.070481	13	0.019894	no	CULTFB
chr1_1871210_G_T_b38	SLC35E2	3.503	0.00051	0.070755	13	0.020196	no	CULTFB
chr1_1951106_G_A_b38	SLC35E2	-3.503	0.00051	-0.054414	95	0.015533	no	CULTFB
chr1_1825782_G_A_b38	SLC35E2	-3.492	0.000532	-0.111674	5	0.031984	no	CULTFB
chr1_1951865_G_GT_b38	SLC35E2	-3.485	0.000546	-0.054261	95	0.015572	no	CULTFB
chr1_1936906_C_CA_b38	SLC35E2	-3.484	0.000547	-0.061015	41	0.017513	no	CULTFB
chr1_1775996_G_A_b38	SLC35E2	3.478	0.000559	0.066897	15	0.019235	no	CULTFB
chr1_1775296_C_T_b38	SLC35E2	3.458	6e-04	0.07002	13	0.020248	no	CULTFB
chr1_1815255_G_T_b38	SLC35E2	3.458	6e-04	0.07002	13	0.020248	no	CULTFB
chr1_2106518_A_G_b38	SLC35E2	-3.451	0.000616	-0.170016	3	0.049267	no	CULTFB
chr1_1731904_CA_C_b38	SLC35E2	3.4	0.000739	0.060797	28	0.017879	no	CULTFB
chr1_1736729_G_T_b38	SLC35E2	3.4	0.00074	0.049765	131	0.014637	no	CULTFB
chr1_1955080_C_CGGCTCACACCGGAAGTGAGGCTCACACCGGAAGTGA_b38	SLC35E2	-3.388	0.000771	-0.052695	88	0.015552	no	CULTFB
chr1_1909167_G_A_b38	SLC35E2	3.38	0.000794	0.070004	12	0.020712	no	CULTFB
chr1_1792696_C_CA_b38	SLC35E2	3.365	0.000836	0.053033	56	0.015759	no	CULTFB
chr1_2106511_C_CT_b38	SLC35E2	-3.365	0.000837	-0.161553	3	0.048011	no	CULTFB
chr1_1880594_A_T_b38	SLC35E2	3.364	0.000839	0.063084	20	0.018751	no	CULTFB
chr1_1945975_TG_T_b38	SLC35E2	-3.357	0.000862	-0.052499	93	0.01564	no	CULTFB
chr1_1795751_T_TCAAAAAAA_b38	SLC35E2	3.35	0.000883	0.091877	10	0.027426	no	CULTFB
chr1_1868514_T_C_b38	SLC35E2	3.349	0.000885	0.102448	4	0.03059	no	CULTFB
chr1_1591419_A_G_b38	SLC35E2	3.348	0.000887	0.067385	15	0.020124	no	CULTFB
chr1_1830575_T_C_b38	SLC35E2	3.324	0.000966	0.092657	9	0.027874	no	CULTFB
chr1_1945913_T_C_b38	SLC35E2	-3.32	0.00098	-0.064914	12	0.019552	no	CULTFB
chr1_1827587_T_C_b38	SLC35E2	3.317	0.000989	0.092011	10	0.027736	no	CULTFB
chr1_1829550_A_C_b38	SLC35E2	3.317	0.000989	0.092011	10	0.027736	no	CULTFB
chr1_1834144_T_C_b38	SLC35E2	3.317	0.000989	0.092011	10	0.027736	no	CULTFB
chr1_1834920_A_G_b38	SLC35E2	3.317	0.000989	0.092011	10	0.027736	no	CULTFB
chr1_1838619_T_C_b38	SLC35E2	3.317	0.000989	0.092011	10	0.027736	no	CULTFB
chr1_1943706_C_T_b38	SLC35E2	-3.298	0.00106	-0.065974	13	0.020006	no	CULTFB
chr1_1881065_G_A_b38	SLC35E2	3.271	0.00116	0.064682	14	0.019771	no	CULTFB
chr1_1881798_C_T_b38	SLC35E2	3.271	0.00116	0.064682	14	0.019771	no	CULTFB
chr1_1738295_G_T_b38	SLC35E2	3.271	0.00116	0.047972	130	0.014667	no	CULTFB
chr1_1725339_C_A_b38	SLC35E2	3.267	0.00118	0.04716	90	0.014434	no	CULTFB
chr1_1624723_C_T_b38	SLC35E2	-3.262	0.0012	-0.064036	13	0.019632	no	CULTFB
chr1_1965001_G_A_b38	SLC35E2	3.236	0.00131	0.054536	32	0.016855	no	CULTFB
chr1_1801188_T_C_b38	SLC35E2	3.234	0.00132	0.06066	17	0.018755	no	CULTFB
chr1_1814717_A_G_b38	SLC35E2	3.226	0.00136	0.088999	10	0.027592	no	CULTFB
chr1_1821516_C_T_b38	SLC35E2	3.226	0.00136	0.088999	10	0.027592	no	CULTFB
chr1_1629572_TG_T_b38	SLC35E2	-3.221	0.00138	-0.05333	55	0.016558	no	CULTFB
chr1_1628814_C_T_b38	SLC35E2	-3.199	0.00148	-0.053522	53	0.01673	no	CULTFB
chr1_1943828_A_G_b38	SLC35E2	-3.192	0.00152	-0.064268	12	0.020135	no	CULTFB
chr1_1845840_C_G_b38	SLC35E2	3.19	0.00153	0.066179	8	0.020744	no	CULTFB
chr1_1938493_C_CAT_b38	SLC35E2	-3.183	0.00157	-0.063986	12	0.020104	no	CULTFB
chr1_1939978_T_C_b38	SLC35E2	-3.183	0.00157	-0.063986	12	0.020104	no	CULTFB
chr1_1628409_C_A_b38	SLC35E2	-3.182	0.00157	-0.053188	53	0.016714	no	CULTFB
chr1_1903577_C_T_b38	SLC35E2	3.18	0.00159	0.065541	13	0.020612	no	CULTFB
chr1_1734903_A_G_b38	SLC35E2	3.178	0.00159	0.046158	133	0.014523	no	CULTFB
chr1_1903242_C_T_b38	SLC35E2	3.169	0.00164	0.066146	11	0.020873	no	CULTFB
chr1_1906935_C_T_b38	SLC35E2	3.169	0.00164	0.066146	11	0.020873	no	CULTFB
chr1_1812038_G_C_b38	SLC35E2	3.167	0.00166	0.085142	12	0.026885	no	CULTFB
chr1_1933640_C_T_b38	SLC35E2	-3.164	0.00167	-0.091927	9	0.02905	no	CULTFB
chr1_1898043_T_C_b38	SLC35E2	3.158	0.00171	0.06397	12	0.020256	no	CULTFB
chr1_1698022_G_A_b38	SLC35E2	-3.155	0.00172	-0.117665	16	0.037289	no	CULTFB
chr1_1829897_A_C_b38	SLC35E2	3.148	0.00177	0.086855	10	0.027593	no	CULTFB
chr1_1898712_C_T_b38	SLC35E2	3.135	0.00184	0.064451	11	0.020562	no	CULTFB
chr1_1899188_T_A_b38	SLC35E2	3.135	0.00184	0.064451	11	0.020562	no	CULTFB
chr1_1886690_A_C_b38	SLC35E2	3.116	0.00196	0.062122	13	0.019935	no	CULTFB
chr1_1986752_A_G_b38	SLC35E2	3.113	0.00198	0.048602	82	0.015611	no	CULTFB
chr1_1945799_T_G_b38	SLC35E2	-3.111	0.002	-0.063862	12	0.020529	no	CULTFB
chr1_1731963_A_C_b38	SLC35E2	3.104	0.00204	0.04524	133	0.014574	no	CULTFB
chr1_1732392_C_T_b38	SLC35E2	3.104	0.00204	0.04524	133	0.014574	no	CULTFB
chr1_1735176_C_T_b38	SLC35E2	3.104	0.00204	0.04524	133	0.014574	no	CULTFB
chr1_1735980_A_C_b38	SLC35E2	3.104	0.00204	0.04524	133	0.014574	no	CULTFB
chr1_1740343_C_T_b38	SLC35E2	3.104	0.00204	0.04524	133	0.014574	no	CULTFB
chr1_1740703_C_T_b38	SLC35E2	3.104	0.00204	0.04524	133	0.014574	no	CULTFB
chr1_1747472_A_T_b38	SLC35E2	-3.103	0.00205	-0.048441	90	0.015609	no	CULTFB
chr1_1734174_A_G_b38	SLC35E2	3.102	0.00205	0.045096	133	0.014538	no	CULTFB
chr1_1882449_A_AAG_b38	SLC35E2	3.093	0.00212	0.075647	7	0.02446	no	CULTFB
chr1_1772160_A_AT_b38	SLC35E2	3.093	0.00212	0.062572	10	0.020233	no	CULTFB
chr1_1986211_T_C_b38	SLC35E2	3.092	0.00212	0.050694	45	0.016393	no	CULTFB
chr1_1135812_T_C_b38	SLC35E2	3.082	0.00219	0.084157	3	0.027304	no	CULTFB
chr1_1892085_G_C_b38	SLC35E2	3.08	0.00221	0.061776	12	0.020055	no	CULTFB
chr1_1837221_C_G_b38	SLC35E2	3.067	0.0023	0.084485	10	0.027544	no	CULTFB
chr1_1905533_AT_A_b38	SLC35E2	3.063	0.00234	0.064538	5	0.021073	no	CULTFB
chr1_2017202_C_T_b38	SLC35E2	3.058	0.00237	0.06487	11	0.02121	no	CULTFB
chr1_1978404_C_T_b38	SLC35E2	3.056	0.00239	0.049765	46	0.016286	no	CULTFB
chr1_1978415_G_A_b38	SLC35E2	3.056	0.00239	0.049765	46	0.016286	no	CULTFB
chr1_1948515_C_T_b38	SLC35E2	-3.053	0.00242	-0.04689	103	0.015361	no	CULTFB
chr1_1948519_T_C_b38	SLC35E2	-3.053	0.00242	-0.04689	103	0.015361	no	CULTFB
chr1_1938771_G_A_b38	SLC35E2	-3.047	0.00246	-0.060952	12	0.020007	no	CULTFB
chr1_1765220_A_G_b38	SLC35E2	3.044	0.00249	0.08275	11	0.027187	no	CULTFB
chr1_1624720_G_A_b38	SLC35E2	-3.034	0.00257	-0.051001	53	0.016812	no	CULTFB
chr1_1977879_G_A_b38	SLC35E2	3.026	0.00263	0.049301	46	0.01629	no	CULTFB
chr1_1644361_C_T_b38	SLC35E2	3.026	0.00263	0.063817	3	0.021088	no	CULTFB
chr1_1987049_A_G_b38	SLC35E2	3.025	0.00264	0.046885	83	0.0155	no	CULTFB
chr1_1764135_G_T_b38	SLC35E2	3.024	0.00265	0.082373	11	0.027244	no	CULTFB
chr1_1767368_C_G_b38	SLC35E2	3.024	0.00265	0.082373	11	0.027244	no	CULTFB
chr1_1653825_T_TACACAC_b38	SLC35E2	3.017	0.00271	0.056947	17	0.018877	no	CULTFB
chr1_1910289_C_T_b38	SLC35E2	3.011	0.00276	0.057676	16	0.019154	no	CULTFB
chr1_1910369_G_A_b38	SLC35E2	3.011	0.00276	0.057676	16	0.019154	no	CULTFB
chr1_1910480_G_A_b38	SLC35E2	3.011	0.00276	0.057676	16	0.019154	no	CULTFB
chr1_1773713_T_A_b38	SLC35E2	-2.996	0.0029	-0.050341	48	0.016801	no	CULTFB
chr1_1983166_A_T_b38	SLC35E2	2.994	0.00292	0.04911	45	0.016404	no	CULTFB
chr1_1983956_TGG_T_b38	SLC35E2	2.994	0.00292	0.04911	45	0.016404	no	CULTFB
chr1_1984859_C_T_b38	SLC35E2	2.994	0.00292	0.04911	45	0.016404	no	CULTFB
chr1_1985148_G_T_b38	SLC35E2	2.994	0.00292	0.04911	45	0.016404	no	CULTFB
chr1_1625805_G_A_b38	SLC35E2	-2.993	0.00292	-0.050066	54	0.016725	no	CULTFB
chr1_1978114_T_A_b38	SLC35E2	2.993	0.00293	0.049009	45	0.016372	no	CULTFB
chr1_1981319_G_C_b38	SLC35E2	2.993	0.00293	0.049009	45	0.016372	no	CULTFB
chr1_1986033_G_A_b38	SLC35E2	2.993	0.00293	0.049009	45	0.016372	no	CULTFB
chr1_1986176_A_T_b38	SLC35E2	2.993	0.00293	0.049009	45	0.016372	no	CULTFB
chr1_1986390_T_G_b38	SLC35E2	2.993	0.00293	0.049009	45	0.016372	no	CULTFB
chr1_1986469_A_C_b38	SLC35E2	2.993	0.00293	0.049009	45	0.016372	no	CULTFB
chr1_1987096_A_T_b38	SLC35E2	2.993	0.00293	0.049009	45	0.016372	no	CULTFB
chr1_1987156_G_A_b38	SLC35E2	2.993	0.00293	0.049009	45	0.016372	no	CULTFB
chr1_1984595_C_T_b38	SLC35E2	2.985	0.003	0.048803	46	0.016349	no	CULTFB
chr1_1764392_C_T_b38	SLC35E2	2.983	0.00302	0.082462	10	0.027644	no	CULTFB
chr1_1774334_A_G_b38	SLC35E2	2.983	0.00302	0.082462	10	0.027644	no	CULTFB
chr1_1746522_GT_G_b38	SLC35E2	-2.978	0.00307	-0.056935	23	0.019118	no	CULTFB
chr1_1837255_A_AT_b38	SLC35E2	2.975	0.0031	0.056445	20	0.018972	no	CULTFB
chr1_1978055_C_T_b38	SLC35E2	2.97	0.00316	0.048363	46	0.016286	no	CULTFB
chr1_1980953_G_A_b38	SLC35E2	2.964	0.00321	0.048329	46	0.016306	no	CULTFB
chr1_1984300_CT_C_b38	SLC35E2	2.941	0.00346	0.062632	3	0.021297	no	CULTFB
chr1_1746440_A_G_b38	SLC35E2	-2.936	0.00351	-0.056144	23	0.019125	no	CULTFB
chr1_1972273_C_A_b38	SLC35E2	2.934	0.00353	0.047842	46	0.016306	no	CULTFB
chr1_1976473_C_T_b38	SLC35E2	2.934	0.00353	0.047842	46	0.016306	no	CULTFB
chr1_1976573_T_C_b38	SLC35E2	2.934	0.00353	0.047842	46	0.016306	no	CULTFB
chr1_1976600_C_T_b38	SLC35E2	2.934	0.00353	0.047842	46	0.016306	no	CULTFB
chr1_1976646_A_G_b38	SLC35E2	2.934	0.00353	0.047842	46	0.016306	no	CULTFB
chr1_1976661_G_T_b38	SLC35E2	2.934	0.00353	0.047842	46	0.016306	no	CULTFB
chr1_1976946_C_T_b38	SLC35E2	2.934	0.00353	0.047842	46	0.016306	no	CULTFB
chr1_1977264_C_G_b38	SLC35E2	2.934	0.00353	0.047842	46	0.016306	no	CULTFB
chr1_1977765_A_G_b38	SLC35E2	2.934	0.00353	0.047842	46	0.016306	no	CULTFB
chr1_1978647_G_T_b38	SLC35E2	2.934	0.00353	0.047842	46	0.016306	no	CULTFB
chr1_1152303_T_C_b38	SLC35E2	2.933	0.00355	0.083356	3	0.028422	no	CULTFB
chr1_1154630_C_A_b38	SLC35E2	2.933	0.00355	0.083356	3	0.028422	no	CULTFB
chr1_1882915_C_T_b38	SLC35E2	2.929	0.00359	0.05873	13	0.020049	no	CULTFB
chr1_1915143_A_G_b38	SLC35E2	-2.925	0.00364	-0.059547	11	0.020361	no	CULTFB
chr1_1912140_T_G_b38	SLC35E2	2.921	0.00368	0.054582	20	0.018688	no	CULTFB
chr1_908953_ATATGCGGTGATCGGGGTCAGGCCCCCGGGCGCACCTTTGCTGGTATATGCGGGGGTCGGGGTCAGGCCCCCGGGCGCACCGTTGCTGGTATATGCGGGGGTCGGGGTCAGGCCCCCGGGCGCACCGTTGCTGGTATATGCGGTGGTCGGGGTCAGGCCCCCCGGGCGCACTG_A_b38	SLC35E2	2.919	0.0037	0.083806	5	0.028708	no	CULTFB
chr1_1978006_A_G_b38	SLC35E2	2.918	0.00372	0.047669	46	0.016337	no	CULTFB
chr1_1737504_A_C_b38	SLC35E2	2.913	0.00377	0.042304	136	0.014522	no	CULTFB
chr1_1748597_C_G_b38	SLC35E2	-2.908	0.00383	-0.045076	92	0.015501	no	CULTFB
chr1_1922882_A_G_b38	SLC35E2	-2.898	0.00396	-0.059061	11	0.02038	no	CULTFB
chr1_1955018_A_AGGAAGTGCGGCTCACACC_b38	SLC35E2	2.894	0.00401	0.063077	10	0.021799	no	CULTFB
chr1_2137483_G_A_b38	SLC35E2	-2.893	0.00402	-0.12645	5	0.043709	no	CULTFB
chr1_1631710_T_C_b38	SLC35E2	2.887	0.0041	0.065259	10	0.022607	no	CULTFB
chr1_1978262_C_T_b38	SLC35E2	2.873	0.00428	0.046744	47	0.01627	no	CULTFB
chr1_1978294_G_T_b38	SLC35E2	2.873	0.00428	0.046744	47	0.01627	no	CULTFB
chr1_1897985_C_G_b38	SLC35E2	2.87	0.00431	0.054592	17	0.019019	no	CULTFB
chr1_1650370_C_CT_b38	SLC35E2	-2.865	0.00439	-0.055459	23	0.01936	no	CULTFB
chr1_1984601_T_C_b38	SLC35E2	2.858	0.00448	0.046824	46	0.016386	no	CULTFB
chr1_1835922_GA_G_b38	SLC35E2	2.85	0.00459	0.081353	5	0.028546	no	CULTFB
chr1_1726904_T_C_b38	SLC35E2	2.832	0.00485	0.041373	116	0.014608	no	CULTFB
chr1_1847597_T_C_b38	SLC35E2	2.824	0.00498	0.077375	11	0.027401	no	CULTFB
chr1_2288986_T_C_b38	SLC35E2	-2.819	0.00506	-0.045386	49	0.016102	no	CULTFB
chr1_1955580_A_G_b38	SLC35E2	-2.818	0.00506	-0.057509	10	0.020405	no	CULTFB
chr1_1946013_C_T_b38	SLC35E2	-2.811	0.00517	-0.044288	95	0.015753	no	CULTFB
chr1_1984586_G_A_b38	SLC35E2	2.808	0.00522	0.045979	46	0.016373	no	CULTFB
chr1_1986010_T_G_b38	SLC35E2	2.808	0.00522	0.045894	46	0.016343	no	CULTFB
chr1_1985619_A_G_b38	SLC35E2	2.801	0.00533	0.045333	63	0.016182	no	CULTFB
chr1_2029235_C_T_b38	SLC35E2	2.797	0.0054	0.059541	12	0.021286	no	CULTFB
chr1_2029969_C_T_b38	SLC35E2	2.797	0.0054	0.059541	12	0.021286	no	CULTFB
chr1_2031380_T_A_b38	SLC35E2	2.797	0.0054	0.059541	12	0.021286	no	CULTFB
chr1_2031629_GTGTCTGGGGCGCTAC_G_b38	SLC35E2	2.797	0.0054	0.059541	12	0.021286	no	CULTFB
chr1_2031648_CCTCTG_C_b38	SLC35E2	2.797	0.0054	0.059541	12	0.021286	no	CULTFB
chr1_2031655_AGGACCCAGGCATCTG_A_b38	SLC35E2	2.797	0.0054	0.059541	12	0.021286	no	CULTFB
chr1_2031719_C_T_b38	SLC35E2	2.797	0.0054	0.059541	12	0.021286	no	CULTFB
chr1_2031852_C_G_b38	SLC35E2	2.797	0.0054	0.059541	12	0.021286	no	CULTFB
chr1_1814797_CAAAAAAAAA_C_b38	SLC35E2	2.789	0.00553	0.061285	7	0.021975	no	CULTFB
chr1_1944182_G_C_b38	SLC35E2	-2.785	0.00559	-0.043482	97	0.01561	no	CULTFB
chr1_1750589_G_A_b38	SLC35E2	-2.784	0.00561	-0.075161	11	0.026993	no	CULTFB
chr1_1946058_T_C_b38	SLC35E2	-2.777	0.00574	-0.043532	97	0.015676	no	CULTFB
chr1_1944074_T_C_b38	SLC35E2	-2.777	0.00574	-0.043147	98	0.01554	no	CULTFB
chr1_1944091_G_C_b38	SLC35E2	-2.777	0.00574	-0.043147	98	0.01554	no	CULTFB
chr1_1609890_C_T_b38	SLC35E2	-2.774	0.00579	-0.062163	11	0.022408	no	CULTFB
chr1_2675618_G_T_b38	SLC35E2	2.765	0.00595	0.067054	8	0.024253	no	CULTFB
chr1_1931519_A_G_b38	SLC35E2	-2.763	0.00598	-0.055592	12	0.020117	no	CULTFB
chr1_1982826_T_C_b38	SLC35E2	2.75	0.00621	0.044859	47	0.01631	no	CULTFB
chr1_1976990_T_C_b38	SLC35E2	2.75	0.00622	0.044766	47	0.016278	no	CULTFB
chr1_1978562_C_G_b38	SLC35E2	2.75	0.00622	0.044766	47	0.016278	no	CULTFB
chr1_1978573_T_C_b38	SLC35E2	2.75	0.00622	0.044766	47	0.016278	no	CULTFB
chr1_1978797_T_C_b38	SLC35E2	2.75	0.00622	0.044766	47	0.016278	no	CULTFB
chr1_1976870_C_CAG_b38	SLC35E2	2.742	0.00637	0.043499	46	0.015863	no	CULTFB
chr1_1627156_G_A_b38	SLC35E2	-2.734	0.00654	-0.061946	10	0.022662	no	CULTFB
chr1_1954783_T_G_b38	SLC35E2	-2.73	0.0066	-0.056393	9	0.020654	no	CULTFB
chr1_1954946_T_C_b38	SLC35E2	-2.73	0.0066	-0.056393	9	0.020654	no	CULTFB
chr1_1958353_A_T_b38	SLC35E2	-2.73	0.0066	-0.056393	9	0.020654	no	CULTFB
chr1_1945121_T_C_b38	SLC35E2	-2.727	0.00666	-0.042371	99	0.015537	no	CULTFB
chr1_1969015_A_G_b38	SLC35E2	2.724	0.00673	0.042264	104	0.015518	no	CULTFB
chr1_1925261_C_T_b38	SLC35E2	-2.721	0.00679	-0.055301	11	0.020324	no	CULTFB
chr1_1944420_A_G_b38	SLC35E2	-2.721	0.00679	-0.041926	101	0.015411	no	CULTFB
chr1_1946632_C_T_b38	SLC35E2	-2.699	0.00723	-0.042228	98	0.015644	no	CULTFB
chr1_1947189_C_T_b38	SLC35E2	-2.699	0.00724	-0.042221	98	0.015643	no	CULTFB
chr1_1613090_A_G_b38	SLC35E2	-2.693	0.00736	-0.045439	50	0.016871	no	CULTFB
chr1_1594614_G_C_b38	SLC35E2	-2.678	0.00771	-0.045483	50	0.016986	no	CULTFB
chr1_1942887_C_G_b38	SLC35E2	-2.667	0.00796	-0.041338	98	0.015502	no	CULTFB
chr1_1622510_C_T_b38	SLC35E2	-2.658	0.00817	-0.044854	49	0.016877	no	CULTFB
chr1_2033336_T_C_b38	SLC35E2	2.654	0.00827	0.057207	11	0.021557	no	CULTFB
chr1_2033373_T_G_b38	SLC35E2	2.654	0.00827	0.057207	11	0.021557	no	CULTFB
chr1_1608603_C_A_b38	SLC35E2	-2.643	0.00853	-0.044603	52	0.016875	no	CULTFB
chr1_1609070_G_A_b38	SLC35E2	-2.643	0.00853	-0.044603	52	0.016875	no	CULTFB
chr1_1141684_C_A_b38	SLC35E2	2.641	0.00857	0.073324	3	0.02776	no	CULTFB
chr1_1989523_T_C_b38	SLC35E2	2.634	0.00876	0.042707	70	0.016216	no	CULTFB
chr1_1616048_C_T_b38	SLC35E2	-2.634	0.00877	-0.043099	57	0.016366	no	CULTFB
chr1_1944419_C_G_b38	SLC35E2	-2.621	0.00908	-0.040888	99	0.015597	no	CULTFB
chr1_1959595_C_T_b38	SLC35E2	-2.619	0.00915	-0.083003	3	0.031693	no	CULTFB
chr1_1951510_A_G_b38	SLC35E2	-2.615	0.00926	-0.054721	8	0.020929	no	CULTFB
chr1_2010975_T_C_b38	SLC35E2	2.61	0.00939	0.053328	12	0.020435	no	CULTFB
chr1_1861110_CA_C_b38	SLC35E2	2.599	0.00968	0.067646	3	0.026027	no	CULTFB
chr1_1691377_C_T_b38	SLC35E2	-2.596	0.00978	-0.044059	45	0.016975	no	CULTFB
chr1_1647600_C_G_b38	SLC35E2	-2.594	0.00981	-0.059453	51	0.022916	no	CULTFB
chr1_1949564_T_TG_b38	SLC35E2	-2.588	0.00999	-0.054239	8	0.020958	no	CULTFB
chr1_1950848_A_G_b38	SLC35E2	-2.588	0.00999	-0.054239	8	0.020958	no	CULTFB
chr1_1951521_C_A_b38	SLC35E2	-2.588	0.00999	-0.054239	8	0.020958	no	CULTFB
chr1_1673818_A_C_b38	SLC35E2	7.831	2.07e-12	0.170899	28	0.021823	yes	EBVTLC
chr1_1674720_TGC_T_b38	SLC35E2	7.831	2.07e-12	0.170899	28	0.021823	yes	EBVTLC
chr1_1674868_G_A_b38	SLC35E2	7.831	2.07e-12	0.170899	28	0.021823	yes	EBVTLC
chr1_1677720_T_G_b38	SLC35E2	7.831	2.07e-12	0.170899	28	0.021823	yes	EBVTLC
chr1_1677726_A_T_b38	SLC35E2	7.831	2.07e-12	0.170899	28	0.021823	yes	EBVTLC
chr1_1676790_C_T_b38	SLC35E2	7.813	2.28e-12	0.165384	29	0.021167	yes	EBVTLC
chr1_1671995_G_T_b38	SLC35E2	7.643	5.59e-12	0.164254	27	0.021492	yes	EBVTLC
chr1_1671797_G_A_b38	SLC35E2	7.534	9.88e-12	0.164327	27	0.021813	yes	EBVTLC
chr1_1673060_G_A_b38	SLC35E2	7.352	2.53e-11	0.172596	26	0.023475	yes	EBVTLC
chr1_1649932_C_T_b38	SLC35E2	6.579	1.27e-09	0.147861	26	0.022474	yes	EBVTLC
chr1_1648736_G_A_b38	SLC35E2	6.307	4.85e-09	0.145772	24	0.023114	yes	EBVTLC
chr1_1651653_C_T_b38	SLC35E2	6.111	1.24e-08	0.142965	28	0.023394	yes	EBVTLC
chr1_1661562_G_C_b38	SLC35E2	6.043	1.72e-08	0.120969	31	0.020018	yes	EBVTLC
chr1_1636278_G_T_b38	SLC35E2	5.957	2.59e-08	0.140206	22	0.023536	yes	EBVTLC
chr1_1646352_A_C_b38	SLC35E2	5.715	8.02e-08	0.184407	3	0.032265	yes	EBVTLC
chr1_1739131_T_C_b38	SLC35E2	5.37	3.87e-07	0.114397	38	0.021304	yes	EBVTLC
chr1_1658422_T_C_b38	SLC35E2	5.327	4.69e-07	0.145137	7	0.027247	yes	EBVTLC
chr1_1673968_GA_G_b38	SLC35E2	5.302	5.23e-07	0.150403	11	0.028367	yes	EBVTLC
chr1_1649976_G_A_b38	SLC35E2	5.076	1.41e-06	0.11751	24	0.023149	yes	EBVTLC
chr1_1728671_C_A_b38	SLC35E2	4.708	6.74e-06	0.139711	13	0.029678	yes	EBVTLC
chr1_1664757_T_C_b38	SLC35E2	-4.701	6.93e-06	-0.110103	20	0.023423	yes	EBVTLC
chr1_1670423_AT_A_b38	SLC35E2	4.571	1.18e-05	0.147056	10	0.032172	yes	EBVTLC
chr1_1658830_C_G_b38	SLC35E2	-4.481	1.7e-05	-0.126459	7	0.028223	yes	EBVTLC
chr1_1660683_C_T_b38	SLC35E2	-4.392	2.42e-05	-0.113122	16	0.025758	yes	EBVTLC
chr1_1675091_A_G_b38	SLC35E2	-4.375	2.59e-05	-0.130463	7	0.029822	yes	EBVTLC
chr1_1729859_A_G_b38	SLC35E2	4.35	2.86e-05	0.125319	11	0.02881	yes	EBVTLC
chr1_1658866_G_A_b38	SLC35E2	-4.14	6.46e-05	-0.10199	21	0.024637	yes	EBVTLC
chr1_1659114_A_G_b38	SLC35E2	-4.14	6.46e-05	-0.10199	21	0.024637	yes	EBVTLC
chr1_1659220_A_G_b38	SLC35E2	-4.14	6.46e-05	-0.10199	21	0.024637	yes	EBVTLC
chr1_1661420_C_A_b38	SLC35E2	-4.14	6.46e-05	-0.10199	21	0.024637	yes	EBVTLC
chr1_1664865_A_G_b38	SLC35E2	-4.115	7.1e-05	-0.098787	20	0.024007	yes	EBVTLC
chr1_1659060_G_A_b38	SLC35E2	-4.002	0.000109	-0.107822	15	0.026943	yes	EBVTLC
chr1_1722690_TA_T_b38	SLC35E2	-3.975	0.00012	-0.140696	3	0.035392	yes	EBVTLC
chr1_1668108_C_T_b38	SLC35E2	3.946	0.000134	0.098283	18	0.024909	yes	EBVTLC
chr1_1668721_C_T_b38	SLC35E2	-3.928	0.000143	-0.1068	12	0.027188	yes	EBVTLC
chr1_1671148_C_T_b38	SLC35E2	3.809	0.00022	0.091162	22	0.023931	yes	EBVTLC
chr1_2692584_C_A_b38	SLC35E2	3.775	0.00025	0.105714	9	0.028007	yes	EBVTLC
chr1_1654662_CT_C_b38	SLC35E2	3.718	0.000306	0.10174	15	0.027365	yes	EBVTLC
chr1_1650000_G_A_b38	SLC35E2	3.699	0.000327	0.087683	21	0.023706	yes	EBVTLC
chr1_1649846_G_A_b38	SLC35E2	-3.676	0.000355	-0.107583	7	0.029269	yes	EBVTLC
chr1_1651421_GTAGCCCCTCTGAACGGTCTGTGACACACGCATGCTTTCAGCTAGAGTACTCTA_G_b38	SLC35E2	-3.669	0.000364	-0.095804	17	0.026114	yes	EBVTLC
chr1_1671097_G_C_b38	SLC35E2	3.624	0.000425	0.088184	21	0.024334	yes	EBVTLC
chr1_1651137_C_T_b38	SLC35E2	-3.587	0.000484	-0.092666	18	0.025837	yes	EBVTLC
chr1_1651267_T_C_b38	SLC35E2	-3.587	0.000484	-0.092666	18	0.025837	yes	EBVTLC
chr1_1651574_G_A_b38	SLC35E2	-3.587	0.000484	-0.092666	18	0.025837	yes	EBVTLC
chr1_1651785_C_A_b38	SLC35E2	-3.587	0.000484	-0.092666	18	0.025837	yes	EBVTLC
chr1_1651926_T_C_b38	SLC35E2	-3.587	0.000484	-0.092666	18	0.025837	yes	EBVTLC
chr1_1652061_T_C_b38	SLC35E2	-3.587	0.000484	-0.092666	18	0.025837	yes	EBVTLC
chr1_1652135_C_G_b38	SLC35E2	-3.587	0.000484	-0.092666	18	0.025837	yes	EBVTLC
chr1_1652191_C_T_b38	SLC35E2	-3.587	0.000484	-0.092666	18	0.025837	yes	EBVTLC
chr1_1652592_A_G_b38	SLC35E2	-3.587	0.000484	-0.092666	18	0.025837	yes	EBVTLC
chr1_1652779_A_G_b38	SLC35E2	-3.587	0.000484	-0.092666	18	0.025837	yes	EBVTLC
chr1_1653147_A_C_b38	SLC35E2	-3.587	0.000484	-0.092666	18	0.025837	yes	EBVTLC
chr1_1653396_T_C_b38	SLC35E2	-3.587	0.000484	-0.092666	18	0.025837	yes	EBVTLC
chr1_1653472_T_C_b38	SLC35E2	-3.587	0.000484	-0.092666	18	0.025837	yes	EBVTLC
chr1_1653811_G_A_b38	SLC35E2	-3.587	0.000484	-0.092666	18	0.025837	yes	EBVTLC
chr1_1653893_C_T_b38	SLC35E2	-3.587	0.000484	-0.092666	18	0.025837	yes	EBVTLC
chr1_1653934_G_A_b38	SLC35E2	-3.587	0.000484	-0.092666	18	0.025837	yes	EBVTLC
chr1_1654143_G_A_b38	SLC35E2	-3.587	0.000484	-0.092666	18	0.025837	yes	EBVTLC
chr1_1654188_T_G_b38	SLC35E2	-3.587	0.000484	-0.092666	18	0.025837	yes	EBVTLC
chr1_1667424_T_TAAAATA_b38	SLC35E2	3.583	0.00049	0.102434	16	0.028585	yes	EBVTLC
chr1_1650777_G_A_b38	SLC35E2	-3.574	0.000506	-0.091041	18	0.025475	yes	EBVTLC
chr1_1650688_T_A_b38	SLC35E2	-3.526	0.000596	-0.101154	12	0.028685	yes	EBVTLC
chr1_1641261_C_T_b38	SLC35E2	-3.517	0.000614	-0.120449	4	0.034243	yes	EBVTLC
chr1_1714674_G_C_b38	SLC35E2	3.504	0.000644	0.111113	15	0.031712	yes	EBVTLC
chr1_1652913_C_T_b38	SLC35E2	-3.44	0.000799	-0.098467	12	0.028624	yes	EBVTLC
chr1_969780_C_T_b38	SLC35E2	3.416	0.000865	0.124095	12	0.036324	yes	EBVTLC
chr1_1637577_T_C_b38	SLC35E2	-3.414	0.000871	-0.099172	9	0.029045	yes	EBVTLC
chr1_1639348_G_T_b38	SLC35E2	-3.407	0.000893	-0.088569	21	0.025998	yes	EBVTLC
chr1_1650664_CTTTTT_C_b38	SLC35E2	-3.403	0.000905	-0.103494	7	0.030413	yes	EBVTLC
chr1_1648826_A_G_b38	SLC35E2	-3.37	0.00101	-0.089579	22	0.026577	yes	EBVTLC
chr1_1648636_G_A_b38	SLC35E2	-3.305	0.00125	-0.087704	22	0.02654	yes	EBVTLC
chr1_1675228_C_CG_b38	SLC35E2	3.303	0.00126	0.095456	27	0.028904	yes	EBVTLC
chr1_1739519_C_G_b38	SLC35E2	3.211	0.0017	0.10258	16	0.03195	yes	EBVTLC
chr1_1639685_G_A_b38	SLC35E2	-3.131	0.00219	-0.100362	5	0.032055	yes	EBVTLC
chr1_1586962_C_T_b38	SLC35E2	2.952	0.0038	0.07742	18	0.026229	yes	EBVTLC
chr1_1667424_T_TAAATA_b38	SLC35E2	-2.948	0.00384	-0.08333	19	0.028264	yes	EBVTLC
chr1_1675132_A_G_b38	SLC35E2	2.921	0.00417	0.083079	24	0.028444	yes	EBVTLC
chr1_1662738_CT_C_b38	SLC35E2	-2.918	0.0042	-0.093423	14	0.032018	yes	EBVTLC
chr1_1662855_T_C_b38	SLC35E2	-2.918	0.0042	-0.093423	14	0.032018	yes	EBVTLC
chr1_1613769_C_T_b38	SLC35E2	2.918	0.00421	0.090077	9	0.030875	yes	EBVTLC
chr1_1638879_C_T_b38	SLC35E2	-2.902	0.00441	-0.088108	7	0.030361	yes	EBVTLC
chr1_2363805_C_CAAACAA_b38	SLC35E2	-2.902	0.00441	-0.103432	6	0.035642	yes	EBVTLC
chr1_1650195_A_G_b38	SLC35E2	-2.899	0.00445	-0.076092	20	0.026248	yes	EBVTLC
chr1_2500892_C_A_b38	SLC35E2	2.891	0.00455	0.07368	22	0.025487	yes	EBVTLC
chr1_1724543_G_C_b38	SLC35E2	-2.887	0.0046	-0.141918	5	0.04915	yes	EBVTLC
chr1_1615869_C_T_b38	SLC35E2	2.866	0.00491	0.077204	19	0.02694	yes	EBVTLC
chr1_1703968_A_G_b38	SLC35E2	-2.856	0.00505	-0.138413	5	0.048466	yes	EBVTLC
chr1_1722626_AGCG_A_b38	SLC35E2	2.824	0.00555	0.087427	17	0.030961	yes	EBVTLC
chr1_2619655_CAA_C_b38	SLC35E2	-2.767	0.00654	-0.097308	6	0.035162	yes	EBVTLC
chr1_1005954_G_A_b38	SLC35E2	2.729	0.0073	0.068435	22	0.025077	yes	EBVTLC
chr1_2343445_C_T_b38	SLC35E2	-2.711	0.00768	-0.087659	4	0.032332	yes	EBVTLC
chr1_1676287_C_T_b38	SLC35E2	-2.708	0.00775	-0.088583	5	0.03271	yes	EBVTLC
chr1_2692592_T_A_b38	SLC35E2	2.708	0.00776	0.076716	9	0.028332	yes	EBVTLC
chr1_1934619_TTGTAGGTACACACGTGTGTACGTGGGTGTTAGGC_T_b38	SLC35E2	-2.687	0.00823	-0.107167	3	0.039889	yes	EBVTLC
chr1_1714635_A_G_b38	SLC35E2	2.679	0.00841	0.088837	6	0.033162	yes	EBVTLC
chr1_1641642_T_C_b38	SLC35E2	-2.677	0.00845	-0.073401	20	0.027414	yes	EBVTLC
chr1_1949580_T_G_b38	SLC35E2	-2.669	0.00866	-0.1224	3	0.045863	yes	EBVTLC
chr1_1949631_G_A_b38	SLC35E2	-2.669	0.00866	-0.1224	3	0.045863	yes	EBVTLC
chr1_1949646_A_G_b38	SLC35E2	-2.669	0.00866	-0.1224	3	0.045863	yes	EBVTLC
chr1_1714638_G_T_b38	SLC35E2	2.662	0.00881	0.089104	5	0.033467	yes	EBVTLC
chr1_1722619_C_T_b38	SLC35E2	2.66	0.00888	0.08159	18	0.030675	yes	EBVTLC
chr1_1663513_C_T_b38	SLC35E2	-2.644	0.00927	-0.118156	10	0.04468	yes	EBVTLC
chr1_1634406_C_CG_b38	SLC35E2	-2.622	0.00986	-0.097668	6	0.037248	yes	EBVTLC
chr1_1661177_A_G_b38	SLC35E2	-3.824	0.000209	-0.118028	5	0.030862	no	EBVTLC
chr1_1649993_A_G_b38	SLC35E2	-3.754	0.000269	-0.085717	33	0.022835	no	EBVTLC
chr1_1668542_C_T_b38	SLC35E2	-3.674	0.000357	-0.113929	5	0.031007	no	EBVTLC
chr1_1668717_C_G_b38	SLC35E2	-3.674	0.000357	-0.113929	5	0.031007	no	EBVTLC
chr1_1665061_C_T_b38	SLC35E2	-3.636	0.000407	-0.112217	5	0.030859	no	EBVTLC
chr1_1665581_C_G_b38	SLC35E2	-3.587	0.000483	-0.103372	7	0.028815	no	EBVTLC
chr1_1667948_A_G_b38	SLC35E2	-3.575	0.000503	-0.111789	5	0.031266	no	EBVTLC
chr1_1669613_G_A_b38	SLC35E2	-3.546	0.000557	-0.110296	5	0.031105	no	EBVTLC
chr1_1641275_A_G_b38	SLC35E2	-3.352	0.00107	-0.091621	22	0.027332	no	EBVTLC
chr1_1662933_T_A_b38	SLC35E2	3.244	0.00153	0.08938	12	0.027556	no	EBVTLC
chr1_1659940_A_C_b38	SLC35E2	-3.226	0.00162	-0.115077	4	0.035676	no	EBVTLC
chr1_1669576_G_A_b38	SLC35E2	-3.205	0.00173	-0.101926	5	0.0318	no	EBVTLC
chr1_897580_AT_A_b38	SLC35E2	-3.19	0.00181	-0.083485	32	0.02617	no	EBVTLC
chr1_2342840_A_ATATTT_b38	SLC35E2	-3.189	0.00182	-0.122746	5	0.038489	no	EBVTLC
chr1_1674633_C_CA_b38	SLC35E2	3.155	0.00203	0.091544	13	0.029015	no	EBVTLC
chr1_1629332_G_T_b38	SLC35E2	3.135	0.00216	0.093803	10	0.02992	no	EBVTLC
chr1_1949125_T_TTCCC_b38	SLC35E2	3.122	0.00225	0.095856	8	0.030705	no	EBVTLC
chr1_1707555_C_T_b38	SLC35E2	-3.051	0.0028	-0.12991	18	0.042579	no	EBVTLC
chr1_1702383_T_C_b38	SLC35E2	-3.036	0.00294	-0.093768	6	0.030888	no	EBVTLC
chr1_1612562_T_TC_b38	SLC35E2	3.013	0.00315	0.081726	13	0.027122	no	EBVTLC
chr1_1736801_CA_C_b38	SLC35E2	3.006	0.00322	0.091905	14	0.030572	no	EBVTLC
chr1_1147418_G_A_b38	SLC35E2	2.967	0.00362	0.102786	3	0.034638	no	EBVTLC
chr1_1498616_T_C_b38	SLC35E2	-2.941	0.00392	-0.16214	4	0.055134	no	EBVTLC
chr1_806017_A_G_b38	SLC35E2	-2.771	0.00648	-0.130909	4	0.047249	no	EBVTLC
chr1_1002415_C_CATTTTT_b38	SLC35E2	-2.742	0.00703	-0.071438	12	0.026051	no	EBVTLC
chr1_1689421_G_A_b38	SLC35E2	2.697	0.008	0.07109	20	0.026361	no	EBVTLC
chr1_1660408_T_C_b38	SLC35E2	-2.653	0.00904	-0.086648	4	0.032655	no	EBVTLC
chr1_1499586_C_CTT_b38	SLC35E2	-2.646	0.00923	-0.081451	11	0.030783	no	EBVTLC
chr1_1630798_C_T_b38	SLC35E2	2.645	0.00925	0.081714	9	0.030893	no	EBVTLC
chr1_1743714_C_CA_b38	SLC35E2	7.36	2.38e-12	0.121957	51	0.016571	yes	CLNSGM
chr1_1742587_G_C_b38	SLC35E2	6.977	2.46e-11	0.105379	78	0.015103	yes	CLNSGM
chr1_1744499_C_T_b38	SLC35E2	-6.745	9.75e-11	-0.1038	62	0.015389	yes	CLNSGM
chr1_1744854_C_A_b38	SLC35E2	-6.73	1.06e-10	-0.101591	47	0.015094	yes	CLNSGM
chr1_1744652_C_T_b38	SLC35E2	-6.587	2.45e-10	-0.106315	62	0.016141	yes	CLNSGM
chr1_1742672_C_T_b38	SLC35E2	-6.436	5.8e-10	-0.103762	56	0.016121	yes	CLNSGM
chr1_1743238_G_C_b38	SLC35E2	-6.436	5.8e-10	-0.103762	56	0.016121	yes	CLNSGM
chr1_1744028_A_AC_b38	SLC35E2	-6.344	9.79e-10	-0.1297	15	0.020445	yes	CLNSGM
chr1_1743840_T_C_b38	SLC35E2	-6.297	1.27e-09	-0.117811	25	0.01871	yes	CLNSGM
chr1_1743586_T_TAC_b38	SLC35E2	-6.223	1.92e-09	-0.10433	42	0.016766	yes	CLNSGM
chr1_1744052_GAGA_G_b38	SLC35E2	-6.143	3e-09	-0.124433	17	0.020258	yes	CLNSGM
chr1_1755523_C_T_b38	SLC35E2	6.083	4.15e-09	0.094209	78	0.015486	yes	CLNSGM
chr1_1743886_C_T_b38	SLC35E2	-6.007	6.31e-09	-0.10993	27	0.018302	yes	CLNSGM
chr1_1744096_C_T_b38	SLC35E2	-5.968	7.75e-09	-0.119446	40	0.020013	yes	CLNSGM
chr1_1743851_C_T_b38	SLC35E2	-5.968	7.77e-09	-0.112533	23	0.018856	yes	CLNSGM
chr1_1688328_C_T_b38	SLC35E2	-5.872	1.3e-08	-0.116495	12	0.019838	yes	CLNSGM
chr1_1743544_CA_C_b38	SLC35E2	5.708	3.09e-08	0.086384	70	0.015134	yes	CLNSGM
chr1_1692151_T_C_b38	SLC35E2	-5.625	4.75e-08	-0.105349	24	0.018728	yes	CLNSGM
chr1_1730405_G_C_b38	SLC35E2	5.586	5.82e-08	0.098225	48	0.017585	yes	CLNSGM
chr1_1746522_GT_G_b38	SLC35E2	-5.517	8.26e-08	-0.10357	25	0.018772	yes	CLNSGM
chr1_1764023_C_A_b38	SLC35E2	5.4	1.49e-07	0.090024	55	0.01667	yes	CLNSGM
chr1_1651653_C_T_b38	SLC35E2	5.386	1.6e-07	0.087783	71	0.016298	yes	CLNSGM
chr1_1648736_G_A_b38	SLC35E2	5.366	1.77e-07	0.087857	66	0.016373	yes	CLNSGM
chr1_1649932_C_T_b38	SLC35E2	5.327	2.16e-07	0.086931	67	0.01632	yes	CLNSGM
chr1_1757725_C_T_b38	SLC35E2	5.298	2.49e-07	0.088557	52	0.016717	yes	CLNSGM
chr1_1755504_T_C_b38	SLC35E2	5.275	2.78e-07	0.081124	76	0.015379	yes	CLNSGM
chr1_1750440_G_A_b38	SLC35E2	-5.181	4.42e-07	-0.095005	43	0.018339	yes	CLNSGM
chr1_1750428_G_C_b38	SLC35E2	-5.179	4.44e-07	-0.095347	45	0.018409	yes	CLNSGM
chr1_1757074_G_T_b38	SLC35E2	5.177	4.51e-07	0.085938	52	0.016602	yes	CLNSGM
chr1_1740343_C_T_b38	SLC35E2	5.121	5.89e-07	0.077521	87	0.015137	yes	CLNSGM
chr1_1736729_G_T_b38	SLC35E2	5.08	7.19e-07	0.077765	87	0.015309	yes	CLNSGM
chr1_1744121_A_C_b38	SLC35E2	-5.079	7.2e-07	-0.108076	39	0.021278	yes	CLNSGM
chr1_1673818_A_C_b38	SLC35E2	5.061	7.87e-07	0.08188	72	0.016179	yes	CLNSGM
chr1_1750226_C_T_b38	SLC35E2	5.043	8.58e-07	0.083907	55	0.01664	yes	CLNSGM
chr1_1754601_G_T_b38	SLC35E2	5.04	8.7e-07	0.084308	52	0.016729	yes	CLNSGM
chr1_1737504_A_C_b38	SLC35E2	5.024	9.38e-07	0.076487	89	0.015224	yes	CLNSGM
chr1_1756186_T_C_b38	SLC35E2	5.021	9.5e-07	0.083151	53	0.01656	yes	CLNSGM
chr1_1671995_G_T_b38	SLC35E2	5.006	1.02e-06	0.080673	70	0.016114	yes	CLNSGM
chr1_1654662_CT_C_b38	SLC35E2	4.942	1.38e-06	0.085645	52	0.017329	yes	CLNSGM
chr1_1676790_C_T_b38	SLC35E2	4.899	1.69e-06	0.078458	73	0.016016	yes	CLNSGM
chr1_1734903_A_G_b38	SLC35E2	4.855	2.08e-06	0.073858	88	0.015214	yes	CLNSGM
chr1_1731963_A_C_b38	SLC35E2	4.818	2.46e-06	0.073408	88	0.015237	yes	CLNSGM
chr1_1732392_C_T_b38	SLC35E2	4.818	2.46e-06	0.073408	88	0.015237	yes	CLNSGM
chr1_1734174_A_G_b38	SLC35E2	4.818	2.46e-06	0.073408	88	0.015237	yes	CLNSGM
chr1_1735176_C_T_b38	SLC35E2	4.818	2.46e-06	0.073408	88	0.015237	yes	CLNSGM
chr1_1735980_A_C_b38	SLC35E2	4.818	2.46e-06	0.073408	88	0.015237	yes	CLNSGM
chr1_1740703_C_T_b38	SLC35E2	4.818	2.46e-06	0.073408	88	0.015237	yes	CLNSGM
chr1_1677720_T_G_b38	SLC35E2	4.818	2.46e-06	0.077577	74	0.016103	yes	CLNSGM
chr1_1677726_A_T_b38	SLC35E2	4.818	2.46e-06	0.077577	74	0.016103	yes	CLNSGM
chr1_1904424_A_AAAATAAATAAAT_b38	SLC35E2	4.803	2.63e-06	0.077121	48	0.016056	yes	CLNSGM
chr1_1673060_G_A_b38	SLC35E2	4.799	2.69e-06	0.078496	70	0.016358	yes	CLNSGM
chr1_1820337_A_G_b38	SLC35E2	4.763	3.17e-06	0.076593	63	0.016082	yes	CLNSGM
chr1_1738295_G_T_b38	SLC35E2	4.751	3.33e-06	0.072593	87	0.015278	yes	CLNSGM
chr1_1752126_G_A_b38	SLC35E2	4.73	3.67e-06	0.084521	37	0.017868	yes	CLNSGM
chr1_1674868_G_A_b38	SLC35E2	4.727	3.73e-06	0.076221	72	0.016126	yes	CLNSGM
chr1_1747472_A_T_b38	SLC35E2	-4.722	3.82e-06	-0.081826	67	0.017331	yes	CLNSGM
chr1_1760882_T_C_b38	SLC35E2	4.708	4.06e-06	0.074471	66	0.015818	yes	CLNSGM
chr1_1749637_G_T_b38	SLC35E2	4.584	7.07e-06	0.074017	54	0.016147	yes	CLNSGM
chr1_1742432_TA_T_b38	SLC35E2	-4.565	7.68e-06	-0.082975	34	0.018175	yes	CLNSGM
chr1_1708474_C_A_b38	SLC35E2	-4.56	7.88e-06	-0.098913	11	0.021694	yes	CLNSGM
chr1_1749826_A_G_b38	SLC35E2	-4.526	9.12e-06	-0.074049	77	0.01636	yes	CLNSGM
chr1_1960609_G_C_b38	SLC35E2	-4.511	9.75e-06	-0.073092	51	0.016204	yes	CLNSGM
chr1_1726904_T_C_b38	SLC35E2	4.455	1.24e-05	0.070012	72	0.015715	yes	CLNSGM
chr1_1746440_A_G_b38	SLC35E2	-4.419	1.46e-05	-0.085932	23	0.019448	yes	CLNSGM
chr1_1736836_A_G_b38	SLC35E2	4.393	1.63e-05	0.07105	81	0.016174	yes	CLNSGM
chr1_1743565_ATAT_A_b38	SLC35E2	-4.354	1.92e-05	-0.068246	56	0.015676	yes	CLNSGM
chr1_1919188_CAGCGGCAGG_C_b38	SLC35E2	-4.348	1.97e-05	-0.073236	70	0.016844	yes	CLNSGM
chr1_1740869_C_T_b38	SLC35E2	-4.287	2.55e-05	-0.190846	4	0.044516	yes	CLNSGM
chr1_1743712_G_A_b38	SLC35E2	4.235	3.16e-05	0.117765	3	0.027806	yes	CLNSGM
chr1_1673968_GA_G_b38	SLC35E2	4.215	3.44e-05	0.082941	32	0.019678	yes	CLNSGM
chr1_1936906_CA_C_b38	SLC35E2	4.186	3.88e-05	0.09051	6	0.021621	yes	CLNSGM
chr1_1750589_G_A_b38	SLC35E2	-4.177	4.02e-05	-0.106227	12	0.02543	yes	CLNSGM
chr1_1667424_T_TAAAATA_b38	SLC35E2	4.176	4.05e-05	0.072837	43	0.017443	yes	CLNSGM
chr1_1851414_GA_G_b38	SLC35E2	-4.159	4.34e-05	-0.074519	38	0.017918	yes	CLNSGM
chr1_1741174_TTCA_T_b38	SLC35E2	-4.157	4.36e-05	-0.18703	4	0.044988	yes	CLNSGM
chr1_1741497_G_A_b38	SLC35E2	-4.157	4.36e-05	-0.18703	4	0.044988	yes	CLNSGM
chr1_1736832_GA_G_b38	SLC35E2	-4.073	6.16e-05	-0.195447	3	0.047991	yes	CLNSGM
chr1_1810086_A_G_b38	SLC35E2	4.062	6.43e-05	0.083823	14	0.020636	yes	CLNSGM
chr1_1708521_C_G_b38	SLC35E2	-4.05	6.75e-05	-0.079177	24	0.01955	yes	CLNSGM
chr1_1670423_AT_A_b38	SLC35E2	4.043	6.94e-05	0.077667	40	0.01921	yes	CLNSGM
chr1_1849992_T_TG_b38	SLC35E2	4.006	8.06e-05	0.090023	8	0.022474	yes	CLNSGM
chr1_1675132_A_G_b38	SLC35E2	3.995	8.43e-05	0.075545	36	0.018912	yes	CLNSGM
chr1_1909237_G_T_b38	SLC35E2	3.979	8.97e-05	0.076675	16	0.019271	yes	CLNSGM
chr1_1742432_T_TA_b38	SLC35E2	3.957	9.78e-05	0.069384	47	0.017534	yes	CLNSGM
chr1_1835922_G_GAAA_b38	SLC35E2	-3.929	0.000109	-0.154593	5	0.039348	yes	CLNSGM
chr1_1937046_G_A_b38	SLC35E2	3.916	0.000115	0.089405	8	0.022833	yes	CLNSGM
chr1_1906439_C_T_b38	SLC35E2	3.912	0.000116	0.074076	18	0.018933	yes	CLNSGM
chr1_1913504_CT_C_b38	SLC35E2	-3.868	0.000138	-0.071967	52	0.018604	yes	CLNSGM
chr1_1731093_G_C_b38	SLC35E2	-3.832	0.000159	-0.168755	4	0.044038	yes	CLNSGM
chr1_1735087_A_C_b38	SLC35E2	-3.832	0.000159	-0.168755	4	0.044038	yes	CLNSGM
chr1_1735286_G_A_b38	SLC35E2	-3.832	0.000159	-0.168755	4	0.044038	yes	CLNSGM
chr1_1866635_T_TAAA_b38	SLC35E2	-3.772	2e-04	-0.070288	40	0.018633	yes	CLNSGM
chr1_1900918_G_A_b38	SLC35E2	3.761	0.000209	0.073076	16	0.019429	yes	CLNSGM
chr1_1907199_A_G_b38	SLC35E2	3.761	0.000209	0.073076	16	0.019429	yes	CLNSGM
chr1_1762759_AAATG_A_b38	SLC35E2	3.76	0.00021	0.061695	62	0.01641	yes	CLNSGM
chr1_1907077_C_A_b38	SLC35E2	3.724	0.00024	0.076047	15	0.02042	yes	CLNSGM
chr1_1947648_G_A_b38	SLC35E2	3.706	0.000256	0.073818	13	0.019916	yes	CLNSGM
chr1_1691417_T_C_b38	SLC35E2	3.699	0.000263	0.068318	58	0.018468	yes	CLNSGM
chr1_1726649_G_A_b38	SLC35E2	-3.687	0.000276	-0.153567	6	0.041655	yes	CLNSGM
chr1_1722626_AGCG_A_b38	SLC35E2	3.675	0.000288	0.081328	21	0.022127	yes	CLNSGM
chr1_1903603_G_A_b38	SLC35E2	3.642	0.000326	0.071523	16	0.019639	yes	CLNSGM
chr1_1903617_C_T_b38	SLC35E2	3.642	0.000326	0.071523	16	0.019639	yes	CLNSGM
chr1_1653319_A_G_b38	SLC35E2	3.62	0.000353	0.067286	22	0.018585	yes	CLNSGM
chr1_1661562_G_C_b38	SLC35E2	3.61	0.000367	0.055472	72	0.015366	yes	CLNSGM
chr1_1722625_A_T_b38	SLC35E2	3.593	0.00039	0.079868	21	0.022226	yes	CLNSGM
chr1_1791389_G_A_b38	SLC35E2	3.592	0.000392	0.07388	15	0.020569	yes	CLNSGM
chr1_1024462_C_T_b38	SLC35E2	3.589	0.000396	0.062101	36	0.017303	yes	CLNSGM
chr1_1915022_C_T_b38	SLC35E2	3.589	0.000396	0.069538	16	0.019377	yes	CLNSGM
chr1_1942186_G_A_b38	SLC35E2	3.571	0.000423	0.072252	13	0.020233	yes	CLNSGM
chr1_1948121_T_G_b38	SLC35E2	3.562	0.000438	0.069648	18	0.019555	yes	CLNSGM
chr1_1750528_G_A_b38	SLC35E2	-3.558	0.000444	-0.055083	69	0.015483	yes	CLNSGM
chr1_1695459_A_G_b38	SLC35E2	3.55	0.000457	0.073581	51	0.020727	yes	CLNSGM
chr1_1017114_A_AT_b38	SLC35E2	3.534	0.000484	0.062566	43	0.017705	yes	CLNSGM
chr1_1742468_G_C_b38	SLC35E2	3.525	0.000499	0.056978	87	0.016163	yes	CLNSGM
chr1_995982_G_A_b38	SLC35E2	3.512	0.000523	0.056971	60	0.016221	yes	CLNSGM
chr1_1667424_T_TAAATA_b38	SLC35E2	-3.508	0.000532	-0.058097	56	0.016563	yes	CLNSGM
chr1_1913254_C_T_b38	SLC35E2	3.506	0.000535	0.06376	39	0.018187	yes	CLNSGM
chr1_1023351_A_G_b38	SLC35E2	3.489	0.000568	0.058168	43	0.016671	yes	CLNSGM
chr1_1722619_C_T_b38	SLC35E2	3.478	0.000592	0.076981	21	0.022136	yes	CLNSGM
chr1_1963533_C_CA_b38	SLC35E2	3.476	0.000595	0.056894	50	0.016365	yes	CLNSGM
chr1_1938467_C_T_b38	SLC35E2	3.476	0.000595	0.070319	13	0.020228	yes	CLNSGM
chr1_1726053_G_C_b38	SLC35E2	3.451	0.000651	0.083026	14	0.024059	yes	CLNSGM
chr1_1661169_C_A_b38	SLC35E2	3.433	0.000693	0.064068	22	0.018661	yes	CLNSGM
chr1_1016623_G_A_b38	SLC35E2	3.427	0.000708	0.057617	50	0.016812	yes	CLNSGM
chr1_1739131_T_C_b38	SLC35E2	3.412	0.000747	0.056788	59	0.016644	yes	CLNSGM
chr1_1055037_T_C_b38	SLC35E2	3.398	0.000785	0.061181	31	0.018007	yes	CLNSGM
chr1_1055000_C_T_b38	SLC35E2	3.387	0.000814	0.061383	30	0.018121	yes	CLNSGM
chr1_1929306_C_T_b38	SLC35E2	3.373	0.000855	0.067095	14	0.019889	yes	CLNSGM
chr1_995371_C_G_b38	SLC35E2	3.367	0.000874	0.05428	60	0.016121	yes	CLNSGM
chr1_1938221_TCA_T_b38	SLC35E2	3.361	0.000893	0.069145	12	0.020575	yes	CLNSGM
chr1_1054900_C_T_b38	SLC35E2	-3.356	0.000908	-0.061163	36	0.018226	yes	CLNSGM
chr1_1970506_T_A_b38	SLC35E2	-3.337	0.00097	-0.053075	60	0.015905	yes	CLNSGM
chr1_1903309_A_G_b38	SLC35E2	3.331	0.00099	0.063528	27	0.019073	yes	CLNSGM
chr1_1927692_C_T_b38	SLC35E2	3.325	0.00101	0.066222	14	0.019914	yes	CLNSGM
chr1_1929713_G_A_b38	SLC35E2	3.325	0.00101	0.066222	14	0.019914	yes	CLNSGM
chr1_1026830_A_G_b38	SLC35E2	3.321	0.00102	0.05582	42	0.016806	yes	CLNSGM
chr1_1877314_A_T_b38	SLC35E2	3.313	0.00105	0.064224	20	0.019386	yes	CLNSGM
chr1_1034279_G_A_b38	SLC35E2	3.306	0.00108	0.058635	27	0.017735	yes	CLNSGM
chr1_1897325_G_A_b38	SLC35E2	3.292	0.00113	0.066941	13	0.020335	yes	CLNSGM
chr1_1023525_A_G_b38	SLC35E2	3.289	0.00114	0.055701	42	0.016937	yes	CLNSGM
chr1_1637577_T_C_b38	SLC35E2	-3.26	0.00126	-0.064695	18	0.019847	yes	CLNSGM
chr1_995512_T_C_b38	SLC35E2	3.236	0.00137	0.052861	66	0.016334	yes	CLNSGM
chr1_1015903_C_T_b38	SLC35E2	-3.231	0.00139	-0.054538	82	0.01688	yes	CLNSGM
chr1_1728274_G_C_b38	SLC35E2	-3.221	0.00144	-0.150501	3	0.046724	yes	CLNSGM
chr1_1934896_C_T_b38	SLC35E2	3.216	0.00146	0.067013	10	0.020835	yes	CLNSGM
chr1_1891450_G_A_b38	SLC35E2	3.207	0.00151	0.061948	18	0.019315	yes	CLNSGM
chr1_1016184_A_G_b38	SLC35E2	3.204	0.00152	0.053061	57	0.016558	yes	CLNSGM
chr1_1722599_G_A_b38	SLC35E2	3.193	0.00158	0.064717	30	0.02027	yes	CLNSGM
chr1_995786_A_G_b38	SLC35E2	3.189	0.0016	0.051771	66	0.016235	yes	CLNSGM
chr1_1735008_G_GGTTT_b38	SLC35E2	-3.189	0.0016	-0.053319	54	0.016721	yes	CLNSGM
chr1_1675228_C_CG_b38	SLC35E2	3.185	0.00162	0.059338	41	0.018628	yes	CLNSGM
chr1_1023573_A_G_b38	SLC35E2	3.185	0.00162	0.054029	43	0.016966	yes	CLNSGM
chr1_1672155_G_A_b38	SLC35E2	-3.176	0.00167	-0.062313	24	0.019619	yes	CLNSGM
chr1_1005954_G_A_b38	SLC35E2	3.174	0.00168	0.052324	56	0.016483	yes	CLNSGM
chr1_1008307_G_C_b38	SLC35E2	3.167	0.00172	0.052959	54	0.016722	yes	CLNSGM
chr1_1009184_T_C_b38	SLC35E2	3.167	0.00172	0.052959	54	0.016722	yes	CLNSGM
chr1_2312125_G_A_b38	SLC35E2	-3.162	0.00175	-0.050696	86	0.016034	yes	CLNSGM
chr1_1022868_A_G_b38	SLC35E2	3.162	0.00175	0.052347	46	0.016556	yes	CLNSGM
chr1_1018652_C_G_b38	SLC35E2	3.161	0.00175	0.053734	37	0.016997	yes	CLNSGM
chr1_1018754_G_A_b38	SLC35E2	3.161	0.00175	0.053734	37	0.016997	yes	CLNSGM
chr1_1877312_A_T_b38	SLC35E2	3.152	0.00181	0.075172	7	0.023846	yes	CLNSGM
chr1_1963538_T_C_b38	SLC35E2	3.144	0.00186	0.052612	47	0.016733	yes	CLNSGM
chr1_995153_C_G_b38	SLC35E2	3.141	0.00188	0.051684	63	0.016456	yes	CLNSGM
chr1_1902056_G_A_b38	SLC35E2	3.133	0.00193	0.059922	18	0.019125	yes	CLNSGM
chr1_1021740_G_C_b38	SLC35E2	3.132	0.00193	0.053254	37	0.017003	yes	CLNSGM
chr1_1015915_C_T_b38	SLC35E2	-3.117	0.00203	-0.052613	83	0.016879	yes	CLNSGM
chr1_1004625_A_G_b38	SLC35E2	3.115	0.00204	0.051177	59	0.016428	yes	CLNSGM
chr1_1729403_C_T_b38	SLC35E2	-3.115	0.00204	-0.146174	3	0.046926	yes	CLNSGM
chr1_1730099_A_G_b38	SLC35E2	-3.115	0.00204	-0.146174	3	0.046926	yes	CLNSGM
chr1_1022518_G_T_b38	SLC35E2	3.114	0.00205	0.051535	43	0.016547	yes	CLNSGM
chr1_995187_A_G_b38	SLC35E2	3.113	0.00206	0.050733	65	0.016297	yes	CLNSGM
chr1_1663949_A_G_b38	SLC35E2	-3.097	0.00216	-0.072222	6	0.023317	yes	CLNSGM
chr1_2263866_C_CA_b38	SLC35E2	-3.088	0.00223	-0.06302	15	0.020405	yes	CLNSGM
chr1_1025970_C_T_b38	SLC35E2	3.085	0.00225	0.053171	34	0.017235	yes	CLNSGM
chr1_1619986_T_C_b38	SLC35E2	3.079	0.0023	0.059005	24	0.019166	yes	CLNSGM
chr1_1015297_T_C_b38	SLC35E2	-3.076	0.00232	-0.051059	83	0.016599	yes	CLNSGM
chr1_1026084_G_T_b38	SLC35E2	3.05	0.00253	0.05276	34	0.0173	yes	CLNSGM
chr1_1032846_C_A_b38	SLC35E2	3.036	0.00264	0.051769	35	0.017052	yes	CLNSGM
chr1_1014228_G_A_b38	SLC35E2	3.035	0.00265	0.051056	57	0.016821	yes	CLNSGM
chr1_1845824_TACACACACACACACACACACACACACACAC_T_b38	SLC35E2	3.03	0.00269	0.058315	20	0.019247	yes	CLNSGM
chr1_1674633_C_CA_b38	SLC35E2	3.027	0.00271	0.053324	35	0.017614	yes	CLNSGM
chr1_1025561_G_C_b38	SLC35E2	3.022	0.00276	0.052287	34	0.017304	yes	CLNSGM
chr1_1852145_G_A_b38	SLC35E2	3.019	0.00279	0.057409	19	0.019015	yes	CLNSGM
chr1_1020217_G_T_b38	SLC35E2	3.01	0.00286	0.051112	37	0.016979	yes	CLNSGM
chr1_1740160_G_A_b38	SLC35E2	-3.006	0.00291	-0.05016	56	0.016688	yes	CLNSGM
chr1_1617375_T_C_b38	SLC35E2	3.003	0.00293	0.054232	30	0.018058	yes	CLNSGM
chr1_1618213_C_G_b38	SLC35E2	3.003	0.00293	0.054232	30	0.018058	yes	CLNSGM
chr1_1618290_G_C_b38	SLC35E2	3.003	0.00293	0.054232	30	0.018058	yes	CLNSGM
chr1_1865951_T_A_b38	SLC35E2	3	0.00296	0.057613	17	0.019205	yes	CLNSGM
chr1_1869595_G_A_b38	SLC35E2	2.989	0.00307	0.057547	18	0.019253	yes	CLNSGM
chr1_1878070_C_T_b38	SLC35E2	2.989	0.00307	0.057547	18	0.019253	yes	CLNSGM
chr1_1881006_GGA_G_b38	SLC35E2	2.989	0.00307	0.057547	18	0.019253	yes	CLNSGM
chr1_1780791_C_T_b38	SLC35E2	2.982	0.00314	0.057433	18	0.019261	yes	CLNSGM
chr1_1782430_T_G_b38	SLC35E2	2.982	0.00314	0.057433	18	0.019261	yes	CLNSGM
chr1_1783572_C_A_b38	SLC35E2	2.982	0.00314	0.057433	18	0.019261	yes	CLNSGM
chr1_1794321_C_T_b38	SLC35E2	2.982	0.00314	0.057433	18	0.019261	yes	CLNSGM
chr1_1805214_T_G_b38	SLC35E2	2.982	0.00314	0.057433	18	0.019261	yes	CLNSGM
chr1_1827615_G_A_b38	SLC35E2	2.982	0.00314	0.057433	18	0.019261	yes	CLNSGM
chr1_1837455_C_T_b38	SLC35E2	2.982	0.00314	0.057433	18	0.019261	yes	CLNSGM
chr1_1851762_G_A_b38	SLC35E2	2.982	0.00314	0.057433	18	0.019261	yes	CLNSGM
chr1_1842226_T_C_b38	SLC35E2	2.98	0.00315	0.057539	18	0.019308	yes	CLNSGM
chr1_1005904_C_T_b38	SLC35E2	2.976	0.00319	0.049282	56	0.016559	yes	CLNSGM
chr1_1968103_A_ATGAG_b38	SLC35E2	2.975	0.00321	0.057012	20	0.019166	yes	CLNSGM
chr1_1955061_GCGGCTC_G_b38	SLC35E2	2.97	0.00326	0.055463	29	0.018677	yes	CLNSGM
chr1_1955068_ACACCGGAAGTGC_A_b38	SLC35E2	2.97	0.00326	0.055463	29	0.018677	yes	CLNSGM
chr1_2321320_A_G_b38	SLC35E2	2.961	0.00334	0.050401	48	0.01702	yes	CLNSGM
chr1_1014863_A_C_b38	SLC35E2	2.957	0.00339	0.049128	54	0.016617	yes	CLNSGM
chr1_1888667_A_C_b38	SLC35E2	2.951	0.00346	0.056998	18	0.019317	yes	CLNSGM
chr1_1020697_C_T_b38	SLC35E2	2.95	0.00347	0.052248	30	0.017714	yes	CLNSGM
chr1_1005429_C_CA_b38	SLC35E2	2.946	0.00351	0.04857	57	0.016488	yes	CLNSGM
chr1_1466242_C_CA_b38	SLC35E2	-2.941	0.00357	-0.088453	6	0.030081	yes	CLNSGM
chr1_1688442_T_C_b38	SLC35E2	-2.938	0.0036	-0.059771	23	0.020346	yes	CLNSGM
chr1_1951642_C_T_b38	SLC35E2	2.933	0.00365	0.058268	17	0.019864	yes	CLNSGM
chr1_1020681_A_AG_b38	SLC35E2	2.922	0.00378	0.05169	30	0.017688	yes	CLNSGM
chr1_1951498_C_T_b38	SLC35E2	2.921	0.00379	0.058067	17	0.019877	yes	CLNSGM
chr1_1688102_G_A_b38	SLC35E2	-2.918	0.00383	-0.057198	20	0.019602	yes	CLNSGM
chr1_1954765_A_AGAGT_b38	SLC35E2	2.918	0.00383	0.054406	27	0.018648	yes	CLNSGM
chr1_1885444_TTAGA_T_b38	SLC35E2	2.908	0.00395	0.056464	18	0.019416	yes	CLNSGM
chr1_1615869_C_T_b38	SLC35E2	2.906	0.00397	0.052592	30	0.018095	yes	CLNSGM
chr1_1918697_C_T_b38	SLC35E2	2.904	0.004	0.055653	21	0.019166	yes	CLNSGM
chr1_1811084_T_A_b38	SLC35E2	-2.897	0.00409	-0.048943	65	0.016895	yes	CLNSGM
chr1_1015925_A_ATT_b38	SLC35E2	2.89	0.00418	0.048994	43	0.016953	yes	CLNSGM
chr1_1734263_T_C_b38	SLC35E2	-2.886	0.00422	-0.048427	56	0.016777	yes	CLNSGM
chr1_1676287_C_T_b38	SLC35E2	-2.879	0.00432	-0.063072	8	0.021907	yes	CLNSGM
chr1_1635226_T_C_b38	SLC35E2	-2.877	0.00434	-0.06626	6	0.023028	yes	CLNSGM
chr1_1873952_G_A_b38	SLC35E2	2.871	0.00443	0.055484	19	0.019328	yes	CLNSGM
chr1_1878651_C_T_b38	SLC35E2	2.871	0.00443	0.055484	19	0.019328	yes	CLNSGM
chr1_1954781_C_T_b38	SLC35E2	2.87	0.00444	0.053788	26	0.018742	yes	CLNSGM
chr1_1884183_G_A_b38	SLC35E2	2.87	0.00444	0.055311	19	0.019274	yes	CLNSGM
chr1_1616547_T_C_b38	SLC35E2	2.867	0.00448	0.052067	29	0.018159	yes	CLNSGM
chr1_1879682_G_A_b38	SLC35E2	2.865	0.00451	0.055595	19	0.019407	yes	CLNSGM
chr1_1803531_C_T_b38	SLC35E2	2.864	0.00453	0.055375	19	0.019337	yes	CLNSGM
chr1_1830566_A_T_b38	SLC35E2	2.864	0.00453	0.055375	19	0.019337	yes	CLNSGM
chr1_1839349_C_G_b38	SLC35E2	2.864	0.00453	0.055375	19	0.019337	yes	CLNSGM
chr1_1839350_T_A_b38	SLC35E2	2.864	0.00453	0.055375	19	0.019337	yes	CLNSGM
chr1_1842333_G_A_b38	SLC35E2	2.864	0.00453	0.055375	19	0.019337	yes	CLNSGM
chr1_1851181_C_T_b38	SLC35E2	2.864	0.00453	0.055375	19	0.019337	yes	CLNSGM
chr1_1006159_C_T_b38	SLC35E2	2.863	0.00454	0.047301	59	0.016523	yes	CLNSGM
chr1_1735008_G_GTTTT_b38	SLC35E2	2.86	0.00458	0.043189	88	0.015103	yes	CLNSGM
chr1_1737703_A_C_b38	SLC35E2	-2.856	0.00463	-0.047395	56	0.016594	yes	CLNSGM
chr1_1679100_A_G_b38	SLC35E2	-2.855	0.00465	-0.047038	51	0.016476	yes	CLNSGM
chr1_1842213_A_G_b38	SLC35E2	2.854	0.00466	0.055384	19	0.019405	yes	CLNSGM
chr1_1842221_C_G_b38	SLC35E2	2.854	0.00466	0.055384	19	0.019405	yes	CLNSGM
chr1_1928119_T_C_b38	SLC35E2	2.853	0.00468	0.057674	13	0.020215	yes	CLNSGM
chr1_1639685_G_A_b38	SLC35E2	-2.846	0.00477	-0.059761	14	0.020996	yes	CLNSGM
chr1_1808642_TTTTG_T_b38	SLC35E2	2.846	0.00478	0.055511	18	0.019506	yes	CLNSGM
chr1_1890186_G_A_b38	SLC35E2	2.836	0.00493	0.055014	19	0.019399	yes	CLNSGM
chr1_1767762_C_A_b38	SLC35E2	2.833	0.00497	0.054614	18	0.019279	yes	CLNSGM
chr1_1773215_C_A_b38	SLC35E2	2.833	0.00497	0.054614	18	0.019279	yes	CLNSGM
chr1_1774308_G_A_b38	SLC35E2	2.833	0.00497	0.054614	18	0.019279	yes	CLNSGM
chr1_1776301_T_G_b38	SLC35E2	2.833	0.00497	0.054614	18	0.019279	yes	CLNSGM
chr1_995508_ATTTTT_A_b38	SLC35E2	-2.816	0.00523	-0.046927	86	0.016662	yes	CLNSGM
chr1_1708001_A_T_b38	SLC35E2	-2.807	0.00537	-0.092272	7	0.032871	yes	CLNSGM
chr1_1741276_C_T_b38	SLC35E2	-2.8	0.00549	-0.047481	48	0.016958	yes	CLNSGM
chr1_1714932_G_T_b38	SLC35E2	2.788	0.0057	0.04588	71	0.016458	yes	CLNSGM
chr1_1965250_G_GA_b38	SLC35E2	2.78	0.00582	0.052921	20	0.019033	yes	CLNSGM
chr1_992993_A_G_b38	SLC35E2	2.776	0.0059	0.044077	73	0.015878	yes	CLNSGM
chr1_1707801_C_G_b38	SLC35E2	-2.774	0.00593	-0.104582	9	0.037695	yes	CLNSGM
chr1_1966606_G_A_b38	SLC35E2	2.773	0.00596	0.053866	19	0.019428	yes	CLNSGM
chr1_1030889_ATGTGTGTGTGTGCAGTGCATGGTGCTGTGAGATCAGCG_A_b38	SLC35E2	-2.772	0.00596	-0.103533	3	0.037344	yes	CLNSGM
chr1_1834655_A_C_b38	SLC35E2	2.771	0.00599	0.05349	18	0.019305	yes	CLNSGM
chr1_1924659_C_T_b38	SLC35E2	2.766	0.00607	0.052999	21	0.019159	yes	CLNSGM
chr1_1912983_T_C_b38	SLC35E2	2.764	0.00611	0.05042	23	0.01824	yes	CLNSGM
chr1_1613421_T_C_b38	SLC35E2	2.753	0.00632	0.050358	29	0.018292	yes	CLNSGM
chr1_1881428_C_T_b38	SLC35E2	2.739	0.00659	0.055266	15	0.020179	yes	CLNSGM
chr1_1005757_AGCCCCCGCAGCAGT_A_b38	SLC35E2	-2.737	0.00663	-0.044701	78	0.016334	yes	CLNSGM
chr1_1615322_A_G_b38	SLC35E2	2.735	0.00666	0.04994	29	0.01826	yes	CLNSGM
chr1_2137275_G_A_b38	SLC35E2	2.734	0.00668	0.056008	17	0.020484	yes	CLNSGM
chr1_1677707_C_T_b38	SLC35E2	-2.734	0.00669	-0.068939	6	0.025218	yes	CLNSGM
chr1_1773723_T_A_b38	SLC35E2	-2.732	0.00673	-0.050334	29	0.018427	yes	CLNSGM
chr1_1890770_C_T_b38	SLC35E2	2.731	0.00675	0.052969	23	0.019398	yes	CLNSGM
chr1_1021472_C_T_b38	SLC35E2	-2.729	0.00678	-0.045445	85	0.016651	yes	CLNSGM
chr1_1773725_T_A_b38	SLC35E2	-2.721	0.00694	-0.050151	29	0.01843	yes	CLNSGM
chr1_1954906_C_CA_b38	SLC35E2	2.721	0.00695	0.05045	30	0.018542	yes	CLNSGM
chr1_1954907_G_GCC_b38	SLC35E2	2.721	0.00695	0.05045	30	0.018542	yes	CLNSGM
chr1_1688457_G_A_b38	SLC35E2	-2.72	0.00696	-0.056419	25	0.020741	yes	CLNSGM
chr1_1629332_G_T_b38	SLC35E2	2.719	0.00698	0.048608	38	0.017875	yes	CLNSGM
chr1_1704673_G_A_b38	SLC35E2	-2.718	0.00701	-0.080021	10	0.029445	yes	CLNSGM
chr1_1773719_T_A_b38	SLC35E2	-2.715	0.00708	-0.050113	30	0.018461	yes	CLNSGM
chr1_1773721_T_A_b38	SLC35E2	-2.715	0.00708	-0.050113	30	0.018461	yes	CLNSGM
chr1_1665061_C_T_b38	SLC35E2	-2.712	0.00713	-0.056189	15	0.020718	yes	CLNSGM
chr1_1968012_GTGAA_G_b38	SLC35E2	2.704	0.0073	0.05167	20	0.019109	yes	CLNSGM
chr1_1950071_C_A_b38	SLC35E2	2.704	0.00731	0.053268	18	0.019702	yes	CLNSGM
chr1_998410_G_A_b38	SLC35E2	-2.701	0.00736	-0.045235	88	0.016747	yes	CLNSGM
chr1_1671724_C_T_b38	SLC35E2	-2.697	0.00745	-0.053655	19	0.019893	yes	CLNSGM
chr1_989068_GTTGA_G_b38	SLC35E2	-2.697	0.00745	-0.044881	86	0.01664	yes	CLNSGM
chr1_1842237_T_C_b38	SLC35E2	2.694	0.00751	0.052295	19	0.019411	yes	CLNSGM
chr1_1769737_GA_G_b38	SLC35E2	2.691	0.00758	0.056037	12	0.020823	yes	CLNSGM
chr1_1721197_CA_C_b38	SLC35E2	2.689	0.00762	0.072152	12	0.026829	yes	CLNSGM
chr1_1688619_AAAC_A_b38	SLC35E2	-2.688	0.00765	-0.058802	17	0.021878	yes	CLNSGM
chr1_1965001_G_A_b38	SLC35E2	2.687	0.00767	0.051489	19	0.019161	yes	CLNSGM
chr1_1014733_GAAGT_G_b38	SLC35E2	-2.686	0.0077	-0.044968	85	0.016742	yes	CLNSGM
chr1_1896396_CT_C_b38	SLC35E2	2.68	0.00784	0.059243	5	0.022108	yes	CLNSGM
chr1_1864350_C_T_b38	SLC35E2	2.679	0.00784	0.050528	21	0.018859	yes	CLNSGM
chr1_1594570_A_G_b38	SLC35E2	2.676	0.00792	0.048603	30	0.018162	yes	CLNSGM
chr1_2313782_C_T_b38	SLC35E2	-2.668	0.0081	-0.050884	33	0.01907	yes	CLNSGM
chr1_1921849_G_T_b38	SLC35E2	2.668	0.0081	0.050631	23	0.018976	yes	CLNSGM
chr1_1601796_A_C_b38	SLC35E2	2.668	0.00811	0.04837	33	0.018129	yes	CLNSGM
chr1_1604202_G_A_b38	SLC35E2	2.668	0.00811	0.04837	33	0.018129	yes	CLNSGM
chr1_1964101_A_G_b38	SLC35E2	2.667	0.00813	0.051197	20	0.019196	yes	CLNSGM
chr1_1964746_T_C_b38	SLC35E2	2.667	0.00813	0.051197	20	0.019196	yes	CLNSGM
chr1_1964784_C_T_b38	SLC35E2	2.667	0.00813	0.051197	20	0.019196	yes	CLNSGM
chr1_1966030_A_G_b38	SLC35E2	2.667	0.00813	0.051197	20	0.019196	yes	CLNSGM
chr1_1966314_C_G_b38	SLC35E2	2.667	0.00813	0.051197	20	0.019196	yes	CLNSGM
chr1_1966930_G_A_b38	SLC35E2	2.667	0.00813	0.051197	20	0.019196	yes	CLNSGM
chr1_1967246_T_C_b38	SLC35E2	2.667	0.00813	0.051197	20	0.019196	yes	CLNSGM
chr1_1967338_G_C_b38	SLC35E2	2.667	0.00813	0.051197	20	0.019196	yes	CLNSGM
chr1_1967340_C_A_b38	SLC35E2	2.667	0.00813	0.051197	20	0.019196	yes	CLNSGM
chr1_1967389_T_C_b38	SLC35E2	2.667	0.00813	0.051197	20	0.019196	yes	CLNSGM
chr1_1967396_C_A_b38	SLC35E2	2.667	0.00813	0.051197	20	0.019196	yes	CLNSGM
chr1_1967420_G_A_b38	SLC35E2	2.667	0.00813	0.051197	20	0.019196	yes	CLNSGM
chr1_1967495_T_C_b38	SLC35E2	2.667	0.00813	0.051197	20	0.019196	yes	CLNSGM
chr1_1967536_G_A_b38	SLC35E2	2.667	0.00813	0.051197	20	0.019196	yes	CLNSGM
chr1_1967725_G_C_b38	SLC35E2	2.667	0.00813	0.051197	20	0.019196	yes	CLNSGM
chr1_1967840_A_T_b38	SLC35E2	2.667	0.00813	0.051197	20	0.019196	yes	CLNSGM
chr1_1967880_T_C_b38	SLC35E2	2.667	0.00813	0.051197	20	0.019196	yes	CLNSGM
chr1_1968130_GTGAA_G_b38	SLC35E2	2.667	0.00813	0.051197	20	0.019196	yes	CLNSGM
chr1_1968422_C_T_b38	SLC35E2	2.667	0.00813	0.051197	20	0.019196	yes	CLNSGM
chr1_1964663_G_A_b38	SLC35E2	2.666	0.00816	0.051062	20	0.019154	yes	CLNSGM
chr1_1963738_C_T_b38	SLC35E2	2.665	0.00818	0.051192	20	0.019209	yes	CLNSGM
chr1_1965114_C_T_b38	SLC35E2	2.665	0.00818	0.051192	20	0.019209	yes	CLNSGM
chr1_1966910_C_T_b38	SLC35E2	2.665	0.00818	0.051192	20	0.019209	yes	CLNSGM
chr1_1967980_A_AAGAATGAG_b38	SLC35E2	2.664	0.0082	0.051074	20	0.01917	yes	CLNSGM
chr1_1008588_C_T_b38	SLC35E2	-2.664	0.0082	-0.045062	82	0.016916	yes	CLNSGM
chr1_1968585_TG_T_b38	SLC35E2	2.646	0.00865	0.050363	21	0.019037	yes	CLNSGM
chr1_1840043_T_TA_b38	SLC35E2	2.645	0.00866	0.060103	5	0.022721	yes	CLNSGM
chr1_1050080_T_C_b38	SLC35E2	-2.636	0.00889	-0.087032	8	0.033019	yes	CLNSGM
chr1_2288986_T_C_b38	SLC35E2	-2.632	0.00898	-0.044962	37	0.017081	yes	CLNSGM
chr1_1034835_G_C_b38	SLC35E2	-2.627	0.00912	-0.042892	78	0.016326	yes	CLNSGM
chr1_1688647_G_A_b38	SLC35E2	-2.621	0.00927	-0.056233	20	0.021453	yes	CLNSGM
chr1_1955652_CG_C_b38	SLC35E2	2.619	0.00932	0.053602	14	0.020464	yes	CLNSGM
chr1_1664099_T_C_b38	SLC35E2	-2.619	0.00933	-0.056457	12	0.021555	yes	CLNSGM
chr1_1023789_G_C_b38	SLC35E2	-2.609	0.00961	-0.042859	77	0.016429	yes	CLNSGM
chr1_1774506_T_C_b38	SLC35E2	-2.607	0.00966	-0.048367	40	0.018552	yes	CLNSGM
chr1_1650383_G_T_b38	SLC35E2	-2.604	0.00973	-0.048363	24	0.01857	yes	CLNSGM
chr1_1985619_A_G_b38	SLC35E2	2.604	0.00974	0.044945	35	0.017261	yes	CLNSGM
chr1_1966152_C_T_b38	SLC35E2	2.601	0.00984	0.049936	20	0.019202	yes	CLNSGM
chr1_1613322_T_C_b38	SLC35E2	2.597	0.00993	0.047014	31	0.018101	yes	CLNSGM
chr1_1753033_C_T_b38	SLC35E2	-5.674	3.69e-08	-0.092964	78	0.016384	no	CLNSGM
chr1_1759611_C_T_b38	SLC35E2	-5.565	6.47e-08	-0.093748	70	0.016846	no	CLNSGM
chr1_1759354_G_A_b38	SLC35E2	-5.479	1e-07	-0.092762	68	0.016929	no	CLNSGM
chr1_1752461_G_A_b38	SLC35E2	-5.468	1.06e-07	-0.092783	67	0.016969	no	CLNSGM
chr1_1752730_C_G_b38	SLC35E2	-5.468	1.06e-07	-0.092783	67	0.016969	no	CLNSGM
chr1_1753319_G_A_b38	SLC35E2	-5.468	1.06e-07	-0.092783	67	0.016969	no	CLNSGM
chr1_1753361_G_A_b38	SLC35E2	-5.468	1.06e-07	-0.092783	67	0.016969	no	CLNSGM
chr1_1692124_T_G_b38	SLC35E2	-5.426	1.31e-07	-0.103686	21	0.019111	no	CLNSGM
chr1_1743565_AT_A_b38	SLC35E2	5.328	2.14e-07	0.076967	83	0.014446	no	CLNSGM
chr1_1748780_G_A_b38	SLC35E2	-5.298	2.48e-07	-0.089279	69	0.016851	no	CLNSGM
chr1_1756043_G_T_b38	SLC35E2	-5.277	2.75e-07	-0.089436	68	0.016947	no	CLNSGM
chr1_1754482_TCCCTGGGACCGAAGTCGCCCCA_T_b38	SLC35E2	-5.2	4.02e-07	-0.088068	68	0.016936	no	CLNSGM
chr1_1752908_C_CCCT_b38	SLC35E2	-5.196	4.1e-07	-0.089603	60	0.017245	no	CLNSGM
chr1_1750280_A_G_b38	SLC35E2	-5.106	6.34e-07	-0.085645	72	0.016774	no	CLNSGM
chr1_1649976_G_A_b38	SLC35E2	5.088	6.91e-07	0.084131	56	0.016535	no	CLNSGM
chr1_1747695_A_G_b38	SLC35E2	-5.064	7.75e-07	-0.073579	73	0.01453	no	CLNSGM
chr1_1877330_T_C_b38	SLC35E2	-4.982	1.15e-06	-0.082169	61	0.016495	no	CLNSGM
chr1_1636278_G_T_b38	SLC35E2	4.954	1.31e-06	0.084565	58	0.01707	no	CLNSGM
chr1_1770997_G_A_b38	SLC35E2	-4.835	2.28e-06	-0.0813	69	0.016816	no	CLNSGM
chr1_1646352_A_C_b38	SLC35E2	4.725	3.75e-06	0.11528	4	0.024395	no	CLNSGM
chr1_1773460_G_A_b38	SLC35E2	-4.704	4.14e-06	-0.080475	68	0.017109	no	CLNSGM
chr1_1773476_C_G_b38	SLC35E2	-4.704	4.14e-06	-0.080475	68	0.017109	no	CLNSGM
chr1_1650000_G_A_b38	SLC35E2	4.699	4.22e-06	0.07622	49	0.01622	no	CLNSGM
chr1_1674720_TGC_T_b38	SLC35E2	4.688	4.44e-06	0.075812	71	0.016171	no	CLNSGM
chr1_1791493_C_T_b38	SLC35E2	-4.676	4.7e-06	-0.081351	67	0.017399	no	CLNSGM
chr1_1791592_G_A_b38	SLC35E2	-4.676	4.7e-06	-0.081351	67	0.017399	no	CLNSGM
chr1_1792927_G_A_b38	SLC35E2	-4.676	4.7e-06	-0.081351	67	0.017399	no	CLNSGM
chr1_1748597_C_G_b38	SLC35E2	-4.658	5.07e-06	-0.080664	68	0.017316	no	CLNSGM
chr1_1776461_GAAAC_G_b38	SLC35E2	-4.64	5.5e-06	-0.080257	68	0.017295	no	CLNSGM
chr1_1777362_A_G_b38	SLC35E2	-4.64	5.5e-06	-0.080257	68	0.017295	no	CLNSGM
chr1_1808816_G_T_b38	SLC35E2	-4.64	5.5e-06	-0.080257	68	0.017295	no	CLNSGM
chr1_1819825_G_A_b38	SLC35E2	-4.64	5.5e-06	-0.080257	68	0.017295	no	CLNSGM
chr1_1831318_C_T_b38	SLC35E2	-4.64	5.5e-06	-0.080257	68	0.017295	no	CLNSGM
chr1_1755713_G_A_b38	SLC35E2	-4.615	6.16e-06	-0.079416	60	0.017209	no	CLNSGM
chr1_1847030_A_G_b38	SLC35E2	-4.613	6.2e-06	-0.079262	68	0.017181	no	CLNSGM
chr1_1850017_G_T_b38	SLC35E2	-4.613	6.2e-06	-0.079262	68	0.017181	no	CLNSGM
chr1_1671797_G_A_b38	SLC35E2	4.595	6.73e-06	0.074813	68	0.016282	no	CLNSGM
chr1_1899573_C_T_b38	SLC35E2	-4.539	8.61e-06	-0.078607	69	0.017317	no	CLNSGM
chr1_1764887_C_A_b38	SLC35E2	-4.512	9.7e-06	-0.078052	69	0.017299	no	CLNSGM
chr1_1771864_G_A_b38	SLC35E2	-4.512	9.7e-06	-0.078052	69	0.017299	no	CLNSGM
chr1_1772426_T_A_b38	SLC35E2	-4.512	9.7e-06	-0.078052	69	0.017299	no	CLNSGM
chr1_1773848_A_C_b38	SLC35E2	-4.512	9.7e-06	-0.078052	69	0.017299	no	CLNSGM
chr1_1790040_C_T_b38	SLC35E2	-4.512	9.7e-06	-0.078052	69	0.017299	no	CLNSGM
chr1_1817295_T_C_b38	SLC35E2	-4.512	9.7e-06	-0.078052	69	0.017299	no	CLNSGM
chr1_1827774_A_G_b38	SLC35E2	-4.512	9.7e-06	-0.078052	69	0.017299	no	CLNSGM
chr1_1846009_AGG_A_b38	SLC35E2	-4.504	1e-05	-0.077704	70	0.01725	no	CLNSGM
chr1_1846011_G_GTCC_b38	SLC35E2	-4.504	1e-05	-0.077704	70	0.01725	no	CLNSGM
chr1_1797530_C_A_b38	SLC35E2	-4.493	1.06e-05	-0.078303	67	0.017429	no	CLNSGM
chr1_1866508_A_G_b38	SLC35E2	-4.49	1.07e-05	-0.077084	70	0.017169	no	CLNSGM
chr1_1875208_T_C_b38	SLC35E2	-4.49	1.07e-05	-0.077084	70	0.017169	no	CLNSGM
chr1_1879567_T_C_b38	SLC35E2	-4.49	1.07e-05	-0.077084	70	0.017169	no	CLNSGM
chr1_1843381_A_T_b38	SLC35E2	-4.485	1.09e-05	-0.077047	69	0.01718	no	CLNSGM
chr1_1891450_G_C_b38	SLC35E2	-4.45	1.27e-05	-0.0758	67	0.017033	no	CLNSGM
chr1_1901262_C_T_b38	SLC35E2	-4.446	1.29e-05	-0.076881	70	0.017292	no	CLNSGM
chr1_1901386_C_A_b38	SLC35E2	-4.446	1.29e-05	-0.076881	70	0.017292	no	CLNSGM
chr1_1860718_A_C_b38	SLC35E2	-4.437	1.34e-05	-0.076195	72	0.017171	no	CLNSGM
chr1_1881082_C_T_b38	SLC35E2	-4.428	1.4e-05	-0.075837	70	0.017127	no	CLNSGM
chr1_1881249_A_G_b38	SLC35E2	-4.428	1.4e-05	-0.075837	70	0.017127	no	CLNSGM
chr1_1886800_G_A_b38	SLC35E2	-4.428	1.4e-05	-0.075837	70	0.017127	no	CLNSGM
chr1_1891654_C_CAGAG_b38	SLC35E2	-4.428	1.4e-05	-0.075837	70	0.017127	no	CLNSGM
chr1_1772410_T_C_b38	SLC35E2	-4.418	1.46e-05	-0.076152	69	0.017237	no	CLNSGM
chr1_1751981_A_T_b38	SLC35E2	-4.416	1.47e-05	-0.086391	30	0.019564	no	CLNSGM
chr1_1848037_C_CTA_b38	SLC35E2	4.414	1.49e-05	0.072707	61	0.016473	no	CLNSGM
chr1_1912607_C_T_b38	SLC35E2	-4.401	1.57e-05	-0.076262	64	0.017329	no	CLNSGM
chr1_1905586_C_T_b38	SLC35E2	-4.366	1.83e-05	-0.076156	68	0.017445	no	CLNSGM
chr1_1909234_G_A_b38	SLC35E2	-4.336	2.07e-05	-0.076127	70	0.017556	no	CLNSGM
chr1_1909238_G_A_b38	SLC35E2	-4.336	2.07e-05	-0.076127	70	0.017556	no	CLNSGM
chr1_1844830_C_A_b38	SLC35E2	4.331	2.12e-05	0.071909	60	0.016604	no	CLNSGM
chr1_1766653_A_G_b38	SLC35E2	-4.33	2.12e-05	-0.075083	69	0.01734	no	CLNSGM
chr1_1781909_C_T_b38	SLC35E2	4.324	2.18e-05	0.071183	61	0.016463	no	CLNSGM
chr1_1762287_A_G_b38	SLC35E2	-4.307	2.35e-05	-0.075177	70	0.017456	no	CLNSGM
chr1_1891444_CG_C_b38	SLC35E2	-4.305	2.36e-05	-0.074203	67	0.017236	no	CLNSGM
chr1_1902481_G_A_b38	SLC35E2	-4.278	2.65e-05	-0.073569	70	0.017197	no	CLNSGM
chr1_1880596_T_A_b38	SLC35E2	-4.276	2.67e-05	-0.073746	64	0.017247	no	CLNSGM
chr1_1836126_C_A_b38	SLC35E2	-4.265	2.79e-05	-0.071504	73	0.016763	no	CLNSGM
chr1_1902439_C_T_b38	SLC35E2	-4.257	2.89e-05	-0.073312	70	0.017222	no	CLNSGM
chr1_1944216_C_T_b38	SLC35E2	-4.195	3.74e-05	-0.073176	68	0.017445	no	CLNSGM
chr1_1758323_T_C_b38	SLC35E2	4.174	4.08e-05	0.06771	59	0.016222	no	CLNSGM
chr1_1769969_CAAAACAAAAACA_C_b38	SLC35E2	-4.141	4.66e-05	-0.072391	72	0.017481	no	CLNSGM
chr1_1769969_CAAAACA_C_b38	SLC35E2	4.133	4.83e-05	0.067212	57	0.016264	no	CLNSGM
chr1_1881428_C_CT_b38	SLC35E2	-4.132	4.84e-05	-0.072262	66	0.017488	no	CLNSGM
chr1_1877316_A_T_b38	SLC35E2	4.129	4.9e-05	0.067538	50	0.016357	no	CLNSGM
chr1_1918090_A_G_b38	SLC35E2	-4.114	5.22e-05	-0.070495	70	0.017136	no	CLNSGM
chr1_1612562_T_TC_b38	SLC35E2	4.1	5.52e-05	0.067546	41	0.016475	no	CLNSGM
chr1_1913643_T_C_b38	SLC35E2	-4.099	5.53e-05	-0.071195	63	0.017367	no	CLNSGM
chr1_1866635_T_TA_b38	SLC35E2	4.086	5.83e-05	0.075391	41	0.018449	no	CLNSGM
chr1_1945975_TG_T_b38	SLC35E2	-4.024	7.5e-05	-0.070991	66	0.017643	no	CLNSGM
chr1_1725582_T_C_b38	SLC35E2	4.021	7.59e-05	0.060654	64	0.015086	no	CLNSGM
chr1_1945842_A_AAAAGAAC_b38	SLC35E2	-4.014	7.8e-05	-0.073063	48	0.018202	no	CLNSGM
chr1_1925307_C_A_b38	SLC35E2	-4.013	7.84e-05	-0.069917	66	0.017424	no	CLNSGM
chr1_1921333_C_T_b38	SLC35E2	-4.012	7.85e-05	-0.068562	71	0.017088	no	CLNSGM
chr1_1925281_C_T_b38	SLC35E2	-4.011	7.89e-05	-0.069109	70	0.017229	no	CLNSGM
chr1_1944074_T_C_b38	SLC35E2	-3.982	8.85e-05	-0.069233	69	0.017386	no	CLNSGM
chr1_1944091_G_C_b38	SLC35E2	-3.982	8.85e-05	-0.069233	69	0.017386	no	CLNSGM
chr1_1926870_T_C_b38	SLC35E2	-3.98	8.92e-05	-0.067225	57	0.01689	no	CLNSGM
chr1_1937802_G_T_b38	SLC35E2	-3.98	8.93e-05	-0.070577	67	0.017733	no	CLNSGM
chr1_1944419_C_G_b38	SLC35E2	-3.978	8.99e-05	-0.069375	69	0.017439	no	CLNSGM
chr1_1944675_C_T_b38	SLC35E2	-3.978	8.99e-05	-0.069375	69	0.017439	no	CLNSGM
chr1_1945121_T_C_b38	SLC35E2	-3.978	8.99e-05	-0.069375	69	0.017439	no	CLNSGM
chr1_1946013_C_T_b38	SLC35E2	-3.978	8.99e-05	-0.069375	69	0.017439	no	CLNSGM
chr1_1946058_T_C_b38	SLC35E2	-3.978	8.99e-05	-0.069375	69	0.017439	no	CLNSGM
chr1_1946632_C_T_b38	SLC35E2	-3.978	8.99e-05	-0.069375	69	0.017439	no	CLNSGM
chr1_1947189_C_T_b38	SLC35E2	-3.978	8.99e-05	-0.069375	69	0.017439	no	CLNSGM
chr1_1914345_C_T_b38	SLC35E2	-3.966	9.45e-05	-0.068204	71	0.017198	no	CLNSGM
chr1_1914918_G_A_b38	SLC35E2	-3.966	9.45e-05	-0.068204	71	0.017198	no	CLNSGM
chr1_1915326_G_A_b38	SLC35E2	-3.966	9.45e-05	-0.068204	71	0.017198	no	CLNSGM
chr1_1916217_C_T_b38	SLC35E2	-3.966	9.45e-05	-0.068204	71	0.017198	no	CLNSGM
chr1_1920695_A_G_b38	SLC35E2	-3.966	9.45e-05	-0.068204	71	0.017198	no	CLNSGM
chr1_1925233_T_C_b38	SLC35E2	-3.966	9.45e-05	-0.068204	71	0.017198	no	CLNSGM
chr1_1927857_T_C_b38	SLC35E2	-3.966	9.45e-05	-0.068204	71	0.017198	no	CLNSGM
chr1_1924788_C_T_b38	SLC35E2	-3.966	9.45e-05	-0.068117	72	0.017177	no	CLNSGM
chr1_1929904_C_T_b38	SLC35E2	-3.948	0.000101	-0.068213	70	0.017279	no	CLNSGM
chr1_1930143_C_T_b38	SLC35E2	-3.948	0.000101	-0.068213	70	0.017279	no	CLNSGM
chr1_1936906_C_CA_b38	SLC35E2	-3.945	0.000102	-0.072121	37	0.018279	no	CLNSGM
chr1_1865278_A_C_b38	SLC35E2	3.943	0.000103	0.066266	54	0.016806	no	CLNSGM
chr1_1779667_T_TTG_b38	SLC35E2	3.943	0.000103	0.071642	42	0.018171	no	CLNSGM
chr1_1944182_G_C_b38	SLC35E2	-3.941	0.000104	-0.069474	68	0.01763	no	CLNSGM
chr1_1916417_G_T_b38	SLC35E2	-3.917	0.000115	-0.066184	62	0.016898	no	CLNSGM
chr1_1931743_CA_C_b38	SLC35E2	-3.909	0.000118	-0.078467	26	0.020072	no	CLNSGM
chr1_1942887_C_G_b38	SLC35E2	-3.902	0.000121	-0.0683	69	0.017504	no	CLNSGM
chr1_1934565_G_A_b38	SLC35E2	-3.887	0.000128	-0.065506	63	0.016851	no	CLNSGM
chr1_1936077_C_T_b38	SLC35E2	-3.885	0.00013	-0.064382	65	0.016572	no	CLNSGM
chr1_1902318_T_TA_b38	SLC35E2	-3.866	0.000139	-0.075946	31	0.019642	no	CLNSGM
chr1_1944420_A_G_b38	SLC35E2	-3.828	0.000162	-0.067011	69	0.017506	no	CLNSGM
chr1_1931587_A_G_b38	SLC35E2	-3.827	0.000162	-0.063245	64	0.016526	no	CLNSGM
chr1_1969015_A_G_b38	SLC35E2	3.823	0.000165	0.065671	71	0.017177	no	CLNSGM
chr1_1931580_CA_C_b38	SLC35E2	-3.806	0.000176	-0.063406	63	0.016658	no	CLNSGM
chr1_1914634_G_T_b38	SLC35E2	-3.784	0.000191	-0.063837	62	0.01687	no	CLNSGM
chr1_1916670_G_C_b38	SLC35E2	-3.784	0.000191	-0.063837	62	0.01687	no	CLNSGM
chr1_1936627_C_G_b38	SLC35E2	-3.771	0.000201	-0.063588	62	0.016862	no	CLNSGM
chr1_1620609_G_A_b38	SLC35E2	3.737	0.000228	0.062915	39	0.016835	no	CLNSGM
chr1_1750508_A_C_b38	SLC35E2	-3.733	0.000232	-0.056451	71	0.015122	no	CLNSGM
chr1_1940540_G_A_b38	SLC35E2	-3.724	0.00024	-0.062831	64	0.01687	no	CLNSGM
chr1_1940973_C_T_b38	SLC35E2	-3.724	0.00024	-0.062831	64	0.01687	no	CLNSGM
chr1_1942014_G_A_b38	SLC35E2	-3.724	0.00024	-0.062831	64	0.01687	no	CLNSGM
chr1_1942075_A_G_b38	SLC35E2	-3.724	0.00024	-0.062831	64	0.01687	no	CLNSGM
chr1_1942086_T_C_b38	SLC35E2	-3.724	0.00024	-0.062831	64	0.01687	no	CLNSGM
chr1_1942260_G_C_b38	SLC35E2	-3.724	0.00024	-0.062831	64	0.01687	no	CLNSGM
chr1_1942258_G_A_b38	SLC35E2	-3.697	0.000266	-0.062531	63	0.016913	no	CLNSGM
chr1_1922670_A_G_b38	SLC35E2	-3.694	0.000269	-0.061803	62	0.016732	no	CLNSGM
chr1_1928648_C_T_b38	SLC35E2	-3.694	0.000269	-0.061803	62	0.016732	no	CLNSGM
chr1_1938332_A_ACT_b38	SLC35E2	-3.68	0.000284	-0.061454	66	0.016701	no	CLNSGM
chr1_1947645_C_T_b38	SLC35E2	-3.678	0.000285	-0.064452	67	0.017523	no	CLNSGM
chr1_1622295_G_C_b38	SLC35E2	3.678	0.000286	0.061972	39	0.016851	no	CLNSGM
chr1_1935987_G_A_b38	SLC35E2	-3.667	0.000297	-0.063524	71	0.017323	no	CLNSGM
chr1_1937273_T_C_b38	SLC35E2	-3.653	0.000312	-0.061993	61	0.016968	no	CLNSGM
chr1_1918989_A_G_b38	SLC35E2	-3.626	0.000346	-0.060872	61	0.016789	no	CLNSGM
chr1_1773713_T_A_b38	SLC35E2	-3.62	0.000354	-0.067003	31	0.01851	no	CLNSGM
chr1_1937895_C_T_b38	SLC35E2	-3.606	0.000373	-0.063131	69	0.017509	no	CLNSGM
chr1_1933087_C_T_b38	SLC35E2	-3.604	0.000374	-0.060642	61	0.016824	no	CLNSGM
chr1_1933859_A_G_b38	SLC35E2	-3.604	0.000374	-0.060642	61	0.016824	no	CLNSGM
chr1_1937841_ACACCAGGTCCACCTCTGGACACAGGTCCACC_A_b38	SLC35E2	-3.593	0.000391	-0.060637	64	0.016877	no	CLNSGM
chr1_1938054_ACT_A_b38	SLC35E2	-3.585	0.000403	-0.060803	64	0.016962	no	CLNSGM
chr1_1921745_T_C_b38	SLC35E2	-3.554	0.000449	-0.05973	61	0.016804	no	CLNSGM
chr1_1938125_TCA_T_b38	SLC35E2	-3.533	0.000485	-0.06143	68	0.017387	no	CLNSGM
chr1_1621352_G_A_b38	SLC35E2	3.522	0.000505	0.059479	39	0.016887	no	CLNSGM
chr1_1649993_A_G_b38	SLC35E2	-3.516	0.000516	-0.057035	81	0.016222	no	CLNSGM
chr1_972790_C_G_b38	SLC35E2	-3.507	0.000533	-0.132049	8	0.037653	no	CLNSGM
chr1_1613769_C_T_b38	SLC35E2	3.502	0.000543	0.061451	36	0.017547	no	CLNSGM
chr1_1828894_T_TAC_b38	SLC35E2	3.502	0.000543	0.05945	53	0.016977	no	CLNSGM
chr1_1716710_G_T_b38	SLC35E2	-3.487	0.000574	-0.190483	3	0.054633	no	CLNSGM
chr1_1600379_C_T_b38	SLC35E2	3.47	0.000609	0.059398	38	0.017118	no	CLNSGM
chr1_1951106_G_A_b38	SLC35E2	-3.428	0.000706	-0.060149	72	0.017547	no	CLNSGM
chr1_1951865_G_GT_b38	SLC35E2	-3.428	0.000706	-0.060149	72	0.017547	no	CLNSGM
chr1_1818305_T_TA_b38	SLC35E2	-3.427	0.000709	-0.058637	41	0.017112	no	CLNSGM
chr1_1950071_C_T_b38	SLC35E2	-3.385	0.000821	-0.059301	72	0.017518	no	CLNSGM
chr1_1952064_G_A_b38	SLC35E2	-3.385	0.000821	-0.059301	72	0.017518	no	CLNSGM
chr1_1952823_TA_T_b38	SLC35E2	-3.385	0.000821	-0.059301	72	0.017518	no	CLNSGM
chr1_1600320_C_G_b38	SLC35E2	3.385	0.000821	0.058012	37	0.017139	no	CLNSGM
chr1_1715541_A_C_b38	SLC35E2	3.359	0.000899	0.12014	3	0.035769	no	CLNSGM
chr1_1717507_T_C_b38	SLC35E2	3.287	0.00115	0.086925	12	0.026441	no	CLNSGM
chr1_1609058_G_A_b38	SLC35E2	3.287	0.00115	0.055539	39	0.016899	no	CLNSGM
chr1_1948515_C_T_b38	SLC35E2	-3.267	0.00123	-0.055226	79	0.016906	no	CLNSGM
chr1_1948519_T_C_b38	SLC35E2	-3.267	0.00123	-0.055226	79	0.016906	no	CLNSGM
chr1_1607931_G_A_b38	SLC35E2	3.242	0.00134	0.055106	38	0.016997	no	CLNSGM
chr1_1776772_TA_T_b38	SLC35E2	3.233	0.00138	0.071508	5	0.022121	no	CLNSGM
chr1_1606507_GTGGGC_G_b38	SLC35E2	3.21	0.00149	0.054749	62	0.017058	no	CLNSGM
chr1_1708855_TTCCTCCTCC_T_b38	SLC35E2	3.207	0.00151	0.059879	56	0.01867	no	CLNSGM
chr1_1918484_C_A_b38	SLC35E2	-3.182	0.00164	-0.091592	4	0.028786	no	CLNSGM
chr1_1935938_T_C_b38	SLC35E2	-3.169	0.00171	-0.05464	52	0.017241	no	CLNSGM
chr1_1948919_T_TCCTTCCCTCCTCTTTCCCTCCCTTCTTTCCTTCCCTTTCCCTCCCTC_b38	SLC35E2	-3.168	0.00172	-0.047923	66	0.01513	no	CLNSGM
chr1_1727506_T_C_b38	SLC35E2	3.156	0.00178	0.064395	25	0.020402	no	CLNSGM
chr1_1035169_TGG_T_b38	SLC35E2	3.137	0.0019	0.061801	13	0.019701	no	CLNSGM
chr1_1586962_C_T_b38	SLC35E2	3.129	0.00195	0.053812	42	0.0172	no	CLNSGM
chr1_1708951_C_T_b38	SLC35E2	3.119	0.00202	0.054812	51	0.017572	no	CLNSGM
chr1_1425464_CA_C_b38	SLC35E2	-3.117	0.00203	-0.081507	3	0.026152	no	CLNSGM
chr1_1967499_G_A_b38	SLC35E2	3.094	0.00219	0.051934	47	0.016785	no	CLNSGM
chr1_1739883_C_T_b38	SLC35E2	-3.088	0.00223	-0.051739	56	0.016755	no	CLNSGM
chr1_1719638_C_CTCGCTCTGTCACCCAGGCT_b38	SLC35E2	3.088	0.00223	0.077864	16	0.025219	no	CLNSGM
chr1_1697272_G_A_b38	SLC35E2	3.072	0.00235	0.086507	15	0.028159	no	CLNSGM
chr1_1955080_C_CGGCTCACACCGGAAGTGAGGCTCACACCGGAAGTGA_b38	SLC35E2	-3.065	0.0024	-0.051088	66	0.016668	no	CLNSGM
chr1_1708505_G_C_b38	SLC35E2	3.049	0.00253	0.048746	45	0.015987	no	CLNSGM
chr1_1736832_GAAAA_G_b38	SLC35E2	-3.047	0.00254	-0.052706	45	0.017295	no	CLNSGM
chr1_1738309_A_G_b38	SLC35E2	-3.043	0.00258	-0.050889	55	0.016723	no	CLNSGM
chr1_1968793_T_C_b38	SLC35E2	3.038	0.00262	0.050797	49	0.016721	no	CLNSGM
chr1_1732013_G_A_b38	SLC35E2	-3.023	0.00275	-0.050535	56	0.016714	no	CLNSGM
chr1_1732412_G_C_b38	SLC35E2	-3.023	0.00275	-0.050535	56	0.016714	no	CLNSGM
chr1_1732422_G_A_b38	SLC35E2	-3.023	0.00275	-0.050535	56	0.016714	no	CLNSGM
chr1_1733576_G_A_b38	SLC35E2	-3.023	0.00275	-0.050535	56	0.016714	no	CLNSGM
chr1_1735370_G_A_b38	SLC35E2	-3.023	0.00275	-0.050535	56	0.016714	no	CLNSGM
chr1_1735884_C_T_b38	SLC35E2	-3.023	0.00275	-0.050535	56	0.016714	no	CLNSGM
chr1_1736472_C_T_b38	SLC35E2	-3.023	0.00275	-0.050535	56	0.016714	no	CLNSGM
chr1_1737704_C_T_b38	SLC35E2	-3.023	0.00275	-0.050535	56	0.016714	no	CLNSGM
chr1_1776772_TAA_T_b38	SLC35E2	-3.023	0.00275	-0.057164	30	0.01891	no	CLNSGM
chr1_1732834_T_TATCG_b38	SLC35E2	-3.016	0.00281	-0.050183	56	0.016638	no	CLNSGM
chr1_1715553_G_A_b38	SLC35E2	3.016	0.00281	0.082184	21	0.02725	no	CLNSGM
chr1_1738606_C_T_b38	SLC35E2	3.008	0.00289	0.057876	32	0.019241	no	CLNSGM
chr1_1715546_C_T_b38	SLC35E2	3.001	0.00295	0.07951	13	0.026499	no	CLNSGM
chr1_1715350_T_C_b38	SLC35E2	2.994	0.00302	0.082918	11	0.027698	no	CLNSGM
chr1_1704835_C_T_b38	SLC35E2	2.99	0.00305	0.051076	86	0.017081	no	CLNSGM
chr1_1931966_T_C_b38	SLC35E2	2.975	0.0032	0.057024	39	0.019165	no	CLNSGM
chr1_1595028_C_CAG_b38	SLC35E2	2.967	0.00328	0.056123	25	0.018914	no	CLNSGM
chr1_1718040_T_TAG_b38	SLC35E2	2.949	0.00348	0.080874	13	0.027425	no	CLNSGM
chr1_1924264_CCG_C_b38	SLC35E2	-2.936	0.00362	-0.047203	76	0.016079	no	CLNSGM
chr1_1714988_T_G_b38	SLC35E2	2.928	0.00371	0.081455	12	0.027821	no	CLNSGM
chr1_1715011_G_A_b38	SLC35E2	2.928	0.00371	0.081455	12	0.027821	no	CLNSGM
chr1_981454_G_A_b38	SLC35E2	-2.925	0.00375	-0.047954	84	0.016395	no	CLNSGM
chr1_983193_A_G_b38	SLC35E2	-2.925	0.00375	-0.047954	84	0.016395	no	CLNSGM
chr1_1720309_G_C_b38	SLC35E2	2.923	0.00377	0.080917	12	0.027686	no	CLNSGM
chr1_1904424_A_AAAATAAAT_b38	SLC35E2	-2.915	0.00386	-0.049386	68	0.016942	no	CLNSGM
chr1_1716247_A_C_b38	SLC35E2	2.915	0.00387	0.0796	12	0.02731	no	CLNSGM
chr1_986280_C_T_b38	SLC35E2	2.897	0.00409	0.060523	13	0.020893	no	CLNSGM
chr1_986629_G_A_b38	SLC35E2	2.897	0.00409	0.060523	13	0.020893	no	CLNSGM
chr1_1688570_A_T_b38	SLC35E2	-2.896	0.0041	-0.066966	7	0.023127	no	CLNSGM
chr1_1792696_C_CA_b38	SLC35E2	2.893	0.00414	0.048072	40	0.016619	no	CLNSGM
chr1_989148_C_A_b38	SLC35E2	-2.883	0.00426	-0.047342	81	0.016419	no	CLNSGM
chr1_1924269_C_T_b38	SLC35E2	-2.881	0.00429	-0.046196	76	0.016036	no	CLNSGM
chr1_973034_C_T_b38	SLC35E2	-2.88	0.00431	-0.101713	7	0.035318	no	CLNSGM
chr1_1740107_G_A_b38	SLC35E2	-2.877	0.00434	-0.047713	57	0.016581	no	CLNSGM
chr1_1836387_CTT_C_b38	SLC35E2	-2.849	0.00473	-0.06633	14	0.023279	no	CLNSGM
chr1_1801780_A_G_b38	SLC35E2	-2.841	0.00485	-0.054207	36	0.019081	no	CLNSGM
chr1_1715860_C_T_b38	SLC35E2	2.84	0.00486	0.079503	12	0.027992	no	CLNSGM
chr1_1715862_G_A_b38	SLC35E2	2.84	0.00486	0.079503	12	0.027992	no	CLNSGM
chr1_1716085_C_T_b38	SLC35E2	2.84	0.00486	0.079503	12	0.027992	no	CLNSGM
chr1_1716089_G_C_b38	SLC35E2	2.84	0.00486	0.079503	12	0.027992	no	CLNSGM
chr1_1717185_C_A_b38	SLC35E2	2.84	0.00486	0.079503	12	0.027992	no	CLNSGM
chr1_1718761_A_C_b38	SLC35E2	2.84	0.00486	0.079503	12	0.027992	no	CLNSGM
chr1_1718824_G_T_b38	SLC35E2	2.84	0.00486	0.079503	12	0.027992	no	CLNSGM
chr1_1718971_T_C_b38	SLC35E2	2.84	0.00486	0.079503	12	0.027992	no	CLNSGM
chr1_1719368_T_C_b38	SLC35E2	2.84	0.00486	0.079503	12	0.027992	no	CLNSGM
chr1_1719406_G_A_b38	SLC35E2	2.84	0.00486	0.079503	12	0.027992	no	CLNSGM
chr1_1720183_C_T_b38	SLC35E2	2.84	0.00486	0.079503	12	0.027992	no	CLNSGM
chr1_1720376_T_C_b38	SLC35E2	2.84	0.00486	0.079503	12	0.027992	no	CLNSGM
chr1_1720472_C_A_b38	SLC35E2	2.84	0.00486	0.079503	12	0.027992	no	CLNSGM
chr1_1720498_G_A_b38	SLC35E2	2.84	0.00486	0.079503	12	0.027992	no	CLNSGM
chr1_1720523_G_A_b38	SLC35E2	2.84	0.00486	0.079503	12	0.027992	no	CLNSGM
chr1_1720696_C_CTTA_b38	SLC35E2	2.84	0.00486	0.079503	12	0.027992	no	CLNSGM
chr1_1720787_A_G_b38	SLC35E2	2.84	0.00486	0.079503	12	0.027992	no	CLNSGM
chr1_1721565_T_C_b38	SLC35E2	2.84	0.00486	0.079503	12	0.027992	no	CLNSGM
chr1_1721589_C_T_b38	SLC35E2	2.84	0.00486	0.079503	12	0.027992	no	CLNSGM
chr1_1721864_T_C_b38	SLC35E2	2.84	0.00486	0.079503	12	0.027992	no	CLNSGM
chr1_1721893_GT_G_b38	SLC35E2	2.84	0.00486	0.079503	12	0.027992	no	CLNSGM
chr1_1721922_C_T_b38	SLC35E2	2.84	0.00486	0.079503	12	0.027992	no	CLNSGM
chr1_1721975_C_T_b38	SLC35E2	2.84	0.00486	0.079503	12	0.027992	no	CLNSGM
chr1_1740017_C_T_b38	SLC35E2	-2.824	0.00511	-0.047064	55	0.016666	no	CLNSGM
chr1_1969229_T_A_b38	SLC35E2	2.8	0.00549	0.054037	19	0.019299	no	CLNSGM
chr1_983004_G_T_b38	SLC35E2	-2.799	0.00551	-0.046413	86	0.016582	no	CLNSGM
chr1_1955317_G_GCTGGTGCGCGT_b38	SLC35E2	-2.799	0.00551	-0.079555	3	0.028427	no	CLNSGM
chr1_1650664_CT_C_b38	SLC35E2	2.797	0.00554	0.055308	30	0.019775	no	CLNSGM
chr1_1695747_C_T_b38	SLC35E2	2.783	0.00579	0.056873	47	0.020439	no	CLNSGM
chr1_1707744_A_G_b38	SLC35E2	-2.781	0.00582	-0.082893	11	0.029811	no	CLNSGM
chr1_1722940_TAAG_T_b38	SLC35E2	2.772	0.00597	0.067041	20	0.024185	no	CLNSGM
chr1_1834667_C_CTT_b38	SLC35E2	-2.765	0.0061	-0.125079	3	0.045239	no	CLNSGM
chr1_1708486_C_A_b38	SLC35E2	2.765	0.0061	0.044007	62	0.015918	no	CLNSGM
chr1_1764303_C_T_b38	SLC35E2	-2.763	0.00614	-0.085211	3	0.030844	no	CLNSGM
chr1_1769192_C_T_b38	SLC35E2	-2.763	0.00614	-0.085211	3	0.030844	no	CLNSGM
chr1_1780639_C_T_b38	SLC35E2	-2.763	0.00614	-0.085211	3	0.030844	no	CLNSGM
chr1_1787203_C_A_b38	SLC35E2	-2.763	0.00614	-0.085211	3	0.030844	no	CLNSGM
chr1_1811239_C_T_b38	SLC35E2	-2.763	0.00614	-0.085211	3	0.030844	no	CLNSGM
chr1_1860776_C_T_b38	SLC35E2	-2.763	0.00614	-0.085211	3	0.030844	no	CLNSGM
chr1_998741_G_A_b38	SLC35E2	2.756	0.00626	0.056373	16	0.020453	no	CLNSGM
chr1_1845824_TACACAC_T_b38	SLC35E2	2.746	0.00644	0.056417	14	0.020542	no	CLNSGM
chr1_1706067_ACT_A_b38	SLC35E2	2.744	0.00649	0.047193	85	0.017199	no	CLNSGM
chr1_1837255_A_AT_b38	SLC35E2	2.74	0.00657	0.0588	11	0.02146	no	CLNSGM
chr1_2106518_A_G_b38	SLC35E2	-2.738	0.00661	-0.117632	4	0.042966	no	CLNSGM
chr1_1889256_CTTAA_C_b38	SLC35E2	-2.737	0.00662	-0.083847	3	0.030631	no	CLNSGM
chr1_1834667_C_CT_b38	SLC35E2	-2.734	0.00668	-0.044736	50	0.016362	no	CLNSGM
chr1_1902068_C_T_b38	SLC35E2	-2.733	0.0067	-0.084351	3	0.030859	no	CLNSGM
chr1_1773727_T_A_b38	SLC35E2	-2.732	0.00672	-0.050522	28	0.018491	no	CLNSGM
chr1_1948938_C_T_b38	SLC35E2	-2.718	0.007	-0.041192	67	0.015155	no	CLNSGM
chr1_1738597_C_A_b38	SLC35E2	2.712	0.00713	0.052094	34	0.019207	no	CLNSGM
chr1_1730265_A_G_b38	SLC35E2	-2.697	0.00745	-0.049386	31	0.018311	no	CLNSGM
chr1_1018572_G_A_b38	SLC35E2	-2.694	0.00752	-0.045323	83	0.016824	no	CLNSGM
chr1_1738525_G_A_b38	SLC35E2	-2.693	0.00755	-0.046353	49	0.017215	no	CLNSGM
chr1_979560_T_C_b38	SLC35E2	-2.691	0.00757	-0.044345	86	0.016476	no	CLNSGM
chr1_1004716_C_T_b38	SLC35E2	-2.69	0.0076	-0.044004	82	0.016356	no	CLNSGM
chr1_1888382_A_AG_b38	SLC35E2	2.689	0.00762	0.06964	3	0.025894	no	CLNSGM
chr1_1969235_A_G_b38	SLC35E2	2.689	0.00763	0.051852	19	0.019284	no	CLNSGM
chr1_1993108_C_G_b38	SLC35E2	2.679	0.00784	0.044238	74	0.01651	no	CLNSGM
chr1_1844896_C_T_b38	SLC35E2	-2.677	0.00789	-0.083408	3	0.031152	no	CLNSGM
chr1_1606384_A_G_b38	SLC35E2	2.664	0.0082	0.046716	42	0.017535	no	CLNSGM
chr1_1886690_A_C_b38	SLC35E2	2.662	0.00826	0.061112	6	0.022961	no	CLNSGM
chr1_1993107_C_A_b38	SLC35E2	2.658	0.00835	0.043815	75	0.016485	no	CLNSGM
chr1_1882915_C_T_b38	SLC35E2	2.656	0.0084	0.061128	6	0.023019	no	CLNSGM
chr1_1703669_G_A_b38	SLC35E2	-2.655	0.00842	-0.078055	11	0.029403	no	CLNSGM
chr1_1986752_A_G_b38	SLC35E2	2.653	0.00846	0.046458	58	0.01751	no	CLNSGM
chr1_1746439_GA_G_b38	SLC35E2	2.647	0.00862	0.050968	49	0.019257	no	CLNSGM
chr1_1715135_T_C_b38	SLC35E2	2.646	0.00863	0.071364	14	0.026969	no	CLNSGM
chr1_1704310_C_A_b38	SLC35E2	2.641	0.00875	0.043248	69	0.016373	no	CLNSGM
chr1_1707486_C_T_b38	SLC35E2	-2.636	0.00889	-0.077468	10	0.029387	no	CLNSGM
chr1_1991116_A_G_b38	SLC35E2	2.634	0.00893	0.134304	3	0.050984	no	CLNSGM
chr1_1857246_T_TAA_b38	SLC35E2	2.632	0.00899	0.05923	6	0.022502	no	CLNSGM
chr1_1857250_C_G_b38	SLC35E2	2.632	0.00899	0.05923	6	0.022502	no	CLNSGM
chr1_1857305_G_GGGCT_b38	SLC35E2	2.632	0.00899	0.05923	6	0.022502	no	CLNSGM
chr1_1019397_C_A_b38	SLC35E2	-2.631	0.00903	-0.0437	83	0.016612	no	CLNSGM
chr1_1591703_T_C_b38	SLC35E2	2.625	0.00917	0.043228	69	0.016467	no	CLNSGM
chr1_1724489_G_C_b38	SLC35E2	2.624	0.00921	0.044764	81	0.017061	no	CLNSGM
chr1_1634406_C_G_b38	SLC35E2	-2.623	0.00924	-0.099615	3	0.037984	no	CLNSGM
chr1_1718593_A_C_b38	SLC35E2	2.607	0.00965	0.073367	13	0.028141	no	CLNSGM
chr1_1718594_T_C_b38	SLC35E2	2.607	0.00965	0.073367	13	0.028141	no	CLNSGM
chr1_1865177_G_A_b38	SLC35E2	-2.607	0.00966	-0.052267	15	0.02005	no	CLNSGM
chr1_1720192_T_G_b38	SLC35E2	2.602	0.0098	0.044193	85	0.016985	no	CLNSGM
chr1_1673818_A_C_b38	SLC35E2	7.857	7.25e-14	0.120923	82	0.015389	yes	CLNTRN
chr1_1671995_G_T_b38	SLC35E2	7.843	7.97e-14	0.118994	81	0.015172	yes	CLNTRN
chr1_1674720_TGC_T_b38	SLC35E2	7.767	1.32e-13	0.119521	81	0.015389	yes	CLNTRN
chr1_1674868_G_A_b38	SLC35E2	7.751	1.46e-13	0.11902	82	0.015356	yes	CLNTRN
chr1_1676790_C_T_b38	SLC35E2	7.744	1.52e-13	0.116216	83	0.015006	yes	CLNTRN
chr1_1677726_A_T_b38	SLC35E2	7.576	4.55e-13	0.116075	84	0.015321	yes	CLNTRN
chr1_1673060_G_A_b38	SLC35E2	7.518	6.6e-13	0.118679	79	0.015785	yes	CLNTRN
chr1_1677720_T_G_b38	SLC35E2	7.511	6.94e-13	0.115496	84	0.015378	yes	CLNTRN
chr1_1671797_G_A_b38	SLC35E2	7.217	4.46e-12	0.114125	77	0.015813	yes	CLNTRN
chr1_1648736_G_A_b38	SLC35E2	6.202	1.86e-09	0.102139	72	0.016468	yes	CLNTRN
chr1_1649932_C_T_b38	SLC35E2	6.091	3.47e-09	0.1015	69	0.016664	yes	CLNTRN
chr1_1636278_G_T_b38	SLC35E2	5.988	6.14e-09	0.099389	66	0.016599	yes	CLNTRN
chr1_1649976_G_A_b38	SLC35E2	5.984	6.26e-09	0.098194	65	0.01641	yes	CLNTRN
chr1_1708474_C_A_b38	SLC35E2	-5.879	1.11e-08	-0.121292	19	0.020631	yes	CLNTRN
chr1_1651653_C_T_b38	SLC35E2	5.873	1.15e-08	0.096736	81	0.016472	yes	CLNTRN
chr1_1708521_C_G_b38	SLC35E2	-5.343	1.82e-07	-0.102183	27	0.019124	yes	CLNTRN
chr1_1674633_C_CA_b38	SLC35E2	5.272	2.6e-07	0.094259	40	0.017879	yes	CLNTRN
chr1_1722625_A_T_b38	SLC35E2	5.271	2.62e-07	0.105665	39	0.020048	yes	CLNTRN
chr1_1722626_AGCG_A_b38	SLC35E2	5.271	2.62e-07	0.105665	39	0.020048	yes	CLNTRN
chr1_1637577_T_C_b38	SLC35E2	-4.952	1.23e-06	-0.094921	23	0.019168	yes	CLNTRN
chr1_1739131_T_C_b38	SLC35E2	4.911	1.5e-06	0.082397	73	0.016777	yes	CLNTRN
chr1_1722619_C_T_b38	SLC35E2	4.877	1.76e-06	0.097909	41	0.020077	yes	CLNTRN
chr1_1654662_CT_C_b38	SLC35E2	4.681	4.35e-06	0.088655	52	0.018939	yes	CLNTRN
chr1_1722690_TA_T_b38	SLC35E2	-4.654	4.92e-06	-0.123884	4	0.026621	yes	CLNTRN
chr1_1658830_C_G_b38	SLC35E2	-4.59	6.54e-06	-0.090023	22	0.019611	yes	CLNTRN
chr1_1649846_G_A_b38	SLC35E2	-4.427	1.34e-05	-0.089494	18	0.020214	yes	CLNTRN
chr1_1639348_G_T_b38	SLC35E2	-4.399	1.52e-05	-0.076995	41	0.017503	yes	CLNTRN
chr1_1649993_A_G_b38	SLC35E2	-4.397	1.53e-05	-0.073193	86	0.016645	yes	CLNTRN
chr1_1742587_G_C_b38	SLC35E2	4.391	1.57e-05	0.076339	74	0.017384	yes	CLNTRN
chr1_1744121_A_C_b38	SLC35E2	-4.382	1.63e-05	-0.11294	36	0.025773	yes	CLNTRN
chr1_1667948_A_G_b38	SLC35E2	-4.365	1.76e-05	-0.08899	20	0.020387	yes	CLNTRN
chr1_1589495_CTTT_C_b38	SLC35E2	4.325	2.09e-05	0.083583	29	0.019327	yes	CLNTRN
chr1_1667424_T_TAAAATA_b38	SLC35E2	4.311	2.21e-05	0.078	46	0.018092	yes	CLNTRN
chr1_1665061_C_T_b38	SLC35E2	-4.304	2.28e-05	-0.08901	19	0.020682	yes	CLNTRN
chr1_1668721_C_T_b38	SLC35E2	-4.301	2.31e-05	-0.081264	28	0.018895	yes	CLNTRN
chr1_1661177_A_G_b38	SLC35E2	-4.279	2.54e-05	-0.087403	20	0.020426	yes	CLNTRN
chr1_1641261_C_T_b38	SLC35E2	-4.221	3.23e-05	-0.088058	18	0.020861	yes	CLNTRN
chr1_1650777_G_A_b38	SLC35E2	-4.208	3.42e-05	-0.077477	32	0.018413	yes	CLNTRN
chr1_1668108_C_T_b38	SLC35E2	4.197	3.58e-05	0.077383	33	0.018438	yes	CLNTRN
chr1_1650195_A_G_b38	SLC35E2	-4.192	3.66e-05	-0.078327	33	0.018686	yes	CLNTRN
chr1_1668542_C_T_b38	SLC35E2	-4.183	3.8e-05	-0.087537	16	0.020929	yes	CLNTRN
chr1_1675228_C_CG_b38	SLC35E2	4.178	3.86e-05	0.07416	53	0.017748	yes	CLNTRN
chr1_1650664_CT_C_b38	SLC35E2	4.177	3.89e-05	0.082761	34	0.019814	yes	CLNTRN
chr1_1675132_A_G_b38	SLC35E2	4.166	4.07e-05	0.075439	46	0.018107	yes	CLNTRN
chr1_1670423_AT_A_b38	SLC35E2	4.155	4.27e-05	0.085164	40	0.020499	yes	CLNTRN
chr1_1688328_C_T_b38	SLC35E2	-4.109	5.15e-05	-0.080422	22	0.019573	yes	CLNTRN
chr1_1743714_C_CA_b38	SLC35E2	4.107	5.18e-05	0.077032	45	0.018756	yes	CLNTRN
chr1_1728671_C_A_b38	SLC35E2	4.082	5.74e-05	0.087884	21	0.021529	yes	CLNTRN
chr1_1743840_T_C_b38	SLC35E2	-4.075	5.91e-05	-0.085768	27	0.021048	yes	CLNTRN
chr1_1744052_GAGA_G_b38	SLC35E2	-4.071	6.01e-05	-0.091274	20	0.022421	yes	CLNTRN
chr1_1651137_C_T_b38	SLC35E2	-4.07	6.03e-05	-0.075151	32	0.018464	yes	CLNTRN
chr1_1651267_T_C_b38	SLC35E2	-4.07	6.03e-05	-0.075151	32	0.018464	yes	CLNTRN
chr1_1651421_GTAGCCCCTCTGAACGGTCTGTGACACACGCATGCTTTCAGCTAGAGTACTCTA_G_b38	SLC35E2	-4.07	6.03e-05	-0.075151	32	0.018464	yes	CLNTRN
chr1_1651785_C_A_b38	SLC35E2	-4.07	6.03e-05	-0.075151	32	0.018464	yes	CLNTRN
chr1_1652135_C_G_b38	SLC35E2	-4.07	6.03e-05	-0.075151	32	0.018464	yes	CLNTRN
chr1_1652191_C_T_b38	SLC35E2	-4.07	6.03e-05	-0.075151	32	0.018464	yes	CLNTRN
chr1_1652592_A_G_b38	SLC35E2	-4.07	6.03e-05	-0.075151	32	0.018464	yes	CLNTRN
chr1_1652779_A_G_b38	SLC35E2	-4.07	6.03e-05	-0.075151	32	0.018464	yes	CLNTRN
chr1_1653147_A_C_b38	SLC35E2	-4.07	6.03e-05	-0.075151	32	0.018464	yes	CLNTRN
chr1_1653396_T_C_b38	SLC35E2	-4.07	6.03e-05	-0.075151	32	0.018464	yes	CLNTRN
chr1_1653472_T_C_b38	SLC35E2	-4.07	6.03e-05	-0.075151	32	0.018464	yes	CLNTRN
chr1_1653811_G_A_b38	SLC35E2	-4.07	6.03e-05	-0.075151	32	0.018464	yes	CLNTRN
chr1_1653893_C_T_b38	SLC35E2	-4.07	6.03e-05	-0.075151	32	0.018464	yes	CLNTRN
chr1_1654143_G_A_b38	SLC35E2	-4.07	6.03e-05	-0.075151	32	0.018464	yes	CLNTRN
chr1_1676287_C_T_b38	SLC35E2	-4.062	6.22e-05	-0.086143	13	0.021205	yes	CLNTRN
chr1_1651574_G_A_b38	SLC35E2	-4.036	6.93e-05	-0.074679	32	0.018505	yes	CLNTRN
chr1_1729859_A_G_b38	SLC35E2	4.029	7.12e-05	0.083986	18	0.020845	yes	CLNTRN
chr1_1650688_T_A_b38	SLC35E2	-4.021	7.36e-05	-0.076122	29	0.018932	yes	CLNTRN
chr1_1653934_G_A_b38	SLC35E2	-4	7.99e-05	-0.073908	32	0.018476	yes	CLNTRN
chr1_1749637_G_T_b38	SLC35E2	3.996	8.13e-05	0.070563	54	0.017659	yes	CLNTRN
chr1_1612562_T_TC_b38	SLC35E2	3.983	8.56e-05	0.071095	38	0.017849	yes	CLNTRN
chr1_1717507_T_C_b38	SLC35E2	3.98	8.67e-05	0.095787	19	0.024067	yes	CLNTRN
chr1_1726053_G_C_b38	SLC35E2	3.98	8.67e-05	0.095746	15	0.024057	yes	CLNTRN
chr1_1750226_C_T_b38	SLC35E2	3.978	8.75e-05	0.074324	53	0.018685	yes	CLNTRN
chr1_1667424_T_TAAATA_b38	SLC35E2	-3.966	9.18e-05	-0.069927	58	0.017634	yes	CLNTRN
chr1_1652913_C_T_b38	SLC35E2	-3.96	9.4e-05	-0.07518	29	0.018986	yes	CLNTRN
chr1_1651926_T_C_b38	SLC35E2	-3.946	9.91e-05	-0.073209	32	0.018551	yes	CLNTRN
chr1_1586962_C_T_b38	SLC35E2	3.945	9.98e-05	0.069898	45	0.01772	yes	CLNTRN
chr1_1743851_C_T_b38	SLC35E2	-3.923	0.000108	-0.082868	26	0.021121	yes	CLNTRN
chr1_1652061_T_C_b38	SLC35E2	-3.923	0.000109	-0.072113	33	0.018381	yes	CLNTRN
chr1_1654188_T_G_b38	SLC35E2	-3.923	0.000109	-0.072113	33	0.018381	yes	CLNTRN
chr1_1744854_C_A_b38	SLC35E2	-3.895	0.000121	-0.065191	53	0.016735	yes	CLNTRN
chr1_1744028_A_AC_b38	SLC35E2	-3.895	0.000122	-0.088376	19	0.022693	yes	CLNTRN
chr1_1664757_T_C_b38	SLC35E2	-3.887	0.000125	-0.071809	32	0.018473	yes	CLNTRN
chr1_1648826_A_G_b38	SLC35E2	-3.881	0.000128	-0.071392	39	0.018394	yes	CLNTRN
chr1_1755504_T_C_b38	SLC35E2	3.874	0.000132	0.065985	75	0.017033	yes	CLNTRN
chr1_1744096_C_T_b38	SLC35E2	-3.87	0.000134	-0.096662	39	0.024979	yes	CLNTRN
chr1_1744652_C_T_b38	SLC35E2	-3.868	0.000135	-0.069636	70	0.018001	yes	CLNTRN
chr1_1744499_C_T_b38	SLC35E2	-3.861	0.000138	-0.067082	73	0.017373	yes	CLNTRN
chr1_1660683_C_T_b38	SLC35E2	-3.849	0.000146	-0.075671	24	0.019663	yes	CLNTRN
chr1_1661420_C_A_b38	SLC35E2	-3.836	0.000153	-0.069825	36	0.018203	yes	CLNTRN
chr1_1671148_C_T_b38	SLC35E2	3.825	0.000159	0.069146	37	0.018077	yes	CLNTRN
chr1_1659060_G_A_b38	SLC35E2	-3.805	0.000172	-0.071316	32	0.018741	yes	CLNTRN
chr1_1752126_G_A_b38	SLC35E2	3.799	0.000176	0.075155	34	0.019781	yes	CLNTRN
chr1_1658866_G_A_b38	SLC35E2	-3.793	0.00018	-0.069158	36	0.018233	yes	CLNTRN
chr1_1659114_A_G_b38	SLC35E2	-3.793	0.00018	-0.069158	36	0.018233	yes	CLNTRN
chr1_1659220_A_G_b38	SLC35E2	-3.793	0.00018	-0.069158	36	0.018233	yes	CLNTRN
chr1_1692151_T_C_b38	SLC35E2	-3.786	0.000185	-0.077898	31	0.020575	yes	CLNTRN
chr1_1665581_C_G_b38	SLC35E2	-3.773	0.000194	-0.075454	23	0.019997	yes	CLNTRN
chr1_1730405_G_C_b38	SLC35E2	3.76	0.000204	0.074058	43	0.019695	yes	CLNTRN
chr1_1650664_CTTTTT_C_b38	SLC35E2	-3.758	0.000206	-0.076883	19	0.020457	yes	CLNTRN
chr1_1672155_G_A_b38	SLC35E2	-3.731	0.000229	-0.070236	31	0.018827	yes	CLNTRN
chr1_1755523_C_T_b38	SLC35E2	3.665	0.000293	0.063573	80	0.017348	yes	CLNTRN
chr1_1764023_C_A_b38	SLC35E2	3.656	0.000303	0.066868	53	0.018291	yes	CLNTRN
chr1_1648636_G_A_b38	SLC35E2	-3.601	0.000371	-0.067064	39	0.018623	yes	CLNTRN
chr1_1607931_G_A_b38	SLC35E2	3.592	0.000384	0.064876	37	0.018062	yes	CLNTRN
chr1_1609058_G_A_b38	SLC35E2	3.592	0.000384	0.064876	37	0.018062	yes	CLNTRN
chr1_1671097_G_C_b38	SLC35E2	3.549	0.000449	0.065618	36	0.018489	yes	CLNTRN
chr1_1679100_A_G_b38	SLC35E2	-3.517	0.000504	-0.057592	76	0.016375	yes	CLNTRN
chr1_1757725_C_T_b38	SLC35E2	3.516	0.000506	0.066516	49	0.018916	yes	CLNTRN
chr1_1743886_C_T_b38	SLC35E2	-3.51	0.000517	-0.073104	32	0.020826	yes	CLNTRN
chr1_1743238_G_C_b38	SLC35E2	-3.498	0.00054	-0.065678	60	0.018775	yes	CLNTRN
chr1_2282423_CGAGAAGACAGGCGGTGGCGGAGATCTTCAGAGAGAGGACGCCT_C_b38	SLC35E2	-3.49	0.000556	-0.149282	3	0.042771	yes	CLNTRN
chr1_1664865_A_G_b38	SLC35E2	-3.429	0.000693	-0.063669	33	0.018571	yes	CLNTRN
chr1_1722599_G_A_b38	SLC35E2	3.428	0.000695	0.065866	52	0.019216	yes	CLNTRN
chr1_1591703_T_C_b38	SLC35E2	3.419	0.000716	0.060056	66	0.017564	yes	CLNTRN
chr1_1606507_GTGGGC_G_b38	SLC35E2	3.413	0.000732	0.055693	95	0.016318	yes	CLNTRN
chr1_1714797_C_T_b38	SLC35E2	3.398	0.000772	0.083032	21	0.024436	yes	CLNTRN
chr1_1742672_C_T_b38	SLC35E2	-3.394	0.000781	-0.063611	61	0.01874	yes	CLNTRN
chr1_1715011_G_A_b38	SLC35E2	3.386	0.000805	0.08762	18	0.025878	yes	CLNTRN
chr1_1760882_T_C_b38	SLC35E2	3.385	0.000808	0.058641	64	0.017325	yes	CLNTRN
chr1_1757074_G_T_b38	SLC35E2	3.353	0.000903	0.061805	50	0.018432	yes	CLNTRN
chr1_1714988_T_G_b38	SLC35E2	3.331	0.000976	0.086641	18	0.026014	yes	CLNTRN
chr1_1027633_C_T_b38	SLC35E2	-3.327	0.000987	-0.058556	59	0.017598	yes	CLNTRN
chr1_1754601_G_T_b38	SLC35E2	3.322	0.00101	0.062757	49	0.018891	yes	CLNTRN
chr1_1702383_T_C_b38	SLC35E2	-3.32	0.00101	-0.06756	19	0.020348	yes	CLNTRN
chr1_1720288_G_A_b38	SLC35E2	3.318	0.00102	0.087784	33	0.026457	yes	CLNTRN
chr1_1716710_G_T_b38	SLC35E2	-3.275	0.00118	-0.180388	3	0.055088	yes	CLNTRN
chr1_1650383_G_T_b38	SLC35E2	-3.263	0.00123	-0.0637	28	0.019519	yes	CLNTRN
chr1_1714674_G_C_b38	SLC35E2	3.261	0.00124	0.075028	35	0.023008	yes	CLNTRN
chr1_1756186_T_C_b38	SLC35E2	3.261	0.00124	0.060557	50	0.01857	yes	CLNTRN
chr1_1716210_C_CT_b38	SLC35E2	3.256	0.00126	0.086579	33	0.026592	yes	CLNTRN
chr1_1731093_G_C_b38	SLC35E2	-3.212	0.00146	-0.1385	4	0.043114	yes	CLNTRN
chr1_1735087_A_C_b38	SLC35E2	-3.212	0.00146	-0.1385	4	0.043114	yes	CLNTRN
chr1_1735286_G_A_b38	SLC35E2	-3.212	0.00146	-0.1385	4	0.043114	yes	CLNTRN
chr1_1731904_CA_C_b38	SLC35E2	3.209	0.00148	0.064331	26	0.020044	yes	CLNTRN
chr1_1719638_C_CTCGCTCTGTCACCCAGGCT_b38	SLC35E2	3.195	0.00155	0.075569	23	0.02365	yes	CLNTRN
chr1_1736832_GA_G_b38	SLC35E2	-3.183	0.00161	-0.155604	3	0.048893	yes	CLNTRN
chr1_1753033_C_T_b38	SLC35E2	-3.172	0.00167	-0.060066	82	0.018934	yes	CLNTRN
chr1_1715553_G_A_b38	SLC35E2	3.163	0.00172	0.081899	33	0.02589	yes	CLNTRN
chr1_1684789_C_CAAAAA_b38	SLC35E2	-3.159	0.00174	-0.109419	9	0.034635	yes	CLNTRN
chr1_1641275_A_G_b38	SLC35E2	-3.157	0.00176	-0.058696	39	0.018593	yes	CLNTRN
chr1_1721197_CA_C_b38	SLC35E2	3.153	0.00178	0.080643	18	0.025575	yes	CLNTRN
chr1_2329738_C_T_b38	SLC35E2	-3.144	0.00183	-0.077065	17	0.024509	yes	CLNTRN
chr1_1743544_CA_C_b38	SLC35E2	3.144	0.00184	0.054065	69	0.017197	yes	CLNTRN
chr1_1743565_AT_A_b38	SLC35E2	3.143	0.00184	0.051222	78	0.016295	yes	CLNTRN
chr1_1718040_T_TAG_b38	SLC35E2	3.14	0.00186	0.081116	20	0.02583	yes	CLNTRN
chr1_2056364_G_A_b38	SLC35E2	-3.137	0.00188	-0.06318	49	0.020143	yes	CLNTRN
chr1_1717067_A_AT_b38	SLC35E2	3.124	0.00196	0.079536	20	0.025459	yes	CLNTRN
chr1_1657085_C_CTAA_b38	SLC35E2	-3.12	0.00198	-0.066075	27	0.021176	yes	CLNTRN
chr1_1732685_T_C_b38	SLC35E2	3.12	0.00199	0.077774	36	0.024927	yes	CLNTRN
chr1_1734899_G_A_b38	SLC35E2	3.12	0.00199	0.077774	36	0.024927	yes	CLNTRN
chr1_1740869_C_T_b38	SLC35E2	-3.117	0.002	-0.13531	4	0.043405	yes	CLNTRN
chr1_1741174_TTCA_T_b38	SLC35E2	-3.117	0.002	-0.13531	4	0.043405	yes	CLNTRN
chr1_1741497_G_A_b38	SLC35E2	-3.117	0.002	-0.13531	4	0.043405	yes	CLNTRN
chr1_2264013_TA_T_b38	SLC35E2	3.116	0.00202	0.056297	73	0.01807	yes	CLNTRN
chr1_2274109_A_C_b38	SLC35E2	3.1	0.00212	0.053892	71	0.017383	yes	CLNTRN
chr1_1595306_CAG_C_b38	SLC35E2	-3.085	0.00222	-0.058484	80	0.018955	yes	CLNTRN
chr1_1718663_C_T_b38	SLC35E2	3.08	0.00226	0.072612	26	0.023573	yes	CLNTRN
chr1_1692286_C_A_b38	SLC35E2	3.068	0.00235	0.079044	3	0.025761	yes	CLNTRN
chr1_1630798_C_T_b38	SLC35E2	3.048	0.00251	0.054856	42	0.017999	yes	CLNTRN
chr1_1715218_T_C_b38	SLC35E2	3.045	0.00253	0.076698	22	0.025185	yes	CLNTRN
chr1_1726649_G_A_b38	SLC35E2	-3.045	0.00253	-0.129251	5	0.042443	yes	CLNTRN
chr1_1720523_G_A_b38	SLC35E2	3.043	0.00255	0.080648	17	0.026501	yes	CLNTRN
chr1_1657081_C_T_b38	SLC35E2	-3.033	0.00263	-0.063459	27	0.02092	yes	CLNTRN
chr1_1743565_ATAT_A_b38	SLC35E2	-3.032	0.00265	-0.051206	63	0.01689	yes	CLNTRN
chr1_1692124_T_G_b38	SLC35E2	-3.028	0.00268	-0.061162	29	0.0202	yes	CLNTRN
chr1_1715860_C_T_b38	SLC35E2	3.027	0.00268	0.07974	18	0.02634	yes	CLNTRN
chr1_1715862_G_A_b38	SLC35E2	3.027	0.00268	0.07974	18	0.02634	yes	CLNTRN
chr1_1716085_C_T_b38	SLC35E2	3.027	0.00268	0.07974	18	0.02634	yes	CLNTRN
chr1_1716089_G_C_b38	SLC35E2	3.027	0.00268	0.07974	18	0.02634	yes	CLNTRN
chr1_1717185_C_A_b38	SLC35E2	3.027	0.00268	0.07974	18	0.02634	yes	CLNTRN
chr1_1718761_A_C_b38	SLC35E2	3.027	0.00268	0.07974	18	0.02634	yes	CLNTRN
chr1_1718824_G_T_b38	SLC35E2	3.027	0.00268	0.07974	18	0.02634	yes	CLNTRN
chr1_1718971_T_C_b38	SLC35E2	3.027	0.00268	0.07974	18	0.02634	yes	CLNTRN
chr1_1719368_T_C_b38	SLC35E2	3.027	0.00268	0.07974	18	0.02634	yes	CLNTRN
chr1_1719406_G_A_b38	SLC35E2	3.027	0.00268	0.07974	18	0.02634	yes	CLNTRN
chr1_1720183_C_T_b38	SLC35E2	3.027	0.00268	0.07974	18	0.02634	yes	CLNTRN
chr1_1720376_T_C_b38	SLC35E2	3.027	0.00268	0.07974	18	0.02634	yes	CLNTRN
chr1_1720472_C_A_b38	SLC35E2	3.027	0.00268	0.07974	18	0.02634	yes	CLNTRN
chr1_1720498_G_A_b38	SLC35E2	3.027	0.00268	0.07974	18	0.02634	yes	CLNTRN
chr1_1720696_C_CTTA_b38	SLC35E2	3.027	0.00268	0.07974	18	0.02634	yes	CLNTRN
chr1_1720787_A_G_b38	SLC35E2	3.027	0.00268	0.07974	18	0.02634	yes	CLNTRN
chr1_1721565_T_C_b38	SLC35E2	3.027	0.00268	0.07974	18	0.02634	yes	CLNTRN
chr1_1721589_C_T_b38	SLC35E2	3.027	0.00268	0.07974	18	0.02634	yes	CLNTRN
chr1_1721864_T_C_b38	SLC35E2	3.027	0.00268	0.07974	18	0.02634	yes	CLNTRN
chr1_1721893_GT_G_b38	SLC35E2	3.027	0.00268	0.07974	18	0.02634	yes	CLNTRN
chr1_1721922_C_T_b38	SLC35E2	3.027	0.00268	0.07974	18	0.02634	yes	CLNTRN
chr1_1721975_C_T_b38	SLC35E2	3.027	0.00268	0.07974	18	0.02634	yes	CLNTRN
chr1_1026830_A_G_b38	SLC35E2	3.018	0.00277	0.053578	44	0.017755	yes	CLNTRN
chr1_1718593_A_C_b38	SLC35E2	3.018	0.00277	0.078241	19	0.025928	yes	CLNTRN
chr1_1718594_T_C_b38	SLC35E2	3.018	0.00277	0.078241	19	0.025928	yes	CLNTRN
chr1_1688586_C_T_b38	SLC35E2	-3.017	0.00277	-0.068011	22	0.02254	yes	CLNTRN
chr1_1718200_G_A_b38	SLC35E2	3.012	0.00282	0.076615	20	0.02544	yes	CLNTRN
chr1_1743586_T_TAC_b38	SLC35E2	-2.999	0.00294	-0.05871	46	0.019575	yes	CLNTRN
chr1_1677707_C_T_b38	SLC35E2	-2.999	0.00294	-0.076948	9	0.02566	yes	CLNTRN
chr1_1734308_T_C_b38	SLC35E2	2.995	0.00297	0.073675	16	0.024599	yes	CLNTRN
chr1_1739115_T_C_b38	SLC35E2	-2.994	0.00298	-0.126625	6	0.042287	yes	CLNTRN
chr1_1948594_G_GTTT_b38	SLC35E2	-2.991	0.00302	-0.12353	5	0.041304	yes	CLNTRN
chr1_1720309_G_C_b38	SLC35E2	2.977	0.00315	0.077809	18	0.026135	yes	CLNTRN
chr1_1707486_C_T_b38	SLC35E2	-2.971	0.00321	-0.08385	16	0.028226	yes	CLNTRN
chr1_1716247_A_C_b38	SLC35E2	2.97	0.00322	0.077256	18	0.026014	yes	CLNTRN
chr1_1751981_A_T_b38	SLC35E2	-2.943	0.00351	-0.060108	36	0.020424	yes	CLNTRN
chr1_1081790_C_G_b38	SLC35E2	-2.933	0.00362	-0.047796	84	0.016295	yes	CLNTRN
chr1_1706898_T_C_b38	SLC35E2	-2.926	0.0037	-0.082682	16	0.028257	yes	CLNTRN
chr1_2270709_G_A_b38	SLC35E2	-2.921	0.00375	-0.060397	20	0.020674	yes	CLNTRN
chr1_1736801_CA_C_b38	SLC35E2	2.914	0.00384	0.062918	37	0.021594	yes	CLNTRN
chr1_1742119_C_CA_b38	SLC35E2	-2.907	0.00393	-0.126318	4	0.043455	yes	CLNTRN
chr1_1706927_A_G_b38	SLC35E2	-2.893	0.0041	-0.080265	17	0.027745	yes	CLNTRN
chr1_2271718_T_TG_b38	SLC35E2	2.892	0.00412	0.056978	32	0.019705	yes	CLNTRN
chr1_1703572_A_G_b38	SLC35E2	-2.876	0.00432	-0.079401	32	0.027611	yes	CLNTRN
chr1_1708855_TTCCTCCTCC_T_b38	SLC35E2	2.865	0.00447	0.052888	59	0.018461	yes	CLNTRN
chr1_1749826_A_G_b38	SLC35E2	-2.85	0.00468	-0.050544	92	0.017734	yes	CLNTRN
chr1_1750428_G_C_b38	SLC35E2	-2.843	0.00478	-0.057793	53	0.020331	yes	CLNTRN
chr1_1904424_A_AAAATAAATAAAT_b38	SLC35E2	2.841	0.00481	0.047441	55	0.016698	yes	CLNTRN
chr1_2268951_C_A_b38	SLC35E2	2.84	0.00482	0.049938	56	0.017581	yes	CLNTRN
chr1_1725582_T_C_b38	SLC35E2	2.836	0.00488	0.042914	89	0.015132	yes	CLNTRN
chr1_1688647_G_A_b38	SLC35E2	-2.828	0.005	-0.059599	30	0.021073	yes	CLNTRN
chr1_1931743_CA_C_b38	SLC35E2	-2.815	0.0052	-0.059172	33	0.02102	yes	CLNTRN
chr1_1671724_C_T_b38	SLC35E2	-2.815	0.0052	-0.055569	26	0.019741	yes	CLNTRN
chr1_1936906_C_CA_b38	SLC35E2	-2.813	0.00523	-0.056357	48	0.020032	yes	CLNTRN
chr1_1725697_T_C_b38	SLC35E2	2.809	0.0053	0.056878	38	0.020249	yes	CLNTRN
chr1_1720462_T_C_b38	SLC35E2	2.804	0.00537	0.074849	9	0.026689	yes	CLNTRN
chr1_1945842_A_AAAAGAAC_b38	SLC35E2	-2.801	0.00542	-0.055337	58	0.019753	yes	CLNTRN
chr1_1714635_A_G_b38	SLC35E2	2.798	0.00547	0.065356	13	0.023356	yes	CLNTRN
chr1_1714638_G_T_b38	SLC35E2	2.798	0.00547	0.065356	13	0.023356	yes	CLNTRN
chr1_1773676_TTGTGTG_T_b38	SLC35E2	2.788	0.00564	0.07232	5	0.025937	yes	CLNTRN
chr1_1703669_G_A_b38	SLC35E2	-2.772	0.00593	-0.078626	17	0.028365	yes	CLNTRN
chr1_1779667_T_TTG_b38	SLC35E2	2.771	0.00595	0.054492	40	0.019668	yes	CLNTRN
chr1_1940973_C_T_b38	SLC35E2	-2.766	0.00602	-0.049544	75	0.01791	yes	CLNTRN
chr1_2249085_G_A_b38	SLC35E2	2.76	0.00614	0.048705	56	0.017648	yes	CLNTRN
chr1_1715135_T_C_b38	SLC35E2	2.758	0.00618	0.069176	23	0.025082	yes	CLNTRN
chr1_1034835_G_C_b38	SLC35E2	-2.757	0.00619	-0.047948	80	0.017389	yes	CLNTRN
chr1_1688619_AAAC_A_b38	SLC35E2	-2.755	0.00624	-0.058856	27	0.021365	yes	CLNTRN
chr1_1657093_C_A_b38	SLC35E2	-2.754	0.00625	-0.057497	28	0.020879	yes	CLNTRN
chr1_1703583_A_G_b38	SLC35E2	-2.754	0.00626	-0.076374	34	0.027735	yes	CLNTRN
chr1_1086657_C_T_b38	SLC35E2	-2.746	0.00639	-0.045151	79	0.01644	yes	CLNTRN
chr1_1737789_T_C_b38	SLC35E2	2.744	0.00644	0.0681	10	0.02482	yes	CLNTRN
chr1_2450586_C_A_b38	SLC35E2	2.742	0.00648	0.13607	4	0.049627	yes	CLNTRN
chr1_1926870_T_C_b38	SLC35E2	-2.738	0.00656	-0.049033	65	0.01791	yes	CLNTRN
chr1_1937273_T_C_b38	SLC35E2	-2.733	0.00665	-0.048989	69	0.017925	yes	CLNTRN
chr1_1688786_G_A_b38	SLC35E2	-2.73	0.0067	-0.063985	16	0.023435	yes	CLNTRN
chr1_2231034_C_T_b38	SLC35E2	-2.729	0.00674	-0.070672	7	0.025899	yes	CLNTRN
chr1_2252962_T_G_b38	SLC35E2	2.725	0.00682	0.046465	83	0.017054	yes	CLNTRN
chr1_1751442_C_T_b38	SLC35E2	2.721	0.00688	0.067693	3	0.024874	yes	CLNTRN
chr1_1649954_C_CA_b38	SLC35E2	-2.719	0.00693	-0.059208	16	0.021775	yes	CLNTRN
chr1_971790_AG_A_b38	SLC35E2	2.718	0.00695	0.045228	60	0.016641	yes	CLNTRN
chr1_1748780_G_A_b38	SLC35E2	-2.717	0.00697	-0.050674	89	0.01865	yes	CLNTRN
chr1_1027511_C_T_b38	SLC35E2	-2.709	0.00715	-0.045801	76	0.016908	yes	CLNTRN
chr1_1936077_C_T_b38	SLC35E2	-2.697	0.00739	-0.048283	75	0.017901	yes	CLNTRN
chr1_2235168_G_GT_b38	SLC35E2	2.695	0.00744	0.046237	81	0.017157	yes	CLNTRN
chr1_2263866_C_CA_b38	SLC35E2	-2.691	0.00753	-0.057822	18	0.021488	yes	CLNTRN
chr1_1713469_C_T_b38	SLC35E2	2.683	0.00771	0.062916	29	0.023451	yes	CLNTRN
chr1_1081817_C_T_b38	SLC35E2	-2.682	0.00772	-0.044615	95	0.016633	yes	CLNTRN
chr1_1688531_T_C_b38	SLC35E2	-2.681	0.00774	-0.062487	18	0.023304	yes	CLNTRN
chr1_1916417_G_T_b38	SLC35E2	-2.681	0.00776	-0.049339	70	0.018406	yes	CLNTRN
chr1_1716769_C_T_b38	SLC35E2	2.679	0.0078	0.071888	18	0.026836	yes	CLNTRN
chr1_2274088_A_G_b38	SLC35E2	2.673	0.00794	0.047108	68	0.017625	yes	CLNTRN
chr1_1703754_T_C_b38	SLC35E2	-2.67	0.008	-0.075597	18	0.028313	yes	CLNTRN
chr1_1704126_C_T_b38	SLC35E2	-2.67	0.008	-0.075597	18	0.028313	yes	CLNTRN
chr1_1715546_C_T_b38	SLC35E2	2.668	0.00805	0.066992	21	0.025108	yes	CLNTRN
chr1_1716588_T_C_b38	SLC35E2	2.665	0.00812	0.070129	12	0.026314	yes	CLNTRN
chr1_2261509_T_C_b38	SLC35E2	2.664	0.00815	0.051521	34	0.019341	yes	CLNTRN
chr1_1096160_A_G_b38	SLC35E2	-2.663	0.00817	-0.053853	22	0.020224	yes	CLNTRN
chr1_2261200_G_C_b38	SLC35E2	2.663	0.00817	0.045204	83	0.016977	yes	CLNTRN
chr1_2244599_C_T_b38	SLC35E2	2.656	0.00834	0.047011	53	0.017701	yes	CLNTRN
chr1_1708001_A_T_b38	SLC35E2	-2.649	0.00851	-0.084812	10	0.032021	yes	CLNTRN
chr1_1718313_T_G_b38	SLC35E2	2.646	0.00858	0.057548	18	0.021749	yes	CLNTRN
chr1_1124975_G_C_b38	SLC35E2	2.646	0.00859	0.046175	54	0.017454	yes	CLNTRN
chr1_1922670_A_G_b38	SLC35E2	-2.643	0.00864	-0.048048	68	0.018177	yes	CLNTRN
chr1_1928648_C_T_b38	SLC35E2	-2.643	0.00864	-0.048048	68	0.018177	yes	CLNTRN
chr1_1706210_G_A_b38	SLC35E2	-2.642	0.00868	-0.07521	16	0.028467	yes	CLNTRN
chr1_1706488_C_G_b38	SLC35E2	-2.642	0.00868	-0.07521	16	0.028467	yes	CLNTRN
chr1_1706141_C_T_b38	SLC35E2	-2.641	0.00871	-0.074488	17	0.028209	yes	CLNTRN
chr1_1052514_C_CGT_b38	SLC35E2	-2.639	0.00876	-0.044865	79	0.017002	yes	CLNTRN
chr1_1715350_T_C_b38	SLC35E2	2.638	0.00878	0.068162	17	0.025839	yes	CLNTRN
chr1_1688442_T_C_b38	SLC35E2	-2.636	0.00882	-0.056786	31	0.02154	yes	CLNTRN
chr1_1704673_G_A_b38	SLC35E2	-2.629	0.00901	-0.074476	16	0.028329	yes	CLNTRN
chr1_1869185_C_CA_b38	SLC35E2	2.628	0.00903	0.076562	11	0.029132	yes	CLNTRN
chr1_1728274_G_C_b38	SLC35E2	-2.626	0.00909	-0.119658	3	0.045568	yes	CLNTRN
chr1_1976566_T_C_b38	SLC35E2	2.625	0.00911	0.048062	69	0.01831	yes	CLNTRN
chr1_2252606_GC_G_b38	SLC35E2	2.624	0.00913	0.044379	83	0.016911	yes	CLNTRN
chr1_2253720_G_A_b38	SLC35E2	2.624	0.00913	0.044379	83	0.016911	yes	CLNTRN
chr1_2255546_G_A_b38	SLC35E2	2.624	0.00913	0.044379	83	0.016911	yes	CLNTRN
chr1_1032846_C_A_b38	SLC35E2	2.622	0.00918	0.047789	35	0.018224	yes	CLNTRN
chr1_2106511_C_CT_b38	SLC35E2	-2.616	0.00934	-0.113244	3	0.043281	yes	CLNTRN
chr1_2251031_G_A_b38	SLC35E2	2.613	0.00943	0.044553	82	0.017049	yes	CLNTRN
chr1_1704504_A_C_b38	SLC35E2	-2.608	0.00958	-0.073264	18	0.028096	yes	CLNTRN
chr1_1707714_C_G_b38	SLC35E2	-2.6	0.00978	-0.079202	12	0.03046	yes	CLNTRN
chr1_1707716_T_C_b38	SLC35E2	-2.6	0.00978	-0.079202	12	0.03046	yes	CLNTRN
chr1_2247560_C_T_b38	SLC35E2	2.598	0.00985	0.050256	34	0.019345	yes	CLNTRN
chr1_2257757_A_T_b38	SLC35E2	2.598	0.00985	0.050256	34	0.019345	yes	CLNTRN
chr1_2258038_T_C_b38	SLC35E2	2.598	0.00985	0.050256	34	0.019345	yes	CLNTRN
chr1_2268965_C_T_b38	SLC35E2	2.598	0.00985	0.050256	34	0.019345	yes	CLNTRN
chr1_1718301_C_T_b38	SLC35E2	2.596	0.00991	0.056416	18	0.021734	yes	CLNTRN
chr1_1940540_G_A_b38	SLC35E2	-2.593	0.00998	-0.046747	73	0.018026	yes	CLNTRN
chr1_1942260_G_C_b38	SLC35E2	-2.593	0.00998	-0.046747	73	0.018026	yes	CLNTRN
chr1_1673968_GA_G_b38	SLC35E2	6.099	3.32e-09	0.115997	35	0.019019	no	CLNTRN
chr1_1661562_G_C_b38	SLC35E2	5.175	4.2e-07	0.078374	83	0.015144	no	CLNTRN
chr1_1646352_A_C_b38	SLC35E2	4.919	1.45e-06	0.119028	6	0.0242	no	CLNTRN
chr1_1675091_A_G_b38	SLC35E2	-4.63	5.47e-06	-0.091352	22	0.01973	no	CLNTRN
chr1_1639685_G_A_b38	SLC35E2	-4.47	1.12e-05	-0.090301	19	0.020203	no	CLNTRN
chr1_1613769_C_T_b38	SLC35E2	4.374	1.69e-05	0.082425	34	0.018843	no	CLNTRN
chr1_1668717_C_G_b38	SLC35E2	-4.343	1.93e-05	-0.088744	20	0.020435	no	CLNTRN
chr1_1669613_G_A_b38	SLC35E2	-4.343	1.93e-05	-0.088744	20	0.020435	no	CLNTRN
chr1_1970506_T_A_b38	SLC35E2	-4.296	2.36e-05	-0.076904	53	0.017901	no	CLNTRN
chr1_1669576_G_A_b38	SLC35E2	-4.218	3.28e-05	-0.087738	19	0.020802	no	CLNTRN
chr1_1650000_G_A_b38	SLC35E2	4.209	3.4e-05	0.071381	52	0.016959	no	CLNTRN
chr1_1621352_G_A_b38	SLC35E2	4.101	5.32e-05	0.072959	41	0.017792	no	CLNTRN
chr1_1638879_C_T_b38	SLC35E2	-3.99	8.34e-05	-0.079637	21	0.019961	no	CLNTRN
chr1_1746522_GT_G_b38	SLC35E2	-3.931	0.000105	-0.082631	24	0.021018	no	CLNTRN
chr1_1835922_G_GAAA_b38	SLC35E2	-3.851	0.000144	-0.199022	3	0.05168	no	CLNTRN
chr1_1620609_G_A_b38	SLC35E2	3.781	0.000189	0.067244	40	0.017783	no	CLNTRN
chr1_1746440_A_G_b38	SLC35E2	-3.743	0.000218	-0.080524	22	0.021514	no	CLNTRN
chr1_1658422_T_C_b38	SLC35E2	3.678	0.000279	0.076225	19	0.020722	no	CLNTRN
chr1_1622295_G_C_b38	SLC35E2	3.665	0.000293	0.065697	40	0.017925	no	CLNTRN
chr1_1340697_G_A_b38	SLC35E2	3.665	0.000293	0.07463	21	0.020365	no	CLNTRN
chr1_1600379_C_T_b38	SLC35E2	3.568	0.000419	0.063906	38	0.017911	no	CLNTRN
chr1_2325494_G_A_b38	SLC35E2	-3.503	0.00053	-0.084128	15	0.024015	no	CLNTRN
chr1_2325768_C_A_b38	SLC35E2	-3.503	0.00053	-0.084128	15	0.024015	no	CLNTRN
chr1_2326256_G_A_b38	SLC35E2	-3.503	0.00053	-0.084128	15	0.024015	no	CLNTRN
chr1_1600320_C_G_b38	SLC35E2	3.503	0.000531	0.063142	36	0.018025	no	CLNTRN
chr1_1584321_T_C_b38	SLC35E2	-3.471	0.000596	-0.06154	57	0.017732	no	CLNTRN
chr1_2676824_ACGGCC_A_b38	SLC35E2	-3.322	0.00101	-0.16513	4	0.049715	no	CLNTRN
chr1_1794187_C_T_b38	SLC35E2	3.309	0.00105	0.076037	8	0.022978	no	CLNTRN
chr1_1595028_C_CAG_b38	SLC35E2	3.308	0.00105	0.064512	26	0.0195	no	CLNTRN
chr1_972790_C_G_b38	SLC35E2	-3.262	0.00123	-0.119932	12	0.036765	no	CLNTRN
chr1_1715541_A_C_b38	SLC35E2	3.248	0.0013	0.113271	4	0.034874	no	CLNTRN
chr1_1822247_A_G_b38	SLC35E2	3.21	0.00148	0.073216	9	0.022812	no	CLNTRN
chr1_1898043_T_C_b38	SLC35E2	3.159	0.00174	0.075678	6	0.023953	no	CLNTRN
chr1_1629332_G_T_b38	SLC35E2	3.141	0.00185	0.057673	41	0.018361	no	CLNTRN
chr1_1798974_C_T_b38	SLC35E2	3.13	0.00192	0.072382	8	0.023127	no	CLNTRN
chr1_2458710_G_A_b38	SLC35E2	-3.11	0.00205	-0.162598	3	0.052282	no	CLNTRN
chr1_2253095_GAA_G_b38	SLC35E2	3.096	0.00215	0.059393	52	0.019183	no	CLNTRN
chr1_1606532_GTGGGCTGGGCTGGTCAGGCA_G_b38	SLC35E2	3.081	0.00225	0.057099	32	0.01853	no	CLNTRN
chr1_1775996_G_A_b38	SLC35E2	3.068	0.00235	0.070203	9	0.022883	no	CLNTRN
chr1_1007746_CTTTTTTTTTTTTTT_C_b38	SLC35E2	3.063	0.00239	0.070818	12	0.023119	no	CLNTRN
chr1_875929_A_G_b38	SLC35E2	-3.062	0.0024	-0.155796	3	0.050873	no	CLNTRN
chr1_1775296_C_T_b38	SLC35E2	3.057	0.00244	0.073502	7	0.024042	no	CLNTRN
chr1_1815255_G_T_b38	SLC35E2	3.057	0.00244	0.073502	7	0.024042	no	CLNTRN
chr1_1782906_T_G_b38	SLC35E2	3.038	0.00259	0.069662	9	0.022929	no	CLNTRN
chr1_1898648_CACACACATAAGTTGGATAT_C_b38	SLC35E2	3.036	0.00261	0.055021	33	0.018122	no	CLNTRN
chr1_1990027_C_CT_b38	SLC35E2	3.036	0.00261	0.118231	7	0.038948	no	CLNTRN
chr1_2342876_AT_A_b38	SLC35E2	3.035	0.00262	0.121061	5	0.039889	no	CLNTRN
chr1_1880594_A_T_b38	SLC35E2	3.005	0.00288	0.068187	10	0.02269	no	CLNTRN
chr1_1846651_T_G_b38	SLC35E2	2.997	0.00296	0.068663	9	0.022913	no	CLNTRN
chr1_1653863_C_A_b38	SLC35E2	-2.99	0.00303	-0.067592	9	0.022609	no	CLNTRN
chr1_2327507_C_CA_b38	SLC35E2	-2.981	0.00311	-0.072265	12	0.024245	no	CLNTRN
chr1_1837340_C_T_b38	SLC35E2	2.978	0.00315	0.068264	9	0.022927	no	CLNTRN
chr1_1752461_G_A_b38	SLC35E2	-2.963	0.00329	-0.056524	75	0.019074	no	CLNTRN
chr1_1752730_C_G_b38	SLC35E2	-2.963	0.00329	-0.056524	75	0.019074	no	CLNTRN
chr1_1881065_G_A_b38	SLC35E2	2.957	0.00335	0.069966	7	0.023658	no	CLNTRN
chr1_1881798_C_T_b38	SLC35E2	2.957	0.00335	0.069966	7	0.023658	no	CLNTRN
chr1_1882915_C_T_b38	SLC35E2	2.957	0.00335	0.069966	7	0.023658	no	CLNTRN
chr1_1886690_A_C_b38	SLC35E2	2.957	0.00335	0.069966	7	0.023658	no	CLNTRN
chr1_1659940_A_C_b38	SLC35E2	-2.954	0.00338	-0.068341	9	0.023132	no	CLNTRN
chr1_1857305_G_GGGCT_b38	SLC35E2	2.932	0.00363	0.06939	7	0.023669	no	CLNTRN
chr1_1750440_G_A_b38	SLC35E2	-2.922	0.00375	-0.059225	52	0.020272	no	CLNTRN
chr1_1477850_C_G_b38	SLC35E2	2.914	0.00384	0.12901	3	0.044273	no	CLNTRN
chr1_1477855_G_C_b38	SLC35E2	2.914	0.00384	0.12901	3	0.044273	no	CLNTRN
chr1_1660408_T_C_b38	SLC35E2	-2.906	0.00394	-0.064913	7	0.022337	no	CLNTRN
chr1_1772160_A_AT_b38	SLC35E2	2.904	0.00396	0.068189	5	0.023479	no	CLNTRN
chr1_1871210_G_T_b38	SLC35E2	2.9	0.00401	0.069697	7	0.024033	no	CLNTRN
chr1_1717604_CGCTTTCAGCTAGAGTTTGCTCTCTCTGGTTTTCGGTCTGTGACACACGCAT_C_b38	SLC35E2	2.898	0.00404	0.047366	77	0.016345	no	CLNTRN
chr1_1898712_C_T_b38	SLC35E2	2.894	0.00409	0.069621	6	0.024057	no	CLNTRN
chr1_1899188_T_A_b38	SLC35E2	2.894	0.00409	0.069621	6	0.024057	no	CLNTRN
chr1_1855245_G_A_b38	SLC35E2	2.892	0.00411	0.068783	7	0.023786	no	CLNTRN
chr1_1835922_GA_G_b38	SLC35E2	2.875	0.00433	0.095343	3	0.033161	no	CLNTRN
chr1_1818305_TAAAAAAA_T_b38	SLC35E2	2.872	0.00438	0.06973	6	0.024283	no	CLNTRN
chr1_1840043_T_TA_b38	SLC35E2	2.865	0.00446	0.069364	5	0.024209	no	CLNTRN
chr1_1968793_T_C_b38	SLC35E2	2.857	0.00458	0.050995	59	0.017849	no	CLNTRN
chr1_1865177_G_A_b38	SLC35E2	-2.855	0.00461	-0.06147	17	0.021534	no	CLNTRN
chr1_1857246_T_TAA_b38	SLC35E2	2.849	0.00469	0.067166	7	0.023573	no	CLNTRN
chr1_1857250_C_G_b38	SLC35E2	2.849	0.00469	0.067166	7	0.023573	no	CLNTRN
chr1_1750280_A_G_b38	SLC35E2	-2.846	0.00473	-0.05283	85	0.01856	no	CLNTRN
chr1_1855939_G_A_b38	SLC35E2	2.83	0.00497	0.06676	7	0.023591	no	CLNTRN
chr1_1814797_CAAAAAAAAA_C_b38	SLC35E2	2.824	0.00507	0.072191	5	0.025567	no	CLNTRN
chr1_1048922_T_C_b38	SLC35E2	-2.819	0.00514	-0.046447	87	0.016475	no	CLNTRN
chr1_1909167_G_A_b38	SLC35E2	2.815	0.00521	0.067922	7	0.024129	no	CLNTRN
chr1_1987547_C_CT_b38	SLC35E2	2.813	0.00524	0.054458	63	0.019362	no	CLNTRN
chr1_998410_G_A_b38	SLC35E2	-2.804	0.00539	-0.047564	90	0.016965	no	CLNTRN
chr1_875916_GCTC_G_b38	SLC35E2	-2.799	0.00547	-0.101375	6	0.036223	no	CLNTRN
chr1_1903242_C_T_b38	SLC35E2	2.778	0.00583	0.068102	6	0.024519	no	CLNTRN
chr1_1906935_C_T_b38	SLC35E2	2.778	0.00583	0.068102	6	0.024519	no	CLNTRN
chr1_1960609_G_C_b38	SLC35E2	-2.777	0.00584	-0.050484	63	0.018182	no	CLNTRN
chr1_1057980_C_A_b38	SLC35E2	-2.775	0.00588	-0.047098	100	0.016975	no	CLNTRN
chr1_1892085_G_C_b38	SLC35E2	2.774	0.0059	0.065185	7	0.023503	no	CLNTRN
chr1_1845824_TACACAC_T_b38	SLC35E2	2.77	0.00596	0.062205	12	0.022458	no	CLNTRN
chr1_1967499_G_A_b38	SLC35E2	2.759	0.00615	0.0496	56	0.017976	no	CLNTRN
chr1_1594890_G_GAC_b38	SLC35E2	-2.758	0.00617	-0.047718	76	0.017299	no	CLNTRN
chr1_1753319_G_A_b38	SLC35E2	-2.745	0.00642	-0.052629	75	0.019173	no	CLNTRN
chr1_1753361_G_A_b38	SLC35E2	-2.745	0.00642	-0.052629	75	0.019173	no	CLNTRN
chr1_1849781_T_C_b38	SLC35E2	-2.743	0.00645	-0.058514	18	0.021331	no	CLNTRN
chr1_1707555_C_T_b38	SLC35E2	-2.732	0.00668	-0.078914	37	0.028889	no	CLNTRN
chr1_2331844_G_C_b38	SLC35E2	-2.722	0.00687	-0.070278	11	0.025816	no	CLNTRN
chr1_1546962_G_A_b38	SLC35E2	-2.716	0.00699	-0.116923	7	0.043044	no	CLNTRN
chr1_1920497_C_A_b38	SLC35E2	-2.712	0.00707	-0.06114	11	0.022541	no	CLNTRN
chr1_1897985_C_G_b38	SLC35E2	2.706	0.0072	0.060111	10	0.022212	no	CLNTRN
chr1_1041119_GGGC_G_b38	SLC35E2	-2.681	0.00776	-0.038301	28	0.014288	no	CLNTRN
chr1_1723766_C_T_b38	SLC35E2	-2.679	0.00779	-0.061898	17	0.023101	no	CLNTRN
chr1_1903577_C_T_b38	SLC35E2	2.679	0.00779	0.06436	8	0.024022	no	CLNTRN
chr1_1624323_AT_A_b38	SLC35E2	2.674	0.00791	0.047376	55	0.017717	no	CLNTRN
chr1_2233496_G_T_b38	SLC35E2	2.671	0.00798	0.045533	81	0.017047	no	CLNTRN
chr1_1684789_C_CAAAA_b38	SLC35E2	2.665	0.00812	0.095962	5	0.036009	no	CLNTRN
chr1_1688570_A_T_b38	SLC35E2	-2.663	0.00818	-0.062757	8	0.023569	no	CLNTRN
chr1_1041126_AGCGGGGGC_A_b38	SLC35E2	-2.644	0.00863	-0.038267	34	0.014474	no	CLNTRN
chr1_1756043_G_T_b38	SLC35E2	-2.64	0.00873	-0.050816	75	0.019249	no	CLNTRN
chr1_2055097_C_T_b38	SLC35E2	-2.639	0.00875	-0.057384	14	0.021743	no	CLNTRN
chr1_1876492_C_CGA_b38	SLC35E2	2.637	0.0088	0.066152	4	0.025086	no	CLNTRN
chr1_1963538_T_C_b38	SLC35E2	2.631	0.00896	0.047298	55	0.017979	no	CLNTRN
chr1_2676830_TGGAACAGCACCCACACCCCCA_T_b38	SLC35E2	-2.626	0.00908	-0.142122	3	0.054112	no	CLNTRN
chr1_1938332_A_ACT_b38	SLC35E2	-2.616	0.00934	-0.046834	75	0.017901	no	CLNTRN
chr1_1606384_A_G_b38	SLC35E2	2.607	0.00959	0.045437	48	0.017427	no	CLNTRN
chr1_2325032_T_A_b38	SLC35E2	-2.595	0.00994	-0.088323	8	0.034039	no	CLNTRN
chr1_1649932_C_T_b38	SLC35E2	7.782	1.46e-13	0.118119	72	0.015178	yes	ESPGSJ
chr1_1648736_G_A_b38	SLC35E2	7.522	7.75e-13	0.116055	71	0.015429	yes	ESPGSJ
chr1_1671995_G_T_b38	SLC35E2	7.271	3.75e-12	0.105659	79	0.014532	yes	ESPGSJ
chr1_1671797_G_A_b38	SLC35E2	7.194	6.01e-12	0.105782	79	0.014704	yes	ESPGSJ
chr1_1673818_A_C_b38	SLC35E2	7.07	1.29e-11	0.10402	80	0.014713	yes	ESPGSJ
chr1_1646352_A_C_b38	SLC35E2	7.043	1.52e-11	0.157058	7	0.022299	yes	ESPGSJ
chr1_1674868_G_A_b38	SLC35E2	6.963	2.47e-11	0.102357	80	0.014701	yes	ESPGSJ
chr1_1673060_G_A_b38	SLC35E2	6.933	2.96e-11	0.10429	77	0.015043	yes	ESPGSJ
chr1_1674720_TGC_T_b38	SLC35E2	6.912	3.35e-11	0.101989	79	0.014755	yes	ESPGSJ
chr1_1677720_T_G_b38	SLC35E2	6.879	4.08e-11	0.100472	83	0.014605	yes	ESPGSJ
chr1_1651653_C_T_b38	SLC35E2	6.805	6.35e-11	0.105037	77	0.015435	yes	ESPGSJ
chr1_1649976_G_A_b38	SLC35E2	6.802	6.46e-11	0.106535	58	0.015662	yes	ESPGSJ
chr1_1677726_A_T_b38	SLC35E2	6.723	1.03e-10	0.098699	83	0.014681	yes	ESPGSJ
chr1_1676790_C_T_b38	SLC35E2	6.677	1.35e-10	0.096966	82	0.014523	yes	ESPGSJ
chr1_1636278_G_T_b38	SLC35E2	6.536	3.08e-10	0.105543	64	0.016149	yes	ESPGSJ
chr1_1661562_G_C_b38	SLC35E2	6.206	2e-09	0.09184	79	0.014799	yes	ESPGSJ
chr1_1650000_G_A_b38	SLC35E2	5.518	7.96e-08	0.091807	42	0.016639	yes	ESPGSJ
chr1_1739131_T_C_b38	SLC35E2	5.495	8.92e-08	0.090707	46	0.016506	yes	ESPGSJ
chr1_1630798_C_T_b38	SLC35E2	5.476	9.87e-08	0.096222	36	0.017573	yes	ESPGSJ
chr1_1708474_C_A_b38	SLC35E2	-5.463	1.05e-07	-0.115218	8	0.021092	yes	ESPGSJ
chr1_1629332_G_T_b38	SLC35E2	5.451	1.12e-07	0.096225	37	0.017653	yes	ESPGSJ
chr1_1673968_GA_G_b38	SLC35E2	5.285	2.56e-07	0.095871	35	0.018139	yes	ESPGSJ
chr1_1613769_C_T_b38	SLC35E2	5.181	4.28e-07	0.093662	36	0.018077	yes	ESPGSJ
chr1_1639685_G_A_b38	SLC35E2	-5.145	5.09e-07	-0.098749	15	0.019192	yes	ESPGSJ
chr1_1667424_T_TAAAATA_b38	SLC35E2	5.125	5.63e-07	0.08585	49	0.016752	yes	ESPGSJ
chr1_1654662_CT_C_b38	SLC35E2	5.098	6.41e-07	0.092915	53	0.018226	yes	ESPGSJ
chr1_1621352_G_A_b38	SLC35E2	5.087	6.75e-07	0.087811	39	0.017261	yes	ESPGSJ
chr1_1612562_T_TC_b38	SLC35E2	5.071	7.3e-07	0.084919	42	0.016746	yes	ESPGSJ
chr1_1670423_AT_A_b38	SLC35E2	5.023	9.18e-07	0.095926	41	0.019097	yes	ESPGSJ
chr1_1638879_C_T_b38	SLC35E2	-5.007	9.9e-07	-0.093643	17	0.018701	yes	ESPGSJ
chr1_1620609_G_A_b38	SLC35E2	4.914	1.54e-06	0.084887	39	0.017274	yes	ESPGSJ
chr1_1667424_T_TAAATA_b38	SLC35E2	-4.907	1.59e-06	-0.079189	61	0.016139	yes	ESPGSJ
chr1_1649993_A_G_b38	SLC35E2	-4.718	3.79e-06	-0.075246	82	0.015947	yes	ESPGSJ
chr1_1597128_C_CCCTCAGCTGGACT_b38	SLC35E2	-4.663	4.88e-06	-0.078382	53	0.016811	yes	ESPGSJ
chr1_1658422_T_C_b38	SLC35E2	4.647	5.24e-06	0.09408	16	0.020245	yes	ESPGSJ
chr1_1622295_G_C_b38	SLC35E2	4.583	6.97e-06	0.080554	39	0.017576	yes	ESPGSJ
chr1_1600320_C_G_b38	SLC35E2	4.472	1.14e-05	0.081884	31	0.018311	yes	ESPGSJ
chr1_1607931_G_A_b38	SLC35E2	4.366	1.8e-05	0.078605	34	0.018004	yes	ESPGSJ
chr1_1600379_C_T_b38	SLC35E2	4.352	1.9e-05	0.079073	34	0.018168	yes	ESPGSJ
chr1_1609058_G_A_b38	SLC35E2	4.345	1.97e-05	0.078043	35	0.017962	yes	ESPGSJ
chr1_1606384_A_G_b38	SLC35E2	4.243	3.03e-05	0.074895	36	0.017653	yes	ESPGSJ
chr1_1669576_G_A_b38	SLC35E2	-4.232	3.17e-05	-0.086883	12	0.020532	yes	ESPGSJ
chr1_1641261_C_T_b38	SLC35E2	-4.214	3.41e-05	-0.087099	11	0.020669	yes	ESPGSJ
chr1_1742587_G_C_b38	SLC35E2	4.2	3.62e-05	0.067182	75	0.015996	yes	ESPGSJ
chr1_1593732_G_C_b38	SLC35E2	-4.195	3.69e-05	-0.071041	61	0.016934	yes	ESPGSJ
chr1_1674633_C_CA_b38	SLC35E2	4.147	4.5e-05	0.070827	40	0.01708	yes	ESPGSJ
chr1_1728671_C_A_b38	SLC35E2	4.13	4.83e-05	0.087528	11	0.021194	yes	ESPGSJ
chr1_1661177_A_G_b38	SLC35E2	-4.097	5.51e-05	-0.08219	13	0.02006	yes	ESPGSJ
chr1_1665061_C_T_b38	SLC35E2	-4.054	6.56e-05	-0.081279	13	0.020049	yes	ESPGSJ
chr1_1586962_C_T_b38	SLC35E2	4.019	7.57e-05	0.070161	45	0.017459	yes	ESPGSJ
chr1_1650664_CT_C_b38	SLC35E2	4.002	8.08e-05	0.077177	32	0.019283	yes	ESPGSJ
chr1_1722625_A_T_b38	SLC35E2	3.976	8.98e-05	0.086044	23	0.021642	yes	ESPGSJ
chr1_1722626_AGCG_A_b38	SLC35E2	3.976	8.98e-05	0.086044	23	0.021642	yes	ESPGSJ
chr1_1594890_G_GAC_b38	SLC35E2	-3.965	9.39e-05	-0.067565	61	0.017042	yes	ESPGSJ
chr1_1722619_C_T_b38	SLC35E2	3.95	9.94e-05	0.086228	23	0.021829	yes	ESPGSJ
chr1_1589495_CTTT_C_b38	SLC35E2	3.945	0.000102	0.075276	31	0.019083	yes	ESPGSJ
chr1_1639348_G_T_b38	SLC35E2	-3.933	0.000106	-0.067554	32	0.017177	yes	ESPGSJ
chr1_1675091_A_G_b38	SLC35E2	-3.87	0.000136	-0.077339	14	0.019984	yes	ESPGSJ
chr1_1653863_C_A_b38	SLC35E2	-3.865	0.000139	-0.080898	9	0.020929	yes	ESPGSJ
chr1_1606532_GTGGGCTGGGCTGGTCAGGCA_G_b38	SLC35E2	3.845	0.00015	0.070172	29	0.018249	yes	ESPGSJ
chr1_1650195_A_G_b38	SLC35E2	-3.84	0.000153	-0.067563	28	0.017596	yes	ESPGSJ
chr1_1658830_C_G_b38	SLC35E2	-3.819	0.000166	-0.076127	13	0.019936	yes	ESPGSJ
chr1_1760882_T_C_b38	SLC35E2	3.798	0.00018	0.064222	59	0.016911	yes	ESPGSJ
chr1_1650383_G_T_b38	SLC35E2	-3.772	0.000198	-0.073906	16	0.019593	yes	ESPGSJ
chr1_1637577_T_C_b38	SLC35E2	-3.759	0.000209	-0.071407	16	0.018998	yes	ESPGSJ
chr1_1665581_C_G_b38	SLC35E2	-3.707	0.000254	-0.074148	13	0.020002	yes	ESPGSJ
chr1_1652913_C_T_b38	SLC35E2	-3.703	0.000258	-0.069603	19	0.018798	yes	ESPGSJ
chr1_1649846_G_A_b38	SLC35E2	-3.656	0.000307	-0.073066	12	0.019987	yes	ESPGSJ
chr1_1648826_A_G_b38	SLC35E2	-3.647	0.000317	-0.064813	28	0.01777	yes	ESPGSJ
chr1_1688328_C_T_b38	SLC35E2	-3.61	0.000364	-0.069511	18	0.019254	yes	ESPGSJ
chr1_1650370_C_CT_b38	SLC35E2	-3.603	0.000373	-0.077565	13	0.021527	yes	ESPGSJ
chr1_1668721_C_T_b38	SLC35E2	-3.59	0.000391	-0.068458	18	0.019068	yes	ESPGSJ
chr1_1725582_T_C_b38	SLC35E2	3.583	0.000402	0.054509	69	0.015215	yes	ESPGSJ
chr1_1648636_G_A_b38	SLC35E2	-3.549	0.000455	-0.063063	28	0.017769	yes	ESPGSJ
chr1_1651926_T_C_b38	SLC35E2	-3.539	0.000472	-0.063786	25	0.018024	yes	ESPGSJ
chr1_1650777_G_A_b38	SLC35E2	-3.537	0.000475	-0.06379	25	0.018036	yes	ESPGSJ
chr1_1651137_C_T_b38	SLC35E2	-3.517	0.000511	-0.063191	25	0.017967	yes	ESPGSJ
chr1_1651267_T_C_b38	SLC35E2	-3.517	0.000511	-0.063191	25	0.017967	yes	ESPGSJ
chr1_1651574_G_A_b38	SLC35E2	-3.517	0.000511	-0.063191	25	0.017967	yes	ESPGSJ
chr1_1652061_T_C_b38	SLC35E2	-3.517	0.000511	-0.063191	25	0.017967	yes	ESPGSJ
chr1_1652135_C_G_b38	SLC35E2	-3.517	0.000511	-0.063191	25	0.017967	yes	ESPGSJ
chr1_1652191_C_T_b38	SLC35E2	-3.517	0.000511	-0.063191	25	0.017967	yes	ESPGSJ
chr1_1652592_A_G_b38	SLC35E2	-3.517	0.000511	-0.063191	25	0.017967	yes	ESPGSJ
chr1_1652779_A_G_b38	SLC35E2	-3.517	0.000511	-0.063191	25	0.017967	yes	ESPGSJ
chr1_1653147_A_C_b38	SLC35E2	-3.517	0.000511	-0.063191	25	0.017967	yes	ESPGSJ
chr1_1653396_T_C_b38	SLC35E2	-3.517	0.000511	-0.063191	25	0.017967	yes	ESPGSJ
chr1_1653472_T_C_b38	SLC35E2	-3.517	0.000511	-0.063191	25	0.017967	yes	ESPGSJ
chr1_1653811_G_A_b38	SLC35E2	-3.517	0.000511	-0.063191	25	0.017967	yes	ESPGSJ
chr1_1653893_C_T_b38	SLC35E2	-3.517	0.000511	-0.063191	25	0.017967	yes	ESPGSJ
chr1_1654143_G_A_b38	SLC35E2	-3.517	0.000511	-0.063191	25	0.017967	yes	ESPGSJ
chr1_1654188_T_G_b38	SLC35E2	-3.517	0.000511	-0.063191	25	0.017967	yes	ESPGSJ
chr1_1779667_T_TTG_b38	SLC35E2	3.508	0.000527	0.064224	41	0.018307	yes	ESPGSJ
chr1_1991778_A_G_b38	SLC35E2	-3.507	0.00053	-0.065635	22	0.018716	yes	ESPGSJ
chr1_1584321_T_C_b38	SLC35E2	-3.495	0.000554	-0.061759	48	0.017673	yes	ESPGSJ
chr1_1743565_AT_A_b38	SLC35E2	3.491	0.000561	0.053736	79	0.015393	yes	ESPGSJ
chr1_1650688_T_A_b38	SLC35E2	-3.475	0.000594	-0.066682	18	0.01919	yes	ESPGSJ
chr1_1073612_C_T_b38	SLC35E2	-3.442	0.000667	-0.179207	3	0.052062	yes	ESPGSJ
chr1_1074345_G_GGGTCATGCT_b38	SLC35E2	-3.442	0.000667	-0.179207	3	0.052062	yes	ESPGSJ
chr1_1075479_G_A_b38	SLC35E2	-3.442	0.000667	-0.179207	3	0.052062	yes	ESPGSJ
chr1_1075491_G_C_b38	SLC35E2	-3.442	0.000667	-0.179207	3	0.052062	yes	ESPGSJ
chr1_1081492_G_A_b38	SLC35E2	-3.442	0.000667	-0.179207	3	0.052062	yes	ESPGSJ
chr1_1764023_C_A_b38	SLC35E2	3.424	0.000711	0.058921	53	0.017206	yes	ESPGSJ
chr1_1743544_CA_C_b38	SLC35E2	3.413	0.000739	0.054548	67	0.015981	yes	ESPGSJ
chr1_1649954_C_CA_b38	SLC35E2	-3.377	0.00084	-0.072052	13	0.021337	yes	ESPGSJ
chr1_1653934_G_A_b38	SLC35E2	-3.365	0.000876	-0.060625	25	0.018018	yes	ESPGSJ
chr1_1714674_G_C_b38	SLC35E2	3.34	0.000955	0.079031	17	0.023664	yes	ESPGSJ
chr1_1717507_T_C_b38	SLC35E2	3.328	0.000995	0.09003	9	0.027054	yes	ESPGSJ
chr1_1708855_TTCCTCCTCC_T_b38	SLC35E2	3.294	0.00112	0.059663	63	0.018113	yes	ESPGSJ
chr1_1758323_T_C_b38	SLC35E2	3.282	0.00116	0.056033	56	0.017073	yes	ESPGSJ
chr1_1635226_T_C_b38	SLC35E2	-3.282	0.00117	-0.074634	6	0.022742	yes	ESPGSJ
chr1_1651421_GTAGCCCCTCTGAACGGTCTGTGACACACGCATGCTTTCAGCTAGAGTACTCTA_G_b38	SLC35E2	-3.282	0.00117	-0.059578	24	0.018155	yes	ESPGSJ
chr1_1844830_C_A_b38	SLC35E2	3.263	0.00124	0.056398	59	0.017284	yes	ESPGSJ
chr1_1744052_GAGA_G_b38	SLC35E2	-3.253	0.00128	-0.069361	21	0.02132	yes	ESPGSJ
chr1_1660683_C_T_b38	SLC35E2	-3.248	0.00131	-0.062454	18	0.019229	yes	ESPGSJ
chr1_1750589_G_A_b38	SLC35E2	-3.24	0.00134	-0.078998	14	0.024382	yes	ESPGSJ
chr1_1651785_C_A_b38	SLC35E2	-3.236	0.00136	-0.05831	25	0.01802	yes	ESPGSJ
chr1_1659060_G_A_b38	SLC35E2	-3.226	0.00141	-0.061335	19	0.019013	yes	ESPGSJ
chr1_1595028_C_CAG_b38	SLC35E2	3.226	0.00141	0.062478	25	0.019368	yes	ESPGSJ
chr1_1970506_T_A_b38	SLC35E2	-3.217	0.00145	-0.053032	57	0.016486	yes	ESPGSJ
chr1_1650664_CTTTTT_C_b38	SLC35E2	-3.215	0.00146	-0.065699	15	0.020436	yes	ESPGSJ
chr1_1753033_C_T_b38	SLC35E2	-3.211	0.00148	-0.055938	82	0.017421	yes	ESPGSJ
chr1_1744499_C_T_b38	SLC35E2	-3.206	0.0015	-0.052874	69	0.016492	yes	ESPGSJ
chr1_1848037_C_CTA_b38	SLC35E2	3.204	0.00152	0.055587	60	0.017351	yes	ESPGSJ
chr1_1866635_T_TA_b38	SLC35E2	3.193	0.00157	0.060191	37	0.018848	yes	ESPGSJ
chr1_1660408_T_C_b38	SLC35E2	-3.159	0.00176	-0.067369	7	0.021325	yes	ESPGSJ
chr1_1596162_GAGC_G_b38	SLC35E2	-3.148	0.00182	-0.068697	6	0.021821	yes	ESPGSJ
chr1_1688457_G_A_b38	SLC35E2	-3.142	0.00186	-0.065672	21	0.020903	yes	ESPGSJ
chr1_1671148_C_T_b38	SLC35E2	3.119	0.00201	0.056407	27	0.018082	yes	ESPGSJ
chr1_1722599_G_A_b38	SLC35E2	3.103	0.00212	0.064248	32	0.020705	yes	ESPGSJ
chr1_1591703_T_C_b38	SLC35E2	3.083	0.00226	0.053316	68	0.017293	yes	ESPGSJ
chr1_1744028_A_AC_b38	SLC35E2	-3.081	0.00228	-0.067495	17	0.02191	yes	ESPGSJ
chr1_1081587_G_A_b38	SLC35E2	-3.065	0.00239	-0.160777	3	0.052454	yes	ESPGSJ
chr1_1721197_CA_C_b38	SLC35E2	3.062	0.00242	0.086779	9	0.02834	yes	ESPGSJ
chr1_1596173_G_A_b38	SLC35E2	-3.052	0.0025	-0.067305	5	0.022056	yes	ESPGSJ
chr1_1671097_G_C_b38	SLC35E2	3.031	0.00267	0.055462	26	0.0183	yes	ESPGSJ
chr1_1079456_A_G_b38	SLC35E2	-3.019	0.00277	-0.048255	88	0.015984	yes	ESPGSJ
chr1_1931743_CA_C_b38	SLC35E2	-2.999	0.00296	-0.062694	30	0.020907	yes	ESPGSJ
chr1_1744652_C_T_b38	SLC35E2	-2.994	0.003	-0.050132	69	0.016742	yes	ESPGSJ
chr1_1664757_T_C_b38	SLC35E2	-2.994	0.00301	-0.05444	24	0.018184	yes	ESPGSJ
chr1_1945842_A_AAAAGAAC_b38	SLC35E2	-2.992	0.00303	-0.052476	52	0.017542	yes	ESPGSJ
chr1_1754601_G_T_b38	SLC35E2	2.991	0.00303	0.052621	51	0.017592	yes	ESPGSJ
chr1_1757725_C_T_b38	SLC35E2	2.991	0.00303	0.052621	51	0.017592	yes	ESPGSJ
chr1_1749637_G_T_b38	SLC35E2	2.99	0.00305	0.049903	56	0.016692	yes	ESPGSJ
chr1_1688586_C_T_b38	SLC35E2	-2.984	0.0031	-0.065819	15	0.022054	yes	ESPGSJ
chr1_1624723_C_T_b38	SLC35E2	-2.943	0.00353	-0.064454	10	0.021904	yes	ESPGSJ
chr1_1634406_C_G_b38	SLC35E2	-2.939	0.00358	-0.106419	3	0.036212	yes	ESPGSJ
chr1_1752908_C_CCCT_b38	SLC35E2	-2.935	0.00362	-0.053743	64	0.018312	yes	ESPGSJ
chr1_1926870_T_C_b38	SLC35E2	-2.93	0.00367	-0.05019	61	0.017128	yes	ESPGSJ
chr1_1026830_A_G_b38	SLC35E2	2.912	0.00389	0.051805	46	0.017792	yes	ESPGSJ
chr1_1759611_C_T_b38	SLC35E2	-2.894	0.00411	-0.051816	76	0.017907	yes	ESPGSJ
chr1_1743840_T_C_b38	SLC35E2	-2.891	0.00415	-0.058068	28	0.020087	yes	ESPGSJ
chr1_1936906_C_CA_b38	SLC35E2	-2.88	0.0043	-0.052593	45	0.018265	yes	ESPGSJ
chr1_1742672_C_T_b38	SLC35E2	-2.868	0.00445	-0.049343	61	0.017202	yes	ESPGSJ
chr1_1743238_G_C_b38	SLC35E2	-2.868	0.00445	-0.049343	61	0.017202	yes	ESPGSJ
chr1_1134095_AAAAAAAG_A_b38	SLC35E2	-2.854	0.00464	-0.047198	62	0.016536	yes	ESPGSJ
chr1_1744096_C_T_b38	SLC35E2	-2.854	0.00465	-0.07105	29	0.024895	yes	ESPGSJ
chr1_1743886_C_T_b38	SLC35E2	-2.841	0.00483	-0.056308	28	0.019819	yes	ESPGSJ
chr1_1688102_G_A_b38	SLC35E2	-2.838	0.00488	-0.054834	24	0.019321	yes	ESPGSJ
chr1_962358_C_T_b38	SLC35E2	-2.825	0.00507	-0.097146	3	0.034387	yes	ESPGSJ
chr1_1692151_T_C_b38	SLC35E2	-2.824	0.00509	-0.054738	28	0.019385	yes	ESPGSJ
chr1_2331844_G_C_b38	SLC35E2	-2.822	0.00512	-0.07724	5	0.02737	yes	ESPGSJ
chr1_1688531_T_C_b38	SLC35E2	-2.8	0.00547	-0.062652	12	0.022372	yes	ESPGSJ
chr1_962184_T_C_b38	SLC35E2	2.795	0.00556	0.09459	3	0.033848	yes	ESPGSJ
chr1_1034279_G_A_b38	SLC35E2	2.787	0.00569	0.051307	31	0.018408	yes	ESPGSJ
chr1_1762759_AAATG_A_b38	SLC35E2	2.78	0.00582	0.04831	60	0.017379	yes	ESPGSJ
chr1_1936906_CA_C_b38	SLC35E2	2.771	0.00597	0.059385	8	0.02143	yes	ESPGSJ
chr1_966227_C_G_b38	SLC35E2	2.768	0.00602	0.089978	5	0.032501	yes	ESPGSJ
chr1_2224923_A_G_b38	SLC35E2	2.762	0.00614	0.04874	39	0.017649	yes	ESPGSJ
chr1_1055393_C_T_b38	SLC35E2	2.757	0.00622	0.060864	10	0.022073	yes	ESPGSJ
chr1_1055426_G_A_b38	SLC35E2	2.757	0.00622	0.060864	10	0.022073	yes	ESPGSJ
chr1_1057460_ATT_A_b38	SLC35E2	2.757	0.00622	0.060864	10	0.022073	yes	ESPGSJ
chr1_1708951_C_T_b38	SLC35E2	2.751	0.00634	0.046914	59	0.017055	yes	ESPGSJ
chr1_1719638_C_CTCGCTCTGTCACCCAGGCT_b38	SLC35E2	2.745	0.00645	0.07191	14	0.026197	yes	ESPGSJ
chr1_1865278_A_C_b38	SLC35E2	2.737	0.00661	0.047827	54	0.017474	yes	ESPGSJ
chr1_1081790_C_G_b38	SLC35E2	-2.718	0.00699	-0.043519	85	0.016011	yes	ESPGSJ
chr1_1743586_T_TAC_b38	SLC35E2	-2.716	0.00703	-0.047519	50	0.017495	yes	ESPGSJ
chr1_1759354_G_A_b38	SLC35E2	-2.71	0.00715	-0.048955	74	0.018064	yes	ESPGSJ
chr1_1708505_G_C_b38	SLC35E2	2.707	0.00722	0.039953	52	0.014759	yes	ESPGSJ
chr1_1653825_T_TACACAC_b38	SLC35E2	2.705	0.00726	0.05319	14	0.019665	yes	ESPGSJ
chr1_1743851_C_T_b38	SLC35E2	-2.704	0.00729	-0.055085	27	0.020374	yes	ESPGSJ
chr1_1734812_G_A_b38	SLC35E2	2.689	0.00761	0.058335	25	0.021697	yes	ESPGSJ
chr1_1718200_G_A_b38	SLC35E2	2.673	0.00796	0.078321	9	0.029296	yes	ESPGSJ
chr1_1750440_G_A_b38	SLC35E2	-2.67	0.00803	-0.053227	43	0.019932	yes	ESPGSJ
chr1_1750428_G_C_b38	SLC35E2	-2.665	0.00817	-0.052858	45	0.019837	yes	ESPGSJ
chr1_1753319_G_A_b38	SLC35E2	-2.663	0.0082	-0.047669	74	0.017901	yes	ESPGSJ
chr1_1714988_T_G_b38	SLC35E2	2.661	0.00826	0.078018	9	0.029324	yes	ESPGSJ
chr1_1715011_G_A_b38	SLC35E2	2.661	0.00826	0.078018	9	0.029324	yes	ESPGSJ
chr1_1904424_A_AAAATAAATAAAT_b38	SLC35E2	2.651	0.0085	0.043454	49	0.016394	yes	ESPGSJ
chr1_1992226_A_G_b38	SLC35E2	2.65	0.00851	0.045528	63	0.017178	yes	ESPGSJ
chr1_1026084_G_T_b38	SLC35E2	2.648	0.00857	0.048174	35	0.018194	yes	ESPGSJ
chr1_1720288_G_A_b38	SLC35E2	2.648	0.00857	0.079417	15	0.029993	yes	ESPGSJ
chr1_1940973_C_T_b38	SLC35E2	-2.645	0.00863	-0.044482	69	0.016816	yes	ESPGSJ
chr1_1706963_G_A_b38	SLC35E2	-2.633	0.00894	-0.084161	8	0.031963	yes	ESPGSJ
chr1_1940540_G_A_b38	SLC35E2	-2.63	0.00903	-0.044273	68	0.016835	yes	ESPGSJ
chr1_1942014_G_A_b38	SLC35E2	-2.63	0.00903	-0.044273	68	0.016835	yes	ESPGSJ
chr1_1942075_A_G_b38	SLC35E2	-2.63	0.00903	-0.044273	68	0.016835	yes	ESPGSJ
chr1_1942086_T_C_b38	SLC35E2	-2.63	0.00903	-0.044273	68	0.016835	yes	ESPGSJ
chr1_1942260_G_C_b38	SLC35E2	-2.63	0.00903	-0.044273	68	0.016835	yes	ESPGSJ
chr1_1752126_G_A_b38	SLC35E2	2.626	0.00912	0.047885	41	0.018234	yes	ESPGSJ
chr1_1692124_T_G_b38	SLC35E2	-2.623	0.0092	-0.05066	29	0.019312	yes	ESPGSJ
chr1_1945975_TG_T_b38	SLC35E2	-2.613	0.00947	-0.045606	71	0.017454	yes	ESPGSJ
chr1_2698922_T_C_b38	SLC35E2	-2.613	0.00948	-0.049664	30	0.01901	yes	ESPGSJ
chr1_1721975_C_T_b38	SLC35E2	2.612	0.0095	0.077096	9	0.029517	yes	ESPGSJ
chr1_1971864_C_T_b38	SLC35E2	2.612	0.0095	0.043259	57	0.016562	yes	ESPGSJ
chr1_958251_A_G_b38	SLC35E2	2.607	0.00964	0.086261	3	0.033093	yes	ESPGSJ
chr1_1942258_G_A_b38	SLC35E2	-2.604	0.00971	-0.04393	67	0.016867	yes	ESPGSJ
chr1_1722940_TAAG_T_b38	SLC35E2	2.603	0.00974	0.063416	17	0.024361	yes	ESPGSJ
chr1_1752461_G_A_b38	SLC35E2	-2.595	0.00997	-0.046715	74	0.018002	yes	ESPGSJ
chr1_1752730_C_G_b38	SLC35E2	-2.595	0.00997	-0.046715	74	0.018002	yes	ESPGSJ
chr1_1753361_G_A_b38	SLC35E2	-2.595	0.00997	-0.046715	74	0.018002	yes	ESPGSJ
chr1_1595306_CAG_C_b38	SLC35E2	-4.62	5.92e-06	-0.082454	66	0.017848	no	ESPGSJ
chr1_1675228_C_CG_b38	SLC35E2	4.594	6.65e-06	0.080586	48	0.017543	no	ESPGSJ
chr1_1675132_A_G_b38	SLC35E2	4.49	1.05e-05	0.079854	42	0.017784	no	ESPGSJ
chr1_1667948_A_G_b38	SLC35E2	-4.388	1.64e-05	-0.0891	13	0.020307	no	ESPGSJ
chr1_1708521_C_G_b38	SLC35E2	-4.368	1.78e-05	-0.082297	21	0.018843	no	ESPGSJ
chr1_1668717_C_G_b38	SLC35E2	-4.343	1.98e-05	-0.087905	13	0.020243	no	ESPGSJ
chr1_1668542_C_T_b38	SLC35E2	-4.292	2.46e-05	-0.087925	12	0.020487	no	ESPGSJ
chr1_1672155_G_A_b38	SLC35E2	-4.246	2.99e-05	-0.07773	34	0.018308	no	ESPGSJ
chr1_1669613_G_A_b38	SLC35E2	-4.204	3.56e-05	-0.085627	13	0.020369	no	ESPGSJ
chr1_1661169_C_A_b38	SLC35E2	4.083	5.83e-05	0.076469	26	0.018727	no	ESPGSJ
chr1_1739519_C_G_b38	SLC35E2	4.054	6.57e-05	0.076511	22	0.018873	no	ESPGSJ
chr1_1717604_CGCTTTCAGCTAGAGTTTGCTCTCTCTGGTTTTCGGTCTGTGACACACGCAT_C_b38	SLC35E2	3.946	0.000101	0.064432	53	0.01633	no	ESPGSJ
chr1_1653319_A_G_b38	SLC35E2	3.913	0.000115	0.072628	26	0.01856	no	ESPGSJ
chr1_1743714_C_CA_b38	SLC35E2	3.889	0.000127	0.068338	47	0.017574	no	ESPGSJ
chr1_1676287_C_T_b38	SLC35E2	-3.813	0.00017	-0.081587	12	0.021396	no	ESPGSJ
chr1_1627057_C_G_b38	SLC35E2	-3.777	0.000194	-0.07316	29	0.019368	no	ESPGSJ
chr1_1730405_G_C_b38	SLC35E2	3.762	0.000206	0.067394	48	0.017915	no	ESPGSJ
chr1_1729859_A_G_b38	SLC35E2	3.725	0.000237	0.080133	7	0.021511	no	ESPGSJ
chr1_1671724_C_T_b38	SLC35E2	-3.7	0.000261	-0.068461	29	0.018505	no	ESPGSJ
chr1_1725339_C_A_b38	SLC35E2	3.573	0.000417	0.054894	74	0.015363	no	ESPGSJ
chr1_1820337_A_G_b38	SLC35E2	3.52	0.000505	0.05988	65	0.017011	no	ESPGSJ
chr1_1679993_A_G_b38	SLC35E2	-3.498	0.000546	-0.058929	73	0.016845	no	ESPGSJ
chr1_1688442_T_C_b38	SLC35E2	-3.407	0.000755	-0.069726	21	0.020466	no	ESPGSJ
chr1_1677707_C_T_b38	SLC35E2	-3.36	0.00089	-0.085523	8	0.025452	no	ESPGSJ
chr1_1731904_CA_C_b38	SLC35E2	3.341	0.000951	0.062019	33	0.018563	no	ESPGSJ
chr1_1679100_A_G_b38	SLC35E2	-3.326	0.001	-0.055727	56	0.016756	no	ESPGSJ
chr1_1071101_C_A_b38	SLC35E2	-3.305	0.00108	-0.173506	3	0.052497	no	ESPGSJ
chr1_1664865_A_G_b38	SLC35E2	-3.261	0.00125	-0.059217	24	0.018157	no	ESPGSJ
chr1_1611248_ATC_A_b38	SLC35E2	-3.219	0.00144	-0.063988	14	0.01988	no	ESPGSJ
chr1_1668108_C_T_b38	SLC35E2	3.211	0.00148	0.058733	25	0.018293	no	ESPGSJ
chr1_1755523_C_T_b38	SLC35E2	3.2	0.00154	0.05468	74	0.017089	no	ESPGSJ
chr1_1755504_T_C_b38	SLC35E2	3.19	0.00159	0.052374	70	0.01642	no	ESPGSJ
chr1_1680672_C_T_b38	SLC35E2	-3.159	0.00176	-0.056723	48	0.017956	no	ESPGSJ
chr1_1750226_C_T_b38	SLC35E2	3.132	0.00192	0.05533	54	0.017665	no	ESPGSJ
chr1_1688619_AAAC_A_b38	SLC35E2	-3.111	0.00206	-0.065823	20	0.021157	no	ESPGSJ
chr1_1658866_G_A_b38	SLC35E2	-3.073	0.00233	-0.055958	25	0.018208	no	ESPGSJ
chr1_1659114_A_G_b38	SLC35E2	-3.073	0.00233	-0.055958	25	0.018208	no	ESPGSJ
chr1_1659220_A_G_b38	SLC35E2	-3.073	0.00233	-0.055958	25	0.018208	no	ESPGSJ
chr1_1661420_C_A_b38	SLC35E2	-3.073	0.00233	-0.055958	25	0.018208	no	ESPGSJ
chr1_1828894_T_TAC_b38	SLC35E2	3.068	0.00237	0.054575	55	0.017791	no	ESPGSJ
chr1_1708486_C_A_b38	SLC35E2	3.06	0.00243	0.046335	70	0.015141	no	ESPGSJ
chr1_1781909_C_T_b38	SLC35E2	3.048	0.00253	0.052118	60	0.017098	no	ESPGSJ
chr1_1075450_A_G_b38	SLC35E2	-3.037	0.00262	-0.156107	3	0.051403	no	ESPGSJ
chr1_1081152_A_AG_b38	SLC35E2	-3.037	0.00262	-0.156107	3	0.051403	no	ESPGSJ
chr1_1082218_A_G_b38	SLC35E2	-3.037	0.00262	-0.156107	3	0.051403	no	ESPGSJ
chr1_1614340_C_T_b38	SLC35E2	3.023	0.00274	0.077916	3	0.025772	no	ESPGSJ
chr1_1055000_C_T_b38	SLC35E2	2.991	0.00303	0.054948	34	0.018368	no	ESPGSJ
chr1_1595366_G_C_b38	SLC35E2	-2.991	0.00304	-0.066022	7	0.022077	no	ESPGSJ
chr1_1054900_C_T_b38	SLC35E2	-2.947	0.00349	-0.05315	42	0.018037	no	ESPGSJ
chr1_1757074_G_T_b38	SLC35E2	2.944	0.00352	0.051381	51	0.017453	no	ESPGSJ
chr1_1617375_T_C_b38	SLC35E2	2.941	0.00355	0.054108	32	0.018396	no	ESPGSJ
chr1_1618213_C_G_b38	SLC35E2	2.941	0.00355	0.054108	32	0.018396	no	ESPGSJ
chr1_1618290_G_C_b38	SLC35E2	2.941	0.00355	0.054108	32	0.018396	no	ESPGSJ
chr1_1744854_C_A_b38	SLC35E2	-2.94	0.00356	-0.047105	54	0.016022	no	ESPGSJ
chr1_1659940_A_C_b38	SLC35E2	-2.912	0.00388	-0.063301	7	0.021736	no	ESPGSJ
chr1_1688647_G_A_b38	SLC35E2	-2.867	0.00447	-0.059724	23	0.020835	no	ESPGSJ
chr1_1615322_A_G_b38	SLC35E2	2.85	0.0047	0.052067	32	0.018267	no	ESPGSJ
chr1_1613421_T_C_b38	SLC35E2	2.843	0.0048	0.052034	33	0.018302	no	ESPGSJ
chr1_1769969_CAAAACA_C_b38	SLC35E2	2.818	0.00518	0.04773	56	0.016938	no	ESPGSJ
chr1_1866635_T_TAAA_b38	SLC35E2	-2.815	0.00523	-0.056362	43	0.020021	no	ESPGSJ
chr1_1024462_C_T_b38	SLC35E2	2.803	0.00542	0.052118	36	0.018591	no	ESPGSJ
chr1_998719_G_C_b38	SLC35E2	2.803	0.00543	0.108378	3	0.03867	no	ESPGSJ
chr1_998726_A_G_b38	SLC35E2	2.803	0.00543	0.108378	3	0.03867	no	ESPGSJ
chr1_1688570_A_T_b38	SLC35E2	-2.797	0.00553	-0.063457	9	0.022689	no	ESPGSJ
chr1_1613974_G_A_b38	SLC35E2	2.791	0.00562	0.052305	22	0.018739	no	ESPGSJ
chr1_2215707_T_C_b38	SLC35E2	2.789	0.00566	0.04956	38	0.01777	no	ESPGSJ
chr1_1615869_C_T_b38	SLC35E2	2.785	0.00573	0.04979	34	0.01788	no	ESPGSJ
chr1_1055037_T_C_b38	SLC35E2	2.723	0.00687	0.049381	38	0.018132	no	ESPGSJ
chr1_1865177_G_A_b38	SLC35E2	-2.721	0.00693	-0.05497	17	0.020204	no	ESPGSJ
chr1_1716097_C_T_b38	SLC35E2	-2.71	0.00716	-0.081161	5	0.02995	no	ESPGSJ
chr1_1721125_G_A_b38	SLC35E2	-2.71	0.00716	-0.081161	5	0.02995	no	ESPGSJ
chr1_1572877_TG_T_b38	SLC35E2	-2.703	0.00731	-0.05406	15	0.020002	no	ESPGSJ
chr1_1849781_T_C_b38	SLC35E2	-2.698	0.0074	-0.054145	18	0.020067	no	ESPGSJ
chr1_1861110_C_CA_b38	SLC35E2	-2.696	0.00746	-0.044807	61	0.016621	no	ESPGSJ
chr1_1599234_T_C_b38	SLC35E2	-2.693	0.00752	-0.053501	15	0.019868	no	ESPGSJ
chr1_1602057_C_T_b38	SLC35E2	-2.693	0.00752	-0.053501	15	0.019868	no	ESPGSJ
chr1_1613322_T_C_b38	SLC35E2	2.693	0.00753	0.049054	34	0.018218	no	ESPGSJ
chr1_1616547_T_C_b38	SLC35E2	2.686	0.00768	0.049307	31	0.018358	no	ESPGSJ
chr1_1634405_C_CGG_b38	SLC35E2	-2.685	0.0077	-0.118743	3	0.044225	no	ESPGSJ
chr1_2425690_G_GT_b38	SLC35E2	-2.678	0.00784	-0.054768	12	0.020448	no	ESPGSJ
chr1_1688786_G_A_b38	SLC35E2	-2.675	0.00792	-0.064202	7	0.024001	no	ESPGSJ
chr1_1756186_T_C_b38	SLC35E2	2.662	0.00822	0.046232	52	0.017367	no	ESPGSJ
chr1_1618982_G_A_b38	SLC35E2	2.66	0.00827	0.049723	23	0.01869	no	ESPGSJ
chr1_1691417_T_C_b38	SLC35E2	2.627	0.00909	0.047137	62	0.017942	no	ESPGSJ
chr1_1025970_C_T_b38	SLC35E2	2.61	0.00954	0.047197	36	0.01808	no	ESPGSJ
chr1_1596590_GAC_G_b38	SLC35E2	-2.605	0.0097	-0.051352	16	0.019716	no	ESPGSJ
chr1_1674868_G_A_b38	SLC35E2	9.284	8.41e-19	0.1007	114	0.010847	yes	ESPMCS
chr1_1677720_T_G_b38	SLC35E2	9.277	8.84e-19	0.099949	116	0.010773	yes	ESPMCS
chr1_1677726_A_T_b38	SLC35E2	9.259	1.02e-18	0.099901	116	0.01079	yes	ESPMCS
chr1_1673818_A_C_b38	SLC35E2	9.151	2.35e-18	0.09935	115	0.010856	yes	ESPMCS
chr1_1673060_G_A_b38	SLC35E2	9.123	2.93e-18	0.100019	113	0.010963	yes	ESPMCS
chr1_1676790_C_T_b38	SLC35E2	8.909	1.51e-17	0.095806	115	0.010753	yes	ESPMCS
chr1_1742587_G_C_b38	SLC35E2	7.751	6.76e-14	0.086132	116	0.011113	yes	ESPMCS
chr1_1744499_C_T_b38	SLC35E2	-7.529	3.08e-13	-0.083014	99	0.011026	yes	ESPMCS
chr1_1651653_C_T_b38	SLC35E2	7.481	4.25e-13	0.085219	109	0.011391	yes	ESPMCS
chr1_1744652_C_T_b38	SLC35E2	-7.343	1.07e-12	-0.083273	100	0.011341	yes	ESPMCS
chr1_1675091_A_G_b38	SLC35E2	-7.295	1.47e-12	-0.098737	27	0.013534	yes	ESPMCS
chr1_1649932_C_T_b38	SLC35E2	7.226	2.31e-12	0.082114	101	0.011363	yes	ESPMCS
chr1_1743586_T_TAC_b38	SLC35E2	-7.048	7.33e-12	-0.084167	70	0.011941	yes	ESPMCS
chr1_1671148_C_T_b38	SLC35E2	7.032	8.17e-12	0.085725	54	0.012192	yes	ESPMCS
chr1_1743565_AT_A_b38	SLC35E2	7.029	8.3e-12	0.074252	119	0.010563	yes	ESPMCS
chr1_1654662_CT_C_b38	SLC35E2	6.911	1.77e-11	0.087272	75	0.012629	yes	ESPMCS
chr1_1692286_C_A_b38	SLC35E2	6.875	2.22e-11	0.117448	5	0.017084	yes	ESPMCS
chr1_1636278_G_T_b38	SLC35E2	6.828	2.98e-11	0.080707	89	0.01182	yes	ESPMCS
chr1_1743714_C_CA_b38	SLC35E2	6.763	4.47e-11	0.085922	66	0.012705	yes	ESPMCS
chr1_1739131_T_C_b38	SLC35E2	6.711	6.16e-11	0.077587	92	0.01156	yes	ESPMCS
chr1_1752908_C_CCCT_b38	SLC35E2	-6.7	6.62e-11	-0.08458	89	0.012624	yes	ESPMCS
chr1_1661562_G_C_b38	SLC35E2	6.67	7.97e-11	0.072453	110	0.010863	yes	ESPMCS
chr1_1757725_C_T_b38	SLC35E2	6.652	8.89e-11	0.080662	78	0.012126	yes	ESPMCS
chr1_1674633_C_CA_b38	SLC35E2	6.637	9.77e-11	0.082219	61	0.012388	yes	ESPMCS
chr1_1743544_CA_C_b38	SLC35E2	6.61	1.15e-10	0.07366	106	0.011143	yes	ESPMCS
chr1_1671097_G_C_b38	SLC35E2	6.557	1.59e-10	0.081102	53	0.012369	yes	ESPMCS
chr1_1692124_T_G_b38	SLC35E2	-6.515	2.06e-10	-0.08597	41	0.013196	yes	ESPMCS
chr1_1736729_G_T_b38	SLC35E2	6.5	2.24e-10	0.073033	125	0.011235	yes	ESPMCS
chr1_1764023_C_A_b38	SLC35E2	6.499	2.26e-10	0.077846	83	0.011978	yes	ESPMCS
chr1_1754601_G_T_b38	SLC35E2	6.492	2.36e-10	0.078743	78	0.012129	yes	ESPMCS
chr1_1756186_T_C_b38	SLC35E2	6.463	2.82e-10	0.076249	82	0.011799	yes	ESPMCS
chr1_1755504_T_C_b38	SLC35E2	6.446	3.11e-10	0.07433	115	0.01153	yes	ESPMCS
chr1_1750226_C_T_b38	SLC35E2	6.41	3.86e-10	0.077079	82	0.012024	yes	ESPMCS
chr1_1744854_C_A_b38	SLC35E2	-6.38	4.63e-10	-0.070335	79	0.011025	yes	ESPMCS
chr1_1754482_TCCCTGGGACCGAAGTCGCCCCA_T_b38	SLC35E2	-6.37	4.92e-10	-0.077493	110	0.012166	yes	ESPMCS
chr1_1779667_T_TTG_b38	SLC35E2	6.362	5.14e-10	0.081175	65	0.012759	yes	ESPMCS
chr1_1670423_AT_A_b38	SLC35E2	6.32	6.6e-10	0.088292	56	0.01397	yes	ESPMCS
chr1_1848037_C_CTA_b38	SLC35E2	6.317	6.72e-10	0.074547	97	0.011801	yes	ESPMCS
chr1_1752126_G_A_b38	SLC35E2	6.297	7.57e-10	0.079984	62	0.012702	yes	ESPMCS
chr1_1865278_A_C_b38	SLC35E2	6.278	8.44e-10	0.073695	90	0.011738	yes	ESPMCS
chr1_1844830_C_A_b38	SLC35E2	6.26	9.4e-10	0.074033	95	0.011826	yes	ESPMCS
chr1_1757074_G_T_b38	SLC35E2	6.225	1.15e-09	0.074291	80	0.011934	yes	ESPMCS
chr1_1743851_C_T_b38	SLC35E2	-6.212	1.24e-09	-0.084286	41	0.013568	yes	ESPMCS
chr1_1737504_A_C_b38	SLC35E2	6.138	1.91e-09	0.068041	130	0.011084	yes	ESPMCS
chr1_1743565_ATAT_A_b38	SLC35E2	-6.09	2.52e-09	-0.069712	88	0.011447	yes	ESPMCS
chr1_1743840_T_C_b38	SLC35E2	-6.083	2.62e-09	-0.082529	41	0.013566	yes	ESPMCS
chr1_1751981_A_T_b38	SLC35E2	-6.064	2.93e-09	-0.083801	46	0.01382	yes	ESPMCS
chr1_1760882_T_C_b38	SLC35E2	5.995	4.33e-09	0.068771	101	0.011471	yes	ESPMCS
chr1_1750280_A_G_b38	SLC35E2	-5.991	4.43e-09	-0.070955	115	0.011843	yes	ESPMCS
chr1_1744052_GAGA_G_b38	SLC35E2	-5.954	5.49e-09	-0.087873	28	0.01476	yes	ESPMCS
chr1_1667424_T_TAAAATA_b38	SLC35E2	5.947	5.71e-09	0.073336	65	0.012332	yes	ESPMCS
chr1_1749637_G_T_b38	SLC35E2	5.946	5.74e-09	0.06889	87	0.011587	yes	ESPMCS
chr1_1781909_C_T_b38	SLC35E2	5.946	5.74e-09	0.069821	97	0.011744	yes	ESPMCS
chr1_1866635_T_TA_b38	SLC35E2	5.945	5.75e-09	0.07725	61	0.012993	yes	ESPMCS
chr1_1722690_TA_T_b38	SLC35E2	-5.919	6.68e-09	-0.109036	5	0.018422	yes	ESPMCS
chr1_1668721_C_T_b38	SLC35E2	-5.913	6.91e-09	-0.079263	35	0.013405	yes	ESPMCS
chr1_1922670_A_G_b38	SLC35E2	-5.886	8.04e-09	-0.068782	103	0.011687	yes	ESPMCS
chr1_1928648_C_T_b38	SLC35E2	-5.886	8.04e-09	-0.068782	103	0.011687	yes	ESPMCS
chr1_1755523_C_T_b38	SLC35E2	5.885	8.07e-09	0.068012	120	0.011557	yes	ESPMCS
chr1_1936077_C_T_b38	SLC35E2	-5.802	1.28e-08	-0.066576	114	0.011476	yes	ESPMCS
chr1_1732892_CT_C_b38	SLC35E2	5.758	1.63e-08	0.09676	9	0.016804	yes	ESPMCS
chr1_1762759_AAATG_A_b38	SLC35E2	5.747	1.73e-08	0.067849	99	0.011806	yes	ESPMCS
chr1_1661420_C_A_b38	SLC35E2	-5.727	1.94e-08	-0.072096	54	0.012589	yes	ESPMCS
chr1_1708474_C_A_b38	SLC35E2	-5.704	2.2e-08	-0.087433	18	0.01533	yes	ESPMCS
chr1_1659114_A_G_b38	SLC35E2	-5.693	2.33e-08	-0.071605	54	0.012578	yes	ESPMCS
chr1_1659220_A_G_b38	SLC35E2	-5.693	2.33e-08	-0.071605	54	0.012578	yes	ESPMCS
chr1_1750428_G_C_b38	SLC35E2	-5.687	2.4e-08	-0.076253	67	0.013408	yes	ESPMCS
chr1_1828894_T_TAC_b38	SLC35E2	5.673	2.6e-08	0.067066	91	0.011823	yes	ESPMCS
chr1_1650195_A_G_b38	SLC35E2	-5.658	2.81e-08	-0.072902	53	0.012884	yes	ESPMCS
chr1_1758323_T_C_b38	SLC35E2	5.657	2.83e-08	0.065372	94	0.011556	yes	ESPMCS
chr1_1750440_G_A_b38	SLC35E2	-5.653	2.9e-08	-0.075504	67	0.013357	yes	ESPMCS
chr1_1668108_C_T_b38	SLC35E2	5.647	2.99e-08	0.072329	51	0.012809	yes	ESPMCS
chr1_1660683_C_T_b38	SLC35E2	-5.64	3.1e-08	-0.075995	39	0.013473	yes	ESPMCS
chr1_1658866_G_A_b38	SLC35E2	-5.624	3.39e-08	-0.070515	55	0.012539	yes	ESPMCS
chr1_1921745_T_C_b38	SLC35E2	-5.578	4.33e-08	-0.065127	101	0.011675	yes	ESPMCS
chr1_1664757_T_C_b38	SLC35E2	-5.564	4.66e-08	-0.069433	51	0.012478	yes	ESPMCS
chr1_1664865_A_G_b38	SLC35E2	-5.559	4.78e-08	-0.069991	52	0.01259	yes	ESPMCS
chr1_1612562_T_TC_b38	SLC35E2	5.545	5.17e-08	0.066282	59	0.011954	yes	ESPMCS
chr1_1637577_T_C_b38	SLC35E2	-5.498	6.62e-08	-0.074241	35	0.013503	yes	ESPMCS
chr1_1630798_C_T_b38	SLC35E2	5.498	6.63e-08	0.069504	52	0.012642	yes	ESPMCS
chr1_1651137_C_T_b38	SLC35E2	-5.488	6.98e-08	-0.069747	51	0.012708	yes	ESPMCS
chr1_1651267_T_C_b38	SLC35E2	-5.488	6.98e-08	-0.069747	51	0.012708	yes	ESPMCS
chr1_1651574_G_A_b38	SLC35E2	-5.488	6.98e-08	-0.069747	51	0.012708	yes	ESPMCS
chr1_1651785_C_A_b38	SLC35E2	-5.488	6.98e-08	-0.069747	51	0.012708	yes	ESPMCS
chr1_1652135_C_G_b38	SLC35E2	-5.488	6.98e-08	-0.069747	51	0.012708	yes	ESPMCS
chr1_1652191_C_T_b38	SLC35E2	-5.488	6.98e-08	-0.069747	51	0.012708	yes	ESPMCS
chr1_1652592_A_G_b38	SLC35E2	-5.488	6.98e-08	-0.069747	51	0.012708	yes	ESPMCS
chr1_1652779_A_G_b38	SLC35E2	-5.488	6.98e-08	-0.069747	51	0.012708	yes	ESPMCS
chr1_1653147_A_C_b38	SLC35E2	-5.488	6.98e-08	-0.069747	51	0.012708	yes	ESPMCS
chr1_1653396_T_C_b38	SLC35E2	-5.488	6.98e-08	-0.069747	51	0.012708	yes	ESPMCS
chr1_1653472_T_C_b38	SLC35E2	-5.488	6.98e-08	-0.069747	51	0.012708	yes	ESPMCS
chr1_1653811_G_A_b38	SLC35E2	-5.488	6.98e-08	-0.069747	51	0.012708	yes	ESPMCS
chr1_1653893_C_T_b38	SLC35E2	-5.488	6.98e-08	-0.069747	51	0.012708	yes	ESPMCS
chr1_1654143_G_A_b38	SLC35E2	-5.488	6.98e-08	-0.069747	51	0.012708	yes	ESPMCS
chr1_1937273_T_C_b38	SLC35E2	-5.468	7.78e-08	-0.064603	101	0.011815	yes	ESPMCS
chr1_1649993_A_G_b38	SLC35E2	-5.467	7.79e-08	-0.063575	122	0.011628	yes	ESPMCS
chr1_1650000_G_A_b38	SLC35E2	5.465	7.9e-08	0.066046	69	0.012086	yes	ESPMCS
chr1_1652061_T_C_b38	SLC35E2	-5.464	7.92e-08	-0.06942	52	0.012704	yes	ESPMCS
chr1_1654188_T_G_b38	SLC35E2	-5.464	7.92e-08	-0.06942	52	0.012704	yes	ESPMCS
chr1_1650777_G_A_b38	SLC35E2	-5.452	8.47e-08	-0.069167	51	0.012688	yes	ESPMCS
chr1_1904424_A_AAAATAAATAAAT_b38	SLC35E2	5.427	9.64e-08	0.059264	84	0.01092	yes	ESPMCS
chr1_1613769_C_T_b38	SLC35E2	5.413	1.04e-07	0.06948	51	0.012836	yes	ESPMCS
chr1_1651926_T_C_b38	SLC35E2	-5.394	1.15e-07	-0.068596	51	0.012717	yes	ESPMCS
chr1_1659060_G_A_b38	SLC35E2	-5.385	1.2e-07	-0.071122	41	0.013207	yes	ESPMCS
chr1_1651421_GTAGCCCCTCTGAACGGTCTGTGACACACGCATGCTTTCAGCTAGAGTACTCTA_G_b38	SLC35E2	-5.383	1.21e-07	-0.068796	49	0.012781	yes	ESPMCS
chr1_1918989_A_G_b38	SLC35E2	-5.353	1.42e-07	-0.062383	103	0.011654	yes	ESPMCS
chr1_1653934_G_A_b38	SLC35E2	-5.342	1.5e-07	-0.068136	51	0.012754	yes	ESPMCS
chr1_1750508_A_C_b38	SLC35E2	-5.321	1.67e-07	-0.056282	112	0.010577	yes	ESPMCS
chr1_1648826_A_G_b38	SLC35E2	-5.319	1.69e-07	-0.06878	59	0.012932	yes	ESPMCS
chr1_1648636_G_A_b38	SLC35E2	-5.288	1.98e-07	-0.068552	59	0.012963	yes	ESPMCS
chr1_1639348_G_T_b38	SLC35E2	-5.211	2.93e-07	-0.066704	59	0.0128	yes	ESPMCS
chr1_1629332_G_T_b38	SLC35E2	5.183	3.37e-07	0.066419	53	0.012814	yes	ESPMCS
chr1_1667424_T_TAAATA_b38	SLC35E2	-5.173	3.56e-07	-0.062164	78	0.012017	yes	ESPMCS
chr1_1652913_C_T_b38	SLC35E2	-5.167	3.67e-07	-0.069174	39	0.013389	yes	ESPMCS
chr1_1936906_CA_C_b38	SLC35E2	5.027	7.35e-07	0.074702	14	0.01486	yes	ESPMCS
chr1_1708521_C_G_b38	SLC35E2	-4.984	9.09e-07	-0.069455	32	0.013936	yes	ESPMCS
chr1_1792696_C_CA_b38	SLC35E2	4.948	1.08e-06	0.062894	54	0.012711	yes	ESPMCS
chr1_1729859_A_G_b38	SLC35E2	4.892	1.42e-06	0.075645	17	0.015464	yes	ESPMCS
chr1_1750528_G_A_b38	SLC35E2	-4.86	1.66e-06	-0.052535	106	0.01081	yes	ESPMCS
chr1_1621352_G_A_b38	SLC35E2	4.853	1.71e-06	0.060435	57	0.012453	yes	ESPMCS
chr1_1641275_A_G_b38	SLC35E2	-4.834	1.87e-06	-0.062627	56	0.012956	yes	ESPMCS
chr1_1742432_TA_T_b38	SLC35E2	-4.823	1.98e-06	-0.063582	55	0.013184	yes	ESPMCS
chr1_1728671_C_A_b38	SLC35E2	4.807	2.13e-06	0.076287	19	0.015871	yes	ESPMCS
chr1_1584321_T_C_b38	SLC35E2	-4.796	2.24e-06	-0.059637	77	0.012435	yes	ESPMCS
chr1_1742468_G_C_b38	SLC35E2	4.79	2.31e-06	0.056388	126	0.011773	yes	ESPMCS
chr1_1620609_G_A_b38	SLC35E2	4.758	2.69e-06	0.05903	56	0.012407	yes	ESPMCS
chr1_1735008_G_GTTTT_b38	SLC35E2	4.743	2.88e-06	0.053432	124	0.011265	yes	ESPMCS
chr1_1851414_GA_G_b38	SLC35E2	-4.675	3.95e-06	-0.060278	62	0.012893	yes	ESPMCS
chr1_1589495_CTTT_C_b38	SLC35E2	4.652	4.4e-06	0.064839	38	0.013939	yes	ESPMCS
chr1_1695459_A_G_b38	SLC35E2	4.639	4.67e-06	0.065834	85	0.014192	yes	ESPMCS
chr1_1731904_CA_C_b38	SLC35E2	4.622	5.04e-06	0.063346	44	0.013705	yes	ESPMCS
chr1_1769969_CAAAACA_C_b38	SLC35E2	4.595	5.72e-06	0.054606	91	0.011885	yes	ESPMCS
chr1_1924264_CCG_C_b38	SLC35E2	-4.592	5.79e-06	-0.053876	117	0.011733	yes	ESPMCS
chr1_1924269_C_T_b38	SLC35E2	-4.573	6.31e-06	-0.053217	118	0.011637	yes	ESPMCS
chr1_1622295_G_C_b38	SLC35E2	4.562	6.63e-06	0.056714	56	0.012431	yes	ESPMCS
chr1_1586962_C_T_b38	SLC35E2	4.507	8.49e-06	0.057649	58	0.01279	yes	ESPMCS
chr1_1801188_T_C_b38	SLC35E2	4.498	8.86e-06	0.068023	16	0.015123	yes	ESPMCS
chr1_1650383_G_T_b38	SLC35E2	-4.452	1.09e-05	-0.060279	40	0.01354	yes	ESPMCS
chr1_1717507_T_C_b38	SLC35E2	4.431	1.19e-05	0.083153	18	0.018764	yes	ESPMCS
chr1_1950071_C_A_b38	SLC35E2	4.404	1.35e-05	0.059619	33	0.013537	yes	ESPMCS
chr1_1600379_C_T_b38	SLC35E2	4.38	1.5e-05	0.055046	53	0.012567	yes	ESPMCS
chr1_1845840_C_G_b38	SLC35E2	4.366	1.59e-05	0.072788	7	0.016672	yes	ESPMCS
chr1_1708951_C_T_b38	SLC35E2	4.355	1.67e-05	0.053669	89	0.012324	yes	ESPMCS
chr1_1951642_C_T_b38	SLC35E2	4.343	1.76e-05	0.059112	32	0.013612	yes	ESPMCS
chr1_1951498_C_T_b38	SLC35E2	4.33	1.86e-05	0.058926	32	0.013608	yes	ESPMCS
chr1_1722626_AGCG_A_b38	SLC35E2	4.318	1.96e-05	0.067692	36	0.015677	yes	ESPMCS
chr1_1948919_T_TCCTTCCCTCCTCTTTCCCTCCCTTCTTTCCTTCCCTTTCCCTCCCTC_b38	SLC35E2	-4.258	2.54e-05	-0.045305	101	0.010639	yes	ESPMCS
chr1_1947648_G_A_b38	SLC35E2	4.255	2.57e-05	0.059659	25	0.014021	yes	ESPMCS
chr1_1607931_G_A_b38	SLC35E2	4.235	2.81e-05	0.052952	54	0.012504	yes	ESPMCS
chr1_1609058_G_A_b38	SLC35E2	4.235	2.81e-05	0.052952	54	0.012504	yes	ESPMCS
chr1_1931743_CA_C_b38	SLC35E2	-4.232	2.84e-05	-0.061906	38	0.014628	yes	ESPMCS
chr1_1960609_G_C_b38	SLC35E2	-4.224	2.94e-05	-0.049728	95	0.011774	yes	ESPMCS
chr1_1722625_A_T_b38	SLC35E2	4.212	3.09e-05	0.066515	36	0.015791	yes	ESPMCS
chr1_1714674_G_C_b38	SLC35E2	4.2	3.26e-05	0.074032	34	0.017628	yes	ESPMCS
chr1_1657926_A_AG_b38	SLC35E2	-4.157	3.91e-05	-0.065035	21	0.015646	yes	ESPMCS
chr1_1606384_A_G_b38	SLC35E2	4.134	4.29e-05	0.05146	60	0.012448	yes	ESPMCS
chr1_1837255_A_AT_b38	SLC35E2	4.104	4.87e-05	0.063701	16	0.015522	yes	ESPMCS
chr1_1942186_G_A_b38	SLC35E2	4.083	5.32e-05	0.056814	25	0.013916	yes	ESPMCS
chr1_1904424_A_AAAATAAAT_b38	SLC35E2	-4.066	5.71e-05	-0.046017	116	0.011319	yes	ESPMCS
chr1_1955420_C_T_b38	SLC35E2	4.043	6.26e-05	0.055193	30	0.013651	yes	ESPMCS
chr1_1981144_T_G_b38	SLC35E2	4.037	6.43e-05	0.056822	29	0.014076	yes	ESPMCS
chr1_1798925_C_CT_b38	SLC35E2	-3.974	8.3e-05	-0.050832	46	0.012791	yes	ESPMCS
chr1_1595028_C_CAG_b38	SLC35E2	3.956	8.93e-05	0.055665	34	0.014071	yes	ESPMCS
chr1_1836856_CT_C_b38	SLC35E2	3.948	9.21e-05	0.061584	24	0.015597	yes	ESPMCS
chr1_1702383_T_C_b38	SLC35E2	-3.938	9.59e-05	-0.056201	26	0.014271	yes	ESPMCS
chr1_1938467_C_T_b38	SLC35E2	3.934	9.76e-05	0.054945	25	0.013967	yes	ESPMCS
chr1_1927692_C_T_b38	SLC35E2	3.921	0.000103	0.054969	24	0.014019	yes	ESPMCS
chr1_1929713_G_A_b38	SLC35E2	3.917	0.000104	0.054713	25	0.013967	yes	ESPMCS
chr1_1679993_A_G_b38	SLC35E2	-3.908	0.000108	-0.047759	109	0.012219	yes	ESPMCS
chr1_1932079_AC_A_b38	SLC35E2	-3.907	0.000109	-0.049471	67	0.012662	yes	ESPMCS
chr1_1948938_C_T_b38	SLC35E2	-3.907	0.000109	-0.042248	102	0.010814	yes	ESPMCS
chr1_1976855_C_CTT_b38	SLC35E2	3.9	0.000112	0.05676	23	0.014555	yes	ESPMCS
chr1_1937046_G_A_b38	SLC35E2	3.888	0.000117	0.060202	16	0.015484	yes	ESPMCS
chr1_1814815_A_AG_b38	SLC35E2	-3.866	0.000128	-0.055957	40	0.014475	yes	ESPMCS
chr1_1722619_C_T_b38	SLC35E2	3.828	0.000149	0.060114	39	0.015704	yes	ESPMCS
chr1_1924659_C_T_b38	SLC35E2	3.808	0.00016	0.052143	38	0.013692	yes	ESPMCS
chr1_1971127_G_A_b38	SLC35E2	3.797	0.000168	0.051777	31	0.013635	yes	ESPMCS
chr1_1948037_T_A_b38	SLC35E2	3.796	0.000169	0.058619	16	0.015443	yes	ESPMCS
chr1_1921849_G_T_b38	SLC35E2	3.794	0.00017	0.050852	40	0.013403	yes	ESPMCS
chr1_1697979_G_A_b38	SLC35E2	-3.794	0.00017	-0.072042	4	0.01899	yes	ESPMCS
chr1_1635226_T_C_b38	SLC35E2	-3.782	0.000177	-0.064453	11	0.01704	yes	ESPMCS
chr1_1688328_C_T_b38	SLC35E2	-3.781	0.000178	-0.053261	27	0.014086	yes	ESPMCS
chr1_1956754_C_A_b38	SLC35E2	3.779	0.00018	0.051692	30	0.013679	yes	ESPMCS
chr1_1938221_TCA_T_b38	SLC35E2	3.773	0.000184	0.052954	25	0.014035	yes	ESPMCS
chr1_1955652_CG_C_b38	SLC35E2	3.755	0.000197	0.052077	28	0.013869	yes	ESPMCS
chr1_1932396_CA_C_b38	SLC35E2	3.751	0.000201	0.059393	11	0.015834	yes	ESPMCS
chr1_1697272_G_A_b38	SLC35E2	3.751	0.000201	0.072697	28	0.019382	yes	ESPMCS
chr1_1907077_C_A_b38	SLC35E2	3.742	0.000208	0.054426	24	0.014545	yes	ESPMCS
chr1_1855321_C_CA_b38	SLC35E2	3.733	0.000215	0.059175	18	0.015852	yes	ESPMCS
chr1_1650664_CTTTTT_C_b38	SLC35E2	-3.727	0.00022	-0.052761	32	0.014156	yes	ESPMCS
chr1_1688586_C_T_b38	SLC35E2	-3.711	0.000234	-0.056029	35	0.015099	yes	ESPMCS
chr1_1955672_GC_G_b38	SLC35E2	3.688	0.000255	0.050803	29	0.013774	yes	ESPMCS
chr1_1955806_G_A_b38	SLC35E2	3.684	0.00026	0.05114	27	0.013883	yes	ESPMCS
chr1_1971434_C_T_b38	SLC35E2	3.659	0.000284	0.049717	32	0.013586	yes	ESPMCS
chr1_1971027_A_C_b38	SLC35E2	3.645	0.000301	0.049794	31	0.013661	yes	ESPMCS
chr1_1971123_A_G_b38	SLC35E2	3.64	0.000306	0.049016	33	0.013466	yes	ESPMCS
chr1_1987547_C_CT_b38	SLC35E2	3.633	0.000314	0.047466	89	0.013066	yes	ESPMCS
chr1_1688442_T_C_b38	SLC35E2	-3.604	0.00035	-0.051729	43	0.014354	yes	ESPMCS
chr1_1680672_C_T_b38	SLC35E2	-3.6	0.000356	-0.046039	90	0.012789	yes	ESPMCS
chr1_1688619_AAAC_A_b38	SLC35E2	-3.595	0.000363	-0.052741	41	0.014671	yes	ESPMCS
chr1_1928119_T_C_b38	SLC35E2	3.59	0.000369	0.050683	24	0.014116	yes	ESPMCS
chr1_1948594_G_GTTT_b38	SLC35E2	-3.576	0.000389	-0.102174	6	0.028572	yes	ESPMCS
chr1_1687153_A_G_b38	SLC35E2	-3.573	0.000394	-0.043447	98	0.012161	yes	ESPMCS
chr1_1903603_G_A_b38	SLC35E2	3.572	0.000394	0.050236	25	0.014062	yes	ESPMCS
chr1_1903617_C_T_b38	SLC35E2	3.572	0.000394	0.050236	25	0.014062	yes	ESPMCS
chr1_1915022_C_T_b38	SLC35E2	3.562	0.000409	0.04908	29	0.013778	yes	ESPMCS
chr1_1687734_CAA_C_b38	SLC35E2	-3.557	0.000418	-0.046698	61	0.01313	yes	ESPMCS
chr1_1683909_A_C_b38	SLC35E2	-3.54	0.000444	-0.04329	101	0.012229	yes	ESPMCS
chr1_1688647_G_A_b38	SLC35E2	-3.537	0.000449	-0.051091	45	0.014444	yes	ESPMCS
chr1_1978429_G_A_b38	SLC35E2	3.526	0.000468	0.047628	34	0.013508	yes	ESPMCS
chr1_1900918_G_A_b38	SLC35E2	3.523	0.000473	0.048869	27	0.013871	yes	ESPMCS
chr1_1918697_C_T_b38	SLC35E2	3.52	0.000478	0.047719	41	0.013557	yes	ESPMCS
chr1_1983507_C_T_b38	SLC35E2	3.516	0.000486	0.04748	34	0.013505	yes	ESPMCS
chr1_1897325_G_A_b38	SLC35E2	3.506	0.000503	0.051502	19	0.014688	yes	ESPMCS
chr1_1810086_A_G_b38	SLC35E2	3.502	0.000511	0.053316	19	0.015226	yes	ESPMCS
chr1_1698048_T_C_b38	SLC35E2	-3.5	0.000514	-0.099131	5	0.028321	yes	ESPMCS
chr1_1884183_G_A_b38	SLC35E2	3.499	0.000515	0.048737	30	0.013927	yes	ESPMCS
chr1_1606532_GTGGGCTGGGCTGGTCAGGCA_G_b38	SLC35E2	3.481	0.000552	0.043799	48	0.012584	yes	ESPMCS
chr1_1907199_A_G_b38	SLC35E2	3.479	0.000554	0.048007	28	0.013797	yes	ESPMCS
chr1_1877316_A_T_b38	SLC35E2	3.475	0.000563	0.044895	63	0.012919	yes	ESPMCS
chr1_1791389_G_A_b38	SLC35E2	3.475	0.000564	0.051358	22	0.01478	yes	ESPMCS
chr1_1897682_CA_C_b38	SLC35E2	3.468	0.000578	0.052312	15	0.015086	yes	ESPMCS
chr1_898676_A_C_b38	SLC35E2	-3.46	0.000595	-0.089046	11	0.025738	yes	ESPMCS
chr1_899257_AC_A_b38	SLC35E2	-3.46	0.000595	-0.089046	11	0.025738	yes	ESPMCS
chr1_1956891_C_T_b38	SLC35E2	3.45	0.000617	0.045837	37	0.013288	yes	ESPMCS
chr1_1840233_GA_G_b38	SLC35E2	3.431	0.000661	0.05041	18	0.014694	yes	ESPMCS
chr1_1634406_C_G_b38	SLC35E2	-3.426	0.000673	-0.091968	4	0.026847	yes	ESPMCS
chr1_899576_G_A_b38	SLC35E2	-3.425	0.000673	-0.090774	8	0.0265	yes	ESPMCS
chr1_806017_A_G_b38	SLC35E2	-3.394	0.000754	-0.092729	11	0.027323	yes	ESPMCS
chr1_1687643_G_A_b38	SLC35E2	-3.388	0.000769	-0.041104	93	0.012132	yes	ESPMCS
chr1_1957014_G_A_b38	SLC35E2	3.386	0.000774	0.044888	37	0.013256	yes	ESPMCS
chr1_1957636_C_T_b38	SLC35E2	3.386	0.000774	0.044888	37	0.013256	yes	ESPMCS
chr1_1976870_C_CAG_b38	SLC35E2	3.371	0.000817	0.042773	46	0.012688	yes	ESPMCS
chr1_1687061_C_T_b38	SLC35E2	-3.361	0.000848	-0.040541	92	0.012064	yes	ESPMCS
chr1_1679100_A_G_b38	SLC35E2	-3.357	0.000859	-0.042096	80	0.01254	yes	ESPMCS
chr1_1818305_T_TA_b38	SLC35E2	-3.351	0.000879	-0.042223	64	0.012602	yes	ESPMCS
chr1_1952590_A_AAAAG_b38	SLC35E2	3.317	0.000987	0.044312	40	0.013358	yes	ESPMCS
chr1_1802763_T_TAA_b38	SLC35E2	3.316	0.00099	0.050672	17	0.01528	yes	ESPMCS
chr1_1502507_A_AT_b38	SLC35E2	3.3	0.00105	0.129038	3	0.039097	yes	ESPMCS
chr1_1739519_C_G_b38	SLC35E2	3.298	0.00106	0.049058	35	0.014876	yes	ESPMCS
chr1_1906439_C_T_b38	SLC35E2	3.294	0.00107	0.044514	32	0.013514	yes	ESPMCS
chr1_1734308_T_C_b38	SLC35E2	3.29	0.00109	0.063674	15	0.019354	yes	ESPMCS
chr1_1688457_G_A_b38	SLC35E2	-3.286	0.0011	-0.048115	44	0.014641	yes	ESPMCS
chr1_1686017_A_AT_b38	SLC35E2	-3.277	0.00113	-0.039422	93	0.012029	yes	ESPMCS
chr1_1967980_A_AAGAATGAG_b38	SLC35E2	3.272	0.00115	0.045334	28	0.013854	yes	ESPMCS
chr1_1687159_G_T_b38	SLC35E2	-3.267	0.00117	-0.03952	91	0.012096	yes	ESPMCS
chr1_1909237_G_T_b38	SLC35E2	3.265	0.00118	0.044488	32	0.013626	yes	ESPMCS
chr1_1978647_G_T_b38	SLC35E2	3.262	0.00119	0.04181	47	0.012817	yes	ESPMCS
chr1_1849992_T_TG_b38	SLC35E2	3.261	0.0012	0.05163	14	0.015832	yes	ESPMCS
chr1_1885444_TTAGA_T_b38	SLC35E2	3.254	0.00123	0.045304	28	0.013924	yes	ESPMCS
chr1_1597128_C_CCCTCAGCTGGACT_b38	SLC35E2	-3.243	0.00127	-0.039476	76	0.012171	yes	ESPMCS
chr1_1978114_T_A_b38	SLC35E2	3.242	0.00128	0.041628	47	0.01284	yes	ESPMCS
chr1_1968103_A_ATGAG_b38	SLC35E2	3.234	0.00132	0.044661	29	0.013812	yes	ESPMCS
chr1_1686321_CTTT_C_b38	SLC35E2	-3.227	0.00135	-0.044756	37	0.013871	yes	ESPMCS
chr1_1972273_C_A_b38	SLC35E2	3.224	0.00136	0.041839	44	0.012977	yes	ESPMCS
chr1_1845824_TACACACACACACACACACACACACACACAC_T_b38	SLC35E2	3.222	0.00137	0.044919	32	0.01394	yes	ESPMCS
chr1_1864337_G_A_b38	SLC35E2	-3.22	0.00138	-0.042819	42	0.013296	yes	ESPMCS
chr1_1896396_CT_C_b38	SLC35E2	3.215	0.0014	0.051353	11	0.01597	yes	ESPMCS
chr1_1968012_GTGAA_G_b38	SLC35E2	3.215	0.0014	0.04401	30	0.013687	yes	ESPMCS
chr1_1769737_GA_G_b38	SLC35E2	3.213	0.00141	0.047417	20	0.014758	yes	ESPMCS
chr1_1684266_T_C_b38	SLC35E2	-3.212	0.00142	-0.038989	91	0.012138	yes	ESPMCS
chr1_901812_A_G_b38	SLC35E2	-3.199	0.00148	-0.068286	16	0.021347	yes	ESPMCS
chr1_1976646_A_G_b38	SLC35E2	3.191	0.00152	0.041206	45	0.012911	yes	ESPMCS
chr1_1977879_G_A_b38	SLC35E2	3.19	0.00153	0.040882	47	0.012816	yes	ESPMCS
chr1_1978006_A_G_b38	SLC35E2	3.19	0.00153	0.040882	47	0.012816	yes	ESPMCS
chr1_1978562_C_G_b38	SLC35E2	3.181	0.00158	0.040351	49	0.012685	yes	ESPMCS
chr1_1978573_T_C_b38	SLC35E2	3.181	0.00158	0.040351	49	0.012685	yes	ESPMCS
chr1_1686147_T_G_b38	SLC35E2	-3.173	0.00162	-0.039435	83	0.012429	yes	ESPMCS
chr1_1688531_T_C_b38	SLC35E2	-3.17	0.00163	-0.049778	29	0.015702	yes	ESPMCS
chr1_1688786_G_A_b38	SLC35E2	-3.168	0.00164	-0.051497	23	0.016253	yes	ESPMCS
chr1_1986211_T_C_b38	SLC35E2	3.165	0.00166	0.040821	46	0.012899	yes	ESPMCS
chr1_1955580_A_G_b38	SLC35E2	-3.164	0.00167	-0.052387	8	0.016558	yes	ESPMCS
chr1_1976990_T_C_b38	SLC35E2	3.163	0.00167	0.040325	48	0.01275	yes	ESPMCS
chr1_1978055_C_T_b38	SLC35E2	3.162	0.00168	0.04067	46	0.012864	yes	ESPMCS
chr1_1978404_C_T_b38	SLC35E2	3.161	0.00169	0.040705	46	0.012879	yes	ESPMCS
chr1_1978415_G_A_b38	SLC35E2	3.161	0.00169	0.040705	46	0.012879	yes	ESPMCS
chr1_1976473_C_T_b38	SLC35E2	3.158	0.0017	0.04066	46	0.012876	yes	ESPMCS
chr1_1976573_T_C_b38	SLC35E2	3.158	0.0017	0.04066	46	0.012876	yes	ESPMCS
chr1_1976600_C_T_b38	SLC35E2	3.158	0.0017	0.04066	46	0.012876	yes	ESPMCS
chr1_1976661_G_T_b38	SLC35E2	3.158	0.0017	0.04066	46	0.012876	yes	ESPMCS
chr1_1976946_C_T_b38	SLC35E2	3.158	0.0017	0.04066	46	0.012876	yes	ESPMCS
chr1_1977264_C_G_b38	SLC35E2	3.158	0.0017	0.04066	46	0.012876	yes	ESPMCS
chr1_1977765_A_G_b38	SLC35E2	3.158	0.0017	0.04066	46	0.012876	yes	ESPMCS
chr1_1980953_G_A_b38	SLC35E2	3.158	0.0017	0.04066	46	0.012876	yes	ESPMCS
chr1_1981319_G_C_b38	SLC35E2	3.158	0.0017	0.04066	46	0.012876	yes	ESPMCS
chr1_1986033_G_A_b38	SLC35E2	3.158	0.0017	0.04066	46	0.012876	yes	ESPMCS
chr1_1986176_A_T_b38	SLC35E2	3.158	0.0017	0.04066	46	0.012876	yes	ESPMCS
chr1_1986390_T_G_b38	SLC35E2	3.158	0.0017	0.04066	46	0.012876	yes	ESPMCS
chr1_1986469_A_C_b38	SLC35E2	3.158	0.0017	0.04066	46	0.012876	yes	ESPMCS
chr1_1987096_A_T_b38	SLC35E2	3.158	0.0017	0.04066	46	0.012876	yes	ESPMCS
chr1_1987156_G_A_b38	SLC35E2	3.158	0.0017	0.04066	46	0.012876	yes	ESPMCS
chr1_1954906_C_CA_b38	SLC35E2	3.158	0.0017	0.04114	52	0.013029	yes	ESPMCS
chr1_1954907_G_GCC_b38	SLC35E2	3.158	0.0017	0.04114	52	0.013029	yes	ESPMCS
chr1_1983166_A_T_b38	SLC35E2	3.157	0.00171	0.040713	46	0.012898	yes	ESPMCS
chr1_1983956_TGG_T_b38	SLC35E2	3.157	0.00171	0.040713	46	0.012898	yes	ESPMCS
chr1_1984859_C_T_b38	SLC35E2	3.157	0.00171	0.040713	46	0.012898	yes	ESPMCS
chr1_1985148_G_T_b38	SLC35E2	3.157	0.00171	0.040713	46	0.012898	yes	ESPMCS
chr1_1965001_G_A_b38	SLC35E2	3.154	0.00172	0.043025	31	0.013641	yes	ESPMCS
chr1_1963738_C_T_b38	SLC35E2	3.144	0.00178	0.04353	28	0.013846	yes	ESPMCS
chr1_1965114_C_T_b38	SLC35E2	3.144	0.00178	0.04353	28	0.013846	yes	ESPMCS
chr1_1966910_C_T_b38	SLC35E2	3.144	0.00178	0.04353	28	0.013846	yes	ESPMCS
chr1_1627515_C_T_b38	SLC35E2	3.14	0.00181	0.037589	96	0.011972	yes	ESPMCS
chr1_1984595_C_T_b38	SLC35E2	3.125	0.0019	0.040159	47	0.012852	yes	ESPMCS
chr1_1954781_C_T_b38	SLC35E2	3.122	0.00192	0.041074	47	0.013157	yes	ESPMCS
chr1_1964663_G_A_b38	SLC35E2	3.119	0.00194	0.043016	29	0.01379	yes	ESPMCS
chr1_1965250_G_GA_b38	SLC35E2	3.116	0.00195	0.042313	32	0.013578	yes	ESPMCS
chr1_1902056_G_A_b38	SLC35E2	3.104	0.00204	0.042403	31	0.013662	yes	ESPMCS
chr1_1888667_A_C_b38	SLC35E2	3.102	0.00205	0.043395	27	0.013989	yes	ESPMCS
chr1_1805214_T_G_b38	SLC35E2	3.102	0.00205	0.043642	26	0.014071	yes	ESPMCS
chr1_1834655_A_C_b38	SLC35E2	3.102	0.00205	0.043642	26	0.014071	yes	ESPMCS
chr1_1984601_T_C_b38	SLC35E2	3.099	0.00207	0.039548	48	0.01276	yes	ESPMCS
chr1_1963406_G_A_b38	SLC35E2	3.098	0.00208	0.042752	29	0.013802	yes	ESPMCS
chr1_1949125_T_TTCCC_b38	SLC35E2	3.097	0.00208	0.052935	13	0.01709	yes	ESPMCS
chr1_1838449_C_CT_b38	SLC35E2	3.094	0.0021	0.044772	21	0.014469	yes	ESPMCS
chr1_1226892_C_T_b38	SLC35E2	-3.092	0.00212	-0.061799	5	0.019986	yes	ESPMCS
chr1_1954765_A_AGAGT_b38	SLC35E2	3.091	0.00213	0.040544	48	0.013117	yes	ESPMCS
chr1_1978262_C_T_b38	SLC35E2	3.086	0.00216	0.03932	48	0.012742	yes	ESPMCS
chr1_1978294_G_T_b38	SLC35E2	3.086	0.00216	0.03932	48	0.012742	yes	ESPMCS
chr1_1985619_A_G_b38	SLC35E2	3.084	0.00218	0.039613	59	0.012846	yes	ESPMCS
chr1_1966152_C_T_b38	SLC35E2	3.081	0.00219	0.042529	29	0.013802	yes	ESPMCS
chr1_1955061_GCGGCTC_G_b38	SLC35E2	3.081	0.0022	0.039754	52	0.012905	yes	ESPMCS
chr1_1955068_ACACCGGAAGTGC_A_b38	SLC35E2	3.081	0.0022	0.039754	52	0.012905	yes	ESPMCS
chr1_1978797_T_C_b38	SLC35E2	3.078	0.00222	0.039226	48	0.012745	yes	ESPMCS
chr1_1986010_T_G_b38	SLC35E2	3.078	0.00222	0.039226	48	0.012745	yes	ESPMCS
chr1_1715553_G_A_b38	SLC35E2	3.078	0.00222	0.060304	34	0.019594	yes	ESPMCS
chr1_1982826_T_C_b38	SLC35E2	3.076	0.00223	0.039268	48	0.012765	yes	ESPMCS
chr1_1984586_G_A_b38	SLC35E2	3.076	0.00223	0.039268	48	0.012765	yes	ESPMCS
chr1_1680214_T_C_b38	SLC35E2	-3.074	0.00225	-0.037266	95	0.012122	yes	ESPMCS
chr1_1964101_A_G_b38	SLC35E2	3.07	0.00228	0.042309	29	0.013782	yes	ESPMCS
chr1_1964746_T_C_b38	SLC35E2	3.07	0.00228	0.042309	29	0.013782	yes	ESPMCS
chr1_1964784_C_T_b38	SLC35E2	3.07	0.00228	0.042309	29	0.013782	yes	ESPMCS
chr1_1966030_A_G_b38	SLC35E2	3.07	0.00228	0.042309	29	0.013782	yes	ESPMCS
chr1_1966314_C_G_b38	SLC35E2	3.07	0.00228	0.042309	29	0.013782	yes	ESPMCS
chr1_1966930_G_A_b38	SLC35E2	3.07	0.00228	0.042309	29	0.013782	yes	ESPMCS
chr1_1967246_T_C_b38	SLC35E2	3.07	0.00228	0.042309	29	0.013782	yes	ESPMCS
chr1_1967338_G_C_b38	SLC35E2	3.07	0.00228	0.042309	29	0.013782	yes	ESPMCS
chr1_1967340_C_A_b38	SLC35E2	3.07	0.00228	0.042309	29	0.013782	yes	ESPMCS
chr1_1967389_T_C_b38	SLC35E2	3.07	0.00228	0.042309	29	0.013782	yes	ESPMCS
chr1_1967396_C_A_b38	SLC35E2	3.07	0.00228	0.042309	29	0.013782	yes	ESPMCS
chr1_1967420_G_A_b38	SLC35E2	3.07	0.00228	0.042309	29	0.013782	yes	ESPMCS
chr1_1967495_T_C_b38	SLC35E2	3.07	0.00228	0.042309	29	0.013782	yes	ESPMCS
chr1_1967536_G_A_b38	SLC35E2	3.07	0.00228	0.042309	29	0.013782	yes	ESPMCS
chr1_1967725_G_C_b38	SLC35E2	3.07	0.00228	0.042309	29	0.013782	yes	ESPMCS
chr1_1967840_A_T_b38	SLC35E2	3.07	0.00228	0.042309	29	0.013782	yes	ESPMCS
chr1_1967880_T_C_b38	SLC35E2	3.07	0.00228	0.042309	29	0.013782	yes	ESPMCS
chr1_1968422_C_T_b38	SLC35E2	3.07	0.00228	0.042309	29	0.013782	yes	ESPMCS
chr1_1968667_T_TCTC_b38	SLC35E2	3.07	0.00228	0.042309	29	0.013782	yes	ESPMCS
chr1_1968585_TG_T_b38	SLC35E2	3.068	0.00229	0.041948	30	0.013674	yes	ESPMCS
chr1_1794321_C_T_b38	SLC35E2	3.057	0.00238	0.043146	26	0.014116	yes	ESPMCS
chr1_1968130_GTGAA_G_b38	SLC35E2	3.053	0.00241	0.042372	28	0.013879	yes	ESPMCS
chr1_1782430_T_G_b38	SLC35E2	3.032	0.00258	0.042455	27	0.014003	yes	ESPMCS
chr1_1226936_G_T_b38	SLC35E2	-3.028	0.00261	-0.062643	5	0.020689	yes	ESPMCS
chr1_1969235_A_G_b38	SLC35E2	3.017	0.0027	0.04375	23	0.0145	yes	ESPMCS
chr1_1842237_T_C_b38	SLC35E2	3.016	0.00272	0.041623	32	0.013801	yes	ESPMCS
chr1_1953296_CTT_C_b38	SLC35E2	-3.006	0.0028	-0.069979	5	0.023276	yes	ESPMCS
chr1_1594890_G_GAC_b38	SLC35E2	-3.003	0.00283	-0.036617	98	0.012193	yes	ESPMCS
chr1_1890186_G_A_b38	SLC35E2	2.996	0.00289	0.04185	30	0.013967	yes	ESPMCS
chr1_1624323_AT_A_b38	SLC35E2	2.996	0.0029	0.036582	78	0.012211	yes	ESPMCS
chr1_1852145_G_A_b38	SLC35E2	2.995	0.0029	0.042369	26	0.014145	yes	ESPMCS
chr1_1991835_C_T_b38	SLC35E2	2.994	0.00291	0.03863	79	0.012902	yes	ESPMCS
chr1_1680556_A_G_b38	SLC35E2	-2.993	0.00292	-0.036394	95	0.01216	yes	ESPMCS
chr1_1780791_C_T_b38	SLC35E2	2.987	0.00298	0.041953	27	0.014047	yes	ESPMCS
chr1_1223568_A_G_b38	SLC35E2	-2.987	0.00298	-0.059245	6	0.019837	yes	ESPMCS
chr1_1223640_A_G_b38	SLC35E2	-2.985	0.003	-0.059723	5	0.020006	yes	ESPMCS
chr1_1223644_C_T_b38	SLC35E2	-2.985	0.003	-0.059723	5	0.020006	yes	ESPMCS
chr1_1950848_A_G_b38	SLC35E2	-2.983	0.00301	-0.050437	6	0.016906	yes	ESPMCS
chr1_1951510_A_G_b38	SLC35E2	-2.983	0.00301	-0.050437	6	0.016906	yes	ESPMCS
chr1_1951521_C_A_b38	SLC35E2	-2.983	0.00301	-0.050437	6	0.016906	yes	ESPMCS
chr1_1878070_C_T_b38	SLC35E2	2.982	0.00303	0.041746	27	0.013998	yes	ESPMCS
chr1_1881006_GGA_G_b38	SLC35E2	2.982	0.00303	0.041746	27	0.013998	yes	ESPMCS
chr1_1837455_C_T_b38	SLC35E2	2.982	0.00303	0.042471	25	0.014242	yes	ESPMCS
chr1_1851762_G_A_b38	SLC35E2	2.982	0.00303	0.042471	25	0.014242	yes	ESPMCS
chr1_1803531_C_T_b38	SLC35E2	2.969	0.00316	0.041743	29	0.014061	yes	ESPMCS
chr1_1830566_A_T_b38	SLC35E2	2.969	0.00316	0.041743	29	0.014061	yes	ESPMCS
chr1_1684817_G_C_b38	SLC35E2	-2.967	0.00318	-0.037833	78	0.012752	yes	ESPMCS
chr1_1808642_TTTTG_T_b38	SLC35E2	2.965	0.0032	0.041675	29	0.014055	yes	ESPMCS
chr1_1226620_G_GC_b38	SLC35E2	-2.949	0.00337	-0.058827	5	0.01995	yes	ESPMCS
chr1_1226901_G_A_b38	SLC35E2	-2.949	0.00337	-0.058827	5	0.01995	yes	ESPMCS
chr1_1891450_G_A_b38	SLC35E2	2.945	0.0034	0.040878	31	0.013879	yes	ESPMCS
chr1_1827615_G_A_b38	SLC35E2	2.942	0.00344	0.04174	25	0.014187	yes	ESPMCS
chr1_1954783_T_G_b38	SLC35E2	-2.942	0.00344	-0.049513	6	0.016832	yes	ESPMCS
chr1_1954946_T_C_b38	SLC35E2	-2.942	0.00344	-0.049513	6	0.016832	yes	ESPMCS
chr1_1949564_T_TG_b38	SLC35E2	-2.939	0.00347	-0.049877	6	0.016971	yes	ESPMCS
chr1_1934821_C_CGTTGTAGGTACGTGTGTACGTGGGTGTTAGGTTGTAGGTACACACGTGTATATGTGGGTGTTAG_b38	SLC35E2	-2.934	0.00352	-0.035442	58	0.012078	yes	ESPMCS
chr1_1834667_C_CT_b38	SLC35E2	-2.933	0.00354	-0.036025	70	0.012284	yes	ESPMCS
chr1_1681928_C_A_b38	SLC35E2	-2.931	0.00356	-0.036909	85	0.012592	yes	ESPMCS
chr1_1842333_G_A_b38	SLC35E2	2.929	0.00358	0.040995	30	0.013996	yes	ESPMCS
chr1_1958353_A_T_b38	SLC35E2	-2.926	0.00362	-0.049514	6	0.016921	yes	ESPMCS
chr1_1641342_C_A_b38	SLC35E2	-2.922	0.00366	-0.110282	4	0.037741	yes	ESPMCS
chr1_1869595_G_A_b38	SLC35E2	2.915	0.00375	0.041248	26	0.014153	yes	ESPMCS
chr1_1783572_C_A_b38	SLC35E2	2.912	0.00378	0.041271	26	0.014171	yes	ESPMCS
chr1_1221960_A_G_b38	SLC35E2	-2.909	0.00382	-0.058203	5	0.020009	yes	ESPMCS
chr1_1221992_G_A_b38	SLC35E2	-2.909	0.00382	-0.058203	5	0.020009	yes	ESPMCS
chr1_1222167_T_C_b38	SLC35E2	-2.909	0.00382	-0.058203	5	0.020009	yes	ESPMCS
chr1_1222184_G_A_b38	SLC35E2	-2.909	0.00382	-0.058203	5	0.020009	yes	ESPMCS
chr1_1222304_C_T_b38	SLC35E2	-2.909	0.00382	-0.058203	5	0.020009	yes	ESPMCS
chr1_1222325_C_G_b38	SLC35E2	-2.909	0.00382	-0.058203	5	0.020009	yes	ESPMCS
chr1_1222454_C_T_b38	SLC35E2	-2.909	0.00382	-0.058203	5	0.020009	yes	ESPMCS
chr1_1222482_C_T_b38	SLC35E2	-2.909	0.00382	-0.058203	5	0.020009	yes	ESPMCS
chr1_1222579_C_T_b38	SLC35E2	-2.909	0.00382	-0.058203	5	0.020009	yes	ESPMCS
chr1_1222580_T_C_b38	SLC35E2	-2.909	0.00382	-0.058203	5	0.020009	yes	ESPMCS
chr1_1222594_A_G_b38	SLC35E2	-2.909	0.00382	-0.058203	5	0.020009	yes	ESPMCS
chr1_1222611_G_A_b38	SLC35E2	-2.909	0.00382	-0.058203	5	0.020009	yes	ESPMCS
chr1_1222640_A_C_b38	SLC35E2	-2.909	0.00382	-0.058203	5	0.020009	yes	ESPMCS
chr1_1222897_G_A_b38	SLC35E2	-2.909	0.00382	-0.058203	5	0.020009	yes	ESPMCS
chr1_1222946_G_A_b38	SLC35E2	-2.909	0.00382	-0.058203	5	0.020009	yes	ESPMCS
chr1_1222977_A_G_b38	SLC35E2	-2.909	0.00382	-0.058203	5	0.020009	yes	ESPMCS
chr1_1223154_G_GAC_b38	SLC35E2	-2.909	0.00382	-0.058203	5	0.020009	yes	ESPMCS
chr1_1223182_AAC_A_b38	SLC35E2	-2.909	0.00382	-0.058203	5	0.020009	yes	ESPMCS
chr1_1223593_A_T_b38	SLC35E2	-2.909	0.00382	-0.058203	5	0.020009	yes	ESPMCS
chr1_1223595_A_C_b38	SLC35E2	-2.909	0.00382	-0.058203	5	0.020009	yes	ESPMCS
chr1_1223682_T_C_b38	SLC35E2	-2.909	0.00382	-0.058203	5	0.020009	yes	ESPMCS
chr1_1223727_G_A_b38	SLC35E2	-2.909	0.00382	-0.058203	5	0.020009	yes	ESPMCS
chr1_1224105_C_T_b38	SLC35E2	-2.909	0.00382	-0.058203	5	0.020009	yes	ESPMCS
chr1_1224349_T_G_b38	SLC35E2	-2.909	0.00382	-0.058203	5	0.020009	yes	ESPMCS
chr1_1224844_C_T_b38	SLC35E2	-2.909	0.00382	-0.058203	5	0.020009	yes	ESPMCS
chr1_1224846_A_G_b38	SLC35E2	-2.909	0.00382	-0.058203	5	0.020009	yes	ESPMCS
chr1_1225429_T_C_b38	SLC35E2	-2.909	0.00382	-0.058203	5	0.020009	yes	ESPMCS
chr1_1225720_CGCCACAGACACGGGCCACACACTCCACAT_C_b38	SLC35E2	-2.909	0.00382	-0.058203	5	0.020009	yes	ESPMCS
chr1_1225982_A_G_b38	SLC35E2	-2.909	0.00382	-0.058203	5	0.020009	yes	ESPMCS
chr1_1226261_G_A_b38	SLC35E2	-2.909	0.00382	-0.058203	5	0.020009	yes	ESPMCS
chr1_1226334_AC_A_b38	SLC35E2	-2.909	0.00382	-0.058203	5	0.020009	yes	ESPMCS
chr1_1226338_TGTACGGTCAGGAGGAAACATGGCACCTCCCCTCTGGGGGCTCTTTCCAGAAACCCTCAACCC_T_b38	SLC35E2	-2.909	0.00382	-0.058203	5	0.020009	yes	ESPMCS
chr1_1227161_G_C_b38	SLC35E2	-2.909	0.00382	-0.058203	5	0.020009	yes	ESPMCS
chr1_1227792_T_C_b38	SLC35E2	-2.909	0.00382	-0.058203	5	0.020009	yes	ESPMCS
chr1_1227975_T_C_b38	SLC35E2	-2.909	0.00382	-0.058203	5	0.020009	yes	ESPMCS
chr1_1229160_G_T_b38	SLC35E2	-2.909	0.00382	-0.058203	5	0.020009	yes	ESPMCS
chr1_1229307_G_C_b38	SLC35E2	-2.909	0.00382	-0.058203	5	0.020009	yes	ESPMCS
chr1_1229900_GCA_G_b38	SLC35E2	-2.909	0.00382	-0.058203	5	0.020009	yes	ESPMCS
chr1_1229940_CAT_C_b38	SLC35E2	-2.909	0.00382	-0.058203	5	0.020009	yes	ESPMCS
chr1_1229981_A_G_b38	SLC35E2	-2.909	0.00382	-0.058203	5	0.020009	yes	ESPMCS
chr1_1230091_T_C_b38	SLC35E2	-2.909	0.00382	-0.058203	5	0.020009	yes	ESPMCS
chr1_1230345_A_G_b38	SLC35E2	-2.909	0.00382	-0.058203	5	0.020009	yes	ESPMCS
chr1_1230441_T_C_b38	SLC35E2	-2.909	0.00382	-0.058203	5	0.020009	yes	ESPMCS
chr1_1230695_G_A_b38	SLC35E2	-2.909	0.00382	-0.058203	5	0.020009	yes	ESPMCS
chr1_1230797_G_C_b38	SLC35E2	-2.909	0.00382	-0.058203	5	0.020009	yes	ESPMCS
chr1_1230825_C_T_b38	SLC35E2	-2.909	0.00382	-0.058203	5	0.020009	yes	ESPMCS
chr1_1864350_C_T_b38	SLC35E2	2.904	0.00388	0.039961	31	0.013761	yes	ESPMCS
chr1_1873952_G_A_b38	SLC35E2	2.899	0.00393	0.04048	30	0.013962	yes	ESPMCS
chr1_1878651_C_T_b38	SLC35E2	2.899	0.00393	0.04048	30	0.013962	yes	ESPMCS
chr1_1663180_T_C_b38	SLC35E2	-2.898	0.00394	-0.046196	16	0.015938	yes	ESPMCS
chr1_1663182_C_A_b38	SLC35E2	-2.898	0.00394	-0.046196	16	0.015938	yes	ESPMCS
chr1_1839349_C_G_b38	SLC35E2	2.894	0.004	0.041049	28	0.014185	yes	ESPMCS
chr1_1839350_T_A_b38	SLC35E2	2.894	0.004	0.041049	28	0.014185	yes	ESPMCS
chr1_1851181_C_T_b38	SLC35E2	2.894	0.004	0.041049	28	0.014185	yes	ESPMCS
chr1_1227055_C_A_b38	SLC35E2	-2.894	0.004	-0.057613	5	0.01991	yes	ESPMCS
chr1_1742470_A_G_b38	SLC35E2	-2.893	0.00401	-0.061397	7	0.021222	yes	ESPMCS
chr1_1222251_G_A_b38	SLC35E2	-2.891	0.00403	-0.057633	5	0.019934	yes	ESPMCS
chr1_1969238_C_T_b38	SLC35E2	2.889	0.00406	0.041897	23	0.0145	yes	ESPMCS
chr1_1865951_T_A_b38	SLC35E2	2.887	0.00409	0.041316	25	0.014311	yes	ESPMCS
chr1_1861110_CA_C_b38	SLC35E2	2.887	0.00409	0.058335	5	0.020209	yes	ESPMCS
chr1_1957586_A_G_b38	SLC35E2	-2.885	0.00411	-0.047543	9	0.016477	yes	ESPMCS
chr1_812899_A_T_b38	SLC35E2	-2.883	0.00414	-0.064675	13	0.022432	yes	ESPMCS
chr1_788511_G_C_b38	SLC35E2	2.883	0.00414	0.062143	15	0.021555	yes	ESPMCS
chr1_1688409_C_G_b38	SLC35E2	-2.882	0.00415	-0.036045	81	0.012507	yes	ESPMCS
chr1_1842221_C_G_b38	SLC35E2	2.88	0.00417	0.040493	31	0.014058	yes	ESPMCS
chr1_1664099_T_C_b38	SLC35E2	-2.874	0.00425	-0.045323	21	0.015768	yes	ESPMCS
chr1_1737789_T_C_b38	SLC35E2	2.872	0.00428	0.05722	9	0.01992	yes	ESPMCS
chr1_1222245_C_T_b38	SLC35E2	-2.859	0.00446	-0.057288	5	0.02004	yes	ESPMCS
chr1_1969229_T_A_b38	SLC35E2	2.856	0.0045	0.04139	23	0.014492	yes	ESPMCS
chr1_1981062_A_G_b38	SLC35E2	2.855	0.00451	0.036595	51	0.012818	yes	ESPMCS
chr1_1981291_A_G_b38	SLC35E2	2.855	0.00451	0.036595	51	0.012818	yes	ESPMCS
chr1_1981295_T_C_b38	SLC35E2	2.855	0.00451	0.036595	51	0.012818	yes	ESPMCS
chr1_1842226_T_C_b38	SLC35E2	2.855	0.00451	0.039951	30	0.013993	yes	ESPMCS
chr1_1966606_G_A_b38	SLC35E2	2.855	0.00452	0.039838	27	0.013955	yes	ESPMCS
chr1_1842213_A_G_b38	SLC35E2	2.854	0.00452	0.040295	30	0.014117	yes	ESPMCS
chr1_791564_C_G_b38	SLC35E2	2.845	0.00465	0.042231	49	0.014842	yes	ESPMCS
chr1_1969249_A_AGCCCT_b38	SLC35E2	2.843	0.00468	0.041917	22	0.014743	yes	ESPMCS
chr1_1943403_C_G_b38	SLC35E2	2.839	0.00474	0.069521	4	0.024486	yes	ESPMCS
chr1_1773676_TTGTGTG_T_b38	SLC35E2	2.839	0.00474	0.055181	4	0.019436	yes	ESPMCS
chr1_1968900_A_G_b38	SLC35E2	2.826	0.00494	0.038612	31	0.013664	yes	ESPMCS
chr1_1606507_GTGGGC_G_b38	SLC35E2	2.819	0.00504	0.032625	127	0.011574	yes	ESPMCS
chr1_1625951_G_A_b38	SLC35E2	-2.804	0.00527	-0.035026	69	0.01249	yes	ESPMCS
chr1_1695747_C_T_b38	SLC35E2	2.804	0.00528	0.040184	89	0.014331	yes	ESPMCS
chr1_1793064_C_CA_b38	SLC35E2	2.801	0.00532	0.040687	27	0.014524	yes	ESPMCS
chr1_1879682_G_A_b38	SLC35E2	2.8	0.00534	0.039153	30	0.013983	yes	ESPMCS
chr1_1987145_C_T_b38	SLC35E2	2.8	0.00535	0.035931	50	0.012834	yes	ESPMCS
chr1_1716210_C_CT_b38	SLC35E2	2.799	0.00537	0.058331	34	0.020843	yes	ESPMCS
chr1_1720288_G_A_b38	SLC35E2	2.799	0.00537	0.058331	34	0.020843	yes	ESPMCS
chr1_1225285_G_A_b38	SLC35E2	-2.797	0.00539	-0.055663	6	0.019902	yes	ESPMCS
chr1_779047_G_A_b38	SLC35E2	2.772	0.00581	0.059275	17	0.021382	yes	ESPMCS
chr1_1969006_C_T_b38	SLC35E2	2.767	0.0059	0.037552	32	0.013571	yes	ESPMCS
chr1_777382_T_G_b38	SLC35E2	-2.761	0.00602	-0.064753	3	0.023455	yes	ESPMCS
chr1_1688102_G_A_b38	SLC35E2	-2.756	0.0061	-0.038362	36	0.013919	yes	ESPMCS
chr1_1962845_T_C_b38	SLC35E2	2.753	0.00616	0.037839	30	0.013745	yes	ESPMCS
chr1_2004501_C_CA_b38	SLC35E2	2.752	0.00617	0.1221	3	0.044362	yes	ESPMCS
chr1_1968924_GCCCTCCTGGGGGCTCCGGTCCTGCCCAGCAGCCCCAGGTGAGACAGCGCCTGGCGGCCCCTCCCTAGCT_G_b38	SLC35E2	2.743	0.00634	0.037262	32	0.013584	yes	ESPMCS
chr1_1225476_T_C_b38	SLC35E2	-2.738	0.00645	-0.053654	7	0.019599	yes	ESPMCS
chr1_1226013_C_T_b38	SLC35E2	-2.738	0.00645	-0.053654	7	0.019599	yes	ESPMCS
chr1_1877314_A_AT_b38	SLC35E2	2.736	0.00647	0.061574	5	0.022503	yes	ESPMCS
chr1_1724543_G_C_b38	SLC35E2	-2.734	0.00652	-0.083444	11	0.030521	yes	ESPMCS
chr1_812761_G_A_b38	SLC35E2	-2.733	0.00654	-0.064714	8	0.023682	yes	ESPMCS
chr1_932613_GTTTC_G_b38	SLC35E2	2.728	0.00664	0.08617	18	0.031593	yes	ESPMCS
chr1_1985451_C_T_b38	SLC35E2	2.723	0.00673	0.03542	67	0.013006	yes	ESPMCS
chr1_1649954_C_CA_b38	SLC35E2	-2.707	0.00706	-0.042867	22	0.015834	yes	ESPMCS
chr1_1714638_G_T_b38	SLC35E2	2.699	0.00722	0.047822	11	0.017716	yes	ESPMCS
chr1_794299_C_G_b38	SLC35E2	2.689	0.00745	0.04423	33	0.01645	yes	ESPMCS
chr1_771398_G_A_b38	SLC35E2	2.685	0.00753	0.039276	68	0.014627	yes	ESPMCS
chr1_1877314_A_T_b38	SLC35E2	2.679	0.00767	0.041789	26	0.015599	yes	ESPMCS
chr1_1776301_T_G_b38	SLC35E2	2.677	0.00771	0.037543	28	0.014024	yes	ESPMCS
chr1_1239126_C_CT_b38	SLC35E2	-2.675	0.00776	-0.052927	6	0.019785	yes	ESPMCS
chr1_1239127_A_ACATGCATCC_b38	SLC35E2	-2.675	0.00776	-0.052927	6	0.019785	yes	ESPMCS
chr1_1239574_T_C_b38	SLC35E2	-2.675	0.00776	-0.052927	6	0.019785	yes	ESPMCS
chr1_1624086_G_A_b38	SLC35E2	-2.672	0.00783	-0.033527	78	0.012547	yes	ESPMCS
chr1_1714635_A_G_b38	SLC35E2	2.668	0.00793	0.046813	12	0.017548	yes	ESPMCS
chr1_1662738_CT_C_b38	SLC35E2	-2.666	0.00797	-0.050506	26	0.018944	yes	ESPMCS
chr1_1461621_T_TCTCCTCATGAGACCCCCATGTCGGAATTCGAAGGAGAGG_b38	SLC35E2	-2.659	0.00814	-0.057673	16	0.021694	yes	ESPMCS
chr1_1773215_C_A_b38	SLC35E2	2.656	0.0082	0.037355	28	0.014063	yes	ESPMCS
chr1_1931966_T_C_b38	SLC35E2	2.652	0.0083	0.037971	64	0.014317	yes	ESPMCS
chr1_1686882_T_C_b38	SLC35E2	-2.647	0.00842	-0.031487	108	0.011896	yes	ESPMCS
chr1_1774165_A_G_b38	SLC35E2	2.644	0.00849	0.037762	25	0.014281	yes	ESPMCS
chr1_1743712_G_A_b38	SLC35E2	2.631	0.00882	0.05415	8	0.020581	yes	ESPMCS
chr1_871922_A_ATT_b38	SLC35E2	-2.624	0.009	-0.041476	19	0.015807	yes	ESPMCS
chr1_1890770_C_T_b38	SLC35E2	2.623	0.00904	0.036033	35	0.01374	yes	ESPMCS
chr1_1662855_T_C_b38	SLC35E2	-2.616	0.00921	-0.049156	27	0.018791	yes	ESPMCS
chr1_813498_G_T_b38	SLC35E2	2.613	0.0093	0.040333	29	0.015436	yes	ESPMCS
chr1_1029365_A_ATCTATGCAGGCAGGTGGGGGGATCAGTG_b38	SLC35E2	2.603	0.00956	0.03486	37	0.013392	yes	ESPMCS
chr1_783406_A_AT_b38	SLC35E2	-2.596	0.00977	-0.056141	3	0.021629	yes	ESPMCS
chr1_809641_G_T_b38	SLC35E2	-2.594	0.0098	-0.056754	11	0.021875	yes	ESPMCS
chr1_1613330_A_AT_b38	SLC35E2	-2.594	0.00983	-0.035432	46	0.013661	yes	ESPMCS
chr1_788418_CAG_C_b38	SLC35E2	2.588	0.00997	0.057231	11	0.022111	yes	ESPMCS
chr1_1674720_TGC_T_b38	SLC35E2	9.255	1.05e-18	0.100682	113	0.010878	no	ESPMCS
chr1_1671797_G_A_b38	SLC35E2	9.221	1.37e-18	0.100971	111	0.01095	no	ESPMCS
chr1_1671995_G_T_b38	SLC35E2	8.993	7.96e-18	0.097546	114	0.010847	no	ESPMCS
chr1_1730405_G_C_b38	SLC35E2	7.624	1.61e-13	0.096575	74	0.012667	no	ESPMCS
chr1_1648736_G_A_b38	SLC35E2	7.347	1.04e-12	0.085361	97	0.011619	no	ESPMCS
chr1_1742672_C_T_b38	SLC35E2	-7.193	2.87e-12	-0.083486	89	0.011607	no	ESPMCS
chr1_1743238_G_C_b38	SLC35E2	-7.193	2.87e-12	-0.083486	89	0.011607	no	ESPMCS
chr1_1649976_G_A_b38	SLC35E2	6.87	2.29e-11	0.079821	86	0.011619	no	ESPMCS
chr1_1673968_GA_G_b38	SLC35E2	6.744	5.03e-11	0.090116	51	0.013362	no	ESPMCS
chr1_1753033_C_T_b38	SLC35E2	-6.681	7.43e-11	-0.080977	112	0.01212	no	ESPMCS
chr1_1692151_T_C_b38	SLC35E2	-6.605	1.19e-10	-0.087546	42	0.013254	no	ESPMCS
chr1_1752461_G_A_b38	SLC35E2	-6.556	1.6e-10	-0.07973	106	0.012161	no	ESPMCS
chr1_1752730_C_G_b38	SLC35E2	-6.556	1.6e-10	-0.07973	106	0.012161	no	ESPMCS
chr1_1749826_A_G_b38	SLC35E2	-6.494	2.33e-10	-0.073401	124	0.011303	no	ESPMCS
chr1_1753319_G_A_b38	SLC35E2	-6.403	4.04e-10	-0.078257	106	0.012222	no	ESPMCS
chr1_1753361_G_A_b38	SLC35E2	-6.403	4.04e-10	-0.078257	106	0.012222	no	ESPMCS
chr1_1660318_C_T_b38	SLC35E2	6.38	4.63e-10	0.114338	3	0.017922	no	ESPMCS
chr1_1756043_G_T_b38	SLC35E2	-6.37	4.9e-10	-0.077536	108	0.012172	no	ESPMCS
chr1_1759611_C_T_b38	SLC35E2	-6.331	6.17e-10	-0.076581	111	0.012095	no	ESPMCS
chr1_1759354_G_A_b38	SLC35E2	-6.267	9.05e-10	-0.075948	108	0.01212	no	ESPMCS
chr1_1744028_A_AC_b38	SLC35E2	-6.203	1.31e-09	-0.09388	23	0.015135	no	ESPMCS
chr1_1738295_G_T_b38	SLC35E2	6.144	1.85e-09	0.069011	126	0.011233	no	ESPMCS
chr1_1734903_A_G_b38	SLC35E2	6.089	2.54e-09	0.06818	127	0.011198	no	ESPMCS
chr1_1732392_C_T_b38	SLC35E2	6.078	2.7e-09	0.068221	127	0.011224	no	ESPMCS
chr1_1735176_C_T_b38	SLC35E2	6.078	2.7e-09	0.068221	127	0.011224	no	ESPMCS
chr1_1735980_A_C_b38	SLC35E2	6.078	2.7e-09	0.068221	127	0.011224	no	ESPMCS
chr1_1740343_C_T_b38	SLC35E2	6.078	2.7e-09	0.068221	127	0.011224	no	ESPMCS
chr1_1740703_C_T_b38	SLC35E2	6.078	2.7e-09	0.068221	127	0.011224	no	ESPMCS
chr1_1734174_A_G_b38	SLC35E2	6.065	2.92e-09	0.067869	127	0.011191	no	ESPMCS
chr1_1731963_A_C_b38	SLC35E2	6.057	3.06e-09	0.067799	128	0.011194	no	ESPMCS
chr1_1820337_A_G_b38	SLC35E2	5.995	4.34e-09	0.069663	102	0.01162	no	ESPMCS
chr1_1667948_A_G_b38	SLC35E2	-5.971	4.97e-09	-0.086282	25	0.01445	no	ESPMCS
chr1_1748780_G_A_b38	SLC35E2	-5.971	4.98e-09	-0.070046	119	0.011731	no	ESPMCS
chr1_1926870_T_C_b38	SLC35E2	-5.956	5.42e-09	-0.069037	97	0.011592	no	ESPMCS
chr1_1743886_C_T_b38	SLC35E2	-5.929	6.31e-09	-0.08038	45	0.013558	no	ESPMCS
chr1_1748597_C_G_b38	SLC35E2	-5.925	6.44e-09	-0.071955	108	0.012144	no	ESPMCS
chr1_1755713_G_A_b38	SLC35E2	-5.829	1.1e-08	-0.069739	100	0.011964	no	ESPMCS
chr1_1931587_A_G_b38	SLC35E2	-5.821	1.15e-08	-0.067836	105	0.011654	no	ESPMCS
chr1_1747472_A_T_b38	SLC35E2	-5.798	1.31e-08	-0.071	107	0.012246	no	ESPMCS
chr1_1940540_G_A_b38	SLC35E2	-5.786	1.4e-08	-0.067596	107	0.011684	no	ESPMCS
chr1_1942260_G_C_b38	SLC35E2	-5.786	1.4e-08	-0.067596	107	0.011684	no	ESPMCS
chr1_1668542_C_T_b38	SLC35E2	-5.776	1.48e-08	-0.085471	21	0.014798	no	ESPMCS
chr1_1931580_CA_C_b38	SLC35E2	-5.774	1.5e-08	-0.067451	104	0.011682	no	ESPMCS
chr1_1942014_G_A_b38	SLC35E2	-5.743	1.77e-08	-0.067358	106	0.011728	no	ESPMCS
chr1_1942075_A_G_b38	SLC35E2	-5.743	1.77e-08	-0.067358	106	0.011728	no	ESPMCS
chr1_1942086_T_C_b38	SLC35E2	-5.743	1.77e-08	-0.067358	106	0.011728	no	ESPMCS
chr1_1933087_C_T_b38	SLC35E2	-5.743	1.77e-08	-0.066789	104	0.01163	no	ESPMCS
chr1_1933859_A_G_b38	SLC35E2	-5.743	1.77e-08	-0.066789	104	0.01163	no	ESPMCS
chr1_1916417_G_T_b38	SLC35E2	-5.733	1.87e-08	-0.067774	104	0.011822	no	ESPMCS
chr1_1665581_C_G_b38	SLC35E2	-5.73	1.9e-08	-0.079281	30	0.013836	no	ESPMCS
chr1_1940973_C_T_b38	SLC35E2	-5.728	1.92e-08	-0.067137	108	0.011721	no	ESPMCS
chr1_1937841_ACACCAGGTCCACCTCTGGACACAGGTCCACC_A_b38	SLC35E2	-5.72	2.01e-08	-0.06677	107	0.011672	no	ESPMCS
chr1_1938054_ACT_A_b38	SLC35E2	-5.714	2.08e-08	-0.066707	107	0.011675	no	ESPMCS
chr1_1668717_C_G_b38	SLC35E2	-5.687	2.41e-08	-0.081803	26	0.014385	no	ESPMCS
chr1_1942258_G_A_b38	SLC35E2	-5.683	2.45e-08	-0.066614	106	0.011721	no	ESPMCS
chr1_1934565_G_A_b38	SLC35E2	-5.669	2.66e-08	-0.066578	108	0.011745	no	ESPMCS
chr1_1770997_G_A_b38	SLC35E2	-5.666	2.69e-08	-0.0675	114	0.011912	no	ESPMCS
chr1_1669613_G_A_b38	SLC35E2	-5.628	3.31e-08	-0.081103	26	0.01441	no	ESPMCS
chr1_1945842_A_AAAAGAAC_b38	SLC35E2	-5.625	3.36e-08	-0.07151	77	0.012712	no	ESPMCS
chr1_1914634_G_T_b38	SLC35E2	-5.624	3.38e-08	-0.065872	104	0.011713	no	ESPMCS
chr1_1916670_G_C_b38	SLC35E2	-5.624	3.38e-08	-0.065872	104	0.011713	no	ESPMCS
chr1_1658830_C_G_b38	SLC35E2	-5.599	3.88e-08	-0.077669	30	0.013873	no	ESPMCS
chr1_1936627_C_G_b38	SLC35E2	-5.568	4.57e-08	-0.065206	104	0.011711	no	ESPMCS
chr1_1669576_G_A_b38	SLC35E2	-5.567	4.59e-08	-0.081041	25	0.014557	no	ESPMCS
chr1_1938332_A_ACT_b38	SLC35E2	-5.555	4.9e-08	-0.064456	110	0.011604	no	ESPMCS
chr1_1944182_G_C_b38	SLC35E2	-5.535	5.44e-08	-0.068608	108	0.012395	no	ESPMCS
chr1_1899573_C_T_b38	SLC35E2	-5.532	5.54e-08	-0.068537	110	0.012389	no	ESPMCS
chr1_1901262_C_T_b38	SLC35E2	-5.532	5.54e-08	-0.068537	110	0.012389	no	ESPMCS
chr1_1901386_C_A_b38	SLC35E2	-5.532	5.54e-08	-0.068537	110	0.012389	no	ESPMCS
chr1_1935938_T_C_b38	SLC35E2	-5.484	7.13e-08	-0.065576	91	0.011957	no	ESPMCS
chr1_1947189_C_T_b38	SLC35E2	-5.467	7.81e-08	-0.067348	109	0.012319	no	ESPMCS
chr1_1946632_C_T_b38	SLC35E2	-5.467	7.83e-08	-0.067412	109	0.012332	no	ESPMCS
chr1_1659940_A_C_b38	SLC35E2	-5.457	8.24e-08	-0.087488	13	0.016032	no	ESPMCS
chr1_1726904_T_C_b38	SLC35E2	5.438	9.1e-08	0.061699	109	0.011346	no	ESPMCS
chr1_1880596_T_A_b38	SLC35E2	-5.434	9.3e-08	-0.067576	97	0.012436	no	ESPMCS
chr1_1797530_C_A_b38	SLC35E2	-5.424	9.8e-08	-0.066103	111	0.012188	no	ESPMCS
chr1_1886800_G_A_b38	SLC35E2	-5.42	9.99e-08	-0.066198	112	0.012213	no	ESPMCS
chr1_1891654_C_CAGAG_b38	SLC35E2	-5.42	9.99e-08	-0.066198	112	0.012213	no	ESPMCS
chr1_1836126_C_A_b38	SLC35E2	-5.42	1e-07	-0.064418	115	0.011885	no	ESPMCS
chr1_1944675_C_T_b38	SLC35E2	-5.419	1e-07	-0.066831	110	0.012332	no	ESPMCS
chr1_1946058_T_C_b38	SLC35E2	-5.419	1e-07	-0.066831	110	0.012332	no	ESPMCS
chr1_1736836_A_G_b38	SLC35E2	5.418	1.01e-07	0.061559	118	0.011363	no	ESPMCS
chr1_1646352_A_C_b38	SLC35E2	5.417	1.02e-07	0.090028	9	0.01662	no	ESPMCS
chr1_1946013_C_T_b38	SLC35E2	-5.411	1.05e-07	-0.066994	109	0.012382	no	ESPMCS
chr1_1881249_A_G_b38	SLC35E2	-5.387	1.19e-07	-0.065935	111	0.012239	no	ESPMCS
chr1_1909234_G_A_b38	SLC35E2	-5.379	1.24e-07	-0.066778	110	0.012415	no	ESPMCS
chr1_1773460_G_A_b38	SLC35E2	-5.378	1.25e-07	-0.065821	111	0.01224	no	ESPMCS
chr1_1773476_C_G_b38	SLC35E2	-5.378	1.25e-07	-0.065821	111	0.01224	no	ESPMCS
chr1_1661177_A_G_b38	SLC35E2	-5.377	1.25e-07	-0.076718	27	0.014267	no	ESPMCS
chr1_1771864_G_A_b38	SLC35E2	-5.376	1.26e-07	-0.065965	112	0.01227	no	ESPMCS
chr1_1772410_T_C_b38	SLC35E2	-5.376	1.26e-07	-0.065965	112	0.01227	no	ESPMCS
chr1_1772426_T_A_b38	SLC35E2	-5.376	1.26e-07	-0.065965	112	0.01227	no	ESPMCS
chr1_1746522_GT_G_b38	SLC35E2	-5.364	1.34e-07	-0.079473	29	0.014816	no	ESPMCS
chr1_1944419_C_G_b38	SLC35E2	-5.364	1.34e-07	-0.065963	111	0.012298	no	ESPMCS
chr1_1945121_T_C_b38	SLC35E2	-5.363	1.35e-07	-0.066268	110	0.012357	no	ESPMCS
chr1_1944074_T_C_b38	SLC35E2	-5.361	1.36e-07	-0.066411	109	0.012389	no	ESPMCS
chr1_1944091_G_C_b38	SLC35E2	-5.361	1.36e-07	-0.066411	109	0.012389	no	ESPMCS
chr1_1747695_A_G_b38	SLC35E2	-5.36	1.36e-07	-0.054505	114	0.010168	no	ESPMCS
chr1_1912607_C_T_b38	SLC35E2	-5.357	1.39e-07	-0.066314	104	0.01238	no	ESPMCS
chr1_1843381_A_T_b38	SLC35E2	-5.356	1.4e-07	-0.065819	111	0.012289	no	ESPMCS
chr1_1847030_A_G_b38	SLC35E2	-5.356	1.4e-07	-0.065819	111	0.012289	no	ESPMCS
chr1_1850017_G_T_b38	SLC35E2	-5.356	1.4e-07	-0.065819	111	0.012289	no	ESPMCS
chr1_1881082_C_T_b38	SLC35E2	-5.339	1.52e-07	-0.065391	111	0.012247	no	ESPMCS
chr1_1945975_TG_T_b38	SLC35E2	-5.336	1.55e-07	-0.065843	112	0.012339	no	ESPMCS
chr1_1764887_C_A_b38	SLC35E2	-5.324	1.65e-07	-0.065667	110	0.012334	no	ESPMCS
chr1_1773848_A_C_b38	SLC35E2	-5.322	1.66e-07	-0.065542	111	0.012315	no	ESPMCS
chr1_1776461_GAAAC_G_b38	SLC35E2	-5.322	1.66e-07	-0.065542	111	0.012315	no	ESPMCS
chr1_1777362_A_G_b38	SLC35E2	-5.322	1.66e-07	-0.065542	111	0.012315	no	ESPMCS
chr1_1790040_C_T_b38	SLC35E2	-5.322	1.66e-07	-0.065542	111	0.012315	no	ESPMCS
chr1_1808816_G_T_b38	SLC35E2	-5.322	1.66e-07	-0.065542	111	0.012315	no	ESPMCS
chr1_1817295_T_C_b38	SLC35E2	-5.322	1.66e-07	-0.065542	111	0.012315	no	ESPMCS
chr1_1819825_G_A_b38	SLC35E2	-5.322	1.66e-07	-0.065542	111	0.012315	no	ESPMCS
chr1_1866508_A_G_b38	SLC35E2	-5.319	1.69e-07	-0.065194	112	0.012256	no	ESPMCS
chr1_1879567_T_C_b38	SLC35E2	-5.319	1.69e-07	-0.065194	112	0.012256	no	ESPMCS
chr1_1951865_G_GT_b38	SLC35E2	-5.316	1.71e-07	-0.064501	106	0.012133	no	ESPMCS
chr1_1827774_A_G_b38	SLC35E2	-5.309	1.78e-07	-0.065552	111	0.012347	no	ESPMCS
chr1_1831318_C_T_b38	SLC35E2	-5.309	1.78e-07	-0.065552	111	0.012347	no	ESPMCS
chr1_1951106_G_A_b38	SLC35E2	-5.296	1.9e-07	-0.064112	106	0.012106	no	ESPMCS
chr1_1792927_G_A_b38	SLC35E2	-5.289	1.97e-07	-0.065093	110	0.012308	no	ESPMCS
chr1_1909238_G_A_b38	SLC35E2	-5.287	1.99e-07	-0.065515	111	0.012391	no	ESPMCS
chr1_1846009_AGG_A_b38	SLC35E2	-5.286	2e-07	-0.064963	113	0.01229	no	ESPMCS
chr1_1846011_G_GTCC_b38	SLC35E2	-5.286	2e-07	-0.064963	113	0.01229	no	ESPMCS
chr1_1942887_C_G_b38	SLC35E2	-5.275	2.12e-07	-0.065045	109	0.012331	no	ESPMCS
chr1_1944420_A_G_b38	SLC35E2	-5.261	2.27e-07	-0.064815	111	0.012319	no	ESPMCS
chr1_1902439_C_T_b38	SLC35E2	-5.261	2.27e-07	-0.065326	110	0.012416	no	ESPMCS
chr1_1791493_C_T_b38	SLC35E2	-5.256	2.34e-07	-0.064956	110	0.012359	no	ESPMCS
chr1_1791592_G_A_b38	SLC35E2	-5.256	2.34e-07	-0.064956	110	0.012359	no	ESPMCS
chr1_1905586_C_T_b38	SLC35E2	-5.255	2.34e-07	-0.065535	108	0.01247	no	ESPMCS
chr1_1860718_A_C_b38	SLC35E2	-5.25	2.41e-07	-0.064341	114	0.012256	no	ESPMCS
chr1_1948515_C_T_b38	SLC35E2	-5.244	2.48e-07	-0.062946	114	0.012004	no	ESPMCS
chr1_1738597_C_A_b38	SLC35E2	5.244	2.48e-07	0.07075	59	0.013492	no	ESPMCS
chr1_1881428_C_CT_b38	SLC35E2	-5.232	2.63e-07	-0.064455	107	0.012319	no	ESPMCS
chr1_1766653_A_G_b38	SLC35E2	-5.219	2.82e-07	-0.064233	111	0.012308	no	ESPMCS
chr1_1950071_C_T_b38	SLC35E2	-5.2	3.11e-07	-0.062978	106	0.012112	no	ESPMCS
chr1_1952064_G_A_b38	SLC35E2	-5.2	3.11e-07	-0.062978	106	0.012112	no	ESPMCS
chr1_1948519_T_C_b38	SLC35E2	-5.196	3.16e-07	-0.062262	114	0.011983	no	ESPMCS
chr1_1665061_C_T_b38	SLC35E2	-5.194	3.2e-07	-0.075198	26	0.014478	no	ESPMCS
chr1_1944216_C_T_b38	SLC35E2	-5.191	3.24e-07	-0.065201	106	0.01256	no	ESPMCS
chr1_1738606_C_T_b38	SLC35E2	5.181	3.41e-07	0.07018	56	0.013545	no	ESPMCS
chr1_1902481_G_A_b38	SLC35E2	-5.176	3.5e-07	-0.064324	109	0.012428	no	ESPMCS
chr1_1708855_TTCCTCCTCC_T_b38	SLC35E2	5.171	3.6e-07	0.066617	91	0.012884	no	ESPMCS
chr1_1762287_A_G_b38	SLC35E2	-5.141	4.17e-07	-0.064052	114	0.012458	no	ESPMCS
chr1_1927857_T_C_b38	SLC35E2	-5.134	4.32e-07	-0.064453	110	0.012554	no	ESPMCS
chr1_1938125_TCA_T_b38	SLC35E2	-5.121	4.61e-07	-0.06326	108	0.012352	no	ESPMCS
chr1_1925307_C_A_b38	SLC35E2	-5.107	4.96e-07	-0.064867	105	0.012702	no	ESPMCS
chr1_1952823_TA_T_b38	SLC35E2	-5.1	5.11e-07	-0.061645	106	0.012086	no	ESPMCS
chr1_1925233_T_C_b38	SLC35E2	-5.078	5.72e-07	-0.063858	110	0.012576	no	ESPMCS
chr1_1925281_C_T_b38	SLC35E2	-5.078	5.72e-07	-0.063858	110	0.012576	no	ESPMCS
chr1_1920695_A_G_b38	SLC35E2	-5.076	5.78e-07	-0.063833	110	0.012576	no	ESPMCS
chr1_1918090_A_G_b38	SLC35E2	-5.073	5.85e-07	-0.063839	109	0.012584	no	ESPMCS
chr1_1750589_G_A_b38	SLC35E2	-5.061	6.22e-07	-0.096945	16	0.019155	no	ESPMCS
chr1_1924788_C_T_b38	SLC35E2	-5.059	6.26e-07	-0.063409	111	0.012533	no	ESPMCS
chr1_1937895_C_T_b38	SLC35E2	-5.041	6.85e-07	-0.06241	109	0.01238	no	ESPMCS
chr1_1935987_G_A_b38	SLC35E2	-5.024	7.46e-07	-0.062062	112	0.012353	no	ESPMCS
chr1_1891444_CG_C_b38	SLC35E2	-5.021	7.58e-07	-0.062765	102	0.012501	no	ESPMCS
chr1_1914345_C_T_b38	SLC35E2	-5.014	7.82e-07	-0.063214	109	0.012606	no	ESPMCS
chr1_1914918_G_A_b38	SLC35E2	-5.014	7.82e-07	-0.063214	109	0.012606	no	ESPMCS
chr1_1915326_G_A_b38	SLC35E2	-5.014	7.82e-07	-0.063214	109	0.012606	no	ESPMCS
chr1_1916217_C_T_b38	SLC35E2	-5.014	7.82e-07	-0.063214	109	0.012606	no	ESPMCS
chr1_1947645_C_T_b38	SLC35E2	-5.009	8.02e-07	-0.063424	103	0.012662	no	ESPMCS
chr1_1929904_C_T_b38	SLC35E2	-5.009	8.04e-07	-0.063129	109	0.012604	no	ESPMCS
chr1_1641261_C_T_b38	SLC35E2	-4.994	8.62e-07	-0.073655	23	0.014747	no	ESPMCS
chr1_1930143_C_T_b38	SLC35E2	-4.991	8.79e-07	-0.062837	109	0.012591	no	ESPMCS
chr1_1742432_T_TA_b38	SLC35E2	4.98	9.25e-07	0.061928	80	0.012435	no	ESPMCS
chr1_1921333_C_T_b38	SLC35E2	-4.96	1.02e-06	-0.061941	110	0.012488	no	ESPMCS
chr1_1639685_G_A_b38	SLC35E2	-4.948	1.08e-06	-0.072853	24	0.014723	no	ESPMCS
chr1_1638879_C_T_b38	SLC35E2	-4.939	1.13e-06	-0.06926	30	0.014022	no	ESPMCS
chr1_1913504_CT_C_b38	SLC35E2	-4.931	1.17e-06	-0.066063	85	0.013397	no	ESPMCS
chr1_1875208_T_C_b38	SLC35E2	-4.915	1.27e-06	-0.060464	112	0.012301	no	ESPMCS
chr1_1937802_G_T_b38	SLC35E2	-4.89	1.43e-06	-0.061715	106	0.012621	no	ESPMCS
chr1_1822247_A_G_b38	SLC35E2	4.883	1.48e-06	0.075733	14	0.015509	no	ESPMCS
chr1_1769969_CAAAACAAAAACA_C_b38	SLC35E2	-4.857	1.68e-06	-0.059473	116	0.012245	no	ESPMCS
chr1_1798974_C_T_b38	SLC35E2	4.834	1.87e-06	0.075981	13	0.015718	no	ESPMCS
chr1_1660408_T_C_b38	SLC35E2	-4.832	1.89e-06	-0.074403	14	0.015397	no	ESPMCS
chr1_1846651_T_G_b38	SLC35E2	4.827	1.94e-06	0.075204	14	0.015581	no	ESPMCS
chr1_1653863_C_A_b38	SLC35E2	-4.8	2.2e-06	-0.075118	14	0.015651	no	ESPMCS
chr1_1857305_G_GGGCT_b38	SLC35E2	4.791	2.3e-06	0.076607	12	0.01599	no	ESPMCS
chr1_1737703_A_C_b38	SLC35E2	-4.789	2.32e-06	-0.056313	88	0.011759	no	ESPMCS
chr1_1891450_G_C_b38	SLC35E2	-4.785	2.36e-06	-0.059894	103	0.012517	no	ESPMCS
chr1_1881065_G_A_b38	SLC35E2	4.755	2.72e-06	0.075375	13	0.015852	no	ESPMCS
chr1_1881798_C_T_b38	SLC35E2	4.755	2.72e-06	0.075375	13	0.015852	no	ESPMCS
chr1_1794187_C_T_b38	SLC35E2	4.737	2.96e-06	0.074499	13	0.015728	no	ESPMCS
chr1_1735008_G_GGTTT_b38	SLC35E2	-4.735	2.99e-06	-0.056702	86	0.011976	no	ESPMCS
chr1_1740017_C_T_b38	SLC35E2	-4.732	3.03e-06	-0.055932	88	0.01182	no	ESPMCS
chr1_1738309_A_G_b38	SLC35E2	-4.719	3.22e-06	-0.055801	87	0.011825	no	ESPMCS
chr1_1882915_C_T_b38	SLC35E2	4.711	3.35e-06	0.075909	12	0.016115	no	ESPMCS
chr1_1886690_A_C_b38	SLC35E2	4.71	3.35e-06	0.075389	12	0.016005	no	ESPMCS
chr1_1936906_C_CA_b38	SLC35E2	-4.703	3.48e-06	-0.062051	64	0.013195	no	ESPMCS
chr1_1837340_C_T_b38	SLC35E2	4.699	3.54e-06	0.073399	14	0.015622	no	ESPMCS
chr1_1857246_T_TAA_b38	SLC35E2	4.695	3.59e-06	0.074911	12	0.015954	no	ESPMCS
chr1_1857250_C_G_b38	SLC35E2	4.695	3.59e-06	0.074911	12	0.015954	no	ESPMCS
chr1_1736472_C_T_b38	SLC35E2	-4.689	3.7e-06	-0.055772	87	0.011895	no	ESPMCS
chr1_1871210_G_T_b38	SLC35E2	4.687	3.74e-06	0.076481	12	0.016318	no	ESPMCS
chr1_1737704_C_T_b38	SLC35E2	-4.682	3.83e-06	-0.055515	88	0.011858	no	ESPMCS
chr1_1733576_G_A_b38	SLC35E2	-4.673	3.99e-06	-0.055828	87	0.011947	no	ESPMCS
chr1_1740160_G_A_b38	SLC35E2	-4.669	4.06e-06	-0.055307	88	0.011845	no	ESPMCS
chr1_1732412_G_C_b38	SLC35E2	-4.661	4.22e-06	-0.055539	88	0.011916	no	ESPMCS
chr1_1732422_G_A_b38	SLC35E2	-4.661	4.22e-06	-0.055539	88	0.011916	no	ESPMCS
chr1_1735370_G_A_b38	SLC35E2	-4.661	4.22e-06	-0.055539	88	0.011916	no	ESPMCS
chr1_1735884_C_T_b38	SLC35E2	-4.661	4.22e-06	-0.055539	88	0.011916	no	ESPMCS
chr1_1732013_G_A_b38	SLC35E2	-4.645	4.53e-06	-0.055214	88	0.011886	no	ESPMCS
chr1_1855245_G_A_b38	SLC35E2	4.641	4.62e-06	0.074618	12	0.016078	no	ESPMCS
chr1_1775296_C_T_b38	SLC35E2	4.635	4.76e-06	0.075759	12	0.016346	no	ESPMCS
chr1_1815255_G_T_b38	SLC35E2	4.635	4.76e-06	0.075759	12	0.016346	no	ESPMCS
chr1_1855939_G_A_b38	SLC35E2	4.626	4.95e-06	0.074313	12	0.016064	no	ESPMCS
chr1_1782906_T_G_b38	SLC35E2	4.622	5.05e-06	0.071886	14	0.015553	no	ESPMCS
chr1_1913643_T_C_b38	SLC35E2	-4.621	5.07e-06	-0.059146	99	0.012799	no	ESPMCS
chr1_1892085_G_C_b38	SLC35E2	4.595	5.7e-06	0.072917	12	0.015868	no	ESPMCS
chr1_1727506_T_C_b38	SLC35E2	4.589	5.86e-06	0.066131	46	0.01441	no	ESPMCS
chr1_1919188_CAGCGGCAGG_C_b38	SLC35E2	-4.567	6.48e-06	-0.056954	109	0.01247	no	ESPMCS
chr1_1746440_A_G_b38	SLC35E2	-4.564	6.57e-06	-0.068732	28	0.015059	no	ESPMCS
chr1_1691417_T_C_b38	SLC35E2	4.562	6.63e-06	0.057558	99	0.012616	no	ESPMCS
chr1_1775996_G_A_b38	SLC35E2	4.55	6.99e-06	0.071612	14	0.015737	no	ESPMCS
chr1_1840043_T_TA_b38	SLC35E2	4.542	7.28e-06	0.073946	9	0.016282	no	ESPMCS
chr1_1740107_G_A_b38	SLC35E2	-4.502	8.69e-06	-0.053106	89	0.011795	no	ESPMCS
chr1_1898043_T_C_b38	SLC35E2	4.481	9.57e-06	0.073728	11	0.016454	no	ESPMCS
chr1_1649846_G_A_b38	SLC35E2	-4.481	9.57e-06	-0.062569	28	0.013964	no	ESPMCS
chr1_1818305_TAAAAAAA_T_b38	SLC35E2	4.473	9.9e-06	0.075305	10	0.016835	no	ESPMCS
chr1_1650688_T_A_b38	SLC35E2	-4.46	1.05e-05	-0.060135	39	0.013483	no	ESPMCS
chr1_1732834_T_TATCG_b38	SLC35E2	-4.453	1.08e-05	-0.052984	88	0.011899	no	ESPMCS
chr1_1739883_C_T_b38	SLC35E2	-4.443	1.13e-05	-0.052516	82	0.011821	no	ESPMCS
chr1_1955080_C_CGGCTCACACCGGAAGTGAGGCTCACACCGGAAGTGA_b38	SLC35E2	-4.429	1.2e-05	-0.054284	93	0.012256	no	ESPMCS
chr1_1880594_A_T_b38	SLC35E2	4.428	1.21e-05	0.068987	16	0.015581	no	ESPMCS
chr1_1600320_C_G_b38	SLC35E2	4.377	1.51e-05	0.055535	50	0.012687	no	ESPMCS
chr1_1898712_C_T_b38	SLC35E2	4.355	1.67e-05	0.071848	11	0.016497	no	ESPMCS
chr1_1899188_T_A_b38	SLC35E2	4.355	1.67e-05	0.071848	11	0.016497	no	ESPMCS
chr1_1877330_T_C_b38	SLC35E2	-4.345	1.74e-05	-0.05465	92	0.012576	no	ESPMCS
chr1_1882449_A_AAG_b38	SLC35E2	4.325	1.9e-05	0.08873	5	0.020514	no	ESPMCS
chr1_1738525_G_A_b38	SLC35E2	-4.315	1.98e-05	-0.051448	77	0.011922	no	ESPMCS
chr1_1888382_A_AG_b38	SLC35E2	4.275	2.36e-05	0.081725	5	0.019117	no	ESPMCS
chr1_1741276_C_T_b38	SLC35E2	-4.242	2.72e-05	-0.051475	78	0.012134	no	ESPMCS
chr1_1772160_A_AT_b38	SLC35E2	4.197	3.3e-05	0.067043	9	0.015976	no	ESPMCS
chr1_1744121_A_C_b38	SLC35E2	-4.183	3.5e-05	-0.069939	50	0.01672	no	ESPMCS
chr1_1897985_C_G_b38	SLC35E2	4.176	3.6e-05	0.064951	15	0.015553	no	ESPMCS
chr1_1744096_C_T_b38	SLC35E2	-4.105	4.85e-05	-0.070055	50	0.017066	no	ESPMCS
chr1_1845824_TACACAC_T_b38	SLC35E2	4.032	6.56e-05	0.060381	22	0.014977	no	ESPMCS
chr1_1903577_C_T_b38	SLC35E2	3.995	7.61e-05	0.066126	12	0.016551	no	ESPMCS
chr1_1934896_C_T_b38	SLC35E2	3.987	7.88e-05	0.057638	20	0.014457	no	ESPMCS
chr1_1903242_C_T_b38	SLC35E2	3.967	8.53e-05	0.066295	11	0.01671	no	ESPMCS
chr1_1906935_C_T_b38	SLC35E2	3.967	8.53e-05	0.066295	11	0.01671	no	ESPMCS
chr1_1910289_C_T_b38	SLC35E2	3.957	8.89e-05	0.061092	15	0.015439	no	ESPMCS
chr1_1910369_G_A_b38	SLC35E2	3.957	8.89e-05	0.061092	15	0.015439	no	ESPMCS
chr1_1910480_G_A_b38	SLC35E2	3.957	8.89e-05	0.061092	15	0.015439	no	ESPMCS
chr1_1657085_C_CTAA_b38	SLC35E2	-3.948	9.21e-05	-0.057343	38	0.014524	no	ESPMCS
chr1_1591703_T_C_b38	SLC35E2	3.923	0.000102	0.046803	97	0.011932	no	ESPMCS
chr1_1746439_GA_G_b38	SLC35E2	3.916	0.000105	0.052948	79	0.01352	no	ESPMCS
chr1_1734263_T_C_b38	SLC35E2	-3.898	0.000113	-0.046924	85	0.012039	no	ESPMCS
chr1_1835922_G_GAAA_b38	SLC35E2	-3.891	0.000116	-0.123759	7	0.031804	no	ESPMCS
chr1_1736832_GAAAA_G_b38	SLC35E2	-3.867	0.000127	-0.046445	79	0.012011	no	ESPMCS
chr1_1912140_T_G_b38	SLC35E2	3.863	0.000129	0.058357	19	0.015105	no	ESPMCS
chr1_1909167_G_A_b38	SLC35E2	3.861	0.00013	0.064268	12	0.016644	no	ESPMCS
chr1_1657081_C_T_b38	SLC35E2	-3.858	0.000132	-0.055223	38	0.014314	no	ESPMCS
chr1_1776772_TAA_T_b38	SLC35E2	-3.843	0.00014	-0.052858	47	0.013756	no	ESPMCS
chr1_1902318_T_TA_b38	SLC35E2	-3.837	0.000143	-0.056183	43	0.014641	no	ESPMCS
chr1_1741473_C_T_b38	SLC35E2	-3.833	0.000145	-0.046573	72	0.012149	no	ESPMCS
chr1_1706067_ACT_A_b38	SLC35E2	3.823	0.000151	0.047144	137	0.012331	no	ESPMCS
chr1_1929306_C_T_b38	SLC35E2	3.816	0.000155	0.053368	25	0.013984	no	ESPMCS
chr1_1986752_A_G_b38	SLC35E2	3.806	0.000162	0.048261	86	0.012681	no	ESPMCS
chr1_1712515_T_A_b38	SLC35E2	3.785	0.000175	0.058539	27	0.015464	no	ESPMCS
chr1_1955018_A_AGGAAGTGCGGCTCACACC_b38	SLC35E2	3.774	0.000184	0.065862	6	0.017453	no	ESPMCS
chr1_1876492_C_CGA_b38	SLC35E2	3.74	0.00021	0.064524	4	0.017254	no	ESPMCS
chr1_1717604_CGCTTTCAGCTAGAGTTTGCTCTCTCTGGTTTTCGGTCTGTGACACACGCAT_C_b38	SLC35E2	3.738	0.000211	0.044747	86	0.011971	no	ESPMCS
chr1_1663949_A_G_b38	SLC35E2	-3.732	0.000215	-0.064176	12	0.017195	no	ESPMCS
chr1_1970506_T_A_b38	SLC35E2	-3.719	0.000227	-0.044661	84	0.01201	no	ESPMCS
chr1_1866635_T_TAAA_b38	SLC35E2	-3.709	0.000236	-0.049378	72	0.013313	no	ESPMCS
chr1_1720192_T_G_b38	SLC35E2	3.696	0.000247	0.045278	139	0.01225	no	ESPMCS
chr1_1814797_CAAAAAAAAA_C_b38	SLC35E2	3.686	0.000257	0.064405	8	0.017471	no	ESPMCS
chr1_1741733_T_C_b38	SLC35E2	-3.653	0.000291	-0.042238	104	0.011561	no	ESPMCS
chr1_1849781_T_C_b38	SLC35E2	-3.642	0.000304	-0.050651	30	0.013908	no	ESPMCS
chr1_1650664_CT_C_b38	SLC35E2	3.622	0.000327	0.049895	46	0.013774	no	ESPMCS
chr1_1864334_AAAG_A_b38	SLC35E2	-3.605	0.000349	-0.05323	36	0.014764	no	ESPMCS
chr1_1657093_C_A_b38	SLC35E2	-3.591	0.000367	-0.053102	39	0.014786	no	ESPMCS
chr1_1708486_C_A_b38	SLC35E2	3.568	4e-04	0.040176	100	0.011259	no	ESPMCS
chr1_1920497_C_A_b38	SLC35E2	-3.566	0.000403	-0.055874	14	0.015667	no	ESPMCS
chr1_1726126_G_A_b38	SLC35E2	3.513	0.000491	0.041861	112	0.011916	no	ESPMCS
chr1_1658422_T_C_b38	SLC35E2	3.488	0.000536	0.053077	21	0.015215	no	ESPMCS
chr1_1987049_A_G_b38	SLC35E2	3.458	0.000599	0.043346	89	0.012535	no	ESPMCS
chr1_1595306_CAG_C_b38	SLC35E2	-3.451	0.000613	-0.045708	107	0.013243	no	ESPMCS
chr1_1865177_G_A_b38	SLC35E2	-3.451	0.000614	-0.048604	28	0.014084	no	ESPMCS
chr1_1943142_A_G_b38	SLC35E2	-3.448	0.000621	-0.057122	9	0.016567	no	ESPMCS
chr1_1704835_C_T_b38	SLC35E2	3.419	0.000689	0.04216	137	0.012331	no	ESPMCS
chr1_1915143_A_G_b38	SLC35E2	-3.411	0.00071	-0.056464	10	0.016555	no	ESPMCS
chr1_1715838_C_T_b38	SLC35E2	3.38	0.000791	0.041796	138	0.012365	no	ESPMCS
chr1_1228069_T_C_b38	SLC35E2	-3.36	0.00085	-0.068626	3	0.020426	no	ESPMCS
chr1_1932081_AAAAAAC_A_b38	SLC35E2	-3.347	0.000889	-0.050688	38	0.015144	no	ESPMCS
chr1_1969015_A_G_b38	SLC35E2	3.335	0.000926	0.042327	108	0.01269	no	ESPMCS
chr1_1922882_A_G_b38	SLC35E2	-3.327	0.000956	-0.054817	10	0.016479	no	ESPMCS
chr1_1725339_C_A_b38	SLC35E2	3.317	0.000988	0.037694	95	0.011364	no	ESPMCS
chr1_1925261_C_T_b38	SLC35E2	-3.305	0.00103	-0.054262	10	0.016418	no	ESPMCS
chr1_1606099_G_GGTCAGGCGAGGGGTC_b38	SLC35E2	3.296	0.00106	0.043904	47	0.01332	no	ESPMCS
chr1_1650370_C_CT_b38	SLC35E2	-3.289	0.00109	-0.050828	26	0.015454	no	ESPMCS
chr1_1967499_G_A_b38	SLC35E2	3.276	0.00114	0.039657	88	0.012106	no	ESPMCS
chr1_1705799_A_G_b38	SLC35E2	3.276	0.00114	0.037997	133	0.0116	no	ESPMCS
chr1_1664417_G_A_b38	SLC35E2	3.269	0.00117	0.047199	31	0.014439	no	ESPMCS
chr1_1811086_T_A_b38	SLC35E2	-3.261	0.0012	-0.052242	18	0.016022	no	ESPMCS
chr1_1943706_C_T_b38	SLC35E2	-3.242	0.00128	-0.053441	10	0.016484	no	ESPMCS
chr1_1883278_C_CA_b38	SLC35E2	3.237	0.0013	0.058547	7	0.018085	no	ESPMCS
chr1_1976566_T_C_b38	SLC35E2	3.235	0.00131	0.038955	95	0.012044	no	ESPMCS
chr1_1675228_C_CG_b38	SLC35E2	3.232	0.00132	0.041256	82	0.012763	no	ESPMCS
chr1_1945799_T_G_b38	SLC35E2	-3.214	0.00141	-0.053971	9	0.016791	no	ESPMCS
chr1_2676824_ACGGCC_A_b38	SLC35E2	-3.206	0.00145	-0.136887	3	0.042695	no	ESPMCS
chr1_1968793_T_C_b38	SLC35E2	3.197	0.00149	0.038852	90	0.012153	no	ESPMCS
chr1_1903309_A_G_b38	SLC35E2	3.195	0.0015	0.044346	54	0.013881	no	ESPMCS
chr1_1687236_T_G_b38	SLC35E2	-3.193	0.00151	-0.03957	83	0.012393	no	ESPMCS
chr1_1931519_A_G_b38	SLC35E2	-3.178	0.00159	-0.051043	12	0.016062	no	ESPMCS
chr1_1934821_C_G_b38	SLC35E2	-3.177	0.0016	-0.038115	52	0.011998	no	ESPMCS
chr1_1778596_C_T_b38	SLC35E2	-3.174	0.00161	-0.041942	48	0.013214	no	ESPMCS
chr1_1724489_G_C_b38	SLC35E2	3.167	0.00165	0.038931	135	0.012292	no	ESPMCS
chr1_1703583_A_G_b38	SLC35E2	-3.167	0.00165	-0.068573	36	0.021653	no	ESPMCS
chr1_1943828_A_G_b38	SLC35E2	-3.16	0.00169	-0.052452	9	0.0166	no	ESPMCS
chr1_1963538_T_C_b38	SLC35E2	3.153	0.00173	0.038122	87	0.012092	no	ESPMCS
chr1_1773356_TC_T_b38	SLC35E2	-3.151	0.00174	-0.043201	40	0.013712	no	ESPMCS
chr1_1963533_C_CA_b38	SLC35E2	3.146	0.00177	0.037904	91	0.01205	no	ESPMCS
chr1_1684308_G_C_b38	SLC35E2	-3.142	0.0018	-0.038366	89	0.012212	no	ESPMCS
chr1_1684619_G_A_b38	SLC35E2	-3.142	0.0018	-0.038366	89	0.012212	no	ESPMCS
chr1_1924208_G_A_b38	SLC35E2	3.141	0.0018	0.043008	46	0.013692	no	ESPMCS
chr1_1938771_G_A_b38	SLC35E2	-3.127	0.00189	-0.051658	9	0.016519	no	ESPMCS
chr1_1774721_A_G_b38	SLC35E2	-3.123	0.00191	-0.043107	36	0.013802	no	ESPMCS
chr1_1971864_C_T_b38	SLC35E2	3.107	0.00202	0.037261	84	0.011992	no	ESPMCS
chr1_1728948_T_C_b38	SLC35E2	-3.103	0.00204	-0.042425	43	0.013671	no	ESPMCS
chr1_1681164_G_A_b38	SLC35E2	-3.097	0.00208	-0.037458	95	0.012095	no	ESPMCS
chr1_1938493_C_CAT_b38	SLC35E2	-3.061	0.00234	-0.050814	9	0.016599	no	ESPMCS
chr1_1939978_T_C_b38	SLC35E2	-3.061	0.00234	-0.050814	9	0.016599	no	ESPMCS
chr1_1688570_A_T_b38	SLC35E2	-3.055	0.00239	-0.049413	17	0.016173	no	ESPMCS
chr1_1773713_T_A_b38	SLC35E2	-3.04	0.00251	-0.040309	56	0.013259	no	ESPMCS
chr1_1945913_T_C_b38	SLC35E2	-3.038	0.00253	-0.049176	10	0.016189	no	ESPMCS
chr1_1728604_T_A_b38	SLC35E2	-3.02	0.00268	-0.042514	44	0.014076	no	ESPMCS
chr1_1951920_A_G_b38	SLC35E2	-3.014	0.00273	-0.053063	6	0.017606	no	ESPMCS
chr1_1956930_A_G_b38	SLC35E2	-3.014	0.00273	-0.053063	6	0.017606	no	ESPMCS
chr1_1836387_CT_C_b38	SLC35E2	2.997	0.00288	0.05102	25	0.017021	no	ESPMCS
chr1_1221275_G_A_b38	SLC35E2	-2.974	0.00311	-0.061331	3	0.020624	no	ESPMCS
chr1_1729539_C_A_b38	SLC35E2	-2.974	0.00311	-0.041946	43	0.014106	no	ESPMCS
chr1_1773719_T_A_b38	SLC35E2	-2.967	0.00318	-0.037235	65	0.01255	no	ESPMCS
chr1_1593732_G_C_b38	SLC35E2	-2.948	0.00337	-0.03592	98	0.012185	no	ESPMCS
chr1_1728905_T_C_b38	SLC35E2	-2.945	0.00341	-0.040356	43	0.013704	no	ESPMCS
chr1_1728908_A_G_b38	SLC35E2	-2.945	0.00341	-0.040356	43	0.013704	no	ESPMCS
chr1_1773723_T_A_b38	SLC35E2	-2.928	0.0036	-0.037155	61	0.01269	no	ESPMCS
chr1_1609196_CA_C_b38	SLC35E2	2.917	0.00372	0.043456	40	0.014897	no	ESPMCS
chr1_1924011_A_G_b38	SLC35E2	-2.916	0.00373	-0.050327	8	0.017259	no	ESPMCS
chr1_1221355_T_C_b38	SLC35E2	-2.911	0.00379	-0.059875	3	0.02057	no	ESPMCS
chr1_1240390_G_A_b38	SLC35E2	-2.899	0.00394	-0.064581	3	0.022279	no	ESPMCS
chr1_1773721_T_A_b38	SLC35E2	-2.893	0.00401	-0.036518	64	0.012622	no	ESPMCS
chr1_1905533_AT_A_b38	SLC35E2	2.869	0.00433	0.050031	4	0.01744	no	ESPMCS
chr1_1882426_CAAAAA_C_b38	SLC35E2	-2.861	0.00443	-0.047432	18	0.016577	no	ESPMCS
chr1_1776772_TA_T_b38	SLC35E2	2.837	0.00477	0.047368	9	0.016698	no	ESPMCS
chr1_1641819_C_T_b38	SLC35E2	2.836	0.00479	0.048882	13	0.017237	no	ESPMCS
chr1_1773725_T_A_b38	SLC35E2	-2.831	0.00485	-0.03586	62	0.012665	no	ESPMCS
chr1_1708505_G_C_b38	SLC35E2	2.83	0.00488	0.031676	82	0.011195	no	ESPMCS
chr1_1989523_T_C_b38	SLC35E2	2.828	0.00491	0.035927	78	0.012704	no	ESPMCS
chr1_1685108_CA_C_b38	SLC35E2	-2.82	0.00502	-0.04137	42	0.014668	no	ESPMCS
chr1_1912983_T_C_b38	SLC35E2	2.818	0.00506	0.037906	35	0.013452	no	ESPMCS
chr1_1724035_G_A_b38	SLC35E2	2.811	0.00517	0.044823	45	0.015948	no	ESPMCS
chr1_1985090_C_T_b38	SLC35E2	2.809	0.0052	0.036392	66	0.012956	no	ESPMCS
chr1_1583688_A_C_b38	SLC35E2	-2.786	0.00558	-0.034182	58	0.012271	no	ESPMCS
chr1_1889659_T_TA_b38	SLC35E2	2.772	0.00582	0.041565	22	0.014995	no	ESPMCS
chr1_1715541_A_C_b38	SLC35E2	2.769	0.00587	0.0774	3	0.027953	no	ESPMCS
chr1_1224281_GTTTTA_G_b38	SLC35E2	-2.757	0.00609	-0.060258	3	0.02186	no	ESPMCS
chr1_1227886_G_A_b38	SLC35E2	-2.757	0.00609	-0.060258	3	0.02186	no	ESPMCS
chr1_1230250_G_A_b38	SLC35E2	-2.757	0.00609	-0.060258	3	0.02186	no	ESPMCS
chr1_1921045_A_G_b38	SLC35E2	2.755	0.00613	0.038494	61	0.013975	no	ESPMCS
chr1_1714932_G_T_b38	SLC35E2	2.748	0.00625	0.032553	113	0.011845	no	ESPMCS
chr1_1634405_C_CGG_b38	SLC35E2	-2.736	0.00649	-0.088623	4	0.032395	no	ESPMCS
chr1_1217733_G_A_b38	SLC35E2	-2.735	0.0065	-0.052168	7	0.019074	no	ESPMCS
chr1_1948121_T_G_b38	SLC35E2	2.708	0.00705	0.036962	39	0.013651	no	ESPMCS
chr1_1742119_CA_C_b38	SLC35E2	-2.684	0.00756	-0.038133	35	0.014209	no	ESPMCS
chr1_1226486_C_T_b38	SLC35E2	-2.683	0.00759	-0.048705	9	0.018156	no	ESPMCS
chr1_1594614_G_C_b38	SLC35E2	-2.672	0.00784	-0.035558	52	0.01331	no	ESPMCS
chr1_1773727_T_A_b38	SLC35E2	-2.671	0.00785	-0.034286	58	0.012836	no	ESPMCS
chr1_1238883_G_A_b38	SLC35E2	-2.669	0.00789	-0.058157	3	0.021787	no	ESPMCS
chr1_1235869_T_C_b38	SLC35E2	-2.666	0.00798	-0.05695	4	0.021365	no	ESPMCS
chr1_1881428_C_T_b38	SLC35E2	2.661	0.00808	0.037856	26	0.014224	no	ESPMCS
chr1_1596144_GAGAC_G_b38	SLC35E2	-2.641	0.00856	-0.034745	53	0.013154	no	ESPMCS
chr1_2459410_TGGTGGTCCTCCTTGCC_T_b38	SLC35E2	-2.623	0.00902	-0.034407	46	0.013115	no	ESPMCS
chr1_1820356_TA_T_b38	SLC35E2	2.618	0.00915	0.040232	27	0.015365	no	ESPMCS
chr1_1628814_C_T_b38	SLC35E2	-2.616	0.0092	-0.034138	54	0.013048	no	ESPMCS
chr1_1835922_GA_G_b38	SLC35E2	2.614	0.00928	0.060207	4	0.023036	no	ESPMCS
chr1_1662582_G_A_b38	SLC35E2	-2.611	0.00934	-0.10769	4	0.041239	no	ESPMCS
chr1_1773717_T_A_b38	SLC35E2	-2.602	0.00958	-0.032081	71	0.012328	no	ESPMCS
chr1_2327229_GACACAGAAAC_G_b38	SLC35E2	-2.595	0.00977	-0.035005	39	0.013487	no	ESPMCS
chr1_1219941_C_T_b38	SLC35E2	-2.59	0.00992	-0.060061	3	0.023188	no	ESPMCS
chr1_1707555_C_T_b38	SLC35E2	-2.589	0.00995	-0.059441	40	0.022959	no	ESPMCS
chr1_1671995_G_T_b38	SLC35E2	8.33	1.36e-15	0.107339	106	0.012886	yes	ESPMSL
chr1_1677720_T_G_b38	SLC35E2	8.303	1.64e-15	0.106965	109	0.012882	yes	ESPMSL
chr1_1677726_A_T_b38	SLC35E2	8.299	1.7e-15	0.107156	109	0.012913	yes	ESPMSL
chr1_1676790_C_T_b38	SLC35E2	8.265	2.15e-15	0.105802	108	0.012801	yes	ESPMSL
chr1_1674868_G_A_b38	SLC35E2	8.176	4.05e-15	0.107383	105	0.013133	yes	ESPMSL
chr1_1673818_A_C_b38	SLC35E2	8.132	5.56e-15	0.106761	107	0.013129	yes	ESPMSL
chr1_1674720_TGC_T_b38	SLC35E2	8.113	6.36e-15	0.107066	104	0.013197	yes	ESPMSL
chr1_1673060_G_A_b38	SLC35E2	7.998	1.43e-14	0.106205	105	0.01328	yes	ESPMSL
chr1_1671797_G_A_b38	SLC35E2	7.66	1.46e-13	0.100187	102	0.013079	yes	ESPMSL
chr1_1648736_G_A_b38	SLC35E2	6.716	6.55e-11	0.092148	95	0.013721	yes	ESPMSL
chr1_1651653_C_T_b38	SLC35E2	6.649	9.84e-11	0.090186	108	0.013563	yes	ESPMSL
chr1_1637577_T_C_b38	SLC35E2	-6.644	1.02e-10	-0.099359	32	0.014955	yes	ESPMSL
chr1_1649932_C_T_b38	SLC35E2	6.598	1.35e-10	0.090537	96	0.013722	yes	ESPMSL
chr1_1673968_GA_G_b38	SLC35E2	6.433	3.63e-10	0.103343	46	0.016065	yes	ESPMSL
chr1_1636278_G_T_b38	SLC35E2	6.222	1.26e-09	0.087491	82	0.014062	yes	ESPMSL
chr1_1649976_G_A_b38	SLC35E2	6.167	1.73e-09	0.086192	81	0.013977	yes	ESPMSL
chr1_1667948_A_G_b38	SLC35E2	-5.995	4.6e-09	-0.101586	19	0.016945	yes	ESPMSL
chr1_1722690_TA_T_b38	SLC35E2	-5.931	6.61e-09	-0.128494	5	0.021667	yes	ESPMSL
chr1_1739131_T_C_b38	SLC35E2	5.927	6.73e-09	0.079244	84	0.013369	yes	ESPMSL
chr1_1744052_GAGA_G_b38	SLC35E2	-5.926	6.79e-09	-0.105356	23	0.01778	yes	ESPMSL
chr1_1675091_A_G_b38	SLC35E2	-5.884	8.59e-09	-0.096448	22	0.016393	yes	ESPMSL
chr1_1650195_A_G_b38	SLC35E2	-5.869	9.3e-09	-0.086197	46	0.014687	yes	ESPMSL
chr1_1654662_CT_C_b38	SLC35E2	5.842	1.08e-08	0.087919	70	0.01505	yes	ESPMSL
chr1_1668717_C_G_b38	SLC35E2	-5.84	1.09e-08	-0.098151	20	0.016806	yes	ESPMSL
chr1_1688328_C_T_b38	SLC35E2	-5.83	1.16e-08	-0.092512	25	0.015869	yes	ESPMSL
chr1_1661562_G_C_b38	SLC35E2	5.793	1.42e-08	0.07182	109	0.012398	yes	ESPMSL
chr1_1668542_C_T_b38	SLC35E2	-5.776	1.55e-08	-0.100247	16	0.017356	yes	ESPMSL
chr1_1668721_C_T_b38	SLC35E2	-5.765	1.65e-08	-0.08981	30	0.015578	yes	ESPMSL
chr1_1671148_C_T_b38	SLC35E2	5.758	1.72e-08	0.083259	46	0.014461	yes	ESPMSL
chr1_1692151_T_C_b38	SLC35E2	-5.688	2.51e-08	-0.089668	38	0.015764	yes	ESPMSL
chr1_1669613_G_A_b38	SLC35E2	-5.687	2.52e-08	-0.095899	20	0.016863	yes	ESPMSL
chr1_1649993_A_G_b38	SLC35E2	-5.685	2.56e-08	-0.074318	121	0.013074	yes	ESPMSL
chr1_1658830_C_G_b38	SLC35E2	-5.674	2.71e-08	-0.090404	25	0.015934	yes	ESPMSL
chr1_1669576_G_A_b38	SLC35E2	-5.635	3.35e-08	-0.095709	19	0.016986	yes	ESPMSL
chr1_1670423_AT_A_b38	SLC35E2	5.583	4.41e-08	0.091436	52	0.016377	yes	ESPMSL
chr1_1667424_T_TAAAATA_b38	SLC35E2	5.577	4.55e-08	0.078781	67	0.014125	yes	ESPMSL
chr1_1661177_A_G_b38	SLC35E2	-5.556	5.1e-08	-0.092724	21	0.01669	yes	ESPMSL
chr1_1665061_C_T_b38	SLC35E2	-5.549	5.28e-08	-0.093792	20	0.016902	yes	ESPMSL
chr1_1743840_T_C_b38	SLC35E2	-5.518	6.23e-08	-0.090258	36	0.016358	yes	ESPMSL
chr1_1661420_C_A_b38	SLC35E2	-5.512	6.41e-08	-0.080258	48	0.01456	yes	ESPMSL
chr1_1671097_G_C_b38	SLC35E2	5.497	6.96e-08	0.080398	47	0.014626	yes	ESPMSL
chr1_1744028_A_AC_b38	SLC35E2	-5.44	9.35e-08	-0.098677	19	0.018138	yes	ESPMSL
chr1_1668108_C_T_b38	SLC35E2	5.422	1.03e-07	0.079317	46	0.01463	yes	ESPMSL
chr1_1659114_A_G_b38	SLC35E2	-5.405	1.13e-07	-0.078826	48	0.014584	yes	ESPMSL
chr1_1659220_A_G_b38	SLC35E2	-5.405	1.13e-07	-0.078826	48	0.014584	yes	ESPMSL
chr1_1722626_AGCG_A_b38	SLC35E2	5.355	1.46e-07	0.092762	32	0.017323	yes	ESPMSL
chr1_1651137_C_T_b38	SLC35E2	-5.34	1.57e-07	-0.079005	45	0.014794	yes	ESPMSL
chr1_1651267_T_C_b38	SLC35E2	-5.34	1.57e-07	-0.079005	45	0.014794	yes	ESPMSL
chr1_1651785_C_A_b38	SLC35E2	-5.34	1.57e-07	-0.079005	45	0.014794	yes	ESPMSL
chr1_1652135_C_G_b38	SLC35E2	-5.34	1.57e-07	-0.079005	45	0.014794	yes	ESPMSL
chr1_1652191_C_T_b38	SLC35E2	-5.34	1.57e-07	-0.079005	45	0.014794	yes	ESPMSL
chr1_1652592_A_G_b38	SLC35E2	-5.34	1.57e-07	-0.079005	45	0.014794	yes	ESPMSL
chr1_1652779_A_G_b38	SLC35E2	-5.34	1.57e-07	-0.079005	45	0.014794	yes	ESPMSL
chr1_1653147_A_C_b38	SLC35E2	-5.34	1.57e-07	-0.079005	45	0.014794	yes	ESPMSL
chr1_1653396_T_C_b38	SLC35E2	-5.34	1.57e-07	-0.079005	45	0.014794	yes	ESPMSL
chr1_1653472_T_C_b38	SLC35E2	-5.34	1.57e-07	-0.079005	45	0.014794	yes	ESPMSL
chr1_1653811_G_A_b38	SLC35E2	-5.34	1.57e-07	-0.079005	45	0.014794	yes	ESPMSL
chr1_1653893_C_T_b38	SLC35E2	-5.34	1.57e-07	-0.079005	45	0.014794	yes	ESPMSL
chr1_1654143_G_A_b38	SLC35E2	-5.34	1.57e-07	-0.079005	45	0.014794	yes	ESPMSL
chr1_1650777_G_A_b38	SLC35E2	-5.331	1.65e-07	-0.078808	45	0.014782	yes	ESPMSL
chr1_1660683_C_T_b38	SLC35E2	-5.322	1.73e-07	-0.082847	36	0.015568	yes	ESPMSL
chr1_1639348_G_T_b38	SLC35E2	-5.312	1.81e-07	-0.077323	55	0.014555	yes	ESPMSL
chr1_1652061_T_C_b38	SLC35E2	-5.31	1.83e-07	-0.078446	46	0.014772	yes	ESPMSL
chr1_1654188_T_G_b38	SLC35E2	-5.31	1.83e-07	-0.078446	46	0.014772	yes	ESPMSL
chr1_1651421_GTAGCCCCTCTGAACGGTCTGTGACACACGCATGCTTTCAGCTAGAGTACTCTA_G_b38	SLC35E2	-5.308	1.85e-07	-0.07896	44	0.014876	yes	ESPMSL
chr1_1650383_G_T_b38	SLC35E2	-5.295	1.98e-07	-0.083666	35	0.0158	yes	ESPMSL
chr1_1658866_G_A_b38	SLC35E2	-5.268	2.27e-07	-0.076595	49	0.014539	yes	ESPMSL
chr1_1664865_A_G_b38	SLC35E2	-5.268	2.28e-07	-0.07733	46	0.01468	yes	ESPMSL
chr1_1653934_G_A_b38	SLC35E2	-5.266	2.3e-07	-0.078094	45	0.014829	yes	ESPMSL
chr1_1651574_G_A_b38	SLC35E2	-5.265	2.31e-07	-0.077724	45	0.014764	yes	ESPMSL
chr1_1648826_A_G_b38	SLC35E2	-5.239	2.64e-07	-0.077092	53	0.014715	yes	ESPMSL
chr1_1651926_T_C_b38	SLC35E2	-5.23	2.76e-07	-0.077683	45	0.014853	yes	ESPMSL
chr1_1692124_T_G_b38	SLC35E2	-5.213	3.01e-07	-0.081899	35	0.015711	yes	ESPMSL
chr1_1639685_G_A_b38	SLC35E2	-5.196	3.28e-07	-0.085877	23	0.016529	yes	ESPMSL
chr1_1743851_C_T_b38	SLC35E2	-5.17	3.74e-07	-0.085959	34	0.016627	yes	ESPMSL
chr1_1650664_CTTTTT_C_b38	SLC35E2	-5.126	4.64e-07	-0.083251	28	0.01624	yes	ESPMSL
chr1_1742587_G_C_b38	SLC35E2	5.095	5.41e-07	0.069644	105	0.013668	yes	ESPMSL
chr1_1649846_G_A_b38	SLC35E2	-5.095	5.43e-07	-0.083664	21	0.016422	yes	ESPMSL
chr1_1664757_T_C_b38	SLC35E2	-5.082	5.77e-07	-0.073964	45	0.014554	yes	ESPMSL
chr1_1659060_G_A_b38	SLC35E2	-5.054	6.65e-07	-0.07793	35	0.015421	yes	ESPMSL
chr1_1650000_G_A_b38	SLC35E2	5.045	6.92e-07	0.070564	69	0.013986	yes	ESPMSL
chr1_1722625_A_T_b38	SLC35E2	5.008	8.31e-07	0.087555	32	0.017483	yes	ESPMSL
chr1_1744121_A_C_b38	SLC35E2	-4.984	9.36e-07	-0.096315	49	0.019326	yes	ESPMSL
chr1_1652913_C_T_b38	SLC35E2	-4.976	9.73e-07	-0.078114	33	0.015699	yes	ESPMSL
chr1_1648636_G_A_b38	SLC35E2	-4.959	1.05e-06	-0.073564	53	0.014833	yes	ESPMSL
chr1_1613769_C_T_b38	SLC35E2	4.958	1.06e-06	0.074229	49	0.014973	yes	ESPMSL
chr1_1744652_C_T_b38	SLC35E2	-4.957	1.06e-06	-0.069526	88	0.014025	yes	ESPMSL
chr1_1730405_G_C_b38	SLC35E2	4.943	1.14e-06	0.074592	69	0.015092	yes	ESPMSL
chr1_1612562_T_TC_b38	SLC35E2	4.936	1.18e-06	0.069372	56	0.014054	yes	ESPMSL
chr1_1744499_C_T_b38	SLC35E2	-4.936	1.18e-06	-0.067229	90	0.013621	yes	ESPMSL
chr1_1722619_C_T_b38	SLC35E2	4.927	1.23e-06	0.085455	34	0.017343	yes	ESPMSL
chr1_1660408_T_C_b38	SLC35E2	-4.916	1.3e-06	-0.087783	12	0.017857	yes	ESPMSL
chr1_1665581_C_G_b38	SLC35E2	-4.907	1.35e-06	-0.080516	23	0.016407	yes	ESPMSL
chr1_1743714_C_CA_b38	SLC35E2	4.888	1.49e-06	0.072882	65	0.014911	yes	ESPMSL
chr1_1743565_ATAT_A_b38	SLC35E2	-4.871	1.61e-06	-0.0654	82	0.013427	yes	ESPMSL
chr1_1638879_C_T_b38	SLC35E2	-4.845	1.83e-06	-0.07905	26	0.016317	yes	ESPMSL
chr1_1646352_A_C_b38	SLC35E2	4.833	1.93e-06	0.094651	11	0.019583	yes	ESPMSL
chr1_1621352_G_A_b38	SLC35E2	4.8	2.26e-06	0.068541	56	0.01428	yes	ESPMSL
chr1_1622295_G_C_b38	SLC35E2	4.735	3.06e-06	0.067615	55	0.014281	yes	ESPMSL
chr1_1729859_A_G_b38	SLC35E2	4.732	3.1e-06	0.083422	15	0.017628	yes	ESPMSL
chr1_1620609_G_A_b38	SLC35E2	4.702	3.57e-06	0.067211	55	0.014294	yes	ESPMSL
chr1_1667424_T_TAAATA_b38	SLC35E2	-4.682	3.91e-06	-0.063402	82	0.013541	yes	ESPMSL
chr1_1659940_A_C_b38	SLC35E2	-4.669	4.16e-06	-0.088195	10	0.01889	yes	ESPMSL
chr1_1708474_C_A_b38	SLC35E2	-4.628	5.03e-06	-0.081312	16	0.017571	yes	ESPMSL
chr1_1743238_G_C_b38	SLC35E2	-4.614	5.35e-06	-0.066223	76	0.014352	yes	ESPMSL
chr1_1629332_G_T_b38	SLC35E2	4.564	6.71e-06	0.06795	52	0.014888	yes	ESPMSL
chr1_1708521_C_G_b38	SLC35E2	-4.532	7.76e-06	-0.072373	29	0.015969	yes	ESPMSL
chr1_1742672_C_T_b38	SLC35E2	-4.503	8.85e-06	-0.064539	77	0.014333	yes	ESPMSL
chr1_1692286_C_A_b38	SLC35E2	4.502	8.87e-06	0.093851	4	0.020846	yes	ESPMSL
chr1_1630798_C_T_b38	SLC35E2	4.484	9.64e-06	0.066441	50	0.014819	yes	ESPMSL
chr1_1607931_G_A_b38	SLC35E2	4.468	1.03e-05	0.063955	54	0.014314	yes	ESPMSL
chr1_1609058_G_A_b38	SLC35E2	4.419	1.28e-05	0.06299	55	0.014255	yes	ESPMSL
chr1_1744096_C_T_b38	SLC35E2	-4.397	1.41e-05	-0.086635	47	0.019704	yes	ESPMSL
chr1_1743544_CA_C_b38	SLC35E2	4.375	1.56e-05	0.058935	95	0.013472	yes	ESPMSL
chr1_1600379_C_T_b38	SLC35E2	4.373	1.57e-05	0.062832	55	0.014367	yes	ESPMSL
chr1_1600320_C_G_b38	SLC35E2	4.357	1.69e-05	0.062873	52	0.014431	yes	ESPMSL
chr1_1606384_A_G_b38	SLC35E2	4.324	1.95e-05	0.060358	61	0.01396	yes	ESPMSL
chr1_1589495_CTTT_C_b38	SLC35E2	4.323	1.96e-05	0.070142	35	0.016227	yes	ESPMSL
chr1_1586962_C_T_b38	SLC35E2	4.292	2.23e-05	0.063779	53	0.014861	yes	ESPMSL
chr1_1728671_C_A_b38	SLC35E2	4.232	2.88e-05	0.076465	17	0.018068	yes	ESPMSL
chr1_1750440_G_A_b38	SLC35E2	-4.207	3.2e-05	-0.065881	62	0.015659	yes	ESPMSL
chr1_1750428_G_C_b38	SLC35E2	-4.169	3.76e-05	-0.065736	62	0.015766	yes	ESPMSL
chr1_1641261_C_T_b38	SLC35E2	-4.167	3.8e-05	-0.072185	19	0.017323	yes	ESPMSL
chr1_1743565_AT_A_b38	SLC35E2	4.139	4.27e-05	0.053756	110	0.012988	yes	ESPMSL
chr1_1595028_C_CAG_b38	SLC35E2	4.119	4.65e-05	0.064535	37	0.015669	yes	ESPMSL
chr1_1650688_T_A_b38	SLC35E2	-4.109	4.83e-05	-0.065033	34	0.015825	yes	ESPMSL
chr1_1743586_T_TAC_b38	SLC35E2	-4.106	4.9e-05	-0.060789	58	0.014806	yes	ESPMSL
chr1_1641275_A_G_b38	SLC35E2	-4.078	5.51e-05	-0.06105	51	0.014972	yes	ESPMSL
chr1_1674633_C_CA_b38	SLC35E2	4.041	6.41e-05	0.060295	57	0.014922	yes	ESPMSL
chr1_1606532_GTGGGCTGGGCTGGTCAGGCA_G_b38	SLC35E2	4.032	6.64e-05	0.05896	48	0.014623	yes	ESPMSL
chr1_1866635_T_TA_b38	SLC35E2	4.011	7.22e-05	0.062306	53	0.015532	yes	ESPMSL
chr1_1749826_A_G_b38	SLC35E2	-3.996	7.68e-05	-0.054041	113	0.013523	yes	ESPMSL
chr1_1753033_C_T_b38	SLC35E2	-3.988	7.95e-05	-0.056802	104	0.014244	yes	ESPMSL
chr1_1635226_T_C_b38	SLC35E2	-3.977	8.29e-05	-0.077661	9	0.019526	yes	ESPMSL
chr1_1971864_C_T_b38	SLC35E2	3.942	9.57e-05	0.056636	74	0.014368	yes	ESPMSL
chr1_1717507_T_C_b38	SLC35E2	3.906	0.000111	0.083478	16	0.021373	yes	ESPMSL
chr1_1746522_GT_G_b38	SLC35E2	-3.895	0.000115	-0.067625	29	0.01736	yes	ESPMSL
chr1_1739519_C_G_b38	SLC35E2	3.817	0.000157	0.064775	32	0.016968	yes	ESPMSL
chr1_1658422_T_C_b38	SLC35E2	3.813	0.000159	0.064899	23	0.017021	yes	ESPMSL
chr1_1650664_CT_C_b38	SLC35E2	3.795	0.000171	0.061919	38	0.016315	yes	ESPMSL
chr1_1688619_AAAC_A_b38	SLC35E2	-3.759	0.000197	-0.06209	44	0.01652	yes	ESPMSL
chr1_1752461_G_A_b38	SLC35E2	-3.744	0.000208	-0.054386	95	0.014526	yes	ESPMSL
chr1_1747695_A_G_b38	SLC35E2	-3.741	0.000211	-0.045709	104	0.01222	yes	ESPMSL
chr1_1851414_GA_G_b38	SLC35E2	-3.727	0.000222	-0.057273	55	0.015367	yes	ESPMSL
chr1_1732892_CT_C_b38	SLC35E2	3.722	0.000226	0.073055	9	0.019627	yes	ESPMSL
chr1_1752730_C_G_b38	SLC35E2	-3.716	0.000232	-0.053889	95	0.014502	yes	ESPMSL
chr1_1725582_T_C_b38	SLC35E2	3.692	0.000254	0.048359	98	0.013099	yes	ESPMSL
chr1_1798925_C_CT_b38	SLC35E2	-3.69	0.000256	-0.055278	44	0.014982	yes	ESPMSL
chr1_1755504_T_C_b38	SLC35E2	3.68	0.000265	0.04984	104	0.013542	yes	ESPMSL
chr1_1965001_G_A_b38	SLC35E2	3.668	0.000278	0.055093	33	0.015021	yes	ESPMSL
chr1_1591703_T_C_b38	SLC35E2	3.664	0.000282	0.050652	91	0.013823	yes	ESPMSL
chr1_1965250_G_GA_b38	SLC35E2	3.65	0.000298	0.05466	34	0.014977	yes	ESPMSL
chr1_1752126_G_A_b38	SLC35E2	3.639	0.00031	0.056745	54	0.015594	yes	ESPMSL
chr1_1976566_T_C_b38	SLC35E2	3.635	0.000314	0.052089	83	0.014329	yes	ESPMSL
chr1_1609196_CA_C_b38	SLC35E2	3.634	0.000316	0.061135	36	0.016823	yes	ESPMSL
chr1_1753319_G_A_b38	SLC35E2	-3.591	0.00037	-0.052145	95	0.014519	yes	ESPMSL
chr1_1753361_G_A_b38	SLC35E2	-3.579	0.000388	-0.052095	95	0.014556	yes	ESPMSL
chr1_1722599_G_A_b38	SLC35E2	3.577	0.000391	0.058376	52	0.01632	yes	ESPMSL
chr1_1759354_G_A_b38	SLC35E2	-3.564	0.000411	-0.051874	96	0.014556	yes	ESPMSL
chr1_1688647_G_A_b38	SLC35E2	-3.555	0.000424	-0.058537	46	0.016466	yes	ESPMSL
chr1_1624323_AT_A_b38	SLC35E2	3.554	0.000425	0.050091	72	0.014094	yes	ESPMSL
chr1_1759611_C_T_b38	SLC35E2	-3.553	0.000427	-0.051591	99	0.01452	yes	ESPMSL
chr1_1750226_C_T_b38	SLC35E2	3.544	0.000442	0.051508	78	0.014535	yes	ESPMSL
chr1_1757725_C_T_b38	SLC35E2	3.516	0.00049	0.051353	72	0.014607	yes	ESPMSL
chr1_1968012_GTGAA_G_b38	SLC35E2	3.513	0.000494	0.053163	33	0.015132	yes	ESPMSL
chr1_1967980_A_AAGAATGAG_b38	SLC35E2	3.498	0.000522	0.053517	31	0.015299	yes	ESPMSL
chr1_1756043_G_T_b38	SLC35E2	-3.493	0.000531	-0.050885	96	0.014567	yes	ESPMSL
chr1_1751981_A_T_b38	SLC35E2	-3.476	0.000565	-0.05635	44	0.016211	yes	ESPMSL
chr1_1081790_C_G_b38	SLC35E2	-3.469	0.00058	-0.046258	108	0.013335	yes	ESPMSL
chr1_1964663_G_A_b38	SLC35E2	3.467	0.000584	0.052726	32	0.015208	yes	ESPMSL
chr1_1963406_G_A_b38	SLC35E2	3.453	0.000613	0.052597	32	0.01523	yes	ESPMSL
chr1_1963738_C_T_b38	SLC35E2	3.437	0.000651	0.052615	31	0.015309	yes	ESPMSL
chr1_1965114_C_T_b38	SLC35E2	3.437	0.000651	0.052615	31	0.015309	yes	ESPMSL
chr1_1966910_C_T_b38	SLC35E2	3.437	0.000651	0.052615	31	0.015309	yes	ESPMSL
chr1_1750280_A_G_b38	SLC35E2	-3.428	0.000672	-0.048711	105	0.014209	yes	ESPMSL
chr1_1675228_C_CG_b38	SLC35E2	3.427	0.000674	0.05314	64	0.015505	yes	ESPMSL
chr1_1968130_GTGAA_G_b38	SLC35E2	3.421	0.000688	0.052463	31	0.015334	yes	ESPMSL
chr1_1966152_C_T_b38	SLC35E2	3.421	0.000688	0.052069	32	0.015219	yes	ESPMSL
chr1_1627515_C_T_b38	SLC35E2	3.419	0.000695	0.047451	88	0.013879	yes	ESPMSL
chr1_1688102_G_A_b38	SLC35E2	-3.41	0.000717	-0.056407	31	0.016542	yes	ESPMSL
chr1_1968585_TG_T_b38	SLC35E2	3.407	0.000725	0.051873	32	0.015226	yes	ESPMSL
chr1_1968924_GCCCTCCTGGGGGCTCCGGTCCTGCCCAGCAGCCCCAGGTGAGACAGCGCCTGGCGGCCCCTCCCTAGCT_G_b38	SLC35E2	3.406	0.000726	0.051649	33	0.015162	yes	ESPMSL
chr1_1964101_A_G_b38	SLC35E2	3.406	0.000726	0.051839	32	0.015219	yes	ESPMSL
chr1_1964746_T_C_b38	SLC35E2	3.406	0.000726	0.051839	32	0.015219	yes	ESPMSL
chr1_1964784_C_T_b38	SLC35E2	3.406	0.000726	0.051839	32	0.015219	yes	ESPMSL
chr1_1966030_A_G_b38	SLC35E2	3.406	0.000726	0.051839	32	0.015219	yes	ESPMSL
chr1_1966314_C_G_b38	SLC35E2	3.406	0.000726	0.051839	32	0.015219	yes	ESPMSL
chr1_1966930_G_A_b38	SLC35E2	3.406	0.000726	0.051839	32	0.015219	yes	ESPMSL
chr1_1967246_T_C_b38	SLC35E2	3.406	0.000726	0.051839	32	0.015219	yes	ESPMSL
chr1_1967338_G_C_b38	SLC35E2	3.406	0.000726	0.051839	32	0.015219	yes	ESPMSL
chr1_1967340_C_A_b38	SLC35E2	3.406	0.000726	0.051839	32	0.015219	yes	ESPMSL
chr1_1967389_T_C_b38	SLC35E2	3.406	0.000726	0.051839	32	0.015219	yes	ESPMSL
chr1_1967396_C_A_b38	SLC35E2	3.406	0.000726	0.051839	32	0.015219	yes	ESPMSL
chr1_1967420_G_A_b38	SLC35E2	3.406	0.000726	0.051839	32	0.015219	yes	ESPMSL
chr1_1967495_T_C_b38	SLC35E2	3.406	0.000726	0.051839	32	0.015219	yes	ESPMSL
chr1_1967536_G_A_b38	SLC35E2	3.406	0.000726	0.051839	32	0.015219	yes	ESPMSL
chr1_1967725_G_C_b38	SLC35E2	3.406	0.000726	0.051839	32	0.015219	yes	ESPMSL
chr1_1967840_A_T_b38	SLC35E2	3.406	0.000726	0.051839	32	0.015219	yes	ESPMSL
chr1_1967880_T_C_b38	SLC35E2	3.406	0.000726	0.051839	32	0.015219	yes	ESPMSL
chr1_1968103_A_ATGAG_b38	SLC35E2	3.406	0.000726	0.051839	32	0.015219	yes	ESPMSL
chr1_1968422_C_T_b38	SLC35E2	3.406	0.000726	0.051839	32	0.015219	yes	ESPMSL
chr1_1968667_T_TCTC_b38	SLC35E2	3.406	0.000726	0.051839	32	0.015219	yes	ESPMSL
chr1_1748780_G_A_b38	SLC35E2	-3.401	0.000741	-0.048758	109	0.014338	yes	ESPMSL
chr1_1731093_G_C_b38	SLC35E2	-3.399	0.000745	-0.137494	3	0.040449	yes	ESPMSL
chr1_1735087_A_C_b38	SLC35E2	-3.399	0.000745	-0.137494	3	0.040449	yes	ESPMSL
chr1_1735286_G_A_b38	SLC35E2	-3.399	0.000745	-0.137494	3	0.040449	yes	ESPMSL
chr1_1755523_C_T_b38	SLC35E2	3.388	0.000776	0.047218	106	0.013939	yes	ESPMSL
chr1_1752908_C_CCCT_b38	SLC35E2	-3.377	0.000807	-0.051189	81	0.01516	yes	ESPMSL
chr1_1613330_A_AT_b38	SLC35E2	-3.37	0.000827	-0.054805	39	0.016264	yes	ESPMSL
chr1_1968900_A_G_b38	SLC35E2	3.369	0.00083	0.051148	34	0.015184	yes	ESPMSL
chr1_1729403_C_T_b38	SLC35E2	-3.361	0.000852	-0.137042	3	0.04077	yes	ESPMSL
chr1_1730099_A_G_b38	SLC35E2	-3.361	0.000852	-0.137042	3	0.04077	yes	ESPMSL
chr1_1649954_C_CA_b38	SLC35E2	-3.358	0.000863	-0.058404	21	0.017395	yes	ESPMSL
chr1_1969235_A_G_b38	SLC35E2	3.357	0.000864	0.054414	26	0.016208	yes	ESPMSL
chr1_1969015_A_G_b38	SLC35E2	3.354	0.000874	0.04913	99	0.014649	yes	ESPMSL
chr1_1969006_C_T_b38	SLC35E2	3.353	0.000877	0.050901	33	0.015181	yes	ESPMSL
chr1_1750589_G_A_b38	SLC35E2	-3.353	0.000877	-0.080147	12	0.023905	yes	ESPMSL
chr1_1754601_G_T_b38	SLC35E2	3.347	0.000896	0.048826	72	0.014589	yes	ESPMSL
chr1_1966606_G_A_b38	SLC35E2	3.336	0.00093	0.051126	31	0.015325	yes	ESPMSL
chr1_1624086_G_A_b38	SLC35E2	-3.327	0.00096	-0.048047	74	0.014441	yes	ESPMSL
chr1_1754482_TCCCTGGGACCGAAGTCGCCCCA_T_b38	SLC35E2	-3.314	0.001	-0.048026	97	0.01449	yes	ESPMSL
chr1_1764023_C_A_b38	SLC35E2	3.312	0.00101	0.047508	77	0.014343	yes	ESPMSL
chr1_1968893_A_G_b38	SLC35E2	3.309	0.00102	0.052479	25	0.015858	yes	ESPMSL
chr1_1986752_A_G_b38	SLC35E2	3.307	0.00103	0.049737	78	0.015038	yes	ESPMSL
chr1_1728274_G_C_b38	SLC35E2	-3.301	0.00105	-0.133702	3	0.040501	yes	ESPMSL
chr1_1595306_CAG_C_b38	SLC35E2	-3.289	0.0011	-0.048859	102	0.014857	yes	ESPMSL
chr1_1756186_T_C_b38	SLC35E2	3.284	0.00112	0.046705	76	0.014222	yes	ESPMSL
chr1_1962845_T_C_b38	SLC35E2	3.277	0.00114	0.050206	31	0.015321	yes	ESPMSL
chr1_1675132_A_G_b38	SLC35E2	3.271	0.00117	0.05085	52	0.015547	yes	ESPMSL
chr1_1650370_C_CT_b38	SLC35E2	-3.267	0.00118	-0.058796	22	0.017996	yes	ESPMSL
chr1_2312125_G_A_b38	SLC35E2	-3.256	0.00123	-0.044959	120	0.013806	yes	ESPMSL
chr1_1969249_A_AGCCCT_b38	SLC35E2	3.254	0.00124	0.05385	25	0.016548	yes	ESPMSL
chr1_1931743_CA_C_b38	SLC35E2	-3.254	0.00124	-0.056007	32	0.017213	yes	ESPMSL
chr1_1760882_T_C_b38	SLC35E2	3.236	0.00131	0.044301	93	0.013688	yes	ESPMSL
chr1_1746440_A_G_b38	SLC35E2	-3.219	0.00139	-0.056351	28	0.017506	yes	ESPMSL
chr1_1969238_C_T_b38	SLC35E2	3.21	0.00143	0.052094	26	0.016227	yes	ESPMSL
chr1_1688786_G_A_b38	SLC35E2	-3.209	0.00144	-0.059292	25	0.018477	yes	ESPMSL
chr1_1736729_G_T_b38	SLC35E2	3.197	0.0015	0.043758	117	0.013687	yes	ESPMSL
chr1_1585900_C_T_b38	SLC35E2	3.184	0.00157	0.086462	4	0.027156	yes	ESPMSL
chr1_1757074_G_T_b38	SLC35E2	3.179	0.00159	0.045663	74	0.014363	yes	ESPMSL
chr1_2334639_T_C_b38	SLC35E2	-3.169	0.00165	-0.042957	125	0.013556	yes	ESPMSL
chr1_1987547_C_CT_b38	SLC35E2	3.159	0.00171	0.049183	81	0.015569	yes	ESPMSL
chr1_1688442_T_C_b38	SLC35E2	-3.157	0.00172	-0.052454	40	0.016616	yes	ESPMSL
chr1_1672155_G_A_b38	SLC35E2	-3.149	0.00176	-0.049317	37	0.015661	yes	ESPMSL
chr1_1970506_T_A_b38	SLC35E2	-3.138	0.00183	-0.044453	75	0.014168	yes	ESPMSL
chr1_1740343_C_T_b38	SLC35E2	3.134	0.00185	0.043014	118	0.013723	yes	ESPMSL
chr1_1691417_T_C_b38	SLC35E2	3.13	0.00188	0.04725	88	0.015094	yes	ESPMSL
chr1_1075337_C_T_b38	SLC35E2	-3.119	0.00195	-0.042233	98	0.01354	yes	ESPMSL
chr1_1052514_C_CGT_b38	SLC35E2	-3.107	0.00203	-0.043621	94	0.014041	yes	ESPMSL
chr1_1740869_C_T_b38	SLC35E2	-3.105	0.00204	-0.128462	3	0.04137	yes	ESPMSL
chr1_1741174_TTCA_T_b38	SLC35E2	-3.105	0.00204	-0.128462	3	0.04137	yes	ESPMSL
chr1_1741497_G_A_b38	SLC35E2	-3.105	0.00204	-0.128462	3	0.04137	yes	ESPMSL
chr1_1079456_A_G_b38	SLC35E2	-3.092	0.00213	-0.041235	116	0.013335	yes	ESPMSL
chr1_1969229_T_A_b38	SLC35E2	3.081	0.00221	0.04993	26	0.016208	yes	ESPMSL
chr1_1034279_G_A_b38	SLC35E2	3.072	0.00227	0.045995	42	0.014971	yes	ESPMSL
chr1_1945842_A_AAAAGAAC_b38	SLC35E2	-3.04	0.00253	-0.046071	69	0.015156	yes	ESPMSL
chr1_1976870_C_CAG_b38	SLC35E2	3.039	0.00253	0.045246	44	0.01489	yes	ESPMSL
chr1_1976855_C_CTT_b38	SLC35E2	3.028	0.00262	0.0496	26	0.01638	yes	ESPMSL
chr1_1625951_G_A_b38	SLC35E2	-3.022	0.00268	-0.043977	61	0.014554	yes	ESPMSL
chr1_1977879_G_A_b38	SLC35E2	3.019	0.00271	0.045155	45	0.01496	yes	ESPMSL
chr1_1969479_G_A_b38	SLC35E2	3.017	0.00271	0.049398	26	0.016371	yes	ESPMSL
chr1_1594599_T_C_b38	SLC35E2	3.017	0.00272	0.084745	3	0.028089	yes	ESPMSL
chr1_1981144_T_G_b38	SLC35E2	3.013	0.00276	0.047784	32	0.015861	yes	ESPMSL
chr1_1750508_A_C_b38	SLC35E2	-3.006	0.00282	-0.037582	101	0.012503	yes	ESPMSL
chr1_1708486_C_A_b38	SLC35E2	3.004	0.00283	0.038029	100	0.012658	yes	ESPMSL
chr1_1755713_G_A_b38	SLC35E2	-3.002	0.00286	-0.042555	86	0.014177	yes	ESPMSL
chr1_1073854_T_C_b38	SLC35E2	-3.001	0.00286	-0.040203	104	0.013398	yes	ESPMSL
chr1_1987049_A_G_b38	SLC35E2	2.99	0.00297	0.044484	80	0.014879	yes	ESPMSL
chr1_1738295_G_T_b38	SLC35E2	2.99	0.00297	0.040806	118	0.01365	yes	ESPMSL
chr1_1086657_C_T_b38	SLC35E2	-2.982	0.00304	-0.039841	107	0.013359	yes	ESPMSL
chr1_1671724_C_T_b38	SLC35E2	-2.967	0.00319	-0.047889	30	0.016139	yes	ESPMSL
chr1_1726904_T_C_b38	SLC35E2	2.965	0.00321	0.040176	104	0.013551	yes	ESPMSL
chr1_1828894_T_TAC_b38	SLC35E2	2.963	0.00323	0.042953	82	0.014497	yes	ESPMSL
chr1_1079746_A_G_b38	SLC35E2	-2.961	0.00325	-0.040443	97	0.013658	yes	ESPMSL
chr1_1978262_C_T_b38	SLC35E2	2.951	0.00335	0.044065	45	0.014931	yes	ESPMSL
chr1_1978294_G_T_b38	SLC35E2	2.951	0.00335	0.044065	45	0.014931	yes	ESPMSL
chr1_1779667_T_TTG_b38	SLC35E2	2.948	0.00339	0.044779	61	0.015189	yes	ESPMSL
chr1_1737504_A_C_b38	SLC35E2	2.943	0.00344	0.039729	123	0.013498	yes	ESPMSL
chr1_1982826_T_C_b38	SLC35E2	2.937	0.00351	0.04403	45	0.014992	yes	ESPMSL
chr1_1984586_G_A_b38	SLC35E2	2.937	0.00351	0.04403	45	0.014992	yes	ESPMSL
chr1_1657081_C_T_b38	SLC35E2	-2.935	0.00353	-0.049132	32	0.01674	yes	ESPMSL
chr1_1978114_T_A_b38	SLC35E2	2.924	0.00366	0.043994	45	0.015046	yes	ESPMSL
chr1_1688586_C_T_b38	SLC35E2	-2.92	0.00371	-0.051141	33	0.017517	yes	ESPMSL
chr1_1688457_G_A_b38	SLC35E2	-2.917	0.00374	-0.049029	42	0.016808	yes	ESPMSL
chr1_1708505_G_C_b38	SLC35E2	2.915	0.00376	0.037337	74	0.01281	yes	ESPMSL
chr1_981282_A_C_b38	SLC35E2	2.903	0.0039	0.049453	19	0.017034	yes	ESPMSL
chr1_1083324_A_G_b38	SLC35E2	-2.901	0.00393	-0.03933	97	0.013557	yes	ESPMSL
chr1_2327034_G_A_b38	SLC35E2	-2.898	0.00396	-0.041678	63	0.01438	yes	ESPMSL
chr1_1081817_C_T_b38	SLC35E2	-2.897	0.00397	-0.039677	122	0.013694	yes	ESPMSL
chr1_1972273_C_A_b38	SLC35E2	2.894	0.00401	0.044257	41	0.015291	yes	ESPMSL
chr1_1731963_A_C_b38	SLC35E2	2.894	0.00402	0.039366	120	0.013604	yes	ESPMSL
chr1_1978404_C_T_b38	SLC35E2	2.891	0.00406	0.043388	44	0.015009	yes	ESPMSL
chr1_1978415_G_A_b38	SLC35E2	2.891	0.00406	0.043388	44	0.015009	yes	ESPMSL
chr1_2326288_C_T_b38	SLC35E2	-2.889	0.00407	-0.041428	60	0.014338	yes	ESPMSL
chr1_2326884_C_T_b38	SLC35E2	-2.889	0.00407	-0.041428	60	0.014338	yes	ESPMSL
chr1_1983166_A_T_b38	SLC35E2	2.876	0.00424	0.043348	44	0.015071	yes	ESPMSL
chr1_1983956_TGG_T_b38	SLC35E2	2.876	0.00424	0.043348	44	0.015071	yes	ESPMSL
chr1_1984595_C_T_b38	SLC35E2	2.876	0.00424	0.043348	44	0.015071	yes	ESPMSL
chr1_1984859_C_T_b38	SLC35E2	2.876	0.00424	0.043348	44	0.015071	yes	ESPMSL
chr1_1985148_G_T_b38	SLC35E2	2.876	0.00424	0.043348	44	0.015071	yes	ESPMSL
chr1_2314131_C_G_b38	SLC35E2	-2.876	0.00425	-0.042867	52	0.014907	yes	ESPMSL
chr1_1978562_C_G_b38	SLC35E2	2.872	0.0043	0.043001	45	0.014975	yes	ESPMSL
chr1_1978573_T_C_b38	SLC35E2	2.872	0.0043	0.043001	45	0.014975	yes	ESPMSL
chr1_1978797_T_C_b38	SLC35E2	2.872	0.0043	0.043001	45	0.014975	yes	ESPMSL
chr1_1986010_T_G_b38	SLC35E2	2.872	0.0043	0.043001	45	0.014975	yes	ESPMSL
chr1_982112_C_T_b38	SLC35E2	2.862	0.00443	0.049127	18	0.017163	yes	ESPMSL
chr1_1732392_C_T_b38	SLC35E2	2.86	0.00446	0.038978	119	0.013627	yes	ESPMSL
chr1_1734903_A_G_b38	SLC35E2	2.86	0.00446	0.038978	119	0.013627	yes	ESPMSL
chr1_1735176_C_T_b38	SLC35E2	2.86	0.00446	0.038978	119	0.013627	yes	ESPMSL
chr1_1735980_A_C_b38	SLC35E2	2.86	0.00446	0.038978	119	0.013627	yes	ESPMSL
chr1_1740703_C_T_b38	SLC35E2	2.86	0.00446	0.038978	119	0.013627	yes	ESPMSL
chr1_1606507_GTGGGC_G_b38	SLC35E2	2.834	0.00484	0.039478	111	0.013932	yes	ESPMSL
chr1_1584321_T_C_b38	SLC35E2	-2.827	0.00494	-0.040984	71	0.014498	yes	ESPMSL
chr1_1978006_A_G_b38	SLC35E2	2.822	0.00501	0.042321	45	0.014996	yes	ESPMSL
chr1_1985090_C_T_b38	SLC35E2	2.818	0.00507	0.041588	62	0.014757	yes	ESPMSL
chr1_2326424_C_T_b38	SLC35E2	-2.817	0.00509	-0.040448	60	0.014358	yes	ESPMSL
chr1_1982312_C_T_b38	SLC35E2	2.816	0.00511	0.051514	12	0.018294	yes	ESPMSL
chr1_1714674_G_C_b38	SLC35E2	2.811	0.00519	0.056893	31	0.020242	yes	ESPMSL
chr1_1976473_C_T_b38	SLC35E2	2.81	0.0052	0.0423	44	0.015052	yes	ESPMSL
chr1_1976573_T_C_b38	SLC35E2	2.81	0.0052	0.0423	44	0.015052	yes	ESPMSL
chr1_1976600_C_T_b38	SLC35E2	2.81	0.0052	0.0423	44	0.015052	yes	ESPMSL
chr1_1976661_G_T_b38	SLC35E2	2.81	0.0052	0.0423	44	0.015052	yes	ESPMSL
chr1_1976946_C_T_b38	SLC35E2	2.81	0.0052	0.0423	44	0.015052	yes	ESPMSL
chr1_1977264_C_G_b38	SLC35E2	2.81	0.0052	0.0423	44	0.015052	yes	ESPMSL
chr1_1977765_A_G_b38	SLC35E2	2.81	0.0052	0.0423	44	0.015052	yes	ESPMSL
chr1_1978647_G_T_b38	SLC35E2	2.81	0.0052	0.0423	44	0.015052	yes	ESPMSL
chr1_1980953_G_A_b38	SLC35E2	2.81	0.0052	0.0423	44	0.015052	yes	ESPMSL
chr1_1981319_G_C_b38	SLC35E2	2.81	0.0052	0.0423	44	0.015052	yes	ESPMSL
chr1_1986033_G_A_b38	SLC35E2	2.81	0.0052	0.0423	44	0.015052	yes	ESPMSL
chr1_1986176_A_T_b38	SLC35E2	2.81	0.0052	0.0423	44	0.015052	yes	ESPMSL
chr1_1986390_T_G_b38	SLC35E2	2.81	0.0052	0.0423	44	0.015052	yes	ESPMSL
chr1_1986469_A_C_b38	SLC35E2	2.81	0.0052	0.0423	44	0.015052	yes	ESPMSL
chr1_1987096_A_T_b38	SLC35E2	2.81	0.0052	0.0423	44	0.015052	yes	ESPMSL
chr1_1987156_G_A_b38	SLC35E2	2.81	0.0052	0.0423	44	0.015052	yes	ESPMSL
chr1_1676287_C_T_b38	SLC35E2	-2.81	0.0052	-0.052173	10	0.018568	yes	ESPMSL
chr1_1657085_C_CTAA_b38	SLC35E2	-2.798	0.0054	-0.047104	32	0.016838	yes	ESPMSL
chr1_1734174_A_G_b38	SLC35E2	2.796	0.00542	0.037991	119	0.013585	yes	ESPMSL
chr1_1848037_C_CTA_b38	SLC35E2	2.796	0.00543	0.039654	89	0.014185	yes	ESPMSL
chr1_1594890_G_GAC_b38	SLC35E2	-2.791	0.00551	-0.038135	96	0.013664	yes	ESPMSL
chr1_1657926_A_AG_b38	SLC35E2	-2.785	0.00561	-0.050425	17	0.018106	yes	ESPMSL
chr1_1978055_C_T_b38	SLC35E2	2.783	0.00565	0.04192	44	0.015064	yes	ESPMSL
chr1_1750528_G_A_b38	SLC35E2	-2.78	0.00569	-0.035703	97	0.012843	yes	ESPMSL
chr1_1726649_G_A_b38	SLC35E2	-2.78	0.0057	-0.109326	5	0.039329	yes	ESPMSL
chr1_2324977_G_GGCT_b38	SLC35E2	-2.778	0.00572	-0.040733	59	0.014661	yes	ESPMSL
chr1_1986211_T_C_b38	SLC35E2	2.777	0.00576	0.041976	44	0.015118	yes	ESPMSL
chr1_976536_C_T_b38	SLC35E2	2.776	0.00577	0.047958	17	0.017279	yes	ESPMSL
chr1_982890_C_T_b38	SLC35E2	2.775	0.00579	0.047696	18	0.01719	yes	ESPMSL
chr1_983237_G_A_b38	SLC35E2	2.775	0.00579	0.047696	18	0.01719	yes	ESPMSL
chr1_1747472_A_T_b38	SLC35E2	-2.774	0.00579	-0.04083	96	0.014717	yes	ESPMSL
chr1_1079484_T_A_b38	SLC35E2	-2.763	0.00599	-0.037201	109	0.013463	yes	ESPMSL
chr1_1748597_C_G_b38	SLC35E2	-2.756	0.00612	-0.040573	97	0.01472	yes	ESPMSL
chr1_1082764_T_C_b38	SLC35E2	-2.755	0.00615	-0.03817	111	0.013856	yes	ESPMSL
chr1_1083800_T_C_b38	SLC35E2	-2.754	0.00615	-0.037484	95	0.013608	yes	ESPMSL
chr1_1079877_A_G_b38	SLC35E2	-2.754	0.00615	-0.037845	93	0.01374	yes	ESPMSL
chr1_1985619_A_G_b38	SLC35E2	2.75	0.00624	0.040743	55	0.014818	yes	ESPMSL
chr1_1014228_G_A_b38	SLC35E2	2.747	0.00629	0.038615	72	0.014056	yes	ESPMSL
chr1_1976990_T_C_b38	SLC35E2	2.747	0.00629	0.041243	45	0.015013	yes	ESPMSL
chr1_1984601_T_C_b38	SLC35E2	2.745	0.00632	0.041227	45	0.015017	yes	ESPMSL
chr1_1026830_A_G_b38	SLC35E2	2.743	0.00636	0.039553	61	0.014419	yes	ESPMSL
chr1_1662855_T_C_b38	SLC35E2	-2.742	0.00638	-0.062134	27	0.02266	yes	ESPMSL
chr1_2326492_G_A_b38	SLC35E2	-2.736	0.0065	-0.042758	35	0.015628	yes	ESPMSL
chr1_1989523_T_C_b38	SLC35E2	2.734	0.00654	0.04197	67	0.015351	yes	ESPMSL
chr1_1686147_T_G_b38	SLC35E2	-2.733	0.00657	-0.038826	74	0.014209	yes	ESPMSL
chr1_1987145_C_T_b38	SLC35E2	2.728	0.00665	0.040566	48	0.014868	yes	ESPMSL
chr1_1976646_A_G_b38	SLC35E2	2.728	0.00667	0.041285	43	0.015136	yes	ESPMSL
chr1_1978429_G_A_b38	SLC35E2	2.725	0.00672	0.042251	34	0.015507	yes	ESPMSL
chr1_1024462_C_T_b38	SLC35E2	2.723	0.00675	0.040642	49	0.014923	yes	ESPMSL
chr1_1032846_C_A_b38	SLC35E2	2.719	0.00683	0.039752	49	0.014618	yes	ESPMSL
chr1_1679993_A_G_b38	SLC35E2	-2.718	0.00685	-0.037453	100	0.013778	yes	ESPMSL
chr1_1971434_C_T_b38	SLC35E2	2.711	0.00701	0.042629	32	0.015726	yes	ESPMSL
chr1_1983507_C_T_b38	SLC35E2	2.705	0.00712	0.042078	34	0.015553	yes	ESPMSL
chr1_981935_G_A_b38	SLC35E2	2.702	0.00718	0.046135	19	0.017072	yes	ESPMSL
chr1_1985451_C_T_b38	SLC35E2	2.684	0.00757	0.03959	63	0.014748	yes	ESPMSL
chr1_1844830_C_A_b38	SLC35E2	2.682	0.00763	0.038073	88	0.014195	yes	ESPMSL
chr1_1688531_T_C_b38	SLC35E2	-2.672	0.00786	-0.047666	30	0.017842	yes	ESPMSL
chr1_1687236_T_G_b38	SLC35E2	-2.67	0.00791	-0.037766	74	0.014147	yes	ESPMSL
chr1_1781909_C_T_b38	SLC35E2	2.667	0.00796	0.03766	90	0.01412	yes	ESPMSL
chr1_1820337_A_G_b38	SLC35E2	2.645	0.0085	0.036974	93	0.01398	yes	ESPMSL
chr1_1597128_C_CCCTCAGCTGGACT_b38	SLC35E2	-2.641	0.0086	-0.036301	79	0.013746	yes	ESPMSL
chr1_1022868_A_G_b38	SLC35E2	2.635	0.00875	0.037723	61	0.014316	yes	ESPMSL
chr1_1681928_C_A_b38	SLC35E2	-2.625	0.009	-0.037767	74	0.014388	yes	ESPMSL
chr1_2680248_G_A_b38	SLC35E2	-2.623	0.00906	-0.070325	5	0.026813	yes	ESPMSL
chr1_1688570_A_T_b38	SLC35E2	-2.622	0.00907	-0.047598	18	0.018152	yes	ESPMSL
chr1_978230_G_A_b38	SLC35E2	2.621	0.0091	0.044741	19	0.017068	yes	ESPMSL
chr1_1762759_AAATG_A_b38	SLC35E2	2.619	0.00916	0.036769	91	0.014039	yes	ESPMSL
chr1_1708951_C_T_b38	SLC35E2	2.611	0.00936	0.036369	88	0.013927	yes	ESPMSL
chr1_1981062_A_G_b38	SLC35E2	2.606	0.00952	0.038789	49	0.014886	yes	ESPMSL
chr1_1981291_A_G_b38	SLC35E2	2.606	0.00952	0.038789	49	0.014886	yes	ESPMSL
chr1_1981295_T_C_b38	SLC35E2	2.606	0.00952	0.038789	49	0.014886	yes	ESPMSL
chr1_1880596_T_A_b38	SLC35E2	-2.605	0.00953	-0.038817	85	0.014899	yes	ESPMSL
chr1_1739115_T_C_b38	SLC35E2	-2.604	0.00955	-0.096498	8	0.037052	yes	ESPMSL
chr1_1742432_T_TA_b38	SLC35E2	2.601	0.00966	0.037895	73	0.014571	yes	ESPMSL
chr1_1836856_CT_C_b38	SLC35E2	2.6	0.00967	0.046464	24	0.01787	yes	ESPMSL
chr1_992967_GGGAGGGTCCATGTGTCCGTCATCTGA_G_b38	SLC35E2	-2.592	0.00988	-0.036668	127	0.014144	yes	ESPMSL
chr1_933038_C_T_b38	SLC35E2	2.591	0.00994	0.041106	38	0.015867	yes	ESPMSL
chr1_1743886_C_T_b38	SLC35E2	-5.208	3.09e-07	-0.084001	39	0.01613	no	ESPMSL
chr1_1660318_C_T_b38	SLC35E2	5.088	5.63e-07	0.11005	3	0.021631	no	ESPMSL
chr1_1744854_C_A_b38	SLC35E2	-4.917	1.29e-06	-0.065328	74	0.013285	no	ESPMSL
chr1_2676824_ACGGCC_A_b38	SLC35E2	-4.605	5.59e-06	-0.188857	5	0.041015	no	ESPMSL
chr1_1653863_C_A_b38	SLC35E2	-4.581	6.22e-06	-0.082662	13	0.018044	no	ESPMSL
chr1_1736801_CA_C_b38	SLC35E2	4.154	4e-05	0.07475	44	0.017993	no	ESPMSL
chr1_1751442_C_T_b38	SLC35E2	3.907	0.00011	0.07998	3	0.02047	no	ESPMSL
chr1_1702383_T_C_b38	SLC35E2	-3.737	0.000214	-0.060925	24	0.016305	no	ESPMSL
chr1_1708855_TTCCTCCTCC_T_b38	SLC35E2	3.636	0.000314	0.052515	92	0.014443	no	ESPMSL
chr1_1717604_CGCTTTCAGCTAGAGTTTGCTCTCTCTGGTTTTCGGTCTGTGACACACGCAT_C_b38	SLC35E2	3.61	0.000346	0.049415	79	0.013688	no	ESPMSL
chr1_1698048_T_C_b38	SLC35E2	-3.535	0.000457	-0.116867	5	0.033064	no	ESPMSL
chr1_2676830_TGGAACAGCACCCACACCCCCA_T_b38	SLC35E2	-3.523	0.000477	-0.155905	4	0.044259	no	ESPMSL
chr1_799081_G_GA_b38	SLC35E2	-3.507	0.000506	-0.149284	3	0.042569	no	ESPMSL
chr1_1693256_GT_G_b38	SLC35E2	-3.293	0.00108	-0.112544	6	0.034179	no	ESPMSL
chr1_1880594_A_T_b38	SLC35E2	3.25	0.00125	0.058637	15	0.018042	no	ESPMSL
chr1_2386621_G_A_b38	SLC35E2	-3.176	0.00161	-0.094414	3	0.029731	no	ESPMSL
chr1_1968793_T_C_b38	SLC35E2	3.117	0.00196	0.043155	78	0.013844	no	ESPMSL
chr1_1967499_G_A_b38	SLC35E2	3.11	0.00201	0.043255	76	0.013908	no	ESPMSL
chr1_2425690_G_GT_b38	SLC35E2	-3.091	0.00214	-0.053053	18	0.017164	no	ESPMSL
chr1_2347212_C_T_b38	SLC35E2	3.091	0.00214	0.05603	14	0.018129	no	ESPMSL
chr1_2429693_C_T_b38	SLC35E2	-3.086	0.00217	-0.055109	17	0.017856	no	ESPMSL
chr1_1606099_G_GGTCAGGCGAGGGGTC_b38	SLC35E2	3.038	0.00254	0.046739	45	0.015387	no	ESPMSL
chr1_1845824_TACACAC_T_b38	SLC35E2	3.027	0.00263	0.053414	18	0.017644	no	ESPMSL
chr1_1963538_T_C_b38	SLC35E2	3.006	0.00282	0.041742	74	0.013888	no	ESPMSL
chr1_2342133_C_G_b38	SLC35E2	2.988	0.00298	0.059881	9	0.020038	no	ESPMSL
chr1_2342137_G_A_b38	SLC35E2	2.988	0.00298	0.059881	9	0.020038	no	ESPMSL
chr1_1585589_A_G_b38	SLC35E2	2.986	0.003	0.081828	3	0.027405	no	ESPMSL
chr1_1963533_C_CA_b38	SLC35E2	2.978	0.00308	0.041123	78	0.013811	no	ESPMSL
chr1_1731904_CA_C_b38	SLC35E2	2.969	0.00317	0.048428	39	0.016309	no	ESPMSL
chr1_1697272_G_A_b38	SLC35E2	2.968	0.00318	0.066513	26	0.022412	no	ESPMSL
chr1_1628409_C_A_b38	SLC35E2	-2.958	0.00328	-0.044975	47	0.015202	no	ESPMSL
chr1_1628814_C_T_b38	SLC35E2	-2.958	0.00328	-0.044975	47	0.015202	no	ESPMSL
chr1_2324806_A_T_b38	SLC35E2	-2.957	0.00329	-0.043396	57	0.014676	no	ESPMSL
chr1_1624720_G_A_b38	SLC35E2	-2.954	0.00332	-0.045142	47	0.01528	no	ESPMSL
chr1_2351215_T_G_b38	SLC35E2	2.946	0.00341	0.054031	16	0.018338	no	ESPMSL
chr1_2428501_C_T_b38	SLC35E2	-2.946	0.00341	-0.053502	16	0.01816	no	ESPMSL
chr1_975093_G_A_b38	SLC35E2	2.925	0.00364	0.057171	8	0.019546	no	ESPMSL
chr1_1881065_G_A_b38	SLC35E2	2.909	0.00384	0.054618	12	0.018779	no	ESPMSL
chr1_1881798_C_T_b38	SLC35E2	2.909	0.00384	0.054618	12	0.018779	no	ESPMSL
chr1_1629572_TG_T_b38	SLC35E2	-2.906	0.00387	-0.044087	48	0.015173	no	ESPMSL
chr1_1736836_A_G_b38	SLC35E2	2.902	0.00392	0.040306	113	0.013891	no	ESPMSL
chr1_1625805_G_A_b38	SLC35E2	-2.895	0.00401	-0.044229	48	0.015279	no	ESPMSL
chr1_973443_G_A_b38	SLC35E2	2.848	0.00463	0.049449	18	0.017363	no	ESPMSL
chr1_1886690_A_C_b38	SLC35E2	2.831	0.00488	0.053902	11	0.019041	no	ESPMSL
chr1_2351678_C_T_b38	SLC35E2	2.818	0.00507	0.052299	15	0.018556	no	ESPMSL
chr1_1840043_T_TA_b38	SLC35E2	2.804	0.00529	0.053293	8	0.019005	no	ESPMSL
chr1_1055037_T_C_b38	SLC35E2	2.803	0.00532	0.042083	49	0.015016	no	ESPMSL
chr1_1712515_T_A_b38	SLC35E2	2.801	0.00534	0.049617	28	0.017712	no	ESPMSL
chr1_2326052_C_T_b38	SLC35E2	-2.799	0.00538	-0.043045	36	0.01538	no	ESPMSL
chr1_2328611_G_A_b38	SLC35E2	-2.799	0.00538	-0.043045	36	0.01538	no	ESPMSL
chr1_1613090_A_G_b38	SLC35E2	-2.797	0.00542	-0.04333	45	0.015494	no	ESPMSL
chr1_1608603_C_A_b38	SLC35E2	-2.79	0.00553	-0.043052	46	0.015432	no	ESPMSL
chr1_1609070_G_A_b38	SLC35E2	-2.788	0.00556	-0.04285	47	0.01537	no	ESPMSL
chr1_1983989_A_AT_b38	SLC35E2	2.777	0.00575	0.045461	25	0.016371	no	ESPMSL
chr1_1857305_G_GGGCT_b38	SLC35E2	2.771	0.00586	0.052327	11	0.018885	no	ESPMSL
chr1_1898043_T_C_b38	SLC35E2	2.771	0.00586	0.053457	10	0.019295	no	ESPMSL
chr1_1804001_AAAG_A_b38	SLC35E2	-2.77	0.00588	-0.062001	19	0.022385	no	ESPMSL
chr1_1594614_G_C_b38	SLC35E2	-2.748	0.00627	-0.04302	44	0.015654	no	ESPMSL
chr1_946653_G_A_b38	SLC35E2	2.747	0.00629	0.044816	26	0.016316	no	ESPMSL
chr1_2350750_AGGGGTGGCACG_A_b38	SLC35E2	2.745	0.00633	0.047798	21	0.017413	no	ESPMSL
chr1_2331844_G_C_b38	SLC35E2	-2.742	0.00638	-0.059268	12	0.021611	no	ESPMSL
chr1_2427409_G_C_b38	SLC35E2	-2.738	0.00645	-0.049175	18	0.017957	no	ESPMSL
chr1_1822247_A_G_b38	SLC35E2	2.738	0.00647	0.05068	12	0.018511	no	ESPMSL
chr1_1596144_GAGAC_G_b38	SLC35E2	-2.726	0.00671	-0.042337	45	0.015533	no	ESPMSL
chr1_1618118_G_A_b38	SLC35E2	-2.724	0.00673	-0.042181	45	0.015484	no	ESPMSL
chr1_1610924_C_T_b38	SLC35E2	-2.718	0.00686	-0.041923	46	0.015424	no	ESPMSL
chr1_1882915_C_T_b38	SLC35E2	2.718	0.00687	0.052342	11	0.01926	no	ESPMSL
chr1_1960609_G_C_b38	SLC35E2	-2.715	0.00693	-0.0371	81	0.013667	no	ESPMSL
chr1_1846651_T_G_b38	SLC35E2	2.707	0.00708	0.050342	12	0.018596	no	ESPMSL
chr1_1876492_C_CGA_b38	SLC35E2	2.698	0.00728	0.055096	3	0.020421	no	ESPMSL
chr1_2362863_C_CA_b38	SLC35E2	2.697	0.0073	0.05112	12	0.018957	no	ESPMSL
chr1_1857246_T_TAA_b38	SLC35E2	2.695	0.00734	0.050674	11	0.018803	no	ESPMSL
chr1_1857250_C_G_b38	SLC35E2	2.695	0.00734	0.050674	11	0.018803	no	ESPMSL
chr1_1898712_C_T_b38	SLC35E2	2.693	0.00739	0.052237	10	0.019399	no	ESPMSL
chr1_1899188_T_A_b38	SLC35E2	2.693	0.00739	0.052237	10	0.019399	no	ESPMSL
chr1_2354645_C_T_b38	SLC35E2	2.683	0.0076	0.049233	16	0.01835	no	ESPMSL
chr1_2354688_G_C_b38	SLC35E2	2.683	0.0076	0.049233	16	0.01835	no	ESPMSL
chr1_2325642_ATTT_A_b38	SLC35E2	-2.674	0.0078	-0.045082	27	0.016858	no	ESPMSL
chr1_2342999_A_G_b38	SLC35E2	2.674	0.00781	0.043178	29	0.016147	no	ESPMSL
chr1_2348393_G_A_b38	SLC35E2	2.673	0.00782	0.047488	18	0.017764	no	ESPMSL
chr1_1622510_C_T_b38	SLC35E2	-2.668	0.00795	-0.041483	44	0.015549	no	ESPMSL
chr1_1892085_G_C_b38	SLC35E2	2.665	0.00801	0.050378	11	0.018903	no	ESPMSL
chr1_1837340_C_T_b38	SLC35E2	2.658	0.00819	0.049392	12	0.018586	no	ESPMSL
chr1_1871210_G_T_b38	SLC35E2	2.655	0.00824	0.051386	11	0.019352	no	ESPMSL
chr1_1075707_CG_C_b38	SLC35E2	-2.651	0.00834	-0.036562	114	0.013789	no	ESPMSL
chr1_1855245_G_A_b38	SLC35E2	2.651	0.00835	0.050397	11	0.019012	no	ESPMSL
chr1_1427468_A_AGCCCCCTCCCCTCCATCACCCTGCCCT_b38	SLC35E2	2.644	0.00852	0.07371	4	0.02788	no	ESPMSL
chr1_2691474_C_G_b38	SLC35E2	-2.643	0.00854	-0.074717	11	0.028266	no	ESPMSL
chr1_1798974_C_T_b38	SLC35E2	2.643	0.00855	0.049194	12	0.018614	no	ESPMSL
chr1_1050080_T_C_b38	SLC35E2	-2.637	0.0087	-0.064845	18	0.024591	no	ESPMSL
chr1_1586987_G_A_b38	SLC35E2	-2.634	0.00876	-0.040711	58	0.015453	no	ESPMSL
chr1_1855939_G_A_b38	SLC35E2	2.629	0.00891	0.049712	11	0.018912	no	ESPMSL
chr1_1606559_C_CGGCTGGTCAGGCGTGGGGCGGGCTGGTCAGGCGTGGGGCG_b38	SLC35E2	-2.628	0.00891	-0.07138	9	0.027157	no	ESPMSL
chr1_2691530_A_G_b38	SLC35E2	-2.624	0.00904	-0.115525	3	0.044034	no	ESPMSL
chr1_1775296_C_T_b38	SLC35E2	2.619	0.00917	0.050744	11	0.019378	no	ESPMSL
chr1_1815255_G_T_b38	SLC35E2	2.619	0.00917	0.050744	11	0.019378	no	ESPMSL
chr1_1586956_T_C_b38	SLC35E2	-2.616	0.00925	-0.040272	59	0.015396	no	ESPMSL
chr1_1055000_C_T_b38	SLC35E2	2.612	0.00933	0.03902	45	0.014936	no	ESPMSL
chr1_1775996_G_A_b38	SLC35E2	2.61	0.0094	0.048127	13	0.01844	no	ESPMSL
chr1_2333587_G_A_b38	SLC35E2	-2.596	0.00978	-0.040199	36	0.015483	no	ESPMSL
chr1_2333780_C_T_b38	SLC35E2	-2.596	0.00978	-0.040199	36	0.015483	no	ESPMSL
chr1_1054900_C_T_b38	SLC35E2	-2.593	0.00987	-0.039251	54	0.015137	no	ESPMSL
chr1_2362229_A_G_b38	SLC35E2	2.592	0.00989	0.047571	16	0.018352	no	ESPMSL
chr1_1673818_A_C_b38	SLC35E2	7.45	9.94e-13	0.091386	86	0.012266	yes	HRTAA
chr1_1677726_A_T_b38	SLC35E2	7.412	1.26e-12	0.090542	88	0.012215	yes	HRTAA
chr1_1674868_G_A_b38	SLC35E2	7.382	1.53e-12	0.090591	85	0.012271	yes	HRTAA
chr1_1676790_C_T_b38	SLC35E2	7.348	1.9e-12	0.089097	86	0.012125	yes	HRTAA
chr1_1674720_TGC_T_b38	SLC35E2	7.347	1.92e-12	0.090733	84	0.012349	yes	HRTAA
chr1_1677720_T_G_b38	SLC35E2	7.305	2.5e-12	0.089252	88	0.012218	yes	HRTAA
chr1_1671995_G_T_b38	SLC35E2	7.164	6.07e-12	0.087626	85	0.012232	yes	HRTAA
chr1_1671797_G_A_b38	SLC35E2	7.134	7.29e-12	0.090462	83	0.01268	yes	HRTAA
chr1_1673060_G_A_b38	SLC35E2	7.003	1.64e-11	0.088426	83	0.012627	yes	HRTAA
chr1_1646352_A_C_b38	SLC35E2	6.199	1.87e-09	0.118584	4	0.01913	yes	HRTAA
chr1_1648736_G_A_b38	SLC35E2	6.156	2.38e-09	0.08336	73	0.013541	yes	HRTAA
chr1_1651653_C_T_b38	SLC35E2	5.895	1.01e-08	0.080148	80	0.013597	yes	HRTAA
chr1_1649932_C_T_b38	SLC35E2	5.54	6.59e-08	0.075659	73	0.013656	yes	HRTAA
chr1_1636278_G_T_b38	SLC35E2	5.507	7.85e-08	0.077108	64	0.014003	yes	HRTAA
chr1_1661562_G_C_b38	SLC35E2	5.307	2.17e-07	0.067274	81	0.012678	yes	HRTAA
chr1_1725582_T_C_b38	SLC35E2	5.157	4.56e-07	0.059992	88	0.011633	yes	HRTAA
chr1_1673968_GA_G_b38	SLC35E2	5.028	8.54e-07	0.076925	36	0.0153	yes	HRTAA
chr1_1670423_AT_A_b38	SLC35E2	4.963	1.16e-06	0.076789	49	0.015472	yes	HRTAA
chr1_1688328_C_T_b38	SLC35E2	-4.963	1.17e-06	-0.076473	22	0.01541	yes	HRTAA
chr1_1739131_T_C_b38	SLC35E2	4.957	1.19e-06	0.063702	72	0.01285	yes	HRTAA
chr1_1586962_C_T_b38	SLC35E2	4.818	2.31e-06	0.072112	40	0.014969	yes	HRTAA
chr1_1654662_CT_C_b38	SLC35E2	4.652	4.92e-06	0.070768	51	0.015211	yes	HRTAA
chr1_1600320_C_G_b38	SLC35E2	4.64	5.2e-06	0.068857	32	0.014839	yes	HRTAA
chr1_1600379_C_T_b38	SLC35E2	4.629	5.46e-06	0.068044	34	0.014698	yes	HRTAA
chr1_1649976_G_A_b38	SLC35E2	4.578	6.88e-06	0.065356	56	0.014276	yes	HRTAA
chr1_1667424_T_TAAAATA_b38	SLC35E2	4.519	8.94e-06	0.065492	45	0.014493	yes	HRTAA
chr1_1675228_C_CG_b38	SLC35E2	4.503	9.58e-06	0.065597	61	0.014566	yes	HRTAA
chr1_1629332_G_T_b38	SLC35E2	4.44	1.27e-05	0.06828	32	0.01538	yes	HRTAA
chr1_1620609_G_A_b38	SLC35E2	4.42	1.38e-05	0.063604	38	0.014391	yes	HRTAA
chr1_1609058_G_A_b38	SLC35E2	4.34	1.95e-05	0.064116	33	0.014774	yes	HRTAA
chr1_1622295_G_C_b38	SLC35E2	4.307	2.24e-05	0.062575	38	0.014528	yes	HRTAA
chr1_1675132_A_G_b38	SLC35E2	4.301	2.3e-05	0.062998	52	0.014646	yes	HRTAA
chr1_1621352_G_A_b38	SLC35E2	4.268	2.64e-05	0.061852	38	0.014491	yes	HRTAA
chr1_1606384_A_G_b38	SLC35E2	4.257	2.77e-05	0.062521	36	0.014686	yes	HRTAA
chr1_1650664_CT_C_b38	SLC35E2	4.228	3.13e-05	0.076545	22	0.018105	yes	HRTAA
chr1_1607931_G_A_b38	SLC35E2	4.225	3.17e-05	0.062602	33	0.014817	yes	HRTAA
chr1_1658866_G_A_b38	SLC35E2	-4.152	4.29e-05	-0.059835	38	0.014409	yes	HRTAA
chr1_1659114_A_G_b38	SLC35E2	-4.152	4.29e-05	-0.059835	38	0.014409	yes	HRTAA
chr1_1659220_A_G_b38	SLC35E2	-4.152	4.29e-05	-0.059835	38	0.014409	yes	HRTAA
chr1_1674633_C_CA_b38	SLC35E2	4.134	4.62e-05	0.060111	42	0.014539	yes	HRTAA
chr1_1661420_C_A_b38	SLC35E2	-4.112	5.06e-05	-0.059175	38	0.01439	yes	HRTAA
chr1_1613769_C_T_b38	SLC35E2	4.054	6.41e-05	0.061852	34	0.015256	yes	HRTAA
chr1_1612562_T_TC_b38	SLC35E2	4.028	7.14e-05	0.057983	39	0.014396	yes	HRTAA
chr1_1650195_A_G_b38	SLC35E2	-4.021	7.34e-05	-0.057161	38	0.014217	yes	HRTAA
chr1_1688442_T_C_b38	SLC35E2	-4.015	7.51e-05	-0.065795	25	0.016387	yes	HRTAA
chr1_1589495_CTTT_C_b38	SLC35E2	3.938	0.000102	0.063131	30	0.01603	yes	HRTAA
chr1_1688586_C_T_b38	SLC35E2	-3.927	0.000107	-0.067848	20	0.017276	yes	HRTAA
chr1_1591703_T_C_b38	SLC35E2	3.922	0.000109	0.053735	64	0.013702	yes	HRTAA
chr1_1630798_C_T_b38	SLC35E2	3.849	0.000145	0.05871	31	0.015252	yes	HRTAA
chr1_1635226_T_C_b38	SLC35E2	-3.798	0.000176	-0.069275	9	0.018238	yes	HRTAA
chr1_1691417_T_C_b38	SLC35E2	3.798	0.000177	0.05387	68	0.014185	yes	HRTAA
chr1_1595028_C_CAG_b38	SLC35E2	3.769	0.000197	0.0611	22	0.016209	yes	HRTAA
chr1_1648826_A_G_b38	SLC35E2	-3.694	0.000262	-0.05206	43	0.014094	yes	HRTAA
chr1_1606532_GTGGGCTGGGCTGGTCAGGCA_G_b38	SLC35E2	3.683	0.000273	0.053942	32	0.014645	yes	HRTAA
chr1_1648636_G_A_b38	SLC35E2	-3.677	0.000279	-0.051734	43	0.014068	yes	HRTAA
chr1_1639348_G_T_b38	SLC35E2	-3.622	0.000343	-0.049794	46	0.013747	yes	HRTAA
chr1_1615869_C_T_b38	SLC35E2	3.618	0.000349	0.053677	39	0.014838	yes	HRTAA
chr1_1695459_A_G_b38	SLC35E2	3.588	0.00039	0.055971	63	0.015602	yes	HRTAA
chr1_1708855_TTCCTCCTCC_T_b38	SLC35E2	3.587	0.00039	0.053711	66	0.014974	yes	HRTAA
chr1_1653863_C_A_b38	SLC35E2	-3.567	0.000419	-0.063325	10	0.017751	yes	HRTAA
chr1_1742587_G_C_b38	SLC35E2	3.546	0.000454	0.047256	89	0.013328	yes	HRTAA
chr1_1613974_G_A_b38	SLC35E2	3.529	0.000482	0.055847	26	0.015825	yes	HRTAA
chr1_1603989_T_C_b38	SLC35E2	3.529	0.000483	0.055569	28	0.015749	yes	HRTAA
chr1_1609909_G_T_b38	SLC35E2	3.529	0.000483	0.055569	28	0.015749	yes	HRTAA
chr1_1601796_A_C_b38	SLC35E2	3.526	0.000488	0.052403	45	0.014864	yes	HRTAA
chr1_1663759_G_A_b38	SLC35E2	-3.514	0.00051	-0.087822	8	0.024994	yes	HRTAA
chr1_1660683_C_T_b38	SLC35E2	-3.512	0.000513	-0.055353	25	0.015761	yes	HRTAA
chr1_1618982_G_A_b38	SLC35E2	3.502	0.000532	0.055362	27	0.015808	yes	HRTAA
chr1_1608244_T_C_b38	SLC35E2	3.493	0.000548	0.056149	24	0.016073	yes	HRTAA
chr1_1688457_G_A_b38	SLC35E2	-3.439	0.000666	-0.057754	25	0.016793	yes	HRTAA
chr1_1722626_AGCG_A_b38	SLC35E2	3.439	0.000667	0.062928	21	0.0183	yes	HRTAA
chr1_1672155_G_A_b38	SLC35E2	-3.414	0.000727	-0.051976	36	0.015223	yes	HRTAA
chr1_1722625_A_T_b38	SLC35E2	3.405	0.000751	0.062361	21	0.018314	yes	HRTAA
chr1_1617375_T_C_b38	SLC35E2	3.397	0.000773	0.050473	39	0.014859	yes	HRTAA
chr1_1618213_C_G_b38	SLC35E2	3.397	0.000773	0.050473	39	0.014859	yes	HRTAA
chr1_1618290_G_C_b38	SLC35E2	3.397	0.000773	0.050473	39	0.014859	yes	HRTAA
chr1_1708474_C_A_b38	SLC35E2	-3.377	0.00083	-0.061699	10	0.018271	yes	HRTAA
chr1_1679993_A_G_b38	SLC35E2	-3.377	0.00083	-0.046018	77	0.013629	yes	HRTAA
chr1_1641275_A_G_b38	SLC35E2	-3.373	0.000841	-0.048099	42	0.01426	yes	HRTAA
chr1_1604202_G_A_b38	SLC35E2	3.335	0.00096	0.04986	44	0.014951	yes	HRTAA
chr1_1649993_A_G_b38	SLC35E2	-3.315	0.00103	-0.04492	90	0.013552	yes	HRTAA
chr1_1613322_T_C_b38	SLC35E2	3.3	0.00108	0.04979	38	0.015087	yes	HRTAA
chr1_1739519_C_G_b38	SLC35E2	3.298	0.00109	0.051275	31	0.015548	yes	HRTAA
chr1_1613421_T_C_b38	SLC35E2	3.29	0.00112	0.049711	37	0.015111	yes	HRTAA
chr1_1591419_A_G_b38	SLC35E2	3.278	0.00117	0.060002	10	0.018305	yes	HRTAA
chr1_1728671_C_A_b38	SLC35E2	3.256	0.00126	0.056881	14	0.017468	yes	HRTAA
chr1_828389_A_AT_b38	SLC35E2	3.226	0.00139	0.050984	46	0.015804	yes	HRTAA
chr1_1746440_A_G_b38	SLC35E2	-3.2	0.00152	-0.054668	18	0.017086	yes	HRTAA
chr1_1676287_C_T_b38	SLC35E2	-3.178	0.00164	-0.05698	10	0.01793	yes	HRTAA
chr1_1619986_T_C_b38	SLC35E2	3.165	0.00171	0.048666	30	0.015374	yes	HRTAA
chr1_1729859_A_G_b38	SLC35E2	3.164	0.00172	0.054707	12	0.017291	yes	HRTAA
chr1_1597128_C_CCCTCAGCTGGACT_b38	SLC35E2	-3.123	0.00197	-0.042615	60	0.013648	yes	HRTAA
chr1_1594570_A_G_b38	SLC35E2	3.096	0.00214	0.046167	43	0.014911	yes	HRTAA
chr1_1631710_T_C_b38	SLC35E2	3.058	0.00243	0.061589	7	0.020138	yes	HRTAA
chr1_1662738_CT_C_b38	SLC35E2	-3.049	0.0025	-0.065799	17	0.021577	yes	HRTAA
chr1_1662855_T_C_b38	SLC35E2	-3.049	0.0025	-0.065799	17	0.021577	yes	HRTAA
chr1_1671724_C_T_b38	SLC35E2	-3.036	0.00261	-0.047234	32	0.015558	yes	HRTAA
chr1_1693427_G_A_b38	SLC35E2	3.029	0.00267	0.050731	57	0.01675	yes	HRTAA
chr1_1743544_CA_C_b38	SLC35E2	3.021	0.00274	0.039825	77	0.013183	yes	HRTAA
chr1_1667424_T_TAAATA_b38	SLC35E2	-3.02	0.00274	-0.042214	59	0.013976	yes	HRTAA
chr1_1606507_GTGGGC_G_b38	SLC35E2	3.011	0.00282	0.039526	92	0.013126	yes	HRTAA
chr1_1688102_G_A_b38	SLC35E2	-3.011	0.00282	-0.047362	26	0.015729	yes	HRTAA
chr1_1594618_C_G_b38	SLC35E2	3.007	0.00286	0.048639	29	0.016177	yes	HRTAA
chr1_1708521_C_G_b38	SLC35E2	-2.977	0.00315	-0.047412	25	0.015925	yes	HRTAA
chr1_1615322_A_G_b38	SLC35E2	2.969	0.00323	0.044495	37	0.014987	yes	HRTAA
chr1_1722619_C_T_b38	SLC35E2	2.955	0.00337	0.053024	23	0.017942	yes	HRTAA
chr1_1676955_C_T_b38	SLC35E2	2.933	0.00361	0.084287	4	0.028734	yes	HRTAA
chr1_1744121_A_C_b38	SLC35E2	-2.889	0.00415	-0.055478	43	0.019204	yes	HRTAA
chr1_1366923_AGTTG_A_b38	SLC35E2	-2.869	0.00442	-0.090861	3	0.031675	yes	HRTAA
chr1_1725697_T_C_b38	SLC35E2	2.868	0.00442	0.048673	32	0.016971	yes	HRTAA
chr1_1687643_G_A_b38	SLC35E2	-2.857	0.00457	-0.039863	63	0.013953	yes	HRTAA
chr1_2464099_G_C_b38	SLC35E2	2.841	0.0048	0.038817	83	0.013662	yes	HRTAA
chr1_2699855_C_G_b38	SLC35E2	-2.84	0.00482	-0.090426	5	0.031838	yes	HRTAA
chr1_1594890_G_GAC_b38	SLC35E2	-2.804	0.00537	-0.03945	73	0.014068	yes	HRTAA
chr1_1593732_G_C_b38	SLC35E2	-2.802	0.00541	-0.039387	73	0.014058	yes	HRTAA
chr1_1743565_AT_A_b38	SLC35E2	2.792	0.00558	0.034916	98	0.012507	yes	HRTAA
chr1_1687236_T_G_b38	SLC35E2	-2.761	0.00612	-0.039371	56	0.014262	yes	HRTAA
chr1_1126311_G_GT_b38	SLC35E2	-2.75	0.00633	-0.068945	4	0.025075	yes	HRTAA
chr1_1466242_C_CA_b38	SLC35E2	-2.747	0.00637	-0.061276	10	0.022304	yes	HRTAA
chr1_1687153_A_G_b38	SLC35E2	-2.747	0.00637	-0.038186	67	0.0139	yes	HRTAA
chr1_1744096_C_T_b38	SLC35E2	-2.722	0.00686	-0.050914	48	0.018703	yes	HRTAA
chr1_1686147_T_G_b38	SLC35E2	-2.715	0.00701	-0.038871	56	0.014316	yes	HRTAA
chr1_1683909_A_C_b38	SLC35E2	-2.708	0.00715	-0.037884	67	0.013988	yes	HRTAA
chr1_1686017_A_AT_b38	SLC35E2	-2.701	0.00731	-0.03774	62	0.013973	yes	HRTAA
chr1_1679100_A_G_b38	SLC35E2	-2.697	0.0074	-0.037854	69	0.014037	yes	HRTAA
chr1_1687159_G_T_b38	SLC35E2	-2.666	0.00809	-0.037523	60	0.014074	yes	HRTAA
chr1_2467710_A_G_b38	SLC35E2	2.664	0.00813	0.036061	86	0.013534	yes	HRTAA
chr1_1760882_T_C_b38	SLC35E2	2.658	0.00827	0.035978	80	0.013534	yes	HRTAA
chr1_2471060_G_A_b38	SLC35E2	2.645	0.00859	0.034794	91	0.013153	yes	HRTAA
chr1_1757074_G_T_b38	SLC35E2	2.639	0.00874	0.036288	65	0.013748	yes	HRTAA
chr1_1306183_A_G_b38	SLC35E2	-2.637	0.00879	-0.113339	3	0.042975	yes	HRTAA
chr1_1320653_C_T_b38	SLC35E2	-2.637	0.00879	-0.113339	3	0.042975	yes	HRTAA
chr1_2461209_G_C_b38	SLC35E2	2.631	0.00896	0.036337	81	0.013813	yes	HRTAA
chr1_1757725_C_T_b38	SLC35E2	2.598	0.00984	0.036125	65	0.013904	yes	HRTAA
chr1_1755504_T_C_b38	SLC35E2	2.598	0.00985	0.034994	89	0.013471	yes	HRTAA
chr1_1650383_G_T_b38	SLC35E2	-4.565	7.3e-06	-0.067347	30	0.014754	no	HRTAA
chr1_1650777_G_A_b38	SLC35E2	-4.271	2.61e-05	-0.060709	37	0.014214	no	HRTAA
chr1_1651421_GTAGCCCCTCTGAACGGTCTGTGACACACGCATGCTTTCAGCTAGAGTACTCTA_G_b38	SLC35E2	-4.24	2.98e-05	-0.060565	36	0.014285	no	HRTAA
chr1_1664865_A_G_b38	SLC35E2	-4.211	3.36e-05	-0.059895	37	0.014224	no	HRTAA
chr1_1651137_C_T_b38	SLC35E2	-4.144	4.44e-05	-0.059067	37	0.014254	no	HRTAA
chr1_1651267_T_C_b38	SLC35E2	-4.144	4.44e-05	-0.059067	37	0.014254	no	HRTAA
chr1_1651574_G_A_b38	SLC35E2	-4.144	4.44e-05	-0.059067	37	0.014254	no	HRTAA
chr1_1652061_T_C_b38	SLC35E2	-4.144	4.44e-05	-0.059067	37	0.014254	no	HRTAA
chr1_1652135_C_G_b38	SLC35E2	-4.144	4.44e-05	-0.059067	37	0.014254	no	HRTAA
chr1_1652191_C_T_b38	SLC35E2	-4.144	4.44e-05	-0.059067	37	0.014254	no	HRTAA
chr1_1652592_A_G_b38	SLC35E2	-4.144	4.44e-05	-0.059067	37	0.014254	no	HRTAA
chr1_1652779_A_G_b38	SLC35E2	-4.144	4.44e-05	-0.059067	37	0.014254	no	HRTAA
chr1_1653147_A_C_b38	SLC35E2	-4.144	4.44e-05	-0.059067	37	0.014254	no	HRTAA
chr1_1653396_T_C_b38	SLC35E2	-4.144	4.44e-05	-0.059067	37	0.014254	no	HRTAA
chr1_1653472_T_C_b38	SLC35E2	-4.144	4.44e-05	-0.059067	37	0.014254	no	HRTAA
chr1_1653811_G_A_b38	SLC35E2	-4.144	4.44e-05	-0.059067	37	0.014254	no	HRTAA
chr1_1653893_C_T_b38	SLC35E2	-4.144	4.44e-05	-0.059067	37	0.014254	no	HRTAA
chr1_1653934_G_A_b38	SLC35E2	-4.144	4.44e-05	-0.059067	37	0.014254	no	HRTAA
chr1_1654143_G_A_b38	SLC35E2	-4.144	4.44e-05	-0.059067	37	0.014254	no	HRTAA
chr1_1654188_T_G_b38	SLC35E2	-4.144	4.44e-05	-0.059067	37	0.014254	no	HRTAA
chr1_1650000_G_A_b38	SLC35E2	4.137	4.57e-05	0.058285	49	0.014089	no	HRTAA
chr1_1651926_T_C_b38	SLC35E2	-4.104	5.24e-05	-0.05881	37	0.014331	no	HRTAA
chr1_1664757_T_C_b38	SLC35E2	-4.098	5.36e-05	-0.056949	37	0.013896	no	HRTAA
chr1_1668108_C_T_b38	SLC35E2	4	7.96e-05	0.05748	38	0.014368	no	HRTAA
chr1_1671148_C_T_b38	SLC35E2	3.988	8.36e-05	0.056799	41	0.014241	no	HRTAA
chr1_1671097_G_C_b38	SLC35E2	3.95	9.76e-05	0.056669	40	0.014348	no	HRTAA
chr1_1688619_AAAC_A_b38	SLC35E2	-3.89	0.000124	-0.065179	26	0.016757	no	HRTAA
chr1_1651785_C_A_b38	SLC35E2	-3.847	0.000146	-0.054866	37	0.014261	no	HRTAA
chr1_1650664_CTTTTT_C_b38	SLC35E2	-3.802	0.000174	-0.061395	19	0.016148	no	HRTAA
chr1_1680672_C_T_b38	SLC35E2	-3.733	0.000226	-0.0543	66	0.014545	no	HRTAA
chr1_1675091_A_G_b38	SLC35E2	-3.661	0.000296	-0.056407	23	0.015406	no	HRTAA
chr1_1725339_C_A_b38	SLC35E2	3.626	0.000338	0.04686	69	0.012922	no	HRTAA
chr1_1688647_G_A_b38	SLC35E2	-3.595	0.000378	-0.059661	29	0.016593	no	HRTAA
chr1_1688786_G_A_b38	SLC35E2	-3.489	0.000556	-0.062713	15	0.017972	no	HRTAA
chr1_1668717_C_G_b38	SLC35E2	-3.451	0.000639	-0.055209	21	0.015999	no	HRTAA
chr1_1665061_C_T_b38	SLC35E2	-3.381	0.000818	-0.05354	21	0.015836	no	HRTAA
chr1_1688531_T_C_b38	SLC35E2	-3.342	0.000937	-0.058979	19	0.017649	no	HRTAA
chr1_1661177_A_G_b38	SLC35E2	-3.332	0.00097	-0.053311	21	0.016	no	HRTAA
chr1_1668542_C_T_b38	SLC35E2	-3.323	0.001	-0.05359	20	0.016129	no	HRTAA
chr1_1688570_A_T_b38	SLC35E2	-3.314	0.00103	-0.060993	9	0.018402	no	HRTAA
chr1_1669576_G_A_b38	SLC35E2	-3.305	0.00106	-0.052903	22	0.016005	no	HRTAA
chr1_1724489_G_C_b38	SLC35E2	3.297	0.00109	0.044556	94	0.013513	no	HRTAA
chr1_1667948_A_G_b38	SLC35E2	-3.296	0.0011	-0.052916	21	0.016057	no	HRTAA
chr1_1658830_C_G_b38	SLC35E2	-3.254	0.00127	-0.051366	22	0.015785	no	HRTAA
chr1_1818305_T_TAA_b38	SLC35E2	3.21	0.00147	0.12506	3	0.038965	no	HRTAA
chr1_1665581_C_G_b38	SLC35E2	-3.209	0.00147	-0.050525	23	0.015742	no	HRTAA
chr1_1731904_CA_C_b38	SLC35E2	3.181	0.00162	0.050674	31	0.015931	no	HRTAA
chr1_1616547_T_C_b38	SLC35E2	3.165	0.00171	0.04777	36	0.015095	no	HRTAA
chr1_1669613_G_A_b38	SLC35E2	-3.081	0.00225	-0.049221	22	0.015975	no	HRTAA
chr1_1743851_C_T_b38	SLC35E2	-3.058	0.00243	-0.047768	29	0.015622	no	HRTAA
chr1_1652913_C_T_b38	SLC35E2	-3.033	0.00263	-0.046302	27	0.015266	no	HRTAA
chr1_1695747_C_T_b38	SLC35E2	3.02	0.00274	0.047149	62	0.015612	no	HRTAA
chr1_1639685_G_A_b38	SLC35E2	-3.017	0.00277	-0.047657	25	0.015796	no	HRTAA
chr1_1453643_A_AT_b38	SLC35E2	-3.005	0.00288	-0.055199	7	0.018371	no	HRTAA
chr1_1659060_G_A_b38	SLC35E2	-2.994	0.00298	-0.045745	28	0.015278	no	HRTAA
chr1_1706067_ACT_A_b38	SLC35E2	2.988	0.00304	0.040849	98	0.013671	no	HRTAA
chr1_1717604_CGCTTTCAGCTAGAGTTTGCTCTCTCTGGTTTTCGGTCTGTGACACACGCAT_C_b38	SLC35E2	2.973	0.00319	0.040674	60	0.013683	no	HRTAA
chr1_1649846_G_A_b38	SLC35E2	-2.963	0.00329	-0.047475	18	0.016022	no	HRTAA
chr1_1720192_T_G_b38	SLC35E2	2.938	0.00356	0.040172	99	0.013675	no	HRTAA
chr1_1715838_C_T_b38	SLC35E2	2.932	0.00363	0.040107	103	0.013681	no	HRTAA
chr1_1638879_C_T_b38	SLC35E2	-2.9	0.00401	-0.043723	29	0.015079	no	HRTAA
chr1_1630685_AG_A_b38	SLC35E2	2.893	0.00409	0.048208	18	0.016663	no	HRTAA
chr1_1668721_C_T_b38	SLC35E2	-2.886	0.00418	-0.044035	27	0.015256	no	HRTAA
chr1_1687061_C_T_b38	SLC35E2	-2.885	0.00419	-0.040458	61	0.014022	no	HRTAA
chr1_1743840_T_C_b38	SLC35E2	-2.874	0.00434	-0.045256	29	0.015745	no	HRTAA
chr1_1758323_T_C_b38	SLC35E2	2.863	0.00449	0.038592	75	0.013478	no	HRTAA
chr1_1681928_C_A_b38	SLC35E2	-2.815	0.0052	-0.040124	57	0.014255	no	HRTAA
chr1_1611570_CT_C_b38	SLC35E2	-2.804	0.00537	-0.059459	7	0.021202	no	HRTAA
chr1_1704835_C_T_b38	SLC35E2	2.773	0.0059	0.037678	99	0.013586	no	HRTAA
chr1_1570655_G_A_b38	SLC35E2	2.76	0.00614	0.051293	10	0.018585	no	HRTAA
chr1_1759611_C_T_b38	SLC35E2	-2.737	0.00657	-0.038049	75	0.013902	no	HRTAA
chr1_1744028_A_AC_b38	SLC35E2	-2.726	0.00679	-0.047494	17	0.017424	no	HRTAA
chr1_1697272_G_A_b38	SLC35E2	2.713	0.00704	0.060447	19	0.022278	no	HRTAA
chr1_2211900_C_CTTTT_b38	SLC35E2	-2.673	0.00792	-0.064358	6	0.024073	no	HRTAA
chr1_1684308_G_C_b38	SLC35E2	-2.656	0.00832	-0.037665	59	0.014179	no	HRTAA
chr1_1684619_G_A_b38	SLC35E2	-2.656	0.00832	-0.037665	59	0.014179	no	HRTAA
chr1_1135812_T_C_b38	SLC35E2	2.645	0.0086	0.052956	11	0.020023	no	HRTAA
chr1_1606094_G_GAGGGGTC_b38	SLC35E2	2.643	0.00864	0.043177	29	0.016335	no	HRTAA
chr1_1637577_T_C_b38	SLC35E2	-2.633	0.0089	-0.040008	26	0.015195	no	HRTAA
chr1_1684266_T_C_b38	SLC35E2	-2.629	0.00901	-0.037263	60	0.014176	no	HRTAA
chr1_1154630_C_A_b38	SLC35E2	2.628	0.00902	0.054806	12	0.020851	no	HRTAA
chr1_1606089_GGC_G_b38	SLC35E2	2.62	0.00923	0.042451	29	0.0162	no	HRTAA
chr1_1696758_A_G_b38	SLC35E2	2.607	0.00958	0.0356	60	0.013653	no	HRTAA
chr1_1611248_ATC_A_b38	SLC35E2	-2.601	0.00976	-0.043407	17	0.016691	no	HRTAA
chr1_1676790_C_T_b38	SLC35E2	6.386	6.11e-10	0.071602	84	0.011213	yes	HRTLV
chr1_1674868_G_A_b38	SLC35E2	6.33	8.44e-10	0.072394	81	0.011437	yes	HRTLV
chr1_1674720_TGC_T_b38	SLC35E2	6.294	1.04e-09	0.072342	80	0.011494	yes	HRTLV
chr1_1677720_T_G_b38	SLC35E2	6.284	1.1e-09	0.070558	84	0.011229	yes	HRTLV
chr1_1677726_A_T_b38	SLC35E2	6.281	1.11e-09	0.070746	84	0.011263	yes	HRTLV
chr1_1671995_G_T_b38	SLC35E2	6.202	1.75e-09	0.070952	80	0.01144	yes	HRTLV
chr1_1673060_G_A_b38	SLC35E2	6.022	4.79e-09	0.071166	78	0.011817	yes	HRTLV
chr1_1671797_G_A_b38	SLC35E2	5.922	8.34e-09	0.068476	78	0.011564	yes	HRTLV
chr1_1673818_A_C_b38	SLC35E2	5.915	8.63e-09	0.068443	81	0.01157	yes	HRTLV
chr1_1673968_GA_G_b38	SLC35E2	4.73	3.39e-06	0.06783	30	0.01434	yes	HRTLV
chr1_1649932_C_T_b38	SLC35E2	4.714	3.66e-06	0.057001	70	0.012093	yes	HRTLV
chr1_1675091_A_G_b38	SLC35E2	-4.603	6.06e-06	-0.065303	25	0.014188	yes	HRTLV
chr1_1648736_G_A_b38	SLC35E2	4.471	1.09e-05	0.054073	74	0.012093	yes	HRTLV
chr1_1739131_T_C_b38	SLC35E2	4.2	3.47e-05	0.049036	77	0.011674	yes	HRTLV
chr1_1651653_C_T_b38	SLC35E2	4.143	4.41e-05	0.049956	82	0.012058	yes	HRTLV
chr1_1773713_T_A_b38	SLC35E2	-4.134	4.57e-05	-0.055615	37	0.013451	yes	HRTLV
chr1_1750589_G_A_b38	SLC35E2	-4.107	5.12e-05	-0.095659	8	0.023294	yes	HRTLV
chr1_1679100_A_G_b38	SLC35E2	-4.093	5.41e-05	-0.050907	69	0.012437	yes	HRTLV
chr1_1661562_G_C_b38	SLC35E2	4.019	7.31e-05	0.044552	82	0.011085	yes	HRTLV
chr1_1746522_GT_G_b38	SLC35E2	-3.89	0.000123	-0.06055	18	0.015567	yes	HRTLV
chr1_1650664_CT_C_b38	SLC35E2	3.886	0.000124	0.060958	27	0.015687	yes	HRTLV
chr1_1636278_G_T_b38	SLC35E2	3.879	0.000128	0.04843	61	0.012484	yes	HRTLV
chr1_1665061_C_T_b38	SLC35E2	-3.851	0.000143	-0.052953	26	0.013752	yes	HRTLV
chr1_1659940_A_C_b38	SLC35E2	-3.823	0.000159	-0.059034	12	0.015444	yes	HRTLV
chr1_1668542_C_T_b38	SLC35E2	-3.819	0.000162	-0.054799	23	0.01435	yes	HRTLV
chr1_1708521_C_G_b38	SLC35E2	-3.789	0.000181	-0.05368	24	0.014167	yes	HRTLV
chr1_1987702_C_T_b38	SLC35E2	3.724	0.000233	0.058072	10	0.015595	yes	HRTLV
chr1_1668717_C_G_b38	SLC35E2	-3.724	0.000233	-0.052411	26	0.014075	yes	HRTLV
chr1_1667948_A_G_b38	SLC35E2	-3.678	0.000276	-0.052668	25	0.014319	yes	HRTLV
chr1_1661177_A_G_b38	SLC35E2	-3.666	0.000289	-0.051028	26	0.013919	yes	HRTLV
chr1_1665581_C_G_b38	SLC35E2	-3.612	0.000354	-0.04939	28	0.013675	yes	HRTLV
chr1_1668721_C_T_b38	SLC35E2	-3.6	0.00037	-0.048274	31	0.01341	yes	HRTLV
chr1_1946013_C_T_b38	SLC35E2	-3.595	0.000377	-0.047188	77	0.013127	yes	HRTLV
chr1_1968793_T_C_b38	SLC35E2	3.594	0.000378	0.04442	69	0.012359	yes	HRTLV
chr1_1946632_C_T_b38	SLC35E2	-3.571	0.000411	-0.046945	77	0.013146	yes	HRTLV
chr1_1947189_C_T_b38	SLC35E2	-3.571	0.000411	-0.046945	77	0.013146	yes	HRTLV
chr1_1984300_CT_C_b38	SLC35E2	3.566	0.000419	0.060139	4	0.016866	yes	HRTLV
chr1_1970506_T_A_b38	SLC35E2	-3.558	0.000432	-0.045258	59	0.012722	yes	HRTLV
chr1_1649976_G_A_b38	SLC35E2	3.553	0.000439	0.044882	60	0.012631	yes	HRTLV
chr1_1671148_C_T_b38	SLC35E2	3.552	0.00044	0.04532	42	0.012758	yes	HRTLV
chr1_945259_TC_T_b38	SLC35E2	3.537	0.000465	0.051444	19	0.014543	yes	HRTLV
chr1_1946058_T_C_b38	SLC35E2	-3.531	0.000476	-0.046286	78	0.013109	yes	HRTLV
chr1_1669576_G_A_b38	SLC35E2	-3.529	0.00048	-0.050039	25	0.014181	yes	HRTLV
chr1_1654662_CT_C_b38	SLC35E2	3.524	0.000488	0.04907	51	0.013925	yes	HRTLV
chr1_1944675_C_T_b38	SLC35E2	-3.522	0.000491	-0.046294	77	0.013143	yes	HRTLV
chr1_1944074_T_C_b38	SLC35E2	-3.509	0.000515	-0.046228	77	0.013173	yes	HRTLV
chr1_1944091_G_C_b38	SLC35E2	-3.509	0.000515	-0.046228	77	0.013173	yes	HRTLV
chr1_1945975_TG_T_b38	SLC35E2	-3.506	0.000521	-0.045983	81	0.013116	yes	HRTLV
chr1_1674633_C_CA_b38	SLC35E2	3.496	0.000539	0.045395	40	0.012983	yes	HRTLV
chr1_1945121_T_C_b38	SLC35E2	-3.485	0.000561	-0.045878	78	0.013163	yes	HRTLV
chr1_1669613_G_A_b38	SLC35E2	-3.478	0.000576	-0.049481	25	0.014226	yes	HRTLV
chr1_1692151_T_C_b38	SLC35E2	-3.454	0.000628	-0.050556	29	0.014637	yes	HRTLV
chr1_1944419_C_G_b38	SLC35E2	-3.45	0.000636	-0.045085	79	0.013067	yes	HRTLV
chr1_1034279_G_A_b38	SLC35E2	3.436	0.000669	0.045727	30	0.013307	yes	HRTLV
chr1_1722690_TA_T_b38	SLC35E2	-3.423	0.000701	-0.065264	3	0.019067	yes	HRTLV
chr1_1653863_C_A_b38	SLC35E2	-3.418	0.000713	-0.053936	12	0.015779	yes	HRTLV
chr1_1942887_C_G_b38	SLC35E2	-3.414	0.000723	-0.045075	76	0.013201	yes	HRTLV
chr1_1708474_C_A_b38	SLC35E2	-3.406	0.000745	-0.053057	14	0.015578	yes	HRTLV
chr1_1606099_G_GGTCAGGCGAGGGGTC_b38	SLC35E2	3.392	0.000783	0.048417	30	0.014275	yes	HRTLV
chr1_1658830_C_G_b38	SLC35E2	-3.388	0.000793	-0.047392	25	0.013987	yes	HRTLV
chr1_1746440_A_G_b38	SLC35E2	-3.385	0.000802	-0.052909	18	0.015631	yes	HRTLV
chr1_1688328_C_T_b38	SLC35E2	-3.381	0.000814	-0.047251	22	0.013977	yes	HRTLV
chr1_1743714_C_CA_b38	SLC35E2	3.365	0.00086	0.045719	57	0.013587	yes	HRTLV
chr1_1938054_ACT_A_b38	SLC35E2	-3.346	0.000918	-0.041165	90	0.012302	yes	HRTLV
chr1_1671097_G_C_b38	SLC35E2	3.319	0.00101	0.042505	42	0.012808	yes	HRTLV
chr1_1658422_T_C_b38	SLC35E2	3.314	0.00103	0.050696	15	0.015296	yes	HRTLV
chr1_954724_G_A_b38	SLC35E2	3.311	0.00104	0.049847	15	0.015056	yes	HRTLV
chr1_1937273_T_C_b38	SLC35E2	-3.31	0.00104	-0.040754	87	0.012314	yes	HRTLV
chr1_1940540_G_A_b38	SLC35E2	-3.304	0.00106	-0.040616	90	0.012292	yes	HRTLV
chr1_1942260_G_C_b38	SLC35E2	-3.304	0.00106	-0.040616	90	0.012292	yes	HRTLV
chr1_1026084_G_T_b38	SLC35E2	3.287	0.00113	0.042488	38	0.012925	yes	HRTLV
chr1_1750440_G_A_b38	SLC35E2	-3.287	0.00113	-0.045136	51	0.013732	yes	HRTLV
chr1_1032846_C_A_b38	SLC35E2	3.277	0.00117	0.042368	37	0.01293	yes	HRTLV
chr1_1025561_G_C_b38	SLC35E2	3.271	0.00119	0.041767	39	0.012768	yes	HRTLV
chr1_1837340_C_T_b38	SLC35E2	3.268	0.0012	0.052697	10	0.016125	yes	HRTLV
chr1_1846651_T_G_b38	SLC35E2	3.268	0.0012	0.052697	10	0.016125	yes	HRTLV
chr1_1855245_G_A_b38	SLC35E2	3.267	0.00121	0.054423	9	0.016659	yes	HRTLV
chr1_1944420_A_G_b38	SLC35E2	-3.267	0.00121	-0.043022	79	0.01317	yes	HRTLV
chr1_2370674_CTT_C_b38	SLC35E2	3.262	0.00123	0.043661	80	0.013384	yes	HRTLV
chr1_941767_G_A_b38	SLC35E2	3.261	0.00123	0.047653	19	0.014614	yes	HRTLV
chr1_1937841_ACACCAGGTCCACCTCTGGACACAGGTCCACC_A_b38	SLC35E2	-3.261	0.00123	-0.040009	90	0.01227	yes	HRTLV
chr1_1942014_G_A_b38	SLC35E2	-3.26	0.00123	-0.040213	89	0.012334	yes	HRTLV
chr1_1942075_A_G_b38	SLC35E2	-3.26	0.00123	-0.040213	89	0.012334	yes	HRTLV
chr1_1942086_T_C_b38	SLC35E2	-3.26	0.00123	-0.040213	89	0.012334	yes	HRTLV
chr1_1845840_C_G_b38	SLC35E2	3.257	0.00125	0.056171	5	0.017248	yes	HRTLV
chr1_1660683_C_T_b38	SLC35E2	-3.256	0.00125	-0.043805	30	0.013454	yes	HRTLV
chr1_1944182_G_C_b38	SLC35E2	-3.236	0.00134	-0.042504	77	0.013136	yes	HRTLV
chr1_1986752_A_G_b38	SLC35E2	3.228	0.00138	0.042849	63	0.013275	yes	HRTLV
chr1_1857246_T_TAA_b38	SLC35E2	3.214	0.00144	0.052866	9	0.016447	yes	HRTLV
chr1_1857250_C_G_b38	SLC35E2	3.214	0.00144	0.052866	9	0.016447	yes	HRTLV
chr1_1857305_G_GGGCT_b38	SLC35E2	3.211	0.00146	0.053148	9	0.016551	yes	HRTLV
chr1_1753033_C_T_b38	SLC35E2	-3.209	0.00147	-0.042733	78	0.013316	yes	HRTLV
chr1_1940973_C_T_b38	SLC35E2	-3.208	0.00147	-0.039354	91	0.012267	yes	HRTLV
chr1_1942258_G_A_b38	SLC35E2	-3.202	0.0015	-0.039508	89	0.012337	yes	HRTLV
chr1_1845824_TACACAC_T_b38	SLC35E2	3.199	0.00152	0.050258	13	0.015713	yes	HRTLV
chr1_965125_G_C_b38	SLC35E2	3.198	0.00153	0.046111	23	0.014419	yes	HRTLV
chr1_1750428_G_C_b38	SLC35E2	-3.193	0.00155	-0.04424	52	0.013855	yes	HRTLV
chr1_1987049_A_G_b38	SLC35E2	3.186	0.00159	0.041587	66	0.013053	yes	HRTLV
chr1_1722626_AGCG_A_b38	SLC35E2	3.176	0.00164	0.049672	26	0.015638	yes	HRTLV
chr1_1661420_C_A_b38	SLC35E2	-3.167	0.00169	-0.039948	42	0.012615	yes	HRTLV
chr1_1971864_C_T_b38	SLC35E2	3.166	0.00169	0.041339	62	0.013056	yes	HRTLV
chr1_1855939_G_A_b38	SLC35E2	3.158	0.00174	0.052159	9	0.016518	yes	HRTLV
chr1_1938125_TCA_T_b38	SLC35E2	-3.139	0.00186	-0.041199	77	0.013127	yes	HRTLV
chr1_1888382_A_AG_b38	SLC35E2	3.137	0.00187	0.060854	5	0.019398	yes	HRTLV
chr1_1001870_C_G_b38	SLC35E2	3.133	0.00189	0.047698	13	0.015225	yes	HRTLV
chr1_1937895_C_T_b38	SLC35E2	-3.121	0.00197	-0.040946	78	0.013118	yes	HRTLV
chr1_2020388_A_G_b38	SLC35E2	-3.116	0.002	-0.047037	14	0.015094	yes	HRTLV
chr1_1976644_G_A_b38	SLC35E2	3.114	0.00201	0.043825	21	0.014072	yes	HRTLV
chr1_1658866_G_A_b38	SLC35E2	-3.111	0.00204	-0.039255	42	0.012619	yes	HRTLV
chr1_1659114_A_G_b38	SLC35E2	-3.111	0.00204	-0.039255	42	0.012619	yes	HRTLV
chr1_1659220_A_G_b38	SLC35E2	-3.111	0.00204	-0.039255	42	0.012619	yes	HRTLV
chr1_1722625_A_T_b38	SLC35E2	3.11	0.00204	0.048767	26	0.015681	yes	HRTLV
chr1_965666_ACC_A_b38	SLC35E2	3.103	0.00209	0.045495	19	0.01466	yes	HRTLV
chr1_946653_G_A_b38	SLC35E2	3.103	0.00209	0.046744	18	0.015066	yes	HRTLV
chr1_1897985_C_G_b38	SLC35E2	3.096	0.00214	0.048719	12	0.015735	yes	HRTLV
chr1_1938332_A_ACT_b38	SLC35E2	-3.086	0.00221	-0.037569	92	0.012175	yes	HRTLV
chr1_1971183_G_A_b38	SLC35E2	3.085	0.00222	0.043858	20	0.014218	yes	HRTLV
chr1_1971918_G_C_b38	SLC35E2	3.085	0.00222	0.043858	20	0.014218	yes	HRTLV
chr1_1960886_T_C_b38	SLC35E2	-3.081	0.00225	-0.047669	12	0.015474	yes	HRTLV
chr1_1836856_CT_C_b38	SLC35E2	3.079	0.00226	0.048427	17	0.015728	yes	HRTLV
chr1_1743586_T_TAC_b38	SLC35E2	-3.078	0.00227	-0.04172	46	0.013553	yes	HRTLV
chr1_2021171_T_C_b38	SLC35E2	-3.064	0.00238	-0.046236	14	0.015092	yes	HRTLV
chr1_1910289_C_T_b38	SLC35E2	3.057	0.00242	0.048918	11	0.016	yes	HRTLV
chr1_1910369_G_A_b38	SLC35E2	3.057	0.00242	0.048918	11	0.016	yes	HRTLV
chr1_1910480_G_A_b38	SLC35E2	3.057	0.00242	0.048918	11	0.016	yes	HRTLV
chr1_1945842_A_AAAAGAAC_b38	SLC35E2	-3.056	0.00244	-0.041907	55	0.013714	yes	HRTLV
chr1_969663_CAT_C_b38	SLC35E2	3.056	0.00244	0.042604	23	0.013943	yes	HRTLV
chr1_1340697_G_A_b38	SLC35E2	3.051	0.00248	0.045406	22	0.014885	yes	HRTLV
chr1_2666111_C_G_b38	SLC35E2	-3.045	0.00252	-0.066711	11	0.021909	yes	HRTLV
chr1_1650195_A_G_b38	SLC35E2	-3.033	0.00262	-0.039874	39	0.013148	yes	HRTLV
chr1_1744652_C_T_b38	SLC35E2	-3.017	0.00276	-0.039111	73	0.012962	yes	HRTLV
chr1_1975657_A_G_b38	SLC35E2	3.009	0.00284	0.043603	18	0.014493	yes	HRTLV
chr1_2021343_C_A_b38	SLC35E2	-3.006	0.00286	-0.045278	14	0.015063	yes	HRTLV
chr1_1945913_T_C_b38	SLC35E2	-2.992	0.00299	-0.047503	10	0.015878	yes	HRTLV
chr1_1976566_T_C_b38	SLC35E2	2.985	0.00306	0.038452	68	0.012882	yes	HRTLV
chr1_2012662_C_G_b38	SLC35E2	-2.979	0.00311	-0.04273	20	0.014342	yes	HRTLV
chr1_2015152_G_A_b38	SLC35E2	-2.979	0.00311	-0.04273	20	0.014342	yes	HRTLV
chr1_2015370_C_T_b38	SLC35E2	-2.979	0.00311	-0.04273	20	0.014342	yes	HRTLV
chr1_2016316_C_A_b38	SLC35E2	-2.979	0.00311	-0.04273	20	0.014342	yes	HRTLV
chr1_2017366_T_C_b38	SLC35E2	-2.979	0.00311	-0.04273	20	0.014342	yes	HRTLV
chr1_2021813_T_C_b38	SLC35E2	-2.967	0.00324	-0.044327	15	0.014942	yes	HRTLV
chr1_1947645_C_T_b38	SLC35E2	-2.964	0.00327	-0.039961	72	0.013484	yes	HRTLV
chr1_1743565_ATAT_A_b38	SLC35E2	-2.963	0.00328	-0.036909	65	0.012458	yes	HRTLV
chr1_1814797_CAAAAAAAAA_C_b38	SLC35E2	2.958	0.00333	0.052211	6	0.017652	yes	HRTLV
chr1_1744028_A_AC_b38	SLC35E2	-2.954	0.00337	-0.04997	13	0.016914	yes	HRTLV
chr1_1871210_G_T_b38	SLC35E2	2.952	0.00339	0.049694	9	0.016832	yes	HRTLV
chr1_1749637_G_T_b38	SLC35E2	2.947	0.00344	0.035782	72	0.01214	yes	HRTLV
chr1_1752461_G_A_b38	SLC35E2	-2.936	0.00357	-0.039139	71	0.013333	yes	HRTLV
chr1_1752730_C_G_b38	SLC35E2	-2.936	0.00357	-0.039139	71	0.013333	yes	HRTLV
chr1_1378484_AT_A_b38	SLC35E2	2.916	0.00379	0.044754	57	0.015345	yes	HRTLV
chr1_1861110_CA_C_b38	SLC35E2	2.915	0.00381	0.05901	4	0.020242	yes	HRTLV
chr1_1909167_G_A_b38	SLC35E2	2.901	0.00398	0.049208	9	0.016962	yes	HRTLV
chr1_2018105_G_T_b38	SLC35E2	-2.894	0.00407	-0.041438	20	0.014319	yes	HRTLV
chr1_1937802_G_T_b38	SLC35E2	-2.892	0.00409	-0.038916	76	0.013455	yes	HRTLV
chr1_1944216_C_T_b38	SLC35E2	-2.888	0.00414	-0.038654	75	0.013383	yes	HRTLV
chr1_2021166_T_C_b38	SLC35E2	-2.879	0.00426	-0.041211	20	0.014315	yes	HRTLV
chr1_1798974_C_T_b38	SLC35E2	2.878	0.00427	0.047329	9	0.016443	yes	HRTLV
chr1_2023641_G_A_b38	SLC35E2	-2.876	0.0043	-0.043004	15	0.014952	yes	HRTLV
chr1_1024462_C_T_b38	SLC35E2	2.875	0.00432	0.037226	43	0.012948	yes	HRTLV
chr1_1050063_AG_A_b38	SLC35E2	2.875	0.00432	0.035273	79	0.01227	yes	HRTLV
chr1_1750280_A_G_b38	SLC35E2	-2.871	0.00436	-0.036427	82	0.012686	yes	HRTLV
chr1_1729859_A_G_b38	SLC35E2	2.87	0.00438	0.045147	11	0.01573	yes	HRTLV
chr1_1971220_C_T_b38	SLC35E2	2.868	0.00441	0.040731	20	0.014201	yes	HRTLV
chr1_1672155_G_A_b38	SLC35E2	-2.864	0.00446	-0.040136	32	0.014014	yes	HRTLV
chr1_1050069_G_A_b38	SLC35E2	-2.859	0.00453	-0.037196	88	0.01301	yes	HRTLV
chr1_1757074_G_T_b38	SLC35E2	2.859	0.00454	0.036388	69	0.01273	yes	HRTLV
chr1_1880594_A_T_b38	SLC35E2	2.858	0.00455	0.044763	12	0.015664	yes	HRTLV
chr1_1822247_A_G_b38	SLC35E2	2.855	0.00458	0.046313	10	0.016219	yes	HRTLV
chr1_2024923_G_A_b38	SLC35E2	-2.855	0.00459	-0.041636	18	0.014584	yes	HRTLV
chr1_1881065_G_A_b38	SLC35E2	2.853	0.00461	0.046278	10	0.016219	yes	HRTLV
chr1_1881798_C_T_b38	SLC35E2	2.853	0.00461	0.046278	10	0.016219	yes	HRTLV
chr1_1722619_C_T_b38	SLC35E2	2.852	0.00463	0.04525	26	0.015864	yes	HRTLV
chr1_1943142_A_G_b38	SLC35E2	-2.847	0.0047	-0.045755	10	0.016072	yes	HRTLV
chr1_1892085_G_C_b38	SLC35E2	2.842	0.00477	0.046716	8	0.016437	yes	HRTLV
chr1_1676287_C_T_b38	SLC35E2	-2.839	0.00483	-0.046321	8	0.016318	yes	HRTLV
chr1_1744052_GAGA_G_b38	SLC35E2	-2.825	0.00503	-0.04703	15	0.016646	yes	HRTLV
chr1_1798925_C_CT_b38	SLC35E2	-2.825	0.00503	-0.037742	29	0.01336	yes	HRTLV
chr1_1934565_G_A_b38	SLC35E2	-2.824	0.00505	-0.035562	89	0.012593	yes	HRTLV
chr1_1782906_T_G_b38	SLC35E2	2.819	0.00513	0.045696	10	0.016212	yes	HRTLV
chr1_1933087_C_T_b38	SLC35E2	-2.808	0.0053	-0.03473	86	0.012368	yes	HRTLV
chr1_1933859_A_G_b38	SLC35E2	-2.808	0.0053	-0.03473	86	0.012368	yes	HRTLV
chr1_1886690_A_C_b38	SLC35E2	2.803	0.00538	0.046117	9	0.016453	yes	HRTLV
chr1_1639685_G_A_b38	SLC35E2	-2.802	0.00539	-0.039057	28	0.013939	yes	HRTLV
chr1_1728671_C_A_b38	SLC35E2	2.801	0.00541	0.044997	13	0.016065	yes	HRTLV
chr1_1743840_T_C_b38	SLC35E2	-2.798	0.00546	-0.042696	27	0.015261	yes	HRTLV
chr1_1764023_C_A_b38	SLC35E2	2.794	0.00552	0.035616	70	0.012747	yes	HRTLV
chr1_1625951_G_A_b38	SLC35E2	-2.79	0.00559	-0.035048	55	0.012562	yes	HRTLV
chr1_1759611_C_T_b38	SLC35E2	-2.783	0.00571	-0.036807	73	0.013224	yes	HRTLV
chr1_1903577_C_T_b38	SLC35E2	2.778	0.0058	0.0471	9	0.016957	yes	HRTLV
chr1_1650000_G_A_b38	SLC35E2	2.765	0.00603	0.035236	50	0.012743	yes	HRTLV
chr1_1869185_C_CA_b38	SLC35E2	2.765	0.00603	0.058552	13	0.021177	yes	HRTLV
chr1_1801188_T_C_b38	SLC35E2	2.764	0.00605	0.043507	10	0.01574	yes	HRTLV
chr1_1903242_C_T_b38	SLC35E2	2.762	0.00608	0.047389	8	0.017158	yes	HRTLV
chr1_1906935_C_T_b38	SLC35E2	2.762	0.00608	0.047389	8	0.017158	yes	HRTLV
chr1_1022518_G_T_b38	SLC35E2	2.759	0.00614	0.034232	47	0.012407	yes	HRTLV
chr1_1743238_G_C_b38	SLC35E2	-2.757	0.00618	-0.036789	60	0.013345	yes	HRTLV
chr1_1775996_G_A_b38	SLC35E2	2.756	0.00618	0.045411	9	0.016475	yes	HRTLV
chr1_1753319_G_A_b38	SLC35E2	-2.756	0.0062	-0.036938	71	0.013404	yes	HRTLV
chr1_1753361_G_A_b38	SLC35E2	-2.756	0.0062	-0.036938	71	0.013404	yes	HRTLV
chr1_1637577_T_C_b38	SLC35E2	-2.756	0.0062	-0.037171	31	0.013489	yes	HRTLV
chr1_1597462_C_T_b38	SLC35E2	-2.745	0.00639	-0.039991	26	0.014567	yes	HRTLV
chr1_1882915_C_T_b38	SLC35E2	2.74	0.0065	0.045508	9	0.016611	yes	HRTLV
chr1_1936627_C_G_b38	SLC35E2	-2.739	0.00651	-0.033999	85	0.012411	yes	HRTLV
chr1_1794187_C_T_b38	SLC35E2	2.738	0.00653	0.045063	9	0.016458	yes	HRTLV
chr1_1750226_C_T_b38	SLC35E2	2.738	0.00653	0.035169	71	0.012845	yes	HRTLV
chr1_968046_C_T_b38	SLC35E2	2.737	0.00655	0.036183	38	0.013219	yes	HRTLV
chr1_1945799_T_G_b38	SLC35E2	-2.735	0.00659	-0.044814	10	0.016386	yes	HRTLV
chr1_1757725_C_T_b38	SLC35E2	2.732	0.00665	0.035352	69	0.012939	yes	HRTLV
chr1_1692124_T_G_b38	SLC35E2	-2.732	0.00665	-0.040785	25	0.014928	yes	HRTLV
chr1_2695099_G_C_b38	SLC35E2	-2.724	0.0068	-0.064905	7	0.023824	yes	HRTLV
chr1_1756043_G_T_b38	SLC35E2	-2.719	0.00692	-0.036371	71	0.013379	yes	HRTLV
chr1_992993_A_G_b38	SLC35E2	2.717	0.00696	0.03168	84	0.011662	yes	HRTLV
chr1_1743886_C_T_b38	SLC35E2	-2.703	0.00725	-0.040462	32	0.014971	yes	HRTLV
chr1_1648636_G_A_b38	SLC35E2	-2.694	0.00744	-0.034702	42	0.012881	yes	HRTLV
chr1_1935987_G_A_b38	SLC35E2	-2.69	0.00753	-0.035407	81	0.013164	yes	HRTLV
chr1_1752908_C_CCCT_b38	SLC35E2	-2.688	0.00756	-0.038455	57	0.014305	yes	HRTLV
chr1_1028341_T_C_b38	SLC35E2	2.687	0.00759	0.04369	7	0.016259	yes	HRTLV
chr1_1752126_G_A_b38	SLC35E2	2.687	0.00759	0.037272	47	0.01387	yes	HRTLV
chr1_1849781_T_C_b38	SLC35E2	-2.679	0.00778	-0.039252	22	0.014654	yes	HRTLV
chr1_1743851_C_T_b38	SLC35E2	-2.673	0.0079	-0.040563	27	0.015174	yes	HRTLV
chr1_1898043_T_C_b38	SLC35E2	2.671	0.00795	0.044401	9	0.016622	yes	HRTLV
chr1_1742672_C_T_b38	SLC35E2	-2.656	0.00832	-0.035296	61	0.013291	yes	HRTLV
chr1_1022868_A_G_b38	SLC35E2	2.65	0.00847	0.033072	50	0.012482	yes	HRTLV
chr1_1723766_C_T_b38	SLC35E2	-2.647	0.00852	-0.043559	19	0.016455	yes	HRTLV
chr1_1938771_G_A_b38	SLC35E2	-2.634	0.00885	-0.042247	10	0.016038	yes	HRTLV
chr1_1742119_C_CA_b38	SLC35E2	-2.634	0.00886	-0.085504	4	0.032466	yes	HRTLV
chr1_1755504_T_C_b38	SLC35E2	2.629	0.00898	0.032594	91	0.012397	yes	HRTLV
chr1_1743712_G_A_b38	SLC35E2	2.621	0.0092	0.05449	5	0.020792	yes	HRTLV
chr1_2022997_G_A_b38	SLC35E2	-2.62	0.00921	-0.0378	20	0.014426	yes	HRTLV
chr1_1743565_AT_A_b38	SLC35E2	2.62	0.00921	0.031192	95	0.011905	yes	HRTLV
chr1_1943706_C_T_b38	SLC35E2	-2.617	0.00931	-0.041921	11	0.016021	yes	HRTLV
chr1_1717604_CGCTTTCAGCTAGAGTTTGCTCTCTCTGGTTTTCGGTCTGTGACACACGCAT_C_b38	SLC35E2	2.612	0.00943	0.031712	64	0.01214	yes	HRTLV
chr1_1936906_C_CA_b38	SLC35E2	-2.603	0.00969	-0.038418	39	0.014761	yes	HRTLV
chr1_1912140_T_G_b38	SLC35E2	2.595	0.00989	0.040644	14	0.01566	yes	HRTLV
chr1_1748780_G_A_b38	SLC35E2	-2.594	0.00992	-0.033406	84	0.012877	yes	HRTLV
chr1_1936077_C_T_b38	SLC35E2	-2.592	0.01	-0.032174	90	0.012415	yes	HRTLV
chr1_1621352_G_A_b38	SLC35E2	4.816	2.28e-06	0.060853	38	0.012637	no	HRTLV
chr1_1612562_T_TC_b38	SLC35E2	4.814	2.3e-06	0.061226	36	0.012718	no	HRTLV
chr1_1613769_C_T_b38	SLC35E2	4.785	2.63e-06	0.062292	37	0.013017	no	HRTLV
chr1_1620609_G_A_b38	SLC35E2	4.766	2.88e-06	0.060099	38	0.012611	no	HRTLV
chr1_1607931_G_A_b38	SLC35E2	4.625	5.48e-06	0.058079	38	0.012558	no	HRTLV
chr1_1609058_G_A_b38	SLC35E2	4.614	5.75e-06	0.05783	38	0.012533	no	HRTLV
chr1_1589495_CTTT_C_b38	SLC35E2	4.585	6.57e-06	0.065091	25	0.014197	no	HRTLV
chr1_1622295_G_C_b38	SLC35E2	4.572	6.96e-06	0.057801	38	0.012644	no	HRTLV
chr1_1600320_C_G_b38	SLC35E2	4.531	8.35e-06	0.057619	36	0.012717	no	HRTLV
chr1_1667424_T_TAAAATA_b38	SLC35E2	4.515	8.95e-06	0.057194	47	0.012667	no	HRTLV
chr1_1600379_C_T_b38	SLC35E2	4.468	1.1e-05	0.056149	38	0.012567	no	HRTLV
chr1_1667424_T_TAAATA_b38	SLC35E2	-4.359	1.77e-05	-0.052766	61	0.012104	no	HRTLV
chr1_1606384_A_G_b38	SLC35E2	4.315	2.14e-05	0.053825	43	0.012474	no	HRTLV
chr1_1960609_G_C_b38	SLC35E2	-4.282	2.46e-05	-0.0524	66	0.012236	no	HRTLV
chr1_1595028_C_CAG_b38	SLC35E2	4.245	2.87e-05	0.057543	27	0.013554	no	HRTLV
chr1_1629332_G_T_b38	SLC35E2	4.2	3.47e-05	0.05509	37	0.013116	no	HRTLV
chr1_1586962_C_T_b38	SLC35E2	4.135	4.56e-05	0.055385	36	0.013395	no	HRTLV
chr1_1660318_C_T_b38	SLC35E2	4.127	4.72e-05	0.075414	3	0.018274	no	HRTLV
chr1_1630798_C_T_b38	SLC35E2	4.046	6.55e-05	0.053057	37	0.013112	no	HRTLV
chr1_1591703_T_C_b38	SLC35E2	3.965	9.1e-05	0.04625	74	0.011666	no	HRTLV
chr1_1595306_CAG_C_b38	SLC35E2	-3.867	0.000134	-0.049027	85	0.012679	no	HRTLV
chr1_1593732_G_C_b38	SLC35E2	-3.828	0.000156	-0.045805	76	0.011965	no	HRTLV
chr1_1606532_GTGGGCTGGGCTGGTCAGGCA_G_b38	SLC35E2	3.826	0.000157	0.048785	36	0.01275	no	HRTLV
chr1_1594890_G_GAC_b38	SLC35E2	-3.794	0.000178	-0.046103	74	0.012152	no	HRTLV
chr1_1589491_A_G_b38	SLC35E2	-3.767	0.000197	-0.046894	52	0.01245	no	HRTLV
chr1_1026830_A_G_b38	SLC35E2	3.738	0.000221	0.046673	49	0.012487	no	HRTLV
chr1_1589418_T_TA_b38	SLC35E2	3.675	0.000279	0.047847	55	0.013018	no	HRTLV
chr1_1597128_C_CCCTCAGCTGGACT_b38	SLC35E2	-3.564	0.000422	-0.042683	64	0.011977	no	HRTLV
chr1_1837255_A_AT_b38	SLC35E2	3.557	0.000432	0.055096	15	0.015488	no	HRTLV
chr1_1025970_C_T_b38	SLC35E2	3.516	0.000503	0.044713	40	0.012718	no	HRTLV
chr1_1589057_T_C_b38	SLC35E2	-3.492	0.000548	-0.044173	50	0.012651	no	HRTLV
chr1_975093_G_A_b38	SLC35E2	3.464	0.000607	0.05822	10	0.016809	no	HRTLV
chr1_1589151_C_T_b38	SLC35E2	-3.447	0.000643	-0.043421	50	0.012596	no	HRTLV
chr1_996120_C_T_b38	SLC35E2	3.443	0.000653	0.054788	9	0.015912	no	HRTLV
chr1_987103_T_C_b38	SLC35E2	3.44	0.000659	0.053825	10	0.015645	no	HRTLV
chr1_991588_C_T_b38	SLC35E2	3.44	0.000659	0.053825	10	0.015645	no	HRTLV
chr1_994185_G_T_b38	SLC35E2	3.438	0.000664	0.054788	9	0.015934	no	HRTLV
chr1_1590682_T_C_b38	SLC35E2	-3.43	0.000684	-0.042917	51	0.012513	no	HRTLV
chr1_1670423_AT_A_b38	SLC35E2	3.425	0.000696	0.049903	45	0.01457	no	HRTLV
chr1_1840043_T_TA_b38	SLC35E2	3.413	0.000725	0.056475	6	0.016545	no	HRTLV
chr1_1773715_T_A_b38	SLC35E2	-3.391	0.000784	-0.040966	84	0.012079	no	HRTLV
chr1_1967499_G_A_b38	SLC35E2	3.365	0.00086	0.041564	67	0.012351	no	HRTLV
chr1_1668108_C_T_b38	SLC35E2	3.309	0.00104	0.042479	40	0.012837	no	HRTLV
chr1_1659060_G_A_b38	SLC35E2	-3.307	0.00105	-0.043311	34	0.013097	no	HRTLV
chr1_1606094_G_GAGGGGTC_b38	SLC35E2	3.246	0.00129	0.047923	27	0.014762	no	HRTLV
chr1_1587397_A_AT_b38	SLC35E2	-3.245	0.0013	-0.042579	58	0.013123	no	HRTLV
chr1_985597_T_C_b38	SLC35E2	3.213	0.00145	0.050357	10	0.015671	no	HRTLV
chr1_1589618_A_T_b38	SLC35E2	-3.207	0.00148	-0.041335	44	0.012891	no	HRTLV
chr1_1039411_T_TGGG_b38	SLC35E2	3.198	0.00153	0.044184	27	0.013818	no	HRTLV
chr1_2691474_C_G_b38	SLC35E2	-3.189	0.00157	-0.088463	7	0.027743	no	HRTLV
chr1_1974351_A_G_b38	SLC35E2	3.171	0.00167	0.045837	18	0.014453	no	HRTLV
chr1_1698048_T_C_b38	SLC35E2	-3.163	0.00172	-0.090484	3	0.028611	no	HRTLV
chr1_1606089_GGC_G_b38	SLC35E2	3.154	0.00177	0.046555	27	0.014761	no	HRTLV
chr1_1963533_C_CA_b38	SLC35E2	3.153	0.00177	0.038965	68	0.012358	no	HRTLV
chr1_1000291_C_G_b38	SLC35E2	3.111	0.00204	0.049132	10	0.015795	no	HRTLV
chr1_998750_G_C_b38	SLC35E2	3.106	0.00207	0.049067	10	0.015799	no	HRTLV
chr1_1609070_G_A_b38	SLC35E2	-3.099	0.00212	-0.040164	48	0.012961	no	HRTLV
chr1_2695064_G_C_b38	SLC35E2	-3.074	0.00229	-0.064638	4	0.021025	no	HRTLV
chr1_1629572_TG_T_b38	SLC35E2	-3.069	0.00233	-0.039899	48	0.012999	no	HRTLV
chr1_985260_C_T_b38	SLC35E2	3.068	0.00234	0.047411	11	0.015452	no	HRTLV
chr1_1584321_T_C_b38	SLC35E2	-3.06	0.00241	-0.039656	49	0.012961	no	HRTLV
chr1_1969015_A_G_b38	SLC35E2	3.056	0.00244	0.04148	75	0.013574	no	HRTLV
chr1_1608603_C_A_b38	SLC35E2	-3.044	0.00253	-0.039674	47	0.013033	no	HRTLV
chr1_1776772_TA_T_b38	SLC35E2	3.043	0.00254	0.052537	7	0.017263	no	HRTLV
chr1_1660408_T_C_b38	SLC35E2	-3.035	0.00261	-0.047701	9	0.015718	no	HRTLV
chr1_985123_G_A_b38	SLC35E2	3.026	0.00269	0.049955	9	0.016511	no	HRTLV
chr1_1624323_AT_A_b38	SLC35E2	3.023	0.0027	0.03737	63	0.01236	no	HRTLV
chr1_1628814_C_T_b38	SLC35E2	-2.986	0.00305	-0.038863	47	0.013016	no	HRTLV
chr1_1963538_T_C_b38	SLC35E2	2.98	0.00311	0.036805	66	0.01235	no	HRTLV
chr1_2024545_C_T_b38	SLC35E2	-2.975	0.00316	-0.043056	18	0.014475	no	HRTLV
chr1_1628409_C_A_b38	SLC35E2	-2.959	0.00332	-0.038412	47	0.012982	no	HRTLV
chr1_1613090_A_G_b38	SLC35E2	-2.954	0.00337	-0.038634	47	0.013077	no	HRTLV
chr1_1773717_T_A_b38	SLC35E2	-2.95	0.00341	-0.036766	57	0.012462	no	HRTLV
chr1_1664865_A_G_b38	SLC35E2	-2.946	0.00346	-0.03715	40	0.012612	no	HRTLV
chr1_1688442_T_C_b38	SLC35E2	-2.943	0.00349	-0.043045	30	0.014624	no	HRTLV
chr1_1742587_G_C_b38	SLC35E2	2.942	0.0035	0.036543	91	0.01242	no	HRTLV
chr1_1679993_A_G_b38	SLC35E2	-2.942	0.00351	-0.035037	84	0.01191	no	HRTLV
chr1_1592572_T_C_b38	SLC35E2	-2.933	0.0036	-0.038123	45	0.012997	no	HRTLV
chr1_1622510_C_T_b38	SLC35E2	-2.929	0.00365	-0.038435	46	0.013125	no	HRTLV
chr1_1684789_C_CAAAAA_b38	SLC35E2	-2.906	0.00392	-0.074231	7	0.025544	no	HRTLV
chr1_1594614_G_C_b38	SLC35E2	-2.902	0.00397	-0.03825	45	0.01318	no	HRTLV
chr1_1646352_A_C_b38	SLC35E2	2.892	0.00409	0.050592	6	0.017492	no	HRTLV
chr1_981282_A_C_b38	SLC35E2	2.892	0.0041	0.042671	18	0.014757	no	HRTLV
chr1_982890_C_T_b38	SLC35E2	2.892	0.0041	0.043073	17	0.014896	no	HRTLV
chr1_983237_G_A_b38	SLC35E2	2.892	0.0041	0.043073	17	0.014896	no	HRTLV
chr1_1624720_G_A_b38	SLC35E2	-2.881	0.00424	-0.037753	48	0.013105	no	HRTLV
chr1_1610924_C_T_b38	SLC35E2	-2.877	0.00428	-0.037534	47	0.013045	no	HRTLV
chr1_1618118_G_A_b38	SLC35E2	-2.877	0.00428	-0.037534	47	0.013045	no	HRTLV
chr1_978230_G_A_b38	SLC35E2	2.874	0.00433	0.042656	17	0.014842	no	HRTLV
chr1_1613330_A_AT_b38	SLC35E2	-2.871	0.00436	-0.039188	41	0.013647	no	HRTLV
chr1_1605347_C_T_b38	SLC35E2	-2.869	0.00439	-0.037508	47	0.013072	no	HRTLV
chr1_976536_C_T_b38	SLC35E2	2.867	0.00443	0.042848	16	0.014947	no	HRTLV
chr1_1688102_G_A_b38	SLC35E2	-2.866	0.00443	-0.041701	25	0.014548	no	HRTLV
chr1_982112_C_T_b38	SLC35E2	2.855	0.00459	0.042432	17	0.014864	no	HRTLV
chr1_1836387_CT_C_b38	SLC35E2	2.852	0.00463	0.04971	19	0.017429	no	HRTLV
chr1_1652913_C_T_b38	SLC35E2	-2.848	0.00469	-0.038265	30	0.013437	no	HRTLV
chr1_1625805_G_A_b38	SLC35E2	-2.835	0.00488	-0.037216	48	0.013129	no	HRTLV
chr1_981935_G_A_b38	SLC35E2	2.831	0.00494	0.040695	19	0.014375	no	HRTLV
chr1_1587413_C_T_b38	SLC35E2	-2.825	0.00502	-0.036735	64	0.013002	no	HRTLV
chr1_1586679_C_T_b38	SLC35E2	-2.806	0.00532	-0.036412	64	0.012974	no	HRTLV
chr1_1596144_GAGAC_G_b38	SLC35E2	-2.802	0.00539	-0.036425	46	0.013	no	HRTLV
chr1_1586626_C_T_b38	SLC35E2	-2.799	0.00544	-0.036302	64	0.012968	no	HRTLV
chr1_1586425_A_G_b38	SLC35E2	-2.798	0.00545	-0.036002	65	0.012866	no	HRTLV
chr1_1616048_C_T_b38	SLC35E2	-2.796	0.00549	-0.036282	50	0.012976	no	HRTLV
chr1_1609196_CA_C_b38	SLC35E2	2.744	0.00642	0.03859	37	0.014064	no	HRTLV
chr1_1648826_A_G_b38	SLC35E2	-2.739	0.00651	-0.03516	42	0.012835	no	HRTLV
chr1_1987547_C_CT_b38	SLC35E2	2.723	0.00682	0.036826	69	0.013523	no	HRTLV
chr1_2074854_G_GT_b38	SLC35E2	-2.721	0.00686	-0.046098	11	0.01694	no	HRTLV
chr1_1000079_A_G_b38	SLC35E2	-2.72	0.00689	-0.040247	29	0.014798	no	HRTLV
chr1_1041950_T_C_b38	SLC35E2	2.72	0.0069	0.051713	7	0.019015	no	HRTLV
chr1_1038078_C_T_b38	SLC35E2	2.719	0.00692	0.051679	7	0.019009	no	HRTLV
chr1_1675132_A_G_b38	SLC35E2	2.7	0.00732	0.036957	50	0.01369	no	HRTLV
chr1_973443_G_A_b38	SLC35E2	2.697	0.00738	0.039852	17	0.014778	no	HRTLV
chr1_2067567_G_A_b38	SLC35E2	-2.692	0.00748	-0.045972	7	0.017077	no	HRTLV
chr1_1657081_C_T_b38	SLC35E2	-2.688	0.00756	-0.038672	28	0.014386	no	HRTLV
chr1_1649846_G_A_b38	SLC35E2	-2.682	0.00771	-0.039406	17	0.014693	no	HRTLV
chr1_1595226_C_G_b38	SLC35E2	2.67	0.00798	0.043865	13	0.01643	no	HRTLV
chr1_1650777_G_A_b38	SLC35E2	-2.669	0.00801	-0.034183	38	0.012808	no	HRTLV
chr1_1000112_G_T_b38	SLC35E2	-2.668	0.00802	-0.0396	28	0.014842	no	HRTLV
chr1_965337_CTTAT_C_b38	SLC35E2	-2.667	0.00804	-0.036569	81	0.01371	no	HRTLV
chr1_1650383_G_T_b38	SLC35E2	-2.666	0.00806	-0.036245	31	0.013593	no	HRTLV
chr1_1650688_T_A_b38	SLC35E2	-2.664	0.00812	-0.036374	30	0.013655	no	HRTLV
chr1_1688570_A_T_b38	SLC35E2	-2.661	0.00819	-0.043242	14	0.01625	no	HRTLV
chr1_1651137_C_T_b38	SLC35E2	-2.651	0.00842	-0.034085	38	0.012855	no	HRTLV
chr1_1651267_T_C_b38	SLC35E2	-2.651	0.00842	-0.034085	38	0.012855	no	HRTLV
chr1_1651574_G_A_b38	SLC35E2	-2.651	0.00842	-0.034085	38	0.012855	no	HRTLV
chr1_1651785_C_A_b38	SLC35E2	-2.651	0.00842	-0.034085	38	0.012855	no	HRTLV
chr1_1651926_T_C_b38	SLC35E2	-2.651	0.00842	-0.034085	38	0.012855	no	HRTLV
chr1_1652061_T_C_b38	SLC35E2	-2.651	0.00842	-0.034085	38	0.012855	no	HRTLV
chr1_1652135_C_G_b38	SLC35E2	-2.651	0.00842	-0.034085	38	0.012855	no	HRTLV
chr1_1652191_C_T_b38	SLC35E2	-2.651	0.00842	-0.034085	38	0.012855	no	HRTLV
chr1_1652592_A_G_b38	SLC35E2	-2.651	0.00842	-0.034085	38	0.012855	no	HRTLV
chr1_1652779_A_G_b38	SLC35E2	-2.651	0.00842	-0.034085	38	0.012855	no	HRTLV
chr1_1653147_A_C_b38	SLC35E2	-2.651	0.00842	-0.034085	38	0.012855	no	HRTLV
chr1_1653396_T_C_b38	SLC35E2	-2.651	0.00842	-0.034085	38	0.012855	no	HRTLV
chr1_1653472_T_C_b38	SLC35E2	-2.651	0.00842	-0.034085	38	0.012855	no	HRTLV
chr1_1653811_G_A_b38	SLC35E2	-2.651	0.00842	-0.034085	38	0.012855	no	HRTLV
chr1_1653893_C_T_b38	SLC35E2	-2.651	0.00842	-0.034085	38	0.012855	no	HRTLV
chr1_1653934_G_A_b38	SLC35E2	-2.651	0.00842	-0.034085	38	0.012855	no	HRTLV
chr1_1654143_G_A_b38	SLC35E2	-2.651	0.00842	-0.034085	38	0.012855	no	HRTLV
chr1_1654188_T_G_b38	SLC35E2	-2.651	0.00842	-0.034085	38	0.012855	no	HRTLV
chr1_1133807_G_A_b38	SLC35E2	2.635	0.00884	0.050121	11	0.019025	no	HRTLV
chr1_1133811_A_G_b38	SLC35E2	2.635	0.00884	0.050121	11	0.019025	no	HRTLV
chr1_1657085_C_CTAA_b38	SLC35E2	-2.618	0.00927	-0.038081	28	0.014546	no	HRTLV
chr1_1587352_A_G_b38	SLC35E2	-2.607	0.00958	-0.03351	66	0.012856	no	HRTLV
chr1_1585345_C_T_b38	SLC35E2	-2.606	0.00961	-0.034252	56	0.013146	no	HRTLV
chr1_1714674_G_C_b38	SLC35E2	2.6	0.00976	0.048135	21	0.018514	no	HRTLV
chr1_1688586_C_T_b38	SLC35E2	-2.595	0.00991	-0.039643	26	0.015279	no	HRTLV
chr1_1582992_C_CT_b38	SLC35E2	4.229	0.000107	0.162708	13	0.038473	yes	KDNCTX
chr1_2416398_G_GGGACA_b38	SLC35E2	-3.22	0.00233	-0.131186	7	0.040747	yes	KDNCTX
chr1_2342999_A_G_b38	SLC35E2	3.099	0.00328	0.146829	4	0.047385	yes	KDNCTX
chr1_1670423_AT_A_b38	SLC35E2	3.056	0.00369	0.154776	10	0.05064	yes	KDNCTX
chr1_915400_C_T_b38	SLC35E2	-3.016	0.00412	-0.111972	16	0.037125	yes	KDNCTX
chr1_917495_C_T_b38	SLC35E2	-3.016	0.00412	-0.111972	16	0.037125	yes	KDNCTX
chr1_918574_C_A_b38	SLC35E2	-3.016	0.00412	-0.111972	16	0.037125	yes	KDNCTX
chr1_919598_A_C_b38	SLC35E2	-3.006	0.00424	-0.112993	17	0.037587	yes	KDNCTX
chr1_2215707_T_C_b38	SLC35E2	-2.832	0.00678	-0.121697	8	0.042966	yes	KDNCTX
chr1_2224923_A_G_b38	SLC35E2	-2.832	0.00678	-0.121697	8	0.042966	yes	KDNCTX
chr1_924305_G_A_b38	SLC35E2	2.809	0.00722	0.13372	7	0.047603	yes	KDNCTX
chr1_914838_T_A_b38	SLC35E2	-2.799	0.00742	-0.107334	17	0.038354	yes	KDNCTX
chr1_916657_G_A_b38	SLC35E2	-2.799	0.00742	-0.107334	17	0.038354	yes	KDNCTX
chr1_916683_G_A_b38	SLC35E2	-2.799	0.00742	-0.107334	17	0.038354	yes	KDNCTX
chr1_2241949_C_CTG_b38	SLC35E2	-2.769	0.00803	-0.131904	6	0.047641	yes	KDNCTX
chr1_1067159_G_A_b38	SLC35E2	2.764	0.00814	0.156636	7	0.056678	yes	KDNCTX
chr1_914991_G_T_b38	SLC35E2	-2.763	0.00815	-0.10657	15	0.038572	yes	KDNCTX
chr1_1067007_A_G_b38	SLC35E2	2.724	0.00902	0.138476	5	0.05083	yes	KDNCTX
chr1_2225560_G_C_b38	SLC35E2	-2.708	0.00941	-0.116397	8	0.042985	yes	KDNCTX
chr1_1739131_T_C_b38	SLC35E2	4.256	9.86e-05	0.140028	13	0.032902	no	KDNCTX
chr1_1671995_G_T_b38	SLC35E2	4.079	0.000174	0.165765	17	0.040641	no	KDNCTX
chr1_1673060_G_A_b38	SLC35E2	3.639	0.000679	0.152509	17	0.041911	no	KDNCTX
chr1_1673818_A_C_b38	SLC35E2	3.639	0.000679	0.152509	17	0.041911	no	KDNCTX
chr1_1676790_C_T_b38	SLC35E2	3.549	0.000891	0.138169	18	0.038935	no	KDNCTX
chr1_2433984_T_TC_b38	SLC35E2	-3.547	0.000896	-0.128024	15	0.036097	no	KDNCTX
chr1_914682_A_T_b38	SLC35E2	3.468	0.00113	0.161516	8	0.046578	no	KDNCTX
chr1_915810_G_A_b38	SLC35E2	3.444	0.00122	0.157124	8	0.045626	no	KDNCTX
chr1_1658830_C_G_b38	SLC35E2	-3.408	0.00135	-0.177994	3	0.052235	no	KDNCTX
chr1_1673968_GA_G_b38	SLC35E2	3.402	0.00138	0.15211	7	0.044715	no	KDNCTX
chr1_1651653_C_T_b38	SLC35E2	3.383	0.00146	0.147821	14	0.043699	no	KDNCTX
chr1_1650383_G_T_b38	SLC35E2	-3.358	0.00156	-0.164796	4	0.049072	no	KDNCTX
chr1_1674720_TGC_T_b38	SLC35E2	3.34	0.00165	0.136844	17	0.040971	no	KDNCTX
chr1_1674868_G_A_b38	SLC35E2	3.34	0.00165	0.136844	17	0.040971	no	KDNCTX
chr1_912111_G_A_b38	SLC35E2	3.33	0.00169	0.153944	9	0.046223	no	KDNCTX
chr1_913076_A_G_b38	SLC35E2	3.33	0.00169	0.153944	9	0.046223	no	KDNCTX
chr1_922660_C_A_b38	SLC35E2	3.324	0.00173	0.159525	6	0.047998	no	KDNCTX
chr1_914483_G_GACTGCCCAGCTC_b38	SLC35E2	3.282	0.00195	0.152571	8	0.046492	no	KDNCTX
chr1_1639348_G_T_b38	SLC35E2	-3.256	0.0021	-0.158791	5	0.048763	no	KDNCTX
chr1_923311_TG_T_b38	SLC35E2	-3.253	0.00212	-0.144649	8	0.044473	no	KDNCTX
chr1_923421_A_G_b38	SLC35E2	-3.253	0.00212	-0.144649	8	0.044473	no	KDNCTX
chr1_1677720_T_G_b38	SLC35E2	3.213	0.00237	0.124213	18	0.038658	no	KDNCTX
chr1_1677726_A_T_b38	SLC35E2	3.213	0.00237	0.124213	18	0.038658	no	KDNCTX
chr1_922671_C_T_b38	SLC35E2	3.198	0.00247	0.15561	6	0.048652	no	KDNCTX
chr1_914948_CA_C_b38	SLC35E2	3.176	0.00264	0.156638	5	0.049325	no	KDNCTX
chr1_933038_C_T_b38	SLC35E2	3.168	0.0027	0.156905	6	0.049534	no	KDNCTX
chr1_1671797_G_A_b38	SLC35E2	3.138	0.00293	0.140304	17	0.044709	no	KDNCTX
chr1_1739519_C_G_b38	SLC35E2	3.128	0.00302	0.134667	6	0.043056	no	KDNCTX
chr1_925308_G_A_b38	SLC35E2	-3.083	0.00342	-0.146929	7	0.047658	no	KDNCTX
chr1_928622_G_C_b38	SLC35E2	3.072	0.00353	0.144642	6	0.047085	no	KDNCTX
chr1_909894_G_T_b38	SLC35E2	3.062	0.00363	0.141569	9	0.04623	no	KDNCTX
chr1_918870_A_G_b38	SLC35E2	3.057	0.00368	0.148178	7	0.048474	no	KDNCTX
chr1_915824_G_C_b38	SLC35E2	3.054	0.00371	0.140502	9	0.046004	no	KDNCTX
chr1_925036_G_A_b38	SLC35E2	-2.994	0.00438	-0.142336	7	0.047533	no	KDNCTX
chr1_927486_C_T_b38	SLC35E2	-2.976	0.0046	-0.14222	7	0.047788	no	KDNCTX
chr1_1648736_G_A_b38	SLC35E2	2.973	0.00464	0.137045	13	0.046099	no	KDNCTX
chr1_940296_GCC_G_b38	SLC35E2	-2.969	0.00469	-0.099529	18	0.033523	no	KDNCTX
chr1_911848_C_T_b38	SLC35E2	2.924	0.00531	0.138976	9	0.047532	no	KDNCTX
chr1_1668721_C_T_b38	SLC35E2	-2.922	0.00533	-0.141812	4	0.048532	no	KDNCTX
chr1_913065_G_A_b38	SLC35E2	2.913	0.00546	0.138643	9	0.047592	no	KDNCTX
chr1_1671148_C_T_b38	SLC35E2	2.911	0.00549	0.126245	7	0.043367	no	KDNCTX
chr1_926250_G_A_b38	SLC35E2	-2.889	0.00582	-0.142288	7	0.049246	no	KDNCTX
chr1_936972_G_C_b38	SLC35E2	2.883	0.00592	0.121409	9	0.042107	no	KDNCTX
chr1_912710_G_A_b38	SLC35E2	2.858	0.00633	0.143578	6	0.050232	no	KDNCTX
chr1_913274_TG_T_b38	SLC35E2	2.858	0.00633	0.143578	6	0.050232	no	KDNCTX
chr1_913358_C_T_b38	SLC35E2	2.858	0.00633	0.143578	6	0.050232	no	KDNCTX
chr1_914743_C_T_b38	SLC35E2	2.858	0.00633	0.143578	6	0.050232	no	KDNCTX
chr1_917284_C_T_b38	SLC35E2	2.858	0.00633	0.143578	6	0.050232	no	KDNCTX
chr1_917378_G_C_b38	SLC35E2	2.858	0.00633	0.143578	6	0.050232	no	KDNCTX
chr1_917859_A_G_b38	SLC35E2	2.858	0.00633	0.143578	6	0.050232	no	KDNCTX
chr1_1675091_A_G_b38	SLC35E2	-2.811	0.00719	-0.137833	3	0.04904	no	KDNCTX
chr1_910558_G_A_b38	SLC35E2	2.805	0.00729	0.130849	7	0.046642	no	KDNCTX
chr1_1648636_G_A_b38	SLC35E2	-2.789	0.00761	-0.144186	5	0.051695	no	KDNCTX
chr1_1648826_A_G_b38	SLC35E2	-2.789	0.00761	-0.144186	5	0.051695	no	KDNCTX
chr1_1649932_C_T_b38	SLC35E2	2.771	0.00797	0.124613	13	0.044962	no	KDNCTX
chr1_929839_G_A_b38	SLC35E2	2.734	0.0088	0.132997	6	0.048648	no	KDNCTX
chr1_932255_C_T_b38	SLC35E2	2.734	0.0088	0.132997	6	0.048648	no	KDNCTX
chr1_1658866_G_A_b38	SLC35E2	-2.733	0.00882	-0.138288	5	0.050602	no	KDNCTX
chr1_1659114_A_G_b38	SLC35E2	-2.733	0.00882	-0.138288	5	0.050602	no	KDNCTX
chr1_1659220_A_G_b38	SLC35E2	-2.733	0.00882	-0.138288	5	0.050602	no	KDNCTX
chr1_1661420_C_A_b38	SLC35E2	-2.733	0.00882	-0.138288	5	0.050602	no	KDNCTX
chr1_1664865_A_G_b38	SLC35E2	-2.733	0.00882	-0.138288	5	0.050602	no	KDNCTX
chr1_1650370_C_CT_b38	SLC35E2	-2.731	0.00887	-0.142978	4	0.052356	no	KDNCTX
chr1_935265_T_C_b38	SLC35E2	2.7	0.0096	0.127153	8	0.047088	no	KDNCTX
chr1_1671097_G_C_b38	SLC35E2	2.692	0.00982	0.11833	7	0.043963	no	KDNCTX
chr1_975555_G_A_b38	SLC35E2	2.685	0.00998	0.122394	7	0.045582	no	KDNCTX
chr1_1671995_G_T_b38	SLC35E2	6.957	7.53e-11	0.097893	55	0.014071	yes	LIVER
chr1_1673060_G_A_b38	SLC35E2	6.435	1.25e-09	0.094605	54	0.014702	yes	LIVER
chr1_1673818_A_C_b38	SLC35E2	6.394	1.56e-09	0.092881	55	0.014527	yes	LIVER
chr1_1671797_G_A_b38	SLC35E2	6.267	3.02e-09	0.088548	52	0.01413	yes	LIVER
chr1_1676790_C_T_b38	SLC35E2	6.091	7.48e-09	0.08777	55	0.01441	yes	LIVER
chr1_1674720_TGC_T_b38	SLC35E2	6.067	8.44e-09	0.089782	53	0.014798	yes	LIVER
chr1_1674868_G_A_b38	SLC35E2	6.067	8.44e-09	0.089782	53	0.014798	yes	LIVER
chr1_1677720_T_G_b38	SLC35E2	5.798	3.28e-08	0.085225	55	0.0147	yes	LIVER
chr1_1677726_A_T_b38	SLC35E2	5.798	3.28e-08	0.085225	55	0.0147	yes	LIVER
chr1_1670423_AT_A_b38	SLC35E2	5.771	3.74e-08	0.105881	31	0.018348	yes	LIVER
chr1_1649932_C_T_b38	SLC35E2	5.02	1.32e-06	0.086205	36	0.017173	yes	LIVER
chr1_1648736_G_A_b38	SLC35E2	4.996	1.46e-06	0.084461	40	0.016905	yes	LIVER
chr1_1674633_C_CA_b38	SLC35E2	4.961	1.72e-06	0.084156	28	0.016964	yes	LIVER
chr1_1651653_C_T_b38	SLC35E2	4.916	2.1e-06	0.081293	47	0.016538	yes	LIVER
chr1_1667424_T_TAAAATA_b38	SLC35E2	4.672	6.1e-06	0.079226	30	0.016956	yes	LIVER
chr1_1661562_G_C_b38	SLC35E2	4.517	1.18e-05	0.069285	49	0.015339	yes	LIVER
chr1_1649976_G_A_b38	SLC35E2	4.387	2.03e-05	0.078477	30	0.017888	yes	LIVER
chr1_1612562_T_TC_b38	SLC35E2	4.339	2.47e-05	0.075023	20	0.017289	yes	LIVER
chr1_1636278_G_T_b38	SLC35E2	4.301	2.88e-05	0.077004	31	0.017902	yes	LIVER
chr1_1615322_A_G_b38	SLC35E2	4.259	3.42e-05	0.075096	24	0.017633	yes	LIVER
chr1_1586962_C_T_b38	SLC35E2	4.257	3.45e-05	0.077	23	0.018088	yes	LIVER
chr1_1675228_C_CG_b38	SLC35E2	4.229	3.85e-05	0.071519	34	0.01691	yes	LIVER
chr1_1667424_T_TAAATA_b38	SLC35E2	-4.193	4.45e-05	-0.06843	39	0.016318	yes	LIVER
chr1_1615869_C_T_b38	SLC35E2	4.159	5.11e-05	0.073503	24	0.017675	yes	LIVER
chr1_1613421_T_C_b38	SLC35E2	4.122	5.9e-05	0.07281	24	0.017662	yes	LIVER
chr1_1621352_G_A_b38	SLC35E2	4.122	5.91e-05	0.074322	19	0.018031	yes	LIVER
chr1_1673968_GA_G_b38	SLC35E2	4.105	6.3e-05	0.078845	19	0.019205	yes	LIVER
chr1_1613322_T_C_b38	SLC35E2	4.066	7.35e-05	0.0707	25	0.017387	yes	LIVER
chr1_1658422_T_C_b38	SLC35E2	4.018	8.85e-05	0.083121	9	0.020685	yes	LIVER
chr1_1600320_C_G_b38	SLC35E2	3.999	9.53e-05	0.072305	18	0.01808	yes	LIVER
chr1_1661169_C_A_b38	SLC35E2	3.952	0.000114	0.070927	20	0.017947	yes	LIVER
chr1_1620609_G_A_b38	SLC35E2	3.924	0.000127	0.070619	19	0.017998	yes	LIVER
chr1_1613769_C_T_b38	SLC35E2	3.872	0.000155	0.072786	18	0.0188	yes	LIVER
chr1_1675132_A_G_b38	SLC35E2	3.845	0.000171	0.068774	29	0.017887	yes	LIVER
chr1_1622295_G_C_b38	SLC35E2	3.76	0.000234	0.067799	19	0.01803	yes	LIVER
chr1_1600379_C_T_b38	SLC35E2	3.707	0.000285	0.066515	19	0.017944	yes	LIVER
chr1_1672155_G_A_b38	SLC35E2	-3.694	0.000299	-0.065177	22	0.017643	yes	LIVER
chr1_1606532_GTGGGCTGGGCTGGTCAGGCA_G_b38	SLC35E2	3.691	0.000302	0.065998	18	0.017879	yes	LIVER
chr1_1629332_G_T_b38	SLC35E2	3.691	0.000302	0.071417	18	0.01935	yes	LIVER
chr1_1676287_C_T_b38	SLC35E2	-3.648	0.000353	-0.077245	6	0.021175	yes	LIVER
chr1_1630798_C_T_b38	SLC35E2	3.634	0.000371	0.071013	17	0.019541	yes	LIVER
chr1_1220751_T_C_b38	SLC35E2	-3.624	0.000385	-0.080277	10	0.022152	yes	LIVER
chr1_1627057_C_G_b38	SLC35E2	-3.564	0.000476	-0.067907	20	0.019051	yes	LIVER
chr1_1607931_G_A_b38	SLC35E2	3.528	0.000541	0.063459	19	0.017986	yes	LIVER
chr1_1653319_A_G_b38	SLC35E2	3.484	0.00063	0.0625	20	0.017937	yes	LIVER
chr1_1609058_G_A_b38	SLC35E2	3.448	0.000714	0.061464	20	0.017824	yes	LIVER
chr1_1654662_CT_C_b38	SLC35E2	3.365	0.000949	0.070137	28	0.020842	yes	LIVER
chr1_1606384_A_G_b38	SLC35E2	3.359	0.000971	0.059928	20	0.017844	yes	LIVER
chr1_1589495_CTTT_C_b38	SLC35E2	3.294	0.00121	0.06361	17	0.019311	yes	LIVER
chr1_1739131_T_C_b38	SLC35E2	3.267	0.00132	0.058177	37	0.017808	yes	LIVER
chr1_1596162_GAGC_G_b38	SLC35E2	-3.246	0.00141	-0.068694	7	0.021162	yes	LIVER
chr1_2216191_C_A_b38	SLC35E2	-3.241	0.00144	-0.075598	4	0.023322	yes	LIVER
chr1_1590785_G_A_b38	SLC35E2	-3.228	0.0015	-0.082333	4	0.025506	yes	LIVER
chr1_1590792_C_T_b38	SLC35E2	-3.228	0.0015	-0.082333	4	0.025506	yes	LIVER
chr1_1596173_G_A_b38	SLC35E2	-3.223	0.00153	-0.069301	6	0.021504	yes	LIVER
chr1_1585717_C_A_b38	SLC35E2	-3.211	0.00159	-0.079963	5	0.024903	yes	LIVER
chr1_1586215_A_G_b38	SLC35E2	-3.211	0.00159	-0.079963	5	0.024903	yes	LIVER
chr1_1595028_C_CAG_b38	SLC35E2	3.202	0.00164	0.061566	15	0.019229	yes	LIVER
chr1_1671724_C_T_b38	SLC35E2	-3.193	0.00168	-0.057774	20	0.018093	yes	LIVER
chr1_1611248_ATC_A_b38	SLC35E2	-3.193	0.00168	-0.063069	11	0.019752	yes	LIVER
chr1_2215527_T_C_b38	SLC35E2	-3.185	0.00173	-0.072046	5	0.022619	yes	LIVER
chr1_2221645_G_A_b38	SLC35E2	-3.185	0.00173	-0.072046	5	0.022619	yes	LIVER
chr1_1606559_C_CGGCTGGTCAGGCGTGGGGCG_b38	SLC35E2	-3.164	0.00185	-0.06151	14	0.019441	yes	LIVER
chr1_1650664_CT_C_b38	SLC35E2	3.163	0.00185	0.070779	13	0.022374	yes	LIVER
chr1_1585173_C_T_b38	SLC35E2	-3.126	0.00209	-0.07715	5	0.024684	yes	LIVER
chr1_1599234_T_C_b38	SLC35E2	-3.123	0.00211	-0.061625	12	0.019734	yes	LIVER
chr1_1602057_C_T_b38	SLC35E2	-3.123	0.00211	-0.061625	12	0.019734	yes	LIVER
chr1_924305_G_A_b38	SLC35E2	3.121	0.00212	0.071387	8	0.022874	yes	LIVER
chr1_1585372_T_A_b38	SLC35E2	-3.106	0.00223	-0.076931	5	0.024769	yes	LIVER
chr1_2226499_CG_C_b38	SLC35E2	-3.103	0.00225	-0.070665	5	0.022777	yes	LIVER
chr1_1595366_G_C_b38	SLC35E2	-3.059	0.00258	-0.066973	5	0.021891	yes	LIVER
chr1_975093_G_A_b38	SLC35E2	3.002	0.00309	0.076419	4	0.025454	yes	LIVER
chr1_1594817_A_C_b38	SLC35E2	-2.983	0.00328	-0.059673	11	0.020006	yes	LIVER
chr1_1594820_C_T_b38	SLC35E2	-2.983	0.00328	-0.059673	11	0.020006	yes	LIVER
chr1_1596449_G_A_b38	SLC35E2	-2.983	0.00328	-0.059673	11	0.020006	yes	LIVER
chr1_2230051_C_T_b38	SLC35E2	-2.963	0.00349	-0.067463	5	0.022768	yes	LIVER
chr1_2288174_A_T_b38	SLC35E2	-2.961	0.00351	-0.066884	7	0.022588	yes	LIVER
chr1_2222256_T_C_b38	SLC35E2	-2.934	0.00382	-0.067498	5	0.023007	yes	LIVER
chr1_2222257_G_C_b38	SLC35E2	-2.934	0.00382	-0.067498	5	0.023007	yes	LIVER
chr1_2222258_T_C_b38	SLC35E2	-2.934	0.00382	-0.067498	5	0.023007	yes	LIVER
chr1_1793064_C_CA_b38	SLC35E2	-2.881	0.00449	-0.059943	11	0.020807	yes	LIVER
chr1_1659940_A_C_b38	SLC35E2	-2.876	0.00456	-0.070305	6	0.024448	yes	LIVER
chr1_1669576_G_A_b38	SLC35E2	-2.868	0.00466	-0.059846	11	0.020866	yes	LIVER
chr1_2041023_T_C_b38	SLC35E2	2.863	0.00474	0.081199	4	0.028362	yes	LIVER
chr1_2675723_C_A_b38	SLC35E2	2.846	0.00498	0.096997	3	0.034082	yes	LIVER
chr1_1668721_C_T_b38	SLC35E2	-2.834	0.00516	-0.055608	15	0.019621	yes	LIVER
chr1_816108_G_GA_b38	SLC35E2	-2.834	0.00517	-0.088414	3	0.031201	yes	LIVER
chr1_1496953_T_C_b38	SLC35E2	-2.83	0.00522	-0.076621	10	0.027072	yes	LIVER
chr1_2213842_A_G_b38	SLC35E2	-2.828	0.00527	-0.058333	9	0.02063	yes	LIVER
chr1_1723766_C_T_b38	SLC35E2	-2.825	0.00531	-0.06465	10	0.022887	yes	LIVER
chr1_1668717_C_G_b38	SLC35E2	-2.819	0.0054	-0.058726	11	0.020834	yes	LIVER
chr1_1669613_G_A_b38	SLC35E2	-2.819	0.0054	-0.058726	11	0.020834	yes	LIVER
chr1_1667948_A_G_b38	SLC35E2	-2.814	0.00549	-0.059684	10	0.021213	yes	LIVER
chr1_1178191_A_G_b38	SLC35E2	-2.78	0.00606	-0.070984	4	0.025534	yes	LIVER
chr1_2220140_C_A_b38	SLC35E2	-2.78	0.00606	-0.051599	19	0.018562	yes	LIVER
chr1_1668542_C_T_b38	SLC35E2	-2.76	0.00643	-0.058388	10	0.021155	yes	LIVER
chr1_1282558_C_CCA_b38	SLC35E2	-2.724	0.00713	-0.072613	11	0.026656	yes	LIVER
chr1_1591703_T_C_b38	SLC35E2	2.719	0.00725	0.046915	38	0.017258	yes	LIVER
chr1_1459662_C_T_b38	SLC35E2	-2.706	0.00753	-0.088817	7	0.032828	yes	LIVER
chr1_2283772_T_C_b38	SLC35E2	-2.702	0.0076	-0.044142	42	0.016334	yes	LIVER
chr1_2340764_G_T_b38	SLC35E2	2.701	0.00763	0.058082	8	0.021506	yes	LIVER
chr1_1595007_A_G_b38	SLC35E2	-2.683	0.00803	-0.054013	12	0.02013	yes	LIVER
chr1_1593620_G_C_b38	SLC35E2	-2.682	0.00806	-0.053132	12	0.019813	yes	LIVER
chr1_1594077_T_C_b38	SLC35E2	-2.682	0.00806	-0.053132	12	0.019813	yes	LIVER
chr1_1596529_A_G_b38	SLC35E2	-2.682	0.00806	-0.053132	12	0.019813	yes	LIVER
chr1_911848_C_T_b38	SLC35E2	2.68	0.00811	0.05538	10	0.020668	yes	LIVER
chr1_1679100_A_G_b38	SLC35E2	-2.679	0.00813	-0.045194	34	0.016872	yes	LIVER
chr1_1671148_C_T_b38	SLC35E2	2.672	0.00829	0.048777	20	0.018255	yes	LIVER
chr1_1606099_G_GGTCAGGCGAGGGGTC_b38	SLC35E2	2.657	0.00866	0.050581	19	0.01904	yes	LIVER
chr1_1658830_C_G_b38	SLC35E2	-2.656	0.00866	-0.054002	11	0.020329	yes	LIVER
chr1_2215723_T_C_b38	SLC35E2	-2.645	0.00896	-0.049502	20	0.018718	yes	LIVER
chr1_910698_C_T_b38	SLC35E2	2.63	0.00934	0.057945	7	0.022033	yes	LIVER
chr1_1665061_C_T_b38	SLC35E2	-2.628	0.00938	-0.053917	11	0.020514	yes	LIVER
chr1_1481959_C_T_b38	SLC35E2	-2.627	0.00941	-0.075402	7	0.028701	yes	LIVER
chr1_1533883_G_T_b38	SLC35E2	-2.624	0.00949	-0.08693	3	0.033128	yes	LIVER
chr1_1470034_T_C_b38	SLC35E2	-2.617	0.00968	-0.084256	9	0.032195	yes	LIVER
chr1_1471144_G_C_b38	SLC35E2	-2.617	0.00968	-0.084256	9	0.032195	yes	LIVER
chr1_1459632_T_C_b38	SLC35E2	-2.615	0.00973	-0.082528	7	0.031557	yes	LIVER
chr1_2217699_C_G_b38	SLC35E2	-2.606	0.01	-0.048674	20	0.01868	yes	LIVER
chr1_2219851_AAAAAC_A_b38	SLC35E2	-2.606	0.01	-0.048674	20	0.01868	yes	LIVER
chr1_1619986_T_C_b38	SLC35E2	4.313	2.75e-05	0.078463	21	0.018193	no	LIVER
chr1_1616547_T_C_b38	SLC35E2	4.308	2.8e-05	0.075956	24	0.017631	no	LIVER
chr1_1617375_T_C_b38	SLC35E2	4.287	3.05e-05	0.076103	24	0.017751	no	LIVER
chr1_1618213_C_G_b38	SLC35E2	4.287	3.05e-05	0.076103	24	0.017751	no	LIVER
chr1_1618290_G_C_b38	SLC35E2	4.287	3.05e-05	0.076103	24	0.017751	no	LIVER
chr1_1604202_G_A_b38	SLC35E2	4.067	7.34e-05	0.07455	25	0.018332	no	LIVER
chr1_1594570_A_G_b38	SLC35E2	4.013	9.03e-05	0.072212	24	0.017994	no	LIVER
chr1_1601796_A_C_b38	SLC35E2	3.983	0.000101	0.072842	26	0.018288	no	LIVER
chr1_1646352_A_C_b38	SLC35E2	3.862	0.00016	0.094006	4	0.02434	no	LIVER
chr1_1594618_C_G_b38	SLC35E2	3.799	0.000203	0.070088	19	0.01845	no	LIVER
chr1_1613974_G_A_b38	SLC35E2	3.795	0.000206	0.070005	19	0.018448	no	LIVER
chr1_1618982_G_A_b38	SLC35E2	3.795	0.000206	0.070005	19	0.018448	no	LIVER
chr1_1603989_T_C_b38	SLC35E2	3.662	0.000335	0.068406	19	0.018678	no	LIVER
chr1_1609909_G_T_b38	SLC35E2	3.662	0.000335	0.068406	19	0.018678	no	LIVER
chr1_1624723_C_T_b38	SLC35E2	-3.543	0.000513	-0.074969	9	0.021158	no	LIVER
chr1_1606507_GTGGGC_G_b38	SLC35E2	3.527	0.000542	0.057492	55	0.0163	no	LIVER
chr1_1591419_A_G_b38	SLC35E2	3.489	0.000619	0.075673	8	0.021687	no	LIVER
chr1_818464_CCT_C_b38	SLC35E2	3.397	0.000851	0.072072	13	0.021215	no	LIVER
chr1_1050080_T_C_b38	SLC35E2	-3.386	0.000883	-0.104364	9	0.030818	no	LIVER
chr1_1584321_T_C_b38	SLC35E2	-3.337	0.00104	-0.059995	33	0.01798	no	LIVER
chr1_1280044_T_C_b38	SLC35E2	-3.277	0.00128	-0.070249	26	0.021437	no	LIVER
chr1_818469_G_T_b38	SLC35E2	3.27	0.00131	0.070868	12	0.021675	no	LIVER
chr1_1596899_A_C_b38	SLC35E2	3.234	0.00147	0.064443	11	0.019929	no	LIVER
chr1_1608244_T_C_b38	SLC35E2	3.142	0.00199	0.059401	17	0.018908	no	LIVER
chr1_1596590_GAC_G_b38	SLC35E2	-3.141	0.00199	-0.063496	10	0.020213	no	LIVER
chr1_1460021_C_CTG_b38	SLC35E2	-3.085	0.00239	-0.099883	5	0.03238	no	LIVER
chr1_1460022_CAG_C_b38	SLC35E2	-3.085	0.00239	-0.099883	5	0.03238	no	LIVER
chr1_1594131_T_C_b38	SLC35E2	-3.065	0.00254	-0.057201	17	0.018665	no	LIVER
chr1_1609890_C_T_b38	SLC35E2	-2.994	0.00318	-0.070318	8	0.023489	no	LIVER
chr1_2341692_GA_G_b38	SLC35E2	2.924	0.00393	0.054477	21	0.01863	no	LIVER
chr1_1627156_G_A_b38	SLC35E2	-2.891	0.00435	-0.069269	7	0.023959	no	LIVER
chr1_2340807_G_A_b38	SLC35E2	2.793	0.00583	0.060157	8	0.021536	no	LIVER
chr1_2341451_G_A_b38	SLC35E2	2.793	0.00583	0.060157	8	0.021536	no	LIVER
chr1_1459004_T_C_b38	SLC35E2	-2.781	0.00604	-0.098877	6	0.035553	no	LIVER
chr1_1258206_AT_A_b38	SLC35E2	-2.756	0.0065	-0.06377	20	0.023139	no	LIVER
chr1_1259424_T_C_b38	SLC35E2	-2.717	0.00729	-0.06405	23	0.023575	no	LIVER
chr1_1459658_G_A_b38	SLC35E2	-2.704	0.00756	-0.086763	10	0.032088	no	LIVER
chr1_2337239_T_C_b38	SLC35E2	2.682	0.00804	0.051734	18	0.019287	no	LIVER
chr1_1277830_C_CA_b38	SLC35E2	-2.674	0.00825	-0.084183	4	0.031486	no	LIVER
chr1_2283682_C_T_b38	SLC35E2	-2.653	0.00874	-0.057912	7	0.021828	no	LIVER
chr1_1182832_T_C_b38	SLC35E2	-2.643	0.009	-0.051558	25	0.019507	no	LIVER
chr1_2340625_G_A_b38	SLC35E2	2.623	0.00953	0.055737	9	0.02125	no	LIVER
chr1_2344256_A_T_b38	SLC35E2	2.621	0.00958	0.057597	6	0.021977	no	LIVER
chr1_1677720_T_G_b38	SLC35E2	8.598	1.4e-16	0.107039	118	0.012449	yes	LUNG
chr1_1677726_A_T_b38	SLC35E2	8.544	2.1e-16	0.106421	118	0.012456	yes	LUNG
chr1_1674720_TGC_T_b38	SLC35E2	8.369	7.61e-16	0.105531	113	0.012609	yes	LUNG
chr1_1674868_G_A_b38	SLC35E2	8.346	9e-16	0.105062	114	0.012588	yes	LUNG
chr1_1676790_C_T_b38	SLC35E2	8.316	1.12e-15	0.102798	115	0.012361	yes	LUNG
chr1_1671995_G_T_b38	SLC35E2	8.263	1.66e-15	0.104163	112	0.012606	yes	LUNG
chr1_1673818_A_C_b38	SLC35E2	8.12	4.65e-15	0.102619	115	0.012638	yes	LUNG
chr1_1673060_G_A_b38	SLC35E2	8.053	7.5e-15	0.102773	114	0.012762	yes	LUNG
chr1_1671797_G_A_b38	SLC35E2	7.846	3.24e-14	0.101945	107	0.012994	yes	LUNG
chr1_1673968_GA_G_b38	SLC35E2	6.949	1.32e-11	0.109241	42	0.01572	yes	LUNG
chr1_1591703_T_C_b38	SLC35E2	6.111	2.16e-09	0.081109	95	0.013272	yes	LUNG
chr1_1586962_C_T_b38	SLC35E2	6.022	3.61e-09	0.085937	54	0.01427	yes	LUNG
chr1_1589495_CTTT_C_b38	SLC35E2	5.916	6.61e-09	0.08928	39	0.015092	yes	LUNG
chr1_1648736_G_A_b38	SLC35E2	5.907	6.95e-09	0.07895	97	0.013366	yes	LUNG
chr1_1649932_C_T_b38	SLC35E2	5.815	1.16e-08	0.076155	100	0.013096	yes	LUNG
chr1_1651653_C_T_b38	SLC35E2	5.688	2.33e-08	0.074605	112	0.013116	yes	LUNG
chr1_1613769_C_T_b38	SLC35E2	5.67	2.58e-08	0.082373	49	0.014528	yes	LUNG
chr1_1620609_G_A_b38	SLC35E2	5.666	2.64e-08	0.079081	56	0.013958	yes	LUNG
chr1_1621352_G_A_b38	SLC35E2	5.65	2.87e-08	0.078986	56	0.01398	yes	LUNG
chr1_1675091_A_G_b38	SLC35E2	-5.64	3.03e-08	-0.089661	27	0.015897	yes	LUNG
chr1_1612562_T_TC_b38	SLC35E2	5.623	3.32e-08	0.077815	57	0.013839	yes	LUNG
chr1_1739131_T_C_b38	SLC35E2	5.569	4.44e-08	0.074049	108	0.013297	yes	LUNG
chr1_1636278_G_T_b38	SLC35E2	5.51	6.09e-08	0.074556	89	0.013531	yes	LUNG
chr1_1661562_G_C_b38	SLC35E2	5.48	7.15e-08	0.066893	107	0.012208	yes	LUNG
chr1_1600379_C_T_b38	SLC35E2	5.467	7.64e-08	0.076454	54	0.013984	yes	LUNG
chr1_1600320_C_G_b38	SLC35E2	5.414	1.01e-07	0.075962	52	0.014031	yes	LUNG
chr1_1607931_G_A_b38	SLC35E2	5.402	1.08e-07	0.075635	54	0.014001	yes	LUNG
chr1_1609058_G_A_b38	SLC35E2	5.394	1.12e-07	0.07504	55	0.013911	yes	LUNG
chr1_1667424_T_TAAAATA_b38	SLC35E2	5.389	1.15e-07	0.075975	63	0.014099	yes	LUNG
chr1_1622295_G_C_b38	SLC35E2	5.336	1.52e-07	0.074668	56	0.013994	yes	LUNG
chr1_1606384_A_G_b38	SLC35E2	5.289	1.93e-07	0.071879	61	0.01359	yes	LUNG
chr1_1629332_G_T_b38	SLC35E2	5.242	2.46e-07	0.076224	52	0.01454	yes	LUNG
chr1_1649976_G_A_b38	SLC35E2	5.229	2.62e-07	0.071163	81	0.013608	yes	LUNG
chr1_1671097_G_C_b38	SLC35E2	5.163	3.68e-07	0.073301	53	0.014198	yes	LUNG
chr1_1671148_C_T_b38	SLC35E2	5.16	3.73e-07	0.073466	51	0.014238	yes	LUNG
chr1_1744052_GAGA_G_b38	SLC35E2	-5.121	4.54e-07	-0.085267	30	0.016651	yes	LUNG
chr1_1595028_C_CAG_b38	SLC35E2	5.113	4.72e-07	0.078418	35	0.015337	yes	LUNG
chr1_1970506_T_A_b38	SLC35E2	-5.1	5.04e-07	-0.068552	87	0.013441	yes	LUNG
chr1_1670423_AT_A_b38	SLC35E2	5.041	6.76e-07	0.079591	56	0.015789	yes	LUNG
chr1_1658830_C_G_b38	SLC35E2	-5.029	7.18e-07	-0.077981	28	0.015508	yes	LUNG
chr1_1667948_A_G_b38	SLC35E2	-4.977	9.24e-07	-0.0797	27	0.016013	yes	LUNG
chr1_1630798_C_T_b38	SLC35E2	4.973	9.42e-07	0.07243	51	0.014563	yes	LUNG
chr1_1742587_G_C_b38	SLC35E2	4.962	9.97e-07	0.065792	122	0.01326	yes	LUNG
chr1_1664757_T_C_b38	SLC35E2	-4.936	1.13e-06	-0.069121	49	0.014005	yes	LUNG
chr1_1744028_A_AC_b38	SLC35E2	-4.933	1.15e-06	-0.086661	23	0.017568	yes	LUNG
chr1_1743840_T_C_b38	SLC35E2	-4.917	1.24e-06	-0.076762	42	0.015613	yes	LUNG
chr1_1668542_C_T_b38	SLC35E2	-4.866	1.59e-06	-0.079369	24	0.016312	yes	LUNG
chr1_1668717_C_G_b38	SLC35E2	-4.843	1.77e-06	-0.077663	27	0.016035	yes	LUNG
chr1_1669613_G_A_b38	SLC35E2	-4.799	2.18e-06	-0.076572	28	0.015954	yes	LUNG
chr1_1661177_A_G_b38	SLC35E2	-4.793	2.25e-06	-0.076111	27	0.01588	yes	LUNG
chr1_1743565_ATAT_A_b38	SLC35E2	-4.775	2.45e-06	-0.061307	83	0.01284	yes	LUNG
chr1_1668721_C_T_b38	SLC35E2	-4.769	2.52e-06	-0.071525	35	0.014999	yes	LUNG
chr1_1755504_T_C_b38	SLC35E2	4.762	2.59e-06	0.063515	113	0.013337	yes	LUNG
chr1_1668108_C_T_b38	SLC35E2	4.748	2.78e-06	0.068542	50	0.014436	yes	LUNG
chr1_1743851_C_T_b38	SLC35E2	-4.742	2.86e-06	-0.074315	42	0.015673	yes	LUNG
chr1_1665061_C_T_b38	SLC35E2	-4.741	2.87e-06	-0.075087	27	0.015838	yes	LUNG
chr1_1664865_A_G_b38	SLC35E2	-4.728	3.05e-06	-0.067246	49	0.014223	yes	LUNG
chr1_1744652_C_T_b38	SLC35E2	-4.727	3.07e-06	-0.063626	100	0.01346	yes	LUNG
chr1_1743886_C_T_b38	SLC35E2	-4.724	3.1e-06	-0.071798	51	0.015197	yes	LUNG
chr1_1692124_T_G_b38	SLC35E2	-4.71	3.32e-06	-0.071229	46	0.015124	yes	LUNG
chr1_1692151_T_C_b38	SLC35E2	-4.686	3.71e-06	-0.070672	47	0.015081	yes	LUNG
chr1_1660683_C_T_b38	SLC35E2	-4.683	3.76e-06	-0.071303	36	0.015224	yes	LUNG
chr1_1744499_C_T_b38	SLC35E2	-4.682	3.77e-06	-0.061584	99	0.013152	yes	LUNG
chr1_1669576_G_A_b38	SLC35E2	-4.666	4.08e-06	-0.074564	28	0.015981	yes	LUNG
chr1_1698048_T_C_b38	SLC35E2	-4.654	4.3e-06	-0.143841	7	0.030906	yes	LUNG
chr1_1665581_C_G_b38	SLC35E2	-4.649	4.41e-06	-0.072788	29	0.015657	yes	LUNG
chr1_1661420_C_A_b38	SLC35E2	-4.635	4.7e-06	-0.066126	51	0.014267	yes	LUNG
chr1_1659114_A_G_b38	SLC35E2	-4.612	5.23e-06	-0.065764	51	0.01426	yes	LUNG
chr1_1659220_A_G_b38	SLC35E2	-4.612	5.23e-06	-0.065764	51	0.01426	yes	LUNG
chr1_1986752_A_G_b38	SLC35E2	4.597	5.59e-06	0.063774	96	0.013872	yes	LUNG
chr1_1667424_T_TAAATA_b38	SLC35E2	-4.57	6.33e-06	-0.061639	81	0.013488	yes	LUNG
chr1_1658866_G_A_b38	SLC35E2	-4.565	6.48e-06	-0.06491	52	0.014219	yes	LUNG
chr1_1659940_A_C_b38	SLC35E2	-4.558	6.68e-06	-0.082798	9	0.018165	yes	LUNG
chr1_1743238_G_C_b38	SLC35E2	-4.546	7.07e-06	-0.062958	90	0.01385	yes	LUNG
chr1_1747695_A_G_b38	SLC35E2	-4.527	7.7e-06	-0.052569	111	0.011613	yes	LUNG
chr1_1744854_C_A_b38	SLC35E2	-4.47	9.96e-06	-0.055866	88	0.012499	yes	LUNG
chr1_1742672_C_T_b38	SLC35E2	-4.451	1.08e-05	-0.061487	91	0.013815	yes	LUNG
chr1_1639685_G_A_b38	SLC35E2	-4.437	1.15e-05	-0.068962	31	0.015543	yes	LUNG
chr1_1987049_A_G_b38	SLC35E2	4.436	1.16e-05	0.061084	97	0.01377	yes	LUNG
chr1_1751981_A_T_b38	SLC35E2	-4.429	1.19e-05	-0.069176	49	0.015618	yes	LUNG
chr1_1688328_C_T_b38	SLC35E2	-4.416	1.26e-05	-0.067154	34	0.015207	yes	LUNG
chr1_1606532_GTGGGCTGGGCTGGTCAGGCA_G_b38	SLC35E2	4.391	1.41e-05	0.061253	52	0.01395	yes	LUNG
chr1_1708474_C_A_b38	SLC35E2	-4.383	1.46e-05	-0.077798	19	0.017749	yes	LUNG
chr1_1639348_G_T_b38	SLC35E2	-4.38	1.48e-05	-0.060648	62	0.013845	yes	LUNG
chr1_1674633_C_CA_b38	SLC35E2	4.31	2.01e-05	0.062569	56	0.014516	yes	LUNG
chr1_1753033_C_T_b38	SLC35E2	-4.305	2.06e-05	-0.06124	114	0.014226	yes	LUNG
chr1_1650195_A_G_b38	SLC35E2	-4.26	2.49e-05	-0.062098	51	0.014576	yes	LUNG
chr1_1653863_C_A_b38	SLC35E2	-4.259	2.51e-05	-0.074959	14	0.0176	yes	LUNG
chr1_1708521_C_G_b38	SLC35E2	-4.257	2.53e-05	-0.067371	38	0.015827	yes	LUNG
chr1_1659060_G_A_b38	SLC35E2	-4.242	2.7e-05	-0.063292	37	0.014921	yes	LUNG
chr1_1730405_G_C_b38	SLC35E2	4.208	3.12e-05	0.063218	80	0.015025	yes	LUNG
chr1_1722626_AGCG_A_b38	SLC35E2	4.203	3.18e-05	0.071945	41	0.017116	yes	LUNG
chr1_1752461_G_A_b38	SLC35E2	-4.188	3.39e-05	-0.059972	105	0.014319	yes	LUNG
chr1_1752730_C_G_b38	SLC35E2	-4.181	3.49e-05	-0.060009	105	0.014352	yes	LUNG
chr1_1971864_C_T_b38	SLC35E2	4.167	3.7e-05	0.056004	91	0.013438	yes	LUNG
chr1_1722690_TA_T_b38	SLC35E2	-4.146	4.06e-05	-0.087112	4	0.021012	yes	LUNG
chr1_1752126_G_A_b38	SLC35E2	4.136	4.22e-05	0.061963	61	0.01498	yes	LUNG
chr1_1660408_T_C_b38	SLC35E2	-4.12	4.51e-05	-0.072553	9	0.017609	yes	LUNG
chr1_1976566_T_C_b38	SLC35E2	4.104	4.83e-05	0.054542	101	0.01329	yes	LUNG
chr1_1755523_C_T_b38	SLC35E2	4.103	4.84e-05	0.05514	122	0.013438	yes	LUNG
chr1_1651137_C_T_b38	SLC35E2	-4.094	5.03e-05	-0.059478	47	0.014527	yes	LUNG
chr1_1651267_T_C_b38	SLC35E2	-4.094	5.03e-05	-0.059478	47	0.014527	yes	LUNG
chr1_1651574_G_A_b38	SLC35E2	-4.094	5.03e-05	-0.059478	47	0.014527	yes	LUNG
chr1_1652135_C_G_b38	SLC35E2	-4.094	5.03e-05	-0.059478	47	0.014527	yes	LUNG
chr1_1652191_C_T_b38	SLC35E2	-4.094	5.03e-05	-0.059478	47	0.014527	yes	LUNG
chr1_1652592_A_G_b38	SLC35E2	-4.094	5.03e-05	-0.059478	47	0.014527	yes	LUNG
chr1_1652779_A_G_b38	SLC35E2	-4.094	5.03e-05	-0.059478	47	0.014527	yes	LUNG
chr1_1653147_A_C_b38	SLC35E2	-4.094	5.03e-05	-0.059478	47	0.014527	yes	LUNG
chr1_1653396_T_C_b38	SLC35E2	-4.094	5.03e-05	-0.059478	47	0.014527	yes	LUNG
chr1_1653472_T_C_b38	SLC35E2	-4.094	5.03e-05	-0.059478	47	0.014527	yes	LUNG
chr1_1653811_G_A_b38	SLC35E2	-4.094	5.03e-05	-0.059478	47	0.014527	yes	LUNG
chr1_1653893_C_T_b38	SLC35E2	-4.094	5.03e-05	-0.059478	47	0.014527	yes	LUNG
chr1_1653934_G_A_b38	SLC35E2	-4.094	5.03e-05	-0.059478	47	0.014527	yes	LUNG
chr1_1654143_G_A_b38	SLC35E2	-4.094	5.03e-05	-0.059478	47	0.014527	yes	LUNG
chr1_1652061_T_C_b38	SLC35E2	-4.093	5.06e-05	-0.059384	48	0.014508	yes	LUNG
chr1_1654188_T_G_b38	SLC35E2	-4.093	5.06e-05	-0.059384	48	0.014508	yes	LUNG
chr1_1756043_G_T_b38	SLC35E2	-4.089	5.15e-05	-0.059185	106	0.014475	yes	LUNG
chr1_1624323_AT_A_b38	SLC35E2	4.078	5.38e-05	0.056518	77	0.013859	yes	LUNG
chr1_1650777_G_A_b38	SLC35E2	-4.06	5.81e-05	-0.058872	47	0.014501	yes	LUNG
chr1_1753361_G_A_b38	SLC35E2	-4.049	6.07e-05	-0.058209	105	0.014376	yes	LUNG
chr1_1753319_G_A_b38	SLC35E2	-4.034	6.45e-05	-0.058045	105	0.014388	yes	LUNG
chr1_1676287_C_T_b38	SLC35E2	-4.008	7.17e-05	-0.067912	18	0.016943	yes	LUNG
chr1_1651421_GTAGCCCCTCTGAACGGTCTGTGACACACGCATGCTTTCAGCTAGAGTACTCTA_G_b38	SLC35E2	-3.991	7.7e-05	-0.05873	44	0.014716	yes	LUNG
chr1_1749637_G_T_b38	SLC35E2	3.988	7.78e-05	0.053808	92	0.013491	yes	LUNG
chr1_1651926_T_C_b38	SLC35E2	-3.974	8.26e-05	-0.057781	47	0.014541	yes	LUNG
chr1_1722619_C_T_b38	SLC35E2	3.947	9.21e-05	0.066827	44	0.016933	yes	LUNG
chr1_1592572_T_C_b38	SLC35E2	-3.943	9.35e-05	-0.058482	53	0.014832	yes	LUNG
chr1_1675228_C_CG_b38	SLC35E2	3.935	9.66e-05	0.056291	77	0.014306	yes	LUNG
chr1_1651785_C_A_b38	SLC35E2	-3.929	9.88e-05	-0.057063	47	0.014523	yes	LUNG
chr1_1722625_A_T_b38	SLC35E2	3.929	9.88e-05	0.067564	41	0.017196	yes	LUNG
chr1_1654662_CT_C_b38	SLC35E2	3.909	0.000107	0.058611	75	0.014993	yes	LUNG
chr1_1750280_A_G_b38	SLC35E2	-3.894	0.000114	-0.053417	114	0.013719	yes	LUNG
chr1_1650664_CT_C_b38	SLC35E2	3.872	0.000124	0.063711	39	0.016453	yes	LUNG
chr1_1743565_AT_A_b38	SLC35E2	3.858	0.000131	0.04718	128	0.012228	yes	LUNG
chr1_1754482_TCCCTGGGACCGAAGTCGCCCCA_T_b38	SLC35E2	-3.833	0.000145	-0.055578	104	0.014498	yes	LUNG
chr1_1757725_C_T_b38	SLC35E2	3.829	0.000147	0.054319	82	0.014185	yes	LUNG
chr1_1648826_A_G_b38	SLC35E2	-3.827	0.000148	-0.054773	57	0.014313	yes	LUNG
chr1_1692286_C_A_b38	SLC35E2	3.824	0.00015	0.078732	5	0.020587	yes	LUNG
chr1_1596144_GAGAC_G_b38	SLC35E2	-3.81	0.000159	-0.05596	54	0.014688	yes	LUNG
chr1_1743714_C_CA_b38	SLC35E2	3.801	0.000164	0.05713	68	0.015032	yes	LUNG
chr1_1749826_A_G_b38	SLC35E2	-3.791	0.00017	-0.050192	120	0.013238	yes	LUNG
chr1_1739519_C_G_b38	SLC35E2	3.78	0.000179	0.060546	41	0.016019	yes	LUNG
chr1_1648636_G_A_b38	SLC35E2	-3.779	0.000179	-0.054474	57	0.014416	yes	LUNG
chr1_1649993_A_G_b38	SLC35E2	-3.764	0.00019	-0.050753	121	0.013485	yes	LUNG
chr1_1748780_G_A_b38	SLC35E2	-3.756	0.000196	-0.051865	118	0.01381	yes	LUNG
chr1_1924231_CCCT_C_b38	SLC35E2	-3.75	2e-04	-0.178057	3	0.047486	yes	LUNG
chr1_1754601_G_T_b38	SLC35E2	3.715	0.000229	0.052704	82	0.014187	yes	LUNG
chr1_1757074_G_T_b38	SLC35E2	3.711	0.000233	0.052256	82	0.014081	yes	LUNG
chr1_1744096_C_T_b38	SLC35E2	-3.695	0.000248	-0.071083	57	0.01924	yes	LUNG
chr1_1589618_A_T_b38	SLC35E2	-3.691	0.000251	-0.055029	52	0.014909	yes	LUNG
chr1_1688619_AAAC_A_b38	SLC35E2	-3.689	0.000253	-0.060092	46	0.016289	yes	LUNG
chr1_1589151_C_T_b38	SLC35E2	-3.685	0.000257	-0.052933	61	0.014366	yes	LUNG
chr1_1594614_G_C_b38	SLC35E2	-3.679	0.000263	-0.054502	54	0.014816	yes	LUNG
chr1_1680672_C_T_b38	SLC35E2	-3.672	0.00027	-0.050647	98	0.013791	yes	LUNG
chr1_1866635_T_TA_b38	SLC35E2	3.664	0.000278	0.056647	59	0.015461	yes	LUNG
chr1_1743544_CA_C_b38	SLC35E2	3.663	0.000279	0.047512	113	0.01297	yes	LUNG
chr1_1756186_T_C_b38	SLC35E2	3.652	0.000292	0.051417	83	0.01408	yes	LUNG
chr1_1638879_C_T_b38	SLC35E2	-3.652	0.000292	-0.055198	35	0.015116	yes	LUNG
chr1_1750226_C_T_b38	SLC35E2	3.641	0.000304	0.050364	89	0.013833	yes	LUNG
chr1_1590682_T_C_b38	SLC35E2	-3.636	0.00031	-0.051417	64	0.014142	yes	LUNG
chr1_1589057_T_C_b38	SLC35E2	-3.624	0.000323	-0.051973	61	0.01434	yes	LUNG
chr1_1641275_A_G_b38	SLC35E2	-3.624	0.000324	-0.051921	56	0.014328	yes	LUNG
chr1_1729859_A_G_b38	SLC35E2	3.621	0.000327	0.063875	19	0.017639	yes	LUNG
chr1_1688647_G_A_b38	SLC35E2	-3.614	0.000336	-0.058082	49	0.01607	yes	LUNG
chr1_1650000_G_A_b38	SLC35E2	3.614	0.000336	0.050303	70	0.013919	yes	LUNG
chr1_1746522_GT_G_b38	SLC35E2	-3.604	0.000349	-0.062051	22	0.017216	yes	LUNG
chr1_1969235_A_G_b38	SLC35E2	3.6	0.000354	0.058142	24	0.016151	yes	LUNG
chr1_1637577_T_C_b38	SLC35E2	-3.595	0.000361	-0.054832	32	0.015253	yes	LUNG
chr1_1938493_C_CAT_b38	SLC35E2	-3.583	0.000377	-0.06243	14	0.017424	yes	LUNG
chr1_1939978_T_C_b38	SLC35E2	-3.583	0.000377	-0.06243	14	0.017424	yes	LUNG
chr1_1945799_T_G_b38	SLC35E2	-3.579	0.000382	-0.064151	14	0.017923	yes	LUNG
chr1_1609070_G_A_b38	SLC35E2	-3.575	0.000389	-0.052061	58	0.014562	yes	LUNG
chr1_1608603_C_A_b38	SLC35E2	-3.566	0.000402	-0.052189	57	0.014636	yes	LUNG
chr1_1948594_G_GTTT_b38	SLC35E2	-3.565	0.000403	-0.113388	6	0.031803	yes	LUNG
chr1_1708855_TTCCTCCTCC_T_b38	SLC35E2	3.563	0.000406	0.049949	92	0.014017	yes	LUNG
chr1_1675132_A_G_b38	SLC35E2	3.563	0.000407	0.051698	68	0.014511	yes	LUNG
chr1_1938771_G_A_b38	SLC35E2	-3.561	0.000409	-0.061771	14	0.017346	yes	LUNG
chr1_1728671_C_A_b38	SLC35E2	3.554	0.00042	0.063688	23	0.01792	yes	LUNG
chr1_1969249_A_AGCCCT_b38	SLC35E2	3.553	0.000422	0.058019	23	0.016331	yes	LUNG
chr1_1943828_A_G_b38	SLC35E2	-3.549	0.000427	-0.061896	14	0.017439	yes	LUNG
chr1_1587352_A_G_b38	SLC35E2	-3.547	0.000431	-0.050561	79	0.014254	yes	LUNG
chr1_1752908_C_CCCT_b38	SLC35E2	-3.526	0.000466	-0.053505	81	0.015175	yes	LUNG
chr1_1943706_C_T_b38	SLC35E2	-3.523	0.00047	-0.061011	15	0.017316	yes	LUNG
chr1_1764023_C_A_b38	SLC35E2	3.511	0.000492	0.049609	83	0.014131	yes	LUNG
chr1_1605347_C_T_b38	SLC35E2	-3.495	0.000522	-0.05188	55	0.014846	yes	LUNG
chr1_1759611_C_T_b38	SLC35E2	-3.493	0.000525	-0.050854	108	0.014557	yes	LUNG
chr1_1750508_A_C_b38	SLC35E2	-3.475	0.000561	-0.042139	113	0.012127	yes	LUNG
chr1_1746440_A_G_b38	SLC35E2	-3.467	0.000577	-0.058235	25	0.016797	yes	LUNG
chr1_1759354_G_A_b38	SLC35E2	-3.466	0.000579	-0.05047	105	0.01456	yes	LUNG
chr1_1679993_A_G_b38	SLC35E2	-3.466	0.00058	-0.045667	123	0.013176	yes	LUNG
chr1_1969238_C_T_b38	SLC35E2	3.464	0.000584	0.055649	24	0.016066	yes	LUNG
chr1_1820337_A_G_b38	SLC35E2	3.461	0.00059	0.047924	99	0.013846	yes	LUNG
chr1_1625805_G_A_b38	SLC35E2	-3.454	0.000605	-0.050719	57	0.014684	yes	LUNG
chr1_1937273_T_C_b38	SLC35E2	-3.442	0.000632	-0.048132	102	0.013983	yes	LUNG
chr1_1610924_C_T_b38	SLC35E2	-3.441	0.000635	-0.050222	57	0.014596	yes	LUNG
chr1_1747472_A_T_b38	SLC35E2	-3.439	0.000638	-0.049515	107	0.014397	yes	LUNG
chr1_1940973_C_T_b38	SLC35E2	-3.439	0.00064	-0.047717	110	0.013877	yes	LUNG
chr1_1627515_C_T_b38	SLC35E2	3.432	0.000656	0.046353	96	0.013508	yes	LUNG
chr1_1721552_G_A_b38	SLC35E2	-3.431	0.000658	-0.141219	3	0.04116	yes	LUNG
chr1_1628409_C_A_b38	SLC35E2	-3.418	0.000689	-0.050188	57	0.014684	yes	LUNG
chr1_1697979_G_A_b38	SLC35E2	-3.409	0.000711	-0.070581	5	0.020704	yes	LUNG
chr1_1624086_G_A_b38	SLC35E2	-3.406	0.000719	-0.047659	77	0.013993	yes	LUNG
chr1_1688586_C_T_b38	SLC35E2	-3.405	0.000722	-0.057146	40	0.016784	yes	LUNG
chr1_1613090_A_G_b38	SLC35E2	-3.397	0.000743	-0.049926	56	0.014697	yes	LUNG
chr1_1926870_T_C_b38	SLC35E2	-3.396	0.000745	-0.047722	94	0.014052	yes	LUNG
chr1_1943142_A_G_b38	SLC35E2	-3.395	0.000747	-0.059133	14	0.017416	yes	LUNG
chr1_1760882_T_C_b38	SLC35E2	3.388	0.000766	0.046646	98	0.013767	yes	LUNG
chr1_1628814_C_T_b38	SLC35E2	-3.382	0.000783	-0.049681	57	0.014689	yes	LUNG
chr1_1625951_G_A_b38	SLC35E2	-3.376	0.000799	-0.04747	67	0.01406	yes	LUNG
chr1_1624720_G_A_b38	SLC35E2	-3.373	0.00081	-0.049608	57	0.014709	yes	LUNG
chr1_1029365_A_ATCTATGCAGGCAGGTGGGGGGATCAGTG_b38	SLC35E2	3.369	0.000819	0.050287	38	0.014925	yes	LUNG
chr1_1586987_G_A_b38	SLC35E2	-3.369	0.000822	-0.049138	63	0.014588	yes	LUNG
chr1_1629572_TG_T_b38	SLC35E2	-3.357	0.000854	-0.049082	59	0.014619	yes	LUNG
chr1_1748597_C_G_b38	SLC35E2	-3.354	0.000864	-0.048378	107	0.014422	yes	LUNG
chr1_1587547_C_T_b38	SLC35E2	-3.354	0.000865	-0.049529	67	0.014767	yes	LUNG
chr1_1936906_C_CA_b38	SLC35E2	-3.353	0.000867	-0.051283	58	0.015294	yes	LUNG
chr1_1585290_TTTTG_T_b38	SLC35E2	-3.342	0.000902	-0.048125	77	0.014399	yes	LUNG
chr1_1586956_T_C_b38	SLC35E2	-3.332	0.000936	-0.048521	64	0.014564	yes	LUNG
chr1_1684789_C_CAAAA_b38	SLC35E2	3.328	0.000948	0.100061	10	0.030068	yes	LUNG
chr1_1934821_C_CGTTGTAGGTACGTGTGTACGTGGGTGTTAGGTTGTAGGTACACACGTGTATATGTGGGTGTTAG_b38	SLC35E2	-3.311	0.00101	-0.045242	58	0.013665	yes	LUNG
chr1_1942014_G_A_b38	SLC35E2	-3.31	0.00101	-0.046119	107	0.013933	yes	LUNG
chr1_1942075_A_G_b38	SLC35E2	-3.31	0.00101	-0.046119	107	0.013933	yes	LUNG
chr1_1942086_T_C_b38	SLC35E2	-3.31	0.00101	-0.046119	107	0.013933	yes	LUNG
chr1_1698022_G_A_b38	SLC35E2	-3.301	0.00104	-0.121008	16	0.036658	yes	LUNG
chr1_1951920_A_G_b38	SLC35E2	-3.295	0.00106	-0.063252	8	0.019196	yes	LUNG
chr1_1589491_A_G_b38	SLC35E2	-3.279	0.00112	-0.046365	64	0.014138	yes	LUNG
chr1_1956930_A_G_b38	SLC35E2	-3.251	0.00124	-0.062257	8	0.019152	yes	LUNG
chr1_1622510_C_T_b38	SLC35E2	-3.239	0.00129	-0.047643	55	0.01471	yes	LUNG
chr1_1672155_G_A_b38	SLC35E2	-3.22	0.00137	-0.047806	45	0.014845	yes	LUNG
chr1_1865278_A_C_b38	SLC35E2	3.213	0.00141	0.045345	86	0.014113	yes	LUNG
chr1_1942258_G_A_b38	SLC35E2	-3.211	0.00142	-0.044831	107	0.013962	yes	LUNG
chr1_1688786_G_A_b38	SLC35E2	-3.208	0.00143	-0.057647	26	0.017969	yes	LUNG
chr1_1969229_T_A_b38	SLC35E2	3.189	0.00153	0.051572	24	0.01617	yes	LUNG
chr1_1877314_A_AT_b38	SLC35E2	3.18	0.00157	0.085627	4	0.026925	yes	LUNG
chr1_1955580_A_G_b38	SLC35E2	-3.162	0.00167	-0.057078	10	0.018049	yes	LUNG
chr1_1951510_A_G_b38	SLC35E2	-3.158	0.0017	-0.057933	8	0.018347	yes	LUNG
chr1_1051063_C_T_b38	SLC35E2	3.156	0.00171	0.062858	25	0.019919	yes	LUNG
chr1_1585345_C_T_b38	SLC35E2	-3.143	0.00178	-0.046257	66	0.014718	yes	LUNG
chr1_1725582_T_C_b38	SLC35E2	3.139	0.00181	0.039448	119	0.012568	yes	LUNG
chr1_1723766_C_T_b38	SLC35E2	-3.134	0.00184	-0.056782	25	0.018116	yes	LUNG
chr1_1969479_G_A_b38	SLC35E2	3.131	0.00186	0.051037	25	0.016301	yes	LUNG
chr1_1658422_T_C_b38	SLC35E2	3.095	0.0021	0.050492	27	0.016316	yes	LUNG
chr1_1618118_G_A_b38	SLC35E2	-3.091	0.00212	-0.045245	56	0.014638	yes	LUNG
chr1_1922882_A_G_b38	SLC35E2	-3.077	0.00222	-0.055448	11	0.018018	yes	LUNG
chr1_1844830_C_A_b38	SLC35E2	3.062	0.00233	0.043208	93	0.014109	yes	LUNG
chr1_1916417_G_T_b38	SLC35E2	-3.059	0.00236	-0.043296	105	0.014154	yes	LUNG
chr1_1026830_A_G_b38	SLC35E2	3.05	0.00242	0.042722	64	0.014007	yes	LUNG
chr1_1915143_A_G_b38	SLC35E2	-3.049	0.00243	-0.055856	10	0.018318	yes	LUNG
chr1_1881428_C_CT_b38	SLC35E2	-3.045	0.00247	-0.045227	102	0.014855	yes	LUNG
chr1_988598_A_AG_b38	SLC35E2	3.043	0.00248	0.055664	15	0.018293	yes	LUNG
chr1_1688442_T_C_b38	SLC35E2	-3.042	0.00249	-0.04798	48	0.015772	yes	LUNG
chr1_1991213_T_C_b38	SLC35E2	3.039	0.00252	0.041952	89	0.013807	yes	LUNG
chr1_1949564_T_TG_b38	SLC35E2	-3.031	0.00258	-0.055854	8	0.018426	yes	LUNG
chr1_1950848_A_G_b38	SLC35E2	-3.028	0.00261	-0.055568	8	0.018354	yes	LUNG
chr1_1951521_C_A_b38	SLC35E2	-3.028	0.00261	-0.055568	8	0.018354	yes	LUNG
chr1_1957586_A_G_b38	SLC35E2	-3.005	0.0028	-0.054315	10	0.018073	yes	LUNG
chr1_1904424_A_AAAATAAATAAAT_b38	SLC35E2	2.996	0.00289	0.038815	85	0.012954	yes	LUNG
chr1_1877330_T_C_b38	SLC35E2	-2.978	0.00306	-0.042681	93	0.014333	yes	LUNG
chr1_1954783_T_G_b38	SLC35E2	-2.974	0.00309	-0.054554	8	0.018341	yes	LUNG
chr1_1954946_T_C_b38	SLC35E2	-2.974	0.00309	-0.054554	8	0.018341	yes	LUNG
chr1_1958353_A_T_b38	SLC35E2	-2.974	0.00309	-0.054554	8	0.018341	yes	LUNG
chr1_1991761_T_C_b38	SLC35E2	2.973	0.00311	0.041327	84	0.013899	yes	LUNG
chr1_1688102_G_A_b38	SLC35E2	-2.968	0.00316	-0.046696	38	0.015733	yes	LUNG
chr1_1657081_C_T_b38	SLC35E2	-2.943	0.00342	-0.047588	32	0.016169	yes	LUNG
chr1_1931519_A_G_b38	SLC35E2	-2.941	0.00344	-0.052208	13	0.017753	yes	LUNG
chr1_1375678_TAA_T_b38	SLC35E2	-2.933	0.00353	-0.051336	23	0.017505	yes	LUNG
chr1_1051820_C_T_b38	SLC35E2	2.928	0.00359	0.057839	25	0.019756	yes	LUNG
chr1_1914634_G_T_b38	SLC35E2	-2.925	0.00362	-0.040962	105	0.014005	yes	LUNG
chr1_1916670_G_C_b38	SLC35E2	-2.925	0.00362	-0.040962	105	0.014005	yes	LUNG
chr1_1688457_G_A_b38	SLC35E2	-2.917	0.00372	-0.046918	49	0.016087	yes	LUNG
chr1_1922670_A_G_b38	SLC35E2	-2.916	0.00373	-0.041728	100	0.014312	yes	LUNG
chr1_1928648_C_T_b38	SLC35E2	-2.916	0.00373	-0.041728	100	0.014312	yes	LUNG
chr1_1918989_A_G_b38	SLC35E2	-2.915	0.00374	-0.040067	104	0.013746	yes	LUNG
chr1_1053123_A_T_b38	SLC35E2	2.913	0.00376	0.057848	25	0.019861	yes	LUNG
chr1_1968900_A_G_b38	SLC35E2	2.909	0.00381	0.044743	32	0.015382	yes	LUNG
chr1_1025970_C_T_b38	SLC35E2	2.899	0.00392	0.041239	54	0.014223	yes	LUNG
chr1_1301426_A_AT_b38	SLC35E2	-2.894	0.00399	-0.05727	19	0.01979	yes	LUNG
chr1_1034279_G_A_b38	SLC35E2	2.891	0.00403	0.042715	43	0.014776	yes	LUNG
chr1_1968924_GCCCTCCTGGGGGCTCCGGTCCTGCCCAGCAGCCCCAGGTGAGACAGCGCCTGGCGGCCCCTCCCTAGCT_G_b38	SLC35E2	2.883	0.00413	0.044267	32	0.015354	yes	LUNG
chr1_1018652_C_G_b38	SLC35E2	2.872	0.00427	0.040063	55	0.013948	yes	LUNG
chr1_1969006_C_T_b38	SLC35E2	2.87	0.00431	0.043988	32	0.015329	yes	LUNG
chr1_1984300_CT_C_b38	SLC35E2	2.868	0.00432	0.056105	5	0.019561	yes	LUNG
chr1_1920497_C_A_b38	SLC35E2	-2.857	0.00448	-0.050422	14	0.01765	yes	LUNG
chr1_1021740_G_C_b38	SLC35E2	2.856	0.00449	0.039917	54	0.013977	yes	LUNG
chr1_1925261_C_T_b38	SLC35E2	-2.84	0.00472	-0.051059	11	0.01798	yes	LUNG
chr1_1991778_A_G_b38	SLC35E2	-2.84	0.00472	-0.042375	37	0.014923	yes	LUNG
chr1_1703583_A_G_b38	SLC35E2	-2.835	0.00479	-0.070481	37	0.024859	yes	LUNG
chr1_2699998_G_C_b38	SLC35E2	-2.823	0.00497	-0.08658	7	0.030668	yes	LUNG
chr1_1993887_C_A_b38	SLC35E2	-2.817	0.00507	-0.078894	5	0.028009	yes	LUNG
chr1_1020217_G_T_b38	SLC35E2	2.81	0.00517	0.039136	56	0.013928	yes	LUNG
chr1_1702383_T_C_b38	SLC35E2	-2.807	0.00521	-0.046438	25	0.016541	yes	LUNG
chr1_1688531_T_C_b38	SLC35E2	-2.798	0.00536	-0.047956	35	0.017138	yes	LUNG
chr1_1026084_G_T_b38	SLC35E2	2.791	0.00548	0.040184	52	0.014396	yes	LUNG
chr1_1724543_G_C_b38	SLC35E2	-2.773	0.00578	-0.101135	9	0.036468	yes	LUNG
chr1_2656416_C_A_b38	SLC35E2	-2.767	0.00589	-0.134997	3	0.04878	yes	LUNG
chr1_1018754_G_A_b38	SLC35E2	2.764	0.00594	0.038733	54	0.014011	yes	LUNG
chr1_1953296_CTT_C_b38	SLC35E2	-2.754	0.00613	-0.069736	5	0.025322	yes	LUNG
chr1_2369355_G_GA_b38	SLC35E2	2.744	0.00632	0.041545	48	0.015143	yes	LUNG
chr1_1657085_C_CTAA_b38	SLC35E2	-2.725	0.00668	-0.04492	32	0.016482	yes	LUNG
chr1_1968103_A_ATGAG_b38	SLC35E2	2.712	0.00695	0.042175	29	0.015551	yes	LUNG
chr1_1032846_C_A_b38	SLC35E2	2.709	0.007	0.039233	51	0.01448	yes	LUNG
chr1_1022868_A_G_b38	SLC35E2	2.705	0.00709	0.037188	68	0.013747	yes	LUNG
chr1_1924011_A_G_b38	SLC35E2	-2.703	0.00714	-0.051354	10	0.019002	yes	LUNG
chr1_1722599_G_A_b38	SLC35E2	2.701	0.00717	0.043168	64	0.01598	yes	LUNG
chr1_1714674_G_C_b38	SLC35E2	2.689	0.00743	0.05579	37	0.020744	yes	LUNG
chr1_2579270_A_AT_b38	SLC35E2	-2.683	0.00757	-0.054424	12	0.020284	yes	LUNG
chr1_1882449_A_AAG_b38	SLC35E2	2.677	0.0077	0.060918	6	0.022756	yes	LUNG
chr1_1047064_A_G_b38	SLC35E2	2.673	0.00779	0.053594	20	0.020049	yes	LUNG
chr1_2598113_G_A_b38	SLC35E2	-2.671	0.00783	-0.08622	3	0.032274	yes	LUNG
chr1_1691417_T_C_b38	SLC35E2	2.645	0.00846	0.036648	107	0.013855	yes	LUNG
chr1_1025561_G_C_b38	SLC35E2	2.643	0.00851	0.037886	52	0.014334	yes	LUNG
chr1_1968893_A_G_b38	SLC35E2	2.639	0.0086	0.041448	28	0.015705	yes	LUNG
chr1_1991835_C_T_b38	SLC35E2	2.636	0.00867	0.037193	77	0.014108	yes	LUNG
chr1_1913643_T_C_b38	SLC35E2	-2.624	0.00899	-0.03985	96	0.015187	yes	LUNG
chr1_1703968_A_G_b38	SLC35E2	-2.609	0.00939	-0.094874	9	0.036364	yes	LUNG
chr1_1746439_GA_G_b38	SLC35E2	2.599	0.00966	0.038245	91	0.014716	yes	LUNG
chr1_1967961_G_GTGAA_b38	SLC35E2	-2.597	0.00972	-0.041854	22	0.016116	yes	LUNG
chr1_1635226_T_C_b38	SLC35E2	-2.595	0.00977	-0.049649	9	0.019131	yes	LUNG
chr1_924305_G_A_b38	SLC35E2	2.591	0.00989	0.040934	32	0.015799	yes	LUNG
chr1_1965250_G_GA_b38	SLC35E2	2.588	0.00998	0.039748	31	0.01536	yes	LUNG
chr1_1595306_CAG_C_b38	SLC35E2	-5.017	7.6e-07	-0.071985	113	0.014348	no	LUNG
chr1_1584321_T_C_b38	SLC35E2	-4.682	3.79e-06	-0.065544	68	0.014	no	LUNG
chr1_1969015_A_G_b38	SLC35E2	4.468	1e-05	0.062644	117	0.014021	no	LUNG
chr1_1743586_T_TAC_b38	SLC35E2	-4.29	2.2e-05	-0.060413	71	0.014084	no	LUNG
chr1_1987547_C_CT_b38	SLC35E2	4.267	2.42e-05	0.061446	99	0.0144	no	LUNG
chr1_1594890_G_GAC_b38	SLC35E2	-4.233	2.8e-05	-0.055687	101	0.013154	no	LUNG
chr1_1750428_G_C_b38	SLC35E2	-4.228	2.86e-05	-0.062676	79	0.014823	no	LUNG
chr1_1967499_G_A_b38	SLC35E2	4.213	3.05e-05	0.057517	91	0.013651	no	LUNG
chr1_1646352_A_C_b38	SLC35E2	4.213	3.05e-05	0.079191	10	0.018796	no	LUNG
chr1_1606099_G_GGTCAGGCGAGGGGTC_b38	SLC35E2	4.205	3.16e-05	0.065273	43	0.015523	no	LUNG
chr1_1597128_C_CCCTCAGCTGGACT_b38	SLC35E2	-4.2	3.23e-05	-0.055032	85	0.013103	no	LUNG
chr1_1963533_C_CA_b38	SLC35E2	4.182	3.49e-05	0.056528	96	0.013519	no	LUNG
chr1_1750440_G_A_b38	SLC35E2	-4.141	4.14e-05	-0.061476	77	0.014846	no	LUNG
chr1_1968793_T_C_b38	SLC35E2	4.127	4.4e-05	0.055814	94	0.013525	no	LUNG
chr1_1963538_T_C_b38	SLC35E2	4.103	4.86e-05	0.055848	91	0.013613	no	LUNG
chr1_1606094_G_GAGGGGTC_b38	SLC35E2	4.025	6.69e-05	0.066081	35	0.016416	no	LUNG
chr1_1845824_TACACAC_T_b38	SLC35E2	4.016	6.95e-05	0.069568	18	0.017322	no	LUNG
chr1_1881065_G_A_b38	SLC35E2	3.977	8.14e-05	0.074236	11	0.018666	no	LUNG
chr1_1881798_C_T_b38	SLC35E2	3.977	8.14e-05	0.074236	11	0.018666	no	LUNG
chr1_1960609_G_C_b38	SLC35E2	-3.961	8.69e-05	-0.052076	94	0.013147	no	LUNG
chr1_1593732_G_C_b38	SLC35E2	-3.918	0.000103	-0.051554	103	0.013159	no	LUNG
chr1_1945913_T_C_b38	SLC35E2	-3.915	0.000105	-0.066328	15	0.016943	no	LUNG
chr1_1886690_A_C_b38	SLC35E2	3.852	0.000134	0.071975	11	0.018684	no	LUNG
chr1_1587397_A_AT_b38	SLC35E2	-3.844	0.000139	-0.056566	69	0.014715	no	LUNG
chr1_1641261_C_T_b38	SLC35E2	-3.777	0.00018	-0.063072	25	0.0167	no	LUNG
chr1_1840043_T_TA_b38	SLC35E2	3.764	0.000189	0.070674	8	0.018774	no	LUNG
chr1_1837255_A_AT_b38	SLC35E2	3.761	0.000192	0.065553	18	0.017428	no	LUNG
chr1_1888382_A_AG_b38	SLC35E2	3.718	0.000227	0.080214	6	0.021576	no	LUNG
chr1_1652913_C_T_b38	SLC35E2	-3.714	0.00023	-0.056585	34	0.015235	no	LUNG
chr1_1606089_GGC_G_b38	SLC35E2	3.697	0.000246	0.061177	35	0.01655	no	LUNG
chr1_1801188_T_C_b38	SLC35E2	3.696	0.000247	0.065947	13	0.017845	no	LUNG
chr1_1606507_GTGGGC_G_b38	SLC35E2	3.689	0.000253	0.048062	135	0.01303	no	LUNG
chr1_1586425_A_G_b38	SLC35E2	-3.688	0.000254	-0.052868	78	0.014335	no	LUNG
chr1_1587413_C_T_b38	SLC35E2	-3.679	0.000263	-0.052574	77	0.01429	no	LUNG
chr1_1782906_T_G_b38	SLC35E2	3.667	0.000276	0.066722	12	0.018197	no	LUNG
chr1_1586679_C_T_b38	SLC35E2	-3.662	0.00028	-0.05263	77	0.014371	no	LUNG
chr1_1775296_C_T_b38	SLC35E2	3.658	0.000285	0.069295	11	0.018946	no	LUNG
chr1_1815255_G_T_b38	SLC35E2	3.658	0.000285	0.069295	11	0.018946	no	LUNG
chr1_1882915_C_T_b38	SLC35E2	3.62	0.000328	0.068253	11	0.018854	no	LUNG
chr1_1586626_C_T_b38	SLC35E2	-3.618	0.000331	-0.051966	77	0.014362	no	LUNG
chr1_1871210_G_T_b38	SLC35E2	3.616	0.000333	0.068526	11	0.018949	no	LUNG
chr1_1798974_C_T_b38	SLC35E2	3.616	0.000333	0.066038	12	0.018261	no	LUNG
chr1_1892085_G_C_b38	SLC35E2	3.61	0.00034	0.067704	10	0.018752	no	LUNG
chr1_1822247_A_G_b38	SLC35E2	3.609	0.000343	0.065832	12	0.018242	no	LUNG
chr1_1794187_C_T_b38	SLC35E2	3.596	0.000359	0.065282	12	0.018154	no	LUNG
chr1_1948938_C_T_b38	SLC35E2	-3.59	0.000368	-0.044824	102	0.012486	no	LUNG
chr1_1744121_A_C_b38	SLC35E2	-3.579	0.000384	-0.067471	58	0.018854	no	LUNG
chr1_1948919_T_TCCTTCCCTCCTCTTTCCCTCCCTTCTTTCCTTCCCTTTCCCTCCCTC_b38	SLC35E2	-3.558	0.000413	-0.044382	101	0.012472	no	LUNG
chr1_1775996_G_A_b38	SLC35E2	3.53	0.000458	0.064529	12	0.018278	no	LUNG
chr1_1837340_C_T_b38	SLC35E2	3.524	0.00047	0.064571	12	0.018326	no	LUNG
chr1_1938054_ACT_A_b38	SLC35E2	-3.508	0.000497	-0.049127	107	0.014003	no	LUNG
chr1_1695459_A_G_b38	SLC35E2	3.469	0.000574	0.052992	97	0.015276	no	LUNG
chr1_1937841_ACACCAGGTCCACCTCTGGACACAGGTCCACC_A_b38	SLC35E2	-3.462	0.000589	-0.048414	107	0.013986	no	LUNG
chr1_1940540_G_A_b38	SLC35E2	-3.462	0.000589	-0.048414	107	0.013986	no	LUNG
chr1_1649846_G_A_b38	SLC35E2	-3.447	0.000622	-0.055055	23	0.015973	no	LUNG
chr1_1898043_T_C_b38	SLC35E2	3.446	0.000624	0.064914	11	0.01884	no	LUNG
chr1_1876492_C_CGA_b38	SLC35E2	3.436	0.000647	0.067405	5	0.019619	no	LUNG
chr1_1650383_G_T_b38	SLC35E2	-3.41	0.000708	-0.05276	36	0.015471	no	LUNG
chr1_1846651_T_G_b38	SLC35E2	3.408	0.000714	0.062487	12	0.018335	no	LUNG
chr1_1898712_C_T_b38	SLC35E2	3.407	0.000717	0.064705	10	0.018992	no	LUNG
chr1_1899188_T_A_b38	SLC35E2	3.407	0.000717	0.064705	10	0.018992	no	LUNG
chr1_1855245_G_A_b38	SLC35E2	3.404	0.000725	0.063664	11	0.018704	no	LUNG
chr1_1934565_G_A_b38	SLC35E2	-3.395	0.000749	-0.049476	104	0.014575	no	LUNG
chr1_1798925_C_CT_b38	SLC35E2	-3.384	0.000778	-0.050417	45	0.014898	no	LUNG
chr1_1938332_A_ACT_b38	SLC35E2	-3.381	0.000787	-0.046999	110	0.013903	no	LUNG
chr1_1857305_G_GGGCT_b38	SLC35E2	3.36	0.000846	0.06285	11	0.018703	no	LUNG
chr1_1855939_G_A_b38	SLC35E2	3.347	0.000886	0.062488	11	0.018669	no	LUNG
chr1_1679100_A_G_b38	SLC35E2	-3.342	0.000902	-0.044795	88	0.013404	no	LUNG
chr1_1616048_C_T_b38	SLC35E2	-3.336	0.000922	-0.048054	60	0.014406	no	LUNG
chr1_1942260_G_C_b38	SLC35E2	-3.309	0.00101	-0.046146	108	0.013945	no	LUNG
chr1_1755713_G_A_b38	SLC35E2	-3.293	0.00107	-0.046091	98	0.013997	no	LUNG
chr1_1857246_T_TAA_b38	SLC35E2	3.275	0.00114	0.060904	11	0.018598	no	LUNG
chr1_1857250_C_G_b38	SLC35E2	3.275	0.00114	0.060904	11	0.018598	no	LUNG
chr1_1758323_T_C_b38	SLC35E2	3.266	0.00118	0.045162	93	0.013829	no	LUNG
chr1_1880594_A_T_b38	SLC35E2	3.257	0.00121	0.05879	14	0.018049	no	LUNG
chr1_1897985_C_G_b38	SLC35E2	3.252	0.00123	0.057983	14	0.01783	no	LUNG
chr1_1944216_C_T_b38	SLC35E2	-3.214	0.0014	-0.04677	108	0.01455	no	LUNG
chr1_1650688_T_A_b38	SLC35E2	-3.197	0.00149	-0.049349	33	0.015435	no	LUNG
chr1_1936077_C_T_b38	SLC35E2	-3.172	0.00162	-0.044963	106	0.014176	no	LUNG
chr1_1903577_C_T_b38	SLC35E2	3.172	0.00162	0.060028	11	0.018926	no	LUNG
chr1_1697272_G_A_b38	SLC35E2	3.169	0.00163	0.063426	35	0.020014	no	LUNG
chr1_1903242_C_T_b38	SLC35E2	3.168	0.00164	0.060531	10	0.019107	no	LUNG
chr1_1906935_C_T_b38	SLC35E2	3.168	0.00164	0.060531	10	0.019107	no	LUNG
chr1_1848037_C_CTA_b38	SLC35E2	3.15	0.00174	0.044269	95	0.014052	no	LUNG
chr1_1909167_G_A_b38	SLC35E2	3.141	0.0018	0.059375	11	0.018902	no	LUNG
chr1_1865177_G_A_b38	SLC35E2	-3.113	0.00197	-0.049663	29	0.015953	no	LUNG
chr1_1936627_C_G_b38	SLC35E2	-3.11	0.00199	-0.044318	98	0.01425	no	LUNG
chr1_1781909_C_T_b38	SLC35E2	3.101	0.00205	0.043077	96	0.013891	no	LUNG
chr1_1042190_G_A_b38	SLC35E2	3.075	0.00223	0.061283	31	0.019927	no	LUNG
chr1_1910289_C_T_b38	SLC35E2	3.047	0.00245	0.05406	13	0.017742	no	LUNG
chr1_1910369_G_A_b38	SLC35E2	3.047	0.00245	0.05406	13	0.017742	no	LUNG
chr1_1910480_G_A_b38	SLC35E2	3.047	0.00245	0.05406	13	0.017742	no	LUNG
chr1_1945842_A_AAAAGAAC_b38	SLC35E2	-3.045	0.00246	-0.045425	78	0.014916	no	LUNG
chr1_1987702_C_T_b38	SLC35E2	3.044	0.00247	0.053465	15	0.017565	no	LUNG
chr1_1944182_G_C_b38	SLC35E2	-3.044	0.00248	-0.044526	108	0.014629	no	LUNG
chr1_1039514_C_T_b38	SLC35E2	3.018	0.00269	0.058994	26	0.019546	no	LUNG
chr1_1042400_C_T_b38	SLC35E2	3.018	0.00269	0.058994	26	0.019546	no	LUNG
chr1_1849781_T_C_b38	SLC35E2	-3.006	0.0028	-0.047774	30	0.015893	no	LUNG
chr1_1951106_G_A_b38	SLC35E2	-2.999	0.00286	-0.042426	111	0.014147	no	LUNG
chr1_1950071_C_T_b38	SLC35E2	-2.996	0.00289	-0.042472	110	0.014176	no	LUNG
chr1_1952064_G_A_b38	SLC35E2	-2.996	0.00289	-0.042472	110	0.014176	no	LUNG
chr1_806017_A_G_b38	SLC35E2	-2.995	0.0029	-0.093623	10	0.031263	no	LUNG
chr1_1952823_TA_T_b38	SLC35E2	-2.992	0.00293	-0.042241	110	0.01412	no	LUNG
chr1_1967961_G_A_b38	SLC35E2	2.99	0.00294	0.051295	14	0.017153	no	LUNG
chr1_1951865_G_GT_b38	SLC35E2	-2.988	0.00296	-0.042389	111	0.014185	no	LUNG
chr1_1668373_C_T_b38	SLC35E2	2.987	0.00297	0.048269	51	0.016157	no	LUNG
chr1_1779667_T_TTG_b38	SLC35E2	2.984	0.003	0.04475	65	0.014996	no	LUNG
chr1_1933087_C_T_b38	SLC35E2	-2.968	0.00316	-0.042214	100	0.014225	no	LUNG
chr1_1933859_A_G_b38	SLC35E2	-2.968	0.00316	-0.042214	100	0.014225	no	LUNG
chr1_1650664_CTTTTT_C_b38	SLC35E2	-2.95	0.00334	-0.048751	26	0.016524	no	LUNG
chr1_1924183_GC_G_b38	SLC35E2	-2.94	0.00346	-0.042011	55	0.014292	no	LUNG
chr1_1828894_T_TAC_b38	SLC35E2	2.937	0.00348	0.042738	85	0.01455	no	LUNG
chr1_1935938_T_C_b38	SLC35E2	-2.936	0.00349	-0.042545	88	0.014489	no	LUNG
chr1_1022518_G_T_b38	SLC35E2	2.934	0.00352	0.039927	64	0.01361	no	LUNG
chr1_1946013_C_T_b38	SLC35E2	-2.927	0.00359	-0.043111	107	0.014726	no	LUNG
chr1_1881082_C_T_b38	SLC35E2	-2.921	0.00367	-0.042965	109	0.014711	no	LUNG
chr1_1770997_G_A_b38	SLC35E2	-2.92	0.00368	-0.041731	111	0.014293	no	LUNG
chr1_1946058_T_C_b38	SLC35E2	-2.914	0.00375	-0.042793	108	0.014687	no	LUNG
chr1_1971183_G_A_b38	SLC35E2	2.908	0.00382	0.045813	28	0.015753	no	LUNG
chr1_2407440_G_A_b38	SLC35E2	2.905	0.00386	0.043692	43	0.015042	no	LUNG
chr1_1591419_A_G_b38	SLC35E2	2.895	0.00398	0.050566	16	0.017468	no	LUNG
chr1_1731904_CA_C_b38	SLC35E2	2.888	0.00407	0.045937	41	0.015908	no	LUNG
chr1_1881249_A_G_b38	SLC35E2	-2.886	0.00409	-0.042571	109	0.014749	no	LUNG
chr1_1947189_C_T_b38	SLC35E2	-2.879	0.00418	-0.042428	108	0.014736	no	LUNG
chr1_1946632_C_T_b38	SLC35E2	-2.856	0.00449	-0.042164	108	0.014762	no	LUNG
chr1_2207909_C_CGT_b38	SLC35E2	-2.856	0.0045	-0.063006	7	0.022064	no	LUNG
chr1_1945121_T_C_b38	SLC35E2	-2.84	0.00471	-0.041749	109	0.014698	no	LUNG
chr1_1773713_T_A_b38	SLC35E2	-2.839	0.00473	-0.042921	55	0.015119	no	LUNG
chr1_1845840_C_G_b38	SLC35E2	2.839	0.00474	0.054857	7	0.019324	no	LUNG
chr1_1944675_C_T_b38	SLC35E2	-2.835	0.00479	-0.041646	109	0.01469	no	LUNG
chr1_1831318_C_T_b38	SLC35E2	-2.824	0.00495	-0.042085	105	0.014901	no	LUNG
chr1_1671724_C_T_b38	SLC35E2	-2.822	0.00498	-0.042716	40	0.015135	no	LUNG
chr1_2007629_CA_C_b38	SLC35E2	-2.816	0.00508	-0.042378	93	0.01505	no	LUNG
chr1_1725339_C_A_b38	SLC35E2	2.813	0.00513	0.036407	91	0.012943	no	LUNG
chr1_1772160_A_AT_b38	SLC35E2	2.808	0.00521	0.052173	9	0.018583	no	LUNG
chr1_1921745_T_C_b38	SLC35E2	-2.8	0.00533	-0.039847	99	0.014229	no	LUNG
chr1_1971220_C_T_b38	SLC35E2	2.79	0.0055	0.043845	28	0.015717	no	LUNG
chr1_1814797_CAAAAAAAAA_C_b38	SLC35E2	2.788	0.00553	0.056746	5	0.020354	no	LUNG
chr1_1948515_C_T_b38	SLC35E2	-2.786	0.00556	-0.038918	119	0.013969	no	LUNG
chr1_1866508_A_G_b38	SLC35E2	-2.783	0.00562	-0.040952	110	0.014717	no	LUNG
chr1_1875208_T_C_b38	SLC35E2	-2.783	0.00562	-0.040952	110	0.014717	no	LUNG
chr1_1879567_T_C_b38	SLC35E2	-2.783	0.00562	-0.040952	110	0.014717	no	LUNG
chr1_1886800_G_A_b38	SLC35E2	-2.783	0.00562	-0.040952	110	0.014717	no	LUNG
chr1_1891654_C_CAGAG_b38	SLC35E2	-2.783	0.00562	-0.040952	110	0.014717	no	LUNG
chr1_1944074_T_C_b38	SLC35E2	-2.781	0.00566	-0.040792	109	0.01467	no	LUNG
chr1_1944091_G_C_b38	SLC35E2	-2.781	0.00566	-0.040792	109	0.01467	no	LUNG
chr1_1912140_T_G_b38	SLC35E2	2.778	0.00571	0.048539	16	0.017474	no	LUNG
chr1_1942887_C_G_b38	SLC35E2	-2.775	0.00575	-0.040472	110	0.014584	no	LUNG
chr1_1937895_C_T_b38	SLC35E2	-2.77	0.00584	-0.040734	108	0.014706	no	LUNG
chr1_1944419_C_G_b38	SLC35E2	-2.763	0.00597	-0.040447	110	0.01464	no	LUNG
chr1_1750589_G_A_b38	SLC35E2	-2.757	0.00607	-0.059837	18	0.0217	no	LUNG
chr1_1965567_C_T_b38	SLC35E2	2.752	0.00616	0.049996	13	0.018165	no	LUNG
chr1_1937802_G_T_b38	SLC35E2	-2.75	0.00621	-0.040717	106	0.014807	no	LUNG
chr1_1931587_A_G_b38	SLC35E2	-2.75	0.00621	-0.039518	102	0.014372	no	LUNG
chr1_1861110_CA_C_b38	SLC35E2	2.747	0.00626	0.065444	3	0.023824	no	LUNG
chr1_1948519_T_C_b38	SLC35E2	-2.746	0.00629	-0.038326	119	0.013959	no	LUNG
chr1_1924207_T_C_b38	SLC35E2	-2.738	0.00644	-0.039291	59	0.014353	no	LUNG
chr1_1762759_AAATG_A_b38	SLC35E2	2.735	0.00648	0.037716	100	0.013789	no	LUNG
chr1_1843381_A_T_b38	SLC35E2	-2.728	0.00662	-0.040268	108	0.014758	no	LUNG
chr1_1990864_C_T_b38	SLC35E2	2.727	0.00665	0.0378	95	0.013862	no	LUNG
chr1_1989523_T_C_b38	SLC35E2	2.722	0.00675	0.037493	91	0.013776	no	LUNG
chr1_1687153_A_G_b38	SLC35E2	-2.718	0.00682	-0.036295	108	0.013353	no	LUNG
chr1_1847030_A_G_b38	SLC35E2	-2.71	0.007	-0.040108	107	0.014802	no	LUNG
chr1_1850017_G_T_b38	SLC35E2	-2.71	0.007	-0.040108	107	0.014802	no	LUNG
chr1_1835922_GA_G_b38	SLC35E2	2.705	0.0071	0.077168	3	0.02853	no	LUNG
chr1_1705198_C_G_b38	SLC35E2	-2.704	0.00711	-0.075053	10	0.027756	no	LUNG
chr1_1773717_T_A_b38	SLC35E2	-2.697	0.00725	-0.037255	78	0.013811	no	LUNG
chr1_1797530_C_A_b38	SLC35E2	-2.694	0.00732	-0.039516	106	0.014667	no	LUNG
chr1_1687643_G_A_b38	SLC35E2	-2.689	0.00744	-0.035598	104	0.01324	no	LUNG
chr1_1769969_CAAAACAAAAACA_C_b38	SLC35E2	-2.687	0.00748	-0.039082	112	0.014544	no	LUNG
chr1_1047561_T_C_b38	SLC35E2	2.687	0.00749	0.053472	29	0.019904	no	LUNG
chr1_1684266_T_C_b38	SLC35E2	-2.68	0.00764	-0.036007	100	0.013438	no	LUNG
chr1_1681164_G_A_b38	SLC35E2	-2.677	0.00769	-0.03607	101	0.013471	no	LUNG
chr1_1771864_G_A_b38	SLC35E2	-2.673	0.0078	-0.039259	109	0.014689	no	LUNG
chr1_1772426_T_A_b38	SLC35E2	-2.673	0.0078	-0.039259	109	0.014689	no	LUNG
chr1_1938125_TCA_T_b38	SLC35E2	-2.669	0.00789	-0.039239	107	0.014703	no	LUNG
chr1_1860718_A_C_b38	SLC35E2	-2.665	0.00797	-0.039415	112	0.014788	no	LUNG
chr1_1687061_C_T_b38	SLC35E2	-2.664	0.00799	-0.035487	103	0.013319	no	LUNG
chr1_1764887_C_A_b38	SLC35E2	-2.663	0.00803	-0.03946	107	0.014819	no	LUNG
chr1_1687159_G_T_b38	SLC35E2	-2.655	0.00822	-0.035622	100	0.013417	no	LUNG
chr1_1944420_A_G_b38	SLC35E2	-2.653	0.00826	-0.038706	110	0.014589	no	LUNG
chr1_1827774_A_G_b38	SLC35E2	-2.651	0.00831	-0.039226	108	0.014796	no	LUNG
chr1_1718786_G_A_b38	SLC35E2	-2.644	0.00848	-0.107363	5	0.040601	no	LUNG
chr1_1719189_G_A_b38	SLC35E2	-2.644	0.00848	-0.107363	5	0.040601	no	LUNG
chr1_1720548_G_A_b38	SLC35E2	-2.644	0.00848	-0.107363	5	0.040601	no	LUNG
chr1_1721336_G_A_b38	SLC35E2	-2.644	0.00848	-0.107363	5	0.040601	no	LUNG
chr1_1683909_A_C_b38	SLC35E2	-2.644	0.00849	-0.035445	111	0.013407	no	LUNG
chr1_1750528_G_A_b38	SLC35E2	-2.641	0.00855	-0.033056	106	0.012516	no	LUNG
chr1_1962899_A_C_b38	SLC35E2	2.639	0.0086	0.049464	11	0.018742	no	LUNG
chr1_1684308_G_C_b38	SLC35E2	-2.639	0.00861	-0.035528	99	0.013464	no	LUNG
chr1_1684619_G_A_b38	SLC35E2	-2.639	0.00861	-0.035528	99	0.013464	no	LUNG
chr1_1726140_C_A_b38	SLC35E2	2.636	0.00869	0.09004	3	0.034161	no	LUNG
chr1_1968747_T_C_b38	SLC35E2	2.624	0.00898	0.047251	13	0.018004	no	LUNG
chr1_1931580_CA_C_b38	SLC35E2	-2.624	0.00899	-0.037746	101	0.014384	no	LUNG
chr1_1955080_C_CGGCTCACACCGGAAGTGAGGCTCACACCGGAAGTGA_b38	SLC35E2	-2.624	0.00899	-0.037633	98	0.014342	no	LUNG
chr1_1945975_TG_T_b38	SLC35E2	-2.624	0.009	-0.038119	110	0.014529	no	LUNG
chr1_1055153_G_A_b38	SLC35E2	-2.623	0.00901	-0.090407	11	0.034466	no	LUNG
chr1_1766653_A_G_b38	SLC35E2	-2.622	0.00903	-0.038724	108	0.014767	no	LUNG
chr1_1773848_A_C_b38	SLC35E2	-2.622	0.00903	-0.038724	108	0.014767	no	LUNG
chr1_1790040_C_T_b38	SLC35E2	-2.622	0.00903	-0.038724	108	0.014767	no	LUNG
chr1_1817295_T_C_b38	SLC35E2	-2.622	0.00903	-0.038724	108	0.014767	no	LUNG
chr1_1773460_G_A_b38	SLC35E2	-2.618	0.00914	-0.038645	107	0.014761	no	LUNG
chr1_1773476_C_G_b38	SLC35E2	-2.618	0.00914	-0.038645	107	0.014761	no	LUNG
chr1_1773727_T_A_b38	SLC35E2	-2.617	0.00917	-0.037397	67	0.014289	no	LUNG
chr1_1846009_AGG_A_b38	SLC35E2	-2.613	0.00929	-0.038773	109	0.014841	no	LUNG
chr1_1846011_G_GTCC_b38	SLC35E2	-2.613	0.00929	-0.038773	109	0.014841	no	LUNG
chr1_1020681_A_AG_b38	SLC35E2	2.61	0.00937	0.037401	46	0.014332	no	LUNG
chr1_1456891_T_C_b38	SLC35E2	2.607	0.00944	0.039364	43	0.0151	no	LUNG
chr1_1776461_GAAAC_G_b38	SLC35E2	-2.603	0.00956	-0.038532	107	0.014805	no	LUNG
chr1_1777362_A_G_b38	SLC35E2	-2.603	0.00956	-0.038532	107	0.014805	no	LUNG
chr1_1808816_G_T_b38	SLC35E2	-2.603	0.00956	-0.038532	107	0.014805	no	LUNG
chr1_1819825_G_A_b38	SLC35E2	-2.603	0.00956	-0.038532	107	0.014805	no	LUNG
chr1_1686017_A_AT_b38	SLC35E2	-2.602	0.00958	-0.034563	104	0.013283	no	LUNG
chr1_1686147_T_G_b38	SLC35E2	-2.601	0.00962	-0.035617	93	0.013696	no	LUNG
chr1_1047614_T_C_b38	SLC35E2	2.599	0.00966	0.05183	22	0.019942	no	LUNG
chr1_1650370_C_CT_b38	SLC35E2	-2.592	0.00985	-0.048103	19	0.018558	no	LUNG
chr1_1778596_C_T_b38	SLC35E2	-2.59	0.0099	-0.040206	46	0.015521	no	LUNG
chr1_1825782_G_A_b38	SLC35E2	-2.589	0.00995	-0.070879	6	0.027378	no	LUNG
chr1_1680214_T_C_b38	SLC35E2	-2.587	0.00999	-0.034716	102	0.013418	no	LUNG
chr1_1673968_GA_G_b38	SLC35E2	4.365	2.74e-05	0.126307	13	0.028934	yes	SLVRYG
chr1_1744121_A_C_b38	SLC35E2	-4.221	4.81e-05	-0.143616	15	0.034026	yes	SLVRYG
chr1_1730405_G_C_b38	SLC35E2	4.168	5.89e-05	0.116872	19	0.028042	yes	SLVRYG
chr1_1742587_G_C_b38	SLC35E2	4.117	7.15e-05	0.105172	27	0.025545	yes	SLVRYG
chr1_1708855_TTCCTCCTCC_T_b38	SLC35E2	4.034	9.78e-05	0.103591	22	0.025682	yes	SLVRYG
chr1_1877316_A_T_b38	SLC35E2	3.983	0.000118	0.106172	20	0.026654	yes	SLVRYG
chr1_1744499_C_T_b38	SLC35E2	-3.96	0.000129	-0.098255	27	0.024815	yes	SLVRYG
chr1_1743886_C_T_b38	SLC35E2	-3.912	0.000153	-0.113114	13	0.028913	yes	SLVRYG
chr1_1743851_C_T_b38	SLC35E2	-3.888	0.000168	-0.113443	11	0.029179	yes	SLVRYG
chr1_1743840_T_C_b38	SLC35E2	-3.88	0.000173	-0.112808	12	0.029076	yes	SLVRYG
chr1_1746439_GA_G_b38	SLC35E2	3.863	0.000184	0.106725	20	0.027628	yes	SLVRYG
chr1_1743714_C_CA_b38	SLC35E2	3.818	0.000216	0.107065	12	0.02804	yes	SLVRYG
chr1_1744652_C_T_b38	SLC35E2	-3.735	0.000291	-0.096148	28	0.025743	yes	SLVRYG
chr1_1744854_C_A_b38	SLC35E2	-3.721	0.000305	-0.084068	23	0.022592	yes	SLVRYG
chr1_1744052_GAGA_G_b38	SLC35E2	-3.662	0.000376	-0.112628	9	0.030755	yes	SLVRYG
chr1_1708951_C_T_b38	SLC35E2	3.613	0.000446	0.093107	18	0.025768	yes	SLVRYG
chr1_1670423_AT_A_b38	SLC35E2	3.562	0.000533	0.105198	17	0.029537	yes	SLVRYG
chr1_1743565_AT_A_b38	SLC35E2	3.524	0.000607	0.086822	26	0.02464	yes	SLVRYG
chr1_1691417_T_C_b38	SLC35E2	3.519	0.000617	0.090239	32	0.025646	yes	SLVRYG
chr1_1742432_T_TA_b38	SLC35E2	3.499	0.00066	0.090288	21	0.025804	yes	SLVRYG
chr1_1746440_A_G_b38	SLC35E2	-3.458	0.000758	-0.106466	8	0.030788	yes	SLVRYG
chr1_1708474_C_A_b38	SLC35E2	-3.44	0.000806	-0.115279	6	0.033515	yes	SLVRYG
chr1_1721197_CA_C_b38	SLC35E2	3.382	0.000976	0.136228	7	0.040279	yes	SLVRYG
chr1_1704835_C_T_b38	SLC35E2	3.359	0.00105	0.083515	28	0.02486	yes	SLVRYG
chr1_1720192_T_G_b38	SLC35E2	3.359	0.00105	0.083515	28	0.02486	yes	SLVRYG
chr1_1755523_C_T_b38	SLC35E2	3.357	0.00106	0.086128	28	0.025659	yes	SLVRYG
chr1_1704310_C_A_b38	SLC35E2	3.345	0.00111	0.076815	33	0.022967	yes	SLVRYG
chr1_1695459_A_G_b38	SLC35E2	3.334	0.00114	0.097155	21	0.029137	yes	SLVRYG
chr1_1715838_C_T_b38	SLC35E2	3.33	0.00116	0.083786	28	0.025158	yes	SLVRYG
chr1_1750428_G_C_b38	SLC35E2	-3.315	0.00122	-0.104488	18	0.031521	yes	SLVRYG
chr1_1719638_C_CTCGCTCTGTCACCCAGGCT_b38	SLC35E2	3.31	0.00124	0.120653	10	0.036456	yes	SLVRYG
chr1_1706067_ACT_A_b38	SLC35E2	3.286	0.00134	0.08254	28	0.025122	yes	SLVRYG
chr1_1748780_G_A_b38	SLC35E2	-3.28	0.00136	-0.091919	31	0.028023	yes	SLVRYG
chr1_1936906_CA_C_b38	SLC35E2	3.279	0.00137	0.103964	5	0.031708	yes	SLVRYG
chr1_1717507_T_C_b38	SLC35E2	3.266	0.00143	0.131358	7	0.040225	yes	SLVRYG
chr1_1750440_G_A_b38	SLC35E2	-3.261	0.00145	-0.102767	17	0.031516	yes	SLVRYG
chr1_1688570_A_T_b38	SLC35E2	-3.257	0.00147	-0.113828	7	0.034946	yes	SLVRYG
chr1_1750280_A_G_b38	SLC35E2	-3.254	0.00148	-0.092103	31	0.028302	yes	SLVRYG
chr1_1676790_C_T_b38	SLC35E2	3.244	0.00153	0.0834	27	0.025708	yes	SLVRYG
chr1_1750226_C_T_b38	SLC35E2	3.242	0.00154	0.090545	20	0.02793	yes	SLVRYG
chr1_1757725_C_T_b38	SLC35E2	3.242	0.00154	0.090545	20	0.02793	yes	SLVRYG
chr1_1673060_G_A_b38	SLC35E2	3.222	0.00164	0.083499	26	0.025911	yes	SLVRYG
chr1_1674720_TGC_T_b38	SLC35E2	3.222	0.00164	0.083499	26	0.025911	yes	SLVRYG
chr1_1674868_G_A_b38	SLC35E2	3.222	0.00164	0.083499	26	0.025911	yes	SLVRYG
chr1_1677720_T_G_b38	SLC35E2	3.221	0.00165	0.08265	28	0.025656	yes	SLVRYG
chr1_1677726_A_T_b38	SLC35E2	3.221	0.00165	0.08265	28	0.025656	yes	SLVRYG
chr1_1717067_A_AT_b38	SLC35E2	3.219	0.00166	0.130136	8	0.040423	yes	SLVRYG
chr1_1714932_G_T_b38	SLC35E2	3.178	0.0019	0.074001	32	0.023288	yes	SLVRYG
chr1_1752908_C_CCCT_b38	SLC35E2	-3.172	0.00193	-0.092925	26	0.029295	yes	SLVRYG
chr1_1722619_C_T_b38	SLC35E2	3.154	0.00204	0.110813	14	0.035134	yes	SLVRYG
chr1_1671995_G_T_b38	SLC35E2	3.141	0.00213	0.082131	26	0.026147	yes	SLVRYG
chr1_1680672_C_T_b38	SLC35E2	-3.134	0.00217	-0.083868	18	0.026757	yes	SLVRYG
chr1_1764023_C_A_b38	SLC35E2	3.121	0.00227	0.085796	19	0.027492	yes	SLVRYG
chr1_1881082_C_T_b38	SLC35E2	-3.11	0.00235	-0.088329	30	0.028405	yes	SLVRYG
chr1_1781909_C_T_b38	SLC35E2	3.088	0.00251	0.082332	21	0.026662	yes	SLVRYG
chr1_1848037_C_CTA_b38	SLC35E2	3.088	0.00251	0.082332	21	0.026662	yes	SLVRYG
chr1_1686321_CTTT_C_b38	SLC35E2	-3.051	0.00282	-0.086019	11	0.028196	yes	SLVRYG
chr1_1760882_T_C_b38	SLC35E2	3.038	0.00293	0.079362	21	0.02612	yes	SLVRYG
chr1_1804004_G_A_b38	SLC35E2	3.033	0.00298	0.071161	23	0.023464	yes	SLVRYG
chr1_1758323_T_C_b38	SLC35E2	3.023	0.00307	0.079411	23	0.026265	yes	SLVRYG
chr1_1754601_G_T_b38	SLC35E2	3.023	0.00307	0.084875	20	0.028073	yes	SLVRYG
chr1_1756186_T_C_b38	SLC35E2	3.018	0.00311	0.082788	20	0.027427	yes	SLVRYG
chr1_1754482_TCCCTGGGACCGAAGTCGCCCCA_T_b38	SLC35E2	-3.01	0.0032	-0.087112	27	0.028944	yes	SLVRYG
chr1_1792696_C_CA_b38	SLC35E2	3.008	0.00321	0.080463	14	0.026747	yes	SLVRYG
chr1_1722625_A_T_b38	SLC35E2	2.995	0.00335	0.103635	14	0.034607	yes	SLVRYG
chr1_1891444_CG_C_b38	SLC35E2	-2.992	0.00338	-0.084584	30	0.028273	yes	SLVRYG
chr1_1877330_T_C_b38	SLC35E2	-2.988	0.00342	-0.087046	26	0.029132	yes	SLVRYG
chr1_1695747_C_T_b38	SLC35E2	2.982	0.00348	0.087193	25	0.029236	yes	SLVRYG
chr1_1779667_T_TTG_b38	SLC35E2	2.977	0.00353	0.083543	13	0.028064	yes	SLVRYG
chr1_1687236_T_G_b38	SLC35E2	-2.973	0.00358	-0.079629	22	0.026784	yes	SLVRYG
chr1_1891450_G_C_b38	SLC35E2	-2.958	0.00374	-0.083845	30	0.028341	yes	SLVRYG
chr1_1769969_CAAAACA_C_b38	SLC35E2	2.955	0.00377	0.077779	19	0.026317	yes	SLVRYG
chr1_1720288_G_A_b38	SLC35E2	2.952	0.00381	0.126733	13	0.042926	yes	SLVRYG
chr1_1692151_T_C_b38	SLC35E2	-2.95	0.00383	-0.084999	13	0.028809	yes	SLVRYG
chr1_1673818_A_C_b38	SLC35E2	2.943	0.00391	0.076023	26	0.025831	yes	SLVRYG
chr1_1757074_G_T_b38	SLC35E2	2.916	0.00424	0.080992	20	0.027775	yes	SLVRYG
chr1_1703583_A_G_b38	SLC35E2	-2.911	0.00431	-0.124903	14	0.042908	yes	SLVRYG
chr1_2414660_C_G_b38	SLC35E2	-2.909	0.00433	-0.079151	10	0.027206	yes	SLVRYG
chr1_1688531_T_C_b38	SLC35E2	-2.905	0.00439	-0.094612	14	0.032573	yes	SLVRYG
chr1_1749637_G_T_b38	SLC35E2	2.903	0.00441	0.078217	21	0.026942	yes	SLVRYG
chr1_1820337_A_G_b38	SLC35E2	2.901	0.00443	0.077325	21	0.026652	yes	SLVRYG
chr1_1683909_A_C_b38	SLC35E2	-2.894	0.00454	-0.075479	28	0.026085	yes	SLVRYG
chr1_1687153_A_G_b38	SLC35E2	-2.894	0.00454	-0.075479	28	0.026085	yes	SLVRYG
chr1_1866635_T_TA_b38	SLC35E2	2.873	0.00483	0.080968	14	0.028187	yes	SLVRYG
chr1_1739131_T_C_b38	SLC35E2	2.867	0.00491	0.076779	24	0.026782	yes	SLVRYG
chr1_1722626_AGCG_A_b38	SLC35E2	2.867	0.00491	0.098018	14	0.034193	yes	SLVRYG
chr1_1865278_A_C_b38	SLC35E2	2.864	0.00495	0.076098	19	0.02657	yes	SLVRYG
chr1_1688409_C_G_b38	SLC35E2	-2.861	0.005	-0.076143	26	0.026618	yes	SLVRYG
chr1_1687643_G_A_b38	SLC35E2	-2.857	0.00505	-0.073822	26	0.025838	yes	SLVRYG
chr1_1680214_T_C_b38	SLC35E2	-2.805	0.00589	-0.075077	25	0.026767	yes	SLVRYG
chr1_1680556_A_G_b38	SLC35E2	-2.805	0.00589	-0.075077	25	0.026767	yes	SLVRYG
chr1_1681164_G_A_b38	SLC35E2	-2.805	0.00589	-0.075077	25	0.026767	yes	SLVRYG
chr1_1708486_C_A_b38	SLC35E2	2.804	0.0059	0.066837	24	0.023835	yes	SLVRYG
chr1_1692124_T_G_b38	SLC35E2	-2.784	0.00626	-0.081265	13	0.029194	yes	SLVRYG
chr1_1752126_G_A_b38	SLC35E2	2.772	0.00647	0.082455	16	0.029742	yes	SLVRYG
chr1_1636278_G_T_b38	SLC35E2	2.771	0.00649	0.07134	26	0.025745	yes	SLVRYG
chr1_2069153_C_A_b38	SLC35E2	-2.759	0.00673	-0.085879	20	0.031131	yes	SLVRYG
chr1_1844830_C_A_b38	SLC35E2	2.758	0.00674	0.073952	21	0.026811	yes	SLVRYG
chr1_1308549_G_T_b38	SLC35E2	2.758	0.00674	0.065135	34	0.023615	yes	SLVRYG
chr1_1880596_T_A_b38	SLC35E2	-2.743	0.00704	-0.076257	29	0.0278	yes	SLVRYG
chr1_1686017_A_AT_b38	SLC35E2	-2.734	0.00722	-0.072168	25	0.026396	yes	SLVRYG
chr1_1687061_C_T_b38	SLC35E2	-2.734	0.00722	-0.072168	25	0.026396	yes	SLVRYG
chr1_1693427_G_A_b38	SLC35E2	2.733	0.00724	0.084561	20	0.030941	yes	SLVRYG
chr1_1749826_A_G_b38	SLC35E2	-2.73	0.00731	-0.073484	34	0.02692	yes	SLVRYG
chr1_822427_CCCTGGCCAGCAGATCCACCCTGTCTATACTACCTG_C_b38	SLC35E2	-2.728	0.00735	-0.089181	6	0.032693	yes	SLVRYG
chr1_1687734_CAA_C_b38	SLC35E2	-2.717	0.00758	-0.073105	21	0.026907	yes	SLVRYG
chr1_909894_G_T_b38	SLC35E2	2.705	0.00785	0.087178	11	0.032233	yes	SLVRYG
chr1_1716796_A_C_b38	SLC35E2	2.704	0.00785	0.114494	8	0.042336	yes	SLVRYG
chr1_1919188_CAGCGGCAGG_C_b38	SLC35E2	-2.697	0.00803	-0.074229	30	0.027527	yes	SLVRYG
chr1_1684266_T_C_b38	SLC35E2	-2.681	0.00838	-0.071525	24	0.026675	yes	SLVRYG
chr1_1687159_G_T_b38	SLC35E2	-2.681	0.00838	-0.071525	24	0.026675	yes	SLVRYG
chr1_2619655_CA_C_b38	SLC35E2	2.656	0.00899	0.076685	12	0.028868	yes	SLVRYG
chr1_1724489_G_C_b38	SLC35E2	2.626	0.0098	0.069086	33	0.026313	yes	SLVRYG
chr1_1684308_G_C_b38	SLC35E2	-2.62	0.00995	-0.070741	22	0.027001	yes	SLVRYG
chr1_1684619_G_A_b38	SLC35E2	-2.62	0.00995	-0.070741	22	0.027001	yes	SLVRYG
chr1_1744028_A_AC_b38	SLC35E2	-4.527	1.44e-05	-0.145499	7	0.032142	no	SLVRYG
chr1_1742672_C_T_b38	SLC35E2	-4.099	7.66e-05	-0.107701	24	0.026276	no	SLVRYG
chr1_1743238_G_C_b38	SLC35E2	-4.099	7.66e-05	-0.107701	24	0.026276	no	SLVRYG
chr1_1688328_C_T_b38	SLC35E2	-3.762	0.000264	-0.095556	12	0.025402	no	SLVRYG
chr1_1747695_A_G_b38	SLC35E2	-3.753	0.000273	-0.080585	31	0.021474	no	SLVRYG
chr1_1743565_ATAT_A_b38	SLC35E2	-3.689	0.000342	-0.088988	24	0.024124	no	SLVRYG
chr1_1936906_C_CA_b38	SLC35E2	-3.652	0.000389	-0.114772	14	0.031428	no	SLVRYG
chr1_1753033_C_T_b38	SLC35E2	-3.642	0.000403	-0.103118	31	0.028313	no	SLVRYG
chr1_1679993_A_G_b38	SLC35E2	-3.506	0.000644	-0.090919	32	0.025932	no	SLVRYG
chr1_1744096_C_T_b38	SLC35E2	-3.475	0.000715	-0.124239	14	0.035748	no	SLVRYG
chr1_1736729_G_T_b38	SLC35E2	3.471	0.000726	0.089425	29	0.025764	no	SLVRYG
chr1_1759354_G_A_b38	SLC35E2	-3.445	0.000792	-0.097923	27	0.028425	no	SLVRYG
chr1_1759611_C_T_b38	SLC35E2	-3.445	0.000792	-0.097923	27	0.028425	no	SLVRYG
chr1_1724035_G_A_b38	SLC35E2	3.38	0.000984	0.109791	7	0.032485	no	SLVRYG
chr1_1881428_C_CT_b38	SLC35E2	-3.375	0.000999	-0.096601	28	0.028621	no	SLVRYG
chr1_1747472_A_T_b38	SLC35E2	-3.307	0.00125	-0.095593	27	0.02891	no	SLVRYG
chr1_1748597_C_G_b38	SLC35E2	-3.307	0.00125	-0.095593	27	0.02891	no	SLVRYG
chr1_1752461_G_A_b38	SLC35E2	-3.307	0.00125	-0.095593	27	0.02891	no	SLVRYG
chr1_1752730_C_G_b38	SLC35E2	-3.307	0.00125	-0.095593	27	0.02891	no	SLVRYG
chr1_1753361_G_A_b38	SLC35E2	-3.307	0.00125	-0.095593	27	0.02891	no	SLVRYG
chr1_1756043_G_T_b38	SLC35E2	-3.307	0.00125	-0.095593	27	0.02891	no	SLVRYG
chr1_1746522_GT_G_b38	SLC35E2	-3.294	0.00131	-0.100228	9	0.030432	no	SLVRYG
chr1_1737504_A_C_b38	SLC35E2	3.278	0.00137	0.082019	32	0.025018	no	SLVRYG
chr1_1753319_G_A_b38	SLC35E2	-3.276	0.00138	-0.093703	27	0.028606	no	SLVRYG
chr1_1738295_G_T_b38	SLC35E2	3.275	0.00139	0.081979	31	0.025032	no	SLVRYG
chr1_1727506_T_C_b38	SLC35E2	3.247	0.00152	0.102062	10	0.031429	no	SLVRYG
chr1_1731963_A_C_b38	SLC35E2	3.211	0.0017	0.081217	31	0.025291	no	SLVRYG
chr1_1732392_C_T_b38	SLC35E2	3.204	0.00174	0.08168	30	0.025494	no	SLVRYG
chr1_1734174_A_G_b38	SLC35E2	3.204	0.00174	0.08168	30	0.025494	no	SLVRYG
chr1_1735176_C_T_b38	SLC35E2	3.204	0.00174	0.08168	30	0.025494	no	SLVRYG
chr1_1735980_A_C_b38	SLC35E2	3.204	0.00174	0.08168	30	0.025494	no	SLVRYG
chr1_1740343_C_T_b38	SLC35E2	3.204	0.00174	0.08168	30	0.025494	no	SLVRYG
chr1_1740703_C_T_b38	SLC35E2	3.204	0.00174	0.08168	30	0.025494	no	SLVRYG
chr1_1734903_A_G_b38	SLC35E2	3.176	0.0019	0.080151	30	0.025233	no	SLVRYG
chr1_1681928_C_A_b38	SLC35E2	-3.127	0.00222	-0.087033	21	0.027832	no	SLVRYG
chr1_1762759_AAATG_A_b38	SLC35E2	3.108	0.00236	0.07962	23	0.025621	no	SLVRYG
chr1_967384_C_G_b38	SLC35E2	-3.082	0.00256	-0.090264	32	0.02929	no	SLVRYG
chr1_1866508_A_G_b38	SLC35E2	-3.065	0.0027	-0.08776	30	0.02863	no	SLVRYG
chr1_1879567_T_C_b38	SLC35E2	-3.065	0.0027	-0.08776	30	0.02863	no	SLVRYG
chr1_1881249_A_G_b38	SLC35E2	-3.065	0.0027	-0.08776	30	0.02863	no	SLVRYG
chr1_1886800_G_A_b38	SLC35E2	-3.065	0.0027	-0.08776	30	0.02863	no	SLVRYG
chr1_1891654_C_CAGAG_b38	SLC35E2	-3.065	0.0027	-0.08776	30	0.02863	no	SLVRYG
chr1_1764887_C_A_b38	SLC35E2	-3.065	0.0027	-0.087921	29	0.02869	no	SLVRYG
chr1_1766653_A_G_b38	SLC35E2	-3.065	0.0027	-0.087921	29	0.02869	no	SLVRYG
chr1_1771864_G_A_b38	SLC35E2	-3.065	0.0027	-0.087921	29	0.02869	no	SLVRYG
chr1_1772410_T_C_b38	SLC35E2	-3.065	0.0027	-0.087921	29	0.02869	no	SLVRYG
chr1_1772426_T_A_b38	SLC35E2	-3.065	0.0027	-0.087921	29	0.02869	no	SLVRYG
chr1_1773460_G_A_b38	SLC35E2	-3.065	0.0027	-0.087921	29	0.02869	no	SLVRYG
chr1_1773476_C_G_b38	SLC35E2	-3.065	0.0027	-0.087921	29	0.02869	no	SLVRYG
chr1_1773848_A_C_b38	SLC35E2	-3.065	0.0027	-0.087921	29	0.02869	no	SLVRYG
chr1_1776461_GAAAC_G_b38	SLC35E2	-3.065	0.0027	-0.087921	29	0.02869	no	SLVRYG
chr1_1777362_A_G_b38	SLC35E2	-3.065	0.0027	-0.087921	29	0.02869	no	SLVRYG
chr1_1790040_C_T_b38	SLC35E2	-3.065	0.0027	-0.087921	29	0.02869	no	SLVRYG
chr1_1791493_C_T_b38	SLC35E2	-3.065	0.0027	-0.087921	29	0.02869	no	SLVRYG
chr1_1791592_G_A_b38	SLC35E2	-3.065	0.0027	-0.087921	29	0.02869	no	SLVRYG
chr1_1792927_G_A_b38	SLC35E2	-3.065	0.0027	-0.087921	29	0.02869	no	SLVRYG
chr1_1808816_G_T_b38	SLC35E2	-3.065	0.0027	-0.087921	29	0.02869	no	SLVRYG
chr1_1817295_T_C_b38	SLC35E2	-3.065	0.0027	-0.087921	29	0.02869	no	SLVRYG
chr1_1819825_G_A_b38	SLC35E2	-3.065	0.0027	-0.087921	29	0.02869	no	SLVRYG
chr1_1827774_A_G_b38	SLC35E2	-3.065	0.0027	-0.087921	29	0.02869	no	SLVRYG
chr1_1831318_C_T_b38	SLC35E2	-3.065	0.0027	-0.087921	29	0.02869	no	SLVRYG
chr1_1843381_A_T_b38	SLC35E2	-3.065	0.0027	-0.087921	29	0.02869	no	SLVRYG
chr1_1847030_A_G_b38	SLC35E2	-3.065	0.0027	-0.087921	29	0.02869	no	SLVRYG
chr1_1850017_G_T_b38	SLC35E2	-3.065	0.0027	-0.087921	29	0.02869	no	SLVRYG
chr1_1743586_T_TAC_b38	SLC35E2	-3.057	0.00277	-0.084483	20	0.02764	no	SLVRYG
chr1_1770997_G_A_b38	SLC35E2	-3.047	0.00286	-0.085807	29	0.028165	no	SLVRYG
chr1_1697272_G_A_b38	SLC35E2	3.033	0.00298	0.115369	10	0.038037	no	SLVRYG
chr1_1797530_C_A_b38	SLC35E2	-2.998	0.00331	-0.086704	28	0.028916	no	SLVRYG
chr1_1902481_G_A_b38	SLC35E2	-2.981	0.00349	-0.083372	30	0.027971	no	SLVRYG
chr1_1755504_T_C_b38	SLC35E2	2.941	0.00394	0.076512	27	0.026018	no	SLVRYG
chr1_1686147_T_G_b38	SLC35E2	-2.914	0.00428	-0.078718	22	0.027017	no	SLVRYG
chr1_1902439_C_T_b38	SLC35E2	-2.903	0.00441	-0.082451	30	0.028404	no	SLVRYG
chr1_1899573_C_T_b38	SLC35E2	-2.903	0.00442	-0.085044	30	0.0293	no	SLVRYG
chr1_1866635_T_TAAA_b38	SLC35E2	-2.877	0.00477	-0.084752	21	0.029458	no	SLVRYG
chr1_1726904_T_C_b38	SLC35E2	2.851	0.00514	0.07251	28	0.025431	no	SLVRYG
chr1_814617_A_G_b38	SLC35E2	-2.841	0.0053	-0.076729	14	0.027008	no	SLVRYG
chr1_1717604_CGCTTTCAGCTAGAGTTTGCTCTCTCTGGTTTTCGGTCTGTGACACACGCAT_C_b38	SLC35E2	2.825	0.00555	0.075405	26	0.026692	no	SLVRYG
chr1_1739883_C_T_b38	SLC35E2	-2.819	0.00565	-0.074011	24	0.026255	no	SLVRYG
chr1_1804002_AAG_A_b38	SLC35E2	-2.801	0.00595	-0.066646	35	0.023792	no	SLVRYG
chr1_1736836_A_G_b38	SLC35E2	2.765	0.00661	0.073572	30	0.02661	no	SLVRYG
chr1_1937802_G_T_b38	SLC35E2	-2.757	0.00676	-0.076283	31	0.027668	no	SLVRYG
chr1_1901262_C_T_b38	SLC35E2	-2.747	0.00695	-0.080265	30	0.029216	no	SLVRYG
chr1_1901386_C_A_b38	SLC35E2	-2.747	0.00695	-0.080265	30	0.029216	no	SLVRYG
chr1_1905586_C_T_b38	SLC35E2	-2.747	0.00695	-0.080265	30	0.029216	no	SLVRYG
chr1_1936627_C_G_b38	SLC35E2	-2.747	0.00695	-0.072027	26	0.026219	no	SLVRYG
chr1_1909234_G_A_b38	SLC35E2	-2.74	0.0071	-0.07926	31	0.028927	no	SLVRYG
chr1_1909238_G_A_b38	SLC35E2	-2.74	0.0071	-0.07926	31	0.028927	no	SLVRYG
chr1_1750589_G_A_b38	SLC35E2	-2.739	0.00712	-0.086965	9	0.031751	no	SLVRYG
chr1_2075002_G_A_b38	SLC35E2	-2.733	0.00725	-0.097563	3	0.035704	no	SLVRYG
chr1_1912607_C_T_b38	SLC35E2	-2.721	0.00749	-0.080861	28	0.029715	no	SLVRYG
chr1_1738597_C_A_b38	SLC35E2	2.719	0.00754	0.081232	14	0.029878	no	SLVRYG
chr1_1875208_T_C_b38	SLC35E2	-2.691	0.00815	-0.07698	31	0.028602	no	SLVRYG
chr1_1846009_AGG_A_b38	SLC35E2	-2.69	0.00817	-0.077123	30	0.028666	no	SLVRYG
chr1_1846011_G_GTCC_b38	SLC35E2	-2.69	0.00817	-0.077123	30	0.028666	no	SLVRYG
chr1_2071051_C_CACCTGGGCGTGTGACCTGGGCGTGTG_b38	SLC35E2	-2.685	0.0083	-0.090681	3	0.033776	no	SLVRYG
chr1_1762287_A_G_b38	SLC35E2	-2.68	0.00841	-0.077694	30	0.028989	no	SLVRYG
chr1_1946013_C_T_b38	SLC35E2	-2.675	0.00854	-0.070703	32	0.026433	no	SLVRYG
chr1_1946058_T_C_b38	SLC35E2	-2.675	0.00854	-0.070703	32	0.026433	no	SLVRYG
chr1_1940973_C_T_b38	SLC35E2	-2.668	0.0087	-0.066733	29	0.025013	no	SLVRYG
chr1_1751981_A_T_b38	SLC35E2	-2.667	0.00873	-0.082179	13	0.030814	no	SLVRYG
chr1_1944216_C_T_b38	SLC35E2	-2.658	0.00896	-0.071474	31	0.026894	no	SLVRYG
chr1_1755713_G_A_b38	SLC35E2	-2.655	0.00903	-0.077166	25	0.029067	no	SLVRYG
chr1_1075707_CG_C_b38	SLC35E2	-2.652	0.00911	-0.065151	36	0.024571	no	SLVRYG
chr1_1769969_CAAAACAAAAACA_C_b38	SLC35E2	-2.646	0.00925	-0.075836	30	0.028657	no	SLVRYG
chr1_1914634_G_T_b38	SLC35E2	-2.636	0.00953	-0.068225	27	0.025887	no	SLVRYG
chr1_1916417_G_T_b38	SLC35E2	-2.636	0.00953	-0.068225	27	0.025887	no	SLVRYG
chr1_1916670_G_C_b38	SLC35E2	-2.636	0.00953	-0.068225	27	0.025887	no	SLVRYG
chr1_1836126_C_A_b38	SLC35E2	-2.625	0.00981	-0.06937	32	0.026425	no	SLVRYG
chr1_1926870_T_C_b38	SLC35E2	-2.624	0.00983	-0.068843	24	0.026233	no	SLVRYG
chr1_1725582_T_C_b38	SLC35E2	2.619	0.00998	0.05965	39	0.022777	no	SLVRYG
chr1_1677720_T_G_b38	SLC35E2	13.501	1.06e-36	0.114053	171	0.008448	yes	MSCLSK
chr1_1674868_G_A_b38	SLC35E2	13.472	1.45e-36	0.113542	169	0.008428	yes	MSCLSK
chr1_1677726_A_T_b38	SLC35E2	13.47	1.48e-36	0.113884	171	0.008455	yes	MSCLSK
chr1_1674720_TGC_T_b38	SLC35E2	13.324	6.86e-36	0.113061	167	0.008486	yes	MSCLSK
chr1_1673818_A_C_b38	SLC35E2	13.25	1.48e-35	0.112568	170	0.008496	yes	MSCLSK
chr1_1676790_C_T_b38	SLC35E2	13.082	8.5e-35	0.109716	170	0.008387	yes	MSCLSK
chr1_1673060_G_A_b38	SLC35E2	12.939	3.75e-34	0.111586	167	0.008624	yes	MSCLSK
chr1_1671995_G_T_b38	SLC35E2	12.872	7.45e-34	0.109551	168	0.008511	yes	MSCLSK
chr1_1671797_G_A_b38	SLC35E2	12.063	2.57e-30	0.106093	162	0.008795	yes	MSCLSK
chr1_1673968_GA_G_b38	SLC35E2	10.917	1.52e-25	0.11296	75	0.010347	yes	MSCLSK
chr1_1661562_G_C_b38	SLC35E2	9.996	6.03e-22	0.083854	168	0.008389	yes	MSCLSK
chr1_1658422_T_C_b38	SLC35E2	9.908	1.29e-21	0.117289	33	0.011838	yes	MSCLSK
chr1_1651653_C_T_b38	SLC35E2	9.754	4.88e-21	0.08989	165	0.009216	yes	MSCLSK
chr1_1648736_G_A_b38	SLC35E2	9.596	1.87e-20	0.089845	148	0.009362	yes	MSCLSK
chr1_1649932_C_T_b38	SLC35E2	9.303	2.17e-19	0.086691	148	0.009318	yes	MSCLSK
chr1_1670423_AT_A_b38	SLC35E2	8.938	4.29e-18	0.096477	90	0.010795	yes	MSCLSK
chr1_1636278_G_T_b38	SLC35E2	8.492	1.44e-16	0.083086	130	0.009784	yes	MSCLSK
chr1_1649976_G_A_b38	SLC35E2	8.485	1.51e-16	0.081805	121	0.009641	yes	MSCLSK
chr1_1739131_T_C_b38	SLC35E2	8.219	1.16e-15	0.075976	132	0.009244	yes	MSCLSK
chr1_1674633_C_CA_b38	SLC35E2	8.029	4.79e-15	0.08057	84	0.010035	yes	MSCLSK
chr1_1654662_CT_C_b38	SLC35E2	7.736	4.06e-14	0.081058	111	0.010478	yes	MSCLSK
chr1_1675132_A_G_b38	SLC35E2	7.542	1.61e-13	0.079201	92	0.010501	yes	MSCLSK
chr1_1675228_C_CG_b38	SLC35E2	7.535	1.69e-13	0.077779	108	0.010323	yes	MSCLSK
chr1_1667424_T_TAAAATA_b38	SLC35E2	7.256	1.17e-12	0.072503	97	0.009992	yes	MSCLSK
chr1_1676287_C_T_b38	SLC35E2	-7.219	1.5e-12	-0.0903	19	0.012508	yes	MSCLSK
chr1_1650000_G_A_b38	SLC35E2	7.099	3.37e-12	0.069952	97	0.009854	yes	MSCLSK
chr1_1675091_A_G_b38	SLC35E2	-6.939	9.74e-12	-0.076977	44	0.011093	yes	MSCLSK
chr1_1667948_A_G_b38	SLC35E2	-6.932	1.02e-11	-0.079989	38	0.011539	yes	MSCLSK
chr1_1723766_C_T_b38	SLC35E2	-6.895	1.3e-11	-0.09181	33	0.013316	yes	MSCLSK
chr1_1660683_C_T_b38	SLC35E2	-6.884	1.4e-11	-0.075715	50	0.010999	yes	MSCLSK
chr1_1708521_C_G_b38	SLC35E2	-6.873	1.5e-11	-0.075902	50	0.011044	yes	MSCLSK
chr1_1668542_C_T_b38	SLC35E2	-6.786	2.64e-11	-0.079476	34	0.011711	yes	MSCLSK
chr1_1762759_A_AAATG_b38	SLC35E2	-6.762	3.09e-11	-0.118494	3	0.017523	yes	MSCLSK
chr1_1668717_C_G_b38	SLC35E2	-6.723	3.98e-11	-0.077674	38	0.011554	yes	MSCLSK
chr1_1672155_G_A_b38	SLC35E2	-6.69	4.89e-11	-0.072827	59	0.010885	yes	MSCLSK
chr1_1659114_A_G_b38	SLC35E2	-6.659	5.96e-11	-0.068142	74	0.010233	yes	MSCLSK
chr1_1659220_A_G_b38	SLC35E2	-6.659	5.96e-11	-0.068142	74	0.010233	yes	MSCLSK
chr1_1661420_C_A_b38	SLC35E2	-6.653	6.2e-11	-0.068054	74	0.010229	yes	MSCLSK
chr1_1664865_A_G_b38	SLC35E2	-6.648	6.42e-11	-0.068298	70	0.010274	yes	MSCLSK
chr1_1669613_G_A_b38	SLC35E2	-6.638	6.82e-11	-0.076348	39	0.011501	yes	MSCLSK
chr1_1650195_A_G_b38	SLC35E2	-6.633	7.06e-11	-0.068653	74	0.010351	yes	MSCLSK
chr1_1661177_A_G_b38	SLC35E2	-6.586	9.47e-11	-0.075394	39	0.011447	yes	MSCLSK
chr1_1729859_A_G_b38	SLC35E2	6.547	1.21e-10	0.079643	26	0.012165	yes	MSCLSK
chr1_1665061_C_T_b38	SLC35E2	-6.482	1.82e-10	-0.074524	39	0.011498	yes	MSCLSK
chr1_1728671_C_A_b38	SLC35E2	6.46	2.08e-10	0.080564	31	0.01247	yes	MSCLSK
chr1_1658866_G_A_b38	SLC35E2	-6.456	2.14e-10	-0.065975	75	0.010219	yes	MSCLSK
chr1_1658830_C_G_b38	SLC35E2	-6.443	2.31e-10	-0.072696	40	0.011283	yes	MSCLSK
chr1_1669576_G_A_b38	SLC35E2	-6.433	2.47e-10	-0.074423	38	0.011569	yes	MSCLSK
chr1_1668108_C_T_b38	SLC35E2	6.418	2.7e-10	0.066457	70	0.010354	yes	MSCLSK
chr1_1671097_G_C_b38	SLC35E2	6.392	3.18e-10	0.064628	79	0.010111	yes	MSCLSK
chr1_1671148_C_T_b38	SLC35E2	6.239	8.04e-10	0.063367	77	0.010156	yes	MSCLSK
chr1_1667424_T_TAAATA_b38	SLC35E2	-6.201	1.01e-09	-0.059899	121	0.00966	yes	MSCLSK
chr1_1659060_G_A_b38	SLC35E2	-6.173	1.19e-09	-0.066122	57	0.010711	yes	MSCLSK
chr1_1729373_A_G_b38	SLC35E2	6.141	1.45e-09	0.06954	60	0.011324	yes	MSCLSK
chr1_1664757_T_C_b38	SLC35E2	-6.138	1.47e-09	-0.062662	69	0.010208	yes	MSCLSK
chr1_1660408_T_C_b38	SLC35E2	-6.123	1.61e-09	-0.076957	16	0.012568	yes	MSCLSK
chr1_1665581_C_G_b38	SLC35E2	-6.122	1.62e-09	-0.068363	44	0.011167	yes	MSCLSK
chr1_1668721_C_T_b38	SLC35E2	-6.105	1.79e-09	-0.066361	52	0.01087	yes	MSCLSK
chr1_1677707_C_T_b38	SLC35E2	-6.092	1.93e-09	-0.08276	20	0.013585	yes	MSCLSK
chr1_1648826_A_G_b38	SLC35E2	-6.09	1.96e-09	-0.062679	82	0.010292	yes	MSCLSK
chr1_1868925_C_T_b38	SLC35E2	-6.085	2.01e-09	-0.107742	3	0.017706	yes	MSCLSK
chr1_1729539_C_A_b38	SLC35E2	6.014	3.05e-09	0.068256	62	0.011349	yes	MSCLSK
chr1_1653934_G_A_b38	SLC35E2	-5.999	3.34e-09	-0.06215	70	0.01036	yes	MSCLSK
chr1_1651137_C_T_b38	SLC35E2	-5.986	3.6e-09	-0.062022	70	0.010361	yes	MSCLSK
chr1_1651267_T_C_b38	SLC35E2	-5.986	3.6e-09	-0.062022	70	0.010361	yes	MSCLSK
chr1_1651785_C_A_b38	SLC35E2	-5.986	3.6e-09	-0.062022	70	0.010361	yes	MSCLSK
chr1_1652061_T_C_b38	SLC35E2	-5.986	3.6e-09	-0.062022	70	0.010361	yes	MSCLSK
chr1_1652135_C_G_b38	SLC35E2	-5.986	3.6e-09	-0.062022	70	0.010361	yes	MSCLSK
chr1_1652191_C_T_b38	SLC35E2	-5.986	3.6e-09	-0.062022	70	0.010361	yes	MSCLSK
chr1_1652592_A_G_b38	SLC35E2	-5.986	3.6e-09	-0.062022	70	0.010361	yes	MSCLSK
chr1_1652779_A_G_b38	SLC35E2	-5.986	3.6e-09	-0.062022	70	0.010361	yes	MSCLSK
chr1_1653147_A_C_b38	SLC35E2	-5.986	3.6e-09	-0.062022	70	0.010361	yes	MSCLSK
chr1_1653396_T_C_b38	SLC35E2	-5.986	3.6e-09	-0.062022	70	0.010361	yes	MSCLSK
chr1_1653472_T_C_b38	SLC35E2	-5.986	3.6e-09	-0.062022	70	0.010361	yes	MSCLSK
chr1_1653811_G_A_b38	SLC35E2	-5.986	3.6e-09	-0.062022	70	0.010361	yes	MSCLSK
chr1_1653893_C_T_b38	SLC35E2	-5.986	3.6e-09	-0.062022	70	0.010361	yes	MSCLSK
chr1_1654143_G_A_b38	SLC35E2	-5.986	3.6e-09	-0.062022	70	0.010361	yes	MSCLSK
chr1_1654188_T_G_b38	SLC35E2	-5.986	3.6e-09	-0.062022	70	0.010361	yes	MSCLSK
chr1_1639348_G_T_b38	SLC35E2	-5.955	4.31e-09	-0.059836	86	0.010048	yes	MSCLSK
chr1_1613769_C_T_b38	SLC35E2	5.953	4.35e-09	0.062168	79	0.010443	yes	MSCLSK
chr1_1649993_A_G_b38	SLC35E2	-5.936	4.8e-09	-0.05637	172	0.009496	yes	MSCLSK
chr1_1651574_G_A_b38	SLC35E2	-5.913	5.48e-09	-0.06129	70	0.010365	yes	MSCLSK
chr1_1650777_G_A_b38	SLC35E2	-5.886	6.41e-09	-0.06084	70	0.010336	yes	MSCLSK
chr1_1708474_C_A_b38	SLC35E2	-5.876	6.79e-09	-0.074301	23	0.012645	yes	MSCLSK
chr1_1648636_G_A_b38	SLC35E2	-5.874	6.85e-09	-0.060765	82	0.010344	yes	MSCLSK
chr1_1651421_GTAGCCCCTCTGAACGGTCTGTGACACACGCATGCTTTCAGCTAGAGTACTCTA_G_b38	SLC35E2	-5.873	6.89e-09	-0.061212	68	0.010422	yes	MSCLSK
chr1_1651926_T_C_b38	SLC35E2	-5.845	8.09e-09	-0.060704	70	0.010385	yes	MSCLSK
chr1_1689421_G_A_b38	SLC35E2	5.839	8.37e-09	0.058731	98	0.010058	yes	MSCLSK
chr1_1722626_AGCG_A_b38	SLC35E2	5.835	8.57e-09	0.070892	57	0.012149	yes	MSCLSK
chr1_1689446_T_C_b38	SLC35E2	5.832	8.71e-09	0.059064	97	0.010127	yes	MSCLSK
chr1_1722625_A_T_b38	SLC35E2	5.789	1.11e-08	0.070458	57	0.012171	yes	MSCLSK
chr1_1671724_C_T_b38	SLC35E2	-5.787	1.13e-08	-0.064684	49	0.011178	yes	MSCLSK
chr1_1679100_A_G_b38	SLC35E2	-5.773	1.22e-08	-0.057123	119	0.009896	yes	MSCLSK
chr1_1738207_ACT_A_b38	SLC35E2	5.723	1.61e-08	0.062826	78	0.010977	yes	MSCLSK
chr1_1639685_G_A_b38	SLC35E2	-5.679	2.06e-08	-0.064541	41	0.011364	yes	MSCLSK
chr1_1659940_A_C_b38	SLC35E2	-5.65	2.43e-08	-0.074484	17	0.013184	yes	MSCLSK
chr1_1653863_C_A_b38	SLC35E2	-5.593	3.31e-08	-0.07173	19	0.012824	yes	MSCLSK
chr1_1722619_C_T_b38	SLC35E2	5.552	4.15e-08	0.066715	61	0.012016	yes	MSCLSK
chr1_1630798_C_T_b38	SLC35E2	5.516	5.04e-08	0.056684	81	0.010276	yes	MSCLSK
chr1_1637577_T_C_b38	SLC35E2	-5.498	5.56e-08	-0.059434	48	0.01081	yes	MSCLSK
chr1_1650383_G_T_b38	SLC35E2	-5.488	5.86e-08	-0.06081	55	0.01108	yes	MSCLSK
chr1_1629332_G_T_b38	SLC35E2	5.488	5.87e-08	0.056439	86	0.010283	yes	MSCLSK
chr1_1652913_C_T_b38	SLC35E2	-5.487	5.92e-08	-0.05969	54	0.010879	yes	MSCLSK
chr1_1641275_A_G_b38	SLC35E2	-5.359	1.17e-07	-0.056049	82	0.010459	yes	MSCLSK
chr1_1600320_C_G_b38	SLC35E2	5.324	1.41e-07	0.053617	81	0.01007	yes	MSCLSK
chr1_1586962_C_T_b38	SLC35E2	5.274	1.83e-07	0.054677	91	0.010367	yes	MSCLSK
chr1_1649846_G_A_b38	SLC35E2	-5.264	1.93e-07	-0.059826	37	0.011366	yes	MSCLSK
chr1_1600379_C_T_b38	SLC35E2	5.241	2.18e-07	0.052646	84	0.010045	yes	MSCLSK
chr1_1621352_G_A_b38	SLC35E2	5.237	2.23e-07	0.052605	91	0.010046	yes	MSCLSK
chr1_1644361_C_T_b38	SLC35E2	5.22	2.43e-07	0.071142	4	0.013629	yes	MSCLSK
chr1_1589495_CTTT_C_b38	SLC35E2	5.153	3.43e-07	0.05672	63	0.011008	yes	MSCLSK
chr1_1641261_C_T_b38	SLC35E2	-5.145	3.57e-07	-0.062289	33	0.012107	yes	MSCLSK
chr1_1638879_C_T_b38	SLC35E2	-5.107	4.34e-07	-0.056866	46	0.011136	yes	MSCLSK
chr1_1609058_G_A_b38	SLC35E2	5.101	4.46e-07	0.051632	83	0.010122	yes	MSCLSK
chr1_1650664_CT_C_b38	SLC35E2	5.099	4.52e-07	0.058362	63	0.011446	yes	MSCLSK
chr1_1607931_G_A_b38	SLC35E2	5.081	4.94e-07	0.051587	82	0.010153	yes	MSCLSK
chr1_1691377_C_T_b38	SLC35E2	-5.078	5.02e-07	-0.055267	72	0.010884	yes	MSCLSK
chr1_1704605_G_A_b38	SLC35E2	-5.063	5.42e-07	-0.051104	105	0.010094	yes	MSCLSK
chr1_1708362_T_C_b38	SLC35E2	-5.025	6.56e-07	-0.05278	88	0.010504	yes	MSCLSK
chr1_1606384_A_G_b38	SLC35E2	5.018	6.79e-07	0.049412	98	0.009847	yes	MSCLSK
chr1_1591703_T_C_b38	SLC35E2	4.963	8.92e-07	0.04821	142	0.009713	yes	MSCLSK
chr1_1704180_T_C_b38	SLC35E2	-4.944	9.79e-07	-0.050021	104	0.010117	yes	MSCLSK
chr1_1716489_A_G_b38	SLC35E2	4.924	1.08e-06	0.04965	101	0.010084	yes	MSCLSK
chr1_1728948_T_C_b38	SLC35E2	4.909	1.17e-06	0.053286	62	0.010856	yes	MSCLSK
chr1_1943487_C_G_b38	SLC35E2	4.884	1.32e-06	0.059027	34	0.012086	yes	MSCLSK
chr1_1650664_CTTTTT_C_b38	SLC35E2	-4.876	1.37e-06	-0.057477	37	0.011789	yes	MSCLSK
chr1_1717376_CTAACACCCG_C_b38	SLC35E2	4.865	1.45e-06	0.049292	99	0.010132	yes	MSCLSK
chr1_1697467_G_A_b38	SLC35E2	-4.826	1.75e-06	-0.04835	107	0.010019	yes	MSCLSK
chr1_1689465_A_G_b38	SLC35E2	4.784	2.14e-06	0.047023	117	0.00983	yes	MSCLSK
chr1_1722690_TA_T_b38	SLC35E2	-4.766	2.33e-06	-0.075367	5	0.015813	yes	MSCLSK
chr1_1661169_C_A_b38	SLC35E2	4.741	2.63e-06	0.052185	53	0.011008	yes	MSCLSK
chr1_1713751_T_C_b38	SLC35E2	4.734	2.71e-06	0.046501	103	0.009822	yes	MSCLSK
chr1_1619986_T_C_b38	SLC35E2	4.732	2.74e-06	0.052469	57	0.011088	yes	MSCLSK
chr1_1650688_T_A_b38	SLC35E2	-4.73	2.76e-06	-0.052045	55	0.011002	yes	MSCLSK
chr1_1606532_GTGGGCTGGGCTGGTCAGGCA_G_b38	SLC35E2	4.659	3.88e-06	0.048015	75	0.010307	yes	MSCLSK
chr1_1694167_G_A_b38	SLC35E2	-4.633	4.38e-06	-0.045484	119	0.009818	yes	MSCLSK
chr1_1694109_A_ACG_b38	SLC35E2	-4.602	5.05e-06	-0.04535	129	0.009854	yes	MSCLSK
chr1_1650370_C_CT_b38	SLC35E2	-4.468	9.36e-06	-0.056196	33	0.012578	yes	MSCLSK
chr1_1715745_G_A_b38	SLC35E2	4.448	1.02e-05	0.045374	99	0.010201	yes	MSCLSK
chr1_1653319_A_G_b38	SLC35E2	4.346	1.62e-05	0.04775	53	0.010988	yes	MSCLSK
chr1_1696366_A_C_b38	SLC35E2	-4.289	2.07e-05	-0.041776	122	0.009739	yes	MSCLSK
chr1_1736832_GAAAA_G_b38	SLC35E2	4.233	2.65e-05	0.043508	101	0.010279	yes	MSCLSK
chr1_1690308_AT_A_b38	SLC35E2	-4.174	3.4e-05	-0.039208	161	0.009392	yes	MSCLSK
chr1_1696117_G_A_b38	SLC35E2	-4.016	6.61e-05	-0.0392	123	0.00976	yes	MSCLSK
chr1_1606507_GTGGGC_G_b38	SLC35E2	3.99	7.38e-05	0.039186	175	0.009821	yes	MSCLSK
chr1_1615869_C_T_b38	SLC35E2	3.899	0.000107	0.041609	75	0.010672	yes	MSCLSK
chr1_1614340_C_T_b38	SLC35E2	3.873	0.000118	0.057427	11	0.014826	yes	MSCLSK
chr1_1624723_C_T_b38	SLC35E2	-3.848	0.000131	-0.049742	19	0.012927	yes	MSCLSK
chr1_1617375_T_C_b38	SLC35E2	3.723	0.000215	0.03985	74	0.010704	yes	MSCLSK
chr1_1618213_C_G_b38	SLC35E2	3.723	0.000215	0.03985	74	0.010704	yes	MSCLSK
chr1_1618290_G_C_b38	SLC35E2	3.723	0.000215	0.03985	74	0.010704	yes	MSCLSK
chr1_1657926_A_AG_b38	SLC35E2	-3.72	0.000217	-0.04782	27	0.012854	yes	MSCLSK
chr1_1668373_C_T_b38	SLC35E2	3.694	0.00024	0.043906	73	0.011885	yes	MSCLSK
chr1_1681370_T_G_b38	SLC35E2	3.685	0.000248	0.050545	21	0.013717	yes	MSCLSK
chr1_1634663_C_G_b38	SLC35E2	-3.669	0.000264	-0.057048	33	0.015548	yes	MSCLSK
chr1_1649954_C_CA_b38	SLC35E2	-3.666	0.000267	-0.047658	27	0.013001	yes	MSCLSK
chr1_1613421_T_C_b38	SLC35E2	3.665	0.000268	0.039391	72	0.010747	yes	MSCLSK
chr1_1615322_A_G_b38	SLC35E2	3.648	0.000285	0.039314	71	0.010776	yes	MSCLSK
chr1_1613322_T_C_b38	SLC35E2	3.641	0.000294	0.038876	74	0.010677	yes	MSCLSK
chr1_1616547_T_C_b38	SLC35E2	3.595	0.000349	0.038769	70	0.010783	yes	MSCLSK
chr1_1722599_G_A_b38	SLC35E2	3.558	0.000401	0.040738	83	0.011449	yes	MSCLSK
chr1_1691121_A_G_b38	SLC35E2	-3.55	0.000413	-0.048984	22	0.013797	yes	MSCLSK
chr1_1590792_C_T_b38	SLC35E2	-3.512	0.000476	-0.055799	9	0.015887	yes	MSCLSK
chr1_1739519_C_G_b38	SLC35E2	3.5	0.000498	0.041109	56	0.011745	yes	MSCLSK
chr1_1005904_C_T_b38	SLC35E2	3.482	0.000532	0.03457	107	0.009929	yes	MSCLSK
chr1_1005954_G_A_b38	SLC35E2	3.482	0.000532	0.03457	107	0.009929	yes	MSCLSK
chr1_1005429_C_CA_b38	SLC35E2	3.48	0.000536	0.034475	108	0.009907	yes	MSCLSK
chr1_1839692_C_CA_b38	SLC35E2	3.474	0.000548	0.058655	5	0.016886	yes	MSCLSK
chr1_1585717_C_A_b38	SLC35E2	-3.469	0.000558	-0.054559	10	0.015729	yes	MSCLSK
chr1_1590785_G_A_b38	SLC35E2	-3.456	0.000585	-0.053177	10	0.015387	yes	MSCLSK
chr1_1635226_T_C_b38	SLC35E2	-3.433	0.000635	-0.046528	16	0.013552	yes	MSCLSK
chr1_1897682_C_CA_b38	SLC35E2	3.423	0.000659	0.055615	6	0.016247	yes	MSCLSK
chr1_2572136_C_CTT_b38	SLC35E2	-3.422	0.000661	-0.036046	107	0.010533	yes	MSCLSK
chr1_995371_C_G_b38	SLC35E2	3.422	0.000662	0.03419	106	0.009992	yes	MSCLSK
chr1_995982_G_A_b38	SLC35E2	3.419	0.000669	0.034188	108	0.009999	yes	MSCLSK
chr1_1015925_A_ATT_b38	SLC35E2	3.405	0.000704	0.035251	85	0.010354	yes	MSCLSK
chr1_1761550_G_A_b38	SLC35E2	3.401	0.000714	0.058596	6	0.01723	yes	MSCLSK
chr1_1627057_C_G_b38	SLC35E2	-3.388	0.000747	-0.03928	60	0.011594	yes	MSCLSK
chr1_1601796_A_C_b38	SLC35E2	3.375	0.000782	0.03574	90	0.010589	yes	MSCLSK
chr1_1604202_G_A_b38	SLC35E2	3.35	0.000856	0.035627	88	0.010635	yes	MSCLSK
chr1_1591419_A_G_b38	SLC35E2	3.337	0.000896	0.043381	21	0.013	yes	MSCLSK
chr1_1735008_G_GTTTT_b38	SLC35E2	-3.321	0.00095	-0.031449	189	0.009471	yes	MSCLSK
chr1_986280_C_T_b38	SLC35E2	3.294	0.00104	0.040667	28	0.012346	yes	MSCLSK
chr1_1594570_A_G_b38	SLC35E2	3.286	0.00107	0.03469	80	0.010558	yes	MSCLSK
chr1_1009184_T_C_b38	SLC35E2	3.284	0.00108	0.032613	111	0.009932	yes	MSCLSK
chr1_1008307_G_C_b38	SLC35E2	3.271	0.00113	0.032322	112	0.00988	yes	MSCLSK
chr1_1004625_A_G_b38	SLC35E2	3.264	0.00116	0.03235	119	0.009911	yes	MSCLSK
chr1_2568020_T_C_b38	SLC35E2	-3.248	0.00122	-0.031991	174	0.009849	yes	MSCLSK
chr1_1984300_C_CT_b38	SLC35E2	-3.246	0.00123	-0.063993	4	0.019716	yes	MSCLSK
chr1_919397_A_G_b38	SLC35E2	-3.243	0.00125	-0.032677	99	0.010077	yes	MSCLSK
chr1_1780989_A_C_b38	SLC35E2	3.242	0.00125	0.055413	6	0.01709	yes	MSCLSK
chr1_1726053_G_C_b38	SLC35E2	3.234	0.00128	0.047832	25	0.014791	yes	MSCLSK
chr1_1729998_T_TGGGA_b38	SLC35E2	3.23	0.0013	0.035737	61	0.011063	yes	MSCLSK
chr1_1606559_C_CGGCTGGTCAGGCGTGGGGCG_b38	SLC35E2	-3.215	0.00137	-0.038097	41	0.01185	yes	MSCLSK
chr1_2619655_CA_C_b38	SLC35E2	3.201	0.00144	0.03574	70	0.011166	yes	MSCLSK
chr1_1704310_C_A_b38	SLC35E2	-3.192	0.00148	-0.030739	160	0.00963	yes	MSCLSK
chr1_1701564_CG_C_b38	SLC35E2	-3.186	0.00151	-0.03089	100	0.009696	yes	MSCLSK
chr1_1743570_T_A_b38	SLC35E2	3.17	0.0016	0.056248	13	0.017741	yes	MSCLSK
chr1_920719_T_G_b38	SLC35E2	3.169	0.0016	0.032016	100	0.010103	yes	MSCLSK
chr1_920728_A_G_b38	SLC35E2	3.169	0.0016	0.032016	100	0.010103	yes	MSCLSK
chr1_1806456_G_A_b38	SLC35E2	3.155	0.00168	0.053508	6	0.016961	yes	MSCLSK
chr1_1806461_C_T_b38	SLC35E2	3.155	0.00168	0.053508	6	0.016961	yes	MSCLSK
chr1_1641642_T_C_b38	SLC35E2	-3.152	0.0017	-0.035515	70	0.011267	yes	MSCLSK
chr1_1657081_C_T_b38	SLC35E2	-3.151	0.0017	-0.037291	51	0.011833	yes	MSCLSK
chr1_1725697_T_C_b38	SLC35E2	3.14	0.00177	0.037795	63	0.012037	yes	MSCLSK
chr1_1714674_G_C_b38	SLC35E2	3.14	0.00177	0.044507	48	0.014176	yes	MSCLSK
chr1_1006159_C_T_b38	SLC35E2	3.133	0.00181	0.030993	121	0.009891	yes	MSCLSK
chr1_1716919_CTT_C_b38	SLC35E2	3.131	0.00182	0.03456	71	0.01104	yes	MSCLSK
chr1_1989803_A_G_b38	SLC35E2	-3.129	0.00184	-0.034225	82	0.01094	yes	MSCLSK
chr1_995187_A_G_b38	SLC35E2	3.127	0.00185	0.031411	118	0.010047	yes	MSCLSK
chr1_2570571_T_C_b38	SLC35E2	-3.124	0.00186	-0.03109	171	0.009951	yes	MSCLSK
chr1_2579841_C_T_b38	SLC35E2	-3.121	0.00188	-0.03126	169	0.010016	yes	MSCLSK
chr1_995153_C_G_b38	SLC35E2	3.11	0.00195	0.03127	117	0.010054	yes	MSCLSK
chr1_2581013_G_A_b38	SLC35E2	-3.1	0.00202	-0.031176	167	0.010055	yes	MSCLSK
chr1_2581616_A_T_b38	SLC35E2	-3.1	0.00202	-0.031176	167	0.010055	yes	MSCLSK
chr1_2582193_C_G_b38	SLC35E2	-3.1	0.00202	-0.031176	167	0.010055	yes	MSCLSK
chr1_2334639_T_C_b38	SLC35E2	-3.082	0.00214	-0.030952	185	0.010042	yes	MSCLSK
chr1_919695_C_G_b38	SLC35E2	-3.075	0.00219	-0.031077	100	0.010106	yes	MSCLSK
chr1_1657085_C_CTAA_b38	SLC35E2	-3.075	0.0022	-0.036887	51	0.011997	yes	MSCLSK
chr1_986629_G_A_b38	SLC35E2	3.07	0.00223	0.038078	28	0.012403	yes	MSCLSK
chr1_1847293_A_ACAACAAAATCCCTTTTT_b38	SLC35E2	3.07	0.00223	0.052166	6	0.016993	yes	MSCLSK
chr1_1856365_C_G_b38	SLC35E2	3.07	0.00223	0.052166	6	0.016993	yes	MSCLSK
chr1_2563346_G_A_b38	SLC35E2	-3.069	0.00224	-0.03065	167	0.009988	yes	MSCLSK
chr1_1585372_T_A_b38	SLC35E2	-3.055	0.00234	-0.046182	11	0.015116	yes	MSCLSK
chr1_1319750_G_A_b38	SLC35E2	-3.052	0.00237	-0.084021	10	0.027534	yes	MSCLSK
chr1_2568341_G_A_b38	SLC35E2	-3.017	0.00265	-0.030295	167	0.01004	yes	MSCLSK
chr1_2106495_A_G_b38	SLC35E2	-3.015	0.00267	-0.047469	16	0.015744	yes	MSCLSK
chr1_1765746_G_T_b38	SLC35E2	3.015	0.00268	0.053175	5	0.017639	yes	MSCLSK
chr1_1714638_G_T_b38	SLC35E2	3.014	0.00268	0.043687	16	0.014494	yes	MSCLSK
chr1_2564775_C_T_b38	SLC35E2	-3.013	0.00269	-0.029849	171	0.009908	yes	MSCLSK
chr1_1714635_A_G_b38	SLC35E2	3.008	0.00273	0.042707	19	0.014197	yes	MSCLSK
chr1_1016184_A_G_b38	SLC35E2	3.002	0.00278	0.029961	113	0.009979	yes	MSCLSK
chr1_2566239_A_G_b38	SLC35E2	-2.982	0.00297	-0.029186	178	0.009787	yes	MSCLSK
chr1_2567423_G_C_b38	SLC35E2	-2.982	0.00297	-0.029186	178	0.009787	yes	MSCLSK
chr1_2571341_C_T_b38	SLC35E2	-2.982	0.00297	-0.029186	178	0.009787	yes	MSCLSK
chr1_2571395_A_G_b38	SLC35E2	-2.982	0.00297	-0.029186	178	0.009787	yes	MSCLSK
chr1_1524938_T_G_b38	SLC35E2	-2.979	0.003	-0.088387	3	0.029669	yes	MSCLSK
chr1_2566613_C_T_b38	SLC35E2	-2.971	0.00308	-0.029126	177	0.009803	yes	MSCLSK
chr1_2567179_G_T_b38	SLC35E2	-2.965	0.00314	-0.029847	166	0.010066	yes	MSCLSK
chr1_940296_GCC_G_b38	SLC35E2	-2.963	0.00316	-0.029335	120	0.009899	yes	MSCLSK
chr1_1016623_G_A_b38	SLC35E2	2.962	0.00317	0.030028	99	0.010137	yes	MSCLSK
chr1_2583136_C_T_b38	SLC35E2	-2.952	0.00328	-0.029767	166	0.010085	yes	MSCLSK
chr1_1014228_G_A_b38	SLC35E2	2.924	0.00358	0.029022	117	0.009924	yes	MSCLSK
chr1_1760401_G_A_b38	SLC35E2	2.924	0.00358	0.049301	6	0.016861	yes	MSCLSK
chr1_915400_C_T_b38	SLC35E2	-2.91	0.00374	-0.029336	129	0.01008	yes	MSCLSK
chr1_2575049_C_T_b38	SLC35E2	-2.909	0.00376	-0.029199	169	0.010039	yes	MSCLSK
chr1_1017114_A_AT_b38	SLC35E2	2.9	0.00386	0.030782	84	0.010615	yes	MSCLSK
chr1_1624323_AT_A_b38	SLC35E2	2.899	0.00387	0.029241	109	0.010086	yes	MSCLSK
chr1_1686882_T_C_b38	SLC35E2	2.898	0.00389	0.029054	140	0.010027	yes	MSCLSK
chr1_2566588_A_G_b38	SLC35E2	-2.895	0.00392	-0.029308	166	0.010124	yes	MSCLSK
chr1_917495_C_T_b38	SLC35E2	-2.874	0.00419	-0.029123	134	0.010134	yes	MSCLSK
chr1_1627515_C_T_b38	SLC35E2	2.873	0.0042	0.028418	139	0.00989	yes	MSCLSK
chr1_918574_C_A_b38	SLC35E2	-2.868	0.00427	-0.029115	133	0.010151	yes	MSCLSK
chr1_1613974_G_A_b38	SLC35E2	2.866	0.00429	0.031913	51	0.011134	yes	MSCLSK
chr1_2500892_C_A_b38	SLC35E2	2.865	0.00431	0.027584	135	0.009627	yes	MSCLSK
chr1_2565214_A_G_b38	SLC35E2	-2.865	0.00431	-0.029003	165	0.010123	yes	MSCLSK
chr1_1691417_T_C_b38	SLC35E2	-2.864	0.00432	-0.030975	126	0.010816	yes	MSCLSK
chr1_1631710_T_C_b38	SLC35E2	2.864	0.00432	0.042429	13	0.014816	yes	MSCLSK
chr1_2559459_C_A_b38	SLC35E2	-2.848	0.00453	-0.028499	170	0.010005	yes	MSCLSK
chr1_1739996_G_T_b38	SLC35E2	-2.843	0.00462	-0.082158	4	0.028902	yes	MSCLSK
chr1_919598_A_C_b38	SLC35E2	-2.842	0.00463	-0.028629	138	0.010073	yes	MSCLSK
chr1_1618982_G_A_b38	SLC35E2	2.821	0.00494	0.031357	52	0.011117	yes	MSCLSK
chr1_2566202_G_A_b38	SLC35E2	-2.82	0.00496	-0.02802	169	0.009937	yes	MSCLSK
chr1_1716710_G_T_b38	SLC35E2	-2.819	0.00496	-0.108661	3	0.038539	yes	MSCLSK
chr1_1323853_G_GA_b38	SLC35E2	-2.819	0.00497	-0.091462	5	0.03245	yes	MSCLSK
chr1_1891375_G_A_b38	SLC35E2	2.818	0.00498	0.047956	6	0.017016	yes	MSCLSK
chr1_1734308_T_C_b38	SLC35E2	2.812	0.00508	0.041396	25	0.014722	yes	MSCLSK
chr1_1422379_G_A_b38	SLC35E2	-2.794	0.00536	-0.079566	8	0.028475	yes	MSCLSK
chr1_1605629_G_A_b38	SLC35E2	2.792	0.0054	0.038964	6	0.013957	yes	MSCLSK
chr1_1721552_G_A_b38	SLC35E2	-2.788	0.00547	-0.095454	3	0.034243	yes	MSCLSK
chr1_1461687_CTGGAGGGAGAGGCTCCTCATGAGACCCCCATGTAGGGAT_C_b38	SLC35E2	2.778	0.00564	0.084991	3	0.030598	yes	MSCLSK
chr1_1625951_G_A_b38	SLC35E2	-2.776	0.00567	-0.028144	102	0.010139	yes	MSCLSK
chr1_2186506_G_C_b38	SLC35E2	2.774	0.00571	0.029249	94	0.010546	yes	MSCLSK
chr1_1014863_A_C_b38	SLC35E2	2.759	0.00596	0.027799	105	0.010074	yes	MSCLSK
chr1_914991_G_T_b38	SLC35E2	-2.757	0.006	-0.027759	129	0.010067	yes	MSCLSK
chr1_1587082_G_A_b38	SLC35E2	2.744	0.00625	0.040685	13	0.014829	yes	MSCLSK
chr1_2238792_C_T_b38	SLC35E2	2.735	0.00641	0.027154	126	0.009927	yes	MSCLSK
chr1_1306183_A_G_b38	SLC35E2	-2.733	0.00646	-0.080885	7	0.0296	yes	MSCLSK
chr1_1320653_C_T_b38	SLC35E2	-2.733	0.00646	-0.080885	7	0.0296	yes	MSCLSK
chr1_1523190_A_G_b38	SLC35E2	-2.729	0.00652	-0.076955	6	0.028196	yes	MSCLSK
chr1_2268951_C_A_b38	SLC35E2	2.723	0.00664	0.026844	131	0.009858	yes	MSCLSK
chr1_2559503_C_A_b38	SLC35E2	-2.721	0.00668	-0.026908	179	0.009888	yes	MSCLSK
chr1_1022518_G_T_b38	SLC35E2	2.718	0.00675	0.027651	87	0.010174	yes	MSCLSK
chr1_2557491_G_A_b38	SLC35E2	-2.716	0.00678	-0.027091	174	0.009973	yes	MSCLSK
chr1_1022868_A_G_b38	SLC35E2	2.712	0.00688	0.027957	93	0.010311	yes	MSCLSK
chr1_1609909_G_T_b38	SLC35E2	2.711	0.0069	0.030094	56	0.011102	yes	MSCLSK
chr1_2556327_T_C_b38	SLC35E2	-2.703	0.00706	-0.026726	175	0.009887	yes	MSCLSK
chr1_1024462_C_T_b38	SLC35E2	2.701	0.0071	0.029282	71	0.010842	yes	MSCLSK
chr1_998741_G_A_b38	SLC35E2	2.701	0.00711	0.033024	31	0.012228	yes	MSCLSK
chr1_1297051_CCA_C_b38	SLC35E2	-2.7	0.00712	-0.080006	7	0.02963	yes	MSCLSK
chr1_1874419_G_C_b38	SLC35E2	2.7	0.00712	0.045148	5	0.016722	yes	MSCLSK
chr1_1000335_C_T_b38	SLC35E2	2.699	0.00713	0.03288	31	0.012181	yes	MSCLSK
chr1_988598_A_AG_b38	SLC35E2	2.699	0.00713	0.037075	20	0.013735	yes	MSCLSK
chr1_992361_G_A_b38	SLC35E2	2.68	0.00755	0.032976	29	0.012303	yes	MSCLSK
chr1_1603989_T_C_b38	SLC35E2	2.679	0.00758	0.029619	57	0.011058	yes	MSCLSK
chr1_1608244_T_C_b38	SLC35E2	2.676	0.00764	0.029779	51	0.011127	yes	MSCLSK
chr1_1422280_A_G_b38	SLC35E2	-2.66	0.00802	-0.074131	9	0.027873	yes	MSCLSK
chr1_2186900_A_G_b38	SLC35E2	2.65	0.00825	0.027204	104	0.010266	yes	MSCLSK
chr1_2186920_A_G_b38	SLC35E2	2.65	0.00825	0.027204	104	0.010266	yes	MSCLSK
chr1_2244722_C_T_b38	SLC35E2	2.644	0.00839	0.025962	131	0.009818	yes	MSCLSK
chr1_1634406_C_CG_b38	SLC35E2	-2.644	0.0084	-0.041075	19	0.015536	yes	MSCLSK
chr1_1377480_C_CA_b38	SLC35E2	-2.639	0.00853	-0.057369	3	0.021742	yes	MSCLSK
chr1_2559766_C_T_b38	SLC35E2	-2.639	0.00853	-0.026489	170	0.010039	yes	MSCLSK
chr1_2143629_G_C_b38	SLC35E2	2.636	0.00859	0.027155	104	0.010301	yes	MSCLSK
chr1_2153159_T_C_b38	SLC35E2	2.636	0.00859	0.027155	104	0.010301	yes	MSCLSK
chr1_1679041_C_G_b38	SLC35E2	-2.636	0.0086	-0.049247	5	0.018684	yes	MSCLSK
chr1_2249085_G_A_b38	SLC35E2	2.635	0.00861	0.025894	133	0.009825	yes	MSCLSK
chr1_2581271_T_C_b38	SLC35E2	-2.634	0.00863	-0.026501	181	0.01006	yes	MSCLSK
chr1_1340811_GCACACACCTGCA_G_b38	SLC35E2	-2.619	0.00902	-0.068859	5	0.02629	yes	MSCLSK
chr1_2499618_C_T_b38	SLC35E2	-2.617	0.00909	-0.03031	58	0.011584	yes	MSCLSK
chr1_2244599_C_T_b38	SLC35E2	2.613	0.00919	0.025699	130	0.009835	yes	MSCLSK
chr1_996168_G_T_b38	SLC35E2	2.604	0.00942	0.031616	31	0.01214	yes	MSCLSK
chr1_1811084_T_A_b38	SLC35E2	2.6	0.00955	0.027123	144	0.010433	yes	MSCLSK
chr1_2158656_T_G_b38	SLC35E2	2.598	0.0096	0.026803	103	0.010318	yes	MSCLSK
chr1_2576499_A_G_b38	SLC35E2	-2.589	0.00984	-0.02517	177	0.009721	yes	MSCLSK
chr1_1357246_C_T_b38	SLC35E2	-2.586	0.00992	-0.069099	14	0.026716	yes	MSCLSK
chr1_997077_G_A_b38	SLC35E2	2.586	0.00993	0.031446	31	0.01216	yes	MSCLSK
chr1_2582213_AAAAC_A_b38	SLC35E2	-2.585	0.00995	-0.02591	181	0.010022	yes	MSCLSK
chr1_1586987_G_A_b38	SLC35E2	-2.585	0.00996	-0.027939	82	0.010809	yes	MSCLSK
chr1_1660318_C_T_b38	SLC35E2	8.71	2.63e-17	0.128232	5	0.014723	no	MSCLSK
chr1_1646352_A_C_b38	SLC35E2	7.662	6.86e-14	0.105564	12	0.013777	no	MSCLSK
chr1_1728604_T_A_b38	SLC35E2	5.846	8.05e-09	0.066672	62	0.011404	no	MSCLSK
chr1_1658115_G_A_b38	SLC35E2	-5.839	8.37e-09	-0.127829	3	0.021891	no	MSCLSK
chr1_1620609_G_A_b38	SLC35E2	5.314	1.49e-07	0.05324	88	0.010019	no	MSCLSK
chr1_1728905_T_C_b38	SLC35E2	5.184	2.92e-07	0.05674	62	0.010945	no	MSCLSK
chr1_1728908_A_G_b38	SLC35E2	5.184	2.92e-07	0.05674	62	0.010945	no	MSCLSK
chr1_1622295_G_C_b38	SLC35E2	5.137	3.72e-07	0.051549	88	0.010035	no	MSCLSK
chr1_1703565_T_C_b38	SLC35E2	-5.1	4.5e-07	-0.050946	106	0.00999	no	MSCLSK
chr1_1734263_T_C_b38	SLC35E2	5.017	6.84e-07	0.050936	107	0.010154	no	MSCLSK
chr1_1705867_T_C_b38	SLC35E2	-4.974	8.45e-07	-0.044248	171	0.008896	no	MSCLSK
chr1_1728965_A_G_b38	SLC35E2	4.904	1.2e-06	0.053423	61	0.010894	no	MSCLSK
chr1_1706566_G_C_b38	SLC35E2	-4.879	1.35e-06	-0.049759	101	0.010198	no	MSCLSK
chr1_1612562_T_TC_b38	SLC35E2	4.819	1.81e-06	0.047872	86	0.009935	no	MSCLSK
chr1_1724661_CGATG_C_b38	SLC35E2	4.735	2.7e-06	0.048433	84	0.010229	no	MSCLSK
chr1_1717953_C_T_b38	SLC35E2	4.715	2.98e-06	0.047858	98	0.010151	no	MSCLSK
chr1_1595028_C_CAG_b38	SLC35E2	4.619	4.68e-06	0.051982	53	0.011255	no	MSCLSK
chr1_1737704_C_T_b38	SLC35E2	4.384	1.36e-05	0.044451	111	0.010138	no	MSCLSK
chr1_1730265_A_G_b38	SLC35E2	4.367	1.47e-05	0.049282	54	0.011285	no	MSCLSK
chr1_1741733_T_C_b38	SLC35E2	4.366	1.47e-05	0.043065	131	0.009863	no	MSCLSK
chr1_1732412_G_C_b38	SLC35E2	4.353	1.56e-05	0.044253	111	0.010165	no	MSCLSK
chr1_1732422_G_A_b38	SLC35E2	4.353	1.56e-05	0.044253	111	0.010165	no	MSCLSK
chr1_1735370_G_A_b38	SLC35E2	4.353	1.56e-05	0.044253	111	0.010165	no	MSCLSK
chr1_1735884_C_T_b38	SLC35E2	4.353	1.56e-05	0.044253	111	0.010165	no	MSCLSK
chr1_1733576_G_A_b38	SLC35E2	4.351	1.58e-05	0.044355	110	0.010195	no	MSCLSK
chr1_1736472_C_T_b38	SLC35E2	4.35	1.59e-05	0.044226	110	0.010167	no	MSCLSK
chr1_1738309_A_G_b38	SLC35E2	4.347	1.61e-05	0.04415	110	0.010156	no	MSCLSK
chr1_1740160_G_A_b38	SLC35E2	4.327	1.76e-05	0.043855	111	0.010136	no	MSCLSK
chr1_1741473_C_T_b38	SLC35E2	4.326	1.76e-05	0.044688	90	0.010329	no	MSCLSK
chr1_1732013_G_A_b38	SLC35E2	4.313	1.87e-05	0.043732	111	0.01014	no	MSCLSK
chr1_1740107_G_A_b38	SLC35E2	4.29	2.06e-05	0.043355	112	0.010106	no	MSCLSK
chr1_1732834_T_TATCG_b38	SLC35E2	4.271	2.25e-05	0.04364	110	0.010219	no	MSCLSK
chr1_1737703_A_C_b38	SLC35E2	4.242	2.54e-05	0.042425	112	0.01	no	MSCLSK
chr1_1740017_C_T_b38	SLC35E2	4.21	2.92e-05	0.04249	111	0.010092	no	MSCLSK
chr1_1738525_G_A_b38	SLC35E2	4.201	3.04e-05	0.043645	95	0.01039	no	MSCLSK
chr1_1735008_G_GGTTT_b38	SLC35E2	4.188	3.21e-05	0.04286	108	0.010233	no	MSCLSK
chr1_1597128_C_CCCTCAGCTGGACT_b38	SLC35E2	-4.122	4.25e-05	-0.039936	117	0.009688	no	MSCLSK
chr1_1707607_C_G_b38	SLC35E2	-3.973	7.9e-05	-0.033512	144	0.008434	no	MSCLSK
chr1_1746263_C_T_b38	SLC35E2	-3.918	9.9e-05	-0.046702	59	0.01192	no	MSCLSK
chr1_1698048_T_C_b38	SLC35E2	-3.907	0.000103	-0.094253	7	0.024122	no	MSCLSK
chr1_1948594_G_GTTT_b38	SLC35E2	-3.874	0.000118	-0.085622	9	0.022101	no	MSCLSK
chr1_1662933_T_A_b38	SLC35E2	3.846	0.000132	0.04133	65	0.010747	no	MSCLSK
chr1_1705816_A_G_b38	SLC35E2	-3.839	0.000136	-0.035762	146	0.009315	no	MSCLSK
chr1_1663038_T_C_b38	SLC35E2	3.788	0.000166	0.041039	105	0.010833	no	MSCLSK
chr1_1729287_T_C_b38	SLC35E2	3.645	0.000289	0.041508	55	0.011386	no	MSCLSK
chr1_1717604_CGCTTTCAGCTAGAGTTTGCTCTCTCTGGTTTTCGGTCTGTGACACACGCAT_C_b38	SLC35E2	3.617	0.000322	0.036529	117	0.0101	no	MSCLSK
chr1_1729296_T_C_b38	SLC35E2	3.608	0.000332	0.041816	52	0.011589	no	MSCLSK
chr1_2690139_C_A_b38	SLC35E2	3.567	0.000388	0.054792	6	0.01536	no	MSCLSK
chr1_1696758_A_G_b38	SLC35E2	-3.567	0.000389	-0.034992	114	0.009811	no	MSCLSK
chr1_1741276_C_T_b38	SLC35E2	3.554	0.000407	0.036754	98	0.010341	no	MSCLSK
chr1_1698022_G_A_b38	SLC35E2	-3.553	0.000409	-0.102784	20	0.028928	no	MSCLSK
chr1_1627156_G_A_b38	SLC35E2	-3.494	0.000509	-0.052416	12	0.015002	no	MSCLSK
chr1_1609890_C_T_b38	SLC35E2	-3.487	0.000521	-0.051604	14	0.014797	no	MSCLSK
chr1_992993_A_G_b38	SLC35E2	3.474	0.000547	0.033809	155	0.009731	no	MSCLSK
chr1_1594890_G_GAC_b38	SLC35E2	-3.447	0.000605	-0.033355	149	0.009678	no	MSCLSK
chr1_1739883_C_T_b38	SLC35E2	3.436	0.000629	0.034344	108	0.009996	no	MSCLSK
chr1_1835922_G_GAAA_b38	SLC35E2	-3.407	0.000698	-0.090401	8	0.026534	no	MSCLSK
chr1_2690121_C_G_b38	SLC35E2	3.398	0.000722	0.05239	6	0.01542	no	MSCLSK
chr1_1707623_T_C_b38	SLC35E2	-3.396	0.000728	-0.027964	139	0.008236	no	MSCLSK
chr1_1664099_T_C_b38	SLC35E2	3.38	0.000768	0.043629	28	0.012907	no	MSCLSK
chr1_1586215_A_G_b38	SLC35E2	-3.338	0.000892	-0.052385	10	0.015692	no	MSCLSK
chr1_1653825_T_TACACAC_b38	SLC35E2	3.324	0.000937	0.039092	35	0.011759	no	MSCLSK
chr1_1585173_C_T_b38	SLC35E2	-3.323	0.000943	-0.050923	12	0.015326	no	MSCLSK
chr1_2433984_T_TC_b38	SLC35E2	-3.24	0.00126	-0.031905	151	0.009848	no	MSCLSK
chr1_1593732_G_C_b38	SLC35E2	-3.233	0.00129	-0.031059	151	0.009606	no	MSCLSK
chr1_1686321_CTTTTTTT_C_b38	SLC35E2	-3.157	0.00167	-0.084407	3	0.026733	no	MSCLSK
chr1_1050069_G_A_b38	SLC35E2	-3.119	0.00189	-0.034229	147	0.010973	no	MSCLSK
chr1_1724035_G_A_b38	SLC35E2	-3.092	0.00208	-0.040481	61	0.013093	no	MSCLSK
chr1_995512_T_C_b38	SLC35E2	3.079	0.00217	0.030701	126	0.009972	no	MSCLSK
chr1_1584321_T_C_b38	SLC35E2	-3.077	0.00218	-0.031375	114	0.010195	no	MSCLSK
chr1_1742468_G_C_b38	SLC35E2	-3.067	0.00226	-0.030681	185	0.010005	no	MSCLSK
chr1_995786_A_G_b38	SLC35E2	3.063	0.00228	0.030501	126	0.009957	no	MSCLSK
chr1_946653_G_A_b38	SLC35E2	3.061	0.0023	0.037219	34	0.01216	no	MSCLSK
chr1_1341803_C_T_b38	SLC35E2	-3.059	0.00231	-0.092696	7	0.0303	no	MSCLSK
chr1_1373079_A_G_b38	SLC35E2	-3.059	0.00231	-0.092696	7	0.0303	no	MSCLSK
chr1_1373582_C_T_b38	SLC35E2	-3.059	0.00231	-0.092696	7	0.0303	no	MSCLSK
chr1_1375923_C_T_b38	SLC35E2	-3.059	0.00231	-0.092696	7	0.0303	no	MSCLSK
chr1_1376025_T_C_b38	SLC35E2	-3.059	0.00231	-0.092696	7	0.0303	no	MSCLSK
chr1_1725582_T_C_b38	SLC35E2	3.011	0.00271	0.027041	168	0.008981	no	MSCLSK
chr1_1810535_C_CA_b38	SLC35E2	-3.008	0.00273	-0.075957	8	0.025249	no	MSCLSK
chr1_2459410_TGGTGGTCCTCCTTGCC_T_b38	SLC35E2	-2.958	0.00321	-0.031951	67	0.0108	no	MSCLSK
chr1_1717507_T_C_b38	SLC35E2	2.954	0.00325	0.045984	20	0.015564	no	MSCLSK
chr1_1714932_G_T_b38	SLC35E2	-2.94	0.0034	-0.028606	157	0.00973	no	MSCLSK
chr1_921096_A_G_b38	SLC35E2	2.927	0.00354	0.030412	118	0.01039	no	MSCLSK
chr1_1734812_G_A_b38	SLC35E2	2.912	0.00372	0.036656	75	0.012588	no	MSCLSK
chr1_1705856_G_A_b38	SLC35E2	-2.898	0.00389	-0.026461	201	0.009131	no	MSCLSK
chr1_1953296_CTT_C_b38	SLC35E2	-2.897	0.0039	-0.054261	10	0.018733	no	MSCLSK
chr1_1929687_C_G_b38	SLC35E2	-2.882	0.00408	-0.067404	3	0.023385	no	MSCLSK
chr1_1716097_C_T_b38	SLC35E2	-2.881	0.0041	-0.049292	12	0.017111	no	MSCLSK
chr1_1742432_TA_T_b38	SLC35E2	2.876	0.00416	0.032938	67	0.011452	no	MSCLSK
chr1_1371538_C_T_b38	SLC35E2	-2.858	0.0044	-0.084357	8	0.029515	no	MSCLSK
chr1_986336_C_A_b38	SLC35E2	-2.855	0.00444	-0.029753	178	0.010421	no	MSCLSK
chr1_1002192_A_AT_b38	SLC35E2	2.846	0.00458	0.0437	7	0.015357	no	MSCLSK
chr1_1361163_AACAC_A_b38	SLC35E2	-2.841	0.00464	-0.074308	15	0.026154	no	MSCLSK
chr1_1018652_C_G_b38	SLC35E2	2.84	0.00466	0.029805	74	0.010495	no	MSCLSK
chr1_1681101_C_T_b38	SLC35E2	-2.837	0.0047	-0.042483	11	0.014976	no	MSCLSK
chr1_1020217_G_T_b38	SLC35E2	2.835	0.00473	0.029841	73	0.010526	no	MSCLSK
chr1_1005757_AGCCCCCGCAGCAGT_A_b38	SLC35E2	-2.834	0.00474	-0.028272	153	0.009975	no	MSCLSK
chr1_1004716_C_T_b38	SLC35E2	-2.832	0.00477	-0.028342	162	0.010007	no	MSCLSK
chr1_1707555_C_T_b38	SLC35E2	-2.803	0.00522	-0.050113	55	0.01788	no	MSCLSK
chr1_981454_G_A_b38	SLC35E2	-2.789	0.00544	-0.027201	164	0.009752	no	MSCLSK
chr1_999842_C_A_b38	SLC35E2	-2.777	0.00565	-0.028736	187	0.010348	no	MSCLSK
chr1_992967_GGGAGGGTCCATGTGTCCGTCATCTGA_G_b38	SLC35E2	-2.774	0.0057	-0.027824	192	0.010031	no	MSCLSK
chr1_914838_T_A_b38	SLC35E2	-2.741	0.00631	-0.028261	170	0.010312	no	MSCLSK
chr1_1573265_C_CAAA_b38	SLC35E2	2.735	0.0064	0.070626	6	0.025819	no	MSCLSK
chr1_1021740_G_C_b38	SLC35E2	2.731	0.00649	0.028788	72	0.010541	no	MSCLSK
chr1_1991852_G_A_b38	SLC35E2	2.724	0.00662	0.028703	64	0.010536	no	MSCLSK
chr1_1715541_A_C_b38	SLC35E2	2.713	0.00684	0.061026	4	0.02249	no	MSCLSK
chr1_1018754_G_A_b38	SLC35E2	2.709	0.00694	0.028431	74	0.010496	no	MSCLSK
chr1_1721125_G_A_b38	SLC35E2	-2.708	0.00695	-0.046282	12	0.01709	no	MSCLSK
chr1_983193_A_G_b38	SLC35E2	-2.706	0.007	-0.026481	165	0.009786	no	MSCLSK
chr1_1586956_T_C_b38	SLC35E2	-2.693	0.00728	-0.028908	84	0.010736	no	MSCLSK
chr1_1378550_G_A_b38	SLC35E2	-2.691	0.00731	-0.081729	7	0.03037	no	MSCLSK
chr1_1378591_C_T_b38	SLC35E2	-2.691	0.00731	-0.081729	7	0.03037	no	MSCLSK
chr1_1592964_C_T_b38	SLC35E2	2.691	0.00731	0.049523	5	0.018403	no	MSCLSK
chr1_1588701_C_T_b38	SLC35E2	-2.691	0.00731	-0.081037	3	0.030116	no	MSCLSK
chr1_1825782_G_A_b38	SLC35E2	-2.681	0.00753	-0.05283	8	0.019706	no	MSCLSK
chr1_2112675_T_TTTGG_b38	SLC35E2	-2.668	0.00783	-0.050972	3	0.019108	no	MSCLSK
chr1_933741_T_TG_b38	SLC35E2	-2.658	0.00805	-0.028838	79	0.010848	no	MSCLSK
chr1_989068_GTTGA_G_b38	SLC35E2	-2.653	0.00817	-0.026877	164	0.010129	no	MSCLSK
chr1_814609_C_T_b38	SLC35E2	-2.648	0.0083	-0.031773	45	0.011999	no	MSCLSK
chr1_1595306_CAG_C_b38	SLC35E2	-2.648	0.00831	-0.028008	155	0.010579	no	MSCLSK
chr1_1594131_T_C_b38	SLC35E2	-2.645	0.00838	-0.029297	51	0.011078	no	MSCLSK
chr1_1704835_C_T_b38	SLC35E2	-2.645	0.00838	-0.026383	197	0.009976	no	MSCLSK
chr1_995508_ATTTTT_A_b38	SLC35E2	-2.642	0.00843	-0.026729	160	0.010115	no	MSCLSK
chr1_2107223_G_A_b38	SLC35E2	-2.633	0.00866	-0.027074	112	0.010281	no	MSCLSK
chr1_979560_T_C_b38	SLC35E2	-2.628	0.0088	-0.026017	175	0.0099	no	MSCLSK
chr1_1004111_TG_T_b38	SLC35E2	2.624	0.0089	0.031436	34	0.01198	no	MSCLSK
chr1_978509_G_A_b38	SLC35E2	-2.602	0.00949	-0.025513	167	0.009806	no	MSCLSK
chr1_916657_G_A_b38	SLC35E2	-2.599	0.00956	-0.026834	172	0.010323	no	MSCLSK
chr1_916683_G_A_b38	SLC35E2	-2.597	0.00962	-0.026867	171	0.010345	no	MSCLSK
chr1_940390_A_G_b38	SLC35E2	-2.593	0.00973	-0.026035	179	0.01004	no	MSCLSK
chr1_2477921_G_A_b38	SLC35E2	-2.589	0.00986	-0.024891	169	0.009616	no	MSCLSK
chr1_936972_G_C_b38	SLC35E2	2.588	0.00986	0.028236	67	0.010909	no	MSCLSK
chr1_1613330_A_AT_b38	SLC35E2	-2.586	0.00992	-0.028516	69	0.011026	no	MSCLSK
chr1_1345423_G_A_b38	SLC35E2	-2.585	0.00996	-0.082948	5	0.032087	no	MSCLSK
chr1_1673060_G_A_b38	SLC35E2	8.435	4.29e-16	0.108886	114	0.012908	yes	NERVET
chr1_1673818_A_C_b38	SLC35E2	8.409	5.2e-16	0.107972	116	0.01284	yes	NERVET
chr1_1674868_G_A_b38	SLC35E2	8.237	1.84e-15	0.10593	115	0.01286	yes	NERVET
chr1_1677726_A_T_b38	SLC35E2	8.227	1.98e-15	0.105675	116	0.012845	yes	NERVET
chr1_1677720_T_G_b38	SLC35E2	8.215	2.16e-15	0.105344	116	0.012823	yes	NERVET
chr1_1671797_G_A_b38	SLC35E2	8.169	3.03e-15	0.105099	112	0.012866	yes	NERVET
chr1_1674720_TGC_T_b38	SLC35E2	8.167	3.06e-15	0.105956	113	0.012974	yes	NERVET
chr1_1671995_G_T_b38	SLC35E2	8.097	5.08e-15	0.104299	114	0.012882	yes	NERVET
chr1_1676790_C_T_b38	SLC35E2	7.96	1.35e-14	0.102144	113	0.012832	yes	NERVET
chr1_1673968_GA_G_b38	SLC35E2	7.094	4.93e-12	0.108812	50	0.015338	yes	NERVET
chr1_1648736_G_A_b38	SLC35E2	6.635	9.1e-11	0.089684	104	0.013516	yes	NERVET
chr1_1751981_A_T_b38	SLC35E2	-6.231	1.05e-09	-0.105544	33	0.016939	yes	NERVET
chr1_1651653_C_T_b38	SLC35E2	6.188	1.35e-09	0.082309	117	0.013302	yes	NERVET
chr1_1744854_C_A_b38	SLC35E2	-6.08	2.52e-09	-0.078289	76	0.012876	yes	NERVET
chr1_1660683_C_T_b38	SLC35E2	-6.077	2.57e-09	-0.088855	42	0.014623	yes	NERVET
chr1_1753033_C_T_b38	SLC35E2	-5.958	5.09e-09	-0.084108	104	0.014118	yes	NERVET
chr1_1692286_C_A_b38	SLC35E2	5.942	5.54e-09	0.117677	6	0.019803	yes	NERVET
chr1_1636278_G_T_b38	SLC35E2	5.902	6.97e-09	0.082472	92	0.013974	yes	NERVET
chr1_1752461_G_A_b38	SLC35E2	-5.834	1.02e-08	-0.082884	97	0.014206	yes	NERVET
chr1_1752730_C_G_b38	SLC35E2	-5.834	1.02e-08	-0.082884	97	0.014206	yes	NERVET
chr1_1742587_G_C_b38	SLC35E2	5.807	1.19e-08	0.076981	130	0.013256	yes	NERVET
chr1_1649932_C_T_b38	SLC35E2	5.798	1.24e-08	0.077648	104	0.013391	yes	NERVET
chr1_1753319_G_A_b38	SLC35E2	-5.776	1.41e-08	-0.082468	97	0.014278	yes	NERVET
chr1_1753361_G_A_b38	SLC35E2	-5.776	1.41e-08	-0.082468	97	0.014278	yes	NERVET
chr1_1743586_T_TAC_b38	SLC35E2	-5.771	1.45e-08	-0.083193	65	0.014416	yes	NERVET
chr1_1671148_C_T_b38	SLC35E2	5.715	1.97e-08	0.077953	66	0.013639	yes	NERVET
chr1_1756043_G_T_b38	SLC35E2	-5.696	2.19e-08	-0.081222	100	0.01426	yes	NERVET
chr1_1650195_A_G_b38	SLC35E2	-5.691	2.25e-08	-0.078217	62	0.013743	yes	NERVET
chr1_1661562_G_C_b38	SLC35E2	5.647	2.86e-08	0.07082	117	0.012541	yes	NERVET
chr1_1671097_G_C_b38	SLC35E2	5.637	3.02e-08	0.077021	66	0.013664	yes	NERVET
chr1_1665061_C_T_b38	SLC35E2	-5.637	3.02e-08	-0.08788	31	0.01559	yes	NERVET
chr1_1743565_ATAT_A_b38	SLC35E2	-5.636	3.03e-08	-0.076516	78	0.013575	yes	NERVET
chr1_1744652_C_T_b38	SLC35E2	-5.607	3.55e-08	-0.075905	96	0.013537	yes	NERVET
chr1_1742672_C_T_b38	SLC35E2	-5.553	4.76e-08	-0.078513	81	0.014139	yes	NERVET
chr1_1743238_G_C_b38	SLC35E2	-5.553	4.76e-08	-0.078513	81	0.014139	yes	NERVET
chr1_1660408_T_C_b38	SLC35E2	-5.547	4.89e-08	-0.093966	15	0.016939	yes	NERVET
chr1_1708521_C_G_b38	SLC35E2	-5.538	5.13e-08	-0.085549	38	0.015446	yes	NERVET
chr1_1866635_T_TA_b38	SLC35E2	5.537	5.18e-08	0.083399	74	0.015063	yes	NERVET
chr1_1668717_C_G_b38	SLC35E2	-5.529	5.39e-08	-0.086617	31	0.015665	yes	NERVET
chr1_1668542_C_T_b38	SLC35E2	-5.523	5.59e-08	-0.08794	27	0.015923	yes	NERVET
chr1_1665581_C_G_b38	SLC35E2	-5.515	5.83e-08	-0.083082	36	0.015065	yes	NERVET
chr1_1670423_AT_A_b38	SLC35E2	5.502	6.22e-08	0.086603	59	0.015739	yes	NERVET
chr1_1754482_TCCCTGGGACCGAAGTCGCCCCA_T_b38	SLC35E2	-5.497	6.39e-08	-0.078443	99	0.014269	yes	NERVET
chr1_1661177_A_G_b38	SLC35E2	-5.478	7.1e-08	-0.085328	31	0.015578	yes	NERVET
chr1_1661420_C_A_b38	SLC35E2	-5.474	7.23e-08	-0.075261	61	0.013748	yes	NERVET
chr1_1708474_C_A_b38	SLC35E2	-5.47	7.41e-08	-0.095461	18	0.017453	yes	NERVET
chr1_1649976_G_A_b38	SLC35E2	5.467	7.5e-08	0.074696	85	0.013662	yes	NERVET
chr1_1658866_G_A_b38	SLC35E2	-5.461	7.76e-08	-0.075299	61	0.013789	yes	NERVET
chr1_1659114_A_G_b38	SLC35E2	-5.461	7.76e-08	-0.075299	61	0.013789	yes	NERVET
chr1_1659220_A_G_b38	SLC35E2	-5.461	7.76e-08	-0.075299	61	0.013789	yes	NERVET
chr1_1667948_A_G_b38	SLC35E2	-5.436	8.83e-08	-0.085333	31	0.015696	yes	NERVET
chr1_1646352_A_C_b38	SLC35E2	5.433	8.98e-08	0.104891	8	0.019306	yes	NERVET
chr1_1750440_G_A_b38	SLC35E2	-5.394	1.1e-07	-0.085786	59	0.015903	yes	NERVET
chr1_1752126_G_A_b38	SLC35E2	5.383	1.17e-07	0.079838	68	0.014831	yes	NERVET
chr1_1759611_C_T_b38	SLC35E2	-5.383	1.17e-07	-0.077028	102	0.01431	yes	NERVET
chr1_1674633_C_CA_b38	SLC35E2	5.331	1.54e-07	0.077287	60	0.014499	yes	NERVET
chr1_1668108_C_T_b38	SLC35E2	5.324	1.59e-07	0.074157	60	0.013929	yes	NERVET
chr1_1669576_G_A_b38	SLC35E2	-5.301	1.79e-07	-0.083587	31	0.015768	yes	NERVET
chr1_1669613_G_A_b38	SLC35E2	-5.292	1.87e-07	-0.082598	32	0.015607	yes	NERVET
chr1_1747695_A_G_b38	SLC35E2	-5.289	1.9e-07	-0.062316	110	0.011782	yes	NERVET
chr1_1651421_GTAGCCCCTCTGAACGGTCTGTGACACACGCATGCTTTCAGCTAGAGTACTCTA_G_b38	SLC35E2	-5.247	2.36e-07	-0.073232	57	0.013956	yes	NERVET
chr1_1675091_A_G_b38	SLC35E2	-5.244	2.4e-07	-0.08125	34	0.015494	yes	NERVET
chr1_1970506_T_A_b38	SLC35E2	-5.237	2.49e-07	-0.072759	81	0.013893	yes	NERVET
chr1_1759354_G_A_b38	SLC35E2	-5.232	2.56e-07	-0.075164	99	0.014367	yes	NERVET
chr1_1660318_C_T_b38	SLC35E2	5.226	2.63e-07	0.107286	4	0.020529	yes	NERVET
chr1_1730405_G_C_b38	SLC35E2	5.224	2.66e-07	0.079036	81	0.015131	yes	NERVET
chr1_1692151_T_C_b38	SLC35E2	-5.217	2.75e-07	-0.084865	34	0.016266	yes	NERVET
chr1_1755504_T_C_b38	SLC35E2	5.197	3.04e-07	0.06905	128	0.013286	yes	NERVET
chr1_1744499_C_T_b38	SLC35E2	-5.197	3.05e-07	-0.06909	94	0.013295	yes	NERVET
chr1_1986752_A_G_b38	SLC35E2	5.174	3.43e-07	0.074139	90	0.01433	yes	NERVET
chr1_1750226_C_T_b38	SLC35E2	5.17	3.49e-07	0.073174	96	0.014152	yes	NERVET
chr1_1764023_C_A_b38	SLC35E2	5.155	3.76e-07	0.07239	96	0.014042	yes	NERVET
chr1_1750428_G_C_b38	SLC35E2	-5.152	3.83e-07	-0.081787	60	0.015876	yes	NERVET
chr1_1750280_A_G_b38	SLC35E2	-5.152	3.83e-07	-0.071169	109	0.013815	yes	NERVET
chr1_1639348_G_T_b38	SLC35E2	-5.139	4.09e-07	-0.068805	73	0.013389	yes	NERVET
chr1_1651137_C_T_b38	SLC35E2	-5.131	4.25e-07	-0.071005	59	0.013838	yes	NERVET
chr1_1651267_T_C_b38	SLC35E2	-5.131	4.25e-07	-0.071005	59	0.013838	yes	NERVET
chr1_1651574_G_A_b38	SLC35E2	-5.131	4.25e-07	-0.071005	59	0.013838	yes	NERVET
chr1_1651785_C_A_b38	SLC35E2	-5.131	4.25e-07	-0.071005	59	0.013838	yes	NERVET
chr1_1652061_T_C_b38	SLC35E2	-5.131	4.25e-07	-0.071005	59	0.013838	yes	NERVET
chr1_1652135_C_G_b38	SLC35E2	-5.131	4.25e-07	-0.071005	59	0.013838	yes	NERVET
chr1_1652191_C_T_b38	SLC35E2	-5.131	4.25e-07	-0.071005	59	0.013838	yes	NERVET
chr1_1652592_A_G_b38	SLC35E2	-5.131	4.25e-07	-0.071005	59	0.013838	yes	NERVET
chr1_1652779_A_G_b38	SLC35E2	-5.131	4.25e-07	-0.071005	59	0.013838	yes	NERVET
chr1_1653147_A_C_b38	SLC35E2	-5.131	4.25e-07	-0.071005	59	0.013838	yes	NERVET
chr1_1653396_T_C_b38	SLC35E2	-5.131	4.25e-07	-0.071005	59	0.013838	yes	NERVET
chr1_1653472_T_C_b38	SLC35E2	-5.131	4.25e-07	-0.071005	59	0.013838	yes	NERVET
chr1_1653811_G_A_b38	SLC35E2	-5.131	4.25e-07	-0.071005	59	0.013838	yes	NERVET
chr1_1653893_C_T_b38	SLC35E2	-5.131	4.25e-07	-0.071005	59	0.013838	yes	NERVET
chr1_1654143_G_A_b38	SLC35E2	-5.131	4.25e-07	-0.071005	59	0.013838	yes	NERVET
chr1_1654188_T_G_b38	SLC35E2	-5.131	4.25e-07	-0.071005	59	0.013838	yes	NERVET
chr1_1653934_G_A_b38	SLC35E2	-5.125	4.38e-07	-0.071044	59	0.013861	yes	NERVET
chr1_1743886_C_T_b38	SLC35E2	-5.111	4.7e-07	-0.083309	34	0.0163	yes	NERVET
chr1_1650777_G_A_b38	SLC35E2	-5.111	4.71e-07	-0.070721	59	0.013838	yes	NERVET
chr1_1739131_T_C_b38	SLC35E2	5.11	4.73e-07	0.066846	102	0.013082	yes	NERVET
chr1_1756186_T_C_b38	SLC35E2	5.071	5.74e-07	0.070876	97	0.013976	yes	NERVET
chr1_1664757_T_C_b38	SLC35E2	-5.061	6.04e-07	-0.069759	59	0.013784	yes	NERVET
chr1_1987547_C_CT_b38	SLC35E2	5.058	6.12e-07	0.074949	94	0.014817	yes	NERVET
chr1_1658830_C_G_b38	SLC35E2	-5.032	6.96e-07	-0.077548	33	0.01541	yes	NERVET
chr1_1848037_C_CTA_b38	SLC35E2	5.03	7.04e-07	0.06915	117	0.013748	yes	NERVET
chr1_1754601_G_T_b38	SLC35E2	5.025	7.2e-07	0.071617	92	0.014251	yes	NERVET
chr1_1757725_C_T_b38	SLC35E2	5.025	7.2e-07	0.071617	92	0.014251	yes	NERVET
chr1_1648826_A_G_b38	SLC35E2	-5.019	7.44e-07	-0.069685	67	0.013885	yes	NERVET
chr1_1722690_TA_T_b38	SLC35E2	-5.007	7.88e-07	-0.105767	4	0.021123	yes	NERVET
chr1_1945842_A_AAAAGAAC_b38	SLC35E2	-4.982	8.91e-07	-0.073901	79	0.014834	yes	NERVET
chr1_1844830_C_A_b38	SLC35E2	4.942	1.09e-06	0.068223	114	0.013806	yes	NERVET
chr1_1752908_C_CCCT_b38	SLC35E2	-4.94	1.1e-06	-0.074082	82	0.014997	yes	NERVET
chr1_1651926_T_C_b38	SLC35E2	-4.936	1.12e-06	-0.068615	59	0.0139	yes	NERVET
chr1_1664865_A_G_b38	SLC35E2	-4.931	1.15e-06	-0.068087	60	0.013809	yes	NERVET
chr1_1743840_T_C_b38	SLC35E2	-4.923	1.19e-06	-0.080988	34	0.01645	yes	NERVET
chr1_1987049_A_G_b38	SLC35E2	4.922	1.2e-06	0.069671	92	0.014156	yes	NERVET
chr1_1743714_C_CA_b38	SLC35E2	4.919	1.21e-06	0.073607	76	0.014962	yes	NERVET
chr1_1743851_C_T_b38	SLC35E2	-4.916	1.23e-06	-0.080358	34	0.016346	yes	NERVET
chr1_1654662_CT_C_b38	SLC35E2	4.878	1.48e-06	0.071947	84	0.014749	yes	NERVET
chr1_1976566_T_C_b38	SLC35E2	4.878	1.48e-06	0.066759	98	0.013686	yes	NERVET
chr1_1591703_T_C_b38	SLC35E2	4.877	1.49e-06	0.065981	99	0.013529	yes	NERVET
chr1_1748780_G_A_b38	SLC35E2	-4.871	1.53e-06	-0.06816	112	0.013992	yes	NERVET
chr1_1639685_G_A_b38	SLC35E2	-4.859	1.62e-06	-0.074687	34	0.01537	yes	NERVET
chr1_1747472_A_T_b38	SLC35E2	-4.857	1.63e-06	-0.070747	99	0.014565	yes	NERVET
chr1_1648636_G_A_b38	SLC35E2	-4.852	1.68e-06	-0.06792	67	0.013999	yes	NERVET
chr1_1755523_C_T_b38	SLC35E2	4.835	1.82e-06	0.06478	134	0.013399	yes	NERVET
chr1_1748597_C_G_b38	SLC35E2	-4.833	1.83e-06	-0.070251	99	0.014535	yes	NERVET
chr1_1659060_G_A_b38	SLC35E2	-4.832	1.84e-06	-0.071157	44	0.014725	yes	NERVET
chr1_1820337_A_G_b38	SLC35E2	4.827	1.88e-06	0.065797	122	0.01363	yes	NERVET
chr1_1781909_C_T_b38	SLC35E2	4.821	1.94e-06	0.065963	116	0.013682	yes	NERVET
chr1_1668721_C_T_b38	SLC35E2	-4.8	2.15e-06	-0.071817	42	0.014962	yes	NERVET
chr1_1698048_T_C_b38	SLC35E2	-4.78	2.36e-06	-0.149847	6	0.031347	yes	NERVET
chr1_1971864_C_T_b38	SLC35E2	4.757	2.63e-06	0.065865	88	0.013845	yes	NERVET
chr1_1744121_A_C_b38	SLC35E2	-4.749	2.73e-06	-0.089629	57	0.018872	yes	NERVET
chr1_1629332_G_T_b38	SLC35E2	4.748	2.75e-06	0.071425	52	0.015044	yes	NERVET
chr1_1757074_G_T_b38	SLC35E2	4.733	2.94e-06	0.066759	93	0.014104	yes	NERVET
chr1_1960609_G_C_b38	SLC35E2	-4.733	2.95e-06	-0.063752	103	0.01347	yes	NERVET
chr1_1749826_A_G_b38	SLC35E2	-4.727	3.03e-06	-0.062767	117	0.013279	yes	NERVET
chr1_1749637_G_T_b38	SLC35E2	4.711	3.26e-06	0.063289	100	0.013433	yes	NERVET
chr1_1667424_T_TAAAATA_b38	SLC35E2	4.686	3.68e-06	0.068537	62	0.014627	yes	NERVET
chr1_1641275_A_G_b38	SLC35E2	-4.684	3.71e-06	-0.065346	67	0.013951	yes	NERVET
chr1_1606384_A_G_b38	SLC35E2	4.644	4.46e-06	0.065608	62	0.014127	yes	NERVET
chr1_1658422_T_C_b38	SLC35E2	4.643	4.49e-06	0.078812	24	0.016975	yes	NERVET
chr1_1835922_G_GAAA_b38	SLC35E2	-4.639	4.57e-06	-0.186429	5	0.040188	yes	NERVET
chr1_1630798_C_T_b38	SLC35E2	4.637	4.61e-06	0.069754	49	0.015043	yes	NERVET
chr1_1744028_A_AC_b38	SLC35E2	-4.629	4.78e-06	-0.085603	16	0.018492	yes	NERVET
chr1_1722626_AGCG_A_b38	SLC35E2	4.6	5.46e-06	0.083984	38	0.018256	yes	NERVET
chr1_1945975_TG_T_b38	SLC35E2	-4.598	5.52e-06	-0.065215	104	0.014184	yes	NERVET
chr1_1692124_T_G_b38	SLC35E2	-4.597	5.54e-06	-0.073931	34	0.016083	yes	NERVET
chr1_1926870_T_C_b38	SLC35E2	-4.594	5.62e-06	-0.06065	109	0.013202	yes	NERVET
chr1_1746522_GT_G_b38	SLC35E2	-4.591	5.69e-06	-0.076268	30	0.016611	yes	NERVET
chr1_1722625_A_T_b38	SLC35E2	4.589	5.75e-06	0.083757	38	0.018251	yes	NERVET
chr1_1828894_T_TAC_b38	SLC35E2	4.557	6.66e-06	0.063805	109	0.014002	yes	NERVET
chr1_1969015_A_G_b38	SLC35E2	4.54	7.18e-06	0.06674	106	0.0147	yes	NERVET
chr1_1934565_G_A_b38	SLC35E2	-4.539	7.22e-06	-0.063386	119	0.013965	yes	NERVET
chr1_1916417_G_T_b38	SLC35E2	-4.539	7.23e-06	-0.062388	116	0.013745	yes	NERVET
chr1_1744052_GAGA_G_b38	SLC35E2	-4.508	8.33e-06	-0.07914	23	0.017557	yes	NERVET
chr1_1652913_C_T_b38	SLC35E2	-4.503	8.49e-06	-0.066872	42	0.01485	yes	NERVET
chr1_1744096_C_T_b38	SLC35E2	-4.499	8.66e-06	-0.088473	57	0.019665	yes	NERVET
chr1_1944216_C_T_b38	SLC35E2	-4.49	9.01e-06	-0.065608	103	0.014612	yes	NERVET
chr1_1760882_T_C_b38	SLC35E2	4.466	1.01e-05	0.060527	120	0.013554	yes	NERVET
chr1_1676287_C_T_b38	SLC35E2	-4.459	1.04e-05	-0.080006	13	0.017942	yes	NERVET
chr1_1770997_G_A_b38	SLC35E2	-4.455	1.06e-05	-0.064693	103	0.014523	yes	NERVET
chr1_1779667_T_TTG_b38	SLC35E2	4.416	1.25e-05	0.064479	80	0.0146	yes	NERVET
chr1_1613769_C_T_b38	SLC35E2	4.403	1.33e-05	0.067266	50	0.015276	yes	NERVET
chr1_1653863_C_A_b38	SLC35E2	-4.4	1.34e-05	-0.075297	17	0.017112	yes	NERVET
chr1_1797530_C_A_b38	SLC35E2	-4.392	1.39e-05	-0.063923	102	0.014553	yes	NERVET
chr1_1688328_C_T_b38	SLC35E2	-4.381	1.46e-05	-0.071268	26	0.016266	yes	NERVET
chr1_1914634_G_T_b38	SLC35E2	-4.377	1.49e-05	-0.059778	116	0.013659	yes	NERVET
chr1_1916670_G_C_b38	SLC35E2	-4.377	1.49e-05	-0.059778	116	0.013659	yes	NERVET
chr1_1621352_G_A_b38	SLC35E2	4.37	1.54e-05	0.063574	56	0.014548	yes	NERVET
chr1_1831318_C_T_b38	SLC35E2	-4.359	1.61e-05	-0.064398	100	0.014772	yes	NERVET
chr1_1764887_C_A_b38	SLC35E2	-4.339	1.76e-05	-0.064112	100	0.014775	yes	NERVET
chr1_1918090_A_G_b38	SLC35E2	-4.336	1.78e-05	-0.063667	101	0.014683	yes	NERVET
chr1_1758323_T_C_b38	SLC35E2	4.32	1.91e-05	0.059312	111	0.013729	yes	NERVET
chr1_1881428_C_CT_b38	SLC35E2	-4.318	1.93e-05	-0.063918	99	0.014801	yes	NERVET
chr1_1650688_T_A_b38	SLC35E2	-4.312	1.98e-05	-0.064698	42	0.015004	yes	NERVET
chr1_1792927_G_A_b38	SLC35E2	-4.311	1.98e-05	-0.063398	101	0.014705	yes	NERVET
chr1_1936077_C_T_b38	SLC35E2	-4.308	2.01e-05	-0.058272	122	0.013526	yes	NERVET
chr1_1773848_A_C_b38	SLC35E2	-4.308	2.02e-05	-0.063553	101	0.014753	yes	NERVET
chr1_1776461_GAAAC_G_b38	SLC35E2	-4.308	2.02e-05	-0.063553	101	0.014753	yes	NERVET
chr1_1777362_A_G_b38	SLC35E2	-4.308	2.02e-05	-0.063553	101	0.014753	yes	NERVET
chr1_1790040_C_T_b38	SLC35E2	-4.308	2.02e-05	-0.063553	101	0.014753	yes	NERVET
chr1_1791493_C_T_b38	SLC35E2	-4.308	2.02e-05	-0.063553	101	0.014753	yes	NERVET
chr1_1791592_G_A_b38	SLC35E2	-4.308	2.02e-05	-0.063553	101	0.014753	yes	NERVET
chr1_1808816_G_T_b38	SLC35E2	-4.308	2.02e-05	-0.063553	101	0.014753	yes	NERVET
chr1_1817295_T_C_b38	SLC35E2	-4.308	2.02e-05	-0.063553	101	0.014753	yes	NERVET
chr1_1819825_G_A_b38	SLC35E2	-4.308	2.02e-05	-0.063553	101	0.014753	yes	NERVET
chr1_1827774_A_G_b38	SLC35E2	-4.308	2.02e-05	-0.063553	101	0.014753	yes	NERVET
chr1_1922670_A_G_b38	SLC35E2	-4.307	2.03e-05	-0.05856	114	0.013598	yes	NERVET
chr1_1773460_G_A_b38	SLC35E2	-4.301	2.08e-05	-0.063204	101	0.014695	yes	NERVET
chr1_1773476_C_G_b38	SLC35E2	-4.301	2.08e-05	-0.063204	101	0.014695	yes	NERVET
chr1_1944182_G_C_b38	SLC35E2	-4.293	2.15e-05	-0.061679	105	0.014368	yes	NERVET
chr1_1771864_G_A_b38	SLC35E2	-4.289	2.19e-05	-0.063056	102	0.014701	yes	NERVET
chr1_1772426_T_A_b38	SLC35E2	-4.289	2.19e-05	-0.063056	102	0.014701	yes	NERVET
chr1_1772410_T_C_b38	SLC35E2	-4.277	2.3e-05	-0.06271	102	0.014662	yes	NERVET
chr1_1932079_AC_A_b38	SLC35E2	-4.277	2.3e-05	-0.065548	65	0.015325	yes	NERVET
chr1_1865278_A_C_b38	SLC35E2	4.276	2.31e-05	0.059199	105	0.013843	yes	NERVET
chr1_1928648_C_T_b38	SLC35E2	-4.273	2.34e-05	-0.058046	114	0.013584	yes	NERVET
chr1_1914345_C_T_b38	SLC35E2	-4.273	2.35e-05	-0.062515	102	0.014631	yes	NERVET
chr1_1914918_G_A_b38	SLC35E2	-4.273	2.35e-05	-0.062515	102	0.014631	yes	NERVET
chr1_1916217_C_T_b38	SLC35E2	-4.273	2.35e-05	-0.062515	102	0.014631	yes	NERVET
chr1_1946058_T_C_b38	SLC35E2	-4.262	2.46e-05	-0.061339	105	0.014392	yes	NERVET
chr1_1915326_G_A_b38	SLC35E2	-4.259	2.49e-05	-0.062504	102	0.014676	yes	NERVET
chr1_1946632_C_T_b38	SLC35E2	-4.248	2.61e-05	-0.061235	105	0.014414	yes	NERVET
chr1_1947189_C_T_b38	SLC35E2	-4.248	2.61e-05	-0.061235	105	0.014414	yes	NERVET
chr1_1620609_G_A_b38	SLC35E2	4.234	2.78e-05	0.061228	55	0.014462	yes	NERVET
chr1_1586962_C_T_b38	SLC35E2	4.225	2.88e-05	0.061815	62	0.01463	yes	NERVET
chr1_1769969_CAAAACAAAAACA_C_b38	SLC35E2	-4.222	2.92e-05	-0.062294	104	0.014756	yes	NERVET
chr1_1600379_C_T_b38	SLC35E2	4.206	3.13e-05	0.061121	52	0.014534	yes	NERVET
chr1_1944419_C_G_b38	SLC35E2	-4.186	3.4e-05	-0.06015	106	0.01437	yes	NERVET
chr1_1946013_C_T_b38	SLC35E2	-4.185	3.42e-05	-0.060377	104	0.014427	yes	NERVET
chr1_1921333_C_T_b38	SLC35E2	-4.183	3.44e-05	-0.060227	104	0.014397	yes	NERVET
chr1_1866508_A_G_b38	SLC35E2	-4.179	3.51e-05	-0.061647	102	0.014752	yes	NERVET
chr1_1875208_T_C_b38	SLC35E2	-4.179	3.51e-05	-0.061647	102	0.014752	yes	NERVET
chr1_1879567_T_C_b38	SLC35E2	-4.179	3.51e-05	-0.061647	102	0.014752	yes	NERVET
chr1_1843381_A_T_b38	SLC35E2	-4.178	3.52e-05	-0.061749	101	0.01478	yes	NERVET
chr1_1847030_A_G_b38	SLC35E2	-4.178	3.52e-05	-0.061749	101	0.01478	yes	NERVET
chr1_1850017_G_T_b38	SLC35E2	-4.178	3.52e-05	-0.061749	101	0.01478	yes	NERVET
chr1_1940540_G_A_b38	SLC35E2	-4.173	3.6e-05	-0.056908	116	0.013638	yes	NERVET
chr1_1649846_G_A_b38	SLC35E2	-4.172	3.6e-05	-0.065519	30	0.015703	yes	NERVET
chr1_1944074_T_C_b38	SLC35E2	-4.168	3.67e-05	-0.059778	105	0.014342	yes	NERVET
chr1_1944091_G_C_b38	SLC35E2	-4.168	3.67e-05	-0.059778	105	0.014342	yes	NERVET
chr1_1675132_A_G_b38	SLC35E2	4.164	3.73e-05	0.063266	67	0.015193	yes	NERVET
chr1_1931587_A_G_b38	SLC35E2	-4.164	3.73e-05	-0.057157	114	0.013726	yes	NERVET
chr1_1924788_C_T_b38	SLC35E2	-4.163	3.74e-05	-0.060734	104	0.014587	yes	NERVET
chr1_1675228_C_CG_b38	SLC35E2	4.16	3.79e-05	0.062667	82	0.015064	yes	NERVET
chr1_1925233_T_C_b38	SLC35E2	-4.158	3.83e-05	-0.06071	103	0.014602	yes	NERVET
chr1_1925281_C_T_b38	SLC35E2	-4.158	3.83e-05	-0.06071	103	0.014602	yes	NERVET
chr1_1921745_T_C_b38	SLC35E2	-4.155	3.87e-05	-0.056221	114	0.01353	yes	NERVET
chr1_1933087_C_T_b38	SLC35E2	-4.155	3.89e-05	-0.056797	113	0.013671	yes	NERVET
chr1_1933859_A_G_b38	SLC35E2	-4.155	3.89e-05	-0.056797	113	0.013671	yes	NERVET
chr1_1940973_C_T_b38	SLC35E2	-4.154	3.89e-05	-0.05645	119	0.013589	yes	NERVET
chr1_1920695_A_G_b38	SLC35E2	-4.15	3.96e-05	-0.060624	103	0.014608	yes	NERVET
chr1_1600320_C_G_b38	SLC35E2	4.149	3.98e-05	0.060518	51	0.014586	yes	NERVET
chr1_1925307_C_A_b38	SLC35E2	-4.148	4e-05	-0.061581	97	0.014847	yes	NERVET
chr1_1927857_T_C_b38	SLC35E2	-4.14	4.13e-05	-0.060587	103	0.014635	yes	NERVET
chr1_1929904_C_T_b38	SLC35E2	-4.14	4.14e-05	-0.060327	103	0.014573	yes	NERVET
chr1_1881249_A_G_b38	SLC35E2	-4.136	4.2e-05	-0.060962	102	0.01474	yes	NERVET
chr1_1886800_G_A_b38	SLC35E2	-4.136	4.2e-05	-0.060962	102	0.01474	yes	NERVET
chr1_1891654_C_CAGAG_b38	SLC35E2	-4.136	4.2e-05	-0.060962	102	0.01474	yes	NERVET
chr1_1930143_C_T_b38	SLC35E2	-4.129	4.33e-05	-0.060285	103	0.014601	yes	NERVET
chr1_1881082_C_T_b38	SLC35E2	-4.126	4.37e-05	-0.060597	102	0.014685	yes	NERVET
chr1_1938054_ACT_A_b38	SLC35E2	-4.121	4.48e-05	-0.056161	116	0.013629	yes	NERVET
chr1_1650664_CTTTTT_C_b38	SLC35E2	-4.12	4.49e-05	-0.065063	32	0.015791	yes	NERVET
chr1_1612562_T_TC_b38	SLC35E2	4.116	4.57e-05	0.058779	58	0.014281	yes	NERVET
chr1_1638879_C_T_b38	SLC35E2	-4.112	4.64e-05	-0.061712	39	0.015007	yes	NERVET
chr1_1860718_A_C_b38	SLC35E2	-4.107	4.75e-05	-0.06073	104	0.014788	yes	NERVET
chr1_1622295_G_C_b38	SLC35E2	4.106	4.77e-05	0.059466	55	0.014484	yes	NERVET
chr1_1595028_C_CAG_b38	SLC35E2	4.104	4.81e-05	0.065706	35	0.016011	yes	NERVET
chr1_1945121_T_C_b38	SLC35E2	-4.099	4.89e-05	-0.058679	107	0.014314	yes	NERVET
chr1_1918989_A_G_b38	SLC35E2	-4.098	4.93e-05	-0.055312	117	0.013499	yes	NERVET
chr1_1766653_A_G_b38	SLC35E2	-4.092	5.05e-05	-0.060355	101	0.01475	yes	NERVET
chr1_1948919_T_TCCTTCCCTCCTCTTTCCCTCCCTTCTTTCCTTCCCTTTCCCTCCCTC_b38	SLC35E2	-4.09	5.09e-05	-0.051244	100	0.01253	yes	NERVET
chr1_1904424_A_AAAATAAATAAAT_b38	SLC35E2	4.089	5.11e-05	0.051494	98	0.012592	yes	NERVET
chr1_1981144_T_G_b38	SLC35E2	4.089	5.12e-05	0.066763	32	0.016329	yes	NERVET
chr1_1937841_ACACCAGGTCCACCTCTGGACACAGGTCCACC_A_b38	SLC35E2	-4.08	5.31e-05	-0.055577	116	0.013622	yes	NERVET
chr1_1846009_AGG_A_b38	SLC35E2	-4.077	5.38e-05	-0.060421	102	0.014821	yes	NERVET
chr1_1846011_G_GTCC_b38	SLC35E2	-4.077	5.38e-05	-0.060421	102	0.014821	yes	NERVET
chr1_1769969_CAAAACA_C_b38	SLC35E2	4.073	5.45e-05	0.055972	107	0.013741	yes	NERVET
chr1_1936627_C_G_b38	SLC35E2	-4.071	5.51e-05	-0.055753	112	0.013696	yes	NERVET
chr1_1607931_G_A_b38	SLC35E2	4.068	5.58e-05	0.05925	52	0.014565	yes	NERVET
chr1_1919188_CAGCGGCAGG_C_b38	SLC35E2	-4.063	5.7e-05	-0.059056	101	0.014536	yes	NERVET
chr1_1963533_C_CA_b38	SLC35E2	4.058	5.8e-05	0.056567	100	0.013938	yes	NERVET
chr1_1942260_G_C_b38	SLC35E2	-4.051	5.98e-05	-0.055186	117	0.013622	yes	NERVET
chr1_1609058_G_A_b38	SLC35E2	4.046	6.1e-05	0.058659	53	0.014496	yes	NERVET
chr1_1762287_A_G_b38	SLC35E2	-4.045	6.14e-05	-0.059843	106	0.014795	yes	NERVET
chr1_1637577_T_C_b38	SLC35E2	-4.044	6.16e-05	-0.06012	38	0.014867	yes	NERVET
chr1_1836126_C_A_b38	SLC35E2	-4.042	6.2e-05	-0.057478	106	0.014219	yes	NERVET
chr1_1931580_CA_C_b38	SLC35E2	-4.033	6.43e-05	-0.055593	113	0.013783	yes	NERVET
chr1_1899573_C_T_b38	SLC35E2	-4.019	6.82e-05	-0.059578	101	0.014823	yes	NERVET
chr1_1901262_C_T_b38	SLC35E2	-4.019	6.82e-05	-0.059578	101	0.014823	yes	NERVET
chr1_1901386_C_A_b38	SLC35E2	-4.019	6.82e-05	-0.059578	101	0.014823	yes	NERVET
chr1_1912607_C_T_b38	SLC35E2	-4.007	7.16e-05	-0.059584	95	0.014869	yes	NERVET
chr1_1951106_G_A_b38	SLC35E2	-3.986	7.82e-05	-0.057711	105	0.01448	yes	NERVET
chr1_1951865_G_GT_b38	SLC35E2	-3.986	7.82e-05	-0.057711	105	0.01448	yes	NERVET
chr1_1942014_G_A_b38	SLC35E2	-3.983	7.92e-05	-0.054204	116	0.01361	yes	NERVET
chr1_1942075_A_G_b38	SLC35E2	-3.983	7.92e-05	-0.054204	116	0.01361	yes	NERVET
chr1_1942086_T_C_b38	SLC35E2	-3.983	7.92e-05	-0.054204	116	0.01361	yes	NERVET
chr1_1909234_G_A_b38	SLC35E2	-3.982	7.95e-05	-0.059543	99	0.014954	yes	NERVET
chr1_1944675_C_T_b38	SLC35E2	-3.979	8.05e-05	-0.05737	105	0.014419	yes	NERVET
chr1_1942258_G_A_b38	SLC35E2	-3.966	8.47e-05	-0.05395	116	0.013603	yes	NERVET
chr1_1950071_C_T_b38	SLC35E2	-3.964	8.54e-05	-0.05722	105	0.014435	yes	NERVET
chr1_1952064_G_A_b38	SLC35E2	-3.964	8.54e-05	-0.05722	105	0.014435	yes	NERVET
chr1_1944420_A_G_b38	SLC35E2	-3.962	8.63e-05	-0.056656	107	0.014302	yes	NERVET
chr1_1902481_G_A_b38	SLC35E2	-3.96	8.69e-05	-0.058329	101	0.014731	yes	NERVET
chr1_1942887_C_G_b38	SLC35E2	-3.959	8.72e-05	-0.056641	106	0.014307	yes	NERVET
chr1_1938332_A_ACT_b38	SLC35E2	-3.954	8.9e-05	-0.053613	120	0.013559	yes	NERVET
chr1_1952823_TA_T_b38	SLC35E2	-3.952	8.96e-05	-0.056733	105	0.014355	yes	NERVET
chr1_1902439_C_T_b38	SLC35E2	-3.943	9.31e-05	-0.058111	101	0.014739	yes	NERVET
chr1_1746440_A_G_b38	SLC35E2	-3.94	9.43e-05	-0.066523	30	0.016886	yes	NERVET
chr1_1762759_AAATG_A_b38	SLC35E2	3.935	9.59e-05	0.054327	118	0.013805	yes	NERVET
chr1_1589495_CTTT_C_b38	SLC35E2	3.931	9.77e-05	0.061933	43	0.015757	yes	NERVET
chr1_1743565_AT_A_b38	SLC35E2	3.924	0.000101	0.050254	140	0.012808	yes	NERVET
chr1_1938125_TCA_T_b38	SLC35E2	-3.924	0.000101	-0.056256	104	0.014338	yes	NERVET
chr1_1932081_AAAAAAC_A_b38	SLC35E2	-3.908	0.000107	-0.069048	40	0.017668	yes	NERVET
chr1_1905586_C_T_b38	SLC35E2	-3.886	0.000117	-0.058164	98	0.014967	yes	NERVET
chr1_1729859_A_G_b38	SLC35E2	3.877	0.000121	0.066334	20	0.017109	yes	NERVET
chr1_1750528_G_A_b38	SLC35E2	-3.877	0.000121	-0.049448	100	0.012754	yes	NERVET
chr1_1924264_CCG_C_b38	SLC35E2	-3.861	0.000129	-0.053366	110	0.013822	yes	NERVET
chr1_1659940_A_C_b38	SLC35E2	-3.859	0.00013	-0.069968	14	0.018131	yes	NERVET
chr1_1935938_T_C_b38	SLC35E2	-3.839	0.000141	-0.05371	97	0.013992	yes	NERVET
chr1_1937273_T_C_b38	SLC35E2	-3.827	0.000148	-0.052655	110	0.01376	yes	NERVET
chr1_1909238_G_A_b38	SLC35E2	-3.82	0.000152	-0.056827	101	0.014876	yes	NERVET
chr1_1948938_C_T_b38	SLC35E2	-3.809	0.000158	-0.047767	102	0.01254	yes	NERVET
chr1_1948515_C_T_b38	SLC35E2	-3.797	0.000166	-0.053768	115	0.014161	yes	NERVET
chr1_1840043_T_TA_b38	SLC35E2	3.792	0.000169	0.07115	9	0.018761	yes	NERVET
chr1_1948519_T_C_b38	SLC35E2	-3.771	0.000183	-0.05333	115	0.01414	yes	NERVET
chr1_1595306_CAG_C_b38	SLC35E2	-3.753	0.000197	-0.056643	115	0.015093	yes	NERVET
chr1_1937895_C_T_b38	SLC35E2	-3.744	0.000204	-0.053751	105	0.014358	yes	NERVET
chr1_1650383_G_T_b38	SLC35E2	-3.743	0.000205	-0.05614	45	0.014997	yes	NERVET
chr1_1935987_G_A_b38	SLC35E2	-3.718	0.000225	-0.053436	106	0.014371	yes	NERVET
chr1_1937802_G_T_b38	SLC35E2	-3.696	0.000245	-0.054515	101	0.01475	yes	NERVET
chr1_1728671_C_A_b38	SLC35E2	3.69	0.000251	0.0654	23	0.017725	yes	NERVET
chr1_1723766_C_T_b38	SLC35E2	-3.688	0.000253	-0.06594	28	0.017878	yes	NERVET
chr1_1977879_G_A_b38	SLC35E2	3.683	0.000258	0.0539	52	0.014634	yes	NERVET
chr1_1725582_T_C_b38	SLC35E2	3.658	0.000284	0.04544	121	0.012424	yes	NERVET
chr1_1947645_C_T_b38	SLC35E2	-3.644	0.000298	-0.053033	101	0.014552	yes	NERVET
chr1_1591419_A_G_b38	SLC35E2	3.644	0.000299	0.066743	12	0.018317	yes	NERVET
chr1_1725339_C_A_b38	SLC35E2	3.64	0.000303	0.046984	101	0.012907	yes	NERVET
chr1_1978114_T_A_b38	SLC35E2	3.622	0.000325	0.053412	51	0.014746	yes	NERVET
chr1_1985619_A_G_b38	SLC35E2	3.62	0.000328	0.052414	71	0.01448	yes	NERVET
chr1_1837255_A_AT_b38	SLC35E2	3.576	0.000385	0.061996	19	0.017336	yes	NERVET
chr1_1991835_C_T_b38	SLC35E2	3.56	0.000409	0.052196	79	0.014661	yes	NERVET
chr1_1667424_T_TAAATA_b38	SLC35E2	-3.559	0.00041	-0.05023	79	0.014112	yes	NERVET
chr1_946653_G_A_b38	SLC35E2	3.559	0.00041	0.059787	24	0.016797	yes	NERVET
chr1_1978006_A_G_b38	SLC35E2	3.553	0.000421	0.052068	52	0.014657	yes	NERVET
chr1_1968012_GTGAA_G_b38	SLC35E2	3.539	0.000442	0.054601	35	0.015427	yes	NERVET
chr1_1679100_A_G_b38	SLC35E2	-3.531	0.000455	-0.047532	96	0.01346	yes	NERVET
chr1_1649993_A_G_b38	SLC35E2	-3.529	0.000459	-0.047207	130	0.013378	yes	NERVET
chr1_1606532_GTGGGCTGGGCTGGTCAGGCA_G_b38	SLC35E2	3.518	0.000478	0.051178	49	0.014548	yes	NERVET
chr1_1978647_G_T_b38	SLC35E2	3.509	0.000494	0.051473	52	0.014669	yes	NERVET
chr1_1743544_CA_C_b38	SLC35E2	3.501	0.000509	0.046088	117	0.013165	yes	NERVET
chr1_1978429_G_A_b38	SLC35E2	3.483	0.000543	0.054126	37	0.015541	yes	NERVET
chr1_1978404_C_T_b38	SLC35E2	3.48	0.00055	0.051327	51	0.014751	yes	NERVET
chr1_1978415_G_A_b38	SLC35E2	3.48	0.00055	0.051327	51	0.014751	yes	NERVET
chr1_1111648_A_G_b38	SLC35E2	-3.477	0.000555	-0.112006	3	0.032212	yes	NERVET
chr1_1981319_G_C_b38	SLC35E2	3.467	0.000576	0.05123	50	0.014778	yes	NERVET
chr1_1983166_A_T_b38	SLC35E2	3.467	0.000576	0.05123	50	0.014778	yes	NERVET
chr1_1983956_TGG_T_b38	SLC35E2	3.467	0.000576	0.05123	50	0.014778	yes	NERVET
chr1_1984859_C_T_b38	SLC35E2	3.467	0.000576	0.05123	50	0.014778	yes	NERVET
chr1_1985148_G_T_b38	SLC35E2	3.467	0.000576	0.05123	50	0.014778	yes	NERVET
chr1_1986033_G_A_b38	SLC35E2	3.467	0.000576	0.05123	50	0.014778	yes	NERVET
chr1_1986176_A_T_b38	SLC35E2	3.467	0.000576	0.05123	50	0.014778	yes	NERVET
chr1_1986390_T_G_b38	SLC35E2	3.467	0.000576	0.05123	50	0.014778	yes	NERVET
chr1_1986469_A_C_b38	SLC35E2	3.467	0.000576	0.05123	50	0.014778	yes	NERVET
chr1_1987096_A_T_b38	SLC35E2	3.467	0.000576	0.05123	50	0.014778	yes	NERVET
chr1_1987156_G_A_b38	SLC35E2	3.467	0.000576	0.05123	50	0.014778	yes	NERVET
chr1_1986211_T_C_b38	SLC35E2	3.456	0.000599	0.051071	50	0.014777	yes	NERVET
chr1_1978055_C_T_b38	SLC35E2	3.453	0.000605	0.050959	51	0.014757	yes	NERVET
chr1_1977765_A_G_b38	SLC35E2	3.439	0.000636	0.050713	51	0.014745	yes	NERVET
chr1_1980953_G_A_b38	SLC35E2	3.439	0.000636	0.050713	51	0.014745	yes	NERVET
chr1_1976473_C_T_b38	SLC35E2	3.438	0.000639	0.050742	51	0.014759	yes	NERVET
chr1_1976573_T_C_b38	SLC35E2	3.438	0.000639	0.050742	51	0.014759	yes	NERVET
chr1_1976646_A_G_b38	SLC35E2	3.438	0.000639	0.050742	51	0.014759	yes	NERVET
chr1_1976661_G_T_b38	SLC35E2	3.438	0.000639	0.050742	51	0.014759	yes	NERVET
chr1_1976946_C_T_b38	SLC35E2	3.438	0.000639	0.050742	51	0.014759	yes	NERVET
chr1_1977264_C_G_b38	SLC35E2	3.438	0.000639	0.050742	51	0.014759	yes	NERVET
chr1_1983507_C_T_b38	SLC35E2	3.435	0.000646	0.053275	37	0.01551	yes	NERVET
chr1_1877316_A_T_b38	SLC35E2	3.43	0.000658	0.048024	86	0.014001	yes	NERVET
chr1_1775296_C_T_b38	SLC35E2	3.425	0.000671	0.066199	13	0.019331	yes	NERVET
chr1_1815255_G_T_b38	SLC35E2	3.425	0.000671	0.066199	13	0.019331	yes	NERVET
chr1_1984595_C_T_b38	SLC35E2	3.419	0.000683	0.050346	51	0.014723	yes	NERVET
chr1_1985090_C_T_b38	SLC35E2	3.416	0.000691	0.050325	76	0.014731	yes	NERVET
chr1_1880596_T_A_b38	SLC35E2	-3.416	0.000692	-0.050962	90	0.014918	yes	NERVET
chr1_1969479_G_A_b38	SLC35E2	3.406	0.000716	0.055322	28	0.01624	yes	NERVET
chr1_1849781_T_C_b38	SLC35E2	-3.391	0.000756	-0.05646	28	0.01665	yes	NERVET
chr1_1991213_T_C_b38	SLC35E2	3.386	0.000769	0.047899	86	0.014144	yes	NERVET
chr1_1991841_T_C_b38	SLC35E2	3.381	0.000784	0.066218	16	0.019586	yes	NERVET
chr1_1702383_T_C_b38	SLC35E2	-3.38	0.000786	-0.054058	30	0.015993	yes	NERVET
chr1_1990864_C_T_b38	SLC35E2	3.378	0.000793	0.048311	91	0.014303	yes	NERVET
chr1_1606507_GTGGGC_G_b38	SLC35E2	3.372	0.000809	0.045608	134	0.013526	yes	NERVET
chr1_1976600_C_T_b38	SLC35E2	3.368	0.000821	0.049771	51	0.014778	yes	NERVET
chr1_1967980_A_AAGAATGAG_b38	SLC35E2	3.364	0.000833	0.053362	31	0.015864	yes	NERVET
chr1_1972273_C_A_b38	SLC35E2	3.359	0.000847	0.050043	48	0.014897	yes	NERVET
chr1_1631710_T_C_b38	SLC35E2	3.357	0.000853	0.067837	8	0.020206	yes	NERVET
chr1_1989523_T_C_b38	SLC35E2	3.353	0.000865	0.048383	83	0.01443	yes	NERVET
chr1_1866635_T_TAAA_b38	SLC35E2	-3.349	0.000879	-0.053947	61	0.01611	yes	NERVET
chr1_1971434_C_T_b38	SLC35E2	3.341	0.000902	0.052251	35	0.015638	yes	NERVET
chr1_1971127_G_A_b38	SLC35E2	3.324	0.000959	0.052147	34	0.01569	yes	NERVET
chr1_954724_G_A_b38	SLC35E2	3.317	0.000983	0.055597	23	0.016763	yes	NERVET
chr1_1991690_A_G_b38	SLC35E2	3.316	0.000987	0.04487	96	0.013533	yes	NERVET
chr1_1985451_C_T_b38	SLC35E2	3.314	0.000993	0.048882	78	0.014751	yes	NERVET
chr1_1898712_C_T_b38	SLC35E2	3.313	0.000994	0.063928	11	0.019293	yes	NERVET
chr1_1899188_T_A_b38	SLC35E2	3.313	0.000994	0.063928	11	0.019293	yes	NERVET
chr1_1871210_G_T_b38	SLC35E2	3.302	0.00104	0.063299	13	0.019171	yes	NERVET
chr1_1984601_T_C_b38	SLC35E2	3.294	0.00106	0.048694	51	0.014784	yes	NERVET
chr1_1971123_A_G_b38	SLC35E2	3.29	0.00108	0.051296	35	0.015592	yes	NERVET
chr1_1978562_C_G_b38	SLC35E2	3.289	0.00108	0.048175	53	0.014648	yes	NERVET
chr1_1978573_T_C_b38	SLC35E2	3.289	0.00108	0.048175	53	0.014648	yes	NERVET
chr1_1865177_G_A_b38	SLC35E2	-3.282	0.00111	-0.055133	27	0.016797	yes	NERVET
chr1_1976855_C_CTT_b38	SLC35E2	3.269	0.00116	0.055647	25	0.017022	yes	NERVET
chr1_1635226_T_C_b38	SLC35E2	-3.267	0.00117	-0.06068	15	0.018573	yes	NERVET
chr1_1978262_C_T_b38	SLC35E2	3.257	0.00121	0.047967	52	0.014726	yes	NERVET
chr1_1978294_G_T_b38	SLC35E2	3.257	0.00121	0.047967	52	0.014726	yes	NERVET
chr1_1971027_A_C_b38	SLC35E2	3.25	0.00124	0.050831	35	0.01564	yes	NERVET
chr1_1074660_C_T_b38	SLC35E2	3.248	0.00125	0.09577	4	0.029484	yes	NERVET
chr1_1984586_G_A_b38	SLC35E2	3.245	0.00126	0.047888	51	0.014757	yes	NERVET
chr1_1986010_T_G_b38	SLC35E2	3.245	0.00126	0.047888	51	0.014757	yes	NERVET
chr1_1891444_CG_C_b38	SLC35E2	-3.244	0.00126	-0.047871	96	0.014755	yes	NERVET
chr1_1968130_GTGAA_G_b38	SLC35E2	3.239	0.00129	0.050993	32	0.015743	yes	NERVET
chr1_1891450_G_C_b38	SLC35E2	-3.237	0.00129	-0.048424	95	0.014958	yes	NERVET
chr1_1160003_G_A_b38	SLC35E2	3.231	0.00132	0.053054	30	0.016422	yes	NERVET
chr1_1721552_G_A_b38	SLC35E2	-3.22	0.00137	-0.136169	3	0.042292	yes	NERVET
chr1_1968103_A_ATGAG_b38	SLC35E2	3.219	0.00137	0.050419	33	0.015661	yes	NERVET
chr1_1978797_T_C_b38	SLC35E2	3.219	0.00138	0.047393	52	0.014724	yes	NERVET
chr1_1982826_T_C_b38	SLC35E2	3.219	0.00138	0.047393	52	0.014724	yes	NERVET
chr1_1976990_T_C_b38	SLC35E2	3.215	0.0014	0.047437	52	0.014755	yes	NERVET
chr1_1909167_G_A_b38	SLC35E2	3.212	0.00141	0.062553	12	0.019477	yes	NERVET
chr1_932255_C_T_b38	SLC35E2	3.211	0.00141	0.05653	16	0.017603	yes	NERVET
chr1_1963738_C_T_b38	SLC35E2	3.21	0.00142	0.050552	32	0.015749	yes	NERVET
chr1_1965114_C_T_b38	SLC35E2	3.21	0.00142	0.050552	32	0.015749	yes	NERVET
chr1_1966910_C_T_b38	SLC35E2	3.21	0.00142	0.050552	32	0.015749	yes	NERVET
chr1_945259_TC_T_b38	SLC35E2	3.21	0.00142	0.052415	27	0.01633	yes	NERVET
chr1_1965001_G_A_b38	SLC35E2	3.201	0.00146	0.050134	35	0.015661	yes	NERVET
chr1_1792696_C_CA_b38	SLC35E2	3.201	0.00147	0.04738	63	0.014804	yes	NERVET
chr1_1983048_A_G_b38	SLC35E2	3.2	0.00147	0.047115	80	0.014722	yes	NERVET
chr1_1776772_TA_T_b38	SLC35E2	3.199	0.00147	0.058689	13	0.018347	yes	NERVET
chr1_1963406_G_A_b38	SLC35E2	3.197	0.00148	0.04999	33	0.015635	yes	NERVET
chr1_1743712_G_A_b38	SLC35E2	3.197	0.00148	0.072476	8	0.022669	yes	NERVET
chr1_1898043_T_C_b38	SLC35E2	3.19	0.00152	0.061066	12	0.019143	yes	NERVET
chr1_1968585_TG_T_b38	SLC35E2	3.188	0.00153	0.049967	33	0.015673	yes	NERVET
chr1_1943403_C_G_b38	SLC35E2	3.188	0.00153	0.089835	4	0.028182	yes	NERVET
chr1_1965250_G_GA_b38	SLC35E2	3.177	0.00159	0.049438	36	0.015563	yes	NERVET
chr1_1716097_C_T_b38	SLC35E2	-3.173	0.00161	-0.072229	11	0.022761	yes	NERVET
chr1_1903242_C_T_b38	SLC35E2	3.168	0.00163	0.062266	11	0.019652	yes	NERVET
chr1_1906935_C_T_b38	SLC35E2	3.168	0.00163	0.062266	11	0.019652	yes	NERVET
chr1_1976870_C_CAG_b38	SLC35E2	3.162	0.00167	0.046038	51	0.014562	yes	NERVET
chr1_1964101_A_G_b38	SLC35E2	3.155	0.00171	0.049519	33	0.015694	yes	NERVET
chr1_1964746_T_C_b38	SLC35E2	3.155	0.00171	0.049519	33	0.015694	yes	NERVET
chr1_1964784_C_T_b38	SLC35E2	3.155	0.00171	0.049519	33	0.015694	yes	NERVET
chr1_1966030_A_G_b38	SLC35E2	3.155	0.00171	0.049519	33	0.015694	yes	NERVET
chr1_1966314_C_G_b38	SLC35E2	3.155	0.00171	0.049519	33	0.015694	yes	NERVET
chr1_1966930_G_A_b38	SLC35E2	3.155	0.00171	0.049519	33	0.015694	yes	NERVET
chr1_1967246_T_C_b38	SLC35E2	3.155	0.00171	0.049519	33	0.015694	yes	NERVET
chr1_1967338_G_C_b38	SLC35E2	3.155	0.00171	0.049519	33	0.015694	yes	NERVET
chr1_1967340_C_A_b38	SLC35E2	3.155	0.00171	0.049519	33	0.015694	yes	NERVET
chr1_1967389_T_C_b38	SLC35E2	3.155	0.00171	0.049519	33	0.015694	yes	NERVET
chr1_1967396_C_A_b38	SLC35E2	3.155	0.00171	0.049519	33	0.015694	yes	NERVET
chr1_1967420_G_A_b38	SLC35E2	3.155	0.00171	0.049519	33	0.015694	yes	NERVET
chr1_1967495_T_C_b38	SLC35E2	3.155	0.00171	0.049519	33	0.015694	yes	NERVET
chr1_1967536_G_A_b38	SLC35E2	3.155	0.00171	0.049519	33	0.015694	yes	NERVET
chr1_1967725_G_C_b38	SLC35E2	3.155	0.00171	0.049519	33	0.015694	yes	NERVET
chr1_1967840_A_T_b38	SLC35E2	3.155	0.00171	0.049519	33	0.015694	yes	NERVET
chr1_1967880_T_C_b38	SLC35E2	3.155	0.00171	0.049519	33	0.015694	yes	NERVET
chr1_1968422_C_T_b38	SLC35E2	3.155	0.00171	0.049519	33	0.015694	yes	NERVET
chr1_1966606_G_A_b38	SLC35E2	3.148	0.00175	0.049798	32	0.015819	yes	NERVET
chr1_1619986_T_C_b38	SLC35E2	3.137	0.00182	0.048441	45	0.015442	yes	NERVET
chr1_1966152_C_T_b38	SLC35E2	3.129	0.00186	0.049414	32	0.015791	yes	NERVET
chr1_1904424_A_AAAATAAAT_b38	SLC35E2	-3.127	0.00188	-0.041585	109	0.013301	yes	NERVET
chr1_1614340_C_T_b38	SLC35E2	3.112	0.00198	0.063742	8	0.020484	yes	NERVET
chr1_1698022_G_A_b38	SLC35E2	-3.111	0.00198	-0.113081	18	0.036352	yes	NERVET
chr1_1606099_G_GGTCAGGCGAGGGGTC_b38	SLC35E2	3.111	0.00198	0.047062	50	0.01513	yes	NERVET
chr1_1736729_G_T_b38	SLC35E2	3.107	0.00201	0.041609	146	0.013393	yes	NERVET
chr1_1877314_A_AT_b38	SLC35E2	3.105	0.00202	0.075288	7	0.024247	yes	NERVET
chr1_1746439_GA_G_b38	SLC35E2	3.105	0.00202	0.047795	99	0.015395	yes	NERVET
chr1_1735176_C_T_b38	SLC35E2	3.104	0.00202	0.04148	146	0.013362	yes	NERVET
chr1_1731963_A_C_b38	SLC35E2	3.104	0.00203	0.041384	147	0.013333	yes	NERVET
chr1_1688102_G_A_b38	SLC35E2	-3.101	0.00205	-0.050266	35	0.016208	yes	NERVET
chr1_1606094_G_GAGGGGTC_b38	SLC35E2	3.101	0.00205	0.050763	40	0.016371	yes	NERVET
chr1_1903577_C_T_b38	SLC35E2	3.097	0.00208	0.059969	13	0.019366	yes	NERVET
chr1_1058003_G_A_b38	SLC35E2	3.096	0.00208	0.093751	3	0.030277	yes	NERVET
chr1_929839_G_A_b38	SLC35E2	3.095	0.00209	0.054532	16	0.017617	yes	NERVET
chr1_1888382_A_AG_b38	SLC35E2	3.092	0.00211	0.063652	8	0.020586	yes	NERVET
chr1_1886690_A_C_b38	SLC35E2	3.091	0.00212	0.058089	13	0.018795	yes	NERVET
chr1_1721125_G_A_b38	SLC35E2	-3.088	0.00214	-0.070242	11	0.022748	yes	NERVET
chr1_1964663_G_A_b38	SLC35E2	3.078	0.00221	0.048663	32	0.01581	yes	NERVET
chr1_1624323_AT_A_b38	SLC35E2	3.075	0.00223	0.042775	79	0.013911	yes	NERVET
chr1_1968667_T_TCTC_b38	SLC35E2	3.069	0.00227	0.048286	33	0.015731	yes	NERVET
chr1_1672155_G_A_b38	SLC35E2	-3.068	0.00228	-0.048459	42	0.015793	yes	NERVET
chr1_1983989_A_AT_b38	SLC35E2	3.064	0.00231	0.048978	31	0.015985	yes	NERVET
chr1_2274109_A_C_b38	SLC35E2	3.059	0.00235	0.040725	95	0.013312	yes	NERVET
chr1_1981062_A_G_b38	SLC35E2	3.045	0.00246	0.045097	57	0.014809	yes	NERVET
chr1_1981291_A_G_b38	SLC35E2	3.045	0.00246	0.045097	57	0.014809	yes	NERVET
chr1_1981295_T_C_b38	SLC35E2	3.045	0.00246	0.045097	57	0.014809	yes	NERVET
chr1_1697979_G_A_b38	SLC35E2	-3.045	0.00246	-0.063385	4	0.020818	yes	NERVET
chr1_965666_ACC_A_b38	SLC35E2	3.044	0.00247	0.049707	28	0.01633	yes	NERVET
chr1_1593732_G_C_b38	SLC35E2	-3.032	0.00256	-0.041886	104	0.013813	yes	NERVET
chr1_1969006_C_T_b38	SLC35E2	3.032	0.00257	0.046617	36	0.015376	yes	NERVET
chr1_1740343_C_T_b38	SLC35E2	3.022	0.00265	0.040405	146	0.013371	yes	NERVET
chr1_1951642_C_T_b38	SLC35E2	3.012	0.00274	0.047425	35	0.015745	yes	NERVET
chr1_1951498_C_T_b38	SLC35E2	3.004	0.00281	0.047261	35	0.015732	yes	NERVET
chr1_1791389_G_A_b38	SLC35E2	3.004	0.00281	0.049858	24	0.016599	yes	NERVET
chr1_1987145_C_T_b38	SLC35E2	3	0.00285	0.044398	55	0.0148	yes	NERVET
chr1_1814815_A_AG_b38	SLC35E2	-2.995	0.00289	-0.051757	37	0.01728	yes	NERVET
chr1_1594890_G_GAC_b38	SLC35E2	-2.988	0.00295	-0.04129	103	0.013817	yes	NERVET
chr1_1740703_C_T_b38	SLC35E2	2.98	0.00303	0.039942	147	0.013404	yes	NERVET
chr1_1969235_A_G_b38	SLC35E2	2.978	0.00306	0.047898	28	0.016086	yes	NERVET
chr1_1968924_GCCCTCCTGGGGGCTCCGGTCCTGCCCAGCAGCCCCAGGTGAGACAGCGCCTGGCGGCCCCTCCCTAGCT_G_b38	SLC35E2	2.973	0.0031	0.04561	36	0.01534	yes	NERVET
chr1_1955420_C_T_b38	SLC35E2	2.969	0.00314	0.046606	33	0.015695	yes	NERVET
chr1_1732392_C_T_b38	SLC35E2	2.969	0.00314	0.039718	147	0.013376	yes	NERVET
chr1_1734174_A_G_b38	SLC35E2	2.969	0.00314	0.039718	147	0.013376	yes	NERVET
chr1_1734903_A_G_b38	SLC35E2	2.969	0.00314	0.039718	147	0.013376	yes	NERVET
chr1_1735980_A_C_b38	SLC35E2	2.969	0.00314	0.039718	147	0.013376	yes	NERVET
chr1_1609890_C_T_b38	SLC35E2	-2.961	0.00323	-0.060082	11	0.020292	yes	NERVET
chr1_1737504_A_C_b38	SLC35E2	2.954	0.0033	0.039265	151	0.013293	yes	NERVET
chr1_1736836_A_G_b38	SLC35E2	2.949	0.00335	0.039953	133	0.013547	yes	NERVET
chr1_1627156_G_A_b38	SLC35E2	-2.942	0.00342	-0.060151	10	0.020445	yes	NERVET
chr1_933741_T_TG_b38	SLC35E2	-2.931	0.00355	-0.043012	61	0.014674	yes	NERVET
chr1_1950071_C_A_b38	SLC35E2	2.915	0.00374	0.045564	36	0.015634	yes	NERVET
chr1_1882915_C_T_b38	SLC35E2	2.904	0.00386	0.055066	13	0.018959	yes	NERVET
chr1_2280375_C_CA_b38	SLC35E2	2.899	0.00392	0.049528	17	0.017084	yes	NERVET
chr1_2362863_C_CA_b38	SLC35E2	2.898	0.00393	0.052906	12	0.018254	yes	NERVET
chr1_1545968_T_C_b38	SLC35E2	2.868	0.00432	0.045089	36	0.015722	yes	NERVET
chr1_1738295_G_T_b38	SLC35E2	2.865	0.00435	0.038339	147	0.01338	yes	NERVET
chr1_1962845_T_C_b38	SLC35E2	2.855	0.0045	0.044658	34	0.015644	yes	NERVET
chr1_1650664_CT_C_b38	SLC35E2	2.85	0.00457	0.046361	46	0.016267	yes	NERVET
chr1_1968900_A_G_b38	SLC35E2	2.846	0.00462	0.044563	35	0.015657	yes	NERVET
chr1_931558_G_A_b38	SLC35E2	2.846	0.00463	0.047361	22	0.016644	yes	NERVET
chr1_1851414_GA_G_b38	SLC35E2	-2.844	0.00465	-0.044857	53	0.01577	yes	NERVET
chr1_1955652_CG_C_b38	SLC35E2	2.84	0.00471	0.045073	33	0.01587	yes	NERVET
chr1_2225560_G_C_b38	SLC35E2	2.834	0.0048	0.040521	56	0.014299	yes	NERVET
chr1_1606089_GGC_G_b38	SLC35E2	2.822	0.00497	0.045838	41	0.016241	yes	NERVET
chr1_1663759_G_A_b38	SLC35E2	-2.821	0.005	-0.076818	9	0.027232	yes	NERVET
chr1_1969249_A_AGCCCT_b38	SLC35E2	2.819	0.00502	0.045922	27	0.016289	yes	NERVET
chr1_1731904_CA_C_b38	SLC35E2	2.81	0.00517	0.04261	56	0.015165	yes	NERVET
chr1_1948594_G_GTTT_b38	SLC35E2	-2.808	0.00519	-0.092986	7	0.033112	yes	NERVET
chr1_1969238_C_T_b38	SLC35E2	2.807	0.00521	0.045249	28	0.016121	yes	NERVET
chr1_936972_G_C_b38	SLC35E2	2.792	0.00545	0.041398	50	0.014826	yes	NERVET
chr1_1695459_A_G_b38	SLC35E2	2.791	0.00547	0.045691	88	0.016369	yes	NERVET
chr1_1597128_C_CCCTCAGCTGGACT_b38	SLC35E2	-2.786	0.00556	-0.038655	83	0.013875	yes	NERVET
chr1_1952590_A_AAAAG_b38	SLC35E2	2.785	0.00557	0.042332	44	0.015198	yes	NERVET
chr1_928622_G_C_b38	SLC35E2	2.777	0.00572	0.049262	15	0.017742	yes	NERVET
chr1_2224923_A_G_b38	SLC35E2	2.765	0.00592	0.039508	56	0.014289	yes	NERVET
chr1_2238792_C_T_b38	SLC35E2	2.757	0.00606	0.038237	90	0.013868	yes	NERVET
chr1_1579717_T_A_b38	SLC35E2	2.755	0.00609	0.044423	33	0.016123	yes	NERVET
chr1_1585372_T_A_b38	SLC35E2	-2.754	0.00612	-0.057367	7	0.020831	yes	NERVET
chr1_1955672_GC_G_b38	SLC35E2	2.751	0.00617	0.04361	33	0.01585	yes	NERVET
chr1_1589618_A_T_b38	SLC35E2	-2.751	0.00618	-0.042132	52	0.015315	yes	NERVET
chr1_1653825_T_TACACAC_b38	SLC35E2	2.743	0.00632	0.04537	24	0.016539	yes	NERVET
chr1_1948037_T_A_b38	SLC35E2	2.73	0.00658	0.04782	20	0.017518	yes	NERVET
chr1_1615869_C_T_b38	SLC35E2	2.729	0.0066	0.041194	55	0.015097	yes	NERVET
chr1_1708486_C_A_b38	SLC35E2	2.728	0.00662	0.035391	106	0.012974	yes	NERVET
chr1_1876492_C_CGA_b38	SLC35E2	2.724	0.00669	0.053433	4	0.019615	yes	NERVET
chr1_2348393_G_A_b38	SLC35E2	2.718	0.00681	0.047356	19	0.017421	yes	NERVET
chr1_1145547_T_TCTGACCTCATGGCCGACCCCAC_b38	SLC35E2	2.717	0.00683	0.040026	42	0.01473	yes	NERVET
chr1_1141684_C_A_b38	SLC35E2	2.711	0.00696	0.059096	8	0.021801	yes	NERVET
chr1_1842403_C_A_b38	SLC35E2	2.71	0.00699	0.076212	3	0.028127	yes	NERVET
chr1_1851999_C_A_b38	SLC35E2	2.71	0.00699	0.076212	3	0.028127	yes	NERVET
chr1_2347212_C_T_b38	SLC35E2	2.706	0.00706	0.047162	18	0.017429	yes	NERVET
chr1_1590792_C_T_b38	SLC35E2	-2.705	0.00709	-0.059836	5	0.022121	yes	NERVET
chr1_1877312_A_T_b38	SLC35E2	2.703	0.00712	0.058023	12	0.021463	yes	NERVET
chr1_1453643_A_AT_b38	SLC35E2	-2.698	0.00724	-0.050465	13	0.018706	yes	NERVET
chr1_1956754_C_A_b38	SLC35E2	2.695	0.00729	0.042717	33	0.015849	yes	NERVET
chr1_2280410_A_G_b38	SLC35E2	2.693	0.00734	0.036235	92	0.013454	yes	NERVET
chr1_1810086_A_G_b38	SLC35E2	2.691	0.00737	0.046016	21	0.017097	yes	NERVET
chr1_1585717_C_A_b38	SLC35E2	-2.678	0.00767	-0.058446	6	0.021824	yes	NERVET
chr1_1524938_T_G_b38	SLC35E2	-2.673	0.00779	-0.105736	3	0.039564	yes	NERVET
chr1_1708855_TTCCTCCTCC_T_b38	SLC35E2	2.672	0.00781	0.039197	99	0.014669	yes	NERVET
chr1_1580890_C_T_b38	SLC35E2	2.663	0.00802	0.044563	29	0.016735	yes	NERVET
chr1_1154630_C_A_b38	SLC35E2	2.662	0.00803	0.059079	9	0.022192	yes	NERVET
chr1_1954781_C_T_b38	SLC35E2	2.658	0.00813	0.040098	57	0.015084	yes	NERVET
chr1_1936906_CA_C_b38	SLC35E2	2.656	0.00819	0.045591	16	0.017167	yes	NERVET
chr1_1845824_TACACACACACACACACACACACACACACAC_T_b38	SLC35E2	2.655	0.00821	0.041057	38	0.015465	yes	NERVET
chr1_1586215_A_G_b38	SLC35E2	-2.652	0.00828	-0.057958	6	0.021855	yes	NERVET
chr1_1818305_TAAAAAAA_T_b38	SLC35E2	2.643	0.0085	0.050286	13	0.019027	yes	NERVET
chr1_1954765_A_AGAGT_b38	SLC35E2	2.641	0.00854	0.039743	58	0.015048	yes	NERVET
chr1_1969229_T_A_b38	SLC35E2	2.64	0.00858	0.042505	28	0.016103	yes	NERVET
chr1_2249085_G_A_b38	SLC35E2	2.635	0.00869	0.03617	94	0.013726	yes	NERVET
chr1_922671_C_T_b38	SLC35E2	2.633	0.00875	0.047072	13	0.017877	yes	NERVET
chr1_1688647_G_A_b38	SLC35E2	-2.625	0.00896	-0.043763	40	0.016672	yes	NERVET
chr1_1991778_A_G_b38	SLC35E2	-2.62	0.00908	-0.041174	32	0.015714	yes	NERVET
chr1_1929306_C_T_b38	SLC35E2	2.62	0.00909	0.042029	28	0.016044	yes	NERVET
chr1_935954_G_T_b38	SLC35E2	-2.619	0.00911	-0.037824	82	0.014443	yes	NERVET
chr1_1921849_G_T_b38	SLC35E2	2.611	0.00931	0.039722	42	0.015212	yes	NERVET
chr1_917859_A_G_b38	SLC35E2	2.611	0.00932	0.045497	17	0.017425	yes	NERVET
chr1_1920497_C_A_b38	SLC35E2	-2.611	0.00933	-0.047648	15	0.018252	yes	NERVET
chr1_1613974_G_A_b38	SLC35E2	2.605	0.00947	0.040915	38	0.015704	yes	NERVET
chr1_1152303_T_C_b38	SLC35E2	2.596	0.00974	0.059406	7	0.022886	yes	NERVET
chr1_1774721_A_G_b38	SLC35E2	-2.594	0.00979	-0.041309	41	0.015925	yes	NERVET
chr1_1658115_G_A_b38	SLC35E2	-5.797	1.25e-08	-0.161982	4	0.027942	no	NERVET
chr1_1650000_G_A_b38	SLC35E2	4.838	1.79e-06	0.067012	73	0.013852	no	NERVET
chr1_1755713_G_A_b38	SLC35E2	-4.53	7.52e-06	-0.064666	86	0.014275	no	NERVET
chr1_1641261_C_T_b38	SLC35E2	-4.378	1.49e-05	-0.071126	27	0.016248	no	NERVET
chr1_1750508_A_C_b38	SLC35E2	-4.226	2.87e-05	-0.052545	106	0.012435	no	NERVET
chr1_1967499_G_A_b38	SLC35E2	4.186	3.41e-05	0.057587	96	0.013758	no	NERVET
chr1_1864334_AAAG_A_b38	SLC35E2	-4.163	3.75e-05	-0.071988	31	0.017293	no	NERVET
chr1_1722619_C_T_b38	SLC35E2	4.079	5.33e-05	0.075501	38	0.01851	no	NERVET
chr1_1963538_T_C_b38	SLC35E2	4.068	5.58e-05	0.056255	94	0.013829	no	NERVET
chr1_1798925_C_CT_b38	SLC35E2	-4.019	6.81e-05	-0.062025	44	0.015431	no	NERVET
chr1_1968793_T_C_b38	SLC35E2	3.939	9.47e-05	0.054754	97	0.013902	no	NERVET
chr1_1877330_T_C_b38	SLC35E2	-3.902	0.00011	-0.057874	87	0.014831	no	NERVET
chr1_1924269_C_T_b38	SLC35E2	-3.849	0.000135	-0.052905	111	0.013744	no	NERVET
chr1_1794187_C_T_b38	SLC35E2	3.842	0.000139	0.070129	14	0.018251	no	NERVET
chr1_1822247_A_G_b38	SLC35E2	3.84	0.00014	0.069537	15	0.018107	no	NERVET
chr1_1801188_T_C_b38	SLC35E2	3.799	0.000165	0.068017	16	0.017906	no	NERVET
chr1_1798974_C_T_b38	SLC35E2	3.798	0.000165	0.06986	14	0.018392	no	NERVET
chr1_1782906_T_G_b38	SLC35E2	3.797	0.000166	0.068999	15	0.018174	no	NERVET
chr1_967384_C_G_b38	SLC35E2	-3.778	0.000179	-0.055605	107	0.014719	no	NERVET
chr1_1775996_G_A_b38	SLC35E2	3.772	0.000183	0.069526	14	0.018432	no	NERVET
chr1_1845824_TACACAC_T_b38	SLC35E2	3.676	0.000265	0.062837	21	0.017095	no	NERVET
chr1_2334639_T_C_b38	SLC35E2	-3.654	0.000288	-0.051016	137	0.013961	no	NERVET
chr1_1955080_C_CGGCTCACACCGGAAGTGAGGCTCACACCGGAAGTGA_b38	SLC35E2	-3.65	0.000292	-0.052656	92	0.014424	no	NERVET
chr1_1936906_C_CA_b38	SLC35E2	-3.626	0.00032	-0.056982	56	0.015717	no	NERVET
chr1_965125_G_C_b38	SLC35E2	3.624	0.000323	0.058628	33	0.016179	no	NERVET
chr1_1657085_C_CTAA_b38	SLC35E2	-3.619	0.000329	-0.058593	41	0.016191	no	NERVET
chr1_1837340_C_T_b38	SLC35E2	3.609	0.000341	0.065556	14	0.018166	no	NERVET
chr1_1650370_C_CT_b38	SLC35E2	-3.592	0.000363	-0.061422	29	0.017099	no	NERVET
chr1_1857246_T_TAA_b38	SLC35E2	3.579	0.000382	0.067245	12	0.018791	no	NERVET
chr1_1857250_C_G_b38	SLC35E2	3.579	0.000382	0.067245	12	0.018791	no	NERVET
chr1_1846651_T_G_b38	SLC35E2	3.576	0.000385	0.065068	14	0.018194	no	NERVET
chr1_940296_GCC_G_b38	SLC35E2	-3.571	0.000394	-0.048538	93	0.013594	no	NERVET
chr1_1855245_G_A_b38	SLC35E2	3.557	0.000414	0.066986	12	0.018831	no	NERVET
chr1_1772160_A_AT_b38	SLC35E2	3.534	0.000451	0.065845	12	0.018633	no	NERVET
chr1_1855939_G_A_b38	SLC35E2	3.523	0.000469	0.066499	12	0.018875	no	NERVET
chr1_1880594_A_T_b38	SLC35E2	3.511	0.00049	0.061617	20	0.017549	no	NERVET
chr1_1657081_C_T_b38	SLC35E2	-3.447	0.000618	-0.054776	41	0.01589	no	NERVET
chr1_1913643_T_C_b38	SLC35E2	-3.444	0.000626	-0.051691	92	0.01501	no	NERVET
chr1_1910289_C_T_b38	SLC35E2	3.422	0.000677	0.061436	16	0.017953	no	NERVET
chr1_1910369_G_A_b38	SLC35E2	3.422	0.000677	0.061436	16	0.017953	no	NERVET
chr1_1910480_G_A_b38	SLC35E2	3.422	0.000677	0.061436	16	0.017953	no	NERVET
chr1_1857305_G_GGGCT_b38	SLC35E2	3.389	0.000762	0.063914	12	0.018861	no	NERVET
chr1_1912140_T_G_b38	SLC35E2	3.383	0.000777	0.059938	20	0.017716	no	NERVET
chr1_1727506_T_C_b38	SLC35E2	3.38	0.000785	0.058948	45	0.017438	no	NERVET
chr1_933038_C_T_b38	SLC35E2	3.341	0.000902	0.053014	38	0.015866	no	NERVET
chr1_1991761_T_C_b38	SLC35E2	3.291	0.00107	0.045263	83	0.013753	no	NERVET
chr1_1897985_C_G_b38	SLC35E2	3.257	0.00121	0.058603	16	0.017992	no	NERVET
chr1_946247_G_A_b38	SLC35E2	-3.247	0.00125	-0.048267	103	0.014864	no	NERVET
chr1_955679_C_T_b38	SLC35E2	-3.238	0.00129	-0.047309	99	0.014611	no	NERVET
chr1_956565_A_G_b38	SLC35E2	-3.238	0.00129	-0.047309	99	0.014611	no	NERVET
chr1_949171_GAGAA_G_b38	SLC35E2	-3.226	0.00134	-0.046694	101	0.014474	no	NERVET
chr1_1773713_T_A_b38	SLC35E2	-3.224	0.00135	-0.048275	55	0.014971	no	NERVET
chr1_1677707_C_T_b38	SLC35E2	-3.201	0.00147	-0.062854	13	0.019637	no	NERVET
chr1_1915143_A_G_b38	SLC35E2	-3.141	0.00179	-0.059848	11	0.019052	no	NERVET
chr1_1892085_G_C_b38	SLC35E2	3.138	0.00181	0.058893	12	0.018769	no	NERVET
chr1_1913504_CT_C_b38	SLC35E2	-3.123	0.0019	-0.049124	78	0.015728	no	NERVET
chr1_1902318_T_TA_b38	SLC35E2	-3.089	0.00213	-0.052006	43	0.016838	no	NERVET
chr1_1845840_C_G_b38	SLC35E2	3.061	0.00233	0.059652	6	0.019485	no	NERVET
chr1_1905533_AT_A_b38	SLC35E2	3.058	0.00236	0.06099	5	0.019943	no	NERVET
chr1_1881065_G_A_b38	SLC35E2	3.026	0.00262	0.056573	14	0.018695	no	NERVET
chr1_1881798_C_T_b38	SLC35E2	3.026	0.00262	0.056573	14	0.018695	no	NERVET
chr1_1835922_GA_G_b38	SLC35E2	3.018	0.00269	0.073444	6	0.024335	no	NERVET
chr1_1157285_CCCCGCCCCCAGCCCACCCAT_C_b38	SLC35E2	2.989	0.00295	0.038759	43	0.012968	no	NERVET
chr1_965337_CTTAT_C_b38	SLC35E2	-2.977	0.00307	-0.043933	114	0.014758	no	NERVET
chr1_1717604_CGCTTTCAGCTAGAGTTTGCTCTCTCTGGTTTTCGGTCTGTGACACACGCAT_C_b38	SLC35E2	2.963	0.0032	0.040916	85	0.013807	no	NERVET
chr1_1668373_C_T_b38	SLC35E2	2.955	0.00329	0.047843	62	0.016191	no	NERVET
chr1_2207909_C_CGT_b38	SLC35E2	-2.938	0.00347	-0.065893	6	0.02243	no	NERVET
chr1_1814797_CAAAAAAAAA_C_b38	SLC35E2	2.925	0.00361	0.057672	7	0.019716	no	NERVET
chr1_1589151_C_T_b38	SLC35E2	-2.844	0.00465	-0.04201	63	0.014769	no	NERVET
chr1_1934821_C_CGTTGTAGGTACGTGTGTACGTGGGTGTTAGGTTGTAGGTACACACGTGTATATGTGGGTGTTAG_b38	SLC35E2	-2.833	0.00481	-0.039392	58	0.013903	no	NERVET
chr1_935265_T_C_b38	SLC35E2	2.816	0.00507	0.042882	43	0.015227	no	NERVET
chr1_1931743_CA_C_b38	SLC35E2	-2.8	0.00532	-0.048004	38	0.017143	no	NERVET
chr1_1293731_A_ACGCCCCTGCCCTGGAGGCCCCGCCCCTGCCCTGGAGGCCC_b38	SLC35E2	-2.792	0.00546	-0.085548	5	0.030645	no	NERVET
chr1_1943142_A_G_b38	SLC35E2	-2.787	0.00554	-0.052866	12	0.018967	no	NERVET
chr1_941767_G_A_b38	SLC35E2	2.775	0.00575	0.046023	26	0.016588	no	NERVET
chr1_1568428_C_G_b38	SLC35E2	2.766	0.0059	0.043024	39	0.015552	no	NERVET
chr1_875916_GCTC_G_b38	SLC35E2	-2.758	0.00604	-0.094737	4	0.034348	no	NERVET
chr1_1725745_C_G_b38	SLC35E2	-2.745	0.00629	-0.045698	33	0.016649	no	NERVET
chr1_1922882_A_G_b38	SLC35E2	-2.744	0.0063	-0.051729	12	0.018849	no	NERVET
chr1_1925261_C_T_b38	SLC35E2	-2.744	0.0063	-0.051729	12	0.018849	no	NERVET
chr1_1773717_T_A_b38	SLC35E2	-2.665	0.00797	-0.038007	80	0.014262	no	NERVET
chr1_1882449_A_AAG_b38	SLC35E2	2.647	0.0084	0.063323	5	0.023923	no	NERVET
chr1_1554548_T_C_b38	SLC35E2	2.64	0.00858	0.040805	64	0.015458	no	NERVET
chr1_1161528_T_C_b38	SLC35E2	2.638	0.00862	0.061485	5	0.023306	no	NERVET
chr1_928223_T_A_b38	SLC35E2	2.636	0.00868	0.059477	4	0.022565	no	NERVET
chr1_1589057_T_C_b38	SLC35E2	-2.61	0.00936	-0.038568	63	0.014779	no	NERVET
chr1_1692151_T_C_b38	SLC35E2	-5.611	1.2e-07	-0.155891	13	0.027784	yes	OVARY
chr1_1742587_G_C_b38	SLC35E2	5.098	1.21e-06	0.119665	45	0.023472	yes	OVARY
chr1_1742672_C_T_b38	SLC35E2	-4.481	1.64e-05	-0.116067	25	0.025904	yes	OVARY
chr1_1743586_T_TAC_b38	SLC35E2	-4.464	1.75e-05	-0.117208	21	0.026254	yes	OVARY
chr1_1744499_C_T_b38	SLC35E2	-4.383	2.43e-05	-0.108933	34	0.024852	yes	OVARY
chr1_1743238_G_C_b38	SLC35E2	-4.322	3.09e-05	-0.114356	24	0.026456	yes	OVARY
chr1_1945842_A_AAAAGAAC_b38	SLC35E2	-4.163	5.75e-05	-0.106157	23	0.025498	yes	OVARY
chr1_1743851_C_T_b38	SLC35E2	-4.152	6e-05	-0.11751	11	0.028301	yes	OVARY
chr1_1754601_G_T_b38	SLC35E2	4.152	6e-05	0.098749	28	0.023783	yes	OVARY
chr1_1757725_C_T_b38	SLC35E2	4.152	6e-05	0.098749	28	0.023783	yes	OVARY
chr1_1762759_AAATG_A_b38	SLC35E2	4.125	6.65e-05	0.095282	36	0.023098	yes	OVARY
chr1_1865278_A_C_b38	SLC35E2	4.106	7.16e-05	0.093872	32	0.022862	yes	OVARY
chr1_1743886_C_T_b38	SLC35E2	-4.046	8.98e-05	-0.128388	7	0.031729	yes	OVARY
chr1_1730405_G_C_b38	SLC35E2	4.031	9.52e-05	0.107614	28	0.026698	yes	OVARY
chr1_1744052_GAGA_G_b38	SLC35E2	-4.009	0.000103	-0.129659	6	0.032339	yes	OVARY
chr1_1936906_C_CA_b38	SLC35E2	-4	0.000107	-0.104219	21	0.026057	yes	OVARY
chr1_1743840_T_C_b38	SLC35E2	-3.976	0.000117	-0.116874	10	0.029391	yes	OVARY
chr1_1737504_A_C_b38	SLC35E2	3.956	0.000126	0.095885	47	0.024238	yes	OVARY
chr1_1738295_G_T_b38	SLC35E2	3.944	0.000132	0.097468	46	0.024711	yes	OVARY
chr1_1755504_T_C_b38	SLC35E2	3.937	0.000135	0.09419	42	0.023922	yes	OVARY
chr1_1740703_C_T_b38	SLC35E2	3.932	0.000138	0.097161	47	0.024709	yes	OVARY
chr1_1760882_T_C_b38	SLC35E2	3.927	0.00014	0.091447	39	0.023285	yes	OVARY
chr1_1820337_A_G_b38	SLC35E2	3.924	0.000142	0.087997	41	0.022425	yes	OVARY
chr1_1674720_TGC_T_b38	SLC35E2	3.913	0.000148	0.085869	44	0.021943	yes	OVARY
chr1_1674868_G_A_b38	SLC35E2	3.913	0.000148	0.085869	44	0.021943	yes	OVARY
chr1_1676790_C_T_b38	SLC35E2	3.913	0.000148	0.085869	44	0.021943	yes	OVARY
chr1_1744028_A_AC_b38	SLC35E2	-3.885	0.000164	-0.127561	5	0.032835	yes	OVARY
chr1_1749826_A_G_b38	SLC35E2	-3.864	0.000177	-0.087416	44	0.022626	yes	OVARY
chr1_1687734_CAA_C_b38	SLC35E2	-3.834	0.000197	-0.101996	21	0.026601	yes	OVARY
chr1_1748780_G_A_b38	SLC35E2	-3.819	0.000209	-0.09053	37	0.023707	yes	OVARY
chr1_1747695_A_G_b38	SLC35E2	-3.811	0.000215	-0.076796	45	0.020153	yes	OVARY
chr1_1731963_A_C_b38	SLC35E2	3.806	0.000218	0.094102	47	0.024722	yes	OVARY
chr1_1732392_C_T_b38	SLC35E2	3.806	0.000218	0.094102	47	0.024722	yes	OVARY
chr1_1734903_A_G_b38	SLC35E2	3.806	0.000218	0.094102	47	0.024722	yes	OVARY
chr1_1735176_C_T_b38	SLC35E2	3.806	0.000218	0.094102	47	0.024722	yes	OVARY
chr1_1735980_A_C_b38	SLC35E2	3.806	0.000218	0.094102	47	0.024722	yes	OVARY
chr1_1736729_G_T_b38	SLC35E2	3.806	0.000218	0.094102	47	0.024722	yes	OVARY
chr1_1740343_C_T_b38	SLC35E2	3.806	0.000218	0.094102	47	0.024722	yes	OVARY
chr1_1937802_G_T_b38	SLC35E2	-3.78	0.00024	-0.090544	36	0.023952	yes	OVARY
chr1_1944074_T_C_b38	SLC35E2	-3.773	0.000247	-0.090668	38	0.024033	yes	OVARY
chr1_1944091_G_C_b38	SLC35E2	-3.773	0.000247	-0.090668	38	0.024033	yes	OVARY
chr1_1945121_T_C_b38	SLC35E2	-3.773	0.000247	-0.090668	38	0.024033	yes	OVARY
chr1_1688619_AAAC_A_b38	SLC35E2	-3.769	0.00025	-0.115004	7	0.030512	yes	OVARY
chr1_1677720_T_G_b38	SLC35E2	3.767	0.000251	0.083194	44	0.022083	yes	OVARY
chr1_1677726_A_T_b38	SLC35E2	3.767	0.000251	0.083194	44	0.022083	yes	OVARY
chr1_1651926_T_C_b38	SLC35E2	-3.749	0.000269	-0.096269	14	0.025681	yes	OVARY
chr1_1750280_A_G_b38	SLC35E2	-3.746	0.000271	-0.08805	41	0.023502	yes	OVARY
chr1_1670423_AT_A_b38	SLC35E2	3.737	0.00028	0.099466	24	0.026614	yes	OVARY
chr1_1944182_G_C_b38	SLC35E2	-3.726	0.000292	-0.090084	37	0.024178	yes	OVARY
chr1_1673968_GA_G_b38	SLC35E2	3.716	0.000302	0.104136	18	0.028021	yes	OVARY
chr1_1747472_A_T_b38	SLC35E2	-3.668	0.000358	-0.087781	39	0.023929	yes	OVARY
chr1_1753033_C_T_b38	SLC35E2	-3.664	0.000364	-0.089265	40	0.024364	yes	OVARY
chr1_1734174_A_G_b38	SLC35E2	3.653	0.000377	0.090071	47	0.024653	yes	OVARY
chr1_1938125_TCA_T_b38	SLC35E2	-3.642	0.000393	-0.086429	38	0.023731	yes	OVARY
chr1_1744652_C_T_b38	SLC35E2	-3.63	0.000409	-0.092752	31	0.025551	yes	OVARY
chr1_1937895_C_T_b38	SLC35E2	-3.629	0.000411	-0.086242	38	0.023764	yes	OVARY
chr1_1942887_C_G_b38	SLC35E2	-3.629	0.000411	-0.086242	38	0.023764	yes	OVARY
chr1_1650195_A_G_b38	SLC35E2	-3.626	0.000415	-0.096527	14	0.026618	yes	OVARY
chr1_1639348_G_T_b38	SLC35E2	-3.62	0.000425	-0.090535	20	0.025013	yes	OVARY
chr1_1769969_CAAAACA_C_b38	SLC35E2	3.618	0.000427	0.081065	36	0.022405	yes	OVARY
chr1_1944419_C_G_b38	SLC35E2	-3.615	0.000432	-0.087433	38	0.024188	yes	OVARY
chr1_1946013_C_T_b38	SLC35E2	-3.615	0.000432	-0.087433	38	0.024188	yes	OVARY
chr1_1946058_T_C_b38	SLC35E2	-3.615	0.000432	-0.087433	38	0.024188	yes	OVARY
chr1_1946632_C_T_b38	SLC35E2	-3.615	0.000432	-0.087433	38	0.024188	yes	OVARY
chr1_1947189_C_T_b38	SLC35E2	-3.615	0.000432	-0.087433	38	0.024188	yes	OVARY
chr1_1743714_C_CA_b38	SLC35E2	3.611	0.000438	0.097765	28	0.027078	yes	OVARY
chr1_1637577_T_C_b38	SLC35E2	-3.604	0.000448	-0.093783	13	0.02602	yes	OVARY
chr1_1679993_A_G_b38	SLC35E2	-3.602	0.000451	-0.084908	33	0.02357	yes	OVARY
chr1_1651137_C_T_b38	SLC35E2	-3.597	0.00046	-0.092536	14	0.025726	yes	OVARY
chr1_1651267_T_C_b38	SLC35E2	-3.597	0.00046	-0.092536	14	0.025726	yes	OVARY
chr1_1651421_GTAGCCCCTCTGAACGGTCTGTGACACACGCATGCTTTCAGCTAGAGTACTCTA_G_b38	SLC35E2	-3.597	0.00046	-0.092536	14	0.025726	yes	OVARY
chr1_1651574_G_A_b38	SLC35E2	-3.597	0.00046	-0.092536	14	0.025726	yes	OVARY
chr1_1651785_C_A_b38	SLC35E2	-3.597	0.00046	-0.092536	14	0.025726	yes	OVARY
chr1_1652135_C_G_b38	SLC35E2	-3.597	0.00046	-0.092536	14	0.025726	yes	OVARY
chr1_1652191_C_T_b38	SLC35E2	-3.597	0.00046	-0.092536	14	0.025726	yes	OVARY
chr1_1652592_A_G_b38	SLC35E2	-3.597	0.00046	-0.092536	14	0.025726	yes	OVARY
chr1_1652779_A_G_b38	SLC35E2	-3.597	0.00046	-0.092536	14	0.025726	yes	OVARY
chr1_1653147_A_C_b38	SLC35E2	-3.597	0.00046	-0.092536	14	0.025726	yes	OVARY
chr1_1653396_T_C_b38	SLC35E2	-3.597	0.00046	-0.092536	14	0.025726	yes	OVARY
chr1_1653472_T_C_b38	SLC35E2	-3.597	0.00046	-0.092536	14	0.025726	yes	OVARY
chr1_1653811_G_A_b38	SLC35E2	-3.597	0.00046	-0.092536	14	0.025726	yes	OVARY
chr1_1653893_C_T_b38	SLC35E2	-3.597	0.00046	-0.092536	14	0.025726	yes	OVARY
chr1_1653934_G_A_b38	SLC35E2	-3.597	0.00046	-0.092536	14	0.025726	yes	OVARY
chr1_1654143_G_A_b38	SLC35E2	-3.597	0.00046	-0.092536	14	0.025726	yes	OVARY
chr1_1748597_C_G_b38	SLC35E2	-3.585	0.000479	-0.085521	39	0.023852	yes	OVARY
chr1_1955018_A_AGGAAGTGCGGCTCACACC_b38	SLC35E2	3.567	0.000509	0.116897	4	0.032769	yes	OVARY
chr1_1650777_G_A_b38	SLC35E2	-3.555	0.000531	-0.090768	14	0.02553	yes	OVARY
chr1_1942186_G_A_b38	SLC35E2	3.542	0.000555	0.101701	6	0.02871	yes	OVARY
chr1_1648826_A_G_b38	SLC35E2	-3.537	0.000565	-0.090933	17	0.025706	yes	OVARY
chr1_1758323_T_C_b38	SLC35E2	3.532	0.000576	0.080992	34	0.022934	yes	OVARY
chr1_1944216_C_T_b38	SLC35E2	-3.53	0.000579	-0.086133	37	0.024399	yes	OVARY
chr1_1750440_G_A_b38	SLC35E2	-3.528	0.000584	-0.103364	21	0.029299	yes	OVARY
chr1_1648636_G_A_b38	SLC35E2	-3.513	0.000614	-0.091026	17	0.02591	yes	OVARY
chr1_1671995_G_T_b38	SLC35E2	3.49	0.000666	0.076856	45	0.022025	yes	OVARY
chr1_1673060_G_A_b38	SLC35E2	3.485	0.000676	0.077224	44	0.022158	yes	OVARY
chr1_1673818_A_C_b38	SLC35E2	3.469	0.000715	0.076569	45	0.022076	yes	OVARY
chr1_1945975_TG_T_b38	SLC35E2	-3.461	0.000734	-0.086729	39	0.025059	yes	OVARY
chr1_1935987_G_A_b38	SLC35E2	-3.444	0.000776	-0.083437	38	0.024223	yes	OVARY
chr1_1743544_CA_C_b38	SLC35E2	3.437	0.000797	0.08206	42	0.023878	yes	OVARY
chr1_1726904_T_C_b38	SLC35E2	3.433	0.000806	0.085002	39	0.02476	yes	OVARY
chr1_1641275_A_G_b38	SLC35E2	-3.423	0.000834	-0.092974	17	0.027161	yes	OVARY
chr1_1949564_T_TG_b38	SLC35E2	-3.42	0.000842	-0.105177	5	0.030752	yes	OVARY
chr1_1950848_A_G_b38	SLC35E2	-3.42	0.000842	-0.105177	5	0.030752	yes	OVARY
chr1_1951510_A_G_b38	SLC35E2	-3.42	0.000842	-0.105177	5	0.030752	yes	OVARY
chr1_1951521_C_A_b38	SLC35E2	-3.42	0.000842	-0.105177	5	0.030752	yes	OVARY
chr1_1650383_G_T_b38	SLC35E2	-3.42	0.000844	-0.091144	13	0.026653	yes	OVARY
chr1_1652061_T_C_b38	SLC35E2	-3.419	0.000845	-0.087506	15	0.025594	yes	OVARY
chr1_1654188_T_G_b38	SLC35E2	-3.419	0.000845	-0.087506	15	0.025594	yes	OVARY
chr1_1726162_T_C_b38	SLC35E2	3.409	0.000875	0.085836	41	0.02518	yes	OVARY
chr1_1750428_G_C_b38	SLC35E2	-3.391	0.000929	-0.097097	23	0.028636	yes	OVARY
chr1_1802763_T_TAA_b38	SLC35E2	3.388	0.000938	0.103261	5	0.030478	yes	OVARY
chr1_1688647_G_A_b38	SLC35E2	-3.367	0.00101	-0.103111	9	0.030624	yes	OVARY
chr1_1924788_C_T_b38	SLC35E2	-3.349	0.00107	-0.080726	39	0.024103	yes	OVARY
chr1_1955580_A_G_b38	SLC35E2	-3.344	0.00108	-0.101168	5	0.03025	yes	OVARY
chr1_1662738_CT_C_b38	SLC35E2	-3.314	0.0012	-0.132383	6	0.039952	yes	OVARY
chr1_1944675_C_T_b38	SLC35E2	-3.308	0.00122	-0.081088	37	0.024511	yes	OVARY
chr1_1658866_G_A_b38	SLC35E2	-3.304	0.00124	-0.082292	16	0.024905	yes	OVARY
chr1_1659114_A_G_b38	SLC35E2	-3.304	0.00124	-0.082292	16	0.024905	yes	OVARY
chr1_1659220_A_G_b38	SLC35E2	-3.304	0.00124	-0.082292	16	0.024905	yes	OVARY
chr1_1661420_C_A_b38	SLC35E2	-3.304	0.00124	-0.082292	16	0.024905	yes	OVARY
chr1_1754482_TCCCTGGGACCGAAGTCGCCCCA_T_b38	SLC35E2	-3.304	0.00124	-0.080447	37	0.02435	yes	OVARY
chr1_1649846_G_A_b38	SLC35E2	-3.29	0.0013	-0.093668	8	0.028469	yes	OVARY
chr1_1707555_C_T_b38	SLC35E2	-3.287	0.00131	-0.167505	14	0.050956	yes	OVARY
chr1_1925233_T_C_b38	SLC35E2	-3.284	0.00132	-0.079428	38	0.024187	yes	OVARY
chr1_1663513_C_T_b38	SLC35E2	-3.278	0.00135	-0.173855	3	0.053041	yes	OVARY
chr1_1914345_C_T_b38	SLC35E2	-3.278	0.00135	-0.079296	38	0.024192	yes	OVARY
chr1_1914918_G_A_b38	SLC35E2	-3.278	0.00135	-0.079296	38	0.024192	yes	OVARY
chr1_1915326_G_A_b38	SLC35E2	-3.278	0.00135	-0.079296	38	0.024192	yes	OVARY
chr1_1916217_C_T_b38	SLC35E2	-3.278	0.00135	-0.079296	38	0.024192	yes	OVARY
chr1_1920695_A_G_b38	SLC35E2	-3.278	0.00135	-0.079296	38	0.024192	yes	OVARY
chr1_1921333_C_T_b38	SLC35E2	-3.278	0.00135	-0.079296	38	0.024192	yes	OVARY
chr1_1752730_C_G_b38	SLC35E2	-3.274	0.00137	-0.081522	37	0.024899	yes	OVARY
chr1_1753319_G_A_b38	SLC35E2	-3.274	0.00137	-0.081522	37	0.024899	yes	OVARY
chr1_1753361_G_A_b38	SLC35E2	-3.274	0.00137	-0.081522	37	0.024899	yes	OVARY
chr1_1929904_C_T_b38	SLC35E2	-3.274	0.00137	-0.079227	37	0.024201	yes	OVARY
chr1_1930143_C_T_b38	SLC35E2	-3.274	0.00137	-0.079227	37	0.024201	yes	OVARY
chr1_1755523_C_T_b38	SLC35E2	3.267	0.0014	0.07972	45	0.024399	yes	OVARY
chr1_1947648_G_A_b38	SLC35E2	3.266	0.0014	0.095482	6	0.029237	yes	OVARY
chr1_1958353_A_T_b38	SLC35E2	-3.263	0.00142	-0.099368	5	0.030456	yes	OVARY
chr1_1925281_C_T_b38	SLC35E2	-3.256	0.00145	-0.079376	37	0.024375	yes	OVARY
chr1_1762287_A_G_b38	SLC35E2	-3.255	0.00145	-0.08213	36	0.02523	yes	OVARY
chr1_1671097_G_C_b38	SLC35E2	3.24	0.00153	0.083313	13	0.025712	yes	OVARY
chr1_1688586_C_T_b38	SLC35E2	-3.234	0.00156	-0.101312	6	0.031332	yes	OVARY
chr1_1722625_A_T_b38	SLC35E2	3.21	0.00168	0.101211	12	0.031529	yes	OVARY
chr1_1722626_AGCG_A_b38	SLC35E2	3.21	0.00168	0.101211	12	0.031529	yes	OVARY
chr1_1954783_T_G_b38	SLC35E2	-3.21	0.00168	-0.098276	5	0.030619	yes	OVARY
chr1_1954946_T_C_b38	SLC35E2	-3.21	0.00168	-0.098276	5	0.030619	yes	OVARY
chr1_1668721_C_T_b38	SLC35E2	-3.208	0.00169	-0.08534	11	0.026603	yes	OVARY
chr1_1660683_C_T_b38	SLC35E2	-3.204	0.00171	-0.082971	14	0.025896	yes	OVARY
chr1_1756043_G_T_b38	SLC35E2	-3.195	0.00176	-0.079099	38	0.024755	yes	OVARY
chr1_1769969_CAAAACAAAAACA_C_b38	SLC35E2	-3.192	0.00178	-0.080701	38	0.025282	yes	OVARY
chr1_1650664_CTTTTT_C_b38	SLC35E2	-3.186	0.00181	-0.0877	10	0.027523	yes	OVARY
chr1_1797530_C_A_b38	SLC35E2	-3.184	0.00183	-0.078847	36	0.024766	yes	OVARY
chr1_1932079_AC_A_b38	SLC35E2	-3.18	0.00185	-0.078559	21	0.024704	yes	OVARY
chr1_1903603_G_A_b38	SLC35E2	3.175	0.00188	0.092488	7	0.029126	yes	OVARY
chr1_1903617_C_T_b38	SLC35E2	3.175	0.00188	0.092488	7	0.029126	yes	OVARY
chr1_1808816_G_T_b38	SLC35E2	-3.166	0.00194	-0.078261	37	0.024719	yes	OVARY
chr1_1817295_T_C_b38	SLC35E2	-3.166	0.00194	-0.078261	37	0.024719	yes	OVARY
chr1_1819825_G_A_b38	SLC35E2	-3.166	0.00194	-0.078261	37	0.024719	yes	OVARY
chr1_1827774_A_G_b38	SLC35E2	-3.166	0.00194	-0.078261	37	0.024719	yes	OVARY
chr1_1843381_A_T_b38	SLC35E2	-3.166	0.00194	-0.078261	37	0.024719	yes	OVARY
chr1_1846009_AGG_A_b38	SLC35E2	-3.166	0.00194	-0.078261	37	0.024719	yes	OVARY
chr1_1846011_G_GTCC_b38	SLC35E2	-3.166	0.00194	-0.078261	37	0.024719	yes	OVARY
chr1_1847030_A_G_b38	SLC35E2	-3.166	0.00194	-0.078261	37	0.024719	yes	OVARY
chr1_1850017_G_T_b38	SLC35E2	-3.166	0.00194	-0.078261	37	0.024719	yes	OVARY
chr1_1635226_T_C_b38	SLC35E2	-3.145	0.00207	-0.109067	3	0.034684	yes	OVARY
chr1_1652913_C_T_b38	SLC35E2	-3.143	0.00208	-0.08254	13	0.026262	yes	OVARY
chr1_1918090_A_G_b38	SLC35E2	-3.131	0.00217	-0.07629	38	0.024369	yes	OVARY
chr1_1927857_T_C_b38	SLC35E2	-3.131	0.00217	-0.07629	38	0.024369	yes	OVARY
chr1_1729859_A_G_b38	SLC35E2	3.125	0.0022	0.096909	3	0.031008	yes	OVARY
chr1_1767762_C_A_b38	SLC35E2	3.115	0.00227	0.084235	12	0.027038	yes	OVARY
chr1_1773215_C_A_b38	SLC35E2	3.115	0.00227	0.084235	12	0.027038	yes	OVARY
chr1_1774308_G_A_b38	SLC35E2	3.115	0.00227	0.084235	12	0.027038	yes	OVARY
chr1_1776301_T_G_b38	SLC35E2	3.115	0.00227	0.084235	12	0.027038	yes	OVARY
chr1_1774165_A_G_b38	SLC35E2	3.11	0.00231	0.086152	10	0.027705	yes	OVARY
chr1_1925307_C_A_b38	SLC35E2	-3.105	0.00235	-0.076167	35	0.024533	yes	OVARY
chr1_1650405_G_A_b38	SLC35E2	-3.097	0.00241	-0.138456	4	0.044705	yes	OVARY
chr1_1664865_A_G_b38	SLC35E2	-3.096	0.00241	-0.078308	15	0.025293	yes	OVARY
chr1_1849781_T_C_b38	SLC35E2	-3.089	0.00247	-0.080523	15	0.02607	yes	OVARY
chr1_1865177_G_A_b38	SLC35E2	-3.089	0.00247	-0.080523	15	0.02607	yes	OVARY
chr1_1828894_T_TAC_b38	SLC35E2	3.082	0.00252	0.073981	32	0.024004	yes	OVARY
chr1_1755713_G_A_b38	SLC35E2	-3.079	0.00255	-0.074347	37	0.024148	yes	OVARY
chr1_1671797_G_A_b38	SLC35E2	3.072	0.00261	0.069592	42	0.022656	yes	OVARY
chr1_1735008_G_GTTTT_b38	SLC35E2	3.07	0.00262	0.075282	42	0.02452	yes	OVARY
chr1_1803531_C_T_b38	SLC35E2	3.068	0.00264	0.082388	13	0.026858	yes	OVARY
chr1_1830566_A_T_b38	SLC35E2	3.068	0.00264	0.082388	13	0.026858	yes	OVARY
chr1_1839349_C_G_b38	SLC35E2	3.068	0.00264	0.082388	13	0.026858	yes	OVARY
chr1_1839350_T_A_b38	SLC35E2	3.068	0.00264	0.082388	13	0.026858	yes	OVARY
chr1_1851181_C_T_b38	SLC35E2	3.068	0.00264	0.082388	13	0.026858	yes	OVARY
chr1_1662855_T_C_b38	SLC35E2	-3.046	0.00282	-0.119024	7	0.03907	yes	OVARY
chr1_1671148_C_T_b38	SLC35E2	3.042	0.00286	0.080233	12	0.026379	yes	OVARY
chr1_1842237_T_C_b38	SLC35E2	3.033	0.00294	0.079916	15	0.026349	yes	OVARY
chr1_1659060_G_A_b38	SLC35E2	-3.029	0.00298	-0.077147	14	0.025474	yes	OVARY
chr1_1664757_T_C_b38	SLC35E2	-3.028	0.00298	-0.076475	15	0.025256	yes	OVARY
chr1_1739131_T_C_b38	SLC35E2	3.026	0.003	0.072166	29	0.023845	yes	OVARY
chr1_1873952_G_A_b38	SLC35E2	3.021	0.00305	0.081252	13	0.026896	yes	OVARY
chr1_1878651_C_T_b38	SLC35E2	3.021	0.00305	0.081252	13	0.026896	yes	OVARY
chr1_1879682_G_A_b38	SLC35E2	3.021	0.00305	0.081252	13	0.026896	yes	OVARY
chr1_1957586_A_G_b38	SLC35E2	-3.018	0.00307	-0.089061	7	0.029508	yes	OVARY
chr1_1890186_G_A_b38	SLC35E2	3.007	0.00318	0.081065	13	0.026959	yes	OVARY
chr1_1776772_TAA_T_b38	SLC35E2	-3.005	0.0032	-0.07847	15	0.026114	yes	OVARY
chr1_1831318_C_T_b38	SLC35E2	-3.001	0.00324	-0.075245	36	0.025072	yes	OVARY
chr1_1885444_TTAGA_T_b38	SLC35E2	3.001	0.00324	0.081956	11	0.027312	yes	OVARY
chr1_2335858_C_T_b38	SLC35E2	2.995	0.0033	0.087308	10	0.029151	yes	OVARY
chr1_1650688_T_A_b38	SLC35E2	-2.977	0.00349	-0.07803	13	0.02621	yes	OVARY
chr1_1938467_C_T_b38	SLC35E2	2.965	0.00362	0.085625	6	0.028883	yes	OVARY
chr1_1951920_A_G_b38	SLC35E2	-2.959	0.00369	-0.096229	5	0.032524	yes	OVARY
chr1_1956930_A_G_b38	SLC35E2	-2.959	0.00369	-0.096229	5	0.032524	yes	OVARY
chr1_1668108_C_T_b38	SLC35E2	2.952	0.00377	0.074946	16	0.025391	yes	OVARY
chr1_1836126_C_A_b38	SLC35E2	-2.939	0.00391	-0.070591	39	0.024019	yes	OVARY
chr1_1842213_A_G_b38	SLC35E2	2.938	0.00393	0.0787	14	0.026789	yes	OVARY
chr1_1842221_C_G_b38	SLC35E2	2.938	0.00393	0.0787	14	0.026789	yes	OVARY
chr1_1842333_G_A_b38	SLC35E2	2.938	0.00393	0.0787	14	0.026789	yes	OVARY
chr1_1702383_T_C_b38	SLC35E2	-2.937	0.00393	-0.088697	8	0.030197	yes	OVARY
chr1_1912607_C_T_b38	SLC35E2	-2.924	0.00409	-0.07308	35	0.024992	yes	OVARY
chr1_1948515_C_T_b38	SLC35E2	-2.922	0.00411	-0.074442	34	0.025474	yes	OVARY
chr1_1948519_T_C_b38	SLC35E2	-2.922	0.00411	-0.074442	34	0.025474	yes	OVARY
chr1_1897325_G_A_b38	SLC35E2	2.921	0.00413	0.08404	7	0.028773	yes	OVARY
chr1_1674633_C_CA_b38	SLC35E2	2.92	0.00414	0.077078	18	0.026392	yes	OVARY
chr1_1739519_C_G_b38	SLC35E2	2.914	0.00422	0.087969	11	0.030191	yes	OVARY
chr1_1900918_G_A_b38	SLC35E2	2.907	0.00431	0.083544	8	0.028739	yes	OVARY
chr1_1907199_A_G_b38	SLC35E2	2.907	0.00431	0.083544	8	0.028739	yes	OVARY
chr1_1938221_TCA_T_b38	SLC35E2	2.906	0.00432	0.084094	6	0.02894	yes	OVARY
chr1_1684266_T_C_b38	SLC35E2	-2.903	0.00436	-0.070368	30	0.02424	yes	OVARY
chr1_1687159_G_T_b38	SLC35E2	-2.903	0.00436	-0.070368	30	0.02424	yes	OVARY
chr1_1731904_CA_C_b38	SLC35E2	2.899	0.00441	0.079729	18	0.027502	yes	OVARY
chr1_1808642_TTTTG_T_b38	SLC35E2	2.897	0.00444	0.077718	14	0.026827	yes	OVARY
chr1_1708855_TTCCTCCTCC_T_b38	SLC35E2	2.895	0.00447	0.078158	35	0.027	yes	OVARY
chr1_1934896_C_T_b38	SLC35E2	2.893	0.0045	0.083949	6	0.029023	yes	OVARY
chr1_1675091_A_G_b38	SLC35E2	-2.886	0.00459	-0.081351	9	0.028191	yes	OVARY
chr1_1907077_C_A_b38	SLC35E2	2.872	0.00479	0.087571	7	0.030497	yes	OVARY
chr1_1881428_C_T_b38	SLC35E2	2.868	0.00484	0.083387	8	0.029078	yes	OVARY
chr1_1664417_G_A_b38	SLC35E2	2.861	0.00494	0.080944	12	0.028292	yes	OVARY
chr1_1810086_A_G_b38	SLC35E2	2.853	0.00506	0.084517	8	0.029624	yes	OVARY
chr1_1952823_TA_T_b38	SLC35E2	-2.851	0.0051	-0.07375	31	0.025873	yes	OVARY
chr1_1950071_C_T_b38	SLC35E2	-2.848	0.00514	-0.074395	31	0.026126	yes	OVARY
chr1_1952064_G_A_b38	SLC35E2	-2.848	0.00514	-0.074395	31	0.026126	yes	OVARY
chr1_1960609_G_C_b38	SLC35E2	-2.839	0.00527	-0.072693	29	0.025604	yes	OVARY
chr1_1658830_C_G_b38	SLC35E2	-2.836	0.00531	-0.076918	10	0.027117	yes	OVARY
chr1_1742468_G_C_b38	SLC35E2	2.834	0.00534	0.072051	47	0.02542	yes	OVARY
chr1_1845824_TACACACACACACACACACACACACACACAC_T_b38	SLC35E2	2.808	0.00578	0.07535	14	0.026836	yes	OVARY
chr1_1915022_C_T_b38	SLC35E2	2.794	0.00602	0.079942	7	0.028613	yes	OVARY
chr1_1947645_C_T_b38	SLC35E2	-2.78	0.00626	-0.069917	35	0.02515	yes	OVARY
chr1_1855321_C_CA_b38	SLC35E2	2.777	0.00631	0.083666	10	0.030124	yes	OVARY
chr1_1684308_G_C_b38	SLC35E2	-2.769	0.00646	-0.067137	29	0.024245	yes	OVARY
chr1_1684619_G_A_b38	SLC35E2	-2.769	0.00646	-0.067137	29	0.024245	yes	OVARY
chr1_1780791_C_T_b38	SLC35E2	2.74	0.00703	0.076236	10	0.027825	yes	OVARY
chr1_1782430_T_G_b38	SLC35E2	2.74	0.00703	0.076236	10	0.027825	yes	OVARY
chr1_1783572_C_A_b38	SLC35E2	2.74	0.00703	0.076236	10	0.027825	yes	OVARY
chr1_1794321_C_T_b38	SLC35E2	2.74	0.00703	0.076236	10	0.027825	yes	OVARY
chr1_1805214_T_G_b38	SLC35E2	2.74	0.00703	0.076236	10	0.027825	yes	OVARY
chr1_1827615_G_A_b38	SLC35E2	2.74	0.00703	0.076236	10	0.027825	yes	OVARY
chr1_1834655_A_C_b38	SLC35E2	2.74	0.00703	0.076236	10	0.027825	yes	OVARY
chr1_1837455_C_T_b38	SLC35E2	2.74	0.00703	0.076236	10	0.027825	yes	OVARY
chr1_1851762_G_A_b38	SLC35E2	2.74	0.00703	0.076236	10	0.027825	yes	OVARY
chr1_1852145_G_A_b38	SLC35E2	2.74	0.00703	0.076236	10	0.027825	yes	OVARY
chr1_1836856_CT_C_b38	SLC35E2	2.728	0.00728	0.087654	6	0.032135	yes	OVARY
chr1_1884183_G_A_b38	SLC35E2	2.722	0.00741	0.074055	13	0.027211	yes	OVARY
chr1_1910289_C_T_b38	SLC35E2	2.708	0.00769	0.082905	6	0.03061	yes	OVARY
chr1_1910369_G_A_b38	SLC35E2	2.708	0.00769	0.082905	6	0.03061	yes	OVARY
chr1_1910480_G_A_b38	SLC35E2	2.708	0.00769	0.082905	6	0.03061	yes	OVARY
chr1_1869595_G_A_b38	SLC35E2	2.695	0.008	0.075134	10	0.027881	yes	OVARY
chr1_1878070_C_T_b38	SLC35E2	2.695	0.008	0.075134	10	0.027881	yes	OVARY
chr1_1881006_GGA_G_b38	SLC35E2	2.695	0.008	0.075134	10	0.027881	yes	OVARY
chr1_1888667_A_C_b38	SLC35E2	2.695	0.008	0.075134	10	0.027881	yes	OVARY
chr1_1744121_A_C_b38	SLC35E2	-2.683	0.00827	-0.094411	19	0.03519	yes	OVARY
chr1_2335286_T_C_b38	SLC35E2	-2.67	0.00857	-0.077543	9	0.029038	yes	OVARY
chr1_1791389_G_A_b38	SLC35E2	2.662	0.00877	0.079152	8	0.029732	yes	OVARY
chr1_2414976_CTT_C_b38	SLC35E2	-2.66	0.00882	-0.071709	26	0.026957	yes	OVARY
chr1_1425464_CA_C_b38	SLC35E2	-2.655	0.00895	-0.092959	3	0.035016	yes	OVARY
chr1_1842226_T_C_b38	SLC35E2	2.654	0.00898	0.072765	14	0.027421	yes	OVARY
chr1_1877330_T_C_b38	SLC35E2	-2.649	0.00911	-0.068125	29	0.02572	yes	OVARY
chr1_1639685_G_A_b38	SLC35E2	-2.647	0.00916	-0.075907	9	0.028681	yes	OVARY
chr1_1728671_C_A_b38	SLC35E2	2.646	0.00919	0.084064	5	0.031775	yes	OVARY
chr1_1937046_G_A_b38	SLC35E2	2.631	0.00958	0.08294	5	0.031528	yes	OVARY
chr1_1708521_C_G_b38	SLC35E2	-2.617	0.00995	-0.072969	16	0.027884	yes	OVARY
chr1_1734308_T_C_b38	SLC35E2	2.616	0.00998	0.113863	3	0.043526	yes	OVARY
chr1_1692124_T_G_b38	SLC35E2	-5.465	2.35e-07	-0.159979	14	0.029273	no	OVARY
chr1_1938332_A_ACT_b38	SLC35E2	-4.809	4.22e-06	-0.106117	37	0.022066	no	OVARY
chr1_1942014_G_A_b38	SLC35E2	-4.699	6.68e-06	-0.103635	36	0.022053	no	OVARY
chr1_1942075_A_G_b38	SLC35E2	-4.699	6.68e-06	-0.103635	36	0.022053	no	OVARY
chr1_1942086_T_C_b38	SLC35E2	-4.699	6.68e-06	-0.103635	36	0.022053	no	OVARY
chr1_1937841_ACACCAGGTCCACCTCTGGACACAGGTCCACC_A_b38	SLC35E2	-4.59	1.05e-05	-0.102749	36	0.022385	no	OVARY
chr1_1940540_G_A_b38	SLC35E2	-4.59	1.05e-05	-0.102749	36	0.022385	no	OVARY
chr1_1940973_C_T_b38	SLC35E2	-4.59	1.05e-05	-0.102749	36	0.022385	no	OVARY
chr1_1942258_G_A_b38	SLC35E2	-4.59	1.05e-05	-0.102749	36	0.022385	no	OVARY
chr1_1942260_G_C_b38	SLC35E2	-4.59	1.05e-05	-0.102749	36	0.022385	no	OVARY
chr1_1938054_ACT_A_b38	SLC35E2	-4.584	1.08e-05	-0.102624	36	0.022386	no	OVARY
chr1_1744854_C_A_b38	SLC35E2	-4.572	1.13e-05	-0.110436	24	0.024153	no	OVARY
chr1_1936627_C_G_b38	SLC35E2	-4.569	1.14e-05	-0.102391	35	0.022408	no	OVARY
chr1_1933087_C_T_b38	SLC35E2	-4.461	1.78e-05	-0.101516	35	0.022757	no	OVARY
chr1_1933859_A_G_b38	SLC35E2	-4.461	1.78e-05	-0.101516	35	0.022757	no	OVARY
chr1_1937273_T_C_b38	SLC35E2	-4.422	2.08e-05	-0.099054	34	0.0224	no	OVARY
chr1_1756186_T_C_b38	SLC35E2	4.407	2.21e-05	0.100163	29	0.02273	no	OVARY
chr1_1935938_T_C_b38	SLC35E2	-4.366	2.59e-05	-0.098319	33	0.022518	no	OVARY
chr1_1936077_C_T_b38	SLC35E2	-4.354	2.72e-05	-0.101613	38	0.023337	no	OVARY
chr1_1926870_T_C_b38	SLC35E2	-4.262	3.92e-05	-0.095183	32	0.022334	no	OVARY
chr1_1916417_G_T_b38	SLC35E2	-4.245	4.18e-05	-0.097162	35	0.022888	no	OVARY
chr1_1922670_A_G_b38	SLC35E2	-4.153	5.99e-05	-0.094608	35	0.022783	no	OVARY
chr1_1928648_C_T_b38	SLC35E2	-4.153	5.99e-05	-0.094608	35	0.022783	no	OVARY
chr1_1914634_G_T_b38	SLC35E2	-4.101	7.31e-05	-0.09308	35	0.022699	no	OVARY
chr1_1916670_G_C_b38	SLC35E2	-4.101	7.31e-05	-0.09308	35	0.022699	no	OVARY
chr1_1781909_C_T_b38	SLC35E2	4.023	9.8e-05	0.089441	40	0.022232	no	OVARY
chr1_1931580_CA_C_b38	SLC35E2	-4.007	0.000104	-0.09401	35	0.02346	no	OVARY
chr1_1931587_A_G_b38	SLC35E2	-4.007	0.000104	-0.09401	35	0.02346	no	OVARY
chr1_1934565_G_A_b38	SLC35E2	-3.993	0.00011	-0.094952	37	0.023783	no	OVARY
chr1_1866635_T_TA_b38	SLC35E2	3.973	0.000118	0.109488	21	0.027561	no	OVARY
chr1_1844830_C_A_b38	SLC35E2	3.934	0.000137	0.088169	39	0.022411	no	OVARY
chr1_1848037_C_CTA_b38	SLC35E2	3.934	0.000137	0.088169	39	0.022411	no	OVARY
chr1_1779667_T_TTG_b38	SLC35E2	3.934	0.000137	0.101392	22	0.025776	no	OVARY
chr1_1921745_T_C_b38	SLC35E2	-3.906	0.000152	-0.089018	34	0.022789	no	OVARY
chr1_1736836_A_G_b38	SLC35E2	3.9	0.000155	0.094311	42	0.024185	no	OVARY
chr1_1918989_A_G_b38	SLC35E2	-3.863	0.000178	-0.088465	35	0.022903	no	OVARY
chr1_1752126_G_A_b38	SLC35E2	3.806	0.000219	0.100992	17	0.026536	no	OVARY
chr1_1750226_C_T_b38	SLC35E2	3.793	0.000229	0.090961	29	0.023984	no	OVARY
chr1_1757074_G_T_b38	SLC35E2	3.789	0.000232	0.089607	29	0.023647	no	OVARY
chr1_1764023_C_A_b38	SLC35E2	3.785	0.000236	0.087704	31	0.023173	no	OVARY
chr1_1749637_G_T_b38	SLC35E2	3.748	0.00027	0.087208	29	0.023269	no	OVARY
chr1_1944420_A_G_b38	SLC35E2	-3.631	0.000409	-0.086377	39	0.023791	no	OVARY
chr1_1773460_G_A_b38	SLC35E2	-3.437	0.000795	-0.084145	37	0.02448	no	OVARY
chr1_1773476_C_G_b38	SLC35E2	-3.437	0.000795	-0.084145	37	0.02448	no	OVARY
chr1_1751981_A_T_b38	SLC35E2	-3.373	0.000987	-0.095869	14	0.028425	no	OVARY
chr1_1279400_C_CT_b38	SLC35E2	3.284	0.00132	0.167859	3	0.051121	no	OVARY
chr1_1901262_C_T_b38	SLC35E2	-3.235	0.00155	-0.080438	38	0.024863	no	OVARY
chr1_1901386_C_A_b38	SLC35E2	-3.235	0.00155	-0.080438	38	0.024863	no	OVARY
chr1_1851414_GA_G_b38	SLC35E2	-3.212	0.00167	-0.084138	18	0.026195	no	OVARY
chr1_1687643_G_A_b38	SLC35E2	-3.211	0.00168	-0.077603	32	0.024169	no	OVARY
chr1_1764887_C_A_b38	SLC35E2	-3.21	0.00168	-0.079455	37	0.024749	no	OVARY
chr1_1766653_A_G_b38	SLC35E2	-3.21	0.00168	-0.079455	37	0.024749	no	OVARY
chr1_1771864_G_A_b38	SLC35E2	-3.21	0.00168	-0.079455	37	0.024749	no	OVARY
chr1_1772410_T_C_b38	SLC35E2	-3.21	0.00168	-0.079455	37	0.024749	no	OVARY
chr1_1772426_T_A_b38	SLC35E2	-3.21	0.00168	-0.079455	37	0.024749	no	OVARY
chr1_1773848_A_C_b38	SLC35E2	-3.21	0.00168	-0.079455	37	0.024749	no	OVARY
chr1_1776461_GAAAC_G_b38	SLC35E2	-3.21	0.00168	-0.079455	37	0.024749	no	OVARY
chr1_1777362_A_G_b38	SLC35E2	-3.21	0.00168	-0.079455	37	0.024749	no	OVARY
chr1_1790040_C_T_b38	SLC35E2	-3.21	0.00168	-0.079455	37	0.024749	no	OVARY
chr1_1791493_C_T_b38	SLC35E2	-3.21	0.00168	-0.079455	37	0.024749	no	OVARY
chr1_1791592_G_A_b38	SLC35E2	-3.21	0.00168	-0.079455	37	0.024749	no	OVARY
chr1_1792927_G_A_b38	SLC35E2	-3.21	0.00168	-0.079455	37	0.024749	no	OVARY
chr1_1773713_T_A_b38	SLC35E2	-3.21	0.00168	-0.077949	25	0.024285	no	OVARY
chr1_1899573_C_T_b38	SLC35E2	-3.189	0.0018	-0.080098	37	0.025118	no	OVARY
chr1_1759354_G_A_b38	SLC35E2	-3.189	0.0018	-0.079001	38	0.024774	no	OVARY
chr1_1759611_C_T_b38	SLC35E2	-3.189	0.0018	-0.079001	38	0.024774	no	OVARY
chr1_1752461_G_A_b38	SLC35E2	-3.184	0.00183	-0.079662	37	0.02502	no	OVARY
chr1_1770997_G_A_b38	SLC35E2	-3.18	0.00185	-0.077956	37	0.024516	no	OVARY
chr1_1881428_C_CT_b38	SLC35E2	-3.178	0.00186	-0.07832	36	0.024642	no	OVARY
chr1_1680556_A_G_b38	SLC35E2	-3.172	0.0019	-0.074845	32	0.023599	no	OVARY
chr1_1687153_A_G_b38	SLC35E2	-3.17	0.00191	-0.076743	33	0.024208	no	OVARY
chr1_1902439_C_T_b38	SLC35E2	-3.16	0.00197	-0.077932	39	0.024658	no	OVARY
chr1_1902481_G_A_b38	SLC35E2	-3.16	0.00197	-0.077932	39	0.024658	no	OVARY
chr1_1880596_T_A_b38	SLC35E2	-3.149	0.00204	-0.077752	34	0.024692	no	OVARY
chr1_1860718_A_C_b38	SLC35E2	-3.111	0.0023	-0.076779	38	0.024676	no	OVARY
chr1_1866508_A_G_b38	SLC35E2	-3.111	0.0023	-0.076779	38	0.024676	no	OVARY
chr1_1875208_T_C_b38	SLC35E2	-3.111	0.0023	-0.076779	38	0.024676	no	OVARY
chr1_1879567_T_C_b38	SLC35E2	-3.111	0.0023	-0.076779	38	0.024676	no	OVARY
chr1_1881082_C_T_b38	SLC35E2	-3.111	0.0023	-0.076779	38	0.024676	no	OVARY
chr1_1881249_A_G_b38	SLC35E2	-3.111	0.0023	-0.076779	38	0.024676	no	OVARY
chr1_1886800_G_A_b38	SLC35E2	-3.111	0.0023	-0.076779	38	0.024676	no	OVARY
chr1_1891654_C_CAGAG_b38	SLC35E2	-3.111	0.0023	-0.076779	38	0.024676	no	OVARY
chr1_1905586_C_T_b38	SLC35E2	-3.106	0.00234	-0.076993	37	0.024789	no	OVARY
chr1_1909234_G_A_b38	SLC35E2	-3.106	0.00234	-0.076993	37	0.024789	no	OVARY
chr1_1909238_G_A_b38	SLC35E2	-3.106	0.00234	-0.076993	37	0.024789	no	OVARY
chr1_1680214_T_C_b38	SLC35E2	-3.073	0.00259	-0.073267	32	0.023842	no	OVARY
chr1_1685108_CA_C_b38	SLC35E2	-3.045	0.00283	-0.091263	13	0.029972	no	OVARY
chr1_1866635_T_TAAA_b38	SLC35E2	-3.027	0.00299	-0.078326	22	0.025878	no	OVARY
chr1_1750589_G_A_b38	SLC35E2	-2.997	0.00328	-0.130892	3	0.043667	no	OVARY
chr1_2335275_G_C_b38	SLC35E2	-2.964	0.00362	-0.088265	8	0.029776	no	OVARY
chr1_1683909_A_C_b38	SLC35E2	-2.949	0.00379	-0.071905	34	0.024379	no	OVARY
chr1_1686017_A_AT_b38	SLC35E2	-2.941	0.00388	-0.070546	32	0.023983	no	OVARY
chr1_1687061_C_T_b38	SLC35E2	-2.941	0.00388	-0.070546	32	0.023983	no	OVARY
chr1_1722619_C_T_b38	SLC35E2	2.938	0.00393	0.092938	13	0.031635	no	OVARY
chr1_1924264_CCG_C_b38	SLC35E2	-2.933	0.00399	-0.067115	42	0.022884	no	OVARY
chr1_1951865_G_GT_b38	SLC35E2	-2.928	0.00404	-0.076318	32	0.026065	no	OVARY
chr1_1913643_T_C_b38	SLC35E2	-2.922	0.00412	-0.075229	30	0.025746	no	OVARY
chr1_1738606_C_T_b38	SLC35E2	2.898	0.00443	0.088026	22	0.030378	no	OVARY
chr1_1938493_C_CAT_b38	SLC35E2	-2.87	0.00481	-0.091805	4	0.031989	no	OVARY
chr1_1939978_T_C_b38	SLC35E2	-2.87	0.00481	-0.091805	4	0.031989	no	OVARY
chr1_1943142_A_G_b38	SLC35E2	-2.87	0.00481	-0.091805	4	0.031989	no	OVARY
chr1_1943706_C_T_b38	SLC35E2	-2.87	0.00481	-0.091805	4	0.031989	no	OVARY
chr1_1943828_A_G_b38	SLC35E2	-2.87	0.00481	-0.091805	4	0.031989	no	OVARY
chr1_1945799_T_G_b38	SLC35E2	-2.87	0.00481	-0.091805	4	0.031989	no	OVARY
chr1_1921849_G_T_b38	SLC35E2	2.86	0.00496	0.078285	13	0.027373	no	OVARY
chr1_1583688_A_C_b38	SLC35E2	-2.845	0.00518	-0.074587	18	0.026216	no	OVARY
chr1_1741276_C_T_b38	SLC35E2	-2.842	0.00523	-0.077597	23	0.027308	no	OVARY
chr1_1924269_C_T_b38	SLC35E2	-2.841	0.00524	-0.064984	42	0.022871	no	OVARY
chr1_1680672_C_T_b38	SLC35E2	-2.834	0.00535	-0.072827	40	0.025696	no	OVARY
chr1_1686882_T_C_b38	SLC35E2	-2.829	0.00542	-0.066313	38	0.023438	no	OVARY
chr1_1681164_G_A_b38	SLC35E2	-2.824	0.00551	-0.067505	31	0.023904	no	OVARY
chr1_1743565_AT_A_b38	SLC35E2	2.815	0.00565	0.062652	48	0.022254	no	OVARY
chr1_1951106_G_A_b38	SLC35E2	-2.812	0.00571	-0.073194	32	0.026033	no	OVARY
chr1_935426_C_CGGAGCTCCTCT_b38	SLC35E2	-2.807	0.00578	-0.166782	6	0.05941	no	OVARY
chr1_1948594_G_GTTT_b38	SLC35E2	-2.798	0.00594	-0.148042	3	0.052902	no	OVARY
chr1_1688442_T_C_b38	SLC35E2	-2.793	0.00604	-0.082826	10	0.029659	no	OVARY
chr1_1945913_T_C_b38	SLC35E2	-2.757	0.00669	-0.0867	4	0.031442	no	OVARY
chr1_1627515_C_T_b38	SLC35E2	2.757	0.0067	0.067336	27	0.024426	no	OVARY
chr1_1922882_A_G_b38	SLC35E2	-2.748	0.00687	-0.088919	4	0.032357	no	OVARY
chr1_1925261_C_T_b38	SLC35E2	-2.748	0.00687	-0.088919	4	0.032357	no	OVARY
chr1_1904424_A_AAAATAAATAAAT_b38	SLC35E2	2.745	0.00693	0.061278	26	0.022325	no	OVARY
chr1_1891450_G_C_b38	SLC35E2	-2.732	0.00719	-0.070241	32	0.02571	no	OVARY
chr1_1688531_T_C_b38	SLC35E2	-2.725	0.00733	-0.090625	5	0.033251	no	OVARY
chr1_1641261_C_T_b38	SLC35E2	-2.722	0.00741	-0.087911	5	0.0323	no	OVARY
chr1_1688409_C_G_b38	SLC35E2	-2.714	0.00758	-0.076684	23	0.028258	no	OVARY
chr1_1955080_C_CGGCTCACACCGGAAGTGAGGCTCACACCGGAAGTGA_b38	SLC35E2	-2.707	0.00772	-0.06976	30	0.025769	no	OVARY
chr1_1708505_G_C_b38	SLC35E2	2.692	0.00807	0.061638	32	0.0229	no	OVARY
chr1_1524911_C_T_b38	SLC35E2	2.68	0.00834	0.129152	6	0.048194	no	OVARY
chr1_1717604_CGCTTTCAGCTAGAGTTTGCTCTCTCTGGTTTTCGGTCTGTGACACACGCAT_C_b38	SLC35E2	2.662	0.00878	0.072698	29	0.027311	no	OVARY
chr1_1938771_G_A_b38	SLC35E2	-2.642	0.00927	-0.084196	4	0.031867	no	OVARY
chr1_1924011_A_G_b38	SLC35E2	-2.638	0.00938	-0.090346	3	0.034244	no	OVARY
chr1_2047887_T_C_b38	SLC35E2	-2.625	0.00972	-0.064464	24	0.024554	no	OVARY
chr1_1918697_C_T_b38	SLC35E2	2.622	0.00982	0.072144	14	0.02752	no	OVARY
chr1_2225467_A_AT_b38	SLC35E2	-2.617	0.00993	-0.081275	8	0.031051	no	OVARY
chr1_1677720_T_G_b38	SLC35E2	7.097	1.32e-11	0.099938	74	0.014082	yes	PNCREAS
chr1_1676790_C_T_b38	SLC35E2	7.043	1.83e-11	0.098505	72	0.013986	yes	PNCREAS
chr1_1674868_G_A_b38	SLC35E2	6.983	2.61e-11	0.100455	70	0.014385	yes	PNCREAS
chr1_1671995_G_T_b38	SLC35E2	6.937	3.44e-11	0.100056	69	0.014423	yes	PNCREAS
chr1_1677726_A_T_b38	SLC35E2	6.888	4.61e-11	0.097274	74	0.014123	yes	PNCREAS
chr1_1674720_TGC_T_b38	SLC35E2	6.799	7.74e-11	0.098586	69	0.0145	yes	PNCREAS
chr1_1673818_A_C_b38	SLC35E2	6.725	1.19e-10	0.097386	71	0.014481	yes	PNCREAS
chr1_1729859_A_G_b38	SLC35E2	6.68	1.55e-10	0.11871	12	0.01777	yes	PNCREAS
chr1_1671797_G_A_b38	SLC35E2	6.65	1.84e-10	0.096748	68	0.014549	yes	PNCREAS
chr1_1673060_G_A_b38	SLC35E2	6.627	2.1e-10	0.098275	68	0.014829	yes	PNCREAS
chr1_1728671_C_A_b38	SLC35E2	6.529	3.69e-10	0.120412	13	0.018442	yes	PNCREAS
chr1_1739131_T_C_b38	SLC35E2	6.478	4.93e-10	0.096006	51	0.01482	yes	PNCREAS
chr1_1722625_A_T_b38	SLC35E2	5.965	8.36e-09	0.111704	27	0.018727	yes	PNCREAS
chr1_1722626_AGCG_A_b38	SLC35E2	5.952	8.95e-09	0.111255	27	0.018692	yes	PNCREAS
chr1_1722619_C_T_b38	SLC35E2	5.78	2.23e-08	0.107944	27	0.018676	yes	PNCREAS
chr1_1722690_TA_T_b38	SLC35E2	-5.449	1.22e-07	-0.135947	3	0.02495	yes	PNCREAS
chr1_1674633_C_CA_b38	SLC35E2	5.396	1.59e-07	0.087515	34	0.016219	yes	PNCREAS
chr1_1717507_T_C_b38	SLC35E2	5.389	1.64e-07	0.117295	15	0.021767	yes	PNCREAS
chr1_1637577_T_C_b38	SLC35E2	-5.305	2.49e-07	-0.090551	22	0.017069	yes	PNCREAS
chr1_1650195_A_G_b38	SLC35E2	-5.274	2.91e-07	-0.08803	27	0.016693	yes	PNCREAS
chr1_1648736_G_A_b38	SLC35E2	5.245	3.33e-07	0.077894	71	0.01485	yes	PNCREAS
chr1_1649932_C_T_b38	SLC35E2	5.238	3.46e-07	0.078363	67	0.014962	yes	PNCREAS
chr1_1661562_G_C_b38	SLC35E2	5.201	4.14e-07	0.071513	72	0.01375	yes	PNCREAS
chr1_1708474_C_A_b38	SLC35E2	-5.17	4.8e-07	-0.097302	15	0.018819	yes	PNCREAS
chr1_1675091_A_G_b38	SLC35E2	-5.086	7.2e-07	-0.091487	15	0.017988	yes	PNCREAS
chr1_1673968_GA_G_b38	SLC35E2	5.063	8.04e-07	0.091062	31	0.017987	yes	PNCREAS
chr1_1665061_C_T_b38	SLC35E2	-4.865	2.03e-06	-0.087659	16	0.018019	yes	PNCREAS
chr1_1651653_C_T_b38	SLC35E2	4.859	2.09e-06	0.072969	75	0.015017	yes	PNCREAS
chr1_1661177_A_G_b38	SLC35E2	-4.818	2.53e-06	-0.086074	16	0.017866	yes	PNCREAS
chr1_1636278_G_T_b38	SLC35E2	4.749	3.46e-06	0.072168	62	0.015198	yes	PNCREAS
chr1_1658830_C_G_b38	SLC35E2	-4.718	3.98e-06	-0.084299	16	0.017869	yes	PNCREAS
chr1_1665581_C_G_b38	SLC35E2	-4.661	5.12e-06	-0.081334	17	0.017448	yes	PNCREAS
chr1_1739519_C_G_b38	SLC35E2	4.646	5.48e-06	0.084281	21	0.01814	yes	PNCREAS
chr1_1734308_T_C_b38	SLC35E2	4.637	5.72e-06	0.106085	10	0.022879	yes	PNCREAS
chr1_1668717_C_G_b38	SLC35E2	-4.496	1.06e-05	-0.08126	16	0.018075	yes	PNCREAS
chr1_1737789_T_C_b38	SLC35E2	4.493	1.07e-05	0.100839	8	0.022442	yes	PNCREAS
chr1_1639685_G_A_b38	SLC35E2	-4.485	1.11e-05	-0.081651	17	0.018205	yes	PNCREAS
chr1_1649846_G_A_b38	SLC35E2	-4.464	1.22e-05	-0.084619	13	0.018956	yes	PNCREAS
chr1_1668542_C_T_b38	SLC35E2	-4.43	1.41e-05	-0.081889	14	0.018484	yes	PNCREAS
chr1_1660683_C_T_b38	SLC35E2	-4.412	1.52e-05	-0.078427	20	0.017774	yes	PNCREAS
chr1_1648826_A_G_b38	SLC35E2	-4.41	1.54e-05	-0.075064	30	0.01702	yes	PNCREAS
chr1_1667948_A_G_b38	SLC35E2	-4.382	1.73e-05	-0.080604	15	0.018393	yes	PNCREAS
chr1_1714674_G_C_b38	SLC35E2	4.355	1.94e-05	0.091819	24	0.021081	yes	PNCREAS
chr1_1669613_G_A_b38	SLC35E2	-4.312	2.33e-05	-0.078775	15	0.018269	yes	PNCREAS
chr1_1648636_G_A_b38	SLC35E2	-4.304	2.41e-05	-0.073513	30	0.017078	yes	PNCREAS
chr1_1668721_C_T_b38	SLC35E2	-4.284	2.63e-05	-0.073244	22	0.017099	yes	PNCREAS
chr1_1707555_C_T_b38	SLC35E2	-4.241	3.15e-05	-0.114296	26	0.026953	yes	PNCREAS
chr1_1659060_G_A_b38	SLC35E2	-4.239	3.17e-05	-0.071582	24	0.016887	yes	PNCREAS
chr1_1669576_G_A_b38	SLC35E2	-4.223	3.38e-05	-0.078686	14	0.018633	yes	PNCREAS
chr1_1638879_C_T_b38	SLC35E2	-4.22	3.42e-05	-0.075536	19	0.017899	yes	PNCREAS
chr1_1658866_G_A_b38	SLC35E2	-4.208	3.6e-05	-0.070678	27	0.016797	yes	PNCREAS
chr1_1654662_CT_C_b38	SLC35E2	4.198	3.75e-05	0.070394	46	0.016768	yes	PNCREAS
chr1_1646352_A_C_b38	SLC35E2	4.184	3.98e-05	0.091529	8	0.021877	yes	PNCREAS
chr1_1659114_A_G_b38	SLC35E2	-4.173	4.16e-05	-0.070598	26	0.016918	yes	PNCREAS
chr1_1659220_A_G_b38	SLC35E2	-4.173	4.16e-05	-0.070598	26	0.016918	yes	PNCREAS
chr1_1661420_C_A_b38	SLC35E2	-4.173	4.16e-05	-0.070598	26	0.016918	yes	PNCREAS
chr1_1653863_C_A_b38	SLC35E2	-4.166	4.28e-05	-0.083638	9	0.020077	yes	PNCREAS
chr1_1671148_C_T_b38	SLC35E2	4.148	4.61e-05	0.069352	27	0.01672	yes	PNCREAS
chr1_1668108_C_T_b38	SLC35E2	4.086	5.92e-05	0.06948	25	0.017003	yes	PNCREAS
chr1_1720288_G_A_b38	SLC35E2	4.058	6.63e-05	0.101166	22	0.02493	yes	PNCREAS
chr1_1670423_AT_A_b38	SLC35E2	4.057	6.65e-05	0.077742	31	0.019161	yes	PNCREAS
chr1_1703583_A_G_b38	SLC35E2	-4.053	6.76e-05	-0.103355	24	0.0255	yes	PNCREAS
chr1_1708521_C_G_b38	SLC35E2	-4.047	6.93e-05	-0.069722	25	0.017229	yes	PNCREAS
chr1_1652913_C_T_b38	SLC35E2	-3.987	8.8e-05	-0.069214	22	0.017361	yes	PNCREAS
chr1_1651421_GTAGCCCCTCTGAACGGTCTGTGACACACGCATGCTTTCAGCTAGAGTACTCTA_G_b38	SLC35E2	-3.972	9.34e-05	-0.06873	23	0.017305	yes	PNCREAS
chr1_1722599_G_A_b38	SLC35E2	3.97	9.4e-05	0.068347	39	0.017215	yes	PNCREAS
chr1_1650688_T_A_b38	SLC35E2	-3.948	0.000102	-0.068231	22	0.017281	yes	PNCREAS
chr1_1716210_C_CT_b38	SLC35E2	3.942	0.000105	0.09867	22	0.025029	yes	PNCREAS
chr1_1730405_G_C_b38	SLC35E2	3.91	0.000119	0.06864	40	0.017554	yes	PNCREAS
chr1_1649976_G_A_b38	SLC35E2	3.905	0.000121	0.060932	57	0.015603	yes	PNCREAS
chr1_1651137_C_T_b38	SLC35E2	-3.887	0.00013	-0.067092	24	0.017263	yes	PNCREAS
chr1_1651267_T_C_b38	SLC35E2	-3.887	0.00013	-0.067092	24	0.017263	yes	PNCREAS
chr1_1651574_G_A_b38	SLC35E2	-3.887	0.00013	-0.067092	24	0.017263	yes	PNCREAS
chr1_1651785_C_A_b38	SLC35E2	-3.887	0.00013	-0.067092	24	0.017263	yes	PNCREAS
chr1_1651926_T_C_b38	SLC35E2	-3.887	0.00013	-0.067092	24	0.017263	yes	PNCREAS
chr1_1652061_T_C_b38	SLC35E2	-3.887	0.00013	-0.067092	24	0.017263	yes	PNCREAS
chr1_1652135_C_G_b38	SLC35E2	-3.887	0.00013	-0.067092	24	0.017263	yes	PNCREAS
chr1_1652191_C_T_b38	SLC35E2	-3.887	0.00013	-0.067092	24	0.017263	yes	PNCREAS
chr1_1652592_A_G_b38	SLC35E2	-3.887	0.00013	-0.067092	24	0.017263	yes	PNCREAS
chr1_1652779_A_G_b38	SLC35E2	-3.887	0.00013	-0.067092	24	0.017263	yes	PNCREAS
chr1_1653147_A_C_b38	SLC35E2	-3.887	0.00013	-0.067092	24	0.017263	yes	PNCREAS
chr1_1653396_T_C_b38	SLC35E2	-3.887	0.00013	-0.067092	24	0.017263	yes	PNCREAS
chr1_1653472_T_C_b38	SLC35E2	-3.887	0.00013	-0.067092	24	0.017263	yes	PNCREAS
chr1_1653811_G_A_b38	SLC35E2	-3.887	0.00013	-0.067092	24	0.017263	yes	PNCREAS
chr1_1653893_C_T_b38	SLC35E2	-3.887	0.00013	-0.067092	24	0.017263	yes	PNCREAS
chr1_1654143_G_A_b38	SLC35E2	-3.887	0.00013	-0.067092	24	0.017263	yes	PNCREAS
chr1_1654188_T_G_b38	SLC35E2	-3.887	0.00013	-0.067092	24	0.017263	yes	PNCREAS
chr1_1664865_A_G_b38	SLC35E2	-3.863	0.000143	-0.065456	25	0.016944	yes	PNCREAS
chr1_1639348_G_T_b38	SLC35E2	-3.855	0.000148	-0.064404	32	0.016709	yes	PNCREAS
chr1_1650777_G_A_b38	SLC35E2	-3.838	0.000157	-0.065829	24	0.01715	yes	PNCREAS
chr1_1667424_T_TAAAATA_b38	SLC35E2	3.83	0.000162	0.06156	39	0.016074	yes	PNCREAS
chr1_1653934_G_A_b38	SLC35E2	-3.823	0.000167	-0.066354	24	0.017357	yes	PNCREAS
chr1_1650664_CTTTTT_C_b38	SLC35E2	-3.813	0.000173	-0.072065	16	0.018901	yes	PNCREAS
chr1_1659940_A_C_b38	SLC35E2	-3.794	0.000186	-0.075049	10	0.01978	yes	PNCREAS
chr1_1667424_T_TAAATA_b38	SLC35E2	-3.691	0.000274	-0.056498	49	0.015307	yes	PNCREAS
chr1_1715553_G_A_b38	SLC35E2	3.665	0.000302	0.090565	22	0.02471	yes	PNCREAS
chr1_1742587_G_C_b38	SLC35E2	3.664	0.000304	0.058006	65	0.015832	yes	PNCREAS
chr1_1660408_T_C_b38	SLC35E2	-3.647	0.000323	-0.073306	6	0.020101	yes	PNCREAS
chr1_1671097_G_C_b38	SLC35E2	3.633	0.00034	0.062369	25	0.017167	yes	PNCREAS
chr1_1676287_C_T_b38	SLC35E2	-3.597	0.000388	-0.074954	7	0.020838	yes	PNCREAS
chr1_1650383_G_T_b38	SLC35E2	-3.567	0.000433	-0.063173	21	0.017709	yes	PNCREAS
chr1_1649954_C_CA_b38	SLC35E2	-3.565	0.000437	-0.068136	15	0.019115	yes	PNCREAS
chr1_1749637_G_T_b38	SLC35E2	3.553	0.000455	0.057674	45	0.016231	yes	PNCREAS
chr1_1945842_A_AAAAGAAC_b38	SLC35E2	-3.544	0.00047	-0.064403	39	0.018172	yes	PNCREAS
chr1_1750226_C_T_b38	SLC35E2	3.544	0.000471	0.059669	45	0.016838	yes	PNCREAS
chr1_1664757_T_C_b38	SLC35E2	-3.461	0.000634	-0.056991	25	0.016468	yes	PNCREAS
chr1_1641261_C_T_b38	SLC35E2	-3.446	0.000667	-0.067859	13	0.019692	yes	PNCREAS
chr1_1726106_AT_A_b38	SLC35E2	3.414	0.000748	0.070438	17	0.020635	yes	PNCREAS
chr1_1757725_C_T_b38	SLC35E2	3.384	0.000831	0.05745	42	0.016979	yes	PNCREAS
chr1_1703572_A_G_b38	SLC35E2	-3.326	0.00101	-0.087646	21	0.026354	yes	PNCREAS
chr1_1865278_A_C_b38	SLC35E2	3.315	0.00105	0.052144	51	0.015729	yes	PNCREAS
chr1_1714635_A_G_b38	SLC35E2	3.311	0.00107	0.070822	12	0.021393	yes	PNCREAS
chr1_1714638_G_T_b38	SLC35E2	3.311	0.00107	0.070822	12	0.021393	yes	PNCREAS
chr1_1684789_C_CAAAAA_b38	SLC35E2	-3.295	0.00113	-0.105486	6	0.03201	yes	PNCREAS
chr1_1708001_A_T_b38	SLC35E2	-3.283	0.00117	-0.093061	10	0.028346	yes	PNCREAS
chr1_1675228_C_CG_b38	SLC35E2	3.282	0.00118	0.058282	41	0.017759	yes	PNCREAS
chr1_897580_AT_A_b38	SLC35E2	-3.241	0.00135	-0.050945	73	0.01572	yes	PNCREAS
chr1_1279400_C_CT_b38	SLC35E2	3.24	0.00136	0.129569	3	0.039987	yes	PNCREAS
chr1_1779667_T_TTG_b38	SLC35E2	3.211	0.0015	0.056104	37	0.017474	yes	PNCREAS
chr1_1697979_G_A_b38	SLC35E2	-3.201	0.00155	-0.079062	3	0.024698	yes	PNCREAS
chr1_1752126_G_A_b38	SLC35E2	3.185	0.00163	0.055938	32	0.017564	yes	PNCREAS
chr1_1672155_G_A_b38	SLC35E2	-3.172	0.0017	-0.057879	23	0.018247	yes	PNCREAS
chr1_1970506_T_A_b38	SLC35E2	-3.169	0.00172	-0.049427	51	0.015595	yes	PNCREAS
chr1_1754601_G_T_b38	SLC35E2	3.159	0.00178	0.053506	42	0.016937	yes	PNCREAS
chr1_1758323_T_C_b38	SLC35E2	3.156	0.00179	0.049674	53	0.015738	yes	PNCREAS
chr1_1707744_A_G_b38	SLC35E2	-3.143	0.00188	-0.085517	11	0.027209	yes	PNCREAS
chr1_1715860_C_T_b38	SLC35E2	3.139	0.0019	0.075616	14	0.024086	yes	PNCREAS
chr1_1715862_G_A_b38	SLC35E2	3.139	0.0019	0.075616	14	0.024086	yes	PNCREAS
chr1_1828894_T_TAC_b38	SLC35E2	3.115	0.00206	0.049279	52	0.015821	yes	PNCREAS
chr1_1732685_T_C_b38	SLC35E2	3.111	0.00208	0.075357	28	0.024223	yes	PNCREAS
chr1_1734899_G_A_b38	SLC35E2	3.111	0.00208	0.075357	28	0.024223	yes	PNCREAS
chr1_1940973_C_T_b38	SLC35E2	-3.063	0.00243	-0.048965	66	0.015983	yes	PNCREAS
chr1_1650000_G_A_b38	SLC35E2	3.058	0.00247	0.04715	48	0.015417	yes	PNCREAS
chr1_1649993_A_G_b38	SLC35E2	-3.048	0.00255	-0.046636	81	0.015302	yes	PNCREAS
chr1_1756186_T_C_b38	SLC35E2	3.043	0.00259	0.050219	43	0.016503	yes	PNCREAS
chr1_1721197_CA_C_b38	SLC35E2	3.041	0.00261	0.071581	14	0.023539	yes	PNCREAS
chr1_1706898_T_C_b38	SLC35E2	-3.039	0.00263	-0.07906	13	0.026017	yes	PNCREAS
chr1_1706927_A_G_b38	SLC35E2	-3.039	0.00263	-0.078466	14	0.025822	yes	PNCREAS
chr1_1671724_C_T_b38	SLC35E2	-3.033	0.00268	-0.056464	19	0.018617	yes	PNCREAS
chr1_1762664_A_G_b38	SLC35E2	3.009	0.00289	0.081508	5	0.027086	yes	PNCREAS
chr1_1757074_G_T_b38	SLC35E2	2.999	0.00299	0.050389	43	0.016803	yes	PNCREAS
chr1_1743714_C_CA_b38	SLC35E2	2.991	0.00306	0.052715	37	0.017623	yes	PNCREAS
chr1_1844830_C_A_b38	SLC35E2	2.979	0.00318	0.047017	56	0.015781	yes	PNCREAS
chr1_1848037_C_CTA_b38	SLC35E2	2.979	0.00318	0.047017	56	0.015781	yes	PNCREAS
chr1_1742080_T_C_b38	SLC35E2	2.97	0.00327	0.072152	9	0.024292	yes	PNCREAS
chr1_1762759_AAATG_A_b38	SLC35E2	2.969	0.00328	0.047543	54	0.016014	yes	PNCREAS
chr1_1960609_G_C_b38	SLC35E2	-2.955	0.00343	-0.04574	53	0.015478	yes	PNCREAS
chr1_1739915_G_A_b38	SLC35E2	2.951	0.00347	0.067236	12	0.022782	yes	PNCREAS
chr1_1657093_C_A_b38	SLC35E2	-2.933	0.00367	-0.055676	21	0.018984	yes	PNCREAS
chr1_1735932_A_G_b38	SLC35E2	2.925	0.00376	0.07196	7	0.024602	yes	PNCREAS
chr1_1718663_C_T_b38	SLC35E2	2.924	0.00377	0.065347	20	0.022347	yes	PNCREAS
chr1_1657085_C_CTAA_b38	SLC35E2	-2.921	0.00381	-0.056017	20	0.019177	yes	PNCREAS
chr1_1734132_T_G_b38	SLC35E2	2.92	0.00383	0.070847	12	0.024266	yes	PNCREAS
chr1_1657081_C_T_b38	SLC35E2	-2.918	0.00384	-0.05446	20	0.018662	yes	PNCREAS
chr1_1042813_G_A_b38	SLC35E2	2.914	0.00389	0.063223	7	0.021693	yes	PNCREAS
chr1_1934896_C_T_b38	SLC35E2	2.914	0.00389	0.053538	14	0.01837	yes	PNCREAS
chr1_1714988_T_G_b38	SLC35E2	2.913	0.0039	0.070241	14	0.024109	yes	PNCREAS
chr1_1715011_G_A_b38	SLC35E2	2.913	0.0039	0.070241	14	0.024109	yes	PNCREAS
chr1_1075715_A_G_b38	SLC35E2	-2.912	0.00392	-0.071179	4	0.024446	yes	PNCREAS
chr1_1743544_CA_C_b38	SLC35E2	2.907	0.00397	0.04488	63	0.015436	yes	PNCREAS
chr1_1718824_G_T_b38	SLC35E2	2.867	0.0045	0.0685	14	0.023894	yes	PNCREAS
chr1_1720523_G_A_b38	SLC35E2	2.865	0.00452	0.06991	13	0.0244	yes	PNCREAS
chr1_1718040_T_TAG_b38	SLC35E2	2.862	0.00457	0.069418	14	0.024258	yes	PNCREAS
chr1_1707090_A_G_b38	SLC35E2	-2.854	0.00468	-0.075424	14	0.026426	yes	PNCREAS
chr1_1764023_C_A_b38	SLC35E2	2.849	0.00476	0.047832	44	0.016792	yes	PNCREAS
chr1_1766668_C_T_b38	SLC35E2	2.848	0.00476	0.073528	7	0.025816	yes	PNCREAS
chr1_2286661_C_T_b38	SLC35E2	2.841	0.00486	0.064592	5	0.022733	yes	PNCREAS
chr1_1781909_C_T_b38	SLC35E2	2.837	0.00493	0.044514	56	0.015689	yes	PNCREAS
chr1_1716085_C_T_b38	SLC35E2	2.822	0.00516	0.06853	14	0.024283	yes	PNCREAS
chr1_1716089_G_C_b38	SLC35E2	2.822	0.00516	0.06853	14	0.024283	yes	PNCREAS
chr1_1717185_C_A_b38	SLC35E2	2.822	0.00516	0.06853	14	0.024283	yes	PNCREAS
chr1_1718761_A_C_b38	SLC35E2	2.822	0.00516	0.06853	14	0.024283	yes	PNCREAS
chr1_1718971_T_C_b38	SLC35E2	2.822	0.00516	0.06853	14	0.024283	yes	PNCREAS
chr1_1719368_T_C_b38	SLC35E2	2.822	0.00516	0.06853	14	0.024283	yes	PNCREAS
chr1_1719406_G_A_b38	SLC35E2	2.822	0.00516	0.06853	14	0.024283	yes	PNCREAS
chr1_1720183_C_T_b38	SLC35E2	2.822	0.00516	0.06853	14	0.024283	yes	PNCREAS
chr1_1720376_T_C_b38	SLC35E2	2.822	0.00516	0.06853	14	0.024283	yes	PNCREAS
chr1_1720472_C_A_b38	SLC35E2	2.822	0.00516	0.06853	14	0.024283	yes	PNCREAS
chr1_1720498_G_A_b38	SLC35E2	2.822	0.00516	0.06853	14	0.024283	yes	PNCREAS
chr1_1720696_C_CTTA_b38	SLC35E2	2.822	0.00516	0.06853	14	0.024283	yes	PNCREAS
chr1_1720787_A_G_b38	SLC35E2	2.822	0.00516	0.06853	14	0.024283	yes	PNCREAS
chr1_1721565_T_C_b38	SLC35E2	2.822	0.00516	0.06853	14	0.024283	yes	PNCREAS
chr1_1721589_C_T_b38	SLC35E2	2.822	0.00516	0.06853	14	0.024283	yes	PNCREAS
chr1_1721864_T_C_b38	SLC35E2	2.822	0.00516	0.06853	14	0.024283	yes	PNCREAS
chr1_1721893_GT_G_b38	SLC35E2	2.822	0.00516	0.06853	14	0.024283	yes	PNCREAS
chr1_1721922_C_T_b38	SLC35E2	2.822	0.00516	0.06853	14	0.024283	yes	PNCREAS
chr1_1721975_C_T_b38	SLC35E2	2.822	0.00516	0.06853	14	0.024283	yes	PNCREAS
chr1_1732580_T_C_b38	SLC35E2	2.82	0.00519	0.067576	10	0.023966	yes	PNCREAS
chr1_1722940_TAAG_T_b38	SLC35E2	2.813	0.00529	0.060976	22	0.021674	yes	PNCREAS
chr1_1717067_A_AT_b38	SLC35E2	2.806	0.00541	0.064721	16	0.023065	yes	PNCREAS
chr1_2287068_C_T_b38	SLC35E2	2.792	0.00565	0.064647	5	0.023158	yes	PNCREAS
chr1_1931743_CA_C_b38	SLC35E2	-2.791	0.00566	-0.052855	24	0.018938	yes	PNCREAS
chr1_1866635_T_TA_b38	SLC35E2	2.791	0.00567	0.048329	34	0.017318	yes	PNCREAS
chr1_1718593_A_C_b38	SLC35E2	2.79	0.00567	0.067378	15	0.024147	yes	PNCREAS
chr1_1718594_T_C_b38	SLC35E2	2.79	0.00567	0.067378	15	0.024147	yes	PNCREAS
chr1_1955652_CG_C_b38	SLC35E2	2.789	0.00569	0.050379	19	0.018062	yes	PNCREAS
chr1_1955672_GC_G_b38	SLC35E2	2.789	0.00569	0.050379	19	0.018062	yes	PNCREAS
chr1_1956754_C_A_b38	SLC35E2	2.789	0.00569	0.050379	19	0.018062	yes	PNCREAS
chr1_1730989_A_G_b38	SLC35E2	2.786	0.00575	0.067094	9	0.024086	yes	PNCREAS
chr1_1731456_A_G_b38	SLC35E2	2.786	0.00575	0.067094	9	0.024086	yes	PNCREAS
chr1_1732166_A_G_b38	SLC35E2	2.786	0.00575	0.067094	9	0.024086	yes	PNCREAS
chr1_1735814_T_C_b38	SLC35E2	2.786	0.00575	0.067094	9	0.024086	yes	PNCREAS
chr1_1740427_A_T_b38	SLC35E2	2.786	0.00575	0.067094	9	0.024086	yes	PNCREAS
chr1_1675132_A_G_b38	SLC35E2	2.783	0.0058	0.048994	36	0.017604	yes	PNCREAS
chr1_1224783_G_A_b38	SLC35E2	-2.782	0.00581	-0.067285	4	0.024182	yes	PNCREAS
chr1_1827587_T_C_b38	SLC35E2	2.776	0.00592	0.075218	6	0.027094	yes	PNCREAS
chr1_1829550_A_C_b38	SLC35E2	2.776	0.00592	0.075218	6	0.027094	yes	PNCREAS
chr1_1829897_A_C_b38	SLC35E2	2.776	0.00592	0.075218	6	0.027094	yes	PNCREAS
chr1_1830575_T_C_b38	SLC35E2	2.776	0.00592	0.075218	6	0.027094	yes	PNCREAS
chr1_1834144_T_C_b38	SLC35E2	2.776	0.00592	0.075218	6	0.027094	yes	PNCREAS
chr1_1834920_A_G_b38	SLC35E2	2.776	0.00592	0.075218	6	0.027094	yes	PNCREAS
chr1_1837221_C_G_b38	SLC35E2	2.776	0.00592	0.075218	6	0.027094	yes	PNCREAS
chr1_1838619_T_C_b38	SLC35E2	2.776	0.00592	0.075218	6	0.027094	yes	PNCREAS
chr1_1710588_C_T_b38	SLC35E2	2.766	0.00609	0.069144	13	0.024994	yes	PNCREAS
chr1_1650664_CT_C_b38	SLC35E2	2.754	0.00631	0.047278	31	0.017164	yes	PNCREAS
chr1_1713611_C_T_b38	SLC35E2	2.753	0.00634	0.054588	30	0.019828	yes	PNCREAS
chr1_1715218_T_C_b38	SLC35E2	2.728	0.00682	0.061645	18	0.022593	yes	PNCREAS
chr1_1935938_T_C_b38	SLC35E2	-2.724	0.0069	-0.045906	48	0.01685	yes	PNCREAS
chr1_1715350_T_C_b38	SLC35E2	2.716	0.00707	0.064312	14	0.02368	yes	PNCREAS
chr1_1630798_C_T_b38	SLC35E2	2.71	0.00719	0.045521	30	0.016796	yes	PNCREAS
chr1_1720309_G_C_b38	SLC35E2	2.704	0.00733	0.065108	14	0.024082	yes	PNCREAS
chr1_1755504_T_C_b38	SLC35E2	2.701	0.00738	0.041723	63	0.015446	yes	PNCREAS
chr1_1459004_T_C_b38	SLC35E2	-2.694	0.00754	-0.079142	15	0.029378	yes	PNCREAS
chr1_1228094_A_G_b38	SLC35E2	-2.694	0.00755	-0.069695	4	0.025874	yes	PNCREAS
chr1_1145547_T_TCTGACCTCATGGCCGACCCCAC_b38	SLC35E2	2.691	0.0076	0.046053	24	0.017112	yes	PNCREAS
chr1_1812038_G_C_b38	SLC35E2	2.691	0.00761	0.068688	7	0.025528	yes	PNCREAS
chr1_1814717_A_G_b38	SLC35E2	2.685	0.00773	0.070724	6	0.026336	yes	PNCREAS
chr1_1821516_C_T_b38	SLC35E2	2.685	0.00773	0.070724	6	0.026336	yes	PNCREAS
chr1_1719638_C_CTCGCTCTGTCACCCAGGCT_b38	SLC35E2	2.672	0.00803	0.058483	18	0.021885	yes	PNCREAS
chr1_1825782_G_A_b38	SLC35E2	-2.669	0.0081	-0.080223	4	0.030053	yes	PNCREAS
chr1_1725697_T_C_b38	SLC35E2	2.662	0.00826	0.04959	32	0.018626	yes	PNCREAS
chr1_1967499_G_A_b38	SLC35E2	2.661	0.00829	0.04174	49	0.015684	yes	PNCREAS
chr1_1947648_G_A_b38	SLC35E2	2.647	0.00864	0.048543	17	0.01834	yes	PNCREAS
chr1_1868514_T_C_b38	SLC35E2	2.622	0.00927	0.075004	4	0.028601	yes	PNCREAS
chr1_1942186_G_A_b38	SLC35E2	2.612	0.00956	0.047331	17	0.018124	yes	PNCREAS
chr1_1716247_A_C_b38	SLC35E2	2.608	0.00966	0.062739	14	0.024058	yes	PNCREAS
chr1_2676824_ACGGCC_A_b38	SLC35E2	-6.328	1.14e-09	-0.277487	3	0.043848	no	PNCREAS
chr1_1658422_T_C_b38	SLC35E2	4.062	6.53e-05	0.075439	16	0.018572	no	PNCREAS
chr1_1760882_T_C_b38	SLC35E2	3.819	0.000169	0.059025	56	0.015456	no	PNCREAS
chr1_1949036_C_CTCCT_b38	SLC35E2	-3.572	0.000425	-0.109202	3	0.030568	no	PNCREAS
chr1_908953_ATATGCGGTGATCGGGGTCAGGCCCCCGGGCGCACCTTTGCTGGTATATGCGGGGGTCGGGGTCAGGCCCCCGGGCGCACCGTTGCTGGTATATGCGGGGGTCGGGGTCAGGCCCCCGGGCGCACCGTTGCTGGTATATGCGGTGGTCGGGGTCAGGCCCCCCGGGCGCACTG_A_b38	SLC35E2	3.538	0.00048	0.110265	3	0.031164	no	PNCREAS
chr1_1746522_GT_G_b38	SLC35E2	-3.435	0.000694	-0.067726	16	0.019716	no	PNCREAS
chr1_1688328_C_T_b38	SLC35E2	-3.391	0.00081	-0.062621	14	0.018468	no	PNCREAS
chr1_905373_T_C_b38	SLC35E2	-3.278	0.0012	-0.049542	62	0.015115	no	PNCREAS
chr1_1750589_G_A_b38	SLC35E2	-3.249	0.00132	-0.082532	8	0.025401	no	PNCREAS
chr1_1698022_G_A_b38	SLC35E2	-3.226	0.00143	-0.133515	11	0.041393	no	PNCREAS
chr1_1753033_C_T_b38	SLC35E2	-3.222	0.00144	-0.05445	70	0.016901	no	PNCREAS
chr1_1734812_G_A_b38	SLC35E2	3.205	0.00152	0.063508	35	0.019813	no	PNCREAS
chr1_1725582_T_C_b38	SLC35E2	3.192	0.00159	0.046931	63	0.014701	no	PNCREAS
chr1_1708855_TTCCTCCTCC_T_b38	SLC35E2	3.185	0.00163	0.052579	53	0.016509	no	PNCREAS
chr1_1714797_C_T_b38	SLC35E2	3.144	0.00187	0.070316	17	0.022369	no	PNCREAS
chr1_1689421_G_A_b38	SLC35E2	3.052	0.00252	0.05004	45	0.016397	no	PNCREAS
chr1_1746440_A_G_b38	SLC35E2	-3.033	0.00268	-0.062118	14	0.020482	no	PNCREAS
chr1_2249085_G_A_b38	SLC35E2	3.03	0.0027	0.044953	52	0.014835	no	PNCREAS
chr1_1425464_CA_C_b38	SLC35E2	-3.025	0.00275	-0.07136	3	0.023589	no	PNCREAS
chr1_1937273_T_C_b38	SLC35E2	-3.021	0.00278	-0.048424	60	0.016031	no	PNCREAS
chr1_2268951_C_A_b38	SLC35E2	3.017	0.00282	0.044658	52	0.014802	no	PNCREAS
chr1_2244722_C_T_b38	SLC35E2	3.004	0.00293	0.044657	52	0.014865	no	PNCREAS
chr1_1938332_A_ACT_b38	SLC35E2	-2.999	0.00298	-0.047378	65	0.015796	no	PNCREAS
chr1_1688102_G_A_b38	SLC35E2	-2.977	0.0032	-0.053615	23	0.018009	no	PNCREAS
chr1_903551_A_C_b38	SLC35E2	-2.958	0.0034	-0.06466	9	0.021861	no	PNCREAS
chr1_1950071_C_A_b38	SLC35E2	2.957	0.0034	0.051778	22	0.01751	no	PNCREAS
chr1_1942258_G_A_b38	SLC35E2	-2.955	0.00343	-0.047239	64	0.015986	no	PNCREAS
chr1_1940540_G_A_b38	SLC35E2	-2.954	0.00344	-0.047393	64	0.016043	no	PNCREAS
chr1_1942260_G_C_b38	SLC35E2	-2.954	0.00344	-0.047393	64	0.016043	no	PNCREAS
chr1_1706963_G_A_b38	SLC35E2	-2.953	0.00345	-0.081132	12	0.027475	no	PNCREAS
chr1_2244599_C_T_b38	SLC35E2	2.947	0.00352	0.043713	52	0.014834	no	PNCREAS
chr1_2662748_AGCAACCACACGCACAGG_A_b38	SLC35E2	-2.944	0.00354	-0.103072	5	0.035008	no	PNCREAS
chr1_1942014_G_A_b38	SLC35E2	-2.933	0.00367	-0.047187	63	0.016091	no	PNCREAS
chr1_1942075_A_G_b38	SLC35E2	-2.933	0.00367	-0.047187	63	0.016091	no	PNCREAS
chr1_1942086_T_C_b38	SLC35E2	-2.933	0.00367	-0.047187	63	0.016091	no	PNCREAS
chr1_1948121_T_G_b38	SLC35E2	2.928	0.00372	0.050844	20	0.017363	no	PNCREAS
chr1_1937841_ACACCAGGTCCACCTCTGGACACAGGTCCACC_A_b38	SLC35E2	-2.928	0.00373	-0.04662	64	0.015921	no	PNCREAS
chr1_1689446_T_C_b38	SLC35E2	2.928	0.00373	0.048308	46	0.016499	no	PNCREAS
chr1_1948594_G_GTTT_b38	SLC35E2	-2.919	0.00383	-0.100111	5	0.034291	no	PNCREAS
chr1_1951642_C_T_b38	SLC35E2	2.886	0.00425	0.051363	21	0.017799	no	PNCREAS
chr1_1731904_CA_C_b38	SLC35E2	2.868	0.00449	0.04994	31	0.017414	no	PNCREAS
chr1_1938054_ACT_A_b38	SLC35E2	-2.865	0.00452	-0.045771	64	0.015974	no	PNCREAS
chr1_1936077_C_T_b38	SLC35E2	-2.864	0.00454	-0.045135	65	0.01576	no	PNCREAS
chr1_1713469_C_T_b38	SLC35E2	2.839	0.0049	0.06192	22	0.021812	no	PNCREAS
chr1_1702383_T_C_b38	SLC35E2	-2.81	0.00535	-0.050864	18	0.018102	no	PNCREAS
chr1_1951498_C_T_b38	SLC35E2	2.808	0.00537	0.049914	21	0.017773	no	PNCREAS
chr1_1820337_A_G_b38	SLC35E2	2.806	0.00541	0.043934	58	0.015657	no	PNCREAS
chr1_1991852_G_A_b38	SLC35E2	2.804	0.00545	0.050848	21	0.018137	no	PNCREAS
chr1_1026830_A_G_b38	SLC35E2	2.794	0.0056	0.04502	42	0.01611	no	PNCREAS
chr1_1926870_T_C_b38	SLC35E2	-2.786	0.00575	-0.044576	55	0.016002	no	PNCREAS
chr1_1934565_G_A_b38	SLC35E2	-2.784	0.00578	-0.045009	65	0.016168	no	PNCREAS
chr1_908943_CGTTGCTGGT_C_b38	SLC35E2	2.762	0.00618	0.065103	13	0.023574	no	PNCREAS
chr1_1055000_C_T_b38	SLC35E2	2.754	0.00632	0.046118	27	0.016746	no	PNCREAS
chr1_2238792_C_T_b38	SLC35E2	2.751	0.00638	0.041235	51	0.014989	no	PNCREAS
chr1_1851414_GA_G_b38	SLC35E2	-2.724	0.0069	-0.049208	33	0.018063	no	PNCREAS
chr1_1023351_A_G_b38	SLC35E2	2.657	0.00839	0.041904	43	0.015769	no	PNCREAS
chr1_1423775_C_CT_b38	SLC35E2	2.645	0.00869	0.063523	10	0.024017	no	PNCREAS
chr1_1752908_C_CCCT_b38	SLC35E2	-2.635	0.00895	-0.04854	50	0.018422	no	PNCREAS
chr1_1936627_C_G_b38	SLC35E2	-2.629	0.00908	-0.042705	60	0.016241	no	PNCREAS
chr1_1933087_C_T_b38	SLC35E2	-2.628	0.00913	-0.042268	60	0.016086	no	PNCREAS
chr1_1933859_A_G_b38	SLC35E2	-2.628	0.00913	-0.042268	60	0.016086	no	PNCREAS
chr1_1219858_G_A_b38	SLC35E2	-2.621	0.0093	-0.059002	10	0.022509	no	PNCREAS
chr1_1425013_C_T_b38	SLC35E2	-2.61	0.00959	-0.065306	25	0.025018	no	PNCREAS
chr1_1673818_A_C_b38	SLC35E2	6.071	6.46e-09	0.132251	57	0.021783	yes	PTTARY
chr1_1671995_G_T_b38	SLC35E2	6.038	7.71e-09	0.131397	57	0.021763	yes	PTTARY
chr1_1673060_G_A_b38	SLC35E2	5.941	1.27e-08	0.129256	57	0.021758	yes	PTTARY
chr1_1671797_G_A_b38	SLC35E2	5.912	1.48e-08	0.130351	57	0.022048	yes	PTTARY
chr1_1677720_T_G_b38	SLC35E2	5.896	1.6e-08	0.129225	56	0.021916	yes	PTTARY
chr1_1677726_A_T_b38	SLC35E2	5.896	1.6e-08	0.129225	56	0.021916	yes	PTTARY
chr1_1648736_G_A_b38	SLC35E2	5.893	1.63e-08	0.136213	43	0.023113	yes	PTTARY
chr1_1651653_C_T_b38	SLC35E2	5.82	2.37e-08	0.136697	48	0.023487	yes	PTTARY
chr1_1674720_TGC_T_b38	SLC35E2	5.808	2.52e-08	0.126129	55	0.021716	yes	PTTARY
chr1_1674868_G_A_b38	SLC35E2	5.808	2.52e-08	0.126129	55	0.021716	yes	PTTARY
chr1_1676790_C_T_b38	SLC35E2	5.645	5.72e-08	0.123336	55	0.021847	yes	PTTARY
chr1_1743565_ATAT_A_b38	SLC35E2	-5.598	7.25e-08	-0.119347	42	0.02132	yes	PTTARY
chr1_1674633_C_CA_b38	SLC35E2	5.449	1.51e-07	0.133304	27	0.024465	yes	PTTARY
chr1_1649932_C_T_b38	SLC35E2	5.326	2.74e-07	0.125945	43	0.023649	yes	PTTARY
chr1_1649976_G_A_b38	SLC35E2	5.162	5.97e-07	0.123593	34	0.023943	yes	PTTARY
chr1_1661562_G_C_b38	SLC35E2	5.097	8.11e-07	0.106064	51	0.02081	yes	PTTARY
chr1_1673968_GA_G_b38	SLC35E2	5.023	1.14e-06	0.136248	21	0.027125	yes	PTTARY
chr1_1670423_AT_A_b38	SLC35E2	4.802	3.11e-06	0.130343	30	0.027144	yes	PTTARY
chr1_1755504_T_C_b38	SLC35E2	4.697	4.97e-06	0.103297	60	0.021994	yes	PTTARY
chr1_1636278_G_T_b38	SLC35E2	4.688	5.15e-06	0.116279	35	0.024802	yes	PTTARY
chr1_1586962_C_T_b38	SLC35E2	4.611	7.2e-06	0.115588	26	0.025065	yes	PTTARY
chr1_1675091_A_G_b38	SLC35E2	-4.599	7.59e-06	-0.116469	16	0.025322	yes	PTTARY
chr1_1650000_G_A_b38	SLC35E2	4.577	8.36e-06	0.10913	30	0.023842	yes	PTTARY
chr1_1654662_CT_C_b38	SLC35E2	4.493	1.2e-05	0.124977	35	0.027815	yes	PTTARY
chr1_1739131_T_C_b38	SLC35E2	4.492	1.2e-05	0.099967	39	0.022253	yes	PTTARY
chr1_1650664_CTTTTT_C_b38	SLC35E2	-4.485	1.24e-05	-0.122156	12	0.027234	yes	PTTARY
chr1_1639348_G_T_b38	SLC35E2	-4.399	1.78e-05	-0.101335	30	0.023037	yes	PTTARY
chr1_1759611_C_T_b38	SLC35E2	-4.293	2.77e-05	-0.097742	52	0.022766	yes	PTTARY
chr1_1759354_G_A_b38	SLC35E2	-4.254	3.25e-05	-0.097427	51	0.022904	yes	PTTARY
chr1_1589495_CTTT_C_b38	SLC35E2	4.189	4.23e-05	0.10893	21	0.026001	yes	PTTARY
chr1_1653863_C_A_b38	SLC35E2	-4.143	5.09e-05	-0.119291	8	0.028792	yes	PTTARY
chr1_1591703_T_C_b38	SLC35E2	4.125	5.47e-05	0.094325	46	0.022866	yes	PTTARY
chr1_1753319_G_A_b38	SLC35E2	-4.113	5.73e-05	-0.093096	50	0.022632	yes	PTTARY
chr1_1753033_C_T_b38	SLC35E2	-4.082	6.51e-05	-0.092797	55	0.022735	yes	PTTARY
chr1_1752461_G_A_b38	SLC35E2	-4.04	7.67e-05	-0.091588	50	0.02267	yes	PTTARY
chr1_1752730_C_G_b38	SLC35E2	-4.04	7.67e-05	-0.091588	50	0.02267	yes	PTTARY
chr1_1753361_G_A_b38	SLC35E2	-4.04	7.67e-05	-0.091588	50	0.02267	yes	PTTARY
chr1_1648636_G_A_b38	SLC35E2	-4.036	7.78e-05	-0.096873	25	0.024	yes	PTTARY
chr1_1638879_C_T_b38	SLC35E2	-4.028	8.05e-05	-0.10405	17	0.025834	yes	PTTARY
chr1_1607931_G_A_b38	SLC35E2	4.004	8.85e-05	0.094922	26	0.023709	yes	PTTARY
chr1_1609058_G_A_b38	SLC35E2	4.004	8.85e-05	0.094922	26	0.023709	yes	PTTARY
chr1_1612562_T_TC_b38	SLC35E2	3.967	0.000102	0.091505	29	0.023069	yes	PTTARY
chr1_1756043_G_T_b38	SLC35E2	-3.9	0.000132	-0.089332	51	0.022904	yes	PTTARY
chr1_1755523_C_T_b38	SLC35E2	3.873	0.000146	0.086412	64	0.022311	yes	PTTARY
chr1_1754482_TCCCTGGGACCGAAGTCGCCCCA_T_b38	SLC35E2	-3.831	0.000172	-0.08845	50	0.023088	yes	PTTARY
chr1_940296_GCC_G_b38	SLC35E2	-3.767	0.000218	-0.084052	41	0.022311	yes	PTTARY
chr1_1635226_T_C_b38	SLC35E2	-3.749	0.000234	-0.108814	9	0.029024	yes	PTTARY
chr1_1688328_C_T_b38	SLC35E2	-3.749	0.000234	-0.095416	17	0.025453	yes	PTTARY
chr1_1758323_T_C_b38	SLC35E2	3.665	0.000319	0.083478	49	0.02278	yes	PTTARY
chr1_1595306_CAG_C_b38	SLC35E2	-3.637	0.000352	-0.092491	45	0.025429	yes	PTTARY
chr1_1667424_T_TAAAATA_b38	SLC35E2	3.621	0.000373	0.08892	31	0.024554	yes	PTTARY
chr1_1752908_C_CCCT_b38	SLC35E2	-3.584	0.000426	-0.085435	43	0.023836	yes	PTTARY
chr1_1629332_G_T_b38	SLC35E2	3.547	0.000488	0.085237	31	0.024032	yes	PTTARY
chr1_1613769_C_T_b38	SLC35E2	3.531	0.000516	0.086583	27	0.024522	yes	PTTARY
chr1_1630798_C_T_b38	SLC35E2	3.507	0.000562	0.085207	29	0.024298	yes	PTTARY
chr1_1641275_A_G_b38	SLC35E2	-3.46	0.000662	-0.082504	27	0.023842	yes	PTTARY
chr1_924305_G_A_b38	SLC35E2	3.358	0.000943	0.089836	14	0.026752	yes	PTTARY
chr1_1969015_A_G_b38	SLC35E2	3.355	0.000952	0.080873	53	0.024104	yes	PTTARY
chr1_1708855_TTCCTCCTCC_T_b38	SLC35E2	3.304	0.00113	0.081634	44	0.024711	yes	PTTARY
chr1_1606532_GTGGGCTGGGCTGGTCAGGCA_G_b38	SLC35E2	3.293	0.00118	0.077914	27	0.02366	yes	PTTARY
chr1_1971864_C_T_b38	SLC35E2	3.285	0.00121	0.073184	48	0.02228	yes	PTTARY
chr1_2427812_G_T_b38	SLC35E2	-3.281	0.00123	-0.102179	5	0.031145	yes	PTTARY
chr1_1631710_T_C_b38	SLC35E2	3.277	0.00124	0.111588	4	0.034049	yes	PTTARY
chr1_1597128_C_CCCTCAGCTGGACT_b38	SLC35E2	-3.243	0.00139	-0.078066	34	0.02407	yes	PTTARY
chr1_1750508_A_C_b38	SLC35E2	-3.241	0.0014	-0.066748	53	0.020598	yes	PTTARY
chr1_940390_A_G_b38	SLC35E2	-3.234	0.00143	-0.07422	47	0.022947	yes	PTTARY
chr1_1649993_A_G_b38	SLC35E2	-3.211	0.00154	-0.06995	56	0.021783	yes	PTTARY
chr1_946653_G_A_b38	SLC35E2	3.21	0.00155	0.091137	12	0.028389	yes	PTTARY
chr1_1692151_T_C_b38	SLC35E2	-3.193	0.00164	-0.085491	19	0.026773	yes	PTTARY
chr1_1865278_A_C_b38	SLC35E2	3.192	0.00164	0.076641	47	0.024008	yes	PTTARY
chr1_1692124_T_G_b38	SLC35E2	-3.165	0.0018	-0.085646	16	0.027057	yes	PTTARY
chr1_1614340_C_T_b38	SLC35E2	3.149	0.0019	0.104369	5	0.033148	yes	PTTARY
chr1_1820356_TA_T_b38	SLC35E2	3.148	0.0019	0.091227	12	0.028978	yes	PTTARY
chr1_1747472_A_T_b38	SLC35E2	-3.121	0.00208	-0.073467	50	0.023542	yes	PTTARY
chr1_1748597_C_G_b38	SLC35E2	-3.118	0.00209	-0.073311	50	0.023509	yes	PTTARY
chr1_1641642_T_C_b38	SLC35E2	-3.111	0.00214	-0.081471	20	0.026187	yes	PTTARY
chr1_1987049_A_G_b38	SLC35E2	3.087	0.00232	0.069988	49	0.022674	yes	PTTARY
chr1_935265_T_C_b38	SLC35E2	3.044	0.00265	0.08161	21	0.026806	yes	PTTARY
chr1_1649846_G_A_b38	SLC35E2	-3.038	0.00271	-0.08481	11	0.02792	yes	PTTARY
chr1_1679100_A_G_b38	SLC35E2	-3.002	0.00303	-0.070835	38	0.023596	yes	PTTARY
chr1_939779_AGCCAGTGGACGCCGACCT_A_b38	SLC35E2	-2.964	0.00341	-0.068047	41	0.022958	yes	PTTARY
chr1_954724_G_A_b38	SLC35E2	2.936	0.00372	0.081886	12	0.027889	yes	PTTARY
chr1_1744121_A_C_b38	SLC35E2	-2.934	0.00374	-0.091932	27	0.031333	yes	PTTARY
chr1_945259_TC_T_b38	SLC35E2	2.92	0.00391	0.08028	13	0.027496	yes	PTTARY
chr1_1828894_T_TAC_b38	SLC35E2	2.903	0.00413	0.067815	50	0.023364	yes	PTTARY
chr1_1615869_C_T_b38	SLC35E2	2.863	0.00465	0.074468	19	0.026009	yes	PTTARY
chr1_1762759_AAATG_A_b38	SLC35E2	2.846	0.0049	0.064994	55	0.022838	yes	PTTARY
chr1_828389_A_AT_b38	SLC35E2	2.83	0.00514	0.074819	25	0.026436	yes	PTTARY
chr1_955679_C_T_b38	SLC35E2	-2.826	0.0052	-0.068445	35	0.024217	yes	PTTARY
chr1_956565_A_G_b38	SLC35E2	-2.826	0.0052	-0.068445	35	0.024217	yes	PTTARY
chr1_1619986_T_C_b38	SLC35E2	2.792	0.00576	0.075525	15	0.027052	yes	PTTARY
chr1_1837255_A_AT_b38	SLC35E2	2.784	0.00589	0.087421	7	0.031396	yes	PTTARY
chr1_949171_GAGAA_G_b38	SLC35E2	-2.783	0.00591	-0.066806	37	0.024002	yes	PTTARY
chr1_1750589_G_A_b38	SLC35E2	-2.776	0.00604	-0.100508	11	0.036205	yes	PTTARY
chr1_874906_G_A_b38	SLC35E2	-2.761	0.00631	-0.092882	6	0.033643	yes	PTTARY
chr1_1750528_G_A_b38	SLC35E2	-2.758	0.00636	-0.057242	51	0.020752	yes	PTTARY
chr1_1877312_A_T_b38	SLC35E2	2.758	0.00637	0.104328	4	0.03783	yes	PTTARY
chr1_1686321_CTTT_C_b38	SLC35E2	-2.752	0.00648	-0.069471	21	0.025243	yes	PTTARY
chr1_1746522_GT_G_b38	SLC35E2	-2.748	0.00655	-0.079743	12	0.029016	yes	PTTARY
chr1_946247_G_A_b38	SLC35E2	-2.744	0.00663	-0.06752	37	0.024606	yes	PTTARY
chr1_2462394_G_T_b38	SLC35E2	-2.741	0.00669	-0.095865	3	0.034971	yes	PTTARY
chr1_960891_C_T_b38	SLC35E2	-2.717	0.00717	-0.065908	43	0.024254	yes	PTTARY
chr1_1950071_C_A_b38	SLC35E2	2.717	0.00718	0.074541	15	0.027435	yes	PTTARY
chr1_1877316_A_T_b38	SLC35E2	2.712	0.00727	0.062984	38	0.02322	yes	PTTARY
chr1_1978562_C_G_b38	SLC35E2	2.707	0.00739	0.06866	22	0.025366	yes	PTTARY
chr1_1978573_T_C_b38	SLC35E2	2.707	0.00739	0.06866	22	0.025366	yes	PTTARY
chr1_1978647_G_T_b38	SLC35E2	2.707	0.00739	0.06866	22	0.025366	yes	PTTARY
chr1_1653825_T_TACACAC_b38	SLC35E2	2.701	0.00752	0.0748	12	0.027693	yes	PTTARY
chr1_1609196_CA_C_b38	SLC35E2	2.7	0.00753	0.073383	28	0.027176	yes	PTTARY
chr1_965337_CTTAT_C_b38	SLC35E2	-2.697	0.00761	-0.067999	38	0.025214	yes	PTTARY
chr1_1617375_T_C_b38	SLC35E2	2.688	0.00781	0.070784	18	0.026335	yes	PTTARY
chr1_1618213_C_G_b38	SLC35E2	2.688	0.00781	0.070784	18	0.026335	yes	PTTARY
chr1_1618290_G_C_b38	SLC35E2	2.688	0.00781	0.070784	18	0.026335	yes	PTTARY
chr1_1019479_TG_T_b38	SLC35E2	-2.683	0.00791	-0.063054	45	0.023498	yes	PTTARY
chr1_1951498_C_T_b38	SLC35E2	2.68	0.008	0.073643	15	0.027484	yes	PTTARY
chr1_1951642_C_T_b38	SLC35E2	2.68	0.008	0.073643	15	0.027484	yes	PTTARY
chr1_2456853_C_A_b38	SLC35E2	-2.679	0.00802	-0.091417	3	0.034126	yes	PTTARY
chr1_2456946_G_T_b38	SLC35E2	-2.679	0.00802	-0.091417	3	0.034126	yes	PTTARY
chr1_2458486_G_A_b38	SLC35E2	-2.679	0.00802	-0.091417	3	0.034126	yes	PTTARY
chr1_1968012_GTGAA_G_b38	SLC35E2	2.672	0.00817	0.076942	11	0.028796	yes	PTTARY
chr1_1725582_T_C_b38	SLC35E2	2.668	0.00827	0.054644	60	0.020481	yes	PTTARY
chr1_1963406_G_A_b38	SLC35E2	2.668	0.00828	0.073859	12	0.027688	yes	PTTARY
chr1_941767_G_A_b38	SLC35E2	2.66	0.00847	0.073105	15	0.027487	yes	PTTARY
chr1_1965001_G_A_b38	SLC35E2	2.647	0.00877	0.075391	11	0.028477	yes	PTTARY
chr1_1805416_A_G_b38	SLC35E2	2.631	0.00918	0.114035	3	0.043336	yes	PTTARY
chr1_1616547_T_C_b38	SLC35E2	2.624	0.00938	0.069898	17	0.026638	yes	PTTARY
chr1_1613421_T_C_b38	SLC35E2	2.623	0.00939	0.070098	17	0.026719	yes	PTTARY
chr1_1972273_C_A_b38	SLC35E2	2.621	0.00945	0.067529	20	0.025763	yes	PTTARY
chr1_921096_A_G_b38	SLC35E2	2.621	0.00945	0.062391	35	0.023804	yes	PTTARY
chr1_1963738_C_T_b38	SLC35E2	2.614	0.00963	0.074407	11	0.02846	yes	PTTARY
chr1_1965114_C_T_b38	SLC35E2	2.614	0.00963	0.074407	11	0.02846	yes	PTTARY
chr1_1966910_C_T_b38	SLC35E2	2.614	0.00963	0.074407	11	0.02846	yes	PTTARY
chr1_1667424_T_TAAATA_b38	SLC35E2	-2.609	0.00978	-0.062957	41	0.024129	yes	PTTARY
chr1_1671097_G_C_b38	SLC35E2	4.836	2.67e-06	0.110493	27	0.022848	no	PTTARY
chr1_1665581_C_G_b38	SLC35E2	-4.727	4.35e-06	-0.124254	14	0.026287	no	PTTARY
chr1_1671148_C_T_b38	SLC35E2	4.612	7.18e-06	0.105539	27	0.022882	no	PTTARY
chr1_1664865_A_G_b38	SLC35E2	-4.57	8.63e-06	-0.10727	23	0.023474	no	PTTARY
chr1_1742587_G_C_b38	SLC35E2	4.391	1.85e-05	0.097132	65	0.022122	no	PTTARY
chr1_1743565_AT_A_b38	SLC35E2	4.389	1.86e-05	0.088046	60	0.020061	no	PTTARY
chr1_1660683_C_T_b38	SLC35E2	-4.376	1.97e-05	-0.112603	15	0.025734	no	PTTARY
chr1_1661420_C_A_b38	SLC35E2	-4.328	2.4e-05	-0.102474	24	0.023678	no	PTTARY
chr1_1658866_G_A_b38	SLC35E2	-4.303	2.66e-05	-0.102253	24	0.023763	no	PTTARY
chr1_1659114_A_G_b38	SLC35E2	-4.303	2.66e-05	-0.102253	24	0.023763	no	PTTARY
chr1_1659220_A_G_b38	SLC35E2	-4.303	2.66e-05	-0.102253	24	0.023763	no	PTTARY
chr1_1668717_C_G_b38	SLC35E2	-4.301	2.68e-05	-0.117121	12	0.027231	no	PTTARY
chr1_1668108_C_T_b38	SLC35E2	4.27	3.04e-05	0.100368	24	0.023505	no	PTTARY
chr1_1650195_A_G_b38	SLC35E2	-4.25	3.31e-05	-0.100048	25	0.023542	no	PTTARY
chr1_1661177_A_G_b38	SLC35E2	-4.237	3.48e-05	-0.114716	12	0.027074	no	PTTARY
chr1_1668542_C_T_b38	SLC35E2	-4.213	3.83e-05	-0.112942	13	0.026805	no	PTTARY
chr1_1669613_G_A_b38	SLC35E2	-4.213	3.83e-05	-0.112942	13	0.026805	no	PTTARY
chr1_1669576_G_A_b38	SLC35E2	-4.211	3.87e-05	-0.112972	13	0.026828	no	PTTARY
chr1_1751981_A_T_b38	SLC35E2	-4.21	3.88e-05	-0.110604	21	0.026269	no	PTTARY
chr1_1744854_C_A_b38	SLC35E2	-4.169	4.58e-05	-0.090831	37	0.021785	no	PTTARY
chr1_1792696_C_CA_b38	SLC35E2	4.153	4.9e-05	0.10037	29	0.02417	no	PTTARY
chr1_1600320_C_G_b38	SLC35E2	4.101	6.02e-05	0.097093	27	0.023674	no	PTTARY
chr1_1648826_A_G_b38	SLC35E2	-4.089	6.32e-05	-0.098239	25	0.024025	no	PTTARY
chr1_1606384_A_G_b38	SLC35E2	4.063	7.01e-05	0.097095	29	0.023898	no	PTTARY
chr1_1600379_C_T_b38	SLC35E2	4.06	7.09e-05	0.096254	27	0.023708	no	PTTARY
chr1_1639685_G_A_b38	SLC35E2	-4.036	7.78e-05	-0.104106	17	0.025791	no	PTTARY
chr1_1665061_C_T_b38	SLC35E2	-4.035	7.82e-05	-0.109731	12	0.027194	no	PTTARY
chr1_1667948_A_G_b38	SLC35E2	-4.012	8.56e-05	-0.108028	13	0.026927	no	PTTARY
chr1_1658830_C_G_b38	SLC35E2	-3.974	9.93e-05	-0.108677	11	0.027347	no	PTTARY
chr1_1650777_G_A_b38	SLC35E2	-3.939	0.000114	-0.09393	24	0.023844	no	PTTARY
chr1_1651137_C_T_b38	SLC35E2	-3.939	0.000114	-0.09393	24	0.023844	no	PTTARY
chr1_1651267_T_C_b38	SLC35E2	-3.939	0.000114	-0.09393	24	0.023844	no	PTTARY
chr1_1651574_G_A_b38	SLC35E2	-3.939	0.000114	-0.09393	24	0.023844	no	PTTARY
chr1_1651785_C_A_b38	SLC35E2	-3.939	0.000114	-0.09393	24	0.023844	no	PTTARY
chr1_1652061_T_C_b38	SLC35E2	-3.939	0.000114	-0.09393	24	0.023844	no	PTTARY
chr1_1652135_C_G_b38	SLC35E2	-3.939	0.000114	-0.09393	24	0.023844	no	PTTARY
chr1_1652191_C_T_b38	SLC35E2	-3.939	0.000114	-0.09393	24	0.023844	no	PTTARY
chr1_1652592_A_G_b38	SLC35E2	-3.939	0.000114	-0.09393	24	0.023844	no	PTTARY
chr1_1652779_A_G_b38	SLC35E2	-3.939	0.000114	-0.09393	24	0.023844	no	PTTARY
chr1_1653147_A_C_b38	SLC35E2	-3.939	0.000114	-0.09393	24	0.023844	no	PTTARY
chr1_1653396_T_C_b38	SLC35E2	-3.939	0.000114	-0.09393	24	0.023844	no	PTTARY
chr1_1653472_T_C_b38	SLC35E2	-3.939	0.000114	-0.09393	24	0.023844	no	PTTARY
chr1_1653811_G_A_b38	SLC35E2	-3.939	0.000114	-0.09393	24	0.023844	no	PTTARY
chr1_1653893_C_T_b38	SLC35E2	-3.939	0.000114	-0.09393	24	0.023844	no	PTTARY
chr1_1653934_G_A_b38	SLC35E2	-3.939	0.000114	-0.09393	24	0.023844	no	PTTARY
chr1_1654143_G_A_b38	SLC35E2	-3.939	0.000114	-0.09393	24	0.023844	no	PTTARY
chr1_1654188_T_G_b38	SLC35E2	-3.939	0.000114	-0.09393	24	0.023844	no	PTTARY
chr1_1742672_C_T_b38	SLC35E2	-3.911	0.000127	-0.088349	42	0.022588	no	PTTARY
chr1_1743238_G_C_b38	SLC35E2	-3.911	0.000127	-0.088349	42	0.022588	no	PTTARY
chr1_1664757_T_C_b38	SLC35E2	-3.89	0.000137	-0.092153	23	0.023692	no	PTTARY
chr1_1743851_C_T_b38	SLC35E2	-3.836	0.000169	-0.100203	20	0.026123	no	PTTARY
chr1_933038_C_T_b38	SLC35E2	3.816	0.000182	0.100073	17	0.026225	no	PTTARY
chr1_1877314_A_T_b38	SLC35E2	3.816	0.000182	0.110078	13	0.028849	no	PTTARY
chr1_1651926_T_C_b38	SLC35E2	-3.814	0.000183	-0.091427	24	0.023973	no	PTTARY
chr1_1743714_C_CA_b38	SLC35E2	3.796	0.000196	0.096813	36	0.025505	no	PTTARY
chr1_1760882_T_C_b38	SLC35E2	3.794	0.000197	0.086548	53	0.022812	no	PTTARY
chr1_1595028_C_CAG_b38	SLC35E2	3.783	0.000206	0.09739	20	0.025748	no	PTTARY
chr1_1747695_A_G_b38	SLC35E2	-3.762	0.000223	-0.07628	50	0.020278	no	PTTARY
chr1_1744499_C_T_b38	SLC35E2	-3.753	0.00023	-0.08337	44	0.022215	no	PTTARY
chr1_1650383_G_T_b38	SLC35E2	-3.75	0.000233	-0.101565	15	0.027086	no	PTTARY
chr1_1744652_C_T_b38	SLC35E2	-3.736	0.000245	-0.084016	47	0.022489	no	PTTARY
chr1_1743586_T_TAC_b38	SLC35E2	-3.729	0.000252	-0.086374	39	0.023163	no	PTTARY
chr1_1620609_G_A_b38	SLC35E2	3.72	0.00026	0.087027	29	0.023395	no	PTTARY
chr1_1668721_C_T_b38	SLC35E2	-3.71	0.000269	-0.096305	15	0.025955	no	PTTARY
chr1_1659060_G_A_b38	SLC35E2	-3.687	0.000294	-0.095865	15	0.026003	no	PTTARY
chr1_1934821_C_CGTTGTAGGTACGTGTGTACGTGGGTGTTAGGTTGTAGGTACACACGTGTATATGTGGGTGTTAG_b38	SLC35E2	-3.685	0.000296	-0.089376	25	0.024256	no	PTTARY
chr1_1744028_A_AC_b38	SLC35E2	-3.678	0.000303	-0.104549	12	0.028423	no	PTTARY
chr1_1660408_T_C_b38	SLC35E2	-3.645	0.000342	-0.106432	6	0.029198	no	PTTARY
chr1_1743840_T_C_b38	SLC35E2	-3.64	0.000349	-0.096194	21	0.026429	no	PTTARY
chr1_1695459_A_G_b38	SLC35E2	3.632	0.00036	0.093196	40	0.025662	no	PTTARY
chr1_1621352_G_A_b38	SLC35E2	3.632	0.00036	0.08562	29	0.023577	no	PTTARY
chr1_1820337_A_G_b38	SLC35E2	3.63	0.000361	0.082836	52	0.022817	no	PTTARY
chr1_1752126_G_A_b38	SLC35E2	3.591	0.000416	0.087369	36	0.024328	no	PTTARY
chr1_1651421_GTAGCCCCTCTGAACGGTCTGTGACACACGCATGCTTTCAGCTAGAGTACTCTA_G_b38	SLC35E2	-3.55	0.000482	-0.087307	21	0.02459	no	PTTARY
chr1_1744052_GAGA_G_b38	SLC35E2	-3.524	0.000529	-0.096286	16	0.027321	no	PTTARY
chr1_1622295_G_C_b38	SLC35E2	3.509	0.000558	0.082567	29	0.023532	no	PTTARY
chr1_1755713_G_A_b38	SLC35E2	-3.471	0.000638	-0.080307	46	0.023137	no	PTTARY
chr1_1743886_C_T_b38	SLC35E2	-3.457	0.000669	-0.09089	20	0.02629	no	PTTARY
chr1_1864334_AAAG_A_b38	SLC35E2	-3.436	0.00072	-0.105989	12	0.030842	no	PTTARY
chr1_1848037_C_CTA_b38	SLC35E2	3.436	0.00072	0.078971	52	0.022982	no	PTTARY
chr1_1591419_A_G_b38	SLC35E2	3.416	0.000771	0.106721	4	0.031237	no	PTTARY
chr1_1986752_A_G_b38	SLC35E2	3.384	0.000863	0.077356	47	0.02286	no	PTTARY
chr1_1113260_C_A_b38	SLC35E2	-3.38	0.000874	-0.17786	3	0.052617	no	PTTARY
chr1_1113344_A_C_b38	SLC35E2	-3.38	0.000874	-0.17786	3	0.052617	no	PTTARY
chr1_1114769_G_A_b38	SLC35E2	-3.38	0.000874	-0.17786	3	0.052617	no	PTTARY
chr1_1116728_A_G_b38	SLC35E2	-3.38	0.000874	-0.17786	3	0.052617	no	PTTARY
chr1_1118491_T_C_b38	SLC35E2	-3.38	0.000874	-0.17786	3	0.052617	no	PTTARY
chr1_1118832_C_T_b38	SLC35E2	-3.38	0.000874	-0.17786	3	0.052617	no	PTTARY
chr1_1119514_G_A_b38	SLC35E2	-3.38	0.000874	-0.17786	3	0.052617	no	PTTARY
chr1_1120626_G_A_b38	SLC35E2	-3.38	0.000874	-0.17786	3	0.052617	no	PTTARY
chr1_1120771_G_A_b38	SLC35E2	-3.38	0.000874	-0.17786	3	0.052617	no	PTTARY
chr1_1120821_T_G_b38	SLC35E2	-3.38	0.000874	-0.17786	3	0.052617	no	PTTARY
chr1_1750226_C_T_b38	SLC35E2	3.374	0.000894	0.078716	46	0.023333	no	PTTARY
chr1_1290968_C_G_b38	SLC35E2	-3.346	0.000982	-0.109234	13	0.032644	no	PTTARY
chr1_1835922_G_GAAA_b38	SLC35E2	-3.34	0.001	-0.19074	3	0.057105	no	PTTARY
chr1_1743544_CA_C_b38	SLC35E2	3.336	0.00102	0.071516	57	0.021439	no	PTTARY
chr1_929839_G_A_b38	SLC35E2	3.334	0.00102	0.098152	7	0.029436	no	PTTARY
chr1_1844830_C_A_b38	SLC35E2	3.331	0.00104	0.076949	51	0.023103	no	PTTARY
chr1_1652913_C_T_b38	SLC35E2	-3.321	0.00107	-0.087492	15	0.026342	no	PTTARY
chr1_1781909_C_T_b38	SLC35E2	3.309	0.00112	0.076296	50	0.023059	no	PTTARY
chr1_1634405_C_CGG_b38	SLC35E2	-3.299	0.00115	-0.210466	3	0.063804	no	PTTARY
chr1_1730405_G_C_b38	SLC35E2	3.298	0.00116	0.079151	48	0.024003	no	PTTARY
chr1_1866635_T_TA_b38	SLC35E2	3.268	0.00128	0.082186	38	0.02515	no	PTTARY
chr1_1659940_A_C_b38	SLC35E2	-3.265	0.00129	-0.10215	5	0.03129	no	PTTARY
chr1_1744096_C_T_b38	SLC35E2	-3.253	0.00135	-0.100222	25	0.030811	no	PTTARY
chr1_1750280_A_G_b38	SLC35E2	-3.247	0.00137	-0.07421	53	0.022858	no	PTTARY
chr1_1955080_C_CGGCTCACACCGGAAGTGAGGCTCACACCGGAAGTGA_b38	SLC35E2	-3.237	0.00142	-0.076034	44	0.023485	no	PTTARY
chr1_1757074_G_T_b38	SLC35E2	3.212	0.00154	0.075398	43	0.023477	no	PTTARY
chr1_1756186_T_C_b38	SLC35E2	3.19	0.00165	0.074428	44	0.023328	no	PTTARY
chr1_1754601_G_T_b38	SLC35E2	3.173	0.00175	0.074831	43	0.023581	no	PTTARY
chr1_1757725_C_T_b38	SLC35E2	3.173	0.00175	0.074831	43	0.023581	no	PTTARY
chr1_928622_G_C_b38	SLC35E2	3.167	0.00179	0.094961	6	0.029988	no	PTTARY
chr1_1934565_G_A_b38	SLC35E2	-3.144	0.00192	-0.076611	44	0.024365	no	PTTARY
chr1_1650688_T_A_b38	SLC35E2	-3.129	0.00202	-0.083133	14	0.026566	no	PTTARY
chr1_1593732_G_C_b38	SLC35E2	-3.123	0.00206	-0.074969	44	0.024008	no	PTTARY
chr1_1309988_G_A_b38	SLC35E2	3.109	0.00216	0.08468	23	0.027236	no	PTTARY
chr1_932255_C_T_b38	SLC35E2	3.104	0.00219	0.091622	7	0.029521	no	PTTARY
chr1_1293731_A_ACGCCCCTGCCCTGGAGGCCC_b38	SLC35E2	3.102	0.00221	0.077752	23	0.025067	no	PTTARY
chr1_1936077_C_T_b38	SLC35E2	-3.093	0.00227	-0.073088	47	0.02363	no	PTTARY
chr1_1116304_A_C_b38	SLC35E2	-3.086	0.00232	-0.167026	3	0.054119	no	PTTARY
chr1_1118777_T_C_b38	SLC35E2	-3.086	0.00232	-0.167026	3	0.054119	no	PTTARY
chr1_1118779_C_T_b38	SLC35E2	-3.086	0.00232	-0.167026	3	0.054119	no	PTTARY
chr1_1118835_A_G_b38	SLC35E2	-3.086	0.00232	-0.167026	3	0.054119	no	PTTARY
chr1_1119363_C_G_b38	SLC35E2	-3.086	0.00232	-0.167026	3	0.054119	no	PTTARY
chr1_1764023_C_A_b38	SLC35E2	3.086	0.00232	0.071205	46	0.023073	no	PTTARY
chr1_1749826_A_G_b38	SLC35E2	-3.076	0.0024	-0.07018	53	0.022816	no	PTTARY
chr1_1723766_C_T_b38	SLC35E2	-3.069	0.00245	-0.095663	11	0.031169	no	PTTARY
chr1_1749637_G_T_b38	SLC35E2	3.064	0.00249	0.069085	45	0.022551	no	PTTARY
chr1_1115543_T_C_b38	SLC35E2	-3.042	0.00267	-0.168222	3	0.055292	no	PTTARY
chr1_1987547_C_CT_b38	SLC35E2	3.042	0.00267	0.071857	50	0.023624	no	PTTARY
chr1_1976566_T_C_b38	SLC35E2	3.042	0.00268	0.067109	49	0.022064	no	PTTARY
chr1_1594890_G_GAC_b38	SLC35E2	-3.04	0.00269	-0.073772	42	0.024265	no	PTTARY
chr1_1115166_G_GT_b38	SLC35E2	-2.97	0.00335	-0.154065	5	0.051865	no	PTTARY
chr1_1116992_A_G_b38	SLC35E2	-2.97	0.00335	-0.154065	5	0.051865	no	PTTARY
chr1_1114143_C_A_b38	SLC35E2	-2.952	0.00355	-0.15608	5	0.05288	no	PTTARY
chr1_1904424_A_AAAATAAATAAAT_b38	SLC35E2	2.947	0.00359	0.061046	52	0.020712	no	PTTARY
chr1_1637577_T_C_b38	SLC35E2	-2.944	0.00363	-0.077226	17	0.026229	no	PTTARY
chr1_1926870_T_C_b38	SLC35E2	-2.94	0.00367	-0.06996	44	0.023793	no	PTTARY
chr1_1668373_C_T_b38	SLC35E2	2.937	0.00371	0.080689	24	0.027472	no	PTTARY
chr1_1937841_ACACCAGGTCCACCTCTGGACACAGGTCCACC_A_b38	SLC35E2	-2.917	0.00394	-0.068941	46	0.023632	no	PTTARY
chr1_1938054_ACT_A_b38	SLC35E2	-2.917	0.00394	-0.068941	46	0.023632	no	PTTARY
chr1_1940540_G_A_b38	SLC35E2	-2.917	0.00394	-0.068941	46	0.023632	no	PTTARY
chr1_1970506_T_A_b38	SLC35E2	-2.916	0.00396	-0.067378	45	0.023106	no	PTTARY
chr1_1688442_T_C_b38	SLC35E2	-2.907	0.00408	-0.079845	16	0.027471	no	PTTARY
chr1_1641261_C_T_b38	SLC35E2	-2.904	0.00411	-0.084907	12	0.029243	no	PTTARY
chr1_1731904_CA_C_b38	SLC35E2	2.896	0.00421	0.075204	25	0.025968	no	PTTARY
chr1_1916417_G_T_b38	SLC35E2	-2.896	0.00421	-0.069316	47	0.023936	no	PTTARY
chr1_1931580_CA_C_b38	SLC35E2	-2.894	0.00423	-0.069195	45	0.023908	no	PTTARY
chr1_1931587_A_G_b38	SLC35E2	-2.894	0.00423	-0.069195	45	0.023908	no	PTTARY
chr1_1977879_G_A_b38	SLC35E2	2.888	0.00432	0.073486	21	0.025449	no	PTTARY
chr1_931558_G_A_b38	SLC35E2	2.887	0.00433	0.081594	9	0.028263	no	PTTARY
chr1_1922670_A_G_b38	SLC35E2	-2.886	0.00433	-0.069646	45	0.02413	no	PTTARY
chr1_1914634_G_T_b38	SLC35E2	-2.884	0.00436	-0.068575	47	0.023777	no	PTTARY
chr1_1916670_G_C_b38	SLC35E2	-2.884	0.00436	-0.068575	47	0.023777	no	PTTARY
chr1_1921745_T_C_b38	SLC35E2	-2.875	0.00448	-0.068928	45	0.023973	no	PTTARY
chr1_1748780_G_A_b38	SLC35E2	-2.874	0.0045	-0.066975	54	0.023302	no	PTTARY
chr1_1938332_A_ACT_b38	SLC35E2	-2.873	0.00452	-0.067386	47	0.023458	no	PTTARY
chr1_933741_T_TG_b38	SLC35E2	-2.87	0.00456	-0.073592	23	0.025642	no	PTTARY
chr1_1968924_GCCCTCCTGGGGGCTCCGGTCCTGCCCAGCAGCCCCAGGTGAGACAGCGCCTGGCGGCCCCTCCCTAGCT_G_b38	SLC35E2	2.864	0.00463	0.080338	13	0.028047	no	PTTARY
chr1_1969006_C_T_b38	SLC35E2	2.864	0.00463	0.080338	13	0.028047	no	PTTARY
chr1_1292284_TTGAG_T_b38	SLC35E2	-2.861	0.00468	-0.098698	7	0.034498	no	PTTARY
chr1_1937273_T_C_b38	SLC35E2	-2.851	0.00482	-0.067515	45	0.023679	no	PTTARY
chr1_931513_T_C_b38	SLC35E2	-2.849	0.00486	-0.064483	50	0.022634	no	PTTARY
chr1_1308516_C_T_b38	SLC35E2	2.843	0.00495	0.078004	23	0.02744	no	PTTARY
chr1_922660_C_A_b38	SLC35E2	2.837	0.00503	0.08505	7	0.029974	no	PTTARY
chr1_922671_C_T_b38	SLC35E2	2.837	0.00503	0.08505	7	0.029974	no	PTTARY
chr1_1928648_C_T_b38	SLC35E2	-2.814	0.0054	-0.06734	45	0.023932	no	PTTARY
chr1_1944182_G_C_b38	SLC35E2	-2.806	0.00552	-0.068167	51	0.024293	no	PTTARY
chr1_2431982_C_T_b38	SLC35E2	-2.805	0.00553	-0.105556	3	0.037628	no	PTTARY
chr1_1015925_A_ATT_b38	SLC35E2	2.794	0.00572	0.072707	23	0.026022	no	PTTARY
chr1_1978429_G_A_b38	SLC35E2	2.792	0.00576	0.075452	15	0.027025	no	PTTARY
chr1_1983507_C_T_b38	SLC35E2	2.792	0.00576	0.075452	15	0.027025	no	PTTARY
chr1_866675_C_T_b38	SLC35E2	2.791	0.00578	0.12816	5	0.045926	no	PTTARY
chr1_1115683_C_A_b38	SLC35E2	-2.787	0.00584	-0.154075	3	0.055277	no	PTTARY
chr1_1697272_G_A_b38	SLC35E2	2.783	0.00591	0.096107	15	0.034535	no	PTTARY
chr1_2274109_A_C_b38	SLC35E2	2.782	0.00592	0.070332	32	0.025277	no	PTTARY
chr1_1969249_A_AGCCCT_b38	SLC35E2	2.781	0.00595	0.076239	14	0.027417	no	PTTARY
chr1_1284756_A_G_b38	SLC35E2	-2.781	0.00595	-0.121429	8	0.04367	no	PTTARY
chr1_1942258_G_A_b38	SLC35E2	-2.78	0.00596	-0.065968	46	0.023728	no	PTTARY
chr1_1925075_G_A_b38	SLC35E2	-2.775	0.00605	-0.119358	5	0.043005	no	PTTARY
chr1_1313807_G_A_b38	SLC35E2	2.774	0.00608	0.075582	23	0.027248	no	PTTARY
chr1_1370553_CA_C_b38	SLC35E2	2.771	0.00612	0.064939	63	0.023432	no	PTTARY
chr1_1285574_G_A_b38	SLC35E2	-2.765	0.00623	-0.124373	7	0.044974	no	PTTARY
chr1_1971434_C_T_b38	SLC35E2	2.763	0.00628	0.075237	14	0.027231	no	PTTARY
chr1_1918989_A_G_b38	SLC35E2	-2.761	0.0063	-0.06437	48	0.023311	no	PTTARY
chr1_1312114_T_C_b38	SLC35E2	2.761	0.00631	0.075612	23	0.027386	no	PTTARY
chr1_1940973_C_T_b38	SLC35E2	-2.75	0.00652	-0.065038	47	0.023653	no	PTTARY
chr1_1942014_G_A_b38	SLC35E2	-2.75	0.00652	-0.065038	47	0.023653	no	PTTARY
chr1_1942075_A_G_b38	SLC35E2	-2.75	0.00652	-0.065038	47	0.023653	no	PTTARY
chr1_1942086_T_C_b38	SLC35E2	-2.75	0.00652	-0.065038	47	0.023653	no	PTTARY
chr1_1942260_G_C_b38	SLC35E2	-2.75	0.00652	-0.065038	47	0.023653	no	PTTARY
chr1_2235045_A_AT_b38	SLC35E2	2.749	0.00654	0.070469	24	0.025638	no	PTTARY
chr1_1641342_C_A_b38	SLC35E2	-2.745	0.00662	-0.171834	3	0.062607	no	PTTARY
chr1_1968900_A_G_b38	SLC35E2	2.736	0.00679	0.077489	13	0.028322	no	PTTARY
chr1_1969238_C_T_b38	SLC35E2	2.736	0.0068	0.074971	14	0.027405	no	PTTARY
chr1_839543_G_C_b38	SLC35E2	-2.73	0.0069	-0.078154	14	0.028624	no	PTTARY
chr1_1613974_G_A_b38	SLC35E2	2.724	0.00704	0.076336	11	0.028028	no	PTTARY
chr1_1618982_G_A_b38	SLC35E2	2.724	0.00704	0.076336	11	0.028028	no	PTTARY
chr1_1933087_C_T_b38	SLC35E2	-2.716	0.0072	-0.065014	43	0.023937	no	PTTARY
chr1_1933859_A_G_b38	SLC35E2	-2.716	0.0072	-0.065014	43	0.023937	no	PTTARY
chr1_1969235_A_G_b38	SLC35E2	2.709	0.00734	0.074638	14	0.027547	no	PTTARY
chr1_1282558_C_CCA_b38	SLC35E2	-2.709	0.00735	-0.089646	9	0.033094	no	PTTARY
chr1_936972_G_C_b38	SLC35E2	2.679	0.00801	0.069417	20	0.025909	no	PTTARY
chr1_1936627_C_G_b38	SLC35E2	-2.677	0.00805	-0.064111	43	0.023946	no	PTTARY
chr1_1981144_T_G_b38	SLC35E2	2.675	0.0081	0.073152	15	0.027346	no	PTTARY
chr1_1978055_C_T_b38	SLC35E2	2.673	0.00814	0.068375	21	0.025576	no	PTTARY
chr1_1746440_A_G_b38	SLC35E2	-2.666	0.00831	-0.075512	14	0.028319	no	PTTARY
chr1_1969479_G_A_b38	SLC35E2	2.666	0.00832	0.077044	11	0.028899	no	PTTARY
chr1_1976473_C_T_b38	SLC35E2	2.649	0.00874	0.06774	21	0.025574	no	PTTARY
chr1_1976573_T_C_b38	SLC35E2	2.649	0.00874	0.06774	21	0.025574	no	PTTARY
chr1_1976600_C_T_b38	SLC35E2	2.649	0.00874	0.06774	21	0.025574	no	PTTARY
chr1_1976646_A_G_b38	SLC35E2	2.649	0.00874	0.06774	21	0.025574	no	PTTARY
chr1_1976661_G_T_b38	SLC35E2	2.649	0.00874	0.06774	21	0.025574	no	PTTARY
chr1_1976946_C_T_b38	SLC35E2	2.649	0.00874	0.06774	21	0.025574	no	PTTARY
chr1_1977264_C_G_b38	SLC35E2	2.649	0.00874	0.06774	21	0.025574	no	PTTARY
chr1_1977765_A_G_b38	SLC35E2	2.649	0.00874	0.06774	21	0.025574	no	PTTARY
chr1_1978006_A_G_b38	SLC35E2	2.649	0.00874	0.06774	21	0.025574	no	PTTARY
chr1_1978114_T_A_b38	SLC35E2	2.649	0.00874	0.06774	21	0.025574	no	PTTARY
chr1_1978262_C_T_b38	SLC35E2	2.649	0.00874	0.06774	21	0.025574	no	PTTARY
chr1_1978294_G_T_b38	SLC35E2	2.649	0.00874	0.06774	21	0.025574	no	PTTARY
chr1_1978404_C_T_b38	SLC35E2	2.649	0.00874	0.06774	21	0.025574	no	PTTARY
chr1_1978415_G_A_b38	SLC35E2	2.649	0.00874	0.06774	21	0.025574	no	PTTARY
chr1_1978797_T_C_b38	SLC35E2	2.649	0.00874	0.06774	21	0.025574	no	PTTARY
chr1_1980953_G_A_b38	SLC35E2	2.649	0.00874	0.06774	21	0.025574	no	PTTARY
chr1_1981319_G_C_b38	SLC35E2	2.649	0.00874	0.06774	21	0.025574	no	PTTARY
chr1_1982826_T_C_b38	SLC35E2	2.649	0.00874	0.06774	21	0.025574	no	PTTARY
chr1_1983166_A_T_b38	SLC35E2	2.649	0.00874	0.06774	21	0.025574	no	PTTARY
chr1_1983956_TGG_T_b38	SLC35E2	2.649	0.00874	0.06774	21	0.025574	no	PTTARY
chr1_1984586_G_A_b38	SLC35E2	2.649	0.00874	0.06774	21	0.025574	no	PTTARY
chr1_1984595_C_T_b38	SLC35E2	2.649	0.00874	0.06774	21	0.025574	no	PTTARY
chr1_1984859_C_T_b38	SLC35E2	2.649	0.00874	0.06774	21	0.025574	no	PTTARY
chr1_1985148_G_T_b38	SLC35E2	2.649	0.00874	0.06774	21	0.025574	no	PTTARY
chr1_1986010_T_G_b38	SLC35E2	2.649	0.00874	0.06774	21	0.025574	no	PTTARY
chr1_1986033_G_A_b38	SLC35E2	2.649	0.00874	0.06774	21	0.025574	no	PTTARY
chr1_1986176_A_T_b38	SLC35E2	2.649	0.00874	0.06774	21	0.025574	no	PTTARY
chr1_1986211_T_C_b38	SLC35E2	2.649	0.00874	0.06774	21	0.025574	no	PTTARY
chr1_1986390_T_G_b38	SLC35E2	2.649	0.00874	0.06774	21	0.025574	no	PTTARY
chr1_1986469_A_C_b38	SLC35E2	2.649	0.00874	0.06774	21	0.025574	no	PTTARY
chr1_1987096_A_T_b38	SLC35E2	2.649	0.00874	0.06774	21	0.025574	no	PTTARY
chr1_1987156_G_A_b38	SLC35E2	2.649	0.00874	0.06774	21	0.025574	no	PTTARY
chr1_1688647_G_A_b38	SLC35E2	-2.639	0.00897	-0.074475	15	0.028217	no	PTTARY
chr1_1950071_C_T_b38	SLC35E2	-2.636	0.00907	-0.063752	49	0.024189	no	PTTARY
chr1_1951106_G_A_b38	SLC35E2	-2.636	0.00907	-0.063752	49	0.024189	no	PTTARY
chr1_1951865_G_GT_b38	SLC35E2	-2.636	0.00907	-0.063752	49	0.024189	no	PTTARY
chr1_1952064_G_A_b38	SLC35E2	-2.636	0.00907	-0.063752	49	0.024189	no	PTTARY
chr1_1952823_TA_T_b38	SLC35E2	-2.636	0.00907	-0.063752	49	0.024189	no	PTTARY
chr1_1969229_T_A_b38	SLC35E2	2.635	0.00908	0.072413	14	0.027478	no	PTTARY
chr1_1688619_AAAC_A_b38	SLC35E2	-2.626	0.00931	-0.074859	14	0.028502	no	PTTARY
chr1_866664_G_A_b38	SLC35E2	2.625	0.00934	0.101971	6	0.038844	no	PTTARY
chr1_1945842_A_AAAAGAAC_b38	SLC35E2	-2.624	0.00937	-0.062254	46	0.023724	no	PTTARY
chr1_1238902_T_C_b38	SLC35E2	-2.614	0.00964	-0.064957	25	0.024849	no	PTTARY
chr1_2367306_CAA_C_b38	SLC35E2	2.614	0.00965	0.066177	32	0.02532	no	PTTARY
chr1_1361679_G_A_b38	SLC35E2	2.609	0.00979	0.076786	14	0.029436	no	PTTARY
chr1_1971127_G_A_b38	SLC35E2	2.607	0.00983	0.070992	14	0.027228	no	PTTARY
chr1_1935938_T_C_b38	SLC35E2	-2.603	0.00996	-0.063576	38	0.024427	no	PTTARY
chr1_1743565_ATAT_A_b38	SLC35E2	-5.473	1.46e-07	-0.131231	43	0.02398	yes	PRSTTE
chr1_1744028_A_AC_b38	SLC35E2	-5.389	2.19e-07	-0.177995	12	0.033029	yes	PRSTTE
chr1_1751981_A_T_b38	SLC35E2	-5.384	2.24e-07	-0.155896	22	0.028954	yes	PRSTTE
chr1_1747695_A_G_b38	SLC35E2	-5.238	4.49e-07	-0.123569	44	0.023592	yes	PRSTTE
chr1_1743840_T_C_b38	SLC35E2	-5.151	6.72e-07	-0.156792	17	0.030437	yes	PRSTTE
chr1_1744052_GAGA_G_b38	SLC35E2	-5.135	7.24e-07	-0.169721	13	0.033051	yes	PRSTTE
chr1_1754482_TCCCTGGGACCGAAGTCGCCCCA_T_b38	SLC35E2	-5.116	7.9e-07	-0.140189	46	0.0274	yes	PRSTTE
chr1_1864334_AAAG_A_b38	SLC35E2	-5.056	1.04e-06	-0.158869	13	0.031421	yes	PRSTTE
chr1_1743886_C_T_b38	SLC35E2	-5.036	1.15e-06	-0.148587	24	0.029508	yes	PRSTTE
chr1_1881082_C_T_b38	SLC35E2	-5.033	1.16e-06	-0.140888	45	0.027992	yes	PRSTTE
chr1_1743851_C_T_b38	SLC35E2	-5.003	1.33e-06	-0.154942	17	0.030968	yes	PRSTTE
chr1_1688328_C_T_b38	SLC35E2	-4.991	1.4e-06	-0.140605	14	0.02817	yes	PRSTTE
chr1_1881249_A_G_b38	SLC35E2	-4.979	1.48e-06	-0.139384	45	0.027995	yes	PRSTTE
chr1_1752908_C_CCCT_b38	SLC35E2	-4.973	1.52e-06	-0.140728	41	0.028296	yes	PRSTTE
chr1_1750280_A_G_b38	SLC35E2	-4.966	1.58e-06	-0.131869	50	0.026556	yes	PRSTTE
chr1_1849781_T_C_b38	SLC35E2	-4.919	1.94e-06	-0.149039	10	0.030297	yes	PRSTTE
chr1_1860718_A_C_b38	SLC35E2	-4.851	2.64e-06	-0.136015	48	0.028038	yes	PRSTTE
chr1_1846009_AGG_A_b38	SLC35E2	-4.839	2.79e-06	-0.136415	47	0.028193	yes	PRSTTE
chr1_1846011_G_GTCC_b38	SLC35E2	-4.839	2.79e-06	-0.136415	47	0.028193	yes	PRSTTE
chr1_1866508_A_G_b38	SLC35E2	-4.834	2.84e-06	-0.135369	46	0.028001	yes	PRSTTE
chr1_1879567_T_C_b38	SLC35E2	-4.834	2.84e-06	-0.135369	46	0.028001	yes	PRSTTE
chr1_1886800_G_A_b38	SLC35E2	-4.834	2.84e-06	-0.135369	46	0.028001	yes	PRSTTE
chr1_1891654_C_CAGAG_b38	SLC35E2	-4.834	2.84e-06	-0.135369	46	0.028001	yes	PRSTTE
chr1_1750428_G_C_b38	SLC35E2	-4.827	2.93e-06	-0.142805	34	0.029584	yes	PRSTTE
chr1_1945842_A_AAAAGAAC_b38	SLC35E2	-4.781	3.6e-06	-0.124629	37	0.026066	yes	PRSTTE
chr1_1781909_C_T_b38	SLC35E2	4.731	4.49e-06	0.124671	38	0.026353	yes	PRSTTE
chr1_1836126_C_A_b38	SLC35E2	-4.715	4.81e-06	-0.128206	47	0.027191	yes	PRSTTE
chr1_1843381_A_T_b38	SLC35E2	-4.713	4.86e-06	-0.132611	46	0.028139	yes	PRSTTE
chr1_1847030_A_G_b38	SLC35E2	-4.713	4.86e-06	-0.132611	46	0.028139	yes	PRSTTE
chr1_1850017_G_T_b38	SLC35E2	-4.713	4.86e-06	-0.132611	46	0.028139	yes	PRSTTE
chr1_1746440_A_G_b38	SLC35E2	-4.665	5.99e-06	-0.151058	12	0.032383	yes	PRSTTE
chr1_1844830_C_A_b38	SLC35E2	4.661	6.08e-06	0.125572	35	0.026939	yes	PRSTTE
chr1_1750440_G_A_b38	SLC35E2	-4.626	7.07e-06	-0.136675	34	0.029543	yes	PRSTTE
chr1_1757725_C_T_b38	SLC35E2	4.591	8.22e-06	0.128306	32	0.027945	yes	PRSTTE
chr1_1899573_C_T_b38	SLC35E2	-4.567	9.12e-06	-0.127962	47	0.028019	yes	PRSTTE
chr1_1901262_C_T_b38	SLC35E2	-4.567	9.12e-06	-0.127962	47	0.028019	yes	PRSTTE
chr1_1901386_C_A_b38	SLC35E2	-4.567	9.12e-06	-0.127962	47	0.028019	yes	PRSTTE
chr1_1848037_C_CTA_b38	SLC35E2	4.552	9.71e-06	0.122584	36	0.026928	yes	PRSTTE
chr1_1708474_C_A_b38	SLC35E2	-4.497	1.23e-05	-0.143914	9	0.032005	yes	PRSTTE
chr1_1750508_A_C_b38	SLC35E2	-4.469	1.38e-05	-0.109055	43	0.024404	yes	PRSTTE
chr1_1865177_G_A_b38	SLC35E2	-4.463	1.42e-05	-0.134638	10	0.030165	yes	PRSTTE
chr1_1764023_C_A_b38	SLC35E2	4.461	1.43e-05	0.121059	33	0.027139	yes	PRSTTE
chr1_1762759_AAATG_A_b38	SLC35E2	4.43	1.63e-05	0.118874	39	0.026835	yes	PRSTTE
chr1_1746522_GT_G_b38	SLC35E2	-4.419	1.71e-05	-0.147707	11	0.033427	yes	PRSTTE
chr1_1902481_G_A_b38	SLC35E2	-4.394	1.9e-05	-0.123367	46	0.028079	yes	PRSTTE
chr1_1851414_GA_G_b38	SLC35E2	-4.381	2e-05	-0.12486	29	0.028499	yes	PRSTTE
chr1_1902439_C_T_b38	SLC35E2	-4.37	2.09e-05	-0.121892	46	0.027894	yes	PRSTTE
chr1_1916417_G_T_b38	SLC35E2	-4.366	2.12e-05	-0.121924	43	0.027924	yes	PRSTTE
chr1_1688457_G_A_b38	SLC35E2	-4.35	2.27e-05	-0.127325	24	0.029272	yes	PRSTTE
chr1_1914634_G_T_b38	SLC35E2	-4.314	2.64e-05	-0.118322	43	0.02743	yes	PRSTTE
chr1_1916670_G_C_b38	SLC35E2	-4.314	2.64e-05	-0.118322	43	0.02743	yes	PRSTTE
chr1_1909238_G_A_b38	SLC35E2	-4.303	2.76e-05	-0.121906	47	0.028332	yes	PRSTTE
chr1_1828894_T_TAC_b38	SLC35E2	4.302	2.77e-05	0.113956	37	0.026491	yes	PRSTTE
chr1_1780791_C_T_b38	SLC35E2	4.287	2.93e-05	0.135104	7	0.031511	yes	PRSTTE
chr1_1782430_T_G_b38	SLC35E2	4.287	2.93e-05	0.135104	7	0.031511	yes	PRSTTE
chr1_1794321_C_T_b38	SLC35E2	4.287	2.93e-05	0.135104	7	0.031511	yes	PRSTTE
chr1_1805214_T_G_b38	SLC35E2	4.287	2.93e-05	0.135104	7	0.031511	yes	PRSTTE
chr1_1878070_C_T_b38	SLC35E2	4.287	2.93e-05	0.135104	7	0.031511	yes	PRSTTE
chr1_1881006_GGA_G_b38	SLC35E2	4.287	2.93e-05	0.135104	7	0.031511	yes	PRSTTE
chr1_1888667_A_C_b38	SLC35E2	4.287	2.93e-05	0.135104	7	0.031511	yes	PRSTTE
chr1_1940540_G_A_b38	SLC35E2	-4.287	2.94e-05	-0.115554	44	0.026954	yes	PRSTTE
chr1_1754601_G_T_b38	SLC35E2	4.286	2.96e-05	0.120229	32	0.028053	yes	PRSTTE
chr1_1749826_A_G_b38	SLC35E2	-4.277	3.07e-05	-0.115334	52	0.026968	yes	PRSTTE
chr1_1891444_CG_C_b38	SLC35E2	-4.276	3.07e-05	-0.121513	41	0.028415	yes	PRSTTE
chr1_1909234_G_A_b38	SLC35E2	-4.246	3.48e-05	-0.12126	46	0.028562	yes	PRSTTE
chr1_1755713_G_A_b38	SLC35E2	-4.232	3.67e-05	-0.119899	39	0.02833	yes	PRSTTE
chr1_1942014_G_A_b38	SLC35E2	-4.225	3.79e-05	-0.114039	44	0.026993	yes	PRSTTE
chr1_1942075_A_G_b38	SLC35E2	-4.225	3.79e-05	-0.114039	44	0.026993	yes	PRSTTE
chr1_1942086_T_C_b38	SLC35E2	-4.225	3.79e-05	-0.114039	44	0.026993	yes	PRSTTE
chr1_1937273_T_C_b38	SLC35E2	-4.2	4.18e-05	-0.1142	42	0.027188	yes	PRSTTE
chr1_1918989_A_G_b38	SLC35E2	-4.187	4.41e-05	-0.114966	42	0.027457	yes	PRSTTE
chr1_1936906_C_CA_b38	SLC35E2	-4.169	4.73e-05	-0.126552	24	0.030352	yes	PRSTTE
chr1_1757074_G_T_b38	SLC35E2	4.167	4.78e-05	0.115309	33	0.027674	yes	PRSTTE
chr1_1940973_C_T_b38	SLC35E2	-4.164	4.84e-05	-0.110506	46	0.026541	yes	PRSTTE
chr1_1942260_G_C_b38	SLC35E2	-4.152	5.06e-05	-0.111138	45	0.026766	yes	PRSTTE
chr1_1834655_A_C_b38	SLC35E2	4.147	5.17e-05	0.131051	7	0.031602	yes	PRSTTE
chr1_1688531_T_C_b38	SLC35E2	-4.137	5.38e-05	-0.128995	17	0.031179	yes	PRSTTE
chr1_1891450_G_C_b38	SLC35E2	-4.132	5.49e-05	-0.11671	42	0.028247	yes	PRSTTE
chr1_1922670_A_G_b38	SLC35E2	-4.129	5.56e-05	-0.113485	41	0.027485	yes	PRSTTE
chr1_1928648_C_T_b38	SLC35E2	-4.129	5.56e-05	-0.113485	41	0.027485	yes	PRSTTE
chr1_1864350_C_T_b38	SLC35E2	4.121	5.74e-05	0.125343	9	0.030417	yes	PRSTTE
chr1_1944182_G_C_b38	SLC35E2	-4.105	6.11e-05	-0.112412	45	0.027385	yes	PRSTTE
chr1_1885444_TTAGA_T_b38	SLC35E2	4.104	6.13e-05	0.130457	7	0.031785	yes	PRSTTE
chr1_1987547_C_CT_b38	SLC35E2	4.089	6.51e-05	0.109853	42	0.026867	yes	PRSTTE
chr1_1875208_T_C_b38	SLC35E2	-4.077	6.82e-05	-0.116596	45	0.028598	yes	PRSTTE
chr1_1942258_G_A_b38	SLC35E2	-4.067	7.11e-05	-0.109477	44	0.026921	yes	PRSTTE
chr1_1944420_A_G_b38	SLC35E2	-4.058	7.34e-05	-0.109681	47	0.027025	yes	PRSTTE
chr1_1902056_G_A_b38	SLC35E2	4.058	7.36e-05	0.125595	9	0.030952	yes	PRSTTE
chr1_1937841_ACACCAGGTCCACCTCTGGACACAGGTCCACC_A_b38	SLC35E2	-4.051	7.55e-05	-0.109805	44	0.027103	yes	PRSTTE
chr1_1938054_ACT_A_b38	SLC35E2	-4.051	7.55e-05	-0.109805	44	0.027103	yes	PRSTTE
chr1_1931587_A_G_b38	SLC35E2	-4.042	7.83e-05	-0.108983	42	0.026963	yes	PRSTTE
chr1_1931580_CA_C_b38	SLC35E2	-4.037	7.98e-05	-0.109319	41	0.027078	yes	PRSTTE
chr1_1891450_G_A_b38	SLC35E2	4.025	8.35e-05	0.123366	11	0.030647	yes	PRSTTE
chr1_1688786_G_A_b38	SLC35E2	-4.016	8.66e-05	-0.131122	14	0.032649	yes	PRSTTE
chr1_1688442_T_C_b38	SLC35E2	-4.008	8.95e-05	-0.116028	25	0.028951	yes	PRSTTE
chr1_1921745_T_C_b38	SLC35E2	-4.006	9.01e-05	-0.108903	40	0.027186	yes	PRSTTE
chr1_1986752_A_G_b38	SLC35E2	3.992	9.52e-05	0.10716	41	0.026846	yes	PRSTTE
chr1_1921333_C_T_b38	SLC35E2	-3.987	9.68e-05	-0.112386	47	0.028185	yes	PRSTTE
chr1_1987049_A_G_b38	SLC35E2	3.971	0.000103	0.10612	41	0.026725	yes	PRSTTE
chr1_1692124_T_G_b38	SLC35E2	-3.95	0.000112	-0.126079	19	0.031919	yes	PRSTTE
chr1_1936077_C_T_b38	SLC35E2	-3.942	0.000116	-0.10579	44	0.02684	yes	PRSTTE
chr1_1692151_T_C_b38	SLC35E2	-3.933	0.000119	-0.122388	20	0.031118	yes	PRSTTE
chr1_1880596_T_A_b38	SLC35E2	-3.922	0.000125	-0.112993	40	0.028813	yes	PRSTTE
chr1_1926870_T_C_b38	SLC35E2	-3.913	0.000129	-0.10591	38	0.027067	yes	PRSTTE
chr1_1698022_G_A_b38	SLC35E2	-3.906	0.000132	-0.233726	8	0.05983	yes	PRSTTE
chr1_1947648_G_A_b38	SLC35E2	3.881	0.000146	0.125798	7	0.032418	yes	PRSTTE
chr1_1933087_C_T_b38	SLC35E2	-3.88	0.000146	-0.104938	42	0.027043	yes	PRSTTE
chr1_1933859_A_G_b38	SLC35E2	-3.88	0.000146	-0.104938	42	0.027043	yes	PRSTTE
chr1_1945975_TG_T_b38	SLC35E2	-3.857	0.000159	-0.105751	46	0.027417	yes	PRSTTE
chr1_1774165_A_G_b38	SLC35E2	3.84	0.00017	0.122413	7	0.031879	yes	PRSTTE
chr1_1708521_C_G_b38	SLC35E2	-3.812	0.000189	-0.118626	11	0.031118	yes	PRSTTE
chr1_1838449_C_CT_b38	SLC35E2	3.806	0.000193	0.121474	7	0.031916	yes	PRSTTE
chr1_1845824_TACACACACACACACACACACACACACACAC_T_b38	SLC35E2	3.772	0.000219	0.119896	9	0.031787	yes	PRSTTE
chr1_1866635_T_TAAA_b38	SLC35E2	-3.743	0.000244	-0.114769	30	0.030659	yes	PRSTTE
chr1_1952590_A_AAAAG_b38	SLC35E2	3.742	0.000245	0.111225	13	0.029727	yes	PRSTTE
chr1_1722626_AGCG_A_b38	SLC35E2	3.729	0.000257	0.118314	19	0.031731	yes	PRSTTE
chr1_933548_A_AG_b38	SLC35E2	-3.729	0.000257	-0.101516	29	0.027226	yes	PRSTTE
chr1_1810077_T_A_b38	SLC35E2	-3.725	0.000261	-0.116116	20	0.031173	yes	PRSTTE
chr1_1877330_T_C_b38	SLC35E2	-3.707	0.000279	-0.101493	39	0.027378	yes	PRSTTE
chr1_1688586_C_T_b38	SLC35E2	-3.69	0.000297	-0.115982	17	0.031433	yes	PRSTTE
chr1_1802763_T_TAA_b38	SLC35E2	3.658	0.000333	0.127086	5	0.034737	yes	PRSTTE
chr1_1960609_G_C_b38	SLC35E2	-3.655	0.000336	-0.096453	39	0.026386	yes	PRSTTE
chr1_1936906_CA_C_b38	SLC35E2	3.649	0.000344	0.121001	6	0.033159	yes	PRSTTE
chr1_1901149_A_AAAGAAAGG_b38	SLC35E2	3.627	0.000373	0.099298	30	0.02738	yes	PRSTTE
chr1_1918697_C_T_b38	SLC35E2	3.613	0.000392	0.115278	12	0.031903	yes	PRSTTE
chr1_1688647_G_A_b38	SLC35E2	-3.601	0.00041	-0.106442	25	0.029563	yes	PRSTTE
chr1_1688619_AAAC_A_b38	SLC35E2	-3.572	0.000454	-0.107877	22	0.0302	yes	PRSTTE
chr1_1842213_A_G_b38	SLC35E2	3.569	0.000458	0.112684	9	0.031569	yes	PRSTTE
chr1_1842221_C_G_b38	SLC35E2	3.569	0.000458	0.112684	9	0.031569	yes	PRSTTE
chr1_1976566_T_C_b38	SLC35E2	3.563	0.000469	0.089193	45	0.025036	yes	PRSTTE
chr1_1728671_C_A_b38	SLC35E2	3.514	0.000557	0.121846	8	0.03467	yes	PRSTTE
chr1_1924264_CCG_C_b38	SLC35E2	-3.512	0.000561	-0.09461	50	0.026937	yes	PRSTTE
chr1_1924269_C_T_b38	SLC35E2	-3.512	0.000561	-0.09461	50	0.026937	yes	PRSTTE
chr1_1921849_G_T_b38	SLC35E2	3.463	0.000667	0.11318	13	0.032684	yes	PRSTTE
chr1_1944216_C_T_b38	SLC35E2	-3.462	0.00067	-0.096523	45	0.027883	yes	PRSTTE
chr1_1972273_C_A_b38	SLC35E2	3.435	0.000735	0.092077	22	0.026807	yes	PRSTTE
chr1_1729859_A_G_b38	SLC35E2	3.427	0.000756	0.11614	8	0.033892	yes	PRSTTE
chr1_1739131_T_C_b38	SLC35E2	3.404	0.000819	0.091156	40	0.026782	yes	PRSTTE
chr1_1684789_C_CAAAAA_b38	SLC35E2	-3.401	0.000826	-0.184045	5	0.054113	yes	PRSTTE
chr1_1660683_C_T_b38	SLC35E2	-3.395	0.000844	-0.100618	15	0.029638	yes	PRSTTE
chr1_1971864_C_T_b38	SLC35E2	3.393	0.000849	0.084184	43	0.024811	yes	PRSTTE
chr1_1744096_C_T_b38	SLC35E2	-3.371	0.000916	-0.133055	20	0.039473	yes	PRSTTE
chr1_1855321_C_CA_b38	SLC35E2	3.356	0.000965	0.113103	7	0.033706	yes	PRSTTE
chr1_1744121_A_C_b38	SLC35E2	-3.35	0.000984	-0.124839	21	0.037266	yes	PRSTTE
chr1_1942186_G_A_b38	SLC35E2	3.339	0.00102	0.107775	7	0.032275	yes	PRSTTE
chr1_1971027_A_C_b38	SLC35E2	3.304	0.00115	0.093048	16	0.028162	yes	PRSTTE
chr1_1976990_T_C_b38	SLC35E2	3.302	0.00116	0.086124	25	0.026079	yes	PRSTTE
chr1_1984601_T_C_b38	SLC35E2	3.302	0.00116	0.086124	25	0.026079	yes	PRSTTE
chr1_1688102_G_A_b38	SLC35E2	-3.294	0.00119	-0.096366	14	0.029258	yes	PRSTTE
chr1_1924659_C_T_b38	SLC35E2	3.292	0.0012	0.10728	10	0.032588	yes	PRSTTE
chr1_1981144_T_G_b38	SLC35E2	3.282	0.00124	0.0947	17	0.028852	yes	PRSTTE
chr1_2304920_G_A_b38	SLC35E2	-3.281	0.00124	-0.115175	4	0.035099	yes	PRSTTE
chr1_1971434_C_T_b38	SLC35E2	3.275	0.00127	0.091808	17	0.028037	yes	PRSTTE
chr1_1702383_T_C_b38	SLC35E2	-3.274	0.00127	-0.094052	16	0.028723	yes	PRSTTE
chr1_1929306_C_T_b38	SLC35E2	3.268	0.00129	0.105815	7	0.032375	yes	PRSTTE
chr1_1637577_T_C_b38	SLC35E2	-3.264	0.00131	-0.097084	17	0.029741	yes	PRSTTE
chr1_1981062_A_G_b38	SLC35E2	3.258	0.00134	0.084398	27	0.025909	yes	PRSTTE
chr1_1981291_A_G_b38	SLC35E2	3.258	0.00134	0.084398	27	0.025909	yes	PRSTTE
chr1_1981295_T_C_b38	SLC35E2	3.258	0.00134	0.084398	27	0.025909	yes	PRSTTE
chr1_2301093_G_A_b38	SLC35E2	-3.256	0.00135	-0.115239	4	0.035388	yes	PRSTTE
chr1_1929713_G_A_b38	SLC35E2	3.242	0.00141	0.104612	7	0.032268	yes	PRSTTE
chr1_1976646_A_G_b38	SLC35E2	3.237	0.00144	0.085837	24	0.02652	yes	PRSTTE
chr1_1971127_G_A_b38	SLC35E2	3.236	0.00144	0.091619	16	0.02831	yes	PRSTTE
chr1_1976473_C_T_b38	SLC35E2	3.227	0.00149	0.084691	25	0.026246	yes	PRSTTE
chr1_1976573_T_C_b38	SLC35E2	3.227	0.00149	0.084691	25	0.026246	yes	PRSTTE
chr1_1976600_C_T_b38	SLC35E2	3.227	0.00149	0.084691	25	0.026246	yes	PRSTTE
chr1_1976661_G_T_b38	SLC35E2	3.227	0.00149	0.084691	25	0.026246	yes	PRSTTE
chr1_1976946_C_T_b38	SLC35E2	3.227	0.00149	0.084691	25	0.026246	yes	PRSTTE
chr1_1977264_C_G_b38	SLC35E2	3.227	0.00149	0.084691	25	0.026246	yes	PRSTTE
chr1_1977765_A_G_b38	SLC35E2	3.227	0.00149	0.084691	25	0.026246	yes	PRSTTE
chr1_1977879_G_A_b38	SLC35E2	3.227	0.00149	0.084691	25	0.026246	yes	PRSTTE
chr1_1978006_A_G_b38	SLC35E2	3.227	0.00149	0.084691	25	0.026246	yes	PRSTTE
chr1_1978055_C_T_b38	SLC35E2	3.227	0.00149	0.084691	25	0.026246	yes	PRSTTE
chr1_1978562_C_G_b38	SLC35E2	3.227	0.00149	0.084691	25	0.026246	yes	PRSTTE
chr1_1978573_T_C_b38	SLC35E2	3.227	0.00149	0.084691	25	0.026246	yes	PRSTTE
chr1_1978647_G_T_b38	SLC35E2	3.227	0.00149	0.084691	25	0.026246	yes	PRSTTE
chr1_1978797_T_C_b38	SLC35E2	3.227	0.00149	0.084691	25	0.026246	yes	PRSTTE
chr1_1980953_G_A_b38	SLC35E2	3.227	0.00149	0.084691	25	0.026246	yes	PRSTTE
chr1_1981319_G_C_b38	SLC35E2	3.227	0.00149	0.084691	25	0.026246	yes	PRSTTE
chr1_1982826_T_C_b38	SLC35E2	3.227	0.00149	0.084691	25	0.026246	yes	PRSTTE
chr1_1983166_A_T_b38	SLC35E2	3.227	0.00149	0.084691	25	0.026246	yes	PRSTTE
chr1_1983956_TGG_T_b38	SLC35E2	3.227	0.00149	0.084691	25	0.026246	yes	PRSTTE
chr1_1984586_G_A_b38	SLC35E2	3.227	0.00149	0.084691	25	0.026246	yes	PRSTTE
chr1_1984595_C_T_b38	SLC35E2	3.227	0.00149	0.084691	25	0.026246	yes	PRSTTE
chr1_1984859_C_T_b38	SLC35E2	3.227	0.00149	0.084691	25	0.026246	yes	PRSTTE
chr1_1985148_G_T_b38	SLC35E2	3.227	0.00149	0.084691	25	0.026246	yes	PRSTTE
chr1_1986010_T_G_b38	SLC35E2	3.227	0.00149	0.084691	25	0.026246	yes	PRSTTE
chr1_1986033_G_A_b38	SLC35E2	3.227	0.00149	0.084691	25	0.026246	yes	PRSTTE
chr1_1986176_A_T_b38	SLC35E2	3.227	0.00149	0.084691	25	0.026246	yes	PRSTTE
chr1_1986211_T_C_b38	SLC35E2	3.227	0.00149	0.084691	25	0.026246	yes	PRSTTE
chr1_1986390_T_G_b38	SLC35E2	3.227	0.00149	0.084691	25	0.026246	yes	PRSTTE
chr1_1986469_A_C_b38	SLC35E2	3.227	0.00149	0.084691	25	0.026246	yes	PRSTTE
chr1_1987096_A_T_b38	SLC35E2	3.227	0.00149	0.084691	25	0.026246	yes	PRSTTE
chr1_1987156_G_A_b38	SLC35E2	3.227	0.00149	0.084691	25	0.026246	yes	PRSTTE
chr1_1687153_A_G_b38	SLC35E2	-3.214	0.00155	-0.08261	48	0.025704	yes	PRSTTE
chr1_1924208_G_A_b38	SLC35E2	3.209	0.00157	0.102092	14	0.03181	yes	PRSTTE
chr1_1937046_G_A_b38	SLC35E2	3.194	0.00166	0.117415	3	0.036762	yes	PRSTTE
chr1_1987145_C_T_b38	SLC35E2	3.171	0.00178	0.082416	27	0.02599	yes	PRSTTE
chr1_1927692_C_T_b38	SLC35E2	3.157	0.00187	0.103584	6	0.032811	yes	PRSTTE
chr1_1671148_C_T_b38	SLC35E2	3.143	0.00196	0.085893	25	0.027332	yes	PRSTTE
chr1_1683909_A_C_b38	SLC35E2	-3.14	0.00198	-0.080148	50	0.025527	yes	PRSTTE
chr1_1978114_T_A_b38	SLC35E2	3.139	0.00198	0.082549	25	0.026297	yes	PRSTTE
chr1_1978262_C_T_b38	SLC35E2	3.137	0.00199	0.082617	25	0.026335	yes	PRSTTE
chr1_1978294_G_T_b38	SLC35E2	3.137	0.00199	0.082617	25	0.026335	yes	PRSTTE
chr1_1978404_C_T_b38	SLC35E2	3.137	0.00199	0.082617	25	0.026335	yes	PRSTTE
chr1_1978415_G_A_b38	SLC35E2	3.137	0.00199	0.082617	25	0.026335	yes	PRSTTE
chr1_1971123_A_G_b38	SLC35E2	3.135	0.002	0.087028	18	0.027759	yes	PRSTTE
chr1_1938467_C_T_b38	SLC35E2	3.086	0.00235	0.099485	7	0.032235	yes	PRSTTE
chr1_1983507_C_T_b38	SLC35E2	3.055	0.00259	0.083571	20	0.027352	yes	PRSTTE
chr1_1938221_TCA_T_b38	SLC35E2	3.028	0.00282	0.09739	7	0.03216	yes	PRSTTE
chr1_1934896_C_T_b38	SLC35E2	3.022	0.00287	0.095592	7	0.031632	yes	PRSTTE
chr1_1668721_C_T_b38	SLC35E2	-3.012	0.00297	-0.085202	21	0.028288	yes	PRSTTE
chr1_1668542_C_T_b38	SLC35E2	-2.996	0.00312	-0.096562	10	0.032231	yes	PRSTTE
chr1_1660408_T_C_b38	SLC35E2	-2.992	0.00316	-0.10337	4	0.034545	yes	PRSTTE
chr1_1661420_C_A_b38	SLC35E2	-2.991	0.00317	-0.082736	24	0.027663	yes	PRSTTE
chr1_1978429_G_A_b38	SLC35E2	2.968	0.0034	0.081609	20	0.027493	yes	PRSTTE
chr1_1877316_A_T_b38	SLC35E2	2.933	0.00379	0.085226	31	0.02906	yes	PRSTTE
chr1_922671_C_T_b38	SLC35E2	2.93	0.00383	0.095615	8	0.032637	yes	PRSTTE
chr1_1664865_A_G_b38	SLC35E2	-2.929	0.00384	-0.081066	23	0.027679	yes	PRSTTE
chr1_946653_G_A_b38	SLC35E2	2.926	0.00387	0.091629	13	0.031316	yes	PRSTTE
chr1_1848357_CA_C_b38	SLC35E2	-2.914	0.00402	-0.091988	23	0.031571	yes	PRSTTE
chr1_1928119_T_C_b38	SLC35E2	2.913	0.00403	0.094997	7	0.032607	yes	PRSTTE
chr1_1983989_A_AT_b38	SLC35E2	2.88	0.00445	0.079706	20	0.027671	yes	PRSTTE
chr1_1976870_C_CAG_b38	SLC35E2	2.877	0.00449	0.075646	25	0.026291	yes	PRSTTE
chr1_936972_G_C_b38	SLC35E2	2.877	0.0045	0.08381	19	0.029132	yes	PRSTTE
chr1_1985619_A_G_b38	SLC35E2	2.869	0.00461	0.075198	31	0.026213	yes	PRSTTE
chr1_1861110_C_CA_b38	SLC35E2	-2.852	0.00484	-0.074377	37	0.026076	yes	PRSTTE
chr1_2065678_C_CA_b38	SLC35E2	-2.845	0.00496	-0.097243	13	0.034184	yes	PRSTTE
chr1_1840233_GA_G_b38	SLC35E2	2.844	0.00497	0.095411	5	0.033549	yes	PRSTTE
chr1_965666_ACC_A_b38	SLC35E2	2.841	0.00501	0.087991	14	0.030971	yes	PRSTTE
chr1_1750589_G_A_b38	SLC35E2	-2.839	0.00504	-0.106641	10	0.037558	yes	PRSTTE
chr1_925036_G_A_b38	SLC35E2	-2.839	0.00505	-0.088599	17	0.031212	yes	PRSTTE
chr1_1669613_G_A_b38	SLC35E2	-2.819	0.00535	-0.089094	12	0.031605	yes	PRSTTE
chr1_1668108_C_T_b38	SLC35E2	2.814	0.00544	0.07893	24	0.02805	yes	PRSTTE
chr1_1968893_A_G_b38	SLC35E2	2.811	0.00548	0.083906	13	0.029846	yes	PRSTTE
chr1_945259_TC_T_b38	SLC35E2	2.809	0.00551	0.088529	13	0.031514	yes	PRSTTE
chr1_923421_A_G_b38	SLC35E2	-2.809	0.00552	-0.086745	18	0.030882	yes	PRSTTE
chr1_1687643_G_A_b38	SLC35E2	-2.806	0.00556	-0.071435	44	0.025456	yes	PRSTTE
chr1_1659060_G_A_b38	SLC35E2	-2.806	0.00557	-0.079914	21	0.02848	yes	PRSTTE
chr1_1659114_A_G_b38	SLC35E2	-2.805	0.00557	-0.077823	24	0.02774	yes	PRSTTE
chr1_1659220_A_G_b38	SLC35E2	-2.805	0.00557	-0.077823	24	0.02774	yes	PRSTTE
chr1_1931743_CA_C_b38	SLC35E2	-2.801	0.00564	-0.093112	18	0.033238	yes	PRSTTE
chr1_923311_TG_T_b38	SLC35E2	-2.801	0.00565	-0.0866	17	0.030918	yes	PRSTTE
chr1_1811082_T_TA_b38	SLC35E2	-2.784	0.00594	-0.07676	27	0.027571	yes	PRSTTE
chr1_1668717_C_G_b38	SLC35E2	-2.784	0.00594	-0.08828	12	0.031711	yes	PRSTTE
chr1_933741_T_TG_b38	SLC35E2	-2.765	0.00629	-0.079011	22	0.02858	yes	PRSTTE
chr1_1985451_C_T_b38	SLC35E2	2.761	0.00636	0.072815	34	0.026375	yes	PRSTTE
chr1_1671097_G_C_b38	SLC35E2	2.758	0.00641	0.076682	24	0.027803	yes	PRSTTE
chr1_1969238_C_T_b38	SLC35E2	2.755	0.00647	0.083202	13	0.030203	yes	PRSTTE
chr1_1985090_C_T_b38	SLC35E2	2.742	0.00672	0.072298	34	0.026369	yes	PRSTTE
chr1_1658830_C_G_b38	SLC35E2	-2.74	0.00676	-0.079745	16	0.029107	yes	PRSTTE
chr1_922660_C_A_b38	SLC35E2	2.734	0.00689	0.090323	8	0.033041	yes	PRSTTE
chr1_1768171_CA_C_b38	SLC35E2	2.714	0.00729	0.095777	3	0.035293	yes	PRSTTE
chr1_965125_G_C_b38	SLC35E2	2.709	0.00739	0.082478	16	0.030444	yes	PRSTTE
chr1_1669576_G_A_b38	SLC35E2	-2.701	0.00757	-0.086059	12	0.031863	yes	PRSTTE
chr1_1650195_A_G_b38	SLC35E2	-2.697	0.00767	-0.078873	20	0.029249	yes	PRSTTE
chr1_1969229_T_A_b38	SLC35E2	2.693	0.00775	0.080319	13	0.029829	yes	PRSTTE
chr1_1969235_A_G_b38	SLC35E2	2.679	0.00806	0.081264	13	0.030332	yes	PRSTTE
chr1_938178_G_T_b38	SLC35E2	-2.675	0.00815	-0.078269	26	0.029257	yes	PRSTTE
chr1_1658866_G_A_b38	SLC35E2	-2.672	0.00823	-0.073531	25	0.027521	yes	PRSTTE
chr1_932255_C_T_b38	SLC35E2	2.666	0.00837	0.08803	7	0.033019	yes	PRSTTE
chr1_978230_G_A_b38	SLC35E2	2.655	0.00863	0.087606	9	0.032991	yes	PRSTTE
chr1_1970506_T_A_b38	SLC35E2	-2.648	0.0088	-0.075023	36	0.028327	yes	PRSTTE
chr1_1007746_CTTTTTTTTTTTTTT_C_b38	SLC35E2	2.627	0.00936	0.080428	13	0.03062	yes	PRSTTE
chr1_1742672_C_T_b38	SLC35E2	-5.642	6.39e-08	-0.146865	42	0.026031	no	PRSTTE
chr1_1743238_G_C_b38	SLC35E2	-5.642	6.39e-08	-0.146865	42	0.026031	no	PRSTTE
chr1_1743586_T_TAC_b38	SLC35E2	-5.448	1.65e-07	-0.150332	31	0.027596	no	PRSTTE
chr1_1753319_G_A_b38	SLC35E2	-5.327	2.94e-07	-0.14401	46	0.027036	no	PRSTTE
chr1_1779667_T_TTG_b38	SLC35E2	5.315	3.12e-07	0.15356	25	0.028893	no	PRSTTE
chr1_1752461_G_A_b38	SLC35E2	-5.298	3.37e-07	-0.144638	46	0.0273	no	PRSTTE
chr1_1752730_C_G_b38	SLC35E2	-5.298	3.37e-07	-0.144638	46	0.0273	no	PRSTTE
chr1_1753361_G_A_b38	SLC35E2	-5.298	3.37e-07	-0.144638	46	0.0273	no	PRSTTE
chr1_1744854_C_A_b38	SLC35E2	-5.202	5.3e-07	-0.130413	32	0.025069	no	PRSTTE
chr1_1744652_C_T_b38	SLC35E2	-5.179	5.91e-07	-0.135476	45	0.02616	no	PRSTTE
chr1_1755523_C_T_b38	SLC35E2	5.12	7.76e-07	0.136176	45	0.026596	no	PRSTTE
chr1_1756043_G_T_b38	SLC35E2	-5.061	1.02e-06	-0.138386	46	0.027344	no	PRSTTE
chr1_1743714_C_CA_b38	SLC35E2	4.937	1.79e-06	0.133731	33	0.027085	no	PRSTTE
chr1_1748597_C_G_b38	SLC35E2	-4.935	1.81e-06	-0.137352	46	0.027834	no	PRSTTE
chr1_1881428_C_CT_b38	SLC35E2	-4.878	2.33e-06	-0.134449	46	0.02756	no	PRSTTE
chr1_1760882_T_C_b38	SLC35E2	4.857	2.57e-06	0.12518	39	0.025775	no	PRSTTE
chr1_1747472_A_T_b38	SLC35E2	-4.855	2.59e-06	-0.136018	45	0.028014	no	PRSTTE
chr1_1742587_G_C_b38	SLC35E2	4.819	3.04e-06	0.122523	49	0.025426	no	PRSTTE
chr1_1797530_C_A_b38	SLC35E2	-4.813	3.13e-06	-0.134382	46	0.027922	no	PRSTTE
chr1_1766653_A_G_b38	SLC35E2	-4.749	4.14e-06	-0.133265	46	0.028059	no	PRSTTE
chr1_1771864_G_A_b38	SLC35E2	-4.749	4.14e-06	-0.133265	46	0.028059	no	PRSTTE
chr1_1772410_T_C_b38	SLC35E2	-4.749	4.14e-06	-0.133265	46	0.028059	no	PRSTTE
chr1_1772426_T_A_b38	SLC35E2	-4.749	4.14e-06	-0.133265	46	0.028059	no	PRSTTE
chr1_1773460_G_A_b38	SLC35E2	-4.749	4.14e-06	-0.133265	46	0.028059	no	PRSTTE
chr1_1773476_C_G_b38	SLC35E2	-4.749	4.14e-06	-0.133265	46	0.028059	no	PRSTTE
chr1_1773848_A_C_b38	SLC35E2	-4.749	4.14e-06	-0.133265	46	0.028059	no	PRSTTE
chr1_1776461_GAAAC_G_b38	SLC35E2	-4.749	4.14e-06	-0.133265	46	0.028059	no	PRSTTE
chr1_1777362_A_G_b38	SLC35E2	-4.749	4.14e-06	-0.133265	46	0.028059	no	PRSTTE
chr1_1790040_C_T_b38	SLC35E2	-4.749	4.14e-06	-0.133265	46	0.028059	no	PRSTTE
chr1_1791493_C_T_b38	SLC35E2	-4.749	4.14e-06	-0.133265	46	0.028059	no	PRSTTE
chr1_1791592_G_A_b38	SLC35E2	-4.749	4.14e-06	-0.133265	46	0.028059	no	PRSTTE
chr1_1792927_G_A_b38	SLC35E2	-4.749	4.14e-06	-0.133265	46	0.028059	no	PRSTTE
chr1_1808816_G_T_b38	SLC35E2	-4.749	4.14e-06	-0.133265	46	0.028059	no	PRSTTE
chr1_1817295_T_C_b38	SLC35E2	-4.749	4.14e-06	-0.133265	46	0.028059	no	PRSTTE
chr1_1819825_G_A_b38	SLC35E2	-4.749	4.14e-06	-0.133265	46	0.028059	no	PRSTTE
chr1_1753033_C_T_b38	SLC35E2	-4.747	4.17e-06	-0.127174	52	0.026788	no	PRSTTE
chr1_1750226_C_T_b38	SLC35E2	4.707	4.98e-06	0.12927	34	0.027463	no	PRSTTE
chr1_1764887_C_A_b38	SLC35E2	-4.684	5.52e-06	-0.132912	45	0.028378	no	PRSTTE
chr1_1695459_A_G_b38	SLC35E2	4.655	6.24e-06	0.141241	33	0.03034	no	PRSTTE
chr1_1827774_A_G_b38	SLC35E2	-4.627	7.06e-06	-0.130422	46	0.028188	no	PRSTTE
chr1_1831318_C_T_b38	SLC35E2	-4.627	7.06e-06	-0.130422	46	0.028188	no	PRSTTE
chr1_1770997_G_A_b38	SLC35E2	-4.574	8.85e-06	-0.124176	47	0.027148	no	PRSTTE
chr1_1748780_G_A_b38	SLC35E2	-4.555	9.62e-06	-0.126096	50	0.027685	no	PRSTTE
chr1_1758323_T_C_b38	SLC35E2	4.516	1.13e-05	0.119809	37	0.026531	no	PRSTTE
chr1_1866635_T_TA_b38	SLC35E2	4.479	1.32e-05	0.129016	26	0.028802	no	PRSTTE
chr1_1743565_AT_A_b38	SLC35E2	4.469	1.38e-05	0.10748	50	0.024048	no	PRSTTE
chr1_1759354_G_A_b38	SLC35E2	-4.415	1.73e-05	-0.123437	45	0.027956	no	PRSTTE
chr1_1769969_CAAAACAAAAACA_C_b38	SLC35E2	-4.399	1.85e-05	-0.122074	50	0.027748	no	PRSTTE
chr1_1905586_C_T_b38	SLC35E2	-4.397	1.86e-05	-0.123716	45	0.028133	no	PRSTTE
chr1_1820337_A_G_b38	SLC35E2	4.393	1.9e-05	0.115607	40	0.026319	no	PRSTTE
chr1_1783572_C_A_b38	SLC35E2	4.39	1.92e-05	0.141159	6	0.032155	no	PRSTTE
chr1_1837455_C_T_b38	SLC35E2	4.39	1.92e-05	0.141159	6	0.032155	no	PRSTTE
chr1_1851762_G_A_b38	SLC35E2	4.39	1.92e-05	0.141159	6	0.032155	no	PRSTTE
chr1_1869595_G_A_b38	SLC35E2	4.39	1.92e-05	0.141159	6	0.032155	no	PRSTTE
chr1_1749637_G_T_b38	SLC35E2	4.388	1.94e-05	0.113001	35	0.025752	no	PRSTTE
chr1_1934565_G_A_b38	SLC35E2	-4.383	1.98e-05	-0.121519	44	0.027727	no	PRSTTE
chr1_1827615_G_A_b38	SLC35E2	4.373	2.06e-05	0.141147	6	0.032275	no	PRSTTE
chr1_1769737_GA_G_b38	SLC35E2	4.346	2.31e-05	0.141679	6	0.0326	no	PRSTTE
chr1_1759611_C_T_b38	SLC35E2	-4.325	2.52e-05	-0.121058	46	0.027993	no	PRSTTE
chr1_1744499_C_T_b38	SLC35E2	-4.315	2.62e-05	-0.112762	43	0.026134	no	PRSTTE
chr1_1852145_G_A_b38	SLC35E2	4.309	2.69e-05	0.1362	7	0.031609	no	PRSTTE
chr1_1762287_A_G_b38	SLC35E2	-4.306	2.72e-05	-0.122686	49	0.028492	no	PRSTTE
chr1_1912607_C_T_b38	SLC35E2	-4.299	2.8e-05	-0.122897	44	0.028586	no	PRSTTE
chr1_1865951_T_A_b38	SLC35E2	4.242	3.53e-05	0.136305	7	0.032133	no	PRSTTE
chr1_1848356_GC_G_b38	SLC35E2	4.23	3.71e-05	0.156362	3	0.036965	no	PRSTTE
chr1_1950071_C_A_b38	SLC35E2	4.221	3.85e-05	0.128956	8	0.030554	no	PRSTTE
chr1_1697272_G_A_b38	SLC35E2	4.194	4.28e-05	0.170288	13	0.040602	no	PRSTTE
chr1_1952823_TA_T_b38	SLC35E2	-4.17	4.72e-05	-0.113938	46	0.027323	no	PRSTTE
chr1_1755504_T_C_b38	SLC35E2	4.149	5.13e-05	0.110191	46	0.026558	no	PRSTTE
chr1_1752126_G_A_b38	SLC35E2	4.146	5.19e-05	0.116467	29	0.028092	no	PRSTTE
chr1_1950071_C_T_b38	SLC35E2	-4.142	5.27e-05	-0.113215	46	0.027333	no	PRSTTE
chr1_1951106_G_A_b38	SLC35E2	-4.142	5.27e-05	-0.113215	46	0.027333	no	PRSTTE
chr1_1951865_G_GT_b38	SLC35E2	-4.142	5.27e-05	-0.113215	46	0.027333	no	PRSTTE
chr1_1952064_G_A_b38	SLC35E2	-4.142	5.27e-05	-0.113215	46	0.027333	no	PRSTTE
chr1_1955080_C_CGGCTCACACCGGAAGTGAGGCTCACACCGGAAGTGA_b38	SLC35E2	-4.134	5.44e-05	-0.11223	41	0.027146	no	PRSTTE
chr1_1951498_C_T_b38	SLC35E2	4.126	5.62e-05	0.12729	8	0.030851	no	PRSTTE
chr1_1951642_C_T_b38	SLC35E2	4.126	5.62e-05	0.12729	8	0.030851	no	PRSTTE
chr1_1865278_A_C_b38	SLC35E2	4.113	5.93e-05	0.109302	36	0.026576	no	PRSTTE
chr1_1884183_G_A_b38	SLC35E2	4.111	5.98e-05	0.129832	8	0.031585	no	PRSTTE
chr1_940296_GCC_G_b38	SLC35E2	-4.094	6.39e-05	-0.106712	37	0.026066	no	PRSTTE
chr1_1769969_CAAAACA_C_b38	SLC35E2	4.082	6.69e-05	0.111509	32	0.027317	no	PRSTTE
chr1_1798925_C_CT_b38	SLC35E2	-4.069	7.04e-05	-0.115874	18	0.028477	no	PRSTTE
chr1_1915326_G_A_b38	SLC35E2	-4.066	7.13e-05	-0.116052	47	0.028544	no	PRSTTE
chr1_1916217_C_T_b38	SLC35E2	-4.066	7.13e-05	-0.116052	47	0.028544	no	PRSTTE
chr1_1904424_A_AAAATAAAT_b38	SLC35E2	-4.046	7.69e-05	-0.101023	47	0.024966	no	PRSTTE
chr1_1947645_C_T_b38	SLC35E2	-4.035	8.05e-05	-0.113979	43	0.028249	no	PRSTTE
chr1_1903603_G_A_b38	SLC35E2	4.031	8.17e-05	0.126689	8	0.031427	no	PRSTTE
chr1_1903617_C_T_b38	SLC35E2	4.031	8.17e-05	0.126689	8	0.031427	no	PRSTTE
chr1_1936627_C_G_b38	SLC35E2	-4.021	8.48e-05	-0.109343	41	0.02719	no	PRSTTE
chr1_1944074_T_C_b38	SLC35E2	-3.993	9.49e-05	-0.109786	46	0.027497	no	PRSTTE
chr1_1944091_G_C_b38	SLC35E2	-3.993	9.49e-05	-0.109786	46	0.027497	no	PRSTTE
chr1_1945121_T_C_b38	SLC35E2	-3.993	9.49e-05	-0.109786	46	0.027497	no	PRSTTE
chr1_1897325_G_A_b38	SLC35E2	3.972	0.000103	0.127809	6	0.032178	no	PRSTTE
chr1_1914345_C_T_b38	SLC35E2	-3.962	0.000107	-0.114046	46	0.028788	no	PRSTTE
chr1_1914918_G_A_b38	SLC35E2	-3.962	0.000107	-0.114046	46	0.028788	no	PRSTTE
chr1_1756186_T_C_b38	SLC35E2	3.959	0.000108	0.108058	34	0.027292	no	PRSTTE
chr1_1810086_A_G_b38	SLC35E2	3.951	0.000111	0.137984	3	0.03492	no	PRSTTE
chr1_1944675_C_T_b38	SLC35E2	-3.95	0.000112	-0.108283	46	0.027416	no	PRSTTE
chr1_1946058_T_C_b38	SLC35E2	-3.95	0.000112	-0.108283	46	0.027416	no	PRSTTE
chr1_1946632_C_T_b38	SLC35E2	-3.95	0.000112	-0.108283	46	0.027416	no	PRSTTE
chr1_1947189_C_T_b38	SLC35E2	-3.95	0.000112	-0.108283	46	0.027416	no	PRSTTE
chr1_1944419_C_G_b38	SLC35E2	-3.947	0.000113	-0.107207	47	0.027164	no	PRSTTE
chr1_1767762_C_A_b38	SLC35E2	3.937	0.000118	0.128306	6	0.032593	no	PRSTTE
chr1_1773215_C_A_b38	SLC35E2	3.937	0.000118	0.128306	6	0.032593	no	PRSTTE
chr1_1774308_G_A_b38	SLC35E2	3.937	0.000118	0.128306	6	0.032593	no	PRSTTE
chr1_1919188_CAGCGGCAGG_C_b38	SLC35E2	-3.936	0.000118	-0.109911	44	0.027925	no	PRSTTE
chr1_1695747_C_T_b38	SLC35E2	3.934	0.000119	0.120492	43	0.030631	no	PRSTTE
chr1_1900918_G_A_b38	SLC35E2	3.931	0.000121	0.123386	8	0.031392	no	PRSTTE
chr1_1918090_A_G_b38	SLC35E2	-3.929	0.000121	-0.113583	45	0.028906	no	PRSTTE
chr1_1776301_T_G_b38	SLC35E2	3.91	0.000131	0.126618	6	0.032386	no	PRSTTE
chr1_1920695_A_G_b38	SLC35E2	-3.908	0.000132	-0.11181	47	0.028614	no	PRSTTE
chr1_1924788_C_T_b38	SLC35E2	-3.908	0.000132	-0.11181	47	0.028614	no	PRSTTE
chr1_1925233_T_C_b38	SLC35E2	-3.908	0.000132	-0.11181	47	0.028614	no	PRSTTE
chr1_1925281_C_T_b38	SLC35E2	-3.908	0.000132	-0.11181	47	0.028614	no	PRSTTE
chr1_1930143_C_T_b38	SLC35E2	-3.908	0.000132	-0.11181	47	0.028614	no	PRSTTE
chr1_1848358_A_T_b38	SLC35E2	3.898	0.000137	0.143574	3	0.036836	no	PRSTTE
chr1_1935938_T_C_b38	SLC35E2	-3.879	0.000147	-0.108382	36	0.027941	no	PRSTTE
chr1_1691417_T_C_b38	SLC35E2	3.868	0.000153	0.104037	47	0.026896	no	PRSTTE
chr1_1927857_T_C_b38	SLC35E2	-3.859	0.000158	-0.109985	47	0.028499	no	PRSTTE
chr1_1929904_C_T_b38	SLC35E2	-3.859	0.000158	-0.109985	47	0.028499	no	PRSTTE
chr1_1791389_G_A_b38	SLC35E2	3.856	0.00016	0.128765	5	0.03339	no	PRSTTE
chr1_1890770_C_T_b38	SLC35E2	3.856	0.00016	0.125646	7	0.032582	no	PRSTTE
chr1_1730405_G_C_b38	SLC35E2	3.83	0.000177	0.108143	32	0.028236	no	PRSTTE
chr1_1907199_A_G_b38	SLC35E2	3.814	0.000187	0.118807	9	0.031147	no	PRSTTE
chr1_1904424_A_AAAATAAATAAAT_b38	SLC35E2	3.789	0.000206	0.093001	38	0.024545	no	PRSTTE
chr1_1808642_TTTTG_T_b38	SLC35E2	3.783	0.00021	0.123047	7	0.032523	no	PRSTTE
chr1_1839349_C_G_b38	SLC35E2	3.783	0.00021	0.123047	7	0.032523	no	PRSTTE
chr1_1839350_T_A_b38	SLC35E2	3.783	0.00021	0.123047	7	0.032523	no	PRSTTE
chr1_1851181_C_T_b38	SLC35E2	3.783	0.00021	0.123047	7	0.032523	no	PRSTTE
chr1_1948515_C_T_b38	SLC35E2	-3.771	0.00022	-0.102095	48	0.027073	no	PRSTTE
chr1_1948519_T_C_b38	SLC35E2	-3.771	0.00022	-0.102095	48	0.027073	no	PRSTTE
chr1_1688409_C_G_b38	SLC35E2	-3.76	0.000229	-0.099124	38	0.026365	no	PRSTTE
chr1_1946013_C_T_b38	SLC35E2	-3.754	0.000234	-0.103737	45	0.027631	no	PRSTTE
chr1_1937802_G_T_b38	SLC35E2	-3.753	0.000235	-0.105785	46	0.028186	no	PRSTTE
chr1_1938332_A_ACT_b38	SLC35E2	-3.746	0.000242	-0.101747	46	0.027164	no	PRSTTE
chr1_1913504_CT_C_b38	SLC35E2	-3.727	0.000259	-0.11217	35	0.0301	no	PRSTTE
chr1_1842237_T_C_b38	SLC35E2	3.721	0.000264	0.11876	8	0.031914	no	PRSTTE
chr1_1913643_T_C_b38	SLC35E2	-3.721	0.000265	-0.108925	43	0.029276	no	PRSTTE
chr1_1925307_C_A_b38	SLC35E2	-3.716	0.00027	-0.107157	45	0.028837	no	PRSTTE
chr1_1879682_G_A_b38	SLC35E2	3.703	0.000283	0.116449	9	0.03145	no	PRSTTE
chr1_1803531_C_T_b38	SLC35E2	3.694	0.000292	0.117574	8	0.031828	no	PRSTTE
chr1_1830566_A_T_b38	SLC35E2	3.694	0.000292	0.117574	8	0.031828	no	PRSTTE
chr1_1842226_T_C_b38	SLC35E2	3.694	0.000292	0.117574	8	0.031828	no	PRSTTE
chr1_1842333_G_A_b38	SLC35E2	3.694	0.000292	0.117574	8	0.031828	no	PRSTTE
chr1_1873952_G_A_b38	SLC35E2	3.694	0.000292	0.117574	8	0.031828	no	PRSTTE
chr1_1878651_C_T_b38	SLC35E2	3.694	0.000292	0.117574	8	0.031828	no	PRSTTE
chr1_1890186_G_A_b38	SLC35E2	3.694	0.000292	0.117574	8	0.031828	no	PRSTTE
chr1_1688570_A_T_b38	SLC35E2	-3.693	0.000293	-0.120354	10	0.03259	no	PRSTTE
chr1_1722625_A_T_b38	SLC35E2	3.679	0.000308	0.117504	19	0.031935	no	PRSTTE
chr1_1906439_C_T_b38	SLC35E2	3.671	0.000317	0.112831	11	0.030732	no	PRSTTE
chr1_1909237_G_T_b38	SLC35E2	3.671	0.000317	0.112831	11	0.030732	no	PRSTTE
chr1_1734308_T_C_b38	SLC35E2	3.671	0.000318	0.141724	7	0.038611	no	PRSTTE
chr1_1881428_C_T_b38	SLC35E2	3.646	0.000348	0.118819	6	0.03259	no	PRSTTE
chr1_1967499_G_A_b38	SLC35E2	3.637	0.000359	0.096978	34	0.026661	no	PRSTTE
chr1_1955652_CG_C_b38	SLC35E2	3.622	0.000379	0.115163	7	0.031793	no	PRSTTE
chr1_1955672_GC_G_b38	SLC35E2	3.622	0.000379	0.115163	7	0.031793	no	PRSTTE
chr1_1849992_T_TG_b38	SLC35E2	3.622	0.00038	0.130856	3	0.03613	no	PRSTTE
chr1_1722619_C_T_b38	SLC35E2	3.619	0.000384	0.114394	20	0.031611	no	PRSTTE
chr1_1942887_C_G_b38	SLC35E2	-3.616	0.000387	-0.100935	44	0.027911	no	PRSTTE
chr1_1907077_C_A_b38	SLC35E2	3.614	0.00039	0.118022	7	0.032654	no	PRSTTE
chr1_1956754_C_A_b38	SLC35E2	3.582	0.000438	0.111851	8	0.031227	no	PRSTTE
chr1_1746439_GA_G_b38	SLC35E2	3.58	0.000441	0.111449	29	0.031129	no	PRSTTE
chr1_1937895_C_T_b38	SLC35E2	-3.574	0.000451	-0.099376	46	0.027805	no	PRSTTE
chr1_1938125_TCA_T_b38	SLC35E2	-3.574	0.000451	-0.099376	46	0.027805	no	PRSTTE
chr1_1801780_A_G_b38	SLC35E2	-3.564	0.000467	-0.11415	24	0.032029	no	PRSTTE
chr1_1877314_A_T_b38	SLC35E2	3.564	0.000468	0.126667	10	0.035545	no	PRSTTE
chr1_1963533_C_CA_b38	SLC35E2	3.544	0.000501	0.093529	36	0.026389	no	PRSTTE
chr1_1956891_C_T_b38	SLC35E2	3.542	0.000505	0.109978	9	0.031049	no	PRSTTE
chr1_1957014_G_A_b38	SLC35E2	3.542	0.000505	0.109978	9	0.031049	no	PRSTTE
chr1_1957636_C_T_b38	SLC35E2	3.542	0.000505	0.109978	9	0.031049	no	PRSTTE
chr1_1963538_T_C_b38	SLC35E2	3.524	0.000539	0.093659	34	0.02658	no	PRSTTE
chr1_1912983_T_C_b38	SLC35E2	3.514	0.000559	0.10552	12	0.030032	no	PRSTTE
chr1_1774506_T_C_b38	SLC35E2	-3.504	0.000578	-0.110364	26	0.031496	no	PRSTTE
chr1_1935987_G_A_b38	SLC35E2	-3.472	0.000646	-0.096086	48	0.027673	no	PRSTTE
chr1_1955806_G_A_b38	SLC35E2	3.433	0.000739	0.10578	8	0.030809	no	PRSTTE
chr1_1968793_T_C_b38	SLC35E2	3.428	0.000752	0.091328	34	0.02664	no	PRSTTE
chr1_1969015_A_G_b38	SLC35E2	3.424	0.000763	0.092745	55	0.027087	no	PRSTTE
chr1_1948037_T_A_b38	SLC35E2	3.421	0.00077	0.119093	5	0.034809	no	PRSTTE
chr1_1897682_CA_C_b38	SLC35E2	3.421	0.000772	0.116203	4	0.033969	no	PRSTTE
chr1_1915022_C_T_b38	SLC35E2	3.358	0.000957	0.105816	11	0.031512	no	PRSTTE
chr1_1913254_C_T_b38	SLC35E2	3.345	0.001	0.103258	29	0.030869	no	PRSTTE
chr1_915824_G_C_b38	SLC35E2	3.295	0.00118	0.100313	13	0.030442	no	PRSTTE
chr1_1968103_A_ATGAG_b38	SLC35E2	3.283	0.00123	0.092259	17	0.028105	no	PRSTTE
chr1_1955420_C_T_b38	SLC35E2	3.281	0.00124	0.103234	8	0.031468	no	PRSTTE
chr1_1750528_G_A_b38	SLC35E2	-3.278	0.00125	-0.085822	41	0.026181	no	PRSTTE
chr1_1889659_T_TA_b38	SLC35E2	3.272	0.00128	0.103703	10	0.031691	no	PRSTTE
chr1_1948938_C_T_b38	SLC35E2	-3.217	0.00153	-0.078437	44	0.024379	no	PRSTTE
chr1_1453643_A_AT_b38	SLC35E2	-3.2	0.00162	-0.120835	4	0.037762	no	PRSTTE
chr1_1686321_CTTT_C_b38	SLC35E2	-3.2	0.00162	-0.091989	17	0.028748	no	PRSTTE
chr1_1667948_A_G_b38	SLC35E2	-3.171	0.00179	-0.101675	11	0.032065	no	PRSTTE
chr1_1903309_A_G_b38	SLC35E2	3.17	0.00179	0.102577	18	0.032359	no	PRSTTE
chr1_1793064_C_CA_b38	SLC35E2	3.12	0.00211	0.096214	12	0.030838	no	PRSTTE
chr1_1969006_C_T_b38	SLC35E2	3.083	0.00237	0.088307	16	0.028643	no	PRSTTE
chr1_1968924_GCCCTCCTGGGGGCTCCGGTCCTGCCCAGCAGCCCCAGGTGAGACAGCGCCTGGCGGCCCCTCCCTAGCT_G_b38	SLC35E2	3.065	0.00251	0.087277	17	0.028474	no	PRSTTE
chr1_1679993_A_G_b38	SLC35E2	-3.059	0.00256	-0.077208	54	0.025237	no	PRSTTE
chr1_1954906_C_CA_b38	SLC35E2	3.053	0.00261	0.089568	26	0.029342	no	PRSTTE
chr1_1954907_G_GCC_b38	SLC35E2	3.053	0.00261	0.089568	26	0.029342	no	PRSTTE
chr1_1965250_G_GA_b38	SLC35E2	3.049	0.00264	0.085164	18	0.027933	no	PRSTTE
chr1_1680672_C_T_b38	SLC35E2	-3.046	0.00267	-0.078311	37	0.025712	no	PRSTTE
chr1_1462302_A_G_b38	SLC35E2	-3.018	0.00291	-0.13594	4	0.045036	no	PRSTTE
chr1_1968900_A_G_b38	SLC35E2	3.018	0.00291	0.087627	16	0.02903	no	PRSTTE
chr1_1708855_TTCCTCCTCC_T_b38	SLC35E2	3.017	0.00292	0.079321	41	0.026291	no	PRSTTE
chr1_1962845_T_C_b38	SLC35E2	3.002	0.00306	0.085681	16	0.028539	no	PRSTTE
chr1_1954781_C_T_b38	SLC35E2	3.002	0.00306	0.089572	23	0.029836	no	PRSTTE
chr1_1743544_CA_C_b38	SLC35E2	3.001	0.00307	0.077364	48	0.025777	no	PRSTTE
chr1_1964101_A_G_b38	SLC35E2	2.978	0.0033	0.084033	17	0.028216	no	PRSTTE
chr1_1964746_T_C_b38	SLC35E2	2.978	0.0033	0.084033	17	0.028216	no	PRSTTE
chr1_1964784_C_T_b38	SLC35E2	2.978	0.0033	0.084033	17	0.028216	no	PRSTTE
chr1_1966030_A_G_b38	SLC35E2	2.978	0.0033	0.084033	17	0.028216	no	PRSTTE
chr1_1966314_C_G_b38	SLC35E2	2.978	0.0033	0.084033	17	0.028216	no	PRSTTE
chr1_1966606_G_A_b38	SLC35E2	2.978	0.0033	0.084033	17	0.028216	no	PRSTTE
chr1_1966930_G_A_b38	SLC35E2	2.978	0.0033	0.084033	17	0.028216	no	PRSTTE
chr1_1967246_T_C_b38	SLC35E2	2.978	0.0033	0.084033	17	0.028216	no	PRSTTE
chr1_1967338_G_C_b38	SLC35E2	2.978	0.0033	0.084033	17	0.028216	no	PRSTTE
chr1_1967340_C_A_b38	SLC35E2	2.978	0.0033	0.084033	17	0.028216	no	PRSTTE
chr1_1967389_T_C_b38	SLC35E2	2.978	0.0033	0.084033	17	0.028216	no	PRSTTE
chr1_1967396_C_A_b38	SLC35E2	2.978	0.0033	0.084033	17	0.028216	no	PRSTTE
chr1_1967420_G_A_b38	SLC35E2	2.978	0.0033	0.084033	17	0.028216	no	PRSTTE
chr1_1967495_T_C_b38	SLC35E2	2.978	0.0033	0.084033	17	0.028216	no	PRSTTE
chr1_1967536_G_A_b38	SLC35E2	2.978	0.0033	0.084033	17	0.028216	no	PRSTTE
chr1_1967725_G_C_b38	SLC35E2	2.978	0.0033	0.084033	17	0.028216	no	PRSTTE
chr1_1967840_A_T_b38	SLC35E2	2.978	0.0033	0.084033	17	0.028216	no	PRSTTE
chr1_1967880_T_C_b38	SLC35E2	2.978	0.0033	0.084033	17	0.028216	no	PRSTTE
chr1_1968012_GTGAA_G_b38	SLC35E2	2.978	0.0033	0.084033	17	0.028216	no	PRSTTE
chr1_1968130_GTGAA_G_b38	SLC35E2	2.978	0.0033	0.084033	17	0.028216	no	PRSTTE
chr1_1968422_C_T_b38	SLC35E2	2.978	0.0033	0.084033	17	0.028216	no	PRSTTE
chr1_1968585_TG_T_b38	SLC35E2	2.978	0.0033	0.084033	17	0.028216	no	PRSTTE
chr1_1968667_T_TCTC_b38	SLC35E2	2.978	0.0033	0.084033	17	0.028216	no	PRSTTE
chr1_1954765_A_AGAGT_b38	SLC35E2	2.977	0.00331	0.088523	24	0.029738	no	PRSTTE
chr1_1963738_C_T_b38	SLC35E2	2.977	0.00331	0.0848	16	0.028489	no	PRSTTE
chr1_1965114_C_T_b38	SLC35E2	2.977	0.00331	0.0848	16	0.028489	no	PRSTTE
chr1_1966910_C_T_b38	SLC35E2	2.977	0.00331	0.0848	16	0.028489	no	PRSTTE
chr1_918870_A_G_b38	SLC35E2	2.964	0.00344	0.090959	11	0.030687	no	PRSTTE
chr1_1955061_GCGGCTC_G_b38	SLC35E2	2.958	0.00351	0.087542	25	0.029592	no	PRSTTE
chr1_1955068_ACACCGGAAGTGC_A_b38	SLC35E2	2.958	0.00351	0.087542	25	0.029592	no	PRSTTE
chr1_1708951_C_T_b38	SLC35E2	2.949	0.00361	0.073389	38	0.024887	no	PRSTTE
chr1_1963406_G_A_b38	SLC35E2	2.945	0.00365	0.083981	16	0.028512	no	PRSTTE
chr1_913274_TG_T_b38	SLC35E2	2.931	0.00382	0.094347	8	0.032193	no	PRSTTE
chr1_1949125_T_TTCCC_b38	SLC35E2	2.928	0.00384	0.115142	4	0.039318	no	PRSTTE
chr1_1137233_C_G_b38	SLC35E2	2.924	0.0039	0.079183	27	0.027079	no	PRSTTE
chr1_1948919_T_TCCTTCCCTCCTCTTTCCCTCCCTTCTTTCCTTCCCTTTCCCTCCCTC_b38	SLC35E2	-2.909	0.00408	-0.073432	41	0.025243	no	PRSTTE
chr1_914483_G_GACTGCCCAGCTC_b38	SLC35E2	2.906	0.00411	0.091403	10	0.031449	no	PRSTTE
chr1_917378_G_C_b38	SLC35E2	2.906	0.00412	0.09346	8	0.032165	no	PRSTTE
chr1_1717604_CGCTTTCAGCTAGAGTTTGCTCTCTCTGGTTTTCGGTCTGTGACACACGCAT_C_b38	SLC35E2	2.893	0.00429	0.075125	42	0.025972	no	PRSTTE
chr1_1989523_T_C_b38	SLC35E2	2.89	0.00433	0.076952	39	0.026628	no	PRSTTE
chr1_909894_G_T_b38	SLC35E2	2.865	0.00466	0.090333	14	0.031527	no	PRSTTE
chr1_1724035_G_A_b38	SLC35E2	2.851	0.00487	0.095903	17	0.033643	no	PRSTTE
chr1_1921045_A_G_b38	SLC35E2	2.849	0.00489	0.090542	23	0.031776	no	PRSTTE
chr1_1983048_A_G_b38	SLC35E2	2.846	0.00493	0.074879	35	0.026306	no	PRSTTE
chr1_1964663_G_A_b38	SLC35E2	2.843	0.00498	0.081466	16	0.028651	no	PRSTTE
chr1_1966152_C_T_b38	SLC35E2	2.843	0.00498	0.081466	16	0.028651	no	PRSTTE
chr1_1967980_A_AAGAATGAG_b38	SLC35E2	2.84	0.00502	0.082173	15	0.028931	no	PRSTTE
chr1_910558_G_A_b38	SLC35E2	2.833	0.00513	0.090201	12	0.031839	no	PRSTTE
chr1_1687061_C_T_b38	SLC35E2	-2.83	0.00518	-0.073017	43	0.025799	no	PRSTTE
chr1_912710_G_A_b38	SLC35E2	2.83	0.00518	0.091461	8	0.032317	no	PRSTTE
chr1_913358_C_T_b38	SLC35E2	2.83	0.00518	0.091461	8	0.032317	no	PRSTTE
chr1_911018_G_A_b38	SLC35E2	2.83	0.00518	0.091006	10	0.032161	no	PRSTTE
chr1_915810_G_A_b38	SLC35E2	2.827	0.00523	0.086883	11	0.030733	no	PRSTTE
chr1_1686147_T_G_b38	SLC35E2	-2.824	0.00527	-0.073232	41	0.025931	no	PRSTTE
chr1_1965001_G_A_b38	SLC35E2	2.823	0.00529	0.07881	18	0.027917	no	PRSTTE
chr1_912111_G_A_b38	SLC35E2	2.816	0.00541	0.087022	11	0.030906	no	PRSTTE
chr1_914682_A_T_b38	SLC35E2	2.816	0.00541	0.087022	11	0.030906	no	PRSTTE
chr1_917284_C_T_b38	SLC35E2	2.804	0.00559	0.090527	8	0.032279	no	PRSTTE
chr1_917859_A_G_b38	SLC35E2	2.804	0.00559	0.090527	8	0.032279	no	PRSTTE
chr1_1836856_CT_C_b38	SLC35E2	2.802	0.00564	0.098548	7	0.035177	no	PRSTTE
chr1_918574_C_A_b38	SLC35E2	-2.791	0.00583	-0.071924	46	0.025774	no	PRSTTE
chr1_917495_C_T_b38	SLC35E2	-2.786	0.00591	-0.071346	47	0.025612	no	PRSTTE
chr1_1687159_G_T_b38	SLC35E2	-2.777	0.00607	-0.071225	43	0.025649	no	PRSTTE
chr1_2341847_T_C_b38	SLC35E2	-2.773	0.00613	-0.100254	6	0.036153	no	PRSTTE
chr1_2341464_A_G_b38	SLC35E2	-2.756	0.00644	-0.099917	6	0.03625	no	PRSTTE
chr1_1680214_T_C_b38	SLC35E2	-2.756	0.00645	-0.071631	45	0.025989	no	PRSTTE
chr1_1687236_T_G_b38	SLC35E2	-2.753	0.00651	-0.070636	42	0.025657	no	PRSTTE
chr1_919598_A_C_b38	SLC35E2	-2.752	0.00653	-0.069995	48	0.025437	no	PRSTTE
chr1_1727506_T_C_b38	SLC35E2	2.749	0.00658	0.091749	15	0.033373	no	PRSTTE
chr1_1738597_C_A_b38	SLC35E2	2.747	0.00663	0.085387	23	0.031087	no	PRSTTE
chr1_1902318_T_TA_b38	SLC35E2	-2.735	0.00685	-0.089465	21	0.032709	no	PRSTTE
chr1_1684266_T_C_b38	SLC35E2	-2.733	0.00689	-0.069791	44	0.025533	no	PRSTTE
chr1_916657_G_A_b38	SLC35E2	-2.73	0.00696	-0.073391	53	0.026883	no	PRSTTE
chr1_1686017_A_AT_b38	SLC35E2	-2.728	0.007	-0.069729	44	0.02556	no	PRSTTE
chr1_914838_T_A_b38	SLC35E2	-2.723	0.00709	-0.073602	52	0.027025	no	PRSTTE
chr1_913076_A_G_b38	SLC35E2	2.721	0.00714	0.084545	11	0.03107	no	PRSTTE
chr1_1742432_T_TA_b38	SLC35E2	2.718	0.00721	0.076033	38	0.027976	no	PRSTTE
chr1_1901149_A_AAAGAAAGGAAGAAAGG_b38	SLC35E2	-2.717	0.00722	-0.078112	44	0.028746	no	PRSTTE
chr1_1681164_G_A_b38	SLC35E2	-2.712	0.00734	-0.070286	44	0.025921	no	PRSTTE
chr1_1681928_C_A_b38	SLC35E2	-2.711	0.00735	-0.071958	40	0.026539	no	PRSTTE
chr1_1706067_ACT_A_b38	SLC35E2	2.709	0.00739	0.069071	62	0.025494	no	PRSTTE
chr1_1029365_A_ATCTATGCAGGCAGGTGGGGGGATCAGTG_b38	SLC35E2	2.706	0.00746	0.084576	14	0.031254	no	PRSTTE
chr1_914991_G_T_b38	SLC35E2	-2.699	0.00761	-0.071524	42	0.026496	no	PRSTTE
chr1_1024462_C_T_b38	SLC35E2	2.691	0.00779	0.080433	20	0.02989	no	PRSTTE
chr1_916683_G_A_b38	SLC35E2	-2.688	0.00787	-0.071862	53	0.026738	no	PRSTTE
chr1_1570655_G_A_b38	SLC35E2	2.678	0.00809	0.093236	7	0.034819	no	PRSTTE
chr1_1931966_T_C_b38	SLC35E2	2.676	0.00814	0.085588	28	0.031986	no	PRSTTE
chr1_1877312_A_T_b38	SLC35E2	2.656	0.00861	0.110792	4	0.041709	no	PRSTTE
chr1_913065_G_A_b38	SLC35E2	2.653	0.00869	0.081998	11	0.030911	no	PRSTTE
chr1_946247_G_A_b38	SLC35E2	-2.652	0.00871	-0.077202	43	0.029109	no	PRSTTE
chr1_914743_C_T_b38	SLC35E2	2.652	0.00871	0.085422	8	0.03221	no	PRSTTE
chr1_965337_CTTAT_C_b38	SLC35E2	-2.642	0.00896	-0.075746	47	0.028668	no	PRSTTE
chr1_1736729_G_T_b38	SLC35E2	2.636	0.00912	0.06932	58	0.026298	no	PRSTTE
chr1_915400_C_T_b38	SLC35E2	-2.634	0.00916	-0.068113	45	0.025856	no	PRSTTE
chr1_910255_C_T_b38	SLC35E2	2.625	0.00942	0.086327	7	0.032892	no	PRSTTE
chr1_911848_C_T_b38	SLC35E2	2.612	0.00976	0.08358	9	0.032	no	PRSTTE
chr1_1671995_G_T_b38	SLC35E2	7.172	3.1e-12	0.088051	113	0.012277	yes	SKINNS
chr1_1673818_A_C_b38	SLC35E2	6.758	4.38e-11	0.083833	114	0.012405	yes	SKINNS
chr1_1674868_G_A_b38	SLC35E2	6.746	4.73e-11	0.08398	112	0.012449	yes	SKINNS
chr1_1674720_TGC_T_b38	SLC35E2	6.739	4.95e-11	0.08406	111	0.012474	yes	SKINNS
chr1_1677720_T_G_b38	SLC35E2	6.72	5.57e-11	0.083256	115	0.012389	yes	SKINNS
chr1_1676790_C_T_b38	SLC35E2	6.678	7.22e-11	0.082185	113	0.012306	yes	SKINNS
chr1_1677726_A_T_b38	SLC35E2	6.646	8.82e-11	0.082573	115	0.012425	yes	SKINNS
chr1_1673060_G_A_b38	SLC35E2	6.639	9.21e-11	0.083162	112	0.012527	yes	SKINNS
chr1_1671797_G_A_b38	SLC35E2	6.203	1.27e-09	0.076859	111	0.012391	yes	SKINNS
chr1_1742587_G_C_b38	SLC35E2	6.127	1.96e-09	0.07833	114	0.012783	yes	SKINNS
chr1_1688328_C_T_b38	SLC35E2	-5.98	4.59e-09	-0.092261	26	0.01543	yes	SKINNS
chr1_1673968_GA_G_b38	SLC35E2	5.884	7.89e-09	0.087525	47	0.014876	yes	SKINNS
chr1_1752908_C_CCCT_b38	SLC35E2	-5.789	1.34e-08	-0.082944	94	0.014328	yes	SKINNS
chr1_1742672_C_T_b38	SLC35E2	-5.789	1.34e-08	-0.078228	89	0.013514	yes	SKINNS
chr1_1743238_G_C_b38	SLC35E2	-5.789	1.34e-08	-0.078228	89	0.013514	yes	SKINNS
chr1_1744499_C_T_b38	SLC35E2	-5.715	2.01e-08	-0.073086	100	0.012788	yes	SKINNS
chr1_1744652_C_T_b38	SLC35E2	-5.662	2.68e-08	-0.073424	102	0.012967	yes	SKINNS
chr1_1753319_G_A_b38	SLC35E2	-5.594	3.87e-08	-0.078126	107	0.013965	yes	SKINNS
chr1_1752730_C_G_b38	SLC35E2	-5.584	4.09e-08	-0.078479	107	0.014054	yes	SKINNS
chr1_1752461_G_A_b38	SLC35E2	-5.582	4.13e-08	-0.078324	107	0.014031	yes	SKINNS
chr1_1753361_G_A_b38	SLC35E2	-5.582	4.13e-08	-0.078324	107	0.014031	yes	SKINNS
chr1_1649932_C_T_b38	SLC35E2	5.528	5.53e-08	0.071167	104	0.012875	yes	SKINNS
chr1_1743565_ATAT_A_b38	SLC35E2	-5.519	5.8e-08	-0.072501	82	0.013137	yes	SKINNS
chr1_1744028_A_AC_b38	SLC35E2	-5.507	6.17e-08	-0.09362	27	0.017	yes	SKINNS
chr1_1743586_T_TAC_b38	SLC35E2	-5.464	7.76e-08	-0.076994	71	0.014092	yes	SKINNS
chr1_1651653_C_T_b38	SLC35E2	5.414	1.01e-07	0.070739	111	0.013067	yes	SKINNS
chr1_1648736_G_A_b38	SLC35E2	5.411	1.02e-07	0.071206	101	0.013158	yes	SKINNS
chr1_1744854_C_A_b38	SLC35E2	-5.343	1.46e-07	-0.064635	83	0.012098	yes	SKINNS
chr1_1692124_T_G_b38	SLC35E2	-5.324	1.62e-07	-0.079597	38	0.014952	yes	SKINNS
chr1_1637577_T_C_b38	SLC35E2	-5.302	1.81e-07	-0.079169	29	0.014932	yes	SKINNS
chr1_1649976_G_A_b38	SLC35E2	5.216	2.8e-07	0.068894	83	0.013208	yes	SKINNS
chr1_1743840_T_C_b38	SLC35E2	-5.155	3.82e-07	-0.078098	43	0.01515	yes	SKINNS
chr1_1743851_C_T_b38	SLC35E2	-5.152	3.87e-07	-0.077505	44	0.015042	yes	SKINNS
chr1_1636278_G_T_b38	SLC35E2	5.128	4.37e-07	0.069391	89	0.013531	yes	SKINNS
chr1_1743565_AT_A_b38	SLC35E2	5.07	5.84e-07	0.062154	127	0.012259	yes	SKINNS
chr1_1674633_C_CA_b38	SLC35E2	5.07	5.85e-07	0.070185	60	0.013844	yes	SKINNS
chr1_1755504_T_C_b38	SLC35E2	5.065	5.99e-07	0.064975	113	0.012829	yes	SKINNS
chr1_1653863_C_A_b38	SLC35E2	-5.012	7.78e-07	-0.086466	13	0.017251	yes	SKINNS
chr1_1692151_T_C_b38	SLC35E2	-4.967	9.69e-07	-0.075619	41	0.015224	yes	SKINNS
chr1_1866635_T_TA_b38	SLC35E2	4.911	1.27e-06	0.070283	69	0.01431	yes	SKINNS
chr1_1757725_C_T_b38	SLC35E2	4.908	1.29e-06	0.067367	77	0.013726	yes	SKINNS
chr1_1750226_C_T_b38	SLC35E2	4.9	1.34e-06	0.067003	81	0.013674	yes	SKINNS
chr1_1743886_C_T_b38	SLC35E2	-4.896	1.37e-06	-0.074312	46	0.015179	yes	SKINNS
chr1_1747695_A_G_b38	SLC35E2	-4.865	1.59e-06	-0.054933	119	0.011291	yes	SKINNS
chr1_1757074_G_T_b38	SLC35E2	4.807	2.1e-06	0.065206	78	0.013566	yes	SKINNS
chr1_1750280_A_G_b38	SLC35E2	-4.785	2.32e-06	-0.064542	119	0.013487	yes	SKINNS
chr1_1755523_C_T_b38	SLC35E2	4.777	2.42e-06	0.062327	119	0.013048	yes	SKINNS
chr1_1744052_GAGA_G_b38	SLC35E2	-4.766	2.55e-06	-0.079131	29	0.016603	yes	SKINNS
chr1_1692286_C_A_b38	SLC35E2	4.757	2.65e-06	0.091734	3	0.019283	yes	SKINNS
chr1_1754601_G_T_b38	SLC35E2	4.744	2.82e-06	0.065205	77	0.013744	yes	SKINNS
chr1_1650000_G_A_b38	SLC35E2	4.707	3.36e-06	0.061587	72	0.013084	yes	SKINNS
chr1_1752126_G_A_b38	SLC35E2	4.695	3.55e-06	0.068782	55	0.014649	yes	SKINNS
chr1_1748780_G_A_b38	SLC35E2	-4.674	3.92e-06	-0.063443	120	0.013574	yes	SKINNS
chr1_1828894_T_TAC_b38	SLC35E2	4.665	4.09e-06	0.063975	87	0.013715	yes	SKINNS
chr1_1658830_C_G_b38	SLC35E2	-4.63	4.8e-06	-0.072261	25	0.015607	yes	SKINNS
chr1_1779667_T_TTG_b38	SLC35E2	4.6	5.52e-06	0.066023	67	0.014354	yes	SKINNS
chr1_1756186_T_C_b38	SLC35E2	4.593	5.68e-06	0.061863	81	0.013468	yes	SKINNS
chr1_1730405_G_C_b38	SLC35E2	4.558	6.66e-06	0.064295	81	0.014105	yes	SKINNS
chr1_1758323_T_C_b38	SLC35E2	4.548	6.97e-06	0.060527	92	0.013307	yes	SKINNS
chr1_1844830_C_A_b38	SLC35E2	4.538	7.32e-06	0.061364	91	0.013522	yes	SKINNS
chr1_1820337_A_G_b38	SLC35E2	4.535	7.41e-06	0.059673	100	0.013159	yes	SKINNS
chr1_1667424_T_TAAAATA_b38	SLC35E2	4.534	7.44e-06	0.062352	61	0.013752	yes	SKINNS
chr1_1764023_C_A_b38	SLC35E2	4.533	7.47e-06	0.061429	81	0.01355	yes	SKINNS
chr1_1668542_C_T_b38	SLC35E2	-4.53	7.59e-06	-0.072943	23	0.016103	yes	SKINNS
chr1_1688619_AAAC_A_b38	SLC35E2	-4.517	8.03e-06	-0.072255	38	0.015995	yes	SKINNS
chr1_1665061_C_T_b38	SLC35E2	-4.511	8.25e-06	-0.072164	24	0.015996	yes	SKINNS
chr1_1781909_C_T_b38	SLC35E2	4.474	9.77e-06	0.059548	96	0.013311	yes	SKINNS
chr1_1688647_G_A_b38	SLC35E2	-4.459	1.04e-05	-0.070076	43	0.015716	yes	SKINNS
chr1_1661177_A_G_b38	SLC35E2	-4.456	1.06e-05	-0.071008	24	0.015934	yes	SKINNS
chr1_1669576_G_A_b38	SLC35E2	-4.454	1.07e-05	-0.071738	24	0.016106	yes	SKINNS
chr1_1639685_G_A_b38	SLC35E2	-4.452	1.08e-05	-0.069895	28	0.0157	yes	SKINNS
chr1_1650664_CT_C_b38	SLC35E2	4.444	1.12e-05	0.067399	46	0.015168	yes	SKINNS
chr1_1750428_G_C_b38	SLC35E2	-4.406	1.32e-05	-0.066491	73	0.01509	yes	SKINNS
chr1_1848037_C_CTA_b38	SLC35E2	4.397	1.37e-05	0.059495	94	0.01353	yes	SKINNS
chr1_1668717_C_G_b38	SLC35E2	-4.393	1.4e-05	-0.070351	24	0.016015	yes	SKINNS
chr1_1743714_C_CA_b38	SLC35E2	4.393	1.4e-05	0.061722	72	0.014051	yes	SKINNS
chr1_1646352_A_C_b38	SLC35E2	4.372	1.53e-05	0.083537	7	0.019106	yes	SKINNS
chr1_1760882_T_C_b38	SLC35E2	4.36	1.61e-05	0.05755	100	0.013199	yes	SKINNS
chr1_1639348_G_T_b38	SLC35E2	-4.306	2.05e-05	-0.057934	61	0.013455	yes	SKINNS
chr1_1865278_A_C_b38	SLC35E2	4.295	2.14e-05	0.058248	84	0.013561	yes	SKINNS
chr1_1638879_C_T_b38	SLC35E2	-4.275	2.34e-05	-0.0646	34	0.015111	yes	SKINNS
chr1_1675091_A_G_b38	SLC35E2	-4.273	2.36e-05	-0.067795	28	0.015867	yes	SKINNS
chr1_1688442_T_C_b38	SLC35E2	-4.257	2.53e-05	-0.067267	38	0.015802	yes	SKINNS
chr1_1708474_C_A_b38	SLC35E2	-4.23	2.83e-05	-0.072846	18	0.01722	yes	SKINNS
chr1_1743544_CA_C_b38	SLC35E2	4.213	3.05e-05	0.054229	101	0.012872	yes	SKINNS
chr1_1612562_T_TC_b38	SLC35E2	4.212	3.07e-05	0.055756	61	0.013238	yes	SKINNS
chr1_1680672_C_T_b38	SLC35E2	-4.206	3.15e-05	-0.058528	89	0.013916	yes	SKINNS
chr1_1668721_C_T_b38	SLC35E2	-4.192	3.33e-05	-0.062282	34	0.014856	yes	SKINNS
chr1_1660683_C_T_b38	SLC35E2	-4.175	3.59e-05	-0.062792	31	0.015041	yes	SKINNS
chr1_1750440_G_A_b38	SLC35E2	-4.173	3.61e-05	-0.063289	71	0.015166	yes	SKINNS
chr1_1749826_A_G_b38	SLC35E2	-4.171	3.65e-05	-0.054361	127	0.013033	yes	SKINNS
chr1_1661562_G_C_b38	SLC35E2	4.171	3.65e-05	0.050117	114	0.012016	yes	SKINNS
chr1_1667424_T_TAAATA_b38	SLC35E2	-4.16	3.82e-05	-0.054603	80	0.013126	yes	SKINNS
chr1_1749637_G_T_b38	SLC35E2	4.154	3.92e-05	0.055338	82	0.013323	yes	SKINNS
chr1_1750508_A_C_b38	SLC35E2	-4.134	4.26e-05	-0.049041	118	0.011863	yes	SKINNS
chr1_1926870_T_C_b38	SLC35E2	-4.066	5.66e-05	-0.054521	90	0.013411	yes	SKINNS
chr1_1676287_C_T_b38	SLC35E2	-4.052	5.99e-05	-0.070035	17	0.017283	yes	SKINNS
chr1_1665581_C_G_b38	SLC35E2	-4.042	6.24e-05	-0.06306	28	0.015601	yes	SKINNS
chr1_1613769_C_T_b38	SLC35E2	4.033	6.49e-05	0.058153	49	0.014421	yes	SKINNS
chr1_1688786_G_A_b38	SLC35E2	-4.014	7.01e-05	-0.069774	22	0.017384	yes	SKINNS
chr1_1708521_C_G_b38	SLC35E2	-3.999	7.45e-05	-0.060852	38	0.015217	yes	SKINNS
chr1_1686321_CTTT_C_b38	SLC35E2	-3.999	7.45e-05	-0.059802	40	0.014955	yes	SKINNS
chr1_1708855_TTCCTCCTCC_T_b38	SLC35E2	3.938	9.52e-05	0.055428	96	0.014074	yes	SKINNS
chr1_1695459_A_G_b38	SLC35E2	3.933	9.71e-05	0.061391	90	0.015607	yes	SKINNS
chr1_1960609_G_C_b38	SLC35E2	-3.892	0.000114	-0.05158	77	0.013252	yes	SKINNS
chr1_914743_C_T_b38	SLC35E2	3.881	0.00012	0.063004	19	0.016233	yes	SKINNS
chr1_1904424_A_AAAATAAATAAAT_b38	SLC35E2	3.864	0.000128	0.04948	78	0.012804	yes	SKINNS
chr1_1683909_A_C_b38	SLC35E2	-3.848	0.000136	-0.051292	101	0.013328	yes	SKINNS
chr1_1769969_CAAAACA_C_b38	SLC35E2	3.83	0.000147	0.051329	89	0.013402	yes	SKINNS
chr1_1675132_A_G_b38	SLC35E2	3.825	0.00015	0.055682	73	0.014558	yes	SKINNS
chr1_1976566_T_C_b38	SLC35E2	3.825	0.00015	0.048778	112	0.012754	yes	SKINNS
chr1_1773460_G_A_b38	SLC35E2	-3.82	0.000152	-0.053991	114	0.014132	yes	SKINNS
chr1_1773476_C_G_b38	SLC35E2	-3.82	0.000152	-0.053991	114	0.014132	yes	SKINNS
chr1_1687153_A_G_b38	SLC35E2	-3.79	0.000172	-0.050509	98	0.013328	yes	SKINNS
chr1_1991690_A_G_b38	SLC35E2	3.774	0.000182	0.051151	96	0.013553	yes	SKINNS
chr1_917859_A_G_b38	SLC35E2	3.771	0.000184	0.06239	18	0.016544	yes	SKINNS
chr1_1672155_G_A_b38	SLC35E2	-3.764	0.000189	-0.055534	51	0.014753	yes	SKINNS
chr1_1831318_C_T_b38	SLC35E2	-3.749	0.000201	-0.053924	113	0.014383	yes	SKINNS
chr1_1808816_G_T_b38	SLC35E2	-3.749	0.000201	-0.053595	114	0.014296	yes	SKINNS
chr1_1819825_G_A_b38	SLC35E2	-3.749	0.000201	-0.053595	114	0.014296	yes	SKINNS
chr1_917284_C_T_b38	SLC35E2	3.744	0.000205	0.061294	19	0.01637	yes	SKINNS
chr1_1654662_CT_C_b38	SLC35E2	3.743	0.000206	0.053565	83	0.014311	yes	SKINNS
chr1_1817295_T_C_b38	SLC35E2	-3.733	0.000213	-0.053313	115	0.01428	yes	SKINNS
chr1_1750528_G_A_b38	SLC35E2	-3.726	0.000219	-0.044785	115	0.012019	yes	SKINNS
chr1_1771864_G_A_b38	SLC35E2	-3.72	0.000224	-0.052802	116	0.014192	yes	SKINNS
chr1_1772426_T_A_b38	SLC35E2	-3.72	0.000224	-0.052802	116	0.014192	yes	SKINNS
chr1_1746522_GT_G_b38	SLC35E2	-3.72	0.000225	-0.060001	34	0.016131	yes	SKINNS
chr1_1827774_A_G_b38	SLC35E2	-3.715	0.000229	-0.053203	115	0.014322	yes	SKINNS
chr1_1772410_T_C_b38	SLC35E2	-3.707	0.000236	-0.052597	116	0.014187	yes	SKINNS
chr1_1691417_T_C_b38	SLC35E2	3.705	0.000238	0.051089	102	0.01379	yes	SKINNS
chr1_1776461_GAAAC_G_b38	SLC35E2	-3.701	0.000242	-0.052755	114	0.014255	yes	SKINNS
chr1_1777362_A_G_b38	SLC35E2	-3.701	0.000242	-0.052755	114	0.014255	yes	SKINNS
chr1_1881082_C_T_b38	SLC35E2	-3.691	0.000251	-0.05217	114	0.014133	yes	SKINNS
chr1_1764887_C_A_b38	SLC35E2	-3.686	0.000256	-0.052486	115	0.014241	yes	SKINNS
chr1_1773848_A_C_b38	SLC35E2	-3.686	0.000256	-0.052486	115	0.014241	yes	SKINNS
chr1_1790040_C_T_b38	SLC35E2	-3.686	0.000256	-0.052486	115	0.014241	yes	SKINNS
chr1_1688586_C_T_b38	SLC35E2	-3.667	0.000275	-0.060596	33	0.016526	yes	SKINNS
chr1_1791493_C_T_b38	SLC35E2	-3.666	0.000276	-0.052423	113	0.014299	yes	SKINNS
chr1_1791592_G_A_b38	SLC35E2	-3.666	0.000276	-0.052423	113	0.014299	yes	SKINNS
chr1_1792927_G_A_b38	SLC35E2	-3.666	0.000276	-0.052423	113	0.014299	yes	SKINNS
chr1_1680556_A_G_b38	SLC35E2	-3.666	0.000276	-0.049225	91	0.013428	yes	SKINNS
chr1_1688531_T_C_b38	SLC35E2	-3.661	0.000281	-0.062166	27	0.016979	yes	SKINNS
chr1_1739519_C_G_b38	SLC35E2	3.652	0.000292	0.054019	47	0.014793	yes	SKINNS
chr1_1688102_G_A_b38	SLC35E2	-3.65	0.000293	-0.055942	34	0.015327	yes	SKINNS
chr1_1680214_T_C_b38	SLC35E2	-3.647	0.000297	-0.048805	91	0.013383	yes	SKINNS
chr1_1886800_G_A_b38	SLC35E2	-3.645	0.000299	-0.051797	115	0.014211	yes	SKINNS
chr1_1891654_C_CAGAG_b38	SLC35E2	-3.645	0.000299	-0.051797	115	0.014211	yes	SKINNS
chr1_1762287_A_G_b38	SLC35E2	-3.64	0.000305	-0.051987	118	0.014283	yes	SKINNS
chr1_1621352_G_A_b38	SLC35E2	3.63	0.000316	0.050798	53	0.013994	yes	SKINNS
chr1_1797530_C_A_b38	SLC35E2	-3.624	0.000323	-0.051395	113	0.014181	yes	SKINNS
chr1_1688457_G_A_b38	SLC35E2	-3.612	0.000338	-0.057188	42	0.015831	yes	SKINNS
chr1_1629332_G_T_b38	SLC35E2	3.606	0.000346	0.052286	50	0.014499	yes	SKINNS
chr1_1888382_A_AG_b38	SLC35E2	3.602	0.000351	0.075416	6	0.020938	yes	SKINNS
chr1_1736729_G_T_b38	SLC35E2	3.599	0.000355	0.045593	132	0.012667	yes	SKINNS
chr1_1679100_A_G_b38	SLC35E2	-3.597	0.000358	-0.046435	96	0.012908	yes	SKINNS
chr1_1866508_A_G_b38	SLC35E2	-3.591	0.000366	-0.05118	115	0.014251	yes	SKINNS
chr1_1875208_T_C_b38	SLC35E2	-3.591	0.000366	-0.05118	115	0.014251	yes	SKINNS
chr1_1879567_T_C_b38	SLC35E2	-3.591	0.000366	-0.05118	115	0.014251	yes	SKINNS
chr1_912710_G_A_b38	SLC35E2	3.591	0.000366	0.058365	19	0.016254	yes	SKINNS
chr1_913358_C_T_b38	SLC35E2	3.591	0.000366	0.058365	19	0.016254	yes	SKINNS
chr1_1847030_A_G_b38	SLC35E2	-3.588	0.00037	-0.051359	114	0.014313	yes	SKINNS
chr1_1850017_G_T_b38	SLC35E2	-3.588	0.00037	-0.051359	114	0.014313	yes	SKINNS
chr1_1670423_AT_A_b38	SLC35E2	3.585	0.000374	0.052509	67	0.014647	yes	SKINNS
chr1_1843381_A_T_b38	SLC35E2	-3.572	0.000393	-0.051051	115	0.014292	yes	SKINNS
chr1_1766653_A_G_b38	SLC35E2	-3.556	0.000418	-0.050345	115	0.01416	yes	SKINNS
chr1_1746440_A_G_b38	SLC35E2	-3.541	0.000441	-0.058047	32	0.016394	yes	SKINNS
chr1_1589495_CTTT_C_b38	SLC35E2	3.524	0.000469	0.052762	44	0.014973	yes	SKINNS
chr1_1740343_C_T_b38	SLC35E2	3.519	0.000478	0.044323	133	0.012597	yes	SKINNS
chr1_910698_C_T_b38	SLC35E2	3.517	0.000481	0.059027	16	0.016783	yes	SKINNS
chr1_1864334_AAAG_A_b38	SLC35E2	-3.5	0.000513	-0.058754	29	0.016789	yes	SKINNS
chr1_1725582_T_C_b38	SLC35E2	3.498	0.000515	0.04106	121	0.011737	yes	SKINNS
chr1_1922670_A_G_b38	SLC35E2	-3.498	0.000516	-0.047865	96	0.013683	yes	SKINNS
chr1_1928648_C_T_b38	SLC35E2	-3.498	0.000516	-0.047865	96	0.013683	yes	SKINNS
chr1_1934565_G_A_b38	SLC35E2	-3.494	0.000524	-0.048856	96	0.013984	yes	SKINNS
chr1_1648636_G_A_b38	SLC35E2	-3.491	0.00053	-0.048605	55	0.013924	yes	SKINNS
chr1_1945842_A_AAAAGAAC_b38	SLC35E2	-3.487	0.000537	-0.051222	84	0.014689	yes	SKINNS
chr1_1991761_T_C_b38	SLC35E2	3.484	0.000543	0.048894	80	0.014035	yes	SKINNS
chr1_1877316_A_T_b38	SLC35E2	3.457	0.000598	0.048573	70	0.014049	yes	SKINNS
chr1_1936077_C_T_b38	SLC35E2	-3.454	0.000605	-0.046932	101	0.013587	yes	SKINNS
chr1_1731963_A_C_b38	SLC35E2	3.449	0.000615	0.043437	133	0.012593	yes	SKINNS
chr1_1735176_C_T_b38	SLC35E2	3.449	0.000615	0.043437	133	0.012593	yes	SKINNS
chr1_1675228_C_CG_b38	SLC35E2	3.435	0.000647	0.049398	83	0.014379	yes	SKINNS
chr1_1904424_A_AAAATAAAT_b38	SLC35E2	-3.43	0.000659	-0.044942	110	0.013102	yes	SKINNS
chr1_1940540_G_A_b38	SLC35E2	-3.414	7e-04	-0.046496	97	0.013621	yes	SKINNS
chr1_1792696_C_CA_b38	SLC35E2	3.403	0.000726	0.048992	52	0.014396	yes	SKINNS
chr1_1620609_G_A_b38	SLC35E2	3.396	0.000746	0.047142	53	0.013884	yes	SKINNS
chr1_1071823_A_G_b38	SLC35E2	-3.384	0.000778	-0.054133	25	0.015998	yes	SKINNS
chr1_1722625_A_T_b38	SLC35E2	3.38	0.000789	0.059061	37	0.017474	yes	SKINNS
chr1_1650383_G_T_b38	SLC35E2	-3.366	0.000828	-0.050284	38	0.014938	yes	SKINNS
chr1_1609058_G_A_b38	SLC35E2	3.362	0.000841	0.046532	53	0.013841	yes	SKINNS
chr1_1945913_T_C_b38	SLC35E2	-3.356	0.000858	-0.057111	10	0.017018	yes	SKINNS
chr1_1600320_C_G_b38	SLC35E2	3.354	0.000865	0.04702	50	0.014019	yes	SKINNS
chr1_1880596_T_A_b38	SLC35E2	-3.351	0.000873	-0.047701	102	0.014234	yes	SKINNS
chr1_1734903_A_G_b38	SLC35E2	3.345	0.000892	0.042105	134	0.012587	yes	SKINNS
chr1_1740703_C_T_b38	SLC35E2	3.328	0.000948	0.041973	134	0.012613	yes	SKINNS
chr1_1921745_T_C_b38	SLC35E2	-3.328	0.000948	-0.045599	95	0.013703	yes	SKINNS
chr1_1940973_C_T_b38	SLC35E2	-3.326	0.000953	-0.045159	99	0.013576	yes	SKINNS
chr1_1732392_C_T_b38	SLC35E2	3.324	0.000962	0.04189	134	0.012604	yes	SKINNS
chr1_1734174_A_G_b38	SLC35E2	3.324	0.000962	0.04189	134	0.012604	yes	SKINNS
chr1_1735980_A_C_b38	SLC35E2	3.324	0.000962	0.04189	134	0.012604	yes	SKINNS
chr1_1600379_C_T_b38	SLC35E2	3.322	0.000969	0.046391	52	0.013967	yes	SKINNS
chr1_1622295_G_C_b38	SLC35E2	3.31	0.00101	0.046041	53	0.013909	yes	SKINNS
chr1_1937841_ACACCAGGTCCACCTCTGGACACAGGTCCACC_A_b38	SLC35E2	-3.308	0.00102	-0.045017	97	0.013609	yes	SKINNS
chr1_1722626_AGCG_A_b38	SLC35E2	3.308	0.00102	0.057716	37	0.017449	yes	SKINNS
chr1_1737504_A_C_b38	SLC35E2	3.292	0.00107	0.041231	138	0.012525	yes	SKINNS
chr1_1938054_ACT_A_b38	SLC35E2	-3.282	0.00111	-0.044793	97	0.013647	yes	SKINNS
chr1_1938493_C_CAT_b38	SLC35E2	-3.279	0.00112	-0.05819	9	0.017748	yes	SKINNS
chr1_1938771_G_A_b38	SLC35E2	-3.279	0.00112	-0.05819	9	0.017748	yes	SKINNS
chr1_1939978_T_C_b38	SLC35E2	-3.279	0.00112	-0.05819	9	0.017748	yes	SKINNS
chr1_1943706_C_T_b38	SLC35E2	-3.279	0.00112	-0.05819	9	0.017748	yes	SKINNS
chr1_1943828_A_G_b38	SLC35E2	-3.279	0.00112	-0.05819	9	0.017748	yes	SKINNS
chr1_1936627_C_G_b38	SLC35E2	-3.273	0.00115	-0.044931	95	0.013727	yes	SKINNS
chr1_1942014_G_A_b38	SLC35E2	-3.269	0.00116	-0.044438	98	0.013594	yes	SKINNS
chr1_1942075_A_G_b38	SLC35E2	-3.269	0.00116	-0.044438	98	0.013594	yes	SKINNS
chr1_1942086_T_C_b38	SLC35E2	-3.269	0.00116	-0.044438	98	0.013594	yes	SKINNS
chr1_1942260_G_C_b38	SLC35E2	-3.269	0.00116	-0.044438	98	0.013594	yes	SKINNS
chr1_1069047_G_A_b38	SLC35E2	-3.267	0.00117	-0.045608	50	0.013958	yes	SKINNS
chr1_1931580_CA_C_b38	SLC35E2	-3.258	0.00121	-0.044591	96	0.013685	yes	SKINNS
chr1_1931587_A_G_b38	SLC35E2	-3.258	0.00121	-0.044591	96	0.013685	yes	SKINNS
chr1_1630798_C_T_b38	SLC35E2	3.255	0.00122	0.047037	48	0.014449	yes	SKINNS
chr1_1738295_G_T_b38	SLC35E2	3.253	0.00123	0.041175	132	0.012658	yes	SKINNS
chr1_1607931_G_A_b38	SLC35E2	3.238	0.00129	0.045067	52	0.013917	yes	SKINNS
chr1_1891450_G_C_b38	SLC35E2	-3.235	0.00131	-0.045848	110	0.014172	yes	SKINNS
chr1_1987049_A_G_b38	SLC35E2	3.234	0.00131	0.044631	96	0.013799	yes	SKINNS
chr1_1791389_G_A_b38	SLC35E2	3.232	0.00132	0.050798	25	0.01572	yes	SKINNS
chr1_1375678_TAA_T_b38	SLC35E2	-3.217	0.00139	-0.057537	16	0.017885	yes	SKINNS
chr1_1937273_T_C_b38	SLC35E2	-3.216	0.00139	-0.043968	92	0.013671	yes	SKINNS
chr1_910255_C_T_b38	SLC35E2	3.213	0.00141	0.05467	15	0.017013	yes	SKINNS
chr1_911428_C_T_b38	SLC35E2	3.212	0.00142	0.050016	28	0.015574	yes	SKINNS
chr1_1729859_A_G_b38	SLC35E2	3.173	0.00161	0.052534	19	0.016558	yes	SKINNS
chr1_1722619_C_T_b38	SLC35E2	3.163	0.00167	0.05514	38	0.017431	yes	SKINNS
chr1_1728671_C_A_b38	SLC35E2	3.15	0.00174	0.052789	23	0.01676	yes	SKINNS
chr1_1942258_G_A_b38	SLC35E2	-3.149	0.00175	-0.042874	97	0.013615	yes	SKINNS
chr1_1891444_CG_C_b38	SLC35E2	-3.146	0.00176	-0.044456	110	0.014129	yes	SKINNS
chr1_1933087_C_T_b38	SLC35E2	-3.142	0.00179	-0.043105	94	0.013718	yes	SKINNS
chr1_1933859_A_G_b38	SLC35E2	-3.142	0.00179	-0.043105	94	0.013718	yes	SKINNS
chr1_1736836_A_G_b38	SLC35E2	3.141	0.00179	0.040572	126	0.012916	yes	SKINNS
chr1_1938332_A_ACT_b38	SLC35E2	-3.131	0.00186	-0.042295	100	0.013509	yes	SKINNS
chr1_922671_C_T_b38	SLC35E2	3.13	0.00186	0.052041	18	0.016625	yes	SKINNS
chr1_1742432_T_TA_b38	SLC35E2	3.116	0.00195	0.043373	81	0.01392	yes	SKINNS
chr1_1649993_A_G_b38	SLC35E2	-3.112	0.00198	-0.039386	132	0.012657	yes	SKINNS
chr1_1160003_G_A_b38	SLC35E2	3.11	0.00199	0.047458	39	0.015258	yes	SKINNS
chr1_1943142_A_G_b38	SLC35E2	-3.105	0.00202	-0.055	9	0.017712	yes	SKINNS
chr1_1945799_T_G_b38	SLC35E2	-3.099	0.00206	-0.05576	9	0.017991	yes	SKINNS
chr1_1685108_CA_C_b38	SLC35E2	-3.092	0.00211	-0.050185	41	0.016229	yes	SKINNS
chr1_910558_G_A_b38	SLC35E2	3.077	0.00222	0.048191	39	0.015661	yes	SKINNS
chr1_1977879_G_A_b38	SLC35E2	3.077	0.00222	0.043664	48	0.014192	yes	SKINNS
chr1_1981476_T_A_b38	SLC35E2	3.053	0.0024	0.05765	3	0.01888	yes	SKINNS
chr1_1074098_G_C_b38	SLC35E2	-3.04	0.00251	-0.044866	38	0.01476	yes	SKINNS
chr1_1595028_C_CAG_b38	SLC35E2	3.037	0.00253	0.045922	36	0.01512	yes	SKINNS
chr1_1773713_T_A_b38	SLC35E2	-3.034	0.00255	-0.042541	60	0.01402	yes	SKINNS
chr1_1081961_G_T_b38	SLC35E2	-3.03	0.00259	-0.044494	42	0.014683	yes	SKINNS
chr1_1810086_A_G_b38	SLC35E2	3.024	0.00264	0.048507	23	0.01604	yes	SKINNS
chr1_1586962_C_T_b38	SLC35E2	3.013	0.00274	0.041948	63	0.013923	yes	SKINNS
chr1_1071610_G_A_b38	SLC35E2	-3.013	0.00274	-0.044675	39	0.014829	yes	SKINNS
chr1_922660_C_A_b38	SLC35E2	2.995	0.00289	0.0505	17	0.016859	yes	SKINNS
chr1_1985090_C_T_b38	SLC35E2	2.995	0.00289	0.042525	70	0.014197	yes	SKINNS
chr1_1606532_GTGGGCTGGGCTGGTCAGGCA_G_b38	SLC35E2	2.983	0.00301	0.042647	45	0.014295	yes	SKINNS
chr1_1776772_TAA_T_b38	SLC35E2	-2.981	0.00303	-0.046321	49	0.015539	yes	SKINNS
chr1_1978562_C_G_b38	SLC35E2	2.974	0.0031	0.041994	49	0.014121	yes	SKINNS
chr1_1978573_T_C_b38	SLC35E2	2.974	0.0031	0.041994	49	0.014121	yes	SKINNS
chr1_929839_G_A_b38	SLC35E2	2.966	0.00317	0.049982	18	0.016849	yes	SKINNS
chr1_995982_G_A_b38	SLC35E2	2.95	0.00335	0.039187	78	0.013285	yes	SKINNS
chr1_1902439_C_T_b38	SLC35E2	-2.946	0.00338	-0.042056	113	0.014274	yes	SKINNS
chr1_1081790_C_G_b38	SLC35E2	-2.94	0.00345	-0.037077	120	0.012609	yes	SKINNS
chr1_1986211_T_C_b38	SLC35E2	2.926	0.00361	0.042018	46	0.01436	yes	SKINNS
chr1_911018_G_A_b38	SLC35E2	2.925	0.00362	0.046895	32	0.016031	yes	SKINNS
chr1_1324134_G_GGCTGGGGGGCTGGGAGGCTGAGAGGCTGGGGAGCTGGGGA_b38	SLC35E2	-2.918	0.0037	-0.081567	11	0.027951	yes	SKINNS
chr1_1978055_C_T_b38	SLC35E2	2.913	0.00376	0.041607	47	0.014282	yes	SKINNS
chr1_1978797_T_C_b38	SLC35E2	2.91	0.0038	0.041299	48	0.014193	yes	SKINNS
chr1_1982826_T_C_b38	SLC35E2	2.91	0.0038	0.041299	48	0.014193	yes	SKINNS
chr1_1978114_T_A_b38	SLC35E2	2.908	0.00382	0.041519	47	0.014277	yes	SKINNS
chr1_928622_G_C_b38	SLC35E2	2.906	0.00384	0.049186	16	0.016925	yes	SKINNS
chr1_1641275_A_G_b38	SLC35E2	-2.906	0.00384	-0.040075	58	0.013791	yes	SKINNS
chr1_1945975_TG_T_b38	SLC35E2	-2.905	0.00385	-0.040773	111	0.014035	yes	SKINNS
chr1_1086035_A_G_b38	SLC35E2	-2.903	0.00388	-0.042608	40	0.014679	yes	SKINNS
chr1_1901262_C_T_b38	SLC35E2	-2.902	0.00389	-0.041483	114	0.014296	yes	SKINNS
chr1_1901386_C_A_b38	SLC35E2	-2.902	0.00389	-0.041483	114	0.014296	yes	SKINNS
chr1_1075337_C_T_b38	SLC35E2	-2.902	0.0039	-0.036794	106	0.01268	yes	SKINNS
chr1_1695747_C_T_b38	SLC35E2	2.902	0.0039	0.045273	94	0.015603	yes	SKINNS
chr1_1978647_G_T_b38	SLC35E2	2.901	0.0039	0.041226	48	0.014209	yes	SKINNS
chr1_1978006_A_G_b38	SLC35E2	2.898	0.00394	0.04117	48	0.014208	yes	SKINNS
chr1_2675320_A_G_b38	SLC35E2	2.895	0.00398	0.062995	5	0.021762	yes	SKINNS
chr1_1079746_A_G_b38	SLC35E2	-2.873	0.00426	-0.03656	109	0.012724	yes	SKINNS
chr1_1902481_G_A_b38	SLC35E2	-2.87	0.0043	-0.040776	113	0.014209	yes	SKINNS
chr1_1984586_G_A_b38	SLC35E2	2.87	0.0043	0.040949	47	0.014269	yes	SKINNS
chr1_1986010_T_G_b38	SLC35E2	2.87	0.0043	0.040949	47	0.014269	yes	SKINNS
chr1_1041126_AGCGGGGGC_A_b38	SLC35E2	-2.86	0.00444	-0.030082	47	0.010519	yes	SKINNS
chr1_1650370_C_CT_b38	SLC35E2	-2.857	0.00447	-0.048364	25	0.016927	yes	SKINNS
chr1_1972273_C_A_b38	SLC35E2	2.855	0.00451	0.041094	46	0.014394	yes	SKINNS
chr1_2369355_G_GAA_b38	SLC35E2	-2.847	0.00462	-0.10062	7	0.035343	yes	SKINNS
chr1_1597128_C_CCCTCAGCTGGACT_b38	SLC35E2	-2.845	0.00465	-0.03772	79	0.01326	yes	SKINNS
chr1_1877314_A_T_b38	SLC35E2	2.84	0.00471	0.045854	29	0.016143	yes	SKINNS
chr1_1977765_A_G_b38	SLC35E2	2.837	0.00477	0.040512	47	0.014281	yes	SKINNS
chr1_1980953_G_A_b38	SLC35E2	2.837	0.00477	0.040512	47	0.014281	yes	SKINNS
chr1_1794321_C_T_b38	SLC35E2	2.834	0.00481	0.041835	33	0.014764	yes	SKINNS
chr1_1805214_T_G_b38	SLC35E2	2.834	0.00481	0.041835	33	0.014764	yes	SKINNS
chr1_1978262_C_T_b38	SLC35E2	2.832	0.00484	0.040167	48	0.014184	yes	SKINNS
chr1_1978294_G_T_b38	SLC35E2	2.832	0.00484	0.040167	48	0.014184	yes	SKINNS
chr1_1976473_C_T_b38	SLC35E2	2.823	0.00497	0.040406	47	0.014314	yes	SKINNS
chr1_1976573_T_C_b38	SLC35E2	2.823	0.00497	0.040406	47	0.014314	yes	SKINNS
chr1_1976646_A_G_b38	SLC35E2	2.823	0.00497	0.040406	47	0.014314	yes	SKINNS
chr1_1976661_G_T_b38	SLC35E2	2.823	0.00497	0.040406	47	0.014314	yes	SKINNS
chr1_1976946_C_T_b38	SLC35E2	2.823	0.00497	0.040406	47	0.014314	yes	SKINNS
chr1_1977264_C_G_b38	SLC35E2	2.823	0.00497	0.040406	47	0.014314	yes	SKINNS
chr1_911484_G_C_b38	SLC35E2	2.821	0.005	0.044331	26	0.015715	yes	SKINNS
chr1_932255_C_T_b38	SLC35E2	2.817	0.00507	0.047305	18	0.016794	yes	SKINNS
chr1_1976600_C_T_b38	SLC35E2	2.814	0.0051	0.0403	47	0.01432	yes	SKINNS
chr1_1340697_G_A_b38	SLC35E2	2.814	0.00511	0.042818	31	0.015217	yes	SKINNS
chr1_1722599_G_A_b38	SLC35E2	2.808	0.0052	0.047015	52	0.016743	yes	SKINNS
chr1_929558_G_A_b38	SLC35E2	-2.8	0.00533	-0.042826	58	0.015295	yes	SKINNS
chr1_1981319_G_C_b38	SLC35E2	2.796	0.0054	0.04015	46	0.014359	yes	SKINNS
chr1_1983166_A_T_b38	SLC35E2	2.796	0.0054	0.04015	46	0.014359	yes	SKINNS
chr1_1983956_TGG_T_b38	SLC35E2	2.796	0.0054	0.04015	46	0.014359	yes	SKINNS
chr1_1984859_C_T_b38	SLC35E2	2.796	0.0054	0.04015	46	0.014359	yes	SKINNS
chr1_1985148_G_T_b38	SLC35E2	2.796	0.0054	0.04015	46	0.014359	yes	SKINNS
chr1_1986033_G_A_b38	SLC35E2	2.796	0.0054	0.04015	46	0.014359	yes	SKINNS
chr1_1986176_A_T_b38	SLC35E2	2.796	0.0054	0.04015	46	0.014359	yes	SKINNS
chr1_1986390_T_G_b38	SLC35E2	2.796	0.0054	0.04015	46	0.014359	yes	SKINNS
chr1_1986469_A_C_b38	SLC35E2	2.796	0.0054	0.04015	46	0.014359	yes	SKINNS
chr1_1987096_A_T_b38	SLC35E2	2.796	0.0054	0.04015	46	0.014359	yes	SKINNS
chr1_1987156_G_A_b38	SLC35E2	2.796	0.0054	0.04015	46	0.014359	yes	SKINNS
chr1_1978404_C_T_b38	SLC35E2	2.788	0.00554	0.039844	47	0.014293	yes	SKINNS
chr1_1978415_G_A_b38	SLC35E2	2.788	0.00554	0.039844	47	0.014293	yes	SKINNS
chr1_1969015_A_G_b38	SLC35E2	2.764	0.00594	0.039838	109	0.014411	yes	SKINNS
chr1_1834655_A_C_b38	SLC35E2	2.764	0.00594	0.040856	33	0.01478	yes	SKINNS
chr1_1914345_C_T_b38	SLC35E2	-2.764	0.00595	-0.039883	112	0.014431	yes	SKINNS
chr1_1914918_G_A_b38	SLC35E2	-2.764	0.00595	-0.039883	112	0.014431	yes	SKINNS
chr1_1976990_T_C_b38	SLC35E2	2.763	0.00596	0.039486	48	0.014291	yes	SKINNS
chr1_1916217_C_T_b38	SLC35E2	-2.763	0.00597	-0.039778	113	0.014397	yes	SKINNS
chr1_995371_C_G_b38	SLC35E2	2.763	0.00597	0.036427	77	0.013185	yes	SKINNS
chr1_1918090_A_G_b38	SLC35E2	-2.759	0.00604	-0.039902	111	0.014462	yes	SKINNS
chr1_1731904_CA_C_b38	SLC35E2	2.724	0.0067	0.041494	49	0.015233	yes	SKINNS
chr1_1984595_C_T_b38	SLC35E2	2.719	0.0068	0.038997	47	0.014341	yes	SKINNS
chr1_1936906_C_CA_b38	SLC35E2	-2.707	0.00704	-0.040275	63	0.014876	yes	SKINNS
chr1_1801188_T_C_b38	SLC35E2	2.702	0.00716	0.047588	11	0.017614	yes	SKINNS
chr1_909894_G_T_b38	SLC35E2	2.699	0.00723	0.043679	39	0.016185	yes	SKINNS
chr1_1919188_CAGCGGCAGG_C_b38	SLC35E2	-2.693	0.00734	-0.037499	113	0.013923	yes	SKINNS
chr1_2367306_CA_C_b38	SLC35E2	-2.693	0.00734	-0.041089	34	0.015256	yes	SKINNS
chr1_1842237_T_C_b38	SLC35E2	2.691	0.00738	0.039275	38	0.014593	yes	SKINNS
chr1_1925281_C_T_b38	SLC35E2	-2.684	0.00754	-0.038715	112	0.014423	yes	SKINNS
chr1_1991778_A_G_b38	SLC35E2	-2.677	0.0077	-0.040588	29	0.015162	yes	SKINNS
chr1_1912607_C_T_b38	SLC35E2	-2.671	0.00783	-0.038562	107	0.014436	yes	SKINNS
chr1_1089921_T_C_b38	SLC35E2	-2.669	0.00789	-0.061797	3	0.023155	yes	SKINNS
chr1_907835_C_CCTGCCCGGTCCTTCTGACCAGCCGAGAGAGTA_b38	SLC35E2	2.668	0.00791	0.037646	53	0.014112	yes	SKINNS
chr1_1746439_GA_G_b38	SLC35E2	2.666	0.00795	0.039146	86	0.014681	yes	SKINNS
chr1_1836856_CT_C_b38	SLC35E2	2.66	0.00809	0.042583	27	0.016006	yes	SKINNS
chr1_1067552_C_G_b38	SLC35E2	-2.653	0.00826	-0.039029	38	0.014711	yes	SKINNS
chr1_2466310_G_A_b38	SLC35E2	2.648	0.00837	0.054136	10	0.020441	yes	SKINNS
chr1_2466611_G_A_b38	SLC35E2	2.648	0.00837	0.054136	10	0.020441	yes	SKINNS
chr1_2467963_C_G_b38	SLC35E2	2.648	0.00837	0.054136	10	0.020441	yes	SKINNS
chr1_1929904_C_T_b38	SLC35E2	-2.645	0.00846	-0.037957	112	0.014351	yes	SKINNS
chr1_1743712_G_A_b38	SLC35E2	2.642	0.00853	0.062286	4	0.023576	yes	SKINNS
chr1_1924788_C_T_b38	SLC35E2	-2.638	0.00862	-0.037913	114	0.01437	yes	SKINNS
chr1_1708951_C_T_b38	SLC35E2	2.637	0.00865	0.034811	91	0.013199	yes	SKINNS
chr1_840409_TAA_T_b38	SLC35E2	-2.629	0.00886	-0.052197	8	0.019853	yes	SKINNS
chr1_1920695_A_G_b38	SLC35E2	-2.629	0.00886	-0.037855	113	0.014399	yes	SKINNS
chr1_1925233_T_C_b38	SLC35E2	-2.629	0.00886	-0.037855	113	0.014399	yes	SKINNS
chr1_1927857_T_C_b38	SLC35E2	-2.629	0.00886	-0.037855	113	0.014399	yes	SKINNS
chr1_2686084_CA_C_b38	SLC35E2	2.623	0.00901	0.041314	24	0.01575	yes	SKINNS
chr1_1913504_CT_C_b38	SLC35E2	-2.615	0.00923	-0.039944	86	0.015276	yes	SKINNS
chr1_2383824_C_G_b38	SLC35E2	2.61	0.00935	0.034931	72	0.013382	yes	SKINNS
chr1_1877312_A_T_b38	SLC35E2	2.605	0.0095	0.052127	11	0.020011	yes	SKINNS
chr1_1838449_C_CT_b38	SLC35E2	2.599	0.00966	0.040153	28	0.015449	yes	SKINNS
chr1_1897325_G_A_b38	SLC35E2	2.597	0.00971	0.040638	23	0.015647	yes	SKINNS
chr1_995786_A_G_b38	SLC35E2	2.597	0.00972	0.034135	93	0.013146	yes	SKINNS
chr1_1836387_CT_C_b38	SLC35E2	2.593	0.00983	0.049656	20	0.019151	yes	SKINNS
chr1_1907199_A_G_b38	SLC35E2	2.59	0.00992	0.039617	26	0.015298	yes	SKINNS
chr1_1753033_C_T_b38	SLC35E2	-5.777	1.43e-08	-0.079123	117	0.013697	no	SKINNS
chr1_1754482_TCCCTGGGACCGAAGTCGCCCCA_T_b38	SLC35E2	-5.623	3.32e-08	-0.078623	109	0.013983	no	SKINNS
chr1_1756043_G_T_b38	SLC35E2	-5.509	6.12e-08	-0.077472	109	0.014063	no	SKINNS
chr1_1759354_G_A_b38	SLC35E2	-5.4	1.09e-07	-0.075968	109	0.014069	no	SKINNS
chr1_1759611_C_T_b38	SLC35E2	-5.287	1.95e-07	-0.074132	112	0.014022	no	SKINNS
chr1_1739131_T_C_b38	SLC35E2	5.113	4.71e-07	0.06587	88	0.012882	no	SKINNS
chr1_1970506_T_A_b38	SLC35E2	-4.798	2.19e-06	-0.060806	95	0.012673	no	SKINNS
chr1_1835922_G_GAAA_b38	SLC35E2	-4.772	2.48e-06	-0.148292	8	0.031078	no	SKINNS
chr1_1751981_A_T_b38	SLC35E2	-4.722	3.14e-06	-0.077096	42	0.016328	no	SKINNS
chr1_1755713_G_A_b38	SLC35E2	-4.665	4.08e-06	-0.065236	98	0.013983	no	SKINNS
chr1_1744121_A_C_b38	SLC35E2	-4.51	8.29e-06	-0.079924	56	0.017721	no	SKINNS
chr1_1669613_G_A_b38	SLC35E2	-4.456	1.06e-05	-0.071248	25	0.015991	no	SKINNS
chr1_1748597_C_G_b38	SLC35E2	-4.442	1.12e-05	-0.063891	108	0.014383	no	SKINNS
chr1_1747472_A_T_b38	SLC35E2	-4.432	1.18e-05	-0.063566	108	0.014344	no	SKINNS
chr1_1667948_A_G_b38	SLC35E2	-4.428	1.2e-05	-0.070736	24	0.015973	no	SKINNS
chr1_1664757_T_C_b38	SLC35E2	-4.165	3.74e-05	-0.057575	47	0.013824	no	SKINNS
chr1_1668108_C_T_b38	SLC35E2	4.136	4.22e-05	0.058159	47	0.01406	no	SKINNS
chr1_1770997_G_A_b38	SLC35E2	-4.11	4.71e-05	-0.057101	116	0.013894	no	SKINNS
chr1_1744096_C_T_b38	SLC35E2	-3.953	8.98e-05	-0.069062	56	0.017471	no	SKINNS
chr1_1652913_C_T_b38	SLC35E2	-3.945	9.27e-05	-0.058848	35	0.014917	no	SKINNS
chr1_1659060_G_A_b38	SLC35E2	-3.945	9.27e-05	-0.058028	37	0.014709	no	SKINNS
chr1_1650195_A_G_b38	SLC35E2	-3.925	1e-04	-0.054799	50	0.013961	no	SKINNS
chr1_1769969_CAAAACAAAAACA_C_b38	SLC35E2	-3.919	0.000103	-0.055616	120	0.014193	no	SKINNS
chr1_1650777_G_A_b38	SLC35E2	-3.909	0.000107	-0.054917	47	0.014047	no	SKINNS
chr1_1688409_C_G_b38	SLC35E2	-3.895	0.000113	-0.053626	79	0.013769	no	SKINNS
chr1_1971864_C_T_b38	SLC35E2	3.888	0.000116	0.049339	100	0.012689	no	SKINNS
chr1_1721552_G_A_b38	SLC35E2	-3.87	0.000125	-0.153802	4	0.039737	no	SKINNS
chr1_1660318_C_T_b38	SLC35E2	3.865	0.000128	0.079495	3	0.020567	no	SKINNS
chr1_1836126_C_A_b38	SLC35E2	-3.862	0.000129	-0.053274	119	0.013793	no	SKINNS
chr1_1651137_C_T_b38	SLC35E2	-3.862	0.000129	-0.054312	47	0.014065	no	SKINNS
chr1_1651267_T_C_b38	SLC35E2	-3.862	0.000129	-0.054312	47	0.014065	no	SKINNS
chr1_1651574_G_A_b38	SLC35E2	-3.862	0.000129	-0.054312	47	0.014065	no	SKINNS
chr1_1652061_T_C_b38	SLC35E2	-3.862	0.000129	-0.054312	47	0.014065	no	SKINNS
chr1_1652135_C_G_b38	SLC35E2	-3.862	0.000129	-0.054312	47	0.014065	no	SKINNS
chr1_1652191_C_T_b38	SLC35E2	-3.862	0.000129	-0.054312	47	0.014065	no	SKINNS
chr1_1652592_A_G_b38	SLC35E2	-3.862	0.000129	-0.054312	47	0.014065	no	SKINNS
chr1_1652779_A_G_b38	SLC35E2	-3.862	0.000129	-0.054312	47	0.014065	no	SKINNS
chr1_1653147_A_C_b38	SLC35E2	-3.862	0.000129	-0.054312	47	0.014065	no	SKINNS
chr1_1653396_T_C_b38	SLC35E2	-3.862	0.000129	-0.054312	47	0.014065	no	SKINNS
chr1_1653472_T_C_b38	SLC35E2	-3.862	0.000129	-0.054312	47	0.014065	no	SKINNS
chr1_1653811_G_A_b38	SLC35E2	-3.862	0.000129	-0.054312	47	0.014065	no	SKINNS
chr1_1653893_C_T_b38	SLC35E2	-3.862	0.000129	-0.054312	47	0.014065	no	SKINNS
chr1_1654143_G_A_b38	SLC35E2	-3.862	0.000129	-0.054312	47	0.014065	no	SKINNS
chr1_1654188_T_G_b38	SLC35E2	-3.862	0.000129	-0.054312	47	0.014065	no	SKINNS
chr1_1661420_C_A_b38	SLC35E2	-3.854	0.000133	-0.053959	49	0.014	no	SKINNS
chr1_1591703_T_C_b38	SLC35E2	3.827	0.000149	0.04988	96	0.013035	no	SKINNS
chr1_1658866_G_A_b38	SLC35E2	-3.821	0.000152	-0.053504	49	0.014003	no	SKINNS
chr1_1659114_A_G_b38	SLC35E2	-3.821	0.000152	-0.053504	49	0.014003	no	SKINNS
chr1_1659220_A_G_b38	SLC35E2	-3.821	0.000152	-0.053504	49	0.014003	no	SKINNS
chr1_1635226_T_C_b38	SLC35E2	-3.819	0.000153	-0.066774	12	0.017483	no	SKINNS
chr1_1679993_A_G_b38	SLC35E2	-3.814	0.000156	-0.050241	114	0.013173	no	SKINNS
chr1_1881428_C_CT_b38	SLC35E2	-3.813	0.000157	-0.054554	110	0.014309	no	SKINNS
chr1_915810_G_A_b38	SLC35E2	3.812	0.000157	0.059522	26	0.015615	no	SKINNS
chr1_1606384_A_G_b38	SLC35E2	3.811	0.000158	0.052899	57	0.013881	no	SKINNS
chr1_1851414_GA_G_b38	SLC35E2	-3.801	0.000164	-0.057045	59	0.015006	no	SKINNS
chr1_915824_G_C_b38	SLC35E2	3.788	0.000172	0.058598	32	0.015468	no	SKINNS
chr1_1653934_G_A_b38	SLC35E2	-3.786	0.000174	-0.053307	47	0.014079	no	SKINNS
chr1_1762759_AAATG_A_b38	SLC35E2	3.782	0.000177	0.051676	97	0.013664	no	SKINNS
chr1_1860718_A_C_b38	SLC35E2	-3.778	0.00018	-0.053655	118	0.014203	no	SKINNS
chr1_1651926_T_C_b38	SLC35E2	-3.763	0.000191	-0.053006	47	0.014088	no	SKINNS
chr1_1750589_G_A_b38	SLC35E2	-3.734	0.000213	-0.071763	21	0.019221	no	SKINNS
chr1_1648826_A_G_b38	SLC35E2	-3.731	0.000215	-0.052005	55	0.013938	no	SKINNS
chr1_1684266_T_C_b38	SLC35E2	-3.73	0.000216	-0.049947	90	0.013389	no	SKINNS
chr1_912111_G_A_b38	SLC35E2	3.728	0.000218	0.058321	27	0.015645	no	SKINNS
chr1_1651421_GTAGCCCCTCTGAACGGTCTGTGACACACGCATGCTTTCAGCTAGAGTACTCTA_G_b38	SLC35E2	-3.724	0.000221	-0.052912	46	0.014208	no	SKINNS
chr1_1846009_AGG_A_b38	SLC35E2	-3.719	0.000225	-0.053044	117	0.014262	no	SKINNS
chr1_1846011_G_GTCC_b38	SLC35E2	-3.719	0.000225	-0.053044	117	0.014262	no	SKINNS
chr1_1687061_C_T_b38	SLC35E2	-3.714	0.00023	-0.049635	90	0.013365	no	SKINNS
chr1_1717604_CGCTTTCAGCTAGAGTTTGCTCTCTCTGGTTTTCGGTCTGTGACACACGCAT_C_b38	SLC35E2	3.707	0.000236	0.051122	79	0.013791	no	SKINNS
chr1_1881249_A_G_b38	SLC35E2	-3.702	0.000241	-0.052512	114	0.014184	no	SKINNS
chr1_1660408_T_C_b38	SLC35E2	-3.701	0.000242	-0.061839	11	0.016711	no	SKINNS
chr1_913076_A_G_b38	SLC35E2	3.662	0.00028	0.057301	27	0.015645	no	SKINNS
chr1_1686147_T_G_b38	SLC35E2	-3.661	0.000281	-0.050179	83	0.013706	no	SKINNS
chr1_1671097_G_C_b38	SLC35E2	3.655	0.000287	0.051019	52	0.013957	no	SKINNS
chr1_1687159_G_T_b38	SLC35E2	-3.648	0.000295	-0.048928	89	0.013411	no	SKINNS
chr1_1649846_G_A_b38	SLC35E2	-3.628	0.000319	-0.057707	24	0.015908	no	SKINNS
chr1_914682_A_T_b38	SLC35E2	3.627	0.00032	0.056799	26	0.015662	no	SKINNS
chr1_913065_G_A_b38	SLC35E2	3.624	0.000324	0.056583	27	0.015614	no	SKINNS
chr1_1651785_C_A_b38	SLC35E2	-3.611	0.00034	-0.050934	47	0.014106	no	SKINNS
chr1_1641261_C_T_b38	SLC35E2	-3.609	0.000342	-0.060303	20	0.016707	no	SKINNS
chr1_1664865_A_G_b38	SLC35E2	-3.609	0.000342	-0.050615	47	0.014024	no	SKINNS
chr1_1681164_G_A_b38	SLC35E2	-3.6	0.000354	-0.048172	91	0.013382	no	SKINNS
chr1_1671148_C_T_b38	SLC35E2	3.593	0.000363	0.050343	53	0.01401	no	SKINNS
chr1_981282_A_C_b38	SLC35E2	3.589	0.000368	0.060613	18	0.016887	no	SKINNS
chr1_1687236_T_G_b38	SLC35E2	-3.588	0.000371	-0.048935	83	0.01364	no	SKINNS
chr1_1687643_G_A_b38	SLC35E2	-3.583	0.000377	-0.04798	91	0.013391	no	SKINNS
chr1_1686017_A_AT_b38	SLC35E2	-3.579	0.000383	-0.047656	91	0.013317	no	SKINNS
chr1_982112_C_T_b38	SLC35E2	3.579	0.000383	0.060792	17	0.016988	no	SKINNS
chr1_913274_TG_T_b38	SLC35E2	3.571	0.000394	0.059465	17	0.01665	no	SKINNS
chr1_1948594_G_GTTT_b38	SLC35E2	-3.558	0.000414	-0.108144	7	0.030397	no	SKINNS
chr1_1837255_A_AT_b38	SLC35E2	3.544	0.000436	0.064231	13	0.018124	no	SKINNS
chr1_1684308_G_C_b38	SLC35E2	-3.517	0.000481	-0.047514	88	0.01351	no	SKINNS
chr1_1684619_G_A_b38	SLC35E2	-3.517	0.000481	-0.047514	88	0.01351	no	SKINNS
chr1_914483_G_GACTGCCCAGCTC_b38	SLC35E2	3.508	0.000498	0.056149	24	0.016007	no	SKINNS
chr1_1732892_CT_C_b38	SLC35E2	3.485	0.000541	0.061755	11	0.01772	no	SKINNS
chr1_911848_C_T_b38	SLC35E2	3.468	0.000576	0.05598	23	0.016144	no	SKINNS
chr1_918870_A_G_b38	SLC35E2	3.46	0.000591	0.055158	23	0.01594	no	SKINNS
chr1_1688570_A_T_b38	SLC35E2	-3.444	0.000628	-0.063171	14	0.018344	no	SKINNS
chr1_1986752_A_G_b38	SLC35E2	3.434	0.000651	0.04815	93	0.014023	no	SKINNS
chr1_1134273_C_T_b38	SLC35E2	3.434	0.000651	0.050809	30	0.014797	no	SKINNS
chr1_982890_C_T_b38	SLC35E2	3.426	0.000669	0.058161	17	0.016976	no	SKINNS
chr1_983237_G_A_b38	SLC35E2	3.426	0.000669	0.058161	17	0.016976	no	SKINNS
chr1_917378_G_C_b38	SLC35E2	3.408	0.000714	0.05752	16	0.016879	no	SKINNS
chr1_1727506_T_C_b38	SLC35E2	3.406	0.000719	0.054617	42	0.016037	no	SKINNS
chr1_921056_TG_T_b38	SLC35E2	3.398	0.00074	0.057487	16	0.016918	no	SKINNS
chr1_975093_G_A_b38	SLC35E2	3.382	0.000782	0.064847	10	0.019173	no	SKINNS
chr1_1684817_G_C_b38	SLC35E2	-3.38	0.000787	-0.047648	76	0.014095	no	SKINNS
chr1_1944182_G_C_b38	SLC35E2	-3.375	0.000804	-0.047036	111	0.013938	no	SKINNS
chr1_1916417_G_T_b38	SLC35E2	-3.371	0.000815	-0.046343	100	0.013748	no	SKINNS
chr1_1905533_AT_A_b38	SLC35E2	3.362	0.000841	0.064766	3	0.019265	no	SKINNS
chr1_1659940_A_C_b38	SLC35E2	-3.361	0.000842	-0.058825	11	0.017501	no	SKINNS
chr1_976536_C_T_b38	SLC35E2	3.355	0.00086	0.057118	17	0.017023	no	SKINNS
chr1_1650664_CTTTTT_C_b38	SLC35E2	-3.323	0.000962	-0.053	27	0.015947	no	SKINNS
chr1_981935_G_A_b38	SLC35E2	3.323	0.000964	0.054278	21	0.016334	no	SKINNS
chr1_1725339_C_A_b38	SLC35E2	3.314	0.000994	0.040998	91	0.01237	no	SKINNS
chr1_1681928_C_A_b38	SLC35E2	-3.293	0.00107	-0.045662	82	0.013867	no	SKINNS
chr1_2371472_G_A_b38	SLC35E2	3.278	0.00113	0.053135	20	0.016209	no	SKINNS
chr1_1650688_T_A_b38	SLC35E2	-3.268	0.00117	-0.049942	34	0.015281	no	SKINNS
chr1_1955080_C_CGGCTCACACCGGAAGTGAGGCTCACACCGGAAGTGA_b38	SLC35E2	-3.263	0.00119	-0.046705	100	0.014314	no	SKINNS
chr1_1947645_C_T_b38	SLC35E2	-3.254	0.00122	-0.046449	108	0.014274	no	SKINNS
chr1_1903577_C_T_b38	SLC35E2	3.253	0.00123	0.060936	10	0.018735	no	SKINNS
chr1_973693_C_T_b38	SLC35E2	-3.251	0.00124	-0.043541	75	0.013392	no	SKINNS
chr1_927486_C_T_b38	SLC35E2	-3.245	0.00126	-0.051296	55	0.015807	no	SKINNS
chr1_1085543_A_AG_b38	SLC35E2	-3.245	0.00126	-0.046173	53	0.014229	no	SKINNS
chr1_1132482_T_C_b38	SLC35E2	3.239	0.00129	0.052801	20	0.016304	no	SKINNS
chr1_925308_G_A_b38	SLC35E2	-3.216	0.00139	-0.050127	55	0.015586	no	SKINNS
chr1_1914634_G_T_b38	SLC35E2	-3.208	0.00143	-0.044024	100	0.013725	no	SKINNS
chr1_1916670_G_C_b38	SLC35E2	-3.208	0.00143	-0.044024	100	0.013725	no	SKINNS
chr1_1950071_C_T_b38	SLC35E2	-3.207	0.00144	-0.046307	112	0.014441	no	SKINNS
chr1_1952064_G_A_b38	SLC35E2	-3.207	0.00144	-0.046307	112	0.014441	no	SKINNS
chr1_1952823_TA_T_b38	SLC35E2	-3.207	0.00144	-0.046307	112	0.014441	no	SKINNS
chr1_925036_G_A_b38	SLC35E2	-3.204	0.00145	-0.050187	52	0.015663	no	SKINNS
chr1_1951106_G_A_b38	SLC35E2	-3.197	0.00149	-0.046223	112	0.014458	no	SKINNS
chr1_1951865_G_GT_b38	SLC35E2	-3.197	0.00149	-0.046223	112	0.014458	no	SKINNS
chr1_926250_G_A_b38	SLC35E2	-3.182	0.00156	-0.05014	53	0.015757	no	SKINNS
chr1_1866635_T_TAAA_b38	SLC35E2	-3.177	0.00159	-0.04867	68	0.01532	no	SKINNS
chr1_1083795_C_G_b38	SLC35E2	-3.157	0.0017	-0.044522	57	0.014103	no	SKINNS
chr1_1903242_C_T_b38	SLC35E2	3.154	0.00172	0.060259	8	0.019108	no	SKINNS
chr1_1906935_C_T_b38	SLC35E2	3.154	0.00172	0.060259	8	0.019108	no	SKINNS
chr1_1898712_C_T_b38	SLC35E2	3.14	0.0018	0.05889	8	0.018754	no	SKINNS
chr1_1899188_T_A_b38	SLC35E2	3.14	0.0018	0.05889	8	0.018754	no	SKINNS
chr1_1132196_G_A_b38	SLC35E2	3.123	0.0019	0.052258	19	0.016732	no	SKINNS
chr1_1909167_G_A_b38	SLC35E2	3.116	0.00195	0.059526	8	0.019104	no	SKINNS
chr1_1845824_TACACAC_T_b38	SLC35E2	3.112	0.00198	0.054245	14	0.017431	no	SKINNS
chr1_1133966_C_T_b38	SLC35E2	3.105	0.00202	0.051504	18	0.016586	no	SKINNS
chr1_1946013_C_T_b38	SLC35E2	-3.094	0.0021	-0.043619	112	0.014097	no	SKINNS
chr1_1946058_T_C_b38	SLC35E2	-3.094	0.0021	-0.043619	112	0.014097	no	SKINNS
chr1_1130420_C_T_b38	SLC35E2	3.092	0.00211	0.052309	18	0.016919	no	SKINNS
chr1_1881065_G_A_b38	SLC35E2	3.089	0.00214	0.056691	9	0.018354	no	SKINNS
chr1_1881798_C_T_b38	SLC35E2	3.089	0.00214	0.056691	9	0.018354	no	SKINNS
chr1_1849781_T_C_b38	SLC35E2	-3.083	0.00218	-0.047673	28	0.015464	no	SKINNS
chr1_1815255_G_T_b38	SLC35E2	3.08	0.0022	0.059164	8	0.019207	no	SKINNS
chr1_1944216_C_T_b38	SLC35E2	-3.078	0.00221	-0.043501	111	0.014133	no	SKINNS
chr1_1944074_T_C_b38	SLC35E2	-3.071	0.00226	-0.043203	112	0.014069	no	SKINNS
chr1_1944091_G_C_b38	SLC35E2	-3.071	0.00226	-0.043203	112	0.014069	no	SKINNS
chr1_1697272_G_A_b38	SLC35E2	3.066	0.0023	0.063157	34	0.020596	no	SKINNS
chr1_923421_A_G_b38	SLC35E2	-3.048	0.00244	-0.047239	52	0.015497	no	SKINNS
chr1_1922882_A_G_b38	SLC35E2	-3.042	0.00249	-0.054826	9	0.018025	no	SKINNS
chr1_1935938_T_C_b38	SLC35E2	-3.038	0.00252	-0.042325	81	0.013931	no	SKINNS
chr1_978230_G_A_b38	SLC35E2	3.036	0.00254	0.051201	19	0.016865	no	SKINNS
chr1_1880594_A_T_b38	SLC35E2	3.035	0.00254	0.054579	13	0.017982	no	SKINNS
chr1_923311_TG_T_b38	SLC35E2	-3.031	0.00258	-0.047028	52	0.015515	no	SKINNS
chr1_981454_G_A_b38	SLC35E2	-3.029	0.0026	-0.039413	116	0.013012	no	SKINNS
chr1_1857305_G_GGGCT_b38	SLC35E2	3.022	0.00266	0.056849	7	0.018814	no	SKINNS
chr1_1686882_T_C_b38	SLC35E2	-3.021	0.00266	-0.040172	105	0.013296	no	SKINNS
chr1_1595306_CAG_C_b38	SLC35E2	-3.02	0.00267	-0.04321	109	0.014306	no	SKINNS
chr1_924305_G_A_b38	SLC35E2	3.017	0.0027	0.046958	30	0.015562	no	SKINNS
chr1_1898043_T_C_b38	SLC35E2	3.014	0.00272	0.056514	8	0.018749	no	SKINNS
chr1_1882915_C_T_b38	SLC35E2	3.012	0.00274	0.056503	8	0.018756	no	SKINNS
chr1_1775296_C_T_b38	SLC35E2	3.009	0.00277	0.057372	9	0.019067	no	SKINNS
chr1_983193_A_G_b38	SLC35E2	-3.003	0.00282	-0.039213	116	0.013056	no	SKINNS
chr1_1855245_G_A_b38	SLC35E2	2.999	0.00286	0.056549	7	0.018857	no	SKINNS
chr1_1920497_C_A_b38	SLC35E2	-2.994	0.00291	-0.052399	12	0.017501	no	SKINNS
chr1_1885444_TTAGA_T_b38	SLC35E2	2.992	0.00292	0.043913	35	0.014676	no	SKINNS
chr1_1892085_G_C_b38	SLC35E2	2.99	0.00295	0.054992	8	0.018394	no	SKINNS
chr1_1857246_T_TAA_b38	SLC35E2	2.981	0.00303	0.055875	7	0.018746	no	SKINNS
chr1_1857250_C_G_b38	SLC35E2	2.981	0.00303	0.055875	7	0.018746	no	SKINNS
chr1_1798925_C_CT_b38	SLC35E2	-2.978	0.00306	-0.04205	49	0.014118	no	SKINNS
chr1_2312125_G_A_b38	SLC35E2	-2.978	0.00306	-0.038451	138	0.012911	no	SKINNS
chr1_1948938_C_T_b38	SLC35E2	-2.978	0.00306	-0.036314	108	0.012193	no	SKINNS
chr1_978953_C_G_b38	SLC35E2	-2.974	0.0031	-0.038287	110	0.012875	no	SKINNS
chr1_1886690_A_C_b38	SLC35E2	2.973	0.0031	0.055417	8	0.018638	no	SKINNS
chr1_1944419_C_G_b38	SLC35E2	-2.97	0.00313	-0.04177	113	0.014062	no	SKINNS
chr1_1945121_T_C_b38	SLC35E2	-2.97	0.00313	-0.04177	113	0.014062	no	SKINNS
chr1_1946632_C_T_b38	SLC35E2	-2.97	0.00313	-0.04177	113	0.014062	no	SKINNS
chr1_1909238_G_A_b38	SLC35E2	-2.969	0.00315	-0.042553	114	0.014332	no	SKINNS
chr1_1985619_A_G_b38	SLC35E2	2.968	0.00316	0.041458	64	0.013968	no	SKINNS
chr1_978509_G_A_b38	SLC35E2	-2.965	0.00319	-0.038388	120	0.012948	no	SKINNS
chr1_1909234_G_A_b38	SLC35E2	-2.963	0.00321	-0.042638	113	0.01439	no	SKINNS
chr1_1899573_C_T_b38	SLC35E2	-2.961	0.00323	-0.04257	113	0.014379	no	SKINNS
chr1_1931519_A_G_b38	SLC35E2	-2.956	0.00328	-0.052337	11	0.017704	no	SKINNS
chr1_979472_G_C_b38	SLC35E2	-2.954	0.0033	-0.038457	122	0.013019	no	SKINNS
chr1_1698048_T_C_b38	SLC35E2	-2.947	0.00337	-0.09532	7	0.032343	no	SKINNS
chr1_983004_G_T_b38	SLC35E2	-2.945	0.00339	-0.03883	134	0.013183	no	SKINNS
chr1_1871210_G_T_b38	SLC35E2	2.945	0.00339	0.056103	8	0.019048	no	SKINNS
chr1_1947189_C_T_b38	SLC35E2	-2.945	0.0034	-0.041409	113	0.01406	no	SKINNS
chr1_914948_CA_C_b38	SLC35E2	2.943	0.00342	0.050575	18	0.017182	no	SKINNS
chr1_1371538_C_T_b38	SLC35E2	-2.943	0.00343	-0.118141	4	0.040149	no	SKINNS
chr1_1373079_A_G_b38	SLC35E2	-2.943	0.00343	-0.118141	4	0.040149	no	SKINNS
chr1_1375923_C_T_b38	SLC35E2	-2.943	0.00343	-0.118141	4	0.040149	no	SKINNS
chr1_1376025_T_C_b38	SLC35E2	-2.943	0.00343	-0.118141	4	0.040149	no	SKINNS
chr1_1378550_G_A_b38	SLC35E2	-2.943	0.00343	-0.118141	4	0.040149	no	SKINNS
chr1_1378591_C_T_b38	SLC35E2	-2.943	0.00343	-0.118141	4	0.040149	no	SKINNS
chr1_1948919_T_TCCTTCCCTCCTCTTTCCCTCCCTTCTTTCCTTCCCTTTCCCTCCCTC_b38	SLC35E2	-2.938	0.00347	-0.035984	105	0.012247	no	SKINNS
chr1_1855939_G_A_b38	SLC35E2	2.934	0.00352	0.055098	7	0.018782	no	SKINNS
chr1_1133503_G_A_b38	SLC35E2	2.925	0.00362	0.049397	19	0.016888	no	SKINNS
chr1_1944420_A_G_b38	SLC35E2	-2.919	0.00369	-0.041069	113	0.014068	no	SKINNS
chr1_1641819_C_T_b38	SLC35E2	2.917	0.00371	0.052611	15	0.018036	no	SKINNS
chr1_1649954_C_CA_b38	SLC35E2	-2.911	0.00379	-0.051415	18	0.017664	no	SKINNS
chr1_1706067_ACT_A_b38	SLC35E2	2.889	0.00405	0.038743	148	0.01341	no	SKINNS
chr1_1891450_G_A_b38	SLC35E2	2.886	0.00409	0.041768	36	0.014471	no	SKINNS
chr1_1888667_A_C_b38	SLC35E2	2.884	0.00412	0.042329	34	0.01468	no	SKINNS
chr1_1736801_CA_C_b38	SLC35E2	2.881	0.00415	0.046836	58	0.016256	no	SKINNS
chr1_1592964_C_T_b38	SLC35E2	2.876	0.00422	0.069599	3	0.024201	no	SKINNS
chr1_973443_G_A_b38	SLC35E2	2.861	0.00442	0.049443	18	0.017282	no	SKINNS
chr1_2694012_G_C_b38	SLC35E2	2.859	0.00444	0.033748	90	0.011802	no	SKINNS
chr1_1985451_C_T_b38	SLC35E2	2.848	0.0046	0.040808	72	0.014328	no	SKINNS
chr1_1965001_G_A_b38	SLC35E2	2.825	0.00494	0.04434	25	0.015696	no	SKINNS
chr1_1041119_GGGC_G_b38	SLC35E2	-2.825	0.00494	-0.02907	42	0.010291	no	SKINNS
chr1_1780791_C_T_b38	SLC35E2	2.824	0.00496	0.041519	34	0.014703	no	SKINNS
chr1_1782430_T_G_b38	SLC35E2	2.824	0.00496	0.041519	34	0.014703	no	SKINNS
chr1_1878070_C_T_b38	SLC35E2	2.824	0.00496	0.041519	34	0.014703	no	SKINNS
chr1_1881006_GGA_G_b38	SLC35E2	2.824	0.00496	0.041519	34	0.014703	no	SKINNS
chr1_1842226_T_C_b38	SLC35E2	2.822	0.00498	0.041728	35	0.014786	no	SKINNS
chr1_1137871_C_A_b38	SLC35E2	2.812	0.00515	0.046496	18	0.016538	no	SKINNS
chr1_1981466_C_A_b38	SLC35E2	2.807	0.00522	0.050961	5	0.018156	no	SKINNS
chr1_1918989_A_G_b38	SLC35E2	-2.806	0.00523	-0.038159	98	0.013598	no	SKINNS
chr1_1865177_G_A_b38	SLC35E2	-2.796	0.0054	-0.043533	27	0.015571	no	SKINNS
chr1_1905586_C_T_b38	SLC35E2	-2.795	0.00541	-0.040196	111	0.014379	no	SKINNS
chr1_1846651_T_G_b38	SLC35E2	2.793	0.00544	0.051432	8	0.018413	no	SKINNS
chr1_1915143_A_G_b38	SLC35E2	-2.793	0.00544	-0.051583	8	0.018467	no	SKINNS
chr1_1085026_T_C_b38	SLC35E2	-2.781	0.00565	-0.039254	54	0.014115	no	SKINNS
chr1_1938125_TCA_T_b38	SLC35E2	-2.776	0.00574	-0.039071	110	0.014076	no	SKINNS
chr1_1842221_C_G_b38	SLC35E2	2.774	0.00576	0.040933	37	0.014754	no	SKINNS
chr1_1864350_C_T_b38	SLC35E2	2.771	0.00582	0.039417	40	0.014225	no	SKINNS
chr1_979560_T_C_b38	SLC35E2	-2.771	0.00582	-0.036541	127	0.013187	no	SKINNS
chr1_975555_G_A_b38	SLC35E2	2.768	0.00587	0.043593	30	0.015747	no	SKINNS
chr1_1083324_A_G_b38	SLC35E2	-2.767	0.00589	-0.035133	106	0.012697	no	SKINNS
chr1_1890186_G_A_b38	SLC35E2	2.766	0.00591	0.040697	36	0.014713	no	SKINNS
chr1_1134222_T_C_b38	SLC35E2	2.761	0.00599	0.038132	56	0.013809	no	SKINNS
chr1_1596144_GAGAC_G_b38	SLC35E2	-2.76	0.00601	-0.040724	50	0.014753	no	SKINNS
chr1_1879682_G_A_b38	SLC35E2	2.755	0.00611	0.040726	36	0.014782	no	SKINNS
chr1_1842333_G_A_b38	SLC35E2	2.753	0.00614	0.04053	36	0.014721	no	SKINNS
chr1_931558_G_A_b38	SLC35E2	2.75	0.0062	0.043824	23	0.015935	no	SKINNS
chr1_1845824_TACACACACACACACACACACACACACACAC_T_b38	SLC35E2	2.742	0.00635	0.040643	37	0.014821	no	SKINNS
chr1_1950071_C_A_b38	SLC35E2	2.742	0.00635	0.042004	31	0.015319	no	SKINNS
chr1_1915326_G_A_b38	SLC35E2	-2.736	0.00647	-0.039533	113	0.014449	no	SKINNS
chr1_1837340_C_T_b38	SLC35E2	2.732	0.00654	0.05025	8	0.018393	no	SKINNS
chr1_1944675_C_T_b38	SLC35E2	-2.73	0.00658	-0.03838	112	0.014057	no	SKINNS
chr1_1884183_G_A_b38	SLC35E2	2.727	0.00664	0.039838	37	0.014608	no	SKINNS
chr1_1083800_T_C_b38	SLC35E2	-2.724	0.00671	-0.03452	107	0.012674	no	SKINNS
chr1_995508_ATTTTT_A_b38	SLC35E2	-2.72	0.00678	-0.036843	119	0.013545	no	SKINNS
chr1_1827615_G_A_b38	SLC35E2	2.718	0.00683	0.04052	32	0.01491	no	SKINNS
chr1_1837455_C_T_b38	SLC35E2	2.718	0.00683	0.04052	32	0.01491	no	SKINNS
chr1_1851762_G_A_b38	SLC35E2	2.718	0.00683	0.04052	32	0.01491	no	SKINNS
chr1_1852145_G_A_b38	SLC35E2	2.718	0.00683	0.04052	32	0.01491	no	SKINNS
chr1_1803531_C_T_b38	SLC35E2	2.713	0.00693	0.040103	35	0.014784	no	SKINNS
chr1_1830566_A_T_b38	SLC35E2	2.713	0.00693	0.040103	35	0.014784	no	SKINNS
chr1_1079877_A_G_b38	SLC35E2	-2.712	0.00695	-0.034496	106	0.012721	no	SKINNS
chr1_1951642_C_T_b38	SLC35E2	2.709	0.00701	0.041934	29	0.01548	no	SKINNS
chr1_1783572_C_A_b38	SLC35E2	2.708	0.00703	0.040209	33	0.014848	no	SKINNS
chr1_1869595_G_A_b38	SLC35E2	2.708	0.00703	0.040209	33	0.014848	no	SKINNS
chr1_1873952_G_A_b38	SLC35E2	2.706	0.00707	0.039874	36	0.014736	no	SKINNS
chr1_1878651_C_T_b38	SLC35E2	2.706	0.00707	0.039874	36	0.014736	no	SKINNS
chr1_1086315_A_G_b38	SLC35E2	-2.697	0.00726	-0.038325	50	0.014209	no	SKINNS
chr1_1937895_C_T_b38	SLC35E2	-2.692	0.00736	-0.037959	112	0.014099	no	SKINNS
chr1_1808642_TTTTG_T_b38	SLC35E2	2.688	0.00745	0.040029	34	0.014889	no	SKINNS
chr1_1150799_T_C_b38	SLC35E2	2.688	0.00745	0.03942	35	0.014664	no	SKINNS
chr1_1987145_C_T_b38	SLC35E2	2.677	0.0077	0.03837	50	0.014332	no	SKINNS
chr1_1965250_G_GA_b38	SLC35E2	2.675	0.00775	0.041855	26	0.015647	no	SKINNS
chr1_1777680_C_T_b38	SLC35E2	2.671	0.00784	0.072069	3	0.026981	no	SKINNS
chr1_1775996_G_A_b38	SLC35E2	2.667	0.00792	0.048599	9	0.01822	no	SKINNS
chr1_1794187_C_T_b38	SLC35E2	2.664	0.00799	0.049088	8	0.018424	no	SKINNS
chr1_1798974_C_T_b38	SLC35E2	2.664	0.00799	0.049088	8	0.018424	no	SKINNS
chr1_1951498_C_T_b38	SLC35E2	2.663	0.00804	0.041307	29	0.015514	no	SKINNS
chr1_967384_C_G_b38	SLC35E2	-2.659	0.00812	-0.037809	103	0.014219	no	SKINNS
chr1_1842213_A_G_b38	SLC35E2	2.659	0.00813	0.039337	36	0.014795	no	SKINNS
chr1_1848356_GC_G_b38	SLC35E2	2.649	0.00835	0.044296	19	0.01672	no	SKINNS
chr1_1704835_C_T_b38	SLC35E2	2.648	0.00839	0.035302	146	0.013332	no	SKINNS
chr1_1925261_C_T_b38	SLC35E2	-2.647	0.00842	-0.047764	9	0.018048	no	SKINNS
chr1_1897682_CA_C_b38	SLC35E2	2.644	0.00849	0.042844	18	0.016207	no	SKINNS
chr1_1720192_T_G_b38	SLC35E2	2.642	0.00853	0.034841	150	0.013188	no	SKINNS
chr1_1624086_G_A_b38	SLC35E2	-2.641	0.00854	-0.036163	76	0.01369	no	SKINNS
chr1_998410_G_A_b38	SLC35E2	-2.633	0.00876	-0.035131	121	0.013343	no	SKINNS
chr1_1715838_C_T_b38	SLC35E2	2.632	0.00878	0.03531	148	0.013416	no	SKINNS
chr1_1624323_AT_A_b38	SLC35E2	2.63	0.00883	0.035941	75	0.013665	no	SKINNS
chr1_1341803_C_T_b38	SLC35E2	-2.63	0.00884	-0.107542	4	0.040892	no	SKINNS
chr1_1373582_C_T_b38	SLC35E2	-2.63	0.00884	-0.107542	4	0.040892	no	SKINNS
chr1_1840043_T_TA_b38	SLC35E2	2.629	0.00885	0.047995	8	0.018253	no	SKINNS
chr1_1073854_T_C_b38	SLC35E2	-2.623	0.009	-0.032817	117	0.01251	no	SKINNS
chr1_1968103_A_ATGAG_b38	SLC35E2	2.623	0.00901	0.041273	25	0.015734	no	SKINNS
chr1_1942887_C_G_b38	SLC35E2	-2.613	0.00928	-0.036677	114	0.014037	no	SKINNS
chr1_1086657_C_T_b38	SLC35E2	-2.613	0.00929	-0.033633	111	0.012873	no	SKINNS
chr1_1924011_A_G_b38	SLC35E2	-2.613	0.00929	-0.049437	7	0.018923	no	SKINNS
chr1_1130717_G_A_b38	SLC35E2	2.612	0.0093	0.044803	17	0.01715	no	SKINNS
chr1_1687734_CAA_C_b38	SLC35E2	-2.607	0.00943	-0.037218	64	0.014274	no	SKINNS
chr1_1952590_A_AAAAG_b38	SLC35E2	2.607	0.00944	0.03961	35	0.015195	no	SKINNS
chr1_1134070_C_T_b38	SLC35E2	2.602	0.00958	0.036514	51	0.014033	no	SKINNS
chr1_1822247_A_G_b38	SLC35E2	2.596	0.00975	0.047567	9	0.018324	no	SKINNS
chr1_1839349_C_G_b38	SLC35E2	2.593	0.00982	0.038677	34	0.014915	no	SKINNS
chr1_1839350_T_A_b38	SLC35E2	2.593	0.00982	0.038677	34	0.014915	no	SKINNS
chr1_1851181_C_T_b38	SLC35E2	2.593	0.00982	0.038677	34	0.014915	no	SKINNS
chr1_1865951_T_A_b38	SLC35E2	2.59	0.0099	0.038585	32	0.014895	no	SKINNS
chr1_1753033_C_T_b38	SLC35E2	-7.956	1.07e-14	-0.104848	123	0.013178	yes	SKNS
chr1_1743238_G_C_b38	SLC35E2	-7.839	2.48e-14	-0.104031	93	0.013271	yes	SKNS
chr1_1742672_C_T_b38	SLC35E2	-7.777	3.85e-14	-0.102946	94	0.013237	yes	SKNS
chr1_1742587_G_C_b38	SLC35E2	7.697	6.76e-14	0.09577	143	0.012442	yes	SKNS
chr1_1743586_T_TAC_b38	SLC35E2	-7.549	1.91e-13	-0.102705	76	0.013605	yes	SKNS
chr1_1752461_G_A_b38	SLC35E2	-7.457	3.59e-13	-0.099503	115	0.013343	yes	SKNS
chr1_1752730_C_G_b38	SLC35E2	-7.308	9.97e-13	-0.097812	115	0.013385	yes	SKNS
chr1_1753361_G_A_b38	SLC35E2	-7.285	1.16e-12	-0.097582	115	0.013396	yes	SKNS
chr1_1753319_G_A_b38	SLC35E2	-7.267	1.31e-12	-0.09707	115	0.013357	yes	SKNS
chr1_1744499_C_T_b38	SLC35E2	-7.088	4.34e-12	-0.090237	111	0.012731	yes	SKNS
chr1_1754482_TCCCTGGGACCGAAGTCGCCCCA_T_b38	SLC35E2	-7.037	6.04e-12	-0.094117	119	0.013374	yes	SKNS
chr1_1756043_G_T_b38	SLC35E2	-7.034	6.18e-12	-0.094761	117	0.013472	yes	SKNS
chr1_1744028_A_AC_b38	SLC35E2	-7.033	6.21e-12	-0.119239	22	0.016954	yes	SKNS
chr1_1744652_C_T_b38	SLC35E2	-6.964	9.77e-12	-0.090909	109	0.013055	yes	SKNS
chr1_1755504_T_C_b38	SLC35E2	6.793	2.94e-11	0.084638	139	0.01246	yes	SKNS
chr1_1743565_ATAT_A_b38	SLC35E2	-6.749	3.88e-11	-0.084794	95	0.012563	yes	SKNS
chr1_1744854_C_A_b38	SLC35E2	-6.649	7.33e-11	-0.081373	91	0.012239	yes	SKNS
chr1_1759611_C_T_b38	SLC35E2	-6.61	9.33e-11	-0.089092	119	0.013478	yes	SKNS
chr1_1759354_G_A_b38	SLC35E2	-6.593	1.04e-10	-0.0894	116	0.01356	yes	SKNS
chr1_1748597_C_G_b38	SLC35E2	-6.503	1.81e-10	-0.089037	117	0.013691	yes	SKNS
chr1_1743886_C_T_b38	SLC35E2	-6.479	2.11e-10	-0.098982	44	0.015278	yes	SKNS
chr1_1747472_A_T_b38	SLC35E2	-6.458	2.4e-10	-0.088494	117	0.013704	yes	SKNS
chr1_1692286_C_A_b38	SLC35E2	6.454	2.45e-10	0.123232	5	0.019093	yes	SKNS
chr1_1746522_GT_G_b38	SLC35E2	-6.43	2.83e-10	-0.100778	37	0.015672	yes	SKNS
chr1_1752908_C_CCCT_b38	SLC35E2	-6.43	2.84e-10	-0.089158	97	0.013866	yes	SKNS
chr1_1692151_T_C_b38	SLC35E2	-6.426	2.91e-10	-0.099329	42	0.015458	yes	SKNS
chr1_1750280_A_G_b38	SLC35E2	-6.406	3.27e-10	-0.084495	127	0.013189	yes	SKNS
chr1_1750428_G_C_b38	SLC35E2	-6.356	4.44e-10	-0.092348	79	0.014529	yes	SKNS
chr1_1747695_A_G_b38	SLC35E2	-6.332	5.15e-10	-0.071488	129	0.01129	yes	SKNS
chr1_1744052_GAGA_G_b38	SLC35E2	-6.324	5.38e-10	-0.103235	29	0.016324	yes	SKNS
chr1_1750226_C_T_b38	SLC35E2	6.281	6.99e-10	0.082051	106	0.013064	yes	SKNS
chr1_1748780_G_A_b38	SLC35E2	-6.272	7.37e-10	-0.083446	131	0.013305	yes	SKNS
chr1_1752126_G_A_b38	SLC35E2	6.271	7.43e-10	0.08841	75	0.014099	yes	SKNS
chr1_1760882_T_C_b38	SLC35E2	6.21	1.06e-09	0.078453	124	0.012633	yes	SKNS
chr1_1671995_G_T_b38	SLC35E2	6.207	1.09e-09	0.07534	137	0.012139	yes	SKNS
chr1_1677726_A_T_b38	SLC35E2	6.129	1.71e-09	0.075177	138	0.012265	yes	SKNS
chr1_1755523_C_T_b38	SLC35E2	6.099	2.05e-09	0.077826	144	0.012761	yes	SKNS
chr1_1677720_T_G_b38	SLC35E2	6.092	2.13e-09	0.074688	138	0.01226	yes	SKNS
chr1_1779667_T_TTG_b38	SLC35E2	6.082	2.27e-09	0.083747	79	0.013771	yes	SKNS
chr1_1756186_T_C_b38	SLC35E2	6.077	2.33e-09	0.079095	103	0.013015	yes	SKNS
chr1_1750440_G_A_b38	SLC35E2	-6.07	2.42e-09	-0.088183	78	0.014527	yes	SKNS
chr1_1758323_T_C_b38	SLC35E2	6.063	2.53e-09	0.077299	115	0.012749	yes	SKNS
chr1_1730405_G_C_b38	SLC35E2	6.055	2.65e-09	0.085069	97	0.014049	yes	SKNS
chr1_1749826_A_G_b38	SLC35E2	-6.05	2.72e-09	-0.077282	138	0.012773	yes	SKNS
chr1_1674868_G_A_b38	SLC35E2	6.047	2.77e-09	0.073973	137	0.012232	yes	SKNS
chr1_1743714_C_CA_b38	SLC35E2	6.041	2.87e-09	0.084987	81	0.014067	yes	SKNS
chr1_1746440_A_G_b38	SLC35E2	-6.029	3.09e-09	-0.095622	35	0.015861	yes	SKNS
chr1_1820337_A_G_b38	SLC35E2	6.021	3.22e-09	0.075518	128	0.012542	yes	SKNS
chr1_1673060_G_A_b38	SLC35E2	6.021	3.23e-09	0.074362	137	0.012351	yes	SKNS
chr1_1754601_G_T_b38	SLC35E2	6.02	3.24e-09	0.080007	99	0.01329	yes	SKNS
chr1_1757725_C_T_b38	SLC35E2	6.02	3.24e-09	0.080007	99	0.01329	yes	SKNS
chr1_1692124_T_G_b38	SLC35E2	-6	3.64e-09	-0.091779	40	0.015297	yes	SKNS
chr1_1674720_TGC_T_b38	SLC35E2	5.998	3.67e-09	0.073587	136	0.012268	yes	SKNS
chr1_1673818_A_C_b38	SLC35E2	5.996	3.72e-09	0.073352	139	0.012233	yes	SKNS
chr1_1844830_C_A_b38	SLC35E2	5.995	3.74e-09	0.07673	118	0.012799	yes	SKNS
chr1_1688328_C_T_b38	SLC35E2	-5.992	3.82e-09	-0.090225	31	0.015058	yes	SKNS
chr1_1676790_C_T_b38	SLC35E2	5.99	3.85e-09	0.071941	140	0.012009	yes	SKNS
chr1_1671797_G_A_b38	SLC35E2	5.981	4.06e-09	0.074481	131	0.012453	yes	SKNS
chr1_1848037_C_CTA_b38	SLC35E2	5.961	4.57e-09	0.076217	121	0.012787	yes	SKNS
chr1_1757074_G_T_b38	SLC35E2	5.907	6.19e-09	0.077708	101	0.013154	yes	SKNS
chr1_1781909_C_T_b38	SLC35E2	5.897	6.56e-09	0.074618	121	0.012653	yes	SKNS
chr1_1744096_C_T_b38	SLC35E2	-5.886	6.99e-09	-0.108441	65	0.018423	yes	SKNS
chr1_1755713_G_A_b38	SLC35E2	-5.876	7.41e-09	-0.078418	105	0.013346	yes	SKNS
chr1_1828894_T_TAC_b38	SLC35E2	5.86	8.09e-09	0.076407	113	0.013038	yes	SKNS
chr1_1749637_G_T_b38	SLC35E2	5.852	8.49e-09	0.07412	106	0.012666	yes	SKNS
chr1_1866635_T_TA_b38	SLC35E2	5.832	9.47e-09	0.081071	79	0.0139	yes	SKNS
chr1_1764023_C_A_b38	SLC35E2	5.717	1.8e-08	0.07481	104	0.013084	yes	SKNS
chr1_1673968_GA_G_b38	SLC35E2	5.645	2.69e-08	0.083467	54	0.014786	yes	SKNS
chr1_1697979_G_A_b38	SLC35E2	-5.602	3.41e-08	-0.109843	4	0.019609	yes	SKNS
chr1_1743565_AT_A_b38	SLC35E2	5.553	4.43e-08	0.064852	149	0.011679	yes	SKNS
chr1_1865278_A_C_b38	SLC35E2	5.544	4.65e-08	0.071174	109	0.012837	yes	SKNS
chr1_1970506_T_A_b38	SLC35E2	-5.509	5.62e-08	-0.072579	96	0.013174	yes	SKNS
chr1_1940540_G_A_b38	SLC35E2	-5.495	6.06e-08	-0.071282	118	0.012972	yes	SKNS
chr1_1945842_A_AAAAGAAC_b38	SLC35E2	-5.473	6.82e-08	-0.076119	89	0.013909	yes	SKNS
chr1_1940973_C_T_b38	SLC35E2	-5.469	6.96e-08	-0.070646	120	0.012917	yes	SKNS
chr1_1926870_T_C_b38	SLC35E2	-5.423	8.91e-08	-0.070261	107	0.012957	yes	SKNS
chr1_1936077_C_T_b38	SLC35E2	-5.409	9.56e-08	-0.070295	121	0.012995	yes	SKNS
chr1_1937841_ACACCAGGTCCACCTCTGGACACAGGTCCACC_A_b38	SLC35E2	-5.409	9.58e-08	-0.070213	118	0.012981	yes	SKNS
chr1_1938054_ACT_A_b38	SLC35E2	-5.409	9.58e-08	-0.070213	118	0.012981	yes	SKNS
chr1_1744121_A_C_b38	SLC35E2	-5.396	1.02e-07	-0.098282	66	0.018213	yes	SKNS
chr1_1942260_G_C_b38	SLC35E2	-5.377	1.13e-07	-0.069744	119	0.01297	yes	SKNS
chr1_1942014_G_A_b38	SLC35E2	-5.371	1.17e-07	-0.06984	117	0.013003	yes	SKNS
chr1_1942075_A_G_b38	SLC35E2	-5.371	1.17e-07	-0.06984	117	0.013003	yes	SKNS
chr1_1942086_T_C_b38	SLC35E2	-5.371	1.17e-07	-0.06984	117	0.013003	yes	SKNS
chr1_1942258_G_A_b38	SLC35E2	-5.365	1.21e-07	-0.069646	118	0.012981	yes	SKNS
chr1_1934565_G_A_b38	SLC35E2	-5.321	1.52e-07	-0.070751	118	0.013298	yes	SKNS
chr1_1937273_T_C_b38	SLC35E2	-5.285	1.84e-07	-0.069356	112	0.013124	yes	SKNS
chr1_1762759_AAATG_A_b38	SLC35E2	5.212	2.67e-07	0.06799	120	0.013045	yes	SKNS
chr1_1798925_C_CT_b38	SLC35E2	-5.21	2.7e-07	-0.075942	45	0.014577	yes	SKNS
chr1_1960609_G_C_b38	SLC35E2	-5.208	2.73e-07	-0.066428	110	0.012755	yes	SKNS
chr1_1769969_CAAAACA_C_b38	SLC35E2	5.205	2.77e-07	0.066234	111	0.012724	yes	SKNS
chr1_1936627_C_G_b38	SLC35E2	-5.203	2.8e-07	-0.068817	111	0.013226	yes	SKNS
chr1_1764887_C_A_b38	SLC35E2	-5.203	2.81e-07	-0.071647	121	0.013771	yes	SKNS
chr1_1660683_C_T_b38	SLC35E2	-5.192	2.96e-07	-0.074591	45	0.014366	yes	SKNS
chr1_1773848_A_C_b38	SLC35E2	-5.177	3.2e-07	-0.071217	122	0.013757	yes	SKNS
chr1_1776461_GAAAC_G_b38	SLC35E2	-5.177	3.2e-07	-0.071217	122	0.013757	yes	SKNS
chr1_1777362_A_G_b38	SLC35E2	-5.177	3.2e-07	-0.071217	122	0.013757	yes	SKNS
chr1_1790040_C_T_b38	SLC35E2	-5.177	3.2e-07	-0.071217	122	0.013757	yes	SKNS
chr1_1938332_A_ACT_b38	SLC35E2	-5.176	3.22e-07	-0.067059	121	0.012956	yes	SKNS
chr1_1773460_G_A_b38	SLC35E2	-5.171	3.29e-07	-0.070906	122	0.013711	yes	SKNS
chr1_1773476_C_G_b38	SLC35E2	-5.171	3.29e-07	-0.070906	122	0.013711	yes	SKNS
chr1_1791493_C_T_b38	SLC35E2	-5.169	3.33e-07	-0.071328	121	0.013799	yes	SKNS
chr1_1791592_G_A_b38	SLC35E2	-5.169	3.33e-07	-0.071328	121	0.013799	yes	SKNS
chr1_1792927_G_A_b38	SLC35E2	-5.169	3.33e-07	-0.071328	121	0.013799	yes	SKNS
chr1_1750508_A_C_b38	SLC35E2	-5.161	3.47e-07	-0.060783	123	0.011777	yes	SKNS
chr1_1904424_A_AAAATAAATAAAT_b38	SLC35E2	5.154	3.59e-07	0.063965	98	0.01241	yes	SKNS
chr1_1831318_C_T_b38	SLC35E2	-5.152	3.64e-07	-0.071285	120	0.013837	yes	SKNS
chr1_1935938_T_C_b38	SLC35E2	-5.149	3.68e-07	-0.068083	99	0.013222	yes	SKNS
chr1_1648736_G_A_b38	SLC35E2	5.148	3.7e-07	0.066194	122	0.012857	yes	SKNS
chr1_1933087_C_T_b38	SLC35E2	-5.148	3.71e-07	-0.06749	113	0.01311	yes	SKNS
chr1_1933859_A_G_b38	SLC35E2	-5.148	3.71e-07	-0.06749	113	0.01311	yes	SKNS
chr1_1771864_G_A_b38	SLC35E2	-5.123	4.2e-07	-0.070242	123	0.01371	yes	SKNS
chr1_1772410_T_C_b38	SLC35E2	-5.123	4.2e-07	-0.070242	123	0.01371	yes	SKNS
chr1_1772426_T_A_b38	SLC35E2	-5.123	4.2e-07	-0.070242	123	0.01371	yes	SKNS
chr1_1916417_G_T_b38	SLC35E2	-5.117	4.34e-07	-0.068168	118	0.013322	yes	SKNS
chr1_1797530_C_A_b38	SLC35E2	-5.116	4.36e-07	-0.06991	122	0.013665	yes	SKNS
chr1_1808816_G_T_b38	SLC35E2	-5.113	4.43e-07	-0.070477	122	0.013784	yes	SKNS
chr1_1817295_T_C_b38	SLC35E2	-5.113	4.43e-07	-0.070477	122	0.013784	yes	SKNS
chr1_1819825_G_A_b38	SLC35E2	-5.113	4.43e-07	-0.070477	122	0.013784	yes	SKNS
chr1_1827774_A_G_b38	SLC35E2	-5.113	4.43e-07	-0.070477	122	0.013784	yes	SKNS
chr1_1914634_G_T_b38	SLC35E2	-5.111	4.46e-07	-0.067589	118	0.013223	yes	SKNS
chr1_1916670_G_C_b38	SLC35E2	-5.111	4.46e-07	-0.067589	118	0.013223	yes	SKNS
chr1_1922670_A_G_b38	SLC35E2	-5.087	5.04e-07	-0.066987	114	0.013167	yes	SKNS
chr1_1649932_C_T_b38	SLC35E2	5.084	5.11e-07	0.064176	126	0.012622	yes	SKNS
chr1_1836126_C_A_b38	SLC35E2	-5.081	5.2e-07	-0.067733	126	0.01333	yes	SKNS
chr1_1770997_G_A_b38	SLC35E2	-5.07	5.48e-07	-0.068122	125	0.013435	yes	SKNS
chr1_1928648_C_T_b38	SLC35E2	-5.046	6.21e-07	-0.066366	114	0.013153	yes	SKNS
chr1_1651653_C_T_b38	SLC35E2	5.04	6.37e-07	0.063472	139	0.012593	yes	SKNS
chr1_1762287_A_G_b38	SLC35E2	-5.012	7.33e-07	-0.069518	125	0.01387	yes	SKNS
chr1_1931587_A_G_b38	SLC35E2	-4.978	8.68e-07	-0.06543	116	0.013144	yes	SKNS
chr1_1921745_T_C_b38	SLC35E2	-4.951	9.9e-07	-0.064889	114	0.013105	yes	SKNS
chr1_1769969_CAAAACAAAAACA_C_b38	SLC35E2	-4.939	1.05e-06	-0.067157	127	0.013597	yes	SKNS
chr1_1931580_CA_C_b38	SLC35E2	-4.918	1.16e-06	-0.064903	115	0.013196	yes	SKNS
chr1_1881249_A_G_b38	SLC35E2	-4.898	1.29e-06	-0.067454	123	0.013772	yes	SKNS
chr1_1846009_AGG_A_b38	SLC35E2	-4.886	1.36e-06	-0.0672	125	0.013753	yes	SKNS
chr1_1846011_G_GTCC_b38	SLC35E2	-4.886	1.36e-06	-0.0672	125	0.013753	yes	SKNS
chr1_1766653_A_G_b38	SLC35E2	-4.885	1.37e-06	-0.067125	122	0.01374	yes	SKNS
chr1_1860718_A_C_b38	SLC35E2	-4.882	1.39e-06	-0.066929	128	0.013709	yes	SKNS
chr1_1843381_A_T_b38	SLC35E2	-4.875	1.44e-06	-0.067266	122	0.013798	yes	SKNS
chr1_1847030_A_G_b38	SLC35E2	-4.875	1.44e-06	-0.067266	122	0.013798	yes	SKNS
chr1_1850017_G_T_b38	SLC35E2	-4.875	1.44e-06	-0.067266	122	0.013798	yes	SKNS
chr1_1866508_A_G_b38	SLC35E2	-4.872	1.46e-06	-0.066986	124	0.01375	yes	SKNS
chr1_1879567_T_C_b38	SLC35E2	-4.872	1.46e-06	-0.066986	124	0.01375	yes	SKNS
chr1_1886800_G_A_b38	SLC35E2	-4.872	1.46e-06	-0.066986	124	0.01375	yes	SKNS
chr1_1891654_C_CAGAG_b38	SLC35E2	-4.872	1.46e-06	-0.066986	124	0.01375	yes	SKNS
chr1_1944182_G_C_b38	SLC35E2	-4.832	1.77e-06	-0.065822	123	0.013621	yes	SKNS
chr1_1946058_T_C_b38	SLC35E2	-4.815	1.92e-06	-0.06572	123	0.01365	yes	SKNS
chr1_1918989_A_G_b38	SLC35E2	-4.805	2.02e-06	-0.063327	117	0.013181	yes	SKNS
chr1_1881428_C_CT_b38	SLC35E2	-4.785	2.22e-06	-0.066677	118	0.013935	yes	SKNS
chr1_1750528_G_A_b38	SLC35E2	-4.783	2.24e-06	-0.057032	119	0.011924	yes	SKNS
chr1_1881082_C_T_b38	SLC35E2	-4.771	2.37e-06	-0.065556	123	0.013742	yes	SKNS
chr1_1944675_C_T_b38	SLC35E2	-4.769	2.4e-06	-0.064895	124	0.013609	yes	SKNS
chr1_1944074_T_C_b38	SLC35E2	-4.759	2.5e-06	-0.065214	122	0.013702	yes	SKNS
chr1_1944091_G_C_b38	SLC35E2	-4.759	2.5e-06	-0.065214	122	0.013702	yes	SKNS
chr1_1946013_C_T_b38	SLC35E2	-4.757	2.53e-06	-0.065329	121	0.013733	yes	SKNS
chr1_1722619_C_T_b38	SLC35E2	4.743	2.71e-06	0.077594	57	0.016361	yes	SKNS
chr1_1945975_TG_T_b38	SLC35E2	-4.73	2.88e-06	-0.064794	123	0.0137	yes	SKNS
chr1_1864334_AAAG_A_b38	SLC35E2	-4.725	2.94e-06	-0.074617	39	0.01579	yes	SKNS
chr1_1717604_CGCTTTCAGCTAGAGTTTGCTCTCTCTGGTTTTCGGTCTGTGACACACGCAT_C_b38	SLC35E2	4.711	3.14e-06	0.059303	109	0.012587	yes	SKNS
chr1_1946632_C_T_b38	SLC35E2	-4.705	3.23e-06	-0.064153	124	0.013634	yes	SKNS
chr1_1722625_A_T_b38	SLC35E2	4.698	3.35e-06	0.076939	54	0.016377	yes	SKNS
chr1_1947189_C_T_b38	SLC35E2	-4.696	3.37e-06	-0.064048	124	0.013638	yes	SKNS
chr1_1945121_T_C_b38	SLC35E2	-4.691	3.45e-06	-0.064048	124	0.013653	yes	SKNS
chr1_1947645_C_T_b38	SLC35E2	-4.677	3.69e-06	-0.064506	118	0.013791	yes	SKNS
chr1_1950071_C_T_b38	SLC35E2	-4.645	4.3e-06	-0.06352	120	0.013676	yes	SKNS
chr1_1952064_G_A_b38	SLC35E2	-4.645	4.3e-06	-0.06352	120	0.013676	yes	SKNS
chr1_1670423_AT_A_b38	SLC35E2	4.64	4.39e-06	0.070022	66	0.015092	yes	SKNS
chr1_1722626_AGCG_A_b38	SLC35E2	4.633	4.54e-06	0.075742	54	0.01635	yes	SKNS
chr1_1938125_TCA_T_b38	SLC35E2	-4.62	4.82e-06	-0.062497	121	0.013529	yes	SKNS
chr1_1586962_C_T_b38	SLC35E2	4.617	4.89e-06	0.063878	70	0.013836	yes	SKNS
chr1_1952823_TA_T_b38	SLC35E2	-4.616	4.92e-06	-0.063103	120	0.013672	yes	SKNS
chr1_1671097_G_C_b38	SLC35E2	4.615	4.92e-06	0.060859	72	0.013187	yes	SKNS
chr1_1951865_G_GT_b38	SLC35E2	-4.614	4.96e-06	-0.063038	122	0.013663	yes	SKNS
chr1_1739131_T_C_b38	SLC35E2	4.613	4.97e-06	0.059009	111	0.012792	yes	SKNS
chr1_1901262_C_T_b38	SLC35E2	-4.609	5.06e-06	-0.064217	121	0.013932	yes	SKNS
chr1_1901386_C_A_b38	SLC35E2	-4.609	5.06e-06	-0.064217	121	0.013932	yes	SKNS
chr1_1944420_A_G_b38	SLC35E2	-4.608	5.1e-06	-0.062674	125	0.013602	yes	SKNS
chr1_1951106_G_A_b38	SLC35E2	-4.601	5.27e-06	-0.062823	122	0.013655	yes	SKNS
chr1_1650195_A_G_b38	SLC35E2	-4.6	5.29e-06	-0.06253	69	0.013594	yes	SKNS
chr1_1944419_C_G_b38	SLC35E2	-4.598	5.33e-06	-0.062619	125	0.013618	yes	SKNS
chr1_1877330_T_C_b38	SLC35E2	-4.577	5.88e-06	-0.063351	102	0.013842	yes	SKNS
chr1_1899573_C_T_b38	SLC35E2	-4.575	5.92e-06	-0.063856	120	0.013957	yes	SKNS
chr1_1671148_C_T_b38	SLC35E2	4.573	5.97e-06	0.060386	71	0.013204	yes	SKNS
chr1_1589495_CTTT_C_b38	SLC35E2	4.567	6.14e-06	0.066936	47	0.014655	yes	SKNS
chr1_1944216_C_T_b38	SLC35E2	-4.567	6.16e-06	-0.063388	119	0.013881	yes	SKNS
chr1_1708521_C_G_b38	SLC35E2	-4.556	6.47e-06	-0.069659	41	0.01529	yes	SKNS
chr1_1722690_TA_T_b38	SLC35E2	-4.549	6.67e-06	-0.093232	4	0.020495	yes	SKNS
chr1_1880596_T_A_b38	SLC35E2	-4.546	6.78e-06	-0.063617	108	0.013995	yes	SKNS
chr1_1902439_C_T_b38	SLC35E2	-4.54	6.97e-06	-0.063421	120	0.013971	yes	SKNS
chr1_1661420_C_A_b38	SLC35E2	-4.524	7.48e-06	-0.060391	69	0.013348	yes	SKNS
chr1_1659114_A_G_b38	SLC35E2	-4.522	7.55e-06	-0.060384	69	0.013353	yes	SKNS
chr1_1659220_A_G_b38	SLC35E2	-4.522	7.55e-06	-0.060384	69	0.013353	yes	SKNS
chr1_2206830_C_CA_b38	SLC35E2	-4.518	7.68e-06	-0.1628	4	0.036032	yes	SKNS
chr1_1658866_G_A_b38	SLC35E2	-4.515	7.79e-06	-0.060049	70	0.013299	yes	SKNS
chr1_1902481_G_A_b38	SLC35E2	-4.513	7.86e-06	-0.062935	119	0.013944	yes	SKNS
chr1_1736729_G_T_b38	SLC35E2	4.502	8.26e-06	0.056417	163	0.012531	yes	SKNS
chr1_1708474_C_A_b38	SLC35E2	-4.483	9.03e-06	-0.075861	23	0.016923	yes	SKNS
chr1_1937895_C_T_b38	SLC35E2	-4.468	9.63e-06	-0.060671	123	0.013578	yes	SKNS
chr1_1948919_T_TCCTTCCCTCCTCTTTCCCTCCCTTCTTTCCTTCCCTTTCCCTCCCTC_b38	SLC35E2	-4.467	9.69e-06	-0.052611	114	0.011778	yes	SKNS
chr1_1740343_C_T_b38	SLC35E2	4.457	1.01e-05	0.055869	163	0.012535	yes	SKNS
chr1_1942887_C_G_b38	SLC35E2	-4.456	1.02e-05	-0.060469	124	0.013571	yes	SKNS
chr1_1905586_C_T_b38	SLC35E2	-4.455	1.02e-05	-0.062302	119	0.013984	yes	SKNS
chr1_1661562_G_C_b38	SLC35E2	4.453	1.03e-05	0.050856	139	0.011419	yes	SKNS
chr1_1921333_C_T_b38	SLC35E2	-4.453	1.03e-05	-0.061398	123	0.013787	yes	SKNS
chr1_1743544_CA_C_b38	SLC35E2	4.426	1.16e-05	0.055153	127	0.01246	yes	SKNS
chr1_1735176_C_T_b38	SLC35E2	4.424	1.17e-05	0.055456	163	0.012534	yes	SKNS
chr1_1909234_G_A_b38	SLC35E2	-4.424	1.17e-05	-0.061754	122	0.013959	yes	SKNS
chr1_1837255_A_AT_b38	SLC35E2	4.419	1.2e-05	0.075273	20	0.017032	yes	SKNS
chr1_1668108_C_T_b38	SLC35E2	4.414	1.23e-05	0.059379	64	0.013452	yes	SKNS
chr1_1937802_G_T_b38	SLC35E2	-4.407	1.27e-05	-0.061592	119	0.013976	yes	SKNS
chr1_1875208_T_C_b38	SLC35E2	-4.403	1.29e-05	-0.060686	124	0.013784	yes	SKNS
chr1_1936906_C_CA_b38	SLC35E2	-4.39	1.37e-05	-0.064571	66	0.01471	yes	SKNS
chr1_1909238_G_A_b38	SLC35E2	-4.384	1.4e-05	-0.061021	123	0.013919	yes	SKNS
chr1_1731963_A_C_b38	SLC35E2	4.382	1.42e-05	0.054842	164	0.012515	yes	SKNS
chr1_1664865_A_G_b38	SLC35E2	-4.378	1.44e-05	-0.058909	65	0.013456	yes	SKNS
chr1_1976566_T_C_b38	SLC35E2	4.369	1.5e-05	0.057296	117	0.013116	yes	SKNS
chr1_1912607_C_T_b38	SLC35E2	-4.36	1.56e-05	-0.060548	115	0.013886	yes	SKNS
chr1_1913643_T_C_b38	SLC35E2	-4.36	1.56e-05	-0.061685	112	0.014149	yes	SKNS
chr1_1695459_A_G_b38	SLC35E2	4.347	1.65e-05	0.067429	102	0.015512	yes	SKNS
chr1_1636278_G_T_b38	SLC35E2	4.329	1.79e-05	0.057324	105	0.013241	yes	SKNS
chr1_1732392_C_T_b38	SLC35E2	4.306	1.98e-05	0.053955	164	0.01253	yes	SKNS
chr1_1734903_A_G_b38	SLC35E2	4.306	1.98e-05	0.053955	164	0.01253	yes	SKNS
chr1_1735980_A_C_b38	SLC35E2	4.306	1.98e-05	0.053955	164	0.01253	yes	SKNS
chr1_1729859_A_G_b38	SLC35E2	4.301	2.02e-05	0.069154	24	0.016077	yes	SKNS
chr1_1737504_A_C_b38	SLC35E2	4.291	2.11e-05	0.053336	169	0.01243	yes	SKNS
chr1_1734174_A_G_b38	SLC35E2	4.286	2.15e-05	0.053618	164	0.012509	yes	SKNS
chr1_1740703_C_T_b38	SLC35E2	4.286	2.16e-05	0.053742	164	0.012539	yes	SKNS
chr1_1738295_G_T_b38	SLC35E2	4.248	2.54e-05	0.053592	161	0.012615	yes	SKNS
chr1_1967499_G_A_b38	SLC35E2	4.246	2.56e-05	0.055677	107	0.013111	yes	SKNS
chr1_1916217_C_T_b38	SLC35E2	-4.245	2.57e-05	-0.059163	121	0.013936	yes	SKNS
chr1_1963533_C_CA_b38	SLC35E2	4.238	2.66e-05	0.055975	110	0.013208	yes	SKNS
chr1_1654662_CT_C_b38	SLC35E2	4.236	2.69e-05	0.060097	95	0.014189	yes	SKNS
chr1_1948938_C_T_b38	SLC35E2	-4.228	2.77e-05	-0.049848	114	0.01179	yes	SKNS
chr1_1646352_A_C_b38	SLC35E2	4.225	2.81e-05	0.07753	13	0.018349	yes	SKNS
chr1_1918090_A_G_b38	SLC35E2	-4.223	2.83e-05	-0.05902	119	0.013976	yes	SKNS
chr1_1915326_G_A_b38	SLC35E2	-4.215	2.94e-05	-0.058859	121	0.013965	yes	SKNS
chr1_1750589_G_A_b38	SLC35E2	-4.214	2.94e-05	-0.088603	18	0.021025	yes	SKNS
chr1_1929904_C_T_b38	SLC35E2	-4.214	2.95e-05	-0.058489	122	0.013881	yes	SKNS
chr1_1688442_T_C_b38	SLC35E2	-4.212	2.98e-05	-0.064049	47	0.015208	yes	SKNS
chr1_1925281_C_T_b38	SLC35E2	-4.199	3.14e-05	-0.058484	121	0.013927	yes	SKNS
chr1_1968793_T_C_b38	SLC35E2	4.197	3.17e-05	0.055281	110	0.013171	yes	SKNS
chr1_1914345_C_T_b38	SLC35E2	-4.195	3.2e-05	-0.058649	120	0.013982	yes	SKNS
chr1_1914918_G_A_b38	SLC35E2	-4.195	3.2e-05	-0.058649	120	0.013982	yes	SKNS
chr1_1948519_T_C_b38	SLC35E2	-4.189	3.28e-05	-0.05572	133	0.013303	yes	SKNS
chr1_1948515_C_T_b38	SLC35E2	-4.187	3.3e-05	-0.055741	133	0.013312	yes	SKNS
chr1_1935987_G_A_b38	SLC35E2	-4.182	3.37e-05	-0.057024	126	0.013635	yes	SKNS
chr1_1728671_C_A_b38	SLC35E2	4.177	3.45e-05	0.06933	26	0.016599	yes	SKNS
chr1_1963538_T_C_b38	SLC35E2	4.171	3.53e-05	0.054902	106	0.013161	yes	SKNS
chr1_1658830_C_G_b38	SLC35E2	-4.171	3.54e-05	-0.061951	35	0.014854	yes	SKNS
chr1_1927857_T_C_b38	SLC35E2	-4.165	3.62e-05	-0.057904	122	0.013901	yes	SKNS
chr1_1951642_C_T_b38	SLC35E2	4.149	3.88e-05	0.059717	44	0.014392	yes	SKNS
chr1_1930143_C_T_b38	SLC35E2	-4.147	3.92e-05	-0.057743	122	0.013925	yes	SKNS
chr1_1968103_A_ATGAG_b38	SLC35E2	4.134	4.14e-05	0.060658	39	0.014672	yes	SKNS
chr1_1951498_C_T_b38	SLC35E2	4.132	4.17e-05	0.059446	44	0.014386	yes	SKNS
chr1_1920695_A_G_b38	SLC35E2	-4.125	4.3e-05	-0.057441	122	0.013924	yes	SKNS
chr1_1925233_T_C_b38	SLC35E2	-4.124	4.31e-05	-0.057424	122	0.013924	yes	SKNS
chr1_1736836_A_G_b38	SLC35E2	4.116	4.47e-05	0.052938	151	0.012862	yes	SKNS
chr1_1876492_C_CGA_b38	SLC35E2	4.107	4.64e-05	0.076009	6	0.018507	yes	SKNS
chr1_1924788_C_T_b38	SLC35E2	-4.096	4.85e-05	-0.057013	123	0.013918	yes	SKNS
chr1_1600379_C_T_b38	SLC35E2	4.086	5.07e-05	0.054395	64	0.013313	yes	SKNS
chr1_1955420_C_T_b38	SLC35E2	4.072	5.37e-05	0.05952	39	0.014617	yes	SKNS
chr1_1814797_CAAAAAAAAA_C_b38	SLC35E2	4.063	5.58e-05	0.077177	6	0.018996	yes	SKNS
chr1_1968012_GTGAA_G_b38	SLC35E2	4.061	5.63e-05	0.059297	40	0.014603	yes	SKNS
chr1_1649976_G_A_b38	SLC35E2	4.053	5.81e-05	0.053527	100	0.013207	yes	SKNS
chr1_1971864_C_T_b38	SLC35E2	4.047	5.96e-05	0.053042	106	0.013107	yes	SKNS
chr1_1679100_A_G_b38	SLC35E2	-4.046	5.98e-05	-0.051946	107	0.012838	yes	SKNS
chr1_1667948_A_G_b38	SLC35E2	-4.038	6.18e-05	-0.061538	34	0.015239	yes	SKNS
chr1_1612562_T_TC_b38	SLC35E2	4.036	6.23e-05	0.05254	70	0.013018	yes	SKNS
chr1_1668542_C_T_b38	SLC35E2	-4.036	6.24e-05	-0.061896	31	0.015337	yes	SKNS
chr1_1891450_G_C_b38	SLC35E2	-4.03	6.39e-05	-0.056342	116	0.013981	yes	SKNS
chr1_1667424_T_TAAAATA_b38	SLC35E2	4.029	6.4e-05	0.052841	82	0.013114	yes	SKNS
chr1_1968900_A_G_b38	SLC35E2	4.029	6.43e-05	0.059259	40	0.01471	yes	SKNS
chr1_1650777_G_A_b38	SLC35E2	-4.019	6.69e-05	-0.05446	66	0.013551	yes	SKNS
chr1_1967980_A_AAGAATGAG_b38	SLC35E2	4.017	6.73e-05	0.059658	37	0.014851	yes	SKNS
chr1_1746439_GA_G_b38	SLC35E2	4.017	6.74e-05	0.058908	99	0.014665	yes	SKNS
chr1_1919188_CAGCGGCAGG_C_b38	SLC35E2	-4.014	6.82e-05	-0.055163	120	0.013742	yes	SKNS
chr1_1606507_GTGGGC_G_b38	SLC35E2	4.013	6.85e-05	0.052007	147	0.01296	yes	SKNS
chr1_1651137_C_T_b38	SLC35E2	-4.004	7.1e-05	-0.054334	66	0.013569	yes	SKNS
chr1_1651267_T_C_b38	SLC35E2	-4.004	7.1e-05	-0.054334	66	0.013569	yes	SKNS
chr1_1651574_G_A_b38	SLC35E2	-4.004	7.1e-05	-0.054334	66	0.013569	yes	SKNS
chr1_1652061_T_C_b38	SLC35E2	-4.004	7.1e-05	-0.054334	66	0.013569	yes	SKNS
chr1_1652135_C_G_b38	SLC35E2	-4.004	7.1e-05	-0.054334	66	0.013569	yes	SKNS
chr1_1652191_C_T_b38	SLC35E2	-4.004	7.1e-05	-0.054334	66	0.013569	yes	SKNS
chr1_1652592_A_G_b38	SLC35E2	-4.004	7.1e-05	-0.054334	66	0.013569	yes	SKNS
chr1_1652779_A_G_b38	SLC35E2	-4.004	7.1e-05	-0.054334	66	0.013569	yes	SKNS
chr1_1653147_A_C_b38	SLC35E2	-4.004	7.1e-05	-0.054334	66	0.013569	yes	SKNS
chr1_1653396_T_C_b38	SLC35E2	-4.004	7.1e-05	-0.054334	66	0.013569	yes	SKNS
chr1_1653472_T_C_b38	SLC35E2	-4.004	7.1e-05	-0.054334	66	0.013569	yes	SKNS
chr1_1653811_G_A_b38	SLC35E2	-4.004	7.1e-05	-0.054334	66	0.013569	yes	SKNS
chr1_1653893_C_T_b38	SLC35E2	-4.004	7.1e-05	-0.054334	66	0.013569	yes	SKNS
chr1_1654143_G_A_b38	SLC35E2	-4.004	7.1e-05	-0.054334	66	0.013569	yes	SKNS
chr1_1654188_T_G_b38	SLC35E2	-4.004	7.1e-05	-0.054334	66	0.013569	yes	SKNS
chr1_1963406_G_A_b38	SLC35E2	3.997	7.33e-05	0.059044	38	0.014774	yes	SKNS
chr1_1891444_CG_C_b38	SLC35E2	-3.996	7.35e-05	-0.055743	115	0.01395	yes	SKNS
chr1_1649993_A_G_b38	SLC35E2	-3.996	7.35e-05	-0.050364	142	0.012604	yes	SKNS
chr1_1924269_C_T_b38	SLC35E2	-3.994	7.42e-05	-0.050959	135	0.01276	yes	SKNS
chr1_1600320_C_G_b38	SLC35E2	3.986	7.64e-05	0.053251	62	0.013358	yes	SKNS
chr1_1665061_C_T_b38	SLC35E2	-3.986	7.66e-05	-0.059797	35	0.015003	yes	SKNS
chr1_1639348_G_T_b38	SLC35E2	-3.981	7.82e-05	-0.052018	81	0.013068	yes	SKNS
chr1_1621352_G_A_b38	SLC35E2	3.978	7.9e-05	0.052137	73	0.013105	yes	SKNS
chr1_1969006_C_T_b38	SLC35E2	3.978	7.92e-05	0.057533	42	0.014464	yes	SKNS
chr1_1653934_G_A_b38	SLC35E2	-3.974	8.05e-05	-0.053956	66	0.013578	yes	SKNS
chr1_1963738_C_T_b38	SLC35E2	3.965	8.35e-05	0.0586	38	0.014781	yes	SKNS
chr1_1965114_C_T_b38	SLC35E2	3.965	8.35e-05	0.0586	38	0.014781	yes	SKNS
chr1_1966910_C_T_b38	SLC35E2	3.965	8.35e-05	0.0586	38	0.014781	yes	SKNS
chr1_1925307_C_A_b38	SLC35E2	-3.963	8.42e-05	-0.055802	114	0.014082	yes	SKNS
chr1_1981144_T_G_b38	SLC35E2	3.952	8.8e-05	0.060231	40	0.015242	yes	SKNS
chr1_1968924_GCCCTCCTGGGGGCTCCGGTCCTGCCCAGCAGCCCCAGGTGAGACAGCGCCTGGCGGCCCCTCCCTAGCT_G_b38	SLC35E2	3.951	8.81e-05	0.057189	42	0.014473	yes	SKNS
chr1_1675091_A_G_b38	SLC35E2	-3.95	8.86e-05	-0.059255	36	0.015001	yes	SKNS
chr1_1964101_A_G_b38	SLC35E2	3.947	8.97e-05	0.058012	39	0.014698	yes	SKNS
chr1_1964746_T_C_b38	SLC35E2	3.947	8.97e-05	0.058012	39	0.014698	yes	SKNS
chr1_1964784_C_T_b38	SLC35E2	3.947	8.97e-05	0.058012	39	0.014698	yes	SKNS
chr1_1966030_A_G_b38	SLC35E2	3.947	8.97e-05	0.058012	39	0.014698	yes	SKNS
chr1_1966314_C_G_b38	SLC35E2	3.947	8.97e-05	0.058012	39	0.014698	yes	SKNS
chr1_1966930_G_A_b38	SLC35E2	3.947	8.97e-05	0.058012	39	0.014698	yes	SKNS
chr1_1967246_T_C_b38	SLC35E2	3.947	8.97e-05	0.058012	39	0.014698	yes	SKNS
chr1_1967338_G_C_b38	SLC35E2	3.947	8.97e-05	0.058012	39	0.014698	yes	SKNS
chr1_1967340_C_A_b38	SLC35E2	3.947	8.97e-05	0.058012	39	0.014698	yes	SKNS
chr1_1967389_T_C_b38	SLC35E2	3.947	8.97e-05	0.058012	39	0.014698	yes	SKNS
chr1_1967396_C_A_b38	SLC35E2	3.947	8.97e-05	0.058012	39	0.014698	yes	SKNS
chr1_1967420_G_A_b38	SLC35E2	3.947	8.97e-05	0.058012	39	0.014698	yes	SKNS
chr1_1967495_T_C_b38	SLC35E2	3.947	8.97e-05	0.058012	39	0.014698	yes	SKNS
chr1_1967536_G_A_b38	SLC35E2	3.947	8.97e-05	0.058012	39	0.014698	yes	SKNS
chr1_1967725_G_C_b38	SLC35E2	3.947	8.97e-05	0.058012	39	0.014698	yes	SKNS
chr1_1967840_A_T_b38	SLC35E2	3.947	8.97e-05	0.058012	39	0.014698	yes	SKNS
chr1_1967880_T_C_b38	SLC35E2	3.947	8.97e-05	0.058012	39	0.014698	yes	SKNS
chr1_1968422_C_T_b38	SLC35E2	3.947	8.97e-05	0.058012	39	0.014698	yes	SKNS
chr1_1964663_G_A_b38	SLC35E2	3.938	9.29e-05	0.058231	38	0.014785	yes	SKNS
chr1_1668721_C_T_b38	SLC35E2	-3.93	9.61e-05	-0.056125	46	0.014282	yes	SKNS
chr1_1968585_TG_T_b38	SLC35E2	3.929	9.65e-05	0.057724	39	0.014691	yes	SKNS
chr1_1688619_AAAC_A_b38	SLC35E2	-3.917	0.000101	-0.062688	42	0.016004	yes	SKNS
chr1_1968130_GTGAA_G_b38	SLC35E2	3.911	0.000104	0.057736	38	0.014761	yes	SKNS
chr1_1968667_T_TCTC_b38	SLC35E2	3.91	0.000104	0.057351	39	0.014666	yes	SKNS
chr1_1664757_T_C_b38	SLC35E2	-3.907	0.000105	-0.051753	64	0.013246	yes	SKNS
chr1_1950071_C_A_b38	SLC35E2	3.901	0.000108	0.055571	46	0.014244	yes	SKNS
chr1_1865177_G_A_b38	SLC35E2	-3.897	0.00011	-0.059419	33	0.015247	yes	SKNS
chr1_1924264_CCG_C_b38	SLC35E2	-3.894	0.000111	-0.050116	134	0.01287	yes	SKNS
chr1_1965250_G_GA_b38	SLC35E2	3.889	0.000113	0.05678	42	0.014599	yes	SKNS
chr1_1668717_C_G_b38	SLC35E2	-3.887	0.000114	-0.059167	34	0.015222	yes	SKNS
chr1_1651926_T_C_b38	SLC35E2	-3.886	0.000115	-0.052993	66	0.013636	yes	SKNS
chr1_1661177_A_G_b38	SLC35E2	-3.884	0.000116	-0.058352	35	0.015025	yes	SKNS
chr1_1966152_C_T_b38	SLC35E2	3.874	0.00012	0.057349	38	0.014804	yes	SKNS
chr1_1669613_G_A_b38	SLC35E2	-3.863	0.000126	-0.058918	34	0.015252	yes	SKNS
chr1_1966606_G_A_b38	SLC35E2	3.855	0.00013	0.057315	37	0.014867	yes	SKNS
chr1_1651421_GTAGCCCCTCTGAACGGTCTGTGACACACGCATGCTTTCAGCTAGAGTACTCTA_G_b38	SLC35E2	-3.839	0.000138	-0.052685	63	0.013723	yes	SKNS
chr1_1965001_G_A_b38	SLC35E2	3.836	0.00014	0.056188	41	0.014649	yes	SKNS
chr1_1658422_T_C_b38	SLC35E2	3.834	0.000141	0.062264	28	0.01624	yes	SKNS
chr1_1651785_C_A_b38	SLC35E2	-3.832	0.000142	-0.05209	66	0.013592	yes	SKNS
chr1_1956754_C_A_b38	SLC35E2	3.822	0.000148	0.055532	41	0.014528	yes	SKNS
chr1_1595028_C_CAG_b38	SLC35E2	3.811	0.000155	0.057303	39	0.015036	yes	SKNS
chr1_1659060_G_A_b38	SLC35E2	-3.788	0.000169	-0.053361	52	0.014088	yes	SKNS
chr1_1648826_A_G_b38	SLC35E2	-3.771	0.000181	-0.050911	76	0.013499	yes	SKNS
chr1_1962845_T_C_b38	SLC35E2	3.765	0.000185	0.055331	40	0.014695	yes	SKNS
chr1_1688586_C_T_b38	SLC35E2	-3.749	0.000197	-0.061714	38	0.016462	yes	SKNS
chr1_1609058_G_A_b38	SLC35E2	3.741	0.000203	0.049816	64	0.013316	yes	SKNS
chr1_1620609_G_A_b38	SLC35E2	3.731	0.000211	0.049061	70	0.01315	yes	SKNS
chr1_1688786_G_A_b38	SLC35E2	-3.73	0.000212	-0.065159	25	0.017467	yes	SKNS
chr1_1688570_A_T_b38	SLC35E2	-3.73	0.000212	-0.064986	22	0.017422	yes	SKNS
chr1_1898712_C_T_b38	SLC35E2	3.728	0.000214	0.066099	13	0.017731	yes	SKNS
chr1_1899188_T_A_b38	SLC35E2	3.728	0.000214	0.066099	13	0.017731	yes	SKNS
chr1_1955652_CG_C_b38	SLC35E2	3.709	0.00023	0.054381	39	0.014663	yes	SKNS
chr1_1792696_C_CA_b38	SLC35E2	3.704	0.000234	0.050695	71	0.013687	yes	SKNS
chr1_1904424_A_AAAATAAAT_b38	SLC35E2	-3.703	0.000235	-0.047206	124	0.012748	yes	SKNS
chr1_1607931_G_A_b38	SLC35E2	3.701	0.000237	0.04955	63	0.013389	yes	SKNS
chr1_1669576_G_A_b38	SLC35E2	-3.691	0.000246	-0.056834	33	0.015398	yes	SKNS
chr1_1622295_G_C_b38	SLC35E2	3.689	0.000248	0.048566	70	0.013165	yes	SKNS
chr1_1650383_G_T_b38	SLC35E2	-3.683	0.000254	-0.054489	48	0.014796	yes	SKNS
chr1_1947648_G_A_b38	SLC35E2	3.682	0.000255	0.055686	34	0.015125	yes	SKNS
chr1_1957014_G_A_b38	SLC35E2	3.674	0.000263	0.05169	50	0.014069	yes	SKNS
chr1_1957636_C_T_b38	SLC35E2	3.674	0.000263	0.05169	50	0.014069	yes	SKNS
chr1_1956891_C_T_b38	SLC35E2	3.67	0.000267	0.051753	50	0.014101	yes	SKNS
chr1_1707801_C_A_b38	SLC35E2	-3.663	0.000274	-0.167398	3	0.045698	yes	SKNS
chr1_1650000_G_A_b38	SLC35E2	3.658	0.00028	0.049507	80	0.013535	yes	SKNS
chr1_1883278_C_CA_b38	SLC35E2	3.644	0.000295	0.071427	9	0.019603	yes	SKNS
chr1_1725582_T_C_b38	SLC35E2	3.639	3e-04	0.043521	137	0.01196	yes	SKNS
chr1_1688531_T_C_b38	SLC35E2	-3.616	0.000327	-0.060405	34	0.016703	yes	SKNS
chr1_1955672_GC_G_b38	SLC35E2	3.613	0.000331	0.053008	39	0.01467	yes	SKNS
chr1_1968893_A_G_b38	SLC35E2	3.613	0.000332	0.054289	35	0.015028	yes	SKNS
chr1_1845824_TACACACACACACACACACACACACACACAC_T_b38	SLC35E2	3.604	0.000343	0.053028	44	0.014715	yes	SKNS
chr1_1734308_T_C_b38	SLC35E2	3.593	0.000357	0.069248	24	0.019271	yes	SKNS
chr1_1717507_T_C_b38	SLC35E2	3.576	0.00038	0.07377	21	0.020628	yes	SKNS
chr1_1675228_C_CG_b38	SLC35E2	3.576	0.00038	0.050141	95	0.014021	yes	SKNS
chr1_1637577_T_C_b38	SLC35E2	-3.569	0.00039	-0.050887	45	0.014256	yes	SKNS
chr1_1726904_T_C_b38	SLC35E2	3.566	0.000395	0.045383	138	0.012727	yes	SKNS
chr1_1591703_T_C_b38	SLC35E2	3.535	0.000444	0.044283	121	0.012528	yes	SKNS
chr1_1978429_G_A_b38	SLC35E2	3.518	0.000472	0.051271	45	0.014574	yes	SKNS
chr1_1983507_C_T_b38	SLC35E2	3.515	0.000476	0.051236	45	0.014575	yes	SKNS
chr1_1715541_A_C_b38	SLC35E2	3.512	0.000482	0.108397	4	0.030863	yes	SKNS
chr1_1714674_G_C_b38	SLC35E2	3.508	0.00049	0.06773	43	0.019309	yes	SKNS
chr1_1688647_G_A_b38	SLC35E2	-3.505	0.000495	-0.055408	45	0.015808	yes	SKNS
chr1_1648636_G_A_b38	SLC35E2	-3.495	0.000514	-0.047293	76	0.013533	yes	SKNS
chr1_1971434_C_T_b38	SLC35E2	3.485	0.000532	0.051336	42	0.014729	yes	SKNS
chr1_1921849_G_T_b38	SLC35E2	3.482	0.000539	0.050613	49	0.014536	yes	SKNS
chr1_1650664_CTTTTT_C_b38	SLC35E2	-3.482	0.000539	-0.052671	36	0.015128	yes	SKNS
chr1_1688457_G_A_b38	SLC35E2	-3.481	0.000541	-0.053473	53	0.015362	yes	SKNS
chr1_1742432_T_TA_b38	SLC35E2	3.473	0.000557	0.04732	94	0.013626	yes	SKNS
chr1_1676287_C_T_b38	SLC35E2	-3.462	0.00058	-0.057901	18	0.016726	yes	SKNS
chr1_1791389_G_A_b38	SLC35E2	3.456	0.000592	0.05372	31	0.015543	yes	SKNS
chr1_1877316_A_T_b38	SLC35E2	3.451	0.000603	0.046641	92	0.013516	yes	SKNS
chr1_1969235_A_G_b38	SLC35E2	3.438	0.000631	0.053075	30	0.015437	yes	SKNS
chr1_1708855_TTCCTCCTCC_T_b38	SLC35E2	3.435	0.00064	0.048652	106	0.014166	yes	SKNS
chr1_1945913_T_C_b38	SLC35E2	-3.431	0.000648	-0.058861	12	0.017156	yes	SKNS
chr1_1739519_C_G_b38	SLC35E2	3.423	0.000666	0.054384	46	0.015887	yes	SKNS
chr1_1639685_G_A_b38	SLC35E2	-3.404	0.000714	-0.050721	39	0.014901	yes	SKNS
chr1_1907199_A_G_b38	SLC35E2	3.396	0.000735	0.049639	41	0.014618	yes	SKNS
chr1_1971127_G_A_b38	SLC35E2	3.394	0.000739	0.050289	41	0.014815	yes	SKNS
chr1_1629332_G_T_b38	SLC35E2	3.391	0.000748	0.046836	67	0.013811	yes	SKNS
chr1_1942186_G_A_b38	SLC35E2	3.357	0.000844	0.050311	35	0.014987	yes	SKNS
chr1_1938493_C_CAT_b38	SLC35E2	-3.352	0.000859	-0.059263	11	0.017679	yes	SKNS
chr1_1939978_T_C_b38	SLC35E2	-3.352	0.000859	-0.059263	11	0.017679	yes	SKNS
chr1_1938771_G_A_b38	SLC35E2	-3.351	0.000861	-0.058802	11	0.017545	yes	SKNS
chr1_1606384_A_G_b38	SLC35E2	3.351	0.000863	0.044285	73	0.013217	yes	SKNS
chr1_2415084_G_C_b38	SLC35E2	3.34	0.000896	0.04821	43	0.014434	yes	SKNS
chr1_2415085_T_C_b38	SLC35E2	3.34	0.000896	0.04821	43	0.014434	yes	SKNS
chr1_1955806_G_A_b38	SLC35E2	3.336	0.000908	0.049395	37	0.014805	yes	SKNS
chr1_986336_C_A_b38	SLC35E2	-3.334	0.000917	-0.044856	161	0.013456	yes	SKNS
chr1_1878070_C_T_b38	SLC35E2	3.331	0.000924	0.048991	38	0.014706	yes	SKNS
chr1_1881006_GGA_G_b38	SLC35E2	3.331	0.000924	0.048991	38	0.014706	yes	SKNS
chr1_1888667_A_C_b38	SLC35E2	3.331	0.000924	0.048991	38	0.014706	yes	SKNS
chr1_1015925_A_ATT_b38	SLC35E2	3.327	0.000939	0.045096	71	0.013555	yes	SKNS
chr1_1952590_A_AAAAG_b38	SLC35E2	3.324	0.000948	0.04699	50	0.014137	yes	SKNS
chr1_1623412_T_C_b38	SLC35E2	3.318	0.000967	0.082224	3	0.024779	yes	SKNS
chr1_1653863_C_A_b38	SLC35E2	-3.316	0.000974	-0.054817	19	0.016529	yes	SKNS
chr1_1724543_G_C_b38	SLC35E2	-3.316	0.000976	-0.124465	8	0.037539	yes	SKNS
chr1_1864350_C_T_b38	SLC35E2	3.312	0.000988	0.04774	42	0.014413	yes	SKNS
chr1_1882449_A_AAG_b38	SLC35E2	3.305	0.00101	0.072388	8	0.021901	yes	SKNS
chr1_1971123_A_G_b38	SLC35E2	3.303	0.00102	0.048653	42	0.014732	yes	SKNS
chr1_1969249_A_AGCCCT_b38	SLC35E2	3.292	0.00106	0.051268	30	0.015573	yes	SKNS
chr1_1722599_G_A_b38	SLC35E2	3.244	0.00125	0.050624	79	0.015606	yes	SKNS
chr1_946653_G_A_b38	SLC35E2	3.244	0.00125	0.051354	29	0.015832	yes	SKNS
chr1_1943828_A_G_b38	SLC35E2	-3.232	0.00131	-0.057304	11	0.017731	yes	SKNS
chr1_1978114_T_A_b38	SLC35E2	3.218	0.00137	0.046212	56	0.014358	yes	SKNS
chr1_1969479_G_A_b38	SLC35E2	3.218	0.00137	0.04872	33	0.01514	yes	SKNS
chr1_1649846_G_A_b38	SLC35E2	-3.215	0.00138	-0.048514	33	0.015089	yes	SKNS
chr1_1652913_C_T_b38	SLC35E2	-3.21	0.00141	-0.046006	50	0.01433	yes	SKNS
chr1_1606532_GTGGGCTGGGCTGGTCAGGCA_G_b38	SLC35E2	3.208	0.00141	0.043944	54	0.013696	yes	SKNS
chr1_1943142_A_G_b38	SLC35E2	-3.208	0.00142	-0.056635	11	0.017653	yes	SKNS
chr1_1630798_C_T_b38	SLC35E2	3.205	0.00143	0.044315	64	0.013826	yes	SKNS
chr1_1026830_A_G_b38	SLC35E2	3.194	0.00149	0.042972	75	0.013454	yes	SKNS
chr1_1977879_G_A_b38	SLC35E2	3.193	0.00149	0.04556	57	0.014269	yes	SKNS
chr1_1978006_A_G_b38	SLC35E2	3.193	0.00149	0.04556	57	0.014269	yes	SKNS
chr1_1810086_A_G_b38	SLC35E2	3.189	0.00151	0.050486	29	0.015833	yes	SKNS
chr1_1976646_A_G_b38	SLC35E2	3.188	0.00151	0.045819	56	0.01437	yes	SKNS
chr1_1900918_G_A_b38	SLC35E2	3.188	0.00152	0.046604	40	0.01462	yes	SKNS
chr1_1674633_C_CA_b38	SLC35E2	3.187	0.00152	0.045027	64	0.014127	yes	SKNS
chr1_1903603_G_A_b38	SLC35E2	3.182	0.00155	0.046993	39	0.014769	yes	SKNS
chr1_1903617_C_T_b38	SLC35E2	3.182	0.00155	0.046993	39	0.014769	yes	SKNS
chr1_1735008_G_GTTTT_b38	SLC35E2	3.17	0.00161	0.039052	162	0.012317	yes	SKNS
chr1_1943706_C_T_b38	SLC35E2	-3.164	0.00164	-0.055833	12	0.017644	yes	SKNS
chr1_1023573_A_G_b38	SLC35E2	3.163	0.00165	0.042401	73	0.013406	yes	SKNS
chr1_1675132_A_G_b38	SLC35E2	3.16	0.00166	0.044657	84	0.01413	yes	SKNS
chr1_1969238_C_T_b38	SLC35E2	3.156	0.00169	0.048918	30	0.015498	yes	SKNS
chr1_1983166_A_T_b38	SLC35E2	3.154	0.0017	0.04529	56	0.01436	yes	SKNS
chr1_1983956_TGG_T_b38	SLC35E2	3.154	0.0017	0.04529	56	0.01436	yes	SKNS
chr1_1984859_C_T_b38	SLC35E2	3.154	0.0017	0.04529	56	0.01436	yes	SKNS
chr1_1985148_G_T_b38	SLC35E2	3.154	0.0017	0.04529	56	0.01436	yes	SKNS
chr1_1984595_C_T_b38	SLC35E2	3.153	0.0017	0.045155	57	0.014319	yes	SKNS
chr1_1929306_C_T_b38	SLC35E2	3.15	0.00172	0.047264	36	0.015003	yes	SKNS
chr1_1976473_C_T_b38	SLC35E2	3.143	0.00177	0.044961	57	0.014307	yes	SKNS
chr1_1976573_T_C_b38	SLC35E2	3.143	0.00177	0.044961	57	0.014307	yes	SKNS
chr1_1976661_G_T_b38	SLC35E2	3.143	0.00177	0.044961	57	0.014307	yes	SKNS
chr1_1976946_C_T_b38	SLC35E2	3.143	0.00177	0.044961	57	0.014307	yes	SKNS
chr1_1977264_C_G_b38	SLC35E2	3.143	0.00177	0.044961	57	0.014307	yes	SKNS
chr1_1986211_T_C_b38	SLC35E2	3.142	0.00177	0.045119	56	0.01436	yes	SKNS
chr1_1907077_C_A_b38	SLC35E2	3.141	0.00178	0.04794	36	0.015261	yes	SKNS
chr1_1978055_C_T_b38	SLC35E2	3.14	0.00178	0.044983	57	0.014325	yes	SKNS
chr1_1978404_C_T_b38	SLC35E2	3.14	0.00179	0.044883	57	0.014296	yes	SKNS
chr1_1978415_G_A_b38	SLC35E2	3.14	0.00179	0.044883	57	0.014296	yes	SKNS
chr1_1842237_T_C_b38	SLC35E2	3.139	0.00179	0.04553	45	0.014507	yes	SKNS
chr1_1971027_A_C_b38	SLC35E2	3.138	0.0018	0.046581	41	0.014845	yes	SKNS
chr1_1981319_G_C_b38	SLC35E2	3.136	0.00181	0.044976	56	0.014343	yes	SKNS
chr1_1986033_G_A_b38	SLC35E2	3.136	0.00181	0.044976	56	0.014343	yes	SKNS
chr1_1986176_A_T_b38	SLC35E2	3.136	0.00181	0.044976	56	0.014343	yes	SKNS
chr1_1986390_T_G_b38	SLC35E2	3.136	0.00181	0.044976	56	0.014343	yes	SKNS
chr1_1986469_A_C_b38	SLC35E2	3.136	0.00181	0.044976	56	0.014343	yes	SKNS
chr1_1987096_A_T_b38	SLC35E2	3.136	0.00181	0.044976	56	0.014343	yes	SKNS
chr1_1987156_G_A_b38	SLC35E2	3.136	0.00181	0.044976	56	0.014343	yes	SKNS
chr1_1016184_A_G_b38	SLC35E2	3.129	0.00185	0.040822	92	0.013047	yes	SKNS
chr1_1773713_T_A_b38	SLC35E2	-3.128	0.00185	-0.043812	70	0.014005	yes	SKNS
chr1_1945799_T_G_b38	SLC35E2	-3.127	0.00186	-0.056401	11	0.018034	yes	SKNS
chr1_995512_T_C_b38	SLC35E2	3.126	0.00187	0.041073	101	0.013138	yes	SKNS
chr1_1977765_A_G_b38	SLC35E2	3.124	0.00188	0.044686	57	0.014303	yes	SKNS
chr1_1978647_G_T_b38	SLC35E2	3.124	0.00188	0.044686	57	0.014303	yes	SKNS
chr1_1980953_G_A_b38	SLC35E2	3.124	0.00188	0.044686	57	0.014303	yes	SKNS
chr1_1976600_C_T_b38	SLC35E2	3.122	0.00189	0.044635	57	0.014295	yes	SKNS
chr1_1934896_C_T_b38	SLC35E2	3.121	0.0019	0.049653	23	0.015908	yes	SKNS
chr1_1641275_A_G_b38	SLC35E2	-3.104	0.00201	-0.042197	76	0.013595	yes	SKNS
chr1_1912140_T_G_b38	SLC35E2	3.101	0.00203	0.051251	21	0.016525	yes	SKNS
chr1_1605787_G_A_b38	SLC35E2	3.094	0.00208	0.086308	6	0.027895	yes	SKNS
chr1_1984586_G_A_b38	SLC35E2	3.091	0.0021	0.044218	58	0.014307	yes	SKNS
chr1_1624323_AT_A_b38	SLC35E2	3.087	0.00213	0.039899	99	0.012926	yes	SKNS
chr1_933038_C_T_b38	SLC35E2	3.081	0.00217	0.046482	36	0.015085	yes	SKNS
chr1_1023351_A_G_b38	SLC35E2	3.08	0.00218	0.0406	72	0.013182	yes	SKNS
chr1_1897325_G_A_b38	SLC35E2	3.08	0.00218	0.046776	31	0.015188	yes	SKNS
chr1_1969229_T_A_b38	SLC35E2	3.076	0.00221	0.047476	30	0.015437	yes	SKNS
chr1_1986010_T_G_b38	SLC35E2	3.073	0.00223	0.043918	58	0.014291	yes	SKNS
chr1_1743712_G_A_b38	SLC35E2	3.072	0.00223	0.070019	6	0.022789	yes	SKNS
chr1_1915143_A_G_b38	SLC35E2	-3.071	0.00224	-0.054965	12	0.017897	yes	SKNS
chr1_1838449_C_CT_b38	SLC35E2	3.058	0.00234	0.046651	33	0.015257	yes	SKNS
chr1_1691417_T_C_b38	SLC35E2	3.043	0.00246	0.042693	105	0.014028	yes	SKNS
chr1_1927692_C_T_b38	SLC35E2	3.042	0.00247	0.045725	36	0.015031	yes	SKNS
chr1_1934821_C_CGTTGTAGGTACGTGTGTACGTGGGTGTTAGGTTGTAGGTACACACGTGTATATGTGGGTGTTAG_b38	SLC35E2	-3.037	0.00251	-0.039845	65	0.01312	yes	SKNS
chr1_1679993_A_G_b38	SLC35E2	-3.029	0.00258	-0.03978	132	0.013135	yes	SKNS
chr1_1667424_T_TAAATA_b38	SLC35E2	-3.023	0.00263	-0.038804	100	0.012838	yes	SKNS
chr1_1931743_CA_C_b38	SLC35E2	-3.022	0.00263	-0.047879	48	0.015842	yes	SKNS
chr1_1936906_CA_C_b38	SLC35E2	3.018	0.00266	0.049078	22	0.01626	yes	SKNS
chr1_1984601_T_C_b38	SLC35E2	3.008	0.00275	0.043072	58	0.014318	yes	SKNS
chr1_1005429_C_CA_b38	SLC35E2	3.006	0.00277	0.039424	87	0.013113	yes	SKNS
chr1_1005904_C_T_b38	SLC35E2	3.006	0.00277	0.039424	87	0.013113	yes	SKNS
chr1_1005954_G_A_b38	SLC35E2	3.006	0.00277	0.039424	87	0.013113	yes	SKNS
chr1_1034279_G_A_b38	SLC35E2	3.005	0.00278	0.04218	48	0.014036	yes	SKNS
chr1_1906439_C_T_b38	SLC35E2	3.005	0.00278	0.043044	47	0.014325	yes	SKNS
chr1_1938467_C_T_b38	SLC35E2	3.002	0.0028	0.044946	35	0.01497	yes	SKNS
chr1_1991761_T_C_b38	SLC35E2	2.999	0.00283	0.040954	86	0.013654	yes	SKNS
chr1_791549_G_GGAATGGAATC_b38	SLC35E2	-2.995	0.00287	-0.043763	42	0.014611	yes	SKNS
chr1_1016623_G_A_b38	SLC35E2	2.993	0.00289	0.040046	80	0.01338	yes	SKNS
chr1_1929713_G_A_b38	SLC35E2	2.993	0.00289	0.044732	37	0.014947	yes	SKNS
chr1_995982_G_A_b38	SLC35E2	2.992	0.0029	0.039109	90	0.013072	yes	SKNS
chr1_1585589_A_G_b38	SLC35E2	2.983	0.00298	0.078721	3	0.026386	yes	SKNS
chr1_1802763_T_TAA_b38	SLC35E2	2.972	0.00309	0.047636	24	0.016027	yes	SKNS
chr1_954724_G_A_b38	SLC35E2	2.966	0.00316	0.04744	25	0.015997	yes	SKNS
chr1_1035169_TGG_T_b38	SLC35E2	2.965	0.00317	0.048577	19	0.016385	yes	SKNS
chr1_1461621_T_TCTCCTCATGAGACCCCCATGTCGGAATTCGAAGGAGAGG_b38	SLC35E2	-2.962	0.0032	-0.075062	16	0.025345	yes	SKNS
chr1_1725697_T_C_b38	SLC35E2	2.956	0.00326	0.047253	56	0.015987	yes	SKNS
chr1_1737703_A_C_b38	SLC35E2	-2.95	0.00332	-0.039486	92	0.013386	yes	SKNS
chr1_1702383_T_C_b38	SLC35E2	-2.945	0.00337	-0.046349	32	0.015738	yes	SKNS
chr1_1032846_C_A_b38	SLC35E2	2.942	0.0034	0.040613	55	0.013804	yes	SKNS
chr1_1022868_A_G_b38	SLC35E2	2.939	0.00344	0.039111	73	0.013308	yes	SKNS
chr1_1009184_T_C_b38	SLC35E2	2.938	0.00345	0.038372	89	0.013061	yes	SKNS
chr1_1008307_G_C_b38	SLC35E2	2.937	0.00346	0.038551	89	0.013126	yes	SKNS
chr1_1938221_TCA_T_b38	SLC35E2	2.927	0.00357	0.043999	35	0.015031	yes	SKNS
chr1_1976855_C_CTT_b38	SLC35E2	2.914	0.00371	0.046314	30	0.015891	yes	SKNS
chr1_945259_TC_T_b38	SLC35E2	2.913	0.00373	0.044903	31	0.015416	yes	SKNS
chr1_1948037_T_A_b38	SLC35E2	2.911	0.00375	0.048055	21	0.016507	yes	SKNS
chr1_2677450_C_A_b38	SLC35E2	2.886	0.00406	0.055091	13	0.01909	yes	SKNS
chr1_1021740_G_C_b38	SLC35E2	2.879	0.00415	0.039551	56	0.013736	yes	SKNS
chr1_1019479_TG_T_b38	SLC35E2	-2.875	0.00421	-0.036045	148	0.012539	yes	SKNS
chr1_1931519_A_G_b38	SLC35E2	-2.866	0.00431	-0.050077	14	0.01747	yes	SKNS
chr1_995371_C_G_b38	SLC35E2	2.863	0.00436	0.037385	88	0.013057	yes	SKNS
chr1_1922882_A_G_b38	SLC35E2	-2.862	0.00437	-0.050917	12	0.017788	yes	SKNS
chr1_1650688_T_A_b38	SLC35E2	-2.857	0.00445	-0.040945	50	0.014333	yes	SKNS
chr1_1915022_C_T_b38	SLC35E2	2.854	0.00448	0.041927	42	0.014689	yes	SKNS
chr1_1693256_GT_G_b38	SLC35E2	-2.851	0.00452	-0.088937	9	0.031193	yes	SKNS
chr1_1220377_C_T_b38	SLC35E2	-2.851	0.00453	-0.069112	24	0.024244	yes	SKNS
chr1_1641261_C_T_b38	SLC35E2	-2.836	0.00474	-0.044769	30	0.015787	yes	SKNS
chr1_1022518_G_T_b38	SLC35E2	2.836	0.00474	0.037804	68	0.013331	yes	SKNS
chr1_1987145_C_T_b38	SLC35E2	2.823	0.00493	0.040401	61	0.01431	yes	SKNS
chr1_1025970_C_T_b38	SLC35E2	2.822	0.00495	0.038358	59	0.013592	yes	SKNS
chr1_1909237_G_T_b38	SLC35E2	2.808	0.00517	0.040289	48	0.01435	yes	SKNS
chr1_1000731_C_T_b38	SLC35E2	-2.805	0.00521	-0.037341	138	0.013311	yes	SKNS
chr1_1071823_A_G_b38	SLC35E2	-2.805	0.00522	-0.04426	26	0.015781	yes	SKNS
chr1_1877312_A_T_b38	SLC35E2	2.803	0.00524	0.056338	13	0.020096	yes	SKNS
chr1_1991690_A_G_b38	SLC35E2	2.801	0.00528	0.03699	103	0.013205	yes	SKNS
chr1_799081_G_GA_b38	SLC35E2	-2.8	0.00529	-0.136007	3	0.048573	yes	SKNS
chr1_1014863_A_C_b38	SLC35E2	2.795	0.00538	0.037196	84	0.013308	yes	SKNS
chr1_1953296_CTT_C_b38	SLC35E2	-2.792	0.00542	-0.066963	8	0.023982	yes	SKNS
chr1_1912983_T_C_b38	SLC35E2	2.762	0.00595	0.03947	50	0.014292	yes	SKNS
chr1_1024462_C_T_b38	SLC35E2	2.761	0.00595	0.038779	55	0.014043	yes	SKNS
chr1_1160003_G_A_b38	SLC35E2	2.759	0.00599	0.042138	38	0.015272	yes	SKNS
chr1_1020217_G_T_b38	SLC35E2	2.754	0.00608	0.037523	58	0.013624	yes	SKNS
chr1_1695747_C_T_b38	SLC35E2	2.749	0.00617	0.04153	106	0.015105	yes	SKNS
chr1_1773676_TTGTGTGTG_T_b38	SLC35E2	2.744	0.00627	0.072723	3	0.026498	yes	SKNS
chr1_1589151_C_T_b38	SLC35E2	-2.739	0.00636	-0.036683	79	0.013391	yes	SKNS
chr1_2264013_TA_T_b38	SLC35E2	2.738	0.00638	0.036571	137	0.013355	yes	SKNS
chr1_1026084_G_T_b38	SLC35E2	2.735	0.00644	0.037801	56	0.01382	yes	SKNS
chr1_1903309_A_G_b38	SLC35E2	2.727	0.0066	0.039736	72	0.01457	yes	SKNS
chr1_1375678_TAA_T_b38	SLC35E2	-2.722	0.0067	-0.04802	20	0.017641	yes	SKNS
chr1_1025561_G_C_b38	SLC35E2	2.718	0.00679	0.037229	57	0.013699	yes	SKNS
chr1_1849992_T_TG_b38	SLC35E2	2.717	0.0068	0.046007	18	0.016933	yes	SKNS
chr1_1902056_G_A_b38	SLC35E2	2.708	0.00699	0.038951	45	0.014384	yes	SKNS
chr1_1020681_A_AG_b38	SLC35E2	2.699	0.00718	0.03768	51	0.013962	yes	SKNS
chr1_1848358_A_T_b38	SLC35E2	2.698	0.00719	0.045471	22	0.016852	yes	SKNS
chr1_1635226_T_C_b38	SLC35E2	-2.696	0.00723	-0.04824	14	0.017891	yes	SKNS
chr1_2699855_C_G_b38	SLC35E2	2.683	0.00752	0.070318	15	0.026208	yes	SKNS
chr1_1937046_G_A_b38	SLC35E2	2.672	0.00778	0.044316	20	0.016588	yes	SKNS
chr1_1442855_A_AATAAACCAAGTCAATTTTCTATAGTGACGGTG_b38	SLC35E2	2.668	0.00786	0.079693	11	0.029867	yes	SKNS
chr1_1663759_G_A_b38	SLC35E2	-2.665	0.00793	-0.072501	9	0.027203	yes	SKNS
chr1_2677434_G_T_b38	SLC35E2	2.656	0.00815	0.053517	6	0.020152	yes	SKNS
chr1_941767_G_A_b38	SLC35E2	2.652	0.00824	0.04205	28	0.015855	yes	SKNS
chr1_2291058_G_A_b38	SLC35E2	-2.646	0.00839	-0.035328	98	0.013351	yes	SKNS
chr1_1027633_C_T_b38	SLC35E2	-2.645	0.00841	-0.035786	109	0.013529	yes	SKNS
chr1_2290929_G_A_b38	SLC35E2	-2.643	0.00846	-0.035318	97	0.013364	yes	SKNS
chr1_965666_ACC_A_b38	SLC35E2	2.642	0.00848	0.041274	30	0.015622	yes	SKNS
chr1_1877314_A_T_b38	SLC35E2	2.639	0.00856	0.042921	37	0.016264	yes	SKNS
chr1_1928119_T_C_b38	SLC35E2	2.634	0.00868	0.039418	37	0.014963	yes	SKNS
chr1_1017114_A_AT_b38	SLC35E2	2.628	0.00885	0.036462	68	0.013876	yes	SKNS
chr1_1703968_A_G_b38	SLC35E2	-2.619	0.00907	-0.097799	9	0.037343	yes	SKNS
chr1_1020697_C_T_b38	SLC35E2	2.609	0.00933	0.03632	51	0.01392	yes	SKNS
chr1_1228069_T_C_b38	SLC35E2	-2.605	0.00944	-0.054487	5	0.020915	yes	SKNS
chr1_1141684_C_A_b38	SLC35E2	2.59	0.00986	0.052196	10	0.020152	yes	SKNS
chr1_1615869_C_T_b38	SLC35E2	2.589	0.00988	0.036636	61	0.014149	yes	SKNS
chr1_1715553_G_A_b38	SLC35E2	2.588	0.00992	0.054119	41	0.020913	yes	SKNS
chr1_1751981_A_T_b38	SLC35E2	-7.44	4.05e-13	-0.110492	51	0.014852	no	SKNS
chr1_1743840_T_C_b38	SLC35E2	-6.167	1.37e-09	-0.092937	46	0.015069	no	SKNS
chr1_1743851_C_T_b38	SLC35E2	-5.985	3.98e-09	-0.090356	46	0.015098	no	SKNS
chr1_1658115_G_A_b38	SLC35E2	-5.548	4.55e-08	-0.155113	4	0.027958	no	SKNS
chr1_1986752_A_G_b38	SLC35E2	4.799	2.07e-06	0.067629	103	0.014091	no	SKNS
chr1_1727506_T_C_b38	SLC35E2	4.715	3.09e-06	0.075904	52	0.016099	no	SKNS
chr1_996133_A_C_b38	SLC35E2	-4.689	3.49e-06	-0.151886	3	0.032393	no	SKNS
chr1_1698022_G_A_b38	SLC35E2	-4.657	4.05e-06	-0.165261	21	0.035484	no	SKNS
chr1_1698048_T_C_b38	SLC35E2	-4.637	4.46e-06	-0.149577	7	0.032259	no	SKNS
chr1_1987049_A_G_b38	SLC35E2	4.633	4.53e-06	0.064558	106	0.013934	no	SKNS
chr1_1955080_C_CGGCTCACACCGGAAGTGAGGCTCACACCGGAAGTGA_b38	SLC35E2	-4.437	1.11e-05	-0.06091	104	0.013726	no	SKNS
chr1_1969015_A_G_b38	SLC35E2	4.42	1.19e-05	0.062786	124	0.014204	no	SKNS
chr1_1613769_C_T_b38	SLC35E2	4.316	1.89e-05	0.0588	64	0.013623	no	SKNS
chr1_1845824_TACACAC_T_b38	SLC35E2	4.312	1.93e-05	0.06999	24	0.016233	no	SKNS
chr1_1845840_C_G_b38	SLC35E2	4.281	2.21e-05	0.078177	8	0.018263	no	SKNS
chr1_1660408_T_C_b38	SLC35E2	-4.237	2.67e-05	-0.069642	16	0.016437	no	SKNS
chr1_1782906_T_G_b38	SLC35E2	4.233	2.71e-05	0.07101	17	0.016774	no	SKNS
chr1_1089099_C_T_b38	SLC35E2	-4.233	2.72e-05	-0.141343	3	0.033392	no	SKNS
chr1_1846651_T_G_b38	SLC35E2	4.23	2.75e-05	0.072086	15	0.017041	no	SKNS
chr1_1888382_A_AG_b38	SLC35E2	4.226	2.79e-05	0.08222	9	0.019454	no	SKNS
chr1_1987547_C_CT_b38	SLC35E2	4.207	3.04e-05	0.061371	108	0.014589	no	SKNS
chr1_1837340_C_T_b38	SLC35E2	4.155	3.79e-05	0.070876	15	0.017058	no	SKNS
chr1_1849781_T_C_b38	SLC35E2	-4.129	4.22e-05	-0.062217	35	0.015067	no	SKNS
chr1_1775296_C_T_b38	SLC35E2	4.125	4.29e-05	0.071871	16	0.017422	no	SKNS
chr1_1871210_G_T_b38	SLC35E2	4.117	4.44e-05	0.07208	15	0.017507	no	SKNS
chr1_1738597_C_A_b38	SLC35E2	4.092	4.94e-05	0.060564	76	0.0148	no	SKNS
chr1_1857246_T_TAA_b38	SLC35E2	4.088	5.02e-05	0.071052	14	0.01738	no	SKNS
chr1_1857250_C_G_b38	SLC35E2	4.088	5.02e-05	0.071052	14	0.01738	no	SKNS
chr1_1857305_G_GGGCT_b38	SLC35E2	4.088	5.02e-05	0.071052	14	0.01738	no	SKNS
chr1_1882915_C_T_b38	SLC35E2	4.074	5.33e-05	0.071004	15	0.01743	no	SKNS
chr1_1815255_G_T_b38	SLC35E2	4.064	5.55e-05	0.071276	15	0.017539	no	SKNS
chr1_1777680_C_T_b38	SLC35E2	4.055	5.76e-05	0.104154	3	0.025687	no	SKNS
chr1_1822247_A_G_b38	SLC35E2	4.053	5.8e-05	0.068534	16	0.016909	no	SKNS
chr1_1892085_G_C_b38	SLC35E2	4.042	6.08e-05	0.069898	14	0.017293	no	SKNS
chr1_1881065_G_A_b38	SLC35E2	4.039	6.15e-05	0.069633	15	0.01724	no	SKNS
chr1_1881798_C_T_b38	SLC35E2	4.039	6.15e-05	0.069633	15	0.01724	no	SKNS
chr1_1855939_G_A_b38	SLC35E2	4.032	6.32e-05	0.070257	14	0.017423	no	SKNS
chr1_1886690_A_C_b38	SLC35E2	4.029	6.43e-05	0.06963	15	0.017284	no	SKNS
chr1_1913504_CT_C_b38	SLC35E2	-4.027	6.48e-05	-0.060753	90	0.015087	no	SKNS
chr1_1855245_G_A_b38	SLC35E2	4.006	7.05e-05	0.069789	14	0.01742	no	SKNS
chr1_1840043_T_TA_b38	SLC35E2	4.005	7.08e-05	0.070065	11	0.017494	no	SKNS
chr1_1794187_C_T_b38	SLC35E2	3.995	7.38e-05	0.067869	15	0.016988	no	SKNS
chr1_1798974_C_T_b38	SLC35E2	3.986	7.66e-05	0.06805	15	0.017073	no	SKNS
chr1_1738606_C_T_b38	SLC35E2	3.918	0.000101	0.058517	72	0.014936	no	SKNS
chr1_1660318_C_T_b38	SLC35E2	3.864	0.000125	0.077214	4	0.019985	no	SKNS
chr1_1775996_G_A_b38	SLC35E2	3.847	0.000134	0.064818	17	0.016849	no	SKNS
chr1_1851414_GA_G_b38	SLC35E2	-3.834	0.000141	-0.055699	65	0.014526	no	SKNS
chr1_1835922_G_GAAA_b38	SLC35E2	-3.819	0.00015	-0.121294	9	0.031758	no	SKNS
chr1_1801188_T_C_b38	SLC35E2	3.812	0.000154	0.062434	18	0.016376	no	SKNS
chr1_1898043_T_C_b38	SLC35E2	3.799	0.000162	0.06672	14	0.017562	no	SKNS
chr1_1665581_C_G_b38	SLC35E2	-3.672	0.000265	-0.05389	39	0.014675	no	SKNS
chr1_1880594_A_T_b38	SLC35E2	3.629	0.000312	0.060456	21	0.01666	no	SKNS
chr1_1814815_A_AAAAAAG_b38	SLC35E2	-3.606	0.00034	-0.074457	17	0.020648	no	SKNS
chr1_1903242_C_T_b38	SLC35E2	3.606	0.000341	0.064717	13	0.017949	no	SKNS
chr1_1906935_C_T_b38	SLC35E2	3.606	0.000341	0.064717	13	0.017949	no	SKNS
chr1_1903577_C_T_b38	SLC35E2	3.585	0.000367	0.06352	15	0.017716	no	SKNS
chr1_1909167_G_A_b38	SLC35E2	3.575	0.000382	0.064267	13	0.017977	no	SKNS
chr1_1772160_A_AT_b38	SLC35E2	3.536	0.000442	0.061299	13	0.017336	no	SKNS
chr1_1985619_A_G_b38	SLC35E2	3.531	0.00045	0.049633	79	0.014058	no	SKNS
chr1_1659940_A_C_b38	SLC35E2	-3.527	0.000457	-0.060791	17	0.017237	no	SKNS
chr1_1015915_C_T_b38	SLC35E2	-3.493	0.000518	-0.045134	134	0.012922	no	SKNS
chr1_1982141_G_A_b38	SLC35E2	3.475	0.000552	0.118704	5	0.034157	no	SKNS
chr1_1047464_G_C_b38	SLC35E2	-3.443	0.000621	-0.09269	3	0.026923	no	SKNS
chr1_1885444_TTAGA_T_b38	SLC35E2	3.42	0.000673	0.050004	40	0.014619	no	SKNS
chr1_1739883_C_T_b38	SLC35E2	-3.407	0.000707	-0.045073	89	0.01323	no	SKNS
chr1_1827615_G_A_b38	SLC35E2	3.385	0.000764	0.050222	37	0.014836	no	SKNS
chr1_1985090_C_T_b38	SLC35E2	3.373	0.000798	0.048097	85	0.01426	no	SKNS
chr1_1884183_G_A_b38	SLC35E2	3.372	0.000799	0.049218	42	0.014595	no	SKNS
chr1_1015903_C_T_b38	SLC35E2	-3.359	0.000837	-0.043488	132	0.012946	no	SKNS
chr1_1782430_T_G_b38	SLC35E2	3.319	0.000966	0.048837	38	0.014716	no	SKNS
chr1_1805214_T_G_b38	SLC35E2	3.319	0.000966	0.048837	38	0.014716	no	SKNS
chr1_1834655_A_C_b38	SLC35E2	3.319	0.000966	0.048837	38	0.014716	no	SKNS
chr1_1055000_C_T_b38	SLC35E2	3.315	0.00098	0.046416	61	0.014003	no	SKNS
chr1_1265603_T_TTG_b38	SLC35E2	-3.301	0.00103	-0.056878	15	0.017231	no	SKNS
chr1_1869595_G_A_b38	SLC35E2	3.295	0.00105	0.04894	37	0.014853	no	SKNS
chr1_1910289_C_T_b38	SLC35E2	3.272	0.00114	0.055059	17	0.016829	no	SKNS
chr1_1910369_G_A_b38	SLC35E2	3.272	0.00114	0.055059	17	0.016829	no	SKNS
chr1_1910480_G_A_b38	SLC35E2	3.272	0.00114	0.055059	17	0.016829	no	SKNS
chr1_1780791_C_T_b38	SLC35E2	3.265	0.00117	0.04805	38	0.014717	no	SKNS
chr1_1794321_C_T_b38	SLC35E2	3.265	0.00117	0.04805	38	0.014717	no	SKNS
chr1_2274109_A_C_b38	SLC35E2	3.252	0.00122	0.042115	108	0.012952	no	SKNS
chr1_1983048_A_G_b38	SLC35E2	3.241	0.00126	0.04647	88	0.014336	no	SKNS
chr1_1985451_C_T_b38	SLC35E2	3.238	0.00128	0.046136	86	0.014249	no	SKNS
chr1_1783572_C_A_b38	SLC35E2	3.219	0.00136	0.047737	37	0.014828	no	SKNS
chr1_1837455_C_T_b38	SLC35E2	3.219	0.00136	0.047737	37	0.014828	no	SKNS
chr1_1851762_G_A_b38	SLC35E2	3.219	0.00136	0.047737	37	0.014828	no	SKNS
chr1_1852145_G_A_b38	SLC35E2	3.219	0.00136	0.047737	37	0.014828	no	SKNS
chr1_1873952_G_A_b38	SLC35E2	3.218	0.00137	0.047095	43	0.014633	no	SKNS
chr1_1878651_C_T_b38	SLC35E2	3.218	0.00137	0.047095	43	0.014633	no	SKNS
chr1_1890186_G_A_b38	SLC35E2	3.218	0.00137	0.047095	43	0.014633	no	SKNS
chr1_992993_A_G_b38	SLC35E2	3.214	0.00139	0.040917	126	0.012732	no	SKNS
chr1_1897985_C_G_b38	SLC35E2	3.206	0.00142	0.053538	18	0.016697	no	SKNS
chr1_1865951_T_A_b38	SLC35E2	3.206	0.00143	0.047605	37	0.01485	no	SKNS
chr1_1586956_T_C_b38	SLC35E2	-3.203	0.00144	-0.044442	75	0.013876	no	SKNS
chr1_1586987_G_A_b38	SLC35E2	-3.2	0.00146	-0.044477	73	0.0139	no	SKNS
chr1_1808642_TTTTG_T_b38	SLC35E2	3.197	0.00147	0.04725	42	0.014782	no	SKNS
chr1_1842333_G_A_b38	SLC35E2	3.185	0.00153	0.046556	44	0.014616	no	SKNS
chr1_1004625_A_G_b38	SLC35E2	3.182	0.00155	0.041533	99	0.013052	no	SKNS
chr1_995786_A_G_b38	SLC35E2	3.181	0.00155	0.041716	102	0.013113	no	SKNS
chr1_1015297_T_C_b38	SLC35E2	-3.165	0.00164	-0.041322	130	0.013057	no	SKNS
chr1_1890770_C_T_b38	SLC35E2	3.157	0.00169	0.045512	47	0.014418	no	SKNS
chr1_1803531_C_T_b38	SLC35E2	3.152	0.00171	0.04616	43	0.014643	no	SKNS
chr1_1830566_A_T_b38	SLC35E2	3.152	0.00171	0.04616	43	0.014643	no	SKNS
chr1_1891450_G_A_b38	SLC35E2	3.123	0.00189	0.045379	43	0.014529	no	SKNS
chr1_1776301_T_G_b38	SLC35E2	3.121	0.0019	0.04611	40	0.014773	no	SKNS
chr1_1972273_C_A_b38	SLC35E2	3.115	0.00194	0.045156	53	0.014495	no	SKNS
chr1_1004716_C_T_b38	SLC35E2	-3.114	0.00194	-0.041071	134	0.013188	no	SKNS
chr1_1842226_T_C_b38	SLC35E2	3.109	0.00198	0.045547	43	0.01465	no	SKNS
chr1_1839349_C_G_b38	SLC35E2	3.105	0.002	0.045803	42	0.014749	no	SKNS
chr1_1839350_T_A_b38	SLC35E2	3.105	0.002	0.045803	42	0.014749	no	SKNS
chr1_1851181_C_T_b38	SLC35E2	3.092	0.00209	0.04571	42	0.014782	no	SKNS
chr1_1924659_C_T_b38	SLC35E2	3.092	0.00209	0.045395	47	0.014682	no	SKNS
chr1_965125_G_C_b38	SLC35E2	3.086	0.00213	0.04745	35	0.015376	no	SKNS
chr1_1982826_T_C_b38	SLC35E2	3.08	0.00218	0.043951	59	0.014269	no	SKNS
chr1_998410_G_A_b38	SLC35E2	-3.069	0.00225	-0.040711	136	0.013264	no	SKNS
chr1_1978262_C_T_b38	SLC35E2	3.068	0.00227	0.043715	59	0.014249	no	SKNS
chr1_1978294_G_T_b38	SLC35E2	3.068	0.00227	0.043715	59	0.014249	no	SKNS
chr1_1842213_A_G_b38	SLC35E2	3.063	0.0023	0.045274	44	0.01478	no	SKNS
chr1_1978562_C_G_b38	SLC35E2	3.063	0.00231	0.043655	59	0.014255	no	SKNS
chr1_1978573_T_C_b38	SLC35E2	3.063	0.00231	0.043655	59	0.014255	no	SKNS
chr1_1978797_T_C_b38	SLC35E2	3.063	0.00231	0.043655	59	0.014255	no	SKNS
chr1_1879682_G_A_b38	SLC35E2	3.057	0.00235	0.044561	44	0.014575	no	SKNS
chr1_1918697_C_T_b38	SLC35E2	3.054	0.00237	0.04442	52	0.014546	no	SKNS
chr1_1842221_C_G_b38	SLC35E2	3.049	0.00241	0.044938	45	0.014737	no	SKNS
chr1_1726140_C_A_b38	SLC35E2	3.043	0.00246	0.096833	3	0.031826	no	SKNS
chr1_1767762_C_A_b38	SLC35E2	3.037	0.0025	0.044947	40	0.014798	no	SKNS
chr1_1774308_G_A_b38	SLC35E2	3.037	0.0025	0.044947	40	0.014798	no	SKNS
chr1_995508_ATTTTT_A_b38	SLC35E2	-3.023	0.00263	-0.040308	131	0.013335	no	SKNS
chr1_1976990_T_C_b38	SLC35E2	3.014	0.0027	0.042983	59	0.014259	no	SKNS
chr1_995153_C_G_b38	SLC35E2	3.008	0.00275	0.039576	96	0.013157	no	SKNS
chr1_1776772_TAA_T_b38	SLC35E2	-3.005	0.00278	-0.045981	48	0.015303	no	SKNS
chr1_1773215_C_A_b38	SLC35E2	2.999	0.00283	0.044317	40	0.014776	no	SKNS
chr1_1740017_C_T_b38	SLC35E2	-2.999	0.00284	-0.040362	92	0.01346	no	SKNS
chr1_1989523_T_C_b38	SLC35E2	2.996	0.00286	0.041478	96	0.013845	no	SKNS
chr1_1955018_A_AGGAAGTGCGGCTCACACC_b38	SLC35E2	2.986	0.00296	0.056284	9	0.018852	no	SKNS
chr1_989068_GTTGA_G_b38	SLC35E2	-2.98	0.00302	-0.039725	136	0.013332	no	SKNS
chr1_995187_A_G_b38	SLC35E2	2.974	0.00307	0.03916	98	0.013167	no	SKNS
chr1_1023525_A_G_b38	SLC35E2	2.974	0.00308	0.039631	72	0.013328	no	SKNS
chr1_1740160_G_A_b38	SLC35E2	-2.972	0.00309	-0.039948	92	0.01344	no	SKNS
chr1_1866635_T_TAAA_b38	SLC35E2	-2.971	0.0031	-0.043738	74	0.014721	no	SKNS
chr1_1587397_A_AT_b38	SLC35E2	-2.956	0.00325	-0.040867	85	0.013825	no	SKNS
chr1_1773676_TTG_T_b38	SLC35E2	-2.953	0.00329	-0.065558	5	0.022202	no	SKNS
chr1_940296_GCC_G_b38	SLC35E2	-2.951	0.0033	-0.038454	100	0.013029	no	SKNS
chr1_1769737_GA_G_b38	SLC35E2	2.948	0.00333	0.045343	30	0.015379	no	SKNS
chr1_1021472_C_T_b38	SLC35E2	-2.947	0.00335	-0.038575	135	0.01309	no	SKNS
chr1_1688409_C_G_b38	SLC35E2	-2.946	0.00336	-0.040476	91	0.013738	no	SKNS
chr1_999842_C_A_b38	SLC35E2	-2.945	0.00337	-0.039786	156	0.013509	no	SKNS
chr1_1848356_GC_G_b38	SLC35E2	2.943	0.00339	0.049476	23	0.016813	no	SKNS
chr1_1773676_TTGTGTG_T_b38	SLC35E2	2.942	0.0034	0.061119	7	0.020774	no	SKNS
chr1_1018652_C_G_b38	SLC35E2	2.932	0.00351	0.039907	59	0.013611	no	SKNS
chr1_1735008_G_GGTTT_b38	SLC35E2	-2.932	0.00351	-0.039873	89	0.0136	no	SKNS
chr1_1697272_G_A_b38	SLC35E2	2.929	0.00354	0.060713	38	0.020726	no	SKNS
chr1_1733576_G_A_b38	SLC35E2	-2.925	0.00359	-0.039639	91	0.01355	no	SKNS
chr1_992967_GGGAGGGTCCATGTGTCCGTCATCTGA_G_b38	SLC35E2	-2.925	0.00359	-0.038404	166	0.01313	no	SKNS
chr1_1005757_AGCCCCCGCAGCAGT_A_b38	SLC35E2	-2.923	0.00361	-0.038415	126	0.013143	no	SKNS
chr1_1738309_A_G_b38	SLC35E2	-2.919	0.00366	-0.039346	91	0.013479	no	SKNS
chr1_2312125_G_A_b38	SLC35E2	-2.905	0.00382	-0.037919	159	0.013053	no	SKNS
chr1_1881428_C_T_b38	SLC35E2	2.897	0.00392	0.044569	33	0.015385	no	SKNS
chr1_1055037_T_C_b38	SLC35E2	2.894	0.00395	0.040587	68	0.014023	no	SKNS
chr1_1740107_G_A_b38	SLC35E2	-2.891	0.00399	-0.038754	93	0.013404	no	SKNS
chr1_1954781_C_T_b38	SLC35E2	2.89	0.00401	0.04012	64	0.013882	no	SKNS
chr1_1737704_C_T_b38	SLC35E2	-2.885	0.00407	-0.038838	92	0.013462	no	SKNS
chr1_1586626_C_T_b38	SLC35E2	-2.883	0.0041	-0.038746	95	0.013441	no	SKNS
chr1_1932079_AC_A_b38	SLC35E2	-2.883	0.0041	-0.041364	75	0.01435	no	SKNS
chr1_1736472_C_T_b38	SLC35E2	-2.881	0.00412	-0.038932	91	0.013511	no	SKNS
chr1_1023775_G_A_b38	SLC35E2	-2.881	0.00412	-0.037165	158	0.012899	no	SKNS
chr1_1589057_T_C_b38	SLC35E2	-2.879	0.00415	-0.038667	79	0.01343	no	SKNS
chr1_1586679_C_T_b38	SLC35E2	-2.879	0.00415	-0.0387	95	0.013443	no	SKNS
chr1_1054900_C_T_b38	SLC35E2	-2.872	0.00425	-0.040231	76	0.014009	no	SKNS
chr1_1774165_A_G_b38	SLC35E2	2.867	0.00431	0.043169	36	0.015058	no	SKNS
chr1_1732412_G_C_b38	SLC35E2	-2.864	0.00434	-0.03869	92	0.013507	no	SKNS
chr1_1732422_G_A_b38	SLC35E2	-2.864	0.00434	-0.03869	92	0.013507	no	SKNS
chr1_1735370_G_A_b38	SLC35E2	-2.864	0.00434	-0.03869	92	0.013507	no	SKNS
chr1_1735884_C_T_b38	SLC35E2	-2.864	0.00434	-0.03869	92	0.013507	no	SKNS
chr1_789680_A_AGGAAT_b38	SLC35E2	2.855	0.00447	0.056454	13	0.019773	no	SKNS
chr1_1954765_A_AGAGT_b38	SLC35E2	2.835	0.00476	0.0393	65	0.013864	no	SKNS
chr1_1736832_GAAAA_G_b38	SLC35E2	-2.835	0.00476	-0.038481	84	0.013576	no	SKNS
chr1_1006159_C_T_b38	SLC35E2	2.833	0.00478	0.036882	101	0.013017	no	SKNS
chr1_1741733_T_C_b38	SLC35E2	-2.827	0.00487	-0.036945	112	0.013069	no	SKNS
chr1_1732013_G_A_b38	SLC35E2	-2.827	0.00488	-0.038148	92	0.013497	no	SKNS
chr1_1018754_G_A_b38	SLC35E2	2.825	0.00491	0.038417	59	0.0136	no	SKNS
chr1_1731904_CA_C_b38	SLC35E2	2.824	0.00492	0.042871	49	0.015182	no	SKNS
chr1_1793064_C_CA_b38	SLC35E2	2.823	0.00494	0.040939	46	0.014503	no	SKNS
chr1_1773717_T_A_b38	SLC35E2	-2.818	0.00501	-0.037871	85	0.013437	no	SKNS
chr1_1901149_A_AAAGAAAGG_b38	SLC35E2	2.817	0.00503	0.037025	80	0.013145	no	SKNS
chr1_1587352_A_G_b38	SLC35E2	-2.813	0.00509	-0.037801	97	0.013438	no	SKNS
chr1_1773719_T_A_b38	SLC35E2	-2.812	0.0051	-0.037795	81	0.013439	no	SKNS
chr1_989148_C_A_b38	SLC35E2	-2.811	0.00511	-0.037989	159	0.013513	no	SKNS
chr1_1855321_C_CA_b38	SLC35E2	2.811	0.00512	0.04891	20	0.017399	no	SKNS
chr1_1738525_G_A_b38	SLC35E2	-2.797	0.00534	-0.037996	83	0.013583	no	SKNS
chr1_1597128_C_CCCTCAGCTGGACT_b38	SLC35E2	-2.794	0.00539	-0.035502	96	0.012706	no	SKNS
chr1_981454_G_A_b38	SLC35E2	-2.792	0.00543	-0.035744	132	0.012803	no	SKNS
chr1_983193_A_G_b38	SLC35E2	-2.79	0.00547	-0.035694	134	0.012796	no	SKNS
chr1_1014733_GAAGT_G_b38	SLC35E2	-2.778	0.00566	-0.036224	134	0.013038	no	SKNS
chr1_1585900_C_T_b38	SLC35E2	2.764	0.00591	0.069897	6	0.025287	no	SKNS
chr1_1083324_A_G_b38	SLC35E2	-2.757	0.00603	-0.034512	117	0.012518	no	SKNS
chr1_1983989_A_AT_b38	SLC35E2	2.755	0.00607	0.04358	31	0.015819	no	SKNS
chr1_1081790_C_G_b38	SLC35E2	-2.752	0.00612	-0.034249	134	0.012444	no	SKNS
chr1_1014228_G_A_b38	SLC35E2	2.745	0.00625	0.036009	92	0.013116	no	SKNS
chr1_1082764_T_C_b38	SLC35E2	-2.734	0.00646	-0.03415	137	0.012489	no	SKNS
chr1_983004_G_T_b38	SLC35E2	-2.728	0.00659	-0.035473	152	0.013004	no	SKNS
chr1_1596144_GAGAC_G_b38	SLC35E2	-2.721	0.00672	-0.038136	65	0.014016	no	SKNS
chr1_1741276_C_T_b38	SLC35E2	-2.717	0.00681	-0.036965	82	0.013607	no	SKNS
chr1_1991852_G_A_b38	SLC35E2	2.71	0.00695	0.037392	56	0.013799	no	SKNS
chr1_1981062_A_G_b38	SLC35E2	2.706	0.00704	0.038705	63	0.014305	no	SKNS
chr1_1981291_A_G_b38	SLC35E2	2.706	0.00704	0.038705	63	0.014305	no	SKNS
chr1_1981295_T_C_b38	SLC35E2	2.706	0.00704	0.038705	63	0.014305	no	SKNS
chr1_1691121_A_G_b38	SLC35E2	-2.704	0.00706	-0.048667	23	0.017996	no	SKNS
chr1_1951920_A_G_b38	SLC35E2	-2.699	0.00718	-0.051749	8	0.019176	no	SKNS
chr1_1898648_CACACACATAAGTTGGATAT_C_b38	SLC35E2	2.698	0.0072	0.038628	45	0.014318	no	SKNS
chr1_1680672_C_T_b38	SLC35E2	-2.691	0.00736	-0.037361	102	0.013886	no	SKNS
chr1_1075337_C_T_b38	SLC35E2	-2.69	0.00736	-0.033327	120	0.012387	no	SKNS
chr1_1586425_A_G_b38	SLC35E2	-2.69	0.00736	-0.03628	96	0.013486	no	SKNS
chr1_1956930_A_G_b38	SLC35E2	-2.687	0.00743	-0.051373	8	0.019118	no	SKNS
chr1_1594614_G_C_b38	SLC35E2	-2.679	0.00761	-0.037738	66	0.014085	no	SKNS
chr1_907835_C_CCTGCCCGGTCCTTCTGACCAGCCGAGAGAGTA_b38	SLC35E2	2.679	0.00762	0.037127	59	0.01386	no	SKNS
chr1_1587413_C_T_b38	SLC35E2	-2.677	0.00765	-0.036196	94	0.013519	no	SKNS
chr1_1662738_CT_C_b38	SLC35E2	-2.676	0.00767	-0.055245	34	0.020642	no	SKNS
chr1_1079746_A_G_b38	SLC35E2	-2.676	0.00769	-0.033546	120	0.012538	no	SKNS
chr1_1081817_C_T_b38	SLC35E2	-2.673	0.00776	-0.033668	152	0.012597	no	SKNS
chr1_2676824_ACGGCC_A_b38	SLC35E2	-2.668	0.00787	-0.103891	7	0.038946	no	SKNS
chr1_937396_GCC_G_b38	SLC35E2	2.666	0.00791	0.035851	121	0.013447	no	SKNS
chr1_1905533_AT_A_b38	SLC35E2	2.656	0.00814	0.04873	7	0.018345	no	SKNS
chr1_940390_A_G_b38	SLC35E2	-2.652	0.00825	-0.034693	148	0.013084	no	SKNS
chr1_1773721_T_A_b38	SLC35E2	-2.65	0.00828	-0.035596	80	0.013431	no	SKNS
chr1_1954906_C_CA_b38	SLC35E2	2.645	0.0084	0.036402	70	0.013761	no	SKNS
chr1_1954907_G_GCC_b38	SLC35E2	2.645	0.0084	0.036402	70	0.013761	no	SKNS
chr1_1980742_C_T_b38	SLC35E2	2.643	0.00845	0.065213	3	0.024671	no	SKNS
chr1_1083800_T_C_b38	SLC35E2	-2.641	0.00851	-0.033009	119	0.012499	no	SKNS
chr1_2369355_G_GAA_b38	SLC35E2	-2.638	0.00858	-0.094454	7	0.035804	no	SKNS
chr1_1991213_T_C_b38	SLC35E2	2.631	0.00875	0.036327	91	0.013806	no	SKNS
chr1_1638879_C_T_b38	SLC35E2	-2.628	0.00883	-0.038621	42	0.014694	no	SKNS
chr1_1017048_G_A_b38	SLC35E2	-2.623	0.00897	-0.035012	155	0.013349	no	SKNS
chr1_929110_C_T_b38	SLC35E2	-2.621	0.00901	-0.083308	3	0.031783	no	SKNS
chr1_1079877_A_G_b38	SLC35E2	-2.618	0.00909	-0.03273	117	0.012501	no	SKNS
chr1_1073854_T_C_b38	SLC35E2	-2.611	0.00928	-0.032389	128	0.012405	no	SKNS
chr1_1605347_C_T_b38	SLC35E2	-2.599	0.00962	-0.03636	68	0.013991	no	SKNS
chr1_1662855_T_C_b38	SLC35E2	-2.599	0.00962	-0.053303	34	0.020513	no	SKNS
chr1_1948121_T_G_b38	SLC35E2	2.591	0.00984	0.040089	41	0.015474	no	SKNS
chr1_1594890_G_GAC_b38	SLC35E2	-2.586	0.00996	-0.033719	118	0.013038	no	SKNS
chr1_1676790_C_T_b38	SLC35E2	5.834	3.92e-08	0.108852	41	0.018659	yes	SNTTRM
chr1_1673060_G_A_b38	SLC35E2	5.763	5.49e-08	0.112348	39	0.019496	yes	SNTTRM
chr1_1674720_TGC_T_b38	SLC35E2	5.658	8.99e-08	0.108433	39	0.019164	yes	SNTTRM
chr1_1739131_T_C_b38	SLC35E2	5.621	1.07e-07	0.114908	28	0.020443	yes	SNTTRM
chr1_1673818_A_C_b38	SLC35E2	5.577	1.31e-07	0.106775	40	0.019145	yes	SNTTRM
chr1_1674868_G_A_b38	SLC35E2	5.577	1.31e-07	0.106775	40	0.019145	yes	SNTTRM
chr1_1671995_G_T_b38	SLC35E2	5.545	1.52e-07	0.105086	40	0.018951	yes	SNTTRM
chr1_1671797_G_A_b38	SLC35E2	5.494	1.93e-07	0.104492	41	0.01902	yes	SNTTRM
chr1_1677720_T_G_b38	SLC35E2	5.461	2.25e-07	0.10362	41	0.018976	yes	SNTTRM
chr1_1677726_A_T_b38	SLC35E2	5.461	2.25e-07	0.10362	41	0.018976	yes	SNTTRM
chr1_1659940_A_C_b38	SLC35E2	-5.46	2.26e-07	-0.16283	3	0.029822	yes	SNTTRM
chr1_1671097_G_C_b38	SLC35E2	4.984	1.9e-06	0.107825	20	0.021633	yes	SNTTRM
chr1_1650195_A_G_b38	SLC35E2	-4.769	4.79e-06	-0.104568	21	0.021926	yes	SNTTRM
chr1_1660683_C_T_b38	SLC35E2	-4.702	6.36e-06	-0.112745	14	0.023979	yes	SNTTRM
chr1_1668108_C_T_b38	SLC35E2	4.627	8.69e-06	0.102026	19	0.022049	yes	SNTTRM
chr1_1671148_C_T_b38	SLC35E2	4.626	8.73e-06	0.099193	20	0.021442	yes	SNTTRM
chr1_1651653_C_T_b38	SLC35E2	4.607	9.44e-06	0.089135	44	0.019346	yes	SNTTRM
chr1_1661562_G_C_b38	SLC35E2	4.559	1.15e-05	0.082781	44	0.018159	yes	SNTTRM
chr1_1668721_C_T_b38	SLC35E2	-4.43	1.95e-05	-0.103706	14	0.023411	yes	SNTTRM
chr1_1658866_G_A_b38	SLC35E2	-4.309	3.17e-05	-0.095025	21	0.022053	yes	SNTTRM
chr1_1659114_A_G_b38	SLC35E2	-4.309	3.17e-05	-0.095025	21	0.022053	yes	SNTTRM
chr1_1659220_A_G_b38	SLC35E2	-4.309	3.17e-05	-0.095025	21	0.022053	yes	SNTTRM
chr1_1661420_C_A_b38	SLC35E2	-4.309	3.17e-05	-0.095025	21	0.022053	yes	SNTTRM
chr1_1639348_G_T_b38	SLC35E2	-4.244	4.09e-05	-0.092685	25	0.021838	yes	SNTTRM
chr1_1674633_C_CA_b38	SLC35E2	4.239	4.18e-05	0.095112	23	0.022439	yes	SNTTRM
chr1_1675091_A_G_b38	SLC35E2	-4.222	4.46e-05	-0.106647	9	0.025261	yes	SNTTRM
chr1_1665061_C_T_b38	SLC35E2	-4.202	4.83e-05	-0.108806	9	0.025897	yes	SNTTRM
chr1_1667948_A_G_b38	SLC35E2	-4.168	5.49e-05	-0.108732	9	0.026085	yes	SNTTRM
chr1_1668717_C_G_b38	SLC35E2	-4.168	5.49e-05	-0.108732	9	0.026085	yes	SNTTRM
chr1_1668542_C_T_b38	SLC35E2	-4.158	5.73e-05	-0.111127	7	0.026729	yes	SNTTRM
chr1_1650777_G_A_b38	SLC35E2	-4.147	5.96e-05	-0.092224	20	0.022238	yes	SNTTRM
chr1_1673968_GA_G_b38	SLC35E2	4.132	6.32e-05	0.097288	22	0.023544	yes	SNTTRM
chr1_1660408_T_C_b38	SLC35E2	-4.078	7.77e-05	-0.113779	5	0.027898	yes	SNTTRM
chr1_1669576_G_A_b38	SLC35E2	-4.068	8.08e-05	-0.108845	8	0.026756	yes	SNTTRM
chr1_1708474_C_A_b38	SLC35E2	-4.043	8.89e-05	-0.120421	3	0.029787	yes	SNTTRM
chr1_1651137_C_T_b38	SLC35E2	-4.04	8.99e-05	-0.090397	20	0.022376	yes	SNTTRM
chr1_1651267_T_C_b38	SLC35E2	-4.04	8.99e-05	-0.090397	20	0.022376	yes	SNTTRM
chr1_1651421_GTAGCCCCTCTGAACGGTCTGTGACACACGCATGCTTTCAGCTAGAGTACTCTA_G_b38	SLC35E2	-4.04	8.99e-05	-0.090397	20	0.022376	yes	SNTTRM
chr1_1651785_C_A_b38	SLC35E2	-4.04	8.99e-05	-0.090397	20	0.022376	yes	SNTTRM
chr1_1651926_T_C_b38	SLC35E2	-4.04	8.99e-05	-0.090397	20	0.022376	yes	SNTTRM
chr1_1652061_T_C_b38	SLC35E2	-4.04	8.99e-05	-0.090397	20	0.022376	yes	SNTTRM
chr1_1652135_C_G_b38	SLC35E2	-4.04	8.99e-05	-0.090397	20	0.022376	yes	SNTTRM
chr1_1652191_C_T_b38	SLC35E2	-4.04	8.99e-05	-0.090397	20	0.022376	yes	SNTTRM
chr1_1652592_A_G_b38	SLC35E2	-4.04	8.99e-05	-0.090397	20	0.022376	yes	SNTTRM
chr1_1652779_A_G_b38	SLC35E2	-4.04	8.99e-05	-0.090397	20	0.022376	yes	SNTTRM
chr1_1653147_A_C_b38	SLC35E2	-4.04	8.99e-05	-0.090397	20	0.022376	yes	SNTTRM
chr1_1653396_T_C_b38	SLC35E2	-4.04	8.99e-05	-0.090397	20	0.022376	yes	SNTTRM
chr1_1653472_T_C_b38	SLC35E2	-4.04	8.99e-05	-0.090397	20	0.022376	yes	SNTTRM
chr1_1653811_G_A_b38	SLC35E2	-4.04	8.99e-05	-0.090397	20	0.022376	yes	SNTTRM
chr1_1653893_C_T_b38	SLC35E2	-4.04	8.99e-05	-0.090397	20	0.022376	yes	SNTTRM
chr1_1653934_G_A_b38	SLC35E2	-4.04	8.99e-05	-0.090397	20	0.022376	yes	SNTTRM
chr1_1654143_G_A_b38	SLC35E2	-4.04	8.99e-05	-0.090397	20	0.022376	yes	SNTTRM
chr1_1654188_T_G_b38	SLC35E2	-4.04	8.99e-05	-0.090397	20	0.022376	yes	SNTTRM
chr1_1667424_T_TAAAATA_b38	SLC35E2	4.017	9.8e-05	0.095478	20	0.023768	yes	SNTTRM
chr1_1728671_C_A_b38	SLC35E2	3.973	0.000116	0.121137	5	0.030491	yes	SNTTRM
chr1_1669613_G_A_b38	SLC35E2	-3.97	0.000117	-0.104273	9	0.026268	yes	SNTTRM
chr1_1661177_A_G_b38	SLC35E2	-3.925	0.000139	-0.10141	9	0.025839	yes	SNTTRM
chr1_1649976_G_A_b38	SLC35E2	3.915	0.000144	0.076802	38	0.019616	yes	SNTTRM
chr1_1729859_A_G_b38	SLC35E2	3.912	0.000145	0.11855	4	0.030305	yes	SNTTRM
chr1_1648826_A_G_b38	SLC35E2	-3.893	0.000156	-0.087035	24	0.022357	yes	SNTTRM
chr1_1648636_G_A_b38	SLC35E2	-3.88	0.000164	-0.086576	24	0.022315	yes	SNTTRM
chr1_1650370_C_CT_b38	SLC35E2	-3.806	0.000215	-0.089013	13	0.023388	yes	SNTTRM
chr1_1651574_G_A_b38	SLC35E2	-3.759	0.000255	-0.084614	20	0.022512	yes	SNTTRM
chr1_1725582_T_C_b38	SLC35E2	3.757	0.000257	0.069041	40	0.018378	yes	SNTTRM
chr1_1665581_C_G_b38	SLC35E2	-3.753	0.00026	-0.095189	9	0.025363	yes	SNTTRM
chr1_1650383_G_T_b38	SLC35E2	-3.735	0.000278	-0.084748	18	0.022692	yes	SNTTRM
chr1_1591419_A_G_b38	SLC35E2	3.688	0.000329	0.102982	3	0.027927	yes	SNTTRM
chr1_1670423_AT_A_b38	SLC35E2	3.643	0.000385	0.090501	21	0.024841	yes	SNTTRM
chr1_1664865_A_G_b38	SLC35E2	-3.619	0.000419	-0.08002	20	0.02211	yes	SNTTRM
chr1_1637577_T_C_b38	SLC35E2	-3.6	0.000449	-0.085809	12	0.023838	yes	SNTTRM
chr1_1641275_A_G_b38	SLC35E2	-3.596	0.000454	-0.080205	24	0.022302	yes	SNTTRM
chr1_1363601_A_AT_b38	SLC35E2	3.573	0.000492	0.074708	48	0.020908	yes	SNTTRM
chr1_1431014_G_A_b38	SLC35E2	-3.569	0.000499	-0.096155	10	0.02694	yes	SNTTRM
chr1_1708505_G_C_b38	SLC35E2	3.535	0.000562	0.073577	26	0.020815	yes	SNTTRM
chr1_1652913_C_T_b38	SLC35E2	-3.524	0.000584	-0.08344	16	0.02368	yes	SNTTRM
chr1_1708855_TTCCTCCTCC_T_b38	SLC35E2	3.454	0.000741	0.076454	31	0.022135	yes	SNTTRM
chr1_1650688_T_A_b38	SLC35E2	-3.422	0.000826	-0.080523	16	0.023529	yes	SNTTRM
chr1_1664757_T_C_b38	SLC35E2	-3.394	0.000908	-0.07314	20	0.021549	yes	SNTTRM
chr1_1658830_C_G_b38	SLC35E2	-3.377	0.00096	-0.083482	11	0.024717	yes	SNTTRM
chr1_1435945_C_CCGGGCGGGGGCG_b38	SLC35E2	-3.361	0.00102	-0.102388	5	0.030468	yes	SNTTRM
chr1_2124387_G_A_b38	SLC35E2	-3.322	0.00115	-0.149423	4	0.04498	yes	SNTTRM
chr1_1639685_G_A_b38	SLC35E2	-3.249	0.00147	-0.084209	9	0.025919	yes	SNTTRM
chr1_1440430_C_G_b38	SLC35E2	-3.242	0.0015	-0.095161	10	0.029348	yes	SNTTRM
chr1_1591703_T_C_b38	SLC35E2	3.131	0.00214	0.065889	33	0.021045	yes	SNTTRM
chr1_1650664_CTTTTT_C_b38	SLC35E2	-3.102	0.00235	-0.078257	12	0.025228	yes	SNTTRM
chr1_1667424_T_TAAATA_b38	SLC35E2	-3.087	0.00246	-0.070562	25	0.022858	yes	SNTTRM
chr1_1668373_C_T_b38	SLC35E2	3.056	0.00271	0.076709	20	0.025104	yes	SNTTRM
chr1_1743544_CA_C_b38	SLC35E2	3.045	0.00281	0.071232	28	0.023397	yes	SNTTRM
chr1_1428969_T_C_b38	SLC35E2	-3.017	0.00306	-0.083915	24	0.027817	yes	SNTTRM
chr1_1426261_C_T_b38	SLC35E2	-3.014	0.00309	-0.084693	23	0.028102	yes	SNTTRM
chr1_1426810_C_G_b38	SLC35E2	-3.014	0.00309	-0.084693	23	0.028102	yes	SNTTRM
chr1_1572877_T_TG_b38	SLC35E2	-3.007	0.00316	-0.080962	4	0.026929	yes	SNTTRM
chr1_1631710_T_C_b38	SLC35E2	3.002	0.00321	0.089996	4	0.029981	yes	SNTTRM
chr1_1430190_A_C_b38	SLC35E2	-2.942	0.00385	-0.08219	24	0.02794	yes	SNTTRM
chr1_1708486_C_A_b38	SLC35E2	2.929	0.004	0.060641	33	0.020701	yes	SNTTRM
chr1_1641261_C_T_b38	SLC35E2	-2.917	0.00415	-0.075443	7	0.025865	yes	SNTTRM
chr1_1609890_C_T_b38	SLC35E2	-2.904	0.00432	-0.098696	4	0.033991	yes	SNTTRM
chr1_1627156_G_A_b38	SLC35E2	-2.904	0.00432	-0.098696	4	0.033991	yes	SNTTRM
chr1_1992226_A_G_b38	SLC35E2	2.887	0.00454	0.061514	38	0.021306	yes	SNTTRM
chr1_1584321_T_C_b38	SLC35E2	-2.882	0.00461	-0.06155	27	0.021359	yes	SNTTRM
chr1_1430908_A_G_b38	SLC35E2	-2.869	0.00479	-0.079588	24	0.027742	yes	SNTTRM
chr1_1431450_A_G_b38	SLC35E2	-2.852	0.00503	-0.079667	24	0.027931	yes	SNTTRM
chr1_1431537_G_C_b38	SLC35E2	-2.852	0.00503	-0.079667	24	0.027931	yes	SNTTRM
chr1_1586962_C_T_b38	SLC35E2	2.831	0.00536	0.05924	26	0.020925	yes	SNTTRM
chr1_1638879_C_T_b38	SLC35E2	-2.824	0.00547	-0.072082	10	0.025522	yes	SNTTRM
chr1_1454612_A_G_b38	SLC35E2	-2.755	0.00669	-0.127331	4	0.046214	yes	SNTTRM
chr1_1375678_TAA_T_b38	SLC35E2	-2.734	0.00712	-0.084921	5	0.031065	yes	SNTTRM
chr1_2325032_T_A_b38	SLC35E2	-2.725	0.00729	-0.112322	6	0.041218	yes	SNTTRM
chr1_1635226_T_C_b38	SLC35E2	-2.685	0.00819	-0.084264	3	0.031388	yes	SNTTRM
chr1_1452812_G_A_b38	SLC35E2	-2.675	0.00841	-0.145941	3	0.054557	yes	SNTTRM
chr1_1708951_C_T_b38	SLC35E2	2.672	0.00849	0.059207	28	0.02216	yes	SNTTRM
chr1_1330125_G_A_b38	SLC35E2	2.67	0.00852	0.078928	24	0.029557	yes	SNTTRM
chr1_1619986_T_C_b38	SLC35E2	2.648	0.00909	0.060874	14	0.022992	yes	SNTTRM
chr1_2323471_T_C_b38	SLC35E2	-2.642	0.00922	-0.06528	11	0.024705	yes	SNTTRM
chr1_1675228_C_CG_b38	SLC35E2	2.62	0.00983	0.062039	25	0.023683	yes	SNTTRM
chr1_1708521_C_G_b38	SLC35E2	-4.715	6.03e-06	-0.117294	10	0.024879	no	SNTTRM
chr1_1648736_G_A_b38	SLC35E2	4.449	1.81e-05	0.086637	42	0.019474	no	SNTTRM
chr1_1649932_C_T_b38	SLC35E2	4.393	2.26e-05	0.08639	41	0.019666	no	SNTTRM
chr1_1688328_C_T_b38	SLC35E2	-3.823	0.000202	-0.098578	7	0.025788	no	SNTTRM
chr1_1646352_A_C_b38	SLC35E2	3.795	0.000223	0.11227	4	0.02958	no	SNTTRM
chr1_1659060_G_A_b38	SLC35E2	-3.777	0.000239	-0.087785	17	0.023244	no	SNTTRM
chr1_1636278_G_T_b38	SLC35E2	3.776	0.00024	0.075397	39	0.019969	no	SNTTRM
chr1_1439805_G_C_b38	SLC35E2	-3.594	0.000458	-0.099583	8	0.027709	no	SNTTRM
chr1_1630798_C_T_b38	SLC35E2	3.592	0.000461	0.089087	14	0.024805	no	SNTTRM
chr1_1186816_A_G_b38	SLC35E2	3.515	0.000602	0.117745	3	0.033497	no	SNTTRM
chr1_1629332_G_T_b38	SLC35E2	3.432	0.000799	0.084315	14	0.024567	no	SNTTRM
chr1_1185961_C_T_b38	SLC35E2	3.426	0.000814	0.106321	3	0.03103	no	SNTTRM
chr1_1186245_C_G_b38	SLC35E2	3.426	0.000814	0.106321	3	0.03103	no	SNTTRM
chr1_1723766_C_T_b38	SLC35E2	-3.387	0.00093	-0.090637	10	0.026761	no	SNTTRM
chr1_1170681_G_A_b38	SLC35E2	3.316	0.00118	0.068264	35	0.020585	no	SNTTRM
chr1_2691671_T_C_b38	SLC35E2	3.315	0.00118	0.099496	6	0.030012	no	SNTTRM
chr1_1654662_CT_C_b38	SLC35E2	3.145	0.00205	0.069063	28	0.021959	no	SNTTRM
chr1_2682331_C_T_b38	SLC35E2	3.13	0.00215	0.081187	27	0.025939	no	SNTTRM
chr1_1613769_C_T_b38	SLC35E2	3.112	0.00227	0.076071	14	0.024444	no	SNTTRM
chr1_1547458_A_G_b38	SLC35E2	-3.108	0.0023	-0.180674	3	0.058124	no	SNTTRM
chr1_1431656_G_A_b38	SLC35E2	-3.102	0.00235	-0.099956	4	0.032222	no	SNTTRM
chr1_1361679_G_A_b38	SLC35E2	3.101	0.00236	0.090347	16	0.029138	no	SNTTRM
chr1_1546962_G_A_b38	SLC35E2	-3.063	0.00266	-0.168602	4	0.055051	no	SNTTRM
chr1_1442793_G_A_b38	SLC35E2	-3.059	0.00269	-0.100733	3	0.032935	no	SNTTRM
chr1_1426253_G_A_b38	SLC35E2	-3.04	0.00285	-0.102864	3	0.033835	no	SNTTRM
chr1_1730405_G_C_b38	SLC35E2	2.93	0.00399	0.07355	22	0.025101	no	SNTTRM
chr1_1185634_G_A_b38	SLC35E2	2.909	0.00424	0.095628	3	0.032868	no	SNTTRM
chr1_1186414_G_A_b38	SLC35E2	2.909	0.00424	0.095628	3	0.032868	no	SNTTRM
chr1_1454676_T_A_b38	SLC35E2	-2.888	0.00453	-0.138508	3	0.047964	no	SNTTRM
chr1_1455134_T_A_b38	SLC35E2	-2.888	0.00453	-0.138508	3	0.047964	no	SNTTRM
chr1_2006596_C_CA_b38	SLC35E2	-2.878	0.00466	-0.076277	10	0.026499	no	SNTTRM
chr1_1773713_T_A_b38	SLC35E2	-2.871	0.00476	-0.061563	24	0.021444	no	SNTTRM
chr1_2698543_GGGCAGCCTGGAGCAGCACCCACACCCCCAGATGAGCATCT_G_b38	SLC35E2	2.845	0.00514	0.112807	4	0.039646	no	SNTTRM
chr1_2500892_C_A_b38	SLC35E2	2.842	0.00519	0.059431	30	0.020911	no	SNTTRM
chr1_1589495_CTTT_C_b38	SLC35E2	2.802	0.00584	0.068827	12	0.024566	no	SNTTRM
chr1_1265603_T_TTGTG_b38	SLC35E2	-2.799	0.00588	-0.074115	5	0.026475	no	SNTTRM
chr1_1949125_T_TTCCC_b38	SLC35E2	2.771	0.00638	0.080513	5	0.029052	no	SNTTRM
chr1_1621352_G_A_b38	SLC35E2	2.717	0.00746	0.062904	18	0.023151	no	SNTTRM
chr1_1308548_G_GT_b38	SLC35E2	2.691	0.00804	0.121549	3	0.045167	no	SNTTRM
chr1_813498_G_T_b38	SLC35E2	2.615	0.00996	0.071542	9	0.02736	no	SNTTRM
chr1_1688328_C_T_b38	SLC35E2	-4.885	2.22e-06	-0.123916	11	0.025367	yes	SPLEEN
chr1_1675091_A_G_b38	SLC35E2	-4.314	2.6e-05	-0.105809	11	0.024528	yes	SPLEEN
chr1_1750428_G_C_b38	SLC35E2	-4.109	5.95e-05	-0.099786	33	0.024284	yes	SPLEEN
chr1_1750440_G_A_b38	SLC35E2	-4.085	6.54e-05	-0.097494	32	0.023864	yes	SPLEEN
chr1_1698022_G_A_b38	SLC35E2	-4.085	6.55e-05	-0.227469	8	0.055686	yes	SPLEEN
chr1_1746522_GT_G_b38	SLC35E2	-4.034	8.01e-05	-0.106895	11	0.0265	yes	SPLEEN
chr1_1747695_A_G_b38	SLC35E2	-3.979	9.9e-05	-0.070793	59	0.01779	yes	SPLEEN
chr1_1752908_C_CCCT_b38	SLC35E2	-3.971	0.000102	-0.092758	42	0.023357	yes	SPLEEN
chr1_1753033_C_T_b38	SLC35E2	-3.959	0.000107	-0.089829	49	0.022687	yes	SPLEEN
chr1_1851414_GA_G_b38	SLC35E2	-3.888	0.000141	-0.09076	30	0.023345	yes	SPLEEN
chr1_1757725_C_T_b38	SLC35E2	3.88	0.000145	0.09111	26	0.023482	yes	SPLEEN
chr1_1251356_AT_A_b38	SLC35E2	-3.852	0.000161	-0.101903	6	0.026452	yes	SPLEEN
chr1_1746440_A_G_b38	SLC35E2	-3.845	0.000166	-0.105563	10	0.027456	yes	SPLEEN
chr1_1671995_G_T_b38	SLC35E2	3.772	0.000217	0.076955	55	0.0204	yes	SPLEEN
chr1_1692151_T_C_b38	SLC35E2	-3.724	0.00026	-0.095436	17	0.025628	yes	SPLEEN
chr1_1679993_A_G_b38	SLC35E2	-3.716	0.000267	-0.080835	48	0.021752	yes	SPLEEN
chr1_1744652_C_T_b38	SLC35E2	-3.708	0.000275	-0.081276	51	0.021917	yes	SPLEEN
chr1_1756043_G_T_b38	SLC35E2	-3.695	0.00029	-0.084383	48	0.02284	yes	SPLEEN
chr1_1752730_C_G_b38	SLC35E2	-3.685	0.000299	-0.084472	48	0.022921	yes	SPLEEN
chr1_1753319_G_A_b38	SLC35E2	-3.685	0.000299	-0.084472	48	0.022921	yes	SPLEEN
chr1_1753361_G_A_b38	SLC35E2	-3.685	0.000299	-0.084472	48	0.022921	yes	SPLEEN
chr1_1752461_G_A_b38	SLC35E2	-3.665	0.000322	-0.084447	48	0.023039	yes	SPLEEN
chr1_1744028_A_AC_b38	SLC35E2	-3.653	0.000337	-0.103866	10	0.028432	yes	SPLEEN
chr1_1744121_A_C_b38	SLC35E2	-3.617	0.000383	-0.106598	22	0.029468	yes	SPLEEN
chr1_1754601_G_T_b38	SLC35E2	3.615	0.000387	0.084747	26	0.023444	yes	SPLEEN
chr1_1744499_C_T_b38	SLC35E2	-3.614	0.000389	-0.075572	51	0.020914	yes	SPLEEN
chr1_1674868_G_A_b38	SLC35E2	3.585	0.00043	0.074511	54	0.020783	yes	SPLEEN
chr1_1750226_C_T_b38	SLC35E2	3.576	0.000445	0.08301	28	0.023216	yes	SPLEEN
chr1_2425690_G_GT_b38	SLC35E2	-3.573	0.000449	-0.092727	7	0.025951	yes	SPLEEN
chr1_1779667_T_TTG_b38	SLC35E2	3.57	0.000455	0.081737	29	0.022897	yes	SPLEEN
chr1_1680672_C_T_b38	SLC35E2	-3.562	0.000468	-0.079424	31	0.022299	yes	SPLEEN
chr1_1676790_C_T_b38	SLC35E2	3.545	0.000497	0.070916	57	0.020007	yes	SPLEEN
chr1_1674720_TGC_T_b38	SLC35E2	3.517	0.000549	0.073452	53	0.020886	yes	SPLEEN
chr1_1754482_TCCCTGGGACCGAAGTCGCCCCA_T_b38	SLC35E2	-3.516	0.00055	-0.080764	48	0.022968	yes	SPLEEN
chr1_1677720_T_G_b38	SLC35E2	3.492	0.000598	0.071444	56	0.020457	yes	SPLEEN
chr1_1683909_A_C_b38	SLC35E2	-3.489	0.000605	-0.074323	44	0.021302	yes	SPLEEN
chr1_1743851_C_T_b38	SLC35E2	-3.472	0.000643	-0.089183	18	0.025687	yes	SPLEEN
chr1_1804004_G_A_b38	SLC35E2	3.467	0.000655	0.064591	25	0.018633	yes	SPLEEN
chr1_1759611_C_T_b38	SLC35E2	-3.453	0.000685	-0.079241	48	0.022946	yes	SPLEEN
chr1_1687734_CAA_C_b38	SLC35E2	-3.453	0.000687	-0.078705	30	0.022796	yes	SPLEEN
chr1_1687643_G_A_b38	SLC35E2	-3.432	0.000739	-0.072837	41	0.021226	yes	SPLEEN
chr1_1744052_GAGA_G_b38	SLC35E2	-3.431	0.000742	-0.098673	11	0.028762	yes	SPLEEN
chr1_1755713_G_A_b38	SLC35E2	-3.428	0.000748	-0.077379	44	0.02257	yes	SPLEEN
chr1_1743840_T_C_b38	SLC35E2	-3.421	0.000767	-0.087856	19	0.025682	yes	SPLEEN
chr1_1687153_A_G_b38	SLC35E2	-3.417	0.000777	-0.072402	44	0.021187	yes	SPLEEN
chr1_1079456_A_G_b38	SLC35E2	-3.401	0.000822	-0.065881	60	0.019371	yes	SPLEEN
chr1_1759354_G_A_b38	SLC35E2	-3.382	0.000879	-0.076908	48	0.022744	yes	SPLEEN
chr1_1680214_T_C_b38	SLC35E2	-3.373	0.000904	-0.071952	41	0.02133	yes	SPLEEN
chr1_2304920_G_A_b38	SLC35E2	-3.343	0.001	-0.09883	4	0.02956	yes	SPLEEN
chr1_1684266_T_C_b38	SLC35E2	-3.336	0.00103	-0.071219	38	0.021347	yes	SPLEEN
chr1_1687159_G_T_b38	SLC35E2	-3.336	0.00103	-0.071219	38	0.021347	yes	SPLEEN
chr1_1743238_G_C_b38	SLC35E2	-3.333	0.00103	-0.076376	40	0.022912	yes	SPLEEN
chr1_1750280_A_G_b38	SLC35E2	-3.306	0.00113	-0.07261	50	0.02196	yes	SPLEEN
chr1_1684308_G_C_b38	SLC35E2	-3.293	0.00119	-0.070437	37	0.021392	yes	SPLEEN
chr1_1684619_G_A_b38	SLC35E2	-3.293	0.00119	-0.070437	37	0.021392	yes	SPLEEN
chr1_1688619_AAAC_A_b38	SLC35E2	-3.291	0.0012	-0.084177	19	0.025581	yes	SPLEEN
chr1_1688647_G_A_b38	SLC35E2	-3.29	0.0012	-0.085141	18	0.025881	yes	SPLEEN
chr1_1742672_C_T_b38	SLC35E2	-3.288	0.0012	-0.0746	41	0.022685	yes	SPLEEN
chr1_1976855_C_CTT_b38	SLC35E2	3.269	0.00129	0.085485	12	0.026151	yes	SPLEEN
chr1_1680556_A_G_b38	SLC35E2	-3.257	0.00134	-0.071401	41	0.021925	yes	SPLEEN
chr1_1749826_A_G_b38	SLC35E2	-3.243	0.0014	-0.067835	56	0.020917	yes	SPLEEN
chr1_1747472_A_T_b38	SLC35E2	-3.225	0.00149	-0.07519	47	0.023313	yes	SPLEEN
chr1_1681164_G_A_b38	SLC35E2	-3.222	0.0015	-0.069148	40	0.021459	yes	SPLEEN
chr1_1764023_C_A_b38	SLC35E2	3.213	0.00155	0.075009	28	0.023348	yes	SPLEEN
chr1_1742587_G_C_b38	SLC35E2	3.206	0.00159	0.070495	40	0.02199	yes	SPLEEN
chr1_1002415_C_CATTTT_b38	SLC35E2	-3.206	0.00159	-0.064364	44	0.020079	yes	SPLEEN
chr1_1751981_A_T_b38	SLC35E2	-3.197	0.00163	-0.076581	25	0.023954	yes	SPLEEN
chr1_1756186_T_C_b38	SLC35E2	3.179	0.00173	0.072856	28	0.022922	yes	SPLEEN
chr1_1755523_C_T_b38	SLC35E2	3.163	0.00182	0.069952	40	0.022112	yes	SPLEEN
chr1_1688786_G_A_b38	SLC35E2	-3.16	0.00184	-0.08974	10	0.028396	yes	SPLEEN
chr1_1940540_G_A_b38	SLC35E2	-3.158	0.00186	-0.070826	44	0.02243	yes	SPLEEN
chr1_1942260_G_C_b38	SLC35E2	-3.158	0.00186	-0.070826	44	0.02243	yes	SPLEEN
chr1_1940973_C_T_b38	SLC35E2	-3.154	0.00188	-0.070073	45	0.022217	yes	SPLEEN
chr1_1691417_T_C_b38	SLC35E2	3.153	0.00189	0.073208	43	0.02322	yes	SPLEEN
chr1_1836126_C_A_b38	SLC35E2	-3.134	0.00201	-0.069071	51	0.022042	yes	SPLEEN
chr1_1770997_G_A_b38	SLC35E2	-3.116	0.00213	-0.069171	50	0.0222	yes	SPLEEN
chr1_1942014_G_A_b38	SLC35E2	-3.113	0.00214	-0.069691	43	0.022384	yes	SPLEEN
chr1_1942075_A_G_b38	SLC35E2	-3.113	0.00214	-0.069691	43	0.022384	yes	SPLEEN
chr1_1942086_T_C_b38	SLC35E2	-3.113	0.00214	-0.069691	43	0.022384	yes	SPLEEN
chr1_1757074_G_T_b38	SLC35E2	3.109	0.00217	0.071891	27	0.023123	yes	SPLEEN
chr1_1951106_G_A_b38	SLC35E2	-3.108	0.00218	-0.070218	49	0.022595	yes	SPLEEN
chr1_1861110_C_CA_b38	SLC35E2	-3.107	0.00218	-0.06138	42	0.019754	yes	SPLEEN
chr1_1658830_C_G_b38	SLC35E2	-3.101	0.00223	-0.075079	14	0.024208	yes	SPLEEN
chr1_1686017_A_AT_b38	SLC35E2	-3.086	0.00234	-0.064256	41	0.020825	yes	SPLEEN
chr1_1687061_C_T_b38	SLC35E2	-3.086	0.00234	-0.064256	41	0.020825	yes	SPLEEN
chr1_1748780_G_A_b38	SLC35E2	-3.085	0.00235	-0.069273	47	0.022455	yes	SPLEEN
chr1_1748597_C_G_b38	SLC35E2	-3.072	0.00245	-0.072361	48	0.023556	yes	SPLEEN
chr1_1951865_G_GT_b38	SLC35E2	-3.06	0.00254	-0.069222	49	0.022621	yes	SPLEEN
chr1_1743886_C_T_b38	SLC35E2	-3.059	0.00255	-0.081772	17	0.026732	yes	SPLEEN
chr1_1934565_G_A_b38	SLC35E2	-3.044	0.00267	-0.070055	46	0.023015	yes	SPLEEN
chr1_1755504_T_C_b38	SLC35E2	3.036	0.00274	0.067116	41	0.022105	yes	SPLEEN
chr1_1942258_G_A_b38	SLC35E2	-3.034	0.00276	-0.068177	44	0.022472	yes	SPLEEN
chr1_1843381_A_T_b38	SLC35E2	-3.033	0.00276	-0.070093	50	0.023108	yes	SPLEEN
chr1_1847030_A_G_b38	SLC35E2	-3.033	0.00276	-0.070093	50	0.023108	yes	SPLEEN
chr1_1850017_G_T_b38	SLC35E2	-3.033	0.00276	-0.070093	50	0.023108	yes	SPLEEN
chr1_1937841_ACACCAGGTCCACCTCTGGACACAGGTCCACC_A_b38	SLC35E2	-3.027	0.00282	-0.067645	44	0.022347	yes	SPLEEN
chr1_1938054_ACT_A_b38	SLC35E2	-3.027	0.00282	-0.067645	44	0.022347	yes	SPLEEN
chr1_1846009_AGG_A_b38	SLC35E2	-3.024	0.00285	-0.069402	51	0.02295	yes	SPLEEN
chr1_1846011_G_GTCC_b38	SLC35E2	-3.024	0.00285	-0.069402	51	0.02295	yes	SPLEEN
chr1_1459662_C_T_b38	SLC35E2	-3.016	0.00292	-0.115962	18	0.038444	yes	SPLEEN
chr1_1950071_C_T_b38	SLC35E2	-3.015	0.00293	-0.068707	48	0.022787	yes	SPLEEN
chr1_1952064_G_A_b38	SLC35E2	-3.015	0.00293	-0.068707	48	0.022787	yes	SPLEEN
chr1_1881428_C_CT_b38	SLC35E2	-3.009	0.00299	-0.06964	49	0.023147	yes	SPLEEN
chr1_1937046_G_A_b38	SLC35E2	3.008	0.003	0.087016	6	0.02893	yes	SPLEEN
chr1_1948515_C_T_b38	SLC35E2	-3.004	0.00304	-0.067794	56	0.022571	yes	SPLEEN
chr1_1948519_T_C_b38	SLC35E2	-3.004	0.00304	-0.067794	56	0.022571	yes	SPLEEN
chr1_1752126_G_A_b38	SLC35E2	2.998	0.00309	0.074993	17	0.025013	yes	SPLEEN
chr1_1976870_C_CAG_b38	SLC35E2	2.993	0.00314	0.068469	20	0.022876	yes	SPLEEN
chr1_1932079_AC_A_b38	SLC35E2	-2.987	0.0032	-0.067943	29	0.022745	yes	SPLEEN
chr1_1916417_G_T_b38	SLC35E2	-2.974	0.00332	-0.066411	41	0.022327	yes	SPLEEN
chr1_1936627_C_G_b38	SLC35E2	-2.973	0.00334	-0.066911	41	0.022504	yes	SPLEEN
chr1_1936077_C_T_b38	SLC35E2	-2.973	0.00334	-0.067439	42	0.022685	yes	SPLEEN
chr1_2429693_C_T_b38	SLC35E2	-2.969	0.00338	-0.077581	7	0.026131	yes	SPLEEN
chr1_1912607_C_T_b38	SLC35E2	-2.967	0.0034	-0.070605	45	0.023797	yes	SPLEEN
chr1_1769969_CAAAACAAAAACA_C_b38	SLC35E2	-2.961	0.00346	-0.06736	52	0.022746	yes	SPLEEN
chr1_1804002_AAG_A_b38	SLC35E2	-2.961	0.00347	-0.057916	45	0.01956	yes	SPLEEN
chr1_1952823_TA_T_b38	SLC35E2	-2.957	0.00351	-0.066931	48	0.022638	yes	SPLEEN
chr1_1810086_A_G_b38	SLC35E2	2.944	0.00366	0.080089	7	0.027207	yes	SPLEEN
chr1_1981144_T_G_b38	SLC35E2	2.939	0.00371	0.073341	14	0.024953	yes	SPLEEN
chr1_939570_T_TCCCTGGAGGACC_b38	SLC35E2	-2.938	0.00372	-0.062919	27	0.021413	yes	SPLEEN
chr1_1931587_A_G_b38	SLC35E2	-2.936	0.00375	-0.065462	42	0.022298	yes	SPLEEN
chr1_1881082_C_T_b38	SLC35E2	-2.931	0.0038	-0.067943	51	0.023179	yes	SPLEEN
chr1_1692124_T_G_b38	SLC35E2	-2.931	0.00381	-0.075978	16	0.025925	yes	SPLEEN
chr1_1866508_A_G_b38	SLC35E2	-2.924	0.00388	-0.067796	51	0.023186	yes	SPLEEN
chr1_1879567_T_C_b38	SLC35E2	-2.924	0.00388	-0.067796	51	0.023186	yes	SPLEEN
chr1_1881249_A_G_b38	SLC35E2	-2.924	0.00388	-0.067796	51	0.023186	yes	SPLEEN
chr1_1886800_G_A_b38	SLC35E2	-2.924	0.00388	-0.067796	51	0.023186	yes	SPLEEN
chr1_1891654_C_CAGAG_b38	SLC35E2	-2.924	0.00388	-0.067796	51	0.023186	yes	SPLEEN
chr1_1688457_G_A_b38	SLC35E2	-2.917	0.00397	-0.075029	20	0.02572	yes	SPLEEN
chr1_1860718_A_C_b38	SLC35E2	-2.917	0.00397	-0.067192	52	0.023036	yes	SPLEEN
chr1_1695459_A_G_b38	SLC35E2	2.906	0.0041	0.074682	31	0.025698	yes	SPLEEN
chr1_1938332_A_ACT_b38	SLC35E2	-2.906	0.00411	-0.063781	46	0.02195	yes	SPLEEN
chr1_1684817_G_C_b38	SLC35E2	-2.904	0.00414	-0.065165	33	0.022443	yes	SPLEEN
chr1_1760882_T_C_b38	SLC35E2	2.902	0.00416	0.064319	35	0.022165	yes	SPLEEN
chr1_1901262_C_T_b38	SLC35E2	-2.896	0.00423	-0.068141	50	0.023526	yes	SPLEEN
chr1_1901386_C_A_b38	SLC35E2	-2.896	0.00423	-0.068141	50	0.023526	yes	SPLEEN
chr1_1762759_AAATG_A_b38	SLC35E2	2.89	0.00431	0.065323	36	0.022604	yes	SPLEEN
chr1_1981062_A_G_b38	SLC35E2	2.887	0.00435	0.064705	22	0.022412	yes	SPLEEN
chr1_1981291_A_G_b38	SLC35E2	2.887	0.00435	0.064705	22	0.022412	yes	SPLEEN
chr1_1981295_T_C_b38	SLC35E2	2.887	0.00435	0.064705	22	0.022412	yes	SPLEEN
chr1_1987145_C_T_b38	SLC35E2	2.887	0.00435	0.064705	22	0.022412	yes	SPLEEN
chr1_1649954_C_CA_b38	SLC35E2	-2.885	0.00437	-0.07539	11	0.026129	yes	SPLEEN
chr1_1831318_C_T_b38	SLC35E2	-2.88	0.00445	-0.066428	49	0.023067	yes	SPLEEN
chr1_1750528_G_A_b38	SLC35E2	-2.875	0.00451	-0.055081	56	0.019157	yes	SPLEEN
chr1_1686147_T_G_b38	SLC35E2	-2.873	0.00453	-0.063049	37	0.021943	yes	SPLEEN
chr1_1790040_C_T_b38	SLC35E2	-2.872	0.00455	-0.065364	50	0.022756	yes	SPLEEN
chr1_1791493_C_T_b38	SLC35E2	-2.872	0.00455	-0.065364	50	0.022756	yes	SPLEEN
chr1_1791592_G_A_b38	SLC35E2	-2.872	0.00455	-0.065364	50	0.022756	yes	SPLEEN
chr1_1933087_C_T_b38	SLC35E2	-2.866	0.00463	-0.0648	41	0.022607	yes	SPLEEN
chr1_1933859_A_G_b38	SLC35E2	-2.866	0.00463	-0.0648	41	0.022607	yes	SPLEEN
chr1_1750508_A_C_b38	SLC35E2	-2.865	0.00464	-0.054269	57	0.01894	yes	SPLEEN
chr1_1814815_A_AAAAAAG_b38	SLC35E2	-2.863	0.00468	-0.106574	4	0.037228	yes	SPLEEN
chr1_1764887_C_A_b38	SLC35E2	-2.849	0.00488	-0.065236	50	0.022898	yes	SPLEEN
chr1_1771864_G_A_b38	SLC35E2	-2.849	0.00488	-0.065236	50	0.022898	yes	SPLEEN
chr1_1772410_T_C_b38	SLC35E2	-2.849	0.00488	-0.065236	50	0.022898	yes	SPLEEN
chr1_1772426_T_A_b38	SLC35E2	-2.849	0.00488	-0.065236	50	0.022898	yes	SPLEEN
chr1_1773460_G_A_b38	SLC35E2	-2.849	0.00488	-0.065236	50	0.022898	yes	SPLEEN
chr1_1773476_C_G_b38	SLC35E2	-2.849	0.00488	-0.065236	50	0.022898	yes	SPLEEN
chr1_1773848_A_C_b38	SLC35E2	-2.849	0.00488	-0.065236	50	0.022898	yes	SPLEEN
chr1_1776461_GAAAC_G_b38	SLC35E2	-2.849	0.00488	-0.065236	50	0.022898	yes	SPLEEN
chr1_1777362_A_G_b38	SLC35E2	-2.849	0.00488	-0.065236	50	0.022898	yes	SPLEEN
chr1_1808816_G_T_b38	SLC35E2	-2.849	0.00488	-0.065236	50	0.022898	yes	SPLEEN
chr1_1817295_T_C_b38	SLC35E2	-2.849	0.00488	-0.065236	50	0.022898	yes	SPLEEN
chr1_1819825_G_A_b38	SLC35E2	-2.849	0.00488	-0.065236	50	0.022898	yes	SPLEEN
chr1_1827774_A_G_b38	SLC35E2	-2.849	0.00488	-0.065236	50	0.022898	yes	SPLEEN
chr1_1792927_G_A_b38	SLC35E2	-2.84	0.00501	-0.064275	50	0.022632	yes	SPLEEN
chr1_1914634_G_T_b38	SLC35E2	-2.838	0.00504	-0.061874	41	0.021802	yes	SPLEEN
chr1_1916670_G_C_b38	SLC35E2	-2.838	0.00504	-0.061874	41	0.021802	yes	SPLEEN
chr1_1797530_C_A_b38	SLC35E2	-2.836	0.00507	-0.064814	49	0.022851	yes	SPLEEN
chr1_1688586_C_T_b38	SLC35E2	-2.833	0.00512	-0.07536	14	0.026598	yes	SPLEEN
chr1_1931580_CA_C_b38	SLC35E2	-2.832	0.00514	-0.06373	41	0.022507	yes	SPLEEN
chr1_1986211_T_C_b38	SLC35E2	2.831	0.00515	0.063659	20	0.022488	yes	SPLEEN
chr1_1922670_A_G_b38	SLC35E2	-2.829	0.00519	-0.063383	40	0.022407	yes	SPLEEN
chr1_1928648_C_T_b38	SLC35E2	-2.829	0.00519	-0.063383	40	0.022407	yes	SPLEEN
chr1_1024462_C_T_b38	SLC35E2	2.824	0.00527	0.063992	26	0.022663	yes	SPLEEN
chr1_1717507_T_C_b38	SLC35E2	2.823	0.00527	0.089344	12	0.031646	yes	SPLEEN
chr1_1935938_T_C_b38	SLC35E2	-2.806	0.00555	-0.064613	37	0.023025	yes	SPLEEN
chr1_1991835_C_T_b38	SLC35E2	2.804	0.00559	0.065942	32	0.023519	yes	SPLEEN
chr1_1708474_C_A_b38	SLC35E2	-2.803	0.0056	-0.074151	13	0.026454	yes	SPLEEN
chr1_1899573_C_T_b38	SLC35E2	-2.801	0.00564	-0.066251	49	0.023657	yes	SPLEEN
chr1_1971864_C_T_b38	SLC35E2	2.8	0.00565	0.060462	37	0.021592	yes	SPLEEN
chr1_1673968_GA_G_b38	SLC35E2	2.8	0.00566	0.069987	24	0.024999	yes	SPLEEN
chr1_1921745_T_C_b38	SLC35E2	-2.799	0.00567	-0.061544	39	0.021991	yes	SPLEEN
chr1_1955080_C_CGGCTCACACCGGAAGTGAGGCTCACACCGGAAGTGA_b38	SLC35E2	-2.793	0.00576	-0.063907	41	0.022877	yes	SPLEEN
chr1_1019479_TG_T_b38	SLC35E2	-2.791	0.0058	-0.056788	53	0.020344	yes	SPLEEN
chr1_1079484_T_A_b38	SLC35E2	-2.781	0.00598	-0.055231	60	0.01986	yes	SPLEEN
chr1_1909234_G_A_b38	SLC35E2	-2.778	0.00603	-0.066088	50	0.023792	yes	SPLEEN
chr1_1909238_G_A_b38	SLC35E2	-2.778	0.00603	-0.066088	50	0.023792	yes	SPLEEN
chr1_1791389_G_A_b38	SLC35E2	2.776	0.00607	0.074497	8	0.026837	yes	SPLEEN
chr1_1762287_A_G_b38	SLC35E2	-2.775	0.00608	-0.063445	51	0.02286	yes	SPLEEN
chr1_2299360_T_C_b38	SLC35E2	-2.773	0.00612	-0.055851	48	0.02014	yes	SPLEEN
chr1_1944182_G_C_b38	SLC35E2	-2.769	0.00619	-0.067954	48	0.02454	yes	SPLEEN
chr1_1743714_C_CA_b38	SLC35E2	2.764	0.00629	0.064836	26	0.023459	yes	SPLEEN
chr1_1021472_C_T_b38	SLC35E2	-2.75	0.00655	-0.057556	51	0.020929	yes	SPLEEN
chr1_1976600_C_T_b38	SLC35E2	2.75	0.00655	0.062183	20	0.022615	yes	SPLEEN
chr1_1828894_T_TAC_b38	SLC35E2	2.744	0.00667	0.061783	36	0.022518	yes	SPLEEN
chr1_1880596_T_A_b38	SLC35E2	-2.726	0.00703	-0.063212	45	0.02319	yes	SPLEEN
chr1_1982826_T_C_b38	SLC35E2	2.726	0.00703	0.061992	20	0.022743	yes	SPLEEN
chr1_1983166_A_T_b38	SLC35E2	2.726	0.00703	0.061992	20	0.022743	yes	SPLEEN
chr1_1983956_TGG_T_b38	SLC35E2	2.726	0.00703	0.061992	20	0.022743	yes	SPLEEN
chr1_1984586_G_A_b38	SLC35E2	2.726	0.00703	0.061992	20	0.022743	yes	SPLEEN
chr1_1984601_T_C_b38	SLC35E2	2.726	0.00703	0.061992	20	0.022743	yes	SPLEEN
chr1_1984859_C_T_b38	SLC35E2	2.726	0.00703	0.061992	20	0.022743	yes	SPLEEN
chr1_1985148_G_T_b38	SLC35E2	2.726	0.00703	0.061992	20	0.022743	yes	SPLEEN
chr1_1905586_C_T_b38	SLC35E2	-2.726	0.00703	-0.06483	49	0.023786	yes	SPLEEN
chr1_1903603_G_A_b38	SLC35E2	2.725	0.00704	0.067428	11	0.02474	yes	SPLEEN
chr1_1903617_C_T_b38	SLC35E2	2.725	0.00704	0.067428	11	0.02474	yes	SPLEEN
chr1_1664757_T_C_b38	SLC35E2	-2.724	0.00706	-0.061318	22	0.02251	yes	SPLEEN
chr1_2301873_A_G_b38	SLC35E2	-2.724	0.00707	-0.084551	4	0.031042	yes	SPLEEN
chr1_1909237_G_T_b38	SLC35E2	2.72	0.00714	0.064432	14	0.023686	yes	SPLEEN
chr1_1976646_A_G_b38	SLC35E2	2.719	0.00716	0.062258	19	0.022895	yes	SPLEEN
chr1_1984595_C_T_b38	SLC35E2	2.711	0.00733	0.06119	21	0.022569	yes	SPLEEN
chr1_1688531_T_C_b38	SLC35E2	-2.704	0.00749	-0.07357	12	0.027209	yes	SPLEEN
chr1_1134040_G_C_b38	SLC35E2	2.703	0.00752	0.061375	20	0.02271	yes	SPLEEN
chr1_1945975_TG_T_b38	SLC35E2	-2.7	0.00758	-0.062751	51	0.023242	yes	SPLEEN
chr1_1976473_C_T_b38	SLC35E2	2.699	0.0076	0.061154	20	0.022659	yes	SPLEEN
chr1_1976573_T_C_b38	SLC35E2	2.699	0.0076	0.061154	20	0.022659	yes	SPLEEN
chr1_1976661_G_T_b38	SLC35E2	2.699	0.0076	0.061154	20	0.022659	yes	SPLEEN
chr1_1976946_C_T_b38	SLC35E2	2.699	0.0076	0.061154	20	0.022659	yes	SPLEEN
chr1_1976990_T_C_b38	SLC35E2	2.699	0.0076	0.061154	20	0.022659	yes	SPLEEN
chr1_1977264_C_G_b38	SLC35E2	2.699	0.0076	0.061154	20	0.022659	yes	SPLEEN
chr1_1977765_A_G_b38	SLC35E2	2.699	0.0076	0.061154	20	0.022659	yes	SPLEEN
chr1_1978404_C_T_b38	SLC35E2	2.699	0.0076	0.061154	20	0.022659	yes	SPLEEN
chr1_1978415_G_A_b38	SLC35E2	2.699	0.0076	0.061154	20	0.022659	yes	SPLEEN
chr1_1978562_C_G_b38	SLC35E2	2.699	0.0076	0.061154	20	0.022659	yes	SPLEEN
chr1_1978573_T_C_b38	SLC35E2	2.699	0.0076	0.061154	20	0.022659	yes	SPLEEN
chr1_1978647_G_T_b38	SLC35E2	2.699	0.0076	0.061154	20	0.022659	yes	SPLEEN
chr1_1978797_T_C_b38	SLC35E2	2.699	0.0076	0.061154	20	0.022659	yes	SPLEEN
chr1_1980953_G_A_b38	SLC35E2	2.699	0.0076	0.061154	20	0.022659	yes	SPLEEN
chr1_1981319_G_C_b38	SLC35E2	2.699	0.0076	0.061154	20	0.022659	yes	SPLEEN
chr1_1986010_T_G_b38	SLC35E2	2.699	0.0076	0.061154	20	0.022659	yes	SPLEEN
chr1_1986033_G_A_b38	SLC35E2	2.699	0.0076	0.061154	20	0.022659	yes	SPLEEN
chr1_1986176_A_T_b38	SLC35E2	2.699	0.0076	0.061154	20	0.022659	yes	SPLEEN
chr1_1986390_T_G_b38	SLC35E2	2.699	0.0076	0.061154	20	0.022659	yes	SPLEEN
chr1_1986469_A_C_b38	SLC35E2	2.699	0.0076	0.061154	20	0.022659	yes	SPLEEN
chr1_1987096_A_T_b38	SLC35E2	2.699	0.0076	0.061154	20	0.022659	yes	SPLEEN
chr1_1987156_G_A_b38	SLC35E2	2.699	0.0076	0.061154	20	0.022659	yes	SPLEEN
chr1_1907199_A_G_b38	SLC35E2	2.698	0.00763	0.06655	11	0.02467	yes	SPLEEN
chr1_1907077_C_A_b38	SLC35E2	2.695	0.00768	0.072298	9	0.026823	yes	SPLEEN
chr1_2427409_G_C_b38	SLC35E2	-2.689	0.00782	-0.072805	7	0.027076	yes	SPLEEN
chr1_1978114_T_A_b38	SLC35E2	2.686	0.00788	0.06085	20	0.022651	yes	SPLEEN
chr1_1913643_T_C_b38	SLC35E2	-2.673	0.0082	-0.064688	43	0.024204	yes	SPLEEN
chr1_1976566_T_C_b38	SLC35E2	2.667	0.00832	0.056619	43	0.021228	yes	SPLEEN
chr1_1926870_T_C_b38	SLC35E2	-2.666	0.00836	-0.058229	36	0.021844	yes	SPLEEN
chr1_1946632_C_T_b38	SLC35E2	-2.66	0.0085	-0.06558	47	0.024655	yes	SPLEEN
chr1_1025970_C_T_b38	SLC35E2	2.657	0.00856	0.059358	26	0.022338	yes	SPLEEN
chr1_1687236_T_G_b38	SLC35E2	-2.657	0.00858	-0.057203	38	0.021532	yes	SPLEEN
chr1_1025561_G_C_b38	SLC35E2	2.656	0.00858	0.059055	26	0.02223	yes	SPLEEN
chr1_1079877_A_G_b38	SLC35E2	-2.653	0.00867	-0.054229	52	0.02044	yes	SPLEEN
chr1_1866635_T_TA_b38	SLC35E2	2.65	0.00875	0.060863	30	0.022969	yes	SPLEEN
chr1_1891444_CG_C_b38	SLC35E2	-2.649	0.00877	-0.060141	49	0.022703	yes	SPLEEN
chr1_2305258_A_G_b38	SLC35E2	-2.647	0.00881	-0.081463	4	0.030771	yes	SPLEEN
chr1_1978055_C_T_b38	SLC35E2	2.644	0.00889	0.059806	20	0.02262	yes	SPLEEN
chr1_1134222_T_C_b38	SLC35E2	2.642	0.00894	0.059168	23	0.022394	yes	SPLEEN
chr1_1985090_C_T_b38	SLC35E2	2.641	0.00896	0.057537	32	0.021785	yes	SPLEEN
chr1_1977879_G_A_b38	SLC35E2	2.641	0.00897	0.058968	21	0.022329	yes	SPLEEN
chr1_1978006_A_G_b38	SLC35E2	2.641	0.00897	0.058968	21	0.022329	yes	SPLEEN
chr1_860178_C_CTTTTTTT_b38	SLC35E2	-2.636	0.00909	-0.092749	3	0.035179	yes	SPLEEN
chr1_1749637_G_T_b38	SLC35E2	2.636	0.0091	0.060973	27	0.023132	yes	SPLEEN
chr1_1978262_C_T_b38	SLC35E2	2.635	0.00912	0.059956	20	0.022753	yes	SPLEEN
chr1_1978294_G_T_b38	SLC35E2	2.635	0.00912	0.059956	20	0.022753	yes	SPLEEN
chr1_1912983_T_C_b38	SLC35E2	2.631	0.00924	0.062006	17	0.023571	yes	SPLEEN
chr1_1681928_C_A_b38	SLC35E2	-2.63	0.00926	-0.058249	38	0.022149	yes	SPLEEN
chr1_1848037_C_CTA_b38	SLC35E2	2.629	0.00927	0.058879	39	0.022393	yes	SPLEEN
chr1_1686882_T_C_b38	SLC35E2	-2.629	0.00928	-0.054831	49	0.020857	yes	SPLEEN
chr1_1743544_CA_C_b38	SLC35E2	2.621	0.00948	0.054437	42	0.020766	yes	SPLEEN
chr1_1885444_TTAGA_T_b38	SLC35E2	2.621	0.00949	0.063889	12	0.024375	yes	SPLEEN
chr1_1844830_C_A_b38	SLC35E2	2.62	0.00952	0.058203	39	0.022216	yes	SPLEEN
chr1_1048791_CAG_C_b38	SLC35E2	-2.616	0.00964	-0.056141	46	0.021464	yes	SPLEEN
chr1_1937273_T_C_b38	SLC35E2	-2.615	0.00964	-0.059021	39	0.022566	yes	SPLEEN
chr1_1766653_A_G_b38	SLC35E2	-2.61	0.0098	-0.059731	50	0.022889	yes	SPLEEN
chr1_1970506_T_A_b38	SLC35E2	-2.609	0.00982	-0.055977	33	0.021455	yes	SPLEEN
chr1_1688102_G_A_b38	SLC35E2	-5.711	4.38e-08	-0.136543	15	0.023909	no	SPLEEN
chr1_2691474_C_G_b38	SLC35E2	-4.391	1.89e-05	-0.178663	4	0.04069	no	SPLEEN
chr1_1931743_CA_C_b38	SLC35E2	-4.334	2.39e-05	-0.117788	15	0.027175	no	SPLEEN
chr1_1637577_T_C_b38	SLC35E2	-3.98	9.89e-05	-0.091687	19	0.02304	no	SPLEEN
chr1_2301093_G_A_b38	SLC35E2	-3.652	0.000338	-0.112289	3	0.030746	no	SPLEEN
chr1_2316305_G_A_b38	SLC35E2	-3.637	0.000357	-0.108426	4	0.029812	no	SPLEEN
chr1_1673818_A_C_b38	SLC35E2	3.595	0.000416	0.074471	54	0.020717	no	SPLEEN
chr1_1677726_A_T_b38	SLC35E2	3.524	0.000534	0.071746	56	0.020357	no	SPLEEN
chr1_1730405_G_C_b38	SLC35E2	3.518	0.000546	0.085844	24	0.0244	no	SPLEEN
chr1_2662748_AGCAACCACACGCACAGG_A_b38	SLC35E2	-3.479	0.000627	-0.167406	3	0.048119	no	SPLEEN
chr1_1673060_G_A_b38	SLC35E2	3.383	0.000873	0.071715	53	0.021195	no	SPLEEN
chr1_1684789_C_CAAAAA_b38	SLC35E2	-3.35	0.000979	-0.148785	4	0.044417	no	SPLEEN
chr1_1744854_C_A_b38	SLC35E2	-3.329	0.00105	-0.066961	39	0.020113	no	SPLEEN
chr1_1669576_G_A_b38	SLC35E2	-3.301	0.00115	-0.087129	9	0.026395	no	SPLEEN
chr1_1667948_A_G_b38	SLC35E2	-3.29	0.0012	-0.085764	10	0.026069	no	SPLEEN
chr1_1668717_C_G_b38	SLC35E2	-3.29	0.0012	-0.085764	10	0.026069	no	SPLEEN
chr1_1669613_G_A_b38	SLC35E2	-3.29	0.0012	-0.085764	10	0.026069	no	SPLEEN
chr1_1671797_G_A_b38	SLC35E2	3.281	0.00123	0.068681	50	0.02093	no	SPLEEN
chr1_1688442_T_C_b38	SLC35E2	-3.28	0.00124	-0.081585	21	0.024871	no	SPLEEN
chr1_1744096_C_T_b38	SLC35E2	-3.267	0.00129	-0.094162	24	0.028819	no	SPLEEN
chr1_2431325_A_T_b38	SLC35E2	-3.262	0.00132	-0.07384	18	0.022639	no	SPLEEN
chr1_1668542_C_T_b38	SLC35E2	-3.198	0.00163	-0.084579	9	0.026448	no	SPLEEN
chr1_1750589_G_A_b38	SLC35E2	-3.132	0.00202	-0.105178	6	0.03358	no	SPLEEN
chr1_1650664_CTTTTT_C_b38	SLC35E2	-3.13	0.00203	-0.077444	14	0.024742	no	SPLEEN
chr1_1649846_G_A_b38	SLC35E2	-3.128	0.00205	-0.076318	13	0.024402	no	SPLEEN
chr1_1661177_A_G_b38	SLC35E2	-3.089	0.00232	-0.079457	11	0.025723	no	SPLEEN
chr1_2295727_A_G_b38	SLC35E2	-3.085	0.00234	-0.068009	34	0.022043	no	SPLEEN
chr1_1665061_C_T_b38	SLC35E2	-3.082	0.00237	-0.079729	11	0.025866	no	SPLEEN
chr1_1132482_T_C_b38	SLC35E2	2.983	0.00324	0.07847	7	0.026304	no	SPLEEN
chr1_1134273_C_T_b38	SLC35E2	2.974	0.00333	0.071409	12	0.024008	no	SPLEEN
chr1_1659940_A_C_b38	SLC35E2	-2.953	0.00356	-0.081559	6	0.027622	no	SPLEEN
chr1_1639685_G_A_b38	SLC35E2	-2.936	0.00374	-0.076367	11	0.026007	no	SPLEEN
chr1_1722619_C_T_b38	SLC35E2	2.935	0.00375	0.08014	22	0.027303	no	SPLEEN
chr1_1641261_C_T_b38	SLC35E2	-2.928	0.00384	-0.075778	11	0.025883	no	SPLEEN
chr1_1945842_A_AAAAGAAC_b38	SLC35E2	-2.925	0.00387	-0.073043	33	0.024972	no	SPLEEN
chr1_1913504_CT_C_b38	SLC35E2	-2.917	0.00396	-0.076992	32	0.026391	no	SPLEEN
chr1_2325287_C_CCT_b38	SLC35E2	-2.9	0.00418	-0.063135	34	0.021772	no	SPLEEN
chr1_2298039_C_T_b38	SLC35E2	-2.896	0.00424	-0.083627	5	0.028881	no	SPLEEN
chr1_2430581_G_T_b38	SLC35E2	-2.892	0.00428	-0.065403	18	0.022615	no	SPLEEN
chr1_2691535_A_G_b38	SLC35E2	-2.889	0.00432	-0.137501	3	0.047594	no	SPLEEN
chr1_1849992_T_TG_b38	SLC35E2	2.88	0.00445	0.081501	6	0.028301	no	SPLEEN
chr1_2290738_G_A_b38	SLC35E2	-2.872	0.00456	-0.078849	8	0.027457	no	SPLEEN
chr1_1668721_C_T_b38	SLC35E2	-2.87	0.00458	-0.067147	19	0.023395	no	SPLEEN
chr1_1638879_C_T_b38	SLC35E2	-2.865	0.00466	-0.074287	12	0.025933	no	SPLEEN
chr1_2293719_T_A_b38	SLC35E2	-2.853	0.00482	-0.079515	8	0.02787	no	SPLEEN
chr1_1865177_G_A_b38	SLC35E2	-2.843	0.00498	-0.067232	16	0.023652	no	SPLEEN
chr1_1768171_CA_C_b38	SLC35E2	2.814	0.00541	0.080592	3	0.028635	no	SPLEEN
chr1_2431388_C_T_b38	SLC35E2	-2.801	0.00564	-0.064654	16	0.023086	no	SPLEEN
chr1_1987547_C_CT_b38	SLC35E2	2.775	0.00608	0.0646	38	0.023276	no	SPLEEN
chr1_1810077_T_A_b38	SLC35E2	-2.771	0.00615	-0.060476	31	0.021824	no	SPLEEN
chr1_2342999_A_G_b38	SLC35E2	2.761	0.00635	0.070455	10	0.025522	no	SPLEEN
chr1_1650688_T_A_b38	SLC35E2	-2.754	0.00648	-0.063161	22	0.022937	no	SPLEEN
chr1_1659060_G_A_b38	SLC35E2	-2.751	0.00652	-0.063684	22	0.023146	no	SPLEEN
chr1_2691530_A_G_b38	SLC35E2	-2.736	0.00683	-0.137661	3	0.050323	no	SPLEEN
chr1_1459658_G_A_b38	SLC35E2	-2.729	0.00695	-0.105407	22	0.038618	no	SPLEEN
chr1_1776772_TAA_T_b38	SLC35E2	-2.721	0.00712	-0.060486	27	0.022228	no	SPLEEN
chr1_1426175_T_C_b38	SLC35E2	-2.713	0.00728	-0.09541	6	0.035161	no	SPLEEN
chr1_1130717_G_A_b38	SLC35E2	2.709	0.00737	0.074538	7	0.027513	no	SPLEEN
chr1_1686321_CTTT_C_b38	SLC35E2	-2.707	0.00743	-0.064394	18	0.023791	no	SPLEEN
chr1_1983989_A_AT_b38	SLC35E2	2.695	0.00767	0.064387	14	0.023888	no	SPLEEN
chr1_1936906_CA_C_b38	SLC35E2	2.694	0.00771	0.071822	6	0.026661	no	SPLEEN
chr1_1073854_T_C_b38	SLC35E2	-2.678	0.00806	-0.053702	58	0.02005	no	SPLEEN
chr1_1849781_T_C_b38	SLC35E2	-2.675	0.00814	-0.062729	17	0.023452	no	SPLEEN
chr1_1134095_AAAAAAAG_A_b38	SLC35E2	-2.661	0.00848	-0.056382	42	0.021192	no	SPLEEN
chr1_1809189_AT_A_b38	SLC35E2	-2.648	0.0088	-0.072764	39	0.027481	no	SPLEEN
chr1_1722626_AGCG_A_b38	SLC35E2	2.641	0.00897	0.071711	22	0.027153	no	SPLEEN
chr1_1133966_C_T_b38	SLC35E2	2.639	0.00902	0.071655	7	0.027152	no	SPLEEN
chr1_1459632_T_C_b38	SLC35E2	-2.637	0.00908	-0.099719	18	0.037822	no	SPLEEN
chr1_1652913_C_T_b38	SLC35E2	-2.63	0.00924	-0.061687	21	0.023452	no	SPLEEN
chr1_1722625_A_T_b38	SLC35E2	2.627	0.00934	0.071798	22	0.027335	no	SPLEEN
chr1_1804001_AAAG_A_b38	SLC35E2	-2.619	0.00956	-0.085352	9	0.032595	no	SPLEEN
chr1_1665581_C_G_b38	SLC35E2	-2.616	0.00963	-0.064639	13	0.024708	no	SPLEEN
chr1_1985451_C_T_b38	SLC35E2	2.61	0.0098	0.057475	33	0.022022	no	SPLEEN
chr1_1957014_G_A_b38	SLC35E2	2.606	0.00989	0.060565	16	0.023237	no	SPLEEN
chr1_1957636_C_T_b38	SLC35E2	2.606	0.00989	0.060565	16	0.023237	no	SPLEEN
chr1_1674720_TGC_T_b38	SLC35E2	6.781	7.61e-11	0.119077	73	0.017561	yes	STMACH
chr1_1677726_A_T_b38	SLC35E2	6.773	7.97e-11	0.116988	77	0.017273	yes	STMACH
chr1_1677720_T_G_b38	SLC35E2	6.743	9.5e-11	0.116687	77	0.017305	yes	STMACH
chr1_1674868_G_A_b38	SLC35E2	6.708	1.17e-10	0.117688	74	0.017546	yes	STMACH
chr1_1676790_C_T_b38	SLC35E2	6.698	1.24e-10	0.114695	77	0.017124	yes	STMACH
chr1_1673818_A_C_b38	SLC35E2	6.697	1.25e-10	0.117805	74	0.017592	yes	STMACH
chr1_1673060_G_A_b38	SLC35E2	6.532	3.25e-10	0.117625	71	0.018008	yes	STMACH
chr1_1646352_A_C_b38	SLC35E2	5.787	1.99e-08	0.155921	6	0.026941	yes	STMACH
chr1_1651653_C_T_b38	SLC35E2	5.741	2.55e-08	0.104983	76	0.018288	yes	STMACH
chr1_1648736_G_A_b38	SLC35E2	5.729	2.71e-08	0.105177	69	0.018358	yes	STMACH
chr1_1654662_CT_C_b38	SLC35E2	5.686	3.4e-08	0.114661	47	0.020166	yes	STMACH
chr1_1742587_G_C_b38	SLC35E2	5.592	5.52e-08	0.100923	66	0.018046	yes	STMACH
chr1_1649932_C_T_b38	SLC35E2	5.444	1.18e-07	0.100931	69	0.018541	yes	STMACH
chr1_1670423_AT_A_b38	SLC35E2	5.225	3.5e-07	0.11735	33	0.022458	yes	STMACH
chr1_1743714_C_CA_b38	SLC35E2	5.12	5.83e-07	0.105858	36	0.020674	yes	STMACH
chr1_1730405_G_C_b38	SLC35E2	5.074	7.3e-07	0.105692	39	0.020832	yes	STMACH
chr1_1708474_C_A_b38	SLC35E2	-5.07	7.42e-07	-0.124602	16	0.024576	yes	STMACH
chr1_1744652_C_T_b38	SLC35E2	-5.05	8.17e-07	-0.093709	71	0.018555	yes	STMACH
chr1_1752126_G_A_b38	SLC35E2	5.033	8.88e-07	0.104532	35	0.020771	yes	STMACH
chr1_1744499_C_T_b38	SLC35E2	-5.03	8.97e-07	-0.091625	74	0.018214	yes	STMACH
chr1_1743840_T_C_b38	SLC35E2	-5.018	9.52e-07	-0.109848	31	0.02189	yes	STMACH
chr1_1755523_C_T_b38	SLC35E2	4.891	1.73e-06	0.088929	68	0.018182	yes	STMACH
chr1_1743851_C_T_b38	SLC35E2	-4.882	1.81e-06	-0.106341	31	0.021782	yes	STMACH
chr1_1613769_C_T_b38	SLC35E2	4.874	1.87e-06	0.100315	33	0.02058	yes	STMACH
chr1_1708521_C_G_b38	SLC35E2	-4.849	2.11e-06	-0.109833	24	0.022652	yes	STMACH
chr1_1744854_C_A_b38	SLC35E2	-4.839	2.21e-06	-0.084446	59	0.017451	yes	STMACH
chr1_1744028_A_AC_b38	SLC35E2	-4.758	3.2e-06	-0.118629	17	0.024934	yes	STMACH
chr1_1755504_T_C_b38	SLC35E2	4.742	3.45e-06	0.085408	70	0.018012	yes	STMACH
chr1_1743886_C_T_b38	SLC35E2	-4.724	3.74e-06	-0.105344	30	0.022302	yes	STMACH
chr1_1744052_GAGA_G_b38	SLC35E2	-4.684	4.48e-06	-0.113867	20	0.024311	yes	STMACH
chr1_1743238_G_C_b38	SLC35E2	-4.652	5.17e-06	-0.09028	62	0.019406	yes	STMACH
chr1_1750428_G_C_b38	SLC35E2	-4.647	5.29e-06	-0.100656	53	0.021662	yes	STMACH
chr1_1637577_T_C_b38	SLC35E2	-4.64	5.46e-06	-0.097071	21	0.020921	yes	STMACH
chr1_1757725_C_T_b38	SLC35E2	4.63	5.7e-06	0.092606	46	0.020001	yes	STMACH
chr1_1742672_C_T_b38	SLC35E2	-4.607	6.33e-06	-0.089173	63	0.019357	yes	STMACH
chr1_1692151_T_C_b38	SLC35E2	-4.499	1.02e-05	-0.09825	29	0.02184	yes	STMACH
chr1_1945842_A_AAAAGAAC_b38	SLC35E2	-4.473	1.14e-05	-0.095774	47	0.021411	yes	STMACH
chr1_1751981_A_T_b38	SLC35E2	-4.468	1.16e-05	-0.10334	31	0.023127	yes	STMACH
chr1_1754601_G_T_b38	SLC35E2	4.461	1.2e-05	0.089495	46	0.02006	yes	STMACH
chr1_1589495_CTTT_C_b38	SLC35E2	4.449	1.27e-05	0.097696	26	0.021961	yes	STMACH
chr1_1750440_G_A_b38	SLC35E2	-4.35	1.94e-05	-0.093681	53	0.021536	yes	STMACH
chr1_1756186_T_C_b38	SLC35E2	4.329	2.12e-05	0.084249	48	0.019461	yes	STMACH
chr1_1750280_A_G_b38	SLC35E2	-4.318	2.22e-05	-0.083913	76	0.019435	yes	STMACH
chr1_1750226_C_T_b38	SLC35E2	4.292	2.48e-05	0.08505	48	0.019817	yes	STMACH
chr1_1692124_T_G_b38	SLC35E2	-4.266	2.76e-05	-0.092429	29	0.021664	yes	STMACH
chr1_1757074_G_T_b38	SLC35E2	4.251	2.95e-05	0.084074	48	0.01978	yes	STMACH
chr1_1749637_G_T_b38	SLC35E2	4.249	2.96e-05	0.081318	49	0.019137	yes	STMACH
chr1_1675091_A_G_b38	SLC35E2	-4.247	2.99e-05	-0.095578	17	0.022506	yes	STMACH
chr1_1743544_CA_C_b38	SLC35E2	4.243	3.05e-05	0.078989	61	0.018618	yes	STMACH
chr1_1584321_T_C_b38	SLC35E2	-4.209	3.51e-05	-0.081593	54	0.019386	yes	STMACH
chr1_1764023_C_A_b38	SLC35E2	4.155	4.39e-05	0.080731	49	0.019432	yes	STMACH
chr1_1748780_G_A_b38	SLC35E2	-4.114	5.17e-05	-0.081386	69	0.019781	yes	STMACH
chr1_1688328_C_T_b38	SLC35E2	-4.094	5.62e-05	-0.08782	19	0.021452	yes	STMACH
chr1_1752461_G_A_b38	SLC35E2	-4.06	6.44e-05	-0.08176	74	0.020137	yes	STMACH
chr1_1752730_C_G_b38	SLC35E2	-4.06	6.44e-05	-0.08176	74	0.020137	yes	STMACH
chr1_1743586_T_TAC_b38	SLC35E2	-4.054	6.6e-05	-0.081669	44	0.020144	yes	STMACH
chr1_1753033_C_T_b38	SLC35E2	-4.045	6.84e-05	-0.08103	79	0.02003	yes	STMACH
chr1_1629332_G_T_b38	SLC35E2	4.044	6.88e-05	0.082961	37	0.020516	yes	STMACH
chr1_1945975_TG_T_b38	SLC35E2	-4.032	7.22e-05	-0.080912	76	0.020069	yes	STMACH
chr1_1942014_G_A_b38	SLC35E2	-4.029	7.3e-05	-0.077706	67	0.019287	yes	STMACH
chr1_1942075_A_G_b38	SLC35E2	-4.029	7.3e-05	-0.077706	67	0.019287	yes	STMACH
chr1_1942086_T_C_b38	SLC35E2	-4.029	7.3e-05	-0.077706	67	0.019287	yes	STMACH
chr1_1755713_G_A_b38	SLC35E2	-3.985	8.69e-05	-0.079386	66	0.019919	yes	STMACH
chr1_1944074_T_C_b38	SLC35E2	-3.973	9.12e-05	-0.080973	73	0.020379	yes	STMACH
chr1_1944091_G_C_b38	SLC35E2	-3.973	9.12e-05	-0.080973	73	0.020379	yes	STMACH
chr1_1773713_T_A_b38	SLC35E2	-3.947	0.000101	-0.080478	35	0.020388	yes	STMACH
chr1_1940973_C_T_b38	SLC35E2	-3.945	0.000102	-0.076326	68	0.019347	yes	STMACH
chr1_1756043_G_T_b38	SLC35E2	-3.936	0.000106	-0.08032	74	0.020407	yes	STMACH
chr1_1650195_A_G_b38	SLC35E2	-3.927	0.000109	-0.081987	32	0.020876	yes	STMACH
chr1_1749826_A_G_b38	SLC35E2	-3.925	0.00011	-0.073374	80	0.018695	yes	STMACH
chr1_1591703_T_C_b38	SLC35E2	3.923	0.000111	0.073244	67	0.018673	yes	STMACH
chr1_1753319_G_A_b38	SLC35E2	-3.892	0.000125	-0.078801	74	0.020245	yes	STMACH
chr1_1753361_G_A_b38	SLC35E2	-3.887	0.000128	-0.07899	74	0.02032	yes	STMACH
chr1_1940540_G_A_b38	SLC35E2	-3.871	0.000136	-0.074463	68	0.019238	yes	STMACH
chr1_1942260_G_C_b38	SLC35E2	-3.871	0.000136	-0.074463	68	0.019238	yes	STMACH
chr1_1744096_C_T_b38	SLC35E2	-3.854	0.000145	-0.104059	31	0.026998	yes	STMACH
chr1_1926870_T_C_b38	SLC35E2	-3.846	0.00015	-0.073431	60	0.019095	yes	STMACH
chr1_1945121_T_C_b38	SLC35E2	-3.845	0.000151	-0.078352	74	0.020379	yes	STMACH
chr1_1937273_T_C_b38	SLC35E2	-3.844	0.000151	-0.074561	64	0.019397	yes	STMACH
chr1_1746522_GT_G_b38	SLC35E2	-3.835	0.000157	-0.088232	22	0.023009	yes	STMACH
chr1_1835922_G_GAAA_b38	SLC35E2	-3.829	0.00016	-0.155566	7	0.04063	yes	STMACH
chr1_1849781_T_C_b38	SLC35E2	-3.823	0.000164	-0.086936	18	0.022738	yes	STMACH
chr1_1752908_C_CCCT_b38	SLC35E2	-3.818	0.000167	-0.081263	57	0.021286	yes	STMACH
chr1_1586962_C_T_b38	SLC35E2	3.805	0.000176	0.075882	42	0.019942	yes	STMACH
chr1_1942258_G_A_b38	SLC35E2	-3.794	0.000183	-0.073079	68	0.019261	yes	STMACH
chr1_1760882_T_C_b38	SLC35E2	3.79	0.000186	0.069895	62	0.018442	yes	STMACH
chr1_1865177_G_A_b38	SLC35E2	-3.733	0.000231	-0.086072	17	0.023058	yes	STMACH
chr1_1667948_A_G_b38	SLC35E2	-3.715	0.000247	-0.085523	14	0.02302	yes	STMACH
chr1_1936077_C_T_b38	SLC35E2	-3.713	0.000249	-0.070892	70	0.019091	yes	STMACH
chr1_1937841_ACACCAGGTCCACCTCTGGACACAGGTCCACC_A_b38	SLC35E2	-3.709	0.000253	-0.07136	68	0.019241	yes	STMACH
chr1_1938054_ACT_A_b38	SLC35E2	-3.702	0.00026	-0.071224	68	0.019241	yes	STMACH
chr1_1639348_G_T_b38	SLC35E2	-3.696	0.000266	-0.075522	40	0.020435	yes	STMACH
chr1_1934565_G_A_b38	SLC35E2	-3.694	0.000267	-0.072359	67	0.019588	yes	STMACH
chr1_1938332_A_ACT_b38	SLC35E2	-3.68	0.000282	-0.069735	72	0.018952	yes	STMACH
chr1_1944182_G_C_b38	SLC35E2	-3.678	0.000284	-0.074817	73	0.020341	yes	STMACH
chr1_1759354_G_A_b38	SLC35E2	-3.674	0.000289	-0.074967	74	0.020406	yes	STMACH
chr1_1944675_C_T_b38	SLC35E2	-3.671	0.000291	-0.074447	74	0.020279	yes	STMACH
chr1_1946058_T_C_b38	SLC35E2	-3.671	0.000291	-0.074447	74	0.020279	yes	STMACH
chr1_1946632_C_T_b38	SLC35E2	-3.671	0.000291	-0.074447	74	0.020279	yes	STMACH
chr1_1947189_C_T_b38	SLC35E2	-3.671	0.000291	-0.074447	74	0.020279	yes	STMACH
chr1_1702383_T_C_b38	SLC35E2	-3.67	0.000293	-0.082817	15	0.022566	yes	STMACH
chr1_1792696_C_CA_b38	SLC35E2	3.66	0.000304	0.072024	40	0.019678	yes	STMACH
chr1_1668721_C_T_b38	SLC35E2	-3.66	0.000304	-0.077698	22	0.02123	yes	STMACH
chr1_1676287_C_T_b38	SLC35E2	-3.657	0.000307	-0.09307	10	0.025448	yes	STMACH
chr1_1648636_G_A_b38	SLC35E2	-3.647	0.000318	-0.075105	39	0.020591	yes	STMACH
chr1_1779667_T_TTG_b38	SLC35E2	3.636	0.000332	0.076309	38	0.020986	yes	STMACH
chr1_1648826_A_G_b38	SLC35E2	-3.627	0.000343	-0.07462	39	0.020574	yes	STMACH
chr1_1744121_A_C_b38	SLC35E2	-3.623	0.000348	-0.097146	31	0.026813	yes	STMACH
chr1_1936627_C_G_b38	SLC35E2	-3.609	0.000366	-0.071272	64	0.019746	yes	STMACH
chr1_1722619_C_T_b38	SLC35E2	3.604	0.000374	0.089982	27	0.024969	yes	STMACH
chr1_1922670_A_G_b38	SLC35E2	-3.601	0.000378	-0.070144	63	0.01948	yes	STMACH
chr1_1928648_C_T_b38	SLC35E2	-3.601	0.000378	-0.070144	63	0.01948	yes	STMACH
chr1_1743565_AT_A_b38	SLC35E2	3.59	0.000393	0.063222	72	0.017611	yes	STMACH
chr1_1781909_C_T_b38	SLC35E2	3.586	0.000399	0.069236	59	0.019308	yes	STMACH
chr1_1946013_C_T_b38	SLC35E2	-3.569	0.000424	-0.072728	73	0.020377	yes	STMACH
chr1_1916417_G_T_b38	SLC35E2	-3.56	0.000438	-0.069526	65	0.019529	yes	STMACH
chr1_1851414_GA_G_b38	SLC35E2	-3.545	0.000464	-0.074608	47	0.021048	yes	STMACH
chr1_1722626_AGCG_A_b38	SLC35E2	3.541	0.00047	0.088249	26	0.024924	yes	STMACH
chr1_1668717_C_G_b38	SLC35E2	-3.536	0.000478	-0.081638	14	0.023087	yes	STMACH
chr1_1650777_G_A_b38	SLC35E2	-3.531	0.000488	-0.07309	31	0.020702	yes	STMACH
chr1_1661177_A_G_b38	SLC35E2	-3.529	0.000491	-0.081168	14	0.023	yes	STMACH
chr1_1935938_T_C_b38	SLC35E2	-3.528	0.000492	-0.070389	57	0.019949	yes	STMACH
chr1_1759611_C_T_b38	SLC35E2	-3.527	0.000494	-0.072723	76	0.020617	yes	STMACH
chr1_1754482_TCCCTGGGACCGAAGTCGCCCCA_T_b38	SLC35E2	-3.523	0.000502	-0.071287	76	0.020236	yes	STMACH
chr1_1653934_G_A_b38	SLC35E2	-3.506	0.000533	-0.073355	31	0.020921	yes	STMACH
chr1_1675132_A_G_b38	SLC35E2	3.505	0.000535	0.072356	41	0.020645	yes	STMACH
chr1_1675228_C_CG_b38	SLC35E2	3.505	0.000536	0.070534	48	0.020127	yes	STMACH
chr1_1651574_G_A_b38	SLC35E2	-3.502	0.00054	-0.07325	31	0.020915	yes	STMACH
chr1_1944420_A_G_b38	SLC35E2	-3.502	0.000542	-0.070284	75	0.020072	yes	STMACH
chr1_1942887_C_G_b38	SLC35E2	-3.497	0.000551	-0.070414	73	0.020136	yes	STMACH
chr1_1668542_C_T_b38	SLC35E2	-3.491	0.000563	-0.082349	12	0.023591	yes	STMACH
chr1_1931580_CA_C_b38	SLC35E2	-3.49	0.000565	-0.068835	64	0.019724	yes	STMACH
chr1_1931587_A_G_b38	SLC35E2	-3.49	0.000565	-0.068835	64	0.019724	yes	STMACH
chr1_1651137_C_T_b38	SLC35E2	-3.489	0.000566	-0.072811	31	0.020866	yes	STMACH
chr1_1651267_T_C_b38	SLC35E2	-3.489	0.000566	-0.072811	31	0.020866	yes	STMACH
chr1_1651421_GTAGCCCCTCTGAACGGTCTGTGACACACGCATGCTTTCAGCTAGAGTACTCTA_G_b38	SLC35E2	-3.489	0.000566	-0.072811	31	0.020866	yes	STMACH
chr1_1651785_C_A_b38	SLC35E2	-3.489	0.000566	-0.072811	31	0.020866	yes	STMACH
chr1_1652135_C_G_b38	SLC35E2	-3.489	0.000566	-0.072811	31	0.020866	yes	STMACH
chr1_1652191_C_T_b38	SLC35E2	-3.489	0.000566	-0.072811	31	0.020866	yes	STMACH
chr1_1652592_A_G_b38	SLC35E2	-3.489	0.000566	-0.072811	31	0.020866	yes	STMACH
chr1_1652779_A_G_b38	SLC35E2	-3.489	0.000566	-0.072811	31	0.020866	yes	STMACH
chr1_1653147_A_C_b38	SLC35E2	-3.489	0.000566	-0.072811	31	0.020866	yes	STMACH
chr1_1653396_T_C_b38	SLC35E2	-3.489	0.000566	-0.072811	31	0.020866	yes	STMACH
chr1_1653472_T_C_b38	SLC35E2	-3.489	0.000566	-0.072811	31	0.020866	yes	STMACH
chr1_1653811_G_A_b38	SLC35E2	-3.489	0.000566	-0.072811	31	0.020866	yes	STMACH
chr1_1653893_C_T_b38	SLC35E2	-3.489	0.000566	-0.072811	31	0.020866	yes	STMACH
chr1_1654143_G_A_b38	SLC35E2	-3.489	0.000566	-0.072811	31	0.020866	yes	STMACH
chr1_1944419_C_G_b38	SLC35E2	-3.47	0.000607	-0.070015	75	0.02018	yes	STMACH
chr1_1933087_C_T_b38	SLC35E2	-3.465	0.000618	-0.067589	64	0.019507	yes	STMACH
chr1_1933859_A_G_b38	SLC35E2	-3.465	0.000618	-0.067589	64	0.019507	yes	STMACH
chr1_1758323_T_C_b38	SLC35E2	3.456	0.000637	0.066385	54	0.019207	yes	STMACH
chr1_1652061_T_C_b38	SLC35E2	-3.447	0.000659	-0.071534	32	0.020754	yes	STMACH
chr1_1654188_T_G_b38	SLC35E2	-3.447	0.000659	-0.071534	32	0.020754	yes	STMACH
chr1_1672155_G_A_b38	SLC35E2	-3.431	0.000697	-0.074004	29	0.021572	yes	STMACH
chr1_1848037_C_CTA_b38	SLC35E2	3.43	0.000699	0.066527	59	0.019396	yes	STMACH
chr1_1937802_G_T_b38	SLC35E2	-3.428	0.000704	-0.071146	73	0.020756	yes	STMACH
chr1_1651926_T_C_b38	SLC35E2	-3.424	0.000713	-0.071413	31	0.020856	yes	STMACH
chr1_1743565_ATAT_A_b38	SLC35E2	-3.423	0.000715	-0.063603	59	0.018579	yes	STMACH
chr1_1938125_TCA_T_b38	SLC35E2	-3.421	0.000721	-0.069005	74	0.02017	yes	STMACH
chr1_1669613_G_A_b38	SLC35E2	-3.409	0.000751	-0.078818	14	0.023118	yes	STMACH
chr1_1912607_C_T_b38	SLC35E2	-3.393	0.000796	-0.072931	69	0.021495	yes	STMACH
chr1_1864334_AAAG_A_b38	SLC35E2	-3.392	0.000798	-0.079083	21	0.023314	yes	STMACH
chr1_1924788_C_T_b38	SLC35E2	-3.382	0.000828	-0.069543	78	0.020564	yes	STMACH
chr1_1659060_G_A_b38	SLC35E2	-3.375	0.000847	-0.07162	25	0.021219	yes	STMACH
chr1_1914345_C_T_b38	SLC35E2	-3.371	0.00086	-0.06984	76	0.02072	yes	STMACH
chr1_1914918_G_A_b38	SLC35E2	-3.371	0.00086	-0.06984	76	0.02072	yes	STMACH
chr1_1665581_C_G_b38	SLC35E2	-3.364	0.000879	-0.075796	16	0.022528	yes	STMACH
chr1_1630798_C_T_b38	SLC35E2	3.362	0.000886	0.067634	38	0.020116	yes	STMACH
chr1_1671148_C_T_b38	SLC35E2	3.361	0.000889	0.067655	35	0.020129	yes	STMACH
chr1_1914634_G_T_b38	SLC35E2	-3.358	9e-04	-0.064328	65	0.019158	yes	STMACH
chr1_1916670_G_C_b38	SLC35E2	-3.358	9e-04	-0.064328	65	0.019158	yes	STMACH
chr1_1722625_A_T_b38	SLC35E2	3.346	0.000938	0.083719	26	0.025022	yes	STMACH
chr1_1736801_CA_C_b38	SLC35E2	3.337	0.000966	0.082217	30	0.024637	yes	STMACH
chr1_1847030_A_G_b38	SLC35E2	-3.332	0.000982	-0.06862	75	0.020592	yes	STMACH
chr1_1850017_G_T_b38	SLC35E2	-3.332	0.000982	-0.06862	75	0.020592	yes	STMACH
chr1_1937895_C_T_b38	SLC35E2	-3.332	0.000983	-0.067118	75	0.020143	yes	STMACH
chr1_1844830_C_A_b38	SLC35E2	3.332	0.000984	0.064871	58	0.01947	yes	STMACH
chr1_1725582_T_C_b38	SLC35E2	3.331	0.000989	0.058031	75	0.017424	yes	STMACH
chr1_1920695_A_G_b38	SLC35E2	-3.322	0.00102	-0.068823	77	0.020718	yes	STMACH
chr1_1925233_T_C_b38	SLC35E2	-3.322	0.00102	-0.068823	77	0.020718	yes	STMACH
chr1_1925281_C_T_b38	SLC35E2	-3.322	0.00102	-0.068823	77	0.020718	yes	STMACH
chr1_1915326_G_A_b38	SLC35E2	-3.314	0.00105	-0.068644	77	0.020711	yes	STMACH
chr1_1916217_C_T_b38	SLC35E2	-3.314	0.00105	-0.068644	77	0.020711	yes	STMACH
chr1_1921745_T_C_b38	SLC35E2	-3.313	0.00105	-0.063825	61	0.019263	yes	STMACH
chr1_1913643_T_C_b38	SLC35E2	-3.299	0.0011	-0.07262	65	0.022014	yes	STMACH
chr1_1762759_AAATG_A_b38	SLC35E2	3.286	0.00115	0.065297	58	0.01987	yes	STMACH
chr1_1930143_C_T_b38	SLC35E2	-3.285	0.00116	-0.068262	76	0.020782	yes	STMACH
chr1_1843381_A_T_b38	SLC35E2	-3.277	0.00119	-0.067978	76	0.020743	yes	STMACH
chr1_1866508_A_G_b38	SLC35E2	-3.277	0.00119	-0.067978	76	0.020743	yes	STMACH
chr1_1879567_T_C_b38	SLC35E2	-3.277	0.00119	-0.067978	76	0.020743	yes	STMACH
chr1_1881249_A_G_b38	SLC35E2	-3.277	0.00119	-0.067978	76	0.020743	yes	STMACH
chr1_1886800_G_A_b38	SLC35E2	-3.277	0.00119	-0.067978	76	0.020743	yes	STMACH
chr1_1891654_C_CAGAG_b38	SLC35E2	-3.277	0.00119	-0.067978	76	0.020743	yes	STMACH
chr1_1944216_C_T_b38	SLC35E2	-3.271	0.00121	-0.067	72	0.020481	yes	STMACH
chr1_1769969_CAAAACA_C_b38	SLC35E2	3.261	0.00126	0.062643	53	0.019213	yes	STMACH
chr1_1668108_C_T_b38	SLC35E2	3.255	0.00128	0.067154	32	0.020632	yes	STMACH
chr1_1901262_C_T_b38	SLC35E2	-3.253	0.00129	-0.068216	75	0.020967	yes	STMACH
chr1_1901386_C_A_b38	SLC35E2	-3.253	0.00129	-0.068216	75	0.020967	yes	STMACH
chr1_1820337_A_G_b38	SLC35E2	3.253	0.00129	0.061532	63	0.018915	yes	STMACH
chr1_1671724_C_T_b38	SLC35E2	-3.252	0.00129	-0.071487	24	0.02198	yes	STMACH
chr1_1929904_C_T_b38	SLC35E2	-3.25	0.0013	-0.067671	76	0.020822	yes	STMACH
chr1_1921333_C_T_b38	SLC35E2	-3.249	0.00131	-0.067066	77	0.020644	yes	STMACH
chr1_1952823_TA_T_b38	SLC35E2	-3.246	0.00132	-0.068607	66	0.021138	yes	STMACH
chr1_1846009_AGG_A_b38	SLC35E2	-3.237	0.00136	-0.067092	78	0.020726	yes	STMACH
chr1_1846011_G_GTCC_b38	SLC35E2	-3.237	0.00136	-0.067092	78	0.020726	yes	STMACH
chr1_1860718_A_C_b38	SLC35E2	-3.237	0.00136	-0.067092	78	0.020726	yes	STMACH
chr1_1866635_T_TA_b38	SLC35E2	3.235	0.00137	0.069591	34	0.021509	yes	STMACH
chr1_1880596_T_A_b38	SLC35E2	-3.229	0.0014	-0.0663	67	0.020531	yes	STMACH
chr1_1731904_CA_C_b38	SLC35E2	3.228	0.0014	0.069453	25	0.021514	yes	STMACH
chr1_1881428_C_CT_b38	SLC35E2	-3.227	0.00141	-0.067465	74	0.020906	yes	STMACH
chr1_1881082_C_T_b38	SLC35E2	-3.217	0.00146	-0.067036	76	0.02084	yes	STMACH
chr1_1775296_C_T_b38	SLC35E2	3.21	0.00149	0.084722	8	0.026389	yes	STMACH
chr1_1815255_G_T_b38	SLC35E2	3.21	0.00149	0.084722	8	0.026389	yes	STMACH
chr1_1918090_A_G_b38	SLC35E2	-3.203	0.00152	-0.066231	75	0.020676	yes	STMACH
chr1_1935987_G_A_b38	SLC35E2	-3.183	0.00163	-0.065167	77	0.020473	yes	STMACH
chr1_1899573_C_T_b38	SLC35E2	-3.178	0.00166	-0.066551	74	0.020943	yes	STMACH
chr1_1671097_G_C_b38	SLC35E2	3.176	0.00167	0.064654	34	0.020355	yes	STMACH
chr1_1606507_GTGGGC_G_b38	SLC35E2	3.169	0.00171	0.062306	72	0.019662	yes	STMACH
chr1_1947645_C_T_b38	SLC35E2	-3.168	0.00171	-0.065159	70	0.020565	yes	STMACH
chr1_1905586_C_T_b38	SLC35E2	-3.165	0.00173	-0.067492	73	0.021327	yes	STMACH
chr1_1927857_T_C_b38	SLC35E2	-3.163	0.00174	-0.065373	77	0.020666	yes	STMACH
chr1_1902439_C_T_b38	SLC35E2	-3.158	0.00177	-0.066688	74	0.021119	yes	STMACH
chr1_1902481_G_A_b38	SLC35E2	-3.158	0.00177	-0.066688	74	0.021119	yes	STMACH
chr1_1650664_CTTTTT_C_b38	SLC35E2	-3.125	0.00198	-0.074154	16	0.023732	yes	STMACH
chr1_1743712_G_A_b38	SLC35E2	3.123	0.00198	0.102149	6	0.032704	yes	STMACH
chr1_1731093_G_C_b38	SLC35E2	-3.112	0.00206	-0.146654	4	0.047123	yes	STMACH
chr1_1735087_A_C_b38	SLC35E2	-3.112	0.00206	-0.146654	4	0.047123	yes	STMACH
chr1_1735286_G_A_b38	SLC35E2	-3.112	0.00206	-0.146654	4	0.047123	yes	STMACH
chr1_1773460_G_A_b38	SLC35E2	-3.112	0.00206	-0.063318	76	0.020347	yes	STMACH
chr1_1773476_C_G_b38	SLC35E2	-3.112	0.00206	-0.063318	76	0.020347	yes	STMACH
chr1_1606384_A_G_b38	SLC35E2	3.106	0.0021	0.060765	45	0.019564	yes	STMACH
chr1_1909234_G_A_b38	SLC35E2	-3.1	0.00214	-0.06585	75	0.021242	yes	STMACH
chr1_1909238_G_A_b38	SLC35E2	-3.1	0.00214	-0.06585	75	0.021242	yes	STMACH
chr1_1770997_G_A_b38	SLC35E2	-3.079	0.00229	-0.063881	76	0.020748	yes	STMACH
chr1_1697272_G_A_b38	SLC35E2	3.051	0.00251	0.094383	15	0.030933	yes	STMACH
chr1_1936906_C_CA_b38	SLC35E2	-3.041	0.00259	-0.0661	37	0.021736	yes	STMACH
chr1_1831318_C_T_b38	SLC35E2	-3.029	0.00269	-0.062174	75	0.020525	yes	STMACH
chr1_1836126_C_A_b38	SLC35E2	-3.026	0.00272	-0.059644	80	0.019713	yes	STMACH
chr1_1659940_A_C_b38	SLC35E2	-3.02	0.00277	-0.079876	5	0.02645	yes	STMACH
chr1_1918989_A_G_b38	SLC35E2	-3.001	0.00294	-0.057362	64	0.019112	yes	STMACH
chr1_1688647_G_A_b38	SLC35E2	-2.997	0.00299	-0.066747	30	0.022274	yes	STMACH
chr1_1776461_GAAAC_G_b38	SLC35E2	-2.995	0.003	-0.061397	76	0.020497	yes	STMACH
chr1_1777362_A_G_b38	SLC35E2	-2.995	0.003	-0.061397	76	0.020497	yes	STMACH
chr1_1808816_G_T_b38	SLC35E2	-2.995	0.003	-0.061397	76	0.020497	yes	STMACH
chr1_1819825_G_A_b38	SLC35E2	-2.995	0.003	-0.061397	76	0.020497	yes	STMACH
chr1_1891444_CG_C_b38	SLC35E2	-2.988	0.00307	-0.063407	71	0.021219	yes	STMACH
chr1_1688619_AAAC_A_b38	SLC35E2	-2.987	0.00308	-0.067065	29	0.022451	yes	STMACH
chr1_1891450_G_C_b38	SLC35E2	-2.977	0.00317	-0.063049	71	0.021175	yes	STMACH
chr1_1740869_C_T_b38	SLC35E2	-2.977	0.00318	-0.142442	4	0.047845	yes	STMACH
chr1_1741174_TTCA_T_b38	SLC35E2	-2.977	0.00318	-0.142442	4	0.047845	yes	STMACH
chr1_1741497_G_A_b38	SLC35E2	-2.977	0.00318	-0.142442	4	0.047845	yes	STMACH
chr1_1791493_C_T_b38	SLC35E2	-2.972	0.00323	-0.061069	75	0.020548	yes	STMACH
chr1_1791592_G_A_b38	SLC35E2	-2.972	0.00323	-0.061069	75	0.020548	yes	STMACH
chr1_1750508_A_C_b38	SLC35E2	-2.964	0.00331	-0.052815	78	0.017819	yes	STMACH
chr1_1627057_C_G_b38	SLC35E2	-2.963	0.00332	-0.065792	28	0.022208	yes	STMACH
chr1_1750528_G_A_b38	SLC35E2	-2.962	0.00333	-0.052929	76	0.017869	yes	STMACH
chr1_1898043_T_C_b38	SLC35E2	2.959	0.00336	0.078078	7	0.026382	yes	STMACH
chr1_1955018_A_AGGAAGTGCGGCTCACACC_b38	SLC35E2	2.959	0.00336	0.081289	5	0.027471	yes	STMACH
chr1_1925307_C_A_b38	SLC35E2	-2.958	0.00337	-0.061907	73	0.020928	yes	STMACH
chr1_1792927_G_A_b38	SLC35E2	-2.957	0.00338	-0.060367	75	0.020413	yes	STMACH
chr1_1742432_T_TA_b38	SLC35E2	2.944	0.00352	0.060655	42	0.0206	yes	STMACH
chr1_1762287_A_G_b38	SLC35E2	-2.94	0.00356	-0.06034	78	0.020521	yes	STMACH
chr1_1764887_C_A_b38	SLC35E2	-2.938	0.00359	-0.060635	77	0.020638	yes	STMACH
chr1_1771864_G_A_b38	SLC35E2	-2.938	0.00359	-0.060635	77	0.020638	yes	STMACH
chr1_1772410_T_C_b38	SLC35E2	-2.938	0.00359	-0.060635	77	0.020638	yes	STMACH
chr1_1772426_T_A_b38	SLC35E2	-2.938	0.00359	-0.060635	77	0.020638	yes	STMACH
chr1_1773848_A_C_b38	SLC35E2	-2.938	0.00359	-0.060635	77	0.020638	yes	STMACH
chr1_1817295_T_C_b38	SLC35E2	-2.938	0.00359	-0.060635	77	0.020638	yes	STMACH
chr1_1827774_A_G_b38	SLC35E2	-2.938	0.00359	-0.060635	77	0.020638	yes	STMACH
chr1_1797530_C_A_b38	SLC35E2	-2.935	0.00362	-0.059518	77	0.020279	yes	STMACH
chr1_1919188_CAGCGGCAGG_C_b38	SLC35E2	-2.921	0.00379	-0.060698	72	0.02078	yes	STMACH
chr1_1790040_C_T_b38	SLC35E2	-2.92	0.0038	-0.060199	77	0.020617	yes	STMACH
chr1_1798925_C_CT_b38	SLC35E2	-2.916	0.00385	-0.061848	32	0.021211	yes	STMACH
chr1_1726649_G_A_b38	SLC35E2	-2.908	0.00395	-0.129568	6	0.044562	yes	STMACH
chr1_1865278_A_C_b38	SLC35E2	2.906	0.00396	0.055833	55	0.019212	yes	STMACH
chr1_2436349_TC_T_b38	SLC35E2	-2.859	0.00459	-0.142249	4	0.049762	yes	STMACH
chr1_1691417_T_C_b38	SLC35E2	2.847	0.00476	0.057264	66	0.020116	yes	STMACH
chr1_1967499_G_A_b38	SLC35E2	2.844	0.00479	0.056607	44	0.019901	yes	STMACH
chr1_1880594_A_T_b38	SLC35E2	2.833	0.00496	0.071301	10	0.025168	yes	STMACH
chr1_1871210_G_T_b38	SLC35E2	2.812	0.00529	0.075138	8	0.026725	yes	STMACH
chr1_1130186_CAAAAAA_C_b38	SLC35E2	-2.809	0.00534	-0.112845	6	0.040179	yes	STMACH
chr1_1661169_C_A_b38	SLC35E2	2.807	0.00537	0.058865	26	0.020971	yes	STMACH
chr1_1649954_C_CA_b38	SLC35E2	-2.8	0.00548	-0.069752	14	0.024912	yes	STMACH
chr1_1882915_C_T_b38	SLC35E2	2.785	0.00574	0.07215	8	0.025909	yes	STMACH
chr1_1931743_CA_C_b38	SLC35E2	-2.782	0.00579	-0.064592	26	0.02322	yes	STMACH
chr1_1708505_G_C_b38	SLC35E2	2.776	0.00589	0.050746	47	0.01828	yes	STMACH
chr1_1875208_T_C_b38	SLC35E2	-2.774	0.00593	-0.057897	75	0.020871	yes	STMACH
chr1_1969249_A_AGCCCT_b38	SLC35E2	2.768	0.00603	0.066217	12	0.023919	yes	STMACH
chr1_1881065_G_A_b38	SLC35E2	2.759	0.00621	0.071432	8	0.025895	yes	STMACH
chr1_1881798_C_T_b38	SLC35E2	2.759	0.00621	0.071432	8	0.025895	yes	STMACH
chr1_1886690_A_C_b38	SLC35E2	2.759	0.00621	0.071432	8	0.025895	yes	STMACH
chr1_1970506_T_A_b38	SLC35E2	-2.757	0.00623	-0.055331	52	0.020067	yes	STMACH
chr1_1980742_C_T_b38	SLC35E2	2.754	0.0063	0.09363	3	0.034001	yes	STMACH
chr1_1688786_G_A_b38	SLC35E2	-2.748	0.00641	-0.069924	13	0.02545	yes	STMACH
chr1_1664865_A_G_b38	SLC35E2	-2.741	0.00653	-0.056662	31	0.020669	yes	STMACH
chr1_1857246_T_TAA_b38	SLC35E2	2.739	0.00658	0.070532	8	0.025751	yes	STMACH
chr1_1857250_C_G_b38	SLC35E2	2.739	0.00658	0.070532	8	0.025751	yes	STMACH
chr1_1857305_G_GGGCT_b38	SLC35E2	2.739	0.00658	0.070532	8	0.025751	yes	STMACH
chr1_1766653_A_G_b38	SLC35E2	-2.729	0.00678	-0.056124	77	0.020567	yes	STMACH
chr1_1688531_T_C_b38	SLC35E2	-2.701	0.00735	-0.065836	18	0.024373	yes	STMACH
chr1_1688442_T_C_b38	SLC35E2	-2.685	0.00771	-0.058389	34	0.021749	yes	STMACH
chr1_1855245_G_A_b38	SLC35E2	2.683	0.00774	0.06991	8	0.026053	yes	STMACH
chr1_1920497_C_A_b38	SLC35E2	-2.677	0.00788	-0.067726	11	0.025298	yes	STMACH
chr1_1688457_G_A_b38	SLC35E2	-2.67	0.00805	-0.059114	33	0.022142	yes	STMACH
chr1_1773676_TTGTGTG_T_b38	SLC35E2	2.663	0.0082	0.079743	4	0.02994	yes	STMACH
chr1_1855939_G_A_b38	SLC35E2	2.66	0.00829	0.068948	8	0.025921	yes	STMACH
chr1_1938493_C_CAT_b38	SLC35E2	-2.659	0.0083	-0.068649	9	0.025813	yes	STMACH
chr1_1939978_T_C_b38	SLC35E2	-2.659	0.0083	-0.068649	9	0.025813	yes	STMACH
chr1_1943142_A_G_b38	SLC35E2	-2.659	0.0083	-0.068649	9	0.025813	yes	STMACH
chr1_1943828_A_G_b38	SLC35E2	-2.659	0.0083	-0.068649	9	0.025813	yes	STMACH
chr1_1948594_G_GTTT_b38	SLC35E2	-2.655	0.00839	-0.110273	5	0.041526	yes	STMACH
chr1_1728274_G_C_b38	SLC35E2	-2.654	0.00843	-0.132169	3	0.049797	yes	STMACH
chr1_1688586_C_T_b38	SLC35E2	-2.638	0.00883	-0.062511	23	0.023696	yes	STMACH
chr1_1650383_G_T_b38	SLC35E2	-2.633	0.00895	-0.057411	27	0.021801	yes	STMACH
chr1_2303580_T_C_b38	SLC35E2	2.633	0.00895	0.055231	22	0.020976	yes	STMACH
chr1_1641275_A_G_b38	SLC35E2	-2.628	0.00909	-0.0564	40	0.021464	yes	STMACH
chr1_1693256_GT_G_b38	SLC35E2	-2.619	0.00933	-0.105326	7	0.040219	yes	STMACH
chr1_1979589_T_C_b38	SLC35E2	2.608	0.00961	0.07843	7	0.030071	yes	STMACH
chr1_1981144_T_G_b38	SLC35E2	2.603	0.00975	0.057734	20	0.022178	yes	STMACH
chr1_1606099_G_GGTCAGGCGAGGGGTC_b38	SLC35E2	2.599	0.00986	0.053839	31	0.020713	yes	STMACH
chr1_1671797_G_A_b38	SLC35E2	6.829	5.71e-11	0.119186	72	0.017453	no	STMACH
chr1_1671995_G_T_b38	SLC35E2	6.72	1.09e-10	0.117274	73	0.017451	no	STMACH
chr1_1673968_GA_G_b38	SLC35E2	5.737	2.6e-08	0.118261	34	0.020614	no	STMACH
chr1_1649976_G_A_b38	SLC35E2	5.246	3.16e-07	0.097103	58	0.018509	no	STMACH
chr1_1636278_G_T_b38	SLC35E2	5.2	3.97e-07	0.0987	61	0.018982	no	STMACH
chr1_1660318_C_T_b38	SLC35E2	4.971	1.19e-06	0.144954	3	0.029162	no	STMACH
chr1_1667424_T_TAAAATA_b38	SLC35E2	4.644	5.36e-06	0.091268	43	0.019652	no	STMACH
chr1_1739131_T_C_b38	SLC35E2	4.481	1.1e-05	0.081328	62	0.018151	no	STMACH
chr1_1667424_T_TAAATA_b38	SLC35E2	-4.477	1.12e-05	-0.0848	54	0.018941	no	STMACH
chr1_1674633_C_CA_b38	SLC35E2	4.266	2.76e-05	0.084484	37	0.019803	no	STMACH
chr1_1661562_G_C_b38	SLC35E2	4.213	3.45e-05	0.070685	79	0.016779	no	STMACH
chr1_1612562_T_TC_b38	SLC35E2	4.172	4.09e-05	0.081107	37	0.019442	no	STMACH
chr1_1717507_T_C_b38	SLC35E2	4.111	5.24e-05	0.11804	15	0.028711	no	STMACH
chr1_1728671_C_A_b38	SLC35E2	3.922	0.000112	0.100308	10	0.025579	no	STMACH
chr1_1658830_C_G_b38	SLC35E2	-3.838	0.000155	-0.088202	13	0.022984	no	STMACH
chr1_1738606_C_T_b38	SLC35E2	3.688	0.000273	0.077751	38	0.02108	no	STMACH
chr1_1738597_C_A_b38	SLC35E2	3.684	0.000277	0.076352	41	0.020723	no	STMACH
chr1_1729859_A_G_b38	SLC35E2	3.674	0.000288	0.090227	10	0.024555	no	STMACH
chr1_1650000_G_A_b38	SLC35E2	3.661	0.000303	0.06956	48	0.019003	no	STMACH
chr1_1621352_G_A_b38	SLC35E2	3.646	0.00032	0.07249	39	0.019882	no	STMACH
chr1_1652913_C_T_b38	SLC35E2	-3.641	0.000326	-0.07836	23	0.021523	no	STMACH
chr1_1600379_C_T_b38	SLC35E2	3.635	0.000333	0.072667	36	0.019992	no	STMACH
chr1_1727506_T_C_b38	SLC35E2	3.628	0.000342	0.086979	24	0.023975	no	STMACH
chr1_1620609_G_A_b38	SLC35E2	3.619	0.000353	0.07148	38	0.019751	no	STMACH
chr1_1622295_G_C_b38	SLC35E2	3.605	0.000372	0.071548	38	0.019847	no	STMACH
chr1_1735176_C_T_b38	SLC35E2	3.591	0.000392	0.065447	75	0.018226	no	STMACH
chr1_1639685_G_A_b38	SLC35E2	-3.586	0.000399	-0.083149	14	0.023188	no	STMACH
chr1_1641261_C_T_b38	SLC35E2	-3.586	4e-04	-0.086832	13	0.024217	no	STMACH
chr1_1736729_G_T_b38	SLC35E2	3.582	0.000405	0.065594	75	0.018312	no	STMACH
chr1_2436355_C_T_b38	SLC35E2	-3.575	0.000415	-0.213849	3	0.059812	no	STMACH
chr1_1731963_A_C_b38	SLC35E2	3.572	0.00042	0.064812	76	0.018144	no	STMACH
chr1_1650664_CT_C_b38	SLC35E2	3.569	0.000425	0.077739	29	0.021784	no	STMACH
chr1_1649846_G_A_b38	SLC35E2	-3.546	0.000462	-0.082032	12	0.023135	no	STMACH
chr1_1738295_G_T_b38	SLC35E2	3.539	0.000474	0.064477	75	0.01822	no	STMACH
chr1_1650688_T_A_b38	SLC35E2	-3.529	0.00049	-0.076521	23	0.02168	no	STMACH
chr1_1665061_C_T_b38	SLC35E2	-3.523	0.000501	-0.082677	13	0.023466	no	STMACH
chr1_1660683_C_T_b38	SLC35E2	-3.52	0.000507	-0.075491	24	0.021445	no	STMACH
chr1_1607931_G_A_b38	SLC35E2	3.513	0.00052	0.069953	37	0.019914	no	STMACH
chr1_2676824_ACGGCC_A_b38	SLC35E2	-3.499	0.000547	-0.18472	4	0.052792	no	STMACH
chr1_1597128_C_CCCTCAGCTGGACT_b38	SLC35E2	-3.479	0.000586	-0.067605	55	0.01943	no	STMACH
chr1_1748597_C_G_b38	SLC35E2	-3.469	0.000608	-0.071259	75	0.020542	no	STMACH
chr1_1609058_G_A_b38	SLC35E2	3.456	0.000636	0.068586	38	0.019843	no	STMACH
chr1_1732392_C_T_b38	SLC35E2	3.416	0.000733	0.062387	76	0.018262	no	STMACH
chr1_1734903_A_G_b38	SLC35E2	3.416	0.000733	0.062387	76	0.018262	no	STMACH
chr1_1735980_A_C_b38	SLC35E2	3.416	0.000733	0.062387	76	0.018262	no	STMACH
chr1_1740343_C_T_b38	SLC35E2	3.416	0.000733	0.062387	76	0.018262	no	STMACH
chr1_1740703_C_T_b38	SLC35E2	3.416	0.000733	0.062387	76	0.018262	no	STMACH
chr1_1669576_G_A_b38	SLC35E2	-3.415	0.000738	-0.080078	13	0.023451	no	STMACH
chr1_1638879_C_T_b38	SLC35E2	-3.401	0.000773	-0.077259	16	0.022714	no	STMACH
chr1_1747472_A_T_b38	SLC35E2	-3.394	0.000794	-0.069788	74	0.020565	no	STMACH
chr1_1595306_CAG_C_b38	SLC35E2	-3.384	0.000821	-0.069621	66	0.020573	no	STMACH
chr1_1677707_C_T_b38	SLC35E2	-3.376	0.000843	-0.098813	5	0.029266	no	STMACH
chr1_1600320_C_G_b38	SLC35E2	3.369	0.000866	0.068855	33	0.02044	no	STMACH
chr1_1734174_A_G_b38	SLC35E2	3.324	0.00101	0.060404	76	0.018174	no	STMACH
chr1_1904424_A_AAAATAAATAAAT_b38	SLC35E2	3.309	0.00106	0.059908	50	0.018104	no	STMACH
chr1_1747695_A_G_b38	SLC35E2	-3.294	0.00112	-0.05388	82	0.016356	no	STMACH
chr1_1725339_C_A_b38	SLC35E2	3.293	0.00113	0.057678	68	0.017517	no	STMACH
chr1_1955080_C_CGGCTCACACCGGAAGTGAGGCTCACACCGGAAGTGA_b38	SLC35E2	-3.281	0.00117	-0.069354	56	0.021139	no	STMACH
chr1_1661420_C_A_b38	SLC35E2	-3.274	0.0012	-0.066743	34	0.020388	no	STMACH
chr1_1737504_A_C_b38	SLC35E2	3.265	0.00124	0.059826	77	0.018321	no	STMACH
chr1_1606532_GTGGGCTGGGCTGGTCAGGCA_G_b38	SLC35E2	3.257	0.00127	0.067885	28	0.020845	no	STMACH
chr1_1969479_G_A_b38	SLC35E2	3.249	0.0013	0.072643	15	0.022356	no	STMACH
chr1_1948515_C_T_b38	SLC35E2	-3.219	0.00144	-0.066875	72	0.020772	no	STMACH
chr1_1948519_T_C_b38	SLC35E2	-3.219	0.00144	-0.066875	72	0.020772	no	STMACH
chr1_1658866_G_A_b38	SLC35E2	-3.208	0.0015	-0.065889	34	0.020538	no	STMACH
chr1_1659114_A_G_b38	SLC35E2	-3.208	0.0015	-0.065889	34	0.020538	no	STMACH
chr1_1659220_A_G_b38	SLC35E2	-3.208	0.0015	-0.065889	34	0.020538	no	STMACH
chr1_1751442_C_T_b38	SLC35E2	3.188	0.0016	0.089019	3	0.027927	no	STMACH
chr1_1660408_T_C_b38	SLC35E2	-3.18	0.00165	-0.075873	8	0.023861	no	STMACH
chr1_1746440_A_G_b38	SLC35E2	-3.172	0.00169	-0.076511	20	0.024119	no	STMACH
chr1_1951865_G_GT_b38	SLC35E2	-3.149	0.00182	-0.067077	67	0.0213	no	STMACH
chr1_1950071_C_T_b38	SLC35E2	-3.126	0.00196	-0.066296	66	0.021206	no	STMACH
chr1_1952064_G_A_b38	SLC35E2	-3.126	0.00196	-0.066296	66	0.021206	no	STMACH
chr1_1951106_G_A_b38	SLC35E2	-3.109	0.00208	-0.065795	67	0.02116	no	STMACH
chr1_1736836_A_G_b38	SLC35E2	3.086	0.00224	0.057144	72	0.018519	no	STMACH
chr1_1828894_T_TAC_b38	SLC35E2	3.084	0.00226	0.062024	52	0.020113	no	STMACH
chr1_1904424_A_AAAATAAAT_b38	SLC35E2	-3.084	0.00226	-0.055972	77	0.018151	no	STMACH
chr1_1594890_G_GAC_b38	SLC35E2	-3.06	0.00244	-0.05901	72	0.019285	no	STMACH
chr1_1794187_C_T_b38	SLC35E2	3.036	0.00263	0.076479	9	0.025191	no	STMACH
chr1_1653863_C_A_b38	SLC35E2	-2.948	0.00347	-0.075507	7	0.025609	no	STMACH
chr1_1969235_A_G_b38	SLC35E2	2.946	0.0035	0.069144	12	0.023467	no	STMACH
chr1_1558204_T_TAAAAAA_b38	SLC35E2	2.939	0.00358	0.071155	20	0.024208	no	STMACH
chr1_1726904_T_C_b38	SLC35E2	2.929	0.0037	0.053168	68	0.018154	no	STMACH
chr1_1627156_G_A_b38	SLC35E2	-2.923	0.00376	-0.088918	5	0.030419	no	STMACH
chr1_1595028_C_CAG_b38	SLC35E2	2.92	0.0038	0.067386	20	0.02308	no	STMACH
chr1_1798974_C_T_b38	SLC35E2	2.917	0.00383	0.073264	9	0.025117	no	STMACH
chr1_1750589_G_A_b38	SLC35E2	-2.914	0.00386	-0.090857	10	0.031174	no	STMACH
chr1_1589151_C_T_b38	SLC35E2	-2.897	0.00408	-0.060535	33	0.020897	no	STMACH
chr1_1822247_A_G_b38	SLC35E2	2.896	0.00409	0.071442	10	0.024665	no	STMACH
chr1_1775996_G_A_b38	SLC35E2	2.878	0.00433	0.070914	10	0.024643	no	STMACH
chr1_1589057_T_C_b38	SLC35E2	-2.871	0.00442	-0.059945	33	0.02088	no	STMACH
chr1_1609890_C_T_b38	SLC35E2	-2.868	0.00445	-0.087488	5	0.0305	no	STMACH
chr1_1782906_T_G_b38	SLC35E2	2.868	0.00447	0.0711	10	0.024795	no	STMACH
chr1_1593732_G_C_b38	SLC35E2	-2.845	0.00479	-0.055311	69	0.019444	no	STMACH
chr1_2425690_G_GT_b38	SLC35E2	-2.824	0.0051	-0.069788	10	0.024715	no	STMACH
chr1_1801188_T_C_b38	SLC35E2	2.82	0.00517	0.068208	10	0.02419	no	STMACH
chr1_1882449_A_AAG_b38	SLC35E2	2.812	0.00529	0.093202	4	0.033146	no	STMACH
chr1_1719638_C_CTCGCTCTGTCACCCAGGCT_b38	SLC35E2	2.807	0.00536	0.08395	17	0.029902	no	STMACH
chr1_1468636_G_A_b38	SLC35E2	2.783	0.00578	0.127128	3	0.045687	no	STMACH
chr1_1963533_C_CA_b38	SLC35E2	2.754	0.00629	0.054741	44	0.019878	no	STMACH
chr1_1963538_T_C_b38	SLC35E2	2.748	0.0064	0.054818	42	0.019948	no	STMACH
chr1_1649993_A_G_b38	SLC35E2	-2.738	0.00659	-0.050627	80	0.018488	no	STMACH
chr1_1721197_CA_C_b38	SLC35E2	2.736	0.00664	0.084623	14	0.030933	no	STMACH
chr1_1453643_A_AT_b38	SLC35E2	-2.733	0.00669	-0.07203	6	0.026354	no	STMACH
chr1_1714635_A_G_b38	SLC35E2	2.73	0.00676	0.077412	10	0.02836	no	STMACH
chr1_1714638_G_T_b38	SLC35E2	2.73	0.00676	0.077412	10	0.02836	no	STMACH
chr1_2106796_TGACTCTTCAGCAGGCCCCTCTGGTGGGCGAGGACCTCCACACGTGTCACCAGGCCAGGC_T_b38	SLC35E2	-2.707	0.00723	-0.092849	4	0.034303	no	STMACH
chr1_1590682_T_C_b38	SLC35E2	-2.706	0.00725	-0.055239	35	0.020415	no	STMACH
chr1_1726053_G_C_b38	SLC35E2	2.702	0.00734	0.078941	14	0.029218	no	STMACH
chr1_1835922_GA_G_b38	SLC35E2	2.683	0.00775	0.099576	3	0.037111	no	STMACH
chr1_1688409_C_G_b38	SLC35E2	-2.679	0.00784	-0.053164	57	0.019843	no	STMACH
chr1_1969229_T_A_b38	SLC35E2	2.678	0.00787	0.062838	12	0.023465	no	STMACH
chr1_1969238_C_T_b38	SLC35E2	2.66	0.0083	0.06253	12	0.023512	no	STMACH
chr1_1897985_C_G_b38	SLC35E2	2.65	0.00853	0.065415	10	0.024684	no	STMACH
chr1_1837340_C_T_b38	SLC35E2	2.649	0.00856	0.066575	10	0.025135	no	STMACH
chr1_1688570_A_T_b38	SLC35E2	-2.63	0.00902	-0.065302	14	0.024827	no	STMACH
chr1_1589491_A_G_b38	SLC35E2	-2.615	0.00944	-0.053188	35	0.020342	no	STMACH
chr1_2689953_T_G_b38	SLC35E2	-2.613	0.00947	-0.091403	5	0.034974	no	STMACH
chr1_1673818_A_C_b38	SLC35E2	6.588	2.36e-10	0.097797	68	0.014844	yes	TESTIS
chr1_1673060_G_A_b38	SLC35E2	6.57	2.62e-10	0.099029	66	0.015072	yes	TESTIS
chr1_1677720_T_G_b38	SLC35E2	6.483	4.33e-10	0.095333	70	0.014705	yes	TESTIS
chr1_1677726_A_T_b38	SLC35E2	6.482	4.35e-10	0.094936	70	0.014646	yes	TESTIS
chr1_1671995_G_T_b38	SLC35E2	6.391	7.3e-10	0.095703	66	0.014974	yes	TESTIS
chr1_1676790_C_T_b38	SLC35E2	6.34	9.76e-10	0.092818	68	0.01464	yes	TESTIS
chr1_1674720_TGC_T_b38	SLC35E2	6.338	9.85e-10	0.094354	67	0.014887	yes	TESTIS
chr1_1674868_G_A_b38	SLC35E2	6.338	9.85e-10	0.094354	67	0.014887	yes	TESTIS
chr1_1648736_G_A_b38	SLC35E2	5.978	7.23e-09	0.09158	67	0.015321	yes	TESTIS
chr1_1654662_CT_C_b38	SLC35E2	5.852	1.42e-08	0.097199	54	0.01661	yes	TESTIS
chr1_1649932_C_T_b38	SLC35E2	5.665	3.8e-08	0.086312	67	0.015236	yes	TESTIS
chr1_1651653_C_T_b38	SLC35E2	5.601	5.31e-08	0.084945	76	0.015167	yes	TESTIS
chr1_1671797_G_A_b38	SLC35E2	5.509	8.47e-08	0.084599	66	0.015356	yes	TESTIS
chr1_1673968_GA_G_b38	SLC35E2	5.42	1.33e-07	0.092407	33	0.017049	yes	TESTIS
chr1_1646352_A_C_b38	SLC35E2	5.204	3.89e-07	0.113663	8	0.021841	yes	TESTIS
chr1_1670423_AT_A_b38	SLC35E2	5.203	3.9e-07	0.096026	36	0.018454	yes	TESTIS
chr1_1674633_C_CA_b38	SLC35E2	5.116	5.98e-07	0.089384	29	0.017473	yes	TESTIS
chr1_1660683_C_T_b38	SLC35E2	-4.883	1.8e-06	-0.08974	24	0.018378	yes	TESTIS
chr1_1671148_C_T_b38	SLC35E2	4.855	2.05e-06	0.081321	37	0.016749	yes	TESTIS
chr1_1586962_C_T_b38	SLC35E2	4.852	2.08e-06	0.083065	37	0.017119	yes	TESTIS
chr1_1743565_ATAT_A_b38	SLC35E2	-4.788	2.8e-06	-0.074328	52	0.015525	yes	TESTIS
chr1_1664865_A_G_b38	SLC35E2	-4.717	3.87e-06	-0.079645	35	0.016885	yes	TESTIS
chr1_1650664_CT_C_b38	SLC35E2	4.633	5.63e-06	0.088774	23	0.01916	yes	TESTIS
chr1_1639348_G_T_b38	SLC35E2	-4.631	5.7e-06	-0.079306	42	0.017126	yes	TESTIS
chr1_1659940_A_C_b38	SLC35E2	-4.623	5.89e-06	-0.097836	7	0.021161	yes	TESTIS
chr1_1589495_CTTT_C_b38	SLC35E2	4.62	5.98e-06	0.088992	19	0.019263	yes	TESTIS
chr1_1688328_C_T_b38	SLC35E2	-4.592	6.78e-06	-0.082256	19	0.017915	yes	TESTIS
chr1_1661562_G_C_b38	SLC35E2	4.589	6.86e-06	0.066067	69	0.014396	yes	TESTIS
chr1_1653863_C_A_b38	SLC35E2	-4.583	7.03e-06	-0.098561	8	0.021504	yes	TESTIS
chr1_1651574_G_A_b38	SLC35E2	-4.574	7.34e-06	-0.078557	35	0.017176	yes	TESTIS
chr1_1650777_G_A_b38	SLC35E2	-4.564	7.65e-06	-0.078336	35	0.017162	yes	TESTIS
chr1_1651137_C_T_b38	SLC35E2	-4.564	7.65e-06	-0.078336	35	0.017162	yes	TESTIS
chr1_1651267_T_C_b38	SLC35E2	-4.564	7.65e-06	-0.078336	35	0.017162	yes	TESTIS
chr1_1651785_C_A_b38	SLC35E2	-4.564	7.65e-06	-0.078336	35	0.017162	yes	TESTIS
chr1_1652061_T_C_b38	SLC35E2	-4.564	7.65e-06	-0.078336	35	0.017162	yes	TESTIS
chr1_1652135_C_G_b38	SLC35E2	-4.564	7.65e-06	-0.078336	35	0.017162	yes	TESTIS
chr1_1652191_C_T_b38	SLC35E2	-4.564	7.65e-06	-0.078336	35	0.017162	yes	TESTIS
chr1_1652592_A_G_b38	SLC35E2	-4.564	7.65e-06	-0.078336	35	0.017162	yes	TESTIS
chr1_1652779_A_G_b38	SLC35E2	-4.564	7.65e-06	-0.078336	35	0.017162	yes	TESTIS
chr1_1653147_A_C_b38	SLC35E2	-4.564	7.65e-06	-0.078336	35	0.017162	yes	TESTIS
chr1_1653396_T_C_b38	SLC35E2	-4.564	7.65e-06	-0.078336	35	0.017162	yes	TESTIS
chr1_1653472_T_C_b38	SLC35E2	-4.564	7.65e-06	-0.078336	35	0.017162	yes	TESTIS
chr1_1653811_G_A_b38	SLC35E2	-4.564	7.65e-06	-0.078336	35	0.017162	yes	TESTIS
chr1_1653893_C_T_b38	SLC35E2	-4.564	7.65e-06	-0.078336	35	0.017162	yes	TESTIS
chr1_1654143_G_A_b38	SLC35E2	-4.564	7.65e-06	-0.078336	35	0.017162	yes	TESTIS
chr1_1654188_T_G_b38	SLC35E2	-4.564	7.65e-06	-0.078336	35	0.017162	yes	TESTIS
chr1_1613769_C_T_b38	SLC35E2	4.553	8.03e-06	0.08037	32	0.017651	yes	TESTIS
chr1_1650195_A_G_b38	SLC35E2	-4.535	8.72e-06	-0.078125	36	0.017228	yes	TESTIS
chr1_1752908_C_CCCT_b38	SLC35E2	-4.517	9.42e-06	-0.076492	58	0.016934	yes	TESTIS
chr1_1659114_A_G_b38	SLC35E2	-4.516	9.45e-06	-0.077128	36	0.017077	yes	TESTIS
chr1_1659220_A_G_b38	SLC35E2	-4.516	9.45e-06	-0.077128	36	0.017077	yes	TESTIS
chr1_1661420_C_A_b38	SLC35E2	-4.516	9.45e-06	-0.077128	36	0.017077	yes	TESTIS
chr1_1744052_GAGA_G_b38	SLC35E2	-4.489	1.07e-05	-0.088569	18	0.019731	yes	TESTIS
chr1_1660408_T_C_b38	SLC35E2	-4.471	1.15e-05	-0.09547	5	0.021352	yes	TESTIS
chr1_1658866_G_A_b38	SLC35E2	-4.466	1.18e-05	-0.075582	37	0.016925	yes	TESTIS
chr1_1658830_C_G_b38	SLC35E2	-4.447	1.28e-05	-0.082831	19	0.018626	yes	TESTIS
chr1_1653934_G_A_b38	SLC35E2	-4.434	1.35e-05	-0.076226	35	0.017191	yes	TESTIS
chr1_1651926_T_C_b38	SLC35E2	-4.427	1.39e-05	-0.076567	35	0.017293	yes	TESTIS
chr1_1743886_C_T_b38	SLC35E2	-4.414	1.48e-05	-0.079407	28	0.017991	yes	TESTIS
chr1_1668108_C_T_b38	SLC35E2	4.392	1.62e-05	0.075175	36	0.017115	yes	TESTIS
chr1_2427409_G_C_b38	SLC35E2	-4.377	1.73e-05	-0.094618	9	0.021619	yes	TESTIS
chr1_2428501_C_T_b38	SLC35E2	-4.376	1.74e-05	-0.097853	7	0.022364	yes	TESTIS
chr1_1744028_A_AC_b38	SLC35E2	-4.343	2e-05	-0.088761	13	0.020438	yes	TESTIS
chr1_1648826_A_G_b38	SLC35E2	-4.34	2.03e-05	-0.075736	39	0.017452	yes	TESTIS
chr1_1651421_GTAGCCCCTCTGAACGGTCTGTGACACACGCATGCTTTCAGCTAGAGTACTCTA_G_b38	SLC35E2	-4.323	2.18e-05	-0.07539	33	0.017439	yes	TESTIS
chr1_1671097_G_C_b38	SLC35E2	4.322	2.19e-05	0.073309	37	0.016962	yes	TESTIS
chr1_1751981_A_T_b38	SLC35E2	-4.31	2.3e-05	-0.083638	23	0.019406	yes	TESTIS
chr1_1752461_G_A_b38	SLC35E2	-4.276	2.65e-05	-0.070113	65	0.016398	yes	TESTIS
chr1_1752730_C_G_b38	SLC35E2	-4.276	2.65e-05	-0.070113	65	0.016398	yes	TESTIS
chr1_1753361_G_A_b38	SLC35E2	-4.276	2.65e-05	-0.070113	65	0.016398	yes	TESTIS
chr1_1667948_A_G_b38	SLC35E2	-4.273	2.69e-05	-0.082065	18	0.019206	yes	TESTIS
chr1_1667424_T_TAAAATA_b38	SLC35E2	4.268	2.75e-05	0.073142	37	0.017139	yes	TESTIS
chr1_1668721_C_T_b38	SLC35E2	-4.264	2.78e-05	-0.07621	28	0.017871	yes	TESTIS
chr1_1648636_G_A_b38	SLC35E2	-4.25	2.95e-05	-0.07399	39	0.017409	yes	TESTIS
chr1_1708474_C_A_b38	SLC35E2	-4.244	3.04e-05	-0.085907	10	0.020244	yes	TESTIS
chr1_1652913_C_T_b38	SLC35E2	-4.244	3.04e-05	-0.077019	27	0.01815	yes	TESTIS
chr1_1753319_G_A_b38	SLC35E2	-4.223	3.32e-05	-0.069156	65	0.016378	yes	TESTIS
chr1_1649846_G_A_b38	SLC35E2	-4.198	3.67e-05	-0.078655	18	0.018736	yes	TESTIS
chr1_1665061_C_T_b38	SLC35E2	-4.192	3.76e-05	-0.07967	19	0.019005	yes	TESTIS
chr1_2429693_C_T_b38	SLC35E2	-4.186	3.86e-05	-0.086956	10	0.020774	yes	TESTIS
chr1_1753033_C_T_b38	SLC35E2	-4.18	3.96e-05	-0.06855	70	0.016402	yes	TESTIS
chr1_1659060_G_A_b38	SLC35E2	-4.178	3.99e-05	-0.075135	28	0.017985	yes	TESTIS
chr1_1661177_A_G_b38	SLC35E2	-4.15	4.47e-05	-0.079511	19	0.019157	yes	TESTIS
chr1_1669576_G_A_b38	SLC35E2	-4.121	5.04e-05	-0.079107	18	0.019196	yes	TESTIS
chr1_1739131_T_C_b38	SLC35E2	4.119	5.07e-05	0.06872	53	0.016682	yes	TESTIS
chr1_2682331_C_T_b38	SLC35E2	4.09	5.71e-05	0.083922	48	0.020517	yes	TESTIS
chr1_1759611_C_T_b38	SLC35E2	-4.067	6.28e-05	-0.066963	67	0.016466	yes	TESTIS
chr1_1750428_G_C_b38	SLC35E2	-4.066	6.29e-05	-0.075086	40	0.018465	yes	TESTIS
chr1_1639685_G_A_b38	SLC35E2	-4.061	6.44e-05	-0.076953	23	0.018952	yes	TESTIS
chr1_1668542_C_T_b38	SLC35E2	-4.038	7.06e-05	-0.078204	17	0.019368	yes	TESTIS
chr1_1600320_C_G_b38	SLC35E2	4.032	7.21e-05	0.066894	36	0.016589	yes	TESTIS
chr1_1668717_C_G_b38	SLC35E2	-4.019	7.62e-05	-0.076634	19	0.01907	yes	TESTIS
chr1_1637577_T_C_b38	SLC35E2	-4.012	7.83e-05	-0.071768	26	0.01789	yes	TESTIS
chr1_1665581_C_G_b38	SLC35E2	-4.005	8.05e-05	-0.076372	20	0.01907	yes	TESTIS
chr1_1744652_C_T_b38	SLC35E2	-3.977	8.98e-05	-0.063216	61	0.015894	yes	TESTIS
chr1_1638879_C_T_b38	SLC35E2	-3.974	9.09e-05	-0.073768	25	0.018562	yes	TESTIS
chr1_1669613_G_A_b38	SLC35E2	-3.971	9.22e-05	-0.076539	18	0.019275	yes	TESTIS
chr1_1622295_G_C_b38	SLC35E2	3.954	9.87e-05	0.065446	38	0.016554	yes	TESTIS
chr1_1649993_A_G_b38	SLC35E2	-3.928	0.000109	-0.060628	81	0.015435	yes	TESTIS
chr1_1612562_T_TC_b38	SLC35E2	3.928	0.000109	0.064876	36	0.016517	yes	TESTIS
chr1_1620609_G_A_b38	SLC35E2	3.904	0.00012	0.064451	38	0.016509	yes	TESTIS
chr1_1600379_C_T_b38	SLC35E2	3.898	0.000123	0.065398	36	0.016778	yes	TESTIS
chr1_1591703_T_C_b38	SLC35E2	3.87	0.000137	0.066589	54	0.017206	yes	TESTIS
chr1_1742587_G_C_b38	SLC35E2	3.87	0.000137	0.059845	79	0.015465	yes	TESTIS
chr1_1722625_A_T_b38	SLC35E2	3.863	0.000141	0.076636	21	0.019838	yes	TESTIS
chr1_1606532_GTGGGCTGGGCTGGTCAGGCA_G_b38	SLC35E2	3.848	0.000149	0.065084	32	0.016913	yes	TESTIS
chr1_1621352_G_A_b38	SLC35E2	3.84	0.000154	0.063387	39	0.016505	yes	TESTIS
chr1_935265_T_C_b38	SLC35E2	3.776	0.000196	0.069993	23	0.018534	yes	TESTIS
chr1_1607931_G_A_b38	SLC35E2	3.77	0.000201	0.062663	37	0.01662	yes	TESTIS
chr1_1609058_G_A_b38	SLC35E2	3.77	0.000201	0.062663	37	0.01662	yes	TESTIS
chr1_1664757_T_C_b38	SLC35E2	-3.751	0.000216	-0.06405	34	0.017076	yes	TESTIS
chr1_1750440_G_A_b38	SLC35E2	-3.695	0.000267	-0.068362	39	0.018502	yes	TESTIS
chr1_1650688_T_A_b38	SLC35E2	-3.689	0.000272	-0.068128	26	0.018466	yes	TESTIS
chr1_2691474_C_G_b38	SLC35E2	-3.686	0.000276	-0.117513	6	0.031883	yes	TESTIS
chr1_1606507_GTGGGC_G_b38	SLC35E2	3.62	0.000353	0.058172	66	0.01607	yes	TESTIS
chr1_1630798_C_T_b38	SLC35E2	3.603	0.000376	0.063698	33	0.017682	yes	TESTIS
chr1_1650383_G_T_b38	SLC35E2	-3.589	0.000394	-0.067198	26	0.018721	yes	TESTIS
chr1_1747695_A_G_b38	SLC35E2	-3.564	0.000433	-0.050696	66	0.014226	yes	TESTIS
chr1_922660_C_A_b38	SLC35E2	3.561	0.000437	0.077944	6	0.021887	yes	TESTIS
chr1_1708855_TTCCTCCTCC_T_b38	SLC35E2	3.539	0.000473	0.061359	56	0.017336	yes	TESTIS
chr1_1755713_G_A_b38	SLC35E2	-3.529	0.000491	-0.058206	58	0.016493	yes	TESTIS
chr1_1675091_A_G_b38	SLC35E2	-3.484	0.000578	-0.065923	20	0.018924	yes	TESTIS
chr1_1725339_C_A_b38	SLC35E2	3.464	0.00062	0.053374	55	0.015409	yes	TESTIS
chr1_1240684_G_GCCGCCCCCATTCACCCCGGCCGTGGTCCCTGCCCCAGCCCCCA_b38	SLC35E2	-3.418	0.00073	-0.107019	10	0.031313	yes	TESTIS
chr1_1584321_T_C_b38	SLC35E2	-3.41	0.00075	-0.058023	41	0.017016	yes	TESTIS
chr1_2431388_C_T_b38	SLC35E2	-3.404	0.000766	-0.062116	22	0.018249	yes	TESTIS
chr1_1657093_C_A_b38	SLC35E2	-3.397	0.000785	-0.067503	26	0.019872	yes	TESTIS
chr1_1746440_A_G_b38	SLC35E2	-3.385	0.000818	-0.068191	16	0.020144	yes	TESTIS
chr1_1744096_C_T_b38	SLC35E2	-3.379	0.000835	-0.085578	30	0.025323	yes	TESTIS
chr1_1760882_T_C_b38	SLC35E2	3.375	0.000849	0.054347	64	0.016104	yes	TESTIS
chr1_1750226_C_T_b38	SLC35E2	3.36	0.000894	0.055462	57	0.016508	yes	TESTIS
chr1_1650664_CTTTTT_C_b38	SLC35E2	-3.357	0.000904	-0.066587	17	0.019837	yes	TESTIS
chr1_922671_C_T_b38	SLC35E2	3.354	0.000911	0.073141	6	0.021806	yes	TESTIS
chr1_1657085_C_CTAA_b38	SLC35E2	-3.338	0.000963	-0.064452	26	0.019306	yes	TESTIS
chr1_1649954_C_CA_b38	SLC35E2	-3.243	0.00133	-0.069775	13	0.021515	yes	TESTIS
chr1_1641261_C_T_b38	SLC35E2	-3.216	0.00146	-0.063271	20	0.019673	yes	TESTIS
chr1_1708521_C_G_b38	SLC35E2	-3.214	0.00147	-0.061154	16	0.019027	yes	TESTIS
chr1_1746522_GT_G_b38	SLC35E2	-3.199	0.00155	-0.065552	15	0.020494	yes	TESTIS
chr1_1730405_G_C_b38	SLC35E2	3.188	0.0016	0.055969	53	0.017556	yes	TESTIS
chr1_2430581_G_T_b38	SLC35E2	-3.182	0.00164	-0.056996	25	0.017915	yes	TESTIS
chr1_1657081_C_T_b38	SLC35E2	-3.18	0.00164	-0.060777	26	0.01911	yes	TESTIS
chr1_1755504_T_C_b38	SLC35E2	3.172	0.00169	0.051039	72	0.01609	yes	TESTIS
chr1_1752126_G_A_b38	SLC35E2	3.161	0.00175	0.054022	45	0.017089	yes	TESTIS
chr1_1606384_A_G_b38	SLC35E2	3.105	0.00211	0.051122	42	0.016465	yes	TESTIS
chr1_1758323_T_C_b38	SLC35E2	3.065	0.0024	0.048939	61	0.015967	yes	TESTIS
chr1_1986752_A_G_b38	SLC35E2	3.036	0.00264	0.052266	54	0.017218	yes	TESTIS
chr1_1971864_C_T_b38	SLC35E2	3.01	0.00286	0.048649	52	0.016161	yes	TESTIS
chr1_2431325_A_T_b38	SLC35E2	-3.003	0.00292	-0.053598	26	0.017846	yes	TESTIS
chr1_2427319_C_T_b38	SLC35E2	-2.992	0.00303	-0.046493	57	0.015536	yes	TESTIS
chr1_1936906_C_CA_b38	SLC35E2	-2.991	0.00304	-0.055782	33	0.01865	yes	TESTIS
chr1_2583136_C_T_b38	SLC35E2	-2.976	0.00319	-0.048488	74	0.016295	yes	TESTIS
chr1_1728671_C_A_b38	SLC35E2	2.973	0.00322	0.064528	10	0.021706	yes	TESTIS
chr1_933741_T_TG_b38	SLC35E2	-2.961	0.00335	-0.052384	34	0.017693	yes	TESTIS
chr1_936972_G_C_b38	SLC35E2	2.957	0.00339	0.052519	30	0.017764	yes	TESTIS
chr1_1828894_T_TAC_b38	SLC35E2	2.938	0.00359	0.050166	55	0.017076	yes	TESTIS
chr1_1035169_TG_T_b38	SLC35E2	-2.936	0.00362	-0.057582	22	0.019614	yes	TESTIS
chr1_1635226_T_C_b38	SLC35E2	-2.935	0.00362	-0.06482	9	0.022084	yes	TESTIS
chr1_1729859_A_G_b38	SLC35E2	2.931	0.00367	0.062656	7	0.021374	yes	TESTIS
chr1_1029365_A_ATCTATGCAGGCAGGTGGGGGGATCAGTG_b38	SLC35E2	2.929	0.00369	0.054186	17	0.018499	yes	TESTIS
chr1_2682288_A_G_b38	SLC35E2	2.926	0.00373	0.052999	41	0.018111	yes	TESTIS
chr1_2425473_G_A_b38	SLC35E2	-2.914	0.00387	-0.045114	56	0.015479	yes	TESTIS
chr1_1757725_C_T_b38	SLC35E2	2.893	0.00413	0.048753	53	0.01685	yes	TESTIS
chr1_1702383_T_C_b38	SLC35E2	-2.885	0.00424	-0.05693	17	0.019736	yes	TESTIS
chr1_2581271_T_C_b38	SLC35E2	-2.879	0.00431	-0.047582	76	0.016525	yes	TESTIS
chr1_2581777_C_T_b38	SLC35E2	-2.879	0.00431	-0.047582	76	0.016525	yes	TESTIS
chr1_2582213_AAAAC_A_b38	SLC35E2	-2.879	0.00431	-0.047582	76	0.016525	yes	TESTIS
chr1_2582239_A_T_b38	SLC35E2	-2.879	0.00431	-0.047582	76	0.016525	yes	TESTIS
chr1_1970506_T_A_b38	SLC35E2	-2.879	0.00431	-0.048108	49	0.01671	yes	TESTIS
chr1_1586987_G_A_b38	SLC35E2	-2.877	0.00434	-0.049076	43	0.017059	yes	TESTIS
chr1_1743714_C_CA_b38	SLC35E2	2.874	0.00438	0.049782	49	0.017323	yes	TESTIS
chr1_2581211_T_C_b38	SLC35E2	-2.866	0.00448	-0.047376	77	0.016529	yes	TESTIS
chr1_2557169_T_C_b38	SLC35E2	-2.843	0.00482	-0.046899	73	0.016497	yes	TESTIS
chr1_1586956_T_C_b38	SLC35E2	-2.84	0.00485	-0.048734	43	0.017157	yes	TESTIS
chr1_2581666_C_T_b38	SLC35E2	-2.83	0.00501	-0.061996	9	0.021907	yes	TESTIS
chr1_2428478_T_C_b38	SLC35E2	-2.826	0.00507	-0.04793	32	0.016963	yes	TESTIS
chr1_1781909_C_T_b38	SLC35E2	2.806	0.00538	0.046335	58	0.016512	yes	TESTIS
chr1_2579841_C_T_b38	SLC35E2	-2.782	0.0058	-0.045155	73	0.016234	yes	TESTIS
chr1_979560_T_C_b38	SLC35E2	-2.781	0.00581	-0.044103	73	0.015859	yes	TESTIS
chr1_2581013_G_A_b38	SLC35E2	-2.78	0.00582	-0.045479	72	0.016359	yes	TESTIS
chr1_2581616_A_T_b38	SLC35E2	-2.78	0.00582	-0.045479	72	0.016359	yes	TESTIS
chr1_2582193_C_G_b38	SLC35E2	-2.78	0.00582	-0.045479	72	0.016359	yes	TESTIS
chr1_1594570_A_G_b38	SLC35E2	2.778	0.00586	0.049705	27	0.017893	yes	TESTIS
chr1_1848037_C_CTA_b38	SLC35E2	2.776	0.00589	0.04642	57	0.016722	yes	TESTIS
chr1_2534232_T_C_b38	SLC35E2	2.77	0.00601	0.054276	13	0.019597	yes	TESTIS
chr1_935954_G_T_b38	SLC35E2	-2.764	0.0061	-0.048805	41	0.017654	yes	TESTIS
chr1_1931743_CA_C_b38	SLC35E2	-2.764	0.0061	-0.053879	26	0.019491	yes	TESTIS
chr1_1764023_C_A_b38	SLC35E2	2.758	0.00622	0.045875	55	0.016634	yes	TESTIS
chr1_2523270_T_C_b38	SLC35E2	2.747	0.00643	0.051377	20	0.018704	yes	TESTIS
chr1_917284_C_T_b38	SLC35E2	2.727	0.00681	0.060221	6	0.022082	yes	TESTIS
chr1_917378_G_C_b38	SLC35E2	2.727	0.00681	0.060221	6	0.022082	yes	TESTIS
chr1_917859_A_G_b38	SLC35E2	2.727	0.00681	0.060221	6	0.022082	yes	TESTIS
chr1_1960609_G_C_b38	SLC35E2	-2.727	0.00681	-0.045006	49	0.016504	yes	TESTIS
chr1_2431888_G_C_b38	SLC35E2	-2.727	0.00682	-0.042767	56	0.015684	yes	TESTIS
chr1_981454_G_A_b38	SLC35E2	-2.723	0.0069	-0.043335	67	0.015916	yes	TESTIS
chr1_938178_G_T_b38	SLC35E2	-2.703	0.0073	-0.048111	40	0.017797	yes	TESTIS
chr1_2579316_G_A_b38	SLC35E2	-2.701	0.00735	-0.059281	9	0.021946	yes	TESTIS
chr1_1641819_C_T_b38	SLC35E2	2.699	0.0074	0.059184	15	0.02193	yes	TESTIS
chr1_1680672_C_T_b38	SLC35E2	-2.673	0.00798	-0.046636	52	0.017446	yes	TESTIS
chr1_2533705_C_T_b38	SLC35E2	2.669	0.00807	0.049046	22	0.018375	yes	TESTIS
chr1_2683374_T_C_b38	SLC35E2	2.668	0.00809	0.077133	4	0.028909	yes	TESTIS
chr1_1756186_T_C_b38	SLC35E2	2.668	0.00809	0.043708	55	0.016381	yes	TESTIS
chr1_978953_C_G_b38	SLC35E2	-2.666	0.00814	-0.041946	64	0.015733	yes	TESTIS
chr1_1754601_G_T_b38	SLC35E2	2.661	0.00827	0.04477	53	0.016827	yes	TESTIS
chr1_983004_G_T_b38	SLC35E2	-2.656	0.00839	-0.042313	78	0.015933	yes	TESTIS
chr1_978509_G_A_b38	SLC35E2	-2.653	0.00847	-0.041555	69	0.015666	yes	TESTIS
chr1_983193_A_G_b38	SLC35E2	-2.645	0.00865	-0.042346	67	0.016008	yes	TESTIS
chr1_2534473_C_T_b38	SLC35E2	2.64	0.00877	0.048299	22	0.018294	yes	TESTIS
chr1_2572795_C_A_b38	SLC35E2	-2.639	0.0088	-0.043412	76	0.01645	yes	TESTIS
chr1_979472_G_C_b38	SLC35E2	-2.626	0.00914	-0.041117	70	0.015657	yes	TESTIS
chr1_1757074_G_T_b38	SLC35E2	2.623	0.00921	0.043022	54	0.016401	yes	TESTIS
chr1_1820337_A_G_b38	SLC35E2	2.616	0.0094	0.042657	62	0.016306	yes	TESTIS
chr1_965337_CTTAT_C_b38	SLC35E2	-2.61	0.00956	-0.0458	60	0.017546	yes	TESTIS
chr1_2561226_G_T_b38	SLC35E2	-2.598	0.00989	-0.057018	9	0.021945	yes	TESTIS
chr1_1649976_G_A_b38	SLC35E2	5.535	7.44e-08	0.088421	52	0.015975	no	TESTIS
chr1_1636278_G_T_b38	SLC35E2	5.277	2.72e-07	0.084605	57	0.016033	no	TESTIS
chr1_1698048_T_C_b38	SLC35E2	-4.951	1.31e-06	-0.178582	3	0.036072	no	TESTIS
chr1_1743851_C_T_b38	SLC35E2	-4.651	5.2e-06	-0.08663	23	0.018625	no	TESTIS
chr1_2425690_G_GT_b38	SLC35E2	-4.529	8.94e-06	-0.093295	7	0.0206	no	TESTIS
chr1_1743840_T_C_b38	SLC35E2	-4.402	1.55e-05	-0.082081	24	0.018645	no	TESTIS
chr1_1744499_C_T_b38	SLC35E2	-4.374	1.75e-05	-0.067048	61	0.015327	no	TESTIS
chr1_1742672_C_T_b38	SLC35E2	-4.343	2e-05	-0.06873	56	0.015826	no	TESTIS
chr1_1743238_G_C_b38	SLC35E2	-4.343	2e-05	-0.06873	56	0.015826	no	TESTIS
chr1_1759354_G_A_b38	SLC35E2	-4.058	6.5e-05	-0.066751	65	0.016449	no	TESTIS
chr1_1722626_AGCG_A_b38	SLC35E2	4.056	6.54e-05	0.079836	21	0.019681	no	TESTIS
chr1_1864334_AAAG_A_b38	SLC35E2	-4.047	6.81e-05	-0.086633	15	0.021409	no	TESTIS
chr1_1692124_T_G_b38	SLC35E2	-4.007	7.97e-05	-0.075091	21	0.018738	no	TESTIS
chr1_1754482_TCCCTGGGACCGAAGTCGCCCCA_T_b38	SLC35E2	-3.956	9.78e-05	-0.065829	65	0.016641	no	TESTIS
chr1_1756043_G_T_b38	SLC35E2	-3.943	0.000103	-0.065489	65	0.01661	no	TESTIS
chr1_1750280_A_G_b38	SLC35E2	-3.898	0.000123	-0.063624	69	0.016323	no	TESTIS
chr1_1692151_T_C_b38	SLC35E2	-3.854	0.000146	-0.071889	22	0.018655	no	TESTIS
chr1_1629332_G_T_b38	SLC35E2	3.804	0.000177	0.066118	37	0.017383	no	TESTIS
chr1_1641275_A_G_b38	SLC35E2	-3.776	0.000197	-0.06586	39	0.017442	no	TESTIS
chr1_2423784_T_C_b38	SLC35E2	-3.767	0.000203	-0.08176	7	0.021702	no	TESTIS
chr1_1650000_G_A_b38	SLC35E2	3.738	0.000227	0.060301	44	0.016133	no	TESTIS
chr1_2424713_C_A_b38	SLC35E2	-3.735	0.00023	-0.088136	6	0.0236	no	TESTIS
chr1_1743586_T_TAC_b38	SLC35E2	-3.628	0.000342	-0.060322	43	0.016625	no	TESTIS
chr1_1744854_C_A_b38	SLC35E2	-3.607	0.00037	-0.055806	46	0.015473	no	TESTIS
chr1_1667424_T_TAAATA_b38	SLC35E2	-3.6	0.000379	-0.060165	47	0.016713	no	TESTIS
chr1_1748780_G_A_b38	SLC35E2	-3.57	0.000423	-0.05973	69	0.016732	no	TESTIS
chr1_946653_G_A_b38	SLC35E2	3.556	0.000446	0.068903	16	0.019378	no	TESTIS
chr1_2424124_G_T_b38	SLC35E2	-3.536	0.000478	-0.08109	6	0.02293	no	TESTIS
chr1_1747472_A_T_b38	SLC35E2	-3.532	0.000485	-0.059711	64	0.016905	no	TESTIS
chr1_1748597_C_G_b38	SLC35E2	-3.514	0.000519	-0.059394	65	0.016904	no	TESTIS
chr1_1675228_C_CG_b38	SLC35E2	3.499	0.000547	0.05894	46	0.016845	no	TESTIS
chr1_1695459_A_G_b38	SLC35E2	3.469	0.000609	0.068509	53	0.019749	no	TESTIS
chr1_1743565_AT_A_b38	SLC35E2	3.46	0.000628	0.052332	75	0.015123	no	TESTIS
chr1_924305_G_A_b38	SLC35E2	3.458	0.000633	0.06982	13	0.02019	no	TESTIS
chr1_1717507_T_C_b38	SLC35E2	3.441	0.000673	0.085126	8	0.024742	no	TESTIS
chr1_1722619_C_T_b38	SLC35E2	3.411	0.000746	0.067405	22	0.019759	no	TESTIS
chr1_1688531_T_C_b38	SLC35E2	-3.389	0.000806	-0.07188	18	0.021208	no	TESTIS
chr1_1744121_A_C_b38	SLC35E2	-3.348	0.00093	-0.083555	30	0.024955	no	TESTIS
chr1_1688570_A_T_b38	SLC35E2	-3.337	0.000966	-0.07054	11	0.021136	no	TESTIS
chr1_1688409_C_G_b38	SLC35E2	-3.336	0.000969	-0.055474	48	0.016627	no	TESTIS
chr1_965666_ACC_A_b38	SLC35E2	3.318	0.00103	0.06499	16	0.01959	no	TESTIS
chr1_1688786_G_A_b38	SLC35E2	-3.315	0.00104	-0.072362	15	0.02183	no	TESTIS
chr1_1595028_C_CAG_b38	SLC35E2	3.292	0.00113	0.060522	24	0.018386	no	TESTIS
chr1_1698022_G_A_b38	SLC35E2	-3.277	0.00119	-0.152698	7	0.04659	no	TESTIS
chr1_1695747_C_T_b38	SLC35E2	3.272	0.00121	0.062869	52	0.019216	no	TESTIS
chr1_1749637_G_T_b38	SLC35E2	3.252	0.00129	0.05124	57	0.015758	no	TESTIS
chr1_1749826_A_G_b38	SLC35E2	-3.244	0.00133	-0.051749	73	0.015955	no	TESTIS
chr1_923311_TG_T_b38	SLC35E2	-3.216	0.00146	-0.063086	24	0.019617	no	TESTIS
chr1_1688619_AAAC_A_b38	SLC35E2	-3.211	0.00149	-0.064396	25	0.020057	no	TESTIS
chr1_1688586_C_T_b38	SLC35E2	-3.205	0.00152	-0.065965	22	0.020584	no	TESTIS
chr1_965125_G_C_b38	SLC35E2	3.204	0.00152	0.061134	19	0.01908	no	TESTIS
chr1_1675132_A_G_b38	SLC35E2	3.188	0.0016	0.055115	38	0.017287	no	TESTIS
chr1_1688442_T_C_b38	SLC35E2	-3.15	0.00182	-0.061158	27	0.019415	no	TESTIS
chr1_945259_TC_T_b38	SLC35E2	3.13	0.00194	0.061221	15	0.019557	no	TESTIS
chr1_1606099_G_GGTCAGGCGAGGGGTC_b38	SLC35E2	3.125	0.00198	0.054928	28	0.01758	no	TESTIS
chr1_2579270_A_AT_b38	SLC35E2	-3.118	0.00202	-0.069839	11	0.022398	no	TESTIS
chr1_931558_G_A_b38	SLC35E2	3.09	0.00221	0.060848	14	0.01969	no	TESTIS
chr1_1688647_G_A_b38	SLC35E2	-3.078	0.0023	-0.060509	28	0.019661	no	TESTIS
chr1_941767_G_A_b38	SLC35E2	3.076	0.00231	0.06214	12	0.020199	no	TESTIS
chr1_969663_CAT_C_b38	SLC35E2	3.034	0.00265	0.057653	17	0.019	no	TESTIS
chr1_1976566_T_C_b38	SLC35E2	3.013	0.00284	0.048184	56	0.015994	no	TESTIS
chr1_1597128_C_CCCTCAGCTGGACT_b38	SLC35E2	-3.005	0.00291	-0.048547	50	0.016156	no	TESTIS
chr1_1606094_G_GAGGGGTC_b38	SLC35E2	2.99	0.00305	0.056797	23	0.018997	no	TESTIS
chr1_1697272_G_A_b38	SLC35E2	2.978	0.00316	0.074123	21	0.024887	no	TESTIS
chr1_1595306_CAG_C_b38	SLC35E2	-2.973	0.00322	-0.05383	71	0.018107	no	TESTIS
chr1_954724_G_A_b38	SLC35E2	2.972	0.00323	0.059251	13	0.019938	no	TESTIS
chr1_932255_C_T_b38	SLC35E2	2.966	0.00329	0.061302	11	0.020667	no	TESTIS
chr1_1679100_A_G_b38	SLC35E2	-2.959	0.00337	-0.047236	56	0.015966	no	TESTIS
chr1_2676824_ACGGCC_A_b38	SLC35E2	-2.949	0.00347	-0.122451	3	0.041527	no	TESTIS
chr1_1606089_GGC_G_b38	SLC35E2	2.941	0.00356	0.055847	23	0.018991	no	TESTIS
chr1_2425138_A_G_b38	SLC35E2	-2.926	0.00373	-0.045198	58	0.015446	no	TESTIS
chr1_1770997_G_A_b38	SLC35E2	-2.92	0.0038	-0.048149	67	0.016491	no	TESTIS
chr1_929839_G_A_b38	SLC35E2	2.915	0.00386	0.060203	11	0.020656	no	TESTIS
chr1_1755523_C_T_b38	SLC35E2	2.914	0.00387	0.046881	79	0.016089	no	TESTIS
chr1_1691417_T_C_b38	SLC35E2	2.901	0.00403	0.049591	61	0.017094	no	TESTIS
chr1_1750508_A_C_b38	SLC35E2	-2.897	0.00408	-0.043231	70	0.014922	no	TESTIS
chr1_923421_A_G_b38	SLC35E2	-2.895	0.00411	-0.056474	25	0.019511	no	TESTIS
chr1_1688457_G_A_b38	SLC35E2	-2.889	0.00418	-0.056088	30	0.019412	no	TESTIS
chr1_1773676_TTG_T_b38	SLC35E2	-2.872	0.00441	-0.084709	3	0.029495	no	TESTIS
chr1_1763634_AAG_A_b38	SLC35E2	2.858	0.0046	0.051672	54	0.01808	no	TESTIS
chr1_928622_G_C_b38	SLC35E2	2.845	0.00479	0.058232	11	0.020472	no	TESTIS
chr1_1308552_GGA_G_b38	SLC35E2	2.84	0.00486	0.076765	6	0.02703	no	TESTIS
chr1_1836126_C_A_b38	SLC35E2	-2.828	0.00504	-0.045561	70	0.016111	no	TESTIS
chr1_2677450_C_A_b38	SLC35E2	2.809	0.00533	0.064117	11	0.022824	no	TESTIS
chr1_1851414_GA_G_b38	SLC35E2	-2.786	0.00573	-0.049579	42	0.017799	no	TESTIS
chr1_925308_G_A_b38	SLC35E2	-2.782	0.00579	-0.055605	25	0.019987	no	TESTIS
chr1_1466535_C_CA_b38	SLC35E2	2.745	0.00646	0.072776	5	0.026509	no	TESTIS
chr1_2687365_C_A_b38	SLC35E2	2.739	0.00657	0.050352	31	0.018382	no	TESTIS
chr1_1987049_A_G_b38	SLC35E2	2.735	0.00665	0.046629	55	0.017046	no	TESTIS
chr1_926250_G_A_b38	SLC35E2	-2.725	0.00685	-0.054659	25	0.020058	no	TESTIS
chr1_940296_GCC_G_b38	SLC35E2	-2.72	0.00696	-0.044682	55	0.016427	no	TESTIS
chr1_1672155_G_A_b38	SLC35E2	-2.703	0.00731	-0.048323	29	0.017876	no	TESTIS
chr1_1668373_C_T_b38	SLC35E2	2.703	0.00731	0.050556	37	0.018704	no	TESTIS
chr1_1683909_A_C_b38	SLC35E2	-2.702	0.00734	-0.04577	59	0.016942	no	TESTIS
chr1_1877312_A_T_b38	SLC35E2	2.7	0.00737	0.060785	9	0.022509	no	TESTIS
chr1_1881428_C_CT_b38	SLC35E2	-2.696	0.00746	-0.0465	63	0.017246	no	TESTIS
chr1_1831318_C_T_b38	SLC35E2	-2.695	0.00749	-0.045621	66	0.01693	no	TESTIS
chr1_1692286_C_A_b38	SLC35E2	2.693	0.00752	0.063863	3	0.023712	no	TESTIS
chr1_925036_G_A_b38	SLC35E2	-2.691	0.00758	-0.053241	25	0.019786	no	TESTIS
chr1_1969015_A_G_b38	SLC35E2	2.679	0.00784	0.046088	72	0.017204	no	TESTIS
chr1_968046_C_T_b38	SLC35E2	2.66	0.00828	0.047309	30	0.017783	no	TESTIS
chr1_1924207_T_C_b38	SLC35E2	-2.634	0.00893	-0.046215	34	0.017544	no	TESTIS
chr1_1679993_A_G_b38	SLC35E2	-2.619	0.00933	-0.044532	72	0.017005	no	TESTIS
chr1_1827774_A_G_b38	SLC35E2	-2.619	0.00933	-0.04403	67	0.016814	no	TESTIS
chr1_1238902_T_C_b38	SLC35E2	-2.618	0.00935	-0.050993	33	0.019477	no	TESTIS
chr1_927486_C_T_b38	SLC35E2	-2.6	0.00985	-0.051585	26	0.019844	no	TESTIS
chr1_1681928_C_A_b38	SLC35E2	-2.596	0.00994	-0.043452	52	0.016735	no	TESTIS
chr1_1677720_T_G_b38	SLC35E2	6.382	3.98e-10	0.083413	141	0.013071	yes	THYROID
chr1_1742587_G_C_b38	SLC35E2	6.342	5.06e-10	0.085133	143	0.013424	yes	THYROID
chr1_1676790_C_T_b38	SLC35E2	6.331	5.42e-10	0.082173	141	0.01298	yes	THYROID
chr1_1671995_G_T_b38	SLC35E2	6.325	5.61e-10	0.083254	140	0.013163	yes	THYROID
chr1_1677726_A_T_b38	SLC35E2	6.304	6.33e-10	0.082606	141	0.013103	yes	THYROID
chr1_1674720_TGC_T_b38	SLC35E2	6.289	6.95e-10	0.083358	138	0.013255	yes	THYROID
chr1_1674868_G_A_b38	SLC35E2	6.265	8.01e-10	0.082981	139	0.013245	yes	THYROID
chr1_1673060_G_A_b38	SLC35E2	6.243	9.12e-10	0.083787	138	0.01342	yes	THYROID
chr1_1673818_A_C_b38	SLC35E2	6.193	1.23e-09	0.082164	141	0.013267	yes	THYROID
chr1_1743565_ATAT_A_b38	SLC35E2	-6.123	1.85e-09	-0.080533	100	0.013152	yes	THYROID
chr1_1688328_C_T_b38	SLC35E2	-6.026	3.26e-09	-0.092889	36	0.015416	yes	THYROID
chr1_1744652_C_T_b38	SLC35E2	-6.012	3.52e-09	-0.08287	109	0.013784	yes	THYROID
chr1_1743238_G_C_b38	SLC35E2	-5.991	3.99e-09	-0.083289	99	0.013903	yes	THYROID
chr1_1744854_C_A_b38	SLC35E2	-5.988	4.03e-09	-0.077824	89	0.012996	yes	THYROID
chr1_1753033_C_T_b38	SLC35E2	-5.954	4.91e-09	-0.082769	129	0.013901	yes	THYROID
chr1_1692151_T_C_b38	SLC35E2	-5.929	5.66e-09	-0.095125	47	0.016043	yes	THYROID
chr1_1742672_C_T_b38	SLC35E2	-5.922	5.9e-09	-0.082168	100	0.013875	yes	THYROID
chr1_1751981_A_T_b38	SLC35E2	-5.904	6.52e-09	-0.093324	54	0.015806	yes	THYROID
chr1_1752461_G_A_b38	SLC35E2	-5.87	7.9e-09	-0.081919	121	0.013954	yes	THYROID
chr1_1752730_C_G_b38	SLC35E2	-5.87	7.9e-09	-0.081919	121	0.013954	yes	THYROID
chr1_1864334_AAAG_A_b38	SLC35E2	-5.852	8.75e-09	-0.097856	39	0.016721	yes	THYROID
chr1_1753319_G_A_b38	SLC35E2	-5.797	1.19e-08	-0.08109	121	0.013988	yes	THYROID
chr1_1753361_G_A_b38	SLC35E2	-5.797	1.19e-08	-0.08109	121	0.013988	yes	THYROID
chr1_1747695_A_G_b38	SLC35E2	-5.786	1.27e-08	-0.069897	129	0.01208	yes	THYROID
chr1_1739131_T_C_b38	SLC35E2	5.73	1.73e-08	0.077429	104	0.013513	yes	THYROID
chr1_1722690_TA_T_b38	SLC35E2	-5.67	2.41e-08	-0.124781	3	0.022008	yes	THYROID
chr1_1671797_G_A_b38	SLC35E2	5.633	2.95e-08	0.075801	133	0.013456	yes	THYROID
chr1_1750280_A_G_b38	SLC35E2	-5.633	2.96e-08	-0.077637	132	0.013784	yes	THYROID
chr1_1660683_C_T_b38	SLC35E2	-5.567	4.23e-08	-0.089956	35	0.01616	yes	THYROID
chr1_1743714_C_CA_b38	SLC35E2	5.554	4.52e-08	0.083318	85	0.015001	yes	THYROID
chr1_1668721_C_T_b38	SLC35E2	-5.554	4.54e-08	-0.085981	41	0.015482	yes	THYROID
chr1_1675091_A_G_b38	SLC35E2	-5.54	4.88e-08	-0.088051	36	0.015894	yes	THYROID
chr1_1671097_G_C_b38	SLC35E2	5.512	5.68e-08	0.080791	58	0.014657	yes	THYROID
chr1_1756043_G_T_b38	SLC35E2	-5.495	6.21e-08	-0.077061	124	0.014023	yes	THYROID
chr1_1708474_C_A_b38	SLC35E2	-5.458	7.57e-08	-0.100431	15	0.018401	yes	THYROID
chr1_1671148_C_T_b38	SLC35E2	5.456	7.65e-08	0.080131	59	0.014687	yes	THYROID
chr1_1744028_A_AC_b38	SLC35E2	-5.453	7.77e-08	-0.097333	26	0.017849	yes	THYROID
chr1_1743886_C_T_b38	SLC35E2	-5.443	8.22e-08	-0.087294	51	0.016039	yes	THYROID
chr1_1743851_C_T_b38	SLC35E2	-5.439	8.38e-08	-0.08796	45	0.016172	yes	THYROID
chr1_1668108_C_T_b38	SLC35E2	5.416	9.45e-08	0.080709	55	0.014901	yes	THYROID
chr1_1743586_T_TAC_b38	SLC35E2	-5.401	1.02e-07	-0.077767	79	0.014398	yes	THYROID
chr1_1754482_TCCCTGGGACCGAAGTCGCCCCA_T_b38	SLC35E2	-5.394	1.06e-07	-0.076153	124	0.014118	yes	THYROID
chr1_1744052_GAGA_G_b38	SLC35E2	-5.392	1.08e-07	-0.092977	34	0.017245	yes	THYROID
chr1_1668542_C_T_b38	SLC35E2	-5.368	1.22e-07	-0.08959	28	0.01669	yes	THYROID
chr1_1730405_G_C_b38	SLC35E2	5.354	1.31e-07	0.079641	94	0.014875	yes	THYROID
chr1_1673968_GA_G_b38	SLC35E2	5.342	1.4e-07	0.084438	59	0.015807	yes	THYROID
chr1_1667948_A_G_b38	SLC35E2	-5.337	1.43e-07	-0.087866	31	0.016463	yes	THYROID
chr1_1728671_C_A_b38	SLC35E2	5.336	1.44e-07	0.094244	21	0.017662	yes	THYROID
chr1_1692286_C_A_b38	SLC35E2	5.327	1.51e-07	0.110932	4	0.020826	yes	THYROID
chr1_1749826_A_G_b38	SLC35E2	-5.321	1.56e-07	-0.071384	139	0.013416	yes	THYROID
chr1_1668717_C_G_b38	SLC35E2	-5.314	1.61e-07	-0.087991	30	0.016557	yes	THYROID
chr1_1750440_G_A_b38	SLC35E2	-5.314	1.62e-07	-0.0812	82	0.015281	yes	THYROID
chr1_1670423_AT_A_b38	SLC35E2	5.307	1.67e-07	0.086644	68	0.016326	yes	THYROID
chr1_1752126_G_A_b38	SLC35E2	5.297	1.76e-07	0.079001	76	0.014913	yes	THYROID
chr1_1743840_T_C_b38	SLC35E2	-5.297	1.76e-07	-0.085575	46	0.016154	yes	THYROID
chr1_1750428_G_C_b38	SLC35E2	-5.294	1.79e-07	-0.081271	84	0.01535	yes	THYROID
chr1_1692124_T_G_b38	SLC35E2	-5.279	1.93e-07	-0.083833	46	0.015879	yes	THYROID
chr1_1658866_G_A_b38	SLC35E2	-5.243	2.33e-07	-0.078416	55	0.014957	yes	THYROID
chr1_1659114_A_G_b38	SLC35E2	-5.243	2.33e-07	-0.078416	55	0.014957	yes	THYROID
chr1_1659220_A_G_b38	SLC35E2	-5.243	2.33e-07	-0.078416	55	0.014957	yes	THYROID
chr1_1661420_C_A_b38	SLC35E2	-5.243	2.33e-07	-0.078416	55	0.014957	yes	THYROID
chr1_1665061_C_T_b38	SLC35E2	-5.189	3.06e-07	-0.086481	29	0.016665	yes	THYROID
chr1_1748780_G_A_b38	SLC35E2	-5.182	3.18e-07	-0.072112	136	0.013915	yes	THYROID
chr1_1669576_G_A_b38	SLC35E2	-5.182	3.19e-07	-0.086148	29	0.016626	yes	THYROID
chr1_1755523_C_T_b38	SLC35E2	5.142	3.89e-07	0.069462	149	0.013507	yes	THYROID
chr1_1744499_C_T_b38	SLC35E2	-5.141	3.93e-07	-0.070623	107	0.013738	yes	THYROID
chr1_1664865_A_G_b38	SLC35E2	-5.099	4.84e-07	-0.076617	52	0.015025	yes	THYROID
chr1_1752908_C_CCCT_b38	SLC35E2	-5.098	4.87e-07	-0.075392	101	0.014789	yes	THYROID
chr1_1669613_G_A_b38	SLC35E2	-5.094	4.96e-07	-0.084297	30	0.016548	yes	THYROID
chr1_1659060_G_A_b38	SLC35E2	-5.089	5.11e-07	-0.07989	42	0.0157	yes	THYROID
chr1_1729859_A_G_b38	SLC35E2	5.073	5.52e-07	0.089084	17	0.01756	yes	THYROID
chr1_1759611_C_T_b38	SLC35E2	-5.066	5.72e-07	-0.071646	125	0.014143	yes	THYROID
chr1_1757725_C_T_b38	SLC35E2	5.051	6.16e-07	0.071383	101	0.014133	yes	THYROID
chr1_1658830_C_G_b38	SLC35E2	-5.042	6.43e-07	-0.082796	29	0.01642	yes	THYROID
chr1_1748597_C_G_b38	SLC35E2	-5.035	6.66e-07	-0.071418	122	0.014183	yes	THYROID
chr1_1661177_A_G_b38	SLC35E2	-5.029	6.86e-07	-0.083321	30	0.016568	yes	THYROID
chr1_1749637_G_T_b38	SLC35E2	5.028	6.9e-07	0.067246	110	0.013374	yes	THYROID
chr1_1743565_AT_A_b38	SLC35E2	5.025	7.03e-07	0.063361	149	0.01261	yes	THYROID
chr1_1750226_C_T_b38	SLC35E2	5.022	7.13e-07	0.070374	107	0.014014	yes	THYROID
chr1_1755504_T_C_b38	SLC35E2	4.996	8.1e-07	0.066796	141	0.013371	yes	THYROID
chr1_1759354_G_A_b38	SLC35E2	-4.995	8.12e-07	-0.070592	123	0.014132	yes	THYROID
chr1_1756186_T_C_b38	SLC35E2	4.922	1.16e-06	0.068225	104	0.01386	yes	THYROID
chr1_1747472_A_T_b38	SLC35E2	-4.906	1.26e-06	-0.06997	121	0.014262	yes	THYROID
chr1_1757074_G_T_b38	SLC35E2	4.902	1.28e-06	0.068277	103	0.01393	yes	THYROID
chr1_1754601_G_T_b38	SLC35E2	4.898	1.31e-06	0.069226	101	0.014133	yes	THYROID
chr1_1708521_C_G_b38	SLC35E2	-4.879	1.43e-06	-0.080676	34	0.016534	yes	THYROID
chr1_1688786_G_A_b38	SLC35E2	-4.85	1.65e-06	-0.09101	25	0.018766	yes	THYROID
chr1_1688619_AAAC_A_b38	SLC35E2	-4.793	2.17e-06	-0.082567	44	0.017228	yes	THYROID
chr1_1654662_CT_C_b38	SLC35E2	4.79	2.2e-06	0.072115	97	0.015055	yes	THYROID
chr1_1664757_T_C_b38	SLC35E2	-4.788	2.22e-06	-0.071101	52	0.01485	yes	THYROID
chr1_1744121_A_C_b38	SLC35E2	-4.788	2.22e-06	-0.096107	64	0.020074	yes	THYROID
chr1_1665581_C_G_b38	SLC35E2	-4.783	2.28e-06	-0.078241	32	0.016359	yes	THYROID
chr1_1820337_A_G_b38	SLC35E2	4.772	2.4e-06	0.064885	126	0.013598	yes	THYROID
chr1_1865177_G_A_b38	SLC35E2	-4.752	2.63e-06	-0.077392	32	0.016285	yes	THYROID
chr1_1755713_G_A_b38	SLC35E2	-4.731	2.91e-06	-0.067507	111	0.014269	yes	THYROID
chr1_1722626_AGCG_A_b38	SLC35E2	4.709	3.22e-06	0.083016	41	0.017629	yes	THYROID
chr1_1695459_A_G_b38	SLC35E2	4.704	3.3e-06	0.075067	105	0.015958	yes	THYROID
chr1_1746440_A_G_b38	SLC35E2	-4.703	3.32e-06	-0.080938	29	0.01721	yes	THYROID
chr1_1722625_A_T_b38	SLC35E2	4.692	3.49e-06	0.082832	41	0.017654	yes	THYROID
chr1_1650195_A_G_b38	SLC35E2	-4.687	3.58e-06	-0.071094	53	0.01517	yes	THYROID
chr1_1945842_A_AAAAGAAC_b38	SLC35E2	-4.686	3.6e-06	-0.069366	93	0.014804	yes	THYROID
chr1_1660408_T_C_b38	SLC35E2	-4.649	4.26e-06	-0.085139	11	0.018313	yes	THYROID
chr1_1760882_T_C_b38	SLC35E2	4.614	5.01e-06	0.062626	125	0.013572	yes	THYROID
chr1_1688531_T_C_b38	SLC35E2	-4.614	5.03e-06	-0.083852	33	0.018175	yes	THYROID
chr1_1688647_G_A_b38	SLC35E2	-4.609	5.14e-06	-0.077662	50	0.01685	yes	THYROID
chr1_1758323_T_C_b38	SLC35E2	4.581	5.85e-06	0.062729	115	0.013694	yes	THYROID
chr1_1746522_GT_G_b38	SLC35E2	-4.576	5.97e-06	-0.078138	30	0.017075	yes	THYROID
chr1_1764023_C_A_b38	SLC35E2	4.552	6.67e-06	0.063162	107	0.013876	yes	THYROID
chr1_1637577_T_C_b38	SLC35E2	-4.541	7.02e-06	-0.071563	40	0.01576	yes	THYROID
chr1_1653863_C_A_b38	SLC35E2	-4.537	7.15e-06	-0.083732	15	0.018456	yes	THYROID
chr1_1750508_A_C_b38	SLC35E2	-4.536	7.19e-06	-0.057411	129	0.012658	yes	THYROID
chr1_1688586_C_T_b38	SLC35E2	-4.532	7.31e-06	-0.08052	37	0.017767	yes	THYROID
chr1_1770997_G_A_b38	SLC35E2	-4.522	7.63e-06	-0.062648	129	0.013853	yes	THYROID
chr1_1831318_C_T_b38	SLC35E2	-4.519	7.75e-06	-0.064516	125	0.014276	yes	THYROID
chr1_1847030_A_G_b38	SLC35E2	-4.502	8.38e-06	-0.064839	126	0.014403	yes	THYROID
chr1_1850017_G_T_b38	SLC35E2	-4.502	8.38e-06	-0.064839	126	0.014403	yes	THYROID
chr1_1743544_CA_C_b38	SLC35E2	4.494	8.67e-06	0.059615	130	0.013264	yes	THYROID
chr1_1866635_T_TA_b38	SLC35E2	4.485	9.04e-06	0.066806	79	0.014895	yes	THYROID
chr1_1866508_A_G_b38	SLC35E2	-4.478	9.34e-06	-0.064266	129	0.014352	yes	THYROID
chr1_1879567_T_C_b38	SLC35E2	-4.478	9.34e-06	-0.064266	129	0.014352	yes	THYROID
chr1_1843381_A_T_b38	SLC35E2	-4.477	9.39e-06	-0.064455	127	0.014399	yes	THYROID
chr1_1881249_A_G_b38	SLC35E2	-4.463	9.97e-06	-0.064052	129	0.014351	yes	THYROID
chr1_1886800_G_A_b38	SLC35E2	-4.463	9.97e-06	-0.064052	129	0.014351	yes	THYROID
chr1_1891654_C_CAGAG_b38	SLC35E2	-4.463	9.97e-06	-0.064052	129	0.014351	yes	THYROID
chr1_1808816_G_T_b38	SLC35E2	-4.457	1.02e-05	-0.063321	127	0.014206	yes	THYROID
chr1_1819825_G_A_b38	SLC35E2	-4.457	1.02e-05	-0.063321	127	0.014206	yes	THYROID
chr1_1848037_C_CTA_b38	SLC35E2	4.442	1.09e-05	0.061449	120	0.013832	yes	THYROID
chr1_1697979_G_A_b38	SLC35E2	-4.442	1.1e-05	-0.094415	4	0.021256	yes	THYROID
chr1_1792927_G_A_b38	SLC35E2	-4.441	1.1e-05	-0.063037	126	0.014193	yes	THYROID
chr1_1688442_T_C_b38	SLC35E2	-4.44	1.11e-05	-0.075094	47	0.016914	yes	THYROID
chr1_1791493_C_T_b38	SLC35E2	-4.44	1.11e-05	-0.063131	126	0.01422	yes	THYROID
chr1_1791592_G_A_b38	SLC35E2	-4.44	1.11e-05	-0.063131	126	0.01422	yes	THYROID
chr1_1773460_G_A_b38	SLC35E2	-4.438	1.11e-05	-0.062872	127	0.014166	yes	THYROID
chr1_1773476_C_G_b38	SLC35E2	-4.438	1.11e-05	-0.062872	127	0.014166	yes	THYROID
chr1_1776461_GAAAC_G_b38	SLC35E2	-4.434	1.14e-05	-0.06299	127	0.014208	yes	THYROID
chr1_1777362_A_G_b38	SLC35E2	-4.434	1.14e-05	-0.06299	127	0.014208	yes	THYROID
chr1_1817295_T_C_b38	SLC35E2	-4.433	1.14e-05	-0.062952	128	0.014202	yes	THYROID
chr1_1779667_T_TTG_b38	SLC35E2	4.432	1.15e-05	0.065536	80	0.014786	yes	THYROID
chr1_1846009_AGG_A_b38	SLC35E2	-4.431	1.15e-05	-0.064403	127	0.014534	yes	THYROID
chr1_1846011_G_GTCC_b38	SLC35E2	-4.431	1.15e-05	-0.064403	127	0.014534	yes	THYROID
chr1_1688457_G_A_b38	SLC35E2	-4.412	1.25e-05	-0.075358	50	0.01708	yes	THYROID
chr1_1827774_A_G_b38	SLC35E2	-4.411	1.26e-05	-0.062782	128	0.014234	yes	THYROID
chr1_1764887_C_A_b38	SLC35E2	-4.409	1.27e-05	-0.062629	128	0.014204	yes	THYROID
chr1_1771864_G_A_b38	SLC35E2	-4.409	1.27e-05	-0.062629	128	0.014204	yes	THYROID
chr1_1772410_T_C_b38	SLC35E2	-4.409	1.27e-05	-0.062629	128	0.014204	yes	THYROID
chr1_1772426_T_A_b38	SLC35E2	-4.409	1.27e-05	-0.062629	128	0.014204	yes	THYROID
chr1_1773848_A_C_b38	SLC35E2	-4.409	1.27e-05	-0.062629	128	0.014204	yes	THYROID
chr1_1790040_C_T_b38	SLC35E2	-4.409	1.27e-05	-0.062629	128	0.014204	yes	THYROID
chr1_1828894_T_TAC_b38	SLC35E2	4.402	1.31e-05	0.062486	109	0.014195	yes	THYROID
chr1_1797530_C_A_b38	SLC35E2	-4.397	1.34e-05	-0.061946	127	0.014087	yes	THYROID
chr1_1650777_G_A_b38	SLC35E2	-4.394	1.36e-05	-0.066714	50	0.015181	yes	THYROID
chr1_1860718_A_C_b38	SLC35E2	-4.392	1.37e-05	-0.063633	130	0.014489	yes	THYROID
chr1_1769969_CAAAACAAAAACA_C_b38	SLC35E2	-4.379	1.45e-05	-0.061601	134	0.014066	yes	THYROID
chr1_1844830_C_A_b38	SLC35E2	4.379	1.45e-05	0.061164	117	0.013967	yes	THYROID
chr1_1781909_C_T_b38	SLC35E2	4.378	1.46e-05	0.059897	122	0.013682	yes	THYROID
chr1_1881428_C_CT_b38	SLC35E2	-4.373	1.49e-05	-0.063151	124	0.01444	yes	THYROID
chr1_1934565_G_A_b38	SLC35E2	-4.371	1.51e-05	-0.061073	124	0.013974	yes	THYROID
chr1_1651137_C_T_b38	SLC35E2	-4.37	1.51e-05	-0.066469	50	0.015209	yes	THYROID
chr1_1651267_T_C_b38	SLC35E2	-4.37	1.51e-05	-0.066469	50	0.015209	yes	THYROID
chr1_1652135_C_G_b38	SLC35E2	-4.37	1.51e-05	-0.066469	50	0.015209	yes	THYROID
chr1_1652191_C_T_b38	SLC35E2	-4.37	1.51e-05	-0.066469	50	0.015209	yes	THYROID
chr1_1652592_A_G_b38	SLC35E2	-4.37	1.51e-05	-0.066469	50	0.015209	yes	THYROID
chr1_1652779_A_G_b38	SLC35E2	-4.37	1.51e-05	-0.066469	50	0.015209	yes	THYROID
chr1_1653147_A_C_b38	SLC35E2	-4.37	1.51e-05	-0.066469	50	0.015209	yes	THYROID
chr1_1653396_T_C_b38	SLC35E2	-4.37	1.51e-05	-0.066469	50	0.015209	yes	THYROID
chr1_1653472_T_C_b38	SLC35E2	-4.37	1.51e-05	-0.066469	50	0.015209	yes	THYROID
chr1_1653811_G_A_b38	SLC35E2	-4.37	1.51e-05	-0.066469	50	0.015209	yes	THYROID
chr1_1653893_C_T_b38	SLC35E2	-4.37	1.51e-05	-0.066469	50	0.015209	yes	THYROID
chr1_1653934_G_A_b38	SLC35E2	-4.37	1.51e-05	-0.066469	50	0.015209	yes	THYROID
chr1_1654143_G_A_b38	SLC35E2	-4.37	1.51e-05	-0.066469	50	0.015209	yes	THYROID
chr1_1722619_C_T_b38	SLC35E2	4.368	1.52e-05	0.076902	44	0.017606	yes	THYROID
chr1_1881082_C_T_b38	SLC35E2	-4.359	1.58e-05	-0.062331	129	0.014298	yes	THYROID
chr1_1652061_T_C_b38	SLC35E2	-4.322	1.86e-05	-0.065689	51	0.015198	yes	THYROID
chr1_1654188_T_G_b38	SLC35E2	-4.322	1.86e-05	-0.065689	51	0.015198	yes	THYROID
chr1_1651574_G_A_b38	SLC35E2	-4.309	1.97e-05	-0.06559	50	0.01522	yes	THYROID
chr1_1698048_T_C_b38	SLC35E2	-4.306	2e-05	-0.144851	5	0.033637	yes	THYROID
chr1_1688570_A_T_b38	SLC35E2	-4.302	2.03e-05	-0.07984	21	0.018557	yes	THYROID
chr1_1680672_C_T_b38	SLC35E2	-4.296	2.09e-05	-0.063092	105	0.014686	yes	THYROID
chr1_1651926_T_C_b38	SLC35E2	-4.289	2.15e-05	-0.065243	50	0.015211	yes	THYROID
chr1_1651421_GTAGCCCCTCTGAACGGTCTGTGACACACGCATGCTTTCAGCTAGAGTACTCTA_G_b38	SLC35E2	-4.286	2.18e-05	-0.065341	49	0.015246	yes	THYROID
chr1_1836126_C_A_b38	SLC35E2	-4.265	2.39e-05	-0.058681	134	0.013759	yes	THYROID
chr1_1940973_C_T_b38	SLC35E2	-4.222	2.88e-05	-0.058157	125	0.013776	yes	THYROID
chr1_1639348_G_T_b38	SLC35E2	-4.215	2.96e-05	-0.061961	68	0.014699	yes	THYROID
chr1_1766653_A_G_b38	SLC35E2	-4.2	3.16e-05	-0.059666	128	0.014207	yes	THYROID
chr1_1651785_C_A_b38	SLC35E2	-4.198	3.19e-05	-0.063971	50	0.01524	yes	THYROID
chr1_1586962_C_T_b38	SLC35E2	4.192	3.27e-05	0.061549	76	0.014682	yes	THYROID
chr1_1935938_T_C_b38	SLC35E2	-4.181	3.42e-05	-0.059259	101	0.014173	yes	THYROID
chr1_1942014_G_A_b38	SLC35E2	-4.178	3.47e-05	-0.05777	123	0.013827	yes	THYROID
chr1_1942075_A_G_b38	SLC35E2	-4.178	3.47e-05	-0.05777	123	0.013827	yes	THYROID
chr1_1942086_T_C_b38	SLC35E2	-4.178	3.47e-05	-0.05777	123	0.013827	yes	THYROID
chr1_1940540_G_A_b38	SLC35E2	-4.175	3.51e-05	-0.057609	124	0.013797	yes	THYROID
chr1_1942260_G_C_b38	SLC35E2	-4.175	3.51e-05	-0.057609	124	0.013797	yes	THYROID
chr1_1942258_G_A_b38	SLC35E2	-4.173	3.54e-05	-0.057719	123	0.013832	yes	THYROID
chr1_1945975_TG_T_b38	SLC35E2	-4.173	3.55e-05	-0.059529	131	0.014267	yes	THYROID
chr1_1912607_C_T_b38	SLC35E2	-4.167	3.64e-05	-0.060866	119	0.014608	yes	THYROID
chr1_1652913_C_T_b38	SLC35E2	-4.161	3.72e-05	-0.066932	38	0.016084	yes	THYROID
chr1_1937273_T_C_b38	SLC35E2	-4.149	3.93e-05	-0.057074	121	0.013757	yes	THYROID
chr1_1865278_A_C_b38	SLC35E2	4.14	4.07e-05	0.058321	106	0.014087	yes	THYROID
chr1_1744096_C_T_b38	SLC35E2	-4.128	4.29e-05	-0.08229	63	0.019935	yes	THYROID
chr1_1651653_C_T_b38	SLC35E2	4.122	4.4e-05	0.057807	139	0.014025	yes	THYROID
chr1_1762287_A_G_b38	SLC35E2	-4.121	4.41e-05	-0.05918	130	0.01436	yes	THYROID
chr1_1937841_ACACCAGGTCCACCTCTGGACACAGGTCCACC_A_b38	SLC35E2	-4.106	4.69e-05	-0.05656	124	0.013774	yes	THYROID
chr1_1679993_A_G_b38	SLC35E2	-4.099	4.84e-05	-0.057731	131	0.014084	yes	THYROID
chr1_1938125_TCA_T_b38	SLC35E2	-4.096	4.9e-05	-0.058461	129	0.014274	yes	THYROID
chr1_1691417_T_C_b38	SLC35E2	4.092	4.97e-05	0.060268	113	0.014727	yes	THYROID
chr1_1918090_A_G_b38	SLC35E2	-4.091	5e-05	-0.05926	126	0.014486	yes	THYROID
chr1_1938054_ACT_A_b38	SLC35E2	-4.081	5.22e-05	-0.056229	124	0.013779	yes	THYROID
chr1_1919188_CAGCGGCAGG_C_b38	SLC35E2	-4.076	5.33e-05	-0.058056	126	0.014245	yes	THYROID
chr1_1909234_G_A_b38	SLC35E2	-4.073	5.39e-05	-0.059391	127	0.014581	yes	THYROID
chr1_1916417_G_T_b38	SLC35E2	-4.065	5.57e-05	-0.056745	121	0.013959	yes	THYROID
chr1_1933087_C_T_b38	SLC35E2	-4.065	5.58e-05	-0.05638	118	0.01387	yes	THYROID
chr1_1933859_A_G_b38	SLC35E2	-4.065	5.58e-05	-0.05638	118	0.01387	yes	THYROID
chr1_1922670_A_G_b38	SLC35E2	-4.059	5.72e-05	-0.056409	119	0.013898	yes	THYROID
chr1_1942887_C_G_b38	SLC35E2	-4.056	5.78e-05	-0.057855	131	0.014263	yes	THYROID
chr1_1902439_C_T_b38	SLC35E2	-4.048	5.98e-05	-0.058454	127	0.01444	yes	THYROID
chr1_1914345_C_T_b38	SLC35E2	-4.045	6.05e-05	-0.058679	127	0.014506	yes	THYROID
chr1_1914918_G_A_b38	SLC35E2	-4.045	6.05e-05	-0.058679	127	0.014506	yes	THYROID
chr1_1916217_C_T_b38	SLC35E2	-4.045	6.05e-05	-0.058679	127	0.014506	yes	THYROID
chr1_1880596_T_A_b38	SLC35E2	-4.033	6.35e-05	-0.05909	115	0.01465	yes	THYROID
chr1_1944675_C_T_b38	SLC35E2	-4.028	6.5e-05	-0.05775	130	0.014338	yes	THYROID
chr1_1905586_C_T_b38	SLC35E2	-4.017	6.8e-05	-0.058647	125	0.0146	yes	THYROID
chr1_1589495_CTTT_C_b38	SLC35E2	4.014	6.87e-05	0.063831	49	0.015901	yes	THYROID
chr1_1937895_C_T_b38	SLC35E2	-4.013	6.92e-05	-0.057247	131	0.014266	yes	THYROID
chr1_1925307_C_A_b38	SLC35E2	-4.012	6.93e-05	-0.058626	124	0.014612	yes	THYROID
chr1_1902481_G_A_b38	SLC35E2	-4.01	6.99e-05	-0.057866	126	0.01443	yes	THYROID
chr1_1928648_C_T_b38	SLC35E2	-4.008	7.05e-05	-0.055662	119	0.013888	yes	THYROID
chr1_1915326_G_A_b38	SLC35E2	-4.007	7.09e-05	-0.058342	127	0.014561	yes	THYROID
chr1_1591703_T_C_b38	SLC35E2	4.002	7.24e-05	0.054778	114	0.013689	yes	THYROID
chr1_1875208_T_C_b38	SLC35E2	-3.987	7.69e-05	-0.057481	128	0.014418	yes	THYROID
chr1_1935987_G_A_b38	SLC35E2	-3.983	7.81e-05	-0.057051	133	0.014324	yes	THYROID
chr1_1901262_C_T_b38	SLC35E2	-3.981	7.89e-05	-0.057688	128	0.014492	yes	THYROID
chr1_1901386_C_A_b38	SLC35E2	-3.981	7.89e-05	-0.057688	128	0.014492	yes	THYROID
chr1_1936077_C_T_b38	SLC35E2	-3.976	8.03e-05	-0.054719	127	0.013762	yes	THYROID
chr1_1762759_AAATG_A_b38	SLC35E2	3.973	8.12e-05	0.055998	119	0.014093	yes	THYROID
chr1_1936627_C_G_b38	SLC35E2	-3.962	8.49e-05	-0.055414	116	0.013985	yes	THYROID
chr1_1899573_C_T_b38	SLC35E2	-3.956	8.71e-05	-0.057399	128	0.014509	yes	THYROID
chr1_1938332_A_ACT_b38	SLC35E2	-3.955	8.76e-05	-0.05404	128	0.013664	yes	THYROID
chr1_1648826_A_G_b38	SLC35E2	-3.95	8.95e-05	-0.060246	60	0.015254	yes	THYROID
chr1_1909238_G_A_b38	SLC35E2	-3.939	9.33e-05	-0.057335	129	0.014555	yes	THYROID
chr1_1944420_A_G_b38	SLC35E2	-3.937	9.41e-05	-0.056107	132	0.01425	yes	THYROID
chr1_1925281_C_T_b38	SLC35E2	-3.934	9.51e-05	-0.057151	128	0.014526	yes	THYROID
chr1_1929904_C_T_b38	SLC35E2	-3.927	9.79e-05	-0.056887	129	0.014485	yes	THYROID
chr1_1925233_T_C_b38	SLC35E2	-3.927	9.79e-05	-0.056968	129	0.014506	yes	THYROID
chr1_1927857_T_C_b38	SLC35E2	-3.927	9.82e-05	-0.056912	129	0.014494	yes	THYROID
chr1_1639685_G_A_b38	SLC35E2	-3.925	9.9e-05	-0.064867	33	0.016528	yes	THYROID
chr1_1920695_A_G_b38	SLC35E2	-3.923	9.97e-05	-0.056905	129	0.014506	yes	THYROID
chr1_1921333_C_T_b38	SLC35E2	-3.923	9.98e-05	-0.056652	129	0.014442	yes	THYROID
chr1_1708855_TTCCTCCTCC_T_b38	SLC35E2	3.921	1e-04	0.058396	103	0.014893	yes	THYROID
chr1_1635226_T_C_b38	SLC35E2	-3.909	0.000105	-0.07724	10	0.01976	yes	THYROID
chr1_1926870_T_C_b38	SLC35E2	-3.904	0.000108	-0.053861	112	0.013796	yes	THYROID
chr1_1914634_G_T_b38	SLC35E2	-3.902	0.000108	-0.05422	121	0.013896	yes	THYROID
chr1_1916670_G_C_b38	SLC35E2	-3.902	0.000108	-0.05422	121	0.013896	yes	THYROID
chr1_1937802_G_T_b38	SLC35E2	-3.9	0.000109	-0.056629	127	0.014519	yes	THYROID
chr1_1924788_C_T_b38	SLC35E2	-3.894	0.000112	-0.056396	130	0.014485	yes	THYROID
chr1_1931587_A_G_b38	SLC35E2	-3.883	0.000117	-0.053975	121	0.0139	yes	THYROID
chr1_1648636_G_A_b38	SLC35E2	-3.882	0.000117	-0.05917	60	0.015241	yes	THYROID
chr1_1674633_C_CA_b38	SLC35E2	3.873	0.000122	0.058169	72	0.015018	yes	THYROID
chr1_1811082_T_TA_b38	SLC35E2	-3.872	0.000122	-0.055513	78	0.014336	yes	THYROID
chr1_1921745_T_C_b38	SLC35E2	-3.872	0.000122	-0.053877	117	0.013916	yes	THYROID
chr1_1649932_C_T_b38	SLC35E2	3.858	0.000129	0.054342	126	0.014084	yes	THYROID
chr1_1930143_C_T_b38	SLC35E2	-3.849	0.000134	-0.055976	129	0.014541	yes	THYROID
chr1_1931580_CA_C_b38	SLC35E2	-3.849	0.000134	-0.053673	120	0.013944	yes	THYROID
chr1_1913643_T_C_b38	SLC35E2	-3.829	0.000145	-0.057201	114	0.014939	yes	THYROID
chr1_1649976_G_A_b38	SLC35E2	3.826	0.000147	0.054163	105	0.014156	yes	THYROID
chr1_1695747_C_T_b38	SLC35E2	3.825	0.000147	0.061476	105	0.016072	yes	THYROID
chr1_1686147_T_G_b38	SLC35E2	-3.798	0.000164	-0.055206	97	0.014536	yes	THYROID
chr1_1960609_G_C_b38	SLC35E2	-3.794	0.000166	-0.052642	102	0.013876	yes	THYROID
chr1_1739519_C_G_b38	SLC35E2	3.776	0.000178	0.062694	40	0.016603	yes	THYROID
chr1_1667424_T_TAAAATA_b38	SLC35E2	3.771	0.000182	0.055369	76	0.014684	yes	THYROID
chr1_1687236_T_G_b38	SLC35E2	-3.757	0.000192	-0.054147	98	0.014411	yes	THYROID
chr1_1649846_G_A_b38	SLC35E2	-3.746	0.000201	-0.063834	26	0.017043	yes	THYROID
chr1_1687153_A_G_b38	SLC35E2	-3.734	0.00021	-0.053857	114	0.014423	yes	THYROID
chr1_1769969_CAAAACA_C_b38	SLC35E2	3.701	0.000239	0.050557	114	0.01366	yes	THYROID
chr1_1891444_CG_C_b38	SLC35E2	-3.684	0.000255	-0.054084	119	0.014681	yes	THYROID
chr1_1918989_A_G_b38	SLC35E2	-3.654	0.000285	-0.050255	120	0.013753	yes	THYROID
chr1_1717604_CGCTTTCAGCTAGAGTTTGCTCTCTCTGGTTTTCGGTCTGTGACACACGCAT_C_b38	SLC35E2	3.636	0.000306	0.05056	93	0.013907	yes	THYROID
chr1_1649993_A_G_b38	SLC35E2	-3.635	0.000306	-0.050135	139	0.013791	yes	THYROID
chr1_1683909_A_C_b38	SLC35E2	-3.626	0.000317	-0.052589	118	0.014501	yes	THYROID
chr1_1750528_G_A_b38	SLC35E2	-3.625	0.000318	-0.047087	123	0.01299	yes	THYROID
chr1_1886690_A_C_b38	SLC35E2	3.591	0.000362	0.066496	16	0.018519	yes	THYROID
chr1_1877316_A_T_b38	SLC35E2	3.554	0.000416	0.052871	77	0.014878	yes	THYROID
chr1_1650000_G_A_b38	SLC35E2	3.547	0.000426	0.050544	84	0.014251	yes	THYROID
chr1_1882915_C_T_b38	SLC35E2	3.542	0.000433	0.066254	16	0.018703	yes	THYROID
chr1_1589491_A_G_b38	SLC35E2	-3.538	0.000441	-0.049924	76	0.014113	yes	THYROID
chr1_1734308_T_C_b38	SLC35E2	3.53	0.000453	0.077229	17	0.021875	yes	THYROID
chr1_1746439_GA_G_b38	SLC35E2	3.494	0.000518	0.05421	99	0.015516	yes	THYROID
chr1_1951106_G_A_b38	SLC35E2	-3.493	0.00052	-0.051534	125	0.014755	yes	THYROID
chr1_1951865_G_GT_b38	SLC35E2	-3.493	0.00052	-0.051534	125	0.014755	yes	THYROID
chr1_1688102_G_A_b38	SLC35E2	-3.48	0.000545	-0.056933	38	0.016361	yes	THYROID
chr1_1681928_C_A_b38	SLC35E2	-3.478	0.000548	-0.050767	98	0.014595	yes	THYROID
chr1_1904424_A_AAAATAAATAAAT_b38	SLC35E2	3.475	0.000554	0.045285	103	0.01303	yes	THYROID
chr1_1987049_A_G_b38	SLC35E2	3.475	0.000555	0.051063	108	0.014694	yes	THYROID
chr1_1687643_G_A_b38	SLC35E2	-3.473	0.00056	-0.050129	107	0.014435	yes	THYROID
chr1_1950071_C_T_b38	SLC35E2	-3.466	0.000574	-0.051228	124	0.014781	yes	THYROID
chr1_1952064_G_A_b38	SLC35E2	-3.466	0.000574	-0.051228	124	0.014781	yes	THYROID
chr1_1613769_C_T_b38	SLC35E2	3.459	0.000588	0.052638	63	0.015218	yes	THYROID
chr1_1892085_G_C_b38	SLC35E2	3.45	0.000609	0.064117	15	0.018587	yes	THYROID
chr1_1814815_A_AAAAAAG_b38	SLC35E2	-3.442	0.000626	-0.073311	18	0.021301	yes	THYROID
chr1_1684817_G_C_b38	SLC35E2	-3.441	0.000628	-0.051295	89	0.014907	yes	THYROID
chr1_1719615_CT_C_b38	SLC35E2	3.439	0.000632	0.081631	3	0.023736	yes	THYROID
chr1_1815255_G_T_b38	SLC35E2	3.426	0.000662	0.064698	16	0.018884	yes	THYROID
chr1_1970506_T_A_b38	SLC35E2	-3.416	0.000686	-0.048699	99	0.014254	yes	THYROID
chr1_1025970_C_T_b38	SLC35E2	3.416	0.000687	0.05151	52	0.01508	yes	THYROID
chr1_1877330_T_C_b38	SLC35E2	-3.414	0.000692	-0.049265	106	0.01443	yes	THYROID
chr1_1851414_GA_G_b38	SLC35E2	-3.411	0.000699	-0.052032	75	0.015254	yes	THYROID
chr1_1708951_C_T_b38	SLC35E2	3.406	0.000713	0.047953	99	0.01408	yes	THYROID
chr1_1952823_TA_T_b38	SLC35E2	-3.405	0.000716	-0.050149	124	0.01473	yes	THYROID
chr1_1680214_T_C_b38	SLC35E2	-3.396	0.000738	-0.049049	106	0.014444	yes	THYROID
chr1_1936906_CA_C_b38	SLC35E2	3.392	0.000749	0.059235	19	0.017464	yes	THYROID
chr1_1871210_G_T_b38	SLC35E2	3.392	0.00075	0.064086	16	0.018896	yes	THYROID
chr1_1624323_AT_A_b38	SLC35E2	3.387	0.000763	0.048526	93	0.014328	yes	THYROID
chr1_1680556_A_G_b38	SLC35E2	-3.383	0.000773	-0.048945	106	0.014469	yes	THYROID
chr1_1948515_C_T_b38	SLC35E2	-3.382	0.000776	-0.048127	138	0.01423	yes	THYROID
chr1_2292928_G_T_b38	SLC35E2	-3.378	0.000786	-0.080867	4	0.023937	yes	THYROID
chr1_1775296_C_T_b38	SLC35E2	3.376	0.000793	0.063399	17	0.018781	yes	THYROID
chr1_1986752_A_G_b38	SLC35E2	3.374	0.000799	0.050097	105	0.01485	yes	THYROID
chr1_1687061_C_T_b38	SLC35E2	-3.318	0.000973	-0.047823	105	0.014414	yes	THYROID
chr1_1650383_G_T_b38	SLC35E2	-3.312	0.000993	-0.053647	42	0.016197	yes	THYROID
chr1_2699998_G_C_b38	SLC35E2	-3.309	0.00101	-0.115062	5	0.034777	yes	THYROID
chr1_1646352_A_C_b38	SLC35E2	3.307	0.00101	0.068197	9	0.020621	yes	THYROID
chr1_1948519_T_C_b38	SLC35E2	-3.305	0.00102	-0.047057	138	0.014237	yes	THYROID
chr1_1687159_G_T_b38	SLC35E2	-3.272	0.00114	-0.047306	103	0.014456	yes	THYROID
chr1_1773676_TTGTGTG_T_b38	SLC35E2	3.266	0.00116	0.074973	6	0.022954	yes	THYROID
chr1_1936906_C_CA_b38	SLC35E2	-3.263	0.00118	-0.051968	71	0.015925	yes	THYROID
chr1_1686017_A_AT_b38	SLC35E2	-3.246	0.00125	-0.046644	106	0.014369	yes	THYROID
chr1_1684266_T_C_b38	SLC35E2	-3.239	0.00128	-0.046963	104	0.014499	yes	THYROID
chr1_1638879_C_T_b38	SLC35E2	-3.236	0.00129	-0.052475	37	0.016214	yes	THYROID
chr1_1641275_A_G_b38	SLC35E2	-3.235	0.0013	-0.048954	63	0.015134	yes	THYROID
chr1_1708486_C_A_b38	SLC35E2	3.234	0.0013	0.042448	116	0.013124	yes	THYROID
chr1_1590682_T_C_b38	SLC35E2	-3.231	0.00131	-0.04709	75	0.014573	yes	THYROID
chr1_1857305_G_GGGCT_b38	SLC35E2	3.225	0.00134	0.059961	15	0.018593	yes	THYROID
chr1_1987547_C_CT_b38	SLC35E2	3.221	0.00136	0.049691	109	0.015427	yes	THYROID
chr1_1667424_T_TAAATA_b38	SLC35E2	-3.216	0.00138	-0.045448	96	0.014131	yes	THYROID
chr1_1794187_C_T_b38	SLC35E2	3.213	0.0014	0.057991	17	0.018048	yes	THYROID
chr1_1584321_T_C_b38	SLC35E2	-3.163	0.00166	-0.046823	91	0.014805	yes	THYROID
chr1_1798974_C_T_b38	SLC35E2	3.161	0.00167	0.057372	17	0.018151	yes	THYROID
chr1_1592572_T_C_b38	SLC35E2	-3.157	0.00169	-0.04832	62	0.015308	yes	THYROID
chr1_1641261_C_T_b38	SLC35E2	-3.155	0.0017	-0.054449	28	0.017256	yes	THYROID
chr1_1594614_G_C_b38	SLC35E2	-3.147	0.00174	-0.048081	64	0.015276	yes	THYROID
chr1_1586956_T_C_b38	SLC35E2	-3.144	0.00176	-0.047216	71	0.015017	yes	THYROID
chr1_1902318_T_TA_b38	SLC35E2	-3.125	0.00188	-0.052739	52	0.016878	yes	THYROID
chr1_1681164_G_A_b38	SLC35E2	-3.124	0.00189	-0.045056	106	0.014424	yes	THYROID
chr1_1857246_T_TAA_b38	SLC35E2	3.124	0.00189	0.05801	15	0.018571	yes	THYROID
chr1_1857250_C_G_b38	SLC35E2	3.124	0.00189	0.05801	15	0.018571	yes	THYROID
chr1_1621352_G_A_b38	SLC35E2	3.123	0.00189	0.045919	71	0.014703	yes	THYROID
chr1_1650664_CTTTTT_C_b38	SLC35E2	-3.107	0.00199	-0.052594	30	0.016925	yes	THYROID
chr1_1586987_G_A_b38	SLC35E2	-3.107	0.002	-0.046798	70	0.015062	yes	THYROID
chr1_2297701_C_T_b38	SLC35E2	-3.103	0.00202	-0.074341	3	0.023957	yes	THYROID
chr1_1822247_A_G_b38	SLC35E2	3.1	0.00204	0.055691	18	0.017965	yes	THYROID
chr1_1596144_GAGAC_G_b38	SLC35E2	-3.099	0.00205	-0.047194	64	0.015228	yes	THYROID
chr1_1589057_T_C_b38	SLC35E2	-3.097	0.00206	-0.045469	73	0.014682	yes	THYROID
chr1_1985619_A_G_b38	SLC35E2	3.096	0.00207	0.046046	74	0.014872	yes	THYROID
chr1_1589151_C_T_b38	SLC35E2	-3.091	0.00211	-0.045248	73	0.01464	yes	THYROID
chr1_1686882_T_C_b38	SLC35E2	-3.076	0.00221	-0.043279	126	0.014071	yes	THYROID
chr1_1845840_C_G_b38	SLC35E2	3.073	0.00224	0.05993	9	0.019504	yes	THYROID
chr1_1855939_G_A_b38	SLC35E2	3.069	0.00226	0.057361	15	0.01869	yes	THYROID
chr1_1883278_C_CA_b38	SLC35E2	3.062	0.00232	0.066002	8	0.021556	yes	THYROID
chr1_1968793_T_C_b38	SLC35E2	3.06	0.00233	0.04416	95	0.014432	yes	THYROID
chr1_1684308_G_C_b38	SLC35E2	-3.051	0.0024	-0.044407	102	0.014554	yes	THYROID
chr1_1684619_G_A_b38	SLC35E2	-3.051	0.0024	-0.044407	102	0.014554	yes	THYROID
chr1_2056364_G_A_b38	SLC35E2	-3.047	0.00243	-0.054332	61	0.017829	yes	THYROID
chr1_1736729_G_T_b38	SLC35E2	3.034	0.00254	0.041316	163	0.013617	yes	THYROID
chr1_1967499_G_A_b38	SLC35E2	3.026	0.0026	0.043649	94	0.014423	yes	THYROID
chr1_1898043_T_C_b38	SLC35E2	3.023	0.00263	0.057047	15	0.018871	yes	THYROID
chr1_1624086_G_A_b38	SLC35E2	-3.022	0.00264	-0.04398	95	0.014554	yes	THYROID
chr1_1937046_G_A_b38	SLC35E2	3.02	0.00265	0.053486	22	0.017709	yes	THYROID
chr1_1782906_T_G_b38	SLC35E2	3.012	0.00273	0.053969	19	0.01792	yes	THYROID
chr1_1723766_C_T_b38	SLC35E2	-3.008	0.00276	-0.056637	30	0.01883	yes	THYROID
chr1_1026830_A_G_b38	SLC35E2	3.007	0.00277	0.043839	70	0.014578	yes	THYROID
chr1_1801188_T_C_b38	SLC35E2	3.007	0.00277	0.05321	20	0.017695	yes	THYROID
chr1_1589618_A_T_b38	SLC35E2	-2.996	0.00287	-0.045915	60	0.015327	yes	THYROID
chr1_1740343_C_T_b38	SLC35E2	2.986	0.00296	0.04038	164	0.013521	yes	THYROID
chr1_1650098_A_G_b38	SLC35E2	-2.984	0.00299	-0.101512	5	0.034022	yes	THYROID
chr1_1837340_C_T_b38	SLC35E2	2.982	0.003	0.054253	17	0.018194	yes	THYROID
chr1_1587397_A_AT_b38	SLC35E2	-2.978	0.00304	-0.044556	85	0.014963	yes	THYROID
chr1_1650370_C_CT_b38	SLC35E2	-2.975	0.00307	-0.055614	24	0.018693	yes	THYROID
chr1_1627515_C_T_b38	SLC35E2	2.974	0.00308	0.042387	114	0.014254	yes	THYROID
chr1_1846651_T_G_b38	SLC35E2	2.952	0.0033	0.053636	17	0.01817	yes	THYROID
chr1_1039411_T_TGGG_b38	SLC35E2	2.943	0.0034	0.047602	38	0.016173	yes	THYROID
chr1_1855245_G_A_b38	SLC35E2	2.942	0.00341	0.055109	15	0.018732	yes	THYROID
chr1_1620609_G_A_b38	SLC35E2	2.94	0.00344	0.043064	70	0.014649	yes	THYROID
chr1_2312125_G_A_b38	SLC35E2	-2.939	0.00345	-0.040419	151	0.013755	yes	THYROID
chr1_1775996_G_A_b38	SLC35E2	2.91	0.00378	0.052309	19	0.017977	yes	THYROID
chr1_1600379_C_T_b38	SLC35E2	2.908	0.0038	0.042603	66	0.014651	yes	THYROID
chr1_2293719_T_A_b38	SLC35E2	-2.905	0.00383	-0.0569	11	0.019586	yes	THYROID
chr1_1738295_G_T_b38	SLC35E2	2.883	0.00411	0.039111	164	0.013568	yes	THYROID
chr1_1981144_T_G_b38	SLC35E2	2.878	0.00417	0.045971	39	0.015971	yes	THYROID
chr1_1888382_A_AG_b38	SLC35E2	2.878	0.00418	0.061041	10	0.021213	yes	THYROID
chr1_1810086_A_G_b38	SLC35E2	2.848	0.00458	0.049493	25	0.017376	yes	THYROID
chr1_1963538_T_C_b38	SLC35E2	2.843	0.00465	0.04086	93	0.014371	yes	THYROID
chr1_1792696_C_CA_b38	SLC35E2	2.842	0.00467	0.042649	63	0.015007	yes	THYROID
chr1_1154630_C_A_b38	SLC35E2	2.841	0.00468	0.064676	13	0.022765	yes	THYROID
chr1_1845824_TACACACACACACACACACACACACACACAC_T_b38	SLC35E2	2.84	0.00469	0.045622	39	0.016063	yes	THYROID
chr1_1735176_C_T_b38	SLC35E2	2.838	0.00472	0.03843	164	0.01354	yes	THYROID
chr1_1731963_A_C_b38	SLC35E2	2.836	0.00475	0.038337	165	0.013516	yes	THYROID
chr1_1978262_C_T_b38	SLC35E2	2.826	0.00491	0.041706	59	0.014759	yes	THYROID
chr1_1978294_G_T_b38	SLC35E2	2.826	0.00491	0.041706	59	0.014759	yes	THYROID
chr1_1912983_T_C_b38	SLC35E2	2.824	0.00494	0.043298	47	0.015335	yes	THYROID
chr1_1791389_G_A_b38	SLC35E2	2.823	0.00495	0.048376	26	0.017139	yes	THYROID
chr1_1606384_A_G_b38	SLC35E2	2.814	0.00509	0.040808	73	0.014503	yes	THYROID
chr1_1625951_G_A_b38	SLC35E2	-2.813	0.00511	-0.041464	86	0.014742	yes	THYROID
chr1_1609070_G_A_b38	SLC35E2	-2.811	0.00513	-0.042499	69	0.01512	yes	THYROID
chr1_1963533_C_CA_b38	SLC35E2	2.808	0.00518	0.040001	98	0.014245	yes	THYROID
chr1_2290738_G_A_b38	SLC35E2	-2.808	0.00518	-0.054551	11	0.019429	yes	THYROID
chr1_1978114_T_A_b38	SLC35E2	2.807	0.00519	0.041638	58	0.014832	yes	THYROID
chr1_1657085_C_CTAA_b38	SLC35E2	-2.802	0.00527	-0.048065	37	0.017152	yes	THYROID
chr1_1622295_G_C_b38	SLC35E2	2.799	0.00533	0.040955	70	0.014634	yes	THYROID
chr1_1586679_C_T_b38	SLC35E2	-2.798	0.00534	-0.041007	92	0.014655	yes	THYROID
chr1_981935_G_A_b38	SLC35E2	2.797	0.00535	0.047992	23	0.017157	yes	THYROID
chr1_1982826_T_C_b38	SLC35E2	2.797	0.00536	0.041308	59	0.01477	yes	THYROID
chr1_1864350_C_T_b38	SLC35E2	2.795	0.00538	0.044794	38	0.016024	yes	THYROID
chr1_1595028_C_CAG_b38	SLC35E2	2.795	0.00539	0.045516	44	0.016286	yes	THYROID
chr1_1984586_G_A_b38	SLC35E2	2.792	0.00543	0.041374	58	0.014818	yes	THYROID
chr1_1898712_C_T_b38	SLC35E2	2.791	0.00546	0.053167	14	0.019053	yes	THYROID
chr1_1899188_T_A_b38	SLC35E2	2.791	0.00546	0.053167	14	0.019053	yes	THYROID
chr1_1608603_C_A_b38	SLC35E2	-2.788	0.0055	-0.042305	68	0.015172	yes	THYROID
chr1_1734903_A_G_b38	SLC35E2	2.785	0.00556	0.037602	165	0.013502	yes	THYROID
chr1_1907199_A_G_b38	SLC35E2	2.784	0.00557	0.044949	35	0.016145	yes	THYROID
chr1_1924011_A_G_b38	SLC35E2	-2.78	0.00564	-0.054849	11	0.01973	yes	THYROID
chr1_1706067_ACT_A_b38	SLC35E2	2.775	0.00573	0.03933	159	0.014175	yes	THYROID
chr1_2332063_T_C_b38	SLC35E2	-2.774	0.00574	-0.06	16	0.02163	yes	THYROID
chr1_1605347_C_T_b38	SLC35E2	-2.765	0.0059	-0.04204	66	0.015205	yes	THYROID
chr1_1976855_C_CTT_b38	SLC35E2	2.764	0.00591	0.046002	31	0.016641	yes	THYROID
chr1_1976870_C_CAG_b38	SLC35E2	2.753	0.00612	0.040452	58	0.014694	yes	THYROID
chr1_1836856_CT_C_b38	SLC35E2	2.752	0.00613	0.048712	29	0.017698	yes	THYROID
chr1_1951642_C_T_b38	SLC35E2	2.752	0.00613	0.044054	39	0.016006	yes	THYROID
chr1_1732392_C_T_b38	SLC35E2	2.75	0.00618	0.037266	165	0.013553	yes	THYROID
chr1_1735980_A_C_b38	SLC35E2	2.75	0.00618	0.037266	165	0.013553	yes	THYROID
chr1_1628409_C_A_b38	SLC35E2	-2.746	0.00625	-0.040972	71	0.014922	yes	THYROID
chr1_1976990_T_C_b38	SLC35E2	2.743	0.0063	0.040605	59	0.014802	yes	THYROID
chr1_1978797_T_C_b38	SLC35E2	2.742	0.00632	0.040501	59	0.014769	yes	THYROID
chr1_1924183_GC_G_b38	SLC35E2	-2.742	0.00632	-0.041811	56	0.015247	yes	THYROID
chr1_1915143_A_G_b38	SLC35E2	-2.741	0.00634	-0.052001	12	0.01897	yes	THYROID
chr1_1986010_T_G_b38	SLC35E2	2.738	0.00641	0.040563	58	0.014817	yes	THYROID
chr1_982112_C_T_b38	SLC35E2	2.738	0.00641	0.048198	21	0.017606	yes	THYROID
chr1_1978404_C_T_b38	SLC35E2	2.737	0.00641	0.040619	58	0.014839	yes	THYROID
chr1_1978415_G_A_b38	SLC35E2	2.737	0.00641	0.040619	58	0.014839	yes	THYROID
chr1_2246853_T_TG_b38	SLC35E2	2.731	0.00654	0.03973	77	0.014548	yes	THYROID
chr1_1737504_A_C_b38	SLC35E2	2.728	0.0066	0.036775	169	0.013483	yes	THYROID
chr1_1986211_T_C_b38	SLC35E2	2.725	0.00665	0.040586	57	0.014893	yes	THYROID
chr1_1909237_G_T_b38	SLC35E2	2.722	0.00672	0.04252	41	0.015622	yes	THYROID
chr1_1586425_A_G_b38	SLC35E2	-2.721	0.00674	-0.039586	94	0.014549	yes	THYROID
chr1_1586626_C_T_b38	SLC35E2	-2.72	0.00675	-0.039875	92	0.01466	yes	THYROID
chr1_1924207_T_C_b38	SLC35E2	-2.718	0.0068	-0.040739	61	0.014989	yes	THYROID
chr1_1740703_C_T_b38	SLC35E2	2.715	0.00686	0.036881	165	0.013585	yes	THYROID
chr1_1945913_T_C_b38	SLC35E2	-2.711	0.00693	-0.048967	14	0.018061	yes	THYROID
chr1_1984595_C_T_b38	SLC35E2	2.709	0.00697	0.040273	58	0.014864	yes	THYROID
chr1_1922882_A_G_b38	SLC35E2	-2.707	0.00703	-0.050876	13	0.018796	yes	THYROID
chr1_1983166_A_T_b38	SLC35E2	2.703	0.00709	0.040277	57	0.014898	yes	THYROID
chr1_1983956_TGG_T_b38	SLC35E2	2.703	0.00709	0.040277	57	0.014898	yes	THYROID
chr1_1984859_C_T_b38	SLC35E2	2.703	0.00709	0.040277	57	0.014898	yes	THYROID
chr1_1985148_G_T_b38	SLC35E2	2.703	0.00709	0.040277	57	0.014898	yes	THYROID
chr1_1628814_C_T_b38	SLC35E2	-2.702	0.00713	-0.040415	71	0.014958	yes	THYROID
chr1_982890_C_T_b38	SLC35E2	2.7	0.00717	0.047532	21	0.017605	yes	THYROID
chr1_983237_G_A_b38	SLC35E2	2.7	0.00717	0.047532	21	0.017605	yes	THYROID
chr1_1938771_G_A_b38	SLC35E2	-2.699	0.00719	-0.050049	13	0.018543	yes	THYROID
chr1_1876492_C_CGA_b38	SLC35E2	2.698	0.0072	0.053675	6	0.019892	yes	THYROID
chr1_1938493_C_CAT_b38	SLC35E2	-2.698	0.00721	-0.050158	13	0.018592	yes	THYROID
chr1_1939978_T_C_b38	SLC35E2	-2.698	0.00721	-0.050158	13	0.018592	yes	THYROID
chr1_1951498_C_T_b38	SLC35E2	2.697	0.00723	0.04317	39	0.016007	yes	THYROID
chr1_1734174_A_G_b38	SLC35E2	2.695	0.00726	0.036451	165	0.013523	yes	THYROID
chr1_1976646_A_G_b38	SLC35E2	2.695	0.00727	0.0402	57	0.014915	yes	THYROID
chr1_1587352_A_G_b38	SLC35E2	-2.692	0.00735	-0.039337	94	0.014614	yes	THYROID
chr1_1976473_C_T_b38	SLC35E2	2.689	0.00741	0.039964	58	0.014864	yes	THYROID
chr1_1976573_T_C_b38	SLC35E2	2.689	0.00741	0.039964	58	0.014864	yes	THYROID
chr1_1976661_G_T_b38	SLC35E2	2.689	0.00741	0.039964	58	0.014864	yes	THYROID
chr1_1976946_C_T_b38	SLC35E2	2.689	0.00741	0.039964	58	0.014864	yes	THYROID
chr1_1977264_C_G_b38	SLC35E2	2.689	0.00741	0.039964	58	0.014864	yes	THYROID
chr1_1736836_A_G_b38	SLC35E2	2.687	0.00744	0.03682	154	0.013701	yes	THYROID
chr1_2299360_T_C_b38	SLC35E2	-2.687	0.00744	-0.037005	104	0.01377	yes	THYROID
chr1_1931519_A_G_b38	SLC35E2	-2.687	0.00745	-0.049673	15	0.018486	yes	THYROID
chr1_1950071_C_A_b38	SLC35E2	2.682	0.00756	0.042828	41	0.015969	yes	THYROID
chr1_1882449_A_AAG_b38	SLC35E2	2.68	0.0076	0.064625	8	0.024112	yes	THYROID
chr1_1587413_C_T_b38	SLC35E2	-2.679	0.00763	-0.039366	91	0.014696	yes	THYROID
chr1_1984601_T_C_b38	SLC35E2	2.678	0.00764	0.039736	58	0.014836	yes	THYROID
chr1_2324194_G_A_b38	SLC35E2	-2.677	0.00767	-0.077046	5	0.02878	yes	THYROID
chr1_1827615_G_A_b38	SLC35E2	2.676	0.0077	0.04386	32	0.016392	yes	THYROID
chr1_1978647_G_T_b38	SLC35E2	2.673	0.00776	0.039513	59	0.014781	yes	THYROID
chr1_799080_TG_T_b38	SLC35E2	-2.66	0.00807	-0.045221	34	0.017001	yes	THYROID
chr1_2326256_G_A_b38	SLC35E2	-2.659	0.00809	-0.05496	19	0.02067	yes	THYROID
chr1_1610924_C_T_b38	SLC35E2	-2.659	0.0081	-0.040233	68	0.015134	yes	THYROID
chr1_1587547_C_T_b38	SLC35E2	-2.656	0.00815	-0.040252	80	0.015154	yes	THYROID
chr1_1977765_A_G_b38	SLC35E2	2.653	0.00822	0.039398	58	0.014848	yes	THYROID
chr1_1980953_G_A_b38	SLC35E2	2.653	0.00822	0.039398	58	0.014848	yes	THYROID
chr1_1848356_GC_G_b38	SLC35E2	2.653	0.00823	0.049477	19	0.01865	yes	THYROID
chr1_1981319_G_C_b38	SLC35E2	2.648	0.00834	0.039454	57	0.014897	yes	THYROID
chr1_1986033_G_A_b38	SLC35E2	2.648	0.00834	0.039454	57	0.014897	yes	THYROID
chr1_1986176_A_T_b38	SLC35E2	2.648	0.00834	0.039454	57	0.014897	yes	THYROID
chr1_1986390_T_G_b38	SLC35E2	2.648	0.00834	0.039454	57	0.014897	yes	THYROID
chr1_1986469_A_C_b38	SLC35E2	2.648	0.00834	0.039454	57	0.014897	yes	THYROID
chr1_1987096_A_T_b38	SLC35E2	2.648	0.00834	0.039454	57	0.014897	yes	THYROID
chr1_1987156_G_A_b38	SLC35E2	2.648	0.00834	0.039454	57	0.014897	yes	THYROID
chr1_1952590_A_AAAAG_b38	SLC35E2	2.648	0.00835	0.041385	47	0.015629	yes	THYROID
chr1_1624720_G_A_b38	SLC35E2	-2.646	0.00839	-0.039908	71	0.01508	yes	THYROID
chr1_1978055_C_T_b38	SLC35E2	2.638	0.00861	0.039001	59	0.014786	yes	THYROID
chr1_1976600_C_T_b38	SLC35E2	2.636	0.00866	0.039207	58	0.014876	yes	THYROID
chr1_1972273_C_A_b38	SLC35E2	2.635	0.00866	0.039732	54	0.015076	yes	THYROID
chr1_1722599_G_A_b38	SLC35E2	2.632	0.00875	0.044266	62	0.01682	yes	THYROID
chr1_1945799_T_G_b38	SLC35E2	-2.628	0.00886	-0.049645	13	0.018892	yes	THYROID
chr1_1629572_TG_T_b38	SLC35E2	-2.628	0.00886	-0.039079	74	0.014873	yes	THYROID
chr1_1616048_C_T_b38	SLC35E2	-2.627	0.00889	-0.039352	73	0.014982	yes	THYROID
chr1_2261509_T_C_b38	SLC35E2	2.624	0.00895	0.038144	78	0.014536	yes	THYROID
chr1_1814815_A_G_b38	SLC35E2	-2.623	0.00899	-0.089803	3	0.03424	yes	THYROID
chr1_1978429_G_A_b38	SLC35E2	2.621	0.00904	0.040062	44	0.015288	yes	THYROID
chr1_981282_A_C_b38	SLC35E2	2.62	0.00907	0.046192	21	0.017633	yes	THYROID
chr1_2298039_C_T_b38	SLC35E2	-2.617	0.00914	-0.050727	10	0.019384	yes	THYROID
chr1_1943706_C_T_b38	SLC35E2	-2.611	0.00929	-0.048668	13	0.018637	yes	THYROID
chr1_1943828_A_G_b38	SLC35E2	-2.611	0.00929	-0.048668	13	0.018637	yes	THYROID
chr1_2271718_T_TG_b38	SLC35E2	2.605	0.00945	0.039048	70	0.014987	yes	THYROID
chr1_2262484_G_A_b38	SLC35E2	2.604	0.00947	0.037896	76	0.01455	yes	THYROID
chr1_2247560_C_T_b38	SLC35E2	2.603	0.0095	0.037811	78	0.014524	yes	THYROID
chr1_2257757_A_T_b38	SLC35E2	2.603	0.0095	0.037811	78	0.014524	yes	THYROID
chr1_2268965_C_T_b38	SLC35E2	2.603	0.0095	0.037811	78	0.014524	yes	THYROID
chr1_1808642_TTTTG_T_b38	SLC35E2	2.603	0.00952	0.042458	36	0.016312	yes	THYROID
chr1_2246288_T_C_b38	SLC35E2	2.595	0.00973	0.037648	78	0.014506	yes	THYROID
chr1_2255646_T_G_b38	SLC35E2	2.595	0.00973	0.037648	78	0.014506	yes	THYROID
chr1_1783572_C_A_b38	SLC35E2	2.594	0.00977	0.042589	32	0.01642	yes	THYROID
chr1_1837455_C_T_b38	SLC35E2	2.594	0.00977	0.042589	32	0.01642	yes	THYROID
chr1_1851762_G_A_b38	SLC35E2	2.594	0.00977	0.042589	32	0.01642	yes	THYROID
chr1_1852145_G_A_b38	SLC35E2	2.594	0.00977	0.042589	32	0.01642	yes	THYROID
chr1_1869595_G_A_b38	SLC35E2	2.594	0.00978	0.04279	32	0.016499	yes	THYROID
chr1_1903242_C_T_b38	SLC35E2	2.588	0.00993	0.049821	14	0.01925	yes	THYROID
chr1_1906935_C_T_b38	SLC35E2	2.588	0.00993	0.049821	14	0.01925	yes	THYROID
chr1_1659940_A_C_b38	SLC35E2	-5.565	4.27e-08	-0.105261	11	0.018916	no	THYROID
chr1_1849781_T_C_b38	SLC35E2	-4.867	1.52e-06	-0.079408	32	0.016317	no	THYROID
chr1_1944182_G_C_b38	SLC35E2	-4.414	1.24e-05	-0.062884	128	0.014246	no	THYROID
chr1_1798925_C_CT_b38	SLC35E2	-4.354	1.62e-05	-0.06382	58	0.014657	no	THYROID
chr1_1698022_G_A_b38	SLC35E2	-4.312	1.95e-05	-0.167026	17	0.038735	no	THYROID
chr1_1946058_T_C_b38	SLC35E2	-4.191	3.29e-05	-0.059974	130	0.014312	no	THYROID
chr1_1697272_G_A_b38	SLC35E2	4.168	3.62e-05	0.090596	33	0.021735	no	THYROID
chr1_1648736_G_A_b38	SLC35E2	4.145	3.99e-05	0.058814	126	0.01419	no	THYROID
chr1_1946013_C_T_b38	SLC35E2	-4.138	4.11e-05	-0.059404	129	0.014356	no	THYROID
chr1_1702383_T_C_b38	SLC35E2	-4.114	4.54e-05	-0.068665	28	0.01669	no	THYROID
chr1_1946632_C_T_b38	SLC35E2	-4.111	4.6e-05	-0.058918	130	0.014332	no	THYROID
chr1_1947189_C_T_b38	SLC35E2	-4.111	4.6e-05	-0.058918	130	0.014332	no	THYROID
chr1_1944074_T_C_b38	SLC35E2	-4.11	4.62e-05	-0.058846	129	0.014317	no	THYROID
chr1_1944091_G_C_b38	SLC35E2	-4.11	4.62e-05	-0.058846	129	0.014317	no	THYROID
chr1_1945121_T_C_b38	SLC35E2	-4.108	4.66e-05	-0.058788	131	0.014311	no	THYROID
chr1_1944419_C_G_b38	SLC35E2	-4.104	4.74e-05	-0.058529	132	0.014262	no	THYROID
chr1_1947645_C_T_b38	SLC35E2	-4.039	6.21e-05	-0.058585	124	0.014505	no	THYROID
chr1_1944216_C_T_b38	SLC35E2	-4.033	6.37e-05	-0.057954	126	0.014371	no	THYROID
chr1_2334639_T_C_b38	SLC35E2	-3.973	8.15e-05	-0.055126	151	0.013877	no	THYROID
chr1_1453643_A_AT_b38	SLC35E2	-3.881	0.000118	-0.073857	14	0.01903	no	THYROID
chr1_1686321_CTTT_C_b38	SLC35E2	-3.828	0.000145	-0.061132	43	0.015968	no	THYROID
chr1_1661562_G_C_b38	SLC35E2	3.786	0.000172	0.048629	137	0.012846	no	THYROID
chr1_1039514_C_T_b38	SLC35E2	3.76	0.00019	0.083233	20	0.022134	no	THYROID
chr1_1042400_C_T_b38	SLC35E2	3.722	0.00022	0.082849	20	0.022257	no	THYROID
chr1_1047064_A_G_b38	SLC35E2	3.712	0.000228	0.085025	16	0.022902	no	THYROID
chr1_1891450_G_C_b38	SLC35E2	-3.677	0.000261	-0.054038	118	0.014695	no	THYROID
chr1_1904424_A_AAAATAAAT_b38	SLC35E2	-3.627	0.000316	-0.047249	136	0.013026	no	THYROID
chr1_1835922_G_GAAA_b38	SLC35E2	-3.62	0.000325	-0.127571	8	0.035244	no	THYROID
chr1_1650688_T_A_b38	SLC35E2	-3.599	0.000351	-0.058234	39	0.016181	no	THYROID
chr1_2676824_ACGGCC_A_b38	SLC35E2	-3.579	0.000378	-0.143653	6	0.040133	no	THYROID
chr1_1688409_C_G_b38	SLC35E2	-3.574	0.000385	-0.052619	91	0.014723	no	THYROID
chr1_1636278_G_T_b38	SLC35E2	3.572	0.000389	0.051728	111	0.014483	no	THYROID
chr1_1866635_T_TAAA_b38	SLC35E2	-3.565	0.000398	-0.054579	79	0.015308	no	THYROID
chr1_1881065_G_A_b38	SLC35E2	3.551	0.00042	0.065368	17	0.018409	no	THYROID
chr1_1881798_C_T_b38	SLC35E2	3.551	0.00042	0.065368	17	0.018409	no	THYROID
chr1_1913504_CT_C_b38	SLC35E2	-3.474	0.000557	-0.05438	94	0.015652	no	THYROID
chr1_1022518_G_T_b38	SLC35E2	3.426	0.000662	0.049766	67	0.014525	no	THYROID
chr1_940296_GCC_G_b38	SLC35E2	-3.421	0.000675	-0.04886	93	0.014284	no	THYROID
chr1_1042190_G_A_b38	SLC35E2	3.394	0.000744	0.076448	23	0.022526	no	THYROID
chr1_1051063_C_T_b38	SLC35E2	3.391	0.000752	0.074624	22	0.022008	no	THYROID
chr1_1045707_A_G_b38	SLC35E2	3.382	0.000776	0.080501	10	0.023804	no	THYROID
chr1_1051820_C_T_b38	SLC35E2	3.372	0.000803	0.073488	23	0.021793	no	THYROID
chr1_1955080_C_CGGCTCACACCGGAAGTGAGGCTCACACCGGAAGTGA_b38	SLC35E2	-3.363	0.00083	-0.048911	112	0.014544	no	THYROID
chr1_1750589_G_A_b38	SLC35E2	-3.36	0.000839	-0.072335	21	0.021529	no	THYROID
chr1_1047561_T_C_b38	SLC35E2	3.347	0.000877	0.075291	22	0.022493	no	THYROID
chr1_1024462_C_T_b38	SLC35E2	3.299	0.00104	0.050173	53	0.015208	no	THYROID
chr1_1773717_T_A_b38	SLC35E2	-3.297	0.00104	-0.047181	79	0.014309	no	THYROID
chr1_1023525_A_G_b38	SLC35E2	3.296	0.00105	0.048547	67	0.01473	no	THYROID
chr1_1773713_T_A_b38	SLC35E2	-3.286	0.00109	-0.049003	73	0.014911	no	THYROID
chr1_1053123_A_T_b38	SLC35E2	3.285	0.00109	0.071556	23	0.021785	no	THYROID
chr1_1038078_C_T_b38	SLC35E2	3.272	0.00114	0.076461	8	0.02337	no	THYROID
chr1_1023573_A_G_b38	SLC35E2	3.271	0.00115	0.048201	69	0.014737	no	THYROID
chr1_1025561_G_C_b38	SLC35E2	3.265	0.00117	0.049585	50	0.015185	no	THYROID
chr1_1023351_A_G_b38	SLC35E2	3.26	0.00119	0.047901	67	0.014696	no	THYROID
chr1_1693256_GT_G_b38	SLC35E2	-3.259	0.00119	-0.109031	8	0.033455	no	THYROID
chr1_1041950_T_C_b38	SLC35E2	3.259	0.00119	0.076213	8	0.023386	no	THYROID
chr1_1047614_T_C_b38	SLC35E2	3.254	0.00121	0.074665	15	0.022946	no	THYROID
chr1_1629332_G_T_b38	SLC35E2	3.24	0.00128	0.050139	65	0.015477	no	THYROID
chr1_1022868_A_G_b38	SLC35E2	3.233	0.0013	0.047162	71	0.014587	no	THYROID
chr1_1717507_T_C_b38	SLC35E2	3.228	0.00133	0.075735	13	0.02346	no	THYROID
chr1_1036754_C_T_b38	SLC35E2	3.213	0.0014	0.070973	10	0.022089	no	THYROID
chr1_1982253_C_T_b38	SLC35E2	3.178	0.00158	0.089393	6	0.028132	no	THYROID
chr1_2325287_C_CCT_b38	SLC35E2	-3.149	0.00173	-0.047086	70	0.014951	no	THYROID
chr1_946653_G_A_b38	SLC35E2	3.142	0.00178	0.05375	28	0.017106	no	THYROID
chr1_1969015_A_G_b38	SLC35E2	3.092	0.0021	0.046569	127	0.01506	no	THYROID
chr1_1880594_A_T_b38	SLC35E2	3.091	0.00211	0.054492	23	0.017632	no	THYROID
chr1_1035987_T_C_b38	SLC35E2	3.087	0.00214	0.076493	6	0.024782	no	THYROID
chr1_1026084_G_T_b38	SLC35E2	3.077	0.0022	0.046742	51	0.015191	no	THYROID
chr1_1976566_T_C_b38	SLC35E2	3.073	0.00224	0.042912	118	0.013966	no	THYROID
chr1_1641819_C_T_b38	SLC35E2	3.055	0.00237	0.057873	22	0.018941	no	THYROID
chr1_1027869_C_T_b38	SLC35E2	3.039	0.0025	0.068435	11	0.022522	no	THYROID
chr1_1029365_A_ATCTATGCAGGCAGGTGGGGGGATCAGTG_b38	SLC35E2	3.029	0.00258	0.048011	38	0.01585	no	THYROID
chr1_1032846_C_A_b38	SLC35E2	3.009	0.00275	0.045843	51	0.015234	no	THYROID
chr1_1046551_A_G_b38	SLC35E2	3	0.00284	0.065334	19	0.021779	no	THYROID
chr1_1650664_CT_C_b38	SLC35E2	2.993	0.00289	0.050173	47	0.016761	no	THYROID
chr1_1039282_G_T_b38	SLC35E2	2.988	0.00295	0.07446	6	0.024921	no	THYROID
chr1_1985451_C_T_b38	SLC35E2	2.988	0.00295	0.044596	82	0.014926	no	THYROID
chr1_1442855_A_AATAAACCAAGTCAATTTTCTATAGTGACGGTG_b38	SLC35E2	2.985	0.00298	0.097368	11	0.032623	no	THYROID
chr1_1630798_C_T_b38	SLC35E2	2.969	0.00313	0.045364	63	0.01528	no	THYROID
chr1_1045080_G_A_b38	SLC35E2	2.968	0.00314	0.073794	6	0.024866	no	THYROID
chr1_1845824_TACACAC_T_b38	SLC35E2	2.95	0.00333	0.052649	21	0.017847	no	THYROID
chr1_1018652_C_G_b38	SLC35E2	2.93	0.00355	0.043682	57	0.014909	no	THYROID
chr1_1160003_G_A_b38	SLC35E2	2.913	0.00374	0.048132	37	0.016526	no	THYROID
chr1_1837255_A_AT_b38	SLC35E2	2.908	0.0038	0.054051	17	0.018588	no	THYROID
chr1_1947648_G_A_b38	SLC35E2	2.901	0.00388	0.047659	31	0.016429	no	THYROID
chr1_1018754_G_A_b38	SLC35E2	2.896	0.00394	0.043339	56	0.014964	no	THYROID
chr1_1738597_C_A_b38	SLC35E2	2.893	0.00398	0.046181	79	0.015962	no	THYROID
chr1_2301093_G_A_b38	SLC35E2	-2.882	0.00411	-0.059798	6	0.020745	no	THYROID
chr1_1035844_A_G_b38	SLC35E2	2.881	0.00414	0.06762	8	0.023473	no	THYROID
chr1_1773719_T_A_b38	SLC35E2	-2.865	0.00435	-0.041373	74	0.014442	no	THYROID
chr1_1047133_T_C_b38	SLC35E2	2.864	0.00436	0.072139	5	0.02519	no	THYROID
chr1_1034279_G_A_b38	SLC35E2	2.856	0.00447	0.044363	43	0.015535	no	THYROID
chr1_1985090_C_T_b38	SLC35E2	2.852	0.00452	0.04271	81	0.014976	no	THYROID
chr1_1727506_T_C_b38	SLC35E2	2.839	0.00471	0.049493	56	0.017432	no	THYROID
chr1_1595306_CAG_C_b38	SLC35E2	-2.838	0.00472	-0.043325	125	0.015264	no	THYROID
chr1_1865951_T_A_b38	SLC35E2	2.83	0.00484	0.046671	31	0.016492	no	THYROID
chr1_1059011_G_T_b38	SLC35E2	2.829	0.00486	0.055061	27	0.019464	no	THYROID
chr1_1840043_T_TA_b38	SLC35E2	2.825	0.00492	0.052655	12	0.018641	no	THYROID
chr1_1315752_GAGCGAGGGAGGTGGGGGCGGGGAGGGAGGGAGGGAGGCGGGC_G_b38	SLC35E2	-2.819	0.00501	-0.049146	27	0.017433	no	THYROID
chr1_1924264_CCG_C_b38	SLC35E2	-2.816	0.00505	-0.037851	141	0.013441	no	THYROID
chr1_1570655_G_A_b38	SLC35E2	2.803	0.00525	0.054214	18	0.019339	no	THYROID
chr1_1020217_G_T_b38	SLC35E2	2.8	0.00531	0.04187	57	0.014954	no	THYROID
chr1_1977879_G_A_b38	SLC35E2	2.799	0.00533	0.041434	58	0.014804	no	THYROID
chr1_1600320_C_G_b38	SLC35E2	2.796	0.00536	0.041328	63	0.014779	no	THYROID
chr1_1037956_A_G_b38	SLC35E2	2.794	0.00541	0.066383	7	0.02376	no	THYROID
chr1_1037997_G_A_b38	SLC35E2	2.794	0.00541	0.066383	7	0.02376	no	THYROID
chr1_1038800_G_T_b38	SLC35E2	2.794	0.00541	0.066383	7	0.02376	no	THYROID
chr1_1038819_C_T_b38	SLC35E2	2.794	0.00541	0.066383	7	0.02376	no	THYROID
chr1_1038845_A_G_b38	SLC35E2	2.794	0.00541	0.066383	7	0.02376	no	THYROID
chr1_1038916_A_G_b38	SLC35E2	2.794	0.00541	0.066383	7	0.02376	no	THYROID
chr1_1038975_G_A_b38	SLC35E2	2.794	0.00541	0.066383	7	0.02376	no	THYROID
chr1_1038976_T_C_b38	SLC35E2	2.794	0.00541	0.066383	7	0.02376	no	THYROID
chr1_1039114_G_T_b38	SLC35E2	2.794	0.00541	0.066383	7	0.02376	no	THYROID
chr1_1039190_T_G_b38	SLC35E2	2.794	0.00541	0.066383	7	0.02376	no	THYROID
chr1_1039753_T_A_b38	SLC35E2	2.794	0.00541	0.066383	7	0.02376	no	THYROID
chr1_1040322_A_G_b38	SLC35E2	2.794	0.00541	0.066383	7	0.02376	no	THYROID
chr1_1612562_T_TC_b38	SLC35E2	2.794	0.00541	0.040144	72	0.01437	no	THYROID
chr1_1773721_T_A_b38	SLC35E2	-2.792	0.00544	-0.040455	73	0.014491	no	THYROID
chr1_1924269_C_T_b38	SLC35E2	-2.784	0.00556	-0.037251	141	0.013378	no	THYROID
chr1_1021740_G_C_b38	SLC35E2	2.784	0.00558	0.041569	56	0.014933	no	THYROID
chr1_1849992_T_TG_b38	SLC35E2	2.775	0.00572	0.05035	18	0.018142	no	THYROID
chr1_1983048_A_G_b38	SLC35E2	2.772	0.00577	0.041725	83	0.015051	no	THYROID
chr1_1978562_C_G_b38	SLC35E2	2.762	0.00596	0.040601	60	0.014702	no	THYROID
chr1_1978573_T_C_b38	SLC35E2	2.762	0.00596	0.040601	60	0.014702	no	THYROID
chr1_1948938_C_T_b38	SLC35E2	-2.759	0.00602	-0.035229	119	0.012771	no	THYROID
chr1_1778596_C_T_b38	SLC35E2	-2.75	0.00617	-0.04283	52	0.015572	no	THYROID
chr1_1971864_C_T_b38	SLC35E2	2.75	0.00618	0.03884	105	0.014125	no	THYROID
chr1_2677434_G_T_b38	SLC35E2	2.745	0.00626	0.06044	6	0.022015	no	THYROID
chr1_1018298_T_C_b38	SLC35E2	2.742	0.00633	0.061733	7	0.022516	no	THYROID
chr1_1773725_T_A_b38	SLC35E2	-2.734	0.00648	-0.040059	71	0.014654	no	THYROID
chr1_2295727_A_G_b38	SLC35E2	-2.732	0.00651	-0.040011	91	0.014645	no	THYROID
chr1_1057472_AAG_A_b38	SLC35E2	2.719	0.00677	0.05165	28	0.018993	no	THYROID
chr1_1606099_G_GGTCAGGCGAGGGGTC_b38	SLC35E2	2.706	0.00703	0.040789	60	0.015071	no	THYROID
chr1_1662855_T_C_b38	SLC35E2	-2.704	0.00708	-0.062178	25	0.022995	no	THYROID
chr1_1773676_TTG_T_b38	SLC35E2	-2.698	0.00721	-0.064816	6	0.024022	no	THYROID
chr1_933548_A_AG_b38	SLC35E2	-2.692	0.00734	-0.038788	93	0.014409	no	THYROID
chr1_1056344_C_T_b38	SLC35E2	2.687	0.00745	0.05077	29	0.018894	no	THYROID
chr1_1029468_A_T_b38	SLC35E2	2.681	0.00758	0.061153	10	0.022807	no	THYROID
chr1_2285626_G_A_b38	SLC35E2	2.681	0.00758	0.046949	25	0.017511	no	THYROID
chr1_1609058_G_A_b38	SLC35E2	2.672	0.00779	0.039059	67	0.014619	no	THYROID
chr1_1842226_T_C_b38	SLC35E2	2.67	0.00783	0.043457	37	0.016276	no	THYROID
chr1_1774721_A_G_b38	SLC35E2	-2.665	0.00796	-0.043159	40	0.016197	no	THYROID
chr1_1017844_C_T_b38	SLC35E2	2.655	0.00819	0.056687	13	0.021352	no	THYROID
chr1_1052290_T_G_b38	SLC35E2	2.652	0.00826	0.064512	7	0.024326	no	THYROID
chr1_1607931_G_A_b38	SLC35E2	2.649	0.00832	0.038935	66	0.014696	no	THYROID
chr1_1089890_C_T_b38	SLC35E2	-2.644	0.00846	-0.068476	4	0.025902	no	THYROID
chr1_1687734_CAA_C_b38	SLC35E2	-2.639	0.00857	-0.040562	73	0.015368	no	THYROID
chr1_1773723_T_A_b38	SLC35E2	-2.637	0.00863	-0.038641	71	0.014654	no	THYROID
chr1_1978006_A_G_b38	SLC35E2	2.636	0.00865	0.039071	58	0.014823	no	THYROID
chr1_1606094_G_GAGGGGTC_b38	SLC35E2	2.628	0.00885	0.041997	49	0.01598	no	THYROID
chr1_965666_ACC_A_b38	SLC35E2	2.624	0.00896	0.044539	30	0.016975	no	THYROID
chr1_2676830_TGGAACAGCACCCACACCCCCA_T_b38	SLC35E2	-2.595	0.00972	-0.11711	5	0.045121	no	THYROID
chr1_1056425_GCGGGTA_G_b38	SLC35E2	2.594	0.00977	0.050506	9	0.019473	no	THYROID
chr1_1001870_C_G_b38	SLC35E2	2.591	0.00985	0.047191	15	0.018214	no	THYROID
chr1_1674720_TGC_T_b38	SLC35E2	3.442	0.000833	0.086933	35	0.025257	yes	UTERUS
chr1_1674868_G_A_b38	SLC35E2	3.442	0.000833	0.086933	35	0.025257	yes	UTERUS
chr1_924310_C_G_b38	SLC35E2	3.426	0.000879	0.192596	7	0.056223	yes	UTERUS
chr1_1676790_C_T_b38	SLC35E2	3.365	0.00107	0.083997	35	0.02496	yes	UTERUS
chr1_2335494_C_T_b38	SLC35E2	-3.251	0.00155	-0.10489	5	0.032268	yes	UTERUS
chr1_1677720_T_G_b38	SLC35E2	3.196	0.00184	0.080377	35	0.025147	yes	UTERUS
chr1_1677726_A_T_b38	SLC35E2	3.196	0.00184	0.080377	35	0.025147	yes	UTERUS
chr1_2325287_C_CCT_b38	SLC35E2	-3.095	0.00253	-0.08562	13	0.027665	yes	UTERUS
chr1_1546962_G_A_b38	SLC35E2	-3.062	0.0028	-0.172944	5	0.056473	yes	UTERUS
chr1_1673060_G_A_b38	SLC35E2	3.044	0.00296	0.079957	34	0.026271	yes	UTERUS
chr1_1671995_G_T_b38	SLC35E2	3.002	0.00336	0.076777	35	0.025576	yes	UTERUS
chr1_1673818_A_C_b38	SLC35E2	3	0.00338	0.077348	35	0.02578	yes	UTERUS
chr1_1945842_A_AAAAGAAC_b38	SLC35E2	-2.966	0.00375	-0.089835	15	0.030291	yes	UTERUS
chr1_1742587_G_C_b38	SLC35E2	2.906	0.00447	0.079012	35	0.027187	yes	UTERUS
chr1_1979465_A_G_b38	SLC35E2	2.89	0.00469	0.103998	3	0.035987	yes	UTERUS
chr1_1744121_A_C_b38	SLC35E2	-2.89	0.00469	-0.10691	13	0.036998	yes	UTERUS
chr1_1672155_G_A_b38	SLC35E2	-2.869	0.00498	-0.100001	6	0.034853	yes	UTERUS
chr1_1170681_G_A_b38	SLC35E2	-2.704	0.008	-0.067293	25	0.024886	yes	UTERUS
chr1_1671797_G_A_b38	SLC35E2	2.676	0.00867	0.071902	32	0.026873	yes	UTERUS
chr1_924024_C_G_b38	SLC35E2	3.696	0.000352	0.217245	7	0.058779	no	UTERUS
chr1_1675132_A_G_b38	SLC35E2	3.231	0.00165	0.105867	12	0.032764	no	UTERUS
chr1_1937273_T_C_b38	SLC35E2	-3.182	0.00193	-0.081403	30	0.025583	no	UTERUS
chr1_1670423_AT_A_b38	SLC35E2	3.167	0.00202	0.102485	17	0.032355	no	UTERUS
chr1_1942014_G_A_b38	SLC35E2	-3.094	0.00254	-0.078349	32	0.025327	no	UTERUS
chr1_1942075_A_G_b38	SLC35E2	-3.094	0.00254	-0.078349	32	0.025327	no	UTERUS
chr1_1942086_T_C_b38	SLC35E2	-3.094	0.00254	-0.078349	32	0.025327	no	UTERUS
chr1_935426_C_CGGAGCTCCTCT_b38	SLC35E2	-3.075	0.00269	-0.185042	4	0.060182	no	UTERUS
chr1_1675228_C_CG_b38	SLC35E2	3.04	0.003	0.100586	15	0.033092	no	UTERUS
chr1_1744854_C_A_b38	SLC35E2	-3.012	0.00325	-0.081004	19	0.02689	no	UTERUS
chr1_1937841_ACACCAGGTCCACCTCTGGACACAGGTCCACC_A_b38	SLC35E2	-2.999	0.00338	-0.077216	32	0.025743	no	UTERUS
chr1_1938332_A_ACT_b38	SLC35E2	-2.999	0.00338	-0.077216	32	0.025743	no	UTERUS
chr1_1940540_G_A_b38	SLC35E2	-2.999	0.00338	-0.077216	32	0.025743	no	UTERUS
chr1_1940973_C_T_b38	SLC35E2	-2.999	0.00338	-0.077216	32	0.025743	no	UTERUS
chr1_1942258_G_A_b38	SLC35E2	-2.999	0.00338	-0.077216	32	0.025743	no	UTERUS
chr1_1942260_G_C_b38	SLC35E2	-2.999	0.00338	-0.077216	32	0.025743	no	UTERUS
chr1_925081_G_A_b38	SLC35E2	2.925	0.00423	0.1747	7	0.059734	no	UTERUS
chr1_925141_C_A_b38	SLC35E2	2.925	0.00423	0.1747	7	0.059734	no	UTERUS
chr1_925628_G_C_b38	SLC35E2	2.925	0.00423	0.1747	7	0.059734	no	UTERUS
chr1_1671724_C_T_b38	SLC35E2	-2.911	0.00441	-0.107211	4	0.036835	no	UTERUS
chr1_1945975_TG_T_b38	SLC35E2	-2.878	0.00485	-0.083573	26	0.029034	no	UTERUS
chr1_1938054_ACT_A_b38	SLC35E2	-2.872	0.00495	-0.074409	32	0.025913	no	UTERUS
chr1_2334639_T_C_b38	SLC35E2	-2.843	0.00538	-0.072626	31	0.025547	no	UTERUS
chr1_1936627_C_G_b38	SLC35E2	-2.842	0.00539	-0.072131	33	0.025379	no	UTERUS
chr1_1932079_AC_A_b38	SLC35E2	-2.793	0.00622	-0.086451	13	0.030953	no	UTERUS
chr1_938014_A_G_b38	SLC35E2	-2.776	0.00652	-0.159092	5	0.057307	no	UTERUS
chr1_1933087_C_T_b38	SLC35E2	-2.749	0.00706	-0.070928	33	0.025805	no	UTERUS
chr1_1933859_A_G_b38	SLC35E2	-2.749	0.00706	-0.070928	33	0.025805	no	UTERUS
chr1_1938221_TCA_T_b38	SLC35E2	2.741	0.00721	0.084506	7	0.030831	no	UTERUS
chr1_924321_C_G_b38	SLC35E2	2.72	0.00765	0.135932	8	0.049975	no	UTERUS
chr1_1938467_C_T_b38	SLC35E2	2.709	0.0079	0.08317	7	0.030704	no	UTERUS
chr1_1935938_T_C_b38	SLC35E2	-2.696	0.00818	-0.067429	31	0.025009	no	UTERUS
chr1_1947648_G_A_b38	SLC35E2	2.685	0.00845	0.082097	7	0.03058	no	UTERUS
chr1_1944074_T_C_b38	SLC35E2	-2.678	0.00861	-0.077148	26	0.028806	no	UTERUS
chr1_1944091_G_C_b38	SLC35E2	-2.678	0.00861	-0.077148	26	0.028806	no	UTERUS
chr1_1936077_C_T_b38	SLC35E2	-2.664	0.00895	-0.069487	32	0.026084	no	UTERUS
chr1_1942186_G_A_b38	SLC35E2	2.655	0.00918	0.082285	7	0.030994	no	UTERUS
chr1_2459410_TGGTGGTCCTCCTTGCC_T_b38	SLC35E2	-2.647	0.00937	-0.07553	12	0.02853	no	UTERUS
chr1_1934896_C_T_b38	SLC35E2	2.633	0.00974	0.083014	5	0.031524	no	UTERUS
chr1_1744499_C_T_b38	SLC35E2	-2.631	0.00981	-0.074031	23	0.028137	no	UTERUS
chr1_1737789_T_C_b38	SLC35E2	5.104	1.31e-06	0.174628	5	0.034211	yes	VAGINA
chr1_1734308_T_C_b38	SLC35E2	4.918	2.91e-06	0.166299	5	0.033814	yes	VAGINA
chr1_1739915_G_A_b38	SLC35E2	4.651	8.84e-06	0.148251	7	0.031878	yes	VAGINA
chr1_1728671_C_A_b38	SLC35E2	4.395	2.46e-05	0.124858	5	0.028406	yes	VAGINA
chr1_1730989_A_G_b38	SLC35E2	4.342	3.04e-05	0.151207	5	0.034827	yes	VAGINA
chr1_1731456_A_G_b38	SLC35E2	4.342	3.04e-05	0.151207	5	0.034827	yes	VAGINA
chr1_1735814_T_C_b38	SLC35E2	4.342	3.04e-05	0.151207	5	0.034827	yes	VAGINA
chr1_1735932_A_G_b38	SLC35E2	4.342	3.04e-05	0.151207	5	0.034827	yes	VAGINA
chr1_1740427_A_T_b38	SLC35E2	4.342	3.04e-05	0.151207	5	0.034827	yes	VAGINA
chr1_1734132_T_G_b38	SLC35E2	4.255	4.25e-05	0.153624	5	0.0361	yes	VAGINA
chr1_1732166_A_G_b38	SLC35E2	4.181	5.67e-05	0.144737	5	0.03462	yes	VAGINA
chr1_1732580_T_C_b38	SLC35E2	4.007	0.000109	0.141548	5	0.035321	yes	VAGINA
chr1_1742080_T_C_b38	SLC35E2	4.007	0.000109	0.141548	5	0.035321	yes	VAGINA
chr1_1692151_T_C_b38	SLC35E2	-3.949	0.000135	-0.105391	10	0.02669	yes	VAGINA
chr1_1714674_G_C_b38	SLC35E2	3.78	0.00025	0.137462	9	0.036369	yes	VAGINA
chr1_1741091_CT_C_b38	SLC35E2	3.751	0.000277	0.112594	6	0.030021	yes	VAGINA
chr1_1662738_CT_C_b38	SLC35E2	-3.682	0.000353	-0.186338	4	0.050611	yes	VAGINA
chr1_1703572_A_G_b38	SLC35E2	-3.666	0.000373	-0.148693	7	0.040563	yes	VAGINA
chr1_1716210_C_CT_b38	SLC35E2	3.629	0.000425	0.145804	9	0.04018	yes	VAGINA
chr1_1720288_G_A_b38	SLC35E2	3.629	0.000425	0.145804	9	0.04018	yes	VAGINA
chr1_1715553_G_A_b38	SLC35E2	3.614	0.000448	0.141717	9	0.039216	yes	VAGINA
chr1_1742587_G_C_b38	SLC35E2	3.569	0.000523	0.080844	36	0.022653	yes	VAGINA
chr1_1688586_C_T_b38	SLC35E2	-3.564	0.000532	-0.100955	6	0.028327	yes	VAGINA
chr1_1724428_C_CG_b38	SLC35E2	-3.552	0.000554	-0.213375	3	0.060077	yes	VAGINA
chr1_1703968_A_G_b38	SLC35E2	-3.519	0.00062	-0.2179	3	0.061926	yes	VAGINA
chr1_1688570_A_T_b38	SLC35E2	-3.505	0.00065	-0.105237	3	0.030024	yes	VAGINA
chr1_1739519_C_G_b38	SLC35E2	3.45	0.000783	0.097329	8	0.028213	yes	VAGINA
chr1_1735008_G_GTTTT_b38	SLC35E2	3.443	0.000802	0.075788	30	0.022014	yes	VAGINA
chr1_1707555_C_T_b38	SLC35E2	-3.395	0.000941	-0.14184	11	0.041781	yes	VAGINA
chr1_1722619_C_T_b38	SLC35E2	3.367	0.00103	0.10268	9	0.030492	yes	VAGINA
chr1_1730405_G_C_b38	SLC35E2	3.353	0.00108	0.08317	30	0.024807	yes	VAGINA
chr1_1948594_G_GTTT_b38	SLC35E2	-3.337	0.00114	-0.149923	3	0.04493	yes	VAGINA
chr1_1734301_T_C_b38	SLC35E2	3.303	0.00127	0.123499	4	0.037394	yes	VAGINA
chr1_1724543_G_C_b38	SLC35E2	-3.3	0.00129	-0.192999	3	0.058486	yes	VAGINA
chr1_1743544_CA_C_b38	SLC35E2	3.275	0.00139	0.074541	37	0.022762	yes	VAGINA
chr1_1703583_A_G_b38	SLC35E2	-3.254	0.00149	-0.131316	9	0.040356	yes	VAGINA
chr1_1650195_A_G_b38	SLC35E2	-3.243	0.00154	-0.089563	9	0.027614	yes	VAGINA
chr1_1714987_C_T_b38	SLC35E2	-3.234	0.00159	-0.196035	3	0.060616	yes	VAGINA
chr1_1718786_G_A_b38	SLC35E2	-3.234	0.00159	-0.196035	3	0.060616	yes	VAGINA
chr1_1719189_G_A_b38	SLC35E2	-3.234	0.00159	-0.196035	3	0.060616	yes	VAGINA
chr1_1720548_G_A_b38	SLC35E2	-3.234	0.00159	-0.196035	3	0.060616	yes	VAGINA
chr1_1721336_G_A_b38	SLC35E2	-3.234	0.00159	-0.196035	3	0.060616	yes	VAGINA
chr1_1746440_A_G_b38	SLC35E2	-3.218	0.00167	-0.095391	5	0.029644	yes	VAGINA
chr1_1662855_T_C_b38	SLC35E2	-3.179	0.0019	-0.155919	5	0.049047	yes	VAGINA
chr1_1688647_G_A_b38	SLC35E2	-3.167	0.00197	-0.085849	9	0.027107	yes	VAGINA
chr1_1688619_AAAC_A_b38	SLC35E2	-3.16	0.00201	-0.08639	8	0.027336	yes	VAGINA
chr1_1639348_G_T_b38	SLC35E2	-3.118	0.0023	-0.08437	13	0.027063	yes	VAGINA
chr1_1722625_A_T_b38	SLC35E2	3.105	0.00239	0.095884	8	0.03088	yes	VAGINA
chr1_1722626_AGCG_A_b38	SLC35E2	3.105	0.00239	0.095884	8	0.03088	yes	VAGINA
chr1_1688786_G_A_b38	SLC35E2	-3.036	0.00296	-0.093605	3	0.030833	yes	VAGINA
chr1_1650383_G_T_b38	SLC35E2	-3.032	0.003	-0.08822	9	0.029098	yes	VAGINA
chr1_1743586_T_TAC_b38	SLC35E2	-3.016	0.00315	-0.081352	12	0.026973	yes	VAGINA
chr1_1732685_T_C_b38	SLC35E2	2.981	0.0035	0.11061	11	0.037105	yes	VAGINA
chr1_1734899_G_A_b38	SLC35E2	2.981	0.0035	0.11061	11	0.037105	yes	VAGINA
chr1_1731375_T_C_b38	SLC35E2	2.945	0.0039	0.101068	6	0.034317	yes	VAGINA
chr1_1736836_A_G_b38	SLC35E2	2.939	0.00397	0.068023	39	0.023143	yes	VAGINA
chr1_1722599_G_A_b38	SLC35E2	2.917	0.00425	0.079091	16	0.027115	yes	VAGINA
chr1_1729196_T_G_b38	SLC35E2	2.896	0.00451	0.107238	4	0.037025	yes	VAGINA
chr1_1688457_G_A_b38	SLC35E2	-2.896	0.00451	-0.080724	8	0.027871	yes	VAGINA
chr1_1648826_A_G_b38	SLC35E2	-2.875	0.0048	-0.078717	12	0.027376	yes	VAGINA
chr1_1648636_G_A_b38	SLC35E2	-2.873	0.00483	-0.079123	12	0.027537	yes	VAGINA
chr1_1737504_A_C_b38	SLC35E2	2.855	0.00511	0.066071	35	0.023146	yes	VAGINA
chr1_1955018_A_AGGAAGTGCGGCTCACACC_b38	SLC35E2	2.836	0.00539	0.088174	5	0.031087	yes	VAGINA
chr1_1513923_G_C_b38	SLC35E2	2.751	0.00689	0.09799	7	0.035616	yes	VAGINA
chr1_1746522_GT_G_b38	SLC35E2	-2.748	0.00695	-0.078878	7	0.028702	yes	VAGINA
chr1_2287526_C_T_b38	SLC35E2	-2.729	0.00734	-0.070721	22	0.025914	yes	VAGINA
chr1_2687568_G_C_b38	SLC35E2	2.722	0.00749	0.087054	7	0.031982	yes	VAGINA
chr1_2456276_C_T_b38	SLC35E2	-2.7	0.00798	-0.086953	3	0.032208	yes	VAGINA
chr1_1641275_A_G_b38	SLC35E2	-2.683	0.00836	-0.079585	9	0.029661	yes	VAGINA
chr1_1738606_C_T_b38	SLC35E2	2.668	0.00871	0.074932	18	0.02808	yes	VAGINA
chr1_1664757_T_C_b38	SLC35E2	-2.665	0.00878	-0.072774	11	0.027302	yes	VAGINA
chr1_1731963_A_C_b38	SLC35E2	2.658	0.00898	0.061482	36	0.023135	yes	VAGINA
chr1_1732392_C_T_b38	SLC35E2	2.658	0.00898	0.061482	36	0.023135	yes	VAGINA
chr1_1734903_A_G_b38	SLC35E2	2.658	0.00898	0.061482	36	0.023135	yes	VAGINA
chr1_1735176_C_T_b38	SLC35E2	2.658	0.00898	0.061482	36	0.023135	yes	VAGINA
chr1_1735980_A_C_b38	SLC35E2	2.658	0.00898	0.061482	36	0.023135	yes	VAGINA
chr1_1736729_G_T_b38	SLC35E2	2.658	0.00898	0.061482	36	0.023135	yes	VAGINA
chr1_1740343_C_T_b38	SLC35E2	2.658	0.00898	0.061482	36	0.023135	yes	VAGINA
chr1_1675228_C_CG_b38	SLC35E2	2.648	0.00923	0.068228	17	0.025766	yes	VAGINA
chr1_1658866_G_A_b38	SLC35E2	-2.644	0.00931	-0.072612	12	0.027458	yes	VAGINA
chr1_1659114_A_G_b38	SLC35E2	-2.644	0.00931	-0.072612	12	0.027458	yes	VAGINA
chr1_1659220_A_G_b38	SLC35E2	-2.644	0.00931	-0.072612	12	0.027458	yes	VAGINA
chr1_1661420_C_A_b38	SLC35E2	-2.644	0.00931	-0.072612	12	0.027458	yes	VAGINA
chr1_1651926_T_C_b38	SLC35E2	-2.643	0.00935	-0.073424	10	0.027779	yes	VAGINA
chr1_1757074_G_T_b38	SLC35E2	2.632	0.00963	0.061226	28	0.023259	yes	VAGINA
chr1_1688531_T_C_b38	SLC35E2	-2.621	0.00995	-0.077034	6	0.029394	yes	VAGINA
chr1_1651137_C_T_b38	SLC35E2	-2.62	0.00996	-0.073266	10	0.027962	yes	VAGINA
chr1_1651267_T_C_b38	SLC35E2	-2.62	0.00996	-0.073266	10	0.027962	yes	VAGINA
chr1_1651421_GTAGCCCCTCTGAACGGTCTGTGACACACGCATGCTTTCAGCTAGAGTACTCTA_G_b38	SLC35E2	-2.62	0.00996	-0.073266	10	0.027962	yes	VAGINA
chr1_1651574_G_A_b38	SLC35E2	-2.62	0.00996	-0.073266	10	0.027962	yes	VAGINA
chr1_1651785_C_A_b38	SLC35E2	-2.62	0.00996	-0.073266	10	0.027962	yes	VAGINA
chr1_1652135_C_G_b38	SLC35E2	-2.62	0.00996	-0.073266	10	0.027962	yes	VAGINA
chr1_1652191_C_T_b38	SLC35E2	-2.62	0.00996	-0.073266	10	0.027962	yes	VAGINA
chr1_1652592_A_G_b38	SLC35E2	-2.62	0.00996	-0.073266	10	0.027962	yes	VAGINA
chr1_1652779_A_G_b38	SLC35E2	-2.62	0.00996	-0.073266	10	0.027962	yes	VAGINA
chr1_1653147_A_C_b38	SLC35E2	-2.62	0.00996	-0.073266	10	0.027962	yes	VAGINA
chr1_1653396_T_C_b38	SLC35E2	-2.62	0.00996	-0.073266	10	0.027962	yes	VAGINA
chr1_1653472_T_C_b38	SLC35E2	-2.62	0.00996	-0.073266	10	0.027962	yes	VAGINA
chr1_1653811_G_A_b38	SLC35E2	-2.62	0.00996	-0.073266	10	0.027962	yes	VAGINA
chr1_1653893_C_T_b38	SLC35E2	-2.62	0.00996	-0.073266	10	0.027962	yes	VAGINA
chr1_1653934_G_A_b38	SLC35E2	-2.62	0.00996	-0.073266	10	0.027962	yes	VAGINA
chr1_1654143_G_A_b38	SLC35E2	-2.62	0.00996	-0.073266	10	0.027962	yes	VAGINA
chr1_1729859_A_G_b38	SLC35E2	4.625	9.8e-06	0.128717	5	0.02783	no	VAGINA
chr1_1674720_TGC_T_b38	SLC35E2	4.044	9.49e-05	0.084318	42	0.020849	no	VAGINA
chr1_1674868_G_A_b38	SLC35E2	4.044	9.49e-05	0.084318	42	0.020849	no	VAGINA
chr1_1676790_C_T_b38	SLC35E2	4.044	9.49e-05	0.084318	42	0.020849	no	VAGINA
chr1_1673818_A_C_b38	SLC35E2	3.905	0.000159	0.082949	42	0.021241	no	VAGINA
chr1_1677720_T_G_b38	SLC35E2	3.893	0.000166	0.080769	42	0.020745	no	VAGINA
chr1_1677726_A_T_b38	SLC35E2	3.893	0.000166	0.080769	42	0.020745	no	VAGINA
chr1_1671995_G_T_b38	SLC35E2	3.808	0.000226	0.080369	42	0.021107	no	VAGINA
chr1_1715541_A_C_b38	SLC35E2	3.748	0.000279	0.175607	3	0.04685	no	VAGINA
chr1_1673060_G_A_b38	SLC35E2	3.659	0.000382	0.079215	41	0.021646	no	VAGINA
chr1_1671797_G_A_b38	SLC35E2	3.606	0.00046	0.078696	39	0.021824	no	VAGINA
chr1_1679993_A_G_b38	SLC35E2	-3.548	0.000562	-0.075618	29	0.021315	no	VAGINA
chr1_1676287_C_T_b38	SLC35E2	-3.455	0.00077	-0.099053	4	0.02867	no	VAGINA
chr1_1649846_G_A_b38	SLC35E2	-3.361	0.00105	-0.092768	7	0.027601	no	VAGINA
chr1_1949036_C_CTCCT_b38	SLC35E2	-3.352	0.00108	-0.149128	3	0.044485	no	VAGINA
chr1_1739131_T_C_b38	SLC35E2	3.345	0.00111	0.07288	26	0.021785	no	VAGINA
chr1_1714635_A_G_b38	SLC35E2	3.24	0.00156	0.113501	4	0.035026	no	VAGINA
chr1_1714638_G_T_b38	SLC35E2	3.24	0.00156	0.113501	4	0.035026	no	VAGINA
chr1_1673968_GA_G_b38	SLC35E2	3.221	0.00166	0.08404	20	0.026093	no	VAGINA
chr1_1744499_C_T_b38	SLC35E2	-3.177	0.00191	-0.079618	21	0.025061	no	VAGINA
chr1_1708486_C_A_b38	SLC35E2	3.139	0.00215	0.06702	37	0.021353	no	VAGINA
chr1_1742672_C_T_b38	SLC35E2	-3.129	0.00222	-0.079967	16	0.02556	no	VAGINA
chr1_1687734_CAA_C_b38	SLC35E2	-3.123	0.00226	-0.077443	16	0.024795	no	VAGINA
chr1_1637577_T_C_b38	SLC35E2	-3.112	0.00234	-0.08775	7	0.028201	no	VAGINA
chr1_1743238_G_C_b38	SLC35E2	-3.111	0.00235	-0.080753	15	0.025957	no	VAGINA
chr1_1758323_T_C_b38	SLC35E2	3.111	0.00235	0.069016	34	0.022185	no	VAGINA
chr1_1844830_C_A_b38	SLC35E2	3.095	0.00246	0.069411	37	0.022424	no	VAGINA
chr1_1848037_C_CTA_b38	SLC35E2	3.095	0.00246	0.069411	37	0.022424	no	VAGINA
chr1_1781909_C_T_b38	SLC35E2	3.054	0.0028	0.067534	37	0.022115	no	VAGINA
chr1_1762759_AAATG_A_b38	SLC35E2	3.045	0.00288	0.069076	35	0.022688	no	VAGINA
chr1_1684308_G_C_b38	SLC35E2	-3.024	0.00308	-0.068743	22	0.022736	no	VAGINA
chr1_1684619_G_A_b38	SLC35E2	-3.024	0.00308	-0.068743	22	0.022736	no	VAGINA
chr1_1820337_A_G_b38	SLC35E2	3.008	0.00323	0.067144	37	0.022323	no	VAGINA
chr1_1760882_T_C_b38	SLC35E2	2.983	0.00348	0.066714	37	0.022367	no	VAGINA
chr1_1779667_T_TTG_b38	SLC35E2	2.937	0.004	0.073148	23	0.024908	no	VAGINA
chr1_1687153_A_G_b38	SLC35E2	-2.934	0.00403	-0.067141	24	0.022884	no	VAGINA
chr1_1708855_TTCCTCCTCC_T_b38	SLC35E2	2.905	0.0044	0.067693	32	0.023303	no	VAGINA
chr1_2454659_A_G_b38	SLC35E2	2.879	0.00475	0.094342	3	0.032771	no	VAGINA
chr1_1708951_C_T_b38	SLC35E2	2.878	0.00476	0.066231	31	0.023009	no	VAGINA
chr1_1657926_A_AG_b38	SLC35E2	-2.876	0.00479	-0.091863	5	0.031939	no	VAGINA
chr1_1692124_T_G_b38	SLC35E2	-2.873	0.00484	-0.077102	11	0.026839	no	VAGINA
chr1_1684266_T_C_b38	SLC35E2	-2.823	0.0056	-0.064025	23	0.022681	no	VAGINA
chr1_1687159_G_T_b38	SLC35E2	-2.823	0.0056	-0.064025	23	0.022681	no	VAGINA
chr1_1769969_CAAAACA_C_b38	SLC35E2	2.803	0.00593	0.062521	33	0.022302	no	VAGINA
chr1_1865278_A_C_b38	SLC35E2	2.788	0.0062	0.062718	31	0.022498	no	VAGINA
chr1_1686017_A_AT_b38	SLC35E2	-2.783	0.00629	-0.062658	24	0.022513	no	VAGINA
chr1_1687061_C_T_b38	SLC35E2	-2.783	0.00629	-0.062658	24	0.022513	no	VAGINA
chr1_2686263_G_A_b38	SLC35E2	2.779	0.00636	0.086519	5	0.031133	no	VAGINA
chr1_1687643_G_A_b38	SLC35E2	-2.771	0.0065	-0.062988	24	0.022728	no	VAGINA
chr1_2685080_C_G_b38	SLC35E2	2.754	0.00683	0.088262	4	0.032047	no	VAGINA
chr1_2685081_C_G_b38	SLC35E2	2.754	0.00683	0.088262	4	0.032047	no	VAGINA
chr1_1753033_C_T_b38	SLC35E2	-2.749	0.00693	-0.06684	29	0.024312	no	VAGINA
chr1_1681164_G_A_b38	SLC35E2	-2.741	0.00709	-0.061782	24	0.022536	no	VAGINA
chr1_1755504_T_C_b38	SLC35E2	2.734	0.00724	0.062414	37	0.022831	no	VAGINA
chr1_1702383_T_C_b38	SLC35E2	-2.726	0.00741	-0.08456	5	0.031022	no	VAGINA
chr1_1641261_C_T_b38	SLC35E2	-2.724	0.00746	-0.085832	3	0.031515	no	VAGINA
chr1_1661562_G_C_b38	SLC35E2	2.722	0.00749	0.056674	40	0.020819	no	VAGINA
chr1_1708505_G_C_b38	SLC35E2	2.716	0.00761	0.058178	21	0.021417	no	VAGINA
chr1_1726162_T_C_b38	SLC35E2	2.714	0.00767	0.068603	30	0.02528	no	VAGINA
chr1_2566239_A_G_b38	SLC35E2	-2.709	0.00778	-0.063699	29	0.023515	no	VAGINA
chr1_2566613_C_T_b38	SLC35E2	-2.709	0.00778	-0.063699	29	0.023515	no	VAGINA
chr1_2567423_G_C_b38	SLC35E2	-2.709	0.00778	-0.063699	29	0.023515	no	VAGINA
chr1_2568020_T_C_b38	SLC35E2	-2.709	0.00778	-0.063699	29	0.023515	no	VAGINA
chr1_2570571_T_C_b38	SLC35E2	-2.709	0.00778	-0.063699	29	0.023515	no	VAGINA
chr1_2571341_C_T_b38	SLC35E2	-2.709	0.00778	-0.063699	29	0.023515	no	VAGINA
chr1_2571395_A_G_b38	SLC35E2	-2.709	0.00778	-0.063699	29	0.023515	no	VAGINA
chr1_1744028_A_AC_b38	SLC35E2	-2.706	0.00785	-0.079343	6	0.029326	no	VAGINA
chr1_1650664_CTTTTT_C_b38	SLC35E2	-2.704	0.00788	-0.077406	8	0.028625	no	VAGINA
chr1_1746439_GA_G_b38	SLC35E2	2.692	0.00815	0.067197	27	0.024959	no	VAGINA
chr1_2607961_T_C_b38	SLC35E2	-2.682	0.0084	-0.06702	25	0.024993	no	VAGINA
chr1_1190043_C_T_b38	SLC35E2	2.678	0.00849	0.107506	3	0.04015	no	VAGINA
chr1_1684817_G_C_b38	SLC35E2	-2.677	0.0085	-0.063669	19	0.023783	no	VAGINA
chr1_1680556_A_G_b38	SLC35E2	-2.66	0.00893	-0.060179	24	0.022627	no	VAGINA
chr1_1659060_G_A_b38	SLC35E2	-2.655	0.00905	-0.070348	10	0.026496	no	VAGINA
chr1_2620778_G_GAA_b38	SLC35E2	-2.652	0.00912	-0.07204	15	0.027163	no	VAGINA
chr1_1683909_A_C_b38	SLC35E2	-2.64	0.00944	-0.061049	25	0.023128	no	VAGINA
chr1_2684706_G_T_b38	SLC35E2	2.624	0.00986	0.080805	6	0.030793	no	VAGINA
chr1_1864334_AAAG_A_b38	SLC35E2	-2.623	0.00989	-0.081664	7	0.031137	no	VAGINA
chr1_1674868_G_A_b38	SLC35E2	10.235	9.11e-23	0.101057	146	0.009874	yes	WHLBLD
chr1_1674720_TGC_T_b38	SLC35E2	10.192	1.33e-22	0.101026	145	0.009912	yes	WHLBLD
chr1_1677720_T_G_b38	SLC35E2	10.065	4.03e-22	0.099216	150	0.009858	yes	WHLBLD
chr1_1677726_A_T_b38	SLC35E2	10.043	4.88e-22	0.098916	150	0.009849	yes	WHLBLD
chr1_1676790_C_T_b38	SLC35E2	10.033	5.29e-22	0.097863	149	0.009754	yes	WHLBLD
chr1_1671995_G_T_b38	SLC35E2	9.919	1.42e-21	0.098125	144	0.009893	yes	WHLBLD
chr1_1673818_A_C_b38	SLC35E2	9.912	1.51e-21	0.098589	146	0.009947	yes	WHLBLD
chr1_1673060_G_A_b38	SLC35E2	9.801	3.91e-21	0.099243	143	0.010126	yes	WHLBLD
chr1_1671797_G_A_b38	SLC35E2	9.372	1.43e-19	0.094894	136	0.010125	yes	WHLBLD
chr1_1673968_GA_G_b38	SLC35E2	8.7	3.2e-17	0.102585	67	0.011791	yes	WHLBLD
chr1_1648736_G_A_b38	SLC35E2	7.447	3.33e-13	0.080738	126	0.010841	yes	WHLBLD
chr1_1667424_T_TAAAATA_b38	SLC35E2	6.696	4.94e-11	0.075411	82	0.011262	yes	WHLBLD
chr1_1636278_G_T_b38	SLC35E2	6.538	1.33e-10	0.072901	109	0.01115	yes	WHLBLD
chr1_1739131_T_C_b38	SLC35E2	6.235	8.53e-10	0.06534	124	0.010479	yes	WHLBLD
chr1_1670423_AT_A_b38	SLC35E2	6.214	9.7e-10	0.076811	77	0.012362	yes	WHLBLD
chr1_1674633_C_CA_b38	SLC35E2	6.15	1.42e-09	0.070095	75	0.011398	yes	WHLBLD
chr1_1660318_C_T_b38	SLC35E2	6.107	1.82e-09	0.098246	5	0.016086	yes	WHLBLD
chr1_1649976_G_A_b38	SLC35E2	6.092	1.99e-09	0.066353	105	0.010891	yes	WHLBLD
chr1_1675091_A_G_b38	SLC35E2	-5.955	4.42e-09	-0.07237	43	0.012152	yes	WHLBLD
chr1_1671097_G_C_b38	SLC35E2	5.934	4.99e-09	0.066119	78	0.011142	yes	WHLBLD
chr1_1660683_C_T_b38	SLC35E2	-5.907	5.85e-09	-0.07133	54	0.012076	yes	WHLBLD
chr1_1744652_C_T_b38	SLC35E2	-5.773	1.25e-08	-0.062235	130	0.01078	yes	WHLBLD
chr1_1671148_C_T_b38	SLC35E2	5.756	1.38e-08	0.064097	78	0.011137	yes	WHLBLD
chr1_1661420_C_A_b38	SLC35E2	-5.645	2.55e-08	-0.064455	75	0.011418	yes	WHLBLD
chr1_1613769_C_T_b38	SLC35E2	5.645	2.56e-08	0.066436	67	0.011769	yes	WHLBLD
chr1_1659114_A_G_b38	SLC35E2	-5.63	2.77e-08	-0.064296	75	0.01142	yes	WHLBLD
chr1_1659220_A_G_b38	SLC35E2	-5.63	2.77e-08	-0.064296	75	0.01142	yes	WHLBLD
chr1_1658866_G_A_b38	SLC35E2	-5.627	2.82e-08	-0.064068	76	0.011387	yes	WHLBLD
chr1_1591703_T_C_b38	SLC35E2	5.616	2.99e-08	0.059726	129	0.010634	yes	WHLBLD
chr1_1742587_G_C_b38	SLC35E2	5.547	4.38e-08	0.059191	153	0.010672	yes	WHLBLD
chr1_1722690_TA_T_b38	SLC35E2	-5.521	5.03e-08	-0.09198	7	0.016661	yes	WHLBLD
chr1_1667424_T_TAAATA_b38	SLC35E2	-5.497	5.72e-08	-0.059779	102	0.010875	yes	WHLBLD
chr1_1762759_A_AAATG_b38	SLC35E2	-5.474	6.49e-08	-0.100499	3	0.01836	yes	WHLBLD
chr1_1664865_A_G_b38	SLC35E2	-5.472	6.53e-08	-0.062122	71	0.011352	yes	WHLBLD
chr1_1744854_C_A_b38	SLC35E2	-5.451	7.33e-08	-0.055525	107	0.010186	yes	WHLBLD
chr1_1743586_T_TAC_b38	SLC35E2	-5.448	7.44e-08	-0.061081	90	0.011211	yes	WHLBLD
chr1_1675228_C_CG_b38	SLC35E2	5.419	8.67e-08	0.061098	104	0.011274	yes	WHLBLD
chr1_1646352_A_C_b38	SLC35E2	5.387	1.03e-07	0.081118	12	0.015058	yes	WHLBLD
chr1_1751981_A_T_b38	SLC35E2	-5.382	1.06e-07	-0.068048	57	0.012645	yes	WHLBLD
chr1_1744499_C_T_b38	SLC35E2	-5.361	1.19e-07	-0.056493	130	0.010539	yes	WHLBLD
chr1_1668108_C_T_b38	SLC35E2	5.313	1.52e-07	0.061039	72	0.011488	yes	WHLBLD
chr1_1752730_C_G_b38	SLC35E2	-5.295	1.67e-07	-0.059193	138	0.011178	yes	WHLBLD
chr1_1743714_C_CA_b38	SLC35E2	5.283	1.78e-07	0.062196	88	0.011774	yes	WHLBLD
chr1_1755504_T_C_b38	SLC35E2	5.255	2.06e-07	0.054464	152	0.010365	yes	WHLBLD
chr1_1743238_G_C_b38	SLC35E2	-5.223	2.43e-07	-0.057569	111	0.011021	yes	WHLBLD
chr1_1692124_T_G_b38	SLC35E2	-5.22	2.47e-07	-0.06523	49	0.012496	yes	WHLBLD
chr1_1630798_C_T_b38	SLC35E2	5.218	2.5e-07	0.061159	67	0.011721	yes	WHLBLD
chr1_1752461_G_A_b38	SLC35E2	-5.201	2.72e-07	-0.058219	138	0.011193	yes	WHLBLD
chr1_1650195_A_G_b38	SLC35E2	-5.183	2.99e-07	-0.059989	73	0.011575	yes	WHLBLD
chr1_1753033_C_T_b38	SLC35E2	-5.155	3.44e-07	-0.057722	149	0.011196	yes	WHLBLD
chr1_1868925_C_T_b38	SLC35E2	-5.151	3.52e-07	-0.095061	3	0.018454	yes	WHLBLD
chr1_1612562_T_TC_b38	SLC35E2	5.147	3.59e-07	0.056777	75	0.011031	yes	WHLBLD
chr1_1742672_C_T_b38	SLC35E2	-5.147	3.59e-07	-0.056681	112	0.011012	yes	WHLBLD
chr1_1621352_G_A_b38	SLC35E2	5.133	3.87e-07	0.057078	78	0.011121	yes	WHLBLD
chr1_1667948_A_G_b38	SLC35E2	-5.121	4.09e-07	-0.066103	34	0.012907	yes	WHLBLD
chr1_1753361_G_A_b38	SLC35E2	-5.121	4.09e-07	-0.057295	138	0.011187	yes	WHLBLD
chr1_1756043_G_T_b38	SLC35E2	-5.121	4.11e-07	-0.057079	140	0.011147	yes	WHLBLD
chr1_1743840_T_C_b38	SLC35E2	-5.112	4.29e-07	-0.067002	41	0.013106	yes	WHLBLD
chr1_1753319_G_A_b38	SLC35E2	-5.107	4.4e-07	-0.056996	138	0.01116	yes	WHLBLD
chr1_1650000_G_A_b38	SLC35E2	5.107	4.41e-07	0.057799	82	0.011318	yes	WHLBLD
chr1_1652061_T_C_b38	SLC35E2	-5.102	4.52e-07	-0.059049	71	0.011574	yes	WHLBLD
chr1_1654188_T_G_b38	SLC35E2	-5.102	4.52e-07	-0.059049	71	0.011574	yes	WHLBLD
chr1_1754482_TCCCTGGGACCGAAGTCGCCCCA_T_b38	SLC35E2	-5.1	4.57e-07	-0.05644	140	0.011067	yes	WHLBLD
chr1_1755523_C_T_b38	SLC35E2	5.094	4.7e-07	0.053547	162	0.010511	yes	WHLBLD
chr1_1620609_G_A_b38	SLC35E2	5.085	4.91e-07	0.056521	76	0.011114	yes	WHLBLD
chr1_1629332_G_T_b38	SLC35E2	5.08	5.05e-07	0.059432	72	0.0117	yes	WHLBLD
chr1_1692151_T_C_b38	SLC35E2	-5.061	5.57e-07	-0.063691	50	0.012586	yes	WHLBLD
chr1_1743886_C_T_b38	SLC35E2	-5.06	5.58e-07	-0.064532	50	0.012753	yes	WHLBLD
chr1_1744052_GAGA_G_b38	SLC35E2	-5.057	5.67e-07	-0.069912	31	0.013825	yes	WHLBLD
chr1_1926870_T_C_b38	SLC35E2	-5.052	5.82e-07	-0.055281	115	0.010943	yes	WHLBLD
chr1_1743851_C_T_b38	SLC35E2	-5.043	6.1e-07	-0.066372	40	0.013162	yes	WHLBLD
chr1_1658830_C_G_b38	SLC35E2	-5.022	6.76e-07	-0.062394	38	0.012425	yes	WHLBLD
chr1_1730405_G_C_b38	SLC35E2	5.014	7.03e-07	0.059801	99	0.011926	yes	WHLBLD
chr1_1668542_C_T_b38	SLC35E2	-5	7.55e-07	-0.065315	31	0.013063	yes	WHLBLD
chr1_1658422_T_C_b38	SLC35E2	4.995	7.72e-07	0.06686	29	0.013385	yes	WHLBLD
chr1_1609058_G_A_b38	SLC35E2	4.969	8.78e-07	0.055718	71	0.011212	yes	WHLBLD
chr1_1607931_G_A_b38	SLC35E2	4.969	8.78e-07	0.055929	70	0.011255	yes	WHLBLD
chr1_1668721_C_T_b38	SLC35E2	-4.968	8.84e-07	-0.0595	51	0.011977	yes	WHLBLD
chr1_1622295_G_C_b38	SLC35E2	4.967	8.88e-07	0.055326	76	0.011139	yes	WHLBLD
chr1_1668717_C_G_b38	SLC35E2	-4.946	9.86e-07	-0.063606	35	0.01286	yes	WHLBLD
chr1_1639348_G_T_b38	SLC35E2	-4.945	9.91e-07	-0.055648	88	0.011254	yes	WHLBLD
chr1_1757725_C_T_b38	SLC35E2	4.923	1.1e-06	0.055485	102	0.01127	yes	WHLBLD
chr1_1728671_C_A_b38	SLC35E2	4.916	1.14e-06	0.06976	29	0.014191	yes	WHLBLD
chr1_1664757_T_C_b38	SLC35E2	-4.885	1.33e-06	-0.054819	70	0.011222	yes	WHLBLD
chr1_1986752_A_G_b38	SLC35E2	4.878	1.38e-06	0.054088	121	0.011089	yes	WHLBLD
chr1_1754601_G_T_b38	SLC35E2	4.875	1.4e-06	0.054912	102	0.011265	yes	WHLBLD
chr1_1934565_G_A_b38	SLC35E2	-4.851	1.56e-06	-0.053676	129	0.011064	yes	WHLBLD
chr1_1692286_C_A_b38	SLC35E2	4.846	1.6e-06	0.079659	4	0.016437	yes	WHLBLD
chr1_1589495_CTTT_C_b38	SLC35E2	4.842	1.64e-06	0.059828	53	0.012357	yes	WHLBLD
chr1_1648826_A_G_b38	SLC35E2	-4.835	1.69e-06	-0.056126	83	0.011608	yes	WHLBLD
chr1_1750280_A_G_b38	SLC35E2	-4.798	2.03e-06	-0.052358	153	0.010912	yes	WHLBLD
chr1_1606507_GTGGGC_G_b38	SLC35E2	4.786	2.14e-06	0.050245	174	0.010498	yes	WHLBLD
chr1_1600379_C_T_b38	SLC35E2	4.774	2.27e-06	0.053178	72	0.011138	yes	WHLBLD
chr1_1669576_G_A_b38	SLC35E2	-4.767	2.35e-06	-0.062329	33	0.013076	yes	WHLBLD
chr1_1606384_A_G_b38	SLC35E2	4.764	2.39e-06	0.051863	82	0.010887	yes	WHLBLD
chr1_1759611_C_T_b38	SLC35E2	-4.744	2.62e-06	-0.053072	141	0.011187	yes	WHLBLD
chr1_1764023_C_A_b38	SLC35E2	4.744	2.62e-06	0.052787	108	0.011127	yes	WHLBLD
chr1_1600320_C_G_b38	SLC35E2	4.744	2.63e-06	0.052873	71	0.011146	yes	WHLBLD
chr1_1936077_C_T_b38	SLC35E2	-4.729	2.81e-06	-0.051031	133	0.01079	yes	WHLBLD
chr1_1940540_G_A_b38	SLC35E2	-4.726	2.85e-06	-0.051547	127	0.010906	yes	WHLBLD
chr1_1750226_C_T_b38	SLC35E2	4.723	2.89e-06	0.052856	109	0.01119	yes	WHLBLD
chr1_1757074_G_T_b38	SLC35E2	4.691	3.37e-06	0.052137	104	0.011115	yes	WHLBLD
chr1_1648636_G_A_b38	SLC35E2	-4.689	3.41e-06	-0.054463	83	0.011616	yes	WHLBLD
chr1_1916417_G_T_b38	SLC35E2	-4.67	3.72e-06	-0.051527	127	0.011033	yes	WHLBLD
chr1_1938054_ACT_A_b38	SLC35E2	-4.658	3.93e-06	-0.050854	127	0.010917	yes	WHLBLD
chr1_1987049_A_G_b38	SLC35E2	4.652	4.05e-06	0.051247	123	0.011016	yes	WHLBLD
chr1_1914634_G_T_b38	SLC35E2	-4.651	4.06e-06	-0.050895	127	0.010942	yes	WHLBLD
chr1_1916670_G_C_b38	SLC35E2	-4.651	4.06e-06	-0.050895	127	0.010942	yes	WHLBLD
chr1_1759354_G_A_b38	SLC35E2	-4.648	4.13e-06	-0.052109	139	0.011212	yes	WHLBLD
chr1_1937841_ACACCAGGTCCACCTCTGGACACAGGTCCACC_A_b38	SLC35E2	-4.638	4.32e-06	-0.050538	127	0.010896	yes	WHLBLD
chr1_1752908_C_CCCT_b38	SLC35E2	-4.621	4.69e-06	-0.053593	115	0.011599	yes	WHLBLD
chr1_1942014_G_A_b38	SLC35E2	-4.604	5.07e-06	-0.050301	126	0.010926	yes	WHLBLD
chr1_1942075_A_G_b38	SLC35E2	-4.604	5.07e-06	-0.050301	126	0.010926	yes	WHLBLD
chr1_1942086_T_C_b38	SLC35E2	-4.604	5.07e-06	-0.050301	126	0.010926	yes	WHLBLD
chr1_1938332_A_ACT_b38	SLC35E2	-4.602	5.12e-06	-0.049887	131	0.010841	yes	WHLBLD
chr1_1942258_G_A_b38	SLC35E2	-4.6	5.17e-06	-0.05024	127	0.010923	yes	WHLBLD
chr1_1749826_A_G_b38	SLC35E2	-4.597	5.23e-06	-0.048315	163	0.01051	yes	WHLBLD
chr1_1937273_T_C_b38	SLC35E2	-4.594	5.29e-06	-0.050664	120	0.011027	yes	WHLBLD
chr1_1942260_G_C_b38	SLC35E2	-4.593	5.33e-06	-0.050013	128	0.010889	yes	WHLBLD
chr1_1750440_G_A_b38	SLC35E2	-4.576	5.76e-06	-0.055254	93	0.012074	yes	WHLBLD
chr1_1748780_G_A_b38	SLC35E2	-4.553	6.4e-06	-0.050102	157	0.011003	yes	WHLBLD
chr1_1940973_C_T_b38	SLC35E2	-4.533	7.03e-06	-0.049335	130	0.010884	yes	WHLBLD
chr1_1744028_A_AC_b38	SLC35E2	-4.52	7.45e-06	-0.063455	27	0.014039	yes	WHLBLD
chr1_1747695_A_G_b38	SLC35E2	-4.498	8.23e-06	-0.042503	153	0.009449	yes	WHLBLD
chr1_1981144_T_G_b38	SLC35E2	4.49	8.56e-06	0.055646	43	0.012394	yes	WHLBLD
chr1_1922670_A_G_b38	SLC35E2	-4.487	8.65e-06	-0.049452	123	0.011021	yes	WHLBLD
chr1_1933087_C_T_b38	SLC35E2	-4.486	8.69e-06	-0.049174	122	0.010961	yes	WHLBLD
chr1_1933859_A_G_b38	SLC35E2	-4.486	8.69e-06	-0.049174	122	0.010961	yes	WHLBLD
chr1_1606099_G_GGTCAGGCGAGGGGTC_b38	SLC35E2	4.486	8.7e-06	0.053626	60	0.011954	yes	WHLBLD
chr1_1676287_C_T_b38	SLC35E2	-4.474	9.18e-06	-0.060364	20	0.013492	yes	WHLBLD
chr1_1779667_T_TTG_b38	SLC35E2	4.467	9.46e-06	0.053206	75	0.01191	yes	WHLBLD
chr1_1928648_C_T_b38	SLC35E2	-4.465	9.56e-06	-0.049146	123	0.011006	yes	WHLBLD
chr1_1936627_C_G_b38	SLC35E2	-4.462	9.69e-06	-0.049353	121	0.01106	yes	WHLBLD
chr1_1744096_C_T_b38	SLC35E2	-4.457	9.94e-06	-0.070087	72	0.015726	yes	WHLBLD
chr1_1848037_C_CTA_b38	SLC35E2	4.453	1.01e-05	0.048569	124	0.010908	yes	WHLBLD
chr1_1756186_T_C_b38	SLC35E2	4.449	1.03e-05	0.048802	106	0.010968	yes	WHLBLD
chr1_1586962_C_T_b38	SLC35E2	4.433	1.11e-05	0.051929	76	0.011715	yes	WHLBLD
chr1_1987547_C_CT_b38	SLC35E2	4.426	1.14e-05	0.050657	124	0.011445	yes	WHLBLD
chr1_1752126_G_A_b38	SLC35E2	4.4	1.28e-05	0.052105	79	0.011842	yes	WHLBLD
chr1_1708474_C_A_b38	SLC35E2	-4.391	1.34e-05	-0.060547	25	0.01379	yes	WHLBLD
chr1_1744121_A_C_b38	SLC35E2	-4.375	1.44e-05	-0.068023	74	0.01555	yes	WHLBLD
chr1_1844830_C_A_b38	SLC35E2	4.367	1.48e-05	0.047626	122	0.010905	yes	WHLBLD
chr1_1743565_AT_A_b38	SLC35E2	4.359	1.53e-05	0.043653	159	0.010013	yes	WHLBLD
chr1_1729859_A_G_b38	SLC35E2	4.351	1.6e-05	0.059798	24	0.013744	yes	WHLBLD
chr1_1820337_A_G_b38	SLC35E2	4.335	1.71e-05	0.046548	132	0.010737	yes	WHLBLD
chr1_1748597_C_G_b38	SLC35E2	-4.323	1.8e-05	-0.048922	140	0.011316	yes	WHLBLD
chr1_1918989_A_G_b38	SLC35E2	-4.321	1.82e-05	-0.046926	128	0.010859	yes	WHLBLD
chr1_1921745_T_C_b38	SLC35E2	-4.318	1.84e-05	-0.047348	122	0.010965	yes	WHLBLD
chr1_1679100_A_G_b38	SLC35E2	-4.303	1.96e-05	-0.046388	116	0.01078	yes	WHLBLD
chr1_1637577_T_C_b38	SLC35E2	-4.293	2.05e-05	-0.050815	49	0.011836	yes	WHLBLD
chr1_1989523_T_C_b38	SLC35E2	4.292	2.06e-05	0.04753	110	0.011073	yes	WHLBLD
chr1_1747472_A_T_b38	SLC35E2	-4.286	2.12e-05	-0.048582	138	0.011335	yes	WHLBLD
chr1_1866635_T_TA_b38	SLC35E2	4.279	2.18e-05	0.050968	81	0.01191	yes	WHLBLD
chr1_1945842_A_AAAAGAAC_b38	SLC35E2	-4.273	2.24e-05	-0.049112	102	0.011493	yes	WHLBLD
chr1_1931587_A_G_b38	SLC35E2	-4.259	2.38e-05	-0.046869	125	0.011005	yes	WHLBLD
chr1_1750428_G_C_b38	SLC35E2	-4.25	2.48e-05	-0.051631	95	0.01215	yes	WHLBLD
chr1_1743544_CA_C_b38	SLC35E2	4.249	2.49e-05	0.043649	141	0.010273	yes	WHLBLD
chr1_1697979_G_A_b38	SLC35E2	-4.242	2.56e-05	-0.069505	7	0.016384	yes	WHLBLD
chr1_1649993_A_G_b38	SLC35E2	-4.202	3.05e-05	-0.04519	155	0.010755	yes	WHLBLD
chr1_1760882_T_C_b38	SLC35E2	4.195	3.14e-05	0.045191	129	0.010772	yes	WHLBLD
chr1_1931580_CA_C_b38	SLC35E2	-4.192	3.18e-05	-0.046224	124	0.011027	yes	WHLBLD
chr1_1639685_G_A_b38	SLC35E2	-4.191	3.19e-05	-0.052911	41	0.012624	yes	WHLBLD
chr1_1985619_A_G_b38	SLC35E2	4.19	3.21e-05	0.047366	91	0.011304	yes	WHLBLD
chr1_1595028_C_CAG_b38	SLC35E2	4.178	3.37e-05	0.051531	49	0.012333	yes	WHLBLD
chr1_1978114_T_A_b38	SLC35E2	4.176	3.41e-05	0.047511	71	0.011378	yes	WHLBLD
chr1_1650383_G_T_b38	SLC35E2	-4.174	3.44e-05	-0.051218	54	0.012272	yes	WHLBLD
chr1_1723766_C_T_b38	SLC35E2	-4.156	3.71e-05	-0.060501	30	0.014557	yes	WHLBLD
chr1_1865278_A_C_b38	SLC35E2	4.156	3.72e-05	0.045195	115	0.010876	yes	WHLBLD
chr1_1606532_GTGGGCTGGGCTGGTCAGGCA_G_b38	SLC35E2	4.15	3.8e-05	0.046945	64	0.011311	yes	WHLBLD
chr1_1976566_T_C_b38	SLC35E2	4.14	3.98e-05	0.043331	132	0.010467	yes	WHLBLD
chr1_1762759_AAATG_A_b38	SLC35E2	4.134	4.07e-05	0.044562	125	0.01078	yes	WHLBLD
chr1_1960609_G_C_b38	SLC35E2	-4.106	4.59e-05	-0.044615	115	0.010867	yes	WHLBLD
chr1_1781909_C_T_b38	SLC35E2	4.104	4.63e-05	0.044424	125	0.010825	yes	WHLBLD
chr1_1978404_C_T_b38	SLC35E2	4.103	4.64e-05	0.046484	71	0.011328	yes	WHLBLD
chr1_1978415_G_A_b38	SLC35E2	4.103	4.64e-05	0.046484	71	0.011328	yes	WHLBLD
chr1_1976646_A_G_b38	SLC35E2	4.098	4.74e-05	0.04656	70	0.011362	yes	WHLBLD
chr1_1978055_C_T_b38	SLC35E2	4.093	4.85e-05	0.046351	71	0.011326	yes	WHLBLD
chr1_1978562_C_G_b38	SLC35E2	4.085	5.01e-05	0.045973	73	0.011254	yes	WHLBLD
chr1_1978573_T_C_b38	SLC35E2	4.085	5.01e-05	0.045973	73	0.011254	yes	WHLBLD
chr1_1978797_T_C_b38	SLC35E2	4.085	5.01e-05	0.045973	73	0.011254	yes	WHLBLD
chr1_1982826_T_C_b38	SLC35E2	4.085	5.01e-05	0.045987	73	0.011258	yes	WHLBLD
chr1_1977765_A_G_b38	SLC35E2	4.08	5.11e-05	0.046178	71	0.011318	yes	WHLBLD
chr1_1978647_G_T_b38	SLC35E2	4.08	5.11e-05	0.046178	71	0.011318	yes	WHLBLD
chr1_1980953_G_A_b38	SLC35E2	4.08	5.11e-05	0.046178	71	0.011318	yes	WHLBLD
chr1_1976473_C_T_b38	SLC35E2	4.078	5.15e-05	0.046181	71	0.011323	yes	WHLBLD
chr1_1976573_T_C_b38	SLC35E2	4.078	5.15e-05	0.046181	71	0.011323	yes	WHLBLD
chr1_1976661_G_T_b38	SLC35E2	4.078	5.15e-05	0.046181	71	0.011323	yes	WHLBLD
chr1_1976946_C_T_b38	SLC35E2	4.078	5.15e-05	0.046181	71	0.011323	yes	WHLBLD
chr1_1977264_C_G_b38	SLC35E2	4.078	5.15e-05	0.046181	71	0.011323	yes	WHLBLD
chr1_1708521_C_G_b38	SLC35E2	-4.073	5.25e-05	-0.050184	50	0.01232	yes	WHLBLD
chr1_1942186_G_A_b38	SLC35E2	4.069	5.35e-05	0.050879	36	0.012504	yes	WHLBLD
chr1_1672155_G_A_b38	SLC35E2	-4.065	5.45e-05	-0.048263	55	0.011873	yes	WHLBLD
chr1_1986211_T_C_b38	SLC35E2	4.061	5.54e-05	0.046125	70	0.011359	yes	WHLBLD
chr1_1944182_G_C_b38	SLC35E2	-4.059	5.57e-05	-0.045594	142	0.011232	yes	WHLBLD
chr1_1977879_G_A_b38	SLC35E2	4.059	5.59e-05	0.045724	72	0.011266	yes	WHLBLD
chr1_1945975_TG_T_b38	SLC35E2	-4.058	5.61e-05	-0.045818	140	0.011292	yes	WHLBLD
chr1_1650664_CT_C_b38	SLC35E2	4.058	5.61e-05	0.053362	54	0.013151	yes	WHLBLD
chr1_1755713_G_A_b38	SLC35E2	-4.058	5.61e-05	-0.044849	126	0.011053	yes	WHLBLD
chr1_1970506_T_A_b38	SLC35E2	-4.052	5.75e-05	-0.043525	114	0.010741	yes	WHLBLD
chr1_1944216_C_T_b38	SLC35E2	-4.049	5.83e-05	-0.045505	140	0.01124	yes	WHLBLD
chr1_1641275_A_G_b38	SLC35E2	-4.046	5.9e-05	-0.048525	80	0.011994	yes	WHLBLD
chr1_1946632_C_T_b38	SLC35E2	-4.027	6.38e-05	-0.045388	142	0.011271	yes	WHLBLD
chr1_1972273_C_A_b38	SLC35E2	4.024	6.46e-05	0.046049	67	0.011444	yes	WHLBLD
chr1_1946058_T_C_b38	SLC35E2	-4.024	6.46e-05	-0.045323	142	0.011264	yes	WHLBLD
chr1_1978006_A_G_b38	SLC35E2	4.018	6.61e-05	0.045325	72	0.01128	yes	WHLBLD
chr1_1986010_T_G_b38	SLC35E2	4.011	6.82e-05	0.045297	72	0.011294	yes	WHLBLD
chr1_1984586_G_A_b38	SLC35E2	4.01	6.83e-05	0.045306	72	0.011298	yes	WHLBLD
chr1_1981319_G_C_b38	SLC35E2	4.005	6.97e-05	0.045501	70	0.01136	yes	WHLBLD
chr1_1986033_G_A_b38	SLC35E2	4.005	6.97e-05	0.045501	70	0.01136	yes	WHLBLD
chr1_1986176_A_T_b38	SLC35E2	4.005	6.97e-05	0.045501	70	0.01136	yes	WHLBLD
chr1_1986390_T_G_b38	SLC35E2	4.005	6.97e-05	0.045501	70	0.01136	yes	WHLBLD
chr1_1986469_A_C_b38	SLC35E2	4.005	6.97e-05	0.045501	70	0.01136	yes	WHLBLD
chr1_1987096_A_T_b38	SLC35E2	4.005	6.97e-05	0.045501	70	0.01136	yes	WHLBLD
chr1_1987156_G_A_b38	SLC35E2	4.005	6.97e-05	0.045501	70	0.01136	yes	WHLBLD
chr1_1983166_A_T_b38	SLC35E2	4.005	6.98e-05	0.045509	70	0.011363	yes	WHLBLD
chr1_1983956_TGG_T_b38	SLC35E2	4.005	6.98e-05	0.045509	70	0.011363	yes	WHLBLD
chr1_1984595_C_T_b38	SLC35E2	4.005	6.98e-05	0.045509	70	0.011363	yes	WHLBLD
chr1_1984859_C_T_b38	SLC35E2	4.005	6.98e-05	0.045509	70	0.011363	yes	WHLBLD
chr1_1985148_G_T_b38	SLC35E2	4.005	6.98e-05	0.045509	70	0.011363	yes	WHLBLD
chr1_1978262_C_T_b38	SLC35E2	4	7.13e-05	0.045089	73	0.011272	yes	WHLBLD
chr1_1978294_G_T_b38	SLC35E2	4	7.13e-05	0.045089	73	0.011272	yes	WHLBLD
chr1_1944074_T_C_b38	SLC35E2	-3.986	7.55e-05	-0.044923	142	0.01127	yes	WHLBLD
chr1_1944091_G_C_b38	SLC35E2	-3.986	7.55e-05	-0.044923	142	0.01127	yes	WHLBLD
chr1_1978429_G_A_b38	SLC35E2	3.983	7.65e-05	0.047613	48	0.011954	yes	WHLBLD
chr1_1945121_T_C_b38	SLC35E2	-3.979	7.78e-05	-0.044724	144	0.011241	yes	WHLBLD
chr1_1936906_C_CA_b38	SLC35E2	-3.97	8.05e-05	-0.050231	75	0.012652	yes	WHLBLD
chr1_1944675_C_T_b38	SLC35E2	-3.957	8.5e-05	-0.04468	142	0.011291	yes	WHLBLD
chr1_1985090_C_T_b38	SLC35E2	3.957	8.51e-05	0.04499	98	0.011371	yes	WHLBLD
chr1_1976600_C_T_b38	SLC35E2	3.955	8.57e-05	0.044758	71	0.011317	yes	WHLBLD
chr1_1749637_G_T_b38	SLC35E2	3.948	8.8e-05	0.042578	112	0.010784	yes	WHLBLD
chr1_1983507_C_T_b38	SLC35E2	3.948	8.83e-05	0.04705	48	0.011918	yes	WHLBLD
chr1_1750528_G_A_b38	SLC35E2	-3.944	8.96e-05	-0.039328	142	0.009972	yes	WHLBLD
chr1_1971127_G_A_b38	SLC35E2	3.94	9.12e-05	0.047663	44	0.012099	yes	WHLBLD
chr1_1976990_T_C_b38	SLC35E2	3.935	9.31e-05	0.044441	73	0.011295	yes	WHLBLD
chr1_1944419_C_G_b38	SLC35E2	-3.922	9.79e-05	-0.044061	144	0.011234	yes	WHLBLD
chr1_1971864_C_T_b38	SLC35E2	3.917	1e-04	0.040993	121	0.010466	yes	WHLBLD
chr1_1947189_C_T_b38	SLC35E2	-3.913	0.000102	-0.04408	142	0.011265	yes	WHLBLD
chr1_1944420_A_G_b38	SLC35E2	-3.912	0.000102	-0.043663	146	0.011161	yes	WHLBLD
chr1_1946013_C_T_b38	SLC35E2	-3.91	0.000103	-0.044109	140	0.011281	yes	WHLBLD
chr1_1984601_T_C_b38	SLC35E2	3.908	0.000103	0.044332	72	0.011343	yes	WHLBLD
chr1_1913504_CT_C_b38	SLC35E2	-3.906	0.000105	-0.048066	111	0.012307	yes	WHLBLD
chr1_1985451_C_T_b38	SLC35E2	3.898	0.000108	0.044206	99	0.01134	yes	WHLBLD
chr1_1948919_T_TCCTTCCCTCCTCTTTCCCTCCCTTCTTTCCTTCCCTTTCCCTCCCTC_b38	SLC35E2	-3.898	0.000108	-0.038322	128	0.009831	yes	WHLBLD
chr1_1969015_A_G_b38	SLC35E2	3.885	0.000114	0.044423	144	0.011433	yes	WHLBLD
chr1_1971434_C_T_b38	SLC35E2	3.88	0.000116	0.046822	45	0.012068	yes	WHLBLD
chr1_1971027_A_C_b38	SLC35E2	3.86	0.000126	0.046661	44	0.012089	yes	WHLBLD
chr1_1758323_T_C_b38	SLC35E2	3.857	0.000127	0.041844	118	0.010849	yes	WHLBLD
chr1_1881428_C_CT_b38	SLC35E2	-3.856	0.000128	-0.043852	139	0.011371	yes	WHLBLD
chr1_1971123_A_G_b38	SLC35E2	3.85	0.000131	0.046226	46	0.012006	yes	WHLBLD
chr1_1948515_C_T_b38	SLC35E2	-3.842	0.000135	-0.042473	152	0.011056	yes	WHLBLD
chr1_1948519_T_C_b38	SLC35E2	-3.842	0.000135	-0.042473	152	0.011056	yes	WHLBLD
chr1_1935938_T_C_b38	SLC35E2	-3.84	0.000136	-0.043263	105	0.011266	yes	WHLBLD
chr1_1881082_C_T_b38	SLC35E2	-3.834	0.00014	-0.043256	145	0.011283	yes	WHLBLD
chr1_1947648_G_A_b38	SLC35E2	3.83	0.000142	0.047816	35	0.012486	yes	WHLBLD
chr1_1913643_T_C_b38	SLC35E2	-3.82	0.000147	-0.044078	129	0.011539	yes	WHLBLD
chr1_1641261_C_T_b38	SLC35E2	-3.82	0.000148	-0.051825	31	0.013568	yes	WHLBLD
chr1_1942887_C_G_b38	SLC35E2	-3.81	0.000154	-0.042786	143	0.011231	yes	WHLBLD
chr1_1881249_A_G_b38	SLC35E2	-3.803	0.000158	-0.042961	145	0.011297	yes	WHLBLD
chr1_1606094_G_GAGGGGTC_b38	SLC35E2	3.797	0.000161	0.048538	48	0.012782	yes	WHLBLD
chr1_1843381_A_T_b38	SLC35E2	-3.794	0.000163	-0.04298	144	0.011328	yes	WHLBLD
chr1_1847030_A_G_b38	SLC35E2	-3.779	0.000173	-0.042814	143	0.01133	yes	WHLBLD
chr1_1850017_G_T_b38	SLC35E2	-3.779	0.000173	-0.042814	143	0.01133	yes	WHLBLD
chr1_1937895_C_T_b38	SLC35E2	-3.769	0.00018	-0.042446	142	0.011261	yes	WHLBLD
chr1_1886800_G_A_b38	SLC35E2	-3.769	0.00018	-0.042513	146	0.011281	yes	WHLBLD
chr1_1891654_C_CAGAG_b38	SLC35E2	-3.769	0.00018	-0.042513	146	0.011281	yes	WHLBLD
chr1_1938125_TCA_T_b38	SLC35E2	-3.765	0.000183	-0.042107	141	0.011184	yes	WHLBLD
chr1_1981062_A_G_b38	SLC35E2	3.762	0.000185	0.042811	77	0.011378	yes	WHLBLD
chr1_1981291_A_G_b38	SLC35E2	3.762	0.000185	0.042811	77	0.011378	yes	WHLBLD
chr1_1981295_T_C_b38	SLC35E2	3.762	0.000185	0.042811	77	0.011378	yes	WHLBLD
chr1_1866508_A_G_b38	SLC35E2	-3.746	0.000197	-0.042265	146	0.011284	yes	WHLBLD
chr1_1879567_T_C_b38	SLC35E2	-3.746	0.000197	-0.042265	146	0.011284	yes	WHLBLD
chr1_1702383_T_C_b38	SLC35E2	-3.741	0.000201	-0.048273	39	0.012902	yes	WHLBLD
chr1_1831318_C_T_b38	SLC35E2	-3.736	0.000205	-0.042296	142	0.011321	yes	WHLBLD
chr1_1987145_C_T_b38	SLC35E2	3.726	0.000213	0.042289	75	0.011348	yes	WHLBLD
chr1_1914345_C_T_b38	SLC35E2	-3.723	0.000216	-0.0424	142	0.011389	yes	WHLBLD
chr1_1914918_G_A_b38	SLC35E2	-3.723	0.000216	-0.0424	142	0.011389	yes	WHLBLD
chr1_1937802_G_T_b38	SLC35E2	-3.706	0.000231	-0.042417	139	0.011447	yes	WHLBLD
chr1_1770997_G_A_b38	SLC35E2	-3.704	0.000232	-0.041464	146	0.011195	yes	WHLBLD
chr1_1967499_G_A_b38	SLC35E2	3.703	0.000233	0.04066	114	0.010981	yes	WHLBLD
chr1_1983048_A_G_b38	SLC35E2	3.699	0.000236	0.042187	101	0.011405	yes	WHLBLD
chr1_1920695_A_G_b38	SLC35E2	-3.697	0.000238	-0.042056	143	0.011377	yes	WHLBLD
chr1_1924788_C_T_b38	SLC35E2	-3.697	0.000238	-0.042056	143	0.011377	yes	WHLBLD
chr1_1925233_T_C_b38	SLC35E2	-3.696	0.000239	-0.04205	143	0.011376	yes	WHLBLD
chr1_1930143_C_T_b38	SLC35E2	-3.696	0.000239	-0.041999	143	0.011362	yes	WHLBLD
chr1_1846009_AGG_A_b38	SLC35E2	-3.685	0.00025	-0.04165	147	0.011303	yes	WHLBLD
chr1_1846011_G_GTCC_b38	SLC35E2	-3.685	0.00025	-0.04165	147	0.011303	yes	WHLBLD
chr1_1921333_C_T_b38	SLC35E2	-3.684	0.00025	-0.041457	145	0.011253	yes	WHLBLD
chr1_1976870_C_CAG_b38	SLC35E2	3.676	0.000258	0.041072	71	0.011173	yes	WHLBLD
chr1_1916217_C_T_b38	SLC35E2	-3.666	0.000268	-0.041636	143	0.011358	yes	WHLBLD
chr1_1915326_G_A_b38	SLC35E2	-3.666	0.000269	-0.041689	143	0.011373	yes	WHLBLD
chr1_1991213_T_C_b38	SLC35E2	3.657	0.000278	0.040847	107	0.011171	yes	WHLBLD
chr1_1925281_C_T_b38	SLC35E2	-3.656	0.000279	-0.041659	142	0.011396	yes	WHLBLD
chr1_1918090_A_G_b38	SLC35E2	-3.654	0.000281	-0.0416	142	0.011384	yes	WHLBLD
chr1_1860718_A_C_b38	SLC35E2	-3.653	0.000282	-0.041059	150	0.01124	yes	WHLBLD
chr1_1797530_C_A_b38	SLC35E2	-3.644	0.000292	-0.041017	142	0.011256	yes	WHLBLD
chr1_1827774_A_G_b38	SLC35E2	-3.642	0.000294	-0.041147	145	0.011298	yes	WHLBLD
chr1_1929904_C_T_b38	SLC35E2	-3.64	0.000296	-0.041384	143	0.01137	yes	WHLBLD
chr1_1931743_CA_C_b38	SLC35E2	-3.631	0.000306	-0.048245	52	0.013286	yes	WHLBLD
chr1_1771864_G_A_b38	SLC35E2	-3.631	0.000307	-0.040864	146	0.011255	yes	WHLBLD
chr1_1772426_T_A_b38	SLC35E2	-3.631	0.000307	-0.040864	146	0.011255	yes	WHLBLD
chr1_1773848_A_C_b38	SLC35E2	-3.628	0.00031	-0.040894	145	0.011273	yes	WHLBLD
chr1_1817295_T_C_b38	SLC35E2	-3.628	0.00031	-0.040894	145	0.011273	yes	WHLBLD
chr1_1991690_A_G_b38	SLC35E2	3.625	0.000314	0.038941	119	0.010744	yes	WHLBLD
chr1_1776461_GAAAC_G_b38	SLC35E2	-3.613	0.000328	-0.040741	144	0.011277	yes	WHLBLD
chr1_1777362_A_G_b38	SLC35E2	-3.613	0.000328	-0.040741	144	0.011277	yes	WHLBLD
chr1_1808816_G_T_b38	SLC35E2	-3.613	0.000328	-0.040741	144	0.011277	yes	WHLBLD
chr1_1819825_G_A_b38	SLC35E2	-3.613	0.000328	-0.040741	144	0.011277	yes	WHLBLD
chr1_1772410_T_C_b38	SLC35E2	-3.604	0.00034	-0.040501	146	0.011239	yes	WHLBLD
chr1_1790040_C_T_b38	SLC35E2	-3.602	0.000342	-0.04064	144	0.011283	yes	WHLBLD
chr1_1773460_G_A_b38	SLC35E2	-3.599	0.000345	-0.040447	144	0.011237	yes	WHLBLD
chr1_1773476_C_G_b38	SLC35E2	-3.599	0.000345	-0.040447	144	0.011237	yes	WHLBLD
chr1_1947645_C_T_b38	SLC35E2	-3.596	0.00035	-0.041138	134	0.011439	yes	WHLBLD
chr1_1764887_C_A_b38	SLC35E2	-3.596	0.00035	-0.04052	144	0.011269	yes	WHLBLD
chr1_1909238_G_A_b38	SLC35E2	-3.593	0.000354	-0.041022	146	0.011417	yes	WHLBLD
chr1_1938467_C_T_b38	SLC35E2	3.592	0.000355	0.04481	36	0.012474	yes	WHLBLD
chr1_1766653_A_G_b38	SLC35E2	-3.59	0.000358	-0.040469	145	0.011272	yes	WHLBLD
chr1_1935987_G_A_b38	SLC35E2	-3.589	0.000359	-0.040461	146	0.011274	yes	WHLBLD
chr1_1836126_C_A_b38	SLC35E2	-3.576	0.000376	-0.039145	150	0.010945	yes	WHLBLD
chr1_1927857_T_C_b38	SLC35E2	-3.575	0.000379	-0.040657	143	0.011373	yes	WHLBLD
chr1_1638879_C_T_b38	SLC35E2	-3.571	0.000384	-0.044547	45	0.012475	yes	WHLBLD
chr1_1736729_G_T_b38	SLC35E2	3.568	0.000389	0.037902	172	0.010623	yes	WHLBLD
chr1_1773713_T_A_b38	SLC35E2	-3.55	0.000416	-0.041105	79	0.011579	yes	WHLBLD
chr1_1688328_C_T_b38	SLC35E2	-3.549	0.000417	-0.044915	34	0.012655	yes	WHLBLD
chr1_1969479_G_A_b38	SLC35E2	3.548	0.000419	0.044973	32	0.012676	yes	WHLBLD
chr1_1791493_C_T_b38	SLC35E2	-3.547	0.000421	-0.040106	142	0.011308	yes	WHLBLD
chr1_1791592_G_A_b38	SLC35E2	-3.547	0.000421	-0.040106	142	0.011308	yes	WHLBLD
chr1_1684789_C_CAAAA_b38	SLC35E2	3.543	0.000427	0.077415	13	0.021852	yes	WHLBLD
chr1_1909234_G_A_b38	SLC35E2	-3.537	0.000436	-0.040459	145	0.011438	yes	WHLBLD
chr1_1851414_GA_G_b38	SLC35E2	-3.532	0.000443	-0.042627	77	0.012067	yes	WHLBLD
chr1_1662855_T_C_b38	SLC35E2	-3.516	0.000471	-0.061329	39	0.017441	yes	WHLBLD
chr1_1990864_C_T_b38	SLC35E2	3.516	0.000472	0.038993	115	0.011091	yes	WHLBLD
chr1_1952823_TA_T_b38	SLC35E2	-3.511	0.00048	-0.040161	136	0.011438	yes	WHLBLD
chr1_1963538_T_C_b38	SLC35E2	3.51	0.000481	0.038725	111	0.011031	yes	WHLBLD
chr1_1929713_G_A_b38	SLC35E2	3.508	0.000485	0.043524	38	0.012407	yes	WHLBLD
chr1_1769969_CAAAACAAAAACA_C_b38	SLC35E2	-3.503	0.000494	-0.039065	151	0.011152	yes	WHLBLD
chr1_1722626_AGCG_A_b38	SLC35E2	3.494	0.000511	0.047321	56	0.013544	yes	WHLBLD
chr1_1725582_T_C_b38	SLC35E2	3.493	0.000512	0.034188	155	0.009787	yes	WHLBLD
chr1_1584321_T_C_b38	SLC35E2	-3.488	0.000523	-0.038491	105	0.011036	yes	WHLBLD
chr1_1739519_C_G_b38	SLC35E2	3.483	0.000531	0.046237	46	0.013274	yes	WHLBLD
chr1_1762287_A_G_b38	SLC35E2	-3.476	0.000546	-0.039315	147	0.011311	yes	WHLBLD
chr1_1722625_A_T_b38	SLC35E2	3.475	0.000548	0.047076	56	0.013548	yes	WHLBLD
chr1_1983989_A_AT_b38	SLC35E2	3.454	0.000591	0.042503	45	0.012305	yes	WHLBLD
chr1_1905586_C_T_b38	SLC35E2	-3.454	0.000591	-0.039581	141	0.011459	yes	WHLBLD
chr1_1792927_G_A_b38	SLC35E2	-3.444	0.000613	-0.038884	142	0.01129	yes	WHLBLD
chr1_1624323_AT_A_b38	SLC35E2	3.441	0.000619	0.038582	101	0.011212	yes	WHLBLD
chr1_1836856_CT_C_b38	SLC35E2	3.441	0.000621	0.047601	27	0.013835	yes	WHLBLD
chr1_1722619_C_T_b38	SLC35E2	3.438	0.000627	0.046764	57	0.013602	yes	WHLBLD
chr1_1951498_C_T_b38	SLC35E2	3.435	0.000634	0.041464	46	0.012072	yes	WHLBLD
chr1_1948938_C_T_b38	SLC35E2	-3.435	0.000635	-0.033912	130	0.009874	yes	WHLBLD
chr1_1671724_C_T_b38	SLC35E2	-3.431	0.000643	-0.041812	46	0.012186	yes	WHLBLD
chr1_1950071_C_A_b38	SLC35E2	3.43	0.000646	0.040971	48	0.011946	yes	WHLBLD
chr1_1963533_C_CA_b38	SLC35E2	3.421	0.000667	0.037855	115	0.011066	yes	WHLBLD
chr1_1875208_T_C_b38	SLC35E2	-3.42	0.000668	-0.038677	146	0.011307	yes	WHLBLD
chr1_1927692_C_T_b38	SLC35E2	3.416	0.000679	0.042565	37	0.012462	yes	WHLBLD
chr1_1915022_C_T_b38	SLC35E2	3.412	0.000689	0.041677	43	0.012215	yes	WHLBLD
chr1_1901386_C_A_b38	SLC35E2	-3.408	0.000698	-0.038978	144	0.011437	yes	WHLBLD
chr1_1912607_C_T_b38	SLC35E2	-3.4	0.000717	-0.039047	137	0.011483	yes	WHLBLD
chr1_1950071_C_T_b38	SLC35E2	-3.4	0.000719	-0.039124	136	0.011507	yes	WHLBLD
chr1_1952064_G_A_b38	SLC35E2	-3.4	0.000719	-0.039124	136	0.011507	yes	WHLBLD
chr1_1901262_C_T_b38	SLC35E2	-3.393	0.000738	-0.038707	144	0.011409	yes	WHLBLD
chr1_1738295_G_T_b38	SLC35E2	3.392	0.000741	0.035943	174	0.010598	yes	WHLBLD
chr1_1951106_G_A_b38	SLC35E2	-3.381	0.000769	-0.038912	137	0.011508	yes	WHLBLD
chr1_1951865_G_GT_b38	SLC35E2	-3.376	0.000783	-0.038864	137	0.011512	yes	WHLBLD
chr1_1919188_CAGCGGCAGG_C_b38	SLC35E2	-3.358	0.000836	-0.037842	140	0.011271	yes	WHLBLD
chr1_1921849_G_T_b38	SLC35E2	3.356	0.000842	0.040736	52	0.01214	yes	WHLBLD
chr1_1899573_C_T_b38	SLC35E2	-3.351	0.000857	-0.038395	143	0.011459	yes	WHLBLD
chr1_1968793_T_C_b38	SLC35E2	3.339	0.000893	0.037034	117	0.011091	yes	WHLBLD
chr1_1732892_CT_C_b38	SLC35E2	3.328	0.00093	0.049423	15	0.014852	yes	WHLBLD
chr1_1619986_T_C_b38	SLC35E2	3.322	0.000948	0.040261	57	0.012119	yes	WHLBLD
chr1_1924264_CCG_C_b38	SLC35E2	-3.321	0.000953	-0.034739	157	0.010461	yes	WHLBLD
chr1_1968012_GTGAA_G_b38	SLC35E2	3.29	0.00106	0.040429	40	0.012288	yes	WHLBLD
chr1_1776772_TAA_T_b38	SLC35E2	-3.285	0.00108	-0.040377	66	0.012291	yes	WHLBLD
chr1_1880596_T_A_b38	SLC35E2	-3.277	0.00111	-0.03723	132	0.011361	yes	WHLBLD
chr1_1991835_C_T_b38	SLC35E2	3.275	0.00112	0.037348	100	0.011403	yes	WHLBLD
chr1_1925307_C_A_b38	SLC35E2	-3.275	0.00112	-0.037751	136	0.011527	yes	WHLBLD
chr1_1731904_CA_C_b38	SLC35E2	3.274	0.00112	0.040865	55	0.01248	yes	WHLBLD
chr1_1606089_GGC_G_b38	SLC35E2	3.261	0.00117	0.041778	49	0.012811	yes	WHLBLD
chr1_1662738_CT_C_b38	SLC35E2	-3.259	0.00118	-0.057656	38	0.017693	yes	WHLBLD
chr1_1597128_C_CCCTCAGCTGGACT_b38	SLC35E2	-3.256	0.00119	-0.034925	103	0.010725	yes	WHLBLD
chr1_1924208_G_A_b38	SLC35E2	3.253	0.00121	0.039751	60	0.01222	yes	WHLBLD
chr1_1962845_T_C_b38	SLC35E2	3.247	0.00123	0.039995	39	0.012319	yes	WHLBLD
chr1_1738606_C_T_b38	SLC35E2	3.231	0.0013	0.0407	73	0.012596	yes	WHLBLD
chr1_1743712_G_A_b38	SLC35E2	3.222	0.00134	0.062419	7	0.019376	yes	WHLBLD
chr1_1924269_C_T_b38	SLC35E2	-3.213	0.00139	-0.033355	158	0.010383	yes	WHLBLD
chr1_1993107_C_A_b38	SLC35E2	3.205	0.00142	0.034474	164	0.010754	yes	WHLBLD
chr1_1993108_C_G_b38	SLC35E2	3.205	0.00142	0.034474	164	0.010754	yes	WHLBLD
chr1_1924659_C_T_b38	SLC35E2	3.187	0.00151	0.03853	51	0.012091	yes	WHLBLD
chr1_1891444_CG_C_b38	SLC35E2	-3.186	0.00152	-0.036235	136	0.011372	yes	WHLBLD
chr1_1902439_C_T_b38	SLC35E2	-3.178	0.00156	-0.036473	144	0.011476	yes	WHLBLD
chr1_1864334_AAAG_A_b38	SLC35E2	-3.174	0.00158	-0.042908	42	0.013517	yes	WHLBLD
chr1_1737504_A_C_b38	SLC35E2	3.172	0.00159	0.033323	179	0.010505	yes	WHLBLD
chr1_1902481_G_A_b38	SLC35E2	-3.164	0.00164	-0.036294	143	0.011471	yes	WHLBLD
chr1_1617375_T_C_b38	SLC35E2	3.158	0.00167	0.036839	71	0.011664	yes	WHLBLD
chr1_1618213_C_G_b38	SLC35E2	3.158	0.00167	0.036839	71	0.011664	yes	WHLBLD
chr1_1618290_G_C_b38	SLC35E2	3.158	0.00167	0.036839	71	0.011664	yes	WHLBLD
chr1_1590682_T_C_b38	SLC35E2	-3.149	0.00172	-0.036223	83	0.011503	yes	WHLBLD
chr1_1891450_G_C_b38	SLC35E2	-3.119	0.0019	-0.03539	137	0.011348	yes	WHLBLD
chr1_1798925_C_CT_b38	SLC35E2	-3.1	0.00203	-0.036843	58	0.011885	yes	WHLBLD
chr1_1902318_T_TA_b38	SLC35E2	-3.079	0.00218	-0.040565	58	0.013177	yes	WHLBLD
chr1_972790_C_G_b38	SLC35E2	-3.066	0.00226	-0.070804	17	0.02309	yes	WHLBLD
chr1_1688586_C_T_b38	SLC35E2	-3.066	0.00227	-0.042316	40	0.013801	yes	WHLBLD
chr1_1657085_C_CTAA_b38	SLC35E2	-3.065	0.00227	-0.0412	50	0.01344	yes	WHLBLD
chr1_1991761_T_C_b38	SLC35E2	3.057	0.00234	0.033557	102	0.010978	yes	WHLBLD
chr1_1955080_C_CGGCTCACACCGGAAGTGAGGCTCACACCGGAAGTGA_b38	SLC35E2	-3.042	0.00245	-0.034848	121	0.011456	yes	WHLBLD
chr1_1679993_A_G_b38	SLC35E2	-3.021	0.00263	-0.032854	149	0.010875	yes	WHLBLD
chr1_1680672_C_T_b38	SLC35E2	-3.009	0.00273	-0.034267	116	0.011389	yes	WHLBLD
chr1_2500892_C_A_b38	SLC35E2	3.006	0.00276	0.032567	125	0.010835	yes	WHLBLD
chr1_1627515_C_T_b38	SLC35E2	3.005	0.00277	0.033263	134	0.011069	yes	WHLBLD
chr1_1688442_T_C_b38	SLC35E2	-3.001	0.00281	-0.039195	52	0.013063	yes	WHLBLD
chr1_1624086_G_A_b38	SLC35E2	-2.999	0.00282	-0.033534	113	0.011181	yes	WHLBLD
chr1_2427812_G_T_b38	SLC35E2	-2.987	0.00293	-0.045063	15	0.015085	yes	WHLBLD
chr1_1769969_CAAAACA_C_b38	SLC35E2	2.973	0.00307	0.032494	113	0.010931	yes	WHLBLD
chr1_1956754_C_A_b38	SLC35E2	2.97	0.0031	0.036251	43	0.012206	yes	WHLBLD
chr1_1595306_CAG_C_b38	SLC35E2	-2.943	0.00338	-0.034133	149	0.011598	yes	WHLBLD
chr1_1982253_C_T_b38	SLC35E2	2.932	0.0035	0.067351	6	0.022971	yes	WHLBLD
chr1_1849992_T_TG_b38	SLC35E2	2.929	0.00352	0.041055	20	0.014015	yes	WHLBLD
chr1_1743570_T_A_b38	SLC35E2	2.912	0.00373	0.05672	9	0.019479	yes	WHLBLD
chr1_1616547_T_C_b38	SLC35E2	2.9	0.00387	0.034082	68	0.011753	yes	WHLBLD
chr1_1657081_C_T_b38	SLC35E2	-2.89	0.00399	-0.038424	50	0.013295	yes	WHLBLD
chr1_1955672_GC_G_b38	SLC35E2	2.858	0.00442	0.035196	41	0.012316	yes	WHLBLD
chr1_1688619_AAAC_A_b38	SLC35E2	-2.852	0.0045	-0.038745	45	0.013586	yes	WHLBLD
chr1_1615322_A_G_b38	SLC35E2	2.839	0.00468	0.033507	68	0.011802	yes	WHLBLD
chr1_1688786_G_A_b38	SLC35E2	-2.836	0.00472	-0.04151	26	0.014635	yes	WHLBLD
chr1_1952590_A_AAAAG_b38	SLC35E2	2.822	0.00493	0.032779	61	0.011614	yes	WHLBLD
chr1_1955420_C_T_b38	SLC35E2	2.819	0.00498	0.034597	42	0.012275	yes	WHLBLD
chr1_1742432_T_TA_b38	SLC35E2	2.808	0.00515	0.032655	103	0.011631	yes	WHLBLD
chr1_1615869_C_T_b38	SLC35E2	2.796	0.00534	0.032538	72	0.011636	yes	WHLBLD
chr1_1604202_G_A_b38	SLC35E2	2.796	0.00534	0.032419	83	0.011595	yes	WHLBLD
chr1_2687974_A_T_b38	SLC35E2	-2.794	0.00537	-0.041967	8	0.015019	yes	WHLBLD
chr1_1601796_A_C_b38	SLC35E2	2.785	0.00552	0.032268	84	0.011587	yes	WHLBLD
chr1_1688102_G_A_b38	SLC35E2	-2.784	0.00554	-0.035481	42	0.012744	yes	WHLBLD
chr1_1613322_T_C_b38	SLC35E2	2.771	0.00576	0.032626	70	0.011774	yes	WHLBLD
chr1_1056601_A_ACG_b38	SLC35E2	2.766	0.00584	0.029613	114	0.010705	yes	WHLBLD
chr1_2067567_G_A_b38	SLC35E2	-2.757	0.00601	-0.042842	11	0.015538	yes	WHLBLD
chr1_1613421_T_C_b38	SLC35E2	2.757	0.00601	0.032656	68	0.011845	yes	WHLBLD
chr1_1866635_T_TAAA_b38	SLC35E2	-2.743	0.00627	-0.033334	86	0.012154	yes	WHLBLD
chr1_1897985_C_G_b38	SLC35E2	2.728	0.00657	0.038946	17	0.014278	yes	WHLBLD
chr1_2562891_G_A_b38	SLC35E2	-2.72	0.00672	-0.042477	13	0.015616	yes	WHLBLD
chr1_1877330_T_C_b38	SLC35E2	-2.703	0.00706	-0.030922	124	0.011438	yes	WHLBLD
chr1_1904424_A_AAAATAAAT_b38	SLC35E2	-2.699	0.00716	-0.027752	153	0.010283	yes	WHLBLD
chr1_1625951_G_A_b38	SLC35E2	-2.698	0.00716	-0.030061	96	0.01114	yes	WHLBLD
chr1_1750589_G_A_b38	SLC35E2	-2.68	0.00756	-0.046737	19	0.017439	yes	WHLBLD
chr1_2384241_A_G_b38	SLC35E2	2.65	0.00825	0.027917	173	0.010533	yes	WHLBLD
chr1_1691417_T_C_b38	SLC35E2	2.648	0.00832	0.030446	122	0.011499	yes	WHLBLD
chr1_866577_CCTGCACTCACATCCCTGACGTCCTCCCGTGCCCTCACGTGGTCCTCCCT_C_b38	SLC35E2	2.645	0.00837	0.027323	100	0.010329	yes	WHLBLD
chr1_2581666_C_T_b38	SLC35E2	-2.634	0.00865	-0.042037	12	0.015958	yes	WHLBLD
chr1_966179_G_A_b38	SLC35E2	2.623	0.00895	0.045585	40	0.017381	yes	WHLBLD
chr1_1663759_G_A_b38	SLC35E2	-2.617	0.0091	-0.058973	10	0.022538	yes	WHLBLD
chr1_1631710_T_C_b38	SLC35E2	2.616	0.00912	0.041068	13	0.015698	yes	WHLBLD
chr1_1880594_A_T_b38	SLC35E2	2.611	0.00925	0.037538	21	0.014376	yes	WHLBLD
chr1_1803531_C_T_b38	SLC35E2	2.61	0.00928	0.032187	43	0.012333	yes	WHLBLD
chr1_1830566_A_T_b38	SLC35E2	2.61	0.00928	0.032187	43	0.012333	yes	WHLBLD
chr1_2572924_T_C_b38	SLC35E2	-2.592	0.00977	-0.041625	12	0.016057	yes	WHLBLD
chr1_2574274_C_T_b38	SLC35E2	-2.592	0.00977	-0.041625	12	0.016057	yes	WHLBLD
chr1_1877312_A_T_b38	SLC35E2	2.591	0.00979	0.043725	14	0.016873	yes	WHLBLD
chr1_1827615_G_A_b38	SLC35E2	2.587	0.00993	0.032472	37	0.012554	yes	WHLBLD
chr1_1677707_C_T_b38	SLC35E2	-2.585	0.00998	-0.038527	21	0.014905	yes	WHLBLD
chr1_1649932_C_T_b38	SLC35E2	7.274	1.1e-12	0.077947	128	0.010716	no	WHLBLD
chr1_1651653_C_T_b38	SLC35E2	7.056	4.76e-12	0.075331	139	0.010676	no	WHLBLD
chr1_1661562_G_C_b38	SLC35E2	6.142	1.48e-09	0.060673	139	0.009878	no	WHLBLD
chr1_1654662_CT_C_b38	SLC35E2	5.918	5.5e-09	0.070464	95	0.011907	no	WHLBLD
chr1_1658115_G_A_b38	SLC35E2	-5.751	1.42e-08	-0.128777	4	0.022393	no	WHLBLD
chr1_1660408_T_C_b38	SLC35E2	-5.323	1.45e-07	-0.072565	21	0.013633	no	WHLBLD
chr1_1653934_G_A_b38	SLC35E2	-5.171	3.17e-07	-0.059907	70	0.011584	no	WHLBLD
chr1_1651137_C_T_b38	SLC35E2	-5.158	3.4e-07	-0.059785	70	0.011591	no	WHLBLD
chr1_1651267_T_C_b38	SLC35E2	-5.158	3.4e-07	-0.059785	70	0.011591	no	WHLBLD
chr1_1652135_C_G_b38	SLC35E2	-5.158	3.4e-07	-0.059785	70	0.011591	no	WHLBLD
chr1_1652191_C_T_b38	SLC35E2	-5.158	3.4e-07	-0.059785	70	0.011591	no	WHLBLD
chr1_1652592_A_G_b38	SLC35E2	-5.158	3.4e-07	-0.059785	70	0.011591	no	WHLBLD
chr1_1652779_A_G_b38	SLC35E2	-5.158	3.4e-07	-0.059785	70	0.011591	no	WHLBLD
chr1_1653147_A_C_b38	SLC35E2	-5.158	3.4e-07	-0.059785	70	0.011591	no	WHLBLD
chr1_1653396_T_C_b38	SLC35E2	-5.158	3.4e-07	-0.059785	70	0.011591	no	WHLBLD
chr1_1653472_T_C_b38	SLC35E2	-5.158	3.4e-07	-0.059785	70	0.011591	no	WHLBLD
chr1_1653811_G_A_b38	SLC35E2	-5.158	3.4e-07	-0.059785	70	0.011591	no	WHLBLD
chr1_1653893_C_T_b38	SLC35E2	-5.158	3.4e-07	-0.059785	70	0.011591	no	WHLBLD
chr1_1654143_G_A_b38	SLC35E2	-5.158	3.4e-07	-0.059785	70	0.011591	no	WHLBLD
chr1_1651421_GTAGCCCCTCTGAACGGTCTGTGACACACGCATGCTTTCAGCTAGAGTACTCTA_G_b38	SLC35E2	-5.153	3.48e-07	-0.060042	67	0.011651	no	WHLBLD
chr1_1651574_G_A_b38	SLC35E2	-5.121	4.1e-07	-0.059397	70	0.011598	no	WHLBLD
chr1_1650777_G_A_b38	SLC35E2	-5.103	4.5e-07	-0.059062	70	0.011575	no	WHLBLD
chr1_1651926_T_C_b38	SLC35E2	-4.99	7.91e-07	-0.058109	70	0.011644	no	WHLBLD
chr1_1651785_C_A_b38	SLC35E2	-4.976	8.51e-07	-0.05773	70	0.011603	no	WHLBLD
chr1_1659060_G_A_b38	SLC35E2	-4.97	8.76e-07	-0.059125	56	0.011897	no	WHLBLD
chr1_1665581_C_G_b38	SLC35E2	-4.939	1.02e-06	-0.061035	42	0.012358	no	WHLBLD
chr1_1669613_G_A_b38	SLC35E2	-4.809	1.92e-06	-0.062171	34	0.012929	no	WHLBLD
chr1_1661177_A_G_b38	SLC35E2	-4.808	1.93e-06	-0.061613	36	0.012815	no	WHLBLD
chr1_1665061_C_T_b38	SLC35E2	-4.756	2.48e-06	-0.060839	36	0.012792	no	WHLBLD
chr1_1659940_A_C_b38	SLC35E2	-4.59	5.39e-06	-0.065913	18	0.014359	no	WHLBLD
chr1_1743565_ATAT_A_b38	SLC35E2	-4.566	6.04e-06	-0.048033	110	0.01052	no	WHLBLD
chr1_1675132_A_G_b38	SLC35E2	4.472	9.26e-06	0.050815	86	0.011362	no	WHLBLD
chr1_1652913_C_T_b38	SLC35E2	-4.45	1.02e-05	-0.054135	52	0.012165	no	WHLBLD
chr1_1750508_A_C_b38	SLC35E2	-4.247	2.51e-05	-0.042055	147	0.009903	no	WHLBLD
chr1_1828894_T_TAC_b38	SLC35E2	4.157	3.7e-05	0.045703	117	0.010995	no	WHLBLD
chr1_1936906_CA_C_b38	SLC35E2	4.015	6.71e-05	0.053185	22	0.013247	no	WHLBLD
chr1_1649846_G_A_b38	SLC35E2	-3.965	8.23e-05	-0.049849	36	0.012573	no	WHLBLD
chr1_1968900_A_G_b38	SLC35E2	3.937	9.24e-05	0.048122	41	0.012224	no	WHLBLD
chr1_1650664_CTTTTT_C_b38	SLC35E2	-3.907	0.000104	-0.049666	40	0.012711	no	WHLBLD
chr1_1650688_T_A_b38	SLC35E2	-3.865	0.000123	-0.046885	53	0.01213	no	WHLBLD
chr1_1746522_GT_G_b38	SLC35E2	-3.766	0.000182	-0.050362	38	0.013371	no	WHLBLD
chr1_1698048_T_C_b38	SLC35E2	-3.751	0.000193	-0.093159	9	0.024837	no	WHLBLD
chr1_1751442_C_T_b38	SLC35E2	3.716	0.000222	0.059548	3	0.016027	no	WHLBLD
chr1_1698022_G_A_b38	SLC35E2	-3.709	0.000227	-0.100602	25	0.027123	no	WHLBLD
chr1_1934896_C_T_b38	SLC35E2	3.667	0.000268	0.047952	25	0.013078	no	WHLBLD
chr1_1746440_A_G_b38	SLC35E2	-3.659	0.000275	-0.049362	37	0.01349	no	WHLBLD
chr1_1968103_A_ATGAG_b38	SLC35E2	3.629	0.000308	0.044706	39	0.012318	no	WHLBLD
chr1_1976855_C_CTT_b38	SLC35E2	3.597	0.000348	0.046232	34	0.012853	no	WHLBLD
chr1_1904424_A_AAAATAAATAAAT_b38	SLC35E2	3.57	0.000385	0.036097	112	0.01011	no	WHLBLD
chr1_1969006_C_T_b38	SLC35E2	3.557	0.000404	0.04311	42	0.012119	no	WHLBLD
chr1_1938221_TCA_T_b38	SLC35E2	3.515	0.000473	0.044034	36	0.012527	no	WHLBLD
chr1_1968585_TG_T_b38	SLC35E2	3.49	0.000519	0.04278	40	0.012258	no	WHLBLD
chr1_1929306_C_T_b38	SLC35E2	3.478	0.000541	0.043128	38	0.0124	no	WHLBLD
chr1_1951642_C_T_b38	SLC35E2	3.468	0.000562	0.041863	46	0.012072	no	WHLBLD
chr1_2579270_A_AT_b38	SLC35E2	-3.451	0.000598	-0.05664	12	0.016413	no	WHLBLD
chr1_1963406_G_A_b38	SLC35E2	3.444	0.000612	0.042599	38	0.012367	no	WHLBLD
chr1_1050080_T_C_b38	SLC35E2	-3.439	0.000624	-0.068201	21	0.019832	no	WHLBLD
chr1_1726904_T_C_b38	SLC35E2	3.429	0.000647	0.036634	152	0.010683	no	WHLBLD
chr1_1966606_G_A_b38	SLC35E2	3.425	0.000657	0.042636	37	0.012449	no	WHLBLD
chr1_1649954_C_CA_b38	SLC35E2	-3.418	0.000674	-0.04687	28	0.013713	no	WHLBLD
chr1_1965250_G_GA_b38	SLC35E2	3.417	0.000677	0.041593	43	0.012174	no	WHLBLD
chr1_1969235_A_G_b38	SLC35E2	3.403	0.000711	0.043888	33	0.012897	no	WHLBLD
chr1_1968667_T_TCTC_b38	SLC35E2	3.401	0.000717	0.041877	39	0.012314	no	WHLBLD
chr1_1992226_A_G_b38	SLC35E2	3.392	0.00074	0.038043	121	0.011217	no	WHLBLD
chr1_1963738_C_T_b38	SLC35E2	3.386	0.000755	0.041893	38	0.012372	no	WHLBLD
chr1_1965114_C_T_b38	SLC35E2	3.386	0.000755	0.041893	38	0.012372	no	WHLBLD
chr1_1966910_C_T_b38	SLC35E2	3.386	0.000755	0.041893	38	0.012372	no	WHLBLD
chr1_1653863_C_A_b38	SLC35E2	-3.384	0.000762	-0.048247	18	0.014259	no	WHLBLD
chr1_1968924_GCCCTCCTGGGGGCTCCGGTCCTGCCCAGCAGCCCCAGGTGAGACAGCGCCTGGCGGCCCCTCCCTAGCT_G_b38	SLC35E2	3.381	0.00077	0.04082	43	0.012075	no	WHLBLD
chr1_1965001_G_A_b38	SLC35E2	3.378	0.000778	0.041054	43	0.012155	no	WHLBLD
chr1_1937046_G_A_b38	SLC35E2	3.375	0.000785	0.046913	22	0.013899	no	WHLBLD
chr1_1964101_A_G_b38	SLC35E2	3.369	0.000804	0.041535	39	0.01233	no	WHLBLD
chr1_1964746_T_C_b38	SLC35E2	3.369	0.000804	0.041535	39	0.01233	no	WHLBLD
chr1_1964784_C_T_b38	SLC35E2	3.369	0.000804	0.041535	39	0.01233	no	WHLBLD
chr1_1966030_A_G_b38	SLC35E2	3.369	0.000804	0.041535	39	0.01233	no	WHLBLD
chr1_1966314_C_G_b38	SLC35E2	3.369	0.000804	0.041535	39	0.01233	no	WHLBLD
chr1_1966930_G_A_b38	SLC35E2	3.369	0.000804	0.041535	39	0.01233	no	WHLBLD
chr1_1967246_T_C_b38	SLC35E2	3.369	0.000804	0.041535	39	0.01233	no	WHLBLD
chr1_1967338_G_C_b38	SLC35E2	3.369	0.000804	0.041535	39	0.01233	no	WHLBLD
chr1_1967340_C_A_b38	SLC35E2	3.369	0.000804	0.041535	39	0.01233	no	WHLBLD
chr1_1967389_T_C_b38	SLC35E2	3.369	0.000804	0.041535	39	0.01233	no	WHLBLD
chr1_1967396_C_A_b38	SLC35E2	3.369	0.000804	0.041535	39	0.01233	no	WHLBLD
chr1_1967420_G_A_b38	SLC35E2	3.369	0.000804	0.041535	39	0.01233	no	WHLBLD
chr1_1967495_T_C_b38	SLC35E2	3.369	0.000804	0.041535	39	0.01233	no	WHLBLD
chr1_1967536_G_A_b38	SLC35E2	3.369	0.000804	0.041535	39	0.01233	no	WHLBLD
chr1_1967725_G_C_b38	SLC35E2	3.369	0.000804	0.041535	39	0.01233	no	WHLBLD
chr1_1967840_A_T_b38	SLC35E2	3.369	0.000804	0.041535	39	0.01233	no	WHLBLD
chr1_1967880_T_C_b38	SLC35E2	3.369	0.000804	0.041535	39	0.01233	no	WHLBLD
chr1_1968422_C_T_b38	SLC35E2	3.369	0.000804	0.041535	39	0.01233	no	WHLBLD
chr1_1721552_G_A_b38	SLC35E2	-3.341	0.000886	-0.117273	4	0.035099	no	WHLBLD
chr1_1969249_A_AGCCCT_b38	SLC35E2	3.34	0.00089	0.043483	32	0.013019	no	WHLBLD
chr1_1734174_A_G_b38	SLC35E2	3.326	0.000934	0.035222	174	0.010589	no	WHLBLD
chr1_1734903_A_G_b38	SLC35E2	3.326	0.000934	0.035183	174	0.010577	no	WHLBLD
chr1_1731963_A_C_b38	SLC35E2	3.324	0.000942	0.035199	174	0.01059	no	WHLBLD
chr1_1732392_C_T_b38	SLC35E2	3.324	0.000942	0.035199	174	0.01059	no	WHLBLD
chr1_1735176_C_T_b38	SLC35E2	3.324	0.000942	0.035199	174	0.01059	no	WHLBLD
chr1_1735980_A_C_b38	SLC35E2	3.324	0.000942	0.035199	174	0.01059	no	WHLBLD
chr1_1740343_C_T_b38	SLC35E2	3.324	0.000942	0.035199	174	0.01059	no	WHLBLD
chr1_1740703_C_T_b38	SLC35E2	3.324	0.000942	0.035199	174	0.01059	no	WHLBLD
chr1_1848356_GC_G_b38	SLC35E2	3.317	0.000966	0.046974	21	0.014163	no	WHLBLD
chr1_1928119_T_C_b38	SLC35E2	3.301	0.00102	0.04168	36	0.012627	no	WHLBLD
chr1_1968130_GTGAA_G_b38	SLC35E2	3.291	0.00106	0.040783	38	0.012393	no	WHLBLD
chr1_1964663_G_A_b38	SLC35E2	3.29	0.00106	0.040745	38	0.012384	no	WHLBLD
chr1_1591419_A_G_b38	SLC35E2	3.279	0.0011	0.047643	18	0.014528	no	WHLBLD
chr1_1969229_T_A_b38	SLC35E2	3.275	0.00112	0.042187	33	0.012882	no	WHLBLD
chr1_1792696_C_CA_b38	SLC35E2	3.261	0.00117	0.037751	72	0.011576	no	WHLBLD
chr1_1966152_C_T_b38	SLC35E2	3.256	0.00119	0.040363	38	0.012396	no	WHLBLD
chr1_1967980_A_AAGAATGAG_b38	SLC35E2	3.253	0.00121	0.040488	37	0.012446	no	WHLBLD
chr1_1918697_C_T_b38	SLC35E2	3.249	0.00122	0.038579	57	0.011876	no	WHLBLD
chr1_1991778_A_G_b38	SLC35E2	-3.219	0.00136	-0.040161	39	0.012476	no	WHLBLD
chr1_1848358_A_T_b38	SLC35E2	3.172	0.00159	0.045022	21	0.014195	no	WHLBLD
chr1_1969238_C_T_b38	SLC35E2	3.169	0.00161	0.040743	33	0.012856	no	WHLBLD
chr1_1736836_A_G_b38	SLC35E2	3.143	0.00175	0.033844	160	0.010767	no	WHLBLD
chr1_2056364_G_A_b38	SLC35E2	-3.093	0.00207	-0.041044	77	0.013271	no	WHLBLD
chr1_2546252_AG_A_b38	SLC35E2	3.078	0.00218	0.086836	4	0.028208	no	WHLBLD
chr1_1968893_A_G_b38	SLC35E2	3.053	0.00237	0.038472	33	0.012601	no	WHLBLD
chr1_1798974_C_T_b38	SLC35E2	3.049	0.00239	0.045307	15	0.014858	no	WHLBLD
chr1_1810086_A_G_b38	SLC35E2	3.049	0.0024	0.04046	31	0.013272	no	WHLBLD
chr1_1948594_G_GTTT_b38	SLC35E2	-3.015	0.00268	-0.071388	11	0.023677	no	WHLBLD
chr1_1846651_T_G_b38	SLC35E2	3.013	0.0027	0.044492	16	0.014767	no	WHLBLD
chr1_1062896_T_C_b38	SLC35E2	-3.009	0.00273	-0.098833	5	0.032851	no	WHLBLD
chr1_1845824_TACACAC_T_b38	SLC35E2	2.99	0.0029	0.041436	24	0.013856	no	WHLBLD
chr1_1668373_C_T_b38	SLC35E2	2.974	0.00305	0.03889	74	0.013075	no	WHLBLD
chr1_1794187_C_T_b38	SLC35E2	2.97	0.0031	0.044262	15	0.014903	no	WHLBLD
chr1_1837340_C_T_b38	SLC35E2	2.967	0.00312	0.04387	16	0.014784	no	WHLBLD
chr1_1907077_C_A_b38	SLC35E2	2.966	0.00314	0.038172	39	0.012869	no	WHLBLD
chr1_1855245_G_A_b38	SLC35E2	2.961	0.00319	0.044833	14	0.015143	no	WHLBLD
chr1_1955806_G_A_b38	SLC35E2	2.954	0.00326	0.036374	39	0.012314	no	WHLBLD
chr1_1791389_G_A_b38	SLC35E2	2.945	0.00336	0.03837	34	0.01303	no	WHLBLD
chr1_1857305_G_GGGCT_b38	SLC35E2	2.944	0.00337	0.044463	14	0.015103	no	WHLBLD
chr1_1849781_T_C_b38	SLC35E2	-2.942	0.00338	-0.037017	43	0.01258	no	WHLBLD
chr1_1775296_C_T_b38	SLC35E2	2.932	0.00349	0.04482	14	0.015285	no	WHLBLD
chr1_1815255_G_T_b38	SLC35E2	2.932	0.00349	0.04482	14	0.015285	no	WHLBLD
chr1_1871210_G_T_b38	SLC35E2	2.924	0.00358	0.044489	14	0.015214	no	WHLBLD
chr1_1980742_C_T_b38	SLC35E2	2.919	0.00364	0.062013	3	0.021244	no	WHLBLD
chr1_1502507_A_T_b38	SLC35E2	2.915	0.00369	0.080869	5	0.027742	no	WHLBLD
chr1_1822247_A_G_b38	SLC35E2	2.914	0.0037	0.042956	16	0.01474	no	WHLBLD
chr1_1932396_CA_C_b38	SLC35E2	2.9	0.00387	0.041391	17	0.014274	no	WHLBLD
chr1_1881065_G_A_b38	SLC35E2	2.899	0.00389	0.042652	15	0.014715	no	WHLBLD
chr1_1881798_C_T_b38	SLC35E2	2.899	0.00389	0.042652	15	0.014715	no	WHLBLD
chr1_1855939_G_A_b38	SLC35E2	2.897	0.0039	0.043734	14	0.015096	no	WHLBLD
chr1_1588059_G_A_b38	SLC35E2	2.896	0.00391	0.063501	4	0.021924	no	WHLBLD
chr1_1865177_G_A_b38	SLC35E2	-2.892	0.00396	-0.036735	41	0.012701	no	WHLBLD
chr1_1769737_GA_G_b38	SLC35E2	2.891	0.00398	0.037315	30	0.012907	no	WHLBLD
chr1_1604574_G_C_b38	SLC35E2	2.89	0.00399	0.069244	3	0.02396	no	WHLBLD
chr1_1857246_T_TAA_b38	SLC35E2	2.89	0.004	0.043551	14	0.015071	no	WHLBLD
chr1_1857250_C_G_b38	SLC35E2	2.89	0.004	0.043551	14	0.015071	no	WHLBLD
chr1_1589151_C_T_b38	SLC35E2	-2.876	0.00417	-0.033122	78	0.011517	no	WHLBLD
chr1_1782906_T_G_b38	SLC35E2	2.874	0.00419	0.042233	16	0.014692	no	WHLBLD
chr1_1992967_A_G_b38	SLC35E2	2.857	0.00442	0.032221	136	0.011276	no	WHLBLD
chr1_1738597_C_A_b38	SLC35E2	2.857	0.00442	0.035841	77	0.012544	no	WHLBLD
chr1_1886690_A_C_b38	SLC35E2	2.856	0.00444	0.042355	14	0.014832	no	WHLBLD
chr1_1882915_C_T_b38	SLC35E2	2.851	0.00451	0.042511	14	0.014912	no	WHLBLD
chr1_1992764_A_G_b38	SLC35E2	-2.823	0.00492	-0.086465	9	0.030632	no	WHLBLD
chr1_1955652_CG_C_b38	SLC35E2	2.81	0.00512	0.034596	41	0.012313	no	WHLBLD
chr1_1840233_GA_G_b38	SLC35E2	2.8	0.00528	0.037381	23	0.013353	no	WHLBLD
chr1_1948037_T_A_b38	SLC35E2	2.799	0.0053	0.038972	21	0.013925	no	WHLBLD
chr1_1612186_A_G_b38	SLC35E2	2.77	0.00577	0.065741	3	0.02373	no	WHLBLD
chr1_1840043_T_TA_b38	SLC35E2	2.769	0.0058	0.041988	10	0.015164	no	WHLBLD
chr1_928141_C_G_b38	SLC35E2	2.768	0.00581	0.054061	4	0.01953	no	WHLBLD
chr1_1801188_T_C_b38	SLC35E2	2.768	0.00582	0.039484	18	0.014265	no	WHLBLD
chr1_1589618_A_T_b38	SLC35E2	-2.767	0.00583	-0.033177	64	0.011989	no	WHLBLD
chr1_1934821_C_G_b38	SLC35E2	-2.764	0.00589	-0.02914	73	0.010543	no	WHLBLD
chr1_1775996_G_A_b38	SLC35E2	2.763	0.0059	0.040962	16	0.014824	no	WHLBLD
chr1_1980150_G_A_b38	SLC35E2	2.745	0.00623	0.034619	44	0.012612	no	WHLBLD
chr1_1898043_T_C_b38	SLC35E2	2.733	0.00645	0.041156	13	0.015057	no	WHLBLD
chr1_1589057_T_C_b38	SLC35E2	-2.726	0.0066	-0.0317	78	0.011629	no	WHLBLD
chr1_1957014_G_A_b38	SLC35E2	2.725	0.00661	0.032249	51	0.011834	no	WHLBLD
chr1_1957636_C_T_b38	SLC35E2	2.725	0.00661	0.032249	51	0.011834	no	WHLBLD
chr1_1888382_A_AG_b38	SLC35E2	2.707	0.00697	0.045296	8	0.01673	no	WHLBLD
chr1_1855321_C_CA_b38	SLC35E2	2.707	0.00699	0.037769	25	0.013955	no	WHLBLD
chr1_1081152_A_AG_b38	SLC35E2	-2.701	0.00711	-0.096226	4	0.035628	no	WHLBLD
chr1_1772160_A_AT_b38	SLC35E2	2.697	0.00719	0.040043	13	0.014846	no	WHLBLD
chr1_1727506_T_C_b38	SLC35E2	2.69	0.00735	0.036313	57	0.013501	no	WHLBLD
chr1_806470_C_T_b38	SLC35E2	-2.684	0.00748	-0.088227	6	0.032871	no	WHLBLD
chr1_1980146_G_A_b38	SLC35E2	2.678	0.00761	0.033436	45	0.012485	no	WHLBLD
chr1_1980119_C_T_b38	SLC35E2	2.652	0.0082	0.031774	49	0.011979	no	WHLBLD
chr1_1717604_CGCTTTCAGCTAGAGTTTGCTCTCTCTGGTTTTCGGTCTGTGACACACGCAT_C_b38	SLC35E2	2.648	0.00832	0.028564	112	0.010788	no	WHLBLD
chr1_1956891_C_T_b38	SLC35E2	2.635	0.00864	0.03119	51	0.011839	no	WHLBLD
chr1_1802763_T_TAA_b38	SLC35E2	2.63	0.00875	0.034583	26	0.013148	no	WHLBLD
chr1_1839349_C_G_b38	SLC35E2	2.622	0.00897	0.03251	42	0.012399	no	WHLBLD
chr1_1839350_T_A_b38	SLC35E2	2.622	0.00897	0.03251	42	0.012399	no	WHLBLD
chr1_1650370_C_CT_b38	SLC35E2	-2.619	0.00904	-0.036817	31	0.014058	no	WHLBLD
chr1_1452384_G_A_b38	SLC35E2	2.618	0.00907	0.038502	18	0.014706	no	WHLBLD
chr1_1885444_TTAGA_T_b38	SLC35E2	2.615	0.00914	0.032291	41	0.012346	no	WHLBLD
chr1_996133_A_C_b38	SLC35E2	-2.612	0.00923	-0.073338	3	0.02808	no	WHLBLD
chr1_1053123_A_T_b38	SLC35E2	2.605	0.00942	0.042374	31	0.016268	no	WHLBLD
chr1_1053552_G_C_b38	SLC35E2	2.601	0.00953	0.036551	41	0.014053	no	WHLBLD
chr1_1592572_T_C_b38	SLC35E2	-2.597	0.00964	-0.031029	66	0.011949	no	WHLBLD
chr1_1661169_C_A_b38	SLC35E2	2.586	0.00994	0.03127	46	0.012091	no	WHLBLD

---

Filters:      p-Values >= and <=      Betas >= and <=      Statistic >= and <=      Carriers >= and <=
Positions: left right     Zoom: SLC35E2     Other:     -      +     reset     eQTLs Region
Draw    p-Value Beta Statistic Carriers Beta/sd(t)     Scaling     Sign (red=+, blue-)     Colors: Tissue Sign